The TNF Superfamily: Methods and Protocols [2nd ed.] 9781071611296, 9781071611302

Table of contents :
Front Matter ....Pages i-xiv
Signaling in TNFSF15-mediated Suppression of VEGF Production in Endothelial Cells (Huanyu Zhao, Qiangzhe Zhang)....Pages 1-18
Sensitization of Airway Epithelial Cells to Toxin-Induced Death by TNF Superfamily Cytokines (Claire Reynolds-Peterson, Dylan J. Ehrbar, Susanne M. McHale, Timothy J. LaRocca, Nicholas J. Mantis)....Pages 19-42
Inhibition of Chondroitin Sulfate Proteoglycans by APRIL (Mashal Claude Ahmed, Bertrand Huard)....Pages 43-61
Induction of Antigen-Independent Proliferation of Regulatory T-Cells by TNF Superfamily Ligands OX40L and GITRL (Prabhakaran Kumar, Zarema H. Arbieva, Mark Maienschein-Cline, Balaji B. Ganesh, Suresh Ramasamy, Bellur S. Prabhakar)....Pages 63-71
Transition from TNF-Induced Inflammation to Death Signaling (Swati Choksi, Gourav Choudhary, Zheng-Gang Liu)....Pages 73-80
Analysis of FcγR-Dependent Agonism of Antibodies Specific for Receptors of the Tumor Necrosis Factor (TNF) Receptor Superfamily (TNFRSF) (Juliane Medler, Harald Wajant)....Pages 81-90
Generation and Evaluation of Bispecific Anti-TNF Antibodies Based on Single-Chain VHH Domains (M. A. Nosenko, K. -S. N. Atretkhany, V. V. Mokhonov, S. A. Chuvpilo, D. V. Yanvarev, M. S. Drutskaya et al.)....Pages 91-107
In Vitro Physical and Functional Interaction Assays to Examine the Binding of Progranulin Derivative Atsttrin to TNFR2 and Its Anti-TNFα Activity (Wenyu Fu, Aubryanna Hettinghouse, Chuan-Ju Liu)....Pages 109-119
Fluorescence-Based TNFR1 Biosensor for Monitoring Receptor Structural and Conformational Dynamics and Discovery of Small Molecule Modulators (Chih Hung Lo, Tory M. Schaaf, David D. Thomas, Jonathan N. Sachs)....Pages 121-137
Production of Multi-Subtype Influenza Virus-Like Particles by Molecular Fusion with BAFF or APRIL for Vaccine Development (Ting-Hsuan Chen, Jo-Yu Hong, Chia-Chyi Liu, Chung-Chu Chen, Jia-Tsrong Jan, Suh-Chin Wu)....Pages 139-153
Experimental Methods for the Immunological Characterization of Paradoxical Psoriasis Reactions Induced by TNF-α Biologics (Martina Morelli, Claudia Scarponi, Stefania Madonna, Cristina Albanesi)....Pages 155-165
Methods for the Administration of EDAR Pathway Modulators in Mice (Sonia Schuepbach-Mallepell, Christine Kowalczyk-Quintas, Angela Dick, Mahya Eslami, Michele Vigolo, Denis J. Headon et al.)....Pages 167-183
Analysis of Ligand-Receptor Interactions Using Bioluminescent TNF Superfamily (TNFSF) Ligand Fusion Proteins (Kirstin Kucka, Juliane Medler, Harald Wajant)....Pages 185-200
Monitoring Atsttrin-Mediated Inhibition of TNFα/NF-κβ Activation Through In Vivo Bioluminescence Imaging (Aubryanna Hettinghouse, Wenyu Fu, Chuan-Ju Liu)....Pages 201-210
The Use of Murine Infection Models to Investigate the Protective Role of TNF in Central Nervous System Tuberculosis (Nai-Jen Hsu, Muazzam Jacobs)....Pages 211-220
Identification of CD137- and CD137L-Expressing Cells in EL-4 Tumor (Sang W. Kang, Hong R. Cho, Byungsuk Kwon)....Pages 221-229
Expression Profiling of Tumor Necrosis Factor Superfamily Ligands mRNA in Healthy and Injured Murine Kidneys (Bhawna Tomar, Shrikant R. Mulay)....Pages 231-241
Analysis of Lymphotoxin Alpha Expression in Human Retina and Generation of Expression Vectors to Functional Characterization of Polymorphisms in the Tumor Necrosis Factor Locus (Ricardo Usategui-Martín, Irene Rodriguez-Hernández, Rogelio González-Sarmiento, Eva M. Sobas, Jose Carlos Pastor-Jimeno, Salvador Pastor-Idoate)....Pages 243-250
Detection of TNF-α Protein in Extracellular Vesicles Derived from Tumor Cells by Western Blotting (Tandressa Souza Berguetti, Raquel Ciuvalschi Maia, Paloma Silva de Souza)....Pages 251-258
Expression of TNFRs by B and T Lymphocytes in Tumor-Draining Lymph Nodes (Atri Ghods, Abbas Ghaderi, Fereshteh Mehdipour)....Pages 259-269
Methods for Evaluation of TNF-α Inhibition Effect (Kirti Hira, A. Sajeli Begum)....Pages 271-279
Back Matter ....Pages 281-284

Citation preview

Methods in Molecular Biology 2248

Jagadeesh Bayry Editor

The TNF Superfamily Methods and Protocols Second Edition

METHODS

IN

MOLECULAR BIOLOGY

Series Editor John M. Walker School of Life and Medical Sciences University of Hertfordshire Hatfield, Hertfordshire, UK

For further volumes: http://www.springer.com/series/7651

For over 35 years, biological scientists have come to rely on the research protocols and methodologies in the critically acclaimed Methods in Molecular Biology series. The series was the first to introduce the step-by-step protocols approach that has become the standard in all biomedical protocol publishing. Each protocol is provided in readily-reproducible step-bystep fashion, opening with an introductory overview, a list of the materials and reagents needed to complete the experiment, and followed by a detailed procedure that is supported with a helpful notes section offering tips and tricks of the trade as well as troubleshooting advice. These hallmark features were introduced by series editor Dr. John Walker and constitute the key ingredient in each and every volume of the Methods in Molecular Biology series. Tested and trusted, comprehensive and reliable, all protocols from the series are indexed in PubMed.

The TNF Superfamily Methods and Protocols Second Edition

Edited by

Jagadeesh Bayry INSERM, Sorbonne Université, Paris, France

Editor Jagadeesh Bayry INSERM Sorbonne Universite´ Paris, France

ISSN 1064-3745 ISSN 1940-6029 (electronic) Methods in Molecular Biology ISBN 978-1-0716-1129-6 ISBN 978-1-0716-1130-2 (eBook) https://doi.org/10.1007/978-1-0716-1130-2 © Springer Science+Business Media, LLC, part of Springer Nature 2021 This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer Nature. The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.

Preface The tumor necrosis factor (TNF) superfamily (TNFSF), expressed predominantly by various immune cells, is currently composed of 19 members (including TNFα, TNFβ, OX40 ligand, TNF-like ligand 1A, glucocorticoid-induced TNF receptor family-related gene ligand, Fas ligand, receptor activator of nuclear factor kappa-B ligand, CD40 ligand, and B-cell activating factor) that mediate diverse biological processes by binding to receptors [1, 2]. TNFSF members are implicated in the inflammatory responses, anti-viral responses, induction of apoptosis, development of secondary lymphoid organs, differentiation and activation of immune cells, osteoclastogenesis, and also in the regulation of tumorigenesis and angiogenesis [3–9]. It is not surprising to see that TNF superfamily ligands and receptors have a significant diverse role in human diseases including autoimmune diseases, cancer, graftversus-host disease, and inflammation. Therefore, TNF superfamily members are targets for the immunotherapeutic purposes [10–17]. It is certainly refreshing to see the great success of the first edition of TNF superfamily (https://link.springer.com/book/10.1007/978-1-4939-0669-7) published back in 2014. The positive response from the scientific community is highly noticeable. As of now, the chapters of TNF superfamily series were downloaded for more than 27,000 times and have accumulated 49 citations. Probably, this success, which is only because of you, prompted the publisher to consider second edition on TNFSF. It is important to maintain continuation in any field. Therefore, I have ensured that some of the authors from the previous edition have also contributed to this new edition. The initial five chapters describe the methodologies for investigating the biological functions of TNFSF members. The first chapter (Zhao and Zhang) provides various approaches to investigate the mechanisms of TNFSF15-mediated suppression of vascular endothelial cell growth factor production in endothelial cells. Chapter 2 by Mantis’s group presents detailed protocols on how TNF-α and TNF-related apoptosis inducing ligand modulate programmed cell death pathways in airway epithelial cells in concert with ricin toxin, which is a potent activator of acute respiratory distress. Claude Ahmed and Huard detail on how a proliferation inducing ligand (APRIL) inhibits chondroitin sulfate proteoglycans. Prabhakar and colleagues elegantly discuss the role of TNFSF members in the induction of antigenindependent proliferation of regulatory T cells. Liu and co-authors narrated initiation of complex molecular pathways leading to inflammation and cell death by TNF. Several aspects of targeting TNF superfamily in diseases and in vaccination such as Fcγ receptor-dependent agonism of antibodies to TNF receptor superfamily (Medler and Wajant), bispecific anti-TNF antibodies based on single-chain VHH domains (Nedospasov and colleagues), progranulin derivative Atsttrin (Liu and colleagues), discovery of small molecule modulators (Sachs and colleagues), and generation of influenza virus-like particles by molecular fusion with B-cell-activating factor or APRIL for enhancing neutralizing antibody response to vaccines (Wu and colleagues) were detailed in consequent chapters. The remaining nine chapters provide novel as well as standard techniques for studying TNFSF members. Immunological characterization of paradoxical psoriasis reactions induced by TNF-α biologics was discussed by Albanesi and colleagues and methods on the administration of ectodysplasin A receptor pathway modulators in mice were detailed by Schneider and his colleagues. Two chapters (Wajant et al. and Liu et al.) presented protocols

v

vi

Preface

for bioluminescent technology-based analysis of ligand–receptor interactions. Methods to explore the contribution of TNF in protective immunity against central nervous system tuberculosis infection was narrated by Hsu and Jacobs. Subsequent chapters describe various methods for the identification of TNF superfamily members (mRNA or protein) in the tumor (Kwon and colleagues), kidneys (Tomar and Mulay), retina (Idoate and colleagues), extracellular vesicles (de Souza and colleagues), and tumor-draining lymph nodes (Mehdipour and colleagues). Hira and Begum provide an overview of commonly used in vitro screening methods for the evaluation of TNF-α inhibition effect. My sincere gratitude to all the authors who accepted my invitation and carefully narrated these protocols. Their commitment ever since the beginning is remarkable. I am also indebted to Prof. John Walker, the series editor of Methods in Molecular Biology for his assistance and encouragement throughout this process. I am confident that like the first edition, this second edition on TNFSF will be welcomed by you all and that it will help to investigate various novel features of TNFSF members in pathophysiologies and therapy. Paris, France

Jagadeesh Bayry

References 1. Aggarwal BB, Gupta SC, Kim JH (2012) Historical perspectives on tumor necrosis factor and its superfamily: 25 years later, a golden journey. Blood 119:651–665 2. Locksley RM, Killeen N, Lenardo MJ (2001) The TNF and TNF receptor superfamilies: integrating mammalian biology. Cell 104:487–501 3. Vanamee ES, Faustman DL (2018) Structural principles of tumor necrosis factor superfamily signaling. Sci Signal 11:eaao4910 4. Croft M (2009) The role of TNF superfamily members in T-cell function and diseases. Nat Rev Immunol 9:271–285 5. Brenner D, Blaser H, Mak TW (2015) Regulation of tumour necrosis factor signalling: live or let die. Nat Rev Immunol 15:362–374 6. Chen G, Goeddel DV (2002) TNF-R1 signaling: a beautiful pathway. Science 296:1634–1635 7. Maddur MS, Sharma M, Hegde P, et al (2014) Human B cells induce dendritic cell maturation and favour Th2 polarization by inducing OX-40 ligand. Nat Commun 5:4092 8. Valencia X, Stephens G, Goldbach-Mansky R, Wilson M, Shevach EM, Lipsky PE (2006) TNF downmodulates the function of human CD4+CD25hi T-regulatory cells. Blood 108:253–261 9. Bayry J (2010) TL1A in the inflammatory network in autoimmune diseases. Nat Rev Rheumatol 6:67-68. 10. Taylor PC, Feldmann M (2009) Anti-TNF biologic agents: still the therapy of choice for rheumatoid arthritis Nat Rev Rheumatol 5:578–582 11. van Schouwenburg PA, Rispens T, Wolbink GJ (2013) Immunogenicity of anti-TNF biologic therapies for rheumatoid arthritis. Nat Rev Rheumatol 9:164–172

Preface

vii

12. Bayry J, Sibe´ril S, Triebel F, Tough DF, Kaveri SV (2007) Rescuing CD4+CD25+ regulatory T-cell functions in rheumatoid arthritis by cytokine-targeted monoclonal antibody therapy. Drug Discov Today 12:548–552 13. Nadkarni S, Mauri C, Ehrenstein MR (2007) Anti-TNF-α therapy induces a distinct regulatory T cell population in patients with rheumatoid arthritis via TGF-β. J Exp Med. 204:33–39 14. Nguyen DX, Ehrenstein MR (2016) Anti-TNF drives regulatory T cell expansion by paradoxically promoting membrane TNF-TNF-RII binding in rheumatoid arthritis. J Exp Med. 213:1241–1253 15. Tang W, Lu Y, Tian QY, et al (2011) The growth factor progranulin binds to TNF receptors and is therapeutic against inflammatory arthritis in mice. Science 332:478–484 16. Bayry J (2011) New horizons in natural TNF-α antagonist research. Trends Mol Med 17:538–540 17. Sedger LM, McDermott MF (2014) TNF and TNF-receptors: from mediators of cell death and inflammation to therapeutic giants – past, present and future. Cytokine Growth Factor Rev 25:453–472

Contents Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

v xi

1 Signaling in TNFSF15-mediated Suppression of VEGF Production in Endothelial Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Huanyu Zhao and Qiangzhe Zhang 2 Sensitization of Airway Epithelial Cells to Toxin-Induced Death by TNF Superfamily Cytokines . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19 Claire Reynolds-Peterson, Dylan J. Ehrbar, Susanne M. McHale, Timothy J. LaRocca, and Nicholas J. Mantis 3 Inhibition of Chondroitin Sulfate Proteoglycans by APRIL . . . . . . . . . . . . . . . . . . 43 Mashal Claude Ahmed and Bertrand Huard 4 Induction of Antigen-Independent Proliferation of Regulatory T-Cells by TNF Superfamily Ligands OX40L and GITRL . . . . . . . . . . . . . . . . . . . 63 Prabhakaran Kumar, Zarema H. Arbieva, Mark Maienschein-Cline, Balaji B. Ganesh, Suresh Ramasamy, and Bellur S. Prabhakar 5 Transition from TNF-Induced Inflammation to Death Signaling . . . . . . . . . . . . . 73 Swati Choksi, Gourav Choudhary, and Zheng-Gang Liu 6 Analysis of FcγR-Dependent Agonism of Antibodies Specific for Receptors of the Tumor Necrosis Factor (TNF) Receptor Superfamily (TNFRSF) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81 Juliane Medler and Harald Wajant 7 Generation and Evaluation of Bispecific Anti-TNF Antibodies Based on Single-Chain VHH Domains. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 91 M. A. Nosenko, K. -S. N. Atretkhany, V. V. Mokhonov, S. A. Chuvpilo, D. V. Yanvarev, M. S. Drutskaya, S. V. Tillib, and S. A. Nedospasov 8 In Vitro Physical and Functional Interaction Assays to Examine the Binding of Progranulin Derivative Atsttrin to TNFR2 and Its Anti-TNFα Activity. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 109 Wenyu Fu, Aubryanna Hettinghouse, and Chuan-Ju Liu 9 Fluorescence-Based TNFR1 Biosensor for Monitoring Receptor Structural and Conformational Dynamics and Discovery of Small Molecule Modulators . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 121 Chih Hung Lo, Tory M. Schaaf, David D. Thomas, and Jonathan N. Sachs 10 Production of Multi-Subtype Influenza Virus-Like Particles by Molecular Fusion with BAFF or APRIL for Vaccine Development . . . . . . . . . 139 Ting-Hsuan Chen, Jo-Yu Hong, Chia-Chyi Liu, Chung-Chu Chen, Jia-Tsrong Jan, and Suh-Chin Wu

ix

x

11

12

13

14

15

16

17

18

19

20

21

Contents

Experimental Methods for the Immunological Characterization of Paradoxical Psoriasis Reactions Induced by TNF-α Biologics. . . . . . . . . . . . . . . Martina Morelli, Claudia Scarponi, Stefania Madonna, and Cristina Albanesi Methods for the Administration of EDAR Pathway Modulators in Mice . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Sonia Schuepbach-Mallepell, Christine Kowalczyk-Quintas, Angela Dick, Mahya Eslami, Michele Vigolo, Denis J. Headon, Michael Cheeseman, Holm Schneider, and Pascal Schneider Analysis of Ligand-Receptor Interactions Using Bioluminescent TNF Superfamily (TNFSF) Ligand Fusion Proteins . . . . . . . . . . . . . . . . . . . . . . . . . Kirstin Kucka, Juliane Medler, and Harald Wajant Monitoring Atsttrin-Mediated Inhibition of TNFα/NF-κβ Activation Through In Vivo Bioluminescence Imaging . . . . . . . . . . . . . . . . . . . . . . Aubryanna Hettinghouse, Wenyu Fu, and Chuan-Ju Liu The Use of Murine Infection Models to Investigate the Protective Role of TNF in Central Nervous System Tuberculosis . . . . . . . . . . . . . . . . . . . . . . . Nai-Jen Hsu and Muazzam Jacobs Identification of CD137- and CD137L-Expressing Cells in EL-4 Tumor . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Sang W. Kang, Hong R. Cho, and Byungsuk Kwon Expression Profiling of Tumor Necrosis Factor Superfamily Ligands mRNA in Healthy and Injured Murine Kidneys . . . . . . . . . . . . . . . . . . . . . . . . . . . . Bhawna Tomar and Shrikant R. Mulay Analysis of Lymphotoxin Alpha Expression in Human Retina and Generation of Expression Vectors to Functional Characterization of Polymorphisms in the Tumor Necrosis Factor Locus . . . . . . . . . . . . . . . . . . . . . Ricardo Usategui-Martı´n, Irene Rodriguez-Herna´ndez, Rogelio Gonza´lez-Sarmiento, Eva M. Sobas, Jose Carlos Pastor-Jimeno, and Salvador Pastor-Idoate Detection of TNF-α Protein in Extracellular Vesicles Derived from Tumor Cells by Western Blotting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Tandressa Souza Berguetti, Raquel Ciuvalschi Maia, and Paloma Silva de Souza Expression of TNFRs by B and T Lymphocytes in Tumor-Draining Lymph Nodes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Atri Ghods, Abbas Ghaderi, and Fereshteh Mehdipour Methods for Evaluation of TNF-α Inhibition Effect. . . . . . . . . . . . . . . . . . . . . . . . . Kirti Hira and A. Sajeli Begum

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

155

167

185

201

211

221

231

243

251

259 271 281

Contributors MASHAL CLAUDE AHMED • Team Analytic Immunology of Chronic Diseases, UGA/INSERM U1209/CNRS UMR 5309, Institute for Advanced Biosciences, La Tronche, France CRISTINA ALBANESI • Laboratory of Experimental Immunology, Istituto Dermopatico dell’Immacolata, IDI-IRCCS, Rome, Italy ZAREMA H. ARBIEVA • Core Genomics Facility, University of Illinois at Chicago, Chicago, IL, USA K. -S. N. ATRETKHANY • Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Moscow, Russia A. SAJELI BEGUM • Department of Pharmacy, BITS-Pilani Hyderabad Campus, Hyderabad, Telangana State, India TANDRESSA SOUZA BERGUETTI • Laboratorio de Hemato-Oncologia Mocelular e Celular, Programa de Hemato-Oncologia Molecular, Instituto Nacional de Caˆncer (INCA), Rio de Janeiro, Rio de Janeiro, Brazil; Departamento de Imunologia, Instituto de Cieˆncias Biome´dicas, Universidade de Sa˜o Paulo, Sa˜o Paulo, SP, Brazil MICHAEL CHEESEMAN • Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh, Roslin, UK CHUNG-CHU CHEN • Hsinchu MacKay Memorial Hospital, Hsinchu, Taiwan TING-HSUAN CHEN • Institute of Biotechnology, National Tsing Hua University, Hsinchu, Taiwan HONG R. CHO • School of Biological Sciences, University of Ulsan, Ulsan, Republic of Korea; Department of Surgery, Ulsan University Hospital, University of Ulsan, Ulsan, Republic of Korea SWATI CHOKSI • Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, MD, USA GOURAV CHOUDHARY • Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, MD, USA S. A. CHUVPILO • Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Moscow, Russia; Sirius University of Science and Technology, Sochi, Russia PALOMA SILVA DE SOUZA • Laboratorio de Hemato-Oncologia Mocelular e Celular, Programa de Hemato-Oncologia Molecular, Instituto Nacional de Caˆncer (INCA), Rio de Janeiro, Rio de Janeiro, Brazil; Laboratorio de Produtos Bioativos, Polo Novo Cavaleiros/IMCT, Campus Professor Aloisio Teixeira (UFRJ/Macae´), Universidade Federal do Rio de Janeiro (UFRJ), Macae´, RJ, Brazil ANGELA DICK • Department of Pediatrics, University of Erlangen-Nu¨rnberg, Erlangen, Germany M. S. DRUTSKAYA • Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Moscow, Russia DYLAN J. EHRBAR • Division of Infectious Diseases, Wadsworth Center, New York State Department of Health, Albany, NY, USA MAHYA ESLAMI • Department of Biochemistry, University of Lausanne, Epalinges, Switzerland WENYU FU • Department of Orthopaedic Surgery, New York University Medical Center, New York, NY, USA

xi

xii

Contributors

BALAJI B. GANESH • Flow Cytometry Core, University of Illinois at Chicago, Chicago, IL, USA ABBAS GHADERI • Shiraz Institute for Cancer Research, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran; Department of Immunology, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran ATRI GHODS • Shiraz Institute for Cancer Research, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran ROGELIO GONZA´LEZ-SARMIENTO • Molecular Medicine Unit, Departament of Medicine, University of Salamanca, Institute of Biomedical Research of Salamanca (IBSAL), Salamanca, Spain; Instituto de Biologı´a Molecular y Celular del Ca´ncer (IBMCC), University of Salamanca—CSIC, Salamanca, Spain DENIS J. HEADON • Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh, Roslin, UK AUBRYANNA HETTINGHOUSE • Department of Orthopaedic Surgery, New York University Medical Center, New York, NY, USA KIRTI HIRA • Department of Pharmacy, BITS-Pilani Hyderabad Campus, Hyderabad, Telangana State, India JO-YU HONG • Institute of Biotechnology, National Tsing Hua University, Hsinchu, Taiwan NAI-JEN HSU • Division of Immunology, Department of Pathology and Institute of Infectious Disease and Molecular Medicine, Faculty of Health Sciences, University of Cape Town, Cape Town, South Africa BERTRAND HUARD • Team Analytic Immunology of Chronic Diseases, UGA/INSERM U1209/CNRS UMR 5309, Institute for Advanced Biosciences, La Tronche, France MUAZZAM JACOBS • Division of Immunology, Department of Pathology and Institute of Infectious Disease and Molecular Medicine, Faculty of Health Sciences, University of Cape Town, Cape Town, South Africa; National Health Laboratory Service, Johannesburg, South Africa; Immunology of Infectious Disease Research Unit, University of Cape Town, Cape Town, South Africa JIA-TSRONG JAN • Genomics Research Center, Academia Sinica, Taipei, Taiwan SANG W. KANG • School of Biological Sciences, University of Ulsan, Ulsan, Republic of Korea; Biomedical Research Center, Ulsan University Hospital, College of Medicine, University of Ulsan, Ulsan, Republic of Korea CHRISTINE KOWALCZYK-QUINTAS • Department of Biochemistry, University of Lausanne, Epalinges, Switzerland KIRSTIN KUCKA • Division of Molecular Internal Medicine, Department of Internal Medicine II, University Hospital Wu¨rzburg, Wu¨rzburg, Germany PRABHAKARAN KUMAR • Department of Microbiology and Immunology, University of IllinoisCollege of Medicine, Chicago, IL, USA BYUNGSUK KWON • School of Biological Sciences, University of Ulsan, Ulsan, Republic of Korea; Biomedical Research Center, Ulsan University Hospital, College of Medicine, University of Ulsan, Ulsan, Republic of Korea TIMOTHY J. LAROCCA • Department of Basic and Clinical Sciences, Albany College of Pharmacy and Health Sciences, Albany, NY, USA CHIA-CHYI LIU • National Institute of Infectious Diseases and Vaccinology, National Health Research Institutes, Zhunan, Taiwan CHUAN-JU LIU • Department of Orthopaedic Surgery, New York University Medical Center, New York, NY, USA; Department of Cell Biology, New York University School of Medicine, New York, NY, USA

Contributors

xiii

ZHENG-GANG LIU • Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, MD, USA CHIH HUNG LO • Department of Biomedical Engineering, University of Minnesota, Minneapolis, MN, USA STEFANIA MADONNA • Laboratory of Experimental Immunology, Istituto Dermopatico dell’Immacolata, IDI-IRCCS, Rome, Italy RAQUEL CIUVALSCHI MAIA • Laboratorio de Hemato-Oncologia Mocelular e Celular, Programa de Hemato-Oncologia Molecular, Instituto Nacional de Caˆncer (INCA), Rio de Janeiro, Rio de Janeiro, Brazil MARK MAIENSCHEIN-CLINE • Core for Research Informatics, University of Illinois at Chicago, Chicago, IL, USA NICHOLAS J. MANTIS • Division of Infectious Diseases, Wadsworth Center, New York State Department of Health, Albany, NY, USA SUSANNE M. MCHALE • Advanced Genomic Technologies Cluster, Wadsworth Center, New York State Department of Health, Albany, NY, USA JULIANE MEDLER • Division of Molecular Internal Medicine, Department of Internal Medicine II, University Hospital Wu¨rzburg, Wu¨rzburg, Germany FERESHTEH MEHDIPOUR • Shiraz Institute for Cancer Research, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran V. V. MOKHONOV • Blokhina Scientific Research Institute of Epidemiology of Nizhny Novgorod, Nizhny Novgorod, Russia MARTINA MORELLI • Laboratory of Experimental Immunology, Istituto Dermopatico dell’Immacolata, IDI-IRCCS, Rome, Italy; Section of Dermatology, Department of Medicine, University of Verona, Verona, Italy SHRIKANT R. MULAY • Division of Pharmacology, CSIR-Central Drug Research Institute, Lucknow, India S. A. NEDOSPASOV • Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Moscow, Russia; Lomonosov Moscow State University, Moscow, Russia; Sirius University of Science and Technology, Sochi, Russia M. A. NOSENKO • Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Moscow, Russia SALVADOR PASTOR-IDOATE • Instituto Universitario de Oftalmobiologı´a Aplicada (IOBA), University of Valladolid, Valladolid, Spain; Department of Ophthalmology, Hospital Clı´nico Universitario de Valladolid, Valladolid, Spain; Red Tema´tica de Investigacion Cooperativa en Salud (RETICS), Oftared, Instituto de Salud Carlos III, Valladolid, Spain JOSE CARLOS PASTOR-JIMENO • Instituto Universitario de Oftalmobiologı´a Aplicada (IOBA), University of Valladolid, Valladolid, Spain; Department of Ophthalmology, Hospital Clı´nico Universitario de Valladolid, Valladolid, Spain; Red Tema´tica de Investigacion Cooperativa en Salud (RETICS), Oftared, Instituto de Salud Carlos III, Valladolid, Spain; Centro en Red de Medicina Regenerativa y Terapia Celular de Castilla y Leon, Valladolid, Spain BELLUR S. PRABHAKAR • Department of Microbiology and Immunology, University of IllinoisCollege of Medicine, Chicago, IL, USA SURESH RAMASAMY • Flow Cytometry Core, University of Illinois at Chicago, Chicago, IL, USA CLAIRE REYNOLDS-PETERSON • Division of Infectious Diseases, Wadsworth Center, New York State Department of Health, Albany, NY, USA

xiv

Contributors

IRENE RODRIGUEZ-HERNA´NDEZ • Molecular Medicine Unit, Department of Medicine, University of Salamanca, Institute of Biomedical Research of Salamanca (IBSAL), Salamanca, Spain; Instituto de Biologı´a Molecular y Celular del Ca´ncer (IBMCC), University of Salamanca—CSIC, Salamanca, Spain JONATHAN N. SACHS • Department of Biomedical Engineering, University of Minnesota, Minneapolis, MN, USA CLAUDIA SCARPONI • Laboratory of Experimental Immunology, Istituto Dermopatico dell’Immacolata, IDI-IRCCS, Rome, Italy TORY M. SCHAAF • Department of Biochemistry, Molecular Biology and Biophysics, University of Minnesota, Minneapolis, MN, USA HOLM SCHNEIDER • Department of Pediatrics, University of Erlangen-Nu¨rnberg, Erlangen, Germany PASCAL SCHNEIDER • Department of Biochemistry, University of Lausanne, Epalinges, Switzerland SONIA SCHUEPBACH-MALLEPELL • Department of Biochemistry, University of Lausanne, Epalinges, Switzerland EVA M. SOBAS • Instituto Universitario de Oftalmobiologı´a Aplicada (IOBA), University of Valladolid, Valladolid, Spain; Nursing School, University of Valladolid, Valladolid, Spain DAVID D. THOMAS • Department of Biochemistry, Molecular Biology and Biophysics, University of Minnesota, Minneapolis, MN, USA; Photonic Pharma LLC, Minneapolis, MN, USA S. V. TILLIB • Institute of Gene Biology, Russian Academy of Sciences, Moscow, Russia BHAWNA TOMAR • Division of Pharmacology, CSIR-Central Drug Research Institute, Lucknow, India RICARDO USATEGUI-MARTI´N • Instituto Universitario de Oftalmobiologı´a Aplicada (IOBA), University of Valladolid, Valladolid, Spain MICHELE VIGOLO • Department of Biochemistry, University of Lausanne, Epalinges, Switzerland HARALD WAJANT • Division of Molecular Internal Medicine, Department of Internal Medicine II, University Hospital Wu¨rzburg, Wu¨rzburg, Germany SUH-CHIN WU • Institute of Biotechnology, National Tsing Hua University, Hsinchu, Taiwan; Department of Medical Science, National Tsing Hua University, Hsinchu, Taiwan D. V. YANVAREV • Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Moscow, Russia QIANGZHE ZHANG • State Key Laboratory of Medicinal Chemical Biology and College of Pharmacy, and Tianjin Key Laboratory of Molecular Drug Research, Nankai University, Tianjin, China HUANYU ZHAO • State Key Laboratory of Medicinal Chemical Biology and College of Pharmacy, and Tianjin Key Laboratory of Molecular Drug Research, Nankai University, Tianjin, China

Chapter 1 Signaling in TNFSF15-mediated Suppression of VEGF Production in Endothelial Cells Huanyu Zhao and Qiangzhe Zhang Abstract Vascular endothelial growth factor (VEGF) plays a pivotal role in promoting neovascularization. Tumor necrosis factor superfamily 15 (TNFSF15) is an antiangiogenic cytokine prominently produced by endothelial cells in a normal vasculature. In this study, Western blot, quantitative polymerase chain reaction (qPCR), and dual luciferase reporter gene assay were used to validate the mechanisms of TNFSF15mediated suppression of VEGF production in endothelial cells. We report that TNFSF15 inhibits VEGF production via microRNA-29b (miR-29b) targeting the 30 -UTR of VEGF transcript in mouse endothelial cell line bEnd.3. Neutralizing antibody against TNFSF15, 4-3H, inhibits the level of miR-29b and reinvigorates VEGF. In addition, TNFSF15 activates the JNK signaling pathway as well as the transcription factor GATA3, resulting in enhanced miR-29b production. SP600125, an inhibitor of JNK, eradicates TNFSF15-induced GATA3 expression. Moreover, GATA3 siRNA suppressed TNFSF15-induced miR-29b expression. Together, this study provides evidence and method of activation of the JNK-GATA3 signaling pathway by TNFSF15 that suppresses VEGF gene expression, which gives rise to upregulation of miR-29b. Key words Tumor necrosis factor superfamily 15, Vascular endothelial growth factor, MicroRNA29b, GATA3, Western blot, Quantitative polymerase chain reaction, Dual luciferase reporter gene assay

1

Introduction Vascular endothelial growth factor (VEGF) is a multifaceted cytokine, which promotes embryonic and postnatal neovascularization, repairs ischemic tissues and injured organs, maintains heterogeneity of endothelial cell and organ [1–8]. Highly elevated levels of VEGF in pathological tissues, as compared with those in normal tissues, are a major threat in a number of diseases, including cancer, rheumatoid arthritis, atherosclerosis, diabetic retinopathy, and sepsis [9–13]. Therefore, how to down-regulate the VEGF gene expression may be an important implication in clinical settings. Tumor necrosis factor superfamily 15 (TNFSF15; also known as VEGI or TL1A), a special inhibitor of endothelial cell proliferation and angiogenesis, is largely produced by endothelial cells

Jagadeesh Bayry (ed.), The TNF Superfamily: Methods and Protocols, Methods in Molecular Biology, vol. 2248, https://doi.org/10.1007/978-1-0716-1130-2_1, © Springer Science+Business Media, LLC, part of Springer Nature 2021

1

2

Huanyu Zhao and Qiangzhe Zhang

[14–16]. TNFSF15 also inhibits the differentiation of endothelial progenitor cell into endothelial cell [17] by facilitating the production of a soluble form of VEGF receptor-1 (VEGFR1), which competes with the full-length VEGF, thus blocking VEGF activity [18]. In addition, VEGF produced by ovarian cancer ID8 cell can effectively inhibit TNFSF15 production in endothelial cells [19]. Therefore, we infer that VEGF and TNFSF15 may act as a pair of counterbalancing factors in the maintenance of vascular integrity and regulation of neovascularization. We use Western blot, quantitative polymerase chain reaction (qPCR), and dual luciferase assays here to report the signaling pathway in TNFSF15-mediated suppression of VEGF production in endothelial cells. In a word, TNFSF15 is able to stimulate the production of miR-29b in endothelial cell, which targets the 30 -UTR of VEGF mRNA. Furthermore, TNFSF15 activates the JNK signaling to promote the expression of GATA3, which drives the transcription of miR-29b, thus the inhibition of VEGF production.

2

Materials We prepare all solutions using suitable solvents and analytical-grade reagents. Prepare and store reagents in a befitting temperature. Meanwhile, we follow all waste disposal regulations when disposing waste materials.

2.1 Cell Line, Protein, and Inhibitor

1. Complete DMEM medium: DMEM, 10% fetal bovine serum (FBS), 1% penicillin/streptomycin. 2. Mouse endothelial cell line bEnd.3: maintain in complete DMEM at 37  C with 5% CO2. 3. Human recombinant TNFSF15 protein: prepared by our laboratory. 4. 4-3H (TNFSF15-neutralizing antibody): prepared by our laboratory. 5. SP600125: JNK signaling inhibitor (Cell Signal Technology). Store at 80  C. 6. GATA3 siRNA (Santa Cruz Biotechnology): Dilute to 20 μM. Store at 20  C. 7. Scrambled siRNA: The sense and antisense sequences are 50 -UUC UCC GAA CGU GUC ACG UTT-30 and 50 -ACG UGA CAC GUU CGG AGA ATT-30 . Dilute to 20 μM. Store at 20  C. 8. Scramble miRNA mimics (miR-Ctr, #24), miR-29b mimics (miR-29b, #miR10000127), scramble anti-miRNA mimics (anti-Ctr, #22) and anti-miR-29b mimics (anti-miR-29b,

TNFSF15-inhibited VEGF Expression

3

#miR20000127). Use 50 μM concentration of miR-Ctr and miR-29b mimics, and 100 μM concentration of anti-Ctr and anti-miR-29b to treat cells. 2.2

Western Blot

1. Lysis buffer: 95% radioimmunoprecipitation assay buffer (RIPA), 1% phenylmethylsulfonyl fluoride (PMSF), 4% protease inhibitor cocktail. 2. 10% SDS: Dissolve 10 g of SDS in 90 mL water, mix and adjust pH to 7.2 with HCl (see Note 1), make up to 100 mL with ultrapure water (18 MΩ-cm at 25  C). Store at room temperature. 3. 30% acrylamide/Bis solution (29:1) acrylamide (see Note 2). Store at 4  C. 4. Ammonium persulfate (APs): Dissolve 1 g ammonium persulfate in 9 mL ultrapure water. Make up the volume to 10 mL. Store at 4  C. 5. N,N,N,N0 -Tetramethyl-ethylenediamine (TEMED) (see Note 3). Store at 4  C. 6. 1.5 M Tris-HCl, pH 8.8: Dissolve 181.7 g Tris in 800 mL water, adjust pH to 8.8, and make up to 1000 mL with ultrapure water. Store at room temperature. 7. 1 M Tris-HCl, pH 6.8: Dissolve 121.1 g Tris in 800 mL ultrapure water, adjust pH to 6.8, and make up to 1000 mL. Store at room temperature. 8. Separation gel (for four gels): 9.9 mL ddH2O, 12 mL 30% acrylamide/Bis solution (29:1) acrylamide, 7.5 mL 1.5 M TrisHCl (pH 8.8), 300 μL 10% SDS, 300 μL 10% APS, 12 μL TEMED. 9. Concentrated gel: 1.7 mL ddH2O, 1 mL 30% acrylamide/Bis solution (29:1) acrylamide, 0.7 mL 1 M Tris-HCl (pH 6.8), 100 μL 10% SDS, 100 μL 10% APS, 10 μL TEMED. 10. 5 Tris-glycine running buffer: 15.1 g Tris, 94 g glycine, 5 g SDS, 800 mL ultrapure water. Dissolve on the magnetic agitator, and make up to 1000 mL. Store at room temperature (see Note 4). 11. 10 Transfer buffer: 30.3 g Tris, 144 g glycine, 5 g SDS, 800 mL ultrapure water. Dissolve on magnetic agitator, and make up to 1000 mL. Store at room temperature. 12. 1 Transfer buffer: Dilute 100 mL of 10 transfer buffer to 700 mL with ultrapure water. Add 200 mL methanol (see Note 5). 13. 10 Tris-buffered saline (TBS): 60.57 g Tris, 88 g NaCl, 800 mL ultrapure water. Dissolve on magnetic agitator, adjust pH to 7.2 with 1M HCl, and make up to 1000 mL. Store at room temperature.

4

Huanyu Zhao and Qiangzhe Zhang

14. TBS containing 0.1 % Tween-20 (TBST): Dilute 100 mL of 10 TBS to 1000 mL with ultrapure water. Add 1 mL of Tween-20. 15. Blocking solution: 5% skimmed milk or 5% BSA in TBST (see Note 6). Store at 4  C. 16. PVDF membranes (GE Healthcare Life Sciences). 17. Bio-rad vertical electrophoresis glass plate and gel holder (Bio-Rad Laboratories, Inc). 18. Bio-rad PowerPac Universal Power Supply (Bio-Rad Laboratories, Inc.). 19. PageRuler Prestained Protein Ladder (Bio-Rad Laboratories, Inc.). 20. Antibodies: Anti-VEGF (1:1000 dilution, Santa Cruz Biotechnology), anti-GATA-3 (1:1000 dilution, Santa Cruz Biotechnology). Anti-JNK (1:1000 dilution, Cell Signaling Technology), anti-phospho-JNK (1:1000 dilution, Cell Signaling Technology). 21. 4 loading buffer (Solarbio Life Science). 22. ECL System (Millipore Sigma). 2.3

qPCR

1. TRIzol Reagent (Thermo Fisher Scientific) (see Note 7). 2. Trichloromethane. 3. Isopropanol. 4. 75% ethanol (see Note 8). 5. Diethyl pyrocarbonate (DEPC)-treated water. 6. miRNeasy Mini Kit (Qiagen) (see Note 9). 7. TransScript First-Strand cDNA Synthesis SuperMix (TransGen Biotech). 8. TransStart Top Green qPCR SuperMix (TransGen Biotech). 9. The sense and antisense primer sequences: VEGF, 50 -GGC GAT TTA GCA GCA GAT ATA AGA A-30 and 50 -GGA GAT CCT TCG AGG AGC ACT T-30 ; GATA3, 50 -CCA TTA CCA CCT ATC CGC CC-30 and 50 -CAC ACT CCC TGC CTT CTG TG; β-actin, 50 -CAG AAG GAG ATT ACT GCT CT-30 and 50 -TAC TCC TGC TTG CTG ATC CAC ATC-30 . Dilute these primers to 10 μM with DEPC-treated water or RNasefree water. Store at 20  C. 10. Axygen 0.2 mL Polypropylene PCR Tube Strips and Flat Cap Strips, 8 Tubes/Strip, 8 Flat Caps/Strip, Clear, Nonsterile (Corning). 11. miR-29b RT Primer (#ssD1301049265), miR-29b Forward Primer (#ssD1301049267), miR-Reverse Primer (#ssD089261711), U6-RT Primer (#ssD0904071008),

TNFSF15-inhibited VEGF Expression

5

U6-Forward Primer (#ssD0904071006), and U6-Reverse Primer (#ssD0904071007). Dilute these primers to 10 μM with DEPC-treated water or RNase-free water. Store at 20  C. 2.4 Dual Luciferase Assays

1. VEGF 30 -UTR Primer: Two restriction endonuclease sites (SacI and XhoI) were added into forward and reverse primers of VEGF 30 -UTR for facilitating molecular clone experiments. VEGF-30 -UTR-forward+SacI: 50 -ATA GAG CTC GCC AGG CTG CAG GAA GGA G-30 , VEGF-30 -UTR-reverse+XhoI: 50 -GGG CTC GAG GTA CTA CGG AAT ATC TCG GAA AAC T-30 . 2. T4 DNA ligase, dNTP, SacI, and XhoI restriction enzyme. 3. 6 Loading Buffer. 4. Animal Tissues/Cells Genomic DNA Extraction Kit (Solarbio Life Science). 5. KOD Plus (Toyobo). 6. PCR DNA Extraction Kit (Axygen). 7. MgSO4. 8. 0.8% agarose gel: 0.8 g agarose, 100 mL 1 TBE. Heat in the microwave oven, boil three times until the solution is completely clarified. Cool to 50  C with cold water, add appropriate amount of EB, pour into the glue tank, insert the sample comb, allow to solidify at room temperature. Store at 4  C. 9. pmirGLO Dual-Luciferase miRNA Target Expression Vector (Promega). 10. TOP10 Ultracompetent cells (Yeasen). 11. LB liquid medium: 25 g LB broth medium, add 900 mL distilled water. Shake until dissolved, and then make up to 1000 mL. Autoclave for 20 min, add antibiotics to the medium after cooling, and store at 4  C. 12. LB solid medium: 25 g LB broth medium, 15 g agarose, add 900 mL distilled water. Shake until completely dissolved, and then make up to 1000 mL. Autoclave for 20 min. When the medium is cooled to about 50  C, add the antibiotic, shake and pour it into the bacteria culture dish in the ultraclean workbench. After the medium is solidified, store at 4  C. 13. Ampicillin: Dissolve it with deionized water at a concentration of 50 mg/mL. Filter with a 0.22-μm filter, and store at 20  C. Working concentration is 50 μg/mL. 14. 0.5 M EDTA: 146.125 g EDTA, 800 mL distilled water. Adjust pH to 8.0 with 10 M NaOH, and make up to 1000 mL. Store at 4  C.

6

Huanyu Zhao and Qiangzhe Zhang

15. 5 TBE: 20 mL 0.5 M EDTA, 54 g Tris, 27.5 g boric acid, 900 mL double distilled H2O. Adjust pH to 8.3, and then make up to 1000 mL. 16. Plasmid DNA extraction kit (Axygen). 17. Lipofectamin 2000 (Thermo Fisher Scientific). 18. SuperLight Dual Luciferase Reporter Gene Assay Kit (BioAssay Systems).

3

Methods

3.1 Analyses of Effect of TNFSF15 on VEGF-Targeting miR-29b in bEnd.3 Cells 3.1.1 TNFSF15-Induced Expression of miR-29b in bEnd.3 Cells

1. Add 8  104/well bEnd.3 cells in the 12-well plate. Incubate them for 12 h at 37 C with 5% CO2. 2. To explore the dose-dependent effect of TNFSF15, perform serial dilution of TNFSF15 and buffer to achieve the concentration of 0, 0.1, 0.3, 1 unit for each well. Treat bEnd.3 cells for 24 h. 3. To investigate the kinetics of TNFSF15 stimulation, treat bEnd.3 cells with 0.3 unit TNFSF15 for 0, 6, 12, 24, and 48 h, respectively. 4. To detect the inhibitory effect of 4-3H, a TNFSF15 neutralizing antibody on the upregulation of miR-29b in bEnd.3 cells, prepare TNFSF15 (0.3 Unit), 4-3H (0.2 mg/mL), and mix them. Treat bEnd.3 cells for 24 h. 5. Collect the treated samples prepared in steps 2–4 by TRIzol for testing miR-29b expression level (see Subheadings 3.5, 3.6, and 3.7).

3.1.2 Validation of 30 -UTR of VEGF mRNA as Target for miR-29b

1. Construct dual-luciferase miRNA target expression vector, including VEGF 30 -UTR sequences (see Subheading 3.14). 2. Cotransfect HEK-293T cells with miR-29b mimic and recombinant plasmid, including VEGF 30 -UTR sequences (see Subheading 3.8). 3. Detect luminescence value with Dual-Luciferase® Reporter Assay System (see Subheading 3.15).

3.1.3 Validation of miR-29b Target at Protein Level

1. Treat bEnd.3 cells (see step 1 in Subheading 3.1.1). 2. Transfect bEnd.3 cells with 100 nM of anti-miR-29b and 50 nM of miR-29b (see Subheading 3.9). 3. Detect the expression of VEGF by measuring the protein (see Subheading 3.10).

TNFSF15-inhibited VEGF Expression

3.2 Investigation of Role of GATA3 in TNFSF15-Induced miR-29b Production and Silencing of VEGF

7

1. Treat bEnd.3 cells as described under steps 1–3 in Subheading 3.1.1. 2. Collect the treated samples to test GATA3 mRNA and protein expression level by qPCR and Western blot (see Subheadings 3.10, 3.11, 3.12, and 3.13).

3.2.1 TNFSF15 Effect on the Expression of GATA3 in bEnd.3 Cells 3.2.2 siRNA Method to Confirm the Function of GATA3

1. Prepare bEnd.3 cells as described under step 1 in Subheading 3.1.1. 2. Treat bEnd.3 cells with 160 nM of GATA3 siRNA (see Subheading 3.9). 3. Detect the expression of miR-29b (see Subheadings 3.5, 3.6, and 3.7), GATA3, and VEGF (see Subheadings 3.10, 3.11, 3.12, and 3.13) at protein and mRNA level.

3.3 Role of DR3 in Mediating the TNFSF15Stimulated Activation of GATA3, Upregulation of miR-29b, and Downregulation of VEGF

1. Prepare bEnd.3 cells as described under step 1 in Subheading 3.1.1.

3.4 Dissection of JNK Signaling in TNFSF15-Stimulated GATA3 and miR-29b Upregulation

1. Prepare bEnd.3 cells as described under step 1 in Subheading 3.1.1.

3.4.1 Activation of JNK Signaling Pathway by TNFSF15

3. Detect the expression of JNK and p-JNK by Western blot (see Subheading 3.10).

3.4.2 siRNA Method to Validate the Role of DR3 in TNFSF15-Stimulated JNK Activation

1. Prepare bEnd.3 cells as described under step 1 in Subheading 3.1.1.

2. Treat bEnd.3 cells with 40 nM of DR3 siRNA (see Subheading 3.9). 3. Detect the expression of miR-29b (see Subheadings 3.5, 3.6, and 3.7), DR3, GATA3, and VEGF (see Subheadings 3.10, 3.11, 3.12, and 3.13) at protein and mRNA level.

2. To detect TNFSF15-stimulated JNK signal, treat bEnd.3 cells with 0.3 unit of TNFSF15 for 0, 5, 10, 15, 30, 60 min, and 24 h.

2. Treat bEnd.3 cells with 40 nM of DR3 siRNA (see Subheading 3.9). 3. Detect the expression of JNK and p-JNK by Western blot (see Subheading 3.10).

8

Huanyu Zhao and Qiangzhe Zhang

3.4.3 Analysis of Effect of SP600125, a JNK Signaling Inhibitor, Toward TNFSF15-Stimulated GATA3 and miR-29b Upregulation

1. Prepare bEnd.3 cells as described under step 1 in Subheading 3.1.1.

3.4.4 Blockade of TNFSF15-Stimulated GATA3 and miR-29b Upregulation by JNK Silencing

1. Prepare bEnd.3 cells as described under step 1 in Subheading 3.1.1.

3.5 miRNA Extraction for miRNA Analysis

2. Pretreat bEnd.3 cells with 50 μM of SP600125 for 2 h, then continue to stimulate them with recombinant TNFSF15 or buffer for 24 h. 3. Detect the expression of miR-29b (see Subheadings 3.5, 3.6, and 3.7), JNK, p-JNK, c-Jun, p-c-Jun, and GATA3 (see Subheadings 3.10, 3.11, 3.12, and 3.13) at protein and mRNA level.

2. Treat bEnd.3 cells with 44 nM of JNK siRNA (see Subheading 3.9) 3. Detect the expression of miR-29b (see Subheadings 3.5, 3.6, and 3.7), JNK, p-JNK, and GATA3 (see Subheadings 3.10, 3.11, 3.12, and 3.13) at protein and mRNA level. In order to avoid RNase degrading the RNA, all the centrifuge tubes and probes should be RNase-free during the experiment. Meanwhile, gloves and headgear should be used throughout the experiment. 1. Add 500 μL of TRIzol to the 12-well plate. Pipette the cells several times, then transfer them to a 1.5-mL centrifuge tube. Keep them at room temperature for 5 min. 2. Add 100 μL of chloroform, shake vigorously for 15 s. Keep them quietly at room temperature for 3 min, then centrifuge at 12,000  g for 15 min at 4  C. 3. Carefully pipette the supernatant into a new centrifuge tube (see Note 10). Add 1.5 volume 100% ethanol of supernatant, and mix slightly. 4. Add the mixed sample to the RNeasy Mini column, centrifuge at 12,000  g for 15 s at room temperature. 5. Discard the liquid, re-place the column in the collection tube. Add 700 μL of RWT provided in the kit, and centrifuge at room temperature, 12,000  g for 15 s. 6. Discard the liquid, re-place the column in the collection tube. Add 500 μL of RPE provided in the kit. 7. Centrifuge at room temperature, 12,000  g for 15 s. Repeat step 6 and centrifuge at room temperature, 12,000  g for 2 min. 8. Transfer RNeasy mini column to a new 2-mL centrifuge tube. Centrifuge at room temperature, 12,000  g for 1 min to dry the column.

TNFSF15-inhibited VEGF Expression

9

9. Transfer RNeasy mini column to a new 1.5-mL centrifuge tube. Add 30–50 μL of RNase-free water, centrifuge at room temperature, 12,000  g for 1 min. 10. Test the concentration of miRNA with NanoDrop2000. 3.6 Reverse Transcription of RNA into cDNA for miRNA Analysis

1. Take 1 μg of RNA sample, 1 μL of 10 μM miRNA RT Primer. Add RNase-free water to a volume of 9 μL and mix. 2. Heat the sample at 65  C for 5 min, then put on ice for 2 min. 3. Add the premixed mixture, including 10 μL of 2 TS Reaction Mix, 1 μL of TransScript® RT/RI Enzyme Mix. 4. Mix and then heat at 25  C for 10 min, 42  C for 30 min, 85  C for 5 min. Store at 20  C.

3.7

qPCR for miRNA

1. Prepare qPCR mix by adding 2 μL of cDNA sample, 0.5 μL of 10 μM miR-29b-Forward primer, 0.5 μL of 10 μM miR-29bRevers primer, 10 μL of 2 TransStart® Top Green qPCR SuperMix. Add RNase-free water to a volume of 20 μL and mix. 2. Follow the following conditions for quantitative PCR. Predenaturation at 95  C for 20 s, followed by denaturation at 95  C for 10 s, annealing at 60  C for 20 s, and 70  C extension for 10 s. 40 cycles.

3.8 Recombinant Plasmid of VEGF 30 -UTR Co-transfected with miR-29b Mimic

1. Inoculate HEK-293 cells into the culture plate and cultivate to 70–80% confluence. 2. Dilute 2 μL of lipo2000 with 50 μL of Opti-MEM, which is serum-free and antibiotic-free, mix gently, and keep for 5 min at room temperature. Mark as Solution 1. 3. Dilute 1 μg of VEGF 30 -UTR recombinant plasmid with 50 μL of Opti-MEM without serum and antibiotics, and add 50 nM miRNA mimic or control-mimic, mix gently, and let stand for 5 min at room temperature. Mark as Solution 2. 4. Mix Solutions 1 and 2 for 20 min at room temperature to form miRNA-lipo2000 complex. 5. Aspirate the cell culture medium and wash twice with PBS, add 400 μL of serum-free and antibiotic-free medium to each well. 6. Add 100 μL of miRNA mimic-lipo2000 complex to each well. Gently rotate to mix evenly. 7. After 4–6 h of culture, remove the medium containing the mimic-lipo2000 complex in the well and replace it with the fresh medium. 8. Culture for 24 h, collect cells for dual fluorescent reporter assay.

10

Huanyu Zhao and Qiangzhe Zhang

3.9 Transfection for siRNA and miRNA Mimics

1. On the day of transfection, dilute 2 μL of lipo2000 by adding 50 μL of serum-free and antibiotic-free Opti-MEM, mix gently, and stand for 5 min at room temperature. Mark as Solution 1. 2. Dilute appropriate amount siRNA or miRNA with 50 μL of Opti-MEM without serum and antibiotics, mix gently, and let stand for 5 min at room temperature. Mark as Solution 2. 3. Mix Solutions 1 and 2 for 20 min at room temperature to form miRNA or siRNA-lipo2000 complex. 4. Aspirate the cell culture medium and wash twice with PBS (see Note 11), add 400 μL of serum-free and antibiotic-free medium to each well. 5. Add 100 μL of miRNA or siRNA-lipo2000 complex to each well. Gently rotate to mix evenly. 6. Culture them for 4–6 h, and remove the medium containing the miRNA or siRNA -lipo2000 complex in the well and replace it with the fresh medium. 7. Culture for 24 h, collect cells for Western blot and qPCR assay.

3.10

Western Blot

3.10.1 Cellular Protein Extraction

1. Aspirate the medium in the 12-well plate and wash twice with 0.5 mL of precooled PBS. Add 100 μL of lysis buffer to each well and transfer to a 1.5-mL centrifuge tube by scraping the cells. 2. Place the cell lysates on ice and spin three times, 10 min/time. 3. Centrifuge the cell lysates at 12,000  g for 10–15 min at 4  C. 4. Transfer the supernatant to a new 1.5-mL centrifuge tube, set aside 10 μL for testing of protein concentration. Then add 4 loading buffer to the rest. 5. Place the tubes in the metal bath preheated to 100  C, heat for 5 min. Pack and store at 20  C.

3.10.2 Determination of Protein Concentration

1. Prepare protein standard. Take 10 μL of 5 mg/mL standard BSA, add 90 μL of PBS to make the final concentration of 0.5 mg/mL. After mixing completely, add 0, 2, 4, 6, 8, 12, 16, 20 μL of the standard BSA to a 0.5-mL EP tube. Make up to 20 μL for each standard BSA with PBS, mix and then transfer to the 96-well plate. 2. Prepare unknown sample dilution. Take 10 μL of protein sample, then dilute them five to ten times with PBS. Mix completely and add to the 96-well plate. 3. Prepare BCA work solution by adding 50 volumes of BCA reagent and 1 volume of Cu reagent.

TNFSF15-inhibited VEGF Expression

11

4. Add 200 μL of BCA work solution to the 96-well plate with standard BSA and unknown samples, incubate in the 37  C incubator for 30 min, and measure optical density (OD) at 562 nm. 5. Make a standard curve based on OD of the standard BSA, then calculate the concentration from the OD value of unknown samples. 3.10.3 Sodium Dodecyl Sulfate Polyacrylamide (12%) Gel Electrophoresis, and Western blot

1. Prepare separation gel by completely mixing the ingredients (see item 8, Subheading 2.2). Then add to the placed rubber board. The upper layer is flattened with isopropanol. Condense at room temperature. 2. Prepare concentrated gel by completely mixing the ingredients (see item 9, Subheading 2.2). 3. Remove isopropanol by filter paper after the separation gel is polymerized. Then add concentrated gel to the rubber board, insert the prewashed comb, condense at room temperature. Store it at 4  C (see Note 12). 4. Perform electrophoresis. Dilute 5 Tris-glycine running buffer to 1 with ultrapure water, fix the prepared polyacrylamide gel with a clip, and place it in the electrophoresis tank. Add 1 running buffer, gently pull out the comb, and add samples. Run the samples initially at voltage 60 V, and after 30 min, turn voltage 120 V, run for 2 h. 5. Perform protein transfer. After electrophoresis, remove the gel and cut off the excess part of it. Place the front side of the PVDF membrane in contact with the gel with three layers of filter paper and a layer of sponge (see Note 13). Then put it in a transfer tank, 300 mA, run for 2 h. Keep the entire film transfer process on ice. 6. Perform blocking. Remove the PVDF membrane and place it in the blocking solution, which completely covers PVDF membrane, Soak at room temperature for 1 h. 7. Incubate blocked membrane with primary antibody. Dilute the primary antibody to the appropriate concentration with TBST, incubate for 2 h at room temperature or overnight at 4  C. 8. Remove the primary antibody solution, wash PVDF membrane with TBST for 5 times, 6 min/time. Then add the secondary antibody, which is diluted to the appropriate concentration with TBST, incubate for 1 h at room temperature. 9. Prepare ECL Solutions A and B according to 1:1, and expose the protein by Amersham Typhoon.

12

3.11

Huanyu Zhao and Qiangzhe Zhang

RNA Extraction

1. Add 500 μL of TRIzol to the 12-well plate, pipette the cells several times, then transfer them to a 1.5-mL centrifuge tube. Put them at room temperature for 5 min. 2. Add 100 μL of chloroform, shake vigorously for 15 s. Keep quietly at room temperature for 3 min, then centrifuge at 12,000  g for 15 min at 4  C. 3. Carefully pipette the supernatant into a new centrifuge tube (see Note 14). Add an equal volume of isopropanol to it and mix them completely. Keep them quietly at room temperature for 10 min. Centrifuge at 12,000  g for 25 min at 4  C 4. A white precipitate can be seen at the bottom of the tube (RNA). Carefully discard the upper layer of liquid, add 1 mL of 75% ethanol, and gently invert the tube to clean the RNA. 5. Centrifuge at 12,000  g for 5 min at 4  C, then remove 75% ethanol carefully (see Note 10). 6. Repeat steps 4 and 5 (see Note 15). 7. Dry the centrifuge tube at room temperature (see Note 16). 8. Add a certain volume of DEPC-treated water for dissolving the RNA. 9. Test the concentration with NanoDrop2000.

3.12 Reverse Transcription of Total RNA into cDNA

1. Prepare the mix by adding 1 μg of RNA sample, 1 μL of Random Primer (N9, 0.1 μg/μL), and RNase-free water to a volume of 9 μL. Mix well. 2. Heat the mix at 65  C, 5 min, then put on ice for 2 min. 3. Add the premixed mixture, including 10 μL of 2 TS Reaction Mix (supply in TransScript First-Strand cDNA Synthesis SuperMix Kit (TransGen Biotech)), 1 μL of TransScript® RT/RI Enzyme Mix. 4. Mix and then heat at 25  C for 10 min, 42  C for 30 min, 85  C for 5 min. Store at 20  C.

3.13

qPCR for mRNA

1. Prepare qPCR reaction mix by adding 2 μL of cDNA sample, 0.5 μL of 10 μM forward primer, 0.5 μL of 10 μM reverse primer, 10 μL of 2 TransStart® Top Green qPCR SuperMix. Add RNase-free water to a volume of 20 μL, mix. 2. Use following conditions for qPCR: Predenaturation at 94  C for 30 s followed by denaturation at 94  C for 20 s, annealing at 60  C for 15 s, and 72  C extension for 30 s. 40 cycles.

