Herpes Simplex Virus : Methods and Protocols [2nd ed. 2020] 978-1-4939-9813-5, 978-1-4939-9814-2

Table of contents :
Front Matter ....Pages i-xiv
Tour de Herpes: Cycling Through the Life and Biology of HSV-1 (Christopher E. Denes, Roger D. Everett, Russell J. Diefenbach)....Pages 1-30
Vaccines for Herpes Simplex: Recent Progress Driven by Viral and Adjuvant Immunology (Kerrie J. Sandgren, Naomi R. Truong, Jacinta B. Smith, Kirstie Bertram, Anthony L. Cunningham)....Pages 31-56
Herpes Simplex Virus Growth, Preparation, and Assay (Sereina O. Sutter, Peggy Marconi, Anita F. Meier)....Pages 57-72
Engineering HSV-1 Vectors for Gene Therapy (William F. Goins, Shaohua Huang, Bonnie Hall, Marco Marzulli, Justus B. Cohen, Joseph C. Glorioso)....Pages 73-90
Preparation of Herpes Simplex Virus Type 1 (HSV-1)-Based Amplicon Vectors (Cornel Fraefel, Alberto L. Epstein)....Pages 91-109
HSV-1 Amplicon Vectors as Genetic Vaccines (Anita F. Meier, Andrea S. Laimbacher)....Pages 111-130
oHSV Genome Editing by Means of galK Recombineering (Laura Menotti, Valerio Leoni, Valentina Gatta, Biljana Petrovic, Andrea Vannini, Simona Pepe et al.)....Pages 131-151
Rescue, Purification, and Characterization of a Recombinant HSV Expressing a Transgenic Protein (Andrea Vannini, Biljana Petrovic, Valentina Gatta, Valerio Leoni, Simona Pepe, Laura Menotti et al.)....Pages 153-168
CRISPR/Cas9-Based Genome Editing of HSV (Thilaga Velusamy, Anjali Gowripalan, David C. Tscharke)....Pages 169-183
Latent/Quiescent Herpes Simplex Virus 1 Genome Detection by Fluorescence In Situ Hybridization (FISH) (Camille Cohen, Armelle Corpet, Mohamed Ali Maroui, Franceline Juillard, Patrick Lomonte)....Pages 185-197
Oligonucleotide Enrichment of HSV-1 Genomic DNA from Clinical Specimens for Use in High-Throughput Sequencing (Mackenzie M. Shipley, Molly M. Rathbun, Moriah L. Szpara)....Pages 199-217
HSV Mutant Generation and Dual Detection Methods for Gaining Insight into Latent/Lytic Cycles In Vivo (Nancy M. Sawtell, Richard L. Thompson)....Pages 219-239
Phenotypic and Genotypic Testing of HSV-1 and HSV-2 Resistance to Antivirals (Andreas Sauerbrei, Kathrin Bohn-Wippert)....Pages 241-261
Using Primary SCG Neuron Cultures to Study Molecular Determinants of HSV-1 Latency and Reactivation (Hui-Lan Hu, Kalanghad Puthankalam Srinivas, Ian Mohr, Tony T. Huang, Angus C. Wilson)....Pages 263-277
Characterization of Extracellular HSV-1 Virions by Proteomics (Roger Lippé)....Pages 279-288
Analysis and Sorting of Individual HSV-1 Particles by Flow Virometry (Bita Khadivjam, Nabil El Bilali, Roger Lippé)....Pages 289-303
Isolation/Analysis of Extracellular Microvesicles from HSV-1-Infected Cells (Raquel Bello-Morales, José Antonio López-Guerrero)....Pages 305-317
Conformational Change in Herpes Simplex Virus Entry Glycoproteins Detected by Dot Blot (Tri Komala Sari, Katrina A. Gianopulos, Anthony V. Nicola)....Pages 319-326
BioID Combined with Mass Spectrometry to Study Herpesvirus Protein–Protein Interaction Networks (Mujeeb R. Cheerathodi, David G. Meckes Jr.)....Pages 327-341
Preparation of Herpes Simplex Virus-Infected Primary Neurons for Transmission Electron Microscopy (Monica Miranda-Saksena, Ross A. Boadle, Anthony L. Cunningham)....Pages 343-354
Transmission Immunoelectron Microscopy of Herpes Simplex Virus-1-Infected Dorsal Root Ganglia Neurons Sectioned in Growth Plane (Monica Miranda-Saksena, Ross A. Boadle, Anthony L. Cunningham)....Pages 355-364
Multifluorescence Live Analysis of Herpes Simplex Virus Type-1 Replication (Michael Seyffert, Cornel Fraefel)....Pages 365-376
Expression, Purification, and Crystallization of HSV-1 Glycoproteins for Structure Determination (Ellen M. White, Samuel D. Stampfer, Ekaterina E. Heldwein)....Pages 377-393
Expression, Purification, and Crystallization of Full-Length HSV-1 gB for Structure Determination (Rebecca S. Cooper, Ekaterina E. Heldwein)....Pages 395-407
The Use of Microfluidic Neuronal Devices to Study the Anterograde Axonal Transport of Herpes Simplex Virus-1 (Kevin Danastas, Anthony L. Cunningham, Monica Miranda-Saksena)....Pages 409-418
A Model of In Vivo HSV-1 DNA Transport Using Murine Retinal Ganglion Cells (Jennifer H. LaVail)....Pages 419-428
The Murine Intravaginal HSV-2 Challenge Model for Investigation of DNA Vaccines (Joshua O. Marshak, Lichun Dong, David M. Koelle)....Pages 429-454
Back Matter ....Pages 455-457

Citation preview

Methods in Molecular Biology 2060

Russell J. Diefenbach Cornel Fraefel Editors

Herpes Simplex Virus Methods and Protocols Second Edition

METHODS

IN

MOLECULAR BIOLOGY

Series Editor John M. Walker School of Life and Medical Sciences University of Hertfordshire Hatfield, Hertfordshire, UK

For further volumes: http://www.springer.com/series/7651

For over 35 years, biological scientists have come to rely on the research protocols and methodologies in the critically acclaimed Methods in Molecular Biology series. The series was the first to introduce the step-by-step protocols approach that has become the standard in all biomedical protocol publishing. Each protocol is provided in readily-reproducible step-bystep fashion, opening with an introductory overview, a list of the materials and reagents needed to complete the experiment, and followed by a detailed procedure that is supported with a helpful notes section offering tips and tricks of the trade as well as troubleshooting advice. These hallmark features were introduced by series editor Dr. John Walker and constitute the key ingredient in each and every volume of the Methods in Molecular Biology series. Tested and trusted, comprehensive and reliable, all protocols from the series are indexed in PubMed.

Herpes Simplex Virus Methods and Protocols Second Edition

Edited by

Russell J. Diefenbach Department of Biomedical Sciences, Macquarie University, Sydney, NSW, Australia

Cornel Fraefel Institute of Virology, University of Zurich, Zürich, Switzerland

Editors Russell J. Diefenbach Department of Biomedical Sciences Macquarie University Sydney, NSW, Australia

Cornel Fraefel Institute of Virology University of Zurich Zu¨rich, Switzerland

ISSN 1064-3745 ISSN 1940-6029 (electronic) Methods in Molecular Biology ISBN 978-1-4939-9813-5 ISBN 978-1-4939-9814-2 (eBook) https://doi.org/10.1007/978-1-4939-9814-2 © Springer Science+Business Media, LLC, part of Springer Nature 2020 This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, express or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Cover caption: HSV-1 virions in the extracellular space of Vero cells prepared for electron microscopy by high-pressure freezing, freeze-substitution, embedding in epon and ultrathin sectioning showing core, capsid, tegument, envelope and glycoproteins. The size difference is due to the section plane. Bar ¼ 100 nm. Elisabeth M. Schraner, Institute of Virology, University of Zurich, Zu¨rich, Switzerland. This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer Nature. The registered company address is: 233 Spring Street, New York, NY 10013, U.S.A.

Preface Herpes simplex viruses type 1 and 2 (HSV-1, HSV-2) are important human pathogens. HSV-1, for example, has a worldwide seroprevalence of more than 80% in adults. The virus typically enters orofacial mucosal epithelial cells, where productive infection takes place, but it can also infect genital mucosa epithelial cells. Productive replication in epithelial cells leads to release of progeny virus at the site of host entry, from where the virus can access neurons of the trigeminal ganglia to establish lifelong latency and to create a reservoir for periodic reactivation. In immunocompromised patients, HSV-1 can cause severe meningoencephalitis or keratoconjunctivitis that can lead to permanent neurological damage and death or blindness, respectively, if not treated. The herpes simplex viruses have been the prototype viruses of the Alphaherpesvirinae subfamily and have been extensively studied for decades on all aspects of infection, replication, and pathogenesis. HSV-1 and HSV-2 have also become important tools to study cell biology and immunology, and for the development of innovative vaccines and vectors for gene- and tumor therapy. It would be impossible to cover all aspects of methodology related to the investigation of herpes simplex viruses in one book. We hope in this second edition that we have again successfully encapsulated a significant breath of relevant methodology but also incorporated new rapidly developing technologies such as next-generation sequencing, CRISPR/Cas9 engineering, and the use of BioID to identify protein–protein interactions. The chapters contained within will be of interest to immunologists as well as molecular and cell biologists. It will appeal to those researchers who wish to initiate molecular- and/or cellular-based approaches to investigate HSV. Many of the techniques can be readily translated to other closely related herpesviruses. The first two chapters of this book include comprehensive reviews on HSV-1 biology and life cycle and the current state of play in antiviral and vaccine development. These are followed by a wide collection of protocols, including basic protocols on growing viruses in cell culture and manipulating viral DNA. Other chapters describe approaches to design and application of HSV-1 vectors for cancer- and gene therapy, or to study specific aspects of HSV-1 biology such as latency, intracellular transport, and protein–protein interaction using a number of cell culture and animal models. Rapidly developing areas such as the topic of extracellular vesicles, in the context of HSV-1, have also been included. Procedures for structural analyses, microscopy, proteomics, and testing of antivirals are included as well. The methods provided are intended to aid new researchers in the field of herpes virology as well as those experienced investigators wishing to embark on new techniques. We would like to thank all who have contributed to the completion of this book, in particular the authors of the chapters. We would also like to thank the editor of the Methods in Molecular Biology series, John Walker, for his constant support during the preparation of this volume. We gladly accepted John’s invitation to co-edit a second edition of a HSV protocols book largely based on our prior experience with the first edition and how well it

v

vi

Preface

has been received. Finally, we hope that our book will help many researchers in the herpes virus field in their pursuit of understanding the complex interactions between herpes virus and host. Still, much remains to be discovered! Sydney, NSW, Australia ¨ rich, Switzerland Zu

Russell J. Diefenbach Cornel Fraefel

Contents Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

v xi

1 Tour de Herpes: Cycling Through the Life and Biology of HSV-1 . . . . . . . . . . . . Christopher E. Denes, Roger D. Everett, and Russell J. Diefenbach 2 Vaccines for Herpes Simplex: Recent Progress Driven by Viral and Adjuvant Immunology. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Kerrie J. Sandgren, Naomi R. Truong, Jacinta B. Smith, Kirstie Bertram, and Anthony L. Cunningham 3 Herpes Simplex Virus Growth, Preparation, and Assay . . . . . . . . . . . . . . . . . . . . . . Sereina O. Sutter, Peggy Marconi, and Anita F. Meier 4 Engineering HSV-1 Vectors for Gene Therapy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . William F. Goins, Shaohua Huang, Bonnie Hall, Marco Marzulli, Justus B. Cohen, and Joseph C. Glorioso 5 Preparation of Herpes Simplex Virus Type 1 (HSV-1)-Based Amplicon Vectors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Cornel Fraefel and Alberto L. Epstein 6 HSV-1 Amplicon Vectors as Genetic Vaccines . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Anita F. Meier and Andrea S. Laimbacher 7 oHSV Genome Editing by Means of galK Recombineering . . . . . . . . . . . . . . . . . . Laura Menotti, Valerio Leoni, Valentina Gatta, Biljana Petrovic, Andrea Vannini, Simona Pepe, Tatiana Gianni, and Gabriella Campadelli-Fiume 8 Rescue, Purification, and Characterization of a Recombinant HSV Expressing a Transgenic Protein . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Andrea Vannini, Biljana Petrovic, Valentina Gatta, Valerio Leoni, Simona Pepe, Laura Menotti, Gabriella Campadelli-Fiume, and Tatiana Gianni 9 CRISPR/Cas9-Based Genome Editing of HSV. . . . . . . . . . . . . . . . . . . . . . . . . . . . . Thilaga Velusamy, Anjali Gowripalan, and David C. Tscharke 10 Latent/Quiescent Herpes Simplex Virus 1 Genome Detection by Fluorescence In Situ Hybridization (FISH) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Camille Cohen, Armelle Corpet, Mohamed Ali Maroui, Franceline Juillard, and Patrick Lomonte 11 Oligonucleotide Enrichment of HSV-1 Genomic DNA from Clinical Specimens for Use in High-Throughput Sequencing. . . . . . . . . . . . Mackenzie M. Shipley, Molly M. Rathbun, and Moriah L. Szpara 12 HSV Mutant Generation and Dual Detection Methods for Gaining Insight into Latent/Lytic Cycles In Vivo . . . . . . . . . . . . . . . . . . . . . . . Nancy M. Sawtell and Richard L. Thompson

1

vii

31

57 73

91 111 131

153

169

185

199

219

viii

13

14

15 16 17

18

19

20

21

22

23

24

25

Contents

Phenotypic and Genotypic Testing of HSV-1 and HSV-2 Resistance to Antivirals . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Andreas Sauerbrei and Kathrin Bohn-Wippert Using Primary SCG Neuron Cultures to Study Molecular Determinants of HSV-1 Latency and Reactivation . . . . . . . . . . . . . . . . . . . . . . . . . . Hui-Lan Hu, Kalanghad Puthankalam Srinivas, Ian Mohr, Tony T. Huang, and Angus C. Wilson Characterization of Extracellular HSV-1 Virions by Proteomics. . . . . . . . . . . . . . . Roger Lippe´ Analysis and Sorting of Individual HSV-1 Particles by Flow Virometry . . . . . . . . Bita Khadivjam, Nabil El Bilali, and Roger Lippe´ Isolation/Analysis of Extracellular Microvesicles from HSV-1-Infected Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Raquel Bello-Morales and Jose´ Antonio Lo pez-Guerrero Conformational Change in Herpes Simplex Virus Entry Glycoproteins Detected by Dot Blot . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Tri Komala Sari, Katrina A. Gianopulos, and Anthony V. Nicola BioID Combined with Mass Spectrometry to Study Herpesvirus Protein–Protein Interaction Networks . . . . . . . . . . . . . . . . . . . . . . . . . Mujeeb R. Cheerathodi and David G. Meckes Jr. Preparation of Herpes Simplex Virus-Infected Primary Neurons for Transmission Electron Microscopy . . . . . . . . . . . . . . . . . . . . . . . . . . . . Monica Miranda-Saksena, Ross A. Boadle, and Anthony L. Cunningham Transmission Immunoelectron Microscopy of Herpes Simplex Virus-1-Infected Dorsal Root Ganglia Neurons Sectioned in Growth Plane . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Monica Miranda-Saksena, Ross A. Boadle, and Anthony L. Cunningham Multifluorescence Live Analysis of Herpes Simplex Virus Type-1 Replication. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Michael Seyffert and Cornel Fraefel Expression, Purification, and Crystallization of HSV-1 Glycoproteins for Structure Determination . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Ellen M. White, Samuel D. Stampfer, and Ekaterina E. Heldwein Expression, Purification, and Crystallization of Full-Length HSV-1 gB for Structure Determination. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Rebecca S. Cooper and Ekaterina E. Heldwein The Use of Microfluidic Neuronal Devices to Study the Anterograde Axonal Transport of Herpes Simplex Virus-1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Kevin Danastas, Anthony L. Cunningham, and Monica Miranda-Saksena

241

263

279 289

305

319

327

343

355

365

377

395

409

Contents

26

27

ix

A Model of In Vivo HSV-1 DNA Transport Using Murine Retinal Ganglion Cells. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 419 Jennifer H. LaVail The Murine Intravaginal HSV-2 Challenge Model for Investigation of DNA Vaccines. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 429 Joshua O. Marshak, Lichun Dong, and David M. Koelle

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

455

Contributors RAQUEL BELLO-MORALES  Departamento de Biologı´a Molecular, Universidad Autonoma de Madrid, Madrid, Spain; Centro de Biologı´a Molecular Severo Ochoa, CSIC-UAM, Madrid, Spain KIRSTIE BERTRAM  Centre for Virus Research, The Westmead Institute for Medical Research, Westmead, NSW, Australia; Sydney Medical School, The University of Sydney, Westmead, NSW, Australia ROSS A. BOADLE  Westmead Research Hub, Westmead, NSW, Australia KATHRIN BOHN-WIPPERT  Department of Bioengineering, University of Illinois at UrbanaChampaign, Urbana, IL, USA GABRIELLA CAMPADELLI-FIUME  Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna, Italy MUJEEB R. CHEERATHODI  Department of Biomedical Sciences, Florida State University College of Medicine, Tallahassee, FL, USA CAMILLE COHEN  Univ Lyon, Universite´ Claude Bernard Lyon 1, CNRS UMR 5310, INSERM U 1217, LabEx DEVweCAN, Institut NeuroMyoGe`ne (INMG), Team Chromatin Assembly, Nuclear Domains, Virus, Lyon, France JUSTUS B. COHEN  Department of Microbiology and Molecular Genetics, University of Pittsburgh School of Medicine, Pittsburgh, PA, USA REBECCA S. COOPER  Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, MA, USA ARMELLE CORPET  Univ Lyon, Universite´ Claude Bernard Lyon 1, CNRS UMR 5310, INSERM U 1217, LabEx DEVweCAN, Institut NeuroMyoGe`ne (INMG), Team Chromatin Assembly, Nuclear Domains, Virus, Lyon, France ANTHONY L. CUNNINGHAM  Centre for Virus Research, The Westmead Institute for Medical Research, Westmead, NSW, Australia; Sydney Medical School, The University of Sydney, Westmead, NSW, Australia KEVIN DANASTAS  Centre for Virus Research, The Westmead Institute for Medical Research, Westmead, NSW, Australia; The University of Sydney, Westmead, NSW, Australia CHRISTOPHER E. DENES  Centre for Virus Research, The Westmead Institute for Medical Research, The University of Sydney, Westmead, NSW, Australia RUSSELL J. DIEFENBACH  Centre for Virus Research, The Westmead Institute for Medical Research, The University of Sydney, Westmead, NSW, Australia; Department of Biomedical Sciences, Faculty of Medicine and Health Sciences, Macquarie University, Sydney, NSW, Australia LICHUN DONG  Department of Medicine, University of Washington, Seattle, WA, USA NABIL EL BILALI  Department of Pathology and Cell Biology, University of Montreal, Montreal, QC, Canada ALBERTO L. EPSTEIN  UMR INSERM U1179, University of Versailles Saint Quentin en Yvelines (UVSQ), Montigny le Bretonneux, France ROGER D. EVERETT  MRC-University of Glasgow Centre for Virus Research, Glasgow, Scotland, UK CORNEL FRAEFEL  Institute of Virology, University of Zurich, Zu¨rich, Switzerland

xi

xii

Contributors

VALENTINA GATTA  Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna, Italy TATIANA GIANNI  Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna, Italy KATRINA A. GIANOPULOS  Department of Veterinary Microbiology and Pathology, College of Veterinary Medicine, Washington State University, Pullman, WA, USA; School of Molecular Biosciences, College of Veterinary Medicine, Washington State University, Pullman, WA, USA JOSEPH C. GLORIOSO  Department of Microbiology and Molecular Genetics, University of Pittsburgh School of Medicine, Pittsburgh, PA, USA WILLIAM F. GOINS  Department of Microbiology and Molecular Genetics, University of Pittsburgh School of Medicine, Pittsburgh, PA, USA ANJALI GOWRIPALAN  John Curtin School of Medical Research, The Australian National University, Canberra, ACT, Australia BONNIE HALL  Department of Microbiology and Molecular Genetics, University of Pittsburgh School of Medicine, Pittsburgh, PA, USA EKATERINA E. HELDWEIN  Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, MA, USA HUI-LAN HU  Department of Biochemistry and Molecular Pharmacology, New York University School of Medicine, New York, NY, USA SHAOHUA HUANG  Department of Microbiology and Molecular Genetics, University of Pittsburgh School of Medicine, Pittsburgh, PA, USA TONY T. HUANG  Department of Biochemistry and Molecular Pharmacology, New York University School of Medicine, New York, NY, USA FRANCELINE JUILLARD  Univ Lyon, Universite´ Claude Bernard Lyon 1, CNRS UMR 5310, INSERM U 1217, LabEx DEVweCAN, Institut NeuroMyoGe`ne (INMG), Team Chromatin Assembly, Nuclear Domains, Virus, Lyon, France BITA KHADIVJAM  Department of Pathology and Cell Biology, University of Montreal, Montreal, QC, Canada DAVID M. KOELLE  Department of Medicine, University of Washington, Seattle, WA, USA; Department of Laboratory Medicine, University of Washington, Seattle, WA, USA; Department of Global Health, University of Washington, Seattle, WA, USA; Vaccine and Infectious Diseases Division, Fred Hutchinson Cancer Research Center, Seattle, WA, USA; Benaroya Research Institute, Seattle, WA, USA ANDREA S. LAIMBACHER  Musculoskeletal Research Unit (MSRU), Vetsuisse Faculty, University of Zurich, Zu¨rich, Switzerland; Center for Applied Biotechnology and Molecular Medicine (CABMM), University of Zurich, Zu¨rich, Switzerland JENNIFER H. LAVAIL  Department of Anatomy, University of California San Francisco, San Francisco, CA, USA VALERIO LEONI  Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna, Italy ROGER LIPPE´  Department of Pathology and Cell Biology, University of Montreal, Montreal, QC, Canada PATRICK LOMONTE  Univ Lyon, Universite´ Claude Bernard Lyon 1, CNRS UMR 5310, INSERM U 1217, LabEx DEVweCAN, Institut NeuroMyoGe`ne (INMG), Team Chromatin Assembly, Nuclear Domains, Virus, Lyon, France

Contributors

xiii

JOSE´ ANTONIO LO´PEZ-GUERRERO  Departamento de Biologı´a Molecular, Universidad Autonoma de Madrid, Madrid, Spain; Centro de Biologı´a Molecular Severo Ochoa, CSICUAM, Madrid, Spain PEGGY MARCONI  Department of Chemical and Pharmaceutical Sciences (DipSCF), University of Ferrara, Ferrara, Italy MOHAMED ALI MAROUI  Univ Lyon, Universite´ Claude Bernard Lyon 1, CNRS UMR 5310, INSERM U 1217, LabEx DEVweCAN, Institut NeuroMyoGe`ne (INMG), Team Chromatin Assembly, Nuclear Domains, Virus, Lyon, France JOSHUA O. MARSHAK  Department of Medicine, University of Washington, Seattle, WA, USA MARCO MARZULLI  Department of Microbiology and Molecular Genetics, University of Pittsburgh School of Medicine, Pittsburgh, PA, USA DAVID G. MECKES JR.  Department of Biomedical Sciences, Florida State University College of Medicine, Tallahassee, FL, USA ANITA F. MEIER  Institute of Virology, Vetsuisse Faculty, University of Zurich, Zu¨rich, Switzerland LAURA MENOTTI  Department of Pharmacy and Biotechnology, University of Bologna, Bologna, Italy MONICA MIRANDA-SAKSENA  Centre for Virus Research, The Westmead Institute for Medical Research, Westmead, NSW, Australia; The University of Sydney, Westmead, NSW, Australia IAN MOHR  Department of Microbiology, New York University School of Medicine, New York, NY, USA ANTHONY V. NICOLA  Department of Veterinary Microbiology and Pathology, College of Veterinary Medicine, Washington State University, Pullman, WA, USA; School of Molecular Biosciences, College of Veterinary Medicine, Washington State University, Pullman, WA, USA SIMONA PEPE  Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna, Italy BILJANA PETROVIC  Nouscom Srl, Rome, Italy MOLLY M. RATHBUN  Department of Biochemistry and Molecular Biology, Center for Infectious Disease Dynamics, The Huck Institutes of the Life Sciences, Pennsylvania State University, University Park, PA, USA KERRIE J. SANDGREN  Centre for Virus Research, The Westmead Institute for Medical Research, Westmead, NSW, Australia; Sydney Medical School, The University of Sydney, Westmead, NSW, Australia TRI KOMALA SARI  Department of Veterinary Microbiology and Pathology, College of Veterinary Medicine, Washington State University, Pullman, WA, USA ANDREAS SAUERBREI  Section of Experimental Virology, Institute for Medical Microbiology, Jena University Hospital, Jena, Germany NANCY M. SAWTELL  Division of Infectious Diseases, Department of Pediatrics, Cincinnati Children’s Hospital Medical Center, Cincinnati, OH, USA MICHAEL SEYFFERT  Institute of Virology, University of Zurich, Zu¨rich, Switzerland MACKENZIE M. SHIPLEY  Department of Biochemistry and Molecular Biology, Center for Infectious Disease Dynamics, The Huck Institutes of the Life Sciences, Pennsylvania State University, University Park, PA, USA

xiv

Contributors

JACINTA B. SMITH  Centre for Virus Research, The Westmead Institute for Medical Research, Westmead, NSW, Australia; Sydney Medical School, The University of Sydney, Westmead, NSW, Australia KALANGHAD PUTHANKALAM SRINIVAS  Department of Microbiology, New York University School of Medicine, New York, NY, USA SAMUEL D. STAMPFER  Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, MA, USA SEREINA O. SUTTER  Institute of Virology, Vetsuisse Faculty, University of Zurich, Zu¨rich, Switzerland MORIAH L. SZPARA  Department of Biochemistry and Molecular Biology, Center for Infectious Disease Dynamics, The Huck Institutes of the Life Sciences, Pennsylvania State University, University Park, PA, USA RICHARD L. THOMPSON  Department of Molecular Genetics, Biochemistry, and Microbiology, University of Cincinnati College of Medicine, Cincinnati, OH, USA NAOMI R. TRUONG  Centre for Virus Research, The Westmead Institute for Medical Research, Westmead, NSW, Australia; Sydney Medical School, The University of Sydney, Westmead, NSW, Australia DAVID C. TSCHARKE  John Curtin School of Medical Research, The Australian National University, Canberra, ACT, Australia ANDREA VANNINI  Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna, Italy THILAGA VELUSAMY  John Curtin School of Medical Research, The Australian National University, Canberra, ACT, Australia ELLEN M. WHITE  Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, MA, USA ANGUS C. WILSON  Department of Microbiology, New York University School of Medicine, New York, NY, USA

Chapter 1 Tour de Herpes: Cycling Through the Life and Biology of HSV-1 Christopher E. Denes, Roger D. Everett, and Russell J. Diefenbach Abstract Herpes simplex virus type 1 (HSV-1) is a prevalent and important human pathogen that has been studied in a wide variety of contexts. This book provides protocols currently in use in leading laboratories in many fields of HSV-1 research. This introductory chapter gives a brief overview of HSV-1 biology and life cycle, covering basic aspects of virus structure, the prevalence of and diseases caused by the virus, replication in cultured cells, viral latency, antiviral defenses, and the mechanisms that the virus uses to counteract these defenses. Key words Herpes simplex virus type 1, HSV-1 biology, HSV-1 life cycle, Nomenclature

1

Introduction Herpes simplex virus type 1 (HSV-1) is a prevalent and important human pathogen. The model human alphaherpesvirus, HSV-1 provides an excellent experimental system to study many aspects of viral replication, virus–host interactions, and antiviral defense. This chapter aims to give a brief overview of the biology and life cycle of HSV-1 with sufficient information to place in context the chapters that follow. This chapter does not go into the details that can be found in many existing comprehensive reviews and book chapters, and accordingly mainly cites publications that serve as good starting points for the reader wishing to delve in more detail into HSV-1 research. Particularly recommended is a textbook edited by Sandra Weller [1].

2

Herpesviruses The Herpesviridae family within the order Herpesvirales includes a large number of individual virus species that have been isolated from an incredibly wide range of organisms, extending through the evolutionary scale from oysters to humans (for general reviews,

Russell J. Diefenbach and Cornel Fraefel (eds.), Herpes Simplex Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2060, https://doi.org/10.1007/978-1-4939-9814-2_1, © Springer Science+Business Media, LLC, part of Springer Nature 2020

1

2

Christopher E. Denes et al.

see refs. 2, 3). The genomes of herpesviruses range in size from around 125 to 230 kbp, encoding around 80–180 viral proteins. All are characterized by having enveloped particles (180 nm diameter in HSV-1) that include an icosahedral capsid (125 nm diameter in HSV-1) containing a large, double-stranded DNA genome (Fig. 1a). Between the outer shell of the capsid and the envelope

Fig. 1 HSV-1 virion structure, genome organization, and gene expression strategy. (a) A schematic and electron micrograph of the HSV-1 virion, illustrating the envelope with extending glycoproteins, the tegument and the nucleocapsid containing condensed dsDNA. (b) A conventional representation of the HSV-1 genome (prototype orientation), drawn to scale, showing the positions of the five immediate-early (IE) genes and their protein products. Please refer to the main text for descriptions of labels. (c) The gene expression program of HSV-1. VP16 in the viral tegument stimulates viral IE transcription, leading to the expression of five IE proteins. At least three of these (ICP4, ICP0, and ICP27) have major roles in stimulating transcription and expression of early and late genes, while ICP4 is also able to depress (autoregulate) IE transcription. Early gene expression is required for the initiation of viral DNA replication, while in turn late gene expression occurs much more efficiently once DNA replication has commenced

The Life and Biology of HSV-1

3

is a relatively unstructured layer known as the tegument, which contains a number of viral proteins that are important for efficient infection. The host cell-derived envelope includes multiple viral glycoproteins, many of which are key for virus adsorption to the cell surface, receptor recognition, and membrane fusion, enabling viral entry into the cell. Although herpesviruses rely on the transcriptional machinery of the host cell, they code for several proteins of their own that modulate transcription, RNA processing and translation, and produce the apparatus required for replicating viral DNA. The Herpesviridae family is further divided into three subfamilies [3] (alpha-, beta- and gammaherpesviridae) on the basis of their biological characteristics, genomic sequence relatedness, tissue and cell-type tropism, and cell types in which latent infections are established. The alphaherpesviridae subfamily, which includes human pathogens HSV-1, HSV-2, and varicella zoster virus, is defined by the characteristic ability to establish latent infections in neurons.

3

The HSV-1 Life Cycle In Vivo HSV-1 is carried by 45–90% of the population, with the higher prevalence in the developing world. Primary infection usually occurs at an early age, resulting in the establishment of latent infections in sensory neurons. Periodically the virus can reactivate, causing renewed episodes of clinical disease that enable transmission between individuals. The primary infection site for HSV-1 is most commonly the oral mucosa and less frequently the genital mucosa, but infections can also occur in other epithelial regions at the periphery. During the initial active infection, virus particles enter the axons of ganglionic neurons and travel to the nuclei located in the cell body where the viral genome is assembled into a repressed extrachromosomal chromatin structure. Although individual latently infected neurons may contain from tens to hundreds of viral genomes, lytic cycle viral genes are not expressed; viral DNA does not replicate and the great majority of the genome is transcriptionally silent. Only one group of viral transcripts, derived from a single primary transcript, is expressed, known as the latencyassociated transcripts (LATs). The LATs are noncoding and the most abundant is a stable intron that accumulates in the nuclei of latently infected neurons. As neurons are nondividing, the viral genomes are maintained despite the absence of replication, and the lack of viral protein expression in latently infected neurons means these cells are not susceptible to immunological surveillance. Put simply, latently infected neurons are maintained long-term; the virus cannot be eliminated and infection is lifelong.

4

Christopher E. Denes et al.

The most common clinical signs of HSV-1 infection are the characteristic minor lesions in the oral region (herpes labialis). These cold sores occur following reactivation of latent virus within infected neurons and transport in a retrograde manner down the axon to the peripheral site of the primary infection. Lytic infection (i.e., active genome replication, temporal gene expression, virus release) in the epithelia then gives rise to symptoms. In addition to the common cold sore, HSV-1 can also cause lesions at other sites, such as around the genital mucosa (herpes genitalis), on fingers (herpetic whitlow), at sites of abrasion (herpes gladiatorum) and on the eyelids (herpes blepharitis), and infection of the eye can also lead to conjunctivitis. Genital herpes (more often caused by HSV-2) can cause significant physical and psychological issues and is one of the most common sexually transmitted diseases. Due to the lesions caused by disease, herpes infections of the genital tract are associated with increased HIV susceptibility [4]. HSV-1 can also infect the corneal tissues in the eye, leading to herpes keratitis which results in corneal scarring and impairment or loss of sight. The most serious HSV-associated disease occurs when the virus enters the central nervous system, causing herpes encephalitis and although rare, this condition has a high mortality rate. Most HSV infections are just a minor irritation, but for the immunocompromised they can be much more serious if untreated. For example, genital herpes during late pregnancy necessitates caesarean delivery because HSV infections of newborns can be extremely damaging.

4 4.1

HSV-1 Treatment Antivirals

Despite considerable effort, there is no cure and still no vaccine for HSV-1. There are, however, effective antiviral drugs of which the most commonly used is acycloguanosine (acyclovir). This is a nucleoside analog that can be phosphorylated by virally- encoded thymidine kinase, but not the cellular form, with the produced nucleotide terminating DNA replication once incorporated into replicating DNA in virus-infected cells. Drugs such as acyclovir therefore limit lytic infections once they have reactivated, but they cannot eliminate the virus and so do not decrease the potential of future reactivation unless used for prophylaxis. Most tolerated newer antivirals follow a similar mechanism of action (with toxicity effects hampering the use of other drugs like foscarnet) and so new drugs targeting other stages of the viral life cycle are needed to address the emerging antiviral resistance seen in clinics. Prolonged use of antivirals is contributing to resistant strains being transmitted among the population, and the risk of increased disease severity in immunocompromised individuals

The Life and Biology of HSV-1

5

demands the development of new therapeutics. For recent reviews on current clinical practices and antiviral development, please refer to [5–8] and for further discussion see Chapter 2 of this book. 4.2

5

Vaccines

HSV-1 vaccine research has produced many vaccine candidates that have ultimately failed at human clinical trial stages. Therapeutic vaccination for such a prevalent virus would aim to reduce symptom severity, virus shedding and transmission, while preventative vaccination looks to block the initial infection of wild-type virus and limit transmission in this way. For recent reviews on the status of HSV vaccine development, refer to [7, 9, 10] and for further discussion see Chapter 2 of this book.

The HSV-1 Replication Cycle in Cultured Cells HSV-1 provides an excellent model for the study of herpesvirus infection in cultured cells because it replicates rapidly and efficiently in a wide variety of cell types. As such, historically it has been the most intensely studied of the herpesviruses, although in more recent years there has been greater emphasis on viruses of the beta- and gammaherpesviridae subfamilies. Here we describe the replication cycle of HSV-1 in cultured non-neuronal cells (Fig. 2). For recent reviews on the HSV-1 life cycle in epithelial cell and neuronal cells (including the role of the cytoskeleton during each stage), please refer to [11, 12] and references therein.

5.1 The HSV-1 Genome and Nomenclature

HSV-1 has a double-stranded DNA genome of approximately 152 kbp, varying slightly between laboratory strains and clinical isolates. Structurally, the genome is divided into distinct segments, comprising two major unique fragments (unique long or UL and unique short or US), each bounded by lengthy inverted repeats (RL and RS, with prefixes I or T denoting internal or terminal, and subscript indicating which unique region they border) which themselves are bounded by shorter repeated segments known as the “a” sequence (Fig. 1b). The “a” sequence is repeated in one or more copies at the IRL/IRS junction, and the presence of “a” sequences also at the termini of TRL and TRS enables inversion of the orientation of the unique segments with respect to each other, thus producing four genomic isomers in equal ratios and with equal functionality. Approximately 80 genes have been identified by direct study of transcripts and proteins, or by interpretation of open reading frames (ORFs) within the sequence. Nomenclature of most of the genes themselves is straightforward, simply by numbering from the left of the conventional genome isomer orientation and notation of the segment in which the gene lies; thus RL1, RL2, UL1–UL56, RS1 and US1–12 (refer to Table 1 for protein coding genes). Genes in the repeats are

6

Christopher E. Denes et al.

Fig. 2 HSV-1 entry, assembly and egress in cultured nonneuronal cells. HSV-1 glycoprotein C (gC) binds host cell surface receptors. Interactions between gD and gB/gH/gL facilitate binding and subsequent fusion of virus and host cell membranes for delivery of the tegument-wrapped nucleocapsid into the cytoplasm. Having been stripped of the outer tegument layer, inner tegument proteins recruit dynein motors to facilitate retrograde transport along microtubules toward the microtubule organizing center (MTOC). The nucleocapsid is transported to a nuclear pore where viral DNA is delivered through a vertex portal into the nucleus (shown in blue). Here viral DNA undergoes both transcription and replication. mRNA is delivered to and translated in the cytosol in a temporal manner (immediate-early, early, late). After DNA replication, the viral genome is packaged into an immature capsid before undergoing nuclear egress. The prevailing hypothesis for nuclear egress suggests that the nucleocapsid buds into the perinuclear space (in doing so attaining a primary envelope) before it fuses with the outer nuclear membrane (losing its primary envelope) and is released into the cytosol. Here the nucleocapsid matures further, attaining tegument proteins and envelope proteins processed at the endoplasmic reticulum (ER)/Golgi. The maturing virus is transported along microtubules by kinesin motors via the transGolgi network (TGN) or endosome, where the virus gains its fully matured host-derived envelope in a process of secondary envelopment, and finally the virus is released by exocytosis. Adapted from [11]

Neurovirulence factor ICP34.5 Protein γ134.5

RING-type E3 ubiquitin ligase ICP0 Trans-acting transcriptional protein ICP0

Envelope glycoprotein L (gL)

Uracil-DNA glycosylase (UDG) UNG

Nuclear phosphoprotein UL3

Nuclear protein UL4

DNA replication helicase (HELI)

Capsid portal protein

Cytoplasmic envelopment protein 1 (CEP1)

RL1 γ134.5

RL2

UL1

UL2

UL3

UL4

UL5

UL6

UL7

Systematic ORF notationa Recommended/alternative (RL/UL/RS/US) protein names

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

ICP0

n/a

n/a

ICP34.5

Virion polypeptide (VP)

n/a

Infected cell protein (ICP)

Table 1 Nomenclature used in HSV-1 research for established protein-coding genes

n/a

Immediateearly (IE)

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

Vmw110 IE1 Previously IE110

n/a

Vmw

n/a

n/a

n/a

n/a

n/a

n/a

2799

2818

2783

2782

2834

2768

n/a

n/a

(continued)

ABG.ABG/Cytoplasmic 2798 envelopment protein 1

ABG.ABG/Portal protein

ABG/DNA replication helicase

A/Nuclear protein UL4

A/Nuclear phosphoprotein UL3

ABG/Uracil DNA glycosylase

A.S/Glycoprotein L

n/a

α0

n/a

n/a

n/a

α Strict ortholog group gene nameb

Strict ortholog group numberb

The Life and Biology of HSV-1 7

n/a

DNA helicase/primase complex-associated protein (HEPA) Primase-associated factor

Replication origin-binding protein (OBP) OriBP

Envelope glycoprotein M (gM)

Cytoplasmic envelopment protein 3 (CEP3)

Alkaline nuclease

Serine/threonine-protein kinase UL13

Tegument protein UL14

Tripartite terminase subunit n/a 3 (TRM3) Terminase large subunit

Cytoplasmic envelopment protein 2 (CEP2)

UL8

UL9

UL10

UL11

UL12 UL12.5

UL13

UL14

UL15

UL16 n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

Virion polypeptide (VP)

n/a

Infected cell protein (ICP)

Systematic ORF notationa Recommended/alternative (RL/UL/RS/US) protein names

Table 1 (continued)

n/a

n/a

n/a

Vmw57

n/a

n/a

n/a

n/a

n/a

Vmw

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

Immediateearly (IE)

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

2821

2838

2831

2787

n/a

2812

ABG/Cytoplasmic 2816 envelopment protein 2

ABG/Tripartite terminase subunit 3

A/Tegument protein UL14

n/a

ABG/Alkaline nuclease

A/Cytoplasmic 2772 envelopment protein 3

ABG/Envelope glycoprotein M

Ab/Replication originbinding protein

ABG.ABg/DNA helicase 2800 primase complex associated protein

α Strict ortholog group gene nameb

Strict ortholog group numberb

8 Christopher E. Denes et al.

Major capsid protein (MCP) VP5

Envelope protein UL20

Tegument protein UL21

Envelope glycoprotein H (gH)

Thymidine kinase (tk)

Protein UL24

Capsid vertex component 2 (CVC2)

Capsid scaffolding protein Capsid protein P40 Virion structural protein UL26 Protease precursor

Major scaffolding protein

Envelope glycoprotein B (gB)

Tripartite terminase subunit n/a 1 (TRM1)

UL19

UL20

UL21

UL22

UL23

UL24

UL25

UL26

UL26.5

UL27

UL28

VP7

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

UL26 (codon n/a 248–635) ¼ VP21 UL26 (codons 1–247) ¼ VP24 UL26 (codons 307–635) ¼ VP22a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

Vmw155 n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

ICP5

ICP40

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

VP23

Triplex capsid protein 2 (TRX2)

UL18

n/a

Capsid vertex component 1 (CVC1)

UL17

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

ABG/Tripartite terminase subunit 1

ABG.AbG/Glycoprotein B

n/a

ABG/Capsid scaffolding protein

ABG/Capsid vertex component 2

ABG/Protein UL24

AG.A/Thymidine kinase

ABG/Envelope glycoprotein H

A/Tegument protein UL21

A/Protein UL20

ABG/Major capsid protein

ABG/Triplex capsid protein 2

ABG/Capsid vertex component 1

(continued)

2829

2802

n/a

2813

2815

2827

2835

2820

2788

2784

2823

2832

2814

The Life and Biology of HSV-1 9

DNA polymerase catalytic subunit

Nuclear egress protein 1 (NEC1)

Packaging protein UL32

Tripartite terminase subunit n/a 2 (TRM2)

Nuclear egress protein 2 (NEC2)

Small capsomere-interacting VP26 protein (SCP)

Large tegument protein deneddylase (LTP)

Inner tegument protein Viral deamidase UL37

Triplex capsid protein 1 (TRX1)

UL30

UL31

UL32

UL33

UL34

UL35

UL36

UL37

UL38

VP19C

n/a

VP1/2

n/a

n/a

n/a

n/a

Major DNA-binding protein n/a (DBP)

Virion polypeptide (VP)

UL29

Systematic ORF notationa Recommended/alternative (RL/UL/RS/US) protein names

Table 1 (continued)

ICP32

n/a

ICP1/2

n/a

n/a

n/a

n/a

n/a

n/a

ICP8

Infected cell protein (ICP)

Vmw51

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

Vmw

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

Immediateearly (IE)

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

2822

ABG/Triplex capsid protein VP19C

A/Inner tegument protein UL37

ABG.A/Large tegument protein deneddylase

A/Small capsomereinteracting protein

ABG/Nuclear egress protein 2

ABG/Tripartite terminase subunit 2

ABG/Packaging protein UL32

ABG/Nuclear egress protein 1

2833

2778

2797

2786

2825

2830

2826

2824

ABG.a/DNA polymerase 2805

ABG/Major DNA binding protein

α Strict ortholog group gene nameb

Strict ortholog group numberb

10 Christopher E. Denes et al.

n/a n/a

n/a

Virion host shutoff protein (vhs)

n/a DNA polymerase processivity factor DNA-binding protein UL42 Polymerase accessory protein (PAP)

Membrane protein UL43

Envelope glycoprotein C (gC)

Envelope protein UL45 18 kDa protein

Tegument protein UL46 VP11/12 Tegument protein VP11/12

Tegument protein UL47 82/81 kDa tegument protein

UL42

UL43

UL44

UL45

UL46

UL47

VP13/14

n/a

VP8

n/a

n/a

n/a

n/a

n/a

n/a

Vmw58

Vmw38

n/a

n/a

n/a

n/a

n/a

n/a

n/a

Vmw136 n/a

ICP19/20 Vmw82/ n/a 81

n/a

n/a

n/a

n/a

n/a

UL41

n/a

Ribonucleosidediphosphate reductase small subunit (RR2) Ribonucleotide reductase small subunit

ICP6

UL40

n/a

Ribonucleosidediphosphate reductase large subunit (RR1) Ribonucleotide reductase large subunit

UL39

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

2780

2929

n/a

2837

2801

A/Tegument protein UL47

A/Tegument protein UL46

S/Membrane protein UL45

(continued)

2790

2789

2914

A/Envelope glycoprotein 2773 C

A/Membrane protein UL43

A/DNA polymerase processivity factor

n/a

AG/Ribonucleosidediphosphate reductase small subunit

ABG.AG/ Ribonucleosidediphosphate reductase large subunit

The Life and Biology of HSV-1 11

VP16

Tegument protein VP16 Alpha trans-inducing protein αTIF

Tegument protein VP22

Envelope glycoprotein N (gN)

Deoxyuridine 50 -triphosphate nucleotidohydrolase, dUTPase (DUT) dUTP pyrophosphatase

Tegument protein UL51

DNA primase

Envelope glycoprotein K (gK) Syncytial protein

mRNA export factor

UL48

UL49

UL49A

UL50

UL51

UL52

UL53

UL54 n/a

n/a

n/a

ICP27

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

ICP39

ICP25

Virion polypeptide (VP)

VP22

Infected cell protein (ICP)

Systematic ORF notationa Recommended/alternative (RL/UL/RS/US) protein names

Table 1 (continued)

Vmw63

n/a

n/a

n/a

n/a

n/a

n/a

Vmw65

Vmw

IE2 Previously IE63

n/a

n/a

n/a

n/a

n/a

n/a

n/a

Immediateearly (IE)

2806

ABG.a/mRNA export factor

α27

2817

2791

2819

n/a

2777

2771

A/Envelope glycoprotein 2776 K

ABG/DNA primase

A/Tegument protein UL51

ABG/Deoxyuridine 50 -triphosphate nucleotidohydrolase

n/a

A/Glycoprotein N

A.S/Transactivating tegument protein VP16

n/a

n/a

n/a

n/a

n/a

n/a

n/a

α Strict ortholog group gene nameb

Strict ortholog group numberb

12 Christopher E. Denes et al.

Major viral transcription factor ICP4

Transcriptional regulator ICP22

Protein US2

Serine/threonine-protein kinase US3

Envelope glycoprotein G (gG)

Envelope glycoprotein J (gJ) n/a

Envelope glycoprotein D (gD)

Envelope glycoprotein I (gI) n/a g70

Envelope glycoprotein E (gE)

Protein US8A/US8.5

Envelope protein US9 10 kDa protein

RS1

US1

US2

US3

US4

US5

US6

US7

US8

US8A

US9

n/a

n/a

VP12.3, VP12.6

VP17, VP18

n/a

n/a

n/a

n/a

VP4

n/a

Protein UL56

UL56

n/a

Tegument protein UL55

UL55

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

ICP22

ICP4

n/a

n/a n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

Vmw68

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

IE4 Previously IE68

Vmw175 IE3 Previously IE175

n/a

n/a

A/Transcriptional regulator ICP22

α22

n/a

n/a

n/a

n/a

n/a

n/a

n/a

n/a

2912

n/a

2785

2920

2793

2779

2915

2792

A/Membrane protein U S9

n/a

A/Envelope glycoprotein E

A/Envelope glycoprotein I

(continued)

2781

n/a

2774

2775

S/Envelope glycoprotein 2910 D/G

S/Envelope glycoprotein J

n/a

A/Serine/threonineprotein kinase

S/virion protein US2

A/Major viral transcription factor ICP4

α4

n/a

S/Membrane protein UL56

A/Tegument protein UL55

n/a

n/a

The Life and Biology of HSV-1 13

Accessory factor US11

TAP transporter inhibitor

US11

US12

n/a

ICP47

n/a

n/a

Infected cell protein (ICP)

Vmw12

Vmw21

n/a

Vmw

IE5 Previously IE12

n/a

n/a

Immediateearly (IE)

n/a S/TAP transporter inhibitor ICP47

α47

A/Virion protein US10 n/a

n/a

α Strict ortholog group gene nameb

2918

n/a

2796

Strict ortholog group numberb

b

For protein naming, many contemporary papers add a “p” in front of the systematic notation to differentiate protein product from gene name Strict ortholog group (SOG) naming comes from a recent publication classifying Herpesviridae orthologs using domain-architecture aware inference of orthologs (DAIO) [13]

a

n/a

Virion protein US10

US10 n/a

Virion polypeptide (VP)

Systematic ORF notationa Recommended/alternative (RL/UL/RS/US) protein names

Table 1 (continued)

14 Christopher E. Denes et al.

The Life and Biology of HSV-1

15

duplicated and not distinguished by this annotation. Some genes have been identified subsequent to this original definition, and in most cases are named by fractional numbers (e.g., UL12.5). In the case of the immediate-early (IE) genes the nomenclature is more complicated, as in addition to their systematic identification (RL2, UL54, RS1, US1, and US12) they have also been named α genes (α0, α27, α4, α22, and α47) and IE genes (IE1, IE2, IE3, IE4, and IE5), respectively. The nomenclature of encoded proteins is yet more complex. Infected cell proteins (ICPs) have been named in (mostly) ascending order of gel mobility (ICP0–ICP47) while many older papers use a now obsolete system with the prefix Vmw followed by apparent molecular size (e.g., Vmw110 for ICP0). Proteins identified as components of the virus particle have the prefix VP, followed by a number which again derives from ascending order of gel mobility. Properly, the products of the genes identified in the systematic ORF notation system should be known, for example, as pUL12, but in practice the name of the protein and the gene are used interchangeably. Virion components are more commonly known by their VP numbers rather than by systematic gene number (e.g., the major capsid protein VP5), and many proteins have been named according to their function (e.g., thymidine kinase, tk, and all the glycoproteins, such as glycoprotein E or gE). Therefore, a given protein may variously be referred to by its systematic gene name, its ICP name, or its descriptive name (e.g., UL39, ICP6, ribonucleotide reductase large subunit RR1). In practice, the groups working on any particular protein tend to keep to only one of the possible names. A further complication is that the same systematic gene numbering system is used for all herpesviruses, and because gene presence and order differ, UL15, for example, of HSV-1 is not related to UL15 of HCMV. It is therefore helpful, where possible, to use descriptive names (for example, the gB proteins of HSV-1 and HCMV are indeed related). In this chapter, where systematic gene numbers are used, they will also be used to refer to the protein to avoid unnecessarily convoluted description. In order to minimize confusion and simplify interpretation between publications, this chapter presents a comprehensive table of all nomenclature formats (Table 1). 5.2

Virus Entry

HSV-1 entry into cells is a complex multistage process requiring both surface-expressed cellular receptors and viral envelope glycoproteins (reviewed in refs. 14–16). The initial interaction between cellular proteoglycans (such as heparan sulfate) and gC is followed by interactions between cellular receptors and gD (Fig. 2). The receptors for HSV-1 that have been identified include the herpes virus entry mediator (HVEM) and nectin-1. Next, binding of gD to its cellular receptor recruits a fusion complex of gB/gH/gL to

16

Christopher E. Denes et al.

trigger fusion between the viral and cellular membranes. Once released into the cytoplasm, viral capsids are carried in a dyneindependent manner, via binding of dynein to capsid-bound tegument protein VP1/2 (pUL36) [17], along microtubules toward the microtubule organizing center (MTOC), and thereafter to the nuclear envelope. One of the 12 capsid vertices comprises a dodecameric pUL6 portal complex and a complex of pUL17, pUL25, and pUL36 that facilitates binding of the portal complex to nuclear pore complexes at the nuclear envelope. Here, by a mechanism only starting to be understood, the C-terminus of pUL25 triggers uncoating of the viral genome and its subsequent release into the nucleoplasm [18–20]. 5.3 Viral Tegument Proteins

The herpesvirus tegument layer contains a large number of components, some in high abundance with others present in trace amounts, perhaps in some cases nonspecifically [21–23]. Tegument proteins are released into the cell following membrane fusion (Fig. 2) and therefore can have roles not only in virus particle assembly, but also in regulating the initial events of infection. There is evidence of some organization of the tegument, particularly the inner layer that is more tightly associated with the capsid. Many tegument proteins have defined functions that are important for efficient infection. pUL36 is the largest protein encoded by HSV-1 and is essential for both release of the viral genome from the capsid through the nuclear pore and for tegumentation and capsid envelopment. It has orthologs throughout the Herpesviridae, and it includes a domain with ubiquitin-specific protease activity [24]. VP16 (pUL48) is essential for particle assembly, interacts with many other viral tegument proteins, and has a major role in stimulating IE transcription (see below). The product of gene UL41, the vhs protein, destabilizes mRNAs and is required for shutoff of host protein synthesis. The pUL13 and pUS3 [25] tegument proteins are protein kinases known to phosphorylate other viral tegument components and are therefore, although individually nonessential, likely to be involved in tegument-related functions. Other major tegument proteins are VP22 (pUL49, which is very abundant and has multiple properties and functions; see refs. 26, 27 and references therein), VP13/14 (encoded by UL47), VP11/12 (encoded by UL46), and pUL37 [28]. A complex of tegument proteins pUL7 and pUL51 is necessary for effective virus assembly and is important for keeping infected cells attached to their surroundings during infection by forming focal adhesion complexes [29]. Intriguingly, important proteins such as ICP0 and ICP4 are also found in the tegument, but whether their presence in virus particles contributes to infection is currently unknown.

The Life and Biology of HSV-1

17

5.4 Viral Gene Expression

Temporal herpesviral gene expression can be divided into three groups named immediate-early (IE or α), early (or β) and late (or γ) (Fig. 1c). Functionally, these groups are defined by the following criteria: IE genes are the first to be transcribed via a process that uses the host transcriptional apparatus and, although stimulated by the viral tegument protein VP16, does not require de novo viral gene expression; early gene transcription requires the presence of functional IE proteins but occurs independently of viral DNA replication; late genes are transcribed only once viral DNA replication has commenced. Late genes can be further subdivided into leaky-late (γ1) and true-late (γ2) depending on how strict their requirement is for DNA replication. Although these groups may be easily distinguished through the use of viral mutants or inhibitors, it is perhaps misleading during normal infection to use the common phrase “tightly controlled temporal cycle” to describe viral gene expression. After the initial stages of a normal infection of cultured cells, both IE and early genes are expressed, and after DNA replication has commenced, all groups of viral genes may be expressed simultaneously (Fig. 2). The timescale of the replication cycle within a culture depends on both cell type and the input multiplicity of infection, but as a rough guide for most common laboratory cell types infected at a multiplicity sufficient to infect all the cells, maximum progeny viral yields are reached by ~24 h post infection. The three temporal groups of viral genes are also characterized by the sequence complexity of their promoter regions. IE genes are the most complex, with definitive sequence motifs (consensus TAATGARAT, where R is a purine) upstream of the core promoter that includes a TATA box and transcription factor binding sites. The TAATGARAT motif is bound by a tripartite complex of the viral protein VP16 and the cellular factors Oct1 and HCF, which brings the C-terminal transcriptional activation domain of VP16 into the vicinity of the promoter, thereby enhancing the assembly of active transcription complexes. Early gene promoters are simpler, with a TATA box and upstream transcription factor binding elements, while late gene promoters have only a TATA box and an initiator region.

5.5 Immediate-Early Proteins and Their Functions

The initial stages of infection are crucial for determining the outcome of HSV-1 engagement with a cell, and it is therefore not surprising that there has been much work on VP16-mediated activation of IE transcription and the functions of the IE proteins themselves. HSV-1 encodes five IE proteins, of which two (ICP4 and ICP27) are essential for productive infection (Fig. 1b, c). ICP4 (IE3) is a large 1298 amino acid protein (HSV-1 strain 17) that is required for early and late gene transcription. It possesses a DNA-binding domain that has a relaxed sequence specificity, enabling it to bind to multiple locations within the viral genome.

18

Christopher E. Denes et al.

