PCR: Methods and Protocols (Methods in Molecular Biology, 2967) [2nd ed. 2023] 1071633570, 9781071633571

Table of contents :
Preface
Contents
Contributors
Chapter 1: Digital PCR: A Partitioning-Based Application for Detection and Surveillance of SARS-CoV-2 from Sewage Samples
1 Introduction
2 Materials
2.1 Wastewater Sample Collection
2.2 Filtration, Centrifugation, and Precipitation
2.3 RNA Extraction from Concentrated Pellet
2.4 Primer and Probe Design for Digital PCR
2.5 Digital PCR Mix Preparation
2.6 Software Setup and Thermal Cycling Conditions
3 Methods
3.1 Wastewater Sample Collection
3.2 Filtration, Centrifugation, and Precipitation
3.3 RNA Extraction from Concentrated Pellet
3.4 Primer and Probe for Digital PCR
3.5 Digital PCR Mix Preparation for Wastewater Samples
3.6 Software Setup and Thermal Cycling Conditions
3.7 Result Interpretation and Data Analysis
4 Notes
References
Chapter 2: Digital PCR: A Tool to Authenticate Herbal Products and Spices
1 Introduction
2 Materials
2.1 Preparation of Blended Formulations
2.2 DNA Extraction, Quantification, and Dilution
2.3 Primer Dilution
2.4 Preparation of Reaction Mixture
3 Methods
3.1 Preparation of Blended Formulations
3.2 DNA Extraction, Quantification, and Dilution
3.3 Digital PCR Setup
3.4 PCR Thermal Cycle and Run Set Up in QIAcuity Digital PCR System
3.5 Data Collection and Analysis
4 Notes
References
Chapter 3: Emulsion Polymerase Chain Reaction Coupled with Denaturing Gradient Gel Electrophoresis for Microbial Diversity Stu...
1 Introduction
2 Materials
2.1 DNA Extraction
2.2 PCR Amplification
2.3 Droplet Generator
2.4 Emulsion PCR
2.5 Polyacrylamide Gel-DGGE
3 Methods
3.1 DNA Extraction
3.2 Emulsion PCR Amplification
3.3 Emulsion PCR-DGGE
3.3.1 Preparation of Polyacrylamide Gel for DGGE Analysis
3.3.2 Assembling the D-Code (Gel Running) System
3.3.3 Loading the Gel
3.3.4 Staining and Imaging the Gel
4 Notes
References
Chapter 4: Real-Time PCR High-Resolution Melting Assays for the Detection of Foodborne Pathogens
1 Introduction
2 Materials
2.1 DNA Purification
2.2 PCR
3 Methods
3.1 Primer Design
3.2 Real-Time PCR
4 Notes
References
Chapter 5: High-Throughput Real-Time qPCR and High-Resolution Melting (HRM) Assay for Fungal Detection in Plant Matrices
1 Introduction
2 Materials
3 Methods
3.1 qPCR
3.1.1 Experimental Design of qPCR
3.1.2 Standard Curve Design
3.1.3 Quantitative PCR Assay
3.2 High-Resolution Melting
4 Notes
References
Chapter 6: Multiplex Real-Time PCR for the Detection of Shiga Toxin-Producing Escherichia coli in Foods
1 Introduction
2 Materials
2.1 Media (See Note 1)
2.2 Chemicals
2.3 Equipment
3 Methods
3.1 Bacterial Enrichment
3.2 DNA extraction (see Note 3)
3.3 DNA Quantification
3.4 STEC Multiplex qPCR Assay
4 Notes
References
Chapter 7: DNA Isolation from Cocoa-Derived Products and Cocoa Authentication by TaqMan Real-Time PCR
1 Introduction
2 Materials
2.1 General Supplies
2.2 DNA Extraction
2.3 Real-Time PCR
3 Methods
3.1 DNA Extraction
3.2 TaqMan Real-Time PCR
3.3 Thermocycling
3.4 Program and Run
3.5 Data Collection and Analysis
4 Notes
References
Chapter 8: Quantitative Real-Time PCR for the Detection of Allergenic Species in Foods
1 Introduction
2 Materials
2.1 Bioinformatic Tools
2.2 Reagents
2.3 Equipment
3 Methods
3.1 In Silico Analysis
3.2 Preparation of Model Foods
3.3 DNA Extraction
3.4 Determination of DNA Yield and Purity
3.5 Qualitative PCR
3.6 DNA Sequencing
3.7 Real-Time PCR with Hydrolysis Probe
3.8 Real-Time PCR Validation
4 Notes
References
Chapter 9: Accurate Absolute Quantification of Bacterial Populations in Mixed Cultures by qPCR
1 Introduction
2 Materials
2.1 Culture Media and Bacterial Species
2.2 Genomic DNA Extraction
2.3 qPCR Material
3 Methods
3.1 Preparation of Bacterial Cultures for gDNA Calibration Curves
3.2 gDNA Extraction Using a Commercial Kit
3.3 qPCR Efficiency
3.4 qPCR Calibration Curve Construction for Each Target Species
3.5 Absolute Quantification of Bacterial Species Concentration in Polymicrobial Samples
4 Notes
References
Chapter 10: Real-Time PCR Method for Assessment of ParA-Mediated Recombination Efficiency in Minicircle Production
1 Introduction
2 Materials
2.1 Recombination Efficiency Determination
2.2 Agarose Gel Electrophoresis
3 Methods
3.1 Primer Design
3.2 Calibration Curves Preparation
3.3 Determination of Recombination Efficiency
4 Notes
References
Chapter 11: Gene Expression Quantification from Pathogenic Bacterial Biofilms by Quantitative PCR
1 Introduction
2 Materials
2.1 Sample Collection and RNA Isolation
2.2 DNase Treatment
2.3 RNA Quality Assessment
2.4 Complementary DNA Synthesis
2.5 Quantitative PCR
3 Methods
3.1 Sample Collection
3.2 RNA Isolation
3.3 Genomic DNA Degradation/Removal
3.4 RNA Quality Assessment
3.4.1 RNA Quantity and Purity
3.4.2 RNA Integrity
3.5 Complementary DNA Synthesis
3.6 Quantitative PCR Run
4 Notes
References
Chapter 12: A Real-Time Quantitative PCR Protocol for the Quantification of Plasmid Copy Number in Lactococcus lactis
1 Introduction
2 Materials
2.1 L. lactis PCN Determination by Real-Time Quantitative PCR
3 Methods
3.1 L. lactis PCN Determination by Real-Time Quantitative PCR
4 Notes
References
Chapter 13: Improved PCR by the Use of Disruptors, a New Class of Oligonucleotide Reagents
1 Introduction
2 Materials
2.1 PCR
2.2 Agarose Gel Electrophoresis
3 Methods
3.1 Secondary Structure Prediction of Amplicon Sequence
3.2 Disruptor Design
3.3 PCR
3.4 Result Analysis
4 Notes
References
Chapter 14: Mitochondrial DNA D-Loop Amplification and Sequencing for Species Differentiation in Milk
1 Introduction
2 Materials
2.1 Equipment
2.2 Supplies and Reagents
3 Methods
3.1 Total DNA Extraction in Milk
3.2 PCR Amplification of Mitochondrial D-Loop DNA
3.3 Validation
4 Notes
References
Chapter 15: Long-Range Polymerase Chain Reaction
1 Introduction
2 Materials
2.1 PCR
2.2 Agarose Gel Electrophoresis
3 Methods
3.1 Primer Design
3.1.1 Obtaining Reference Sequence
3.1.2 Obtaining Specific Primer Sequences (Fig. 2 (See Note 12))
3.2 PCR
3.3 Agarose Gel Electrophoresis (See Note 19)
4 Notes
References
Chapter 16: Megaprimer-Based PCR to Synthesize Fusion Genes for Cloning
1 Introduction
2 Materials
2.1 Equipment
2.2 Supplies and Reagents
3 Methods
3.1 Primer Design
3.2 Double-Step Primer Extension PCR: Case Study 1
3.3 Standard PCR: Case Study 2
3.4 Vector Cloning and Confirmation of the Fusion Genes´ Sequence
4 Notes
References
Chapter 17: Bacteria and Yeast Colony PCR
1 Introduction
1.1 DNA Release
1.2 Future Developments
2 Materials
2.1 E. coli Colony PCR
2.2 S. cerevisiae Colony PCR Using a Microwave Oven
2.3 PCR Using S. cerevisiae LiAc Permeabilized Cells
3 Methods
3.1 E. coli Colony PCR
3.2 S. cerevisiae Colony PCR Using a Microwave Oven
3.3 PCR Using S. cerevisiae LiAc Permeabilized Cells
4 Notes
References
Chapter 18: Inverse PCR for Site-Directed Mutagenesis
1 Introduction
2 Materials
2.1 iPCR Mutant Amplification
2.2 Agarose Gel Electrophoresis
2.3 Template Removal and Product Recircularization
2.4 Preparation of Chemically Competent E. coli XL1-Blue
2.5 Transformation
2.6 Mutant Confirmation
3 Methods
3.1 iPCR Mutant Amplification
3.2 Template Removal and Product Recircularization
3.3 Transformation and Mutant Confirmation
4 Notes
References
Chapter 19: Optimized Design of Degenerate Primers for PCR Based on DNA or Protein Sequence Comparisons
1 Introduction
2 Materials
2.1 Sequence Manipulation and Primer Design
2.2 PCR, Gel Electrophoresis, and Image Acquisition
2.3 Reagents
3 Methods
3.1 Primer Design from Protein Family Alignment: Reduction of 5′-End Complexity
3.2 Primer Design from DNA Alignment (I): Reduction of Specificity by Degeneration of 5′-End
3.3 Primer Design from DNA Alignment (II): Reduction of Degeneration by Sequence Clustering
3.4 Protocol for Protein or DNA Sequence Analysis
3.5 PCR
3.6 Thermocycling
3.7 Gel Analysis
4 Notes
Bibliography
Index

Citation preview

Methods in Molecular Biology 2967

Lucília Domingues  Editor

PCR

Methods and Protocols Second Edition

METHODS

IN

MOLECULAR BIOLOGY

Series Editor John M. Walker School of Life and Medical Sciences University of Hertfordshire Hatfield, Hertfordshire, UK

For further volumes: http://www.springer.com/series/7651

For over 35 years, biological scientists have come to rely on the research protocols and methodologies in the critically acclaimed Methods in Molecular Biology series. The series was the first to introduce the step-by-step protocols approach that has become the standard in all biomedical protocol publishing. Each protocol is provided in readily-reproducible step-by step fashion, opening with an introductory overview, a list of the materials and reagents needed to complete the experiment, and followed by a detailed procedure that is supported with a helpful notes section offering tips and tricks of the trade as well as troubleshooting advice. These hallmark features were introduced by series editor Dr. John Walker and constitute the key ingredient in each and every volume of the Methods in Molecular Biology series. Tested and trusted, comprehensive and reliable, all protocols from the series are indexed in PubMed.

PCR Methods and Protocols Second Edition

Edited by

Lucília Domingues CEB - Centre of Biological Engineering, University of Minho, Braga, Portugal

Editor Lucı´lia Domingues CEB - Centre of Biological Engineering University of Minho Braga, Portugal

ISSN 1064-3745 ISSN 1940-6029 (electronic) Methods in Molecular Biology ISBN 978-1-0716-3357-1 ISBN 978-1-0716-3358-8 (eBook) https://doi.org/10.1007/978-1-0716-3358-8 © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023 This work is subject to copyright. All rights are solely and exclusively licensed by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Cover illustration by Carlos E. Costa (CEB – Centre of Biological Engineering, University of Minho). This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer Nature. The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.

Preface With 40 years since its official discovery and 51 years since its theoretical proposition, the polymerase chain reaction (PCR) has revolutionized the fields of biotechnology, medicine, food microbiology, environmental microbiology, industry, and science, in general. The concept is so perfectly simple that the elemental scheme remains unchanged since its foundation. There are very few inventions that can compete with the importance of PCR. PCR is still today a fundamental tool in current scientific research and its importance has been recently disclosed to the general public with its widespread use during the COVID-19 pandemic that began in 2019. Being such a relevant technique with wide-range applications, significant literature exists on the basics of PCR. Still, the specificities for its application in diverse areas of the biotechnology and bioengineering field are mostly dispersed and are preferentially found in the health area. PCR is a powerful and flexible tool in modern biotechnology and the continued development of this technology is still expanding its wide range of applications. This new edition of PCR Methods and Protocols maintains the focus of the first edition on PCR application specificities to the biotechnology and bioengineering field with updated content on recently developed cutting-edge methodologies and novel applications. While the previous edition almost exclusively covered end-point PCR, this volume is balanced with real-time PCR and with fresh applications in the biotechnology and bioengineering field, in particular in the food sector, in which a growing trend for the use of this technology is observed. Topics such as detection of foodborne microbial contaminants, toxins, and allergens are included as well as food authentication. Two protocols involving highresolution melting assays are illustrated for the detection of foodborne pathogens and fungi detection in plant matrices. Relevant applications in biotechnology are emphasized with protocols for accurate absolute quantification of bacterial populations in mixed cultures and for gene expression quantification from pathogenic bacterial biofilms. Applications in synthetic biology for the assessment of recombination efficiency in minicircle production and quantification of plasmid copy number are also included. More recently developed PCR techniques like digital PCR protocols were incorporated in this new edition highlighting the applications for SARS-Cov-2 detection and surveillance from sewage samples and food herbal spices and products authentication. Emulsion PCR coupled with denaturing gradient gel electrophoresis is described in the context of microbial diversity studies. New developments for end-point PCR like the use of disruptors for PCR improvement are included as well as novel applications such as the use of mitochondrial DNA D-loop amplification and sequencing for species differentiation in milk. Highly used end-point PCR applications from the previous edition were kept and updated like long fragment PCR and megaprimer applications in the synthesis of fusion genes, colony PCR, inverse PCR for site-directed mutagenesis, and degenerate PCR. It is amazing as such a straightforward methodology like PCR has evolved and expanded its applications over 40 years. The ongoing development of PCR technology has enabled PCR to continue to play an indispensable role in the biotechnology and bioengineering field. The trend is the development of new PCR technologies and applications with digitali-

v

vi

Preface

zation, accessibility, and adaptability to different settings and contexts, contributing to further streamlined analyses while maintaining and improving the sensitivity and specificity required for PCR’s wide range of applications. This book aims to contribute to a current update of the dynamic field of PCR-dependent methods and, thus, to be a valuable, indispensable, and useful resource to wet-lab researchers, particularly within the biotechnology and bioengineering field. Braga, Portugal

Lucı´lia Domingues

Contents Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

v ix

1 Digital PCR: A Partitioning-Based Application for Detection and Surveillance of SARS-CoV-2 from Sewage Samples. . . . . . . . . . . . . . . . . . . . . . 1 Bhumika Prajapati, Dalipsingh Rathore, Chaitanya Joshi, and Madhvi Joshi 2 Digital PCR: A Tool to Authenticate Herbal Products and Spices . . . . . . . . . . . . . 17 Abhi P. Shah, Tasnim Travadi, Sonal Sharma, Ramesh Pandit, Chaitanya Joshi, and Madhvi Joshi 3 Emulsion Polymerase Chain Reaction Coupled with Denaturing Gradient Gel Electrophoresis for Microbial Diversity Studies . . . . . . . . . . . . . . . . . 31 Maria-Eleni Dimitrakopoulou, Dimosthenis Tzimotoudis, and Apostolos Vantarakis 4 Real-Time PCR High-Resolution Melting Assays for the Detection of Foodborne Pathogens. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41 Prashant Singh and Frank J. Velez 5 High-Throughput Real-Time qPCR and High-Resolution Melting (HRM) Assay for Fungal Detection in Plant Matrices . . . . . . . . . . . . . . . . . . . . . . . 53 Filipe Azevedo-Nogueira, Sara Barrias, and Paula Martins-Lopes 6 Multiplex Real-Time PCR for the Detection of Shiga Toxin-Producing Escherichia coli in Foods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63 Ana Costa-Ribeiro, Sarah Azinheiro, Foteini Roumani, Marta Prado, Alexandre Lamas, and Alejandro Garrido-Maestu 7 DNA Isolation from Cocoa-Derived Products and Cocoa Authentication by TaqMan Real-Time PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75 Ana Caroline De Oliveira, Yordan Muhovski, Herve Rogez, and Fre´de´ric Debode 8 Quantitative Real-Time PCR for the Detection of Allergenic Species in Foods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 85 Joana Costa, Caterina Villa, and Isabel Mafra 9 Accurate Absolute Quantification of Bacterial Populations in Mixed Cultures by qPCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 105 ˆ ngela Lima, Lu´cia G. V. Sousa, and Nuno Cerca A 10 Real-Time PCR Method for Assessment of ParA-Mediated Recombination Efficiency in Minicircle Production . . . . . . . . . . . . . . . . . . . . . . . . . 117 Cla´udia P. A. Alves, Duarte Miguel F. Prazeres, and Gabriel A. Monteiro

vii

viii

11

12

13

14

15

16 17 18

19

Contents

Gene Expression Quantification from Pathogenic Bacterial Biofilms by Quantitative PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Angela Franc¸a and Nuno Cerca A Real-Time Quantitative PCR Protocol for the Quantification of Plasmid Copy Number in Lactococcus lactis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Sofia O. D. Duarte and Gabriel A. Monteiro Improved PCR by the Use of Disruptors, a New Class of Oligonucleotide Reagents. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Yong Ma and Minxue Zheng Mitochondrial DNA D-Loop Amplification and Sequencing for Species Differentiation in Milk . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Marlene Baptista and Lucı´lia Domingues Long-Range Polymerase Chain Reaction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Ping Siu Kee, Harsheni Karunanathie, Simran D. S. Maggo, Martin A. Kennedy, and Eng Wee Chua Megaprimer-Based PCR to Synthesize Fusion Genes for Cloning . . . . . . . . . . . . . Tatiana Q. Aguiar, Carla Oliveira, and Lucı´lia Domingues Bacteria and Yeast Colony PCR. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Humberto Pereira, Paulo Ce´sar Silva, and Bjo¨rn Johansson Inverse PCR for Site-Directed Mutagenesis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Diogo Silva, Gustavo Santos, Ma´rio Barroca, Diogo Costa, and Tony Collins Optimized Design of Degenerate Primers for PCR Based on DNA or Protein Sequence Comparisons . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Maria Jorge Campos, Alejandro Gallardo, and Alberto Quesada

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

133

151

159

173 181

193 209 223

239 253

Contributors TATIANA Q. AGUIAR • CEB - Centre of Biological Engineering, University of Minho, Braga, Portugal; LABBELS - Associate Laboratory, Braga/Guimara˜es, Portugal CLA´UDIA P. A. ALVES • iBB- Institute for Bioengineering and Biosciences, Department of Bioengineering, Instituto Superior Te´cnico, Universidade de Lisboa, Lisbon, Portugal; Associate Laboratory i4HB – Institute for Health and Bioeconomy at Instituto Superior Te´ cnico, Universidade de Lisboa, Lisbon, Portugal FILIPE AZEVEDO-NOGUEIRA • DNA & RNA Sensing Lab, University of Tra´s-os-Montes e Alto Douro, Department of Genetics and Biotechnology, School of Life Science and Environment, Vila Real, Portugal; BioISI – Biosystems & Integrative Sciences Institute, University of Lisboa, Faculty of Sciences, Lisbon, Portugal SARAH AZINHEIRO • International Iberian Nanotechnology Laboratory, Food Quality and Safety Research Group, Braga, Portugal; Department of Analytical Chemistry, Nutrition and Food Science, Faculty of Veterinary Science, University of Santiago de Compostela, Lugo, Spain MARLENE BAPTISTA • CEB-Centre of Biological Engineering, University of Minho, Braga, Portugal SARA BARRIAS • DNA & RNA Sensing Lab, University of Tra´s-os-Montes e Alto Douro, Department of Genetics and Biotechnology, School of Life Science and Environment, Vila Real, Portugal; BioISI – Biosystems & Integrative Sciences Institute, University of Lisboa, Faculty of Sciences, Lisbon, Portugal ´ MARIO BARROCA • CBMA - Centre of Molecular and Environmental Biology, Department of Biology, University of Minho, Braga, Portugal MARIA JORGE CAMPOS • MARE-Marine and Environmental Sciences Centre & ARNET— Aquatic Research Network Associated Laboratory, ESTM, Polytechnic of Leiria, Peniche, Portugal NUNO CERCA • Laboratory of Research in Biofilms Rosa´rio Oliveira (LIBRO), CEB – Centre of Biological Engineering, University of Minho, Braga, Portugal; LABBELS –Associate Laboratory, Braga, Guimara˜es, Portugal ENG WEE CHUA • Centre for Drug and Herbal Development, Faculty of Pharmacy, Universiti Kebangsaan Malaysia, Kuala Lumpur, Malaysia TONY COLLINS • CBMA - Centre of Molecular and Environmental Biology, Department of Biology, University of Minho, Braga, Portugal DIOGO COSTA • CBMA - Centre of Molecular and Environmental Biology, Department of Biology, University of Minho, Braga, Portugal JOANA COSTA • REQUIMTE-LAQV, Faculdade de Farma´cia, Universidade do Porto, Porto, Portugal ANA COSTA-RIBEIRO • International Iberian Nanotechnology Laboratory, Food Quality and Safety Research Group, Braga, Portugal; Department of Biochemistry, Genetics and Immunology, University of Vigo, Vigo, Spain ANA CAROLINE DE OLIVEIRA • Department of Life Sciences, Unit Bioengineering, Walloon Agricultural Research Centre (CRA-W), Gembloux, Belgium FRE´DE´RIC DEBODE • Department of Life Sciences, Unit Bioengineering, Walloon Agricultural Research Centre (CRA-W), Gembloux, Belgium

ix

x

Contributors

MARIA-ELENI DIMITRAKOPOULOU • Department of Public Health, Medical School, University of Patras, Patras, Greece LUCI´LIA DOMINGUES • CEB - Centre of Biological Engineering, University of Minho, Braga, Portugal; LABBELS - Associate Laboratory, Braga/Guimara˜es, Portugal SOFIA O. D. DUARTE • iBB- Institute for Bioengineering and Biosciences, Department of Bioengineering, Instituto Superior Te´cnico, Universidade de Lisboa, Lisbon, Portugal; Associate Laboratory i4HB—Institute for Health and Bioeconomy at Instituto Superior Te´ cnico, Universidade de Lisboa, Lisbon, Portugal ANGELA FRANC¸A • LIBRO-Laboratorio de Investigac¸a˜o em Biofilmes Rosa´rio Oliveira, Centre of Biological Engineering, University of Minho, Braga, Portugal; LABBELSAssociate Laboratory, Braga/Guimara˜es, Portugal ALEJANDRO GALLARDO • Departamento de Bioquı´mica, Biologı´a Molecular y Gene´tica, Facultad de Veterinaria, Universidad de Extremadura, Ca´ceres, Spain ALEJANDRO GARRIDO-MAESTU • International Iberian Nanotechnology Laboratory, Food Quality and Safety Research Group, Braga, Portugal ¨ BJORN JOHANSSON • CBMA - Centre of Molecular and Environmental Biology, Department of Biology, University of Minho, Braga, Portugal CHAITANYA JOSHI • Gujarat Biotechnology Research Centre (GBRC), Department of Science and Technology, Government of Gujarat, Gandhinagar, India MADHVI JOSHI • Gujarat Biotechnology Research Centre (GBRC), Department of Science and Technology, Government of Gujarat, Gandhinagar, India HARSHENI KARUNANATHIE • Centre for Drug and Herbal Development, Faculty of Pharmacy, Universiti Kebangsaan Malaysia, Kuala Lumpur, Malaysia PING SIU KEE • Department of Pathology and Biomedical Science, University of Otago, Christchurch, New Zealand MARTIN A. KENNEDY • Department of Pathology and Biomedical Science, University of Otago, Christchurch, New Zealand ALEXANDRE LAMAS • Food Hygiene, Inspection and Control Laboratory, Department of Analytical Chemistry, Nutrition and Bromatology, Universidad de Santiago de Compostela, Lugo, Spain ˆ NGELA LIMA • Laboratory of Research in Biofilms Rosa´rio Oliveira (LIBRO), CEB – Centre A of Biological Engineering, University of Minho, Braga, Portugal; LABBELS –Associate Laboratory, Braga, Guimara˜es, Portugal YONG MA • School of Biomedical Engineering (Suzhou), Division of Life Sciences and Medicine, University of Science and Technology of China, Hefei, Anhui, China; Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, Suzhou, Jiangsu, China ISABEL MAFRA • REQUIMTE-LAQV, Faculdade de Farma´cia, Universidade do Porto, Porto, Portugal SIMRAN D. S. MAGGO • Department of Pathology and Biomedical Science, University of Otago, Christchurch, New Zealand; Department of Pathology, Center for Personalized Medicine, Children’s Hospital Los Angeles, California, LA, USA PAULA MARTINS-LOPES • DNA & RNA Sensing Lab, University of Tra´s-os-Montes e Alto Douro, Department of Genetics and Biotechnology, School of Life Science and Environment, Vila Real, Portugal; BioISI – Biosystems & Integrative Sciences Institute, University of Lisboa, Faculty of Sciences, Lisbon, Portugal

Contributors

xi

GABRIEL A. MONTEIRO • iBB- Institute for Bioengineering and Biosciences, Department of Bioengineering, Instituto Superior Te´cnico, Universidade de Lisboa, Lisbon, Portugal; Associate Laboratory i4HB – Institute for Health and Bioeconomy at Instituto Superior Te´ cnico, Universidade de Lisboa, Lisbon, Portugal YORDAN MUHOVSKI • Department of Life Sciences, Unit Bioengineering, Walloon Agricultural Research Centre (CRA-W), Gembloux, Belgium CARLA OLIVEIRA • Universidade Catolica Portuguesa, CBQF - Centro de Biotecnologia e Quı´mica Fina – Laboratorio Associado, Escola Superior de Biotecnologia, Rua Diogo Botelho, Porto, Portugal RAMESH PANDIT • Gujarat Biotechnology Research Centre (GBRC), Department of Science and Technology, Government of Gujarat, Gandhinagar, India HUMBERTO PEREIRA • CBMA - Centre of Molecular and Environmental Biology, Department of Biology, University of Minho, Braga, Portugal MARTA PRADO • International Iberian Nanotechnology Laboratory, Food Quality and Safety Research Group, Braga, Portugal BHUMIKA PRAJAPATI • Gujarat Biotechnology Research Centre (GBRC), Department of Science and Technology, Government of Gujarat, Gandhinagar, India DUARTE MIGUEL F. PRAZERES • iBB- Institute for Bioengineering and Biosciences, Department of Bioengineering, Instituto Superior Te´cnico, Universidade de Lisboa, Lisbon, Portugal; Associate Laboratory i4HB – Institute for Health and Bioeconomy at Instituto Superior Te´cnico, Universidade de Lisboa, Lisbon, Portugal ALBERTO QUESADA • Departamento de Bioquı´mica, Biologı´a Molecular y Gene´tica, Facultad de Veterinaria, Universidad de Extremadura, Ca´ceres, Spain DALIPSINGH RATHORE • Gujarat Biotechnology Research Centre (GBRC), Department of Science and Technology, Government of Gujarat, Gandhinagar, India HERVE ROGEZ • Centre for Valorisation of Amazonian Bioactive Compounds (CVACBA) & Universidade Federal Do Para´, Bele´m, Para´, Brazil FOTEINI ROUMANI • International Iberian Nanotechnology Laboratory, Food Quality and Safety Research Group, Braga, Portugal; Department of Analytical Chemistry, Nutrition and Food Science, Faculty of Veterinary Science, University of Santiago de Compostela, Lugo, Spain GUSTAVO SANTOS • CBMA - Centre of Molecular and Environmental Biology, Department of Biology, University of Minho, Braga, Portugal ABHI P. SHAH • Gujarat Biotechnology Research Centre (GBRC), Department of Science and Technology, Government of Gujarat, Gandhinagar, India SONAL SHARMA • Gujarat Biotechnology Research Centre (GBRC), Department of Science and Technology, Government of Gujarat, Gandhinagar, India DIOGO SILVA • Instituto de Tecnologia Quı´mica e Biologica Antonio Xavier (ITQB), Universidade NOVA de Lisboa, Oeiras, Portugal PAULO CE´SAR SILVA • CBMA - Centre of Molecular and Environmental Biology, Department of Biology, University of Minho, Braga, Portugal PRASHANT SINGH • Department of Nutrition, and Integrative Physiology, Florida State University, Tallahassee, FL, USA LU´CIA G. V. SOUSA • Laboratory of Research in Biofilms Rosa´rio Oliveira (LIBRO), CEB – Centre of Biological Engineering, University of Minho, Braga, Portugal TASNIM TRAVADI • Gujarat Biotechnology Research Centre (GBRC), Department of Science and Technology, Government of Gujarat, Gandhinagar, India

xii

Contributors

DIMOSTHENIS TZIMOTOUDIS • Department of Public Health, Medical School, University of Patras, Patras, Greece APOSTOLOS VANTARAKIS • Department of Public Health, Medical School, University of Patras, Patras, Greece FRANK J. VELEZ • Department of Nutrition, and Integrative Physiology, Florida State University, Tallahassee, FL, USA CATERINA VILLA • REQUIMTE-LAQV, Faculdade de Farma´cia, Universidade do Porto, Porto, Portugal MINXUE ZHENG • School of Biomedical Engineering (Suzhou), Division of Life Sciences and Medicine, University of Science and Technology of China, Hefei, Anhui, China; Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, Suzhou, Jiangsu, China

Chapter 1 Digital PCR: A Partitioning-Based Application for Detection and Surveillance of SARS-CoV-2 from Sewage Samples Bhumika Prajapati, Dalipsingh Rathore, Chaitanya Joshi, and Madhvi Joshi Abstract The wastewater-based surveillance of SARS-CoV-2 has emerged as a potential tool for cost-effective, simple, and long-term monitoring of the pandemic. Since the COVID-19 pandemic, several developed countries have incorporated the national wastewater surveillance program into their national policies related to pandemic management. Various research groups have utilized the approach of real-time quantitative reverse transcription PCR (RT-qPCR) for the quantification of SARS-CoV-2 from environmental samples like sewage water. However, detection and quantification using RT-qPCR relies on standards and is known to have lesser tolerance to inhibitors present in the sample. Unlike RT-qPCR, digital PCR (dPCR) offers an absolute and sensitive quantification without a need reference and offers higher tolerance to inhibitors present in the wastewater samples. Additionally, the accuracy of detection increases with the presence of rare target copies in the sample. The methodology herein presented comprises the detection and quantification of SARS-CoV-2 from sewer shed samples using the dPCR approach. The main features of the process include virus concentration and absolute quantification of the virus surpassing the substantial presence of inhibitors in the sample. This chapter presents the optimized PEG and NaCl-based protocol for virus concentration followed by nucleic acid extraction and quantification using CDC-approved N1 + N2 assay. The protocol uses MS2 bacteriophage as a process recovery or internal control. The methodology herein described highlights the importance of digital PCR technologies for environmental surveillance of important emerging pathogens or pandemics. Key words Absolute quantification, Digital PCR, Wastewater-based epidemiology, SARS-CoV-2, COVID-19 pandemic

1

Introduction Environmental surveillance (ES) by testing the sewage or wastewater samples for detecting the presence of different pathogens has a long history of importance in public health [1]. Wastewater-based epidemiology (WBE) of SARS-CoV-2 is a promising tool for complementation for diagnosing SARS-CoV-2 in a clinical setting which can provide early warning of infection spread, nearly real-

Lucı´lia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967, https://doi.org/10.1007/978-1-0716-3358-8_1, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

1

2

Bhumika Prajapati et al.

time monitoring of outbreaks, and cost-effective detection in pooled samples even in asymptomatic individuals [2]. Since the COVID-19 pandemic, WBE surveillance has been widely accepted as an unbiased tool for monitoring virus outbreaks and disease dynamics in particular populations during the course of pandemics. The process workflow generally involves the collection of composite or grab samples from different wastewater sources such as sewage treatment plants (STPs) or pumping stations, virus concentration, nucleic acid extraction, and detection/quantification of genes of targets through molecular approaches, i.e., realtime quantitative reverse transcription PCR (RT-qPCR) or digital PCR (dPCR) [3, 4]. The ongoing approach of RT-qPCR relies on bulk reaction real-time quantification of unknown target based on a standard curve of the reference sample. The last generation of PCR, i.e., digital PCR (dPCR), has been developed to overcome the challenges of conventional RT-qPCR. The dPCR works on the principle of partitioning in which the PCR mix containing a sample divides into thousands of tiny partitions through a nanowell plate which either contains zero, one, or few copies of target molecules. The individual tiny partitions having one or more copies of the target molecule are then amplified by thermal cycling or PCR [5, 6]. Unlike qPCR, where the amplification occurs in a single bulk reaction, dPCR enables partitioning in thousands of partitions, in which PCR occur simultaneously, which ultimately increases the tolerance to inhibitors and limit of detection of the assay [7]. The dPCR approach offers several advantages such as absolute quantification without reference, higher sensitivity, costeffectiveness, and tolerance to inhibitors present in environmental samples [8]. Different groups of research have shown one or more orders of magnitude differences in results using different kinds of methods. However, the majority of the work has been focused on the comparison of viral concentration and RNA extraction methods from wastewater samples because the wastewater sample contains a very low amount of target with a pronounced presence of PCR inhibitors. Thus, there is an ultimate need to develop an efficient protocol for sample concentration and viral RNA extraction method for the sensitive detection of any pathogen from wastewater samples [9]. We had previously developed the PEG-NaCl-based in-house protocol for virus concentration from samples like wastewater while adapting the protocol from the QIAcuity® user manual quantification using dPCR with minor changes by following the dMIQE guidelines [10]. The present protocol provides a complete overview of SARS-CoV-2 detection and quantification using dPCR from untreated wastewater samples from any sample source.

Digital PCR for Wastewater-Based Surveillance of SARS-CoV-2

2

3

Materials

2.1 Wastewater Sample Collection

1. Sterile polypropylene bottles (500 mL).

2.2 Filtration, Centrifugation, and Precipitation

1. 50 mL sterile centrifuge tubes.

2. Gloves and face mask.

2. Polyethylene glycol (PEG-8000). 3. Sodium chloride (NaCl). 4. 0.22 μm syringe filter. 5. Biosafety cabinet, Class II, Type A2. 6. Vortex mixer. 7. Refrigerated centrifuge. 8. Shaker incubator with refrigeration. 9. -80 °C/-20 °C deep freezer.

2.3 RNA Extraction from Concentrated Pellet

1. MS2 bacteriophage (Thermo Fisher Scientific) or equivalent. 2. Double distilled, nuclease-free, or Milli-Q H2O. 3. Proteinase K. 4. Viral RNA extraction kit (spin column based) which contains different buffer components, i.e., buffer AVE, NFW containing 0.04% sodium azide to prevent microbial growth and contamination with RNases; buffer AVL (50–70% guanidinium thiocyanate), AW1 & AW2 (wash buffer containing guanidine salts). Preparation of buffer AVL-carrier RNA mix: If buffer AVL precipitates, incubate at 80°C for dissolution of precipitates. Calculate buffer AVL-carrier RNA mix for each batch of samples using the formula below: n × 0:56 mL = y mL y mL × 10 μL=mL = z μL where n = number of samples to be processed y = calculated volume of buffer AVL z = volume of carrier RNA-buffer AVE to add to buffer AVL Gently mix by inverting the tube 10 times. To avoid foaming, do not vortex. 5. 0.5–10, 10–100, and 100–1000 μL micropipettes with their suitable filter tips (pipette tips with aerosol barriers for preventing cross-contamination are recommended). 6. Refrigerated centrifuge. 7. Ethanol (96–100%). 8. 1.5 mL microcentrifuge tubes.

4

Bhumika Prajapati et al.

2.4 Primer and Probe Design for Digital PCR

1. SARS-CoV-2 N1 + N2 assay kit.

2.5 Digital PCR Mix Preparation

1. QIAcuity nanoplate with 26,000 nanopartitions with sealing film (Qiagen, see Note 1). 2. Primers and probe cocktail (10 μM). 3. Sterile PCR strips or plate. 4. One-step viral RNA probe assay (Qiagen or equivalent). 5. DNase, RNase-free Eppendorf tubes (1.5 mL). 6. RNAout: Solution containing surfactant like Tween-20 in nuclease-free water. 7. Mini centrifuge. 8. 0.5–10, 10–100, and 100–1000 μL micropipettes with their suitable filter tips (pipette tips with aerosol barriers for preventing cross-contamination are recommended). 9. PCR workstation. 10. QIAcuity digital PCR system (Qiagen; see Note 2).

2.6 Software Setup and Thermal Cycling Conditions

3

1. QIAcuity software suite (Qiagen).

Methods

3.1 Wastewater Sample Collection

The wastewater samples from an in-flow of eight different STPs across Ahmedabad city in Gujarat, India, were collected in the morning hours once on a weekly basis using the grab sampling method. Collect the samples in 250 mL sterile polypropylene bottles, and transport them to the lab on the same day by maintaining appropriate cooling and sterile conditions. The sampling sites should be selected on the basis of the catchment area and minimal liquid discharge (MLD) capacity of each plant [11]. The entire workflow for the process of SARS-CoV-2 detection from wastewater samples is presented in Fig. 1 [12].

3.2 Filtration, Centrifugation, and Precipitation

1. Collect the sample in 250 mL sterile polypropylene bottles, and transport it to the lab on the same day by maintaining appropriate conditions. Each sample should be labeled giving information regarding the name of the collector, the date, time, and exact geographical location with co-ordinates. 2. On the same day, open the collected sample in the biosafety cabinet, and transfer 30 mL of wastewater samples to a 50 mL centrifuge tube, and centrifuge at 1800 × g for 40 min at 10–14 °C temperature.

Digital PCR for Wastewater-Based Surveillance of SARS-CoV-2

5

Fig. 1 Overview of process workflow. The entire process workflow includes sample collection with different types of samples, sampling methods such as grab or composite sampling, sample/virus concentration using PEG-8000 and NaCl, viral RNA extraction using spin column-based kit, absolute quantification using digital PCR assay, and data analysis

3. After centrifugation, take 25 mL of supernatant without disturbing the bottom, and filter it with a 0.22 μm syringe filter in a fresh centrifuge tube. 4. Then, add 2 g of polyethylene glycol (PEG-8000) and 0.437 g sodium chloride (NaCl) (8% PEG and 0.3 M NaCl) to the collected supernatant. 5. Vortex the mixture and incubate it on a shaker incubator overnight by maintaining 120 rpm and 10–17 °C of temperature. 6. On the following day, take fresh Oakridge tubes, and transfer 25 mL of overnight precipitated/concentrated sample (from the previous step) to it, and centrifuge the tube at 12,000 × g for 90 min at 4 °C. 7. After centrifugation, discard the supernatant, and add 300 μL of nuclease-free water, and transfer the 300 μL of concentrated sample from the above step in a fresh Eppendorf tube (1.5 mL) which will be further used for RNA isolation (or store it at -80 °C for future use). 3.3 RNA Extraction from Concentrated Pellet

1. Perform the RNA extraction from the concentrated pellet using a commercially available spin column-based kit. In the current study, QIAamp viral RNA mini kit (Qiagen) has been used as per the protocol mentioned by the manufacturer with slight modifications [12]. Take 300 μL of concentrated sample from the above procedure using a sterile filter tip for RNA isolation, and add 300 μL nuclease-free water (NFW) in a separate tube which will act as negative control (NC). Add 10 μL of MS2 bacteriophage (see Note 3) as internal process recovery control for each sample and controls.

6

Bhumika Prajapati et al.

2. Pipet 560 μL of prepared buffer AVL containing carrier RNA into a 1.5 mL microcentrifuge tube. Mix by pulse-vortexing for 15 s (see Note 4). 3. Add 20 μL of proteinase K and vortex it and incubate the tube at room temperature for 10 min. 4. Add 560 μL ethanol (96–100%) to the sample, and mix by pulse-vortexing for 15 s. After mixing, briefly centrifuge the tube to remove drops from inside the lid. Incubate at room temperature for 5 min. 5. Carefully load around 630 μL of this preparation to the spin column provided in the kit and spin at 7200 × g for 1 min. 6. Change the collection tube and add 750 μL of buffer AW1 (wash) solution and centrifuge at 7200 × g for 1 min. 7. Change the collection tube and add 750 μL of buffer AW2 (wash) solution and centrifuge at 7200 × g for 1 min. 8. Empty spin 13,500 × g for 2 min. 9. Discard the flow through and transfer the column to a fresh 1.5 mL Eppendorf tube. 10. Carefully open the QIAamp mini spin column. Add 30 μL elution buffer AVE equilibrated to room temperature. Close the cap, and incubate at room temperature for 1 min. Centrifuge at 7200 × g for 1 min. 11. Store it at -80 °C (RNA samples) up to PCR assay. 3.4 Primer and Probe for Digital PCR

The dPCR assay for quantifying the viral RNA consists of a set of primers and a set of fluorescent probes. The assay quantitatively detects the SARS-CoV-2 nucleic acid from the upper and lower respiratory clinical and environmental specimen (nasopharyngeal or oropharyngeal swabs, sputum, lower respiratory aspirates, bronchoalveolar lavage, environmental samples, etc.). The cocktail of N1 + N2 primers and probes targets the genomic regions (N1 and N2) of the SARS-CoV-2 viral genome [13]. The primerprobe mix has been acquired commercially. The two probes are coupled with FAM as a reporter dye and use ZEN™ quenchers for enhanced sensitivity (sequence provided in Table 1 [12, 14]). During the PCR amplification, the (5′-3′) exonuclease activity of DNA polymerase will degrade the probes that are hybridized to the target sequence. When the fluorophore (FAM or HEX or ROX) dye molecules are released from the probes and thus are no longer in close proximity to the quencher, they can be detected and quantified by the imaging analysis steps in the dPCR.

Digital PCR for Wastewater-Based Surveillance of SARS-CoV-2

7

Table 1 Primers and probe sequence used in the protocol herein described for the detection of SARS-CoV-2 Oligonucleotide designation nCoV_N1-F nCoV_N1-R nCoV_N1-P nCoV_N2-F nCoV_N2-R nCoV_N2-P

Sequence (5′-3′) GACCCCAAAATCAGCGAAAT TCTGGTTACTGCCAGTTGAATCTG FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 TTACAAACATTGGCCGCAAA GCGCGACATTCCGAAGAA FAM-ACAATTTGC/ZEN/CCCCAGCGCTTCAG3IABkFQ

3.5 Digital PCR Mix Preparation for Wastewater Samples

Final conc. per reaction (μM) 0.8 0.8 0.25 0.8 0.8 0.25

Ref. [14]

1. Before setting up the final reaction mixture for the dPCR assay, enough precautions should be taken to avoid crosscontamination of the sample and reagents. All reagents including PCR master mix, enzymes, primer-probe mix, and nuclease-free water should be properly thawed before use. Wipe the entire PCR hood surface area and micropipettes with the RNAout (carryover RNA-degrading solution) to degrade or remove any contaminant RNA from the surface and pipettes (see Note 5). 2. After thawing the reagents, vials should be gently inverted 2–3 times and spun down using microcentrifuge to ensure proper mixing of all enzymes and components in the reagent vials. The master mix preparation and sample/template addition area should be separated to avoid aerosol-based contamination (see Note 6). 3. Prepare the PCR master mix in sterile 1.5 μL of Eppendorf tubes as mentioned below. The QIAcuity viral probe kit contains a 4× concentrated PCR master mix, which is optimized for microfluidic use in the QIAcuity nanoplate. 4. Make the mixture of all components as mentioned in Table 2 (see Note 7) except for the RNA sample or positive control. Vortex the mixture well, and dispense appropriate volumes of the reaction mixture into the wells of a standard 24-well, 26,000 partitions PCR nanoplate. Carry the plate to the designated area for template addition to prevent contamination. The PCR along with samples and controls should be prepared at least in duplicates (see Note 8). 5. Dilute the positive control RNA to appropriate dilutions (1:50 or 1:100) using nuclease-free water. Critical: Samples that are not sufficiently diluted will result in a saturation of the microchambers with the target RNA that will preclude calculating

7 μL 21.6 μL 40 μL

7 μL 20.6 μL 40 μL

Template RNA/PC/NC

Nuclease-free water

Total reaction volume

0.4 μL

100× multiplex reverse transcription mix 0.4 μL 1 μL (MS2 assay mix)

10 μL

10 μL

4× one-step viral RT-PCR master mix

2 μL (N1N2 assay mix)

26,000 partitions (24-well)

26,000 partitions (24-well)

Nanoplate type

10× primer-probe mix

Mix 1 (for N1 + N2 assay) Mix 1 (for MS2 assay)

Component

Table 2 PCR mixture composition

1×

1×

–

Final concentration

40 μL

Up to 40 μL × N

7 μL × N

1×

–

100–200 ng

2 μL (N1N2)/1 μL MS2 × N 0.4 μM forward primer 0.4 μM reverse primer 0.2 μM probe

0.4 μL × N

10 μL × N

26,000 partitions (24-well)

Mix N

8 Bhumika Prajapati et al.

Digital PCR for Wastewater-Based Surveillance of SARS-CoV-2

9

an accurate percentage of editing events in the sample (see Note 9). 6. Add appropriate volume of template RNA/positive control/ nuclease-free water to wells containing the reaction mix labeled as samples/positive control/negative template control (NTC), respectively. After ensuring the mixing of the reaction mix along with the template RNA, carefully close the Eppendorf tubes, and briefly centrifuge the content to remove any bubbles. 7. Take out the fresh 24-well nanoplate, and one by one add a master mix containing RNA samples from the previous step to the designated wells. Seal the entire plate without disturbing the plate content as vortex or centrifugation is not recommended with nanoplate because it might damage the tiny partitions inside the plate. 3.6 Software Setup and Thermal Cycling Conditions

1. Before starting the experiment, it is always recommended to set up experimental design in the software by following the guidelines provided by the manufacturer. 2. Open the software suite, and assign a reaction mix name containing N1 + N2 assay and MS2 assay in QIAcuity software suite. Assign appropriate wells with sample annotations such as positive control, unknown, NTC and NC. 3. Assign the respective sample numbers in the plate layout prior in the software to avoid any mistakes. Set the thermal cycling program with a heated lid as mentioned in Table 3. 4. In the software suite, select the imaging tab, and capture the appropriate channel (based on the dye or probes), exposure duration, and gain value for fluorescent signal imaging. The current assay targets the N1 + N2 gene and the probe is labeled with FAM dye; thus a green channel with default exposure duration and gain value should be selected.