TNFSF15-inhibited VEGF Expression

3.14 Construction of Dual-Luciferase miRNA Target Reporter System 3.14.1 Mouse Genomic DNA Extraction

13

1. Collect trypsin-digested LLC cells into 1.5-mL EP tubes. Centrifuge at 200  g for 4 min at 4  C, collect the cells. 2. Add 200 μL of Solution A (Animal Tissues/Cells Genomic DNA Extraction Kit (Solarbio Life Science)), and blow it up to completely suspend. 3. Add 20 μL of RNase A (10 mg/mL), mix by pipetting, and keep it at 55  C for 15 min. 4. Add 20 μL of proteinase K (10 mg/mL), mix by pipetting, and digest at 55  C in the water bath. Mix the tube up and down until a clear and viscous liquid is formed. 5. Add 200 μL of Solution B (Animal Tissues/Cells Genomic DNA Extraction Kit (Solarbio Life Science)), and mix completely (see Note 17). 6. Add 200 μL of absolute ethanol, mix by pipetting, and transfer to the adsorption column (see Note 18) 7. Centrifuge at 12,000  g for 1 min, discard the lower layer of liquid, and put the adsorption column in the collection tube. 8. Add 700 μL of rinse solution, centrifuge at 12,000  g for 1 min, discard liquid, and put the adsorption column in the collection tube. 9. Repeat step 8. 10. Centrifuge at 12,000  g for 2 min, and put the adsorption column in the oven at 50  C for about 5 min to remove the rinse solution. 11. Put the column in a new 1.5-mL collection tube, add 50 μL of ddH2O, which is preheated to 70  C, to the center of the membrane. 12. Obtain the mouse genomic DNA via keeping at room temperature for 3 min and then centrifuge at 12,000  g for 1 min.

3.14.2 PCR Amplification of VEGF 30 -UTR Fragment

1. Prepare PCR system components by mixing 10 μL of mouse genomic DNA sample, 5 μL of 10 Buffer for KOD-Plus, 5 μL of 2 mM dNTPs, 2 μL of 25 mM MgSO4, 1.5 μL each of 10 μM Primer-F and Primer-R, 23 μL of PCR-grade water, and 2 μL of 1.0 U/μL KOD-Plus. 2. Run PCR by using following conditions. 95  C for 2 min, 95  C for 20 s, annealing at 60  C for 30 s, extension at 68  C for 1 min. 35 cycles.

3.14.3 Recovery of PCR Product

1. Pull the comb out of the gel and put it in the electrophoresis tank. 2. Add appropriate amount of 6 loading buffer to the PCR product, mix and add to the gel hole. 3. Perform electrophoresis. 100 V, 20 min.

14

Huanyu Zhao and Qiangzhe Zhang

4. Take the agarose gel out and put it on the gel imager, take a photo, and save the picture. 5. Cut the gel where the target fragment is located quickly with a scalpel under UV light. 6. Weigh the cut gel and convert it into a volume (see Note 19) 7. Add DE-A, 3 times the gel volume, and put it in the 75  C water bath, vortex every 2–3 min until the gel is completely dissolved. 8. Add DE-B, which is 1/2 volume of DE-A. Then add 1 volume of isopropanol when the DNA fragment is less than 400 bp. 9. Place the collection tube in a 2-mL EP tube, add the mixture in the collection tube, and centrifuge at 12,000  g for 1 min. 10. Discard the liquid in 2-mL EP tube, add 500 μL of Buffer W1 to the collection tube, and centrifuge at 12,000  g for 30 s. 11. Discard the liquid in 2-mL EP tube, add 700 μL of Buffer W2 along the tube wall, and centrifuge at 12,000  g for 30 s. 12. Discard the liquid in 2-mL EP tube, add 700 μL of Buffer W2 along the tube wall, and centrifuge at 12,000  g for 1 min. 13. Discard the liquid in 2-mL EP tube, centrifuge at 12,000  g for 1 min. 14. Transfer the collection tube to a 1.5-mL EP tube, add 25–30 μL of ddH2O to the center of the membrane, keep it at room temperature for 1 min, and centrifuge at 12,000  g for 1 min. 3.14.4 Enzymatic Cleavage of PCR Products and Vectors

1. Prepare enzyme cleavage mix by adding 1 μL of XhoI, 1 μL of SacI, 2 μL of 10 Cutsmart Buffer 4, 2 μL of 10 BSA, 0.1–4 μg of VEGF 30 -UTR and plasmid DNA, make up to 20 μL with sterile water. Mix. 2. Incubate in water bath for 4 h at 37  C. 3. Add appropriate amount of 6 Loading Buffer to stop the reaction. 4. For the recovery of enzymatically digested vector and PCR product, follow the steps in Subheading 3.14.3 (see Note 20).

3.14.5

Ligation

1. Prepare the ligation mix by adding 100 ng of vector DNA, 72 ng of insert DNA (the molar ratio to Vector is 3:1), 2 μL of 10 T4 DNA ligase buffer, 0.2 μL of T4 DNA ligase, and add ddH2O to a volume of 20 μL. Mix. 2. Keep at 22  C for 10 min in the water bath.

3.14.6

Transformation

1. Add the recombinant plasmid to the TOP10 Ultracompetent cells (usually 100 μL of cells can be saturated with 1 ng of supercoiled plasmid DNA), gently mix with a pipette, and keep it on the ice for 30 min.

TNFSF15-inhibited VEGF Expression

15

2. Heat at 42  C for 45 s, then transfer the tube to the ice bath immediately, and maintain for 2–3 min. 3. Add 450 μL of LB medium without antibiotics, mix and put on the 37  C shaker, shake at 150 rpm for 45 min. 4. Take appropriate amount of transformed cells, and add to the LB solid medium, which contains the antibiotics. Spread the cells evenly with a sterile glass spreading rod. Put the plate at 37  C until the liquid was absorbed, and then invert it at 37  C for 12–16 h. 3.14.7 Identification of the Recombinant Plasmid

1. Pick five clones from the solid plates, which were cultured overnight. 2. Inoculate the clones separately in 3 mL of LB medium. Shake at 200 rpm overnight. 3. Take 1 mL of bacterial solution, individually, and send them for sequencing. Make sure that you also preserve the strain with glycerol.

3.14.8 Recombinant Plasmid Extraction

1. Pick the glycerol bacteria according to correct strain, and inoculate it in 3 mL of LB medium, shake at 200 rpm overnight at 37  C 2. After centrifugation at 12,000  g for 1 min, collect the cells and discard the filtrate. 3. Add 250 μL of Buffer S1 to suspend the bacterial pellet. 4. Add 250 μL of Buffer S2, gently and completely flip it up and down (four to six times) to mix well, until a clear solution is formed (see Note 21). 5. Add 350 μL of Buffer S3, gently and thoroughly mix it up and down (six to eight times), and centrifuge at 12,000  g for 10 min. 6. Transfer the supernatant to a preparation tube, centrifuge at 12,000  g for 1 min, and discard the filtrate. 7. Add 500 μL of Buffer W1 to the preparation tube, centrifuge at 12,000  g for 1 min, and discard the filtrate. 8. Add 700 μL of Buffer W2, centrifuge at 12,000  g for 1 min, and discard the filtrate. 9. Repeat step 8. 10. Put the preparation tube back into a 2-mL centrifuge tube and centrifuge at 12,000  g for 1 min. 11. Transfer the preparation tube into a new 1.5-mL centrifuge tube, add 60–80 μL of ddH2O to the center of the preparation tube, keep at room temperature for 1 min, and centrifuge at 12,000  g for 1 min.

16

Huanyu Zhao and Qiangzhe Zhang

3.15 Dual Luciferase Reporter Gene Assay

1. Prepare fresh FFL (2 mg/mL) and RL (35 mg/mL) reagents with Assay Buffer according to the instructions. Gently shake each reconstituted reagent until it is completely dissolved (10 min). 2. Remove medium and wash cells with PBS. 3. Add 200 μL of Lysis Buffer to cover the cells and place it on an orbital shaker. Gently shake it for 15 min at room temperature. 4. Transfer 50 μL of lysate to opaque white 96-well plates. 5. Add 100 μL of reconstituted FFL reagent to each well. 6. Measure the firefly luciferase luminescence on a luminometer. 7. Add 100 μL of reconstituted RL reagent to each well and gently tap to mix. 8. Measure renilla luciferase luminescence using luminometer.

4

Notes 1. SDS can be dissolved faster in the 37  C water bath. It is noticeable, however, that solution needs to be brought back to room temperature before adjusting pH. 2. Acrylamide/Bis solution (30%, 29:1) should be kept out of the light. Take an appropriate protection during experiments because of its neurotoxicity. It is a commercial reagent; however, making it by yourself is also feasible. Take 290 g of acrylamide, 10 g of N,N0 -methylene diacrylamide, and add 800 mL ultrapure water, heat to 37  C in the water bath and stir until dissolved. Make up to 1000 mL and filter through a 0.45-μm corning filter. pH  7, store at 4  C. Keep out of the light. 3. TEMED is a flammable, corrosive, volatile, and highly neurotoxic agent. Inhalation of large quantities is forbidden. Close the cap after use and keep out of the light. Store at 4  C. 4. Add SDS solution at the last, since it makes bubbles. Trisglycine running buffer (1) should be diluted before use. Dilute 200 mL of Tris-glycine running buffer (5) to 1000 mL with ultrapure water. 5. Do not add methanol directly to the 10 transfer buffer to avoid precipitation formation. Dilute the 10 transfer buffer before adding methanol and avoid methanol volatilization. 6. Dissolve 1 g of skim milk or BSA with 20 mL of TBST. Shaking will accelerate dissolution.

TNFSF15-inhibited VEGF Expression

17

7. Avoid contact with skin and clothing, protect eyes, and use chemical fume cupboard to avoid vapor inhalation when using TRIzol reagents. 8. 75% ethanol needs to be configured with DEPC-treated water. 9. MicroRNA can also be extracted by traditional method. 10. Carefully remove the ethanol to ensure that it does not come into contact with the RNA precipitation. Minute quantity of ethanol can be left at the bottom of the tube at this step. 11. Optimal cell concentration is 70–80% cell confluence during transfection. 12. Sodium dodecyl sulfate polyacrylamide gel is best used as soon as possible, avoiding long-term storage at 4  C. It can be stored at 4  C for no more than 1 week. 13. Avoid creating bubbles between the gel and the PVDF membrane. The bubbles can be removed gently by a glass rod. 14. Avoid touching the middle layer of protein during the extraction. 15. Ethanol must be completely removed at this step. 16. RNA should not be dried for a long time, which is detrimental to its dissolution. It is desirable to open the lid, place the centrifuge tube on a filter paper for 30 min or in the fume cupboard for 15 min. 17. If a white precipitate appears, put the tube at 75  C for 15–30 min, the precipitation will disappear. This will not affect the subsequent experiment. 18. At this point, flocculent precipitation is likely to emerge, add both the flocculent precipitate and the solution to the adsorption column. 19. According to the ratio of mass to volume 1:1 (for example, if the weight is 100 mg, the volume can be 100 μL). 20. After recovery, a small amount of sample should be taken for nucleic acid electrophoresis to check whether the recovery is successful. 21. This step should not exceed 5 min.

Acknowledgment This study was supported in part by grants from the Natural Science Foundation of China (81672747 and 31560323 to Q.Z.Z.).

18

Huanyu Zhao and Qiangzhe Zhang

References 1. Ferrara N (2009) Vascular endothelial growth factor. Arterioscler Thromb Vasc Biol 29:789–791 2. Carmeliet P, Ferreira V, Breier G et al (1996) Abnormal blood vessel development and lethality in embryos lacking a single VEGF allele. Nature 380:435–439 3. Miquerol L, Langille BL, Nagy A (2000) Embryonic development is disrupted by modest increases in vascular. Development 127:3941–3946 4. Kurtoglu E, Altunkaynak BZ, Aydin I, Ozdemir AZ, Altun G, Kokcu A (2015) Role of vascular endothelial growth factor and placental growth factor expression on placenta structure in pre-eclamptic pregnancy. J Obstet Gynaecol Res 41:1533–1540 5. Poole TJ, Finkelstein EB, Cox CM (2001) The role of FGF and VEGF in angioblast induction and migration during vascular development. Dev Dyn. 220:1–17 6. Matsumoto K, Ema M (2014) Roles of VEGFA signalling in development, regeneration, and tumours. J Biochem 156:1–10 7. Crafts TD, Jensen AR, Blocher-Smith EC, Markel TA (2015) Vascular endothelial growth factor: therapeutic possibilities and challenges for the treatment of ischemia. Cytokine 71:385–393 8. Ding BS, Nolan DJ, Butler JM et al (2010) Inductive angiocrine signals from sinusoidal endothelium are required for liver regeneration. Nature 468:310–315 9. Moreno PR, Purushothaman KR, Sirol M, Levy AP, Fuster V (2006) Neovascularization in human atherosclerosis. Circulation 113:2245–2252 10. Maruotti N, Cantatore FP, Crivellato E, Vacca A, Ribatti D (2006) Angiogenesis in

rheumatoid arthritis. Histol Histopathol 21:557–566 11. Nguyen QD, Tatlipinar S, Shah SM et al (2006) Vascular endothelial growth factor is a critical stimulus for diabetic macular edema. Am J Ophthalmol 142:961–969 12. Yano K, Liaw PC, Mullington JM et al (2006) Vascular endothelial growth factor is an important determinant of sepsis morbidity and mortality. J Exp Med 203:1447–1458 13. Carmeliet P, Jain RK (2000) Angiogenesis in cancer and other diseases. Nature 407:249–257 14. Zhai Y, Yu J, Iruela-Arispe L et al (1999) Inhibition of angiogenesis and breast cancer xenograft tumor growth by VEGI, a novel cytokine of the TNF superfamily. Int J Cancer 82:131–136 15. Yu J, Tian S, Metheny-Barlow L et al (2001) Modulation of endothelial cell growth arrest and apoptosis by vascular endothelial growth inhibitor. Circ Res 89:1161–1167 16. Chew L-J, Pan H, Yu J et al (2002) A novel secreted splice variant of vascular endothelial cell. FASEB J 16(7):742–744 17. Tian F, Liang PH, Li LY (2009) Inhibition of endothelial progenitor cell differentiation by VEGI. Blood 113:5352–5360 18. Qi JW, Qin TT, Xu LX, Li J et al (2013) TNFSF15 inhibits vasculogenesis by regulating relative levels of membrane-bound and soluble isoforms of VEGF receptor 1. Proc Natl Acad Sci USA 110:13863–13868 19. Deng W, Gu X, Lu Y et al (2012) Downmodulation of TNFSF15 in ovarian cancer by VEGF and MCP-1 is a pre-requisite for tumor neovascularization. Angiogenesis 15:71–85

Chapter 2 Sensitization of Airway Epithelial Cells to Toxin-Induced Death by TNF Superfamily Cytokines Claire Reynolds-Peterson, Dylan J. Ehrbar, Susanne M. McHale, Timothy J. LaRocca, and Nicholas J. Mantis Abstract The TNF superfamily of proinflammatory and proapoptotic cytokines influence tissue-wide responses to molecular insults such as small molecules, toxins, and viral infections that perturb cellular homeostasis at the level of DNA replication, transcription, and translation. In the context of acute lung injury, for example, TNF superfamily members like TNF-α and TRAIL can severely exacerbate disease pathophysiology. This chapter describes a systematic approach to optimization of mammalian cell viability assays and transcriptional profiling through nCounter® Technology to permit a detailed examination of how TNF-α and TRAIL modulate programmed cell death pathways in concert with ricin toxin, a ribosome-inactivating protein (RIP) and a potent inducer of acute respiratory distress. We compare two widely used luciferaseand colorimetric-based cell viability assays and provide optimization protocols for adherent and non-adherent cell lines. We provide a computational workflow to facilitate downstream analysis of datasets generated from nCounter® gene expression panels. While combined treatment with ricin toxin and TRAIL serves as the exemplar, the methodologies are applicable to any TNF superfamily member in combination with any biological agent of interest. Key words Epithelial, Toxin, TRAIL, Apoptosis, Programmed cell death, Lung

1

Introduction Understanding the extrinsic and intrinsic factors that promote programmed cell death (PCD) and other cell fate decisions is central to deciphering the molecular basis of disease. At the level of a single cell, toxin-induced intracellular damage activates intrinsic proapoptotic pathways [1, 2]. At the level of a tissue or organ, intoxication activates extrinsic proapoptotic pathways through autocrine and paracrine signaling [1–4]. Once a proapoptotic signaling threshold is exceeded (i.e., “point of no return”), a cell is committed to apoptosis. Although studying intrinsic or extrinsic proapoptotic pathways in isolation in response to a single insult can reveal important mechanisms underlying PCD, a more relevant

Jagadeesh Bayry (ed.), The TNF Superfamily: Methods and Protocols, Methods in Molecular Biology, vol. 2248, https://doi.org/10.1007/978-1-0716-1130-2_2, © Springer Science+Business Media, LLC, part of Springer Nature 2021

19

20

Claire Reynolds-Peterson et al.

scenario is one in which cells are simultaneously exposed to multiple intrinsic and/or extrinsic insults that have the potential to act additively or synergistically. As will be discussed below, nowhere is the importance of the TNF superfamily of cytokines more relevant than in the lung environment following insult by a toxic agent or viral infection, resulting in acute respiratory distress syndrome (ARDS). TNF-related apoptosis inducing ligand (TRAIL) is a driver of extrinsic apoptosis [5–7]. Although TRAIL situationally modulates the immune system and drives inflammation and apoptosis like other TNF superfamily cytokines, it alone has little to no effect on the viability of healthy cells [6, 8]. In conjunction with other extrinsic or intrinsic insults, however, TRAIL has profound effects on cell fate through modulation of caspase activation and transcriptional regulation. This sensitization phenomenon is exemplified by coadministration of TRAIL alongside inhibitors of protein translation such as cycloheximide or ricin toxin. Ricin is a Type II ribosome-inactivating protein (RIP) capable of inducing catastrophic tissue damage and inflammation [9– 11]. Inhalation is the most lethal route of exposure, due in part to ricin’s predilection for alveolar macrophages (AMs) [12, 13]. AMs are depleted from the lung within hours after toxin exposure and are thought to kick-start the cytokine storm that ultimately drives ARDS. While airway epithelial cell sloughing and widespread necrosis are hallmarks of ricin toxin exposure, in vitro cultured airway epithelial cell lines such as A549 and CaLu-3 are relatively insensitive to the toxin. However, the picture is radically different upon the addition of TRAIL or other TNF family members like TNF-α or FasL [10, 14]. We have reported that TRAIL, for example, renders Calu-3 cells >1000-fold more sensitive to the effects of ricin. Increased cell death was also accompanied by increased transcription of IL-6 and other proinflammatory cytokines. Enhanced toxicity in the dual-treated cells can then be reversed by addition of caspase inhibitors or neutralizing antibodies against TRAIL or the toxin [10, 14]. This chapter addresses optimization of a combinatorial cytotoxicity treatment protocol in the TRAIL–ricin paradigm outlined above and describes two possible viability assays with different detection methods, followed by a detailed computational workflow for processing expression data output by nCounter® transcriptional profiling. Cytotoxicity assays combine a toxic exposure protocol with a subsequent cell viability assay. For high throughput protocols, viability assays that indirectly quantify living cells through detection of metabolic activity are the most applicable. The CellTiter-Glo® (CTG) viability assay is a lytic luminescent ATP viability assay. Released ATP activates a modified luciferase reaction to produce glowing luminescence with a 5-h half-life [15]. ATP production is

Sensitization of Airway Epithelial Cells to Toxin-Induced Deat

21

directly proportional to cell number, making ATP luminescence a sensitive and dependable assay [16]. However, this method is sensitive to disruption by any treatment off-target effects influencing ATP production and metabolism, and culture conditions that reduce ATP production such as contact inhibition and serum starvation should be taken into account [17]. Additionally, full lysis of all cells in the assay plate by vigorous mixing is recommended for the most accurate result, particularly when working with high densities of adherent cells. The WST-1 colorimetric assay is another popular and convenient method of quantifying viability. The stabile tetrazolium salt WST-1 is reduced to a soluble nontoxic dye by viable cells through an NADPH-dependent mechanism [18]. This method also offers a fairly quick development step and high sensitivity, with the drawback of potentially overestimating viability. The amount of reagent applied and length of incubation prior to plate reading should be optimized for increased accuracy in this end-point assay. The commonly used MTT and XTT reduction assays work in the same manner using different tetrazolium salts. This class of viability assay is sensitive to disruption by oxidative stress, perturbations of metabolism or cellular oxidoreductase function [19], supplementation with antioxidants [20], and development in conditioned medium [21]. Both methods share a similar sensitivity to off-target effects on metabolism, and one detection method may give more accurate results than the other depending on the specific compounds used for treatment [21–23]. Transcriptional profiling provides further insight into the mechanisms underlying cell death associated with TNF superfamily cytokines and extrinsic insults. NanoString nCounter® technology is one such method of mRNA profiling that we employed to interrogate the effect of TRAIL and ricin on lung epithelial cells [10]. nCounter® transcriptional profiling is a medium throughput assay that directly captures and counts individual transcripts using a digital fluorescent barcode system. This platform requires only 25–100 ng of total RNA per sample, and the absence of reverse transcription or amplification steps allows use of low quality and degraded RNA samples [24]. A single imaging cartridge is used per sample to measure abundance of several hundred transcripts at once (the nCounter® Immunology_v2 (Human) panel used in this chapter probes 594 genes). nCounter® offers highly sensitive and reproducible transcriptional profiling. Low abundance transcripts that fall below detection limits in microarray-based assays are detected by nCounter®, and transcript profiles are highly concordant with real-time PCR results [25]. The nCounter™ XT CodeSet Gene Expression Assay is composed of a multistep process starting with a 16-h, 65
C hybridization of Reporter CodeSet, Capture ProbeSet, and sample RNA. Hybridization is followed by automated sample processing on the

22

Claire Reynolds-Peterson et al.

NanoString Prep Station, wherein magnetic bead separation is used to purify probe target complexes by removing excess probes and unbound targets. Complexes are then immobilized onto a streptavidin-coated imaging cartridge through biotinylated capture probes, followed by alignment of the reporter barcodes. The final prepared cartridge is transferred onto the NanoString Digital Analyzer instrument where an automated fluorescence microscope scans to identify reporter probe barcodes and tally digital counts of the target molecules of interest.

2

Materials

2.1 Cytotoxicity Assay (96-Well Plate)

1. Cell line of interest. Both adherent and non-adherent cells can be used, though non-adherent cells require several additional steps. This specific protocol was developed for A549 (ATCC: CCL-185, RRID:CVCL_0023) or CaLu-3 (ATCC: HTB-55, RRID:CVCL_0609) cells. The amended non-adherent cell protocol was optimized for THP-1 (ATCC: TIB-202, RRID: CVCL_0006) cells. 2. Cell line appropriate culture medium: Kaighn’s Modified Ham’s F-12 (F-12K) medium for A549 cells, Dulbecco’s Modified Eagle Medium (DMEM) for Calu-3 cells. Complete medium for both requires 10% fetal bovine serum (FBS) supplementation. 3. 75 cm2 tissue culture treated sterile culture flasks, vented (Corning). 4. Sterile PBS. 5. 0.05% Trypsin-EDTA (1) Dissociation Reagent (Gibco Life Technologies). 6. 96-well fluorescent assay plate, tissue culture treated, polystyrene, White, Flat bottom (Corning). For CellTiter-Glo® assay, clear-bottomed fluorescent microscopy plates may be used but are not preferable. The clear bottom should be obscured with opaque white tape prior to plate reading to increase signal intensity and reduce signal bleed between wells during detection. 7. 96-well tissue culture treated flat-bottom plates (Corning). Standard culture plates are appropriate for use with the WST1 viability assay. 8. Sterile 96-well plate for treatment preparation, U or V bottom (does not need to be tissue culture treated). 9. Multichannel sterile solution reservoirs (Heathrow Scientific). 10. Glass basin for decanting supernatant (8  8  2.500 borosilicate glass baking dish; Anchor, Pyrex, or similar).

Sensitization of Airway Epithelial Cells to Toxin-Induced Deat

23

11. Multichannel pipette and tips (volume range 30–300 μL). 12. Ricin toxin (Ricinus communis agglutinin II, Vector Laboratories), or another toxin of interest. 13. Recombinant human TRAIL (sTRAIL), recombinant human TNF-α (PeproTech) or other cytokines of interest. 14. Toxin or cytokine neutralizing antibodies of interest such as antihuman sTRAIL-(s)-Apo2L (R & D Systems, RRID: AB_2205069) or antihuman TNF-α neutralizing antibody (Cell Signaling Technology, RRID:AB_10925386). 15. Caspase inhibitors Z-LEHD-FMK, Z-VAD-FMK, Z-DEVDFMK, and/or Z-IETD-FMK (ApexBio). 16. CellTiter-Glo®Luminescent Cell Viability Assay (Promega). 17. SpectraMax L microplate reader (Molecular Devices, Sunnyvale) or comparable luminometer microplate reader. 18. WST-1 cell proliferation assay kit (Takara Bio). 19. Eppendorf Platereader 2200 (Eppendorf) or comparable spectrophotometer plate reader. 20. Centrifuge with plate holder inserts, for non-adherent cells only (Eppendorf 5810 or similar, refrigeration not required. Eppendorf). 2.2 NanoString Assay

1. RNA samples. 2. 96–100% ethanol. 3. nSolver Analysis Software 3.0 (NanoString Technologies). 4. nCounter Advanced Analysis Plugin for nSolver Software 1.1.4 (NanoString Technologies). 5. A computer running Windows OS (8.1 or 10) or MacOS (10.10–10.11). If using Windows OS, R and Java 1.7 or higher must be installed. If using MacOS 10.9 or later, XQuartz must be installed. 6. NanoString Prep Station (NanoString Technologies). 7. NanoString Digital Analyzer (NanoString Technologies). 8. nCounter® Human Immunology v2 Panel (NanoString Technologies). 9. MJ Research PTC-220 Thermal Cycler DNA Engine Dyad or any comparable thermal cycler.

24

3 3.1

Claire Reynolds-Peterson et al.

Methods Cell Culture

Grow A549 and Calu-3 cells at 37
C and 5% CO2 in F-12K or DMEM, respectively, passaging cells at 70–90% confluence (not exceeding a density of 7  104 cells/cm2). Medium should be replaced every 2–3 days. To Passage: 1. Remove culture medium by vacuum aspiration. 2. Wash with 5 mL of sterile PBS to remove residual serum. 3. Remove PBS. 4. Add 2.5 mL of trypsin-EDTA, incubate cells at 37
C for 7–10 min or until cells detach from the bottom of the flask. 5. Inactivate trypsin by adding 7.5 mL culture medium. 6. With a 10 mL serological pipette, draw the cell suspension gently up and down to disperse cell aggregates. 7. Reestablish culture at a ratio between 1:3 and 1:9 (2  103 to 1  104 cells/cm2).

3.2 CellTiter-Glo® Cytotoxicity Assay

Protocols described below were used to generate data presented in [10] (see Note 1).

3.2.1 Preparing CellTiter-Glo® Reagent

1. Thaw the CellTiter-Glo® (CTG) buffer while allowing the lyophilized regent to equilibrate to room temperature. 2. Dissolve the CTG lyophilized reagent in the supplied buffer. 3. Dilute the solubilized reagent mixture 1:5 in PBS. 4. Aliquot the diluted reagent in conical tubes of an appropriate volume (50 mL aliquots if performing multiple 96-well plate assays at a time). 5. Store at 20
C protected from light. 6. Return unused portion of the aliquot to 20
C after reading plates. Minimize freeze–thaw cycles. 7. Reagent is stable for several months when stored at 20
C, but decays over several days at 4
C (see Note 2).

3.2.2 CellTiter-Glo® Cytotoxicity Assay

1. Day 0: Seed A549 or Calu-3 cells at ~1.5  104 cells/cm2 (5000 cells/well) in a 96-well fluorescent assay plate in 100 μL of culture medium and return to 37
C incubator (see Note 3). 2. Day 3: (Once cells have grown to confluence) Prepare serial dilutions of toxin in a sterile 96-well dilution plate (see Fig. 1). Using ricin toxin, start from 1 μg/mL and dilute ten-fold serially across the plate (see Note 4).

Sensitization of Airway Epithelial Cells to Toxin-Induced Deat

25

Fig. 1 Basic cytotoxicity assay layout. Serial dilutions of toxin are performed from column 2 through column 12 across the plate. After each 12 μL transfer, the contents of the column should be mixed well by pipetting up and down several times with a volume of at least 50 μL. Once all dilutions have been performed, transfer contents of the dilution plate onto the assay plate row-by-row with a multichannel pipette (100 μL/well)

3. Dispose of culture medium by inverting the 96-well assay plate over a collection basin and performing a downward flick with an abrupt halt at the bottom of the motion (keeping plate horizontal). Rotate the plate 180
and repeat to ensure that medium is removed evenly from all wells (see Note 5). 4. Wash cells by adding 100 μL/well sterile PBS and repeating the decanting procedure from step 3. 5. Transfer treatment from the prepared dilution plate (80–100 μL/well) onto the assay plate and return cells to the incubator for 24 h. 6. Day 4: Remove treatment and wash twice with PBS as in step 4.

26

Claire Reynolds-Peterson et al.

7. Add complete culture medium (100 μL/well) and allow cells to recover from toxin exposure (24–72 h) (see Note 6). 8. Day 5, 6, or 7: Decant medium. 9. Add 100 μL/well standard culture medium, trying to minimize introduction of air bubbles. 10. Add an equal volume of prepared CellTiter-Glo® reagent (see Subheading 3.2.1). 11. Shake plates on an orbital mixer for 2 min to complete cell lysis. 12. Wait 10 min to allow luminescence to stabilize; protection from light is not necessary. If bubbles were introduced in steps 10 or 11, take this time to pop them using a clean pipette tip. Bubbles on the medium’s surface can interfere with luminescent detection. 13. Read plate with a luminometer (see Note 7). The protocol described above can be used in non-adherent cell types as well, with the suitable modifications and considerations (see Note 8). 3.2.3 Addition of Co-treatments to Modulate Cytotoxicity

Co-treatment with a cytotoxic agent and a modifying factor may be accomplished by either pretreating, co-treating, or both. The critical period for modifying toxicity, and the treatment duration required to observe an effect, will differ based on the compound being applied. In the case of TRAIL-induced sensitization of A549 and Calu-3 cells to ricin toxin, pretreatment and co-treatment with TRAIL are each sufficient to significantly increase ricin-induced cell death. Prior to attempting combinatorial treatment, establish a baseline for any possible independent effect of the modifying treatment on cell viability or assay detection. 1. Prepare a plate for the cytotoxicity assay as described in Subheading 3.2.2 and allow cells to reach confluence. 2. On a sterile dilution plate, prepare a tenfold dilution series using the modifying compound of interest. Start from an arbitrarily high concentration: 10 μg/mL was the starting concentration for TRAIL. 3. Remove medium from the assay plate and wash cells with 100 μL/well sterile PBS. 4. Transfer the prepared dilution series onto the cells and return to the incubator for 24 h. 5. Remove the treatment and wash twice with 100 μL/well sterile PBS. 6. Apply fresh culture medium (100 μL/well) and return to the incubator for the intended recovery period (24–72 h). 7. Detect cell viability.

Sensitization of Airway Epithelial Cells to Toxin-Induced Deat

27

Plain media Media + TRAIL [constant] Media + Ricin [variable] Media + Ricin [variable] + TRAIL [constant]

1

2

3

4

5

6

7

8

9 10 11 12

A B

D E F

Ricin Concentration

C

G H

Fig. 2 Combined treatment example plate layout. Columns 1–6 consist of a simple toxin-only treatment and include the untreated control, while columns 7–12 reproduce the same toxin treatment with addition of a modifying co-treatment: a constant concentration of TRAIL into which dilutions of toxin have been performed. This side of the plate includes the TRAIL-only control for identification of the modifying treatment’s independent effect

8. Using the results from this baseline experiment, identify a range within which the modifying treatment has little to no independent cytotoxicity or interference with the detection method. A dilution series or targeted set of concentrations within this range can be tested against a set concentration of toxin to identify an effective interacting dose. A dilution series of toxin can also be tested against a set concentration of the modifying treatment to see how the killing curve is shifted as detailed below. (a) Prepare a plate for the cytotoxicity assay as described in Subheading 3.2.2 and allow cells to reach confluence. (b) On a sterile dilution plate, mark off the plate into halves (see Fig. 2). (c) For co-treatment, on one half of the plate, perform a tenfold dilution series of the toxin alone, diluting in plain culture medium. (d) On the other half of the plate, perform a tenfold dilution series of the toxin into medium containing the modifying treatment (dose selected from the literature or a baseline killing curve. 100 ng/mL TRAIL was used for a 24-h co-treatment with ricin). (e) Remove medium and wash with 100 μL/well sterile PBS.

28

Claire Reynolds-Peterson et al.

(f) If pretreating, apply the pretreatment (if not, proceed to step (g)). The duration will require optimization, but 1–2 h is a good starting point. For pretreatment in this example, the right half of the plate received 100 μL/well of medium containing 100 ng/mL TRAIL while the left side of the plate received 100 μL/well culture medium. After removing the pretreatment, wash once with 100 μL/well sterile PBS. (g) Apply the prepared toxin treatment for 24 h. (h) Remove the treatment and wash twice with 100 μL/well sterile PBS. (i) Apply culture medium (100 μL/well) and return to the incubator for the intended recovery period (24–72 h). (j) Detect cell viability. Mechanisms of interaction can be further examined by attempting to attenuate lethality in cytokine/toxin co-treated cells using small molecule inhibitors or neutralizing antibodies. This is best attempted using a dilution series of the protective treatment beginning from an arbitrarily high dose against set concentrations of both toxin and cytokine. In the case of welldocumented substances such as Z-VAD-FMK, Z-DEVDFMK, and Z-IETD-FMK (pan-caspase, caspase-3, and caspase-8 inhibitors, respectively), a dilution curve of the protective treatment may not be necessary since effective doses have been published and can be confirmed easily by a variety of assays. Neutralizing antibodies targeting the cytokine or toxin may be pre-incubated with the combination treatment prior to use or mixed immediately before application to cells. Neutralizing antibodies that recognize targets on the cell surface may be preincubated on the cells prior to toxic exposure or mixed together with the combination treatment and applied all at once (see Note 9). 3.2.4 Data Analysis and Presentation

1. If blank (cell-free) wells were left, calculate their average value and subtract from all other readings (see Note 10). 2. For a cytotoxicity assay with combinatorial treatments: (otherwise proceed to step 9), test the normality of each treatment group (the Shapiro–Wilk test is powerful with even small sample sizes and therefore a good choice). 3. Select an appropriate statistical test to compare the untreated control with each independent treatment (for example, Control vs TRAIL only vs ZVAD only, likely a nonparametric pooled test such as Kruskal–Wallis rank test will be most appropriate. If only a single modifying treatment has been used, a

Sensitization of Airway Epithelial Cells to Toxin-Induced Deat

29

direct pair-wise comparison between the control and the modifying treatment is appropriate). 4. If there is no significant effect, proceed to step 9. If the result is significant, follow with a pair-wise test between the outlying group and the control. 5. For an independent treatment that differs significantly from the control, calculate a correction factor: (average of independent treatment)/(average of untreated control). 6. For each sample in the combined treatment group, apply the correction factor: (luminosity reading)/(independent effect correction factor). 7. A bar graph of raw luminosity readings can be presented to indicate the detection of any significant independent effect. 8. Proceed to step 9 using appropriately corrected sample readings. 9. Calculate percent viability for each sample by normalizing to the control: ((luminosity reading)/(average of control))  100. 10. Data can be presented as an X,Y scatter plot if any treatment variable followed a dilution curve, or as a bar graph if only selected concentrations were tested. 11. Viability data processed in this way shows % Survival in reference to the untreated control. 3.3 WST-1 Cytotoxicity Assay 3.3.1 Preparing WST-1 Reagent

The protocol below was used to generate data presented in [14] (see Note 11). 1. Thaw the WST-1 reagent. Warm reagent at 37
C to dissolve precipitates (see Note 12). 2. Aliquot WST-1 reagent. This will prevent multiple freeze–thaw cycles. 3. Dilute the reagent 1:10 in PBS just prior to use.

3.3.2 Basic Procedure

1. Day 0: Seed A549 cells at 12,000 cells/well in a 96-well, flatbottom, clear assay plate in 100 μL of culture medium and return to 37
C incubator. 2. Day 1: (Once cells have grown to confluence) Prepare serial dilutions of toxin in microfuge tubes. The following dilutions of ricin can be made: 0.5, 1, 2, 5, 20, and 40 ng/mL. 3. Remove culture medium using multichannel pipette and discard. Be cautious and try to prevent accidental cell scraping with pipette tips. 4. Wash cells by adding 100 μL/well sterile PBS then removing it as in step 3.

30

Claire Reynolds-Peterson et al.

5. If evaluating the effect of inhibitors, add 100 μL/well medium containing desired inhibitor and incubate at 37
C for 1 h. 6. Wash cells by adding 100 μL/well sterile PBS and repeating step 3. 7. Add 50 μL/well medium with multichannel pipette. 8. Apply toxin dilutions (50 μL/well for a final volume of 100 μL/well) and return cells to incubator for 24 h. At this point toxin will be diluted to final concentrations: 0.25, 0.5, 1, 2.5, 10, and 20 ng/mL. 9. Day 2: Remove treatment and wash with PBS as in step 4. 10. Add 100 μL/well diluted WST-1 reagent (see Subheading 3.2.1). 11. Allow plate to develop for 1 h at 37
C. 12. Read plate in spectrophotometer at an absorbance of 450 nm with a reference wavelength of 600 nm. 3.3.3 Data Analysis and Presentation

1. Subtract absorbance at the reference wavelength (600 nm) from the absorbance at 450 nm for all corresponding wells. 2. Subtract average absorbance of blank wells from each absorbance value. 3. Calculate percent viability as follows: ((sample absorbance)/ (average absorbance untreated control))  100. 4. Express the data as percent death by taking the inverse value of percent viability.

3.4 NanoString nCounter Transcriptional Profiling Computational Workflow 3.4.1 Analysis Preparation

The following method for analysis preparation and example data were drawn from [10]. See Fig. 3 for a flowchart outlining the method that follows (see Note 13).

1. Start nSolver 3.0 software. 2. Import the pertinent Reporter Library File (RLF) using the button in the top menu bar. This file is used to assign probes to specific genes and is needed to perform the Advanced Analysis. The codeset type should automatically be selected but pick the pertinent one (GX in this case) if it’s not. 3. Import Reporter Code Count (RCC) files using the button in the top menu. Each of these raw data files corresponds to a separate sample and contains counts for each gene that was measured. 4. When prompted, run Quality Control (QC) using the default options.

Sensitization of Airway Epithelial Cells to Toxin-Induced Deat

RCC files

RLF file

Perform QC

31

Import with nSolver Analysis software

Create new Study and Experiment

Add samples to experiment, noting QC flagged files

Annotate samples

Perform normalization

Determine pairwise ratios for fold-change calculation

Standard Analysis

Heatmaps

Violin Plots

Box Plots

Advanced Analysis

Scatter Plots

Histograms

Select raw data from experiment menu

Select Custom Analysis

Omit low count data

Select modules to be run in General Options

1. Overview 2. Normalization 3. Differential Expression 4. Pathway Scoring 5. Probe Descriptive

Automatically find good normalization probes

Select Predictors and Confounders for Differential Expression

Plot Pathway Scores vs variable of interest

Select probes of interest and grouping annotations in Probe Descriptive tab

Finish

Fig. 3 Flowchart for computational workflow

5. Select the option to create a new study from the Study menu, naming and describing it as desired. 6. Select the option in create a new experiment from the Experiment menu. This will open the Experiment Design Wizard, where you’ll be given the opportunity to name and describe the experiment as you wish.

32

Claire Reynolds-Peterson et al.

7. On the next screen of the Experiment Design Wizard you will see a menu of imported RCC files. Select the relevant RLF file if it isn’t already picked. You will be given options to keep or exclude RCC files from a list. Keep the RCC files corresponding to the appropriate samples for your experiment, making note of any samples with QC flags. These flags can be seen by scrolling right on the menu of RCC files, with each column corresponding to a different type of QC flag. 8. On the next screen, add annotations to the samples as required (in this example, the treatment groups corresponding to the individual RCC files) by clicking the Add Annotation button, editing the column name field, and then assigning annotations to each RCC file. Ensure that each annotation type is correctly marked as either text, numeric, or true/false (text, for this experiment). If numeric, assign a name for the unit of measure. 9. Adjust the background subtraction parameters on the next screen. Check the box for “Negative control subtraction” if not already checked. Subtract the mean of these controls plus 2 standard deviations. 10. Select and specify the normalization parameters on the subsequent screen. (a) Check the box for “Positive Control Normalization” if not already selected. Use the geometric mean of these controls for normalization. If any control lanes are flagged as beyond the 0.3–3 range, exclude them. (b) Check the box for “Codeset Content (Reference or Housekeeping) Normalization” if not already selected. The Standard option should already be picked, but if not then select it manually. All Housekeeping genes should be listed in the field on the right, while all other genes are on the left. Select any genes with 5 kbp). We will also describe a straightforward method of transient transfection and purification. In the second section, we will detail our strategy for binding assays. We used ELISAs to screen for interactions between our recombinant proteins and CS-GAGs. Positive interactions were then challenged by the addition of APRIL to tested CS-GAGs in an “inhibition assay,” which would evaluate the ability of APRIL to block CSPGs. Finally, the third section will detail our neurite outgrowth assay for the assessment of APRIL’s ability to neutralize CSPG-mediated inhibition on neurons in vitro.

Inhibition of Chondroitin Sulfate Proteoglycans by APRIL

2

45

Materials

2.1 Generation of Mouse cDNA Library

1. C57BL/6J new-born mice. 2. Dissection instruments (forceps, scalpel, microscissors). 3. 25-cm2 flasks. 4. Poly-L-lysine (Sigma Aldrich). 5. Complete DMEM medium: DMEM (Gibco), 10% FCS, 1% Lglutamine, 1% Penicillin/Streptomycin. 6. RNAeasy mini kit (Qiagen). 7. DNAse I (Thermofisher). 8. Diethyl pyrocarbonate (DEPC)-treated (nuclease-free) water. 9. Bench-top heating block. 10. Moloney Murine Leukemia Virus (MMLV) SuperScript II Reverse Transcriptase. 11. “GeneAmp PCR System 2700” (Applied Biosystems). 12. NanoDrop (Thermofisher).

2.2 Polymerase Chain Reaction (PCR)

1. “GeneAmp PCR System 2700” (Applied Biosystems) or another thermocycler. 2. 0.2-mL thin-wall PCR tubes. 3. Appropriately designed primers. 4. cDNA prepared from mouse brain (see Subheading 2.1). 5. Phusion high-fidelity and TAQ platinum polymerase kits (Thermo-Fisher). 6. 100 μM Deoxynucleotide mix (dNTP). 7. DEPC-treated water. 8. DNA ladder. 9. PCR clean-up Gel extraction kit (Macherey-Nagel). 10. Standard agarose gel electrophoresis equipment.

2.3 Molecular Cloning

1. Appropriate vector: pCRIII encoding Fc-tagged (gift from Pascal Schneider, University of Lausanne, Switzerland). 2. Appropriate restriction enzymes and their reaction buffers (see Table 1). 3. Calf Intestinal Alkaline Phosphatase (CIAP) and its buffer (Thermofisher). 4. T4 DNA ligase and its buffer (Promega). 5. Max efficiency DH5α-competent cells (Thermofisher). 6. Standard lysogeny broth (LB) medium.

46

Mashal Claude Ahmed and Bertrand Huard

Table 1 Primer designs for amplification of sequences for soluble protein production Molecule

Accession no

Primer sequences

Mouse PTPRS 1–855 aa (Gly)

Nucleotide: XM_006523881 Protein: XP_006523944

PF 50 GC GAATTC GCCACC ATGGCGCCCACCTGG AG 30 EcoR1 Kozak PR 50 CG GTCGAC GCCCTCCTCGCCGTCCAC 30 SalI

Mouse NgR1 Nucleotide: NM_022982 PF 50 GC GGATCC GCCACC ATGAAGAGGGCGTCCTCC 30 1–446 aa Protein: NP_075358 (Gly) BamH1 Kozak PR 50 CG GTCGAC ACCCTCTGCGTCCCCTG 30 SalI Mouse Slit2 1–1520 aa (Ser)

Nucleotide: AF144628 Protein: AAD44759

PF 50 GC GGATCC GCCACC ATGAGTGGCATTGGCTGG 30 BamH1 Kozak PR 50 CG GTCGAC GGAGGCACATCTCGCGC 30 SalI ^Stop codon omitted

7. Antibiotics for the selection of clones. 8. Water bath. 9. Microtube centrifuge. 10. NucleoSpin Plasmid purification kit (Macherey-Nagel). 11. GelGreen fluorescent nucleic acid dye. 12. Standard agarose gel electrophoresis equipment. 2.4 Protein Production and Validation

1. Polyethylenimine (PEI, thermofisher) as transfection agent. 2. HEK-293T cell line. 3. “D10” culture medium: DMEM, 10% fetal calf serum (FCS), 1% L-glutamine, 1% Penicillin/Streptomycin. 4. Transfection culture medium: Opti-MEM. 5. Phosphate-Buffered Saline (PBS). 6. 10-cm culture dishes. 7. Humidified incubator with regulated CO2 and temperature. 8. Amicon® Ultra Centrifugal Filters 30 kDa (Merck Millipore). 9. Protein-G-sepharose loaded column (GE Healthcare). 10. Tris-Buffered Saline (TBS). 11. Tris-HCl, pH 8. 12. Elution buffer: 0.1 M Glycine-HCl, pH 2. 13. Pierce BCA Protein Assay Kit (Thermofisher).

Inhibition of Chondroitin Sulfate Proteoglycans by APRIL

2.5

Western Blot

47

1. 10% ammonium persulfate (p/v) (APS). 2. 3 reducing loading buffer solution: 187.5 mM Tris-HCl, pH 6.8, 6% SDS, 0.03% Phenol Red, 10% glycerol, 15% β-mercaptoethanol. 3. SDS polyacrylamide gel: 12% acrylamide resolving gel preparation, 4% acrylamide stacking gel preparation. 4. 12% acrylamide resolving gel preparation: 4.5 mL water, 2.5 mL 4 resolving gel buffer, 3 mL 40% acrylamide/bis (29/1), 50 μL 10% APS, 10 μL TEMED. 5. 4% acrylamide stacking gel preparation: 2 mL water, 0.75 mL 4 stacking gel buffer, 300 μL 40% acrylamide/bis (29/1), 35 μL 10% APS, 5 μL TEMED. 6. 4 resolving gel solution: 90.85 g Tris-HCl, pH 8.8, 2 g SDS (or 10 mL of 20% SDS solution), 500 mL ultrapure water. Store at 4  C. 7. 4 stacking gel solution: 30.5 g Tris-HCl, pH 6.8, 2 g SDS (or 10 mL of 20% SDS solution), 500 mL ultrapure water. Store at 4  C. 8. Molecular-weight ladders. 9. 10 SDS-PAGE running buffer: 30.3 g Tris-HCl, pH at 8.6, 144 g glycine, 10 g SDS (or 50 mL 20% SDS), 1 L water. Store at room temperature. 10. Commercial silver staining or coomassie blue staining kits. 11. 10 protein transfer buffer: 60.6 g Tris-base, 30.9 g boric acid, 1 L water. Store at room temperature. 12. PVDF membrane (Bio-Rad). 13. Donkey antihuman IgG conjugated to HRP (Jackson Immuno). 14. Blocking buffer: PBS, 5% Bovine serum albumin (BSA). 15. PBS, 0.1% Tween 20. 16. Clarity western ECL substrate (Bio-Rad). 17. ChemiDocTM acquisition.

2.6 Biotinylation of CS-GAGs

(Bio-Rad)

for

chemiluminescent

signal

1. Solubilized preparation of chondroitin sulfate glycosaminoglycans (CS-GAGs) (Sigma, for example Chondroitin sulfate A sodium salt from bovine trachea). 2. 0.1 M 2-[morpholino]ethanesulfonic acid (MES) buffer (Sigma). 3. 50 mM biotin hydrazide (Pierce). 4. Dimethyl sulfoxide (DMSO). 5. 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide.

48

2.7

Mashal Claude Ahmed and Bertrand Huard

ELISA

1. Chondroitin sulfate glycosaminoglycans (CS-GAGS, Sigma), biotinylated using biotin hydrazide and 1-Ethyl-3-(3-dimethylaminopropylcarbodiimide) (EDC) as the crosslinker. 2. Maxisorb 96-well plates (Nunc). 3. Blocking solution: PBS, 1% BSA. 4. PBS, 0.05% Tween 20. 5. Recombinant Fc-fused APRIL (blocking agent). 6. Recombinant Fc-fused Thy1 (mock control). 7. Streptavidin-HRP (Thermofisher). 8. Substrate: 3,30 ,5,50 Bioscience).

tetramethylbenzidine

(TMB,

BD

9. Stop solution: 2 N sulfuric acid. 10. Victor3 1420 Multilabel Counter (PerkinElmer) for spectrophotometric analysis. 2.8 Neurite Outgrowth Assay

1. E17 prenatal mouse cortices. 2. Dissection instruments (forceps, scalpel, microscissors). 3. Dissection microscope. 4. Horizontal laminar flow hood. 5. 12-mm coverslips. 6. 24-well plates. 7. Hanks’ balanced salt solution (HBSS). 8. Trypsin. 9. Glial culture medium: DMEM, 10% horse serum. 10. Neuron culture medium: MACS Neuro Medium (Mylteniy Biotec), B27 1/50, GlutaMAX 1/100. 11. Fixing solution: PBS, 4% PFA, 4% sucrose. 12. Permeabilization solution: PBS, 0.2% Triton. 13. Blocking buffer: PBS, 1% BSA. 14. β-tubulin III antibody (clone Tuj1, R&D Systems). 15. Goat antimouse IgG2A-FITC (Thermofisher). 16. Fluoroshield™ with DAPI histology mounting medium. 17. Axio Imager M2 microscope (Carl Zeiss) with a plan-neofluar 10/0.75 objective and AxioCam MRc camera. 18. ImageJ with the NeuronJ plugin.

Inhibition of Chondroitin Sulfate Proteoglycans by APRIL

3

49

Methods

3.1 Production and Purification of Recombinant Fc-Fused Candidate Proteins

PTPRS, NgR1, and Slit2 were the candidate proteins chosen for our investigation. Here, we describe the methods for the construction of expression plasmids coding for soluble candidate proteins, and their subsequent use in protein production by transient transfection. An Fc-fused pCRIII plasmid was used as the vector.

3.1.1 Generation of Mouse Brain cDNA Library

1. Establish primary mixed murine glial cultures from cortices of C57BL/6J new-born mice. Following standard procedures, carefully separate cortices from meninges, chop into small sections, and dissociate by mild trypsinization and mechanical disruption before seeding. 2. Seed the cells onto poly-L-lysine (10 μg/mL)-coated 25-cm2 flasks at the density of 5  105 cells/cm2 in complete DMEM medium. Change the medium every 3 days. 3. Extract total RNA using the RNAeasy mini kit following the manufacturer’s instructions. Treat the extracted RNA with DNAse I to eliminate genomic DNA, then quantify and check for quality by NanoDrop and agarose gel electrophoresis. 4. To convert the extracted RNA into cDNA, use the Moloney Murine Leukemia Virus (MMLV) SuperScript II Reverse Transcriptase kit: (a) Denature the RNA preparation by incubating for 5 min at 65  C. (b) Put the solution on ice for 5 min, then incubate at 42  C for 50 min with the reverse transcriptase. Stop the reaction by incubating for 15 min at 70  C.

3.1.2 Polymerase Chain Reaction (PCR)

1. Primers should be designed with the appropriate restriction sites, and a Kozak sequence for forward primers as illustrated in Table 1. Generally, primers can be 20–30 nucleotides in length. Here, we designed primers for the extracellular domains of the membrane-bound proteins NgR1 and PTPRS, and for the whole coding sequence of Slit2, a secreted protein. It is important to omit the stop codon from the primer sequence as it is present at the end of Fc-coding sequence in the plasmid, which will be downstream of the insertion site of a cloned sequence. 2. For the PCR reaction, follow the instructions of the manufacturer and apply 35 cycles. However, certain conditions will vary depending on the DNA sequence to be amplified, as illustrated in Table 2. Indeed, finding the ideal conditions can involve a process of trial and error, and especially difficult for very long sequences (see Note 1).

50

Mashal Claude Ahmed and Bertrand Huard

Table 2 Specific PCR conditions and reagents for the amplification of nucleotide sequences Molecule

Template and primer

Polymerase

Additive

Mouse PTPRS Initial: 1–855 aa (Gly) 98  C for 2 min Cyclic: 98  C for 10 s 65  C for 30 s 72  C for 3 min

4 ng/μL of mouse brain cDNA 0.2 μM for each primer

Phusion high fidelity

4% DMSO

Mouse NgR1 Initial: 1–446 aa (Gly) 94  C for 3 min Cyclic: 94  C for 30 s 60  C for 30 s 68  C for 2 min

4 ng/μL of mouse brain cDNA 0.5 μM for each primer

Taq platinum

–

Initial:98  C for 40 s 4 ng/μL of mouse brain cDNA Cyclic: 0.5 μM for each primer 98  C for 12 s 65  C for 30 s 72  C for 3 min

Phusion high fidelity

4% DMSO

Mouse Slit2 1–1520 aa (Ser)

PCR conditions

3. Following a PCR reaction, analyze 5 μL of the amplification product by agarose gel electrophoresis against a DNA ladder. 4. Purify the rest of the amplification product using a PCR cleanup Gel extraction kit. 3.1.3 Molecular Cloning

Standard cloning procedures will apply for the insertion of the amplicon into an expression vector. 1. Purify the amplicon using a “NucleoSpin Plasmid” purification kit. Note that with each purification step, a percentage of the product will be lost (around 20%); it would therefore be important to have prepare an excess of the amplicon for the following steps. 2. Digest the purified amplicon with the appropriate restriction enzymes and purify the product by gel extraction (“NucleoSpin Plasmid” purification kit). Proceed directly to ligation with the prepared vector (or else store the prepared insert at 4  C for use within one day or at 20  C). Avoid freezing and thawing this preparation. 3. Digest the vector with the appropriate restriction enzymes and purify the product by gel extraction. Dephosphorylate the product using Calf Intestinal Alkaline Phosphatase (CIAP) following the manufacturer’s instructions. Purify the product. 4. Ligate using T4 DNA ligase enzyme following the manufacturer’s instructions (see Note 2). The ligated product can be stored at 20  C.

Inhibition of Chondroitin Sulfate Proteoglycans by APRIL

51

5. For transformation, use Max efficiency DH5α competent cells following the manufacturer’s instructions (see Note 3). Culture single bacterial colonies overnight in LB medium (containing the appropriate antibiotic for selection) and perform a plasmid extraction using the “NucleoSpin Plasmid” purification kit, following the protocol supplied. 6. Quantify purified DNA by Nano-drop and then verify the insert by double digestion with appropriate restriction enzymes followed by analysis on an agarose gel. 7. Check the nucleotide sequence of the cloned amplicon for errors introduced by the DNA polymerase. For this, Sanger sequencing services such as those of Eurofins Genomics are suitable. 3.1.4 Mutation or Demutation by Double PCR

If a single nucleotide was mutated during the cloning process, resulting in a code for a different amino acid, it is possible to perform a “demutation” by double PCR to correct the error, rather than repeating the cloning from cDNA. The same principle can be used to introduce a mutation instead. The process relies on the fact that DNA polymerases use primers if about 15 nucleotides on the 30 end on the primer anneal perfectly to the template, but the 50 end can be altered to differ from the template (the same principle allows for the introduction of restriction sites to the flanks of an amplified sequence). Two pairs of primers can be designed to amplify two “halves” of the sequence, where the mutation point is at the 30 end of one fragment, and at the 50 end of the other fragment (see Fig. 1). The mutation-bearing extremities of both fragments must be identical to each other over about 15 nucleotides. After these fragments are created (using primers that corrected for the mutation), they can be mixed together and submitted through a few PCR cycles. The fragments will anneal by way of the overlapping region around the mutation site, and a full DNA sequence will be created by the action of the polymerase. This product can then be amplified using primers designed for its extremities. 1. Identify the cDNA sequence of interest and generate a sequence with the point mutation of interest using the genetic code. 2. Design the 30 sequence of the forward mutagenic oligonucleotide. Start at the mutation and include 15 nucleotides on the right (30 ). If the sequence ends with A or T, and if next nucleotide is C or G, extend for one more nucleotide. 3. Use strand + of the mutated cDNA to design the 30 sequence of the reverse mutagenic oligonucleotide. Start at the mutation and include 15 nucleotides on the left (or 16 if this helps ending with a C or G).

52

Mashal Claude Ahmed and Bertrand Huard

Fig. 1 Mutation/demutation by double PCR. (a) Principle of mutation/demutation by double PCR. (b) Specifications for the design of mutagenic oligonucleotides. (c) Details of mutagenic oligonucleotide design with the example of FasL cDNA. (d) Sequence of mutagenic oligonucleotides to generate the Y218R mutation in FasL

4. Extend the forward mutagenic oligonucleotide on the left by 6 to 8 nucleotides and extend the reverse mutagenic oligonucleotide on the right by 6 to 8 nucleotides until the overlap between both oligos is exactly 15 nucleotides. If possible, have a C or G at the 50 ends. 5. Perform two separate PCRs to amplify the two fragments (called products A and B) (see Subheading 3.1.2). Purify the amplicons (PCR products A and B) by gel extraction. 6. In PCR tubes, prepare mix 1: 5 μL PCR product A. 5 μL PCR product B. 8 μL 5 PCR buffer. 5 μL each dNTP 2 mM. 15.5 μL H2O. 0.5 μL DNA polymerase (add last). 7. In a separate tube, prepare the reaction mix 2 (multiply volumes by the number of tubes containing mix 1): 5 μL 10 μM Forward oligonucleotide. 5 μL 10 μM Reverse oligonucleotides. 2 μL 5 PCR buffer.

Inhibition of Chondroitin Sulfate Proteoglycans by APRIL

53

8. For the tubes containing mix 1, run the PCR program: Step 1: 3 min at 95  C (denaturation). Step 2: 30 s at 94  C (denaturation). Step 3: 1 min at 52  C (annealing). Step 4: 1 min at 72  C (extension). Step 5: cycle to step 2, 2 times. Step 6: 5 min at 72  C. Step 7: 5 min at 45  C (during this step, add reaction mix 2; 12 μL per tube). Step 8: 30 s at 98  C. Step 9: 30 s at 55  C. Step 10: 1 min at 72  C. Step 11: cycle to step 8, 25 times. Step 12: 5 min at 72  C. Step 13: hold at 10  C. 9. Purify the product. It is ready for analysis and subsequent cloning. 3.1.5 Transient Transfection of HEK293T Cells

1. Culture HEK293T cells in 10-cm dishes in D10 medium at 37  C using a humified incubator with 5% CO2. Cultures should be at approximately 60–70% confluency on the day of transfection. 2. Gently wash the cells with 1 PBS once, and add 5 mL of a serum-free culture medium, Opti-MEM. Return the dishes to the incubator while the PEI mix is prepared. 3. Prepare the transfection mix: for each 10 cm culture dish, prepare a 2-mL Eppendorf tube with a 500-μL solution of Opti-MEM containing 15 μg of the expression plasmid, and 30 μg of PEI (1:2 ratio of DNA/PEI by mass). Mix gently by inversion, spin down, and incubate at room temperature for 15 min. 4. Gently, drop by drop, pipette the transfection mix over the HEK293T cells. Mix gently by swirling, and return the cells to the incubator for 6 h. 5. After no longer than 6 h (PEI is toxic), gently aspirate the medium, and wash the cells once with PBS. Add 10 mL of Opti-MEM and incubate for approximately 5 days (see Note 4). 6. Collect the culture supernatant and discard the dishes. Centrifuge the supernatant at 340  g for 4 min and discard the pellet (cells and debris). The supernatant can be stored at 20  C.

54

Mashal Claude Ahmed and Bertrand Huard

7. Concentrate the collected supernatants using Amicon® Ultra Centrifugal Filters with appropriate cutoffs, by centrifuging at 3200  g for 5–10 min. The concentrated product is retained by the filter in the upper compartment, and adjust its volume as desired by adding PBS. 3.1.6 Purification and Validation of Recombinant Proteins

Purify the Fc-fused recombinant protein from the supernatant using a protein-G-sepharose loaded column by affinity chromatography. 1. Wash the gel-loaded column with 3 volumes of elution buffer (Glycine-HCl, pH 2). Do not let the gel remain in acidic pH longer than 20 min. Immediately equilibrate the column with TBS. Do not let the column dry at any time. 2. Allow the column to drain, then pass the supernatant through the column twice to maximize binding. 3. Pass 10 volumes of TBS to wash the column of nonspecifically bound proteins. A vacuum pump set at low power (40–60 mbar) can be used to speed up the washing step. 4. Meanwhile, prepare 9 glass tubes containing an appropriate amount of Tris-HCl, pH 8, to neutralize 1 mL of elution buffer. 5. Elute the recombinant protein using 6 mL of elution buffer, collecting the flow through in fractions of 1 mL in the glass tubes. Do not leave the column with an acidic pH for longer than 20 min. 6. Immediately equilibrate the column with TBS. 7. Dialyze the purified product in PBS. This can be done by using the Amicon® Ultra Centrifugal Filters. Wash the product with sequential 10 mL volumes of PBS (3 washes will suffice), and concentrate to a desired volume. 8. Quickly quantify the product using a Pierce BCA Protein Assay Kit following the manufacturer’s instructions. 9. Additionally, validate the quality of the preparation and the presence of the recombinant protein by standard SDS polyacrylamide gel (SDS-PAGE) and Western blot. 10. Denature samples in 1 reducing loading buffer solution by incubating at 95  C for 10 min, then place the samples in ice. 11. Migrate products and molecular-weight ladders in reducing conditions on a standard SDS-PAGE. 12. Visualize the resolved proteins with a standard, commercial silver staining (sensitivity of about 0.5 ng) or coomassie blue staining (sensitivity of about 500 ng) kits.