It interacts with components of the cellular basal transcription apparatus in order to stimulate viral gene transcription (reviewed in ref. 30). ICP27 (IE2) is a multifunctional protein that enhances processing and export of viral mRNAs and in some cases stimulates their translation (reviewed in ref. 31). It is a representative of a small group of viral proteins for which orthologs exist in a wide range of herpesviruses. ICP0 (IE1) is another IE protein that has been the subject of a large body of research (reviewed in refs. 32–35). Although not absolutely essential for HSV-1 replication in cultured cells, it is extremely important for the biology of the virus. HSV-1 mutants lacking functional ICP0 are less likely to proceed into lytic replication, with the extent of this defect being cell-type dependent (of the order of 1000-fold in human diploid fibroblasts). Such mutants also reactivate from latency poorly in mouse models, while expression of ICP0 is sufficient to stimulate reactivation of HSV-1 from quiescence in cell culture models of latency. Biochemically, ICP0 is an E3 ubiquitin ligase that stimulates degradation of a number of cellular proteins, and the consequence of this activity is thought to impede cell-mediated restriction of viral gene expression [32]. ICP22 (IE4) is heavily phosphorylated and regulates the phosphorylation state of the C-terminal domain of RNA polymerase II (reviewed in ref. 36). Recent findings have shown a role for ICP22 in recruiting host cell complexes and transcription elongation factors to herpesviral genomes to facilitate efficient transcription of viral genes [37]. ICP22 is required for efficient infection of certain commonly used laboratory cell types and has been shown to impact host cell gene expression [38]. Unlike the other IE proteins, which are all involved in aspects of the regulation of viral gene expression, ICP47 (IE5) is a small protein that inhibits transport of virally derived peptides to MHC Class I molecules. ICP47 competitively binds the transporter associated with antigen processing (TAP) by forming a hairpin structure, prohibiting substrate binding and interfering with antigen presentation [39]. This suggests that herpesviral immune evasion strategies have evolved to occur during the very early stages of infection. 5.6 Viral DNA Replication

Viral DNA replication takes place in the nucleus and only commences after early gene expression has begun (Fig. 2). HSV-1 has three origins of DNA replication: one in each of the two repeated IRS sequences bounding the US region, and one in the middle of UL. The virus encodes all proteins required for replicating its DNA, including an origin recognition protein (pUL9), a tripartite helicase/primase complex (proteins pUL5, pUL8 and pUL52), a viral DNA polymerase and accessory protein (pUL30 and pUL42) and a major ssDNA-binding protein (ICP8, encoded by UL29). HSV-1

The Life and Biology of HSV-1

19

also encodes several proteins involved in nucleotide metabolism, including a thymidine kinase (pUL23), a two-subunit ribonucleotide reductase (encoded by UL39 and UL40), a deoxyuridine triphosphatase (pUL50), and a uracil DNA-glycosylase (pUL2). DNA replication involves the formation of long concatemers of viral DNA which are then processed into unit length molecules during packaging into new capsid particles. For many years, the accepted model for viral DNA replication was that the DNA circularized rapidly after nuclear entry, then replication occurred through a rolling circle mechanism. Circularization does not appear to occur during normal lytic infection and instead replication is driven via the formation of concatemers that initially form through recombination events in the terminal sequences [40, 41]. Recently, the annealing activity of ICP8 has been shown to be essential for viral DNA replication and adds support to the proposed mechanism of recombination-dependent replication (RDR) [42]. During replication, the UL and US regions can invert (due to their positions flanked by inverted repeats), resulting in the four isomeric genomes mentioned previously. Inversion is dependent on seven essential viral replication proteins and suggests viral DNA synthesis is intrinsically recombinogenic [43]. Further, pUL8 may have a function in generating the X- and Y-branched structures that are produced during HSV-1 replication which are themselves similar to recombination intermediates [44]. DNA replication occurs in nuclear locations known as viral replication compartments. The first step in this process appears to be the association of ICP4 with parental viral genomes to form prereplication compartments. Once the DNA replication proteins are expressed they are recruited into these compartments which develop into mature replication compartments by a multistage pathway [40]. Viral replication compartments expand, and although those developing from different parental viral genomes appear later to fuse and almost fill the nucleus, there is evidence that genomes derived from different initial centers do not substantially intermingle [45]. DNA replication is very efficient, producing the equivalent of many hundreds if not thousands of viral genome copies. 5.7 Capsid Assembly and DNA Packaging

The mature HSV-1 capsid is an icosahedral structure, 125 nm in diameter, containing 162 capsomers, each including either six (for hexons) or five (for pentons) molecules of the major capsid protein VP5 (pUL19). The VP5 molecules of hexons (but not pentons) bind one molecule of VP26 each, and between the hexons and pentons are triplexes composed of VP19C and VP23 (see ref. 46 for references and a more detailed description). One vertex of the structure forms the capsid portal that allows packaging of viral DNA into the maturing capsid. This is composed largely of pUL6, which forms a 12-membered ring with a central hole through

20

Christopher E. Denes et al.

which the DNA may pass. Other less abundant capsid components include pUL15, pUL17, pUL25, pUL28 and pUL33, which are involved in processing and packaging of replicated viral DNA. Newly synthesized HSV-1 capsid proteins accumulate in the nucleus and are assembled in an orderly manner into immature capsids, known as B-capsids, that also include the UL26.5-encoded scaffolding protein (VP21) and VP24 (encoded by UL26). The scaffold is dismantled by UL26-dependent cleavage and the DNA is then packaged through the portal to eventually form the mature C-capsids. A-capsids do not contain viral DNA and are likely to result from abortive packaging events. DNA packaging requires specific packaging sequences (pac1 and pac2) within the “a” segment of the genome, and proceeds from TRL toward the TRS end of the genome. The pUL12 alkaline exonuclease is required for processing the complex branched replicated viral DNA into a form suitable for packaging. Once an entire genome has been packaged into the capsid shell, a terminase complex comprising pUL15, pUL28, and pUL33 cleaves the concatemeric replicated DNA to release the unit length viral genome. pUL17 and pUL32 are also required for this process. pUL32 appears to be involved in disulfide bond formation during capsid assembly [47]. pUL17 forms part of the tripartite capsid vertex specific component (CVSC) and anchors this complex (also made up of pUL25 and pUL36) to the capsid, and is also required for viral DNA concatemer cleavage and packaging into capsids [46, 48, 49]. pUL25, which is another low abundance capsid component, is required to maintain the stability of packaged C-capsids. 5.8 Assembly of Virus Particles and Egress

Once the capsid has been assembled and DNA packaging completed in the nucleus, the nucleocapsid begins a complicated journey that results in the release of mature virus particles from the cell, complete with tegument and envelope (reviewed in refs. 21, 22, 50–52) (Fig. 2). The initial step is the budding of the capsid through the inner nuclear membrane into the perinuclear space via a process that requires the nuclear export complex which contains key viral proteins pUL31 and pUL33 [53]. Electron microscopy and other lines of evidence indicate that the primary enveloped particles in the perinuclear space do not include a full tegument and lack many of the glycoproteins of the mature particle. In the most widely accepted model, these particles then bud through the outer nuclear membrane via membrane fusion, thus releasing into the cytoplasm capsids that again lack an envelope. Capsids then associate with the membranes of Golgi vesicles, where the tegument and host-derived envelope (studded with mature viral glycoproteins) becomes assembled around the capsids as they bud into the vesicles [52]. Protein–protein interactions between envelope glycoproteins and the tegument anchor the membrane to the tegument layer surrounding the new capsid [23, 51, 52]. For

The Life and Biology of HSV-1

21

example, envelope protein gE requires binding of tegument proteins pUL11, pUL16 and pUL21 to its cytoplasmic tail to become fully functional in its role in egress and cell-to-cell spread [54]. Lastly, these vesicles are transported to the cytoplasmic membrane where they undergo membrane fusion and release the mature virus particles from the cell by exocytosis (Fig. 2). The mechanisms behind this transport are not yet understood. Recent structural analyses of proteins seemingly necessary for egress (e.g., pUL21 [55] and pUL37 [56]) and cell-to-cell spread may lead to new discoveries in this field as well as research into the cellular components hijacked for their activities [57–60].

6

Latent and Quiescent HSV-1 Infections Latency is the hallmark of herpesvirus biology, enabling a viral reservoir to be maintained in a high proportion of the population while evading host antiviral defenses. The core features of the establishment of HSV-1 latency in neurons after initial infection at the periphery were described above (see also refs. 61–65 for reviews). Once the viral genomes have entered the nucleus of the neuron, they are assembled into a chromatin structure resembling heterochromatin and become transcriptionally repressed [66]. At least some of these genomes appear to be sequestered within modified PML nuclear bodies (PML-NBs—see below for further details on these structures) [67]. While the great majority of the viral genome is transcriptionally silent during latency, the region that runs countersense to RL2 (which encodes IE protein ICP0) produces a family of RNAs known as the LATs that accumulate in the nucleus of some, but not all, latently infected cells. The LAT region has a chromatin structure distinct from that of the bulk of the viral genome, with more markers of active euchromatin. The prevailing view is that the LATs are noncoding; indeed, the most abundant is a nonpolyadenylated product that is a stable form of an excised intron [61]. The biological function of LATs remains enigmatic and controversial, despite decades of interest from a large number of investigators. It is generally accepted, however, that they are not essential for any stage of the latency program, but they have variously been linked to the efficiency of establishment of latency, or of reactivation [68], and with the efficiency of maintenance of latency perhaps through antiapoptotic functions (discussed in ref. 61). Studies into latency require conceptually and practically difficult experiments, and the results can be influenced by the virus strain and the animal model that is used; recent research has found that neuronal subtype can impact LAT promoter activity during latency [69]. It is eminently feasible that the influence of LATs is more marked in human infections than in the available rodent models and so the recent development of a scalable human cellular

22

Christopher E. Denes et al.

model of latent HSV-1 infection will support future research in this area [70]. LAT transcripts may also be processed to produce a number of miRNAs, some of which accumulate to high levels in latently infected cells [71]. Studies on the roles of these miRNAs during both lytic and latent infection are beginning to be developed [72]. Traditionally it is thought that the virus defaults to the latent pathway as a result of failed IE protein transcription (or dominantly efficient repression thereof) once the viral genome has entered the nucleus of the neuron. Certainly, it seems likely that delivery of the IE transcriptional activator VP16 from the tegument to the cell body might be inefficient in neurons after the long-distance migration of the capsid up the axon compared to the short distances travelled in non-neuronal cells. This assumption has been challenged by recent evidence that has highlighted the presence of some initial IE transcription in a substantial proportion of neurons in which latency becomes established, and in a lower proportion of cells some early and, in rare cells, even late gene transcription has occurred [73–75]. Equally, the assumption that latency is tightly maintained until a reactivation event causes clinically manifest symptoms has been challenged by recent evidence finding that subclinical reactivation events are common [76]. Therefore, the virus can be transmitted between individuals even without the obvious symptoms of a recurrent infection. 6.1 Quiescent Infections in Cultured Cells

7

While true latency can only be studied in animal models, there are a number of systems in which quiescent infections can be established in cultured cells (both fibroblasts and cells of neuronal origin) (reviewed in ref. 62). These systems use defective virus mutants and/or suboptimal, inhibitory infection conditions to repress viral gene expression, after which repressed viral genomes can be maintained in the cells for a number of days or even weeks. Among other things, these systems have been very useful for studies on the chromatin structure of quiescent viral genomes [77, 78], and they led to the discovery that ICP0 expression has dual roles in latency: the protein is sufficient to reactivate viral gene expression in quiescently infected cells [79] and is also able to promote LAT expression and maintain the latent state by promoting total histone and heterochromatin loading on the viral genome [80].

Antiviral Defenses and Viral Countermeasures This section provides an overview of the three major arms of cellular antiviral defenses and the mechanisms which HSV-1 may use to evade them.

The Life and Biology of HSV-1

23

Innate Immunity

Innate immunity comprises several aspects, including natural killer cells, the complement system, and interferon (IFN)-mediated defenses. For brevity, this section will discuss only the IFN-mediated defenses. IFNs are cytokines that are synthesized in response to pathogen infections. They engage with cell surface receptors and initiate signal transduction cascades which activate the synthesis of a large number of IFN-stimulated genes (ISGs), many of which encode proteins with antiviral properties. Infected cells can thus signal to neighboring uninfected cells through IFN production, thereby allowing an antiviral state to be developed before a virus engages a cell (reviewed in ref. 81). There is abundant evidence that IFN pathways inhibit HSV-1 infection both in animal models and in cultured cells (reviewed in ref. 82). A fascinating aspect of this topic is provided by the observation that HSV-1 infection triggers the synthesis of ISGs through both IFN-dependent and IFN-independent pathways. Infection with the virus stimulates pathways that lead to the activation of IFN regulatory factor 3 (IRF3), which then translocates to the nucleus to promote the formation of active transcription complexes on the IFN-β gene promoter. The IFN-β that is synthesized is then secreted so that it can bind to IFN receptors on the surface of other cells. This triggers the activation of the JAK/STAT signal transduction pathway leading to transcription of ISGs that include IFN-α, which further enhances the IFN response. Activation of IRF3 by HSV-1 infection also stimulates transcription of ISGs directly, even in the absence of IFN [82]. This antiviral response is, however, only readily detectable during infections with HSV-1 mutants defective in viral protein synthesis; thus the virus first activates and subsequently disarms IFN pathway responses.

7.2 HSV-1 Interference with the IFN Response

In common with many other viruses [81], HSV-1 encodes proteins that counteract IFN pathway defenses, either by impeding the signaling pathways, inhibiting synthesis of ISGs, or interfering with the antiviral functions of selected ISGs themselves. For example, ICP0 is required (but not sufficient) for inhibiting IRF3mediated IFN and ISG induction (discussed in ref. 82), and it also targets IFN pathway activation through the DNA sensor IFI16 [83]. The virion host shutoff factor (vhs, pUL41) promotes the degradation of host cell mRNAs and therefore inhibits IFN-stimulated gene expression. The UL34.5 product inhibits protein kinase R (PKR), a major ISG, and therefore relieves translational inhibition brought about by PKR through phosphorylation of the translation factor eIF2α. The tegument protein pUS11 is able to inhibit oligoadenylate synthetase (OAS), another major ISG. These and other aspects of the interplay between HSV-1 and innate immunity pathways are described in more detail elsewhere [83–87].

7.1

24

Christopher E. Denes et al.

7.3 Acquired Immunity

Individuals infected with HSV-1 mount robust humoral and cellmediated acquired immunity defenses. Antibody seropositivity is used as a diagnostic method for HSV-1 (and HSV-2) infection, and neutralizing antibodies directed against a range of viral proteins, particularly glycoproteins and other components of the virus particle, are produced in high titer (reviewed in ref. 84). However, this strong and persistent humoral response against the virus is insufficient to eliminate reactivation episodes, perhaps because spread of the virus from the reactivating neuron and through infected epithelia can occur by cell-to-cell spread. There is clearer evidence for the importance of cell-mediated immunity for containing and clearing active infections, as immunocompromised individuals (particularly those with low CD8+ T cells) suffer from more severe disease. T cells can infiltrate both the peripheral infection-site lesion and also the latently infected ganglion. It has been suggested that HSV-specific T cells within the ganglion control the infection at that site via mechanisms that do not involve clearance of the latently infected neurons but instead in some way enhance maintenance of latency (reviewed in refs. 84, 88). Interestingly, HSV-specific CD8+ T cells persist at the sites of HSV-2 peripheral lesions even after healing has been completed [89, 90]. These findings are consistent with the concept that latency is not simply an either/or situation. Increasing evidence proposes that latency involves frequent, subclinical reactivation episodes that are held in check by continuous CD8+ T cell immunological surveillance.

7.4 HSV-1 Evasion of the Acquired Immune Response

Compared to some other herpesviruses, whose latency mechanisms may involve more active viral replication, HSV-1 appears to express a relatively modest number of proteins that counteract the acquired immune response. The glycoproteins gE and gI act as Fc receptors to impede antibody mediated immunity (reviewed in ref. 84), while the IE protein ICP47 inhibits the loading of virus-specific peptides onto MHC class I molecules to reduce the potential for T cell recognition [91]. These and other aspects of HSV evasion of acquired immune responses are discussed in more detail in [84].

7.5 Intrinsic Immunity

The third and most recently recognized arm of antiviral defenses is known as intrinsic immunity, or intrinsic antiviral defense. This is a broad concept that involves the functions of constitutively expressed cellular proteins that act within an individual infected cell. Therefore, as opposed to innate and adaptive immunity, intrinsic immunity neither depends on signal transduction nor presence of antigen. Intrinsic immunity covers a wide range of cellular proteins that act on different viruses and at different stages of their life cycles. In many cases, viruses express proteins that counteract these cellular proteins that restrict the efficiency of the infection, such that the inhibitory effect becomes noticeable only when viruses lacking the relevant function are studied. Furthermore, even in

The Life and Biology of HSV-1

25

these cases the restriction can be overcome by high input doses of mutant virus. The restrictive proteins themselves are often expressed or act in a cell- or species-specific manner. Intrinsic immunity is a flexible concept that can cover many different aspects of virus infection. There is a 1000-fold decrease in probability that a restrictive cell infected with an ICP0-null mutant HSV-1 will progress to productive lytic infection, reflecting the actions of cellular intrinsic immunity restriction factors (reviewed in refs. 32, 34). The consequence of such restriction in the absence of ICP0 is that the viral genome is assembled into a repressed chromatin structure, enabling a quiescent infection to be established. There are a number of strands of research that are related to this eventuality, including the involvement of chromatin-modifying proteins and complexes [66, 78, 92–94] and the repressive effects of components of cellular nuclear substructures known as PML-NBs or ND10 [32, 34, 95]. These distinct punctate bodies are nucleated by the promyelocytic leukemia (PML) protein and their assembly requires that PML is modified by small ubiquitin-like proteins known as SUMO1, -2, and -3 [96]. PML and other major PML-NB components, such as Sp100, hDaxx, and ATRX, have all been linked with restriction of herpesvirus infections (reviewed in refs. 32, 34, 95–97). A striking feature of HSV-1 infection is that several PML-NB proteins are rapidly recruited to the parental viral genomes via a mechanism that involves SUMO modification and the ability of proteins to interact noncovalently with SUMO [98]. This response of this group of proteins correlates with their repressive effects on HSV-1 replication (reviewed in ref. 32). This restriction is overcome by ICP0, which induces the degradation of PML and several other SUMO-modified proteins and also inhibits the recruitment of this group of proteins to the viral genome [32]. For further discussion of these topics, along with the mechanisms used by ICP0 to overcome these defenses, please refer to the cited reviews and publications.

8

Concluding Remarks Clinically, HSV-1 is an important human pathogen, widely prevalent in society, but it is also important because it provides excellent experimental systems for studying many aspects of virology and virus–cell interactions. Decades of research have provided incredibly valuable insight into subjects extending beyond virology, such as cell biology and the regulation of many cellular processes. This chapter aims to take a quick tour through herpes virus research, providing a comprehensive but surface review on the biology and life cycle of the virus, including virus structure, prevalence and disease, replication in cultured cells, latency, antiviral defense,

26

Christopher E. Denes et al.

and viral mechanisms to overcome the cellular response. The following chapters provide detailed protocols currently in use in labs across the world at the forefront of HSV-1 research.

Acknowledgments This work was funded by the UK Medical Research Council (to R. D.E.) and the Australian National Health and Medical Research Council (to R.J.D.). An Australian Government Research Training Program stipend was awarded to C.E.D. The authors are very grateful for the TEM image provided by Dr. Monica MirandaSaksena that is presented in Fig. 1a. References 1. Weller SK (2011) Alphaherpesviruses. Molecular virology. Caister Academic Press, Norfolk, UK 2. Knipe DM, Howley PM (2013) Fields virology. Lippincott Williams and Wilkins, Philadelphia, PA 3. Davison AJ, Eberle R, Ehlers B, Hayward GS, McGeoch DJ, Minson AC, Pellett PE, Roizman B, Studdert MJ, Thiry E (2009) The order Herpesvirales. Arch Virol 154:171–177 4. Looker KJ, Elmes JAR, Gottlieb SL, Schiffer JT, Vickerman P, Turner KME, Boily MC (2017) Effect of HSV-2 infection on subsequent HIV acquisition: an updated systematic review and meta-analysis. Lancet Infect Dis 17:1303–1316 5. Kukhanova MK, Korovina AN, Kochetkov SN (2014) Human herpes simplex virus: life cycle and development of inhibitors. Biochemistry 79:1635–1652 6. Birkmann A, Zimmermann H (2016) HSV antivirals - current and future treatment options. Curr Opin Virol 18:9–13 7. Whitley R, Baines J (2018) Clinical management of herpes simplex virus infections: past, present, and future. F1000Res 7. https://doi. org/10.12688/f1000research.16157.1 8. Shiraki K (2018) Antiviral drugs against alphaherpesvirus. Adv Exp Med Biol 1045:103–122 9. Johnston C, Gottlieb SL, Wald A (2016) Status of vaccine research and development of vaccines for herpes simplex virus. Vaccine 34:2948–2952 10. Rajcani J, Banati F, Szenthe K, Szathmary S (2018) The potential of currently unavailable herpes virus vaccines. Expert Rev Vaccines 17:239–248

11. Denes CE, Miranda-Saksena M, Cunningham AL, Diefenbach RJ (2018) Cytoskeletons in the closet-subversion in alphaherpesvirus infections. Viruses 10:E79 12. Miranda-Saksena M, Denes CE, Diefenbach RJ, Cunningham AL (2018) Infection and transport of herpes simplex virus type 1 in neurons: role of the cytoskeleton. Viruses 10:E92 13. Zmasek CM, Knipe DM, Pellett PE, Scheuermann RH (2019) Classification of human Herpesviridae proteins using domain-architecture aware inference of orthologs (DAIO). Virology 529:29–42 14. Eisenberg RJ, Heldwein EE, Cohen GH, Krummenacher C (2011) Recent progress in understanding herpes simplex virus entry: relationship of structure to function. In: Weller SK (ed) Alphaherpesviruses. Molecular virology. Caister Academic Press, Norfolk, UK, pp 131–152 15. Agelidis AM, Shukla D (2015) Cell entry mechanisms of HSV: what we have learned in recent years. Future Virol 10:1145–1154 16. Arii J, Kawaguchi Y (2018) The role of HSV glycoproteins in mediating cell entry. Adv Exp Med Biol 1045:3–21 17. Zaichick SV, Bohannon KP, Hughes A, Sollars PJ, Pickard GE, Smith GA (2013) The herpesvirus VP1/2 protein is an effector of dyneinmediated capsid transport and neuroinvasion. Cell Host Microbe 13:193–203 18. Preston VG, Murray J, Preston CM, McDougall IM, Stow ND (2008) The UL25 gene product of herpes simplex virus type 1 is involved in uncoating of the viral genome. J Virol 82:6654–6666 19. Huffman JB, Daniel GR, Falck-Pedersen E, Huet A, Smith GA, Conway JF, Homa FL (2017) The C terminus of the herpes simplex

The Life and Biology of HSV-1 virus UL25 protein is required for release of viral genomes from capsids bound to nuclear pores. J Virol 91:e00641–e00617 20. McElwee M, Vijayakrishnan S, Rixon F, Bhella D (2018) Structure of the herpes simplex virus portal-vertex. PLoS Biol 16:e2006191 21. Mettenleiter TC, Klupp BG, Granzow H (2009) Herpesvirus assembly: an update. Virus Res 143:222–234 22. Mettenleiter TC, Minson T (2006) Egress of alphaherpesviruses. J Virol 80:1610–1611 23. Diefenbach RJ (2015) Conserved tegument protein complexes: essential components in the assembly of herpesviruses. Virus Res 210:308–317 24. Abaitua F, Souto RN, Browne H, Daikoku T, O’Hare P (2009) Characterization of the herpes simplex virus (HSV)-1 tegument protein VP1-2 during infection with the HSV temperature-sensitive mutant tsB7. J Gen Virol 90:2353–2363 25. Kato A, Kawaguchi Y (2018) Us3 protein kinase encoded by HSV: the precise function and mechanism on viral life cycle. Adv Exp Med Biol 1045:45–62 26. Maringer K, Stylianou J, Elliott G (2012) A network of protein interactions around the herpes simplex virus tegument protein VP22. J Virol 86:12971–12982 27. Sciortino MT, Taddeo B, Giuffre-CucullettoM, Medici MA, Mastino A, Roizman B (2007) Replication-competent herpes simplex virus 1 isolates selected from cells transfected with a bacterial artificial chromosome DNA lacking only the UL49 gene vary with respect to the defect in the UL41 gene encoding host shutoff RNase. J Virol 81:10924–10932 28. Mettenleiter TC (2002) Herpesvirus assembly and egress. J Virol 76:1537–1547 29. Albecka A, Owen DJ, Ivanova L, Brun J, Liman R, Davies L, Ahmed MF, Colaco S, Hollinshead M, Graham SC, Crump CM (2017) Dual function of the pUL7-pUL51 tegument protein complex in herpes simplex virus 1 infection. J Virol 91:e02196–e02116 30. DeLuca NA (2011) Functions and mechanism of action of the herpes simplex virus regulatory protein, ICP4. In: Weller SK (ed) Alphaherpesviruses. Molecular virology. Caister Academic Press, Norfolk, UK, pp 17–38 31. Sandri-Goldin RM (2011) The functions and activities of HSV-1 ICP27, a multifunctional regulator of gene expression. In: Weller SK (ed) Alphaherpesviruses. Molecular virology. Caister Academic Press, Norfolk, UK, pp 39–50

27

32. Boutell C, Everett RD (2013) The regulation of alphaherpesvirus infections by the ICP0 family of proteins. J Gen Virol 94:465–481 33. Everett RD (2006) The roles of ICP0 during HSV-1 infection. In: Sandri-Goldin RM (ed) Alpha herpesviruses. Molecular and cellular biology. Caister Academic Press, Wymondham, pp 39–64 34. Everett RD (2011) The role of ICP0 in counteracting intrinsic cellular resistance to virus infection. In: Weller SK (ed) Alphaherpesviruses: molecular virology. Caister Academic Press, Norfolk, UK, pp 51–72 35. Hagglund R, Roizman B (2004) Role of ICP0 in the strategy of conquest of the host cell by herpes simplex virus 1. J Virol 78:2169–2178 36. Rice SA (2011) Multiple roles of immediateearly protein ICP22 in HSV-1 replication. In: Weller SK (ed) Alphaherpesviruses. Molecular virology. Caister Academic Press, Norfolk, UK, pp 73–88 37. Fox HL, Dembowski JA, DeLuca NA (2017) A herpesviral immediate early protein promotes transcription elongation of viral transcripts. MBio 8:e00745–e00717 38. Zaborowska J, Baumli S, Laitem C, O’Reilly D, Thomas PH, O’Hare P, Murphy S (2014) Herpes simplex virus 1 (HSV-1) ICP22 protein directly interacts with cyclin-dependent kinase (CDK)9 to inhibit RNA polymerase II transcription elongation. PLoS One 9:e107654 39. Oldham ML, Hite RK, Steffen AM, Damko E, Li Z, Walz T, Chen J (2016) A mechanism of viral immune evasion revealed by cryo-EM analysis of the TAP transporter. Nature 529:537–540 40. Ward SA, Weller SK (2011) HSV-1 DNA replication. In: Weller SK (ed) Alphaherpesviruses. Molecular virology. Caister Academic Press, Norfolk, UK, pp 89–112 41. Wilkinson DE, Weller SK (2003) The role of DNA recombination in herpes simplex virus DNA replication. IUBMB Life 55:451–458 42. Weerasooriya S, DiScipio KA, Darwish AS, Bai P, Weller SK (2019) Herpes simplex virus 1 ICP8 mutant lacking annealing activity is deficient for viral DNA replication. Proc Natl Acad Sci U S A 116:1033 43. Weber PC, Challberg MD, Nelson NJ, Levine M, Glorioso JC (1988) Inversion events in the HSV-1 genome are directly mediated by the viral DNA replication machinery and lack sequence specificity. Cell 54:369–381 44. Bermek O, Weller SK, Griffith JD (2017) The UL8 subunit of the helicase-primase complex of herpes simplex virus promotes DNA

28

Christopher E. Denes et al.

annealing and has a high affinity for replication forks. J Biol Chem 292:15611–15621 45. Sourvinos G, Everett RD (2002) Visualization of parental HSV-1 genomes and replication compartments in association with ND10 in live infected cells. EMBO J 21:4989–4997 46. Heming JD, Conway JF, Homa FL (2017) Herpesvirus capsid assembly and DNA packaging. Adv Anat Embryol Cell Biol 223:119–142 47. Albright BS, Kosinski A, Szczepaniak R, Cook EA, Stow ND, Conway JF, Weller SK (2015) The putative herpes simplex virus 1 chaperone protein UL32 modulates disulfide bond formation during infection. J Virol 89:443–453 48. Salmon B, Cunningham C, Davison AJ, Harris WJ, Baines JD (1998) The herpes simplex virus type 1 U(L)17 gene encodes virion tegument proteins that are required for cleavage and packaging of viral DNA. J Virol 72:3779–3788 49. Wang J, Yuan S, Zhu D, Tang H, Wang N, Chen W, Gao Q, Li Y, Wang J, Liu H, Zhang X, Rao Z, Wang X (2018) Structure of the herpes simplex virus type 2 C-capsid with capsid-vertex-specific component. Nat Commun 9:3668 50. Mettenleiter TC, Muller F, Granzow H, Klupp BG (2013) The way out: what we know and do not know about herpesvirus nuclear egress. Cell Microbiol 15:170–178 51. Crump C (2018) Virus assembly and egress of HSV. Adv Exp Med Biol 1045:23–44 52. Owen DJ, Crump CM, Graham SC (2015) Tegument assembly and secondary envelopment of alphaherpesviruses. Viruses 7:5084–5114 53. Bigalke JM, Heldwein EE (2017) Have NEC coat, will travel: structural basis of membrane budding during nuclear egress in herpesviruses. Adv Virus Res 97:107–141 54. Han J, Chadha P, Starkey JL, Wills JW (2012) Function of glycoprotein E of herpes simplex virus requires coordinated assembly of three tegument proteins on its cytoplasmic tail. Proc Natl Acad Sci U S A 109:19798–19803 55. Metrick CM, Heldwein EE (2016) Novel structure and unexpected RNA-binding ability of the C-terminal domain of herpes simplex virus 1 tegument protein UL21. J Virol 90:5759–5769 56. Koenigsberg AL, Heldwein EE (2018) The dynamic nature of the conserved tegument protein UL37 of herpesviruses. J Biol Chem 293:15827–15839 57. Raza S, Alvisi G, Shahin F, Husain U, Rabbani M, Yaqub T, Anjum AA, Sheikh AA, Nawaz M, Ali MA (2018) Role of Rab GTPases in HSV-1 infection: molecular understanding

of viral maturation and egress. Microb Pathog 118:146–153 58. Roussel E, Lippe R (2018) Cellular protein kinase D modulators play a role during multiple steps of herpes simplex virus 1 egress. J Virol 92:e01486–e01418 59. Albecka A, Laine RF, Janssen AF, Kaminski CF, Crump CM (2016) HSV-1 glycoproteins are delivered to virus assembly sites through dynamin-dependent endocytosis. Traffic 17:21–39 60. Carmichael JC, Yokota H, Craven RC, Schmitt A, Wills JW (2018) The HSV-1 mechanisms of cell-to-cell spread and fusion are critically dependent on host PTP1B. PLoS Pathog 14:e1007054 61. Bloom DC, Kwiatkowski DL (2011) HSV-1 latency and the roles of LATs. In: Weller SK (ed) Alphaherpesviruses. Molecular virology. Caister Academic Press, Norfolk, UK, pp 295–316 62. Efstathiou S, Preston CM (2005) Towards an understanding of the molecular basis of herpes simplex virus latency. Virus Res 111:108–119 63. Nicoll MP, Proenca JT, Efstathiou S (2012) The molecular basis of herpes simplex virus latency. FEMS Microbiol Rev 36:684–705 64. Phelan D, Barrozo ER, Bloom DC (2017) HSV1 latent transcription and non-coding RNA: a critical retrospective. J Neuroimmunol 308:65–101 65. Collins-McMillen D, Goodrum FD (2017) The loss of binary: pushing the herpesvirus latency paradigm. Curr Clin Microbiol Rep 4:124–131 66. Knipe DM, Cliffe A (2008) Chromatin control of herpes simplex virus lytic and latent infection. Nat Rev Microbiol 6:211–221 67. Catez F, Picard C, Held K, Gross S, Rousseau A, Theil D, Sawtell N, Labetoulle M, Lomonte P (2012) HSV-1 genome subnuclear positioning and associations with host-cell PML-NBs and centromeres regulate LAT locus transcription during latency in neurons. PLoS Pathog 8:e1002852 68. Watson ZL, Washington SD, Phelan DM, Lewin AS, Tuli SS, Schultz GS, Neumann DM, Bloom DC (2018) In vivo knockdown of the herpes simplex virus 1 latency-associated transcript reduces reactivation from latency. J Virol 92:e00812–e00818 69. Cabrera JR, Charron AJ, Leib DA (2018) Neuronal subtype determines herpes simplex virus 1 latency-associated-transcript promoter activity during latency. J Virol 92:JVI.00430-00418 70. Edwards TG, Bloom DC (2019) Lund human mesencephalic (LUHMES) neuronal cell line

The Life and Biology of HSV-1 supports HSV-1 latency in vitro. J Virol 93: e02210–e02218 71. Umbach JL, Kramer MF, Jurak I, Karnowski HW, Coen DM, Cullen BR (2008) MicroRNAs expressed by herpes simplex virus 1 during latent infection regulate viral mRNAs. Nature 454:780–783 72. Flores O, Nakayama S, Whisnant AW, Javanbakht H, Cullen BR, Bloom DC (2013) Mutational inactivation of herpes simplex virus 1 microRNAs identifies viral mRNA targets and reveals phenotypic effects in culture. J Virol 87:6589–6603 73. Nicoll MP, Proenca JT, Connor V, Efstathiou S (2012) Influence of herpes simplex virus 1 latency-associated transcripts on the establishment and maintenance of latency in the ROSA26R reporter mouse model. J Virol 86:8848–8858 74. Proenca JT, Coleman HM, Connor V, Winton DJ, Efstathiou S (2008) A historical analysis of herpes simplex virus promoter activation in vivo reveals distinct populations of latently infected neurones. J Gen Virol 89:2965–2974 75. Proenca JT, Coleman HM, Nicoll MP, Connor V, Preston CM, Arthur J, Efstathiou S (2011) An investigation of herpes simplex virus promoter activity compatible with latency establishment reveals VP16-independent activation of immediate-early promoters in sensory neurones. J Gen Virol 92:2575–2585 76. Ramchandani M, Kong M, Tronstein E, Selke S, Mikhaylova A, Magaret A, Huang ML, Johnston C, Corey L, Wald A (2016) Herpes simplex virus type 1 shedding in tears and nasal and oral mucosa of healthy adults. Sex Transm Dis 43:756–760 77. Ferenczy MW, DeLuca NA (2009) Epigenetic modulation of gene expression from quiescent herpes simplex virus genomes. J Virol 83:8514–8524 78. Ferenczy MW, DeLuca NA (2011) Reversal of heterochromatic silencing of quiescent herpes simplex virus type 1 by ICP0. J Virol 85:3424–3435 79. Harris RA, Everett RD, Zhu XX, Silverstein S, Preston CM (1989) Herpes simplex virus type 1 immediate-early protein Vmw110 reactivates latent herpes simplex virus type 2 in an in vitro latency system. J Virol 63:3513–3515 80. Raja P, Lee JS, Pan D, Pesola JM, Coen DM, Knipe DM (2016) A herpesviral lytic protein regulates the structure of latent viral chromatin. MBio 7:e00633–e00616 81. Randall RE, Goodbourn S (2008) Interferons and viruses: an interplay between induction,

29

signalling, antiviral responses and virus countermeasures. J Gen Virol 89:1–47 82. Sobol PT, Mossman KL (2011) Mechanisms of subversion of type I interferon responses by alphaherpesviruses. In: Weller SK (ed) Alphaherpesviruses. Molecular virology. Caister Academic Press, Norfolk, UK, pp 219–336 83. Orzalli MH, DeLuca NA, Knipe DM (2012) Nuclear IFI16 induction of IRF-3 signaling during herpesviral infection and degradation of IFI16 by the viral ICP0 protein. Proc Natl Acad Sci U S A 109:E3008–E3017 84. Jerome KR (2011) Immunity to herpes simplex virus. In: Weller SK (ed) Alphaherpesviruses. Molecular virology. Caister Academic Press, Norfolk, UK, pp 331–350 85. Luecke S, Paludan SR (2015) Innate recognition of alphaherpesvirus DNA. Adv Virus Res 92:63–100 86. Kurt-Jones EA, Orzalli MH, Knipe DM (2017) Innate immune mechanisms and herpes simplex virus infection and disease. Adv Anat Embryol Cell Biol 223:49–75 87. Su C, Zhan G, Zheng C (2016) Evasion of host antiviral innate immunity by HSV-1, an update. Virol J 13:38 88. Zhang J, Liu H, Wei B (2017) Immune response of T cells during herpes simplex virus type 1 (HSV-1) infection. J Zhejiang Univ Sci B 18:277–288 89. Zhu J, Koelle DM, Cao J, Vazquez J, Huang ML, Hladik F, Wald A, Corey L (2007) Virusspecific CD8+ T cells accumulate near sensory nerve endings in genital skin during subclinical HSV-2 reactivation. J Exp Med 204:595–603 90. Zhu J, Peng T, Johnston C, Phasouk K, Kask AS, Klock A, Jin L, Diem K, Koelle DM, Wald A, Robins H, Corey L (2013) Immune surveillance by CD8alphaalpha+ skin-resident T cells in human herpes virus infection. Nature 497:494–497 91. Hill A, Jugovic P, York I, Russ G, Bennink J, Yewdell J, Ploegh H, Johnson D (1995) Herpes simplex virus turns off the TAP to evade host immunity. Nature 375:411–415 92. Ferenczy MW, Ranayhossaini DJ, Deluca NA (2011) Activities of ICP0 involved in the reversal of silencing of quiescent herpes simplex virus 1. J Virol 85:4993–5002 93. Gu H, Roizman B (2007) Herpes simplex virus-infected cell protein 0 blocks the silencing of viral DNA by dissociating histone deacetylases from the CoREST-REST complex. Proc Natl Acad Sci U S A 104:17134–17139 94. Gu H, Roizman B (2009) The two functions of herpes simplex virus 1 ICP0, inhibition of

30

Christopher E. Denes et al.

silencing by the CoREST/REST/HDAC complex and degradation of PML, are executed in tandem. J Virol 83:181–187 95. Glass M, Everett RD (2013) Components of promyelocytic leukemia nuclear bodies (ND10) act cooperatively to repress herpesvirus infection. J Virol 87:2174–2185 96. Everett RD, Boutell C, Hale BG (2013) Interplay between viruses and host sumoylation pathways. Nat Rev Microbiol 11:400–411

97. Tavalai N, Stamminger T (2008) New insights into the role of the subnuclear structure ND10 for viral infection. Biochim Biophys Acta 1783:2207–2221 98. Cuchet-Lourenco D, Boutell C, Lukashchuk V, Grant K, Sykes A, Murray J, Orr A, Everett RD (2011) SUMO pathway dependent recruitment of cellular repressors to herpes simplex virus type 1 genomes. PLoS Pathog 7:e1002123

Chapter 2 Vaccines for Herpes Simplex: Recent Progress Driven by Viral and Adjuvant Immunology Kerrie J. Sandgren, Naomi R. Truong, Jacinta B. Smith, Kirstie Bertram, and Anthony L. Cunningham Abstract Herpes simplex viruses (HSV) types 1 and 2 are ubiquitous. They both cause genital herpes, occasionally severe disease in the immunocompromised, and facilitate much HIV acquisition globally. Despite more than 60 years of research, there is no licensed prophylactic HSV vaccine and some doubt as to whether this can be achieved. Nevertheless, a previous HSV vaccine candidate did have partial success in preventing genital herpes and HSV acquisition and another immunotherapeutic candidate reduced viral shedding and recurrent lesions, inspiring further research. However, the entry pathway of HSV into the anogenital mucosa and the subsequent cascade of immune responses need further elucidation so that these responses could be mimicked or improved by a vaccine, to prevent viral entry and colonization of the neuronal ganglia. For an effective novel vaccine against genital herpes the choice of antigen and adjuvant may be critical. The incorporation of adjuvants of the vaccine candidates in the past, may account for their partial efficacy. It is likely that they can be improved by understanding the mechanisms of immune responses elicited by different adjuvants and comparing these to natural immune responses. Here we review the history of vaccines for HSV, those in development and compare them to successful vaccines for chicken pox or herpes zoster. We also review what is known of the natural immune control of herpes lesions, via interacting innate immunity and CD4 and CD8 T cells and the lessons they provide for development of new, more effective vaccines. Key words Herpes simplex, Varicella, Vaccine development, Antigen, Adjuvants, Antibody, T cells, Innate immunity

1

Introduction

1.1 The Need for Herpes Simplex Virus Vaccines

The two great challenges in translational research for Herpes simplex virus are prevention of initial genital herpes and suppression of recurrent herpes, by prophylactic vaccines and either antivirals or immunotherapeutic vaccines respectively. There is currently no licensed prophylactic vaccine. Antiviral therapy for recurrent genital herpes markedly reduces clinical episodes but does not completely suppress viral shedding and would benefit from a longer drug halflife [1]. Thus, prophylactic and immunotherapeutic vaccines have

Russell J. Diefenbach and Cornel Fraefel (eds.), Herpes Simplex Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2060, https://doi.org/10.1007/978-1-4939-9814-2_2, © Springer Science+Business Media, LLC, part of Springer Nature 2020

31

32

Kerrie J. Sandgren et al.

different goals and different challenges. Prophylactic vaccines must stimulate a protective naive immune response whereas immunotherapeutic vaccines must exceed the existing natural immune response. The latter is particularly difficult for recurrent herpes simplex where each recurrence boosts the immune response locally and systemically but is still insufficient to prevent future recurrences. A prophylactic vaccine for HSV1 and 2 is a global public health priority for development, as stated by WHO [2, 3] for several reasons: (1) genital herpes caused by HSV1 or 2 is one of the commonest sexually transmitted infection; (2) it causes severe disease in neonates; (3) HSV1 is the leading cause of infectious blindness in Western countries; and (4) prior HSV2 infection leads to a three- to sixfold increased risk of HIV infection globally [4–6]. Up to 50% of HIV transmissions in sub-Saharan Africa are estimated to occur in a setting of HSV2 infection [7, 8] and are more likely to occur soon after HSV2 acquisition [9]. Therefore, a prophylactic HSV vaccine would be likely to reduce HIV spread [10]. 1.2 The History of HSV Vaccine Development

The only licensed human herpesvirus vaccines are live attenuated viral vaccines or subunit vaccines for chicken pox and herpes zoster (shingles), both caused by varicella zoster virus (VZV). Progress with development of vaccines for herpes simplex virus has been very slow. During 60 years of mostly unsuccessful attempts at development of an HSV vaccine, live attenuated candidates have been avoided because of concerns about potential carcinogenicity (for cervical cancer) and recombination with clinical strains resulting in reversion to virulence. In the 1990s two recombinant viral protein (subunit) vaccine candidates were trialed. The Chiron vaccine candidate consisted of HSV2 entry glycoproteins B and D combined with oil in water emulsion adjuvant, MF59. When administered to subjects with recurrent genital herpes it induced high levels of neutralizing antibody but had no persistent or significant effect on frequency of recurrences [11]. The GSK vaccine candidate, Simplirix, consisted of just the HSV2 entry glycoprotein D (gD), and the adjuvant system AS04 [12]. HSV2 gD is widely recognized by human populations, inducing both neutralizing antibody and CD4 T cells [13]. AS04 consists of alum and deacylated monophosphoryl lipid A (dMPL). Simplirix showed 74% efficacy but only in HSV1/ 2 seronegative women with long-term HSV2-infected partners [12]. However, the subsequent Herpevac trial of Simplirix in randomly selected HSV1 and 2 seronegative women surprisingly showed significant efficacy against genital herpes caused by HSV1 (58% efficacy) but not HSV2 (only 20% and insignificant efficacy) [14]. Thus, cross-protection against HSV1 was achieved with recombinant HSV2 gD, which is highly conserved between the two serotypes [15]. This protection correlated with HSV1

Immunology Drives HSV Vaccine Progress

33

neutralizing antibody titers, whereas HSV2 neutralizing antibody titers were low. The better efficacy of the first trial might be explained by subclinical genital exposure to HSV2 shed by the infected partner, priming a later successful vaccine response. The efficacy of the novel adjuvant dMPL was attributed to induction of CD4 follicular helper (Tfh, and possibly Th1) T cells as well as neutralizing antibody. However, no specific CD8 T cells were induced [16]. More recently, new specifically mutated, live attenuated candidates have been developed. The most advanced is HSV529 where two key proteins have been deleted, rather than using simple point mutations, to reduce the likelihood of reversion to virulence. They are currently in clinical trials [17]. Other vaccine candidates have included DNA vaccines and hybrid recombinant viruses. 1.3 A Comparison of the Recent Herpes Zoster and Herpes Simplex Vaccines

The pathogenesis of the alphaherpesviruses VZV and HSV is similar. Both infect skin and nerves and reactivate, from latent infection in trigeminal and dorsal root ganglia (TG and DRG), although this is much more frequent for HSV. Vaccination with live attenuated varicella virus Oka strain has been successful against chicken pox (Varivax) and against Herpes zoster with a 14-fold more concentrated preparation (Zostavax). Zostavax prevents herpes zoster in 51% of immunized subjects over 60 years of age and prolonged pain or postherpetic neuralgia (PHN) in 65% of them, but its efficacy against the incidence of zoster diminishes in subjects >70 years of age and markedly declines in all over 8 years [18, 19]. Recently a new recombinant protein vaccine for herpes zoster (RZV) was shown to have much higher efficacy of >90%, even in subjects >80 years of age. There was no significant decline in protection over 4 years, with immunogenicity retained for 9 years [20–22]. The vaccine contains a single varicella glycoprotein (E) and the adjuvant system, AS01B, which consists of toll-like receptor 4 agonist dMPL and the saponin QS21, formulated in liposomes. QS21 stimulates a complex cascade of innate and adaptive immunity in injected muscle and draining lymph nodes. Together the adjuvant system stimulates VZV glycoprotein-specific CD4 T cells (and low level CD8 memory T cells) and gE specific antibody responses. CD8 T cell responses are only detected by the most sensitive assays [20, 23–26]. Therefore, very high levels of protection against a reactivating alphaherpesvirus can be induced by a single recombinant viral protein combined with an adjuvant that induces the appropriate adaptive (T and B cell) immune response by initially targeting innate immune and antigen presenting cells, including macrophages, NK cells and dendritic cells. This is a strong improvement in immunogenicity and efficacy over the response induced by the live attenuated vaccine [25, 27]. The marked difference between the 90% efficacy of RZV and the partial efficacy of Simplirix despite similar compositions is

34

Kerrie J. Sandgren et al.

probably due to the following factors: (1) prevention of primary versus recurrent disease—RZV is controlling disease after viral reactivation, whereas Simplirix was aimed at preventing disease after first or primary infection; (2) virus specific differences in the immune responses needed for prevention or control; (3) important differences in the mechanism of action of dMPL alone and combined dMPL and QS21; (4) possibly strategies which each virus uses to evade the immune response [28, 29]. Understanding the relative importance of each mechanism may help develop a more efficacious HSV vaccine. There is a very important distinction between an “immunotherapeutic” and a “prophylactic” vaccine. Prophylactic vaccines aim at preventing entry of a pathogen usually at a skin/mucosal surface and therefore need to stimulate broad and durable immunity at this site. Simplirix stimulated both antibody and CD4 T cell responses and the best correlation with efficacy in the Herpevac trial was antibody to which CD4 T (probably Tfh) cells contributed [16]. These responses were measured in blood but local immune responses to HSV in skin (and possibly nerve ganglia) are more important and may not parallel those in blood. CD8 T cell responses almost certainly need to be stimulated [30]. This is supported by results of trials of candidate immunotherapeutic vaccines from Genocea and Agenus where the correlation of immune effectors with vaccine efficacy suggests all three—antibody, CD4 and CD8 T cells—are important. This may also be true for prophylactic HSV vaccines. Furthermore, a prophylactic vaccine will need to stimulate dendritic cells (DCs) to induce all of these immune effectors as these are the only cells which can stimulate naı¨ve T cells. Alternatively, the aim of therapeutic vaccines is to prevent or reduce recurrences or to reduce disease severity or duration. Herpes zoster results from neuronal VZV reactivation so in preventing it, RZV acts like an immunotherapeutic vaccine. The mechanism of action of RZV is activation and/or recruitment of blood and presumably tissue memory T cells in a polyfunctional state which lasts for many years [20]. It also stimulates a weak CD8 T cell memory response [26]. These combined effects of QS21 and dMPL compared to dMPL alone may partly explain its increased efficacy over Simplirix. Furthermore, future vaccine design should be guided by precisely elucidating the effects of such adjuvants on the innate immune response, especially on subsets of DCs, which result in the immune effector response required for prevention of infection or disease. The following mechanisms need to be defined: (1) the important effector immune responses (antibody, CD4 and/or CD8 T cells; key cytokines); (2) which pathogen proteins induce them; (3) which DCs to target to induce such effectors; (4) which adjuvants will activate the appropriate DC subsets and where will they work; (5) what side-effects of these adjuvants might lead to toxicity.

Immunology Drives HSV Vaccine Progress

2 2.1

35

Immune Control of HSV Innate Immunity

2.1.1 Skin and Mucosal Keratinocytes

Keratinocytes are the first line of defense against HSV infection in the skin and form a formidable barrier to pathogen entry. Keratinocytes also play a key role in innate immunity against pathogens [31, 32] expressing many Toll-like receptors (TLRs) and producing a vast array of antimicrobial peptides [33]. In HSV, keratinocytes attract activated CD4 or CD8 T cells by producing the chemokines CCL3, 4, and 5 [13] and direct the immune response to Th1 or Th2/Treg response through proinflammatory cytokines—TNF, IL-1α, IL-1β, IL-6, IL-10, IL-18, and IL-33 [13, 34, 35]. In addition, keratinocytes have also been shown to be an accessory or “nonprofessional” antigen presenting cell that upregulate MHC class II in response to IFN-γ produced by T cells [36, 37].

2.1.2 Type I Interferons and Plasmacytoid DCs

Type I Interferons (IFNs) are a key component of innate antiviral immunity, produced by keratinocytes and antigen presenting cells in the epidermis following detection of the virus and activation of pattern recognition receptor signalling, such as the TLR and RNA/DNA sensor signalling pathways. The type I IFNs expressed in humans include IFN-α (with multiple subtypes), IFN-β, IFN-ε, IFN-ω, and IFN-κ, although the functions of IFN-α and -β have been best characterized [38, 39]. Type I IFNs induce the expression of antiviral genes known as IFN stimulated genes (ISGs), which play a role in inhibiting viral replication and promoting degradation of viral mRNA [39]. Type I IFNs also activate multiple immune cell types in response to HSV infection, including neutrophils, macrophages, natural killer cells and DCs [38]. In human recurrent genital herpes lesions, IFN-α producing plasmacytoid dendritic cells (pDCs) have been shown to infiltrate the dermis and were often found at the dermoepidermal junction, surrounded by ISG-producing stromal cells. They were closely associated with activated CD69+ T cells as well as NK cells [40]. Despite expressing the HSV entry receptors nectin1, nectin2 and HVEM, pDCs were resistant to HSV infection in vitro, but were able to stimulate virus-specific autologous T cell proliferation, particularly in CD8 T cells, indicating their capacity to crosspresent antigens. Thus pDCs were both strong producers of IFN-α and stimulated T cell proliferation in these lesions. However, more recent studies suggest that in general T cell proliferation is stimulated by a subset of DCs, AXL+SIGLEC6+ DCs (AS-DCs), copurifying with pDCs rather than pDCs themselves. This needs to be studied in herpes lesions.

2.1.3 Natural Killer Cells and Innate Lymphoid Cells

Several studies suggest a role for natural killer (NK) cells in response to HSV infection, particularly in controlling the severity of infection. In mouse studies, mice that lack or are depleted of NK cells or

36

Kerrie J. Sandgren et al.

that have defective NK cell activity have increased susceptibility to HSV2 infection and increased viral titers in the skin, vaginal mucosa, spinal cord, and brain stem [41–43]. Similarly, in humans, case studies examining patients with a specific lack of NK cells have correlated this with increased susceptibility to severe HSV infections [44, 45]. Furthermore, enrichment of NK cells has been observed in recurrent herpes lesions [46], interacting with pDCs [40] and CD4 T cells [47]. In in vitro studies, TLR2-stimulated NK cells could directly activate HSV gD-specific CD4 T cells [47], and their high frequency of contact with CD4 T cells in herpetic lesions suggests they play a role in stimulating CD4 T cells in this setting. These studies indicate that NK cells play a role in controlling HSV infection by restricting viral replication and spread through the early production of IFNγ and may also be important stimulators of adaptive immunity. However, studies in both mice and humans have not identified a correlation between NK cell activity and viral clearance, which appears to be the role of T lymphocytes [46, 48–50]. NK cells are part of a network of innate lymphoid cells (ILCs), whose functions are analogous to T cell subsets [51]. ILCs preferentially localize into barrier tissues such as the skin, lungs, and gut [52]. To date, no studies have investigated the presence and role of ILCs in HSV infection. 2.2 Adaptive Immunity 2.2.1 The Role of Neutralizing Antibodies in HSV Infection

Levels of HSV specific IgG and more importantly mucosal IgA, are increased in vaginal secretions of mice, guinea pigs, and nonhuman primates intravaginally vaccinated with HSV2 [48, 53, 54], as well as in cervical secretions of women with primary HSV2 infection [53]. Antibody responses vary, with IgG present as early as a few days and IgA present up to 2 weeks postinfection; however, both persist for weeks after infection. Both antibodies react to various HSV glycoproteins, including gD, gB, and gC [53]. However, the relative importance of antibody in protection against HSV2 in animal models has been contradictory [39], as has data from vaccine trials [55–59]. Some studies found that T cells, rather than B cells, were critical for protection against lethal challenge of HSV2 [60, 61]. More recently, the importance of neutralizing antibodies has again been demonstrated in studies of a trivalent vaccine containing HSV2 gC, gD and gE with adjuvants CpG and alum in rhesus macaques and guinea pigs. The vaccine induced plasma and mucosal neutralizing antibodies that blocked gD and gE immune evasion activities and stimulated CD4 T cell responses [62]. In guinea pigs the vaccine reduced the frequency of recurrent lesions and vaginal shedding of HSV2 DNA by approximately 50% and almost completely prevented viral shedding [63]. In a human in vitro model of fetal dorsal root ganglionic (DRG) neurons innervating autologous epidermal skin explants,

Immunology Drives HSV Vaccine Progress

37

neutralizing antibodies reduced transmission of virus from axons to epidermis by 90% by binding to the virus in the intercellular gaps between axon termini and epidermal cells. It was suggested that antibodies might also be effective in preventing epidermis-to-neuron transmission during primary HSV infection [64]. Studies of neonatal herpes and the protective effects of maternal immunization also provide some strong evidence for the importance of neutralizing antibodies in protection against HSV infection. Neonatal HSV infections are rare, but cause considerable morbidity and mortality in infants, with an estimated fatality rate of 60% worldwide [65]. The risk of neonatal herpes infection is highest in mothers who have first-episode primary infection at the time of delivery, with transmission rates up to 60%, whereas only 1–2% of babies born to mothers with recurrent HSV are likely to develop neonatal herpes [66–68]. Thus, maternal immunity provides protection to the neonate. During pregnancy, IgG antibodies are transferred from mother to child across the placenta [69], and low maternal neutralizing antibody titer and avidity have been identified as risk factors for transmission to neonates [66, 67]. Some pregnant women do not have protective antibody levels and there is some evidence in mice that maternal immunization could provide protection [70–72], as with tetanus and seasonal influenza [73]. Clearly, neutralizing antibodies play a key early role in primary HSV infection, and may be particularly important in preventing vertical transmission from mother to neonate. However, they are not acting in isolation, as cell-mediated immunity is also necessary for HSV protection and especially clearance [39]. 2.2.2 The Role of T Cells in HSV Infection

CD4 and CD8 T cells are major cell-mediated immune effectors. CD4 T cells “help” activate B cells and class-switching of antibody from IgM to IgG, and also help activate CD8 T cells to be cytotoxic or secrete cytokines [74, 75]. CD4 T cells cytokines such as TNF and IFN-γ, which are antiviral, control HSV viral replication and spread [76]. Several groups have shown that IFN-γ is important in human recurrent herpes [50, 77]. It exerts its effect by inducing antiviral ISGs [78], immunologically by activating NK and CDT cells, stimulating macrophage phagocytosis, enhancing MHCI and inducing MHCII expression by secondary antigen presenting cells, including keratinocytes. CD8 T cells kill virally infected cells via perforin and granzymes and also secrete IFN-γ and TNF [78]. T cell immunity to HSV acts at two main sites—at the anogenital mucosa and at neuronal ganglia: After initial mucosal HSV infection, HSV-specific, activated effector memory CD4 and CD8 T cells expressing IFN-γ and TNF infiltrate trigeminal ganglia (TG) and surround neurons and adherent satellite cells. It has been speculated that these T cells might be tissue resident memory cells (TRMs), but so far this remains unproven [79, 80]. The same

38

Kerrie J. Sandgren et al.

phenomenon has been observed in mice where the T cells control latency (and a minor degree of reactivation) via granzymes which penetrate the neurons and degrade intracellular HSV immediate early protein ICP4 [81, 82]. CD4 and CD8 T cells are also important in control of HSV infection in the anogenital mucosa, as shown by early studies of human recurrent herpes lesions. CD4 T cells infiltrate early and remain predominant in the first 12–48 h after lesion appearance, followed by later infiltration of CD8 T cells [50]. HSV infection downregulates MHCI on keratinocytes, so they cannot be recognized by CD8 T cells, however, the early infiltrating CD4 T cells produce IFN-γ, which can restore MHCI expression, allowing recognition by the later infiltrating HSV specific CD8 T cells. IFN-γ also upregulates MHC class II on keratinocytes allowing them to present HSV antigen to the specific CD4 T cells [27]. Although HSV does not downregulate MHCI in mice, depletion of CD4 T cells provided evidence of their critical role—CD4 T cell-deficient mice fail to recruit CD8 T cells to the vaginal epithelium through failure of epithelial cells to secrete CXCL9 and CXCL10 after IFN-γ stimulation [83]. The later infiltration of CD8 T cells [50] into genital herpes lesions is strongly correlated with viral clearance [46]. In biopsies at the site of healed human recurrent herpes lesions, HSV specific resident memory CD4 and CD8 T cells persist in this genital skin for at least 6 months posthealing [84] and are able to produce IFN-γ [1]. The CD8 TRMs express two CD8α chains which result in high affinity antiviral binding to infected cells [85]. They persist at the dermoepidermal junction (deeper than in mice) adjacent to peripheral nerve endings where they monitor reactivation and respond by expressing genes for antiviral function and chemotaxis [86–88]. CD4 TRMs are deeper in the dermis. CD8 TRMS lack expression of chemokine receptors required for egress from dermis and recirculation and are mostly noncytolytic [85]. Therefore, these cells maintain active immunosurveillance after clearance of a recurrent lesion or symptomatic shedding. Nevertheless, viral shedding continues to occur at variable rates in different subjects. Mathematical modelling showed that insufficient CD8 TRM cells are present in genital skin to eliminate foci of reactivation. The restricted spatial distribution and heterogeneity of TRM cells allow areas for replication of reactivated HSV to occur in keratinocytes between them. The mathematical modelling was confirmed through immunohistology of genital biopsies. This paucity of genital tract TRM cells explains how reactivation continues to occur, despite their presence, and suggest a zone of remote control of HSV replication around them probably via antiviral cytokines [89].

Immunology Drives HSV Vaccine Progress

39

The above studies show key roles for CD8 T cells in recurrent genital herpes. They clear HSV infected cells from active lesions and then some transition to TRM cells, immune sentinels, to partly control viral shedding after reactivation. We have also shown marked infiltration of CD4 and CD8 T cells in the upper dermis after initial genital herpes (unpublished observations). These studies suggest they are important target cells for prophylactic as well as immunotherapeutic vaccines. Therefore, development of new vaccines for genital herpes should include a focus on stimulation of both CD4 and CD8 T cells as they are synergistic, and also on induction of TRM cells that remain at the site of a lesion or of viral shedding, ready for the next encounter with HSV after reactivation. Higher TRM cell numbers than those induced by natural infection may be required to overcome the inadequate spatial distribution and to provide higher IFN-γ production, perhaps needing special adjuvants [89]. On the other hand, induction of regulatory CD4 T cells (Tregs) by adjuvants should be avoided. Although they have been found to suppress the proliferation of HSV specific CD4 T cells at times of clinical quiescence [90], they have also been shown to suppress T cell effector functions in mice [91, 92] and correlate with increased viral shedding in humans [93]. Gamma-delta (γδ) T cells defined by the expression of a γδ TCR, not an αβ TCR, are enriched in skin, in both the epidermis and dermis in mice but only the dermis in humans [94], In mice one study found that γδ T cells were protective [95], but a more recent study found that they were the first immune effector to encounter HSV and were directly infected, prior to the infection of Langerhans cells [96]. However, the role of skin γδ T cells during HSV infection has not been investigated in human skin or genital mucosa and whether they are relevant to vaccine design. 2.2.3 The Role of Dendritic Cells in Stimulating HSV Immunity

Dendritic cells (DCs) patrol skin and mucosa to detect and take up pathogens, after which they mature and migrate to lymph nodes where they present their antigens to naıve T cells, thereby activating the adaptive immune response [97]. Early studies of the role and response of human DCs to HSV infection used model monocytederived DCs (MDDCs) because of technical limitations in obtaining human skin/mucosa DCs. These immature MDDCs could be productively infected by HSV, resulting in apoptosis (a process that HSV normally inhibits). Bystander uninfected DCs pulsed with apoptotic HSV-infected DCs could cross-present and stimulate HSV specific CD8 T cells [98, 99]. These studies complimented murine studies in the 1980s showing the importance of Langerhans cells (LCs), the major DC subtype in the stratified squamous epidermis of anogenital mucosa, in uptake and deep transport of HSV [100]. However murine LCs do not present HSV antigen to naı¨ve CD8 T cells in lymph nodes

40

Kerrie J. Sandgren et al.

but this is the function of CD8α+ DCs and CD103+ dermal DCs (cDC1s) [101–103]. The latter are the predominant cells transporting HSV antigens out of murine skin explants [96] suggesting an exchange of HSV antigen between different DC subtypes occurs in skin. This has been demonstrated in our human studies where LCs are productively infected and migrate into the dermis while developing apoptosis [104]. Unlike murine LCs, there was no inhibition of migration of a significant proportion of LCs to the dermis. In recent years, single cell RNA-sequencing have facilitated the classification of DC subsets. In human dermis, the two main DC subsets are conventional DC type 1 and 2 (cDC1 and cDC2) [105]. cDC1s are a minor subset proportionally, but are highly efficient at crosspresentation of exogenous antigen to CD8 T cells [106]. The major dermal DC subset are cDC2s, which have conventional antigenpresenting capacity to stimulate CD4 T cells, but also have some ability to cross-present to CD8 T cells [107, 108]. DC-SIGN expressing dermal DCs are now thought to be more accurately classified as macrophages [109]. Using this new classification, we studied the interaction of HSV-infected LCs with dermal cDC1s in human inner foreskin explants and in biopsies of initial herpes simplex virus lesions. The migrating apoptotic HSV1 infected LCs interacted with cDC1s in clusters in the dermis. LC fragments were detected within some cDC1s, and cDC1s emigrated from HSV1 infected explants, similar to CD103+ dermal DCs in murine models. Additionally, DC-SIGN+ MNPs were also observed in clusters interacting with HSV-infected LCs in the dermis [104]. Therefore, epidermal LCs take up HSV, become infected and transfer the virus or viral antigens to subsets of dermal DCs/MNPs, facilitating viral relay, probably leading to stimulation of CD4 and CD8 T cells in lymph nodes and even lesions by different pathways. An important question that remains is whether human cDC2s have similar interactions with HSV-infected LCs? Understanding the roles of specific human DC subsets in response to HSV infection should help DC targeting of vaccines (and adjuvants), perhaps simulating the same immune responses as natural infection and stimulating CD8 T cell responses. A summary of the HSV viral relay and localization of immune cell subsets in human skin is shown in Fig. 1.

