Plant breeding reviews . Volume 43 9781119616733, 1119616735, 9781119616757, 9781119616771

Table of contents :
Content: Maria Isabel Andrade: Sweetpotato Breeder, Technology Transfer Specialist, and Advocate --
Development of Cold Climate Grapes in the Upper Midwestern U.S.: The Pioneering Work of Elmer Swenson --
Candidate Genes to Extend Fleshy Fruit Shelf Life --
Breeding Naked Barley for Food, Feed, and Malt --
The Foundations, Continuing Evolution, and Outcomes from the Application of Intellectual Property Protection in Plant Breeding and Agriculture --
The Use of Endosperm Genes for Sweet Corn Improvement --
Gender and Farmer Preferences for Varietal Traits: Evidence and Issues for Crop Improvement --
Domestication, Genetics, and Genomics of the American Cranberry --
Images and Descriptions of Cucurbita maxima in Western Europe in the Sixteenth and Seventeenth Centuries.

Citation preview

Plant Breeding Reviews Volume 43

Plant Breeding Reviews Volume 43

Edited by

Irwin Goldman University of Wisconsin–Madison Madison, WI, USA

This edition first published 2020 © 2020 John Wiley & Sons, Inc. All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted, in any form or by any means, electronic, mechanical, photocopying, recording or otherwise, except as permitted by law. Advice on how to obtain permission to reuse material from this title is available at http://www.wiley.com/go/permissions. The right of Irwin Goldman to be identified as the author of this editorial material has been asserted in accordance with law. Registered Office John Wiley & Sons, Inc., 111 River Street, Hoboken, NJ 07030, USA Editorial Office The Atrium, Southern Gate, Chichester, West Sussex, PO19 8SQ, UK For details of our global editorial offices, customer services, and more information about Wiley products visit us at www.wiley.com. Wiley also publishes its books in a variety of electronic formats and by print‐on‐ demand. Some content that appears in standard print versions of this book may not be available in other formats. Limit of Liability/Disclaimer of Warranty While the publisher and authors have used their best efforts in preparing this work, they make no representations or warranties with respect to the accuracy or completeness of the contents of this work and specifically disclaim all warranties, including without limitation any implied warranties of merchantability or fitness for a particular purpose. No warranty may be created or extended by sales representatives, written sales materials or promotional statements for this work. The fact that an organization, website, or product is referred to in this work as a citation and/or potential source of further information does not mean that the publisher and authors endorse the information or services the organization, website, or product may provide or recommendations it may make. This work is sold with the understanding that the publisher is not engaged in rendering professional services. The advice and strategies contained herein may not be suitable for your situation. You should consult with a specialist where appropriate. Further, readers should be aware that websites listed in this work may have changed or disappeared between when this work was written and when it is read. Neither the publisher nor authors shall be liable for any loss of profit or any other commercial damages, including but not limited to special, incidental, consequential, or other damages. Library of Congress Cataloging‐in‐Publication Data Name: Goldman, Irwin, 1963– editor. Title: Plant breeding reviews / edited by Irwin Goldman. Description: First edition. | Hoboken, NJ : Wiley, 2020. | Includes bibliographical references and index. Identifiers: LCCN 2019026412 (print) | LCCN 2019026413 (ebook) | ISBN 9781119616733 (hardback) | ISBN 9781119616757 (adobe pdf) | ISBN 9781119616771 (epub) Subjects: LCSH: Plant breeding–Research. | Plant breeders–Research. Classification: LCC SB123 .P552 2020 (print) | LCC SB123 (ebook) | DDC 631.5/2–dc23 LC record available at https://lccn.loc.gov/2019026412 LC ebook record available at https://lccn.loc.gov/2019026413 Cover Design: Wiley Cover Illustration: © browndogstudios/Getty Images Set in 10/12pts Melior by SPi Global, Pondicherry, India 10 9 8 7 6 5 4 3 2 1

Contents Contributorsix 1. Maria Isabel Andrade: Sweetpotato Breeder, Technology Transfer Specialist, and Advocate

1

Jan W. Low and Edward Carey I. Early Years II. Research for Devlopment in Southern Africa III. The Advocate and Team Player IV. The Mentor at Work and in her Community V. Awards and Service Literature Cited Publications

3 7 18 21 24 25 26

2 Development of Cold Climate Grapes in the Upper Midwestern U.S.: The Pioneering Work of Elmer Swenson 31 Matthew D. Clark I. A Cold Climate Grape Industry II. Elmer Swenson III. Grape Improvement in the Midwest IV. Summary and Future Prospects Acknowledgments Literature Cited

32 37 53 57 57 58

3 Candidate Genes to Extend Fleshy Fruit Shelf Life

61

Haya Friedman

I. Introduction 62 II. Available Methods for Breeding and Genetic Manipulations 66 III. Cuticle Structure and Effect on Fruit Shelf Life 68 IV. Candidate Genes for Cell‐Wall Modification and Fruit Softening 69 V. Ethylene‐Biosynthesis Pathway and Effect on Fruit Ripening 77 v

vi

Contents



VI. Usefulness of Components of the Ethylene‐Response Pathway for Delay of Fruit Ripening VII. Fruit‐Ripening Delay Based on Manipulation of  Upstream Transcription Factors VIII. Concluding Remarks and Future Prospects Acknowledgments Literature Cited

4 Breeding Naked Barley for Food, Feed, and Malt

79 81 84 85 86

95

Brigid Meints and Patrick M. Hayes I. Introduction II. The Nud Gene III. Traits of Interest Related to Nud IV. Selecting for β‐Glucan and Starch Type V. Feed Barley Breeding and Quality VI. Food Barley Breeding and Quality VII. Malting Barley Breeding and Quality VIII. Brewing IX. Distilling X. Conclusions and Future Directions Acknowledgments Literature Cited

96 97 98 102 104 106 108 111 112 113 114 114

5 The Foundations, Continuing Evolution, and Outcomes from the Application of Intellectual Property Protection in Plant Breeding and Agriculture

121

Stephen Smith

I. Intellectual Property, Intellectual Property Rights, and the Thesis Underlying this Review 125 II. The Philosophical Basis of IP and IPR and the Need to Establish Appropriate Balances 128 III. Intellectual Property, Intellectual Property Rights, and their Associations with Plant Breeding and  Agriculture 133 IV. The Global Framework within which IPR Applicable to Plant Breeding Resides 143 V. The Development of Formal Mechanisms of  Intellectual Property Rights for Plant Varieties and Plant‐Related Subject Matter 148 VI. Forms of Intellectual Property Protection Available to Plant Breeders and Trait Developers 156

Contents

vii



VII. Associations Between IP Systems and the Generation of Benefits 176 VIII. Concluding Comments: Looking to the Future 188 Literature Cited 192

6 The Use of Endosperm Genes for Sweet Corn Improvement: A review of developments in endosperm genes in sweet corn since the seminal ­publication in  Plant Breeding Reviews, Volume 1, by Charles Boyer and Jack Shannon (1984) 215 William F. Tracy, Stacie L. Shuler, and Hallie Dodson‐Swenson

I. Introduction II. Economics III. Endosperm Development IV. Endosperm Mutants, Germination, and Seedling Vigor in Sweet Corn V. Future Prospects Literature Cited

7 Gender and Farmer Preferences for Varietal Traits: Evidence and Issues for Crop Improvement

217 218 219 233 234 235

243

Eva Weltzien, Fred Rattunde, Anja Christinck, Krista Isaacs, and Jacqueline Ashby

I. Introduction 245 II. Methods 247 III. Cases Documenting Gender Differentiation for Trait Preferences 250 IV. Findings on Gender‐Specific Trait Preferences 256 V. Issues for Gender‐Responsive Crop Improvement 264 Acknowledgments 273 Literature Cited 273

8 Domestication, Genetics, and Genomics of the  American Cranberry

279

Nicholi Vorsa and Juan Zalapa

I. Domestication and Breeding II. Life History Parameters III. Taxonomy IV. Cytology

281 285 287 288

viii

Contents

V. Traits of Interest VI. Heritability of Traits VII. Molecular Markers VIII. Nuclear and Organellar Genome Assembly IX. Linkage Mapping and SNP Markers X. Marker‐Trait Association Studies XI. Future Prospects Acknowledgments Literature Cited

289 297 297 302 303 305 308 310 310

9 Images and Descriptions of ­Cucurbita maxima in  Western ­Europe in the Sixteenth and Seventeenth ­ Centuries 317 Alice K. Formiga and James R. Myers

I. Introduction 318 II. Challenges of Identifying Cucurbits in Historical  Sources 319 III. Distinguishing Cucurbita maxima 321 IV. Where was Cucurbita maxima Present in South America Before the Arrival of Europeans and how Early Could it have Arrived in Europe? 327 V. Cucurbita maxima in Herbals and Botanical and  Agricultural Books 329 VI. Cucurbita maxima in Art 335 VII. Cucurbita maxima in Botanical Paintings 344 VIII. Cucurbita maxima in Genre Paintings and Still Lifes 346 IX. Conclusion and Future Prospects 349 Acknowledgments 350 Literature Cited 351

Author Index Subject Index

357 365

Contributors Jacqueline Ashby Senior consultant, Gender and Breeding Initiative (GBI), CGIAR Research Program on Roots, Tubers and Bananas Edward Carey Sweetpotato Breeder, International Potato Center, Kumasi, Ghana Anja Christinck Seed4change, Research & Communication, Gersfeld, Germany Matthew D. Clark Department of Horticultural Science, University of Minnesota‐Twin Cities, St. Paul, MN, USA Hallie Dodson‐Swenson Syngenta Seeds, Wilmington, DE, USA Alice K. Formiga Department of Horticulture, Oregon State University, Corvallis, OR, USA Haya Friedman Department of Postharvest Science of Fresh Produce, Agricultural Research Organization (ARO), the Volcani Center, Bet Dagan, Israel Patrick M. Hayes Department of Crop and Soil Science, Oregon State University, Corvallis, OR, USA Krista Isaacs Michigan State University, East Lansing, MI, USA Jan W. Low Principal Scientist and Co‐leader of the Sweetpotato for Profit and Health Initiative, International Potato Center, Nairobi, Kenya ix

x

Contributors

Brigid Meints Department of Crop and Soil Science, Oregon State University, Corvallis, OR, USA James R. Myers Department of Horticulture, Oregon State University, Corvallis, OR, USA Fred Rattunde Department of Agronomy, University of Wisconsin–Madison, ­Madison, WI, USA Stacie L. Shuler Syngenta Crop Protection, Slater, IA, USA Stephen Smith Department of Agronomy, Iowa State University, Ames, IA, USA William F. Tracy Department of Agronomy, University of Wisconsin–Madison, Madison, WI, USA Nicholi Vorsa Blueberry and Cranberry Research and Extension Center, Rutgers University, Chatsworth, NJ, USA Eva Weltzien Department of Agronomy, University of Wisconsin–Madison, Madison, WI, USA Juan Zalapa USDA‐ARS, Vegetable Crops Research Unit, Department of Horticulture, University of Wisconsin–Madison, Madison, WI, USA

1 Maria Isabel Andrade: Sweetpotato Breeder, Technology Transfer Specialist, and Advocate Jan W. Low Principal Scientist and Co‐leader of the Sweetpotato for Profit and Health Initiative, International Potato Center, Nairobi, Kenya Edward Carey Sweetpotato Breeder, International Potato Center, Kumasi, Ghana ABSTRACT Dr. Maria Isabel Andrade has not followed the more typical path of being a breeder in an academic institution or a private company. She developed a passion for a crop long neglected by the world, sweetpotato, in large part because it is a crop of the poor, predominantly cultivated by women in Sub-Saharan Africa. Hence, to be able to breed, she had to become on advocate for the crop, demonstrating its practical potential to not only address food insecurity but that the orange types, largely unknown in Sub-Saharan Africa (SSA), could also effectively tackle vitamin A deficiency. Most of her career has been spent in Mozambique, where her tireless efforts to develop and deliver improved drought-tolerant orange-fleshed sweetpotato varieties have been a model for others to emulate. Her ability to recognize the importance of collaborating with nutritionists and agricultural economists to develop innovative mechanisms to ensure that the improved orange-fleshed varieties could make a difference to human health and wealth has resulted in growing awareness and recognition of the concept of biofortification, that is breeding for enhance micronutrient quality in staple crops. As a collaborative member of the breeding team at the International Potato Center, she has demonstrated that an innovative accelerated breeding scheme could effectively deliver quality varieties. Over the years, she has mentored hundreds of staff members and students, helping Plant Breeding Reviews, Volume 43, First Edition. Edited by Irwin Goldman. © 2020 John Wiley & Sons, Inc. Published 2020 by John Wiley & Sons, Inc. 1

2

Jan W. Low AND EDWARD CAREY

to build a community of practice that recognizes that for scientists to make a difference in SSA, they must stretch their mandate and engage in delivery and often advocacy. This chapter describes the evolution of this unique career of a most amazing woman driven by her faith in god and the power of agriculture to improve nutrition among those most in need. KEYWORDS: sweetpotato, Africa, Mozambique, breeding, accelerated breeding, drought tolerance, orange-fleshed, vitamin A, advocacy

Maria Andrade in an Exhibition Booth on Sweetpotato Research in Mozambique at the Conference held in Kigali, Rwanda in 2015 (credit: J. Low). I.  EARLY YEARS II.  RESEARCH FOR DEVELOPMENT A. Technology Transfer in the First Decade B. Building the Evidence Base Through Collaborative Research C. Breeding in Africa for Africa III.  THE ADVOCATE AND TEAM PLAYER IV.  THE MENTOR AT WORK AND IN HER COMMUNITY V.  AWARDS AND SERVICE A. Awards B. Boards and Other Representation LITERATURE CITED PUBLICATIONS A. Articles and Chapters B. Papers at Workshops C. Project Reports

Maria Isabel Andrade

3

ABBREVIATIONS ABS AGRA AVRDC CGIAR

Accelerated Breeding Scheme Alliance for a Green Revolution in Africa World Vegetable Center Referred to just by its acronym since 2010, but formerly meant Consultative Group for International Agricultural Research CIAT Centro International de Agricultura Tropical: International Center for Tropical Agriculture CIP International Potato Center FAO Food and Agriculture Organization (United Nations) IDRC International Development Research Center IIAM Instituto de Investigação Agrária de Moçambique: National Agrarian Research Institute (2004 to date) INIA Instituto Nacional de Investigação Agronómica, National Institute of Agronomic Research, Mozambique INIA National Agriculture Research Institute, Cabo Verde IITA International Institute of Tropical Agriculture NIRS Near‐Infrared Spectrometer NGOs Non‐governmental organizations OFSP Orange‐fleshed sweetpotato SARRNET Southern Africa Root Crop Research Network SASHA Sweetpotato Action for Security and Health in Africa SETSAN Technical Secretariat for Food Security and Nutrition in Mozambique SPHI Sweetpotato for Profit and Health Initiative SSA Sub‐Saharan Africa SUN Scaling Up Nutrition USAID United States Agency for International Development VAD Vitamin A deficiency I.  EARLY YEARS Maria Isabel Vaz de Andrade was born on July 28, 1958, to Maria Vaz Andrade, in the town of São Filipe, on the small Island of Fogo, Cape Verde. She was the seventh of 10 children to her mother and the eleventh of 14 children to her father, a man so renowned for his work ethic that there is a song about him: “If you look for someone rich, don’t go to Francisco Andrade, but if are looking for a hardworking man, go to him.” Her father was a seafarer and, later, a shop owner on Fogo, and her mother sold homemade pastries in the town. Because of her

4

Jan W. Low AND EDWARD CAREY

parents’ hard work, the family never went hungry, supplementing their modest incomes with maize, cassava, beans, squash, sweetpotato, and watermelon grown on a small rented plot, often re‐planting the maize due to unreliable rains in the dry climate. Maria knew early that she would go into agriculture, and at the age of five refused to go to the store to buy butter for her mother to make a cake, swearing that she was going to study coffee and leave and work in Angola to help her family and change the life of people who suffer from hunger in Africa. She did get a gentle spanking from her father for that bit of impertinence. Maria’s parents emphasized food, nutrition, and education for their children, recognizing that education was the key to a successful future. At the local grade school, Maria learned addition and subtraction quickly, using chalk on a slate tablet. When she was 15 years old, Maria left Fogo for the first time when she moved to Santiago, the capitol, to attend high school, returning home only for summer vacations. She lived with her older brother Braz and his family, who cared for her and shared the work ethic of their father. For example, after getting 85% on a physics exam, she hurried to her brother’s workplace hoping to be rewarded for her success, but her brother was not sympathetic, asking her why she didn’t do better. As a result, she improved. After receiving her high school diploma in 1978, Maria taught math and natural science at the high school level from 1978 to 1980, where she quickly realized that enthusiasm and commitment are key to success, inspiring students and being inspired by what they could do together. She had an opportunity to study medicine in France via Senegal, but was interested in studying in the United States, idolized as “Mecca” by most Cape Verdeans, and in 1980 received a scholarship from the African American Institute to study agronomy at the University of Arizona in Tucson. As an undergraduate, she was fortunate to be exposed to an outstanding teacher and researcher, Dr. Albert K. Dobrenz, whom she worked for as an undergraduate, helping with drought response trials of maize, among other things. Completing her bachelor’s degree in 1984, she quickly completed her masters with a thesis on the genetics of guar under Dr. Ray at the University of Arizona, before returning to Cape Verde to a position in the National Institute of Agricultural Research (INIA in Portuguese), Cape Verde. Life on a university campus in the USA in the early 1980s was an eye‐ opener for Maria, but she kept her focus on working hard to make the most of her good fortune. Maria was able to enjoy the wonderful international social life, forging friendships and professional ties that would be important later in her career. Among her peers, Maria was famous for having a great time dancing, without needing to drink alcohol. While at

Maria Isabel Andrade

5

the University of Arizona, she married her high school sweetheart, who would be the father of her two daughters. When she returned to Cape Verde, it took some time to identify root crops as an important area where she could devote her career energies. She had wanted to work in plant pathology, but the position was already occupied. Her Director, Horacio Soares, a great supporter, assigned her to the maize program under Carlos Silva, but soon it became clear that the career opportunities in the maize program were limited. Tomato improvement was another possibility offered, but Maria was interested in working on important staple food crops for the people of her country. She was a member of a cohort of agricultural staff who had trained at the University of Arizona. The University’s relationship with Cape Verde also involved placing a faculty mentor, Vicky Makariam, in the country to provide mentoring and guidance to the recent graduates. Knowing the importance of cassava and sweetpotato in the Cape Verdean diet, Maria decided to set up a program in this area. At the University of ­Arizona, Maria also interacted with Marcio Porto, an agronomist and plant physiologist who would later head the cassava program in Brazil and go on to work for Centro International de Agricultura Tropical (CIAT), whose regional office in Africa was based at the International Institute of Tropical Agriculture (IITA) in Nigeria. He recognized the potential in this area. Her Director and faculty mentor were supportive. The next years (1985 to 1989) kept her busy assembling and evaluating germplasm collections for each crop and developing and disseminating recommended agronomic practices to extension services. During this time, she s­ upervised graduate students, served on thesis defense committees, and participated in short courses on cassava multiplication and breeding at IITA. Also, in 1987, Maria gave birth to her first daughter, Tania. During this period, Maria learned about the need for sensitivity, patience, and respect when dealing with farmers. A memorable example is when the African Cassava Mosaic Virus had been identified in the country, and by quick action Maria and a colleague concluded it could be eliminated by destruction of the cassava crop in the affected area. The team drove out to the affected area in their shiny pickup trucks and explained to the farmers what was going to happen. The farmers politely, but firmly, informed them that any large‐scale destruction of their important food crops would result in a large‐scale destruction of Maria and her colleagues! The team left, and over the course of time, developed other solutions, including the identification and deployment of resistant varieties. With the focus on root crops, the opportunity to study for the PhD soon arose, and in 1989, Maria enrolled at North Carolina State University

6

Jan W. Low AND EDWARD CAREY

for a degree in Plant Breeding and Plant Physiology under the guidance of Dr. Wanda Collins, the sweetpotato breeder there. Wanda was a role model and mentor, demanding hard work, but also providing support when things did not go as planned. Her thesis, titled Physiological basis of yield stability in sweetpotato, was co‐supervized by Dr. Raper, a physiologist. At North Carolina, Maria’s leadership skills and responsibility were recognized as she served stints as the Secretary of the African Students Association and as the Secretary of the Graduate Students Association in the Department of Horticulture. Once again, Maria would interact with peers and develop relationships that would last a lifetime. While in Arizona she had been largely oblivious to the scourge of racism, she did not escape from North Carolina completely naïve, but when treated with anything other than respect, she took her business elsewhere. Maria completed her research in 1993 and returned to Cape Verde to resume her leadership of the national root crops program, and complete her thesis write‐up. She returned briefly to the USA to give birth to her second daughter, Emalisa, in S ­ eptember 1993, and in 1994 she was awarded the PhD. With a doctorate under her belt and the importance of root crops increasingly recognized, Dr. Andrade joined the FAO as a National Expert with the Root and Tuber Crops Program, where she continued to support the work of the Cabo Verdean national root and tubers program. This productive period saw the release of cassava and sweetpotato varieties, the development of systems for the maintenance and dissemination of high‐quality planting materials to farmers, the implementation of hybridization and selection programs for both cassava and sweetpotato, and training of national scientists and technicians. In addition, she interacted with IITA and the International Potato Center (CIP) and AVRDC1 to introduce new cassava and sweetpotato germplasm to Cape Verde. During a study tour to IITA with national program colleagues, Maria met the head of cassava breeding at IITA at that time, Dr. Alfred Dixon, who told her that IITA was looking for a regional agronomist to be based in Mozambique (like Cape Verde, a Portuguese‐speaking country) under the Southern African Root Crops Research Network, a project that IITA was managing with CIP providing expertise on sweetpotato. Maria, who had just become a single mother, applied for the position, fought strongly to overcome skepticism by the largely male search committee about her potential for success with the job, but fortunately succeeded, most likely due to the support of Dr. Margaret Quinn,

1  AVRDC is now known as the World Vegetable Center.

Maria Isabel Andrade

7

IITA’s Director of the Crop Improvement Division. Maria, with her two little girls, moved to Maputo to embark on the work of a lifetime. During her time with IITA in Mozambique, there were some great supporters and influences who helped her to overcome many challenges both in the professional and personal realms. Dr. Andrew Uriyo, one of the managers of SARRNET based at IITA, was a consistent supporter and Dr. Michael Bassey, Director of International Cooperation, provided formative advice and counseling that would help to shape Maria’s mission. Dr. Bassey, who had previously worked for the Canadian International Development Research Center (IDRC), knew of the potential for nutritious crops (in this case, a soybean utilization project they had funded in Nigeria) to make a large difference when researchers developed their skills in technology transfer to ensure that farmers benefit directly from research results. He was also strong in his support of the need for women to be given the opportunity to take a leading role in improving food security. This vision was an affirmative guide to Maria’s work and provided moral support throughout her professional life. Further, Maria’s hard work and fiery capacity to get things done was recognized and supported by Dr. Rodomiro Ortiz, Deputy Director of Research and Director for Research for Development at IITA, in the first half of the 2000s. Maria’s life also took a decisive turn in 1996, when she met her colleague to be, Dr. Jan Low. As Maria says, Jan, an agricultural economist, “also taught me the real value of very hard work.” A powerful faith in God plays a very strong role in Maria’s life. This became particularly important during the early years in Mozambique. The hard‐working single mother with two small children to raise in a new environment, thought it would be best to take her children to the Catholic church, just next door to her house, where they could stay late if she needed to work late. However, Maria realized that she needed to monitor the children’s experiences a little more closely, particularly when a friend from the church inquired about the failing health of her child’s grandmother, who one child had said lived with them and said needed an extra gift from the church, which the child happily received on grandma’s behalf. In truth, Grandma was living back in Cape Verde and was in very good health. II.  RESEARCH FOR DEVLOPMENT IN SOUTHERN AFRICA A.  Technology Transfer in the First Decade Maria Andrade’s 22‐year relationship with Mozambique began in 1996, when she joined the International Institute for Tropical Agriculture

8

Jan W. Low AND EDWARD CAREY

(IITA) as their regional cassava and sweetpotato agronomist for the Southern Africa Root Crop Research Network (SARRNET).2 This was a United States Agency for International Development (USAID) funded network run by IITA, which among the Consultative Group for International Agricultural Research (CGIAR) is responsible for cassava in SSA, and the International Potato Center (known by its Spanish acronym CIP), the CGIAR center responsible for sweetpotato. At the time of her arrival, Mozambique had been at peace for just four years, following a brutal and destructive 16‐year civil war. Her office was based in the Instituto Nacional de Investigação Agronómica (INIA), whose staffing and infrastructure had suffered considerably during the war years. The Government was committed to rebuilding, but operating conditions both at the station and in the field were challenging. In fact, her predecessor in the position just lasted one year before resigning. Cassava was the major food crop in Mozambique, followed by maize. Sweetpotato was the fifth most important food crop in the country. In other Southern African countries at the time, maize was the dominant staple, followed by cassava. Sweetpotato was widely grown, but typically on small plots with a major constraint being lack of access to sufficient planting material, particularly after a dry season lasting 4–6 months.3 In the 1990s, there were few resources for breeding, and those that existed were concentrated on maize. The decade of the 1990s is renowned for declining investment in agriculture in general and overseas development assistance for agriculture in particular. Hence, both IITA and CIP were breeding at their headquarters in Nigeria and Peru, respectively, with promising clones from those programs and other sources around the world sent to Mozambique for varietal selection. The network concept was built on the idea that critical research could be undertaken by selected countries with results shared by all, to efficiently utilize very limited financial resources. Cassava received about 70% of the operational funds; sweetpotato just 30%. A major achievement during this period was Maria’s efforts to assist INIA to revive Mozambique’s national root and tuber crop program. INIA had just two bachelor level staff at headquarters with no background in roots and tubers; this was true capacity strengthening from the ground up. The work also required collaborating with district level agriculture 2 Countries covered by SARRNET include Malawi, Zambia, Zimbabwe, South Africa, Swaziland, Lesotho, Botswana, Namibia, and Angola. Tanzania also participated but was not backstopped by Andrade as there was an agronomist based in Tanzania to do so. 3  Note that sweetpotato is propagated in the tropics using cuttings from vines, which are perishable.

Maria Isabel Andrade

9

extension agents and four non‐governmental organizations (NGOs), such as World Vision, that were engaged in food security projects. In addition, Maria backstopped eight other Southern African countries, visiting each country on average twice per year, in addition to the annual SARRNET partners’ meeting. Most country visits are straightforward, but in the case of Angola, a civil war was still on‐going. As part of a supervisory team for the Seeds of Freedom project (1998–2000) in collaboration with World Vision, it was necessary to fly into many multiplication sites as road travel was too dangerous. Strong stomachs were required, as pilots took off and landed at steep inclines to avoid missile attacks. During this period, her direct boss at IITA, Rodomiro Ortiz, a geneticist leading the crop improvement division, provided excellent ­mentoring in research design and analysis, and in fundraising skills. Substantial support on network management came from Andrew Uriyo and Michael Bassey coordinating IITA’s efforts outside Nigeria. Ted Carey, from CIP’s regional office in Kenya, also provided sweetpotato clones for testing and collaborated with Maria in numerous joint training exercises. Thirty‐eight orange‐fleshed varieties arrived for selection in 1997 in Mozambique and were evaluated at INIA’s Umbeluzi station, just outside the capital, Maputo. However, 1996 also marked the year of initiation of deep friendships and collaborations among a group sometimes referred to as the “Ladies in Orange” (Fig. 1.1). Being a divorced mother, with two young

Fig. 1.1.  Three of the Ladies in Orange: (left to right) Maria Andrade, Jan Low, and Regina Kapinga (2007).

10

Jan W. Low AND EDWARD CAREY

children, in a field dominated by men and needing to travel a third of your time cannot be easy. That year Maria Andrade connected with Jan Low, an agricultural economist working for the International Food Policy Research Institute, based in Mozambique, but who had just finished a post‐doctoral stint with CIP in Kenya and had developed a passion for orange‐fleshed sweetpotato. Then there was Lurdes Fidalgo, a nutritionist leading the nutrition division at the Ministry of Health, and, finally, Regina Kapinga, a Tanzanian agronomist who backstopped SARRNET efforts in Tanzania. All recognized the potential contribution of orange‐fleshed sweetpotato for reducing vitamin A deficiency, a major public health problem in SSA, but particularly severe in Mozambique, where 69% of children under five were vitamin A deficient. Given that the dominant sweetpotato varieties in SSA are white‐fleshed, lacking any pro‐Vitamin A (beta‐carotene), the marginal shift to orange‐fleshed types would supply a rich source of Vitamin A that could be grown by any farmer. Just 125 g (a small root) of most orange‐fleshed sweetpotato (OFSP) varieties provides the daily vitamin A needs of a young child. Recognizing the need to address the underlying problem of insufficient vitamin A in the diet, Low and Fidalgo were instrumental in getting Helen Keller International to finance provincial level trials of OFSP varieties in 1998 that Maria had only been able to test at INIA headquarters due to funding limitations. The team convinced the donor that this was a necessary complementary action to the high‐dose vitamin A capsule distribution effort starting at the same time to help resolve the underlying problem of inadequate intakes of vitamin A. High‐dose capsules need to be administered every six months until the infant reaches five years of age. Promising results of OFSP varietal performance compared to local checks were presented at the Ministry of Agriculture and Rural Development in April 1999 (Fig. 1.2) at what probably was the first workshop promoting integrated agriculture‐nutrition strategies for addressing vitamin A deficiency. Subsequently, in July 1999, the government approved its Strategy for Combating Micronutrient Deficiencies, emphasizing both short‐ and longer‐term approaches for reducing iodine, iron, and vitamin A deficiencies. Nine OFSP varieties from the selection efforts were released later that year, the first in the country. However, there were no funds to multiply and distribute planting material or “seed” of these materials. Then fate intervened. In February and March 2000, devastating floods hit southern and central Mozambique, killing 700 and leaving over 44,000 families homeless and many more with complete crop loss. Low and Andrade were able to capitalize on the OFSP varieties being available and OXFAM GB invested in the CIP‐INIA‐Ministry of Health

Maria Isabel Andrade

11

Fig. 1.2.  The presenters at the first multisector meeting concerning OFSP in Mozambique (1999) (Maria second from left, middle row).

team to coordinate an effort that reached 108,000 affected households in the provinces of Gaza, Maputo, Inhambane, and Sofala. Over 47 hectares of multiplication plots were established, so that this distribution occurred in the 2000/2001 season. As the OFSP varieties can begin to be harvested at 3 months, this crop provided critical calories and nutrients during the hunger season. What was unique, however, was the collaboration with Fidalgo’s nutrition division to design a concurrent nutrition education campaign. In this campaign, community theater groups introduced the new OFSP type and its nutritional benefits. ­Decorated material worn as skirts, known as capulanas, were produced en masse that carried the slogan “O Doce que Dá Saúde”—the Sweet that Gives Health—and were distributed along with a radio campaign effort. In essence, this multidisciplinary effort turned disaster recovery into a development opportunity effort. The success of the disaster response effort raised the interest of USAID‐Mozambique, who subsequently funded a 4.5‐year project at the level of $4.5 million dollars on Accelerated Multiplication and Distribution of Health Planting Materials of the Best High Yielding

12

Jan W. Low AND EDWARD CAREY

Varieties of Cassava and Sweetpotato. The government of Mozambique itself contributed $1 million dollars to this work. Maria Andrade led this effort, collaborating with 124 partner organizations, with the dissemination effort for these two crops reaching 93 of Mozambique’s 141 districts across all provinces except Niassa. Maria trained and coordinated partners in improved rapid multiplication techniques that led to the establishment of over 500 hectares of conventional multiplication of cassava and sweetpotato plots across the country. A key mentor during this period was Malachy Akoroda, a root and tuber professor from Nigeria, who also had experience in large‐scale dissemination efforts. Over 1.3 million families received high‐quality planting material. Efforts were also made to promote diversified utilization of the crop (most sweetpotato roots in Mozambique are just steamed or boiled), with over 200 trainers of trainers instructed in how to make processed products and engage in market development. Varietal selection continued during this period, with 87 selection trials across major agro‐ecological zones being conducted. Yield studies during the period indicate that on‐farm yields of sweetpotato under the rain‐fed, unfertilized conditions faced by smallholder Mozambican farmers rose from 5.6 tons per hectare in 2001 to 11–13.6 tons per hectare in 2005. For cassava, average yields moved from 6.0 tons per hectare to 11–14 tons per hectare. B.  Building the Evidence Base Through Collaborative Research To put the situation in context, during the 1990s the nutrition community was quite focused on resolving micronutrient deficiencies through providing periodic high‐dose supplements that did not require changing behaviors. There was very little evidence of the effectiveness of so‐called food‐based approaches as an effective way of tackling vitamin A deficiency. In 2002, Jan Low, now with Michigan State University, received a grant to conduct a proof‐of‐concept project4 to test whether using an integrated agriculture‐nutrition education‐marketing approach using OFSP as the key entry point could be an effective strategy for addressing vitamin A deficiency (VAD) among children under five years of age. Maria Andrade provided the OFSP varieties and collaborated on training the World Vision extensionists who implemented the agronomic intervention. The positive results demonstrating significant 4 The Towards Sustainable Nutrition Improvement (TSNI) project (2002–2005) was funded by the Micronutrient Initiative of Canada, USAID, the Rockefeller Foundation, and HarvestPlus.

Maria Isabel Andrade

13

increases in vitamin A intakes and a 15% reduction in VAD prevalence after an 18‐month intervention were key for demonstrating the potential impact of biofortification and integrated agriculture‐nutrition interventions (Low et al. 2017). However, the need for breeding better OFSP in Mozambique instead of relying on successful varieties bred elsewhere emerged. The most well‐liked OFSP variety, ‘Resisto’, had excellent root yield, good taste, and a smooth, oval shape favored by traders. However, during the dry season, when sweetpotato is produced in valley bottoms where there is sufficient residual moisture, even though ‘Resisto’ produced far more roots than the local landrace ‘Canasumana,’ ‘Resisto’ had virtually no vines left at harvest time, whereas ‘Canasumana’ had abundant vines. Moreover, in 2005, after the study ended, there was a severe drought throughout most of the country for three consecutive seasons, resulting in the loss of over 50% of sweetpotato varieties. Logically, any varieties surviving this devastating drought became candidates for consideration as parents in breeding program to combat drought. Armed with the positive nutrition findings and the clear need for breeding, Andrade convinced the Rockefeller Foundation to invest in a true breeding program for Mozambique5, including the training of national collaborator in breeding at the Masters’ level. Joe DeVries of the Rockefeller Foundation and a maize breeder became a long‐term supporter of Andrade’s work and committed to building up national sweetpotato breeding capacity across the region. The first crossing block was established at Umbeluzi in August 2005, with partner INIA having now been reformed to be IIAM—Instituto de Investigação Agrária de Moçambique. Prior to this, only the Ugandan and South African national programs had sweetpotato breeding programs established. Maria and her team traveled throughout the country to collect any sweetpotato varieties that had survived the prolonged drought. Fifty‐ eight were collected and characterized. Eight of these landraces were included in the first polycross crossing block, consisting of 24 varieties. C.  Breeding in Africa for Africa In 2006, Maria Andrade joined CIP, focusing henceforth only on sweetpotato and leading CIP’s country program in Mozambique, continuing dissemination efforts with an additional focus on processed product development. Three of the four “Ladies in Orange” were now in the 5  The two-year project (August 2005–July 2007) was entitled Breeding for beta-carotene rich drought-tolerant sweetpotato for the drought-prone areas of Mozambique.

14

Jan W. Low AND EDWARD CAREY

same institutional home, with Regina Kapinga having joined in 2001 (based in Uganda) and Jan Low as Regional Director in late 2005. Moreover, CIP as an institution was strengthening its sweetpotato breeding effort and Maria Andrade was a critical addition to that effort. From its headquarters in Peru, Wolfgang Grüneberg led the team and Robert Mwanga joined CIP from the Ugandan national program in 2009. Edward Carey was hired to lead the breeding effort in West Africa in 2010, based in Ghana. Recognizing the challenge in getting donors to fund breeding efforts that take 8–9 years to produce improved varieties, Grüneberg realized that by taking advantage of the vegetative nature of the crop, it would be possible to cut down the time from crossing to varieties submitted for release to 4–5 years instead of 8–9. It was named the Accelerated Breeding Scheme (ABS). Given that each seed generated through crossings is a potential variety, the first step is to make nine copies of each seedling in the screenhouse. Then it is possible to have three sites for the first observational trial instead of just one. Thus, the key to ABS is that there are more sites earlier in the breeding cycle, and at least one of those sites should be the stress environment of interest. Andrade began working closely with Grüneberg, testing the ABS approach in Mozambique beginning in 2006. The three initial sites include one highly drought‐stressed environment, one exhibiting virus pressure, and one with reasonable growing conditions in the Mozambican context. She succeeded in demonstrating that ABS was a viable approach, with the release of 15 drought‐tolerant OFSP varieties in 2011 (Andrade et  al. 2016a), followed by seven additional varieties (four OFSP and three purple‐fleshed) in 2016 (Andrade et al. 2016b); that is, the completion of two cycles of breeding using the ABS approach (Fig. 1.3). Beginning in 2009, CIP has been leading the 10‐year Sweetpotato Action for Security and Health in Africa (SASHA) project6, which provides substantial support to its population development efforts in Sub‐Saharan Africa. There are three sub‐regional sweetpotato support platforms that support high‐throughput quality breeding. Each of these platforms has a quality lab with a freeze drier and Near‐Infrared Spectrometer (NIRS) that can determine accurate dry matter, protein, carbohydrate, beta‐carotene, and sugar analysis in just two minutes, along with rough estimates of iron and zinc contents. All platforms have increasing dry matter and beta‐carotene contents as core trait breeding objectives, but the focus in the East and Central African program in Uganda is on

6  Funded by the Bill & Melinda Gates Foundation, with Jan Low as the project manager.

Maria Isabel Andrade

15

Fig. 1.3.  Maria with her 2016 releases (credit: J. Low).

virus resistance, in the West African program in Ghana on low‐sugar sweetpotato, and in the Southern African program in Mozambique on drought tolerance. Each support platform backstops and provides virus clean‐up services and NIRS access to national programs breeding sweetpotato in their sub‐region. Maria Andrade leads the Southern African program and currently backstops sweetpotato breeders in Malawi, Zambia, Madagascar, South Africa, and Mozambique. Building on the strong relationship Maria has with Joe Devries of the Rockefeller Foundation, which, together with the Bill & Melinda Gates Foundation, heavily invested in the creation of the Alliance for a Green Revolution in Africa (AGRA) in 2006, SASHA project manager Jan Low negotiated for AGRA to agree to support national sweetpotato breeding programs and training a cohort of sweetpotato breeders, which CIP breeders would backstop and support, including convening an annual Sweetpotato Breeders (now referred to as Speedbreeders) meeting as a learning and information exchange opportunity. This enabled the training of nine breeders at the doctoral level and two breeders at the

16

Jan W. Low AND EDWARD CAREY

Fig. 1.4.  Speedbreeders decked out in orange sunglasses at the 2015 annual meeting.

master’s level, including Jose Ricardo of IIAM in Mozambique. Maria specifically supports or collaborates with breeders in Malawi, Zambia, Madagascar, and South Africa7, providing seed to test, visiting their programs, and offering NIRS and virus clean‐up services upon request. These efforts have paid off, with 41 varieties released by the other Southern African countries since 2009, 30 of which are orange‐fleshed and 11 non‐orange‐fleshed. Moreover, two of the Mozambican varieties Maria bred were tested and released in Ivory Coast in 2015 and are performing well in the United Arab Emirates. Since 2015, she has also been sharing seed from her crossing program with a breeder in Bangladesh, attending an Asian sweetpotato breeders’ forum annually. As of 2018, there are 14 SSA countries engaged in the Sweetpotato Breeding Community of Practice (Fig. 1.4) and Maria Andrade serves as an inspirational example to all on what can be achieved. Maria has long collaborated with Jose Ricardo of IIAM, with all varieties released as joint CIP‐IIAM products, but in 2014 a post‐ doctoral ­fellow, Godwill Makunde, also joined her team. The challenge of breeding for drought‐tolerant varieties that can survive under smallholder management in different agro‐ecologies has led the team to 7  Note that Angola and Madagascar do varietal selection based on varieties received from CIP, whereas Malawi, Zambia, and South Africa have breeding programs. Malawi bred and released five OFSP and four non-OFSP varieties since 2009, Zambia four OFSP and one non-OFSP, and South Africa four OFSP and released one CIP-bread OFSP variety.

Maria Isabel Andrade

17

explore a broader range of traits needed by successful varieties than were originally present in the initial breeding program in 2006. These include: Exploring vine survival after long dry spells (Andrade et  al. 2017). Vine length and stem diameter are indicators for vine survival and are highly heritable. Varieties with erect (short) and thick stems had better survivability. 1. Nutritional quality and stability over successively later harvesting periods (Alvaro et al. 2018). 2. Ability to sprout after storage in the sand or in the ground. The number of sprouts can easily be determined, with high numbers being a desirable trait. 3. Good taste has proved to be a critical factor influencing adoption. The protocol for on‐farm assessment has become more detailed since 2005, capturing not just cooked appearance and taste but also starchiness and presence of fiber. Moreover, the appearance, taste, and tenderness of cooked leaves is assessed at approximately 90 days after planting. Details describing advances in sweetpotato breeding methods applied in SSA have been described in detail in two book chapters (Grüneberg et  al. 2015; Mwanga et  al. 2017). Andrade is currently engaged in validating the concept of heterotic increments for both root and foliage yield in sweetpotato, maintaining two distinct breeding populations in Mozambique. In addition, there is an ongoing breeding effort in Mozambique to raise iron and zinc contents in OFSPs. Progress in raising iron contents is faster than in zinc. Non‐iron enhanced varieties have 1.8 mg/kg on average, whereas there are several clones above 4.0 mg/kg emerging from the 2017 trials. In 2018, the design of a study began to assess the bioavailability of the iron found in a clone with a 4.4 mg/kg iron content. If there is adequate bioavailability found, this would be a breakthrough in the ability to address iron deficiency, as the micronutrient problem is even more widespread than vitamin A deficiency. A multimeal feeding trial to establish bioavailability is scheduled for early 2019. Note that dissemination efforts did not stop in Mozambique during the development of the breeding program, following the philosophy of “use the best you have while breeding for better.” Moreover, dissemination efforts in other SSA countries intensified under the auspices of the Sweetpotato for Profit and Health Initiative (SPHI), which was launched in 2009. The goal of the SPHI is to combat undernutrition and

18

Jan W. Low AND EDWARD CAREY

improve incomes through providing 10 million African households in 17 target countries access to improved varieties of sweetpotato and their diversified use by 2020. Mozambique under Andrade’s guidance has been a leader in disseminating improved OFSP varieties at scale, with different projects utilizing different delivery models. She has traveled and trained extension personnel in all of Mozambique’s ten provinces and in all of its 141 districts, except one (Moma in Nampula province). III.  THE ADVOCATE AND TEAM PLAYER The old saying that necessity is the mother of invention is true. Advocacy is defined as any action that argues for a cause. In many instances, scientists feel that if a clear argument or evidence is p ­ resented, wise governments and donors will invest. However, in the resourced constrained environment of Mozambique, sweetpotato in the 1990s was not a policy priority. The uniting of the four “Ladies in Orange” was the critical mass needed to unleash a new way of doing advocacy in the world of the CGIAR. The color orange clearly represents the carotenoids found in Vitamin A rich foods as well as being a color of passion. Maria Andrade has been at the forefront of designing new ways to promote the OFSP. Mozambique was the first country to paint vehicles orange with the logo “O Doce que Dá Saúde” or “The Sweet that Gives Health.” As they moved through the countryside, people would approach asking what does it mean and where can I get the planting material? The capulanas have already been described, but in addition there have been hats, T‐shirts for adults and children, ties, and even fashion shoes. The campaign (Fig. 1.5) has included billboards, community theater, decorated market stalls, participation in national and provincial exhibitions, radio programs, and consistent television coverage. Maria engages consistently with government officials, particularly encouraging them to come to field events and exhibitions. Nothing is more convincing that watching a young child eat its first OFSP root—the look of enjoyment and the inevitable reach for another root. Because of the April 1999 multisectoral meeting looking at the potential of OFSP, in July 1999 the Mozambican government approved its Strategy for Combating Micronutrient Deficiencies, emphasizing both short‐ and longer‐term approaches for reducing iodine, iron, and vitamin A deficiencies. The strategy for reduction of vitamin A deficiency argues forcefully for complementary approaches: the distribution of vitamin A capsules and interventions to improve diet quality, while at the same time increasing the number of calories consumed. In addition,

Maria Isabel Andrade

19

Fig. 1.5.  (a) Decorated market stall promoting vine and root sales. (b) Women in Capulanas dancing. (c) Branded vehicle.

the Plan of Action for the Reduction of Absolute Poverty 2000–2004 specifically mentions increasing the consumption of foods rich in vitamin A as one the key activities to be undertaken to combat malnutrition. This meant that Mozambique was at the forefront of acknowledging the role biofortification could play in improving diet quality. Every food security, nutrition, or poverty document since then continues to integrate biofortification and OFSP as part of the solution. In the nutrition sector, OFSP has been adopted as a mainstream technology for combating vitamin A deficiency by the Technical Secretariat for Food Security and Nutrition in Mozambique (SETSAN) and in the country’s strategy in the Scaling Up Nutrition (SUN) movement.

20

Jan W. Low AND EDWARD CAREY

Mozambique is also the only country to date to have the collection of disaggregated data on OFSP varieties versus non‐OFSP varieties as part of its national sample survey of agriculture protocol. From this source, we know that by 2015, 32% of the sweetpotato grown in M ­ ozambique was orange‐fleshed. In 2014, the Minister of Agriculture and Rural Development, José Pacheco, commented that “one of these days, I will be known as the Minister of orange‐fleshed sweetpotato”. Maria’s passion for OFSP has been contagious. Work on developing processed products using orange‐fleshed sweetpotato as a key ingredient began in 2003, and her laboratory has backstopped recipe development for bread, juices, crisps, and a range of dishes using OFSP. As most sweetpotato in Africa is eaten boiled or steamed, the promotion of diversified products using OFSP is part of the advocacy campaign to change the image of sweetpotato as a crop of the poor towards being a healthy food for all. One to catch the OFSP bug was the program officer for her USAID funded dissemination project, Irene de Souza. In her retirement, Irene launched a company specializing in OFSP food products, which were sold regularly each weekend at a food court linked to a crafts market and at catered events. Her flagship products were OFSP cheesecake and roasted roots. As Maria’s work gained more recognition, she became increasingly involved in regional and global advocacy efforts. On 12 August 2012, Maria participated in the Global Hunger Event at 10 Downing Street (Fig.  1.6), convened by the UK Prime Minister, David Cameron, and the Brazilian Vice‐President, Michel Temer. The goal was to increase global political commitment and action to tackle malnutrition so that real improvement would be seen in nutrition indicators before the next Olympics in 2016. Maria shared her insights on the role of OFSP in tackling micronutrient malnutrition among women and children and the challenges of scaling‐up delivery. That same year, CIP received substantial support from the UK to take its integrated agriculture‐nutrition education program using OFSP as the key entry point to scale with ­relevant partners in Kenya, Rwanda, Malawi, and Mozambique. As a member of the CIP breeding team, the larger SASHA project team, and as leader of the CIP Mozambique Country office, Maria is a team player, renowned for her problem‐solving ability and willingness to make tough decisions. She believes in giving farmers a range of varieties to try, recognizing the diverse agro‐ecologies across the country and distinct personal preferences. She also attends annual sweetpotato breeding meetings in Asia, building on the SSA experience. Other CGIAR centers in Mozambique selected Maria to be their representative for the centers on the Platform for Innovation of Agriculture and

Maria Isabel Andrade

21

Fig. 1.6.  Maria and Howdy Bouis, CEO of HarvestPlus, in front of 10 Downing Street.

Technology Transfer in Mozambique, financed by USAID from 2009 through 2016. The underlying factor making Andrade’s advocacy work a success is that she delivers on her commitments. When funding tightens among certain donors, projects led by Maria and her team often continue when others are dropped, reflecting the trust she has established among the donor community and the Mozambique government. In early 2019, CIP promoted Maria to Principal Scientist, the highest technical level in the organization. IV.  THE MENTOR AT WORK AND IN HER COMMUNITY Throughout her career, Maria has been committed to building the next generation of agriculturalists. While she failed to convince her daughters to pursue a career in agriculture, which they saw as having long

22

Jan W. Low AND EDWARD CAREY

working hours with lower returns than other professions, she has influenced the lives and provided opportunities to many young students through internships. In addition, she has served as a co‐supervisor and provided operational funds for thesis work of 23 men and 11 women since 2001. Graduate study opportunities are limited in Mozambique. The co‐supervised students have come from the Universidade de Eduardo Mondlane (14 BSc with honors); the Universidade Católica (two BSc with honors), the Universidade São Tomas (one BSc with honors); the Instituto Medio‐Agro‐Pecuária de Gurué (three BSc with honors; six agriculture technicians); the Instituto Agrário de Boane (four agriculture technicians) and the Instituto Politécnico Alvor (one agriculture technician). In addition, she has co‐supervised the Master’s level breeding training of IIAM collaborator José Ricardo at IIAM at the University of Kwa Zulu Natal (South Africa) and two Doctoral students from Stellenbosch University (South Africa) and ETH Zurich (Switzerland). Within her residential condominium complex, Maria has served as the president of the commission overseeing 42 residences. In that role, she had to confront the developer and get him to honor commitments made to the investors. Maria remains quite active in her faith. Over time Maria moved to an evangelical church and became a born‐again Christian in 2004. Her faith has given her strength, security, and additional work in support of the church. Of course, she could not resist assisting her church group in setting up a multiplication plot to produce their own storage roots for their own consumption and for selling, as well as providing training in how to make processed products. As she says, “Life is not a straight road, but you end up in a straight way. Everything is possible.” In fact, twice following her prayers in drought‐stricken fields in Mozambique and Tanzania, clouds formed and rain fell within the next three hours (Fig.  1.7). At CIP, we do tease her about being the rainmaker, but we appreciate and recognize the drive coming from her deep beliefs. Maria became a grandmother in 2009, when Esther was born to her daughter Tania. Her second granddaughter, Abrianna, was born in 2018. Needless to say, mashed OFSP was their first solid food. Truly, Maria’s boundless energy and commitment to rural Mozambican women means her family is quite extended and she serves as a role model for many (see Fig. 1.8). One event I will never forget as long as I live, and which opened my eyes up to this day, took place in Zondene, district of Xai‐Xai in the province of Gaza. CIP was invited by Save the Children US to train their farmers on sweetpotato product development. The idea was to train them and then they will train more villages in that district under the supervision of Save the Children. We trained women on how to make sweetpotato cake using

Maria Isabel Andrade

23

Fig. 1.7.  Drenched Maria enjoying the rain she prayed for in Zambézia, Mozambique.

Fig. 1.8.  A family has boiled sweetpotato for breakfast in rural Zambézia (credit: J. Low).

24

Jan W. Low AND EDWARD CAREY

their own local utensils and ingredient. The oven was a hole made in the ground which was heated with charcoal and then the cake in the cooking pan went to this oven for baking and successfully made it. The satisfaction on the face of those women was very hard to describe. They made a song immediately saying we are really making a cake in Zondene. Unbelievable for a person like me, born in the house where my mother baked every day for sale; I could not understand that type of satisfaction. This is when I realized that I take things for granted and that I can make women who farm very happy just training them what I know and then see how this technology can be well adapted to their local conditions. I also concluded that no contribution is too small to serve as an excuse for not contributing. Maria Andrade

V.  AWARDS AND SERVICE A. Awards 2016  Co‐Laureate. World Food Prize for her work on Biofortification, Des Moines, Iowa, 13 October 2016 (Fig. 1.9) Maria notes that “The winning of World Food Prize changed my life completely. For a small person, coming from a tiny Island to win a prize of this size it is very hard to believe. This prize opened the door for my life and made me feel very visible to the world. I felt very special.”

Fig. 1.9.  Winning the World Food Prize in 2016.

Maria Isabel Andrade

25

2016  Outstanding Alumnus Award. North Carolina State University, Raleigh, North Carolina, USA, 20 November 2016 2017  Appreciation Award. International Society for Tropical Root Crops—Africa Branch, Dar‐es‐Salaam, Tanzania, 9 March 2017 2017  Swaminathan Award for Environmental Protection, Rotary Club of Madras East (RCME), Chennai, India, 8 August 2017 2018  Wonder Woman of Agriculture, United States Department of Agriculture, Washington, DC, USA, 27 March, 2018 2018  Woman of the Year: Cabo Verde, Artemedia Zwela. This recognition honors the best of Cape Verde, the people, not only those living in the Islands but also abroad. Praia, Cape Verde, 6 July, 2018 B.  Boards and Other Representations Vice‐President of the International Society for Tropical Root Crops, in charge of fund raising (2012–2016) Member of the board of Directors of Alliance for Green Revolution in Africa (2012 to present) Member of External Panel review of Next Generation Cassava Breeding Project, project of Cornell & IITA (2018 to present) Representative for the CGIAR Centers on Platform for Innovation of Agriculture and Technology Transfer in Mozambique (2009–2016) Member, Group of Champions for the Food Forever Initiative – Global Crop Diversity Trust (2016 to present) LITERATURE CITED Alvaro, A., M.I. Andrade, G.S. Makunde, et al. 2018. Yield, nutritional quality and stability of orange‐fleshed sweetpotato cultivars successively later harvesting periods in Mozambique. Open Agric. 2:464–468. Andrade, M.I., A. Alvaro, J. Menomussanga, et  al. 2016a. ‘Alisha’, ‘Anamaria’, ‘Bie’, ‘Bita’, ‘Caelan’, ‘Ivone’, ‘Lawrence’, ‘Margarete’, ‘Victoria’, sweetpotato. HortScience 51(5):597–600. Andrade, M.I., A. Naico, J. Ricardo, et al. 2016b. Genotype × environment interaction and selection for drought adaptation of sweetpotato (Ipomoea batatas [L.] Lam.) in Mozambique. Euphytica 209:261–280. Andrade, M.I., G.S. Makunde, J. Ricardo, et  al. 2017. Vine survival of sweetpotato (Ipomoea batatas [L.] Lam) cultivars subjected to long dry spells after the growing season in Mozambique. Open Agric. 2:58–63. Grüneberg, W.J., R.O.M. Mwanga, E.E. Carey, et  al. 2015. Advances in sweetpotato breeding from 1992 to 2012. p. 3–68. In: J. Low, M. Nyongesa, S. Quinn, and M. Parker (eds.), Potato and sweetpotato in Africa: Transforming the value chains for food and nutrition security. CABI International, Wallingford, UK. Low, J.W., R.O.M. Mwanga, M. Andrade, et al. 2017. Tackling vitamin A deficiency with biofortified sweetpotato in Sub‐Saharan Africa. Global Food Security 14:23–30.

26

Jan W. Low AND EDWARD CAREY

Mwanga, R.O.M., W.J. Grüneberg, M.I. Andrade, et al. 2017. Sweetpotato (Ipomoea batatas L.). p. 181–218. In: H. Campos and P.D.S. Caligari (eds.), Genetic improvement of tropical crops. Springer Int. Pub.

PUBLICATIONS A. Journal Articles and Book Chapters Alvaro, A., M.I. Andrade, G.S. Makunde, et al. 2018. Yield, nutritional quality and stability of orange‐fleshed sweetpotato cultivars successively later harvesting periods in Mozambique. Open Agric. 2:464–468. Andrade, M.I., A. Alvaro, J. Menomussanga, et  al. 2016. ‘Alisha’, ‘Anamaria’, ‘Bie’, ‘Bita’, ‘Caelan’, ‘Ivone’, ‘Lawrence’, ‘Margarete’, ‘Victoria’, sweetpotato. HortScience 51(5):597–600. Andrade, M.I., I. Barker, D. Cole, et  al. 2009. Unleashing the potential of sweetpotato in Sub‐Saharan Africa: Current challenges and way forward. Working Paper 2009‐1. International Potato Center (CIP), Lima, Peru. Andrade, M.I., G.S. Makunde, J. Ricardo, et al. 2017. Vine survival of sweetpotato (Ipomoea batatas [L.] Lam) cultivars subjected to long dry spells after the growing season in Mozambique. Open Agric. 2:58–63. Andrade, M.I., and A. Naico. 2007a. Orange‐fleshed sweetpotato—Linking school and community—A case study of Cumbene District of Marracuene. p. 72–82. In: N.M. Mahungu, and V.M. Manyong (eds.), Proceedings of the Ninth Triennial International Society for Tropical Root Crops Africa Branch (ISTRC‐AB) Symposium, Mombasa, Kenya, 1–5 November 2004. IITA, Ibadan, Nigeria. Andrade, M.I., and A. Naico. 2007b. Study on cassava and sweetpotato yields in Mozambique. p. 200–208. In: N.M. Mahungu and V.M. Manyong (eds.), Proceedings of the Ninth Triennial International Society for Tropical Root Crops Africa Branch (ISTRC‐ AB) Symposium, 1–5 November 2004. IITA, Ibadan, Nigeria. Andrade, M.I., A. Naico, J. Ricardo, et al. 2016. Genotype × environment interaction and selection for drought adaptation of sweetpotato (Ipomoea batatas [L.] Lam.) in Mozambique. Euphytica 209:261–280. Andrade, M.I., J. Ricardo, A. Naico, et  al. 2016. Release of orange‐fleshed sweetpotato (Ipomoea batatas [L.] Lam.) cultivars in Mozambique through an accelerated breeding scheme. J. Agric. Sci. 155(6):919–929. Barker, I., M. Andrade, R. Labarta, et al. 2009. Sustainable seed systems. p. 43–72. In: Unleashing the potential of sweetpotato in Sub‐Saharan Africa: Current challenges and way forward. International Potato Center, Social Sciences Working Paper No. 1‐2009, Lima, Peru. Grüneberg, W.J., R.O.M. Mwanga, E.E. Carey, et  al. 2015. Advances in sweetpotato breeding from 1992 to 2012. p. 3–68. In: J. Low, M. Nyongesa, S. Quinn, and M. Parker (eds.), Potato and sweetpotato in Africa: Transforming the value chains for food and nutrition security. CABI International, Wallingford, UK. Keatinge, J.D.H., F. Waliyar, R.H. Jamnadas, et  al. 2010. Relearning old lessons for the future of food—By bread alone no longer: Diversifying diets with fruit and vegetables. Crop Science 50 (Supplement 1):s51–s62. Low, J., M. Arimond, R. Labarta, et al. 2013. The introduction of orange‐fleshed sweetpotato (OFSP) in Mozambican diets: A marginal change to make a major difference. p.  283–290. In: J. Fanzo, D. Hunter, T. Borelli, and F. Mattei (eds.), Case Study 5 in Diversifying food and diets: Using agricultural biodiversity to improve nutrition and health. Routledge Press.

Maria Isabel Andrade

27

Low, J.W., A.‐M. Ball, S. Magezi, et al. 2017. Sweet potato development and delivery in Sub‐Saharan Africa. African J. Food, Agric., Nutrition and Development, Special issue on Biofortification 17(2):11955–11972. Low, J., R. Kapinga, D. Cole, et al. 2009. Nutritional impact with orange‐fleshed sweetpotato. p. 73–105. In: Unleashing the potential of sweetpotato in Sub‐Saharan Africa: Current challenges and way forward. International Potato Center, Social Sciences Working Paper No. 1‐2009, Lima, Peru. Low, J.W., J. Lynam, B. Lemaga, et al. 2009. Sweetpotato in Sub‐Saharan Africa. p. 355– 386. In: G. Loebenstein and G. Thottapilly (eds.), The sweetpotato. Springer Publications, New York. Low, J.W., R.O.M. Mwanga, M. Andrade, et al. 2017. Tackling vitamin A deficiency with biofortified sweetpotato in Sub‐Saharan Africa. Global Food Security 14:23–30. Makunde, G.S., M.I. Andrade, J. Ricardo, et al. 2017. Adaptation to mid‐season drought in a sweetpotato (Ipomoea batatas [L.] Lam) germplasm collection grown in Mozambique. Open Agric. 2:133–138. Makunde, G.S., M.I. Andrade, J. Menomussanga, and W. Grüneberg. 2018. Adapting sweetpotato production to changing climate in Mozambique. Open Agric. 3:122–130. Maquia, I., I. Muocha, A. Naico, et al. 2013. Molecular, morphological and agronomic characterization of the sweet potato (Ipomoea batatas L.) germplasm collection from Mozambique: Genotype selection for drought prone regions. S. African J. Bot. 88:142–151. Mwanga, R.O.M., W.J. Grüneberg, M.I. Andrade, et al. 2017. Sweetpotato (Ipomoea batatas L.). p. 181–218. In: H. Campos and P.D.S. Caligari (eds.), Genetic improvement of tropical crops. Springer Int. Pub. Rakotoarisoa, B.E., E.A. Francisco, M. Jaisse, et al. 2017. Access to lowland areas for vine conservation: a key determinant of increased utilization of orange‐fleshed sweetpotato in Niassa province, Mozambique. Open Agric. 2:280–291. Ramírez, D.A., C. Gavilána, C. Barreda, et al. 2017. Characterizing the diversity of sweetpotato through growth parameters and leaf traits: Precocity and light use efficiency as important ordination factors. S. African J. Bot. 113:192–199. Thiele, G., A. Khan, B. Heider, et  al. 2017. Roots, tubers and bananas: Planning and research for climate resilience. Open Agric. 2(1):350–361. Toko, M., R. Hanna, J. Legg, et al. 2007. Distribution & incidence and severity of cassava diseases and pests in Mozambique. p. 623–633. In: N.M. Mahungu, and V.M. Manyong (eds.), Proceedings of the Ninth Triennial Root Crops Africa Branch (ISTRC‐AB) Symposium, Mombasa, Kenya, 1–5 November 2004. IITA, Ibadan, Nigeria. Zhang, D., W.W. Collins, and M. Andrade. 1995. Estimation of genetic variance of starch digestibility in sweetpotato. HortScience 30(2):348–349.

B. Papers for Workshops or Donors Andrade, M.I. 1998. Current situation of cassava and sweetpotato research and technology transfer in Mozambique. Paper presented at SARRNET Scientific Workshop, Lusaka, Zambia, 17–19 August 1998. Andrade, M.I. 1999a. Agronomy and technology transfer in SARRNET. Paper presented at stakeholders’ meeting in Harare, Zimbabwe, January 1999. Andrade, M.I. 1999b. Sustainable production system. Paper presented at SARRNET Workshop on production and impact statistics for cassava and sweetpotato in Dar‐es‐ Salaam, Tanzania, 13–16 September 1999. Andrade, M.I. 2000a. Sustainable production of cassava. Paper presented at SARRNET planning and steering committee meeting in Lilongwe, Malawi, 14–16 March 2000.

28

Jan W. Low AND EDWARD CAREY

Andrade, M.I. 2000b. Collaboration of NGO’s on research and technology transfer in Mozambique. Paper presented at Collaborators Workshop in Harare, Zimbabwe, April 2000. Andrade, M.I. 2003. A experiência e actividades do projecto SARRNET no âmbito do processamento da mandioca e batata doce (Experience and activities of the SARRNET project concerning processing of cassava and sweetpotato). Paper presented in a workshop on agro‐processing at the National Directorate of Agriculture, Quelimane, Mozambique, June 2003. Andrade, M.I. 2006a. SARRNET Handover report to IITA/National program on cassava. Submitted to USAID. 89 pp. March 2006. Andrade, M.I. 2006b. SARRNET Handover report to IITA/National program on sweetpotato. Submitted to USAID. 83 pp. April 2006. Andrade, M.I., and A. Gani. 2003. Cultivation, use and consumption of sweetpotato in Mozambique. Paper presented at SARRNET Scientific Workshop in Zambia, May 2003. Andrade, M.I., and A. Naico. 2003. Cassava and sweetpotato, production, processing and marketing in Mozambique. Paper presented at SARRNET Scientific Workshop, Lusaka, Zambia, May 2003. Andrade, M. I., A. Naico, J. Ricardo, and A. Sandramo. 2004. Estudo sobre o Impacto da Disseminação das Variedades de Mandioca e Batata Doce de Polpa Alaranjada em Moçambique (Study about the impact of disseminated cassava and orange‐fleshed sweetpotato varieties in Mozambique). Paper presented to Instituto Nacional de Investigação Agronómica (INIA) and Southern Africa Root Crops Research Network (SARRNET). Andrade, M.I., A. Naico, J. Ricardo, et al. 2010. Evaluation of 64 clones selected from advanced yield trials established between 2005/06 and 2009/10 in Maputo, Gaza, Zambézia, and Tete. Maputo, Mozambique: International Potato Center Instituto de Investigação Agraria de Mozambique. Report submitted to the Varietal Release Committee. Andrade, M.I., and J. Ricardo. 1999. Use of orange‐fleshed sweetpotato to combat vitamin A deficiency in Mozambique. Roots, December 1999. Andrade, M.I., and J. Ricardo. 2003a. Evaluation of nineteen orange‐fleshed sweetpotato clones across fourteen different environments of Mozambique. Paper presented at SARRNET Scientific Workshop in Zambia, May 2003. Andrade, M.I., and J. Ricardo. 2003b. Opportunity emerging from disaster: The role of orange‐fleshed sweetpotato in reducing the risk of Vitamin A Deficiency in the flood‐ affected areas of Mozambique. In Second SARRNET Scientific Workshop; May 2003, TAJ Pamodzi Hotel, Lusaka, Zambia. Andrade, M., J. Tembe, and F. Pequenino. 1998. Accelerated multiplication and distribution of improved cassava and sweetpotato planting materials as a drought recovery measure in Mozambique. p. 333–342. In: M. Akoroda and J. Teri (eds.), Food security and crop diversification in SADC countries: the role of cassava and sweetpotato. ­Proceedings of the scientific workshop of the Southern Africa Root Crops Research Network (SARRNET) held at Pamodzi Hotel, Lusaka, Zambia. 17–19 August 1998. Dixon, A., J.B. Whyte, N.M. Mahungu, et  al. 2003. Cassava mosaic pandemic in Sub‐ Saharan Africa: An unsolved problem with a solution. Presented at the International Society of Tropical Root Crops (ISTRC) Conference, Arusha, Tanzania. Gani, A., and M.I. Andrade. 1998. Dissemination of processing methods for detoxification of bitter cassava in Nampula Province of Mozambique. In: Proceedings of the Scientific Workshop of the Southern African Root Crops Research Network (SARRNET) held at Pamodzi Hotel, Lusaka, Zambia, 17–19 August 1998. Gani, A., and M.I. Andrade. 2000. Preference of orange‐fleshed sweetpotato and reasonability of vitamin A consumption in rural areas in Mozambique. Paper presented at African Potato Congress held in Uganda, 29 May–2 June 2000.

Maria Isabel Andrade

29

Kapinga, R., D. Zhang, B. Lemaga, et  al. 2003. Sweetpotato crop improvement in Sub‐­ Saharan Africa and future challenges. In: Proceedings of the Thirteenth Triennial ­ISTRC Symposium, Arusha, Tanzania, 10–14 November 2003. Kapinga, R., M. Andrade, B. Lemaga, et al. 2003. Role of orange‐fleshed sweetpotato in disaster mitigation: Experiences from East and Southern Africa. In: Proceedings of the Thirteenth Triennial ISTRC Symposium, Arusha, Tanzania, 10–14 November 2003. Low, J.W., R. Uaiene, M. Andrade, and J. Howard. 2000. Orange‐flesh sweetpotato: Promising partnerships for assuring the integration of nutritional concerns into Agricultural Research and Extension. Roots. Flash Brief No. 20E. Department of Policy Analysis, Ministry of Agriculture and Rural Development (Mozambique), 10 November 2000. Macia, R., and M. Andrade. 1998. Processing, utilization and analysis of the quality of cassava flour in Inharrime and Morrumbene Districts, Inhambane Province, Mozambique. Paper presented at the SARRNET Scientific Workshop, Lusaka, Zambia, 17–19 August 1998. Macia, E., M.I. Andrade, and P. Cardoso. 1998. Processing utilization and analysis of quality cassava flour in Inharrine and Marrombene Districts of Mozambique. In: ­Proceedings of the Scientific Workshop of the Southern African Root Crops Research Network (SARRNET), Pamodzi Hotel, Lusaka, Zambia, 17–19 August 1998. Mangana, S., M.I. Andrade, J.A. Chirruco, and J. Ricardo. 1998. Evaluation of sweetpotato genotypes for yield, dry matter, total nitrogen content, nematode damage and storability in Mozambique. In: Proceedings of the Scientific Workshop of the Southern African Root Crops Research Network (SARRNET), Pamodzi Hotel, Lusaka, Zambia, 17–19 August 1998. Pequenino, F., and M.I. Andrade. 1998. Evaluation of harvest time of 20 genotypes of sweetpotato in Southern Mozambique. In: Proceedings of the Scientific Workshop of the Southern African Root Crops Research Network (SARRNET), Pamodzi Hotel, Lusaka, Zambia, 17–19 August 1998. Ricardo, R., and M.I. Andrade. 1998. Study of Branching of “Gangassol” a Cassava Variety in Mozambique. Roots, vol. 5, no.2, December 1998.

C. Project Reports Andrade, M.I. 1999. Práticas culturais, processamento, utilização e mercado de mandioca e batata doce em Moçambique (Cultural pracitces, processing, utilization and marketing of cassava and sweetpotato in Mozambique). Report. 97 p., November 1999. Andrade, M.I., and J. Ricardo. 1999. Results of first round provincial trials on the evaluation of nineteen orange‐fleshed sweetpotato clones across fourteen different environments of Mozambique. Report submitted to the Mozambican varietal release committee, 78 p., December 1999. Andrade M.I., J. Ricardo, and A. Gani. 2002. Combating vitamin A deficiency in rural Mozambique with orange‐fleshed sweetpotato: Results of a survey on nutritional status and two round provincial trials on the evaluation of 19 orange‐fleshed sweetpotato across 21 different environments over 8 provinces in two seasons. INIA/SARRNET, Maputo, Mozambique. 66 p. IITA. 1998. El Nino strategic action plan for roots and tubers in East and Southern ­Africa. SARRNET progress report on Mozambique for January to May 1998. Submitted to U ­ SAID. IITA. 1999a. El Nino strategic action plan for roots and tubers in East and Southern ­Africa. SARRNET progress report on Mozambique for May 1998 to January 1999. Submitted to USAID. IITA. 1999b. El Nino strategic action plan for roots and tubers in East and Southern Africa. SARRNET progress report on Mozambique for January to April 1999. Submitted to USAID.

30

Jan W. Low AND EDWARD CAREY

IITA. 1999c. SARRNET progress report for Mozambique for period October to December 1999. Submitted to USAID. IITA. 1999d. SARRNET end of project report for Mozambique. 78 p. Submitted to USAID. November 1999. IITA. 2000. Baseline report on production, processing and market of cassava and sweetpotato in Mozambique. In English and Portuguese with annexes, 116 p. Submitted to USAID. IITA. 2003a. Final project report: INIA‐IITA‐SARRNET, March 2001–March 2003 in Portuguese and English. Submitted to USAID. IITA. 2003b. Report on the impact of orange fleshed sweetpotato in the district of Chókwè. Submitted to USAID. July 2003. IITA. 2003c. Report on study on yield of cassava and sweetpotato in Mozambique. Submitted to USAID. July 2003. IITA. 2003d. Report on the impact of orange‐fleshed sweetpotato in Namunoe, Cabo Delgado, Submitted to USAID. July 2003. IITA. 2003e. Report on the study of the impact of orange‐fleshed sweetpotato in the district of Chókwè, Gaza, AJUS. July 2003. IITA. 2003 f. Report on pilot experience in primary school of Cumbene, District of Marracuene. Submitted to USAID. March 2003. IITA. 2003 g. Assessment of cassava and sweetpotato pests and diseases in the Republic of Mozambique, July 2003. IITA. 2003 h. Relatório Trimestral do IITA/SARRNET‐INIA, Projecto Bilateral, Moçambique, Abril–Julho 2003, Multiplicação acelerada e distribuição de materiais de plantio saudáveis das melhores e mais produtivas variedades da mandioca e batata doce em Moçambique: Uma actividade para mitigação da seca e cheias (Progress Report for April– July 2003 concerning IITA/SARRNET‐INIA Bilateral Project: The accelerated multiplication and distribution of healthy planting material of the best and most productive varieties of cassava and sweetpotato in Mozambique: An activity to mitigate drought and floods). Instituto Internacional de Agricultura Tropical (IITA), Ibadan, Nigeria. IITA. 2003i. Relatório do IITA/SARRNET‐INIA Projecto Bilateral, Moçambique, Agosto–Novembro 2003 sobre multiplicação acelerada e distribuição de materiais de plantio saudáveis das melhores e mais produtivas variedades da mandioca e batata doce em Moçambique: Uma actividade para mitigação da seca e cheias (Progress Report for August–November 2003 concerning IITA/SARRNET‐INIA Bilateral Project: The accelerated multiplication and distribution of healthy planting material of the best and most productive varieties of cassava and sweetpotato in Mozambique: An activity to mitigate drought and floods). Instituto Internacional de Agricultura Tropical (IITA), Ibadan, Nigeria. IITA. 2004a. Relatório do IITA/SARRNET‐INIA Projecto Bilateral, Moçambique, Abril– Decembro 2004 sobre multiplicação acelerada e distribuição de materiais de plantio saudáveis das melhores e mais produtivas variedades da mandioca e batata doce em Moçambique: Uma actividade para mitigação da seca e cheias (Progress Report for April–December 2004 concerning IITA/SARRNET‐INIA Bilateral Project: The accelerated multiplication and distribution of healthy planting material of the best and most productive varieties of cassava and sweetpotato in Mozambique: An activity to mitigate drought and floods). Submitted to PROAGRI. April–December, 2004. IITA. 2004b. Resultados da avaliação de vinte e um clones de Batata doce em catorze ambientes em Moçambique, primeira época (Results from the evaluation of 21 clones of sweetpotato from 14 environments in Mozambique, 1st season). December, 2004. INIA (Instituto Nacional de Investigação Agronomica)/SARRNET. 2003. Cassava and sweetpotato production, processing and marketing in Mozambique. Report of survey conducted countrywide. 154 p. Submitted to USAID.

2 Development of Cold Climate Grapes in the Upper Midwestern U.S.: The Pioneering Work of Elmer Swenson Matthew D. Clark Department of Horticultural Science, University of Minnesota‐Twin Cities, St. Paul, MN, USA ABSTRACT The increase in cold climate grape production across the Midwest and Great Plains states is due in large part to the pioneering efforts of grape breeders who have combined the traits of native Vitis species with qualities of European grape varieties. After prohibition, the confluence of consumer demand, public policy, and fortuitous plant breeding set the stage for new wine industries to emerge in the region. The breeding work of Elmer Swenson led the way at a time when University efforts had shifted to other crops. Swenson’s hobby of breeding table grapes propelled the industry because his varieties performed better than the French hybrids for winter hardiness across the region. The new varieties reduced labor costs and ensured consistent yields. Swenson’s work inspired plant breeders to work with the North American Vitis species, and inspired an entrepreneurial spirit to reinvest in farming in a new way and to join the American wine revolution. KEYWORDS: cold-hardy, grapes, Swenson, cold climate, wine, Midwest I.  A COLD CLIMATE GRAPE INDUSTRY II.  ELMER SWENSON A. A Book that Changed Everything B. The Plant Breeder’s Journey C. Persistence Pays Off D. Working in Retirement

Plant Breeding Reviews, Volume 43, First Edition. Edited by Irwin Goldman. © 2020 John Wiley & Sons, Inc. Published 2020 by John Wiley & Sons, Inc. 31

32

Matthew D. Clark

E. A Collaborator, Godfather, and Pioneer F. The Swenson Varieties G. Preserving the Swenson Materials H. Swenson’s Legacy III.  GRAPE IMPROVEMENT IN THE MIDWEST A. Breeding Projects B. Breeding Targets IV.  SUMMARY AND FUTURE PROSPECTS ACKNOWLEDGMENTS LITERATURE CITED

ABBREVIATIONS MGGA NIFA SSE USDA

Minnesota Grape Growers Association National Institute of Food and Agriculture Seed Savers Exchange United States Department of Agriculture

I.  A COLD CLIMATE GRAPE INDUSTRY As European settlers moved into the Midwest and Great Plains of the United States they were limited by the variety of commercially available fruits and vegetables they could grow. This was especially true in northern states like Minnesota with a short growing season and extremely cold winters. However, native grapes grew wild in the Midwest landscape. This must have been inspiring (and maybe misleading) to Europeans who carried with them cuttings of grapevines and the aspirations of growing traditional varieties from their homelands. One native species in the region, Vitis riparia, has a very large distribution (Magoon and Snyder 1943) but was limited in use due to the small fruit and highly acidic berries that were favored by birds more so than humans. However, the high‐acid fruit can be harvested late to reduce the acid, ameliorated with water, and balanced by adding sugar to make sweet wines (Hedrick et al. 1908). Additional sympatric Vitis species were found in the Midwest, occupying ecological niches including V. aestivalis, V. cinerea, V. rubra, V. vulpina, and V. labrusca. In North America, there are about 30 native species of Vitis and a second center of diversity of another 30 species exists in East Asia (Owens 2008). With human expansion in the region, these native grapes were at risk of being plowed under or grazed. This problem continues today because of human disruption of native areas across the range of many of the North American Vitis species.

Development of Cold Climate Grapes in the Upper Midwestern U.S. 33

Grapes have long been domesticated and numerous reviews describe the history and uses of the cultivated European species V. vinifera, its wild progenitor V. sylvestris (syn. V. vinifera spp. sylvestris), and breeding applications (Abbo et  al. 2015; Burger et  al. 2009; Janick 2005; Owens 2008; Reisch and Pratt 1996). Controlled crosses were initiated within V. vinifera as early as 1824 (although other reports say 1828; Snyder 1937), when Louis Bouschet de Bernard and his son Henri hybridized a dark pigmented ‘Tienturier du cher’ with ‘Aramon’ with the intent of developing berries with improved color (Paul 1996). Hybridization within all Euvitis species is readily achieved, allowing the improvement and development of new cultivars adapted beyond the areas where V. vinifera has been domesticated (Alleweldt et  al. 1991; Mullins et al. 1992). Collections of North American grapevine species had found their way into Europe, in part due to the fashionable hobby of plant collecting by the upper classes and their funded expeditions around the globe. Travelling with the grapevines were their parasites and diseases, both of which were introduced into highly susceptible European vineyards from North America (Burger et  al. 2009; Owens 2008; Reisch and Pratt 1996). These other grape species were also brought into Europe specifically for breeding, as the novel Vitis species offered resistance and tolerance in many cases due to their co‐evolutionary history (Alleweldt et al. 1991). Grapevines coming into Europe were the cause and solution(s) to these pests as several waves of epidemic ensued. The new resistant varieties known as the French hybrids, or hybrid direct producers, were important across France and a summary of their development is found in Owens (2008). The introduction of phylloxera (Daktulosphaira vitifoliae), an insect that invaded roots and decimated vineyards, was the impetus for developing resistant rootstocks to allow traditional varieties to be grown again in Europe. Eventually the French hybrids were replaced by the traditional varieties grown on resistant rootstocks and managed with improved pesticides. However, the hybrids have provided the foundation for fruit quality in many North American breeding programs (Owens 2008). V. vinifera cultivars were difficult to grow in the eastern part of the United States due to climate conditions and phylloxera as early as colonial times. Today, most grapes grown in the Midwest and Plains states are on their own roots, a stark contrast to the V. vinifera production, which is nearly entirely grafted worldwide. Rootstocks have been developed to accommodate diverse soil conditions and other soil‐borne pests such as nematodes (Meloidogyne incognita; Cousins and Walker 2002).

34

Matthew D. Clark

The North American grape breeders in the 19th and 20th centuries were working throughout the United States and Canada. They worked privately or with university or State Agricultural Experiment Stations. Many focused on regional adaptation using the native species at their disposal. Owens (2008) and Reisch and Pratt (1996) summarize many of the early contributions, the geographic distribution of the species (in North American and Asia), as well as the unique contributions of particular species to traits of interests including insect resistance, fungal resistance, and abiotic stress. Early breeding efforts helped to establish grape production regions in northern areas where settlers were establishing homesteads and wanted grapes for multiple uses, including wine. In the early 1900s, popular cultivars in the Midwest included ‘Concord’, ‘Worden’, ‘Moore’s Early’, and ‘Lady’, all V. labrusca hybrids (Green 1912), sometimes referred to as Vitis x labruscana. Cultivated grapes were prevalent on homesteads across the upper Midwest landscape at the turn of the 20th century, with an estimated 232,000 kg of grapes being produced around 1900 in Minnesota (Domoto et al. 2016). The cultivars ‘Beta’ and ‘Janesville’ were developed as hybrids between ‘Concord’ and V. riparia selections and were even more cold‐hardy (Green 1912). Juice grapes such as ‘Concord’ and ‘Delaware’ were marginally hardy in Minnesota, but performed much better in Iowa where juice industries were established (Pirog 2002). In addition to low‐temperature injury, the short growing season was a limitation with fruit not fully ripening before frost (Luby 1991). Other aspects that influenced varietal adaptation include day length, moisture availability, soil characteristics, average temperature during the growing season, and humidity (Magoon and Snyder 1943). Changes in agriculture, industrialization, and public policy (including the prohibition of alcohol) affected the grape industries in the early part of the 20th century. Principally, grapes were being produced in California and the advent of refrigerated railcars meant that grapes, especially table grapes, and juice for wine making could be shipped long distances all around the country (Pirog 2002). Industrialization meant that those people moving off farms and into cities could conveniently purchase “imported” grapes and grape products. The crops produced by farmers regionally also shifted; wheat, oats, and other subsistence crops grown on family farms were converted to millions of hectares of corn and soybeans. This shift in the 1930s and 1940s meant that, in valuable farmland suitable for mechanized crops, economies of scale won out over specialty crops that could be more cheaply produced elsewhere. Broadleaf herbicides, primarily 2,4‐D, were used

Development of Cold Climate Grapes in the Upper Midwestern U.S. 35

heavily, and highly susceptible grapevines were damaged by the drift of these volatile compounds (Pirog 2002). Small, extant vineyards are still found on family farms, often relegated to less ideal sites behind barns and windbreaks where they escape damage from herbicide drift. Commercial and household use grape production became nearly non‐existent in this region by the 1970s, despite Iowa being the 11th ranked state in 1899 and 6th in 1919 (Pirog 2002). Wines and grape products like jelly could be purchased readily and grown in more suitable climates where they did not compete with grain crops. In the 20th century, the American palate was shifting from sweet and high alcohol dessert wines to dry, “sophisticated” table wines (Hisano 2017). Wine manufacturers and marketers influenced the American consumer, and eventually some Californian wines began earning awards in international competitions. Wine consumption increased in post‐prohibition America and wine production followed; Sumner et al. (2001) describe the economics at play. In the 1970s, wineries were often backed by large, multinational food companies (Hisano 2017). Success in California spurred other states to redevelop industries and encourage entrepreneurs to lead the way in newly emerging wine regions. Cold climate grape varieties allowed the development and/or expansion of industries across the Midwest, Great Plains, New England, and Canada. Plocher and Parke (2001) report on additional industries in Latvia, Estonia, Denmark, Sweden, Mongolia, Russia, Ukraine, and Belarus. Wine became sophisticated and accessible to the middle classes and more people wanted a stake in the game. The “Wine Revolution” of the 1960s resulted in what is known as the “farm winery,” first in Pennsylvania, and in the late 1970s Minnesota passed its own legislation. Farm winery legislations allow farmers to grow grapes, produce their own wines, and sell the wines directly from their wineries (Krosh 1988). There is no accepted definition of what characterizes a cold climate grape or grape‐growing region. However, expansion into these areas was the direct result of the development of hybrid cultivars that utilize the winter hardiness traits of North American species, especially V. riparia and V. labrusca, and the Asian species V. amurensis (Hemstad and Luby 2000; Burger et al. 2009; Reisch and Pratt 1996). V. riparia occurs from Manitoba and Saskatchewan, Canada, and eastward to Nova Scotia and south into west Texas and eastward into Virginia, and all the states and provinces between (Gerrath et al. 2015). In Minnesota, the term “cold‐hardy” colloquially refers to grape plants that are able to withstand the –34 °C temperatures typical of USDA Horticultural Zone 4a without additional protection such as burying vines with soil or straw for insulation. One method to evaluate

36

Matthew D. Clark

hardiness in grapevine is to dissect count buds after cold events and examine the meristems for necrosis (Hemstad and Luby 2000). The French hybrids like ‘Marechal Foch’ and ‘Leon Millot’ and the labrusca hybrid ‘Concord’ are marginally hardy by this definition and perform best with winter protection (burying canes) during the winter months. Grapes developed in Arkansas, Missouri, and New York, for example, are not consistently nor sufficiently cold‐hardy to produce in Minnesota or the Dakotas. One grape breeder in particular, Elmer Swenson, led the way in the Midwest. After decades of breeding, Swenson’s efforts coalesced with many external factors that spurred on a grape and wine revolution in the upper Midwest (Read and Gu 2003) but has also extended around the globe. Fortunately, Swenson’s successes rejuvenated breeding efforts in the public and private sectors and most importantly facilitated grower organizations, legislation, and policies to help grow the nascent industries. The majority of growth in the Midwest wine industry has occurred since 2000. The Northern Grapes Project, a Specialty Crops Research Initiative Program through the USDA‐NIFA (Project 2011‐51181‐30850), characterized the vineyard and winery economics for the northern region, including 13 states growing cold‐hardy grapes (Tuck and Gartner 2013, 2014; Tuck et al. 2016). B ­ etween the years 2002 and 2007, 44% of the responding vineyards had been established and 36% between 2007 and 2012 (Tuck and Gartner 2013). The Swenson varieties made up about 54% of the acreage in cold climate white variety production and 13.5% of cold climate red variety production in 2012 across 13 states surveyed (Tuck and Gartner 2013). The University of Minnesota varieties ­generally make up the majority of the other grapes produced in both red and white grape categories. The economic activity of the cold climate wine industry is generally divided into three categories: vineyard, winery, and tourism. In 2015, the economic activity was estimated at $1.6 billion in the surveyed states (Tuck et  al. 2016). However, when including the impact of only cold‐hardy grapes, the economic activity was $539.1 million, an increase of 34% over the 2011 survey (Tuck et al. 2016). Between 2011 and 2015, the direct effect of winery tourism increased due to more wineries, more tasting room visitors per winery, and an increase in per person spending (Tuck et al. 2016). The modern Minnesota grape and wine industry had just three wineries at its inception by end of the 1970s. Today, the economic activity of the Minnesota grape industry alone was $80.3 million in 2016 (Tuck and Gartner 2017) with over 60 active farm wineries.

Development of Cold Climate Grapes in the Upper Midwestern U.S. 37

II.  ELMER SWENSON A.  A Book that Changed Everything Elmer Swenson (1913–2004) dedicated his life to breeding grapes adapted to the American Midwest, despite there being no active grape or wine industry in the area post‐prohibition. The 18th Amendment to the U.S. Constitution prohibited the manufacture and sale of alcohol from 1920 to 1933. Swenson was pioneering in his thinking, thanks in a very large part to his grandfather’s copy of T.V. Munson’s work, Foundations of American Grape Culture (1909). This book captured the imagination of young Elmer Swenson while growing up in rural Wisconsin, reading about exploring and developing North American grape species. Reading Munson’s work set into motion a lifelong passion that has resulted in grape and wine industries in areas where commercial grape production was once unimaginable. As both a big dreamer and problem‐solver, Munson’s research melded the disciplines of botany and plant breeding. He recognized that North American grapes would revolutionize century‐old traditions, and his efforts in selecting phylloxera‐resistant rootstocks were instrumental in revitalizing the suffering European wine industry (McLeRoy and Renfro 2004; Reisch et  al. 2012). Munson died in January 1913, just months before Elmer Swenson was born. However, his impact on Elmer Swenson from just a singular tome set into motion a lifetime of pioneering efforts in developing cold‐hardy grape varieties that have traveled far beyond their humble beginnings. Swenson’s varieties are planted in vineyards around the globe, including the northern United States from Washington to Maine, Canada, Finland, Norway, Estonia, and Poland. Swenson’s breeding efforts for elite Midwestern table grapes sparked cold‐climate wine industries in the post‐prohibition era. His cultivars and breeding lines have become integral germplasm to many grape breeding programs. The University of Minnesota has used Swenson materials for developing table and wine grapes. Often overlooked because of his status as an untrained scientist, Elmer Swenson’s impact and legacy are a reminder of how plant breeding successes can have the most humble of beginnings. Swenson was raised on a dairy farm outside Osceola, Wisconsin, in a small town called Alden. His maternal grandfather, a Norwegian immigrant named Peter Larson, tended to native and cultivated grapes in a vineyard on the property that were used for making juice, jellies, and wine. In addition, Larson had established a two‐acre orchard when he arrived from Norway around 1868, also building a two‐story log cabin where several generations have since lived. Larson’s vineyard was a place where friends and neighbors would gather to pick grapes, tell

38

Matthew D. Clark

Fig. 2.1.  Photograph of Elmer Swenson in January 2000. With a copy of T.V. Munson’s book on North American grapes (credit: Rolf Hagberg).

stories, and laugh during the harvest. “We had a small home vineyard of 140 plants that I believe were Worden and Moore Early […] I have not positively identified them. Most of all, I remember the joy of being with him as he repaired fences or worked in the vineyard” (Swenson 1988a). Grandfather Larson died when Elmer was five, but Elmer’s memories of the family vineyard persisted through his life. As a child, Elmer began reading Grandfather Larson’s copy of Munson’s book, and was captured in a photograph eight decades later (Fig. 2.1). It is said that his schoolteacher boarded at the Swenson home and taught Elmer to read from this book. Munson’s book starts with a poem to grapevine devotees—a non‐ standard dedication, but one fitting to capture the mind of a young child. Below are a few key lines from that poem that young Elmer must have taken to heart: these themes reflect the way he lived, his approach to planting out seedlings, and his willingness to share the best of his selections with anyone who would show interest. Some few bore better grapes than from the wilds he brought; Such vines he loved and saved and kindly trained, betimes. He always gathered from the new and better vines, And planted vacant places with their seeds, select; He gave to kith and kin, who likewise grew and gave… … But plant and eat and drink and ne’er get drunk (Munson 1909).

Development of Cold Climate Grapes in the Upper Midwestern U.S. 39

In the book’s Preface, Munson highlights the importance of North American germplasm for breeding adaptability and disease resistance (Munson 1909). Europeans had been looking for resistance to Odium (a powdery mildew (Erisphye necator)) and downy mildew (Plasmopora viticola) in the middle of the 19th century and in that process allowed phylloxera to infiltrate and decimate European vineyards. Sources of resistance to these insect and fungal pests have since been identified, but even through decades of breeding, the “faux” grapes of American ancestry continue to remain absent (if not outright prohibited by legislation) from most European markets due to tradition (Allweldt et al. 1991; Ardenghi et al. 2015). B.  The Plant Breeder’s Journey Elmer raised four children (Carole, Corinne, Alan, and Brian) and a herd of dairy cattle with his wife Louise on the 48.6 ha family farm that he eventually inherited. Elmer even described himself as an “indifferent sort of farmer”: not overly interested in cows or corn, and limited by the acidic soils with a shallow water table in western Wisconsin (Demuth 1992). His grape breeding hobby meant that grape seedlings eventually occupied spare parcels of land that surrounded his farm, in addition to apples, apricots, and berries. Adapted to the cold winters, native Vitis riparia accessions and V. labrusca‐based cultivars were already present, although both lacking in different aspects of quality when Elmer initiated his breeding program. The riparia berries were generally small, high in acid, and borne on small clusters. The labrusca varieties were slip‐skin, seeded, and not preferred in wine‐making. Two riparia vines made up arbors that Elmer used as playhouses with the other children on the farm. “He [Grandpa Larson] had evidently selected the best wild ones he could find, at least they were both unusual. The bearing vine had the largest clusters of any riparia I have seen, and I remember counting more than 200 berries on one” (Swenson 1985). The vines making up the arbor were male and female at either end. The staminate vine had such large clusters and profusion of blossoms that it was used in breeding. The labrusca hybrids were flavorful, but not reliably hardy nor of superior table quality. Elmer did not drink alcohol, so breeding for wine quality was not a target in the beginning; therefore, he was not limited by the proscriptive or fundamentalist approach to the European‐style wine markets. Later in his career, breeding for vines lacking the foxy (faux) characteristics caused by methyl anthranilate became more important. For ­Elmer, V. vinifera quality was important for table grapes including the flavor, texture, adherent (cling‐skin), and seedless traits that are popular today.

40

Matthew D. Clark

His first crosses in 1943 used a native riparia vine with large berries and probably a clone of ‘Moore’s Early’ or ‘Janesville’ that was in the vineyard as the pollen parent (Swenson 1985; Demuth 1992). The hardiest grape at the time, ‘Beta’, developed by Louis Suelter in Carver, MN, was the check variety to which Elmer compared his grapes. ‘Beta’ was a unique offspring of a white berry color female V. riparia clone that was crossed with ‘Concord’ (Swenson 1985). ‘Beta’ has become one of the more prevalent rootstocks used in Northern China (Hemstad 2015). The fruit from Swenson’s first cross were comparable in berry size to ‘Beta’, but not in quality. None of these lines became cultivars and all seedlings were eventually abandoned. “With all the wineries today, people would think it normal, but people back then probably though he was an oddball,” commented John Marshall. “This was in the middle of World War II, and it’s intriguing he took this on.” Elmer requested grapevines from all over the country and Canada for evaluation, for use in breeding, and to establish his germplasm pool. His University of Minnesota contemporary, A.N. Wilcox, provided cuttings of MN78, a quality pistillate parent, and four new cultivars that M.J. Dorsey had developed in the 1920s, including ‘Moonbeam’, ‘Red Amber’, ‘Bluebell’, and ‘Bluejay’ (Luby 1991). MN78, an offspring of ‘Beta’, became the backbone of the Swenson material, eventually giving rise to the well‐known cultivars ‘Edelweiss’ and ‘Swenson Red’ (Swenson et al. 1980). The parentage of MN78 was questioned by Elmer: “Somebody made them up, after the fact maybe.” Elmer suggested that MN78 was an offspring of the cross between ‘Beta’ with ‘Jessica’ (Demuth 1992), and Elmer had even suggested testing this theory using DNA markers as early as 1991 (Swenson 1991). Vines were also acquired from the New York Fruit Breeding Station in Geneva, NY, from Niels Hanson at South Dakota State University, and from other collectors and breeders who were importing French hybrids like Seibel 1000 (‘Rosette’). Swenson was the first to utilize the French hybrids in Midwest grape breeding (Luby 1991). “One of the French hybrids I got was Seibel 11803 [‘Rubilande’]. It was of interest to me because it was described as being very vinifera in character, cling‐skin, and a good table grape. It also produced a wine in which no hybrid flavor could be detected” (Swenson 1988a). Elmer was in correspondence with fruit enthusiasts and breeders, and shared cuttings of his vines with those who were interested. This included growers in the northeastern part of the United States where grapes were still being produced commercially. Swenson’s vines were trialed in Manitoba, Canada, where they outperformed other hybrids at the time for fruit quality and winter hardiness (Coutts 1978). He also

Development of Cold Climate Grapes in the Upper Midwestern U.S. 41

shared cuttings with local enthusiasts and aspiring winemakers. Swenson’s grape breeding efforts were often overlooked by his family. Although his children reported being his first line of “tasters” and taking these special grapes in their lunches to school (Ronning 2013), it is not clear that they understood the impact that their father’s puttering would have on grape production in cold climates (M. Hart personal communication). Amateur breeders need to find a way to break into the market with new varieties, a playing field often limited to universities and catalog companies. In the 1950s, Elmer shared cuttings of his ES 40 with the Faribault, MN company, Farmer Seed and Nursery, but these vines were never offered for sale in their catalog despite the cold tender ‘Interlaken’ and ‘Niagara’ being listed (Demuth 1992). However, ES 40 did find its way to the University of New Hampshire by way of Farmer Seed, as Elmer found out when contacted by the plant breeder, Professor Elwyn Meader (Demuth 1992; Swenson 1988a). Meader shared cuttings with other New Hampshire growers like John Canepa and F. Cameron Ludwig, who used the grape in wine making or as a table grape, respectively. Early on, the name ‘white Concord’ was used as the cultivar lacked a name (Marshall 1982). C.  Persistence Pays Off In 1967, Elmer heard about a fruit field day on the radio and brought examples of his best selections, later known as ‘Swenson Red’ and ‘Edelweiss’, to the University of Minnesota Horticultural Research Center (HRC, formerly the Fruit Breeding Farm) in Excelsior, M ­ innesota (Ronning 2013). The fruit were impressive, but initially did not receive much notice from those attending. The university’s fruit breeder at the time was Cecil Stushnoff, who showed a casual interest and maintained some contact with Elmer over the next few years. It is likely that Elmer’s humble personality meant that he did not stick around the event long enough to promote his grapes to the assembled experts. Even in 1972, when he again brought fruit to the HRC, he did not stay long enough for a response but instead left after a day of work. “Just about the time I got to my car, Al Johnson, one of the horticulture faculty, came out the door and across the parking lot trying to catch up to me. ‘Say Elmer,’ he called to me, ‘hold on. You’ve got a real cling‐skin table grape there!’” (Demuth 1992). How Elmer had time to raise a family, milk cattle, and maintain a farm in addition to establishing acres of grapes for his breeding hobby is nearly unfathomable. Unlike publicly funded research in fruit breeding, Elmer had to invest his own funds and lands with little pay off.