Inhibition of Chondroitin Sulfate Proteoglycans by APRIL

55

13. For Western blot, transfer proteins to a PVDF membrane. Perform a blocking step with PBS, 0.3% Tween 20, 5% BSA at room temperature for 1 h. Incubate membrane at 4  C overnight in donkey α-human IgG-HRP (1.5 μg/mL) diluted in blocking buffer. Wash 3 times with PBS-0.1%Tween 20. Perform revelation with the clarity western ECL substrate and acquire the chemiluminescent signal with an imaging station, for example, the ChemiDocTM. 3.2 Binding and Inhibition Assays

3.2.1 Biotinylation of CSGAGs

The purpose of this section is to detail a method to screen for interactions between CS-GAGs and their potential protein partners, and the necessary protocol modifications to evaluate the inhibition of any positive interactions by a blocking agent. 1. Dissolve 5 mg of solubilized CS-GAG in 1 mL of 0.1 M MES, pH 5.5. 2. Mix with 25 μL of 50 mM biotin hydrazide in DMSO. 3. To this mixture, add 25 μL of 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (to get 100 mg/mL in 0.1 M MES, pH 5.5), and incubate the solution overnight at room temperature with rotation. 4. Dialyze the solution against PBS, pH 7 (for example at 4  C for 36 h, or similar). Products can be stored at 20  C.

3.2.2 ELISA

1. Coat wells of a Maxisorb 96-well plate with 50 μL of purified Fc-fused recombinant protein at 10 μg/mL and leave overnight at 4  C. Coat an appropriate control Fc-fused molecule prepared in a similar manner for a suitable non-CS-binding negative control. Wash 3 times with PBS Tween 0.05%. 2. Add the blocking solution (PBS-1% BSA) and incubate for 1 h at room temperature. 3. For the screening purpose, follow the following steps of addition of CS-GAGs. 4. Add 50 μL of biotinylated CS-GAGs at 1–50 μg/mL in PBS and incubate for 1 h at room temperature (see Note 5). Wash 3 time with PBS-0.05% Tween. 5. Add 50 μL of streptavidin-HRP at the dilution indicated on the bottle, incubate for 40 min at room temperature. Wash 5 ties with PBS-0.05% Tween. 6. Add the TMB substrate and incubate until the solution turns blue (5–15 min). Do not wait for the negative control to turn blue before stopping the reaction.

56

Mashal Claude Ahmed and Bertrand Huard

7. Stop the reaction with 50 μL of 2 N sulfuric acid. The plate is ready for spectrometric measurements at 480 nm using Victor3 1420 Multilabel Counter. Positive interactions are determined based on the strength of the absorbance signal, corrected using (subtracted by) the negative control. 8. Upon detection of positive interactions, this protocol (steps 3– 7 in Subheading 3.2.2) can be modified into an “inhibition assay” designed to evaluate a blocking agent. Replace step 4 with steps 5 and 6 in Subheading 3.2.2. 9. For the blocking purpose, follow the following steps of addition of CS-GAGs. 10. During the blocking step, preincubate biotinylated CS-GAGs with APRIL for a minimum of 40 min at room temperature (various concentrations of the blocking agent should be tested). Preincubation with an equivalent molar concentration of Thy1-Fc can serve as a suitable negative control. 11. Add 50 μL of “blocked” CS-GAGs to coated wells and incubate for 1 h at room temperature. 12. Wash 3 times with PBS-0.05%Tween. 3.3 Neurite Outgrowth Assay

1. Prior to dissection, prepare culture plates as follows. Place sterilized 12-mm glass coverslips into a 24-well plate, and add 100 μg/mL of poly-L-lysine so that it covers the coverslip. Incubate at room temperature overnight (under the hood is suitable), or for 1–2 h at 37  C. Wash the coverslips thoroughly with sterile water three times. 2. Add a solution of CS-GAGs (1–10 μg/mL in PBS) to the coverslips, and incubate overnight at 4  C. Wash once with PBS. 3. Add the solution containing the blocking agent (APRIL). Incubate for 1 h at room temperature. Replace the solution with glial culture medium and proceed directly to cell seeding. 4. Using sterile dissection instruments, carefully dissect cortices of C57BL/6J new-born mice under a horizontal laminar flow hood with the help of a dissection microscope. Following typical dissection procedures, cortices must be carefully freed of meninges before being digested in 0.25% trypsin in HBSS at 37  C for 15 min. Mix gently every 5 min. 5. Aspirate and wash 3 times with HBSS. Resuspend in 500 μL of glial culture medium (this medium contains serum, which will promote cell attachment following seeding). 6. Mechanically dissociate the tissue by gentle up-and-down pipetting first with a P1000 (about 10–15 times), then again with a P200 cone fitted onto the P1000 cone.

Inhibition of Chondroitin Sulfate Proteoglycans by APRIL

57

7. Seed the cells onto PLL-coated coverslips in a 24-well plate and incubate for 2 h at 37  C using a humified incubator with 5% CO2. 8. Replace the medium with neuron culture medium (this medium lacks serum, preventing the proliferation of glial cells). Incubate at 37  C for 3 days. 9. Aspirate the medium and add fixing solution. Incubate at 37  C for 30 min. 10. Wash the coverslips with PBS 3 times. 11. Permeabilize the cells with PBS, Triton 0.2% for 5 min at room temperature. Wash twice. 12. Add the primary antibody (β-tubulin III antibody clone Tuj1 at 8 μg/mL specific for neurons) in blocking solution and incubate at room temperature for 3 h (see Note 6). Wash twice. 13. Add the secondary antibody (Goat antimouse IgG2A-FITC, 8 μg/mL) in blocking solution and incubate in the dark at room temperature for 1 h. Wash three times. 14. Mount the coverslips onto glass slides with Fluoroshield™ DAPI histology mounting medium and proceed to epifluorescence imaging. 15. Acquire photos of neurons at a magnification of 10 or 20 and proceed to analysis using the NeuronJ plugin in the ImageJ software (see Note 7).

4

Notes 1. The outcomes of PCRs are dependent on a multitude of variables. Further complicating the process is that the ideal set of variables will differ with the sequence to be amplified, owing for example to the length of the target sequence, or the richness of GC nucleotides in it; these variables apply to the primers used as well. Some examples of important parameters are listed in Table 2. For the purposes of this chapter, we list a few handy general rules for amplifying a complicated sequence from a cDNA library: (a) The polymerase matters. We found that high-fidelity polymerases such as Phusion high-fidelity polymerase from Thermofisher are more reliable when amplifying long sequences of DNA (>3 kbp) and will make fewer errors. We found not more than 1 error for 5 kpb amplified. In our experience, this polymerase performs better for very long sequences if DMSO is added and mixed into the reaction solution immediately before the reaction

58

Mashal Claude Ahmed and Bertrand Huard

(optimal concentration may vary). Taq Platinum is reliable for lower-length sequences to be amplified but is prone to introducing errors in the final product (1 error for about 1 kbp amplified). It is a suitable option for screening. (b) Two of the most common problems with PCR is the production of nonspecific products or getting no product at all. As a general rule, we found that adjusting the annealing temperature is often sufficient to fix both of these issues, which are often the result of falling either too short or too far off the optimal temperature for hybridization. Increase the annealing temperature to eliminate nonspecific products or reduce it if there was no product (adjusting by increments of 5  C is sufficient). (c) GC-nucleotide richness of the target or primers can also be obstacles to amplification. In the case of PTPRS, which has a GC-rich DNA sequence, we obtained primer dimers instead of the desired product. To overcome this, we increased the initial denaturation time, and adjusted primer-template concentration ratios to favor correct template-primer hybridization (see Table 2). DMSO weakens hydrogen bonds between G or C base pairs to improve amplification of GC-rich sequences. 2. The ligation step with the T4 DNA ligase enzyme should be performed overnight in ice left to melt at room temperature (the gradually changing temperature guarantees an optimal reaction). The ideal molar concentrations of the insert and vector can differ depending on their relative lengths. Generally, a vector to insert molar ratio of 1:3 is suitable, though for long (>5 kbp) inserts a ratio of 1:1 can provide better results. 3. Max efficiency DH5α-competent cells were used for transformation; however, we found that Subcloning Efficiency™ DH5α cells are also suitable. In either case, we strongly recommend not using S.O.C. medium for the final steps; we found a significant number of false-positive bacterial colonies, and poor transformation efficiency using this medium. Use LB medium instead. 4. The 5-day incubation is a general rule. The viability of transiently transfected cells may deteriorate more rapidly due to factors such as confluency, or the toxicity of the produced molecule. In the case where cell viability has deteriorated to the point of detachment of the monolayer, it is better to collect the supernatant before the 5-day incubation is complete. Cell death is accompanied by the release of proteases that may degrade the desired product.

Inhibition of Chondroitin Sulfate Proteoglycans by APRIL

59

5. Polysaccharides like CS-GAGs have a poor affinity for plastic; it is for this reason we coat the candidate protein as bait and add the CS-GAG as prey for our ELISA protocols. If it is desired that the CS-GAGs be coated instead, the plastic can be coated with streptavidin prior to the addition of biotinylated CS-GAGs. In this case, binding of Fc-fused proteins to the polysaccharide coat should be revealed with an anti-Fc antibody (or similar). 6. The neuron-specific antibody presented in this protocol is not adequate for the analysis of specific neuron types, nor neurite types (for example, axons only). TUJ1 (an anti-beta-tubulin III antibody) will stain all neurons, and all their neurites. Dissociated cortical tissue will contain several neuron types with various neurite morphologies; it is for this reason we measure total neurite length. If it is desired to measure, for example, axonal length specifically, we recommend either using specific antibodies (e.g., MAP2 for dendrites, or Tau for axons), or using hippocampal tissue, which primarily comprises pyramidal neurons with easily distinguishable axons and dendrites by morphology. 7. The analysis of neurite lengths requires that neurons grow separate from each other to avoid overlapping processes. A few key steps are important to optimize the culture for this: Firstly, the number of cells seeded onto a well should be calibrated to have neurons that are not too close together nor too far apart (a seeding concentration that is too high will lead to overlapping neurites, and too low will hinder culture growth and viability). Test a range of seeding concentrations to find the optimal set up. It is equally important that the dissociation step before the seeding is performed correctly (too much mechanical dissociation can damage neurons, but too little will cause cellular clumps and poor spacing between cells). Check the dissociated cells under a microscope before seeding and continue to dissociate them if clumps are visible. Note that cell aggregation can also occur depending on the treatment of the coverslip prior to the seeding: CS-GAGs are negatively charged molecules, and higher concentrations will impede neuron attachment to the CS-coated substrate, as these cells prefer positively charged surfaces for attachment.

Acknowledgments We thank Pascal Schneider (University of Lausanne) for sharing his protocol for mutation/demutation of plasmids, and Leticia Peris (Grenoble Institute of Neurosciences) for sharing her expertise for the culture of neurons.

60

Mashal Claude Ahmed and Bertrand Huard

References 1. Cui H, Freeman C, Jacobson GA, Small DH (2013) Proteoglycans in the central nervous system: role in development, neural repair, and Alzheimer’s disease. IUBMB Life 65:108–120 2. Galtrey CM, Fawcett JW (2007) The role of chondroitin sulfate proteoglycans in regeneration and plasticity in the central nervous system. Brain Res Rev 54:1–18 3. Snow DM, Lemmon V, Carrino DA, Caplan AI, Silver J (1990) Sulfated proteoglycans in astroglial barriers inhibit neurite outgrowth in vitro. Exp Neurol 109:111–130 4. Siebert JR, Conta Steencken A, Osterhout DJ (2014) Chondroitin sulfate proteoglycans in the nervous system: inhibitors to repair. Biomed Res Int 2014:1–15 5. Lau LW, Keough MB, Haylock-Jacobs S, Cua R, Do¨ring A, Sloka S et al (2012) Chondroitin sulfate proteoglycans in demyelinated lesions impair remyelination. Ann Neurol 72:419–432 6. Sun Y, Deng Y, Xiao M, Hu L, Li Z, Chen C (2017) Chondroitin sulfate proteoglycans inhibit the migration and differentiation of oligodendrocyte precursor cells and its counteractive interaction with laminin. Int J Mol Med 40:1657–1668 7. DeWitt DA, Richey PL, Praprotnik D, Silver J, Perry G (1994) Chondroitin sulfate proteoglycans are a common component of neuronal inclusions and astrocytic reaction in neurodegenerative diseases. Brain Res 656:205–209 8. Sobel RA, Ahmed AS (2001) White matter extracellular matrix chondroitin sulfate/dermatan sulfate proteoglycans in multiple sclerosis. J Neuropathol Exp Neurol 60:1198–1207 9. DeWitt DA, Silver J, Canning DR, Perry G (1993) Chondroitin sulfate proteoglycans are associated with the lesions of Alzheimer’s disease. Exp Neurol 121:149–152 10. Miller GM, Hsieh-Wilson LC (2015) Sugardependent modulation of neuronal development, regeneration, and plasticity by chondroitin sulfate proteoglycans. Exp Neurol 274:115–125 11. Li H-P, Komuta Y, Kimura-Kuroda J, van Kuppevelt TH, Kawano H (2013) Roles of chondroitin sulfate and dermatan sulfate in the formation of a lesion scar and axonal regeneration after traumatic injury of the mouse brain. J Neurotrauma 30:413–425 12. Swarup VP, Mencio CP, Hlady V, Kuberan B (2013) Sugar glues for broken neurons. Biomol Concepts 4:233–257

13. Hayes A, Sugahara K, Farrugia B, Whitelock JM, Caterson B, Melrose J (2018) Biodiversity of CS-proteoglycan sulphation motifs: chemical messenger recognition modules with roles in information transfer, control of cellular behaviour and tissue morphogenesis. Biochem J 475:587–620 14. Smith PD, Coulson-Thomas VJ, Foscarin S, Kwok JCF, Fawcett JW (2015) “GAG-ing with the neuron”: the role of glycosaminoglycan patterning in the central nervous system. Exp Neurol 274:100–114 15. Moon LDF, Asher RA, Rhodes KE, Fawcett JW (2001) Regeneration of CNS axons back to their target following treatment of adult rat brain with chondroitinase ABC. Nat Neurosci 4:465–466 16. Ohtake Y, Li S (2015) Receptors of chondroitin sulfate proteoglycans and CNS repair. Austin J Neurol Disord Epilepsy 2:1010–1011 17. Zhang X, Wang B, Li JP (2014) Implications of heparan sulfate and heparanase in neuroinflammation. Matrix Biol 35:174–181 18. Karus M, Ulc A, Ehrlich M, Czopka T, Hennen E, Fischer J et al (2016) Regulation of oligodendrocyte precursor maintenance by chondroitin sulphate glycosaminoglycans. Glia 64:270–286 19. Pendleton JC, Shamblott MJ, Gary DS, Belegu V, Hurtado A, Malone ML, McDonald JW (2013) Chondroitin sulfate proteoglycans inhibit oligodendrocyte myelination through PTPσ. Exp Neurol 247:113–121 20. Alizadeh A, Karimi-Abdolrezaee S (2016) Microenvironmental regulation of oligodendrocyte replacement and remyelination in spinal cord injury. J Physiol 594:3539–3552 21. Dy S, Kataria H, Alizadeh A, Santhosh KT, Lang B, Silver J, Karimi-Abdolrezaee S (2018) Perturbing chondroitin sulfate proteoglycan signaling through LAR and PTPσ receptors promotes a beneficial inflammatory response following spinal cord injury. J Neuroinflammation 15:90 22. Luo F, Tran P, Xin L, Sanapala C, Lang BT, Silver J, Yang Y (2018) Modulation of proteoglycan receptor PTPσ enhances MMP-2 activity to promote recovery from multiple sclerosis. Nat Commun 9:4126 23. Shen Y, Tenney AP, Busch SA, Horn KP, Cuascut FX, Liu K et al (2009) PTPsigma is a receptor for chondroitin sulfate proteoglycan, an inhibitor of neural regeneration. Science 326 (5952):592–596. https://doi.org/10.1126/ science.1178310

Inhibition of Chondroitin Sulfate Proteoglycans by APRIL 24. Dickendesher TL, Baldwin KT, Mironova YA, Koriyama Y, Raiker SJ, Askew KL et al (2012) NgR1 and NgR3 are receptors for chondroitin sulfate proteoglycans. Nat Neurosci 15:703–712 25. Nguyen-Ba-Charvet KT, Brose K, Ma L, Wang KH, Marillat V, Sotelo C et al (2001) Diversity and specificity of actions of Slit2 proteolytic fragments in axon guidance. J Neurosci 21:4281–4289

61

26. Liu X, Lu Y, Zhang Y, Li Y, Zhou J, Yuan Y et al (2012) Slit2 regulates the dispersal of oligodendrocyte precursor cells via Fyn/RhoA signaling. J Biol Chem 287:17503–17516 27. Baert L, Benkhoucha M, Popa N, Ahmed MC, Manfroi B, Boutonnat J et al (2019) APRILmediated anti-inflammatory response of astrocytes in multiple sclerosis. Ann Neurol 85:406–420

Chapter 4 Induction of Antigen-Independent Proliferation of Regulatory T-Cells by TNF Superfamily Ligands OX40L and GITRL Prabhakaran Kumar, Zarema H. Arbieva, Mark Maienschein-Cline, Balaji B. Ganesh, Suresh Ramasamy, and Bellur S. Prabhakar Abstract TNF receptor superfamily comprises many T-cell costimulatory receptors, including TNFRSF1, TNFRSF2, TNFRSF4 (OX40), TNFRSF9 (4-1BB), TNFRSF18 (GITR), and TNFRSF7 (CD27). Signaling through these costimulatory stimulatory receptors can promote conventional T-cell (Tconv) proliferation, and effector functions in an antigen-dependent manner. Thus, agonistic antibodies and ligands for OX40, 4-1BB, GITR, and CD27 have been tested for inducing T-cell-mediated antitumor responses in several cancers. However, recently emerging reports show critical role for TNFR signaling in regulatory T-cell (Treg) differentiation and expansion, which might suppress effector T-cell proliferation and functions. Here, we show preferential over expression of TNFR2, OX40, 4-1BB, and GITR in Treg cells over Tconv cells, and the ability of OX40L and GITRL to induce selective proliferation of Treg cells, but not Tconv cells, in an antigen-independent manner. We describe the standard protocols used for Affymetrix gene expression profiling, T-cell isolation, and Cell Trace Violet-based cell proliferation assay. Key words Tregs, TNF-α, 4-1BBL, OX40L, GITRL, Cell proliferation

1

Introduction TNF superfamily comprises 30 receptors and 19 ligands (Table 1) that regulate cellular processes such as cell differentiation, survival, or proliferation depending on the signaling context. Based on their cytosolic signaling domains, they can be classified into three subtypes: (1) Death receptors containing death domains—e.g., DR3, DR6, TNFRI; (2) TRAF-interacting receptors—e.g., TNFRII, GITR, OX40, 41BB, CD30, LTbR, CD40; (3) Decoy receptors lacking the cytosolic domain- TRAILR3, TRAILR4, DcR3 [1]. Among these, TRAF-interacting receptors like 41BB TNFRII, OX40, and GITR function as potent T-cell costimulatory molecules mediating T-cell survival, proliferation, and effector functions

Jagadeesh Bayry (ed.), The TNF Superfamily: Methods and Protocols, Methods in Molecular Biology, vol. 2248, https://doi.org/10.1007/978-1-0716-1130-2_4, © Springer Science+Business Media, LLC, part of Springer Nature 2021

63

64

Prabhakaran Kumar et al.

Table 1 Receptors and ligands of TNF superfamily TNF Receptor

Other names

TNF ligands

Other names

TNFRSF1A

TNFR1

TNFSF1

LTα

TNFRSF1B

TNFR2

TNFSF2

TNF

TNFRSF3

LTβR

TNFSF3

LTβ

TNFRSF4

OX40

TNFSF4

OX40L

TNFRSF5

CD40

TNFSF5

CD40L

TNFRSF6

FAS

TNFSF6

FASL

TNFRSF6B

DcR3

TNFSF7

CD27L

TNFRSF7

CD27

TNFSF8

CD30L

TNFRSF8

CD30

TNFSF9

4-1BBL

TNFRSF9

4-1BB

TNFRSF10

TRAIL

TNFRSF10A

DR4

TNFSF11

RANKL

TNFRSF10B

DR5

TNFSF12

TWEAK

TNFRSF10C

DcR1

TNFSF13

APRIL

TNFRSF10D

DcR2

TNFSF13B

BLYS

TNFRSF11A

RANK

TNFSF14

LIGHT

TNFRSF11B

OPG

TNFSF15

TL1

TNFRSF12

DR3

TNFSF18

GITRL

TNFRSF14

HveA

TNFRSF16

NGFR

TNFRSF17

BCMA

TNFRSF18

GITR

TNFRSF19

Troy

TNFRSF21

DR6

TNFRSF22

DCTRAILR2

TNFRSF23

DCTRAILR1

TNFRSF25

DR3

in the presence of TCR stimulation [2]. These receptors are expressed on activated and memory T-cells, but not on resting T-cells and their cognate ligands are predominantly expressed on activated antigen-presenting cells such as dendritic cells, macrophages, innate lymphoid cells, and many other inflammatory cell types [3]. Their immune-enhancing costimulatory properties are

OX40L and GITRL induce Ag-Independent Treg Proliferation

Tconv

b

Treg

4-1BB

Tnfrsf4 (OX40) Tnfrsf9 (41BB) Tnfrsf18 (GITR) Tnfrsf8 (CD30) Tnfrsf1b (TNFR2) Tnfrsf13b Tnfrsf10b Tnfrsf19 Tnfrsf11b Tnfrsf25 Tnfrsf11a Tnfrsf12a Tnfrsf22 Tnfrsf13c Tnfrsf17 Tnfrsf14 Tnfrsf21 Tnfrsf23 Tnfrsf26 row min

row max

TNFR2

100

100

80

80

60

60

40

40

20

20

0

0 0

10

% max

a

65

101

102

103

100

101

102

103

GITR

OX40 100

100

80

80

60

60

40

40

20

20

0

0 100

101

102

103

100

101

102

103

CD4+CD25–Foxp3– CD4+CD25+Foxp3+

Fig. 1 (a) CD4+Foxp3+GFP+ Tregs and CD4+Foxp3
GFP
Tconv cells from Foxp3.GFP reporter mice were sorted. Total RNA was isolated and converted into cDNA and differential gene expression profiling was performed by Affymetrix microarray analysis. Heat maps shows differential mRNA expression of TNFRSF genes. (b) Overlay histograms show 4-1BB, TNFR2, OX40, and GITR expression in CD4+CD25
Foxp3
Tconv cells (blue) and CD4+CD25+Foxp3+ Treg cells (red)

exploited to boost antitumor immunity in several types of cancers using either cognate soluble ligands or specific agonistic antibodies to these receptors. However, recent studies have identified critical roles played by these TNFRs in thymic Treg differentiation and expansion [4, 5], which might suppress the effector T-cell proliferation and functions and thereby attenuate intended antitumor effects. Here, we show the preferential expression of several TNF superfamily receptors, including TNFRII, 4-1BB, OX40, and GITR on Tregs over conventional T-cells (Tconv) under resting state by microarray analysis (Fig. 1a), which was confirmed by specific staining for select receptors followed by flow cytometry analysis (Fig. 1b). Functional relevance of expression of these receptors was evaluated by their ability to cause selective proliferation of Tregs. OX40L and GITRL induced selective proliferation of Tregs in an antigen independent, but IL-2-dependent, manner while 4-1BB failed to induce Treg proliferation (Fig. 2a, b). TNFa induced a weaker proliferation of Tregs and none of these ligands induced Tconv cell proliferation in the absence of antigen stimulation (Fig. 2c).

66

Prabhakaran Kumar et al.

Fig. 2 (a) Histograms show cell trace violet dilution in gated CD4+CD25+Foxp3+ Treg cells (top panel) and CD4+CD25
Foxp3
Tconv cells (bottom panel). Numbers indicate cell division index. (b) Bar graphs summarize cumulative division index calculated from (a). Values are expressed as Mean  SEM (n ¼ 3 independent experiments; *p < 0.05, ****p < 0.001)

2 2.1

Materials Cell Culture

1. Dulbecco’s Phosphate-Buffered Saline (DPBS) without calcium and magnesium (Corning). 2. Prime-XV T cell expansion XSFM (Irvine Scientific). 3. 40-μm-nylon mesh cell strainer (Falcon). 4. 6-well flat bottom and 96-well U-bottom plates (Corning). 5. Recombinant mouse IL-2 (eBioscience). 6. Recombinant mouse TNF-a, 4-1BBL, OX40L, and GITRL (Biolegend).

2.2

T-Cell Isolation

1. Foxp3.GFP mice on C57BL6/J background. 2. Mouse dissection tools: Sterile sharp pointed dissection scissors and thumb forceps. 3. EasySep Mouse CD4+ T Cell Isolation Kit (Stemcell technologies).

OX40L and GITRL induce Ag-Independent Treg Proliferation

67

4. EasySep Separation buffer: PBS, 2% FBS,1 mM EDTA. 5. 5-mL Polystyrene round bottom tube with cell strainer cap (Falcon). 6. MoFlo Astrios cell sorter (Beckman and Coulter). 7. Centrifuge: Refrigerated Eppendorf centrifuge 5810R. 2.3 RNA Isolation and Microarray

1. RNAeasy kit (Qiagen). 2. DNase I (RNase free) (New England BioLabs). 3. cDNA synthesis Kit (Thermo Scientific). 4. GeneChip Mouse Gene 2.0 ST array (Thermo Scientific). 5. Automated electrophoresis system TapeStation (Agilent). 6. Scanning confocal laser microscope (Thermo Fisher Scientific).

2.4

Flow Cytometry

1. Cell Trace Violet kit (Life technologies). 2. Antimouse OX40 (CD134) Monoclonal Antibody (OX-86), PE-conjugated (Thermo Scientific). 3. Antimouse TNFR2 Monoclonal Antibody (MR2-1), PE-conjugated (Thermo Scientific). 4. Antimouse 4-1BB, (CD137) Monoclonal Antibody (17B5), PE-conjugated (Thermo Scientific). 5. Antimouse GITR (CD357) Monoclonal Antibody (DTA-1), PE-conjugated (Thermo Scientific). 6. Antimouse CD4 Monoclonal Antibody (RM4-5), APC-eFluor 780-conjugated (Thermo Scientific). 7. Antimouse CD25 Monoclonal Antibody APC-conjugated (Thermo Scientific).

(PC61.5),

8. FOXP3 Monoclonal Antibody (FJK-16s), FITC-conjugated (Thermo Scientific). 9. FOXP3/Transcription Factor Staining Buffer Kit (Tonbo Biosciences). 10. Wash buffer: 1 PBS, 0.5% bovine serum albumin (BSA). 11. Cytoflex flow cytometer (Beckmen and Coulter). 12. Kaluza software (Beckmen and Coulter). 13. Flowjo_v10.6.1 (BD Biosciences). 14. Hemocytometer. 15. Dimethyl sulfoxide (DMSO).

68

3

Prabhakaran Kumar et al.

Methods

3.1 Isolation of CD4+ T Cells

1. Collect spleen from the Foxp3.GFP mice on C57BL6/J background in DPBS in a 6-well plate and smash against 40-μmnylon mesh cell strainer in 5 mL of 1 DPBS. 2. Wash cell suspension with 1 DPBS by centrifuging at 400  g for 5 min at 4  C. 3. Resuspend the cell pellet in 80–100  106 cells/mL EasySep separation buffer and transfer to 5-mL polystyrene roundbottom tube. The described procedure is optimized for normal spleen containing 80–100  106 cells (see Note 1). 4. Add 50 μL of rat serum to cell suspension and mix well by pipetting. 5. Add 50 μL of CD4+ T cell isolation cocktail containing biotinconjugated capturing antibodies for non-T-cells, mix well and incubate for 10 min at room temperature. 6. Vortex 75 μL of magnetic particle suspension containing streptavidin spheres for 30 s and add to the cell suspension and mix well by pipetting. 7. Incubate cell suspension at room temperature for 3 min and make up the cell suspension volume up to 2.5 mL with EasySep separation buffer. 8. Place the tube containing cell suspension in to a magnetic holder without cap. 9. After 3 min, quickly invert the magnetic holder containing tube into a new tube in one continuous motion to collect CD4+ T cells in EasySep Separation buffer. 10. Wash the enriched CD4+ T cells with 1 DPBS twice at 400  g for 5 min at 4  C. 11. FACS sort the CD4+ T cells further into CD4+Foxp3+GFP+ Tregs and CD4+Foxp3
GFP
Tconv cells using MoFlo Astrios cell sorter.

3.2 Microarray Analysis

1. Isolate total cellular RNA using RNeasy kit according to the manufacturer’s protocol. 2. Ensure RNA quality ensured with the use of automated electrophoresis system TapeStation. 3. Carry out labeling reactions and hybridizations according to the Whole Transcript (WT) Plus Target labeling protocol from Thermo Fisher Scientific. 4. Use 100 ng of total RNA in each labeling reaction and hybridize the resulting labeled and fragmented ss-cDNA target to the arrays.

OX40L and GITRL induce Ag-Independent Treg Proliferation

69

5. Following hybridizations, carry out binding to streptavidinconjugated fluorescent marker. Perform laser excitation of the fluorescent marker to detect bound probe and followed by scanning of the resultant emission spectra using a scanning confocal laser microscope. 3.3 Bioinformatics Processing

1. Import raw microarray data (CEL files) into R using the oligo package [6]. Perform all processing steps within R. 2. Convert feature intensity values from each CEL file into summarized normalized expression values using Robust Multiarray Average (RMA) with the oligo package. 3. Remove positive and negative control probes before performing downstream analysis. 4. Perform Principal component analysis (PCA) on normalized intensities and visualize a scatterplot of principal component PC 1 vs PC2 to check for batch effects or outlier samples. 5. Perform differential gene expression using the limma package [7]. 6. Adjust P-values for multiple testing using the false discovery rate (FDR) correction of Benjamini and Hochberg [8]. 7. Generate heat maps by using normalized gene expression values (Fig. 1a).

3.4 Flow Cytometry– Based TNFR Expression Analysis

1. Wash 1  105 CD4+ T cells per well by centrifugation with wash buffer twice at 400  g for 5 min at 4  C in 96-well round-bottom plates. 2. Prepare surface antibody cocktail containing anti-CD4 (1:400), anti-CD25 (1:200) anti-GITR (1:200), anti-OX40 (1:200), anti-TNFR2 (1:200), and anti-4-1BB(1:200) at indicated dilutions in wash buffer. 3. Add 100 μL of antibody cocktail to each well, mix well by pipetting, and incubate in dark for 45 min at 4  C. 4. Wash the cells by centrifugation with wash buffer twice at 400  g for 5 min at 4  C. 5. Prepare 1 Foxp3/Transcription Factor Fix/Perm buffer from 4 concentrate. 6. Add 100 μL of 1 Foxp3/Transcription Factor Fix/Perm buffer to each well and mix well by pipetting, and incubate in dark for 1 h at 4  C. 7. Wash the cells by centrifugation with 1 Flow Cytometry Perm Buffer twice at 400 g for 5 min at 4  C. 8. Prepare Foxp3 staining antibody at 1:200 dilution in 1 Flow Cytometry Perm Buffer (see Note 2).

70

Prabhakaran Kumar et al.

9. Add 100 μL of Foxp3 antibody to each well, mix well by pipetting, and incubate in dark for 1 h at 4  C. 10. Wash the cells by centrifugation with 1 Flow Cytometry Perm Buffer twice at 400  g for 5 min at 4  C. 11. Finally, suspend the cells in 1 PBS for flow cytometry run. 12. Prepare appropriate unstained, isotype and single-stain controls as described. 13. Analyze stained cells for TNFR expression by flow cytometry using flow cytometer and perform data analysis by using Kaluza software. 14. We found preferential overexpression of GITR, OX40, 4-1BB, and TNFR2 on CD4+Foxp3+ Tregs over CD4+Foxp3
Tconv cells (see Fig. 1b). 3.5 Cell Trace Violet Staining

1. Enumerate isolated CD4+ T-cell by using hemocytometer and resuspend in DPBS at a cell density of 5  106 cells/mL. 2. Dissolve cell trace violet dye in DMSO to get 5 mM stock concentration. Add 1 μL of cell trace violet dye/1  106 cells/mL to a final concentration of 5 μM and mix well (see Note 3). 3. Stain the cells at 37  C for 20 min. 4. Add equal volume of DPBS containing 1% FBS and incubate at 37  C for 5 min. 5. Wash the cells by centrifuging at 400  g for 5 min at 4  C and suspend in desired medium for further culturing.

3.6 TNFR-Induced Antigen-Independent T-Cell Proliferation Assay

1. Treat cell trace violet stained 1  105 CD4+ T cells with either 10 U/mL of mouse recombinant IL-2 alone or along with 5 μg/mL of recombinant 4-1BBL, TNF-α, OX40L, and GITRL for 4 days without antigen stimulation. 2. Wash post-treated cells and stain with antibody cocktail containing anti-CD4 and anti-Foxp3 antibodies as described (see Subheading 3.4). 3. Analyze the cell proliferation of CD4+Foxp3
Tconv cells and CD4+Foxp3+ Tregs by flow cytometry based on cell violet dilution during each cell cycle (Fig. 2a). 4. Calculate cell division index using Flowjo_v10.6.1 and analyze statistical difference using student t-test (Fig. 2b). 5. TNF ligands like OX40L and GITRL induce more robust proliferation of Tregs compared to IL-2 alone control. TNF-α induces statistically significant although modest Treg proliferation while 4-1BBL fail to induce Treg proliferation (Fig. 2a, b).

OX40L and GITRL induce Ag-Independent Treg Proliferation

4

71

Notes 1. RBS lysis before EasySep isolation procedure was avoided to obtain better CD4+ T-cell yield and purity. 2. During flow cytometry staining, surface marker staining can be coupled with intracellular/nuclear staining after fixation and permeabilization in certain cases where target proteins are expressed in both cell surface and intracellular compartments such as CTLA4. However, it should be noted that staining intensity of few surface markers such as CD69 and CD62L tends to become lower while staining after fixation and permeabilization. Hence, care should be taken while staining cells for these markers. 3. Reducing cell trace violet concentration will result in smearing of cell trace violet diluted cells rather than getting separate peak for each division. Addition of live/dead cell dyes might help improve gating.

References 1. Vanamee ES, Faustman DL (2018) Structural principles of tumor necrosis factor superfamily signaling. Sci Signal 11:eaao4910 2. Croft M (2009) The role of TNF superfamily members in T-cell function and diseases. Nat Rev Immunol 9:271–285 3. Kumar P, Bhattacharya P, Prabhakar BS (2018) A comprehensive review on the role of co-signaling receptors and Treg homeostasis in autoimmunity and tumor immunity. J Autoimmun 95:77–99 4. Kumar P, Marinelarena A, Raghunathan D et al (2019) Critical role of OX40 signaling in the TCR-independent phase of human and murine thymic Treg generation. Cell Mol Immunol 16:138–153

5. Mahmud SA, Manlove LS, Schmitz HM et al (2014) Costimulation via the tumor-necrosis factor receptor superfamily couples TCR signal strength to the thymic differentiation of regulatory T cells. Nat Immunol 15:473–481 6. Carvalho BS, Irizarry RA (2010) A framework for oligonucleotide microarray preprocessing. Bioinformatics 26:2363–2367 7. Ritchie ME, Phipson B, Wu D et al (2015) Limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res 43:e47 8. Benjamini Y, Hochberg Y (1995) Controlling the false discovery rate - a practical and powerful approach to multiple testing. J R Stat Soc B 57:289–300

Chapter 5 Transition from TNF-Induced Inflammation to Death Signaling Swati Choksi, Gourav Choudhary, and Zheng-Gang Liu Abstract Tumor necrosis factor (TNF) plays a key role in inflammatory responses and in various cellular events such as apoptosis and necroptosis. The interaction of TNF with its receptor, TNFR1, drives the initiation of complex molecular pathways leading to inflammation and cell death. RARγ is released from the nucleus to orchestrate the formation of the cytosolic death complexes, and it is cytosolic RARγ that plays a pivotal role in switching TNF-induced inflammatory responses to RIPK1-initiated cell death. Thus, RARγ provides a checkpoint for the transition from inflammatory signaling to death machinery of RIPK1-initiated cell death in response to TNF. Here, we use techniques to identify RARγ as a downstream mediator of TNFR1 signaling complex. We use confocal imaging to show the localization of RARγ upon activation of cell death. Immunoprecipitation of RARγ identified the interacting proteins. Key words RARγ, RIPK1, TRADD, Immunoprecipitation

1

Introduction Tumor necrosis factor (TNF) plays a critical role in diverse cellular events, including inflammation, apoptosis, and necroptosis through different signaling complexes [1, 2]. The molecular mechanism involving the interaction of TNF with TNR receptor 1 (TNFR1) and recruitment of several effector proteins has been intensely investigated [1, 2]. However, the transition from inflammatory signaling to death pathways is not well understood. TNF engagement triggers the formation of a TNFR1 signaling complex (complex I) by recruiting effector molecules such as TRADD (TNFR1-associated death domain protein), RIPK1 (receptor interacting protein kinase 1), and TRAF2 (TNFR-associated factor 2) leading to inflammatory responses [3]. However, to trigger cell death pathways, this TNFR1 signaling complex (complex I) dissociates from the receptor and recruits other proteins to form different secondary complexes for apoptosis and necroptosis [4]. The TNFR1 signaling complex dissociates from the receptor

Jagadeesh Bayry (ed.), The TNF Superfamily: Methods and Protocols, Methods in Molecular Biology, vol. 2248, https://doi.org/10.1007/978-1-0716-1130-2_5, © Springer Science+Business Media, LLC, part of Springer Nature 2021

73

74

Swati Choksi et al.

and RIPK1 recruits FADD (Fas-associated death domain protein) and Caspase-8 are recruited to form complex IIa and trigger apoptosis and RIPK3 (receptor interacting protein 3) and MLKL (mixed lineage kinase-domain like) are recruited to form the necrosome to carry out necroptosis [4]. When RIPK1 is recruited to the death receptor signaling complex through its death domain interactions, it is key for mediating inflammatory responses such as NF-kB and MAP kinase activation however, for TNF-induced cell death, RIPK1, is the initiator of the death signaling process. Our recent study demonstrated that cytoplasmic Retinoic acid receptor γ (RARγ), not the nuclear RARγ, is a key regulator of RIPK1-initiated cell death [5]. RARγ is critical for converting the inflammatory response to death signaling by mediating the formation of cytosolic death complexes. TNF-induced cell death (apoptosis and necroptosis) could be initiated by TRADD when de novo protein synthesis is blocked or by RIPK1 when IAP E3 ligases are inhibited. Previous studies suggest that blocking RIPK1 ubiquitination by cIAP1/2 leads to RIPK1 recruitment of FADD and RIPK3, which engages apoptosis and necroptosis respectively [6, 7]. However, our data found that RARγ is essential for the release of RIPK1 from TNFR1 as the nonubiquitinylated RIPK1 was found in the TNFR1 complex and no complex IIa or necrosome was formed in the absence of RARγ. In contrast, the release of TRADD from TNFR1 does not require RARγ. Therefore, RARγ is required for RIPK1-initiated, but not TRADD-initiated, cell death. The functions of RARs have been extensively studied as nuclear transcription factors and the RARs are predominantly nuclear even in the absence of their ligands [8]. To rule out the contribution of RARγ transcriptional activity in cell death, we show that the deletion of the transcription activation domain of RARγ, the DNA-binding domain, and the NLS site interact with the C-terminal of RIP1 and is sufficient to restore the sensitivity of RARγ knockdown cells to TSZ-induced necroptosis. Additionally, it is RARγ and not other RARs such as RARα, that is specifically released from the nucleus. Smac mimetic alone was found to be sufficient to induce the release of RARγ from the nucleus and suggests that cIAPs may play a role in the regulation of RARγ localization. Our in vivo studies showed that RARγ1-knockout mice are resistant to TZ, but not TG treatment, while TRADD knockout mice are resistant to TG, but not TZ treatment [5, 9]. These findings further supported our conclusion that RARγ is required for RIPK1-initiated cell death. RIPK1-initiated cell death is a vital cellular response triggered by death factors and the engagement of this pathway is finely regulated by RARγ [10]. In this chapter, we describe how to analyze the TNFR1 signaling regulated by RARγ using regular Western blot analysis. The actual procedure of immunoblotting will not be described here; however, we provide all the necessary details on how to treat the

Switching from TNF-Induced Inflammation to Cell Death

75

cells, how to prepare the samples for Western blot, and what antibodies to use. We focus on two methods: Confocal microscopy for detecting nuclear versus cytoplasmic RARγ localization and the immunoprecipitation (IP) of endogenous TNFR1 and specifically serial IPs to determine the composition of the death complex. By utilizing the technique of IP we can analyze the proteins that are recruited to the receptor-signaling complex.

2

Materials

2.1 Common Materials

1. PBS: 137 mM NaCl, 2.7 mM KCl, 8 mM Na2HPO4, 2 mM KH2PO4. 2. Complete growth medium for cell lines: DMEM, 2 mM L -glutamine, 100 U/mL penicillin, 100 μg/mL streptomycin, 10% fetal bovine serum. 3. TNF-α (R&D Systems): Reconstitute and store according to the manufacturer’s instructions. 4. z-VAD-fmk (R&D Systems): Reconstitute and store according to the manufacturer’s instructions. 5. Cycloheximide (CHX) (Sigma). 6. Smac mimetic (S. Wang, University of Michigan, Ann Arbor, Michigan, USA). 7. Rotator. 8. 10-cm and 15-cm dishes. 9. 50-mL tubes. 10. 1.5-mL microcentrifuge.

2.2 Immunoprecipitation (IP) and Immunoblotting

1. Antibodies: All antibodies are at concentration of 1 μg/mL and use at 1:1000 dilution unless otherwise stated. Anti-RARγ (C-15, Santa Cruz) for human, anti-RARα (C-20, Santa Cruz), anticaspase-8 (C-20, Santa Cruz), anti-cIAP2 (H-85, Santa Cruz) and anti-Fas (C-20, Santa Cruz), anti-RIP1 (38/RIP, BD Biosciences) and anti-FADD (1/FADD, BD Biosciences), anti-RARγ1 (Abcam) for mouse, anti-RIPK3 (Abcam), anti-RIPK3 (ProSci) for mouse, anti-TRADD (Upstate), and anti-TNFR1 (R&D Systems), anti-Actin (clone AC-40, Sigma) (dilution 1:10,000), anti-FLAG (clone M2, Sigma) (dilution 1:5000) and anti-GFP (clone GFP-20, Sigma) (dilution 1:5000), anti-V5 (Invitrogen) (dilution 1:5000), anticleaved caspase-8 (clone 18C8, Cell Signaling Technology), anti-RIPK1 (Cell Signaling Technology) and anti-p-RIPK1(Cell Signaling Technology), anti-DsRed (Clontech) (dilution 1:5000).

76

Swati Choksi et al.

2. Lysis buffer: M2 buffer (20 mM Tris–HCl, pH 7.5, 0.5% NP-40, 250 mM NaCl, 3 mM EDTA, 3 mM EGTA) supplemented with 2 mM DTT, 0.5 mM PMSF, 20 mM β-glycerol phosphate, 1 mM sodium vanadate, 1 μg/mL leupeptin (see Note 1). 3. Protein G-agarose beads. 4. Criterion™ TGX™ (Tris-Glycine extended, Bio-Rad) precast gels for poly acrylimide gel electrophoresis (PAGE). 5. SDS loading buffer: 5
solution of Tris base, 10% SDS, bromophenol blue, and glycerol (Quality Biological). 6. Tris-Glycine-SDS running buffer: Purchased from Bio-Rad as a 10
premixed electrophoresis buffer, containing 25 mM Tris, 192 mM glycine, 0.1% SDS, pH 8.3 following dilution to 1
with water. 7. Criterion™ wet transfer system. 8. Tri-Glycine transfer buffer: Purchased from Bio-Rad as a 10
premixed electrophoresis buffer contains 25 mM Tris, 192 mM glycine, pH 8.3, following dilution to 1
with water. 2.3 Confocal Microscopy

1. Plasmid: pRARγ-GFP. 2. HeLa cells: Medium for the culturing: DMEM, 2 mM L-glutamine, 100 U/mL penicillin, 100 μg/mL streptomycin, 10% fetal bovine serum. 3. 3-cm Ibidi plates (Ibidi). 4. Dimethyl sulfoxide (DMSO). 5. 3% paraformaldehyde. 6. 40 ,6-diamidino-2-phenylindole (DAPI). 7. Antibodies: anti-F-actin (SIGMA) and anti-RARγ (C-15, Santa Cruz) antibodies. 8. Transfection reagent: Lipofectamine-Plus reagent (Invitrogen). Use as per manufacturer’s recommendation. 9. A confocal microscope (Carl Zeiss LSM780 confocal microscope) equipped with a Plan-Apochromat 63 A˚ ~ numerical aperture 1.40 DIC oil objective.

3

Methods

3.1 Treatment of Cells with Cell Death Conditions

1. Day 1: Plate MEFs at 3–5
106 in a 10 cm dish in complete growth medium overnight at 37  C. 2. Day 2: Treat the cells with either necroptosis or apoptosis conditions.

Switching from TNF-Induced Inflammation to Cell Death

77

3. To induce necroptosis use TSZ treatment [(TNF-α (30 ng/ mL), Smac mimetic (10 nM), z-VAD-fmk (20 μM)] or TCZ [(TNF-α (30 ng/mL), CHX (cycloheximide, 10 μg/mL), zVAD-fmk (20 μM)]. 4. To induce Apoptosis, treat the cells with TNF-α (30 ng /mL) and Smac mimetic (10 nM) or TNF-α (30 ng/mL) and CHX (10 μg/mL). 5. At different time points, collect the cells and wash once with PBS and use them for Western blot analysis. 3.2 Preparation of Samples for Western Blot

1. Collect cells after cell death treatment (see Note 2), at different time points depending on your experiment. 2. Prepare 1.5-mL microcentrifuge tubes on ice. 3. Collect the cells from each dish or well to a separate 1.5-mL microcentrifuge tube. 4. Centrifuge tubes for 5 min at 300
g at 4  C. 5. Aspirate the supernatant, add 1 mL of ice-cold PBS, and centrifuge for 5 min at 300
g at 4  C. 6. Aspirate supernatant and resuspend the pellet in 30 μL of M2 lysis buffer (see Note 3). 7. Rotate tubes in a rotator for 30 min at 4  C. 8. Centrifuge tubes for 10 min at 15,000–20,000
g at 4  C. 9. Transfer the supernatant to a fresh 1.5-mL microcentrifuge tube without disturbing the pellet. The supernatant can be frozen at 70  C. 10. Measure the concentration of proteins in the sample.

3.3 Immunoprecipitation (IP) 3.3.1 Preparation of the Cell Lysate

1. Plate 5–6
106 cells in a 15-cm dish and treat with cell death conditions. (see Note 4). 2. Prepare 50-mL tube with 20 mL of ice-cold PBS. 3. After treatment, quickly transfer the cells from the plate to the tube with PBS. Collect the residual cells with an additional 10 mL of ice-cold PBS. 4. Centrifuge tubes for 5 min at 300
g at 4  C. 5. Aspirate supernatant and resuspend the pellet in 1 mL of M2 lysis buffer that has no DTT. This resuspended pellet can be frozen at 70  C for future use. 6. Transfer the resuspended microcentrifuge tube.

pellet

to

a

1.5-mL

7. Rotate samples on a rotator for 30 min at 4  C. 8. Centrifuge tubes for 10 min at 15,000–20,000
g at 4  C.

78

Swati Choksi et al.

9. Transfer the supernatant to a fresh 1.5-mL microcentrifuge tube without disturbing the pellet. This supernatant can be frozen at 70  C. 10. Measure the concentration of proteins in the sample. Take 1 mg for IP and 1–3% (w/w) for the input sample (loading control). 1. Take enough quantity of protein G-agarose beads (see Note 5).

3.3.2 Washing the Beads and Preparation of 50% Bead Slurry

2. Centrifuge for 1 min at 500
g at 4  C.

3.3.3 Preclearance of the Lysate

1. Bring the volume of the protein lysate taken for IP to 1 mL with the lysis buffer and add 40 μL of 50% bead slurry.

3. Resuspend the pellet in the lysis buffer equal to the volume of beads taken. This is now 50% bead slurry.

2. Rotate on a rotator for 1 h at 4  C. 3. Centrifuge for 2 min at 500
g at 4  C. 4. Transfer the supernatant to a fresh 1.5-mL microcentrifuge tube. Be careful not to transfer beads as the bead pellet is very loose (see Note 6). 3.3.4 Immunoprecipitation

1. Add 1 μg of the antibody (anti-TNFR1, anti- RARγ, or anticaspase 8) of the protein to be immunoprecipitated and 30 μL of 50% protein G-agarose bead slurry to 1 mL of cell lysate. 2. Rotate tubes on a rotator overnight at 4  C. 3. Centrifuge tubes for 2 min at 500
g at 4  C. 4. Very carefully aspirate the supernatant leaving some liquid above the pellet and add 1 mL of M2 lysis buffer (see Note 6). 5. Rotate tubes on a rotator for 10 min at 4  C. 6. Centrifuge tubes for 2 min at 500
g at 4  C. 7. Wash beads four more times (repeat steps 4–6). 8. After the final wash, aspirate as much supernatant as possible, and resuspend the beads in 40 μL of SDS loading buffer. 9. Denature the immunoprecipitated samples and input samples by heating at 100  C for 3 min. 10. Resolve the samples in 4–20% SDS-polyacrylamide gels for western blot analysis. Use the following antibodies to detect proteins in the signaling complex: anti-TNFR1, anti-TRADD, anti-RARγ, anti-RIPK3, anti-RIPK1, and anticaspase 8 antibodies (see Note 7). Visualize the proteins by enhanced chemiluminescence.

Switching from TNF-Induced Inflammation to Cell Death

3.4 Confocal Microscopy

79

1. Plasmid Expression in HeLa Cells. (a) Culture 1
105 HeLa cells in 3-cm Ibidi plates for 24 h. (b) Transfect the HeLa cells with 1 μg of pRARγ-GFP by Lipofectamine-Plus reagent as per manufacturer’s recommendation (see Note 8). 2. For overexpression proteins, 24 h post transfection, treat the cells with DMSO (1%), TNF-α (30 ng/mL) or TS [(TNF-α (30 ng/mL), Smac mimetic (10 nM)] or TSZ [(TNF-α (30 ng/mL), Smac mimetic (10 nM), z-VAD-fmk (20 μM)] for 0–2 h. 3. Immunofluorescent Staining. (a) Assess the localization of endogenous RARγ by immunofluorescent staining. Fix the treated HeLa cells with 3% paraformaldehyde by intermittent shaking for 20 min at room temperature. (b) Stain the cells with anti-F-actin and anti-RARγ antibodies, and nucleus with DAPI and directly visualize by confocal microscopy (see Note 9). (c) For overexpression proteins, stain the treated HeLa cells with nuclear DAPI and directly visualize by confocal microscopy. 4. Perform confocal imaging and analysis. We visualized confocal images using a Carl Zeiss LSM780 confocal microscope ˚ ~ numerical aperture equipped with a Plan-Apochromat 63 A 1.40 DIC oil objective. Analyze acquired images by using Carl Zeiss ZEN software.

4

Notes 1. Basic M2 buffer can be prepared in a large amount and stored at 4  C. If protease inhibitors are added, lysis buffer should be stored in aliquots at 20  C. After thawing, discard unused buffer. 2. For early TNFR1 complexes, an early time point of 30 min should be used. For later complexes, a time of 2 h should be used. 3. Signaling complexes are formed within 5 min of treatment. It is important to keep everything on ice and lyse the cells quickly after treatment. 4. Cells should be plated the night before. The number of cells will vary based on the type of cell line. Plate them so that they will be at 60–80% confluency.

80

Swati Choksi et al.

5. For each sample, you will need 40 μL of beads. Since the beads will be used twice (to preclear the lysate and for the actual IP), the total amount should be doubled. 6. The bead pellet is very loose. Be very careful. We usually use protein gel-loading tips or 30 G needles to suck the supernatant off. 7. When probing with RIPK1 antibodies in addition to the actual RIP1 band, you should be able to see high-molecular-weight smear, which corresponds to ubiquitination of RIPK1. 8. Human RARγ transcript variant 1 (NM_000966) was cloned into the mammalian expression vector pEGFP-C1 to generate pRARγ-GFP. 9. DAPI is used to visualize the nucleus and is added a few minutes before imaging if you wait too long the staining may be too strong.

Acknowledgments The authors’ research is supported by the Intramural Research Program of the National Institutes of Health, National Cancer Institute, Center for Cancer Research. References 1. Brenner D, Blaser H, Mak TW (2015) Regulation of tumour necrosis factor signalling: live or let die. Nat Rev Immunol 15:362–374 2. Chen G, Goeddel DV (2002) TNF-R1 signaling: a beautiful pathway. Science 296:1634–1635 3. Ofengeim D, Yuan J (2013) Regulation of RIP1 kinase signalling at the crossroads of inflammation and cell death. Nat Rev Mol Cell Biol 14:727–736 4. Cai Z, Jitkaew S, Zhao J et al (2014) Plasma membrane translocation of trimerized MLKL protein is required for TNF-induced necroptosis. Nat Cell Biol 16:55–65 5. Xu Q, Jitkaew S, Choksi S et al (2017) The cytoplasmic nuclear receptor RARgamma controls RIP1 initiated cell death when cIAP activity is inhibited. Nat Commun 8:425 6. Vandenabeele P, Galluzzi L, Vanden Berghe T, Kroemer G (2010) Molecular mechanisms of

necroptosis: an ordered cellular explosion. Nat Rev Mol Cell Biol 11:700–714 7. He S, Wang L, Miao L et al (2009) Receptor interacting protein kinase-3 determines cellular necrotic response to TNF-alpha. Cell 137:1100–1111 8. Micheau O, Tschopp J (2003) Induction of TNF receptor I-mediated apoptosis via two sequential signaling complexes. Cell 114:181–190 9. Pobezinskaya YL, Kim YS, Choksi S et al (2008) The function of TRADD in signaling through tumor necrosis factor receptor 1 and TRIF-dependent toll-like receptors. Nat Immunol 9:1047–1054 10. Marill J, Idres N, Capron CC, Nguyen E, Chabot GG (2003) Retinoic acid metabolism and mechanism of action: a review. Curr Drug Metab 4:1–10

Chapter 6 Analysis of FcγR-Dependent Agonism of Antibodies Specific for Receptors of the Tumor Necrosis Factor (TNF) Receptor Superfamily (TNFRSF) Juliane Medler and Harald Wajant Abstract In vivo research of the last decade revealed that the anchoring of antitumor necrosis factor (TNF) receptor superfamily (TNFRSF) receptor antibodies to cell-expressed Fcγ receptors (FcγR) can be of decisive relevance for their receptor-stimulatory activity. Indeed, FcγR anchoring may even result in the conversion of antagonistic to agonistic anti-TNFR antibody activity. The knowledge on this issue is obviously not only relevant to understand the in vivo effects of anti-TNFR antibodies but also of overwhelming importance for the rational clinical development of antibodies and antibody derivatives. Based on the fact that with exception of the decoy TNFRSF receptors (TNFRs) all TNFRs are able to trigger proinflammatory NFκB signaling, resulting in the production of chemokines and cytokines, we established an easy and broadly applicable coculture assay for the evaluation of the FcγR-dependency of the agonism of anti-TNFR antibodies. In this assay, TNFR responder cells, which produce high amounts of IL8 in response to TNFR stimulation, were pairwise incubated with empty vector- and FcγR-transfected HEK293 cells, which produce only very low amounts of IL8. This cocultures were then comparatively analyzed with respect to anti-TNFR antibody-induced IL8 production as a readout for TNFR activation to uncover proagonistic effects of FcγR binding. Key words agonistic antibodies, NFκB, FcγR, coculture, IL8, ELISA, TNFRSF

1

Introduction The tumor necrosis factor (TNF) receptor superfamily (TNFRSF) receptors (TNFRs) are of considerable interest as targets in the treatment of autoimmune diseases and cancer. Both inhibition of TNFR activity and stimulation of TNFRs can elicit valuable therapeutic activities [1]. The activation of TNFRs can be straightforwardly prevented by means of ligand neutralizing antibodies or soluble decoy receptors. Several such TNFR-inhibitory reagents have found their way in clinical practice and include various TNF blockers.

Jagadeesh Bayry (ed.), The TNF Superfamily: Methods and Protocols, Methods in Molecular Biology, vol. 2248, https://doi.org/10.1007/978-1-0716-1130-2_6, © Springer Science+Business Media, LLC, part of Springer Nature 2021

81

82

Juliane Medler and Harald Wajant

Activation of TNFRs is of particular interest for the treatment of cancer and is in fact under consideration for this purpose since more than two decades. These efforts have, however, yet not led to approved clinical applications. This lack of success has mainly two reasons. First, dose limitations due to unwanted off-target activities arising from systemic TNFR activation and second difficulties in the development of potent agonists. The challenges in the development of TNFR agonists result from the molecular mechanisms of TNFR activation. TNFRs are naturally activated by ligands of the TNF superfamily (TNFSF), which occur as soluble and transmembrane trimers. Full and robust activation of TNFRs requires two steps [2]. Initially, three TNFR molecules interact with a TNFSF ligand (TNFL) trimer. In a second step, two or more of these initially formed trimeric ligand receptor complexes assemble to supramolecular signaling clusters. Two categories of TNFRs can be defined, based on their response to soluble TNFL trimers. TNFRs of category I bind soluble TNFL trimers, aggregate afterwards, and become fully and strongly activated this way. In contrast, category II TNFRs interact with high-affinity with soluble TNFL trimers, too, but fail to cluster and signal afterwards. Worth mentioning, oligomerization and cell attachment of soluble TNFL trimers enable them to robustly stimulate category II TNFRs [2]. The category II TNFR group includes translational relevant receptors, such as 41BB, CD27, CD40, CD95, Fn14, OX40, TNFR2, and the TRAIL death receptors [2]. The idiotype of an anti-TNFR IgG antibody has been generally considered as the decisive factor responsible for agonistic activity. Research of recent years with CD40-, CD95-, Fn14-, OX40-, and TRAILR2/DR5specific antibodies, however, revealed that this does not apply for antibodies specific for category II receptors. For antibodies targeting receptors of this TNFR subgroup, Fcγ-receptor (FcγR) binding has been identified as the dominant factor required for strong agonism [3–15]. Thus, it has been found that the in vivo agonism of anticategory II TNFR antibodies almost completely disappeared when mice, which lack expression of FcγRIIB, were used [4–6, 11– 14]. Likewise, variants/mutants of anticategory II TNFR antibodies with reduced or defective FcγR binding were found to be largely inactive in vitro and in vivo, too [5, 7–10, 15]. In contrast, antibodies specific for the category I TNFRs LTβR and TNFR1 showed strong agonistic activity independent from FcγR binding [8]. Thus, it appears that it is the type/category of TNFR, which determines the relevance of FcγR-binding for agonistic antibody activity. The ability of anticategory II TNFR antibodies to act as potent agonists was found to be essentially independent from the antibody isotype, FcγR type, and the epitope recognized [8]. This indicates that already the mere cell attachment, mediated by IgG-FcγR interaction, is sufficient to confer agonistic activity to anticategory II antibodies. Indeed, we could show that

FcγR Dependent Agonism

83

Fig. 1 General scheme of the procedure. FcγR+ anchoring cells and FcγR- control cells were obtained by transient transfection of HEK293 cells with an FcγR encoding plasmid or empty vector (EV) and were mixed with TNFR responder cells. Cocultures were challenged with the anti-TNFR antibody of interest and the next day supernatants were analyzed for IL-8 production as a readout for TNFR signaling

anticategory II antibody fusion proteins with an anchoring domain enabling FcγR-independent cell surface anchoring act as strong TNFR agonists, too, provided they have the opportunity to bind to their anchoring target [8]. For the rational clinical development of antibodies and antibody derivatives, it is therefore obviously mandatory to know whether, and if yes, to which extent, such antibodies acquire agonistic activity upon interaction with FcγRs. Here, we present an easy and broadly applicable coculture assay for the evaluation of the FcγR-dependency of the agonism of anti-TNFR antibodies and antibody fusion proteins, which exploits the ability of TNFRs to induce IL8 production (Fig. 1).

2

Materials

2.1 Effector Cells and FcγR-Expressing Transfectants

1. Standard equipment for cell culture work. 2. HEK293 cells (ATCC, Rockville, MD, USA) or other “easyto-transfect” cells (e.g., CHO or COS). 3. Effector cells strongly producing IL-8 in response to TNFR activation.