3

Using Knowledge of Natural Immunity to Design a Vaccine

3.1 Prophylactic Versus Immunotherapeutic Vaccines

Prophylactic vaccines need to stimulate primary immune responses at the site of pathogen entry to prevent its acquisition and therefore need to stimulate DCs to provide naıve T cells with an antigenspecific signal and a second costimulatory signal to differentiate into effectors. However, immunotherapeutic vaccines can

Immunology Drives HSV Vaccine Progress

41

Fig. 1 The HSV viral relay and localization of immune cell subsets in human skin. In humans, HSV infects Langerhans cells (LCs) causing them to mature and migrate to the dermis and undergo apoptosis. Once in the dermis, HSV infected apoptotic LCs have been observed in clusters with and taken up by dermal cDC1s and CD14+ MNPs [104], potentially for antigen presentation to T cells. Whether cDC2s are also involved in the uptake and presentation is unknown in humans. Whilst we have pieced together multiple cellular players in this viral relay, there are an abundance of other innate and adaptive immune cells residing in the dermis, including additional DC subsets, macrophages, and γδ T cells, as well as infiltrating immune cells, such as pDCs and T cells. NK cells are found both constitutively in skin in low numbers and also infiltrate into the skin during infection or inflammation. There is increasing evidence that at least some of these additional cell types influence the developing immune response to HSV infection in the skin and further illuminating this complex picture would inform vaccine design

42

Kerrie J. Sandgren et al.

restimulate already existing memory T cell responses through “secondary” or “nonprofessional” antigen presenting cells (including keratinocytes and monocytes). Thus in herpes simplex memory T cells resident (TRMs) in skin/mucosa can be restimulated [85, 86]. Thus TRMs and neutralizing antibodies in the mucosa are critical for protection against release of virus from the DRG in recurrent infection [80] and also likely to prevent virus entry into the DRG during initial infection. It is therefore important to consider how to design a prophylactic vaccine that will induce the development of local TRM cells and mucosal antibody to prevent infection with HSV as recruitment of B and T cells from the blood may be too slow to prevent viral seeding of the nerves. 3.2 Targeting Key Antigens and Epitopes

Neutralizing antibodies or ADCC target surface HSV envelope glycoproteins and CD4 T cells usually target structural HSV core, tegument or envelope proteins whereas CD8 T cells can target both structural and nonstructural proteins. The envelope glycoproteins gD and gB are dominant targets for HSV neutralizing antibodies, of which multiple epitopes are recognized [110, 111], as well as gC and gH/L in human sera directed against HSV1 [13, 110–113]. Other envelope glycoproteins, such as gK, have only been investigated in murine models [114]. Therefore gD and gB were used as immunogens in the Chiron trial and gD combined with dMPL (AS04) was used in the Simplirix and Herpevac trials. In the Herpevac trial, high anti-gD antibody titers correlated with protection against genital disease caused by HSV1 (but not HSV2). In guinea pig models the more gD epitopes the animals recognized, the better the protection against genital disease, but women in the Herpevac trial recognized significantly fewer epitopes [115]. A recently developed trivalent vaccine candidate containing recombinant gC, gD, and gE provided sterilizing immunity in 98% of guinea pigs, apparently due to induction of high levels of plasma and mucosal neutralizing antibodies [63]. Human antibody responses to this vaccine are yet to be assessed. A well characterized live attenuated vaccine candidate HSV529 (deleted for UL5 and UL29) was shown to induce significant HSV2-specific antibody dependent cellular cytotoxicity (ADCC), as well as neutralizing antibodies in humans [116] suggesting it may be important to induce ADCC activity. Another recently developed live attenuated HSV vaccine candidate explored the importance of subdominant HSV epitopes by deleting gD. In murine models it induced low titers of mucosal neutralizing antibodies but high ADCC and provided sterilizing immunity against multiple clinical isolates. This immunity against vaginal murine infection could be passively transferred [117–119]. However they did not control for neutralization due to complement. Murine models are poor predictors of human vaccine responses so human trials are awaited.

Immunology Drives HSV Vaccine Progress

43

Although these studies seem to indicate the importance of inducing strong neutralizing antibody responses by vaccines, several previous vaccine candidates did induce neutralizing antibodies and yet were unsuccessful in human clinical trials [120, 121]. This suggests neutralizing antibodies alone are insufficient to protect against HSV infection. Both CD4 and CD8 T cells are probably also needed and should be targeted and improved from previous vaccine candidates. CD4 T cells respond mainly to late HSV glycoproteins, such as gD, gB, gC, and gH. They also recognize the tegument proteins VP16 and UL49 and the capsid protein VP5 [13, 27, 122]. HSV2 gD contains several immunodominant epitopes which are recognized by CD4 T cells from both HSV1 and HSV2 seropositive patients and across multiple MHCII types [123]. In a vaccine these cross-reactive epitopes would be useful to target genital herpes caused by either HSV1 or 2. CD8 T cells recognize many HSV proteins, including the early nonstructural viral proteins ICP27, ICP4, and ICP0 [27, 124], and also tegument and capsid proteins [125]. Many (13) CD4 and CD8 T cell epitopes are also conserved between VZV and HSV [126]. Recently HSV gD was shown to be selectively taken up by the DC subtype cDC1s, which cross-present the antigen to CD8 T cells. Thus gD may be an important target for all major immune effectors: CD4 and CD8 T cells [127] and B cells. Further definition of conserved and cross-reactive epitopes and incorporation into vaccine candidates might allow targeting of multiple herpesviruses through multiple immune cells in a single vaccine. Although most studies defining HSV T cell epitopes in humans have focused on blood, HSV targets for tissue-specific responses may differ in magnitude and specificity, that is, recent studies have shown compartmentalization of T cell clone expansion at different sites as shown by T-cell receptor (TCR) repertoires. This may be relevant to responses to potential vaccine candidates. Posavad et al. have shown such differences in magnitude between blood and cervical CD4 T cell responses with a 25-fold enrichment of cervical HSV2-reactive CD4 T cells compared to blood in HSV2 infected women [87]. They also showed little overlap in TCR repertoires of TRMs in genital mucosa and those found in blood. Thus, similar tissue-based T cell responses will need evaluation in response to vaccines [128]. 3.3

Vaccine Delivery

Clearly HSV vaccines must be effective at inducing protective immunity at mucosal surfaces. Vaccine delivery has conventionally been intramuscular; however, intravaginal immunization is a strategy that has been thoroughly tested and been successful in small animal models and should be considered in humans. For example, intravaginal delivery of a live attenuated, replication defective HSV2 vaccine candidate (HSV2-gD27) induced superior

44

Kerrie J. Sandgren et al.

protection against HSV2 intravaginal challenge than intramuscular, subcutaneous or intranasal administration [129]. As an alternative to direct intravaginal vaccination which may be impractical in human trials, a “prime and pull” approach was developed in murine models. Systemic T cells were primed by subcutaneous immunization and then CXCL9 and CXCL10 topically applied to the genital mucosa to “pull” them into the mucosa [130]. This resulted in long term establishment of IFN-γ expressing CD8 TRMs which conferred protection against HSV2 challenge [131]. Other novel delivery systems aimed at inducing mucosal immunity, currently being tested include intranasal application of nanoemulsion-based adjuvants in RSV and TB vaccines resulting in high antibody titers, Th1 and Th17 T cell responses [132, 133]. A nanoemulsion vaccine for HSV2 is also being developed (BlueWillow Biologics, formerly NanoBio Corporation) with preliminary evidence showing protection against genital HSV2 challenge in animal models [134]. Many types of experimental peptide vaccines are being tested, including lipopeptides or synthetically designed peptides, combined with nanoparticle adjuvants. Some of these vaccines strongly stimulate systemic polyfunctional cytotoxic CD8 T cells, as well as in the genital mucosa and in draining lymph nodes, capable of protecting against lethal HSV challenge [135, 136]. Combination of a calcium phosphate-based nanoparticle and HSV2 epitope in a vaccine also showed enhanced mucosal and systemic protection [137]. However, mouse models provide a notoriously optimistic prediction and these experimental vaccines need to be tested in phase I human clinical trials. 3.4 Vaccine Adjuvants

As discussed above, in contrast to live attenuated vaccines, vaccines consisting of recombinant protein usually require one or a combination of adjuvants (adjuvant systems) to replace the dangerassociated molecular pattern (protein/lipid/nucleic acid) stimuli from the original pathogen. These adjuvants direct the desired immune response usually by stimulating innate immune cells, ultimately DCs, and then immune effectors—antibody and T cells (for HSV, including TRMs). They can also act as antigen carriers (e.g., alum, liposomes). Adjuvants able to enhance neutralizing antibody responses to HSV have included the traditionally used alum, MF59 used in the Chiron HSV2 gB/gD subunit vaccine [11], alum/dMPL used in the Simplirix gD vaccine [12, 14], and more recently, alum/CpG used in the trivalent gC, gD, and gE vaccine [63]. dMPL acts to enhance antibody production by inducing follicular helper CD4 T cells. The older alum adjuvant is a poor stimulator of T cell responses [138, 139]. MF59, ISCOMs (saponin-based immune stimulating complexes), TLR2 and TLR5 ligands enhance T cell responses without altering the Th1/Th2 balance. Conversely

Immunology Drives HSV Vaccine Progress

45

adjuvants that act as agonists of TLR3, TLR4, TLR7/8, and TLR9 (including dMPL and CpG) induce Th1 cell responses. The partially successful Simplirix HSV vaccine containing dMPL, was initially thought to induce mainly a Th1 pattern of cytokines (including IFN-γ) but the Tfh response is at least as important [16]. There was no CD8 T cell response. Indeed adjuvants inducing antigen cross-presentation and primary human CD8 T cell responses would be most valuable but are still to be defined. Saponin-based adjuvants have been shown to induce strong T cell responses and in particular memory CD8 T cell responses, and their use in recently trialed immunotherapeutic vaccines has shown some success. As mentioned, the highly successful RZV vaccine for herpes zoster contains dMPL formulated together with QS21, a saponin, in liposomes. RZV induced VZV-specific CD4 T cells as well as memory CD8 T cells, although not naive CD8 T cells [24]. Similarly, the Agenus HerpV vaccine contains a patented QS21 stimulon adjuvant and the Genocea vaccine contains a saponin Matrix M2 adjuvant. Both the immunotherapeutic Agenus and Genocea vaccines induced a combination of neutralizing antibody, CD4 and CD8 T cell responses in animal models. In the human clinical trial of the Genocea vaccine, equivalent CD8 T cell responses were induced to both HSV gD and ICP4, confirming that gD contains CD8 T cell epitopes, and that saponin-based adjuvants are able to induce memory CD8 T cell responses through cross presentation [140, 141]. In the future broader targeting of adjuvants to other immune cells or different modes of action may be needed to stimulate the required responses for an HSV vaccine, including neutralizing and nonneutralizing antibody, different subsets of CD4 T cells and CD8 T cells. For example, for subunit vaccines to target the key dermal DC subsets involved in primary HSV infection, adjuvants may need to simulate the immune effects of HSV-infected apoptotic LCs [104]. Furthermore, other immune cell effectors which are often overlooked in the vaccine design, such as NK cells, should also be considered as targets [47, 142, 143]. Suppressive immune responses such as Tregs may also need to be antagonized by adjuvants. For example the adjuvant CpG was able to suppress induction of antigen specific FoxP3+ Tregs after primary and repeated vaccination with influenza viral peptides and promoted viral clearance in murine models. Similar studies are needed using HSV vaccines. Nevertheless, there have been concerns about inducing or reactivating autoimmune diseases by using powerful adjuvants to direct the immune response. So far, over 70,000 subjects have been immunized with vaccines, containing dMPL and QS21, in trials and no

46

Kerrie J. Sandgren et al.

Table 1 The developmental status of HSV vaccine candidatesa Vaccine candidate

Company

Vaccine constitution

Developmental stage

References

Subunit/s + adjuvants Simplirix/ Herpevac

GlaxoSmithKline

gD2 and AS04 (dMPL)

Ceased after Phase III [14, 144] trials

GEN-003

Genocea

gD2 and Matrix M2

Ceased after Phase II [145–147] trials

HerpV

Agenus

Peptide vaccine + QS-21 Stimulon

No development [148, 149] since Phase II trials

VCL-HB01

Vical

gD2  UL46 and Vaxfectin DNA vaccine

Ceased after Phase II [150, 151] trials

COR-1

Admedus

gD2 codon optimized DNA vaccine

Phase IIb planned

NE-HSV2

BlueWillow Biologics

Nanoemulsion with gB2 and Pre-clinical, clinical gD2 antigens trial planned

[134, 155]

HSV2 trivalent vaccine

University of Pennsylvania

gC2, gD2, gE2

[62, 156]

G103

Immune Design

HSV2 gD, UL19 and UL25 Pre-clinical

Pre-clinical

[152–154]

[157]

Live-attenuated HSV529

Sanofi Pasteur

Replication defective HSV2, UL5, UL29 deletion

Phase I trial ongoing [17, 158]

RVX201

Rational Vaccines

HSV2 ICP0 deletion mutant Phase Ib/IIa planned [159]

VC2

Louisiana State University

HSV1 with mutations in gK and UL20

R2

Thyreos LLC

HSV1 with UL37 R2 region Pre-clinical mutation

[162]

HSV2 ΔgD2

Albert Einstein College of Medicine

HSV2 with US6 (gD) deletion Pre-clinical

[117, 119]

Pre-clinical

Pre-clinical

[114, 160, 161]

a

Adapted from [163]

such safety signals have been observed. Continuing postmarketing surveillance will be required. Furthermore, QS21 has been shown to elicit a high degree of systemic and injection site reactogenicity. Whether the reactogenicity and immunogenicity of such adjuvants can be dissociated through chemical modifications is a challenge. The status of current HSV vaccine candidates is provided in Table 1.

Immunology Drives HSV Vaccine Progress

4

47

Concluding Remarks Newer-generation vaccines aim to use adjuvants to advantageously manipulate the immune response or, alternatively, permanently attenuate live vaccine candidates through specific mutations. For herpes zoster surprisingly, RZV had a higher degree of efficacy and immunogenicity than the live attenuated HZ vaccine Zostavax [20, 26]. A key question is whether this higher vaccine efficacy induced by adjuvants in RZV can be exploited to improve vaccines for genital herpes. Perhaps one antigen alone is insufficient and more are needed. The recent reports on RZV and Zostavax immunogenicity indicate a need for a much more detailed understanding of initial protective immune responses. As highlighted in consensus statements on HSV vaccine development, immunologic correlates of efficacy in partially successful vaccines (e.g., Genocea, Herpevac) are particularly important, that is, comparing immune responses in protected vs. unprotected patients. A successful prophylactic vaccine against initial genital herpes must prevent HSV seeding of the neuronal ganglia via the cutaneous sensory nerves. To do this the vaccine would need to prevent virus entering nerve terminals in the epidermis. This might be achieved by resident immune cells which can quickly migrate into the stratified squamous epidermis or produce rapidly diffusing protective cytokines upon infection. High levels of neutralizing antibodies may also penetrate the epidermis from dermal vessels although this is unknown. We do know that viruses such as HIV can be contained by these mechanisms even if they obtain a “toe-hold” in mucosal epidermis. Nevertheless much more needs to be known about the interaction of HSV infected epidermal cells with key innate and adaptive immune responses in the skin and mucosa. Multiple innate immune cells including DC subsets, NK cells, monocytes/macrophages, and γδ T cells may play a role and interact with each other at the site of HSV entry. Together with antibody and T cells, they may all play a role in protecting against or controlling initial HSV infection. Finally there are other cofactors of potential importance in initial HSV mucosal infection. One of the most important is the role of the microbiome in mucosal integrity and interacting with mucosal immunity, thus determining susceptibility to viral pathogen entry. Many women have a “diverse” vaginal microbiome without Lactobacilli which increases the likelihood of HIV and possibly HSV acquisition, especially in sub-Saharan Africa [80, 164–167]. The effects of an altered microbiome on HSV specific mucosal immunity and interactions with HSV immunization also require future investigation.

48

Kerrie J. Sandgren et al.

References 1. Schiffer JT, Swan D, Corey L et al (2013) Rapid viral expansion and short drug half-life explain the incomplete effectiveness of current Herpes Simplex Virus-2 directed antiviral agents. Antimicrob Agents Chemother 57:5820–5829. https://doi.org/10.1128/ AAC.01114-13 2. Gottlieb SL, Giersing BK, Hickling J et al (2017) Meeting report: Initial World Health Organization consultation on herpes simplex virus (HSV) vaccine preferred product characteristics. Vaccine. https://doi.org/10. 1016/j.vaccine.2017.10.084 3. 2011–2020 GVAP (2012) Global vaccine action plan 2011–2020 [online]. https:// www.who.int/immunization/global_vac cine_action_plan/GVAP_doc_2011_2020/ en/ 4. Freeman EE, Weiss HA, Glynn JR et al (2006) Herpes simplex virus 2 infection increases HIV acquisition in men and women: systematic review and meta-analysis of longitudinal studies. AIDS 20(1):73–83 5. Looker KJ, Elmes JAR, Gottlieb SL et al (2017) Effect of HSV-2 infection on subsequent HIV acquisition: an updated systematic review and meta-analysis. Lancet Infect Dis 17(12):1303–1316. https://doi. org/10.1016/s1473-3099(17)30405-x 6. Bradley J, Floyd S, Piwowar-Manning E et al (2018) Sexually transmitted bedfellows: exquisite association between HIV and herpes simplex virus type 2 in 21 communities in southern Africa in the HIV prevention trials network 071 (PopART) study. J Infect Dis 218(3):443–452. https://doi.org/10.1093/ infdis/jiy178 7. Wald A, Link K (2002) Risk of human immunodeficiency virus infection in herpes simplex virus type 2-seropositive persons: a meta-analysis. J Infect Dis 185(1):45–52. https://doi. org/10.1086/338231 8. Omori R, Nagelkerke N, Abu-Raddad LJ (2018) HIV and herpes simplex virus type 2 epidemiological synergy: misguided observational evidence? A modelling study. Sex Transm Infect 94(5):372–376. https://doi. org/10.1136/sextrans-2017-053336 9. Reynolds SJ, Risbud AR, Shepherd ME et al (2003) Recent herpes simplex virus type 2 infection and the risk of human immunodeficiency virus type 1 acquisition in India. J Infect Dis 187(10):1513–1521. https://doi. org/10.1086/368357

10. Spicknall IH, Looker KJ, Gottlieb SL et al (2018) Review of mathematical models of HSV-2 vaccination: implications for vaccine development. Vaccine. https://doi.org/10. 1016/j.vaccine.2018.02.067 11. Corey L, Langenberg AG, Ashley R et al (1999) Recombinant glycoprotein vaccine for the prevention of genital HSV-2 infection: two randomized controlled trials. Chiron HSV Vaccine Study Group. JAMA 282 (4):331–340 12. Stanberry LR, Spruance SL, Cunningham AL et al (2002) Glycoprotein-D-adjuvant vaccine to prevent genital herpes. N Engl J Med 347 (21):1652–1661. https://doi.org/10.1056/ NEJMoa011915 13. Mikloska Z, Cunningham AL (1998) Herpes simplex virus type 1 glycoproteins gB, gC and gD are major targets for CD4 T-lymphocyte cytotoxicity in HLA-DR expressing human epidermal keratinocytes. J Gen Virol 79. (Pt 2:353–361 14. Belshe RB, Leone PA, Bernstein DI et al (2012) Efficacy results of a trial of a herpes simplex vaccine. N Engl J Med 366(1):34–43. https://doi.org/10.1056/NEJMoa1103151 15. Lamers SL, Newman RM, Laeyendecker O et al (2015) Global diversity within and between human herpesvirus 1 and 2 glycoproteins. J Virol 89(16):8206–8218. https://doi.org/ 10.1128/jvi.01302-15 16. Belshe RB, Heineman TC, Bernstein DI et al (2014) Correlate of immune protection against HSV-1 genital disease in vaccinated women. J Infect Dis 209(6):828–836. https://doi.org/10.1093/infdis/jit651 17. Bernard MC, Barban V, Pradezynski F et al (2015) Immunogenicity, protective efficacy, and non-replicative status of the HSV-2 vaccine candidate HSV529 in mice and guinea pigs. PLoS One 10(4):e0121518. https:// doi.org/10.1371/journal.pone.0121518 18. Oxman MN, Levin MJ, Johnson GR et al (2005) A vaccine to prevent herpes zoster and postherpetic neuralgia in older adults. N Engl J Med 352(22):2271–2284. https:// doi.org/10.1056/NEJMoa051016 19. Morrison VA, Johnson GR, Schmader KE et al (2015) Long-term persistence of zoster vaccine efficacy. Clin Infect Dis 60 (6):900–909. https://doi.org/10.1093/ cid/ciu918 20. Cunningham AL, Heineman TC, Lal H et al (2018) Immune responses to a recombinant glycoprotein E herpes zoster vaccine in adults

Immunology Drives HSV Vaccine Progress aged >/=50 years. J Infect Dis 217:1750. https://doi.org/10.1093/infdis/jiy095 21. Lal H, Cunningham AL, Godeaux O et al (2015) Efficacy of an adjuvanted herpes zoster subunit vaccine in older adults. N Engl J Med 372(22):2087–2096. https://doi.org/10. 1056/NEJMoa1501184 22. Schwarz TF, Volpe S, Catteau G et al (2018) Persistence of immune response to an adjuvanted varicella-zoster virus subunit vaccine for up to year nine in older adults. Hum Vaccin Immunother 14(6):1370–1377. https:// doi.org/10.1080/21645515.2018.1442162 23. Didierlaurent AM, Laupeze B, Di Pasquale A et al (2017) Adjuvant system AS01: helping to overcome the challenges of modern vaccines. Expert Rev Vaccines 16(1):55–63. https:// doi.org/10.1080/14760584.2016.1213632 24. Leroux-Roels I, Leroux-Roels G, Clement F et al (2012) A phase 1/2 clinical trial evaluating safety and immunogenicity of a varicella zoster glycoprotein e subunit vaccine candidate in young and older adults. J Infect Dis 206(8):1280–1290. https://doi.org/10. 1093/infdis/jis497 25. Weinberg A, Kroehl ME, Johnson MJ et al (2018) Comparative immune responses to licensed herpes zoster vaccines. J Infect Dis 218(Suppl_2):S81–S87. https://doi.org/10. 1093/infdis/jiy383 26. Levin MJ, Kroehl ME, Johnson MJ et al (2018) Th1 memory differentiates recombinant from live herpes zoster vaccines. J Clin Invest 128(10):4429–4440. https://doi. org/10.1172/jci121484 27. Mikloska Z, Kesson AM, Penfold ME et al (1996) Herpes simplex virus protein targets for CD4 and CD8 lymphocyte cytotoxicity in cultured epidermal keratinocytes treated with interferon-gamma. J Infect Dis 173(1):7–17 28. Arvin A, Abendroth A (2007) VZV: immunobiology and host response. In: Arvin A, Campadelli-Fiume G, Mocarski E et al (eds) Human herpesviruses: biology, therapy, and immunoprophylaxis. Cambridge University Press, Cambridge, p 2007 29. Mori I, Nishiyama Y (2005) Herpes simplex virus and varicella-zoster virus: why do these human alphaherpesviruses behave so differently from one another? Rev Med Virol 15 (6):393–406. https://doi.org/10.1002/ rmv.478 30. Koelle DM, Corey L (2008) Herpes simplex: insights on pathogenesis and possible vaccines. Annu Rev Med 59:381–395. https:// doi.org/10.1146/annurev.med.59.061606. 095540

49

31. Heath WR, Carbone FR (2013) The skinresident and migratory immune system in steady state and memory: innate lymphocytes, dendritic cells and T cells. Nat Immunol 14 (10):978–985. https://doi.org/10.1038/ni. 2680 32. Albanesi C, Scarponi C, Giustizieri ML et al (2005) Keratinocytes in inflammatory skin diseases. Curr Drug Targets Inflamm Allergy 4(3):329–334 33. Kuo IH, Yoshida T, De Benedetto A et al (2013) The cutaneous innate immune response in patients with atopic dermatitis. J Allergy Clin Immunol 131(2):266–278. https://doi.org/10.1016/j.jaci.2012.12. 1563 34. Strittmatter GE, Sand J, Sauter M et al (2016) IFN-gamma primes keratinocytes for HSV-1induced inflammasome activation. J Invest Dermatol 136(3):610–620. https://doi. org/10.1016/j.jid.2015.12.022 35. Aoki R, Kawamura T, Goshima F et al (2016) The Alarmin IL-33 derived from HSV-2infected keratinocytes triggers mast cellmediated antiviral innate immunity. J Invest Dermatol 136(6):1290–1292. https://doi. org/10.1016/j.jid.2016.01.030 36. Cunningham AL, Noble JR (1989) Role of keratinocytes in human recurrent herpetic lesions. Ability to present herpes simplex virus antigen and act as targets for T lymphocyte cytotoxicity in vitro. J Clin Invest 83 (2):490–496. https://doi.org/10.1172/ jci113908 37. Nickoloff BJ, Turka LA (1994) Immunological functions of non-professional antigen-presenting cells: new insights from studies of Tcell interactions with keratinocytes. Immunol Today 15(10):464–469. https://doi.org/10. 1016/0167-5699(94)90190-2 38. Takaoka A, Yanai H (2006) Interferon signalling network in innate defence. Cell Microbiol 8(6):907–922. https://doi.org/10.1111/j. 1462-5822.2006.00716.x 39. Chan T, Barra NG, Lee AJ et al (2011) Innate and adaptive immunity against herpes simplex virus type 2 in the genital mucosa. J Reprod Immunol 88(2):210–218. https://doi.org/ 10.1016/j.jri.2011.01.001 40. Donaghy H, Bosnjak L, Harman AN et al (2009) Role for plasmacytoid dendritic cells in the immune control of recurrent human herpes simplex virus infection. J Virol 83 (4):1952–1961. https://doi.org/10.1128/ jvi.01578-08 41. Ashkar AA, Rosenthal KL (2003) Interleukin15 and natural killer and NKT cells play a

50

Kerrie J. Sandgren et al.

critical role in innate protection against genital herpes simplex virus type 2 infection. J Virol 77(18):10168–10171 42. Kawakami Y, Ando T, Lee JR et al (2017) Defective natural killer cell activity in a mouse model of eczema herpeticum. J Allergy Clin Immunol 139(3):997–1006.e1010. https://doi.org/10.1016/j.jaci.2016.06. 034 43. Thapa M, Kuziel WA, Carr DJ (2007) Susceptibility of CCR5-deficient mice to genital herpes simplex virus type 2 is linked to NK cell mobilization. J Virol 81(8):3704–3713. https://doi.org/10.1128/jvi.02626-06 44. Biron CA, Byron KS, Sullivan JL (1989) Severe herpesvirus infections in an adolescent without natural killer cells. N Engl J Med 320 (26):1731–1735. https://doi.org/10.1056/ nejm198906293202605 45. Dalloul A, Oksenhendler E, Chosidow O et al (2004) Severe herpes virus (HSV-2) infection in two patients with myelodysplasia and undetectable NK cells and plasmacytoid dendritic cells in the blood. J Clin Virol 30 (4):329–336. https://doi.org/10.1016/j. jcv.2003.11.014 46. Koelle DM, Frank JM, Johnson ML et al (1998) Recognition of herpes simplex virus type 2 tegument proteins by CD4 T cells infiltrating human genital herpes lesions. J Virol 72(9):7476–7483 47. Kim M, Osborne NR, Zeng W et al (2012) Herpes simplex virus antigens directly activate NK cells via TLR2, thus facilitating their presentation to CD4 T lymphocytes. J Immunol 188(9):4158–4170. https://doi.org/10. 4049/jimmunol.1103450 48. Milligan GN, Bernstein DI (1997) Interferon-gamma enhances resolution of herpes simplex virus type 2 infection of the murine genital tract. Virology 229(1):259–268. https://doi.org/10.1006/viro.1997.8441 49. Gill N, Ashkar AA (2009) Overexpression of interleukin-15 compromises CD4-dependent adaptive immune responses against herpes simplex virus 2. J Virol 83(2):918–926. https://doi.org/10.1128/jvi.01282-08 50. Cunningham AL, Turner RR, Miller AC et al (1985) Evolution of recurrent herpes simplex lesions. An immunohistologic study. J Clin Invest 75(1):226–233. https://doi.org/10. 1172/jci111678 51. Eberl G, Colonna M, Di Santo JP et al (2015) Innate lymphoid cells. Innate lymphoid cells: a new paradigm in immunology. Science 348 (6237):aaa6566. https://doi.org/10.1126/ science.aaa6566

52. Yang Q, Bhandoola A (2016) The development of adult innate lymphoid cells. Curr Opin Immunol 39:114–120. https://doi. org/10.1016/j.coi.2016.01.006 53. Ashley RL, Corey L, Dalessio J et al (1994) Protein-specific cervical antibody responses to primary genital herpes simplex virus type 2 infections. J Infect Dis 170(1):20–26 54. Gallichan WS, Rosenthal KL (1998) Longterm immunity and protection against herpes simplex virus type 2 in the murine female genital tract after mucosal but not systemic immunization. J Infect Dis 177 (5):1155–1161 55. Parr EL, Parr MB (1997) Immunoglobulin G is the main protective antibody in mouse vaginal secretions after vaginal immunization with attenuated herpes simplex virus type 2. J Virol 71(11):8109–8115 56. Halford WP, Geltz J, Messer RJ et al (2015) Antibodies are required for complete vaccineinduced protection against herpes simplex virus 2. PLoS One 10(12):e0145228. https://doi.org/10.1371/journal.pone. 0145228 57. Halford WP, Geltz J, Gershburg E (2013) Pan-HSV-2 IgG antibody in vaccinated mice and guinea pigs correlates with protection against herpes simplex virus 2. PLoS One 8 (6):e65523. https://doi.org/10.1371/jour nal.pone.0065523 58. McDermott MR, Brais LJ, Evelegh MJ (1990) Mucosal and systemic antiviral antibodies in mice inoculated intravaginally with herpes simplex virus type 2. J Gen Virol 71 (Pt 7):1497–1504. https://doi.org/10. 1099/0022-1317-71-7-1497 59. Morrison LA, Zhu L, Thebeau LG (2001) Vaccine-induced serum immunoglobin contributes to protection from herpes simplex virus type 2 genital infection in the presence of immune T cells. J Virol 75(3):1195–1204. https://doi.org/10.1128/jvi.75.3.11951204.2001 60. Dudley KL, Bourne N, Milligan GN (2000) Immune protection against HSV-2 in B-celldeficient mice. Virology 270(2):454–463. https://doi.org/10.1006/viro.2000.0298 61. Harandi AM, Svennerholm B, Holmgren J et al (2001) Differential roles of B cells and IFNgamma-secreting CD4(+) T cells in innate and adaptive immune control of genital herpes simplex virus type 2 infection in mice. J Gen Virol 82(Pt 4):845–853. https://doi.org/10. 1099/0022-1317-82-4-845 62. Awasthi S, Hook LM, Shaw CE et al (2017) An HSV-2 trivalent vaccine is immunogenic

Immunology Drives HSV Vaccine Progress in rhesus macaques and highly efficacious in guinea pigs. PLoS Pathog 13(1):e1006141. https://doi.org/10.1371/journal.ppat. 1006141 63. Awasthi S, Hook LM, Shaw CE et al (2017) A trivalent subunit antigen glycoprotein vaccine as immunotherapy for genital herpes in the guinea pig genital infection model. Hum Vaccin Immunother 13(12):2785–2793. https://doi.org/10.1080/21645515.2017. 1323604 64. Mikloska Z, Sanna PP, Cunningham AL (1999) Neutralizing antibodies inhibit axonal spread of herpes simplex virus type 1 to epidermal cells in vitro. J Virol 73(7):5934–5944 65. Looker KJ, Magaret AS, May MT et al (2017) First estimates of the global and regional incidence of neonatal herpes infection. Lancet Glob Health 5(3):e300–e309. https://doi. org/10.1016/s2214-109x(16)30362-x 66. Prober CG, Sullender WM, Yasukawa LL et al (1987) Low risk of herpes simplex virus infections in neonates exposed to the virus at the time of vaginal delivery to mothers with recurrent genital herpes simplex virus infections. N Engl J Med 316(5):240–244. https://doi. org/10.1056/nejm198701293160503 67. Brown ZA, Wald A, Morrow RA et al (2003) Effect of serologic status and cesarean delivery on transmission rates of herpes simplex virus from mother to infant. JAMA 289 (2):203–209 68. Allen UD, Robinson JL (2014) Prevention and management of neonatal herpes simplex virus infections. Paediatr Child Health 19 (4):201–212 69. Dancis J, Lind J, Oratz M et al (1961) Placental transfer of proteins in human gestation. Am J Obstet Gynecol 82:167–171 70. Evans IA, Jones CA (2002) Maternal immunization with a herpes simplex virus type 2 replication-defective virus reduces visceral dissemination but not lethal encephalitis in newborn mice after oral challenge. J Infect Dis 185(11):1550–1560. https://doi.org/ 10.1086/340572 71. Jiang Y, Patel CD, Manivanh R et al (2017) Maternal antiviral immunoglobulin accumulates in neural tissue of neonates to prevent HSV neurological disease. mBio 8(4). https://doi.org/10.1128/mBio.00678-17 72. Kao C, Burn C, Jacobs WR Jr et al (2017) Maternal immunization with a single-cycle herpes simplex virus (HSV) candidate vaccine, ΔgD-2, protects neonatal mice from lethal viral challenge. Open Forum Infect Dis 4

51

(Suppl 1):S22. https://doi.org/10.1093/ ofid/ofx162.056 73. Marchant A, Sadarangani M, Garand M et al (2017) Maternal immunisation: collaborating with mother nature. Lancet Infect Dis 17(7): e197–e208. https://doi.org/10.1016/ s1473-3099(17)30229-3 74. Cella M, Scheidegger D, Palmer-Lehmann K et al (1996) Ligation of CD40 on dendritic cells triggers production of high levels of interleukin-12 and enhances T cell stimulatory capacity: T-T help via APC activation. J Exp Med 184(2):747–752 75. Murphy KM, Stockinger B (2010) Effector T cell plasticity: flexibility in the face of changing circumstances. Nat Immunol 11(8):674–680. https://doi.org/10.1038/ni.1899 76. Iijima N, Linehan MM, Zamora M et al (2008) Dendritic cells and B cells maximize mucosal Th1 memory response to herpes simplex virus. J Exp Med 205(13):3041–3052. https://doi.org/10.1084/jem.20082039 77. Bourne N, Perry CL, Banasik BN et al (2019) Increased frequency of virus shedding by herpes simplex virus 2-infected guinea pigs in the absence of CD4(+) T lymphocytes. J Virol 93 (4). https://doi.org/10.1128/jvi.01721-18 78. Egan KP, Wu S, Wigdahl B et al (2013) Immunological control of herpes simplex virus infections. J Neurovirol 19 (4):328–345. https://doi.org/10.1007/ s13365-013-0189-3 79. Ouwendijk WJ, Laing KJ, Verjans GM et al (2013) T-cell immunity to human alphaherpesviruses. Curr Opin Virol 3(4):452–460. https://doi.org/10.1016/j.coviro.2013.04. 004 80. van Velzen M, Jing L, Osterhaus AD et al (2013) Local CD4 and CD8 T-cell reactivity to HSV-1 antigens documents broad viral protein expression and immune competence in latently infected human trigeminal ganglia. PLoS Pathog 9(8):e1003547. https://doi. org/10.1371/journal.ppat.1003547 81. Decman V, Kinchington PR, Harvey SA et al (2005) Gamma interferon can block herpes simplex virus type 1 reactivation from latency, even in the presence of late gene expression. J Virol 79(16):10339–10347. https://doi. org/10.1128/jvi.79.16.10339-10347.2005 82. Knickelbein JE, Khanna KM, Yee MB et al (2008) Noncytotoxic lytic granule-mediated CD8+ T cell inhibition of HSV-1 reactivation from neuronal latency. Science 322 (5899):268–271. https://doi.org/10.1126/ science.1164164

52

Kerrie J. Sandgren et al.

83. Nakanishi Y, Lu B, Gerard C et al (2009) CD8(+) T lymphocyte mobilization to virusinfected tissue requires CD4(+) T-cell help. Nature 462(7272):510–513. https://doi. org/10.1038/nature08511 84. Zhu J, Hladik F, Woodward A et al (2009) Persistence of HIV-1 receptor-positive cells after HSV-2 reactivation is a potential mechanism for increased HIV-1 acquisition. Nat Med 15(8):886–892. https://doi.org/10. 1038/nm.2006 85. Zhu J, Peng T, Johnston C et al (2013) Immune surveillance by CD8alphaalpha+ skin-resident T cells in human herpes virus infection. Nature 497(7450):494–497. https://doi.org/10.1038/nature12110 86. Zhu J, Koelle DM, Cao J et al (2007) Virusspecific CD8+ T cells accumulate near sensory nerve endings in genital skin during subclinical HSV-2 reactivation. J Exp Med 204 (3):595–603. https://doi.org/10.1084/ jem.20061792 87. Posavad CM, Zhao L, Dong L et al (2017) Enrichment of herpes simplex virus type 2 (HSV-2) reactive mucosal T cells in the human female genital tract. Mucosal Immunol 10(5):1259–1269. https://doi.org/10. 1038/mi.2016.118 88. Peng T, Zhu J, Phasouk K et al (2012) An effector phenotype of CD8+ T cells at the junction epithelium during clinical quiescence of herpes simplex virus 2 infection. J Virol 86 (19):10587–10596. https://doi.org/10. 1128/jvi.01237-12 89. Schiffer JT, Swan DA, Roychoudhury P et al (2018) A fixed spatial structure of CD8(+) T cells in tissue during chronic HSV-2 infection. J Immunol 201(5):1522–1535. https://doi. org/10.4049/jimmunol.1800471 90. Diaz GA, Koelle DM (2006) Human CD4+ CD25 high cells suppress proliferative memory lymphocyte responses to herpes simplex virus type 2. J Virol 80(16):8271–8273. https://doi.org/10.1128/jvi.00656-06 91. Fernandez MA, Puttur FK, Wang YM et al (2008) T regulatory cells contribute to the attenuated primary CD8+ and CD4+ T cell responses to herpes simplex virus type 2 in neonatal mice. J Immunol 180 (3):1556–1564 92. Fernandez MA, Yu U, Zhang G et al (2013) Treg depletion attenuates the severity of skin disease from ganglionic spread after HSV-2 flank infection. Virology 447 (1–2):9–20. https://doi.org/10.1016/j. virol.2013.08.027

93. Milman N, Zhu J, Johnston C et al (2016) In situ detection of regulatory T cells in human genital herpes simplex virus type 2 (HSV-2) reactivation and their influence on spontaneous HSV-2 reactivation. J Infect Dis 214 (1):23–31. https://doi.org/10.1093/ infdis/jiw091 94. Bos JD, Teunissen MB, Cairo I et al (1990) Tcell receptor gamma delta bearing cells in normal human skin. J Invest Dermatol 94 (1):37–42 95. Sciammas R, Kodukula P, Tang Q et al (1997) T cell receptor-gamma/delta cells protect mice from herpes simplex virus type 1induced lethal encephalitis. J Exp Med 185 (11):1969–1975 96. Puttur FK, Fernandez MA, White R et al (2010) Herpes simplex virus infects skin gamma delta T cells before Langerhans cells and impedes migration of infected Langerhans cells by inducing apoptosis and blocking E-cadherin downregulation. J Immunol 185 (1):477–487. https://doi.org/10.4049/ jimmunol.0904106 97. Kashem SW, Haniffa M, Kaplan DH (2017) Antigen-presenting cells in the skin. Annu Rev Immunol 35:469–499. https://doi.org/ 10.1146/annurev-immunol-051116052215 98. Bosnjak L, Miranda-Saksena M, Koelle DM et al (2005) Herpes simplex virus infection of human dendritic cells induces apoptosis and allows cross-presentation via uninfected dendritic cells. J Immunol 174(4):2220–2227 99. Mikloska Z, Bosnjak L, Cunningham AL (2001) Immature monocyte-derived dendritic cells are productively infected with herpes simplex virus type 1. J Virol 75 (13):5958–5964. https://doi.org/10.1128/ jvi.75.13.5958-5964.2001 100. Sprecher E, Becker Y (1986) Skin Langerhans cells play an essential role in the defense against HSV-1 infection. Arch Virol 91 (3–4):341–349 101. Allan RS, Smith CM, Belz GT et al (2003) Epidermal viral immunity induced by CD8alpha+ dendritic cells but not by Langerhans cells. Science 301(5641):1925–1928. https://doi.org/10.1126/science.1087576 102. Bedoui S, Whitney PG, Waithman J et al (2009) Cross-presentation of viral and self antigens by skin-derived CD103+ dendritic cells. Nat Immunol 10(5):488–495. https:// doi.org/10.1038/ni.1724 103. Zhao X, Deak E, Soderberg K et al (2003) Vaginal submucosal dendritic cells, but not Langerhans cells, induce protective Th1

Immunology Drives HSV Vaccine Progress responses to herpes simplex virus-2. J Exp Med 197(2):153–162 104. Kim M, Truong NR, James V et al (2015) Relay of herpes simplex virus between Langerhans cells and dermal dendritic cells in human skin. PLoS Pathog 11(4):e1004812. https://doi.org/10.1371/journal.ppat. 1004812 105. Guilliams M, Ginhoux F, Jakubzick C et al (2014) Dendritic cells, monocytes and macrophages: a unified nomenclature based on ontogeny. Nat Rev Immunol 14 (8):571–578. https://doi.org/10.1038/ nri3712 106. Theisen D, Murphy K (2017) The role of cDC1s in vivo: CD8 T cell priming through cross-presentation. F1000Research 6:98. https://doi.org/10.12688/f1000research. 9997.1 107. Fehres CM, Bruijns SC, Sotthewes BN et al (2015) Phenotypic and functional properties of human steady state CD14+ and CD1a+ antigen presenting cells and epidermal Langerhans cells. PLoS One 10(11):e0143519. https://doi.org/10.1371/journal.pone. 0143519 108. Haniffa M, Shin A, Bigley V et al (2012) Human tissues contain CD141hi cross-presenting dendritic cells with functional homology to mouse CD103+ nonlymphoid dendritic cells. Immunity 37(1):60–73. https://doi.org/10.1016/j.immuni.2012. 04.012 109. McGovern N, Schlitzer A, Gunawan M et al (2014) Human dermal CD14(+) cells are a transient population of monocyte-derived macrophages. Immunity 41(3):465–477. https://doi.org/10.1016/j.immuni.2014. 08.006 110. Cairns TM, Huang ZY, Gallagher JR et al (2015) Patient-specific neutralizing antibody responses to herpes simplex virus are attributed to epitopes on gD, gB, or both and can be type specific. J Virol 89(18):9213–9231. https://doi.org/10.1128/jvi.01213-15 111. Cairns TM, Huang ZY, Whitbeck JC et al (2014) Dissection of the antibody response against herpes simplex virus glycoproteins in naturally infected humans. J Virol 88 (21):12612–12622. https://doi.org/10. 1128/jvi.01930-14 112. Berman PW, Gregory T, Crase D et al (1985) Protection from genital herpes simplex virus type 2 infection by vaccination with cloned type 1 glycoprotein D. Science 227 (4693):1490–1492

53

113. Eisenberg RJ, Long D, Ponce de Leon M et al (1985) Localization of epitopes of herpes simplex virus type 1 glycoprotein D. J Virol 53(2):634–644 114. Stanfield BA, Stahl J, Chouljenko VN et al (2014) A single intramuscular vaccination of mice with the HSV-1 VC2 virus with mutations in the glycoprotein K and the membrane protein UL20 confers full protection against lethal intravaginal challenge with virulent HSV-1 and HSV-2 strains. PLoS One 9(10): e109890. https://doi.org/10.1371/journal. pone.0109890 115. Hook LM, Cairns TM, Awasthi S et al (2018) Vaccine-induced antibodies to herpes simplex virus glycoprotein D epitopes involved in virus entry and cell-to-cell spread correlate with protection against genital disease in guinea pigs. PLoS Pathog 14(5):e1007095. https://doi.org/10.1371/journal.ppat. 1007095 116. Dropulic L, Wang K, Oestreich M et al (2017) A replication-defective herpes simplex virus (HSV)-2 vaccine, HSV529, is safe and well-tolerated in adults with or without HSV infection and induces significant HSV-2-specific antibody responses in HSV seronegative individuals. Open Forum Infect Dis 4(Suppl 1):S415–S416. https://doi.org/10.1093/ ofid/ofx163.1041 117. Burn C, Ramsey N, Garforth SJ et al (2018) A herpes simplex virus (HSV)-2 single-cycle candidate vaccine deleted in glycoprotein D protects male mice from lethal skin challenge with clinical isolates of HSV-1 and HSV-2. J Infect Dis 217(5):754–758. https://doi.org/ 10.1093/infdis/jix628 118. Petro C, Gonzalez PA, Cheshenko N et al (2015) Herpes simplex type 2 virus deleted in glycoprotein D protects against vaginal, skin and neural disease. eLife 4. https://doi. org/10.7554/eLife.06054 119. Petro CD, Weinrick B, Khajoueinejad N et al (2016) HSV-2 DeltagD elicits FcgammaReffector antibodies that protect against clinical isolates. JCI Insight 1(12). https://doi.org/ 10.1172/jci.insight.88529 120. Mertz GJ, Ashley R, Burke RL et al (1990) Double-blind, placebo-controlled trial of a herpes simplex virus type 2 glycoprotein vaccine in persons at high risk for genital herpes infection. J Infect Dis 161(4):653–660 121. Terhune SS, Coleman KT, Sekulovich R et al (1998) Limited variability of glycoprotein gene sequences and neutralizing targets in herpes simplex virus type 2 isolates and stability on passage in cell culture. J Infect Dis 178 (1):8–15

54

Kerrie J. Sandgren et al.

122. Koelle DM, Schomogyi M, McClurkan C et al (2000) CD4 T-cell responses to herpes simplex virus type 2 major capsid protein VP5: comparison with responses to tegument and envelope glycoproteins. J Virol 74 (23):11422–11425 123. Kim M, Taylor J, Sidney J et al (2008) Immunodominant epitopes in herpes simplex virus type 2 glycoprotein D are recognized by CD4 lymphocytes from both HSV-1 and HSV2 seropositive subjects. J Immunol 181 (9):6604–6615 124. Mikloska Z, Ruckholdt M, Ghadiminejad I et al (2000) Monophosphoryl lipid A and QS21 increase CD8 T lymphocyte cytotoxicity to herpes simplex virus-2 infected cell proteins 4 and 27 through IFN-gamma and IL-12 production. J Immunol 164(10):5167–5176 125. Hosken N, McGowan P, Meier A et al (2006) Diversity of the CD8+ T-cell response to herpes simplex virus type 2 proteins among persons with genital herpes. J Virol 80 (11):5509–5515. https://doi.org/10.1128/ JVI.02659-05 126. Jing L, Laing KJ, Dong L et al (2016) Extensive CD4 and CD8 T cell cross-reactivity between Alphaherpesviruses. J Immunol 196 (5):2205–2218. https://doi.org/10.4049/ jimmunol.1502366 127. Porchia B, Moreno ACR, Ramos RN et al (2017) Herpes simplex virus glycoprotein D targets a specific dendritic cell subset and improves the performance of vaccines to human papillomavirus-associated tumors. Mol Cancer Ther 16(9):1922–1933. https://doi.org/10.1158/1535-7163.Mct17-0071 128. Ford E, Li A, Dong L, et al. (2018) Expansion of the tissue based T-cell receptor repertoire is distinct from the PBMC response after immunotherapeutic HSV-2 vaccine. Paper presented at the International Herpesvirus Workshop, Vancouver, BC 129. Wang K, Goodman KN, Li DY et al (2016) A herpes simplex virus 2 (HSV-2) gD mutant impaired for neural tropism is superior to an HSV-2 gD subunit vaccine to protect animals from challenge with HSV-2. J Virol 90 (1):562–574. https://doi.org/10.1128/jvi. 01845-15 130. Shin H, Iwasaki A (2012) A vaccine strategy that protects against genital herpes by establishing local memory T cells. Nature 491 (7424):463–467. https://doi.org/10.1038/ nature11522 131. Shin H, Kumamoto Y, Gopinath S et al (2016) CD301b+ dendritic cells stimulate tissue-resident memory CD8+ T cells to protect

against genital HSV-2. Nat Commun 7:13346. https://doi.org/10.1038/ ncomms13346 132. Ahmed M, Smith DM, Hamouda T et al (2017) A novel nanoemulsion vaccine induces mucosal Interleukin-17 responses and confers protection upon Mycobacterium tuberculosis challenge in mice. Vaccine 35 (37):4983–4989. https://doi.org/10.1016/ j.vaccine.2017.07.073 133. O’Konek JJ, Makidon PE, Landers JJ et al (2015) Intranasal nanoemulsion-based inactivated respiratory syncytial virus vaccines protect against viral challenge in cotton rats. Hum Vaccin Immunother 11 (12):2904–2912. https://doi.org/10.1080/ 21645515.2015.1075680 134. Bluewillow Biologics (2018) HSV-2 vaccine. Bluewillow Biologics. http://www.blue willow.com/vaccine-pipeline/hsv-2-vaccine/ 135. Zhang X, Chentoufi AA, Dasgupta G et al (2009) A genital tract peptide epitope vaccine targeting TLR-2 efficiently induces local and systemic CD8+ T cells and protects against herpes simplex virus type 2 challenge. Mucosal Immunol 2(2):129–143. https://doi.org/ 10.1038/mi.2008.81 136. Zhang X, Dervillez X, Chentoufi AA et al (2012) Targeting the genital tract mucosa with a lipopeptide/recombinant adenovirus prime/boost vaccine induces potent and long-lasting CD8+ T cell immunity against herpes: importance of MyD88. J Immunol 189(9):4496–4509. https://doi.org/10. 4049/jimmunol.1201121 137. He Q, Mitchell A, Morcol T et al (2002) Calcium phosphate nanoparticles induce mucosal immunity and protection against herpes simplex virus type 2. Clin Diagn Lab Immunol 9(5):1021–1024 138. Marrack P, McKee AS, Munks MW (2009) Towards an understanding of the adjuvant action of aluminium. Nat Rev Immunol 9 (4):287–293. https://doi.org/10.1038/ nri2510 139. Di Pasquale A, Preiss S, Tavares Da Silva F et al (2015) Vaccine adjuvants: from 1920 to 2015 and beyond. Vaccine 3(2):320–343. https://doi.org/10.3390/vaccines3020320 140. den Brok MH, Bull C, Wassink M et al (2016) Saponin-based adjuvants induce cross-presentation in dendritic cells by intracellular lipid body formation. Nat Commun 7:13324. https://doi.org/10.1038/ncomms13324 141. Flechtner JB, Long D, Larson S et al (2016) Immune responses elicited by the GEN-003 candidate HSV-2 therapeutic vaccine in a

Immunology Drives HSV Vaccine Progress randomized controlled dose-ranging phase 1/2a trial. Vaccine 34(44):5314–5320. https://doi.org/10.1016/j.vaccine.2016. 09.001 142. Ferlazzo G, Morandi B (2014) Cross-talks between natural killer cells and distinct subsets of dendritic cells. Front Immunol 5:159. https://doi.org/10.3389/fimmu.2014. 00159 143. Deauvieau F, Ollion V, Doffin AC et al (2015) Human natural killer cells promote cross-presentation of tumor cell-derived antigens by dendritic cells. Int J Cancer 136 (5):1085–1094. https://doi.org/10.1002/ ijc.29087 144. Cohen J (2010) Immunology. Painful failure of promising genital herpes vaccine. Science 330(6002):304 145. Bernstein DI, Wald A, Warren T et al (2017) Therapeutic vaccine for genital herpes simplex virus-2 infection: findings from a randomized trial. J Infect Dis 215(6):856–864 146. Genocea (2017) Genocea announces strategic shift to immuno oncology and the development of neoantigen cancer vaccines 147. Van Wagoner N, Fife K, Leone PA et al (2018) Effects of different doses of GEN003, a therapeutic vaccine for genital herpes simplex virus-2, on viral shedding and lesions: results of a randomized placebo-controlled trial. J Infect Dis 218(12):1890–1899 148. Wald A, Koelle DM, Fife K et al (2011) Safety and immunogenicity of long HSV-2 peptides complexed with rhHsc70 in HSV-2 seropositive persons. Vaccine 29(47):8520–8529 149. Agenus (2014) Agenus vaccine shows significant reduction in viral burden after herpv generated immune activation [online]. https://investor.agenusbio.com/2014-0626-Agenus-Vaccine-Shows-Significant-Reduc tion-in-Viral-Burden-after-HerpV-Gener ated-Immune-Activation 150. Veselenak RL, Shlapobersky M, Pyles RB et al (2012) A Vaxfectin((R))-adjuvanted HSV2 plasmid DNA vaccine is effective for prophylactic and therapeutic use in the guinea pig model of genital herpes. Vaccine 30 (49):7046–7051 151. Vical (2018) Vical reports phase 2 trial of HSV-2 therapeutic vaccine did not meet primary endpoint. Vical 152. Admedus (2017) Admedus hsv 2 phase iia results. Admedus 153. Dutton JL, Woo WP, Chandra J et al (2016) An escalating dose study to assess the safety, tolerability and immunogenicity of a Herpes Simplex Virus DNA vaccine, COR-1. Hum Vaccin Immunother 12(12):3079–3088

55

154. Proactive Investors (2017) Admedus meets primary endpoint for herpes vaccine study [online]. https://www.proactiveinvestors. com.au/companies/news/177275/ admedus-meets-primary-endpoint-for-her pes-vaccine-study-177275.html 155. Bluewillow Biologics (2017) Nanobio receives sbir grant for genital herpes vaccine [online]. http://www.bluewillow.com/ nanobio-receives-sbir-grant-for-genital-her pes-vaccine/ 156. Awasthi S, Huang J, Shaw C et al (2014) Blocking herpes simplex virus 2 glycoprotein E immune evasion as an approach to enhance efficacy of a trivalent subunit antigen vaccine for genital herpes. J Virol 88(15):8421–8432 157. Odegard JM, Flynn PA, Campbell DJ et al (2016) A novel HSV-2 subunit vaccine induces GLA-dependent CD4 and CD8 T cell responses and protective immunity in mice and guinea pigs. Vaccine 34(1):101–109 158. NIH (2018) HSV vaccine in hsv-2 seropositive adults [online]. https://clinicaltrials. gov/ct2/show/record/NCT02571166? view=record 159. Halford WP, Puschel R, Gershburg E et al (2011) A live-attenuated HSV-2 ICP0 virus elicits 10 to 100 times greater protection against genital herpes than a glycoprotein D subunit vaccine. PLoS One 6(3):e17748 160. Stanfield BA, Pahar B, Chouljenko VN et al (2017) Vaccination of rhesus macaques with the live-attenuated HSV-1 vaccine VC2 stimulates the proliferation of mucosal T cells and germinal center responses resulting in sustained production of highly neutralizing antibodies. Vaccine 35(4):536–543 161. Stanfield BA, Rider PJF, Caskey J et al (2018) Intramuscular vaccination of guinea pigs with the live-attenuated human herpes simplex vaccine VC2 stimulates a transcriptional profile of vaginal Th17 and regulatory Tr1 responses. Vaccine 36(20):2842–2849 162. Richards AL, Sollars PJ, Pitts JD et al (2017) The pUL37 tegument protein guides alphaherpesvirus retrograde axonal transport to promote neuroinvasion. PLoS Pathog 13 (12):e1006741 163. Truong NR, Smith JB, Sandgren KJ et al (2019) Mechanisms of immune control of mucosal HSV infection: a guide to rational vaccine design. Front Immunol 10:373 164. Chohan V, Baeten JM, Benki S et al (2009) A prospective study of risk factors for herpes simplex virus type 2 acquisition among highrisk HIV-1 seronegative women in Kenya. Sex Transm Infect 85(7):489–492. https://doi. org/10.1136/sti.2009.036103

56

Kerrie J. Sandgren et al.

165. Gosmann C, Anahtar MN, Handley SA et al (2017) Lactobacillus-deficient cervicovaginal bacterial communities are associated with increased HIV acquisition in young South African women. Immunity 46(1):29–37. https://doi.org/10.1016/j.immuni.2016. 12.013 166. Masese L, Baeten JM, Richardson BA et al (2015) Changes in the contribution of genital tract infections to HIV acquisition among

Kenyan high-risk women from 1993 to 2012. AIDS 29(9):1077–1085. https://doi. org/10.1097/qad.0000000000000646 167. Masese L, Baeten JM, Richardson BA et al (2014) Incident herpes simplex virus type 2 infection increases the risk of subsequent episodes of bacterial vaginosis. J Infect Dis 209(7):1023–1027. https://doi.org/10. 1093/infdis/jit634

Chapter 3 Herpes Simplex Virus Growth, Preparation, and Assay Sereina O. Sutter, Peggy Marconi, and Anita F. Meier Abstract The human herpesvirus family members, in particular herpes simplex virus type 1 (HSV-1) and herpes simplex virus type 2 (HSV-2), are abundant and extremely contagious viruses with a high seroprevalence in the human population emphasizing the importance of studying their biology. Hence, the propagation and purification of virus stocks constitute a key element in laboratory work. Key words HSV growth, Plaque purification, Plaque titration, Growth curve, Virus stock, Purification

1

Introduction Herpes, derived from the ancient Greek word “to creep or crawl” [1] refers to a family of viruses of which HSV-1 and HSV-2 are common and important human pathogens. HSV infections cause a wide range of diseases, some of which show a mild course of disease while others are life threatening. HSV-1 most frequently invades oral and ocular epithelial cells while HSV-2 infects the genital areas, but both strains have the ability to cause infection in either area of the body. After initial infection and replication in the epithelial mucosa, which causes epithelial cell death, the virus enters the sensory neurons that innervate the infected area and, following retrograde transport to the cell bodies, establishes a lifelong latent infection in sensory ganglia. HSV has the ability to infect and grow in a wide variety of cell types. Different permissive cell lines can be routinely used to grow replication competent HSV, such as Vero (African green monkey kidney), BHK (baby hamster kidney), RK (rabbit kidney), HeLa (human cervical cancer) as well as HEp2 (HeLa derivative, human epidermoid carcinoma) cells. HSV can spread from a single infected cell to neighboring cells by two distinct routes: cytolysis or cell fusion. Some virus strains induce cytopathic effects leading to necrosis of the infected cells. Progeny virus particles are set free by virus-induced lysis (cytolysis) leading

Russell J. Diefenbach and Cornel Fraefel (eds.), Herpes Simplex Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2060, https://doi.org/10.1007/978-1-4939-9814-2_3, © Springer Science+Business Media, LLC, part of Springer Nature 2020

57

58

Sereina O. Sutter et al.

to the infection of neighboring cells. Other virus strains can pass from cell to cell without lysis. Instead, they induce fusion between the cells, leading to a polykaryocyte formation (syncytial phenotype, Syn+). Cytolysis as well as syncytium foci result in plaques of infection that can be counted to determine the virus titers (number of plaque-forming units, PFU). Many different strategies and methods for HSV manipulation and purification have been developed in the past in order to obtain high titers of purified virus stocks. However, although it appears simple to produce HSV stocks, there are specific aspects that should be considered, such as spontaneous genomic mutations, which (if they are not essential for virus replication) are maintained in the progeny virus population. A full factorial assay (serum, cell density, cell type, time of harvesting) should be performed in order to define the optimal conditions to prepare high titer HSV stocks. In our experience, it is crucial to infect the cells with the optimal multiplicity of infection (MOI). A low MOI allows optimal amplification and packaging of the complete virion and avoids the formation of defective particles.