Table 3 PCR amplification profile of the digital PCR system herein described Name

Time

Temperature (°C)

Reverse transcription

50 min

50

PCR initial heat activation

2 min

95

Denaturation

5s

95

Combined annealing/extension

30 s

60

Two-step cycling

10

Bhumika Prajapati et al.

5. For MS2 bacteriophage assay, assign the ROX dye as a fluorophore dye option, for which the software will automatically assign the red channel. 6. Place the QIAcuity sealed nanoplate into the QIAcuity digital PCR system and start the dPCR program. The three major steps of the program are priming, thermal cycling, and imaging. Priming Nanoplates micropartitions are filled with the input volume by plunging of elastic top seal and the input wells which creates a peristaltic pressure that pumps the input well liquid into the microchannel and partitions. Subsequently, the connecting channels between the partitions are closed by a pressure-controlled rolling process. Thermocycling The thermal cycling step performs the polymerase chain reaction in the QIAcuity thermal cycler with high speed and precise temperature control of the various cycling steps. Imaging The image acquisition of all wells is the final step in the dPCR system. The microfluidics partitions that have one or few copies of target molecule inside can emit fluorescence land are brighter than those without the target. 3.7 Result Interpretation and Data Analysis

1. Post-run analysis can be easily performed and exported from the QIAcuity software suite. After the run, view the file, and observe the threshold line in the 1D scatter plot (Fig. 2) which separates the negative and positive partitions. There should be good separation among positive and negative partitions for getting output copies in a precise manner (see Note 10). 2. Baseline thresholds for each well/sample can be adjusted manually by clicking into the respective wells and adjusting the recalculation tab. 3. Save the results of the run and remove the plate from the instrument. 4. Analyze each well for valid partitions. The valid partition indicates the total analyzable volume of the PCR mixture. It is recommended to achieve around 25,000 valid partitions for each well. 5. The obtained copy numbers/μL should be reviewed as per the dMIQE guideline and final (total) copy numbers of target genes should be calculated using the following formula:

Digital PCR for Wastewater-Based Surveillance of SARS-CoV-2

11

Fig. 2 Representative image of 1D scatter plot: 1D scatter plot indicates the separation of negative and positive partitions based on the fluorescence intensity. The fluorescence amplitude threshold is represented by the red line. Positive partitions are seen above the red line, while negative are seen below the line. B1, positive control; B2,C1, wastewater samples

Total reaction volume ðμLÞ × Obtained copy number per μL Volume of RNA template ðμLÞ As per example, if we get a copy number of 1.2 in sample number A, then in 40 μL of reaction system, while using 7 μL of RNA as a template, then 40 × 1:2 7 = 6:85 copies=μL of eluted RNA sample Further, 300 μL of concentrated wastewater sample was taken as a starting material for RNA extraction, and in the final step, the RNA was eluted in a total of 30 μL of elution buffer.

12

Bhumika Prajapati et al.

Therefore, the viral genome copies in 1 liter of wastewater samples will be Copies of RNA × Elution volume ðμLÞ × 1000 μL Volume of concentrated sample ðμLÞ 6:85 × 30 × 1000 300 = 685 copies per liter of wastewater sample Accordingly, calculate the final copies in each of the samples by applying the formula given. Before interpretation of results in samples, properly analyze the controls (Table 4).

4

Notes 1. There are a total three types of nanoplate available: (1) 24-well 26,000 partitions, (2) 24-well 8,500 partitions, and (3) 96-well 8,500 partitions. Use the selected nanoplate as required. It is suggested to use 26,000 partition well plates for rare target quantification as a higher number of partitions can increase the sensitivity of the assay. Always be careful to design the experiment so that it occupies the entire well plate because the nanoplate cannot be used again. 2. There are around three types of dPCR platforms available in the market. They all are based on a similar principle, i.e., partitioning whether it can be droplet- (oil in water emulsion) or nanoplate-based system (microfluidics system), which can be used for the absolute quantification of SARS-CoV-2 or any pathogen from sewage samples containing plenty of inhibitors. 3. Always use a matrix recovery control (also known as process control) while analyzing the wastewater samples for detection of SARS-CoV-2 to understand the amount of inhibitors during the sample processing. The process control is necessary for comparison of concentration resulting from various testing methods over time. It is an utmost need to quantitatively assess the recovery of the target because wastewater is a biologically and chemically complex and variable sample and often contains the entities which can interfere with the sample/virus concentration, nucleic acid extraction, and molecular quantification methods. It is always recommended to include the matrix recovery controls such as MS2 bacteriophage, murine or bovine coronavirus, etc. for each sample for accounting for unexpected changes in the wastewater composition. 4. To ensure efficient lysis, it is essential that the sample is mixed thoroughly with buffer AVL to yield a homogeneous solution.

Green (FAM) Red (ROX)

Green (FAM) Red (ROX)

N1 + N2 MS2

N1 + N2 MS2

N1 + N2 MS2

N1 + N2 MS2

N1 + N2 MS2

N1 + N2 MS2

A2

A3

A4

NC

PC

NTC

Green (FAM) Red (ROX)

Green (FAM) Red (ROX)

Green (FAM) Red (ROX)

Green (FAM) Red (ROX)

Green (FAM) Red (ROX)

N1 + N2 MS2

A1

Channel

Target

Sample

Table 4 Results of dPCR assay

25,434 25,678

25,480 NA

71.2 NA 0 0

25,386 25,446

25,438 25,452

25,455 25,442

25,448 25,453

25,451 24,441

Total valid partitions

0.086 4.6

0.86 3.1

1.1 3.9

0.258 5.1

0.301 3.5

Copies/μL

0 0

1604 NA

02 106

20 72

26 91

06 119

07 80

Positive partitions

25,434 25,678

23,876 NA

25,384 25,340

25,418 25,380

25,429 25,351

25,442 25,334

25,444 25,361

Negative partitions

– –

101.7 –

0.49 26.2

4.91 17.7

6.29 22.3

1.47 29.1

1.72 20

Total copy number/ μL of RNA sample

Digital PCR for Wastewater-Based Surveillance of SARS-CoV-2 13

14

Bhumika Prajapati et al.

5. Some precautions should be taken while setting up the dPCR mixture and assay to avoid contamination to reagents and samples. Always wear a clean lab coat and disposable nitrile gloves while working with molecular biology assays. It is recommended to use separate sets of micropipettes for reagent preparation and template addition. It is of utmost importance to work in three separate molecular biology areas. One area must be designated for RNA or DNA extraction, another for preparing the PCR master mix, and the last designated for the template addition. Use properly autoclaved sterile pipette tips with filters. Wipe out the working space and lab ware using RNAout or any RNA-degrading solution to avoid any foreign RNA or carry-over contamination. 6. Storage or preparation of DNA/RNA-containing samples or positive controls should be separated from other reagents. In a dPCR-like sensitive platform, pipetting accuracy and precision affect the consistency of results. All reagents including primerprobe mix, master mix, and reverse transcriptase enzyme should be aliquoted in multiple tubes to avoid the repeat freeze-thaw and contamination. All the micropipette and instruments should be checked and calibrated according to the manufacturer’s recommendations. 7. The protocol has been developed using instrument specific kit (Qiagen) but other equivalent kit may be used. 8. The samples or controls should be analyzed in duplicate or triplicate based on the individual statistical requirement of the respective laboratory. An excessive variability among duplicate or triplicate indicates a problem with master mix preparation or pipetting error. Ensure that master mix is prepared properly and well mixed before aliquoting it to individual wells and that the micropipettes are calibrated and dispensing proper volume of reagents. 9. While performing analysis after a run, carefully observe the results of positive and negative controls before interpreting the results of unknown samples. The NTC should not produce any amplification. If it shows amplification, this can be due to amplicon contamination in the PCR master mix preparation. Repeat the assay with a fresh set of primer-probe and other reagents. NC represents the negative control of the RNA extraction procedure, which should be free of any amplification of N1 + N2 genes. NC should amplify only MS2 as it contains bacteriophage with NFW as a starting sample for RNA extraction. Amplification in NC indicates the presence of carryover contamination in the reagents or plastic wares used in the RNA extraction process. The PC should show the proper amplification of target genes without signal saturation. If PC or any

Digital PCR for Wastewater-Based Surveillance of SARS-CoV-2

15

Fig. 3 Representative image of signal map: The figure represents the signal map of the N1 + N2 target gene, which is captured in the green channel with FAM as a fluorescent molecule. (a) Positive control. (b) Negative control. (c) Wastewater samples. The higher copies in positive control indicate more green fluorescent wells, while samples contain very few target copies, thus showing few wells with green fluorescence. A negative control should not show any wells with fluorescence

sample shows saturation in the signal map, it is recommended to use the dilutions of samples and PC (Fig. 3). 10. Observe the scatter plot and signal map in the results output for each positive and negative control. The 1D scatter plot should have proper separation of positive and negative partitions for each sample. The software auto adjusts the threshold value for scatter plot; if not one can also adjust the threshold manually and recalculate the copies in samples accordingly. In the signal map, green dots indicate the partitions or nanowell showing amplification. The signal map for samples or control should not show saturation of fluorescence; in case of saturation, re-perform the assay with appropriate dilutions of samples and controls (Fig. 2).

Acknowledgments The authors are grateful to Ahmedabad Municipal Corporation (AMC) for providing the permission for sample collection from different sewage treatment plants. We acknowledge SERB, DST, GOI and DST, GoG for financial support for research study.

16

Bhumika Prajapati et al.

References 1. Guidance for surveillance of SARS-CoV-2 variants: interim guidance (2021) World Health Organization 2. D’Aoust PM, Graber TE, Mercier E, Montpetit D, Alexandrov I, Neault N et al (2021) Catching a resurgence: increase in SARS-CoV-2 viral RNA identified in wastewater 48 h before COVID-19 clinical tests and 96 h before hospitalizations. Sci Total Environ 770:145319 3. Baldovin T, Amoruso I, Fonzo M, Buja A, Baldo V, Cocchio S et al (2021) SARS-CoV2 RNA detection and persistence in wastewater samples: an experimental network for COVID19 environmental surveillance in Padua, Veneto Region (NE Italy). Sci Total Environ 760:143329 4. Chik AHS, Glier MB, Servos M, Mangat CS, Pang X, Qiu Y et al (2021) Comparison of approaches to quantify SARS-CoV-2 in wastewater using RT-QPCR: results and implications from a collaborative inter-laboratory study in Canada. J Environ Sci 107:218–229 5. K€astner A, Lu¨cker P, Sombetzki M, Ehmke M, Koslowski N, Mittmann S et al (2022) SARSCoV-2 surveillance by RT-qPCR-based pool testing of saliva swabs (lollipop method) at primary and special schools—a pilot study on feasibility and acceptability. PLoS One 17(9): e0274545 6. Jenney A, Chibo D, Batty M, Druce J, Melvin R, Stewardson A et al (2022) Surveillance testing using salivary RT-PCR for SARSCoV-2 in managed quarantine facilities in Australia: a laboratory validation and implementation study. Lancet Reg Health West Pac 26:100533 7. Kokkoris V, Vukicevich E, Richards A, Thomsen C, Hart MM (2021) Challenges

using droplet digital PCR for environmental samples. Appl Microbiol 1(1):74–88 8. Ahmed W, Smith WJM, Metcalfe S, Jackson G, Choi PM, Morrison M et al (2022) Comparison of RT-qPCR and RT-dPCR platforms for the trace detection of SARS-CoV-2 RNA in wastewater. ACS ES & T Water 2(11): 1871–1880 9. Ma D, Straathof J, Liu Y, Natalie HNM (2022) Monitoring SARS-CoV-2 RNA in wastewater with RT-qPCR and chip-based RT-dPCR: sewershed-level trends and relationships to COVID-19. ACS ES & T Water 2(11): 2084–2093 10. Huggett JF (2020) The digital MIQE guidelines update: minimum information for publication of quantitative digital PCR experiments for 2020. Clin Chem 66:1012–1029 11. Kumar M, Joshi M, Patel AK, Joshi CG (2021) Unravelling the early warning capability of wastewater surveillance for COVID-19: a temporal study on SARS-CoV-2 RNA detection and need for the escalation. Environ Res 196: 110946 12. Kumar M, Patel A, Shah A, Raval J, Rajpara N, Joshi M et al (2020) The first proof of the capability of wastewater surveillance for COVID-19 in India through the detection of the genetic material of SARS-CoV-2. Sci Total Environ 746:141326 13. Natarajan A, Han A, Zlitni S, Brooks EF, Vance SE, Wolfe M et al (2021) Standardized preservation, extraction and quantification techniques for detection of fecal SARS-CoV-2 RNA. Nat Commun 12:5753 14. Centers for Disease Control and Prevention. 2019-Novel Coronavirus (2019-nCoV) realtime rRT-PCR panel primers and probes

Chapter 2 Digital PCR: A Tool to Authenticate Herbal Products and Spices Abhi P. Shah, Tasnim Travadi, Sonal Sharma, Ramesh Pandit, Chaitanya Joshi, and Madhvi Joshi Abstract Authentication of herbal products and spices is experiencing a resurgence using DNA-based molecular tools, mainly species-specific assays and DNA barcoding. However, poor DNA quality and quantity are the major demerits of conventional PCR and real-time quantitative PCR (qPCR), as herbal products and spices are highly enriched in secondary metabolites such as polyphenolic compounds. The third-generation digital PCR (dPCR) technology is a highly sensitive, accurate, and reliable method to detect target DNA molecules as it is less affected by PCR inhibiting secondary metabolites due to nanopartitions. Therefore, it can be certainly used for the detection of adulteration in herbal formulations. In dPCR, extracted DNA is subjected to get amplification in nanopartitions using target gene primers, the EvaGreen master mix, or fluorescently labeled targeted gene-specific probes. Here, we describe the detection of Carica papaya (CP) adulteration in Piper nigrum (PN) products using species-specific primers. We observed an increase in fluorescence signal as the concentration of target DNA increased in PN-CP blended formulations (mock controls). Using species-specific primers, we successfully demonstrated the use of dPCR in the authentication of medicinal botanicals. Key words Absolute quantification, Digital PCR, Herbal products, Species-specific PCR assay, Thirdgeneration PCR

1

Introduction The demand and supply chains of the herbal market are expanding with industrialization and globalization. However, a bottleneck is created, which leads to an increased incidence of economically motivated adulteration in herbal products and spices [1]. As DNA is a stable biomolecule, it is unaffected by the environmental and physiological parameters of the plant life cycle which makes it very suitable to be used for authentication methods with a universal, reliable, and reproducible approach [1, 2]. Regulatory guidelines and various pharmacopeia advocate the inclusion of DNA-based methods such as species-specific PCR assays and DNA barcoding to

Lucı´lia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967, https://doi.org/10.1007/978-1-0716-3358-8_2, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

17

18

Abhi P. Shah et al.

authenticate plant raw materials and processed products [3]. Digital PCR (dPCR) is a third-generation PCR technology that employs the divide and conquer rule, in which template DNA is diluted and distributed into thousands of nanopartitions using a microfluidics mechanism. Here, individual partitions will act as single PCR, and amplification will take place if target DNA is present as shown in Fig. 1 [4, 5]. Poisson statistical analysis of the numbers of positive (PCR +ve) and negative (PCR -ve) partitions yields absolute quantitation of the target sequence without the need for a calibration curve, which is required for quantifying target DNA using quantitative real-time PCR (qPCR). Plant raw materials, processed herbal products, and spices will yield DNA of poor quality and quantity due to secondary metabolites such as polyphenolic compounds. In this case, the phenomenon of distributing the DNA template into thousands of nanopartitions provides high sensitivity and specificity of amplification by diluting secondary metabolites (Fig. 1). Furthermore, DNA may not be extracted equally from all the ingredients used in polyherbal or multi-ingredient formulations, which may also contain different plant components like leaves, fruits, barks, or roots. Partitioning will increase the probability of detecting low-frequency targeted DNA in the unequally extracted DNA pool. Thus, nowadays, dPCR has been widely used for authenticating herbal products, foods, and spices [3]. We have

Fig. 1 Overview of digital PCR workflow. The steps in the dPCR workflow are as follows: (1) prepare the PCR mixture; (2) load the PCR mixture containing the template DNA onto the QIAcuity nanoplate and seal it; (3) partitioning of template DNA, amplification of targeted DNA, and detection of the target DNA by the QIAcuity digital PCR system; and (4) data analysis after adjusting the threshold line

Digital PCR for Authentication of Herbal Products and Spices

19

adapted the protocol from the QIAcuity® user manual followed by the dMIQE guidelines [6] and used the QIAcuity digital PCR system (QIAGEN, India) (see Note 1) to authenticate Ocimum basilicum and Ocimum tenuiflorum [7], Piper nigrum, and Carica papaya [8 and the protocol described here]. This protocol is based on the quantification of targeted DNA copies using species-specific sets of primers and DNA-binding EvaGreen fluorescent dye (Fig. 1).

2

Materials

2.1 Preparation of Blended Formulations

1. Weighing balance. 2. Dried Carica papaya (CP) seed and Piper nigrum (PN) berries. 3. Mortar and pestle. 4. Liquid nitrogen.

2.2 DNA Extraction, Quantification, and Dilution

1. DNA extraction can be done either with manual CTAB-based modified methods [8–11] or using commercially available plant DNA extraction kit-based methods. The necessary materials/reagents should be prepared in accordance with that. 2. DNA quantification can be performed using Qubit fluorometer with Qubit dsDNA BR (broad-range) assay kit or Qubit dsDNA HS (high-sensitivity) assay kit, as directed by the manufacturer, or with a nanodrop spectrophotometer, QIAxpert, or a UV/VIS spectrophotometer (see Note 2). A DNA quantification requirement should be prepared in accordance with it. 3. 1 M stock solution of Tris–HCl (pH 8.0): For preparing 1 M stock solution of Tris–HCl, add about 500 mL water to a 1 L graduated cylinder or a glass beaker, weigh 121.14 g Tris base, and transfer to the cylinder. Mix and adjust pH with HCl. Make up the final volume to 1 L with water. Store at 4 °C. 4. 0.5 M stock solution of EDTA (pH 8): For preparing 0.5 M stock solution of EDTA, add about 500 mL water to a 1 L graduated cylinder or a glass beaker, weigh EDTA, and transfer to the cylinder. Add NaOH pellets to dissolve the EDTA and adjust the pH. Make up the final volume to 1 L with water. Store at 4 °C. 5. Low TE (Tris-EDTA) buffer: 10 mM Tris–HCl (pH 8.0), 0.1 mM EDTA (pH 8.0). For preparing low TE, add 10 mL of 1 M stock solution of Tris–HCl (pH 8.0) and 0.2 mL of 0.5 M stock solution of EDTA (pH 8) to a 1 L graduated cylinder or a glass beaker, and make up the final volume to 1 L with water. Store at 4 °C.

20

Abhi P. Shah et al.

Table 1 Primers used for the authentication of Piper nigrum (PN) and Carica papaya (CP) with the protocol described herein Targeted plant

Oligonucleotide (designation)

Piper nigrum (PN)

PN-forward

Carica papaya (CP)

2.3

PN-reverse CP-forward CP-reverse

Primer Dilution

Sequence (5′-3′)

Molecular marker

Amplicon size (bp)

AACATTGATCCTTGGG rps16 gene 400 bp TTTAGACA TCCGCCACTTTCTA TATCCTCGAAG ATGATAATCGTAATG trnK-UUU 360 bp TAATGGG gene TGAGATCGTGGAAA TGATGGCA

References [7]

1. Primers are generally received at 100 μM concentration. By diluting the stock solution by a factor of 10 in either low TE buffer or nuclease-free water, the working solution of 10 μM can be prepared. 2. Working aliquots must be prepared as required, and both working aliquots and stock must be stored at -20 °C.

2.4 Preparation of Reaction Mixture

1. 1.5 mL microcentrifuge tubes. 2. Micropipettes. 3. 1 mL, 200 μL, and 10 μL sterile micropipette tips. 4. EvaGreen or SYBR Green PCR Master Mix. 5. 10 μM forward and reverse primers (Table 1). 6. EcoRI restriction enzyme and buffer. 7. Template DNA. 8. Nuclease-free water (NFW). 9. Sterile PCR strips or plate. 10. Laminar flow hoods or PCR cabinet. 11. Vortex mixer. 12. Centrifuge for PCR plate or PCR strips. 13. 24-well QIAcuity nanoplate with 26,000 nanopartitions (see Note 3). 14. QIAcuity nanoplate sealer.

Digital PCR for Authentication of Herbal Products and Spices

3

21

Methods

3.1 Preparation of Blended Formulations

1. Grind the sample materials [here, dried Carica papaya (CP) seed and Piper nigrum (PN) berries] with liquid nitrogen in a mortar and pestle (see Note 4). 2. For preparing a blended formulation (mock control) containing 75% (w/w) of CP and 25% (w/w) PN, weigh 75 mg of CP seed powder and 25 mg of PN barriers powder in a single 1.5 mL microcentrifuge tube. 3. For preparing a blended formulation containing 50% (w/w) of CP and PN, weigh 50 mg of CP seed powder and 50 mg of PN barriers powder in another 1.5 mL microcentrifuge tube. 4. For preparing a blended formulation containing 25% (w/w) of CP and 75% (w/w) of PN, weigh 25 mg of CP seed powder and 75 mg of PN barriers powder in a third 1.5 mL microcentrifuge tube. 5. After weighing, homogenize each prepared mixture.

3.2 DNA Extraction, Quantification, and Dilution

1. Extract DNA either with manual CTAB-based modified methods [8–11] or using commercially available plant DNA extraction kit-based methods (see Note 5). 2. Quantify the extracted DNA by any method that is described in Subheading 2.2. 3. After quantification, dilute the extracted DNA using low TE according to the desired final concentration. Here, we have diluted the extracted DNA of each blended formulation using low TE to obtain a final concentration of 0.25 ng/μL.

3.3

Digital PCR Setup

Precautions should be taken while setting up digital PCR at all stages to prevent contamination of the sample and reagent. To avoid cross-contamination, DNA extraction and PCR setup should be performed in different rooms (see Note 6). Preparation of the reaction mixture for PCR should be performed in a laminar flow hood or PCR cabinet: 1. All reagents should be thawed and mixed by repeatedly inverting the tubes or, for small volumes, by flicking the tube and spinning briefly in a centrifuge, prior to preparing the reaction mixture. For the selection or design of primers, refer to Note 7. 2. Prepare the PCR mixture in 1.5 mL microcentrifuge tubes, as shown in Table 2. To ensure homogeneous distribution of the template across the partitions on the plate, circular DNA such as plasmids or long DNA templates (>20 kb) such as genomic DNA extracted from plants and animals must be digested with

22

Abhi P. Shah et al.

Table 2 Components of PCR mixture (see Note 10)

Mixture for one reaction Component

Nanoplate with 26,000 partitions (24-well)

Mixture for N reactions

For authentication of PN and CP (mixture for N reactions)

Nanoplate with Nanoplate with 26,000 26,000 partitions partitions (24-well) (24-well)

3× EvaGreen PCR 13.3 μL Master Mix (QIAGEN)

13.3 × N μL

13.3 × N μL

10 μM forward primer

1.6 μL

1.6 × N μL

1.6 × N μL

10 μM reverse primer

1.6 μL

1.6 × N μL

1.6 × N μL

Restriction enzyme (optional)

Up to 1 μL (final concentration in reaction system: 0.025–0.25 U/μL)

Up to 1 μL × N

1 μL EcoRI (1 U/μL), i.e., 0.025 U/μL reaction volume

Template DNA

Variablea (in μL)

Variablea × N

2 μL (0.25 ng/μL)

Nuclease-free water (NFW)

Variablea (in μL)

Variablea × N

20.5 μL

Final volume

40 μL

40 × N μL

40 × N μL

See Notes 10 and 11

a

a restriction enzyme (see Note 8). The final volume of the PCR mixture is calculated by multiplying the total number of reactions required for the dPCR experiment by the volume of each reaction. To account for pipetting variations, PCR mixtures can be made in excess, i.e., 10–12% more than required. It is not required to keep samples on ice during reaction setup or when programming the QIAcuity instrument because of the hot-start polymerase in the dPCR Master Mix. Mix the master mix thoroughly, centrifuge it, and dispense equal aliquots into each well of the PCR plate or each tube of PCR strips. 3. Add template DNA (here we have used 2 μL of 0.25 ng/μL DNA of each blended formulation, i.e., a total of 0.5 ng of DNA) to each reaction tube as needed [make sure that negative template control (NTC) does not receive any template] (see Note 9). For each sample, prepare at least duplicate reactions (see Note 9). 4. Seal the PCR plate or PCR strips and vortex it for proper mixing. Then, centrifuge the PCR plate or PCR strips.

Digital PCR for Authentication of Herbal Products and Spices

23

5. After that, load each reaction mixture into a 24-well QIAcuity nanoplate comprising 26,000 nanopartitions (see Note 3). Load each reaction carefully so that no bubbles are introduced into the wells of the dPCR nanoplate, allowing for a greater number of valid partitions. 6. Carefully seal the QIAcuity nanoplate using the QIAcuity nanoplate sealer by the instructions provided in the QIAcuity® user manual. Improper sealing can affect areas of the reference and target channels to not be filled with the reaction mixture, lowering the number of valid partitions. 7. If the reaction contains a restriction enzyme for DNA digestion, leave the plate at room temperature (15–25 °C) for 10 min. 3.4 PCR Thermal Cycle and Run Set Up in QIAcuity Digital PCR System

1. Operate the QIAcuity digital PCR system and software according to the manufacturer’s recommendations. 2. Set the thermal cycling program as follows: initial heat activation at 95 °C for 2 min, followed by 40 cycles of 95 °C for 15 s, 58 °C for 30 s, and 72 °C for 40 s, and a final cooling step at 40 °C for 5 min (see Note 12). 3. In the Imaging tab of QIAcuity software, select the channel, exposure duration, and gain value for fluorescent signal imaging depending on the dye or probes used (see Note 13). We chose a green channel with the default exposure duration and gain value for the EvaGreen-based reaction system. 4. Place the QIAcuity nanoplate into the QIAcuity digital PCR system and start the dPCR program. 5. To start the PCR run, click on the “Run” icon located on the plate’s pane in the QIAcuity software.

3.5 Data Collection and Analysis

1. After the run is completed, you can adjust the threshold line to obtain a good separation between negative and positive partitions using automatic thresholding. 2. When the positive and negative partitions are not well separated, automatic thresholding fails, and the threshold line must be adjusted manually. The threshold line can be adjusted manually by clicking into the different wells and adjusting the threshold line vertically. After adjusting the threshold, the analysis can be updated by selecting “recalculate” (Fig. 2, Table 3). 3. Save the results of the run and remove the plate from the instrument. 4. The obtained copy numbers/μL should be reviewed and as per the dMIQE guideline [6]. Further, the final (total) copy numbers of targeted DNA should be calculated using the following

24

Abhi P. Shah et al.

Fig. 2 Digital PCR assay of Piper nigrum (PN) and Carica papaya (CP) blended formulations. Digital PCR assay of 75% CP + 25% PN, 50% CP + 50% PN, 25% CP + 75% PN blended formulations with CP- and PN-specific primers. The fluorescence amplitude threshold is represented by the red line. Above the threshold, positive partitions were seen, and below the threshold, negative partitions. NTC = no template control. (a) Digital PCR assay using CP primers. (b) Digital PCR assay using PN primers Table 3 Copy numbers of Piper nigrum (PN) and Carica papaya (CP) determined by digital PCR with the protocol described herein Obtained copy Total copy numbers (obtained Total valid Positive Negative copy numbers/μL × 20 μL) partitions partitions partitions Target Samplea numbers/μL CP

75% CP 698.4 50% CP 389.55 25% CP 322.4

13,968 7,791 6,448

25,474 25,332 25,480

12,010 7,609 6,495

13,464 17,723 18,985

PN

25% PN 9.2 50% PN 107.85 75% PN 137.95

184 2,157 2,759

25,232 25,463 25,439

219 2,387 3,011

25,013 23,076 22,428

Total valid partitions and valid positive and valid negative partitions are also described in the table a Digital PCR assay of 75% CP + 25% PN, 50% CP + 50% PN, 25% CP + 75% PN blended formulations with CP- and PN-specific primers

formula: [(total PCR volume in μL/volume of DNA template in μL used in PCR) x (obtained copy numbers/μL)]; here, (40 μL PCR volume/2 μL DNA template) × (obtained copy numbers/μL) = 20 μL × (obtained copy numbers/μL) (Table 3). 5. The obtained copy numbers of the targeted DNA must be taken into account for the interpretation of the results or for authenticating herbal products and spices. If the copy number of target DNA is detected in the samples, it implies that the samples include the desired species, and if the copy number of the target DNA is not found, it means that the desired species are not present in the herbal products or spices.

Digital PCR for Authentication of Herbal Products and Spices

4

25

Notes 1. Commercially available dPCR is classified into two types: (1) Chamber-based dPCR is composed of thousands of partitions, which are referred to as nanopartitions, microwells, chambers, or chip-based dPCR. Using the microfluidics mechanism, the reactions are divided by subvolumes into partitions, chambers, or wells. BioMark, the QuantStudio series, Constellation/QIAcuity, Clarity, and Optolane are illustrations of chamber-based PCR. (2) Droplet-based dPCR is primarily a microfluidics mechanism based on oil/water partitions (i.e., emulsion PCR). The formulations of surfactant and oil, which stabilize the droplet PCR machinery, are a vital part of this technology. Droplets could be formed using a T-junction, a nozzle, or a step emulsifier. Bio-Rad Laboratories, RainDance Technologies, and Stilla have commercialized these technologies [12]. In this protocol, QIAcuity digital PCR system (QIAGEN, India) was used. 2. DNA Quantification: In this protocol, quantification of the extracted DNA was done using Qubit dsDNA HS assay kit. For that, we mixed 2 μL of extracted DNA with 198 μL 1× dsDNA high-sensitivity reagent in Qubit vials and measured quantification using a Qubit fluorometer. 3. There are two types of QIAcuity nanoplates available, which have 24 wells with 26,000 nanopartitions and 24 wells with 8500 nanopartitions. If the targeted gene is in lower abundance, the sensitivity would increase with the increased number of partitions. Therefore, a nanoplate with 8500 partitions is recommended for high-frequency target genes, and a nanoplate with 26,000 partitions is recommended for genes with low-frequency target genes (QIAcuity® user manual). 4. If the sample is in the form of a “churna,” then it can be subjected directly to DNA extraction without grinding. Depending on the purpose of the experiment, blended formulations (mock controls) can be prepared. For the authentication of market samples and to determine the presence of labeled species, blended formulations containing different amounts of the target standard reference can be prepared. Various biomass ratios of adulterated/substituted plant material and reference plants can be prepared as a mock control to detect adulteration or substitution [7, 13]. 5. DNA extraction from herbal products and spices is the first and crucial step for any PCR setup. The extraction of degraded and low-quality DNA from processed material will be one key impediment to successful PCR. Additionally, contamination of secondary metabolites, especially phenolic compounds in the extracted DNA, is also a major concern. To address this

26

Abhi P. Shah et al.

issue, DNA extraction could be performed to improve the efficiency of DNA recovery and to remove potential PCR inhibitors. Here, DNA extraction was done from 100 mg of each blended formulation using the DNeasy Plant Mini Kit (QIAGEN) according to the manufacturer’s instructions. 6. To avoid cross-contamination or aerosol contamination, standard operating procedures (SOPs) and good laboratory practice (GLP) must be followed. According to the SOPs, separate cubicles must be designated for DNA isolation, master mix preparation, and template addition. The template should be added with a designated pipette set and the reagents with a different pipette set. Keep the reagent separate from the primers and template DNA. Only sterile filter tips and plasticware should be used. Always wear gloves while performing the experiment. Spray gloves with a freshly prepared 1.0% bleach or 70% alcohol solution before beginning work. 7. The primer pair is selected from literature or designed in such a way that the PCR product size ranges between 60 and 150 bp. Even if QIAGEN dPCR EvaGreen chemistry can be applicable for 400–500 bp product sizes, for multiplexing PCR (see Note 13), the length of PCR products should be kept in the range of 60–150 bp. Make sure to follow the standard primer designing criteria listed in the QIAcuity® User Manual Extension when designing primers, such as the primer length must be between 18 and 30 nucleotides and the primer melting temperature (Tm) must be between 58 and 62 °C. For authentication of herbal products or spices, primer pair that targets single-copy nuclear genes (e.g., the diacylglycerol kinase 1 gene), multicopy nuclear genes (e.g., the ITS gene), genes of mitochondrial DNA (mtDNA), or genes of chloroplast DNA (cpDNA) (e.g., the rbcL gene) can be selected. However, nuclear genes that are present in multicopy and genes from mtDNA and cpDNA that show great variation in different tissues cannot give an accurate quantitative analysis with respect to the quantity of plant materials. A single-copy nuclear gene is more suitable for quantitative analysis of plant materials. For instance, Yu et al. [11] used single-copy nuclear genes to develop a duplex dPCR assay for the authentication and quantification of Panax notoginseng and its adulterants, rice, and soybean. In the weight/weight proportion of P. notoginseng/rice or P. notoginseng/soybeans, they were able to obtain linearity in the copy numbers of the targeted genes. In here, the linearity in copy number for PN and CP is obtained in proportion to PN and CP weights. However, the accurate quantification of plant materials (weight/weight) cannot be determined using this data due to cpDNA gene copy number variability [14].

Digital PCR for Authentication of Herbal Products and Spices

27

8. Larger DNA molecules (>20 kb) can produce rainy partitions, i.e., partitions that fall between positive and negative partitions (positive partitions are those that contain one or a few targeted DNA copies, and negative partitions are those that have none), and may lead to inaccurate quantification because of poor target accessibility and uneven partitioning. The addition of restriction enzymes into the PCR mixture leads to the fragmentation of large templates into smaller sizes that can be distributed evenly in the partitions and become accessible for PCR amplification, which results in a reduction in the number of rainy partitions and accurate quantification. Six cutter restriction enzymes (REs) include EcoRI, Pvu II, and Xba I, and four cutter restriction enzymes include Alu I, Hae II, and CviQ I, which may be added as recommended by the QIAcuity® user manual with 0.025–0.25 U per μL PCR mixture and 10 min of incubation at room temperature (15–25 °C). However, make sure the enzymes do not cut the target amplicon sequence. The amount of restriction enzyme and incubation time needed to digest larger DNA fragments to achieve equal distribution of template DNA in the partitions and reduce rainy partitions must be optimized if you are using different restriction enzymes other than the ones recommended in the QIAcuity® user manual. 9. The experiment must be repeated if the negative template control (NTC) results are positive. A probable reason would be contamination during the procedure, whether from reagents or aerosols. To avoid amplification in NTC, repeat the experiment with freshly aliquoted reagent, and/or clean the pipette properly. In the case of species-specific determination, negative controls (NC) containing DNA from allied species can be employed to confirm that no cross-reactivity is observed in allied species. DNA samples from standard reference materials such as herbal products or spices in which amplification of the target gene is observed can be used as a positive control (PC). To validate the dPCR assay for adulteration detection and authentication of market samples (test samples), in-house blended formulations or mock controls that resemble market formulations should be prepared, e.g., here for detection of Carica papaya (CP) adulteration in Piper nigrum (PN), we have prepared blended formulations of 75% CP + 25% PN, 50% CP + 50% PN, and 25% CP + 75% PN. Blended formulations can also be used as positive controls. Market samples of herbal products or spices, as well as controls, should be evaluated in duplicate or triplicate, according to statistical robustness. 10. The range of input DNA template (i.e., the highest and lowest amount of input DNA) can be decided by serial dilution of

28

Abhi P. Shah et al.

template DNA either in twofold, fivefold, or tenfold to achieve the range of valid positive partitions to valid negative partitions dynamics. The dynamic range of an input DNA template is the range within which it can quantify targeted gene copy numbers with good linearity (R2 ≥ 0.980) and efficiency (ideally between 90 and 110%). In the PCR mixture, add the desired volume of template DNA (input DNA), and add NFW to make up the final volume of 40 μL. If an 8500-partition nanoplate is used, the PCR mixture should be made with a final volume of 12 μL, and all components should be added in accordance with the instructions given in the QIAcuity® user manual. The dynamic range of input DNA in dPCR is smaller and is proportional to the partition numbers and inversely proportional to the input volume. The dynamic range of the dPCR is also influenced by the primer specificity and sensitivity and the targeted gene copy numbers. Although dPCR has a smaller dynamic range, it applies to finding a needle in a haystack because it is more sensitive to detecting low copy numbers, has a high tolerance to inhibitors, and is more precise than qPCR. In addition, possibly contaminated nucleic acids, proteins, and salts can impact the measurement of DNA using a spectrophotometer. To address this issue, dPCR can be used to perform absolute quantification of targeted DNA or qPCR plasmid standards [5]. 11. Limit of Detection (LOD) and Limit of Quantification (LOQ): The lowest stable copy number that can be detected with more than a stated percentage of confidence is described as the limit of detection (LOD); it is not necessarily quantified as an exact value. For dPCR-based molecular authentication, the limit of quantification (LOQ) can be defined as the detected lowest copy number that can be quantitatively determined with a coefficient of variation (CV) ≤ 25% [6, 15]. 12. PCR conditions can be optimized by the dMIQE [6] and manufacturer guidelines to maximize partition separation, PCR efficacy, optimal primer specificity, and sensitivity and reduce artifacts of noise and nonspecificity. Generally, with the standard thermal cycling conditions (given in the QIAcuity® user manual), optimal results will be obtained. If optimal results are not obtained, thermal cycler parameters can be optimized, among which annealing temperature optimization is one of the most important parameters in PCR optimization. If the annealing temperature is too high, the yield of the desired product is lowered, leading to false-negative signals. If the annealing temperature is too low, nonspecific DNA fragments are amplified, leading to false-positive signals. That will lead to erroneous copy number detection. The QIAGEN dPCR does not have gradient PCR facilities; hence, the

Digital PCR for Authentication of Herbal Products and Spices

29

QIAcuity® user manual recommends optimizing the annealing temperature using the gradient facilities of qPCR with EvaGreen chemistry. The numbers of cycles also play a crucial role in endpoint detection. To achieve the best effects, the thermal cycling condition should be repeated 30–40 times. 13. As an alternative to EvaGreen chemistry, probe-based chemistry can also be used, in which target-specific probes are labeled with different fluorescent dyes. Probe-based chemistry enhances specificity and sensitivity, and one of the key strengths of this approach is that it can be used for the development of multiplex dPCR by using species-specific probes labeled with different fluorescent dyes. Optimization of the probe, primers, and DNA concentration is needed for multiplex PCR, and no cross-reactivity should be observed. Yu et al. [16] developed duplex PCR for P. notoginseng and rice as well as for P. notoginseng and soybean. Xu et al. [17] developed triplex dPCR for the authentication of Akebiae caulis and its two adulterants, Clematis armandii and Aristolochia manshuriensis. References 1. Ichim MC (2019) The DNA-based authentication of commercial herbal products reveals their globally widespread adulteration. Front Pharmacol 10:1–9. https://doi.org/10. 3389/fphar.2019.01227 2. Raclariu AC, Heinrich M, Ichim MC, de Boer H (2018) Benefits and limitations of DNA barcoding and metabarcoding in herbal product authentication. Phytochem Anal 29:123– 128. https://doi.org/10.1002/pca.2732 3. Wu HY, Shaw PC (2022) Strategies for molecular authentication of herbal products: from experimental design to data analysis. Chinese Med (United Kingdom) 17:1–15. https://doi. org/10.1186/s13020-022-00590-y 4. Quan PL, Sauzade M, Brouzes E (2018) DPCR: a technology review. Sensors (Switzerland) 18. https://doi.org/10.3390/ s18041271 5. Beinhauerova M, Babak V, Bertasi B, Boniotti MB, Kralik P (2020) Utilization of digital PCR in quantity verification of plasmid standards used in quantitative PCR. Front Mol Biosci 7: 1–13. https://doi.org/10.3389/fmolb.2020. 00155 6. Huggett JF (2020) The digital MIQE guidelines update: minimum information for publication of quantitative digital PCR experiments for 2020. Clin Chem 66:1012–1029. https:// doi.org/10.1093/clinchem/hvaa125

7. Travadi T, Sharma S, Pandit R, Nakrani M, Joshi C, Joshi M (2022) A duplex PCR assay for authentication of Ocimum basilicum L. and Ocimum tenuiflorum L in Tulsi churna. Food Control 137: https://doi.org/10.1016/j. foodcont.2021.108790 8. Aboul-Maaty NA-F, Oraby HA-S (2019) Extraction of high-quality genomic DNA from different plant orders applying a modified CTAB-based method. Bull Natl Res Cent 43: 1–10. https://doi.org/10.1186/s42269-0190066-1 9. Porebski S, Bailey LG, Baum BR (1997) Modification of a CTAB DNA extraction protocol for plants containing high polysaccharide and polyphenol components. Plant Mol Biol Report 15:8–15. https://doi.org/10.1007/ BF02772108 10. Clarke JD (2009) Cetyltrimethyl ammonium bromide (CTAB) DNA miniprep for plant DNA isolation. Cold Spring Harb Protoc 2009:pdb-prot5177 11. Krizman M, Jakse J, Baricevic D, Javornik B, Prosekm M (2006) Robust CTAB-activated charcoal protocol for plant DNA extraction. Acta Agric Slov 87:427–433 12. Tan LL, Loganathan N, Agarwalla S, Yang C, Yuan W, Zeng J, Wu R, Wang W, Duraiswamy S (2022) Current commercial dPCR platforms: technology and market review. Crit Rev

30

Abhi P. Shah et al.