42

Matthew D. Clark

There was no mechanism for selling his crop, and as plant breeders know, the proportion of top‐performing seedlings is so low that most of his crop was likely left for the birds, raccoons, and squirrels to eat. Elmer kept quality notes on his seedlings, including disease and pest resistances, basic juice chemistry, sensory notes, and growth habit. His pedigree records were detailed and organized, rivaling those kept by any professional fruit breeder at the time. An enthusiast of Swenson’s work, Jim Liberko compiled his ­writings and supported a University of Minnesota librarian, Penelope Krosch (2005), to conduct interviews with Elmer and assemble this information into a book. This reference includes crossing notes, observations, and correspondences with other researchers and captures Elmer’s personality and approach to plant breeding. There are not many photos of Elmer ­Swenson. However, some videos were created with Elmer giving a tour of his property and describing his plant breeding work. “Elmer didn’t like photos of himself sitting around,” commented Hart, which is exemplified by photographer Rolf Hagberg who captured Elmer in his vineyard in 2000 (Fig. 2.2). Other Swenson grape devotees have championed Elmer’s work including Lon Rombough, the Elmer Swenson Preservation Society,

Fig. 2.2.  Elmer Swenson working in his vineyard circa 2000 (credit: Rolf Hagberg).

Development of Cold Climate Grapes in the Upper Midwestern U.S. 43

and the Minnesota Grape Growers Association. Carl Camper has compiled many of Elmer’s breeding records and has constructed electronic pedigrees available on his website (http://chateaustripmine.info). In addition to some of his notes on breeding, Elmer described his process for germinating seeds and planting seedling vineyards. “In planting seedlings, I plant them quite close, even as close as 3 feet. In a standard vineyard planting, you wouldn’t think of planting them that close. Eight feet is a standard spacing. But in growing seedlings you’ll have a tremendous variance. Ninety‐five percent won’t be worth a second look. So you’re not keeping most of those vines beyond 3 to 4 years. I’m very glad that there is some interest in growing grapes from seedlings because that is how we are going to find plants that are suitable to the area here” (Swenson 1984b). Elmer was supportive of other breeders and was always happy to share budwood, techniques, and tours of his vineyard. Despite the tough conditions that Wisconsin winters can deliver, not every winter was the “test” necessary to thoroughly evaluate all the germplasm. In his summary of the 1983–1984 winter, Elmer commented, “A grape breeder, however, welcomes such a winter as it provides a sure hardiness evaluation of his material. In more than 40 years growing grapes, I have seen 4 such winters” (Swenson 1984a). D.  Working in Retirement Eventually, Elmer retired from farming and took up a position maintaining the fruit breeding plots at the University of Minnesota HRC in 1969. John Marshall reflected on a conversation with Elmer and quoted him as saying, “It was a vacation for me; I got a job and sold the cows. I didn’t have to be to work until 8 every morning, I got an hour lunch, I got off at 5, and I didn’t have to work on weekends, and I got vacation.” When asked about how he could still maintain his vineyards at 85, Elmer commented on another job he had with his parish, West Immanuel Lutheran Church in Alden, WI: “This isn’t much work. Digging a grave in January, that’s a lot of work” (T. Plocher personal communication). Grapes were not even part of Elmer’s job description at the HRC; rather, he cared for the apples, blueberries, and raspberries. In fact, grapes were such a low priority that there were no active breeding efforts at the time. Heeding T.V. Munson’s advice, Elmer found room to plant some vines, and his superiors either did not know or did not mind. “They didn’t say no, and they had room, so I muscled in there,” Elmer explained (Ronning 2013). In autumn 1972, Elmer brought two varieties to the University fruit breeding faculty from his Osceola farm and said they “can have it” if they would name and release it. Dr. Stushnoff

44

Matthew D. Clark

Fig. 2.3.  Elmer Swenson inspects ‘Swenson Red’ grapes at the University of Minnesota Horticultural Research Center (credit: University of Minnesota Agricultural Experiment Station).

and the University of Minnesota took up Elmer’s offer. One of these varieties was the well‐traveled ES 40, which became ‘Edelweiss’ and was released in 1979. The name was provided by John Canepas from White Mountain Vineyards and Winery in Laconia, New Hampshire, who had acquired vines from Meader with Elmer’s permission and made the first wines from them (Marshall 1982). The other grape, a delicious seeded variety named ‘Swenson Red’ (formerly ES 439 (MN 78 × Seibel 11803), was officially introduced in 1978 (Hemstad 2015). Elmer can be seen inspecting ‘Swenson Red’ at the HRC in Fig. 2.3. ‘Edelweiss’ (Fig.  2.4) has become a wine grape frequently used in cold climate regions. It is highly resistant to both downy and powdery mildew, and is used extensively in Nebraska for producing white wine. Its limitation lies in selecting a proper harvest date, as the fruit can become overly aromatic with “foxy” characteristics when fully ripe. Swenson was excited to find a first‐generation seedling in his material with such great qualities: “[…] it was a real thrill to first taste #439, a large red cling‐skin of good texture and low acidity, a real table grape— the kind I had hoped and dreamed of getting. I could hardly believe my good luck” (Swenson 1988a). Edward Zurawicz, a Polish supporter of Swenson, gave the grape its moniker ‘Swenson Red’, and traveled home with cuttings of several of Elmer’s advanced lines. ‘Swenson Red’ (Fig.  2.5) would be more likely to have a greater place in the market

Development of Cold Climate Grapes in the Upper Midwestern U.S. 45

Fig. 2.4.  ‘Edelweiss’ (ES 40) is a white grape cultivar used in wine making and is also eaten as a seeded table grape (credit: University of Minnesota Agricultural Experiment Station).

Fig. 2.5.  ‘Swenson Red’ (ES 56) is a red skin table grape with large berries and ­excellent flavor, but is seeded (credit: University of Minnesota Agricultural Experiment Station).

46

Matthew D. Clark

if it were seedless, as it has excellent texture, flavor, color and berry size. Elmer wanted to call ES 439 ‘NorVin’ (for northern vinifera) for its quality traits; however, it is not reliably hardy in USDA hardiness zone 4 and has been relegated to homeowners’ backyards instead of being widely planted in commercial vineyards (Hemstad 2015). Swenson’s work at the HRC continued until 1979. For much of his time at the university, Elmer had commuted nearly 3 hours each day from his farm to care for the test plots. Eventually he moved to live on‐site at the HRC, contributing to the daily operations but spending less time on the road. “He was always a fruit guy, more than anyone gave him credit. He was interested in apples, pears, plums, any kind of fruit,” said Marshall. His attention to detail was important: according to apple breeder David Bedford, Elmer helped in identifying apples’ trueness‐to‐type, because of his exquisite memory and passion for what he was doing. E.  A Collaborator, Godfather, and Pioneer Elmer did not conduct his plant breeding in a vacuum and was well connected with enthusiasts around the globe. He was also inspired by many local breeders in the private sector. In his time at the University of Minnesota, he collaborated with Patrick Pierquet, a graduate student at the university, and initiated the resurgence of the University of Minnesota breeding program. Pierquet was studying and collecting V. riparia to select cold hardy vines with good viticultural traits. Peirquet, along with Dr. Stushnoff and Swenson, made crosses with the superior riparia accessions #89 (from near Jordan, MN) and #37, #39, and #64 from collections in Manitoba, Canada (Swenson 1991, as cited in Krosch 2005). From the crosses that Pierquet made in 1978, eventually came ‘Frontenac’, the University’s first wine grape variety in 1996 (Hemstad 2015; Pierquet 1998). The use of diverse Asian and North American species in the University of Minnesota breeding program is summarized in Luby (1991). Research showed how V. riparia was ­ regionally adapted to shorter growing conditions across its species range, and was responsive to a photo period for induced bud dormancy (Fennell and Hoover 1991), and offered variation of fruit quality traits (Luby 1991). A subsequent partnership between the South Dakota State University and University of Minnesota resulted in the development of an F2 genetic mapping population using the French hybrid ‘Seyval’ and a V. riparia clone that has been used in mapping some of these traits (Garris et al. 2009; Yang et al. 2016a). Despite having only a 9th grade education, Elmer contributed greatly to the local industry. Though never formally trained, he gave lectures

Development of Cold Climate Grapes in the Upper Midwestern U.S. 47

to grape growers, earning the titles “Father of Minnesota Grapes” (Marshall 2013), “godfather of cold hardy grape breeding” (Luby and Fennell 2006), and “dean of grapes” (Smith 1983) thanks to his pioneering efforts in assembling germplasm and conducting the tedious work of breeding. “Elmer was the Johnny Appleseed of grapes. He wanted ­people to have better grapes, and would give anything to make that ­happen,” said Mark Hart. Elmer’s reputation and contributions continued to gain him recognition. The North American Grape Breeders group even visited his vineyards, in addition to many others who came for advice and share germplasm and techniques. “Around 1980, the Minnesota Grape Growers Association (MGGA) was small back then, and Elmer would show up at all the gatherings. That is where I first met him, going to all those meetings,” grape breeder Tom Plocher said. “I bought property in Hugo, MN, and started testing all sorts of things and got interested in doing some grape breeding. I grew lots of things and made wine from them, including Elmer’s selections. That’s how I got into this gradually, I would always go out into his vineyard a few times a year, and especially at harvest. Getting ideas of what numbered selections to work with.” Elmer attended a lot of the MGGA meetings, despite there being just a few growers and winemakers in the nascent industry. “He had a vision of what was going to happen in the future. He kept plugging away at those seedless table grapes too, probably his first love,” said Plocher. “Elmer was not a winemaker or wine drinker at all. [We] Finally turned him into a wine drinker many years later in his 80s. A glass was about all he would have at a time,” said Plocher. “It was not until the mid‐1990s that he realized he should make some crosses specifically for wine.” Elmer produced some first hybrids with V. vinifera parents, including Cabernet Sauvignon and Chardonnay. “These last crosses are very interesting, including seedling ES10‐18‐6 (blue, pistillate) and seedling ES10‐18‐14 a perfected flowered white selection, ideal for dry white wine,” said Plocher. F.  The Swenson Varieties The 31 grape varieties (Table  2.1) directly released from Swenson’s breeding program have names that reflect the important people and places around him. In Table 2.2, 32 additional varieties are identified that are derived from Swenson’s breeding lines and cultivars. Reading the litany of 31 named grape variety releases from Swenson’s breeding program (Table 2.1) (and the 32 others that have been derived from it; see Table 2.2), it is easy to see the importance of the people and places

Table 2.1.  Grape varieties developed by Elmer Swenson. Those marked with * are patented varieties. “OP” indicates open pollinated. “ES” refers to the seedling/selection designation assigned by Swenson. GVIT designation is for accessions in the USDA‐ARS Grape germplasm repository in Geneva, New York. Color refers to berry color. For flower sex, H = hermaphrodite and P = pistillate. ‘Edelweiss’ and ‘Swenson Red’ were co‐released with the University of Minnesota. Variety

Seed parent

Pollen parent

ES number

Accession

Color

Sex

Adalmiina Aldemina Alpenglow Brianna Delisle Esprit* Fabel Jukka Kandiyohi Kay Gray* La Crosse* Laura’s Laughter Lorelei Louise Swenson Magenta Montreal Blue(s)/Flambow/Flambeau/St. Theresa Norway Red Petite Jewel Prairie Star Sabrevois Shannon Somerset Seedless St. Croix* St. Pepin* Summersweet Swenson White Tango Trollhaugen Edelweiss Swenson Red

ES 2‐3‐17 ES 5‐8‐17 ES 5‐14 ES 1‐63 ES 2‐2‐22 ES 40 ES 2‐11‐4 ES 2‐4‐13 ES 56 ES 217 ES 114 ‐ ES 2‐4‐13 ES 2‐3‐17 Suelter Kandiyohi ES 283 MN78 ES 2‐7‐13 ES 283 ES 5‐14 ES 5‐3‐64 ES 283 ES 114 ES 2‐4‐13 ES 40 ES 2‐8‐23 MN78 MN78 ES 56

ES 35 ES 5‐3‐26 Swenson Red ES 2‐12‐13 Esprit Villard Blanc ES 5‐4‐51 ES 2‐5‐5 Seibel 11803 OP Seyval blanc ‐ ES 2‐5‐5 ES 1‐63 Venus ES 24‐52 ES 193 Canadice ES 2‐8‐1 ES 193 OP Petite Jewel ES 193 Seyval blanc ES 2‐5‐5 ES 442 Louise Swenson Venus Ontario Seibel 11803

ES 6‐16‐30 ES 9‐7‐48 ES 2‐8‐1 ES 7‐4‐76 ES 7‐5‐41 ES 4‐22 ES 11‐2‐58 ES 5‐4‐16 ES 4‐14 ES 1‐63 ES 294 ‐ ES 5‐4‐29 ES 4‐8‐33 ES 3‐22‐16 ES 6‐4‐47 ES 2‐4‐7 ES 3‐20‐36 ES 3‐24‐7 ES 2‐1‐9 ES 6‐11‐42 ES 12‐7‐98 ES 2‐3‐21 ES 282 ES 5‐4‐35 ES 6‐1‐43 ES 7‐2‐24 ES 3‐22‐18 ES 40 ES 439

GVIT 1661 GVIT 1636

White Blue Red White White White Red Blue Blue White White ‐ White White Blue Blue Blue Pink White Red White Pink Red White Blue White White Blue White Red

H H H H H H H H H H H ‐ P H H H P H H H H H H P H H H H H H

0004416669.indd 48

GVIT 1642 GVIT 1648 GVIT 583 ‐ GVIT 1632

GVIT 1722 GVIT 647 GVIT 1482

GVIT 647 GVIT 439

8/31/2019 1:00:04 PM

Development of Cold Climate Grapes in the Upper Midwestern U.S. 49 Table 2.2.  Named grape varieties that are derived as first generation offspring from Elmer Swenson breeding lines or cultivars. Variety

Breeder

Seed parent

Pollen parent

1095Sprit Clondike Francis Honeymoon Icydora Jubilee of Swenson Minnesota Emerald Northland Seedless Olson Petalia Rose Prestige Queenette Blanc Sandy Moon St. Paul Tracy Evangeline Czar Nicholas Richard Walden Petite Ami Troubador Chisago Nokomis Jokke Crimson Pearl Petite Pearl Skandia T.P. 1‐1‐12 T.P. 2‐3‐15 Verona Dilemma Rombough Seedless La Crescent

Ambers Bortnov Bortnov Bortnov Bortnov Bortnov Bortnov Bortnov Bortnov Bortnov Bortnov Bortnov Bortnov Bortnov Bortnov Jamieson Johnson Johnson Macgregor Macgregor Peterson Peterson Pierquet Plocher Plocher Plocher Plocher Plocher Plocher Rombough Rombough U. Minnesota

MN1095 St. Pepin St. Pepin St. Pepin St. Pepin St. Pepin St. Pepin St. Pepin St. Pepin St. Pepin St. Pepin St. Pepin St. Pepin St. Pepin Edelweiss St. Pepin ES 5‐14 ES 5‐17 ES 2‐11‐4 V. riparia 89 St. Croix St. Croix Kay Gray MN1094 MN1094 MN1094 Troubador ES 10‐18‐06 Troubador Esprit Esprit St. Pepin

Esprit Thompson Seedless Jukka Frontenac gris Brianna Frontenac gris Thompson Seedless Reliance Jukka Jukka Thompson Seedless OP Frontenac gris OP Concord Siegerrebe Alden Flame Seedless DM P2‐54 St. Croix Swenson Red Chisago Veeblanc ES 4‐7‐26 ES 4‐7‐26 ES 9‐7‐48 ES 5‐4‐16 Regent ES 5‐4‐16 Himrod Interlaken ES 6‐8‐25

around him. Although Swenson did not name all releases himself, the importance of the region and its features are evident in the names. For example, ‘St. Croix’, for the river that feeds the upper Mississippi and separates Minnesota from Wisconsin; ‘St. Pepin’, a homage to the county and town of the same name near Lake Pepin; and ‘Louise ­Swenson’, named for his wife. ‘La Crosse’, a sibling vine to ‘St. Pepin’, gets its name from another Mississippi river town in Wisconsin. ‘La Crescent’, named for a community in southern Minnesota, is a muscat‐ type descendent released by the University of Minnesota breeding program. Another aromatic variety, ‘Osceola Muscat’, was named for

50

Matthew D. Clark

his home community. Three other local names include ‘Trollhaugen’ (a  small ski resort in Dresser, WI), ‘Somerset Seedless’ (after another small town on Apple River in Wisconsin), and a white grape, ‘Prairie Star’, may be the word‐shuffling of nearby Star Prairie, WI. “Nurseries found it easier to sell a plant with a name,” commented Mark Hart. “So when things got planted widespread, people would come back to Elmer and get permission to name something. His only request was that it could not be named after him.” Elmer was not interested in collecting royalties on these vines, and in his modesty asked that they were not given his name. Other than ‘Swenson Red’ and ‘Swenson White’ (not the possessive Swenson’s), no grapes have received the moniker ‘Elmer Swenson’, perhaps because none of the grapes ever met his benchmark of superiority. ‘Swenson Red’ comes the closest, as it has all the positive attributes for a Midwest table grape, but its seeded nature leaves it just shy of being his ideal grape. Although much smaller, ‘Somerset Seedless’ is currently being sold in Minnesota to schools and farmer’s markets, where it achieves $3/lb, the highest price of any grape in 2017 (Clark et al. 2018). Elmer continued his grape breeding work throughout the rest of his life. Although some of his releases were from first‐generation offspring, Elmer was able to accumulate five or more generations in his lifetime. “When I consider this grape [‘Swenson White’] and compare it to ‘Beta’ from which it descended thru both seed and pollen parent, I am amazed at what nature, with a little assist can do in four generations” (Swenson 1988b). The genetic background of ‘Swenson White’ has combined five Vitis spp., including labrusca, lincecumii, riparia, rupestris, and vinifera. A unique aspect of plant breeding is the accumulation of decades of work and how that work builds on the creativity and hard work of others. The Swenson legacy is, in part, a continuation of other grape breeding pioneers. The Swenson lines and cultivars have been used by at least a dozen other breeders and have many first‐generation offspring named from those programs. “I am very grateful for the help and encouragement I have received in this work. I also have great satisfaction in knowing others are using the Swenson hybrids in breeding efforts of their own. This is as it should be, as my work, in a large part was building on the work begun by others” (Swenson 1988a). G.  Preserving the Swenson Materials The maintenance and evaluation of top‐performing Swenson lines has helped to propel cold hardy and disease resistance breeding efforts,

Development of Cold Climate Grapes in the Upper Midwestern U.S. 51

wine grape cultivar improvement, and table grape breeding programs. Grape breeder and enthusiast Lon Rombough contacted Seed Savers Exchange (SSE) in Decorah, IA, to suggest that top selections and important breeding founders be maintained as Elmer’s capacity to maintain his vineyards was declining by 1990. SSE committed to placing over 200 plants into their Heritage Farm, in addition to accessions of ­native V. riparia and other key cold‐hardy breeding lines. In 2018, the University of Minnesota grape breeding project acquired this collection and planted it at the Horst M. Rechelbacher property in Osceola, WI, as a final breeder’s evaluation for important traits such as disease resistance, pest resistance, and production in an organic vineyard. Admitting that breeding lines are no longer a part of their program, SSE has now decommissioned the Swenson selections and will retain only a subset of the collection that they have identified as being superior and warranted for long‐term maintenance (primarily, named cultivars). Plocher commented, “In the last three years before he died, he wasn’t able to care for [the vineyard]. And the vineyards went downhill with the lack of fungicide sprays.” Plocher and Hart volunteered and got funds to care for the vineyard in these final years. The Elmer Swenson Preservation Project was formed and in 2003 these efforts led to 46 selections submitted to the USDA Cold Hardy Grape Collection at the Plant Genetic Resources Research facility in Geneva, NY. The intent was to make sure the Swenson breeding lines were available for future breeding efforts. One example genotype entered into the collection is ES 14‐4‐29 (GVIT 1629), a seedling from a cross of a low‐acid V. riparia from Herb Fritzke with DR73‐26 (a cross of V. vinifera and V. rotundifolia). “It was a cooperative way to get cuttings and to clean up the vines. Many never rooted because the vineyard was in poor conditions,” said Mark Hart. “We wanted to get the material evaluated with some tender loving care.” It became obvious to others that plant breeder’s intellectual property could be harnessed to license Swenson varieties and recover some royalty funds to support Elmer’s work. A partnership was formed with Bill Smith, known as Swenson‐Smith Vines, Inc., and included a small board with Robin Partch and David Macgregor (Macgregor 1989). A benefactor, Bill Gray, was also instrumental in supporting the program. Elmer patented five of his varieties, including ‘St. Croix’, ‘La Crosse’, ‘Esprit’, ‘St. Pepin’, and ‘Kay Gray’, named after the wife of Mr. Gray. This business arrangement lasted only a few years. “He never thought of making money of it, people had to force money on him to pay him,” Plocher said. “He wasn’t well‐off, but he seemed to be happy with his situation.” Royalties were being paid to Elmer,

52

Matthew D. Clark

even for vines lacking intellectual property protection. “People didn’t want him to stop breeding or working in the vineyard,” said Plocher. The challenges collecting royalties and patenting varieties was partly Elmer’s fault: by sharing his germplasm so freely, it was difficult to trace ownership of the materials and many were deemed to be in the public domain. “Elmer preferred the ‘honor system’ from nurseries. Some vineyards would send checks at $0.25 per vine,” said Hart. At an MGGA meeting on his property, after giving a tour and answering questions, “Elmer brought out seedlings of hybrids for people to try. People tried to give him money and he said, ‘No, just take it. Keep in mind you are helping me, I’m not helping you” (Marshall personal communication). H.  Swenson’s Legacy A plant breeder’s legacy is perpetual in that the varieties they develop continue to live on far after them; in grape, those varieties can last centuries or more. Swenson varieties are grown around the globe where they have created new opportunities for entrepreneurs. Thanks in part to Elmer’s vision for grapes in cold climates, there are an estimated 70 farm wineries in Minnesota to date, all owing Elmer Swenson and the MGGA some gratitude for starting this industry. “The guy led the way for all of us. The growth is completely unexpected,” said John Marshall. “We all have a job to do, and this was his.” Swenson (1988a) was optimistic about the future of the new industry: “Hopefully, a grape culture in cold northern areas of relatively short growing seasons will increase.” His table grapes are being grown for schoolchildren. Wine is being produced in regions of the world where it was once thought to be too cold, or the growing season too short. New industries have been built around Elmer’s work, and not just in Minnesota. Popular media even has shown Swenson’s work, with a ‘Sabrevois’ wine being featured in celebrity chef Anthony Bourdain’s “Parts Unknown” CNN television series shot in Nova Scotia, Canada. The Minnesota Grape Growers Association raises money for the Elmer Swenson Scholarship Fund to provide scholarships each year to undergraduate and graduate students to honor Elmer’s contribution. To date, $36,000 has been given to students studying grapes and wine in Minnesota and Wisconsin. Even at the end of his life, Elmer was making crosses trying to reach his ideal table grape. “We need a seedless table grape for the North, and the material to create it is out here somewhere, but my breeding days are over” (Demuth 1992).

Development of Cold Climate Grapes in the Upper Midwestern U.S. 53

III.  GRAPE IMPROVEMENT IN THE MIDWEST T.V. Munson (1909) himself listed the qualities required for grape breeding (Chapter II), including a “great patience and perseverance, without the stimulation of money‐making in it, for there is little to the originator.” Although that may have been true at the turn of the last century, plant variety protection of various sorts now enable breeders to profit from—or at least cover some of the expenses of—this endeavor. Munson goes on, “The originator must have a great fund of enthusiasm, and an ambition to add something to the general fund of human development for the benefit of the world at large …” (Munson 1909). When asked a similar question, Elmer responded, “What causes a ­person to become a plant breeder? In my case, I believe it was an ­inherited love of nature and seeing a great need for the improvement and adaptation of cultivated grapes for this area” (Swenson 1988a). Elmer Swenson benefited in his breeding efforts thanks to the generations that came before him and who shared their knowledge and plant materials. The Swenson varieties came into the market in an environment of changed consumer preferences, grower demand, and policies that allowed the grape and wine industry regain its Midwestern foothold. This may be in part due to declining commodity prices in other agricultural products, giving farmers opportunities for new crops to grow (Casscles 2015). Although Minnesota breeders like Louis Suelter, A.N. Wilcox, J.M. Dorsey, and Niels E. Hansen (South Dakota State University) pre‐dated his efforts, other contemporary breeders helped shape Swenson’s germplasm and network. Swenson had a long career and, over time, his expertise and germplasm earned him a prominent position among the loosely associated Norther American Grape Breeders group, a consortium of private and public grape breeders. One local contemporary was Herb Fritzke (Minnesota), who evaluated V. riparia selections and proposed a method for recurrent mass selection in grape as a way to reduce the high acidity. Krosch (2005) documents some of the correspondences between Fritzke and Swenson, including their quest to identify the original white riparia used by Suelter. A.  Breeding Projects A review of the Midwest grape breeders by Hemstad (2015) discusses many of the breeding efforts in more detail; a short summary is provided here. The University of Minnesota breeders who overlapped with ­Swenson included Patrick Pierquet, Peter Hemstad, James Luby, and

54

Matthew D. Clark

Cecil Stushnoff. Today the University of Minnesota program is directed by the author. Five wine grape cultivars have been released from the University of Minnesota program: Frontenac, Frontenac Gris, Itasca, La Crescent, and Marquette. ‘Itasca’ is the newest variety and exhibits more cold hardiness and better wine quality than its parent ‘Frontenac gris’ (Clark et al. 2017). Minnesota has been a hotbed of breeding activity, with many private breeders, including Alexandru Bortnov, David McGregor, Kyle Peterson, and Tom Plocher. David Macgregor was an integral member in starting the Minnesota industry. His winery, Lake Sylvia Vineyard, was the third bonded winery in the state and the first to use Minnesota grown grapes in its wines. Mr. Macgregor released the muscat variety Petite Ami, a hybrid of one of his breeding selections and a Swenson selection. Plocher’s ‘Petite Pearl’ and ‘Crimson Pearl’ share a common ancestor with ‘Marquette’ (MN1094), a decedent of ‘Mandan’ from N.E. Hansen’s program. Mr. Plocher has also worked directly with North Dakota State University in developing a breeding program for the Northern Plains, under the direction of Harlene Hatterman‐Valenti. In Bayfield, Wisconsin, Mark Hart is developing grapes in a cold region impacted by Lake Superior that produces short, cool summers. Brian Smith focuses on table grapes at the University of Wisconsin‐River Falls. Anne Fennell at South Dakota State University has been studying grapevine genetics of cold hardiness traits and fruit quality attributes of V. riparia in recent years. A previous breeder there was Ron Peterson who developed the variety Valiant, one of the most cold‐hardy grapes available. Chin‐Feng Hwang at Missouri State University has been studying downy mildew resistance and other important traits in hybrid mapping families of ‘Norton’ (V. aestivalis) crossed with V. vinifera varieties (Sapkota et al. 2018). Lucien Dressel has used ‘Norton’ in the development of a number of hybrids. Wyoming too has University research focused on grape development. Sadanand Dhekney focuses on precision breeding techniques. Carl Camper volunteers in that lab and also independently hybridizes grapes. Mr. Camper runs the aforementioned Chateau Stripmine website, cataloging historic grape breeding records. Other contributors of note include Lon Rombough (Oregon), Cecil Farris (Michigan), Ed Swanson (Nebraska), Herbert Barret (Illinois), and Bill Shoemaker (Illinois). B.  Breeding Targets Although there are approximately 40 cold‐hardy wine grape varieties grown in the region, growers and winemakers are still demanding

Development of Cold Climate Grapes in the Upper Midwestern U.S. 55

improvements and new cultivar releases. ‘Frontenac’ (and its color mutant clones, ‘Frontenac gris’ and ‘Frontenac blanc’) is 50% V. riparia and although it can achieve 27 °Brix regularly, it has 15 g/L total ­acidity, much higher than V. vinifera juices. ‘Frontenac’ (noir) and ‘­ Marquette’ are high in diglucoside anthocyanins, a hallmark of interspecific hybrids (Mullins et al. 1992). These compounds require further study as they are likely to affect the color and aging properties of the wine and are common characteristics of interspecific hybrids (Mullins et al. 1992). Related to this is the low amount of tannins in the wines of some of the hybrid varieties. Even with tannin additions, the end wine products are low in these polyphenolic compounds, which are important for color and mouthfeel, especially in high‐quality red wines (Mansfield 2015). Research suggests that tannins are bound to pathogen‐related proteins in the hybrid wines and fall out of solution (Springer and Sacks 2014; Springer et  al. 2016). This leads to challenges in producing full‐bodied red wines from the current hybrid varieties. Even with the addition of tannins, the timing and type for the desired quality has yet to be optimized. Thus, most producers are requesting new red wine varieties that are low or lacking in diglucoside anthocyanins and have tannins characteristics that are more akin to the V. vinifera varieties that are associated with full‐bodied wines, including ‘Cabernet Sauvignon’. Hybrid varieties have been plagued for a century or more due to their off‐aromas (often varietal characters) that are associated with lower‐quality wines. This includes the “foxy” characteristics in V. labrusca‐based cultivars, as exemplified in ‘Concord’, but detectable in ‘Brianna’ and ‘Louise Swenson’. The V. riparia hybrids are also high in “hybrid” aromatic compounds called pyrazines. The methoxypyrazines are described as earthy, green, and herbaceous aromas, and are common in V. vinifera as well, but in much lower concentrations (Sun et  al. 2011). Genetic mapping of fruit quality traits (Yang et  al. 2016a) is important for identifying loci involved in acid and sugar composition, off‐aromas, and decoupling these traits from winter hardiness. Today, it is unknown if any of these traits are linked, resulting in linkage drag. Sustainability is a target for all plant breeders. Growers are demanding vines that require fewer inputs, especially reduced pesticides. Grapes must be disease resistant, pest resistant, and capable of adapting to abiotic stresses while still being productive and profitable. Profitable yields remain an issue for many growers in the region. Martinson (2016) proposed that a 9,000 kg/ha yield is necessary for a grower to break even. Limitations for yield include winter injury; pest and insect management; and trunk disorders and dieback. Some of these

56

Matthew D. Clark

concerns can be addressed through breeding efforts, but quality vineyard management is critical. Disease‐ and pest‐resistant varieties should not be considered as “no spray,” as pest populations must be managed to prevent the resistance loci from being overcome. Integrated pest management approaches, known as IPM, will be important in all areas where new resistant varieties are deployed to mitigate the effects of climate change (Strand 2000). Current breeding efforts aim to pyramid resistances, specifically to powdery mildew. A cooperative project among public breeding programs, called VitisGen2 (USDA‐NIFA grant award: 2017–51181‐26829), has developed a breeding scheme with shared pollen to stack resistance genes. This is supported by phenotyping and genotyping platforms for screening seedlings (Cadle‐Davidson et  al. 2016; Fresnedo‐Ramírez et al. 2017). An objective of the project is to have pyramided seedlings available in the USDA germplasm repository for shared use. One limitation is that the seedlings may not be regionally adapted for traits like cold‐hardiness. Marker‐assisted breeding efforts are commonplace in the university programs and have been improved through amplicon sequencing technologies (Yang et  al. 2016b) that allow marker haplotypes to be evaluated across different breeding families and breeding programs that use the various Vitis species. This was a major limitation for transferability when using genotype by sequencing and SSR marker types in the VitisGen program. The amplicon sequencing technology is being developed for whole‐genome mapping approaches as well as for use in parental and seedling selection. Climate change exacerbates many of the biotic and abiotic stresses for which plant breeders are selecting resistance traits. Invasive insect species and their effects on grape and wine production generally have not received much attention, including brown marmorated stinkbug (Halyomorpha halys), spotted wing drosophila (Drosophila suzukii), spotted lantern fly (Lycorma delicatula), Japanese beetle (Popillia japonica), and multicolored Asian lady beetle (Harmonia axyridis). Multicolored Asian lady beetle is known to taint wines when crushed and IPM approaches have been developed for control (Galvan et  al. 2006). Warmer temperatures overall have allowed these insect populations to move north and in from the coasts where they were most likely introduced. There is an expected general increase in temperatures and also less predictability for major storm events, including those that bring unprecedented amounts of rainfall. Climate change may also influence plant phenology, especially related to spring bud‐ burst. Crop losses are expected if vines de‐acclimate because of warm

Development of Cold Climate Grapes in the Upper Midwestern U.S. 57

spring days, begin growing, and then are exposed to a late spring frost. ‘Marquette’ is an example of a variety that experienced significant crop loss due to two frost events in Minnesota and western Wisconsin on 13–15 May 2016. As the main progenitor species, V. riparia, it and other cold‐hardy donors (V. labrusca and V. amurensis) should be evaluated for high‐temperature requirements for bud burst to maintain dormancy and avoid frost and freeze injury and crop loss (Allewledt et al. 1991). Londo and Martinson (2015) identified trends that northern V. riparia accessions were most likely to have shorter dormancy periods and a rapid loss of dormancy as temperatures rise, suggesting that breeders may want to use more southern germplasm in breeding. IV.  SUMMARY AND FUTURE PROSPECTS Grape breeding in the 21st century is at its most advanced technological stage. DNA marker technologies allow breeders to screen parents and offspring for alleles of interest. Without pioneers like Elmer Swenson, there would be many fewer efforts in the public and private sector for developing new varieties. The confluence of consumer demand, public policy, and entrepreneurship merged with the availability of Swenson varieties to start a revolution of Midwest and Great Plains wine industries. The Swenson materials were cold‐ hardy and had quality aspects that set them apart from the earlier generations of grapes produced in the region. Swenson’s spirit and success propelled universities and communities to reinvest in grapes and in wine. Combined, these efforts have fueled the successes of many farmers, families, and winemakers in the region. The current wave of breeders is focused on sustainability and climate change with improved wine quality. The germplasm pools, whether in nature or in breeder’s vineyards, have the resources to continue to influence the worldwide wine industry “through the patient and hardworking plant breeder” (Charles Haralson in 1908). ACKNOWLEDGMENTS Grape breeders Tom Plocher and Mark Hart were instrumental in providing anecdotes of Mr. Swenson and some of the resources cited. Mr. John Marshall provided an oral history of the early days of the Minnesota Grape Growers Association and Swenson’s influence in the region.

58

Matthew D. Clark

LITERATURE CITED Abbo, S., A. Gopher, and S. Lev‐Yadun. 2015. Fruit domestication in the Near East. Plant Breed. Rev. 39:325–377. Alleweldt, G., P. Spiegel‐Roy, and B. Reisch. 1991. Grapes (Vitis). Acta Hortic. 290:291–330. Ardenghi, N.M.G., Galasso, G., Banfi, E., and P. Cauzzi. 2015. Vitis xnovae‐angliae (Vitaceae): Systematics, distribution, and history of an “illegal” alien grape in Europe. Willdenowia 45:197–207. Burger, P., A. Bouquet, and M.J. Striem. 2009. Grape breeding. p. 161–189. In: S.M. Jain and P.M. Priyadarshan (eds.), Breeding plantation tree crops: Tropical species. Springer, New York. Cadle‐Davidson, L.E., D. Gadoury, J. Fresnedo, et al. 2016. Lessons from a phenotyping center revealed by the genome‐guided mapping of powdery mildew resistance loci. Phytopathology 106:1159–1169. Casscles, J.S. 2015. Grapes of the Hudson Valley and other cool climate regions of the United States and Canada. Flint Mine Press, Coxsakie, NY. p. 1–248. Clark, M., P. Hemstad, and J. Luby. 2017. ‘Itasca’ grapevine, a new cold‐hardy hybrid for white wine production. HortSci. 52:649–651. Clark, M., B. Tuck, and A. Klodd. 2018. 2017 Minnesota grape production statistics. University of Minnesota Extension. https://enology.dl.umn.edu/sites/g/files/pua1676/f/ media/2017_minnesota_crush_report.pdf. Accessed online 7/6/2018. Cousins, P. and M. Walker. 2002. Genetics of resistance to Meloidogye incognita in cross of grape rootstocks. Theor. App. Gen. 105:802–807. Coutts, J. 1978. Annual Report. p. 3–4. In: J. Marshall and P. Pierquet (eds.), Minnesota Grape Growers Association. St. Paul, MN. Demuth, S. 1992. Grapes for the North: Campout speech. Seed Savers 1992 Harvest Edition, Decorah, IA. p. 49–58. Domoto, P., C. Anderson, M. Clark, and I. Geary. 2016. Growing grapes in Minnesota (10th edn.). Minnesota Grape Growers Association, Red Wing, MN. p. 1–166. Fennell, A., and E. Hoover. 1991. Photoperiod influences growth, bud dormancy, and cold acclimation in V. labruscana and V. riparia. J. ASHS. 116:270–273. Fresnedo‐Ramírez, J., S. Yang, Q. Sun, et al. 2017. An integrative AmpSeq platform for highly multiplexed marker‐assisted pyramiding of grapevine powdery mildew resistance loci. Molecular Breeding 37:145. Galvan, T.L., E.C. Burkness, and W.D. Hutchinson. 2006. Wine grapes in the Midwest: Reducing the risk of the Multicolored Asian Lady Beetle. Publ. 08232. University of Minnesota, St. Paul, MN. p. 1–2. Garris, A., L. Clark, C. Owens, S. et al. 2009. Mapping photoperiod‐induced growth cessation in the wild grape V. riparia. J. ASHS. 134:261–272. Green, S. 1912. Popular fruit growing. 5th edn. Webb Publishing, St. Paul, MN. p. 220–221. Gerrath, J., U. Posluszny, and L. Melville. 2015. Identification of Vitaceae in North America. p. 65–101. In: Taming the wild grape: Botany and horticulture in the Vitaceae. Springer, Cham. Haralson, C. 1908. How members may assist the State Fruit Breeding Farm. The Minnesota Horticulturalist 36:401–403. Hedrick, U.P., N.O. Booth, O.M. Taylor, et al. 1908. Grapes of New York. J.B. Lyon. Albany, NY. p. 1–564. Hemstad, P. 2015. Grapevine breeding in the Midwest. p. 411–425. In: A.G. Reynolds (ed.), Grapevine breeding programs for the wine industry. Cambridge, Woodhead.

Development of Cold Climate Grapes in the Upper Midwestern U.S. 59 Hemstad, P.R., and J.J. Luby. 2000. Utilization of Vitis riparia for the development of new wine varieties with resistance to disease and extreme cold. Acta Hortic. 528:487–490. Hisano, A. 2017. Reinventing the American wine industry: Marketing strategies and the construction of wine culture. Harvard Business School Working Paper, No. 17‐099. p. 1–33. Janick, J. 2005. Grape, p. 279–281. In: The origins of fruits, fruit growing, and fruit breeding. Plant Breed. Rev. 25:5–320. Krosch, P. 1988. Grape research in Minnesota. Agricultural History 62:258–269. Krosch, P. 2005. With a tweezers in one hand and a book in the other, the grape breeding work of Elmer Swenson. Minnesota Grape Growers Association, Red Wing, MN. p.1–118. Londo, J.P., and T. Martinson. 2015. Geographic trend of bud hardiness response in Vitis riparia. Acta Hortic. 1082:299–304. Luby, J.J. 1991. Breeding cold‐hardy fruit crops in Minnesota. HortSci. 26:507–512. Luby, J.J., and A. Fennel. 2006. Fruit breeding for the Northern Great Plains at the University of Minnesota and South Dakota State University. HortSci. 41:25–26. Macgregor, D. 1989. Notes from Swenson Smith Vines. Notes from the North, Minnesota Grape Growers Association. Cannon Falls, MN. 15:5–6. Magoon, C.A., and E. Snyder. 1943. Grapes for different region. USDA, No. 1936. p. 3–31. Mansfield. A.K. 2015. A few truths about phenolics. Wines & Vines, Ja. San Rafael, CA. https:// www. winesandvines.com/features/article/143879/A‐Few‐Truths‐About‐Phenolics. Marshall, J. 1982. Edelweiss, the New England connection. Notes from the North. Minnesota Grape Growers Association, Red Wing, MN. 7:3–5. Marshall, J. 2013. Northern hybrids—A new class of wine grapes. Midwest Wine Press. https://midwestwinepress.com/2013/03/17/john‐marshall/. Accessed online 7/5/2018. Martinson, T. 2016. Vineyard practices: Insights from the 2012 and 2016 Northern Grapes surveys. Northern Grapes News 5:4–7. McLeRoy, S.S., and R.E. Renfro, Jr. 2004. Grape man of Texas. Eakin Press, Austin. p. 86. Mullins, M.G., A. Bouquet, and L.E. Williams. 1992. Biology of the grapevine. Cambridge University press, Cambridge. p. 1–229. Munson, T.V. 1909. Foundations of American grape culture. T.V. Munson & Son, Denison. p. 4; 120. Owens, C. 2008. Grapes. p. 197–234. In: J.F. Hancock (ed.), Temperate fruit crop breeding: Germplasm to genomics. Springer, Dordrecht. Paul, H.W. 1996. Science, vine and wine in modern France. Cambridge University Press, Cambridge, UK. p. 1–355. Pierquet, P. 1978. Grape breeding report. Minnesota Grape Growers Association: 1978 Annual Report. p. 9–11. Pirog, R. 2002. Grape expectations: A food system perspective on redeveloping the Iowa grape industry. Revised ed. Leopold Center, Iowa State University, Ames. p. 4–6. Plocher, T. and B. Parke. 2001. Northern winework: growing grapes and making wine in cold climates. Northern Winework, Inc., Hugo, MN. p. 1–178. Read, P. and S. Gu. 2003. A century of American viticulture. HortSci. 38:943–951. Reisch, B.I., Owens, C.L., and P.S. Cousins. 2012. Grapes. p. 225–262. In: M. Badenes and D. Byrne (eds.), Fruit breeding. Handbook of plant breeding. vol. 8. Springer, Boston. Reisch, B.I., and C. Pratt. 1996. Grapes. p. 297–369. In: J. Janick and J.N. Moore (eds), Fruit breeding. vol. II. John Wiley & Sons, Inc., New York. Ronning, J. 2013. He is a treasure for us all. Oxcart Chronicles 6:1–3; 5. Sapkota, S., L.L. Chen, S. Yang, et al. 2018. Construction of a high‐density linkage map and QTL detection of downy mildew resistance in Vitis aestivalis‐derived ‘Norton’. Theor. Appl. Genet. 10.1007/s00122‐018‐3203‐6.

60

Matthew D. Clark

Smith, W. 1983. Letter to the editor. Notes from the North, Minnesota Grape Growers Association. St. Paul, MN. 8:4. Snyder, E. 1937. Grape development and improvement. USDA, Yearbook, Separate No. 1587:631–664. Springer, L.F., and G.L. Sacks. 2014. Protein‐precipitable tannin in wines from Vitis vinifera and interspecific hybrid grapes (Vitis spp.): Differences in concentration, extractability, and cell wall binding. J. Ag. Food Chem. 62:7515–7523. Springer, L.F., R.W. Sherwood, and G.L. Sacks. 2016. Pathogenesis‐related proteins limit the retention of condensed tannin additions in red wine. J. Ag. Food Chem. 64:1309–1317. Strand, J.F. 2000. Some agrometeorological aspects of pest and disease management for the 21st century. Ag. Forest Meterology 103:73–82. Sumner, D., H. Bombrun, J.M. Alson, and D. Heien. 2001. An economic survey of the wine and winegrape industry in the United States and Canada. In K. Anderson (ed.), Globalization of the world’s wine markets. Edward Elgar, London. Sun, Q., M.J. Gates, E.H. lavin, et  al. 2011. Comparison of odor‐active compounds in grapes and wines from Vitis viniera and non‐foxy American grape species. J. Ag. Food Chem. 59:10657–10664. Swenson, E. 1984a. Grape hybridization. Annual report. Minnesota Grape Growers Association, St. Paul, MN. p. 8–10. Swenson, E. 1984b. Panel on propagation of cuttings. Cold climate grape growing and wine making conference. Notes from the North, Minnesota Grape Growers Association, St. Paul, MN. 9:15. Swenson, E.P. 1985. Wild Vitis riparia from Northern U.S. and Canada—Breeding source for winter hardiness in cultivated grapes: A background of the Swenson hybrids. Fruit Var. J. 39:28–31. Swenson, E. 1988a. A bit of history of the Swenson grape hybrids. Notes from the North, Minnesota Grape Growers Association, Cannon Falls, MN. 14(1):1–3. Swenson, E. 1988b. A Response to “A tale of two (or more) Betas.” Notes from the North, Minnesota Grape Growers Association, Cannon Falls, MN. 14(4):1–3. Swenson, E. 1991. The Minn. #78 grape—Lady of mystery. Fruit Var. J. 45:6–9. Swenson, E., Pierquet, P., and C. Stushonoff. 1980. ‘Edelweiss’ and ‘Swenson Red’ Grapes. HortSci. 15:100. Tuck, B., and W. Gartner. 2013. Vineyards and grapes of the North. University of Minnesota: Center for Community Vitality, St. Paul, MN. p. 1–29. Tuck, B., and W. Gartner. 2014. Economic contribution: Vineyards and wineries of the North. University of Minnesota: Center for Community Vitality, St. Paul, MN. p. 1–17. Tuck, B., and W. Gartner. 2017. Vineyards and wineries in Minnesota: 2016 status summary. University of Minnesota: Center for Community Vitality, St. Paul, MN p. 1–5. Tuck, B., W. Gartner, and G. Appiah. 2016. Economic contributions of vineyards and wineries of the North 2015. University of Minnesota: Center for Community Vitality, St. Paul, MN. p. 1–18. Yang, S., J. Fresnedo‐Ramírez, Q. Sun, et al. 2016a. Next generation mapping of enological traits in an F2 interpsecific grapevine hybrid family. PLoS One 11:e0149560. Yang, S., J. Fresnedo‐Ramírez, M. Wang, et al. 2016b. A next‐generation marker genotyping platform (AmpSeq) in heterozygous crops: a case study for marker‐assisted selection in grapevine. Nature Hort. Res. 3:16002.

3 Candidate Genes to Extend Fleshy Fruit Shelf Life Haya Friedman Department of Postharvest Science of Fresh Produce, Agricultural Research Organization (ARO), the Volcani Center, Bet Dagan, Israel ABSTRACT Postharvest commercial technologies are implemented mainly in developed countries to delay excessive softening, extend shelf life and reduce fresh food loss. However, these technologies drive up fresh fruit prices and hence are rarely implemented in developing countries, where they are most needed. The mechanisms of fruit ripening and softening have been elucidated mainly in tomato, with a translational approach, yielding information on fruit softening of several other fruit types. Fruit softening is dependent on cuticle function, cell-wall integrity, ethylene biosynthesis (in ethylene-sensitive fruit types) and upstream components that regulate ripening. Despite the cuticle’s role, there are as yet no available candidate genes related to cuticle synthesis that can be used to manipulate softening. However, genes encoding enzymes of cell-wall degradation, ethylene biosynthesis, and upstream transcription factors can serve as candidate genes for shelf-life extension. This review describes the candidate genes, mainly in tomato, apple, melon, peach, strawberry, and banana, whose mani­ pulation has been shown to delay softening. Although the function of selected candidate genes has been confirmed in these crops, translational research to additional crops requires further analysis. The multiple candidate genes that have already been discovered can be manipulated by genome editing or used in marker-assistant breeding to extend fleshy fruit shelf life, enabling a reduction in postharvest-handling costs. Cultivars with extended shelf life are especially suitable for cultivation in developing countries. KEYWORDS: ACO, ACS, cell-wall enzyme, cuticle, ethylene sensitivity, genome editing, MAB, MADS-box gene Plant Breeding Reviews, Volume 43, First Edition. Edited by Irwin Goldman. © 2020 John Wiley & Sons, Inc. Published 2020 by John Wiley & Sons, Inc. 61

62

Haya Friedman

I.  INTRODUCTION II.  AVAILABLE METHODS FOR BREEDING AND GENETIC MANIPULATIONS III.  CUTICLE STRUCTURE AND EFFECT ON FRUIT SHELF LIFE IV.  CANDIDATE GENES FOR CELL‐WALL MODIFICATION AND FRUIT SOFTENING V.  ETHYLENE‐BIOSYNTHESIS PATHWAY AND EFFECT ON FRUIT RIPENING VI.  USEFULNESS OF COMPONENTS OF THE ETHYLENE‐RESPONSE PATHWAY FOR DELAY OF FRUIT RIPENING VII.  FRUIT‐RIPENING DELAY BASED ON MANIPULATION OF UPSTREAM TRANSCRITION FACTORS VIII.  CONCLUDING REMARKS AND FUTURE PROSPECTS ACKNOWLEDGMENTS LITERATURE CITED

ABBREVIATIONS ACO 1‐aminocyclopropane‐1‐carboxylic acid (ACC) oxidase ACS ACC synthase β‐GAL β‐galactosidase CRES‐T Chimeric repressor gene‐silencing technology dfd Delayed fruit deterioration EGase Endo‐β‐glucanase ETR Ethylene receptor EXP Expansin GMO Genetically modified organism MAB Marker‐assisted breeding MADS‐box gene A gene containing the MCM1, AGAMOUS, DEFICIENS, SRF domain nor Non‐ripening nr Never ripening PG Polygalacturonase PL Pectate lyase PME Pectin methylesterase QTL Quantitative trait locus SMF Slow‐melting flesh sr Slow ripening TILLING Targeting‐induced local lesions in genomes XTH Xyloglucan endotransglycosylase‐hydrolase VIGS Virus‐induced gene silencing I. INTRODUCTION Fruits have enormous economic value and are essential to the human diet, providing minerals, carbohydrates, fiber, and vitamins. Unfortunately, about 30% of fruits are discarded after harvest due to deterioration, and

Candidate Genes to Extend Fleshy Fruit Shelf Life

63

curbing this waste is a global mission (Porat et  al. 2018). Postharvest fruit follow a ripening program aimed at seed dispersal which, on the one hand, improves fruit quality and includes an increase in sugar, aroma, and color development, but on the other, increases fruit deterioration, due to excessive softening and increased sensitivity to pathogens (Giovannoni 2001). Although a multitude of technologies have been developed to improve postharvest handling and extend shelf life, they are implemented mainly in developed countries, because the high cost deters their implementation in developing countries. Hence, breeding or engineering fruit such as tomato, melon, apple, banana, peach, and strawberry for an extended shelf life would make a major contribution to food security, especially in developing countries, and the knowledge from these crops can be translated to other fruit crops. It would also reduce costs and the carbon footprint in developed countries, since such fruit could be stored at higher temperatures. Breeding for longer shelf life can be achieved by identifying candidate genes whose manipulation can contribute to inhibition of fruit ripening and excessive softening. The fleshy tomato fruit has been used as a model to study basic processes of ripening, and the resultant data have been used as a platform to discover similar components in other climacteric fruit such as peach, apple, banana, and melon (Pech et al. 2008), as well as non‐ climacteric fruit such as strawberry and grape (Goulao and Oliveira 2008; Karlova et al. 2014). Candidate genes for shelf‐life extension can be identified as genes involved directly in cell‐wall metabolism or in the mechanism controlling ripening (Brummell 2006; Matas et al. 2009; Saladié et al. 2007; Mercado et al. 2011; Vicente et al. 2007). A correlation between a gene’s expression and ripening is not sufficient to qualify it as a candidate gene, however functional analyses by multiple methods can confirm the roles of candidate genes in ripening. Most of these technologies aim to reduce the gene’s expression, e.g., antisense (AS), RNA inhibition (RNAi), co‐suppression (CS), virus‐induced gene silencing (VIGS), or a technology for transcription factor silencing termed chimeric repressor gene‐silencing technology (CRES‐T) using the EAR amphiphilic repression domain (SRDX). A few other methods use overexpression in the same systems or in heterologous, more amenable ones. In a few crops, apple in particular, it is even possible to show specific alleles of candidate genes that correlate with a long shelf life (Table 3.1). Cell‐wall metabolism has been thoroughly investigated, since it determines fruit texture, a major quality attribute. It has been suggested that the cell wall, cuticle, and tissue turgor play a major role in fruit texture and the softening that occurs during ripening (Brummell 2006; Lara et al. 2014; Matas et al. 2009; Mercado et al. 2011; Saladié et al. 2007;

64

Haya Friedman

Table 3.1.  Candidate genes in apple suitable for manipulation to extend shelf life. Their involvement in extension of shelf life was validated either by antisense/sense technology or by identification of DNA markers. Antisense/RNAi/sense technology

DNA markers

Cell‐wall modification MdPG

Antisense: increased firmness, reduced water loss (Atkinson et al. 2012)

MdEXP7

Different SNPs correlated with softening phenotypes (Costa et al. 2010) Gene localized to a major QTL for firmness (Costa et al. 2008)

Ethylene biosynthesis MdACO1

MdACS1

Antisense: increased firmness, reduced softening at room temperature. No change in TSS, reduced volatile esters (Dandekar et al. 2004; Johnston et al. 2009; Schaffer et al. 2007) Antisense: increased firmness, reduced softening at room temperature. No change in TSS, reduced volatile esters (Dandekar et al. 2004)

MdACS3

Linkage group L10 MdACO1‐1 low ethylene (Zhu and Barritt 2008)

MdACS1‐1/MdACS1‐2 high/low ethylene, respectively (Costa et al. 2005; Dougherty et al. 2016; Harada et al. 2000). MdACS1‐2 in late cultivars with better firmness (Oraguzie et al. 2004) Mdacs3a/G289V exists in firmer fruit (Wang et al. 2009). Using restriction enzymes to identify Mdacs3a or G289V; Mdacs3a associated with delayed ethylene peak (Dougherty et al. 2016)

Transcription factors MdMADS8/9 (SEP)

MdMADS2.1 (FUL‐AG)

Antisense: inhibition of starch clearance, skin color change and volatile level changes. Fruit remained firm even with ethylene. Deformation of apple fruit shape (Ireland et al. 2013; Schaffer et al. 2013) Polymorphic repeat, (AT)n, in the 3′UTR of MdMADS2.1 localized to linkage group 14 correlated with firmness (Cevik et al. 2010)

Vicente et al. 2007). There are several reports supporting the contribution of cell swelling (Goulao and Oliveira 2008; Mercado et  al. 2011; Saladié et al. 2007) and turgor to fruit softening. However, turgor is controlled by multiple processes, including modification of the cell wall

Candidate Genes to Extend Fleshy Fruit Shelf Life

65

and cuticle, but also by cytoplasmic water/sugar transport. Hence, due to the uncertainty of the genes involved in turgor maintenance, no approaches have been suggested to delay fruit softening by manipulating turgor pressure. On the other hand, candidate genes involved in cell‐wall modification and their contribution to fruit softening will be discussed. Ripening‐related cell‐wall modifications are one aspect of ripening and this process is controlled in many climacteric fruit by ethylene (Bennett and Labavitch 2008). Ethylene biosynthesis, perception, and response pathways have been elucidated mainly in the climacteric fleshy tomato fruit (Alexander and Grierson 2002; Barry and Giovannoni 2007; Bouzayen et al. 2010). Fruit ripening in climacteric fruit such as banana, tomato, and apple, as well as in non‐climacteric fruit such as strawberry and grape, is most likely controlled by several transcription factors (Fig. 3.1A) (Giovannoni 2007; Giovannoni 2004; Klee and Giovannoni 2011). Excellent reviews describe the genetic components involved in ethylene biosynthesis and perception (Alexander and Grierson 2002; Barry and Giovannoni 2007) and in transcriptional control, mainly in tomato (Giovannoni 2007; Giovannoni 2004; Karlova et  al. 2014; Klee and Giovannoni 2011; Seymour et al. 2013). (a)

(b) Developmental cues (hypermethylation, additional components??)

Fruit ripening in ethylenesensitive fruit

Transcription factors (NON, RIN, TAGL1, CNR)

Ethylene synthesis

Fruit ripening

Ethylene-insensitive fruit

Ethylene-sensitive fruit

Sugar accumulation Acidity loss Transcription factors

Color development Cell wall modifications

Ethylene response

Chlorophyll degradation Volatiles synthesis

Fig. 3.1.  Diagram describing the mechanisms of fruit‐ripening. (A) The mechanism controlling ripening in ethylene‐sensitive (dashed lines) and insensitive fruits (solid lines). Few of the ethylene‐sensitive fruits are controlled directly by upstream transcriptions factors, in addition to the ethylene pathway. (B) The ripening processes in ethylene‐ sensitive fruit. Dark grey and light grey boxes in B show ripening processes that are dependent or not on ethylene, respectively. A dark/light grey box shows a process that is both independent and dependent on ethylene.

66

Haya Friedman

This review will concentrate on those candidate genes that modify the cell wall and control the fruit‐ripening process, for which there is evidence of their manipulation in extending shelf life in tomato, melon, apple, peach, strawberry, and banana. This can serve as a platform for developing different crops with extended shelf lives. The pitfalls of using these genes will be discussed. II. AVAILABLE METHODS FOR BREEDING AND GENETIC MANIPULATIONS For many years, two independent disciplines dominated the field of postharvest crop improvement; one focused on physiology and the other on searching for quantitative trait loci (QTLs); these different approaches suffered from a communication barrier. With the advances in DNA sequencing, it became possible to associate specific phenotypes to genes and to a defined QTL (Salvi and Tuberosa 2005). A global effort to sequence many types of fruit resulted in sites where sequences of banana (http://banana‐genome‐hub.southgreen.fr), apple and peach (https://www.rosaceae.org/node/1), cherry (ftp://ftp.kazusa.or.jp/pub/ cherry), and melon (melonomics.net/search/features/) can be found, with many more under construction. Although the DNA‐sequencing data were widely used to improve different aspects of crop cultivation (Carrasco et al. 2013), they were barely used for postharvest improvement. Most studies on fruit postharvest quality focused on biochemistry, physiology, and molecular biology and were geared toward finding ripening mechanisms and new technologies to improve shelf life. It is only recently that this knowledge has begun to be translated into genetic engineering or breeding research to yield crops with better quality, as will be described further on. Recently, there has been interest in using marker‐assisted breeding (MAB) to improve fruit texture and shelf life of apple and peach by the European community (http://www.fruitbreedomics.com/index). This approach enables identifying plants that carry a specific desired trait at an early developmental stage by following a specific DNA marker. The classical approach of MAB is based on finding simple sequence repeats (SSRs) or single‐nucleotide polymorphisms (SNPs) that are highly correlated to a desired phenotype. Due to the availability of relatively inexpensive DNA‐sequencing methods, genome by sequencing (GBS) can provide large‐scale information on many cultivars and their genome modifications (Aranzana et  al. 2010). Candidate genes obtained from studies of fruit‐ripening mechanisms or cell‐wall modifications can

Candidate Genes to Extend Fleshy Fruit Shelf Life

67

facilitate the search for markers to improve shelf life. These markers can help reveal QTLs that exhibit positive postharvest traits. Candidate genes can also be used in targeting induced local lesions in genomes (TILLING). A search for induced mutations in a specific candidate gene early in the plant’s development can yield a desired phenotype, and this approach has had a few successes in postharvest. Candidate genes can also be manipulated either by genetically modifying organisms (GMOs) or by CRISPR/Cas9 editing. High expectations accompanied the development of GMO in the 1980s and 1990s, and the creation of fruit with a better shelf life was one of the goals (Bird and Ray 1991). Aided by Agrobacterium, which can transfer its T‐DNA plasmid into a host genome, it became possible to either overexpress a gene of interest or reduce the expression of selected genes by inserting antisense or RNAi constructs randomly throughout the host genome. Details on this technology are summarized in Meyers et al. (2010) and Tzfira and Citovsky (2006). This approach has been used to improve fruit sweetness, aroma, phytonutrients, and blackening (Han and ­Korban 2011). Nevertheless, this technology has not been accepted for fruit and vegetables mainly in Europe and hence discouraged further development of GMO fruits in the postharvest arena. Today, the technology is used for functional analysis of candidate genes (Elitzur et al. 2016) and it is not likely to be used to develop commercial products. Recently, the new CRISPR/Cas9 technology for targeted genome ­editing has been successfully implemented in several crops. Cas9 is an RNA‐guided DNA endonuclease that can be used to induce mutations in specific DNA sites (Belhaj et  al. 2015; Bortesi and Fischer 2015). Improvements in this technology may exempt it from being considered as producing GMOs (Woo et  al. 2015). The simplicity of its application and its robustness places this technology at the forefront of gene manipulation. However, application of this technology to different ­ crops requires protocols for plant regeneration from a single cell, which is still challenging in many crops. Recently, a few groups have been working on tissue‐specific expression of genome‐editing components to separate out the effects of genes that may have undesirable consequences in non‐target tissues (J. Giovannoni personal communication). Making crop improvements by manipulating candidate genes can benefit from the translational approach of using the candidate genes discovered in tomato to improve the shelf life of different fruit crops. However, this approach might pose a problem, because most of the candidate genes belong to gene families, and it is not always obvious from sequence similarity which of the genes exhibit functional similarity to those in tomato (Elitzur et al. 2010, 2016). Hence, it is necessary to

68

Haya Friedman

identify the correct gene before using it in MAB or for genetic mani­ pulation. In addition, the candidate‐gene approach cannot reveal all of the components affecting fruit softening. For example, in melon, a classical genetic approach identified two independent genes determining ethylene sensitivity (Al‐3, Al‐4), but their identity is still unknown (Moreno et al. 2008; Périn et al. 2002). Although crop improvements, especially for postharvest handling, can benefit from DNA variation or from genetic manipulation, one should bear in mind that epigenetic changes can also contribute to beneficial traits that can be stably inherited. Epigenetic modification can be directed to a gene promoter by targeting VIGS to that promoter (Kanazawa et al. 2011). This approach was used to target the promoter of the tomato Squamosa Promoter Binding protein (SPB) Colorless Non‐Ripening (Sl‐SPB‐CNR), leading to delayed ripening, as had been observed for the natural epigenetic mutation cnr (Manning et al. 2006). However, it is not clear whether this can be achieved for any gene, and the technology of creating epi‐alleles is still being developed (Springer and Schmitz 2017). III.  CUTICLE STRUCTURE AND EFFECT ON FRUIT SHELF LIFE The cuticle plays a major role in fruit quality and postharvest performance, mainly due to its role in water loss (Lara et al. 2014). Transpiration water loss from fruit occurs via the cuticle and can curb fruit shelf life and increase softening (Paniagua et al. 2013). The cuticle is composed mainly of wax and cutin, and excellent recent reviews describe the complex network of transcription factors, biosynthetic enzymes, transporters of the lipophilic units to the surface (Fich et al. 2016; Hen‐Avivi et al. 2014; Yeats and Rose 2013), and cuticle structure (Fernández et al. 2016). Cutin is a complex polyester polymer produced from oxygenated long‐chain fatty acids, which forms a scaffold for the waxes, constituting the outer surface. Neither cuticle thickness nor the total amount of wax appear to correlate with the rate of transpiration‐related water loss. However, specific classes of wax compounds located in the cuticular layer— long‐chain n‐alkanes—have been related to the water‐barrier properties of the cuticle in tomato (Isaacson et al. 2009) and pepper (Parsons et al. 2012, 2013). Further studies in tomato showed that suppression of SlSHINE3 or a mutation in its target enzyme (encoded by SlCYP86A69) converting C18:1 fatty acid to a cutin monomer leads to enhanced water loss. These modifications led to alterations in both cutin and wax composition and a thinner cuticle (Shi et al. 2013). However, it is still not clear if other modifications can reduce water loss and further studies are necessary.

Candidate Genes to Extend Fleshy Fruit Shelf Life

69

Water loss can be affected not only by the chemical identity of the cuticle units but also by the structure, such as cracks in the cuticle or amorphous deposition of wax (Isaacson et al. 2009; Lara et al. 2014). The links between cuticle biosynthesis and structure are still not clear. Therefore, identifying the genes that can be manipulated to reduce water loss is not straightforward. For example, reduction in the polyester polymer monomers by knocking out the Glycerol‐3‐phosphate acyltransferase (GPAT4/GPAT8) gene or their increase by overexpression of GPAT5/CYP86A1 caused a similar phenomenon of increased water permeability (Li et  al. 2007). This perplexing result might be due to modification of the general structure of the cuticle by each of the manipulations. The relationship between cuticle composition and ­structure has rarely been investigated and the self‐assembly mechanism is poorly understood (Fernández et al. 2016). Accordingly, the finding of a tomato mutant with micro‐fissuring that dehydrates at a mature stage but whose cuticle has the same composition as the wild type suggests that neither the content nor the composition of the cuticle are the only factors affecting water loss; rather, it is the rheological properties of the cuticle membrane (Hovav et al. 2007). Rheological properties might be affected by hydration and temperature, and not by cuticle thickness or structure (Edelmann et al. 2005; Matas et al. 2005), making it even more difficult to genetically manipulate cuticle to improve shelf life. Unlike genes within the cuticle biosynthesis network that affect composition, but hardly the water loss, the tomato mutant delayed fruit deterioration (dfd) has a major impact on water loss. Mutated tomato fruit seem to ripen normally, but can last for several months as ripe fruit with minimal water loss (Saladié et  al. 2007). The cuticle of the mutant contains larger amounts of wax, especially alkadienes, and the force needed to induce a rupture is higher. The dfd phenotype is caused by mutation to an NAC gene (Rose et al. 2015) and will be further discussed. Recently, two QTLs were discovered in pepper that contribute to low postharvest water loss and are enriched in genes related to cuticle formation; these may serve to improve postharvest performance of pepper (Popovsky‐Sarid et al. 2017). IV. CANDIDATE GENES FOR CELL‐WALL MODIFICATION AND FRUIT SOFTENING Although firmness is a complex trait that is hard to determine phenotypically due to the many ways of describing texture (Seymour et al. 2002), it is clear that firmness loss should be slowed down in fruit to

70

Haya Friedman

extend their shelf life. The cell wall is a rigid structure contributing to fruit firmness, and its modification leads to fruit softening. These changes have been thoroughly investigated (Brummell 2006; Brummell and Harpster 2001; Goulao and Oliveira 2008; Mercado et  al. 2011; Prasanna et al. 2007; Vicente et al. 2007). Mainly pectin, as well as the hemicellulose matrix (matrix glycans), but not cellulose, undergo major changes during the ripening of many fruits (Bennett and Labavitch 2008; Brummell 2006; Brummell et al. 2004). Not all of the activities of cell‐wall degradation have been elucidated. Nevertheless, genes ­encoding enzymes involved in the degradation of pectin, such as pectin methylesterase (PME), polygalacturonase (PG), β‐galactosidase (β‐GAL), and pectate lyase (PL), or of matrix glycans, such as endo‐β‐glucanase (EGase), xyloglucan endotransglycosylase‐hydrolases (XTHs), and expansins (EXPs), are highly expressed during tomato ripening, and their contribution to fruit softening has been studied by transgenic manipulations (Han and Korban 2011; Mercado et  al. 2011). The precise activities of the various enzymes in polymer degradation have been described in many excellent reviews (Brummell 2006; Brummell et al. 2004; Brummell and Harpster 2001; Mercado et al. 2011; Payasi et al. 2009) and are not within the scope of this review. In several fruits, such as tomato and peach, either PME gene expression or activity is induced during ripening (Alexander and Grierson 2002; Brummell et al. 2004) and the degree of pectin methylesterification is reduced. Hence, it was suspected to be a major contributor to fruit firmness. However, although silencing PME in tomato had a major effect on pectin and reduced the accumulation of calcium in the cell wall, it was not sufficient to significantly impact texture (Brummell 2006; Mercado et al. 2011; Tieman and Handa 1994). In one case, silencing of tomato PMEU1 even enhanced softening (Phan et al. 2007). Consistent with the lack of a PME‐modification effect on softening, melon CmPME2 and CmPME3 were not localized to any firmness loci ­(Moreno et  al. 2008). In apple, the activity or gene expression of PME is reduced during ripening (Gwanpua et al. 2016; Ng et al. 2013) and, in strawberry, there is conflicting evidence as to PME levels during ripening (Castillejo et al. 2004; Mercado et al. 2011). Hence, the role of PME in apple and strawberry softening during ripening is still unclear and so far there are no data to support a major role for PME in softening of these fruits. The possible role of PG in softening has been demonstrated in s­ everal fruit types. Silencing of PG in tomato was not sufficient to significantly impact texture, although PG was reduced to 1% of its activity (Brummell 2006; Brummell and Labavitch 1997; Mercado et al. 2011).

Candidate Genes to Extend Fleshy Fruit Shelf Life

71

In pepper, a gene encoding a PG is responsible for both soft fruit and deciduous phenotypes (Rao and Paran 2003). In peach cultivars that remain firm (non‐melting flesh), the genes encoding PG are not expressed due to a deletion (Lester et  al. 1996). Further analysis revealed that the locus for the melting phenotype consists of at least three effective alleles, and a polymerase chain reaction (PCR) test was devised to differentiate three major phenotypes: freestone melting flesh (FMF), clingstone melting flesh (CMF), and clingstone non‐melting flesh (CNMF) (Table 3.2) (Peace et al. 2005). These alleles can serve in breeding for non‐melting cultivars that are suitable for the processing industry. Reducing MdPG1 expression in the ‘Royal Gala’ apple by antisense technology increased its firmness, juiciness, and intracellular adhesion, and also reduced water loss, suggesting that this gene plays an important role in apple softening (Table 3.1) (Atkinson et al. 2012). Moreover, a reduction in firmness at ambient temperature, but not following 2 months of storage, was correlated with MdPG1; a change in a single nucleotide (SNP) of MdPG1 contributed to differences between soft and hard fruits (Costa et al. 2010). The importance of PG to fruit softening has also been demonstrated in strawberry, where fruit of antisense Table 3.2.  Candidate genes in peach suitable for manipulation to extend shelf life. Their involvement in extension of shelf life was validated either by antisense/sense technology or by identification of DNA markers. Antisense/RNAi/ sense technology

DNA markers

Cell‐wall modification PpPG IAA biosynthesis PpYUC11

PG deletion caused non‐melting phenotype (Lester et al. 1996; Peace et al. 2005) A microsatellite insertion causing stony hard phenotype (Pan et al. 2015)

Transcription factors PpPLENA(AG)

PpNAC

Overexpression in tomato: enhanced ripening (Tadiello et al. 2009) QTL of SMF and MD co‐ localized and contain the gene ppa008301m encoding the SR phenotype (Eduardo et al. 2015)

72

Haya Friedman

Table 3.3.  Identified candidate genes in strawberry suitable for manipulation to extend shelf life. Their involvement in extension of shelf life was validated either by antisense/ sense technology or by identification of DNA markers. Antisense/RNAi/sense technology

DNA markers

Cell‐wall modification FaPG

Antisense: firmer fruit (Quesada et al. 2009)

FaPL

Antisense: firm fruit also at overripe stage (Jiménez‐Bermúdez et al. 2002; Santiago‐Domenech et al. 2008) Antisense: reduced fruit softening, higher sugar and smaller fruit (Paniagua et al. 2015)

FaβGAL

Truncated PG was associated with higher fruit firmness (Villarreal et al. 2008)

Upstream transcription factors FaSHP (AG)

FaMADS9 (AG/PLE)

Overexpression by transient expression: enhanced ripening (Daminato et al. 2013) Antisense: ripening delay and deformed fruit (Seymour et al. 2011)

plants were significantly firmer than controls (Table 3.3) (Quesada et al. 2009). Moreover, a truncated form of strawberry PG was associated with higher fruit firmness among different cultivars (Table  3.3) (Villarreal et al. 2008). Hence, PG‐encoding genes in peach, apple, and strawberry, of the Rosacea family, may serve as genetic markers for the breeding of firmer fruit, or the genes can be manipulated by CRISPR/Cas9 technology in these species. Activity of β‐GAL is associated with fruit ripening and genes encoding this enzyme have been isolated. Silencing of β‐GAL (TBG4) in tomato reduced Gal levels only in mature green tomato, but no effect was seen in ripe tomato (Smith et  al. 2002). Accordingly, its silencing only ­moderately reduced tomato softening (Brummell and Harpster 2001; Brummell et al. 1999; Smith et al. 2002). The β‐GAL enzymes were isolated from avocado and bell pepper and their activity demonstrated in vitro (Ogasawara et al. 2007; Veau et al. 1993). However, manipulation of their activity in these crops requires further identification to pinpoint the exact genes. This enzyme has an unequivocal role in strawberry softening, as it was reduced when β‐GAL was silenced (Table  3.3) ­(Paniagua et al. 2015). Recent work has identified a correlation between the expression of β‐GAL (Mdβ‐GAL2), in addition to MdPG1, and fruit softening (Gwanpua et  al. 2016). However, whether modification or

Candidate Genes to Extend Fleshy Fruit Shelf Life

73

silencing of this gene can be a good candidate to delay softening in different fruit still needs to be verified. PL breaks down crosslinked homogalacturonan polymers in the middle lamella, thereby enabling further degradation of the pectin polysaccharides by enzymes such as PG (Uluisik et al. 2016). In a recent study in tomato, silencing the highly expressed PL inhibited fruit softening, with no effect on other physiological parameters such as color, aroma, sugar content or ethylene biosynthesis (Table 3.4) (Uluisik et al. 2016; Yang et  al. 2017). Moreover, the tomato PL gene was found to localize to a major QTL for firmness and initial trials to knock it out via CRISPR/Cas9 are underway (Uluisik et  al. 2016). Silencing PL in strawberry also reduced fruit softening (Table 3.3) (Jiménez‐Bermúdez et  al. 2002; ­Santiago‐Domenech et  al. 2008). PL exists in many fruit (Marín‐Rodríguez et al. 2002) and its expression has been demonstrated in fruit exhibiting melting flesh, such as peach (Trainotti et  al. 2003) and banana (Payasi et al. 2004; Pua et al. 2001). Moreover, a PL gene from banana expressed in yeast exhibited PL activity (Marín‐Rodríguez et al. 2002). Hence, PL manipulation in fruit such as strawberry, tomato, and possibly also banana or peach may delay softening, but functional analysis of genes within this family in other fruit awaits further study. Fruit ripening‐related EXPs have been discovered in many fruit (Hayama et al. 2003; Mercado et al. 2011). Over‐ or underexpression of EXP1 in tomato enhanced or reduced firmness, respectively, and this phenotype was even observed in overripe fruit (Table 3.4) (Brummell et al. 1999). Recently, application of TILLING technology led to selection of a mutation in one of the EXP genes that delays ripening in tomato fruit (Table 3.4) (Minoia et al. 2016). This further shows the importance of this gene in tomato softening. In melon, three EXP genes were associated with different QTLs for firmness: CmEXP3 with ff10.2, CmEXP1 with ff8.4 (requiring further verification), and possibly CmEXP2 with eth3.1. However, further confirmation is required to use the SNPs discovered in these genes as markers for breeding (Table  3.5) (Moreno et  al. 2008). Similarly, the gene MdEXP7 in apple was localized to a major QTL for firmness (Table 3.1) (Costa et al. 2008) and its homolog was also localized to pear DNA (Costa et  al. 2008). Expression of the peach EXP, PpEXP3, was induced by ethylene treatment in stony hard peach fruit, which soften following ethylene treatment (Hayama et al. 2006) and in strawberry, expression of three EXP genes was correlated with enhanced softening in one out of three cultivars (Dotto et  al. 2006). In banana, EXP also seems to be related to ripening, since promoters of this gene bind to a potential negative regulator of banana ripening (Han et al. 2016).

Table 3.4.  Candidate genes in tomato suitable for manipulation to extend shelf life. Their involvement in extension of shelf life was validated either by antisense/sense technology or by identification of DNA markers. Antisense/RNAi/sense technology

DNA markers Cell‐wall modification

SlPL SlEXP Slα‐Man Slβ‐Hex

RNAi: firmer fruit with no adverse effect on taste or color (Uluisik et al. 2016; Yang et al. 2017) Antisense and overexpression reduced and enhanced softening, respectively (Brummell et al. 1999) RNAi: suppression of tomato fruit softening (Meli et al. 2010) RNAi: suppression of tomato fruit softening (Meli et al. 2010)

Localized to a major QTL for firmness (Uluisik et al. 2016) Mutation in EXP1 by TILLING approach delayed softening (Minoia et al. 2016)

Ethylene biosynthesis SlACO1

SlACS2

Antisense: increased firmness, high TSS, flesh color maintained (Hamilton et al. 1990) RNAi: delayed deterioration and color development (Xiong et al. 2005) Antisense: delayed color development (Oeller and Min‐Wong 1991) Upstream transcription factors

SlMADS‐RIN (SEP) Slrin

Antisense: reduced color development (Vrebalov et al. 2002) CRISPR/Cas9: enhanced ripening (Ito et al. 2017)

SlTAGL1(AG)

Antisense, VIGS, CRES‐T (SRDX): reduced carotenoid and size, no effect on firmness (Itkin et al. 2009; Vrebalov et al. 2009)

SlSBP‐CNR SlNOR

0004416670.indd 74

Deletion of C terminus of SlRIN and N terminus and MC creating a fusion gene. Heterozygote has a long shelf life and reduced lycopene accumulation (Kitagawa et al. 2005). Homozygote has lower sugar and non‐ripening phenotype (Mizrahi et al. 1982)

Hypermethylation of the CNR promoters caused delayed ripening (Kanazawa et al. 2011; Manning et al. 2006) Alc mutant shelf life up to 4 months. It contains an SNP in NOR (Casals et al. 2012). Dfd mutant (Patent # US20150322537) has similar phenotype

8/31/2019 12:51:23 PM

Candidate Genes to Extend Fleshy Fruit Shelf Life

75

Table 3.5.  Candidate genes in melon suitable for manipulation to extend shelf life. Their involvement in extension of shelf life was validated either by antisense/sense technology or by identification of DNA markers. Antisense/RNAi/sense technology

DNA markers

Cell‐wall modification CmEXP

Independent QTLs for firmness harbour EXP2, EXP3, and EXP1 genes (Moreno et al. 2008) Ethylene biosynthesis/response

CmACO1

Antisense: increased firmness, TSS and flesh color not modified (Ayub et al. 1996; Martínez‐Madrid et al. 2002; Nuñez‐Palenius et al. 2007), volatiles reduced (Bauchot et al. 1998)

CmACS5

Missense mutation by TILLING delayed softening (Dahmani et al. 2010)

Two SNPs colocalized to a no‐ethylene‐production QTL (Moreno et al. 2008) Three genes of the family (CmEIL1, CmEIL3, and CmEIL4) are associated with 2 independent QTLs for firmness (Moreno et al. 2008)

CmEIL

Upstream transcription factors CmMADS‐ RIN (SEP)

Antisense: reduced softening and deterioration (Binzel and Giovannoni personal communication)

However, there are no studies showing that genes within this family can be silenced in peach, strawberry, or banana to delay softening. Besides EXP, the matrix glycans are modified by EGases and XTHs. Silencing of EGase in tomato had no effect on softening (Brummell and Harpster 2001; Mercado et al. 2011). Suppression of endo‐1,4‐β‐ glucanase in pepper did not change softening, although the protein level and activity of this enzyme were reduced in the transgenic lines (Harpster et al. 2002). The 1,4‐β‐glucanase enzyme was isolated from strawberries (Woolley et  al. 2001). However, when one of two genes encoding this enzyme was silenced, enzymatic activity was reduced but softening was unaffected (Palomer et al. 2006; Woolley et al. 2001). Also in pear and peach, there is an indication that EGase does not affect softening, since activation of softening by ethylene in peach and pear or its inhibition in pear by 1‐MCP, an inhibitor of ethylene receptor,

76

Haya Friedman

had no effect on the expression of EGase‐encoding genes (Hiwasa et al. 2003; Trainotti et al. 2006). By comparing three cultivars of banana with different softening behaviors, it was demonstrated that 1,3‐β‐glucanase activity and gene expression are correlated with softening (Choudhury et al. 2009). However, further studies are required to elucidate the contribution of silencing this gene to reduce banana softening. Less investigated is the role of XTH in fruit softening for crops other than tomato. In the latter, its silencing did not change softening (Brummell and Harpster 2001; Mercado et al. 2011). Moreover, overexpression of XTH enhanced firmness, in agreement with its role in maintaining cell‐ wall structure and not softening (Miedes et al. 2010). In melon, although CmXTH5 was localized to a major QTL for firmness, the nature of its contribution is still not known (Moreno et al. 2008). Other XTH genes in melon (CmXTH6, CmXTH8, CmXTH2) were not localized to QTLs for fruit ripening (Moreno et al. 2008). In strawberry, at least one gene encoding this enzyme was expressed in fruit ripening, but its expression was higher in a firm cultivar than in a softer one (Nardi et al. 2014). These results are similar to those described in tomato, where higher expression of the gene led to increased firmness (Miedes et al. 2010), and it is possible that this gene is related to high firmness. Aside from the enzymes that are directly involved in cell‐wall modi­ fications, glycoproteins with yet unknown functions are commonly found in the cell wall. Silencing of N‐glycoprotein‐modifying enzymes α‐mannosidase (α‐Man) and β‐D‐N‐acetylhexosaminidase (β‐Hex), which are abundant in the cell wall during ripening, suppressed tomato fruit softening (Table 3.4) (Meli et al. 2010). Support for the importance of these enzymes to fruit softening also comes from a study in peach, where inhibiting these enzymes with 2‐acetaindo‐1,2‐dideoxynojirimycin delayed the decline in fruit firmness (Cao et al. 2014). The contribution of these genes to other crops has not yet been investigated. The emerging picture, summarizing decades of research in tomato, shows that the genes encoding PL, EXP, and N‐glycoprotein‐modifying enzymes are the most important genes for shelf‐life improvement (Table 3.4). Concerning the other cell‐wall‐degrading enzymes, several genes might work together to modify softening (Bennett and Labavitch 2008; Brummell 2006; Vicente et al. 2006). Indeed, silencing SlPG and SlEXP yielded firmer tomatoes at postharvest and better resistance to Botrytis than silencing each of the genes individually (Cantu et al. 2008; Powell et  al. 2003). This might be different for other crops, although similar cell‐wall‐modifying enzymes have been identified (Bennett and Labavitch 2008).

Candidate Genes to Extend Fleshy Fruit Shelf Life

77

V. ETHYLENE‐BIOSYNTHESIS PATHWAY AND EFFECT ON FRUIT RIPENING Although ripening can proceed without ethylene in many types of fruit, such as strawberry, citrus, or grape, in others, such as tomato, melon, banana, or apple, ethylene production and response execute and maintain the fruit‐ripening process. However, even in ethylene‐sensitive fruit, ethylene is not responsible for all aspects of fruit ripening that occur concomitantly with the burst in ethylene (Fig. 3.1B). Synthesis of volatiles, chlorophyll degradation, and some cell‐wall modifications are ethylene‐sensitive, whereas sugar accumulation, color development, and acidity loss are less dependent on ethylene (Ireland et  al. 2014; Johnston et al. 2009; Pech et al. 2008; Yin et al. 2016). The precise control mechanism is still not clear; however, it is possible that ethylene’s influence occurs via its effect on transcription regulators (Figure 3.1B) (Elitzur et  al. 2010; Giovannoni et  al. 2017). Ethylene‐biosynthesis and response‐related pathways have been identified in many fruit, and excellent reviews on their involvement in fruit ripening have been published (Alexander and Grierson 2002; Bapat et al. 2010; Barry and Giovannoni 2007; Gapper et al. 2013; Guo and Ecker 2004; Klee 2004; Klee and Giovannoni 2011; Liu et al. 2015a). Two major families of genes, ACC synthase (ACS) and ACC oxidase (ACO), encode key enzymes of ethylene biosynthesis (Klee and Giovannoni 2011). In tomato, silencing SlACS2 (Oeller and Min‐Wong 1991) or SlACO1 (Hamilton et al. 1990; Xiong et al. 2005), which are specifically expressed in the fruit, delayed fruit deterioration (Table 3.4) (Han and Korban 2011). Similarly, silencing of CmACO in different melon cultivars through Agrobacterium transformation (Ayub et  al. 1996; Guis et  al. 1997; Martínez‐Madrid et  al. 2002; Nuñez‐Palenius et  al. 2007) prolonged shelf life by decreasing ethylene production and increasing firmness (Table  3.5). However, the levels of the volatiles were compromised (Bauchot et al. 1998). In a few of these lines, accumulation of soluble sugars in the developing fruit and carotenoid content in the flesh were ethylene‐independent (Grumet et al. 2007; Guis et al. 1997), and fruit developed high total soluble solids (TSS) (Guis et al. 1997; Martínez‐ Madrid et al. 2002). TILLING technology was used to identify mutations in the ACO1 gene in melon. One missense mutation was found in the catalytic region, which yielded a melon with a long shelf life (Dahmani et  al. 2010) ­(Table  3.5). An attempt to identify additional SNPs (or other

78

Haya Friedman

DNA modifications) in members of the melon ACO family (CmACO1, CmACO2, CmACO3, CmACO5) or ACS family (CmACS1, CmACS2, CmACS3) that are associated with ethylene production was unsuccessful (Moreno et al. 2008; Périn et al. 2002). However, CmACS5 was localized to a major QTL (eth3.5/ff3.5) for reduced climacteric ethylene and two SNPs were discovered (Périn et al. 2002, Moreno et al. 2008), which might be useful for MAB (Table 3.5). Multiple genes of each of the families were discovered in apple and their chromosome locations were established (Singh et al. 2017). Silencing of MdACO1 or MdACS1 genes in apple (Dandekar et  al. 2004; Johnston et al. 2009; Schaffer et al. 2007) resulted in firmer fruit at harvest and after storage, supporting their role in maintaining the fruit shelf life (Table 3.1). However, the levels of volatiles were reduced in MdACO1‐antisense fruit (Dandekar et al. 2004; Schaffer et al. 2007), similar to melon. Utilizing the knowledge of ethylene physiology, ­MdACO1 was chosen as a candidate gene to examine a QTL for apple fruit firmness. Indeed, MdACO1 was placed on linkage group L10 in this important QTL (Costa et al. 2005). Hence, genes in these families can be excellent candidates for editing or marker selection to be used in the breeding of climacteric crops for fruit with a longer shelf life (Ruduś et al. 2013). In the background of the ACS1‐2 allele (see below), the ACO1‐1 allele contributed more firmness than the ACO1‐2 allele (Zhu and Barritt 2008). However, the effect was minor, emphasizing the importance of ACS. In search of additional markers for apple breeding, two MdACS candidate genes were followed: ACS1 and ACS3. Ethylene production was highly correlated with homozygosity of the MdACS1‐1 allele, whereas homozygosity of the MdACS1‐2 allele was correlated with low ethylene production (Harada et al. 2000). The MdACS1‐2 is caused by a retro­ transposon insertion, which can serve to identify low‐ethylene producers, irrespective of the apple’s maturation date. Interestingly, late cultivars that harbor the MdACS1‐2 allele maintain better firmness than early cultivars (Oraguzie et al. 2004). In addition to MdACS1, MdACS3, which is expressed prior to the climacteric peak at the transition from system 1 to system 2 (Singh et al. 2017; Wang et al. 2009), contributes to ethylene production during ripening. Two paralogs of the MdACS3 gene (MdACS3b and MdACS3c) located on different chromosomes have a transposon insert in the 5′ flanking region and hence are not transcribed (Wang et al. 2009). The paralog MdACS3a has three alleles: one is the normal gene, another is the null allele Mdacs3a (Wang et al. 2009), and the third is an allele harbouring an SNP in its active site, resulting in an amino acid substitution (G289V) that inactivates the enzyme. This SNP is associated with a large SSR in the upstream sequence, which

Candidate Genes to Extend Fleshy Fruit Shelf Life

79

can be used to identify this mutation. A null homozygote due to either G289V mutation or Mdacs3a resulted in lower expression of ripening‐ related genes and firmer fruit. New tools based on restriction‐enzyme analysis simplified the identification of the Mdacs3a transcriptional null allele and G289V mutation (Dougherty et al. 2016). This study led to the conclusion that Mdacs3a and not the G289V mutation significantly delays the time required to reach the ethylene peak on the same MdACS1 background (Dougherty et al. 2016). These tools can be useful for MAB of apples with a long shelf life. Several phenotypes of peach softening have been described: melting, non‐melting, and stony hard (SH) (Haji et al. 2005), in addition to slow melting flesh (SMF) (Serra et al. 2017) or slow ripening (SR), which will be discussed below (Eduardo et al. 2015). The stony hard fruit remains firm with no ability to produce ethylene, but responds to ethylene and softens like normal melting fruit (Hayama et  al. 2006; Tatsuki et  al. 2006). PpACS1 was suppressed in cultivars of this phenotype and was suspected as a candidate gene for this mutant (Tatsuki et al. 2006). However, the SH phenotype is related to IAA synthesis; a TC‐dinucleotide microsatellite sequence variant was inserted into the intron of the PpYUC11 (Ppa008176m) gene, encoding a flavin mono‐oxygenase (Table 3.2) (Pan et al. 2015). Such a phenotype might be very useful to the peach industry by enabling control of ripening. This ­candidate gene may also function in other fruit to control ripening. VI. USEFULNESS OF COMPONENTS OF THE ETHYLENE‐ RESPONSE PATHWAY FOR DELAY OF FRUIT RIPENING High expectations of additional candidate genes for manipulating an ethylene response in fruit accompanied the discovery of the ethylene‐ response pathway components. This was mainly supported by the delay in fruit ripening of the ethylene receptor (ETR) genes, especially the never ripening (nr) mutant of SlETR3, which exhibits delayed fruit ripening (Wilkinson et  al. 1995). However, incorporation of this mutant in breeding programs contributed only a minor effect to shelf‐life extension (Kopeliovitch et al. 1982). Moreover, genes in the ETR family, as well as CTR, a downstream kinase, function as negative regulators, and their downregulation enhances the ethylene response (Klee and Giovannoni 2011). The gain‐of‐function mutations in receptor genes, such as nr in tomato, which exhibits a reduced ethylene response, cannot be used as candidate genes to enhance shelf life. This is because the ethylene response is involved in several hormonal

80

Haya Friedman

pathways (Gazzarrini and McCourt 2003) and many d ­ evelopmental stages (Klee and Giovannoni 2011), and therefore changes in the ethylene‐response pathway are not specific to fruit ripening. Similarly, in melon, a CmERS was co‐localized to a QTL for ethylene insensitivity (locus eth1.1), and the mutant exhibited the phenotype at the seedling level as well (Périn et al. 2002). A downstream positive regulator such as EIN2 might also not be useful as a candidate gene for DNA manipulation to extend fruit shelf life, because it participates in multiple ethylene activities and its general shutdown would be detrimental (Zhu et al. 2006). Members of the ethylene‐induced transcription factor EIN3/EIL gene  family are also positive regulators (Huang et  al. 2010; Klee and Giovannoni 2011). Functionally redundant EIL genes were isolated in tomato, but were shown to regulate multiple ethylene responses throughout plant development (Tieman et  al. 2001). Hence, the usefulness of genes in this family for delaying tomato ripening awaits further investigation. In melon, on the other hand, CmEIL1 and CmEIL3 genes co‐ localized with a firmness QTL (locus eth2.1) and CmEIL4 with another site of ethylene insensitivity and firmness (locus eth3.1) (Table 3.5). SNPs were discovered in these genes, and it might be possible to use them in MAB, but further studies are needed to verify that these genes are indeed the only ones contributing to the identified QTL (Moreno et al. 2008). The Ethylene Response Factor (ERF) genes, which constitute a family of 77 genes in tomato, are the downstream transcription factors of the ethylene‐response pathway (Liu et al. 2016; Pirrello et al. 2012). It may be that the ethylene response diverges at the point of ERF functions and a few of the genes exhibit fruit‐specific functions (Liu et al. 2016). In tomato, SlERF6 (Sl‐ERF.E4) acts as a negative regulator of ripening, and its silencing enhances carotenoid biosynthesis (Lee et al. 2012). Another ERF, AP2, was also found to function as a negative regulator of fruit ripening (Chung et al. 2010). Similarly in banana, MaERF11 expression was reduced during ripening and the protein interacted with ACO1 and most likely acted as a negative regulator, but no functional analysis was demonstrated (Xiao et al. 2013). The usefulness of negative regulators for extending fruit shelf life via genome editing is questionable, but promoter or gain‐of‐function mutations, which will enhance their expression or revert their function, respectively, might be useful. Since genes within this family exhibit different expression patterns during tomato ripening (Liu et al. 2016; Pirrello et al. 2012), it is possible that a few genes act as positive regulators (Liu et  al. 2016) and might emerge as candidates for improving shelf life. Fruit‐specific ERF genes have been identified in melon (Ma et al. 2015), banana (Lakhwani

Candidate Genes to Extend Fleshy Fruit Shelf Life

81

et al. 2016), and apple (Girardi et al. 2013). For example, in banana, the expression of the MaERF9 transcript increased during ripening and the protein interacted with the ACO1 promoter, and although a functional analysis was not demonstrated, it might act as a positive regulator (Xiao et al. 2013). The expressions of two ERFs of apple were correlated with high ethylene production in different apple cultivars (Wang et al. 2007), emphasizing their usefulness for genetic manipulation. Interestingly, although grape is non‐climacteric, its fruit contains a large number of ERFs that are modified during ripening (Licausi et al. 2010). Citrus is also a non‐climacteric fruit, but ethylene is involved in de‐greening and CitERF13 was shown to be involved in direct degradation of chlorophyll by binding to the gene promoter encoding pheophorbide hydrolase (Yin et al. 2016). Nevertheless, no functional analysis is yet available for any of the ERFs mentioned above to confirm their role in extending shelf life. Despite a putatively positive role for a few ERFs, the emerging picture is that the role of ERF in fruit ripening is complex (Liu et al. 2016). For example, on the one hand, silencing Sl‐ERF.B3 in tomato delayed carotenoid accumulation and ethylene appearance, but on the other, it enhanced loss of firmness (Liu et  al. 2014). Hence, further studies are needed to pinpoint useful ERFs for genetic manipulation to extend shelf life. VII. FRUIT‐RIPENING DELAY BASED ON MANIPULATION OF UPSTREAM TRANSCRIPTION FACTORS The transcriptional network controlling ethylene biosynthesis and ­ripening has been elucidated in tomato, revealing many essential components of ripening control (Giovannoni 2004; Karlova et  al. 2014). Recently, the role of hypermethylation in ripening inhibition has been established (Giovannoni et al. 2017). A few of these factors also act in non‐ climacteric fruits such as strawberry and grape (Fig.  3.1A) (Giovannoni et al. 2017). In this section, the data related to functional analysis of the components involved in ripening control is summarized. The rin mutation was discovered over 50 years ago (Tigchelaar et al. 1978) and was introduced into tomato breeding programs to create fruit with long shelf lives (Kopeliovitch et al. 1982). In fact, this mutation exists in most commercial cultivars (Kedar 1989). The mutation results from a deletion of the SlMADS‐RIN C terminus leading to a chimeric protein with the SlMADS‐MC excluding the N terminus, creating a chimeric long gene (Table 3.4) (Kitagawa et al. 2005; Vrebalov et al. 2002).