2 2.1

Materials Cell Culture

1. Incubator: humidified, 37
C, 95% air, 5% CO2, suitable for cell culture. 2. 1 PBS (phosphate buffered saline): 137 mM NaCl, 2.7 mM KCl, 8 mM Na2HPO4, 2 mM KH2PO4, pH 7.4. Dissolve 8 g of NaCl, 0.2 g of KCl, 1.44 g of Na2HPO4, 0.24 g of KH2PO4 in 800 ml of distilled H2O. Adjust pH to 7.4 and bring the volume to 1 l with distilled H2O. Sterilize by autoclaving. Store at room temperature. 3. Trypsin solution: 0.25% trypsin–0.02% EDTA. 4. Vero cells (African green monkey kidney, ATCC). 5. Cell culture medium: Dulbecco’s Modified Eagle’s Medium (DMEM) high glucose, supplemented with 10% fetal bovine serum (FBS), 2 mM glutamine, 100 units/ml penicillin, 100 μg/ml streptomycin. 6. 75-cm2 tissue culture flask. 7. Hemacytometer.

2.2

Limiting Dilution

1. Incubator. 2. HSV-1 stock (titrated). 3. Sonicator: Ultrasonic Processor with 2½00 Cup Horn. 4. 1 PBS. 5. Trypsin solution.

HSV-1 Preparation

59

6. Vero cells. 7. Serum-free cell culture medium: Dulbecco’s Modified Eagle’s Medium (DMEM) high glucose, without FBS or antibiotic/ antimycotic. 8. Cell culture medium. 9. 15 ml polypropylene centrifuge tubes. 10. 50 ml reagent reservoirs, polystyrene. 11. Multichannel pipette. 12. 96-well plates. 13. Pipette tips with filters for p20, p200, and p1000 to protect the pipette shafts from contamination and reduce the risk of crosscontamination with virus particles. 14. Light microscope. 2.3 Preparation of Wild-Type HSV Midi Stocks

1. Incubator. 2. T75 or T175 cm2 tissue culture flask. 3. Vero cells. 4. Cell culture medium. 5. Serum-free cell culture medium. 6. Trypsin solution. 7. 1 PBS. 8. HSV-1 stock (from Subheading 3.2).

limiting

dilution

prepared

in

9. Cell scrapers: 18 cm handle/1.8 cm blade and 25 cm handle/ 1.8 cm blade. 10. 15 and 50 ml polypropylene centrifuge tubes. 11. 30 ml tubes (Centrifuge Oak Ridge copolymer). 12. Sonicator. 13. Appropriate centrifuge and rotor (e.g., Beckman Avanti J25 with JA-20 rotor). 14. Liquid N2. 15. Water bath. 16. Glycerol. 17. 1.5 ml tubes suitable for storage at 80
C. 2.4 Preparation of Wild-Type HSV Stocks

1. Incubator. 2. T150–175 cm2 tissue culture flasks. 3. Vero cells. 4. Cell culture medium. 5. Serum-free cell culture medium.

60

Sereina O. Sutter et al.

6. Trypsin solution. 7. 1 PBS. 8. HSV-1 stock (titrated HSV-1 midi stock prepared in Subheading 3.3). 9. Cell scrapers: 18 cm handle/1.8 cm blade and 25 cm handle/ 1.8 cm blade. 10. 15 and 50 ml polypropylene centrifuge tubes. 11. 30 ml tubes (Centrifuge Oak Ridge copolymer). 12. Sonicator. 13. Appropriate centrifuge and rotor (e.g., Beckman Avanti J25 with JA-20 rotor). 14. Liquid N2. 15. Water bath. 16. Glycerol. 17. 1.5 ml tubes suitable for storage at 80
C. 2.5 Purification of HSV Stocks

1. OptiSeal polyallomer centrifuge tubes and plugs 5/8  2¾ in., 11.2 ml capacity. 2. Needles: 18 G, 1½ in. 3. Syringes: 10 cc. 4. Sonicator. 5. Appropriate centrifuge and rotor (e.g., Beckman Avanti J25 with JA-20 rotor). 6. Appropriate centrifuge and rotor (e.g., Ultracentrifuge Beckman Coulter Optima LE-80K with Vti65.1 rotor). 7. Iodixanol solution: 60% (w/v) iodixanol in water with a density of 1.32 g/ml (e.g., OptiPrep). 8. Stericup, vacuum disposable filtration system, 0.22 μm. 9. Gradient solution A: 2.8 ml of 5 M NaCl, 6 ml of 1 M HEPES, pH 7.3, 1.2 ml of 0.5 M EDTA, pH 8.0. Add dH2O to a final volume of 100 ml and filter-sterilize with the Stericup vacuum disposable filtration system, 0.22 μm. Store at 4
C. 10. Gradient solution B: 2.8 ml of 5 M NaCl, 1 ml of 1 M HEPES, pH 7.3, 200 μl of 0.5 M EDTA, pH 8.0. Add dH2O to a final volume of 100 ml and filter-sterilize the same way as for gradient solution A. Store at 4
C. 11. Gradient solution C: 5 volumes of iodixanol solution and 1 volume of gradient solution A (5:1). 4.5 ml of solution C is required for each OptiSeal tube. For gradient solution C, 10 ml iodixanol solution and 2 ml of gradient solution A is sufficient for two OptiSeal tubes.

HSV-1 Preparation

61

12. Gradient solution D: Mix virus solution with gradient solution B to obtain a total volume of 4.5 ml per OptiSeal tube. Purify up to 0.5 ml of virus solution per OptiSeal tube. 13. Gradient solution E or top-up solution: 1.27 ml gradient solution B (without virus) and 1 ml gradient solution C (see Note 1). 14. High precision scale. 15. 1 PBS. 16. 30 ml tubes (Nalgene Centrifuge Oak Ridge copolymer). 17. 1.5 ml tubes suitable for storage at 80
C. 2.6

Titration of Virus

2.6.1 Plaque Assay

1. Incubator. 2. 6-well plates. 3. Vero cells. 4. Cell culture medium. 5. Trypsin solution. 6. 1 PBS. 7. Pipette tips with filters for p20, p200, and p1000. 8. Sonicator. 9. Methylcellulose overlay: 1.5% methylcellulose in PBS. Add 1.5 g of methylcellulose to 100 ml PBS, pH 7.5 in a sterile bottle containing a stir bar. Autoclave the bottle on liquid cycle for 45 min. After the solution has cooled down, add 350 ml of cell culture medium. Mix well, place the bottle on a stir plate at 4
C overnight or until the methylcellulose has completely dissolved. 10. Staining solution: 1% crystal violet in a 50:50 (v/v) methanol–H2O solution. 11. 1.5 ml tubes.

2.6.2 End Point Dilution Assay

1. Incubator. 2. 96-well plates. 3. Vero cells. 4. Cell culture medium. 5. Serum-free cell culture medium. 6. Cell culture medium containing 2% FBS: Dulbecco’s Modified Eagle’s Medium (DMEM) high glucose, supplemented with 2% fetal bovine serum (FBS). 7. Trypsin solution. 8. 1 PBS. 9. Sonicator.

62

Sereina O. Sutter et al.

10. Pipette tips with filters for p20, p200, and p1000. 11. 1.5 ml tubes. 2.7 Growth Curve Assay

1. Incubator. 2. 6-well plates. 3. Vero cells. Or other cells of interest. 4. Cell culture medium. 5. Serum-free cell culture medium. 6. Trypsin solution. 7. 1 PBS. 8. Pipette tips with filters for p20, p200, and p1000. 9. Liquid N2. 10. Water bath.

3

Methods Pathogens that are classified as biosafety level 2 organisms, such as HSV, require good microbiological practice as well as sterile working conditions. The main safety hazards concerning herpes viruses are based on direct contact with virus isolates, such as exposure of mucous membranes (e.g., eyes, nose and mouth) to droplets, inhalation of concentrated aerosolized material, or accidental parenteral injection. Generally, any work that involves handling of the virus should be conducted in a biological safety hood with protective clothing (e.g., lab coat, gloves, and safety glasses). The use of needles, syringes, and other sharp objects should be strictly limited. All waste that contains or has come in contact with replicating HSV has to be decontaminated with 1% sodium hypochlorite (bleach) solution, which is the most effective disinfectant for HSV (see Note 2).

3.1 Cell Culture: Maintenance and Seeding

Most methods explained below require working with cell cultures. Always use biological safety hoods when working with cell cultures to avoid contamination. In this section we describe how to maintain and seed Vero cells. If other cells are used, conditions need to be adjusted. Contact the provider of the cell line for details on growth conditions. 1. Maintain Vero cells in a humid incubator at 37
C and 5% CO2. Propagate the culture twice a week by splitting ~1/5 in fresh medium (10 ml) into a new 75-cm2 tissue culture flask. 2. In order to split or seed the cells aspirate culture medium, wash each flask bottom with 5 ml 1 PBS, add 2 ml of trypsin solution, and incubate for 10 min at 37
C to allow cells to detach from the flask bottom. Resuspend cells in fresh culture medium.

HSV-1 Preparation

63

3. Count cells using a hemacytometer and plate the indicated number of cells into the appropriate tissue culture dish containing sufficient medium to cover the cell layer. Incubate cells at 37
C and 5% CO2 in a humid incubator. 3.2

Limiting Dilution

To guarantee the genomic homogeneity and the purity of the HSV stock, the initial inoculum has to derive from a single infectious particle isolated by a limiting dilution procedure. The main benefit of this procedure is the substantial reduction of contaminating particles that often occur in standard plaque isolation techniques, such as 2% methylcellulose or agarose overlay procedures. In order to obtain a pure virus stock, it is essential to go through at least three rounds of limiting dilution as follows: 1. It is recommended to sonicate the original virus stock for a few seconds in order to resuspend the virus particles, thereby preventing single plaques arising from two or more virus particles. 2. Detach the Vero cell monolayer with trypsin solution, count cells, and transfer 2  106 cells in a final volume of 2 ml serumfree cell culture medium to a 15 ml polypropylene centrifuge tube (see Subheading 3.1 for more detailed instructions). 3. Add 20–30 PFU of titered original virus stock to the cells. Rock the tube containing the cells and virus inoculum at 37
C for 1 h to allow the virus to adsorb to the cells. 4. Add 8 ml of cell culture medium containing 10% FBS to the 2 ml of the infected cells to reach a final volume of 10 ml, mix well. By using a 50 ml reagent reservoir and a multichannel pipette, dispense 100 μl into each well of a 96-well plate. 5. Incubate the plate in an incubator until plaques become visible (2–3 days). Plaques can be identified using a light microscope. First, infected cells become rounded up or fuse with neighboring cells leading to syncytia formation. At later stages infected cells will lyse leaving empty spots (plaques) in the monolayer. 6. Identify and mark the wells containing single plaques. Carefully inspect the edges of the wells under high magnification to ensure that no additional plaques are present. 7. Freeze the plate at 80
C and thaw at 37
C. Repeat the freeze-thaw cycle twice. 8. Using a p200 Pipetman, scrape the cells from the bottom of each well identified to contain a single plaque and pipet the entire content of the well into 1.5 ml Eppendorf tube; store at 80
C or proceed with the next step. 9. Repeat steps 1–8 two more times using 50 μl of the virus obtained from a single well (step 8) (second and third limiting dilutions).

64

Sereina O. Sutter et al.

10. After the final round of limiting dilution, the virus stock can be used to produce a midi stock in Subheading 3.3 from which a high-titer stock can then be prepared. 3.3 Preparation of Wild-Type HSV Midi Stocks

1. Seed 7  106 or 2  107 Vero cells in 10–20 ml of cell culture medium into a 75 cm2 or 175 cm2 tissue culture flasks, respectively and incubate overnight at 37
C in a humidified 95% air-5% CO2 incubator (see Subheading 3.1 for more detailed instructions). 2. On the next day, decant medium from the cells and add the virus (complete amount of virus after last round of limiting dilution from Subheading 3.2) in a sufficient quantity of serum-free cell culture medium to cover the monolayer. Incubate the cells for 1 h at 37
C to allow adsorption of the virus to the cells. Rock the flasks every 15 min in order to evenly distribute the inoculum. 3. Aspirate the virus inoculum and add cell culture medium with a final volume of 10–20 ml per flask. 4. Incubate the infected cells at 37
C in a humidified 95% air-5% CO2 incubator for 36–48 h until complete cytopathic effect (CPE) is reached. 5. Scrape cells with the cell scraper into the medium and pipet the suspension into 50 ml polypropylene centrifuge tubes. 6. Pellet at 1204  g for 15 min at 4
C. 7. Decant the supernatant into Oak Ridge polypropylene tubes. Centrifuge at 48,384  g for 30 min at 4
C to concentrate the virions released into the medium. Resuspend the virus pellets in a small volume of supernatant, combine in only one tube, and repellet. 8. Resuspend cell pellet (from step 6) in a small volume of supernatant, combine, and repellet as described in step 6. 9. Resuspend and combine virus and cell pellet in 2–3 ml of the same supernatant derived from the infected cells in a 15 ml polypropylene centrifuge tube. Store at 80
C or continue with the next step. 10. Freeze-thaw the cell pellet three times using liquid nitrogen and a water bath set to 37
C; vortex each time after thawing. After the final thawing, sonicate three times for 10–15 s with 10 s of incubation on ice after each sonication. The virus suspension should be homogeneous. 11. Centrifuge the suspension at 1734  g for 15 min at 4
C to pellet cell debris.

HSV-1 Preparation

65

12. Transfer the supernatant from step 11 into Oak Ridge polypropylene tube from step 7 and centrifuge for 30 min and 4
C at 48,384  g. 13. Decant and discard supernatant. Carefully remove remaining supernatant and resuspend pellet by vortexing or pipetting in 1 ml growth medium without serum, add glycerol to a final concentration of 10% for cryopreservation. Briefly spin the tube to remove bubbles. 14. Once a virus midi stock has been grown up from a plaquepurified isolate, store aliquots at 80
C and use as the only source of virus for generating working virus stocks (see Note 3). 15. Virus midi stocks should be titered. For titration two different protocols are provided (see Subheading 3.6). Both protocols should lead to a comparable result if the same stock is used. 3.4 Preparation of Wild-Type HSV Stocks

To produce a large master stock of wild-type HSV, ten 175-cm2 tissue culture flasks, each containing 2  107 permissive cells, are infected with an MOI of 0.01 PFU/cell using the midi stock from Subheading 3.3. The number of cells and the MOI can be adjusted depending on the virus strain. Virus particles are isolated from the supernatant and cell pellet as soon as the entire cell monolayer displays a CPE by rounding up and cells starting to detach from the flask. The use of fast dividing and permissive cells, as well as the ideal time point to harvest the virus, are important factors that affect the overall yield of infectious virus particles. The following protocol has been optimized to achieve maximal yields. 1. Seed 1  107 Vero cells in 20 ml of cell culture medium into each of the ten 150–175 cm2 tissue culture flasks and incubate overnight at 37
C in a humidified 95% air-5% CO2 incubator (see Subheading 3.1 for more detailed instructions). 2. On the next day, decant medium from the cells and add the virus (e.g., MOI of 0.01 PFU/cell) in an amount of serum-free cell culture medium sufficient to cover the monolayer. Incubate the cells for 1 h at 37
C to allow adsorption of the virus to the cells. Rock the flasks every 15 min in order to evenly distribute the inoculum. 3. Aspirate the virus inoculum and add cell culture medium to a final volume of 20 ml per flask. 4. Incubate the infected cells at 37
C in a humidified 95% air-5% CO2 incubator for 36–48 h until complete CPE is reached. 5. Scrape cells with the cell scraper into the medium and pipet the suspension into 50 ml polypropylene centrifuge tubes. 6. Pellet at 1204  g for 15 min at 4
C. 7. Decant the supernatant into Oak Ridge polypropylene tubes (the supernatant derived from ten 150–175 cm2 flasks fits into

66

Sereina O. Sutter et al.

six tubes). Centrifuge at 48,384  g for 30 min at 4
C to concentrate the virions released into the medium. Resuspend the virus pellets in a small volume of supernatant, combine in only one tube, and repellet. 8. Resuspend cell pellet (from step 6) in a small volume of supernatant, combine, and repellet as described in step 6. 9. Resuspend and combine virus and cell pellet in 2–3 ml of the same supernatant derived from the infected cells in a 15 ml polypropylene centrifuge tube. Store at 80
C or continue with the next step. 10. Freeze-thaw the cell pellet three times using liquid nitrogen and a water bath set to 37
C; vortex each time after thawing. After the final thawing, sonicate three times for 10–15 s with 10 s of incubation on ice after each sonication. The virus suspension should be homogeneous. 11. Centrifuge the suspension at 1734  g for 15 min at 4
C to pellet cell debris. 12. Transfer the supernatant from step 11 into 30-ml Oak Ridge polypropylene tube from step 7 and centrifuge for 30 min and 4
C at 48,384  g. 13. Decant and discard supernatant. Carefully remove remaining supernatant and resuspend pellet by vortexing or pipetting in 1 ml growth medium without serum, add glycerol to a final concentration of 10% for cryopreservation. Briefly spin the tube to remove bubbles. 14. Store aliquots at 80
C. For titration of master stocks see Subheading 3.6. Note that if the virus stock is used for animal experiments it must be gradient purified to remove cell debris. In this case do not add glycerol or freeze the virus, but proceed directly with the purification protocol in Subheading 3.5. 3.5 Purification of HSV Stocks

There are diverse protocols available to purify HSV-1 stocks from cell debris and proteins for preclinical experiments [2, 3]. These protocols are based on centrifugation [4], gradients [4], filtration [5], and affinity chromatography [6]. The following protocol describes the use of iodixanol gradients. 1. It is recommended to keep all gradient solutions on ice and to precool the ultracentrifuge rotor (see Note 1). 2. Prepare OptiSeal polyallomer centrifuge tubes and pipet 4.5 ml of gradient solution C into each tube. 3. Sonicate the virus stock to break up clumps before adding it into gradient solution B to obtain gradient solution D. Mix gradient solution D well before adding it into the tube containing gradient solution C (see Note 4).

HSV-1 Preparation

67

Fig. 1 Band containing the HSV-1 particles in an OptiPrep gradient

4. Slowly add 4.5 ml of gradient solution D into each tube. Be careful to avoid clogging of neck and bubble formation. If necessary, remove bubbles using a syringe. 5. Fill up the tubes with gradient solution E (approximately 1.5 ml per tube). 6. Leave a small air bubble in the neck of the tube and close it with the cap. 7. Balance tubes using a scale; if necessary, add solution E. 8. Dry the outside of the tubes if necessary and place them into the rotor. Place plugs and caps, and close tubes by using 120 in. lb torque value. 9. Place rotor into ultracentrifuge, close door, turn on vacuum, enter run specifications: speed 296,516  g 4–15 h, 4
C, maximum acceleration rate, no brake during deceleration. It takes a minimum of 4 h to obtain the separation but longer run times are recommended. As deceleration without brake takes at least 2 h, over-night centrifugation is convenient. During the run, check if centrifuge attained full speed. 10. At the end of the run, turn off vacuum, remove rotor and carefully put the tubes on ice. A band containing the virus will be visible in the middle of the gradient (Fig. 1). 11. Collect the band by puncturing the side of the tube 2–3 mm under the band with a needle and syringe. Be careful not to aspirate too much volume to avoid collecting debris.

68

Sereina O. Sutter et al.

12. Place the collected virus into 30 ml Nalgene Centrifuge Oak Ridge tubes and add cold PBS to fill up the tubes and to dilute the residual iodixanol solution within the collected virus solution (see Note 5). 13. Centrifuge the tubes at 48,384  g for 30 min and 4
C to concentrate the virus. 14. Discard supernatant and resuspend the pellet in approximately 1–2 ml of cold PBS. If resuspension is a problem, leave the tubes overnight on ice. 15. Carefully transfer the virus into a tube, which can be used for sonication. Sonicate to break up clumps (2–3 times, 5–10 s each time, with 10 s of incubation on ice between sonication steps). The virus suspension should be homogeneous. 16. Aliquot the virus in small volumes in 1.5 ml tubes to avoid repeated thawing and loss of infectivity. 17. Store the aliquots at 80
C. Virus stocks should be titered. For titration we provide two different protocols (Subheading 3.6). Both protocols should lead to a comparable result if the same stock is used. 3.6

Titration of Virus

3.6.1 Plaque Assay

Different protocols were established to titer virus stocks. Plaque forming viruses, such as the HSV-1, can be titered using the described assays (plaque assay and end point dilution assay). Here, the titer is determined by plaque forming units (PFU) per volume, indicating that the concentration of infectious particles is determined. Viruses, which do not induce cell lysis or plaque formation (e.g., adeno-associated virus or viral vectors) can be titered by determining genome containing particles (gcp) using qPCR or alkaline gels. Note that with the latter methods the concentration of viral genomes opposed to infectious entities is determined. 1. One day prior to titration, prepare 6-well tissue culture plates with 0.5  106 Vero cells per well. Note that on the day of titration the cell monolayer should be confluent (see Subheading 3.1 for more detailed instructions). 2. Thaw the virus on ice and sonicate it for a few seconds prior to infection in order to separate virus particles. 3. Prepare a series of tenfold dilutions (102 to 1010) of the virus stock in 1 ml cell culture medium without serum in 1.5 ml Eppendorf tubes. 4. Add 100 μl of each dilution per well. 5. Allow the virus to infect the cells for 1 h at 37
C in a humidified 95% air-5% CO2 incubator. Rock the plate every 15 min to distribute the inoculum to all cells in the monolayer.

HSV-1 Preparation

69

6. Aspirate the virus inoculum, and overlay the monolayer with 3 ml of methylcellulose overlay in cell culture medium (see Note 6). 7. Incubate the plates for 3–5 days until well-defined plaques are visible. 8. Aspirate the methylcellulose medium and stain for 10–20 min with 2 ml of crystal violet staining solution. The stain fixes the cells and the virus. 9. Aspirate the crystal violet staining solution, rinse gently with tap water to remove excess dye and then air dry. 10. Count the number of plaques per well, determine the average for each dilution (if it is in duplicate or triplicate), and multiply by 10 to the power of the dilution to obtain the number of plaque forming units per milliliter (PFU/ml) (see Note 7). 3.6.2 End Point Dilution Assay

1. One day prior to titration, prepare a 96-well tissue culture plate with 104 Vero cells per well (see Subheading 3.1 for more detailed instructions). 2. Thaw the virus on ice and sonicate it for a few seconds prior to infection in order to separate virus particles. 3. Prepare a series of tenfold dilutions (102 to 1010) of the virus stock in 1 ml cell culture medium without serum in 1.5 ml Eppendorf tubes. 4. Add 100 μl of each dilution per well (prepare 10 wells per dilution). 5. Allow the virus to infect the cells for 1 h at 37
C in a humidified 95% air-5% CO2 incubator. 6. Aspirate the virus inoculum and add 100 μl cell culture medium containing 2% FBS. 7. Incubate the plates for 3–4 days until well-defined plaques are visible. 8. Count the number of infected wells for each dilution (10 wells) and determine the ratio of infection as well as the proportion of infection. To define the 50% Tissue Culture Infection Dose (TCID50) use the calculation of Spearman-K€arber [7, 8] (see Note 8). To convert the TCID50 to PFU/ml multiply TCID50/ml by 0.69 (see Note 9).

3.7 Growth Curve Assay

Determining growth curves represents a suitable and sensitive method for analyzing HSV replication, as it defines virus yield as a function of time. Growth curve assays are widely used to investigate the impact of different parameters, such as cell number, multiplicities of infection, temperature, or antivirals, on virus replication [9].

70

Sereina O. Sutter et al.

1. Seed 6-well tissue culture plates with 0.5  106 cells per well in cell culture medium containing 10% FBS; use one plate for each cell line in order to evaluate the growth curves in different permissive cells. Incubate the plates overnight in a humidified 95% air-5% CO2 incubator at 37
C (see Subheading 3.1 for more detailed instructions). 2. The next day, aspirate the medium and infect the cell monolayer with a MOI of 2–5 PFU/cell, resuspended in 1 ml of cell culture medium without serum for 1 h at 37
C in a humidified 95% air-5% CO2 incubator (see Note 10). 3. After 1 h of adsorption, wash the cells with PBS in order to remove unbound virus particles and add 2 ml of cell culture medium containing 10% FBS and incubate at 37
C. 4. At 4, 8, 12, 18, and 24 h post infection (hpi), remove the plates from the incubator and scrape the cells into the medium. Transfer cells and the cell culture medium into a test tube and store at 80
C. 5. After all time points have been harvested, freeze-thaw the crude virus lysate three times, vortex after each cycle. 6. Determine the titers of the virus stocks from each time point as described in Subheading 3.6. Calculate the titer of the original virus suspension to get a t ¼ 0 h PFU/ml value. Store lysates at 80
C for retitration (see Note 11).

4

Notes 1. To prepare gradient solution D, sonicate the virus to break up clumps before adding it to gradient solution B. Use the virus obtained from no more than three T175 tissue culture flasks for each OptiSeal polyallomer centrifuge tube in order to prevent overloading the gradient. Gradient solution E is used to top up the tubes and to balance them. To prepare gradient solution E, gradient solutions B and C are mixed to give a final concentration of 22% of iodixanol. Prepare all solutions immediately before use. 2. 1% sodium hypochlorite: Just before use, dilute 1 volume of commercial bleach solution (with 6% sodium hypochlorite, e.g., Clorox) with 5 volumes of tap water. Ensure a 15 min contact time with sodium hypochlorite solution. Use this disinfectant for treatment of reusable equipment, surfaces, and liquid waste (final volume 1%). Disinfectant alternatives include phenolics, 2% glutaraldehyde, pantasept, and 70% ethanol. 3. Virus stocks should be maintained at a low passage number. Use one vial of a newly prepared stock for preparing all future stocks used in a series of experiments. In order to reduce the

HSV-1 Preparation

71

chance of acquiring undesired mutations during the propagation of viruses, stocks should be routinely prepared from single plaque isolates. Also avoid repeated freeze and thaw cycles of the virus stock. 4. Gradients should not be overloaded; for example, if the virus is resuspended in a final volume of 2 ml from the stock preparation prior to iodixanol purification, do not load more than 0.5 ml of virus per gradient. 5. The virus bands collected after gradient fractionation are diluted 2–4 times with cold PBS before centrifugation. The dilution with PBS is important to avoid the presence of a high percentage of residual iodixanol that could affect pellet formation leaving the virus particles in suspension. 6. Plaque assays in cell-culture monolayers under solid or semisolid overlays are commonly used for virus titration. The overlay prevents viral spread and ensures formation of localized plaques. A similar result can be achieved by overlaying the infected monolayer with medium containing 0.3% of human gamma globulin. 7. Calculation of titers. As an example if 100 μl of a 106 dilution yields 45 plaques, the titer of the virus is 45  107 PFU/ml or 4.5  108 PFU/ml. If 10 μl of a 106 dilution yields 30 plaques, the titer of the virus is 30  108 PFU/ml or 3  109 PFU/ml. 8. The log10 of the virus suspension containing 1 TCID50/0.1 ml is: L  d(s  0.5). L represents the log10 of the most concentrated virus dilution tested, d constitutes the log10 of the dilution factor and s defines the sum of the proportions. Example: Class limits

3

Ratio of infection

5/5 5/5 4/5 3/5 2/5 1/5 0/5 0/5

Proportion of infection 1

4

1

5

0.8

6

0.6

7

0.4

8

0.2

9

0

10

0

L ¼ 3 d¼1 s ¼ 1 + 1 + 0.8 + 0.6 + 0.4 + 0.2 + 0 + 0 ¼ 4 In this example, the log10 TCID50/ 0.1 ml ¼ 3  1  (4  0.5) ¼ 6.5. The virus titer corresponds to 106.5 TCID50/0.1 ml or 7.5 10 TCID50/ml. 9. The relationship between TCID50/ml and PFU/ml depends on the Poisson distribution.

72

Sereina O. Sutter et al.

10. All cells in a culture should become infected simultaneously so that only a single cycle of infection occurs. Synchronous infection can be achieved by using high MOIs. 11. At 4 hpi, virus titers should have dropped significantly because much of the input virus becomes uncoated during this time. Any virus titers detected at this time originates from virus particles that have not yet entered the cell. By 8 h of infection, the titer is nearly at the level of the original input virus due to de novo synthesis, and two- to fivefold higher than the original input by 18–24 h of infection. However, the values can change depending on the permissiveness of the cells. References 1. Beswick TSL (1962) The origin and the use of the word herpes. Med Hist 6:214–232 2. Segura MM, Kamen AA, Garnier A (2011) Overview of current scalable methods for purification of viral vectors. In: Merten O-W, Al-Rubeai M (eds) Viral vectors for gene therapy: methods and protocols. Humana, Totowa, NJ, pp 89–116 3. Mundle ST, Hernandez H, Hamberger J et al (2013) High-purity preparation of HSV-2 vaccine candidate ACAM529 is immunogenic and efficacious in vivo. PLoS One 8:e57224 4. Vahlne AG, Blomberg J (1974) Purification of herpes simplex virus. J Gen Virol 22:297–302 5. Knop DR, Harrell H (2008) Bioreactor production of recombinant herpes simplex virus vectors. Biotechnol Prog 23:715–721

6. Jiang C, Wechuck JB, Goins WF et al (2004) Immobilized cobalt affinity chromatography provides a novel, efficient method for herpes simplex virus type 1 gene vector purification. J Virol 78:8994–9006 7. K€arber G (1931) Beitrag zur kollektiven Behandlung pharmakologischer Reihenversuche. Naunyn-Schmiedebergs Arch Fu¨r Exp Pathol Pharmakol 162:480–483 8. Spearman C (1908) The method of “right and wrong cases” (constant stimuli) without Gauss’s formula. J Psychol 2:227–242 9. Ozuer A, Wechuck JB, Goins WF et al (2002) Effect of genetic background and culture conditions on the production of herpesvirus-based gene therapy vectors. Biotechnol Bioeng 77:658–692

Chapter 4 Engineering HSV-1 Vectors for Gene Therapy William F. Goins, Shaohua Huang, Bonnie Hall, Marco Marzulli, Justus B. Cohen, and Joseph C. Glorioso Abstract Virus vectors have been employed as gene transfer vehicles for various preclinical and clinical gene therapy applications and with the approval of Glybera (Alipogene tiparvovec) as the first gene therapy product as a standard medical treatment (Yla-Herttuala, Mol Ther 20:1831–1832, 2013), gene therapy has reached the status of being a part of standard patient care. Replication-competent herpes simplex virus (HSV) vectors that replicate specifically in actively dividing tumor cells have been used in Phase I–III human trials in patients with glioblastoma multiforme (GBM), a fatal form of brain cancer, and in malignant melanoma. In fact, Imlygic® (T-VEC, Talimogene laherparepvec, formerly known as OncoVex GM-CSF), displayed efficacy in a recent Phase-III trial when compared to standard GM-CSF treatment alone (Andtbacka et al., J Clin Oncol 31:sLBA9008, 2013), and has since become the first FDA-approved viral gene therapy product used in standard patient care (October 2015) (Pol et al., Oncoimmunology 5:e1115641, 2016). Moreover, increased efficacy was observed when Imlygic® was combined with checkpoint inhibitory antibodies as a frontline therapy for malignant melanoma (Ribas et al., Cell 170:1109–1119.e1110, 2017; Dummer et al., Cancer Immunol Immunother 66:683–695, 2017). In addition to the replicationcompetent oncolytic HSV vectors like T-VEC, replication-defective HSV vectors have been employed in Phase I–II human trials and have been explored as delivery vehicles for disorders such as pain, neuropathy and other neurodegenerative conditions. Research during the last decade on the development of HSV vectors has resulted in the engineering of recombinant vectors that are completely replication defective, nontoxic, and capable of long-term transgene expression in neurons. This chapter describes methods for the construction of recombinant genomic HSV vectors based on the HSV-1 replication-defective vector backbones, steps in their purification, and their small-scale production for use in cell culture experiments as well as preclinical animal studies. Key words Herpes simplex virus, Gene therapy, Gene transfer, Virus vectors, Virus purification, Virus production

1

Introduction HSV-1 (HHV-1) is one of the eight members of the human herpesvirus (HHV) family that also includes HSV-2 (HHV-2), varicella zoster virus (VZV or HHV-3), Epstein–Barr virus (EBV or HHV-4), human cytomegalovirus (HCMV of HHV-5), human herpesvirus 6 (HHV-6), human herpesvirus 7 (HHV-7), and

Russell J. Diefenbach and Cornel Fraefel (eds.), Herpes Simplex Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2060, https://doi.org/10.1007/978-1-4939-9814-2_4, © Springer Science+Business Media, LLC, part of Springer Nature 2020

73

74

William F. Goins et al.

Kaposi-sarcoma herpes virus (KSHV or HHV-8), all of which cause some form of human disease and are capable of long-term persistence within specific cells of the human host. Of the three neurotropic herpesviruses or alphaherpesviruses (HSV-1, HSV-2, and VZV), HSV-1 contains a 152-kb linear double-stranded DNA genome encoding approximately 85 gene products [1]. The HSV genome (Fig. 1a) is composed of two segments, the unique long (UL) and unique short (US) components, each of which is flanked by inverted repeats containing important viral regulatory genes and elements. With few exceptions, HSV genes are present as contiguous transcription units in a single copy, which makes their genetic manipulation relatively straightforward for the construction of recombinant vectors, with the exception of the genes that are present as two identical copies within the inverted repeats. The HSV particle (Fig. 1b) is composed of over 34 proteins with an icosahedral-shaped nucleocapsid composed of structural capsid proteins surrounded by a lipid envelope bilayer possessing virusencoded glycoproteins essential for attachment and penetration of

(A) HSV Genome VP16

Essential Accessory

ICP27

UL LAT ICP0

UL41

ICP4

LAT ICP22 ICP0

ICP4

US

ICP47

(B) HSV Particle Envelope Glycoproteins Viral dsDNA Genome Viral Capsid Tegument Proteins

Fig. 1 Organization of the HSV-1 genome and structure of the virion particle. (a) Schematic representation of the HSV-1 genome, showing the unique long (UL) and unique short (US) segments, each bounded by inverted repeat elements (boxes). The location of the VP16, ICP27, and ICP4 essential genes that are required for viral replication in vitro are indicated above the viral genome while the ICP0, LAT, UL41, ICP22 and ICP47 nonessential genes, which may be deleted without dramatically affecting replication in tissue culture, are depicted below the genome. (b) Electron microscopic depiction of the HSV virion showing the icosahedral-shaped nucleocapsid containing the 152 kb double-stranded viral genome; the tegument which contains VP16, UL41, and other HSV encoded gene products; and the envelope containing the virus-encoded glycoproteins that are responsible for the attachment and entry of the virus into receptor-bearing cells

HSV Vector Engineering

75

the virus into receptor-bearing cells. Between the capsid and the envelope exists an amorphous protein matrix known as the tegument that contains a number of structural proteins, foremost of which is VP16 [2] that acts in concert with cellular transcription factors Oct-1 and HCF to activate HSV immediate early (IE) gene promoters. Transcription of the IE transcriptional regulatory genes activates the remainder of the lytic life cycle cascade of gene expression that ultimately results in the production of progeny virus particles and lysis of the infected cell. In addition to VP16, the tegument also contains the UL41 (virion host shutoff, vhs) gene product involved in the shut off of host protein synthesis, thereby aiding the preferential translation of viral messages [3]. During natural infection in the human host or in animal models of virus infection, the virus initially replicates in epithelial cells of the skin or mucosa, usually resulting in lysis of these cells. Progeny virions from this initial infection attach to and enter into sensory nerve termini of the peripheral nervous system (PNS), and are carried via retrograde axonal transport to peripheral nerve cell nuclei where the viral DNA genome is injected through a modified capsid penton portal into the nucleus, after which two alternative forms of the viral life cycle may ensue. The virus may enter the lytic form of the replication cycle, in which expression of viral IE genes serves to transactivate expression of early (E) genes whose products are the principal components of the viral DNA replication machinery that ultimately leads to the production of concatemers of the viral genome. Following viral DNA synthesis, in conjunction with IE gene products, the late (L) genes that encode the structural proteins such as the capsid, tegument and viral glycoproteins present within the virion envelope are then transcribed. These late genes are required for viral particle assembly within the nucleus, the budding of the particle through a modified portion of the nuclear membrane, transport of that particle to the cell surface, and egress from the cells with release of fully infectious progeny virus particles. Alternatively, the virus may enter a latent state, in which the over 85 viral genes that are active during lytic infection are either not transcribed or are transcriptionally silenced over time by mechanisms that are not yet completely understood but are thought to involve genome methylation and histone binding and acetylation. The ability of the virus to enter either the lytic or latent stage of the virus life cycle holds true for replication-competent (oncolytic) and replication-defective vectors. However, replicationdefective vectors that have been rendered replication-deficient through the deletion of one or more essential HSV gene products, typically one or more transcription regulatory factors such as the IE gene products infected cell polypeptide (ICP) 4 and 27, directly enter a quiescent, “latent-like” state where the viral genome persists long-term with exclusive expression of the latency-associated

76

William F. Goins et al.

transcripts or LATs [4], the real hallmark of HSV latent infection of the nervous system. HSV possesses numerous biological features that make it attractive as a gene delivery vehicle for gene transfer to the nervous system and other tissues [5–7]. The virus possesses a broad host range and is able to infect both nondividing cells, such as neurons, and dividing cells at extremely high efficiencies [7–10]. The virus is capable of establishing a latent infection in neurons as part of its natural biology, a state in which viral genomes persist as intranuclear episomal elements that become transcriptionally silent over time. Completely replication-defective viruses can be constructed which retain the ability to establish a latent-like state in neurons, but which are unable to replicate or reactivate from this latent-like state; in contrast, wild-type virus may be reactivated from latency. These largely quiescent, defective genomes still retain the ability to express transgenes long-term using the HSV latency viral promoter system [11–13]. The large capacity of the viral genome (152 kb), and the fact that many viral genes can be removed as contiguous segments without dramatically affecting virus production, have enabled the incorporation of large [14] or multiple [15] transgenes, making it a preferred vector for expression of multiple gene products or gene libraries. Since HSV genes are expressed in a sequential, interdependent lytic cycle cascade [16], the simple removal of the essential IE gene ICP4 blocks expression of later downstream viral genes in the gene expression cascade [17], resulting in the production of a first-generation replication-defective vector that is incapable of producing virus particles. Since these first-generation vectors are toxic to some cells in culture [18] due to the expression of the remaining IE genes, second and third generation vectors deleted for combinations of these multiple IE genes were engineered that displayed reduced cytotoxicity compared to the first-generation vectors [19–21]. A third-generation vector deleted for the IE genes ICP4, ICP27 and ICP22 (TOZ.1) and containing an ICP0 promoter-lacZ expression cassette, exhibited reduced toxicity in neurons in culture [19]. Another thirdgeneration vector, vHG [22], is also less cytotoxic than first- and second-generation vectors. We have developed methods to systematically introduce foreign genes into the HSV-1 genome by homologous recombination [23], initially using the TOZ.1 vector backbone. This vector can only be propagated using ICP4/ICP27-complementing cells, such as our Vero cell-derived 7b cell line that has been engineered to avoid overlap of the complementing sequences with the deletions present within the virus in order to eliminate the chance of homologous recombination and rescue of the mutant viruses during propagation in the complementing line [24]. We have recently developed another ICP4/ICP27-complementing cell line (U2OS-ICP4/27) in the background of U2OS osteosarcoma

HSV Vector Engineering

77

cells that possess the unique ability to complement mutations/ deletions in the HSV IE ICP0 gene [25, 26], enabling this line to be used to complement the replication of highly defective HSV vectors deleted for the expression of all the regulatory IE gene products [25, 26]. Using homologous recombination between the TOZ.1 vector backbone and a plasmid containing an expression cassette for a gene of interest (GOI) within the UL41 gene sequence, we previously constructed a series of gene delivery vectors [19, 23]. More recently, we have employed the vHG backbone that contains the same deletions of ICP4 and ICP27 as TOZ.1 but is not deleted for ICP22 [22] (Fig. 2a) since we found that elimination of ICP22 resulted in a 1–2 log reduction in virus titers. Instead, vHG possesses deletions within the ICP22 and ICP47 IE gene promoters that result in these genes being expressed as early (E) rather than IE genes. Although vHG lacks the lacZ reporter gene cassette in the UL41 locus, it possesses an HCMV promoter driven eGFP reporter gene cassette within the ICP4 loci in place of the deleted coding sequences for ICP4 (Fig. 2a). Recombination of targeting plasmids such as pSASB3, that contains ICP4 flanking sequences for homologous recombination on either side of a multicloning site for insertion of a GOI between a promoter (e.g., HCMV, HSV LAP2 latency promoter, or the hybrid LAP2-HCMV promoter) and a bovine growth hormone (BGH) polyadenylation sequence (pA) (Fig. 2b), into the viral ICP4 loci results in the insertion of the GOI with the corresponding loss of the eGFP expression cassette, enabling the rapid identification of recombinants due to the loss of green fluorescent signal. However, we found that it was difficult to identify recombinants that produced clear plaques in the background of green-plaque producing parental virus. To further aid in the identification of recombinants, we have introduced an HCMVp-mCherry expression cassette into the UL41 locus of vHG (Fig. 2a), designated vHG-mCherry, that enables the easy identification of bright-red mCherry+/eGFP
plaques (Fig. 2c) on the background of fainter mCherry+/eGFP+ plaques produced by the parental virus. Moreover, inclusion of two fluorescent reporter cassettes within the virus allows for the recombination of genes into either or even both loci in circumstances that require the introduction of multiple genes into the vector. Following three rounds of limiting dilution analysis, the structure of the recombinants is then confirmed by Southern blot, PCR, or sequence analysis. We have also developed detailed methodologies for the production and purification of large-scale stocks of HSV vectors [27, 28]. We have recently applied Red-mediated recombineering [29] to a bacterial artificial chromosome (BAC) containing a complete HSV-1 genome [30] to rapidly engineer replication-defective [25, 26] and replication-competent [31] HSV vectors. Although the methods detailed in this chapter concentrate on the generation

78

William F. Goins et al. ICP47

ICP22

ICP27

UL41

(A) vHG-mCherry

ICP4

HCMV IEp

dsRed

SV40 pA

HCMV IEp

GFP

ICP4

BGH pA

BGH pA

GFP

HCMV IEp

(B) pSASB3-LAP2 or –HCMV or LAP2-HCMV ICP4 5’ flanking sequence

C) vH-Therapy Gene (C)

ICP4 3’ flanking sequence

Hi HindIII—LAP2– BamHI-SpeI-EcoRI-PstI-EcoRV-NotI-XhoI-SphI-XbaI-BGHpA-XbaI -HCMV-LAP2-HCMVICP22 ICP27 UL41 ICP47 ICP4

HCMV IEp

(D)

1) 2) 3) 4) 5) 6) 7) 8) 9)

dsRed

SV40 pA

HCMV Therapeutic BGH pA Gene IEp

ICP4

BGH Therapeutic HCMV pA Gene IEp

Obtain plasmid clone containing therapeutic gene of interest Subclone into ICP4 (pSASB3) or UL41 (p41) transfer plasmids Verify clones by restriction digestion and/or sequencing Prepare MaxiPrep of new plasmid construct Transfect transfer plasmid into 7b cells twice, then infect with vHG-mCherry virus Wait until CPE occurs, then harvest cells + supernatant Perform limiting dilution analysis of harvest Select mCherry+/GFP- (ICP4) or mCherry-/GFP+ (UL41) plaques Screen isolates for the presence of therapeutic gene (Southern, Western, ELISA, IHC)

Fig. 2 Construction and production of a replication-defective recombinant HSV-1 vector. (a) Replicationdefective HSV-1 vector vHG-mCherry is deleted (Δ) for ICP4 and ICP27, expresses ICP22 and ICP47 as Early genes (β-ICP22/β-ICP47), and contains an HCMV promoter-driven eGFP expression reporter gene cassette in the ICP4 loci and an HCMVp-driven mCherry reporter gene cassette within the UL41 locus. This parental virus vector produces both green and red plaques when plated on the complementing Vero-7b cells. (b) The GOI is cloned into the multicloning site (MCS) of a pSASB3 transfer plasmid downstream of a promoter (HCMV, LAP2, or hybrid LAP2-HCMV) and upstream of the BGH polyadenylation signal (pA). The pSASB3 plasmid possesses over 1 kb of ICP4 flanking sequences on either side of the promoter-MCS-pA segment to ensure homologous recombination into the ICP4 loci of vHG-mCherry. (c) Homologous recombination of the GOI within the pSASB3 transfer plasmid into the ICP4 loci of vHG-mCherry will result in a vector that shows an eGFP
/mCherry+ plaque phenotype compared to the eGFP+/mCherry+ plaque phenotype of the parental vHG-mCherry vector. (d) The various steps of the process of inserting your GOI into the vHG-mCherry vector by homologous recombination are detailed

and use of replication-defective HSV vectors, the same techniques can be applied to replication-competent vectors except that those do not require a complementing cell line for vector growth and propagation.

HSV Vector Engineering

2 2.1

79

Materials Cell Culture

1. DMEM/10% FBS: Dulbecco’s Eagle’s modified essential medium (DMEM) supplemented with nonessential amino acids, 100 U/mL penicillin G, 100 μg/mL streptomycin sulfate, 2 mM GlutaMAX, and 10% fetal bovine serum (FBS). Store at 4  C. 2. VP-SFM, virus-production Technologies).

serum-free

media

(Life

3. Methylcellulose overlay (1.0%): Add 25 g methylcellulose (Aldrich, Milwaukee, WI) to 100 mL phosphate-buffered saline (PBS) pH 7.5 in a 500 mL sterile bottle containing a stir bar. Autoclave the bottle on liquid cycle for at least 45 min. After the solution cools, add 350 mL of DMEM supplemented with nonessential amino acids, 100 U/mL penicillin G, 100 μg/mL streptomycin sulfate, and 2 mM GlutaMAX, mix well and place the bottle on a stir plate at 4  C overnight. Once the methylcellulose has entered solution, add 50 mL of FBS. Store at 4  C (see Note 1). 4. 1% crystal violet solution (in 50:50 ethanol–dH2O, v/v). Dissolve 1 g crystal violet in 50 mL dH2O and then add 50 mL of ethanol. Filter using a 0.22-μm filter and store at room temperature. 2.2

Cells

2.3 Buffers and Solutions

1. Vero cells (African green monkey kidney; ATCC #CCL81, Rockville, MD), or Vero-7b and U2OS-ICP4/27 cells that express both ICP4 and ICP27 [24–26] are required to propagate HSV-1 replication-competent or replication-defective viruses, respectively. 1. Tris-buffered saline (TBS) pH 7.5: 50 mM Tris–HCl pH 7.5, 150 mM NaCl, 1 mM ethylenediamine tetraacetic acid (EDTA). Store at room temperature. 2. PBS (1) pH 7.5: 135 mM NaCl, 2.5 mM KCl, 1.5 mM KH2PO4, 8.0 mM Na2HPO4 pH 7.5. Store at room temperature. 3. Glycerol. Store at room temperature. 4. 70% ethanol. Store at
20  C. 5. Lipofectamine 3000 (Life Technologies). Store at 4  C. 6. Opti-MEM (Life Technologies). Store at 4  C. 7. 5 M NaCl. Store at 4  C. 8. 100 mg/mL dextran sulfate MW9-20K. Store at 4  C.

80

2.4

William F. Goins et al.

Nucleic Acids

1. Transfer plasmid pSASB3 (Fig. 2b) for recombination into the ICP4 loci. Other transfer plasmids such as p41 can also be employed [19, 23] that will enable transfer of the expression cassette into the UL41 locus of the vector. 2. Plasmid containing gene of interest. 3. E1G6-mCherry (vHG-mCherry) virus (Fig. 2a).

2.5

Equipment

1. 6360-cm2 10-layer Cell Stack (Corning, Corning, NY). 2. 6-well, 12-well and 96-well flat-bottomed plates. 3. T-75 and T-150-cm2 flasks. 4. Cell scrapers. 5. 15- and 50-mL conical polypropylene tubes. 6. Cup-horn sonicator. 7. Nutator rocking platform. 8. Preparative and tabletop centrifuges. 9. CO2 incubator. 10. 50- and 500-mL polypropylene centrifuge bottle. 11. Multichannel pipettor. 12. Mini-Prep kit (Qiagen, Valencia, CA). 13. Parafilm. 14. 0.8-μm CN vacuum filter for small samples up to 100, 250, 500 or 1000 mL bottle filters (Nalgene-Thermo/Fisher, Pittsburgh, PA). 15. 1.5-mL cryovials.

3

Methods The protocols contained herein describe the methods necessary to construct and purify recombinant genomic HSV vectors. Although the chapter details the procedures for constructing and producing a replication-defective HSV vector, these same methods can be applied to replication-competent genomic HSV vectors like the oncolytic vectors employed in the glioblastoma multiforme (GBM) and malignant melanoma clinical trials [31–37]. The only major difference between the two is that the replication-defective vectors require the use of a cell line that expresses HSV gene products that are deleted from the genome of the replicationdefective vector to complement the missing essential genes. We have also provided methods for the production and purification of high-titer vector stocks once an isolate is identified and purified through three rounds of limiting dilution analysis.

HSV Vector Engineering

3.1 Construction of Recombinant Virus

81

In order to engineer the desired recombinant virus, the GOI to be inserted into the virus must first be cloned into the transfer plasmid (pSASB3 or p41) that contains at least 500–1000 bp of flanking HSV-1 sequences (Fig. 2b). In the example delineated in this chapter, we will employ the pSASB3 transfer plasmid that contains HSV flanking sequences that enable recombination of the gene expression cassette into the ICP4 gene loci of the vHG-mCherry vector (Fig. 2a) that will result in the loss of the GFP reporter with positive isolates screened for the eGFP
/mCherry+ phenotype. The addition of 500–1000 bp of flanking sequence is needed to achieve a high frequency of recombination between the plasmid and viral genome; flanking sequences as small as 100–200 bp will produce recombinants, but at a very reduced frequency. The basic pSASB3 and p41 plasmids each contain a unique BamHI restriction site for cloning of the expression cassette into the transfer plasmid. The expression cassette should consist of the cDNA of interest driven by a promoter of interest and followed by a polyadenylation signal. Alternatively, we have created versions of pSASB3 that possess the HCMV, LAP2, or LAP2-HCMV hybrid promoter, a multicloning site (MCS) for cDNA insertion, and a BGH polyA site (Fig. 2b). The p41 transfer plasmid contains HSV-1 flanking sequences for cDNA cassette recombination into the UL41 locus of vHG-mCherry, resulting in eGFP+/mCherry
recombinants, in a manner similar to recombination into the UL41 locus of the TOZ.1 vector that contained a lacZ reporter in UL41 rather than mCherry [19, 23]. Initial studies were performed with vHG, which lacks a second reporter gene cassette within the viral vector, so recombination of the target plasmid into the ICP4 loci resulted in the loss of the eGFP reporter and a clear plaque phenotype that was difficult to screen for in the background of nonrecombinant vHG plaques that appear bright green under fluorescence. Thus, in order to readily detect the recombinants containing the desired GOI, the parental virus backbone should possess two fluorescent reporter gene cassettes (eGFP, mCherry), one each at a desired site of recombination (e.g., ICP4 and UL41). Positive recombinants obtained from recombination of the GOI cassette in the pSASB3 transfer plasmid with the viral DNA will produce bright-red eGFP
/ mCherry+ plaques (Fig. 2c) compared to the fainter-red eGFP+/ mCherry+ plaque phenotype of the parental virus, enabling rapid identification. 1. Clone your cDNA expression cassette of interest into the pSASB3 shuttle plasmid at the BamHI site or your cDNA into one of the promoter-MCS-pA versions of pSASB3 (see Note 2). 2. One day prior to transfection, seed 5  105 7b or U2OSICP4/27 cells in a 6-well tissue culture plate in DMEM/10%

82

William F. Goins et al.

FBS. This will ensure that cells are nearly (80%) confluent the next day. 3. Transfect the cells with the plasmid DNA using Lipofectamine 3000 in Opti-MEM following the manufacturer’s instructions. It is important to linearize the plasmid construct before transfection to increase the recombination frequency compared to that obtained with uncut supercoiled plasmid. Digestion of the plasmid to release the insert, followed by purification of the restriction fragment does not increase the recombination frequency, but does eliminate the chance of insertion of plasmid vector sequences into the virus by semihomologous recombination with any complementary sequences such as promoters or polyadenylation sites. 4. After incubation steps, add fresh DMEM–10% FBS and incubate at 37  C. 5. At 24 h post transfection, repeat the plasmid transfection process, and incubate at 37  C. 6. At 24 h after the second plasmid transfection step, infect with the vHG-mCherry virus at a multiplicity of infection (MOI) of 1–3 virus PFU per cell in 1 mL serum-free DMEM for 60–90 min at 37  C. After the infection period, add 4 mL DMEM–5% FBS and reincubate at 37  C. 7. It usually takes 2–5 days for plaques to develop depending on the virus and the cell line. One can usually see some signs of CPE within 24–48 h post-infection, due to the presence of the fluorescent reporter gene that enables the identification of virus-infected cells. 8. Examine the plate under a fluorescence microscope to look for eGFP
/mCherry+ recombinants in the background of eGFP+/mCherry+ parental virus plaques (see Note 3). 9. Once plaques have formed, harvest media and cells using a cell scraper and transfer into a 15-mL conical tube. 10. Subject cells/media to three cycles of freezing and thawing, and sonicate the cells three times for 15 s each on setting 5 using a cup-horn sonicator. 11. Centrifuge at 2060  g for 5 min at 4  C to remove cell debris. 12. Store supernatant at
80  C for use as a stock (see Note 4). 3.1.1 Determine the Titer of the Stock of Recombinant Virus

1. Prepare a series of tenfold dilutions (10
2 to 10
10) of the virus stock in serum-free DMEM or VP-SFM media. 2. Add 100 μL of each dilution to a well of a 12-well tissue culture plate containing 4  105 Vero-7b or U2OS-ICP4/27 cells/ well (~80–90% confluent) (see Note 5).

HSV Vector Engineering

83

3. Incubate the plates at 37  C in a CO2 incubator for 1 h, then add 1 mL DMEM/10% FBS and place in the incubator overnight. 4. Within the next 24 h, remove the media and overlay the monolayer with 1 mL of 1% methycellulose/10% FBS solution to limit virus spread and produce readily visible plaques. 5. Incubate the plates for 3–5 days until well-defined plaques appear, depending on the virus and the cell line used. The presence of the fluorescent reporter gene within the virus readily accentuates the visualization of infectious centers and plaques. 6. Aspirate the methycellulose overlay, and stain with 1% crystal violet solution (in 50:50 ethanol:dH2O v/v) for 5 min. Remove stain, rinse with water and air dry. 7. Count plaques and calculate the number of plaque-forming units per 1 mL of original stock (see Note 6). 3.1.2 Limiting Dilution Analysis to Isolate and Purify Recombinants

1. Add ~30 PFU of titered original stock virus to 1 mL containing 2  106 Vero-7b (or U2OS-ICP4/27) cells in suspension (DMEM/10% FBS) in a 15-mL conical tube and place the tube on a Nutator rocker platform at 37  C for 1.5 h. Cover the cap with Parafilm to prevent leaking and contamination. 2. Add 9 mL of fresh DMEM/10% FBS media, mix and plate 100 μL in each well of a 96-well flat-bottomed tissue culture plate using a multichannel pipettor. 3. Incubate the plates at 37  C in a CO2 incubator for a period of 3–5 days until plaques appear, depending on the virus and cell line employed. Again, the presence of the fluorescent reporter facilitates this step. Score the wells for the number of plaques. Theoretically, there should be approximately 30 individual plaque wells/plate. Most wells should lack plaques, while some may have two or more plaques. 4. If recombination between the transgene cassette with the ICP4 (or UL41, depending on the transfer plasmid employed) flanking sequences and the virus has occurred, the GOI will have replaced the eGFP (or mCherry) reporter gene. When inserting genes into the ICP4 loci, the corresponding positive recombinants should produce the eGFP
/mCherry+ plaque phenotype, while the parental vHG-mCherry virus will show an eGFP+/mCherry+ plaque phenotype. 5. Wrap the plate with Parafilm and store at
80  C for use as a stock for the next round of limiting dilution. Alternatively, one can just store the cells and media from wells displaying the eGFP
/mCherry+ plaque phenotype. 6. Score wells that have eGFP
/mCherry+ plaques.

84

William F. Goins et al.

7. Select a well containing only eGFP
/mCherry+ plaques, as these were formed from virus recombinants in which the GOI has replaced eGFP (or mCherry if using the p41 transfer plasmid) in vHG-mCherry. 8. Carry out at least two additional rounds of limiting dilution/ plaque isolation using the stock of virus stored at
80  C, as in steps 1–5 above. At the final round of limiting dilution, all the plaques identified on the plate should show the desired plaque phenotype (i.e., red but not green plaques for insertion of genes into the ICP4 loci of vHG-mCherry). At this point, the virus stock can be used to produce a midi stock for the eventual preparation of a high-titer stock for general experimental use. At the same time this stock can be used to produce viral DNA to confirm the presence of the insert as well as the absence of the deleted sequences by Southern blot, PCR analyses and/or sequencing. 3.2 Virus Stock Preparation and Purification

The following procedure entails the preparation of a virus stock from one 10-layer cell stack factory that equates to an area of 6360 cm2 but can be scaled up or down depending on specific needs. We have employed a salt-release treatment step in our production runs as this increases the overall yield of virus in the supernatant fraction 2 to tenfold [27, 28]. In addition, we have now incorporated the addition of dextran sulfate treatment along with the salt-release step to increase our yield (20–200) based on the production of an HSV-2-based vaccine vector [38]. Our new purification protocol (Fig. 3a) calls for the use of filtration steps can that be employed to separate the virus from cellular debris in combination with a centrifugation step to concentrate the filtrate. The ultimate goal is to purify virus particles away from cellular and extracellular debris which was a problem using our older purification procedure (Fig. 3b, c). The purity achieved by this new methodology is demonstrated in electron micrographs (EM) of purified virus preparations where the traditional Dextran T-10 or OptiPrep/Iodixanol gradient centrifugation protocols yielded high levels of membrane-containing contaminants (Fig. 3b, c), while the biofiltration produced clean stocks consisting of almost exclusively membraned HSV particles (Fig. 3d). In order to further verify stock purity, we performed Western blot analysis of the new filtration HSV virus stock preparations compared to traditional OptiPrep purified virus stocks (Fig. 4). Additional downstream purification steps may be added to further eliminate contaminating cellular DNA and protein such as treatment with benzonase in combination with other ultrafiltration steps. 1. Seed one 10-layer cell stack with 1.4  108 7b or U2OSICP4/27 cells in 1400 mL DMEM/5% FBS and incubate at 37  C in a CO2 incubator.

HSV Vector Engineering

85

Dextran sulfate Low-speed centrifugation

High-speed centrifugation

Low-speed centrifugation

High-speed centrifugation

Vial in 5-200 µL aliquots, store to -80°C, titer

(C) OptiPrep Gradient Purified HSV

Fig. 3 Comparison of the HSV vector production and purification procedures. (a) The previous methods to obtain purified HSV vectors employed a series of centrifugation steps, culminating with an OptiPrep/Iodixanol or Dextran T10 gradient step. We found that the integrity of the viral membrane was dramatically damaged by multiple centrifugation steps that are frequently used to purify nonenveloped viral vectors such as AAV and Adenovirus. In addition, density gradient centrifugation of the virus failed to sufficiently separate the viral particles away from small cellular membrane vesicles, resulting in high levels of cellular contaminants within the purified vector preparations. Thus, we developed a new strategy (a) for virus production and purification. This new methodology employs salt and dextran sulfate treatment to achieve greater release of virus particles from cellular membranes of infected cells and utilizes filtration methods for virus separation from cellular debris. Our ultrafiltration methodology yielded virus of high purity by EM (d) compared to (b) Dextran T10 or (c) OptiPrep density ultracentrifugation

2. Allow cells to become 80–100% confluent. If over confluent, lower overall virus yield will be achieved. 3. Infect cells in a small volume using very low MOIs, usually 0.001–0.005 depending on the cell type and virus. For a 10-layer of 7b cells, infect with virus in a total volume of 300 mL of serum-free VP-SFM media. Make sure that equal amounts of the inoculum spreads to each layer of the 10-layer cell stack (see Note 7). 4. Infection should proceed at 37  C for 60–90 min, with rocking of the cell-stack every 15 min to ensure that the inoculum covers the monolayer.