84

Juliane Medler and Harald Wajant

4. RPMI1640 medium. 5. Complete RPMI medium: RPMI1640 medium, 10% fetal calf serum (FCS), 100 U/mL Penicillin, 100 μg/mL streptomycin. 6. Cell-counting chamber. 7. Multichannel pipette. 8. 15-cm Tissue culture dishes and 96-well flat-bottom cell culture plates. 9. Polyethylenimine (PEI) (Polyscience Inc.): 1 mg/mL dissolved in ddH2O. 10. FcγRs-encoding expression plasmids. 11. Vortex. 2.2 Transient FcγR Expression

1. Standard equipment for cell culture work. 2. FcγR-expressing HEK293 transfectants (see Subheading 2.1). 3. RPMI1640 medium. 4. Complete RPMI medium: RPMI1640 medium, 10% fetal calf serum (FCS), 100 U/mL Penicillin, 100 μg/mL streptomycin. 5. Cell-counting chamber. 6. 96-well U-bottom cell culture plates. 7. Multichannel pipette. 8. Phosphate-buffered saline (PBS): 137 mM NaCl, 2.7 mM KCl, 8 mM Na2HPO4, 2 mM KH2PO4. 9. FcγR-specific flow cytometry antibodies and corresponding isotype controls. 10. Flow cytometer and analyzing software. 11. ROTANTA 460/460R centrifuge.

2.3 TNFR Stimulation with Antibody and Antibody Fusion Proteins

1. Standard equipment for cell culture work. 2. FcγR-expressing HEK293 transfectants. 3. RPMI1640 medium. 4. Complete RPMI medium: RPMI1640 medium, 10% fetal calf serum (FCS), 100 U/mL Penicillin, 100 μg/mL streptomycin. 5. 96-well U-bottom cell culture plates. 6. Multichannel pipette. 7. TNFR-specific antibodies and antibody fusion proteins. 8. 96-well flat-bottom cell culture plates with TNFR effector cells from Subheading 2.1. 9. Water-jacketed CO2 incubator.

FcγR Dependent Agonism

2.4

IL-8 ELISA

85

1. 96-well ELISA plate with high binding capacity. 2. IL-8 ELISA kit (BD Bioscience). 3. Coating buffer: 0.1 M sodium carbonate, pH 9.5 (7.13 g NaHCO3, 1.59 g Na2CO3; q.s. to 1.0 L; pH to 9.5 with 10 N NaOH). 4. Multichannel pipette. 5. PBS-T: 137 mM NaCl, 2.7 mM KCl, 8 mM Na2HPO4, 2 mM KH2PO4, 0.05% v/v Tween 20. 6. Assay diluent: PBS, 10% FCS. 7. ABTS and ABTS buffer: 3.25 mM sodium perborate, 39.8 mM citric acid, 60 mM disodium hydrogen phosphate, pH 4.4–4.5 (Roche Diagnostics). 8. HRP-linked streptavidin. 9. Photometer.

3

Methods

3.1 Preparing Effector Cells and FcγR-Expressing Transfectants

1. Seed TNFR-expressing effector cells in 96-well flat-bottom cell culture plates (2x104 cells/well) in medium suited for the effector cells used (typically RPMI 1640 10 & FCS). 2. The same day, transfect HEK293 cells with an expression plasmid encoding the FcγR of interest or empty vector as a negative control. For this, treat previously prepared 15-cm tissue culture dishes with near to confluent HEK293 cells as described in the following steps 3–6 (see Notes 1 and 2). 3. Mix 2 mL of serum-free RPMI 1640 medium with 12 μg of the FcγR expression plasmid(s) of interest (concentration > 100 μg/mL) or empty vector (see Note 2). 4. Add dropwise under vortexing 36 μL of polyethylenimine (PEI) solution. 5. Incubate the DNA/PEI mixture for 15 min at room temperature and replace during this time the medium from the HEK293 cells with 15 mL of serum-free RPMI 1640 medium containing 100 U/mL Penicillin and 100 μg/mL streptomycin. 6. After the 15 min of incubation time, add the DNA/PEI mixture to the HEK293 cells. 7. Cultivate transfected HEK293 cells and TNFR responder cells overnight. 8. Harvest the HEK293 transfectants and resuspend them in complete RPMI 1640 medium.

86

Juliane Medler and Harald Wajant

9. Use an aliquot of the HEK293 transfectants for flow cytometry of cell surface expression of the transfected FcγR(s) (see Subheading 3.2). The rest of the cells can be used for the actual coculture assay (see Subheading 3.3) (see Note 3). 3.2 Control of Transient FcγR Expression

1. Wash an aliquot (app. 1  106 cells) of the harvested transfectants of step 8, Subheading 3.1, twice in PBS. For this, resuspend cells in 0.2 mL of PBS and pellet them afterwards by centrifugation for 4 min at 310  g (ROTANTA 460/460R centrifuge, rotor 5624). 2. After the second wash step, resuspend cells in 0.2 mL of PBS. 3. Split resuspended cells in two aliquots and supplement these aliquots with isotype control antibody and anti-FcγR-antibody at a concentration recommended by the supplier. 4. Incubate cells for 30 min at 4  C. 5. Wash the cells again twice with PBS and analyze the cells by flow cytometry.

3.3 TNFR Stimulation with Antibody and Antibody Fusion Proteins

1. Dilute the remaining HEK293 transfectants from step 8, Subheading 3.1, to a concentration of 2  105 cells per mL in complete RPMI1640 medium. 2. Prepare 96-well U-shaped cell culture plates with the suspended cells. Calculate with 10 wells (one row) per antibody and transfectant. Add 120 μL of the cell suspension to each well. 3. Complement the transfectants with a concentration series of the antibodies of interest starting with 5 μg/mL and three fold dilution. For this purpose, add 60 μL of antibody solution (three fold concentrated, thus 15 μg/mL) to the first well of each row and mix carefully by pipetting up and down. 4. Transfer 60 μL of the first well to the second well and mix again carefully. 5. Proceed as described in step 4 with the following wells to obtain the cell suspension with the antibody concentration series. Stop after the ninth dilution step and supplement the remaining well with 60 μL medium only. 6. Incubate the plate for 20 min at 37  C and 5% CO2. 7. During this incubation time, remove the medium from the 96-well plate with the TNFR-responsive cells from step 1, Subheading 3.1. 8. Transfer 100 μL of each well of the antibody supplemented HEK293 transfectants from step 6 to the TNFR-responsive cells of step 7.

FcγR Dependent Agonism

87

Fig. 2 The anti-CD40 antibody G28.5 and the anti-Fn14 antibody 18D1 acquire strong agonistic activity after binding to various types of FcγRs. (a, b) HT1080-CD40 (a) and WiDr (b) cells were cultivated overnight in 96-well plates and mixed the next day with HEK293 cells transiently transfected with expression plasmids encoding the indicated human FcγRs or empty vector (EV) along with 100 ng/mL of the anti-CD40-IgG1 G28.5 (a) or 200 ng/mL of the anti-Fn14-IgG1 18D1 (b). After 24 h, TNFR-driven IL-8 production was analyzed by ELISA of the coculture supernatants

9. Optional: To control that the analyzed antibodies do not (or only neglectable) stimulate IL-8 production by the HEK293 transfectants, seed 100 μL of these cells (see step 1) alone and supplement with the highest antibody concentration used in step 3 to wells without TNFR-responsive cells. 10. Incubate cocultures overnight at 37  C and 5% CO2. 11. Analyze supernatants for their IL-8 content (see Subheading 3.4 and Note 4) to evaluate FcγR-dependency of TNFR activation (Figs. 2 and 3). 3.4

IL-8 ELISA

1. On the day of HEK293 transfection, incubate a 96-well ELISA plate with high binding capacity with 50 μL of capture anti-IL8 antibody (concentration as recommended by the supplier) in coating buffer overnight at 4  C. 2. In the morning, wash the ELISA plate 3 times with PBS-T. 3. Incubate wells for 1 h at room temperature with 200 μL of assay diluent to block unspecific binding sites. 4. Wash the plate 4 times with PBS-T. 5. Transfer 50 μL of the supernatants of the cocultures and HEK293 cells from step 11, Subheading 3.3, and a concentration series of an IL-8 standard to the ELISA plate. 6. Incubate plate for 2 h at room temperature. 7. Wash 5 times with PBS-T and dry plate. 8. Mix the biotinylated detection antibody together with the HRP-linked streptavidin in assay diluent and add 50 μL to each well of the ELISA plate (1 h, room temperature). 9. In the meanwhile, prepare the HRP-substrate ABTS in ABTS buffer.

88

Juliane Medler and Harald Wajant

Fig. 3 Antibodies against category II TNFRs acquire strong agonistic activity after murine FcγR2B binding. (a, b) The indicated TNFR transfectants and cell lines were cultivated overnight in 96-well plates and mixed the next day with HEK293 cells transiently transfected with a murine FcγR2B expression plasmid or empty vector (EV) along with increasing concentrations of the indicated human (anti-41BB HBBK4, anti-CD40 G28.5, antiCD95 E09, anti-Fn14 18D1) (a) and murine (anti-CD27 R&D clone 57703, anti-CD40 Milteny clone HB14, antiDR4 Adipogen clone HS101, anti-OX40 Santa Cruz clone Ber-Act35) (b) anti-TNFR IgG1s. After 24 h, TNFRdriven IL-8 production was analyzed by ELISA of the coculture supernatants

10. Wash ELISA plate 7 times. Dry the plate and add 100 μL of the ABTS solution. 11. Measure the absorbance with a photometer at 405 nm (see Note 5).

4

Notes 1. Other easy-to-transfect cells can be used, too. Particularly attractive is to use transfected FcγR anchoring cells and TNFR responder cells of different species origin, especially in cases of weak TNFR-induced IL8 production. In these cases, the species specificity of the human IL8 ELISA ensures that IL8 production only derives from the TNFR responder cells so that a contribution of the FcγR anchoring cells can be ruled out. 2. Instead of FcγR transfectants cells with endogenous FcγR expression (e.g., murine A20 cells, human THP-1 cells, primary myeloid cells) can also be used. The relevance of FcγR binding for agonistic activity will then be acquired by comparison with groups in which FcγRs have been blocked with high concentrations of an irrelevant antibody species. 3. If antibody variants or mutants with an unknown ability to interact with a certain FcγR type are investigated, the principal FcγR-binding ability of the antibody variant has to be checked,

FcγR Dependent Agonism

89

e.g., by use of an antibody variant genetically fused with a luciferase domain and binding studies based on the detection of luminescence activity [16]. 4. Other prominently secreted factors, besides IL8, that are under the control of the NFκB system can also be used for detection of TNFR activation. In principle, every easily measurable readout triggered in the TNFR responder cells but not in the FcγR anchoring cells might be used for measuring TNFR activation as well. 5. Please note since the FcγR-dependency of agonistic activity of anti-TNFR antibodies can be overcome by oligomerization (e.g., by protein G or anti-IgG crosslinking), antibodies or antibody preparations showing FcγR-independent activity have to be checked for aggregated antibody species to allow final conclusions.

Acknowledgments This work was funded by the Deutsche Forschungsgemeinschaft (DFG, German Research Foundation)—Projektnummer 324392634—TRR 221 and WA 1025/31-1. References 1. Aggarwal BB, Gupta SC, Kim JH (2012) Historical perspectives on tumor necrosis factor and its superfamily: 25 years later, a golden journey. Blood 119:651–665 2. Wajant H (2015) Principles of antibodymediated TNF receptor activation. Cell Death Differ 22:1727–1741 3. Dahan R, Barnhart BC, Li F et al (2016) Therapeutic activity of agonistic, human anti-CD40 monoclonal antibodies requires selective FcgammaR engagement. Cancer Cell 29:820–831 4. Jodo S, Kung JT, Xiao S et al (2003) AntiCD95-induced lethality requires radioresistant Fcgamma RII+ cells. A novel mechanism for fulminant hepatic failure. J Biol Chem 278:7553–7557 5. Li F, Ravetch JV (2011) Inhibitory Fcgamma receptor engagement drives adjuvant and antitumor activities of agonistic CD40 antibodies. Science 333:1030–1034 6. Li F, Ravetch JV (2012) Apoptotic and antitumor activity of death receptor antibodies require inhibitory Fcgamma receptor engagement. Proc Natl Acad Sci U S A 109:10966–10971

7. Li F, Ravetch JV (2013) Antitumor activities of agonistic anti-TNFR antibodies require differential FcgammaRIIB coengagement in vivo. Proc Natl Acad Sci U S A 110:19501–19506 8. Medler J, Nelke J, Weisenberger D et al (2019) TNFRSF receptor-specific antibody fusion proteins with targeting controlled FcgammaRindependent agonistic activity. Cell Death Dis 10:224 9. Salzmann S, Seher A, Trebing J et al (2013) Fibroblast growth factor inducible (Fn14)specific antibodies concomitantly display signaling pathway-specific agonistic and antagonistic activity. J Biol Chem 288:13455–13466 10. Trebing J, Lang I, Chopra M et al (2014) A novel llama antibody targeting Fn14 exhibits anti-metastatic activity in vivo. MAbs 6:297–308 11. White AL, Chan HT, Roghanian A et al (2011) Interaction with FcgammaRIIB is critical for the agonistic activity of anti-CD40 monoclonal antibody. J Immunol 187(4):1754–1763. https://doi.org/10.4049/jimmunol. 1101135 12. White AL, Dou L, Chan HT et al (2014) Fcgamma receptor dependency of agonistic

90

Juliane Medler and Harald Wajant

CD40 antibody in lymphoma therapy can be overcome through antibody multimerization. J Immunol 193:1828–1835 13. Wilson NS, Yang B, Yang A et al (2011) An Fcgamma receptor-dependent mechanism drives antibody-mediated target-receptor signaling in cancer cells. Cancer Cell 19:101–113 14. Xu Y, Szalai AJ, Zhou T et al (2003) Fc gamma Rs modulate cytotoxicity of anti-Fas antibodies: implications for agonistic antibody-based therapeutics. J Immunol 171:562–568

15. Zhang P, Tu GH, Wei J et al (2019) Ligandblocking and membrane-proximal domain targeting anti-OX40 antibodies mediate potent T cell-stimulatory and anti-tumor activity. Cell Rep 27:3117–3123 16. Lang I, Kums J, Wajant H (2017) Generation and application of bioluminescent CD95 ligand fusion proteins. Methods Mol Biol 1557:63–77

Chapter 7 Generation and Evaluation of Bispecific Anti-TNF Antibodies Based on Single-Chain VHH Domains M. A. Nosenko, K. -S. N. Atretkhany, V. V. Mokhonov, S. A. Chuvpilo, D. V. Yanvarev, M. S. Drutskaya, S. V. Tillib, and S. A. Nedospasov Abstract Systemic cytokine inhibition may be an effective therapeutic strategy for several autoimmune diseases. However, recent studies suggest that tissue or cell type–specific targeting of certain cytokines, including TNF, may have distinct advantages and show fewer side effects. Here we describe protocols for generating and testing bispecific cytokine inhibitors using variable domain of single-chain antibodies from Camelidae (VHH) with a focus on cell-specific TNF inhibitors. Key words Bispecific antibody, VHH, Camelidae, Anti-cytokine therapy, TNF

1

Introduction Pharmacological inactivation of proinflammatory cytokines, most importantly TNF, represents a major advance in the therapy of autoimmune diseases [1]. In this regard, a variety of monoclonal antibodies targeting TNF, as well as other cytokines, has been generated and is successfully used in clinic. However, systemic anticytokine therapy is usually associated with a number of side effects, including immunosuppression [2], reactivation of tuberculosis [3], and others. Recent studies in mice revealed that these effects can be related to essential physiological functions of proinflammatory cytokines that are disrupted by systemic cytokine ablation in the course of therapy [4–7]. Thus, generation of more specific anticytokine or antireceptor therapeutics represents an emerging trend in treatment of autoimmune diseases. Mice with conditional genetic inactivation of cytokine genes in distinct cellular sources show different contributions to overall beneficial and deleterious cytokine functions. For example, TNF produced by myeloid cells, but not by T-cells or B-cells, is pathogenic in mouse models of rheumatoid arthritis, experimental autoimmune

Jagadeesh Bayry (ed.), The TNF Superfamily: Methods and Protocols, Methods in Molecular Biology, vol. 2248, https://doi.org/10.1007/978-1-0716-1130-2_7, © Springer Science+Business Media, LLC, part of Springer Nature 2021

91

92

M. A. Nosenko et al.

encephalomyelitis, and LPS-D/Gal-induced acute hepatotoxicity [5, 6, 8]. At the same time, TNF from T- and B-cells is crucial for lymphoid tissue organization and for protection against M. tuberculosis [3]. These findings suggest that myeloid cell-derived TNF is an attractive target for therapy and its efficacy may be higher than systemic anti-TNF therapy due to lesser side effects. One approach for more selective tissue-specific cytokine inhibition may be implemented by the use of bispecific antibodies [9]. Such reagents consist of two modules, the first one is specific for the cytokine (or its receptor) and the second recognizes cell surface marker of a certain cell population. In particular, we have generated and evaluated several types of myeloid cell-specific human TNF and IL-6 inhibitors, with one specificity directed against cytokine and the other specificity to either murine F4/80 [9] or CD11b [10]. We designated myeloid cell–specific TNF inhibitors as MYSTI and tested them in vitro and in vivo in mouse models [9, 11, 12]. Our data indicate that despite the same anti-TNF module [13] bispecific antibodies may show substantial differences when tested in vitro or in vivo as compared to similar control reagents lacking cell type-specific modules. Here we describe how to design, produce, purify, and test bispecific anticytokine reagents (with TNF as example target) based on small VHH variable domains from Camelidae antibodies [14–18].

2

Materials

2.1 Animal Immunization and Lymphocyte Preparation

1. A llama (Llama glama) or a two-hump camel (Camelus bactrianus). 2. Recombinant TNF for generation of antibodies, 5–10 mg (see Note 1). 3. Complete and incomplete Freund’s adjuvant (Sigma Aldrich). 4. Histopaque-1077 (Merck KGaA). 5. PBS-EDTA: acid EDTA.

PBS,

1

mM

ethylenediaminetetraacetic

6. Centrifuge with refrigeration, suitable for 50-mL tubes. 7. 50-mL tubes. 2.2 Library Preparation and VHH Screening

1. TRIZol (ThermoFisher). 2. Oligo (dT)-cellulose (New England Biolabs). 3. M-MuLV reverse transcriptase (New England Biolabs). 4. Taq-polymerase with buffer and dNTP mix (New England Biolabs).

Generation of Bispecific Antibodies

93

5. Specific primers for variable domains of single-chain antibodies (site for restriction enzymes NcoI, PstI, and NotI are underlined): Camel VHH: Cam-01 50 -gtcctggctgctcttctacaagg-30 . Cam-02 50 -ggtacgtgctgttgaactgttcc-30 . Cam-03 50 -cgagccgaccatggccctgcaggtgcagctggtggagtctgg-30 . Cam-04 50 -ggactagtgcggccgcttgaggagacggtgacctgggt-30 . Llama VHH: Lam_back 50 -aggtsmarctgcagsagtcwgg-30 . Lam-01 50 -ggtatggatccttgggttttggdgggaagakgaagacdgatgg-30 . Lam-03 50 -ggtatggatccacrtccaccaccacrcaygtgacct-30 . Lam-07 50 -aacagttaagcttccgcttgcggccgcggagctggggtcttcgctgtgg tgcg-30 . Lam-08 50 -aacagttaagcttccgcttgcggccgctggttgtggttttggtgtgttgg gtt-30 6. Thermal cycler for PCR. 7. Standard agarose DNA gel electrophoresis. 8. DNA gel extraction kit QIAEX II (Qiagen). 9. Restriction enzymes: PstI, NcoI, and NotI for preparation of the libraries; HinfI, MspI, RsaI for VHH fingerprint analysis. 10. E. coli strains: TG1, XL1-Blue. 11. Standard E. coli cloning materials, including agar plate with LB medium with ampicillin. 12. Helper phage M13K07 (New England Biolabs). 13. Phagemid vectors: pHEN4, pHEN6. 14. Nunc-immuno plate F96 maxisorp (Nunc). 15. Tris-buffered saline (TBS). 16. TBST: TBS, 0.1% Tween20. 17. Blocking solution: TBS, 5% skim milk, or 1% bovine serum albumin (BSA). 18. Spectrophotometer NanoDrop (ThermoFisher). 19. Ni-NTA agarose (ThermoFisher). 20. QIAExpressionist purification system (Qiagen).

94

M. A. Nosenko et al.

2.3 Preparation, Expression, and Purification of Bispecific Antibody Constructs

1. VHH modules recognizing cytokine (e.g., human TNF or IL-6), cell surface markers (e.g., murine F4/80 or CD11b) and control modules inserted in expression vectors (see Note 2). 2. Temperature-controlled incubator for bacterial culture. 3. 2-L flasks. 4. Primers for Gibson assembly. 5. Exonuclease T5 (New England Biolabs). 6. Taq DNA ligase (New England Biolabs). 7. Phusion High-Fidelity DNA polymerase (New England Biolabs). 8. Dimethyl sulfoxide (DMSO). 9. 2.5 mM each dNTP (ThermoFisher). 10. DH5α-Competent cells (ThermoFisher) and Rosetta™ 2 (DE3) Singles™ Competent Cells (Merck KGaA). 11. Standard E. coli cloning materials, including agar plate with LB medium, antibiotics (e.g., Ampicillin, Chloramphenicol). 12. DNA sequencer for plasmid verification. 13. Isopropyl β-d-1-thiogalactopyranoside (IPTG, Merck KGaA). 14. Orbital shaker. 15. Vivaspin 20 centrifugal concentrator. 16. Dialysis tubing cellulose membrane (Merck KGaA). 17. Sonicator. 18. Ni Sepharose® 6 Fast Flow (Merck KGaA). 19. Bacterial lysis buffer: 25 mM HEPES, 500 mM NaCl, 5 mM Imidazole, 10% w/w glycerol, 1% w/w Triton X100, 1 mM 2-mercaptoethanol, pH 8.0, adjust with NaOH, DNase I 10 μg/mL, RNaseA 10 μg/mL, Lysozyme 50 μg/mL, PMSF 0.2 mM. 20. Washing buffer: 25 mM HEPES, 500 mM NaCl, 15 mM Imidazole, 10% w/w glycerol, 0.2% w/w Triton X100, 1 mM 2-mercaptoethanol, pH 8.0, adjust with HCl. 21. Elution buffer: 25 mM HEPES, 500 mM NaCl, 300 mM Imidazole, 10% w/w glycerol, 0.2% w/w Triton X100 1 mM 2-mercaptoethanol, pH 8.0, adjust with HCl. 22. Dialysis buffer 1: 150 mM NaCl, 5% glycerol, 25 mM HEPES, 5 mM EDTA, 1 mM 2-mercaptoethanol, 0.2 mM phenylmethylsulfonyl fluoride (PMSF), pH 8.0, adjust with NaOH.

Generation of Bispecific Antibodies

95

23. Dialysis buffer 2: 150 mM NaCl, 5% glycerol, 25 mM HEPES, 0.5 mM EDTA, 0.1 mM 2-mercaptoethanol, pH 8.0, adjust with NaOH. 24. Dialysis buffer 3: 150 mM NaCl, 5% glycerol, 25 mM HEPES, 0.5 mM EDTA, pH 8.0, adjust with NaOH. 25. SDS-PAGE system: 12%. 2.4 Labeling and Testing Bispecific Antibodies

1. Specific ELISA kit for cytokine (e.g., TNF) (ThermoFisher). 2. ELISA plate reader. 3. Phosphate-buffered saline (PBS). 4. PBST: PBS, 0.1% Tween20. 5. E.coli LPS (SigmaAldrich). 6. 1 M carbonate buffer (to prepare buffer with pH ¼ 9.5 mix 7 parts of 1 M sodium bicarbonate solution with 3 parts of 1 M sodium carbonate solution). Prepare fresh and use as 10 stock. 7. DMSO. 8. Fluorescein isothiocyanate isomer I, suitable for protein labeling (FITC, Sigma-Aldrich). 9. PD10 or other desalting column (GE Healthcare). 10.

125

INa (20 mBq, 1 MBq/μL, Khlopin Radium Institute, St Petersburg, Russia).

11. 100 mM NaHPO4, pH 7.2 (phosphate buffer). 12. Centrifuge with refrigeration, suitable for 50-mL tubes. 13. 50-mL tubes. 14. Alum foil. 15. Chloramine-T trihydrate 95% (Sigma-Aldrich). 16. Dithiothreitol (DTT, Sigma-Aldrich). 17. Microspin™ G-25 Columns (GE Healthcare, Sigma-Aldrich). 18. Sodium iodide, sodium dihydrophosphate (Sigma-Aldrich). 19. Liquid scintillation counter (e.g., Tricarb-2810, Perkin Elmer). 20. Primary culture of murine bone marrow–derived macrophages (BMDM). 21. Humidified, CO2, and temperature-controlled incubator. 22. Complete DMEM: DMEM, 2 mM L-Gln, 100 U/mL Penicillin, 100 μg/mL Streptomycin, 10% fetal bovine serum. 23. Viability Dye, anti-F4/80, anti-hTNF, anti-Fcγ, suitable for flow cytometry (ThermoFisher, Miltenyi). 24. Recombinant cytokine of interest (e.g., human TNF). 25. Flow cytometer.

96

3

M. A. Nosenko et al.

Methods This protocol consists of three parts: generation and selection of VHHs (see Subheading 3.1), generation and purification of bispecific antibody using two VHHs (see Subheading 3.2), and testing bispecific antibodies in vitro (see Subheading 3.3). If you already have selected VHHs, you may proceed to Subheading 3.2.

3.1 Generation of New VHHs 3.1.1 Animal Immunization

1. Prepare recombinant protein of interest (e.g., F4/80, CD11b, TNF or IL-6, see Note 1) sufficient for 5 consequent immunizations of llama or camel (1–2 mg of protein for one immunization). Perform first immunization in complete Freund’s adjuvant (total volume—8-10 mL, protein to adjuvant ratio—1:1) in 4–5 subcutaneous sites. 2. Perform second immunization 3–4 weeks after the first immunization and the remaining three immunizations at 10-day intervals the same as first immunization, but using incomplete Freund’s adjuvant. 3. After 5 days from the last immunization, collect 150 mL of blood from immunized animal and mix with 150 mL of PBS-EDTA, to prevent blood clotting. 4. Isolate peripheral blood mononuclear cells (PBMC) using gradient centrifugation in Histapaque-1077 medium. Add 35 mL of diluted blood on the top of 15 mL of Histopaque in 50-mL tubes and centrifuge for 20 min, 800  g. 5. Collect the interphase containing PBMC and wash with PBS-EDTA. 6. Pellet the cells. Proceed to library preparation.

3.1.2 Preparation of VHH Library

1. Prepare total RNA from ~107 of isolated PBMC according to manufacturer’s instruction for selected reagent (e.g., TRIZol). 2. Isolate mRNA using oligo(dT)-cellulose column according to manufacturer’s instructions. Measure RNA concentration on spectrophotometer using A260 absorption. 3. Generate cDNA from 1 μg of mRNA using reverse transcription kit and following manufacturer’s instructions (reaction volume—40 μL, use 1 μg of (dT)18 oligonucleotide as a primer). 4. Amplification of VH domains. For camel VHH, setup one PCR mix (50 μL), containing 1 μL of cDNA library from step 3 and 20 pmol of primers Cam-01 and Cam-02. For llama VHH, setup two PCR tubes (tube1-1 and tube1-2, 50 μL each), containing 1 μL of cDNA library and one of two pairs of primers (tube1-1: Lam_back and Lam-01; tube1-2: lam_back and Lam-03, final concentration for each primer—0.4 μM). Run PCR with the following program: 95  С—90 s, (95  С—

Generation of Bispecific Antibodies

97

30 s, 58  С—300 s, 72  С—90 s)  5 cycles, (95  С—30 s, 58  С—60 s, 72  С—60 s with an addition of 2 s for each of the following cycles)  25 cycles, 72  С—300 s. At the end, 1.5  volume of fresh PCR mix (75 μL) with primers and enzyme is added into each reaction tube and 1 additional final cycle of amplification is performed (95  С—120 s, 58  С— 120 s, 72  С—90 s)  1 cycle, 72  С—300 s. 5. Run PCR products on agarose DNA electrophoresis. Products, containing camel VHH fragments, should have size between 600 and 800 bp (450–520 bp for llama). Isolate them from the gel using DNA gel extraction kit according to the manufacturer’s instructions. 6. Setup the second PCR to amplify VHH fragments similar to step 4, but with VHH-specific primers. For camel antibodies combine primers Cam-03 and Cam-04, for llama antibodies run again two PCRs (tube2-1 and tube 2-2) with different pairs of primers (tube2-1: Lam_back and Lam-07; tube2-2: lam_back and Lam-08, final concentration for each primer— 0.4 μM). Add the material from tube 1-1 to tube 2-1 and the material from tube1-2 to tube 2-2. Use the same PCR protocol as in step 4. 7. Prepare new library by cloning llama VHH inserts (5 μg) into pHEN4 vector (10 μg) predigested with NcoI and NotI restriction enzymes using standard cloning procedures (setup overnight ligation). For camel VHH setup two libraries: with NcoI/NotI and PstI/NotI pairs of restriction enzymes to include in the library VHHs with sites for NcoI or PstI restriction enzyme inside the sequence. Combine libraries after ligation. 8. Grow E. coli (TG1 strain) and transfect them with generated plasmid library according to standard protocol. Grow transformed bacteria on LB-ampicillin agar plates overnight, scrap the colonies, and store at 80  C in LB medium. Proceed with library screening. 3.1.3 Selection of Specific VHH

1. Setup liquid culture with collected bacteria from previous step, grow to ~109 cells, and infect them with M13K07 phage. 2. Collect virions and proceed with selection. 3. Coat Nunc-immuno plate with 100 μL of recombinant protein (e.g., F4/80) in TBS for overnight, +4  С. 4. Discard protein solution and wash wells for three times with 300 μL of TBST. 5. Block wells with 200 μL of blocking solution for 2 h, room temperature. 6. Discard blocking solution, wash once with TBST and apply ~1011 phage particles per well.

98

M. A. Nosenko et al.

Fig. 1 HMR-analysis data (“HMR fingerprints”) for five selected clones of initially generated VHH library. Each HMR fingerprint is an electrophoregram, which consist of three gel lanes with separated DNA fragments obtained after parallel treatment of PCR product (an amplified nanoantibody sequence) with one of three restriction endonucleases, HinfI (H), MspI (M), or RsaI (R), and the fourth lane with marker DNA

7. Wash with TBST and elute bound virions with 50 mM diethylamine. 8. Repeat steps 1–7 additionally 2–3 times to enrich phages with specific VHH sequences. Instead of using transformed E. coli at step 1, infect grown TG1 bacteria with eluted phage with addition of helper phage M13K07. 9. To test library diversity before sequencing, perform “fingerprinting” analysis. Collect several single clones from phageinfected E. coli, amplify VHH sequences using PCR from step 6, Subheading 3.1.2. Split PCR products into three tubes and digest DNA with HinfI, MspI, and RsaI restriction enzymes (one enzyme per tube) following by agarose gel electrophoresis. Analyze resulting “fingerprints” to check for library diversity (Fig. 1). 10. Produce individual VHH proteins from selected clones to test their individual specificity. For this subclone selected sequences into expression plasmid (e.g., pHEN6) with the addition of His-tag at the 30 end of the construct, transfect E.coli (strain XL1-Blue), select one of transfected clones, and grow bacteria in LB medium with antibiotics. 11. Induce VHH expression by addition of 0.2 mM IPTG and subsequent overnight incubation at 37  С. Collect bacteria, isolate protein from periplasmic extract using Ni-NTA agarose and QIAExpressionist purification system according to the manufacturer’s instructions. 12. Check the specificity and affinity of generated VHHs by ELISA with antigen of interest and by surface plasmon resonance, respectively (see Note 3). 13. Determine DNA sequences for VHHs with highest affinity and use them for subsequent steps.

Generation of Bispecific Antibodies

3.2 Generation of Bispecific Antibodies from Single VHH Domains 3.2.1 Design and Assembly of Bispecific Antibodies

99

The desired bispecific antibody should contain the following fragments: the first VHH module, linker, the second VHH module, His-tag (see Note 4, Fig. 2). At least two different bispecific reagents should be generated (see Note 2). The first one is a bispecific antibody carrying both cytokine and target cell surface specificities (e.g., MYSTI that is specific for human TNF and murine F4/80). The second reagent is a control molecule that carries the same anticytokine specificity, but instead of second cell-targeting VHH module has irrelevant or mutated VHH (e.g., STI that has anti-hTNF module and irrelevant second VHH). In order to generate these bispecific constructs, Gibson assembly method can be used. 1. Select specific primers for amplification of the three main parts of a bispecific antibody (see Fig. 2). Primers should have 20–40 bp overlaps between two combined modules in order to provide enough specificity and assembly efficiency. Primer 1F should overlap with one end of target expression vector (e.g., pET22b+) and the first VHH module. Primers 1R and 2F should overlap with the first VHH module and the linker. Primers 2R and 3F should overlap with the linker and the second VHH module. Finally, primer 3R should overlap with the second VHH module and the distal end of the expression vector. Primers 1R, 2F and 2R, 3F are complementary to each other.

Fig. 2 Design of bispecific antibody based on single VHH fragments using Gibson assembly. First, several overlapping primers are designed at junctions of the inserts and the vector (in this case pET22b+). Second, DNA fragments are amplified using selected primers and high-fidelity DNA polymerase. Vector is digested with restriction enzymes (in this case, NdeI and XhoI). Finally, Gibson assembly is performed resulting in complete bispecific construct encoded in the plasmid, ready for further transformation and antibody expression

100

M. A. Nosenko et al.

2. Amplify insert fragments (VHH1, linker, VHH2) with selected primers. Use primers 1F and 1R for VHH1 fragment, 2F and 2R for linker fragment, 3F and 3R for VHH2 fragment. 3. Setup PCR mix for each of the fragments according to the manufacturer’s instructions (total 50 μL per one reaction). Use 50 ng of template DNA (plasmid, containing VHH from 3.1.21 or desired linker) and 2 μM concentration of primers. Run the PCR with the following program: 95  С—120 s, (95  С—30 s, 60  С—30 s, 72  С—120 s)  25 cycles, 72  С—120 s. 4. Purify amplified fragments using DNA gel electrophoresis and DNA gel extraction kit according to the manufacturer’s instructions. 5. Digest the vector for bispecific construct cloning/expression with selected restriction enzymes (e.g., for pET22b + NdeI and XhoI can be used). 6. Purify predigested vector using agarose gel electrophoresis and DNA gel extraction kit according to the manufacturer’s instructions. 7. Setup Gibson assembly mix (20 μL in total): 1 Phusion HighFidelity DNA polymerase buffer, 0.5 pM of each assembly components (digested vector and VHH1, linker, VHH2 modules), 5 mM NAD+, 0.1 mM each dNTP, 5 U exonuclease T5, 5 U Taq-DNA ligase, 5 U Phusion DNA polymerase, water to 20 μL. Incubate 1 h at 60  С, then 10 min at 94 С. 8. Cool on ice and transform E. coli (DH5α) with assembled plasmid DNA according to manufacturer’s protocol. 9. Grow cells on agar plate with LB medium containing corresponding antibiotic (e.g., for pET22b + Ampicillin (100 μg/mL) and Chloramphenicol (34 μg/mL)) at 37  C overnight. 10. Grow selected colonies in 2 mL of LB medium with antibiotic at 37  C overnight, isolate plasmids, and sequence the insert to confirm correct construct assembly. 11. After sequence confirmation, transform E. coli (Rosetta™ 2 (DE3) Singles™ Competent Cells) with isolated plasmid DNA according to manufacturer’s protocol. 12. Prepare agar plate with LB medium containing corresponding antibiotic (e.g., for pET22b + Ampicillin (100 μg/mL) and Chloramphenicol (34 μg/mL)). 13. Place transformed cells onto agar plates and incubate at 37  C overnight.

Generation of Bispecific Antibodies

101

14. Prepare preculture for protein expression: inoculate 5–7 transformed colonies into 100 mL of LB with appropriate antibiotics and shake at 37  C overnight (200 rpm/min). 15. Prepare culture for protein expression: dilute 100 mL of overnight precultured cells with 900 mL of LB with appropriate antibiotics in 2-L flasks and shake at 30  C until the OD600 reaches 0.5. 16. Add IPTG to the final concentration 0.5 mM and continue incubation for 7 h. 17. Collect cells by centrifugation at 4  C, 5000  g for 15 min, and freeze pellet at 70  C. 3.2.2 Isolation and Purification of Bispecific Antibodies

1. Resuspend 5 g of cell pellet in 25 mL of bacterial lysis buffer and incubate on ice for 15 min. 2. Disintegrate the cells by extensive sonication on ice to prevent overheating and centrifuge lysed cells at 4  C, 12,000  g for 15 min. Transfer the supernatant to a fresh 50 mL tube. 3. Prepare the affinity column: add 5 mL of Ni Sepharose® 6 Fast Flow to empty gravity column. 4. Wash the column with 5 bed volumes with the lysis buffer. 5. Transfer washed Ni Sepharose® 6 Fast Flow from gravity column to cell lysates in 50 mL tube and incubate on orbital shaker for 30 min at 4  C, 150 rpm. Transfer cell lysates incubated with Ni Sepharose® 6 Fast Flow back to gravity column. 6. Wash the column with 10 bed volumes of the washing buffer. 7. Elute the proteins with 2 bed volumes of elution buffer. Add 50 mM EDTA and 0.2 mM PMSF to the protein eluate. 8. Perform consecutive dialysis of the eluate against dialysis buffers 1, 2, and 3 (see Note 5). Use 1–2 L of each buffer. Incubate for 2 h at 4  C with gentle stirring. 9. Perform one additional dialysis in buffer 3 overnight at 4  C with gentle stirring of the buffer. 10. Concentrate the dialyzed proteins on Vivaspin 20 centrifugal concentrator to desired concentration and analyze the purity by 12% SDS-PAGE. 11. Aliquot and store the proteins at 80 before use (see Note 6).

102

M. A. Nosenko et al.

3.3 (Optional) Functional In Vitro Characterization of Bispecific Antibodies 3.3.1 Labeling of Bispecific Antibody with FITC

1. Prepare 2 mg/mL bispecific solution in 0.1 M carbonate buffer (see Note 7) and 10 mg/mL FITC solution in DMSO. 2. Add FITC solution to the bispecific to reach molar ratio of FITC/bispecific in the range 25–100 (see Note 8). 3. Wrap the tube in alum foil and incubate for 1 h, room temperature, shaking. 4. Dilute the mixture fourfold with PBS (final volume should be at least 1 mL). 5. Prepare desalting column according to the manufacturer’s instructions. For PD10 column: pour off the storage solution, wash the column 3 times with PBS, and then apply the sample. Centrifuge for 2 min, 1000  g. Collect the flow-through and discard the column after use. 6. Measure absorption at 280 and 493 nm. Calculate resulting F/P ratio (see Note 8).

3.3.2 FACS Analysis of Bispecific Antibodies

1. To confirm the specificity of generated bispecific antibodies use a cell culture, expressing both the surface marker and the cytokine of interest. Bone marrow–derived macrophages (BMDM) are used here as an example to test MYSTIs (see Note 9). 2. Block nonspecific Fc and protein binding to the cells by incubating them with Fcγ-specific antibody in 50 μL of PBS/2% FBS for 20 min, 4  C. 3. Wash cells once with 100 μL of PBS/2% FBS, centrifuge at 300  g, 5 min, 4  C. Do the same for consequent wash steps. 4. Incubate the cells with FITC-labeled bispecific antibodies, dissolved in PBS/2%FBS for 30 min, 4  C. Wash the cells (see step 3). 5. (Optional) To test the ability of a bispecific antibody to bind simultaneously to the cell surface and the cytokine, additionally incubate the cells with recombinant human TNF for 30 min, 4  C. Wash once and then incubate with the labeled anti-hTNF antibody, 30 min, 4  C (see Note 10). 6. Continue with standard flow cytometry staining of desired markers and a viability dye. 7. Analyze the cells using a flow cytometer (Fig. 3). Live cells should be stained with functional bispecific antibody (e.g., MYSTI) (Fig. 3a), but not with the control antibody (e.g., STI) (Fig. 3b). If cells were additionally stained with recombinant human TNF and anti-hTNF antibody, then double staining for both MYSTI and hTNF is expected for the majority of the cells (Fig. 3c).

Generation of Bispecific Antibodies

a

hTNF

10

5

b

MYSTI Q6 0,044

Q5 0

10

5

c

STI Q6 0,56

Q5 0,61

MYSTI + hTNF 5

10

104

104

104

103

103

103

102 0 –102

Q8 0,71 0

102 0 Q8 –102 96,4

Q7 99,2 103

104

5

10

0

103

104

103

Q6 60,7

Q5 0

Q7 2,39

102 0 Q8 –102 0,34

105

0

Q7 38,9 103

104

105

bispecific-FITC

Fig. 3 Flow cytometry analysis of FITC-labeled bispecific antibodies (in this case, MYSTI and STI). Staining of bone marrow–derived macrophages (BMDM): staining of live (viability dye-negative) cells with bispecific antibodies demonstrates the specificity of functional (MYSTI, (a), but not control (STI, (b) antibody. MYSTI is also able to bind to the cell surface and to hTNF simultaneously as demonstrated by double staining for MYSTI and hTNF (c) 3.3.3 Labeling of Bispecific Antibodies with 125I (See Note 11)

1. Dissolve 125INa in appropriate volume of phosphate buffer (100 mM, pH 7.2) and add nonradioactive NaI to reach activity of 0.1 MBq/μL and total NaI concentration of 200 μM. Prepare 33 μM solutions of bispecific antibodies (both functional and control) in the same buffer as for NaI dissolution. 2. Mix 20 μL of NaI solution (4 nmol) with 30 μL of bispecific antibody solution (1 nmol) and cool the reaction mixture to 0  C (ice bath). 3. Add 5 μL of chloroamine-T water solution (20 nmol) and incubate for 4–5 min at 0  C. 4. Stop the reaction with 10 μL of water solution, containing 20 nmol of DTT. After 5 min at room temperature add to the reaction mixture 200 μL of phosphate buffer (100 mM, pH 7.2). 5. Equilibrate G-25 spin-column with phosphate buffer (0.5 mL), then transfer all reaction mixture to the column, and centrifuge at 1000  g for 3 min. Calculate resulting radioactivity per ng of the protein using liquid scintillator counter. 6. BMDM or any other attached cells of interest should be seeded onto 24-well plates (5  105cells/well). 7. Remove cell media, wash up twice with 500 μL PBS, then add to each well 400 μL of PBS containing 0.1–10 μg of 125 I-labeled protein (see Note 12). 8. Incubate at 0  C for 30 min, discard the solution, and wash the cells twice with 400 μL of PBS.

104

M. A. Nosenko et al.

a

b

cell-bound antibody, ug/well

1,2 MYSTI

1,0

STI

0,8 0,6 0,4 0,2 0,0 0

2

4

6

8

10

initial concentration of antibody in the medium, ug/ml

Fig. 4 (a) Using of iodine-labeled bispecific antibody to evaluate its binding capacity to the surface of macrophages. 125I-labeled MYSTI or STI were incubated with BMDM at indicated concentrations (initial concentration of antibody in the medium, X-axis). Cells were washed and then the radioactivity from cellbound bispecific antibodies was quantified and used to calculate the amount of cell-bound proteins (cellbound antibody, Y-axis). This analysis is convenient for kinetic studies of bispecific Abs as well as for comparative quantitative analysis of cell binding by different bispecific antibodies. (b) Functional analysis of bispecific antibodies in vitro using cytokine-release assay. BMDM from hTNF KI mice (producing human TNF instead of murine TNF) were incubated with MYSTI or STI, washed and activated with LPS to induce hTNF production and secretion. Results indicate that MYSTI, but not STI, can completely prevent hTNF release from BMDM upon activation with LPS

9. Lyse the cells with 400 μL of any lysing buffer, transfer the lysates to 1.5 mL polyethylene tubes, then quantify radioactivity using liquid scintillator counter and gamma vials. 10. Use radioactivity per protein value, measured in step 5, to calculate the resulting amount of the bound protein per well. Plot these values as a function of the initial antibody concentration (see Fig. 4a, for representative results). 3.3.4 Cytokine-Release Assay

1. To functionally test generated bispecific antibody, seed 10-day BMDM in V-shaped 96-well plates, 0.5–1  105cells/well in 100 μL of complete DMEM. 2. Add functional (e.g., MYSTI) or control (e.g., STI) bispecific antibody to the cells using the concentration that is sufficient for functional antibody to stain the majority of the cells in flow cytometry analysis (see Subheading 3.3.2). Use the same concentration for control antibody. Use PBS as a negative control. Incubate the cells for 20 min at +4  C. 3. Spin the cells down in V-shaped 96-well plates at 300  g, +4  C for 5 min, discard the medium, wash the cells with 200 μL of PBS for a total of three times. Resuspend cells in 200 μL of complete DMEM with 100 ng/mL of E. coli LPS, and transfer cells to F-shaped 96-well plates, incubate for 4 h, +37  C, 5% CO2 (see Note 13) to allow adhesion and activation of macrophages. Use nonactivated cells as a control.

Generation of Bispecific Antibodies

105

4. Collect the medium and proceed with specific ELISA for cytokine of interest (e.g., human TNF). Refer to Fig. 4b for the expected results. Cells that were prestained with a functional bispecific antibody (e.g., MYSTI) should accumulate less human TNF in culture medium after LPS stimulation, compared to control antibody (e.g., STI) or PBS-treated cells.

4

Notes 1. The source of recombinant protein is crucial for successful generation of functional VHH. It is recommended to use eukaryotic expression system since their production in bacteria will lead to altered glycosylation that might affect antibody specificity. Use the recombinant cytokines for generation of anticytokine VHHs. The second specificity of bispecific antibody should recognize unique surface marker for the cell type of interest. Consider to use extracellular part of the cell surface protein for immunization and selection of VHHs to increase the prevalence of cell surface–targeting VHHs. 2. Control reagents should be generated to correctly evaluate the bispecific antibody. First, the systemic cytokine inhibitor can be generated, consisting of the same anticytokine VHH, but with the second module bearing either no specificity or with specificity to broadly expressing proteins (e.g., albumin as exemplified in [19]). Nonspecific VHH module can be generated by introducing targeted mutations into CDRs of cell marker– specific VHH used in the functional bispecific reagent. However, keep in mind that a bispecific antibody lacking the second specificity may be rapidly cleared from the circulation. At the same time, cell-targeting bispecific antibody is expected to have an increased half-life time due to binding of the cell surface. Full-size antibodies can also be used as systemic anticytokine control; however, the differences in molecular mass should be considered. 3. For plasmon resonance, you can use Biacore (GE Healthcare). 4. The order of VHH domains within bispecific antibody as well as the exact structure of the linker sequence may be crucial for bispecific functionality and affinity [20]. 5. The composition of the final dialysis buffer is crucial both for protein stability and solubility. The buffer should not contain primary amines, as it will interfere with consequent FITClabeling step. 6. Freshly isolated bispecific proteins are usually stable at +4  C for several months. Once frozen at liquid nitrogen, the

106

M. A. Nosenko et al.

bispecific protein can be stored for several years. Thaw the vial overnight at +4  C and avoid repeated freezing. Thawed vial is stable for approximately 1–2 months. 7. Borate buffer, pH 9, is also suitable for FITC labeling. 8. FITC and protein concentrations can be titrated in order to find the most suitable labeling conditions. Refer to manufacturer’s instruction (Sigma Aldrich) for calculation of resulting F/P ratio (protein molecular mass, extinction coefficient and A280, A493 absorption of labeled protein will be required). 9. MYSTI recognizes human TNF and murine macrophage marker F4/80. To allow for testing in vitro and in vivo, we used mice that produce human TNF instead of murine TNF (TNF-humanized mice [21, 22]). 10. To test for simultaneous binding of cell surface and the target cytokine, an additional anticytokine antibody that does not interfere with anticytokine VHH binding should be used. When generating MYSTI, we tested several commercially available clones of anti-TNF antibodies and found only one that can bind to MYSTI-bound human TNF. Using this antibody, we were able to perform double staining of the cells as shown on Fig. 4 (see also [11] for the details). 11. Additional details for the iodine labeling protocol can be found in [23]. 12. We recommend to test several concentrations of iodine-labeled bispecific and analyze the resulting amount of cell-bound protein as a function of initially added bispecific antibody (as demonstrated in Fig. 4a). This will give an estimation of maximum possible reagent bound per cell that can be compared between different bispecific antibodies. 13. Consider using the most potent activator of cytokine of interest expression in selected cell type (e.g., LPS for macrophages to study TNF).

Acknowledgments Authors thank Drs. A. Kruglov and G. Efimov for advice and Russian Science Foundation (grant #19-75-30032) for financial support. Sequencing of VHH-encoding constructs was performed using the equipment of EIMB RAS ‘Genome’ center (http://www. eimb.ru/ru1/ckp/ccu_genome_c.php).

Generation of Bispecific Antibodies

107

References 1. Drutskaya MS, Efimov GA, Kruglov AA, Nedospasov SA (2017) Can we design a better anti-cytokine therapy? J Leukoc Biol 102:783–790 2. Fernandez-Ruiz M, Aguado JM (2018) Risk of infection associated with anti-TNF-alpha therapy. Expert Rev Anti-Infect Ther 16:939–956 3. Allie N, Grivennikov SI, Keeton R et al (2013) Prominent role for T cell-derived tumour necrosis factor for sustained control of Mycobacterium tuberculosis infection. Sci Rep 3:1809 4. Kroetsch JT, Levy AS, Zhang H et al (2017) Constitutive smooth muscle tumour necrosis factor regulates microvascular myogenic responsiveness and systemic blood pressure. Nat Commun 8:14805 5. Grivennikov SI, Tumanov AV, Liepinsh DJ et al (2005) Distinct and nonredundant in vivo functions of TNF produced by T cells and macrophages/neutrophils: protective and deleterious effects. Immunity 22:93–104 6. Kruglov AA, Lampropoulou V, Fillatreau S, Nedospasov SA (2011) Pathogenic and protective functions of TNF in neuroinflammation are defined by its expression in T lymphocytes and myeloid cells. J Immunol 187:5660–5670 7. Tumanov AV, Grivennikov SI, Kruglov AA et al (2010) Cellular source and molecular form of TNF specify its distinct functions in organization of secondary lymphoid organs. Blood 116:3456–3464 8. Kruglov A, Drutskaya M, Schlienz D et al (2020) Contrasting contributions of TNF from distinct cellular sources in arthritis. Ann Rheum Dis. Published Online First: 12 August 2020. https://doi.org/10.1136/ annrheumdis-2019-216068 9. Efimov GA, Kruglov AA, Khlopchatnikova ZV et al (2016) Cell-type–restricted anti-cytokine therapy: TNF inhibition from one pathogenic source. Proc Natl Acad Sci 113:3006–3011 10. Rashidian M, Keliher EJ, Bilate AM et al (2015) Noninvasive imaging of immune responses. Proc Natl Acad Sci 112:6146–6151 11. Nosenko MA, Atretkhany K-SN, Mokhonov VV et al (2017) VHH-based bispecific antibodies targeting cytokine production. Front Immunol 8:1073 12. Nosenko MA, Atretkhany K-SN, Mokhonov VV et al (2019) Modulation of bioavailability of proinflammatory cytokines produced by myeloid cells. Semin Arthritis Rheum 49: S39–S42 13. Coppieters K, Dreier T, Silence K et al (2006) Formatted anti-tumor necrosis factor alpha

VHH proteins derived from camelids show superior potency and targeting to inflamed joints in a murine model of collagen-induced arthritis. Arthritis Rheum 54:1856–1866 14. Hamers-Casterman C, Atarhouch T, Muyldermans S et al (1993) Naturally occurring antibodies devoid of light chains. Nature 363:446–448 15. Arbabi Ghahroudi M, Desmyter A, Wyns L et al (1997) Selection and identification of single domain antibody fragments from camel heavy-chain antibodies. FEBS Lett 414:521–526 16. Van Der Linden R, De Geus B, Stok W et al (2000) Induction of immune responses and molecular cloning of the heavy chain antibody repertoire of Lama glama. J Immunol Methods 240:185–195 17. Saerens D, Kinne J, Bosmans E et al (2004) Single domain antibodies derived from dromedary lymph node and peripheral blood lymphocytes sensing conformational variants of prostate-specific antigen. J Biol Chem 279:51965–51972 18. Alturki NA, Henry KA, MacKenzie CR, Arbabi-Ghahroudi M (2015) Isolation of camelid single-domain antibodies against native proteins using recombinant multivalent peptide ligands. Methods Mol Biol 1348:167–189 19. Beirnaert E, Desmyter A, Spinelli S et al (2017) Bivalent llama single-domain antibody fragments against tumor necrosis factor have Picomolar potencies due to intramolecular interactions. Front Immunol 8:867 20. Vasilenko EA, Gorshkova EN, Astrakhantseva IV et al (2020) The structure of myeloid cellspecific TNF inhibitors affects their biological properties. FEBS Lett. Published Online First: 31 August 2020. https://doi.org/10.1002/ 1873-3468.13913 21. Olleros ML, Chavez-Galan L, Segueni N et al (2015) Control of mycobacterial infections in mice expressing human tumor necrosis factor (TNF) but not mouse TNF. Infect Immun 83:3612–3623 22. Atretkhany KSN, Mufazalov IA, Dunst J et al (2018) Intrinsic TNFR2 signaling in T regulatory cells provides protection in CNS autoimmunity. Proc Natl Acad Sci 115:13051–13056 23. Meier SR, Syvanen S, Hultqvist G et al (2018) Antibody-based in vivo PET imaging detects amyloid-beta reduction in Alzheimer transgenic mice after BACE-1 inhibition. J Nucl Med 59:1885–1891

Chapter 8 In Vitro Physical and Functional Interaction Assays to Examine the Binding of Progranulin Derivative Atsttrin to TNFR2 and Its Anti-TNFα Activity Wenyu Fu, Aubryanna Hettinghouse, and Chuan-Ju Liu Abstract TNFα/TNFR signaling plays a critical role in the pathogenesis of various inflammatory and autoimmune diseases, and anti-TNFα therapies have been accepted as the effective approaches for treating several autoimmune diseases. Progranulin (PGRN), a multi-faced growth factor–like molecule, directly binds to TNFR1 and TNFR2, particularly to the latter with higher affinity than TNFα. PGRN derivative Atsttrin is composed of three TNFR-binding domain of PGRN and exhibits even better therapeutic effects than PGRN in several inflammatory disease models, including collagen-induced arthritis. Herein we describe the detailed methodology of using (1) ELISA-based solid phase protein–protein interaction assay to demonstrate the direct binding of Atsttrin to TNFR2 and its inhibition of TNFα/TNFR2 interaction; and (2) tartrate-resistant acid phosphatase (TRAP) staining of in vitro osteoclastogenesis to reveal the cellbased anti-TNFα activity of Atsttrin. Using the protocol described here, the investigators should be able to reproducibly detect the physical inhibition of TNFα binding to TNFR and the functional inhibition of TNFα activity by Atsttrin and various kinds of TNF inhibitors. Key words TNFα, Progranulin, Atsttrin, TNFR2, ELISA-based protein–protein interaction assay, In vitro osteoclastogenesis

1

Introduction TNFα/TNFR signaling orchestrates a wide range of inflammatory processes, and plays a crucial role in the pathogenesis of various inflammatory autoimmune diseases [1–4]. TNFR1 primarily mediates the inflammatory activity of TNFα, whereas emerging evidence indicates that TNFR2 plays a protective and antiinflammatory role in various diseases [5–8]. Our genetic screen for the binding partners of progranulin (PGRN), a growth factor–like molecule with multiple functions [9–14], led to the isolation of TNFR2 as the PGRN-binding receptor [15]. Remarkably, PGRN exhibits an approximately 600-fold higher-binding affinity to TNFR2 than does TNFα. Moreover, beyond the binding of

Jagadeesh Bayry (ed.), The TNF Superfamily: Methods and Protocols, Methods in Molecular Biology, vol. 2248, https://doi.org/10.1007/978-1-0716-1130-2_8, © Springer Science+Business Media, LLC, part of Springer Nature 2021

109

110

Wenyu Fu et al.

PGRN to TNFR, growing evidence demonstrates that PGRN/ TNFR interactions play an important role in various kinds of diseases and conditions [12–42]. PGRN is a 593-aa secreted glycoprotein. It contains seven-anda half repeats of a cysteine-rich motif in the order P-G-F-B-A-C-DE and forms a unique “beads-on-a-string” structure [43, 44]. In an effort to identify the minimal required domains of PGRN that retain comparable TNFR binding affinity of PGRN, an engineered protein composed of FAC domain of PGRN is created and referred to as Atsttrin (antagonist of TNFα/TNFR signaling via targeting to TNF receptors), which, similar to PGRN, exhibits higher binding affinity for TNFR2, but lower affinity for TNFR1 than TNFα [15, 45, 46]. More importantly, Atsttrin exhibits therapeutic effects in various diseases [15, 21, 34, 47, 48], and surpasses PGRN in collagen-induced arthritis model in vivo [15]. In addition, Atsttrin has been show to exhibit a preventive effect in non-surgically or surgically induced rodent osteoarthritis models [38], and Atsttrintransduced mesenchymal stem cells articular treatment prevents osteoarthritis progression in surgically induced murine osteoarthritis model [49]. Atsttrin also enhances bone regeneration in several bone defect models [50]. It is known that inflammatory cytokine TNFα acts in concert with RANKL to promote osteoclastogenesis [51–54], and our previous studies demonstrated that Atsttrin inhibited osteoclastogenensis in vitro [15] and bone loss in vivo [38]. Herein, we describe the detailed methodology of using (1) ELISA-based solid phase protein–protein interaction to demonstrate the direct binding of PGRN-derived Atsttrin to TNFR and its inhibition of TNFα/TNFR interaction (Figs. 1 and 2); and (2) tartrate-resistant acid phosphatase (TRAP) staining, which is widely accepted as an important cytochemical marker of oscteoclasts, to reveal the cell-based anti-TNFα activity of Atsttrin (Fig. 3).

2 2.1

Materials ELISA

1. Recombinant proteins: Recombinant Atsttrin (Atreaon, Inc), Recombinant Human TNFR2, (R&D Systems, carrier free), Recombinant Human TNFα (R&D Systems, carrier free). 2. EZ-Link Sulfo-NHS-Biotinylation Kit (Thermo scientific). 3. Zeba Spin Desalting Column (Thermo scientific). 4. Tris-buffered saline (TBS): 10 mM Tris–HCl, pH 7.4, 150 mM NaCl. 5. Binding buffer: TBS saline, 0.1% (w/v) bovine serum albumin (BSA), 1 mM CaCl2. Prepare fresh.

Assays to Test Atsttrin’s Binding to TNFR2 and its Anti-TNF Activity

a

Protein to protein binding immobilized protein coating (protein A) Wash Blocking Biotinylated protein binding (protein B) Wash Streptavidin-HRP Wash

111

b Inhibition binding immobilized protein coating (protein A) Wash Blocking Biotinylated protein (protein B) plus protein of interest (protein C) binding Wash Streptavidin-HRP Wash

TMB

TMB

Stop

Stop

Fig. 1 ELISA-based solid phase binding assay. (a) Protein–protein interaction assay to determine whether protein A binds to protein B. The immobilized protein of interest (protein A) is maximally coated into the wells of a 96 well assay plate. Unbound protein is removed by washing, and remaining surfaces are blocked with blocking buffer. The plate is washed, and binding is evaluated by incubation with serial dilutions of biotinylated interacting protein (protein B). Following another wash to remove unbound interacting protein, bound protein is detected by streptavidin-HRP and substrate development to quantify bound protein by absorbance at 450 nm. (b) Inhibition binding assay to quantify the interaction between an immobilized protein (protein A) and an interacting biotinylated binding protein in the presence of varied amounts of a second binding protein of interest (protein C). All steps are conducted as in (a) with the exception that during the biotinylated protein binding step, addition of the biotinylated protein B is conducted at a constant concentration in the presence of serial concentrations of a competitive protein C

Fig. 2 Representative examples of ELISA-based solid phase binding assay. (a) Binding of Atsttrin to TNFR2. (b) Atsttrin inhibition of TNFα binding to TNFR2

112

Wenyu Fu et al.

Fig. 3 Representative examples of TRAP staining. (a) BMDMs isolated from wild-type C57BL/6 mice were treated with M-CSF (10 ng/mL) for 3 days, then cultured with RANKL (10 ng/mL) and TNFα (10 ng/mL) with or without 100 ng/mL Atsttrin for 5 days and TRAP staining was performed. Scale bar, 100 μm. (b) Quantitative analysis of the TRAP+ cells

6. Streptavidin-HRP (Thermo scientific). 7. TMB Solution (Invitrogen): Ready to use, no dilution or further preparation required. In the presence of HRP, TMB will turn to blue. 8. Stop solution: 2 N Sulfuric Acid. 9. Blocking solution: TBS, 5% (w/v) bovine serum albumin (BSA). 10. Sample diluent: TBS, 0.5% BSA, 1 mM CaCl2. 11. Costar High Binding plates (Corning). 12. Molecular Devices plate reader. 2.2

TRAP Staining

1. Tartrate-resistant acid phosphatase (TRAP) basic incubation medium (see Note 1): 9.2 g Sodium acetate anhydrous (Sigma), 7.5 g L-(+)-Tartaric acid (Sigma), 950 mL distilled water, 2.8 mL Glacial acetic acid. Dissolve and adjust pH to 4.7–5.0 with 5 M Sodium hydroxide to increase or more glacial acetic acid to decrease. Bring total volume to 1 L with distilled water. 2. Naphthol AS-MX phosphate substrate mix: 20 mg Naphthol AS-MX phosphate (Sigma), 1 mL Ethylene glycol monoethyl ether (Sigma). Vortex or mix with pipette until dissolved.