82

Haya Friedman

For many years, it was suggested that SlMADS‐RIN loss of function contributes to this beneficial phenotype. However, recently, using the CRISPR/Cas9 approach, it was proven that rin is a gain‐of‐function mutation that actively represses ripening‐related transcription and fruit ripening, due to a repressive motif contributed by MC (Ito et al. 2017). Nevertheless, this study does not detract from the importance of SEPPALATTA (SEP) SlMADS‐RIN to the control of fruit ripening, since its silencing reduced ripening (Vrebalov et al. 2002). MADS‐box genes in the AGAMOUS/PLENA (AG/PLE) clade have also been suggested to function in ripening control (Giovannoni et al. 2017; Klee and Giovannoni 2011). TAGL1 belongs to this clade and was shown to be a positive regulator of ripening, as well as of fruit growth (Itkin et al. 2009; ­Vrebalov et al. 2009). Indicative of a complex mechanism of ripening control, two other genes of the SQUAMOSA (SQUA) clade FUL1 and 2 are involved in carotenoid production, but not in controlling ethylene or firmness (Bemer et al. 2012). Hence, these genes might not be useful for extending tomato shelf life. Homologs of the SEP MADS‐RIN MaMADS1 and MaMADS2 were discovered in banana and their function examined. Although these genes could not complement the rin or repressed TAGL1 tomato plants (Elitzur et  al. 2010), when silenced in banana, ripening, including color development and firmness loss, was delayed (Elitzur et al. 2016), whereas TSS content was unaffected. This study provided a proof of concept for MaMADS2 being a good candidate gene in banana fruit to extend shelf life. A similar phenotype was observed for silencing of a RIN homolog in melon (Binzel and Giovannoni unpublished). Silencing of homologs of SEP MADS‐box genes (MADS8/9) in apple (Ireland et  al. 2013; Schaffer et  al. 2013) led to fruit‐ripening delay. However, the fruit and flower were malformed. Hence, despite the similarity to RIN, the usefulness of these genes for improving shelf life in apple is limited. Nevertheless, since at least eight SEP MADS‐box genes are expressed in apple fruit, it is still possible that other MADS‐box genes might be useful as a molecular tool to delay ripening. Surprisingly, apple fruit firmness was found to be associated with a homolog of FUL, a MdMADS2.1 gene located on chromosome 14 (Table 3.1) (Cevik et  al. 2010). In tomato, reducing FUL did not affect firmness (Bemer et al. 2012). Functional analysis of MADS‐box genes in the non‐climacteric straw­ berry fruit revealed that silencing of the MADS‐box gene FaMADS9 inhibits ripening (Seymour et  al. 2011), and also affects fruit shape. Another gene of the AG clade, FaSHP, was functionally analyzed by transient expression and its transcript level was correlated with the

Candidate Genes to Extend Fleshy Fruit Shelf Life

83

appearance of a pink stage (Daminato et al. 2013). Neither case presented any clear evidence of the effects of these genes on fruit firmness. Phylogenetic analysis of MADS‐box genes in peach revealed six homologs of RIN SEP (Ppa010577, Ppa010391, Ppa1027139, Ppa010679, Ppa02294, and Ppa019932) and three of TAGL1 (Ppa011140, Ppa010595, and Ppa010578) (London et al. unpublished). The function of one TAGL1 homolog was examined by overexpressing it in tomato, where it increased fruit ripening (Tadiello et  al. 2009), indicating its potential as a candidate in peach for genetic manipulation or as a marker in MAB (Table 3.2). Since several MADS‐box genes are expressed in tomato (Giovannoni 2007), banana (Elitzur et al. 2010), apple (Ireland et al. 2013), peach, and other fruits, the functions of each of the genes in the different crops need to be analyzed to identify major regulators of ripening in the MADS‐box family. The usefulness of such genes as tools for ripening control is especially relevant in parthenocarpic crops such as the vegetatively propagated and widely consumed Cavendish banana, where breeding options for trait improvement are severely limited. Genes of the NAC family have been shown to be involved in the ­r egulation of ethylene‐mediated ripening in tomato (Fig. 3.1A and Table 3.1) (Casals et al. 2012; Giovannoni 2007; Osorio et al. 2013). The non‐ripening mutation nor, resulting in a non‐ripening phenotype, is caused by a mutation in an NAC family gene, but the nature of this mutation has not yet been published, although a patent has been issued (Giovannoni et al. 2004). Tomato variety Penjar harboring the alcobaca (alc) mutation has a shelf life of about 4 months and was found to have a point mutation in the NOR gene (Casals et  al. 2012). Note that the very long shelf life of the dfd mutant is also caused by a point mutation in a NAC gene (Rose et al. 2015). The mutated dfd tomato fruit seemed to ripen normally, but could last for several months as ripe fruit with minimal water loss (Saladié et  al. 2007). In banana, a gene from the NAC family was found to interact with the promoter of MaEIL5 (Shan et al. 2012), but no functional analysis was presented. The benefits of this gene family for fruit shelf‐life extension have not yet been exhausted and further studies are required. Slow firmness loss, also known as slow melting flesh (SMF), is a trait in various peach cultivars whereby the fruit remain firm for at least five days postharvest at room temperature, compared to less than two days for most peach cultivars (London et al. unpublished; Serra et al. 2017). This trait is highly relevant for marketing and leads to improved fruit quality. The gene that is modified in these cultivars has not yet been identified, but recently it was found that this phenotype is related to the

84

Haya Friedman

QTL for maturity date (MD) on chromosome 4 (Serra et al. 2017). This same region contains the slow‐ripening (Sr/sr) gene. Slow‐ripening (sr) fruit have a different phenotype than the SMF fruit; they do not mature or soften at all and remain attached to the tree after leaf fall (Eduardo et al. 2015; Ramming 1991). The trait is inherited as a single mutation, sr. Heterozygotes of this mutation might confer a beneficial phenotype for postharvest handling, but further research is needed to validate this notion. Fine mapping of the MD locus identified a candidate gene (ppa008301m) encoding a transcription factor of the NAC family, and a deletion in this gene caused this mutation (Eduardo et al. 2015). Another transcription factor involved in ripening is SlSBP‐CNR. Specific methylation of SlSBP‐CNR promoter reduced the expression of this gene and delayed fruit ripening (Kanazawa et al. 2011; Manning et  al. 2006). Inhibition of demethylation at a specific time point can be a useful way to reduce fruit ripening and increase shelf life, particularly in fruit with a narrow genetic background (Liu et al. 2015b). Other transcription factors that affect ripening in tomato have been described (Chung et al. 2010; Dong et al. 2013; Giovannoni et al. 2017; Karlova et  al. 2011; Lin et  al. 2008; Zhu et  al. 2014), but since these are either negative regulators or positive regulators with minor effects, their ­usefulness as candidate genes for shelf‐life extension is not clear. Nevertheless, homologs of these genes might affect ripening in other crops, and hence can be used to extend shelf life. VIII.  CONCLUDING REMARKS AND FUTURE PROSPECTS This review presented the candidate genes in tomato, melon, apple, peach, banana, and strawberry that can be manipulated to extend shelf life. An up‐to‐date summary presents the different approaches used to validate the role of candidate genes in shelf‐life extension either by modification of gene expression or by identification of alleles that are related to the desired phenotype. Although the cuticle plays a major role in fruit ripening, to date there are no candidate genes that can be manipulated to extend shelf life. Softening can be reduced by reducing cell‐wall‐degrading enzymes or ethylene synthesis (in ethylene‐ sensitive fruit) and transcription factors that act as positive regulators of fruit ripening. The first approach has the likely advantage of affecting the process related to cell‐wall degradation and only marginally affecting other processes that are beneficial to fruit quality. The second approach slows down all aspects of fruit ripening and it might therefore

Candidate Genes to Extend Fleshy Fruit Shelf Life

85

negatively affect fruit quality. Nonetheless, many studies have demonstrated its usefulness for shelf‐life extension. Among the cell‐wall‐degrading enzymes, there are as yet no common genes that can be manipulated to reduce softening in all crops. Further studies are needed to establish the role of genes encoding cell‐wall‐degrading enzymes in each crop. Nevertheless, genes in the PG family have shown an effect on fruit softening in three Rosacea crops (apple, peach, and strawberry). Genes of the EXP family might also emerge as good candidates for reducing fruit softening, since their function has been demonstrated in tomato, melon, and apple. The PL might be a good candidate that has to be further investigated. It may be that in some crops a number of genes have to be concomitantly silenced to extend shelf life. The usefulness of ethylene‐response genes for the delay of softening is still questionable; however, silencing/modifying specific genes in the ACO and ACS families of ethylene‐sensitive crops increases firmness, without affecting sugar content; on the other hand, the volatiles may be compromised. Upstream transcription factors have been shown to affect ripening rate, and silencing of genes of the SEP and AG clades might be useful for extending the shelf life of crops such as tomato, melon, and banana. However, further studies are needed to demonstrate the usefulness of these multiple transcription factors in other crops. In addition to the available candidate genes that are suitable for translational research, it should be emphasized that other genes related to ripening control or cell‐wall degradation still await discovery. The elucidation of hormonal control of ripening (besides ethylene) has not been exhausted and additional candidate genes, especially in the abscisic acid pathway, might be discovered, as suggested for banana (Yakir et al. 2018) and strawberry (Kumar et al. 2014; Leng et al. 2014; Li et al. 2011). The discovery of candidate genes can facilitate breeding for long shelf life in crops such as tomato, melon, apple, peach, strawberry, and banana. It might also pave the way for translational research to improve the shelf lives of additional crops. ACKNOWLEDGMENTS This is contribution no. 801/18 from the Agricultural Research Organization (ARO). This work was supported by the NSF/BSF (grant no. 1322714) and the Chief Scientist of the Ministry of Agriculture, Israel (grant nos. 430‐0520‐12 and 132‐1692‐12). The author thanks Dr. Susan Lurie for critical reading of the manuscript.

86

Haya Friedman

LITERATURE CITED Alexander, L., and D. Grierson. 2002. Ethylene biosynthesis and action in tomato: a model for climacteric fruit ripening. J. Exp. Bot. 53:2039–2055. Aranzana, M., E.‐K.J. Abbassi, H. Werner, et  al. 2010. Genetic variation, population structure and linkage disequilibrium in peach commercial varieties. BMC Genetics 11:69–80. Atkinson, R.G., P.W. Sutherland, S.L. Johnston, et al. 2012. Down‐regulation of POLYGALACTURONASE1 alters firmness, tensile strength and water loss in apple (Malus × domestica) fruit. BMC Plant Biol. 12:129. Ayub, R., M. Guis, M.B. Amor, et  al. 1996. Expression of ACC oxidase antisense gene inhibits ripening of cantaloupe melon fruits. Nature Biotechnology 14:862–866. Bapat, V.A., P.K. Trivedi, A. Ghosh, et al. 2010. Ripening of fleshy fruit: Molecular insight and the role of ethylene. Biotechnol. Adv. 28:94–107. Barry, C.S., and J.J. Giovannoni, 2007. Ethylene and fruit ripening. J. Plant Growth Reg. 26:143. Bauchot, A.D., D.S. Mottram, A.T. Dodson, et al. 1998. Effect of aminocyclopropane‐1‐ carboxylic acid oxidase antisense gene on the formation of volatile esters in cantaloupe Charentais melon (cv. Vedrandais). J. Agri. Food Chem. 46:4787–4792. Belhaj, K., A. Chaparro‐Garcia, S. Kamoun, et  al. 2015. Editing plant genomes with CRISPR/Cas9. Curr. Opin. Biotechnol. 32:76–84. Bemer, M., R. Karlova, A.R. Ballester, et  al. 2012. The tomato FRUITFULL homologs TDR4/FUL1 and MBP7/FUL2 regulate ethylene‐independent aspects of fruit ripening. Plant Cell 24:4437–4451. Bennett, A.B., and J.M. Labavitch. 2008. Ethylene and ripening‐regulated expression and function of fruit cell wall modifying proteins. Plant Science 175:130–136. Bird, C.R., and J.A. Ray. 1991. Manipulation of plant gene expression by antisense RNA. Biotechnol. Genetic Engin. Rev. 9:207–228. Bortesi, L., and R. Fischer. 2015. The CRISPR/Cas9 system for plant genome editing and beyond. Biotechnol. Advances 33:41–52. Bouzayen, M., A. Latché, P. Nath, et al. 2010. Mechanism of fruit ripening. p. 319–339. In: E.C. Pua and M.R. Davey (eds.), Plant developmental biology—Biotechnological perspectives. Springer, Berlin, Heidelberg. Brummell, D.A. 2006. Cell wall disassembly in ripening fruit. Fun. Plant Biol. 33:103–119. Brummell, D.A., and M.H. Harpster. 2001. Cell wall metabolism in fruit softening and quality and its manipulation in transgenic plants. Plant Mol. Biol. 47:311–339. Brummell, D.A., and J.M. Labavitch. 1997. Effect of antisense suppression of endopolygalacturonase activity on polyuronide molecular weight in ripening tomato fruit and in fruit homogenates. Plant Physiol. 115:717–725. Brummell, D.A., M.H. Harpster, P.M. Civello, et al. 1999. Modification of expansin protein abundance in tomato fruit alters softening and cell wall polymer metabolism during ripening. Plant Cell. 11:2203–2216. Brummell, D.A., V. Dal Cin, S. Lurie, et  al. 2004. Cell wall metabolism during the development of chilling injury in cold‐stored peach fruit: Association of mealiness with arrested disassembly of cell wall pectins. J. Exp. Bot. 55:2041–2052. Cantu, D., A.R. Vicente, L.C. Greve, et al. 2008. The intersection between cell wall disassembly, ripening, and fruit susceptibility to Botrytis cinerea. Proc. Nat. Acad. Sci. 105:859–864. Cao, L., C. Zhao, S. Su, et al. 2014. The role of β‐hexosaminidase in peach (Prunus persica) fruit softening. Sci. Hort. 169:226–233.

Candidate Genes to Extend Fleshy Fruit Shelf Life

87

Carrasco, B., L. Meisel, M. Gebauer, et al. 2013. Breeding in peach, cherry and plum: from a tissue culture, genetic, transcriptomic and genomic perspective. Biol. Res. 46:219–230. Casals, J., L. Pascual, J. Cañizares, et al. 2012. Genetic basis of long shelf life and variability into Penjar tomato. Gen. Res. Crop Evo. 59:219–229. Castillejo, C., J.I. de‐la‐Fuente, P. Iannetta, et  al. 2004. Pectin esterase gene family in strawberry fruit: study of FaPE1, a ripening‐specific isoform. J. Exp. Bot. 55:909–918. Cevik, V., C.D. Ryder, A. Popovich, et al. 2010. A FRUITFULL‐like gene is associated with genetic variation for fruit flesh firmness in apple (Malus domestica Borkh.). Tree Gen. Genomes 6:271–279. Choudhury, S., S. Roy, and D.N. Sengupta. 2009. Characterization of cultivar differences in β‐1,3 glucanase gene expression, glucanase activity and fruit pulp softening rates during fruit ripening in three naturally occurring banana cultivars. Plant Cell Rep. 28:1641. Chung, M.‐Y., J. Vrebalov, R. Alba, et al. 2010. A tomato (Solanum lycopersicum) APETALA2/ ERF gene, SlAP2a, is a negative regulator of fruit ripening. Plant J. 64:936–947. Costa, F., C.P. Peace, S. Stella, et al. 2010. QTL dynamics for fruit firmness and softening around an ethylene‐dependent polygalacturonase gene in apple (Malus × domestica Borkh.). J. Exp. Bot. 61:3029–3039. Costa, F., S. Stella, W.E. Van de Weg, et  al. 2005. Role of the genes Md‐ACO1 and Md‐ACS1 in ethylene production and shelf life of apple (Malus domestica Borkh). Euphytica 141:181–190. Costa, F., W. Van de Weg, S. Stella, et  al. 2008. Map position and functional allelic diversity of Md‐Exp7, a new putative expansin gene associated with fruit softening in apple (Malus × domestica Borkh.) and pear (Pyrus communis). Tree Gen. Genomes. 4:575–586. Dahmani, F., C. Troadec, A. Boualem, et al. 2010. Engineering melon plants with improved fruit shelf life using the TILLING approach. PLoS One. 5:e15776. Daminato, M., F. Guzzo, and G. Casadoro. 2013. A SHATTERPROOF‐like gene controls ripening in non‐climacteric strawberries, and auxin and abscisic acid antagonistically affect its expression. J. Exp. Bot. 64:3775–3786. Dandekar, A., G. Teo, B. Defilippi, et al. 2004. Effect of down‐regulation of ethylene biosynthesis on fruit flavor complex in apple fruit. Transgenic Research 13:373–384. Dong, T., Z. Hu, L. Deng, et al. 2013. A tomato MADS‐box transcription factor, SlMADS1, acts as a negative regulator of fruit ripening. Plant Physiol. 163:1026–1036. Dotto, M.C., G.A. Martínez, and P.M. Civello. 2006. Expression of expansin genes in strawberry varieties with contrasting fruit firmness. Plant Physiol. Biochem. 44:301–307. Dougherty, L., Y. Zhu, and K. Xu. 2016. Assessing the allelotypic effect of two aminocyclopropane carboxylic acid synthase‐encoding genes MdACS1 and MdACS3a on fruit ethylene production and softening in Malus. Hort. Res. 3:16024. Edelmann, H.G., C. Neinhuis, and H. Bargel. 2005. Influence of hydration and temperature on the rheological properties of plant cuticles and their impact on plant organ integrity. J. Plant Growth Reg. 24:116–126. Eduardo, I., R. Picañol, E. Rojas, et al. 2015. Mapping of a major gene for the slow ripening character in peach: co‐location with the maturity date gene and development of a candidate gene‐based diagnostic marker for its selection. Euphytica 205: 627–636. Elitzur, T., J. Vrebalov, J.J. Giovannoni, et al. 2010. The regulation of MADS‐box genes expression during ripening of banana and their regulatory interaction with ethylene. J. Exp. Bot. 61:1523–1535.

88

Haya Friedman

Elitzur, T., E. Yakir, L. Quansah, et al. 2016. Banana MaMADS transcription factors are necessary for fruit ripening and molecular tools to promote shelf‐life and food security. Plant Physiol. 171:380–391. Fernández, V., P. Guzmán‐Delgado, J. Graça, et al. 2016. Cuticle structure in relation to chemical composition: Re‐assessing the rrevailing model. Fron. Plant Sci. 7:427. Fich, E.A., N.A. Segerson, and J.K. Rose. 2016. The plant polyester cutin: Biosynthesis, structure, and biological roles. Ann. Plant Biology 67:207–233. Gapper, N.E., R.P. McQuinn, and J.J. Giovannoni. 2013. Molecular and genetic regulation of fruit ripening. Plant Mol. Biol. 82:575–591. Gazzarrini, S., and P. McCourt. 2003. Cross‐talk in plant hormone signalling: What Arabidopsis mutants are telling us. Ann. Bot. 91:605–612. Giovannoni, J.J. 2001. Molecular regulation of fruit ripening. Ann. Rev. Plant Physiol. Plant Mol. Biol. 52:725–749. Giovannoni, J.J. 2004. Genetic regulation of fruit development and ripening. Plant Cell. 16:S170–S180. Giovannoni, J. 2007. Fruit ripening mutants yield insights into ripening control. Curr. Opin. Plant Biol. 10:283. Giovannoni, J., S. Tanksley, J. Vrebalov, et al. 2004. NOR gene compositions and methods for use thereof. In: System, T.A.M.U., Inc., C.R.F. (eds.), United State Patents, USA. Giovannoni, J., C. Nguyen, B. Ampofo, et al. 2017. The epigenome and transcriptional dynamics of fruit ripening. Ann. Rev. Plant Biol. 68:61–84. Girardi, C.L., C.V. Rombaldi, J. Dal Cero, et al. 2013. Genome‐wide analysis of the AP2/ ERF superfamily in apple and transcriptional evidence of ERF involvement in scab pathogenesis. Sci. Hort. 151:112–121. Goulao, L.F., and C.M. Oliveira. 2008. Cell wall modifications during fruit ripening: when a fruit is not the fruit. Trend. Food Sci. Technol. 19:4–25. Grumet, R., N. Katzir, H.A. Little, et al. 2007. New insights into reproductive development in melon (Cucumis melo L.). Int. J. Plant Dev. Biol. 1:253–264. Guis, M., R. Botondi, M. Ben‐Amor, et al. 1997. Ripening‐associated biochemical traits of cantaloupe charentais melons expressing an antisense ACC oxidase transgene. J. Amer. Soc. Hort. Sci. 122:748–751. Guo, H.W., and J.R. Ecker. 2004. The ethylene signaling pathway: new insights. Curr. Opin. Plant Biol. 7:40–49. Gwanpua, S.G., I. Mellidou, J. Boeckx, et al. 2016. Expression analysis of candidate cell wall‐related genes associated with changes in pectin biochemistry during postharvest apple softening. Post. Biol. Technol. 112:176–185. Haji, T., H. Yaegaki, and M. Yamaguchi. 2005. Inheritance and expression of fruit texture melting, non‐melting and stony hard in peach. Sci. Hort. 105:241–248. Hamilton, A., G. Lycett, and D. Grierson. 1990. Antisense gene that inhibits synthesis of the hormone ethylene in transgenic plants. Nature 346:284. Han, Y., and S.S. Korban. 2011. Transgenic approaches to improve fruit qaulity. p. 151–172. In: M.A. Jenks and P. Bebeli (eds.), Breeding for fruit quality. John Wiley & Sons, Inc. Han, Y.‐C., J.‐F. Kuang, J.‐Y. Chen, et  al. 2016. Banana transcription factor MaERF11 recruits histone deacetylase MaHDA1 and represses the expression of MaACO1 and expansins during fruit ripening. Plant Physiology 171(2):1070–1084. Harada, T., T. Sunako, Y. Wakasa, et al. 2000. An allele of the 1‐aminocyclopropane‐1‐­ carboxylate synthase gene (Md‐ACS1) accounts for the low level of ethylene production in climacteric fruits of some apple cultivars. Theor. Appl. Gen. 101:742–746. Harpster, M.H., D.A. Brummell, and P. Dunsmuir. 2002. Suppression of a ripening‐related endo‐1,4‐β‐glucanase in transgenic pepper fruit does not prevent depolymerization of cell wall polysaccharides during ripening. Plant Mol. Biol. 50:345–355.

Candidate Genes to Extend Fleshy Fruit Shelf Life

89

Hayama, H., A. Ito, T. Moriguchi, et al. 2003. Identification of a new expansin gene closely associated with peach fruit softening. Post. Biol. Technol. 29:1–10. Hayama, H., T. Shimada, H. Fujii, et al. 2006. Ethylene‐regulation of fruit softening and softening‐related genes in peach. J. Exp. Bot. 57:4071–4077. Hen‐Avivi, S., J. Lashbrooke, F. Costa, et al. 2014. Scratching the surface: genetic regulation of cuticle assembly in fleshy fruit. J. Exp. Bot. 65:4653–4664. Hiwasa, K., Y. Kinugasa, S. Amano, et  al. 2003. Ethylene is required for both the initiation and progression of softening in pear (Pyrus communis L.) fruit. J. Exp. Bot. 54:771–779. Hovav, R., N. Chehanovsky, M. Moy, et  al. 2007. The identification of a gene (Cwp1), silenced during Solanum evolution, which causes cuticle microfissuring and dehydration when expressed in tomato fruit. Plant J. 52:627–639. Huang, S., T. Sawaki, A. Takahashi, et al. 2010. Melon EIN3‐like transcription factors (CmEIL1 and CmEIL2) are positive regulators of an ethylene‐and ripening‐induced 1‐aminocyclopropane‐1‐carboxylic acid oxidase gene (CM‐ACO1). Plant Sci. 178:251–257. Ireland, H.S., J.L. Yao, S. Tomes, et  al. 2013. Apple SEPALLATA1/2‐like genes control fruit flesh development and ripening. Plant J. 73:1044–1056. Ireland, H.S., K. Gunaseelan, R. Muddumage, et  al. 2014. Ethylene regulates apple (Malus × domestica) fruit softening through a dose × time‐dependent mechanism and through differential sensitivities and dependencies of cell wall‐modifying genes. Plant Cell Physiol. 55:1005–1016. Isaacson, T., D.K. Kisma, A.J. Matas, et al. 2009. Cutin deficiency in the tomato cuticle consistently affects resistance to microbial infection and biochemical properties, but not transpirational water loss. Plant J. 60:364. Itkin, M., H. Seybold, D. Breitel, et al. 2009. Tomato AGAMOUS‐LIKE 1 is a component of the fruit ripening regulatory network. Plant J. 60:1081. Ito, Y., A. Nishizawa‐Yokoi, M. Endo, et al. 2017. Re‐evaluation of the rin mutation and the role of RIN in the induction of tomato ripening. Nature Plants 3:866. Jiménez‐Bermúdez, S., J. Redondo‐Nevado, J. Muñoz‐Blanco, et al. 2002. Manipulation of strawberry fruit softening by antisense expression of a pectate lyase gene. Plant Physiol. 128:751–759. Johnston, J.W., K. Gunaseelan, P. Pidakala, et  al. 2009. Co‐ordination of early and late ripening events in apples is regulated through differential sensitivities to ethylene. J. Exp. Bot. 60. Kanazawa, A., J.I. Inaba, H. Shimura, et al. 2011. Virus‐mediated efficient induction of epigenetic modifications of endogenous genes with phenotypic changes in plants. Plant J. 65:156–168. Karlova, R., F.M. Rosin, J. Busscher‐Lange, et al. 2011. Transcriptome and metabolite profiling show that APETALA2a is a major regulator of tomato fruit ripening. Plant Cell 23:923–941. Karlova, R., N. Chapman, K. David, et  al. 2014. Transcriptional control of fleshy fruit development and ripening. J. Exp. Bot. 65:4527–4541. Kedar, N. 1989. Long shelf life heterozygous tomato plant. US Patent 4,843,186. Kitagawa, M., H. Ito, H., Shiina, T. et al. 2005. Characterization of tomato fruit ripening and analysis of gene expression in F1 hybrids of the ripening inhibitor (rin) mutant. Physiol. Plant. 123:331–338. Klee, H.J. 2004. Ethylene signal transduction. Moving beyond Arabidopsis. Plant Physiol. 135:660–667. Klee, H.J., and J.J. Giovannoni. 2011. Genetics and control of tomato fruit ripening and quality attributes. Ann. Rev. Gen. 45:41–59.

90

Haya Friedman

Kopeliovitch, E., Y. Mizrahi, H.D. Rabinowitch, et  al. 1982. Effect of the fruit‐ripening mutant genes rin and nor on the flavor of tomato fruit. J. Am. Soc. Hort. Sci. 107:361–364. Kumar, R., A. Khurana, and A.K. Sharma. 2014. Role of plant hormones and their interplay in development and ripening of fleshy fruits. J. Exp. Bot. 65:4561–4575. Lakhwani, D., A. Pandey, Y.V. Dhar, et al. 2016. Genome‐wide analysis of the AP2/ERF family in Musa species reveals divergence and neofunctionalisation during evolution. Scientific Reports 6:18878. Lara, I., B. Belge, and L.F. Goulao. 2014. The fruit cuticle as a modulator of postharvest quality. Post. Biol. Technol. 87:103–112. Lee, J.M., J.G. Joung, R. McQuinn, et al. 2012. Combined transcriptome, genetic diversity and metabolite profiling in tomato fruit reveals that the ethylene response factor SlERF6 plays an important role in ripening and carotenoid accumulation. Plant J. 70:191–204. Leng, P., B. Yuan, and Y. Guo. 2014. The role of abscisic acid in fruit ripening and responses to abiotic stress. J. Exp. Bot. 65:4577–4588. Lester, D.R., W.B. Sherman, and B.J. Atwell. 1996. Endopolygalacturonase and the melting flesh (M) locus in peach. J. Am. Soc. Hort. Sci. 121:231–235. Li, Y., F. Beisson, A.J.K. Koo, et al. 2007. Identification of acyltransferases required for cutin biosynthesis and production of cutin with suberin‐like monomers. Proc. Nat. Acad. Sci. 104:18339–18344. Li, C., H. Jia, Y. Chai, et al. 2011. Abscisic acid perception and signaling transduction in strawberry: a model for non‐climacteric fruit ripening. Plant Sign. Behav. 6:1950–1953. Licausi, F., F.M. Giorgi, S. Zenoni, et al. 2010. Genomic and transcriptomic analysis of the AP2/ERF superfamily in Vitis vinifera. BMC Genomics 11:719. Lin, Z., Y. Hong, M. Yin, et al. 2008. A tomato HD‐zip homeobox protein, LeHB‐1, plays an important role in floral organogenesis and ripening. Plant J. 55:301. Liu, M., G. Diretto, J. Pirrello, et al. 2014. The chimeric repressor version of an Ethylene Response Factor (ERF) family member, Sl‐ERF. B3, shows contrasting effects on tomato fruit ripening. New Phytol. 203:206–218. Liu, M., J. Pirrello, C. Chervin, et al. 2015a. Ethylene control of fruit ripening: revisiting the complex network of transcriptional regulation. Plant Physiol. 169:2380–2390. Liu, R., A. How‐Kit, L. Stammitti, et  al. 2015b. A DEMETER‐like DNA demethylase ­governs tomato fruit ripening. Proc. Nat. Acad. Sci. 112:10804–10809. Liu, M., B.L. Gomes, I. Mila, et al. 2016. Comprehensive profiling of Ethylene Response Factors expression identifies ripening‐associated ERF genes and their link to key regulators of fruit ripening in tomato (Solanum lycopersicum). Plant Physiol. doi: 10.1104/ pp.1115.01859. Ma, Y., F. Zhang, R. Bade, et  al. 2015. Genome‐wide identification and phylogenetic ­analysis of the ERF gene family in melon. J. Plant Growth Regul. 34:66–77. Manning, K., M. Tor, M. Poole, et al. 2006. A naturally occurring epigenetic mutation in a gene encoding an SPB‐box transcription factor inhibits tomato fruit ripening. Nat. Genet. 38:949. Marín‐Rodríguez, M.C., J. Orchard, and G.B. Seymour. 2002. Pectate lyases, cell wall ­degradation and fruit softening. J. Exp. Bot. 53:2115–2119. Martínez‐Madrid, M.C., F. Flores, and F. Romojaro. 2002. Behaviour of abscisic acid and polyamines in antisense ACC oxidase melon (Cucumis melo) during ripening. Funct. Plant Biol. 29:865–872. Matas, A.J., G. López‐Casado, J. Cuartero, et al. 2005. Relative humidity and temperature modify the mechanical properties of isolated tomato fruit cuticles. Am. J. Bot. 92:462–468. Matas, A.J., N.E. Gapper, M.‐Y. Chung, et al. 2009. Biology and genetic engineering of fruit maturation for enhanced quality and shelf‐life. Curr. Opin. Biotechnol. 20:197–203.

Candidate Genes to Extend Fleshy Fruit Shelf Life

91

Meli, V.S., S. Ghosh, T. Prabha, et al. 2010. Enhancement of fruit shelf life by suppressing N‐glycan processing enzymes. Proc. Nat. Acad. Sci. 107:2413–2418. Mercado, J.A., F. Pliego‐Alfaro, and M.A. Quesada. 2011. Fruit shelf‐life and potential for its genetic improvement. p. 81–104. In: M. Jenks and P. Bebeli (eds.), Breeding for fruit quality, John Wiley & Sons, Inc. Meyers, B., A. Zaltsman, B. Lacroix, et al. 2010. Nuclear and plastid genetic engineering of plants: comparison of opportunities and challenges. Biotechnol. Adv. 28:747–756. Miedes, E., K. Herbers, U. Sonnewald, et al. 2010. Overexpression of a cell wall enzyme reduces xyloglucan depolymerization and softening of transgenic tomato fruits. J. Agri. Food Chem. 58:5708–5713. Minoia, S., A. Boualem, F. Marcel, et al. 2016. Induced mutations in tomato SlExp1 alter cell wall metabolism and delay fruit softening. Plant Sci. 242:195–202. Mizrahi, Y., R. Zohar, and S. Malis‐Arad. 1982. Effect of sodium chloride on fruit ripening of the nonripening tomato mutants nor and rin. Plant Physiol. 69:497–501. Moreno, E., J.M. Obando, N. Dos‐Santos, et al. 2008. Candidate genes and QTLs for fruit ripening and softening in melon. Theor. Appl. Gen. 116:589–602. Nardi, C.F., N.M. Villarreal, M.C. Opazo, et al. 2014. Expression of FaXTH1 and FaXTH2 genes in strawberry fruit. Cloning of promoter regions and effect of plant growth regulators. Sci. Hort. 165:111–122. Ng, J.K., R. Schröder, P.W. Sutherland, et al. 2013. Cell wall structures leading to cultivar differences in softening rates develop early during apple (Malus × domestica) fruit growth. BMC Plant Biol. 13:183. Nuñez‐Palenius, H.G., D.J. Huber, H.J. Klee, et al. 2007. Fruit ripening characteristics in a transgenic ‘Galia’ male parental muskmelon (Cucumis melo L. var. reticulatus Ser.) line. Post. Biol. Technol. 44:95–100. Oeller, P.W., and L. Min‐Wong. 1991. Reversible inhibition of tomato fruit senescence by antisense RNA. Science 254:437–439. Ogasawara, S., K. Abe, and T. Nakajima. 2007. Pepper beta‐Galactosidase 1 (PBG1) plays a significant role in fruit ripening in bell pepper Capsicum annuum. Biosci. Biotechnol. Biochem. 71:309–322. Oraguzie, N.C., H. Iwanami, J. Soejima, et al. 2004. Inheritance of the Md‐ACS1 gene and its relationship to fruit softening in apple (Malus × domestica Borkh.). Theor. Appl. Gen. 108:1526–1533. Osorio, S., F. Scossa, and A.R. Fernie. 2013. Molecular regulation of fruit ripening. Front Plant Sci. 4:198. Palomer, X., I. Llop‐Tous, M. Vendrell, et  al. 2006. Antisense down‐regulation of strawberry endo‐β‐(1,4)‐glucanase genes does not prevent fruit softening during ripening. Plant Sci. 171:640–646. Pan, L., W. Zeng, L. Niu, et al. 2015. PpYUC11, a strong candidate gene for the stony hard phenotype in peach (Prunus persica L. Batsch), participates in IAA biosynthesis during fruit ripening. J. Exp. Bot. 66:7031–7044. Paniagua, A.C., A.R. East, J.P. Hindmarsh, et al. 2013. Moisture loss is the major cause of firmness change during postharvest storage of blueberry. Post. Biol. Technol. 79:13–19. Paniagua, C., R. Blanco‐Portales, M. Barceló‐Muñoz, et al. 2015. Antisense down‐regulation of the strawberry β‐galactosidase gene FaβGal4 increases cell wall galactose levels and reduces fruit softening. J. Exp. Bot. 67:619–631. Parsons, E.P., S. Popopvsky, G.T. Lohrey, et al. 2012. Fruit cuticle lipid composition and fruit post‐harvest water loss in an advanced backcross generation of pepper (Capsicum sp.). Physiol. Plant. 146:15–25.

92

Haya Friedman

Parsons, E.P., S. Popopvsky, G.T. Lohrey, et al. 2013. Fruit cuticle lipid composition and water loss in a diverse collection of pepper (Capsicum). Physiol. Plant. 149:160–174. Payasi, A., P.C. Misra, and G.G. Sanwal. 2004. Effect of phytohormones on pectate lyase activity in ripening Musa acuminata. Plant Physiol. Biochem. 42: 861–865. Payasi, A., N.N. Mishra, A.L.S. Chaves, et al. 2009. Biochemistry of fruit softening: an overview. Physiol. Mol. Biol. Plants 15:103–113. Peace, C.P., C.H. Crisosto, and T.M. Gradziel. 2005. Endopolygalacturonase: a candidate gene for Freestone and Melting Fleshin peach. Mol. Breed. 16:21–31. Pech, J.‐C., M. Bouzayen, and A. Latché. 2008. Climacteric fruit ripening: ethylene‐ dependent and independent regulation of ripening pathways in melon fruit. Plant Sci. 175:114–120. Périn, C., M.C. Gomez‐Jimenez, L. Hagen, et al. 2002. Molecular and genetic characterization of a non‐climacteric phenotype in melon reveals two loci conferring altered ethylene response in fruit. Plant Physiol. 1:300–309. Phan, T.D., W. Bo, G. West, et al. 2007. Silencing of the Major salt‐dependent isoform of pectinesterase in tomato alters fruit softening. Plant Physiol. 144:1960–1967. Pirrello, J., B.N. Prasad, W. Zhang, et al. 2012. Functional analysis and binding affinity of tomato ethylene response factors provide insight on the molecular bases of plant differential responses to ethylene. BMC Plant Biol. 12:190. Popovsky‐Sarid, S., Y. Borovsky, A. Faigenboim, et  al. 2017. Genetic and biochemical analysis reveals linked QTLs determining natural variation for fruit post‐harvest water loss in pepper (Capsicum). Theor. Appl. Gen. 130:445–459. Porat, R., A. Lichter, L.A. Terry, et al. 2018. Postharvest losses of fruit and vegetables during retail and in consumers’ homes: Quantifications, causes, and means of prevention. Post. Biol. Technol. 139:135–149. Powell, A.L.T., M.S. Kalamaki, P.A. Kurien, et al. 2003. Simultaneous transgenic suppression of LePG and LeExp1 influences fruit texture and juice viscosity in a fresh market tomato variety. J. Agri. Food Chem. 51:7450–7455. Prasanna, V., T.N. Prabha, and R.N. Tharanathan. (2007). Fruit ripening phenomena–An overview. Crit. Rev. Food Sci. Nutr. 47:1–19. Pua, E.C., C.K. Ong, P. Liu, et al. 2001. Isolation and expression of two pectate lyase genes during fruit ripening of banana (Musa acuminata). Physiol. Plant. 113:92–99. Quesada, M.A., R. Blanco‐Portales, S. Posé, et  al. 2009. Antisense down‐regulation of the FaPG1 gene reveals an unexpected central role for polygalacturonase in strawberry fruit softening. Plant Physiol. 150. Ramming, D. 1991. Genetic control of a slow‐ripening fruit trait in nectarine. Can. J. Plant Sci. 71:601–603. Rao, G., and I. Paran. 2003. Polygalacturonase: A candidate gene for the soft flesh and deciduous fruit mutation in Capsicum. Plant Mol. Biol. 51:135–141. Rose, K.J., T. Isaacson, and J. Vrebalov. 2015. Delayed fruit deterioration allele in plants and methods of detection. In: Boyce Thompson Institute for Plant Research Inc., C.R.F.I. (ed.), United State Patents, USA. Ruduś, I., M. Sasiak, and J. Kȩpczyński. 2013. Regulation of ethylene biosynthesis at the level of 1‐aminocyclopropane‐1‐carboxylate oxidase (ACO) gene. Acta Physiol. Plant. 35:295–307. Saladié, M., A.J. Matas, T Isaacson, et  al. 2007. A reevaluation of the key factors that influence tomato fruit softening and integrity. Plant Physiol. 144:1012–1028. Salvi, S., and R. Tuberosa. 2005. To clone or not to clone plant QTLs: Present and future challenges. Trends Plant Sci. 10:297–304. Santiago‐Domenech, N., S. Jimenez‐Bemudez, A.J. Matas, et al. 2008. Antisense inhibition of a pectate lyase gene supports a role for pectin depolymerization in strawberry fruit softening. J. Exp. Bot. 59.

Candidate Genes to Extend Fleshy Fruit Shelf Life

93

Schaffer, R.J., E.N. Friel, E.J.F. Souleyre, et al. 2007. A genomics approach reveals that aroma production in apple is controlled by ethylene predominantly at the final step in each biosynthetic pathway. Plant Physiol. 144:1899–1912. Schaffer, R.J., H.S. Ireland, J.J. Ross, et  al. 2013. SEPALLATA1/2‐suppressed mature apples have low ethylene, high auxin and reduced transcription of ripening‐related genes. AoB Plants 5. Serra, O., J. Giné‐Bordonaba, I. Eduardo, et al. 2017. Genetic analysis of the slow‐melting flesh character in peach. Tree Gen. Genomes 13:77. Seymour, G.B., K. Manning, E.M. Eriksson, et al. 2002. Genetic identification and genomic organization of factors affecting fruit texture. J. Exp. Bot. 53:2065–2071. Seymour, G.B., C.D. Ryder, V. Cevik, et al. 2011. A SEPALLATA gene is involved in the development and ripening of strawberry (Fragaria × ananassa Duch.) fruit, a non‐ climacteric tissue. J. Exp. Bot. 62:1179–1188. Seymour, G.B., N.H. Chapman, B.L. Chew, et al. 2013. Regulation of ripening and opportunities for control in tomato and other fruits. Plant Biotechnol. J. 11:269–278. Shan, W., J.‐f. Kuang, L. Chen, et  al. 2012. Molecular characterization of banana NAC transcription factors and their interactions with ethylene signalling component EIL during fruit ripening. J. Exp. Bot. 63:5171–5187. Shi, J.X., A. Adato, N. Alkan, et al. 2013. The tomato SlSHINE3 transcription factor regulates fruit cuticle formation and epidermal patterning. New Phytol. 197:468–480. Singh, V., A. Weksler, and H. Friedman. 2017. Different preclimacteric events in apple cultivars with modified ripening physiology. Front. Plant Sci. 8:1502. Smith, D.L., J.A. Abbott, and K.C. Gross. 2002. Down‐regulation of tomato β‐galactosidase: 4 results in decreased fruit softening. Plant Physiol. 129:1755–1762. Springer, N.M., and R.J. Schmitz. 2017. Exploiting induced and natural epigenetic variation for crop improvement. Nat. Rev. Genet. 18:563–575. Tadiello, A., A. Pavanello, D. Zanin, et al. 2009. A PLENA‐like gene of peach is involved in carpel formation and subsequent transformation into a fleshy fruit. J. Exp. Bot. 60:651–661. Tatsuki, M., T. Haji, and M. Yamaguchi. 2006. The involvement of 1‐aminocyclopropane‐1‐carboxylic acid synthase isogene, Pp‐ACS1, in peach fruit softening. J. Exp. Bot. 57:1281–1289. Tieman, D.M., and A.K. Handa. 1994. Reduction in pectin methylesterase activity modifies tissue integrity and cation levels in ripening tomato (Lycopersicon esculentum Mill.) fruits. Plant Physiol. 106:429–436. Tieman, D., J. Ciardi, M. Taylor, et al. 2001. Members of the tomato LeEIL (EIN3‐like) gene family are functionally redundant and regulate ethylene responses throughout plant development. Plant J. 26:47–58. Tigchelaar, E.C., W.B. McGlasson, and R.W. Buescher. 1978. Genetic regulation of tomato ripening. HortSci. 13:508–513. Trainotti, L., A. Pavanello, and D. Zanin. 2006. PpEG4 is a peach endo‐β‐1,4‐glucanase gene whose expression in climacteric peaches does not follow a climacteric pattern. J. Exp. Bot. 57:589–598. Trainotti, L., D. Zanin, and G. Casadoro. 2003. A cell wall‐oriented genomic approach reveals a new and unexpected complexity of the softening in peaches. J. Exp. Bot. 54:1821–1832. Tzfira, T., and V. Citovsky. 2006. Agrobacterium‐mediated genetic transformation of plants: biology and biotechnology. Curr. Opin. Biotechnol. 17:147–154. Uluisik, S., N.H. Chapman, R. Smith, et  al. 2016. Genetic improvement of tomato by ­targeted control of fruit softening. Nat. Biotech. 34:950–952. Veau, E., K.C. Gross, D.J. Huber, et al. 1993. Degradation and solubilization of pectin by β‐galactosidases purified from avocado mesocarp. Plant Physiol. 87:279–285.

94

Haya Friedman

Vicente, A.R., G.A. Martínez, A.R. Chaves, et  al. 2006. Effect of heat treatment on strawberry fruit damage and oxidative metabolism during storage. Post. Biol. Technol. 40:116–122. Vicente, A.R., M. Saladie, J.K. Rose, et al. 2007. The linkage between cell wall metabolism and fruit softening: looking to the future. J. Sci. Food Agri. 87:1435–1448. Villarreal, N.M., H.G. Rosli, G.A. Martínez, et  al. 2008. Polygalacturonase activity and expression of related genes during ripening of strawberry cultivars with contrasting fruit firmness. Post. Biol. Technol. 47:141–150. Vrebalov, J., D. Ruezinsky, V. Padmanabhan, et al. 2002. A MADS‐box gene necessary for fruit ripening at the tomato ripening‐inhibitor (rin) locus. Science 296:343–346. Vrebalov, J., I. Pan, A. Matas, et al. 2009. Fleshy fruit expansion and ripening are regulated by the tomato SHATTERPROOF gene, TAGL1. Plant Cell. 21:3041. Wang, A., D. Tan, A. Takahashi, et  al. 2007. MdERFs, two ethylene‐response factors involved in apple fruit ripening. J. Exp. Bot. 58:3743–3748. Wang, A., J. Yamakake, H. Kudo, et al. 2009. Null mutation of the MdACS3 gene, coding for a ripening‐specific 1‐aminocyclopropane‐1‐carboxylate synthase, leads to long shelf life in apple fruit. Plant Physiol. 151:391–399. Wilkinson, J.Q., M.B. Lanahan, Y. Hsiao‐Ching, et al. 1995. An ethylene‐inducible components of signal transduction encoded by Never‐ripe. Science 270:1807–1809. Woo, J.W., J. Kim, S.I. Kwon, et al. 2015. DNA‐free genome editing in plants with preassembled CRISPR‐Cas9 ribonucleoproteins. Nat. Biotech. 33:1162–1164. Woolley, L.C., D.J. James, and K. Manning. 2001. Purification and properties of an endo‐β‐1,4‐glucanase from strawberry and down‐regulation of the corresponding gene, cell. Planta 214:11–21. Xiao, Y.‐y., J.‐y. Chen, J.‐f. Kuang, et  al. 2013. Banana ethylene response factors are involved in fruit ripening through their interactions with ethylene biosynthesis genes. J. Exp. Bot. 64:2499–2510. Xiong, A.‐S., Q.‐H. Yao, R.‐H. Peng, et  al. 2005. Different effects on ACC oxidase gene silencing triggered by RNA interference in transgenic tomato. Plant Cell Rep. 23:639–646. Yakir, E., F. Zhangjun, N. Sela, et al. 2018. MaMADS2 repression in banana fruits modifies hormone synthesis and signalling pathways prior to climacteric stage. BMC Plant Biol. 18:267–284. Yang, L., W. Huang, F. Xiong, et al. 2017. Silencing of SlPL, which encodes a pectate lyase in tomato, confers enhanced fruit firmness, prolonged shelf‐life and reduced susceptibility to grey mould. Plant Biotechnol. J. 15:1544–1555. Yeats, T.H., and J.K.C. Rose. 2013. The formation and function of plant cuticles. Plant Physiol. 163:5–20. Yin, X.r., X.l. Xie, X.j. Xia, et al. 2016. Involvement of an ethylene response factor in chlorophyll degradation during citrus fruit degreening. Plant J. 86:403–412. Zhu, Y., and B.H. Barritt. 2008. Md‐ACS1 and Md‐ACO1 genotyping of apple (Malus ×  domestica Borkh.) breeding parents and suitability for marker‐assisted selection. Tree Gen. Genomes 4:555–562. Zhu, H.L., B.Z. Zhu, Y. Shao, et  al. 2006. Tomato fruit development and ripening are altered by the silencing of LeEIN2 gene. J. Integ. Plant Biol. 48:1478–1485. Zhu, M., G. Chen, S. Zhou, et  al. 2014. A new tomato NAC (NAM/ATAF1/2/CUC2) ­transcription factor, SlNAC4, functions as a positive regulator of fruit ripening and carotenoid accumulation. Plant Cell Physiol. 55:119–135.

4 Breeding Naked Barley for Food, Feed, and Malt Brigid Meints and Patrick M. Hayes Oregon State University, Department of Crop and Soil Science, Corvallis, Oregon, USA ABSTRACT Barley (Hordeum vulgare) is a versatile crop with three principal end-uses: feed, food, and malt. Each end-use of barley requires different characteristics, but hull adherence and β-glucan content are important for each of the three classes. Most of the barley grown in the United States has an adhering hull, but a small percentage of the barley grown is hull-less, or “naked”. Naked barley shows potential as a crop that can be used for food, feed, and malt. This review covers research on breeding naked barley for multiple applications: feed, food, malting, brewing, and distilling. As a feed, naked barley contains higher levels of protein than covered barley or corn; based on numerous reports that naked barley is superior to covered barley for swine feed, breeders in Canada began breeding naked barley for swine feed in the 1970s. Barley foods are on the rebound due to fiber and whole grain nutrition health benefits. Breeders have been developing naked barley with increased levels of β-glucan for human consumption. Naked barley can present an opportunity to the malting and brewing community through significantly higher levels of malt extract and improved beer quality. Malting barley has traditionally been covered, but due to the potential advantages, breeders have begun developing naked lines specifically for brewing and distilling. Grower, producer, processer, and consumer communities with interests in innovation, health, and sustainability stand to benefit directly from breeders working to develop new multiuse barley varieties. KEYWORDS: β-glucan, Hordeum vulgare, nud, whole grains

Plant Breeding Reviews, Volume 43, First Edition. Edited by Irwin Goldman. © 2020 John Wiley & Sons, Inc. Published 2020 by John Wiley & Sons, Inc. 95

96

Brigid Meints and Patrick M. Hayes

I.  INTRODUCTION II.  THE NUD GENE III.  TRAITS OF INTEREST RELATED TO NUD IV.  SELECTING FOR β‐GLUCAN AND STARCH TYPE V.  FEED BARLEY BREEDING AND QUALITY VI.  FOOD BARLEY BREEDING AND QUALITY VII.  MALTING BARLEY BREEDING AND QUALITY VIII.  BREWING IX.  DISTILLING X.  CONCLUSIONS ACKNOWLEDGMENTS LITERATURE CITED

ABBREVIATIONS AAFC Agriculture and agri-food Canada BCE Before common era CDC Canadian development center cM Centimorgan DE Digestible energy DON Deoxynivalenol DP Diastatic power DU Dextrinizing units ERF Ethylene response factor FDA Food and drug administration FHB Fusarium head blight LDL Low‐density lipo‐proteins ME Metabolizable energy PSY Predicted spirit yield QTL Quantitative trait locus RIL Recombinant inbred line SNP Single nucleotide polymorphism I. INTRODUCTION Barley (Hordeum vulgare) is one of the oldest known domesticated crops. Originally cultivated for human consumption, other end‐uses have gained importance over time. Barley is the fourth most widely grown cereal in the world (FAO‐STAT 2016), and in 2018, approximately 2.05 million acres of barley were harvested in the United States (National Agricultural Statistics Service 2018). Barley is a versatile crop with three principal end‐uses: feed, food, and malt. Each end‐use of barley requires different characteristics, but hull adherence and β‐glucan

Breeding Naked Barley for Food, Feed, and Malt

97

content are important for each of the three classes. Most of the barley grown in the United States has an adhering hull, but a small percentage of the barley grown is hull‐less, or “naked” (the exact acreage is unknown because naked barley is currently such a minor crop). Numerous reviews have been published on the potential of naked barley for various applications (Bhatty 1986b, 1999; Newman and Newman 2008; Swanston 2014). Renewed interest in breeding naked barley for a variety of end‐ uses in the United States has prompted this latest review. II. THE NUD GENE In most barley germplasm, the hull adheres to the grain. In some barley germplasm, however, the hull does not adhere and the grain threshes clean as with wheat. These types are referred to as hull‐less or naked (the term “naked” is preferred for the sake of clarity) (Fig. 4.1). Naked barley arose by a spontaneous mutation around 6500 BCE (Swanston et al. 2011); no wild forms of naked barley have been discovered, indicating

Fig. 4.1.  Naked (left) and covered (right) barley grains. Source: Modified from Sparks and Malcolm (1978).

98

Brigid Meints and Patrick M. Hayes

that the mutation likely occurred in a domesticated covered type (Taketa et al. 2004). Adherence of the lemma and palea is determined by alleles at a single locus (nud) on chromosome 7HL (Taketa et  al. 2008). Taketa et al. (2008) used positional cloning to determine that the covered/naked phenotype is controlled by an ethylene response factor (ERF) family transcription factor gene. When the nud allele is present, the lemma and palea stick tightly to the caryopsis and remain so postharvest. The nud allele prevents the lemma and palea from sticking to the caryopsis by blocking the production of the cutaneous lipid‐based “cement” discharged from the surface of the pericarp that is responsible for adhering the hull and seed in covered barleys (Swanston et al. 2011). This cementing substance appears at approximately 16 days after pollination, but the hulls and pericarp do not make contact until grain filling is nearly complete, about 10 days before the kernel reaches its largest size (Newman and Newman 2008). In a naked barley, the hull is loosely attached and is mostly removed during harvest. The adhering hull accounts for approximately 10–13% of the weight of harvested barley grain (Rey et al. 2009). The hull is made up primarily of cellulose, lignin, and silica (Newman and Newman 2008). Therefore, as a result of the nud allele, naked barley generally contains greater levels of protein, starch, and total and soluble β‐glucan than covered barley as a result of the dilution effect of the fibrous hull on these components (Bhatty 1999; Newman and Newman 2008). Isogenic lines were created by Xue et  al. (1997) to look at the genetic effect of the naked gene. They also saw a dilution effect on nutrients as a result of  the hull. Additionally, they saw a reduction in kernel weight and % plump kernels (P 60% of the commercial vegetable seed industry. More than 200 trait patent

APPLICATION OF INTELLECTUAL PROPERTY PROTECTION

189

families are covered, which represents >60% of all vegetable trait patents. A second platform to include field crops is under development. In 2013 Syngenta also launched an e‐licensing platform (http://www. traitability.com/) with the objective “to become the iTunes of plant patents. It is one stop shopping for fair prices and with as much transparency as possible” (Gould 2013). DuPont Pioneer seeks to make additional use of the germplasm, laboratory, and field testing technologies, and expertise developed in‐house through collaborations with third parties via an “open‐innovation” website at https://openinnovation.pioneer.com/. DuPont Pioneer and the Broad Institute of MIT and Harvard have also announced “an agreement to jointly provide non‐exclusive licenses to CRISPR‐ Cas9 intellectual property under their respective control for use in commercial agricultural research and product development…. Such foundational intellectual property (IP) for CRISPR‐Cas9 technology will be freely available to universities and nonprofit organizations for academic research” (https://www.broadinstitute.org/news/dupont‐ pioneer‐and‐broad‐institute‐join‐forces‐enable‐democratic‐crispr‐ licensing‐agriculture October 2017). Bayer (2018) introduced an “open innovation” program to “complement in‐house expertise with the know‐how of … partners from academia and industry.” Forms of cooperation include “traditional licensing agreements or strategic research alliances to public‐private partnerships as well as crowdsourcing.” Another approach to facilitating access to patented inventions is through the formation of patent pools (Vermeulen 2013) (https:// www.forbes.com/sites/freekvermeulen/2013/01/22/patent‐pools‐do‐ they‐kill‐innovation/#21f09b0b58f4). However, use of patent pools requires careful consideration and are subject to regulatory clearance (Rodriguez 2010). B.  Other Lessons Learned Each country, and possibly each region, has its own history, cultural identity, beliefs, and body of traditional knowledge or experiences. Superimposed on this diversity are socioeconomic changes including those brought about by increased and faster communications, economic factors, globalization, and patterns of urban migration. Experience has demonstrated that it is impossible to find one specific form of IP that could be implemented with exactly the same detailed provisions that would then be equally capable to contribute to increase social welfare in each of these diverse circumstances (Reid 1992; World Bank 2006;

190

Stephen Smith

Cotter 2013; Batur and Dedeurwaerdere 2014; Halpert and Chappell 2018). It is important, therefore, for students, developers, and practitioners of IPR, to take advantage of learning from the diverse global smorgasbord of IPR experiences including: (1) different types of IPR, (2) implemented in different ways, among (3) different farming and rural communities ranging from subsistence to “industrial” farming, (4) across a range of seed supply networks, and (5) with a diversity of suppliers ranging from farmers themselves to publicly funded plant breeders, participatory farmer‐plant breeders, and seed producers, including NGOs, NARIs, IARCs, and commercial plant breeders (Tansey 1999; Dhar 2002). Other critical lessons learned (Tansey 1999; Dhar 2002; Tripp et al. 2006; DeJonge 2014; DeJonge et al. 2015; DeJonge and Munyi 2016, 2017) include: (1) IPRs are not a silver bullet per se for commercial seed industry development (World Bank 2006), (2) other enabling factors must be present including seed regulations, effective legal systems, available credit and supply of non‐seed inputs, available markets for farm produce, and promotion of responsible business practices, (3) support is required from the full‐range of stakeholders including breeders, seed producers, traders, and farmers, (4) much greater understanding is required of complex seed systems to allow further development of strategies that will result in plant breeders being able to work within such systems to reach farmers, including using farmer participatory approaches (McGuire 2008; Coomes et al. 2015; McGuire and Sperling 2016; Spielman and Kennedy 2016), (5) flexibility in implementation of both IP and seed laws is required both among and within countries, and between crops to accommodate both non‐commercial subsistence and commercial agriculture; not all crops initially need to be covered by PVP (World Bank 2006; DeJonge 2014; DeJonge et al. 2015; DeJonge and Munyi 2016, 2017), (6) cost effective, pragmatic, educational, implementation, and enforcement capabilities are required, (7) there are implications for the continued roles that the NARIs play as they face competition for breeding in crops that attract the commercial sector, (8) there are also implications for how international centers of the CGIAR undertake research and deploy improved varieties, and (9) for maximum effectiveness, seed laws should be implemented so that they are harmonious with the goals and flexibilities provided by implementation of IPRs. Improved management of Utility Patents by commercially funded organizations in the U.S. and Europe employing licensing, allowance of third parties to own IP, and free provision of technologies for use in developing countries, including for humanitarian use, provides further synergies to the continued creation and deployment

APPLICATION OF INTELLECTUAL PROPERTY PROTECTION

191

of innovative plant varieties and associated technologies. Additional lessons can be learned of gaps that need to be filled following privatization of research and plant breeding institutes that were formally funded publicly (Galushko and Gray 2013). The tradition of considering, developing, and evaluating new IPR models will likely continue. Globally, experiences with implementations of various forms of intellectual property protection, becoming better acquainted with seed systems and needs of farmers in developing countries, and outcomes following privatization of public programs in the fields of plant breeding and agriculture within and across a diversity of technological and socioeconomic circumstances, provide rich educational resources that can inform future choices. These may include further revisions of UPOV, new sui generis systems, various forms of implementing utility patents, and other possible approaches (Stiglitz,2008; Kloppenburg 2010; Batur and Dedeurwaerdere, 2014; Van Overwalle 2015). There is much to observe and to learn from the global laboratory of IPR, which comprises decades of use of diverse and complementary forms of IP systems in the field of plant breeding (Llewelyn and Adcock 2006, ISF 2012; Cotter 2013; Lence et al. 2015). Although a perfect system IPR is probably unattainable, further development can be informed by the growing body of experience, especially when tempered with pragmatism. The long‐term public good nature of PGRFA, the multilateral dependencies of nations upon those resources, and the need for practical rather than purely academic dogmatic solutions should also be essential guiding principles in the development and implementation of IPR policy. Overall, a global approach to the use of IPR in plant breeding can recognize high‐level principles with the rubric that “no one size fits all” (ISF 2012), as also concluded by Campi (2017). The global technology, information, research, and business environments are rapidly changing, which, in turn, requires an enlargement and evolution in the practice of IPR in the economy and in society as a whole (Gurry 2013). Within this larger framework, IPR in the critically important fields of plant breeding and agriculture is, and will continue to be, subject to scrutiny, debate, and evolution. At the end of the day, the level of success achieved by the management of IPR should be measured by its ability to help provide a win‐win for all stakeholders, including future generations. The contributions and sustainability of agriculture depend upon the effective conservation and use of plant genetic resources in the service of human health, economic well‐being, and the environment. The development and implementation of appropriate policies to support the positive contributions that all stakeholders

192

Stephen Smith

require from agriculture has, and will inevitably continue to require, a dynamic process of IPR management. At the very least, “The best we can do is reduce the built‐in inequities and imbalances. It is extremely doubtful that we can remove them completely. Nonetheless, we should not give up trying” (Dutfield 2017). LITERATURE CITED ADAS. 2015. Review of the objectives of modern plant breeding and their relation to agricultural sustainability. Ref. no. CSF1046. RSK ADAS Ltd. Helsby, U.K. 71 pp. http://www.plantbreedingmatters.com/sg_userfiles/Report.pdf. Adato, M. and R. Meinzen‐Dick. 2007. Introduction: Evolving concerns in the study of impact. p. 1–19. In: M. Adato and R. Meinzen‐Dick (eds.), Agricultural research, livelihoods, and poverty. Johns Hopkins University Press, Baltimore, MD. Alston, J.M. and R.J. Venner. 2002. The effects of the US Plant Protection Act on wheat genetic improvements. Res. Pol. 31:527–542. Alston, J.M., R.S. Gray, and K. Bolek. 2012. Farmer‐funded R&D: Institutional innovations for enhancing agricultural research investments. Working Paper. Canadian Agricultural Innovation and Research Network. http://www.aginnovation.usask.ca/ cairn_briefs/publications%20for%20download/CAIRN_2 420 012_FarmerFundedRD_ AlstonGrayBolek.pdf (accessed November 16, 2014). Alvarez, N., E. Garine, C. Khasah, et  al. 2005. Farmers’ practices, metapopulation dynamics, and conservation of agricultural biodiversity on‐farm: A case study of sorghum among the Duupa in sub‐Sahelian Cameroon. Biol. Cons. 121:533–543. Anderson, C. 2017. A blessing and a curse: Plant Variety Protection Act Enforcement. Filewrapper. McKee, Voorhees, and Sease, PLC, Des Moines, IA. Posted March 31, 2017. https://www.filewrapper.com/filewrapper/a‐blessing‐and‐a‐curse‐plant‐variety‐ protection‐act‐enforcement?filewrapper=true. Anonymous. 1907. “Copyright” for raisers of novelties. p. 474–475. In: W. Wilks (ed.), Report of the Third International Conference 1906 on Genetics, hybridisation (the cross‐breeding of genera or species), the cross‐breeding of varieties and general plant breeding. Royal Horticultural Society, London. Anthon, C. 1841. A classical dictionary: Containing an account of the principal proper names mentioned in ancient authors, and intended to elucidate all the important points connected with the geography, history, biography, mythology, and fine arts of the Greeks and Romans together with an account of coins, weights, and measures, with tabular values of the same. Harper & Bros., New York. 1451 p. Aoki, K. 2009. “Free seeds, not free beer”: Participatory plant breeding, open source seeds, and acknowledging user innovation in agriculture. Fordham Law Rev. 77:101–136. ASARECA. 2010. Policy Brief on counterfeit and illegal plant protection products, and fake or expired seeds, and fertilizers. Entebbe: Association for Strengthening Agricultural Research in Eastern and Central Africa (ASARECA). USAID‐EAT Project, 10 p. Ashour, M., L. Billings, D.O. Gilligan, and N. Karachiwalla. 2015. An evaluation of the impact of E‐verification on counterfeit agricultural inputs and technology adoption in Uganda. Int. Food Pol. Res. Inst., Washington, DC. 129 p. Assembly of First Nations. nd. Traditional knowledge. AFN Environmental Stewardship. Assembly of First Nations, Ottawa. 2 p. https://www.afn.ca/uploads/files/env/ ns_‐_traditional_knowledge.pdf.

APPLICATION OF INTELLECTUAL PROPERTY PROTECTION

193

Astee Flowers B.V. v. Danziger “Dan” Flower Farm. 2005. Case 198763, Court of The Hague, Netherlands. Avent, T. 2005. Name that plant—The misuse of trademarks in horticulture. Plant Delights Nursery, Inc., Raleigh, NC. Published January 2005. https://www.plantdelights.com/ blogs/articles/name‐that‐plant. Babcock, B.A., and W.E. Foster. 1991. Measuring the potential contribution of plant breeding to crop yields: Flue‐cured tobacco, 1954–87. Am. J. Agric. Econ. 73:850–859. Barnaud, A., H.I. Joly, D. McKey. 2008. Gestion des ressources génétiques du sorgho (Sorghum bicolor) chez les Duupa (Nord Cameroun). Cahiers Agric. 17:178–182. Barnes, D.W. 2011. Congestible intellectual property and impure public goods. Northwestern J. Tech. & Intell. Prop. 9:533–563. http://scholarlycommons.law.northwestern. edu/njtip/vol9/iss8/. Batur, F., and T. Dedeurwaerdere. 2014. The use of agrobiodiversity for plant improvement and the intellectual property paradigm: institutional fit and legal tools for mass selection, conventional and molecular plant breeding. Life Sciences, Society and Policy 10:14. 10.1186/s40504‐014‐0014‐7. Bayer. 2017. Bayer invests $8.1 million in soybean advancement in the Midwest. Posted March 16, 2017. https://www.cropscience.bayer.us/news/press‐releases/2017/03162017‐ new‐soybean‐research‐station‐increases‐access‐to‐new‐technology. Bayer. 2018. Open innovation at Bayer. Posted March 7, 2018. https://www.bayer.com/ en/open‐innovation.aspx. BBRSC. 2014. The Biotechnology and Biological Sciences Research Council (BBSRC) policy for knowledge exchange and commercialisation. Swindon, U.K. 5 p. https:// bbsrc.ukri.org/documents/knowledge‐exchange‐commercialisation‐policy‐pdf/ Becerril, J., and A. Abdulai. 2010. The impact of improved maize varieties on poverty in Mexico: A propensity score‐matching approach. World Dev. 38:1024–1035. Begeman, S. 2016. Same seed, different bag: Diversity helps spread risk. Are you as diverse as you think? AG WEB Farm Journal, posted July 13, 2016. https://www.agweb. com/article/same‐seed‐different‐bag‐naa‐sonja‐begemann/. Begeman, S. 2017a. Seed company shifts underway. Ag WEB Farm Journal, posted November 28, 2017. https://www.agweb.com/article/seed‐company‐shifts‐underway‐ naa‐sonja‐begemann/. Begeman, S. 2017b. What to do when identical genetics cross brands. AG WEB, Farm Journal, posted October 16, 2017. https://www.agweb.com/article/what‐to‐do‐when‐ identical‐genetics‐cross‐brands‐naa‐sonja‐begemann/. Bergadá, P., M.A. Rapela, R. Enriquez, et al. 2016. Generating value in the soybean chain through royalty collection: An international study. Int. Seed Fed., Nyon, Switzerland. 64 p. http://www.worldseed.org/wp‐content/uploads/2016/12/ISF_International‐ Soybean_Study_2016.pdf. Bessen, J.E., and E.S. Maskin. 2000. Sequential innovation, patents, and imitation (January 2000). MIT Department of Economics Working Paper No. 00‐01. 3 p. Harvard University, Cambridge, MA. Available at SSRN: https://ssrn.com/abstract=206189 or 10.2139/ssrn.206189. Bill and Melinda Gates Foundation. 2015. Counterfeiting in African agriculture inputs— challenges & solutions. Workshop in Nairobi, Kenya, on February 14, 2014. Bill and Melinda Gates Foundation, Seattle, WA. Blakeney, M. 2009. Intellectual property rights and food security. CABI, Wallingford, U.K. 266 p. Blakeney, M. L., and G. Mengistie. 2011. Intellectual property and economic development in Sub‐Saharan Africa. J. World Int. Prop. 14:238–264. doi: 10.1111/j.1747‐1796.2011.00417.x.

194

Stephen Smith

Bohning, K.B. 2010. United States Patent: Inbred corn line BE9513 U.S. 7,714,203. United States Patent Office, Alexandria, VA. Bohning, K.B. 2016. United States Patent: Inbred corn line SLB22 U.S. 9,288,955 B1. United States Patent Office, Alexandria, VA. Bohning, K.B. 2018. United States Patent: Inbred corn line XHB03 U.S. 10,117.393. United States Patent Office, Alexandria, VA. Bold, T., K.C. Kaizzi, J. Svensson, and D. Yanagizawa‐Drott (2015). Low quality, low returns, low adoption: Evidence from the market for fertilizer and hybrid seed in Uganda. Faculty Research Working Paper Series, Harvard Kennedy School of Government, Harvard University, Cambridge, MA, USA. 25 p. Bolongaro, K. 2018. Edam it! The taste of cheese cannot be copyrighted, court told. ECJ advised in legal opinion not to add taste of food to copyright rules. Politico July 25, 2018. https://www.politico.eu/article/edam‐it‐the‐taste‐of‐cheese‐cannot‐be‐copyrighted‐ court‐told/. Bordwin, H.J. 1985. The legal and political implications of the International Undertaking on Plant Genetic Resources. Ecol. Law Quarterly. Issue 4, Article 12. 19 p. Available at: http://scholarship.law.berkeley.edu/elq/vol12/iss4/12. Boundless. 2017. Monsanto and Boundless collaborate for open source GIS contributions. Posted December 5, 2017. https://boundlessgeo.com/press_releases/monsanto‐boundless‐ collaborate‐open‐source‐gis‐contributions/. Boztosun, N.A.O. 2010. Exploring the utility of utility models to foster innovation. J. Int. Prop. Rights 15:429–439. Bragdon, S. 2004. International Law of Relevance to Plant Genetic Resources: A practical review for scientists and other professionals working with plant genetic resources. Issues in Genetic Resources No. 10, Int. Plant Gen. Res. Inst., Rome, Italy. 125 p. Brayne, S., K. Tzafestas, R. Ashton, and B. Pattni. 2016. Gene editing technology: ­Market assessment and intellectual property landscape. IP Pragmatics Ltd., London. 64 p. https://www.ip‐pragmatics.com/media/1024/ip‐pragmatics‐gene‐editing‐white‐ paper_june‐2016.pdf. Brown, W.L. 1984. The coming debate over ownership of plant germplasm. p. 44–51. In: Proceedings of 39th Annual Corn and Sorghum Research Conference, Chicago. American Seed Trade Association, Alexandria, VA. BSPB. nd. Safeguarding future innovation. http://www.fairplay.org.uk/. British Society of Plant Breeders, Ely, U.K. https://www.bspb.co.uk/BSPB_Plant_Breeding_Matters_ Spring_2017.pdf. BSPB. 2015. Fair Play Campaign—ten years on. Plant breeding matters. British Society of Plant Breeders. Ely, U.K. 6 p. https://www.bspb.co.uk/sg_userfiles/BSPB_Plant_ Breeding_Matters_Spring_2015.pdf. BSPB. 2017. Plant breeding matters. British Society of Plant Breeders, Ely, U.K. https:// www.bspb.co.uk/BSPB_Plant_Breeding_Matters_Spring_2017.pdf Bush, C.S., G. Bettle, and J.L. Rutzinski. 2002. United States Patent. Process for reducing flatulence in legumes. Patent No. 6,465,031. United States Patent Office, Alexandria, VA. Button, P. 2011. The UPOV Convention: An International Standard. EU plant variety rights in the 21st century, Conference on the outcome of the evaluation of the Community Plant Variety Rights Regime. Brussels, October 11, 2011. UPOV, Geneva, Switzerland. 44 p. https://ec.europa.eu/food/sites/food/files/plant/plant_property_ rights/conference/docs/conf_11102011_10_30_upov_en.pdf. Butler, L.J. and B.W. Marion. 1985. The impacts of patent protection on the US seed industry and public plant breeding. North Central Reg. Res. Pub. 304 (University of Wisconsin‐Madison, Madison, WI. 1985).

APPLICATION OF INTELLECTUAL PROPERTY PROTECTION

195

Caillon, S., and P. Degeorges. 2007. Biodiversity: negotiating the border between nature and culture. Biodivers. Conserv. 16:2919–2931. Campbell, B T, D. Boykin, Z. Abdo, and W.R. Meredith, Jr. 2014. Cotton. p. 13–32. In: S. Smith, B. Diers, J. Specht, and B. Carver (eds.), Yield gains in major U.S. field crops. CSSA Special Publication 33. Crop Science Society of America, Madison, WI. Campi, M. 2017. The effect of intellectual property rights on agricultural productivity. Agric. Econ. 48:327–339. Cao, H.X., W. Wang, H.T.T. Le, and G.T.H. Vu. 2016. The power of CRISPR‐Cas9‐induced genome editing to speed up plant breeding. Int. J. Genomics. vol. 2016. Article ID 5078796, 10 p. Carew, R., E.G. Smith, and C. Grant. 2009. Factors influencing wheat yield variability: Evidence from Manitoba. Can. J. Ag. Appl. Econ. 41:625–639. Carew, R., and S. Devadoss. 2003. Quantifying the contribution of plant breeders’ rights and transgenic varieties to canola yields: Evidence from Manitoba. Can. J. Ag. Econ., 51:371–395. CBD Secretariat. 2011. Nagoya protocol on access to genetic resources and the fair and equitable sharing of benefits arising from their utilization to the Convention on iological diversity: text and annex/Secretariat of the Convention on biological diversity. CBD, Montreal. 25 p. CGIAR. 1999. CGIAR Center statements on genetic resources, Intellectual Property Rights, and Biotechnology. CGIAR, Rome. 40 p. CGIAR. 2006. CGIAR research strategies for IPG in a context of IPR Report and recommendations based on three studies. CGIAR, Rome. 64 p. CGIAR. 2012. CGIAR principles on the management of intellectual assets. Rome, Italy. 11 p. CGIAR–IEA 2017. Review of CGIAR principles on the management of intellectual assets. Independent Evaluation Arrangement (IEA) of CGIAR, Rome, Italy. http://iea.cgiar.org/. Chakrabarty, A.M. 2010. Bioengineered bugs, drugs and contentious issues in patenting. Bioeng. Bugs. 1: 2–8. doi: 10.4161/bbug.1.1.9850 DOI:10.4161%2Fbbug.1.1.9850#pmc_ext. Charnley, B. 2013. Seeds without patents: Science and morality in the British plant breeding in the long nineteenth‐century. Rev écon. 64:69–87. Charnley, B., and G. Radick. 2013. Intellectual property, plant breeding and the making of Mendelian genetics. Studies in history and philosophy of science Part A. Elsevier, Amsterdam. 52 p. 10.1016/j.shpsa.2012.11.004. Chen, J.M. 2014. An agricultural law Jeremiad: The harvest is past, the summer is ended, and seed is not saved. Wisc. Law Rev. 2014:235–264. Chesbrough, H. 2003. Open innovation: The new imperative for creating and profiting from technology. Harvard Business School Press, Cambridge, MA. Christinck, A., and M.W. Tvedt. 2015. The UPOV Convention, Farmers’ rights and human rights. An integrated assessment of potentially conflicting legal frameworks. Deutsche Gesellschaft für Int. Zusammenarbeit. Bonn, Germany. 104 p. CIMMYT. 2009. CIMMYT Intellectual Property Policy. El Batán, Mexico. 4 p. https:// www.cimmyt.org/wp‐content/uploads/2016/05/CIMMYT‐Intellectual‐Property‐ Policy‐Apr‐2009.pdf CJEU. 2018. Affaire C‐310/17 Levola Hengelo BV contre Smilde Foods BV, Conclusions of the Advocate General M. Melchior Wathelet. 18 p. Cleveland, D.A., and S.C. Murray. 1997. The World’s crop genetic resources and the rights of indigenous farmers. Curr. Anthropol. 38, no. 4. Cohen, J.I. 2000. Managing intellectual property–Challenges and responses for agricultural research institutes. Agricultural biotechnology and the poor. p. 209–220. In: G.J. Persley and M.M. Lantin (eds.), Agricultural biotechnology and the poor: Proceedings of the International Conference, Washington, D.C., 21–22 October 1999.

196

Stephen Smith

Coomes, O.T., and N. Ban. 2004. Cultivated plant species diversity in home gardens of an Amazonian peasant village in northeastern Peru. Econ. Bot. 58:420–434. Coomes, O.T., S.J. McGuire, E. Garine et al. 2015. Farmer seed networks make a limited contribution to agriculture? Four common misconceptions. Food Pol. 56:41–50. Cornell Law School. nd. Legal Information Institute. Intellectual property. https://www. law.cornell.edu/wex/intellectual_property. Correa, C. 2012. TRIPS‐related patent flexibilities and food security options for developing countries policy guide. Quaker United Nations Office (QUNO) and International Centre for Trade and Sustainable Development (ICTSD). Geneva. 32 p. Correa, C., S. Ahashikant, and F. Meienberg. 2015. Plant variety protection in developing countries: A tool for designing a sui generis plant variety protection system: An alternative to UPOV, 1991. APREBES, Bonn, Germany. 94 p. Cotter, T.F. 2013. Comparative patent remedies: A legal and economic analysis. Oxford University Press. 452 p. CPVO. 2015. Report of the ad‐hoc legal working group to the administrative council. Summary of discussions June 2012–January 2015. DOC‐AC‐2015‐1‐16‐Annex 1‐EN. Community Plant Variety Office, Angers, France. 68 p. http://cpvoextranet.cpvo. europa.eu/data/acarea/documents/ACLW2015/1025/REPORT%20Ad%20Hoc% 20LWG%20to%20AC.pdf. Craviotti, C. 2018. Agrarian trajectories in Argentina and Brazil: Multinational seed firms and the South American soybean chain. Globalizations.15:56–73. doi: 10.1080/14747731.2017.1370274. Curtis, F., and M. Nilsson. 2012. Collection systems for royalties in soft wheat: An international study. International Seed Federation, Nyon, Switzerland. 31 p. www.worldseed. org/wp…/Royalty_Collection_Breeders_Remuneration_Study.pdf. Danziger v. Azolay & Astee Flowers. 2009. 001228/03, District Court, Tel‐Aviv‐Jaffa, Israel (5 March 2009). Danziger “Dan” Flower Farm v. Astee Flowers B.V. 2009. 105.003.932/01, Court of Appeal, The Hague, The Netherlands. Das, S.K., and H.H.P. Cohly 1995. U.S. Patent. Use of turmeric in wound healing. U.S. Patent No. 5,401,504. U.S. Patent Office, Arlington, VA. David, S., and L. Sperling. 1999. Improving technology delivery mechanisms: Lessons from bean seed systems research in eastern and central Africa. Agric. Human Values 16:381–388. Defoe, D. 1724–1726. A tour through the whole island of Great Britain. P. Rogers (ed.). Penguin. 736 p. ISBN 978‐0140430660. De Jonge, B., G. Tumushabe, J. Barungi, and N. Louwaars. 2011. Agricultural seeds that reduce hunger and poverty—Policies, perceptions and practices in intellectual property rights. In: W. van Genugten, A. Meijknecht, B. Maister, et  al. (eds.), Harnassing intellectual property rights for development objectives. Wolf Legal Publishers, Nijmegen, The Netherlands. De Jonge, B. 2014. Plant variety protection in Sub‐Saharan Africa: Balancing commercial and smallholder farmers’ interests. J. Pol. Law 7:100–111. De Jonge, B., N.P. Louwaars, and J. Kinderlerer. 2015. A solution to the controversy on plant variety protection in Africa. Nature Biotech. 33:487–488. doi: 10.1038/ nbt.3213. De Jonge, B., and P. Munyi. 2016. A differentiated approach to plant variety protection in Africa. J. World Intel. Prop. 19:28–52. De Jonge, B., and P. Munyi. 2017. Creating space for “informal” seed systems in a plant variety protection system that is based on UPOV 1991. ISSD Africa Synthesis Paper. 12 p.

APPLICATION OF INTELLECTUAL PROPERTY PROTECTION

197

Delêtre, M., D.B. McKey, and T.R. Hodkinson. 2011. Marriage exchanges, seed exchanges, and the dynamics of manioc diversity. PNAS 108:18249–18254. 10.1073/ pnas.1106259108. DeLuca, D.L., W.S. Sparks, and D.R. DeLuca. 2000. U.S. Patent No. 6,093,421. Maca and antler for augmenting testosterone levels. U.S. Patent Office, Alexandria, VA. Demeulenaere, E., and C. Bonneuil. 2011. Des semences en partage: construction sociale et identitaire d’un collectif “paysan” autour de pratiques semencières alternatives. Tech. Cult. 57:202–221. Dempewolf, H., G. Baute, J. Anderson, et al. 2017. Past and future sse of wild relatives in crop breeding. Crop Sci. 57:1070–1082. doi: 10.2135/cropsci2016.10.0885. Devaiah, V. nd. A history of patent law. Alternative Law Forum. http://altlawforum.org/ publications/a‐history‐of‐patent‐law/. Dhar, B. 2002. Sui generis systems for plant variety protection: Options under TRIPS, A  Discussion Paper Quaker. http://homepages.3‐c.coop/tansey/pdfs/sg‐col1.pdf. Quaker United Nations Office, Geneva, Switzerland. 32 p. Diez, M.C.F. 2002. The impact of plant varieties rights on research: The case of Spain. Food Pol. 27:171–183. Douaud, C. 2007. Naturex eases maca patents for benefit of Peruvian growers. William Reed Business Media Ltd., Crawley, U.K. https://www.nutraingredients.com/Article/ 2007/06/20/Naturex‐eases‐maca‐patents‐for‐benefit‐of‐Peruvian‐growers#. Doudna, J.A., and S.H. Sternberg. 2017. A crack in creation: Gene editing and the unthinkable power to control evolution. Mariner Books, Houghton Miflin, New York. 281 p. Doyle, K. 2015. Open‐source plant breeding: New freedom for farmers. Posted May 20, 2015. Am. Soc. Agron., Madison, WI. https://www.agronomy.org/story/open‐source‐ plant‐breeding‐new‐freedom‐farmers. Dubock, A. 2014. The politics of Golden Rice. GM Crops & Food 5:210–222. doi.org/ 10.4161/21645698.2014.967570. Dunwell, J.M. 2005. Review: Intellectual property aspects of plant transformation. Plant Biotech. J. 3:371–384. Dutfield, G. 2011. Food, biological diversity and intellectual property. Global Economic Issue Publications Intellectual Property, Issue Paper Number 9. Quaker United Nations Office. 24 p. Convention. Dutfield, G. 2014. Traditional knowledge, intellectual property and pharmaceutical innovation: What’s left to discuss? p. 649–664. In: D.M. and D. Halbert (eds.), The Sage handbook of intellectual property. Sage, Washington, DC. Dutfield, G. 2017. Intellectual property rights and the life sciences industries: A twentieth century history. Routledge, London. 304 p. Duvick, D.N. 2005. The contribution of breeding to yield advances in maize (Zea mays L.). Adv. Agron. 86:83–145. Eaton, D.J.F., E. Kalaugher, and J. Bijman. 2004. International agreements relating to plant genetic resources for food and agriculture and implications for Dutch policy. Rep. Series 29132, Agric. Econ. Res. Inst., The Hague, The Netherlands. 64 p. Eaton, D., N. Louwaars, and R. Tripp. 2006. Intellectual property rights for agriculture in international trade and investment agreements: A plant breeding perspective. Agricultural Rural Development Notes, No. 11. World Bank, Washington, DC. 4 p. Economist. 1851. Amendment of the patent laws. The Economist, Weekly Commercial Times, Bankers Gazette, and Railway Monitor, A political, literary, and general newspaper. 9:811–812. Edgerton, M.D. 2009. Increasing crop productivity to meet global needs for feed, food, and fuel. Plant Physiol. 149:7–13. doi: 10.1104/pp.108.130195.

198

Stephen Smith

Edwards, J. 2016. In Iowa corn fields, Chinese national’s seed theft exposes vulnerability. Reuters posted April 11, 2016. https://www.reuters.com/article/us‐usa‐china‐seeds/ in‐iowa‐corn‐fields‐chinese‐nationals‐seed‐theft‐exposes‐vulnerability‐ idUSKCN0X80D6. Egan, E.J., and D.J. Teese. 2015. Untangling the patent thicket literature. Working Paper No. 7, Tusher Center for Management of Intellectual Capital. Rice University, Houston, TX. 40 p. http://www.bakerinstitute.org/research/untangling‐patent‐thicket‐literature/. Egelie, K.J., G.D. Graff, S.P. Strand, and B. Johansen. 2016. The emerging patent landscape of CRISPR–Cas gene editing technology. Nature Biotech. 34:1025–1031. Egelyng, H. 2005. Evolution of capacity for institutionalized management of intellectual property at International Agricultural Research Centers: A strategic case study. AgBioForum, 8:7–17. Ehlers, J.D., and M.H. Sterner. 2000. U.S. Patent No. 6,040,503: Bean‐nut popping beans. U.S. Patent Office, Arlington, VA. Ekvad, M. 2008. Contracts in relation to plant breeder’s rights. UPOV Symposium [online]. Available at: http://www.upov.int/news/en/2008/4_Ekvad.pdf. Elangovan, M. and K.b. Perumalla. 2013. Managing intellectual property under PVP & PGR IP assets of private seed company–Monsanto. https://www.researchgate.net/ publication/258031916_Managing_Intellectual_Property_under_PVP_PGR_IP_assets_ of_private_seed_company_‐_Monsanto. Eligon, J., and P. Zuo. 2014. Designer seed thought to be latest target by Chinese. New York Times. Posted February 4, 2014. https://www.nytimes.com/2014/02/05/us/ chinese‐implicated‐in‐agricultural‐espionage‐efforts.html. EPO. 2017. Biotechnology Patents at the EPO. Updated July 2017. European Patent Office, Munich. https://www.epo.org/news‐issues/issues/biotechnology‐patents.html. ESA. 2014. ESA reply to the public consultation on the implementation and ratification of the Nagoya protocol on access to genetic resources and the fair and equitable sharing of benefits arising from their utilization to the Convention on biological diversity. ESA_11.0919. Posted 4, 21 December 2011. European Seed Association, Brussels. 19 p. https://www.euroseeds.eu/system/files/publications/files/esa_11.0919.4.pdf. ESA. 2015. Commercialized varieties ESA in the context of the Convention on biological diversity. Doc. 15.0562.2. Posted 03.09.2015. European Seed Association, Brussels. 5 p. https://www.euroseeds.eu/system/files/publications/files/esa_15.0562.2.pdf. European Commission. 2012. Value of production of agricultural products and foodstuffs, wines, aromatised wines and spirits protected by a geographical indication (GI), Tender no. AGRI–2011–EVAL–04 2012. EU Commission, Brussels, Belgium. https://ec.europa. eu/agriculture/sites/agriculture/files/external‐studies/2012/value‐gi/final‐report_en.pdf. European Union Commission. 2013. Geographical‐indications. http://ec.europa.eu/ trade/policy/accessing‐markets/intellectual‐property/geographical‐indications/. Esquinas‐Alcazar, J., A. Hilmi, and I.L. Noriega. 2005. A brief history of the negotiations on the International Treaty on Plant Genetic Resources for Food and Agriculture. p. 135–149. In: M. Halewood, I. Noriega, and S. Louafi (eds.)., Crop genetic resources as a global commons: Challenges in international law and governance. Routledge, Oxford. Fairlie, S. 2009. A short history of enclosure in Britain. The Land Magazine, Bridport, Dorset, U.K. http://www.thelandmagazine.org.uk/articles/short‐history‐enclosure‐britain. FBI. 2016. Protecting vital assets: Pilfering of corn seeds illustrates intellectual property theft. Posted December 19, 2016. https://www.fbi.gov/news/stories/sentencing‐in‐ corn‐seed‐intellectual‐property‐theft‐case. Feeny, D., F. Berkes, B.J. McCay, and J.M. Acheson. 1990. The tragedy of the commons: Twenty‐two years later. Human Ecol. 18:1–19.

APPLICATION OF INTELLECTUAL PROPERTY PROTECTION

199

Filomeno, F.A. 2013. How Argentine farmers overpowered Monsanto: The mobilization of knowledge‐users and intellectual property regimes. J. Pol. Latin Am. 5:35–71. Filomeno, F.A. 2014. Monsanto and intellectual property in South America. Springer. 187 p. Flattery‐O’Brien J. 2015. Protecting your turf with trademarks and plant breeder’s rights. Shelston IP intellectual property: Mind to market. Posted August 5, 2015. https://www. shelstonip.com/news/protecting‐your‐turf‐with‐trade‐marks‐and‐plant‐breeders‐rights/. Foster, W.E. and R. Perrin, 1991. Economic incentives and plant breeding research. NC State University, Department of Agricultural Economics, Faculty working papers, DARE: 91‐05, May. Fowler, C. 1994. Unnatural selection. Technology, politics, and plant evolution. Gordon and Breach, Yverdon, Switzerland. 317 p. Fowler, C., and R.L. Lower. 2005. Politics of plant breeding. Plant Breed. Rev. 25:21–55. Fowler, C., M. Smale, and S. Gaiji. 2000. Germplasm flows between developing countries and the CGIAR: An initial assessment. Global Forum on Agricultural Research (GFAR), Rome: GFAR Secretariat/FAO. 25 p. http://www.fao.org/docs/eims/upload/206939/ gfar0065.PDF. Fowler, C., M. Smale, and S. Gaiji. 2001. Unequal exchange? Recent transfer of agricultural resources and their implications for developing countries. Dev. Pol. Rev. 19:181–204. Fuglie, K., M. Clancy, P. Heisey, and J. Macdonald. 2017. Research, productivity, and output growth in U.S. agriculture. J. Agric. Appl. Econ. 49:514–554. Galushko, V., and R. Gray. 2013. Privatization of crop breeding in the UK: Lessons for other countries. Paper prepared for presentation at the 87th Annual Conference of the Agricultural Economics Society, University of Warwick, United Kingdom, 8–10 April 2013. 28 p. https://ageconsearch.umn.edu/bitstream/158859/2/Richard_Gray_ Galushko‐Gray%20AES%20Warwick.pdf. Gao, C. 2018. The future of CRISPR technologies in agriculture. Nature Rev. Mol. Cell Biol. 19:1–2. doi: 10.1038/nrm.2018.2. Garing, F. 2004. United States Patent. U.S. 6,855,877 B2, Inbred corn plant 85DGD1 and seeds and other publications thereof. U.S. Patent Office, Arlington, VA. Gautam, P.L., S.A. Kumar, S. Manoj, and P.K. Singh. 2012. Indian Journal of Plant Genetic Resources. vol. 25, Issue: 1 Print ISSN: 0971‐8184. Online ISSN: 0976‐1926. GEM. 2017. Germplasm enhancement of maize. Iowa State University. http://www.public. iastate.edu/~usda‐gem/GEM_Project/ GEM_Project.htm (accessed 9 April 2017). Genoways, T. 2015. Corn wars. The new republic. Posted August 16, 2015. https:// newrepublic.com/article/122441/corn‐wars. Gepts, P. 2004. Who owns biodiversity, and how should the owners be compensated? Plant Physiol. 134:1295–1307. doi: 10.1104/pp.103.038885. Gervais, D.J. 2005. Traditional knowledge & intellectual property: A Trips‐compatible approach. Michigan state law review, p. 137, Spring 2005. Available at SSRN: https:// ssrn.com/abstract=507302. Giovanni F., S. Kimura, H.‐M. Tso, and J. Yi. 2017. Petty patents around the world. OSHALIANG Intellectual Property Law, Houston, TX. Posted 27 February. https://oshaliang. com/newsletter/petty‐patents‐around‐the‐world/. Goss, P.J. 1996. Guiding the hand that feeds: Toward socially optimal appropriability in agricultural biotechnology innovation. 84 Cal. L. Rev. 1395. University of California at Berkeley, Berkeley, CA. 43 p. Available at: http://scholarship.law.berkeley.edu/ californialawreview/vol84/iss5/2. Gould, C. 2013. https://www.forbes.com/sites/stevenkotler/2013/04/03/open‐sourcing‐ food‐security/#71d2e83e3d56. Hessel and Kotler, Forbes, April 3, 2013, 06:01 pm.