86

William F. Goins et al.

OptiPrep OptiPrep

Fig. 4 Western blot analyses of ultrafiltration compared to ultracentrifugation purification methodologies. To assess whether our purification methods were capable of removing exosomes from the virus stocks, we performed Western blot analyses with antibodies to CD81 and TSG101, two standard exosome markers, on virus isolated from Vero-7b cells by the old OptiPrep method compared to virus isolated from Vero-7b or U2OS-ICP4/27 cells by our current filtration method. The results show that the OptiPrep-prepared virus contained high levels of exosomal marker contaminants. This probably equates to the fact that the EM from the OptiPrep virus showed more exosome-like microvesicles than actual HSV particles

5. After the 90-min period, add 300–500 mL fresh VP-SFM media. For a 10-layer cell stack of 7b cells we use a final total volume of 800 mL (see Note 8). 6. Reincubate the 10-layer cell stack at 37  C overnight. 7. After 24 h, switch the 10-layer cell stack to 33  C (see Note 9). 8. Observe the flask daily for the presence of CPE. If virus contains a fluorescent marker, it is easy to follow the infection. 9. Harvest once most cells show CPE (90–100%), have rounded up, and are no longer adherent to the plastic, depending on cell type. 10. Add 5 M NaCl to make the overall concentration 0.45 M and add dextran sulfate solution to a final concentration of 100 μg/ mL; and reincubate overnight at 33  C. 11. The following morning, switch from 33  C to RT and place the cell factory onto a shaking platform for a minimum of 60–90 min or longer. At this point all cells should have detached from the monolayer. 12. Spin down cells and debris by low-speed centrifugation 1565  g – 2348  g at 4  C for 5–10 min in a refrigerated tabletop centrifuge in 50-mL conical polypropylene tubes.

HSV Vector Engineering

87

13. Remove supernatant and filter through a 0.8-μm CN vacuum filter (see Note 10). 14. Pellet the virus from the supernatant using a high-speed spin (41,657  g – 47,850  g) for 45 min at 4  C in a refrigerated, preparative centrifuge in 50- or 500-mL polypropylene centrifuge tubes/bottles. A visible white pellet should be present in each tube/bottle after pelleting the virus. 15. Wash 1 with 1PBS to eliminate any residual salt. 16. Resuspend the virus in as small a volume of 1PBS as possible and leave the tube/bottle at an angle overnight at 4  C so that the volume of liquid covers the visible virus pellet (see Note 11). 17. Once the pellet is resuspended, chunks or particulates should no longer be visible. Add glycerol (0.22-μm filtered) to 10% of total volume, mix, aliquot into 1.5-mL cryovials and store at
80  C. We usually aliquot in at least two different volume sizes; for example, 5 or 10 μL and a larger size like 50 or 100 μL (see Note 12). 18. Select at least one cryovial from the
80  C virus stock to titer according to the virus titration protocol (see Subheading 3.1.1). We routinely select one vial from the beginning, middle and end of all the vials of newly made stock. We also confirm the presence of the GOI by Southern blot, PCR or sequencing of the insert in the purified virus stock. In addition, we confirm expression of the GOI using Western blot, ELISA, IHC or other applicable assay.

4

Notes 1. Stir methylcellulose overlay media before each use as methylcellulose tends to settle at bottom of bottle. 2. The transfer plasmid DNA can be prepared by a variety of methods. Large-scale plasmid preparations are not necessary as plasmid DNA prepared using Mini-Prep kits such as the Qiagen Mini-kit (Qiagen, Valencia, CA) is of sufficient purity to deliver high transduction efficiencies. 3. When examining plates under the fluorescence microscope using a filter for red fluorescence, the eGFP
/mCherry+ plaques will show a brighter red signal than those from the parental eGFP+/mCherry+ virus. 4. It is not necessary to add glycerol up to 10% to the virus supernatant as the media contains 5% FBS and the proteins in the media act as a cryoprotectant.

88

William F. Goins et al.

5. In order to obtain a more accurate titer, the titration should be performed in duplicate or triplicate. 6. In calculating the average PFU/mL of the recombinant virus stock, it is important to multiply the average number of plaques counted at a specific dilution by the dilution factor. Since in this example, 100 μL of each dilution of virus stock was plated, the dilution factor for the calculation is 10. The overall titer in PFU/mL ¼ the average number of plaques  the dilution factor to the power of the dilution wells counted. 7. It is important to employ low MOIs to generate the virus stock, as high MOIs result in the introduction of unwanted mutations throughout the viral genome. 8. It is crucial to keep the total volume as low as possible as this determines the overall amount of fluid that one must process during purification steps. Also, it is equally crucial to use a sufficient volume to ensure coverage of the entire monolayer of cells on each layer of the 10-layer cell stack. 9. It is critical to switch the infected cells from 37 to 33  C as we have shown that the virus is more stable at 33  C versus 37  C, and cell growth is more limited at 33  C, helping to produce virus at a greater yield per cell. 10. If one employs 0.45-μm filters, one loses a reasonable percentage of the virus yield and one also gets shearing of virus envelopes. The 0.65-μm size is most ideal for virus separation, but syringe and filter flasks of the 0.65-μm pore size are not commercially available so we employ the 0.8-μm filters. Importantly, using media with serum in it for the infection will readily cause the filters to clog, so we use media without serum (VP-SFM) once we begin the infection process, even for viruses that grow poorly. Otherwise you will go through a considerable number of filters during purification. 11. It is important to thoroughly resuspend the pellet in order to get an even suspension of particles, but vortexing is not good as it can damage the particles and render them noninfectious. 12. If virus does not resuspend in the volume of PBS added, consider adding additional sterile PBS until the pellet has resuspended completely.

Acknowledgments This work was supported by NIH grant P01 DK044935 (Glorioso)-Viral Vector Core B (Goins) and P01 CA163205 (Caliguri/Chiocca)-Viral Vector Core B (Goins). We also thank Drs. Krisky, Wolfe, Wechuck, Ozuer, and Kopp for their contributions to HSV vector production and purification methodologies.

HSV Vector Engineering

89

References 1. Roizman B, Knipe DM (2001) Herpes simplex viruses and their replication. In: Knipe DM, Howley PM (eds) Fields virology, 4th edn. Lippincott Williams and Wilkins, Philadelphia, PA, pp 2399–2459 2. Mackem S, Roizman B (1982) Structural features of the herpes simplex virus alpha gene 4, 0, and 27 promoter-regulatory sequences which confer alpha regulation on chimeric thymidine kinase. J Virol 44:939–949 3. Oroskar A, Read G (1989) Control of mRNA stability by the virion host shutoff function of herpes simplex virus. J Virol 63:1897–1906 4. Stevens JG (1989) Human herpesviruses: a consideration of the latent state. Microbiol Rev 53:318–332 5. Burton EA, Wechuck JB, Wendell SK, Goins WF, Fink DJ, Glorioso JC (2001) Multiple applications for replication-defective herpes simplex virus vectors. Stem Cells 19:358–377 6. Goins WF, Wolfe D, Krisky DM, Bai Q, Burton EA, Fink DJ, Glorioso JC (2004) Delivery using herpes simplex virus: an overview. Methods Mol Biol 246:257–299 7. Wolfe D, Goins WF, Yamada M, Moriuchi S, Krisky DM, Oligino TJ, Marconi PC, Fink DJ, Glorioso JC (1999) Engineering herpes simplex virus vectors for CNS applications. Exp Neurol 159:34–46 8. Glorioso J, Goins W, Meaney C, Fink D, DeLuca N (1994) Gene transfer to brain using herpes simplex virus vectors. Ann Neurol 35:S28–S34 9. Haarr L, Shukla D, Rodahl E, Dal Canto M, Spear P (2001) Transcription from the gene encoding the herpesvirus entry receptor nectin-1 (HveC) in nervous tissue of adult mouse. Virology 287:301–309 10. Mata M, Zhang M, Hu X, Fink D (2001) HveC (nectin-1) is expressed at high levels in sensory neurons, but not in motor neurons of the rat peripheral nervous system. J Neurovirol 7:1–5 11. Goins WF, Lee KA, Cavalcoli JD, O’Malley ME, DeKosky ST, Fink DJ, Glorioso JC (1999) Herpes simplex virus type 1 vectormediated expression of nerve growth factor protects dorsal root ganglia neurons from peroxide toxicity. J Virol 73:519–532 12. Goins WF, Sternberg LR, Croen KD, Krause PR, Hendricks RL, Fink DJ, Straus SE, Levine M, Glorioso JC (1994) A novel latency-active promoter is contained within the herpes simplex virus type 1 UL flanking repeats. J Virol 68:2239–2252

13. Goins WF, Yoshimura N, Ozawa H, Yokoyama T, Phelan M, Bennet N, deGroat WC, Glorioso JC, Chancellor MB (2000) Herpes simplex virus vector-mediated nerve growth factor expression in bladder and afferent neurons: potential treatment for diabetic bladder dysfunction. J Urol 165:1748–1754 14. Akkaraju GR, Huard J, Hoffman EP, Goins WF, Pruchnic R, Watkins SC, Cohen JB, Glorioso JC (1999) Herpes simplex virus vectormediated dystrophin gene transfer and expression in MDX mouse skeletal muscle. J Gene Med 1:280–289 15. Krisky DM, Marconi PC, Oligino TJ, Rouse RJ, Fink DJ, Cohen JB, Watkins SC, Glorioso JC (1998a) Development of herpes simplex virus replication-defective multigene vectors for combination gene therapy applications. Gene Ther 5:1517–1530 16. Honess R, Roizman B (1974) Regulation of herpes simplex virus macromolecular synthesis. I. Cascade regulation of the synthesis of three groups of viral proteins. J Virol 14:8–19 17. DeLuca NA, McCarthy AM, Schaffer PA (1985) Isolation and characterization of deletion mutants of herpes simplex virus type 1 in the gene encoding immediate-early regulatory protein ICP4. J Virol 56:558–570 18. Johnson P, Miyanohara A, Levine F, Cahill T, Friedmann T (1992) Cytotoxicity of a replication-defective mutant herpes simplex virus type 1. J Virol 66:2952–2965 19. Krisky DM, Wolfe D, Goins WF, Marconi PC, Ramakrishnan R, Mata M, Rouse RJ, Fink DJ, Glorioso JC (1998b) Deletion of multiple immediate-early genes from herpes simplex virus reduces cytotoxicity and permits longterm gene expression in neurons. Gene Ther 5:1593–1603 20. Samaniego L, Webb A, DeLuca N (1995) Functional interaction between herpes simplex virus immediate-early proteins during infection: gene expression as a consequence of ICP27 and different domains of ICP4. J Virol 69:5705–5715 21. Wu N, Watkins SC, Schaffer PA, DeLuca NA (1996) Prolonged gene expression and cell survival after infection by a herpes simplex virus mutant defective in the immediate-early genes encoding ICP4, ICP27, and ICP22. J Virol 70:6358–6368 22. Srinivasan R, Huang S, Chaudhry S, Sculptoreanu A, Krisky D, Cascio M, Friedman PA, de Groat WC, Wolfe D, Glorioso JC (2007) An HSV vector system for selection of

90

William F. Goins et al.

ligand-gated ion channel modulators. Nat Methods 4:733–739 23. Krisky D, Marconi P, Oligino T, Rouse R, Fink D, Glorioso J (1997) Rapid method for construction of recombinant HSV gene transfer vectors. Gene Ther 4:1120–1125 24. Marconi P, Krisky D, Oligino T, Poliani PL, Ramakrishnan R, Goins WF, Fink DJ, Glorioso JC (1996) Replication-defective HSV vectors for gene transfer in vivo. Proc Natl Acad Sci U S A 93:11319–11320 25. Miyagawa Y, Marino P, Verlengia G, Uchida H, Goins WF, Yokota S, Geller DA, Yoshida O, Mester J, Cohen JB, Glorioso JC (2015) Herpes simplex viral-vector design for efficient transduction of nonneuronal cells without cytotoxicity. Proc Natl Acad Sci U S A 112: E1632–E1641 26. Miyagawa Y, Verlengia G, Reinhart B, Han F, Uchida H, Zucchini S, Goins WF, Simonato M, Cohen JB, Glorioso JC (2017) Deletion of the virion host shut-off gene enhances neuronal-selective transgene expression from an HSV vector lacking functional IE genes. Mol Ther Methods Clin Dev 6:79–90 27. Ozuer A, Wechuck JB, Goins WF, Wolfe D, Glorioso JC, Ataai MM (2002) Effects of genetic background and culture conditions on production of herpesvirus-based gene therapy vectors. Biotechnol Bioeng 77:685–692 28. Wechuck JB, Ozuer A, Goins WF, Wolfe D, Oligino T, Glorioso JC, Ataai MM (2002) Effect of temperature, composition, and cell passage on production of herpes-based viral vectors. Biotechnol Bioeng 79:112–119 29. Tischer BK, von Einem J, Kaufer B, Osterrieder N (2006) Two-step red-mediated recombination for versatile high-efficiency markerless DNA manipulation in Escherichia coli. BioTechniques 40:191–197 30. Gierasch WW, Zimmerman DL, Ward SL, Vanheyningen TK, Romine JD, Leib DA (2006) Construction and characterization of bacterial artificial chromosomes containing HSV-1 strains 17 and KOS. J Virol Methods 135:197–206 31. Mazzacurati L, Marzulli M, Reinhart B, Miyagawa Y, Uchida H, Goins WF, Li A, Kaur B, Caligiuri M, Cripe T, Chiocca N, Amankulor N, Cohen JB, Glorioso JC, Grandi

P (2015) Use of miRNA response sequences to block off-target replication and increase the safety of an unattenuated, glioblastomatargeted oncolytic HSV. Mol Ther 23:99–107 32. Andtbacka RHI, Collichio FA, Amatruda T, Senzer NN, Chesney J, Delman KA, Spitler LE, Puzanov I, Doleman S, Ye Y, Vanderwalde AM, Coffin R, Kaufman H (2013) OPTiM: a randomized phase III trial of talimogene laherparevec (T-VEC) versus subcutaneous (SC) granulocyte-macrophage colony-stimulatory factor (GM-CSF) for the treatment (tx) of unresectable stage IIIB/C or IV melanoma. J Clin Oncol 31:sLBA9008 33. Pol J, Kroemer G, Galluzzi L (2016) First oncolytic virus approved for melanoma immunotherapy. Oncoimmunology 5:e1115641 34. Ribas A, Dummer R, Puzanov I, VanderWalde A, Andtbacka RHI, Michielin O, Olszanski AJ, Malvehy J, Cebon J, Fernandez E et al (2017) Oncolytic virotherapy promotes intratumoral T cell infiltration and improves anti-PD-1 immunotherapy. Cell 170:1109–1119.e1110 35. Dummer R, Hoeller C, Gruter IP, Michielin O (2017) Combining talimogene laherparepvec with immunotherapies in melanoma and other solid tumors. Cancer Immunol Immunother 66:683–695 36. Markert J, Medlock M, Rabkin S, Gillespie G, Todo T, Hunter W, Palmer C, Feigenbaum F, Tornatore C, Tufaro F, Martuza R (2000) Conditionally replicating herpes simplex virus mutant, G207 for the treatment of malignant glioma: results of a phase I trial. Gene Ther 7:867–874 37. Rampling R, Cruickshank G, Papanastassiou V, Nicoll J, Hadley D, Brennan D, Petty R, MacLean A, Harland J, McKie E, Mabbs R, Brown M (2000) Toxicity evaluation of replication-competent herpes simplex virus (ICP 34.5 null mutant 1716) in patients with recurrent malignant glioma. Gene Ther 7:859–866 38. Mundle S, Hernandez H, Hamberger J, Catalan J, Zhou C, Stegalkina S, Tiffany A, Kleanthous H, Delagrave S, Anderson S (2013) High-purity preparation of HSV-2 vaccine candidate ACAM529 is immunogenic and efficacious in vivo. PLoS One 8:e57224

Chapter 5 Preparation of Herpes Simplex Virus Type 1 (HSV-1)-Based Amplicon Vectors Cornel Fraefel and Alberto L. Epstein Abstract Amplicon vectors, or amplicons, are defective, helper-dependent, herpes simplex virus type 1 (HSV-1)based vectors. The main interest of amplicons as gene transfer tools stems from the fact that the genomes of these vectors do not carry protein-encoding viral sequences. Consequently, they are completely safe for the host and nontoxic for the infected cells. Moreover, the complete absence of virus genes provides a genomic space authorizing a very large payload, enough to accommodate foreign DNA sequences up to almost 150-kbp, the size of the HSV-1 genome. This transgene capacity can be used to deliver complete gene loci, including introns and exons, as well as long regulatory sequences conferring tissue-specific expression or stable maintenance of the transgene in proliferating cells. For many years the development of these vectors and their application in gene transfer experiments was hindered by the presence of contaminating toxic helper virus particles in the vector stocks. In recent years, however, two different methodologies have been developed that allow generating amplicon stocks either completely free of helper particles or only faintly contaminated with fully defective helper particles. This chapter describes these two methodologies. Key words HSV-1, Amplicon vectors, Gene transfer

1

Introduction

1.1 Amplicon Plasmids and Amplicon Vectors

As described in Chapter 1 of this book, herpes simplex virus type 1 (HSV-1) possesses a large, approximately 153-kbp, doublestranded DNA genome. This implies that the virus particle is able to accommodate and deliver large DNA fragments, either native virus DNA or foreign DNA, to the nucleus of infected cells. However, among the different types of gene transfer vectors that can be derived from HSV-1, only amplicons are able to fully exploit the outstanding cargo capacity of the HSV-1 virion. Amplicon vectors, or amplicons [1], are identical to wild type HSV-1 particles from the structural, immunological and host-range points of view, but which carry a concatemeric form of a DNA plasmid, named the amplicon plasmid, instead of the viral genome. An amplicon plasmid (Fig. 1a) is a standard E. coli plasmid carrying

Russell J. Diefenbach and Cornel Fraefel (eds.), Herpes Simplex Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2060, https://doi.org/10.1007/978-1-4939-9814-2_5, © Springer Science+Business Media, LLC, part of Springer Nature 2020

91

92

Cornel Fraefel and Alberto L. Epstein

one origin of DNA replication (generally oriS) and one packaging signal (pac) from HSV-1 [2, 3], in addition to the transgene sequences of interest. The amplicon plasmid carries no genes encoding virus trans-acting proteins. The most outstanding feature of amplicons as gene transfer tools is that these vectors can exploit the large empty space left available by the absence of virus genes to accommodate and deliver up to 150-kbp of foreign DNA to the nucleus of infected cells. In addition, as amplicons do not induce synthesis of virus proteins, these vectors are nontoxic for the infected cells and nonpathogenic for the inoculated organism. Lastly, the absence of virus genes in the amplicon genome strongly reduces the risk of reactivation, complementation, or recombination with latent or resident HSV-1 genomes. Amplicons are versatile vector platforms for gene delivery. The versatility of amplicons stems from the fact that during their production the amplicon genome will replicate, like the HSV-1 genome, via a rolling circle-like mechanism, generating long concatemers composed of tandem repeats of the amplicon plasmid [4] (Fig. 1b). Since HSV-1 particles will always package approximately 150-kbp of DNA, the size of the virus genome, the number of repeats that a particular amplicon vector will carry and deliver, depends on the size of the original amplicon plasmid [5]. Therefore, an amplicon plasmid of around 5-kbp will be repeated some 30 times in the amplicon vector, while a very large amplicon plasmid, carrying a 150-kbp genomic locus, will generate amplicon vectors carrying a single repeat of this sequence. A

B Bacterial ori

Amplicon plasmid

Amplicon plasmid

MCS

Reporter gene

pac

oriS

Antibiotic resistance gene

Fig. 1 Structure of the amplicon plasmid and amplicon vector. (a) An amplicon plasmid is a standard Escherichia coli plasmid, containing one bacterial origin of replication (ori) and one gene conferring resistance to an antibiotic (generally ampR), and carrying, in addition, one HSV-1 origin of DNA replication (oriS), one HSV-1 packaging signal (pac), usually a reporter gene (represented as a green arrow) and a multiple cloning site (MCS) for insertion of the transgene of interest. (b) An amplicon vector is an HSV-1 virus particle containing a concatemer of the amplicon plasmid DNA of up to around 150-kbp as the genome

HSV-1-Based Amplicon Vectors

93

Since HSV-1-amplicon vectors carry no viral genes, they are replication-defective and depend on helper functions for production. The helper genome should provide all virus functions required to replicate and package the amplicon genome (including replication, structural, and DNA packaging proteins), but should lack packaging signals to avoid packaging of the helper genome itself. It is critical that amplicon stocks used for gene transfer and gene therapy do not contain contaminating helper virus particles in order to avoid cytotoxicity and induction of immune responses. For many years it was not possible to generate such helper virus-free amplicon vector stocks, two different methodologies have been developed over the past two decades that allow generating amplicon stocks, either completely free of helper particles or only faintly contaminated with fully defective helper particles. One of these methods is based on the cotransfection of the amplicon plasmid and helper DNA genome, while the second method is based on the transfection of the amplicon plasmid followed by super-infection of the transfected cells with a defective HSV-1 helper virus (Fig. 2). This chapter will describe in detail these two methods to produce amplicon vector stocks. 1.2 Production of Amplicon Vectors by DNA Cotransfection Procedure

Helper functions can be provided by replication-competent, but packaging-defective HSV-1 genomes cloned as a set of cosmids [6] or bacterial artificial chromosome (BAC) [7]. Following transfection into mammalian cells, sets of cosmids that overlap and represent the entire HSV-1 genome can form circular replicationcompetent viral genomes via homologous recombination. These reconstituted viral genomes give rise to infectious virus progeny. Similarly, BACs that contain the entire HSV-1 genome also produce infectious virus progeny in transfected cells. If the viral DNA packaging/cleavage (pac) signals are deleted from the HSV-1 cosmids or HSV-1 BACs, reconstituted virus genomes are packaging defective; however, even in the absence of the pac signals, these genomes can still provide all helper functions required for the replication and packaging of cotransfected amplicon DNA. The resulting amplicon vector stocks are essentially free of helper virus contamination. To improve safety, in the latest version of this strategy [7] the helper genome carried by the BAC lacks a gene encoding one essential virus function (generally ICP27) and its length is oversized, thus further avoiding packaging. Amplicon plasmids are replicated and packaged in a cell line complementing the lacking virus function, or cotransfected with a plasmid expressing this function, as illustrated in Fig. 2a. For details on the preparation of amplicon vectors following the BAC approach, refer to Subheadings 2.1 and 3.1.

94

Cornel Fraefel and Alberto L. Epstein

Fig. 2 Amplicon vector production. (a) DNA-based packaging system: Vero cells expressing the essential HSV-1 protein ICP27 are cotransfected with the amplicon plasmid DNA, the fBACΔpac BAC DNA (which carries a nonpackageable HSV-1 genome), and an ICP27-expressing plasmid. Helper virus-free amplicon vectors are harvested from cells at 2 or 3 days posttransfection. (b) Helper virus-based packaging system: Vero cells expressing the essential virus protein ICP4 are transfected with an amplicon plasmid and superinfected the following day with the HSV-1-LaLΔJ helper virus (which lacks ICP4 and contains floxed pac signals). At 2 days postinfection, the mixed population of virus particles (amplicon vector and helper virus) are harvested and used to infect cells expressing both ICP4 and Cre recombinase. After 2 days, amplicon vectors are harvested. These vector stocks are only faintly contaminated with defective virus particles 1.3 Production of Amplicon Vectors Using the Cre/loxP1 System

Alternatively, large amounts of amplicon vector stocks, only faintly contaminated with defective helper virus, can be prepared using a system based on the deletion of the pac signals from the helper virus genome by Cre/loxP1-based site-specific recombination [8]. This helper virus, named HSV-1-LaLΔJ, carries a unique and ectopic pac signal, flanked by two loxP1 sites in parallel orientation. This is

HSV-1-Based Amplicon Vectors

95

therefore a Cre-sensitive virus that cannot be packaged in Cre-expressing cells due to deletion of the floxed packaging signals. Nevertheless, some helper genomes can escape action of the Cre-recombinase, allowing the production of some contaminating helper virus particles. For this reason, the two genes surrounding the cleavage/packaging signal, which respectively encode a virulence factor known as ICP34.5 and the essential protein ICP4, were also deleted from the HSV-1-LaLΔJ helper genome [8]. Although the amplicon stocks prepared with this helper virus (in a complementing cell line encoding both Cre and ICP4 proteins) still can contain a small amount of contaminating helper virus particles, these are replication incompetent and cannot spread upon infection of target cells or tissues. The amplicon packaging process using HSV-1-LaLΔJ as the helper virus includes two steps: a first one, in ICP4-complementing cells, allows generating large amounts of helper-contaminated amplicon vectors, while the second step, in cells expressing both ICP4 and Cre-recombinase, allows eliminating by Cre-mediated deletion of the packaging signal, most of the contaminating helper viruses (Fig. 2b). Use of the HSV-1-LaLΔJ helper virus system generally results in the production of large stocks of amplicon vectors with a very small contamination (0.05–0.5%) of defective, nonpathogenic helper virus particles. For details on the preparation of amplicon vectors following this strategy, refer to Subheadings 2.2 and 3.2.

2

Materials

2.1 Packaging of HSV-1 Amplicon Vectors Using a Defective HSV-1BAC DNA

1. E. coli clones of HSV-1 BAC fHSVΔpacΔ27ΔKn and plasmid pEBHICP27 [7].

2.1.1 Preparation of HSV-1 BAC DNA

4. TE buffer pH 7.4.

2. LB medium containing 12.5 μg/ml of chloramphenicol. 3. Plasmid Maxi Kit (Qiagen), which includes Qiagen-tip 500 columns and buffers P1, P2, P3, QBT, QC, QGT, and QF. 5. Restriction endonucleases HindIII and KpnI. 6. TAE electrophoresis buffer (10): 24.2 g Tris base, 5.71 ml glacial acetic acid, 3.72 g Na2EDTA·2H2O, H2O to 1 l. Store at room temperature. 7. Graduated snap-cap tubes 17  100 mm (e.g., Falcon 2059), sterile. 8. Sorvall GSA and SS-34 rotors. 9. 120 mm diameter folded filters.

96

Cornel Fraefel and Alberto L. Epstein

10. Ultra Clear Centrifuge tubes 13  51 mm (Beckman, Munich, Germany). 11. TV 865-ultracentrifuge rotor (Sorvall). 12. 1 ml disposable syringes. 13. 21- and 36-gauge hypodermic needles. 14. UV-lamp (366 nm). 15. Dialysis cassettes, Slide-A-Lyzer 10K (10,000 MWCO). 16. UV spectrophotometer. 2.1.2 Preparation of HSV-1 Amplicon Vector Stocks

1. Vero 2-2 cells [9]. 2. Amplicon plasmid (see Note 1). 3. Dulbecco’s modified Eagle medium (DMEM) with 10% or 6% fetal bovine serum (FBS). 4. Geneticin (G418): 1 mg/ml G418 in DMEM with 10% FBS. 5. 0.25% trypsin–0.02% EDTA. 6. Opti-MEM I reduced-serum medium. 7. HSV-1 BAC fHSVΔpacΔ27ΔKn and pEBHICP27 plasmid DNA (C. Fraefel, University of Zurich, Zurich, Switzerland: [email protected]) [7]. 8. HSV-1 amplicon DNA (Maxiprep DNA isolated from E. coli). 9. LipofectAMINE reagent. 10. Plus Reagent. 11. 10%, 30%, and 60% (w/v) sucrose in PBS. 12. Phosphate buffered saline (PBS). 13. 75 cm2 tissue culture flasks. 14. 60 mm diameter tissue culture dishes. 15. Probe sonicator. 16. 0.45 μm syringe-tip filters (Sarstedt polyethersulfone membrane filters). 17. 20 ml disposable syringes. 18. 30 ml centrifuge tubes (Beckman Ultra-Clear 25  89 mm and 14  95 mm). 19. Sorvall SS-34 rotor. 20. Fiber-optic illuminator. 21. Ultracentrifuge (Sorvall) with Beckman SW28 and SW40 rotors. 22. Hemocytometer.

HSV-1-Based Amplicon Vectors 2.1.3 Harvesting, Purification, and Titration of HSV-1 Amplicon Vectors

97

1. Vero cells (clone 76; ECACC #85020205); BHK cells (clone 21; ECACC #85011433); 293 cells (ATCC #1573). 2. DMEM supplemented with 10% or 2% FBS. 3. 4% (w/v) paraformaldehyde solution. 4. X-gal staining solution: 20 mM K3Fe(CN)6, 20 mM K4Fe (CN)6·3H2O, 2 mM MgCl2 in PBS pH 7.5. Filter-sterilize and store up to 1 year at 4  C. Before use, equilibrate solution to 37  C and add 20 μl/ml of 50 mg/ml 5-bromo-4-chloro-3indolyl-β-D-galactopyranoside (X-gal) in DMSO. Store X-gal solution in 1 ml aliquots up to several years at 20  C in the dark. 5. GST solution: 2% (v/v) goat serum and 0.2% (v/v) Triton X-100 in PBS. Store up to 1 month at 4  C. 6. Primary and secondary antibodies specific for detection of the transgene product. 7. 24 well tissue culture plates. 8. Inverted fluorescence microscope. 9. Inverted light microscope.

2.2 Packaging of Amplicon Vectors Using a Cre/loxP1 Sensitive Helper Virus

1. Vero cells (African green monkey cells, ATCC).

2.2.1 Preparation of the Defective Helper Virus

4. TE-Cre-Grina cells [8], Vero-Cre4 cells [12], or any other cell line expressing both ICP4 and Cre recombinase.

2. Vero-7b cells [10] or any other cell line expressing the essential HSV-1 protein ICP4. 3. Gli36 cell line [11].

5. Six well tissue culture plates. 6. Growth medium: DMEM supplemented with 10% fetal bovine serum, 100 units/ml penicillin, and 100 μg/ml streptomycin. All cell lines are maintained at 37  C in humidified incubators containing 5% CO2. 7. Maintenance medium: medium 199 supplemented with 1% FBS. 8. Phosphate buffered saline (PBS). 9. Geneticin (G418): 1 mg/ml G418 in growth medium. 10. Opti-MEM I. 11. LipofectAMINE Plus reagent. 12. Polystyrene roller bottles.

98

3

Cornel Fraefel and Alberto L. Epstein

Methods

3.1 Packaging of HSV-1 Amplicon Vectors Using a Defective BAC

1. Prepare a 17  100 mm sterile snap-cap tube containing 5 ml LB/chloramphenicol medium. Inoculate with frozen longterm culture of the HSV-1 BAC clone (fHSVΔpacΔ27ΔKn). Incubate for 8 h at 37  C in a shaker.

3.1.1 Preparation of HSV-1 BAC DNA

2. Transfer 1 ml of the culture into each of four 2-l flasks containing 1 l sterile LB/chloramphenicol medium, and incubate for 16 h at 37  C, with shaking. 3. Distribute the 4 l overnight culture into six 250 ml polypropylene centrifuge tubes and pellet by centrifugation for 10 min at 4000  g and 4  C. Decant medium, fill polypropylene centrifuge tubes again with bacterial culture, and repeat centrifugation. 4. After the last centrifugation, invert each tube on a paper towel for 2 min to drain all liquid. Resuspend each of the pellets in 5 ml of buffer P1 and combine the six aliquots. Add 130 ml of buffer P1 and distribute to four fresh 250-ml polypropylene centrifuge tubes (40 ml per tube). 5. Add 40 ml of buffer 2 to each centrifuge tube, mix by inverting the tubes four to six times, and incubate for 5 min at room temperature. 6. Add 40 ml of buffer P3 and mix immediately by inverting the tubes six times. Incubate the tubes for 20 min on ice. Invert the tube once more and centrifuge for 30 min at 16,000  g and 4  C. 7. Filter the supernatants through a folded filter (120 mm diameter) into four fresh 250 ml polypropylene centrifuge tubes. 8. Precipitate the DNA with 0.7 volumes (84 ml per tube) of isopropanol, mix gently, and centrifuge immediately for 30 min at 17,000  g and 4  C. 9. Remove the supernatants and mark the locations of the pellet. Wash the DNA pellet by adding 20 ml cold 70% ethanol to each and centrifuge for 30 min at 16,000  g and 4  C. 10. Carefully remove the supernatants and resuspend each of the four pellets in 2 ml TE buffer, pH 7.4. Pool the four solutions (total volume 8 ml) and add 52 ml QGT buffer (final volume 60 ml). 11. Equilibrate two Qiagen-tip 500 columns with 10 ml of buffer QBT and allow the columns to empty by gravity flow. 12. Transfer the solution through a folded filter (120 mm diameter) into Qiagen-tip 500 columns (30 ml per column) and allow the liquid to enter the resin by gravity flow.

HSV-1-Based Amplicon Vectors

99

13. Wash each column twice with 30 ml of buffer QC, and then elute DNA from each column with 15 ml of prewarmed (65  C) buffer QF into a 30-ml centrifuge tube. 14. Precipitate the DNA with 0.7 volumes (10.5 ml) of isopropanol, mix, and immediately centrifuge for 30 min at 20,000  g, 4  C. 15. Carefully remove the supernatants from step 14 and mark the locations of the pellets on the outside of the tubes. Wash the pellets with chilled 70% ethanol and, if necessary, repellet at the same settings as in step 14. 16. Aspirate the supernatants completely. Resuspend each pellet in 3 ml TE buffer (pH 7.4) for several hours at 37  C. 17. Prepare two Beckman Ultra Clear Centrifuge tubes (13  51 mm) with 3 g CsCl and add the DNA solution from step 16 (3 ml per tube). Mix the solution gently until salt is dissolved. Add 300-μl ethidium bromide (10 mg/ml in H2O) to the DNA/CsCl solution. Then overlay the solution with 300 μl paraffin oil and seal the tubes. 18. Centrifuge for 17 h at 218,500  g, 20  C. 19. Two bands of DNA, located in the center of the gradient, should be visible in normal light. The upper band consists of linear and nicked circular HSV-1 BAC DNA. The lower band consists of closed circular HSV-1 BAC DNA. 20. Harvest the lower band using a disposable 1 ml syringe fitted with a 21-gauge hypodermic needle under UV light and transfer it into a microfuge tube. 21. Remove ethidium bromide from the DNA solution by adding an equal volume of n-butanol in TE/CsCl (3 g CsCl dissolved in 3 ml TE, pH 7.4). 22. Mix the two phases by vortexing and centrifuge at 210  g for 3 min at room temperature in a bench centrifuge. 23. Carefully transfer the lower, aqueous phase to a fresh microfuge tube. Repeat steps 21–23 four to six times until the pink color disappears from both the aqueous phase and the organic phase. 24. Add an equal volume of isopropanol, mix and centrifuge at 210  g for 3 min at room temperature. Transfer the aqueous phase to a fresh microfuge tube. 25. To remove the CsCl from the DNA solution, dialyze for 6 h against TE, pH 7.4 at 4  C. Then, change the TE buffer and dialyze overnight. For dialysis, the DNA solution is injected into a dialysis cassette, Slide-A-Lyzer 10K using a 1 ml disposable syringe fitted with a 36-gauge hypodermic needle. After dialysis, the solution is recovered from the dialysis cassette by

100

Cornel Fraefel and Alberto L. Epstein

using a fresh 1 ml disposable syringe fitted with a 36-gauge hypodermic needle. The DNA solution is then transferred to a clean microfuge tube and stored at 4  C. After characterization of the DNA (concentration and restriction enzyme analysis), store DNA at 4  C. 26. Determine the absorbance of the DNA solution from step 25 at 260 nm (A260) and 280 nm (A280) using an UV spectrophotometer. From 4 L of bacterial culture, HSV-BAC DNA yields are typically in the range of 200–300 μg. 27. Verify the HSV-1 BAC DNA by restriction endonuclease analysis (e.g. HindIII, KpnI). Separate the fragments overnight by electrophoresis on a 0.4% agarose gel at 40 V in 1 TAE electrophoresis buffer, using high-molecular-weight DNA and 1-kb DNA ladder as size standards (see Note 2). Stain with ethidium bromide (1 mg/ml in H2O) and compare restriction fragment patterns with the published HSV-1 sequence [13]. 3.1.2 Preparation of Amplicon Plasmid DNA

1. Prepare a 17  100-mm sterile snap-cap tube containing 5 ml LB/chloramphenicol medium. Inoculate with frozen longterm culture of the E. coli harboring the plasmid. Incubate for 8 h at 37  C in a shaker. 2. Transfer 1 ml of the culture into a 1 l flask containing 200 ml of sterile LB medium supplemented with the appropriate antibiotic, and incubate for 16 h at 37  C, with shaking. 3. Transfer the overnight culture into a 250 ml polypropylene centrifuge tube and pellet by centrifugation for 10 min at 4000  g and 4  C. Decant medium and invert the tube on a paper towel for 2 min to drain all liquid. Resuspend the pellet in 10 ml of buffer P1. 4. Add 10 ml of buffer 2, mix by inverting the tube four to six times, and incubate for 5 min at room temperature. 5. Add 10 ml of chilled buffer P3 and mix immediately by inverting the tube six times. Incubate the tube for 20 min on ice. Invert the tube once more and centrifuge for 30 min at 16,000  g and 4  C. 6. Filter the supernatants through a folded filter (120 mm diameter) into a 30 ml centrifuge tube. 7. Equilibrate a Qiagen-tip 500 column with 10 ml of buffer QBT and allow the column to empty by gravity flow. 8. Transfer the solution from step 6 into the Qiagen-tip 500 column and allow the liquid to enter the resin by gravity flow. 9. Wash the column twice with 30 ml of buffer QC, and then elute DNA from the column with 15 ml of prewarmed (65  C) buffer QF into a 30 ml centrifuge tube.

HSV-1-Based Amplicon Vectors

101

10. Precipitate the DNA with 0.7 volumes (10.5 ml) of isopropanol, mix, and immediately centrifuge for 30 min at 20,000  g and 4  C. 11. Carefully remove the supernatant from step 10 and mark the location of the pellet on the outside of the tube. Wash the pellet with chilled 70% ethanol and, if necessary, repellet at the same settings as in step 10. 12. Aspirate the supernatant completely. Resuspend the pellet in 200 μl of TE buffer (pH 7.4), and determine the DNA concentration using a UV spectrophotometer. 3.1.3 Transfect Vero 2-2 Cells and Harvest, and Purify Packaged Amplicon Vectors

1. Maintain Vero 2-2 cells in DMEM–10% FBS containing 1 mg/ ml G418. Propagate the culture twice a week by splitting 1/5 in fresh medium (20 ml) into a new 75 cm2 tissue culture flask (see Note 3). 2. On the day before transfection, remove culture medium, wash cells twice with PBS, add a thin layer of trypsin–EDTA, and incubate for 10 min at 37  C to allow cells to detach from plate. Count cells using a hemocytometer and plate 1.2  106 cells per 60 mm diameter tissue culture dish in 3 ml DMEM–10% FBS. 3. For each 60 mm dish, place 250 μl Opti-MEM I reducedserum medium into each of two 15 ml conical tubes. To one tube, add 0.6 μg amplicon DNA, 2 μg of the HSV-1 BAC DNA, and 0.2 μg pEBHICP27 DNA. Mix the tube and slowly add 10 μl PLUS reagent. Incubate the tube for 5 min at room temperature, mix and incubate for another 5 min. To the other tube, add 15 μl Lipofectamine. 4. Combine the contents of the two tubes, mix well, and incubate for 45 min at room temperature. 5. Wash the cultures prepared the day before (step 2) once with 2 ml of Opti-MEM I. Add 1.1 ml Opti-MEM I to the tube from step 4. containing the DNA–Lipofectamine transfection mixture (1.3 ml total volume). Aspirate medium from the culture, add the transfection mixture, and incubate for 5.5 h. 6. Aspirate the transfection mixture and wash the cells three times with 2 ml Opti-MEM I. After aspirating the last wash, add 3.5 ml DMEM–6% FBS and incubate 2–3 days. 7. Scrape cells into the medium using a rubber policeman. Transfer the suspension to a 15-ml conical centrifuge tube and place the tube containing the cells into a beaker of ice water. Submerge the tip of the sonicator probe ~0.5 cm into the cell suspension and sonicate for 20 s with 20% output energy. This disrupts cell membranes and liberates cell-associated vector particles.

102

Cornel Fraefel and Alberto L. Epstein

8. Remove cell debris by centrifugation for 10 min at 1400 g and 4  C, and filter the supernatant through a 0.45 μm syringe-tip filter attached to a 20 ml disposable syringe into a new 15-ml conical tube. Remove a sample for titration, then divide the remaining stock into 1 ml aliquots, freeze them in a dry ice/ethanol bath, and store at 80  C. Alternatively, concentrate (steps 9a and 10a) or purify and concentrate (steps 9b and 10b) the stock before storage. 9a. Transfer the vector solution from step 8 to a 30 ml centrifuge tube and spin for 2 h at 20,000  g and 4  C. 10a. Resuspend the pellet in a small volume (e.g., 300 μl) of 10% sucrose. Remove a sample of the stock for titration, then divide into aliquots (e.g., 30 μl) and freeze in a dry ice–ethanol bath. Store at 80  C. 9b. Prepare a sucrose gradient in a Beckman Ultra-Clear 25  89mm centrifuge tube by adding the following solutions into the tube: 7 ml of 60% sucrose; 7 ml of 30% sucrose; 3 ml of 10% sucrose. Carefully add the vector stock from step 8 (up to 20 ml) on top of the gradient and centrifuge for 2 h at 100,000  g and 4  C, using a Beckman SW28 rotor. 10b. The interface between the 30% and 60% sucrose layers appears as a cloudy band when viewed with a fiber-optic illuminator. Aspirate the 10% and 30% sucrose layers from the top and collect the virus band at the interface between the 30% and 60% layers. Transfer to a Beckman Ultra-Clear 14  95 mm centrifuge tube, add ~15 ml PBS, and pellet virus particles for 1 h at 100,000  g and 4  C, using a Beckman SW40 rotor. Resuspend the pellet in a small volume (e.g., 300 μl) of 10% sucrose. Divide into aliquots (e.g., 30 μl) and freeze in a dry ice–ethanol bath. Store at 80  C. Before freezing, retain a sample of the stock for titration. 3.1.4 Titration of HSV-1 Amplicon Vector Stocks

1. Plate cells (e.g., Vero 7b, BHK 21, or 293 cells) at a density of 1.0  105 cells per well of a 24-well tissue culture plate in 0.5 ml DMEM–10% FBS. Incubate overnight at 37  C and 5% CO2. 2. Aspirate the medium and wash each well once with PBS. Remove PBS and add 0.1, 1, or 5 μl samples collected from vector stocks to 250 μl of DMEM–2% FBS in microfuge tubes. 3. Incubate for 1–2 days. Remove the inoculum and fix cells for 20 min at room temperature with 250 μl of 4% paraformaldehyde, pH 7.0. Wash the fixed cells three times with PBS, then proceed (depending on the transgene) with a detection protocol such as green fluorescence (step 4), X-gal staining (steps 5 and 6), or immunocytochemical staining (steps 7–9).

HSV-1-Based Amplicon Vectors

103

4. Detect cells expressing the gene for EGFP: Examine the culture from step 3 (before or after fixation) using an inverted fluorescence microscope. Count green fluorescent cells and determine the vector titer in transducing units (TU)/ml by multiplying the number of transgene-positive cells by the dilution factor (see Note 4). 5. Detect cells expressing the E. coli lacZ gene: Add 250 μl X-gal staining solution per well of the 24 well tissue culture plate from step 3, and incubate for 4–12 h (depending on the cell type and the promoter regulating expression of the transgene) at 37  C and 5% CO2. 6. Stop the staining reaction by washing the cells three times with PBS. Count blue cells using an inverted light microscope and determine the vector titer in TU/ml by multiplying the number of transgene-positive cells by the dilution factor. 7. Detect transgene-expressing cells by immunocytochemical staining: Add 250 μl GST solution per well of the 24 well tissue culture plate from step 3 (to block nonspecific binding sites and to permeabilize cell membranes) and let stand for 30 min at room temperature. Replace the blocking solution with the primary antibody (diluted in GST) and incubate overnight at 4  C. 8. Wash the cells three times with PBS, leaving the solution in the well for 10 min each time. Add secondary antibody (diluted in GST) and incubate for at least 4 h at room temperature. 9. Wash the cells twice with PBS and develop according to the appropriate visualization protocol. Count transgene-positive cells using an inverted light microscope and determine the vector titer as TU/ml by multiplying the number of the transgene-positive cells by the dilution factor. 3.2 Packaging of Amplicon Vectors Using a Cre/loxP1 Sensitive Helper Virus

HSV-1-LaLΔJ [8] is a defective recombinant virus. Therefore, to prepare helper virus, follow the instructions described in Chapter 3 of this book. The only difference is that, since HSV-1-LaLΔJ lacks the gene encoding ICP4, it should be grown in ICP4-expressing cells, such as the 7b Vero-derived cell line [10]. These cells grow in DMEM supplemented with 10% FBS, L-glutamine, penicillin, and streptomycin. G418 (1 mg/ml) should be added every four passages, to avoid losing the complementing ICP4 gene. To purify and titrate the helper virus stock, follow the instructions described in Chapter 3 of this book. The virus should be titrated simultaneously in complementing cells, such as Vero-7b, and in noncomplementing Vero cells, to allow detection of unwanted replicationcompetent mutant viruses that can sometimes be generated by recombination between the virus genome and the ICP4 gene located in the cellular genome. If there are revertant viruses, they

104

Cornel Fraefel and Alberto L. Epstein

will produce lysis plaques in Vero cells. If this is the case, start the production again, infecting the complementing cells at a very low MOI (lower than 0.05 PFU/cell), using plaque-purified defective virus. The production of amplicon vector stocks using HSV-1-LaLΔJ as the helper virus is a two-step protocol, as illustrated in Fig. 2b. In the first step, stocks of amplicons contaminated with large amounts of helper virus particles are produced in ICP4-complementing cells, such as Vero-7b cells. In the second step, stocks of vectors, only faintly contaminated with replication-defective helper viruses, are prepared in cells expressing both ICP4 and Cre-recombinase, such as TE-Cre-Grina cells or Vero-Cre4 cells. 3.2.1 Generation of P0 Stock

1. The day before transfection, plate 5  106 Vero-7b cells in growth medium into a 75 cm2 tissue culture flask. Incubate the cells over night at 37  C and 5% CO2. 2. The following day, mix 6 μg of amplicon plasmid DNA, 750 μl of Opti-MEM, and 30 μl of Plus reagent per 75 cm2 cell culture flask in a 15 ml conical tube. Incubate for 15 min at room temperature, and then add a solution consisting of 45 μl of LipofectAmine and 750 μl of Opti-MEM. After 15 min incubation at room temperature, add the transfection mix to the cells in 10 ml Opti-MEM medium and incubate at 37  C and 5% CO2. 3. After 3 h, add 10 ml Opti-MEM medium to the cells and incubate the cultures overnight. 4. The following day, aspirate the medium from the flask, rinse the cells once with maintenance medium and add 3 ml of maintenance medium containing the helper virus diluted to a MOI of 0.3 PFU/cell (see Note 5). 5. Place the flask on a shaker for 1 h 30 min, if possible under 5% CO2 atmosphere. 6. Discard medium, rinse twice with maintenance medium, and then add 20 ml of maintenance medium. 7. Incubate cells for 48 h at 37  C and 5% CO2. 8. At 48 h postinfection when most of the cells show cytopathic effects typical for HSV-1 infection, scrape the cells into the medium and transfer the suspension into 50 ml Falcon tubes. 9. Spin down at 771  g for 10 min at 4  C. 10. Transfer the supernatant to a 35 ml oak ridge tube. 11. Resuspend the cell pellet in 1 ml of PBS and disrupt the cells either by three cycles of freezing-thawing or by using a water sonicator (three times 30 s in cold water). Then, spin down at 771  g for 10 min at 4  C.

HSV-1-Based Amplicon Vectors

105

Table 1 Titers, ratios, and amounts of amplicon vectors and helper particles (see Note 11) P0 (HC)a

P1 (HC)

P2 (HC)

P3 (HF)b

Titer amplicon (TU/ml)

107

108

109

108

Titer helper (PFU/ml)

3  107

5  107

108

5  105

Ratio A/H

1:3

2:1

10:1

200:1

Amount (ml)

0.5

1

5–10

5–10

HC helper-contaminated stocks HF helper-free stocks. Note that “helper-free” stocks obtained using this strategy can be contaminated to a very low extent with replication-defective helper viruses a

b

12. Discard the pellet containing cell debris and store the supernatant containing the virus/vector particles on ice. 13. Centrifuge the supernatant from step 10 for 1 h 30 min at 18,000  g and 4  C. Discard the supernatant, resuspend the pellet containing virus/vector particles in 1 ml of PBS, and combine with the virus/vector particles collected in step 12. Store this final P0 stock at 80  C until titration. 3.2.2 Titration of Amplicon Vectors and Helper Virus in P0 Stocks

1. One day prior to titration of the P0 stock, prepare six well tissue culture plates with 1  106 Gli36 cells, Vero-7b cells, or Vero cells per well in growth medium. 2. Prepare a series of tenfold dilutions (10 2 to 10 8) of the P0 stock in Eppendorf tubes in 1 ml of growth medium without serum. 3. Infect cells as described in Subheading 3.1.4, step 2. 4. To determine the titer of vector particles proceed with one of the protocols described in Subheading 3.1.4, steps 3–9. 5. To determine the titer of the helper virus, fix the cells 3 days after infection, count the numbers of plaques per well in the Vero 7b monolayer, determine the average number of plaques for each dilution (at least in in duplicate), and multiply by the dilution factor to calculate the number of PFU/ml. 6. To determine if the virus/vector stock contains replicationcompetent revertant virus, proceed exactly as in step 5 but using non-trans-complementing Vero cells. 7. Table 1 gives an estimate of the titers that can usually be expected. At this step the ratio of amplicon to helper particles usually is about 0.3–0.5 (see Note 6).

3.2.3 Amplification from P0 to P1 and Titration of P1 Stocks

1. The day before infection, plate 1.3  107 Vero-7b cells in growth medium per 175 cm2 tissue culture flask.

106

Cornel Fraefel and Alberto L. Epstein

2. The following day, aspirate the medium and add 5 ml of maintenance medium containing the P0 stock diluted to a MOI of 0.3 PFU (of helper virus)/cell. 3. Place the flask on a shaker for 1 h 30 min, if possible under 5% CO2 atmosphere. 4. Discard medium, rinse cells twice with maintenance medium, and add 30 ml of maintenance medium. 5. Then proceed as in Subheading 3.2.1, steps 8–13, and Subheading 3.2.2, to respectively generate and titrate the P1 vector stock (Table 1) (see Note 7). 3.2.4 Amplification from P1 to P2 and Titration of P2 Stocks

Further amplification of the vector stock can be performed in 175 cm2 tissue culture flasks as described in Subheading 3.2.3 or in roller bottles as follows: 1. Seed 2  107 Vero-7b cells/roller bottle in 100 ml of growth medium. Since cells in roller bottles are not incubated in a CO2 atmosphere, CO2 should be added to the growth medium using a pipette connected to a CO2 gas bottle, until CO2 bubbles appear in the roller bottle. 2. Turn the roller bottles at a speed of 0.4 rounds per minute. Cells generally become confluent (108 cells/bottle) in 4–5 days of incubation at 37  C. 3. When cells are confluent, aspirate the medium and add 20 ml of maintenance medium containing the P1 stock diluted to a MOI of 0.3 PFU (of helper virus)/cell. 4. After 2 h, add maintenance medium to a final volume of 100 ml per roller bottle and incubate for 48 h at 37  C, constantly turning the bottles at a speed of 0.4 rounds per minute. 5. When cytopathic effects are apparent, which generally occurs at 48 h postinfection, collect and titrate the P2 stock as described in Subheading 3.2.3 for the P1 stock, but scale up the number of tubes (Table 1) (see Note 8).

3.2.5 Production and Titration of P3 Amplicon Vector Stocks

1. Plate 1.3  107 TE-Cre-Grina or Vero-Cre4 cells per 175 cm2 tissue culture flask in growth medium. 2. The following day, infect cells with the P2 vector stock at an MOI of 3 TU (of amplicon particles)/cell. At this dilution of the amplicon vector, the concentration of the helper virus in the stock should be approximately 0.5 PFU/cell. If the concentration of helper virus in the stock is too low, add more helper virus (see Note 9). 3. Place the flask on a shaker for 1 h 30 min, if possible under 5% CO2 atmosphere.

HSV-1-Based Amplicon Vectors

107

4. Discard medium, rinse cells twice with maintenance medium, and add 30 ml of maintenance medium per flask. Incubate cells for 48 h at 37  C and 5% CO2. 5. Collect and titrate the “helper-free” P3 vector stock as described in Subheading 3.2.3 (Table 1). 6. Amplicon vector stocks can be purified and concentrated for in vivo applications as described for wild-type HSV-1 and recombinant viruses in Chapter 3 of this book (see Note 10).

4

Notes 1. An HSV-1 amplicon plasmid is a standard bacterial plasmid containing one origin of DNA replication (ori) and one cleavage/packaging signal (“a” or pac) from HSV-1. It usually carries also a reporter gene expressing GFP, LacZ, or luciferase, which allows to easily titrate the vector stock and to identify the infected cells. In addition, it contains a multiple cloning site where the desired transgene sequences can be inserted. It is propagated like any standard bacterial plasmid in E. coli (Fig. 1). 2. Treat gel with care; 0.4% gels are very delicate. 3. Cells are incubated in a humidified 37  C, 5% CO2 incubator throughout the protocol. All solutions and equipment coming into contact with cells must be sterile. 4. The titers expressed as transducing units per milliliter (TU/ml) are relative. Factors influencing relative transduction efficiencies include the cells used for titration, the promoter regulating the expression of the transgene, the transgene, and the sensitivity of the detection method. The vector titers realized with amplicons that contain the standard ~1-kbp ori should be in the range of 106–107 TU/ml before concentration. The recovery of transducing units after concentration/purification is around ~50%. While the number of physical particles is an intrinsic property of the virus stock, independent of the cell types to be infected, the number of infectious particles, hence the titer of a virus or of a vector stock, strongly depends on the susceptibility of the cells. In the case of helper virus-free amplicon vectors, some cell types, such as Gli36 cells (a human glioblastoma cell line), give very high vector titers, while Vero-derived cell lines give much lower vector titers. In contrast, Vero or Vero-derived cells give very good titers of the helper virus. 5. Before infecting the transfected cells, confirm that transfection was efficient, resulting in at least 30% of cells expressing the reporter transgene (e.g., GFP). If this is not the case, it is better

108

Cornel Fraefel and Alberto L. Epstein

to start again using fresh cells and optimize the transfection procedure. 6. In a typical P0 situation we obtain an amplicon to helper ratio of about 1:3. We usually do not observe replication-competent viruses in Vero cells. 7. At this step the ratio of amplicon to helper particles generally inverts in favor of amplicon particles (from 2:1 to 5:1). The titers of the P1 stocks are generally one order of magnitude higher than in P0. 8. At this step, the ratio of amplicon to helper particles further increases in favor of amplicon particles (from 5:1 to 10:1), and the titers of the stock can be substantially increased, depending on the number of tissue culture flasks infected. 9. The critical point here is that each cell should receive at least one amplicon particle. The infected cells will become round but without displaying other cytopathic effects, as the helper particles cannot spread in these cells. 10. We usually observe less than 1% contamination of the vector stock with defective helper viruses (ratio of amplicon to helper virus ranges from 100:1 and 500:1). However, the titer of the amplicon vectors is generally one order of magnitude lower than that of the P2 stock used to infect TE-Cre-Grina or VeroCre4 cells. 11. Table 1 presents results obtained in a typical vector preparation. Values can be somewhat different depending on the nature and size of the amplicon plasmid, on the passage number of cell lines, and on the efficiency of transfection in P0. References 1. Spaete RR, Frenkel N (1982) The herpes simplex virus amplicon: a new eukaryotic defective-virus cloning-amplifying vector. Cell 30:295–304 2. Vlazny DA, Frenkel N (1981) Replication of herpes simplex virus DNA: localization of replication recognition signals within defective virus genomes. Proc Natl Acad Sci U S A 78:742–746 3. Spaete RR, Frenkel N (1985) The herpes simplex virus amplicon: analyses of cis-acting replication functions. Proc Natl Acad Sci U S A 82:694–698 4. Boehmer PE, Lehman IR (1997) Herpes simplex virus DNA replication. Annu Rev Biochem 66:347–384 5. Kwong AD, Frenkel N (1984) Herpes simplex virus amplicon: effect of size on replication of constructed defective genomes containing

eukaryotic DNA sequences. J Virol 51:595–603 6. Fraefel C, Song S, Lim F, Lang P, Yu L, Wang Y, Wild P, Geller AI (1996) Helper virus-free transfer of herpes simplex virus type 1 plasmid vectors into neural cells. J Virol 70:7190–7197 7. Saeki Y, Fraefel C, Ichikawa T, Breakefield XO, Chiocca EA (2001) Improved helper virus-free packaging system for HSV amplicon vectors using an ICP27-deleted, oversized HSV-1 DNA in a bacterial artificial chromosome. Mol Ther 3:591–601 8. Zaupa C, Revol-Guyot V, Epstein AL (2003) Improved packaging system for generation of high levels non-cytotoxic HSV-1 amplicon vectors using Cre-loxP1 site-specific recombination to delete the packaging signals of

HSV-1-Based Amplicon Vectors defective helper genomes. Hum Gene Ther 14:1049–1063 9. Smith IL, Hardwicke MA, Sandri-Goldin RM (1992) Evidence that the herpes simplex virus immediate early protein ICP27 acts posttranscriptionally during infection to regulate gene expression. Virology 186:74–86 10. Krisky DM, Wolfe D, Goins WF, Marconi PC, Ramakrishnan R, Mata M, Rouse RJ, Fink DJ, Glorioso JC (1998) Deletion of multiple immediate-early genes from herpes simplex virus reduces cytotoxicity and permits longterm gene expression in neurons. Gene Ther 5:1593–1603 11. Kashima T, Vinters HV, Campagnoni AT (1995) Unexpected expression of intermediate

109

filament protein genes in human oligodendroglioma cell lines. J Neuropathol Exp Neurol 54:23–31 12. Melendez ME, Aguirre AI, Baez MV, Bueno CA, Salvetti A, Jerusalinsky DA, Epstein AL (2013) Improvements in HSV-1-derived amplicon vectors for gene transfer, Chapter 1. In: Borrelli J, Giannini Y (eds) Advances in virus genomes research. Nova Science Publishers, Hauppauge, NY, pp 1–49 13. McGeoch DJ, Dalrymple MA, Davison AJ, Dolan A, Frame MC, McNab D, Perry LJ, Scott JE, Taylor P (1988) The complete DNA sequence of the long unique region in the genome of herpes simplex virus type 1. J Gen Virol 69:1531–15374

Chapter 6 HSV-1 Amplicon Vectors as Genetic Vaccines Anita F. Meier and Andrea S. Laimbacher Abstract HSV-1 amplicon vectors have been used as platforms for the generation of genetic vaccines against both DNA and RNA viruses. Mice vaccinated with such vectors encoding structural proteins from both footand-mouth disease virus and rotavirus were partially protected from challenge with wild-type virus (D’Antuono et al., Vaccine 28:7363–7372, 2010; Laimbacher et al., Mol Ther 20:1810–1820, 2012; Meier et al., Int J Mol Sci 18:431, 2017), indicating that HSV-1 amplicon vectors are attractive tools for the development of complex and safe genetic vaccines. This chapter describes the preparation and testing of HSV-1 amplicon vectors that encode individual or multiple viral structural proteins from a polycistronic transgene cassette. We further put particular emphasis on generating virus-like particles (VLPs) in vector-infected cells. Expression of viral genes is confirmed by Western blot and immune fluorescence analysis and generation of VLPs in vector-infected cells is demonstrated by electron microscopy. Furthermore, examples on how to analyze the immune response in a mouse model and possible challenge experiments are described. Key words Helper virus-free HSV-1 amplicon vector, Polycistronic transgene cassette, Virus-like particles, VLPs, Genetic vaccine

1

Introduction Herpes simplex virus type 1 (HSV-1) amplicon vectors are versatile gene transfer vehicles due to the very large transgene capacity, the broad-range cell tropism, low immunogenicity and toxicity, and ease of manipulation. The basic design of HSV-1 amplicon vectors has remained unchanged over the past 30 years but development of new amplicon vector systems, for example, by incorporating genetic elements from other viruses or from nonviral systems, have been reported. Amplicon vectors have shown promising results in many preclinical gene- and cancer therapy applications, as well as in vaccination studies [1, 2]. HSV-1 amplicons have also been used for the synthesis of proteins from other viruses, for example, amplicon vector mediated synthesis of the full set of structural proteins allowed the assembly of retrovirus-like particles (VLPs) [3, 4], foot-and-mouth disease virus [5] rotavirus [6, 7],

Russell J. Diefenbach and Cornel Fraefel (eds.), Herpes Simplex Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2060, https://doi.org/10.1007/978-1-4939-9814-2_6, © Springer Science+Business Media, LLC, part of Springer Nature 2020

111

112

Anita F. Meier and Andrea S. Laimbacher

and West Nile virus [8]. In particular, the possibility of inducing local assembly of inert VLPs in the context of a quasi-infectious process holds great promise as vaccine formulation. The large transgene capacity of HSV-1 amplicon vectors of up to 150 kb allows the incorporation of several genes of interest and the encapsidation of several copies of the transgene cassette, thereby increasing the gene dose. Internal ribosome entry sites (IRES) in polycistronic vectors have been shown to support the simultaneous expression of multiple genes from a single promoter. Amplicon vectors provide a high safety level as they can be produced using a helper virus-free packaging system leading to the absence of expression of all HSV-1 genes. The expression of the individual heterologous viral genes alone or in combination can be confirmed by Western blot and immune fluorescence analysis, and the generation of VLPs in vector-infected cells can be monitored by electron microscopy. For example, inoculation of mice with polycistronic amplicon vectors encoding the structural proteins required for capsid assembly of FMDV or rotavirus as a two-dose regimen without adjuvants resulted in the expression of the heterologous viral antigens, followed by induction of virus-specific immune responses and a variable level of protection against challenge with a high dose of wildtype virus [5–7]. This chapter provides detailed protocols for the production of helper virus-free polycistronic HSV-1 amplicon vector stocks and the characterization of the vectors by Western blot, immunofluorescence analysis and electron microscopy. A summary describing the immunization of experimental animals with HSV-1 amplicon vectors, but no detailed protocols, as well as a basic protocol for ELISA is provided at the end of the chapter.