Biotechnol 0:1–32. https://doi.org/10. 1080/07388551.2022.2037503 13. Travadi T, Shah AP, Pandit R, Sharma S, Joshi C, Joshi M (2022) Detection of Carica papaya adulteration in Piper nigrum using chloroplast DNA marker-based PCR assays. Food Anal Methods. https://doi.org/10. 1007/s12161-022-02395-z 14. Sakamoto W, Takami T (2018) Chloroplast DNA dynamics: copy number, quality control and degradation. Plant Cell Physiol 59:1120– 1127. https://doi.org/10.1093/pcp/pcy084 15. Yu N, Xing R, Wang P, Deng T, Zhang J, Zhao G, Chen Y (2022) A novel duplex droplet digital PCR assay for simultaneous

authentication and quantification of Panax notoginseng and its adulterants. Food Control 132:108493 16. Yu N, Han J, Deng T, Chen L, Zhang J, Xing R, Wang P, Zhao G, Chen Y (2021) A novel analytical droplet digital PCR method for identification and quantification of raw health food material powder from Panax notoginseng. Food Anal Methods 14:552–560. https://doi. org/10.1007/s12161-020-01887-0 17. Xu W, Zhu P, Xin T, Lou Q, Li R, Fu W, Ma T, Song J (2022) Droplet digital PCR for the identification of plant-derived adulterants in highly processed products. Phytomedicine 105:154376. https://doi.org/10.1016/j. phymed.2022.154376

Chapter 3 Emulsion Polymerase Chain Reaction Coupled with Denaturing Gradient Gel Electrophoresis for Microbial Diversity Studies Maria-Eleni Dimitrakopoulou, Dimosthenis Tzimotoudis, and Apostolos Vantarakis Abstract Emulsion PCR-DGGE is a molecular biology technique used to amplify and analyze DNA fragments. This technique combines two processes, emulsion PCR and denaturing gradient gel electrophoresis (DGGE), to enhance the specificity and yield of the amplification process and to separate the amplified fragments based on their melting behavior. In the emulsion PCR step, a high-quality DNA template is mixed with the PCR reagents and droplet generator oil to create an oil-in-water emulsion. The emulsion is then subjected to thermal cycling to amplify the target DNA fragments. The amplified fragments are recovered from the droplets and purified to remove any impurities that may interfere with downstream applications. In the DGGE step, the purified amplicon is loaded onto a DGGE apparatus, where the DNA fragments are separated and visualized based on their melting behavior. This method allows for the concurrent amplification and separation of multiple DNA fragments, thereby enhancing the resolution and sensitivity of the analysis. It is widely used in environmental and medical microbiology research, as well as in other fields that require the identification and characterization of microorganisms, such as the study of microbial diversity in soil, water, and other natural environments, as well as in the human gut microbiome and other medical samples. Key words Emulsion PCR, DGGE, Polyacrylamide gel, DNA extraction, Omics technologies, Digital PCR

1

Introduction Emulsion PCR is a technique that enables the simultaneous amplification of multiple DNA sequences in a single reaction. The sample is initially emulsified, which forms minuscule droplets containing a single PCR amplification product. This allows for the amplification of multiple genetic targets, thereby increasing the resolution and sensitivity of the analysis. Emulsion PCR is widely employed in environmental and medical microbiology research, as well as in

Lucı´lia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967, https://doi.org/10.1007/978-1-0716-3358-8_3, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

31

32

Maria-Eleni Dimitrakopoulou et al.

other fields requiring the identification and characterization of microorganisms [1, 2]. DGGE (denaturing gradient gel electrophoresis) is a method that separates DNA fragments based on their melting temperature. The separation is performed on a gel matrix, where the DNA fragments migrate through the gel in response to an electric field. The gel contains a denaturing gradient, which causes the DNA fragments to denature (unwind) at varying temperatures. The fragments that denature at lower temperatures migrate further through the gel, while those that denature at higher temperatures migrate less. This results in a separation of the fragments based on their melting temperature [3, 4]. Emulsion PCR-DGGE combines the use of emulsion PCR with DGGE to analyze genetic diversity among microorganisms in a sample. After emulsion PCR, the droplets containing the amplified DNA are collected and utilized as the template for DGGE (Fig. 1). This allows for the concurrent amplification and separation of multiple DNA fragments, thereby increasing the resolution and sensitivity of the analysis. Emulsion PCR-DGGE is a robust tool for studying microbial communities. It enables the identification and characterization of a wide range of microorganisms in a sample, including those that are challenging to culture or detect using other methods. It is widely used in environmental and medical microbiology research, as well as in other fields requiring the identification and characterization of microorganisms. For example, it has been employed to study the diversity of microorganisms in soil, water, and other natural environments, as well as in the human gut microbiome and other medical samples [4–6].

Fig. 1 Principle of emulsion PCR-DGGE in comparison to conventional PCR-DGGE (food sample is presented) [5] This article was published in Current Research in Food Science, 4, Dimitrakopoulou, M. E., Panteleli, E., & Vantarakis, A, Improved PCR-DGGE analysis by emulsion-PCR for the determination of food geographical origin: A case study on Greek PDO “avgotaracho Mesolonghiou,” 746–751, Copyright Elsevier (2021).

Emulsion PCR-DGGE

2 2.1

33

Materials DNA Extraction

1. Commercial kit for DNA extraction. 2. Agarose gel. 3. Staining reagents. 4. 1× TAE buffer (40 mM Tris-acetate, 1 mM EDTA). 5. Molecular weight ladder. 6. Casting tray. 7. Well combs. 8. Voltage source. 9. Gel box. 10. UV light source. 11. Microwave.

2.2 PCR Amplification

1. Taq-polymerase. 2. Buffer with Mg+2. 3. Primers (reconstituted in water to concentration 100 mM and stored at -20 °C). 4. MgCL2 (25 mM). 5. Water. 6. dNTPs (10 mM). 7. Thermal cycler.

2.3 Droplet Generator

1. Droplet generator oil. 2. Droplet generator cartridge. 3. Chloroform 100%.

2.4

Emulsion PCR

1. 20 × Taq-polymerase. 2. Primers. 3. MgCL2. 4. Water. 5. dNTPs.

2.5 Polyacrylamide Gel-DGGE

The purpose of materials used in the gel-DGGE is presented on Table 1 and the list of materials needed is presented below. 1. 8% polyacrylamide gel (acrylamide/bisacrylamide, 37.5:1) 2. Denaturants: 40% formamide and 7 M urea (see Notes 1 and 2). 3. Ammonium persulfate: 10% solution in water.

34

Maria-Eleni Dimitrakopoulou et al.

Table 1 Purpose of specific reagents required for DGGE protocol Reagent

Purpose

Polyacrylamide gel

Matrix used to separate DNA fragments based on their melting behavior

Gel apparatus

Equipment used to cast and run the polyacrylamide gel

Electrophoresis buffer

Buffer used to run the gel and maintain a stable pH during electrophoresis

Loading buffer

Solution used to visualize the DNA fragments during electrophoresis

Template DNA

The sample of DNA to be separated by DGGE

Denaturants

Substances used to create a denaturant gradient within the gel matrix to separate DNA fragments based on melting behavior

Power supply

Used to provide the electrical current for electrophoresis

UV transilluminator

Used to visualize the DNA fragments after the electrophoresis is complete

4. TEMED. 5. Staining (GelStar nucleic acid). 6. 50×TAE buffer.

3 3.1

Methods DNA Extraction

3.2 Emulsion PCR Amplification

An optimized protocol for DNA extraction should be employed on the specific sample under examination. The selection of a commercial kit for DNA extraction should be accompanied by strict adherence to the manufacturer’s protocols. For example, commercial kits such as DNeasy PowerFood Microbial Kit and DNeasy mericon Food Kit are suitable for DNA extraction from food samples. Postextraction, it is crucial to ensure the integrity of the DNA sample by assessing its degradation, which can be determined through electrophoresis on a 0.8% (w/v) agarose gel, with a threshold of 60 °C for thermal degradation. Additionally, the purity and concentration of the extracted DNA should be verified using a nanodrop spectrophotometer (see Note 3). 1. Introduce into the droplet generator plate a combination of DNA template, master mix, and droplet generator oil (see Notes 4, 12 and 18). 2. Prepare the PCR mixture in 50 μL final volume containing 100 ng of template DNA, 0.2 μM primers, 200 μM deoxyribonucleotide triphosphate (dNTP), and 2.5 μL of 10× reaction buffer A with Mg+2. In parallel, add an increased concentration of Taq-polymerase (20×) in accordance with literature

Emulsion PCR-DGGE

35

suggesting that excess polymerase enzyme can enhance amplification efficiency (see Note 16). 3. Run the amplification program: initial denaturation at 95 °C for 3 min and 10 touchdown cycles for 1 min at 65 °C (with the temperature decreasing 1 °C per cycle), followed by 20 cycles of denaturing 95 °C for 1 min, annealing at 55 °C for 1 min, extension at 72 °C for 10 min (see Notes 5, 13, 14 and 15). 4. Discard excess oil. 5. Add 20 μL of elution buffer and 70 μL of chloroform to the PCR products, and vortex the mixture for 1 min. 6. Centrifuge at 14,000g for 10 min to separate the water-oil emulsion (see Notes 6 and 17). 7. Collect 2 μL of the upper aqueous phase of PCR products, which contain the DNA. 8. Prepare same mixture to amplify again under the same conditions the PCR products. 9. Analyze aliquots of PCR products by conventional electrophoresis in 2% (w/v) agarose gel with TAE 1× buffer stained with GelRed 0.5 μg/mL in TAE 1× and quantified by using a standard DNA mass ladder 100 bp (see Note 24). 3.3 Emulsion PCRDGGE

1. Set up the purring apparatus, making sure that the valve connecting the two wells of the gradient maker is closed.

3.3.1 Preparation of Polyacrylamide Gel for DGGE Analysis

2. Thoroughly mix the acrylamide solutions (20% with either 40% or 60% or 80%), formamide and urea with the APS and TEMED (see Notes 1, 2, 7, 19, 21 and 25). 3. As quickly as possible, pour the higher concentration solution into the front chamber (the one closest to the outlet valve), and pour the lower concentration solution into the back chamber. 4. Open the valve between the wells on the gradient chamber (bring to horizontal position), and begin the mixing and the pouring of the gel. 5. To promote even mixing, reduce the speed of the stir bar as the gel pours (one should just barely be able to see the mixing in the front chamber). If the stirring speed is too great, the higher concentration denaturant will flow back into the other chamber. 6. Allow the gel to sit for at least 2 h. 7. Prepare the stacking gel to load above the already prepared acrylamide gel. 8. Pour stacking gel as quickly as possible.

36

Maria-Eleni Dimitrakopoulou et al.

3.3.2 Assembling the DCode (Gel Running) System

1. Clean off a set of glass plates (dish soap only). 2. Lock plates into place with supports, ensuring they are flush. 3. Carefully remove the comb from the gel, along with any excess gel from around the wells. 4. With the tall glass facing out and short glass facing in, snap both assemblages into the holder. 5. Fill D-Code system with approximately 7 L of 1×TAE (140 mL 50×TAE and 6860 mL Milli-Q water) until fill line is reached. 6. Place the holder down into the buffer, ensuring that it is properly in place. 7. Place the top of the D-Code system on top of the apparatus. Verify that all electrical connections are created. 8. Plug in electrical cord and turn power switch on. 9. Set temperature to 60 °C and turn on the heater and pump. Make sure that the buffer level rises and remains above the negative electrode wire (see Note 11).

3.3.3

Loading the Gel

1. Turn off power and remove top of D-Code system. 2. Prepare samples by combining equal amounts of template (at least 300 ng) with 5× loading buffer in 500 μL PCR tubes (see Note 8 and 20). 3. Using corresponding gel loading tips, load samples by placing the pipettor tip half-way into the well and expunging sample with extreme care (see Note 22). 4. Load the standard into every fourth lane. 5. Replace top to the D-Code system, ensuring all electrical connections are made. 6. Plug in D-Code and plug it into both the electrical outlet. 7. Turn on D-Code system and set temperature to 60 °C. 8. Set PowerPack300 (with DCODE chip) to appropriate vault (see Note 9). 9. Turn on the pump only after samples are pulled into the gel (approximately 15 min see Note 23). 10. Let gel run (see Note 10).

3.3.4 Staining and Imaging the Gel

1. Drain the excess buffer from the top of the gel and dismantle the apparatus. 2. With the upmost of caution, remove the supports and spacers. 3. With extreme care, use one of the spacers as a lever to pry off the short glass plate, leaving the gel on the tall glass plate. 4. Soak the tall plate (with gel) in staining (see Note 26), and place on rocker (slow mode) for 30 min.

Emulsion PCR-DGGE

37

5. Distain in Milli-Q water for 15–20 min. 6. Thoroughly wet the imager’s glass plate with water. 7. Tilt the glass plate onto the wet surface of the imager, allowing the gel to slowly slide off (continually wetting the edges of the gel is helpful).

4

Notes 1. Formamide must be kept wrapped in foil throughout its use due to it sensitivity to light. 2. Resolve urea in preheated dH20 at 60 °C. 3. Choose high-quality template DNA: To obtain optimal results, start with high-quality, pure DNA as the template. Resulted purity of DNA (A260/280) should be 1.8. 4. Use an appropriate emulsion: Select an emulsion that is compatible with the reagents being used and has been shown to produce reliable results. 5. Optimize reaction conditions: Optimal reaction conditions, such as temperature and pH, will vary depending on the type of polymerase and other reagents used. 6. Break emulsion carefully: Carefully break the emulsion to avoid any damage to the amplified DNA fragments. 7. We usually use gels with 30%–60% denaturing gradients. 8. Load an appropriate amount of the purified amplicon onto the DGGE apparatus to ensure that the DNA fragments are separated and visualized effectively. 9. Regarding appropriate ratio time: voltage concerns, time has been proven of providing a noteworthy impact on the final band pattern. 10. Improve DGGE resolution: To improve the resolution of DGGE, consider using alternative electrophoresis systems, such as capillary electrophoresis, or using a different gradient format. 11. Monitor the denaturant gradient: The denaturant gradient should be monitored to ensure that it remains stable during the run. 12. Control the size of the droplets: The size of the droplets should be controlled to minimize the number of non-specific amplifications. 13. Monitor the reaction temperature: The reaction temperature should be monitored to ensure that it stays within the optimal range for the polymerase being used.

38

Maria-Eleni Dimitrakopoulou et al.

14. Minimize contamination: To minimize contamination, it is recommended to use dedicated PCR setups and reagents, and to practice good laboratory techniques. 15. As an example, if the V3 variable region of bacterial 16S rDNA is targeted, the primers GC338f (5′ CGCCCGCCGCGCGC GGCGGGCGGGGCGGGGGCACGGGGGGACTCCTACG GGAGGCAGCAG-3′, Sigma, France) and 518r (5′-ATT ACCGCGGCTGCTGG-3′) may be used [7]. 16. A 40-bpGC-clamp is usually added to the forward primer. This is to ensure that the fragment of DNA will remain partially double-stranded, and that the region screened is in the lowest melting domain. 17. Purify amplicon: It is recommended to purify the amplicon after the reaction to remove any impurities that may interfere with downstream applications. 18. Optimize the volume of emulsion: The volume of emulsion should be optimized to minimize the number of empty droplets and maximize the yield of amplicon. 19. Adjust the DGGE conditions: Adjust the denaturant gradient, running temperature, and buffer composition to suit the amplified fragment length and GC content. 20. Optimize the concentration of bromophenol blue: A higher concentration of bromophenol blue can be used to help resolve smaller amplicon fragments. 21. Choose appropriate denaturant: Select an appropriate denaturant for the DGGE matrix to ensure that the amplified DNA fragments are separated based on their melting behavior. 22. Before you load PCR products in wells, make sure you wash the wells with 1xTAE buffer. 23. Make sure you perform a pre-run electrophoresis for 15 minutes before you load PCR products. 24. Store amplicons correctly: Store the amplified fragments in a suitable buffer or ethanol to prevent degradation and maintain the quality of the amplicon. 25. APS solution should be freshly prepared. 26. We usually stain the gel with GelStar nucleic acid for 30 min.

Emulsion PCR-DGGE

39

References 1. Shao K, Ding W, Wang F, Li H, Ma D, Wang H (2011) Emulsion PCR: a high efficient way of PCR amplification of random DNA libraries in aptamer selection. PLoS One 6(9):1–7 2. Verma V, Gupta A, Chaudhary VK (2020) Emulsion PCR made easy. BioTechniques 69(1):65–69 3. Ercolini D (2004) PCR-DGGE fingerprinting: novel strategies for detection of microbes in food. J Microbiol Methods 56(3):297–314 4. El Sheikha AF (2019) Molecular detection of mycotoxigenic fungi in foods: the case for using PCR-DGGE. Food Biotechnol [Internet] 33(1):54–108. https://doi.org/10.1080/ 08905436.2018.1547644 5. Dimitrakopoulou ME, Panteleli E, Vantarakis A (2021) Improved PCR-DGGE analysis by

emulsion-PCR for the determination of food geographical origin: a case study on Greek PDO “avgotaracho Mesolonghiou”. Curr Res Food Sci [Internet] 4:746–751. https://doi. org/10.1016/j.crfs.2021.10.005 6. Iacumin L, Cecchini F, Vendrame M, Comi G (2020) Emulsion pcr (ePCR) as a tool to improve the power of dgge analysis for microbial population studies. Microorganisms 8(8):1–11 7. Ampe F, Ben Omar N, Moizan C, Wacher C, Guyot JP (1999) Polyphasic study of the spatial distribution of microorganisms in Mexican pozol, a fermented maize dough, demonstrates the need for cultivation-independent methods to investigate traditional fermentations. Appl Environ Microbiol 65(12):5464–5473

Chapter 4 Real-Time PCR High-Resolution Melting Assays for the Detection of Foodborne Pathogens Prashant Singh and Frank J. Velez Abstract Real-time PCR high-resolution melting assays are a method for the identification of single nucleotide polymorphisms (SNPs). The assay is performed by amplifying a short DNA fragment using a specific primer pair flanking a target SNP in the presence of a high-resolution melting dye. The HRM analysis of amplicons groups the samples based on the differences in the melting temperature and the shape of the melt curves, facilitating a convenient genotyping of samples. This chapter describes the steps and considerations of realtime PCR HRM assay standardization. Key words Genotyping, Melting, Pre-melt, Post-melt, Protocol, Saturating dye, SNP

1

Introduction Real-time polymerase chain reaction assays are a workhorse for the detection of foodborne pathogens. These real-time PCR assays can be broadly divided into two broad categories, i.e., hydrolysis probebased assays and intercalating dye-based assays. The intercalating dye-based assays rely on double-strand DNA binding dyes, which emit a fluorescent signal when they bind to PCR amplicons. These dsDNA binding dyes can be grouped into two categories, i.e., non-saturating dye (e.g., SYBR) and saturating dye or highresolution dye (e.g., ResoLight, SYTO9, EvaGreen, LCGreen). A saturating dye can be used at a higher concentration without inhibiting PCR, and assays using these dyes are known as highresolution melting (HRM) real-time PCR assays. The use of highresolution dye helps to saturate the PCR amplicon and enables high-fidelity genotyping results. The higher fidelity of HRM dyes can be attributed to less redistribution of these dyes to non-denatured regions of the amplicons [1]. The HRM assay was first described by Carl Wittwer’s group for the differentiation of homozygotes and heterozygotes markers

Lucı´lia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967, https://doi.org/10.1007/978-1-0716-3358-8_4, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

41

42

Prashant Singh and Frank J. Velez

[2, 3]. The HRM is a post-PCR, closed-tube method for accurately analyzing the response of a gradual increase in the reaction temperature to the denaturation behavior of the amplicon generated in the PCR [4]. The HRM assays are a low-cost method for screening and identifying the mutations such as single nucleotide polymorphisms (SNPs), tandem-repeat number, and DNA methylation in a target region. The method has been used for microbial identification [5–7], clinically important markers [8], and mutations conferring antibiotic resistance [9, 10]. The advantage of HRM assays is their simplicity, low cost, use of real-time PCR instruments which are commonly available in a diagnostic laboratory, higher accuracy of genotyping known targets, and ease of application for new SNP discovery. A real-time PCR HRM assay works by designing a targetspecific PCR primer, which amplifies the target region of the genome, resulting in the accumulation of an increasing amount of PCR amplicons with every amplification cycle. These amplicons bind to the high-resolution melting dye present in the reaction mixture, increasing the fluorescent signal, which can be observed as a sigmoidal amplification plot [4, 11]. At the end of all amplification cycles, the reaction mixture emits the highest fluorescent value. After completion of all the amplification cycles, the samples go through a high-resolution melt step, where samples are first incubated at 65 °C for 1–2 min to anneal any single-stranded DNA into a double-stranded complex and facilitate maximum intercalation of the high-resolution melting dye to all amplicons generated in the reaction. After that, the amplicons are heated from 65 °C to 95 °C by gradually increasing the temperature (0.02–0.2 ° C). These numbers may vary slightly with real-time PCR make and model. The fluorescent value of each sample, with each temperature increment, is recorded. As an amplicon has specific GC content, each amplicon denatures at a specific temperature causing the release of the intercalating dye and resulting in a crash in fluorescent value. This denaturation of the amplicon in response to gradually increasing temperature is called the “melting curve analysis,” which is sigmoidal in shape. In melting curve analysis, the amplicon’s melting temperature (Tm) can be determined by the peak in the -dF/dT plot. The HRM analysis can be considered as an advanced form of melting curve analysis where the regions before the pre-melt (100% fluorescence) and after the post-melt (0% fluorescence) are excluded from analysis, and only the melt-phase data is used for the identification of genotypes (Fig. 1). Further, in an HRM analysis, the instrument software takes into consideration both the amplicon’s melting temperature and the shape of the curve and uses it to differentiate between genotypes. Based on our extensive experience working with multiple master mixes and real-time PCR

High-Resolution Melting (HRM) Assays

43

Fig. 1 A high-resolution analysis plot showing the pre-melt region with 100% fluorescence, a post-melt region with 0% fluorescence, and the melt-phase region showing the difference in the melting behavior of the amplicons

instruments, a Tm difference of 0.2 °C or higher between two genotypes can be reliably identified by the HRM assays. In the published literature, two terms, “high-resolution melting assays” and “melting curve assay,” have been interchangeably used. However, a major difference between them is the HRM assays are always performed in singleplex, whereas the melting curve assays can be performed using multiple primer pairs (two to six primer pairs) [12, 13]. Moreover, the HRM analysis uses the specific melting temperature of the amplicon as well as the shape of the curve for identifying the different gene variants, whereas the melting curve assays only use melting temperature for analysis. The HRM assay, once standardized, is a simple, reproducible, and low-cost method for the identification of target SNP. The HRM assays have diverse applications ranging from the identification of clinical markers to microbial identification. This chapter focuses on HRM assays and discusses factors that should be considered for optimizing an HRM assay. The points discussed in this chapter will enable laboratories to standardize and troubleshoot HRM assays.

2 2.1

Materials DNA Purification

There are a wide range of published protocols and commercially available DNA isolation kits. These kits vary in their ability to remove impurities from DNA and the length of time and effort to complete the protocol steps [e.g., DNeasy PowerFood Microbial Kit (QIAGEN, Valencia, CA, USA); PrepMan™ Ultra Sample Preparation Reagent (Applied Biosystems, Foster City, CA, USA); Extracta DNA Prep for PCR (Quanta Biosciences, Beverly, MA, USA); and InstaGene™ Matrix (Bio-Rad Laboratories, Hercules, CA)] (see Note 1).

44

2.2

Prashant Singh and Frank J. Velez

PCR

1. Primer stocks are reconstituted in nuclease-free water (NFW) or l× Tris-EDTA to a concentration of 100 μM and further diluted to 10 μM for mother and working stock, respectively. 2. Commercial master mix (see Notes 2–4). 3. Purified genomic DNA samples (see Note 1). 4. PCR additives (see Note 5). 5. Real-time PCR instrument (see Note 6). 6. Real-time PCR software (see Note 7). 7. Plasticware (see Note 8).

3

Methods

3.1

Primer Design

Primer3 is a freely available web-based tool that can be used for designing primers for HRM assays [14]. The Primer3 “target” feature is useful for designing SNP-specific primer pairs. Further, NCBI’s primer designing tool can be used to check the specificity of the designed primer pairs. When considering the design of the HRM primer, it is recommended to target a small-sized amplicon (60–150 bp) (see Note 9), e.g., O26-32F: 5′-GTG GCA CTG GTT CTT TTG GT-3′ and O26-118R: 5′-TTT CAT CCC TGC TAA ATA TTC G-3′ [6].

3.2

Real-Time PCR

1. Set up a protocol on a HRM-capable real-time PCR instrument (see Notes 10–13). 2. Set up all reagents that are needed for the assay over ice and away from direct light source (see Note 14). 3. A 10–20 μL PCR reaction will consist of half of the final volume (5–10 μL) of a 2× master mix, 2 μL of DNA (20–150 ng), 0.3–1 μL of forward and reverse primers, 1.5–3 mM MgCl2, and nuclease-free water to adjust the final reaction volume (see Notes 2, 4, 5, and 15). 4. Briefly mix and spin down the reaction mixture for about 5 s. 5. Pipette the reaction mix in all the wells containing DNA samples or nuclease-free water as a no-template control. 6. Seal the PCR strip or plate. 7. Place the samples into the real-time PCR, and set up the PCR amplification and HRM analysis protocol (see Note 13). 8. After completion of the real-time PCR run, download the data file from the instrument, and analyze the data file using recommended HRM analysis software. If needed, save the PCR product, by storing the samples at -20 °C (see Note 16).

High-Resolution Melting (HRM) Assays

4

45

Notes 1. A wide range of published protocols and DNA isolation kits are commercially available. Each kit or method has its advantages and limitations. Kits like DNeasy PowerFood Microbial Kit (QIAGEN, Valencia, CA, USA) have been extensively validated for their ability to isolate high-purity DNA free of PCR inhibitors [6, 7, 15]. In contrast, quick dirty lysis-based methods such as PrepMan™ Ultra Sample Preparation Reagent (Applied Biosystems, Foster City, CA, USA), Extracta DNA Prep for PCR (Quanta Biosciences, Beverly, MA, USA), and InstaGene™ Matrix (Bio-Rad Laboratories, Hercules, CA) are preferred by the food testing laboratories due to their quick turnaround time. HRM assay using a DNA obtained from a quick dirty lysis method can be used for pure culture bacterial strains. However, a high-purity DNA isolation kit is necessary for HRM assays when working with complex samples (i.e., enriched food samples). The HRM assays are sensitive to the presence of impurities (i.e., protein, fat, inhibitors) present in crude DNA extract and can interfere with the HRM analysis and genotyping [6]. 2. A wide range of DNA concentrations can be used in a real-time PCR. Some commercially available mixes have a higher tolerance for the DNA in a PCR reaction, i.e., MeltDoctor HRM Master Mix (Applied Biosystems, Foster City, CA, USA), can tolerate up to 150 nanograms of DNA in a 10 μL reaction volume [16]. In our studies, we have observed that LightCycler® 480 high-resolution melting master mix (Roche Diagnostics, Indianapolis, IN, USA) and Apex SYBR Green master mix (Genesee Scientific, California, USA) can also tolerate up to 100 ng of DNA. Increasing DNA concentration in a PCR above the tolerance of the mix can result in a reaction failure [16]. As the HRM assays are performed without any internal amplification control, the use of DNA concentration outside the recommended range can result in false-negative results. For an HRM assay, it is important to keep the DNA concentration of all samples and controls at the same level, as samples with higher DNA concentration can generate higher fluorescence compared to samples with lower DNA concentration, interfering with the grouping of samples during HRM analysis. In all our studies, we have used 20 ng of DNA in a 10 μL reaction volume. 3. A high-resolution master mix is the most important component for standardizing an HRM assay. Historically a PCR mix was prepared by adding individual PCR components, e.g., Taq DNA polymerase, reaction buffer, magnesium chloride

46

Prashant Singh and Frank J. Velez

solution, and deoxynucleotide triphosphates (dNTPs). At present multiple commercially available HRM master mixes are available, which typically consists of all essential reaction components including a high-resolution melting dye, and it may sometime include proprietary PCR additives. All these reagents at specific concentrations make a product unique and define its HRM capabilities. The use of a commercially available master mix is highly recommended for a HRM assay as it improves the assay reproducibility. 4. The MgCl2 is a critical and essential component of any PCR. The MgCl2 is needed for the DNA polymerase activity and is optimized for each master mix based on the enzyme concentration and buffer composition. Its concentration in a PCR varies from 1.5 to 3.5 mM. In addition to Taq polymerase activity, the MgCl2 concentration plays a crucial role in the resolution of genotypes during high-resolution melt analysis. MgCl2 concentration is often optimized and pre-added in the master mix for some commercially available products, i.e., MeltDoctor HRM Master Mix. However, some products are sold without MgCl2 and include a separate vial of MgCl2, i.e., LightCycler® 480 high-resolution melting master mix. In this case, MgCl2 concentration can be individually optimized for each HRM assay. In our experience, 1.5–2.5 mM MgCl2 concentration usually works [6]. However, some assays require higher concentrations (i.e., 3 mM) for differentiating the two genotypes [7, 17] (Fig. 2). Optimization of MgCl2 concentration must be considered for HRM assay for differentiating genotypes, which differ by a small Tm change (i.e., A to T change). 5. The commercial HRM master mixes commonly advertise the products’ ability to identify all major types of SNPs, i.e., class one to four SNPs. However, the performance of master mixes varies depending on the type of SNP and composition of the target region being amplified in the PCR. In our experience development of an assay for the identification of SNP located in a AT-rich region is challenging [7], and some commercially available HRM master mixes may fail to resolve the target SNP. Supplementation of 1.25 μM EvaGreen (Biotium, California, USA) to SYBR Green master mix can facilitate the identification of the target genotypes and outperformed commercially available mixes. We believe the addition of an EvaGreen dye to the PCR enabled saturation of the amplicon and enhanced the HRM genotyping capability of the assay. Data from the study further shows that the SYBR Green and EvaGreen dyes are compatible with each other in a real-time PCR. 6. The HRM assays are commonly performed on HRM-capable real-time PCR instruments. Currently, there are multiple

High-Resolution Melting (HRM) Assays

47

Fig. 2 Effect of (a) 2 mM, (b) 3 mM, and (c) 3.5 mM MgCl2 concentrations on HRM genotyping assay. Addition of optimum concentration of MgCl2 to HRM assay facilitate resolution of genotypes

HRM-capable real-time PCR instruments available (i.e., Roche Diagnostics, Qiagen, Applied Biosystems). The most critical feature of an HRM-capable instrument is its ability to precisely increase the sample temperature by very small increments (i.e., 0.02–0.1 °C), sensitive optical detectors, fast data acquisition rate, and minimum sample-to-sample temperature and optical variations. The smaller temperature increments a HRM-capable instrument can achieve enable the instrument to perform superior genotyping. 7. The instrument commonly comes with HRM analysis software. Additionally, the instrument is calibrated for a HRM dye (i.e., LightCycler 96). However, in some cases, it may require purchasing a separate HRM analysis software (e.g., HighResolution Melt Software, ThermoFisher Scientific, Waltham, MA, USA), and the instrument may need to be regularly calibrated for the recommended HRM dye (i.e., StepOnePlus).

48

Prashant Singh and Frank J. Velez

The HRM analysis software allows to define the pre-melt and post-melt regions of the HRM analysis. Further, it enables the user to define the analysis parameter, i.e., SNP differentiation based on Tm only, the shape of the curve only, or a combination of Tm and shape both. 8. Each instrument works only with its compatible plasticware recommended by the manufacturers. Real-time PCR assays can be performed using either clear or white plasticware (i.e., plates and eight-tube strips). However, some instrument allows the use of both clear and white plasticware. In our experience working with LightCycler 96, white plasticware generated data with higher fluorescence values and superior results compared to clear eight-tube strips. This may be due to the complete blocking of any nonspecific fluorescence signal generated from spilled PCR amplicons present on the real-time PCR block. 9. Primers play a crucial role in an HRM assay design. A smallsized amplicon (60–150 bp) is preferred for an HRM assay [5, 18]. However, in some cases, amplicons close to 150–200 bp can be considered [7]. The reason smaller amplicon size is critical for HRM assays is smaller the amplicon, the more prominent and predictable the ΔTm change associated with a SNP. Additionally, the amplicon length defines the GC content and the intercalating dye binding properties, which eventually affects the HRM assay’s ability to differentiate between the different genotypes [11, 13]. The HRM assay works by detecting small differences between the melt profiles of the samples. As the amplicon size increases, the ability of the HRM assay to measure small differences decreases, which affects the assay’s ability to differentiate between genotypes. Based on our experience, the best strategy for standardizing an HRM assay is to design five to ten primer pairs (60–150 bp amplicon) for the amplification of the target SNP. However, in some cases, an AT-rich region might not allow designing primer pairs for amplifying short amplicon (60–150 bp). In such cases, amplicons greater than 150 bp and forced primer design strategies can be considered. All designed primer pairs can be tested for their ability to differentiate between genotypes. Primer pairs showing good amplification and the potential to differentiate genotypes can be further optimized for assay standardization. 10. A real-time PCR program often is defined by the master mix and the instrument make and model. Fast real-time PCR instruments, compared to standard instruments, require shorter denaturation and amplification steps. Universal master mixes are currently available, which can amplify most targets using the same amplification protocol, minimizing the need for standardization. However, optimization of PCR protocols is

High-Resolution Melting (HRM) Assays

49

needed in case of challenging targets such as AT-rich regions. To amplify a target located in the AT-rich region, a lower annealing temperature (55–58 °C) with a lower and longer extension should be considered (60 °C–120 s). 11. Once target-specific HRM primer pairs are designed and a high-purity DNA is available, the process of PCR HRM assay standardization can be started. 12. Depending on the target and/or the master mix used, there are many PCR amplification protocols that can be used for the amplification of a target. 13. The standard amplification protocol entailed an initial denaturation step at 95 °C from 180 to 900 s. This step is specific for each master mix and is needed for the activation of the DNA polymerase. This initial denaturation is followed by 40–45 cycles of a two- or three-step PCR amplification protocol of denaturation at 95 °C for 3–15 s, with annealing at 55–65 ° C for 30–60 s and with or without an extension at 72 °C for 5–25 s. Finally, at the end of all amplification cycles, HRM is performed with a gradual temperature increase of 0.04 °C/s from 65 °C to 97 °C. 14. Master mixes use light-sensitive HRM dyes. Hence all work should be performed on ice and avoid an extended periods of light exposure. However, many companies claim that their product can be stable at room temperature for hours. 15. A typical real-time PCR HRM reaction can be between 10 and 20 μL. Despite different reaction volume recommendations on each commercially available HRM master mix, our laboratory has consistently used a 10 μL reaction volume for all the HRM assays. A typical HRM reaction mixture consists of primers, DNA samples, magnesium chloride, a master mix, and nuclease-free water. The volume and concentration of all these reaction components can be optimized for an HRM assay. In our opinion, a commercially available master mix tends to generate more consistent results compared to a lab mix, as a lab mix is prone to batch-to-batch variations and pipetting errors, which can affect the genotyping results. DNA polymerase is the enzyme that amplifies the target region and plays a crucial role in defining the Cq-values. Extensive research has been performed in identifying and developing novel DNA polymerases with unique properties, e.g., amplification of AT-rich regions, tolerance to PCR inhibitors, and hot-start capabilities. These properties, which are unique to each DNA polymerase, define the PCR program, the time needed for assay completion, and Cq-values. Based on our experience, the high-resolution master mixes are often optimized for genotyping and may generate amplification with

50

Prashant Singh and Frank J. Velez

Fig. 3 (a) A non-sigmodal amplification plots obtained using 2× LightCycler® 480 high-resolution melting master mix. Sample showed a non-sigmoidal amplification curve and high Cq values. (b) Sigmodal amplification plots obtained using Apex green master mix for the same sample set

poor Cq-value [7, 17]. Our group has extensively worked with LightCycler® 480 high-resolution melting master mix (Roche Diagnostics, Indianapolis, IN, USA) for the development of HRM-based SNP detection assays [6, 7, 17, 18]. Data from our studies demonstrate the LightCycler® 480 high-resolution melting master mix’s ability to differentiate target SNP; however, for two of our studies, the master mix generated data with poor Cq-value, making presence/absence calls difficult (Fig. 3). In such cases the presence/absence calls based on presence of target genotype in the HRM analysis can be considered. As initially mentioned, each polymerase is unique; each mix has its optimum activation temperature and extension temperatures. Therefore, it is crucial to follow the manufacturer’s recommendation for these two steps. 16. The HRM data for the target is analyzed by determining the pre-melt and post-melt regions. The amplicons of the same genetic makeup group together in the analysis. 17. HRM assay is a method for the identification of a target SNP located in a small amplicon, and one limitation of HRM assays is its inability to identify all the SNP which can be present in the

High-Resolution Melting (HRM) Assays

51

amplicon. As the number of SNPs present in the amplicon increases, the HRM assay’s ability to accurately differentiate SNPs may reduce. The method is only suitable for the identification or discovery of SNPs, which cause a GC content change in the amplicon. Additionally, the HRM assay starts losing its genotyping ability when the amplicon size is greater than 200 bp. References 1. Wittwer CT, Reed GH, Gundry CN et al (2003) High-resolution genotyping by amplicon melting analysis using LCGreen. Clin Chem 49:853–860. https://doi.org/10. 1373/49.6.853 2. Erali M, Voelkerding KV, Wittwer CT (2008) High resolution melting applications for clinical laboratory medicine. Exp Mol Pathol 85: 50–58. https://doi.org/10.1016/j.yexmp. 2008.03.012 3. Gundry CN, Vandersteen JG, Reed GH et al (2003) Amplicon melting analysis with labeled primers: a closed-tube method for differentiating homozygotes and heterozygotes. Clin Chem 49:396–406. https://doi.org/10. 1373/49.3.396 4. Tong SYC, Giffard PM (2012) Microbiological applications of high-resolution melting analysis. J Clin Microbiol 50:3418–3421. https:// doi.org/10.1128/JCM.01709-12 5. Liu Y, Singh P, Mustapha A (2018) Highresolution melt curve PCR assay for specific detection of E. coli O157:H7 in beef. Food Control 86:275–282. https://doi.org/10. 1016/j.foodcont.2017.11.025 6. Singh P, Cubillos G, Kirshteyn G, Bosilevac JM (2020) High-resolution melting real-time PCR assays for detection of Escherichia coli O26 and O111 strains possessing Shiga toxin genes. LWT 131:109785. https://doi.org/10. 1016/j.lwt.2020.109785 7. Velez FJ, Bosilevac JM, Delannoy S, et al. (2022) Development and validation of highresolution melting assays for the detection of potentially virulent strains of Escherichia coli O103 and O121. Food Control 109095. https://doi.org/10.1016/j.foodcont.2022. 109095 8. Riahi A, Kharrat M, Lariani I, ChaabouniBouhamed H (2014) High-resolution melting (HRM) assay for the detection of recurrent BRCA1/BRCA2 germline mutations in Tunisian breast/ovarian cancer families. Familial Cancer 13:603–609. https://doi.org/10. 1007/s10689-014-9740-5

9. Keikha M, Karbalaei M (2021) High resolution melting assay as a reliable method for diagnosing drug-resistant TB cases: a systematic review and meta-analysis. BMC Infect Dis 21:989. https://doi.org/10.1186/s12879-02106708-1 10. Rezaei F, Haeili M, Fooladi AI, Feizabadi MM (2017) High resolution melting curve analysis for rapid detection of streptomycin and ethambutol resistance in Mycobacterium tuberculosis. Maedica (Bucur) 12:246–257 11. Monis PT, Giglio S, Saint CP (2005) Comparison of SYTO9 and SYBR Green I for real-time polymerase chain reaction and investigation of the effect of dye concentration on amplification and DNA melting curve analysis. Anal Biochem 340:24–34. https://doi.org/10.1016/ j.ab.2005.01.046 12. Singh P, Pfeifer Y, Mustapha A (2016) Multiplex real-time PCR assay for the detection of extended-spectrum β-lactamase and carbapenemase genes using melting curve analysis. J Microbiol Methods 124:72–78. https://doi. org/10.1016/j.mimet.2016.03.014 13. Singh P, Mustapha A (2014) Development of a real-time PCR melt curve assay for simultaneous detection of virulent and antibiotic resistant Salmonella. Food Microbiol 44:6–14. https://doi.org/10.1016/j.fm.2014.04.014 14. Untergasser A, Cutcutache I, Koressaar T et al (2012) Primer3—new capabilities and interfaces. Nucleic Acids Res 40:e115–e115 15. Jana M, Adriana V, Eva K (2020) Evaluation of DNA extraction methods for cultureindependent real-time PCR-based detection of Listeria monocytogenes in cheese. Food Anal Methods 13:667–677. https://doi.org/10. 1007/s12161-019-01686-2 16. Singh P, Liu Y, Bosilevac JM, Mustapha A (2019) Detection of Shiga toxin-producing Escherichia coli, stx1, stx2 and Salmonella by two high resolution melt curve multiplex realtime PCR. Food Control 96:251–259. https://doi.org/10.1016/j.foodcont.2018. 09.024

52

Prashant Singh and Frank J. Velez

17. Sharma L, Watts E, Singh P (2020) High resolution real-time PCR melting curve assay for identification of top five Penaeidae shrimp species. LWT 133:109983. https://doi.org/10. 1016/j.lwt.2020.109983

18. Velez FJ, Bosilevac JM, Singh P (2021) Validation of high-resolution melting assays for the detection of virulent strains of Escherichia coli O26 and O111 in beef and pork enrichment broths. Food Control 128:108123. https:// doi.org/10.1016/j.foodcont.2021.108123

Chapter 5 High-Throughput Real-Time qPCR and High-Resolution Melting (HRM) Assay for Fungal Detection in Plant Matrices Filipe Azevedo-Nogueira, Sara Barrias, and Paula Martins-Lopes Abstract Crop producers are under great pressure to produce more and better food items. Effective control of crop pathogens is fundamental to guaranteeing food safety and reducing economic losses. Therefore, their identification throughout the production chain is of utmost interest. To achieve this goal, genomic analysis tools are currently being developed allowing to control crop production more effectively. Genomic analysis in some samples is difficult, mostly due to the sample’s intrinsic characteristics, i.e., high levels of phenols, fatty acids (e.g., oleaginous fruits, such as olives), and carbon hydrates (e.g., honey), among others. Additionally, some samples yield very low DNA recovery with high content of contaminants, imposing protocol improvements to overcome these difficulties. Here we present protocols focused on qPCR and HRM to detect the presence of fungal pathogens collected from plant-derived samples. Key words qPCR, HRM, Fungi, Food safety, Fluorescence

1

Introduction Economic and health interests lead to a constant need of accessing the presence of food contaminants. The identification of undesired microorganisms throughout the production chain indicates the contamination of edible products, thus reducing their economic value and quality [1]. Molecular methodologies have been implemented to control the whole production chain, aiming to contain the contamination. Nevertheless, faster and easier molecular methods are mandatory, leading to action time reduction and increased efficacy control [2]. Polymerase chain reaction (PCR) has been a crucial tool to achieve such objectives. With a continuous increase of sensitivity and sensibility in PCR methodologies, new tools with faster

Filipe Nogueira-Azevedo and Sara Barrias contributed equally with all other contributors. Lucı´lia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967, https://doi.org/10.1007/978-1-0716-3358-8_5, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

53

54

Filipe Azevedo-Nogueira et al.

response time and increased sensitivity have been raised, such as quantitative PCR (qPCR) and high-resolution melting (HRM) technologies [3, 4]. These are based on PCR methodology with a resource to fluorescent dyes; hence results are easier and faster to obtain [5]. Herein, we describe qPCR and HRM methods for assessing fungal pathogens’ presence in complex matrices samples with low DNA recovery.

2

Materials These protocols are described using StepOne™ Real-Time PCR System of Applied Biosystems™, although they may be adapted to other systems if the analyzing software is available and the equipment presents similar characteristics. PCR should be performed according to manufacturer indications. Nevertheless, we found that “Xpert Fast SYBR MasterMix” from Grisp© worked well for quantitative PCR in our samples which are rich in PCR inhibitors. The following equipment, reagents, consumables, and software are required: 1. StepOne™ Real-Time PCR System with installed StepOne™ Software v2.3 and Applied Biosystems™ High Resolution Melt (HRM) Software v2.0 or equivalent. 2. Optical 48-well reaction plates. 3. 48-well optical adhesive film. 4. Xpert Fast SYBR MasterMix or equivalent. 5. MeltDoctor™ HRM Master Mix or equivalent.

3 3.1

Methods qPCR

3.1.1 Experimental Design of qPCR

These assays must account for DNA concentration (see Notes 1–4), primer concentration (see Notes 5–7), annealing temperature, and temperature cycle (see Note 8). Our experience shows us that good results are in the range of 20 cycles (Ct, cycle threshold) or lower and using 50 ng of DNA and 2 μM of primers per reaction (see Note 8). Also, the product must be checked on gel electrophoresis to confirm the absence of nonspecific bands and/or primer dimers. If nonspecific bands and/or primer dimers are observable, further optimizations are required. To assess the specificity of the reaction, positive controls should always be used, and the comparison of the melting peaks can rule out unspecific amplicons.

qPCR and HRM Assay for Fungal Detection 3.1.2 Standard Curve Design

55

The target amplicon obtained by amplification with the designed primers for qPCR is cloned into a plasmid-transformed vector, and positive colonies are selected by blue-white screening and confirmed by Sanger sequencing. The standard curve method is used to compare qPCR results to the curve, to determine copy number or concentration of the targeted amplicon (see Note 9). The qPCR is followed by a melting curve stage, to ensure assay specificity. Serial dilutions of the target amplicon, with a known copy number, are obtained, starting with the determination of the more concentrated curve point that is based on the following parameters: (a) The weight of the plasmid with insert. (b) The number of copies of the target sequence in each curve point. (c) The quantity of DNA used in the qPCR standard curve reaction. 1. Calculate the mass of the plasmid with the insert (mtp). Thus, the number of base pairs of the transformed plasmid (plasmid length (np) and insert sequence length (nt)) must be known and multiplied by the mean dsDNA base pair weight (1.096 × 10-21 g) as shown in formula 1: mtp = np þ nt × 1:09 × 10 - 21

ð1Þ

2. Calculate the weight of the insert present in one of the curve points (mrx), e.g., 3 × 109 number of insert (nrx) represented in one reaction, as shown in formula 2: m rx = mtp × nrx

ð2Þ

3. This step allows us to calculate the DNA concentration ([DNA]) for each reaction of the chosen standard curve point, by following formula 3, which will be added to the qPCR curve reaction, using the mass of plasmid (mrx) and the volume of plasmid DNA solution (Vtemplate) used (Table 1): ½DNA  = mrx =V template

ð3Þ

4. Serial dilutions are based on a dilution factor of tenfold and are obtained accordingly (see Note 10). qPCR are equally performed for every point of the standard curve, in triplicates (Tables 1 and 2). The results obtained allow to translate of C(t) qPCR values and other standard curve characteristics (slope and Yintersection) in copy number (#copies) of the target sequence in each sample, as shown in formula 4: C t = Y intersection þ slope × log 10 ð#copiesÞ

ð4Þ

56

Filipe Azevedo-Nogueira et al.