Assays to Test Atsttrin’s Binding to TNFR2 and its Anti-TNF Activity

113

3. TRAP staining solution mix (see Note 2): 200 mL TRAP basic incubation medium, 120 mg Fast red violet LB salt (Sigma), 1 mL Naphthol AS-MX phosphate substrate mix. 4. 0.02% Fast green: 0.05 g Fast green (Sigma), 250 mL Distilled water. 5. Richard-Allan Scientific Cytoseal XYL (Thermo Scientific). 6. Wide-type C57BL/6 mice. 7. Dissection tools. 8. Complete DMEM Medium: DMEM, 10% fetal bovine serum, 100 U/mL penicillin, and 100 μg/mL streptomycin. 9. Osteoclast medium: DMEM, 10% fetal bovine serum, 100 U/ mL penicillin, 100 μg/mL streptomycin, 10 ng/mL Macrophage colony stimulating factor (M-CSF), 10 ng/mL RANKL. 10. Fixing solution: 6.75 mM Citrate, 65% acetone, 3.7% formalin. 11. Leica bright field microscope.

3

Methods

3.1 ELISA-Based Solid Phase Protein– Protein Interaction to Demonstrate the Direct Binding of Atsttrin to TNFR2

1. Coat various doses (0–0.5 μM) of Atsttrin or BSA (serving as control) in TBS buffer to Costar High Binding plates, 100 μL per well. Perform the assay using triplicates for each set of samples (see Note 3). Seal and incubate the plates overnight at 4  C (see Note 4). 2. The next day, discard the coating material and tap the plates dry on a paper towel. Block the plates by adding 100 μL of blocking solution to each well. Allow the solution to sit in the wells for 1 min and then discard it. Tap the plates dry on a paper towel (see Note 5). Add a volume of 200 μL of blocking solution to each well. Seal the plates and incubate in a 25  C incubator for 2 h. 3. While the plates are blocking, biotinylate TNFR2 using the EZ-Link Sulfo-NHS-Biotinylation Kit according to the manufacturer’s instruction (see Note 6). Briefly, calculate the amount of protein then add an appropriate molar ratio of biotin reagent to the protein, followed by incubation on a rotating platform for 1 h. Then remove the excess free biotin reagent using the Zebra Desalt Spin column. You could employ HABA assay [2– (4-hydroxyazobenzene) benzoic acid] to estimate biotin incorporation (see Note 7). 4. After 2 hours’ incubation, discard the blocking buffer in the plates and tap the plates dry on a paper towel. Add a volume of 300 μL of binding buffer to each well. Allow the wells about 1 min with the binding buffer for each wash step to increase the

114

Wenyu Fu et al.

effectiveness of the washes. After each addition, discard the solution and tap the plates dry on a paper towel. Repeat for a total of 3–5 washes. 5. Dilute the biotin-labeled TNFR2 in binding buffer to a concentration of 1 ng/μL. Add a volume of 100 μL of TNFR2 protein solution to the appropriate wells of the plates. Seal the plates and incubate in a 37  C incubator for 1 h. 6. Wash the plates with binding buffer to remove unbound protein. Discard the solution in the plates and dry the plates by tapping on a paper towel. Add a volume of 300 μL of binding buffer to each well three times using multichannel pipette. After each addition, discard the solution and tap dry the plates on a paper towel. Repeat for a total of 3–5 washes. 7. Dilute Streptavidin-HRP 1:2500 in binding buffer and add 100 μL of this reagent to each well. Seal the plates and incubate at room temperature for 15 min. 8. Wash the plates with binding buffer to remove unbound streptavidin-HRP. Discard the solution in the plates and tap dry the plates on a paper towel. Add a volume of 300 μL of binding buffer to each well. After each addition, discard the solution and tap dry the plates on a paper towel. Repeat for a total of 5–7 washes 9. Add a volume of 100 μL of TMB to each well of the plate. Incubate the plates uncovered, at room temperature until a blue color is obtained, typically within 5–30 min. 10. After the desired color is developed, add a volume of 100 μL per well of 1 M phosphoric acid to stop the TMB reaction. 11. Place the plates on a plate shaker and shake at a speed of 6 rpm for 3–5 s to ensure complete mixing of the TMB and acid. 12. Read the plates at 450 nm using a Molecular Devices plate reader (see Note 8) and analyze the data (see Fig. 2a). 3.2 ELISA-Based Solid-Phase Protein– Protein Interaction Assay to Determine Inhibition of TNFα Binding to TNFR2 by Atsttrin

1. Dilute TNFR2 to 0.5 μg/mL with TBS. Add the diluted solutions to the appropriate wells of Costar High Binding plates, 100 μL per well. Add TBS, to the appropriate wells of the plates to serve as a negative control, 100 μL per well. Seal the plates and incubate overnight at 4  C. 2. The next day, discard the coating material and tap dry the plates on a paper towel. Block the plates by adding 100 μL of blocking solution to each well. Allow the solution to sit in the wells for 1 min and then discard. Tap dry the plates on a paper towel. Add a volume of 200 μL of blocking solution to each well. Seal the plates and incubate in a 25  C incubator for 2 h.

Assays to Test Atsttrin’s Binding to TNFR2 and its Anti-TNF Activity

115

3. While the plates are blocking, dilute Atsttrin and BSA to 500 μg/mL in Sample Diluent. For each protein, made six, 1:2 serial dilutions in Sample Diluent. 4. After 2 hours’ incubation, discard the blocking buffer in the plates and tap dry the plates on a paper towel. Add a volume of 300 μL of binding buffer to each well. Allow the binding buffer to remain in the wells for about 1 min during each wash step to increase the effectiveness of the washes. After each addition, discard the solution and tap dry the plates on a paper towel. Repeat for a total of 3–5 washes. 5. Add a volume of 100 μL of each protein solution to the appropriate wells of the plates. Add the sample diluent to all 0 μg/mL wells, 100 μL per well. Seal the plates and incubate in a 37  C incubator for 1 h. 6. While the plates with proteins are incubating, biotinylate TNFα as described in Subheading 3.3, then dilute to 1 μg/mL in Sample Diluent. 7. Add diluted TNFα to appropriate wells of the plate, 10 μL per well. Add Sample Diluent to the “No TNFα” control wells, 10 μL per well. Shake the plates for 10 s, and then seal and incubate in a 37  C incubator for 2 h. 8. Follow the items 6–12 in Subheading 2.1 (see Fig. 2b). 3.3 TRAP Staining to Determine the Anti-TNFa Activity of Atsttrin

Use bone marrow derived macrophages (BMDMs) as osteoclast progenitors (see Note 9). 1. Collect bone marrow cells from wide-type C57BL/6 mice, culture in complete DMEM and stimulate with 10 ng/mL M-CSF for 3 days. 2. After 3 days, change the medium to osteoclast medium along with 10 ng/mL of TNFα in the absence or presence of 100 ng/mL of Atsttrin for a total of 5–7 days. Change the medium every 2 days. 3. Hereafter, aspirate the medium from the culture well. 4. Wash the cells gently with 1 PBS three times. 5. Fix the cells by incubating for 90 s with fixing solution at room temperature and wash with 1X PBS three times. 6. Add 1 mL of pre-warmed TRAP stain solution into each well of the plate to be stained and incubate at 37  C for 1 h. Shield the plate from light (see Note 10). 7. After 1 h, aspirate off the TRAP staining solution, and wash the wells 3 times with pre-warmed deionized water. 8. Counterstain the cells with 0.02% Fast Green for 1–2 min.

116

Wenyu Fu et al.

9. Dehydrate quickly through graded alcohols, 5 s each, clear in Xylene and mount in Cytoseal XYL. 10. Image osteoclasts using bright field microscopy. Red coloration indicates TRAP-positive cells. TRAP-positive multinucleated cells with >3 nuclei visualized by light microscopy are recorded as osteoclasts (see Fig. 3).

4

Notes 1. Tartrate-resistant acid phosphatase (TRAP) basic incubation medium can be stored at room temperature for 6 months. 2. Prepare TRAP staining solution mix fresh every time. 3. It is recommended to perform the experiment in technical triplicate to get reliable results. Also, the experiments should be repeated at least three times to ensure that the results are reproducible. 4. Although the ELISA-based solid-phase protein–protein interaction assay is readily amendable to a number of different situations, a few key points must be observed to ensure success. Importantly, sodium azide must be excluded from all buffers. The inclusion of sodium azide in the buffer will inhibit the activity of HRP and can quench peroxidase activity, thus, rendering no signal. 5. It is critical to remove any residual fluids, but do not let the plate become completely dry. When the wells are completely dry, the active components on the plate will become inactivated, which will negatively impact assay results. 6. EZ-Link Sulfo-NHS-Biotin is moisture sensitive. Dissolve the biotin reagent immediately before use. The NHS-ester moiety readily hydrolyzes and becomes non-reactive; therefore, discard any unused reconstituted reagent. 7. Although the biotin-based solid-phase assay offers numerous advantages over other assays, one potential disadvantage associated with this assay is that the biotinylation process may alter the structure and properties of the proteins of interest, which may also lead to less or no binding activities of labeled proteins to its binding partners. 8. Read plate immediately after adding stop solution. 9. BMDMs are used in the protocol for osteoclast differentiation; this protocol could also be modified accordingly to apply on Raw264.7 cells. The exception is Raw264.7 cells express both M-CSF and its receptor c-fms; therefore, the addition of RANKL alone is sufficient to induce osteoclast differentiation.

Assays to Test Atsttrin’s Binding to TNFR2 and its Anti-TNF Activity

117

10. Incubation time varies according to the amount and activity of TRAP in the samples. Stop the reaction in the appropriate stage while observation is carried out microscopically.

Acknowledgments This work was supported partly by NIH research grants R01AR062207, R01AR061484, R01NS103931, R01AR076900 and a DOD research grant W81XWH-16-1-0482. The recombinant Atsttrin protein is kindly provided by Atreaon, Inc. References 1. Chen G, Goeddel DV (2002) TNF-R1 signaling: a beautiful pathway. Science 296:1634–1635 2. Sedger LM, McDermott MF (2014) TNF and TNF-receptors: from mediators of cell death and inflammation to therapeutic giants - past, present and future. Cytokine Growth Factor Rev 25:453–472 3. Furst DE (2010) Development of TNF inhibitor therapies for the treatment of rheumatoid arthritis. Clin Exp Rheumatol 28:S5–S12 4. Bayry J (2011) New horizons in natural TNF-alpha antagonist research. Trends Mol Med 17:538–540 5. Bluml S, Scheinecker C, Smolen JS, Redlich K (2012) Targeting TNF receptors in rheumatoid arthritis. Int Immunol 24:275–281 6. Candel S, de Oliveira S, Lopez-Munoz A et al (2014) Tnfa signaling through tnfr2 protects skin against oxidative stress-induced inflammation. PLoS Biol 12:e1001855 7. Faustman DL (2018) TNF, TNF inducers, and TNFR2 agonists: a new path to type 1 diabetes treatment. Diabetes Metab Res Rev 34. https://doi.org/10.1002/dmrr.2941 8. Minuz P, Fava C, Hao S et al (2015) Differential regulation of TNF receptors in maternal leukocytes is associated with severe preterm preeclampsia. J Matern Fetal Neonatal Med 28:869–875 9. Bateman A, Bennett HP (2009) The granulin gene family: from cancer to dementia. Bioessays 31:1245–1254 10. Toh H, Chitramuthu BP, Bennett HP, Bateman A (2011) Structure, function, and mechanism of progranulin; the brain and beyond. J Mol Neurosci 45:538–548 11. Jian J, Hettinghouse A, Liu CJ (2017) Progranulin acts as a shared chaperone and regulates multiple lysosomal enzymes. Genes Dis

4:125–126. https://doi.org/10.1016/j. gendis.2017.05.001 12. Jian J, Li G, Hettinghouse A, Liu C (2018) Progranulin: a key player in autoimmune diseases. Cytokine 101:48–55. https://doi.org/ 10.1016/j.cyto.2016.08.007 13. Liu CJ (2011) Progranulin: a promising therapeutic target for rheumatoid arthritis. FEBS Lett 585:3675–3680 14. C-j L, Bosch X (2012) Progranulin: a growth factor, a novel TNFR ligand and a drug target. Pharmacol Ther 133:124–132 15. Tang W, Lu Y, Tian QY et al (2011) The growth factor progranulin binds to TNF receptors and is therapeutic against inflammatory arthritis in mice. Science 332:478–484 16. Guo F, Lai Y, Tian Q, Lin EA, Kong L, Liu C (2010) Granulin-epithelin precursor binds directly to ADAMTS-7 and ADAMTS-12 and inhibits their degradation of cartilage oligomeric matrix protein. Arthritis Rheum 62:2023–2036 17. Kawase R, Ohama T, Matsuyama A et al (2013) Deletion of progranulin exacerbates atherosclerosis in ApoE knockout mice. Cardiovasc Res 100:125–133 18. Thurner L, Preuss KD, Fadle N et al (2013) Progranulin antibodies in autoimmune diseases. J Autoimmun 42:29–38 19. Thurner L, Stoger E, Fadle N et al (2014) Proinflammatory progranulin antibodies in inflammatory bowel diseases. Dig Dis Sci 59:1733–1742 20. Thurner L, Zaks M, Preuss KD et al (2013) Progranulin antibodies entertain a proinflammatory environment in a subgroup of patients with psoriatic arthritis. Arthritis Res Ther 15: R211 21. Zhao YP, Tian QY, Liu CJ (2013) Progranulin deficiency exaggerates, whereas

118

Wenyu Fu et al.

progranulin-derived Atsttrin attenuates, severity of dermatitis in mice. FEBS Lett 587:1805–1810 22. Zhao YP, Liu B, Tian QY, Wei JL, Richbourgh B, Liu CJ (2015) Progranulin protects against osteoarthritis through interacting with TNF-alpha and beta-catenin signalling. Ann Rheum Dis 74:2244–2253 23. Wang BC, Liu H, Talwar A, Jian J (2015) New discovery rarely runs smooth: an update on progranulin/TNFR interactions. Protein Cell 6:792–803 24. Zhou B, Li H, Liu J, Xu L, Guo Q, Sun H, Wu S (2015) Progranulin induces adipose insulin resistance and autophagic imbalance via TNFR1 in mice. J Mol Endocrinol 55:231–243 25. Noguchi T, Ebina K, Hirao M et al (2015) Progranulin plays crucial roles in preserving bone mass by inhibiting TNF-alpha-induced osteoclastogenesis and promoting osteoblastic differentiation in mice. Biochem Biophys Res Commun 465:638–643 26. Wei F, Zhang Y, Jian J et al (2014) PGRN protects against colitis progression in mice in an IL-10 and TNFR2 dependent manner. Sci Rep 4:7023 27. Wei F, Zhang Y, Zhao W, Yu X, Liu CJ (2014) Progranulin facilitates conversion and function of regulatory T cells under inflammatory conditions. PLoS One 9:e112110 28. Fu W, Hu W, Shi L, Mundra JJ, Xiao G, Dustin ML, Liu CJ (2017) Foxo4- and Stat3dependent IL-10 production by progranulin in regulatory T cells restrains inflammatory arthritis. FASEB J 31:1354–1367 29. Zhang K, Li YJ, Guo Y et al (2017) Elevated progranulin contributes to synaptic and learning deficit due to loss of fragile X mental retardation protein. Brain 140:3215–3232 30. Kruse JA, Williams RA, Seng JS (2014) Considering a relational model for depression in women with postpartum depression. Int J Childbirth 4:151–168 31. Hwang HJ, Jung TW, Hong HC et al (2013) Progranulin protects vascular endothelium against atherosclerotic inflammatory reaction via Akt/eNOS and nuclear factor-kappaB pathways. PLoS One 8:e76679 32. Huang K, Chen A, Zhang X et al (2015) Progranulin is preferentially expressed in patients with psoriasis vulgaris and protects mice from psoriasis-like skin inflammation. Immunology 145:279–287 33. Li M, Liu Y, Xia F, Wu Z, Deng L, Jiang R, Guo FJ (2014) Progranulin is required for proper ER stress response and inhibits ER

stress-mediated apoptosis through TNFR2. Cell Signal 26:1539–1548 34. Liu C, Li XX, Gao W, Liu W, Liu DS (2014) Progranulin-derived Atsttrin directly binds to TNFRSF25 (DR3) and inhibits TNF-like ligand 1A (TL1A) activity. PLoS One 9: e92743 35. Vezina A, Vaillancourt-Jean E, Albarao S, Annabi B (2014) Mesenchymal stromal cell ciliogenesis is abrogated in response to tumor necrosis factor-alpha and requires NF-kappaB signaling. Cancer Lett 345:100–105 36. Yamamoto Y, Takemura M, Serrero G et al (2014) Increased serum GP88 (Progranulin) concentrations in rheumatoid arthritis. Inflammation 37:1806–1813 37. Liu J, Li H, Zhou B et al (2015) PGRN induces impaired insulin sensitivity and defective autophagy in hepatic insulin resistance. Mol Endocrinol 29:528–541 38. Wei JL, Fu W, Ding YJ et al (2017) Progranulin derivative Atsttrin protects against early osteoarthritis in mouse and rat models. Arthritis Res Ther 19:280 39. Cui Y, Hettinghouse A, C-j L (2019) Progranulin: a conductor of receptors orchestra, a chaperone of lysosomal enzymes and a therapeutic target for multiple diseases. Cytokine Growth Factor Rev 45:53–64 40. Wei J, Hettinghouse A, Liu C (2016) The role of progranulin in arthritis. Ann N Y Acad Sci 1383:5–20 41. Williams A, Wang EC, Thurner L, Liu CJ (2016) Novel insights into tumor necrosis factor receptor, death receptor 3, and progranulin pathways in arthritis and bone remodeling. Arthritis Rheumatol 68:2845–2856 42. Lata M, Hettinghouse AS, Liu CJ (2019) Targeting tumor necrosis factor receptors in ankylosing spondylitis. Ann N Y Acad Sci 1442:5–16 43. Bateman A, Belcourt D, Bennett H, Lazure C, Solomon S (1990) Granulins, a novel class of peptide from leukocytes. Biochem Biophys Res Commun 173:1161–1168 44. Bhandari V, Palfree RG, Bateman A (1992) Isolation and sequence of the granulin precursor cDNA from human bone marrow reveals tandem cysteine-rich granulin domains. Proc Natl Acad Sci U S A 8:1715–1719 45. Tian Q, Zhao Y, Mundra JJ et al (2014) Three TNFR-binding domains of PGRN act independently in inhibition of TNF-alpha binding and activity. Front Biosci 19:1176–1185 46. Uddin SM, Mundra JJ, Jian J et al (2014) Progranulin inhibition of TNFalpha. Immunol Cell Biol 92:299–300

Assays to Test Atsttrin’s Binding to TNFR2 and its Anti-TNF Activity 47. Liu L, Qu Y, Liu Y et al (2019) Atsttrin reduces lipopolysaccharide-induced neuroinflammation by inhibiting the nuclear factor kappa B signaling pathway. Neural Regen Res 14:1994–2002 48. Ding H, Wei J, Zhao Y, Liu Y, Liu L, Cheng L (2017) Progranulin derived engineered protein Atsttrin suppresses TNF-alpha-mediated inflammation in intervertebral disc degenerative disease. Oncotarget 8 (65):109692–109702 49. Xia Q, Zhu S, Wu Y et al (2015) Intra-articular transplantation of atsttrin-transduced mesenchymal stem cells ameliorate osteoarthritis development. Stem Cells Transl Med 4:523–531 50. Wang Q, Xia Q, Wu Y et al (2015) 3D-printed Atsttrin-incorporated alginate/hydroxyapatite scaffold promotes bone defect regeneration with TNF/TNFR signaling involvement. Adv Healthc Mater 4:1701–1708

119

51. Wang Y, Galli M, Shade Silver A et al (2018) IL1beta and TNFalpha promote RANKLdependent adseverin expression and osteoclastogenesis. J Cell Sci 131:jcs213967 52. Luo G, Li F, Li X, Wang ZG, Zhang B (2018) TNFalpha and RANKL promote osteoclastogenesis by upregulating RANK via the NFkappaB pathway. Mol Med Rep 17:6605–6611 53. Pathak JL, Bravenboer N, Verschueren P et al (2014) Inflammatory factors in the circulation of patients with active rheumatoid arthritis stimulate osteoclastogenesis via endogenous cytokine production by osteoblasts. Osteoporos Int 25:2453–2463 54. Jules J, Feng X (2014) In vitro investigation of the roles of the proinflammatory cytokines tumor necrosis factor-alpha and interleukin-1 in murine osteoclastogenesis. Methods Mol Biol 1155:109–123

Chapter 9 Fluorescence-Based TNFR1 Biosensor for Monitoring Receptor Structural and Conformational Dynamics and Discovery of Small Molecule Modulators Chih Hung Lo, Tory M. Schaaf, David D. Thomas, and Jonathan N. Sachs Abstract Inhibition of tumor necrosis factor receptor 1 (TNFR1) is a billion-dollar industry for treatment of autoimmune and inflammatory diseases. As current therapeutics of anti-TNF leads to dangerous side effects due to global inhibition of the ligand, receptor-specific inhibition of TNFR1 signaling is an intensely pursued strategy. To monitor directly the structural changes of the receptor in living cells, we engineered a fluorescence resonance energy transfer (FRET) biosensor by fusing green and red fluorescent proteins to TNFR1. Expression of the FRET biosensor in living cells allows for detection of receptor–receptor interactions and receptor structural dynamics. Using the TNFR1 FRET biosensor, in conjunction with a high-precision and high-throughput fluorescence lifetime detection technology, we developed a timeresolved FRET-based high-throughput screening platform to discover small molecules that directly target and modulate TNFR1 functions. Using this method in screening multiple pharmaceutical libraries, we have discovered a competitive inhibitor that disrupts receptor–receptor interactions, and allosteric modulators that alter the structural states of the receptor. This enables scientists to conduct high-throughput screening through a biophysical approach, with relevance to compound perturbation of receptor structure, for the discovery of novel lead compounds with high specificity for modulation of TNFR1 signaling. Key words Tumor necrosis factor receptor 1, Receptor–receptor interaction, Receptor conformational dynamics, Time-resolved FRET, NF-κB inhibition

1

Introduction Tumor necrosis factor receptor 1 (TNFR1) is a membrane receptor for which activation is most commonly associated with signal transduction to induce inflammation [1]. Upon ligand stimulation by tumor necrosis factor-alpha (TNFα) or lymphotoxin-alpha (LTα), the downstream signaling complex (including receptor interacting protein-1 [RIP1], TNF receptor-associated death domain [TRADD], and TRAF2) is recruited, leading to degradation of the inhibitor of nuclear factor κBα (IκBα) and the activation of nuclear factor κB (NF-κB) [2]. Over-activation of TNFR1 results in

Jagadeesh Bayry (ed.), The TNF Superfamily: Methods and Protocols, Methods in Molecular Biology, vol. 2248, https://doi.org/10.1007/978-1-0716-1130-2_9, © Springer Science+Business Media, LLC, part of Springer Nature 2021

121

122

Chih Hung Lo et al.

excessive NF-κB activation, which has been associated with several autoimmune diseases, including rheumatoid arthritis [3]. Therapeutic targeting of TNFR1 signaling is a billion-dollar industry [4]. Current therapeutics include anti-TNF antibodies that sequester free ligand [5, 6], but this can cause severe side effects such as reactivation of tuberculosis, increased risk of inflammation, or lymphoma [6–8]. This is primarily due to the off-target inhibition of TNFR2, which mediates immune modulatory functions [9]. Hence, there is a need for TNFR1-selective inhibitors that specifically block TNFR1 signaling without interfering with other receptors [10]. Thus, novel therapeutics that bind and target TNFR1 directly are needed in order to exert receptor-specific effects. Previous reports include small molecules that bind the receptor and prevent ligand binding [11–14]. In addition, the isolated soluble pre-ligand assembly domain (PLAD) of TNFR1 has been shown to inhibit TNFα-induced inflammatory signaling in both cell and mouse models, and the proposed mechanism is that the PLAD protein disrupts receptor–receptor interactions [15]. However, the soluble GST-tagged PLAD protein ablated ligand binding in that study, making it unclear whether the small protein was targeting the PLAD and disrupting the pre-ligand receptor dimer [15]. Furthermore, it has been suggested that a noncompetitive targeting strategy may be more effective in inhibiting protein or receptor function [16–18]. We hypothesize that progress in this therapeutic field requires understanding and exploitation of the structure and dynamics of the receptor [19–28]. A small molecule (F002), which was discovered by computational design, binds to a cavity distal to the ligand binding loop and perturbs the ligand binding residue of tryptophan 107 (W107), leading to allosteric inhibition of TNFR1 signaling [29]. Even though the F002 does not directly prevent ligand binding to the receptor, the movement of W107 induced by the small molecule results in weakened ligand affinity for the receptor and reduced effective ligand stimulated signaling. Moreover, the functional efficacy of F002 is 60-fold weaker than its binding affinity, suggesting that this small molecule perhaps competes with ligand binding and may not be truly allosteric. Hence, there is still potential to discover more effective allosteric small molecules that inhibit TNFR1 signaling by mechanisms that do not ablate ligand binding or disrupt receptor–receptor interactions. While crystal structures of TNFR1 have been available for two decades [30, 31], there is a lack of progress toward targeting the receptor based on its structure and dynamics. In our previous work, we engineered a TNFR1 FRET biosensor that detects compounds that directly alter the structure of the receptor, by measuring the distance between the receptor monomers (Fig. 1a). We present a FRET-based high-throughput screening (HTS) platform, using the TNFR1 FRET biosensor in conjunction with novel fluorescence

Fluorescence Based TNFR1 Biosensor

123

Fig. 1 Schematic representation of the TNFR1 FRET biosensor. (a) FRET is observed when the receptor dimerizes in a closed conformation (left) and the fluorophores are in close proximity to each other. Treatment with small molecule modulators leads to either disruption of receptor–receptor interactions (inhibitor, middle) [32] or perturbation of the receptor conformational states (can be inhibitor or activator, right) [27, 33], and both result in reduced FRET, as the receptor monomers are further apart. (The figure is reproduced with modifications by permission from SAGE publishing [32] and John Wiley and Sons, Inc. [33]). (b) Plasmids encoding the TNFR1 gene of interest fused to the fluorescent proteins (FP) used for transfection of the TNFR1 FRET biosensor into mammalian cells

lifetime (FLT) detection technology. This approach dramatically increases the capability of finding novel chemical structures that directly perturb the receptor, compared with any indirect effect on the inhibition of NF-κB activation. Our FRET-based HTS assay to discover receptor-specific small molecules targeting TNFR1 is enabled by high density plates (384 or 1536 wells) containing the TNFR1 FRET biosensor, using a high-throughput, high-precision measurements with a unique fluorescence lifetime plate reader (FLT-PR) [34]. This nanosecond time-resolved fluorescence spectrometer acquires fluorescence decay waveforms from each well of a 384-well microplate in 3 min with signal-to-noise exceeding 400 [34]. This precision, based on lifetime measurements, is 10–30-fold more precise than intensity measurements acquired at the same speed [34, 35]. Furthermore, waveforms acquired in 0.1 s, by 1000 laser pulses with the FLT-PR instrument, were of sufficient precision to analyze two samples having different lifetimes, resolving minor components with high accuracy with respect to both lifetime (nanosecond decay rate of the fluorescent molecule) and mole fraction (existence

124

Chih Hung Lo et al.

of multiple species with different lifetime that depict multiple structural states of the TNFR1 biosensor) [36]. Concurrent with lifetime measurements, we also record a complete high-quality fluorescence emission spectrum on a well-by-well basis using a spectral unmixing plate reader (SUPR). While SUPR can give an accurate quantitation of FRET of an intramolecular FRET system (fluorophores attached to the same protein), and is useful for filtering out fluorescent compounds, its application to an intermolecular system (fluorophores attached to the separate proteins) cannot compete with FLT data [37, 38]. Hence, we have primarily used the new SUPR technology to filter fluorescence compounds in the screening libraries for this intermolecular TNFR1 FRET biosensor. In our FRET assay, changes in FRET (increase or decrease) correspond to structural changes of TNFR1, induced by the compounds. However, it does not give a functional readout of the effect of the compounds on receptor signaling. Hence, the FRET assay has to be coupled with other functional assays such as NF-κB activation luciferase assay, as well as other biochemical and biophysical assays to validate the functional and mechanistic effects of the hit compounds. Using this approach, we have screened multiple chemical libraries including the NIH clinical collection (NCC), library of pharmaceutically active compounds (LOPAC) and ChemBridge DIVERSet. We have discovered compounds that inhibit TNFR1 signaling by disrupting receptor–receptor interactions (zafirlukast) [32] or altering the conformational states of the receptor (e.g., DS42) [27]. Interestingly, we have also found a small molecule activator (SB 200646 hydrochloride) that stimulates TNFR1 signaling by forcing the receptor into an open conformation and increasing accessibility and binding of TRADD to its death domain [33]. Putting these findings together, we suggest that the conformational states of TNFR1 can act as a molecular switch in determining receptor function, and the TNFR1 FRET biosensor provides powerful technology to study the structural dynamics of the receptor.

2

Materials

2.1 Scientific Equipment, Tools, and Software

1. Fluorescence lifetime plate reader (Fluorescence Innovations). 2. Spectral unmixing plate reader (Fluorescence Innovations). 3. EVOS-FL cell imaging system (Thermo Fisher Scientific). 4. FACSAria II flow cytometry equipment (BD Biosciences). 5. Olympus IX2 inverted confocal fluorescence microscope equipped with a FluoView FV1000 laser scanning confocal head and 60
(1.42NA) oil immersion objective lenses (Olympus).

Fluorescence Based TNFR1 Biosensor

125

6. Light microscope. 7. Magnetic stir bar. 8. Mosquito HV liquid handler (TTP Labtech Ltd.). 9. Multidrop Scientific).

Combi

reagent

dispenser

(Thermo

Fisher

10. Echo Acoustic Liquid Dispenser (Labcyte). 11. Q-switched microchip laser (Concepts Research Corporation). 12. Photomultiplier module (Hamamatsu Photonics K.K.). 13. A proprietary transient digitizer (Fluorescence Innovations, Inc.). 14. A 488-nm long-pass filter (Semrock). 15. 0.31-μm latex microsphere suspensions (Thermo Fisher Scientific). 16. Linear-array CCD detector Sony ILX511B (Sony). 17. Fluorescence Innovations data analysis software (Fluorescence Innovations, Inc.). 2.2 Plasmid DNA, Cell Culture, Transfection, and Small-Molecule Treatments

1. Plasmid DNA: The TNFR1ΔCD-GFP plasmid was cloned in a custom expression vector (pRH132 vector) with EF-1 alpha promoter and puromycin mammalian selection marker and the TNFR1ΔCD-RFP was cloned in pRFP vector with CMV promoter and neomycin mammalian selection marker (Fig. 1b) (see Note 1). 2. Plasmid preparation: Following the manufacturer’s protocol from plasmid maxiprep kit. Resuspend plasmid DNA in autoclaved and 0.2 μm filtered water at a concentration of 0.5 μg/μ L. 3. Cytation 3 imaging reader to determine DNA concentration. 4. HEK293.2sus cells (ATCC): Maintain and culture in an incubator at 37  C in 5% CO2, and routinely passage with sterile technique in a cell culture biosafety hood (see Note 2). 5. Complete Dulbecco’s Modified Eagle Medium (DMEM) cell culture medium: phenol red-free DMEM supplemented with heat-inactivated 10% fetal bovine serum (FBS), 2 mM L-glutamine, 100 U/mL penicillin, and 100 μg/mL streptomycin (see Note 3). 6. Mammalian cell antibiotic selection: Aliquoted stocks of 10 mg/mL puromycin and 50 mg/mL geneticin (G418). They can be stored up to a year at 20  C. Working concentrations of puromycin (0.5 μg/mL for selection and 0.25 μg/ mL for maintenance) and geneticin (500 μg/mL for selection and 250 μg/mL for maintenance) are freshly diluted in complete DMEM medium prior to use.

126

Chih Hung Lo et al.

7. Lipofectamine 3000™. 8. Serum-free Opti-MEM™ medium. 9. TrypLE™ Express. 10. Cell culture centrifuge. 11. Sterile phosphate buffered saline (PBS). 12. Trypan blue solution (0.2 μm filtered). 13. Sterile cell strainer with 70 μm nylon mesh. 14. Cell counter with function to check cell viability (e.g., automated cell counter (Countess, Invitrogen)). 15. Sterile dimethyl sulfoxide (DMSO). 16. Drug plates containing libraries of chemical compounds such as from NIH clinical collection (NCC), library of pharmaceutically active compounds (LOPAC) or ChemBridge DIVERSet 50,000 compounds (see Note 4). These drug plates are frozen at 20  C prior to screening.

3

Methods

3.1 Generation of Stable Cell Lines Expressing TNFR1-GFP Only or TNFR1-GFP/ RFP (TNFR1 FRET Biosensor)

This section describes a method for generating a stably expressing TNFR1 FRET biosensor that can be expanded and directly used for FRET measurements by acquiring the fluorescence lifetime. We describe the use of adapted HEK293.2sus cells and transfection with the Lipofectamine 3000™ reagent, but other cell lines and analogous approaches for introducing plasmids into mammalian cells should work equally well. Co-transfection of the FRET biosensor plasmids with orthogonal antibiotic selection allows for high stringency in selecting high TNFR1-GFP and TNFR1-RFP co-expressing cells. 1. Start with a healthy and low passage adapted HEK293.2sus cell culture. Split one million cells per well in a 6-well or 35 mm plate. 2. After 24 h, confirm that HEK293.2sus cells have attached and are evenly distributed in the 6-well plate under bright field of a light microscope. 3. Transfect these cells with Lipofectamine 3000™, following manufacturer’s protocol (see Note 5). For the transfection, prepare two 1.5 mL tubes prefilled with serum-free OptiMEM™ medium. To one tube, mix the TNFR1-GFP only or TNFR1-GFP/RFP (1:6 ratio) (total DNA is 2.5 μg) and 5 μL of P reagent (2 μL/μg of DNA used) from the transfection kit to the Opti-MEM™ medium. To the other tube of OptiMEM™ medium, add 7.5 μL of the Lipofectamine 3000™ (3 μL/μg of DNA used). The final volume of each tube is 125 μL.

Fluorescence Based TNFR1 Biosensor

127

4. Then mix both tubes, vortex gently and incubate at room temperature for 15 min. After the incubation, add this mixture dropwise to the HEK293.2sus cells in the 6-well plate. 5. After 6 h, gently remove medium on cells and replace with fresh growth medium. 6. Allow cells to express the TNFR1-GFP only control or the TNFR1 FRET biosensor from the transfected plasmids for 48 h. Confirm this expression and a >90% transfection efficiency with fluorescent microscopy using EVOS-FL cell imaging system. Successful transfection should show fluorescent signal in both the green and red channel as well as the merged channel (Fig. 2a). Very gently transport the plate to and from the incubator, as the cells are liable to detach very easily at this stage (see Note 6). 7. Trypsinize and count HEK293.2sus cells from a healthy transfected culture. Mix 1
103 cells with 20 mL of fresh growth medium supplemented with puromycin and geneticin. 8. Plate these cells into a 96-well plate with 5–10 cells per well in 200 μL volume with 0.5 μg/mL of puromycin and 500 μg/mL of geneticin for selection. Multiple 96-well plates can be used. 9. As a control, split an untransfected 6-well plate of cells into growth medium containing puromycin and geneticin. The cells in this control should not survive these selections because they are not transfected with the plasmids with the resistance genes, and in contrast the transfected cells should proliferate under the same selection conditions (see Note 7). 10. Check cells undergoing both puromycin and geneticin selection daily. The debris from unattached or unhealthy cells in the culture should be gently washed away from attached healthy cells by removing the medium and replacing with fresh growth medium containing puromycin and geneticin. 11. Cell lines should be expanded slowly (e.g., from 96-well to 6-well or 100 mm plates through intermediate well sizes) and grown under puromycin and geneticin selection for a minimum of 1–2 weeks. 12. The resulting stable cell lines should also be evaluated by flow cytometry and confocal fluorescence microscopy to confirm a high population of cells expressing the TNFR1 FRET biosensor (Fig. 2b) as well as their proper folding and trafficking to the cell membrane (Fig. 2c) (see Note 8). Lasers of 488 and 561 nm are used in both flow cytometry and fluorescence microscopy for the detection of GFP and RFP, respectively. Once the quality of the cells is checked, they can be frozen in 10% DMSO in FBS at 80  C overnight and in liquid nitrogen for long term as the original cell stocks (see Note 9).

128

Chih Hung Lo et al.

Fig. 2 Characterization of the TNFR1 FRET biosensor. (a) Fluorescence microscopy images of HEK293.2sus cells stably expressing the TNFR1 FRET biosensor with co-localization of both TNFR1-GFP and TNFR1-RFP. (b) Flow cytometry analysis of the stable cells expressing the TNFR1 FRET biosensor shows that nearly all cells contain both TNFR1-GFP and TNFR1-RFP. (c) Confocal microscopy images showing the GFP, RFP, DIC, and merged channel of the stable cells expressing TNFR1 FRET biosensor indicate the co-localization of TNFR1GFP and TNFR1-RFP at the cell membrane 3.2 Preparation of the FRET Biosensor for HTS

1. Four days prior to each screening, thaw the vials containing the frozen stock of the stable TNFR1ΔCD-GFP (donor-only control) or TNFR1-GFP/RFP (TNFR1 FRET biosensor) cells and plate in two 225 cm2 flasks to ensure the same passage of cells is used in screening (see Note 10). 2. After 24 h, expand the cells into six 225 cm2 flasks to obtain sufficient number of cells for screening.

Fluorescence Based TNFR1 Biosensor

129

3. Lift the cells from the 225 cm2 flasks by incubating with 6 mL of TrypLE™ Express for 5–10 min followed by neutralization with 6 mL of complete DMEM medium and harvest in 50 mL conical flask. 4. Wash the cells three times in PBS by centrifugation at 300
g and resuspend in 20 mL of PBS. 5. Filter each tube of cells in PBS using 70 μm cell strainers into a glass flask. 6. Assess the cell viability using trypan blue assay and should have viability above 95%. 7. Use a small aliquot of the cells for flow cytometry analysis to confirm that the expression of TNFR1ΔCD-GFP and TNFR1GFP/RFP (TNFR1ΔCD-FRET pair) in stable cells is above 95%. 8. Count the cells and dilute to one million cells/mL using an automated cell counter. 9. After resuspension and dilution in PBS, stir the stable cells constantly and gently using a magnetic stir bar at room temperature, keeping the cells in suspension and evenly distributed to avoid clumping. 3.3 High-Throughput Screening in 384-Well or 1536-Well Plates

1. The fluorescence lifetime plate reader utilizes a 473-nm microchip laser for excitation of the GFP fluorescence and a 488-nm long-pass filter, as well as a 517/20-nm bandpass to filter the emission [27, 32, 33, 39]. The 473-nm passively Q-switched microchip laser delivers highly reproducible and high-energy pulses (~1 μJ) at a 5-kHz repetition rate. 2. Detect a full fluorescence decay waveform in response to each laser pulse over a 128-ns time window, using a photomultiplier module from Hamamatsu and a proprietary transient digitizer. Use 488-nm long-pass filter and 517/20 bandpass emission filter to ensure that only emission from the GFP donor is detected. Use a fiber-optic cable for 488-nm dichroic mirror directed fluorescence signal toward the PMT (lifetime mode) or spectrograph (spectral mode) (see Notes 11 and 12). 3. Acquire the instrument response function (IRF) by recording scatter from 0.31-μm latex microsphere suspensions (see Note 13). 4. The spectral unmixing plate reader provides direct highthroughput detection of the complete fluorescence emission spectrum (emission vs. wavelength), with excitation provided by a 473-nm continuous wave laser [37, 38]. Record spectra using a grating-based fiber-optic input spectrograph equipped with linear-array CCD detector.

130

Chih Hung Lo et al.

Fig. 3 FRET measurements of TNFR1 biosensor using fluorescence lifetime plate reader. (a) The fluorescence decay waveforms from a 384-well plate containing the stable cells expressing TNFR1 FRET biosensor. Very little variation of the fluorescence decay waveforms is observed. (b) A comparison between the coefficient of variation (CV) between the intensity- vs. the lifetime-based FRET measurements. The CV of the lifetime measurement is 20 times less than that of the intensity measurement, making it an excellent approach for high-throughput screening assay and allowing better selection of hits. (c) Fluorescence lifetime measurement for the stable cells expressing TNFR1 FRET biosensor and the calculated FRET obtained from the measurement

5. The recorded wavelength range in these experiments spans the entire visible spectrum, but use only the 500- to 700-nm range in the data analysis. 6. On the day of screening, equilibrate the compound plates for 30 min at room temperature (25  C). 7. Conduct the fluorescence measurement of a 384-well plate containing only the TNFR1 FRET biosensor without any compounds before any drug treatment. This is to ensure that the signal intensity (Fig. 3a), coefficient of variation (Fig. 3b), and the lifetime of the biosensor giving the basal FRET level (Fig. 3c) are excellent for HTS. 8. Once the drug plates are equilibrated to room temperature (25  C), dispense the cells (50 μL/well at one million cells per mL concentration) a Multidrop Combi Reagent Dispenser into the 384-well assay plates containing the drug compounds and in-plate DMSO negative controls for incubation.

Fluorescence Based TNFR1 Biosensor

131

9. Incubate the cells and compounds at room temperature for 2 h before readings are taken by the fluorescence lifetime and spectral unmixing plate reader (see Note 14). 3.4 Data Analysis and Selection of Hits

1. Fit time-resolved fluorescence waveforms for each well to single-exponential decays using least-squares minimization global analysis software to give donor lifetime (τD) and donor–acceptor lifetime (τDA). 2. Calculate FRET efficiency (E) based on Eq. 1.   τDA E ¼1 τD

ð1Þ

3. Flag fluorescent compounds as potential false positives due to interference from compound fluorescence by the spectral recording method based on the assessment of the similarity index of each well from the screening plates obtained from the spectral unmixing waveforms [37]. 4. Once the data are fitted using a custom MATLAB analysis software or Fluorescence Innovation data analysis software, this software transforms the lifetime and spectral data into an easy-to-use excel spreadsheet which is generated with columns including index, row and column number, compound ID, lifetime, FRET, spectral ratio, and similarity index. 5. After removal of fluorescent compounds, process a histogram of the average FRET distribution from all compounds in the screens and fit to a Gaussian curve to obtain a mean and standard deviation (SD). 6. Define a hit as a compound that changes the average FRET efficiency by more than three times the standard deviation (3SD) relative to the mean (see Note 15). 7. Determine the assay quality using Z-factor (Z0 ) with hit compounds as positive controls and DMSO as negative controls and calculate based on Eq. 2 [40].
3 σp þ σn 0 Z ¼ 1  ð2Þ μp  μn where σ p and σ n are the standard deviations (SD) of the observed τDA values, and μp and μn are the mean τDA values of the positive and negative controls. To make this metric less sensitive to strong outliers, utilize the normalized median absolute deviation (1.4826*MAD) and median in place of the standard deviation and mean, respectively [41] (see Note 16).

132

4

Chih Hung Lo et al.

Notes 1. We describe the fusion of TNFR1 with truncated cytosolic domain (TNFR1ΔCD) to GFP and RFP, but other fluorophores such as the red-shifted FRET pair such as the orange and maroon fluorescent proteins (OFP and MFP) can also be used with adjustment to the respective lasers and filters required to measure the fluorescence waveforms of these proteins [39]. Alternatively, chemical dyes (Alexa Fluor 488 or 562) can be used to label the receptor at region of interactions (e.g., PLAD) for fluorescence lifetime measurements. 2. We describe the use of HEK293.2sus cells which are suspension cells. In our study, we titrated FBS to the cells to allow them to become adapted cells that adhere to the surface of the cell culture plates or flasks for ease of transfection [42]. Other suspension or adherent cell lines may be used with some optimization required to obtain a good FRET signal. 3. Phenol red-free media are used for cell culture as they avoid the risk of fluorescence interference of the lifetime measurements. Unwashed media will not interfere with the fluorescence reading. Phenol red media can still be used, but the user has to make sure that the cells are washed thoroughly with PBS and there is no interference in the reading by any leftover media. 4. The chemical libraries (NCC, LOPAC, ChemBridge DIVERSet, etc.) were purchased and formatted into 96-well mother plates using a FX liquid dispenser, and subsequently formatted across 384-well plates at 50 ηL or 1536-well plates at 5 ηL (10 μM final concentration per well) using an Echo liquid dispenser. DMSO (matching %v/v) was loaded as in-plate no-compound controls as well as in columns 1, 2, 23, and 24 of the 384-well plates or columns 1, 2, 23, 24, 25, 26, 47, and 48 of the 1536-well plates (negative controls). The flat, black-bottom polypropylene plates (Greiner Bio-One) were selected as the assay plates for their low autofluorescence, and low inter-well cross-talk. The plates were sealed and stored at 20  C until use. 5. We describe transfection with the Lipofectamine 3000™ reagent, but analogous approaches such as using calcium phosphate, electroporation, or lentivirus for introducing plasmids into mammalian cells work equally well. These protocols should be optimized by the FRET efficiency observed when different method of transfection is adopted. 6. The lifetime measurements of the TNFR1-GFP donor-only cell line are required to act as a control in determining the lifetime of the GFP fluorophore when it is not in close

Fluorescence Based TNFR1 Biosensor

133

proximity to an acceptor fluorophore (e.g., RFP) or when there is no energy transfer. The lifetime of both the donor-only and the donor–acceptor samples is needed in the calculation of FRET using Eq. 1. 7. We describe creation of stable cell line using the dilution method, but other methods of creating stable cell line such as using lentivirus can also be used. Characterization of the stable cell line has to be performed to ensure the quality of the TNFR1 FRET biosensor. 8. Western blotting can also be performed to ensure the gene of interest and the fluorophores are expressed. Western blot should indicate the correct molecular weight of the receptor and that there is no protein degradation due to attachment of the fluorescent proteins. 9. Our frozen stock of the FRET biosensor has been made more than 4 years ago. We thaw the frozen stock to check on the expression of the FRET biosensor at least once a year and ensure that they are still functional. We suggest users to do the same routine check at least once a year. When a drift in the expression of the FRET biosensor is observed, exposure of the cells to respective antibiotic may restore the expression. Alternatively, fluorescence-activated cell sorting (FACS) on the cell line can be performed to select the cells with co-expression of TNFR1-GFP and TNFR1-RFP for further growth and expansion. 10. During large-scale screening (~50,000 compounds) in 384-well plates, more than six T225 cm2 flasks of cells may be required (typically 30–35 flasks of cells are required), fresh frozen stock of the cell lines has to be thawed a week in advance. After 24 h of thawing, split the cells into six T225 cm2 flasks for 3 days and further split each of the six flasks into six more flasks, making a total of 36 flasks for screening. On the other hand, much less cells are required for screening in 1536well plates with 5 μL of cells per well at one million cells per mL [39]. 11. Fluorescence lifetime plate reader enables high-throughput fluorescence lifetime detection at high precision by utilizing a unique direct waveform recording technology [36]. The performance of this fluorescence lifetime plate reader has been previously demonstrated with FRET-based HTS that targets both structured proteins (e.g., SERCA and ryanodine receptor) [35, 37, 43–45] and intrinsically disordered proteins (e.g., tau and α-synuclein) [46, 47].

134

Chih Hung Lo et al.

12. We have developed fluorescence resonance energy transfer (FRET) biosensors with red-shifted fluorescent proteins, yielding improved characteristics for time-resolved (lifetime) fluorescence measurements. In comparison to biosensors with green and red FRET pairs (GFP/RFP), FPs that emit at longer wavelengths (orange and maroon, OFP/MFP) increased the FRET efficiency, dynamic range, and signal-to-background of HTS [39]. There is also a large reduction in compounds that exhibit fluorescent interference. 13. The instrument response function (IRF) needs to be acquired to remove background contributions from the FLT-PR laser and detection equipment. It is convolved with an exponential to measure the lifetime of the samples. The decay found from the instrument itself is removed by convolution of the samples. This convolution is performed in an iterative process using MATLAB or Fluorescence Innovations data analysis software (Fluorescence Innovations, Inc.). 14. Different incubation timings such as 20 min, 1 h, or anytime up to 4 h can be monitored for kinetics measurements. The FRET signal has been determined to be stable for up to 4 h. 15. In determining the hits, a minimum of 3SD should be used for statistical significance. User can increase the stringency of the hit selection by adopting a higher SD cutoff (e.g., 4SD, 5SD, etc.) with the purpose to limit the hit rate to 0.5–1% for ease of subsequent testing of the hits. Each FRET biosensor will behave differently, so threshold should be defined on a screenby-screen basis. 16. For control compounds (both inhibitors or activators) during HTS, the user can choose from several well-characterized small molecules that disrupt receptor–receptor interaction or perturb receptor conformational dynamics leading to modulation of TNFR1-induced downstream signaling (e.g., NF-κB activation) (see Table 1).

Table 1 Reference compounds and their FRET EC50 values, Z-factor (Z0 ) and functional NF-κB activation IC50 or EC50 values obtained from the NCC, LOPAC, and DIVERSet HTS using the TNFR1 FRET biosensor in the 384-well format Compound Zafirlukast DS42 SB 200646 hydrochloride

Z0 (200 μM)

NF-κB activation

References

18.2

0.76  0.02

Absolute IC50 ¼ 48.0 μM

[32]

101.7

0.63  0.03

Absolute IC50 ¼ 49.8 μM

[27]

6.6

0.55  0.02

Activator EC50 ¼ 6.8 μM

[33]

FRET EC50 (μM)

Fluorescence Based TNFR1 Biosensor

135

Acknowledgements We thank Samantha Yuen and Prachi Bawaskar from the Thomas group and Benjamin Grant from Fluorescence Innovations for technical discussions. The pRH132 plasmid was a gift from the Reuben Harris lab at UMN. Flow cytometry and FACS were performed at the UMN Lillehei Heart Institute, confocal fluorescence microscopy was conducted at the UMN Imaging Center, compound dispensing at the UMN Institute of Therapeutics Discovery and Development, and spectroscopy measurements at the UMN Biophysical Technology Center. This study was supported by U.S. NIH grants to J.N.S. (R01 GM107175 and R35 GM131814) and D.D.T. (R01 GM27906, R37 AG26260, R42 DA03762). C.H.L. was supported by a Doctoral Dissertation Fellowship from the UMN. References 1. Ashkenazi A, Dixit VM (1998) Death receptors: signaling and modulation. Science 281:1305–1308 2. Wajant H, Scheurich P (2011) TNFR1induced activation of the classical NF-kappaB pathway. FEBS J 278:862–876 3. Brenner D, Blaser H, Mak TW (2015) Regulation of tumour necrosis factor signalling: live or let die. Nat Rev Immunol 15:362–374 4. NIH (2005) Progress in autoimmune diseases research, Report to Congress, National Institutes of Health, The Autoimmune Diseases Coordinating Committee, March 2005, forward and pages i, 1, 2, 16, 17, 28, 29, 30, 32, 52 5. Sedger LM, McDermott MF (2014) TNF and TNF-receptors: from mediators of cell death and inflammation to therapeutic giants – past, present and future. Cytokine Growth Factor Rev 25:453–472 6. Tracey D, Klareskog L, Sasso EH et al (2008) Tumor necrosis factor antagonist mechanisms of action: a comprehensive review. Pharmacol Ther 117:244–279 7. Shakoor N, Michalska M, Harris CA et al (2002) Drug-induced systemic lupus erythematosus associated with etanercept therapy. Lancet 359:579–580 8. Wolfe F, Michaud K (2004) Lymphoma in rheumatoid arthritis: the effect of methotrexate and anti-tumor necrosis factor therapy in 18,572 patients. Arthritis Rheum 50 (6):1740–1751 9. Steeland S, Libert C, Vandenbroucke RE (2018) A new venue of TNF targeting. Int J Mol Sci 19:1442

10. Fischer R, Kontermann R, Maier O (2015) Targeting sTNF/TNFR1 signaling as a new therapeutic strategy. Antibodies 4:48 11. Zettlitz KA, Lorenz V, Landauer K et al (2010) ATROSAB, a humanized antagonistic antitumor necrosis factor receptor one-specific antibody. mAbs 2:639–647 12. Steeland S, Puime`ge L, Vandenbroucke RE et al (2015) Generation and characterization of small single domain antibodies inhibiting human tumor necrosis factor receptor 1. J Biol Chem 290:4022–4037 13. Carter PH, Scherle PA, Muckelbauer JK et al (2001) Photochemically enhanced binding of small molecules to the tumor necrosis factor receptor-1 inhibits the binding of TNF-alpha. Proc Natl Acad Sci U S A 98:11879–11884 14. Chen S, Feng Z, Wang Y et al (2017) Discovery of novel ligands for TNF-α and TNF Receptor1 through structure-based virtual screening and biological assay. J Chem Inf Model 57:1101–1111 15. Deng G-M, Zheng L, Ka-Ming Chan F et al (2005) Amelioration of inflammatory arthritis by targeting the pre-ligand assembly domain of tumor necrosis factor receptors. Nat Med 11:1066–1072 16. Schon A, Lam SY, Freire E (2011) Thermodynamics-based drug design: strategies for inhibiting protein-protein interactions. Future Med Chem 3:1129–1137 17. Schon A, Madani N, Smith AB et al (2011) Some binding-related drug properties are dependent on thermodynamic signature. Chem Biol Drug Des 77(3):161–165

136

Chih Hung Lo et al.

18. Wells JA, McClendon CL (2007) Reaching for high-hanging fruit in drug discovery at protein–protein interfaces. Nature 450:1001 19. Lewis AK, Valley CC, Sachs JN (2012) TNFR1 signaling is associated with backbone conformational changes of receptor dimers consistent with overactivation in the R92Q TRAPS mutant. Biochemistry 51:6545–6555 20. Lewis Andrew K, James Zachary M, McCaffrey Jesse E et al (2014) Open and closed conformations of the isolated transmembrane domain of death receptor 5 support a new model of activation. Biophys J 106:L21–L24 21. Valley CC, Lewis AK, Mudaliar DJ et al (2012) Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) induces death receptor 5 networks that are highly organized. J Biol Chem 287:21265–21278 22. Valley CC, Lewis AK, Sachs JN (2017) Piecing it together: unraveling the elusive structurefunction relationship in single-pass membrane receptors. Biochim Biophys Acta Biomembr 1859:1398–1416 23. Fricke F, Malkusch S, Wangorsch G et al (2014) Quantitative single-molecule localization microscopy combined with rule-based modeling reveals ligand-induced TNF-R1 reorganization toward higher-order oligomers. Histochem Cell Biol 142:91–101 24. Wang Y, Bugge K, Kragelund BB et al (2018) Role of protein dynamics in transmembrane receptor signalling. Curr Opin Struct Biol 48:74–82 25. Vunnam N, Lo CH, Grant BD et al (2017) Soluble extracellular domain of death receptor 5 inhibits TRAIL-induced apoptosis by disrupting receptor–receptor interactions. J Mol Biol 429:2943–2953 26. Vunnam N, Campbell-Bezat CK, Lewis AK et al (2017) Death receptor 5 activation is energetically coupled to opening of the transmembrane domain dimer. Biophys J 113:381–392 27. Lo CH, Schaaf TM, Grant BD et al (2019) Noncompetitive inhibitors of TNFR1 probe conformational activation states. Sci Signal 12: eaav5637 28. Lewis AK, Valley CC, Peery SL et al (2016) Death receptor 5 networks require membrane cholesterol for proper structure and function. J Mol Biol 428:4843–4855 29. Murali R, Cheng X, Berezov A et al (2005) Disabling TNF receptor signaling by induced conformational perturbation of tryptophan107. Proc Natl Acad Sci U S A 102:10970–10975

30. Banner DW, D’Arcy A, Janes W et al (1993) Crystal structure of the soluble human 55 kd TNF receptor-human TNFβ complex: implications for TNF receptor activation. Cell 73:431–445 31. Naismith JH, Devine TQ, Brandhuber BJ et al (1995) Crystallographic evidence for dimerization of unliganded tumor necrosis factor receptor. J Biol Chem 270(22):13303–13307 32. Lo CH, Vunnam N, Lewis AK et al (2017) An innovative high-throughput screening approach for discovery of small molecules that inhibit TNF receptors. SLAS Discov 22:950–961 33. Lo CH, Huber EC, Sachs JN (2020) Conformational states of TNFR1 as a molecular switch for receptor function. Protein Sci 29. https:// doi.org/10.1002/pro.3829; Published 20 Jan 2020 34. Petersen KJ, Peterson KC, Muretta JM et al (2014) Fluorescence lifetime plate reader: resolution and precision meet high-throughput. Rev Sci Instrum 85:113101 35. Gruber SJ, Cornea RL, Li J et al (2014) Discovery of enzyme modulators via highthroughput time-resolved FRET in living cells. J Biomol Screen 19(2):215–222 36. Muretta JM, Kyrychenko A, Ladokhin AS et al (2010) High-performance time-resolved fluorescence by direct waveform recording. Rev Sci Instrum 81:103101–103101 37. Schaaf TM, Peterson KC, Grant BD et al (2017) High-throughput spectral and lifetime-based FRET screening in living cells to identify small-molecule effectors of SERCA. SLAS Discov 22:262–273 38. Schaaf TM, Peterson KC, Grant BD et al (2017) Spectral unmixing plate reader: highthroughput, high-precision FRET assays in living cells. SLAS Discov 22:250–261 39. Schaaf TM, Li A, Grant BD et al (2018) Red-shifted FRET biosensors for highthroughput fluorescence lifetime screening. Biosensors 8:99 40. Zhang JH, Chung TD, Oldenburg KR (1999) A simple statistical parameter for use in evaluation and validation of high throughput screening assays. J Biomol Screen 4:67–73 41. Birmingham A, Selfors LM, Forster T et al (2009) Statistical methods for analysis of high-throughput RNA interference screens. Nat Methods 6:569–575 42. McAllister R, Schofield C, Pettman G et al (2002) Adaptation of recombinant HEK-293 cells to growth in serum free suspension. In:

Fluorescence Based TNFR1 Biosensor Bernard A, Griffiths B, Noe´ W, Wurm F (eds) Animal cell technology: products from cells, cells as products: proceedings of the 16th ESACT meeting April 25–29, 1999, Lugano, Switzerland. Springer Netherlands, Dordrecht, pp 367–369 43. Cornea RL, Gruber SJ, Lockamy EL et al (2013) High-throughput FRET assay yields allosteric SERCA activators. J Biomol Screen 18:97–107 44. Rebbeck RT, Essawy MM, Nitu FR et al (2016) High-throughput screens to discover small-molecule modulators of ryanodine receptor calcium release channels. SLAS Discov 22:176–186

137

45. Stroik DR, Yuen SL, Janicek KA et al (2018) Targeting protein-protein interactions for therapeutic discovery via FRET-based highthroughput screening in living cells. Sci Rep 8:12560–12560 46. Lo CH, Lim CK-W, Ding Z et al (2019) Targeting the ensemble of heterogeneous tau oligomers in cells: a novel small molecule screening platform for tauopathies. Alzheimers Dement 15:1489–1502 47. Braun AR, Liao EE, Horvath M et al (2020) Potent inhibitors of toxic alpha-synuclein oligomers identified via cellular time-resolved FRET biosensor. bioRxiv:2020.01.09.900845

Chapter 10 Production of Multi-Subtype Influenza Virus-Like Particles by Molecular Fusion with BAFF or APRIL for Vaccine Development Ting-Hsuan Chen, Jo-Yu Hong, Chia-Chyi Liu, Chung-Chu Chen, Jia-Tsrong Jan, and Suh-Chin Wu Abstract Virus-like particle (VLP) technology is an alternative platform for developing vaccines to combat seasonal and pandemic influenza. Influenza VLPs are non-infectious nanoparticles that can elicit effective vaccine immunogenicity in hosts. B-cell-activating factor (BAFF, or BLyS) and a proliferation-inducing ligand (APRIL) are members of the tumor necrosis factor (TNF) superfamily of cytokines. Both BAFF and APRIL are homotrimers that interact with homotrimeric receptors. Here, we report a method of the production of influenza VLPs by molecular incorporation with BAFF or APRIL homotrimers to interact with their receptors. We engineered the VLPs by direct fusion of BAFF or APRIL to the transmembrane anchored domain of the hemagglutinin (HA) gene. We also describe procedures for the production of BAFF-VLPs containing H5H7 and H1H5H7 for multi-subtype vaccine development. Key words Influenza VLP, Molecular fusion, BAFF, APRIL, Multi-subtype vaccine

1

Introduction Virus-like particle (VLP) technology is an alternative platform for developing vaccines to combat seasonal and pandemic influenza. Influenza VLPs are non-infectious nanoparticles that do not contain genomic RNA. However, they contain native hemagglutinin (HA) and neuraminidase (NA) oligomeric structures that can elicit effective vaccine immunogenicity in hosts [1, 2]. Influenza VLP assembly consists of (a) initiating virus budding by HA and/or NA viral proteins targeted at lipid rafts, (b) assembly by M1 viral protein polymerization, and (c) membrane scission with M2 ion channel proteins [3]. Influenza VLP production involves overexpression of HA, M1, NA, and/or M2 viral proteins in insect cells [4–7], mammalian cells [8–10], or plant cells [11, 12]. Once established, VLPs can elicit protective immune responses following either

Jagadeesh Bayry (ed.), The TNF Superfamily: Methods and Protocols, Methods in Molecular Biology, vol. 2248, https://doi.org/10.1007/978-1-0716-1130-2_10, © Springer Science+Business Media, LLC, part of Springer Nature 2021

139

140

Ting-Hsuan Chen et al.

single- or double-dose intramuscular injections [6, 7, 13], although recent success has been reported with intranasal [14– 17] and intradermal immunizations [18, 19]. B-cell-activating factor (BAFF, or BLyS) and a proliferationinducing ligand (APRIL) are members of the tumor necrosis factor (TNF) superfamily of cytokines. They are both important B-cell factors for survival and differentiation of antigen-activated B cells and antibody-secreting cells (ASCs), as well as, for B-cell development in T follicular helper (TFH)-germinal center (GC) B-cell interactions [20, 21]. There are three types of receptors for BAFF and APRIL: BAFF receptor (BAFF-R), transmembrane activator and CAML interactor (TACI), and B-cell maturation antigen (BCMA) [20, 21]. BAFF functions through these three receptors, but the primary function of promoting survival occurs through BAFF-R [20, 21]. BAFF has a relatively low affinity for BCMA. APRIL binds to TACI and BCMA through a different signaling pathway involved in B-cell activation [20, 21]. Both BAFF and APRIL are homotrimers that interact with homotrimeric receptors, although BAFF can be active as either a hetero- or homotrimer that can also aggregate into 60-mer complexes [21]. BAFF and APRIL can also form single-chain heteromers with different stoichiometric ratios with distinct receptor-binding properties, but the BAFFAPRIL heteromers are less active than BAFF alone [22]. The method of using BAFF and APRIL as molecular adjuvants has been reported for HIV-1 vaccine design, either using soluble envelope trimers [23] or DNA vaccines [24]. The DNA vaccine studies revealed that cis-adjuvant effects of BAFF and APRIL increase the titers of broadly neutralizing antibodies in sera that can be further augmented by IL-12p70 co-stimulation [24]. Recently, a recombinant rabies vaccine containing BAFF was found to rapidly generate antibody-secreting plasma cells through the extrafollicular, but not GC B-cell pathways [25]. However, another recombinant rabies vaccine containing APRIL was found to be dispensable for longlived antibody-secreting plasma cells, and was unrelated to the TACI-associated signaling [26]. The mechanism of how BAFF and APRIL elicit strong antibody responses by either targeting to B-cells by B-cell receptor binding, or targeting to other antigenpresenting cells, such as macrophages and dendritic cells, requires further investigation [27]. More importantly, assessing potentially undesirable autoimmune responses induced by BAFF and APRIL immunizations should be evaluated extensively [27]. Here, we describe a method of designing influenza VLPs by molecular incorporation with BAFF or APRIL homotrimers to interact with their receptors. We engineered the VLPs by direct fusion of BAFF or APRIL to the transmembrane anchored domain of the HA gene. Incorporation of the trimeric conformations of BAFF and APRIL provided by the HA-transmembrane anchor are critical. Our results showed that immunization with the

Multi-Sutbype Influenza VLPs Containing BAFF or APRIL

141

HA-transmembrane anchored BAFF- or APRIL-VLPs elicit significantly higher IgG titers. However, only the BAFF-VLPs induced more potent and broadly neutralizing antibodies against H5N1 clades, and conferred protective immunity against live virus challenges [28]. In addition, we successfully obtained H5H7 and H1H5H7 BAFF-VLPs for multi-subtype influenza vaccine development [28].