2

Materials

2.1 Preparation of HSV-1 BAC DNA

1. 17
100-mm graduated snap-cap tubes (for growing bacteria).

2.1.1 Extraction of HSV-1 BAC DNA

2. Luria-Bertani (LB) medium: dissolve 10 g NaCl, 10 g Bacto tryptone and 5 g Bacto yeast extract in 1000 ml ddH2O and autoclave for 20 min at 121  C. 3. Chloramphenicol (1000
stock solution): 12.5 mg/ml dissolved in 75% ethanol; store at 20  C. 4. E. coli clone of HSV-1 BAC fHSVΔpacΔ27ΔKn [9]. 5. Dimethyl sulfoxide (DMSO). 6. Plasmid Maxi kit (Qiagen).

Genetic Vaccine

113

7. High speed centrifuge equipped with rotor and tubes (Sorvall RC6+, GSA rotor, SS34 rotor, and polypropylene tubes or equivalent). 8. Resuspension buffer P1 (50 mM Tris–HCl, pH 8.0, 10 mM EDTA, 100 μg/ml RNase A): Add 950 ml of H2O to a glass beaker and add 6.06 g Tris base and 3.72 g Na2EDTA·2H2O.Mix on a magnetic stirrer, and adjust pH with HCl. Add H2O to 1 l, and sterilize by autoclaving. Store at room temperature (see Note 1). 9. Lysis buffer P2 (200 mM NaOH, 1% SDS (w/v)): Add 950 ml of H2O to a glass beaker and add 8.0 g NaOH and 50 ml 20% SDS (w/v). Mix on a magnetic stirrer. Add H2O to 1 l, and sterilize by autoclaving. Store at room temperature (see Note 1). 10. Neutralization buffer P3 (3.0 M potassium acetate, pH 5.0): Add 500 ml of H2O to a glass beaker and add 294.5 g potassium acetate. Mix on a magnetic stirrer, and adjust pH with glacial acetic acid (~110 ml). Add H2O to 1 l, and sterilize by autoclaving, Store at room temperature (see Note 1). 11. 120-mm diameter folded filters. 12. 1 M Tris–HCl, pH 8.0: Add 800 ml of H2O to a glass beaker and add 121.1 g Tris base. Mix on a magnetic stirrer, and adjust pH with HCl. Add H2O to 1 l, and sterilize by autoclaving. Store at room temperature. 13. 0.5 M EDTA, pH 8.0: Add 800 ml of H2O to a glass beaker and add 186.1 g disodium EDTA·2H2O. Tris base. Mix on a magnetic stirrer, and adjust pH with NaOH pellets. Add H2O to 1 l, and sterilize by autoclaving. Store at room temperature. 14. TE buffer (10 mM Tris–HCl, pH 7.4, 0.1 mM EDTA): Mix 10 ml of 1 M Tris–HCl, pH 8.0 and 2 ml of 0.5 M EDTA, pH 8 in 988 ml of H2O. Sterilize by autoclaving. Store at room temperature. 15. Buffer QBT, QC, QF and Qiagen-tip 500 columns (Qiagen) (see Note 1). 2.1.2 Purification of HSV1 BAC DNA

1. 13
51-mm Ultra-Clear centrifuge tubes. 2. Cesium chloride (CsCl). 3. Ethidium bromide in H2O: 10 mg/ml and 1 mg/ml stock solutions. 4. Paraffin oil. 5. Ultracentrifuge equipped with Sorvall TV 865 rotor (fixedangle) or equivalent. 6. 1-ml disposable syringes. 7. 21- and 36-gauge hypodermic needles.

114

Anita F. Meier and Andrea S. Laimbacher

8. UV-lamp (366 nm). 9. TE/CsCl solution: dissolve 3 g CsCl in 3 ml TE buffer, pH 7.4. Store up to several months at room temperature. 10. Dialysis cassettes (Slide-A-Lyzer, 10,000 MWCO). 2.1.3 Characterization of HSV-1 BAC DNA

1. UV spectrophotometer. 2. High-molecular-weight- and 1-kb DNA standards. 3. Electrophoresis-grade agarose. 4. TAE (Tris–acetate–EDTA) electrophoresis buffer 10
: Dissolve 24.2 g Tris base, 5.71 ml glacial acetic acid, and 3.72 g Na2EDTA·2H2O in 1000 ml ddH2O. Store at room temperature. 5. Electrophoresis chamber.

2.2 Production of HSV-1 Amplicon Vector Stocks 2.2.1 Preparation of Cells

1. Vero 2-2 cells, a derivative of Vero cells that express HSV-1 ICP27. [10]. 2. DMEM (Dulbecco Modified Eagle’s medium) supplemented with 10% FBS. 3. G418 (Geneticin). 4. 0.25% trypsin–0.02% EDTA. 5. Hemacytometer.

2.2.2 Transfection

1. OptiMEM Scientific).

I

reduced-serum

medium

(Thermo

Fisher

2. Plasmid pEBHICP27 [9]. 3. Lipofectamine LTX Reagent (Thermo Fisher Scientific). 4. PLUS Reagent (Thermo Fisher Scientific). 5. DMEM supplemented with 6% FBS. 2.2.3 Harvesting of Vector Particles

1. Cell scraper. 2. Liquid N2. 3. Probe sonicator. 4. 0.45-μm syringe-tip polyethersulfone membrane filters. 5. 20-ml disposable syringe.

2.2.4 Concentration of Vector Stocks

1. Ultraspeed centrifuge equipped with rotor (Beckman SW28 rotor or equivalent). 2. Beckman Ultra-Clear centrifuge tubes (25
89 mm). 3. 25% sucrose in PBS.

Genetic Vaccine

2.3 Characterization of HSV-1 Amplicon Vectors

1. DMEM supplemented with 2% and 10% FBS.

2.3.1 Western Blotting

4. Protein loading buffer (PLB).

2.3.2 Immunofluorescence

1. DMEM supplemented with 2% and 10% FBS.

115

2. 24-well cell culture plates. 3. 0.25% trypsin–0.02% EDTA.

2. 24-well cell culture plates. 3. 12 mm glass coverslips. 4. 3.7% formaldehyde in PBS. 5. 0.1 M glycine in PBS. 6. PBS-T, PBS containing 0.2% Triton X-100. 7. PBS-BSA, PBS containing 3% BSA. 8. 1 μg/ml DAPI in PBS. 9. Mounting reagent (e.g., glycergel or ProLong (Thermo Fisher Scientific)). 10. Clean microscope slides. 11. Fluorescence microscope.

microscope

or

confocal

2.4 Analysis of HSV1 Amplicon VectorEncoded Heterologous Virus-Like Particles

1. DMEM supplemented with 2% and 10% FBS.

2.4.1 Infection of Cells with HSV-1 Amplicon Vectors and Harvesting of Virus-Like Particles

5. 20-ml disposable syringe.

laser-scanning

2. Cell scraper. 3. Liquid N2. 4. 0.45 μm syringe-tip polyethersulfone membrane filters. 6. Beckman Ultra-Clear centrifuge tubes (14
95 mm). 7. 10% sucrose in PBS. 8. Ultraspeed centrifuge equipped with rotor (SW40 rotor or equivalent). 9. Protease inhibitor cocktail tablets complete, EDTA-free.

2.4.2 Negative Stain Electron Microscopy

1. 2% phosphotungstic acid (PTA) in ddH2O, pH 7.0, store at 4  C. 2. 300 mesh/in. copper grids covered with carbon-coated Parlodion film. 3. Transmission electron microscope equipped with a camera. 4. Glow discharger.

2.4.3 Immunoelectron Microscopy

1. 300 mesh/in. copper grids covered with carbon-coated Parlodion film. 2. PBS-BSA/0.1%, PBS containing 0.1% BSA.

116

Anita F. Meier and Andrea S. Laimbacher

3. Secondary antibody, coupled to colloidal gold particles (e.g., 12 nm). 4. 2% PTA, pH 7.0, in ddH2O. 5. Transmission electron microscope equipped with a camera. 2.5

Immunization

2.5.1 IgG ELISA

1. ELISA 96 microwell plate. 2. Coating buffer (carbonate-bicarbonate buffer): Add 800 ml of H2O into a glass beaker and add 1.59 g of Na2CO3 and 2.93 g of NaHCO3. Mix on a magnetic stirrer. Add H2O to 1 l, and sterilize by autoclaving. Store at room temperature. 3. Concentrated or purified antigen. 4. Humidified chamber. 5. PBS-T: PBS containing 0.05% Tween20. 6. Dilution buffer: PBS containing 0.05% Tween20 and 1% (m/v) casein. 7. HRP conjugated anti-IgG detection antibody. 8. Peroxidase (HRP) substrate. 9. Stop solution: 2 M H2SO4. 10. ELISA microplate reader.

3

Methods

3.1 Preparation of HSV-1 BAC DNA

The entire HSV-1 genome (with the pac signals deleted) has been cloned as a bacterial artificial chromosome (BAC) in E. coli [11]. The pac-deleted HSV-1 BAC DNA can provide all the functions required for supporting the replication and packaging of HSV-1 amplicon vectors but cannot be packaged itself because of the absence of packaging signals. To further improve safety, an essential HSV-1 gene (ICP27) was deleted from the BAC-cloned pac-deleted HSV-1 genome and is provided in trans from a separate plasmid [9]. HSV-1 amplicon vector stocks produced with this method are essentially free of helpervirus contamination [9].

3.2 Extraction of HSV-1 BAC DNA

1. Prepare a 17
100-mm sterile snap-cap tube containing 6 ml sterile LB/chloramphenicol medium. Inoculate with a loop of frozen long-term culture of the HSV-1 BAC clone. Incubate for 8 h at 37  C in a shaker. 2. Transfer 1.5 ml of the culture from step 1 into each of four 2-l Erlenmeyer flasks containing 1000 ml of sterile LB/chloramphenicol and incubate for 12–16 h at 37  C, with shaking. 3. Place 1-ml aliquots of the bacterial culture from step 2 into each of two cryogenic storage vials and add 70 μl of DMSO to

Genetic Vaccine

117

each. Mix well and freeze at 80  C for long-term storage (up to several years). 4. Distribute the 4 l of overnight culture from step 2 into six 250-ml polypropylene centrifuge tubes and centrifuge for 10 min at 4000
g (5000 rpm in a Sorvall GSA rotor), 4  C. 5. Decant the medium, fill polypropylene centrifuge tubes again with bacterial culture and repeat centrifugation. 6. After the last centrifugation, invert each tube on a paper towel for 1–2 min to drain all liquid. 7. Resuspend each pellet in 5 ml of buffer P1 and combine the six aliquots (see Note 1). 8. Add 130 ml of buffer P1 and distribute to four fresh 250 ml polypropylene centrifuge tubes (40 ml per tube). 9. Add 40 ml of buffer P2 to each centrifuge tube, mix by inverting the tubes four to six times, and incubate 5 min at room temperature. 10. Add 40 ml of buffer P3 and mix immediately by inverting the tubes six times. Incubate the tubes for 20 min on ice. 11. Invert the tube once more and centrifuge for 30 min at 16,000
g (10,000 rpm in a Sorvall GSA rotor), 4  C. 12. Filter the supernatants through a folded filter (120 mm diameter) into four fresh 250 ml polypropylene centrifuge tubes. 13. Precipitate the DNA with 0.7 volumes (84 ml per tube) of isopropanol, mix gently, and centrifuge immediately for 30 min at 17,000
g (11,000 rpm in a Sorvall GSA rotor), 4  C. 14. Carefully remove the supernatants and mark the locations of the pellet. Wash the DNA pellet by adding 20 ml of cold 70% ethanol to each tube and centrifuge for 15 min at 16,000
g (10,000 rpm in a Sorvall GSA rotor), 4  C. 15. Carefully remove the supernatants and resuspend each of the four pellets in 2 ml of TE buffer, pH 7.4. Pool the four solutions (total volume 8 ml) and add 52 ml of QGT buffer (final volume 60 ml). 16. Equilibrate two Qiagen-tip 500 columns with 10 ml of buffer QBT and allow the columns to empty by gravity flow. 17. Transfer the solution from step 15 through a folded filter (120 mm diameter) into the Qiagen-tip 500 columns (30 ml per column) and allow the liquid to enter the resin by gravity flow. 18. Wash each column twice with 30 ml of buffer QC and then elute DNA from each column with 15 ml of prewarmed (65  C) buffer QF into a 30 ml centrifuge tube.

118

Anita F. Meier and Andrea S. Laimbacher

19. Precipitate the DNA with 0.7 volumes (10.5 ml) of isopropanol, mix, and immediately centrifuge for 30 min at 20,000
g (13,000 rpm in a Sorvall SS-34 rotor), 4  C. 20. Carefully remove the supernatant and mark the locations of the pellets on the outside of the tubes. Wash the pellets with 5 ml of chilled 70% ethanol and, if necessary (if the pellet becomes detached), repellet at the same settings as in step 19. 21. Aspirate the supernatant completely but avoid drying the pellets. Resuspend each pellet in 3 ml of TE buffer (pH 7.4) and incubate for several hours at 37  C. Avoid pipetting the DNA up and down as this can cause shearing of the DNA. 3.2.1 Purification of HSV1 BAC DNA

1. Prepare two Beckman Ultra-Clear 13
51-mm centrifuge tubes containing 3 g CsCl and add the DNA solution from Subheading 3.2, step 21 (3 ml per tube). Mix gently until dissolved. Add 300 μl of 10 mg/ml ethidium bromide to the DNA/CsCl solution. Then overlay the solution with 300 μl of paraffin oil and seal the tubes. 2. Centrifuge for 17 h at 218,500
g (48,000 rpm in a Sorvall TV 865 ultracentrifuge rotor), 20  C. 3. Two bands of DNA located in the center of the gradient should be visible in normal light (see Note 2). 4. Harvest the lower band under UV-light using a disposable 1-ml syringe fitted with a 21-gauge hypodermic needle and transfer into a microcentrifuge tube. 5. Combine equal volumes of n-butanol and TE/CsCl solution. Add one volume of the CsCl saturated n-butanol (the upper phase) to one volume of the harvested DNA to remove ethidium bromide. 6. Mix the two phases by vortexing and centrifuge for 3 min at 250
g, room temperature, in a benchtop centrifuge. 7. Carefully transfer the lower, aqueous phase to a fresh microcentrifuge tube. 8. Repeat steps 5–7 four to six times until all the pink color disappears from both the aqueous phase and the organic phase. 9. Add an equal volume of isopropanol, mix and centrifuge at 250
g for 3 min at room temperature. 10. Transfer the aqueous phase to a fresh microcentrifuge tube. 11. For dialysis, inject the DNA solution into a dialysis cassette using a 1-ml disposable syringe fitted with a 36-gauge hypodermic needle. Dialyze for 6 h against TE, pH 7.4 at 4  C. Then, change the TE buffer and dialyze overnight to remove all CsCl from the DNA solution.

Genetic Vaccine

119

12. Recover the DNA solution from the dialysis cassette using a fresh 1-ml disposable syringe fitted with a 36-gauge hypodermic needle and transfer to a clean microcentrifuge tube. 13. The DNA solution can be stored up to several months at 4  C. 3.2.2 Characterization of HSV-1 BAC DNA

Recombination events and deletion of sequences from HSV-1 BAC clones may occur during amplification in bacteria. Therefore, isolated DNA should be analyzed before it is used for the preparation of amplicon vector stocks. The HSV-1 genome has been sequenced (strain 17 [12]); restriction patterns can therefore be predicted and used for characterization of the HSV-1 BAC DNA. 1. Determine the absorbance of the DNA solution from Subheading 3.2.1, step 13 at 260 nm (A260) and 280 nm (A280) using a UV spectrophotometer. 2. Verify the HSV-1 BAC DNA by restriction endonuclease analysis (e.g., HindIII, KpnI). 3. Separate the fragments by overnight electrophoresis in a 0.4% agarose gel at 40 V in TAE electrophoresis buffer, using highmolecular-weight DNA and 1-kb DNA ladders as size standards. 4. Stain with ethidium bromide (1 mg/ml in H2O) and compare restriction fragment patterns with the published HSV-1 sequence [12].

3.3 Production of HSV-1 Amplicon Vector Stocks (See Notes 3 and 4)

3.3.1 Preparation of Cells for Transfection

To facilitate titration, it is convenient to include a gene encoding an autofluorescent protein, such as enhanced green fluorescent protein (EGFP), in the polycistronic HSV-1 amplicon vectors. In addition, the vectors express individual or multiple other transgenes of interest. For example, the polycistronic HSV-1 amplicon vector plasmid pHSVT[VP7/6/2] (Fig. 1) contains three IRES signals between the HSV-1 immediate-early (IE) 4/5 promoter and the SV40 polyadenylation signal and allows the efficient expression of up to four different transgenes. It might be beneficial to optimize the transgene cassette to the specific codon usage of the target species. To package HSV-1 amplicon vectors into HSV-1 particles, cells (e.g., Vero 2-2) are co-transfected with amplicon DNA, the ICP27and pac-deleted HSV-1 BAC helper DNA, and a plasmid that encodes ICP27 by cationic liposome-mediated transfection using Lipofectamine and Plus reagent. Amplicon vector particles are harvested 2–3 days after transfection and, if desired, concentrated. 1. Maintain Vero 2-2 cells in DMEM–10% FBS containing 500 μg/ml G418. Propagate the culture twice a week by splitting ~1/5 in fresh medium (10 ml) into a new 75-cm2 tissue culture flask.

120

Anita F. Meier and Andrea S. Laimbacher

Fig. 1 Schematic representation of the polycistronic HSV-1 amplicon vector pHSVT[VP7/6/2]. This vector encodes the three main structural proteins VP2, VP6 and VP7 of rotavirus. Polycistronic expression is facilitated by two picornavirus IRES and an encephalomyocarditis virus (EMCV) derived IRES, and controlled by the HSV-1 IE4/5 promoter. The EGFP reporter gene facilitates titration of vector stocks. The HSV-1 origin of DNA replication (oriS) and packaging/cleavage signal (pac), as well as the SV40 polyadenylation signal are indicated

2. On the day before transfection, aspirate culture medium, wash each plate with 5 ml PBS, add 2 ml of trypsin–EDTA, and incubate for 10 min at 37  C to allow cells to detach from plate. Resuspend cells in fresh DMEM–10% FBS. 3. Count cells using a hemacytometer and plate 1.2
106 cells per 60-mm diameter tissue culture dish in 3 ml of DMEM–10% FBS. Incubate cells at 37  C and 5% CO2. 3.3.2 Transfection

1. For each 60-mm cell culture dish to be transfected, place 250 μl of Opti-MEM I reduced-serum medium into each of two 15-ml conical tubes. A maximum of six dishes can conveniently be manipulated at once. 2. To one tube add 0.4 μg of amplicon DNA and 2 μg of the HSV-1 BAC DNA from Subheading 3.1 and 0.2 μg of pEBHICP27 DNA (see Note 5). 3. Mix the tube (flipping) and slowly add 10 μl of Plus reagent. Incubate for 5 min at room temperature, then mix the tube (flipping) and incubate again for 5 min. 4. To the other tube add 15 μl of Lipofectamine. 5. Combine the contents of the two tubes. Mix well (without vortexing) and incubate for 30–45 min at room temperature. 6. Wash the cultures prepared the day before (Subheading 3.3.1) once by adding 2 ml of Opti-MEM I, swirl the plate, and aspirate the medium. 7. Add 1 ml of Opti-MEM I to the tube from step 5 containing the DNA-Lipofectamine transfection mixture (1.5 ml total volume). 8. Aspirate all medium from the culture, add the transfection mixture, and incubate for 4 h at 37  C and 5% CO2.

Genetic Vaccine

121

9. Aspirate the transfection mixture and wash the cells three times with 2 ml of Opti-MEM I, as described in step 6. 10. After aspirating the last wash, add 3 ml of DMEM–6% FBS and incubate cells for 2–3 days at 37  C and 5% CO2. 3.3.3 Harvesting of Vector Particles

1. Scrape cells from Subheading 3.3.2, step 10 into the medium using a cell scraper. Transfer the suspension to a 15-ml conical centrifuge tube. 2. Perform three freeze–thaw cycles using liquid nitrogen and a 37  C water bath. The suspensions should not be left at 37  C any longer than necessary for thawing. They can, however, be kept frozen for extended periods. 3. Place the tube containing the cells into a beaker containing ice water. Submerge the tip of the sonicator probe ~0.5 cm into the cell suspension and sonicate 20 s with 20% output energy (see Note 6). 4. Remove cell debris by centrifuging for 10 min at 1400
g, 4  C. 5. Filter the supernatant through a 0.45-μm syringe-tip filter attached to a 20-ml disposable syringe into a new 15-ml conical tube. Remove a sample for titration (see Note 3). 6. Divide the remaining stock into 1-ml aliquots, freeze in liquid nitrogen, and store up to 6 months at 80  C. 7. Alternatively, concentrate the stock before storage as described in Subheading 3.3.4.

3.3.4 Concentration of Vector Stocks

For immunization of mice, vector stocks are purified and concentrated by centrifugation. 1. Add 15 ml of 25% sucrose in a Beckman Ultra-Clear 25
89mm centrifuge tube. 2. Carefully add the vector stock from Subheading 3.3.3, step 5 (up to 20 ml) on top of the sucrose cushion and centrifuge for 3 h at 100,000
g, 16  C, using a Beckman SW28 rotor. 3. Aspirate the supernatant and resuspend the pellet in a small volume (e.g., 300 μl) of PBS. Remove a 10 μl sample of the stock for titration (see Note 3). 4. Divide the resuspended pellet into aliquots (e.g., 30 μl) and freeze in liquid nitrogen. Store up to 6 months at 80  C.

3.4 Characterization of Polycistronic HSV-1 Amplicon Vectors

Immunofluorescence and Western analyses are performed to characterize the synthesis and subcellular localization of the transgene products upon infection of cells. For this, mammalian cells are infected with the amplicon vectors, and the transgene products are visualized using specific antibodies.

122

Anita F. Meier and Andrea S. Laimbacher

3.4.1 Western Blotting

1. Grow 1
105 cells (e.g., Vero 2-2) per well in 24-well tissue culture plates in 0.5 ml of DMEM–10% FBS. Incubate overnight at 37  C and 5% CO2. 2. Dilute the vector stocks in 250 μl of DMEM–2% FBS for a multiplicity of infection (MOI) of 1 transducing unit (TU) per cell. 3. Aspirate the growth medium and add the vector dilutions to the cells. Incubate for 1–2 h, then remove the inoculum. Add 0.5 ml of DMEM–2% FBS and incubate for 24 h at 37  C and 5% CO2. 4. Collect the growth medium in a microcentrifuge tube, wash the cells once with 200 μl of PBS, and collect the PBS in the same tube. 5. Trypsinize the cells with 100 μl of trypsin–EDTA per well and incubate for 5 min at 37  C. 6. Add 200 μl of DMEM–10% FBS, transfer cells to the tube of step 4, wash the well with 200 μl of PBS and transfer to the same tube. 7. Centrifuge samples for 2 min at maximum speed in a table top centrifuge, discard supernatant. 8. Add 25 μl of 1
protein loading buffer (PLB) and boil samples for 10 min. 9. The samples are now ready for Western analysis using standard protocols.

3.4.2 Immunofluorescence

1. Grow 0.8–1
105 cells (e.g., Vero 2-2) per well on 12 mm coverslips in 24-well tissue culture plates in 0.5 ml of DMEM–10% FBS. Incubate overnight at 37  C and 5% CO2. 2. Dilute the vector stocks in 250 μl of DMEM–2% FBS for a MOI of 1 TU per cell. 3. Aspirate the growth medium and add vector dilutions to the cells. Incubate for 1–2 h, then remove the inoculum. Add 0.5 ml of DMEM–2% FBS and incubate for 24 h at 37  C and 5% CO2. 4. Aspirate medium and wash the cells once with PBS. 5. Fix the cells with 3.7% of formaldehyde in PBS for 15 min at room temperature. 6. Stop fixation with 0.1 M glycine in PBS for a minimum of 5 min at room temperature. 7. Optional: store in PBS overnight at 4  C. 8. Permeabilize cells with PBS-T (0.2% Triton X-100 in PBS) for 15 min at room temperature. 9. Wash immediately with PBS.

Genetic Vaccine

123

10. Block with PBS-BSA (3% BSA in PBS) for a minimum of 15 min at room temperature. 11. Incubate with the primary antibody diluted in PBS-BSA for 1 h at room temperature. 12. Wash cells three times with PBS for 5 min at room temperature. 13. Incubate with secondary antibody diluted in PBS-BSA for 1 h at room temperature. 14. Wash three times for 5 min with PBS. 15. To stain nuclei, incubate cells for 15 min at room temperature with DAPI in PBS (1 μg/ml) and wash three times for 5 min with PBS. 16. Mount the coverslips onto microscope slides with mounting reagent and let it dry. 17. The samples are now ready to be analyzed by fluorescence microscopy. 3.5 Analysis of HSV1 Amplicon VectorEncoded Heterologous Virus-Like Particles 3.5.1 Infection of Cells with HSV-1 Amplicon Vectors and Harvesting of Virus-Like Particles

In order to examine the assembly of the vector encoded heterologous structural proteins into virus-like particles, cells are infected with amplicon vectors and, after 48 h, total cell lysates are harvested and concentrated. 1. Grow 1.2
106 cells (e.g., Vero 2-2) per 60-mm diameter tissue culture dish in 3 ml of DMEM–10% FBS. Incubate overnight at 37  C and 5% CO2. 2. Dilute the vector stocks from Subheading 3.3.3, step 6 or Subheading 3.3.4, step 4 in 1.5 ml of DMEM–2% FBS for a MOI of 2 TU per cell. 3. Aspirate the growth medium and add vector dilutions to the cell culture plates. Incubate for 1–2 h at 37  C and 5% CO2 and then remove the inoculum. Add 2 ml of DMEM–2% FBS and incubate for 2 days at 37  C and 5% CO2. 4. Scrape cells into the medium using a cell scraper. Transfer the suspension into a 15-ml conical centrifuge tube. 5. Perform three freeze–thaw cycles using liquid nitrogen and a 37  C water bath. 6. Remove cell debris by centrifugation for 10 min at 1400
g, 4  C. 7. Filter the supernatant through a 0.45-μm syringe-tip filter attached to a 20-ml disposable syringe into a new 15-ml conical tube. 8. Add 5 ml of 10% sucrose (in PBS) to a Beckman Ultra-Clear 14
95-mm centrifuge tube.

124

Anita F. Meier and Andrea S. Laimbacher

Fig. 2 Electron photomicrographs of HSV-1 amplicon vector encoded rotavirus-like particles (RVLPs). Two days after infection, RVLPs were purified over a sucrose cushion and the concentrated particles were analyzed by electron microscopy. (a) Negative staining of RVLPs from Vero 2-2 cells infected with the polycistronic HSV-1 amplicon vector pHSVT[VP7/6/2]. (b) Immunogold staining of the same sample of RVLPs as in (a) using a polyclonal anti-rotavirus serum and a secondary antibody coupled to 12 nm colloidal gold particles. Scale bars ¼ 100 nm. (Photomicrographs by A. Laimbacher and E. Schraner, University of Zurich, Switzerland)

9. Carefully transfer the filtrate from step 4 on top of the sucrose cushion and centrifuge for 2 h at 100,000
g, 16  C, using a Beckman SW40 rotor. 10. Carefully aspirate the supernatant and resuspend the pellet in a small volume (e.g. 40 μl) of PBS (see Note 7). 11. Store the suspension containing the VLPs at 4  C. The pelleted VLPs are observed with a transmission electron microscope either by negative stain electron microscopy (Subheading 3.5.2) or by immune electron microscopy (Subheading 3.5.3) (Fig. 2). To further characterize the VLPs, Western analysis of the same concentrated samples as used for electron microscopy may be performed (see Note 8). 3.5.2 Negative Stain Electron Microscopy

Negative staining requires heavy metal salts to enhance contrast. Electron dense heavy metal salts surround small particles so that these appear as electron lucent structures. It is a simple and direct technique to examine virus morphology. 1. Place a drop (approx. 10 μl) of the resuspended virions or VLPs from Subheading 3.5.1, step 11, a drop of ddH2O, and a drop of 2% phosphotungstic acid (PTA) on a strip of Parafilm mounted on a smooth surface. 2. Place the grid (carbon-coated Parlodion film mounted on a 300 mesh/in. copper grid, glow discharged) with the carboncoated side down on top of the sample drop for up to 10 min (see Notes 9 and 10).

Genetic Vaccine

125

3. Remove the grid and wash once to several times (depending on the probe) by placing it on top of the ddH2O drop. 4. Place the grid onto the drop of 2% PTA, pH 7.0, for 1 min (see Note 11). 5. Remove excess PTA carefully with Whatman filter paper and let the grid dry for a few minutes on a labeled piece of Whatman filter paper. Important: do not remove any fluid at the end of steps 2–4. 6. The specimen can now be examined by electron microscopy and photographed. 3.5.3 Immunoelectron Microscopy

The immunogold technique allows identification of the examined sample with a specific primary antibody and a secondary antibody coupled to colloidal gold particles. 1. Place a drop of the resuspended VLPs from Subheading 3.5.1, step 11 onto a strip of Parafilm. 2. Place the grid (carbon-coated Parlodion films mounted on a 300 mesh/in. copper grid, glow discharged) with the carboncoated side down on top of the sample drop and let the sample adsorb to the Parlodion film for 10 min. 3. Block the sample by placing the grid for 10 min on top of a drop of PBS containing 0.1% BSA (PBS-BSA/0.1%). 4. Incubate with the primary antibody (specific for the structural virus proteins) by placing the grid for 1 h on top of a drop containing the primary antibody diluted in PBS-BSA/0.1%. 5. Wash several times by placing the grid on drops of PBS-BSA/0.1%. 6. Incubate with the secondary antibody coupled to colloidal gold particles (e.g., 12 nm), by placing the grid for 1 h on top of a drop containing the secondary antibody diluted in PBS-BSA/0.1%. 7. Wash several times by placing the grid on drops of PBS and ddH2O. 8. Continue with the protocol for negative staining, Subheading 3.5.2, steps 4–6.

3.6 HSV-1 Amplicon Vectors for Immunization

HSV-1 amplicon vectors used for immunization of mice are concentrated by centrifugation (see Subheading 3.3.4). There is no need to add any adjuvant for immunization. For results from immunization experiments using polycistronic HSV-1 amplicon vectors, see refs. 6, 7 (rotavirus) and 5 (foot-and-mouth disease virus).

126

Anita F. Meier and Andrea S. Laimbacher

3.6.1 Immunization of Mice and Sample Collection

Routes of injection include: intraperitoneal (i.p.), intranasal (i.n.), intramuscular (i.m.), and subcutaneous (s.c.) [5–7, 13]. The choice of the route of injection may be based on a pilot experiment in which the most efficient induction of immune responses is determined. For example, mice can be inoculated (i.m.) in a prime–boost regimen with 5
105 TU or 1
106 TU of amplicon vectors. Samples (e.g., serum, feces) may be collected on days 0, 21, and 42 after the first immunization. More frequent serum collection can be performed using microcapillary tubes on tail punctuation for minimal invasion.

3.6.2 Analysis of Antibody Response

The analysis of the immune response depends on the model. We propose to determine the antibody titers in the serum or stool samples by ELISA. If desired, further characterization of the antibody specificity by Western blotting or immunofluorescence is recommended.

3.6.3 IgG ELISA for Serum Samples

The ELISA protocol for IgG antibodies in sera can be adjusted to other isotypes by using different secondary antibodies. Analysis of antibodies in other sample types (e.g., feces, milk) might require the adjustment of the blocking agent. For further protocols see ref. 13. 1. Appropriately dilute the antigen solution in coating buffer (e.g., 1:100 for virus stocks concentrated over a sucrose cushion or 1:10 for CsCl gradient purified virus). Add 0.1 ml of the dilution to each well of an ELISA 96 microwell plate. Incubate the plate in a humidified chamber for 1 h at room temperature or overnight at 4  C. Remove the solution and wash the wells three times with PBS-T. 2. Appropriately dilute the samples and controls in dilution buffer. Ideal sample concentrations should be evaluated beforehand (with a range of 1:100 to 1:10,000 to start with). Apply 0.1 ml of the diluted samples into each well and incubate for 1 h at 37  C in a humidified chamber. Remove the solution and wash the wells three times with PBS-T. 3. Dilute the HRP conjugated detection antibody in dilution buffer to an appropriate concentration (e.g., 1:4000). The optimal dilution should be determined using a titration assay. Apply 0.1 ml of the diluted detection antibody and incubate for 1 h at 37  C in a humidified chamber. Remove the solution and wash the wells three times with PBS-T. 4. Add 0.1 ml of the freshly prepared substrate to each well. Allow the color to develop for 15–30 min and measure the absorption at λ ¼ 650 nm in a microplate reader before stopping the reaction. Do not allow the signal to exceed the optical density (O.D) of 0.6. Otherwise the substrate will form precipitates

Genetic Vaccine

127

after addition of the stop solution. Stop the reaction by adding 0.1 ml stop solution. Allow the reaction to develop for 10 min and measure the plate at λ ¼ 450 nm (see Note 12). 3.6.4 Challenge Infection and Analysis of Protection

4

To evaluate the efficiency of the developed vaccine, challenge experiments are usually performed assessing the protection from infection or, depending on the model used, protection from disease symptoms. For rotavirus there are different strategies to test the efficacy of a rotavirus vaccine candidate. In all species, including human and mice, rotavirus infection in adults is usually asymptomatic. In adult mice, protection against rotavirus infection can be measured by reduction of fecal virus shedding after oral challenge (adult mouse model) [6]. Protection is defined as the absence of detectable fecal viral antigen following challenge and partial protection is defined as reduced quantities of fecal viral antigen compared to that shed by control-inoculated mice [14, 15]. Therefore, virus antigen shedding curves (absorbance versus days postchallenge) of each animal are plotted and the area under the shedding curve for each animal calculated and compared to that of a control group [16]. Similar to human babies and in contrast to adult humans and mice, newborn mice develop severe diarrhea upon rotavirus infection. The immune system of newborn mice and humans is not fully mature, thus it is unlikely to elicit a protective immune response during the short time period of rotavirus disease susceptibility. This makes the vaccination-based protection of newborn a difficult task. Alternatively, protection in newborn mice might be induced by immunization of mothers resulting in the protective transfer of their antibody repertoire to the offspring. This mouse maternal antibody model represents an alternative to the adult mouse model. For example, HSV-1 amplicon vectors encoding rotavirus proteins can be administered intramuscularly to pregnant mice. The antibody titers are then analyzed in sera as well as in milk samples of vaccinated dams and also in sera of their offspring using ELISA [7].

Notes 1. Buffers P1, P2, P3, QBT, QC, and QF are components of the Qiagen Plasmid Maxi Kit. The BAC DNA extraction procedure uses a modified Qiagen-tip 500 protocol. 2. The upper band, which usually contains less material, consists of linear and nicked circular HSV-1 BAC DNA. The lower band consists of closed circular HSV-1 BAC DNA. 3. Titration of HSV-1 amplicon vector stocks: To determine the concentration of infectious vector particles in an amplicon

128

Anita F. Meier and Andrea S. Laimbacher

vector stock, cells are infected with samples collected from stocks either before or after concentration. Cells expressing the transgene are counted 24–48 h after infection to calculate the titer (transducing units per milliliter, TU/ml). Titers expressed in TU/ml are relative and do not necessarily reflect numbers of infectious vector particles per milliliter. It is convenient to include a reporter gene that encodes an autofluorescent protein, such as EGFP, to facilitate titration using a fluorescent microscope. EGFP is an ideal reporter as its fluorescence is independent of substrates or cofactors, and transfection and packaging efficiencies can be monitored in live cell cultures during the entire course of the packaging process. Alternatively, vector-infected cells can be stained using transgene product-specific antibodies. The vector titers should be in the range of 106–107 TU/ml before concentration. The recovery of transducing units after concentration should be ~50% if the titer of the crude vector stock was >106 TU, and ~10–20% if the titer was 99.5%) over the infectious virions. 17. As an alternative to a fluorochrome-conjugated antibody directed against the transgene product, it is possible to use a primary antibody directed to the antigen of interest, followed by a fluorochrome-conjugated secondary antibody. The optimal working antibody concentrations must be determined by the operator.

Acknowledgments This work was supported by European Research Council (ERC) Advanced Grant number 340060, VII framework program to G. C.-F., by RFO (University of Bologna) to L.M. and T.G, and by Fondi Pallotti to T.G. Competing interests: G.C.-F. owns shares in Nouscom Srl. B.P. is currently an employee of Nouscom Srl. G.C.-F. and L.M. receive equity payments from Amgen. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. References 1. Menotti L, Avitabile E, Gatta V, Malatesta P, Petrovic B, Campadelli-Fiume G (2018) HSV as A platform for the generation of retargeted, armed, and reporter-expressing oncolytic viruses. Viruses 10:pii:E352 2. Peng T, Ponce de Leon M, Novotny MJ, Jiang H, Lambris JD, Dubin G, Spear PG, Cohen GH, Eisenberg RJ (1998) Structural and antigenic analysis of a truncated form of the herpes simplex virus glycoprotein gH-gL complex. J Virol 72:6092–6103 3. Leoni V, Vannini A, Gatta V, Rambaldi J, Sanapo M, Barboni C, Zaghini A, Nanni P,

Lollini PL, Casiraghi C, Campadelli-Fiume G (2018) A fully-virulent retargeted oncolytic HSV armed with IL-12 elicits local immunity and vaccine therapy towards distant tumors. PLoS Pathog 14:e1007209 4. Menotti L, Cerretani A, Hengel H, CampadelliFiume G (2008) Construction of a fully retargeted herpes simplex virus 1 recombinant capable of entering cells solely via human epidermal growth factor receptor 2. J Virol 20:10153–10161

Chapter 9 CRISPR/Cas9-Based Genome Editing of HSV Thilaga Velusamy, Anjali Gowripalan, and David C. Tscharke Abstract The CRISPR/Cas9 gene editing system is a robust and versatile technology that has revolutionized our capacity for genome engineering and is applicable in a wide range of organisms, including large dsDNA viruses. Here we provide an efficient methodology that can be used both for marker-based and for markerfree CRISPR/Cas9-mediated editing of the HSV-1 genome. In our method, Cas9, guide RNAs and a homology-directed repair template are provided to cells by cotransection of plasmids, followed by introduction of the HSV genome by infection. This method offers a great deal of flexibility, facilitating editing of the HSV genome that spans the range from individual nucleotide changes to large deletions and insertions. Key words CRISPR/Cas9, Herpes simplex virus, Genome editing, Recombinant viruses, Homology-directed repair

1

Introduction The advent of molecular cloning and genetic engineering technologies has greatly accelerated basic biological research into herpes simplex viruses (HSV). Until now, a variety of emerging technical methods, including RNA interference, gene knockout, and heterologous gene expression technologies, have been tailored to investigate HSV pathogenesis and exploit HSV as a possible recombinant gene-delivery system. In addition, with the advent of high-throughput sequencing technologies, the availability of sequenced genomes of various HSV-1 strains has also continued to expand, revealing the existence of various uncharacterized HSV-1 genes and highlighting novel complexities in the organization of HSV-1 genomes. These advancements provide great opportunities for understanding functional interactions between different viral proteins, small noncoding RNAs and the viral genome itself, as well as gaining further insights into the virus–host relationship. However, although conventional methods are able to modify target HSV genes, the editing efficiencies of these methods are relatively low [1, 2]. As a consequence, small changes are difficult, if not

Russell J. Diefenbach and Cornel Fraefel (eds.), Herpes Simplex Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2060, https://doi.org/10.1007/978-1-4939-9814-2_9, © Springer Science+Business Media, LLC, part of Springer Nature 2020

169

170

Thilaga Velusamy et al.

impossible unless accompanied by a marker gene and that is rarely desirable. Further, screening for recombinants in a large background of nonrecombinant parent virus is laborious and purification can take many rounds of plaque selection. Recently, unparalleled advancements in genome engineering technology have greatly improved the efficiency of generating recombinant organisms, including HSV [3, 4]. Among these technologies is the CRISPR/Cas system, where CRISPR and Cas are acronyms for “clustered regularly interspaced palindromic repeats” and “CRISPR-associated (Cas) proteins,” respectively. The most widely used variant of this technology is based on the type II CRISPR system from Streptococcus pyogenes [5, 6]. This adapted bacterial system consists of a single chimeric-guide RNA (sgRNA) and the Cas9 nuclease. The sgRNA combines the function of two smaller RNAs from the original bacterial system, namely the targetrecognizing CRISPR RNA (crRNA) and the auxiliary transactivating crRNA (tracrRNA), which facilitates binding to the Cas9 protein. Following sgRNA binding, Cas9 catalyzes a double-stranded break in the target genome [6, 7]. The location of this break is conferred by complementarity between the crRNA portion of the sgRNA and the target genome [7]. As sgRNA sequences can be chosen with relatively few constraints, the sgRNA-Cas9 complex is considered a programmable, sequenceguided nuclease. CRISPR/Cas9-mediated events take place inside intact cells, allowing the Cas9-mediated genome break to be repaired by cellular repair mechanisms, such as nonhomologous end joining or homology directed repair (HDR) [8–11]. Nonhomologous end joining can introduce insertions or deletions at the target site and so is useful for creating gene knockouts (generally through changes to the reading frame). However, provision of a DNA fragment with homology to the region spanning the Cas9 cut site allows cells to repair the break using homologous recombination. This method enables targeted changes to a genome to be made [12]. It is this second repair method that we have found most useful for creating HSVs for our research. In the CRISPR/Cas9 context, concurrent expression of a Cas9 gene that has been engineered to include a nuclear localization signal and sgRNAs are essential for genome editing. The method described in this chapter makes use of a plasmid that simultaneously expresses Cas9 and an sgRNA. This plasmid allows the insertion of a 20-nucleotide sequence that becomes part of the sgRNA when transcribed by a Polymerase III promoter and will guide Cas9 to the desired location in the HSV genome. Cotransfection of 293A cells with this CRISPR plasmid and a template for HDR, followed by infection of transfected cells using HSV-1 that provides genomic backbone for recombination, results in precise editing of the HSV-1 genome [3]. This method can be used for accurate

CRISPR/Cas9-Based Editing of HSV

171

modification of short nucleotide sequences, as well as insertion, replacement or deletion of genes or large DNA fragments in the HSV-1 genome. Finally due to the high efficiency of the method, screening of recombinant viruses can be performed using a polymerase chain reaction (PCR), circumventing the need for introducing a marker gene for selection or screening. In the protocol that follows, we describe our entire approach, from the standard molecular biology tasks required to make the vectors needed for CRISPR/Cas9 engineering to the screening of recombinants. We expect most readers will dip in for the CRISPR/ Cas9-specific details and bolster this protocol with their own preferred methods.

2 2.1

Materials Reagents

1. Plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (hereafter pX330; Addgene plasmid # 42230) (see Note 1). 2. HSV-1, KOS strain (see Note 1). 3. 293A cells. This is a subclone of HEK-293 that retains a stably integrated copy of the Adenovirus E1 gene and can be purchased from a variety of commercial suppliers (see Note 1). 4. Vero cells (ATCC CCL-81). 5. Lipofectamine 2000® (Thermo Fisher Scientific™). 6. High fidelity DNA polymerase (e.g., Phusion High fidelity DNA polymerase; NEB). 7. Taq DNA polymerase with standard Taq buffer. 8. DNA markers (100 bp and 1.0 kb). 9. TAE electrophoresis buffer: 40 mM Trizma base, 20 mM glacial acetic acid, and 1 mM EDTA in H2O. 10. UltraPure™ Agarose (Life Technologies). 11. In-Fusion PCR cloning kit (Clontech). 12. Restriction enzyme BbsI with 10
buffer 2.1 (NEB). 13. T4 DNA ligase and 10
reaction buffer. 14. One Shot™ Stbl3™ chemically competent E. coli (Invitrogen). 15. PBS (Sigma-Aldrich). 16. LB medium: 10 g/L tryptone (Bacto), 5 g/L yeast extract (Bacto), 10 g/L sodium chloride in H2O. 17. LB Agar plates: 1.5% (w/v) agar (Bacto) in liquid LB medium. 18. Ampicillin, 100 mg/mL. 19. Gel extraction kit (e.g., Wizard SV Gel and PCR Cleanup System, Promega).

172

Thilaga Velusamy et al.

20. Plasmid Miniprep Kit (e.g., AxyPrep, Axygen). 21. 3 M Sodium Acetate solution (NaOAc), pH 5.2. 22. 100%, 70% ethanol. 23. Proteinase K. 24. Proteinase K DNA prep mix: 10 μg/mL of proteinase K in 1
ThermoPol PCR buffer (New England Biolabs). 2.2 Cell Culture Media

1. D0 medium: Dulbecco’s Modified Eagle Medium (DMEM), high glucose with phenol red and supplemented with 2 mM Lglutamine. We do not add antibiotics. 2. D2 medium: Heat-inactivated fetal bovine serum (FBS) is added at a concentration of 2% (v/v) to D0 medium. 3. D10 medium: 10% (v/v) heat-inactivated FBS in D0 medium. 4. M0 medium: MEM with phenol red, supplemented with 4 mM L-glutamine, 5 mM HEPES buffer and 50 μM β-mercaptoethanol. 5. M2 medium: Heat-inactivated FBS is added at a concentration of 2% (v/v) to M0. 6. CMC-MEM: 0.4% (w/v) carboxymethyl cellulose in M2 medium.

2.3

Equipment

1. Filtered sterile pipette tips. 2. 2 mL screw cap polypropylene tubes. 3. 0.5 μL PCR tubes. 4. 6- and 96-well tissue culture plates. 5. 25 and 75 cm2 tissue culture flasks. 6. Thermal cycler. 7. Desktop microcentrifuge. 8. Gel electrophoresis system. 9. GelDoc Ez™ digital gel imaging system (Bio-Rad), for standard visualization of agarose gels. 10. Blue-light transilluminator and protective orange filter goggles to visualize bands on agarose gels (Thermo Fisher Scientific), for visualization of agarose gels for purification of DNA fragments. 11. NanoDrop™ 2000c UV spectrophotometer to determine DNA concentration (Thermo Fisher Scientific). 12. Lightbox. 13. Laboratory water bath. 14. Shaking incubator. 15. Cell culture CO2 Incubator.

CRISPR/Cas9-Based Editing of HSV

173

16. Class II biosafety cabinet. 17. Water bath. 18. Heat block. 19. Hemocytometer for counting cells. 20. Inverted light microscope. 21. Parafilm®. 22. Flow cytometer (optional).

3

Methods

3.1 Constructing a Guide RNA and Cas9Expressing Plasmid

3.1.1 Design and Preparation of the Targeting Oligodinucleotide Guide

Use pX330 as a parent plasmid to construct a targeted CRISPR/ Cas9 system. It is a single expression vector with a cloning site at which DNA can be inserted into and driven by the U6 (Polymerase III) promoter. The inserted DNA will encode the desired guide RNA sequence. This vector also contains a human codonoptimized spCas9 gene with nuclear localization signals driven by the CBh promoter [7]. 1. Identify a place in the HSV genome with the sequence GG in close proximity to the desired genome modification site. If the 21 nucleotides upstream from this site have characteristics similar to a good PCR primer, this will form a suitable crRNA portion for the sgRNA sequence (see Note 2). Note that this sequence can be taken from either strand of the genome. The 20 nucleotides at the 50 end of this sequence should be added to the vector, with one further condition: If the 50 end is not a G, add an extra G to that end, which enhances the efficiency of the U6 promoter and gives you a 21 nucleotide sequence (see Fig. 1). 2. Once this 20 or 21 nucleotide sequence has been identified, purchase complementary oligodeoxynucleotides (oligos) that when annealed create a dsDNA carrying this sequence and have overhangs compatible for cloning into pX330 at the BbsI cut site. See Fig. 1 for an example. 3. Resuspend each oligo of the pair to a final concentration of 10 μM in H2O. Mix the complimentary oligos at the equimolar ratio, typically by mixing 10 μL of each oligo in a 0.5 μL PCR tube. Anneal the oligos by incubating the mixture at 95  C for 5 min in a heat block, followed by slow cooling at room temperature.

174

Thilaga Velusamy et al.

Fig. 1 Designing HSV-1 appropriate CRISPR/Cas9-associated guide sequences. (1) Choosing a target site and gRNA. Search the HSV-1 genome near the modification site for GG sequences (orange) and identify the 21 bp sequence 50 to this motif. Check that this sequence would make a good primer. The first 20 bp of this sequence is the template for the gRNA (purple), which needs to be inserted into a pX330 vector. Either strand of the HSV genome can be used. (2) Identify the overhangs left by BbsI digestion of the pX330 vector. (3) Design the dsDNA oligo. Append additional bases (blue) to the ends of each of the oligo such that once annealed there are appropriate overhangs for ligation. If not already present, a guanine (grey) can be appended to the 50 end of the 20 bp guide-encoding sequence to improve efficiency of the U6 promoter 3.1.2 Preparation of pX330 for Insertion of a Guide DNA Sequence

1. Digest the pX330 plasmid with BbsI. For this, mix together 2.5 μg of plasmid, 50 units of BbsI enzyme, 1
buffer 2.1, and H2O in a final volume of 125 μL. Gently mix and incubate the reaction mixture at 37  C overnight. 2. Subject the restriction enzyme reaction mix to separation by electrophoresis using a 1% (w/v) agarose gel. Visualize on a lightbox (avoid using a UV-based dye/lightbox combination if possible) and cut out a slice of gel containing the linearized plasmid DNA fragment. Purify the DNA from the gel slice using an appropriate gel purification kit and determine the purified DNA concentration. This purified BbsI cut-plasmid DNA can be stored at 20  C until further use. 3. Carry out a second round of restriction enzyme digestion of the previously cut and purified plasmid DNA to make sure that both BbsI sites in pX330 have been subjected to digestion (see Note 3). For this, mix 50 ng of the previously cut plasmid,

CRISPR/Cas9-Based Editing of HSV

175

1
buffer 2.1, 5 units of BbsI enzyme and H2O in a total volume of 20 μL. Gently mix and incubate the reaction mix at 37  C for 1 h. Use this reaction mix directly for ligation reactions. 3.1.3 Ligation of Guide DNA to Linearized pX330

1. Add 1 μL of annealed oligo mix (see Subheading 3.1.1), 1.5 μL of T4 DNA ligase enzyme and 2.5 μL of T4 DNA ligase buffer to the restriction enzyme reaction described in the previous step (see Subheading 3.1.2) to give a total reaction volume of 25 μL. Gently mix and incubate at 37  C for 1 h. 2. Additionally, set up a ligation without the annealed oligo to control for the presence of incompletely cut vector.

3.1.4 Transformation and Screening for pX330 Containing the Guide Insert

1. Typically, add 2 μL of the ligation mix to a vial of competent cells (e.g., One Shot™ Stbl3™ chemically competent E. coli). Mix the contents gently by flicking the tube or swirling using a sterile pipette (200 μL) tip. Incubate the cells on ice for 30 min, followed by 45 s of heat shock at 42  C in a water bath. Cool the tubes immediately on ice for 2 min with the subsequent addition of 1 mL of prewarmed LB medium. Incubate the tubes for a further 60 min in a shaking incubator set to 37  C and 250 rpm. 2. Spread 100 μL of each lot of transformed cells onto LB agar plates containing 100 μg/mL ampicillin and incubate overnight at 37  C. 3. The following day, screen colonies by PCR for those containing the desired plasmid. We simply emulsify a portion of a colony in H2O, heat kill the bacterial cells at 95  C for 2 min and briefly centrifuge to pellet the cell debris. We use 2 μL of the clear lysate as template in a standard PCR, marking the plate to allow identification. We use the oligo that formed the top strand of the annealed dsDNA fragment as a forward primer with a reverse primer that matches the vector (50 TAGATGTACTGCCAAGTAGGAA 30 ). 4. Culture the desired clone in 5 mL of LB broth with antibiotic overnight at 37  C in a shaking incubator. Following this, extract the plasmid DNA using a plasmid miniprep kit and verify the sequence of the DNA insert.

3.2 Longer DoubleStranded DNA Templates for HDR

Larger genetic modifications can be achieved through the generation of long double-stranded DNA templates. For insertion or deletion of sizeable DNA fragments into genomes, it is preferable to use double-stranded DNA templates with relatively long homologous arms, for instance, 500 bp each (see Fig. 2). We use the In-Fusion cloning system to stitch together the homology arms, desired DNA insert and vector backbone. This cloning system allows the insertion of multiple DNA fragments into a linearized

176

Thilaga Velusamy et al.

Fig. 2 HDR repair template design. Cas9 typically catalyzes double-stranded breaks in DNA 4–5 bp upstream of the GG motif (orange) and within the original target sequence (purple). Following cleavage, DNA is repaired by HDR mechanisms when a repair template is available. These templates can come in the form of (a) long dsDNA templates with large, 500 bp homology arms (teal), or (b) in the form of ssODN sequences when only small changes are required. Longer templates are generally provided in the form of linearized plasmids and are efficient for the introduction of large inserts or deletions. Note that the homology arms found within repair templates may contain portions of the original guide sequence and/or the GG motif. Insertions are shown in green. Ideally the homology arms will extend roughly equidistance from the expected cut site

vector based on 15 bp homologous overlapping segments in the adjacent fragments. The overlapping segments facilitate directional cloning of multiple fragments into the desired vector (see Note 4). 3.2.1 Generating an HDR Template Plasmid

1. Amplify the right and left homology arms and any new sequence to be inserted into the virus by PCR using a high fidelity DNA polymerase. It is also possible to obtain one or more of these chemically synthesized DNA fragments from a supplier. 2. Linearize a cloning vector of your choice by restriction enzyme digestion, using two enzymes can improve efficiency by reducing the amount of residual uncut plasmid. Using the In-Fusion PCR cloning kit (Clontech), clone the purified DNA fragments into the vector backbone. For this, mix 5
In-Fusion HD enzyme premix, linearized vector, purified PCR fragments,

CRISPR/Cas9-Based Editing of HSV

177

comprising the homologous recombination arms and desired insert, and H2O in a total volume of 10 μL. After gentle mixing incubate the reaction mix at 50  C for 15 min, before cooling and transforming into E. coli (as in Subheading 3.1.4). 3. Select the clones on an antibiotic-containing LB agar plate suitable for the vector. Screen the clones using a method appropriate for the size of the insert, grow plasmid minipreps and confirm the sequence. 3.2.2 Preparation of HDR Template for Transfection

1. The use of a linear HDR template is required for efficiency and to avoid the insertion of the entire plasmid via a single crossover into just one of the two homology arms. Chose a restriction enzyme that cuts in the plasmid backbone and digest the plasmid made in Subheading 3.2.1. Use a portion of the digestion reaction to test by agarose gel electrophoresis that cutting has been efficient. 2. Clean up the remaining digested plasmid by precipitation by adding 1/10 volume of 3 M NaOAC, pH 5.2, and two volumes of 100% ethanol. Mix by inversion, leave for at least 15 min at room temperature, then recover by centrifugation at top speed in a standard microcentrifuge for 20 min. Discard the supernatant and wash the pellet once with 500 μL of 70% ethanol before air drying, preferably in a class II biosafety cabinet or other clean environment. This method tends to produce better quality DNA for transfection at a good concentration than most silica-based commercial clean-up kits. 3. Resuspend the DNA in an appropriate volume of sterile H2O and determine the concentration of linearized plasmid DNA.

3.3 Single-Stranded Oligodeoxynucleotide (ssODN) Templates for HDR

For small edits in the HSV genome, ssODNs can be used as a HDR template (see Fig. 2). To design ssODNs, select homology arms of 40–90 nucleotides on either side of the desired modification and the CRISPR cut site. Either DNA strand can be chosen. We recommend using third-base codon redundancy to add a translationally silent restriction enzyme site in addition to the desired change because this greatly facilitates screening of possible recombinant viruses. Purchase the ssODNs directly from a preferred supplier and dilute to a final concentration of 10 μM. Use 2 μL of this solution per transfection reaction.