Table 1 qPCR mix for the standard curve

Component

Concentration

Quantity (μL)a

Xpert Fast MasterMix

Provided

10

Primer forward GCCAACAAATAAACGCCACT [7]

10 μM

0.2

Primer reverse GACTTATTCGGTGACGTGCC [7]

10 μM

0.2

Ultrapure H2O

7.6

Plasmid DNA

Adjusted per standard 2 curve point

a

Per reaction

Table 2 qPCR temperature cycle Cycle stage

Cycle step

Temperature

Duration

Holding

Enzyme activation

95 °C

3 min

Cycling (40×)

Denaturation Annealing and extensiona

95 °C 60 °C

5s 30 s

Melt curve

Denaturation Annealing Meltinga,b Annealing

95 °C 60 °C Rising to 95 °C 60 °C

15 s 1 min 15 s 15 s

a

Fluorescence acquisition step Select the Step and Hold ramp mode and select the ramp rate to 0.3%

b

3.1.3 Quantitative PCR Assay

The samples were tested after the standard curve was designed, following the same temperature regime (Table 2) and reaction conditions (Table 3) as used to obtain the standard curve. To perform the qPCR assay, follow the instructions below: 1. Pipette 5 μL (50 ng) of each sample into a pre-established well in a reaction plate. Perform triplicates of each sample, and add a negative (non-template) control and positive controls (posing as references) to the plate. 2. Prepare the qPCR mix according to Table 3. 3. Briefly vortex the mix (see Note 11). 4. Add 15 μL of qPCR mix to each sample. 5. Seal the reaction plate with the optical adhesive film, using the appropriate accessory included in the MicroAmp™ plate box.

qPCR and HRM Assay for Fungal Detection

57

Table 3 qPCR mix for sample quantification Component

Concentration

Quantity (μL)a

Xpert Fast MasterMix

Provided

10

Primer forward GCCAACAAATAAACGCCACT [7]

10 μM

0.2

Primer reverse GACTTATTCGGTGACGTGCC [7]

10 μM

0.2

Ultrapure H2O Genomic DNA

4.6 10 ng/μL

5

a

Per reaction

6. Spin the reaction plate and confirm that the liquid is at the bottom of the wells. 7. Open the StepOne™ software, and set up the experiment using the following steps: 1. Experiment Properties – Name the experiment. – Experiment Type: Quantitation—standard curve. – Select Reagents: Other. – Select Ramp Speed: Standard (~2 h to complete a run). 2. Plate Setup – Define targets and samples. – Name the target. – Select “SYBRGreen” as the reporter. – Add and name the samples. – Select “ROX” as the passive reference. – Assign targets and samples. – Setup the plate layout following the order of the samples in the optical plate. – Assign the chosen target to all samples. – Select task U (unknown) for every sample to be analyzed and task N (negative) for the negative (non-template) control. 3. Run Method – Set the thermal cycler conditions as followed. – Reaction Volume Per Well: 20 μL. – Thermal profile as shown in Table 2.

58

Filipe Azevedo-Nogueira et al.

Fig. 1 Amplification of fungal samples in olive samples and comparison to a standard curve. (a) A standard curve with an indication of the standard curve points (red) and fungi-infected olive samples (blue). (b) The melting curve ensures reaction specificity, where olive samples infected by the target fungus have a distinct melt peak (blue arrow) as compared to negative (black arrow). (Adapted from [7])

8. Save the experiment, load the reaction plate into the instrument, and select “START RUN” on the navigation panel. 9. When the reaction is finished, save the file to a desired location. 10. Review the amplification plot: fluorescence levels must exceed the threshold between cycles 8 and 35, and an exponential increase in fluorescence should be observed. 11. Finally, obtain the cycle threshold (C(t)) values. Reaction specificity was defined by melting peak analysis (Fig. 1). Triplicates were performed, and medium C(t) was obtained and substituted in formula 4 to obtain the copy number of the target sequence in each sample. 3.2 High-Resolution Melting

High-resolution melting (HRM) assays allow distinguishing small sequence variations in closely related target sequences. This is achieved by a step of melting peak with HRM adequate fluorescent dye, e.g., MeltDoctor™. To perform the HRM assay, follow the instructions below: 1. Pipette 5 μL (50 ng) of each sample into a pre-established well in a reaction plate. Perform triplicates of each sample and add negative control and positive controls (posing as references) to the plate. 2. Prepare the HRM mix according to Table 4. 3. Briefly vortex the mix (see Note 11). 4. Add 15 μL of HRM mix to each sample.

qPCR and HRM Assay for Fungal Detection

59

Table 4 qPCR mix for HRM assay Components

Concentration

Quantity (μL)a

MeltDoctor™ HRM Master Mix

Provided

10

Primer forward TCCGTAGGTGAACCTGCGG [8]

10 μM

0.2

Primer reverse TCCTCCGCTTATTGATATGC [8]

10 μM

0.2

Ultrapure H2O Genomic DNA

4.6 10 ng/μL

5

a

Per reaction

5. Seal the reaction plate with the optical adhesive film, using the appropriate accessory included in the MicroAmp™ plate box. 6. Spin the reaction plate and confirm that the liquid is at the bottom of the wells. 7. Open the StepOne™ software, and set up the experiment using the following steps: 1. Experiment Properties – Name the experiment. – Experiment Type: Quantitation—standard curve. – Select Reagents: Other. – Select Ramp Speed: Standard (~2 h to complete a run). 2. Plate Setup – Define targets and samples. – Name the target. – Select “MeltDoctor” as the reporter. – Add and name the samples. – Select “None” on the passive reference. – Assign targets and samples. – Setup the plate layout following the order of the samples in the optical plate. – Assign the chosen target to all samples. – Select task U for every sample to be analyzed and task N for the negative control. 3. Run Method – Set the thermal cycler conditions as indicated in Table 5. – -Reaction Volume Per Well: 20 μL.

60

Filipe Azevedo-Nogueira et al.

Table 5 HRM temperature cycle Stage

Step

Temperature

Time

Holding

Enzyme activation

95 °C

10 min

Cycling stage (40 cycles)

Denature Anneal Extenda

95 °C 58 °C 72 °C

30 s 30 s 30 s

Melt curve

Denature Anneal High-resolution melta,b Anneal

95 °C 65 °C Rising to 95 °C 65 °C

30 s 1 min 15 s 15 s

a

Fluorescence acquisition step Select the Continuous ramp mode and select the ramp rate to 0.3 °C/s

b

8. Save the experiment, load the reaction plate into the instrument, and select “START RUN” on the navigation panel. 9. When the reaction is terminated, save the file to the desired location. 10. Review the amplification plot: fluorescence levels must exceed the threshold between cycles 8 and 35, and an exponential increase in fluorescence should be observed. 11. Open the High-Resolution Melt Software v3.0 to perform high-resolution melting analysis of the data and review the variants. 12. Adjust the pre-melt and post-melt regions in the Derivative Melt Curves plot to optimize the variant calls. Select all the wells, and set the pre-melt and post-melt regions as close as possible to the melting transition region, including the melting peak. 13. Click Analyze, and then save the changes. Good results allow us to discriminate variants by analysis of two HRM plots (aligned melt curve plot and difference plot) as presented in Fig. 2.

4

Notes 1. We find that CTAB-based DNA extraction methods work better in samples that are rich in fatty acids, polysaccharides, and secondary metabolites; however, any extraction procedure can be used. Just keep in mind that CTAB buffer components in high concentrations may be overcarried during extraction steps and affect PCR.

qPCR and HRM Assay for Fungal Detection

61

Fig. 2 Representative HRM plots that distinguish two fungal species with the same set of primers. With the same conditions of amplification, we observe that fungal species are discriminated by (a) melting temperature, where one fungal species (red) presents an amplicon with a lower melting temperature than the other (green) and (b) where both species present distinct curve profiles that group the two variants. Therefore, this shows that the assay can distinguish fungal samples

2. DNA purity and concentration must be assessed. Pure DNA absorbance ratios at 260 nm/280 nm and 260 nm/230 nm should be close to 2. Absorbance ratios that diverge from this can also be used but can compromise the assay accuracy due to the presence of contaminants derived from the extraction procedure or related to sample composition. 3. To avoid PCR inhibitor compounds, we found that diluting the DNA sample to a lower concentration with ultrapure water improves PCR, as contaminants present in the sample are also diluted. 4. DNA integrity should be assessed by an electrophoretic run on 1% agarose gel. 5. When designing primers, assure that they meet these guidelines: – Primer length ~20 bases – Tm 58 °C to 60 °C (optimal Tm is 59 °C), as normally the PCR temperature regime is facilitated by using two steps in the amplification step, combining annealing and extension in one unique step – 30–80% GC content in each primer 6. Primers for qPCR and HRM should amplify a DNA fragment up to 200 bp long, to avoid multiple melting points. Amplicons with greater size can be used [6]; however, results can be harder

62

Filipe Azevedo-Nogueira et al.

to interpret. Additionally, hairpins and primer dimers should be avoided since they interfere with the melting curve analysis. 7. Primer dilution should be made using ultrapure water and, if possible, in a laminar flow chamber to avoid contaminations that can interfere due to the assay sensitivity. 8. PCR should be optimized to obtain the best results; however, during standard curve and quantification procedures, the conditions should be maintained. Primer concentration and DNA concentration can differ accordingly to each assay; however, these conditions should be maintained when comparing experiences as they influence PCR efficiency. 9. Standard curve should be adapted to each situation, taking into consideration the copy number predicted in each sample type, so they cover all the possible situations. 10. Standard curve serial dilutions can be prepared with other dilution factors. To obtain a higher curve definition, the dilution factor should be lower. 11. Preparation of qPCR and HRM mix with fluorescent dyes should be set up in the dark and on ice to minimize sample degradation and nonspecific reactivity. References 1. Bansal S, Singh A, Mangal M et al (2017) Food adulteration: sources, health risks, and detection methods. Crit Rev Food Sci Nutr 57:1174– 1189 2. Umesha S, Manukumar HM (2018) Advanced molecular diagnostic techniques for detection of food-borne pathogens: current applications and future challenges. Crit Rev Food Sci Nutr 58: 84–104 3. Martins-Lopes P, Gomes S, Pereira L et al (2013) Molecular markers for food traceability. Food Technol Biotechnol 51:198–207 4. Druml B, Cichna-Markl M (2014) High resolution melting (HRM) analysis of DNA - its role and potential in food analysis. Food Chem 158: 245–254 5. Pereira L, Gomes S, Barrias S et al (2018) Applying high-resolution melting (HRM) technology

to olive oil and wine authenticity. Food Res Int 103:170–181 6. Pereira L, Martins-Lopes P (2015) Vitis vinifera L. single-nucleotide polymorphism detection with high-resolution melting analysis based on the UDP-glucose:flavonoid 3- O -glucosyltransferase gene. J Agric Food Chem 63:9165–9174 7. Azevedo-Nogueira F, Gomes S, Lino A et al (2021) Real-time PCR assay for Colletotrichum acutatum sensu stricto quantification in olive fruit samples. Food Chem 339:127858 8. White TJ, Bruns TD, Lee SB et al (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: PCR – protocols and applications – a laboratory manual. Academic Press, pp 315–322

Chapter 6 Multiplex Real-Time PCR for the Detection of Shiga Toxin-Producing Escherichia coli in Foods Ana Costa-Ribeiro, Sarah Azinheiro, Foteini Roumani, Marta Prado, Alexandre Lamas, and Alejandro Garrido-Maestu Abstract Shiga toxin-producing Escherichia coli (STEC) is a group of human foodborne pathogens transmitted to humans through the consumption of different types of food. Their detection is mainly performed by targeting specific serogroups by classical microbiological methods and, later, by molecular typing with different techniques. The application of multiplex real-time PCR (qPCR) can significantly improve the turnaround time of the existing methodologies as in one single run it is possible to detect and characterize specific microorganisms. In the present chapter, a pentaplex qPCR assay is described for the identification of STEC which may also be applied for the rapid screening of these pathogens in different types of foods. The assay targets the most important virulence factors of these microorganisms, the genes stx1, stx2, and eae, along with the rfbE gene which encodes for the “O157” antigen as this is the most prevalent serogroup among all STEC, as well as an internal amplification control to rule out false-negative results due to qPCR inhibition. Key words qPCR, Multiplex, Shiga toxin-producing E. coli, Internal amplification control

1

Introduction Nowadays, microbiological food testing mostly relies on culturebased methods. However, these methods are known to have certain limitations such as long turnaround times and intensive hands-on work [1]. On the other hand, molecular methods have been demonstrated to be a suitable alternative, or at least an excellent complement. This is particularly true for PCR and real-time PCR (qPCR) methods which are now already key parts of certain workflows. In line with this, certain official organizations have implemented these techniques, such as the ISO standard for the detection of Shiga toxin-producing Escherichia coli (STEC) [2] and the corresponding one described by the Food and Drug Administration [3]. In both cases, a PCR/qPCR screening of the

Lucı´lia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967, https://doi.org/10.1007/978-1-0716-3358-8_6, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

63

64

Ana Costa-Ribeiro et al.

pathogens is performed in enriched samples, and positives have to be confirmed by plating on selective media. One added value of the mentioned techniques relies on their multiplexing capabilities so that more than one target can be detected in the same reaction, thus increasing the throughput of the methods by implementing them. As a result, several pathogens may be detected simultaneously [4–6], several genes from the same microorganism [7, 8], or a combination of both [9, 10]. In the present chapter, an assay for the identification of STEC by multiplex qPCR is presented. The described methodology targets four bacterial genes, namely, stx1, stx2, eae, and rfbE, along with an internal amplification control (IAC), making it a pentaplex assay. Additionally, the assay presented is suitable for the rapid screening of STEC in different foodstuffs.

2 2.1 1)

Materials Media (See Note

1. Nutrient broth: 10.0 g tryptone, 5.0 g meat extract, 5.0 NaCl, 1000 mL Milli-Q water, pH 7.2 ± 0.2. 2. Tryptic soy agar: 15.0 g tryptone, 5.0 g papainic digest of soybean meal, 5.0 g NaCl, 15.0 g bacteriological agar, 1000 mL Milli-Q water, pH 7.3 ± 0.2.

2.2

Chemicals

1. Tris-EDTA solution (TE 1×): 10 mM Tris–HCl, 1 mM EDTA. Final pH = 8.0 ± 0.2. See Note 2. 2. 6% (w/v) Chelex (Bio-Rad Laboratories, Inc., USA), from now on chelex. 3. Qubit™ 1× dsDNA HS Assay Kit (Invitrogen™, ThermoFisher Scientific, Carlsbad, CA, USA). 4. Primers and probes (see Table 1). 5. NZYSupreme qPCR Probe Master Mix (NZYTech, Lisbon, Portugal).

2.3

Equipment

1. Real-time PCR thermocycler with at least five different channels for the detection of different fluorophores. In the described assay, a QuantStudio™ 5 (Applied Biosystems™, Foster City, CA, USA) was used. Reactions may be run in 0.1 mL PCR tubes/strips or 96-well plates sealed with optical quality adhesive film or plastic lids. 2. Centrifuge with a speed range of 300–16,000 × g. Also must have a rotor suitable for 1.5–2 mL tubes. 3. Thermomixer comfort (Eppendorf AG, Germany). Similar devices may be used to incubate and shake simultaneously. 4. Qubit™ 4 fluorometer (Invitrogen™, Carlsbad, CA, USA). Suitable 0.5 mL tubes must also be acquired.

STEC Detection by Multiplex qPCR

65

Table 1 Multiplex STEC qPCR primers and probes Primer

Sequence 5′ → 3’

Modifications

stx1-P3F stx1-P3R stx1-P3P stx2-P3F stx2-P3R stx2-P3P eae-P3F eae-P3R eae-P3P

TGT CGC ATA GTG GAA CCT CAC CAG CTG TCA CAG TAA CAA ACC G ACG CAG TCT// GTG GCA AGA GCG ATG T AAC GGT TTC CAT GAC AAC GG CAG TGA GTG ACG ACT GAT TTG C TGC AAC GTG TCG CAG CGC TGG TGA CGG TAG TTC ACT GGA CTT C TGA CCC GCA CCT AAA TTT GC TGG TCA GGT CGG AGC GCG TTA CA

– [23] – FAM/ZEN/IABkFQ – – ATTO550N/IAbRQSp – – TexRd-XN/IAbRQSp

O157-rfbE-F TCA ACA GTC TTG TAC AAG TCC AC – O157-rfbE-R ACT GGC CTT GTT TCG ATG AG – O157-rfbE-P AC TAG GAC CGC AGA GGA AAG AGA GGA A Cy®5/IAbRQSp

Reference

[24]

NC-IAC-F NC-IAC-R

AGT TGC ACA CAG TTA GTT CGA G TGG AGT GCT GGA CGA TTT GAA G

– –

[15]

IAC-P

AGT GGC GGT//GAC ACT GTT GAC CT

YY/ZEN/IABkFQ

[16]

YY (Yakima Yellow), IABkFQ (Iowa Black®FQ), IAbRQSp (Iowa Black®Sp), and ZEN (secondary, internal quencher) are trademarks from IDT. TexRd-XN (Texas Red®). See Note 8

3

Methods

3.1 Bacterial Enrichment

1. Pick one well isolated colony from a TSA plate and resuspend it in 1–4 mL of nutrient broth. Incubate at 37 ± 1 °C overnight. 2. After incubation, take an aliquot (1–2 mL) for DNA extraction.

3.2 DNA extraction (see Note 3)

1. Centrifuge aliquots at 16,000 × g for 2 min. 2. Eliminate the supernatant, resuspend the bacterial pellet in 1 mL of TE 1×, and centrifuge again at 16000 × g for 2 min. 3. Discard the supernatant and resuspend the pellet in 200 μL of chelex, and incubate at 56 °C for 15 min and constant agitation (1000 rpm) in the thermomixer (see Note 4). 4. Place the tubes at 99 °C for 10 min and constant agitation (1400 rpm). 5. Finally, centrifuge the tube at 16,000 × g for 2 min, at 4 °C to further aid in with the thermal lysis. Transfer the supernatant, containing the DNA to a clean tube (see Note 5). 6. The DNA is ready for the qPCR. In the event that the samples are not analyzed, they may be stored at 4 °C and will remain stable for some days; however, if excessive delay from extraction until the analysis is expected, the DNA should be stored at 20 °C to assure its integrity.

66

Ana Costa-Ribeiro et al.

3.3 DNA Quantification

1. Remove Qubit™ reagents from the refrigerator and allow them to reach room temperature. It is recommended to perform the assay at room temperature (18–28 °C). Temperature fluctuations may influence the accuracy of the assay. 2. Prepare the standards and sample reactions. For standards transfer 190 μL of Qubit™ 1× dsDNA HS working solution to two Qubit™ 0.5 mL compatible tubes (label the tubes only in the cap and not in the walls as it can interfere with the reading of the sample). Add 10 μL of Standard #1 (0 ng/ μL) in one tube, and 10 μL of Standard #2 (10 ng/μL) in another one. For the samples, 1–20 μL may be measured, and the working solution will be added to make a final volume of 200 μL. The amount of sample used depends on the sample volume available and the DNA concentration of the sample. In this protocol, 1 μL is used. 3. Mix the standards and samples vigorously using a vortex for 5 s and incubate in the dark for at least 2 min. Reactions are stable for 3 h in the dark. 4. Read the standards in the equipment to perform the calibration, and then proceed with the samples indicating in the equipment the volume of sample used in the reaction. This is necessary for the equipment to calculate the DNA concentration in the original sample. In the case the equipment indicates “concentration too high,” perform a 1/ 10 dilution of the original sample, and repeat the process from step 2 of Subheading 3.3. In the case the equipment indicates “concentration too low,” increase the volume of the sample in step 2 of Subheading 3.3. If the problem persists, perform again the DNA isolation.

3.4 STEC Multiplex qPCR Assay

1. The assay described herein targets three different STEC virulence markers, namely, stx1, stx2, and eae, along with the gene rfbE which encodes for the “O157” antigen (this serogroup is the most commonly reported STEC in most countries worldwide) and an IAC. The sequences of all the primers and probes are provided in Tables 1 and 2. See Notes 6 and 7. 2. Perform tenfold serial dilutions from the original DNA extract in TE 1×, e.g., 10 μL of DNA and 90 μL of TE 1×. 3. Considering the number of dilutions to be tested, prepare enough reaction mixture to test each one in technical duplicates (ideally triplicates), along with negative control (Milli-Q water) and at least one extra reaction having some excess volume. In Table 3 the volumes required for one reaction are presented. 4. To perform a pentaplex assay, a qPCR thermocycler with five filters, or channels, is needed. The thermal profile run is summarized in Table 3.

STEC Detection by Multiplex qPCR

67

Table 2 Reagent concentrations and volumes for one STEC multiplex qPCR assay

Primer/probe

Volume/rxn (μL)

Final concentration (nM)

NZYSupreme

12.5

–

stx1-P3F

0.1

400

stx1-P3R

0.1

400

stx1-P3P

0.05

200

stx2-P3F

0.1

400

stx2-P3R

0.1

400

stx2-P3P

0.05

200

eae-P3F

0.1

400

eae-P3R

0.1

400

eae-P3P

0.05

200

O157-rfbE-F

0.1

400

O157-rfbE-R

0.1

400

O157-rfbE-P

0.05

200

IAC F

0.2

100

IAC R

0.2

100

IAC P

0.2

100

IAC DNA

1.0

7 × 102a

H2O

1.0

–

Template DNA

3b

–

Final volume

25

–

Primer volumes indicated are calculated based on a working solution of 100 μM except for the IAC in which 10 μM stocks were used. Final concentrations may vary depending on specific Master Mixes a Copies/μL, the volume may vary depending on the DNA stock concentration b To reduce pipetting errors, avoid pipetting volumes below 2 μL

5. A bacterial isolate will be considered as a non-STEC if no amplification is observed for stx1 and/or stx2 as these genes encode for the Shiga toxin. Amplification of the eae gene is considered a virulence marker but it may be present in nonSTEC E. coli. Amplification of the rfbE indicates that the isolate under study belongs to the serogroup O157, but has no implications on the virulence potential of the bacteria (it is of interest for surveillance purposes). A sample negative for all the mentioned genes must still be positive for the IAC as a reaction negative for all five targets will indicate that reaction inhibition

68

Ana Costa-Ribeiro et al.

Table 3 Thermal profile for multiplex qPCR Stepa

Temperature (°C)

Time (s)

Cycles

Activation

95

300

1

Dissociation

95

15

40

Annealing-amplificationb

60

30

a

The steps, temperatures, and times may be modified depending on the master mix selected b Annealing and amplification may be separated making it a three-step qPCR assay. Optimal temperatures and times may change among brands. The fluorescence is detected at the end of each annealing-amplification step. See Note 9

Fig. 1 (a) stx1 amplification plot, (b) stx2 amplification plot, (c) eae amplification plot, (d) rfbE amplification plot, (e) IAC amplification plot, (f) simultaneous multiplex amplification

occurred. In Fig. 1A–1F, typical amplification plots are presented. Lack of amplification in the IAC may be observed in samples with high DNA concentrations exhibiting early amplification of one or more targets. In these cases, the absence of amplification of the IAC is not considered an issue. In Table 4 a summary of the qPCR results interpretation is provided. 6. The Cq values obtained for each dilution can be plotted against the DNA concentration, previously quantified, to determine the amplification efficiency; see Fig. 2a, e. This parameter must be between 90 and 110% with an R2 < 0.99 and may also serve to determine the analytical sensitivity of the assay [11, 12]. See Note 10.

STEC Detection by Multiplex qPCR

69

Table 4 qPCR result interpretation stx1/ stx2

Gene Positive

stx1/ stx2

eae

rfbE

eae

Negative

IACa

rfbE

Positive

Negative

Positive

Negative

Positive

Negative

Positive

STEC

STEC

O157-STEC

NON-O157/ STEC

STEC

STEC

Negative

P

NON-STEC

O157

NON-O157/ NON-STEC

NEGATIVE

I

Positive

STEC

STEC

O157

NON-O157/ NON-STEC

Negative

P

NON-STEC

NON - P/ O157

NON-O157/ NON-STEC

Positive

O157-STEC

NON-O157/ STEC

P - O157

Negative

O157

NON-O157/ NON-STEC

Positive

STEC

Negative

STEC

IAC*

P

P

NEGATIVE

I

NON-P/ O157

O157

O157

P/ NON-O157

NON-P/ NON-O157

NEGATIVE

I

STEC

p

NON-STEC

O157

O157

I

P

I

O157

I

a

Certain samples with a high concentration of target DNA may result in no amplification of the IAC. “P,” pathogenic. “I,” inconclusive, inhibition in the IAC, the test must be repeated

Fig. 2 (a) Dynamic range of stx1, (b) dynamic range of stx2, (c) dynamic range of eae, (d) dynamic range of rfbE, (e) standard curves generated from the dynamic range, used to calculate the multiplex qPCR amplification efficiency

4

Notes 1. If desired to apply the assay for food analysis, the media specified in the ISO 13136 may be used [2]; these are modified TSB supplemented with novobiocin (mTSBn): 17 g enzymatic digest of casein, 3 g enzymatic digest of soy, 2.5 g D(+)

70

Ana Costa-Ribeiro et al.

glucose, 5 g NaCl, 4 g K2HPO4, 1.5 g bile salts No. 3, and 1000 mL Milli-Q water. Final pH = 7.4 ± 0.2. Dissolve 0.16 g of novobiocin in 10 mL of Milli-Q water (0.12 g of acriflavine may be used instead of novobiocin), and sterilize filtering through a 0.22 μm filter. Immediately before use add 1 mL to basal medium mTSB. The final concentration will be 16 mg/L (or 12 mg/L of acriflavine). Alternatively, whenever stressed bacteria, and/ or low background microflora, are expected, buffered peptone water (BPW) may be used. Its typical composition is 10 g peptone, 5.0 g NaCl, 3.5 g Na2HPO4, 1.5 g KH2PO4, and 1000 mL Milli-Q water, pH 7.0 ± 0.2. The FDA recommends the usage of modified BPW (mBPW) supplemented with acriflavine, cefsulodin, and vancomycin (ACV) [3]. The composition of this broth is 10 g peptone, 5.0 g NaCl, 3.6 g Na2HPO4, 1.5 g KH2PO4, 6.0 yeast extract, 5.0 casamino acids, 10.0 g lactose, 1.0 g sodium pyruvate, and 1000 mL Milli-Q water, pH 7.2 ± 0.2. The selective agents are added at a final concentration of 10 mg/L of acriflavine and cefsulodin and 8 mg/L of vancomycin (the antimicrobials are filter sterilized and added right before using the medium). 2. TE 1× is intended for sample cleaning; thus any other general buffer/solution may be used such as PBS or a 0.9% NaCl solution. 3. The DNA extraction procedure detailed herein was selected based on its simplicity and low cost; however, commercial DNA extraction kits may also provide satisfactory results. These may include other reagents intended for bacterial thermal lysis such as PrepMan™ Ultra Sample Preparation Reagent and/ or InstaGene™ Matrix from Applied Biosystems™ and Bio-Rad, respectively, or column-based kits like NucleoSpin® Food or DNeasy PowerSoil Pro from Macherey-Nagel and Qiagen, respectively. Even though many kits and protocols may include an enzymatic lytic step, considering that STEC are Gram-negative bacteria, and the rapid growth of Enterobacteriaceae, simple thermal lysis protocols tend to provide good results. 4. The agitation during steps 4 and 5 of the DNA extraction protocol may be performed at different speeds, from 1000 to 1400 rpm. If the process cannot be performed automatically, the samples should be mixed by hand, or inverting the tubes, every few minutes to avoid the settling of the resin. 5. It is of utmost importance to not disturb the pellet with the cellular debris and chelex. Loading the resin into the qPCR, along with the DNA, may result in reaction inhibition (detectable by lack or delay of amplification of the IAC).

STEC Detection by Multiplex qPCR

71

6. Different types of IAC may be designed and used [13, 14], and commercial products are also available. These may be identified as internal positive control (IPC). In the current chapter, the noncompetitive IAC described by Garrido-Maestu et al. was selected [15, 16]. Any chimeric DNA accommodating the primers and probe described herein will be suitable; thus, no particular DNA sequence was provided. The IAC included in this protocol is expected to provide a Cq of 30–33 in non-inhibited negative samples; if inhibition is observed, this can typically be overcome by performing a ½–1/10 dilution of the DNA in Milli-Q water of TE 1×. 7. Primer and probe design may be performed with different software. Primer3 is an online free tool [17] where this task can be performed automatically or manually specified attending to specific requirements such as length, GC %, or Tm among others with particular caution when designing hydrolysis probes to avoid placing a G in the 5′ end, where the fluorophore is attached, due to the high natural quenching capacity of this nucleotide [18, 19]. As input for the design, the sequence of the desired gene may be used, e.g., obtained from NCBI’s Refseq, or several may be retrieved from the same database and aligned and the consensus sequence of a conserved region may be used; free tools to perform this visualization and alignment are also available, for instance, CLC Sequence Viewer [20]. The inclusivity and exclusivity of newly designed primers should be tested in silico prior to their acquisition and later by in vitro testing. This task may be initially performed by a BLAST search (https://blast.ncbi.nlm.nih.gov/Blast.cgi) and later through an in silico PCR [21]. For in vitro studies, the optimized assay must be used (see Notes below) against a panel of target and nontarget strains [22]. The optimal primers and probes concentration must be optimized for optimal performance. The optimization typically begins with the primers using an intercalating dye such as SYBR Green I and testing different relative concentrations of the forward and reverse primer in the range of 100–500 nM. Once determined the optimal primer concentration, one may perform the same step for the probe where concentrations in the range 100–300 nM typically lead to good results. 8. Attention must be paid to the selection of fluorophores. The ones specified in Table 1 are a suitable combination that works well in the qPCR instrument that was used. It is advised to confirm that the fluorophores selected do not have overlapping emission peaks. Oligonucleotide suppliers may have alternative dyes and quenchers equivalent to the ones indicated in Table 1 which may be more economic (e.g., Cy®5 for TYE665 or

72

Ana Costa-Ribeiro et al.

TexRd for TEX615 from IDT). In the link provided, options from IDT may be found (https://eu.idtdna.com/site/cata log/modifications/dyes). In addition to the primers indicated, the ISO standard 13,136 and the FDA have made publicly available their oligonucleotide sequences, which may be found in the corresponding methods [2, 3]. 9. The master mix selected requires a “Hot-Start” for polymerase activation; however enzymes from different suppliers may have different requirements in terms of temperature and time; thus it is of utmost importance to confirm the proper profile as suboptimal activation of the enzyme may generate unsatisfactory results. Regardless of the need of the “Hot-Start,” some master mixes implement, or if not may be added separately, uracil DNA glycosylase (UDG). The addition of this enzyme is intended to avoid, or reduce, carryover contamination between experiments. For this treatment to work, the master mixes selected must contain dUTP instead of dTTP so that the amplicons will incorporate the dUTP which will not be present in the template DNA, it will be degraded by the UDG with a simple incubation at 50 °C for 2–20 min, and then it is denatured in the “Hot-Start” step before the beginning of the PCR amplification. Amplification time and temperature should be optimized whenever a new assay is developed for optimal performance and if the brand of the master mix, or the equipment, is changed. In terms of annealing temperature, the range to be tested typically goes from 58 °C to 66 °C, and the time from 15 to 60 s. 10. In multiplex qPCR assays, the amplification efficiency must be calculated individually for each one of the targets selected, as well as for the combination of all of them to assure that the reaction performs well under the different conditions. The IAC must be loaded but it does not account for the evaluation. References 1. Kim SO, Kim SS (2021) Bacterial pathogen detection by conventional culture-based and recent alternative (Polymerase Chain Reaction, isothermal amplification, Enzyme Linked Immunosorbent Assay, bacteriophage amplification, and gold nanoparticle aggregation) methods in food samp. J Food Saf 41:1–12 2. ISO/TS (2012) Microbiology of food and animal feed – Real-time polymerase chain reaction (PCR)-based method for the detection of food-borne pathogens – horizontal method for the detection of Shiga toxin-producing Escherichia coli (STEC) and the determination of O157

3. Feng P, Weagant SD, Jinneman K (2011) Diarrheagenic Escherichia coli. http://www.fda. gov/Food/ScienceResearch/ LaboratoryMethods/Bacteriolo gicalAnalyticalManualBAM/ucm070080.htm ˜ aranda E 4. Garrido-Maestu A, Chapela M-J, Pen et al (2015) Re-evaluation of enhanced qPCR prevalidated method for next-day detection of Salmonella spp., Shigella spp., Escherichia coli O157 and Listeria monocytogenes. Food Biotechnol 29:317–335 5. Bundidamorn D, Supawasit W, Trevanich S (2021) Taqman® probe based multiplex

STEC Detection by Multiplex qPCR RT-PCR for simultaneous detection of Listeria monocytogenes, Salmonella spp. and Shiga toxin-producing Escherichia coli in foods. LWT 147:111696 6. Villamizar-Rodrı´guez G, Lombo´ F (2017) Multiplex Detection of Food-Borne Pathogens. In: Domingues L (ed) PCR: methods and protocols. Springer New York, New York, pp 153–162 7. Dhital R (2021) Detection of virulence and extended spectrum β-lactamase genes in Salmonella by multiplex high-resolution melt curve real-time PCR assay. J Appl Microbiol 132(3): 2355–2367 8. Mu¨s¸tak I˙B, Mu¨s¸tak HK (2022) Detection and differentiation of Salmonella Enteritidis and Salmonella Typhimurium by multiplex quantitative PCR from different poultry matrices. Br Poult Sci 63:171–178 9. Bundidamorn D, Supawasit W, Trevanich S (2018) A new single-tube platform of melting temperature curve analysis based on multiplex real-time PCR using EvaGreen for simultaneous screening detection of Shiga toxinproducing Escherichia coli, Salmonella spp. and Listeria monocytogenes in food. Food Control 94:195–204 10. Vitullo M, Grant KA, Sammarco ML et al (2013) Real-time PCRs assay for serogrouping Listeria monocytogenes and differentiation from other Listeria spp. Mol Cell Probes 27:68–70 11. Raymaekers M, Smets R, Maes B et al (2009) Checklist for optimization and validation of real-time PCR assays. J Clin Lab Anal 23: 145–151 12. Bustin SA, Benes V, Garson JA et al (2009) The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem 55:611–622 13. Deer DM, Lampel KA, Gonza´lez-Escalona N (2010) A versatile internal control for use as DNA in real-time PCR and as RNA in real-time reverse transcription PCR assays. Lett Appl Microbiol 50:366–372 14. Hoorfar J, Malorny B, Abdulmawjood A et al (2004) Practical considerations in design of internal amplification controls for diagnostic PCR assays MINIREVIEW practical considerations in design of internal amplification

73

controls for diagnostic PCR assays. J Clin Microbiol 42:1863–1868 15. Garrido-Maestu A, Azinheiro S, Carvalho J et al (2019) Combination of immunomagnetic separation and real-time recombinase polymerase amplification (IMS-qRPA) for specific detection of Listeria monocytogenes in smoked salmon samples. J Food Sci 84(7):1881–1887 16. Garrido-Maestu A, Azinheiro S, Carvalho J et al (2018) Development and evaluation of loop-mediated isothermal amplification, and Recombinase Polymerase Amplification methodologies, for the detection of Listeria monocytogenes in ready-to-eat food samples. Food Control 86:27–34 17. Untergasser A, Cutcutache I, Koressaar T et al (2012) Primer3-new capabilities and interfaces. Nucleic Acids Res 40:e115–e115 18. Mackay IM (2004) Real-time PCR in the microbiology laboratory. Clin Microbiol Infect 10:190–212 19. Biassoni R, Raso A (eds) (2020) Quantitative real-time PCR methods and protocols. Humana, New York, NY 20. CLC Bio-Qiagen (2016) CLC Sequence Viewer 21. Bikandi J, San Milla´n R, Rementeria A et al (2004) In silico analysis of complete bacterial genomes: PCR, AFLP–PCR and endonuclease restriction. Bioinformatics 20:798–799 22. Kralik P, Ricchi M (2017) A basic guide to real time PCR in microbial diagnostics: definitions, parameters, and everything. Front Microbiol 8: 1–9 23. Costa-Ribeiro A, Azinheiro S, Fernandes SP, Lamas A, Prado M, Salonen LM, GarridoMaestu A (2023) Evaluation of covalent organic frameworks for the low-cost, rapid detection of Shiga Toxin-producing Escherichia coli in ready-to-eat salads. Anal Chim Acta 341357. https://doi.org/10.1016/j.aca. 2023.341357 24. Garrido-Maestu A, Azinheiro S, Carvalho J et al (2020) Optimized sample treatment, combined with real-time PCR, for same-day detection of E. coli O157 in ground beef and leafy greens. Food Control 108:106790

Chapter 7 DNA Isolation from Cocoa-Derived Products and Cocoa Authentication by TaqMan Real-Time PCR Ana Caroline De Oliveira, Yordan Muhovski, Herve Rogez, and Fre´de´ric Debode Abstract Cocoa (Theobroma cacao L.) is an international commodity used as an ingredient in the manufacturing of chocolate making its authentication a key issue in the cocoa chain. Various molecular techniques have been increasingly applied for quality requirements. These issues highlight the need for techniques that allow the extraction and detection of cocoa DNA from highly processed cocoa products and chocolate. The applicability of real-time PCR to highly processed cocoa-derived products for authentication purposes depends on the possibility of extracting high-quality and amplifiable DNA and further developing efficient PCR tests. This methodology herein describes the use of a classical CTAB method providing DNA suitable for TaqMan real-time PCR amplification. Real-time PCR is a simple and fast method, with a high potential application in a wide range of food products. The main features of this technique are focused on two DNA targets, one located in the nuclear genome (vicilin-li PCR test) and a second one based on chloroplast DNA (lipids PCR test), which successfully passed the performance criteria considering the specificity, sensitivity, efficiency of amplification, robustness, and applicability in processed cocoa-derived products and chocolate. Key words Chloroplast DNA, Chocolate, DNA extraction, Nuclear DNA, Theobroma cacao, qPCR

1

Introduction Cocoa bean (Theobroma cacao L.) is an international agricultural commodity largely produced in several countries, and it is the key raw material in chocolate manufacturing. Since cocoa deliveries are frequently characterized by vast heterogeneity in their quality attributes, a reliable quality assessment is of great importance for both producers and purchasers. Molecular authenticity based on the analysis of DNA extracted from cocoa-derived products could open new opportunities for the marketing of cocoa beans from a single origin and help to check the quality requirements, as well as being a preliminary stage in the future development of fast and

Lucı´lia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967, https://doi.org/10.1007/978-1-0716-3358-8_7, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

75

76

Ana Caroline De Oliveira et al.

cost-effective tests to differentiate bulk and fine cocoa for the chocolate industry [1]. Food authentication has increasingly become at the forefront of consumer concerns, industry strategies, and government policy initiatives and also an essential element of the agricultural supply chain quality assurance management system [2]. The European Union defines several specific common rules for cocoa and chocolate products that complement the legislation applicable to foodstuffs [1]. In this context, DNA technologies (extraction and amplification) represent a useful tool in food authenticity and regulation. DNA quality is an essential element for most amplificationbased analyses. In particular, the quality of nucleic acids extracted from cocoa-derived product samples is influenced by different factors including the presence of PCR inhibitors mainly phenolic compounds and polysaccharides, the level of DNA damage, and the average fragment length of the nucleic acid obtained. These factors are dependent on the sample itself and the processes carried out during the production of the cocoa and chocolate such as high temperature or the presence of an alkalizing step, which could considerably degrade the DNA into small fragments and, consequently, affect detection by PCR amplification [3, 4]. In highly processed foods, real-time PCR techniques are proving to be useful alternatives owing to the great sensitivity and specificity in detecting minute amounts of DNA in processed foods. Real-time PCR is a very sensitive approach that can amplify very low amounts of DNA of plant species in foodstuffs [3]. It is however necessary to know if amplifiable DNA can be recovered from the processed products considered to ensure the applicability of the methods [4]. This chapter is dedicated to the description of a protocol for cocoa DNA extraction from highly processed cocoa products and chocolate and further analysis of the extracted DNA by TaqMan real-time PCR assay using a specific set of primers and probe targeting chloroplast and nuclear genome of T. cacao allowing the authentication of cocoa-derived products. Therefore, the described methodology is valuable for cocoa authentication purposes and constitutes a preliminary step for developing an easy, fast, and cost-effective real-time PCR-based method for the distinction between “fine” and “bulk” cacao genotypes.

2 2.1

Materials General Supplies

1. Sterile DNase-free microtubes of 1.5 mL and 2.0 mL. 2. Micropipettes of variable volume and their respective tips (0.1–2.5 μL; 0.5–10 μL; 10–100 μL; 100–1000 μL). 3. Water purification system (Milli-Q, Millipore). 4. Sterile nuclease-free ultrapure water.

Cocoa-Derived Products Authentication

2.2

DNA Extraction

77

1. Mortar and pestle. 2. Hot water bath or thermal block. 3. Spectrophotometer (NanoDrop). 4. Vortex mixer. 5. Microcentrifuge. 6. Isopropanol, stored at -20 °C. 7. 70% and 95% ethanol, stored at -20 °C. 8. 20 mg/mL RNase A. 9. 20 mg/mL proteinase K. 10. DNA extraction CTAB buffer (CTAB 1): 20 g/L of CTAB, 1.4 mol/L of NaCl, 0.1 mol/L of Tris hydrochloride solution, 0.02 mol/L of Na2EDTA, pH 8.0 (to facilitate the dissolution of the components, preheat on a hot plate with stirring at 65 °C). Autoclave for sterilizing the solution. 11. DNA precipitation buffer CTAB (CTAB 2): 5 g/L of CTAB, 0.04 mol/L of NaCl. 12. NaCl solution (CTAB 3): 1.2 mol/L of NaCl.

2.3

Real-Time PCR

1. QuantStudio 3 or 5 Real-Time PCR Systems (Thermo Fisher Scientific). 2. Microplate centrifuge. 3. MicroAmp® Optical 96-Well Reaction Plate (Thermo Fisher Scientific). 4. MicroAmp optical adhesive film (Thermo Fisher Scientific). 5. TaqMan Universal Master Mix or TaqMan Fast Universal Master Mix (Applied Biosystems). 6. Primers and probes set for vicilin-like seed storage protein (nuclear target) and lipids (chloroplast target) (see Table 1). 7. FAM-TAMRA-labeled oligonucleotide probe.

3 3.1

Methods DNA Extraction

1. DNA is extracted using a CTAB-based protocol [5]. Prepare CTAB solutions, use within 3 months, and store capped in the refrigerator at 4 °C. 2. For the DNA extraction from the cocoa-derived and chocolate samples, prepare the samples as described (see Note 1): For raw cocoa beans: (a) Freeze dry the sample material for 24 h. (b) Grind sample material with a mortar and pestle, and weigh 200 mg of it into a 2.0 mL microtube.

78

Ana Caroline De Oliveira et al.

Table 1 Primers and probes used for cocoa detection in processed cocoa-derived products Oligonucleotide designation

Sequence (5′-3′)

Amplicon size (bp)

Target

NCBI acc. no.

Lipids (chloroplast target)

XM007027212 Forward primer

86

Vicilin-like seed storage protein (nuclear target)

XM018124728 Forward primer

77

TCCCTTATTCCCA ATTTTCTCCTT Reverse primer AGATTGGGAGAG TTCGGTTTCTAA Probe (FAM-TAMRA CCAAGAAACAAAA labeled) CCCGAAACGCCA CCCAAACTACTAA AGCCCTCATCT Reverse primer GCTTTGCCCATGC TTTCG Probe (FAM-TAMRA CTTCCCTCCCCT labeled) CACCTCAAAAACTCAA

For fermented and dried or roasted beans: (a) Grind sample material with a mortar and pestle, and weigh 200 mg of it into a 2.0 mL microtube. For chocolate: (a) Chop finely into small pieces. (b) Weigh 200 mg of crushed sample into a 2.0 mL microtube. 3. Add 1.5 mL CTAB 1 buffer, 5 μL of 20 mg/mL RNase A to each sample (200 mg in 2.0 mL microtube), and vortex vigorously. 4. Incubate for 30 min at 60 °C (shake after 15 min to resuspend the material). 5. Add 10 μL of 20 mg/mL proteinase K and vortex. 6. Incubate for 30 min at 60 °C (shake after 15 min to resuspend the material). 7. Centrifuge for 10 min at 15,000g. 8. Transfer the supernatant into a new 1.5 mL microtube. 9. Centrifuge for 10 min at 15,000g. 10. Transfer 900 μL of supernatant into a new 2.0 mL microtube containing 900 μl of chloroform. 11. Vortex for 30 s. 12. Centrifuge for 15 min at 15,000g. 13. Transfer 650 μL of supernatant into a new 2.0 mL microtube.