2

Materials

2.1 Plasmid Cloning and Preparation

1. Insect cell cDNA sequences: H5 sequence (accession number: CY111598). M1 sequence position 26-784 bp (accession number: MF039638). M2 sequence position 26-1007 bp (accession number: MF039638). NA sequence (accession number: HM006761). Mouse BAFF sequence (accession number: AAD22475). Mouse APRIL sequence (accession number: AAG22534). H1 sequence (accession number: GQ323512). H7 sequence (accession number: KF021597). 2. pFastBacDual plasmid (Invitrogen) [29]. 3. Restriction enzymes: BamHI (New England Biolabs). NotI (New England Biolabs). KpnI (New England Biolabs). XhoI (New England Biolabs). EcoRI (New England Biolabs). HindIII (New England Biolabs). XbaI (New England Biolabs). 4. Tris-acetate-EDTA (TAE) buffer (VWR Life Science). 0.04 M Tris-Acetate, 0.001 M EDTA, pH 8.0. 5. Low electroendosmosis (EEO) agarose (FocusBio). 6. SyBR@ Safe DNA gel stain (Thermo Fisher Scientific). 7. PCR/gel purification kit (Geneaid). 8. T4 DNA ligase (Thermo Fisher Scientific). 9. 10X T4 DNA ligase buffer (Thermo Fisher Scientific). 10. Luria broth (LB) medium (FocusBio).

142

Ting-Hsuan Chen et al.

11. LB agar (FocusBio). 12. Ampicillin (MDBio,Inc.). 13. Presto™ Mini Plasmid Kit (Geneaid). 2.2 Bacmid Preparation

1. DH10Bac competent cells (Invitrogen) [29]. 2. LB medium. 3. LB agar. 4. X-gal (Cyrusbioscience). 5. Isopropyl ß-D-1-thiogalactopyranoside (IPTG). 6. Gentamicin (MDBio,Inc.). 7. Tetracycline (MDBio,Inc.). 8. Kanamycin (MDBio,Inc.). 9. PureLink HiPure Plasmid Midiprep Kit (Invitrogen). 10. Taq polymerase (New England Biolabs). 11. M13 primers (forward and reverse) [29]. 12. TAE buffer. 13. Low EEO agarose (FocusBio). 14. SyBR@ Safe DNA gel stain (Invitrogen).

2.3 Recombinant Baculovirus (rbv)

1. Sf9 cell (Invitrogen) [29]. 2. Sf900 II serum-free medium (SFM) (Gibco). 3. 500 mL flat bottom spinner flask (Bellco). 4. Magnetic stirrer (Bellco). 5. 28
C incubator (Yihder CO., Ltd). 6. Opti-MEM I (Gibco). 7. 6-well cell culture plate (Thermo Fisher Scientific). 8. Fetal bovine serum (FBS) (Gibco). 9. Turbofect transfection reagent (Thermo Fisher Scientific). 10. 15 cm cell culture dish (Thermo Fisher Scientific). 11. 1.5 mL Eppendorf tubes.

2.4 VLP Preparation and Purification

1. Centrifuge 5810R (Eppendorf). 2. 0.45 μm and 0.22 μm polythersulfone membrane filters (Sartorius). 3. 500 mL flat bottom spinner flask (Bellco). 4. 100 kDa Vivaflow 200 laboratory cross flow cassette (Sartorius). 5. Masterflex® Peristaltic Tubing Pump (Cole-Parmer).

Multi-Sutbype Influenza VLPs Containing BAFF or APRIL

143

6. CP100WX himac ultracentrifuge (Hitachi). 7. P40ST rotor (Hitachi). 8. Sucrose (J.T.Baker). 9. Phosphate buffered saline (PBS). 2.5 VLP Characterization

1. Sucrose.

2.5.1 Western Blotting

3. Nitrocellulose blotting membrane (GE Healthcare Life Sciences).

2. 30% acrylamide (Biokit Biotechnology, Inc).

4. Antibodies: Anti-HA antibody GTX41297 (GeneTex), antiNA antibody GTX127984 (GeneTex), anti-M1 antibody GTX127356 (GeneTex), anti-M2 antibody GTX125951 (GeneTex), goat anti-Rabbit IgG H&L (HRP) (ab6721) (Abcam). 5. Western Lightning® Plus ECL (Perkin Elmer). 6. 96-well V bottom plate (Thermo Fisher Scientific). 2.5.2 Transmission Electron Microscopy (TEM) Analysis

1. 200-mesh copper grid (Agar scientific).

2.5.3 Hemagglutination Assay

1. 0.5% turkey red blood cells.

2. 2% uranyl acetate solution (Agar scientific). 3. EM-1400 TEM microscope (JEOL).

2. 96-well V-bottom ELISA plate (Thermo Fisher Scientific). 3. PBS.

2.5.4 Neuraminidase Activity Assay

1. 96-well plate 2. Fetuin from fetal bovine serum (F2379) (Sigma). 3. PBST: PBS, 0.05% Tween 20 (J.T. Baker). 4. Blocking buffer: PBS, 1% Bovine serum albumin (BSA) (Chumeia chemical Inc.). 5. HRP conjugated lectin from Arachis hypogaea (peanut) (L7759) (Sigma). 6. 3,30 ,5,50 – tetramethylbenzidine (BioLegend). 7. 2 N H2SO4. 8. ELISA reader (TECAN).

(TMB)

substrate

set

144

3

Ting-Hsuan Chen et al.

Methods

3.1 Plasmid Construction 3.1.1 pFastBac Dual HAM1 and pFastBac Dual NAM2 Plasmids

3.1.2 pFastBac Dual BAFF/HAtm-M, and pFastBac Dual APRIL/ HAtm-M1 Plasmids

1. Clone the H5HA and M1 genes into a pFastBac Dual plasmid, downstream of the polyhedrin (pH) promoter using BamHI/ NotI sites, and downstream of the p10 promoter using KpnI/ XhoI sites, respectively, to construct a pFastBac Dual HA-M1 plasmid (see Note 1) (Fig. 1). 2. Clone the M2 and NA genes into a pFastBac Dual plasmid downstream of the pH promoter using EcoRI/HindIII sites, and downstream of the p10 promoter using KpnI/XhoI sites, respectively, to construct a pFastBac Dual NA-M2 plasmid (Fig. 1). 1. Synthesize cDNAs of BAFF and APRIL with a H5HA transmembrane-cytoplasmic tail domain (HAtm) at the 30 terminal of each gene to construct respective BAFF/HAtm and APRIL/HAtm fusion protein genes (see Note 2) (Figs. 2 and 3). 2. Clone the BAFF/HAtm and APRIL/HAtm genes into three pFastBac Dual HA-M1 plasmids individually by replacing the H5HA gene. 3. Use BamHI/NotI sites to construct pFastBac Dual BAFF/ HAtm-M1 (Fig. 2), and pFastBac Dual APRIL/HAtm-M1 plasmids, respectively (Fig. 3).

3.1.3 pFastBac Dual H1M1 and pFastBac Dual H7M1 Plasmids

1. Clone the H1HA and H7HA genes into two pFastBact Dual HA-M1 plasmids individually by replacing the H5HA gene.

3.2 Baculovirus Shuttle Vector (Bacmid) Preparation (See Note 4)

1. Prepare the bacmids Bac-HA-M1, Bac-M2-NA, Bac-BAFF/ HAtm-M1, Bac-APRIL/HAtm-M1, Bac-H1-M1, and Bac-H7-M1, by recombination using pFastBac Dual HA-M1, pFastBac Dual NA-M2, pFastBac Dual BAFF/HAtm-M1, pFastBac Dual APRIL/HAtm-M1, pFastBac Dual H1-M1 and pFastBac Dual H7-M1 plasmids, respectively, with the following steps.

2. Use the BamHI/NotI and BamHI/XbaI sites to construct respective pFastBac Dual H1-M1 and pFastBac Dual H7-M1 plasmids (see Note 3) (Figs. 4 and 5).

2. Transform 10 ng of each of the modified pFastBac Dual plasmids mentioned in Subheading 3.1 into the DH10Bac competent cells by co-incubating the plasmids with the competent cells for 30 min on ice, and then heat shock for 45 s at 42
C. 3. Incubate the competent cells on ice for 2 min, add then add 1 mL of LB broth to each tube. Recover the competent cells at 42
C and shake at 180 rpm for 4 h.

Multi-Sutbype Influenza VLPs Containing BAFF or APRIL

145

Fig. 1 WT VLP production. Transform the pFastBac Dual HA-M1 and pFastBac NA-M2 into DH10Bac competent cells for the Bac-HA-M1 and Bac-NA-M2 bacmid purification. Transfect the insect cells with Bac-HA-M1 and Bac-NA-M2 bacmids to generate rbv-HA-M1 and rbv-NA-M2. Finally, co-infect the Sf9 cells with rbv-HA-M1 and rbv-NA-M2 for WT-VLP production in the supernatant

Fig. 2 BAFF-VLP production. Transform the pFastBac Dual BAFF/HAtm-M1 into the DH10Bac competent cells for Bac-BAFF/HAtm-M1 bacmid purification, and transfect the insect cells with Bac-BAFF/HAtm-M1 to generate rbv-BAFF/HAtm-M1. Finally, co-infect the Sf9 cells with rbv-HA-M1, rbv-NA-M2, and rbv-BAFF/ HAtm-M1 for BAFF-VLP production in the supernatant

Fig. 3 APRIL-VLP production. Transform the pFastBac Dual APRIL/HAtm-M1 into the DH10Bac competent cells for Bac-APRIL/HAtm-M1 bacmid purification. Transfect the insect cells with Bac-APRIL/HAtm-M1 to generate rbv-APRIL/HAtm-M1. Finally, co-infect the Sf9 cells with rbv-HA-M1, rbv-NA-M2, and rbv-APRIL/HAtm-M1 for APRIL-VLP production in the supernatant

146

Ting-Hsuan Chen et al.

Fig. 4 Bi-subtype (H5H7)-BAFF-VLP production. Transform the pFastBac Dual H7-M1 into DH10Bac competent cells for Bac-H7-M1 bacmid purification. Transfect the insect cells with Bac-H7-M1 to generate rbv-H7-M1. Finally, co-infect the Sf9 cells with rbv-HA-M1, rbv-NA-M2, rbv-BAFF/HAtm-M1, and rbv-H7-M1 for H5H7BAFF-VLP production in the supernatant

Fig. 5 Tri-subtype (H1H5H7)-BAFF-VLP production. Transform the pFastBac Dual H1-M1 into DH10Bac competent cells for Bac-H1-M1 bacmid purification. Transfect the insect cells with Bac-H1-M1 to generate rbv-H1-M1. Finally, co-infect Sf9 cells with rbv-HA-M1, rbv-NA-M2, rbv-BAFF/HAtm-M1, rbv-H7-M1, and rbv-H1-M1 for H1H5H7-BAFF-VLP production in the supernatant

4. Plate the transformed competent cells onto LB agar plates containing 50 μg/mL of kanamycin, 7 μg/mL of gentamycin, 10 μg/mL of tetracycline, 40 μg/mL of IPTG, and 100 μg/ mL of X-gal.

Multi-Sutbype Influenza VLPs Containing BAFF or APRIL

147

5. Incubate the agar plate at 37
C in the dark for 48 h until both white and blue colonies can be easily observed. 6. Inoculate one of the white colonies on each plate into a 300 mL of LB broth containing 50 μg/mL of kanamycin, 7 μg/mL of gentamycin, 10 μg/mL of tetracycline, and shake at 180 rpm overnight at 37
C. 7. Use the PureLink HiPure Plasmid Midiprep Kit to purify the each Bacmid 8. Perform PCR with M13 primers (see Note 5) to verify successfully generated recombinant bacmid fragments with a predicted size of the introduced DNA plus 2652 bp, as described in the manufacturer’s manual. 3.3 Recombinant Baculovirus (rbv) Preparation

1. Prepare the rbv’s, which include rbv-HA-M1, rbv-M2-NA, rbv-BAFF/HAtm-M1, rbv-APRIL/HAtm-M1, rbv-H1-M1, and rbv-H7-M1, by transfecting Sf9 cells with Bac-HA-M1, Bac-NA-M2, Bac-BAFF/HAtm-M1, Bac-APRIL/HAtm-M, Bac-Dual H1-M1, and Bac-H7-M1 bacmids, respectively, with the following steps. 2. Incubate 9  105 Sf9 cells in 2 mL of Sf-900 II SFM in a 6-well plate for 30 min at 28
C until the cells attach to the bottom of the plate. 3. Gently mix 2 μg of each bacmid with 8 μL of turbofect transfection reagent and 200 μL of Opti-MEM I in a 1.5 mL Eppendorf tube, and then incubate the tubes at room temperature for 15 min. 4. Add the mixture prepared in the previous step to the prepared cells, and then incubate the cells at 28
C for 6 h for transfection. 5. Change the medium with 2 mL of Sf-900 II SFM containing 5% FBS and incubate the cells at 28
C for 5–7 days for rbv amplification. 6. Collect the supernatant (P1 virus), and add 1 mL of P1 virus to 2  107 attached Sf9 cells in a 15 cm culture dish with 20 mL of Sf-900 II SFM containing 5% FBS. 7. Incubate the P1 virus-infected cells for at 28
C for 4–5 days for rbv amplification until >50% of cells detach from the bottom of the dish. 8. Collect the supernatant (P2 virus). Remove cell debris by centrifugation at 1200 g for 5 min, and aliquot the P2 virus (1 mL/Eppendorf tube). Store the stock of virus at 20
C. 9. Thaw and add 1 mL of the P2 virus stock to 2  107 attached Sf9 cells in a 15 cm culture dish with 20 mL of Sf-900 II SFM containing 5% FBS.

148

Ting-Hsuan Chen et al.

10. Incubate the P2 virus-infected cells for at 28
C for 4–5 days for rbv amplification until >50% of cells detach from the bottom of the dish. 11. Collect the supernatant (P3 virus). Remove cell debris by centrifugation at 1200  g for 5 min, and store the P3 virus at 4
C until VLP production. 3.4

VLP Preparation

3.4.1 Production of Wild Type H5N1 VLP (WT-VLP)

1. Prepare 300 mL of 1.7  106 cells/mL of Sf9 suspension cells cultured in Sf-900 II SFM in a 500 mL flat bottom spinner flask stirring at 70 rpm at 28
C. 2. Co-infect the prepared cells with P3 rbv-HA-M1 and P3 rbv-M2-NA, and incubate the infected cells for 72 h, stirring at 70 rpm at 28
C for VLP production (Fig. 1). 3. Harvest VLP-containing supernatant by centrifugation at 500  g at 4
C for 20 min. 4. Remove the remaining cell debris by centrifugation at 13,000  g at 4
C for 5 min. 5. Filter the supernatant through a sterile 0.45 μm filter. 6. Concentrate the supernatant into 30 mL by tangential flow filtration (TFF) using a 100 kDa flow cassette. 7. Load the concentrated supernatants into PBS with 20% sucrose filtered with a 0.22 μm filter, and centrifuge the sample at 136,700  g at 4
C for 3 h using an ultracentrifuge with a P40ST rotor. 8. Discard the supernatant, and resuspend VLP at the bottom of the tube in 600 μL of sterile PBS, and store the sample at 4
C.

3.4.2 Production of the BAFF-VLP

1. Follow the same preparation procedure mentioned in Subheading 3.4.1, except the rbv infection steps mentioned below. 2. For BAFF-VLP production, co-infect the prepared cells with P3 rbv-HA-M1, P3 rbv-BAFF/HAtm-M1, and P3 rbv-M2NA, and incubate the infected cells for 72 h, stirring at 70 rpm at 28
C for VLP production (Fig. 2). 3. Follow the steps 3–8 in Subheading 3.1.4 for the BAFF-VLP purification.

3.4.3 Production of the APRIL-VLP

1. Follow the same preparation procedure mentioned in Subheading 3.4.1, except the rbv infection steps mentioned below. 2. For APRIL-VLP production, co-infect the prepared cells with P3 rbv-HA-M1, P3 rbv-APRIL/HAtm-M1, and P3 rbv-M2NA, and incubate the infected cells for 72 h, stirring at 70 rpm at 28
C for VLP production (Fig. 3). 3. Follow the steps 3–8 in Subheading 3.1.4 for the APRIL-VLP purification.

Multi-Sutbype Influenza VLPs Containing BAFF or APRIL 3.4.4 Production of the Bi-subtype (H5H7) BAFFVLP

149

1. Follow the same preparation procedure mentioned in Subheading 3.4.1, except the rbv infection steps mentioned below. 2. For the bi-subtype (H5H7) BAFF-VLP production, co-infect the prepared cells with P3 rbv-HA-M1, P3 rbv-H7-M1, P3 rbv-BAFF/HAtm-M1, and P3 rbv-M2-NA, and incubate the infected cells for 72 h, stirring at 70 rpm at 28
C for VLP production (Fig. 4). 3. Follow the steps 3–8 in Subheading 3.1.4 for the H5H7 BAFF-VLP purification.

3.4.5 Production of the Tri-subtype (H1H5H7) BAFF-VLP

1. For the tri-subtype (H1H5H7) BAFF-VLP production, co-infect the prepared cells with P3 rbv-H1-M1, P3 rbv-HAM1, P3 rbv-H7-M1, P3 rbv-BAFF/HAtm-M1, and P3 rbv-M2-NA. 2. Incubate the infected cells for 72 h, stirring at 70 rpm at 28
C for VLP production (Fig. 5). 3. Follow the steps 3–8 in Subheading 3.1.4 for the H1H5H7 BAFF-VLP purification.

3.5 VLP Characterization 3.5.1 Western Blotting

1. Load the VLP sample onto a sucrose gradient solution (20%, 30%, 40%, 50%, and 60% sucrose dissolved in PBS, filtered with a 0.22 μm filter). 2. Centrifuge the sample at 33,000 rpm at 4
C for 4 h using an ultracentrifuge with a P40ST rotor. 3. Collect each fraction individually. 4. Characterize each fraction by Western blotting using 12% sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE) with anti-H5HA, anti-N1NA, anti-M1, and anti-M2 antibodies [28].

3.5.2 Transmission Electron Microscopy (TEM) Analysis

1. Add 4 μL of purified VLP sample on a carbon-vaporized 200-mesh copper grid. 2. Keep the sample on the copper grid for 1 min at room temperature. 3. Remove the excess sample with a piece of filter paper. 4. Wash the sample twice with ddH2O. 5. Stain the sample with 2% uranyl acetate solution for 1 min. 6. Remove the uranyl acetate solution with a piece of filter paper. 7. Air-dry the sample. 8. Observe the sample using a JEM-1400 TEM microscope (Fig. 6).

150

Ting-Hsuan Chen et al.

Fig. 6 Observation of VLP by transmission electron microscopy. Purified VLP can be clearly observed using a transmission electron microscope. The diameter of VLPs are about 100 nm, which are similar to that of live influenza virus. These images show the data obtained from the (a) WT-VLP, (b) BAFF-VLP, and (c) APRIL-VLP as examples. The images of H5H7-BAFF-VLP, and H1H5H7-BAFFVLP have been previously published [28] 3.5.3 Hemagglutination Assay

1. Perform a twofold serial dilution of the purified VLP sample, starting from 70 μg/mL in 50 μL of PBS in a V-bottom 96-well plate. 2. Add 50 μL of 0.5% turkey red blood cells (RBC) prepared in PBS to each well. 3. Incubate the mixture at room temperature for 30 min. 4. Determine the HA unit using the reciprocal value of the last dilution containing non-agglutinated RBCs [28].

3.5.4 NA Enzyme Activity Assay

1. Coat 100 μL of 50 μg/mL fetuin in a 96-well plate overnight at 4
C. 2. Wash the wells 3 times with 300 μL of PBST. 3. Block the wells with blocking buffer at room temperature for 2 h. 4. Serial dilute the purified VLP sample two times starting from 150 μg/mL in 100 μL of blocking buffer. 5. Add 100 μL of diluted VLP sample to the prepared 96-well plate.

Multi-Sutbype Influenza VLPs Containing BAFF or APRIL

151

6. Incubate the plate at 4
C for 1 h. 7. Wash the wells 3 times with 300 μL of PBST. 8. Add 100 μL of HRP conjugated lectin from Arachis hypogaea (2.5 μg/mL). Incubate the plate at room temperature for 1 h. 9. Wash the wells 3 times with 300 μL of PBST. 10. Add 100 μL of TMB substrate, and incubate the plate in the dark for 15 min. 11. Add 100 μL of 2 N H2SO4 to stop the reaction. 12. Measure the optical density at 450 nm using an ELISA reader (TECAN) [28].

4

Notes 1. Influenza VLP can be produced from insect cells overexpressing viral HA, NA, M1, and M2 proteins [4–7]. Therefore, the plasmids containing these genes need to be cloned. The pFastBac Dual plasmids contain two promoters (pH and p10), and can be used to generate a baculovirus containing two different exogenous genes. Through co-infection of multiple recombinant baculoviruses carrying different genes, the infected insect cells can express multiple desired exogenous viral proteins for generating engineered VLP [7, 28, 30]. 2. For expression of non-viral proteins on the VLP surface, the desired protein needs to be fused with a viral membrane protein by PCR with a proper formation of biomolecular complexed to assemble functional structures with correct numbers of subunits. For example, FliC can bind to TLR5, triggering downstream signaling as a monomer. Therefore, as previously reported, FliC can be fused with either the trimeric HAtm domain [17], or the tetrameric M2 ectodomain [7, 30] for expression on the VLP surface with the extra adjuvant effect. However, as reported previously, when incorporating a trimeric TNF superfamily cytokine on the VLP surface, for instance, BAFF and APRIL cannot form functional trimeric structures when fused with the tetrameric M2 ectodomain [28]. Thus, in this protocol, to express properly assembled, functional trimeric BAFF or APRIL on the VLP surface, each gene was directly fused with a HAtm domain to construct BAFF/ HAtm and APRIL/HAtm fusion protein genes, respectively. 3. To further generate multi-subtype VLPs carrying multiple HA subtypes, the plasmids containing other HA subtypes need to be cloned.

152

Ting-Hsuan Chen et al.

4. A Bac-to-Bac baculovirus expression system (Invitrogen) was adapted in this protocol. According to the manufacturer’s instructions, the pFastBac Dual plasmid can be used as a donor plasmid for transferring the cloned exogenous genes into a bacmid with the support of a helper plasmid (pMON7124) in the DH10Bac competent cells [29]. The recombinant bacmids can replicate in DH10Bac competent cells and can be purified using a standard plasmid preparation protocol. 5. Sequences of M13 primers are described in the Bac-to-Bac kit manual [29]. M13 Forward: GTTTTCCCAGTCACGAC. M13 Reverse: CAGGAAACAGCTATGAC.

Acknowledgments We thank the International Institute of Macromolecular Analysis and Nanomedicine Innovation, National Cheng Kung University, Taiwan, for TEM analysis. This work was supported by the Ministry of Science and Technology, Taiwan (MOST108-2321-B-007-001, MOST108-2321-B-002-006). References 1. Haynes JR (2009) Influenza virus-like particle vaccines. Expert Rev Vaccines 8:435–445 2. Lopez-Macias C (2012) Virus-like particle (VLP)-based vaccines for pandemic influenza: performance of a VLP vaccine during the 2009 influenza pandemic. Hum Vaccin Immunother 8:411–414 3. Rossman JS, Lamb RA (2011) Influenza virus assembly and budding. Virology 411:229–236 4. Bright RA, Carter DM, Crevar CJ et al (2008) Cross-clade protective immune responses to influenza viruses with H5N1 HA and NA elicited by an influenza virus-like particle. PLoS One 3:e1501 5. Quan FS, Huang C, Compans RW et al (2007) Virus-like particle vaccine induces protective immunity against homologous and heterologous strains of influenza virus. J Virol 81:3514–3524 6. Ross TM, Mahmood K, Crevar CJ (2009) A trivalent virus-like particle vaccine elicits protective immune responses against seasonal influenza strains in mice and ferrets. PLoS One 4:e6032 7. Wei HJ, Chang W, Lin SC et al (2011) Fabrication of influenza virus-like particles using M2 fusion proteins for imaging single viruses and designing vaccines. Vaccine 29:7163–7172

8. Giles BM, Crevar CJ, Carter DM et al (2012) A computationally optimized hemagglutinin virus-like particle vaccine elicits broadly reactive antibodies that protect nonhuman primates from H5N1 infection. J Infect Dis 205:1562–1570 9. Giles BM, Ross TM (2011) A computationally optimized broadly reactive antigen (COBRA) based H5N1 VLP vaccine elicits broadly reactive antibodies in mice and ferrets. Vaccine 29:3043–3054 10. Wu CY, Yeh YC, Chan JT et al (2012) A VLP vaccine induces broad-spectrum cross-protective antibody immunity against H5N1 and H1N1 subtypes of influenza A virus. PLoS One 7:e42363 11. D’Aoust MA, Couture MM, Charland N et al (2010) The production of hemagglutininbased virus-like particles in plants: a rapid, efficient and safe response to pandemic influenza. Plant Biotechnol J 8:607–619 12. Landry N, Ward BJ, Trepanier S et al (2010) Preclinical and clinical development of plantmade virus-like particle vaccine against avian H5N1 influenza. PLoS One 5:e15559 13. Lin SC, Liu WC, Lin YF et al (2013) Heterologous prime-boost immunization regimens using adenovirus vector and virus-like particles

Multi-Sutbype Influenza VLPs Containing BAFF or APRIL induce broadly neutralizing antibodies against H5N1 avian influenza viruses. Biotechnol J 8:1315–1322 14. Hossain MJ, Bourgeois M, Quan FS et al (2011) Virus-like particle vaccine containing hemagglutinin confers protection against 2009 H1N1 pandemic influenza. Clin Vaccine Immunol 18:2010–2017 15. Perrone LA, Ahmad A, Veguilla V et al (2009) Intranasal vaccination with 1918 influenza virus-like particles protects mice and ferrets from lethal 1918 and H5N1 influenza virus challenge. J Virol 83:5726–5734 16. Richert LE, Servid AE, Harmsen AL et al (2012) A virus-like particle vaccine platform elicits heightened and hastened local lung mucosal antibody production after a single dose. Vaccine 30:3653–3665 17. Wang BZ, Xu R, Quan FS et al (2010) Intranasal immunization with influenza VLPs incorporating membrane-anchored flagellin induces strong heterosubtypic protection. PLoS One 5:e13972 18. Pearton M, Kang SM, Song JM et al (2010) Changes in human Langerhans cells following intradermal injection of influenza virus-like particle vaccines. PLoS One 5:e12410 19. Quan FS, Kim YC, Vunnava A (2010) Intradermal vaccination with influenza virus-like particles by using microneedles induces protection superior to that with intramuscular immunization. J Virol 84:7760–7769 20. Murphy K, Weaver C (2017) Janeway’s immunobiology, 9th edn. Garland Science, New York, London 21. Bossen C, Schneider P (2006) BAFF, APRIL and their receptors: structure, function and signaling. Semin Immunol 18:263–275 22. Schuepbach-Mallepell S, Das D, Willen L et al (2015) Stoichiometry of heteromeric BAFF and APRIL cytokines dictates their receptor

153

binding and signaling properties. J Biol Chem 290:16330–16342 23. Melchers M, Bontjer I, Tong T et al (2012) Targeting HIV-1 envelope glycoprotein trimers to B cells by using APRIL improves antibody responses. J Virol 86:2488–2500 24. Gupta S, Clark ES, Termini JM et al (2015) DNA vaccine molecular adjuvants SP-D-BAFF and SP-D-APRIL enhance anti-gp120 immune response and increase HIV-1 neutralizing antibody titers. J Virol 89:4158–4169 25. Haley SL, Tzvetkov EP, Meuwissen S et al (2017) Targeting vaccine-induced extrafollicular pathway of B cell differentiation improves rabies postexposure prophylaxis. J Virol 91: e02435–e02416 26. Haley SL, Tzvetkov EP, Lytle AG et al (2017) APRIL:TACI axis is dispensable for the immune response to rabies vaccination. Antivir Res 144:130–137 27. Sakai J, Akkoyunlu M (2017) The role of BAFF system molecules in host response to pathogens. Clin Microbiol Rev 30:991–1014 28. Hong JY, Chen TH, Chen YJ et al (2019) Highly immunogenic influenza virus-like particles containing B-cell-activating factor (BAFF) for multi-subtype vaccine development. Antivir Res 164:12–22 29. Invitrogen (2015) Bac-to-Bac® Baculovirus Expression System an efficient site-specific transposition system to generate baculovirus for high-level expression of recombinant proteins. http://tools.thermofisher.com/con tent/sfs/manuals/bactobac_man.pdf. Accessed 13 Aug 2015 30. Liu WC, Liu YY, Chen TH et al (2016) Multisubtype influenza virus-like particles incorporated with flagellin and granulocytemacrophage colony-stimulating factor for vaccine design. Antivir Res 133:110–118

Chapter 11 Experimental Methods for the Immunological Characterization of Paradoxical Psoriasis Reactions Induced by TNF-α Biologics Martina Morelli, Claudia Scarponi, Stefania Madonna, and Cristina Albanesi Abstract Immunomodulation with anti-TNFα biologics is highly effective in the treatment of various immunemediated inflammatory diseases, even though 2–5% of patients treated can develop paradoxical psoriasiform skin lesions. We recently analyzed three patients affected by severe hidradenite suppurativa (HS), and who developed paradoxical psoriasiform reactions following treatment with the TNF-α blockers. Psoriasiform skin reactions showed immunological and immunohistochemical features common to acute psoriasis, characterized by cellular players of innate immunity, such as plasmacytoid dendritic cells (pDC), neutrophils, mast cells, macrophages, and monocytes. In addition, IFN-β and IFN-α2a, two type I IFNs typical of early psoriasis, were highly expressed in paradoxical skin reactions. Concomitantly, the lymphotoxin (LT)-α and LT-β were overproduced. Detection of innate immunity cells was carried out on skin sections from HS patients, by immunohistochemistry (IHC) by using antibodies (Abs) against markers identifying specific leukocyte subpopulations. Anti-BDCA2, anti-CD15, anti-CD117, anti-CD68, anti-CD11c, and anti-CD3 Abs were employed to detect pDC, neutrophils, mast cells, macrophages, monocytes/dendritic cells, and T lymphocytes, respectively. In parallel, skin expression of the innate immunity soluble mediators IL-36γ, IFN-β, IFN-κ, LT-α and LT-β was also evaluated by IHC by using specific Abs. In this chapter, we describe the methods and protocols to detect the in situ expression and localization of innate immunity molecules and leukocyte subpopulations in skin lesions where inflammatory and psoriasiform reactions are evoked by anti-TNF- α biological therapy. Key words TNF-α blockade, Paradoxical psoriasis, Innate immunity, Plasmacytoid dendritic cells, Type I IFNs, Lymphotoxins, IL-17A

1

Introduction Immunomodulation with anti-TNF-α biologics is highly effective in the treatment of various immune-mediated inflammatory diseases, such as psoriasis, rheumatoid arthritis, and hidradenitis suppurativa (HS) [1, 2]. However, 2–5% of patients treated with TNFα antagonists develop paradoxical psoriasiform skin lesions [3, 4],

Jagadeesh Bayry (ed.), The TNF Superfamily: Methods and Protocols, Methods in Molecular Biology, vol. 2248, https://doi.org/10.1007/978-1-0716-1130-2_11, © Springer Science+Business Media, LLC, part of Springer Nature 2021

155

156

Martina Morelli et al.

and no longer can be treated with the imputable drug. The pathogenic mechanisms underlying the induction of these events have only partially been characterized [5], even though the involvement of innate immune responses driven by plasmacytoid dendritic cells (pDC) has been described [5]. In addition, the genetic predisposition to psoriasis of patients could be determinant [6]. Our recent studies showed the activation of innate immunity pathways in the skin of patients treated with the TNF-α blocker adalimumab for the HS condition [6]. We analyzed three patients affected by severe HS, and who developed paradoxical psoriasiform reactions following treatment with the TNF-α blocker. The clinical evaluation of paradoxical psoriasis was confirmed histologically, as skin lesions of HS patients showed an epidermal hyperplasia with parakeratosis, papillary vessel ectasia and perivascular infiltrate compatible with a psoriasiform dermatitis. Psoriasiform skin reactions also showed immunological features common to the early phases of psoriasis development, characterized by cellular players of innate immunity, such as pDC, neutrophils, mast cells, macrophages, and monocytes. In addition, IFN-β and IFN-α2a, two type I IFNs typical of early psoriasis, were highly expressed in paradoxical skin reactions (Fig. 1). Concomitantly, other innate immunity molecules, such as the anti-microbial peptide LL37 and lymphotoxin (LT)-α and LT-β were overproduced (Fig. 1). Detection of innate immunity cells was carried out by immunohistochemistry (IHC) conducted on skin sections from HS patients, and using antibodies (Abs) against markers identifying specific leukocyte subpopulations. In particular, anti-BDCA2, anti-CD15, anti-CD117, anti-CD68, anti-CD11c, and anti-CD3 Abs were employed to detect pDC, neutrophils, mast cells, macrophages, monocytes/dendritic cells, and T lymphocytes, respectively. In parallel, skin infiltration of different T lymphocyte subpopulations was evaluated by IHC staining of IL-17A, IFN-γ and IL-22, three cytokines highly released by type-17, type-1 and type-22 T cells. The innate immunity soluble mediators IL-36γ, IFN-β, IFN-κ, LT-α and LT-β were also analyzed by IHC by using specific Abs. Finally, real-time PCR analysis permitted us to detect IFN-α2a, IFN-β, IFN-λ 1-2-3 and LL37 levels in RNA obtained from sections of skin lesions of HS patients. Here, we describe the methods and protocols to detect the in situ expression and localization of innate immunity molecules and leukocyte subpopulations in paradoxical skin lesions where inflammatory and psoriasiform reactions are evoked by anti-TNFα biological therapy.

Characterization of Paradoxical Prsoriasis Induced by Anti-NFs

157

Fig. 1 Innate immunity cells and molecules detected by IHC in paradoxical skin reactions of HS patients after TNF-α therapy, compared with classical psoriasis. (a) Representative immunohistochemistry of BDCA-2 and CD11c positive cells. Positive cells were counted in five adjacent fields and graphs show the mean number of positive cells + SD per three sections. (b) Representative immunohistochemistry relative to the epidermal expression of LT-α and LT-β. Graphs show the mean + SD of semiquantitative, four-stage scoring. * p < 0.01. Scale bars, 200 μm

2

Materials

2.1 General Equipment

1. Thermo Scientific Excelsior ES Tissue Processor (Fisher Scientific). 2. MPS/P1 paraffin dispensing unit (SLEE medical GmbH). 3. Flotation bath (FALC instruments). 4. Microm HM 335 E Microtome electronic microtome (GMI).

158

Martina Morelli et al.

5. FA90 water bath (FALC instruments). 6. Fume hood. 7. Axioplan 2 imaging microscope system (Carl Zeiss). 8. Prism v 5.0 (Graphpad). 9. GeneAmp PCR System 2400 (Thermo-Fisher Scientific). 10. Quantstudio5 Scientific).

Real-Time

PCR

System

(Thermo-Fisher

11. Microcentrifuge capable of at least 10,000
g. 12. Incubators or heat blocks (deep well preferred) set at 50  C, 80  C, and 95  C. 13. Spectrophotometer, Spectrophotometer.

e.g.,

the

NanoDrop

1000

14. Agilent 2100 bioanalyzer, or reagents and apparatus for preparation and electrophoresis of agarose gels. 2.2 Skin Biopsies, Reagents, Disposable Materials, and Solutions

1. 10% neutral buffered formalin (Bio Optica). 2. 100% Ethanol. 3. Xylene (CARLO ERBA Reagents). 4. Paraffin (Bio Optica). 5. Embedding cassettes (Bio Optica). 6. Superfrost Plus slides (Fisher Scientific). 7. Tris-EDTA buffer (UC Diagnostic).

pH

9.0

ready-to-use

solution

8. Tris-EDTA buffer (UC Diagnostic).

pH

7.8

ready-to-use

solution

9. Citrate buffer pH 6.0 ready-to-use-solution (UC Diagnostic). 10. Methanol. 11. Hydrogen peroxide solution (CARLO ERBA Reagents). 12. Serum-free protein block, (Dako, Glostruk, Denmark). 13. Antibody diluent (Dako, Glostruk, Denmark). 14. Biotinylated rabbit laboratories).

anti-goat

IgG

antibody

(Vector

15. Biotinylated horse laboratories).

anti-rabbit

IgG

antibody

(Vector

16. Biotinylated horse laboratories).

anti-mouse

IgG

antibody

(Vector

17. DAB+, Liquid, 2-component system (Dako). 18. Gill’s 3 Hematoxylin solution (Dako, Glostruk, Denmark). 19. Biomounting medium Biodec R (Bio Optica, Milan, Italy).

Characterization of Paradoxical Prsoriasis Induced by Anti-NFs

159

20. Primary antibodies for IHC analysis: anti-BDCA2 (#DDX0043 clone 124B3.1, Dendritics), -CD15 (#347420 clone MMA, BD Biosciences), -IL-17A (#AF-317NA, R&D Systems), -LT-α (# sc-8302, Santa Cruz Biotechnology), -IL-22 (#NB100-733, Novus Biologicals), -IFN-κ (#H00056832-M01 clone 1B7, Abnova), -CD117 and -CD11c (# MONX10234 clone T595, and #MON3371 clone 5D11, Monosan), -CD68 and -CD3 (# GA609 clone KP1, and # A0452 clone F7.2.38, Dako), -IFN-γ, -IL-36γ, IFN-β and LT-β (# ab218426 clone IFNG/466, # ab156783 clone OTI2F4, # ab180616 and # ab64835, Abcam). 21. Secondary antibodies for IHC analyses: biotinylated horse anti-mouse IgG (#BA-2000, Vector laboratories), biotinylated horse anti-rabbit IgG (#BA-1000, Vector laboratories) or biotinylated rabbit anti-goat IgG (#BA-5000, Vector laboratories). 22. VECTASTAIN ABC kit (Vector laboratories). 23. DAB chromogen solution (Dako). 24. 1.5 mL microcentrifuge tubes (Eppendorf). 25. RNase-free tips. 26. Recover all multi-sample Technologies).

RNA/DNA

workflow

(Life

27. SuperScript IV VILO master mix (Thermo-Fisher Scientific). 28. Microamp 96-well plate (Thermo-Fisher Scientific). 29. Sybrgreen PCR mastermix (Thermo-Fisher Scientific). 30. QuantStudio5 Real-Time PCR System (Thermo-Fisher Scientific). 31. Primer sets for real-time PCR analysis: IFN-α2A, 50 TCTGCTATGACCATGACACGAT30 /50 CAGC ATGGTCCTCTGTAAGGG30 ; IFN-β, 50 CAGCAATTTTCAGTGTCAGAAGC30 /50 TCAT CCTGTCCTTGAGGCAGT30 ; IFN-λ1, 50 AGGCTTCTCCAGGTGAGGGA30 /50 TCCAGG ACCTTCAGCGTCAG30 ; IFN-λ2, 50 GGGCCTGTATCCAGCCTCAG30 /50 GAGCC GGTACAGCCAATGGT30 ; IFN-λ3, 50 GGGCCTGTATCCAGCCTCAG30 /50 GGTGCA GCCAATGGTGGAG30 /; LL-37, 50 TTTTGCGGAATCTTGTACCCA30 /50 TCTCAGA GCCCAGAAGCCTG30 ; GAPDH, 50 TGGACCTGACCTGCCGTCTA30 /50 CCCTG TTGCTGTAGCCAAATTC30 ).

160

3

Martina Morelli et al.

Methods

3.1 Processing of Skin Biopsies from Paradoxical Psoriasis Lesions

1. Place each biopsy into a tissue embedding cassette, taking care to orient the skin tissue in order to obtain dermal–epidermal junction in each section. 2. Fix skin biopsy immediately after surgery to prevent the breakdown of cellular protein and degradation of the normal tissue architecture. Put the cassette in 10% buffered formalin beaker and stored overnight at 4  C (at least 12 h, and not for more than 24 h) (see Note 1). Next day, remove cassette from formalin, rinse with running tap water for 1 h and transfer to 70% ethanol. 3. Automatically process samples through dehydration, clearing and infiltration stages using the Thermo Scientific Excelsior ES Tissue Processor. 4. Include biopsies in paraffin blocks using MPS/P1 paraffin dispensing unit. Briefly, place the embedding tissue in metal mold and pour melted paraffin to cover the mold. Place the cassette on top, put it on a cooling rack, and, once the paraffin block has cooled for at least 30 min, remove the mold and shave off the excess paraffin. 5. Cut formalin-fixed paraffin-embedded (FFPE) block into sections of 5-μm thickness using microtome. 6. Place paraffin ribbon in a flotation bath at about 40–45  C in order to flatten out the section. 7. Transfer the sections onto clean Superfrost Plus charging glass slide suitable for immunohistochemistry to improve tissue adherence. Allow the slides to air-dry for 12–24 h at room temperature, overnight at 37  C or at 60  C for 1 h (see Note 2).

3.2

IHC Analysis

1. Place sections in xylene (three changes, 5 min each) to remove paraffin, and rehydrate by 100% ethanol (two changes, 3 min each), 95% (1 min) and 70% ethanol (1 min). Then rinse in distilled water (see Notes 3, 4, and 5). 2. Unmask the epitopes by incubating slides in FA90 water bath set to 95  C using Tris-EDTA Buffer pH 7.8 for BDCA2, CD11c and CD3, or Tris-EDTA Buffer pH 9.0 for IL-22, CD68 and IFN-γ, otherwise Citrate Buffer pH 6.0 for CD117, LT-α, LT-β, CD15, IL-17A, IL-36γ, IFN-β, IFN-κ. After 20 min remove the container with slides from the water bath and let it cool to room temperature for 10 min. Rinse the slides with deionized water and then with PBS (see Notes 6 and 7).

Characterization of Paradoxical Prsoriasis Induced by Anti-NFs

161

3. Incubate slides to block endogenous peroxidase activity with 0.3% H2O2 in PBS in the case of BDCA2, CD11c, CD117, LT-α and LT-β staining, or 3% H2O2 in PBS in the case of CD3, IL-22, CD15, IL-17A and IL-36γ staining, otherwise 3% H2O2 in MetOH for CD68, IFN-γ, IFN-β and IFN-κ. After 10 min, rinse in PBS (2 changes, 5 min each) (see Note 8). 4. Incubate the slides with 100 μL protein blocking buffer (serum free), to prevent non-specific binding of antibodies to the tissue, in a humidified chamber at room temperature for 30 min. Drain the slides and wipe away any excess blocking reagent before proceeding to the next step. 5. Apply 100 μL of primary antibodies, diluted in antibody dilution buffer DAKO, to the sections on the slides and incubate in a humidified chamber at room temperature for 1 h or overnight at 4  C. Rinse in PBS (2 changes, 5 min each) and drain the slides. We used the following working concentrations for the primary antibodies: anti-BDCA2:10 μg/mL; anti-CD15: 1 μg/mL; anti-CD117 ready-to-use; anti-CD68 ready-touse; anti-CD11c: 1.5 μg/mL; anti-CD3: 5 μg/mL; antiIL17A: 5 μg/mL; anti-IFN-γ: 2 μg/mL; anti-IL-22: 20 μg/ mL; anti-IL36γ: 10 μg/mL; anti-IFN-β: 25 μg/mL; anti-IFNκ: 5 μg/mL; anti-LT-α: 4 μg/mL; anti-LT-β: 20 μg/mL. 6. Choose a biotinylated secondary antibody raised against the primary antibody host species, to detect the binding between primary antibody and antigen by using an indirect method. Apply 100 μL of secondary antibody, diluted in antibody dilution buffer DAKO, to the sections on the slides and incubate in a humidified chamber at room temperature for 1 h. Rinse in PBS (2 changes, 5 min each) and drain the slides. We used the following working concentration for the secondary antibodies: biotinylated rabbit anti-goat: 5 μg/mL; biotinylated horse anti-rabbit: 5 μg/mL; biotinylated horse anti-mouse: 10 μg/mL. 7. To increase signal intensity, use VECTASTAIN ABC kit. Combine 100 μL of Reagent A to 10 mL of PBS, then add 100 μL of Reagent B, mix immediately, and allow reagent to stand at least 30 min before use. 8. Apply 100 μL of ABC complex to the sections on the slides and incubate in a humidified chamber at room temperature for 30 min, then rinse in PBS (2 changes, 5 min each). 9. Calculate the working volume of DAB chromogen solution given that 100 μL is required to cover the entire tissue section on a slide and combine 20 μL of DAB Chromogen per mL of Substrate Buffer.

162

Martina Morelli et al.

10. Apply 100 μL of DAB chromogen solution to the sections on the slides and incubate in a humidified chamber at room temperature for less than 5 min until the desired color intensity is reached (see Note 9). Monitor the tissue staining under a microscope and block the reaction rinse the slides in deionized water. 11. Counterstain with Hematoxylin for better visualization of the tissue morphology by 5 min incubation. Rinse in tap water and drain the slides. 12. Dehydrate slides in 100% ethanol (3 changes, 1–2 min each) and xylene (2 changes, 5 min each). 13. Use an adequate amount of mounting medium to cover the sections and apply a coverslip of an appropriate size on the slide. 14. Place slides vertically on a filter paper or towel to drain excess mounting medium and to eliminate air bubbles, then allow them to dry. 3.3 Quantification of Immune Cells and Inflammatory Molecule Expression Detected by IHC

1. Digitize the slides using Axioplan 2 imaging microscope system. 2. Quantify the number of immune cells by counting positive cells in five adjacent fields at a total magnification of 200X. 3. Quantify the epidermal expression of the inflammatory molecule by semi-quantitative four-stage scoring, ranging from negative (0) to strong immunoreactivity (4+). 4. Record all counts and scores to performed statistical analysis with Prism v 5.0 and calculate the significance of differences in the numbers of immunoreactive cells in skin biopsies using the unpaired Student’s t-test.

3.4 RNA Preparation from Skin Sections and Real-Time PCR Analysis

1. Cut 5–20 μm sections from FFPE blocks using a microtome and place the equivalent of 60 μm of tissue sections (i.e., a maximum of three 20 μm) in a 1.5 mL microcentrifuge tube. 2. To extract total RNA from FFPE skin biopsies use RecoverAll Total Nucleic Acid Isolation kit. To remove paraffin from the sections, add 1 mL xylene to the sample, mix, and incubate for 3 min at 50  C to melt the paraffin (see Note 4). 3. Centrifuge for 2 min in microfuge at maximum speed, and discard the xylene. 4. To remove xylene from the sample and accelerate drying of the tissue, wash the pellet twice with 1 mL of 100% ethanol. Then, air dry the pellet (see Note 5).

Characterization of Paradoxical Prsoriasis Induced by Anti-NFs

163

5. To digest proteases, add 200 μL of Digestion Buffer and 4 μL of protease provided by the kit and incubate the sample in heat blocks for 15 min at 50  C, then 15 min at 80  C. Extending the incubation at 80  C substantially (more than 2 min) may result in RNA degradation. 6. For RNA isolation, combine 240 μL of Isolation Additive (part of RecoverAll kit) and 550 μL of ethanol, according to the volume of Digestion Buffer used in your sample. Mix by pipetting up and down. Some samples may appear white and cloudy after mixing. 7. For each sample, place a Filter Cartridge (part of RecoverAll kit) in one of the Collection Tubes supplied. Pipet up to 700 μL of the sample/ethanol mixture (from step 2) onto the Filter Cartridge and close the lid. To prevent clogging of the filter, avoid pipetting large pieces of undigested tissue onto the Filter Cartridge. 8. Centrifuge at 10,000
g for 30 s to pass the mixture through the filter. Discard the flow-through, and re-insert the Filter Cartridge in the same Collection Tube. If necessary, repeat steps 7 and 8 until all the sample mixture has passed through the filter. 9. Wash with 700 μL of Wash 1, then with 500 μL of Wash 2/3, and finally centrifuge to remove residual fluid. 10. For RNA isolation, add 60 μ of DNase mix provided by RecoverAll kit and incubate for 30 min at room temperature. 11. Wash with 700 μL of Wash 1, twice with 500 μL of Wash 2/3, then centrifuge to remove residual fluid. 12. Finally, elute with 40 μL of Elution Solution or nuclease-free water at room temp (RNA), and after 5 min, centrifuge for 1 min at maximum speed to pass the mixture through the filter. The eluate will contain the RNA, which can be stored at 20  C or lower temperatures. 13. The concentration of the RNA solution can be determined by measuring its absorbance at 260 nm. We recommend using the NanoDrop 1000 Spectrophotometer because it is extremely quick and easy to use and it permit to measure 1.5 μL of the RNA sample directly. 14. The RNA recovered with the RecoverAll Total Nucleic Acid Isolation Kit can be used in real-time RT-PCR analysis. Because the RNA extracted from fixed tissues is likely to be degraded, plan to analyze small amplicons.

164

Martina Morelli et al.

15. For each RT reaction, prepare a 10 μL genomic DNA digestion reaction mix in a RNase-free tube on ice with the components provided by the SuperScript IV VILO Master Mix and Template RNA (1 pg to 2.5 μg total RNA). 16. To digest genomic DNA, gently mix and incubate at 37  C for 2 min. Briefly centrifuge the reaction and place on ice. 17. Add SuperScript IV VILO Master Mix or SuperScript IV VILO No RT Control to the dDNA-free RNA samples and incubate at 25  C for 10 min for annealing of primers. 18. Reverse transcribe RNA by incubating at 50  C for 10 min and inactivate enzyme by incubating at 85  C for 5 min. 19. For Real-time PCR analysis, use the primer sets (see Subheading 2.2). 20. Analyze the mRNA expression of targeted genes using the QuantStudio5 Real-Time PCR System. Normalize mRNA values to GAPDH mRNA. Show results as means of 2^-ΔΔCT + SD.

4

Notes 1. Make sure you have enough fixative to cover tissues. Fixative volume should be 5–10 times of tissue volume. Formalin is considered toxic if swallowed, inhaled, or absorbed through the skin. Use it under a fume hood and wear protective gear such as gloves and lab coat. 2. Slides can be stored at room temperature until ready for use. 3. Do not allow slides to dry at any time during this procedure as this can lead to inconsistent staining. 4. Xylene is irritant and flammable; wear gloves while handling and use in a fume hood. 5. Ethanol is an irritant. Perform all procedures while wearing gloves and goggles. 6. Use care with hot solution. 7. Avoid vigorous rinsing to prevent detachment from the slides. 8. Methanol is toxic and highly flammable. Use only with adequate ventilation/chemical fume hood. Wear gloves when using. 9. DAB is a potential carcinogen. Handle with care. Wear gloves, lab coat, and eye protection. This reagent is light-sensitive. Avoid exposure to light by wrapping the reagent tube with tinfoil.

Characterization of Paradoxical Prsoriasis Induced by Anti-NFs

165

References 1. Martin-Ezquerra G, Masferrer E, MasferrerNiubo M et al (2015) Use of biological treatments in patients with hidradenitis suppurativa. J Eur Acad Dermatol Venereol 29:56–60 2. Kimball AB, Kerdel F, Adams D et al (2012) Adalimumab for the treatment of moderate to severe Hidradenitis suppurativa: a parallel randomized trial. Ann Intern Med 157:846–855 3. Garcovich S, De Simone C, Genovese G et al (2019) Paradoxical skin reactions to biologics in patients with rheumatologic disorders. Front Pharmacol 10:282. https://doi.org/10.3389/ fphar.2019.00282

4. Wendling D, Prati C (2014) Paradoxical effects of anti-TNF-alpha agents in inflammatory diseases. Expert Rev Clin Immunol 10:159–169 5. Conrad C, Di Domizio J, Mylonas A et al (2018) TNF blockade induces a dysregulated type I interferon response without autoimmunity in paradoxical psoriasis. Nat Commun 9:25 6. Fania L, Morelli M, Scarponi C et al (2020) Paradoxical psoriasis induced by TNF-alpha blockade shows immunological features typical of the early phase of psoriasis development. J Pathol Clin Res 6:55–68

Chapter 12 Methods for the Administration of EDAR Pathway Modulators in Mice Sonia Schuepbach-Mallepell, Christine Kowalczyk-Quintas, Angela Dick, Mahya Eslami, Michele Vigolo, Denis J. Headon, Michael Cheeseman, Holm Schneider, and Pascal Schneider Abstract Genetic deficiency of ectodysplasin A (EDA) causes X-linked hypohidrotic ectodermal dysplasia, a congenital condition characterized by the absence or abnormal formation of sweat glands, teeth, and several skin appendages. Stimulation of the EDA receptor (EDAR) with agonists in the form of recombinant EDA or anti-EDAR antibodies can compensate for the absence of Eda in a mouse model of Eda deficiency, provided that agonists are administered in a timely manner during fetal development. Here we provide detailed protocols for the administration of EDAR agonists or antagonists, or other proteins, by the intravenous, intraperitoneal, and intra-amniotic routes as well as protocols to collect blood, to visualize sweat gland function, and to prepare skulls in mice. Key words EDAR signaling, Protein replacement therapy, Amniotic fluid, Route of administration, Ectodermal dysplasia

1

Introduction Mutations affecting the Ectodysplasin A gene (EDA) cause the disease X-linked hypohidrotic ectodermal dysplasia both in mice and humans [1, 2]. Mutations of the genes encoding the EDA receptor or the signaling adapter molecule EDAR-associated protein with a death domain (EDARADD) cause autosomal forms of hypohidrotic ectodermal dysplasia with phenotypes virtually indistinguishable from that of EDA deficiency [3–5]. In patients with X-linked hypohidrotic ectodermal dysplasia, anhidrosis and subsequent lack of thermoregulation is a major problem [6]. Experimental strategies have been implemented with the aim of attenuating detrimental effects of EDA deficiency. In mice, ectopic expression of an Eda transgene in the skin under the control of the keratin 14 promoter can rescue many features of the defect,

Jagadeesh Bayry (ed.), The TNF Superfamily: Methods and Protocols, Methods in Molecular Biology, vol. 2248, https://doi.org/10.1007/978-1-0716-1130-2_12, © Springer Science+Business Media, LLC, part of Springer Nature 2021

167

168

Sonia Schuepbach-Mallepell et al.

including sweat gland development. Most rescued structures were maintained when the transgene was switched off postdevelopment, indicating that Eda signals are more important to induce the formation of ectodermal appendages than to maintain them [7]. Similar observations were made when an active recombinant form of EDA fused to the Fc portion of an IgG1 (Fc-EDA) was administered intravenously to pregnant Eda-deficient dams, and presumably transported to the fetal circulation via a transplacental antibody transport machinery [8]. Under these conditions, Eda-deficient fetuses exposed to Fc-EDA gained a phenotype that was close to wild-type in many respects and that was maintained long-term despite discontinuation of Fc-EDA administration. When the protein was administered intraperitoneally to newborn Eda-deficient mice at relatively late time points compared to in utero treatment of fetuses, treatment efficacy decreased sharply with time up to the point of becoming totally inefficient at inducing the formation of ectodermal appendages 1 week after birth [8]. This exquisite time-dependence of treatment efficacy can explain the failure of a phase II clinical trial aimed at treating newborn EDA-deficient human patients with Fc-EDA [9]. The lack of efficacy was interpreted as a likely consequence of mistargeting the time window during which treatment can work. In mice, treatment of Eda-deficient fetuses with Fc-EDA by the intraamniotic route happened to be very successful, with results equaling those obtained for the transplacental route [10]. Indeed, although Fc-EDA administered into the amniotic fluid is outside fetuses and cannot directly access EDAR, the drug can nevertheless reach the fetal circulation by a mechanism that is dependent on the neonatal Fc receptor (FcRn). This was demonstrated when fetuses deficient for both Eda and Fcgrt (Fcgrt encodes FcRn) could not respond to treatment with Fc-EDA, while neighboring fetuses from the same litter deficient for Eda but wild-type for Fcgrt responded to treatment [9]. The intra-amniotic route of administration was deemed adequate for the treatment of human fetuses because it provides several advantages including a potential reservoir function of the amniotic fluid and little leakage of the recombinant protein into the maternal circulation [10]. Indeed, three human male fetuses carrying EDA null mutations who received Fc-EDA via the intra-amniotic route benefitted from restoration of their sweating ability, with beneficial outcome also on teeth and salivary glands [9]. Antibodies that target the EDA-EDAR pathway in positive or negative ways can prevent or induce ectodermal dysplasia phenotypes in animal models [11, 12]. In Eda-deficient mice, in utero treatment of affected fetuses with an anti-EDAR antibody via the transplacental route restored nasal submucosal glands and the paired nasopharyngeal submucosal glands that protect the opening of each of the Eustachian tubes. The seromucous glandular secretions aid mucociliary clearance and prevent rhinitis

Pharmacological Modulation of the EDAR Pathway in Mice

169

and entry of foreign bodies into the middle ear bulla, the presence and persistence of which may cause otitis media [13]. In adult mice, EDA can regulate the function of pre-existing structures, in particular hair-associated sebaceous glands that grow or shrink in response to increased or decreased EDA levels [7, 14]. Here we detail basic procedures for the administration of EDAR agonists via the intravenous, intraperitoneal, and intraamniotic routes in mice. The former are commonly performed methods, but the latter requires surgery to access fetuses. All of them were instrumental in several of the aforementioned publications. Blood sampling via the facial vein is also described, because analysis of EDAR agonists in the circulation can be useful. Monitoring restoration of functional sweat glands has been a recurring theme during the development of pharmacological modifiers of the EDA-EDAR pathway, due to their clinical importance in ectodermal dysplasia. We describe the protocol that we have used for a starch-iodine test to assess sweating ability. This test takes advantage of iodine’s property of forming an intensely dark complex with starch in aqueous solutions. Iodine dissolved in ethanol is first applied onto the skin, followed by a suspension of starch in oil. It is only at the specific locations of sweat gland secretion that black starch-iodine complexes form. Finally, we describe the method that we have been using for mouse skull preparation, which aids the evaluation of dental phenotypes. With regard to the correction of ectodermal dysplasia phenotypes in Eda-deficient mice, best results are obtained when fetuses are exposed to EDAR agonists between embryonic gestational days 13.5 to birth, which can be achieved either by intravenous injection of the pregnant dam or by direct intra-amniotic administration. Intraperitoneal administration of agonists in newborn Eda-deficient pups can only correct some defects (in particular tail hair and sweat glands). In all cases, effects are dose-dependent and can be conditioned by the half-life of the drug. For drugs with a shorter half-life, higher doses or repeated administration can be beneficial; however, repeated administration cannot be performed in mice via the intra-amniotic route with the described procedure.