200

Stephen Smith

Grace, J. 2008. Role of contracts in the exercise of breeders’ rights. Symposium on contracts in relation to plant breeders’ rights. Session II, October 31, 2008. UPOV/SYM/ GE/08/6, UPOV, Geneva, Switzerland. 10 p. Graff, G.D., S.E. Cullen, K.J. Bradford, et al. 2003. The public–private structure of intellectual property ownership in agricultural biotechnology. Nature Biotech. 21:989–995. Gray, R.S., R.S. Kingwell, V. Galushko, and K. Bolek. 2017. Intellectual property rights and Canadian wheat breeding for the 21st century. Can. J. Agric. Econ. 65:667–691. Grassini, P., K.M. Eskridge, and K.S. Cassman. 2013. Distinguishing between yield advances and yield plateaus in historical crop production trends. Nature Comm., vol. 4, Article number: 2918. 10.1038/ncomms3918. Gray, B.N., and W.M. Spruill. 2017. CRISPR–Cas9 claim sets and the potential to stifle innovation. Nature Biotech. 35:630–633. Greenlee, L.L. 1991. Biotechnology Patent Law: Perspective of the first seventeen years, prospective on the next seventeen years. University of Denver Law Review, 68(2):127–140. Gruneker. 2017. The European Patent Office (EPO) limits the patentability of plants and animals. https://grunecker.de/en/information/detail/the‐european‐patent‐office‐ epo‐limits‐the‐patentability‐of‐plants‐and‐animals/. Gruneker, Patent Attorneys and Attorneys at Law, Berlin. Guiard, J. 2013. The development of the provisions of essentially derived varieties. Seminar on essentially derived varieties (EDVs) (UPOV/SEM/GE/13), October 22, 2013. UPOV, Geneva, Switzerland. http://www.upov.int/edocs/mdocs/upov/en/upov_ sem_ge_13/upov_sem_ge_13_ppt_1.pdf. Gurry, F. 2013. Re‐thinking the role of intellectual property. Lecture in Melbourne and Sydney, August,2013. Melbourne Law School. Issue 10. December 2013. https://law. unimelb.edu.au/alumni/mls‐news/issue‐10‐december‐2013/rethinking‐the‐role‐of‐ intellectual‐property. Haegele, J.W., K.A. Cook, D.M. Nichols, and F.E. Below. 2013. Changes in nitrogen use traits associated with genetic improvement for grain yield of maize hybrids released in different decades. Crop Sci. 53:1256–1268. doi:10.2135/cropsci2012.07.0429. Halabi, S.F. 2018. Intellectual property and the new international economic order: Oligopoly, regulation, and wealth redistribution in the global knowledge economy. Cambridge University Press. 235 p. Halewood, M., I.L. Noriega, S. Louafi, et al. 2013. Crop genetic resources as a global commons. Challenges in international law and governance. Routledge, Abingdon, UK. 421 p. Hall, B.H., C. Helmers, and G. von Graevenitz. 2017. Technology entry in the presence of patent thickets. NBER Working Paper 21455. National Bureau of Economic Research, Cambridge, MA. 51 p. Halpert, M.‐T., and M.J. Chappell. 2018. Prima facie reasons to question enclosed intellectual property regimes and favor open‐source regimes for germplasm. Version 1. F1000Res. 2017; 6:284. Published online 17 March 2017, last updated February 2018. doi: 10.12688/ f1000research.10497.1. Hardin, G. 1968. The tragedy of the commons. Science 162:1243–1248. Hassan, E., O. Yaqab, and S. Diepeveen. 2010. Intellectual Property and Developing Countries. A review of the literature prepared for the UK Intellectual Property Office and the UK Department for International Development. Rand Corporation, Cambridge, UK. 92 p. Available at: https://www.rand.org/content/dam/rand/pubs/technical_ reports/2010/RAND_TR804.pdf. Hayes, D.J., S.H. Lence, and S. Goggi. 2009. Impact of intellectual property rights in the seed sector on crop yield growth and social welfare: A case study approach. AgBioForum 12:155–171.

APPLICATION OF INTELLECTUAL PROPERTY PROTECTION

201

Heisey, P.W., J.L. King, and K.D. Rubenstein. 2005. Patterns of public‐sector and private‐ sector patenting in agricultural biotechnology. AgBioForum, 8:73–82. Heisey, P.W., C.S. Srinivasan, and C. Thirtle. 2001. Public sector plant breeding in a privatizing world. Economic Research Service, U.S. Department of Agriculture. Agriculture Information Bulletin No. 722.19 p. Helfer, L.R. 2002. Intellectual property rights in plant varieties. An overview with options for national governments. Food and Agriculture Organization, FAO Legal Papers #31. FAO, Rome, Italy. 62 p. Heller, M.A., and R.S. Eisenberg. 1998. Can patents deter innovation? The anticommons in biomedical research. Science 280:698–701. Hemel, D.J., and L.L. Ouellette. 2017. Bayh–Dole beyond borders. J. Law and Biosciences. 4:282–310. 10.1093/jib/lsx011. Hervouet, A., and C. Langinier. 2018. Plant breeders’ rights, patents, and incentives to innovate. J. Ag. Res. Econ. 43:118–150. Hilbeck, A., and H. Herren. 2016. Millions spent, no one served: Who is to blame for the failure of GMO Golden Rice? Independent Science News. Available at: https://www. independentsciencenews.org/health/millions‐spent‐who‐is‐to‐blame‐failure‐gmo‐ golden‐rice/. Hoffmann, S. 2003. Arawakan women and the erosion of traditional food production in Amazonas Venezuela. p. 258–272. In: P.L. Howard (ed.), Women and plants: Gender relations in biodiversity management and conservation. Zed Press and Palgrave‐ MacMillan, London. 298 p. Holman, C.M. 2016. Trade secret law: An increasingly important form of IP for Biotechnology. Biotech. Law Rep. 35:45–54. 10.1089/blr.2016.29005.cmh. Howe, K.F. 2011. Wisdom in the earth: An examination of the history of intellectual property rights in plants and seeds. Graduate Theses and Dissertations, 10338. 294 p. https://lib.dr.iastate.edu/etd/10338. Huffman, W.E., S. Smith, and A. McCunn. 2018. Maize yields and yield gain in leading producing countries: How much has U.S.‐developed germplasm contributed? International Consortium on Applied Bioeconomy Research (ICABR) Conference. The World Bank, June 13–19, 2018, Washington, DC. International Treaty. 2009. The International Treaty on plant genetic resources for food and agriculture. FAO, Rome. 68 p. IP Australia. 2016. Issues paper, A review of enforcement of plant breeder’s rights. Advisory Council on Intellectual Property. 2007, updated 2016. https://www.ipaustralia. gov.au/about‐us/public‐consultations/archive‐ip‐reviews/ip‐reviews/issues‐ enforcement‐pbr. ISF. 2007. Guidelines for handling a dispute on essential derivation in oilseed rape. ISF, Nyon, France. ISF. 2008. Guidelines for handling a dispute on essential derivation of maize lines. ISF, Nyon, France. ISF. 2009. Guidelines for handling a dispute on essential derivation in ryegrass. ISF, Nyon, France. ISF. 2010. Issues to be addressed by technical experts to define molecular marker sets for establishing thresholds of ISF in EDV arbitration. ISF, Nyon, France. ISF. 2011. Proven and effective measures of PBR enforcement. International Symposium on plant breeders rights, August 30, 2011, Mexico City. http://snics.sagarpa.gob.mx/ somos/Documents/Seminario/7_Ejercicio_DOV ISF. 2012. ISF view on intellectual property. Adopted in Rio de Janeiro, Brazil, 28 June 2012. ISF, Nyon, Switzerland. p.32.

202

Stephen Smith

ISF. 2018. Position on illegal seeds. Adopted in Brisbane, Australia, May 2018. ISF, Nyon, Switzerland. ISU. 1995. http://www.techtransfer.iastate.edu/wp‐content/uploads/2018/09/Plant‐ Germplasm‐Release‐Policy.pdf. Jaffe, W., and J. van Wijk. 1995. The impact of plant breeders’ rights in developing countries. Inter‐Am Institute for Co‐operation on Agriculture, University of Amsterdam, Amsterdam, The Netherlands. Janis, M.D., and S. Smith. 2006. Obsolescence in intellectual property regimes. University of Iowa Legal Studies Research Paper No. 05‐48. Available at SSRN: https://ssrn.com/ abstract=897728 or 10.2139/ssrn.897728. Jefferson, D.J., A.B. Camacho, and C.L. Chi‐Ham. 2014. Towards a balanced regime of intellectual property rights for agricultural innovations. J. Intel. Prop. Rights 19:395–403. Jefferson. T. 1813. Document 12. Thomas Jefferson to Isaac McPherson, 13 August 1813. Writings 13:333–335. Founders Constitution. http://press‐pubs.uchicago.edu/ founders/documents/a1_8_8s12.html. Jensen, H.R., L. Belqadi, P. De Santis, et al. 2013. A case study of seed exchange networks and gene flow for barley (Hordeum vulgare subsp.vulgare) in Morocco. Genet. Res. Crop Evol. 60:1119–1138. Doi: 10.1007/s10722‐012‐9909‐4. JRG. 2015. Exploring options for producer involvement in wheat and barley variety development. Annexes prepared for the Wheat and Barley Variety Working Group, JRG Consulting Group. Guelph, Ontario, Canada. 135 p. http://saskbarleycommission.com/ wp‐content/uploads/2016/09/Report‐annexes.pdf. Justice Department. 2016. The FBI story 2016. Federal Bureau of Investigation, Government Printing Office, Washington, DC. 152 p. Kahler, A.L., J.L. Kahler, S.A. Thompson, et al. 2010. North American study on essential derivation in maize II. Selection and evaluation for a panel of simple sequence repeat loci. Crop Sci. 50:486–503. 10.2135/cropsci2009.03.0121. doi: 10.2135/. Kalaitzandonakes, A.N., E. Carayannis, E. Grigoroudis, and S. Rozakis. 2018. From agriscience to agribusiness. Theories, policies, and practices in technology transfer and commercialization. Springer, Cham, Switzerland. 490 p. Kesan, J.P., and A.A.Gallo. 2005. Property rights and incentives to invest in seed varieties: Governmental Regulations in Argentina. AgBioForum 8:118–126. Khan, B.Z. nd. An economic history of patent institutions. Economic History Association. http://eh.net/encyclopedia/an‐economic‐history‐of‐patent‐institutions/. Khoury, C.K., H.A. Achicanoy, A.D. Bjorkman, et al. 2015. Estimation of countries’ interdependence in plant genetic resources provisioning national food supplies and production systems. ITPGRFA Research Study 8. FAO, Rome. 26 p. Kiewiet, B. 2006. Essentially derived varieties. Adaptation of a presentation made on March 8, 2006 for Plantum NL. 5 p. http://cpvo.europa.eu/sites/default/files/ documents/articles/EDV_presentation_PlantumNL_March_2006_BK.pdf. King, J, A. Toole, and K. Fuglie. 2012. The complementary roles of the public and private sectors in U.S. Agricultural Research and Development. Economic Brief No. 19. United States Department of Agriculture, Economic Research Service, Washington, DC. 8 p. Kloppenburg, J. 1988. First the seed: The political economy of plant biotechnology, 1492– 2000. Cambridge University Press, New York. 349 p. Kloppenburg, J. 2004. First the seed: The political economy of plant biotechnology, 1492– 2000. Reissued with a new preface and an additional final chapter, “Still the Seed.” University of Wisconsin Press, Madison, WI. 426 p. Kloppenburg, J. 2010. Impeding dispossession, enabling repossession: Biological open source and the recovery of seed sovereignty. J. Ag. Change 10:367–388.

APPLICATION OF INTELLECTUAL PROPERTY PROTECTION

203

Kloppenburg, J., and D. Kleinman, 1987. Seed wars: Common heritage, private property, and political strategy. Soc. Rev. 95:7–41. Kock, M., and F. ten Have. 2016. The international licensing platform—Vegetables: A prototype of a patent clearing house in the life science industry. J. Intel. Prop. Law & Practice 11:496–515. Kolady, D.E., and W. Lesser. 2009. Does the Plant Variety Protection Act contribute to crop productivity? Lessons learned from the case of US wheat breeding. J. World Intel, Prop. 12:137–152. Kolady, D., D.J. Spielman, and A.J. Cavalieri, 2010. Intellectual property rights, private investment in research, and productivity growth in Indian agriculture. IFPRI Discussion Paper 0103. IFPRI, Washington, DC. 48 p. Kolady, D.E., D. Spielman, and A. Cavalieri. 2012. The impact of seed policy reforms and intellectual property rights on crop productivity in India. J. Ag. Econ. 63: 361–384. Kostolansky, K.J., and D. Salgado. 2018. Does the experimental use exception in patent law have a future? Colorado Lawyer. January 2018. p. 32–40. https://www.lrrc.com/ webfiles/TCL‐KK_DS.pdf. Kowalski, S.P., and R.D. Kryder. 2002. Golden Rice: A case study in intellectual property management and international capacity building, 13 RISK 47. 24 p. Krattiger, A., and I. Potrykus. 2007. Golden Rice: A product‐development partnership in agricultural biotechnology and humanitarian licensing. p. 11–14. In A. Krattiger, R.T. Mahoney, L. Nelsen, et al. (eds.), Executive guide to intellectual property management in health and agricultural innovation: A handbook of best practices. MIHR: Oxford, U.K., and PIPRA: Davis, U.S. Available online at: www.ipHandbook.org. Krieger, E. 2017. Consequences of the missing essentially derived varieties (EDV) concept in the protection of vegetatively reproduced ornamental and fruit varieties in the United States. CIOPORA. Posted August 1, 2017. https://www.ciopora.org/single‐post/2017/08/01/ Consequences‐of‐the‐missing‐Essentially‐Derived‐Varieties‐EDV‐concept‐in‐the‐ protection‐of‐vegetatively‐reproduced‐ornamental‐and‐fruit‐varieties‐in‐the‐United‐States. Labeyrie, V., B. Rono, and C. Leclerc. 2014. How social organization shapes crop diversity: an ecological anthropology approach among Tharaka farmers of Mount Kenya. Agriculture and Human Values, 31:97–107. The Agriculture, Food, & Human Values Society (AFHVS), Springer. doi: 10.1007/s10460‐013‐9451‐9. Laidig, F., H.‐P. Piepho, T. Drobek, and U. Meyer. 2014. Genetic and non‐genetic long‐term trends of 12 different crops in German official variety performance trials and on‐farm yield trends. Theor. Appl. Genet. 127:2599–2617. doi: 10.1007/s00122‐014‐2402‐z. Landon, A.J. 2007. Bioprospecting and biopiracy in Latin America: The case of Maca in Perú. Nebraska Anthro. 32:63–73. http://digitalcommons.unl.edu/nebanthro/32. Laperche 2010. The offensive role of IPRs: Coordination and leadership within innovation networks. P. 78–100 In: B. Laperche, P. Sommers, and D. Uzunidis (eds.), Innovation networks and clusters: The knowledge backbone. Peter Lang, Brussels. Larkins, J.R. 2000. United States Patent. Inbred corn plant RQAA8 and seeds thereof. Patent No. 6,143,961. U.S. Patent Office, Washington, DC Laursen, L. 2017. Plant breeders test drive first open‐source seed bank. Nature Biotech. 35, 700 (2017). doi: 10.1038/nbt0817‐700. Lawson, C. 2015. The breeder’s exemption under UPOV 1991, the Convention on Biological diversity and its Nagoya protocol. J. Intel. Property Law & Practice. 10:526–535. 10.1093/jiplp/jpv080. LeBuanec. B. 2004. Protection of the plant related innovations: Evolution and current discussion. IP Strategy Today. No. 9‐2004. p. 1–18.

204

Stephen Smith

LeBuanec, B. 2011. The development of plant breeding and plant variety protection. p. 12–21. In: Symposium on plant breeding for the future. October 21. UPOV, Geneva, Switzerland. Lence, S.H., D.J. Hayes, A. McCunn, et al. 2005. Welfare impacts of intellectual property protection in the seed industry. Am. J. Agric. Econ. 87:951–968. doi: 10.1111/ j.1467‐8276.2005.00780. Lence, S.H., S. Marette, D.J. Hayes, and W. Foster. 2006. Collective marketing arrangements for geographically differentiated agricultural products: Welfare impacts and policy implications. MATRIC Working Papers. ISU, Ames, IA. http://lib.dr.iastate.edu/ matric_workingpapers/2. Lence, S.H., D.J. Hayes, J. Alston, and J.S.C. Smith. 2015. Intellectual property in plant breeding: Comparing different levels and forms of protection. Eur. Rev. Agric. Econ. 43:1–29. doi: 10.1093/erae/jbv007. Lertdhamtewe, P. 2013. Asian approaches to international law: Focusing on plant protection issues. J. Intel. Prop. Law 8:388–398. Lesser, W. 1992. Modifications in intellectual Property Rights Law and effects on agricultural research. Cornell Agricultural Econ. Staff Paper SP 92‐16. Cornell University, Ithaca, NY. 28 p. Lesser, W. 2005. Intellectual property rights in a changing political environment: Perspectives on the types and administration of protection. AgBioForum 8:64–72. Lesser, W. 2016. Whether the research anticommons? AgBioForum 19:1–9. Lesser, W., and M.A. Mutschler. 2004. Balancing investment incentives and social benefits when protecting plant varieties: Implementing initial variety systems. Crop Sci. 44:1113–1119. Lightbourne, M. 2016. Food security, biological diversity and intellectual property rights. Routledge, London. 328 p. Lightbourne, M., and G. Dutfield. 2006. Assessing the economic implications of different models for implementing the requirement to protect plant varieties. Literature review and commentary on legal regimes and models for protecting plant varieties. Produced with support of the European Commission’s 6th Framework Programme for Research as part of the project “Impacts of the IPR Rules on Sustainable Development” (IPDEV). IPDEV Work Package 6. Queen Mary College, University of London. 43 p. https://www.ecologic. eu/sites/files/download/projekte/1800‐1849/1802/wp6_legal_literature_review.pdf. Linares, O.F. 2002. African rice (Oryza glaberrima): History and future potential. PNAS. 99: 16360–16365. 10.1073/pnas.252604599. Lincoln, A. 1858. Lecture on discoveries and inventions. Cited in Andrews, M.J. 2017. Fuel of interest and fire of genius: essays on the economic history of innovation. PhD (Doctor of Philosophy) thesis, University of Iowa, 447 p. http://ir.uiowa.edu/etd/5702. Llewelyn, M. and M. Adcock. 2006. European plant intellectual property. Hart Publ., Oxford, U.K. 551 p. Lloyd, W.F. 1833. Two lectures on the checks to population. Oxford University Press, Oxford, England, 1833. Reprinted (in part) in G. Hardin (ed.). 1964. Population, evolution, and birth control. Freeman, San Francisco. p. 37. Locke, J. 1689. Reprinted in A. Miller et al. 1764. Two treatises of government, Thomas Hollis (ed.). London. Accessed 11 August 2018: http://oll.libertyfund.org/titles/222. Long, J. 2013. Global food security and intellectual property rights. Michigan State Int. Law Rev. 21:115–123. Long, P.O. 2001. Openness, secrecy, authorship: Technical arts and the culture of knowledge from antiquity to the Renaissance. John Hopkins University Press, Baltimore. 364 p.

APPLICATION OF INTELLECTUAL PROPERTY PROTECTION

205

Louwaars, N.P., R. Tripp, D. Eaton, et al. 2005. Impacts of strengthened intellectual property rights regimes on the plant breeding industry in developing countries: A synthesis of five case studies. Centre for Genetic Resources, Wageningen, The Netherlands. 176 p. Luby, J.J., and D.S. Bedford. 2015. Cultivars as consumer brands: Trends in protecting and commercializing apple cultivars via intellectual property rights. Crop Sci. 55:2504–2510. doi: 10.2135/cropsci2014.10.0684. Luby, C.H., and I.L. Goldman. 2016a. Freeing crop genetics through the open source seed initiative. PLoS Biol. 14(4):e1002441. doi: 10.1371/journal. pbio.1002441. Luby, C.H., and I.L. Goldman. 2016b. Improving freedom to operate in carrot breeding through the development of eight open source composite populations of carrot (Daucus carota L. var. sativus). Sustainability 2016, 8:479. doi: 10.3390/su8050479. Luby, C.H., J. Kloppenburg, and M.T. Goldman. 2015. Enhancing freedom to operate for plant breeders and farmers through open source plant breeding. Crop Sci. 55:2581–2488. Lynn, M. 2012. Daniel 11: A history of the world. AuthorHouse, Bloomington, Indiana. 500 p. Mack, T.C., and D. Blackburn. 2013. United States Patent: Inbred corn line 1AA01 U.S. 8,581,061. United States Patent Office, Alexandria, VA. 16 p. Mackay, I., A. Horwell, J. Garner, et al. 2011. Reanalyses of the historical series of UK variety trials to quantify the contributions of genetic and environmental factors to trends and variability in yield over time. Theor. Appl. Genet. 122:225–238. doi: 10.1007/s00122‐010‐1438‐y. Magniera, A., N. Kalaitzandonakes, and D.J. Miller. 2010. Product Life Cycles and Innovation in the US Seed Corn Industry. Int. Food Agribus. Management Rev. 13:17–36. Malaza, M. 2003. Modernization and gender dynamics in the loss of agrobiodiversity in Swaziland’s food system. p. 243–257. In: P.L. Howard (ed.), Women and plants: Gender relations in biodiversity management and conservation. Zed Press and Palgrave‐MacMillan, London. 298 p. Mara, K. 2011. IP and traditional expressions: An unnatural alliance? Intellectual property watch, January 5, 2011. www.ip‐watch.org/2011/01/05/ip‐traditional‐cultural‐ expressions‐an‐unnatural‐alliance/. Markel, H. 2013. Patents, profits, and the American people—The Bayh–Dole Act of 1980. New Engl. J. Med. 369:794–796. doi: 10.1056/NEJMp1306553. Marketwired. 2014. House of Commons passes Agricultural Growth Act. Posted November 24, 2014. http://www.marketwired.com/press‐release/house‐of‐commons‐passes‐ agricultural‐growth‐act‐1971375.htm. Martin, B. 1998. Information Liberation: Challenging the corruptions of information power. Freedom Press, London. 189 p. ISBN 0 900384 93 X. MASIPAG. 2009. The Magsasaka at Siyentipiko Para Sa Pag‐unlad ng Agrikultura (MASIPAG) or “Farmer–Scientist Partnership for Development, Inc.” http://www.masipag. org (last visited Mar. 18, 2009). May, C. 2005. The World Intellectual Property Organization: Resurgence and the development agenda. Routledge, London. 154 p. McConnell, R.L. 2004. Developing genetic resources for the future: The long look. ISF International Seminar on Protection of intellectual property and access to plant genetic resources, Berlin, 27–28 May. Bioscience Law Rev. 7:57–60. McGuire, S. 2008. Securing access to seed: Social relations and sorghum seed exchange in Eastern Ethiopia. Hum. Ecol. 36:217–229. doi: 10.1007/s10745‐007‐9143‐4. McGuire, S., and L. Sperling. 2016. Seed systems smallholder farmers use. Food Sec. 8(1). doi: 10.1007/s12571‐015‐0528‐8 McLeod, C., and A. Nuvolari. 2010. Patents and industrialization: An historical overview of the British case, 1624–1907. Laboratory of Economics and Management, Sant’Anna

206

Stephen Smith

School of Advanced Studies, Pisa, Italy. 31 p. http://www.lem.sssup.it/WPLem/ files/2010‐04.pdf. Meinzen‐Dick, R. and P. Eyzaguirre. 2009. Non‐market institutions for agrobiodiversity conservation. p. 82–91. In: A. Kontoleon, U. Pascual, and M. Smale (eds.), Agrobiodiversity, conservation and economic development. Routledge, London, U.K. 432 p. Meredith, W.R., and R. Bridge. 1984. Genetic contributions to yield changes in upland cotton. p. 75–86 In: W. Fehr (ed.), Genetic contributions to yield gains of five major crop plants. CSSA, Madison, WI. Merges, R.P. 2011. Justifying IP. Harvard University Press, Cambridge, MA. 422 p. Merges, R. P. 2017. Economics of Intellectual Property Law. p. 20–219. In: P. Parisi (ed.), The Oxford handbook of law and economics: vol. 2: Private and commercial law. Oxford University Press. 544 p. Miller, L. 1986. U.S. plant variety “Da Vine.” Plant Patent 5,751, U.S. Patent Office, Alexandria, VA. Miller, D.T. 1999. The norm of self‐interest. Am. Psych. 54:1053–1060. 10.1037/ 0003‐066X.54.12.1053. Morris, M.L., R. Tripp, and A. Dankyi. 1999. Adoption and impacts of improved maize production technology: A case study of the Ghana grains development ­project. Economics Program Papers 48767. CIMMYT: International Maize and Wheat Improvement Center. 46 p. Morris, M., G. Edmeades, and E. Pehu. 2006. The global need for plant breeding capacity: What roles for the public and private sectors? HortSci. 41:30–39. Moschini, G., and O. Yerokhin. 2008. Patents, research exemption, and the incentive for sequential innovation. Jour. Econ. Management Strat. 17:379–412. Munzer, S.R. 2012. Corrective justice and intellectual property rights in traditional knowledge. p. 58–87. In: A. Lever (ed.), New frontiers in the philosophy of intellectual property. Cambridge University Press, Cambridge, U.K. Munzer, S.R., and K. Raustiala. 2009. The uneasy case for intellectual property rights in traditional knowledge. Cardozo Arts Entertainment Law J. 27:37–97. Nard, C.A., and A.P. Morriss. 2006. Constitutionalizing patents: From Venice to Philadelphia. Faculty Publications, School of Law, Case Western Reserve University. 587 p. http://scholarlycommons.law.case.edu/faculty_publications/587 100p. Naseem, A., J.F. Oehmke, and D.E. Schimmelpfennig. 2005. Does plant variety intellectual property protection improve farm productivity? Evidence from cotton varieties. AgBioForum 8:100–107. Naseem, A., D.J. Spielman, and S.W. Omano. 2010. Private‐sector investment in R&D: A review of policy options to promote its growth in developing‐country agriculture. Agribusiness 26:143–173. doi: 10.1002/agr.20221. Nellen‐Stucky, R., and F. Meienberg. 2006. Harvesting Royalties for Sowing Dissent? Monsanto’s campaign against Argentina’s patent policy. Berne Declaration, online: www.evb.ch/cm_data/Artikel_Monsanto_Soya_Arg‐EU_E_final.pdf (19 February 2010). Newell, P. 2009. Bio‐hegemony: The political economy of agricultural biotechnology in Argentina. J. Lat. Am. Studies 41:27–57. Noli, E., M. Teriaca, and S. Conti. 2012. Identification of a threshold level to assess essential derivation in durum wheat. Mol. Breeding 29:687–698. Nottenburg, C. 2009. The Enola Bean Patent Controversy. HarvestChoice. https:// harvestchoice.org/publications/enola‐bean‐patent‐controversy. OECD. 2015. Innovation, agricultural productivity and sustainability in Canada. OECD Food and Agricultural Reviews. OECD Publishing, Paris. 179 p.

APPLICATION OF INTELLECTUAL PROPERTY PROTECTION

207

Ohno, Y. 2015. Enforcement in Japan. UPOV presented 7 May 2015. www.upov.int/ edocs/mdocs/upov/en/upov_uspto_ge…/upov_uspto_ge_15_29.pdf. Okawa, M., Y. Niwa, and H. Goto. 2014. Use of DNA variety identification technique for measures against the infringement of plant breeders’ rights in Japan. BMT/14/6, meeting October 5, 2014 in Seoul, Republic of Korea. UPOV, Geneva, Switzerland. 2 p. Overdijk, T.F.W. 2013. Essentially derived varieties—Case law in the Netherlands and connected observations. UPOV EDV Seminar, 22 October 2013. UPOV, Geneva, Switzerland. http://www.upov.int/edocs/mdocs/upov/en/upov_sem_ge_13/upov_sem_ge_13_ ppt_10.pdf. Padolina, W.G. 2000. Plant variety protection for rice in developing countries: Impacts on research and development. Limited proceedings of the workshop on the impact on research and development of sui generis approaches to plant variety protection of rice in developing countries. 16–18 February 2000, IRRI, Los Banos, Laguna, Philippines. International Rice Research Institute, Makati City, Philippines. 233 p. Pallottini, L., E. Garcia, J. Kami, et  al. 2004. Conference: Annual report of the bean improvement cooperative 47:155–162. Michigan State University, East Lansing, MI. Pardey, P.G., J.M. Alston, and R.R. Piggott. 2006. Agricultural R&D in the developing world: Too little, too late? International Food Policy Research Institute, Washington, DC. 420 p. Pardey, P.G., J.M. Alston, and C.C. Kang. 2012. Agricultural production, productivity and R&D over the past half century: An emerging new world order. Invited plenary paper presented at the International Association of Agricultural Economists (IAAE) Triennial Conference, Foz do Iguaçu, Brazil, 18–24 August 2012. 46 p. https://ageconsearch. umn.edu/bitstream/131824/2/PardeyEtAlFinal.pdf. PARM. 2015. Agricultural risk sssessment study: Uganda. Platform for agricultural risk management. International Fund for Agricultural Development, Rome. 134 p. www. p4arm.org. Partners in Innovation. 2015. Agricultural sector pleased with updated Plant Breeders’ Rights from Royal Assent of C‐18. News release posted February 27, 2015. http:// partnersininnovation.ca/wp‐content/uploads/2015/02/Partners‐in‐Innovation_EN__ Feb‐27_FINAL.pd [email protected]. Pautasso, M., G. Aistara, A. Barnaud, S. et  al. 2013. Seed exchange networks for agrobiodiversity conservation. A review. Agron. Sust. Dev. 33:151–175. doi: 10.1007/ s13593‐012‐0089‐6. Peet, R., V. Mohan‐Ram, and P. Vlaemminck. 2010. The future of biotechnology patents in the European Union. Intellectual Property Watch, httpi//www.ip‐watch.org/ weblog/2010/08/17/the‐future‐of‐biotechnology‐patents‐in‐the‐european‐union/. Perrin, R.K., K.A. Hunnings, and L.A. Ihnen.1983. Some effects of the US plant variety protection act of 1970 (Economics Research Report No. 46). North Carolina State University, Department of Economics and Business, Rayleigh, NC. Phillips, P.W.B., and B.C. Onwuekwe. 2007. Accessing and sharing the benefits of the genomics revolution. Springer, New York. 214 p. Pingali, P. 2009. Global agriculture R&D and the changing aid architecture (DRAFT). Presented at the 27th International Association of Agricultural Economics Conference, Beijing, China, August 16–22, 2009. 12 p. Pioneer Hi‐Bred International v. Holden Foundation Seeds, et  al. 1994. US Court of Appeals, Eighth Circuit. 5 F.3d 1226. 31 U.S.P.Q.2d 1385, 39 Fed. R. Evid. Serv. 993. Nos. 92‐3292, 92–3556. https://openjurist.org/35/f3d/1226/pioneer‐hi‐bred‐ international‐v‐holden‐foundation‐seeds‐inc‐pioneer‐hi‐bred‐international. PIPRA, 2009. The Public Intellectual Property Resource for Agriculture (PIPRA). http:// www.pipra.org/ (last visited March 13, 2009).

208

Stephen Smith

Pistorius, R., and J. van Wijk. 1999. The exploitation of plant genetic information: Political perspectives. p. 409–512. In: P. Stoneman (ed.), Handbook of economic innovation and technical change. Blackwell, Oxford, U.K. Pollak, L.M., and W. Salhuana. 2000. The germplasm enhancement of maize (GEM) project: Private and public sector collaboration. p. 319–329 In: H. Cooper, T. Hodgkin, and C. Spillane (eds.), Broadening the genetic base of crop production. CAB Int., Wallingford, U.K. doi: 10.1079/9780851994116.0319. Potrykus, I. 2010. Lessons from the ‘Humanitarian Golden Rice’ project: regulation ­prevents development of public good genetically engineered crop products. New Biotech. 27:466–472. Pretel, D. 2018. The global rise of patent expertise in the late nineteenth century. CWPESH No. 31. University of Cambridge, U.K. 24 p. http://www.econsoc.hist.cam.ac.uk/docs/ CWPESHnumber31Jan2018.pdf Probstdoder Saatzucht GmbH & Co. KG v. Pflanzzucht Oberlimpurg. 2010. (7 0 442t04), Court of First Instance of Mannheim, Civil Chamber, December 10, 2010. Proctor, L.M. 1999. Field bean cultivar named enola. U.S. Patent No. 5,894,079. U.S. Patent Office, Arlington, VA. Quaite‐Randall, E. nd. Use of plant variety protection: Experience of the International Rice Research Institute, Impact of intellectual property rights on research for development. http://apip‐apec.maff.go.jp/members/2012/09/26/files/2‐5‐1_IRRI_Dr.Quaite‐Randall.pdf. Ramanujan, K. 2017. New initiative bridges plant breeding digital divide. Cornell Chronicle, Cornell University, Ithaca, NY. http://news.cornell.edu/stories/2017/08/ new‐initiative‐bridges‐plant‐breeding‐digital‐divide. Ramirez, M., R. Ortiz, S. Taba, et  al. 2013. Demonstrating interdependence on plant genetic resources for food and agriculture. p. 39–61. In: M. Halewood, I.l. Noriega, and S. Louafi (eds.), Crop genetic resources as a global commons: Challenges in international law and governance. Bioversity Int., Routledge, Abingdon, Oxfordshire, UK. p. 78–98. Ramirez‐Villegas, J., A. Jarvis, S. Fujisaka, et al. 2013. Crop and forage genetic resources: International interdependence in the face of climate change. p.78–98. In: M. Halewood, I.l. Noriega, and S. Louafi. (eds.), Crop genetic resources as a global commons: Challenges in international law and governance. Bioversity Int., Routledge, Abingdon, Oxfordshire, UK. Rana, R.B., C. Garforth, B. Sthapit, and D. Jarvis. 2000. Influence of socioeconomic and cultural factors in rice varietal diversity management on‐farm in Nepal. Agric. Hum. Val. 24:461–472. doi: 10.1007/ s10460‐007‐9082‐0. Rangnekar, D. 2000. Intellectual property rights and agriculture: An analysis of the economic impact of plant breeders’ rights. Research Associate, School of Economics, Kingston University, U.K. Prepared for Actionaid, U.K. 58 p. https://www.actionaid. org.uk/sites/default/files/doc_lib/ipr_agriculture.pdf. Rangnekar, D. 2014. Geneva rhetoric, national reality: The political economy of introducing plant breeders’ rights in Kenya. New Pol. Econ. 19:359–383. Raustiala, K., and D.G. Victor. 2003. The regime complex for plant genetic resources. Working Paper #14. Program on Energy and Sustainable Development at the Center for Environmental Science and Policy, Stanford University. 43 p. https://pesd.fsi.stanford. edu/sites/default/files/pgr_regime_complex.pdf. Redqueen, S. 2014. Who benefits from intellectual property rights for agricultural innovation? The case of ogura oilseed rape in France. Haarlem, The Netherlands. 38 p. https:// croplife.org/wp‐content/uploads/2014/11/Ogura‐Final‐report.pdf. Reichman, J.H. 2000. Of green tulips and legal kudzu; repackaging rights in sub‐patentable innovation. Vanderbilt Law Rev. 53:1743–1798.

APPLICATION OF INTELLECTUAL PROPERTY PROTECTION

209

Reid, W.V. 1992. Genetic resources and sustainable agriculture: Creating incentives for local innovation and adaptation. CABI. 35 p. Ridley, M. 1997. The origins of virtue: Human instincts and the evolution of cooperation. Viking Penguin, New York. 296 p. Robinson, D. 2009. Sui generis systems for plant variety protection and traditional knowledge in Asia. p. 235–272. In: R. Melendez‐Ortiz and P.Roffe (eds.), Intellectual property and sustainable development: Development agendas in a changing world. Edward Elgar, Cheltenham, U.K. Rodriguez, C. 2010. Patent pools: Intellectual property rights and competition. Open AIDS J. 4:62–66. doi: 10.2174/1874613601004020062. Roland, M.T., and J.J. Blouin. 1995. U.S. Patent for co‐extraction of azadirachtin and neem oil. U.S. Patent No. 5,397,571. U.S. Patent Office, Arlington, VA. Rosati, E. 2017. Why the CJEU cheese copyright case is anything but cheesy. J. Intel. Prop. Law & Practice 12:813–814. Rose, G.L. 2004. The international undertaking on plant genetic resources for food and agriculture: Will the paper be worth the trees? p. 55–90 In: N. Stoianoff (ed.), Accessing biological resources: Complying with the Convention on biological diversity. Kluwer, London. Rousselle, Y., E. Jones, A. Charcosset, et al. 2015. Study on essential derivation in maize: III. Selection and evaluation of a panel of single nucleotide polymorphism loci for use in European and North American germplasm. Crop Sci. 55:1170–1180. doi: 10.2135/ cropsci2014.09.0627. Runge, C.F., and E. Defrancesco. 2006. Exclusion, inclusion, and enclosure: Historical commons and modern intellectual property. World Dev. 34:1713–1727. Saez, C. 2017. UK Professor charts path to reconciling IP right, farmers’ rights. Intellectual Property Watch. Posted 27 March 2017. http://www.ip‐watch.org/2017/03/27/ uk‐professor‐charts‐path‐reconciling‐ip‐rights‐farmers‐rights/. Saldivar, C.E. 2014. Is there one effective sui generis protection that meets the obligation set out in Article 27(3)(b) of TRIPS? Revista La Propiedad Inmaterial 18:19–129. Universidad Externado de Colombia. Sanderson, J. 2006. Essential derivation, law and the limits of science. Law in Context 24:34–53. Research Paper Series 09‐16. Socio‐legal Research Centre, Griffith Law School, Griffith University, Brisbane, Queensland, Australia. Sanderson, J. 2013. Can intellectual property help feed the world? Intellectual property, the PLUMPYFIELD network and a sociological imagination. p. 145–173. In: C. Lawson and J. Sanderson (eds.), The intellectual property and food project: From rewarding innovation and creation to feeding the world. Ashgate, Farnham, U.K. 260 p. Sanderson, J. 2017. Plants, people and practices: The nature and history of the UPOV Convention. Cambridge University Press, Cambridge, U.K. 348 p. Sarreal, E.S., J.A. Mann, J.E. Stroike, and R.D. Andrews. 1997. U.S. Patent; Basmati rice lines and grains. U.S. Patent No. 5,663,484. U.S. Patent Office, Arlington, VA. Schimmelpfennig, D. 2004. Agricultural patents: Are they developing bad habits? Choices. May19–23. American Agricultural Economics Association. Oxford University Press, Oxford, U.K. Schnable, P.S., D. Ware, R.S. Fulton, et  al. 2009. The B73 maize genome: Complexity, diversity, and dynamics. Science 326:1112–1115. Scotchmer, S. 2004. Innovation and incentives. MIT Press, Cambridge, MA. 376 p. SEARICE. nd. The Philippines‐based Southeast Asia Regional Initiatives for Community Empowerment (SEARICE). https://searice.org.ph/about‐searice/.

210

Stephen Smith

Shapiro, C. 2001. Navigating the patent thicket: Cross licenses, patent pools, and standard setting. p. 119–150. In: A.B. Jaffe, J. Lerner, and S. Stern (eds.), Innovation policy and the economy, vol. 1. MIT Press, Cambridge, USA. Shelton, A.C., and W.F. Tracy. 2017. Cultivar development in the U.S. Public Sector. Crop Sci. 57:1823–1835. doi: 10.2135/cropsci2016.11.0961. Sherkow, J.S. 2015. Law, history and lessons in the CRISPR patent conflict. Nat. Biotech. 33:256–257. Sherkow, J.S. 2018. The CRISPR patent landscape: Past, present, and future. The CRISPR Journal 1:5–9. 10.1089/crispr.2017.0013. Shiva, V. 2001. Protect or plunder? Understanding intellectual property rights. Zed Books, New York. 144 p. Simmons, J. 1998. Makers’ rights. J. Ethics 2:197–218. Singh, K.K. 2016. IP rights in agricultural biotechnology and access to technology: A critical appraisal. Asian Biotech Dev. Rev. 18:3–23. Skolnik, H. 1977. Historical aspects of patent systems. J. of Chemical Information and Comp. Sci. 17:119–121. Sleper, D.A. and J.G. Shannon. 2003. Role of public and private soybean breeding programs in the development of soybean varieties using biotechnology. AgBioForum 6:27–32. Smith, A. 1776. An inquiry into the nature and causes of the Wealth of Nations. Edited by Edwin Cannan (1977) with a Preface by George J. Stigler. Vols I (524 p) and II (568 p). University of Chicago Press. Smith, S., and B. Kurtz. 2015. Why do US corn yields increase? The contributions of genetics, agronomy, and policy instruments. AgBioForum 18:297–302. Smith, J.S.C., T. Hussain, E.S. Jones, et  al. 2008. Use of doubled haploids in maize breeding: Implications for intellectual property protection and genetic diversity in hybrid crops. Mol. Breeding 22:51–59. doi: 10.1007/s11032‐007‐9155‐1. Smith, S., M. Cooper, J. Gogerty, et al. 2014. “Maize.” p. 125–172. In: S. Smith, B. Diers, J. Specht, and B. Carver (eds), Yield gains in major U.S. field crops, CSSA Special Publication 33, Madison, WI. Smith, S., S. Lence, D. Hayes, et al. 2016. Elements of intellectual property protection in plant breeding and biotechnology: Interactions and outcomes. Crop Sci. 56:1401–1411. doi: 10.2135/cropsci2015.10.0608. Song, Y., and J. Jiggins. 2003. Women and maize breeding: The development of new seed systems in a marginal area of South‐West China. p. 273–288. In: P.L. Howard (ed.), Women and plants: Gender relations in biodiversity management and conservation. Zed Press and Palgrave‐MacMillan, London. 298 p. Sonnino, A. 2017. International instruments for conservation and sustainable use of plant genetic resources for food and agriculture: An historical appraisal. Diversity 9:50. doi: 10.3390/d9040050. Specht, J.E., B.W. Diers, R.L. Nelson, et al. 2014. Soybean. p. 311–356. In: S. Smith, B. Diers, J. Specht, and B. Carver (eds), Yield gains in major U.S. field crops, CSSA Special Publication 33, Madison, WI. Sperling, L. 1994. Summary report. Analysis of bean seed channels in the Great Lakes Region: South Kivu, Zaire, Southern Rwanda, and select bean‐growing zones of Burundi. Butare, Rwanda: CIAT/RESAPAC. CIAT African Occasional Publications, Series No. 13. 13 p. Sperling, L. and S. McGurie. 2010. Understanding and strengthening informal seed markets. Exp. Ag. 46:119– 36. doi: 10.1017/S0014479709991074. Spielman, D.J., and A. Kennedy. 2016. Towards better metrics and policymaking for seed‐ system development: Insights from Asia’s seed industry. Agric. Systems 147:111–122.

APPLICATION OF INTELLECTUAL PROPERTY PROTECTION

211

Srinivasan, C.S. 2004. Plant variety protection, innovation, and transferability: Some empirical evidence. Rev. Ag. Econ. 26:445–471. Stiglitz, J.E. 2008. Economic foundations of intellectual property rights. Duke Law Journal 57:1693–1724. Suchman, M. 1989. Invention and ritual: Notes on the interrelation of magic and intellectual property in preliterate societies. Columbia Law Rev. 89:1264–1294. Sullivan, S.S. 2004. Plant genetic resources and the law: Past, present, and future. Plant Physiol. 135:10–15. doi: 10.1104/pp.104.042572. Swanson, T., and T. Goeschl. 2005. Diffusion and distribution: The impacts on poor countries of technological enforcement within the biotechnology sector, p. 669–694. In: K.E. Maskus and J.H. Reichman (eds.), International public goods and transfer of technology. Cambridge University Press, Cambridge, U.K. Tansey, G. 1999. Trade, intellectual property, food and biodiversity: Key issues and options for the 1999 review of Article 27.3(b) of the TRIPS Agreement. Quaker Peace & Service, London. http://www.quno.org. Thirtle, C., P. Bottomley, P. Palladino, et al. 1998. The rise and fall of public sector plant breeding in the United Kingdom: a causal chain model of basic and applied research and diffusion. Ag. Econ. 19:127–143. Thual, D., and F. Lossy. 2011. Q&A Manual: European legislation on geographical indications. EU–China IPR2 Project. European Patent Office, Munich. 132 p. Toro, F. 2014. Fake seeds force Ugandan farmers to resort to “bronze age” agriculture. The Guardian. Posted April 8, 2014. https://www.theguardian.com/sustainable‐business/ counterfeit‐fake‐seeds‐uganda‐farmers‐crop‐failure. Transparency International. 2014. Working together to stop fake agricultural products in Uganda. Retrieved May 15, 2015, from http://blog.transparency.org/2014/08/28/ workingtogether‐to‐stop‐fake‐agricultural‐products‐in‐uganda/. Tripp, R., and D. Byerlee. 2000. Public plant breeding in an era of privatization. Natural Resource Perspectives, No. 57. The Overseas Development Institute, London. 4 p. Tripp, R., N. Louwaars, and D. Eaton. 2006. Intellectual property rights for plant breeding and rural development: Challenges for agricultural policymakers. Agricultural and Rural Development Notes, No. 12. World Bank, Washington, DC. © World Bank. https:// openknowledge.worldbank.org/handle/10986/9603. License: CC BY 3.0 IGO. Tripp, R., N. Louwaars, and D. Eaton. 2007. Plant variety protection in developing countries. A report from the field. Food Pol. 32:354–371. Tripp, R., and S. Pal. 1998. Information exchange in commercial seed markets in Rajasthan. Agricultural Research and Extension Network Paper 83. Overseas Development Institute, London. 16 p. Tripp, S., M. Grueber, A. Yater, and D. Yetter. 2018a. Land‐grant university research as a driver of progress in agriscience. p. 189–222. In: N. Kalaitzandonakes, E. Carayannis, E. Grigoroudis, and S. Rozakis (eds.), From agriscience to agribusiness. Theories, policies, and practices in technology transfer and commercialization. Springer, Cham, Switzerland. 490 p. 10.1007/978‐3‐319‐67958‐7. Tripp, S., J. Simkins, A. Yetter, and D. Yerrer. 2018b. Agriscience innovation at land‐grant universities, measured by patents and plant variety protection certificates as proxies. p. 223–235. In: N. Kalaitzandonakes, E. Carayannis, E. Grigoroudis, and S. Rozakis (eds.), From agriscience to agribusiness. Theories, policies, and practices in technology transfer and commercialization. Springer, Cham, Switzerland. 490 p. 10.1007/978‐3‐319‐67958‐7. UPOV. 1978. Act of 1978 International Convention for the protection of new varieties of plants of December 2, 1961, as revised at Geneva on November 10, 1972, and on October 23, 1978. UPOV, Geneva, Switzerland. 22 p.

212

Stephen Smith

UPOV. 1991. Act of 1991 International Convention for the protection of new varieties of plants of December 2, 1961, as revised at Geneva on November 10, 1972, on October 23, 1978, and on March 19, 1991. UPOV, Geneva, Switzerland. 25 p. UPOV. 2005. UPOV Report on the impact of plant variety protection. UPOV, Geneva, Switzerland. 98 p. http://www.upov.int/export/sites/upov/about/en/pdf/353_upov_report.pdf. UPOV. 2012. Explanatory notes on essentially derived varieties. UPOV/EXN/EDV/2 Draft 2. September 17, 2012. UPOV, Geneva, Switzerland. 12 p. UPOV. 2017. Explanatory notes on essentially derived varieties under the 1991 Act of the UPOV Convention. UPOV/EXN/EDV/2. UPOV, Geneva, Switzerland, 13 p. UPOV. nd. Frequently asked questions: For farmers. http://www.upov.int/about/en/faq.html. USDA. 2008. Wheat baseline. 2008–17, updated 12 March 2008. U.S. House. 1930. Report. Purcell quoting from a telegram received from the widow of Luther Burbank. Report No. 1129. 71st Congress, 2nd Session. U.S. Patent Act. 1952. S. Report No. 1979, 82nd Congress, 2nd Session, 5; House of Representatives Report No. 1979, 82nd Congress, 2nd Session, 6 (1952). Washington, DC. U.S. Supreme Court. 1980. Diamond v. Chakrabarty, 447 U.S. 303 (1980) No. 79–136. https://supreme.justia.com/cases/federal/us/447/303/case.html. U.S. Supreme Court. 2001. J.E.M. Ag. Supply, Inc. v. Pioneer Hi‐Bred International, Inc., 534 U.S. 124. No. 99–1996. Argued October 3, 2001, Decided December 10, 2001. Van Brunt, J. 1985. Ex Parte Hibberd: Another landmark decision. Nat. Biotech. 3:1059–1060. Van Overwalle, G. 2009. Gene patents and collaborative cicensing models: Patent pools, clearinghouses, open source models and liability regimes. Cambridge Universities Press. Available at SSRN: https://ssrn.com/abstract=1720104. Van Overwalle, G. 2015. Inventing inclusive patents. From old to new open innovation. p. 206–217. In: P. Drahos, G. Ghidini, and H. Ullrich (eds.), Essays on intellectual property, vol. 1. Edward Elgar, Cheltenham, U.K. Van Wijk, J. and W. Jaffé, W. 1996. Intellectual property rights and agriculture in developing countries. Proceedings of the Seminar on the impact of plant breeders rights in developing countries, March 7–8, 1995, Santa Fé de BogotáÊ, Colombia. University of Amsterdam, Amsterdam, The Netherlands. Van Wijk, A.J.P., N.P. Louwaars, and D.J.F. Eaton. 2004. Framework for the introduction of plant variety protection in developing countries. Wageningen Centre for Genetic Resources, The Netherlands. Van Zanten Plants B.V. v. Hofland B.V. 2008. 310918/KG ZA 08‐594, District Court of the Hague, August 6, 2008 (interim injunction proceedings). Varella, M.D. 2013. Intellectual property and agriculture: The case on soybeans and Monsanto. J. Tech. Law Pol. 18:59–82. Available at: SSRN: https://ssrn.com/ abstract=2145111 or 10.2139/ssrn.2145111. Verkey, E. 2007. Law of plant variety protection. Eastern Book Co., Lucknow, India. 367 p. Vermeulen. 2013. Patent pools: Do they kill innovation? Forbes. https://www.forbes.com/ sites/freekvermeulen/2013/01/22/patent‐pools‐do‐they‐kill‐innovation/#21f09b0b58f4. Wesseler, J., S. Kaplan, and D. Zilberman. 2014. The cost of delaying approval of golden rice. Agric. Res. Econ. Found. Agric. Econ. 17:1–3. Available from: http://giannini. ucop.edu/media/are‐update/files/ articles/V17N3_1.pdf. Wilson, M. 2003. Exchange, patriarchy and status: Women’s home gardens in Bangladesh. p. 211–226. In: P.L. Howard (ed.), Women and plants: Gender relations in biodiversity management and conservation. Zed Press and Palgrave‐MacMillan, London. 298 p. Wilson, A., and J. Latham. 2018. GMO Golden Rice offers no nutritional benefits says FDA. Biotech. Health News, June 3, 2018. https://www.independentsciencenews.org/ news/gmo‐golden‐rice‐offers‐no‐nutritional‐benefits‐says‐fda/.

APPLICATION OF INTELLECTUAL PROPERTY PROTECTION

213

WIPO. 2003. Introduction to plant variety protection under the UPOV Convention. UPOV, Geneva, Switzerland. 27 p. http://www.wipo.int/edocs/mdocs/sme/en/wipo_ ip_bis_ge_03/wipo_ip_bis_ge_03_11‐main1.pdf. WIPO. 2004a. WIPO intellectual property handbook: Policy, law and use. WIPO. Geneva, Switzerland. 488 p. WIPO. 2004b. Intellectual property, traditional knowledge, and genetic resources. Policy, law and current trends. WIPO National Seminar on intellectual property for faculty members and students of Ajman University. Ajman, May 5 and 6, 2004. WIPO/IP/UNI/ DUB/04/10. Geneva, Switzerland. 34 p. http://www.wipo.int/edocs/mdocs/arab/en/ wipo_ip_uni_dub_04/wipo_ip_uni_dub_04_10.pdf. WIPO. 2015. Intellectual property for agri‐food small and medium enterprises. WIPO, Geneva, Switzerland. 365 p. http://www.uibm.gov.it/attachments/FINAL%20Guide_ for_IP%20Agri‐food%20SME%20_Italian_publication_EN_GBA‐Jaiya.pdf. WIPO. 2016. Understanding copyright and related rights. WIPO, Geneva, Switzerland. 40 p. WIPO. nda. Geographical indicators: An introduction. WIPO, Geneva, Switzerland. 44 p. http://www.wipo.int/edocs/pubdocs/en/geographical/952/wipo_pub_952.pdf. WIPO. Ndb. Traditional knowledge and intellectual property—Background brief. http:// www.wipo.int/pressroom/en/briefs/tk_ip.html. Witthaus, M. 2006. Superposición y contradicciones en la legislación Argentina sobre derechos del obtentor y derechos de patentes. p. 243–268 In: M. Rapela and G. Schötz (eds.), Innovación y propiedad intelectual en mejoramiento vegetal y biotecnología agrícola: Estudio interdisciplinar y propuestas para la Argentina. Heliasta: Centro de Propiedad Intelectual (CPI). Univ. Austral, Buenos Aires, Argentina. Wolf, C. 2015. Patent fairness and international justice. The WIPO J. 7:62–72. World Bank. 2006. Intellectual property rights: Designing regimes to support plant breeding in developing countries, http://siteresources.worldbank. org/INTARD/ Resources/IPR_ESW.pdf. World Food Prize. 2013. 2013—Van Montagu, Chilton, Fraley. World Food Prize, Des Moines, IA. https://www.worldfoodprize.org/index.cfm?nodeID=88095&audienceID=1. WTO. nd. Uruguay Round Agreement: Trips. Part II—Standards concerning the availability, scope and use of intellectual property rights. Section 3: Geographical indications. https://www.wto.org/english/docs_e/legal_e/27‐trips_04b_e.htm. Zappalaglio, A. 2015. The protection of geographical indications: Ambitions and concrete limitations (December 1, 2014). Edinburgh Student Law Review, 2014 Postgraduate Conference Special Series, vol. 2, Issue 4, 2015. Available at SSRN: https://ssrn.com/ abstract=2615779. Zerbe, N. 2005. Biodiversity, ownership, and indigenous knowledge: Exploring legal frameworks for community, farmers, and intellectual property rights in Africa. Ecol. Econ. 53:493–506. Zhao, Z. 2006. The Africa Biofortified Sorghum Project—Applying biotechnology to develop nutritionally improved sorghum for Africa. Biotechnology and sustainable agriculture 2006 and beyond. p. 273–277. In: Zhihong XuJiayang LiYongbiao XueWeicai Yan (eds.), Biotechnology and sustainable agriculture 2006 and beyond. Proceedings of the 11th IAPTC&B Congress, August 31–September 18, 2006, Beijing, China. Springer. 318 p. Zimmer, F.‐J., and M. Grammel. 2015. Plant patents in Europe. Grunecker, Patent Attorneys and Attorneys at Law. July 16, 2015. Munich. 15 p. https://pdfs.semanticscholar.org/ 4d71/4f6003fe65f6d2e359e66b1ded2426d4a694.pdf.

6 The Use of Endosperm Genes for Sweet Corn Improvement: A review of developments in endosperm genes in sweet corn since the seminal p ­ ublication in Plant Breeding Reviews, Volume 1, by Charles Boyer and Jack Shannon (1984) William F. Tracy Department of Agronomy, University of Wisconsin‐Madison, Madison, WI, USA Stacie L. Shuler Syngenta Crop Protection, Slater, Iowa, USA Hallie Dodson‐Swenson Syngenta Seeds, Wilmington, Delaware, USA ABSTRACT Starch produced in the endosperm of cereals is the largest source of calories in the human diet. We know a great deal about the endosperm starch synthesis pathway and much of our understanding is due to the unique biology of maize or corn. The large naked kernels of corn held together as a family by the ear allow easy identification of the frequent endosperm mutations and their Mendelian inheritance. In addition, the large chromosomes of corn allowed mapping of the genes. Many of the mutations used to understand the pathway are lesions in genes that code for enzymes in the pathway. These same mutations have been Plant Breeding Reviews, Volume 43, First Edition. Edited by Irwin Goldman. © 2020 John Wiley & Sons, Inc. Published 2020 by John Wiley & Sons, Inc. 215

216

William F. Tracy, Stacie L. Shuler, and Hallie Dodson‐Swenson

used to improve eating quality and shelf life of sweet corn, allowing what was once a crop important only in North America to become a crop of worldwide importance. Some of these genes also allowed the introgression of non-sweet germplasm from the tropics, to increase adaptation to subtropical and tropical environments and improve resistance to insects and diseases. The high sugar alleles negatively affected germination and seedling vigor, but breeders and seed technologists have worked to reduce these negative effects. kEYWORDS: Zea mays, sweet corn, green corn, fresh corn, starch synthesis, endosperm I.  INTRODUCTION II.  ECONOMICS III.  ENDOSPERM DEVELOPMENT A. Endosperm Starch Accumulation and Storage B. Endosperm Mutants in Sweet Corn 1. Sugary1 2. Shrunken2 (Sh2) 3. Brittle2 4. Brittle1 C. Combining Endosperm Mutants 1. Sugary1, Sugary enhancer1 2. Partial modification IV.  ENDOSPERM MUTANTS, GERMINATION, AND SEEDLING VIGOR IN SWEET CORN V.  FUTURE PROSPECTS LITERATURE CITED

ABBREVIATIONS A1 Anthocyanless1 ADX Amylose extender1, dull1, waxy1 Ae1 Amylose extender1 AGPase ADP‐glucose pyrophosphoylase ATP Adenosine triphosphate BCE Before Common Era Bt1 Brittle1 Bt2 Brittle2 cm Central Mexican allele of su1 DAP Days After Pollination DBE Starch Debranching Enzymes Du1 Dull1 GBSS Granule‐Bound Starch Synthase ha Hectare Isa1 Isoamylase1

The Use of Endosperm Genes for Sweet Corn Improvement

Isa2 Isa3 nc ne pe Sh2 sh2‐i SSI SSII SSIII SSIV SBEI SBEII se1 Su1 su1‐ref Su2 sw U.S. WSP Wx1 Y1 Zpu1

217

Isoamylase2 Isoamylase3 North central allele of su1 North eastern allele of su1 Peruvian allele of su1 Shrunken2 Shrunken2‐intermediate Starch synthase I Starch synthase II Starch synthase III Starch synthase IV Starch branching enzyme I Starch branching enzyme II Sugary enhancer1 Sugary1 Sugary1‐reference Sugary2 South western allele of su1 United States Water Soluble Polysaccharides Waxy1 Yellow endosperm1 Pullulanase

Note: When discussing endosperm alleles in sweet corn it is the convention to only show one gene symbol to represent the homozygous recessive state, e.g., su1 sweet corn. If the locus is heterozygous both alleles are shown, e.g., Su1 su1 or sh2‐r sh2‐i. If a locus is homozygous for the wild type then no gene symbol is shown, e.g., choclo. I. INTRODUCTION In the first volume of Plant Breeding Reviews, Boyer and Shannon (1984) wrote an influential review article entitled “The use of endosperm genes for sweet corn improvement.” At that time, the sweet corn industry was in the early stages of a revolution, the shift from low sugar/short shelf life cultivars to higher sugar/longer lasting types (Marshall and Tracy 2003; Tracy 2017). Boyer and Shannon (1984) described alleles potentially useful in sweet corn and what was known about their molecular and biochemical basis. They also divided the mutants into two classes, which provided breeders with an easy way to predict gene interactions. Generally, the mutants in class 1 are epistatic to those in class 2. Today

218

William F. Tracy, Stacie L. Shuler, and Hallie Dodson‐Swenson

the revolution is complete, with the high sugar types occupying 100% of the fresh market and 70% of processing corn. We now know a great deal more about the molecular and biochemical bases for many of these genes. Prior to the 1950s fresh sweet corn was a luxury limited to summertime in the Northeastern and North Central U.S. and southern Canada. When people in the south ate green corn it was likely to be common (field) corn (Tracy 2017). Sweet corn production in the South was limited by the highly perishable nature of the crop and its susceptibility to diseases and insects. The development of pesticides addressed the later issue and the former was solved by the development of supersweet sweet corn based on the shrunken2 (sh2) allele (Tracy 2017). Anywhere corn for grain is grown, people eat green corn harvested roughly 21 days after pollination when the kernels are soft and succulent. Often this is simply the common grain corn harvested early (Tracy 2001), but sometimes the corn has been bred specifically for fresh consumption such as the Andean chocleros and the waxy corns of east Asia. What distinguishes sweet corn from these starchy corns is the presence of one or more recessive alleles that modify the carbohydrate composition of the endosperm, especially reducing starch content and increasing sugar (Tracy 2001). In the grasses, the result of double fertilization is a single seeded fruit known as a caryopsis or kernel. The caryopsis consists of the three main parts, the pericarp, a diploid embryo, and a triploid endosperm, which make up roughly three‐quarters of the corn kernel. During germination the endosperm supplies energy to the developing seedling (Kiesselbach 1950). In a mature grain corn kernel, the endosperm consists of approximately 80% starch, 10% protein, 2% sugar, and 8% fiber. When you eat corn on the cob, you bite into immature kernels consisting mainly of endosperm and pericarp. The first sensation you get is ease of shearing through the pericarp, the outer layer of the kernel. Is it tough or tender? The thinner the pericarp the more tender (Culpepper and Magoon 1927; Bailey and Bailey 1938; Tracy and Galinat 1987). The pericarp is the remnants of the ovary wall, and thus maternal tissue. The second sensation will be flavor determined mainly by sweetness. Soon after flavor, you will perceive texture (mouthfeel). Is it creamy, watery, gritty, sticky? Flavor and texture are determined by the genetics of the endosperm. The main determinant of flavor is sweetness, primarily the amount of sucrose (Reyes et al. 1982). Texture or mouthfeel is due to the amount of starch and the ratio of starch and water‐soluble polysaccharides (WSP). A high starch ratio results in undesirable dry or gritty texture, while high levels of WSP result in a desirable creamy texture (Dodson‐Swenson and Tracy 2015).

The Use of Endosperm Genes for Sweet Corn Improvement

219

II. ECONOMICS When Boyer and Shannon (1984) published their article in the first volume of Plant Breeding Reviews, sweet corn was an important vegetable crop only in the U.S. and Canada and of growing importance in Japan and Taiwan (Tracy 1993, 1994). Today it is grown and processed all over the world (Lertrat and Pulam 2007). Europe, especially France, Spain, and Eastern Europe, grow corn for canning and freezing, as does South Africa, Australia, and the countries of South America’s southern cone. The most rapid growth is in East and South Asia. Thailand is already established as one of the leaders in producing and exporting processed sweet corn. China’s domestic production and consumption is growing rapidly and India is starting to create a sweet corn industry. It is difficult to document this growth in an academic sense, since seed companies do not publish market shares and the UN Food and Agriculture Organization statistics report green maize production, confounding all of the different green maize types including waxy, which currently has a larger market share in China than sweet corn. The U.S. produced 230,000 ha of sweet corn with a farm gate value of $1.4 billion (USDA 2016). Of commercial U.S. sweet corn 43% was grown for fresh market and 57% was processed. Frozen accounts for roughly 60% of the processed product with 40% canned (USDA 2016). It is likely that China has passed the United States as the number one sweet corn country in terms of total product; if not it soon will. III.  ENDOSPERM DEVELOPMENT Endosperm development in cereals occurs in four stages: syncytial, cellularization, growth and differentiation, and maturation (Bosnes et al. 1992). The syncytium is a single multinucleate cell, formed within 72 hours after pollination. After syncytium formation, mitotic divisions increase within the syncytium and single nucleate cells are formed (cellularization) (Olsen 2001; Scanlon and Takacs 2009). Following cellularization, four distinct endosperm tissues differentiate: starchy endosperm, aleurone, basal endosperm transfer layer, and embryo surrounding region. Differentiation is visible 6 days after pollination (DAP) (Olsen 2001). The peripheral layer of the endosperm becomes the aleurone (Brown and Lemmon 2007). Aleurone cells remain intact and alive through seed maturity, drydown, and germination (Scanlon and Takacs 2009). As cell division terminates, endoreduplication initiates in the starchy endosperm, increasing the amount of nuclear DNA (Grafi and Larkins

220

William F. Tracy, Stacie L. Shuler, and Hallie Dodson‐Swenson

1995). Cell size and mass within the starchy endosperm increases during endoreduplication, and starch and storage proteins rapidly accumulate (Schweizer et al. 1995). Starch and storage protein deposition peaks with onset of kernel maturation at 12 to 15 DAP (James and ­Myers 2009). As endoreduplication ends, approximately 16 days after pollination, endosperm cells begin programmed cell death, first in centrally located cells and spreading to the outermost starchy endosperm cells 24 to 40 DAP (Young et al. 1997a). A.  Endosperm Starch Accumulation and Storage Starch consists of long chains of glucose polymers arranged into semi‐ crystalline structures (Martin and Smith 1995). In mature grain corn kernels more than 70% of the weight is starch and other polysaccharides, most of which is in the endosperm (Boyer and Hannah 2001). Typical grain corn starch consists of 25% amylose and 75% amylopectin (Hannah 2005; James and Myers 2009). Amylose and amylopectin are long chains of glucose. Amylose is relatively unbranched while amylopectin is more heavily branched. Maize has been a model organism (Preiss 1991; Nelson and Pan 1995; Hannah 2005) to understand the enzymatic steps in the starch synthesis pathway and the associated genes (Fig. 6.1, Table 6.1). Sucrose enters the cytosol and sucrose synthase converts it to fructose and UDP‐glucose, which is converted to glucose‐1‐phosphate. ADP‐glucose pyrophosphoylase (AGPase) catalyzes the conversion of glucose‐1‐phosphate and adenosine triphosphate (ATP) to ADP‐glucose and pyrophosphate (Giroux and Hannah 1994; Beckles et  al. 2001). Shrunken2 (Sh2) encodes the two large subunits of the AGPase tetramer and Brittle2 (Bt2) the two small subunits (Hannah and Nelson 1976; Bae et al. 1990; Bhave et al. 1990). A membrane bound metabolite transporter encoded by Brittle1 (Bt1) moves ADP‐glucose into amyloplasts (Sullivan et al. 1991). In the amyloplast, three classes of enzymes, starch synthases, starch branching enzymes, and starch debranching enzymes, catalyze the conversion of ADP‐glucose to crystalline starch granules. Starch synthases elongate α‐(1→4) linear chains of amylose and amylopectin using ADP‐glucose as the glucosyl donor (James and Myers 2009). In all plants, there are five classes of starch synthases: granule‐bound starch synthase (GBSS), starch synthase I (SSI), starch synthase II (SSII), starch synthase III (SSIII), and starch synthase IV (SSIV). Multiple isoforms of starch synthases are in maize endosperm (Cao et al. 1999, 2000). Starch branching enzymes create α‐(1→6) branch linkages in amylose, amylopectin, and WSP (James and Myers 2009). The α‐(1→6) linkages are made by cleaving an internal α‐(1→4) linkage bond within a linear

The Use of Endosperm Genes for Sweet Corn Improvement

UTP

Sucrose UDP

SuSy

UDPGlc

Fructose

UGPase

221

ATPcytosolic AGPase

Glc-1-P

PPi

ADPGlc

PPi

FK PGI

F-6-P PFK

PGM

PPi

PFP

F-1,6-BP

Glc-6-P

Pi

glycolysis

tiose-P, amino acid precursors cytosol

gluconeogenesis; PPP

ADPGlc plastid AGPase

ATP Glc-6-P

PGM

Glc-1-P

amyloplast non-starch meabolism

PPi

PPase

2 Pi

ADP

SSI SSIIa SSIIIa GBSSI SBEI SBEIIb ISA1 ISA2 PUL1

starch Fig. 6.1.  Pathway of the central carbohydrate metabolism in developing maize kernels. The map is based on the recent literature on maize or higher plant biochemistry. Enzymes and pathways are red and cytosolic substrates are black and substrates in the amyloplast are green. AGPase, ADP‐glucose pyrophosphorylase; DBE, starch debranching enzyme; SBE, starch branching enzyme; SS, starch synthase. From and A. Myers personal communication, with permission.

chain and transferring the released end to a carbon‐6‐hydroxyl. There are two classes of branching enzymes, starch branching enzyme I (SBEI) and starch branching enzyme II (SBEII). Starch branching enzyme II has two isoforms, SBEIIa and SBEIIb (Boyer and Preiss 1981; Fisher et al. 1996; Mizuno et al. 2001). Starch debranching enzymes (DBE) hydrolyze α‐(1→6) glucose linkages and two types of DBE are found in maize, pullulanase‐ and isoamylase‐type (Beatty et  al. 1999; Doehlert and Knutson 1991). Pullulanase is encoded by Zpu1 and has a high affinity towards pullulan, a maltotriose polymer (Rahman et  al. 1998). Three isoforms exist for isoamylase: Su1 (Su1 = Isoamylase1), Isoamylase2 (Isa2), and Isoamylase3 (Isa3). Wild type Su1 has a high affinity towards amylopectin and cannot act on pullulan (Rahman et al. 1998). Isa2 produces

222

William F. Tracy, Stacie L. Shuler, and Hallie Dodson‐Swenson

Table 6.1.  Wild type genes encoding enzymes that are involved in the starch synthesis in maize endosperm (developed from Hannah 2005). Chrom. Gene

Enzyme

Used in sweet corn

References

5

Starch branching enzyme2a Adenylate transporter AGPase small subunit Starch synthase3 Isoamylase2 Sucrose synthase

Yes

Fisher et al. 1996

Yes

Sullivan et al. 1991

Yes

No

Hannah and Nelson 1976 Gao et al. 1998 Kubo et al. 2010 Chourey and Nelson 1976 Hannah and Nelson 1976 Yao et al. 2004

No

Blauth et al. 2002

Yes No Yes yes

James et al. 1995 Zhang et al. 2004 von Mogel et al. 2014 Nelson and Rines 1962 Dinges et al. 2003

5

Amylose‐extender1 (Ae1) Brittle1 (Bt1)

4

Brittle2 (Bt2)

10 6 9

Dull1 (Du1) Isoamylase2 (Isa2) Shrunken1 (sh1)

3

Shrunken2 (Sh2)

5 8 4 6 2 9 2

AGPase large subunit Starch branching Starch branching enzymeIa (SbeIa) enzyme Starch branching Starch branching enzymeIIa (SbeIIa) enzyme Sugary1 (Su1) Isoamylase1 Sugary2 (Su2) Starch synthase2a Sugary Enhancer1 (Se1) Unknown Waxy1 (Wx1) Granule‐bound starch synthase Zeapullulanase1 (Zpu1) Pullulanase

Yes No No Yes

No

a non‐catalytic protein, ISA2, that interacts with ISA1 to form two hete­ romeric protein dimers in maize endosperm (ISA1/ISA2) (Kubo et al. 2010). In addition to the heteromeric complexes, ISA1 forms a homomeric dimer. Pullulanase activity is reduced by up to 50% in su1‐ref kernels, but the reason for this reduction is not understood (Beatty et al. 1999). Isa3 transcripts are found during germination, not during endosperm development (Kubo et al. 2010). B.  Endosperm Mutants in Sweet Corn Today the main allele used in commercial sweet corn is sh2 followed by su1 and se1. However, at least eight loci have been used in commercial sweet corn (Table 6.1). All but one of these are known structural genes coding for enzymes in the starch synthesis pathway. Each of these genes have numerous known alleles, sometimes resulting in different phenotypes. For the purposes of understanding the endosperm mutants epistatic relationships and effects on sweet corn endosperm quality and seed

The Use of Endosperm Genes for Sweet Corn Improvement

223

physiology, Boyer and Shannon (1984) divided them into two classes. The three mutants in class 1 are expressed in the cytosol, bt1, b2, and sh2, and result in severe reductions in the total amount of carbohydrate, and large increases in sugar content and decreases in starch. These effects are larger for bt2 and sh2 than for bt1. At 18 to 21 DAP, endosperm homozygous for a class 1 mutant has four to eight times more sugar than wild type endosperm (Laughnan 1953; Cameron and Teas 1954; Creech 1968; Jennings and McComb 1969; Holder et  al. 1974a, 1974b; Tsai and Glover 1974; Nelson 1980; Churchill and Andrew 1984). Due to high sugar levels in sh2, bt1, and bt2 endosperm, cultivars of these genotypes are often called supersweet. All three mutants have been used in commercial sweet corn. The class 1 mutants are generally epistatic over the class 2 mutants, amylose extender1 (ae1), dull1 (du1), sugary1 (su1), and waxy1 (wx1), which are expressed in the plastid. Class 2 mutants change the proportions of polysaccharides and sugars in the kernel, with relatively small changes in total carbohydrate content (Creech 1965, 1968). An eighth allele, sugary enhancer1 (se1), is widely used in commercial sweet corn, but its function is unknown. Combinations of any of these alleles result in synergistic effects, further reducing polysaccharide concentration and increasing sugar content. Creech (1965, 1968) carried out extensive studies comparing the effects of single, double, and triple combinations of mutants on endosperm carbohydrate composition. He found that the combination of ae1, du1, and wx1 result in sugar levels equivalent to the supersweets. The individual alleles or double combinations do not produce enough sugar to make desirable sweet corn. Garwood and Creech (1979) released a hybrid, ‘PennfreshADX’, based on these three loci. There were a few other commercial hybrids based on these alleles, but ADX types were never widely used, probably due to the difficulties of working with three recessive loci. 1. Sugary1. Until the 1960s, sweet corn was defined by the presence of a recessive allele at su1. We know from archeological and anthropological studies that most people who cultivated maize had isolated and maintained populations homozygous for recessive su1 alleles. As early as 2,000 BCE Andean people were cultivating a race of corn, ‘Chulpi’, that is still, today, homozygous for an su1 allele (Tracy 1999). Defective su1 alleles were independently isolated and maintained by indigenous farmers at least four times (Tracy et al. 2006). Three of the alleles: northeastern (ne also known as su1‐ref), northcentral (nc), and southwestern (sw) contain single amino acid substitutions within the

224

William F. Tracy, Stacie L. Shuler, and Hallie Dodson‐Swenson

functional domain of the protein. These three produce a non‐catalytic protein (Rahman et  al. 1998; Dinges et  al. 2001). The fourth allele, central Mexico (cm), contains a 1300bp transposable element in exon 1 and makes no protein. The appearance of Chulpi kernels indicates that the protein has some catalytic function but the lesion is unknown. The five su1 alleles described by Tracy et al. (2006) were analyzed for differences in carbohydrate concentrations, kernel composition, and seedling emergence. Significant differences were found among the five alleles for all traits evaluated (Trimble et  al. 2016). Consistently, the northeastern allele ranked lowest for starch concentration and field germination while the Peruvian allele ranked the highest (Trimble et al. 2016). There are numerous other known mutants; su1‐ref, su1‐Bn2, su1‐ st, su1‐am, su1‐P, and su1‐cr are some of the earlier alleles discovered at the su1 locus (https://www.maizegdb.org/gene_center/gene/su1). Most commercial temperate hybrids have the su1‐ref (su1‐ne) allele but it is possible that other alleles are being used commercially. When Boyer and Shannon published the 1984 chapter, the bioche­ mical function of su1 was unknown. We now know that the wildtype Su1 allele produces ISA1, a starch debranching enzyme required for the production of normal semi‐crystalline starch granules. Starch debranching enzymes cleave misplaced α‐1,6 linkages and are required for normal starch development (Lavintman 1966). Three isoforms exist for isoamylase: Su1 (Su1=Isoamylase1), Isoamylase2 (Isa2), and Isoamylase3 (Isa3). Su1 has a high affinity towards amylopectin and has no ability to act on pullulan (Rahman et  al. 1998). Su1‐ref produces an ISA1 protein at levels not different from wildtype, but the enzyme is inactive. Su1 is expressed at greater levels during endosperm development than Isa2 or Zpu1 (Kubo et al. 2010). Isa2 produces a non‐catalytic protein, ISA2, that interacts with ISA1 to form two heteromeric protein dimers in maize endosperm (ISA1/ISA2) (Kubo et al. 2010). In addition to the heteromeric complexes, ISA1 forms a homomeric fraction with itself. In the presence of su1‐ref, all three protein complexes are inactive (Kubo et al. 2010). No natural mutants of Isa2 are known, but a Mutator‐induced allele, isa2‐339 exists (Kubo et  al. 2010). In the presence of isa2‐339, Su1 results in only a homomeric ISA1 protein complex, but wildtype levels of starch (Kubo et al. 2010). An experiment conducted by De Vries and Tracy (2016) concluded that the dosage of the su1‐ref allele in homozygous isa2‐339 kernels resulted in significantly different carbohydrate profiles. Specifically, endosperm with three doses of Su1 accumulated the greatest amount of starch followed by lines containing two doses

The Use of Endosperm Genes for Sweet Corn Improvement

225

and one dose of Su1. Lines homozygous for su1‐ref and isa2‐339 had significantly less starch and greater WSP than lines homozygous for su1‐ref and Isa2, indicating a role of the ISA2 protein. Repetition of this work in different genetic backgrounds will help determine the effect of the Isa2 allele on endosperm development. When a functional ISA1 enzyme is not produced the amount of starch decreases with increases in sugar and WSP. Mature kernels with a defective allele are wrinkled, with a glassy translucent endosperm (Garwood and Creech 1972). At 20 days after pollination (DAP) the dried whole kernel of su1 corn was comprised of 16% total sugars, 22.8% water‐soluble polysaccharide, and 28% starch, while wild type maize endosperm was 6% total sugars, 3% water‐soluble polysaccharide, and 66% starch (Creech 1965) (Table  6.2). The resulting corn based on su1 is slightly sweet and has a creamy mouthfeel. Creaminess

Table 6.2.  Carbohydrate content in the endosperm of five genotypes at four harvest stages (modified from Creech 1968). Genotype

Kernel age (days)

Total sugars (%)

WSP* (%)

Starch (%)

Total carbohydrates (%)

Normal

16 20 24 28 16 20 24 28 16 20 24 28 16 20 24 28 16 20 24 28 –

17.6 5.9 4.8 3.0 25.7 15.6 13.1 8.3 28.3 34.8 29.4 25.7 33.1 33.5 27.8 24.5 46.7 38.7 34.3 28.1 5.8

3.7 2.8 2.8 2.2 14.3 22.8 28.5 24.2 5.6 4.4 2.4 5.1 5.0 4.9 4.6 4.9 4.2 3.6 4.5 4.9 4.8

39.2 66.2 69.2 73.4 23.3 28.0 29.2 35.4 22.3 18.4 19.6 21.9 7.2 11.7 14.4 15.7 15.9 26.6 31.1 32.0 7.6

60.5 74.9 76.1 78.6 65.3 66.5 70.8 69.6 56.1 57.6 51.4 52.8 47.3 50.1 46.9 45.4 66.7 68.9 69.9 65.1 7.5

–

10.9

10.4

14.2

15.3

su1

sh2

su1 sh2

ae1 du1 wx1

LSD (0.05) ages within genotypes LSD (0.05) genotypes within ages

*Water soluble polysaccharides.

226

William F. Tracy, Stacie L. Shuler, and Hallie Dodson‐Swenson

is determined by the amount of starch and the ratio of soluble to insoluble polysaccharides (Culpepper and Magoon 1924, 1927; Dodson‐Swenson and Tracy 2015). Dry mature Su1 maize kernels contain between 550 and 700 mg/g of starch and 30 to 50 mg/g of WSP at maturity. The su1‐ref kernels contain between 200 and 300 mg/g of starch and equal proportions of WSP. The significant decrease in starch and accumulation of WSP is attributed to the absence of isoamylase1 DBE activity. In su1 types, sugar content reaches a maximum around 19–22 after pollination, depending on temperature. After this time, the sugar is converted into starch and WSP, resulting in a loss of sweetness over later harvest dates. The mature su1 kernel will have as little as 5% sugar and 1:1 ratio of starch to WSP. The conversion seems to be accelerated after harvest with unrefrigerated su1 ears losing 50% of their sugar content in 24 hours (Garwood et al. 1976) (Table 6.3). Because the sugars are converted to soluble WSP using a refractometer to measure or predict sweetness is not effective (Hale et al. 2005). Cultivars based only on su1 are no longer used in the fresh market and have been replaced by high sugar types. It is still possible to find su1 varieties in seed catalogs often listed as old fashioned or traditional. Supersweet types (sh2) have largely replaced su1 varieties in the processing industry (Marshall and Tracy 2003). In 2018, perhaps Table 6.3.  Carbohydrate content in the endosperm of two genotypes after 0, 1, 2, and 4 days of storage at two temperatures, 4 and 27 °C (modified from Garwood et al. 1976). Time (hour)

Temp. (°C)

Reducing sugar

Sucrose

WSPb

Starch

14.4a 10.5b 12.9a 9.9b 5.7c 4.6c 2.4d

32.6d 38.2bcd 37.0cd 42.7abc 45.2a 41.4abc 43.3ab

12.1a 7.9bc 6.9bc 6.0c 7.3bc 7.4bc 9.2b

36.5a 32.7b 30.6b 33.9ab 29.0b 28.2b 13.5c

0.9a 0.7a 0.7a 0.8a 0.8a 0.8a 0.6a

2.9b 5.0ab 5.9a 5.6a 5.2a 8.3a 9.7a

sugary1 0 24 48 96 24 48 96

– 4 4 4 27 27 27

6.0a 5.0ab 4.8abcd 4.9b 3.7c 3.6cd 3.1d shrunken2

0 24 48 96 24 48 96

– 4 4 4 27 27 27

5.3d 7.0abc 7.9a 7.6ab 5.7cd 6.0cd 4.4d

The Use of Endosperm Genes for Sweet Corn Improvement

227

30% of the processing market is su1 but most observers believe that eventually su1 will account for less than 20% of the pack. 2.  Shrunken2 (sh2).  Burnham (1944) described sh2 to be similar to shrunken1 (sh1) and Mains (1949) showed that it was not allelic to sh1. The sh2 locus is located on the long arm of chromosome 3 (Coe et al. 1988; Kramer et al. 2012). In 1953 Professor John Laughnan (1953), a geneticist at the University of Illinois, Urbana‐Champaign, suggested that sh2 would be useful in the sweet corn industry. In the early 1950s Professor Laughnan was researching the genetics of tightly linked genes (Laughnan 1961; Tracy 1997, 2017). He was using one stock due to very tight linkage between sh2 and anthocyanless1 (a1). He received the stock from Professor E.B. Mains of the University of Michigan. Mains (1949) described the origin of the stock as from a self‐pollination he made in 1943. Mains also wrote that that plant derived from a cross he made in 1942 between a “commercial seed of unknown ancestry” and “seed which was 12 years old.” In recent years an urban legend has arisen that the source of the sh2 mutation was from exposing corn kernels to radiation from atomic testing in 1946. A short digression is appropriate here to examine that claim. Given Mains (1949) timeline above, it seems unlikely that this particular sh2 allele was derived from exposure to radiation. The root of the confusion is likely because, for the 1961 article, Professor Laughnan used the unfortunate title “Super sweet, a product of mutation breeding in corn.” It is apparent he was not using the phrase “mutation breeding” in the modern sense. Based on breeding history and recent molecular analysis it appears that all sh2 cultivars carry the Mains–Laughnan allele (Gore personal communication). The sweet corn seed industry showed no interest in Laughnan’s new type of corn, considering it what we would call today, a disruptive technology. Laughnan then bred the first sh2 variety himself. In 1961, he released the first supersweet hybrid ‘Illini Xtra Sweet’, which was based on the su1 hybrid, ‘Iochief’ (Laughnan 1961; Tracy 1997, 2017). Illini Xtra Sweet was released in Japan as ‘Honey Bantam’ and had a large role in popularizing sweet corn in Japan (Tracy 2017). Professor Emil Wolf (Wolf 1978; Wolf and Showalter 1974) of the University of Florida at Belle Glade, FL, using sh2 germplasm received from Laughnan, developed another important supersweet hybrid ‘Florida Staysweet’, an sh2 version of the su1 hybrid ‘Iobelle’. Based on this foundation and much subsequent breeding, sh2 hybrids are widely used around the world for both processing and fresh consumption. Supersweet hybrids have been instrumental in increasing the popularity of sweet corn around the world.

228

William F. Tracy, Stacie L. Shuler, and Hallie Dodson‐Swenson

The sh2 allele is a class 1 mutant. Wildtype Sh2 codes for the large subunit of the AGPase tetramer (Hannah and Nelson 1976). Loss of Sh2 gene function, as seen in sh2 mutants, results in elimination of cytosolic AGPase activity, causing a buildup of ADP‐glucose and a decrease in polysaccharides. The commercially used sh2 allele is completely recessive to the wildtype Sh2 allele (Holder et al. 1974a, 1974b). The visual phenotype of the sh2 kernel is shrunken and opaque to tarnished (Garwood and Creech 1972). In a carbohydrate analysis of whole kernels from 20 days after pollination, sh2 endosperm contained 34.8% total sugars, 4.4% water‐soluble polysaccharides, and 18.4% starch (Creech 1965). The sh2 mutant also greatly reduces the weight of the kernel (Laughnan 1953; Cameron and Teas 1954). Since class 1 mutations such as sh2 greatly reduce the amount of polysaccharides produced in the amyloplast, they are usually epistatic to Class 2 mutants that generally modify the types of polysaccharides produced. Sweet corn based on sh2 has become increasingly important over the past 40 years. In the U.S., over 70% of all sweet corn currently used for processing is sh2. The advantages of sh2 compared to traditional su1 sweet corn include greater sugar content, higher kernel moisture content at fresh maturity, and longer shelf life after harvest (Garwood et  al. 1976; Carey et  al. 1982). The sugar levels are high enough that there is no need to add refined sugar to the canned product, as is done with su1 corn. Supersweet types also have a higher recovery rate than su1 hybrids. Recovery is the number of cases of processed product from a ton of raw corn (unhusked) and is affected by kernel depth. The higher recovery is probably due to the increased osmotic potential due to the high sugar content, causing the kernels to expand more than su1 types. Unlike the short shelf life of su1, the conversion of sugar to polysaccharides is greatly slowed in sh2 and the quality is maintained for a longer postharvest period (Garwood et al. 1976; Wong et al. 1994) (Table 6.3). Due to longer postharvest life, sh2 hybrids are now dominant in long‐ distance shipping and the grocery store trade. Recently, improved quality, especially tenderness of fresh market sh2 types, has resulted in the sh2 hybrids displacing su1/se1 hybrids from the local fresh market trade. Incorporation of the sh2 allele has allowed the introgression of diverse maize germplasm. It seems that off flavors that may be contributed by non‐sweet germplasm are masked by the high sugar of sh2 while in su1 backgrounds they were apparent and unacceptable. This has allowed the development of sh2 sweet corn with better pest resistance and adaption to tropical regions (Brewbaker 2015; Lertrat and Pulam 2007; Tracy 1990a, 1990b; Rice and Tracy 2013).

The Use of Endosperm Genes for Sweet Corn Improvement

229

Besides the commercial sh2 allele, there are numerous alleles of Sh2, many of which do not have visible phenotypes that vary from the wildtype Sh2 (Schaeffer et  al. 2011). One allele that does have a visual phenotype is the shrunken2‐intermediate (sh2‐i) allele. The sh2‐ i mutant was produced by Dr. Gyula Ficsor using EMS treatment of the mature kernels (Neuffer 1996). It is also referenced as sh2‐N2340. Like sh2, sh2‐i limits ADP glucose pyrophosphorylase, but it has a “leaky” expression, that is, it produces a small amount of ADP glucose pyrophosphorylase and has an intermediate phenotype compared to sh2. The leaky expression is caused by a G to A transition of the final nucleotide in intron 2 of the sh2‐i mutant compared to the Sh2 allele (Hannah 2001). When this occurs, approximately 10 percent of the sh2‐i transcripts are correctly spliced utilizing the mutant intron splice site. This allows for some starch to be produced in the endosperm. The visual phenotype of sh2‐i is slightly shrunken to plump and opaque. It has been used as a single mutant to produce supersweet hybrids with improved germination. These hybrids have had limited success because the amount of starch results in a negative flavor and mouthfeel. High‐quality hybrids have been developed by combining su1 and sh2‐i (Dodson‐Swenson and Tracy 2015). 3. Brittle2. Like sh2, a lesion in bt2 knocks out production of cytosolic AGPase and has similar biochemical and physiological effects as sh2. The sh2 allele is used worldwide as a single mutation to make high‐ quality sweet corn, while bt2 is not widely used except in combination with other mutants. The difference in usage is mainly due to the historical accident in that Laughnan was working with sh2 stocks rather than bt2 ones. It is interesting to note that Laughnan worked in a sweet corn canning factory when he was in high school (Tracy 2017). 4. Brittle1. Brittle1 (Bt1) codes for a membrane bound metabolite transporter ADP‐glucose into amyloplasts (Sullivan et  al. 1991). Cao and Shannon (1997) detected both BT1 protein and Bt1 transcripts in kernels from about 10 days post‐pollination (DPP) and they increased up to 14 DPP. The BT1 protein level was stable in kernels after 14 DPP. They also found that membranes from amyloplasts with larger starch granules contained more BT1 protein than those having smaller starch granules. These observations together indicated that Bt1 gene expression is developmentally regulated and that BT1 protein level is correlated with starch accumulation in normal maize endosperm. Kirchberger et al. (2007) found that a Bt1 maize homolog, ZmBT1‐2, exhibited a ubiquitous expression pattern in hetero‐ and autotrophic

230

William F. Tracy, Stacie L. Shuler, and Hallie Dodson‐Swenson

tissues, indicating different physiological roles for both maize Bt1 isoforms. They also found that the expression of ZmBT1 is restricted to endosperm tissues during starch synthesis. The recessive bt1 allele is not used singly in temperate sweet corn. It has less sugar at 20 DAP than does sh2 (Lertrat and Pulam 2007; Tracy 1997). In his tropical sweet corn breeding program Professor Jim Brewbaker developed a number of populations and inbreds with bt1 as the major starch synthesis mutant (Brewbaker 2015). This decision was due to Brewbaker’s observations that in the tropics bt1 corn has better germination than sh2 and bt1 and has significantly higher sugar levels and a longer shelf life than su1 (Brewbaker 1971). Tropical sweet corn today is essentially all based on the sh2 allele rather than bt1 (Lertrat and Pulam 2007). This is due to the demand for higher sugar content than is typical for bt1 corn and improved germination of sh2 due to improved genetics, seed production, and seed treatments (Marshall and Tracy 2003). C.  Combining Endosperm Mutants Given the number of genes affecting sugar content in maize endosperm, numerous gene combinations are possible. Some, such as su1 se1, rapidly attained commercial success, whereas others, such as ae1 du1 wx1, have not. New combinations are developed as breeders search for high‐ quality cultivars with excellent seed quality. Many of the combinations are homozygous for one allele while one or more genes are segregating in the homozygous background of the first allele. The most common combination is the double homozygous recessive, su1 se1. 1. Sugary 1, Sugary enhancer1. The sugary enhancer1 (se1) gene (Gonzales et  al. 1976) does not fit neatly into an endosperm‐mutant class or the starch synthesis pathway. For use in sweet corn, se1 is always combined with homozygous su1. When in combination with su1, homozygous se1 results in sugar levels near those of sh2, and WSP levels similar to those of su1, resulting in a high‐quality, sweet, creamy endosperm (Gonzales et  al. 1976; Ferguson et  al. 1979; Azanza et  al. 1996; Schultz and Juvik 2004). In terms of both preharvest and postharvest, su1 se1 loses sugars at a rate similar to su1 (Ferguson et al. 1979), but starts with a higher total sugar content than su1. For maximum quality, sugary enhancer types should be harvested at peak quality and consumed rapidly after harvest. Given its very high quality and the

The Use of Endosperm Genes for Sweet Corn Improvement

231

need for rapid consumption, sugary enhancer has been most useful in local fresh markets and roadside sales. The effects of se1 were originally observed in IL677a, a line developed by Professor A.M. (Dusty) Rhodes of the University of Illinois (Gonzales et al. 1974). Traits characteristic of se1 include elevated total sugar, increased maltose content, pale yellow kernel color, and slow endosperm drying rate (Brink 1978; Ferguson et al. 1978; La Bonte and Juvik 1991; Schultz and Juvik 2004). Professor Rhodes emphasized tenderness in his breeding program (personal communication). As a result, many su1 se1 hybrids have a very tender pericarp and su1 se1 inbreds have served as a source for tenderness genes for the improvement of sh2 lines. IL677a was derived from a three‐way cross [(Bolivia 1035 × IL44b) × IL422a]. The three parents were chosen because of tenderness. For many years it was thought that se1 came from the Bolivian corn but the se1 allele was present in IL44b, an inbred version derived from an Evergreen strain (Zhang et al. 2019). The kernels of Evergreen types are known to dry more slowly than the kernels of most other su1 corn (Galinat 1971). The wildtype gene has been cloned and sequenced (Von Mogel et  al. 2014). It codes for a 200 amino acid protein of unknown function. Sugary Enhancer1 is near the end of the long arm of chromosome 2. The recessive allele used in sweet corn is an absence variant (Zhang et al. 2019). The molecular and physiological functions of the wildtype allele are unknown. Some of the characteristics of se1, such as a pale kernel color and the presence of relatively high levels of maltose, do not lead to a simple hypothesis placing the function of Se1 into the starch synthesis pathway hypothesis. The phenotypic expression of se1 is dependent on the genetic background, making it difficult to visually characterize in many su1 inbreds and essentially impossible to determine the alleles presence or absence in non‐su1 backgrounds. The availability of the sequence has allowed experiments to determine the role of the wild type allele and the effects of the se1 allele in combination with sh2. The commercialization of high‐quality se1 hybrids was relatively slow. The sweet, creamy, tender quality of IL677a quickly resulted in attempts by sweet corn breeders to develop su1 se1 hybrids. In certain genetic backgrounds the Mendelian segregation of se1 allele was observable and many breeders began backcrossing the se1 allele into their elite germplasm. However, two problems arose: first, it was observed that in many genetic backgrounds it was impossible to identify the se1 segregants and, second, breeders realized to develop lines with excellent eating quality a number of recessive modifiers are required to attain high‐quality su1 se1 hybrids (Tracy 1997; George Crookham personal communication).