Cocoa-Derived Products Authentication

79

14. Add 1300 μL of CTAB 2 (precipitation buffer). 15. Incubate for 60 min at room temperature. 16. Centrifuge for 15 min at 15,000g. 17. Carefully decant the supernatant without disturbing the pellet. 18. Add 700 μL of CTAB 3 (NaCl solution) and vortex to dissolve the DNA. 19. Add 700 μL of chloroform and vortex for 30 s. 20. Centrifuge for 10 min at 15,000g. 21. Pipette 600 μL of the aqueous phase (top) taking care not to aspirate any of the chloroform phase. 22. Place the aqueous phase into a new 2.0 mL microtube. 23. Add 0.6 volume (360 μL) of isopropanol, and mix the tubes gently by inverting them four to five times (see Note 2). 24. Incubate for 20 min at room temperature. 25. Centrifuge for 15 min at 15.000g. Position the tubes in an equal fashion to facilitate the subsequent removal of supernatant without disturbing the resulting DNA pellet. 26. Eliminate the supernatant carefully without disturbing the DNA pellet (see Note 2). 27. Add 500 μL of cold (-20 °C) 70% ethanol, and mix the tubes gently by inverting them four to five times. 28. Centrifuge for 10 min at 15,000g. 29. Eliminate the supernatant carefully without discarding the DNA pellet (see Note 2). 30. Dry the pellet in a vacuum centrifuge or on a thermal block at 55 °C. 31. Resuspend the DNA with 100 μL of molecular biology-grade water. 32. After the extraction, the sample is ready to use for further downstream applications (see Note 3). 33. The extracted DNA must be quantified spectrophotometrically using the absorbance at 260 and 280 nm (see Note 4). 3.2 TaqMan RealTime PCR

The reaction components are assembled in a final volume of 25 μL as described below: 1. Keep all reaction components on ice (see Note 5). 2. Mix and prepare master mix in 1.5 mL microcentrifuge tubes, following the proportions indicated in Table 2. Prepare the reaction mix for each target separately. The final volume of the master mix depends on the number of reactions required for each real-time PCR (see Note 6).

80

Ana Caroline De Oliveira et al.

Table 2 Components of real-time PCR

Mix reagents

Target final concentration

Volume for single reaction (μL)

Final volume for the number of reactions required (μL)

2× TaqMan Master Mix

1×

12.5

N × 12.5

Forward primer (15 μM)

0.3 μM

0.5

N × 0.5

Reverse primer (15 μM)

0.3 μM

0.5

N × 0.5

Probe (15 μM)

0.3 μM

0.5

N × 0.5

Nuclease-free water

–

6.0

N × 6.0

3. Mix gently by vortexing and briefly centrifuge to settle down the tube contents. 4. Carefully aliquot 20 μL of template master mix into each plate well. Set up the real-time PCR in a 96-well plate, including nontemplate control (NTC) (see Note 7), positive control (see Note 8), and the experimental sample (see Note 9). Setup reaction: (a) For NTC reactions, add 5 μL of water to the corresponding plate well. (b) For the experimental samples reactions, add 5 μL of DNA template to the corresponding plate well. (c) For the positive control reactions, add 5 μL of reference material to the corresponding plate well. 5. After pipetting, seal the plate with optical adhesive film. 6. Centrifuge the 96-well plate briefly to remove any air bubbles, and load the plate onto a Real-Time PCR System. 3.3

Thermocycling

1. Incubate the 96-well plate containing the DNA and the master mix in a Real-Time PCR System. 2. Run the program with the standard or fast cycling: (a) Standard cycling: 10 min at 95 °C (initial denaturation) and 40 cycles of 15 s at 95 °C (denaturation) and 1 min at 60 °C (annealing and extension). (b) Fast cycling: 20 s at 95 °C (initial denaturation) and 40 cycles of 3 s at 95 °C (denaturation) and 30 s at 60 ° C (annealing and extension).

Cocoa-Derived Products Authentication

3.4

Program and Run

81

1. Operate the Real-Time PCR System and software according to the manufacturer’s recommendations. Define the experiment properties including the set reaction volume to 25 μL and the amplification program. Use FAM-TAMRA as a detector/ quencher. 2. Briefly, launch the software, and open a new plate template window to denote well locations on the 96-well plate for the controls and experimental samples. Define the plate wells with sample names and targets. Save the template window with the recorded data as a run file. 3. Load the 96-well plate in the instrument. Select the “Start Run” button to begin the actual run and determine Cq (cycle threshold) values for each sample.

3.5 Data Collection and Analysis

4

1. After the run is completed, select baseline (see Note 10), and place the threshold line at the exponential phase of amplification (see Note 11). Remove the plate from the instrument and save the results of the run. When the analysis button is selected in the software, the results will be analyzed automatically if the standards and testing sample information were recorded as noted in the previous section. The obtained Cq values should be thoroughly reviewed, and interpretation of the results must be made taking into account the acquired data in the internal validation performed in each laboratory for a given detection limit (see Note 12).

Notes 1. DNA extraction can be carried out using an increased sample weight (up to 1 g in the case of matrices likely to contain low amount of DNA). In this case, the volumes of the reagents used must be adapted accordingly. 2. Absolute isopropanol should be kept at -20 °C before use, as the low temperature decreases DNA solubility and allows faster and more efficient precipitation. It should be noted that, depending on its concentration, the DNA pellet may not be visible or can appear only as a thin smear on the microtube wall, so the supernatant removal should be carefully performed to avoid accidental discard of DNA. 3. The DNA can be stored at 4 °C if used in the next few days or at -20 °C in the freezer for long-term storage. 4. The extraction protocol will inevitably result in DNA solutions containing contaminants that may inhibit PCR, so we suggest selecting samples with purity ratios of A260/280 superior to 1.6 and A260/230 superior to 1.0, as lower ratios indicate

82

Ana Caroline De Oliveira et al.

high contamination with proteins or organic compounds/ chaotropic salts, respectively, and which may affect the assay. Values higher than 2 may be due to the presence of RNA in the DNA solution. If the DNA purity is not adequate, DNA extraction should be repeated. 5. Prepare a stock solution of 100 μM of TaqMan probe and primers with molecular biology-grade water. This stock solution can be diluted to achieve a working solution concentration (15 μM). Probe working solutions should be aliquoted in volumes that are sufficient for one-time use. These aliquots should be stored at -20 °C. In addition, repeated freezethaw cycles and long exposure to the light of probe solutions should be avoided. 6. Master mixes can be made more than what is needed to account for pipetting variations, i.e., prepare 10% excess of the master mix. 7. Negative reaction control (NTC) produces amplification. A signal in the no template control demonstrates amplicon contamination in the master mix reagents. It is often easier to simply repeat the real-time PCR using new reagents (except DNA prep). If the problem disappears, one can proceed. 8. The positive control is a reaction with DNA extracted from cocoa material used as a reference for limit detection of the technique [6]. The reference material used may be cocoa powder. 9. Test samples should be analyzed in duplicate or triplicate according to individual laboratory statistical requirements. If the samples display large variability between Cq of duplicate or triplicates, there might be a problem in the preparation of the master mix or a pipetting error. Check whether the master mix was prepared and mixed correctly and if the micropipettes are calibrated and dispensing the appropriate volume of liquid reproducibly. 10. The amplification curve begins after the maximum baseline. If the amplification curve begins too far to the right of the maximum baseline, the end cycle value increases. If the curve begins before the maximum baseline, the end cycle value decreases. 11. The threshold is set in the exponential phase of the amplification curve. Threshold settings above or below the optimum increase the standard deviation of the replicate groups. When the threshold is settled below the exponential phase of the amplification curve, the standard deviation is significantly higher than that for a plot where the threshold is set correctly. Similarly, when the threshold is fixed above the exponential phase of the amplification curve, the standard deviation is

Cocoa-Derived Products Authentication

83

significantly higher than that for a plot where the threshold is set correctly. Drag the threshold bar down or up into the exponential phase of the curve, if necessary. 12. The amplification plot is useful for identifying and examining abnormal amplification. Abnormal amplification can include increased fluorescence in negative control wells and the absence of detectable fluorescence at positive control wells. References 1. Perez M, Lopez-Yerena A, Vallverdu´-Queralt A (2020) Traceability, authenticity and sustainability of cocoa and chocolate products: a challenge for the chocolate industry. Crit Rev Food Sci Nutr 62:475. https://doi.org/10.1080/ 10408398.2020.1819769 2. Hassoun A, Abdullah NA, Aı¨t-Kaddour A, ¨ nal B, Ghellam M, Bes¸ird A, Zannou O, O Aadil RM, Lorenzo JM, Khaneghah AM, Regenstein JM (2022) Food traceability 4.0 as part of the fourth industrial revolution: key enabling technologies. Crit Rev Food Sci Nutr. https://doi.org/10.1080/10408398.2022. 2110033 3. Kang TS (2019) Basic principles for developing real-time PCR methods used in food analysis: a review. Trends Food Sci Technol 91:574–585. https://doi.org/10.1016/j.tifs.2019.07.037

4. Mano J, Nishitsuji Y, Kikuchi Y et al (2017) Quantification of DNA fragmentation in processed foods using real-time PCR. Food Chem 226:149–155. https://doi.org/10.1016/j. foodchem.2017.01.064 5. AFNOR XP V03-020-2. (2008) Produits alimentaires. De´tection et quantification des organismes ve´ge´taux ge´ne´tiquement modifie´s et produits de´rive´s. Partie 2: Me´thodes base´es sur la re´action de polyme´risation en chaıˆne. Norme expe´rimentale 6. De Oliveira AC, Marien A, Hulin J et al (2022) Development of real-time PCR methods for cocoa authentication in processed cocoa-derived products. Food Control 131:108414. https:// doi.org/10.1016/j.foodcont.2021.108414

Chapter 8 Quantitative Real-Time PCR for the Detection of Allergenic Species in Foods Joana Costa, Caterina Villa, and Isabel Mafra Abstract Food allergy is an increasing challenge to public health, with widespread global distribution. With no cure for this pathology, the food-allergic individuals are forced to adopt food eviction measurements, relying on label information to avoid consuming the offending foods. To safeguard these individuals, the analytical methods based on real-time PCR approaches are currently faced as excellent tools to verify labeling compliance, aiding industry and regulatory agencies to efficiently manage food allergen control programs. Therefore, this chapter intends to describe a protocol of real-time PCR to analyze allergenic food species. For method development, the main steps to be considered are (i) in silico sequence analysis and primer/ hydrolysis probe design, (ii) preparation of calibrators (model foods containing the allergenic ingredient), (iii) efficient DNA extraction from complex food matrices, (iv) amplification by real-time PCR with hydrolysis probe (90–200 bp) targeting a highly specific DNA region (allergen-encoding gene), (v) sequencing PCR products for identity confirmation, and (vi) validation and application to commercial foods. Herein, a real-time PCR approach for the detection and quantification of cashew nut as an allergenic food is described as an example protocol, including all the steps for method development and validation. Key words Food allergen, Real-time PCR, Detection, Quantification, Allergen-encoding genes

1

Introduction Food-induced allergy is an emerging public health issue, as well as an increasing societal challenge, which is transversal to different countries and world regions. Food allergy is an immunological disease mediated by immunoglobulin E (IgE), and there is no cure for this pathology, meaning that food-allergic patients are recommended to eliminate the causative offending foods from their diet [1, 2]. However, these individuals are still at risk of suffering accidental allergic reactions due to the inadvertent presence of hidden allergens in foods and must rely on the labeling information to avoid accidental exposure. In the European Union, the legislation compels the labeling of 14 groups of allergenic ingredients, namely, cereals containing gluten, peanut, tree nuts,

Lucı´lia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967, https://doi.org/10.1007/978-1-0716-3358-8_8, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

85

86

Joana Costa et al.

soybean, fish, crustaceans, egg, milk, mollusks, mustard, sesame, lupine, celery, and sulphites, which must be highlighted from the rest of the list of ingredients, regardless of their amount [3]. Consequently, the advancement of proficient analytical tools to detect and quantify allergenic components of foods, capable of verifying labeling compliance as well as the efficiency of allergen cleaning plans in the food industry, is much needed [4]. For several years, the analytical methods targeting allergens (proteins), especially the enzyme-linked immunosorbent assays (ELISA), have been the preferential approaches for allergen control, mostly due to their simplicity, rapidity, minimal requirement for specialized personnel, and availability as commercial kits. However, since they rely on protein-antibody recognition, they are highly prone to false-positive or false-negative results due to cross-reactivity phenomena or structural changes of marker proteins induced by food processing, respectively. More recently, DNA-based methods gained great attention because they take advantage of the higher stability of nucleic acids over proteins toward harsh processing, as well as the high specificity conferred by the uniqueness of selected marker sequences. Real-time PCR has been the preferred DNA-based technique for the detection of allergenic foods due to the high specificity and sensitivity and rapid performance, providing quantitative and multiplex analysis [5]. Real-time PCR approaches can be tailored for each allergenic food by selecting species-specific regions that can be allergenencoding sequences, including different DNA or mRNA sequences. Allergen-encoding genes are often targeted for their high specificity (no cross-reactivity with nontarget species), although other DNA regions (e.g., multicopy genes) are also being used because of their potential for high sensitivity [4, 6]. For quantification purposes, real-time PCR methods must rely on the use of calibrators, which should be based on model foods containing known amounts of the target allergenic ingredient. Calibrators may include different allergenic ingredients (e.g., walnut, almond, hazelnut, sesame, lupine, soybean) in a matrix that should be as close as possible to the foods to be tested, such as cookies, ice creams, bread, chocolates, sausages, and cooked hams, among others [7–16]. The calibrators for method development should go down to trace levels (e.g., 0.1–1 mg/kg of allergenic food in matrix) to comply with the requirements of high sensitivity for food allergen analysis and cover the widest range possible (e.g., 0.0001% (1 mg/kg) to 50% (500,000 mg/kg)). Real-time PCR methods targeting single food species are among the most used approaches for allergen detection (Fig. 1) [8, 9, 12, 13, 15–17]. Multiplex real-time PCR assays for the simultaneous detection of two or more allergenic targets provide cost-effective and high-throughput tools [18–21], though often compromising sensitivity. Moreover, other types of real-time PCR have also been successfully proposed for improved sensitivity and

Real-Time PCR for Allergenic Food Detection

87

Fig. 1 Schematic representation of a real-time PCR assay targeting Ana o 3 gene from cashew nut

PCR efficiency, namely, single-tube nested real-time PCR and normalized real-time PCR, respectively. The former combines the advantages of nested PCR (two primer pairs) with real-time PCR (probe) in a single run, thus allowing to increase the sensitivity and specificity of the method [8–11, 17]. A normalized real-time PCR method is based on the simultaneous amplification of two DNA targets, namely, a species-specific marker sequence (target gene) and a universal region to serve as an endogenous (reference) sequence [7, 11, 14], which enables to obviate the variability of food matrices and processing treatments. Therefore, the development of a real-time PCR method should consider the target allergenic food, the matrix and food processing conditions, as well as the required levels of specificity and sensitivity. In any case, the methods for allergen analysis must be validated, considering the applicable acceptance criteria regarding the calibration curve parameters of the slope, PCR efficiency, coefficient of correlation, and dynamic range, as well as trueness, precision, repeatability, and reproducibility [22, 23]. This chapter intends to provide detailed steps for developing a real-time PCR method for allergenic food analysis. With this aim, the development and validation of a real-time PCR for the detection and quantification of cashew nut as an allergenic food in a complex matrix (biscuits) is described as an example. The method targets a mRNA region (first step of gene expression for protein production), which encodes the Ana o 3 allergen, including the required optimization steps, from the in silico analysis and primer/ probe design to model food preparation and attainment of the calibration curve, ending up with the assessment of analytical performance parameters for validation [11].

2

Materials Prepare all solutions with analytical-grade reagents and PCR-grade water (DNase- and RNase-free water) (see Note 1). Prepare and keep all solutions at room temperature (unless otherwise stated).

88

Joana Costa et al.

For DNA extraction and PCR analysis, use molecular biologygrade reagents (sterile, DNase-, and RNase-free) and consumables (e.g., reaction tubes, filtered tips, PCR tubes, real-time PCR strips, and caps). Other non-sterile materials and consumables can also be used after being carefully in-house autoclaved (121 °C, 15 min) or chemically decontaminated with a DNA/RNA cleaning solution (see Note 2). Use a PCR workstation to manipulate the DNA extracts and PCR reagents, as well as to execute all tasks related to the preparation of PCR or real-time PCR mixes. Follow all waste disposal regulations/procedures when discarding waste materials, consumables, and reagents. 2.1 Bioinformatic Tools

1. Use the NCBI database (https://www.ncbi.nlm.nih.gov/), and select DNA or mRNA sequences of potential interest for the unequivocal identification of the allergenic species (e.g., allergen-encoding genes or mRNA sequences) (see Note 3). 2. Use BLASTn (basic local alignment search tool for nucleotides) (https://blast.ncbi.nlm.nih.gov/Blast.cgi) to identify regions of local similarity between the selected nucleotide sequence and orthologues of different species. 3. Select DNA regions of none or very low local similarity between target species and orthologous genes, as templates for primer design. 4. Upon sequence selection, use Primer-BLAST (https://www. ncbi.nlm.nih.gov/tools/primer-blast/) with appropriate criteria to design primers (see Note 4).

2.2

Reagents

1. DNA extraction: NucleoSpin Food kit (Macherey-Nagel, Du¨ren, Germany) (see Note 5). 2. Agarose gel electrophoresis: 1.5% of agarose in 1× SGTB (Grisp, Porto, Portugal) or 2% agarose in TAE (40 mM Trisacetate, 1 mM EDTA) buffer with 1× GelRed (Biotium Inc., Hayward, CA, USA); DNA marker (e.g., DNA 100 bp marker, Bioron GmbH, Ro¨merberg, Germany); loading buffer (4% (w/v) sucrose, 0.05% (w/v) bromophenol blue, 120 mM EDTA). 3. Qualitative PCR mix: SuperHot Taq DNA polymerase (e.g., Genaxxon Bioscience GmbH, Ulm, Germany) that includes 10 × buffer and 25 mM of MgCl2; PCR-grade water; 10 mM of dNTP mix and primers (forward/reverse) outsource synthesized (e.g., Eurofins Genomics, Ebersberg, Germany). Choose a Taq DNA polymerase that is chemically inactivated prior to the activation step (normally at 95 °C for 5–10 min) to maximize PCR formation without unspecific amplification. 4. PCR product purification kit (e.g., GRS PCR & Gel Band Purification Kit, Grisp, Porto, Portugal).

Real-Time PCR for Allergenic Food Detection

89

5. Real-time PCR mix with hydrolysis probe: pre-prepared mixes containing all the reaction components (buffer, dNTP, enzyme, and Mg2+) are normally better choices (e.g., SsoAdvanced Universal Probes Supermix, Bio-Rad Laboratories, Hercules, CA, USA) (see Note 6); PCR-grade water; primers (forward/reverse) and hydrolysis probe outsource synthesized (e.g., Eurofins Genomics, Ebersberg, Germany). 2.3

Equipment

1. Laboratory knife mill Grindomix GM200 (Retsch, Haan, Germany). 2. Thermomixer block (e.g., thermomixer comfort, Eppendorf AG, Hamburg, Germany). 3. Refrigerated centrifuge (e.g., Heraeus Fresco 17, Thermo Scientific, Osterode am Harz, Germany). 4. Vortex stirrer. 5. Water bath (0–100 °C). 6. Microplate reader UV/Vis spectrophotometer (SPECTROstar Nano, BMG Labtech GmbH, Ortenberg, Germany) with microvolume plate accessory for nucleic acid and protein quantification (BMG LVis MicroDrop, SPECTROstar Nano, BMG Labtech GmbH, Ortenberg, Germany), software SPECTROstar Nano v2.1 (SPECTROstar Nano, BMG Labtech GmbH, Ortenberg, Germany) for data acquisition, and MARS Data Analysis software (BMG Labtech GmbH, Ortenberg, Germany) for data analysis (see Note 7). 7. DNA electrophoresis apparatus (electrophoresis tanks and power supply). 8. PCR workstation with UV cleaner-recirculator, UV light, and white lamp (e.g., VWR International GmbH, Darmstadt, Germany). 9. UV light photographic system (e.g., UV light tray Gel Doc™ EZ Imager, Bio-Rad Laboratories, Hercules, CA, USA) and respective image recording software (Image Lab software version 5.2.1, Bio-Rad Laboratories, Hercules, CA, USA). 10. Thermal cycler (e.g., SimpliAmp™ Thermal Cycler (Applied Biosystem™, Thermo Fisher Scientific, Waltham, MA, USA)). 11. Real-time PCR thermocycler (e.g., CFX96 Real-time PCR System, Bio-Rad Laboratories, Hercules, CA, USA) capable of reading at least one fluorophore (e.g., FAM) and respective software for real-time PCR data analysis (Bio-Rad CFX manager 3.1, Bio-Rad Laboratories, Hercules, CA, USA).

90

3

Joana Costa et al.

Methods To advance a real-time PCR protocol for food allergen analysis, the assessment and optimization of several experimental conditions should be previously performed, namely, selecting the most appropriate DNA extraction method to ensure the best quality/ yield/purity of extracts, designing a set(s) of primers and hydrolysis probe to guarantee the best specificity and sensitivity of the method, evaluating the best real-time PCR protocol (e.g., fast, standard, normalized, non-normalized, etc.), and including the amount of primers/probe in the mix and temperature program. In this specific chapter, a real-time PCR method for the detection of cashew nut as an allergenic ingredient in different matrices is described as an example protocol, whose development includes several optimization tests [11]. To maximize reproducibility, all steps should be performed at a controlled room temperature (20 °C) unless otherwise stated. Perform all tasks related to the preparation of PCR mixes and manipulation of DNA extracts in a sterilized PCR workstation using refrigerated platforms to avoid the degradation of the extracts and the accidental activation of the amplification enzymes.

3.1

In Silico Analysis

1. Consult the NCBI database, and select regions (gene or mRNA sequences) for the potential discrimination of the target species (Anacardium occidentale) (see Note 8). Look for local similarities with orthologue genes/sequences using the BLASTn algorithm (see Note 9). 2. Design primers and hydrolysis probe, either manually or using primer designing tools, such as Primer-BLAST (https://www. ncbi.nlm.nih.gov/tools/primer-blast/) (see Note 10). Check the properties of primers and hydrolysis probe (physicochemical parameters, absence of hairpins, 3′-complementary and selfannealing) using specific algorithms (e.g., OligoCalc: Oligonucleotide Properties Calculator, http://biotools.nubic.north western.edu/OligoCalc.html). Verify the specificity of the designed primers and hydrolysis probe with target and nontarget sequences using the software Primer-BLAST (see Note 11). 3. Order primers (Ana 3-F, AGGTACGTGAAGCAGGAGGT CCA and Ana3-R, GCTGCAGCTGCCTCACCATTTG) and hydrolysis probe (Ana3-P, FAM-AAAGCTTGAGGGAATGC TGCCAGGAGTT -BHQ1) [11] synthesis in specialized outsourced facilities (e.g., Eurofins Genomics, Ebersberg, Germany), which might take up to 1 week, depending on the selected production facility.

Real-Time PCR for Allergenic Food Detection

3.2 Preparation of Model Foods

91

Although some reference materials have been proposed by the Standard Reference Materials Program of the National Institute of Standards and Technology (NIST, Gaithersburg, USA) for food allergen analysis, they are still in a development phase, and none of them can mimic real foods. Therefore, for method development, the preparation of reference/model foods is a crucial step. Herein, it is provided an example of a model food based on biscuits containing known amounts of cashew nut [11]: 1. Prepare a dough matrix using the following ingredients and recipe, namely, 225 g of wheat flour (Triticum aestivum), 100 g of sugar, 90 g of butter, and 50 mL of milk. 2. Ground cashew nut into a fine powder of approximately 0.3 mM of diameter in a laboratory knife mill. 3. Prepare the model reference foods with concentrations of 100,000 mg/kg, 50,000 mg/kg, 10,000 mg/kg, 5000 mg/kg, 1000 mg/kg, 500 mg/kg, 100 mg/kg, 50 mg/kg, 10 mg/kg, 5 mg/kg, 1 mg/kg, (w/w) of cashew nut in the dough. Add 30 g of cashew nut to 270 g of dough to prepare the first model mixture of 10% (100,000 mg/kg). Prepare the following concentrations by serial additions of dough until the level of 0.0001% (1 mg/kg). 4. Divide each mixture into two portions. Immediately store one portion at -20 °C to serve as raw model foods, while the second portion should be oven-baked at 180 °C for 20 min to simulate the production of biscuits. After cooling, ground the biscuits to a fine powder of approximately 0.3 mM of diameter with a laboratory knife mill, and store at -20 °C until DNA extraction.

3.3

DNA Extraction

The selection of an appropriate protocol to extract DNA from foods with high purity and yield is a critical step for the successful development of real-time PCR methods. Firstly, the DNA extraction protocol should be selected according to the composition of the food(s) to be analyzed. This might require testing several DNA extraction protocols. The NucleoSpin Food Kit (Macherey-Nagel, Du¨ren, Germany) has proved to be appropriate for most food matrices, thus being the recommended protocol for the detection of allergenic species. Herein, it is described its protocol according to manufacturer’s instructions with minor alterations (see Note 5): 1. Weigh approximately 200 mg of material (raw dough or grounded (model) food) in a 2.0 mL sterile reaction tube. Add 550 μL of CF buffer (preheated at 65 °C) to each tube and 10 μL of proteinase K (10 mg/mL) solution, vortex vigorously, and incubate for 1 h at 65 °C in the thermomixer (~1000 rpm). Vortex occasionally (every 15–20-min interval) during incubation.

92

Joana Costa et al.

2. After lysis incubation, add 2–5 μL of RNase A (2 mg/mL) and incubate for 5 min at room temperature (see Note 12). 3. Centrifuge the tubes at 4 °C, 17,000 × g for 10 min and remove the supernatant carefully to a new tube. Perform a second centrifugation in the same conditions but for 5 min (see Note 13). 4. Transfer the supernatant to a new 2.0 mL sterile reaction tube, and add similar volume of C4 and ethanol (e.g., if 450 μL of supernatant is transferred, add 450 μL of C4 buffer and 450 μL of ethanol 100%). Mix gently by pipetting or tube inversion and transfer all volume to the NucleoSpin Food column. Centrifuge for 1 min at 11,000 × g (room temperature), and discard the flowthrough (the column has a maximum capacity of 700 μL, so repeat loading until the total volume of sample has passed the column). 5. Wash the silica membrane (NucleoSpin Food column) with 400 μL of CQW, 700 μL and 200 μL of C5, respectively, and centrifuge for 1 min (11,000 × g, room temperature) after each wash or 2 min after the final wash, discarding the supernatant after each centrifugation. Ensure that the column is dry after the final centrifugation (residues of ethanol will inhibit DNA polymerase). 6. After the washing steps, place the column in a new 1.5 mL sterile reaction tube, and add 100 μL of elution buffer (CE) (5 mM Tris–HCl, pH 8.5) preheated at 70 °C. Incubate for 5 min and elute DNA through 1-min centrifugation (11,000 × g, room temperature) (see Note 14). 3.4 Determination of DNA Yield and Purity

1. Use a microplate reader UV/Vis spectrophotometer with microvolume plate accessory for nucleic acid quantification. Calibrate the microvolume plate accessory (16 wells) with 4 μL of pure water (e.g., PCR water) and validate the assay. 2. Add 4 μL of each DNA extract (in duplicate) to each spot of the microvolume plate accessory, and read the absorbencies at 230, 260, 280, and 320 nM. The purity and yield of each DNA extract will be automatically assessed, following the nucleic acid quantification protocol with sample type defined for dsDNA. 3. Dilute DNA extracts to a specific concentration (for extracts from allergenic foods, a final DNA concentration of 50–100 ng/μL is highly recommended). Store DNA extracts and dilutions at -20 °C until analysis.

Real-Time PCR for Allergenic Food Detection

3.5

Qualitative PCR

93

1. Prepare the PCR mix for a total volume of 25 μL by mixing all the components needed for the specified reaction. Add PCR-grade water (adjust the volume considering the total amount of remaining reagents), 2.5 μL of buffer 10×, 2.0 μL of 10 mM of dNTP, 3.0 μL MgCl2 (3.0 mM), 7.0 μL of each primer (Ana3-F/Ana3-R) (280 nM), and 0.2 μL of SuperHot Taq DNA polymerase (1.0 U). 2. Add 23 μL of the reaction mix and 2 μL of DNA extract (100–200 ng) in each 0.2 mL reaction tube. Include a positive (DNA from target species) and a negative (no DNA template) control in the PCR amplification. 3. Set the temperature program in the thermal cycler, which was previously optimized [11]: initial denaturation at 95 °C for 5 min; 40 cycles at 95 °C for 30 s, 65 °C (Ana3-F/ Ana3-R) for 30 s, and 72 °C for 30 s; and a final extension at 72 °C for 5 min. 4. Prepare a 1.5% agarose gel stained with GelRed 1× (Biotium Inc., Hayward, CA, USA) to visualize the amplicons. Mix 20 μL of the PCR product with 4 μL of loading buffer, apply to gel wells, and run electrophoresis using SGTB 1× (Grisp, Porto, Portugal) for 25–30 min at 200 V. For each gel, use a DNA marker (e.g., DNA 100 bp marker, Bioron GmbH, Ro¨merberg, Germany) according to the size of expected PCR products. Add 4 μL of loading buffer to unstained DNA markers and load to each gel. 5. Visualize the agarose gel with a UV light tray and the Gel Doc EZ Imager using the GelRed dye protocol. Register a digital image with Image Lab software version 5.2.1 and analyze the results.

3.6

DNA Sequencing

It is highly recommended to confirm the size and sequence of the amplified PCR products, especially if primers are previously designed in mRNA sequences [10] (see Note 8). Therefore, the amplicons should be analyzed by Sanger sequencing that can be easily outsourced. Prior to sequencing, it is recommended a cleaning step of PCR products, which can be performed according to the following steps: 1. Go to Subheading 3.5 “Qualitative PCR,” and execute the described steps to obtain the PCR products from the template species (e.g., cashew nut, pistachio nut) (see Note 15). 2. Use a PCR Purification Kit to remove the interferents that are present in the amplified PCR products (e.g., remaining components of amplification reaction like primers, dNTP, enzyme). Perform amplicon purification according to manufacturers’ instructions (see Note 16).

94

Joana Costa et al.

3. Place the purified PCR products into two sterile reaction tubes, and add primer-F or primer-R (e.g., Ana3-F or Ana3-R) to the respective tube (this will ensure sequencing both strands in the opposite directions of each target amplicon). Tag each tube, and send them to a specialized research facility (Eurofins Genomics, Ebersberg, Germany) for direct Sanger sequencing (see Note 17). 4. Verify the quality of the electropherograms using an appropriate software (e.g., FinchTV 1.4 software, Geospiza Inc., https://digitalworldbiology.com/FinchTV). Analyze the PCR electropherograms and align the high-resolution/quality product sequences with the consensus sequence. For sequence alignment, use a sequence alignment tool/software like BIOEDIT v7.2 (Biological Sequence Alignment Editor, https:// bioedit.software.informer.com/versions/) or MEGA (Molecular Evolutionar y Genetics Analysis, https://www. megasoftware.net/) (see Note 18). 5. Critically analyze the sequencing data, assessing the size and nucleotide identity, and compare it with the consensus sequence. 3.7 Real-Time PCR with Hydrolysis Probe

When performing a real-time PCR run, the components of the reaction mixture, namely, the amounts of primers/probe and template DNA, should be previously adjusted, as well as the temperature program that should be appropriate for each primer/ probe set (see Note 19). The following steps were previously evaluated and defined when developing a real-time PCR approach for the detection of Ana o 3-encoding gene [11] using the CFX96 Real-Time PCR System and respective software (Subheading 2.3) (see Note 20): 1. Open the startup wizard of Bio-Rad CFX Manager 3.1, and define the program of temperatures (protocol total duration 0.9 (see Note 27). 3.4 qPCR Calibration Curve Construction for Each Target Species

1. Start by extracting gDNA from the samples prepared as described in Subheading 3.1, using the method described in Subheading 3.2. 2. Dilute all the DNA samples at least 1:10 (see Note 31), in DNase-free water. 3. Repeat the steps 2–6 described in Subheading 3.3. 4. Add an inter-run calibrator to the qPCR 96-well plate (see Note 32). 5. Normalize the results of the cycle threshold using the equation ΔCT = 2ðCTtarget species - CTcontrol species Þ (see Note 33). 6. Construct the calibration curve “Relative quantification (ΔCT),” as depicted in Fig. 1a.

3.5 Absolute Quantification of Bacterial Species Concentration in Polymicrobial Samples

1. After collection of the polymicrobial samples, add the exogenous bacterial control, as described at the step 5, of the Subheading 3.1.

110

Aˆngela Lima et al.

Fig. 1 Quantification of bacterial species concentration in polymicrobial samples. (a) calibration curves for each species plotted with the relative quantification (ΔCT) vs bacterial concentration (CFU/mL). (b) bacterial species concentration (CFU/mL) in a polymicrobial sample determined using the calibration curves

2. Centrifuge the samples at 16,000 × g for 10 min. Completely remove the supernatant with a pipette tip and freeze the pellets at -20 °C overnight. 3. Isolate the gDNA of the target biological sample, as described in Subheading 3.2. 4. Run the samples in the qPCR instrument, as described in the steps 2–4 of Subheading 3.3. 5. Normalize the results of cycle threshold, as described in the previous item, step 5. 6. Determine the bacterial concentration of each species using the respective calibration curve (Fig. 1b).

4

Notes 1. This protocol was used for the study of polymicrobial biofilms, with species associated with bacterial vaginosis, including the following bacteria: Gardnerella vaginalis, Fannyhessea vaginae, Peptostreptococcus anaerobius, Prevotella bivia, Lactobacillus iners, and Mobiluncus curtisii. Herein we report an example of a triple-species biofilm. However, this protocol can be used with other bacteria. 2. Any appropriated culture media can be used to grow the bacteria. It should not interfere with the downstream applications. 3. This protocol was tested with commercial extraction kits (with silica-based columns) as well as with chemical lysis (phenolchloroform extraction). Herein we report the detailed protocol

Proper Bacteria Quantification by qPCR

111

for silica-based columns extraction, since these kits are more broadly used. 4. Some extraction kit does not contain silica beads. We recommend buying them separately, as their use facilitates cell lysis. This is particularly relevant when working with Gram-positive bacteria. 5. There are many alternatives that can be used. In our experience, the higher g forces involved, the better the lysis efficiency. Vortexes adaptors are cheaper but not as efficient as dedicated cell disrupters. 6. We choose a qPCR SYBR master mix because it is the most commonly used, but other alternatives such as specific fluorescent probes can be used; however, they have a higher cost of acquisition. 7. The qPCR SYBR master mix should be kept at -20 °C and protected from the light when it is not being used. 8. Design primers that will bind specifically to one of the species tested, but not the others. The primers can be freely designed with NCBI Primer-BLAST. When performing that, have in consideration that primer efficiency varies with temperature and the enzyme used in the qPCR master mix. It’s advisable to start the test at 60 °C and design the primers with a melting temperature of 3–5 °C above 60 °C. The primers should have identical melting temperatures, as well as the annealing temperatures. The last one mentioned should be no more than 5 ° C below the first one to avoid nonspecific amplification. The primer specificity should be confirmed first, and this can be achieved using Primer-BLAST and then experimentally determined. 9. The primers should be stored at -20 °C when they are not being used. 10. The determination of bacterial concentration through CFUs should only be used for bacteria that grow well on solid media and that do not form viable but not culturable (VBNC) bacteria. In case of doubt, this quantification may be confirmed by flow cytometry. 11. Calibration curves must have a range of concentrations wide enough to include the maximum and minimum values expected in the biological system. 12. To quantify bacteria loss during the DNA extraction procedure, it is necessary to add some exogenous control to the samples, to normalize the results from qPCR runs. In this sense, we used a bacterium that is unrelated to our target, and it is added to the samples/pure cultures before the centrifugation step (step 4 of Subheading 3.1.), allowing to quantify

112

Aˆngela Lima et al.

bacteria loss during the procedure. The use of bacteria as exogenous control has also been reported in some studies [16, 20]. Choose a bacterium/bacteria biologically similar to the bacteria in the target samples to use as exogenous control, as the DNA extraction kit will be chosen based on this. If the samples contain Gram-negative bacteria, choose a Grampositive bacterium as exogenous control, and if the samples contain Gram-positive bacteria, choose a Gram-negative bacterium. If the samples contain Gram-positive and Gramnegative bacteria, it should be used an exogenous control that includes both types of bacteria, as it has been demonstrated [20]. Other studies [18, 19] use DNA molecules as plasmids, entire genomes, as well as synthetic cDNA unrelated to the target, as exogenous control. However, this only allows to quantify gDNA loss after the step where it is added in DNA extraction process, not considering the loss of bacteria in the previous steps. In the case of choosing this type of exogenous control, it would be added before step 8 of the Subheading 2.2. 13. We freeze bacterial pellets at -20 °C overnight to improve cell lysis in the DNA extraction process. In our experiments, this could increase the yield of DNA up to twofold. 14. Some lysis buffers come with separate components, and it may be necessary to add more than one compound to the samples. Regarding silica glass beads, they can either be purchased in bulk (cheaper) or already preloaded in the microcentrifuge tube. 15. The pellet at this point contains non-DNA organic and inorganic materials, including proteins and cell debris; therefore, avoid transferring any of the pellet. It is essential to remove these contaminants, as they may reduce DNA purity and inhibit downstream applications. 16. The highly concentrated salt solution establishes the high-salt condition, which is required to bind DNA to the silica column membrane. 17. Depending on the extraction kit used, the maximum volume that can be added to the column will be different. 18. This wash solution removes residues of salt and other contaminants but allows the gDNA to stay bound to the silica membrane. 19. Be careful not to splash any of the liquid on the silica column. 20. Measure gDNA concentration and purity in a nanodrop. Keep the gDNA samples at 4 °C. 21. For example, use the serial dilutions of the starting gDNA: 1: 10, 1:100, 1:1000, 1:10000, and 1:100000. It is not required

Proper Bacteria Quantification by qPCR

113

to know the exact concentration of gDNA copies, but it is fundamental to know the exact ratio between each of the four to five dilutions used. 22. It is necessary to be careful when pipetting such low volumes. Do not mix different sets of primers in the same master mix (one set of primers should have the forward and reverse primer for each gene). 23. It is important to mention that too much concentrated samples can inhibit qPCR due to the possible presence of inhibitors. Hence, this should be taken into consideration when preparing the working concentration of the gDNA sample. A good starting point should be to dilute 1:10 after gDNA extraction. This would be the highest concentration to be used for the efficiency curve determination. 24. The NTC allows to verify if there are contaminations in the master mix, since without the gDNA, no amplification should be detected. 25. Set up the qPCR instrument with an adequate cycling protocol for the experiment. The cycling parameters will depend on the qPCR master mix kit that is being used, since there are kits that allow to perform the annealing and extension together, while others require three steps, namely, denaturation, annealing, and extension, all at different temperatures. 26. When using SYBR Green qPCR master mixes, melt-curve analysis needs to be performed to ensure the absence of unspecific products and primer-dimers. A distinct peak in the plot of the graphic “Fluorescence vs Temperature” indicates that the amplified DNA product corresponds to a specific PCR amplicon. On the contrary, more than one peak indicates that more than one product was amplified, which could mean that the reaction is not specific. 27. If the reaction efficiency is lower, repeat the assay, and if it persists, the design of the primers must be improved. 28. The “n” represents the number of reactions that will be used for each set of primers. Pipetting errors should be considered; therefore, for each ten reactions, consider one extra reaction that needs to be prepared. For example, if it is needed to prepare 5 reactions, the n should be n = 5 + 1 = 6; to run 10 reactions, n = 10 + 1 = 11; in the case of 18 reactions, n = 18 + 2 = 20. Consider also that each sample shall be run in triplicates. 29. Normally, qPCR master mixes with SYBR Green come 2× concentrated; therefore, in a total reaction volume of 10 μL, half (5 μL) should be qPCR master mix.

114

Aˆngela Lima et al.

30. Quantify the samples with primers designed for the target species and with primers for the exogenous control species. 31. The DNA extracted should be diluted at least 1:10, with the purpose of decreasing the qPCR inhibitors concentration in the extracted samples. 32. This inter-run calibrator, added on the qPCR plate, serves to avoid the fluorescence variations between the qPCR runs to be performed. It can be a bacterium genome, a plasmid, or a cDNA molecule at a known concentration. 33. This equation, however, makes several assumptions including that the efficiency of PCR is close to one and that the efficiency of the primers for target species is similar to the efficiency of the primers for control species [21].