2

Materials The local institutional animal care and use committee and the Office Ve´te´rinaire Cantonal du Canton de Vaud approved animal experiments performed in this study (authorization 1370.7 to PS). Mice were handled according to Swiss Federal Veterinary Office guidelines. A precise description of the materials that have been used is provided, but similar equivalent material or reagents can also be used.

170

Sonia Schuepbach-Mallepell et al.

2.1 Antibodies and Recombinant Proteins

1. Fc-EDA (EdimerPharmaceuticals): Fc-EDA is a recombinant protein comprising the Fc portion of an immunoglobulin G1 and the receptor-binding domain of human EDA1 (amino acids 238–391). This protein was produced according to Good Manufacturing Practice regulations, and was provided as a drug product under the name of EDI200, at a concentration of 5 mg/mL in a sterile solution of 20 mM sodium phosphate, 300 mM sodium chloride, pH 7.2, 0.02% Polysorbate 20. Store the protein frozen at 70  C until use [9]. Alternatively, recombinant Fc-EDA can be produced in Chinese Hamster Ovary cells (CHO-S, Thermoscientific) and affinity-purified on Protein A-Sepharose mAbSelect Xtra (GE Healthcare) [8]. 2. Agonist anti-EDAR mouse monoclonal IgG1 antibodies (mAbEDAR1 or mAbEDAR3) or function-blocking antiEDA mouse monoclonal IgG1 antibodies (EctoD2 or EctoD3): Purify them from conditioned media of hybridoma cultures by affinity chromatography on Protein G (GE Healthcare) [11, 12]. Store the antibodies frozen at 70  C in sterile PBS at concentrations of 1 to 5 mg/mL until use. Endotoxin levels should be lower than 1 EU/μg.

2.2

Anesthesia

1. Combi-vet anesthesia system table system (Rothacher AG). 2. Isoflurane Attane ad us. Vet. 250 mL (Provet AG Covetrus).

2.3

Blood Collection

2.4 Intravenous and Intraperitoneal Injections in Adult Mice

1. Disposable sterile blood lancets. 1. Syringe: insulin syringe microfine U-100 insulin 0.5 mL, 0.33 mm (29G), 12.7 mm (BD medical). 2. Red lamp equipped with a 175 W infrared bulb (Philips AG). 3. Restrainer for normal mice: made of two pieces: broom and holder. Broom-style rodent restrainer, reference 551-BSRR (for 15–30 g animals) and holder, reference 551-H, Indulab. 4. Restrainer for mice in late pregnancy: Broom-style rodent restrainer, reference 552-BSRR (for 30–120 g animals) and holder, reference 552-H, Indulab.

2.5 Intraperitoneal Injections in Newborn Mice

1. Hamilton syringe: Hamilton glass syringe 710RN 100 μL without needle (Wicom International AG).

2.6 Intra-Amniotic Fluid Injections in Pregnant Mice

1. Dry heating bath: SUB Aqua 5 Plus (Grant instruments).

2. Needles: Hamilton neuros replacement needle, small hub RN NDL, 0.5 inch, point style 4/15 , 33G (Wicom International AG).

2. Hamilton syringe with 33G needle (see Subheading 2.5).

Pharmacological Modulation of the EDAR Pathway in Mice

171

3. Parafilm. 4. Analgesia: Paracetamol (Dafalgan) powder 250 mg (BristolMyers Squibb SA). 5. Analgesia: Buprenorphin (Temgesic) inj. Sol. 0.3 mg/mL (Indivior). 6. Heating mat: Solis thermopad (Solis Apparatefabriken AG). 7. Heating lamp: Red lamp equipped with a 175 W infrared bulb (Philips AG). 8. Scissors: Fine, straight, sharp. 9. Two forceps: Standard pattern, straight, serrated. 10. Needles and stitches (for absorbable suture): MultiPass needles coated Vicryl, 4–0, P-3 (13 mm 3/8c), 45 cm, reference MPV494 (Johnson and Johnson international, ETHICON). 11. Ophthalmic gel: Lacryvisc gel (Alcon). 12. Plastic syringe: 3 mL, sterile. 2.7

Sweat Test

1. Sublimated iodine: reference 1,047,610,100, Merckmillipore, Switzerland. 2. Absolute ethanol: reference 10,428,671, ThermoFischer Scientific, Switzerland. 3. Corn starch, olive oil and cotton buds: any commercial store. ¨ lamp, Ikea, 4. Strong table light: for example JANSJO Switzerland. 5. Camera with macro option: for example Canon Ixus 12x (4.0–4.8 mm). 6. Iodine solution (5%): 0.75 g of iodine in 15 mL of 100% ethanol.

2.8 Preparation of Mouse Skulls

1. Pentobarbital (also known as pentobarbitone) (Esconarkon) at 300 mg/mL (Streuli Pharma) (see Note 1). 2. Fine forceps: Straight. 3. Fine forceps: Curved. 4. Scissors: Standard pattern. 5. Fine scissors: Straight, sharp. 6. Needle: Sterican 21G, 0.8x80 mm (B. Braun). 7. Plastic syringe: 10 mL, any brand. 8. TEN buffer: 10 mM Tris-HCl, pH 8, 5 mM EDTA, 100 mM NaCl, 0.5% SDS. 9. Proteinase K: Stock at 20 mg/mL (Applichem). 10. TEN buffer, proteinase K: Freshly prepared solution of 50 μg/ mL of proteinase K in TEN buffer.

172

Sonia Schuepbach-Mallepell et al.

11. 30% hydrogen peroxide. 12. Stereomicroscope (Leica M205FA) equipped with a cooled color CCD camera (Leica, DFC300FX R2). 13. LAS AF6000 software (Leica).

3

Methods

3.1 Intravenous Injection in Adult Mice

1. The Swiss Federal Veterinary Office currently recommends volumes for intravenous injections of up to 5 mL/kg, i.e., 100 μL for a 20 g mouse or 150 μL for a 30 g mouse (see Note 2). 2. Place mouse cage under the red lamp to warm the mouse and stimulate the dilatation of the veins for about 10–15 min. The lamp is at 30 cm from the bottom of the cage (Fig. 12.1a) (see Note 3). 3. Transfer the mouse to a restrainer. Put the mouse in a lateral position because veins are on the lateral part of the tail. 4. Hold the tail straight with the non-dominant hand (i.e., the left hand for a right-handed experimenter) toward the floor with an angle of about 45 from the horizontal (Fig. 12.1b). 5. Apply a fine spray of 70% ethanol onto the tail. This will cause the lateral vein to become more visible. 6. Insert the needle of an insulin syringe just below the skin. The needle should be almost parallel to the tail (Fig. 12.1c). 7. Once the needle is inside the vein, press the piston. This should deliver the solution easily, without requiring application of firm pressure. If the solution cannot be delivered with gentle pressure, then this means that the needle is not inside the vein and it must be removed, repositioned, and reinserted at another site nearer the tail base for injection.

3.2 Intraperitoneal Injection in Adult Mice

1. The Swiss Federal Veterinary Office currently recommends volumes for intraperitoneal injections of up to 20 mL/kg, i.e., 400 μL for a 20 g mouse or 600 μL for a 30 g mouse. 2. Immobilize the mouse in one hand and hold the mouse with the head toward the floor. 3. Insert the needle on the left side of the mouse belly (from the experimenter’s point of view) with an angle of about 45 , at about 1.5 cm from the base of the tail, and inject the solution.

3.3 Intraperitoneal Injection in Newborn Mice

1. Injection volume of up to 15 μL/pup, ideally 10 μL/pup (see Note 4). 2. Fill the Hamilton syringe equipped with the 33G needle. For this purpose, place a drop of the solution to inject on a clean

Pharmacological Modulation of the EDAR Pathway in Mice

173

Fig. 12.1 Intravenous injection in the tail vein of an adult mouse. (a) Mouse placed under a red lamp to stimulate veins dilatation. (b) Mouse immobilized in the lateral position in a restrainer with the tail held down with an angle of about 45  C with the horizontal. (c) Tail of a mouse moisturized with a fine spray of 70% ethanol to render the vein more visible. A needle almost parallel to the tail is inserted into the vein just below the skin

piece of parafilm and suck from that drop into the syringe (see Note 5). 3. Gently hold the pup in one hand by slightly pinching the skin of the neck. Skin on the belly should be stretched to the minimum. 4. Insert the needle on the lower right quadrant of the mouse belly (from the experimenter’s point of view), coming from the right side with an angle of about 30 , without touching the liver or bladder that can be seen through the partially transparent skin. Slowly inject the solution, leaving the needle in place for a few seconds after completing delivery, then slowly remove the needle to avoid leak of the injected solution (see Note 6). 3.4 Blood Collection in Adult Mice by Puncture of the Facial Vein

1. The Swiss Federal Veterinary Office currently recommends to collect blood volumes not greater than 280 μL for a 20 g mouse and for a period of 14 days (in one or several bleeds) (see Note 7). 2. Switch on the gas anesthesia apparatus, check that the tank supplying isoflurane is full and check that the humidifying chamber contains sufficient water (see Note 8). 3. Set the oxygen input flow on 0.8 L/min and the isoflurane on 3%. 4. Place the mouse in the induction chamber and induce a light anesthesia. Proceed to the next step as soon as the mouse loses consciousness. 5. Hold the lightly anesthetized mouse on the side with the non-dominant hand. 6. The facial vein can be localized by drawing two virtual lines: one from the ending edge of the mouth toward the neck and the other from the external edge of the eye toward the throat.

174

Sonia Schuepbach-Mallepell et al.

Fig. 12.2 Blood collection from the facial vein. Mouse lightly anesthetized with 3% isoflurane and held by the neck. The virtual dashed lines intersect above the facial vein, which lies just under the skin and can be pricked with a shallow hit of a lancet

The vein is at the intersection, close to the skin surface (Fig. 12.2). 7. With the lancet, make a shallow prick of the facial and collect (directly) one or two drops of blood in a tube [~25–50 μL] (see Notes 9 and 10). 8. Once the mouse is released, the bleeding spontaneously stops almost immediately. 3.5 Intra-Amniotic Fluid Injections

3.5.1 Anesthesia and Analgesia

This procedure is divided in 4 steps: (a) Anesthesia and analgesia. (b) Midline laparotomy and injections (Fig. 12.3a–d). (c) Continuous suture of the abdominal wall (Figs. 12.3e and 12.4a). (d) Interrupted stitching of the skin (Figs. 12.3f and 12.4b). The entire surgical procedure should be performed in less than 1 h to avoid spontaneous contraction of the uterus and miscarriage. 1. Switch on the gas anesthesia apparatus, check that the tank supplying isoflurane is full, and check that the humidifying chamber contains sufficient water. 2. Set the oxygen input flow on 0.8 L/min and the isoflurane on 5%. 3. Place the timed-mated pregnant mouse on gestational day 13.5 (E13.5) in the induction chamber and anesthetize it with 5% isoflurane. With fingers, pinch the hind paw to check that the

Pharmacological Modulation of the EDAR Pathway in Mice

175

Fig. 12.3 Intra amniotic fluid administration procedure. (a) Anesthetized mouse placed on the back with the abdominal cavity opened approximately 1.5 cm by midline laparotomy, and with both uterine horns pulled out completely from the cavity and placed on moistened tissue papers around the opening. In this picture, there is a total of 7 fetuses arranged along an inverted “C”. The mass in the middle is the intestine. (b) Injection in the amniotic sac of the second fetus on the top of panel A using a glass syringe with a 33G needle. The amniotic sac is gently held with forceps, but these were removed for the purpose of taking pictures. The position of the fetus that can be seen by transparency is shown as a line drawing, along with the injection needle. (c) Scheme of the position of a fetus inside the amniotic sac, which can be seen by transparency through the membrane. The arrow points at the place between the upper and lower limbs where the protein should be injected without touching the fetus. (d) Placement of uterine horns back into the abdominal cavity. The incised abdominal wall is lifted on one side with a pair of forceps while gently putting back in place the closest uterine horn. (e) Closure of the abdominal wall by continuous suture. (f) Suture of the skin with several interrupted stitches. Pictures of this figure were made on one of the mice analyzed in reference [9]

retraction reflex does not operate. The absence of this pedal reflex indicates that the mouse is anesthetized for surgery. 4. Inject a first dose of analgesic (buprenorphine, 0.1 mg/kg) subcutaneously in the back with an insulin syringe. 5. Apply a copious amount of gel on the eyes to avoid eye desiccation. 6. Place the mouse on its back on absorbing papers, on a pre-warmed heating mat with the snout inserted into the mask (see Note 11). 7. Maintain surgical anesthesia with 2% isoflurane. 3.5.2 Midline Laparotomy and Injections

1. Disinfect the abdominal region with a generous amount of 70% ethanol.

176

Sonia Schuepbach-Mallepell et al.

Fig. 12.4 Continuous and interrupted sutures procedures. (a) Scheme of a continuous suture, used to close the abdominal wall. (b) Scheme of single interrupted stitches, used to close the skin. (c) First step of the continuous suture of the abdominal wall. (d) Scheme for the making of the first part of a surgeon’s knot. About 2 cm of thread is left on the right side of the opening (1). The thread on the other side is held with forceps (2) and wrapped twice clockwise around a second pair of forceps (3). The small end of the thread is grabbed with the second pair of forceps (4). Forceps are gently moved apart (5) so that the wrapped thread slides along the forceps to create the first part of the knot. (e) The thread is wrapped twice clockwise on the extremity of forceps. (f) Scheme of the second and last part of making a surgeon’s knot. The thread is wrapped twice counterclockwise on the forceps (6). The small extremity of the thread is grabbed with those same forceps (7), then forceps are gently moved apart to complete the knot. (g) Closure of the abdominal wall with a continuous suture. (h) Making of the first part of the surgeon’s knot at the end of the continuous suture. Same procedure as shown in panel D, except that a loop of thread, instead of the extremity of a thread, is grabbed. (i) Cut of excess thread after the surgeon’s knot at the end of the continuous suture. (j) Suture of the skin with single interrupted stitches. Pictures of this figure were made on a dead, non-pregnant mouse

2. With forceps, lift the skin at the base of the belly, make a small incision with sharp scissors and use this opening to cut the abdominal skin approximately 1.5 cm toward the head along the midline (see Note 12). 3. With forceps, lift the abdominal wall (consisting of the muscle layer and the peritoneal membrane) at the base of the abdomen, make a small incision with sharp scissors and extend this incision toward the head along the midline for approximately 1.5 cm. 4. Around the opened skin, place paper tissues moistened with sterile PBS prewarmed to 37  C. 5. Very gently pull out completely both uterine horns from the abdominal cavity and place them on the paper tissues (Fig. 12.3a).

Pharmacological Modulation of the EDAR Pathway in Mice

177

6. Hold the amniotic sac carefully with forceps without applying pressure. The fetus can be seen through the partially transparent uterus wall and amniotic fluid. 7. Administer 10 μL of drug (e.g. Fc-EDA at 5 mg/mL), into the amniotic sacs of each individual fetus using a Hamilton glass syringe with a 33-gauge needle (Fig. 12.3b). The easiest site of injection to avoid touching the fetus is in front of the belly between the upper and lower limbs (Fig. 12.3c) (see Note 13). 8. In between each injection, to preserve temperature and moisture, pour about 3 mL of sterile PBS pre-warmed to 37  C with a 3 mL syringe over the uterine horns. 9. Carefully place back the uterine horns in the abdominal cavity with forceps. For this purpose, lift one side of the incised abdominal wall with one pair of forceps while gently pushing the closest uterine horn into the cavity with a second pair of forceps. Repeat the operation on the other side (Fig. 12.3d). 3.5.3 Continuous Suture of the Abdominal Wall

1. Lift each side of the opened abdominal wall using two pairs of forceps and line up the edges of the opening. 2. Pierce the abdominal wall with the needle on each side of the opening (Fig. 12.4c). 3. For the first stitch, pull the needle until there are about 2 cm of thread remaining on the right side of the opening (Fig. 12.4d, step 1). 4. Lay the needle on the left side near the mouse. 5. Take forceps in the dominant hand. With forceps in the non-dominant hand, hold the long part of the thread and wrap it clockwise twice around the tip of the forceps (Fig. 12.4d, steps 2 and 3; Fig. 12.4e). 6. Slightly open the forceps and use it to grasp the 2 cm of thread on the right side of the incision (Fig. 12.4d, step 4). 7. Gently move hands apart, so that the part of the thread wrapped around the forceps slides off and creates a simple overhand knot (Fig. 12.4d, step 5). 8. Repeat the procedure to create a second knot but the second time wrap counter clockwise twice around the forceps (Fig. 12.4f, steps 6–8). 9. Cut the excess of thread on the right to leave about 2 mm. 10. Sew continuously by inserting the needle always on the same side of the opening. The thread should look like a spiral (Fig. 12.4a, g). 11. For the last stitch, pull the needle until there is a loop of about 2 cm of thread remaining on the right side of the wound (Fig. 12.4h).

178

Sonia Schuepbach-Mallepell et al.

12. Repeat steps 4–8, except that the loop of thread is held at step 6. 13. Cut all threads at about 2 mm from the knot (Fig. 12.4i). 3.5.4 Interrupted Stitching of the Skin

1. With a new needle (or the same needle as above if there is enough thread left) cross over to the skin inwards on one side of the opening, then cross over to the skin outwards on the other side of the opening, then perform steps 4–8 under the Subheading 3.5.3 (Fig. 12.4d, f, j) and cut the thread on both sides of the knot (Fig. 12.4b). 2. Stitch the skin by repeating point 30 as many times as necessary. Stitches must be close one to the other to resist the pressure of the growing fetuses in the uterus in late pregnancy (Figs. 12.3f and 12.4b). 3. In a cage pre-warmed on a heating mat and devoid of cage enrichments that could rub on the suture, lay the mouse on tissue papers. Provide semi-solid food and drinking water containing Dafalgan at 1.7 mg/mL. Without further disturbance, let the mouse wake up and recover for 2–3 h, then return the cage to the housing rack. 4. Provide the mouse with a second subcutaneous injection of buprenorphine the day after the surgery, and keep Dafalgan in drinking water for approximately 4 days. Leave the mouse to give birth normally approximately 5 days after the surgery, if done at E13.5 (see Note 14).

3.6

Sweat Test

This protocol relates to the analysis of the phenotype induced by treatment with EDAR pathway modifiers. 1. Prepare a 5% iodine solution in 100% ethanol. 2. Prepare a suspension of 1 g of starch in about 1.5 mL of olive oil. 3. Immobilize in one hand a mouse aged 3 weeks or more (Fig. 12.5a). If necessary, dry rear legs with a soft tissue (see Note 15). 4. Brush the sole of a foot with a cotton bud dipped into the iodine solution and let the ethanol evaporate for a few seconds (Fig. 12.5b) (see Note 16). 5. Brush the sole of the foot again with a second cotton bud dipped into the starch in oil suspension (Fig. 12.5c). 6. Wait for about 1 min until dark spots can be observed on foot pads and at finger tips (Fig. 12.5d, e) (see Note 17). 7. Place lamps on each side of the foot to have appropriate light and take a picture using the camera in macro mode. 8. Wipe the foot with tissue paper and release the mouse.

Pharmacological Modulation of the EDAR Pathway in Mice

179

Fig. 12.5 Starch-iodine sweat test. (a) Mouse restrained in one hand. (b) Application of iodine in ethanol with a cotton tab. (c) Application of starch in oil. (d) Visualization of sweat output as dark spots. (e) Enlargement of the area shown in panel D. White arrows point at functional sweat glands. The approximate cumulative time of the procedure is shown at the bottom left of panels a–d 3.7 Mouse Skull Preparation for Dental Phenotyping

This protocol relates to the analysis of the phenotype induced by treatment with EDAR pathway modifiers. 1. Kill an 8-week-old mouse by CO2 inhalation, or by anesthetic overdose of pentobarbital administered intraperitoneally at 150 mg/kg. 2. With scissors, sever the head from the body at the base of the skull. 3. Surgically clean the head of skin and soft tissues with forceps and scissors. Do not attempt to separate the lower jaw. 4. Insert a 10 mL syringe with a bent 21G needle through the base of the skull and flush several times with water to remove the brain. Brain tissue comes out through the foramen magnum of the occiput. 5. Digest the head for 3 h at 55  C in TEN buffer containing 50 μg/mL of freshly added proteinase K. Over-digestion is not recommended as teeth may fall out in subsequent steps, especially in younger mice (see Note 18).

180

Sonia Schuepbach-Mallepell et al.

6. Rinse the skull 2 or 3 times with plenty of water. Manually remove remaining soft-tissues with fine tweezers (see Note 19). 7. Separate the lower jaw from the skull and further clean the bone by soaking in 70% ethanol for at least 2 days. 8. Bleach the skull and lower jaw in 3% of hydrogen peroxide freshly diluted in water from a 30% stock until bones become white (usually 6 h to overnight), then rinse with plenty of water and dry. 9. Observe teeth with a stereomicroscope equipped with a cooled color CCD camera and using the LAS AF6000 software, or with any other appropriate device.

4

Notes 1. There are restrictions on ordering pentobarbital, and its use must be properly certified. At the Department of Biochemistry of the University of Lausanne, required amounts can be obtained from the veterinary responsible for the animal facility. 2. We recommend a dose of 2 mg/kg for EDAR agonists, but higher doses will also work [11]. Half-lives of 48 h and 11 days have been reported for recombinant Fc-EDA1 and for agonist anti-EDAR antibodies, respectively [9, 11]. Therefore, a second administration of Fc-EDA 3–4 days later can be useful. For function-blocking anti-EDA antibodies, their presence is required throughout the period during which tissues can respond to EDA, justifying more frequent administrations (e.g. every other day) or higher doses (e.g. 4 mg/kg). In support of this hypothesis, tail hair formation was not fully inhibited in the presence of anti-EDA antibodies, suggesting the possibility that some EDA in the tail escaped inhibition [12]. It is known that an exposure to Fc-EDA as short as 3.5 h is sufficient to induce tail hair formation [15]. 3. Red lamps can burn and should be kept at least 20 cm away from mice. 4. Using this administration route, EC50 of 0.1–0.3 mg/kg has been reported with both anti-EDAR antibodies and Fc-EDA recombinant protein for induction of tail hair and sweat glands in newborn Eda-deficient pups [9, 11]. 5. Glass Hamilton syringes do not enter conventional tubes, and the needle is too short to reach the bottom. Filling the syringe from a drop on parafilm reduces the risk of bending or clogging the needle, but the drop should be prepared just before use to minimize evaporation. Insulin syringes may also be used, but with an increased risk of liquid leakage out of the abdomen after injection.

Pharmacological Modulation of the EDAR Pathway in Mice

181

6. The procedure is easier when pups have not yet fed. It is not uncommon for some liquid to leak out when the needle is removed, especially in well-hydrated pups. Record such events as they can be an explanation for suboptimal treatment outcomes, although such leakage often has no or little impact as the leaked fluid is not necessarily the injected solution. 7. Blood volume in mice is 70–80 mL/kg and should be calculated on the lower limit. Natural compensation mechanisms can cope with loss of up to 20% of blood volume in a period of 14 days, which is equivalent to 280 μL for a 20 g mouse. This volume can be taken in a single bleed, or in several smaller bleeds. 8. Blood sampling from the facial vein can also be performed without anesthesia. 9. The facial vein is under the skin, not deeply situated. Best results are obtained with a light pinch of the neck skin. A deep pinch does not help, causes damage, and can even induce bleeding in the ear. 10. To prepare serum, let blood coagulate for 2 h at 37  C or overnight at 4  C. Spin tubes for 20 min at 13,000 rpm (16,200  g) at room temperature in a table top centrifuge. Collect supernatant, which will usually yield 30–40% of the initial volume of blood. 11. Oxygen and isoflurane reach the mask through a cylinder-like piece. A home-made mask can be obtained by cutting the finger of a nitrile or vinyl glove, pulling it over the open end of the cylinder and keeping it in place with sticky tape. Cut the very tip of the glove finger with scissors to create a round opening in which the snout of the anesthetized mouse can be placed. 12. The incision should not be longer than necessary. A length of 1.5 cm is enough to extract uterine horns. 13. Before starting the laparotomy procedure, fill the syringe with the injection solution for all fetuses, provided they all receive the same treatment. For this purpose, aspirate the solution laid as a drop on a piece of parafilm (see Note 5). The Hamilton syringe can be equipped with a 33G or a 34G needle. We prefer a 33G needle in which clogging is less likely than in the very fine 34G needle. 14. Leave the mouse as undisturbed as possible, but perform daily examination of different criteria (activity, posture, movement and gait, coat condition, grooming, breathing, alertness, dehydration, eyes and nose, surgical wound) using a score sheet. In case of an inflamed surgical wound, treat with a Bepanthen Plus

182

Sonia Schuepbach-Mallepell et al.

cream. In case of suspicion of infection, treat with antibiotics upon prescription from the veterinarian. 15. Sweat glands require proper innervation to become fully functional. Sweat tests performed before weaning either do not work or may give unreliable results. 16. If the cotton bud is reused several times, the iodine amount applied will increase as a result of repeated ethanol evaporation, which may increase background. Change the cotton bud after about 3 or 4 mice. 17. A spotty background of small dark spots may appear from time to time. If this is the case, immediately discard and renew the suspension of starch in oil. 18. The bones on the top of the skull (the parietal and interparietal bones) can easily detach from the skull, especially in younger mice. 19. It can be more comfortable to perform this procedure under a binocular magnifier.

Acknowledgments P.S. is supported by the Swiss National Science Foundation [grant 310030A_176256]. Conflict of interest: Authors declare no competing financial interests. References 1. Kere J, Srivastava AK, Montonen O et al (1996) X-linked anhidrotic (hypohidrotic) ectodermal dysplasia is caused by mutation in a novel transmembrane protein. Nat Genet 13:409–416 2. Srivastava AK, Pispa J, Hartung AJ et al (1997) The Tabby phenotype is caused by mutation in a mouse homologue of the EDA gene that reveals novel mouse and human exons and encodes a protein (ectodysplasin-A) with collagenous domains. Proc Natl Acad Sci U S A 94:13069–13074 3. Headon DJ, Emmal SA, Ferguson BM et al (2001) Gene defect in ectodermal dysplasia implicates a death domain adapter in development. Nature 414:913–916 4. Headon DJ, Overbeek PA (1999) Involvement of a novel Tnf receptor homologue in hair follicle induction. Nat Genet 22:370–374 5. Monreal AW, Ferguson BM, Headon DJ, Street SL, Overbeek PA, Zonana J (1999) Mutations in the human homologue of

mouse dl cause autosomal recessive and dominant hypohidrotic ectodermal dysplasia. Nat Genet 22:366–369 6. Hammersen JE, Neukam V, Nusken KD, Schneider H (2011) Systematic evaluation of exertional hyperthermia in children and adolescents with hypohidrotic ectodermal dysplasia: an observational study. Pediatr Res 70:297–301 7. Cui CY, Durmowicz M, Ottolenghi C, Hashimoto T, Griggs B, Srivastava AK, Schlessinger D (2003) Inducible mEDA-A1 transgene mediates sebaceous gland hyperplasia and differential formation of two types of mouse hair follicles. Hum Mol Genet 12:2931–2940 8. Gaide O, Schneider P (2003) Permanent correction of an inherited ectodermal dysplasia with recombinant EDA. Nat Med 9:614–618 9. Schneider H, Faschingbauer F, SchuepbachMallepell S et al (2018) Prenatal correction of

Pharmacological Modulation of the EDAR Pathway in Mice X-linked hypohidrotic ectodermal dysplasia. N Engl J Med 378:1604–1610 10. Hermes K, Schneider P, Krieg P, Dang A, Huttner K, Schneider H (2014) Prenatal therapy in developmental disorders: drug targeting via intra-amniotic injection to treat X-linked hypohidrotic ectodermal dysplasia. J Invest Dermatol 134:2985–2987 11. Kowalczyk C, Dunkel N, Willen L et al (2011) Molecular and therapeutic characterization of anti-ectodysplasin A receptor (EDAR) agonist monoclonal antibodies. J Biol Chem 286:30769–30779 12. Kowalczyk-Quintas C, Willen L et al (2014) Generation and characterization of functionblocking anti-ectodysplasin A (EDA) monoclonal antibodies that induce ectodermal dysplasia. J Biol Chem 289:4273–4285

183

13. Del-Pozo J, MacIntyre N, Azar A, Headon D, Schneider P, Cheeseman M (2019) Role of ectodysplasin signalling in middle ear and nasal pathology in rat and mouse models of hypohidrotic ectodermal dysplasia. Dis Model Mech 12:dmm037804 14. Kowalczyk-Quintas C, Schuepbach-MallepellS, Willen L et al (2015) Pharmacological stimulation of Edar signaling in the adult enhances sebaceous gland size and function. J Invest Dermatol 135:359–368 15. Swee LK, Ingold-Salamin K, Tardivel A et al (2009) Biological activity of ectodysplasin A is conditioned by its collagen and heparan sulfate proteoglycan-binding domains. J Biol Chem 284:27567–27576

Chapter 13 Analysis of Ligand-Receptor Interactions Using Bioluminescent TNF Superfamily (TNFSF) Ligand Fusion Proteins Kirstin Kucka, Juliane Medler, and Harald Wajant Abstract Quantitative analysis of the binding of tumor necrosis factor (TNF) superfamily ligands (TNFLs) to TNF receptor superfamily receptors (TNFRs) is of crucial relevance for the understanding of the mechanisms of TNFR activation. Ligand binding studies are also a basic method required for the development and characterization of agonists and antagonists of TNFRs. TNFL-induced formation of fully active TNFR signaling complexes is a complex process. It involves not only reorganization of monomeric and inactive pre-assembled TNFR complexes into trimeric liganded TNFR complexes but also the secondary interaction of the latter. Moreover, various factors, e.g., TNFR modification, special membrane domains, or accessory proteins, may affect TNFL–TNFR interactions in a TNFR type-specific manner. Widely used cell-free methods for the analysis of protein–protein interactions are thus of limited value for the analysis of TNFL–TNFR interactions and makes therefore in this case cellular binding studies to the method of choice. We and others observed that the genetic fusion of monomeric protein domains to the N-terminus of soluble TNFLs has typically no effect on activity and TNFR binding. We exploited this to generate bioluminescent TNFL fusion proteins which allow simple, sensitive, and highly reproducible cellular binding studies for the investigation of TNFL–TNFR interactions. Here, we report detailed protocols for the production of TNFL fusion proteins with the luciferase of Gaussia princeps and the use of these fusion proteins in various types of cellular binding studies. Key words Bioluminescence, Gaussia princeps luciferase, TNF superfamily ligands (TNFLs), TNF receptor superfamily receptors (TNFRs)

1

Introduction In the majority of studies, the binding of tumor necrosis factor (TNF) superfamily (TNFSF) ligands to receptors of the TNF receptor superfamily (TNFRSF) has been analyzed by help of cell-free methods and recombinant soluble TNFRSF receptor (TNFR) ectodomains (or ectodomain fusion proteins). Although such cell-free binding studies can be helpful, they not necessarily reflect ligand binding to cell expressed TNFRs. Indeed, affinities reported for a

Jagadeesh Bayry (ed.), The TNF Superfamily: Methods and Protocols, Methods in Molecular Biology, vol. 2248, https://doi.org/10.1007/978-1-0716-1130-2_13, © Springer Science+Business Media, LLC, part of Springer Nature 2021

185

186

Kirstin Kucka et al.

particular TNFL–TNFR interaction vary in the literature often up two or three orders of magnitude [1]. Affinities determined with intact cells are thereby often higher than affinities obtained with cell-free methods, especially when monomeric TNFR ectodomains had been used in the cell-free studies [1]. These discrepancies are presumably due to the fact that the formation of plasmamembrane-associated trimeric liganded TNFR complexes from monomeric and/or ligand-free pre-assembled TNFRs is a complex and dynamic multi-step process that cannot be simply mimicked by TNFL binding to an immobilized TNFR ectodomain, irrespective of the multimerization state of the latter [2, 3]. Moreover, other cell-associated factors which gain no relevance in cell-free binding studies, e.g., TNFR localization in specialized lipid compartments, receptor modification (e.g., palmitoylation), and interaction with additional accessory proteins, can modulate TNFL–TNFR interaction again, resulting in unrealistic affinities [4–6]. Ligand binding assays with intact cells are therefore the approach of choice when quantitative aspects of TNFL–TNFR interaction are of relevance. The performance of such cellular binding studies, however, is crucially dependent on the availability of highly traceable, fully functional, and reliable quantifiable TNFL variants. The generation of TNFL variants fulfilling these requirements is, indeed, the major hurdle for cellular binding studies. The standard approaches to generate traceable ligand molecules are to biochemically label them in a non-directed manner with iodine, fluorescent dyes, or biotin. The definition of conditions allowing robust and reproducible labeling of a ligand, however, can be challenging and is frequently associated with significant batch-to-batch variations. Moreover, even when conditions have been defined that allow efficient ligand labelling, there is often still the limitation that such ligand preparations consist of a heterogeneous mixture of ligand species that differ with respect to the number of labeled positions per molecule but also with respect to their receptor binding properties. In previous work, we and others observed that soluble TNFLs which have been connected by genetic engineering with an N-terminal monomeric protein domain display normal/unchanged self-assembly and receptor binding [7]. In particular, we exploited this finding for the labeling of TNFLs by a genetic and thus highly reproducible and side-specific manner. For this purpose, we linked the monomeric secretable luciferase from Gaussia princeps (GpL) [8] to the N-terminus of different formats of soluble TNFLs, including conventional trimeric TNFLs, TNC trimerization domain stabilized trimeric TNFLs, hexameric Fc-TNFLs, and nonameric TNC-scTNFLs [1, 9–15]. The various GpL-TNFL fusion proteins showed similar TNFR stimulatory activities as their corresponding “GpL domain”-free counterparts and furthermore revealed over several orders of magnitude a linear relation between bioluminescence activity and the concentration of

Bioluminescent TNFL Fusion Proteins

187

the GpL-TNFL fusion proteins (ref. 13 and Fig. 1). Based on previous published methods in molecular biology protocols on the generation and application of GpL-CD95L fusion proteins [16], we summarize here detailed general protocols for the production of GpL-TNFL fusion proteins and their use in various types of ligand binding studies with adherent and suspension cells.

2

Materials

2.1 Generation of the GpL-TNFL Fusion Protein of Interest 2.1.1 Production of the GpL-TNFL Fusion Protein of Interest

1. Eukaryotic expression plasmids (e.g., pCR3 based) encoding the GpL-TNFL variant of interest and, if necessary, a corresponding counterpart without GpL domain for determination of non-specific binding. 2. Standard equipment for cell culture work. 3. HEK293 cells (ATCC, USA). 4. RPMI 1640 medium supplemented with 1% v/v of a penicillin–streptomycin stock solution containing 10,000 U/mL penicillin and 10 mg/mL streptomycin. 5. RPMI 1640 medium supplemented with 2% fetal calf serum (FCS) and 1% penicillin/streptomycin. 6. Polyethylenimine (PEI) (Polyscience Inc): 1 mg/mL dissolved in ddH2O. 7. 15 cm tissue culture dishes. 8. 1.5 mM Coelenterazin in methanol (luciferase substrate) (Carl Roth). 9. Black 96-well plates. 10. 96-well Microplate Luminometer. 11. Standard buffers and equipment for SDS-PAGE and Western Blotting. 12. Vortex. 13. ROTANTA 460/460R centrifuge.

2.1.2 Purification of the GpL-TNFL Fusion Protein of Interest

1. Anti-Flag mAb M2 agarose (Sigma). 2. TBS buffer: 0.02 M Tris–HCl, 0.14 M NaCl, pH 7.6. 3. 0.1 M Glycine–HCl, pH 2.5. 4. 50% Glycerol in TBS with 0.02% sodium azide. 5. Flag peptide elution buffer: 100 μg/mL Flag peptide (Sigma) in TBS. 6. Silver staining kit. 7. 0.2 μm filter. 8. M2 agarose column.

188

Kirstin Kucka et al.

Fig. 1 GpL-TNFL fusion proteins are highly traceable and have unchanged TNFRstimulating activity. (a) Domain architecture and self-assembly of a prototypic GpL-TNFL fusion protein. Please note the TNC domain stabilizes the trimeric structure of soluble TNFLs what can be beneficial for poorly stable TNFLs, such as murine TRAIL or murine CD95L, and is thus regularly included in our soluble TNFL versions. (b) Bioluminescence activity of GpL-TNF at room temperature in RPMI1640 medium with 10% FCS. (c) HT1080 and Kym-1 cells were seeded in triplicates in 96-well plates and were stimulated overnight with the indicated concentrations of GpL-TNC-TNF and TNC-TNF. Next day, IL8 production of HT1080 cells was determined by ELISA (left panel) and apoptosis induction in Kym-1 cells was quantified using the MTT assay

9. ROTANTA 460/460R centrifuge. 10. Standard buffers and equipment for SDS-PAGE and Western Blotting. 2.2 Binding Studies with GpL-TNF Ligand (GpL-TNFL) Fusion Proteins

1. Supernatant containing GpL-TNFL fusion protein or purified GpL-TNFL fusion protein. 2. GpL domain-free TNFL or TNFR-blocking antibody or homologous GpL-TNFL fusion protein not expressed on cell of interest or TNFR knockout/knockdown cell line for determination of unspecific binding. 3. Standard equipment for cell culture work. 4. 5 L plastic beakers.

Bioluminescent TNFL Fusion Proteins

189

5. Eppendorf centrifuge. 6. Safe-lock tubes. 7. RPMI 1640 medium supplemented with 10% FCS. 8. RPMI 1640 medium supplemented with 0.5% FCS. 9. Phosphate buffered saline (PBS): 140 mM NaCl, 18.6 mM Na2HPO4, 2.6 mM NaH2PO4. 10. 1.5 μM Coelenterazin in PBS. 11. Black 96-well plates. 12. 96-well Microplate Luminometer. 13. GraphPad Prism5 or related software.

3

Methods

3.1 Generation of the GpL-TNFL Fusion Protein of Interest

3.1.1 Production of the GpL-TNFL Fusion Protein of Interest

Production and purification of Flag-tagged variants of GpL-TNFL fusion proteins are performed according to previously published methods in molecular biology protocols on the production and purification of Flag-tagged scFv–TNFL fusion proteins [17] with the exception that HEK293 cells were transfected using the PEI method instead of electroporation. 1. Cultivate HEK293 cells in 15 cm tissue culture dishes till confluency. 2. Mix for each 15 cm dish 2 mL of serum-free RPMI 1640 medium with 12 μg of expression plasmid (stock concentration > 100 μg/mL) encoding a Flag-tagged version of the GpL-TNFL fusion protein of interest (see Notes 1 and 2). 3. Add 36 μL of polyethylenimine (PEI) solution dropwise to the serum-free medium/DNA solution and vortex. 4. Incubate resulting DNA/PEI mixture for 15 min at room temperature. 5. During the incubation time replace the medium from the HEK293 cells with 15 mL of serum-free RPMI 1640 medium containing penicillin/streptomycin. 6. After the 15 min incubation time, add the DNA/PEI mixture to the HEK293 cells. 7. Cultivate cells overnight. 8. Replace the serum-free medium by RPMI 1640 medium containing 2% of FCS and penicillin/streptomycin. Be aware that a significant fraction of the cells will detach under the low serum cultivation conditions but that this does not affect productivity.

190

Kirstin Kucka et al.

9. Collect the cell culture supernatant after 5–7 days and clean it by centrifugation (10 min, 5063
g, ROTANTA 460/460R centrifuge, rotor 5624). 10. Determine the concentration of the GpL-TNFL fusion protein. This can be done, for example, by anti-Flag Western blotting and comparison with a Flag-tagged protein standard of known concentration, a TNFL-specific ELISA, or by measuring GpL activity and comparison with a GpL standard. Typical yields are between 5 and 20 μg of GpL-TNFL fusion protein per mL, thus 75–225 μg per plate. 11. Control functionality of the GpL-TNFL fusion protein (see Note 3). 3.1.2 Purification of the GpL-TNFL Fusion Protein of Interest (See Note 1)

1. Prepare an anti-Flag mAb M2 agarose column of the required capacity (1 mL per 500 μg of Flag-tagged GpL-TNFL or TNFL protein). Minimal bed volume is 200 μL and bed height should be 3–5 times of the column diameter. Prevent the agarose bed from running dry. 2. Equilibrate the column twice with 10 agarose bed volumes of TBS. Again, prevent the agarose bed from running dry. 3. If agarose was used before, regenerate with 6 agarose bed volumes of 0.1 M Glycine pH 2.5 and wash again with TBS. 4. Supplement the Flag-tagged GpL-TNFL fusion protein/ TNFL-containing cell culture supernatant with NaCl to reach a final concentration of 150 mM. 5. Clear the supernatant to avoid clogging of the M2 agarose column. For this either centrifuge the cell culture supernatant at 5063
g for 10 min (ROTANTA 460/460R centrifuge, rotor 5624) or filtrate it through a 0.2 μm filter. 6. Load the cleared supernatant by gravity flow onto the column. Avoid disturbance of the agarose bed. 7. Wash the M2 agarose column three times with 5 column volumes of TBS to remove unbound proteins from the column. 8. Drain the M2 agarose column to the top of the gel bed without letting it go dry. 9. To elute the Flag-tagged ligand molecules, apply approximately 8–10 column volumes of Flag peptide–containing elution buffer and collect the corresponding flow path in fractions of one column volume. Load the elution buffer without disturbing the M2 agarose bed and drain the column completely after application. 10. Wash the M2 agarose column with 10 column volumes of TBS and store the M2 agarose in 50% glycerol in TBS supplemented with 0.02% NaN3 at 20  C.

Bioluminescent TNFL Fusion Proteins

191

11. Reduce the Flag peptide content of the eluates by double dialyzes against PBS (optional). 12. Analyze the purity of the eluted TNFL/GpL-TNFL fusion protein by SDS-PAGE and silver staining. 13. Pool fractions according to purity and ligand concentration. In the case of GpL-TNFL fusion proteins, this is simply possible by measuring luciferase activity and comparison with a GpL fusion protein with known concentration. The concentration of conventional TNFL variants can be determined with a corresponding ELISA or other conventional means for determination of protein concentrations. 14. Sterile filtrate the pools. 15. Control functionality of the purified TNFL or GpL-TNFL fusion protein (see Note 3). 3.2 Equilibrium Binding Studies 3.2.1 For Good Adherent Cells

1. Seed cells of interest (2–3
105 cells per well) in 24-well tissue culture plates (12 wells). In the case that non-specific binding will be evaluated by help of cells preincubated with an excess of a GpL-domain-free TNFL variant or blocking TNFR antibodies, prepare 24 wells (see Note 4) (Fig. 2). 2. In the case that cells without (TNFR knockout) or strongly reduced (TNFR knockdown) expression of the TNFR investigated are used for determination of non-specific binding, prepare 24-wells of these cells with the same number of cells (see Notes 5 and 6) (Fig. 2). 3. In the case that non-specific binding will be evaluated by help of cells preincubated with an excess of a GpL-domain-free TNFL variant or blocking TNFR antibodies (Fig. 2), add these reagents next day for 30 min to 12 of the 24 wells. The excess of the GpL-domain-free TNFL variant should be >100fold of the highest concentration of the GpL-TNFL variant used in the next step. Likewise, high concentrations (100-fold) of corresponding “GpL-free” TNFL variant (b), (ii) blockade of the TNFR (s) addressed by the GpL-TNFL molecule with an antagonistic anti-TNFR antibody (c), (iii) use of a cell line variant with no (or only low) expression of the TNFR addressed by the GpL-TNFL molecule (d) and (iv) application of a similarly structured irrelevant GpL-TNFL variant targeting a TNFR not expressed on the cell line of interest (e). (Figure modified according to Lang et al., 2017 [16])

count the average number of cells after the washing procedure described below in step 5 (see Note 7). 5. Prepare two 5 L plastic beakers with ice-cold PBS during incubation of the cells with the GpL-TNFL fusion protein. 6. After incubation, discard the medium in the utility sink by a fast move of the plate and gently submerge the plate with the adherent cells in the first plastic beaker with ice-cold PBS. Discard the PBS from the cells and submerge the plate again in the first plastic beaker with PBS. Repeat this procedure a third time with the first beaker with PBS and then three times with the second beaker with PBS. Harvest and count cells from one of the untreated groups. 7. Scrape cells into 50 μL medium containing 0.5% FCS by help of a cell scraper (see Note 8).

Bioluminescent TNFL Fusion Proteins

193

8. Transfer the suspension with the scrapped cells to black 96-well plates. 9. Prepare the required amount of GpL assay solution (1.5 μM Coelenterazin in PBS). Mix the GpL assay solution but do not vortex. 10. Add at room temperature 25 μL of GpL assay solution per 50 μL sample and measure luminescence immediately (1 s per well). The luminescence activity of GpL decays significantly within a minute after adding the GpL assay solution [3]. When GpL activity is measured in groups of 8 samples or less, the systematic error of the activity decay is below 5%. 11. Subtract the non-specific binding values (TNFR-negative cells, preincubated cells) from the corresponding total binding values (TNFR-positive cells, no preincubation) to obtain the specific binding values. 12. To obtain maximal binding (Bmax) and the equilibrium dissociation constant (KD) of the TNFR-TNFL interaction, fit specific binding values by nonlinear regression to a one-sitespecific binding curve using the GraphPad Prism5 software. 13. Calculate the average TNFR number (¼binding sites) per cell (NBS). For this purpose, determine the luciferase activity per GpL-TNFL fusion protein protomer (AGpL-dom) by comparison with the luciferase activity of a GpL-TNFL standard of known concentration. NBS can then be calculated using the Bmax-value obtained in step 12 and the number of cells per sample (CNwell) determined in step 6 with the formula: NBS ¼ Bmax
CNwell1
AGpL-dom1. 3.2.2 For Suspension or Slightly Adherent Cells

1. Prepare aliquots (100–200 μL) of the cells of interest (0.5–2
106) in medium in safe-lock tubes. Eight to eleven measurement points (¼aliquots) are usually sufficient to obtain a meaningful binding curve. Include an additional aliquot for cell counting. In the case that non-specific binding will be evaluated by help of cells preincubated with an excess of a GpL-domain-free TNFL variant or blocking TNFR antibodies, prepare twice the number of aliquots (see Note 4). 2. In the case that cells without (TNFR knockout) or strongly reduced (TNFR knockdown) expression of the TNFR investigated are used for determination of non-specific binding, prepare the same number of aliquots with the same cell number as in step 1 (see Notes 5 and 6). 3. In the case that non-specific binding will be evaluated by help of cells preincubated with an excess of a conventional TNFL variant without GpL domain or blocking TNFR antibodies, add these reagents for 30 min to half of the aliquots. The excess of the GpL-domain-free TNFL variant should be >100-fold of

194

Kirstin Kucka et al.

the highest concentration of the GpL-TNFL variant used in the next step. Likewise, high concentrations (100-fold) of a GpL domain-free conventional TNFL variant or a high concentration of a corresponding TNFR blocking antibody (typically 10–50 μg/mL dependent of antibody and ligand affinity). The cells of these wells are dedicated for the determination of non-specific binding of the GpL-TNFL fusion protein (see Note 6). 4. Prepare two 5 L plastic beakers with ice-cold PBS. 5. Incubate cell samples dedicated for determination of total and non-specific ligand binding pairwise with a constant concentration of the GpL-TNFL fusion protein in cell culture medium for increasing times at 37  C. For this purpose, add the

Bioluminescent TNFL Fusion Proteins

195

GpL-TNFL fusion protein to different times to a pair of cells dedicated for determination of non-specific and total binding. Stop ligand association in all groups simultaneously by discarding the medium in the utility sink and submerging the plate in one of the beakers with ice-cold PBS. Leave cells of one of the wells untreated to have later a control for luciferaseindependent bioluminescence background (typically neglectable small). 6. Discard the PBS from the cells and submerge the plate again in the first plastic beaker with ice-cold PBS. Repeat this wash procedure two times with the first beaker with PBS and then three times with the second beaker with PBS. 7. Proceed as described in steps 7–10 described in Subheading 3.2.1. 8. For each time point of incubation with the GpL-TNFL fusion protein calculate the specific binding values (difference of total binding and non-specific binding). 9. Using the specific binding values obtained in step 8, there are two major ways to calculate the association rate constant. First, if the dissociation rate constant of the GpL-TNFL fusion protein has already been determined (see Subheading 3.4), the association rate constant can be obtained by nonlinear regression fitting with the “association kinetics one ligand concentration” function of the GraphPad Prism5 software. Second, if the dissociation rate constant is not available, several association experiments with different concentrations of the GpL-TNFL fusion protein have to be performed as described in steps 1–7. The resulting specific binding data allow then the calculation of the association rate constant by nonlinear regression fitting with the “association kinetics two or more ligand concentrations” function of the GraphPad Prism5 software. 3.3.2 For Suspension Cells

1. Prepare aliquots (100–200 μL) of the cells of interest (0.5–2
106 cells) in medium in safe-lock tubes with similar systematics as described for adherent cells in steps 1–3 of Subheading 3.3.1. 2. Treat cell samples dedicated for determination of total and non-specific ligand binding pairwise with a constant concentration of the GpL-TNFL fusion protein for increasing times at 37  C. For this purpose, add the GpL-TNFL fusion protein to different times to a pair of cells dedicated for determination of non-specific and total binding. Stop/minimize ligand association in all groups simultaneously by adding 1 mL of ice-cold PBS. Leave cells of one of the wells untreated to have later a control for luciferase-independent bioluminescence background (typically neglectable small).

196

Kirstin Kucka et al.

3. Discard unbound ligand by centrifugation of the tubes with a microcentrifuge (20,000
g, 0–4  C, 1 min, rotor FA-45-3011) and removal of the supernatant. 4. Add 1 mL of ice-cold PBS to the pellet and vortex the cells gently until cells have been resuspended. Repeat this washing step two additional times. 5. Resuspend cells in medium containing 0.5% FCS. 6. Continue with steps 8–10 of Subheading 3.2.1. 7. Continue with steps 8–9 of Subheading 3.3.1. 3.4 Determination of the Dissociation Rate Constant 3.4.1 For Good Adherent Cells

1. Seed cells expressing the TNFR of interest in 24-well tissue culture plates (10–20
104 cells per well) and cultivate overnight (see Note 4). 2. Next day, supplement for 30 min at 37  C half of the wells/ samples with an excess (if possible >200-fold of the concentration of the GpL-TNFL used in step 3) of a GpL-domain-free variant of the TNFL of interest or a blocking anti-TNFR antibody (5–50 μg/mL dependent of antibody affinity). The cells treated this way serve later to determine the unspecific binding of the GpL-TNFL fusion proteins (see Note 5). 3. Incubate ligand/anti-TNFR blocked and non-blocked cells with a constant concentration of the GpL-TNFL fusion protein of interest. It is recommended to use a concentration of the GpL-TNFL fusion protein that results in a convenient measurable amount of specifically bound molecules (e.g., around the KD-value) but is also low enough to not requiring too much ligand/antibody for blocking (see step 2). 4. Incubate cells for 1 h at 37  C to reach equilibrium binding. 5. Chase blocked and non-blocked cells/samples for varying times (0–60 min are typically useful for TNFLs) pairwise with an excess of a GpL-domain-free TNFL variant or a blocking TNFR antibody (e.g., similar to the blocking procedure in step 2). For this purpose, add the blocking TNFL/antibody to different times to a pair of blocked/non-blocked cells. Leave one pair of cells/samples without any further treatment to define 100% equilibrium binding. 6. Prepare two 5 L plastic beakers with ice-cold PBS during steps 4 or 5. 7. Proceed with steps 6–10 described in Subheading 3.2.1. 8. For each time point calculate the specific binding value (total binding value (no pretreatment) minus the non-specific binding value (samples blocked in step 2). Normalize the obtained specific binding values of the chase time points to the 100% binding value obtained from the non-chased sample (see step 5).

Bioluminescent TNFL Fusion Proteins

197

9. Fit the data by nonlinear regression with the “dissociation— one phase exponential decay” function of the GraphPad Prism5 software to obtain the dissociation rate constant. 3.4.2 For Suspension Cells

1. Prepare aliquots (100–200 μL) of the cells of interest (0.5–2
106 cells) in medium in safe-lock tubes with similar systematics as described for adherent cells in steps 1–5 of Subheading 3.4.1. 2. Stop/minimize GpL-TNFL dissociation in all groups simultaneously by adding 1 mL of ice-cold PBS. 3. Discard unbound ligand by centrifugation of the tubes with a microcentrifuge (20,000
g, 0–4  C, 1 min, rotor FA-45-3011) and removal of the supernatant. 4. Add 1 mL of ice-cold PBS to the pellet and vortex the cells gently until cells have been resuspended. Repeat this washing step two additional times. 5. Resuspend cells in medium containing 0.5% FCS. 6. Continue with steps 8–10 of Subheading 3.2.1. 7. Continue with steps 8 and 9 of Subheading 3.4.1.

3.5 Competition Binding Experiments with GpL-TNFL Fusion Proteins 3.5.1 For Good Adherent Cells

1. Seed cells expressing the TNFR of interest (10–20
104 cells per well) in 24-well tissue culture plates and cultivate overnight (see Note 4). 2. Next day, incubate the cells (1 h, 37  C) with mixtures of a constant concentration of the GpL-TNFL fusion protein and increasing concentrations of its competitor for TNFR binding, e.g., a blocking anti-TNFR antibody or another ligand variant. A useful constant concentration of the GpL-TNFL fusion protein is typically at or below its KD value and should ensure a ratio of total binding to non-specific binding >5. The competitor concentrations should cover a range reaching from a high concentration allowing practically complete inhibition of specific GpL-TNFL binding to a low concentration showing no relevant competition. 3. Prepare two 5 L plastic beakers with ice-cold PBS during the incubation time of step 2. 4. Proceed with steps 6–10 described in Subheading 3.2.1. 5. To determine the equilibrium dissociation constant of the competitive inhibitor (Ki) fit the binding values by nonlinear regression to a one-site competitive binding curve, e.g., by help of the GraphPad Prism5 software.

3.5.2 For Suspension Cells

1. Prepare the required number of aliquots of cells in medium (0.2–2
106 cells) in safe-lock tubes.

198

Kirstin Kucka et al.

2. Incubate cells (1 h, 37  C) with mixtures containing a constant concentration of the GpL-TNFL fusion protein and increasing concentrations of the competitor under consideration of the issues listed in step 2 of Subheading 3.5.1 for adherent cells. 3. Add 1 mL of ice-cold PBS to all samples and continue as described in steps 7–9, Subheading 3.2.2. 4. Determine cell-associated luciferase activity as described in steps 8–10, Subheading 3.2.1. 5. To determine the equilibrium dissociation constant of the competitive inhibitor (Ki) fit the binding values by nonlinear regression to a one-site competitive binding curve, e.g., by help of the GraphPad Prism5 software.

4

Notes 1. Since GpL-TNFL containing supernatants work very well in binding studies, there is no need for the use of purified proteins. Thus, non-tagged GpL-TNFL fusion proteins are useful as well. 2. Flag-tagged GpL-free TNFL variants dedicated as competitors for the determination of non-specific binding can be produced and purified using the same procedure. 3. All receptors of the TNFRSF, with exception of the decoy receptors OPG, TRAILR3, TRAILR4 and DcR3, activate in appropriate cell lines the classical NFκB pathway and therefore trigger the production of NFκB-regulated chemokines, e.g., IL6, IL8, or MCP1. Measuring the induction of these chemokines is thus a convenient and sensitive general method to detect TNFR activation. Testing death receptors of the CD95-type may require for this CHX treatment and blockade of apoptosis and/or necroptosis. Of course, the functionality of GpL-TNFL ligand fusion proteins specific for death-inducing TNFRs can also easily be controlled by cell death assays with a cell line with well-established death receptor sensitivity. Please note, some TNFR types become activated only by soluble trimeric TNFL variants upon oligomerization, e.g., by antiFlag crosslinking [3]. 4. Dependent on the cell surface expression levels of the TNFR of interest, binding assays can also be performed in 96-well plates. 5. Cells that have no or low natural expression of the TNFR of interest can also be used for determination of non-specific binding when corresponding TNFR transfectants are investigated. Cells lines that have no or low natural expression of the TNFR of interest can also be used for determination of non-specific binding for heterologous cell lines. However,

Bioluminescent TNFL Fusion Proteins

199

here one have to previously prove that both cell lines have comparable non-specific binding for GpL-TNFLs. For this purpose, determine the non-specific binding of two or three different GpL-TNFL variants, for which is known that their TNFRs are not expressed on the two cell lines. 6. If the cells used for determination of non-specific binding have residual TNFR expression, the Bmax-value reduces accordingly but has no impact on the KD-value. 7. When GpL-Fc-TNFL fusion proteins are used for binding studies, the possible expression of Fc receptors on the cell line of interest has to be considered. If there is expression of Fc receptors, cells must be blocked with an excess of hIgG1 prior binding analysis. 8. Cell samples can be stored at 20  C after removal of the unbound GpL-TNFL fusion proteins.