3.4 Transfection of 293A Cells

The key to the success of the method is achieving a very high transfection efficiency. We aim for >80% of the cells to be transfected. Untransfected cells allow the replication of unmodified parent HSV that contributes to the background from which recombinant viruses need to be identified and selected. We use Lipofectamine 2000® for transfection of 293A cells, but have no reason to think that other cells that support HSV replication or other

178

Thilaga Velusamy et al.

transfection reagents cannot be used, assuming equal transfection efficiency. The following steps are done in a class II biosafety cabinet and at room temperature unless specified otherwise. 1. Approximately 16–18 h prior to transfection seed a 6-well plate with 293A cells at a density of 5
105 cells per well in 2.0 mL D10 medium. Incubate the plate at 37  C and 5% CO2. On the day of transfection, cells should be 70–80% confluent, which is optimal for transfection efficiency (see Note 5). 2. (a) For long plasmid-based templates: Add equimolar amounts of pX330 with a guide inserted (from Subheading 3.1) and the linear HDR template plasmid (prepared in Subheading 3.2) to a 2 mL polypropylene tube labeled “A.” Do not use more than 3 μg of DNA in total to minimize the amount of Lipofectamine 2000® required and hence toxicity associated with this reagent. For each microgram of DNA, add M0 medium to a total volume of 60 μL and mix thoroughly by pipetting. (b) For short ssODN HDR templates, mix together 2 μL of 10 μM ssODN and 2 μg of CRISPR-Cas9-guideRNA plasmid in a total volume of 180 μL M0 medium, in a tube labeled “A” (see Note 6). 3. Work out the amount of Lipofectamine 2000® required based on the requirement for 2 μL of Lipofectamine 2000® for every 1 μg of DNA. Add the appropriate volume of Lipofectamine 2000® to a fresh 2 mL polypropylene tube marked “B” and then add 58 μL of M0 medium for each 2 μL of Lipofectamine 2000® and mix by gentle pipetting. Leave this mixture for 5 min. 4. Add the contents of the tube B to tube A and mix very gently by pipetting up and down slowly. Incubate this mixture for 20–25 min then gently dilute by the addition of M0 medium to a final volume of 0.5 mL. 5. Replace the medium of the 6-well plate of 293A cells with 0.5 mL of prewarmed M0 (see Note 7). Gently add the transfection mix dropwise to the appropriate well, rocking the plates to distribute the transfection mix evenly (see Note 8). Care must be taken to avoid detachment of 293A cells from the plate. Repeat the above steps for each transfection (see Note 9). 6. Incubate the cells with the transfection reagent for 5 h at 37  C and 5% CO2. 3.5 Infection of 293A Cells with HSV-1

1. Following transfection, remove the medium with transfection mix and replace it with 1 mL of M0 medium containing 1
104 PFU of HSV (to achieve approximately 0.01 PFU/cell). Incubate the cells for 2 h at 37  C and 5% CO2.

CRISPR/Cas9-Based Editing of HSV

179

2. Remove the virus inoculum and replace it with fresh, prewarmed M2 medium. Incubate at 37  C and 5% CO2 and after 3 days wash or scrape the cells into the medium and collect. This can be stored at 80  C if required. 3.6 Isolation of Recombinant Virus

1. Prepare 6-well plates of confluent Vero cells, one for each virus that you wish to isolate.

3.6.1 Collection of Recombinant Viruses (Plaque Picking)

2. Break the cells collected after the transfection/infection in Subheading 3.5 with three rapid freeze-thaw cycles then prepare 9 fivefold dilutions of each transfection-infection mix in a final volume of 1.5 mL M0 medium. 3. Replace the medium in the wells of the 6-well plate of Vero cells with 1 mL of the 54–59 dilutions prepared in the previous step and incubate for 2 h at 37  C and 5% CO2. 4. Replace this inoculum with 2 mL of CMC-MEM. Incubate the plate for 48 h at 37  C and 5% CO2. 5. Using an inverted microscope to visualize plaques, mark the location of 24 plaques on the base of the plate with an indelible marker, starting from the well with least plaques and choosing plaques that are well dispersed. If the recombinant virus includes a fluorescent or other marker for visual selection, use this as an additional guide to selection. 6. To collect virus from these plaques place the tip of a micropipette on the bottom of a well just above each mark and aspirate 10 μL of cells and medium, then eject it to 0.5 mL ice-cold D2 medium in a 2 mL polypropylene tube. Freeze and thaw three times. This mixture is referred to as a “plaque pick.”

3.6.2 Preparation of DNA for PCR Screening of Plaques

1. Prepare a 96-well plate of confluent Vero cells. 2. Remove the medium from wells of the 96-well plate containing confluent Vero cells and replace it with 75–100 μL of the appropriate plaque pick. Incubate the plate for 2 days at 37  C and 5% CO2. 3. After 2 days, discard the inoculum and wash the cells by adding 100 μL of PBS to each well. Remove the PBS and add 100 μL of proteinase K DNA prep mix. Seal the plate using Parafilm® and subject the plate to one freeze-thaw cycle. Then, remove the Parafilm® and incubate the plate at 56  C for 25 min followed by heat inactivation of proteinase K at 85  C for 15 min. 4. Subject the plate to centrifugation at 524
g for 10 min. 5. Use 2 μL of the supernatant as template for a standard PCR reaction. Perform PCR using a range of primers to confirm the presence of the recombinant virus, and for distinguishing between this and parent virus (see Notes 10 and 11).

180

Thilaga Velusamy et al.

3.6.3 Plaque Purification of Recombinant Viruses and Growing Stocks

1. There is almost always evidence of parent virus contamination in any plaque pick that contains the correct recombinant. Based on the relative intensity of recombinant virus- and parent virusspecific products on the gel, choose two or three plaques to further purify. 2. Use the relevant plaque picks as an inoculum for a new round of plaque picking and selection by PCR, as described in Subheadings 3.6.1 and 3.6.2, respectively. Use the 51–56 dilutions of a plaque pick. 3. Once a plaque pick shows no evidence of contamination with parent virus by PCR and there has been at least a total of three rounds of picking and selection, a recombinant virus can be deemed to be clean (see Note 12). 4. To grow a seed stock, use 400 μL of a plaque pick to seed a 25 cm2 culture flask with confluent Vero cells and harvest cells into the medium 72 h later. Collect the cells by centrifugation at 524
g for 10 min at 4  C, resuspend in 0.5 mL of M2 medium and freeze and thaw three times to release the virus. PCRs should be done on a sample from the seed stock to verify that it remains clear of contamination with parent virus. The sequence of the recombinant virus around the engineered region, taking care to extend beyond the homology arms used in the HDR template, should also be determined to ensure fidelity to the initial design. Restriction enzyme digests on the whole genome can be done to ensure there are no major rearrangements in the genome. 5. The seed stock can then be used to grow master stocks (typically using 100 μL of the seed to infect a 75 cm2 flask of Vero cells for 72 h). This stock should be titrated and then working stocks grown using large flasks or roller bottles, as desired and infecting them at low multiplicity as usual.

4

Notes 1. There are many similar plasmids to pX330 available, but we had almost immediate success with this one and found no reason to look further. Similarly, we have only used HSV-1 strain KOS and for our purposes 293A cells proved to be appropriate for this method. Other virus strains and cell lines including other subclones of HEK293 were not investigated. 2. Design the guide template such that Cas9 will cut in close proximity to the desired modification site in the genome. This is necessary so that a HDR template can be easily designed such that the two homology arms extend either side of both the cut site and the site to be modified. If a region of the genome is to be deleted, design the guide to cut within the sequences to

CRISPR/Cas9-Based Editing of HSV

181

be deleted. Others also have recommended that the distance between the HDR site and the double-stranded break site must be less than 100 bp for efficient recombination [13, 14]. Our experience is that sgRNA sequences with homopolymer runs and other features that work against good sequence-specific hybridization are to be avoided, but we have no formal or systematic evidence that this is the case. 3. The CRISPR-Cas9 plasmid pX330 has two BbsI recognition sites, both of which need to be cut by the enzyme for cloning of the annealed guide DNA oligos. We find this enzyme to be neither robust nor efficient and this is why we typically do two sequential digestions as described. If cloning remains a problem, choose a different supplier for this enzyme. 4. The designing of primers with appropriate overlapping sequences is vital for amplification of DNA fragments during In-Fusion® cloning. The user should refer to the In-Fusion® cloning manual for designing the overlapping primers. We recommend performing an additional in silico experiment, using a preferred cloning tool (example: Vector NTI), to verify the directionality of the inserts in a given vector. 5. It is critical to transfect the cells when they are sub-confluent, ideally 70–80% confluent, as it improves the efficiency of transfection. 6. When using ssODNs for the HDR template, the cells may dissociate and appear to reach full cytopathic effect within 48 h. In this case, the cells can be harvested before 3 days. Nucleofection is commonly recommended for transfection of ssODN, but we were able to isolate recombinant virus at an efficiency of 5–10% using Lipofectamine-mediated transfection. 7. The monolayer of 293A cells can easily dissociate from the plate if care is not taken while adding reagents or medium. Do not add cold medium or add medium directly to the cells, pipette liquids gently down the sides of the well. 8. It is important to add the transfection reagent in drops that are distributed across the well and to rock to mix every few drops. The best method is to expel most of a drop from the pipette, then touch it to the surface of the medium in the well just before it falls. When rocking the plate, avoid swirling as this will deposit the transfection mix in the middle of the well. 9. We perform transfections in duplicate so that we have two independently derived lineages of recombinant viruses in case there is a problem with one of these. When troubleshooting, we also recommend a full set of controls, including wells where (a) cells are transfected but not infected; (b) cells are infected and not transfected; and (c) cells are transfected with a plasmid

182

Thilaga Velusamy et al.

that encodes a fluorescent marker to test efficiency (there are pX330 variants with fluorescent markers, which make this control redundant). 10. It is possible to use the plaque picks themselves for PCR analysis, for example, by taking a sample and using this either directly as a template or after incubating with proteinase K first. This seems an attractive approach because it cuts out the extra two days to grow small cultures in 96 well plates. However we have found that the additional time taken to grow better samples for PCR analysis invariably pays off because the success of reactions on this material is very high (well above 90%), compared with direct analysis of plaque picks, which is highly variable. 11. When designing PCR primers for these analyses, remember that any sequence that is included in the HDR template may be derived from your plasmid and not from the viral genome. If insertions are large, it can be a good practice to verify that both ends of the insertion produce fragments of the expected size. To do this use sets of primers that make products extending from the viral genome (outside the extent of the homology flanks) into the foreign DNA that has been inserted on both sides of the insertion. Finally for small changes, including a restriction site (e.g., by third base redundancy) greatly facilitates screening as PCR products can be analyzed further by restriction enzyme digestion. 12. If an attempt at plaque purification produces plaques that have no evidence of purification (e.g., less of the correct virus and/or more apparent parental contamination than was seen in the previous round), it is generally best to abandon that entire line of viruses and start fresh from another plaque taken from the transfection mix.

Acknowledgments D.C.T. is supported by an NHMRC (Australia) fellowship (APP1104329) and project grants (APP1084342 and APP1126599). We thank Matthew Witney for reading the manuscript. References 1. Tanaka M, Kagawa H, Yamanashi Y, Sata T, Kawaguchi Y (2003) Construction of an excisable bacterial artificial chromosome containing a full-length infectious clone of herpes simplex virus type 1: viruses reconstituted from the clone exhibit wild-type properties in vitro and in vivo. J Virol 77:1382–1391

2. Ramachandran S, Knickelbein JE, Ferko C, Hendricks RL, Kinchington PR (2008) Development and pathogenic evaluation of recombinant herpes simplex virus type 1 expressing two fluorescent reporter genes from different lytic promoters. Virology 378:254–264

CRISPR/Cas9-Based Editing of HSV 3. Russell TA, Stefanovic T, Tscharke DC (2015) Engineering herpes simplex viruses by infection-transfection methods including recombination site targeting by CRISPR/ Cas9 nucleases. J Virol Methods 213:18–25 4. Lin C, Li H, Hao M, Xiong D, Luo Y, Huang C, Yuan Q, Zhang J, Xia N (2016) Increasing the efficiency of CRISPR/Cas9mediated precise genome editing of HSV-1 virus in human cells. Sci Rep 6:34531 5. Makarova KS, Wolf YI, Koonin EV (2013) The basic building blocks and evolution of CRISPR-Cas systems. Biochem Soc Trans 41:1392–1400 6. Mali P, Yang L, Esvelt KM, Aach J, Guell M, DiCarlo JE, Norville JE, Church GM (2013) RNA-guided human genome engineering via Cas9. Science 339:823–826 7. Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F (2013) Multiplex genome engineering using CRISPR/Cas systems. Science 339:819–823 8. van den Bosch M, Lohman PHM, Pastink A (2002) DNA double-strand break repair by

183

homologous recombination. Biol Chem 383:873–892 9. Pastwa E, Blasiak J (2003) Non-homologous DNA end joining. Acta Biochim Pol 50:891–908 10. Ceccaldi R, Rondinelli B, D’Andrea AD (2016) Repair pathway choices and consequences at the double-strand break. Trends Cell Biol 26:52–64 11. Jasin M, Haber JE (2016) The democratization of gene editing: Insights from site-specific cleavage and double-strand break repair. DNA Repair 44:6–16 12. Sander JD, Joung JK (2014) CRISPR-Cas systems for editing, regulating and targeting genomes. Nat Biotechnol 32:347–355 13. Elliott B, Richardson C, Winderbaum J, Nickoloff JA, Jasin M (1998) Gene conversion tracts from double-stranded break repair in mammalian cells. Mol Cell Biol 18:93–101 14. Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F (2013) Genome engineering using the CRISPR-Cas9 system. Nat Protoc 8:2281–2308

Chapter 10 Latent/Quiescent Herpes Simplex Virus 1 Genome Detection by Fluorescence In Situ Hybridization (FISH) Camille Cohen, Armelle Corpet, Mohamed Ali Maroui, Franceline Juillard, and Patrick Lomonte Abstract Fluorescence in situ hybridization (FISH) has been widely used to analyze genome loci at a single cell level in order to determine within a cell population potential discrepancies in their regulation according to the nuclear positioning. Latent herpes simplex virus 1 (HSV-1) genome remains as an episome in the nucleus of the infected neurons. Accordingly, depending on the location of the viral genomes in the nucleus, they could be targeted by different types of epigenetic regulations important for the establishment and stability of latency, and ultimately for the capacity of HSV-1 to reactivate. Therefore, it is important to take into consideration the interaction of the viral genomes with the nuclear environment to integrate this aspect in the overall set of physiological, immunological, and molecular data that have been produced, and which constitute the main knowledge regarding the biology of HSV-1. In this method chapter we describe in detail the procedure to perform FISH for the detection of HSV-1 genomes particularly during latency and also the combination of this approach with the detection of cellular and/or viral proteins. Key words Fluorescence in situ hybridization (FISH), Immunofluorescence, Herpesvirus, HSV-1, Latency, Promyelocytic leukemia nuclear bodies (PML NBs)

1

Introduction One of the hallmarks of herpes simplex virus 1 (HSV-1) infectious process is its capacity to colonize, from an initial infection in epithelial cells at the periphery, different nervous ganglia, of which the trigeminal ganglion (TG, also called Gasserian ganglion) remains the main site of HSV-1 latency establishment. TGs are essentially composed of sensitive neurons and satellite cells of glial origin. Between 24,000 and 30,000 neurons compose the core of the TG in mice and human, respectively [1–3]. In mice, TG neurons are from different subtypes on the basis of the detection of different carbohydrate moieties present at the plasma membrane [4]. This means that the variety of neurons the virus infects is likely to

Russell J. Diefenbach and Cornel Fraefel (eds.), Herpes Simplex Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2060, https://doi.org/10.1007/978-1-4939-9814-2_10, © Springer Science+Business Media, LLC, part of Springer Nature 2020

185

186

Camille Cohen et al.

determine the fate of latency and probably the likelihood of efficient reactivation [5]. Many features drive the fate of an initial infection of a neuron by HSV-1 at the physiological, immunological and molecular levels. These parameters are as many barriers for the virus to overcome to successfully infect its host. Establishment of latency is one important aspect of the battle won by the virus against a hostile environment. Latency is successful only if, and by definition, the virus can reactivate to produce new progeny able to disseminate in the microenvironment (from cell to cell) and macroenvironment (from a host to another host). At the genome-activity level HSV-1 latency is characterized by a drastic decrease in the transcription of its genome resulting in the repression of genes of the lytic program, which represent more than 80 loci encoding as many proteins (for review see [6]). This transcriptional activity below a biological threshold is accompanied by the abundant expression of a family of long noncoding RNAs called latency associated transcripts (LAT) that signify the presence within the tissue of latent virus. For long, it was considered that latent viruses automatically, exclusively, and homogeneously within the TG, switched from one mode (lytic program) to another (latent program). Several studies performed in the mouse model as well as in human challenged this view of latency and demonstrated that the latency state, when analyzed at the level of the whole ganglion, is not exempt of viruses undergoing reactivations albeit without clinical symptoms [7–9]. It is also known for long that at the single cell level latently infected neurons do not systematically express LAT [1, 10–14]. Therefore it is becoming clear that latent HSV-1 genomes are targeted by some genetic and epigenetic regulation constrains that are likely to determine their transcriptional state within individual neurons of the same ganglion. Regarding the epigenetic regulations of the transcriptional activity of latent HSV-1 genome loci, one that was initially demonstrated was the chromatin modifications at the level of some specific promoters driving the expression and/or repression of lytic and/or latent genes [15–17]. More recently our laboratory published a series of studies analyzing the distribution and localization of the latent viral genomes in the nucleus of infected neurons in latently infected mice and in human TGs [18–20]. Probably one of the most striking feature described was the variety of latent HSV-1 genome localizations in the nucleus of individually infected neurons, and the consequences on the expression of the LAT [18]. Two of the main nuclear domains to which HSV genomes were found to preferentially associate during latency were the promyelocytic leukemia nuclear bodies (PML NBs also known as ND10) and the centromeres [18]. These two specific nuclear localizations of latent HSV-1 genomes were correlated with an absence of detection of

HSV-1 Genome Detection by FISH

187

the primary LAT transcript at least by fluorescence in situ hybridization (FISH). Therefore, the 3D organization of the viral genomes and their interactions with different nuclear structures are not without consequences on the state of HSV-1 latency at least for the LAT transcription. This peculiar aspect concerning LAT transcription is likely not restricted to the sole expression of LAT and has probably also consequences on the transcriptional capacity of other viral loci. At the single viral genome level this could for example determine the capacity of a genome to undergo a full transcriptional program following a stress to initiate the exit of latency to optimize full reactivation. The detection of latent HSV-1 genomes by visualization techniques is thus important to characterize at the single cell level and within a single nucleus how the viral genomes interact with the nuclear environment. This helps to apprehend some molecular aspects associated with the microenvironment in the nucleus, in order to link them to the interactions with the macroenvironment inside the tissues, altogether determining the fate of latency and reactivation. In this method communication we will describe the technical aspects that enable the detection of latent/quiescent HSV-1 genomes by FISH and how to combine this technique with an immunofluorescence approach to detect proteins. As far as detection of viral DNA genomes is concerned we believe that the method could be applied for all herpesviruses as well as other DNA viruses such as HBV, HPV, and HIV provirus.

2

Materials

2.1 Biological Samples

1. HSV-1 SC16 strain or other wild type strain suitable for mouse infections [21]. 2. 6-week-old inbred female BALB/c mice. 3. Non-replicative HSV-1 in1374 mutant virus [22, 23]. 4. Cryosections of HSV-1 latently infected mouse or human Trigeminal Ganglia (TG) [18, 19] 5. Foreskin fibroblast cells (BJ cells), lung fibroblast cells (IMR-90), fetal foreskin fibroblast cells (HFFF-2), hepatocyte cells (HepaRG, HPR101) [20]. The list of primary cells is not exhaustive.

2.2

Cell Culture

1. Dulbecco’s Modified Eagle’s Medium (DMEM). 2. 10% fetal bovine serum. 3. L-Glutamine (1% v/v). 4. Penicillin 10 U/mL/Streptomycin 100 mg/mL.

188

Camille Cohen et al.

2.3 DNA-FISH and Immunofluorescence Analysis

1. HSV-1 Cosmids 14, 28, and 56 [24]. 2. Large vector DNA purification kit. 3. Nick-translation kit (Roche, 10-976-776-001). Respect this reference for probes preparation as many other tested references did not give satisfactory results. 4. dCTP-Cy3. 5. 0.5 M EDTA pH 8.0. 6. Tris–EDTA (TE) buffer, pH 8.0: 10 mL of 1 M Tris–HCl (pH 8.0), 2 mL of 0.5 M EDTA, distilled water to 1 L. 7. Microspin G50 columns. 8. 1.5 mL Eppendorf tubes. 9. Salmon sperm DNA, 10 mg/mL. 10. 3 M sodium acetate, pH 5.2. 11. 100% ethanol, molecular biology grade; 70% ethanol. 12. Formamide, molecular biology grade. 13. Unmasking buffer: 100 mM sodium citrate pH 6.0 (stock solution). 14. Citrate buffer, 10 mM, pH 6.0. 15. 20
saline sodium citrate (SSC): 3 M NaCl, 300 mM Na3C6, H5O7, adjust pH to 7.0 with HCl. 16. 2
SSC, 0.2
SSC. 17. Glacial acetic acid. 18. Methanol, molecular biology grade. 19. Methanol-acetic acid-PBS mix 3:1:4, prepare fresh. 20. Methanol-acetic acid mix 3:1, prepare fresh. 21. Dextran sulfate, MW 500,000. 22. Denhardt’s solution (100
). 23. 2
Hybridization buffer: add 4 g of dextran sulfate (MW 500,000) to 10 mL of distilled water. Incubate for 3–4 h at 70  C under frequent agitation to dissolve the dextran sulfate. Add 4 mL of 20
SSC and 400 μL of 100
Denhardt’s solution. Complete to 20 mL with distilled water and mix well using a vortex. Aliquots can be stored at 20  C. 24. Probing solution: for one slide mix 90 ng of Cy3-labeled HSV-1 DNA probe (30 ng of probe for each cosmid) with 40 μL of formamide. Add 40 μL of 2
hybridization buffer. Mix well by pipetting up and down several times; avoid air bubbles. 25. Rubber Cement “FixoGum” (125 g tube). 26. 1
phosphate-buffered saline (PBS), pH 7.4: 2.7 mM KCl, 1.8 mM KH2PO4, 138 mM NaCl, 10 mM Na2HPO4, pH 7.4.

HSV-1 Genome Detection by FISH

189

27. 4% paraformaldehyde (PFA). 28. 2% PFA in 1
PBS. 29. Triton X-100. 30. 0.5% Triton X-100 in 1
PBS. 31. Normal goat serum (NGS). 32. 1
PBS containing 3% NGS. 33. Primary antibodies. 34. Anti-human PML (H-238) antibody; rabbit polyclonal (Santa Cruz, sc-5621). 35. Anti-human PML(PG-M3) antibody; mouse monoclonal (Santa Cruz, sc-966). 36. Anti-UBN1 Zap1 antibody; mouse monoclonal (a kind gift from Henri Gruffat/CIRI, ENS-Lyon, France). 37. Alexa Fluor-conjugated secondary antibodies. 38. 40 ,6-Diamidino-2-phenylindole, 0.1 μg/mL.

dihydrochloride

(DAPI),

39. Fluoromount G mounting medium. 2.4

Equipment

1. Millicell EZ slides (Merck/Millipore, Ref PEZGS0816). Respect this reference as many other tested references did not give satisfactory results. 2. Superfrost glass slides. 3. Microwave oven. 4. Coplin Jar (Dominique Dutscher, Ref 68512). 5. Staining glass container (Dominique Dutscher, Ref 68506). 6. Incubator slide moat (Boekel Scientific, Ref 240000). 7. Fluorescence microscope.

3

Methods (See Note 1)

3.1 HSV-1 Probe Labeling

1. Cosmids 14, 28, and 56 containing approx. 30 kb portions of the HSV-1 strain 17 genome [24] are prepared using purification columns suitable for large plasmid preparation (e.g., large vector DNA purification kit, Qiagen) (see Note 2). 2. Two micrograms of each cosmid is labeled with Cy3-dCTP using a nick-translation kit according to the manufacturer’s guidelines. Perform labeling with a reaction mix containing only Cy3-dCTP and no unlabeled dCTP (see Table 1). Incubate at 15  C for 2.5 h.

190

Camille Cohen et al.

Table 1 Reagents for FISH probes labeling Cos14-cy3

Cos28-cy3

Cos56-cy3

DNA (2 μg)

1 μL

1 μL

1 μL

Buffer 10
(1
)

4 μL

4 μL

4 μL

dATP 0.4 mM (40 μM)

4 μL

4 μL

4 μL

dGTP 0.4 mM (40 μM)

4 μL

4 μL

4 μL

dTTP 0.4 mM (40 μM)

4 μL

4 μL

4 μL

dCTP-cy3 (40 μM)

1.6 μL

1.6 μL

1.6 μL

DNA pol I/DNase I

4 μL

4 μL

4 μL

Ultrapure water

17.4 μL

17.4 μL

17.4 μL

Total

40 μL

40 μL

40 μL

3. Stop the reaction by adding 3 μL of 0.5 M EDTA pH 8.0, and heating at 70  C for 10 min. Keep on ice and adjust the volume to 50 μL with TE buffer, pH 8.0. 4. Insert one Microspin G50 column/probe in an Eppendorf 1.5 mL tube. Centrifuge for 1 min at 1000
g to remove excess of storage buffer. Apply the 50 μL of the solution probe on the dried out Microspin G50 column. Insert the column in a 1.5 mL Eppendorf tube. Centrifuge for 2 min at 1000
g. Adjust the volume of each sample/probe to 100 μL with TE buffer (pH 8.0). Add 150 μg of salmon sperm DNA. Add 15 μL of sodium acetate 3 M pH 5.2. Add 500 μL of 100% ethanol to precipitate the probe over-night at 20  C. Centrifuge at 13,000
g for 15 min at 4  C. The DNA pellet should be pink due to Cy3 incorporation. Wash the pellet with 500 μL of 70% ethanol. Centrifuge at 13,000
g for 5 min at 4  C. Remove as much ethanol as possible with a pipette. Do not let the pellet dry completely. 5. Dissolve the pellet with 100 μL of deionized formamide per 2 μg of DNA template (probe concentration: 20 ng/μL). Store at 20  C. 3.2

DNA-FISH

See Fig. 1 for illustration. If not otherwise mentioned, all incubations are performed at room temperature. Day 1:

1. For cryosections: remove slides from the freezer and let the sections dry for 10 min. Circle the sections with a hydrophobic pen. Rehydrate the sections in 1
PBS for 10 min.

HSV-1 Genome Detection by FISH

191

Fig. 1 FISH detection of HSV-1 genomes (red) in the nucleus (blue, DAPI) of infected neurons from latently infected mouse TGs. Two main patterns are observed in the detection of viral genomes either as a single spot (Single, a) or multiple spots (Multiple-latency, b). Green channel was activated to show the natural autofluorescence of the neurons, which helps delineating the cell body. The dashed line delineates the nucleus. Bars represent 10 μm

2. For cryosections and infected cell cultures (see Note 3): permeabilize the cells/tissue with 0.5% Triton X-100 in 1
PBS for 10 min. Wash three times for 5 min with 2
SSC, and keep in 2
SSC until the sodium citrate (unmasking) buffer is heated (see below). 3. For unmasking (antigen retrieval procedure), prepare a glass slide tray with lid (20 slides capacity) filled with 200 mL of 10 mM sodium citrate buffer (pH 6.0). Place the tray with lid in a larger container filled with distilled water half height of the tray. Put the tray with lid and water container in the microwave oven until the sodium citrate buffer reaches boiling temperature (around 8 min at 800 W). Stir the buffer to homogenize the buffer temperature. Reheat the buffer until boiling (around 30 s). Remove the lid and place the slides in the preheated citrate buffer-containing tray. Confirm that the slides are completely covered with buffer. Replace the lid. Heat for about 20–30 s until the buffer reaches boiling temperature (small bubbles visible). Cool down for 2 min. Repeat the heating cycle six times (seven heating cycles in total). Cool down 2 min and transfer the slides into 2
SSC for 5 min at RT, then in 1
PBS at RT. Excessive boiling could result in tissue loss and damaged cells. For each heating pulse, the appearance of boiling is carefully watched, and heating should be stop at first signs of boiling (see Note 4). 4. Incubate the slides in a methanol–acetic acid–PBS mix (3:1:4) for 15 min, then in a methanol–acetic acid mix (3:1) for 15 min (Important: prepare these solutions right before use, and manipulate under a fume hood with protection). Dehydrate

192

Camille Cohen et al.

the tissue sections/cells by successive incubations in ethanol solutions: 1
5 min in 70% ethanol, and then twice for 5 min in 100% ethanol. Let dry at room temperature for 10 min. Keep dry until probing. 5. Drop 80 μL/slide of probing solution onto the dried tissue sections/cells. Cover gently with a 22
50 mm glass coverslip in order for the probing solution to spread over the entire surface of the tissue sections/cells without bubbles. Seal the coverslip using rubber cement and let it dry. Keep the slides in the dark at room temperature for at least 2 h for optimal diffusion of the probe in the samples and optimal hybridization signal throughout the slide. 6. Place the slides into an 80  C slide incubator for 5 min in order to allow denaturation. Quickly transfer the slides onto a metallic tray placed on ice for 2 min. Transfer the slides at 37  C in a slide heater for overnight hybridization. Day 2:

7. Peel off the rubber cement with forceps while holding the slide onto the heater to keep the section at 37  C. Remove the coverslip gently with the tip of a scalpel blade. If required 2
SSC can be added on the side of the slide to help removing the coverslip. 8. Wash 3 times for 5 min at 37  C with 2
SSC and three times for 5 min at 37  C with 0.2
SSC. Wash once for 5 min at room temperature with 2
SSC. 9. (a) Stain nuclei for 10 min with DAPI (0.1 μg/mL) in 2
SSC for 10 min. Wash three times for 2 min with 2
SSC. Drain as much liquid as possible from the slide. (b) Alternatively, stain nuclei using a mounting medium containing DAPI and proceed with step 11. 10. Add 80–100 μL of mounting medium containing an antifading agent onto one end of the slide. 11. Cover the sections with a high-quality optical coverslip (n 1.5 glass). 12. Seal coverslip with nail polish and store at 4  C in a dark slide box. 13. Direct observation of DNA-FISH signal of latent HSV-1 genomes requires a
60 or higher magnification oil immersion objective with high numerical aperture (for example
60–
63 N.A 1.4,
100 N.A 1.3) and an excitation light source of at least equivalent to a 100 W mercury lamp.

HSV-1 Genome Detection by FISH

193

Fig. 2 Detection of proteins (green) and HSV-1 genomes (red) in the nucleus (blue, DAPI) of latently infected human primary cells. Left panels (a and c) resulted from the procedure described in Subheading 3.3 (combined immunofluorescence assay-DNA FISH). Right panels (b and d) resulted from the procedure described in Subheading 3.4 (DNA FISH-immunofluorescence assay). Both approaches allow detection of PML, whereas UBN1 can be detected using the anti-UBN1 Zap1 mouse monoclonal antibody only when DNA FISH is performed before immunofluorescence analysis (see Subheading 3.4). Insets represent selected areas (dashed squares) with split channels for separate visualization of HSV-1 and protein signals. Bars represent 5 μm 3.3 Combined Immunofluorescence Analysis-DNA FISH (See Note 5)

See Figs. 2 and 3 for illustration. Day 1:

1. Perform steps 1–3 of the DNA-FISH protocol (Subheading 3.2). 2. Incubate the slides for 30 min in 1
PBS containing 3% NGS. 3. Incubate the slides for 24 h at 4  C with the primary antibody diluted in 1
PBS containing 3% NGS. Reduced incubation times at RT can be used to shorten the protocol and depending on the affinity of the primary antibody.

194

Camille Cohen et al.

Fig. 3 Detection of viral DNA-containing PML nuclear bodies (vDCP NB) in HSV-1 latently infected mouse (a) or human (b) TGs. PML (green) and HSV-1 genomes (red) are detected using the combined immunofluorescence assay-DNA FISH approach (Subheading 3.3). Dashed line delineates the nucleus. Bars represent 10 μm Day 2:

4. Wash three times for 5 min with 1
PBS. 5. Incubate 1 h with an Alexa Fluor-conjugated secondary antibody diluted at 1/500 in 1
PBS containing 3% NGS. Wash three times for 5 min with 1
PBS. 6. Postfix for 10 min with 2% PFA in 1
PBS. Wash three times for 5 min with 1
PBS (see Note 6). 7. Proceed with DNA-FISH protocol (Subheading 3.2) from step 4 onward. Duration of the immuno-DNA-FISH is typically 3 days, with the first antibody incubated overnight. 3.4 Combined DNA FISHImmunofluorescence Analysis

See Figs. 2 and 3 for illustrations. 1. Perform steps 1–8 of the DNA-FISH protocol (Subheading 3.2). 2. Perform steps 2–5 of Subheading 3.3 (see Note 7). 3. Proceed with the DNA-FISH protocol (Subheading 3.2) from step 9 onward.

4

Notes 1. We deliberately did not focus on the animal infection procedures to establish latent HSV-1 infection. For a detailed protocol on animal models handling, TG harvesting and embedding, and preparation of cryosections of tissues from mouse and human TG, we suggest the reading of our previously published studies [18, 19, 25].

HSV-1 Genome Detection by FISH

195

2. The labeled probe used for the DNA-FISH protocol can be prepared in large quantity and stored frozen for several months/years at 20  C. 3. For cell infections with HSV-1 in 1374, we suggest the reader to consult ref. 20 for technical details (open access). 4. The unmasking procedure is one of the most critical steps in the FISH procedure. The microwave oven, tray, container and volume of buffer in the tray and water in the container should be kept identical for reproducibility of unmasking. Once set-up, unmasking appears robust and reproducible. Citratebased unmasking was found to consistently provide good FISH signal using infected tissues or cells from various laboratories and animal models [18]. Absence or failure in performing unmasking does not allow the detection of latent viral genomes. 5. In combined immunofluorescence and FISH procedures, in general, it is advised to perform first the immunofluorescence, since the DNA FISH procedure may denature epitopes and prevent the protein detection by antibodies. However, our experience shows that some antibodies work only if immunofluorescence is performed after the FISH procedure (compare panels c and d of Fig. 2). This should be determined on an antibody to antibody base. 6. For the Immunofluorescence-DNA FISH procedure, it is necessary to covalently link the antibodies used to reveal the antigens in order to preserve the immunofluorescence signal on the sample during the DNA-FISH procedure (Subheading 3.3, step 6). Postfixation is a critical step in immunofluorescenceDNA FISH, and requires careful setup. The stronger the postfixation, the better the IF signal and the lower the DNA-FISH efficiency. 7. For the DNA FISH-immunofluorescence analysis, postfixation is not required after immunolabeling as the samples will not sustain further treatments that affect the immunofluorescence signal.

Acknowledgments The development of the technical approaches described in this chapter was performed in studies funded by grants from CNRS (http://www.cnrs.fr), INSERM (https://www.inserm.fr), University Claude Bernard Lyon 1 (https://www.univ-lyon1.fr), French National Agency for Research-ANR (PL, EPIPRO, ANR-18CE15-0014-01, http://www.agence-nationale-recherche.fr), LabEX DEVweCAN (PL, CC, ANR-10-LABX-61, http://www.

196

Camille Cohen et al.

agence-nationale-recherche.fr), La Ligue contre le cancer and the FINOVI foundation (grant #142690). We are grateful to many colleagues for material transfer, scientific discussions, and experimental contributions, and to the Centre Technologique des Microstructures (CTμ) and the Centre d’Imagerie Quantitative Lyon Est (CIQLE) of the Universite´ Claude Bernard Lyon 1 for the confocal microscopy facilities. References 1. Sawtell NM (1997) Comprehensive quantification of herpes simplex virus latency at the single-cell level. J Virol 71:5423–5431 2. LaGuardia JJ, Cohrs RJ, Gilden DH (2000) Numbers of neurons and non-neuronal cells in human trigeminal ganglia. Neurol Res 22:565–566 3. Thompson RL, Sawtell NM (2001) Herpes simplex virus type 1 latency-associated transcript gene promotes neuronal survival. J Virol 75:6660–6675 4. Bertke AS, Patel A, Imai Y, Apakupakul K, Margolis TP, Krause PR (2009) Latencyassociated transcript (LAT) exon 1 controls herpes simplex virus species-specific phenotypes: reactivation in the guinea pig genital model and neuron subtype-specific latent expression of LAT. J Virol 83:10007–10015 5. Bertke AS, Swanson SM, Chen J, Imai Y, Kinchington PR, Margolis TP (2011) A5-positive primary sensory neurons are nonpermissive for productive infection with herpes simplex virus 1 in vitro. J Virol 85:6669–6677 6. Roizman B, Knipe DM, Whitley RJ (2007) Herpes simplex viruses, vol 5. Lippincott Williams and Wilkins, Philadelphia, PA, pp 2501–2602 7. St Leger AJ, Peters B, Sidney J, Sette A, Hendricks RL (2011) Defining the herpes simplex virus-specific CD8+ T cell repertoire in C57BL/6 mice. J Immunol 186:3927–3933 8. van Velzen M, Jing L, Osterhaus ADME, Sette A, Koelle DM, Verjans GMGM (2013) Local CD4 and CD8 T-cell reactivity to HSV-1 antigens documents broad viral protein expression and immune competence in latently infected human trigeminal ganglia. PLoS Pathog 9:e1003547 9. Bloom DC (2016) Alphaherpesvirus latency: a dynamic state of transcription and reactivation. Adv Virus Res 94:53–80 10. Mehta A, Maggioncalda J, Bagasra O, Thikkavarapu S, Saikumari P, Valyi-Nagy T, Fraser NW, Block TM (1995) In situ DNA PCR and RNA hybridization detection of

herpes simplex virus sequences in trigeminal ganglia of latently infected mice. Virology 206:633–640 11. Chen X-P, Mata M, Kelley M, Glorioso JC, Fink DJ (2002) The relationship of herpes simplex virus latency associated transcript expression to genome copy number: a quantitative study using laser capture microdissection. J Neurovirol 8:204–210 12. Proenca JT, Coleman HM, Connor V, Winton DJ, Efstathiou S (2008) A historical analysis of herpes simplex virus promoter activation in vivo reveals distinct populations of latently infected neurones. J Gen Virol 89:2965–2974 13. Proenca JT, Coleman HM, Nicoll MP, Connor V, Preston CM, Arthur J, Efstathiou S (2011) An investigation of HSV promoter activity compatible with latency establishment reveals VP16 independent activation of HSV immediate early promoters in sensory neurones. J Gen Virol 92:2575–2585 14. Edwards TG, Bloom DC (2019) Lund human mesencephalic (LUHMES) neuronal cell line supports HSV-1 latency in vitro. J Virol 93:02210–02218 15. Bloom DC, Giordani NV, Kwiatkowski DL (2010) Epigenetic regulation of latent HSV-1 gene expression. Biochim Biophys Acta 1799:246–256 16. Kristie TM, Liang Y, Vogel JL (2010) Control of alpha-herpesvirus IE gene expression by HCF-1 coupled chromatin modification activities. Biochim Biophys Acta 1799:257–265 17. Knipe DM, Lieberman PM, Jung JU, McBride AA, Morris KV, Ott M, Margolis D, Nieto A, Nevels M, Parks RJ, Kristie TM (2013) Snapshots: chromatin control of viral infection. Virology 435:141–156 18. Catez F, Picard C, Held K, Gross S, Rousseau A, Theil D, Sawtell N, Labetoulle M, Lomonte P (2012) HSV-1 genome subnuclear positioning and associations with host-cell PML-NBs and centromeres regulate LAT locus transcription during latency in neurons. PLoS Pathog 8:e1002852

HSV-1 Genome Detection by FISH 19. Maroui M-A, Calle´ A, Cohen C, Streichenberger N, Texier P, Takissian J, Rousseau A, Poccardi N, Welsch J, Corpet A, Schaeffer L, Labetoulle M, Lomonte P (2016) Latency entry of herpes simplex virus 1 is determined by the interaction of its genome with the nuclear environment. PLoS Pathog 12: e1005834 20. Cohen C, Corpet A, Roubille S, Maroui M-A, Poccardi N, Rousseau A, Kleijwegt C, Binda O, Texier P, Sawtell N, Labetoulle M, Lomonte P (2018) Promyelocytic leukemia (PML) nuclear bodies (NBs) induce latent/quiescent HSV-1 genomes chromatinization through a PML NB/histone H3.3/H3.3 chaperone axis. PLoS Pathog 14:e1007313 21. Labetoulle M, Maillet S, Efstathiou S, Dezelee S, Frau E, Lafay F (2003) HSV1 latency sites after inoculation in the lip: assessment of their localization and connections to the eye. Invest Ophthalmol Vis Sci 44:217–225

197

22. Jamieson DR, Robinson LH, Daksis JI, Nicholl MJ, Preston CM (1995) Quiescent viral genomes in human fibroblasts after infection with herpes simplex virus type 1 Vmw65 mutants. J Gen Virol 76(Pt 6):1417–1431 23. Preston CM, Nicholl MJ (1997) Repression of gene expression upon infection of cells with herpes simplex virus type 1 mutants impaired for immediate-early protein synthesis. J Virol 71:7807–7813 24. Cunningham C, Davison AJ (1993) A cosmidbased system for constructing mutants of herpes simplex virus type 1. Virology 197:116–124 25. Catez F, Rousseau A, Labetoulle M, Lomonte P (2014) Detection of the genome and transcripts of a persistent DNA virus in neuronal tissues by fluorescent in situ hybridization combined with immunostaining. J Vis Exp 83:e51091

Chapter 11 Oligonucleotide Enrichment of HSV-1 Genomic DNA from Clinical Specimens for Use in High-Throughput Sequencing Mackenzie M. Shipley, Molly M. Rathbun, and Moriah L. Szpara Abstract To date more than 400 genomes of herpes simplex virus 1 (HSV-1) and the distantly related HSV-2 have been examined using deep sequencing techniques. This powerful approach has been especially useful for revealing the global genetic diversity that exists within and between strains of each virus species. However, most early methods for high-throughput sequencing required the input of abundant viral genomic DNA to enable the successful production of sequencing libraries, and the generation of sufficient short-read sequencing data for de novo genome assembly and similar applications. Therefore, the majority of sequenced HSV strains have been cultured and expanded in vitro prior to genomic analysis, to facilitate isolation of sufficient viral DNA for sequencing-library preparation. Here, we describe an in-solution targeted enrichment procedure for isolating, enriching, and sequencing HSV genomic DNA directly from clinical specimens. When this enrichment technique is combined with traditional sequencing-library preparation procedures, the need for in vitro culturing, expansion, and purification of viral DNA is eliminated. Furthermore, enrichment reduces the large amount of nonviral DNA that is typically present in specimens obtained directly from natural infections, thereby increasing the likelihood of successful viral genome sequencing and assembly. We have used this approach to prepare viral DNA libraries from clinical specimens derived from skin swabs, saliva, blood, and similar sources. We then use these libraries for deep sequencing and successful de novo assembly of the ~152 kb viral genomes, at coverage depths exceeding 100–1000
, for both HSV-1 and HSV-2. Key words Oligonucleotide enrichment, Deep sequencing, Virus, Clinical, Low-input, Herpes simplex virus, Oral, Genital, Swab

1

Introduction Next-generation sequencing (NGS) is a powerful technique that facilitates the investigation of genetic information from organisms ranging from humans and other mammals, to bacteria, fungi, and viruses [1, 2]. Successful application of this technology depends on the purity and the amount of genetic material present in a sample, which is often limited in the case of clinical specimens such as those collected from patients infected with herpes simplex virus 1 and 2 (HSV-1 and HSV-2). Traditionally, this problem has been

Russell J. Diefenbach and Cornel Fraefel (eds.), Herpes Simplex Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2060, https://doi.org/10.1007/978-1-4939-9814-2_11, © Springer Science+Business Media, LLC, part of Springer Nature 2020

199

200

Mackenzie M. Shipley et al.

circumvented through initial culturing and expansion of the virus in an in vitro environment (i.e., in cell culture). However, this in vitro expansion can skew the genetic makeup of the pathogen in a manner that may not be representative of the original in vivo infection [3–8]. Implementing a targeted oligonucleotide-based enrichment approach enables capture of HSV (or any other pathogen’s) genetic material directly from clinical specimens. The success of this methodology has been demonstrated for a number of different viruses, including multiple herpesviruses such as human cytomegalovirus (HCMV), varicella zoster virus (VZV), Epstein–Barr virus (EBV), HSV-1, and HSV-2 [3, 9–14]. This method was originally optimized in our laboratory for enriching and sequencing HSV viral DNA directly from mucosal swabs obtained from the human oral and/or genital tract. However, we have used the same approach successfully for other biological sample types (i.e., blood, saliva, cerebrospinal fluid). Additionally, it is feasible to use this method for enrichment of other herpesviruses, using oligonucleotide baits targeted to the virus genome(s) of interest. Assembly of whole viral genomes directly from minimal quantities of viral DNA without initial culture is advantageous for a multitude of applications, including clinical diagnostics, forensic comparisons, analysis of ancient and/or degraded samples, and evolutionary studies. The protocol presented here is based on several commercially available methods [15–20], which we have optimized based on our insights and experience for successful generation of sequencing libraries prepared from HSV-1 DNA that has been extracted directly from clinical specimens. It should be noted that similar outcomes could be achieved using commercial kits from other manufacturers and/or with generic reagents. Additionally, multiple platforms have been demonstrated to work for the oligonucleotide enrichment portion of this protocol [3, 10, 13]. In our lab, we have successfully applied the protocol below to achieve enrichment of HSV-1 DNA from clinical specimens using Roche-Nimblegen SeqCap® baits and more recently, Arbor Biosciences myBaits® [3]. There are three main sections detailed in this protocol for preparing sequencing libraries of enriched HSV-1 or HSV-2 viral DNA directly from clinical specimens (see Fig. 1). The protocol begins with the isolation of total sample DNA using traditional phenol-chloroform organic extraction techniques and overnight precipitation of DNA. Following DNA isolation, the sample is sheared into fragments and processed through a series of steps to generate a sequencing library. This requires creating blunt fragment ends on the sheared DNA, adding deoxyadenosine 50 -monophosphate (dAMP) to the 30 ends, ligating the fragment ends to platform-specific sequencing adapters, and amplifying the library DNA by PCR. Next, the library DNA fragments are hybridized with the HSV-specific oligonucleotide baits, which selectively

Oligonucleotide Enrichment of HSV-1 DNA

201

Methods Workflow*: 3.2

3.1

3.3 Library Preparation

DNA Extraction

Quantitate

i. Organic Extraction & Overnight Precipitation ii. DNA Recovery & Resuspension

i. Qubit ii. qPCR

i. DNA Shearing ii. End Repair & A-Tailing iii. Adapter Ligation iv. Reaction Clean-up v. PCR Amplification

i. 45-60 min; ON** ii. 90 min

i. 5-10 min ii. 45-60 min

i-iii. 90-210 min iv-v. 2-3 hr

Oligonucleotide Enrichment

Quantitate

Sequencing

i. Qubit ii. qPCR

i. Bait Hybridization ii. Target Capture iii. Reaction Clean-up iv. PCR Amplification

i. Qubit ii. qPCR iii. Agilent Bioanalyzer

Per Illumina or Alternative Manufacturer Protocol

i. 5-10 min ii. 45-60 min

i. 30 min ii. 40-48 hr iii-iv. 2-4 hr

i. 5-10 min ii. 45-60 min iii. 45-60 min

Quantitate

*Total time to complete depends on the number of samples being processed and their ligation time. **ON = Overnight.

Fig. 1 Overview of methods. This flowchart provides an overview of the steps and the timing involved in Subheadings 3.1, 3.2, and 3.3 of the protocol for oligonucleotide enrichment of viral DNA for use in highthroughput sequencing

target and bind the viral DNA in a sequence-specific manner. The oligonucleotide baits are biotinylated, which enables the user to isolate the baits and the targeted viral DNA on streptavidin-coupled magnetic beads, while using multiple wash steps to remove a large portion of unbound, non-viral DNA from the immobilized library. The result of this protocol is a DNA sequencing library that has been enriched for HSV DNA and is ready to undergo deep sequencing following appropriate quality control measurements.

2 2.1

Materials DNA Extraction

1. Extraction Buffer (see Note 1): 10 mM Tris–HCl (pH 8), 10 mM EDTA, 100 mM NaCl, 2% SDS. To make 50 mL of Extraction Buffer, combine 500 μL of 1 M Tris–HCl (pH 8.0), 500 μL of 1 M EDTA, 5 mL of 1 M NaCl, 10 mL of 10% SDS w/v, and 34 mL of ddH2O. Store at room temperature. 2. Proteinase K: 20 mg/mL concentration, measure 200 mg Proteinase K powder, dissolve in 10 mL ddH2O, store at 20  C (see Note 1). 3. Thermomixer or heat block (set to 56  C). 4. 2 mL Phase-lock gel (PLG) Heavy tubes (Quanta Bio). 5. Buffered phenol–chloroform–isoamyl (pH 8.0).

alcohol

solution

6. Microcentrifuge. 7. 1.5 and 2 mL Eppendorf tubes. 8. Linear polyacrylamide (LPA) (Alfa Aesar): 5 mg/mL stock concentration, dilute 1:5 in ddH2O and store aliquots of 1 mg/mL at 20  C until ready for use. 9. 3 M sodium acetate solution (pH 5.2).

202

Mackenzie M. Shipley et al.

10. Ethanol: 100% (ice cold) and 70% (room temperature). 11. Vacuum centrifuge. 12. Resuspension Buffer: 10 mM Tris–HCl (pH 8.5). Take 500 μL of 1 M Tris–HCl (pH 8.0), and add 40 mL ddH2O. Adjust pH to 8.5 and then adjust to final volume of 50 mL with ddH2O as needed. 13. Qubit fluorimeter version 2.0 or later. 14. Qubit-compatible 500 μL tubes. 15. Qubit dsDNA quantitation assay reagent kit: High Sensitivity (for samples 600 ng/mL). 2.2 Library Preparation

1. 1.5 mL Eppendorf DNA LoBind tubes. 2. 0.2 mL PCR tubes. 3. Life Technologies DynaMag-2 magnet compatible with 1.5 mL tubes. 4. Beckman Coulter AMPure XP Solid Phase Reversible Immobilization (SPRI) magnetic beads (see Note 2). 5. 80% ethanol: combine 8 mL of 100% ethanol with 2 mL ddH2O (see Note 3). 6. Thermocycler. 7. Covaris sonicator. 8. Covaris microTube Adaptive Focused Acoustics® (AFA®) Fiber Pre-slit Snap-caps. 9. AFA®-grade H2O. 10. KAPA HyperPrep Library Kit with PCR reagents, compatible with Illumina® indices and reagents. 11. Illumina® TruSeq DNA Single Index sets A and B. 12. Resuspension Buffer: 10 mM Tris–HCl (pH 8.5)—see Subheading 2.1, step 12.

2.3 Oligonucleotide Enrichment

1. 1.5 mL Eppendorf DNA LoBind tubes. 2. 0.2 mL PCR tubes. 3. Life Technologies DynaMag-2 magnet compatible with 1.5 mL tubes. 4. Beckman Coulter AMPure XP (SPRI) beads (see Note 2). 5. 80% ethanol: combine 8 mL of 100% ethanol with 2 mL ddH2O (see Note 3). 6. Thermocycler. 7. Benchmark myBlock instrumentation.

Mini

Dry

Bath

or

similar

Oligonucleotide Enrichment of HSV-1 DNA

203

8. Heat block: set to 65  C. 9. Arbor Biosciences myBaits® Target Capture Kit (see Note 4). 10. Arbor Biosciences Hybridization Master Mix: 9.25 μL/sample reagent N, 3.5 μL/sample reagent D, 0.5 μL/sample reagent S (see Note 5), and 1.25 μL/sample reagent R. 11. Arbor Biosciences Blockers Master Mix: 0.5 μL/sample Block reagent A, 2.5 μL/sample Block reagent C, and 2.5 μL/sample Block reagent O. 12. Arbor Biosciences myBaits® custom HSV oligonucleotide probes bound to biotin. Note that others can order our current HSV oligonucleotide bait set directly from Arbor Biosciences. 13. Wash Buffer X: Combine 400 μL Arbor Biosciences Hybridization reagent S + 10 mL Arbor Biosciences Wash Buffer + 39.6 mL ddH2O. Aliquot 1 mL of Wash Buffer X into 1.5 mL Eppendorf tubes and store at 20  C. Warm aliquots to 65  C for 30 min prior to beginning oligoenrichment process (see Note 6). 14. Tween Resuspension Buffer: 10 mM Tris–HCl with 0.05% Tween 20 (pH 8.0–8.5). Prepare 50 mL of 10 mM Tris–HCl (pH 8.5) as directed in Subheading 2.1, step 12. Add 25 μL of Tween 20 solution and adjust the pH if necessary. Vortex the solution to mix and aliquot into 1.5 mL Eppendorf tubes and store at room temperature. 2.4 Quantitation and Quality Control Measurements (See Note 7)

1. Qubit® Fluorimeter version 2.0 or later. 2. Qubit-compatible 500 μL tubes. 3. Qubit DNA quantitation assay reagent kit: High Sensitivity (for samples 600 ng/mL). 4. qPCR instrument and compatible reagents for estimation of HSV genome copy number (see Note 8). 5. Agilent 2100 Bioanalyzer instrument. Agilent Bioanalyzer DNA electrophoresis chips: DNA 1000 (for samples >10 ng/μL) or DNA High Sensitivity (for samples 3`

Nucleotides of HSV-1 genome

TK-1

TTTTATTCTGTCCTTTTATTGC CGTCA

4660746634

TK-R5

CGTGCCGCCCCAGGGTGCC GAGC

4700546983

TK-4

CACGTTATACAGGTCGCCGT TGG

4688246904

TK-R2

CATCGCCGCCCTCCTGTGCT ACCC

4730847285

TK-2

ACGATGTTTGTGCCGGGCAA GGTC

4719247215

TK-R4

ACCCGAGCCGATGACTTACT GGCG

4756047537

TK-5

GCATGCCCATTGTTATCTGG GC

4741247433

TK-R1

CGAGCGACCCTGCAGCGACC 47907CGCT 47884

Pol-1

ATCCGCCAGACAAACAAGGC CCTT

6265562678

Pol-4-1

TGCACGACGGTCACCTCAAG CGC

6308763109

Pol-R4

CCCCACCCTCGTACTTCTTGA 63695TGG 63672

Pol-2

GTCCGAAGCGGGCGTGTGCT 63623GTCG 63646

Pol-5-1

TCATGACCCTTGTGAAACAGT 64155CACC 64178

PolBr1

CCGTTCATGCGGCCGTACCC GTC

Pol-R2

GGCCGTCGTAGATGGTGCGG 64655GTG 64633

Pol-3

CCATCTGGAGCTCTCGGCCG TCGC

Pol-6-1

TTCGACTTTGCCAGCCTGTAC 64952CC 64974

Pol-R3

CGTAAAACAGCAGGTCGACC AGGG

6574465721

Pol-4a

GTAAGATGCTCATCAAGGGC GTGGATC

6564965675

PolCr1

GATGCGCCGATGGGCGTCTA CGAG

6586965846

Pol-71R

GGAGAAGTAATAGTCCGTGT TCA

6629566263

PolR1a

GGCTCATAGACCGGATGCTC AC

6669466673

HSV-1 TK Fragment 2 (426 bp)

HSV-1 TK Fragment 3 (368 bp)

HSV-1 TK Fragment 4 (495 bp)

HSV-1 DNA pol Fragment 1 (1040 bp)

HSV-1 DNA pol Fragment 2 (1032 bp)

HSV-1 DNA pol Fragment 3 (1156 bp)

HSV-1 DNA pol Fragment 4 (1045 bp)

6429064268

6458864611

Phenotypic and Genotypic Testing of HSV-1 and HSV-2 Resistance to Antivirals

253

Table 2 Primers for amplification (black) and sequencing (red) of thymidine kinase (TK) and DNA polymerase (pol) genes of HSV-2 HSV-2 DNA fragment (size in bp)

HSV-2 TK Fragment 1 (428 bp)

Name

Sequence 5’>3`

Nucleotides of HSV-2 genome

TK-1

TTTTATTCTGTCCTTTTATTGC CGTCA

4680546831

TK-R7

GCGGGAGGACTGGGGCCGG CTGAC

4723346210

TK-6

AACAGCGTGTCCTCGATGCG GG

4712247153

TK-R3

TATCGCCTCCCTGCTGTGCT ACCC

4750347480

TK-3

ACCAGGTTCGTGCCGGGCGC 47387GGTC 47410

TK-R6

CGATGACTTACTGGCAGGTG CTGG

4774747724

TK-7

CTGGTCATTACCACCGCCGC CTC

4763047652

TK-R1

CGAGCGGACCCTGCAGCGA CCCGCT

4810548082

Pol-1

CCCGGGCGCGGGTCCGCCG GTCCG

6312463147

Pol-5-2

TGTACGACATCCTGGAGCAC GTG

6371363735

Pol-82R

GTCAGACCCAGAAGCGTGAT GAC

6369563672

Pol-2

GTGCGAAGCGGGCGCGCGC TGGCC

6362363646

Pol-6-2

TGACCTTCGTCAAGCAGTAC GGC

6461964641

PolBr2

GTTCATGCGCCCGTACCCGT CG

6474964728

Pol-R2

GGATCTGCTGGCCGTCGTAT ATGG

6512565102

Pol-11

GGATCTGAGCTACCGCGACA TC

6558865610

Pol-7-2

GCGAGAGCCTGCTGAGCATC CTG

6495264974

PolCr2

GCAGGGCAGAAGACCGTGCT 65769GCAC 65746

Pol10R

TGCGCCGATGGGCGTCTACG AG

6634066319

Pol-4

TCATCAAGGGCGTGGATCTG GTGCG

6613166155

Pol-R1

GGCTCATCGATCGGATGCTG AC

6716767146

HSV-2 TK Fragment 2 (381 bp)

HSV-2 TK Fragment 3 (360 bp)

HSV-2 TK Fragment 4 (475 bp)

HSV-2 DNA pol Fragment 1 (571 bp)

HSV-2 DNA pol Fragment 2 (1502 bp)

HSV-2 DNA pol Fragment 3 (752 bp)

HSV-2 DNA pol Fragment 4 (1036 bp)

254

Andreas Sauerbrei and Kathrin Bohn-Wippert

2. Amplify DNA fragments by following PCR steps: l

Initial denaturation for 5 min at 94  C. 44 cycles with:

l

Denaturation for 50 s at 94  C.

l

Annealing for 50 s at 55  C.

l

Elongation for 90 s at 72  C. Final:

l

3.5.4 Agarose Gel Electrophoresis (See Note 7)

Elongation for 10 min at 72  C.

1. Add 0.5 g of agarose powder to a 100 mL flask. 2. Add 50 mL of 1 TBE buffer and swirl the flask gently. Total gel volume will vary depending on size of the casting tray. 3. Melt agarose in a microwave oven until the solution becomes clear. 4. Let the solution cool down to approximately 40–50  C by swirling the flask occasionally. 5. Add 7 μL of ethidium bromide stock solution to the lukewarm liquid agarose gel and mix by swirling flask gently. 6. Place a comb and pour the melted agarose solution into a gel casting tray. Bubbles in gel can be removed using a pipette tip. Let the agarose gel cool down until it is solid, and color is milky white. 7. Pull out the comb carefully. 8. Place the agarose gel in an electrophoresis chamber and add sufficient buffer (1 TBE) to submerse the gel. 9. Mix loading puffer 1:1 with TE buffer. 10. Pipette 10 μL of the loading/TE buffer mixture and 2 μL of the sample in a 1.5 mL tube without lid. Mix the solution by pipetting repeatedly. 11. Repeat the procedure with all other samples. 12. Pipette 10 μL of each sample/loading buffer/TE buffer mixture carefully into separate slots of gel. 13. Pipette 2 μL undiluted molecular weight marker HyperLadder I into at least one slot of each row of gel. 14. Place the lid on the electrophoresis chamber and connect electrodes. 15. Connect electrode wires to the power supply and make sure that the positive (red electrode) and the negative wire (black electrode) are correctly connected.