Acknowledgments This work was funded by the Portuguese Foundation for Science and Technology (FCT) under the scope of the strategic funding of the unit (UIDB/04469/2020) and EXPL/SAU-INF/1000/ 2021. AL and LGVS are supported by FCT with individual grants 2022.13112.BD and 2020.04912.BD, respectively. References 1. Benes V, Castoldi M (2010) Expression profiling of microRNA using real-time quantitative PCR, how to use it and what is available. Methods 50:244–249. https://doi.org/10. 1016/j.ymeth.2010.01.026 2. Yu J, Wang HM, Zha MS et al (2015) Molecular identification and quantification of lactic acid bacteria in traditional fermented dairy foods of Russia. J Dairy Sci 98:5143–5154. https://doi.org/10.3168/jds.2015-9460 3. Rocha D, Santos C, Pacheco L (2015) Bacterial reference genes for gene expression studies by RT-qPCR: survey and analysis. Antonie Van Leeuwenhoek 108:685–693. https://doi.org/ 10.1007/s10482-015-0524-1 4. Sta˚hlberg A, Thomsen C, Ruff D, Åman P (2012) Quantitative PCR analysis of DNA, RNAs, and proteins in the same single cell. Clin Chem 58:1682–1692. https://doi.org/ 10.1373/clinchem.2012.191445 5. Smith CJ, Osborn AM (2009) Advantages and limitations of quantitative PCR (Q-PCR)based approaches in microbial ecology. FEMS Microbiol Ecol 67:6–20. https://doi.org/10. 1111/j.1574-6941.2008.00629.x

6. Bustin SA (2010) Why the need for qPCR publication guidelines ? – the case for MIQE. Methods 50:217–226. https://doi.org/10. 1016/j.ymeth.2009.12.006 7. Cotto A, Looper JK, Mota LC, Son A (2015) Quantitative polymerase chain reaction for microbial growth kinetics of mixed culture system. J Microbiol Biotechnol 25:1928–1935. https://doi.org/10.4014/jmb.1503.03090 8. Leigh Greathouse K, Sinha R, Vogtmann E (2019) DNA extraction for human microbiome studies: the issue of standardization. Genome Biol 20:1–4. https://doi.org/10. 1186/s13059-019-1843-8 9. Costea PI, Zeller G, Sunagawa S et al (2017) Towards standards for human fecal sample processing in metagenomic studies. Nat Biotechnol 35:1069–1076. https://doi.org/10. 1038/NBT.3960 ˆ , Pereira MO, Cerca N 10. Magalha˜es AP, Franc¸a A (2019) RNA-based qPCR as a tool to quantify and to characterize dual-species biofilms. Sci Rep 9:1–12. https://doi.org/10.1038/ s41598-019-50094-3 11. Marotz C, Amir A, Humphrey G et al (2017) DNA extraction for streamlined metagenomics

Proper Bacteria Quantification by qPCR of diverse environmental samples. BioTechniques 62:290–293. https://doi.org/10.2144/ 000114559 12. O’Connell GC, Chantler PD, Barr TL (2017) High interspecimen variability in nucleic acid extraction efficiency necessitates the use of spike-in control for accurate qPCR-based measurement of plasma cell-free DNA levels. Lab Med 48:332–338. https://doi.org/10.1093/ LABMED/LMX043 ˆ , Franc¸a A (2022) Accurate 13. Cerca N, Lima A qPCR quantification in polymicrobial communities requires assessment of gDNA extraction efficiency. J Microbiol Methods 194:1–4. https://doi.org/10.1016/j.mimet.2022. 106421 14. Bustin SA, Benes V, Garson JA et al (2009) The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem 55:611–622. https://doi.org/10.1373/CLINCHEM. 2008.112797 15. Svec D, Tichopad A, Novosadova V et al (2015) How good is a PCR efficiency estimate: recommendations for precise and robust qPCR efficiency assessments. Biomol Detect Quantif 3:9–16. https://doi.org/10.1016/j.bdq. 2015.01.005 16. Longin C, Guilloux-benatier M, Alexandre H (2016) Design and performance testing of a DNA extraction assay for sensitive and reliable quantification of acetic acid bacteria directly in

115

red wine using real time PCR. Front Microbiol 7:1–9. https://doi.org/10.3389/fmicb.2016. 00831 17. Rosca A, Castro J, Sousa L et al (2022) In vitro interactions within a biofilm containing three species found in bacterial vaginosis (BV) support the higher antimicrobial tolerance associated with BV recurrence. J Antimicrob Chemother 77:2183–2190 18. Coyne KJ, Handy SM, Demir E et al (2005) Improved quantitative real-time PCR assays for enumeration of harmful algal species in field samples using an exogenous DNA reference standard. Limnol Oceanogr Methods 3:381– 391. https://doi.org/10.4319/lom.2005. 3.381 19. Taskin B, Gozen AG, Duran M (2011) Selective quantification of viable Escherichia coli bacteria in biosolids by quantitative PCR with propidium monoazide modification. Appl Environ Microbiol 77:4329–4335. https:// doi.org/10.1128/AEM.02895-10 20. Scarsella E, Zecconi A, Cintio M, Stefanon B (2021) Characterization of microbiome on feces, blood and milk in dairy cows with different milk leucocyte pattern. Animals 11:1–14. https://doi.org/10.3390/ani11051463 21. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 25:402–408. https://doi.org/10. 1006/meth.2001.1262

Chapter 10 Real-Time PCR Method for Assessment of ParA-Mediated Recombination Efficiency in Minicircle Production Cla´udia P. A. Alves, Duarte Miguel F. Prazeres, and Gabriel A. Monteiro Abstract The in vivo intramolecular recombination of a parental plasmid allows excising prokaryotic backbone from the eukaryotic cassette of interest, leading to the formation of, respectively, a miniplasmid and a minicircle. Here we describe a real-time PCR protocol suitable for the determination of recombination efficiency of parental plasmids with multimer resolution sites (MRS). The protocol was successfully applied to purified DNA samples obtained from E. coli cultures, allowing a more reproducible determination of recombination efficiency than densitometry analysis of agarose gels. Key words Minicircles, ParA resolvase, Intramolecular recombination, Recombination efficiency, Real-time PCR

1

Introduction Minicircles (MCs) are covalently closed circular DNA molecules obtained from a larger parental plasmid [1, 2]. MCs are interesting nonviral DNA delivery vectors because they present lower immunogenicity and higher transfection efficiency than standard plasmid DNA vectors [1, 2]. The molecules are produced in vivo in Escherichia coli, by inducing the expression of a resolvase, which acts on specific sites in the parental plasmid (e.g., multimer resolution sites (MRS) [3–5], attB and attP sites [6, 7]). The action of the resolvase leads to the conversion of the parental plasmid into two molecules: a miniplasmid with the prokaryotic backbone and a minicircle with the eukaryotic cassette [8]. Both molecules comprise the sequence originated from the action of the resolvase. In systems where resolvases act on attB and attP sites, different sequences are obtained after recombination [9, 10]. On the contrary, in the case of ParA-mediated recombination, the MRS targeted by the resolvase do not suffer alterations during recombination [11]. This means that parental plasmids, miniplasmids, and minicircles

Lucı´lia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967, https://doi.org/10.1007/978-1-0716-3358-8_10, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

117

118

Cla´udia P. A. Alves et al.

obtained by ParA-based recombination cannot be distinguished by PCR with primers that target MRS. Strategies to evaluate the efficiency of ParA-mediated recombination typically rely on densitometry analysis of agarose gels [3, 4] or on qPCR-based approaches, which rely on the detection of sequences common to the parental plasmid and its recombination products [12]. Densitometry analysis implies a pre-linearization of DNA molecules and relies on the use of image processing software (e.g., ImageJ) and user visual analysis [3, 4]. Real-time qPCR is a sensitive and specific technique, allowing the specific detection of DNA molecules in solution [13]. Co-detection of miniplasmid or minicircle by qPCR along with parental plasmid implies the subsequent subtraction of the amount of these molecules from the amount of parental plasmid detected, to determine the amount of each molecule in solution [12]. The current real-time PCR protocol, which is an alternative approach for the quantification of recombination efficiency [14], was designed to target the regions flanking the MRS. Primers located in these regions were designed and arranged into four pairs: two pairs specific for the parental plasmid, one pair specific for the miniplasmid, and one pair specific for the minicircle. Although all primers anneal on the parental plasmid, pairs designed to amplify fragments from the miniplasmid and minicircle should not result in detectable amplification from the parental plasmid due to the short amplification time. Application of the method, described in here, yielded successful determination of recombination efficiency in pure DNA samples with low standard deviation between replicates ( -3 kcal/mol) as well as false priming sites. Use computational tools to help you estimate the Tm of the selected priming regions (for Vent® DNA polymerase, use the online NEB Tm calculator, New England Biolabs), and change their length (always respecting the standard primer design rules) until you reach a satisfactory Tm. Note that this estimated Tm is only for the primer region complementary to the template DNA and not for the fulllength primer. 4. For the full-length primers, check for GC content, potential primer dimer, and hairpin formation (e.g., with one of the following online primer analysis tools: OligoAnalyzer, Integrated DNA Technologies; NetPrimer, PREMIER Biosoft; or OligoEvaluator, Sigma-Aldrich). If any of these parameters are outside of the recommended guidelines, proceed to the necessary adjustments (see Note 3). 5. In the first case study, the EmGFP-coding gene served as initial template to assemble each of the fusion genes. Thus, we designed one conventional forward primer (P1), complementary to the 5′-end region of the EmGFP-coding gene, which could be used in combination with different reverse megaprimers (Table 1, Fig. 1). The reverse megaprimers P2 and P3 were designed to anneal at the same priming site in the 3′-end region of the EmGFP-coding gene and to have equal 5′-end sequences that were used as priming site for primer P4 (Table 1, Figs. 1 and 3). However, while primer P3 was designed to include a coding sequence for a TEV recognition site plus the CBM1 NL between its 3′- and 5′-ends, in primer P2 only the first sequence was included (Table 1, Figs. 1 and 2). The megaprimer P4 was designed to contain a 3′-end sequence complementary to the 3′ region of the PCR products generated with primes P1 and P2/P3 and to include in its 5′ region the remaining coding sequence for CBM1 plus six histidine codons and a stop codon (see Note 4). Restriction sites for EcoRI and KpnI were added to the 5′-end of primers P1 and P4, respectively, preceded by two nucleotides to increase the cleavage efficiency of the final PCR products by these enzymes.

Megaprimer-Based PCR

201

6. In the second case study, the plasmid pETM20_EGFP [4] served as template to assemble the EGFP-Car9 fusion gene. For this strategy, the conventional forward primer T7, complementary to the T7 promoter of pET series E. coli expression plasmids, was used in combination with a reverse megaprimer (MR) designed to anneal at the 3′-end region of the EGFPcoding gene and to include in its 5′ region the coding sequence for Car9 between a NdeI recognition site, to subsequently allow the cloning of other genes in fusion with the Car9 tag, a stop codon, and a restriction site for XhoI preceded by three nucleotides, to increase the cleavage efficiency of the final PCR product by these enzymes (Table 1, Fig. 2). 3.2 Double-Step Primer Extension PCR: Case Study 1

A two-step PCR was performed to synthesize the fusion genes EmGFP-TrCBM1Cel7A and EmGFP-NL-TrCBM1Cel7A, in which the PCR products from the first PCR round served as template for the second PCR (Table 2). 1. To obtain the PCR1 and PCR3 products (Table 2, Fig. 1), mix the following components in PCR tubes: • Template DNA—100–300 ng (in 1 μL) • Primer P1 (25 μM)—1 μL • Primer P2 for PCR1 and P3 for PCR3 (25 μM)—1 μL • dNTPs (10 mM each)—1.5 μL • 10× ThermoPol® Reaction Buffer—5 μL • 100 mM MgSO4—1 μL • Ultrapure H2O—39 μL • Vent® DNA Polymerase—0.5 μL

Table 2 Primers, template DNA, and annealing temperature (Ta) used for the assembly and amplification of the fusion genes EmGFP-TrCBM1Cel7A and EmGFP-NL-TrCBM1Cel7A in case study 1 Fusion gene EmGFP-TrCBM1Cel7A

PCR products PCR1 PCR2

EmGFP-NL-TrCBM1Cel7A

PCR3 PCR4

a

Plasmid harboring the EmGFP-coding gene Ref. [16]

Primers

Template a

Ta (°C)

P1 P2 P1 P4

pPCG

55

PCR1 product

53

P1 P3 P1 P4

pPCGa

50

PCR3 product

53

202

Tatiana Q. Aguiar et al.

2. Step up the thermal cycler using the following parameters: Number of cycles

PCR step

Temperature (°C)

Time

1

Initial denaturation

95

2 min

30

Denaturation

95

2 min

Annealing

(see Table 2)

45 s

Extension

72

1 min/kb

Final extension

72

10 min

1

3. After the amplification, assess the DNA fragments’ size and quality by running 5 μL of each PCR sample on 1% (w/v) agarose gel. If the expected PCR products are not observed, refer to Note 5. If the PCR products are the right size, but a primer dimer band is also present (typically, below 200 bp), or unspecific PCR products are formed, perform agarose gel purification of the PCR products with the QIAquick® Gel Extraction Kit (spin protocol) before proceeding to the next step (see Note 6). If the PCR products are the right size and are present as a single band, perform silica-column purification of the products with the QIAquick® PCR Purification Kit (see Note 6). Determine the DNA concentration. 4. To obtain the PCR2 and PCR4 products, mix the components described in step 1, using the same amounts, but replace primers P2 and P3 with primer P4, and use as template DNA the adequate purified PCR product from step 3 (Table 2). Since the DNA purification procedure reduces the PCR product yield, a high volume of PCR product (up to 15 μL) is generally needed as template DNA (see Note 7). 5. Purify the PCR products as described in step 3 (Fig. 4) (see Note 8).

Fig. 4 Final PCR products from the amplification of the fusion genes EmGFPTrCBM1Cel7 (A, PCR2 product) and EmGFP-NL-TrCBM1Cel7A (B, PCR4 product) in case study 1 and EGFP-Car9 (C) in case study 2. MW, molecular weight standards

Megaprimer-Based PCR

3.3 Standard PCR: Case Study 2

203

A standard PCR was performed to synthesize the fusion gene EGFP-Car9: 1. To obtain the PCR product (Table 2, Fig. 2), mix the following components in a PCR tube: • Template DNA—100–300 ng (in 1 μL) • Primer T7 (20 μM)—1.25 μL • Primer MR (20 μM)—1.25 μL • dNTPs (10 mM each)—1 μL • 10× ThermoPol® Reaction Buffer—5 μL • 100 mM MgSO4—1 μL • Ultrapure H2O—39 μL • Vent® DNA Polymerase—0.5 μL 2. Step up the thermal cycler using the following parameters: Number of cycles

PCR step

Temperature (°C)

Time

1

Initial denaturation

95

3 min

35

Denaturation

95

30 s

Annealing

56

30 s

Extension

72

1 min/kb

Final extension

72

5 min

1

3. After the amplification, follow the instructions described in step 3 of 3.2 to assess the DNA fragment’s size and quality (Fig. 4), and to purify the PCR product 3.4 Vector Cloning and Confirmation of the Fusion Genes’ Sequence

The final PCR products can be digested with the planned restriction enzymes and cloned directly into the expression vector or can alternatively be cloned into an intermediate cloning vector, propagated, excised by restriction digestion, and finally cloned into the expression vector. Many convenient commercial systems for cloning of PCR products are available, either for blunt-ended (e.g., pMOS®, GE healthcare) or A-ended products (e.g., pGEM®-T, Promega). Thermostable DNA polymerases with proofreading activity, such as Vent®, generate blunt-ended fragments, but these can be modified using an A-tailing procedure (see Note 9) and thus cloned in any type of PCR cloning vectors. However, direct cloning is a faster and less expensive approach: 1. Digest overnight at 37 °C the purified PCR2 and PCR4 products from case study 1 with the cloning enzymes EcoRI-HF and KpnI-HF and the purified PCR product from case study 2 with the cloning enzymes XbaI and XhoI, using the following reaction mixture: • Purified PCR product—25 μL

204

Tatiana Q. Aguiar et al.

• Restriction enzyme 1—1 μL • Restriction enzyme 2—1 μL • 10× CutSmart® buffer—3 μL 2. Purify the digested products with the QIAquick® PCR Purification Kit (see Note 6). 3. Ligate the digested products from case study 1 to the pPICZαA expression plasmid (previously digested with the same enzymes and gel purified) and from case study 2 to the pETM20 expression plasmid (previously digested with the same enzymes and gel purified) with T4 DNA ligase, following the instructions of the manufacturer and using a molar ratio of 1:3–1:10 (see Note 10). 4. Transform E. coli chemically competent cells with the entire ligation mixture according to the manufacturer’s instructions. 5. Screen for positive clones (e.g., by colony PCR [17]), propagate cells from one of these clones, and isolate plasmid DNA to subsequently confirm the sequence of the inserted fusion genes by sequencing (see Note 11). If the sequence and reading frame of the fusion genes are correct, the recombinant plasmids are ready to be transformed into the final expression host (in the presented cases P. pastoris or E. coli). If not, review your strategy and repeat these protocols from the step you consider most adequate.

4

Notes 1. There are several codon optimization tools freely available for adapting DNA sequences to the codon preference of a particular expression host (for some examples consult Table 4.3 in [1]). Codon usage tables for several host organisms are also available from public databases (e.g., Codon Usage Database). 2. When cloning genes into a commercial expression vector, special care must be taken to maintain the existing reading frame so that the ultimately expressed protein has the desired sequence. This is particularly critical when the restriction enzymes used for cloning have within their recognition sequence a start codon, as is the case for NcoI (5’ C/CATGG 3′). The ATG within this site can be used directly to create the ATG start codon and/or the ATG codon for a methionine residue. However, this restriction site dictates that the first nucleotide of the next triplet codon must be a G and that two extra bases are necessary to maintain the reading frame, which can be added in primer design. Thus, an extra amino acid will be added to the protein. One way to overcome this limitation is to use enzymes that, while

Megaprimer-Based PCR

205

recognizing different nucleotide sequences, are able to generate ends compatible with those generated by the NcoI enzyme (e.g., BsaI). 3. The design of primers for gene cloning into expression plasmids has several constraints, such as limited flexibility in the location of priming regions (the primers must anneal at the 5′ and 3′ extremities of the coding region) and difficulty in fulfilling the requirements for secondary structure formation when restriction sites or other extra sequences are added to the 5′-end of primers. Therefore, several adjustments generally have to be manually performed using a trial-and-error method until the most satisfactory parameters for the designed primers can be obtained, which many times are not the optimal ones. 4. We could have constructed longer megaprimers P2 and P3, instead of constructing megaprimer P4, but it would have been cheaper to order the synthesis of the entire fusion genes than ordering the synthesis of oligos >150 bp. Moreover, the bigger the primer, the higher the probability of secondary structure formation, which has a negative impact on PCR efficiency. Therefore, we chose to order shorter (and cheaper) megaprimers and perform a two-step PCR to fuse the desired genes. 5. Run a higher volume of the PCR sample (>5 μL) to verify if you can then observe the expected PCR product. Otherwise, it may be necessary to experimentally optimize the PCR conditions. As initial steps, a gradient of annealing temperatures and different concentrations of template DNA may be tested, as well as a superior number of PCR cycles (up to 40). Subsequently, different concentrations of primers and of Mg2+ may also be tested. The addition of dimethyl sulfoxide (DMSO) may also be considered to inhibit secondary structures in the DNA template or primers, but if used in high concentration (>3–5%), it affects the melting point of the primers, and therefore it may be necessary to decrease the annealing temperature. 6. In both DNA purification protocols, elute the products from the columns with the minimum amount of warm ultrapure water (typically 30 μL), and repeat the elution step with the 30 μL eluate to increase DNA recovery and maximize the concentration of the eluate. 7. The volume of the PCR product to use as template should be sufficiently high to allow amplification, but it should not inhibit the PCR. We have obtained good results using template volumes ≤30% of the final reaction volume. 8. Although in Fig. 4 several unspecific products (such as primer dimers) are observed along with the expected PCR product, in this case, it was not necessary to optimize the PCR conditions. The band corresponding to the product with the desired

206

Tatiana Q. Aguiar et al.

molecular weight could be easily isolated from the others, and the amount of the purified product was sufficient for cloning. However, to reduce primer dimer formation, lower primer concentration could have been tested. Additionally, touchdown PCR could have been performed to reduce nonspecific amplification. 9. At the end of the PCR, add to the reaction mixture 1 μL of Taq DNA polymerase, and perform a 10-min extension step at 72 °C. 10. Since several rounds of purification reduce the amount of DNA available for the cloning procedure, sometimes it is necessary to use a final ligation reaction volume higher than the standard 10 μL indicated by the manufacturer. We have obtained good results with ligation reactions with up to 20 μL. 11. Alternatively, the sequence of the fusion genes can be confirmed by direct sequencing of the final PCR product. However, when sequencing from the expression plasmid, it is also possible to confirm if the direction and reading frame of the sequences are correct.

Acknowledgments This study was supported by the Portuguese Foundation for Science and Technology (FCT) under the scope of the strategic funding of UIDB/04469/2020 unit and project ESSEntial (PTDC/ BII-BTI/1858/2021). References 1. Oliveira C, Aguiar TQ, Domingues L (2017) Principles of genetic engineering. In: Pandey A, Teixeira JA (eds) Current developments in biotechnology and bioengineering: foundations of biotechnology and bioengineering, 1st edn. Elsevier, Oxford 2. Li X, Jin J, Guo Z, Liu L (2022) Evolution of plasmid-construction. Int J Biol Macromol 209(Pt a):1319–1326 3. Oliveira C, Sepu´lveda G, Aguiar TQ, Gama FM, Domingues L (2015) Modification of paper properties using carbohydrate-binding module 3 from the Clostridium thermocellum CipA scaffolding protein produced in Pichia pastoris: elucidation of the glycosylation effect. Cellulose 22:2755–2765 4. Freitas AI, Domingues L, Aguiar TQ (2022) Bare silica as an alternative matrix for affinity purification/immobilization of His-tagged proteins. Sep Pur Technol 286:120448

5. Baptista SL, Romanı´ A, Oliveira C, Ferreira S, Rocha CMR, Domingues L (2021) Galactose to tagatose isomerization by the L-arabinose isomerase from Bacillus subtilis: a biorefinery approach for Gelidium sesquipedale valorisation. LWT-Food Sci Technol 151:112199 6. Bandyopadhyay B, Peleg Y (2018) Facilitating circular permutation using restriction free (RF) cloning. Protein Eng Des Sel 31(3): 65–68 7. Sonnendecker C, Zimmermann W (2019) Domain shuffling of cyclodextrin glucanotransferases for tailored product specificity and thermal stability. FEBS Open Bio 9:384–395 8. Binte Muhammad Jai HS, Dam LC, Tay LS, Koh JJW, Loo HL, Kline KA, Goh BC (2020) Engineered lysins with customized lytic activities against enterococci and staphylococci. Front Microbiol 11:574739

Megaprimer-Based PCR 9. Costa CE, Møller-Hansen I, Romanı´ A, Teixeira JA, Borodina I, Domingues L (2021) Resveratrol production from hydrothermally pretreated Eucalyptus wood using recombinant industrial Saccharomyces cerevisiae strains. ACS Synth Biol 10(8):1895–1903 10. Baptista SL, Cunha JT, Romanı´ A, Domingues L (2018) Xylitol production from lignocellulosic whole slurry corn cob by engineered industrial Saccharomyces cerevisiae PE-2. Bioresour Technol 267:481–491 11. Silva R, Aguiar TQ, Coelho C, Jime´nez A, Revuelta JL, Domingues L (2019) Metabolic engineering of Ashbya gossypii for deciphering the de novo biosynthesis of γ-lactones. Microb Cell Factories 18:62 12. Forloni M, Liu AY, Wajapeyee N (2019) Megaprimer polymerase chain reaction (PCR)-based mutagenesis. Cold Spring Harb Protoc 2019:6 13. Oliveira C, Domingues L (2018) Guidelines to reach high-quality purified recombinant

207

proteins. Appl Microbiol Biotechnol 102(1): 81–92 14. Freitas AI, Domingues L, Aguiar TQ (2021) Tag-mediated single-step purification and immobilization of recombinant proteins toward protein-engineered advanced materials. J Adv Res 36:249–264 15. Aguiar TQ, Oliveira C, Domingues L (2017) Synthesis of fusion genes for cloning by megaprimer-based PCR. In: Domingues L (ed) PCR: methods and protocols, Methods in molecular biology, vol 1620. Springer, New York, NY 16. Wan W, Wang DM, Gao XL, Hong J (2011) Expression of family 3 cellulose-binding module (CBM3) as an affinity tag for recombinant proteins in yeast. Appl Microbiol Biotechnol 91:789–798 17. Azevedo F, Pereira H, Johansson B (2017) Colony PCR. In: Domingues L (ed) PCR: methods and protocols, Methods in Molecular Biology, vol 1620. Springer, New York, NY

Chapter 17 Bacteria and Yeast Colony PCR Humberto Pereira, Paulo Ce´sar Silva, and Bjo¨rn Johansson Abstract The bacteria Escherichia coli and the yeast Saccharomyces cerevisiae are currently the two most important organisms in synthetic biology. E. coli is almost always used for fundamental DNA manipulation, while yeast is the simplest host system for studying eukaryotic gene expression and performing large-scale DNA assembly. Yeast expression studies may also require altering the chromosomal DNA by homologous recombination. All these studies require the verification of the expected DNA sequence, and the fastest method of screening is colony PCR, which is direct PCR of DNA in cells without prior DNA purification. Colony PCR is hampered by the difficulty of releasing DNA into the PCR mix and by the presence of PCR inhibitors. We hereby present one protocol for E. coli and two protocols for S. cerevisiae differing in efficiency and complexity as well as an overview of past and possible future developments of efficient S. cerevisiae colony PCR protocols Key words PCR, Colony, Yeast, Saccharomyces cerevisiae, Escherichia coli, Direct lysis

1

Introduction Colony or whole-cell PCR is the direct PCR amplification of target sequences inside cells without prior isolation or purification of DNA. Colony PCR is possible if enough cells lyse as a consequence of the high temperature in the initial template denaturation step alone or in combination with extra procedures to make DNA more accessible. The material containing the cells or the cells themselves must also not present PCR inhibition to an extent that prevents PCR amplification. The advantage of colony PCR over using purified DNA is savings in time and cost, as the time-consuming DNA extraction step is omitted. Minimizing sample handling by omitting DNA purification can also increase sensitivity if the starting material is limiting as it might be in, for example, forensic applications. Very low amounts of starting material may prohibit DNA purification as all purification procedures are associated with a loss. Less sample handling also lowers the risk of cross-contamination of

Lucı´lia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967, https://doi.org/10.1007/978-1-0716-3358-8_17, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

209

210

Humberto Pereira et al.

samples, an important consideration since PCR is a sensitive technique prone to false-positive results. The need for detecting the presence or absence of specific sequences within cells is routinely needed in a wide range of disciplines, such as clinical microbiology, genetic engineering, and forensic sciences. The most common application of colony PCR in genetic engineering is probably the amplification of ligation product sequences within Escherichia coli transformants after cutand-paste cloning. This procedure is straightforward with few associated problems. The first report on E. coli colony PCR describes the resuspension of one colony in half a mL of water and subsequent boiling for 5 min [1]. After centrifugation for 2 min at maximum speed in a microcentrifuge (15–20,000 g), 5 μL of the supernatant was used as the template for PCR. The authors later succeeded in using E. coli directly without prior dilution or boiling. Few variations of this simple protocol have been published, indicating that it is generally applicable with a reasonable rate of success. The current iteration of the protocol simply involves adding a small amount of an E. coli colony to a PCR which is thereafter handled as if an amplification from pure DNA. Another common application of colony PCR is the analysis of transformants of the yeast Saccharomyces cerevisiae after genetic engineering or DNA assembly experiments. S. cerevisiae can assemble large and complex constructs through homologous recombination in one step [2]. This technique has found many applications in the field of synthetic biology [3–7]. Colony PCR from S. cerevisiae is unfortunately nontrivial, which is evident from the myriad of available protocols, both published under peer review and available online (see www.bit.ly/ pcr_prot for a compilation). This indicates that there may not be one protocol that is optimal for all use cases. False-negative results are a general problem affecting yeast colony PCR. Factors that seem to affect yeast colony PCR efficiency are the chronological age of the culture, growth phase, growth rate, size of the desired PCR product, the copy number of the target sequence, and media components [8]. Fresh cultures of rapidly growing yeast, where the target amplicon is short and present in multiple copies, seem to present the least problems. Early published yeast colony PCR protocols were essentially E. coli protocols adapted for yeast, where yeast cells are simply added to the PCR mixture and the cells are presumably lysed in the initial denaturation step [9]. We have adapted one protocol for E. coli colony PCR (Subheading 3.1) and two different protocols for S. cerevisiae (Subheadings 3.2 and 3.3) that are routinely used in our laboratory. The protocol in Subheading 3.2 is very simple and rapid, involving only a short preincubation step in a microwave oven, while the protocol in Subheading 3.3 is a version of the LiAc-SDS protocol [10], which is more sensitive and robust in our hands, but also more laborious.

Bacteria and Yeast Colony PCR

211

The LiAc-SDS protocol [10] stands out in another respect. Most publications describing yeast colony PCR protocols have a relatively low number of citations, often in publications describing different yeast colony PCR protocols or publications from the laboratory where the protocol originated. The LiAc-SDS has 162 PubMed citations as of January 2023 from a wide range of laboratories, indicating that it is generally applicable. Future developments of yeast colony PCR protocols should separate the effects of DNA release and PCR inhibition, and how these effects vary with variables such as culture medium, age, and growth phase of the cultures, and then systematically apply the relevant conditions based on the results for other direct PCR protocols. 1.1

DNA Release

The addition of preincubation with a yeast lytic enzyme such as zymolyase or lyticase can improve efficiency [11, 12]. Lyticase usually refers to pure β-1,3-glucanase, while zymolyase is a mixture of lytic enzymes. The factor targeted by this enzyme is the strong yeast cell wall which is weakened or removed. The downside is the enzyme cost and potentially the addition of phosphate in the incubation buffer, which may lead to PCR inhibition by interaction with the magnesium ions in the PCR buffer. Recombinant lyticase from the bacteria Oerskovia xanthineolytica is easily produced by the cultivation of cells harboring a plasmid carrying the glucanase structural gene [13]. The resulting lyticase is cost-effective, but PCR strategies should be designed with care since the resulting enzyme is often contaminated with the expression plasmid and E. coli chromosomal DNA. We previously used a protocol based on homemade recombinant lyticase, but while effective, not ultimately considered worth the extra work unless lyticase has some other use in the laboratory. A brief treatment of cells with sodium hydroxide [14] is a method that has several potential targets. The authors suggest that the modes of action could be increased cell wall permeability, dissociation of DNA from bound proteins, or degradation of RNA. Additionally, sodium hydroxide might neutralize intercalated PCR inhibitors by denaturing DNA [15]. The addition of the strong anionic detergent sodium dodecyl sulfate (SDS) alone [16] or in combination with ethanol [17] or lithium acetate (LiAc) [10] has also been described as a method for achieving PCR amplification from whole yeast cells. SDS efficiently dissolves membrane lipids but is also a potent PCR inhibitor [18]. The presence of SDS also potentially eliminates DNA-protein interactions as SDS is used to prevent gel shifts in the electrophoresis of DNA. Ethanol would precipitate DNA as soon as it is liberated from the cells and may be a way to selectively wash away inhibitors and concentrate DNA [17]. LiAc is commonly used in yeast transformation [19], where the mode of action may be to turn the cell wall more porous [20], which probably improves cell lysis.

212

Humberto Pereira et al.

Physical methods such as heating, boiling, grinding with glass beads, or rapid freeze-thaw cycles [21] have also been employed but may be more laborious if the number of samples is large. Glass beads in combination with the metal chelating resin Chelex 100 have been reported to permit PCR from whole yeast cells [22]. The role of the chelator is to remove metal ions necessary for nucleases, thereby protecting DNA. The use of chelating resins has also been reported to allow PCR amplification from forensic samples [23]. Sonication has proved beneficial for colony PCR of Gram-positive bacteria [24] and protein extraction in S. cerevisiae [25]. However, its effectiveness for yeast colony PCR is yet to be established. 1.2 Future Developments

There is substantial development of techniques for direct amplification of DNA in complex matrixes with as few or no manipulation steps involved. Rapid genetic typing of human blood or tissue and detection of human pathogens, as well as forensic science, are likely the strongest motivation for this development. It is possible that at least some of these new procedures could benefit new methods for direct colony PCR from difficult sources such as S. cerevisiae. One of the most attractive recent developments is thermostable DNA polymerases engineered for higher PCR inhibitor tolerance [26]. Examples of these are the addition of DNA binding domains [27] and polymerases developed through gene shuffling or compartmentalized self-replication. The last approach has yielded DNA polymerases resistant to the potent PCR inhibitor heparin [28] and a broad range of environmentally derived inhibitors [29]. PCR enhancers are another area of development that could potentially aid colony PCR protocols. Common PCR enhancers include N,N,N-trimethylglycine (betaine), bovine serum albumin (BSA), dithiothreitol (DTT), glycerol, and dimethyl sulfoxide (DMSO). DMSO was first reported as improving Sanger DNA sequencing quality [30] of PCR products, possibly by preventing reannealing of the strands. Formamide, glycerol, DMSO, Tween20, and NP-40 are suggested as remedies for difficulties in the amplification of GC-rich templates [31] as well as betaine at 1 M [32], 1.3 M [33], and 2 M [34] or at 1 M in combination with DMSO [35, 36]. DMSO disrupts DNA base pairing without affecting fidelity [37], while betaine has been reported to affect the base pair composition dependence of DNA strand composition [38]. Trehalose [39], protein BSA, and gelatin stabilize the DNA polymerase during thermal cycling. Nonionic detergents Tween-20 and NP-40 might have a beneficial effect in this respect as they are added to Taq DNA polymerase purification protocols for this reason [40]. Triton X-100 is thought to have the same effect [41, 42]. Tween-20 and NP-40 alone or in combination with DMSO also have been reported to improve specificity and raise

Bacteria and Yeast Colony PCR

213

the yield of PCR in general [43] and also neutralize the negative effects of sodium dodecyl sulfate (SDS) [44]. Several mono- and disaccharides were recently reported to be effective PCR enhancers, with sucrose surpassing trehalose and DMSO for the conditions tested [45]. Relatively new PCR enhancers are nanoparticles from gold (AuNPs) [46, 47], titanium dioxide (TiO2) [48], and graphene oxide (GO) or reduced graphene oxide (rGO) [49]. The mode of action of nanoparticles has not been elucidated in detail. Finally, attempts have been made to combine several enhancers in an attempt to find synergistic positive effects [50–52]. The PCR reagents can be altered in order to enhance PCR specificity. This was observed when locked nucleic acid (LNA)modified primers were used instead of unmodified oligonucleotides [53]. Replacing the canonical dNTPs with 2′-deoxynucleoside 5′-(alpha-P-seleno)-triphosphates (dNTPαSe) [54] was capable of increasing PCR specificity by over 240-fold [55].

2

Materials

2.1 E. coli Colony PCR

1. Water. PCR components and other solutions should be prepared using the best available water. We routinely use double-deionized water with a specific conductance of 18.2 MΩ/cm at 25 °C. 2. 2× PCR master mix with DMSO (Table 1). We have found it practical to prepare a two times concentrated PCR master mix containing all components except PCR primers and template DNA, as this minimizes pipetting errors and improves consistency across PCR experiments. The PCR master mix can be stored at -20 °C without a noticeable loss of efficiency. We routinely include 1% DMSO in the final PCR mixture. Table 1 Recipe for 1 mL twice concentrated PCR master mix containing 2% DMSO suitable for colony PCR Component

Volume (μL)

Water

650

Taq buffer with NH4SO4 (x10)

200

MgCl2 (50 mM)

80

dNTPs (10 mM each)

40

DMSO (100%)

20

Taq DNA polymerase (5 U/μL)

10

214

Humberto Pereira et al.

Table 2 Recipe for 5× PCR compatible loading buffer Component

Volume

25% Ficoll

10 mL

Tartrazine food coloring

1 mL

Xylene cyanol 125 mg/mL

10 μL

3. 5× PCR-compatible loading buffer (Table 2). A PCR-compatible loading buffer can be added directly into the PCR mix, saving post-PCR pipetting steps that might potentially contaminate the laboratory. We have adopted such a loading buffer made in-house to lower PCR costs. Tartrazine food coloring is a commercial food coloring sold in grocery stores. 4. Thermocycler. 5. Electrophoresis running buffer. We use 1X Tris-acetate-EDTA (TAE) made from a 50X TAE (2 M Tris base, 5.71% (v/v) glacial acetic acid, 50 mM EDTA) stock solution. This 50X TAE is prepared by dissolving 242 g Tris base, 18.61 g EDTA, and 57.1 mL glacial acetic acid in 500 mL of water and adding water up to 1 L. 6. Agarose gel 1%. Add 100 mL of the chosen running buffer for each gram of agarose, and heat it until the agarose melts completely. After adding a pre-staining DNA dye, pour the gel into an appropriate mold and let it solidify. 7. Electrophoresis equipment, including power supply and electrophoresis tank. 2.2 S. cerevisiae Colony PCR Using a Microwave Oven

All the items listed on Subheading 2.1 plus:

2.3 PCR Using S. cerevisiae LiAc Permeabilized Cells

All the items listed on Subheading 2.1 plus:

1. Microwave oven.

1. 1 M lithium acetate stock solution. The lithium acetate solution is prepared as a 1 M stock in water. Add 10.2 g lithium acetate dihydrate (LiOAc*2H2O, Mw 102.02 g/mol) in 80 mL water and dissolve. Add water to 100 mL and autoclave. 2. SDS stock solution 20% (w/v). Add 10 g SDS to 40 mL H2O. Heat to 60 °C to dissolve the SDS. Adjust pH to 7–8 using sodium hydroxide. Adjust volume to 50 mL with water. Do not autoclave as SDS will precipitate. 3. LiOAc-SDS solution. Mix 75 μL water, 20 μL 1 M LiOAc, and 5 μL 20% (w/v) SDS for each DNA extraction. Aliquot 100 μL in 1.5 mL microcentrifuge tubes.

Bacteria and Yeast Colony PCR

215

4. TE buffer. Add 10 mL 1 M Tris–HCl pH 8.0 and 2 mL 0.5 M EDTA pH 8.0 to 988 mL water. The resulting solution will be 10 mM Tris–HCl and 1 mM EDTA. Autoclave to sterilize. This buffer is used to resuspend DNA in the last step. Other recipes of TE buffer can probably also be used.

3

Methods Carry out all procedures at room temperature unless otherwise specified. PCR master mixes should be kept on ice at all times, but PCR tubes can be handled at room temperature during the preparation of the mix.

3.1 E. coli Colony PCR

This protocol can be used to amplify new constructs in E. coli transformants. We have found it efficient to use a three-primer strategy using two vector-specific primers flanking the insertion location of the insert and one gene-specific primer, usually one of the primers used to amplify the insert (Fig. 1). The two vectorspecific primers should differ in the distance to the insertion site by 200–400 bp. Using this strategy, an empty clone will produce a short PCR product corresponding to the distance between the vector-specific primers, while one of two longer bands will arise from a successful clone, depending on the orientation of a cloned insert (see Note 1): 1. Prepare a 1× PCR master mix containing all PCR components except template DNA. We use a homemade 2× PCR master mix containing DNA polymerase, buffer, Mg2+, dNTPs, and DMSO to which PCR primers are added to a final concentration of 1 μM and water. We prepare 110% of the theoretical

Fig. 1 Illustration of three-primer strategy for confirming cloning results. The annealing primer locations (represented in purple) will be different depending on the outcome: (a) plasmid containing an insert with the desired orientation; (b) plasmid containing an insert with the inverse orientation; (c) plasmid without insert

216

Humberto Pereira et al.

required volume, which is calculated as the total volume of each PCR times the number of clones including two negative controls (no cells and cells with the empty vector, i.e., vector without the insert) and a positive control if available. The cells are assumed to take up no volume in the calculation. 2. Prepare the appropriate number of tubes containing 1× PCR master mix. We keep the tubes open before adding the E. coli cells as we have found that the proximity to a Bunsen burner provides a sufficiently clean environment to avoid contamination. 3. Add a part of the E. coli colony to the inside of the tube, by swirling the toothpick against the wall of the tube (see Notes 2–4). 4. Transfer the remaining cells on the toothpick to fresh liquid or solid medium for preserving the clone and possibly preparing plasmid DNA. 5. Vortex and place the PCR tubes in a preheated thermal cycler as soon as possible. 6. Run the PCR program (see Note 5); time periods and temperatures depend on the polymerase used, size of the expected PCR product, and the melting temperature of the primers. We have found that 5-min initial denaturation (94–98 °C), 35 cycles of the main program, and 5 min of post-extension at 72 °C are sufficient. 7. Analyze 5–10 μL of the PCR amplification by gel electrophoresis. We add dyes to the loading buffer, in which case we can omit the addition of a loading buffer to the PCR products. 3.2 S. cerevisiae Colony PCR Using a Microwave Oven

This protocol usually represents the best compromise between cost, work, and success rate and should probably be the first protocol tested for a laboratory wishing to implement S. cerevisiae colony PCR. We have found it to be efficient for PCR products up to 2 kb, with occasional success for products up to 3 kb in size: 1. Prepare 1× PCR master mix according to the same principles as for the E. coli protocol (Subheading 3.1). 2. Pick a small, well-isolated colony with a sterile toothpick or a sterile 200 μL pipette tip (see Notes 3 and 6). 3. Transfer part of the colony to the side of a PCR tube. The most common mistake is to transfer too much cell material to the tube. We usually swirl the toothpick on the inside of the tube. 4. Transfer the remaining cells on the toothpick to fresh solid or liquid medium. 5. Incubate the tubes for 1–2 min at full power (800–1000 W) using a stock domestic microwave oven.

Bacteria and Yeast Colony PCR

217

6. Cool the tubes by placing them on ice or by a 3–5-min incubation at -20 °C in a freezer. 7. Add the PCR master mix; we use a total PCR volume of 20 μL to save on reagents. A larger scale such as 50 μL will be less sensitive to excess biomass in the PCR which might be useful for optimization. 8. Run the PCR program (see Note 7) and analyze 5–10 μL of the PCR product by gel electrophoresis. 3.3 PCR Using S. cerevisiae LiAc Permeabilized Cells

This protocol may not qualify as colony PCR, as DNA is effectively purified from the cells. However, this protocol is considerably less laborious than methods relying on any combination of glass beads, phenol, and chloroform. In our hands, this protocol has succeeded where the microwave oven protocol (Subheading 3.2) failed. This protocol has given more stable results, especially in the hands of less ˜ oke experienced workers. This protocol was first described by Lo et al. [10]: 1. Prepare one tube of 100 μL LiOAc-SDS mix for each colony. 2. Transfer a small colony from a plate using a sterile toothpick (see Note 6). The toothpick can also be used to inoculate liquid or solid medium to preserve the clone. 3. Vortex the tubes briefly and incubate at >70 °C for 10 min (see Note 8). 4. Add 300 μL of 96% ethanol and vortex briefly to precipitate DNA. 5. Spin tubes at least 15,000 g in a microcentrifuge for 3–5 min to precipitate DNA. The cells and cell debris will coprecipitate with the DNA at this point. 6. Remove liquid by inverting the tubes. 7. Add 500 μL 70% ethanol to each tube. 8. Spin tubes like in step 5. 9. Remove liquid by inverting the tubes. Try to remove as much of the liquid as possible in this step (see Note 9). 10. Resuspend the DNA in 100 μL TE buffer (see Note 10). 11. Spin down the cell debris for 1 min at top speed in a microcentrifuge. 12. Use 1 μL of the supernatant for 20 μL of total PCR volume. 13. Transfer about half of the supernatant to a fresh tube and store the DNA at -20 °C. 14. Run the PCR program and analyze 5–10 μL of the PCR product by gel electrophoresis.

218

4

Humberto Pereira et al.

Notes 1. The choice of PCR primers can be important. PCR primers should be specific for both vector and insert, as false-positive detection may arise by using PCR primers that are specific only for the insert or vector. The explanation for this surprising phenomenon is that DNA from the ligation mixture may adsorb onto the surface of the cells and serve as a PCR template masking the absence of the correct DNA construct inside the cells [56]. 2. Each colony must be transferred to both culture medium and PCR. Since many clones are usually screened, keeping track of PCR tubes and clones may be a logistical issue. We have found that stabbing a gridded LB plate with the tip and leaving it there is a good way of keeping track of the picked clones. 3. Many published protocols rely on the use of sterile toothpicks for transferring clones to the PCR tubes. It should be noted that toothpicks have been associated with PCR inhibitors [57]. If this is a concern, sterile pipet tips can be used instead. 4. We have found that toothpicks may absorb some of the PCR mix if cells are added into the master mix. Pipette tips used in the same way may also remove some PCR mix by capillary action. We deposit the cells above the surface of the PCR mix in the tube and vortex the tubes prior to PCR. This has the added benefit of not allowing interaction between PCR mix and template prior to PCR. 5. We provide a web service (http://pydna.pythonanywhere.com) where PCR can be simulated prior to PCR to ensure that PCR primers bind to the template DNA. 6. We usually keep an open petri dish with a suitable solid selective yeast medium nearby to preserve the clones. The petri dish is gridded with 8×8 to 10×10 squares using a marker pen or by placing it on a printable petri dish grid [58]. The toothpicks can be left standing in the agar as a help to keep track of processed clones. 7. This protocol is sensitive to the amount of yeast cells in the PCR tube. During the setup of this protocol, it is useful to use a PCR test case. We use primers 19_D-DFR1 (5’ GAC TCA GAC AGG TTG AAA AGA AGA C 3′) and 18_A-DFR1 (5’ CAA AGG TTT GGT TTT CAG TTA AGA A 3′) to amplify a 1288 bp PCR product from the DFR1 locus in S. cerevisiae using a program consisting of initial denaturation for 4 min at 94 °C, followed by 30 cycles of 94 °C for 30 s, 50 °C for 30 s, and 72 °C for 45 s, and a final extension at 72 °C for 5 min. This PCR is very robust and any yeast colony PCR protocol should do it with success.

Bacteria and Yeast Colony PCR

219

8. The original protocol also states that a 10-min incubation at room temperature can be performed instead of the incubation at 70 °C, but the high temperature should inactivate nucleases that can potentially degrade DNA. This might be an issue since DNA and cell debris are present together until the last step. 9. It is important to remove as much as possible of the ethanol in step 9 of Subheading 3.2, as ethanol could be a PCR inhibitor. The tubes can be incubated in a 37 °C heat block for 3–5 min in order to evaporate traces of ethanol. 10. Unlysed cells and cell debris will also be resuspended in this step.

Acknowledgments This work was supported by the Fundac¸˜ao para a Cieˆncia e Tecnologia Portugal (FCT) through Project FatVal PTDC/EAM-AMB/ 032506/2017 funded by national funds through the FCT I.P. and by the ERDF through the COMPETE2020 – Programa Operacional Competitividade e Internacionalizaca˜o (POCI). CBMA was supported by the strategic program UIDB/04050/2020 funded by national funds through the FCT I.P. Humberto Pereira acknowledges FCT for the Ph.D. scholarship, SFRH/BD/ 148722/2019. References 1. Gu¨ssow D, Clackson T (1989) Direct clone characterization from plaques and colonies by the polymerase chain reaction. Nucleic Acids Res 17:4000 2. Gibson DG, Benders GA, Axelrod KC, Zaveri J, Algire MA, Moodie M, Montague MG, Venter JC, Smith HO, Hutchison CA (2008) One-step assembly in yeast of 25 overlapping DNA fragments to form a complete synthetic Mycoplasma genitalium genome. Proc Natl Acad Sci 105:20404–20409 3. Pereira F, Azevedo F, Parachin NS, HahnH€agerdal B, Gorwa-Grauslund MF, Johansson B (2016) Yeast Pathway Kit: A Method for Metabolic Pathway Assembly with Automatically Simulated Executable Documentation. ACS Synth Biol 5:386–394 4. Cataldo VF, Salgado V, Saa PA, Agosin E (2020) Genomic integration of unclonable gene expression cassettes in Saccharomyces cerevisiae using rapid cloning-free workflows. Microbiologyopen 9:e978 5. Shi Y, Wang D, Li R, Huang L, Dai Z, Zhang X Engineering yeast subcellular (2021)

compartments for increased production of the lipophilic natural products ginsenosides. Metab Eng 67:104–111 6. Wang S, Xu X, Lv X, Liu Y, Li J, Du G, Liu L (2022) Construction and Optimization of the de novo Biosynthesis Pathway of Mogrol in Saccharomyces Cerevisiae. Front Bioeng Biotechnol 10:919526 7. Pereira H, Azevedo F, Domingues L, Johansson B (2022) Expression of Yarrowia lipolytica acetyl-CoA carboxylase in Saccharomyces cerevisiae and its effect on in-vivo accumulation of Malonyl-CoA. Comput Struct Biotechnol J 20: 779–787 8. Bonnet C, Rigaud C, Chanteclaire E, Blandais C, Tassy-Freches E, Arico C, Javaud C (2013) PCR on yeast colonies: an improved method for glyco-engineered Saccharomyces cerevisiae. BMC Res Notes 6:201 9. Sathe GM, O’Brien S, McLaughlin MM, Watson F, Livi GP (1991) Use of polymerase chain reaction for rapid detection of gene insertions in whole yeast cells. Nucleic Acids Res 19: 4775

220

Humberto Pereira et al.