Acknowledgments This work was funded by the Deutsche Forschungsgemeinschaft (DFG, German Research Foundation)—Projektnummer 324392634—TRR 221 and WA 1025/30-1. References 1. Lang I, Fullsack S, Wyzgol A et al (2016) Binding studies of TNF receptor superfamily (TNFRSF) receptors on intact cells. J Biol Chem 291:5022–5037 2. Wajant H (2014) Principles and mechanisms of CD95 activation. Biol Chem 395:1401–1416 3. Wajant H (2015) Principles of antibodymediated TNF receptor activation. Cell Death Differ 22:1727–1741 4. Gajate C, Mollinedo F (2015) Lipid rafts and raft-mediated supramolecular entities in the regulation of CD95 death receptor apoptotic signaling. Apoptosis 20:584–606 5. Seyrek K, Lavrik IN (2019) Modulation of CD95-mediated signaling by post-translational modifications: towards understanding CD95 signaling networks. Apoptosis 24:385–394 6. Zingler P, Sarchen V, Glatter T et al (2019) Palmitoylation is required for TNF-R1 signaling. Cell Commun Signal 17:90 7. Wajant H, Gerspach J, Pfizenmaier K (2013) Engineering death receptor ligands for cancer therapy. Cancer Lett 332:163–174 8. Tannous BA, Kim DE, Fernandez JL et al (2005) Codon-optimized Gaussia luciferase

cDNA for mammalian gene expression in culture and in vivo. Mol Ther 11:435–443 9. Bittner S, Knoll G, Fullsack S et al (2016) Soluble TL1A is sufficient for activation of death receptor 3. FEBS J 283:323–336 10. Chopra M, Biehl M, Steinfatt T et al (2016) Exogenous TNFR2 activation protects from acute GvHD via host T reg cell expansion. J Exp Med 213:1881–1900 11. El-Mesery M, Rosenthal T, Rauert-Wunderlich H et al (2019) The NEDD8-activating enzyme inhibitor MLN4924 sensitizes a TNFR1(+) subgroup of multiple myeloma cells for TNF-induced cell death. Cell Death Dis 10:611 12. Fick A, Lang I, Schafer V et al (2012) Studies of binding of tumor necrosis factor (TNF)-like weak inducer of apoptosis (TWEAK) to fibroblast growth factor inducible 14 (Fn14). J Biol Chem 287:484–495 13. Lang I, Fick A, Schafer V et al (2012) Signaling active CD95 receptor molecules trigger co-translocation of inactive CD95 molecules into lipid rafts. J Biol Chem 287:24026–24042 14. Lang I, Fullsack S, Wajant H (2018) Lack of evidence for a direct interaction of progranulin

200

Kirstin Kucka et al.

and tumor necrosis factor Receptor-1 and tumor necrosis factor Receptor-2 from cellular binding studies. Front Immunol 9:793 15. Salzmann S, Lang I, Rosenthal A et al (2013) TWEAK inhibits TRAF2-mediated CD40 signaling by destabilization of CD40 signaling complexes. J Immunol 191:2308–2318

16. Lang I, Kums J, Wajant H (2017) Generation and application of bioluminescent CD95 ligand fusion proteins. Methods Mol Biol 1557:63–77 17. Fick A, Wyzgol A, Wajant H (2012) Production, purification, and characterization of scFv TNF ligand fusion proteins. Methods Mol Biol 907:597–609

Chapter 14 Monitoring Atsttrin-Mediated Inhibition of TNFα/NF-κβ Activation Through In Vivo Bioluminescence Imaging Aubryanna Hettinghouse, Wenyu Fu, and Chuan-Ju Liu Abstract The NF-κβ transcription factor is a molecular mediator crucial to many biological functions and a central regulator of inflammatory and immune responses. NF-κβ is activated by multiple immunologically relevant stimuli, including members of the tumor necrosis factor (TNF) superfamily, and targeting TNF/NFκβ activity is a therapeutic objective in many inflammatory and autoimmune conditions. Here, we describe the generation of a transgenic reporter mouse model, expressing the human tumor necrosis factor α (TNF-α) transgene (TNF-tg) and carrying the luciferase gene under control of the NFκB-responsive element (NF-κB-Luc). Bioluminescence imaging shows that overexpression of TNF-α effectively activates NF-κB luciferase in vivo. To evaluate this system as a screen for potential therapeutics targeting the TNF/NFκβ signaling pathway, we treated double mutant mice with PGRN-derived Atsttrin, an engineered molecule comprising the minimal progranulin (PGRN):TNFR binding fragments previously demonstrated as therapeutic in multiple models of TNF/NFκβ-driven disease. Administration of Atsttrin could effectively inhibit luciferase activity in TNF-tg:NF-κB-Luc double mutant mice and demonstrates that this transgenic model can be used to non-invasively monitor the in vivo efficacy of modulators of TNF-activated NF-κB signaling pathway. Key words TNFα, NF-κB, Progranulin, Atsttrin, Bioluminescence Imaging, TNF-tg:NF-κB-Luc Double Mutant Mice

1

Introduction Tumor necrosis factor alpha (TNFα) has received great attention due to its position as a prototypical pro-inflammatory cytokine and its dominance in the pathogenesis of various disease processes, particularly inflammatory and autoimmune disorders [1–7]. Regulation of TNFα expression is mediated by NF-κB transcription factor family signaling; at the same time, TNFα is a driver of the canonical NF-κB pathway. NF-κB signaling is a key transcriptional regulator of inflammatory response and dysregulated NF-κB activation underlies numerous inflammatory conditions [8, 9]. In accordance with the bidirectional effects of NF-κB activation and TNFα expression and their involvement in disease processes, drugs

Jagadeesh Bayry (ed.), The TNF Superfamily: Methods and Protocols, Methods in Molecular Biology, vol. 2248, https://doi.org/10.1007/978-1-0716-1130-2_14, © Springer Science+Business Media, LLC, part of Springer Nature 2021

201

202

Aubryanna Hettinghouse et al.

targeting TNF/NF-κB signaling have been highlighted for development of anti-inflammatory therapeutics. Progranulin (PGRN) is a widely expressed, multifunctional growth factor–like molecule and TNF receptor (TNFR) binding partner [10–19]. PGRN preferentially binds to TNFR2 and activates an anabolic signaling pathway, while simultaneously competitively inhibiting the TNFα:TNFR1 interaction and subsequent NF-κB activation [14, 20–23]. The critical role of PGRN in the regulation of inflammatory response is suggested through association with variations in PGRN expression levels and the presence of PGRN autoantibodies in numerous inflammatory conditions [7, 24–30] and is broadly demonstrated by correlation between PGRN deficiency and heightened sensitivity to various murine models of autoimmune conditions, including arthritis, inflammatory bowel diseases, atherosclerosis, and inflammatory skin diseases [1, 2, 14, 29, 31, 32]. Mechanistic studies have further revealed multifarious functionality of PGRN in immune response [17, 18, 24, 33–37]. In vivo systematic treatment with PGRN or PGRNderived Atsttrin, an engineered protein comprising the minimal PGRN domains (FAC) and adjacent linker regions required for interaction with TNFRs, reverses the severe inflammatory arthritis seen in collagen II-challenged PGRN-deficient mice and significantly delays the onset of the arthritic phenotype characteristic of TNF-tg mice [14, 18]. Atsttrin exhibits higher binding affinity for TNFR2 and lower affinity for TNFR1 relative to TNFα, exhibits dose-dependent inhibition of the interaction between TNFα and TNFR1/TNFR2 [14, 18, 37], and has been evaluated as preventative and/or therapeutic in several additional inflammatory disease models including dermatitis [2], osteoarthritis [20, 38], osteolysis [21], neuroinflammation [22], colitis [35], and intervertebral disc degeneration [39]. Although clinical application of specific NF-κB signaling modulators is presently limited to their antitumor activities [6, 9], currently available TNF-α inhibitors (TNFI) are implemented as effective anti-inflammatory therapies [18–20]. However, a subset of patients do not sufficiently respond to treatment with TNFI and implementation can be contraindicated in immunosuppressed individuals [21–23]. Accordingly, identification and characterization of additional TNF antagonists with unique inhibitory properties are of particular promise for the development of disease-modifying drugs and expansion of etiological understanding. To this end, we describe generation of a transgenic animal model by crossing B6. Cg-Tg(TNF)#Xen human TNF transgenic (TNF-tg) mice and BALB/c-Tg(Rela-luc)31Xen mice carrying the luciferase gene under control of the NFκB-responsive element (NF-κB-Luc) [40] (Fig. 1). We further detail the use of TNF-tg:NF-κB-Luc double mutant mice for rapid and minimally invasive in vivo screening via a bioluminescence imaging system, implementing Atsttrin as an

In vivo Bioluminescence Assay to Determine Atsttrin’s Inhibition of NFKβ

203

Fig. 1 Generation and validation of TNF-tg:NF-κB-Luc double mutant mice. (a) TNF-tg:NF-κB-Luc double mutant mice were generated through crossing wt/TNF-tg to wt/NF-κB-Luc reporter mice. This cross also generates mice with no transgene, mice hemizygous for the human TNF transgene, and mice hemizygous for the NF-κB- luciferase reporter. Mice are genotyped before proceeding with experiments. (b) The presence of the luciferase reporter is evidenced via a 182 base pair product, while samples positive for the (c) TNF transgene will display a 91 base pair product. Mice that are confirmed to carry both transgenes can be used in following experiments

exemplary molecule capable of modulating TNFα-mediated NF-κB activation. The methods described herein can be adapted for use in evaluations of alternative potential anti-TNF and/or anti-NF-κB drug candidates.

2

Materials

2.1 Generation and Validation of TNF-tg: NF-κB-Luc Double Mutant Mice

Prepare all solutions using ultrapure water and store at room temperature unless otherwise indicated. 1. Transgenic mice (Taconic). TNF-tg (model number 1006), NF-kB-luc (model number 10499). 2. PCR Thermal cycler. 3. Water Bath. 4. Vortex.

204

Aubryanna Hettinghouse et al.

5. Micro and minicentrifuge. 6. Sterile Eppendorf tubes. 7. PCR tube with cap (Thermo Fisher Scientific). 8. Isopropanol. 9. Dissecting scissors or scalpel. 10. Electrophoresis Grade Agarose (Alfa Aesar). 11. 10 mg/mL ethidium bromide (Thermo Fisher Scientific). 12. 100 bp DNA Ladder (New England BioLabs). 13. UV light box. 14. 70% Ethanol. 15. Tris-acetate-EDTA (TAE) Buffer: 40 mM Tris, 20 mM Acetate, 1 mM EDTA. 16. TE Buffer: 10 mM Tris–HCl, pH 8.0, 1 mM EDTA. 17. Tail Lysis Buffer: 10 mM Tris–HCl, pH 8.0, 10 mM EDTA, pH 8.0, 50 mM NaCl, 0.5% SDS. 18. Proteinase K solution: Prepare a 20 mg/mL stock in sterile 50 mM Tris–HCl, pH 8.0, 1.5 mM calcium acetate. Store aliquoted for use at
20  C. 19. Primers for genotyping: TNF-tg Forward Primer: TATG—30 . TNF-tg Reverse AGC—30 .

Primer:

NF-kB luc Forward AAACGA—30 .

50 -GAGGCCAAGCCCTGG50 -CGGGCCGATTGATCTC

Primer:

50 -TGGCAGAAGCTATG

NF-kB luc Reverse Primer: 50 -AGGGTTGGTACTAGCA ACGC—30 . Dissolve oligos to a concentration of 100 μM in TE buffer and store at
20  C. Working stocks can be made to 10 μM in deionized water. Store working stocks at 4  C for short-term and
20  C for long-term storage. 20. Taq DNA Polymerase with 10 Standard Taq Buffer (New England BioLabs). 21. 25 mM Magnesium Chloride (MgCl2) Solution. 2.2 Administration of Potential Therapeutics and In Vivo Bioluminescence Imaging of TNF-tg:NFκB-Luc Double Mutant Mice

Materials necessary for administration of potential therapeutics will vary in accordance with the route of administration. In this example, we administer Atsttrin and vehicle through intraperitoneal injection. 1. Recombinant protein: Recombinant Atsttrin (Atreaon, Inc). 2. Sterile Slip Tip, Tuberculin Syringe with 26 Gauge  3/8 in. needle (BD Becton Dickinson).

In vivo Bioluminescence Assay to Determine Atsttrin’s Inhibition of NFKβ

205

3. Sterile, endotoxin-free vehicle (Sigma-Aldrich, TMS-012-A). 4. Confirmed TNF-tg:NF-κB-Luc double mutant mice. 5. D-Luciferin 15 mg/mL in PBS, filter sterilized. Store at
20  C and protect from light. (LUCK-100, Gold Biotechnology). 6. Anesthetic machine equipped with vaporizer, waste gas scavenging system, O2 source, O2 regulator, O2 flowmeter, and induction chamber. 7. Sterile ophthalmic ointment (Puralube). 8. Whole animal bioluminescence imaging system (PerkinElmer IVIS Spectrum) and analysis software (PerkinElmer Living Image Software). 9. Anesthetic. Isoflurane is preferred. 10. Scale. 11. Calculator.

3

Methods

3.1 Generation and Validation of TNF-tg: NF-κB-Luc Double Mutant Mice

1. Maintain TNF-tg and NF-kB-luc strains hemizygous for respective transgenes. To generate TNF-tg:NF-κB-Luc double mutant mice, cross the TNF-tg mice to NF-κB-Luc reporter mice. The F1 generation will include mixed background mice with no transgene, mice hemizygous for the human TNF transgene, mice hemizygous for the NF-κB-luciferase reporter, and mice that have both the human TNF transgene and NF-κB-luciferase reporter (see Fig. 1). 2. To validate the genotypes of F1 mice, genotype the mice at approximately 17 days of age to minimize pain associated with the procedure and maximize the quality of DNA (see Note 1). Use sanitized sharp scissors or a sterile disposable blade to remove no more than 5 mm of the tail tip and place into a sterile Eppendorf tube (see Note 2). 3. Add 500 μL of Tail Lysis Buffer and 10 μL of Proteinase K stock solution to each sample. Incubate tail samples in a 50–55  C water bath overnight followed by vortex to break up remaining intact tissue. Inactivate Proteinase K by incubating at 70  C for 5 min and cool on ice for 10 min. 4. Centrifuge samples in a microcentrifuge at 14,000 rpm for 5 min and transfer the supernatant to a fresh tube with an equal volume of isopropanol and mix will to precipitate DNA. 5. Spin down the DNA pellet at 14,000 rpm for 5 min, discard supernatant, and wash with 70% ethanol. Spin down the DNA pellet at 14,000 rpm for 5 min, discard supernatant, and air-dry for 2 min prior to reconstitution in 100 μL of TE buffer (see Note 3).

206

Aubryanna Hettinghouse et al.

Table 1 Components of PCR reaction Component

Volume for each 25 μL reaction Final Concentration

10 standard Taq (Mg-free) reaction buffer 2.5 μL

1

10 mM dNTPs

0.5 μL

200 μM

25 mM MgCl2

2 μL

2.0 mM

10 μM forward primer

0.5 μL

0.2 μM

10 μM reverse primer

0.5 μL

0.2 μM

Template DNA

1

30 bases) sequences are not recommended. Short sequences produce inaccurate amplification products and too long sequences hinder with the amplification rate. Length of the primer must be between 18 and 24 bases and amplicon should be between 90 and 120 bases. G/C content must be between 40% and 60%. Melting temperature of 50–60  C must be maintained with a difference of not more than 5  C between the primer pairs. Special attention should be paid to the fact that primers should not anneal to one another, i.e., should not be complementary. We studied the mRNA expression profiles of following TNFSF ligands—TNF-α, LT-α, LT-β, Fas-L, TRAIL, TWEAK, 4-1BBL, OX40-L, and APP (Table 1). Primers for other TNFSF ligands can be designed as mentioned earlier. 2. Suitable animal models can be employed to study other types of kidney diseases. 3. Other methods of RNA isolation can be used to isolate RNA from kidney tissue. The most important thing to check is the RNA quality after isolation. 4. Ethidium bromide is carcinogenic. Proper precaution must be taken while using. 5. Protocol for RT-PCR mentioned here is optimized for Roche LC-480 machine. 6. We have used the LIVAK method for the quantification of PCR amplification [11].

Acknowledgments This work was supported by the financial grant from the Council of Scientific and Industrial Research (CSIR) - Central Drug Research Institute (CDRI). SRM acknowledges the financial support from the Ramalingaswami Fellowship of the Department of Biotechnology, Government of India (BT/RLF/Re-entry/01/2017). The manuscript has a CDRI communication number 10041.

Kidney TNFSF Lligands mRNA Expression Profiling

241

References 1. Aggarwal BB (2003) Signalling pathways of the TNF superfamily: a double-edged sword. Nat Rev Immunol 3:745–756 2. Grewal IS (2009) Overview of TNF superfamily: a chest full of potential therapeutic targets. Adv Exp Med Biol 647:1–7 3. Sanchez-Nino MD, Benito-Martin A, Goncalves S et al (2010) TNF superfamily: a growing saga of kidney injury modulators. Mediat Inflamm 2010:182958 4. Mulay SR, Desai J, Kumar SV et al (2016) Cytotoxicity of crystals involves RIPK3MLKL-mediated necroptosis. Nat Commun 7:10274 5. Adachi T, Sugiyama N, Gondai T, Yagita H, Yokoyama T (2013) Blockade of death ligand TRAIL inhibits renal ischemia reperfusion injury. Acta Histochem Cytochem 46:161–170 6. Ryu M, Mulay SR, Miosge N, Gross O, Anders HJ (2012) Tumour necrosis factor-alpha drives Alport glomerulosclerosis in mice by promoting podocyte apoptosis. J Pathol 226:120–131

7. Han SS, Yang SH, Choi M et al (2016) The role of TNF superfamily member 13 in the progression of IgA nephropathy. J Am Soc Nephrol 27:3430–3439 8. Gomez IG, Roach AM, Nakagawa N et al (2016) TWEAK-Fn14 signaling activates myofibroblasts to drive progression of fibrotic kidney disease. J Am Soc Nephrol 27:3639–3652 9. Xin G, Cui Z, Su Y, Xu LX, Zhao MH, Li KS (2013) Serum BAFF and APRIL might be associated with disease activity and kidney damage in patients with anti-glomerular basement membrane disease. Nephrology 18:209–214 10. Sitrin J, Suto E, Wuster A et al (2017) The Ox40/Ox40 ligand pathway promotes pathogenic Th cell responses, Plasmablast accumulation, and lupus nephritis in NZB/W F1 mice. J Immunol 199:1238–1249 11. Devarapu SK, Grill JF, Xie J et al (2017) Tumor necrosis factor superfamily ligand mRNA expression profiles differ between humans and mice during homeostasis and between various murine kidney injuries. J Biomed Sci 24:77

Chapter 18 Analysis of Lymphotoxin Alpha Expression in Human Retina and Generation of Expression Vectors to Functional Characterization of Polymorphisms in the Tumor Necrosis Factor Locus Ricardo Usategui-Martı´n, Irene Rodriguez-Herna´ndez, Rogelio Gonza´lez-Sarmiento, Eva M. Sobas, Jose Carlos Pastor-Jimeno, and Salvador Pastor-Idoate Abstract With the evolution of new genomic sequencing technologies an important amount of genomic data has been provided. As a consequence of this, many gene polymorphisms have been shown to be significantly associated with different disorders. Many strategies have been implemented to reveal the role of having more than one allele at a specific locus and their involvement in the illnesses. Site-directed mutagenesis is one of the most common strategies to understand the regulatory regions of genes and the relationship between the protein structure and its function. Here, we describe the analysis of lymphotoxin alpha expression in human retina and the generation of expression vectors to functional characterization of polymorphisms in the tumor necrosis factor locus using pCEFL-Flag expression vector and transfection assays in COS-1 cell line. Key words Tumor necrosis factor, Lymphotoxin alpha, LTA, Retina, Functional characterization, Polymorphisms, Site-directed mutagenesis, Expression vectors and pCEFL-Flag

1

Introduction The identification of single-nucleotide polymorphisms (SNPs) has an important implication in human diseases. They may help to assess the genetic susceptibility for certain diseases, either as a causative factor, a protective factor, or as a biomarker of the disease [1, 2]. Lymphotoxin alpha (LTA) rs2229094 polymorphism is a nonsynonymous change located in the signal peptide of LTA gene, which results in a change from cysteine to arginine in codon 13 (p.cys13arg). While cysteine is a neutral hydrophobic amino acid, arginine is a hydrophilic, positively charged amino acid.

Jagadeesh Bayry (ed.), The TNF Superfamily: Methods and Protocols, Methods in Molecular Biology, vol. 2248, https://doi.org/10.1007/978-1-0716-1130-2_18, © Springer Science+Business Media, LLC, part of Springer Nature 2021

243

244

Ricardo Usategui-Martı´n et al.

TNFα and LTA polymorphisms are reported to be positively associated with retinal diseases [1, 3, 4]. However, to demonstrate that these SNPs that can be located in coding or noncoding regions of the genes are functional or associated with the risk of developing an illness, it is necessary to assess them in a simpler context using other molecular strategies. Functional analysis by site-directed mutagenesis is currently still a rapid and efficient technique employed to determine the potential involvement of the associated polymorphisms with the molecular changes associated to disease. It enables the understanding of the regulatory regions of genes and the relationship between the protein structure and its function [5, 6]. Single site-directed mutagenesis introduces mutation(s) into DNA sequences from plasmids using complementary oligonucleotides carrying the mutation of interest, either by polymerase chain reaction (PCR) or by restriction endonucleases digestion [7]. It is a one-step, easy, and direct method that generates mutant genes in about 25–50% of transformants in a low-cost and robust reaction [8]. Multiple sitedirected mutagenesis requires several cloning steps, which can be done simultaneously in the same reaction or obtained after several rounds. Each mutagenesis cycle involves various steps including PCR, restriction digestion with enzymes, and DNA chain extension [9]. Today, there are different expression vectors systems that can be used to carry foreign DNA fragments into mammalian cells for its expression. An expression vector must have element necessary for gene expression, including a promoter, the correct translation initiation sequence, and a transcription termination sequence [10]. Here, we describe functional characterization of rs2229094 polymorphism in the tumor necrosis factor locus could be efficiently investigated by using pCEFL-Flag expression vector (co-expressing the Flag epitope and either the full-length Arg13LTA or Cys13-LTA human cDNA) and transient transfection assays in the COS-1 kidney fibroblast cell line.

2

Materials 1. Trizol reagent (Invitrogen™). 2. NanoDrop (Thermo Scientific). 3. Chloroform. 4. RNase-free Water. 5. 100% Ethanol. 6. 70% Ethanol (in RNase-free H2O). 7. Improm-IITM Reverse Transcription System (Promega). 8. GoTaq Hot Start Polymerase (Promega).

Cloning, Site-Directed Mutagenesis and Tumor Necrosis Factor Locus

245

9. dNTPs: 400 μM. 10. MgCl2: 3 mM. 11. Flanking primers: Forward: 50 -ATGACACCACCTGAACGTCTC-30 . Reverse: 50 -CTACAGAGCGAAGGCTCCAA-30 . 12. Thermocycler. 13. TBE: 0.044 M Tris, 0.044 M boric acid, 1.0 mM EDTA, pH 8.3. 14. TBE 2% agarose gel: TBE buffer, 2 g agarose, 0.2–0.5 μg/mL ethidium bromide, final volume 100 mL. 15. Electrophoresis apparatus. 16. Ultraviolet (UV) light. 17. ABI Prism 3100 Genetic Analyzer (Applied Biosystems). 18. Plasmid vector pCEFL-Flag. 19. cDNA gene cloning primers containing EcoRI and NotI restriction sites: Forward: 50 -GAATTCACACCACCTGAACG-30 . Reverse: 50 -GCGGCCGCCTACAGAGCGAAGG-30 . 20. Primers for site-directed mutagenesis: Forward: 50 -CTCCCAAGGGTGTGTGGCACCACCC-30 . Reverse: 50 -GGGTGGTGCCACACACCCTTGGGAG-30 . 21. QIAquick PCR Purification Kit (Qiagen). 22. EcoRI restriction enzyme (Promega). 23. NotI restriction enzyme (Promega). 24. QIAquick Gel Extraction Kit (Qiagen). 25. T4 DNA Ligase (Promega). 26. Supercompetent cells: Escherichia coli DH5α. 27. Medium for growing the bacteria: 2xYT medium. 28. Shaker. 29. Transformation medium: 2xYT medium. 30. Rapid DNA plasmid miniprep kit (Genedan, S.L.). 31. QuikChange™ Site-Directed Mutagenesis Kit (Stratagene). 32. COS-1 monkey kidney fibroblast cell line. 33. Hek293T cells human kidney fibroblast cell line. 34. 6-well plate. 35. Complete Dulbecco’s Modified Eagle’s (DMEM) Medium: DMEM (Gibco, Invitrogen), 10% fetal bovine serum, 1% L-glutamine (Gibco, Invitrogen), 1% penicillin-streptomycin (Gibco, Invitrogen).

246

Ricardo Usategui-Martı´n et al.

36. X-tremeGENE HP DNA Transfection Reagent (Roche). 37. 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) (Sigma-Aldrich). 38. Flow cytometer.

3

Methods

3.1 LTA Gene Expression Analysis in Human Neuroretinas

1. Isolate the total RNA from postmortem human neuroretinas using Trizol reagent according to manufacturer protocol (see Note 1). 2. Determine the total RNA concentration by spectrophotometry on a NanoDrop (see Note 1). 3. Synthesize the complementary DNA (cDNA) using ImpromIITM Reverse Transcription System (Promega, Madison, WI, USA). The protocol is according to the manufacturer recommendations using 1 μg total RNA per reaction (see Note 1). 4. Amplify the LTA cDNA by PCR using 100 ng of cDNA, 400 μM of dNTPs, 3 mM of MgCl2, 50 U/mL of GoTaq Hot Start Polymerase, 0.5 μM of flanking primers and freenuclease water up to 25 μL and by following the protocol: denaturation at 94  C for 5 min, followed by 35 cycles of denaturation at 94  C for 30 s, annealing at 58  C for 30 s, and polymerization at 72  C for 1 min (see Note 2). 5. Isolate LTA PCR product from the rest of the products of the reaction. Purify LTA PCR product by using QIAquick PCR Purification Kit and follow the manufacturer instructions. 6. Separate the PCR products by electrophoresis in TBE 2% agarose gel. Visualize the DNA under ultraviolet (UV) light (see Notes 3 and 4) (Fig. 1). 7. Sequence the LTA PCR products to identify the different LTA rs2229094 polymorphism alleles (T>C) and the different LTA transcripts obtained from each sample. You can use an ABI Prism 3100 Genetic Analyzer.

3.2 LTA cDNA Gene Cloning and Site-Directed Mutagenesis

1. Amplify the LTA cDNA by PCR (see step 4, Subheading 3.1) using primers containing EcoRI and NotI restriction sites. Follow the same PCR conditions detailed under step 4, Subheading 3.1. 2. Separate the PCR products by electrophoresis in TBE 2% agarose gel. Visualize the DNA under ultraviolet (UV) light. LTA size is 618pb (see Notes 3 and 4). 3. Isolate LTA PCR product from the rest of the products of the reaction. Purify LTA PCR product by using QIAquick PCR Purification Kit and follow the manufacturer instructions.

Cloning, Site-Directed Mutagenesis and Tumor Necrosis Factor Locus

247

Fig. 1 Example of polymerase chain reaction (PCR) products of lymphotoxin alpha (LTA) gene cDNA detected by 2% agarose gel electrophoresis stained by ethidium bromide. In this case, it could be appreciating the presence of three alternative transcripts. As internal control, it was used the glyceraldehyde-3phosphate dehydrogenase (GADPH) gene amplification as expression level in each sample

4. Sequence the LTA PCR product to identify the different LTA rs2229094 polymorphism allele (T or C) and different LTA transcripts obtained. You can use an ABI Prism 3100 Genetic Analyzer. Select LTA allele C (LTA-C) PCR product. 5. Digest the DNA. Use EcoRI and NotI restriction enzymes to digest the LTA-C PCR product and the recipient plasmid (pCEFL-Flag (Fig. 2)) according to the manufacturer instructions. 10 U of restriction enzymes, Tango 1 buffer, and water up to final volume of 10 μL. The conditions of the digestion are 37  C for 6–8 h. 6. Separate the digest DNA products by electrophoresis in TBE 2% agarose gel. Visualize the DNA under ultraviolet (UV) light (see Notes 3 and 4). 7. Isolate the DNA insert (LTA-C) and the recipient plasmid by gel purification. Run the digest DNA (LTA-C insert and pCEFL-Flag plasmid) on a TBE 2% agarose gel and conduct a gel purification to isolate the DNA. You can use QIAquick Gel Extraction Kit and follow the manufacturer instructions (see Note 5). 8. To generate pCEFL-Flag-LTA-C construct, perform DNA ligation to fuse the LTA-C insert and pCEFL-Flag plasmid. It is ideal that the ratio of recipient plasmid-insert should be 1:3. The final concentration of the plasmid should be 50–100 ng. You can use T4 DNA Ligase according to the manufacturer instructions (see Note 6). 9. Transform 1–2 μL of ligation reaction into supercompetent cells (Escherichia coli DH5α) (see Notes 7 and 8). Mix 1–2 μL of ligation reaction into 20–50 μL of supercompetent cells on

248

Ricardo Usategui-Martı´n et al. (5622) ScaI 6000

AmpR promot er pR

Am

ori

tron A 1a in FLAG EF-

500 0

00 10

0 40

40

0

po

0o S V4 ly (

A)

sig n

al

N eo R

.

20 00

bGH ..

i

ri

or

SV

f1

ter mo pro lac

SP 6p rom ote

r

p.CEFL-Flag 6065 bp

HindIII (1494) Acc65I (1500) KpnI (1504) BamHI (1515) BglII (1548) EcoRI (1557) EcoRV (1569) NotI (1584) PspXI (1590) XbaI (1602)

r ote rom S V 40 p

/K a n R 3000

Fig. 2 pCEFL-Flag vector structure

ice for 45 min. Heat shock placing the tube into a 42  C for 45 s and put the tube back on ice for 2 min. Add 500 μL of 2xYT medium and grow in 37  C shaking incubator for an hour. Plate the transformation onto a 10 cm a 2xYT agar with ampicillin plate. Incubate overnight at 37  C. 10. To purify the finished construct, pick individual bacterial colonies for checking successful ligations. Pick 10-15 colonies and grow overnight cultures for DNA purification in a shaker at 37  C with 2xYT medium (see Note 9). For purifying the DNA, you can use the Rapid DNA plasmid miniprep kit according to the manufacturer instructions. 11. Check for the ligation in the purified DNA. Perform a diagnostic restriction digest of 200–300 ng of purified DNA with the restriction enzymes that were used for the cloning (EcoRI and NotI). Run the digested DNA on an agarose gel (see Note 10). You should verify the construct by automated sequencing. 12. Introduce the polymorphic substitution rs2229094 in pCEFLFlag-LTA-C with the QuikChange™ Site-Directed Mutagenesis Kit according to the manufacturer instructions using the site-directed mutagenesis primers to generate pCEFL-FlagLTA-T construct. 13. Repeat the steps 10–12.

Cloning, Site-Directed Mutagenesis and Tumor Necrosis Factor Locus

3.3 Cell Culture and DNA Transient Transfection

249

1. COS-1 monkey kidney fibroblast cell line is a good choice to conduct functional characterization of polymorphisms. Other option could be Hek293T cells human kidney fibroblast cell line. 2. Culture the cells in a 6-well plate with complete Dulbecco’s Modified Eagle’s Medium at 37  C in a humidified 5% CO2 atmosphere. 3. Transfect transiently the cells with 1–2 μg of total plasmid DNA (pCEFL-Flag-LTA-C or pCEFL-Flag-LTA-T) per well of 6-well plate with the 80% of cells confluence. You can use X-tremeGENE HP DNA Transfection Reagent at ratio 3:1 according to the manufacturer instructions (see Note 11).

3.4 Functional Characterization of Polymorphism

1. After 72 h of the DNA transient transfection, you can use transfected cell culture for the functional characterization of the polymorphism. 2. You can perform immunofluorescence assay to study the protein localization or western blot to analyze if the polymorphism modifies the protein expression. 3. To study if the polymorphism alters the cell viability, you can analyze the cellular metabolic function using MTT. 4. Other option is to analyze if the polymorphism modifies the cell cycle using flow cytometry.

4

Notes 1. The manipulation of total RNA should be done in ice. 2. The glyceraldehyde-3-phosphate dehydrogenase (GADPH) expression levels in each sample can be used as internal control using 50 -CCACCCATGGCAAATTCCATGGCA-30 (forward) and 50 -TCTAGACGGCAGGTCAGGTCCACC-30 (reverse) primers. 3. EtBr binds to the DNA and allows you to visualize the DNA under ultraviolet (UV) light EtBr is a known mutagen. Wear a lab coat, eye protection, and gloves when working with this chemical. 4. Use a DNA ladder (a collection of DNA fragments of known lengths). 5. It is important recovered DNA.

to

determine

the

concentration

of

6. It is important to set up negative control in parallel. A ligation of the recipient plasmid DNA without any insert will communicate you how much background you have of uncut or selfligating recipient plasmid backbone.

250

Ricardo Usategui-Martı´n et al.

7. For constructs with pCEFL-Flag vector, you have to use 2xYT medium plates with ampicillin. 8. The number of bacterial colonies resulting from your transformation (after overnight incubation) will give you the first indication as to whether your transformation worked. The plasmid-insert plate should have significantly more colonies than the negative control plate. The negative control plate will tell you the “background.” 9. For constructs with pCEFL-Flag vector you have to use medium with ampicillin. 10. You should see two bands, one the size of your vector and one the size of your insert. 11. The most plasmid DNA expression is after 72 h of the DNA transient transfection. References 1. Pastor-Idoate S, Rodrı´guez-Herna´ndez I, Rojas J et al (2017) Functional characterization of rs2229094 (T>C) polymorphism in the tumor necrosis factor locus and lymphotoxin alpha expression in human retina: the retina 4 project. Clin Ophthalmol 11:973–981 2. Clark AG (2004) The role of haplotypes in candidate gene studies. Genet Epidemiol 27:321–333 3. Rojas J, Fernandez I, Pastor JC et al (2010) A strong genetic association between the tumor necrosis factor locus and proliferative vitreoretinopathy: the retina 4 project. Ophthalmology 117:2417–2423 4. Rojas J, Fernandez I, Pastor JC et al (2013) A genetic case-control study confirms the implication of SMAD7 and TNF locus in the development of proliferative vitreoretinopathy. Invest Ophthalmol Vis Sci 54:1665–1678 5. Wu D, Guo X, Lu J, Sun X, Li F, Chen Y et al (2013) A rapid and efficient one-step sitedirected deletion, insertion, and substitution

mutagenesis protocol. Anal Biochem 15 (434):254–258 6. Liang X, Peng L, Li K, Peterson T, Katzen F (2012) A method for multi-site-directed mutagenesis based on homologous recombination. Anal Biochem 1(427):99–101 7. Costa GL, Bauer JC, McGowan B, Angert M, Weiner MP (1996) Site-directed mutagenesis using a rapid PCR-based method. Methods Mol Biol 57:239–248 8. Huang Y, Zhang L (2017) An in vitro singleprimer site-directed mutagenesis method for use in biotechnology. Methods Mol Biol 1498:375–383 9. Bhat KS (1996) Multiple site-directed mutagenesis. Methods Mol Biol 57:269–277 10. Old RW, Primrose SB (1981) Principles of gene manipulation: an introduction to genetic engineering. University of California Press, Berkeley

Chapter 19 Detection of TNF-α Protein in Extracellular Vesicles Derived from Tumor Cells by Western Blotting Tandressa Souza Berguetti, Raquel Ciuvalschi Maia, and Paloma Silva de Souza Abstract Detection of tumor necrosis factor-alpha (TNF-α) is usually performed in cell cultured medium or body fluids via measurement of its soluble extracellular form. However, depending on cellular condition, TNF-α might be transported through extracellular vesicles (EV) from donor cells to recipient cells. EV are small membrane-delimited structures (50 nm to 10 μm) that are spontaneously released from multiple cell types. In cancer, EV arise as important mediators in intercellular communication, and their molecular content may support tumor progression. This chapter describes methods to identify protein content in EV released from the tumor cell cultures. Through this protocol, we show first how to purify EV from in vitro cell culture by using differential centrifugation technique and then we demonstrate how to identify both membrane and soluble TNF-α forms in EV by Western blotting. Key words TNF-α, Extracellular vesicles, Western blotting, Differential centrifugation, Cancer

1

Introduction Extracellular vesicles (EV) are small, membrane-enclosed particles that are released by several cell types under physiological and pathological conditions. Based on EV biogenesis or secretory pathways, they are mainly classified as exosomes, membrane microparticles (MP), apoptotic bodies, or oncosomes [1]. Exosomes are nanosized EV, range approximately 50–100 nm in diameter, and are derived from membrane invagination of late endosomes within large multivesicular bodies [2, 3]. MP or microvesicles (MV) are small EV (200 nm to 1 μM in diameter), derived directly from plasma membrane budding upon release of intracellular Ca2+ [4]. Apoptotic bodies are subcellular vesicles ranging from 1 to 5 μm in diameter, which derive from membrane blebbing of cells undergoing apoptosis [5]. Lastly, oncosomes are uncommonly large EV (1–10 μM in diameter) originating from cancer cells, and mostly associated with advanced or metastatic phenotype

Jagadeesh Bayry (ed.), The TNF Superfamily: Methods and Protocols, Methods in Molecular Biology, vol. 2248, https://doi.org/10.1007/978-1-0716-1130-2_19, © Springer Science+Business Media, LLC, part of Springer Nature 2021

251

252

Tandressa Souza Berguetti et al.

[6, 7]. The role of EV in cancer progression is being comprehensively studied. EV released by tumor cells carry their molecular cargo and transfer the cargo to other cells in the microenvironment or distant sites. Other studies have demonstrated that cell–cell communication by EV also contributes to malignancy of normal cells, besides offering support to cancer maintenance [8]. Recently, our group demonstrated that tumor necrosis factoralpha (TNF-α) could be transferred from tumor cells to normal cells through MP. The cancer cells-derived MP induced a proliferative phenotype in fibroblast cells [9]. TNF-α is a cytokine that can be presented in two distinct forms: a 26 kDa membrane-bound precursor protein (tmTNF-α) and an 18 kDa cleavage soluble form (sTNF-α). Both forms are able to interact with TNF receptors (TNFR1 or TNFR2) to further activate inflammatory, apoptotic, or proliferative pathways [10, 11]. Several studies analyzed TNF-α function through its extracellular soluble form quantification using enzyme immunoassay. Nevertheless, by using Western blotting technique, Zhang et al. first identified tmTNF-α in exosomes secreted by primary synovial fibroblasts cells acquired from patients with rheumatoid arthritis [12]. In this chapter, we detail methods to efficiently identify both tmTNF-α and sTNF-α endogenous protein forms from cancer cells-derived MP. First, we describe MP purification by differential centrifugation from tumor cell lines cultures. Subsequently, we detail Western blot-based identification of TNF-α forms in MP contents that were obtained by protein extraction protocol.

2

Materials All solutions must be prepared using ultrapure water (double distilled water; 18 MΩ-cm at 25  C) and analytical grade reagents.

2.1 MP Purification and Lysate Sample Preparation

1. Cell culture medium: DMEM High Glucose (4.5 g/L). Add 1 mM sodium pyruvate, 2 mM L-glutamine, 100 U/mL penicillin/streptomycin, and 10% Fetal Bovine Serum (FBS). 2. Cell lines: parental KB-3-1 cell line, drug-resistant KB-C1 cell line. 3. Recombinant TNF-α (rTNF-α) (Sigma-Aldrich). 4. Sterile phosphate-buffered saline (PBS) pH 7.4. 5. Conical centrifuge tubes and microtubes. 6. Lysis buffer: 10 mM Tris–HCl, pH 8.0, 0.1% Triton X-100, 10 mM MgSO4, 2 mM CaCl2. Add 2 mM dithiothreitol (DTT), 20 μg/μL DNase I, and 1 protease and phosphatase inhibitors cocktail immediately before use.

TNF-α in Extracellular Vesicles

253

7. Loading buffer: 115 mM Tris–HCl, pH 6.8, 15% sodium dodecyl sulfate (SDS), 10% glycerol, 100 mM β-mercaptoethanol, 0.1% bromophenol blue, 12% SDS polyacrylamide gel. 8. Dry ice or liquid nitrogen. 2.2 SDS-Polyacrylamide Gel and Western Blotting

1. Resolving gel buffer: 6.4 mL H2O, 2.5 mL 1.5 M Tris–HCl pH 8.8, 4 mL 30% acrylamide and bis-acrylamide solution (29:1), 100 μL 10% SDS, 100 μL 10% ammonium persulfate (APS), 10 μL tetramethylethylenediamine (TEMED). 2. Stacking gel buffer: 3.7 mL H2O, 1.25 mL 0.5 M Tris–HCl pH 6.8, 830 μL 30% acrylamide and bis-acrylamide solution (29:1), 50 μL 10% SDS, 50 μL 10% APS, 10 μL TEMED. 3. Running buffer: 25 mM Tris–HCl, pH 8.3, 192 mM glycine, 0.1% SDS. 4. Transfer buffer: 25 mM Tris–HCl pH 8.3, 192 mM glycine, 20% methanol. 5. Tris-buffered saline (TBS): 10 mM Tris base, pH 7.4 (adjusted with HCl), 15 mM NaCl. 6. Blocking buffer: 5% low-fat milk in TBS-0.05% Tween. 7. Wash buffer: TBS-0.05% Tween. 8. Nitrocellulose membranes. 9. Rabbit monoclonal antibody, which recognizes tmTNF-α and sTNF-α (ex.: Cell Signaling, clone D1G2). 10. Anti-rabbit secondary antibody (ex.: Sigma-Aldrich, IgG Polyclonal). 11. Luminol-based chemiluminescent substrate for horseradish peroxidase detection.

2.3

Equipment

1. Refrigerated centrifuge. 2. Ultrasonic bath. 3. Dry heat bath. 4. Electrophoresis and blotting apparatus. 5. Basic power supply for gels electrophoresis and transferring. 6. Orbital lab shaker. 7. Gel imaging equipment.

3

Methods The MP purification method described below considered the parental KB-3-1 cell line and the drug-resistant KB-C1 cell line cultures as donor cells [13, 14]. To further identify tmTNF-α and

254

Tandressa Souza Berguetti et al.

sTNF-α in MP by Western blotting, previously, tumor cell cultures were incubated with recombinant TNF-α (rTNF-α) to induce endogenous TNF-α expression, as described by our group [9]. 3.1 Extracellular Vesicles Purification

1. At day 0, seed 2  105 adherent cells per well in 2 mL of culture medium using a 6-well plate. Consider plating cells in at least 2 wells per condition. 2. At day 1, remove all medium and wash the plate with sterile PBS. 3. Add new 2 mL of culture medium with 10 ng/mL of rTNF-α. Return plate to humidified incubator for 24 h. 4. At day 2, collect the supernatant in a clean conical centrifuge tube, then centrifuge at 2500  g for 10 min to pellet detached cells or cell debris. 5. Carefully transfer the supernatant to a new clean conical centrifuge tube. Avoid mixing the pellet. Centrifuge again at 2500  g for 10 min to pellet remaining cells or cell debris (see Note 1). 6. Carefully transfer the supernatant to a clean microtube and centrifuge at 16,000  g for 2 h 30 min at 4  C to pellet MP (see Note 2). 7. Remove the supernatant carefully. Do not disturb the pellet, which now contains the MP harvested from the sample. 8. Resuspend the pellet using cold sterile PBS (1 mL). Homogenize MP thoroughly by washing the inner wall of the microtube. This step must be performed on ice (see Note 3). 9. Centrifuge the sample again at 16,000  g for 2 h 30 min at 4  C to pellet the MP. 10. Discard all supernatant carefully, not disturbing the MP pellet (see Note 4) (Fig. 1).

3.2 Extracellular Vesicles Lysate Preparation

1. Resuspend MP pellet in 20 μL of lysis buffer. Add DTT, DNAse I, and protease and phosphatase inhibitors cocktail immediately before use (see Subheading 2.1). 2. Heat the sample at 37  C for 5 min and then quickly freeze it in dry ice or liquid nitrogen to induce a thermal shock (see Note 5). 3. Proceed to the sonication step in 3 cycles; 1 min in the ultrasonic bath (at room temperature) then 1 min on ice (see Note 6). 4. Add 10 μL of loading buffer and heat the sample at 37  C for 30 min.

TNF-α in Extracellular Vesicles

255

Fig. 1 Representative scheme of membrane microparticles (MP) purification protocol. MP were purified from tumor cell culture medium by using a sequential and differential centrifugation 3.3 SDS-PAGE and Protein Transfer Protocols

1. Run protein in 12% polyacrylamide gel until complete protein separation by using 150–200 V, constantly. Stop the electrophoresis process before protein sample leaves the gel (see Note 7). 2. Proceed to electrophoretic protein transfer to a nitrocellulose membrane. Perform the gel transfer for 2 h in 100 V constantly (see Note 8). 3. Wash the membrane with TBS to remove excess of methanol.

256

Tandressa Souza Berguetti et al.

Fig. 2 Tumor necrosis factor alpha (TNF-α) immunoblot analysis of membrane microparticles (MP) derived from cancer cell lines. KB-3-1 parental and KB-C1 resistant cell lines were first incubated with 10 ng/mL recombinant TNF-α (rTNFα) and then protein content of MP released in cell culture medium was analyzed by using Western blotting. Membrane TNF-α (mTNF-α); soluble TNF-α (sTNF-α); MP derived from KB-3-1 cells (3-1MP); MP derived from KB-C1 cells (C1MP)

4. Add blocking buffer enough to cover the membrane and shake for 1 h at room temperature. 5. Wash the membrane with wash buffer to remove all blocking buffer. 6. Incubate the membrane with anti-TNF-α specific primary antibody diluted 1:1000 in TBS-Tween 0.05%, overnight at 4  C. 7. Wash membrane with TBS-Tween 0.05% three times for 10 min each. 8. Incubate the membrane with secondary antibody diluted 1:30000 in TBS-Tween 0.05%, with agitation for 1 h at room temperature. 9. Wash membrane with TBS-Tween 0.05% three times for 10 min each. 10. Do the chemiluminescent detection to visualize protein bands. Please, use a long-exposure time in X-ray film or digital image system (Fig. 2).

4

Notes 1. The step 5 in Subheading 3.1 must be performed carefully to not disturb detached cells or cell debris pellet. At this point, MP are still in the supernatant fraction. 2. For step 6 in Subheading 3.1, it is recommended to use microtubes to avoid mass loss. Split the total volume of each sample (4 mL) in three or four microtubes. 3. For step 8 in Subheading 3.1, it is recommended to pool the resuspend MP pellets in a single microtube before the next

TNF-α in Extracellular Vesicles

257

centrifugation. For this, wash each microtube by using the same 1 mL cold sterile PBS for all microtubes. 4. It is important to remove the maximum supernatant volume to obtain a clear lysate. At this point, the MP sample can be stored at 80  C for a week. 5. At this point the samples can be stored at short time.

80  C for a

6. The protein sample can be quantified by using Lowry or Bradford protein assays. 7. All reagents were purchased from Bio-Rad Laboratories, Inc. for better compatibility with Bio-Rad’s Western blotting system. 8. We suggest performing the gel transfer protocol on ice by using wet-transfer technic.

Acknowledgements This work was supported by Conselho Nacional de Desenvolvimento Cientı´fico e Tecnolo´gico (CNPq-304565/2016-4). TSB was supported by Ministe´rio da Sau´de/INCA; PSS is supported by Coordenac¸˜ao de Aperfeic¸oamento de pessoal de Nı´vel Superior (PNPD/CAPES). References 1. Zaborowski MP, Balaj L, Breakefield XO et al (2015) Extracellular vesicles: composition, biological relevance, and methods of study. Bioscience 65:783–797 2. Sangiliyandi G, Min-Hee K, Muniyandi J et al (2019) Review of the isolation, characterization, biological function, and multifarious therapeutic approaches of exosomes. Cell 8:307 3. Zhang Y, Liu Y, Liu H et al (2019) Exosomes: biogenesis, biologic function and clinical potential. Cell Biosci 9:19 4. Souza PS, Faccion RS, Bernardo PS et al (2016) Membrane microparticles: shedding new light into cancer cell communication. J Cancer Res Clin Oncol 142:1395–1406 5. Caruso S, Poon IKH (2018) Apoptotic cellderived extracellular vesicles: more than just debris. Front Immunol 9:1486 6. Al-Nedawi K, Meehan B, Micallef J et al (2008) Intercellular transfer of the oncogenic receptor EGFRvIII by microvesicles derived from tumour cells. Nat Cell Biol 10:619–624 7. Minciacchi VR, You S, Spinelli C et al (2015) Large oncosomes contain distinct protein

cargo and represent a separate functional class of tumor-derived extracellular vesicles. Oncotarget 6:11327–11341 8. Becker A, Thakur BK, Weiss JM et al (2016) Extracellular vesicles in cancer: cell-to-cell mediators of metastasis. Cancer Cell 30:836–848 9. Berguetti T, Quintaes LSP, Hancio T et al (2019) TNF-α modulates P-glycoprotein expression and contributes to cellular proliferation via extracellular vesicles. Cell 8:500 10. Sun M, Fink PJ (2007) A new class of reverse signaling costimulators belongs to the TNF family. J Immunol 179:4307–4312 11. Qu Y, Zhao G, Li H (2017) Forward and reverse signaling mediated by transmembrane tumor necrosis factor-alpha and TNF receptor 2: potential roles in an immunosuppressive tumor microenvironment. Front Immunol 8:1675 12. Zhang HG, Liu C, Su K et al (2006) A membrane form of TNF-alpha presented by exosomes delays T cell activation-induced cell death. J Immunol 176:7385–7393

258

Tandressa Souza Berguetti et al.

13. Shen DW, Cardarelli C, Hwang J et al (1986) Multiple drug-resistant human KB carcinoma cells independently selected for high-level resistance to colchicine, adriamycin, or vinblastine show changes in expression of specific proteins. J Biol Chem 261:7762–7770

14. Souza PS, Cruz AL, Viola JP et al (2015) Microparticles induce multifactorial resistance through oncogenic pathways independently of cancer cell type. Cancer Sci 106:60–68

Chapter 20 Expression of TNFRs by B and T Lymphocytes in Tumor-Draining Lymph Nodes Atri Ghods, Abbas Ghaderi, and Fereshteh Mehdipour Abstract Tumor necrosis factor alpha (TNF-α) has crucial roles in the induction or inhibition of various biological activities in immune and nonimmune cells. This cytokine mainly exerts its effects via two receptors named TNFR1 (CD120a) and TNFR2 (CD120b). Both B and T cells express TNFRs; however, opposing roles have been reported for TNF-α in the adaptive immunity. Lymph nodes (LNs), as the secondary lymphoid organs, are one of the major places for the formation of immune responses against cancer. In this chapter, we explain the procedure as to how to isolate mononuclear cells from tumor-draining lymph nodes. In addition, we describe the process of surface staining with fluorochrome-conjugated antibodies for the assessment of the TNFRs expression by CD3+, CD3+CD4+, CD3+CD8+, and CD19+ lymphocytes by flow cytometry. Key words TNFR1, TNFR2, Tumor-draining lymph node, B cell, T cell, Lymphocytes isolation, Surface staining, Antibody, Flow cytometry

1

Introduction Tumor necrosis factor alpha receptor 1 and 2 (TNFR1&2), which are known as CD120a (p55) and CD120b (p75), are the receptors of the pleotropic cytokine, TNF-α [1]. In general, TNFR1 is involved in the pro-inflammatory activities of TNF-α and also can cause apoptosis [2], while TNFR2 signaling can promote cell activation and proliferation but does not induce direct cell death due to lack of the death domain [3]. Lymph nodes (LNs) are secondary lymphoid organs consisting mainly of B and T lymphocytes [4]. Tumor-draining LNs (TDLNs) are usually the first place where the adaptive immune responses are initiated against tumors [5]. Therefore, investigation of the phenotype and functions of lymphocytes in TDLNs can be a useful approach to understand the role of the immune system in cancer [6–9].

Jagadeesh Bayry (ed.), The TNF Superfamily: Methods and Protocols, Methods in Molecular Biology, vol. 2248, https://doi.org/10.1007/978-1-0716-1130-2_20, © Springer Science+Business Media, LLC, part of Springer Nature 2021

259

260

Atri Ghods et al.

Flow cytometry is one of the popular techniques which has been used to assess the expression of different molecules by various cell types. Flow cytometry is an immunology-based technique with a wide range of applications from research to clinic [10]. This high throughput method is used to assess different characteristics of a single cell/particle and provides detailed information about cell populations in a short period of time [11]. Nowadays, flow cytometry is performed for many qualitative and quantitative applications including cell phenotyping, detection of surface and intracellular markers, apoptosis and cell cycle analysis, cancer therapy monitoring, and disease diagnosis [12, 13]. A flow cytometer works on the basis of scattering lights from a single cell flowing through a laser beam, which can provide data about the size and granularity of a single cell. In addition, cells can be stained with antibodies which recognize surface or intracellular antigens. In “direct staining,” this antibody is conjugated to a fluorochrome. Fluorescence emissions from these fluorochromes are detected by a flow cytometer, providing information about each cell’s surface/ intracellular markers [13]. In some cases, the first antibody is not conjugated with a fluorochrome, and a secondary fluorochromeconjugated antibody which recognizes the Fc part of the primary antibody is used, a process called “indirect staining” [14]. Flow cytometry-based analysis has the advantage of assessing the expression of TNFRs at the protein level compared with quantitative realtime PCR which provides data about the expression of these molecules at the mRNA level. Besides, to assess the expression of TNFRs in different lymphocytes subsets with real time PCR, it is required to isolate each subset with purity >90%, which imposes extra cost and effort. In addition, flow cytometry analysis can provide more accurate quantitative data with a higher sensitivity compared with the data obtained from immunohistochemistry (IHC). In this chapter, we first explain the steps on how to isolate mononuclear cells from LNs. Then, we describe the cell surface direct staining protocol in order to evaluate the expression of TNFR1 and TNFR2 on B and T lymphocytes.

2

Materials 1. Roswell Park Memorial Institute-1640 (RPMI-1640). 2. Fetal Bovine Serum (FBS) (see Note 1). 3. 100 Penicillin–Streptomycin (Pen-Strep 100): 10,000 Units/mL penicillin, 10,000 units/mL streptomycin. 4. Complete Culture Medium: RPMI-1640, 10% FBS, 1% 100 Pen–Strep.

TNFRs in Tumor-Draining Lymph Nodes

261

5. Ficoll-Hypaque: Ficoll PM400, sodium diatrizoate, disodium calcium EDTA (see Note 2). 6. Tools for mechanical disruption of lymph node samples: Scalpel, Thumb Forceps, Sterile 60  15 mm Petri Dishes. 7. 40 μm Cell Strainers. 8. 50 and 15 mL Conical Centrifuge Tubes. 9. Pasteur Pipette. 10. Hemocytometer Chamber and Coverslip, or Automated Cell Counter. 11. Microcentrifuge Tubes. 12. Refrigerated Centrifuge. 13. 0.4% Trypan Blue Solution. 14. 1 Phosphate Buffered Saline (PBS): 8.00 g NaCl, 0.20 g KCl, 1.78 g Na2HPO4·2H2O, 0.24 g KH2PO4. Dissolve them thoroughly in 1 L of distilled water on a magnetic stirrer. pH should be adjusted to 7.2–7.4 using HCl or NaOH solution. Filter the solution through a quantitative filter paper, and sterilize the PBS solution using autoclave (20 min at 15 psi (1.05 kg/cm2), 121  C on liquid cycle) (see Note 3). 15. Staining Buffer: 1 PBS, 2% FBS. Add 2 mL of FBS into a sterile bottle and adjust the final volume to 100 mL with 1 PBS. Store at 4  C (see Note 4). 16. Cell Fix Solution: 1% paraformaldehyde, 0.1% sodium azide. Add 1 g of paraformaldehyde and 0.1 g of sodium azide into 100 mL of sterile PBS (pH 7.2–7.4). To prepare a soft homogenous cell fix solution, incubate the glass containing the mixture in a 60  C water bath for about 1 h to let paraformaldehyde completely dissolves in PBS. After that, let the solution to cool at room temperature and adjust the pH, preferentially, to 7.2–7.3 using HCl or NaOH solution. Filter the solution through a 0.45 μm syringe filter. Store it at 4  C (see Notes 5 and 6). 17. Flow Cytometry Tubes. 18. Flow Cytometry Antibodies: Fluorochrome-conjugated antihuman CD120a (TNFR1) antibody, antihuman CD120b (TNFR2) antibody, antihuman CD19 antibody, antihuman CD4 antibody, antihuman CD8a antibody, antihuman CD3 antibody, and isotype control antibodies selected according to the isotype and the conjugated fluorochrome of the aforementioned antibodies. 19. A Flow Cytometer device. 20. FlowJo Software or other flow cytometry data analysis software like Cell Quest™ Pro.

262

Atri Ghods et al.

Fig. 1 The lymph node sample is minced into small pieces in the complete culture medium using scalpel and thumb forceps in a sterile 60  15 mm petri dish

3

Methods

3.1 Mononuclear Cells Isolation from Lymph Node

The following procedures should be done under a sterile condition using class II laminar flow hood with HEPA filter, unless otherwise specified. 1. Prepare 100 mL of the complete culture medium in a sterile bottle. Keep the prepared complete culture medium at 37  C during the following processes. 2. Mechanically crush the LN into small pieces in the complete culture medium using scalpel and thumb forceps in a sterile 60  15 mm petri dish (Fig. 1) (see Notes 7–9). 3. To exclude tissue debris or large particles, pass the cell suspension through a 40 μm cell filter (strainer) in a 50 mL centrifuge tube (Fig. 2). 4. Add 5 mL of Ficoll-Hypaque into a conical centrifuge tube, and gently overlay the filtered cell suspension using Pasteur pipette. Be careful not to mix the two phases (the FicollHypaque: cell suspension proportion is 1:1) (see Note 10). 5. Centrifuge over Ficoll-Hypaque gradient at 600  g, 24  C for 15 min. In this step, the deceleration rate of the centrifuge should be zero (see Note 11). 6. You can see a white colored ring at the interface of FicollHypaque and culture medium. This white ring mostly consists of mononuclear cells (Fig. 3). Draw off the ring carefully while try not to disturb other phases. Pour the cells to a conical centrifuge tube containing at least 5 mL of the complete culture medium.

TNFRs in Tumor-Draining Lymph Nodes

263

Fig. 2 The cell suspension is filtered through a 40 μm cell strainer in a 50 mL centrifuge tube

7. Add the complete culture medium to the tube containing cells to reach the final volume of about 20 mL. 8. Centrifuge the cell suspension twice at 520  g at 24  C for 10 min. Discard the supernatant and suspend the pellet in 15 mL of the complete culture medium. 9. Resuspend the mononuclear cells in 3–10 mL of the complete culture medium (depending on the relative number of the isolated cells), check their viability, and determine the cells number. 10. Check the viability of isolated mononuclear cells by trypan blue dye exclusion test. Mix 10 μL of cell suspension with 10 μL of trypan blue dye (1:1 ratio) in a microcentrifuge tube. Then load 10 μL of the prepared mixture between the hemocytometer chamber and the coverslip. As trypan blue dye enters nonviable cells, these cells will stain blue, whereas viable cells remain unstained and look shiny while observing them under the microscope. Samples with viability less than 90% are not appropriate. 11. Determine the number of unstained, viable mononuclear cells in each square at the corner of the hemocytometer chamber and estimate the average cells count in these squares. In order to estimate the number of cells in each mL of the cell suspension, use this formula: (the average cells count  2  104).

264

Atri Ghods et al.

Fig. 3 Mononuclear cells isolation after centrifugation of the cell suspension over Ficoll-Hypaque gradient. The white ring at the interface of Ficoll-Hypaque and the culture medium consists mostly of mononuclear cells. This ring should be collected thoroughly

There is no need to perform steps 10 and 11 in a sterile condition. 12. Keep cells for 1–2 h in the complete culture medium in a culture flask in the incubator at 37  C with 5% CO2. This is helpful to exclude monocytes and macrophages from the lymphocytes (see Notes 12 and 13). 3.2 Cell Surface Staining

There is no need to perform the following steps in a sterile condition. 1. Harvest the mononuclear cells and centrifuge them (300  g at 18–20  C for 10 min). 2. Discard the supernatant and resuspend the mononuclear cells in an appropriate amount of the complete culture medium (depending on the relative number of the cells). 3. Perform trypan blue dye exclusion test to count cells and check their viability (see step 10, Subheading 3.1).

TNFRs in Tumor-Draining Lymph Nodes

265

4. Determine the number of cells needed for following steps and add cells into a centrifuge tube (see Note 14). 5. Wash the cells with at least 10 mL of the staining buffer (520  g, 4–8  C for 10 min). 6. Carefully discard the supernatant and resuspend the pellet in the residual amount of the staining buffer. 7. Add an appropriate amount of the staining buffer into the tube in order that each 100 μL of the staining buffer contains 1  106 cells. 8. Vortex thoroughly. 9. Label the flow cytometry tubes including unlabeled, isotype control and test tubes according to the predetermined panel designed for the test. 10. Aliquot 100 μL of the cell suspension into each flow cytometry tube. 11. Add predetermined amounts (according to the manufacturer’s instructions) of anti-CD19, anti-CD4, anti-CD8, anti-CD3, anti-TNFR1, anti-TNFR2, and their associated isotype control antibodies into their related tubes (see Notes 15 and 16). 12. Vortex the tubes. 13. Incubate tubes at 4  C for 30 min in dark. 14. Wash twice with 2 mL of the staining buffer (500  g at 4  C for 5 min). After centrifugation, the supernatant should be discarded carefully to prevent cell loss. 15. Add 400 μL of PBS into each tube and vortex gently (see Note 17). 3.3 Flow Cytometry Data Acquisition and Analysis

1. Acquire cells on the flow cytometer. To make sure of the reliability of your data, for each tube, 2  105 events should be acquired on the flow cytometer. 2. Analyze raw flow cytometry data by one of the suggested software (as mentioned in the section 2). First, use forward and side scatters to determine lymphocytes gate. Gate CD19+, CD4+, CD8+, and CD3+ cells and go on to the next step (Fig. 4a, b). Assess the percentages of the cells expressing TNFR1 and TNFR2 in each gate using the guide of isotype or Fluorescence Minus One (FMO) controls (Fig. 5).

266

Atri Ghods et al.

Fig. 4 Gating strategy for flow cytometry analysis using FlowJo software (version 7.6.2). (a) According to the forward and side scatters, lymphocytes are gated. (b) The population of CD3+, CD3+CD4+, CD3+CD8+, and CD19+ cells are gated for the following analysis

Fig. 5 The percentages of TNFR2+ cells in (a) CD3+, (b) CD3+CD4+, (c) CD3+CD8+, and (d) CD19+ lymphocytes are assessed. In each figure, the first flow cytometry plot is representative of fluorescence minus one (FMO) control which is used as a guide to distinguish the positive and negative populations

4

Notes 1. FBS should be incubated for 30 min in a 56  C water bath for heat inactivation of the complement proteins. 2. Ficoll-Hypaque is a lymphocyte isolation medium with a special density optimized for mononuclear cells isolation. It should be

TNFRs in Tumor-Draining Lymph Nodes

267

protected from direct light because sodium diatrizoate is light sensitive. 3. If you want to prepare 1 PBS using Na2HPO4·12H2O, 3.58 g of this powder is required. 4. PBS and FBS used for making the staining buffer are better to be sterile, but there is no need to work in a sterile condition. 5. Although the PBS used for making the cell fix solution must be sterile, there is no need to perform other steps in a sterile condition. 6. The cell fix solution can be prepared in larger amounts and aliquoted for further usage. It should be stored at 20  C and used up to 1 month. 7. After the excision of axillary LNs by the surgeon, they should not be transferred to formalin; instead, they should be received by a pathologist in the fresh form. The pathologist cuts a part of a LN, transfers it to the complete culture medium. The remaining part of that LN along with other LNs are transferred to formalin for routine pathological examinations. 8. A fresh part of a LN should be transferred to the lab in a sterile tube containing 5 mL of the complete culture medium. LN samples can be kept in this condition for about 1 day in 4  C. 9. To ensure optimal results, isolate mononuclear cells from LNs as soon as possible. However, the critical point is that if you want to compare the results of different samples, the time interval between the excision of the LN sample and isolation of the mononuclear cells should be always the same. 10. Ficoll-Hypaque should be used at room temperature; therefore, it is recommended to let it reach the room temperature before use. 11. You may need to use a different relative centrifuge force (RCF or g) and time duration according to the type of your centrifuge to obtain the optimum result. 12. RPMI-1640 has sodium bicarbonate buffering system (2.0 g/ L), hence it requires 5–10% CO2 environment in order to maintain its physiological pH. 13. The size of culture flasks and the volume of the medium used are determined based on the number of isolated cells. If the cells are