232

William F. Tracy, Stacie L. Shuler, and Hallie Dodson‐Swenson

2.  Partial modification.  A common form of gene combination is partial modification. Most sweet corn cultivars are single cross hybrids created by crossing two inbreds. Thus, it is relatively simple to create hybrids that are heterozygous for various endosperm genes, resulting in segregation of kernel types on the ear produced for consumption. The most obvious example of this is bicolor sweet corn in which the two inbreds crossed have an allelic difference for Y1, the gene that causes yellow or white endosperm, usually in the homozygous su1 or sh2 background. Since yellow (Y1/Y1) is dominant over white (y1/y1), the seed the farmer plants will be yellow but, on the ear to be consumed there will be a classical Mendelian segregation, three yellow (Y1/‐) kernels to one white (y1/y1) kernel. When new alleles such as sh2 or se1 are being incorporated into the germplasm, partial modification is a rapid way to move in the new alleles. Thus 20 years ago there were numerous hybrids sold with the genotype of su1/su1 Sh2/sh2 or su1/su1 Se1/ se1. Such hybrids would produce ears that were homozygous su1 and segregating 75% Sh2‐/25%sh2 sh2 or 75%Se1‐/25%se1se1, and those 25% classes would have enhanced sweetness. Now that sh2 and se1 breeding has developed numerous well‐performing lines, these types of hybrids are less numerous. Today, to develop ultra‐high quality, many breeders are developing more complex combinations, in which three or more recessive genes are used, leading to partial modification (Courter et al. 1988; Lertrat and Pulam 2007). In one example, triplesweets ‐ su1/su1 Bt2/bt2 Sh2/sh2, the grower plants seed with two genes heterozygous and one homozygous. After meiosis and pollination in the grower’s field, 44% (7/16) of the kernels have elevated sugar levels. A different triple‐sweet type is homozygous for su1 and heterozygous for two defective alleles at Sh2, sh2, and sh2‐i. In this case an su1/ su1 sh2/sh2 inbred is combined with an su1/su1 sh2‐i/sh2‐i inbred, resulting in a 100% modification. Combining sh2 and sh2‐i with su1 results in cultivars with exceptional quality (Dodson‐Swenson and Tracy 2015). The WSP content in the double mutant sh2 su1 was greater than in sh2 and sh2 su1. The sugar content in the double mutant sh2‐i su1 was greater than in su1 or sh2‐i. The su1/su1 sh2‐r/sh2‐i hybrids had quality factors that exceed both sh2 and su1 commercial hybrids. One downside of the partial modification is that the raw product is variable, because the ear has two (or more) genetically distinct types of kernels. Kernels with a different sugar content can respond differently to processing. Depending on cooking temperatures, certain types of kernels can become tannish or brown and browning of the kernels is caused when reducing sugars, such as glucose and fructose, undergo

The Use of Endosperm Genes for Sweet Corn Improvement

233

Maillard browning reactions (Chevalier et al. 2001). This problem may be avoided by adjusting the blanching temperature. Seed companies have used numerous names to describe these combinations: synergistics, augmented, triplesweets, multisweets, gourmet sweets, tablesweets, which can be quite confusing for growers and breeders. The names are specific to companies and can sometimes mean different types of combinations. IV. ENDOSPERM MUTANTS, GERMINATION, AND SEEDLING VIGOR IN SWEET CORN One of the reasons companies were reluctant to incorporate sh2 into the breeding programs is that sh2 kernels germinated more poorly than su1 types. Corn cultivars based on the su1 allele germinate well under cold soil conditions (Hotchkiss et al. 1997; Revilla et al. 2003). Of course, su1 had been selected for viability for hundreds if not thousands of years. Early in their development, the high sugar endosperm types, especially the class 1 mutants, had very poor germination and seedling vigor. A number of studies have linked the reduced levels of carbohydrates in endosperm mutants to changes in percent germination (Juvik et al. 2003; Douglass et al. 1993; Young et al. 1997b; Wann 1986; Parera et al. 1996; Rowe and Garwood 1978). Decreased starch concentrations in the mature kernel result in decreased energy stored for emergence (Douglass et al. 1993). Kernel weights of class 1 mutants are reduced by as much as 50% compared to wild type (Wann 1986; Schmidt and Tracy 1988). Decreased starch and high sucrose content also delay α‐amylase transcription, which would reduce starch hydrolysis early stages in germination (Young et al. 1997b). In addition to the effects of changes in carbohydrate concentration in high sugar hybrids, other kernel properties affecting germination are negatively affected by sh2. Since high sugar kernels have low polysaccharide levels, the endosperm shrinks dramatically during drying and may pull away from the pericarp, leaving blisters or air pockets between the endosperm and pericarp (Juvik et al. 1992; Styer and Cantliffe 1983). The blistered pericarp is susceptible to physical damage during handling (Tracy 1993; Koehler 1957). Intact pericarp protects the seed from rapid influx of water, while a damaged pericarp causes a number of problems, including membrane damage due to rapid influx of water during imbibition, electrolyte leakage, and infection by pathogens (Parera and Cantliffe, 1991; Waters and Blanchette, 1983; Wann, 1986;

234

William F. Tracy, Stacie L. Shuler, and Hallie Dodson‐Swenson

Tracy and Juvik, 1988; Styer and Cantliffe, 1984; Headrick and Pataky, 1989; Headrick et al. 1990). Electrolyte leakage is significantly greater in sh2 kernels than in su1, and it is negatively correlated with percent germination (Styer and Cantliffe 1983; Wann 1986; Schmidt and Tracy 1988). Pericarp blistering is heritable and should be selected against during inbred development. Over the last 30 years germination of high sugar corns has been dramatically improved. In addition to improved genetics, every aspect of seed production, conditioning, and handling has been altered to reduce physical damage to the pericarp and embryo (Marshall and Tracy 2003). After conditioning, high‐sugar seed is treated with seed protectants. The pathogens of most concern at the seedling stage are Pythium spp., Fusarium spp., Rhizoctonia zeae, and Penicillium oxalicum (Berger and Wolf 1974; Smith and White 1988; Headrick and Pataky 1989; Pataky and Eastburn 1992). These pesticidal seed treatments are not available to organic growers. The effectiveness of treatments that can be used by organic growers is strongly influenced by environmental conditions. Small‐scale organic growers who want to grow high‐quality high‐sugar corns germinate the kernels in a greenhouse and transplant. This can only be done on a limited scale and those organic growers who plant hundreds of hectares may need to opt for hybrids with a lower table quality and sow at high panting densities. V.  FUTURE PROSPECTS Sweet corn markets in North America and Japan are mature, per capita consumption is stable, and yield per hectare continues to increase. Thus, hectarage is steady or declining in these regions. The industry has some clear opportunities to expand consumption in these markets. New sweet corn products and packaging, such as lightly processed, ready to eat preparations, microwavable packing for corn on the cob, and corn bred to be eaten fresh like a banana are possibilities. Also new uses for cut corn could be popularized, for example, as toppings for ice cream. In Brazil, sweet corn is a popular topping for pizza and sweet corn milk or juice is a very popular cold beverage in Thailand. In the Wisconsin sweet corn breeding program we are developing reduced sugar fresh corn varieties that can be used in savory dishes, stir fry, soups, and baking (Bugel 2018). Many chefs believe that modern ultra‐ high‐quality sweet corns are too sweet and soft for many dishes. A rebranding or informational program would also be useful. In 2019, as people become more concerned about obesity and other dietary

The Use of Endosperm Genes for Sweet Corn Improvement

235

problems related to the consumption of sucrose, the words sweet and supersweet are negative. However, sweet corn is a vegetable (technically, the kernels are fruits) and an excellent source of certain minerals, vitamins, and phytonutrients including niacin, thiamine, vitamin C, folate, lutein, zeaxanthin, and cryptoxanthin‐ß (USDA 2018). Consumption of lutein and zeaxanthin are believed to be important in protecting against macular degeneration (Abdel‐Al et al. 2013; Koushan et al. 2013). Also, sweet corn is a good source of dietary fiber, iron, magnesium, potassium, and zinc. Sweet corn production and consumption in most of the world is increasing dramatically, especially in China, Southeast Asia, and India (Lertrat and Pulum 2007). These are enormous markets for sweetcorn. They have also proved themselves to be highly entrepreneurial in creating, new products, and preparations. In East Asia considerable work is underway in studying ways that the very popular waxy corn based on the wx1 allele can be made sweet by combing the wx1 and sh2 alleles. In North America, fresh sweet corn has long been enjoyed as a summer treat, while canned corn has been relied on as a low‐cost s­ taple. However, now sweet corn is a worldwide crop, largely due to the use of the sh2 allele, people everywhere are incorporating sweet corn into their local cuisines and finding new uses. Given human creativity and the genetic variability of maize, it is likely that in 20 years there will be new combinations of new alleles that will result in entirely new flavors and textures and uses.

LITERATURE CITED Abdel‐Aal el‐S.M., H. Akhtar, K. Zaheer, and R. Ali. 2013. Dietary sources of lutein and zeaxanthin carotenoids and their role in eye health. Nutrients 5:1169–1185. doi: 10.3390/nu5041169. Azanza, F., Bar‐Zur, A., and Juvik, J.A. 1996. Variation in sweet corn kernel characteristics associated with stand establishment and eating quality. Euphytica 87:7–18. Bae, J.M., M. Giroux, and L.C. Hannah. 1990. Cloning and molecular characterization of the brittle‐2 gene of maize. Maydica 35:317–322. Bailey, D.M., and R.M. Bailey. 1938. The relationship of the pericarp to tenderness in sweet corn. Proc. Am. Soc. Horti. Sci. 36:555–559. Beatty M.K., A. Rahman, H. Cao, et al. 1999. Purification and molecular genetic characterization of ZPU1, a pullulanase‐type starch debranching enzyme from maize. Plant Physiol. 119:255–266. Beckles, D.M., A.M. Smith, and T. ap Rees. 2001. A cytosolic adp‐glucose pyrophosphorylase is a feature of graminaceous endosperm, but not of other starch‐storing organs. Plant Physiol. 125:818–827.

236

William F. Tracy, Stacie L. Shuler, and Hallie Dodson‐Swenson

Berger, R.D., and E.A. Wolf. 1974. Control of seedborne and soilborne mycoses of ‘Florida Sweet’ corn by seed treatment. Plant Dis. Report 58:922–923. Bhave, M.R., S. Lawrence, C. Barton, and L.C. Hannah. 1990. Identification and molecular characterization of shrunken‐2 cDNA clones of maize. Plant Cell 2:581–588. Blauth, S., K.N. Kim, J. Klucinec, et al. 2002. Identification of mutator insertional mutants of starch‐branching enzyme I (sbeI) in Zea mays L. Plant Mol. Biol. 48:287–297. doi: 10.1023/A:1013335217744. Bosnes, M., F. Weideman, and O.A. Olsen. 1992. Endosperm differentiation in barley wild‐type and sex mutant. Plant J. 2:661–674. Boyer, C.D., and L.C. Hannah. 2001. Kernel mutants of corn. p. 1–31. In: A.R. Hallauer (ed.), Specialty corns, 2nd edn. CRC Press, New York. Boyer, C. D., and J. Preiss. 1981. Evidence for independent genetic control of the multiple forms of maize endosperm branching enzymes and starch synthases. Plant Physiol. 67:1141–1145. Boyer, C.D., and J. Shannon. 1984. The use of endosperm genes for sweet corn improvement. Plant Breeding Rev. 1:139–161. Brewbaker, J.L. 1971. Breeding tropical supersweet corn. Hawaii Farm Science 20:7–9. Brewbaker, J.L. 2015. Breeding tropical vegetable corns. Plant Breeding Rev. 39:125–198. Brink, R.A. 1978. Identity and sources of a sugar enhancer gene significant for sweet corn quality. Maize Genetics Coop. Newsletter 52:110. Brown, R.C., and B.E. Lemmon. 2007. The developmental biology of cereal endosperm. p. 120. In: O.A. Olsen (ed.), Endosperm, vol. 8. Springer‐Verlag, Berlin/Heidelberg, Germany. Bugel, J. 2018. Developing culinary corn: Establishing a collaborative process for breeding savory vegetable corn. MS Thesis, University of Wisconsin‐Madison, Madison, WI. Burnham, C.R. 1944. Midrib color. Maize Genetic Coop. Newsletter 18:15. Cameron, J.W., and J.H. Teas. 1954. Carbohydrate relationships in developing and mature endosperms of brittle and related maize genotypes. Am. J. Bot. 41:50–55. Cao, H.P., and J.C. Shannon. 1997. BT1, a possible adenylate translocator, is developmentally expressed in maize endosperm but not detected in starchy tissues from several other species. Physiol. Plantarum 100:400–406. Cao, H., J. Imparl‐Radosevich, H.P. Guan, et al. 1999. Identification of the soluble starch synthase activities of maize endosperm. Plant Physiol. 119:205–215. Cao, H., M.G. James, and A.M. Myers. 2000. Purification and characterization of soluble starch synthases from maize endosperm. Arch. Biochemistry and Biophysics 373:135–146. Carey, E.E., A.M. Rhodes, and D.B. Dickinson. 1982. Post‐harvest levels of sugars and sorbitol in sugary enhancer (su se) and sugary (su Se) maize. HortSci. 17:241–242. Chevalier, F., J.M. Chobert, C. Genot, and T. Haertle. 2001. Scavenging free radicals, antimicrobial, and cytotoxic activities if the Maillard reaction products of beta‐lactoglobulin glycated with several sugars. J. Agric. Food Chem. 49:5031–5038. Chouery, P.S., and O.S. Nelson. 1976. The enzymatic deficiency conditioned by the shrunken‐1 mutations in maize. Biochemical Genetics 14:1042–1055. Churchill, G.A., and R.H. Andrew. 1984. Effects of two maize endosperm mutants on kernel maturity, carbohydrates, and germination. Crop Sci. 24:76–81. Coe, Jr., E.H., D. Hoisington, and M. Neuffer. 1988. The genetics of corn. p. 81–258. In: G. Sprague and J. Dudley (eds.), Corn and corn improvement. American Society of Agronomy, Madison, Wisconsin. Courter, J.W., A.M. Rhodes, D.L. Garwood, and P.R. Mosely. 1988. Classification of vegetable corns. HortSci. 23:449–450.

The Use of Endosperm Genes for Sweet Corn Improvement

237

Creech, R.G. 1965. Genetic control of carbohydrate synthesis in maize endosperm. Genetics 52:1175–1186. Creech, R.G. 1968. Carbohydrate synthesis in maize. Adv. Agron. 20:275–322. Culpepper, C., and C. Magoon. 1924. Studies upon the relative merits of sweet corn for canning purpose and the relation of maturity of corn to the quality of the canned product. J. Ag. Res. 28:403–443. Culpepper, C., and C. Magoon. 1927. A study of the factors determining quality in sweet corn. J. Ag. Res. 34:413–433. De Vries, B.D., and W.F. Tracy. 2016. Characterization of endosperm carbohydrates in isa2–339 maize and interactions with su1‐ref. Crop Sci. 56(5):2277–2286. Dinges, J.R., C. Colleoni, A.M. Myers, and M.G. James. (2001). Molecular structure of three mutations at the maize sugary1 locus and their allele‐specific phenotypic effects. Plant Physiol. 125:1406–1418. Dinges, J.R., C. Colleoni, M.G. James, and A.M. Myers. 2003. Mutational analysis of the pullulanase‐type debranching enzyme in maize indicates multiple functions in starch metabolism. Plant Cell 15:666–680. Dodson‐Swenson, H.G., and W.F. Tracy. 2015. Endosperm carbohydrate composition and kernel characteristics of shrunken2‐intermediate (sh2‐i/sh2‐i Su1/Su1), and shrunken2‐intermediate, sugary1 (sh2‐i/sh2‐i su1/su1) in sweet corn (Zea mays). Crop Sci. 55:2647–2656. Doehlert, D.C., and C.A. Knutson. 1991. Two classes of starch branching enzymes from developing maize kernels. J. Plant Physiol. 138:566–572. Douglass, S.K., J.A. Juvik, and W.E. Splittstoesser. 1993. Sweet corn seedling emergence and variation in kernel carbohydrates reserves. Seed Sci. Technol. 21:433–445. Ferguson, J.E., A.W. Rhodes, and D.B. Dickinson. 1978. The genetics of sugary enhancer (se) an independent modifier of sweet corn (su1). J. Hered. 69:377–380. Ferguson, J.E., D.B. Dickinson, and A.W. Rhodes. 1979. Analysis of endosperm sugars in a sweet corn inbred (Illinois 677a) which contains the sugary enhancer gene and a comparison of se with other corn genotypes. Plant Physiol. 63:416–420. Fisher, D.K., M. Gao, K.N. Kim, et al. 1996. Allelic analysis of maize amylose extender locus suggests that independent genes encode starch branching enzymes IIa and IIb. Plant Physiol. 110:611–619. Galinat, W.C. 1971. The evolution of sweet corn. Mass. Ag. Exp. Sta. Bull. 591. Gao, M., J. Wanat, P.S. Stinard, et al. 1998. Characterization of dull1, maize gene coding for a novel starch synthase. Plant Physiol. 10:399–412. Garwood, D.L., and R.G. Creech. 1972. Kernel phenotypes of Zea Mays L. genotypes possessing one to four mutated genes. Crop Sci. 12:119–121. Garwood, D.L., and R.G. Creech. 1979. Pennfresh ADX hybrid sweet corn. HortSci. 14:645. Garwood, D.L., F. McArdle, S. Vanderslice, and J. Shannon. 1976. Postharvest carbohydrate transformations and processed quality of high sugar maize genotypes. J. Am. Soc. Hort. Sci. 101:400–404. Giroux, M.J., and L.C. Hannah. 1994. ADP‐glucose pyrophosphorylase in shrunken‐2 and brittle‐2 mutants of maize. Mol. Gen. Genet. 243:400–408. Gonzales, J.W., A.W. Rhodes, and D.B. Dickinson. 1974. A new inbred with high sugar content in sweet corn. HortSci. 9:79–80. Gonzales, J.W., A.W. Rhodes, and D.B. Dickinson. 1976. Carbohydrate and enzymic characterization of a high sucrose sugary inbred line of sweet corn. Plant Physiol. 58:28–32. Grafi, G., and B.A. Larkins. 1995. Endoreduplication in maize endosperm: Involvement of M phase‐promoting factor inhibition and induction of S phase‐related kinase. Science 269:1262–1264.

238

William F. Tracy, Stacie L. Shuler, and Hallie Dodson‐Swenson

Hale, T.A., R.L. Hassell, and T. Phillips. 2005. Refractometer measurements of soluble solid concentration do not reliably predict sugar content in sweet corn. HortTech. 15:668–672. Hannah, L.C. 2001. Mutant genes encoding plant ADP‐glucose pyrophosphorylase and methods of use. U.S. Patent 6,184,438. Filed November 19, 1998, and issued February 6, 2001. Hannah, L.C. 2005. Starch synthesis in the maize endosperm. Maydica 50:497–506. Hannah, L.C., and O.E. Nelson. 1976. Characterization of ADP‐glucose pyrophosphorylase from shrunken‐2 and brittle‐2 mutants of maize. Biochemical Genetics 14:547–560. Headrick, J.M., and J.K. Pataky. 1989. Resistance to kernel infection by Fusarium moniliforme in inbred lines of sweet corn and the effect of infection on emergence. Plant Dis. 73:887–892. Headrick, J.M, J.K. Pataky, and J.A. Juvik. 1990. Relationships among carbohydrate content of kernels, condition of silks after pollination, and the response of sweet corn inbred lines to infection of kernels by Fusarium moniliforme. Phytopath. 80:487–494. Holder, D.G., D.V. Glover, and J.C. Shannon. 1974a. Interaction of shrunken‐2 with five other carbohydrate genes in corn endosperm. Crop Sci. 14:643–646. Holder, D.G., D.V. Glover, and J.C. Shannon. 1974b. Interaction of shrunken‐2 and sugary‐1 in dosage series in corn endosperm. Crop Sci. 14:647–648. Hotchkiss, J.R., P. Revilla, and W.F. Tracy. 1997. Cold tolerance among open‐pollinated sweet corn cultivars. HortSci. 32:719–723. James, M.G., and A.M. Myers. 2009. Seed starch synthesis. p. 439–456. In: J.L. Bennetzen and  S.C. Hake (eds.), Handbook of maize: Its biology. Springer Science+Business ­Media, LLC, New York. James, M., D. Robertson, and A. Myers. 1995. Characterization of the maize gene sugary1, a determinant of starch composition in kernels. Plant Cell 7:417–429. Jennings, P.H., and C.L. McComb. 1969. Effects of sugary1 and shrunken2 loci on kernel carbohydrate contents, phosphorylase and branching enzyme activities during kernel ontogeny. Phytochem. 8:1357–1363. Juvik, J.A., M.C. Jangulo, J.M. Headrick, et  al. 1992. Changes in characteristics of kernels in a population of shrunken‐2 maize selected for improved field emergence and increased kernel weight. J. Am. Soc. Hort. Sci. 118:135–140. Juvik, J.A., G.G. Yousef, T. Han, et al. 2003. QTL influencing kernel chemical composition and seedling stand establishment in sweet corn with the shrunken2 and sugary enhancer1 endosperm mutations. J. Am. Soc. Hort. Sci. 128:864–875. Kiesselbach, T.A. 1950. The structure and reproduction of corn. University of Nebraska Press, Lincoln, NE. p. 1–97. Kirchberger, S., M. Leroch, M.A. Huynen, et al. 2007. Molecular and biochemical analysis of the plastidic ADP‐glucose transporter (ZmBT1) from Zea mays. J. Biol. Chem. 282:22481–22491. Koehler, B. 1957. Pericarp injury in seed corn. Ill. Agric. Exp. Sta. Bull. 617. Koushan, K., R. Rusovici, W. Li, et  al. 2013. The role of lutein in eye‐related disease. Nutrients 5:1823–1839. Kramer, V., L.C. Hannah, J.R. Shaw, et al. 2012. Characterization and partial sequence of the sh2‐R insertion. Maize Genetics Conference Abstracts 54:P010. Kubo, A., C. Colleoni, J.R. Dinges, et al. 2010. Function of heteromeric and homomeric isoamylase‐type starch‐debranching enzymes in developing maize endosperm. Plant Physiol. 153:956–969. La Bonte, D.R., and J.A. Juvik. 1991. Sugary enhancer gene located on the long arm of chromosome 4 in maize. J. Hered. 82:176.

The Use of Endosperm Genes for Sweet Corn Improvement

239

Laughnan, J.R. 1953. The effect of the sh2 factor on the carbohydrate reserves in the mature endosperm of maize. Genetics 38:485–499. Laughnan, J.R. 1961. Super sweet, a product of mutation breeding in corn. Seed World. 13 January 1961. p. 18–19. Lavintman, N. 1966. The formation of branched glucans in sweet corn. Arch. Biochem. Biophys. 116:1–8. Lertrat, K., and T. Pulam. 2007. Breeding for increased sweetness in sweet corn. Int. J. Plant Breeding 1:27–30. Mains, E.B. 1949. Heritable characters in maize: Linkage of a factor for shrunken endosperm with the a1 factor with aleurone color. J. Hered. 40:21–24. Marshall, S.W., and W.F. Tracy. 2003. Sweet Corn. p. 537–569. In: P.E. Ramstad and P.  White (eds.), Corn chemistry and technology, 2nd edn. American Association of Cereal Chemists, Minneapolis, MN. Martin, C., and A.M. Smith. 1995. Starch biosynthesis. Plant Cell 7:971–985. Mizuno, K., E. Kobayashi, M. Tachibana, et al. 2001. Characterization of an isoform of rice starch branching enzyme, RBE4, in developing seeds. Plant and Cell Physiol. 42:349–357. Nelson, O.E. 1980. Genetic control of polysaccharide and storage protein synthesis in the endosperms of barley, maize, and sorghum. Adv. Cereal Sci. Tech. 3:41–71. Nelson, O.E., and D. Pan. 1995. Starch synthesis in maize endosperms. Ann. Rev. Plant Physiol. Plant Mol. Bio. 46:475–496. Nelson, O.E., and H.W. Rines. 1962. The enzymatic deficiency in the waxy mutant of maize. Biochemical and Biophysical Res. Comm. 9:297–300. Neuffer, M.G. 1996. An allele of sh2. Maize Genetics Coop. Newsletter 70:18. Olsen, O.A. 2001. Endosperm development; cellularization and cell fate specification. Ann. Rev. Plant Physiol. Plant Mol. Bio. 52:233–267. Parera, C.A., and Cantliffe, D.J. 1991. Improved germination and modified imbibition of shrunken‐2 sweet corn by seed disinfection and solid matrix priming. J. Am. Soc. Hortic. Sci. 116:942–945. Parera, C.A., D.J. Cantliffe, D.R. McCarty, and L.C. Hannah. 1996. Improving vigor in shrunken‐2 corn seedling. J. Am. Soc. Hort. Sci. 121:1069–1075. Pataky, J.K., and D.M. Eastburn. 1992. Disease problems in sh2 seedlings. Midwest Food Processing Crops Manual and Proceedings, Madison, WI, 4:249–251. Preiss, J. 1991. Biology and molecular biology of starch synthesis and its regulation. Oxford Surveys Plant Mol. Cell Biol. 7:59–114. Rahman, A., K. Wong, J. Jane, et al. 1998. Characterization of SU1 isoamylase, a determinant of storage structure in maize. Plant Physiol. 117:425–435. Revilla, P., J.R. Hotchkiss, and W.F. Tracy. 2003. Cold tolerance evaluation in a diallel among open‐pollinated sweet corn cultivars. HortSci. 38:88–91. Reyes, F.G.R., G.W. Varseveld, and M.C. Kuhn. 1982. Sugar composition and flavor quality of high sugar (shrunken) and normal sweet corn. J. Food Sci. 47:753–755. Rice, R.R., and W.F. Tracy. 2013. Combining ability and acceptability of temperate sweet corn inbreds derived from exotic germplasm. J. Am. Soc. Hort. Sci. 138:461–469. Rowe, D.E., and D.L. Garwood. 1978. Effect of four maize endosperm mutants on kernel vigor. Crop Sci. 18:709–712. Scanlon, M.J., and E.M. Takacs. 2009. Kernel biology. p. 121–143. In: J.L. Bennetzen and S.C. Hake (eds.). Handbook of maize: Its biology. Springer Science+Business Media, LLC, New York. Schaeffer, M.L., L.C. Harper, J.M. Gardiner, et al. 2011. MaizeGDB: Curation and outreach go hand‐in‐hand. Database 2011:bar022. http://www.maizegdb.org/.

240

William F. Tracy, Stacie L. Shuler, and Hallie Dodson‐Swenson

Schmidt, D.H., and W.F. Tracy. 1988. Endosperm type, inbred background, and leakage of seed electrolytes during imbibition in sweet corn. J. Am. Soc. Hort. Sci. 113:269–272. Schultz, J.A., and J.A. Juvik. 2004. Current models for starch synthesis and the sugary enhancer1 mutation in Zea mays. Plant Physiol. Biochem. 42:457–464. Schweizer, L., G.L. Yerk‐Davis, T. Phillips, et  al. 1995. Dynamics of maize endosperm development and DNA endoreduplication. Proc. Nat. Acad. Sci. USA 92:7070–7074. Smith, D.R., and D.G. White. 1988. Diseases of corn. p. 687–766. In: G. Sprague and J. Dudley (eds.), Corn and corn improvement. American Society of Agronomy, Madison, Wisconsin. Styer, R.D., and D.J. Cantliffe. 1983. Changes in seed structure and composition during development and their effects on leakages in two endosperms mutants of sweet corn. J. Am. Soc. Hort. Sci. 108:721–728. Styer, R.D., and D.J. Cantliffe. 1984. Infection of two endosperm mutants of sweet corn by Fusarium moniliforme and its effect on seeding vigor. Phytopath. 74:189–194. Sullivan, T.D., L.I. Strelow, C.A. Illingworth, et al. 1991. The maize brittle‐1 locus: Molecular characterization based on DNA clones isolated using the dSpm‐tagged brittle‐ 1‐mutable allele. Plant Cell 3:1337–1348. Tsai, C.Y., and D.V. Glover. 1974. Effect of brittle‐1 sugary‐1 double mutant combination on carbohydrate and postharvest quality of sweet corn. Crop Sci. 14:808–810. Tracy, W.F. 1990a. Potential contribution of five exotic maize populations to sweet corn improvement. Crop Sci. 30:918–923. Tracy, W.F. 1990b. Potential of field corn germplasm for the improvement of sweet corn. Crop Sci. 30:1041–1045. Tracy, W.F. 1993. Sweet corn. P. 777–807. In: G. Kalloo and B.O. Bergh (eds.), Genetic improvement of vegetable crops. Pergamon, Oxford, U.K. Tracy, W.F. 1994. Sweet corn. p. 147–187. In: A.R. Hallauer (ed.). Specialty corns. CRC Press, CRC, Boca Raton, FL. Tracy, W.F. 1997. History, breeding, and genetics of supersweet corn. Plant Breeding Rev. 14:189–236. Tracy, W.F. 1999. Vegetable uses of corn in pre‐Columbian America. HortSci. 34:812–813. Tracy, W.F. 2001. Sweet corn. p. 155–196. In: A.R. Hallauer (ed.), Specialty corns. CRC Press, New York. Tracy, W.F. 2017. John Laughnan: Sweet corn revolution. p. 114–118. In: F.E. Hoxie (ed.), Engine of innovation: The University of Illinois. University of Illinois Press, Urbana, IL. Tracy, W.F., and W.C. Galinat. 1987. Thickness and cell layer number of the pericarp of sweet corn and some of its relatives. HortSci. 22:645–647. Tracy, W.F., and J.A. Juvik. 1988. Electrolyte leakage and seed quality in a shrunken‐2 selected for improved field emergence. HortSci. 23:391–392. Tracy, W.F., S.R. Whitt, and E.S. Buckler. 2006. Recurrent mutation and genome evolution: Example of Sugary1 and the origin of sweet maize. Crop Sci. 46:S49–S54. Trimble, L., S.L. Shuler, and W.F. Tracy. 2016. Characterization of five naturally occurring alleles at the Sugary1 locus for seed composition, seedling emergence, and isoamylase1 activity. Crop Sci. 56:1–13. USDA. 2016. National Agricultural Statistics Service. https://www.nass.usda.gov/Data_and_ Statistics/index.php. USDA. 2018. Food Composition Databases. https://ndb.nal.usda.gov/ndb/search/list? home=true. Von Mogel, K.H., C.N. Hirsch, and S.M. Kaeppler. 2014. Patent. Maize sugary enhancer sequences. Wisconsin Alumni Research Foundation, Madison, WI. U.S. 2 A1. Wann, E.V. 1986. Leaching of metabolites during imbibition of sweet corn seed of different endosperm genotypes. Crop Sci. 26:731–733.

The Use of Endosperm Genes for Sweet Corn Improvement

241

Waters, Jr., L., and B.L. Blanchette. 1983. Prediction of sweet corn field emergence by conductivity and cold tests. J. Am. Soc. Hort. Sci. 108:778–781. Wolf, E.A. 1978. Florida Staysweet. Circ. Fla. Agric. Exp. Stn., Inst. Stn. Food Agric. Sci. Univ. Fla., Gainesville, Florida, S‐259. Wolf, E.A., and R.K. Showalter. 1974. Florida‐Sweet. A high quality sh2 sweet corn hybrid for fresh market. Circ. Fla. Agric. Exp. Stn., Inst. Stn. Food Agric. Sci. Univ. Fla., Gainesville, Florida, S‐226. Wong, A., J.A. Juvik, D. Breeden, and J. Swiader. 1994. Shrunken2 sweet corn yield and chemical components of quality. J. Am. Soc. Hort. Sci. 119:747–755. Yao, Y., D.B. Thompson, and M.J. Guiltinan. 2004. Maize starch‐branching enzyme isoforms and amylopectin structure. In the absence of starch‐branching enzyme IIb, the further absence of starch‐branching enzyme Ia leads to increased branching. Plant Physiol. 136:3515–3523. doi:10.1104/pp.104.043315. Young, T.E., D.R. Gallie, and D.A. DeMason. 1997a. Ethylene‐mediated programmed cell death during maize endosperm development of wild‐type and shrunken2 genotypes. Plant Physiol. 115:737–751. Young, T.E., J.A. Juvik, and D.A. Mason. 1997b. Changes in carbohydrate composition and α‐amylase expression during germination and seedling growth of starch‐deficient endosperm mutants of maize. Plant Sci. 129:175–189. Zhang, X., C. Colleoni, V. Ratushna, et al. 2004. Molecular characterization demonstrates that the Zea mays gene sugary2 codes for the starch synthase isoform SSIIa. Plant Mol. Biol. 54:865–879. Zhang, X., K.J.H. Von Mogel, S.J. Vai, et  al. 2019. Maize sugary enhancer1 (se1): A presence/absence variant of a novel gene affecting endosperm starch metabolism. Submitted PNAS.

7 Gender and Farmer Preferences for Varietal Traits: Evidence and Issues for Crop Improvement Eva Weltzien and Fred Rattunde University of Wisconsin‐Madison, Madison, Wisconsin, USA Anja Christinck Seed4change, Research & Communication, Gersfeld, Germany Krista Isaacs Michigan State University, East Lansing, Michigan, USA Jacqueline Ashby SE Pennywood Road, Portland, Oregon, USA ABSTRACT Varieties with new traits or trait combinations provide farmers with options to succeed and to adapt to changing agroecological and socioeconomic conditions worldwide. The production goals, access to resources and coping strategies and the corresponding varietal traits vary, however, for different groups of farmers, with gender differences often being critical. Although molecular biology advances now enable more targeted use of genetic diversity, our capacity to assess farmer preferences for varietal traits to guide breeding efforts in responding to specific users, women and men remains an open question. This review of the “state of the art” of gender differentiation for varietal trait preferences examines what research was done where, the methods used, the patterns and underlying causes of gender differences for trait preferences, how this

Plant Breeding Reviews, Volume 43, First Edition. Edited by Irwin Goldman. © 2020 John Wiley & Sons, Inc. Published 2020 by John Wiley & Sons, Inc. 243

244

EVA WELTZIEN ET AL.

knowledge can be used and the support needed for gender-responsive breeding. Studies reporting gender-differentiated trait preferences are of worldwide o ­ rigin, with a majority from Sub-Saharan Africa. Diverse crops are covered, with cereals most represented, followed by legume-, root, and tuber, and other vegetatively propagated crops. Women’s preferences focused on production and use-related traits whereas men’s trait preferences were fewer in number and more related to production and marketing. Women also more frequently valued food security traits such as early maturity, multiple harvests, and productivity even in “bad” years or soils. Trait preferences differed when women and men had contrasting roles and responsibilities for various crop production or postharvest activities. They also differed when women and men grew the same crop under different conditions or for different purposes. Diverse methods were used to elicit gender-specific trait preferences, with farmer evaluations of variety trials a frequently used approach. The extent to which the test-varieties differ and the representativeness of participants and trial conditions are issues for generalizing these findings. For all studies it was impossible to say how important any given trait preference is for women and men of a given social class, agro-ecology, or geographic region. Nevertheless, inclusion of complementary women’s and men’s trait preferences in a given variety will facilitate responding to the full range of household needs. The use of gender-specific trait preference information for prioritization and decision making and the need for dedicated studies of gender trait preferences with specialized socioeconomic expertise, particularly within the context of breeding programs, are discussed. The pursuit of multidisciplinary efforts, documentation of findings, transparent priority setting, and institutional leadership are all seen as keys for successful implementation of gender-responsive breeding that contributes to achieving major development goals. KEYWORDS: breeding, development, gender, preferences, traits I.  INTRODUCTION II.  METHODS III.  CASES DOCUMENTING GENDER DIFFERENTIATION FOR TRAIT PREFERENCES A. Spatial, Temporal, and Commodity Distribution B. Authorship C. Research Motivation D. Methods and Tools Used for Differentiating Trait Preferences 1. Farmer sampling 2. Farmer evaluations in variety trials 3. Survey methods 4. Qualitative approaches 5. Analytical approaches IV.  FINDINGS ON GENDER‐SPECIFIC TRAIT PREFERENCES A. Trait Preferences by Value Chain Domains B. Women’s and Men’s Trait Preferences

Gender and Farmer Preferences for Varietal Traits

245

C. Gender Differences for Crop Production‐Related Preferences 1. Responsibilities during the production cycle 2. Crops grown only or predominantly by women or men 3. Contrasting growing conditions or unequal access to resources D. Preferences Related to Postharvest Processing and Food Preparation E. Gender Differences Related to Unequal Resources or Growing Conditions 1. Plant parts and uses 2. Food security concerns V.  ISSUES FOR GENDER‐RESPONSIVE CROP IMPROVEMENT A. Using Gender‐Differentiated Trait Preference Information in Breeding 1. High‐level targeting of breeding programs 2. Defining variety profiles 3. Setting the breeding strategy B. Are Gender‐Specific Varieties Necessary? C. Methods for Understanding and Responding to Gender Differences for Trait Preferences 1. Generalizing understandings and trait prioritization 2. Use of multiple methods 3. Methods for breeder’s engagement with women and men farmers D. Setting Goals for Gender‐Responsive Crop Improvement 1. Need for research dedicated to understanding gender preferences 2. Need for interdisciplinarity and institutional ownership ACKNOWLEDGMENTS LITERATURE CITED

ABBREVATIONS FGD PPB PRA PVS SDG

Focus Group Discussion Participatory Plant Breeding Participatory Rural Appraisal Participatory Variety Selection Sustainable Development Goals

I. INTRODUCTION Plant breeding has contributed to the development of agricultural systems since the beginning of farming, but tools and methods for increasing genetic gains continue to be developed and have turned plant breeding into a highly specialized activity. A general aim of any plant breeding program is to offer varieties to farmers that have advantages for specific, highly relevant traits such as high yielding ability, short growth duration, or host plant resistance to a devastating pathogen or pest. Improvements of specific traits constitute a basis of successful plant breeding.

246

EVA WELTZIEN ET AL.

However, genetic improvements for these specific traits alone may not be sufficient for varieties to be adopted by farmers. Other considerations, dependent on farmers’ specific context and what will make a variety useful to them, can have considerable weight in determining if a variety will be adopted. Hence, understanding the agro‐­ecological context in which a new variety is to be used, including biophysical, social, and political factors, is essential to successful variety development. The relevance and relative importance of these factors may vary, not only for different geographical locations but also for different groups of users (Witcombe et  al. 2005; Weltzien and Christinck 2017; Orr et al. 2018). Gender is one critical category for which differences can be assumed. Gender differences in ways of acting and viewing the world have likely contributed to human survival and development in the past and, hopefully, with awareness and respectful engagement, will do so in the future. The influence of gender differences on farming is fundamental because men and women have unequal control over and access to key productive resources on which agriculture depends (Quisumbing et al. 2014). This is particularly the case for smallholder farmers where women and men have different roles and responsibilities, and where rights and access to production resources differ. Globally, women do about 50% of the labor involved in farming and are closely involved in farm decisions, such as varietal choice (Doss 2014). The effect of new technologies such as plant varieties on unequal workloads, resources, and decision‐making power between men and women smallholders in low‐income countries is pervasive (World Bank 2007; FAO 2011). As a result of these differences, men and women producers make different choices about what to grow. Gender‐differentiated trait preferences, however, were not customarily considered systematically in breeding programs. This can be a disadvantage for breeding programs seeking to contribute to development goals of reducing poverty or improving nutrition, where insufficient attention to gender‐differentiated user preferences and needs can limit the impact of new varieties. Although the importance of user differentiation is increasingly recognized and indigenous trait preferences have been studied for more than 30 years (Brokensha et al. 1980; Haugerud and Collinson 1990; Eyzaguirre and Iwanaga 1996), detailed knowledge on the ways of analyzing gender differentiated preferences and of systematically integrating them into strategic planning for implementing breeding programs is still limited. Gender differences also affect how crops are used in ­postharvest processing and marketing and how different foods are valued by

Gender and Farmer Preferences for Varietal Traits

247

consumers. When new varieties improve productivity and there is ­market opportunity, men may take over crops that were traditionally allocated to women, and this can cause hardship (Goldstein and Udry 2008; Njuki et al. 2016; Galiè et al. 2017; Doss 2018). The tendency for men to take over from women a crop that is commercializing is well‐ documented in Africa (von Braun 1988). Women’s control of income declined as total income increased from commodities like beans, groundnut, and soybeans (Njuki et  al. 2011). When several thousand farmers organized to facilitate access to improved varieties, disease‐free planting material, credit and markets for banana in Kenya, traditionally a women’s semi‐subsistence crop, women producers tended to lose control over the produce and revenues to men (Fischer and Qaim 2012). Similarly, the commercialization of Shea nut in several countries was associated with men becoming increasingly involved in production and decisions about use of revenues from what traditionally was primarily a women’s activity (Kent 2018). This chapter assesses the evidence on gender‐differentiated trait preferences. We approach trait preferences as a way of “understanding the customer” and the reasons why different users have distinct demands for new breeding products. Specifically, we aim to (a) provide an overview of research documenting gender‐differentiated trait preferences; (b) critically review the methods that were used to study those preferences; (c) identify patterns of gender differences for trait preferences and their underlying causes; and (d) consider how these findings can be used and what is needed to support crop improvement programs to implement gender responsive breeding responding to the demands and opportunities for user‐specific agricultural transformations.

II. METHODS This review was conducted as an interdisciplinary effort of plant breeders and social scientists with experience in the topic. The authors decided to base the review exclusively on empirical case studies that provide research‐based evidence for gender‐differentiated, varietal trait preferences. The literature search was therefore designed with six steps to identify only this type of study. Step 1: Literature search in English‐language sources Five scientific literature databases were used (EVAFA, SOWIPORT, JSTORE, CAB, Web of Science) and the search focused on studies and projects that were conducted from 1985 to 2015. The search criteria,

248

EVA WELTZIEN ET AL.

used in various combinations, were: gender, farmer, women, traits, plant breeding, preference, seed, selection, variety. In order to complement the results of this search, researchers who were assumed to have conducted some work in the area were contacted directly and asked for relevant reports or publications, to make the review more complete and bridge possible gaps. Step 2: Establish criteria for the identification and selection of case studies The main selection criterion for including cases in the detailed review was that the papers provided some evidence, quantitative or qualitative, for gender‐differentiated trait preferences. This meant that their research included documenting trait preferences of both men and women. Nonetheless, we included some research focusing on women only if they provided evidence for trait preferences for the given crop. We did not, for example, include research that compared preferences for different crops or preferences for different varieties but gave no explanations for those differences in terms of trait preferences. Step 3: Selection of case studies A total of 39 studies were identified that met the criteria in Step 2. Those studies that corresponded to the above criteria (Step 2) were collated in a database for further evaluation. Step 4: Establish an evaluation matrix for the analysis of case studies An evaluation matrix was established that included basic information, e.g., on the years when data were collected, on regions, countries, cropping systems and crops targeted, on the institutional setting and whether the study was related to a breeding or seed dissemination program. Furthermore, the methods used were analyzed, such as the unit of analysis (e.g., individuals, households, groups, etc.), the number of units analyzed, the socioeconomic data collected (other than gender), the type of methods that were used, and for which other issues (except trait preferences) the study presented gender‐differentiated information (Table 7.1). Step 5: Analyze case studies The evaluation matrix (Step 4) was then applied to each of the case studies selected in Step 3. Step 6: Review, discussion, and summary of results A table was built to classify, group, and describe the studies according to each of the questions of interest for the analysis, e.g., foci of the research, methods used, institutional arrangements, and results

Gender and Farmer Preferences for Varietal Traits

249

Table 7.1.  Template for reviewing publications from the literature search. Origin and context of publication Title, Author, year of publication, date of data collection Agro‐ecological region(s) included Institutional setting (e.g., types of partners involved in project/study) Professional facilitation/researchers trained in social science methods involved?

Region(s) and country(ies) included Type of farming system and crops covered Related to breeding program? Related to seed dissemination program?

Methods used Unit of analysis (individuals, households, groups, communities, etc.) Number of units in the study (N) Size of populations/groups to which the study refers (e.g., in the case of representative samples taken from a larger group: size of this group) Differentiation for other socioeconomic categories (other than gender, e.g., size of landholding, poverty, education, owner/operator versus laborer, ethnic group, etc.) Type(s) of data collection methods used (e.g., survey, ethnography, participant observation, PVS, PRA, on‐farm or on‐station selection, etc.) Trait preferences documented Trait preferences identified in the study (list) Traits preferred by both men and women (list) Traits preferred by men (list) Traits preferred by women (list) Does the study provide a ranking or information on priorities among traits? (yes/no); If yes, is this ranking gender disaggregated? (yes/no) Preference ranking of traits preferred by men (list) Preference ranking of traits preferred by women (list) Does the study also relate these trait preferences to other socioeconomic categories mentioned above? (explain/list results) Have the results been used in a breeding program? (if yes, how/in which way) Have the results been used for seed dissemination, e.g., to choose varieties for dissemination that target preferences of women/men? Does the study report on outcomes/benefits/impacts of using information on gender‐ differentiated trait preferences in a breeding program? (if yes, which outcomes/ benefits/impacts) Sex/gender differentiated data presented for (yes/no): Access to resources (e.g., size of landholdings, soil quality, irrigation) Production process (e.g., labor or other resource input) Type(s) of use On‐farm processing Value chain(s) and/or marketing channels used Control over end‐product(s) and associated benefits Others (which?)

250

EVA WELTZIEN ET AL.

obtained. Preliminary results were discussed among the authors and with participants of the “Gender, Breeding and Genomics” workshop at Nairobi, Kenya, in October 2016 (CGIAR Gender and Breeding Initiative 2017). Reflections on the implications of findings for applied breeding programs were based on concepts from published literature and the authors’ experiences in client‐oriented breeding through long‐term engagement in participatory breeding activities. III. CASES DOCUMENTING GENDER DIFFERENTIATION FOR TRAIT PREFERENCES A total of 39 studies were identified that met the selection criteria described above. Several characteristics of these studies with relevance for plant breeding are examined in this section. A.  Spatial, Temporal, and Commodity Distribution The 39 studies reporting crop trait preferences in a gender‐differentiated manner or described trait preferences covered a wide range of crops and production systems worldwide. Research examining ­staple cereals represented the majority of cases (maize (12), rice (6), sorghum (5), pearl millet (4), and wheat (1)). Other research also examined major food‐ legume crops such as common bean (4) and cowpea (1). Root and tuber crops and other vegetatively propagated crops (sweet potato, c­ assava, and banana) and crops of regional importance (quinoa and Kersting’s groundnut) were represented by one study each. These crops represent the range of breeding systems, from the predominantly cross‐pollinated crops (maize and pearl millet) to primarily self‐pollinated (common bean, cowpea, wheat, rice, and sorghum) and clonally propagated crops (cassava, sweet potato, and banana). The research included in our analysis focused on smallholder producers in developing countries. Most of the research was conducted in Sub‐Saharan Africa (72%), with the remainder coming from Latin America (15%) and Asia (13%). The earliest paper was published in 1993, followed by another six publications up to 2000, and thereafter a quite constant rate of approximately two papers per year. B. Authorship The backgrounds of the case study authors, indicating who and which institutions conducted the research, revealed good gender balance and a diverse array of institutional affiliations. A high level of

Gender and Farmer Preferences for Varietal Traits

251

multi‐institutional collaboration was evident, with 85% of the articles having two or more collaborating institutions and 44% three or more. International and national research organizations, together with universities outside the study country contributed the most frequently. Local universities, farmer organizations, national extension and development institutes, although less frequently, were also important contributors, whereas development NGOs rarely contributed. Lead authorship, however, represented more narrow institutional origins, with international research organizations (44%) and universities outside the study country (33%) predominating, followed by local universities (13%) and national research organizations (10%). C.  Research Motivation The elucidation of gender differences for trait preferences for a specific crop and context was not the primary objective for any research identified for this review. Nor was the main objective to elucidate differences in gender relations. Consequently, the underlying causes for contrasting gender trait preferences are not targeted or well identified in these publications. Most of them were associated with ongoing breeding programs, thus showing that preferences associated with gender differences have been a concern for some crop improvement programs. The remaining publications were social science research focusing on product acceptance, baseline surveys, and ethnobotany. One third of the publications reported findings from participatory breeding programs (Table 7.2), thus documenting long‐term engagements with farmers. A further 21% of the cases focused on acceptability of released varieties and 15% on participatory variety selection focusing on experimental varieties. Thirteen percent of the cases reported details on use of local varieties in the context of in situ conservation of agricultural biodiversity. Ten percent of the cases focused on consumer acceptance of products from new varieties, such as quality protein maize. Many of the publications within each type of research reported using more than one method to characterize gender‐differentiated trait preferences. D.  Methods and Tools Used for Differentiating Trait Preferences A wide range of methods were used by the 39 reviewed publications to understand and describe gender‐specific trait preferences and their underlying causes (Table 7.2). The studies came from diverse research contexts and disciplines and were classified into groups based on the focus of the study to examine the types of methods used by each type.

Table 7.2.  Classification of reviewed papers into type of research and the frequency (%) of specific research methods used to elucidate gender‐differentiated trait preferences and associated crop responsibilities and roles (N = number of papers; PRA = Participatory Rural Appraisal; FGD = Focus Group Discussion). Research Type

N

PRA/FGD (%)

Participatory plant breeding Varietal acceptance Participatory variety selection Biodiversity/in situ conservation Product acceptance Social science/ ethnobotany Baseline/system information Overall*

12

17

8 6

Questionnaire survey (%)

On‐farm observation or selection (%)

On‐station observa­ tion or selection (%)

Other methods (%)

Mean # of method classes

25

42

42

42

1.7

25 33

50 33

50 83

13 17

25 0

1.6 1.7

5

20

80

40

20

20

1.8

4 2

25 0

50 50

25 50

0 0

50 50

1.5 1.5

2

100

100

50

0

0

2.5

39

26%

47%

49%

20%

28%

1.7

*The percentages of papers using a particular research method do not sum to 100 % as many publications reported use more than one method.

0004416674.indd 252

8/31/2019 1:32:03 PM

Gender and Farmer Preferences for Varietal Traits

253

1. Farmer sampling. Most of the publications (60%) described an explicit sampling strategy for including farmers representing the diversity of farmers in the target area(s) for the breeding program or study. PPB research reported such strategies less frequently (40%) as they often relied on partner organizations to identify farmers with specific expertise and knowledge of the crop (Sperling et al. 1993; Bellon 2002; De Groote et al. 2002; Song et al. 2006). The number of farmers contributing to the results reported in the publications reviewed ranged from 11 (McElhinny et al. 2007) to many hundred farmers (Pingali et  al. 2001; Kerr et  al. 2007; Manzanilla et  al. 2014). Research with few participants often included more detailed observations and used qualitative social science methods (Assefa et  al. 2005; Lope‐Alzina 2007). PPB and biodiversity‐related cases generally reported results from an intermediate number (30–120) of farmers, but included results over several years and steps of interactions with farmers with varying numbers of participants for each step (Mulatu and Belete 2001; Christinck 2002; Kudadjie 2006; Teeken et al. 2012). The extent to which the same farmers contributed to the different steps was not reported. 2. Farmer evaluations in  variety trials. Analysis of farmers’ variety evaluations or decisions made in variety trials was the approach most commonly used for studying gender differentiation for trait preferences: 49% of studies used on‐farm trials and 20% used on‐station trials (Table  7.2). The approach used for eliciting farmer evaluations was not uniform: some research held prior farmer discussions about which traits to use for variety evaluations with women and men separately, before conducting the farmers’ evaluations of varieties in a given trial (Dorward et al. 2007; vom Brocke et al. 2010). Most of the research, however, reported farmers’ ratings of varieties for traits predetermined by the scientists. Some studies used a follow‐up discussion after conducting such farmer variety evaluation in which men and women farmers could explain their reasons for choosing or rejecting specific varieties. Scientists mostly documented for which traits women’s and men’s preferences differed and sometimes summarized the reasons for these differences (Assefa et al. 2005). The findings on trait preferences and their gender differentiation based on farmer variety evaluations depend on the diversity of traits exhibited by the varieties being tested. If the varieties under test do not express a trait or do not differ for it, preferences for that trait may be not be documented. Inclusion of test cultivars based on some prior understanding of women’s roles, responsibilities, and production objectives would therefore be important.

254

EVA WELTZIEN ET AL.

Most of the research did not explain whether hypotheses about gender differences for production objectives or responsibilities influenced the breeders’ choice of varieties for farmer evaluation. The composition of the varieties under evaluation is important as the diversity and range of traits exhibited by these varieties will influence what traits may be observed and preferred. Men and especially women farmers’ resource constraints often limit the number of varieties they can test in their own fields, thus limiting the trait diversity available for observation. Research that conducted farmer evaluations in separate or complementary on‐station trials (e.g., Sperling et  al. 1993; Weltzien et  al. 1998; Assefa et  al. 2005) strive to overcome this limitation, albeit under production conditions that may differ from the farmers’ environments. The timing of the farmer evaluation(s) will also determine which trait differences may be observable. Most farmer variety evaluations in these research undertakings were conducted in the field before harvest, enabling observation of production‐related traits, but not necessarily postharvest quality traits for which women may be more discerning. Some evaluations were conducted during two or three stages of crop development (Gridley 2002) or specifically after harvest (Baidu‐Forson 1997; Assefa et al. 2014). The growing conditions for the trials and their pertinence for specific farmers were infrequently documented in the studies reviewed. The trial field conditions in which evaluations are conducted can impact what trait preferences can be documented. For example, on‐farm cereal trials in men’s fields managed only by men may not permit observation of adaptation traits for contrasting management practices typical for women. One approach to remedying this is to establish separate, smaller trials adapted to intercropping that women could conduct in their own fields (Rattunde et al. 2018). 3. Survey methods. Surveys with questionnaires using a sampling strategy to select respondents were used in 47% of the publications reviewed (Table  7.2). These surveys often interviewed a large number of respondents for a specific situation or time (Smale et al. 1999; De Groote et  al. 2002; Baafi et  al. 2015). Such questionnaires characterized respondents, e.g., their gender, educational status or farming practices, and were therefore able to associate trait preferences with social characteristics in a quantitative manner (Baidu‐Forson 1997; Smale et al. 1999; Ndjeunga and Nelson 2005; Kerr et al. 2007). Some surveys were designed for gaining detailed understanding of particular issues raised by prior qualitative research and long‐term engagement

Gender and Farmer Preferences for Varietal Traits

255

with communities (Katungi et al. 2011; Kerr et al. 2007). The studies for baseline or biodiversity characterization and those led by or involving social scientists used surveys more frequently than PVS or participatory plant breeding (PPB) studies. 4.  Qualitative methods.  Qualitative social science research methods, including tools developed for participatory rural appraisals (PRA) or focus group discussion (FGD), were used by 26% of the cases reporting gender‐differentiated trait preferences (Table  7.2). These ­ tools were used to gain understanding of roles and responsibilities of women and men for crop management and use, for obtaining in‐depth insights into specific crop traits, trait associations, and their implications (Chiwona‐Karltun et al. 1998; Christinck 2002; Gold et al. 2002a; Kudadjie 2006; Efisue et al. 2008; Teeken et al. 2012) or to develop a questionnaire or choose cultivars for testing (Dorward et  al. 2007). Qualitative research tools were often used in long‐duration undertakings describing breeding and selection processes and documenting farmer decision‐making at specific steps. This type of understanding was considered essential for open and frank dialog between farmers and researchers for orienting a gender responsive breeding program (Efisue et al. 2008; vom Brocke et al. 2010; Assefa et al. 2014) or formulating hypotheses of gender‐based differences for subsequent testing of trait preferences (Diallo et al. 2018). A variety of other specialized methods were used to identify gender preferences in 28% of studies reviewed. These methods included choice experiments (choice‐based conjoint methods), comparative selection experiments, in‐depth interviews with key informants (Lope‐ Alzina 2007; McElhinny et al. 2007), or characterizing farmers choice of ­ varieties for home testing (Sperling et  al. 1993). Research using these specialized methods mostly used a combination of tools, some combining qualitative and quantitative social science methods. 5. Analytical approaches. Most of the research reviewed compared frequencies with which women or men mentioned specific traits or groups of traits, usually complemented by the results from open‐ended qualitative discussions. Studies by PPB programs also used varietal performance data by comparing trait means of women’s versus men’s selections (Bellon 2002; Assefa et al. 2005; Dorward et al. 2007; vom Brocke et al. 2010). Some studies analyzed the frequency with which certain traits were mentioned by farmers during open‐ended variety evaluations to derive priorities among traits (Weltzien et  al. 1998).

256

EVA WELTZIEN ET AL.

Few studies asked women and men to rank the importance of traits directly (Smale et al. 1999; Bellon et al. 2003; vom Brocke et al. 2010). Detailed discussions to understand women’s and men’s priorities for future varietal improvement were infrequently used among the cases reviewed. Some research undertakings used multivariate statistical procedures to analyze survey data, such as conjoint analysis with logit or probit models to identify determinants of preferences using variables describing respondents’ socioeconomic attributes including gender (Baidu‐ Forson 1997; Katungi et al. 2011). Analyzing the differences between the varieties preferred by women and men, and the specific traits those varieties possess, can provide a basis for identifying gender differences. Valid statistical analyses of differences between men’s and women’s varietal scores or rankings may be done with specific tests and data sets (reviewed in Christinck et  al. 2005, p. 101; Bellon et  al. 2003). ­Scenarios can be set up to check or test new hypotheses and understandings (Christinck et al. 2005, p. 100).

IV.  FINDINGS ON GENDER‐SPECIFIC TRAIT PREFERENCES The gender‐specific trait preferences documented in the 39 studies reviewed are summarized here. The extent to which these preferences relate to value chain domains, gender roles, responsibilities, and conditions provide insights into the nature and underlying causes of those differences. A.  Trait Preferences by Value Chain Domains The gender‐based differences reported for traits and gender roles related to all of the major domains across the value chain (Table 7.3). Crop use and production were the domains for which differences were the most frequent, while differences for market and seed domains followed at a considerably lower level. B.  Women’s and Men’s Trait Preferences Trait preferences mentioned only by women or only by men in individual studies give indications of strong gender specificity (Table 7.4). Women noted preferences for a host of postharvest, processing, and food use aspects that were not mentioned by men, although one case reported only men mentioning the suitability of a variety for a local dish. Preferences for traits associated with food security, such as resistance to

Gender and Farmer Preferences for Varietal Traits

257

Table 7.3. Percent* of papers documenting gender‐specific trait preferences or background information on women’s roles and responsibilities by value chain domain, the mean number of domains documented within the N publications of each research type, and over all 39 papers reviewed. Research type

N

Production (%)

Participatory plant breeding Varietal acceptance Participatory variety selection Biodiversity/in situ conservation Product acceptance Social science/ ethnobotany Baseline/system information Overall

12

83

8 6

Use (%)

Seed (%)

Market (%)

Mean # of domains

67

33

25

2.1

63 50

63 67

13 0

25 67

1.6 1.8

5

60

80

80

20

2.4

4 2

0 100

50 100

0 0

25 50

1.0 2.5

2

50

50

0

50

1.5

39

62

67

23

33

1.9

*The percentages do not sum to 100% within rows as many publications documented more than one domain.

Table 7.4.  Traits noted only by women or only by men in individual publications. Traits mentioned only by women

Traits mentioned only by men

Vigor Well adapted to a diversity of growing conditions Leafiness Storage life Ease of dehulling Ease of threshing Quantity of usable flour Fuelwood quantity from stover Cooking time Taste, grain color Tall height for ease of harvest

Pest resistance Adapted to intercropping Yield/ha Suitability for local dish Resistance to waterlogging

storage pests and other host plant resistance to pathogens and pests, early maturity and multiple harvests, were mentioned only by women in individual studies. Women also identified harvestable products in addition to grain, such as leaves for food and stalks for fuelwood, which were not mentioned by men. The traits that were only mentioned by men focused mostly on production‐related characteristics. Tabulating traits that were reported to be significantly or substantially more frequently preferred or higher ranked by women or by men revealed that the “predominantly women’s traits” were much more

258

EVA WELTZIEN ET AL.

Table 7.5.  Traits mentioned more often or ranked higher by women than by men. Production‐related traits

Post‐harvest traits

Earliness Ease of harvesting and transport Grain traits Pest and disease resistance Multiple harvests Requirements for weeding

Food security Threshability Cooking quality Less decortication, dehulling, milling losses Market value Resistance to storage pests Straw quality for roofing Processing quality for locally marketed product Grain and leaf quality Medicinal properties Taste of specific dishes

Table 7.6.  Traits mentioned more often or ranked higher by men than by women. Production‐related traits

Post‐harvest traits

Yield by volume Produced with little labor Productivity Agro‐ecological adaptation Cob size, multiple cobs Grain size

Storage life Good feed Marketability

numerous than the “predominantly men’s traits” (Tables 7.5 and 7.6). These traits pertained to two major groups; i.e., aspects pertinent to crop production and related activities, and characteristics relevant for postharvest qualities and activities. Among the production‐related traits showing gender differences, women were more concerned than men about traits conferring ease of harvest, and sometimes about varietal differences for p ­ roductivity under poorer soil fertility conditions, or labor requirements for weeding (Table 7.5). Traits that men mention more often than women concerned production aspects such as yield by volume, productivity per se (although rarely in the first position), and productivity with overall low labor input, as well as more detailed and specific yield components (Table 7.6). Tabulation of gender differences for postharvest quality and use characteristic preferences revealed a large number of traits that were more frequently or strongly preferred by women (Table  7.5) and relatively few that were more preferred by men (Table  7.6). Thus, women’s stronger preference for many unique aspects of quality and use suggests that improving awareness and understanding of women’s

Gender and Farmer Preferences for Varietal Traits

259

preferences will lead to a fuller compliment of varietal characteristics for orienting breeding programs. More detailed examination of women’s and men’s specific trait preferences and their underlying causes will be examined in the subsequent sections to provide insights for guiding gender‐sensitive breeding work. C.  Gender Differences for Crop Production‐Related Preferences 1.  Responsibilities during the production cycle.  Gender‐specific trait preferences for crop‐production traits were often related to who was responsible for which field activities; weeding is one example. Women predominantly responsible for weeding lowland rice in West Africa preferred competitive varieties for weed suppression more frequently than men (Gridley 2002). In contrast, upland rice in Ghana is weeded by men, who valued weed suppression as a plant trait (Dorward et al. 2007). Crop harvesting is another example. Women predominantly responsible for rice harvest specifically preferred tall rice varieties for ease of harvesting (Gridley 2002; Manzanilla et  al. 2014), especially when carrying a child on their back (Efisue et  al. 2008). S ­ imilarly, women responsible for transporting harvested pearl millet panicles from the fields preferred long panicles for easier handling (Baidu‐ Forson 1997). In several cases, women responsible for threshing valued traits conferring ease of threshing for sorghum (Kudadjie 2006), pearl millet (Baidu‐Forson 1997) and rice (Dorward et  al. 2007; Manzanilla et al. 2014). Gendered knowledge results from men and women having responsibility for different agricultural tasks (Chambers and Momsen 2007). ­Several of the publications reviewed indicated that gendered knowledge related to household tasks translated directly into the types of traits that men and women preferred. For example, Smale et al. (1999) found that in Mexico, men are mainly responsible for maize production and production‐related traits were preferred only or most frequently by men while women preferred other traits related to consumption. However, where women were responsible for production, as was the case for beans in Rwanda, they indicated detailed preferences for production traits that outnumbered their preferences for quality traits (Sperling et al. 1993). These results show that it can be misleading to assume that trait preferences necessarily follow a “traditional” division of labor between men and women. Moreover, such trait ­ preferences are not immutable over time and are likely to evolve as women’s rights and responsibilities change. The out‐migration of men to seek work and youth departing for education, jobs, or due to lack of

260

EVA WELTZIEN ET AL.

access to land often results in women becoming primarily responsible for farm activities (Stanley 2015) and may manifest in changes in labor or managerial roles (Gartaula et al. 2010). There is also evidence that research and development activities focusing on gender inequality can lead to changes in women’s rights and responsibilities in agriculture. For example, long‐term gender‐sensitive PPB activities in Syria changed women’s sense of agency and they identified themselves as farmers with specific responsibilities that went beyond their previous traditional roles (Galiè et al. 2017). Hence, understanding women’s and men’s production responsibilities, currently and as they change over time, will help breeders develop varieties that respond to the range of crop‐production concerns. 2.  Crops grown only or predominantly by women or men.  Certain crops are primarily grown either by women or by men in some cultures or agro‐ ecologies. As a result, knowledge, expertise for crop management, and related trait preferences are different for men and for women. Several of the publications reviewed reported women’s expertise and preferences for crops cultivated only or mainly by women, such as common‐beans in Eastern Africa (Sperling et al. 1993; Assefa et al. 2014), groundnut in Benin (Assogba et al. 2016), cassava in Malawi (Chiwona‐Karltun et al. 1998), African rice (Oryza glaberrima) (Teeken et al. 2012), and banana in Uganda (Gold et al. 2002b). Research providing trait preference information for certain classical “women’s crops,” like traditional vegetables in Africa or Asia, groundnut or Bambara groundnut in many countries of West Africa, or finger millet in many countries of eastern Africa, were not found in our literature search. This is thus an area that warrants further research. 3.  Contrasting growing conditions or unequal access to resources.  Several publications document trait preference differences that were linked with gender differences for cultivating the crop as a sole‐ or inter‐crop. Maize in the Bajio region of Mexico was reported to be cultivated in home gardens, intercropped with beans, pumpkins, or other vegetables by women, whereas men mostly cultivated it as a sole crop in larger more distant fields (Chambers and Momsen 2007). These men and women had highly differing perceptions of the yielding ability and the resistance to wind or drought of the same maize varieties. Similarly, women cultivating beans intercropped with maize or bananas in Rwanda (Sperling et  al. 1993) or groundnuts intercropped with sorghum in Mali (Weltzien et  al. 2006) had a better knowledge and

Gender and Farmer Preferences for Varietal Traits

261

expertise than men to select for adaptation for these highly specific growing conditions. Men and women may grow the same crop in different types of fields with contrasting adaptation requirements. For example, rice in Mali is grown in upland fields predominantly by men and in lowland (uncontrolled flooded) and irrigated conditions mostly by women (Efisue et al. 2008). Women’s sorghum fields typically have lower fertility than men’s fields in West Africa, since women are allocated fields at the end of the rotation when soil fertility is lowest (Leiser et al. 2018) and they do not have access to manure. Women’s preferences for early and tall sorghum varieties may be partly due to the exceedingly poor (low plant‐available phosphorus) fertility in their fields (Leiser et al. 2018) that reduces crop development and delays maturity (Leiser et al. 2012). Women also valued common bean (Sperling et al. 1993) and rice varieties (Dorward et  al. 2007) that can produce under poor soil fertility conditions. Low‐caste women in western Rajasthan likewise preferred early flowering and high‐tillering varieties of pearl millet for adaptation to their marginal conditions, being the main food producers for their families (the men leaving for other economic activities) and only having access to land of poorer quality than their higher caste male neighbors (Christinck 2002). These cases show how women and men, even within the same agro‐ ecology and village, may require different adaptive traits for cultivating the same crop under contrasting conditions and thus have different trait preferences for their varieties. D. Preferences Related to Postharvest Processing and Food Preparation The expectation that women’s traditional roles in postharvest processing and food preparation leads to many traits related to these activities being predominantly preferred by women is borne out by the publications retained for this review. The greater number, uniqueness, and detail of postharvest traits preferred by women (Tables  7.5 and 7.6) show that women pay closer attention to a wider range of varietal traits regarding processing and food quality. Examples include women’s preferences for hardness of sorghum grains as it gives a higher milling yield (vom Brocke et al. 2010), sweet (low saponin) grain types of quinoa that are less tedious to prepare (McElhinny et  al. 2007), particular grits to flour ratios that ensure sufficient quantities of sorghum products for most commonly prepared dishes (Diallo et  al. 2018), and particular grain pericarps for relative ease of pounding rice (Teeken et al. 2012).

262

EVA WELTZIEN ET AL.

Examples of women’s stronger focus on attributes determining cooking qualities included cooking time and boiled grain volume (Assefa et al. 2014), bread taste (Nelson 2013), and appropriateness for specific dishes (Chambers and Momsen 2007; Assefa et al. 2014; Diallo et al. 2018). Women’s concerns for traits related to grain and food quality were documented across diverse regions and crops, including, for example, sorghum in Burkina Faso (vom Brocke et  al. 2010), Ethiopia (Mulatu and Belete 2001), and Ghana (Kudadjie 2006), maize in Ethiopia (Mulatu and Zelleke 2002), Mexico (Lope‐Alzina 2007), and Mali (Defoer et  al. 1997), as well as rice in Ghana (Dorward et  al. 2007). The adoption of modern varieties of sorghum resulting from decades of breeding with introduced germplasm without sufficient attention to these qualities was disappointingly low relative to the higher adoption of varieties developed out of Malian landrace varieties known for good food quality (Matlon 1990; Yapi et al. 2000). Likewise the puzzle of the rapid adoption of an initial maize hybrid H614, released in Kenya in 1986, and subsequent disappointing adoption of newer hybrids (Smale and Olwande 2014), can be partly explained by the initial hybrid being particularly appreciated for its harder grains that resist mold and insect damage and are preferred for preparing the local dish ugali (Christinck et  al. 2018). Hence, consideration of these women‐preferred traits by breeding programs is essential for achieving varietal acceptance and user benefits. E.  Preferences Related to Plant Uses and Production Objectives 1.  Plant parts and uses.  Women and men with different responsibilities for the functioning of their farm and household operations can value different parts or qualities of the same crop. Maize in the Bajia region of Mexico provides a striking example with women appreciating husks as an important source of income, men valuing the stalks for feeding animals, and women valuing the cobs as fuel for cooking (Chambers and Momsen 2007). Similarly, the leaves of cowpea and cassava are valued by women for preparing leaf sauce or for sale in the market (Chiwona‐Karltun et al. 1998; Kitch et al. 1998) whereas men preferred aspects of fodder quality for feeding livestock (Kitch et al. 1998). Insufficient consideration of women’s specific crop uses can limit the uptake of new varieties. Women in Ethiopia, for example, objected to modern short‐strawed sorghum varieties that would increase their work and reduce their income from sale of cooking fuel (Mulatu and

Gender and Farmer Preferences for Varietal Traits

263

Belete 2001). Similarly, although women in Burkina Faso depend on red‐grained sorghums for producing malt for local beer, an important source of income (vom Brocke et al. 2010), formal breeding has so far concentrated only on white grain sorghum for food use. 2. Food security concerns. Women explicitly justified some of their preferences for legume (Kerr et  al. 2007; Assefa et  al. 2014) or cereal variety types on food security concerns. For example, women ­explained how they are the first to hear a starving child cry, and thus place great value on maintaining early and drought‐tolerant sorghum varieties, even though those varieties yield less than others (Mulatu and Belete 2001). Varietal attributes determining the timing of harvest is one group of traits that women specifically prefer. Women valued early maturity, often associated with cutting the “hungry season” short, for maize in Kenya (De Groote et al. 2002) and Ethiopia (Mulatu and Zelleke 2002), common beans in Ethiopia (Assefa et  al. 2014), bananas in Uganda, quinoa in Ecuador (McElhinny et al. 2007), and sorghum in Burkina Faso (vom Brocke et  al. 2010). Women also valued the ability to harvest throughout the season, preferring bean varieties that could be repeatedly harvested (Assefa et al. 2005) and choosing both very early groundnuts and late and ratooning photoperiod‐sensitive pigeonpeas (Kerr et  al. 2007), or high‐tillering pearl millet (Christinck 2002). Women preferred traits conferring stability or the capacity to produce under stressful conditions. For example, women preferred maize varieties that could produce even in bad years (Smale et al. 1999) or rice varieties able to grow under poor soil fertility (Dorward et  al. 2007). Women also valued the capacity of common bean (Sperling et al. 1993) and East African highland banana (Gold et al. 2002b) varieties to cope with diverse stress and intercropping conditions. Detailed understanding of why women value bitter cassava in central Malawi (Chiwona‐Karltun et  al. 1998) provides yet another example. The women, especially from poorer families, preferred bitter types as it prevented theft and helped them better manage their harvest even though these types required more tedious processing to remove the toxic compounds than the non‐bitter varieties. Last but not least, women’s and men’s contrasting roles and respective trait preferences may complement each other for achieving household food security. Sorghum in Mali is such a case where men are responsible for producing the staple cereal for the main family meals (Weltzien et al. 2018) and the grain women produce serving as a fallback for the

264

EVA WELTZIEN ET AL.

entire family when the men’s granaries run empty and for feeding children outside of the main meals (Weltzien et al. 2006; Bauchspies et al. 2017). Thus attention to trait preferences and varietal needs of both women and men can contribute to household nutrition, with breeding for “nutrition‐sensitive agriculture” being a major and little tapped opportunity (Christinck and Weltzien 2013). V.  ISSUES FOR GENDER‐RESPONSIVE CROP IMPROVEMENT A. Using Gender‐Differentiated Trait Preference Information in Breeding The publications reviewed show that information about gender differentiated trait preferences is collected through diverse types of research (Table  7.2). The various contexts and purposes for examining gender differentiated trait preferences contribute to diverse and complimentary entry points for implementing gender‐responsive breeding (Table 7.7). The learning and documented gender differentiated trait preferences can help guide gender responsive crop improvement programs at all breeding stages. This can help decisions, whether higher‐level ­targeting of who will benefit where or deciding which specific progenies to advance, to be made in a “gender responsive” (gender inclusive, complimentary, and equitable) manner. 1.  High‐level targeting of breeding programs.  Progress in plant improvement is often defined on the basis of yield in a target population of environments (TPE) (Chenu et al. 2011), where TPE is the set of environments in a geographic area targeted for growing the cultivars (Comstock 1977). This approach, confined to analysis of abiotic or biotic constraints, may miss critical differences between women’s and men’s production conditions or objectives within as well as over geographic regions. Several of the publications reviewed here documented gender differences for production environments that would go undetected in typical analyses focusing solely on geographic and biophysical aspects. Thus, breeding programs also need to analyze and target farmers and user populations. The “socioecological niche” concept, proposed for targeting and developing agricultural technological options, includes sociocultural factors such as gender as well as economic and ecological factors (Ojiem et al. 2006). Public crop improvement programs can benefit from established market analysis concepts and tools for describing and prioritizing consumer needs and market demands as a basis for gender responsive targeting of plant breeding programs (Orr et al. 2018).

Gender and Farmer Preferences for Varietal Traits

265

Table 7.7.  Summary of the context and purpose of information gathering about gender differentiated trait preferences in the reviewed publications and examples of consequences for gender responsive breeding. Context

Purpose

Gender issues/relevance

Understanding patterns of genetic diversity

Justifying the conservation and maintenance of specific types of germplasm, biodiversity Targeting seed dissemination, developing seed marketing strategies

Women may use specific varieties for specific purposes, or source seed differently

Identifying customers for newly developed varieties

Understanding adoption decisions for specific varieties

Assessing benefits that farmers may derive from using new varieties; targeting new breeding priorities

Characterizing consumer demand for specific food products

Predicting market opportunities for specific types of varieties

Understanding farmers criteria for selecting varieties or choosing plants for saving seed Characterizing crop production and food systems

Modifying selection strategies to improve chances for adoption of newly bred varieties Identifying drivers for change in agricultural systems and the potential role of new crop varieties

Women may be targeted as customers for specific varieties due to their trait preferences or family roles, e.g., bio‐fortified crops targeting child nutrition. Women may derive benefits from or be negatively impacted by specific types of traits or varieties, e.g., alter ease and demands for their labor, alter access to resources important to them such as crop residue as cooking fuel Families with different resource levels may have specific demands; e.g., pre‐cooked beans are more demanded by urban poor working women or single men Women and men may have specific expertise for evaluating certain traits; their priorities for traits may vary Food insecurity and overall labor efficiency of crop production and food processing are priorities for women and men, but expertise and decision making focus may differ by gender

2. Defining variety profiles. Defining the specific type of variety to breed is another level of planning that relies on understanding women’s and men’s trait preferences. Defining a product profile, the set of targeted attributes that a new variety is expected to meet in order to be successful in the market (Ragot et al. 2018) is helpful in this respect.

266

EVA WELTZIEN ET AL.

Issues here include identifying the combination of “must have” traits that need to be above a threshold for acceptability and prioritizing the few key traits to be improved. Understanding the underlying reasons for trait preferences that are often revealed during PPB (Sperling et al. 1993; Weltzien et al. 1998; Bellon 2002; vom Brocke et al. 2010; Baafi et al. 2015) is valuable for this endeavor. Consumer preferred quality traits such as processing and cooking attributes are a major group of “must have” traits that women frequently highlight, and insufficient attention to ensure acceptable levels of these traits risks lack of adoption of new varieties (Diallo et al. 2018). In contrast to an “ideal variety,” the product profile defines the combination of traits needed to respond to the targeted demand and that is biologically feasible to attain through breeding. 3.  Setting the breeding strategy.  The choice of parental materials with consideration of traits required by women and men for crop value and acceptance will influence prospects for developing finished varieties that include traits required for adoption. Farmers’ local varieties, frequently characterized as having superior consumer use quality traits, may well offer valuable source materials for breeding. Successful breeding involves “integrating quantitative genetics, statistics, gene‐to‐phenotype knowledge of traits embedded within crop growth and development models” (Cooper et al. 2014). Embedding women’s trait preferences and knowledge in these models will enhance total genetic gains through gender responsive breeding. For example, women’s knowledge of acceptability for milling yield of grain or ease of threshing will help set thresholds for culling progenies. Likewise understanding the relative values of specific traits, for example, grain and straw for fuel or feed, will enable appropriate economic weights to be set in multitrait selection indices for maximizing the total value. Involving women farmers in the selection process, so that they directly contribute their knowledge and experience for specific traits, can open opportunities for increasing gains (Sperling et al. 1993). Direct selection of progenies in the field and postharvest quality assessments are examples. Women farmer’s ability to visually assess thousands of samples for preferred sorghum grain quality traits (e.g. grain hardness) with good heritability (Diallo et al. 2018) can increase speed, cost‐­effectiveness of the breeding, in addition to increasing the value of the retained genetic materials. B.  Are Gender‐Specific Varieties Necessary? The question of whether different varieties are needed to meet customers’ specific needs and trait preferences is vital for impactful breeding and

Gender and Farmer Preferences for Varietal Traits

267

dissemination of new varieties. Breeders need answers to two questions: “Are gender differences important determinants of customer choice of variety?” and, if so: “Is it feasible to develop a gender‐specific variety that meets this demand and has benefits for a given customer group?” The types of gender differences documented for trait preferences in the research reviewed here provide insights for answering the first question. Separate varieties may not be needed when women’s and men’s preferences are based on different roles and responsibilities for activities from production through use. For example, men’s focus on agronomic traits and women’s preferences for qualities for post‐harvest processing, cooking, or food security are complementary. The inclusion of such complementary traits that satisfy both women’s and men’s preferences in a given variety could be a precondition for responding to the full range of household needs (vom Brocke et al. 2010; Isaacs et al. 2018). Attention to what discussion and negotiation occur within families regarding choice of variety to cultivate (Chambers and Momsen 2007) could therefore be highly informative. Breeding separate varieties for women and men could be necessary when the traits for their respective objectives differ and involve tradeoffs. Women’s preference for extra early maturity for adaptation or for food security (Table  7.5), despite associated reduction of yield potential under favorable conditions, is one example of this kind of tradeoff. Farmer’s individual or joint household management of several varieties to meet diverse needs and conditions (Sperling et al. 1993; Siart 2008) point to the importance of providing a range of varieties for diverse contexts. Studies of which varieties men are currently growing compared with women, and why, could provide valuable input for determining whether separate varieties are needed for women and men. When women’s and men’s top varieties show little correspondence and they represent differing agro‐morphological types, as was the case of maize in Oaxaca, Mexico (Bellon et al. 2003), the need for gender‐ specific variety development would be indicated. C. Methods for Understanding and Responding to Gender ­Differences for Trait Preferences Some key issues and problems related to methods for interpretation of gender differences for trait preferences that should be considered in future research are examined here.

268

EVA WELTZIEN ET AL.

1. Generalizing understandings and  trait prioritization. While it is clear that differences between women’s and men’s trait preferences exist, are documented (Table 7.4), and are important for guiding future breeding efforts, it is often difficult to reliably generalize or quantify these gender differences from the currently available information. Prioritizing traits based on the extent to which men and women value a given trait in a given social class, agro‐ecology, or geographical region requires a big further step. Trait prioritization is vitally important for breeding programs that face a long list of desired traits and demands from many different types of customers. Trait prioritization is thus practiced, whether it is done with or without generalizable knowledge of women’s unique trait preferences. Hence all breeding programs make a de facto decision about whether they pursue a gender‐responsive path when important gender differences exist. The methods used by most of the research reviewed herein are not suitable for trait prioritization because they were not designed to show which women’s or men’s trait preferences are both widespread and of socioeconomic significance for breeding on a large geographic scale. For example, participatory breeding research or varietal testing generally did not collect comprehensive socioeconomic data on the farmers taking part in the trials (for an exception see Katungi, 2017). These studies do, however, provide important qualitative insights into differences between men’s and women’s trait preferences and underlying reasons for these. Although 60% of the studies reviewed used a sampling strategy to choose farmers participating in trials or, more commonly, respondents to questionnaires, the publications generally did not report prior characterization of gender differences in their target population or market segment as a basis for selecting the women and men from whom trait preferences were elicited. Generalizing the reported differences for trait preferences to a wider population is therefore difficult. Information about the reference population is crucial for understanding gender differences in demand for a given trait because other social attributes, in particular wealth, education, and age, influence preferences and may override or exacerbate gender difference in certain circumstances. From the perspective of understanding gender, one of the major shortcomings of the research reviewed is that their analysis consists of simple comparisons between the traits preferred by men and by women. The findings from the diverse preference studies are not consistent: in some cases, men and women have completely different trait preferences; in other instances, their trait preferences are similar; and in yet other situations, both sexes consider the same traits important

Gender and Farmer Preferences for Varietal Traits

269

but put them in a very different order of priority (Christinck et al. 2017). The simple comparison of men’s and women’s trait preferences generates this apparently contradictory picture due to numerous socioeconomic characteristics influencing roles, rights, and responsibilities (see Section IV), which, in addition to sex, determine their preferences. This intersection of multiple social characteristics means, for example, that men and women producers with unequal resources and engaged in unequal gender relations are likely to have different trait preferences, whereas men and women in situations where gender relations are more equal may express similar trait preferences. Interpretation of and generalizations about gender‐differentiated trait preferences requires explanation of how preferences reflect underlying gender differences in assets, markets, information, and risk. This requires reference to a social profile that includes but is not limited to analysis of differences between men and women. 2.  Use of multiple methods.  Women and men farmers’ knowledge and expertise is part of their daily lives and “way of doing things;” as such, a major part of it can be described as “tacit knowledge” that is embedded in practices, tools, and procedures (Polanyi 1966). Very often, it is not obvious to farmers how much researchers do not know about the “basic aspects of life and farming.” Likewise, it may not always be clear to researchers that they rely on many unproven assumptions, e.g., on production conditions and goals that may not correspond to the actual situation of (all) farmers. Hence, learning about gender‐differentiated trait preferences, even in a formal research setting, requires iterative and flexible approaches, using participatory methods that focus on dialogue, e.g. by visualizing, showing, observing, and discussing (Christinck et al. 2005), rather than on formal surveys alone. Most of the reviewed research on gender involved farmer participatory breeding or participatory variety selection (Table  7.2). Thus, many results on gender‐differentiated preferences were obtained from evaluations made by farmers in the field. Evaluations based on varieties grown in specific field environments (i.e., concrete objects) can help farmers to express their preferences more clearly as compared to a hypothetical situation such as in responding to a questionnaire. Various scoring and ranking methods have been developed for facilitating farmer comparisons of varieties, each with strengths and weaknesses (Christinck et al. 2005). Most of the publications retained for this review used more than one method to learn about trait preferences of farmers in a gender‐ differentiated manner (Table 7.2). For example, publications reported

270

EVA WELTZIEN ET AL.

use of on‐farm as well as on‐station variety evaluations, or individual farmer interviews and focus group discussions. The iterative evaluation of trait preferences can help provide different perspectives that help confirm or refine prior understandings. Likewise, evaluations over years in an applied PPB program can follow dynamics as preferences change. 3.  Methods for breeders’ engagement with women and men farmers.  Breeding programs are gathering data on women’s and men’s trait preferences, as shown by the studies reviewed here. Further attention and research on ways that they can improve their current activities to enable better interpretation and prioritization of trait preferences would be helpful. Four practices that evolved in West African sorghum breeding programs with this intent are: (a) assigning a notetaker to record women and men farmer’s as they observe test varieties, either individually or in small groups by gender (providing insights into underlying reasons for preferences and thresholds for acceptability) (vom Brocke et al. 2010); (b) holding joint annual feedback and planning meetings of breeders with collaborating farmers and their organizations (improving understanding of overall goals and specific objectives) (Weltzien et al. 2006); (c) setting quotas for variety trials to be conducted by women in their fields (giving women a more direct and empowered voice in the field and in feedback and planning meetings); and (d) having groups of women and men separately propose the traits to use for varietal evaluations, with plenary discussion and negotiation to reconcile and explicitly define the top priority traits for all to use (the traits chosen for evaluation indicate priorities of women and men, the traits are defined more comprehensively than the breeder’s formal understanding of those traits (vom Brocke et  al. 2010), and the underlying reasons for their importance are revealed). In summary, the use of diverse approaches and methods has the advantage of showing that robust gender differences in trait preferences are identifiable regardless of the method used, even if comparison of results between those methods may be difficult. Lack of uniformity and comparability is therefore less of an issue than that of generalizability: we still cannot say much with confidence about the relative importance of the different trait preferences identified in terms of what proportion of men and women farmers demand a given trait in a given social class, agro‐ecology, crop, or geographical region. Efforts to address this information gap will aid trait prioritization in future, gender‐responsive breeding programs.

Gender and Farmer Preferences for Varietal Traits

271

D.  Setting Goals for Gender‐Responsive Crop Improvement The necessity of differentiated insights about potential customers’ needs, priorities, and opportunities for future changes for effective targeting of plant breeding programs was discussed above. How to orient breeding programs to contribute to specific development goals is yet another question. Publicly funded programs, embedded in larger agricultural development programs, are expected to contribute to the sustainable development goals (SDGs) for 2030 such as poverty reduction/income generation, possibly for specific types/genders of farmers, enhancing farm families’ resilience to climatic or other shocks, reducing the gender gap, improving the nutritional status of vulnerable groups, fostering gender equity and agricultural transformation, preserving agro‐biodiversity, or building farmers’ capacities and their empowerment. The cases reviewed here mention some of these goals and show that gender differentiated trait preferences are relevant to very diverse development goals. The urgency to achieve specific SDGs through agricultural innovations requires gender issues to be addressed in a targeted purposeful manner. Thus, plant breeding programs need to become more explicit about their goals and base their targeting and priority setting on sound understandings of these goals and the pathways to achieving them. The detailed understandings of gender differences for roles and responsibilities, access to resources and opportunities for changes that underlie trait, and varietal preferences are essential in this context. Although the studies reviewed are too few to identify relationships between specific goals and types of trait preferences associated with gender, they clearly show the need and the feasibility of determining what are the women’s and men’s production objectives, what plant parts and products are valued, and resilience to what conditions are desired. 1.  Need for research dedicated to understanding gender preferences.  Most cases retained for this review reported gender differentiated information about trait preference from research that was not specifically designed for understanding gender‐related issues. Although the information from these “opportunistic” results are helpful and need to be considered, they have inherent limitations. Specifically, who was involved (which women and which men), what genetic materials were available, and under what resource and growing conditions they were assessed limit the ability to generalize relevant findings for women. Crudely stated, simply sending women through variety trials to give their ratings is a start but is not sufficient to understand the “why” of women’s or men’s trait preferences and to facilitate decision making.

272

EVA WELTZIEN ET AL.

To explain preferences, careful selection of representative respondents is essential, whether for interviewing, focus group discussion, or parti­ cipatory evaluation of varieties in trials (Ashby 1990). Collecting sex‐ disaggregated information on the social characteristics of respondents engaged in participatory varietal evaluations greatly increases the value of the information (Katungi et  al. 2018). Furthermore, opportunistic trait preference evaluations are likely to be based on the vision and context of current breeding efforts and contexts, and are thus not ­necessarily future oriented. Only research that includes some form of foresight analysis, choice experiments, or projections of future trends can realistically contribute to the development of successful variety profiles that take into account gender‐differentiated needs and aspirations. This review reveals that only very few purpose‐designed assessments of gender differences have focused on crop trait preferences to date. The cases that were conducted with a specific gender objective all worked with innovative research methods, provided detailed information on trait preferences, and discussed reasons for gender differences (Defoer et al. 1997; Chiwona‐Karltun et al. 1998; Bellon 2002; Christinck 2002; Assefa et  al. 2005, 2014; Chambers and Momsen 2007; Lope‐Alzina 2007; Kerr et al. 2007; Nelson 2013; Manzanilla et al. 2014; Gunaratna et al. 2016; Diallo et al. 2018). However, only three of these cases were associated with active plant breeding programs. There is therefore a critical need for conducting more built‐for‐purpose gender research on trait preferences within the context of plant breeding programs in order to provide understanding required for designing variety profiles and to more directly influence decisions about variety development. 2. Need for  interdisciplinarity and  institutional ownership. Gender responsive breeding clearly requires concepts, research methods, and effort from diverse disciplines in consort with plant breeding. Research from socioeconomics, agronomy, plant physiology, pathology, and human nutrition, and certainly other disciplines, is needed to complement that of genetics. Depending on the overall goals of the program, this may include market analysis and possible segmentation, consumer‐type studies, clarification of specific gender roles, social and production system risks and opportunities, and nutritional needs. Such interdisciplinarity is a prerequisite for making concrete changes in breeding programs in terms of the market segments and specific customer demands targeted, and the corresponding variety profiles and selection strategies pursued. The diversity of results, obtained at differing scales and perspectives, require integration of concepts and theory across disciplines and across

Gender and Farmer Preferences for Varietal Traits

273

different types of knowledge, including knowledge of the stakeholders involved. The plant breeding discipline is currently debating how to educate the next generation of breeders to better design products, develop production pipelines, and work collaboratively with others in teams (Hmielowski 2018). Joint pursuit of this quest with other disciplines will be vital for realizing the potential of gender responsive breeding. Understanding the complex realities of the socioecological context can and must improve over time, and is thus a dynamic process. Documenting this information and transparent reporting on the priority setting process, including the findings that were used to justify specific decisions at each step, will provide a basis for sharing and advancing gender‐responsive breeding strategies. Implementation of gender‐responsive breeding is therefore a long‐term complex endeavor that transcends individual breeders or breeding programs. Building institutional memory for documenting such long‐term complex processes across disciplines requires institutional commitment and ownership. The leadership of these institutions in supporting collaboration among disciplines to jointly pursue defined development goals will be decisive in determining the outcomes achieved by gender responsive breeding in the long term. ACKNOWLEDGMENTS The literature review reported in this paper was funded in 2016 by the CGIAR System Office Gender Research program’s “Gender and Breeding” initiative, as part of CGIAR’s support to mainstreaming gender in CGIAR Research Programs (CRPs). The authors thank Philipp Kumria and Jonas Metzger, University of Gießen, Germany, for their assistance in building the database and in the evaluation of studies. LITERATURE CITED Ashby, J.A. 1990. Evaluating technology with farmers: A handbook. Centro Internacional de Agricultura Tropical (CIAT), Cali, Colombia. https://hdl.handle.net/10568/54029. Assefa, T., G. Abebe, C. Fininsa, et al. 2005. Participatory bean breeding with women and small holder farmers in Eastern Ethiopia. World J. Agric. Sci. 1:28–35. Assefa, T., L. Sperling, B. Dagne, et al. 2014. Participatory plant breeding with traders and farmers for white pea bean in Ethiopia. J. Agric. Educ. and Ext. 20:497–512. Assogba, P., E.‐E.B.K. Ewedje, A. Dansi, et  al. 2016. Indigenous knowledge and agro‐ morphological evaluation of the minor crop Kersting’s Groundnut (Macrotyloma Geocarpum (Harms) Maréchal et Baudet) cultivars of Benin. Genet. Resour. Crop Evol. 63:513–529. 10.1007/s10722‐015‐0268‐9.

274

EVA WELTZIEN ET AL.

Baafi, E., J. Manu‐Aduening, E.E. Carey, et al. 2015. Constraints and breeding priorities for increased sweetpotato utilization in Ghana. Sus. Agric. Res. 4:1–16. 10.5539/sar. v4n4p1. Baidu‐Forson, J. 1997. On‐station farmer participatory variety evaluation: A strategy for client‐oriented breeding. Exper. Agric. 33:43–50. Bauchspies, W.K., F. Diarra, F. Rattunde, and E. Weltzien. 2017. “An Be Jigi”: Collective cooking, whole grains, and technology transfer in Mali. FACETS 2:955–968. 10.1139/ facets‐2017‐0033. Bellon, M.R. 2002. Analysis of the demand for crop characteristics by wealth and gender: A case study from Oaxaca, Mexico. p. 66–81. In: M.R. Bellon and J. Reeves (eds.), Quantitative analysis of data from participatory methods in plant breeding. International Maize and Wheat Improvement Center (CIMMYT), Mexico. Bellon, M.R., J. Berthaud, M. Smale, et al. 2003. Participatory landrace selection for on‐ farm conservation: An example from the central valleys of Oaxaca, Mexico. Genet. Resour. Crop Evol. 50:401–416. Brokensha, D.M., D.M. Warren, and O. Werner. 1980. Indigenous knowledge systems and development. University Press of America, Washington, DC. CGIAR Gender and Breeding Initiative. 2017. Innovation in gender‐responsive breeding: Workshop report. International Potato Center (CIP), Lima. http://hdl.handle. net/10568/89834. Chambers, K.J., and J.H. Momsen. 2007. From the kitchen and the field: Gender and maize diversity in the bajío region of Mexico. Singapore J. Trop. Geog. 28:39–56. doi:10.1111/j.1467‐9493.2006.00275.x. Chenu, K., M. Cooper, G.L. Hammer, et al. 2011. Environment characterization as an aid to wheat improvement: Interpreting genotype‐environment interactions by modelling water‐deficit patterns in North‐Eastern Australia. J. Exp. Bot. 62:1743–1755. 10.1093/ jxb/erq459. Chiwona‐Karltun, L., J. Mkumbira, J. Saka, et al. 1998. The importance of being ­bitter—A qualitative study on cassava cultivar preference in Malawi. Ecol. Food Nutr. 37:219–245. Christinck, A. 2002. This seed is like ourselves: A case study from Rajasthan, India, on the social aspects of biodiversity and farmers’ management of pearl millet seed. Communication and Extension Series, vol. 47. Margraf Publishers, Weikersheim, Germany. Christinck, A., and E. Weltzien. 2013. Plant breeding for nutrition‐sensitive agriculture: An appraisal of developments in plant breeding. Food Secur. 5:693–707. 10.1007/ s12571‐013‐0288‐2. Christinck, A., E. Weltzien, and V. Hoffmann. 2005. Setting breeding objectives and developing seed systems with farmers: A handbook for practical use in participatory plant breeding projects. Margraf Publishers, Weikersheim, Germany, and CTA, Wageningen, The Netherlands. Christinck, A., E. Weltzien, F. Rattunde, and J. Ashby. 2017. Gender differentiation of farmer preferences for varietal traits in crop improvement: Evidence and issues. CGIAR Gender and Agriculture Research Network. CGIAR System Management Office and International Center for Tropical Agriculture (CIAT), Cali, Colombia. http://library. cgiar.org/handle/10947/4660. Christinck, A., F. Rattunde, A. Kergne, et  al. 2018. “You can’t grow alone”—Prioritized ­sustainable seed system development options for staple food crops in Sub‐Saharan Africa: Cases of Kenya and Mali. Final project report. Center for Development Research (ZEF), Bonn, Germany. http://research4agrinnovation.org/wp‐content/uploads/2018/02/ PARI_seed_study2018.pdf.