˜ oke M, Kristjuhan K, Kristjuhan A (2011) 10. Lo Extraction of genomic DNA from yeasts for PCR-based applications. BioTechniques 50: 325–328 11. Ling M, Merante F, Robinson BH (1995) A rapid and reliable DNA preparation method for screening a large number of yeast clones by polymerase chain reaction. Nucleic Acids Res 23:4924–4925 12. Kwiatkowski TJ Jr, Zoghbi HY, Ledbetter SA, Ellison KA, Chinault AC (1990) Rapid identification of yeast artificial chromosome clones by matrix pooling and crude lysate PCR. Nucleic Acids Res 18:7191–7192 13. Shen SH, Chre´tien P, Bastien L, Slilaty SN (1991) Primary sequence of the glucanase gene from Oerskovia xanthineolytica. Expression and purification of the enzyme from Escherichia coli. J Biol Chem 266(1991): 1058–1063 14. Wang H, Kohalmi SE, Cutler AJ (1996) An improved method for polymerase chain reaction using whole yeast cells. Anal Biochem 237: 145–146 15. Bourke MT, Scherczinger CA, Ladd C, Lee HC (1999) NaOH treatment to neutralize inhibitors of Taq polymerase. J Forensic Sci 44:1046–1050 16. Akada R, Murakane T, Nishizawa Y (2000) DNA extraction method for screening yeast clones by PCR. Biotechniques 28(2000): 668–670, 672, 674 17. Linke B, Schro¨der K, Arter J, Gasperazzo T, Woehlecke H, Ehwald R (2010) Extraction of nucleic acids from yeast cells and plant tissues using ethanol as medium for sample preservation and cell disruption. BioTechniques 49: 655–657 18. Rossen L, Nørskov P, Holmstrøm K, Rasmussen OF (1992) Inhibition of PCR by components of food samples, microbial diagnostic assays and DNA-extraction solutions. Int J Food Microbiol 17:37–45 19. Gietz RD, Schiestl RH (2007) High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method. Nat Protoc 2:31–34 20. Pham TA, Kawai S, Murata K (2011) Visualization of the synergistic effect of lithium acetate and single-stranded carrier DNA on Saccharomyces cerevisiae transformation. Curr Genet 57:233–239 21. Harju S, Fedosyuk H, Peterson KR (2004) Rapid isolation of yeast genomic DNA: Bust n’ Grab. BMC Biotechnol 4:8 22. Blount BA, Driessen MRM, Ellis T (2016) GC Preps: Fast and Easy Extraction of Stable Yeast Genomic DNA. Sci Rep 6:26863

23. Walsh PS, Metzger DA, Higuchi R (1991) Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. BioTechniques 10:506–513 24. Jamal MAHM, Sharma SP, Chung H-J, Kim H-J, Hong S-T, Lee S (2017) Ultra-High Efficient Colony PCR for High Throughput Screening of Bacterial Genes. Indian J Microbiol 57:365–369 25. Liu D, Zeng X-A, Sun D-W, Han Z (2013) Disruption and protein release by ultrasonication of yeast cells. Innov Food Sci Emerg Technol 18:132–137 26. Kermekchiev MB, Kirilova LI, Vail EE, Barnes WM (2009) Mutants of Taq DNA polymerase resistant to PCR inhibitors allow DNA amplification from whole blood and crude soil samples. Nucleic Acids Res 37:e40 27. Wang Y, Prosen DE, Mei L, Sullivan JC, Finney M, Horn PBV (2004) A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res 32:1197–1207 28. Ghadessy FJ, Ong JL, Holliger P (2001) Directed evolution of polymerase function by compartmentalized self-replication. Proc Natl Acad Sci U S A 98:4552–4557 29. Baar C, d’Abbadie M, Vaisman A, Arana ME, Hofreiter M, Woodgate R, Kunkel TA, Holliger P (2011) Molecular breeding of polymerases for resistance to environmental inhibitors. Nucleic Acids Res 39:e51 30. Winship PR (1989) An improved method for directly sequencing PCR amplified material using dimethyl sulphoxide. Nucleic Acids Res 17:1266 31. Varadaraj K, Skinner DM (1994) Denaturants or cosolvents improve the specificity of PCR amplification of a G + C-rich DNA using genetically engineered DNA polymerases. Gene 140: 1–5 32. Henke W, Herdel K, Jung K, Schnorr D, Loening SA (1997) Betaine improves the PCR amplification of GC-rich DNA sequences. Nucleic Acids Res 25:3957–3958 33. Hengen PN (1997) Optimizing multiplex and LA-PCR with betaine. Trends Biochem Sci 22: 225–226 34. Mytelka DS, Chamberlin MJ (1996) Analysis and suppression of DNA polymerase pauses associated with a trinucleotide consensus. Nucleic Acids Res 24:2774–2781 35. Frackman S, Kobs G, Simpson D, Storts D (1998) Others, Betaine and DMSO: enhancing agents for PCR. Promega Notes 65:27–29 36. Kang J, Lee MS, Gorenstein DG (2005) The enhancement of PCR amplification of a

Bacteria and Yeast Colony PCR random sequence DNA library by DMSO and betaine: application to in vitro combinatorial selection of aptamers. J Biochem Biophys Methods 64:147–151 37. Hardjasa A, Ling M, Ma K, Yu H (2010) Investigating the effects of DMSO on PCR fidelity using a restriction digest-based method. J Exp Microbiol Immunol (JEMI) 14:161–164 38. Rees WA, Yager TD, Korte J, von Hippel PH (1993) Betaine can eliminate the base pair composition dependence of DNA melting. Biochemistry 32:137–144 39. Spiess A-N, Mueller N, Ivell R (2004) Trehalose is a potent PCR enhancer: lowering of DNA melting temperature and thermal stabilization of taq polymerase by the disaccharide trehalose. Clin Chem 50:1256–1259 40. Desai UJ, Pfaffle PK (1995) Single-step purification of a thermostable DNA polymerase expressed in Escherichia coli. BioTechniques 19:780–782. 784 41. Adlimoghadam A, Hedayati MH, Siadat SD, Nejati HAM, Vandyousefi J, Norouzion D (2008) Optimization of PCR conditions for detection of human brucellosis from human serum samples. Res J Microbiol 3:352–358 42. Lorenz TC (2012) Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies. J. Vis. Exp. 63:e3998 43. Bachmann B, Lu¨ke W, Hunsmann G (1990) Improvement of PCR amplified DNA sequencing with the aid of detergents. Nucleic Acids Res 18:1309 44. Wilson IG (1997) Inhibition and facilitation of nucleic acid amplification. Appl Environ Microbiol 63:3741–3751 45. Sakhabutdinova AR, Chemeris AV, Garafutdinov RR (2020) Enhancement of PCR efficiency using mono- and disaccharides. Anal Biochem 606:113858 46. Li H, Huang J, Lv J, An H, Zhang X, Zhang Z, Fan C, Hu J (2005) Nanoparticle PCR: Nanogold-Assisted PCR with Enhanced Specificity. Angew Chem Int Ed 44:5100–5103 47. Yang W, Li X, Sun J, Shao Z (2013) Enhanced PCR amplification of GC-rich DNA templates by gold nanoparticles. ACS Appl Mater Interfaces 5:11520–11524 48. Khaliq A, Sonawane RPJ, Sasi BK, Sahu BS, Pradeep T, Das SK, Mahapatra NR (2010)

221

Enhancement in the efficiency of polymerase chain reaction by TiO 2 nanoparticles: crucial role of enhanced thermal conductivity. Nanotechnology. 21:255704 49. Jia J, Sun L, Hu N, Huang G, Weng J (2012) Graphene enhances the specificity of the polymerase chain reaction. Small 8:2011–2015 50. Musso M, Bocciardi R, Parodi S, Ravazzolo R, Ceccherini I (2006) Betaine, dimethyl sulfoxide, and 7-deaza-dGTP, a powerful mixture for amplification of GC-rich DNA sequences. J Mol Diagn 8:544–550 51. Ralser M, Querfurth R, Warnatz H-J, Lehrach H, Yaspo M-L, Krobitsch S (2006) An efficient and economic enhancer mix for PCR. Biochem Biophys Res Commun 347: 747–751 52. Zhang Z, Kermekchiev MB, Barnes WM (2010) Direct DNA amplification from crude clinical samples using a PCR enhancer cocktail and novel mutants of Taq. J Mol Diagn 12: 152–161 53. Pan J, Zhang C, Teng Y, Zeng S, Chen S, Liang D, Li Z, Wu L (2021) Detection of Spinal Muscular Atrophy Using a Duplexed Real-Time PCR Approach With Locked Nucleic Acid-Modified Primers. Ann Lab Med 41:101–107 54. Hu B, Wang Y, Sun S, Yan W, Zhang C, Luo D, Deng H, Hu LR, Huang Z (2019) Synthesis of Selenium-Triphosphates (dNTPαSe) for More Specific DNA Polymerization. Angew Chem Int Ed Engl 58:7835–7839 55. Hu B, Wang Y, Li N, Zhang S, Luo G, Huang Z (2021) Highly convenient and highly specific-and-sensitive PCR using Se-atom modified dNTPs. Chem Commun 57:57–60 56. Dallas-Yang Q, Jiang G, Sladek FM (1998) Avoiding false positives in colony PCR. BioTechniques 24:580–582 57. Lee AB, Cooper TA (1995) Improved direct PCR screen for bacterial colonies: wooden toothpicks inhibit PCR amplification. BioTechniques 18:225–226 58. Lehti T, Westerlund-Wikstro¨m B (2013) Colony immunoblotting assay for detection of bacterial cell-surface or extracellular proteins, Bio Protoc. 3:e888

Chapter 18 Inverse PCR for Site-Directed Mutagenesis Diogo Silva, Gustavo Santos, Ma´rio Barroca, Diogo Costa, and Tony Collins Abstract Inverse PCR is a powerful tool for the rapid introduction of desired mutations at desired positions in a circular double-stranded DNA sequence. In this technique, custom-designed mutant primers oriented in the inverse direction are used to amplify the entire circular template with incorporation of the required mutation(s). By careful primer design, it can be used to perform such diverse modifications as the introduction of point or multiple mutations, the insertion of new sequences, and even sequence deletions. Three primer formats are commonly used, nonoverlapping, partially overlapping, and fully overlapping primers, and here we describe the use of nonoverlapping primers for introduction of a point mutation. Use of such a primer setup in the PCR, with one of the primers containing the desired mismatch mutation, results in the amplification of a linear, double-stranded, mutated product. Methylated template DNA is removed from the non-methylated PCR product by DpnI digestion, and the PCR product is then phosphorylated by polynucleotide kinase treatment before being recircularized by ligation and transformed to E. coli. This relatively simple site-directed mutagenesis procedure is of major importance in biology and biotechnology where it is commonly employed for the study and engineering of DNA, RNA, and proteins. Key words Site-directed mutagenesis, Inverse PCR, Nonoverlapping primers, Protein engineering

1

Introduction Site-directed mutagenesis (SDM) is a powerful method for making targeted, predetermined changes in a DNA sequence. It is invaluable in molecular biology and protein engineering for investigating the role of specific nucleotides and amino acids and for engineering desired properties into protein, DNA, and RNA molecules [1–7]. The original, relatively inefficient, SDM methods based on primer extension with single-stranded DNA templates [8–10] have evolved over the years and have been supplanted by the plethora of versatile, highly efficient SDM methods available today. Indeed, currently, a large variety of specific, high-throughput, in vitro [11, 12], and in vivo [13–15] techniques and manufactured kits

Lucı´lia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967, https://doi.org/10.1007/978-1-0716-3358-8_18, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

223

224

Diogo Silva et al.

Fig. 1 Illustration of primer design formats for inverse PCR with nonoverlapping (a), partially overlapping (b), and fully overlapping (c) primers. The hatched sections show the overlapping regions of the primers

(e.g., the GeneArt, EasyChange, Q5, Phusion, and QuikChange SDM kits) with efficiencies in some cases up to almost 100% for the site-specific mutation of almost any sequence, are available. The most commonly used in vitro SDM methods employ PCR and are based on either overlap extension PCR [12, 16] or inverse PCR (iPCR) [17, 18] as well as modifications and combinations of these. Overlap extension PCR is more appropriate for linear sequences and requires multiple rounds of PCR, whereas iPCR is designed for circular templates such as vector insert sequences and uses a simplified protocol necessitating only one PCR. Inverse PCR was first reported in 1988 for the identification of flanking regions of a known DNA sequence [17, 18]. Its designation, inverse, comes from the fact that the primers are oriented in the reverse direction, facing “outward,” away from each other, in contrast to regular PCR where “in-facing” flanking primers are employed. Nonoverlapping, partially overlapping, or fully overlapping primers can be used for SDM by iPCR. Nonoverlapping, “backto-back” primers (Fig. 1a) produce a linear mutated sequence which must then be recircularized before transformation to E. coli [19]. Partially overlapping primers (Fig. 1b) yield a product with short homologous ends which can be directly transformed for in vivo recombination in E. coli [20–22]. Completely overlapping, complementary, inverse primers (Fig. 1c) form part of the widely used QuikChange SDM kit (StrateGene), but the exact mechanism of action of this has been under discussion. It had initially been proposed to progress by linear amplification of template to give a circular product and not by exponential amplification as for a true PCR [22]. However, another study [23] indicated exponential amplification of a linear product with short homologous ends for recombination, as with partially overlapping primers. Use of partially or fully overlapping primers allows for a more simplified SDM procedure than with nonoverlapping primers, but frequently

Site-Directed Mutagenesis by iPCR

225

necessitates longer more complex primers and is sometimes characterized by poor or no amplification of PCR product, formation of primer dimers, and a reduced transformation efficiency [21–23]. In this chapter, we focus on the iPCR method with nonoverlapping primers for the introduction of a point mutation into a DNA sequence. This is composed of three principal steps (Fig. 2): (1) iPCR mutant amplification (including primer design, PCR, and agarose gel confirmation), (2) template removal and product recircularization (including template digestion, mutant phosphorylation, and ligation), and (3) transformation and mutant confirmation (transformation, plasmid construct isolation, and sequencing). iPCR is relatively easy and rapid to employ, and by simple modification of primer design, not only single base changes (point mutations) but also multiple base changes, deletions, and insertion can be carried out (see Fig. 2). Currently, a variety of optimized kits based on iPCR with nonoverlapping primers are available, e.g., the Phusion (Thermo Scientific), Q5 (New England Biolabs), and KOD-Plus (Toyobo) site-directed mutagenesis kits. The iPCR protocol presented herein is an update of that presented in the first edition of this book series [24]. The protocol is essentially the same, but the modifications included herein enable for a more streamlined and successful process due in particular to a more rapid competent cell preparation and improved primer design.

2

Materials

2.1 iPCR Mutant Amplification

1. PCR thermal cycler. 2. Thin-walled PCR tubes. 3. Circular, double-stranded, template DNA. Approximately 1 ng/μL stock in autoclaved, ultrapure water is recommended, but may vary from 0.1 to 10 ng/μL depending on plasmid size, sequence, and quality (see Note 1). 4. PCR primers (see Note 2). For highest SDM efficiency, HPLCor PAGE-purified primers are recommended. Resuspend lyophilized primers in 1.2 g/L (10 mM) Tris–HCl (tris (hydroxymethyl)aminomethane, adjust pH with HCl, pH 7) to a concentration of 100 μM, and prepare 20 μM working stock solutions by dilution of aliquots in 1.2 g/L (10 mM) Tris–HCl, pH 7. All primer solutions should be stored at -20 ° C and repeated freezing and thawing should be avoided. 5. High-fidelity DNA polymerase with proofreading activity (see Note 3), as supplied, e.g., Phusion High-Fidelity DNA Polymerase (2 U/μL). Store at -20 °C.

Fig. 2 Flowchart of the protocol for site-directed mutagenesis by inverse PCR with nonoverlapping primers. The primer design formats for introduction of a point mutation, multiple mutations, insertions, and deletions into a double-stranded circular DNA template are shown. Following primer design, the protocol employed for each type of mutation is identical. CH3, methyl group of methylated DNA; PO42-, phosphate group of 5’phosphorylated DNA

Site-Directed Mutagenesis by iPCR

227

6. DNA polymerase buffer (as supplied with the polymerase used), e.g., 5× concentrated Phusion HF buffer (see Note 4). Store at -20 °C. 7. Deoxyribonucleoside triphosphate (dNTP) mix, a stock solution of 10 mM is recommended. Store at -20 °C. 8. Autoclaved, ultrapure water (see Note 5). 2.2 Agarose Gel Electrophoresis

1. Agarose, molecular biology grade. 2. 50× (50 times concentrated) TAE solution (see Note 6): 242 g/L (2 M) Tris base, 60 g/L (1 M) glacial acetic acid, 14.6 g/L (50 mM) EDTA (ethylenediaminetetraacetic acid). Store at room temperature. Dilute in deionized water to 1× (i.e., 50-fold dilution) prior to use. 3. 6× loading buffer: 500 g/L glycerol, 58 g/L (0.2 M) EDTA, 0.5 g/L bromophenol blue, pH 8.3. Store at room temperature. Prepare 50 mL and store at room temperature for a maximum of 6 months (see Note 7). 4. Nucleic acid staining solution, e.g., Midori Green Advance (20,000×): 5 μL in 100 mL 1× TAE solution. While being significantly less mutagenic than the traditionally used ethidium bromide stain, appropriate care should be taken to avoid direct contact with Midori Green or similar nucleic acid stains. Store at -20 °C (see Note 8). 5. Molecular weight marker, as supplied. Store at -20 °C (see Note 9). 6. Gel casting trays and sample combs. 7. Electrophoresis chamber and power supply. 8. Transilluminator. Always use appropriate safety procedures and wear protective eyewear when using a transilluminator to prevent UV light damage.

2.3 Template Removal and Product Recircularization

1. Restriction enzyme DpnI (as supplied, typically 10–20 U/μL). Store at -20 °C (see Note 10). 2. DpnI digestion buffer (as supplied with DpnI, typically 10×). Store at -20 °C. 3. T4 DNA ligase buffer (as supplied with T4 DNA Ligase, typically 10×, ensure this contains 5–10 mM ATP and 50–100 mM DTT) (see Note 11). Store at -20 °C. 4. T4 polynucleotide kinase (as supplied, typically 10 U/μL). Store at -20 °C (see Note 12).

228

Diogo Silva et al.

5. T4 DNA ligase (as supplied, typically 5 U/μL). Store at -20 °C (see Note 13). 6. Incubators at 37 °C and 25 °C (or room temperature). 2.4 Preparation of Chemically Competent E. coli XL1-Blue

1. E. coli XL1-Blue cells stored at -70 °C in 15% glycerol (see Note 14). 2. Transformation buffer: 3 g/L (10 mM) PIPES, 3.4 g/L (30 mM) CaCl2, 18.6 g/L (250 mM) KCl, 9.9 g/L (50 mM) MnCl2·4H2O. Mix all components except MnCl2 and adjust pH to 6.7 with 112 g/L (2 M) KOH. Add MnCl2 and mix, and sterilize solution through a 0.22 μm membrane. 3. 100% dimethyl sulfoxide (DMSO). 4. SOC (Super Optimal broth with Catabolite repression): 20 g/L bacto-tryptone, 5 g/L yeast extract, 0.6 g/L (10 mM) NaCl, 0.75 g/L (2.5 mM) KCl, 0.95 g/L (10 mM) MgCl2, 1.2 g/L (10 mM) MgSO4, 3.6 g/L (20 mM) D-glucose.

2.5

Transformation

1. 100 μL aliquots of chemically competent E. coli XL1-Blue cells (see Note 14). Store at -70 °C. 2. pUC18 control plasmid (1 pg/μL). Store at -20 °C. 3. Luria-Bertani broth (LB): 10 g/L bacto-tryptone, 5 g/L yeast extract, 10 g/L NaCl. Adjust pH to 7 with a 200 g/L (5 M) NaOH solution. Autoclave to sterilize. 4. Ampicillin (see Note 15): 100 mg/mL stock solution in water. Filter sterilize through a 0.22 μm membrane and store at -20 ° C or at 4 °C for no more than 1 month. 5. LB agar plates containing antibiotic (100 μg/mL ampicillin). Prepare LB as described above with addition of 18 g/L agar. Autoclave to sterilize, cool to 50–55 °C, add 1 mL/L of 100 mg/mL ampicillin stock, mix, and aseptically pour to petri dishes.

2.6 Mutant Confirmation

1. LB (prepared as described above) + antibiotic (100 μg/mL ampicillin) (see Note 15). 2. 50 mL polypropylene falcon tubes. 3. Plasmid DNA purification kit, as supplied by manufacturer.

3

Methods The protocol given is for the introduction of a single point mutation with Phusion High-Fidelity DNA Polymerase in a construct with a total size of 6500 bp and with ampicillin resistance as the selection marker. Nevertheless, any templates up to ~10 kb in size

Site-Directed Mutagenesis by iPCR

229

and any rapid, high-fidelity polymerase can be used with appropriate protocol modification according to the manufacturer’s recommendations (namely, modifications in the buffer and polymerase concentrations, the PCR cycle, and/or the antibiotic used) (see Note 3). PCR process optimization may be required in some cases. 3.1 iPCR Mutant Amplification

1. Primer Design. Inversed primers should anneal to opposite strands of the plasmid, be nonoverlapping and aligned back to back with apposing 5’ends. Ideally, the targeted mismatch mutation should be located in the middle of the primer with 10–15 perfectly matched nucleotides on either side. Mutations can be incorporated closer to the 5′ end, but at least ten complementary nucleotides are required at the 3’end (see Note 16). Normal considerations for PCR primer design should be adhered to (see Note 17). Phosphorylation of primers is not required (see Note 2). For best results, at least HPLC grade purification of primers is required; for primers greater than 40 nucleotides in length, PAGE purification is recommended (see Note 2). 2. PCR Setup (See Note 18). Add the following components in the order given to a thin-walled PCR tube on ice: 13.4 μL autoclaved ultrapure water (for a total final reaction volume of 20 μL), 4 μL of 5× concentrated Phusion HF buffer (1X buffer) (see Note 4), 0.4 μL of 10 mM stock dNTP mix (200 μM of each dNTP), 0.5 μL of each 20 μM primer stock (0.5 μM of each primer) (see Note 2), 1 μL of 1 ng/μL plasmid template stock (1 ng) (see Note 1), and 0.2 μL of 2 U/μL Phusion DNA polymerase (0.4 U) (see Note 3). Gently mix, briefly centrifuge, and immediately place in the thermal cycler. A negative control reaction with all components except the primers, which are substituted with an equal volume of water, should also be set up. 3. PCR Cycle (See Note 19): 1 cycle at 98 °C for 2 min, 25 cycles of denaturation, annealing, and extension at, respectively, 98 ° C for 20 s, the calculated primer annealing temperature for 20 s, and 72 °C for 2 min (~20 s/kb of the template). A final extension is then carried out at 72 °C for 10 min before cooling to 4–10 °C. The same conditions are used for the sample and negative control. 4. Agarose Gel Confirmation. The results of the PCR are verified by visualizing 5 μL of the sample and negative controls on a 1% agarose gel using the following protocol. To 1 g of agarose, add 1X TAE buffer to 100 mL and boil until the agarose is completely dissolved. When cooled to ~50–60 °C, pour into the casting tray, insert comb, and leave until completely polymerized. Remove the comb, place the gel in the electrophoresis chamber, and add 1× TAE buffer until the gel is covered with

230

Diogo Silva et al.

the solution. To 5 μL of sample and negative control, add 1 μL of 6× loading buffer, mix, and carefully pipette into agarose gel wells. Load molecular weight marker (see Note 9) into an adjacent well. Run the gel at 7–8 V/cm for 45 to 60 min, carefully remove, and place it in nucleic acid staining solution for 30 min (see Note 8) before visualizing under a UV transilluminator. A strong band should be visible at 6500 bp for the sample and no band should be observed for the negative control (see Note 20). 3.2 Template Removal and Product Recircularization

1. Template Digestion. Add 1 μL of DpnI (10–20 U), 2 μL of 10× DpnI buffer, and 2 μL of autoclaved, ultrapure water directly to the PCR (15 μL reaction volume remaining). Mix by gently pipetting up and down, centrifuge briefly, and incubate for 1 h at 37 °C (see Note 10). 2. Phospho-ligation. To a new Eppendorf tube, add 11 μL of autoclaved, ultrapure water, 2 μL of 10× T4 DNA ligase buffer (see Note 11), 5 μL of DpnI-treated PCR product (see Note 21), 1 μL of PNK (10 U/μL) (see Note 12), and 1 μL of T4 DNA ligase (5 U/μL) (see Note 13). Mix by gently pipetting up and down, centrifuge briefly to spin down, and incubate for 90 min at 25 °C. Store on ice until transformation or store at 20 °C.

3.3 Transformation and Mutant Confirmation

1. Preparation of chemically competent E. coli XL1-Blue cells for transformation (see Note 14). Allow a glycerol stock of E. coli XL1-Blue to thaw on ice, add 50 μL of this suspension to 40 mL of sterile SOC medium in a 250 mL Erlenmeyer flask, and incubate at 37 ºC, 200 rpm until OD600nm = 0.6 (~8 h). Incubate the culture on ice for 10 min, centrifuge at 4 ºC for 10 min at 2500 × g, and decant the supernatant. Gently resuspend the pellet in 16 mL of ice-cold transformation buffer by swirling on ice (care should be taken as cells are susceptible to mechanical disruption), and incubate on ice for 10 min. Centrifuge at 4 ºC for 10 min at 2500 × g and decant the supernatant. Gently resuspend the pellet in 8 mL of ice-cold transformation buffer by swirling on ice. Centrifuge at 4 ºC for 10 min at 2500 × g and decant the supernatant. Gently resuspend the pellet in 4 mL of ice-cold transformation buffer by swirling on ice and add 300 μL of DMSO 100% stock, swirl gently, and place on ice for 30 min. Dispense 100 μL aliquots in ice-cold 1.5 mL microcentrifuge tubes and immediately freeze in liquid nitrogen. Store at -70 ºC for up to 1 month. 2. Transformation (see Note 14). Defrost the competent cells on ice (10 to 20 min), and add 5 μL (see Note 22) of the phospholigation reaction mix (see Subheading 3.2, step 2, phospho-

Site-Directed Mutagenesis by iPCR

231

ligation). Swirl the tubes gently and incubate on ice for 30 min. Swirl the tubes gently and heat-shock cells in a water bath at 42 °C for 45 s and immediately transfer to ice for 10 to 15 min. Add 900 μL of fresh SOC medium and incubate for 1 h at 37 ° C, 1.1 × g. Centrifuge for 1 min at 5000×g, at room temperature, remove 850 μL of the supernatant, and gently resuspend the pellet in the remaining solution. Spread-plate the remaining ~150 μL solution on LB + ampicillin agar plates and incubate overnight at 37 °C. A positive transformation control with 1 μL of 1 pg/μL pUC18 plasmid and a negative process control with 1 μL of the PCR negative control should also be carried out. 3. Select three transformant colonies and inoculate into 5 mL LB + ampicillin medium (see Note 15) in a 15 mL Falcon tube. Incubate at 37 °C, 1.1 × g overnight. No colonies should be visible for the negative process control. The LB + ampicillin plate for the positive transformation control should have at least approximately 50 colonies. 4. Isolate plasmid from cultures with a commercial plasmid purification kit, and forward for sequencing of the insert in both directions. > 80% of the sequences should contain the desired mutation and no other undesired mutation (see Note 23).

4

Notes 1. It is essential that the template used for iPCR is purified, circular, double-stranded DNA isolated from a dam+ E. coli strain. The majority of commonly used E. coli strains are dam+, including E. coli XL1-Blue, DH5α, and JM109. E. coli JM110 and SCS110 are examples of dam- strains and should not be used. dam+ E. coli strains contain the enzyme Dam methylase which methylates adenine residues in the sequence GATC. This methylated sequence is the target for digestion by DpnI and allows for later removal of template DNA from the non-methylated in vitro produced iPCR product. While best results are achieved with small templates, iPCR of templates up to 10 kb is commonplace, with some reports of successes with even larger plasmid constructs. 2. We have successfully used desalted primers for SDM but did encounter an increased number of incomplete product sequences with missing nucleotides at the ligation site. To enhance the yield of full-length sequences, HPLC- or PAGEpurified sequences are recommended. The former augments the content of full-length primers (≥ 85% are full length), while the latter, PAGE, is more apt for ensuring the full length (≥ 90% are full length) of longer primers (> 40 bp).

232

Diogo Silva et al.

Primers are frequently resuspended in water or Tris buffer supplemented with EDTA. Non-supplemented Tris buffer is preferred as the pH of water is often slightly acidic and can lead to depurination, while EDTA can interfere with downstream processes by sequestering essential cations. Do not store oligonucleotides in water at 4 °C. Prepare aliquots of 20 μM working stock, store at – 20 °C, and avoid repeated freezing and thawing. Phosphorylation of the iPCR product with polynucleotide kinase (see Subheading 3.2, step 2, phospho-ligation) eliminates the need for phosphorylated primers. Nevertheless, if preferred, these may be used and the polynucleotide kinase treatment omitted by substitution of this enzyme with 1 μL water during the phospho-ligation step. 3. While the polymerase used here is Phusion High-Fidelity DNA Polymerase, any high-fidelity DNA polymerase with a high extension rate and proofreading activity (3′ → 5′ exonuclease activity) may be used, e.g., Q5 High-Fidelity DNA polymerase, Pfu Turbo DNA polymerase, KOD DNA polymerase, etc. Nevertheless, one should be aware of the particular template size limitations of the polymerase chosen, e.g., KOD DNA polymerase is recommended for templates ≤6kbp, and Pfu Turbo and Phusion DNA polymerases are reported to be able to amplify plasmids up to 15 kb. For best PCR results, use the hot start variants of these polymerases where incorporation of automatic hot start technology permits polymerase activity at high temperatures only. This minimizes nonspecific amplification and primer dimer formation at low temperatures during reaction setup and during the initial PCR cycle and allows for room temperature reaction setup. Currently commercialized examples include Platinum SuperFi DNA Polymerase, Phusion Hot Start High-Fidelity DNA Polymerase, and Q5 Hot Start High-Fidelity DNA Polymerase. In all cases, modify the protocol given in this manuscript according to the manufacturers’ recommendations for the particular polymerase used. 4. Two buffers are provided with Phusion Polymerase, a HF and a GC buffer. The former is used as the default buffer for highfidelity amplification as the error rate with this is lower than with the latter. However, GC buffer can improve the performance with certain difficult or long templates, such as GC-rich templates or templates with complex secondary structures. For amplification of GC-rich templates, the use of 3% DMSO with HF buffer should be initially investigated. The GC buffer should only be used when the HF buffer gives unsatisfactory results. 5. Autoclave ultrapure water to ensure sterility and inactivate residual nucleases (DNase).

Site-Directed Mutagenesis by iPCR

233

6. The most popular buffers for DNA electrophoresis are TAE and TBE (1 M Tris base, 1 M boric acid, and 0.02 M EDTA). Either may be used here and should give similar results. 7. Bromophenol blue is used as a tracking dye and has an approximate position on a 1% agarose gel equivalent to a 370 bp (TAE buffer) or 220 bp (TBE buffer) fragment. Xylene cyanol FF (0.03% in 6× loading buffer stock) may also be used and has an approximate position on a 1% agarose gel equivalent to a 4160 bp (TAE buffer) or 3030 bp (TBE buffer) fragment. 8. We describe a DNA post-staining technique using Midori Green, in which, following electrophoresis, the agarose gel is incubated in a TAE-Midori Green solution. Any of a variety of commercial DNA stains may be used, e.g., GreenSafe Premium and Xpert Green, which may employ either pre-staining, poststaining, or direct staining techniques. The post-staining method is generally more sensitive and can be used for staining multiple gels. Pre-staining of the gel before casting enables use of lower quantities of stain, while the “direct sample staining” method using a dye preloaded with loading buffer is simpler to use and negates the necessity for a separate loading buffer solution. 9. Use a molecular weight marker with component DNA of sizes similar to the expected iPCR product size. We commonly use the GeneRuler 1 kb DNA Ladder. 10. The restriction enzyme DpnI digests template DNA (from dam+ strains) at the methylated sequence Gm6ATC, thereby “enriching for” the non-methylated in vitro amplified iPCR product. DpnI is active in the majority of commonly used polymerase reaction buffers (Phusion, Q5, etc.), and therefore the digestion can be performed directly in the PCR mix without purification of the DNA but with addition of DpnI buffer. Ten to twenty units of DpnI is recommended. Enzyme volume should be maintained below 10% of the total volume so as to avoid an altered specificity (“star activity”) related to high glycerol concentrations. Note also that recently, an optimized, three-enzyme mix (DpnI, polynucleotide kinase, and ligase) has been reported for a more rapid (5-min) enrichment and phospho-ligation of iPCR products in one step (New England Biolabs). 11. ATP, DTT, and Mg2+ are essential buffer components for phospho-ligation. We commonly use T4 DNA ligase buffer for the double T4 polynucleotide kinase-T4 DNA ligase reaction. Other buffers, such as the T4 polynucleotide kinase buffer, FastDigest Buffer, or even many of the standard low salt restriction enzyme buffers supplemented with 1 mM riboATP, may also be used. Oxidized DTT leads to reduced enzyme activity, avoid repeated freezing and thawing, and

234

Diogo Silva et al.

avoid using solutions more than 1 year old. Addition of 5% polyethylene glycol (PEG) may enhance phospho-ligation, but in this case extended ligation should be avoided. 12. T4 polynucleotide kinase phosphorylates the 5′-hydroxyl terminus of double- and single-stranded DNA and RNA. It is inhibited by ammonium ions and by high salt and high phosphate concentrations; do not use DNA precipitated with ammonium ions. 13. T4 DNA ligases join the 5′ phosphorylated and 3′ hydroxyl ends of the linear product to give a recircularized iPCR product. It is sensitive to high salt and high EDTA concentrations. Rapid ligases (Quick Ligase) which are reported to enable reaction completion in as little as 5 min have recently been marketed. 14. We commonly use in-house prepared chemically competent E. coli XL1-Blue as the cloning host. The preparation procedure described here allows for transformation efficiencies of 107–108 cfu/μL which is normally sufficient for our SDM protocol. In some protocols for the preparation of competent E. coli XL1-Blue cells, the first step involves the inoculation of 250 mL sterile medium in a 2 L Erlenmeyer flask with a single colony and incubation at 18 °C, 150 rpm until OD600 nm = 0.6. We have found that our protocol results in similar and sometimes higher cell competency, in addition to being much more rapid (~8-h growth as opposed to ~3–4-day growth). E. coli XL1-Blue is resistant to tetracycline and hence is not suited for plasmids with tetracycline resistance markers. Other, commercial, higher-efficiency cloning hosts and supercompetent cells may also be used for higher numbers of transformants. In addition, the use of electrocompetent hosts for transformation by electroporation allows for higher transformation efficiencies and is especially suited for large plasmids (~10 kbp and higher). In this latter case, it is essential that the phospho-ligated circular DNA sample is purified (e.g., with a commercial DNA purification kit) to remove salts, etc. prior to electroporation. 15. Ensure that the antibiotic/selection agent used is appropriate for the selective marker of the plasmid. 16. The description given is for a point mutation, but a similar primer design strategy may be used for short (1–3 bp) multiple base pair mutations or insertions, which may be included on one or both primers (see Fig. 2). Large insertions may be made by adding the nucleotides to be inserted on the 5′ ends of one, or both, of the inverse primers (see Fig. 2). Here, the perfectly

Site-Directed Mutagenesis by iPCR

235

matched portion of the primers should be 24–30 bp in length and should be used for calculation of the primer melting temperature. For deletions, the inverse primers should be designed to be perfectly matched to the sequences flanking the fragment to be deleted (see Fig. 2). All remaining steps of the iPCR SDM procedure for these different types of mutations are similar to that described. 17. Normal considerations for PCR primer design should be adhered to, i.e., forward and reverse primers should have similar (< 5 °C difference) melting temperatures (see Note 12), a GC content of 40–60%, 1 or 2 Gs or Cs at the 3’end, and direct repeats, secondary structures, primer dimers, and mispriming should be avoided. When designing mutations for introduction of an amino-acid change, codon usage tables for the expression host (e.g., the Codon Usage Database at Kazusa) should be consulted for selection of the codon most favored by the host and/or that which requires the least number of base changes. It is recommended to use bioinformatics tools such as SnapGene, NEBaseChanger, PrimerX, or Benchling, to facilitate primer selection and design. In addition, primer quality should be assessed using programs such as Primer3Plus, OligoAnalyser, Oligo Calc, etc., so as to minimize secondary structure formation and mispriming (to self and template) and to optimize primer length, GC content, 3’stability, and melting temperatures. 18. The optimum reaction conditions vary considerably with the polymerase and buffer system used; therefore the reaction conditions recommended by the supplier of the chosen polymerase should always be employed. Mainly, this involves alterations in the amount of polymerase and buffer used. 19. The optimum PCR cycle conditions vary with the polymerase and buffer system used, e.g., the Phusion DNA polymerase system is characterized by elevated denaturation and annealing temperatures and high extension rate as compared to the majority of other polymerases. Therefore, the reaction temperatures and times recommended by the manufacturers of the chosen polymerase should always be employed. Usually, high-fidelity polymerases are thermostable at temperatures higher than 98 °C. Therefore, denaturation temperatures from 95 to 98 °C can be used. The shortest denaturation time should be used so as to avoid template damage. For most templates a 30-s initial denaturation from 95 to 98 °C is enough. Some templates, due to higher complexity, may require up to 3 min or up to 5 min for GC-rich templates (>70% GC content).

236

Diogo Silva et al.

The most appropriate annealing temperature varies widely with the polymerase system employed and should be calculated as recommended by the supplier. Free online calculators for determination of the annealing temperatures are provided for the various DNA polymerase systems being currently commercialized, e.g., the Phusion Tm Calculator at Thermo Fisher Scientific. For primers with calculated annealing temperatures ≥72 °C with Phusion, a two-step thermocycling protocol is recommended in which the annealing step is eliminated. The extension time and temperature depend on the extension rate and optimal temperature of the polymerase utilized, as well as the amplicon length and complexity. Most commonly, 72 °C is used. The extension time employed should ensure adequate full-length product synthesis, and 15–60 s per kb is usually sufficient. We recommend using 25 cycles. A higher number of cycles (up to 35) may increase product yield but also increases the probability of secondary, unwanted mutations. 20. If, in addition to a DNA band of the desired size, other nonspecific DNA bands are visible for the sample, then all the remaining 15 μL of the reaction should be run on a 1% agarose gel and the desired DNA band size excised and purified with a commercial gel extraction DNA purification kit. The purified DNA fragment can then be used directly in the step “Template Removal and Product Recircularization” (Subheading 3.2). The absence of any visible bands indicates PCR failure, and hence typical PCR troubleshooting procedures should be followed, e.g., check primer design, reduce the annealing temperature by 3 to 5 °C increments, optimize Mg2+ concentration in 0.5 mM increments, increase denaturation and extension times, and repeat experiment with various concentrations of template. In the case of Phusion polymerase, use of both HF and GC buffers as well as addition of 3% DMSO should first be investigated (see Note 4). A weak band may be visible for the negative control if higher template concentrations were used (≥10 ng), but this should be manyfold weaker than the sample band. 21. Avoid using large volumes of PCR product as this may interfere with the subsequent phospho-ligation and transformation. If a poor PCR yield leads to the need for larger volumes of PCR product, this should first be purified using a commercially available DNA purification kit. Improved phospho-ligation may be attained by use of 5% PEG. Also, following polynucleotide kinase addition, the sample may be incubated at 37 °C for 30 min before cooling to room temperature, adding the T4 DNA ligase, and further incubating at room temperature for 90 min.

Site-Directed Mutagenesis by iPCR

237

22. Avoid using phospho-ligation mix volumes that are more than 10% of the competent cell volume as this leads to a reduced transformation efficiency. Purify phospho-ligation mix by use of a commercial DNA purification kit if transforming by electroporation. 23. The insert sequence should contain the desired mutation only. While it is not feasible to sequence the entire plasmid construct, the use of a high-fidelity polymerase reduces the risk of secondary mutations in the vector sequence. To ensure the absence of such mutations, the insert sequence may be re-cloned into the original non-PCR-amplified vector.