Gender and Farmer Preferences for Varietal Traits

275

Comstock, R.E. 1977. Quantitative genetics and the design of breeding programs. p. 705–718. In: E. Pollak, O. Kempthorne, and T.B. Bailey Jr. (eds.), Proceedings of the International Conference on quantitative genetics. Iowa State University Press, Ames, Iowa. Cooper, M., C.D. Messina, D. Podlich, et al. 2014. Predicting the future of plant breeding: Complementing empirical evaluation with genetic prediction. Crop Pasture Sci. 65:311. 10.1071/CP14007. Defoer, T., A. Kamara, and H. De Groote. 1997. Gender and variety selection: Farmers’ assessment of local maize varieties in southern Mali. African Crop Sci. J. 5:65–76. De Groote, H., M. Siambi, D. Friesen, and A. DIallo. 2002. Identifying farmers’ preferences for new maize varieties in Eastern Africa. p. 82–103. In: M.R. Bellon and J. Reeves (eds.), Quantitative analysis of data from participatory methods in plant breeding. International Maize and Wheat Improvement Center (CIMMYT), Mexico. Diallo, C., K. Isaacs, V. Gracen, et  al. 2018. Learning from farmers to improve ­sorghum breeding objectives and adoption in Mali. J. Crop Improv. 1:18. 10.1080/ 15427528.2018.1531800. Dorward, P., P. Craufurd, K. Marfo, et  al. 2007. Improving participatory varietal selection processes: Participatory varietal selection and the role of informal seed diffusion mechanisms for upland rice in Ghana. Euphytica 155:315327. DOI 10.1007/s10681‐ 006‐9333‐y. Doss, C. 2014. Collecting sex disaggregated data to improve development policies. J. African Econ. 23:i62–i86. 10.1093/jae/ejt023. Doss, C.R. 2018. Women and agricultural policy: Reframing the issues. Dev. Pol. Rev. 36:35–50. Efisue, A., P. Tongoona, J. Derera, et al. 2008. Farmers’ perceptions on rice varieties in Sikasso region of Mali and their implications for rice breeding. J. Agron. Crop Sci. 194:393–400. 10.1111/j.1439‐037X.2008.00324.x. Eyzaguirre, P., and M. Iwanaga (eds.). 1996. Participatory plant breeding: Proceedings of a workshop on participatory plant breeding. International Plant Genetic Resources Institute (IPGRI), Rome. FAO. 2011. The state of food and agriculture: Women in agriculture. Closing the gender gap for development. Food and Agriculture Organization of the United Nations (FAO), Rome. http://www.fao.org/catalog/inter‐e.htm. Fischer, E., and M. Qaim. 2012. Gender, agricultural commercialization, and collective action in Kenya. Food Sec. 4:441–453. Galiè, A., J. Jiggins, P.C. Struik, et al. 2017. Women’s empowerment through seed improvement and seed governance: Evidence from participatory barley breeding in pre‐war Syria. NJAS‐Wagen. J. Life Sci. 81:1–8. 10.1016/j.njas.2017.01.002. Gartaula, H.N., A. Niehof, and L. Visser. 2010. Feminisation of agriculture as an effect of male out‐migration: Unexpected outcomes from Jhapa District, Eastern Nepal. International J. of Interdisciplinary Soc. Sci. 5:565–578. Gold, C.S., A. Kiggundu, A.M.K. Abera, and D. Karamura. 2002a. Diversity, distribution and farmer preference of Musa cultivars in Uganda. Exper. Agric. 38:39–50. 10.1017/ S0014479702000145. Gold, C.S., A. Kiggundu, A.M.K. Abera, and D. Karamura.2002b. Selection criteria of Musa cultivars through a farmer participatory appraisal survey in Uganda. Exper. Agri. 38:29–38.10.1017/S0014479702000133. Goldstein, M., and C. Udry. 2008. The profits of power: Land rights and agricultural investments in Ghana. J. Pol. Econ. 116:981–1022.

276

EVA WELTZIEN ET AL.

Gridley, H. 2002. Participatory varietal selection in West and Central Africa. p. 132–133. In: M.R. Bellon and J. Reeves (eds.), Quantitative analysis of data from participatory methods in plant breeding. International Maize and Wheat Improvement Center (CIMMYT), Mexico. Gunaratna, N.S, T. Bosha, D. Belayneh, et al. 2016. Women’s and children’s acceptance of biofortified quality protein maize for complementary feeding in rural Ethiopia: Acceptance of biofortified quality protein maize. J. Sci Food Agric. 96:3439–3445. 10.1002/jsfa.7526. Haugerud, A., and M.P. Collinson. 1990. Plants, genes and people: Improving the relevance of plant breeding in Africa. Exper. Agric. 26:341–362. 10.1017/S0014479700018500. Hmielowski, T. 2018. Educating the next generation of plant breeders. CSA News 63:4–6. 10.2134/csa2018.63.0701. Isaacs, K., E. Weltzien, C. Diallo, et al. 2018. Farmer engagement in culinary testing and grain‐quality evaluations provides crucial information for sorghum breeding strategies in Mali. p. 95–107. In: H.A. Tufan, S. Grando, and C. Meola (eds.), State of the knowledge for gender in breeding: Case studies for practitioners. Working Paper No. 3. CGIAR Gender and Breeding Initiative, International Potato Center (CIP), Lima. http:// oar.icrisat.org/10678/. Katungi, E., P. Aseete, C. Mukankusi, and S. Nkalubo. 2018. Towards a more gender‐ responsive bean breeding program: Lessons from East Africa. p. 23–43. In: H.A. Tufan, S. Grando, and C. Meola (eds.), State of the knowledge for gender in breeding: Case studies for practitioners. Working Paper No. 3. CGIAR Gender and Breeding Initiative, International Potato Center (CIP), Lima. http://oar.icrisat.org/10678/. Katungi, E., L. Sperling, D. Karanja, et al. 2011. Relative importance of common bean attributes and variety demand in the drought areas of Kenya. J. Dev. Agric. Econ. 3:411–422. Kent, R. 2018. “Helping” or “Appropriating”? Gender relations in shea nut production in Northern Ghana. Soc. Nat. Resour. 31:367–381. Kerr, R.B., S. Snapp, M. Chirwa (deceased), et al. 2007. Participatory research on legume diversification with Malawian smallholder farmers for improved human nutrition and soil fertility. Exper. Agric. 43:437–453. 10.1017/S0014479707005339. Kitch, L.W., O. Boukar, C. Endondo, and L.L. Murdock. 1998. Farmer acceptability criteria in breeding cowpea. Exper. Agric. 34:475–486. 10.1017/S0014479798004049. Kudadjie, C.Y. 2006. Integrating science with farmer knowledge: sorghum diversity management in north‐east Ghana. PhD thesis. Wageningen University, Wageningen, The Netherlands. Leiser, W.L., F. Rattunde, H.P. Piepho, E. Weltzien, A. Diallo, A.E. Melchinger, H.K. Parzies, and B.I.G. Haussmann. 2012. Selection strategy for sorghum targeting phosphorus‐­limited environments in West Africa: Analysis of multi‐environment experiments. Crop Sci. 52:2517–2527. 10.2135/cropsci2012.02.0139. Leiser, W.L., F. Rattunde, E. Weltzien, and B.I.G. Haussmann. 2018. Sorghum tolerance to low‐phosphorus soil conditions. p. 247–272. In: W. Rooney (ed.), Achieving sustainable cultivation of sorghum vol. 1: Genetics, breeding and production techniques. Burleigh Dodds Science Publishing, Philadelphia. 10.19103/AS.2017.0015.30. Lope‐Alzina, D.G. 2007. Gendered production spaces and crop varietal selection: Case study in Yucatán, Mexico. Singapore J. Trop. Geog. 28:21–38. Manzanilla, D.O., T.R. Paris, G.T. Tatlonghari, et al. 2014. Social and gender perspectives in rice breeding for submergence tolerance in Southeast Asia Exper. Agric. 50:191–215. 10.1017/S0014479713000409. Matlon, P.J. 1990. Improving productivity in sorghum and pearl millet in semi‐arid ­Africa. Food Res. Inst. Stud. 22:1–43.

Gender and Farmer Preferences for Varietal Traits

277

McElhinny, E., E. Peralta, N. Mazón,.2007. Aspects of participatory plant breeding for quinoa in marginal areas of Ecuador. Euphytica 153:373–384. 10.1007/s10681‐006‐9200‐x. Mulatu, E., and K. Belete. 2001. Participatory varietal selection in lowland sorghum in Eastern Ethiopia: Impact on adoption and genetic diversity. Exper. Agric. 37:211–229. Mulatu, E., and H. Zelleke. 2002. Farmers’ highland maize (Zea Mays L.) selection ­criteria: Implication for maize breeding for the Hararghe Highlands of Eastern Ethiopia. Euphytica 127:11–30. Ndjeunga, J., and C.H. Nelson. 2005. Toward understanding household preference for consumption characteristics of millet varieties: A case study from Western Niger. ­Agric. Econ. 32:151–165. Nelson, K.M. 2013. Analysis of farmer preferences for wheat variety traits in Ethiopia: A gender‐responsive study. Cornell University, Ithaca, NY. Njuki, J., S. Kaaria, A. Chamunorwa, and W. Chiuri. 2011. Linking smallholder farmers to markets, gender and intra‐household dynamics: Does the choice of commodity matter? Exper. Agric. 23:426–443. Njuki, J.M., A. Wyatt, I. Baltenweck, et al. 2016. An exploratory study of dairying intensification, women’s decision making, and time use and implications for child nutrition in Kenya. Europ. J. Dev. Res. 28:722–740. http://www.palgrave‐journals.com/ doifinder/10.1057/ejdr.2015.22. Ojiem, J.O., N. de Ridder, B. Vanlauwe, and K.E. Giller. 2006. Socio‐ecological niche: A  conceptual framework for integration of legumes in smallholder farming systems. Int. J. Agric. Syst. 4:79–93. Orr, A., C.M. Cox, Y. Ru, and J.A. Ashby. 2018. Gender and social targeting in plant breeding. Working Paper No. 1. CGIAR Gender and Breeding Initiative, International Potato Center (CIP), Lima. https://cgspace.cgiar.org/handle/10568/91276. Pingali, P.L., S.D. Rozelle, and R.V. Gerpacio. 2001. The farmer’s voice in priority setting: A cross‐country experiment in eliciting technological preferences. Econ. Dev. Cult. Change 49:591–609. 10.1086/452517. Polanyi, M. 1966. Logic of tacit inference. Philosophy 41:1–18. 10.1017/S0031819100066110. Quisumbing, A.R., R. Meinzen‐Dick, T.L. Raney, et al. (eds). 2014. Gender in agriculture: Closing the knowledge gap. Springer, Dordrecht/Heidelberg/New York/London. Ragot, M., M. Bonierbale, and E. Weltzein. 2018. From market demand to breeding decisions: A framework. Working Paper No. 2. CGIAR Gender and Breeding Initiative, International Potato Center (CIP), Lima. Rattunde, F., M. Sidibé, B. Diallo, et al. 2018. Involving women farmers in variety evaluations of a “men’s crop”: Consequences for the sorghum breeding strategy and farmer empowerment in Mali. p. 95–107. In: H.A. Tufan, S. Grando, and C. Meola (eds.), State of the knowledge for gender in breeding: Case studies for practitioners. Working Paper No. 3. CGIAR Gender and Breeding Initiative, International Potato Center (CIP), Lima. http://oar.icrisat.org/10678/. Siart, S. 2008. Strengthening local seed systems: Options for enhancing diffusion of ­varietal diversity of sorghum in Southern Mali. Communication and Extension Series, vol. 85. Margraf Publishers, Weikersheim, Germany. Smale, M., and J. Olwande. 2014. Demand for maize hybrids and hybrid change on smallholder farms in Kenya. Agric. Econ. 45:409–420. 10.1111/agec.12095. Smale, M., J.A. Aguirre, M.R. Bellon, et  al. 1999. Farmer management of maize diversity in the central valleys of Oaxaca, Mexico: CIMMYT INIFAP‐1998 Baseline Socioeconomic Survey. Economics Working Papers 7689. International Maize and Wheat Improvement Center (CIMMYT), Mexico. http://repository.cimmyt.org:8080/xmlui/ handle/10883/991.

278

EVA WELTZIEN ET AL.

Song, Y., S. Zhang, K. Hung, et al. 2006. Participatory plant breeding in Guangxi, South‐ West China. p. 83–90. In: C. Almekinders and J. Hardon (eds.), Bringing farmers back into breeding: Experiences with participatory plant breeding and challenges for ­institutionalisation. Agromisa Special 5. Agromisa Foundation, Wageningen, The Netherlands. Sperling, L., M. Loevinsohn, and B. Ntabomvura. 1993. Rethinking the farmers role in plant‐breeding—local bean experts and on‐station selection in Rwanda. Exper. Agric. 29:509–519. 10.1017/S0014479700021219. Stanley, V. 2015. Women in agriculture: The impact of male out‐migration on women’s agency, household welfare, and agricultural productivity. World Bank Group, Washington, DC. Teeken, B., E. Nuijten, M.P. Temudo, et al. 2012. Maintaining or abandoning African rice: Lessons for understanding processes of seed innovation. Human Ecol. 40:879–892. vom Brocke, K., G. Trouche, E. Weltzien, et al. 2010. Participatory variety development for sorghum in Burkina Faso: Farmers’ selection and farmers’ criteria. Field Crop Res. 119:183194. 10.1016/j.fcr.2010.07.005. von Braun, J. 1988. Effects of technological change in agriculture on food consumption and nutrition: Rice in a West African setting. World Dev. 16:1083–1098. Weltzien, E., and A. Christinck. 2017. Participatory breeding: Developing improved and relevant crop varieties with farmers. p. 259–301. In: S. Snapp and B. Pound (eds.), Agricultural systems: Agroecology and rural innovation for development, 2nd edn. Elsevier, London/New York. Weltzien, E., M.L. Whitaker, F. Rattunde, et al. 1998. Participatory approaches in pearl millet breeding. p. 143–170. In: J. Witcombe, D. Virk, and J. Farrington (eds.), Seeds of choice: Making the most of new varieties for small farmers. Practical Action Publishing, New Delhi. Weltzien, E., A. Christinck, A. Touré, et al. 2006. Enhancing farmers’ access to s­ orghum varieties through scaling‐up participatory plant breeding in Mali, West Africa. p. 58–69. In: C. Almekinders and J. Hardon (eds.), Bringing farmers back into breeding. Experiences with participatory plant breeding and challenges for institutionalisation. Agromisa, Agromisa Special 5. Agromisa Foundation, Wageningen, The ­Netherlands. Weltzien, E., F. Rattunde, T.A. Van Mourik, and H.A. Ajeigbe. 2018. Sorghum cultivation and improvement in West and Central Africa. p. 380. In: W. Rooney (ed.), Achieving sustainable cultivation of sorghum, vol. 2: Sorghum utilization around the world. ­Burleigh Dodds Science Publishing, Cambridge. Witcombe, J.R., K.D. Joshi, S. Gyawali, et al. 2005. Participatory plant breeding is better described as highly client‐oriented plant breeding. I. Four indicators of client‐orientation in plant breeding. Exper. Agric. 41:299–319. 10.1017/S0014479705002656. World Bank. 2007. Agriculture for development: The gender dimensions. Agriculture for development policy brief. The World Bank, Washington, DC. Yapi, A. M, A.O. Kergna, S.K. Debrah, et al. 2000. Analysis of the economic impact of ­sorghum and millet research in Mali. Impact Series, No. 8. International Crops Research Institute for the Semi‐arid Tropics (ICRISAT), Patancheru, India.

8 Domestication, Genetics, and Genomics of the American Cranberry Nicholi Vorsa Blueberry and Cranberry Research and Extension Center, Rutgers University, Chatsworth, New Jersey, USA Juan Zalapa USDA‐ARS, Vegetable Crops Research Unit, Department of Horticulture, University of Wisconsin, Madison, USA ABSTRACT The American cranberry (Vaccinium macrocarpon Aiton) is an iconic fruit species native to eastern North America. The United States is a leader in cranberry production. However, from a genetic perspective, the species has been understudied until very recently. Domesticated less than 200 years ago, breeding efforts did not start until 1929. The American cranberry is a long-lived woody perennial adapted to a temperate climate and well-drained moist acidic soils. Cranberry reproduces both sexually and asexually, through stolons, which are used for clonal asexual propagation of cultivars. The flower is hermaphroditic, relying largely on pollination by hymenoptera pollinators for fruit set. The species is diploid (2n = 2 x = 24), self-fertile, with a genome size of approximately 470 Mbp. Traits of economic importance include productivity, propagation vigor, disease resistance, fruit anthocyanins, brix, and increasingly fruit quality traits for sweetened-dried cranberry products, e.g., fruit firmness and size. Quantitative trait loci (QTL) have been identified for productivity, berry size, TAcy, fruit rot resistance, and other traits. The fruit of American cranberry fruit is recognized for potential benefits to human health due to very high levels of the flavonoid classes, anthocyanins, proanthocyanidins, and flavonols, which result in a very high anti-oxidant status. Recent restrictions on traditional pesticides to control insect and disease pests have altered the

Plant Breeding Reviews, Volume 43, First Edition. Edited by Irwin Goldman. © 2020 John Wiley & Sons, Inc. Published 2020 by John Wiley & Sons, Inc. 279

280

NICHOLI VORSA AND JUAN ZALAPA

ecology with former challenges, e.g., false blossom, having a re-emergence. Genetic improvement of cranberry has been hampered by a long generation interval, including three years from pollination to flower, and assessment of yield requiring 6–8 years after field planting, with typically limited field acreage for breeding. Due to the high cost and effort and long time required for breeding, and due to the recent surge of molecular data and marker-trait association studies, marker-assisted selection will be extremely helpful for cranberry for breeding in the future. KEYWORDS: cranberry breeding, genetics, genomics, molecular markers, mapping, QTLs I.  DOMESTICATION AND BREEDING II.  LIFE HISTORY PARAMETERS III.  TAXONOMY IV.  CYTOLOGY V.  TRAITS OF INTEREST A. Disease Resistance B. Insect Resistance C. Fruit Yield D. Flavonoids E. Anthocyanins F. Proanthocyanidins G. Flavonols H. Hydroxycinnamic Acids VI.  HERITABILITY OF TRAITS VII.  MOLECULAR MARKERS A. Next‐Generation Sequencing Marker Development B. SSR Marker Development C. SSR Genetic Diversity Studies VIII.  NUCLEAR AND ORGANELLAR GENOME ASSEMBLY IX.  LINKAGE MAPPING AND SNP MARKERS X.  MARKER‐TRAIT ASSOCIATION STUDIES XI.  FUTURE PROSPECTS ACKNOWLEDGMENTS LITERATURE CITED

ABBREVIATIONS ANOVA Analysis of variance SDC Sweeten‐dried cranberry TAcy Anthocyanin content TA Titratable acidity PACs Proanthocyanidins Brix Soluble solids content Bp Base pairs

Domestication, Genetics, and Genomics

281

Mbp Mega base pairs Gbp Giga base pairs QTL Quantitative trait loci SSR Simple sequence repeat USDA United States Department of Agriculture SCAR Sequenced characterized amplified region PC Principal component PCA Principal component analysis DP Degree of polymerization DNA Deoxyribonucleic acid RAPD Random amplified polymorphic DNA RNA Ribonucleic acid spp. Species NCBI National Center for Biotechnology SOLiD Sequencing by oligonucleotide ligation and detection NGS Next‐generation sequencing COS Conserved orthologous set genes LSC Large single copy region IR Inter‐repeat region SSC Single small copy region N50 Minimum contig length needed to cover 50% of the genome cM Centimorgam GBS Genotyping by sequencing SNP Single nucleotide polymorphism LG Linkage groups DC Digital color DCV Digital color variation MFW Mean fruit weight GWAS Genome‐wide association study MAS Marker‐assisted selection GS Genomic selection I.  DOMESTICATION AND BREEDING The American cranberry (Vaccinium macrocarpon Aiton) is one of the few fruit crop species that are native to North America. The major production of cranberry is in the United States and Canada. Other production areas are Chile, New Zealand, and Europe. Cranberry has received considerable attention due the “antioxidant” status and beneficial benefits to human health. The American cranberry was thought to relieve scurvy during trans‐Atlantic voyages from the New World back to

282

NICHOLI VORSA AND JUAN ZALAPA

Europe, and by American Indians as a wound dressing and a treatment for blood poisoning (Eck 1990). What has received much attention is the use of cranberry to relieve symptoms of dysuria or urinary tract infections. As will be discussed later, the cranberry’s unique fruit chemistry appears to be the result of evolution away from animal seed dispersal, as is the case with blueberry, another major Vaccinium fruit crop species, but towards water dispersal. The domestication and culture of cranberry appears to have been initiated about the 1820s in Massachusetts (Stevens et  al. 1957). It is reported that the first propagation of a “variety” named ‘Early Black’, was done by Nathanie Robbins, where the first vines were selected from a “swamp” in Harwich, Massachusetts, about 1852, from which the first commercial planting was established in 1857 in Massachusetts (Chandler and Demoranville 1958). During the 1880s and early 1900s, over 132 varieties were named from indigenous selections from Massachusetts, New Jersey, Wisconsin, and Michigan (Dana 1983; Eck 1990). It appears that criteria for selection were season of harvest and fruit color, berry size, and productivity. Of the many varieties selected from native populations “the Big Four,” ‘Early Black’, ‘Howes’, ‘McFarlin’, and ‘Searles’, became the principal cultivars planted during the early and mid‐20th century. ‘Early Black’, ‘Howes’ (East Dennis, MA, about 1843), and ‘McFarlin’ (South Carver in 1874) were selections from Massachusetts and ‘Searles’ (Walker, WI, in 1894) was a selection from Wisconsin (Eck 1990). Today cranberries are cultivated in the Pacific Northwest in the states of Oregon and Washington, the Midwest in Wisconsin, and in the northeastern states of New Jersey, Massachusetts, Michigan, and Maine. In 2017, United States production was 905 million pounds, valued at $257 million. Wisconsin is the principal cranberry producing state with more than half of the nation’s cranberry production, followed by Massachusetts, New Jersey, Oregon, and Washington (http:// www.agmrc.org/agmrc/commodity/fruits/cranberries/). Like most crop species, cranberry has both insect and disease threats, which can cause severe economic losses. Fruit rot is the most serious disease problem facing cranberry production, particularly in New Jersey and Massachusetts (Oudemans et al. 1998; Johnson‐Cicalese et al. 2009). The first breeding and selection cycle was initiated in 1929 by the United States Department of Agriculture (USDA) and the New Jersey and Massachusetts Agricultural Experiment Stations in response to a devastating disease, “false‐blossom,” caused by a phytoplasma belonging to the subgroup of 16SrIII‐V phytoplasmas (Chandler et al. 1947). Being the disease was most severe in New Jersey, the first breeding

Domestication, Genetics, and Genomics

283

populations were field planted in 1.5 × 1.5 m plots in 1934 at J.J. White Inc., at Whitesbog, Pemberton, NJ. Breeding populations from additional crosses were planted in 1937 and 1943. The breeding program’s objective was stated as “…the aim of originating varieties that would show resistance to the spread of false‐blossom disease and that would produce large crops of superior fruit.” From 30 crosses made between 18 native selections a total of 8,692 seedlings were evaluated at Whitesbog. The majority of the parents were selections from Massachusetts native stands. Other cultivars used for crossing were native selections from Michigan, ‘Prolific’, and Wisconsin, ‘Searles’ and ‘Potter’. Of the 30 crosses ‘McFarlin’ was a parent in 16, probably because of the larger fruit size. Selection of progeny from the 1934 planting was initiated in 1938 and carried out over three years through 1940. Of the over 8,000 seedling plots, 1,800 plots that produced at least a “pint” (approx. 100 g) for two to three consecutive years were further evaluated. The berries were hand‐harvested and placed into storage for 2–3 months. The selection criteria included average yield, percent sound berries post‐storage and “general appearance.” Since only the seedlings producing a minimum quantity of fruit were evaluated, it is likely that indirect selection for establishment (stolon) vigor, precocious fruiting, upright production, fruit set, and fruit size took place. From the Whitesbog planting, 40 selections were initially selected for further testing. In 1945 an additional 182 seedlings were selected for further testing. The selections were further evaluated in a “second test” in New Jersey, Massachusetts, and Wisconsin. From this first breeding and selection cycle, six named varieties were released. The cultivars that were initially released in 1950 from the 40 “numbered” selections in 1940 were ‘Stevens’, ‘Beckwith’, and ‘Wilcox’. Subsequently ‘Pilgrim’, ‘Bergman’, and ‘Franklin’ were released in 1961 (Dana 1983). A second round of selections were made, identified by a “two‐letter code,” e.g. #35, CN, DF5, AR, etc., which were not officially named except for BE4 and ‘Crowley’. BE4 was subsequently named ‘Willapa Red’ by K. Patten of the Washington State University Cranberry Research Station, Long Beach, WA (Vorsa 2010). This breeding program only carried out a single breeding cycle. Cranberry production is currently based on sparingly few cultivars, and many farmers still grow native selections made as early as the 1800s (Dana 1983; Eck 1990) (see Table 8.1). Of the named varieties, ‘Stevens’, and to a lesser degree ‘Pilgrim’, are currently the most widely planted cultivars. Both of these cultivars have ‘McFarlin’, the larger fruited of the native varieties, as a parent, which most likely contributed to a larger fruit size. Following the initial breeding efforts, further cranberry

284

NICHOLI VORSA AND JUAN ZALAPA

Table 8.1.  The major cranberry cultivars and new hybrids in production today. Variety*

Source*

Release/Selection Year

Native Selection, MA Native Selection, MA Native Selection, MA Native Selection, WI Native Selection, WI Native Selection, MI Native Selection, WI Native Selection, NJ

1835 1843 1874 1893 1895 1900 1901 1960

‘Early Black’ × ‘Howes’ ‘McFarlin’ × ‘Potter’ ‘McFarlin’ × ‘Early Black’ ‘Howes’ × ‘Searles’ ‘Early Black’ ‘Searles’ ‘McFarlin’ × ‘Prolific’ ‘Prolific’ × ‘McFarlin’ ‘Howes’ × ‘Searles’

1930 1950 1950 1950 1961 1961 1961 N/A

‘Earl Rezin Native’ × ‘Searles’ ‘Earl Rezin Native’ × ‘Searles’ ‘Stevens’ × ‘Ben Lear’ ‘Earl Rezin Native’ × ‘Searles’ ‘Franklin’ × ‘Ben Lear’ ‘Stevens’ × ‘Ben Lear’ #35 × ‘LeMunyon’ ‘Aviator’ × ‘McFarlin’ Stevens × (Franklin V Ben Lear) ‘Stevens’ × ‘Ben Lear’ ‘Beckwith’ × ‘GH1’ ‘Crimson Queen’ × ‘#35’ ‘#35’ × (Franklin V Ben Lear)

1994 1996 2003 2004 2006 2006 2007 2009 2010 2011 2011 2017 2017

Native Standards ‘Early Black’1,2 ‘Howes’1,2 ‘McFarlin’1,2 ‘Searles’1,2 ‘Potter’s Favorite’1 ‘Prolific’1 ‘Ben Lear’1,2 ‘LeMunyon’1,2 First Breeding Cycle Hybrid ‘Franklin’1,2 ‘Stevens’1,2 ‘Beckwith’1,2 ‘Wilcox’1,2 ‘Bergman’1,2 ‘Crowley’1,2 ‘Pilgrim’1,2 ‘No.35’** Newer Released Varieties ’GH1’3 ‘GH2’3 ‘HyRed’3,5 ‘GH3’3 ‘Demoranville’3 ‘Crimson Queen’3 ‘Mullica Queen’3 ‘Willapa Red’3 ‘Scarlet Knight’4 ‘Sundance’6 ‘BG’4 ‘Haines’7 ‘Welker’8

*Cultivar descriptors from Dana (1983)1, Eck (1990)2, Vorsa (20103, 20124), McCown and Zeldin (2003)5, Zeldin and McCown (2014)6, Vorsa and Johnson (2017a7, 2017b8). **Not formally released, but commercially grown, likely section #35 from the USDA breeding program (Chandler et al. 1947).

genetic improvement through breeding was largely delayed until the 1970s when a private program in Wisconsin initiated hybridization of native varieties. Dr. D. Boone, from the University of Wisconsin, initiated the selection of seedlings from open‐pollinated cultivars. Currently, there are two active public breeding programs located at Rutgers University and the University of Wisconsin‐Madison, USDA‐ARS, and

Domestication, Genetics, and Genomics

285

there is an additional grower operated breeding program, Valley Corporation, in Tomah, Wisconsin. Since 2003, these programs have released new cultivars from a second cranberry breeding cycle (Table 8.1). The recently released cranberry cultivars are: ‘HyRed’ and ‘Sundance’ ­(Wisconsin); ‘Demoranville’, ‘Crimson Queen’, ‘Mullica Queen’, ‘Scarlet Knight’, ‘Haines’, and ‘Welker’ (Rutgers); ‘GH1’, ‘GH2’, ‘GH3’, and ‘BG’ (Valley Corporation); and ‘Willapa Red’ (renamed from BE4) by K. Patten (Washington State) (Vorsa 2010, 2012). Many of these cultivars were generated by crossing first‐generation hybrids and elite wild selections, and resulted in the improvement of fruit quality (mainly fruit anthocyanin content and fruit size) and increased productivity (Table  8.1). A recent survey found that new cultivars like ‘Mullica Queen’ (released in 2007) are becoming increasingly more popular among growers, demonstrating the value of breeding efforts in cranberry aiming to improving fruit quality characteristics (Gallardo et al. 2018). II.  LIFE HISTORY PARAMETERS The American cranberry is a temperate climate diploid fruit species (2n = 2x = 24) endemic to northeastern North America. It is a member of the Ericaceae (Heath family) and of the Vaccinium section Oxycoccus, meaning “sour berry.” The American cranberry is adapted to moist acidic (20 ovules). Flowers are protandrous, with the style 6–7 mm in length at anthesis inside the anther whorl, then elongating to 8–10 mm, extending 2–3 mm beyond the anther whorl 2–3 days post anthesis (Fig.  8.1). The stigma appears most receptive 3–5 days after

1

2

3

Fig. 8.1.  Stages of cranberry anthesis: (1) bud prior to anthesis, (2) early anthesis‐style not elongated, and (3) late anthesis‐extruded stigma.

Domestication, Genetics, and Genomics

287

anthesis, producing an exudate. Characteristic of Ericaceae species, pollen is shed as a tetrad with the four pollen grains of a meiotic event held in a tetrahedral formation. All four pollen grains of the tetrad are potentially viable. Anthers of one cranberry flower shed over 7000 pollen tetrads (Cane et  al. 1996). Typically, one to three fruit are set per upright, but up to five are common in many cultivars. Employing colchiploidy, cranberry runner branches are shown to have a 5/13 phyllotactic arrangement Bain and Dermen (1944). As mentioned, although many species within the Vaccinioideae, for example, utilize animal seed dispersal, cranberry is typically found around bodies of water. Cranberry’s fruit chemistry strongly suggests cranberry evolved for water seed dispersal. Cranberry fruit has relatively low sugar content (5–7%), high acid content (2–3%), high proanthocyanidin content, benzoic acid (0.1%) in the epicuticular wax, and large locular chambers. III. TAXONOMY Vaccinium macrocarpon Aiton (Ericaceae) is a diploid member of Vaccinium section Oxycoccus (Hill) Koch. A recent treatment of the section by Vander Kloet (1983) recognized only one other species, V. oxycoccos L., the small‐fruited cranberry. The two species are ­differentiated on predominantly size‐related morphological characters, including leaf length, leaf shape, pedicel bract length, and pedicel bract shape. Both taxa are sympatric and syntopic over much of the distribution of V. macrocarpon. The taxa are reproductively isolated by differences in flowering phenology, with V. oxycoccos flowering earlier than V. macrocarpon. Although diploids exist in both taxa, V. oxycoccos also occurs at tetraploid and hexaploid levels (Vander Kloet 1983). V. macrocarpon has been considered the more primitive of the two (Camp 1945). However, Mahy et  al. (2000) found diploid V. oxycoccos to have a significantly higher genetic diversity than V. macrocarpon, suggesting that V. oxycoccos is the more primitive form. In addition, V. oxycoccos and a V. oxycoccos × V. macrocarpon hybrid have yielded intersectional hybrids with V. darrowii blueberry (Vorsa et. al. 2009). Endemic to eastern North America, the large cranberry’s natural distribution spans from Newfoundland, throughout the Great Lakes region to Minnesota, and south along the Appalachian Mountains to North Carolina and Tennessee. However, the east coast distribution occurs to south New Jersey. It is restricted to acidic soils and peat of

288

NICHOLI VORSA AND JUAN ZALAPA

open bogs, swamps, wet shores, and headlands (Vander Kloet 1983) and stream banks. IV. CYTOLOGY The American cranberry is diploid (2n =2x = 24), having a karyotype of 12 metacentric and submetacentric chromosomes (Hall and Galletta 1971). It was determined that the karyotype of American cranberry, Oxycoccus section, was similar to that of Cyanococcus section (blueberry) which was described as consisting of two long (2μm), eight medium (1.5–2 µm), and two short (under 1.5 µm) chromosomes. Flow cytometry estimated the nuclear DNA content of V. macrocarpon to be 1.16±0.04 pg (Costich et al. 1993). Genome size is estimated to be about 470 Mbp (Zdepski et al. 2011). Pollen tetrad analysis provided evidence for reciprocal translocations in two genotypes, ‘Howes’ and US89‐3 (Ortiz and Vorsa 1998; Daverdin et al. 2017). Tetrad analysis of a reciprocal translocation heterozygote and derived progeny indicated a predominance of alternate segregation which was correlated with a reduction of the crossing over in the interstitial region (Ortiz and ­Vorsa 1998). Significant differences were found in the tetrad frequency distribution for pollen stainability between years, and for cultivars carrying the same translocation. This variation was correlated with significant differences in the frequency of crossing over between years and among cultivars, which indicates that the estimation of recombination frequencies was influenced by both environment and genotype. The occurrence of translocations in cultivars selected from wild populations indicates the possible advantage of maintaining heterozygosity or a block of genes as a link through this chromosome aberration in a self‐pollinated crop like cranberry. Specific chromosomes involved in translocations will be discussed later. Periclinal and total polyploid clones in cranberries have been induced by colchicine treatment of meristems by a USDA program (Dermen and Bain 1941, 1944). The University of Wisconsin d ­ eveloped colchicine‐induced clones, referred to as “colchiploids,” of the cultivars ‘Pilgrim’ and ‘HyRed’ (Zeldin and McCown 2003). Colchicine‐ induced tetraploids were slower to vine in and exhibited a poor fruit set in initial plantings (Chandler et al. 1947). A spontaneous tetraploid was recovered in a breeding population from across between the 6th generation inbred and a native cultivar ‘Drever’ (Johnson‐Cicalese and Vorsa unpublished data). A spontaneous haploid, monoploid, was recovered in a breeding progeny, where simple sequence repeat (SSR)

Domestication, Genetics, and Genomics

289

markers indicated the monoploid arose from an unfertilized egg (Vorsa unpublished data). V.  TRAITS OF INTEREST Since the beginning of cranberry domestication, horticultural traits that have been important included productivity, establishment vigor, fruit shape, size and color, fruit shelf‐life, and disease and insect resistance. The initial fruit parameters of interest, and as described in Chandler and Demoranville (1958) and more recently in Dana (1983), largely relate to fresh fruit quality traits, which include fruit color, harvest season, e.g., early, mid, and late, coloring in storage, and keeping quality. Other fruit characteristics are fruit shape (predominant shape), fruit size (measured previously as cup count), fruit epicuticular wax (bloom) on fruit, vine texture, upright length, leaf shade and shape. The flesh weight to seed ratio was also noted: the varieties ‘Centerville’ and ‘Stanley’ had a higher flesh to seed ratio than ‘Early Black’ and ‘Bugle’. The number of fruit per upright was noted (Bain 1946; Bergman, 1950), with ‘Searles’, ‘Howes’, and ‘McFarlin’ setting on average more than one berry/ upright, whereas other varieties, e.g., ‘Early Black’, set less than one. ‘Early Black’ is noted for its adaptation to various soils. Except for resistance to false‐blossom, little information is given as to resistance to fungal field rots. Current traits of concern mainly encompass horticultural traits and fruit quality as suited to various processed products. Additional fruit quality traits of importance have evolved with the development of cranberry products, from cranberry sauce to fruit drinks to sweeten‐dried cranberry (SDC) and nutraceuticals. Up until the early 1900s fresh fruit was the primary outlet of the cranberry crop. Canned cranberry sauce was introduced in 1941. For sauces, besides fruit color, pectin content and gelling quality were assessed. Cranberry drinks, mostly consumed as “cranberry cocktail,” are made from cranberry concentrate and contain approximately 27% cranberry based on a soluble solid (Brix) calculation. Concentrates vary in color (anthocyanin content) and juices are blended/formulated to specific color hues. During the 1990s SDC (e.g., Craisins®) became a most popular product, which changed the industry requirements in terms of fruit quality. A recent study surveyed the cranberry industry in Wisconsin, New Jersey, and British Columbia (Canada) as to the cranberry trait needs in terms of fruit quality, disease resistance, arthropod pest resistance, plant stress tolerance, and other plant traits (Gallardo et al. 2018). The study aimed to prioritize cranberry traits for enhancement in new cultivars

290

NICHOLI VORSA AND JUAN ZALAPA

based on the needs of growers, handlers, processors, and other stakeholders. Overall, 53% of the respondents identified fruit quality as the most important trait cluster to improve in future cranberry cultivars. The study revealed that fruit characteristics of importance were fruit firmness, size, and anthocyanin content, as well as resistance to fruit rot. In particular, fruit firmness has recently emerged as a trait of importance due to SDC processing. Other fruit quality traits such as anthocyanin content, fruit size, shelf life, flavor, and sweetness were also indicated. In Wisconsin and British Columbia, fruit size was another important trait, and resistance to fruit rot was important in New J­ ersey. In both New Jersey and Wisconsin, the anthocyanin content was more important than the other fruit quality traits. Overall, the results of the survey indicate that genetic improvement is needed in fruit quality characteristics such as firmness, fruit size, anthocyanin content, and resistance to fruit rot, to increase the production of high‐value SDC products, which are critical for the economic viability of the cranberry industry (Gallardo et al. 2018). A.  Disease Resistance Diseases of cranberry include false‐blossom caused by a phytoplasma, fruit rot caused by a complex of fungal pathogens, root rot caused by Phytophthora spp., and viruses, e.g., tobacco streak virus, blueberry shock virus, and red ring spot virus. False‐blossom, if not controlled, is a devastating disease, and is re‐emerging as a threat with reduced organophosphate insect management strategies. From field observations, Stevens (1931) identified varieties as to their ‘susceptibility’ to false‐blossom. Varieties considered highly susceptible to false‐blossom were ‘Howes’, ‘Centennial’, ‘Searles’, and ‘Wales’, while “having some resistance” were ‘Henry’, ‘Berlin’, ‘Metallic Bell’, ‘Palmeter’, ‘Prolific’, ‘Bennett’, and ‘Pride’. ‘Early Black’ was considered to have a “fair degree of resistance under varied field conditions,” while ‘McFarlin’ showed “marked resistance under varied field conditions.” Varietal resistance to false‐blossom was considered to be based on the degree of “susceptibility to leafhopper feeding” (Chandler et  al. 1947) (see Section B, Insect Resistance). Fruit rot pressures are increasing with the warming climate, especially in eastern United States and Wisconsin. Cranberry fruit rot is caused by a complex of fungi from at least 12 genera (Oudemans et al. 1998). The disease complex consists of 10 to 15 fungal species, varying by year and location (Stiles and Oudemans 1999). Fruit rot infection

Domestication, Genetics, and Genomics

291

begins either at early bloom, late bloom, or harvest, depending upon the fungal species. The major fruit rot fungi include Physalospora vaccinii (Shear) Arx and E. Muller, Colletotrichum gloeosporioides (Penz.) Penz. & Sacc. in Penz, teleomorph Glomerella cingulata (Stoneman) Spaulding and H. Schrenk, Phyllosticta vaccinii Earle, Coleophoma empetri (Rostr.) Petr., and Phomopsis vaccinii Shear in Shear, N. Stevens, and H. Bain (Oudemans et  al. 1998; Stiles and Oudemans 1999). Cranberry fruit rot is divided into two classes: field rot and storage rot. Economically, field rot is more significant since most of North American production is aimed at the processing market. In fact, field fruit rot poses perhaps the greatest economic threat to United States cranberry growers today. Oudemans et  al. (1998) state that “Cranberry fruit rot remains one of the most serious yield‐limiting diseases affecting cranberry production in the east” and losses to fruit rot currently range from of $185 to $10,950 per ha. Until the 21st century, Wisconsin was not considered to be exposed to a serious threat from the cranberry fruit‐rot complex pathogens. However, in 1998, McManus (1998) reported the first confirmed incidence of early rot Phyllosticta vaccinii Earle in Wisconsin. Demoranville et al. (2001) listed the varieties of ‘Black Veil’, ‘Howes’, ‘Matthews’, ‘Shaw’s Success’, ‘Stevens’, and ‘Wilcox’ as having “proven resistance” to fruit rot. A variety ‘Bugle’ and ‘Stankavich’ have been identified as having resistance (Caruso personal communication). In a screening (with reduced fungicide applications) of germplasm in New Jersey, ‘Budd’s Blues’, ‘Holliston’, ‘Cumberland’ and a germplasm accession, US89‐3, were identified as having resistance (Johnson‐Cicalese et al. 2015). Root rot of cranberries is caused by several Phytophthora spp., such as Phytophthora cinnamomi and P. megasperma and other spp. such as P. dreschleri (Jeffers 1988; Caruso and Wilcox 1990; Caruso and Ramsdell 1995). The primary pathogen is P. cinnamomi and is found in the northeast cranberry growing regions, including Massachusetts and New Jersey, where it can cause significant crop losses (Caruso and Ramsdell 1995). Other species of Phytophthora have been associated with a cranberry decline syndrome in Wisconsin (Jeffers 1988). Oudemans (1999) found both P. cinnamomi and P. megasperma species to be associated with root rot in New Jersey. Polashock et al. (2005) r­ eported that P. maegasperma causes both root and “runner” (stolon) rot. Carusso (1989) reported the varieties ’Stevens’, ’Franklin’, and ’Bergman’ to have some resistance to root rot. The variety, #35, from the 1930s USDA breeding program appears to have resistance to root rot (Oudemans personal communication).

292

NICHOLI VORSA AND JUAN ZALAPA

B.  Insect Resistance A recent study examined the effect of nutrition and six varieties as to cranberry’s resistance to two native lepidopteran pests to cranberry spotted fireworm (Choristoneura parallela) and Sparganothis fruitworm (Sparganothis sulfureana), and the invasive pest gypsy moth (Lymantria dispar). Varietal differences were not found for the two native pests, but were detected for the gypsy moth. All varieties exhibited decreased resistance with increased nitrogen nutrition (Rodriguez‐Saona et al. 2011). As mentioned, Stevens (1931) reported varietal resistance to false‐ blossom for which there may be a component of differences in blunt‐ nosed feeding preference. Chandler et al. (1947) subjected seedlings to a “susceptibility to leafhopper feeding” ratings test, with existing cultivars for comparison. ‘Shaw’s Success’ (9.5 rating) was considered the least susceptible cultivar and ‘Howes’ (17 rating) the most susceptible. The selections ranged in false‐blossom susceptibility from a rating of 8.7 to 15. Of the 84 seedlings tested, 74% were not significantly more attractive to the bluntnose leafhopper than are ‘Early Black’ and ‘McFarlin’, while one‐third were significantly less attractive. C.  Fruit Yield As in most crops, fruit yield in cranberry is a quantitative trait, and yield has been increased through breeding and in several selection cycles. Being a fruit crop, cranberry requires fertilization of ovules to stimulate ovary development, fruit development, and maturation. For many of the standard varieties, although self‐pollinated flowers had slightly reduced developed seed set, sufficient seed set is achieved with self‐pollination, so cross‐pollination appears not to be a requirement (Sarracino and Vorsa 1991). One component of the observed yield increases in cranberry is an increase in fruit size. In cranberry, fruit size is influenced by temperatures during fruit development ­(DeMoranville et al. 1996). Varieties appear to have different threshold temperatures for fruit sizing. The cultivar ‘Crimson Queen’ may have a lower threshold temperature required for fruit sizing (Vorsa unpublished data). Fruit yield is typically measured as the weight of berries per ft2 (9.3 dm2). Yield is a function of vegetative biomass of vertical shoots (uprights), particularly fruiting upright density, flower number/ upright, berries set per upright, and berry size (eight). Berry size and weight, although highly correlated, are not the same measure. The fruit of some varieties appear “denser,” heavier, as measured by “specific gravity” (Chandler et al. 1947). However, yield differences among most

Domestication, Genetics, and Genomics

293

varieties derived from breeding programs, the largest component in yield variation among varieties results from differences in fruit density (berries/ ft2), and to a lesser extent fruit size. It should be noted, however, that fruit size differences between cross‐bred varieties, e.g., ‘Mullica Queen’ and ‘HyRed’, versus early native varieties, e.g., ‘Early Black’, contributes substantially to yield differences. Genetic variation is apparent for numerous traits contributing to fruit density. Canopy architecture, which includes density of uprights and proportion of uprights with inflorescence buds that are initiated/set in late summer or fall of the previous fruiting year, has a genetic component. The number of fruit set per upright, or, more specifically, the fruit weight per upright, is a trait that can be considered as a yield component having a genetic effect. D. Flavonoids Cranberry flavonoids have received considerable attention due to their association with benefits to human health. The principal flavonoid classes in cranberry are anthocyanins, proanthocyanidins, and flavonols. Because color is a quality parameter in many cranberry products, the industry typically measures, spectrophotometrically, total anthocyanins in fruit in milligrams of anthocyanins/100g of fresh weight. The flavonoids are principally located in the fruit epidermis in cranberry (Vorsa unpublished data) and are similar to how anthocyanin content is quantified; flavonols are also typically measured on whole berry samples, where epidermis and flesh are not analyzed separately. Thus, quantification of flavonol and proanthocyanidin content of cranberry fruit is based on a per whole fruit fresh weight basis, and are not based on concentration of specific tissue, e.g., epidermis versus flesh. It would be expected that an epidermis to flesh ratio would be reduced in larger fruited varieties, resulting in smaller fruited varieties generally having a higher flavonoid content. In fact, berry size, typically measured as fruit weight, is generally negatively correlated with anthocyanin content in germplasm. Thus, with berry weight as a covariate, there is evidence that genetic variation exists for flavonoid content in the epidermis in cranberry germplasm. E. Anthocyanins Fruit color and the color of cranberry products, e.g., sauces, juices, and sweeten‐dried cranberry (SDC), being a parameter of quality, have received considerable attention and study. The principal aglycones, anthocyanidins, in cranberry are cyanidin and peonidin, which are conjugated

294

NICHOLI VORSA AND JUAN ZALAPA

Table 8.2.  Variation of fruit anthocyanin profiles of selected cranberry cultivars representing ranges of the six principal anthocyanins in cranberry, cyanidin‐3‐galactoside (Cy‐3‐gal), cyanidin‐3‐gucoside (Cy‐3‐glc), cyanidin‐3‐arabinoside (Cy‐3‐arab), peonidin‐3‐galactoside (Pn‐3‐gal), peonidin‐3‐glucoside (Pn‐3‐glc), and peonidin‐3‐arabinoside (Pn‐3‐arab). Means (across two years) of proportions of the six anthocyanins and absolute total anthocyanins for selected cranberry germplasm accessions and cultivars (Vorsa et al. 2003). Variety

Anthocyanin (%)

Total anthocyanins ­(g/g fruit)

Cy‐3‐gal Cy‐3‐glc Cy‐3‐arab Pn‐3‐gal Pn‐3‐glc Pn‐3‐arab Common cultivars ‘Stevens’ 33.3 1.4 ‘Franklin’ 32.7 1.5 ‘Early 39.9 1.9 Black’ ‘Ben Lear’ 31.9 1.8 Germplasm accessions US89‐7 52.1 3.7 US93‐246 20.5 0.8 US92‐27 27.5 1.2 US93‐223 32.9 2.1 US89‐10 27.4 0.7 US88‐78 34.3 1.7 US92‐11 34.4 1.6 SE* 1.2 0.2

14.8 13.8 16.0

35.9 37.6 30.9

3.4 4.1 3.4

11.0 10.3 8.0

352 736 665

13.0

38.0

4.8

10.6

555

20.7 9.4 12.6 11.2 17.1 12.5 20.0 0.6

16.2 49.1 41.8 38.7 38.1 40.3 29.5 1.4

2.8 4.8 4.5 5.7 2.0 4.3 3.3 0.2

4.6 15.2 12.1 9.6 14.7 8.9 11.1 0.5

328 257 921 527 253 422 558 109

*Standard error.

to the monosaccharides, galactose and arabinose, and to a lesser extent glucose. The anthocyanins in cranberry are cyanidin‐3‐O‐galactoside, cyandin‐3‐O‐arabinoside, cyanidin‐3‐O‐glucoside, peonidin‐3‐O‐galactoside, peonidin‐3‐O‐arabinoside, and peonidin‐3‐O‐glucoside. Variation exists in the germplasm for anthocyanin profiles (Vorsa et al. 2003). There is variation for both proportions of the aglycones, cyanidin versus peonidin, and the sugar conjugates, galactose, arabinose, and glucose. Cyanidin ranged from 70 to 78% (peonidin 22‐30%) (Table  8.2). The proportion of peonidin increases with fruit maturity (Table 8.3). F. Proanthocyanidins Proanthocyanidins (PACs) are oligomeric and polymeric flavan‐3‐ols, which are flavonoid derivatives of the shikimic acid pathway. PACs have been reported to have antioxidant and anti‐inflammatory activities, which may ameliorate degenerative diseases, have anticancer properties (Singh et  al. 2009, 2012; Wang et  al. 2015), exhibit high

Domestication, Genetics, and Genomics

295

Table 8.3.  ANOVA (Type III sums of squares) for principal components PC1, 2, and 3 from principal component analysis of the six principal anthocyanins (cyanidin and peonidin galactosides, glucosides, and arabinosides) in cranberry from nine v ­ arieties as determined by sequenced characterized amplified region (SCAR) fingerprints established in two cranberry beds (Vorsa et al. 2003). Source

DF

Bed Variety Bed*Variety Harvest Date (HD) Bed*HD Variety*HD Error

1 8 6 1 1 8 32

Mean square PC1

PC2

PC3

14.9*** 9.3*** 1.3 18.3*** 1.5 3.2 1.3

35.9*** 5.7*** 0.4 0.7 0.3 0.2 0.3

4.0*** 0.1*** 0 38.7*** 0 0 0.01

***Significant at the P < 0.001 level.

bioactivities against pathogenic oral biofilms (Duarte et al. 2006; Koo et al. 2010; Feng et al. 2013), and improve cardiovascular health (Bagchi et al. 2000; Li et al. 2001; Cunningham et al. 2003; Rasmussen et al. 2005). Epicatechin is the principal flavan‐3‐ol unit present in cranberry PAC oligomers and polymers. The most common linkage between two linked flavan‐3‐ol units is a single C–C bond (B type) between the C4 of one upper flavan‐3‐ol unit and the C8 or C6 of the second lower unit PAC oligomers of a specific degree‐of polymerization (DP), e.g., DP‐4 and 9. In cranberry PACs, in addition to the C–C linkage, there is also an ether linkage between the C2 of the upper unit and the oxygen at C7 or C5 of the lower unit forming a double linkage, referred to as an A‐type, between two subunits of the polymer. PACs of higher molecular weights, DP > 4, have been identified and isolated from cranberry. PACs exhibit quantitative variation among cultivars. The cultivar ‘Howes’ and its lineage, e.g., #35, ‘Demoranville’, and ‘Mullica Queen’, exhibit higher PAC content than ‘Ben Lear’ and ‘Crimson Queen’, a ‘Ben Lear’ progeny (Carpenter et al. 2014; Wang et al. 2017). Among a set of crosses, narrow sense heritability was apparent (Vorsa and Johnson‐Cicalese 2012). During latter stages of fruit maturity, there generally appears to be an increase of PAC levels in fruit (Vvedenskaya and Vorsa 2004; Wang et al. 2017). G. Flavonols Cranberry flavonols are mainly found as monomeric glycosides con­ jugated to a number of different sugar moieties (Häkkinen and Auriola 1998). Flavonol glycosides that are routinely identified in cranberry are

296

NICHOLI VORSA AND JUAN ZALAPA

quercetin‐3‐galactoside (Q‐3‐Gal), quercetin‐3‐glucoside (Q‐3‐Glu), quercetin‐3‐xylopyranoside (Q‐3‐X), quercetin‐3‐arabinopyranoside (Q‐3‐A‐P), quercetin‐arabinofuranoside (Q‐3‐A‐F), and quercetin‐3‐rhamnopyranoside (Q‐3‐R). The flavonol glycosides Q‐3‐gal and M‐3‐gal are the most abundant flavonol glycosides in eight common cranberry cultivars (Wang et al. 2017). Among the eight cultivars, ‘Stevens’ exhibited significantly higher concentrations of Q‐3‐R and Q‐3‐A‐P, whereas ‘Howes’ exhibited significantly higher levels of myricetin glycosides than quercetin glycosides. ‘Demoranville’ exhibited the lowest concentrations of Q‐3‐R and Q‐3‐A‐P across most of fruit development. Wang et al. (2017) reported that genetic background influences flavonol profiles among cranberry cultivars. Most of the flavonol glycosides did not show concentration patterns which could be related to cranberry fruit development and ripening. Levels of Q‐3‐A‐F and Q‐3‐Glu, however, did exhibit a significant correlation with date in most cultivars, which suggests a temporal regulation of their biosynthetic pathways in cranberry. Overall flavonol levels among eight cultivars indicated that cultivar differences only account for a relatively low percentage of total flavonol variation and that environmental factors contribute to observed variations. A principal component analysis (PCA) indicated a varietal effect for flavonol‐glycoside profiles, with negative eigenvectors for M‐3‐Gal, M‐3‐A, and Q‐3‐Glu and positive eigenvectors for Q‐3‐Gal, Q‐3‐X, and Q‐3‐A‐F. PC2 scores of different ­cultivars suggest varietal variation exists for specific flavonols. ­‘Howes’ exhibited low, negative PC2 scores as reflected in having the highest levels of M‐3‐Gal, M‐3‐A, and Q‐3‐Glu and lowest levels of Q‐3‐X and QA‐F among eight cultivars. In contrast, ‘Ben Lear’ showed high, positive PC2 scores, consistent with the observation that ‘Ben Lear’ had low levels of M‐3‐Gal, M‐3‐A, and Q‐3‐Glu and higher levels of Q‐3‐Gal, Q‐3‐X, and Q‐3‐A‐F among eight cultivars. H.  Hydroxycinnamic Acids Phenolic acids are a class of compounds commonly present in plant species and are relatively abundant in the Vaccinium species of the Ericaceae family. Phenolic acids vary in the different organs of the plant, e.g., seeds, stem, leaf, fruit epidermis, and fruit flesh. Chlorogenic acids are a family of esters formed between quinic acid and certain trans cinnamic acids such as caffeic acid, ferulic, p‐coumaric acid and their dimers. Chlorogenic acids absorbed in humans through dietary digestion, and have been reported to possess anti‐oxidant, anti‐ inflammatory, and anti‐hypertensive activities with important implications for human health (Pappas and Schaich 2009). In cranberry fruit,

Domestication, Genetics, and Genomics

297

the hydroxycinnamic acids are largely found in the exocarp (epidermis) at concentrations less than 0.1%. The major phenolic acids in cranberry are: 3‐caffeoylquinic acid and 5‐caffeoylquinic acid. Minor phenolic acids include protocatechuic acid, p‐coumaric acid‐O‐glucoside, p‐coumaroylquinic acid, dicaffeoylquinic acid, caffeic acid‐O‐glucoside, 4‐caffeoylquinic acid, 3‐acetyl‐4‐caffeoylquinic acid, and other caffeic acid conjugates. VI.  HERITABILITY OF TRAITS Studies designed specifically for estimating heritability of traits are limited in cranberry, due to lack of field space, longevity (minimum of 6 years from planting of trials to evaluate traits including yield), biennial bearing, and fruit rot resistance. Heritability estimates have largely been estimated from mid‐parent offspring regression from breeding populations of intercrosses among first breeding and selection generation parents, which have not been specifically designed for heritability estimates, and most are not based on exclusively monogamous crosses. Fruit yield, berry size (weight), berry density (berries/ft2), percent fruit rot, total fruit anthocyanin content (mg/100 g of fresh fruit), and proanthocyanidin content were all found to have moderate to high heritability (Vorsa and Johnson‐Ciacalese, 2012). In a more recent study of fruit rot, high heritability estimates (h2 = 0.81) were obtained with mid‐parent–­ offspring regression of mean fruit rot ratings, indicating additive genetic variance for fruit rot resistance (Johnson‐Cicalese et al. 2015). VII.  MOLECULAR MARKERS Molecular genetics and genomics research have been sparse in American cranberry until very recently. Bruederle et al. (1996) first used 23 putative isozyme Mendelian loci, of which 12 were polymorphic, to study the genetic diversity of wild cranberry populations. DNA markers such as random amplified polymorphic DNA (RAPD) (Novy et  al. 1994; Novy and Vorsa 1996; Stewart and Excoffier 1996; Debnath 2005, 2007) and sequenced characterized amplified regions (SCAR) (Polashock and Vorsa 2002) were later also used to study diversity in natural cranberry populations and for cultivar genetic identification. More recently, blueberry simple sequence repeat (SSR) markers were cross‐amplified in cranberry and used to characterize cultivars (Rowland et  al. 2003, 2010; Boches et al. 2005, 2006; Bassil et al. 2009). Despite these examples, large‐scale development of markers for linkage map development

298

NICHOLI VORSA AND JUAN ZALAPA

and quantitative trait loci (QTL) mapping in cranberry remained unattainable in cranberry and was not attempted until 2012 with the advent of next‐generation sequencing (NGS). A.  Initial Next‐Generation Sequencing for Marker Development At the end of 2011, the number of DNA, RNA, or protein sequences available for Vaccinium spp. at the National Center for Biotechnology (NCBI) database was only 5,968, and for cranberry only 21 DNA, 10 protein, and six organelle DNA sequences were available at the time (Zalapa et al. 2012). Recently, the application of NGS technologies such as pyrosequencing (454 sequencing), sequencing by oligonucleotide ligation and detection (SOLiD), and Illumina dye sequencing (Illumina) have massively increased the availability of sequence data and molecular markers in cranberry. Initially, cranberry large‐scale sequencing studies based on NGS technologies were conducted at New Jersey (Georgi et al. 2012, 2013) and Wisconsin (Zhu et al. 2012; Zalapa et al. 2012), and resulted in datasets containing millions of DNA and RNA sequences. Georgi et al. (2012) used SOLiD nuclear sequence reads to assemble 441,159 contigs for a total length of 566.7 Mbp (of 470 Mbp estimated genome size) (Zdepski et al. 2011). Zhu et al. (2012) assembled 454 nuclear reads into 188,792 contigs, covering an estimated 72.3 Mbp. Georgi et al. (2013) used Illumina to produce an additional 6.3 Gbp of cranberry transcript sequence data and 8.4 Gbp of Illumina nuclear sequence. The nuclear data was further assembled into 231,033 contigs totaling 420Mbp. Zalapa et al. (2012) attempted the first assemblies of organellar genomes using 454 data. Forty cranberry plastid and 73 mitochondrial contigs (spanning a total length of 137,475 bp and 467,972 bp, respectively) were assembled. Using these initial cranberry sequence databases, both cranberry research groups conducted scans and identified thousands of SSR loci that allowed for the first time the fast and cost‐effective development of SSR markers in cranberry (Georgi et al. 2012, 2013; Zalapa et al. 2012; Zhu et al. 2012) (Table 8.4). B.  SSR Marker Development Zhu et  al. (2012) discovered 107,244 SSR loci using 620 Mbp of 454 shotgun sequence data (‘HyRed’ cultivar) (Table 8.4). Contig sequence data were examined and used to select and design 96 SSR primer‐pairs that resulted in 48 polymorphic SSR loci (50%). Additionally, clustering of 25 cranberry genotypes by principal coordinates and genetic structure analyses confirmed the usefulness of the 48 SSR loci to

Domestication, Genetics, and Genomics

299

Table 8.4.  Number of microsatellite markers developed in cranberry using next‐ generation sequencing data. Source

Number of developed primer‐sets

Number of polymorphic markers

Sequence

Zhu et al. 2012 Georgi et al. 2012 Georgi et al. 2013 Schlautman et al. 2015a Schlautman et al. 2017a

96 48 78 979

48 21 78 697

Nuclear Nuclear Nuclear and transcriptome Nuclear and transcriptome

54

0

Organelle

differentiate cranberry cultivars and for parentage analysis. Based on their SOLiD data, Georgi et al. (2012) designed 48 SSR primer‐pairs and reported 21 polymorphic markers segregating in fruit rot resistance segregating cross‐progeny. Similarly, based on their Illumina improved assembly, Georgi et al. (2013) developed 11 nuclear SSRs, 29 SSRs near putative defense‐related genes, 6 SSRs near putative ­flavonoid‐biosynthetic pathway enzymes and transcription factors, and 32 SSRs near putative conserved orthologous set (COS) genes. Although no markers were developed, a combined effort among cranberry researchers identified a total of 159,394 perfect SSRs of which 150,628 and 8,766 SSRs corresponded to 86,884 assembled genome scaffolds and 7,772 unigene sequences, respectively (Polashock et al. 2014). In a continued joint effort, the cranberry research community c­ onducted the largest development of SSR markers to date (Schlautman et al. 2015a) to identify, test, and validate microsatellite markers from the abundant available nuclear and transcriptome sequencing data. A total of 7,557 high‐quality nuclear SSR loci from the Fajardo et al. (2014) a­ ssembly were identified and tested together with the 7,772 SSR in unigenes from Polashock et al. (2014). In total, 979 new SSR loci primers were designed, synthesized, and tested (Schlautman et  al. 2015a). Out of those primers, 697 of the markers amplified allele patterns consistent with a single locus and diploid segregation and were considered polymorphic. Although no polymorphisms were detected in a set of diverse cranberry accessions, 30 chloroplast, 23 mitochondrial, and 1 mitochondrion‐like SSRs were identified based on cranberry organellar sequence data (Fajardo et al. 2013, 2014; Schlautman et al. 2017a). Nuclear SSR multiplexing panels were developed using four different fluorophores, including 16‐multiplexing panels containing 61 genic evenly distributed SSR markers, with non‐overlapping allele ranges,

300

NICHOLI VORSA AND JUAN ZALAPA

throughout 12 cranberry linkage groups (Schlautman et  al. 2017b). Additionally, two multiplexing panels were developed, which amplified 24 organellar SSRs, to discriminate Vaccinium species (Schlautman et al. 2017a). C.  SSR Genetic Diversity Studies Twelve of the 48 cranberry SSR markers developed from Zhu et  al. (2012) with the most genetic information content were used for cultivar fingerprinting and differentiation in Fajardo et  al. (2012) (Table  8.5). This work provided a reliable DNA fingerprinting method in cranberry to allow the preservation of pure genetics stocks since the species is a long‐lived perennial crop grown commercially from cultivars clonally preserved and vegetatively propagated materials. The study demonstrated that a small set of 12 informative SSR markers allows purity testing of vegetative materials before planting and testing of aging plantings to maintain genetic uniformity. Additionally, the study determined the most probable genotypes of several major cranberry cultivars in production, including ‘Stevens’, based on a consensus of clonal genotypes, pedigrees, and paternity analysis. Cranberry represents one of the few agriculturally important American native plants in which a wild primary gene pool is still readily available within the undisturbed wetlands of the northern U.S. and southern Canada. Thus, the 12 fingerprinting SSR markers from Fajardo et  al. (2012) (Table  8.5) were also used to characterize the genetic diversity of wild cranberries to find new accessions and populations that may harbor high genetic diversity (Zalapa et al. 2014). The study found high clonal diversity in several populations (Ho = 0.40 to 0.84) of cranberry in Wisconsin and provided a set of eight SSR markers to study the diversity in 4 × V. oxycoccos. In contrast, cranberry native populations were found to exhibit extremely low levels (Ht = 0.048) of genetic variation using 12 polymorphic isozyme loci, with the majority of all genetic variation due to differences among individuals within populations (Bruederle et  al. 1996). However, both the Zalapa et  al. (2014) and Bruederle et  al. (1996) studies generally found that most native populations were in Hardy‐Weinberg expectations for panmixis based on molecular markers. Additionally, SSR markers showed that some wild populations harbor rich pockets of diversity while others are completely clonal. Since most natural populations have likely remained relatively undisturbed by humans due to their inaccessible locations in wetland ecosystems, differences in wild cranberry population diversity may be due to natural local conditions (e.g., fertility, temperature,

Table 8.5.  Transferability of SSRs used in fingerprinting and diversity studies in Vaccinium macrocarpon (Vm) and 4 × V. oxycoccos (Vo). Marker name

Forward sequence

Reverse sequence

Vm Vo

vm04084 vm25796 vm26877 vm28527 vm31701 vm38401 vm39030 vm40600 vm51985 vm52682 vm55441 vm78806

CACGACGTTGTAAAACGACGGATTCTCACTCTGATACCATT CACGACGTTGTAAAACGACCACTTACCTGAATCCTCTTAGC CACGACGTTGTAAAACGACCCCCTTTTGAACGAAACTATAC CACGACGTTGTAAAACGACGGACAAGTGAAATGCTAGTTG CACGACGTTGTAAAACGACGTCACTGGTAATGCTATTCTGA CACGACGTTGTAAAACGACCAATGGGAAGTACAAAGAGC CACGACGTTGTAAAACGACCTGATTACTGAGTCTACTAACACCA CACGACGTTGTAAAACGACCAAAAGAGCCATGAAATAGG CACGACGTTGTAAAACGACTGCTAGTATTTTGACTCAGGTG CACGACGTTGTAAAACGACCTCAGGTTATCAGGCTTATTTC CACGACGTTGTAAAACGACAAAAGGAACACGGATACGAT CACGACGTTGTAAAACGACCAAAGAAGAGGAGGATTGAGT

GTTTCTTGAACGATACACAACGAAGGT GTTTCTTTAGAGGAGCCAAACTGATAACT GTTTCTTACATCTCAATTCCGAGCATA GTTTCTTAGATTGTTCGTAGGTAGAAGTG GTTTCTTCTTCTTTGTTTCATCTCCCTAC GTTTCTTCGATGCAATCTTAGTCTTGA GTTTCTTACAGATTTGTAGTCACGAAGTG GTTTCTTTTGGTGAAAACTATACCTGTCC GTTTCTTGCCTATATATAACCAAGCAAGG GTTTCTTCAATTAGTGTGTTCCCAACTC GTTTCTTGGATTCGAGAACCTATCTCAT GTTTCTTGAGCGAGTATTACAAGTGTTTC

+ + + + + + + + + + + +

0004416675.indd 301

+ + – + + + – + – + – +

8/31/2019 1:05:23 PM

302

NICHOLI VORSA AND JUAN ZALAPA

water, etc.) or large natural events such as the Pleistocene glaciation, all of which may have created a reduction of genetic diversity or a genetic bottleneck in certain populations. For example, populations in the ­unglaciated portions of North America have been proposed to harbor high levels of genetic variation, which potentially may provide novel genetic variation for cranberry breeding programs (Bruederle et  al. 1996; Zalapa et al. 2014; Smith et al. 2015). VIII.  NUCLEAR AND ORGANELLAR GENOME ASSEMBLY Based on 454 data, the complete cranberry plastid genome was assembled and annotated with a length of 176,045 bp and a typical structure common in plants consisting of an large single copy (LSC) region of 104,544 bp, two inter‐repeat (IR) regions of 34,232 bp each, and a single small copy (SSC) region of 3,029 bp (Fajardo et al. 2013). The genome contained 110 genes, including 73 protein‐coding genes, 5 hypothetical coding regions, 28 transfer RNAs, and 4 ribosomal RNAs. The cranberry plastid contained 9 confirmed pseudogenes in the LSC and 7 pseudogenes in the SSC. Although the cranberry plastid genome was typical in terms of the position and size of the IR and LSC and SSC regions, more detailed analyses revealed numerous LSC region inversions and other rearrangements, which explained the high number of pseudogenes compared with other plant species. The structural rearrangements were found to be uncommon when compared to other plastid Asterid genomes available at the time; however, the plethora of NGS organellar data available today has now shown that plastid genomes are not as conserved as previously thought. The complete cranberry mitochondrial genome was assembled from 454 specimens and Illumina sequence data (Fajardo et al. 2014). The genome was 459,678 nt with a relatively low repetitive sequence content and DNA of plastid origin. A total of 33 genes were annotated, plus three ribosomal RNAs, and 17 transfer RNAs. Interestingly, the annotation of the cranberry of mitochondrial genome showed the presence of a tRNA‐SeC and traces of SECIS‐like protein, elements that are not commonly present in other plant organelle genomes. Finally, maternal organellar cranberry inheritance was inferred by analyzing gene variation in the cranberry mitochondria and plastid genomes. The current cranberry genomic assembly consists of 229,745 scaffolds representing 420 Mbp (N50 = 4,237 bp) with 20 × average coverage (Polashock et al. 2014). The number of predicted genes was 36,364 and represents 17.7% of the assembled genome. A total of 30,090 candidate

Domestication, Genetics, and Genomics

303

genes were assigned based on homology and 13,170 (36%) genes were supported by transcriptome data. IX.  LINKAGE MAPPING AND SNP MARKERS The first cranberry genetic map was a unified linkage map developed from 182 individuals from four different mapping populations (Georgi et al. 2013) (Table 8.6). The map consisted of 138 loci, including 129 SSRs and 9 SCARs, organized in 14 linkage groups, spanning 880 cM and an estimated genome coverage of 82.2%. The second cranberry linkage map was developed by Schlautman et  al. (2015b) using 221 individuals from population CNJ02‐1 (‘Mullica Queen’ × ‘Crimson Queen’). The map consisted on 541 SSR loci spanning 12 linkage groups and 1,178 cM. More recently, the application of genotyping by sequencing (GBS) approaches allowed for the first time the generation of large numbers of single nucleotide polymorphism (SNP) markers for cranberry genetic mapping (Covarrubias‐Pazaran et al. 2016). This first effort to develop an SNP map with GBS was based on 362 individuals derived from a cross between [BG × (BL × NL)]95 and GH1 × 35, and resulted in a map consisting of 4,849 markers, including 201 SSRs and 4,648 SNPs, and spanning 1,112 cM and 12 linkage groups. Subsequently, Daverdin et al. (2017) developed four GBS linkage maps based on families developed from fruit rot‐resistant germplasm. Although the population sizes were small for all four populations (98, 90, 43, and 39 individuals), one of the crosses [‘Budd’s Blues’ (BB) × ‘Crimson Queen’ (CQ)] recovered the expected 12 linkage groups for each parent with an average of 1,646 loci and spanning an average of 1,143 cM. Schlautman et al. (2017c) developed a composite cranberry map based on 547 individuals of three populations. The composite map contained a total of 6,073 loci, 636 SSRs, and 5437 SNPs in 12 linkage groups and spanning 1,124 cM. To allow comparative mapping with blueberry, Schlautman et al. (2018) used the CNJ02‐1 cranberry population (Schlautman et al. 2015a) to generate an updated linkage map containing 582 specimens, including 43 new SSR markers (17 from blueberry). The availability and testing cranberry SSRs in blueberry allowed comparative mapping and synteny and collinearity comparisons between the two species (Schlautman et al. 2018). A set of 323 cross‐transferable SSR markers was identified and used to construct a linkage map using an interspecific diploid blueberry population [(V. darrowii × V. corymbosum) × V. corymbosum]. The consensus blueberry map encompassed 12 linkage groups in 948 cM and contained 409 markers, including 175 cranberry

Table 8.6.  Cranberry linkage maps, population size (N), population designation, number of loci, number of simple sequence repeat (SSR), number of single nucleotide polymorphism (SNP), number of linkage groups (LGs), and length in centimorgans (cM). N

Population*

Number of loci

Number of SSRs

Number of SNPs

LGs

cM

Reference

182 221 362 587 90 90 221

Unified (4 populations) MQ × CQ [BG × (BL × NL)]95 and GH1 × 35 Composite (3 populations) BB parental (BB × CQ) CQ parental (BB × CQ) MQ × CQ

138 541 4,849 6,073 1,439 1,853 582

129 541 201 636 110 126 582

0 0 4,648 5,437 1,329 1,727 0

14 12 12 12 12 12 12

880 1,178 1,112 1,124 1,216 1,071 1,060

Georgi et al. 2013 Schlautman et al. 2015b Covarrubias‐Pazaran et al. 2016 Schlautman et al. 2017c Daverdin et al. 2017 Daverdin et al. 2017 Schlautman et al. 2018

*MQ = ‘Mullica Queen’, CQ = ‘Crimson Queen’, BG = ‘BG’, BL = ‘Ben Lear’, NL = ‘Norman LeMunyon’, GH1 = ‘GH1’, 35 = ‘#35’. Cultivars descriptions from Dana (1983), Eck (1990), and Table 8.1.

0004416675.indd 304

8/31/2019 1:05:24 PM

Domestication, Genetics, and Genomics

305

SSRs, 147 in common with the updated CNJ02‐1 SSR cranberry map. A  high synteny and collinearity was detected between the cranberry and blueberry maps, with approximately 93% of the blueberry linkage map being collinear with cranberry. This study suggested that Vaccinium species are more genetically similar than previously believed and highlights the importance of easy to use, transferrable, hyperinformative markers such as SSRs in addition to SNP markers to serve as a framework in Vaccinium reference maps to allow QTL and candidate genes to transfer across species. Two different linkage group (LG) nomenclatures have been used in cranberry linkage mapping studies by the Rutgers and Wisconsin research groups. Based on syntenic comparisons using SSR markers (Schlautman et al. 2015a), homologous LGs were found for all current cranberry linkage maps. The Schlautman et  al. (2015b) LG nomenclature used in all the Wisconsin studies (Covarrubias‐Pazaran et  al. 2017; Schlautman et al. 2017c, 2018; Diaz‐Garcia et al. 2018a, 2018b) is equivalent to the Rutgers (Georgi et al. 2013; Daverdin et al. 2017) nomenclature as follows: LG1 = V9, LG2 = V8, LG3 = V7, LG4 = V2, LG5 = V10, LG6 = V5, LG7 = V3, LG8 = V4, LG9 = V1, LG10 = V12, LG11 = V11, and LG12 = V6. X.  MARKER‐TRAIT ASSOCIATION STUDIES For the most part, cranberry breeding resulting in cultivar releases has taken upwards of 30 years (Table  8.1). This slow progress is mainly due to intricacies in the species’ growing habit (e.g., juvenility, perenniality, and clonality), unique culture requirements (e.g., acid bogs and water harvest), as well as limited field space. Therefore, cranberry breeding programs have traditionally required considerable field plot space, expensive and intensive management techniques, and phenotypic evaluation over long periods. Due to the high cost and effort and long time required for breeding, marker‐trait association studies could be very helpful for cranberry if the information could be used for selection and if breeding populations could be used for marker‐trait association studies. Few breeding populations exist that are suitable for both breeding and marker‐trait association studies (Table 8.6). Most linkage maps in cranberry have been developed using elite breeding and selection cycle populations used for breeding traits, including yield, fruit quality, and fruit rot resistance (Table  8.6). Based on these initial linkage studies, a summary of QTLs detected in cranberry is presented in Table  8.7. For example, despite using four relatively

Table 8.7.  Summary of multiple population supported QTLs detected in cranberry. Reference

LG1*

Georgi et al. 2013

LG2

LG3

FW Y

FR

Schlautman et al. 2015b

Daverdin et al. 2017

Diaz‐Garcia et al. 2018a

Diaz‐Garcia et al. 2018b

Number of traits with QTL per LG

LG4

LG5

Y

FR FW Y W A LW TACy TA Brix PAC FW DCV

FR FW Y EC

FR FW Y

TA PAC

9

6

TACy TA Brix PAC FW DC DCV 9

LG6

LG7

FW

TA

LG8

LG9

LG10

FR

FW Y FW Y

FR FW

FR Y

L

EC LW

EC LW

W A

TACy TA DC DVC

TA PAC

TACy PAC FW DC DCV

TACy Brix PAC FW

6

6

9

9

LG12

FR FW

Y

LG11

FR FW Y W

FW FR Y

TACy TA Brix PAC

PAC DCV

PAC FW DCV

4

6

5

Y FW BB FW FR Y A PC1 TACy TA Brix PAC FW DC DCV 12

FW FR Y LW PC1 TACy TA Brix PAC FW DCV 10

*LG = linkage groups. According to Schlautman et al. 2015b, Y = yield, FW = fruit weight, TA = titratable acidity, FW = fruit rot, BB = biennial bearing, W = fruit width, A = fruit area, LW = length/width ratio, EC = eccentricity, L = fruit length, PC1 = persistent homology‐based shape descriptor, TAcy = anthocyanin content, PAC = proanthocyanidin content, and Brix = sugar content, DG = digital color, and DCV = digital color variation.

0004416675.indd 306

8/31/2019 1:05:24 PM

Domestication, Genetics, and Genomics

307

small populations to create an unsaturated unified SSR map, the first cranberry marker‐trait association study mapped seven QTLs related to fruit rot resistance, yield, berry weight, and titratable acidity (Georgi et al. 2013). A second QTL study was conducted by Schlautman et al. (2015b) using an improved near‐saturated SSR map. The study detected four mean fruit weight QTL, three total yield QTL, and one biennial bearing QTL, which co‐localized with a total yield QTL. More recently, using four populations segregating for fruit rot and an SNP enhanced map, 60 QTL were detected across the four populations (Daverdin et al. 2017). A total of 19 QTL were found across all populations for fruit rot rating and percent rot. Similarly, 13 QTL were detected for fruit yield‐ related traits across the populations. For berry weight measurements, across the four populations studied, 14 QTL were detected. The growing consumer demand for sweeten‐dried cranberries (SDC) has increased the need for new high‐quality cranberry varieties that produce large, round, firm, and uniformly shaped and colored fruit. In crop breeding programs, massive phenotyping using multiple populations with numerous individuals is key for the efficient evaluation and selection of new cultivars. In cranberry, however, most breeding programs have traditionally used manual caliper measurements to gather data about basic cranberry fruit quality attributes, and sometimes use visual assessments to categorize complex phenotypes. The need for new approaches to massively acquire trait data for breeding and marker‐trait association studies led to the development of a software package, called GiNA, for image‐based horticultural trait data collection in cranberry, such as fruit shape, length, width, area, size, color, and color variation data (Diaz‐Garcia et al. 2016). This accurate and high‐throughput tool was recently used in a cranberry population to map genetic regions governing fruit shape and size to provide genetic information to breed cultivars for SDC production (Diaz‐Garcia et al. 2018a). The study characterized fruit from a mapping population consisting of 351 progeny (Table  8.6), and detected 252 QTLs in a 3‐year period for cranberry fruit size and shape descriptors (Table  8.7). In total, the study found 17 different QTL that collocated consistently in the three‐year study, including 4 QTL for fruit weight, 3 QTL each for width, area, eccentricity, and persistent homology (PC1; shape descriptor), and one QTL for length. In a second study, GiNA was used to characterize digital color (DC) and digital color (DCV) variation for QTL analysis (Diaz‐Garcia et al. 2018b). Additionally, the study mapped QTL for fruit weight and several chemical traits, including anthocyanin content (TAcy), titratable acidity (TA), proanthocyanidin (PAC) content, and sugar content (Brix) (Table 8.7). A total of 85 significant QTLs were detected across

308

NICHOLI VORSA AND JUAN ZALAPA

the genome for all traits. PAC had the largest number of QTL with 22, followed by TA with 18, mean fruit weight (MFW), TAcy with 16 each, and Brix with 13. For digital phenotyping traits, 26 QTLs were detected and, from these, 11 corresponded to color intensity and 15 to color variation. Overall 15 traits have been utilized for QTL mapping in cranberry (Table  8.7). As observed in Table  8.7, all 12 linkage groups (LGs) in cranberry have been found to contain QTLs for important traits. On average, of the 15 traits studied so far, each LG was found to contain QTL for ~7 of the traits with a range of 4–12. Notably, LG8 and LG10 possessed QTL for only four and five traits, respectively. LG11 and LG12 contained the largest number of traits with QTL represented in those linkage groups. LG11 was associated with the largest number of traits, with QTL in that linkage group with 12. In particular, LG11 was found to contain QTL for fruit size, fruit weight, and shape descriptors, as well as yield and biennial bearing. This fact is interesting since there is evidence that some of these traits are correlated (Schlautman et al. 2015b; Daverdin et al. 2017; Luis Diaz‐Garcia et al. 2018a, 2018b) and may be governed by the same genes (pleiotropy) or may be controlled by linked genes, in this case in LG11. Additionally, LG11 contained QTL for all chemical traits, including anthocyanin content and PAC, which were found to be correlated with the digital color measures and with each other (Diaz‐Garcia et al. 2018b). XI.  FUTURE PROSPECTS Improved management practices and the adoption of new cultivars have led to the increase of cranberry production in the last few decades. Past breeding efforts in cranberries have prioritized the genetic improvement of yield, vine vegetative vigor during the establishment years, fruit anthocyanin content, and fruit rot resistance (Gallardo et al. 2018; Vorsa and Johnson‐Cicalese, 2012). Moreover, many cultivars released after the 2000s provide increased and consistent production, and to some extent an earlier ripening season with higher anthocyanin content and less susceptibility to fruit rot. Thus, some of these cultivars have become popular among growers. However, the cranberry industry has shifted from primarily processing fruit for juice production to requiring high‐quality, high‐value fruit for SDC production. As such, the SDC product requires greater berry to berry uniformity in fruit traits, e.g., size and color. An issue with the most widely grown cultivar ‘Stevens’ is that a percentage of fruit does not develop anthocyanins, i.e., white berries, resulting in heterogeneously colored fruit.

Domestication, Genetics, and Genomics

309

Currently, there is an overproduction of cranberry juice, but not all of the cranberry production (20–30%) can be used for the SDCs (Gallardo et al. 2018). Therefore, a current need is to continue to focus on traits that affect fruit quality with an emphasis on fruit firmness, size, anthocyanin content, and fruit uniformity for SDC production. In addition, overly warm climate causing heat stress during fruit development and ripening season has become more common, exacerbating fruit rot pressure, particularly in the eastern growing regions and increasingly in Wisconsin, which impacts fruit quality parameters. Identification of germplasm offering desired traits for processing and adaptation to heat stress is needed with the objective of effectively pyramiding fruit quality, rot resistance, and production traits. Due to cranberry’s low sugar content and high acid content, another need of the industry is the balancing of cranberry acidity to make fruit more palatable and reduce the need high “added‐sugar.” Other production challenges include newly emerging disease and insect pressures due to loss of organophosphate insecticides. For example, false‐blossom disease has re‐emerged as a threat, and outbreaks of an insect referred to as the “toad‐bug” have occurred. Virus diseases including tobacco‐streak virus and blueberry shock virus have been recently encountered in commercial cranberry beds. In addition to a warmer climate, genetic and breeding research is needed to deal with increasingly unpredictable weather extremes, e.g., excessive rain or drought periods, and cold. Fortunately, recent advances in cranberry genomics have led to development of thousands of informative SSR and SNP markers ­(Table  8.4), several saturated linkage maps in different populations (Table 8.6), and multiple QTLs for different traits in different genetic backgrounds (Table 8.7). Also, the organellar cranberry genomes have been sequenced and two high‐quality nuclear cranberry genomes are nearly completed and will be published soon. In addition to advances in cranberry genotyping, cranberry accurate and high‐throughput phenotyping methods are also being developed such as GiNA, an image‐based horticultural trait data collection software capable of collecting fruit shape, length, width, area, size, color, and color variation data (Diaz‐ Garcia et al. 2016). The development of high‐throughput genotyping and phenotyping methods in cranberry will allow the continuation of QTL mapping and make it possible to conduct genome‐wide association (GWAS) studies for fruit quality and other traits of interest. Additionally, advances in molecular resources and phenotyping techniques in cranberry make the application marker‐assisted selection (MAS) increasingly feasible and cost‐effective. In the future, based on these resources, cranberry breeders and other allied scientists will develop

310

NICHOLI VORSA AND JUAN ZALAPA

MAS selection strategies targeting large effect and consistent QTL (e.g., fruit color/anthocyanin content and fruit size/weight; Table 8.7). Finally, other molecular selection approaches such as genomic selection (GS) applications will continue to be developed and applied to improve fruit quality and other traits of interest in cranberry (Covarrubias et al. 2018). Since the application of MAS in cranberry requires a significant initial investment, breeding efforts should focus on the most valuable traits for the industry, such as the trait priorities determined by Gallardo et al. 2018. ACKNOWLEDGMENTS Support for this work was provided in part by Ocean Spray Cranberries, Inc., Wisconsin Cranberry Growers Association, NJ Cranberry and Blueberry Research Council, and Cranberry Institute. Research findings presented were funded in part by Project No. 5090‐21220‐004‐00‐D, USDA‐SCRI under Grant 2008‐51180‐04878, and USDA‐NIFA‐AFRI Competitive Grant USDANIFA‐2013‐67013‐21107. JZ wishes to express his gratitude through 1 Cor. 10:31. LITERATURE CITED Bagchi, D., M. Bagchi, S.J. Stohs, et  al. 2000. Free radicals and grape seed proanthocyanidin extract: importance in human health and disease prevention. Toxicology 148:187−197. Bain, H.F. 1946. Blooming and fruiting habits of the cranberry in Wisconsin. Cranberries 10:11, 14. Bain, H.F., and H. Dermen. 1944. Sectorial polyploidy and phyllotaxy in the cranberry (Vaccinium macrocarpon Ait.). Am. J. Bot. 31:581. Bassil, N., A. Oda, and K.E. Hummer. 2009. Blueberry microsatellite markers identify cranberry cultivars. Acta Hortic. 810:181–186. Bergman, H.F. 1950. Cranberry flower and fruit production in Massachusetts. Cranberries 15:6–10. Boches, P.S., N.V. Bassil, and L.J. Rowland. 2005. Microsatellite markers for Vaccinium from EST and genomic libraries. Mol. Ecol. Notes 5:657–660. Boches, P.S., L.J. Rowland, K. Hummer, and N.V. Basil. 2006. Cross‐species amplification of SSRs in the genus Vaccinium. Acta Hort. 715:119–127. Bruederle, L.P., M.S. Hugan, J.M. Dignan, and N. Vorsa. 1996. Genetic variation in natural populations of the large cranberry, Vaccinium macrocarpon Ait. (Ericaceae). Bull. Torrey Bot. Club 123:41–47. Camp, W. 1945. The North American blueberries with notes on other groups of Vacciniaceae. Brittonia 5:203–275. Cane, J.H., D. Schiffhauer, and L.J. Kervin. 1996. Pollination, foraging, and nesting ecology of the leaf‐cutting bee Megachile (Delomegachile) addenda (Hymenoptera: Megachilidae) on cranberry beds. Ann. Entomol. Soc. Am. 89: 361–367.

Domestication, Genetics, and Genomics

311

Carpenter, J.L., F.L. Caruso, A. Tata, et al. 2014. Variation in proanthocyanidin content and composition among commonly grown North American cranberry cultivars (Vaccinium macrocarpon). J. Sci. Food Agric. 94:2738–2745. Caruso, F.L. 1989. Phytophthora root rot of the cultivated cranberry in Massachusetts (Vaccinium macrocarpon Ait.). Acta Hort. 241:307–311. Caruso, F.L., and W.F. Wilcox. 1990. Phytophthora cinnamomi as a cause of root rot and dieback of cranberry in Massachusetts. Plant Dis. 74:664–667. Caruso, F.L., and D.C. Ramsdell (eds.). 1995. Compendium of blueberry and cranberry diseases. APS Press, St. Paul, MN. 87 p. Chandler, F., and I. Demoranville. 1958. Cranberry varieties of North America, Bulletin 5. Mass. Ag. Exp. Stat. Bull. Chandler, F., R. Wilcox, H. Bain, et al. 1947. Cranberry breeding investigations of the U.S. Dept. of Agriculture. Cranberries 12:6–9. Costich, D.E., R. Ortiz, T.R. Meagher, et al. 1993. Determination of ploidy level and nuclear DNA content in blueberry by flow cytometry. Theor. Appl. Genet. 86:1001–1006. Covarrubias‐Pazaran, G., L. Diaz‐Garcia, B. Schlautman, et  al. 2016. Exploiting genotyping by sequencing to characterize the genomic structure of the American cranberry through high‐density linkage mapping. BMC Genomics 17:451. Covarrubias‐Pazaran, G., B. Schlautman, L. Diaz‐Garcia, et  al. 2018. Multivariate GBLUP improves accuracy of genomic selection for yield and fruit weight in biparental populations of Vaccinium macrocarpon Ait. Front Plant Sci. 9:1310. doi: 10.3389/ fpls.2018.01310. Cunningham, D.G., S.A. Vannozzi, R. Turk, et al. 2003. Cranberry phytochemicals and their health benefits. In F. Shahidi and D.K. Weerasinghe (eds.), Nutraceutical beverages: Chemistry, nutrition, and health effects. ACS Symposium Series 871, ACS, Washington, DC. p. 35−51. Dana, M.N. 1983. Cranberry cultivar list. Fruit Var. J. 37:88–95. Daverdin, G., J. Johnson‐Cicalese, J.E. Zalapa, et al. 2017. Mapping and identification of fruit rot resistance QTL in American in American cranberry using GBS. Mol Breed. 37:38. Debnath, S.C. 2005. Differentiation of Vaccinium cultivars and wild clones using RAPD markers. J. Plant Biochem. Biotech. 14:173–177. Debnath, S.C. 2007. An assessment of the genetic diversity within a collection of wild cranberry (Vaccinium macrocarpon Ait.) clones with RAPD‐PCR. Gen. Res. Crop Evol. 54:509–517. DeMoranville, C.J., J.R. Davenport, K. Patten, et al. 1996. Fruit mass development in three cranberry cultivars and five production regions. J. Am. Soc. Hort. Sci. 121:680–685. DeMoranville, C.J., H.A. Sandler, and F.L. Caruso. 2001. Planting new cranberry beds: Recommendations and management. University of Massachusetts, Cranberry Experiment Station. (http://www.umass.edu/cranberry/downloads/Planting%20New% 20Cranberry%20Beds.pdf). Dermen, H., and H.F. Bain. 1941. Periclinal and total polyploidy in cranberries induced by colchicine. Proc. Am. Soc. Hort. Sci. 38:400. Dermen, H., and H.F. Bain. 1944. A general cytohistological study of colchicine polyploidy in cranberry. Am. J. Bot. 31:451–463. Diaz‐Garcia L., G. Covarrubias‐Pazaran, B. Schlautman, and J. Zalapa. 2016. GiNA, an efficient and high‐throughput software for horticultural phenotyping. PLoS One 11(8):e0160439 (1–12). Diaz‐Garcia, L., G. Covarrubias‐Pazaran, B. Schlautman, et al. 2018a. Image‐based phenotyping for identification of QTL determining fruit shape and size in American cranberry (Vaccinium macrocarpon L.). Peer J. 6:e5461. doi: 10.7717/peerj.5461.

312

NICHOLI VORSA AND JUAN ZALAPA

Diaz‐Garcia, L., B. Schlautman, G. Covarrubias‐Pazaran, et  al. 2018b. Massive phenotyping of multiple cranberry populations reveals novel QTLs for fruit anthocyanin content and other important chemical traits. Mol. Genet. Genomics 293(6):1379–1392. doi: org/10.1007/s00438‐018‐1464‐z. Duarte, S., S. Gregoire, A.P. Singh, et al. 2006. Inhibitory effects of cranberry polyphenols on formation and acidogenicity of Streptococcus mutans biofilms. FEMS Microbiol Lett. 257:50−56. Eck, P. 1990. The American cranberry. Rutgers University Press, New Brunswick, NJ. Fajardo, D., J. Morales, H. Zhu, et al. 2012. Discrimination of American cranberry cultivars and assessment of clonal heterogeneity using microsatellite markers. Plant Mol. Biol. Report 31:1–8. Fajardo, D., D. Senalik, M. Ames, et al. 2013. Complete plastid genome sequence of Vaccinium macrocarpon: structure, gene content, and rearrangements revealed by next generation sequencing. Tree Genet. Genomes 9:489–498. Fajardo, D., B. Schlautman, S. Steffan, et  al. 2014. The American cranberry mitochondrial genome reveals the presence of selenocysteine (tRNA‐Sec and SECIS) insertion machinery in land plants. Gene 536:336–343. Feng, G.P., M.I. Klein, S. Gregoire, et  al. 2013. The specific degree‐of‐polymerization of A‐type proanthocyanidin oligomers impacts Streptococcus mutans ­glucan‐ mediated adhesion and transcriptome responses within biofilms. Biofouling 29:629−640. Gallardo, R.K., Q. Zhang, P. Klingthong, et  al. 2018. Breeding trait priorities of the cranberry industry in the United States and Canada. Hortsci. 53:1467–1474. Georgi, L.L., R.H. Herai, R. Vidal, et al. 2012. Cranberry microsatellite marker development from assembled next‐generation genomic sequence. Mol. Breed. 30:227–237. Georgi, L., J. Johnson‐Cicalese, J. Honig, et al. 2013. The first genetic map of the American cranberry: Exploration of synteny conservation and quantitative trait loci. Theor. Appl. Genet. 126:673–692. Häkkinen, S., and S. Auriola. 1998. High‐performance liquid chromatography with electrosprayionization mass spectrometry and diode array ultraviolet detection in the identification of flavonol aglycones and glycosides in berries. J. Chromatogr. A. 829:91–100. Hall, S.H., and G.J. Galletta. 1971. Comparative chromosome morphology of diploid Vaccinium species. J. Am. Soc. Hortic. Sci. 96:289–292. Jeffers, S.N. 1988. Phytophthora species associated with a cranberry decline syndrome in Wisconsin. Phytopathology 78:1572. Johnson‐Cicalese, J., N. Vorsa, and J. Polashock. 2009. Breeding for fruit rot resistance in Vaccinium macrocarpon. Acta Hortic. 810:191–198. Johnson‐Cicalese, J., J.J. Polashock, J. Honig, et al. (2015). Heritability of fruit rot resistance in American cranberry. J Am. Soc. Hortic. Sci. 140(3):233–242. Koo, H., S. Duarte, R.M. Murata, et al. 2010. Influence of cranberry proanthocyanidins on formation of biofilms by streptococcus mutans on saliva‐coated apatitic surface and on dental caries development in vivo. Caries Res. 44:116−126. Li, W.G., X.Y. Zhang, Y.J. Wu, and X. Tian. 2001. Anti‐inflammatory effect and mechanism of proanthocyanidins from grape seeds. Acta Pharmacol. Sin. 22:1117−1120. Mahy, G., L.P. Bruederle, B. Connors, et  al. 2000. Allozyme evidence for genetic autopolyploidy and high genetic diversity in tetraploid cranberry, Vaccinium oxycoccos (Ericaceae). Am. J. Bot. 87, 1882–1889. McCown, B.H., and E.L. Zeldin. 2003. HyRed and early, high fruit color cranberry hybrid. HortSci. 38:304–305.