Acknowledgments The European Regional Development Fund (ERDF) is thanked for funding in the scope of Programa Operacional Regional do Norte (NORTE 2020) through the project ATLANTIDA (NORTE-010145-FEDER-000040). The FCT (Fundac¸˜ao para a Cieˆncia e a Tecnologia) is thanked for funding through the “Contrato-Programa” UIDB/04050/2020. All the technical staff at the CBMA are thanked for their skillful technical assistance. References 1. Burdick JP, Basi RS, Burns KS, Weers PMM (1865) The role of C-terminal ionic residues in self-association of apolipoprotein A-I. Biochim Biophys Acta Biomembr 2023:184098. https://doi.org/10.1016/j.bbamem.2022. 184098 2. Dahhas MA, Alsenaidy MA (2022) Role of site-directed mutagenesis and adjuvants in the stability and potency of anthrax protective antigen. Saudi Pharm J 30:595–604. https://doi. org/10.1016/j.jsps.2022.02.011 3. Wang L, Gu J, Zhao W, Wang M, Ng KR, Lyu X, Yang R (2022) Reshaping the binding pocket of cellobiose 2-epimerase for improved substrate affinity and isomerization activity for enabling green synthesis of lactulose. J Agric Food Chem 70:15879–15893. https://doi. org/10.1021/acs.jafc.2c06980 4. Chen K, Zhang M, Gao B, Hasan A, Li J, Bao Y, Fan J, Yu R, Yi Y, Ågren H, Wang Z, Liu H, Ye M, Qiao X (2022) Characterization and protein engineering of glycosyltransferases for the biosynthesis of diverse hepatoprotective cycloartane-type saponins in Astragalus membranaceus. Plant Biotechnol J 21:698. https:// doi.org/10.1111/pbi.13983

5. Sanguinetti M, Silva Santos LH, Dourron J, Alamo´n C, Idiarte J, Amillis S, Pantano S, Ramo´n A (2022) Substrate recognition properties from an intermediate structural state of the UreA transporter. Int J Mol Sci 23:16039. https://doi.org/10.3390/ijms232416039 6. Wang K-D, Dughbaj MA, Nguyen TTV, Nguyen TQY, Oza S, Valdez K, Anda P, Waltz J, Sacco MA (2023) Systematic mutagenesis of Polerovirus protein P0 reveals distinct and overlapping amino acid functions in Nicotiana glutinosa. Virology 578:24–34. https://doi.org/10.1016/j.virol.2022. 11.005 7. Collins T, De Vos D, Hoyoux A, Savvides SN, Gerday C, Van Beeumen J, Feller G (2005) Study of the active site residues of a glycoside hydrolase family 8 xylanase. J Mol Biol 354: 425–435. https://doi.org/10.1016/j.jmb. 2005.09.064 8. Hutchison CA, Phillips S, Edgell MH, Gillam S, Jahnke P, Smith M (1978) Mutagenesis at a specific position in a DNA sequence. J Biol Chem 253:6551–6560 9. Edgell MH, Hutchison CA 3rd, Sclair M (1972) Specific endonuclease R fragments of

238

Diogo Silva et al.

bacteriophage phiX174 deoxyribonucleic acid. J Virol 9:574–582 10. Hutchison CA 3rd, Edgell MH (1971) Genetic assay for small fragments of bacteriophage phi X174 deoxyribonucleic acid. J Virol 8:181– 189 11. Reeves AR (2016) In Vitro Mutagenesis. Methods Protocol:1–796 12. Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR (1989) Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51–59 13. Das N, Ghosh Dhar D, Dhar P (2022) Editing the genome of common cereals (rice and wheat): techniques, applications, and industrial aspects. Mol Biol Rep:1–9. https://doi.org/ 10.1007/S11033-022-07664-Y/TABLES/2 14. Forner J, Kleinschmidt D, Meyer EH, Fischer A, Morbitzer R, Lahaye T, Scho¨ttler MA, Bock R (2022) Targeted introduction of heritable point mutations into the plant mitochondrial genome. Nat Plants 8:245–256. https://doi.org/10.1038/s41477-02201108-y 15. Guo J, Zeng L, Chen H, Ma C, Tu J, Shen J, Wen J, Fu T, Yi B (2022) CRISPR/Cas9mediated targeted mutagenesis of BnaCOL9 advances the flowering time of Brassica napus L. Int J Mol Sci 23:14944. https://doi.org/ 10.3390/ijms232314944 16. Higuchi R, Krummel B, Saiki RK (1988) A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions. Nucleic Acids Res 16:7351–7367 17. Triglia T, Peterson MG, Kemp DJ (1988) A procedure for in vitro amplification of DNA segments that lie outside the boundaries of known sequences. Nucleic Acids Res 16:8186

18. Ochman H, Gerber AS, Hartl DL (1988) Genetic applications of an inverse polymerase chain reaction. Genetics 120:621–623 19. Hemsley A, Arnheim N, Toney MD, Cortopassi G, Galas DJ (1989) A simple method for site-directed mutagenesis using the polymerase chain reaction. Nucleic Acids Res 17:6545–6551 20. Qi D, Scholthof KB (2008) A one-step PCR-based method for rapid and efficient site-directed fragment deletion, insertion, and substitution mutagenesis. J Virol Methods 149:85–90. https://doi.org/10.1016/j. jviromet.2008.01.002 21. Zheng L, Baumann U, Reymond JL (2004) An efficient one-step site-directed and sitesaturation mutagenesis protocol. Nucleic Acids Res 32:e115. https://doi.org/10. 1093/nar/gnh110 22. Liu H, Naismith JH (2008) An efficient one-step site-directed deletion, insertion, single and multiple-site plasmid mutagenesis protocol. BMC Biotechnol 8:91. https://doi.org/ 10.1186/1472-6750-8-91 23. Xia Y, Chu W, Qi Q, Xun L (2015) New insights into the QuikChange process guide the use of Phusion DNA polymerase for sitedirected mutagenesis. Nucleic Acids Res 43: e12. https://doi.org/10.1093/nar/gku1189 24. Silva D, Santos G, Barroca M, Collins T (2017) Inverse PCR for point mutation introduction. In: Domingues L (ed) PCR. Methods and protocols, Springer protocols. Methods in molecular biology, 1st edn. Springer New York, New York, pp 87–100. https://doi.org/10.1007/978-1-49397060-5_5

Chapter 19 Optimized Design of Degenerate Primers for PCR Based on DNA or Protein Sequence Comparisons Maria Jorge Campos, Alejandro Gallardo, and Alberto Quesada Abstract PCR with degenerate primers can be used to identify the coding sequence of an unknown protein or to detect a genetic variant within a gene family. These primers, which are complex mixtures of slightly different oligonucleotide sequences, can be optimized to increase the efficiency and/or specificity of PCR in the amplification of a sequence of interest by the introduction of mismatches with the target sequence and balancing their position toward the primers 5′- or 3′-ends. In this work, we explain in detail examples of rational design of primers in three different applications, including the use of specific determinants at the 3′-end, to (i) improve PCR efficiency with related sequences for members of a protein family by complete degeneration at a core box of conserved genetic information at the 3′-end with the reduction of degeneration at the 5′-end, (ii) optimize specificity of allelic discrimination of closely related DNA sequences of orthologous by 5′-end fully degenerate primers, and (iii) increase the PCR efficiency of primers by targeting DNA sequences belonging to specific phylogenetic groups, within a large and diverse gene family, allowing the use of multiplex/degenerate PCR. Key words PCR, Degenerate primers, 5′-end, 3′-end, PCR specificity, PCR efficiency, Sequence alignment

1

Introduction PCR or polymerase chain reaction is a molecular biology technique first developed by Kary B. Mullis that allows the amplification of a segment of DNA in theory from as little as a single DNA molecule [1]. To carry out a PCR and produce double-stranded DNA molecules, the four building blocks of the DNA (the deoxynucleotides or dNTPs) must be present together with oligonucleotides (also called mers or primers), a DNA polymerase, and a DNA template chain. The use of thermoresistant enzymes enables the production of large amounts of polymers of DNA, flanked by primer sequences, after repetition of cycles of high and low temperature that denature the double-stranded DNA chain, and allows the annealing of the primers to the template DNA and the DNA

Lucı´lia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967, https://doi.org/10.1007/978-1-0716-3358-8_19, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

239

240

Maria Jorge Campos et al.

extension [2]. Primers must be complementary to the upper and lower chains and can be easily designed when the target DNA sequence is well known. However, sometimes the DNA target sequence is unknown or presents variability. Usually, when a DNA sequence is unknown for one organism, its protein sequence might be deduced from orthologous that belong to the same protein family, since the conservation of structure-function relationships relies on amino acid sequence homology [3]. In these cases, it is possible to infer the DNA target sequence through the reverse translation of the amino acid sequence to the coding DNA, although the redundancy of the genetic code imposes a degree of uncertainty on the DNA sequence. This can be overcome by producing sequences of primers, called degenerate, made of a collection of sequences instead of one single sequence as in specific primers [4]. The International Union of Pure and Applied Chemistry (IUPAC) has established a nomenclature for incompletely specified bases in nucleic acid sequences [5] (Table 1). Since only a few sequences within a degenerate oligonucleotide might be functional for every particular DNA template, strategies to reduce its complexity are strongly recommended in order to set an optimal PCR efficiency. Different roles for the 5′- and 3′-ends of primer molecules can be predicted. Thus, whereas the 5′-end contributes marginally, a match of the 3′-end is critical for PCR efficiency during DNA synthesis, since it is where the 3’-OH substrate needed for DNA polymerase activity is located in a double helix template [6]. It has been shown that one single mismatch in the last three nucleotides counting from the 3′-end is acceptable, but a second impaired position drops efficiency below the detectable level on agarose gel electrophoresis [7].

2

Materials

2.1 Sequence Manipulation and Primer Design

1. Text processor, e.g., Microsoft Word, OpenOffice Text Document or Pages for Mac. 2. Multiple alignment programs, e.g., http://www.ebi.ac.uk/ Tools/msa/ or https://www.expasy.org/resources/uniprotclustalo. 3. Primer design algorithms, e.g., http://www.ncbi.nlm.nih. gov/tools/primer-blast/, https://www.thermofisher.com/ es/es/home/life-science/oligonucleotides-primers-probesgenes/custom-dna-oligos/oligo-design-tools/oligoperfect. html, and https://eurofinsgenomics.eu/en/ecom/tools/pcrprimer-design/, or commercial informatics program as OLIGO Primer Analysis Software (Molecular Biology Insight).

Design of Degenerate Primers

241

Table 1 Genetic code and compressed notation code according to IUPAC [5]

Amino acid

Codons

Compressed notation codon Nucleotide Base

A

Alanine

GCT, GCC, GCA, GCG

GCN

R

Arginine

N

A

Adenine

CGT, CGC, CGA, CGG, AGA, AGG CGN, MGR

C

Cytosine

Asparagine

AAT, AAC

AAY

G

Guanine

D

Aspartic acid

GAT, GAC

GAY

T

Thymine

C

Cysteine

TGT, TGC

TGY

R

A or G

Q

Glutamine

CAA, CAG

CAR

Y

C or T

E

Glutamic acid GAA, GAG

GAR

S

G or C

G

Glycine

GGT, GGC, GGA, GGG

GGN

W

A or T

H

Histidine

CAT, CAC

CAY

K

G or T

I

Isoleucine

ATT, ATC, ATA

ATH

M

A or C

L

Leucine

TTA, TTG, CTT, CTC, CTA, CTG

YTR, CTN

B

C or G or T

K

Lysine

AAA, AAG

AAR

D

A or G or T

M

Methionine

ATG

H

A or C or T

F

Phenylalanine TTT, TTC

TTY

V

A or C or G

P

Proline

CCT, CCC, CCA, CCG

CCN

N

Any base

S

Serine

TCT, TCC, TCA, TCG, AGT, AGC

TCN, AGY

T

Threonine

ACT, ACC, ACA, ACG

ACN

W

Tryptophan

TGG

Y

Tyrosine

TAT, TAC

TAY

V

Valine

GTT, GTC, GTA, GTG

GTN

Start

ATG

Stop

TAA, TGA, TAG

2.2 PCR, Gel Electrophoresis, and Image Acquisition

TAR, TRA

1. 200 μL and 1.5 mL DNase-free plastic microtubes (see Note 1). 2. Thermocycler. 3. Gel electrophoresis system. 4. UV transilluminator or gel acquisition system.

2.3

Reagents

1. DreamTaq Green DNA Polymerase (Thermo Fisher) and buffer (see Note 2) or GoTaq® Green Master Mix (Promega). 2. dNTPs (see Note 3). 3. Degenerate primers (see Note 4).

242

Maria Jorge Campos et al.

4. Nuclease-free water or autoclaved to sterility ultrapure water obtained by a water purification system. 5. DNA staining solution, e.g., GreenSafe (NZYTech) or GelRed (Biotium). 6. Gel electrophoresis agarose. 7. DNA molecular weight marker, e.g., GeneRuler 1 kb Plus DNA ladder (Thermo Scientific) or 1 kb DNA Ladder (Promega). 8. Gel electrophoresis buffer TAE (see Note 5).

3

Methods

3.1 Primer Design from Protein Family Alignment: Reduction of 5′-End Complexity

Bfra Bun1 Bthe Bun2 Pden Coch

Fully conserved motifs of 4–6 consecutive amino acids, the core box, are required to design the oligonucleotide 3′-end with, at least, 11 nucleotide positions. This is considering that the first position, in the reverse primer, or the last position, in the forward primer, leading to ambiguity, is omitted from the oligonucleotide sequence to start reducing its complexity. In general terms, a good principle for designing highly efficient degenerate primers would be to establish a limit of degeneracy up to 64 (the number of different sequences within the mixture primer), meaning that the core box should not contain at all amino acid residues encoded by six codons (L, R, or S) and very few encoded by three (I) or four codons (A, G, P, V, or T). In contrast, amino acids encoded by two (C, D, E, F, H, K, N, T, or Y) or particularly only one codon (M or W) are strongly recommended (Table 1). The remaining sequence of primers, typically 7–12 nucleotides toward the 5′-end, is less critical for DNA synthesis and, thus, is the region where efforts to reduce degeneration should be focused. An example of core box selection for primer design is shown in Fig. 1, where relationships between

CepA2 CepA1 110…PQGGIEMSIADLLKYTLQQSDNNACDI……92……VTMGHKTGTGDRNAKG…55 109…PDQDFTITLRELMQYSISQSDNNACDI……92……TVVGHKTGSSDRNADG…53 105…PQGGFNIDIADLLNYTLQQSDNNACDI……92……VTIGHKTGTGDRNAKG…53 127…SGPVISLTVRDLLRYTLTQSDNNASNL……94……VVIAHKTGSGYVNENG…57 127…SGPVISLTVRDLLRYTLTQSDNNASNL……94……VVIAHKTGSGDVNENG…57 127…SGPVISLTVRDLLRYTLTQSDNNASNL……94……VVIAHKTGSGDVNENG…57 . : : : :*:.*:: ******.:: ..:.****:. * .*

Fig. 1 Protein alignment and core box selection for primer design. Sequences shown are: Bfra, AAA22905.1; Bun1, AAA66962; Bthe, NP_813418.1; Bun2, AAB17891; Pden, AAM48119.1; Coch, AAL79549.2. Multiple alignement was performed by Clustal Omega. Bold characters represent strongly conserved positions. Grey boxes indicate identical residues. Black boxes represent CepA characteristic residues used to design primers with 3’-end specific determinants for discriminatory PCR. The expected size of cepA fragments amplified by PCR with cepA1/A2 primers is 329 bp [8]

Design of Degenerate Primers

243

Table 2 Primer design for detection of cepA orthologous from Bacteroides and related anaerobic Gram-negative bacteria

Forward Primer Amino acids Coding sequence

D GAC T

N AAC T

N AAC T

A GCN

C TGC T

D GAC T

Abbreviated

S TCN AGC T WSN

GAY

AAY

AAY

GCN

TGY

GAY

CepA1 (x64)

AGC

GAY

AAY

AAY

GCN

TGY

GA

Amino acids Coding sequence

G GGN

H CAC T

K AAA G

T ACN

G GGN

Abbreviated

GGN

CAY

AAR

ACN

GGN

T/S ACN TCN AGC T WSN

G/S GGN TCN AGC T BSN

Complementary CepA2 (x64)

NSH GA

NSW AGA

NCC TCC

NGT NGT

YTT YTT

RTG RTG

NCC NCC

Reverse Primer

the two class A β-lactamases found in Bacteroides and related microorganisms, encoded by cepA and cfxA genes, are shown. Two primers were designed for cepA selective PCR from core boxes containing 3′-end specificity determinants (Table 2), allowing genotyping of β-lactam-resistant strains of Gram-negative anaerobes isolated from human and animals [8, 9]. The strategies to reduce primer complexity at the 5′-end include consideration of the codon usage bias, which is particular for every organism [10]. So, when the core box is extended toward the 5′-end of the oligonucleotide, the information contained in the protein sequence might be reverse translated by using the genetic code and the particular codon usage bias of the target organism, reducing to a minimum the degeneration of its DNA sequence. Another possible approach would be to combine the reverse translation of core box and the multiple alignment of DNA sequences encoding homologue sequences. The 5′-end sequence of primers could be assumed directly from the alignment, considering the organism codon usage and, further, the particular evolution of DNA sequences within the gene family. However, when the genetic variability extends toward the 5′-end of oligonucleotides and there is no rational way to reduce primer degeneracy to a value lower than 64 or in extreme circumstances to 128 (very few published reports have signaled success by using primer degeneracy higher than 128), we recommend the design of different primer sequence variants that might be used separately in different PCR. This strategy should result better than using inosine phosphate as a

244

Maria Jorge Campos et al.

degenerate base, since although this permissive nucleotide can base-pair with any nucleotide without increasing sequence complexity [11], in our experience its presence confers low reliability to PCR primers. The core boxes selected for oligonucleotide design shown in Fig. 1 constitute an example of managing the 5′-end of degenerate oligonucleotides to reduce their complexity. Whereas reverse primer lacks strongly specific 3′-end (only one position is fully variable among homologous), a fully specific PCR was expected to be determined by the forward primer (Fig. 1). The fully degenerated 3′-ends deduced from both core boxes present the complexity threshold for efficient PCR (64) from 6 amino acid residues for the forward primer (17 nucleotides) and from 5 residues for the reverse primer (15 nucleotides), which are nearly 3/4 of a typical 21-base oligonucleotides. Since specificity and efficiency requirements were fulfilled, the remaining sequences toward the 5′-ends were taken randomly from a DNA sequence alignment (not shown) to balance the GC content near 50%, which is also recommended. 3.2 Primer Design from DNA Alignment (I): Reduction of Specificity by Degeneration of 5′-End

In primer design for allelic discrimination, the number of mismatches at the last positions from the 3′-end of the primer is crucial for annealing and specific elongation by the DNA polymerase, which supports the mismatch amplification mutation assay or MAMA-PCR [7]. The discriminatory capability of this technique is based on the fact that each particular allele of a polymorphic position is complementary to the 3′-end of its corresponding primers, where annealing is further weakened by an additional mismatch with its target sequences, allowing amplification with one but not two mismatches. The technique is so sensitive that additional mispairing of primers produced by genetic variability of sequences would give rise to false negatives. To solve that, in a particular case that requires the use of DNA from closely related species as target sequences, we designed degenerate primers with allele-specific determinant at their 3′-ends that allow discrimination of the C-257-T polymorphism of gyrA sequence, responsible for quinolone resistance of Campylobacter isolates [12]. This primer design, shown in Fig. 2, was performed by including degeneration toward the primer 5′-ends, increasing the target recognition to both major species of thermophilic Campylobacter isolated from humans, C. jejuni and C. coli, without compromising the allelespecific amplification of gyrA for both species.

3.3 Primer Design from DNA Alignment (II): Reduction of Degeneration by Sequence Clustering

Many protein families are too large and/or diverse to support specific primer design, knowing that the efficiency limit for product detection by agarose gel electrophoresis should be 128–256 primer sequences in the PCR mix (see Subheading 3.1). This situation has been addressed to detect the occurrence, in enterobacteria, of mcr genes [13], which are plasmid determinants, conferring colistin

Design of Degenerate Primers Primer gJC-F Target sequence

GAGATGGYTTAAAGCCTGTTCA 122-GAGATGGTTTAAAGCCTGTTCA C

Primer sWT-F Target sequence

GGTATCAYCCACATGGMGATTC 236-GTTATCACCCACATGGAGATAT AG T C C

Primer sMu-R Target sequence

ACCGWCAAATRCTACGRAAYCA-5’ 257-TAGCAGTTTATGATGCTTTGGT CT T C C A

Primer gJC-R Target sequence

TCTATGCCAKCTAAAAYAAGGT-5’ 429-AGATACGGTCGATTTTGTTCCA A A

245

Fig. 2 gyrA sequence variability in human thermophilic Campylobacter: primer design for discrimination the C-257-T polymorphism. Primers are shown above their target sequence, the gyrA gene from C. jejuni. Residues in grey boxes represent primers degenerate positions (IUPAC code), according to the polymorphism of gyrA that exists among described sequences from C. jejuni and C. coli that is shown below the target sequence. Residues in black boxes are critical for MAMA-PCR. In the target sequence they represent the allele-specific polymorphism whereas in primer sequence indicate the mismatch that weakens the annealing and enable discriminatory PCR. The expected product sizes, for multiple PCR with the four primers, are 157 plus 329 bp, for T-257 gyrA linked to quinolone resistant isolates, or 215 plus 329 bp, for C-257 gyrA of quinolone sensitive Campylobacter [12]

resistance with origin in chromosomal genes encoding ethanolamine phosphotransferases (eptA genes) for lipid A modification [14]. Ten different mcr genes have been described so far, among which only mcr-1, mcr-2, mcr-3, mcr-4, mcr-5, mcr-7, and mcr-8 are true mobilizable colistin resistance determinants [15]. Considering the phylogenetic relationships existing among related mcr and enterobacterial eptA genes, four sequence clusters and one singleton could be distinguished (Fig. 3a). Primers were devised to target PCR amplification of mcr-1 and mcr-2 (cluster 1), mcr-3 and mcr-7 (cluster 2), mcr-4 and mcr-8 (cluster 3), and mcr-5 (singleton) (Table 3), selecting DNA regions that present low degeneration (inside every group) and more than one mismatch (outside every group) as efficiency and specificity determinants, respectively (Fig. 3b). 3.4 Protocol for Protein or DNA Sequence Analysis

1. Gather all the DNA or protein sequences of interest from online databases as the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov/nuccore for nucleotides or http://www.ncbi.nlm.nih.gov/protein/ for proteins) in FASTA format (see Note 6). 2. Paste the sequences in a text processor document.

246

Maria Jorge Campos et al.

A

B > > > > > > > > > > > > > > >

ATGATGCAG----------CATAC ---ATGACA----------TCACA ---ATGACA----------CAGCA ATGCGGTTGTCTGCATTTATCACT ATGTTCAAG--------------T ------GTG--------------A -----------------------A ----------------------------------------------A -----------------------A -----------------------A ATGTGGT----------------T ATGTCGTTATT-----------GC ATGTTGAAGCG-----------CC ATGTTAAAGCG-----------CT

13… 10… 10… 24… 9 … 4 … 1 … -6… 1 … 1 … 1 … 8 … 13… 13… 13…

…GGA--TTA---TCCGACTTGGGGCAAGG …CAA--TTA---TCCAACATGGGGCAAAG …GGA--TTA---TCCGACATTGGGTAAGA …ACG--------AACGGGCTGGAAACAAG …AGACAATAAGCGGGGAGCTTTTAGAATT …TCA--TTA---TCAGCCCTTTTTTAAGG …TGA—-ATATGAGGAAAAATGGTTCAAAG …GCG—-CTATCCGGCAAACTGGTACAAGG …TCA-—ATATCCTGAAAAATGGTATAAAG …TGA—-ATATGCAGACAAATGGTACAAAG …CCG-—TTATCCTGAGACATGGATAAAGG …CAT-—TCGCACCGGAAAATGGTGGTATG …CCG-—TAAGCCCGCCACACGGTGGCGCG …CAA-—ACCCACCACCTCACGCCTGCGCA …CCG—-CCCGGCGACGCCGCGCTTACGTA

457 451 451 466 459 445 445 439 445 445 445 445 457 457 457

B (cont.) TGCGGCACATCGACGGCGTATTCTGTGCCGTGTATGTTCAGCTA TGTGGCACATCGACGGCGTATTCTGTGCCGTGTATGTTCAGCTA TGTGGCACATCGACGGCGTACTCTGTGCCGTGTATGTTCAGTTA TGCGGGACGGATACGGCTACATCCCTTCCCTGCATGTTTTCCCT TGCGGAACGGCTACCGCAATATCACTACCCTGCATGTTCTCGCG TGCGGCACGGCCACGGCGGTGTCTCTACCCTGTATGTTTTCACG TGTGGGACTGCAACCGCTGTATCCGTCCCCTGCATGTTCTCCAA TGCGGCACGGCCACAGCGGTGTCGGTGCCCTGCATGTTCTCCAA TGCGGTACCGCTACCGCAATATCCGTTCCGTGCATGTTCTCGAA TGTGGCACGGCGACCGCAGTCTCGGTGCCCTGTATGTTCTCGGA TGTGGCACATCCACAGCCATATCTGTTCCATGCATGTTTTCAGA TGTGGCACGGAAACCGCTGTTTCCGTCCCCTGCATGTTCTCCGG TGCGGCACGGCAACTGCGGTTTCCGTCCCCTGTATGTTCTCTAA TGCGGCACAGCAACAGCCGTCTCAGTGCCGTGCATGTTCTCGGA TGCGGTACGGCGACCGCGATCTCCGTTCCCTGCATGTTTTCTGA ** ** ** ** ** ** * ** ** *****

884… 878… 878… 887… 875… 863… 860… 854… 860… 860… 860… 866… 875… 875… 875…

…AACGAATGCCGCGATGTCGGTAT …AACGAATGCCGTGATGTCGGTAT …AACGAATGTCGTGATGTCGGTAT …GAGCGCTGCCTGGATGAAATTCT …GGTACATGCTTTGATGAGGTGTT …CAATATTGTTTTGACCAAGTATT …AACACATGCTATGACGAGGTTGT …AACACCTGCTATGACGAGGTTGT …AAAACGTGCCATGACGAGGTGAT …AAAACCTGCTATGACGATGTTAT …AACTCATGTTATGATGAGGTTAT …AAATCCTGTATCGACGACGTTAA …GGCGAGTGCTACGATGAGGTCCT …GGCGAATGCTATGACGAAGTGCT …GGCGAGTGCTACGATGAGGTGTT ** **

1106… 1100… 1100… 1091… 1088… 1067… 1064… 1058… 1064… 1064… 1067… 1070… 1079… 1079… 1079…

…AGCAATGCCTATGATGTCTCAATGCTGTATGTCAGCGATCAT …GAAGCGAACTACGATGTCGCCATGCTCTATGTCAGTGACCAC …CAGGCCAACTATGATGTTGCCATGCTCTATGTCAGCGACCAC …-TCCGCTCACACGACACGGCGCTGCTGTACGTTTCCGATCAT …TCCGGGATGCGTGACGTTGCTATGATATATCTTTCTGATCAT …CAGGATATGTTCGATACTGCAATGCTGTATCTCTCTGACCAT …GAAGATAAGTACAACACCGCGTTGCTCTACGTCTCCGATCAT …GAAGATAAGTACAACACGGCGTTGATCTACCTCTCTGATCAC …AGCGATCAGTACAACACCGTGCTGCTTTATGTGTCCGATCAT …AGCGAACAGTACAACACCGTACTGCTGTATGTGTCCGATCAC …AAAGATGAGTATGATACTGTTTTATTATATGTCTCTGACCAT …CAGGCCAACATGAACACGGCGCTCATTTACCTCTCCGATCAC …CAGGATAAATTTACCACTAGCCTGGTTTATTTGTCCGACCAC …CAGGATAAATTTACCACCAGCCTGGTTTATCTTTCTGACCAC …CAGGATAAATTCACAACCAGCCTGGTCTATCTTTCCGATCAC * * ** * ** **

1398 1392 1392 1377 1377 1359 1353 1347 1353 1353 1356 1359 1368 1368 1368

Fig. 3 Phylogenetic analysis of colistin resistance genes and their multiple alignment of sequences to design cluster-specific primers. (a) Neighbor joining tree of the mcr-gene family, with multiple sequence alignment performed by Clustal X 2 and the phylogeny emulated by NJPlot 2.3 (bootstrap values indicated close to the corresponding nodes). eptA sequences representative of enterobacterial groups presenting acquired colistin resistance are indicated: E, Enterobacter spp.; K, Klebsiella spp.; E, Escherichia coli; S, Salmonella enterica. hPET corresponds to a chromosomal gene encoding a hypothetical phosphoethanolamine transferase located in the chromosome of some enterobacterial strains, which genome have been made available but their colistin resistance phenotype remains unknown. (b) Selection of primer sequences for cluster-specific mcr genes from the multiple sequence alignment. For every pair of forward and reverse primer (right and left sequences, respectively), the same color code shown in the phylogenetic tree is utilized, and variants included in degeneration are indicated in green (final sequences of primers in Table 3). Sequences shown are: mcr-1, AP026796.1; mcr-2, LT598652.1; mcr-3, CP053734.1; mcr-4, NG_057470.1; mcr-5, MK731977.1; mcr-6, NG_055781.1; mcr-7, NG_056413.1; mcr-8, CP049891.1; mcr-9, CP049986.1; mcr-10, LC548754.1; hPET, CP044315.2; eptA-E, CP073771.1; eptA-K, CP044050.1; eptA-C, CP054230.1; eptA-S, CP049308.1 Table 3 Primer design for specific detection of mobilizable colistin resistance (mcr) determinants from enterobacteria Product (pb)

Cluster

Forward primer

Reverse primer

Cluster 1 (mcr1/-2)

TGYGGCACATCGACGGCG TA

ATACCGACATCRCGRCATTCG TT

266

Cluster 2 (mcr3/-7)

GTSCCCTGCATGTTC TCCAA

AACGCSGTGTTGTACTTATC TTC

494

Cluster 3 (mcr4/-8)

ACGGCYACSGCRRTRTCWC ATGRTCAGARAGATAYAKCA TAC TWGCA

534

Singleton (mcr-5)

GCGGTTGTCTGCATTTA TCACT

464

CTTGTTTCCAGCCCGTTCGT

Design of Degenerate Primers

247

3. Copy all the sequences and use the algorithm Clustal on online platforms to align the multiple DNA or protein sequences. Clustal can be found in the EBI multi Sequence Alignment (http://www.ebi.ac.uk/Tools/msa/), the Swiss Institute of Bioinformatics (https://www.expasy.org/resources/uniprotclustalo), the Kyoto University Bioinformatics Center or other (http://www.genome.jp/tools/clustalw/), platforms. 4. Look for a core box of successive and conserved amino acid residues in the protein alignment (Fig. 1) or an 18 to 24 conserved DNA sequence around the target polymorphism (see Note 7) (Fig. 2). Protein sequences must be reverse translated to their genetic code (Table 2). This can be done on platforms as the Sequence Manipulation Suit (http://www.bioinformat ics.org/sms2/) or BioPHP (http://www.biophp.org/ minitools/protein_to_dna/demo.php). It is possible to obtain the codon usage of several organisms on online platforms like the Codon Usage Database (http://www.kazusa.or.jp/ codon/ ) or EMBL-EBI (http://www.ebi.ac.uk/Tools/st/ emboss_backtranseq/). 5. Consider a conserved region that has at the penultimate or ultimate position of the 3′-end of the possible primer a conserved position that can be used to distinguish a desirable trait and design the primer considering degenerate positions between target sequences, preferably at the primer 5′-ends (Table 1). An extra and obligated mismatch of the 3′-end should be included to weak primer annealing and increase specificity toward allele-specific (Fig. 2). 6. Primer design quality can be assessed by checking the formation of hairpins and primer dimerization. This information might be obtained by using the PCR Primer Stats option at the Sequence Manipulation Suite (https://www.bioinformat ics.org/sms2/). 7. Once primers are designed, they can be ordered using an online service from an oligonucleotide synthesis company. 3.5

PCR

A successful PCR relies on a number of factors some related to the quality of the primer design. Primer length should be between 16 and 28 nucleotides, which depending on the GC content should produce primers melting temperatures (Tm) between 50 and 62 ° C. It is not judicious to have Tm difference, between the two primers, greater than 5 °C [16], and the annealing temperature can be empirically determined as being 5 °C lower than the primer with the lowest Tm. Since for degenerate primers the working sequence(s) of primers is(are) unknown, a good approach is to set annealing temperature between 50 and 55 °C, although specific primers corresponding to one known homologue could be used to estimate more accurately the PCR conditions.

248

Maria Jorge Campos et al.

Other important aspect in the success of the PCR is the quality of the genomic DNA that includes the target sequence. Due to contamination problems, isolated areas in the laboratory should be dedicated to the DNA extraction process and PCR examination area, where gels are run, while PCR master mix and all PCR reagents should be handled in a laminar flow cabinet: 1. Bacterial DNA suitable for PCR can be obtained by the boiling method (see Note 8) or by using any commercial DNA extraction kit. 2. Prepare a PCR master mix. For a PCR with a final volume of 20 μL, mix in a 1.5 mL microtube the following (see Note 9): (a) 1 to 1000 ng of genomic DNA or 1 to 1000 pg of plasmid DNA (usually 1 to 2 μL of DNA). (b) 2 μL of Taq polymerase buffer (usually comes 10 × concentrated and is used 1× concentrated). (c) 0.4 μL of dNTPs solution with the concentration of 10 μM. (d) 1 μL of forward primer solution with the concentration of 10 mM. (e) 1 μL of reverse primer solution with the concentration of 10 mM. (f) 0.2 μL Taq polymerase at the concentration of 5 U/μL. (g) Water up to the volume of 20 μL. 3. Mix gently. 4. Add to each 200 μL PCR microtubes the sample DNA plus the amount of master mix to obtain a final volume of 20 μL. 3.6

Thermocycling

3.7

Gel Analysis

Incubate the 200 μL PCR microtubes containing the DNA and the master mix in a thermocycler with the following program: initial denaturation 95 °C for 2 min, 35 cycles of denaturation at 95 °C for 30 s, primer annealing between 50 °C and 60 °C for 1 min, extension at 72 °C for 1 min, and a final extension at 72 °C for 10 min. The PCR can be maintained at room temperature indefinitely. 1. Prepare a 0.75 to 1.0% agarose gel (see Note 10). 2. Load 10 μL of each PCR product in each gel well. 3. Connect the power supply to 80 V and wait approximately 1 h or until the fastest moving band in the PCR buffer is close to the gels hedge. 4. Observe the gel in the UV transilluminator or gel acquisition system, and look for the presence of the expected size amplified band.

Design of Degenerate Primers

4

249

Notes 1. If tubes are not DNase-free, sterilization at 121 °C for 15 min is suitable to DNase elimination. 2. DreamTaq Green Buffer allows direct loading of PCR products in gel wells since it has a density reagent and two tracking dyes. 3. dNTPs are available as mixtures of all the dNTP or as single solutions of dATP, dCTP, dGTP, and dTTP. 4. Primers can be ordered online from several commercial services, e.g., StabVida, Caparica, Portugal (https://www. stabvida.com); TriLink BioTechnologies, CA, USA (https:// www.trilinkbiotech.com); or Metabion International, Germany (https://www.metabion.com). 5. TAE buffer is commercialized concentrated 50× or can be prepared with the following composition (1x concentration composition): 40 mM Tris base, 20 mM acetic acid and 1 mM EDTA, pH 8.3. Should be used x1 concentrated for gel preparation and in electrophoresis systems. 6. Nucleotide or protein sequences can be used in the FASTA format. This format is text-based and widely used in bioinformatics with each dNTP being represented with the letters A, T, C, and G and each amino acid represented by the IUPC single letter code [5]. Each FASTA file begins with the symbol “>” followed by a description line which can be used as an identifier of the sequence. The NCBI FASTA format recommends lines of text to be shorter than 80 characters in length (http://blast.ncbi.nlm.nih.gov/blastcgihelp.shtml). 7. At the bottom of a DNA sequence alignment, the symbol “*” indicates a perfect alignment, and a lack of symbol represents a non-conserved sequence. In protein sequence alignments, two other symbols are presented. “:” indicates a position with conserved amino acids with strong similarity, whereas “.” indicates a position with conserved amino acids with weak similarity. 8. To use the boiling method, bacterial cells should be grown on solid media. One isolated colony is suspended in 200 μL of sterile ultrapure water or sterile TE buffer in a microtube. The tube is heated in a thermo bloc at 100 °C for 10 min. After that the tube is centrifuged at 10000 × g for 5 min. The supernatant can be directly used in PCR and can be stored at -20 °C for further use. 9. Multiply the amounts of each reagent by the number of samples reaction plus two. This will guarantee enough volume since handling loss may occur. Make sure to include one negative control (water instead of DNA) and one positive control

250

Maria Jorge Campos et al.

(a sample known to be positive for the presence of the target sequence) in your samples. All reagents and tubes should be kept on ice until placed in the thermocycler to guarantee the polymerase activity. 10. Bigger amplicons are better resolved in lower concentration of agarose gels (0.7 to 1%), while smaller amplicons are better resolved in higher concentrations of agarose gels (1 to 1.5%).

Acknowledgments This work was funded by national funds through FCT, Fundac¸˜ao para a Cieˆncia e a Tecnologia, I.P., under the project MARE (UIDB/04292/2020 and UIDP/04292/2020), the project LA/P/0069/2020 granted to the Associate Laboratory ARNET to Maria J Campos, and projects from the Spanish Ministry of Science and Innovation (Grant PID2020-118405RB-I00) and the Regional Government of Extremadura, also funded by the European Regional Development Funds (FEDER, research projects IB20181 and research group CTS059) to Alberto Quesada (integrated in INBIOG+C Institute). Bibliography 1. Saiki RK, Scharf S, Faloona F, Mullis KB, Horn GT, Erlich HA, Arnheim N (1985) Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 4732:1350– 1354 2. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, Mullis KB, Erlich HA (1988) Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 4839:487–491 3. Chothia C, Lesk AM (1986) The relation between the divergence of sequence and structure in proteins. EMBO J 4:823–826 ˜ i SE, Borio CS, 4. Iserte JA, Stephan BI, Gon Ghiringhelli PD, Lozano ME (2013) Familyspecific degenerate primer design: a tool to design consensus degenerated oligonucleotides. Biotechnol Res Int 2013:383646 5. Nomenclature Committee of the International Union of Biochemistry (NC-IUB) (1985) Nomenclature for incompletely specified bases in nucleic acid sequences. Recommendations. Biochem J 229(2):281–286 6. Haras D, Amoros JP (1994) Polymerase chain reaction, cold probes and clinical diagnosis. Sante 4(1):43–52

7. Cha RS, Zarbl H, Keohavong P, Thilly WG (1992) Mismatch amplification mutation assay (MAMA): application to the c-H-ras gene. PCR Methods Appl 2(1):14–20 8. Garcı´a N, Gutie´rrez G, Lorenzo M, Garcı´a JE, Pı´riz S, Quesada A (2008) Genetic determinants for cfxA expression in Bacteroides strains isolated from human infections. J Antimicrob Chemother 5:942–947 9. Lorenzo M, Garcı´a N, Ayala JA, Vadillo S, Pı´riz S, Quesada A (2012) Antimicrobial resistance determinants among anaerobic bacteria isolated from footrot. Vet Microbiol 157(1–2): 112–118 10. Ikemura T (1985) Codon usage and tRNA content in unicellular and multicellular organisms. Mol Biol Evol 1:13–34 11. Ben-Dov E, Shapiro OH, Siboni N, Kushmaro A (2006) Advantage of using inosine at the 3′ termini of 16S rRNA gene universal primers for the study of microbial diversity. Appl Environ Microbiol 11:6902–6906 ˜ o L, Palomo G, Ugarte-Ruiz M, Por12. Hormen rero MC, Borge C, Vadillo S, Pı´riz S, Domı´nguez L, Campos MJ, Quesada A (2016) Identification of the main quinolone resistance determinant in campylobacter jejuni

Design of Degenerate Primers and campylobacter coli by MAMA-DEG PCR. Diagn Microbiol Infect Dis 3:236–23913 13. Gallardo A, Iglesias MR, Ugarte-Ruiz M, M, Miguela-Villoldo P, Herna´ndez Gutie´rrez G, Rodrı´guez-La´zaro D, Domı´nguez L, Quesada A (2021) The plasmid-mediated Kluyvera-like arnBCADTEF operon confers Colistin (hetero) resistance to Escherichia coli. Antimicrob Agents Chemother 65(5):e00091–e00021 14. Liu YY, Wang Y, Walsh TR, Yi LX, Zhang R, Spencer J, Doi Y, Tian G, Dong B, Huang X, Yu LF, Gu D, Ren H, Chen X, Lv L, He D, Zhou H, Liang Z, Liu JH, Shen J (2016)

251

Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: a microbiological and molecular biological study. Lancet Infect Dis 16(2):161–168 15. Khedher MB, Baron SA, Riziki T, Ruimy R, Raoult D, Diene SM, Rolain JM (2020) Massive analysis of 64,628 bacterial genomes to decipher water reservoir and origin of mobile colistin resistance genes: is there another role for these enzymes? Sci Rep 10(1):5970 16. Chuang LY, Cheng YH, Yang CH (2013) Specific primer design for the polymerase chain reaction. Biotechnol Lett 10:1541–1549

INDEX A Adeno-associated virus (AAV).................... 161, 164, 170 Agarose gel electrophoresis .................88, 119, 153, 155, 162, 163, 167, 168, 175, 183, 186, 196, 227, 240, 243 Allergen-encoding genes ................................... 86, 88, 96

B Bacterial biofilms .................................106, 110, 133–147 Bacterial populations............................................ 105–114

C Calibration curves .............................................18, 87, 96, 97, 102, 106, 107, 109–111, 119–125, 127, 128, 156 Cashew nut ...............................87, 90, 91, 93, 95–97, 99 Chloroplast DNA (cpDNA) ........................................... 26 Chocolate ........................................................... 75–78, 86 Cloning ................................................. 79, 124, 193–206, 210, 215, 234 Cocoa authentication................................................75–83 Colony PCR .................................................204, 209–219 Complementary DNA synthesis......................... 133–137, 140, 141, 146 COVID-19 pandemic ....................................................... 2

D Dairy authentication ..................................................... 173 Degenerate PCR ................................................................v Degenerate primers 3’-end......................................................................... 99 5’-end......................................................................... 99 Detection .............................................. 18, 27, 28, 41–51, 63–72, 76, 78, 81, 82, 85–101, 118, 125, 128, 136, 137, 147, 154, 156, 164, 165 Detection of foodborne pathogens .........................41–51 Digital PCR (dPCR).........................1–11, 13, 14, 17–29 Disruptor .................................... 135, 137, 144, 159–170 DNA extraction.......................................... 19, 21, 25, 26, 33, 34, 59, 65, 70, 76, 77, 81, 82, 88, 90, 91, 98, 105, 106, 111, 112, 175, 178, 179, 209, 214, 248

DNA polymerase ....................................6, 45, 46, 49, 88, 92, 93, 160, 161, 163, 175, 181, 182, 186, 188, 197, 200, 203, 206, 212, 213, 215, 225, 227– 229, 232, 235, 236, 239–241, 243 DNase treatment .................................................. 135–137

E Emulsion PCR-DGGE ...................................... 32, 35–37 Escherichia coli ........................................ 63–72, 117, 118, 124, 125, 151, 196, 198, 201, 204, 210, 211, 213–216, 224, 228, 230, 231, 234 Exogenous control..............................107, 111, 112, 114 Expression plasmids ............................................ 194, 198, 201, 204–206, 211

F Fluorescence .........................................10, 11, 15, 24, 42, 45, 48, 56, 58, 60, 68, 83, 94, 96, 101, 105–107, 113, 114, 136, 139, 154 Food adulteration ................................................ 173–179 Food allergen detection.................................................. 86 Food allergy..................................................................... 85 Food authentication........................................................ 76 Food quality .................................................................. 173 Food safety ........................................................... 159, 173 Free energy (ΔG) .........................................164–166, 170 Fungi detection ..................................................................v Fusion genes......................................................... 193–206

G Gene expression quantification ..........133, 134, 137, 144 Gene family.................................................................... 243 Genotyping.............................41, 42, 45–47, 49, 51, 243

H Herbal products authentication ...............................17–29 High-resolution melting (HRM) post-melt....................................................... 42, 48, 50 pre-melt ........................................................ 42, 48, 50 protocol ..................................................................... 44 saturating dye ............................................................ 41

Lucilia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 2967, https://doi.org/10.1007/978-1-0716-3358-8, © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

253

PCR: METHODS AND PROTOCOLS

254 Index I

Q

Internal amplification control (IAC) ..........45, 64, 66–72 Intramolecular secondary structure ................... 160–162, 164, 165, 169, 170 Inverse PCR (iPCR) ............................................ 223–237 Inverted terminal repeat (ITR) ...................................161, 162, 164, 170

Quantification .................................................2, 5, 11, 19, 21, 26–28, 57, 62, 66, 86, 87, 89, 92, 96, 101, 105–114, 118, 121–123, 128, 133–147, 151–157, 197 Quantitative PCR (qPCR).........................................2, 18, 28, 29, 53–66, 68–72, 105–114, 118–121, 123, 126, 127, 133–147, 151–157, 167, 168

L Lactococcus lactis................................................... 151–157 Long amplicons............................................................. 190 Long-range PCR.................................................. 181–191

M Megaprimers...............................194, 196, 200, 201, 205 Melting .................................... 26, 32, 34, 41–51, 53–62, 99, 111, 119, 121, 123, 126, 127, 147, 154, 156, 157, 183, 185, 189, 194, 195, 205, 216, 235, 247 Microbial diversity studies .............................................. 32 Milk adulteration.................................................. 173–179 Minicircles (MCs) ................................................ 117–129 Mitochondrial D-loop DNA ............................... 173–179 Mixed bacterial cultures................................................ 106 Multiplex real-time PCR ..........................................63–72

N Nonoverlapping primers ...................................... 224–226 Nuclear DNA .................................................................. 76

P ParA resolvase....................................................... 124, 125 PCR additives ............................................................44, 46 PCR efficiency ............................................ 62, 86, 87, 96, 101, 127, 178, 205, 210, 240 PCR enhancers ...........................182, 183, 188, 212, 213 PCR specificity .............................................................. 213 Pentaplex qPCR assay ...............................................64, 66 Plasmid copy number determination..........151–153, 155 Polyacrylamide gel ....................................................33–35 Polymerase chain reaction (PCR) .............................2, 17, 31, 41, 63, 76, 118, 159, 173, 181, 193, 209, 224, 239 Primer design .......................................44, 48, 88, 98, 99, 119, 127, 152, 153, 156, 169, 183–185, 189, 194, 198–201, 204, 224–226, 229, 234–236, 240, 242–247 Proofreading enzyme .................................................... 182 Protein engineering ............................................. 194, 223

R Reaction efficiency ..............................106, 109, 113, 147 Real-time PCR ..................................................18, 41, 42, 44–49, 54, 63–72, 75–83, 86–91, 94–96, 98, 100, 101, 118, 120, 121, 123, 124, 126, 129 Real-time qPCR ..................................151–157, 163, 168 Recombination efficiency..................................... 117–129 Restriction enzymes ..........................................20, 22, 23, 27, 129, 195, 198, 203, 204, 227, 233 RNA isolation.........................5, 133, 135–137, 144, 145 RNA quality......................................... 133–135, 137–140

S Saccharomyces cerevisiae.............. 198, 210, 212, 214–218 Sample collection ................................3–5, 133, 135, 136 SARS-CoV-2 ............................................................... 1–11 Sequence alignment ..................................... 94, 100, 177, 244, 247, 249 Shiga toxin-producing Escherichia coli (STEC).................................................... 63–67, 70 Single nucleotide polymorphism (SNP) ................ 42, 43, 46, 48, 50, 51, 164 Site-directed mutagenesis (SDM) ............. 124, 165, 194, 223–237 Species differentiation .......................................v, 173–179 Species-specific PCR assay .............................................. 17

T Theobroma cacao........................................................75, 76 Thermal cycling.......................................... 2, 4, 9–10, 22, 28, 29, 164, 185, 186, 189, 212 Third-generation PCR.................................................... 18

W Wastewater based epidemiology (WBE) ...................... 1, 2

Y Yeast ..................................... 70, 194, 198, 209–219, 228