Domestication, Genetics, and Genomics

313

McManus, P.S. 1998. First report of early rot of cranberry caused by Phyllosticta vaccinia in Wisconsin. Plant Dis. 82:350. Novy, R.G., and N. Vorsa. 1996. Evidence for RAPD heteroduplex formation in cranberry: Implications for pedigree and genetic relatedness studies and a source of co‐dominant RAPD markers. Theor. Appl. Genet. 92:840–849. Novy, R.G., C. Kokak, J. Goffreda, and N. Vorsa. 1994. RAPDs identify varietal misclassification and regional divergence in cranberry [Vaccinium macrocarpon (Ait) Pursh]. Theor. Appl. Genet. 88:1004–1010. Ortiz, R., and N. Vorsa. 1998. Tetrad analysis with translocation heterozygotes in cranberry (Vaccinium macrocarpon Ait.): Interstitial chiasma and directed segregation of centromeres. Hereditas 129:75–84. Oudemans, P.V. 1999. Phytophthora species associated with cranberry root rot and surface irrigation water in New Jersey. Plant Dis. 83:251–258. Oudemans, P., F. Caruso, and A. Stretch. 1998. Cranberry fruit rot in the Northeast: A complex disease. Plant Dis. 82:1176–1184. Pappas, E., and K.M. Schaich. 2009. Phytochemicals of cranberries and cranberry products: Characterization, potential health effects, and processing stability. Crit. Rev. Food Sci. Nutr. 49:741–781. Polashock, J.J., and N. Vorsa. 2002. Development of SCAR markers for DNA fingerprinting and germplasm analysis of American cranberry. J. Am. Soc. Hortic. Sci. 127:677–684. Polashock, J.J., J. Vaiciunas, and P.V. Oudemans. 2005. Identification of a new Phytophthora species causing root and runner rot of cranberry in New Jersey. Phytopathology 95:1237–1243. Polashock, J., E. Zelzion, D. Fajardo, et al. 2014. The American cranberry: First insights into the whole genome of a species adapted to bog habitat. BMC Plant Biol. 14:165. Rasmussen, S.E., H. Frederiksen, K. Struntze Krogholm, and L. Poulsen. 2005. Dietary proanthocyanidins: Occurrence, dietary intake, bioavailability, and protection against cardiovascular disease. Mol. Nutr. Food Res. 49:159−174. Rodriguez‐Saona, C., N. Vorsa, A.P. Singh, et  al. 2011. Tracing the history of plant traits under domestication in cranberries: Potential consequences on anti‐herbivore defences. J. Exp. Bot. 62:2633–2644. Rowland, L.J., A.L. Dhanaraj, J.J. Polashock, and R. Arora. 2003. Utility of blueberry‐ derived EST‐PCR primers in related Ericaceae species. HortSci. 38:1428–1432. Rowland, L.J., E. Ogden, and M.K. Ehlenfeldt. 2010. EST‐PCR markers developed for highbush blueberry are also useful for genetic fingerprinting and relationship studies in rabbiteye blueberry. Sci Hortic. 125:779–784. Sarracino, J.M., and N. Vorsa. 1991. Self and cross fertility in cranberry. Euphytica 58:129–136. Schlautman, B., D. Fajardo, T. Bougie, et  al. 2015a. Development and validation of 697  novel polymorphic genomic and EST‐SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules 20:2001–2013. Schlautman, B., G. Covarrubias‐Pazaran, L. Diaz‐Garcia, et  al. 2015b. Development of a high‐density cranberry SSR linkage map for comparative genetic analysis and trait detection. Mol. Breed. 35:1–18. Schlautman, B., G. Covarrubias‐Pazaran, D. Fajardo, et al. 2017a. Discriminating power of microsatellites in cranberry organelles for taxonomic studies in Vaccinium and Ericaceae. Gen. Res. Crop Evol. 64:451–466. Schlautman, B., J. Bolivar, S. Hodapp, and J.E. Zalapa. 2017b. Cranberry SSR multiplexing and poolplexing panels for commercial fingerprinting, genetic diversity studies, and high throughput linkage mapping. Sci. Hortic. 219:280–286.

314

NICHOLI VORSA AND JUAN ZALAPA

Schlautman, B., G. Covarrubias‐Pazaran, L. Diaz‐Garcia, et  al. 2017c. Construction of a high‐density American cranberry (Vaccinium macrocarpon Ait.) composite map using genotyping‐by‐sequencing for multi‐pedigree linkage mapping. G3 Gene Genom. Genet. 7:1177–1189. Schlautman, B., L. Diaz‐Garcia, G. Covarrubias‐Pazaran, et al. 2018. Comparative genetic mapping reveals synteny and collinearity between the American cranberry and diploid blueberry genomes. Mol. Breed. 38:9. Singh, A.P., R.K Singh, K.K. Kim, et al. 2009. Cranberry proanthocyanidins are cytotoxic to human cancer cells and sensitize platinum‐resistant ovarian cancer cells to paraplatin. Phytother. Res. 23:1066–1074. Singh, A.P., T.S. Lange, K.K. Kim, et  al. 2012. Purified cranberry proanthocyanidines (PAC‐1A) cause pro‐apoptotic signaling, ROS generation, cyclophosphamide retention and cytotoxicity in high‐risk neuroblastoma cells. Int. J. Oncol. 40:99–108. Stewart, C.N., and L. Excoffier. 1996. Assessing population genetic structure and variability with RAPD data: Application to Vaccinium macrocarpon (American cranberry). J. Evol. Biol. 9:153–171. Stevens, N. 1931. The spread of cranberry false blossom in the United States. United States Department of Agriculture Circular No. 147. Stevens, C.D., C.E. Cross, and W.E. Piper. 1957. The cranberry industry in Massachusetts. Mass. Dep. Agric. Bull. 157:1–45. Stiles, C.M., and P.V. Oudemans. 1999. Distribution of cranberry fruit‐rotting fungi in New Jersey and evidence for nonspecific host resistance. Phytopathology. 89:218–225. Smith, T.W., C. Walinga, S. Wang, et al. 2015. Evaluating the relationship between diploid and tetraploid Vaccinium oxycoccos L. (Ericaceae) in eastern Canada. Botany 93:1–14. Vander Kloet, S. 1983. The taxonomy of Vaccinium section Oxycoccus. Rhodora 85:1–43. Vorsa, N. 2010. Cranberry, p. 728. In: J.R. Clark and C.E. Finn (eds.), Register of new fruit and nut cultivars, List 45. HortSci. 45:716–756. Vorsa, N. 2012. Cranberry. p. 543. In: J.R. Clark and C.E. Finn (eds.). Register of new fruit and nut cultivars, List 46. HortSci. 47:536–562. Vorsa, N., and J. Johnson‐Cicalese. 2012. American cranberry. Fruit Breed. 8:191–223. Vorsa, N., and J. Johnson‐Cicalese. 2017a. Cranberry plant named ‘CNJ99‐9‐96’. US PP 27,657. Vorsa, N., and J. Johnson‐Cicalese. 2017b. Cranberry plant named ‘CNJ99‐52‐15’. US PP 27,709. Vorsa, N., J. Polashock, D. Cunningham, and R. Roderick. 2003. Genetic inferences and breeding and implications from analysis of cranberry germaplsm anthocyanin profiles. J. Am. Soc. Hort. Sci. 128:691–697. Vorsa, N., J. Johnson‐Cicalese, and J. Polashock. 2009. A blueberry by cranberry hybrid derived from a Vaccinium darrowii × (V. macrocarpon × V. oxycoccus) intersectional cross. Acta Hortic. 810:187–190. Vvedenskaya, I.O., and N. Vorsa. 2004. Flavonoid composition over fruit development and maturation in American cranberry, Vaccinium macrocarpon Ait. Plant Sci. 167:1043–1054. Wang, Y., A. Han, E. Chen, et al. 2015. The cranberry flavonoids PAC DP‐9 and quercetin aglycone induce cytotoxicity and cell cycle arrest and increase cisplatin sensitivity in ovarian cancer cells. Int. J. Oncol. 46:1924–1934. Wang, Y., J. Johnson‐Cicalese, A.P. Singh, and N. Vorsa. 2017. Characterization and quantification of flavonoids and organic acids over fruit development in American cranberry (Vaccinium macrocarpon) cultivars using HPLC and APCI‐MS/MS. Plant Sci. 262:91–102.

Domestication, Genetics, and Genomics

315

Zalapa, J.E., H. Cuevas, H. Zhu, et al. 2012. Using next‐generation sequencing approaches to isolate simple sequence repeat (SSR) loci in the plant sciences. Am. J. Bot. 99:193–208. Zalapa, J.E., T.C. Bougie, T.A. Bougie, et  al. 2014. Clonal diversity and genetic differentiation revealed by SSR markers in wild Vaccinium macrocarpon and Vaccinium oxycoccos. Ann. Appl. Biol. 166:196–207. Zdepski, A., S.C. Debnath, A. Howell, et al. 2011. Cranberry. p. 200. In: K. Folta and C. Kole (eds.), Genetics, genomics and breeding of berries. CRC Press, Boca Raton, FL. Zeldin, E.L., and B.H. McCown. 2003. Application of polyploidy to cranberry breeding and biotechnology. In: P. Hicklenton and J. Maas (eds.), Proceedings of XXVI IHC–Berry Crop Breeding. Acta Hort. 626, ISHS. Zeldin, E.L., and B.H. McCown. 2014. Cranberry plant named ‘WI92‐A‐X15’. US PP 25,066. Zhu, H., D.A. Senalik, B.H. McCown, et al. 2012. Mining and validation of pyrosequenced simple sequence repeats (SSRs) from American cranberry (Vaccinium macrocarpon Ait.). Theor. Appl. Genet. 1:87–96.

9 Images and Descriptions of C ­ ucurbita maxima in Western ­Europe in the Sixteenth and Seventeenth ­Centuries Alice K. Formiga and James R. Myers Department of Horticulture, Oregon State University, Corvallis, OR, USA

ABSTRACT Little is known about when the South American species Cucurbita maxima Duchesne was first brought to Europe, where in South America the first European specimens of this species came from, and what cultivar types were available in 16th and 17th century Europe. Botanical literature and iconography can aid in answering these questions; however, identifying this species in historical sources is challenging, due to inconsistent nomenclature as well as its visual similarity with other cucurbits. Using a multidisciplinary approach, this paper examines where in South America C. maxima was present before the arrival of Europeans and whether it could have reached Europe before the conquest of Peru. It also reviews the earliest appearances of C. maxima in European works to learn more about when and where different cultivar types were introduced. The authors discuss Ulisse Aldrovandi’s herbarium specimen and botanical illustrations of C. maxima, the earliest botanical descriptions and mentions in agricultural books, and the small number of genre and still-life paintings containing C. maxima. They raise the possibility that the cucurbits painted by Giovanni da Udine in the Loggia of the Villa Farnesina and the Vatican Loggia in 1515–1519 may not be C. maxima. The first examples of this species in European frescoes may be by Francesco Salviati in the Palazzo Vecchio in Florence in 1543–1545. In addition, they discuss the first appearances in European art of several popular “heirloom” cultivar types, along with the difficulties of identifying them and making conclusions about their geographical diffusion based solely on art and botanical works.

Plant Breeding Reviews, Volume 43, First Edition. Edited by Irwin Goldman. © 2020 John Wiley & Sons, Inc. Published 2020 by John Wiley & Sons, Inc. 317

318

Alice K. Formiga and James R. Myers

KEYWORDS: Cucurbita maxima, squash, pumpkins, history, iconography, painting, botanical illustration, South America I.  INTRODUCTION II.  CHALLENGES OF IDENTIFYING CUCURBITS IN HISTORICAL SOURCES III.  DISTINGUISHING CUCURBITA MAXIMA IV.  WHERE WERE CUCURBITA MAXIMA PRESENT IN SOUTH AMERICA BEFORE THE ARRIVAL OF EUROPEANS AND HOW EARLY COULD IT HAVE ARRIVED IN EUROPE? V.  CUCURBITA MAXIMA IN HERBALS AND BOTANICAL AND AGRICULTURAL BOOKS VI.  CUCURBITA MAXIMA IN FRESCOES A. Frescoes in the Villa Farnesina and the Loggia of Raphael 1. Orange cucurbits 2. Blue and white cucurbits B. Sala delle Udienze in the Palazzo Vecchio, Florence, by Francesco Salviati C. Prospero Fontana VII.  CUCURBITA MAXIMA IN BOTANICAL PAINTINGS VIII.  CUCURBITA MAXIMA IN GENRE PAINTINGS AND STILL LIFES A. Willem Kalf B. Giovanna Garzoni IX.  CONCLUSION AND FUTURE PROSPECTS ACKNOWLEDGMENTS LITERATURE CITED

I. INTRODUCTION Many popular modern and “heirloom” varieties of squash and pumpkins are members of the species Cucurbita maxima Duchesne. This species was domesticated and distributed by Native Americans in South America and is not known to have left that continent before 1492 (Whitaker 1947). The exact date of its discovery by European explorers in the New World, and when the species was introduced into Europe, is not known with any certainty. In addition, little is known about the early forms of C. maxima that were grown in South America and introduced into Europe in the 16th and 17th centuries. While it is possible that this species might have first arrived in Europe from southeastern South America in the first two decades of the 16th century, it could also have been imported from western South America after the conquest of Peru. New World cucurbits were mentioned in the earliest travel accounts by explorers to America and seeds were soon brought to Europe (Ott 2012). While considerable scholarship has been devoted to the European history and iconography of the species Cucurbita pepo L. in the 16th and 17th centuries (e.g., Paris 2001, 2007; Jacobsohn 2005a; Janick

Images and Descriptions of Cucurbita maxima in Western Europe

319

and Paris 2006; Paris et al. 2006; Lust and Paris 2016), less attention has focused on Cucurbita maxima. There are many fewer images and mentions of C. maxima than C. pepo in European works. This article takes a multidisciplinary approach to reviewing some known and previously unknown examples of C. maxima in 16th and 17th century writings and art in an attempt to better understand when it could have arrived in Europe and when various cultivar types were first noted and illustrated. It also highlights the challenges of distinguishing different species of cucurbits in historical sources and the difficulties in drawing conclusions about the geographical diffusion of this species based on literature and iconography alone. Because the words used to describe members of the Cucurbitaceae family are often used indiscriminately for different species and cultivar types, defining our terms will help avoid confusion. The term “cucurbits” and “gourds” refer to any member of the Cucurbitaceae family, and “New World cucurbits” means all cucurbit species that originated in North, Central, and South America. The focus of our discussion of New World cucurbits will be the three species Cucurbita maxima, Cucurbita moschata Duchesne, and Cucurbita pepo. While the words “squash” and “pumpkins” are frequently used for different species and shapes of cucurbits, we use “squash” here to denote edible non‐round fruits of the Cucurbit genus and “pumpkins” for fruits in that genus that are more or less round. Cultivar names and named landraces are in single quotes; double quotes are used for cultivar types described in historical texts. Cultivar group names are capitalized. II. CHALLENGES OF IDENTIFYING CUCURBITS IN HISTORICAL SOURCES The identification and differentiation of cucurbits in documents from the 16th and 17th centuries is challenging, not least because there was no fully consistent nomenclature used to describe them. One reason for this is that European explorers and botanists gave names to New World cucurbits that were already in use for familiar Old World species (Teppner 2004). For example, the Latin word “cucurbita” had been used for Lagenaria siceraria (Molina) Standl. before 1492, as had “zucca” in Italian, “calabaza” in Spanish, “courge” in French, and “Kuerbis” in German. The Latin term “citrullus”, which became the French “citrouille”, had previously been used for cucumbers Cucumis sativus L. and watermelons Citrullus lanatus (Thunb.) Matsum. & Nakai (Paris 2015). “Pepo”, which eventually became “pompon” in French and

320

Alice K. Formiga and James R. Myers

“pumpkin” in English, had been used for watermelons and melons (Cucumis melo L.) (Paris 2015). “Melopepo” had also been used before 1492 for C. melo (Paris 2015) but this term was later applied by botanists to some Cucurbita species. Attempts were sometimes made to distinguish the new arrivals from familiar types by calling them “Indian” or “Turkish” or “overseas” gourds or cucumbers or even apples—names that signified an exotic origin. For example, in a chapter on melons and cucumbers, Hieronymus Bock (1539) mentioned a fruit with large leaves that he had received from Nürnberg, which was referred to as “zuccomarin”, or “overseas gourd”, and Leonhard Fuchs (1542) illustrated two Cucurbita pepo varieties, which he called Cucumis turcicus (“Turkish cucumber”) and Cucumis marinus (“overseas cucumber”). As New World cucurbits became more common in Europe, the meanings of vernacular terms evolved to include them. For example, “citrouille” came into use for New World cucurbits by the 1530s in France (Hyman and Hyman 2005). Although the Spanish Jesuit missionary José de Acosta mentioned “calabazas de Indias” or “Indian gourds” called “capallos” (or “zapallos”) in Peru that might have been Cucurbita maxima (1590), this and other indigenous American words for cucurbits were not often used in Europe at this time. Although many authors supplied botanical names, and often referred to both ancient authors (who had not seen New World cucurbits) and each other in an attempt at consistency, it is often very difficult to tell which species or cultivar type matches a particular name. Not all authors had access to the same species and cultivars, and many continued to speak interchangeably of some or all as melons, watermelons, cucumbers, summer and winter squash, pumpkins, and gourds. Even what seems like a specific term, like “zucca marina” in Italian was not consistently used for a single botanical species throughout its history. In 1640, John Parkinson complained about the confusion in nomenclature and how writers, in their attempts to elucidate the situation, only made it worse. What I said before concerning the variableness of the ancient Authors in these things, I may as well say of our moderne writers in confounding Pepo, Melopepo and Cucurbita so promiscuously, that it is not possible to finde out the distinct certaintie of them all… And Bauhinus who taketh upon him to refine all other mens writings and distinguish of them, in making Pepo, Melopepo and Cucurbita several kinds of plants doth huddle and confound them together, as any that will read him advisedly and compare him may soone see that he giveth severall names to one and the same plant in divers places… (Parkinson 1640).

Images and Descriptions of Cucurbita maxima in Western Europe

321

It was only much later that Antoine Nicolas Duchesne differentiated the three species Cucurbita pepo, C. maxima, and C. moschata in his Natural History of the Gourds (Duchesne 1786) on the basis of cross‐ pollination experiments, but his classification was neither immediately nor universally accepted. Researching backwards from the present using contemporary squash and pumpkin cultivar names can only be done within limits. With several exceptions, most specific names that link them to a locality, such as ‘Rouge d’Étampes’ or ‘Potiron Gris de Boulogne’, did not come into use until the 19th century, along with the expansion of the seed trade. While the first date of introduction of a commercial cultivar need not mean that it was absent from a particular area earlier, it may have been less fixed to type before commercial seed production began (Jacobsohn and Pluvinage 2006). In spite of all these difficulties, however, it is often possible to make an educated guess as to the identification of cucurbit species in historical sources when a species name describes its distinct morphological characteristics and when it is accompanied by a description and an illustration. The ease of identifying specific species in botanical illustrations and artwork depends on the level of detail and accuracy in the artist’s rendering (Eisendrath 1961; Paris 2015). Signorini (2015) summarized some additional factors affecting the identification of plants in historical works of art: the state of conservation of the work; the position of the plants in the work, i.e. whether they are shown in full or obscured by other elements; the presence or lack of necessary diagnostic characteristics; changes in the morphological traits of plants over time; and how faithfully the work depicts the plant, which can often depend on factors such as the painting style of the time, the artist’s skill, how important it was to the artist to show morphological traits, and whether actual plants were available to use as models. Some depictions lack sufficient detail, in some cases because artists were unable to see actual specimens in each stage of growth, or because they showed multiple species entangled together on one plant. Even if an illustration was drawn from life both realistically and in full color, many squash and pumpkins so closely resemble melons and other cucurbits that even the most expert horticulturists and food historians can differ in their interpretations. III. DISTINGUISHING CUCURBITA MAXIMA Cucurbita maxima was first recognized as a distinct species by Antoine Nicolas Duchesne (Duchesne 1786; Paris 2007). At that time, he had available only a limited selection of diversity within this species, so

322

Alice K. Formiga and James R. Myers

his description reflects this fact. Characteristics that he recognized as distinguishing C. maxima from other Cucurbita spp. included generally larger and more robust vegetative and reproductive parts; for the flower, a corolla that was more flared relative to other species, with a broader calyx base and reflexed tips; and round to cordate shaped leaves without substantial lobing. Leaves were held on erect petioles with planar orientation. The hairs on the leaves were finer and softer that other Cucurbita (Duchesne was mainly comparing to C. pepo, which has very coarse and stiff hairs) and approach the softer texture of those found in C. moschata. Fruit were described as generally larger and more uniform in oblate‐spherical form with regular ridging and substantial recesses at the peduncular and stylar ends. Fruit rind was described as thin (soft) in contrast to the (thick) hard rind associated with greater thickness in other species. Fruit flesh was described as firmer while remaining juicy and melting. Duchesne recognized three C. maxima varieties: a large yellow pumpkin averaging 30–40 pounds (13–18 kg) but having individual fruit weighing over 60 pounds (27 kg); with skin color ranging from reddish yellow to bronze, sometimes a white stripe in the valleys between ridges on the fruit, and sometimes acquiring a fine netting such as observed in melon (Cucumis melo). The flesh was generally yellow in color. Secondly, he recognized large and small green fruited types of good keeping and eating quality. The large green type was smaller than the large yellow with grey‐green to slate colored skin. Flesh color ranged from yellow to orange‐red. The small green fruited type had a more oblate fruit shape and had the best keeping and eating quality of all. Several traits that plant systematicists now recognize as characteristic of C. maxima were not mentioned by Duchesne, or were rather ambiguously described. These include for fruit, large, soft, and round peduncle and the hard protruding remnants of the style; for flowers, short and thick androecium (in male flowers); and for seed, acute and symmetrical funicular attachment of the seed, and smooth and obtuse seed ­margin (Whitaker and Bohn 1950). The lack of mention of the distinctive peduncle by Duchesne is most curious because this is one of the most prominent and useful traits for classifying Cucurbita species. In the images illustrated by Duchesne (Paris 2007), the peduncle is generally not shown. Nowadays and presumably in earlier times, farmers will cut peduncles to a stub to minimize injury to other fruits and to reduce entry of pathogens through the peduncle, and it may be that the fruit that Duchesne used in his sketches and paintings did not have enough peduncle to accurately characterize. The rounded peduncle of C. maxima becomes thicker and corky (Fig. 9.1A and B) when the fruits are mature, unlike the angular peduncles of C. pepo

Images and Descriptions of Cucurbita maxima in Western Europe

(a)

323

(b)

(c)

Fig. 9.1.  A comparison of peduncles of Cucurbita species. A. ‘Rouge d’Étampes’ (C. maxima) showing elongated and thin peduncle. B. ‘Sunshine’ (C. maxima) showing large, thick, and very corky peduncle. C. ‘Tricolor Cushaw’ (C. argyrosperma) showing large peduncle that has hard ridges separated by corky tissue filling the valleys. Bar = 5 cm.

and C. moschata, or the long, thin peduncles of Cucumis melo melons and Lagenaria spp. gourds. Cucurbita maxima peduncles vary, and while they are generally thick and corky at harvest maturity (Fig. 9.1B), some varieties have thinner, more elongated round and corky peduncles (Fig. 9.1A), and even those with thick peduncles will show reductions in diameter after several months of storage as the tissues dehydrate. The peduncle is diagnostic of C. maxima with only C. argyrosperma superficially resembling those of C. maxima in mature fruits (Fig.  9.1C). Warty and thick (hard) rind fruits are found within C. maxima but apparently were not available to Duchesne at the time of his studies. Duchesne described netting

324

Alice K. Formiga and James R. Myers

Fig. 9.2.  First known illustrations of turban squash. Top: Antoine Nicolas Duchesne (1785). Bottom: Jean‐Louis Prévost (1786). © Muséum National d’Histoire Naturelle, Paris.

as a characteristic of the large yellow type pumpkin, but this trait is less common today among C. maxima varieties. Duchesne’s description of a recessed peduncular end of the fruit is characteristic of a subset of C. maxima types whereas others have flush or bulging peduncular ends (such as in Hubbard types). It is not clear what he meant by a recessed stylar end. The fruit of cucurbits is a pepo, consisting of a fleshy receptacle that is fused to the pericarp (Hayward 1938). The receptacle usually completely surrounds the pericarp, but in certain varieties of several cucurbit species, the pericarp may be exposed. This is true for many forms of C. maxima where the pericarp is exposed and may be recessed, or protrudes from the receptacle. This takes its most extreme form in the turban‐shaped C. maxima varieties (Fig. 9.2), which Duchesne illustrated, but did not recognize as C. maxima. In varieties with exposed pericarp, a circular scar divides the receptacle from the pericarp. It is rare to find any other Cucurbita spp. with an exposed pericarp, but many older melon (Cucumis melo) cultivars also have a protruding pericarp and a circular scar separating the receptacle from the pericarp.

Images and Descriptions of Cucurbita maxima in Western Europe

325

(a)

(b)

(c)

Fig. 9.3.  Blossom scars on fruit from three Cucurbita maxima cultivars showing ­various degrees of exposed pericarps and the remnants of a hard and corky style. A. ‘Dill’s Atlantic Giant’ with no exposed pericarp and a prominent style. B. ‘Wolf’ with annular ring around protruding style. C. ‘Full Moon’ with exposed pericarp and protruding style.

A difference between Cucurbita maxima and melons is that the remnants of the large style from the female flower form a corky cylinder of tissue at the center of the pericarp in C. maxima (Fig. 9.3), but is much less prominent in melons (Fig. 9.4). Additional comparative photographs and information can also be found in Zanotti (2018). An exposed pericarp

326

Alice K. Formiga and James R. Myers

(a)

(b)

Fig. 9.4.  Blossom end scars on A. watermelon (Citrullus lanatus) and B. cantaloupe (Cucumis melo) fruit.

is not universal in C. maxima, but even those with a receptacle entirely surrounding the pericarp will exhibit a prominent style (Fig. 9.3A). Pumpkins of C. maxima are among the largest fruits in the world, with weights of over 1,000 kg for giant show pumpkins. Fruits of landrace and heirloom types are often medium to large relative to other species. Fruit colors of C. maxima range from red‐orange through pale orange/pink, white, light grey‐blue, to dark green and they may have stripes or marbled spots. Fruit shape varies from oblate to round to elongate or pyriform in appearance, often with shallow ribs. Building on the work of Castetter (1925), C. maxima are often classified into cultivar groups, which have changed somewhat over time based on what types are commercially available. The primary cultivar groups are often identified as Banana, Delicious, Hubbard, Marrow, Show, and Turban (OECD 2012). Based on more contemporary seed listings, Ferriol and Picó (2008) proposed adding Kabocha and Other. While these groups are convenient for classifying many popular forms, they do not necessarily fit every landrace, cultivar type, or variety, nor do they explain their

Images and Descriptions of Cucurbita maxima in Western Europe

327

interrelationships; some varieties descend from or could be sorted into multiple cultivar groups (Decker‐Walters and Walters 2000). In summary, the major traits for differentiation of C. maxima from other squash and pumpkin species and melons are: rounded leaf margins, large fruit size, large and soft peduncle with round cross‐section, often an exposed pericarp, and always a protruding style. In addition, many C. maxima varieties are suitable for long‐term storage, which may be an important factor in iconography because fruit would be available to the artist for six or more months of the year. IV. WHERE WAS CUCURBITA MAXIMA PRESENT IN SOUTH AMERICA BEFORE THE ARRIVAL OF EUROPEANS AND HOW EARLY COULD IT HAVE ARRIVED IN EUROPE? Cucurbita maxima Duchesne originated in South America and is thought to have descended from the wild Cucurbita maxima Duchesne subsp. andreana (Naudin) Filov (Nee 1990; Sanjur et al. 2002), which is native to Argentina, Uruguay, Paraguay (Decker‐Walters and Walters 2000), and possibly Bolivia (Sanjur et al. 2002). Archaeological evidence has uncovered pre‐Columbian specimens of C. maxima, most abundantly in coastal Peru, as well as in northern Chile and Bolivia (Decker‐Walters and Walters 2000). C. maxima and intermediate forms of C. maxima and the wild form have also been identified in northwest Argentina (Martínez et al. 2017), where many landraces exist (Millán 1947; Lorello et al. 2016). Parodi (1935) claimed that C. maxima was probably grown all over Argentina, and lists them among plants that were likely cultivated by the Guarani at the time of the conquest of the Rio de la Plata in Argentina and Paraguay. A recent study found remains of C. moschata in the Entre Rios region of northeast Argentina (Colobig and Ottalagano 2016). Pre‐Columbian cucurbit remains that have not yet been identified at the species level were found in the La Plata basin in southeastern Uruguay (Iriarte et al. 2004; Iriarte 2007), the Paraná Delta (Bonomo et al. 2011; Cornero and Rangone 2015), and southern Brazil (Corteletti et al. 2015). European conquistadors did not reach coastal Peru until 1528; however, if the pre‐Columbian range of C. maxima included southeastern Brazil, Uruguay, Paraguay, or northeast Argentina, it could have been brought to Europe in the early 16th century from eastern South America. While C. moschata is better suited to tropical climates, C. maxima might have been present in the more temperate areas in this region. Although there is some surviving documentation about voyages to eastern South America along the Brazilian coast, including what is now Uruguay,

328

Alice K. Formiga and James R. Myers

down to the Rio de la Plata in the first two decades of the 16th century, by Vespucci, the Portuguese, as well as French brazilwood traders and corsairs, and the Spanish expedition of Juan Díaz de Solís, none of these accounts mention squash or pumpkins. Other crops such as manioc were mentioned by Pêro Vaz de Caminha around 1500 (Posey and Balick 2006) and hot peppers were noted around 1515 by the unknown writer of the Copia der Newen Zeytung aus Presillg Landt (Kux 1982). There is evidence that these early expeditions imported other exotic goods to Europe from South America such as parrots and monkeys, which were in great demand, bringing high prices that supplemented the sellers’ incomes (Veracini 2017). This trade began in Brazil as early as 1500 (Masseti and Veracini 2010). Later accounts by Luis Ramírez from the expedition of Sebastian Cabot (Madero 1892) and by Diego García de Moguer (Trelles 1879), both of whom sailed up the Rio de la Plata into the Paraná in the late 1520s, mention “calabazas,” i.e. gourds, but without describing them, being grown near present‐day Rosario, Argentina, as well as at the confluence of the Paraná and Paraguay rivers, where they also saw maize and manioc being cultivated by the Chana‐Timbu. The participants in these expeditions often suffered from hunger, and one captain in Cabot’s crew was reportedly whipped for stealing three “calabazas” to eat (Medina 1908). Few genetic studies have examined in detail the relationship between landraces of C. maxima in Europe and those in particular regions of South America, but Esteras et al. (2009) indicated that the Spanish landrace accessions they tested most closely resembled less variable accessions from Peru and Ecuador. Ferriol et al. (2004) found Spanish C. maxima landraces to be less variable than those in South America, but that they had traits in common with accessions from more than one region of South America. More extensive comparative genetic studies of European and South American C. maxima landraces—including examples from Portugal, Italy, and France, and various regions of South America—might shed more light on this subject; however, these studies are unlikely to confirm the geographic origin of the first C. maxima in Europe. The oldest surviving specimen of C. maxima in Europe is mounted in the first volume of the herbarium of Ulisse Aldrovandi, which was compiled in 1551 (Soldano 2007) and is housed at the University of Bologna (Fig. 9.5). Aldrovandi received many of the New World plants in this volume from the botanist Luca Ghini (Ubriszy Savoia 1993), who was hired by Grand Duke Cosimo I de’ Medici to direct Italy’s first botanic garden in Pisa, founded in 1544. Above it is another New World cucurbit leaf, which is labeled Cucurbita Cucumer turcicus. The C. maxima is differentiated from it as Cucurbita alia, or “other cucurbit.” This nomenclature in this volume of Aldrovandi’s herbarium may

Images and Descriptions of Cucurbita maxima in Western Europe

329

Fig. 9.5.  Cucurbit leaves in the Herbarium of Ulisse Aldrovandi Vol. 1, foglio 84. Reproduced with the kind permission of the Alma Mater Studiorum Università di Bologna–Sistema Museale di Ateneo–Orto Botanico ed Erbario.

derive from Ghini (Ubriszy Savoia 1992–1993). A DNA analysis of the samples in the herbarium would prove useful in confirming their taxonomy (Paris 2016). V.  CUCURBITA MAXIMA IN HERBALS AND BOTANICAL AND AGRICULTURAL BOOKS Leonhard Fuchs’ herbal (1542) contains illustrations of two forms of Cucurbita.pepo and there is no indication that he knew of C. maxima. Hieronymous Bock, who also illustrated a C. pepo in his 1546 herbal, wrote that many types of new cucurbits had recently been introduced to Germany from overseas, which were commonly called “Zucco marino, Zucco de Syria, and Zucco de Peru.” His is the first botanical description that directly associates certain types of cucurbits coming from Italy with South America, specifically Peru, but he does not supply

330

Alice K. Formiga and James R. Myers

Fig. 9.6.  Matthias de L’Obel. Pepo maximus Indicus compressus. In Plantarum seu stirpium historia, 1576.

any descriptions or pictures as evidence that he had seen C. maxima (Bock 1546). The first illustration and description in a herbal, which is clearly C. maxima, is that of Matthias de L’Obel in 1576, published in Antwerp, entitled Pepo maximus indicus compressus (L’Obel 1576; Whitaker, 1947; Eisendrath 1961). It shows a pumpkin with rounded leaves and flattened round furrowed fruit (Fig. 9.6). L’Obel’s name differentiated it from other cucurbits on the basis of its large size and compressed fruit shape, but he also noted in the caption that its leaves were rounded. This image was reused in other herbals of the late 16th and early 17th century without any significant new descriptive information about C. maxima. In his Historia plantarum universalis, written in France before 1613 but published posthumously in 1650–1651, Johann Bauhin included L’Obel’s illustration, but changed the name of the pumpkin to highlight, not the fruit shape but the non‐serrated leaves and the large fruit size. Cucurbita aspera, folio non fisso, fructu maximo, albo sessili. He said he had seen mature fruits of this species in Masevaux, France, which were white, round, and large, weighing 30 pounds (14 kg) (Bauhin and Cherler 1651). During the mid‐17th century, “potiron” (a French word that had previously been used for a type of mushroom) gradually became the term of choice to describe large, globular, and oblate pumpkins that were C. maxima (Jacobsohn 2005b). The earliest use of this term may have

Images and Descriptions of Cucurbita maxima in Western Europe

331

Fig. 9.7.  Claude Aubriet. Melopepo. In Élémens de Botanique by Joseph Pitton de Tournefort, 1694.

been by Nicolas de Bonnefons (Paris 2007) as early as 1651 (Bonnefons 1651). According to Jacobsohn (2005b), Jean Baptiste de la Quintinie, who was the gardener to Louis XIV at Versailles, was the first author to differentiate them from “citrouilles” in 1690 as large, yellow, and flat (La Quintinie 1690). In 1694, Joseph Pitton de Tournefort described pumpkins called Melopepo as almost round, with ribbing dividing the fruit into five sections, and spongy flesh, resembling the example in Plate 34, drawn by Claude Aubriet (Tournefort 1694) (Fig. 9.7). The illustration clearly shows C. maxima, but Tournefort also listed pattypan and warted pumpkins in this category, both of which are C. pepo types. The situation is no better in his 1719 work, in which he listed many varieties of Melopepo with both cut and rounded leaves, the majority of which appear to be C. pepo (Tournefort 1719).

332

Alice K. Formiga and James R. Myers

The small number of C. maxima types illustrated in herbals is another clue that this species may have been less widespread in Northern Europe during the 16th and 17th centuries, and available in fewer varieties than C. pepo, a situation that persisted through the work of Duchesne in the late 18th century. Paris (2000) noted that Duchesne’s collection of paintings includes only four types of C. maxima versus 93 of C. pepo cultivars: one that is large and netted, a yellow‐orange ribbed one, a green ribbed one, and the turban (Paris 2007). Duchesne stated that C. maxima was new in the 17th century and was called “Courge marine,” “Courge d’Outre mer,” or “Courge de l’Inde,” but he could not find any additional information about their origin (Paris 2007). These same names had been used by Johann Bauhin to describe new cucurbits from Italy that had originally come from America (Bauhin and Cherler 1651, p. 220); however, Bauhin could have translated those terms from other authors such as Pietro Andrea Mattioli or Castore Durante, who used them along with illustrations of C. pepo (Lust and Paris 2016). It is possible, however, that C. maxima figured among the various pumpkins called “zucca marina” described in 16th and 17th century agricultural books from central and northern Italy. These pumpkins were not exclusively eaten by the poor, in spite of their classification as peasant food by some contemporary authors including Bartolomeo Pisanelli (McTighe 2004). As noted by Lust and Paris (2016), Giovanvettorio Soderini, who studied in Bologna and lived in Tuscany from c.  1526–1596, described a “marina” winter squash or pumpkin that had a hard rind and tasted best of all, and could be stored through the winter (Soderini nd). The Economia del Cittadino in Villa, by Vicenzo Tanara of Bologna, lists many delicious‐sounding ways to eat pumpkin, and he also described a large and round variety, with a lot of pulp and a white warted rind, known as “zucca marina,” that tasted “exquisite” (Tanara 1651). While the term “zucca marina” was used for C. pepo as well as Lagenaria gourds, it is possible that these authors might have been referring to C. maxima. Today, there are many C. maxima landraces and named cultivars in the northern Italian regions of Lombardy, Emilia‐Romagna, the Veneto, and Urbino that are round and flattened, light blue‐grey to grey‐green, with or without bumps or furrows, or turban‐shaped, that have a long tradition of use in local cuisine, from “tortelli” with a sweetened squash filling to simple porridge with milk. Examples include varieties called ‘Zucca Santa Bellunese’, ‘Zucca Mantovana’, ‘Capello da Prete’, ‘Berettina di Lungavilla’, ‘Berettina Piacentina’, ‘Bertagnina di Dorno’, ‘Berretta di

Images and Descriptions of Cucurbita maxima in Western Europe

333

Guastalla’, and others. It is not known exactly when they first came into cultivation, but they have been available for generations and many contemporary festivals commemorate them as Italians celebrate and work to preserve their culinary heritage. The earliest known specific reference to the popular “heirloom” C. maxima cultivar known as ‘Marina di Chioggia’, traditionally called “suca baruca” or “zucca barucca,” is in Le baruffe chiozzote, a comic play by Carlo Goldoni (1760). Since his audience presumably understood which pumpkin he meant, that type had likely grown around Chioggia for some years before he wrote the play. Fortunato Luigi ­Naccari (1826) mentions a “zucca baruca,” which he describes as a separate species from C. Clodiense alias “zucca santa,” “zucca del collo torta,” and “zucca di chiozza,” which is a type of C. moschata. In 1824, Georg Matthias von Martens, who grew up in Venice, referred to a “zucca marina,” and wrote that it was the type of giant round and flattened pumpkin beloved in Venice, with a bright sea green rind and orange flesh (von Martens 1824). Von Martens describes it as furrowed, and indeed some strains of today’s ‘Marina di Chioggia’ are furrowed. Others are heavily warted and some have a turban shape. Von Martens went into further detail in 1844, and classified it as a C. maxima. It was green, but sometimes orange, and eaten roasted, or it was sometimes fed to livestock. Its large white seeds were best for roasting and sold as “brustolini”, and its buds and flowers were sometimes fried in oil or eaten raw in salads (von Martens 1844). Von Martens also mentions the “zucca turca” or turban squash separately and, like Naccari, he clearly distinguished the “zucca marina” from the “zucca santa”, which he lists as C. moschata (von Martens 1824, 1844). According to von Martens, the three varieties “zucca barucca,” “zucca santa,” and “zucca turca” were all roasted and sold by street vendors in Venice. Dark and lighter blue‐green and sometimes orange furrowed C. maxima as well as C. moschata are indeed illustrated in 19th century paintings and photographs from Venice and Chioggia by artists such as Ludwig Johann Passini (Fig.  9.8), Luigi da Rios (Fig.  9.9), Alessandro Milesi, Edmond de Pury, Antonio Ermolao Paoletti Francesco Paolo Michetti, and Carlo Naya. A much greater diversity of Cucurbita maxima cultivars became available in Europe in the mid‐19th century along with the growth of the seed trade and new introductions from North and South America and other countries. However, many catalogs were not illustrated and not all the varieties listed in catalogs can easily be found in paintings.

334

Alice K. Formiga and James R. Myers

Fig. 9.8.  Ludwig Johann Passini. Kȕ rbisverkäufer in Chioggia. 1876. © Belvedere, Vienna.

Fig. 9.9.  Luigi da Rios. Venditore di Zucche, 1884. Private Collection. Copyright courtesy of Sotheby’s.

Images and Descriptions of Cucurbita maxima in Western Europe

335

VI.  CUCURBITA MAXIMA IN ART A. Frescoes in the Villa Farnesina and the Loggia of Raphael in the Vatican The festoons painted by Giovanni da Udine in the Loggia Cupid and Psyche in the Villa Farnesina in Rome (1515–1518) and the Loggia of Raphael for Pope Leo X (1517–1519) feature an encyclopedic variety of vegetables and fruits. The vast array of species, and the accurate coloring and botanical details including, in some cases, signs of plant disease, suggest that the artist observed and painted actual specimens (Caneva 1992). Giovanni da Udine also included recently arrived rarities from newly explored lands including birds from South America (Caneva and Carpaneto 2010). What were then extensive and elaborate gardens outside the Villa Farnesina were described in a laudatory poem by Blosius Palladius from 1512, as containing all the plants from around the world: Whatever potent Nature has spread through all the world Whatever the Moors, whatever the Thracians, Whatever the Spaniard and the Indians And finally whatever Pliny assembled in his golden books, This and more your overseer has gathered in your garden. Caneva 1992, p. 81; translated in Rowland 2005, p. 29.

While this praise may have been excessive, especially since the gardens were newly planted, the poem conveys the prestige of amassing new and rare plants from around the world. Pope Leo X also collected and was given exotic plants and animals, and it has been suggested that some New World plants may have been among those brought to the Pope by the delegation of Tristão de Cunha from Portugal in 1514 (Dacos 1969; Janick and Caneva 2005). While acknowledging the difficulties of identification, several authors have identified C. maxima among the species of New World cucurbits in the Villa Farnesina and Vatican Loggia frescoes (Caneva 1992; Janick and Paris 2006; Caneva and Carpaneto 2010; Sgamellotti and Caneva 2017). We will discuss the large orange, and the blue and white examples in turn in order to examine the question of whether they are indeed C. maxima. 1. Orange cucurbits. The difficulty in identifying the large orange fruits illustrated in Figs. 9.10 to 9.12 is that they do not look exactly like any cucurbit available today. Certainly, the bright orange‐red color of the cucurbit in Fig. 9.10A and B is similar to that of some contemporary

(a)

(b)

(c)

(d) (e) (f)

(g)

Fig. 9.10.  Orange cucurbits in the Loggia of Cupid and Psyche, Villa Farnesina by Giovanni da Udine. Janick and Paris (2006) classified (A–G) as Cucurbita maxima (pumpkin): (A and B) orange show pumpkin; (C) grey pumpkin; (D–G) white show pumpkin. Caneva (1992) classified (A) and (B) as Cucurbita moschata and (C) as Citrullus colocynthis and (D)–(G) as Cucumis melo var. inodorus (Image credit: J. Janick and H.S. Paris, The Cucurbit Images (1515–1518) of the Villa Farnesina, Rome. Ann Bot. 2005, 97(2):165–176. doi:10.1093/aob/mcj025. © The Author 2005. Published by Oxford ­University Press on behalf of the Annals of Botany Company. All rights reserved).

Fig. 9.11.  Orange cucurbit in the Loggia of Cupid and Psyche (the same fruit as in Fig. 9.10A). Villa Farnesina painted by Giovanni da Udine. Reproduced with permission of the Biblioteca dell’Accademia Nazionale dei Lincei e Corsiniana.

Images and Descriptions of Cucurbita maxima in Western Europe

337

(a)

(b)

Fig. 9.12.  Orange cucurbits in the Loggia of Raphael (1517–1519). Photographs © ­Vatican Museums.

C. maxima varieties such as ‘Atlantic Giant’ (photographed in Goldman 2004, p.54) or the top of ‘Turk’s Turban’ (Goldman 2004, p.61), which also has a protruding pericarp. The photograph in Fig. 9.11 shows the same fruit as in Fig. 9.10A in a different light, making the color look slightly less bright red and more yellow‐orange. Caneva (1992) identified this fruit and Fig.  9.10B, which has no lobes, as C. moschata, and her identifications of this and other species in the Villa Farnesina are also listed in an online database (Whipkey and Janick 2018). There are indeed some C. moschata types that have a similar shape and are more orange than tan in color, such as the ‘Seminole’ (Goldman 2004, p. 92); however, these do not have a large circular scar or protruding pericarp. Janick and Paris (2006) identified Fig. 9.10A and B as C. maxima on the basis of their red‐orange color and large size. Sgamellotti and Caneva (2017), in their catalog for the Villa Farnesina exhibition “Colours of Prosperity,” listed the fruit in Fig.  9.10A in Italian as “zucca gialla” (which refers to winter squash with yellow flesh, often C. moschata or C. maxima). In the English edition, this is translated as “large musky pumpkin” and both C. maxima and C. moschata are

338

(a)

Alice K. Formiga and James R. Myers

(b) (c)

Fig. 9.13.  A. Cucumis melo A28.076 verso. B. Cucumis melo, A28.074 from the Libri Picturati (1560s). Jagellonian library, Kraków. C. Melon from the collection of paintings commissioned by Ulisse Aldrovandi between 1570 and 1600. Il Teatro della Natura ­Volume 3: Piante, fiori, frutti, 169. © Alma Mater Studiorum. Università di Bologna–Biblioteca Universitaria di Bologna.

listed as botanical names, pointing to a possible sense of ambiguity in the species identification. However, in the online Digital Loggia (2017) that accompanied the exhibition, it is labeled C. maxima. Even more closely, however, the shape of the fruit in Figs. 9.10A and B and 9.11 resembles that of melons that appear in other 16th century paintings. Figure 9.13A and B are from the Libri Picturati paintings from the 1560s by several artists, probably including Jacques van den Corenhuyse and Pieter van der Borcht (de Koning et al. 2008), and Fig. 9.13C is from Aldrovandi’s collection of botanical paintings assembled between c. 1570 and 1600. Aldrovandi titled his example Melopepo flavus ad instar cucurbita, indicating that he also thought it resembled a squash or gourd. Other round melons with protruding pericarps are present in the borders of the Joseph Tapestries commissioned by Cosimo I de’ Medici in the 1540s, and round furrowed melons with protruding stylar ends along with a warted C. pepo feature in Bartolomeo Pasarotti’s Zwei Marktfrauen und ein Junge mit Geflügel und Gemüse (1580) (Fig.  9.14). Melons cross readily with each other, and many different melons had these protruding pericarps (Vilmorin‐Andrieux 1885), a trait that became less common through selection by the 20th century. The fruit in Figs.  9.10A and 9.11 is also in the size range of a melon relative to the surrounding grapes, and while it has an exposed pericarp, it lacks the stylar remnants that would be expected with C. maxima.

Images and Descriptions of Cucurbita maxima in Western Europe

339

Fig. 9.14.  Bartolomeo Passarotti, Zwei Marktfrauen und ein Junge mit Geflügel und Gemüse (1580). © Staatliche Museen zu Berlin, Gemäldegalerie

The tapered peduncular end, even lobes, and the large protruding pericarp with the indentation at the tip are clearly shown in Fig. 9.13C, while Fig.  9.13B shows shape variations within melons of this type. In Fig. 9.13C, the yellow melon has green striping in the furrows, as do cantaloupes such as ‘Charentais’ Cucumis melo cantalupensis (Goldman 2002, p.43) and ‘Bidwell Casaba’ (Cucumis melo inodorus) (Goldman 2002, p.101), which can turn orange when overripe. If the melons were harvested from a garden and not painted immediately, they could have easily become overripe, so it is possible that the fruits painted by Giovanni da Udine could be melons rather than Cucurbita maxima. There are multiple examples of similar orange cucurbits in the Loggia of Raphael, which vary from round to elongated pear shaped (pictured in Caneva and Carpaneto 2010 and Dacos 2008). Two examples are shown in Fig. 9.12A and B, which are orange and tapered at the stem end with

340

Alice K. Formiga and James R. Myers

a circular scar and no visible style. These could also be melons, due to the large circular scar and lack of a style at the base, as well as the more or less protruding pericarp, which take this form on some older melon cultivars rather than on C. maxima or C. moschata. Although Caneva and Carpaneto (2010) noted the resemblance of a painting in the grotesques of the Loggia of Raphael to the ‘Turks Turban’, there are no other paintings of anything resembling turban squash until the late 18th century. At that time, various examples were painted in quick succession by botanical artists such as Antoine Nicolas Duchesne in 1785 and Jean-Louis Prevost in 1786(Fig. 9.2) and Lucette Duchesne (1793), which are in the Museum National d’Histoire Naturelle, Paris, and reproduced in Paris (2007), Joseph Jakob Plenck (nd before 1807) and an unidentified artist in the Règne Végétal (nd), suggesting that it was a novelty. Unlike the cucurbits painted in the Villa Farnesina and the Loggia of Raphael, these 18th century turban squashes are flattened in shape, with bright orange‐red rind, and green and white stripes on the bulging pericarp. The earliest surviving reference to the turban squash may be in the 1779 catalog of the Hamburg nurseryman Johann Nikolaus Buek, in which it was listed as Cucurbita fasciata vulgo tuerkischer Band nova species (Buek 1779), a name which seems to refer to its stripes. It may have been present earlier, however, since he implies that it had a common name, and the word “Türkenkopf,” described as a term in some regions for a squash that resembles a Turkish turban, is listed in Johann Christoph Adelung’s dictionary of 1780 (Adelung 1780). It seems to have been an object of curiosity and experimentation to writers such as Christoph J.F. von Dieskau, who described the ‘Türkenbund’ as red, green, and white striped with a cap, and realized it did not cross‐pollinate with all other cucurbits (von Dieskau 1784). It was first offered in France as the ‘Giraumon Turban’ by the firm of Vilmorin‐Andrieux in their catalogue of 1783 ­(Vilmorin and Andrieux 1783). Duchesne, in his notes on cucurbits from August 1786, mentioned that it had been sent from Germany several years earlier. He was confused about its taxonomy, because an acquaintance gave him a flowering plant which he had said was a turban but was actually a C. pepo (Paris 2007, p. 173–174). Eventually, he classified it as a separate type of C. pepo for which his name was C. polymorpha piliformis (Duchesne 1793). Georg Matthias von Martens (1844) classified it as a C. maxima. Finally, Charles Naudin (1856), through cross‐pollination, proved it to be a C. maxima, and noted turban varieties with differences in shape, size, and color.

Images and Descriptions of Cucurbita maxima in Western Europe

341

2.  Blue and  White Cucurbits.  Janick and Paris (2006) also identified various blue‐grey and white cucurbits in the Villa Farnesina frescoes as C. maxima pumpkins on the basis of their shape and secondary furrowing (Fig.  9.10C to G). The small blue‐grey one in Fig.  9.10C, which is about twice the size of a nearby apple in the fresco, has light striping in the furrows, which Duchesne identified as a characteristic of orange C. maxima, although there are many varieties that lack stripes. It appears to have a style at the base, but it also looks similar to the stylar end of several C. pepo in the frescoes, some of which also have lighter, albeit more yellow stripes. There are several other examples of blue C. maxima paintings from the 1500s, which will be discussed below, so C. maxima was indeed present in 16th century Europe, but we are not certain that these examples painted by Giovanni da Udine depict this species. Due to the round shape, colors, and lack of a clear protruding style on the white pumpkins in Fig. 9.10D to G, we think they could be melons, or C. pepo, which can also have secondary furrowing. Caneva (1992) also identified two dark green, warty cucurbits as C. maxima ‘Marina di Chioggia’ (discussed above); however, Janick and Paris (2006) argued convincingly that they are C. melo, similar to an older variety called ‘Black Rock’ because of their warty appearance, lobes, and large, flat stylar ends. If all these fruits in the Villa Farnesina and the Vatican Loggia frescoes depict C. pepo, or melons, then it is possible that none of Giovanni da Udine’s images represent C. maxima and this species might not yet have arrived in Europe by the 1515 to 1519 time period of his work. B. Sala delle Udienze in the Palazzo Vecchio, Florence, by France co Salviati If one were searching for new and rare plant varieties in 16th century frescoes, a likely place to look would be the palaces of Cosimo I de’ Medici, whose enthusiasm for the natural sciences and collecting exotic plants and animals from the New World, including South America, has been well documented (Tongiorgi Tomasi 2001; Bellorini 2016; Markey 2016). Cosimo and his wife Eleanora de Toledo planted New World crops in their gardens. Eleanora was sent seeds of New World plants from relatives in Spain and Cosimo founded botanical gardens in Pisa and Florence. There are many examples of paintings, sculptures, and tapestries in their palaces depicting New World plants and animals such as parrots and turkeys. These glorified the Medici’s learning and prestige, and also associated them with wealth, abundance, and global conquest (Markey 2016). Indeed, on the walls of the Sala delle Udienze

342

Alice K. Formiga and James R. Myers

in the Palazzo Vecchio in Florence, where visitors waited for an audience with Cosimo, Francesco de’Rossi (alias Salviati) painted scenes from the triumph of Furius Camillus, framed by heavy festoons and garlands of fruits and vegetables, including several New World cucurbits, which have not to our knowledge been previously noted. Painted between 1543 and 1545, several of them are clearly C. pepo varieties, with raised ridges, both colored and striped, oblate and pyriform in shape (Fig. 9.15). There are also several large cucurbits, which are whitish grey and smooth, as well as some that are blue‐grey with ribs, and slightly indented at the blossom end with a style or circular scar at the base (Fig. 9.16). These could be C. maxima. Salviati also painted both round, flattened, ridged C. pepo and a ribbed blue‐grey cucurbit in his fresco of the story of David in the Sala dei Mappamondi in the Palazzo Sacchetti in Rome (1552–1554). C. pepo also appears in his Sala dei Fasti Farnesiani in the Palazzo Farnese (1552–1556), as noted in Ravelli and Signorini (2004). Salviati often copied his own drawings (Nova 1992), so it is not possible to be sure whether he painted actual specimens of these cucurbits in Florence and Rome. While cucurbits abound in other artworks commissioned by Cosimo I and later by his son Francesco I, they seem mostly to be melons and gourds. Examples include the “Dovizia” tapestry designed by Agnolo Bronzino and finished by the workshop of Jan Rost in 1545 (Bambach et al. 2010), which shows a large, split melon along with an American turkey, and melons and cucumbers in the ceiling beams in the Sala degli (a)

(b)

Fig. 9.15.  Ribbed Cucurbita.pepo in the festoons of the fresco in the Sala delle Udienze, Palazzo Vecchio, Firenze by Francesco Salviati (1543–1545). A. Pear‐shaped orange C. pepo. B. Compressed round C.pepo. Photo credit: William Singer. With the ­authorization of the Musei Civici Fiorentini.

Images and Descriptions of Cucurbita maxima in Western Europe

(a)

343

(b)

Fig. 9.16.  Possible Cucurbita maxima in the festoons of the fresco in the Sala delle ­Udienze, Palazzo Vecchio, Firenze by Francesco Salviati (1543–1545). A. Photo credits A and B: William Singer. Reproduced with the authorization of the Musei Civici Fiorentini.

Elementi painted by Christofano Gherardi. Lagenaria gourds and various types of melons appear in the borders of the Joseph tapestries, executed between 1545 and 1553, and there may even be a Cucurbita pepo squash nestled in the upper right border in the tapestry of Joseph fleeing Potiphar’s wife. This tapestry was woven in 1549 by the w ­ orkshop of Nicolas Karcher after a design by Bronzino, possibly with the assistance of Alessandro Allori for the borders (Godart 2015). C.  Prospero Fontana Isabella Dalla Ragione (2009) studied frescoes and archives from Renaissance palaces of noble families in Umbria, and described some of the many beautiful paintings of plants painted by Cristofano Gherardi in the Castello Bufalini in San Giustino and by Prospero Fontana in the Palazzo Vitelli a Sant’Egidio Amid abundant Lagenaria gourd foliage in Fontana’s frescoes from 1571 to 1574, we can see large, round, and flattened gourds of the ‘Corsican’ type; however, some of the fruits are light blue with distinct furrows, suggesting that they might be C. maxima (Fig. 9.17). Fontana was one of the many painters who worked for the

344

Alice K. Formiga and James R. Myers

Fig. 9.17.  Cucurbita maxima in fresco by Prospero Fontana and collaborators in the Loggia of the Palazzina al Giardino, Palazzo Vitelli a Sant’Egidio, Città di Castello (1571–1574). Photo credit: Emilio Tremolada.

naturalist Ulisse Aldrovandi, and it has been proposed that Aldrovandi’s associations with artists around Bologna led to a more scientific style of painting natural objects (Rosenberg et al. 2010). VII.  CUCURBITA MAXIMA IN BOTANICAL PAINTINGS Ulisse Aldrovandi commissioned paintings of natural objects to enhance his famous “theater of nature” museum in Bologna. There, he amassed over 18,000 samples of plants, animals, minerals, and fossils, as well as herbarium specimens, paintings, and engraved blocks for printing. Aldrovandi was very curious about New World plants and animals, specimens of which he obtained from his many correspondents, and had a large collection of books about the New World. In 1569, he tried unsuccessfully to convince Philip II of Spain to sponsor an expedition in which he hoped to learn about the plants and animals at first hand, to document their history, and to have them painted from life (Olmi 1992). Aldrovandi’s collection contains two paintings of C. maxima

Images and Descriptions of Cucurbita maxima in Western Europe

(a)

345

(b)

Fig. 9.18.  Cucurbita maxima in paintings commissioned by Ulisse Aldrovandi between 1570 and 1600. A. Cucurbita peregrina alba fructo pondere 60 librarum. nd. Vol. 3 ­Piante, fiore, frutti 138. B: Cucurbita peregrina alba maior seu Cucurbita Indica Mathioli florida. nd. Vol. 3, 145. © Alma Mater Studiorum. Università di Bologna– Biblioteca Universitaria di Bologna.

(Fig.  9.18A andB). The first is a large and blue‐grey pumpkin, with 10 lobes divided by furrows and a distinct non‐angular corky peduncle. The second has smaller blue‐grey fruits and rounded leaf margins. Aldrovandi labeled these blue pumpkins as Cucurbita peregrina (meaning “foreign cucurbit”), unlike the many examples of what are clearly C. pepo in his collection, which are mostly labeled C. indica, or in one case C. nostra urbana. The term Cucurbita peregrina differs from the label on his herbarium specimen (C. alia) received from Ghini, which does not correspond with any of the paintings in the collection; possibly, Cucurbita peregrina is Aldrovandi’s own name for the species. There are other collections of botanical paintings from the 16th and early 17th centuries such as those of Georg Oellinger (1553) and Conrad Gessner (1555–1565), the Libri Picturati associated with Carolus Clusius and St. Omer from the 1560s (de Koning et al. 2008), and the Hortus Eystettensis by Basilius Besler (1613). All of these contain various types of New World cucurbits, but there are no C. maxima.

346

Alice K. Formiga and James R. Myers

VIII.  CUCURBITA MAXIMA IN GENRE PAINTINGS AND STILL LIFES By the late 16th century, New World cucurbits were no longer rarities to be shown off by the nobility, but had become common staple foods of peasants. They appeared in market, farm, and kitchen scenes in which they were associated with peasants, along with sex and gluttony. They were meant to convey moral messages in northern Europe or to reinforce class differences in Italy (McTighe 2004). Many C. pepo, as well as Lagenaria gourds and melons, appear in late 16th and early 17th century market scenes by artists such as Vincenzo Campi, Bartolomeo Passarotti, Joachim Beuckelaer, Pieter Aertsen, and Nathaniel Bacon. They also feature in still‐life paintings such as several of Giuseppe Arcimboldo’s composite portraits, in which they play both poetic and humorous roles (Kaufmann 2009), and Caravaggio’s Still Life Fruit on a Stone Ledge, in which they have literary and sexual connotations (Von Lates 2010). C. pepo occasionally appears in opulent still‐life paintings that included ripe vegetables and fruit, such as those of Frans Snyders and Adriaen van Utrecht. However, many other still‐life paintings of fruit from this period show melons more than pumpkins, often split open to reveal their seeds. Some of these melons, especially the cantaloupes with protruding pericarp and bumpy skin can easily be mistaken for and have been misidentified as C. maxima varieties such as ‘Marina di Chioggia’ or ‘Berettina’; however, their tendency to split open, thin stems, tapering stem ends, small seeds, and juicy flesh as well as their placement among other sweet fruits, point to their identification as melons. Artists who painted these melons in still lifes of fruit include Michele Pace del Campidoglio (Fig. 9.19), Giovanni Paolo Castelli, Willem van Aelst, Abraham Brueghel, Giovan Battista Ruoppolo, Giovanni Stanchi, and many others. Melons with a similar shape and rind were available in Europe through the late 19th century, as illustrated, for example, by Pierre Joseph Jacquin (1832, Plate XV). Cultivars available today that may be similar are “heirloom” cantaloupes such as the ‘Zatta’ or ‘Melone Rospa’ (Agricoltura Regione Emilia‐Romagna 2016), ‘Noir de Carmes’, or ‘Prescott’. Other than the examples below, however, C. maxima are for the most part absent from genre painting and still life, suggesting that the plant may have been less widely available than C. pepo, especially in northern Europe (Paris 2007). C. maxima takes longer to mature than C. pepo, and might not have matured in time in colder regions if it was direct‐seeded; however, it stores longer over the winter. Farm and market scenes in art were not prevalent everywhere, however, so it is impossible to draw conclusions about whether particular vegetables were present in an area simply based upon their painted presence or absence (Zeven and Brandenburg 1986).

Images and Descriptions of Cucurbita maxima in Western Europe

347

Fig. 9.19.  Michele Pace del Campidoglio. Still Life with Figure. c. 1660. Photography by Erik Gould. Courtesy of the Museum of Art, Rhode Island School of Design, Providence, USA.

A.  Willem Kalf Green and red‐orange streaked and bright orange C. maxima were depicted in paintings by and attributed to the Dutch painter Willem Kalf or his imitators, executed during his stay in Paris, France, between c. 1639 and 1646 (Fig. 9.20A and B). Many of Kalf’s barn and kitchen scenes show similar pumpkins, along with a large yellow pear‐shaped squash (probably C. pepo), among other vegetables associated with peasants. Kalf’s C. maxima are large and round, and some are slightly compressed. These are the earliest examples we know of paintings of C. maxima in France. B.  Giovanna Garzoni Two paintings by Giovanna Garzoni, who worked for the Medicis both in Florence from 1642 to 1651 and in Rome from 1652 to 1662, depict several C. maxima types (Fig. 9.21A and B). The first painting (­ Tongiorgi Tomasi and Hirschauer 2002) shows a large flattened round, furrowed blue

348

(a)

Alice K. Formiga and James R. Myers

(b)

Fig. 9.20.  A. Willem Kalf, Dutch (1619–1693); Peasant Interior with Woman at a Well, c.1642–1643; oil on panel; 10 × 8 1/4 inches; Saint Louis Art Museum, Museum Purchase 93:1947. Image courtesy of the Saint Louis Art Museum. B. Willem Kalf. Untidy interior. 1640–1650 oil on wood, 17 × 13 cm, Museum Bredius, The Hague.

(a)

(b)

Fig. 9.21.  Cucurbita maxima in paintings by Giovanna Garzoni. A. Zucche. nd. Private Collection. In Tongiorgi Tomassi and Hirschauer (2002), p. 86. B. Zucche. nd. Private Collection. In Casale (1996), p. 17. C. maxima is on the right.

and orange C. maxima, and a non‐angular stem, similar to the ones in Kalf’s paintings. The second painting portrays a light blue C. maxima with ridged and warty skin, with a surface like that of various contemporary heirloom varieties from northern Italy, next to a large, orange, pear‐shaped squash that may be C. moschata or C. pepo. Garzoni supplemented her

Images and Descriptions of Cucurbita maxima in Western Europe

(a)

349

(b)

Fig. 9.22.  Cucurbita maxima in paintings by Bartolomeo Bimbi. A. Zucca del giardino granducale di San Francesco a Pisa (1711). Museo di Storia Naturale, Firenze. B. Zucca dei monaci di Monteoliveto (1714). © Museo di Storia Naturale‐sezione Botanica, ­Università di Firenze, Italia.

income by making and selling copies of her own paintings while she was living in Rome and Casale (1996) dates this painting from that period. These paintings provide evidence of the continued presence of light blue C. maxima varieties in mid‐17th century Italy. Other than these examples, which are confined to Italy and France, there are very few paintings showing C. maxima until the late 18th century. Among the exceptions are two paintings by Bartolomeo Bimbi, who worked in Tuscany for Francesco II and Cosimo III de Medici. Completed in 1711 and 1714, they display giant blue lobed C. maxima, part of a series of paintings of giant and extravagantly productive vegetables and fruit (Fig. 9.22A and B). IX.  Conclusion and Future Prospects There are few written and artistic records of what can definitely be identified as Cucurbita maxima in Europe in the 16th and 17th centuries. Table  9.1 summarizes when and where the earliest descriptions and depictions that can reliably be identified as C. maxima appeared in Europe—at least, until additional examples are discovered. Based on these examples, we can tentatively postulate that the available C. maxima in 16th century Europe were spherical or oblate, with blue‐green, light grey‐blue, or white smooth or furrowed fruit, and they seem to have been more common in Italy than in Northern European countries at that time. While it is possible that C. maxima were brought to Europe from eastern South America by the second decade of the 16th

350

Alice K. Formiga and James R. Myers

Table 9.1.  Earliest European Cucurbita maxima descriptions and depictions. Form of evidence

Artist/Source/Reference

Date

Fresco

Giovanni da Udine in Villa Farnesina? Rome (Caneva 1992; Janick and Paris 2006) Francesco Salviati, Sala delle Udienze, Palazzo Vecchio, Florence Herbarium of Ulisse Aldrovandi, Bologna Matthias de L’Obel, Stirpium Historia, Antwerp (Whitaker 1947; Eisendrath 1961) Collection of Ulisse Aldrovandi, Bologna Barn and kitchen paintings by Willem Kalf, Paris Giovanna Garzoni, Rome

1515–1517

Fresco Herbarium specimen Engraving and description in herbal Botanical painting Genre painting Still life painting

1543–1545 1551 1576 1558–1590 1639–1646 1652–1662

century, it is difficult to be certain of this on the basis of the frescoes in the Villa Farnesina and the Loggia of Raphael due to the possibility that they depict other species. There is more evidence of C. maxima in Europe after the conquest of Peru. The 17th century saw the addition of flattened, round, slightly ribbed fruit with marbled green to orange rind, as well as warted fruits, and there are more mentions of its presence in France. Because of the lack of depictions of pumpkins and squash in paintings in many areas, and the uneven distribution of surviving botanical literature around Europe, it is not possible to make sweeping conclusions about the geographical diffusion of this species based on art and botanical literature alone. The authors hope that this article will stimulate further discovery and observations of additional examples of C. maxima in European works and paintings. Future archaeological and genetic studies could reveal more about the pre‐Columbian range of Cucurbita maxima, especially in Eastern South America. Further research into the genetic relationships of Cucurbita maxima varieties, landraces, and herbarium specimens in South America, Europe, and other continents could also shed more light on the diversity and relationships within this fascinating species and its travels around the world. ACKNOWLEDGMENTS The authors gratefully acknowledge the many museums, libraries, botanic gardens, auction houses, and publishers who generously provided photographs and permission to use images for this article; photographers William Singer and Emilio Tremolada; Carol H. Krinsky for editing and encouragement; and the anonymous reviewers for their comments and suggestions.

Images and Descriptions of Cucurbita maxima in Western Europe

351

LITERATURE CITED Acosta, J. 1590. Historia Natural y Moral de las Indias. Ioan de Leon, Seville. p. 245. Adelung, J.C. 1780. Versuch eines vollständigen grammatisch‐kritischen Wörterbuches der Hochdeutschen Mundart: mit beständiger Vergleichung der übrigen Mundarten, besonders aber der oberdeutschen. Vierter Theil. Johann Gottlob Immanuel Breitkopf, Leipzig. p. 1105. Agricoltura Regione Emilia‐Romagna. 2016. Melone rospa. Agrobiodiversità e cultura rurale, Emilia‐Romagna Agricoltura e Pesca. http://agricoltura.regione.emilia-romagna.it/ agrobiodiversita/doc/schede-specie-vegetali/orticole/melone-rospa/view Bambach, C.C., J. Cox‐Rearick, and G.R. Goldner. 2010. The drawings of Bronzino. Metropolitan Museum of Art, New York, New Haven and London. p. 256. Bauhin, J., and J.H. Cherler. 1651. Historia plantarum universalis, vol. 2. Ebroduni. p. 221–222. Bellorini, C. 2016. The world of plants in Renaissance Tuscany: Medicine and botany. Taylor and Francis, Brookfield. Besler, Basilius. 1613. Hortus Eystettensis. Nürnberg. Bock, H. 1539. New Kreutter Buch von underscheydt, wiirckung und namen der Kreutter, so in Teutschen Landen wachsen. Rihel, Strasbourg. Bock, H. 1546. Kreuter Buch. Rihel, Strasbourg. Bonnefons, N. 1651. Le jardiner François, Traicte II. P. Des‐Hays, Paris. p. 117. Bonomo, M., F.J. Aceituno, G.G. Politis, and M.L. Pochettino. 2011. Pre‐Hispanic horticulture in the Paraná Delta (Argentina): Archaeological and historical evidence. World Archaeology 43:554–575. Buek, J.N. 1779. Verzeichniss von in‐und ausländischen Bäumen und Sträuchern, Pflanzen und Samen, so zu bekommen bei Johann Nicolaus Buek wohnhaft bei Dammthor am Walle nebst Anmerkungen über Wachsthum, Wartung und Wärme nach ihrem Vaterlande und unserem Himmelstrich. Foerster, Bremen. p. 168. Caneva, G. 1992. Il mondo di Cerere nella Loggia di Psiche: Villa La Farnesina, sede dell’Accademia nazionale dei Lincei. Fratelli Palombi, Rome. Caneva, G., and G.M. Carpaneto. 2010. Raffaello e l’immaginazione della natura. La raffigurazione del mondo naturale nelle decorazioni delle Logge Vaticane. Silvana, Cinisello Balsamo, Milan. Casale, G. 1996. Gli incanti dell’ iride: Giovanna Garzoni pittrice nel seicento. Silvana, Firenze. p. 17, 20. Castetter, E.F. 1925. Horticultural groups of cucurbits. Proc. Am. Soc. Hort. Sci. 22: 338–340. Colobig, M. de los Milagros, and F.V. Ottalagano. 2016. Estudio arqueobotánico de los residuos orgánicos adheridos en alfarerías prehispánicas de la cuenca del Paraná medio. Arqueología 22:193–210. Cornero, S., and L. Rangone. 2015. Análisis arqueobotánicos en sitios de la entidad arqueológica Goya‐Malabrigo ubicados en el centro‐norte de Santa Fe. Anuario de Arqueologia, Rosario 7:85–94. Corteletti, R., R. Dickau, P. DeBlasis, and J. Iriarte. 2015. Revisiting the economy and mobility of southern proto‐Jê (Taquara‐Itararé) groups in the southern Brazilian highlands: starch grain and phytoliths analyses from the Bonin site, Urubici, Brazil. J. Arch. Sci. 58:46–61. Dacos, N. 1969. Présents américains a la Renaissance: l’assimilation de l’exotisme. Gazette des beaux‐arts 73:60–62.

352

Alice K. Formiga and James R. Myers

Dacos, N. 2008. The loggia of Raphael: A Vatican art treasure. Abbeville Press, New York. p. 14. Dalla Ragione, I. 2009. Tenendo innanzi frutta: vegetali coltivati, descritti e dipinti tra ‘500 e ‘700 nell’Alta Valle del Tevere (Beholding natural fruits: Vegetables in cultivations, writings and paintings in the Upper Tiber Valley, from the 16th to the 18th century). Petruzzi, Città di Castello, Perugia. de Koning J., G. van Uffelen, A. Zemanek, and B.E. Zemanek. 2008. Drawn after nature: The complete botanical watercolours of the 16th century Libri Picturati. KNNV, Zeist. p. 18–19. Decker‐Walters, D.S., and T. Walters. 2000. In K.F. Kiple and K.C. Omelas (eds.), The Cambridge world history of food, vol. 1. Cambridge University Press, Cambridge. Digital Loggia Interactive System. 2017. Designed and developed by the Visual Computing Lab of the Instituto di Scienza e Tecnologie dell’Informazione, CNR di Pisa with the Accademia Nazionale dei Lincei for the Exhibition Colours of Prosperity: Fruits from the Old and New World: The Loggia of Cupid and Psyche. Rome. April 20–July 20, 2017. http://vcg.isti.cnr.it/farnesina/. Duchesne, A.N. 1786. Essai sur l’histoire naturelle des courges. C.J. Pancouke, Paris. Excerpted in H.S. Paris. 2007. The drawings of Antoine Nicolas Duchesne for his natural history of the gourds. Les dessins d’Antoine Nicolas Duchesne pour son histoire naturelle des courges. Muséum National d’Histoire Naturelle, Paris. Duchesne, A.N. 1793. Courge, Cucurbita. In A.H. Tessier and A. Thouin. Encyclopédie méthodique: Agriculture 3. Panckoucke, Paris. p. 606. Eisendrath, E.R. 1961. Portraits of plants. A limited study of the ‘icones’. Annals of the Missouri Botanical Garden 48:291–327. Esteras, C., A. Sifres, F. Nuez, and B. Picó. 2009. Variabilidad de Cucurbita maxima en su zona de origen: un recurso de interés para la mejora de esta hortaliza. Acta no. 54. VI Congreso Ibérico de Ciencias Hortícolas and XII Congreso Nacional de Ciencias Hortícolas. Ferriol, M., B. Pico, P.F. de Cordova, and F. Nuez. 2004. Molecular diversity of a germplasm collection of squash determined by SRAP and AFLP Markers. Crop Science 44:653–664. Ferriol, M., and B. Pico. 2008. Pumpkin and winter squash. p. 317–349. In: J. Prohens and F. Nuez (eds.), Vegetables I, vol. 1. Springer, New York. Fuchs, L. 1542. De historia stirpium commentarii insignes. In officina Isingriniana. p. 698. Gessner, C. 1555–1565. Historia plantarum. Universitätsbibliothek Erlangen‐Nürnberg MS 2386. Plate 367v. Godart, L. (ed.) 2015. Il principe dei sogni: Giuseppe negli arazzi medicei di Pontormo e Bronzino. Skira, Milano. p. 205–207. Goldman, A. 2002. Melons for the passionate grower. Artisan, New York. Goldman, A. 2004. The compleat squash. Artisan. New York. Goldoni, C. 1760. Le baruffe chiozzotte. Reprint: Milan, Bur, 2010. Hayward, H.E. 1938. The structure of economic plants. Macmillian Co., New York. Hyman, M., and Hyman, P. 2005. From milk soup to truffled raviolis: Contrasted uses of a singular vegetable. p. 70–83. In: A. Jacobsohn (ed.), L’épopée des courges: cultures et consommations en Europe; exposition au Potager Du Roi Du 9 Septembre au 9 Octobre 2005. Ecole Nationale Supérieure du Paysage, Versailles. p. 72. Iriarte, J. 2007. New perspectives on plant domestication and the development of agriculture in the New World. p. 167–188. In: T. Denham, L. Vrydaghs, and J. Iriarte (eds.) Rethinking agriculture: archaeological and ethnoarchaeological perspectives. Routledge, London. Iriarte, J., I. Holst, O. Marozzi, et al. 2004. Evidence for cultivar adoption and emerging complexity during the mid‐Holocene in the La Plata basin. Nature 432:614–617.

Images and Descriptions of Cucurbita maxima in Western Europe

353

Jacobsohn, A. (ed.) 2005a. L’épopée des courges: cultures et consommations en Europe; exposition au Potager du Roi du 9 Septembre au 9 Octobre 2005. Ecole Nationale Supérieure du Paysage, Versailles. Jacobsohn, A. 2005b. Summer squash, winter squash: classification, selection and the spread of vegetable varieties in France from the 16th to the 20th century. p. 84–101. In: A. Jacobsohn (ed.), L’épopée des courges: cultures et consommations en Europe; exposition au Potager du Roi du 9 Septembre Au 9 Octobre 2005. Ecole Nationale Supérieure du Paysage, Versailles. p. 88. Jacobsohn, A., and M. Pluvinage. 2006. Des “grosses productions” de Jean‐Baptiste de La Quintinie (17 e siècle) au concours du potiron le plus gros: construire l’histoire et valoriser un patrimoine végétal avec les potagers historiques. Agropolis Museum, Montpelier. Jacquin, M. 1832. Monographie complète du melon. Rousselon, Paris. Plate XV. Janick, J., and G. Caneva. 2005. The first images of maize in Europe. Maydica 50:71–80. Janick, J., and H.S. Paris. 2006. The cucurbit images (1515–1518) of the Villa Farnesina, Rome. Annals of Botany 97:165–176. Kaufmann, T.D. 2009. Arcimboldo: visual jokes, natural history, and still‐life painting. University of Chicago Press, Chicago. p. 92. Kux, H. 1982. 1515 New zeutung aus pressilandt. Estudos Germânicos 3:83–96. 10.17851/0101‐837X.3.1.83‐96 L’Obel, M. de. 1576. Plantarum seu stirpium historia. Cui annexum est adversariorum volumen. Plantinus, Antwerp. p. 365. La Quintinie. J.B. de. 1690. Instruction pour les jardins fruitiers et potagers: avec un traité des orangers, suivy de quelques réflexions sur l’agriculture. Claude Barbin, Paris. p. 398. L’Obel, M. de. 1576. Plantarum seu stirpium historia. Cui annexum est adversariorum volumen. Plantinus, Antwerp. p. 365. Lorello, I.M., S.C. García Lampasona, M.A. Makuch, and I.E. Peralta. 2016. Caracterización morfo‐agronómica de poblaciones de zapallo criollo (Cucurbita maxima Duch.) colectadas en los valles andinos de la Argentina. Agriscientia 33: 46–59. Lust, T.A., and H.S. Paris. 2016. Italian horticultural and culinary records of summer squash (Cucurbita pepo, Cucurbitaceae) and emergence of the zucchini in 19th‐century Milan. Ann. Bot. 118:53–69. Madero, E. 1892. Historia del puerto de Buenos Aires. Imp. La Nación, Buenos Aires. p. 345, 355. Markey, L. 2016. Imagining the Americas in Medici Florence. Pennsylvania State University Press, University Park, PA. Martínez, A.B.‐L., V.S. Lema, S.I. Perez, and F.L. Anido. 2017. Pedúnculos y pericarpios de Cucurbita maxima Duch: un aporte para la reconstrucción del proceso de domesticación del zapallo criollo en el noroeste Argentino. Etnobiologia 15:74–89. Masseti, M., and C. Veracini. 2010. The first record of Marcgrave’s capuchin in Europe: South American monkeys in Italy during the early sixteenth century. Archives of Natural History 37:91–101. McTighe, S. 2004. Foods and the body in Italian genre paintings, about 1580: Campi, Passarotti, Carracci. The Art Bulletin 86:301–323. Medina, J.T. 1908. El veneciano Sebastián Caboto, al servicio de España y especialmente de su proyectado viaje á las Molucas por el estrecho de Magallanes y al reconocimiento de la costa del continente hasta la gobernación de Pedrarias Dávila. Impr. y encuadernación universitaria, Santiago de Chile. p. 195. Millán, R. 1947. Los zapallitos de tronco de Sudamérica extratropical. Darwiniana 7:333–345. Naccari, F.L. 1826. Flora Veneta o descrizione delle piante che nascono nella provincia di Venezia, vol. 1. Bonvecchiato, Venezia. p. 52.

354

Alice K. Formiga and James R. Myers

Naudin, C. 1856. Nouvelles recherches sur les caractères spécifiques et les variétés des plantes du genre Cucurbita. Annales des sciences naturelles, 4e sér. Botanique vi:5–73. Nee, M. 1990. The domestication of Cucurbita (Cucurbitaceae). Economic Botany 44:56–68. Nova, A. 1992. Salviati, Vasari, and the reuse of drawings in their working practice. Universität Heidelberg Forschungsprojekt, Arbeitsgemeinschaft. Einzelpersonen. OECD. 2012. Consensus document on the biology of Cucurbita L. (squashes, pumpkins, zucchinis and gourds). In: Series on Harmonisation of Regulatory Oversight in Biotechnology ENV/JM/MONO(2012)31. Presented at the Environment Directorate: Joint Meeting of the Chemicals Committee and the Working Party on Chemicals, Pesticides and Biotechnology, OECD (Organisation for Economic Co‐operation and Development), Paris. Oellinger, G. 1553. Magnarum medicinae partium herbariae et zoographiae imagines. Universitätsbibliothek Erlangen‐Nürnberg. MS 2362. Olmi, G. 1992. L’inventario del mondo: catalogazione della natura e luoghi del sapere nella prima età moderna. Soc. Ed. Il Mulino, Bologna. p. 41. Ott, C. 2012. Pumpkin: The curious history of an American icon. University of Washington Press, Seattle and London. p. 14, 21. Paris, H.S. 2000. Paintings (1769–1774) by AN Duchesne and the history of Cucurbita pepo. Annals of Botany 85:815–830. Paris, H.S. 2001. History of the cultivar‐groups of Cucurbita pepo. Horticultural Reviews 25:71–170. Paris, H.S. 2007. The drawings of Antoine Nicolas Duchesne for his natural history of the gourds. Les dessins d’Antoine Nicolas Duchesne pour son histoire naturelle des courges. Muséum National d’Histoire Naturelle, Paris. Paris, H.S. 2015. Origin and emergence of the sweet dessert watermelon, Citrullus lanatus. Annals of Botany 116:133–148. Paris, H.S. 2016. Overview of the origins and history of the five major cucurbit crops: Issues for ancient DNA analysis of archaeological specimens. Vegetation History and Archaeobotany 25:405–414. Paris, H.S., M.‐C. Daunay, M. Pitrat, and J. Janick. 2006. First known image of Cucurbita in Europe, 1503–1508. Annals of Botany 98:41–47. Parkinson, J. 1640. Theatrum botanicum. T. Cotes, London. p. 770. Parodi, L.R. 1935. Agricultura prehispánica. Universidad Nacional de Jujuy, San Salvador de Jujuy. p. 142, 155. Plenck, J.J. nd. Courgette and a pumpkin. Fitzwilliam Museum, Cambridge. Posey, D.A., and M.J. Balick. 2006. Human impacts on Amazonia: The role of traditional ecological knowledge in conservation and development. Columbia University Press, New York. p. 7. Ravelli, L., and R. Signorini. 2004. La zucca nella natura morta dal cinquecento al novecento: atti del II convegno sulla zucca, Rocca di Reggiolo, 14 Settembre 2003. Sometti, Mantova. p. 56. Rosenberg, C.M., E. Welch, and G. Bertini. 2010. The court cities of northern Italy, Milan, Parma, Piacenza, Mantua, Ferrara, Bologna, Urbino, Pesaro, and Rimini. Cambridge University Press, Cambridge. p. 290. Rowland, I.D. 2005. The roman garden of Agostino Chigi: The thirteenth Gerson Lecture held in memory of Horst Gerson (1907–1976) in the aula of the University of Groningen on the 17th of November, 2005. The Gerson Lectures Foundation, Groningen. Sanjur O.I., D.R. Piperno, T.C. Andres, and L. Wessel‐Beaver. 2002. Phylogenetic relationships among domesticated and wild species of Cucurbita (Cucurbitaceae) inferred from a

Images and Descriptions of Cucurbita maxima in Western Europe

355

mitochondrial gene: Implications for crop plant evolution and areas of origin. Proceedings of the National Academy of Sciences of the United States of America 99:535–540. Sgamellotti, A., and Caneva, G. (eds.) 2017. Colours of prosperity: fruits from the Old and New World. The Loggia of Cupid and Psyche: Raphael and Giovanni da Udine. April 20th–July 20th, 2017. Bardi Edizioni, Rome. Signorini, M.A. 2015. Frutti e ortaggi nelle nature morte italiane. Repertorio ad uso di studiosi e appassionati d’arte. Fondazione di studi di storia dell’arte Roberto Longhi. Firenze. p. 11–13. Soderini, G. nd. Il trattato della cultura degli orti e giardini di Giovanvettorio Soderini. Reprint: Le opere de Gio. Vettorio Soderini, vol. II. Società Tip. Mareggiani, Bologna, 1903. p. 214–215, 408–409. Soldano, A. 2007. Il primo botanico italiano. p. 49–52. In: A. Alessandrini and A. Ceregato (eds.), Natura picta: Ulisse Aldrovandi. Compositori, Bologna. Tanara, V. 1651. L’economía del cittadino in villa libri VII. Eredi del Dozza, Bologna. p. 291. Teppner, H. 2004. Notes on Lagenaria and Cucurbita (Cucurbitaceae): Review and new contributions. Phyton 44:245–308 and 258‐260. Tongiorgi Tomasi, L. 2001. The study of the natural sciences and botanical and zoological illustrations in Tuscany under the Medicis from the sixteenth to the eighteenth centuries. Archives of Natural History 28:179–193. Tongiorgi Tomasi, L., and G.A. Hirschauer. 2002. The flowering of Florence: botanical art for the Medici. National Gallery of Art, Washington, DC. p. 86. Tournefort, J.P. de. 1694. Elemens de Botanique, ou méthode pour connoître les Plantes. De L’Imprimerie Royale, Paris. vol. 1, p. 88–89. vol. II, Plate 34. Tournefort, J.P. de. 1719. Institutiones rei herbariae. E. Typographia Regia, Paris. vol. 1, p. 106. Trelles, M.R. 1879. Diego García, primer descubridor del Rio de la Plata. Imprenta del Porvenir, Buenos Aires. p. 35, 40. Ubriszy Savoia, A. 1992–1993. Le piante pisane nei manoscritti di Aldrovandi. Museologia Scientifica 9: 363–380. Ubriszy Savoia, A. 1993. Le piante americane nell’erbario di Ulisse Aldrovandi. Webbia 48:579–598. Veracini, C. 2017. Nonhuman primate trade in the age of discoveries: European importation and its consequences. p.147–171. In: Environmental History in the Making, Series 7. Springer, Switzerland. Verbrugge, J.C. Règne Végétal. Plantes et Légumes, vol.1, folio 9. nd. (before 1831). ­Citrouille mojienne, nomée le Pâté ou Bonnet Turq. From an album of watercolor illustrations drawn by Pierre Ledoulx, Mrs. J.F. Duq and Jean Verbrugghe. Royal Horticultural Society Lindley Library Art Collections. Vilmorin, P.V.L. de, and P. Andrieux. 1783. Vilmorin‐Andrieux, Paris. Vilmorin‐Andrieux, MM. 1885. The vegetable garden. Reprint: Ten Speed Press, Berkeley, California. 1981. p. 342. von Dieskau, C.J.F. 1784. Vorteile in der Gärtnerey, vol. 4. Rudolph August Wilhelm, Coburg. p. 213–224. von Lates, A. 2010. Caravaggio in the garden of Priapus: the academic, semiotic and poetic contexts of still life with fruit on a stone ledge. In: A.H. de Groft (ed.), Caravaggio: Still life with fruit on a stone ledge: From the Symposium held at the Muscarelle Museum of Art at the College of William and Mary, November 9–10, 2006. Muscarelle Museum of Art, The College of William and Mary, Williamsburg, VA. von Martens, G.M. 1824. Reise nach Venedig von Georg v. Martens. Erster Teil. Stettin’sche Buchhandlung, Ulm. p. 311–313.

356

Alice K. Formiga and James R. Myers

von Martens, G.M. 1844. Italien: in drei Bänden, vol. 2. Scheible, Rieber und Gattler, Stuttgart. p. 148–149. Whipkey A., and J. Janick. 2018. The festoons of the Cupid and Psyche loggia in the Villa Farnesina in Rome: An interactive database. https://hort.purdue.edu/newcrop/udine/ default.html. Whitaker, T.W. 1947. American origin of cultivated cucurbits. Annals of the Missouri Botanical Garden 34:101–111. Whitaker, T.W., and G.W. Bohn. 1950. The taxonomy, genetics, production and uses of the cultivated species of Cucurbita. Economic Botany 4:52–81. Zanotti, A.L. 2018. Meloni, Zucche e ditorni. Breve note sulle Cucurbitaceae. Botanical recognition. Fondazione Federico Zeri, University of Bologna. http://www.fondazionezeri. unibo.it/en/photo-archive/zeri-photo-archive/still-life-painting/botanical-recognition. Zeven, A.C., and W.A. Brandenburg. 1986. Use of paintings from the 16th to 19th centuries to study the history of domesticated plants. Economic Botany 40:397–408.

Cumulative Contributor Index (Volumes 1–43) Abbo, S., 39:325 Abbott, A.G., 27:175 Abdalla, O.S., 8:43; 37;35 Acquaah, G., 9:63 Agarwal, P., 40:167 Aldwinckle, H.S., 1:294; 29:315; 39:379 Alexander, D.E., 24(1):5 Ali, A.M., 39:23 Aljadi, M., 42:219 Álvarez, M.F., 38:17 Anderson, N.O., 10:93; 11:11 Andersson, M.S., 36:169 Anuradha, K., 39:89 Aronson, A.I., 12:19 Aruna, R., 30:295 Arús, P., 27:175 Ascher, P.D., 10:9 Ashby, J., 43:243 Ashok Kumar, A., 31:189; 39:89 Ashri, A., 16:179 Atlin, G.N., 34:83 Babu, R., 34:83 Baddu‐Apraku, B., 37:123 Badenes, M.L., 37:259 Bado, S., 39:23 Baggett, J.R., 21:93 Bajic, V., 33:31 Balaji, J., 26:171 Baltensperger, D.D., 19:227; 35:247 Balyan, H.S., 36:85; 40:167 Barbosa, M., 38:185 Barker, T., 25:173 Bartels, D., 30:1 Basnizki, J., 12:253 Bassett, M.J., 28:239

Becerra‐López‐Lavalle, L.A., 36:427 Beck, D.L., 17:191 Beebe, S., 23:21‐72; 36:357 Beineke, W.F., 1:236 Bell, A.E., 24(2):211 Below, F.E., 24(1):133 Berrío, L., 38:185 Bertin, C. 30:231 Bertioli, D.J., 30:179 Berzonsky, W.A., 22:221 Bhat, S.R., 31:21; 35:19 Bhatnagar‐Mathur, P., 36:293 Bingham, E.T., 4:123; 13:209 Binns, M.R., 12:271 Bird, R. McK., 5:139 Birru, F.H., 39:199 Bjarnason, M., 9:181 Blair, M.W., 26:171; 30:179; 36:169; 38:17 Blanco, P., 38o:185 Bliss, F.A., 1:59; 6:1 Boase, M.R., 14:321 Boerboom, M.L., 39:199 Bohnert, H.J., 38:67 Bomfin Fernandes, N.N., 40:235 Bonnecarrere, V., 38:18o5 Bonnett, D., 37:35 Borlaug, N.E., 5:1 Bosland, P.W., 39:283 Boyer, C.D., 1:139 Bravo, J.E., 3:193 Brennan, R., 32:1 Brenner, D.M., 19:227 Breseghello, F., 38:185; 42:1 Bressan, R.A., 13:235; 14:39; 22:389; 38:67 Bretting, P.K., 13:11 Brewbaker, J.L., 39:135; 40:43

Plant Breeding Reviews, Volume 43, First Edition. Edited by Irwin Goldman. © 2020 John Wiley & Sons, Inc. Published 2020 by John Wiley & Sons, Inc. 357

358 Brewer, L., 42:219 Broertjes, C., 6:55 Brown, A.H.D., 21:221 Brown, J.W.S., 1:59 Brown, S.K., 9:333, 367 Buhariwalla, H.K., 26:171 Bünger, L., 24(2):169 Burnham, C.R., 4:347 Burton, G.W., 1:162; 9:101 Burton, J.W., 21:263 Butler, N.M., 41:55 Butruille, D.V., 39:199 Byrne, D., 2:73 Callahan, A.M., 40:299 Camadro, E.L., 26:105 Camargo, I., 38:185 Campbell, K.G., 15:187 Campos, H., 25:173 Cantrell, R.G., 5:11 Cardinal, A.J., 30:259 Carey, E., 43:1 Cargill, E.J., 39:199 Carputo, D., 25:1; 26:105; 28:163 Carracelas, G., 38:185 Carvalho, A., 2:157 Casas, A.M., 13:235 Castro, A., 38:185 Ceballos, H., 36:427 Cervantes‐Martinez, C.T., 22:9 Chandler, M.A., 34:131 Chatel, M., 38:185 Chen, J., 23:245 Cherry, M., 27:245. Chew, P.S., 22:165 Chinnusamy, V., 38:67 Choo, T.M., 3:219; 26:125 Chopra, V.L., 31:21 Christenson, G.M., 7:67 Christie, B.R., 9:9 Christinck, A., 43:243 Clark, J.R., 29:19 Clark, M.D., 43:31 Clark, R.L., 7:95 Clarke, A.E., 15:19 Clegg, M.T., 12:1 Clément‐Demange, A., 29:177 Clevidence, B.A., 31:325 Cogeshall, M.V., 41:263 Colley, M., 42:87 Comstock, J.G., 27:15

Cumulative Contributor Index Condon, A.G., 12:81 Conicella, C., 28:163 Conner, A.J., 34:161 Consiglio, F., 28:163 Cooper, M, 24(2):109; 25:173 Cooper, R.L., 3:289 Cornu, A., 1:11 Correa‐Victoria, F., 38:185 Corredor, E., 38:185 Costa, W.M., 2:157 Cregan, P., 12:195 Crouch, J.H., 14:267; 26:171; 36:1 Crow, J.F., 17:225 Cruz, M., 38:185 Cummins, J.N., 1:294 da Silva, J., 42:1 Dambier, D. 30:323 Dana, S., 8:19 Dardick, C., 40:299 Das, B., 34:83 Davis, D.A., 39:199 Dawson, J.C., 41:215; 42:87 De Groote, H., 34:83 De Jong, H., 9:217 Dean, R.A., 27:213 Dedicova, B., 38:185 Dekkers, J.C.M., 24(1):311 Deroles, S.C., 14:321 Dhariwal, R., 40:167 Dhillon, B.S., 14:139 Dhillon, N.P.S., 35:85 D’Hont, A., 27:15 Dhungana, P., 39:199 Diao, X., 35:247 Dias, J.S., 35:151 Dickmann, D.I., 12:163 Diepenbrock, C.H., 42:1 Dill Jr., G.M., 39:199 Ding, H., 22:221 Dirlewanger, E., 27:175 Dodds, P.N., 15:19 Dodson‐Swenson, H., 43:215 Dolan, D., 25:175 Dong, F., 39:199 Donini, P., 21:181 Dowswell, C., 28:1 Doyle, J.J., 31:1 Draper, A.D., 2:195 Drew, R., 26:35 Dudley, J.W. 24(1):79

Cumulative Contributor Index Duitama, J., 38:185 Dumas, C., 4:9 Duncan, D.R., 4:153 Duvick, D.N., 24(2):109 Dwivedi, S.L., 26:171; 30:179; 33:31l; 35:247; 36:169; 38:141; 41:1 Ebert, A.W., 30:415 Echt, C.S., 10:169 Edmeades, G., 25:173 Ehlers, J.D., 15:215 England, F., 20:1 Eubanks, M.W., 20:15 Evans, D.A., 3:193; 5:359 Everett, L.A., 14:237 Ewart, L.C., 9:63 Fakorede, M.A.B., 37:123 Farquhar, G.D., 12:81 Fasoula, D.A., 14:89; 15:315; 18:177 Fasoula, V.A., 13:87; 14:89; 15:315; 18:177; 37:297 Fasoulas, A.C., 13:87 Fazio, G., 39:379 Fazuoli, L.C., 2:157 Fear, C.D., 11:1 Ferris, R.S.B., 14:267 Finn, C.E., 29:19 Flore, J.A., 12:163 Fonseca, A.E., 39:199 Formiga, A., 43:317 Forsberg, R.A., 6:167 Forster, B.P., 25:57; 39:23 Forster, R.L.S., 17:191 Fowler, C., 25:21 Frederick, H., 39:89 Frei, U. K., 23:175; 40:123 French, D.W., 4:347 Friedman, H., 43:61 Friesen, D.K., 28:59; 34:83 Froelicher, Y. 30:323 Frusciante, L., 25:1; 28:163 Fuentes, F.F., 42:257 Fukunaga, K., 35:247 Funk, D., 38:185 Gahlaut, V., 36:85; 40:167 Gai, J., 21:263 Galiba, G., 12:115 Galletta, G.J., 2:195 Gao, Y., 33:115

359 Garaycochea, S., 38:185 Garcia‐Mas, J., 35:85 Gardunia, B.W., 39:199 Gehring, C., 33:31 Gepts, P., 24(2):1 Glaszmann, J.G., 27:15 Gmitter, F.G., Jr., 8:339; 13:345 Gold, M.A., 12:163 Goldman, I.L. 19:15; 20:67; 22:357; 24(1):61; 24(2):89; 35:1; 40:271; 41:291 Goldway, M., 28:215 Gomez‐Pando, L.R., 42:257 Gonsalves, D., 26:35 Goodnight, C.J., 24(1):269 Gopher, A., 39:325 Gordon, S.G., 27:119 Gosman, N., 37:35 Gradziel, T.M., 15:43; 37:207; 40:235 Graham, G.I., 39:1 Grando, S., 39:89 Grenier, C., 38:185 Gressel, J., 11:155; 18:251 Gresshof, P.M., 11:275 Griesbach, R.J., 25:89 Griffin, W.B., 34:161 Grombacher, A.W., 14:237 Grosser, J.W., 8:339 Grumet, R., 12:47 Gudin, S., 17:159 Guimarães, C.T., 16:269 Gul, A., 42:1 Gupta, P.K., 33:145; 36:1; 40:167 Gustafson, J.P., 5:41; 11:225 Guthrie, W.D., 6:209 Habben, J., 25:173 Haley, S.D., 22:221 Hall, A.E., 10:129; 12:81; 15:215 Hall, H.K., 8:249; 29:19; 32:1, 39 Hallauer, A.R., 9:115; 14:1,165; 24(2):153 Hamblin, J., 4:245 Hancock, J.F., 13:1 Hancock, J.R., 9:1 Hanna, W.W., 13:179 Harlan, J.R., 3:1 Harris, M.O., 22:221 Harris‐Schultz, K., 42:119 Hasegawa, P.M. 13:235; 14:39; 22:389 Hash, C., 35:247 Hashimoto Freitas, D.Y., 40:235

360 Havey, M.J., 20:67; 42:39 Hayes, P.M., 43:95 Haytowitz, D.B., 31:325 Healy, G.K., 41:215 Heffner, E.L., 42:1 Henny, R.J., 23:245 Hershey, C., 36:427 Hill, W.G., 24(2):169 Hillel, J., 12:195 Hjalmarsson, I., 29:145 Hoa, T.T.T., 29:177 Hodgkin, T., 21:221 Hokanson, S.C., 21:139; 31:277 Holbrook, C.C., 22:297 Holden, J.M., 31:325 Holland, G.J., 39:199 Holland, J.B., 21:27; 22:9; 33:1, 39:1 Hong, N., 39:199 Hor, T.Y., 22:165 Howe, G.T., 27:245 Hummer, K., 32:1, 39 Hunt, L.A., 16:135 Hutchinson, J.R., 5:181 Hymowitz, T., 8:1; 16:289 Iraçu Gindri Lopes, S., 38:185 Isaacs, K., 43:243 Ishitani, M., 38:185 Isidro Sanchez, J., 42:1 Iván Ortiz‐Monasterio, J., 28:39 Jackson, S.A., 33:257 Jain, A., 29:359 Jaiswal, V. 40:167 Jamieson, A.R., 32:39 Janick, J., 1:xi; 23:1; 25:255; 37:259, 40:1 Jansky, S., 19:77; 41:169 Jarvis, D.E., 42:257 Jayaram, Ch., 8:91 Jayawickrama, K., 27:245 Jellen, E.N., 42:257 Jenderek, M.M., 23:211 Jespersen, D., 42:119 Jiang, J., 41:55 Jifon, J., 27:15 Johnson, A.A.T., 16:229; 20:167 Johnson, G.R., 27:245 Johnson, R., 24(1):293 Jones, A., 4:313 Jones, J.S., 13:209

Cumulative Contributor Index Joobeur, T., 27:213 Ju, G.C., 10:53 Kang, H., 8:139 Kann, R.P., 4:175 Kapazoglou, A., 30:49 Karmakar, P.G., 8:19 Kartha, K.K., 2:215, 265 Kasha, K.J., 3:219 Kaur, H., 30:231 Kazi, A.G., 37:35 Keep, E., 6:245 Keightley, P.D., 24(1):227 Kirti, P.B., 31:21 Kissing Kucek, L., 42:1 Kleinhofs, A., 2:13 Kloppenburg, J.R., 40:271 Knox, R.B., 4:9 Koebner, R.M.D., 21:181 Kollipara, K.P., 16:289 Koncz, C., 26:1 Kononowicz, A.K., 13:235 Konzak, C.F., 2:13 Kovačević, N.M., 30:49 Krikorian, A.D., 4:175 Krishnamani, M.R.S., 4:203 Kronstad, W.E., 5:1 Kuehnle, A.R., 28:125 Kulakow, P.A., 19:227 Kulwal, P.L., 36:85 Kumar, A., 33:145; 40:167 Kumar, J., 33:145 Kumari, S., 40:167 La Rota, M., 42:1 Lagoda, P.J.L., 39:23 Lagudah, E.S., 37:35 Laimer, M., 39:23 Lamb, R.J., 22:221 Lambert, R.J., 22:1; 24(1):79:153 Lamborn, C., 21:93 Lamkey, K.R., 15:1; 24(1):xi; 24(2):xi; 31:223 Lavi, U., 12:195 Layne, R.E.C., 10:271 Lebowitz, R.J., 3:343 Lee, E.A., 34:37 Lee, M., 24(2):153 Lehmann, J.W., 19:227 Lenski, R.E., 24(2):225

Cumulative Contributor Index Lev‐Yadun, S., 39:325 Levings, III, C.S., 10:23 Lewers, K.R., 15:275 Li, J., 17:1,15 Li, Y. 43:321 Liang, G.L, 37:259 Liedl, B.E., 11:11 Lin, C.S., 12:271 Lin, S., 37:259 Linnen, P., 39:199 Liu, Z., 40:123 Lockwood, D.R., 29:285 Lorieux, M., 38:185 Lovell, G.R., 7:5 Low, J.W., 43:1 Lower, R.L., 25:21 Lübberstedt, T., 40:123 Luby, C.H. 40:271 Lukaszewski, A.J., 5:41 Luro, F., 30:323 Lyrene, P.M., 5:307; 30:353 Maas, J. L., 21:139 Mackenzie, S.A., 25:115 Maggio, A., 38:67 Maheswaran, G., 5:181 Maizonnier, D., 1:11 Maleki, S., 38:141 Malnoy, M., 29:285 Manoel Colombari Filho, J., 38:185 Marcotrigiano, M., 15:43 Martin, A., 38:185 Martin, F.W., 4:313 Martin, I., 39:125 Martinez, C.P., 38:185 Martinez‐Gómez, P., 37:207 Martínez, S., 38:185 Matanguihan, J.B, 42:257 Matsumoto, T.K. 22:389 Maughan, P.J., 42:257 May, G.D., 33:257 McCoy, T.J., 4:123; 10:169 McCreight, J.D., 1:267; 16:1; 35:85 McDaniel, R.G., 2:283 McGrath, J.M., 42:167 McKeand, S.E., 19:41 McKenna, J.R., 41:263 McKenzie, R.I.H., 22:221 McRae, D.H., 3:169 Medina‐Filho, H.P., 2:157

361 Mei, M., 40:123 Meintz, B., 43:95 Mejaya, I.J., 24(1):53 Michler, C.H., 33:305 Mikkilineni, V., 24(1):111 Miles, D., 24(2):211 Miles, J.W., 24(2):45 Miller, R., 14:321 Minella, E., 42:1 Ming, R., 27:15; 30:415 Mir, R.R., 33:145 Mirkov, T.E., 27:15 Mobray, D., 28:1 Molina, F., 38:185 Mondragon Jacobo, C., 20:135 Monforte, A.J., 35: 85 Monti, L.M., 28:163 Moose, S.P., 24(1):133 Morgan, E.R., 34:161 Morrison, R.A., 5:359 Mosquera, G., 38:185 Mosquera, T., 38:117 Mowder, J.D., 7:57 Mroginski, L.A., 2:215 Mudalige‐Jayawickrama, 28:125 Muir, W.M., 24(2):211 Mujeeb‐Kazi, A., 37:35 Mumm, R.H., 24(1):1 Munkvold, J.D., 42:1 Murphy, A.M., 9:217 Murphy, J.P., 39:1 Murphy, K.M., 42:257 Mutschler, M.A., 4:1 Myers, J.R., 21:93; 42:219; 43:317 Myers, O., Jr., 4:203 Myers, R.L., 19:227. Namkoong, G., 8:1 Narro León, L.A., 28:59 Nassar, N.M.A., 31:248; 40:235 Navazio, J., 22:357 Nelson, P.T., 33:1 Neuffer, M.G., 5:139 Newbigin, E., 15:19 Nickson, T.E., 29:199 Nielen, S., 30:179; 39:23 Nigam, S.N., 30:295; 36:293 Nikki Jennings, S. 32:1, 39 Nybom, H., 34:221 Nyquist, W.E., 22:9

362 Ogbonnaya, F.C., 37:35 Ohm, H.W., 22:221 Ollitrault, P., 30:323 O’Malley, D.M., 19:41 Ortiz, R., 14:267; 16:15; 21:1; 25:1, 139; 26:171; 28:1, 39; 30:179; 31:248; 33:31; 35:151; 38:141; 41:291 Osborn, T.C., 27:1 Ozias‐Akins, P., 38:141 Palacios, N., 34:83 Palmer, R.G., 15:275, 21:263; 29:1; 31:1 Pandey, S., 14:139; 24(2):45; 28:59; 35:85 Panella, L., 42:167 Pardo, J.M., 22:389 Parliman, B.J., 3:361 Pataky, J.K., 39:199 Paterson, A.H., 14:13; 26:15; 42:1 Patrick, R.M., 42:321 Patterson, F.L., 22:221 Peairs, F.B., 22:221 Pedersen, J.F., 11:251 Peiretti, E.G., 23:175 Peixoto, O., 38:185 Peloquin, S.J., 26:105 Perdue, R.E., Jr., 7:67 Pérez de Vida, F., 38:185 Peterson, P.A., 4:81; 8:91 Pfeiffer, W.H., 36:169; 39:89 Pickering, R., 34:161 Pitrat, M., 35:85 Pixley, K.V., 34:83 Polavarapu, N., 39:199 Polidoros, A.N., 18:87; 30:49 Pollak, L.M., 31:325 Popy, J., 39:199 Porter, D.A., 22:221 Porter, R.A., 14:237 Powell, W., 21:181 Prakash, S., 31:21; 35:19 Prasad, M., 35:247 Prasada Rao, J.D.V.J., 36:293 Prasartsee, V., 26:35 Pratt, R.C., 27:119 Pretorius, Z.A., 31:223 Priyadarshan, P.M., 29:177 Puppala, N., 38:141 Quiros, C.F., 31:21

Cumulative Contributor Index Raghothama, K.G. 29:359 Rai, K.N., 36:169 Rai, M. 27:15 Raina, S.K. 15:141 Rajaram, S. 28:1 Rakow, G., 18:1 Ramage, R.T. 5:95 Ramaiah, B., 39:89 Ramash, S., 31:189 Ramesh, S. 25:139 Ramming, D.W. 11:1 Ratcliffe, R.H., 22:221 Rattunde, F., 43:243 Rattunde, W., 39:89 Raupp, W.J., 37:1 Ray, D.T., 6:93 Reddy, B.V.S., 25:139; 31:189 Redei, G.P., 10:1; 24(1):11 Reimann‐Phillipp, R., 13:265 Reinbergs, E., 3:219 Reitsma, K.R., 35:85 Ren, J.; 40:123 Reynolds, M.P., 28:39 Rhodes, D., 10:53 Richards, C.M., 29:285 Richards, R.A., 12:81 Riedeman, E.S., 34:131 Roath, W.W., 7:183 Robertson, L., 34:1 Robinson, R.W., 1:267; 10:309 Robinson, T.L., 39:379 Rochefored, T.R., 24(1):111 Rodrigo, G., 38 :185 Ron Parra, J., 14:165 Roos, E.E., 7:129 Rosas, J., 38:185 Ross, A.J., 24(2):153 Rossouw, J.D., 31:223 Rotteveel, T., 18:251 Rowe, P., 2:135 Russell, W.A., 2:1 Rutkoski, J., 42:1 Rutter, P.A., 4:347 Ryder, E.J., 1:267; 20:105 Sahi, S.V., 2:359 Sahrawat, K.L., 36:169 Samaras, Y., 10:53 Sanjana Reddy, P., 31:189 Sansavini, S., 16:87

Cumulative Contributor Index Santra, D., 35:247 Sapir, G., 28:215 Saunders, J.W., 9:63 Savidan, Y., 18:13 Sawhney, R.N., 13:293 Saxena, K.B., 41:103 Schaap, T., 12:195 Schaber, M.A., 24(2):89 Schneerman, M.C., 24(1):133 Schnell, R.J., 27:15 Schroeck, G., 20:67 Schussler, J., 25:173 Scorza, R., 40:299 Scott, D.H., 2:195 Seabrook, J.E.A., 9:217 Sears, E.R., 11:225 Seebauer, J.R., 24(1):133 Selvaraj, M. 38:185 Senior, M.L., 39:1 Senthilvel, S., 36:247 Serraj, R., 26:171 Shands, Hazel L., 6:167 Shands, Henry L., 7:1, 5 Shannon, J.C., 1:139 Shanower, T.G., 22:221 Sharma, A., 35:85 Sharma, D., 41:103 Sharma, K.K., 36:293 Shattuck, V.I., 8:217; 9:9 Shaun, R., 14:267 Shrinivasan, C., 40:299 Shuler, S.L., 43:215 Sidhu, G.S., 5:393 Silva, da, J., 27:15 Silva, H.D., 31:223 Simchen, G., 38:1 Simmonds, N.W., 17:259 Simon, P.W., 19:157; 23:211; 31:325 Singh, B.B., 15:215 Singh, P.K., 35:85 Singh, R.J., 16:289 Singh, S.P., 10:199 Singh, Z., 16:87 Slabbert, M.M., 19:227 Sleper, D.A., 3:313 Sleugh, B.B., 19 Smith, J.S.C., 24(2):109 Smith, K.F., 33:219 Smith, S., 43:121 Smith, S.E., 6:361

363 Snoeck, C., 23:21 Sobral, B.W.S., 16:269 Socias i Company, R., 8:313 Soh, A.C., 22:165 Sondahl, M.R., 2:157 Sorrells, M.E., 37:35 Souza, E., 42:1 Spooner, D.M., 41:169 Spoor, W., 20: 1 Srinivasan, G., 40:1 Stafne, E.T., 29:19 Stalker, H.T., 22:297; 30:179 Stark, S.B., 39:199 Steadman, J.R., 23:1 Steffensen, D. M., 19:1 Stern, R.A., 28:215 Stevens, M.A., 4:273 Stoner, A.K., 7:57 Stuber, C.W., 9:37; 12:227 Stupar, R., 41:55 Subudhi, P., 33:31 Sugiura, A., 19:191 Sun, H., 21:263 Suzaki, J.Y., 26:35 Tai, G.C.C., 9:217 Talbert, L.E., 11:235 Tan, C.C., 22:165 Tani, E., 30:49 Tarn, T.R., 9:217 Tehrani, G., 9:367 Teshome, A., 21:221 Tew, T.L., 27:15 Thomas, W.T.B., 25:57 Thompson, A.E., 6:93 Thro, A.M., 34:1 Thudi, M., 33:257 Tiefenthaler, A.E., 24(2):89 Till, B.J., 39:23 Timmerman‐Vaughan, G.M., 34:161 Tohme, J., 38:185 Tollenaar, M., 34:37 Torres, E.A., 38:185 Towill, L.E., 7:159, 13:179 Tracy, W.F., 14:189; 24(2):89; 34:131; 43:215 Trampe, B., 40:123 Trethowan, R.M., 28:39 Tripathi, S., 26:35 Troyer, A.F., 24(1):41; 28:101

364 Tsaftaris, A.S., 18:87; 30:49 Tsai, C.Y., 1:103 Tsujimoto, H., 37:35 Twumasi‐Afriyie, S., 34:83 Tyagi, S., 40:167 Ullrich, S.E., 2:13 Upadhyaya, H.D., 26:171; 39:179; 33:31; 35:247 Uribelarrea, M., 24(1):133 Vales, M.I., 41:103 Van Deynze, A., 42:1 Van Ginkel, M. 34:297 Van Harten, A.M., 6:55 Van Oosten, M.J., 38:67 Vanderleyden, J., 23:21 Varshney, R.K., 33:257 Varughese, G., 8:43 Vasal, S.K., 9:181; 14:139 Vasconcelos, M.J., 29:359 Vega, F.E., 30:415 Vegas, A., 26:35 Veilleux, R., 3:253; 16:229; 20:167; 33:115 Venkatachalam, P., 29:177 Villareal, R.L., 8:43 Virk, P., 39:89 Vivak, B., 34:83 Vogel, K.P., 11:251 Volk, G.M., 23:291; 29:285 Vorsa, N., 43:279 Vuylsteke, D., 14:267 Wallace, B., 29:145 Wallace, D.H., 3:21; 13:141 Walsh, B. 24(1):177 Wan, Y., 11:199 Wang, W., 37:259 Wang, Y., 40:123 Wang, Y.‐H., 27:213 Waters, C., 23:291 Weber, C.A., 32:39 Weber, K., 24(1):249 Weeden, N.F., 6:11 Wehner, T.C., 6:323 Weising, K., 34:221 Welander, M., 26:79 Weltzien, E., 43:243 Wenzel, G. 23:175 Weston, L.A. 30:231 Westwood, M.N., 7:111

Cumulative Contributor Index Wheeler, N.C., 27:245 Whitaker, T.W., 1:1 Whitaker, V.M., 31:277 White, D.W.R., 17:191 White, G.A., 3:361; 7:5 Widholm, J.M., 4:153; 11:199 Widmer, R.E., 10:93 Widrlechner, M.P., 13:11 Wilcox, J.R., 1:183 Williams, E.G., 4:9; 5:181, 237 Williams, M.E., 10:23 Williamson, B., 32:1 Wilson, J.A., 2:303 Woeste, K.E., 33:305 Wong, G., 22:165 Woodfield, D.R., 17:191 Worthen, L.M., 33:305 Wright, D., 25:173 Wright, G.C., 12:81 Wu, K.‐K., 27:15 Wu, L., 8:189 Wu, R., 19:41 Wu, X.‐M. 35:19 Xin, Y., 17:1 Xu, S., 22:113 Xu, S.S., 37:35 Xu, Y., 15:85; 23:73 Yamada, M., 19:191 Yamamoto, T., 27:175 Yan, W., 13:141 Yang, W.‐J., 10:53 Ye, G., 33:219; 34:297 Yonemori, K., 19:191 Yopp, J.H., 4:203 Yu, L.‐X., 42:1 Yu, Y.‐K., 42:1 Yun, D.‐J., 14:39 Zalapa, J. 43:279 Zeng, Z.‐B., 19:41 Zhang, Z., 37:259 Zhengqiang, M., 42:1 Zhu, J.‐K., 38:67 Zhu, L.‐H., 26:79 Zimmerman, M.J.O., 4:245 Zinselmeier, C., 25:173 Zitter, T.A., 33:115 Zohary, D., 12:253 Zorrilla de San Martin, G., 38:185 Zystro, J., 42:87

Cumulative Subject Index (Volumes 1–43) Adaptation: blueberry, rabbiteye, 5:351–352 durum wheat, 5:29–31 genetics, 3:21–167 raspberry, 32:53–54, 153–184 testing, 12:271–297 Aglaonema breeding, 23:267–269 Alexander, Denton, E. (biography), 22:1–7 Alfalfa: honeycomb breeding, 18:230–232 inbreeding, 13:209–233 in vitro culture, 2:229–234 somaclonal variation, 4:123–152 unreduced gametes, 3:277 Allard, Robert W. (biography), 12:1–17 Allelopathy, 30:231–258 Allium cepa, see Onion Alliums transgenics, 35:210–213 Almond: breeding, 37:207–258 breeding self‐compatible, 8:313–338 domestication, 25:290–291; 39:342–344 transformation, 16:103 Alocasia breeding, 23:269 Alstroemaria, mutation breeding, 6:75 Amaranth: breeding, 19:227–285 cytoplasm, 23:191 genetic resources, 19:227–285 Andrade, Maria Isabel (biography), 43:1–30 Aneuploidy: alfalfa, 10:175–176 alfalfa tissue culture, 4:128–130 petunia, 1:19–21

wheat, 10:5–9 Animals, long term selection, 24(2): 169–210, 211–234 Anther culture: cereals, 15:141–186 maize, 11:199–224 Anthocyanin : maize aleurone, 8:91–137 pigmentation, 25:89–114 Anthurium breeding, 23:269–271 Antifungal proteins, 14:39–88 Antimetabolite resistance, cell selection, 4:139–141, 159–160 Apomixis: breeding, 18:13–86 genetics, 18:13–86 reproductive barriers, 11:92–96 rice, 17:114–116 Apple: domestication, 25:286–289 fire blight resistance, 29:315–358 genetics, 9:333–366 patents, 41:307 rootstock breeding, 1:294–394; 39:379–424 transformation, 16:101–102 Apricot: domestication, 25:291–292 transformation, 16:102 Arabidopsis, 32:114–123 Arachis, see Peanut Artichoke breeding, 12:253–269 Association genetics, 38:17–66 Association mapping, see Association genetics Avena sativa, see Oat

Plant Breeding Reviews, Volume 43, First Edition. Edited by Irwin Goldman. © 2020 John Wiley & Sons, Inc. Published 2020 by John Wiley & Sons, Inc. 365

366 Avocado domestication, 25:307 Azalea, mutation breeding, 6:75–76 Bacillus thuringensis, 12:19–45 Bacterial diseases: apple rootstocks, 1:362–365 cell selection, 4:163–164 cowpea, 15:238–239 fire blight, 29:315–358 maize, 27:156–159 potato, 19:113–122 raspberry, 6:281–282; 32:219–221 soybean, 1:209–212 sweet potato, 4:333–336 transformation fruit crops, 16:110 Bacteria, long‐term selection, 24(2):225–265 Banana: breeding, 2:135–155 domestication, 25:298–299 transformation, 16:105–106 Barley: anther culture, 15:141–186 breeding methods, 5:95–138 diversity, 21:234–235 doubled haploid breeding, 15:141–186 gametoclonal variation, 5:368–370 haploids in breeding, 3:219–252 molelcular markers, 21:181–220 photoperiodic response, 3:74, 89–92, 99 vernalization, 3:109 Bean (Phaseolus): breeding, 1:59–102; 10:199–269; 23:21–72; 36:357–426 breeding (tropics), 10:199–269 breeding mixtures, 4:245–272 heat tolerance, 10:149 in vitro culture, 2:234–237 long‐term selection, 24(2):69–74 photoperiodic response, 3:71–73, 86–92; 16:102–109 protein, 1:59–102 rhizobia interaction, 23:21–72 seed color genetics, 28:239–315 Beet (table) breeding 22:357–388 (sugar) breeding, 42:167–201 Beta, see Beet and Sugarbeet Biochemical markers, 9:37–61 Biography: Alexander, Denton E., 22:1–7

Cumulative Subject Index Allard, Robert W., 12:1–17 Andrade, Maria Isabel, 43:1–30 Bliss, Frederick A., 27:1–14 Borlaug, Norman E., 28:1–37 Brewbaker, James L., 40:1–42 Bringhurst, Royce S., 9:1–8 Burton, Glenn W., 3:1–19 Coyne, Dermot E., 23:1–19 Daubeny, H. A., 32:21–37 Downey, Richard K., 18:1–12 Draper, Arlen D., 13:1–10 Dudley, J.W., 24(1):1–10 Duvick, Donald N., 14:1–11 Frey, Kenneth, J. 34:1–36 Gabelman, Warren H., 6:1–9 Gill, Bikram, 37:1–34 Goodman, Major M., 33:1–29 Hallauer, Arnel R., 15:1–17 Harlan, Jack R., 8:1–17 Hymowitz, Theodore, 29:1–18 Jahn, Margaret, M., 35:1–17 Janick, Jules, 41:291–360 Jennings, D., 32:2–21 Jones, Henry A., 1:1–10 Laughnan, John R. 19:1–14 Munger, Henry M., 4:1–8 Ortiz, Rodomiro, 36:1–84 Peloquin, Stanley J., 25:1–19 Rédei, George, P., 26:1–33 Ryder, Edward J., 16:1–14 Salamini, Francesco, 30:1–47 Sears, Ernest Robert, 10:1–22 Simmonds, Norman W., 20:1–13 Sorrells, Mark E., 42:1–38 Sprague, George F., 2:1–11 Stuber, Charles W., 39:1–22 Upadhyaya, Hari Deo, 41:1–54 Vogel, Orville A., 5:1–10 Vuylsteke, Dirk R., 21:1–25 Weinberger, John H., 11:1–10 Yuan, Longping, 17:1–13 Zohary, Daniel. 38:1–16 Biotechnology: Cucurbitaceae, 27:213–244 Douglas‐fir, 27:331–336 politics, 25:21–55 Rosaceae, 27:175–211 Birdsfoot trefoil, tissue culture, 2:228–229 Blackberry, 8:249–312, 29:19–144 mutation breeding, 6:79 Black walnut:

Cumulative Subject Index biology, 41:268–271 breeding, 1:236–266; 41:263–290 heritable traits, 41:274–276 host plant resistance, 41:277–278 plot management, 41:281–283 propagation, 41:279–280 Bliss, Frederick A. (biography), 27:1–14 Blueberry: breeding, 5:307–357;13:1–10; 30:353–414 domestication, 25:304 highbush, 30:353–414 rabbiteye, 5:307–357 Borlaug, Norman, E.(biography), 28:1–37 Brachiaria, apomixis, 18:36–39, 49–51 Bramble (see Blackberry, Raspberry): domestication, 25:303–304 transformation, 16:105 Brassicaceae: incompatibility, 15:23–27 molecular mapping, 14:19–23 Brassica, see Cole crops carinata 35:57–65 cytogenetics, 31:21–187 domestication, 35:19–84 evolution, 31:21–87; 35:19–84 history, 35:19–84 juncea, 35:58–65 napus, 35:65–67, see Canola, Rutabaga nigra, 35:38–41 oleracea, 35:41–45 rapa,35:51–47, see also Canola transgenics:35:199–205 Breeding: Aglaonema, 23:267–269 alfalfa via tissue culture, 4:123–152 allelopathy, 30:231–258 alliums, 35:210–213 almond, 8:313–338, 37:207–258 Alocasia, 23:269 amaranth, 19:227–285 apomixis, 18:13–86 apple, 9:333–366 apple fire blight resistance, 29:315–358 apple rootstocks, 1:294–394; 39:379–424 association genetics, 38:17–66 banana, 2:135–155 barley, 3:219–252; 5:95–138; 26:125–169; 43:95–120 bean, 1:59–102; 4:245–272; 23:21–7; 36:357–426

367 beet (table), 22:357–388 biochemical markers, 9:37–61 blackberry, 8:249–312; 29:19–144 black walnut, 1:236–266 blueberry, 5:307–357; 30:353–414 brassicas, 35:19–84, 199–205 bromeliad, 23:275–276 cactus, 20:135–166 Calathea, 23:276 carbon isotope discrimination, 12:81–113 carrot, 19:157–190, 35:219–220 cassava, 2:73–134; 31:247–275, 35:216 cell selection, 4:153–173 cereal stress resistance, 33:115–144 chestnut, 4:347–397; 33:305–339; 36:427–503 chili pepper, 39:283–323 chimeras, 15:43–84 chrysanthemum, 14:321–361 citrus, 8:339–374; 30:323–352 coffee, 2:157–193; 30:415–447 coleus, 3:343–360 competitive ability, 14:89–138 cotton, 37:322–327 cowpea, 15:215–274, 35:215 cranberry, 43:281–320 cucumber, 6:323–359 Cucurbitaceae 27:213–244 cucurbits, 27:213–244; 35:196–199 currant, 29:145–175 cytoplasmic DNA, 12:175–210 diallel analysis, 9:9–36 Dieffenbachia, 23:271–272 doubled haploids, 15:141–186; 25:57–88, 40:123–166 Dougas‐fir, 27:245–253 Dracaena, 23:277 drought tolerance, maize, 25:173–253 durum wheat, 5:11–40 eggplant, 35:187–191 Epepremnum, 23:272–273 epigenetics, 30:49–177; 38:67–140 epistasis, 21:27–92 exotic maize, 14:165–187 fern, 23:276 fescue, 3:313–342 Ficus, 23:276 fire blight resistance, 29:315–358 flavour, 41:215–262

368 Breeding: (cont’d) flower color, 25:89–114 foliage plant, 23:245–290 forest tree, 8:139–188 fruit crops, 25:255–320 garlic, 6:81; 23:11–214 gender differences, 43:245–273 gene action 15:315–374 genotype x environment interaction, 16:135–178 gooseberry, 29:145–175 grain legumes, 33:157–304 grape, 43:31–60 grapefruit, 13:345–363 grasses, 11:251–274 guayule, 6:93–165 heat tolerance, 10:124–168 Hedera, 23:279–280 herbicide‐resistant crops, 11:155–198 heritability, 22:9–111 heterosis, 12:227–251 homeotic floral mutants, 9:63–99 honeycomb, 13:87–139; 18:177–249 human nutrition, 31:325–392 hybrid, 17:225–257 hybrid wheat, 2:303–319; 3:169–191 induced mutations, 2:13–72 insect and mite resistance in cucurbits, 10:199–269 isozymes, 6:11–54 legumes, 26:171–357; 33:157–304 lettuce, 16:1–14; 20:105–133; 35:205–210 leucaena, 40:43–121 loquat, 37:259–296 maize, 1:103–138, 139–161; 4:81–122; 9:181–216; 11:199–224; 14:139– 163, 165–187, 189–236; 25:173– 253; 27:119–173; 28:59–100; 31:223–245; 33:9–16; 34:37–182, 83–113, 131–160; 37:123–205, 327–335, 40:123–166 marker‐assisted selection, 33:145–217, 219–256; 34:247–358; 39:199–282 meiotic mutants, 28:163–214 melon, 35:85–150 millets, 35:247–374 mitochondrial genetics, 25:115–238 molecular markers, 9:37–61, 10:184– 190; 12:195–226; 13:11–86;

Cumulative Subject Index 14:13–37, 17:113–114, 179, 212–215; 18:20–42; 19:31–68; 21:181–220, 23:73–174; 24(1):293– 309; 26:292–299; 31:210–212, 33:145–217, 219–256; 34:247–348; 35:332–344 mosaics, 15:43–84 mushroom, 8:189–215 mutation, 39:23–87 naked barley, 43:95–120 negatively associated traits, 13:141–177 nutrition enhancement, 36:169–211 oat, 6:167–207 oil palm, 4:175–201; 22:165–219 onion, 20:67–103; 35:210–213 open source, 40:271–298 orange fleshed sweet potato, 43:1–30 ornamental transgenesis, 28:125–216 palms, 23:280–281 papaya, 26:35–78 participatory, 42:96–97 pasture legumes, 5:237–305 peanut, 22:297–356; 30:295–322; 36:293–356; 38:141–183 pear fire blight resistance, 29:315–358 pearl millet, 1:162–182 pea, snap, 212:93–138 perennial rye, 13:265–292 persimmon, 19:191–225 Philodendron, 23:2 phosphate efficiency, 29:394–398 plantain, 2:150–151; 14:267–320; 21:211–25 potato, 3:274–277; 9:217–332; 16:15–86; 19:59–155, 25:1–19; 35:191–196 prognosis, 37:297–347 proteins in maize, 9:181–216 quality protein maize (QPM), 9:181–216 quinoa, 42:279–301 rapid cycling, 40:299–334 raspberry, 6:245–321; 32:1–37, 39–53 recurrent restricted phenotypic selection, 9:101–113 recurrent selection in maize, 9:115–179; 14:139–163 rice, 17:15–156; 23:73–174; 38:185–275 rol genes, 26:79–103 Rosaceae, 27:175–211 rose, 17:159–189; 31:227–334 rubber (Hevea), 29:177–283

Cumulative Subject Index rutabaga, 8:217–248 sensory, 41:215–262 sesame, 16:179–228 snap pea, 21:93–138 somatic hybridization, 20:167–225 sorghum drought tolerance, 31:189–222 sorghum fortification,39:89–122 sorghum male sterility, 25:139–172 soybean, 1:183–235; 3:289–311; 4:203–243; 21:212–307; 30:250– 294; 37:315–322 soybean fatty acids, 30:259–294 soybean hybrids, 21:212–307 soybean nodulation, 11:275–318 soybean recurrent selection, 15:275–313 spelt, 15:187–213 statistics, 17:296–300 strawberry, 2:195–214 stress resistance, 37:123–30 sugarcane, 16:272–273; 27:15–158 supersweet sweet corn, 14:189–236 sweet cherry, 9:367–388 sweet corn, 1:139–161; 14:189–236; 35:213–215; 43:217–235 sweet corn, tropical, 39:125–198 sweet potato, 4:313–345; 35:217–218; 43:1–30 Syngonium, 23:274 tomato, 4:273–311 transgene technology, 25:105–108 triticale, 5:41–93; 8:43–90 turfgrasses, 42:121–122 vegetable crop transgenics, 35:151–246 Vigna, 8:19–42 virus resistance, 12:47–79 wheat, 2:303–319; 3:169–191; 5:11–40; 11:225–234; 13:293–343, 28:1–37, 39–78; 36:85–165; 37:11–24, 35–122; 40:167–234 Wheat, N & K efficiency, 40:167–234 wheat, rust resistance, 13:293–343 white clover, 17:191–223 wild relatives, 30:149–230 wild rice, 14:237–265 Brewbaker, James L, (biography), 40:1–42 Bringhurst, Royce S. (biography), 9:1–8 Broadbean, in vitro culture, 2:244–245 Bromeliad breeding, 23:275–276 Brown, Anthony, H.D. (biography), 31:1–20 Burton, Glenn W. (biography), 3:1–19

369 Cactus: breeding, 20:135–166 domestication, 20:135–166 Cajanus cajan, see Pigeonpea Cajanus, in vitro culture, 2:224 Calathea breeding, 23:276 Canola, R.K. Downey, designer, 18:1–12 Capsicum annuum, see Chili pepper Carbohydrates, 1:144–148 Carbon isotope discrimination, 12:81–113 Carica papaya, see Papaya Carnation, mutation breeding, 6:73–74 Carob domestication, 39:344–346 Carrot: breeding, 19:157–190 transgenics, 35:219–220 Cassava: breeding, 2:73–134; 31:247–275 long‐term selection, 24(2):74–79 transgenics:35:216 Castanea, see Chestnut Cell selection, 4:139–145, 153–173 Cereal breeding, see Grain breeding Cereals: diversity, 21:221–261 stress resistance, 33:31–114 Chenopodium quinoa, see Quinoa Cherry, see Sweet cherry domestication, 25:202–293 Chestnut breeding, 4:347–397; 33:305–339 Chickpea, in vitro culture, 2:224–225 Chili pepper breeding, 39:283–323 Chimeras and mosaics, 15:43–84; 40:235–269 Chinese cabbage, heat tolerance, 10:152 Chromosome, petunia, 1:13–21, 31–33 Chrysanthemum: breeding, 14:321–361 mutation breeding, 6:74 Cicer, see Chickpea Citrus: breeding (seedlessness), 30:323–352 domestication, 25:296–298 protoplast fusion, 8:339–374 Clonal repositories, see National Clonal Germplasm Repository Clone identification (DNA), 34:221–295 Clover: in vitro culture, 2:240–244 molecular genetics, 17:191–223

370 Coffea arabica, see Coffee Coffee, 2:157–193; 30:415–437 Cold hardiness: breeding nectarines and peaches, 10:271–308 wheat adaptation, 12:124–135 Cole crops: Chinese cabbage, heat tolerance, 10:152 gametoclonal variation, 5:371–372 rutabaga, 8:217–248 Coleus, 3:343–360 Competition, 13:158–165 Competitive ability breeding, 14:89–138 Controlling elements, see Transposable elements Corn, see Maize; Sweet corn Cosmetic stay‐green, 42:219–250 Fabaceae, 42–229–235; 240–243 Poaceae, 42–229–231 Rutaceae, 42:240 Solanaceae, 42–236–240 Cotton: breeding, 37:322–327 heat tolerance, 10:151 Cowpea: breeding, 15:215–274 heat tolerance, 10:147–149 in vitro culture, 2:245–246 photoperiodic response, 3:99 transgenics, 35:215 Coyne, Dermot E. (biography), 23:1–19 Cranberry: cytology, 43:288–289 domestication, 25:304–305; 43:281–282 early cultivar development, 43:282–285 heritability of traits, 43:297 life history parameters, 43:285–287 linkage analysis, 43:303–308 major cultivars, 43:284 molecular markers and sequencing, 43:297–302 nuclear and organellar genome assembly, 43:302–303 taxonomy, 43:287–288 traits for breeding, 43:289–297 Crop domestication and selection, 24(2):1–44 Cryopreservation, 7:125–126, 148–151, 167 buds, 7:168–169 genetic stability, 7:125–126 meristems, 7:168–169

Cumulative Subject Index pollen, 7:171–172 seed, 7:148–151,168 Cucumber, breeding, 6:323–359 Cucumis melo, see Melon Cucumis sativus, see Cucumber Cucurbitaceae: insect and mite resistance, 10:309–360 mapping, 27:213–244 Cucurbita maxima, 43:317–350; 321–349 Cucurbita moschata, 43:317–350 Cucurbita pepo, 43:317–350 Cucurbits: identification in historical and artistic works, 43:219–349 mapping, 27:213–244 new world types, identification in historical sources, 43:319–327 new world types, presence in artistic works, 43:335–343 new world types, presence in botanical and genre paintings, 43:344–349 new world types, presence in herbals and books, 43:329–334 new world types, presence in South America, 43:327–329 new world types, terminology, 43:319 transgenics:35:196–199 Currant breeding, 29:145–175 Cybrids. 3:205–210; 20:206–209 Cytogenetics: alfalfa, 10:171–184 blueberry, 5:325–326 Brassica, 31:21–187; 35:25–36 cassava, 2:94 citrus, 8:366–370 coleus, 3:347–348 durum wheat, 5:12–14 fescue, 3:316–319 Glycine, 16:288–317 guayule, 6:99–103 maize mobile elements, 4:81–122 maize‐tripsacum hybrids, 20:15–66 meiotic mutants, 28:163–214 oat, 6:173–174 pearl millet, 1:167 perennial rye, 13:265–292 petunia, 1:13–21, 31–32 polyploidy terminology, 26:105–124 potato, 25:1–19 raspberry, 32:135–137

Cumulative Subject Index rose, 17:169–171 rye, 13:265–292 Saccharum complex, 16:273–275 sesame, 16:185–189 sugarcane, 27:74–78 triticale, 5:41–93; 8:54 wheat, 5:12–14; 10:5–15; 11:225–234; 37:1–24, 35–122 Cytoplasm: breeding, 23:175–210; 25:115–138 cybrids, 3:205–210; 20:206–209 incompatibility, 25:115–138 male sterility, 25:115–138,139–172 molecular biology of male sterility, 10:23–51 organelles, 2:283–302; 6:361–393 pearl millet, 1:166 petunia, 1:43–45 sorghum male sterility, 25:139–172 wheat, 2:308–319 Dahlia, mutation breeding, 6:75 Date palm domestication, 25:272–277; 39:338–340 Daubeny, Hugh A. (biography), 32:21–37 Daucus, see Carrot Diallel cross, 9:9–36 Dieffenbachia breeding, 23:271–272 Diospyros, see Persimmon Diploid, potato breeding, 41:179–195 Disease and pest resistance: antifungal proteins, 14:39–88 apple rootstocks, 1:358–373 banana, 2:143–147 barley, 26:135–169 blackberry, 8:291–295 black walnut, 1:251; 41:277–278 blueberry, rabbiteye, 5:348–350 cassava, 2:105–114; 31:247–275 cell selection, 4:143–145, 163–165 chestnut blight, 4:347–397; 33:305–339 chili pepper, 39:312–314 citrus, 8:347–349 coffee, 2:176–181 coleus, 3:353 cowpea, 15:237–247 durum wheat, 5:23–28 fescue, 3:334–336 herbicide‐resistance, 11:155–198 host‐parasite genetics, 5:393–433

371 induced mutants, 2:25–30 lettuce, 1:286–287 maize, 27:119–173; 31:223–245; 34:131–160; 37:123–205 melon, 35:86–150 millets, 35:247–374 ornamental transgenesis, 28:145–147 papaya, 26:161–357 peanut virus, 36:293–356 potato, 9:264–285, 19:69–155 raspberry, 6:245–321; 32:184–247 rose, 31:277–324 rutabaga, 8:236–240 soybean, 1:183–235 spelt, 15:195–198 strawberry, 2:195–214 sweet corn, tropical, 39:52–175 verticillium wilt, 33:115–144 virus resistance, 12:47–79 wheat rust, 13:293–343 Diversity: epigenetics, 38:67–140 landraces, 21:221–261 legumes, 26:171–357 maize, 33:4–7 melon, 35:85–150 millets, 35:247–374 raspberry, 32:54–58 turfgrasses, 42:129–133; 42:139–142 DNA: clone identification, 34:221–295 methylation, 18:87–176; 30:49–177 Domestication, fruit, 39:325–377 quinoa, 42:259–271 Doubled haploid breeding, 15:141–186; 25:57–88; 39:233–238; 40:123–166, 42:66–67 Douglas‐fir breeding, 27:245–353 Downey, Richard K. (biography), 18:1–12 Dracaena breeding, 23:277 Draper, Arlen D. (biography), 13:1–10 Drought resistance, see also Stress Resistance: cereals, 33:31–114 durum wheat, 5:30–31 maize, 25:173–253 sorghum, 31:189–222 soybean breeding, 4:203–243 wheat adaptation, 12:135–146; 36:85–165

372 Dudley, J.W. (biography), 24(1):1–10 Durum wheat, 5:11–40 Duvick, Donald N. (biography), 14:1–11 Eggplant transgenics:35:187–191 Elaeis, see Oil palm Embryo culture: in crop improvement, 5:181–236 oil palm, 4:186–187 pasture legume hybrids, 5:249–275 Endosperm: balance number, 25:6–7 maize, 1:139–161 sweet corn, 1:139–161 Endothia parasitica, 4:355–357 Epepremnum breeding, 23:272–273 Epigenetics, 30:49–177; 38:67–140 Epistasis, 21:27–92 Escherichia coli, long‐term selection, 24(2):225–224 Evolution: Brassica, 31:21–187 coffee, 2:157–193 domestication, 39:323–377 fruit, 25:255–320 grapefruit, 13:345–363 maize, 20:15–66 sesame, 16:189 Experimental design: alternatives in plant breeding, 42:87–117 augmented designs, 42:111 experimental designs for low‐input and participatory breeding, 42:96–97 incomplete block design, 42:97–98 partially replicated designs, 42:109–110 randomized complete block design, 42:91–96 spatial design in plant breeding, 42:106–108 Exploration, 7:9–11, 26–28, 67–94 Fabaceae, molecular mapping, 14:24–25 Fatty acid genetics and breeding, 30:259–294 Fern breeding, 23:276 Fescue, 3:313–342 Festuca, see Fescue Fig domestication, 25:281–285; 29:332–338 Fire blight resistance, 29:315–358

Cumulative Subject Index Flavonoid chemistry, 25:91–94 Flavour, see Sensory and flavour analysis Floral biology: almond, 8:314–320 blackberry, 8:267–269 black walnut, 1:238–244 cassava, 2:78–82 chestnut, 4:352–353 coffee, 2:163–164 coleus, 3:348–349 color, 25:89–114 fescue, 3:315–316 garlic:23:211–244 guayule, 6:103–105 homeotic mutants, 9:63–99 induced mutants, 2:46–50 pearl millet, 1:165–166 pistil in reproduction, 4:9–79 pollen in reproduction, 4:9–79 rapid cycling, 40:299–334 raspberry, 32:90–92 reproductive barriers, 11:11–154 rutabaga, 8:222–226 sesame, 16:184–185 sweet potato, 4:323–325 Flower: color genetics, 25:89–114 color transgenesis, 28:28–139 Foliage plant breeding, 23:245–290 Forage breeding: alfalfa inbreeding, 13:209–233 diversity, 21:221–261 fescue, 3:313–342 perennials, 11:251–274 white clover, 17:191–223 Forest crop breeding: black walnut, 1:236–266 chestnut, 4:347–397 Douglas‐fir, 27:245–353 ideotype concept, 12:177–187 leucaena, 40:43–121 molecular markers, 19:31–68 quantitative genetics, 8:139–188] rapid cycling, 40:299–334 rubber (Hevea), 29:177–283 Fragaria, see Strawberry Frey, Kenneth J. (biography), 34:1–36 Fruit, nut, and beverage crop breeding: almond, 8:313–338; 37:207–238 apple, 9:333–366

Cumulative Subject Index apple fire blight resistance, 29:315–358 apple rootstocks, 1:294–394 banana, 2:135–155 blackberry, 8:249–312; 29:19–144 blueberry, 5:307–357; 13:1–10; 30:323–414 breeding and genetics for improving postharvest quality, 43:66–68 breeding origins, 25:255–320cactus, 20:135–166 candidate genes for softening, 43:69–76 cherry, 9:367–388 chestnut, 4:347–397; 33:305–339 citrus, 8:339–374; 30:323–352 coffee, 2:157–193; 30:415–437 currant, 29:145–175 cuticle structure and shelf life, 43:68–69 domestication and origins, 25:255–320; 39:325–377 ethylene biosynthesis and ripening, 43:77–81 fire blight resistance, 29:315–358 genetic transformation, 16:87–134 gooseberry, 29:145–175 grapefruit, 13:345–363 ideotype concept, 12:175–177 incompatability, 28:215–237 loquat, 37:259–296 melon, 35:85–150 mutation breeding, 6:78–79 nectarine (cold hardy), 10:271–308 origins &domestication, 25:255–320; 39:325–377 papaya, 26:35–78 peach (cold hardy), 10:271–308 pear fireblight resistance, 29:315–358 persimmon, 19:191–225 plantain, 2:135–155 rapid cycling, 40:299–334 raspberry, 6:245–321; 32:1–353 ripening delay by manipulating upstream transcription factors 43:81–84 ripening mechanisms, 43:65 shelf life extension genes, 43:62–66 strawberry, 2:195–214 sweet cherry, 9:367–388 Functional genomics, 42:337–349 Fungal diseases: apple rootstocks, 1:365–368

373 banana and plantain, 2:143–145, 147 barley, Fusarium head blight, 26:125–169 cassava, 2:110–114 cell selection, 4:163–165 chestnut blight, 4:355–397; 33:305–339 coffee, 2:176–179 cowpea, 15:237–238 durum wheat, 5:23–27 Fusarium head blight (barley), 26:125–169 host‐parasite genetics, 5:393–433 lettuce, 1:286–287 maize foliar, 27:119–173; 31:223–245 potato, 19:69–155 raspberry, 6:245–281; 32:184–221 rose, 31:277–324 soybean, 1:188–209 spelt, 15:196–198 strawberry, 2:195–214 sweet potato, 4:333–336 transformation, fruit crops, 16:111–112 verticillium wilt, Solanaceae, 33:115–144 wheat rust, 13:293–343 Fusarium head blight (barley), 26:125–169 Gabelman, Warren H. (biography), 6:1–9 Gametes: almond, self compatibility, 7:322–330 blackberry, 7:249–312 competition, 11:42–46 epigenetics, 30:49–177 forest trees, 7:139–188 maize aleurone, 7:91–137 maize anthocynanin, 7:91–137 mushroom, 7:189–216 polyploid, 3:253–288 rapid cycling, 40:299–334 rutabaga, 7:217–248 transposable elements, 7:91–137 unreduced, 3:253–288 Gametoclonal variation, 5:359–391 barley, 5:368–370 brassica, 5:371–372 potato, 5:376–377 rice, 5:362–364 rye, 5:370–371 tobacco, 5:372–376 wheat, 5:364–368

374 Garlic breeding, 6:81; 23:211–244 Gender differences in plant breeding: contrasting growing conditions or access to resources, 43:260–261 crops grown only or predominantly by women or men, 43:260 food security, 43:263–264 plant parts and uses, 43:262–263 postharvest processing and food preparation, 32:261–262 responsibilities during the production cycle, 43:259–260 Gender differences in trait preferences, 43:245–247; 264–274 Gene expression, 42:351–365 Gene regulatory network, 42:365–368 Genes: action, 15:315–374 apple, 9:337–356 Bacillus thuringensis, 12:19–45 double haploids, 40:123–166 editing, precision, 41:82–85 flowering, 40:299–334 incompatibility, 15:19–42 incompatibility in sweet cherry, 9:367–388 induced mutants, 2:13–71 lettuce, 1:267–293 maize endosperm, 1:142–144 maize protein, 1:110–120, 148–149 N & P efficiency, wheat, 40:184–200 petunia, 1:21–30 quality protein in maize, 9:183–184 Rhizobium, 23:39–47 rol in breeding, 26:79–103 rye perenniality, 13:261–288 soybean, 1:183–235 soybean nodulation, 11:275–318 sweet corn, 1:142–144; 39:137–152 wheat rust resistance, 13:293–343 Genetic engineering (transgeneic breeding): bean, 1:89–91 cereal stress resistance, 33:31–114 DNA methylation, 18:87–176 fire blight resistance, 29:315–358 fruit crops, 16:87–134 host‐parasite genetics, 5:415–428 legumes, 26:171–357 maize mobile elements, 4:81–122

Cumulative Subject Index ornamentals, 125–162 papaya, 26:35–78 rapid cycling, 40:299–334 rol genes, 26:79–103 salt resistance, 22:389–425 sugarcane, 27:86–97 transformation by particle bombardment, 13:231–260 transgene technology, 25:105–108 virus resistance, 12:47–79 Genetic load and lethal equivalents, 10:93–127 Genetics: adaptation, 3:21–167 almond, self compatibility, 8:322–330 amaranth, 19:243–248 Amaranthus, see Amaranth apomixis, 18:13–86 apple, 9:333–366 association, 38:17–66 Bacillus thuringensis, 12:19–45 bean seed color:28:219–315 bean seed protein, 1:59–102 beet, 22:357–376 blackberry, 8:249–312; 29:19–144 black walnut, 1:247–251 blueberry, 13:1–10 blueberry, rabbiteye, 5:323–325 carrot, 19:164–171 chestnut blight, 4:357–389 chimeras, 15:43–84 chrysanthemums, 14:321–361 clover, white, 17:191–223 coffee, 2:165–170 coleus, 3:3–53 cowpea, 15:215–274 Cucurbitaceae, 27:213–344 cytoplasm, 23:175–210 DNA methylation, 18:87–176 domestication, 25:255–320 double haploids, 40:123–166 durum wheat, 5:11–40 epigenetics, 30:49–177; 67–140 fatty acids in soybean, 30:259–294 fire blight resistance, 29:315–358 flower color, 25:89–114 forest trees, 8:139–188 fruit crop transformation, 16:87–134 gene action, 15:315–374 green revolution, 28:1–37, 39–78

Cumulative Subject Index history, 24(1):11–40 host‐parasite, 5:393–433 incompatibility: circumvention, 11:11–154 molecular biology, 11:19–42; 28:215–237 sweet cherry, 9:367–388 induced mutants, 2:51–54 insect and mite resistance in Cucurbitaceae, 10:309–360 isozymes, 6:11–54 lettuce, 1:267–293 maize adaptedness, 28:101–123 maize aleurone, 8:91–137 maize anther culture, 11:199–224 maize anthocynanin, 8:91–137 maize double haploids, 40:123–166 maize endosperm, 1:142–144 maize foliar diseases, 27:118–173 maize male sterility, 10:23–51 maize mobile elements, 4:81–122 maize mutation, 5:139–180 maize quality protein, 9:183–184; 34:83–113 maize seed protein, 1:110–120, 148–149 maize soil acidity tolerance, 28:59–123 mapping, 14:13–37 markers to manage germplasm, 13:11–86 maturity, 3:21–167 meiotic mutants, 163–214 metabolism and heterosis, 10:53–59 millets, 247–374 mitochondrial, 25:115–138 molecular mapping, 14:13–37 mosaics, 15:43–84 mushroom, 8:189–216 oat, 6:168–174 organelle transfer, 6:361–393 overdominance, 17:225–257 pea, 21:110–120 pearl millet, 1:166, 172–180 perennial rye, 13:261–288 petunia, 1:1–58 phosphate mechanisms, 29:359–419 photoperiod, 3:21–167 plantain, 14:264–320 polyploidy terminology, 26:105–124 potato disease resistance, 19:69–165 potato ploidy manipulation, 3:274–277; 16:15–86

375 quality protein in maize, 9:183–184 quantitative trait loci, 15:85–139 quantitative trait loci in animals selection, 24(2):169–210, 211–224 quinoa, 42:273–279 raspberry, 32 :9–353 reproductive barriers, 11:11–154 rhizobia, 23:21–72 rice, hybrid, 17:15–156, 23:73–174 Rosaceae, 27:175–211 rose, 17:171–172 rubber (Hevea), 29:177–283 rutabaga, 8:217–248 salt resistance, 22:389–425 selection, 24(1):111–131, 143–151, 269–290 sesame, 16:189–195 snap pea, 21:110–120 soybean, 1:183–235 soybean nodulation, 11:275–318 spelt, 15:187–213 supersweet sweet corn, 14:189–236 sweet corn, 1:139–161; 14:189–236; 39:139–152 sweet potato, 4:327–330 temperature, 3:21–167 tomato fruit quality, 4:273–311 transposable elements, 8:91–137 triticale, 5:41–93 vegetable corn, 39:139–152 virus resistance, 12:47–79 wheat gene manipulation, 11:225–234 wheat male sterility, 2:307–308 wheat molecular biology, 11:235–250 wheat rust, 13:293–343 white clover, 17:191–223 yield, 3:21–167; 34:37–182 Genome: Brassica, 31:21–187; 35:25–36 editing, 41:55–102 editing, genome level, 41:85–87 Glycine, 16:289–317 Poaceae, 16:276–281 Genome wide association study, wheat, 42:17 Genomics: coffee, 30:415–437 grain legumes, 26:171–357 Genomic selection, wheat, 42:18–19 Genotype × environment, interaction, 16:135–178

376 Germplasm, see also National Clonal Germplasm Repositories; National Plant Germplasm System acquisition and collection, 7:160–161 apple rootstocks, 1:296–299 banana, 2:140–141 blackberry, 8:265–267 black walnut, 1:244–247 Brassica, 31:21–187 cactus, 20:141–145 cassava, 2:83–94, 117–119; 31:247–275 cereal stress resistance, 33:31–114 chestnut, 4:351–352 coffee, 2:165–172 distribution, 7:161–164 enhancement, 7:98–202 evaluation, 7:183–198 exploration and introduction, 7:9–18,64–94 genetic markers, 13:11–86 grain legumes, 26:171–357 guayule, 6:112–125 isozyme, 6:18–21 legumes, 26:171–357 maintenance and storage, 7:95–110, 111–128,129–158,159–182; 13:11–86 maize, 14:165–187; 33:9–16; 39:216–224 management, 13:11–86 melon, 35:85–150 millets, 35:247–374 oat, 6:174–176 peanut, 22:297–356 pearl millet, 1:167–170 plantain, 14:267–320 potato, 9:219–223 preservation, 2:265–282; 23:291–344 raspberry, 32:75–90 rights, 25:21–55 rutabaga, 8:226–227 sampling, 29:285–314 sesame, 16:201–204 spelt, 15:204–205 sweet potato, 4:320–323 triticale, 8:55–61 wheat, 2:307–313 wild relatives, 30:149–230 Gesneriaceae, mutation breeding, 6:73 Gill, Bikram (biography), 37:1–34

Cumulative Subject Index Gladiolus, mutation breeding, 6:77 Glycine, genomes, 16:289–317 Glycine max, see Soybean Goodman, Major M. (biography), 33:1–29 Gooseberry breeding, 29:145–175 Grain breeding: amaranth, 19:227–285 association, 38:17–66 barley, 3:219–252, 5:95–138; 26:125–169 cereal stress resistance, 33:31–114 diversity, 21:221–261 doubled haploid breeding, 15:141–186 ideotype concept, 12:173–175 maize, 1:103–138, 139–161; 5:139–180; 9:115–179, 181–216; 11:199–224; 14:165–187; 22:3–4; 24(1):11–40, 41–59, 61–78; 24(2):53–64, 109–151; 25:173–253:27:119–173; 28:59–100, 101–123; 31:223–245; 33:9–16. 34:37–82, 83–113, 131–160; 37:123–205, 327–335; 40:123–166 maize double haploids, 40:123–166 maize history, 24(2):31–59, 41–59, 61–7, 39:125–198 millets, 35:247–374 oat, 6:167–207; 34:5–9 pearl millet, 1:162–182 rice, 17:15–156; 24(2):64–67;38:185–275 sorghum, 25:139–172; 31:189–222; 39:89–124 spelt, 15:187–213 transformation, 13:231–260 triticale, 5:41–93; 8:43–90 wheat, 2:303–319; 5:11–40; 11:225–234, 235–250; 13:293–343; 22:221–297; 24(2):67–69;28:1–37, 39–78; 36:85–16; 37:1–34, 35–122; 40:167–234 wild rice, 14:237–265 Grape: cold climate breeding, 43:31–60 cold climate breeding targets, 43:54–57 cold climate grape industry, 43:32–36 domestication, 25:279–281, 39:336–338 Foundations of American Grape Culture (1909), T.V. Munson, 43:37–39 germplasm development, Elmer Swenson, 43:37–52

Cumulative Subject Index germplasm improvement in the Midwestern U.S., 43:53–56 transformation, 16:103–104 varieties of Elmer Swenson, 43:47–49 Grapefruit: breeding, 13:345–363 evolution, 13:345–363 Grass breeding: breeding, 11:251–274 mutation breeding, 6:82 recurrent selection, 9:101–113 transformation, 13:231–260 Growth habit, induced mutants, 2:14–25 Guayule, 6:93–165 Hallauer, Arnel R. (biography), 15:1–17 Haploidy, see also unreduced and polyploid gametes apple, 1:376 barley, 3:219–252 cereals, 15:141–186 doubled, 15:141–186; 25:57–88 maize, 11:199–224 onion, 42:66–67 petunia, 1:16–18, 44–45 potato, 3:274–277; 16:15–86 Harlan, Jack R. (biography), 8:1–17 Heat tolerance, see also Stress Resistance: breeding, 10:129–168 wheat, 36:85–165 Herbicide resistance: breeding needs, 11:155–198 cell selection, 4:160–161 decision trees, 18:251–303 risk assessment, 18:251–303 transforming fruit crops, 16:114 Heritability estimation, 22:9–111 Heterosis: gene action, 15:315–374 overdominance, 17:225–257 plant breeding, 12:227–251 plant metabolism, 10:53–90 rice, 17:24–33 soybean, 21:263–320 Hevea, see Rubber History: raspberry, 32:45–51 raspberry improvement, 32:59–66, 309–314

377 Honeycomb: breeding, 18:177–249, 37:297–347 selection, 13:87–139, 18:177–249, 37:297–347 Hordeum, see Barley Hordeum vulgare, see barley Horticulture Reviews, 41:307–309 Host‐parasite genetics, 5:393–433 Human nutrition: breeding 31:325–392 enhanced food crops, 36:169–291 quality protein maize, 34:97–101 Hyacinth, mutation breeding, 6:76–77 Hybrid and hybridization, see also Heterosis barley, 5:127–129 blueberry, 5:329–341 chemical, 3:169–191 interspecific, 5:237–305 maize high oil selection, 24(1):153–175 maize history, 24(1):31–59, 41–59, 61–78 maize long‐term selection, 24(2):43–64, 109–151 pigeonpea, 41:146–153 raspberry, 32:92–94 rice, 17:15–156 soybean, 21:263–307 verification, 34:193–205 wheat, 2:303–319 Hymowitz, Theodore (biography), 29:1–18 Ideotype concept, 12:163–193 Inbreeding depression, 11:84–92 alfalfa, 13:209–233 cross pollinated crops, 13:209–233 Incompatibility: almond, 8:313–338 molecular biology, 15:19–42, 28:215–237 pollen, 4:39–48 reproductive barrier, 11:47–70 sweet cherry, 9:367–388 Incongruity, 11:71–83 Industrial crop breeding: guayule, 6:93–165 rubber (Hevea), 29:177–283 sugarcane, 27:5–118

378 Insect and mite resistance: apple rootstock, 1:370–372 black walnut, 1:251 cassava, 2:107–110 clover, white, 17:209–210 coffee, 2:179–180 cowpea, 15:240–244 Cucurbitaceae, 10:309–360 durum wheat, 5:28 maize, 6:209–243 raspberry, 6:282–300; 32:221–242 rutabaga, 8:240–241 sweet potato, 4:336–337 transformation fruit crops, 16:113 wheat, 22:221–297 white clover, 17:209–210 Intellectual property rights: contracts and licenses, 43:167–170 copyrights, 43:170 enforcement, 43:138–142 facilitating access to and use of patented materials, 43:188–189 formal systems, 43:148–150 geographical indicators and marketing orders, 43:166–167 global framework and treaties, 43:143–148 historical examples and philosophical basis, 43:127–133 informal systems, 43:142 modeling benefits of, 43:176–188 open source, 40:271–298; 43:170–172 public sector use of, 43:172–176 role in bona fide seed and food security, 43:135–136 trademarks and brand names, 43:165–166 trade secrets, 43:156–157 UPOV, 43:157–164 U.S. Plant Patent Act, 43:157 utility patents, 43:150–156; 165 Intergeneric hybridization, papaya, 26:35–78 Interspecific hybridization: blackberry, 8:284–289 blueberry, 5:333–341 Brassica, 31:21–187 cassava, 31:247–275 citrus, 8:266–270 issues, 34:161–220 pasture legume, 5:237–305

Cumulative Subject Index periclinal breeding, 40:43–121 raspberry, 32:146–152 rose, 17:176–177 rutabaga, 8:228–229 Vigna, 8:24–30 Intersubspecific hybridization, rice, 17:88–98 Introduction, 3:361–434; 7:9–11, 21–25 In vitro culture: alfalfa, 2:229–234; 4:123–152 barley, 3:225–226 bean, 2:234–237 birdsfoot trefoil, 2:228–229 blackberry, 8:274–275 broadbean, 2:244–245 cassava, 2:121–122 cell selection, 4:153–173 chickpea, 2:224–225 citrus, 8:339–374 clover, 2:240–244 coffee, 2:185–187 cowpea, 2:245–246 embryo culture, 5:181–236, 249–275 germplasm preservation, 7:125,162–167 introduction, quarantines, 3:411–414 legumes, 2:215–264 mungbean, 2:245–246 oil palm, 4:175–201 onion, 42:64 pea, 2:236–237 peanut, 2:218–224 petunia, 1:44–48 pigeon pea, 2:224 pollen, 4:59–61 potato, 9:286–288 raspberry, 32:120–122 sesame, 16:218 soybean, 2:225–228 Stylosanthes, 2:238–240 wheat, 12:115–162 wingbean, 2:237–238 zein, 1:110–111 Ipomoea batatas, see sweetpotato Isozymes, in plant breeding, 6:11–54 Jahn, Margaret M. (biography), 35:1–17 Janick, Jules (biography), 41:291–360 Jennings, Derek (biography), 32:2–21 Jones, Henry A. (biography), 1:1–10 Juglans nigra, see Black walnut

Cumulative Subject Index Karyogram, petunia, 1:13 Kiwifruit: domestication, 25:300–301 transformation, 16:104 Lactuca sativa, see Lettuce Landraces, diversity, 21:221–263 Laughnan, Jack R. (bibliography), 19:1–14 Legumes, see also Bean, Oilseed, Peanut, Soybean: breeding, 33:157–304; 37:315–322 cowpea, 15:215–274 genomics, 26:171–357; 33:157–304 pasture legumes, 5:237–305 Vigna, 8:19–42 Legume tissue culture, 2:215–264 Lethal equivalents and genetic load, 10:93–127 Lettuce: breeding, 16:1–14; 20:105–133 genes, 1:267–293 transgenics, 35:2–5‐210 Leucaena breeding, 40:43–121 Leucaena leucocephala, see Leucaeana Lingonberry domestication, 25:300–301 Linkage: bean, 1:76–77 disequilibria, 38:17–66 isozymes, 6:37–38 lettuce, 1:288–290 maps, molecular markers, 9:37–61 petunia, 1:31–34 Loquat breeding, 37:259–296 Lotus: hybrids, 5:284–285 in vitro culture, 2:228–229 Lycopersicon, see Tomato Maize: anther culture, 11:199–224; 15:141–186 anthocyanin, 8:91–137 apomixis, 18:56–64 biotic resistance, 34:131–160 breeding, 1:103–138, 139–161; 27:119–173; 33:9–16; 37:123–205, 327–335 carbohydrates, 1:144–148 cytoplasm, 23:189 diversity, 33:4–7 doubled haploid breeding, 15:141–186; 40:123–166

379 drought tolerance, 25:173–253 exotic germplasm utilization, 14:165–187 foliar diseases, 27:119–173 germplasm, 33:9–16 high oil, 22:3–4; 24(1):153–175 history of hybrids, 23(1):11–40, 41–59, 61–78 honeycomb breeding, 18:226–227 hybrid breeding, 17:249–251 insect resistance, 6:209–243 isozymes, 33:7–8 long‐term selection 24(2):53–64, 109–151 male sterility, 10:23–51 marker‐assisted selection. 24(1):293–309 mobile elements, 4:81–122 mutations, 5:139–180 origins, 20:15–66 origins of hybrids, 24(1):31–50, 41–59, 61–78 overdominance, 17:225–257 physiological changes with selection, 24(1):143–151 protein, quality, 9:181–216; 34:83–113 protein, storage, 1:103–138 recurrent selection, 9:115–179; 14:139–163 RFLF changes with selection, 24(1):111–131 selection for oil and protein, 24(1): 79–110, 153–175 soil acidity tolerance, 28:59–100 sweet corn, supersweet, 14:189–236 sweet corn, tropical, 39:125–198 transformation, 13:235–264 transposable elements, 8:91–137 unreduced gametes, 3:277 vegetative phase change, 131–160 yield, 27–182 Male sterility: chemical induction, 3:169–191 coleus, 3:352–353 genetics, 25:115–138, 139–172 lettuce, 1:284–285 molecular biology, 10:23–51 onion, 42:47–51 pearl millet, 1:166 petunia, 1:43–44 pigeonpea, 41:119–132 rice, 17:33–72

380 Male sterility: (cont’d) sesame, 16:191–192 sorghum, 25:139–172 soybean, 21:277–291 wheat, 2:303–319 Malus spp, see Apple Malus x domestica, see Apple Malvaceae, molecular mapping, 14:25–27 Mango: domestication, 25:277–279 transformation, 16:107 Manihot esculenta, see Cassava Mapping: Cucurbitaceae, 27:213–244 Rosaceae, 27:175–211 Marker‐assisted selection, see Selection conventional breeding, 33:145–217 gene pyramiding, 33:210–256 millets, 35:332–344 onion, 42:64–66 origin, 39:1–22 strategies, 34:247–348 wheat, 42:12–14 Medicago, see also Alfalfa in vitro culture, 2:229–234 Meiosis: mutants, 28:239–115 petunia, 1:14–16 Melon, landraces of India, 35:85–150 Metabolism and heterosis, 10:53–90 Microprojectile bombardment, transformation, 13:231–260 Millets, genetic and genomic resources, 35:247–374 Mitochondrial genetics, 6:377–380; 25:115–138 Mixed plantings, bean breeding, 4:245–272 Mobile elements, see also transposable elements: maize, 4:81–122; 5:146–147 Molecular biology: apomixis, 18:65–73 comparative mapping, 14:13–37 cytoplasmic male sterility, 10:23–51 DNA methylation, 18:87–176 herbicide‐resistant crops, 11:155–198 incompatibility, 15:19–42 legumes, 26:171–357

Cumulative Subject Index molecular markers, 9:37–61, 10:184–190; 12:195–226; 13:11–86; 14:13–37; 17:113–114, 179, 212–215; 18:20–42; 19:31–68, 21:181–220, 23:73–174, 24(1)203–309; 26: 292–299; 33:145–217, 219–256; 34:247–358; 35:332–344 papaya, 26:35–78 raspberry, 32:126–134 rol genes, 26:79–103 salt resistance, 22:389–425 somaclonal variation, 16:229–268 somatic hybridization, 20:167–225 soybean nodulation, 11:275–318 strawberry, 21:139–180 transposable (mobile) elements, 4:81–122; 8:91–137 virus resistance, 12:47–79 wheat improvement, 11:235–250 Molecular markers, 9:37–61, 10:184–190; 12:195–226; 13:11–86; 14:13–37; 17:113–114, 179, 212–215; 18:20–42; 19:31–68, 21:181–220, 23:73–174; 33:145–217, 219–256; 34:247–358 alfalfa, 10:184–190 apomixis, 18:40–42 barley, 21:181–220 clover, white, 17:212–215 forest crops, 19:31–68 fruit crops, 12:195–226 maize selection, 24(1):293–309 mapping, 14:13–37 millets, 35:332–344 plant genetic resource mangement, 13:11–86 rice, 17:113–114, 23:73–124 rose, 17:179 somaclonal variation, 16:238–243 strategies, 34:247–358 sugarbeet, 42–197–201 turfgrass, 42:124–125; 42:134–139; 143–151 wheat, 21:181–220 white clover, 17:212–215 Monosomy, petunia, 1:19 Monsanto, maize breeding, 39:199–282 Mosaics and chimeras, 15:43–84 Mungbean, 8:32–35 in vitro culture, 2:245–246 photoperiodic response, 3:74, 89–92

Cumulative Subject Index Munger, Henry M. (biography), 4:1–8 Musa, see Banana, Plantain Mushroom, breeding and genetics, 8:189–215 Mutagenesis, targeted, 41:77–81 Mutants and mutation: alfalfa tissue culture, 4:130–139 apple rootstocks, 1:374–375 banana, 2:148–149 barley, 5:124–126 blackberry, 8:283–284 breeding, 39:23–87 cassava, 2:120–121 cell selection, 4:154–157 chimeras, 15:43–84 coleus, 3:355 cytoplasmic, 2:293–295 gametoclonal variation, 5:359–391 homeotic floral, 9:63–99 induced, 2:13–72 long term selection variation, 24(1):227–247 maize, 1:139–161, 4:81–122; 5:139–180 mobile elements, see Transposable elements mosaics, 15:43–84 petunia, 1:34–40 sesame, 16:213–217 somaclonal variation, 4:123–152; 5:147–149 sweet corn, 1:139–161 sweet potato, 4:371 transposable elements, 4:181–122; 8:91–137 tree fruits, 6:78–79 vegetatively‐propagated crops, 6:55–91 zein synthesis, 1:111–118 Mycoplasma diseases, raspberry, 6:253–254 Naked barley: beta‐glucan and starch type, 43:102–103 breeding feed types, 43:104–106 breeding food types, 43:106–108 breeding malting types, 43:108–112 NUD gene and related traits, 43:97–102 National Clonal Germplasm Repository (NCGR), 7:40–43 cryopreservation, 7:125–126 genetic considerations, 7:126–127

381 germplasm maintenance and storage, 7:111–128 identification and label verification, 7:122–123 in vitro culture and storage, 7:125 operations guidelines, 7:113–125 preservation techniques, 7:120–121 virus indexing and plant health, 7:123–125 National Plant Germplasm System (NPGS), see also Germplasm history, 7:5–18 information systems, 7:57–65 operations, 7:19–56 preservation of genetic resources, 23:291–34 National Seed Storage Laboratory (NSSL), 7:13–14, 37–38, 152–153 Nectarines, cold hardiness breeding, 10:271–308 Nematode resistance: apple rootstocks, 1:368 banana and plantain, 2:145–146 coffee, 2:180–181 cowpea, 15:245–247 raspberry, 32:235–237 soybean, 1:217–221 sweet potato, 4:336 transformation fruit crops, 16:112–113 New world cucurbits, 43:317–350 identification in historical sources, 43:319–327 presence in artistic works, 43:335–343 presence in botanical and genre paintings, 43:344–349 presence in herbals and books, 43:329–334 presence in South America, 43:327–329 terminology, 43:319 Nicotiana, see Tobacco Nodulation, soybean, 11:275–318 Nucleases, species specific, 41:60–65 Nutrition (human): enhanced crops, 36:169–291 peanut breeding, 38:141–183 plant breeding, 31:325–392 Oat breeding, 6:167–207; 34:5–9 Oil palm: breeding, 4:175–201, 22:165–219 in vitro culture, 4:175–201

382 Oilseed breeding: canola, 18:1–20 oil palm, 4:175–201; 22:165–219 peanut, 22:295–356; 30:295–322 sesame, 16:179–228 soybean, 1:183–235; 3:289–311; 4:203–245; 11:275–318; 15:275–313 Olive domestication, 25:277–279; 39:330–332 Onion: breeding 42:39–85 breeding goals 42:51–42 breeding history, 20:57–103 bulb characteristics 42:52–55 disease and pest resistance 42:61–63 domestication 42:43–44 doubled haploids 42:66–67 health benefits 42:57 heterosis 42:46–47 in vitro propagation 42:64 male sterility 42:47–51 marker assisted selection 42:64–66 phylogeny 42:42–43 pungency and flavor 42:55–56 recurrent selection 42:45–46 seed yield 42–59–61 transformation 42:67 Open source breeding, 40:271–298 Opuntia, see Cactus Organelle transfer, 2:283–302; 3:205–210; 6:361–393 Ornamentals breeding: chrysanthemum, 14:321–361 coleus, 3:343–360 petunia, 1:1–58 rose, 17:159–189; 31:277–324 transgenesis, 28:125–162 Ornithopus, hybrids, 5:285–287 Ortiz, Rodomiro (biography), 36:1–84 Orzya, see Rice Overdominance, 17:225–257 Ovule culture, 5:181–236 Palm (Arecaceae): foliage breeding, 23:280–281 oil palm breeding, 4:175–201; 22:165–219 Panicum maximum, apomixis, 18:34–36, 47–49

Cumulative Subject Index Papaya: breeding, 26:35–78 domestication, 25:307–308 transformation, 16:105–106 Parthenium argentatum, see Guayule Paspalum apomixis, 18:51–52 Paspalum notatum, see Pensacola bahiagrass Passionfruit transformation, 16:105 Pasture legumes, interspecific hybridization, 5:237–305 Patents, raspberry, 32:108–115 Pea: breeding, 21:93–138 flowering, 3:81–86, 89–92 in vitro culture, 2:236–237 Peach: cold hardiness breeding, 10:271–308 domestication, 25:294–296 transformation, 16:102 Peanut: breeding, 22:297–356; 30:295–322; 36:293–356; 38:141–183; 41:16–19 in vitro culture, 2:218–224 Pear: domestication, 25:289–290 transformation, 16:102 Pearl millet: apomixis, 18:55–56 breeding, 1:162–182 Pecan transformation, 16:103 Peloquin, Stanley, J. (biography), 25:1–19 Pennisetum americanum, see Pearl millet Pensacola bahiagrass, 9:101–113 apomixis, 18:51–52 selection, 9:101–113 Pepino transformation, 16:107 Peppermint, mutation breeding, 6:81–82 Perennial grasses, breeding, 11:251–274 Perennial rye breeding, 13:261–288 Periclinal chimeras & breeding, 40:235–269 Persimmon: breeding, 19:191–225 domestication, 25:299–300 Petunia spp., genetics, 1:1–58 Phaseolin, 1:59–102 Phaseolus vulgaris, see Bean Philodendrum breeding, 23:273 Phosphate molecular mechanisms, 29:359–419

Cumulative Subject Index Phytophthora fragariae, 2:195–214 Pigeon pea: breeding, 41:133–141 commercialization of hybrids, 41:146–153 genomics, 41:142–145 in vitro culture, 2:224 male sterility, 41:119–132 reproductive biology, 41:108–114 Pineapple domestication, 25:305–307 Pistil, reproductive function, 4:9–79 Pisum, see Pea Plantain: breeding, 2:135–155; 14:267–320; 21:1–25 domestication, 25:298 Plant breeders rights, 25:21–55 Plant breeding, see also Breeding: epigenetics, 30:49–177; 38:67–140 politics, 25:21–55 prediction, 19:15–40 reviews, 41:307–309 sensory and flavour, 41:215–262 Plant exploration, 7:9–11, 26–28, 67–94 Plant introduction, 3:361–434; 7:9–11, 21–25 Plastid genetics, 6:364–376, see also Organelle Plum: domestication, 25:293–294 transformation, 16:103–140 Poaceae: molecular mapping, 14:23–24 Saccharum complex, 16:269–288 Pollen: reproductive function, 4:9–79 storage, 13:179–207 Polyploidy, see also Haploidy alfalfa, 10:171–184 alfalfa tissue culture, 4:125–128 apple rootstocks, 1:375–376 banana, 2:147–148 barley, 5:126–127 blueberry, 13:1–10 Brassica, 35:34–36 citrus, 30:322–352 gametes, 3:253–288 isozymes, 6:33–34 petunia, 1:18–19 potato, 16:15–86; 25:1–19; 41:170–214 reproductive barriers, 11:98–105

383 sweet potato, 4:371 terminology, 26:105–124 triticale, 5:11–40 Pomegranate domestication, 25:285–286; 39:340–342 Population genetics, see Quantitative Genetics Potato: breeding, 9:217–332, 19:69–165; 41:179–195 classification and origin, 41:171–175 cytoplasm, 23:187–189 diploid breeding, 41:198–200 disease resistance breeding, 19:69–165 European origin, 41:178–179 gametoclonal variation, 5:376–377 heat tolerance, 10:152 honeycomb breeding, 18:227–230 landrace evolution, 41:176–177 mutation breeding, 6:79–80 necessity of tetraploidy, 41:196–197 photoperiodic response, 3:75–76, 89–92 ploidy manipulation, 16:15–86 transgenics, 35:191–196 unreduced gametes, 3:274–277 Propagation: black walnut, 41:279–280 raspberry, 32:116–126 Protein: antifungal, 14:39–88 bean, 1:59–102 induced mutants, 2:38–46 maize, 1:103–138, 148–149; 9:181–216 Protoplast fusion, 3:193–218; 20:167–225 citrus, 8:339–374 mushroom, 8:206–208 Prunus: amygdalus, see Almond avium, see Sweet cherry Pseudograin breeding, amaranth, 19:227–285 Psophocarpus, in vitro culture, 2:237–238 Pumpkins, see Cucurbits Pungency, onion 42:55–56 Quality protein maize. 9:181–216; 34:83–113 Quantitative genetics: epistasis, 21:27–92 forest trees, 8:139–188

384 Quantitative genetics: (cont’d) gene interaction, 24(1):269–290 genotype x environment interaction, 16:135–178 heritability, 22:9–111 maize RFLP changes with selection, 24(1):111–131 mutation variation, 24(1):227–247 overdominance, 17:225–257 population size & selection, 24(1):249–268 selection limits, 24(1):177–225 statistics, 17:296–300 trait loci (QTL), 15:85–139; 19:31–68 variance, 22:113–163 Quantitative trait loci (QTL), 15:85–138; 19:31–68 animal selection, 24(2):169–210, 211–224 marker‐assisted selection, 33:145–217, 219–256 selection limits:24(1):177–225 Quarantines, 3:361–434; 7:12, 35–37 Quinoa: Breeding methods, 42:279–286 Breeding objectives, 42:286–301 End use quality, 42:301–308 Genetics and genomics, 42:273–279 History of domestication and breeding, 42:259–271 Rabbiteye blueberry, 5:307–357 Rapid cycling breeding, 40:299–334 Raspberry, breeding and genetics, 6:245–321, 32:1–353 Recurrent restricted phenotypic selection, 9:101–113 Recurrent selection, 9:101–113, 115–179; 14:139–163 soybean, 15:275–313 wheat, dominant male sterile gene, 42:8–9 Rédei, George P. (biography), 26:1–33 Red stele disease, 2:195–214 Regional trial testing, 12:271–297 Reproduction: barriers and circumvention, 11:11–154 foliage plants, 23:255–259 garlic, 23:211–244 Rhizobia, 23:21–72 Rhododendron, mutation breeding, 6:75–76

Cumulative Subject Index Ribes, see Currant, Gooseberry Rice, see also Wild rice: anther culture, 15:141–186 apomixis, 18:65 cytoplasm, 23:189 doubled haploid breeding, 15:141–186 gametoclonal variation, 5:362–364 heat tolerance, 10:151–152 honeycomb breeding, 18:224–226 hybrid breeding, 17:1–15, 15–156; 23:73–174 Latin American breeding, 38:185–275 long‐term selection 24(2):64–67 molecular markers, 17:113–114; 23:73–174 photoperiodic response, 3:74, 89–92 Rosaceae, synteny, 27:175–211 Rosa, see Rose Rose breeding, 17:159–189; 31:277–324 Rubber (Hevea) breeding, 29:177–283 Rubus, see Blackberry, Raspberry Rust, wheat, 13:293–343; 42:11–12 Rutabaga, 8:217–248 Ryder, Edward J. (biography), 16:1–14 Rye: gametoclonal variation, 5:370–371 perennial breeding, 13:261–288 triticale, 5:41–93 Saccharum complex, 16:269–288 Salamini, Francisco (biography), 30:1–47 Salt resistance: cell selection, 4:141–143 cereals, 33:31–114 durum wheat, 5:31 yeast systems, 22:389–425 Sears, Ernest R. (biography), 10:1–22 Secale, see Rye Seed: apple rootstocks, 1:373–374 banks, 7:13–14, 37–40, 152–153 bean, 1:59–102; 28:239–315 citrus, 30:322–350 garlic, 23:211–244 lettuce, 1:285–286 maintenance and storage, 7:95–110, 129–158, 159–182 maize, 1:103–138, 139–161, 4:81–86 pearl millet, 1:162–182 protein, 1:59–138, 148–149

Cumulative Subject Index raspberry, 32:94–101 rice production, 17:98–111, 118–119, 23:73–174 soybean, 1:183–235, 3:289–311 synthetic, 7:173–174 variegation, 4:81–86 wheat (hybrid), 2:313–317 Selection, see also Breeding bacteria, 24(2):225–265 bean, 24(2):69–74 cell, 4:139–145, 153–173 crops of the developing world, 24(2):45–88 divergent selection for maize ear length, 24(2):153–168 domestication, 24(2):1–44 Escherichia coli, 24(2):225–265 gene interaction, 24(1):269–290 genetic models, 24(1):177–225 honeycomb design, 13:87–139; 18:177–249 limits, 24(1):177–225 maize high oil, 24(1):153–175 maize history, 24(1):11–40, 41–59, 61–78 maize inbreds, 28:101–123 maize long term, 24(1):79–110, 111–131, 133–151; 24(2):53‐ 64, 109–151 maize oil & protein, 24(1):79–110, 153–175 maize physiological changes, 24(1):133–151 maize RFLP changes, 24(1):111–131 marker assisted, 9:37–61, 10:184–190; 12:195–226; 13:11–86; 14:13–37; 17:113–114, 179, 212–215; 18:20–42; 19:31–68, 21:181–220, 23:73–174, 24(1):293–309; 26:292–299; 31:210–212, 33: 145–217, 219–256; 34:247–348, 35:332–344 millets, 35:332–344 mutation variation, 24(1):227–268 population size, 24(1):249–268 prediction, 19:15–40 productivity gains in US crops, 24(2):89–106 prognosis, 37:297–347 quantitative trait loci, 24(1):311–335 raspberry, 32:102–108, 143–146 recurrent restricted phenotypic, 9:101–113

385 recurrent selection in maize, 9:115–179; 14:139–163 rice, 24(2):64–67 wheat, 24(2):67–69 Sensory and flavour analysis: chef flavour evaluations, 41:250–252 crew flavour evaluations, 41:247–249 flavour evaluations, 41:243–245 plant breeding, 41:215–262 rapid methods, 41:221–240 statistical methodologies, 41:246–247 Sequencing: crop genomes sequenced, 42:327–336 whole genome sequencing, 42:324–337 Sesame breeding, 16:179–228 Sesamum indicum, see Sesame Simmonds, N.W. (biography), 21:1–13 Small grains, breeding, 42:8–19 Snap pea breeding, 21:93–138 Solanaceae: incompatibility, 15:27–34 molecular mapping, 14:27–28 verticillium wilt, 33:115–144 Solanum tuberosum, see Potato Solanun lycopsersicum, see Tomato Somaclonal variation, see also Gametoclonal variation alfalfa, 4:123–152 isozymes, 6:30–31 maize, 5:147–149 molecular analysis, 16:229–268 mutation breeding, 6:68–70 rose, 17:178–179 transformation interaction, 16:229–268 utilization, 16:229–268 Somatic embryogenesis, 5:205–212; 7:173–174 oil palm, 4:189–190 Somatic genetics, see also Gametoclonal variation; Somaclonal variation: alfalfa, 4:123–152 legumes, 2:246–248 maize, 5:147–149 organelle transfer, 2:283–302 pearl millet, 1:162–182 petunia, 1:43–46 protoplast fusion, 3:193–218 wheat, 2:303–319 Somatic hybridization, 20:167–225, see also Protoplast fusion

386 Sorghum: biofortification, 39:89–124 drought tolerance, 31:189–222 male sterility, 25:139–172 photoperiodic response, 3:69–71, 97–99 transformation, 13:235–264 Southern pea, see Cowpea Soybean: cytogenetics, 16:289–317 disease resistance, 1:183–235 drought resistance, 4:203–243 fatty acid manipulation, 30:259–294 genetics and evolution, 29:1–18 hybrid breeding, 21:263–307 in vitro culture, 2:225–228 nodulation, 11:275–318 photoperiodic response, 3:73–74 recurrent selection, 15:275–313 semidwarf breeding, 3:289–311 Spelt, agronomy, genetics, breeding, 15:187–213 Sprague, George F. (biography), 2:1–11 Squash, see Cucurbits Starch, maize, 1:114–118 Statistics: advanced methods, 22:113–163 alternative experimental designs, 42:87–117 history, 17:259–316 Stenocarpella ear rot, 31:223–245 Sterility, see also Male sterility, 11:30–41 Strawberry: biotechnology, 21:139–180 domestication, 25:302–303 red stele resistance breeding, 2:195–214 transformation, 16:104 Stress resistance, see also Drought and Heat Resistance: cell selection, 4:141–143, 161–163 cereals, 33:31–114 maize, 37:123–205 transformation fruit crops, 16:115 Stuber, Charles, W., (biography), 39:1–22 Stylosanthes, in vitro culture, 2:238–240 Sugarbeet: breeding, 42:167–201 breeding objectives 180–197 genetic resources, 42:178–180 history and domestication, 42:168–178 markers, 42–197–201 Sugarcane:

Cumulative Subject Index breeding, 27:15–118 mutation breeding, 6:82–84 Saccharum complex, 16:269–288 Sweet cherry: Domestication, 25:202–293 pollen‐incompatibility and self‐fertility, 9:367–388 transformation, 16:102 Sweet corn, see also Maize: brittle1, 43:229 brittle2, 43:229 carbohydrate content in various endosperm types, 43:225 combining endosperm mutants, 43;230–233 endosperm, 1:139–161 endosperm development and mutants, 43:219–230 endosperm genes involved in starch synthesis, 43:222 endosperm mutants and crop production, 43:233–234 shrunken2, 43:227–229 sugary1, 43:223–227 supersweet (shrunken2), 14:189–236 transgenics, 35:213–215 tropical, 39:125–198 Sweet potato: breeding, 4:313–345; 6:80–81 breeding for Africa, 43:13–18 breeding orange fleshed types, 43:18–21 collaborative research, 43:12–13 technology transfer, 43:7–12 transgenics, 35:217–218 Synteny, Rosaceae, 27:175–211 Synthetic wheat, 1–134, 35–122 Tamarillo transformation, 16:107 Taxonomy: amaranth, 19:233–237 apple, 1:296–299 banana, 2:136–138 blackberry, 8:249–253 brassicas. 35:19–83 cassava, 2:83–89 chestnut, 4:351–352 chrysanthemum, 14:321–361 clover, white, 17:193–211 coffee, 2:161–163 coleus, 3:345–347 fescue, 3:314

Cumulative Subject Index garlic, 23:211–244 Glycine, 16:289–317 guayule, 6:112–115 oat, 6:171–173 pearl millet, 1:163–164 petunia, 1:13 plantain, 2:136; 14:271–272 raspberry, 32:51–52 rose, 17:162–169 rutabaga, 8:221–222 Saccharum complex, 16:270–272 sweet potato, 4:320–323 triticale, 8:49–54 Vigna, 8:19–42 white clover, 17:193–211 wild rice, 14:240–241 Testing: adaptation, 12:271–297 honeycomb design, 13:87–139 Tissue culture, see In vitro culture Tobacco, gametoclonal variation, 5:372–376 Tomato: breeding for quality, 4:273–311 heat tolerance, 10:150–151 Toxin resistance, cell selection, 4:163–165 Transformation and transgenesis alfalfa, 10:190–192 allelopathy, 30:231–258 alliums, 35:210–213 barley, 26:155–157 brassicas, 35:199–205 carrot, 35:219–220 cassava, 35:216 cereals, 13:231–260; 33:31–114 cowpea, 35;215 cucurbits, 35:196–199 eggplant, 35:187–191 fire blight resistance, 29:315–358 fruit crops, 16:87–134 lettuce, 35:205–210 mushroom, 8:206 onion, 42:67 ornamentals, 28:125–162 papaya, 26:35–78 potato, 35:191–196 rapid cycling, 40:299–334 raspberry, 16:105; 32:133–134 rice, 17:179–180 somaclonal variation, 16:229–268 strategies, 41:72–76

387 sugarcane, 27:86–97 sweet corn, 35:213–215 sweet potato, 35:217–218 tomato, 35:164–187 vegetable crops, 35:151–246 white clover, 17:193–211 Transpiration efficiency, 12:81–113 Transposable elements, 4:81–122; 5:146–147; 8:91–137 Tree crops, ideotype concept, 12:163–193 Tree fruits, see Fruit, nut, and beverage crop breeding Trifolium hybrids, 5:275–284 in vitro culture, 2:240–244 Trifolium, see Clover, White Clover Trilobium, long‐term selection, 24(2):211–224 Tripsacum: apomixis, 18:51 maize ancestry, 20:15–66 Trisomy, petunia, 1:19–20 Triticale, 5:41–93; 8:43–90 Triticosecale, see Triticale Triticum: Aestivum, see Wheat Turgidum, see Durum wheat Tulip, mutation breeding, 6:76 Turfgrasses: genetic complexity and DNA markers, 42:122–124 genetic diversity, 42:129–133; 42:139–142 marker‐trait associations, 42:124–125; 42:134–139; 143–151 warm and cool season, 42:121–122 United States National Plant Germplasm System, see National Plant Germplasm System Unreduced and polyploid gametes, 3:253–288; 16:15–86 Upadhyaya, Hari Deo (biography), 41:1–54 Urd bean, 8:32–35 Vaccinium macrocarpon, see Cranberry Vaccinium, see Blueberry Variance estimation, 22:113–163 Vegetable, rootstock, and tuber breeding: alliums transgenics, 35:210–213 artichoke, 12:253–269 bean, 1:59–102; 4:245–272, 24(2):69–74; 28:239–315; 36:357–426

388 Vegetable, rootstock, and tuber breeding: (cont’d) bean (tropics), 10:199–269 beet (table), 22:257–388 brassica transgenics, 35:19–84, 199–205 carrot 19:157–190, 35; 219–220 cassava, 2:73–134; 24(2):74–79; 31:247–275; 35:216; 36:427–503 chili pepper, 39:283–323 cowpea, 35:215 cucumber, 6:323–359 cucurbit, 10:309–360; 35:196–199 eggplant transgenics, 35:187–191 lettuce, 1:267–293; 16:1–14; 20:105:‐133; 35:205–210 melon, 35:85–150 mushroom, 8:189–215 onion, 20:67–103 pea, 21:93–138 peanut, 22:297–356; 36:293–356 potato, 9:217–232; 16:15–86l; 19:69–165; 35:191–196 rutabaga, 8:217–248 snap pea, 21:93–138 Solanaceae, verticillium wilt, 33:115–144 sweet corn, 1:139–161; 14:189–236; 35:213–215. 39:125–198 sweet corn, tropical, 39:125–198 sweet potato, 4:313–345; 6:80–81; 35:213–215 tomato, 4:273–311, 35:164–187 vegetable crop transgenics:151–246 verticillium wilt, Solanaceae, 22:115–144 Verticillium wilt, Solanaceae, 33:115–144 Vicia, in vitro culture, 2:244–245 Vigna, see Cowpea, Mungbean in vitro culture, 2:245–246; 8:19–42 Virus diseases: apple rootstocks, 1:358–359 clover, white, 17:201–209 coleus, 3:353 cowpea, 15:239–240 indexing, 3:386–408, 410–411, 423–425 in vitro elimination, 2:265–282 lettuce, 1:286 maize, 27:142–156 papaya, 26:35–78 peanut, 36:293–356 potato, 19:122–134 raspberry, 6:247–254; 32:242–247 resistance, 12:47–79 soybean, 1:212–217

Cumulative Subject Index sweet potato, 4:336 transformation fruit crops, 16:108–110 white clover, 17:201–209 Vitis amurensis, 43:35 Vitis labrusca, 43:34 Vitis riparia, 43:35 Vitis vinifera, see grape Vogel, Orville A. (biography), 5:1–10 Vuylsteke, Dirk R. (biography), 21:1–25 Walnut (black), 1:236–266 Walnut transformation, 16:103 Weinberger, John A. (biography), 11:1–10 Wheat: anther culture, 15:141–186 apomixis, 18:64–65 breeding, 37:35–122 chemical hybridization, 3:169–191 cold hardiness adaptation, 12:124–135 cytogenetics, 10:5–15; 37:1–34, 35–122 cytoplasm, 23:189–190 diversity, 21:236–237 doubled haploid breeding, 15:141–186 drought tolerance, 12:135–146; 36:85–165 durum, 5:11–40 gametoclonal variation, 5:364–368 gene manipulation, 11:225–234 green revolution, 28; 1–37, 39–58 heat tolerance, 10:152; 36:85–165 hybrid, 2:303–319; 3:185–186 insect resistance, 22:221–297 in vitro adaptation, 12:115–162 long‐term selection, 24(2):67–69 molecular biology, 11:235–250 molecular markers, 21:191–220 N & K efficiency breeding, 40:167–234 photoperiodic response, 3:74 rust interaction, 13:293–343 triticale, 5:41–93 vernalization, 3:109 White clover, molecular genetics, 17:191–223 Wild rice, breeding, 14:237–265 Winged bean, in vitro culture, 2:237–238 Yeast, salt resistance, 22:389–425 Yuan, Longping (biography), 17:1–13 Zea mays, see Maize, Sweet corn Zein, 1:103–138 Zizania palustris, see Wild rice Zohary, Daniel (biography), 38:1–16

WILEY END USER LICENSE AGREEMENT Go to www.wiley.com/go/eula to access Wiley’s ebook EULA.