Phenotypic and Genotypic Testing of HSV-1 and HSV-2 Resistance to Antivirals

255

16. Turn on the power supply and set to approximately 90 V. The maximal voltage depends on size of the electrophoresis chamber used. 17. Make sure that the current is running through the buffer by looking for bubbles forming on each electrode and by observing the movement of the blue loading dye (this will take a couple of minutes). 18. Let the power run for approximately 45 min until the blue dye approaches the end of the gel. 19. Thereafter, turn off the power, disconnect wires from the power supply and remove the lid of the electrophoresis chamber. 20. Use nitrile gloves to remove the gel from TBE buffer. 21. Analyze the gel by using an UV transilluminator and take a photo. 3.5.5 DNA Purification Using the QIAquick PCR Purification Kit (See Note 8)

Tests are carried out according to instructions for use (IFU) with minor modifications. 1. Add 5 volumes of the PB buffer from the QIAquick PCR Purification Kit to 1 volume of the PCR sample and mix. 2. Place a QIAquick spin column in a 2 mL tube. 3. Pipette the whole sample to a QIAquick column and spin the sample for 1 min at 16,060  g using a microcentrifuge. Discard the flow-through and place the column back in the same tube, which can be reused. 4. Add 0.75 mL PE wash buffer to the column and incubate for 5 min at room temperature. Then spin the sample for 1 min at 16,060  g. 5. Discard the flow-through again, place the column back into the tube and spin for an additional 1 min at 16,060  g. 6. Place the column in a sterile and labeled 1.5 mL tube and add 30 μL EB buffer to the center of the QIAquick membrane. 7. Incubate samples for 15 min at room temperature. 8. Spin the column for 1 min at 16,060  g. 9. Discard the column and store the 1.5 mL tube containing the DNA at 20  C until next use.

3.5.6 DNA Purification Using QIAquick Gel Extraction Kit

Tests are carried out according to the IFU with minor modifications. 1. Using a clean scalpel, cut the specific DNA fragment out of the agarose gel under UV illumination. In order to minimize the size, cut very closely to the DNA; estimate the gel volume.

256

Andreas Sauerbrei and Kathrin Bohn-Wippert

2. Place the gel into a sterile 2 mL tube and add 3 volumes of QG buffer from the QIAquick Gel Extraction Kit per gel volume. 3. Incubate the 2 mL tube in a 50  C heat block until the gel has completely dissolved (approximately 10 min). To resolve the gel, vortex the tube occasionally. 4. As soon as the gel is completely resolved, add 1 gel volume of 100% isopropanol to the sample if the size of fragments is 90%), for example specific viral intermediates or subgroups [11, 12] (Khadivjam et al. personal communication). Moreover, the heterogeneity of individual viral particles or their maturation can be assessed with high statistical accuracy as hundreds of thousands of individual viral particles can be processed [6, 9, 13–16]. Perhaps most importantly, the method preserves the viability of the samples and thus accesses the infectivity of specific subgroups of viral particles [6, 11, 12]. Finally, it can be performed on standard flow cytometers present in most facilities [8]. Some limitations may also be noteworthy to mention, for instance some sample loss caused by the sorting process and the inability to precisely size these small particles or define the absolute stoichiometry of fluorescently tagged viral components. Flow virometry can be undertaken with a variety of approaches. For instance, some protocols externally decorate viruses with antibodies or nanoparticles, but this can impact their infectivity [9, 12, 14–18]. To minimize this issue, we instead rely on viral genomes that are stained with the SYTO 13 or 61 nuclei acid dyes or on viral particles expressing genetically labeled constituents (e.g., fluorescently tagged capsid, tegument, or envelope proteins) [6, 11] (El Bilali et al. submitted). This chapter details the aforementioned methods including the preparation of samples, labeling of the viral particles with fluorescent dyes and analysis/sorting on a standard BD FACSAria II flow cytometer. This chapter also pinpoints some technical aspects to reduce the background signals associated with the small particles found in the sheath fluid and samples to enable the positive identification of the viral particles (i.e., prefiltration, gating strategy; Fig. 1). It also reports the means to probe

Characterization of HSV-1 Particles by Flow Virometry

291

Fig. 1 Analysis of individual viruses by flow cytometry. Several steps are critical for the analysis of individual viral particles by flow cytometry. Following the infection of cells in tissue culture dishes, the cells or medium are harvested and the viral particles partially enriched and concentrated. For nuclear capsids, this typically involves a 20%–50% sucrose gradient to separate A-, B-, and C-nuclear capsids, while for the extracellular virions, the samples are filtered through a 0.45 μm filter and concentrated by ultracentrifugation. Samples are

292

Bita Khadivjam et al.

coincidental events to insure that single viral particles are monitored (diluted samples, low flow rate and pressure, large nozzle) and measure the thermal stability of the virions (heating of samples). Interestingly, the proposed methods herein work equally well with enveloped and nonenveloped viral particles [6, 11]. Furthermore, while focusing on herpes simplex virus type 1 (HSV-1), they should be adaptable to other viruses with either RNA or DNA based genomes and thus be useful to various virology fields.

2

Materials It is preferable that the HSV-1 stocks be relatively fresh (i.e., a maximum of a few days before sorting) as this improves final yields. The infection step for preparing either extracellular virions or nuclear capsids is identical and therefore requires the same materials.

2.1 Generation of HSV-1 Extracellular Virions and Nuclear Capsids

1. Cells (see Note 1). 2. RPMI-1640 medium supplemented with 0.2 μm filtered 0.1% bovine serum albumin (BSA). 3. HSV-1 wild-type or recombinant virus (optionally expressing a fluorescent structural protein (see Note 2)). 4. Complete DMEM: Dulbecco Modified Eagle’s Medium (DMEM), high-glucose supplemented with 1% L-glutamine, 5% HI-FBS, and 1% penicillin–streptomycin antibiotics. Store at 4
C. 5. Phosphate-buffered saline (PBS 1): 137 mM NaCl, 2.7 mM KCl, 2 mM KH2PO4, 10 mM Na2HPO4. Adjust the pH to 7.4 and filter through a 0.2 μm filter. Autoclave and store at 4
C. 6. 0.45 μm pore size Millex-HV Syringe Driver Filter Unit. 7. DNase I solution: 10 mg/mL DNase I prepared in 20 mM Tris–HCl, 1 mM MgCl2, and 50% glycerol, pH 7.5. 8. RNase A solution: Prepare a stock solution of 25 mg/mL RNase A from bovine pancreas in molecular grade water. 9. MNT buffer: 30 mM MES, 100 mM NaCl, 20 mM Tris–HCl (pH 7.4), 0.2 μm filtered. Autoclave and store at 4
C.

ä Fig. 1 (continued) then appropriately diluted to ensure limited events/s through the flow cytometer and low-pressure conditions used to minimize simultaneous events and maximize detection. Gating is critical to eliminate the background signal, as is the positive selection of the GFP or SYTO 13-labeled viral particles. An optional strategy makes use of a dual GFP/SYTO 61 labeling to remove light viral particles, which are biologically active but devoid of viral DNA and capsids [19]. Most important, sorted particles retain their activity and can be tested using a variety of assays, including those that monitor viral fitness (e.g., plaque assays). The critical steps of this protocol are indicated in green in the figure

Characterization of HSV-1 Particles by Flow Virometry

293

10. Pretreated MNT buffer: Add the DNase I at the final concentration of 500 U/mL and the RNase A at the final concentration of 2 mg/mL to MNT buffer and incubate at 37
C for 15 min. Store at 4
C (see Note 3). 11. Lysis buffer: 10 mM Tris (pH 7.4), 150 mM NaCl, 2 mM MgCl2, 1 mM EDTA, 1% Igepal, 5 mM dithiothreitol (DTT), and protease inhibitors as per the manufacturer’s instructions (see Note 4). 12. Modified TNE: 20 mM Tris (pH 7.5), 150 mM NaCl, 1 mM EDTA, 0.2 μm filtered. Store at 4
C (see Note 5). 13. Sucrose solutions: 20%, 35%, and 50% (w/w) sucrose in modified TNE, 0.2 μm filtered. Store at 4
C. 14. Gradient forming apparatus. We use a Biocomp Instruments gradient maker. 15. Cup horn ultrasonic homogenizer. 16. Pierce™ BCA Protein Assay Kit. 17. Polyallomer centrifuge tubes. 18. Ultracentrifuge. 2.2 Staining of the Viral Particles with SYTO 2.3 Sorting of HSV-1 Virions and Capsids

1. SYTO 13 or 61 fluorescent nucleic acid stains (5 mM in DMSO) (see Note 6). 2. Pretreated MNT buffer. 1. BD FACSAria II cell sorter (or equivalent). 2. Falcon round-bottom polystyrene tubes. 3. Ultracentrifuge. 4. MNT buffer.

2.4 Electron Microscopy of Sorted Particles

1. Fixation buffer: 2% glutaraldehyde in 0.1 M sodium phosphate buffer (PB, pH 7.3). 2. 13 mm Swinney stainless steel filter holder (EMD Millipore). 3. 0.1 μm pore size Omnipore PTFE hydrophobic membrane filter (EMD Millipore). 4. Post-fixation buffer: 1% OsO4 in PB (pH 7.3). 5. Hexagonal 200-mesh Nickel (Ni) grids (Canemco-Marivac). 6. Epon 812 resin (Mecalab). 7. Ultracut S ultramicrotome (Leica). 8. Negative staining solution: 3% w/v uranyl acetate aqueous solution (Mecalab). 9. Transmission electron microscope (we have a Philips CM100 transmission electron microscope equipped with an AMT XR80 digital camera).

294

3

Bita Khadivjam et al.

Methods When working with infectious viral particles, all steps need to be carried out under a biosafety level 2 certified biological hood. Where possible freeze–thaw cycles of viral stocks should be avoided. We use two different approaches to fluorescently label the particles. In the first case, we employ viruses that genetically code for fluorescent virion components (e.g., GFP capsid, tegument, or envelope proteins). In the second scenario, we label the viral genome with a SYTO dye after the particles have been produced and immediately prior to FACS analysis or sorting. Note that it is possible to perform a dual labeling (GFP and SYTO) depending on your experimental needs. In that case, the proper SYTO should be chosen to avoid overlapping excitation/emission spectra. As SYTO dyes are membrane permeable, one can use them with unenveloped and enveloped viral particles.

3.1 Infection with HSV-1

1. One day before the infection, seed cells in a concentration that will yield enough cells at the time of infection (see Note 7). 2. Warm up the PBS 1 and RPMI-0.1% BSA in a 37
C water bath for 15–30 min. 3. Dilute the appropriate virus stock with a known titer in RPMI0.1% BSA to infect the cells at the multiplicity of infection (MOI) of 5 (see Note 8). 4. Wash the cells twice with PBS 1. 5. Add the RMPI-0.1% BSA containing virus on the cells in a dropwise manner and incubate them at 37
C with gentle shaking for an hour to allow the adsorption of the virus. 6. Twenty minutes before the end of adsorption, warm up the complete DMEM to 37
C. 7. At the end of the adsorption period, add the warmed up complete DMEM to the cells and incubate at 37
C for 24 h. 8. The next day, carefully examine the infected cells under a light microscope and take note of signs of infection (see Note 9).

3.2 Purification of Extracellular Viral Particles (If Desired)

1. Collect the cell medium without disrupting the cell layer and spin at 500  g for 5 min at 4
C to remove the cell debris. 2. Transfer the supernatant to a new tube and filter through a 0.45 μm filter (see Note 10). 3. Spin the filtered supernatant at 20,000  g for 1 h at 4
C. 4. Carefully remove the supernatant by inverting the tube, keep the tube inverted for a few seconds to entirely remove the supernatant.

Characterization of HSV-1 Particles by Flow Virometry

295

5. Resuspend the pellet in a minimum amount of MNT or pretreated MNT depending on whether you are concentrating a wild-type or a fluorescently tagged virus, respectively (see Notes 11 and 12). 6. Incubate the tubes at 4
C overnight (see Note 13). 7. Transfer the resuspension containing virus to a new tube. 8. Sonicate the virus stock to break up all the aggregates (see Note 14). 9. Aliquot the stock in small sample sizes. Store at 80
C. 10. Titer the stock, as described in Chapter 3 of this book, to measure the level of infectious particles in the prepared viral stocks. 3.3 Extraction of Nuclear Capsids (If Desired)

1. Remove the supernatant and wash the cells in cold PBS 1 once. 2. Scrape the cells in cold PBS 1 and count them using a hemocytometer. 3. Spin the cells at 500  g for 5 min at 4
C. 4. Resuspend the pellet in the lysis buffer at the concentration of 107 cells/mL and incubate on ice for 15 min (see Notes 15 and 16). 5. Pellet the nuclei at 500  g for 10 min at 4
C. 6. Resuspend the nuclear pellet in 10 mL of modified TNE and transfer to a new tube (see Note 17). 7. Perform three freeze–thaw cycles to break the nuclei open. 8. Pass the nuclear lysate through an 18 G1/2 needle once and then three times through a 27 G1/2 needle to shear the genomic DNA. 9. If very viscous, mildly sonicate the nuclear extract to shear the DNA (see Notes 14 and 18). 10. Treat the nuclear extract with DNase I (500 U/mL) and incubate for 1 h at 10
C (see Note 19). 11. Spin the nuclear extract at 2500  g for 10 min at 4
C. The supernatant contains the capsid mixture. 12. Overlay the 10 mL of capsid mixture on 1.5 mL of 35% w/w sucrose cushion and spin at 100,000  g for 1 h at 4
C. 13. Resuspend the pellet in 200–400 μL of MNT. 14. Make a continuous 20–50% w/w sucrose gradient with a gradient maker apparatus (see Note 20). 15. Overlay the resuspended pellet from step 13 on the sucrose gradient and centrifuge at 100,000  g for 1 h at 4
C.

296

Bita Khadivjam et al.

16. Harvest the three bands corresponding to A-, B-, and C-capsids (see Note 21). 17. Add at least an equal volume of MNT to dilute the sucrose. 18. Spin the diluted bands at 100,000  g for 1 h at 4
C to concentrate the capsids and remove the excess of sucrose. 19. Resuspend the capsids in 20–40 μL of MNT and incubate at 4
C overnight. 20. Perform BCA protein assays as per the manufacturer’s instructions to determine the concentration of capsid stocks (see Note 22). 21. Aliquot the stock in small sample sizes. Store at 80
C. 3.4 Staining of Capsids or Extracellular Viruses with SYTO Dyes (Optional)

1. Briefly spin the tube containing the SYTO dye and take the desired volume. 2. Dilute the SYTO stain in pretreated MNT (RNA and DNA free) in a 1:10 ratio and store on ice (Note 23). 3. If staining extracellular virions, dilute the extracellular viral stock containing 108 PFU in 499 μL with pretreated MNT. If staining capsids, dilute each 8 μg of C-capsids in 499 μL with pretreated MNT. Store the samples on ice. 4. Add 1 μL of the 1:10 diluted SYTO stain to the viral or capsid suspension and gently mix up and down several times, avoiding vortexing as it might disrupt the viral particles. 5. Incubate the tubes on ice for an hour in the dark (see Notes 24 and 25). 6. In parallel, dilute 1 μL of 1:10 SYTO in 499 μL of pretreated MNT and incubate on ice for an hour. This will serve as a negative control to set the parameters later in FACS.

3.5 Preparation of Virus Expressing a Fluorescently Tagged Protein (Alternative to SYTO)

1. Extracellular viral stocks that contain an already tagged virus (see Note 26) should be 108 PFU in 500 μL MNT. Store on ice.

3.6 FACS Analysis/ Sorting of Viral Particles

1. The analysis is performed on a FACSAria II sorter (BD Biosciences) equipped with a 100 μm nozzle and 405, 488, and 633 nm lasers.

2. An untagged extracellular viral stock should be diluted at the same concentration in MNT as a negative control.

2. Analysis and sorting are done in PBS 1 at low pressure (23 psi) and a flow rate between 1 and 3 for a maximum of 3000 events/s to minimize coincidental events. 3. A minimal threshold of 200 for the SSC channel should be applied to remove the background signal (see Note 27).

Characterization of HSV-1 Particles by Flow Virometry

297

4. Viral particles (capsids or extracellular virions) are initially analyzed by light scattering, where the forward scatter (FSC) is an indication of the size of the particles and side scatter (SSC) indicates the granularity and the internal complexity of these particles. 5. A gate should be applied on the bulk of the particles (>95%) to exclude large aggregates. 6. A second gate should next be applied to sort the fluorescent particles (see Note 28). 7. To favor the sorting of single particles, a purity mask of 16 should be applied (i.e., sorting in purity mode). 8. Analyze the data with FlowJo software (TreeStar) (see Note 29). 3.7 Analysis of Coincidental Events

When analyzing or sorting samples by flow cytometry, one must ensure that single cells or particles are characterized. Proper sample preparation and gating are critical to avoid aggregates and doublets, as is the use of the purity mode when sorting. To control for the passage of two particles at the same time in the flow cytometer, diluting the samples is an effective method, hence our limit of 3000 events/s. A classical assay to monitor coincidental events is to perform a dilution analysis [6, 20]. The assumption is that coincidental events will have higher fluorescence than single events. In contrast, while diluting single particles will reduce their frequency (detection), it should not affect their mean fluorescence. 1. Make twofold dilutions of a viral sample (e.g., 1:50 to 1:400) in MNT. 2. Analyze all the dilutions on a flow cytometer as usual, limiting the analysis to 1 min per sample. 3. Plot the number of events per minute and the mean fluorescence intensity of the particles for each dilution (see Note 30 and Fig. 2).

3.8 Electron Microscopy of the Sorted Viral Particles

Electron microscopy is likely the best way to ascertain the quality of sorting and should routinely be used. This monitors the presence of aggregates or even doublets of viral particles as well as the presence of cellular debris. When probing viral intermediates such as the different HSV-1 nuclear capsids, one can readily evaluate sample purity. 1. Fix an aliquot of the sorted viral particles using a fresh solution of fixation buffer and incubate on ice for 1 h. 2. Concentrate the particles by passing them through a 13 mm Swinney stainless steel holder containing a 0.1 μm Omnipore PTFE hydrophobic membrane filter.

298

Bita Khadivjam et al.

Fig. 2 Analysis of coincidental events. Twofold dilutions (1:50 to 1:400 in MNT) of two different viral preparations were analyzed by FACS, limiting the analysis to 1 min per sample. The number of events per minute and the mean fluorescence intensity (MFI) of the particles at each dilution were plotted using GraphPad Prism version 6 (Reprinted with permission from [6] [Copyright © 2017, American Society for Microbiology, Journal of Virology, Vol. 91, 2017, p. e00320–17, doi: https://doi.org/10.1128/JVI.00320-17])

3. Open the Swinney stainless steel holder and take off the filter containing the sorted particles. 4. Wash the filter with PB and incubate it in postfixation buffer for 1 h at 4
C. 5. Rinse the filter with PB. 6. Dehydrate the filter using increased concentrations of ethanol. 7. Embed the filter in Epon 812 resin. 8. Make ultrathin sections of filter containing viruses using a microtome. 9. Place the filter on naked nickel grids. 10. Contrast the grids using negative staining solution. 11. Examine samples on a transmission electron microscope. 3.9 Thermostability of the Sorted Viral Particles

Sorting of different viral subpopulations such as viruses containing high or low amounts of a given constituent (e.g., capsid, tegument, or envelope protein) brings up the question as to whether they may exhibit different stability. In the case of fully assembled virions, it is readily possible to test this scenario by heating the samples. While

Characterization of HSV-1 Particles by Flow Virometry

299

Fig. 3 Thermostability of the viral particles. Wild type extracellular virions expressing GFP-VP22 (a tegument protein) were sorted for the high or low content. Each was further divided into 3 fractions. The fractions were incubated as follows: at 4
C (untreated samples), 37
C (test samples) or 60
C (inactivating controls) for an hour. The samples were then titrated on Vero cells to assess their stability. As expected, no infectivity was recorded at 60
C (data not shown). The recovery of the two samples was identical at 83%–85% (37
C/4
C). The lower infectivity of the two samples reflects the impact of VP22 on viral fitness, as previously reported [6]

heating does reduce the viability of a viral sample, if two samples behave the same in that assay, then they are equally stable. Figure 3 shows the result of such an assay for viruses selected for their high or low content of one of the viral tegument proteins. 1. Sort viral particles as detailed in the above sections. 2. Divide each sample into 3 fractions. 3. Incubate each fraction for an hour at 4
C (untreated samples), 37
C (test samples) or 60
C (inactivating controls). 4. Titrate the fractions as usual.

4

Notes 1. Given the higher viral productivity in Vero or BHK cells, we typically use these cells to produce our viral stocks. However, if the experiment requires the analysis of human proteins incorporated by viral particles, we instead resort to HeLa cells.

300

Bita Khadivjam et al.

2. When infecting cells to prepare nuclear capsids use a wild-type virus. Later, you must perform SYTO staining to distinguish between the capsids containing the viral DNA (C-capsids) and the ones devoid of the viral genomic material (A- and B-capsids). 3. Pretreatment of MNT with DNase and RNase A ensures the elimination of potential nucleic acid residues in the buffer which otherwise cause false positives during FACS analysis. 4. Add the 5 mM DTT and the proper concentration of protease inhibitors to the lysis buffer immediately before use. 5. Conventional TNE solutions contain 500 mM NaCl salt, however, following the optimization of our nuclear capsid purification procedure we have determined that this salt concentration can lead to the loss of tegument proteins during the extraction. Therefore, we have switched to a milder concentration of NaCl (150 mM) and called the solution modified TNE. 6. Following the optimization of our labeling technique using different dyes, we have found that staining the viral genomic material with SYTO 13 (green fluorescent) or SYTO 61 (red fluorescent) provides a better signal-to-noise ratio compared to Hoechst, DAPI, propidium iodine or other SYTO stains. We typically freshly prepare the SYTO dyes. 7. As mentioned earlier in Note 1, viral yield varies depending on the type of cells used to produce the viral stocks. We have determined that about 1.5  108 Vero cells can produce sufficient amounts of extracellular virus or capsids for FACS analysis. However, if you are using HeLa cells 3  108 are required to produce enough viral particle for sorting. If one decides to use another cell line other than the ones mentioned, the optimal number of cells have to be determined empirically. 8. The formula is: Volume required ðmLÞ ¼ ðQuantity of cells  MOIÞ=Viral titer ðPFU=mLÞ 9. Signs of infection include rounding of cells, the presence of intracellular granules, irregular shape nuclei and detachment of the cells from the tissue culture plate. 10. Filtering the supernatant through a 0.45 μm filter significantly reduces the amount of debris that could later interfere with the flow cytometer and result in unwanted background signal. This also leads to cleaner preparations. 11. Minimum amount of MNT for resuspension is a volume sufficient to cover the area where viral pellet is expected to be present. Note that this pellet is generally not visible and the position of pellet depends on the whether a fixed angle or a swinging bucket rotor was used for centrifugation.

Characterization of HSV-1 Particles by Flow Virometry

301

12. If the SYTO staining of the viral particles is required, DNase I and RNase A treatment of MNT is necessary to remove all freefloating nucleic acids as they will be labeled with the dye and result in a background signal. Conversely, if the viral particles encode a fluorescent tag, DNase I and RNase A treatments are optional but not mandatory. 13. Incubating the pellet overnight with resuspension buffer ensures an optimal resuspension and increases yields. 14. We are using the Fisherbrand sonicator with Micro Cup Horn (intensity 8) and sonicate our stocks for 1 s, ten times on ice. If you are using a different device, you might need to adjust the parameters empirically. 15. Gently perform several ups and downs when resuspending the cell pellet in the lysis buffer until no clumps are visible. Avoid rapid up and down motions as the presence of detergent (Igepal) in the lysis buffer can cause foaming. 16. Verify the cell lysis every 5 min under a light microscope by placing 10 μL of the lysate on a microscopic slide. The nucleus should remain intact throughout the lysis procedure. 17. It is possible to pause the experiment at this point. The nuclear stocks should be snap-frozen in liquid nitrogen and conserved at –80
C for several weeks. 18. It has been shown that 3 s of sonication can lead to partial tegument loss [21]. When capsid yields are already low, which depends on the type of cell used to produce the stocks as mentioned in Note 7, sonication can be problematic. Therefore if the focus of the study is the tegument layer and one is using a cell line with low viral productivity, the sonication step should probably be skipped. 19. Modified TNE contains EDTA that chelates bivalent ions. Therefore, when treating with DNase I, add 20 mM MgCl2 as the Mg2+ ions are required for DNase I activity. 20. Use thin transparent wall tubes compatible for ultracentrifugation as these tubes enable the visualization of capsid bands. 21. When collecting the capsid bands, extra care should be taken to minimize the contamination of each band by the other bands. It is possible to harvest these bands by puncturing the tube with a syringe and needle. Another method to collect the bands is using a peristaltic pump. In the latter case, it is preferable to use a separate set of tubing for each band to avoid cross contamination. 22. The expected yields are around 100 μg of C capsids from 1.5  108 Vero cells and 60 μg from 3  108 HeLa cells. However, this varies for each preparation (the ratio of A, B, and C made by virus) and viral strains.

302

Bita Khadivjam et al.

23. SYTO dyes bind to both RNA and DNA, hence the need for RNase treatments. 24. Since SYTO dyes are fluorescent entities, samples should be protected from light to avoid photobleaching. 25. It is not necessary to wash out the unbound SYTO as it emits very little fluorescence when unbound to nucleic acid. 26. The tagged virus can be a virus expressing a fluorescently tagged capsid, tegument or an envelope protein. 27. For analyses, we typically scrutinize 100,000 particles. For purification purposes, it may take several hours of sorting depending on the planned use (plaque assays, mass spectrometry). This must be defined empirically. 28. It is possible to specifically gate out L-particles, which are devoid of capsids and viral genomes [22], by gating on particles that are stained with SYTO and labeled for a tegument or envelope component [6]. 29. We have found that when staining a GFP-tagged virus with SYTO dyes more than 90% of the GFP-positive population is also positive for SYTO, which shows the high efficiency of this staining technique. 30. A flat line for the mean fluorescence intensity (MFI) strongly argues against coincidental events (as illustrated in Fig. 2).

Acknowledgments This work was supported by grants from the Canadian Institutes of Health Research (MOP 82921). Special thanks to Diane Gingras for the optimization of the EM protocol and Annie Gosselin for her help with the flow cytometry section. We are also indebted to Daniele Gagne´, who initially worked out the protocol on the BD FACSAria sorter. References 1. Klasse PJ (2015) Molecular determinants of the ratio of inert to infectious virus particles. Prog Mol Biol Transl Sci 129:285–326 2. Rezelj VV, Levi LI, Vignuzzi M (2018) The defective component of viral populations. Curr Opin Virol 33:74–80 3. Taha MY, Brown SM, Clements GB (1988) Neurovirulence of individual plaque stocks of herpes simplex virus type 2 strain HG 52. Arch Virol 103:15–25 4. Clarke RW, Monnier N, Li H et al (2007) Two-color fluorescence analysis of individual

virions determines the distribution of the copy number of proteins in herpes simplex virus particles. Biophys J 93:1329–1337 5. Bohannon KP, Jun Y, Gross SP et al (2013) Differential protein partitioning within the herpesvirus tegument and envelope underlies a complex and variable virion architecture. Proc Natl Acad Sci U S A 110:E1613–E1620 6. El Bilali N, Duron J, Gingras D et al (2017) Quantitative evaluation of protein heterogeneity within herpes simplex virus 1 particles. J Virol 91:e00320–e00317

Characterization of HSV-1 Particles by Flow Virometry 7. Trabanelli S, Gomez-Cadena A, Salome B et al (2018) Human innate lymphoid cells (ILCs): toward a uniform immune-phenotyping. Cytometry B Clin Cytom 94:392–399 8. Lippe´ R (2018) Flow virometry: a powerful tool to functionally characterize viruses. J Virol 92. pii: JVI.01765-01717 9. Arakelyan A, Fitzgerald W, Margolis L et al (2013) Nanoparticle-based flow virometry for the analysis of individual virions. J Clin Invest 123:3716–3727 10. Tang VA, Renner TM, Fritzsche AK et al (2017) Single-particle discrimination of retroviruses from extracellular vesicles by nanoscale flow cytometry. Sci Rep 7:17769 11. Loret S, El Bilali N, Lippe´ R (2012) Analysis of herpes simplex virus type I nuclear particles by flow cytometry. Cytometry A 81:950–959 12. Gaudin R, Barteneva NS (2015) Sorting of small infectious virus particles by flow virometry reveals distinct infectivity profiles. Nat Commun 6:6022 13. Tang VA, Renner TM, Varette O et al (2016) Single-particle characterization of oncolytic vaccinia virus by flow virometry. Vaccine 34:5082–5089 14. Arakelyan A, Fitzgerald W, King DF et al (2017) Flow virometry analysis of envelope glycoprotein conformations on individual HIV virions. Sci Rep 7:948 15. Zicari S, Arakelyan A, Fitzgerald W et al (2016) Evaluation of the maturation of individual

303

dengue virions with flow virometry. Virology 488:20–27 16. Arakelyan A, Fitzgerald W, Zicari S et al (2017) Flow virometry to analyze antigenic spectra of virions and extracellular vesicles. J Vis Exp (119) 17. Landowski M, Dabundo J, Liu Q et al (2014) Nipah virion entry kinetics, composition, and conformational changes determined by enzymatic virus-like particles and new flow virometry tools. J Virol 88:14197–14206 18. Musich T, Jones JC, Keele BF et al (2017) Flow virometric sorting and analysis of HIV quasispecies from plasma. JCI Insight 2: e90626 19. Dargan DJ, Subak-Sharpe JH (1997) The effect of herpes simplex virus type 1 L-particles on virus entry, replication, and the infectivity of naked herpesvirus DNA. Virology 239:378–388 20. Nolan JP (2015) Flow cytometry of extracellular vesicles: potential, pitfalls, and prospects. Curr Protoc Cytom 73:13.14.11–13.14.16 21. Newcomb WW, Brown JC (2010) Structure and capsid association of the herpesvirus large tegument protein UL36. J Virol 84:9408–9414 22. Szilagyi JF, Cunningham C (1991) Identification and characterization of a novel non-infectious herpes simplex virus-related particle. J Gen Virol 72:661–668

Chapter 17 Isolation/Analysis of Extracellular Microvesicles from HSV-1-Infected Cells Raquel Bello-Morales and Jose´ Antonio Lo´pez-Guerrero Abstract Extracellular vesicles (EVs) are secreted membrane vesicles, derived from endosomes or from the plasma membrane, which have been isolated from most cell types and biological fluids. Although EVs are highly heterogeneous and their classification is complex, two major categories can be distinguished: microvesicles (MVs), which derive from the shedding of the plasma membrane, and exosomes, which correspond to intraluminal vesicles released to the extracellular milieu upon fusion of multivesicular bodies (MVBs) with the plasma membrane. Cells infected with viruses may secrete MVs containing viral proteins, RNAs and, in some instances, infectious virions. A recent study carried out by our laboratory has shown that MVs released by cells infected with HSV-1 contained virions and were endocytosed by naı¨ve cells leading to a productive infection. This suggests that HSV-1 may use MVs for spreading, expanding its tropism and evading the host immune response. Here we describe in detail the methods used to isolate and analyse the MVs released from HSV-1-infected cells. Key words HSV-1, Extracellular vesicles, Microvesicles, Differential centrifugation protocols

1

Introduction Extracellular vesicles (EVs) are membrane vesicles secreted by most cell types and isolated from most biological fluids that play significant roles in intercellular communication and also in numerous physiological and pathological processes, such as viral infections and immune responses [1–6]. EVs are highly heterogeneous and, therefore, their classification and nomenclature is complex. However, two major categories can be distinguished: microvesicles (MVs)—derived from the shedding of the plasma membrane [7–9] and exosomes—the intraluminal vesicles released to the extracellular space upon fusion of multivesicular bodies (MVBs) with the plasma membrane [2, 7]. Regarding the size, exosomes are typically 30–100 nm in diameter while MVs have a more heterogeneous size, spanning from 100 nm to 1 μm in diameter [5, 10].

Russell J. Diefenbach and Cornel Fraefel (eds.), Herpes Simplex Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2060, https://doi.org/10.1007/978-1-4939-9814-2_17, © Springer Science+Business Media, LLC, part of Springer Nature 2020

305

306

Raquel Bello-Morales and Jose´ Antonio Lo´pez-Guerrero

Exosomes are enriched in tetraspanins such as CD9, CD63, and CD81, and also in endosomal markers such as ALIX and TSG101, whereas MVs are enriched in lipid raft proteins such as flotillin-1 and expose phosphatidylserine on the outer leaflet of the membrane [11–14]. Due to their common biogenesis pathways, EVs and viruses have been considered close relatives [15] and, certainly, EVs seem to function as an important system of intercellular communication between infected and uninfected cells, acting as relevant elements in the course of viral infections [3, 4, 16–20]. During the viral life cycle, EVs may perform processes with contrasting effects, such as the inhibition or the promotion of infection, and they may also modulate the immune responses [3]. EVs may also transport viral genomes to target cells and interfere with cell physiology to facilitate infection [21]. The production of secreted vesicles by cells infected with HSV-1 has been well described. The first to be discovered were the L-particles, vesicles similar to virions but lacking the viral nucleocapsid and genome [22]. Although L-particles are noninfectious, they seem to facilitate HSV-1 infection, since these particles deliver viral proteins and cellular factors required for virus replication and immune evasion [23, 24]. On the other hand, cells infected with HSV-1 may secrete exosomes carrying viral RNA and stimulator of IFN genes (STING) to uninfected cells [25]. A recent study carried out in our laboratory [26] has shown that MVs released by HSV-1-infected cells contained virions and were endocytosed by naı¨ve cells—even in the absence of specific viral receptors—leading to a productive infection. This suggests that HSV-1 may use MVs for dissemination, expanding its tropism, and evading the host immune responses. Here we describe in detail the methods to isolate MVs secreted by HSV-1 infected cells and the different approaches to analyse them.

2 2.1

Materials Viral Infections

1. Fetal bovine serum (FBS), sterile filtered. 2. Millex sterile syringe filters, 0.22 μm (Millipore). 3. Sterile Falcon Tissue Culture Flasks (175 cm2), polystyrene, vented cap. 4. Growth medium (GM): Dulbecco’s Modified Eagle’s Medium (DMEM) low glucose supplemented with 1000 mg/l glucose, L-glutamine, 50 U/ml penicillin, 50 μg/ml streptomycin, 3.57 g/l HEPES, 1.5 g/l sodium bicarbonate, and 10% FBS. 5. Differentiation medium (DM): Low-glucose DMEM containing 50 U/ml penicillin, 50 μg/ml streptomycin, 50 μg/ml

Microvesicles from HSV-1-Infected Cells

307

apo-transferrin, 0.5 mg/l insulin, 30 nM triiodothyronine (T3), 30 nM sodium selenite, and 16.1 mg/l putrescine. Briefly before use, add 3-isobutyl-1-methylxanthine (IBMX) and dibutyryl cyclic-AMP (dbcAMP)—an inhibitor of cAMP and cGMP phosphodiesterases—to a final concentration of 0.5 mM each. 6. PBS: 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4 and 1.8 mM KH2PO4; pH 7.4. 7. HSV-1 strain F [26]. 2.2

Isolation of MVs

1. Allegra X-12R swinging-bucket rotor (Beckman Coulter). 2. Polycarbonate bottles with screw cap (30 ml). 3. F0630 fixed-angle rotor (Beckman Coulter).

2.3 Analysis of MVs by Nanoparticle Tracking Analysis (NTA)

1. Micro tubes, 2 ml. 2. Hank’s Balanced Salt Solution (HBSS). 3. NanoSight LM10 system (NanoSight, Wiltshire, UK), equipped with fast video capture and particle-tracking software. Videos are collected and analysed using the NTA software, version 2.3. 4. BD Emerald™ 2 ml syringe.

2.4 Analysis of MVs by SDS-PAGE

1. RIPA buffer: 50 mM Tris–HCl pH 7.4, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS. 2. Materials (reagents, instruments, and equipment) for SDS–polyacrylamide gel electrophoresis (SDS-PAGE) as described [27, 28]. 3. Fixed-angle Eppendorf™ microcentrifuge 5424 R. 4. 5
Laemmli buffer: 10% SDS, 50% glycerol, 0.25% bromophenol blue, and 250 mM Tris–HCl pH 6.8. Before use add 2-mercaptoethanol to a final concentration of 12.5%. 5. Phenylmethanesulfonyl fluoride (PMSF). 6. Protease inhibitor cocktail in DMSO. 7. Micro tubes, 1.5 ml.

2.5 Staining MVs with PKH26

1. PKH26 Red Fluorescence Cell Linker Mini Kit for General Cell Membrane Labelling (Sigma). 2. Sterile 5 ml test tubes. 3. Round glass coverslips ;12 mm. 4. 4% paraformaldehyde (PFA). 5. Sterile 24-well tissue culture plates.

308

Raquel Bello-Morales and Jose´ Antonio Lo´pez-Guerrero

2.6 Electron Microscopy

1. 5 mM EDTA in PBS. 2. 2% PFA in PBS. 3. Glow-discharged collodion/carbon coated copper grids. 4. 1% uranyl acetate in distilled H2O. 5. 0.1% saponin in PBS. 6. Rabbit polyclonal anti-HSV-1 antibody. 7. Protein A-gold, 10 nm (Cell Microscopy Center, Utrecht University, The Netherlands). 8. 1.8% methyl cellulose in distilled H2O. 9. 4% PFA and 2% glutaraldehyde in 0.1 M phosphate buffer (PB) pH 7.4. 10. 1% osmium tetroxide (OsO4) and 1% potassium ferricyanide (K3Fe(CN)6) in distilled H2O. 11. Epoxy, TAAB 812 Resin (TAAB Laboratories). 12. 0.1% lead citrate.

3

Methods According to previous studies, the relative centrifugal force set to isolate MVs ranges from 10,000 to 20,000
g [29–31]. In our study, we have followed a widely used protocol based on a centrifugation step of 10,000
g for 30 min [32–36]. All experiments described here correspond to the first studies carried out in our laboratory, performed with an oligodendroglial model: the HOG cell line. To induce differentiation, these cells were cultured in differentiation medium (DM). Nevertheless, the isolation method described here can equally be performed using other culture media. It is important to note that the presence of FBS might alter the results. The DM lacks FBS, therefore contamination of our MVs preparation with EVs present in the serum is prevented. To isolate MVs from other cell lines, such as Hela or MeWo, DMEM supplemented with 1% exosome-depleted FBS can be used. This FBS is commercially available from a number of suppliers. Otherwise, to eliminate EVs, FBS can be centrifuged at 4  C for 18 h at 100,000
g [37]. The EVs-depleted FBS should be, in addition, filtered through a 0.22 μm Millex sterile syringe filter.

3.1

Viral Infections

1. Two days prior to the infection, plate 1
107 HOG cells in each of 4 175 cm2 Falcon flasks (see Note 1). The number of cells may vary between different cell lines. Culture cells in GM supplemented with 10% FCS. 2. The day before infection, change the GM to DM. To culture in differentiation conditions, wash cells with serum-free GM and culture for 24 h with DM (see Note 2). This step should be

Microvesicles from HSV-1-Infected Cells

309

omitted for other cell lines that do not need to be differentiated. 3. The day of infection, prepare the viral inoculum. The final volume of the inoculum will be calculated as 1 ml per 25 cm2 of culture surface. Thus, for each 175 cm2 flask the final volume will be 7 ml. Add 15 ml of serum-free GM (corresponding to two flasks) to a 50 ml Falcon conical centrifuge tube (see Note 3) and then, add the corresponding amount of HSV-1 stock to the medium as to infect at a multiplicity of infection (moi) of 1 TCID50 per cell (see Note 4). Prepare a second Falcon tube with 15 ml of serum-free GM (for each 175 cm2 tissue culture flask) without the virus as the mock control. 4. Wash the cells with serum-free GM (see Note 5), add the inoculum, and incubate the flasks for 1 h at 37  C in an atmosphere of 5% CO2 (see Note 6) for viral adsorption. 5. After adsorption, remove the viral inoculum and the corresponding mock-inoculum, and wash twice with 10 ml of serum-free GM (see Note 7). Add 15 ml of fresh DM per flask or, alternatively, 1% exosome-depleted culture medium for other cell lines. 6. Incubate the flasks for 24 h at 37  C in an atmosphere of 5% CO2. 3.2

Isolation of MVs

EVs isolated from infected cells may be similar in size to viruses and, therefore, it may be very difficult to separate virions from vesicles. In general, the complete separation of vesicles and viruses according to their density and diameter is not yet possible, due to the heterogeneity of all parameters involved in differential centrifugation [15, 38, 39]. Indeed, our results have indicated that MV fractions isolated from infected HOG cells are not free of HSV-1 virions [26]. Therefore, in order to design appropriate controls, it is necessary to quantify the number of virions remaining in the MV fraction by titration. To design this control, the difference between the viral titers before and after the 10,000
g centrifugation step is calculated, which allows to determine the number of infectious virions that had been pelleted along with the MVs. Perform all centrifugations and isolation steps at 4  C. 1. After step 6 of Subheading 3.1, collect the supernatants at 24 h p.i. from infected and mock-infected flasks (30 ml for each experimental point) and transfer them to one each (infected and mock-infected) 50 ml Falcon tube. Centrifuge the tubes at 400
g for 10 min in a swinging-bucket rotor and transfer the supernatant to another 50 ml Falcon tube (see Note 8). 2. Centrifuge the tube at 2500
g for 15 min and transfer the supernatant to 30 ml polycarbonate bottles. Save 100 μl of supernatant for titration (Titer 1).

310

Raquel Bello-Morales and Jose´ Antonio Lo´pez-Guerrero

3. Centrifuge the polycarbonate bottles at 10,000
g for 30 min in a fixed-angle centrifuge. Discard the supernatant—saving 100 μl for titration (Titer 2)—and resuspend the pellet, which contains the MVs, in 10 ml of PBS (see Note 9). Centrifuge again at 10,000
g for 30 min and process the pellet for the corresponding experiment (see Note 10). 4. Titer the supernatants by standard procedures. The number of infectious virions that had been pelleted along with the MVs will be V ¼ Titer 1  Titer 2 (see Note 11). 3.3 Analysis of MVs by Nanoparticle Tracking Analysis (NTA)

This assay aims to quantify the concentration and size of MVs by Nanoparticle Tracking Analysis (NTA). 1. Resuspend the pellet containing the MVs—obtained as described in Subheading 3.2—in 2 ml of serum-free DMEM in a 2 ml microcentrifuge tube and keep it at 4  C until NTA. 2. Dilute 0.5 ml of each sample in 1.5 ml of HBSS to prepare a 1:4 dilution. Inject these 2 ml of diluted samples in the NanoSight LM10 chamber using a 2 ml syringe without needle (see Note 12). For each measurement, ambient temperature will be recorded manually. 3. Analyse the samples and record 4 videos per sample (see Note 13).

3.4 Analysis of MVs by SDS-PAGE

MVs are lysed in RIPA buffer and the samples analysed by SDS-polyacrylamide gel electrophoresis (SDS-PAGE). Throughout the lysis of the MVs suspension, all steps must be performed in ice or at 4  C. 1. Resuspend the pellet containing the MVs—obtained as described in Subheading 3.2—in 200 μl ice-cold RIPA buffer with freshly added PMSF and protease inhibitor cocktail. Leave the MVs suspension on ice for 15 min. 2. Centrifuge the lysate at 15,000
g for 10 min at 4  C to pellet the cell debris and then transfer supernatant to a new tube (see Note 14). 3. Add 50 μl of 5
Laemmli buffer to the lysate and mix well. Depending on the primary antibody, perform SDS-PAGE under nonreducing conditions. 4. Boil the samples at 95  C in a heat block for 5 min. 5. Subject the samples (30 μl) to SDS-PAGE in 10% acrylamide gels as described [26] and then transfer the proteins to PVDF membranes. 6. Incubate blots with shedding MV markers, such as integrin β-1 and flotillin-1, and complete the immunoblot assay as described [26].

Microvesicles from HSV-1-Infected Cells

3.5 Staining MVs with PKH26

311

To analyze whether MVs can be endocytosed by naı¨ve cells, MVs are isolated from noninfected HOG cells as described above and then stained with the red dye PKH26 following the manufacturer’s instructions. Finally, the stained MVs are added to naı¨ve cells. After incubation of the cell–MV mixture, the cells are washed, fixed, and stained for visualization by confocal fluorescence microscopy. All staining steps are performed in sterile conditions and at ambient temperature (20–25  C). 1. The day before the staining experiment, plate 2
105 HOG cells per well of a 24-well tissue culture plate (Falcon) containing round glass coverslips. 24 h later, the cells should have a confluency of 80%. Culture cells in GM with 10% FBS. 2. The day of the staining experiment, aspirate the supernatant of the polycarbonate 30 ml tube containing the MVs pellet— obtained as described in Subheading 3.2—without disturbing the pellet. 3. Add 1 ml of diluent C—the aqueous labeling vehicle provided in the PKH26 Red Flourescence Cell Linker Mini Kit—(2
cell suspension) to the pellet and resuspend it carefully. 4. Dilute 4 μl of PKH26 ethanolic dye solution into 1 ml of diluent C (2
dye solution) in a 5 ml tube and mix well to disperse. 5. Add the 1 ml 2
cell suspension to the 1 ml of 2
dye and incubate it for 5 min (see Note 15). 6. Quench the staining reaction by addition of 2 ml of FBS. 7. Divide the labeled sample into 2 ml tubes and centrifuge them at 10,000
g for 30 min in a fixed-angle microcentrifuge at 4  C. 8. Aspirate the supernatant and resuspend the pellet of each tube in 200 μl of DMEM with 10% FBS. 9. Aspirate the medium of the wells containing HOG cells cultured over coverslips and add the MVs to the cells. Include a control without MVs (see Note 16). 10. Incubate the mixture of cells and MVs for 2 h at 37  C. 11. Aspirate the mixture, wash cells with PBS and fix them with 4% PFA in PBS for 15 min. After that, aspirate the PFA and wash twice with PBS. 12. Stain cells with an antibody that allows visualizing the boundaries of the cells—such as phalloidin—conjugated with a green or far-red fluorophore (see Note 17); perform the immunofluorescence assay as described elsewhere [26] and observe the specimen by confocal microscopy.

312

Raquel Bello-Morales and Jose´ Antonio Lo´pez-Guerrero

3.6 Electron Microscopy

1. Resuspend the MV pellet obtained as described in Subheading 3.2 in 40 μl of PBS containing 5 mM EDTA.

3.6.1 Negative Staining

2. Add an equal volume of 2% PFA for fixation. MVs in 2% PFA can be stored up to 1 week at 4  C before proceeding further. 3. Adsorb 10 μl of this fraction onto glow-discharged collodion/ carbon coated copper grids for 10 min. 4. Float the grids on a small drop of 1% aqueous uranyl acetate for 45 s. 5. Let the samples air dry before observation under the TEM. 6. Alternatively, grids can be contrasted and embedded with methyl cellulose-uranyl acetate [37] as follows. 7. Transfer grids to a 100-μl drop of a mixture of 1.8% methylcellulose and 0.4% uranyl acetate, incubating on ice for 10 min. 8. Remove the grids with a stainless steel loop and blot excess fluid by pushing the loop sideways on Whatman filter paper n 50 so that a thin film is left behind over the sample side of the grid. Let the samples air dry before observation under the TEM.

3.6.2 Immunoelectron Microscopy

Perform immunogold labeling of MVs at room temperature unless indicated otherwise. 1. Permeabilize the MV pellet obtained as described in Subheading 3.2 with 0.1% saponin for 5 min. 2. Incubate at room temperature with a rabbit polyclonal antiHSV-1 antibody conjugated with 10 nm protein A-gold diluted 1:500 in PBS containing 5% FBS for 45 min. After immunolabeling, wash the samples in distilled H2O and embed them in a mixture of 1.8% methyl cellulose and 0.4% uranyl acetate at 4  C. 3. To examine grids, we have used a Jeol JEM-1010 electron microscope at 80 kV and, to record images, a TemCam-F416 (4K
4K) digital camera from TVIPS.

3.6.3 Conventional TEM with Methylcellulose/ Uranyl Acetate

To study the endocytosis of MVs, conventional Epon embedding methods can be used. To that aim, MVs isolated from infected cells are layered onto HOG cells—cultured in a 24-well plate—and incubated with cells before fixation and processing for electron microscopy. 1. The first day of the experiment, plate cells in 175 cm2 Falcon flasks as in step 1 of Subheading 3.1. Proceed as described in Subheading 3.1 to isolate the MVs. 2. The third day (see Note 18), plate 2
105 HOG cells in a 24-well tissue culture plate. 24 h later, the cells should have a confluency of 80%.

Microvesicles from HSV-1-Infected Cells

313

3. The fourth day, isolate the MVs by centrifugation as described in Subheading 3.1. Then, resuspend the MVs in 200 μl of serum-free DM and layer them onto the HOG cells seeded in the 24-well plate the day before (see Note 19). 4. Incubate the plate for 1 h at 4  C to avoid internalization of MVs (see Note 20). Then, shift to 37  C for 15 min to allow the first stages of endocytic processes, aspirate the medium of the wells, and fix the mixture cells/MVs with 4% PFA and 2% glutaraldehyde in 0.1 M PB, pH 7.4 for 90 min at RT. 5. Carry out post-fixation with 1% OsO4 and 1% K3Fe(CN)6 at 4  C for 1 h. 6. Dehydrate samples with ethanol and flat-embed them in situ in Epoxy, TAAB 812 Resin according to standard procedures. 7. After polymerization for 48 h at 60  C, detach the resin blocks containing the cell monolayers from the wells and mount them on the microtome to obtain orthogonal (from the bottom to the top of the cell) 80-nm ultrathin sections. Deposit the sections onto slot grids and stain them with uranyl acetate and lead citrate as previously described [40].

4

Notes 1. The number of flasks used for MV isolation is limited only by handling reasons and, thus, the experiment should not exceed a manageable number of flasks. 2. Cells can also be cultured with other standard media, such as DMEM or RPMI, with 1% exosome-depleted FBS. 3. Infections with serum-free cell culture medium avoid the variability of serum and enable to standardize the cell culture conditions. 4. The moi ¼ 1 has been chosen in order to get a high amount of EVs from infected cells vs. from uninfected ones. 5. Cells may also be washed with PBS. However, washing with serum-free medium will imply less modification in culture conditions. 6. During viral adsorption, rock the flasks gently every 15 min to prevent the cells from drying out. 7. This washing step is important in order to minimize the presence of virions derived from the viral stock in the EV fraction. 8. It is important not to disturb the pellet when transferring the supernatant. To meet that, do not transfer the whole volume (30 ml) of supernatant to the next tube but, instead, transfer only 29.5 ml, leaving 500 μl behind.

314

Raquel Bello-Morales and Jose´ Antonio Lo´pez-Guerrero

9. If the cells have been cultured without FBS, this wash step can be omitted. With each centrifugation step, a small fraction of MVs may be lost. 10. Depending on the number of flasks and the secretory capacity of the cells, the total amount of isolated MVs can vary considerably and, therefore, the pellet obtained might be difficult to see. Thus, immediately after taking out the centrifuged samples, it is recommended to mark the centrifuge tube with a marker at the region where the pellet is expected (the tube bottom in case of a swinging bucket-rotor or the tube wall opposite to the rotation axis in case of a fixed-angle rotor). In addition, it is also critical to avoid disturbing the MV pellet. 11. Although calculating the number of infectious virions pelleted along with the MVs is not necessary for many assays—such as the protein profile analysis by SDS-PAGE, the NTA, or the electron microscopy of virions enclosed in MVs—this data might be necessary as a control for other types of experiments. Therefore, if it is not necessary, this step can be omitted. 12. MV fractions isolated from infected cells are not free of HSV-1 virions, but the difference in size between HSV-1 virions (700 Hz), thereby reducing image resolution. Very fast biological processes require high-speed imaging systems. Resonance scanning systems allow line frequencies of up to 16 kHz. 18. Some confocal scanning microscopes automatically set the pinhole diameter to 1 Airy unit (AU) by default. The AU value refers to the diameter of the airy disk of a fluorophore, which is the inner, intense light circle of the diffraction pattern from this source of light. A good setting can be calculated as the airy disk diameter. AU ¼ 1.21
l/NA which resembles the area inside the first zero of the diffraction pattern generated by a circular aperture. Closing the pinhole decreases the section thickness and brightness, but increases resolution to a certain point. Opening the pinhole allows to detect even lower intensities of fluorescent signals, but decreases resolution dramatically. 19. We recommend reducing the transmitted laser intensity for imaging as much as possible to avoid bleaching, especially when taking time series or z-stack series for 3D reconstructions. The minimal laser intensity required to acquire optimal fluorescent intensity has to be determined empirically by starting with 1%. HyD detectors are very sensitive and do not require laser intensities above 5%. In addition, line averaging can help reducing noise and increasing the fluorescent intensity. Choose averaging, particularly if using weak fluorophores, to significantly reduce noise without affecting the genuine signal, thereby improving signal to noise ratio. The number of line acquisitions and line averaging has to be determined empirically. We recommend performing a test scan to determine the number of scans per line and series. To do so, set a high number for line and series averaging (e.g., 10) and perform a test scan of an irrelevant area in the specimen. While scanning, the number of repeats can be determined as the point from which the image resolution is not further improved with additional scans.

374

Michael Seyffert and Cornel Fraefel

20. Avoid oversampling, as the same user-defined resolution will be used to scan the specific area (e.g., 512
512 pixels). In particular, the use of zoom-in to select scan areas may lead to oversampling (i.e., capturing an image at a resolution that is beyond the optical capabilities of the microscope). Usually, for visible light and high NA objectives (NA > 0.8), the pixel size of ~0.1–0.2 μm is ideal. We recommend using zoom factors of 2–8
at the most. 21. The use of sequential rather than simultaneous scanning diminishes the bleed-through between the channels during acquisition, as each fluorophore is excited and recorded separately. 22. When using multiple fluorescent color detection channels, we recommend setting the scanning sequence according to the detected wavelength, starting with the most sensitive fluorophores in the red spectrum and ending with the UV-light channels for Hoechst or DAPI followed by the transmitting light channel. Turn off all irrelevant lasers. Only one laser should be on at a time for each sequential scan in order to avoid bleed through. 23. We suggest collecting time lapse series (xyt-scan mode) of a defined area of infected cells, as this provides reliable data on temporal dynamics and spatial organization of HSV-1 proteins during the course of infection. When performing longer timecourse scans (e.g., 12–24 h), it might be necessary to turn on the autofocus mode. We do not recommend to make 3D scans using z-stacks during time-course experiments. The phototoxic burden is too high and bleaching occurs very rapidly. 24. Every .lif-file is associated with a corresponding metafile containing the meta data. If you move .lif-files from one folder to another, make sure to copy the corresponding meta file too. 25. The selected image is appearing in the Easy 3D view by default. Imaris® will open all associated fluorescent channels at the same time, if the sample was taken with the sequential mode (see step 18 in Subheading 3.2). If not, the corresponding channels can be added (Edit ! Add channels, or by pressing Ctrl + Shift + A). In addition, the time course series will appear in Imaris® with a time course navigator at the bottom of the images, allowing cycling through all the pictures. This allows to review the entire time course experiment a first time. 26. The colors for each channel used here should represent the emission color of the fluorophore used in the study to avoid confusion (e.g., blue for the DAPI channel). However, if more than three colors are needed, we recommend using white or purple in addition to the three colors blue, yellow/green, and red.

Live Analysis of HSV-1 Replication

375

27. This function is used to improve the visibility of fluorescent channels and should not be exploited to generate manipulated data. 28. A very common method to determine colocalization is to set the pseudo colors with base colors from the RGB color palette for each channel and assess the degree of colocalization by estimating the additive property of the colors (e.g., green + red ¼ yellow). We strongly do not recommend this method, as such datasets lead to misinterpretations and false positive results. Instead we suggest using a software function such as the Coloc from Imaris®. However, there are a couple of issues, which have to be considered when performing colocalization analysis: avoid bleed-through of the channels when scanning the sample, avoid oversampling, and keep the signal to noise ratio as low as possible. Thresholding of each channel enables “gating” of the pixels exhibiting colocalization and is the crucial step in this process. Imaris® provides a function to determine the thresholds automatically. We recommend that beginners use this feature. Resolution limitations have to be considered when interpreting colocalization data, in particular the axial dimension (axial resolution is typically 500 nm only, which is insufficient to resolve lower distances, e.g. structures of 100 nm in diameter). This issue can be countered by deconvolution of the acquired images. We suggest using the Huygens Professional deconvolution tool (v.18.10). Overall, we strongly recommend visiting the developer’s home page (http://www.bitplane.com) for a detailed tutorial on colocalization measurements. 29. We suggest saving the images as TIFF-files, as this format retains the highest resolution and is the preferred format for most journals. 30. Every channel should be saved as an individual file, but additional merged images provide helpful illustrations of certain features (e.g., colocalization and spatial organization). In addition, the complete scene can be saved as .ims- or .imx-files (File ! Export Scene, or by pressing Ctrl + E). These file formats allow opening the entire scene created with the sample picture(s) without losing any settings and adjustments performed previously. 31. We recommend saving as H264 movies in the .mp4-format using the highest quality. This will create rather large movie files, but it helps in maintaining the resolution necessary to visualize the small structures in the specimen.

376

Michael Seyffert and Cornel Fraefel

References 1. Walker-Daniels J, Faklaris O (2012) Live cell imaging methods review. Mater Methods 2:124 2. Witte R, Andriasyan V, Georgi F et al (2018) Concepts in light microscopy of viruses. Viruses 10(4):202

3. De Oliveira AP, Glauser DL, Laimbacher AS et al (2008) Live visualization of herpes simplex virus type 1 compartment dynamics. J Virol 82:4974–4990

Chapter 23 Expression, Purification, and Crystallization of HSV-1 Glycoproteins for Structure Determination Ellen M. White, Samuel D. Stampfer, and Ekaterina E. Heldwein Abstract Herpes simplex viruses utilize glycoproteins displayed on the viral envelope to perform a variety of functions in the viral infectious cycle. Structural and functional studies of these viral glycoproteins can benefit from biochemical, biophysical, and structural analysis of purified proteins. Here, we describe a general protocol for expression and purification of viral glycoproteins from insect cells based on those developed for the HSV-1 gB and HSV-2 gH/gL ectodomains as well as the protocol for crystallization of these glycoproteins. This protocol can be used for generating milligram amounts of wild-type (WT) or mutant gB and gH/gL ectodomains or can be adapted to produce purified ectodomains of glycoproteins from HSV or other herpesviruses for biochemical and structural studies. Key words Herpes simplex viruses, Glycoproteins, Viral entry, Ectodomain, Crystallography, Protein purification

1

Introduction Herpes simplex virus types 1 and 2 (HSV-1 and HSV-2) are enveloped viruses that display 12 glycoproteins and three nonglycosylated proteins on their surface. These proteins perform a variety of functions in the viral infectious cycle, including entry into the host cell by mediating membrane fusion, cell–cell spread, viral egress, and other yet unclear roles [1–3]. Being surface exposed, they also modulate the immune response, and some generate neutralizing antibodies [4, 5]. Their surface exposure and essential functions make them promising targets for the development of drugs and vaccines. HSV glycoproteins gD, gH, gL, and gB are necessary [6–9] and sufficient [10] for viral entry into the host cell. The receptorbinding protein gD binds one of its three cellular receptors, which determines viral tropism [1, 11]. Binding to a cognate receptor triggers a conformational change in gD that is thought to lead to the activation of gH/gL and, ultimately, gB during the host cell

Russell J. Diefenbach and Cornel Fraefel (eds.), Herpes Simplex Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2060, https://doi.org/10.1007/978-1-4939-9814-2_23, © Springer Science+Business Media, LLC, part of Springer Nature 2020

377

378

Ellen M. White et al.

fusion process [11, 12]. While the specific role of the heterodimer gH/gL in the membrane fusion process is unknown, it is thought to activate gB in response to an activating signal from gD [13, 14] and may function as a fusion adaptor protein [15]. gB is a class III viral fusogen [16] that undergoes a conformational rearrangement from the prefusion to the postfusion form [17, 18]. Most HSV glycoproteins are anchored to the membrane by at least one transmembrane region. The presence of a transmembrane anchor presents many challenges to isolation of glycoproteins. While detergents have successfully been used to solubilize integral membrane proteins, solubilization of membrane proteins containing large external portions has remained challenging. Thus, isolation of glycoprotein ectodomains has great appeal. The ectodomains of several HSV glycoproteins, gD, gB, and the gH/gL heterodimer, have been successfully produced as purified proteins, which has been critical for understanding how they work. In particular, the ability to produce large quantities of homogenous proteins has allowed the determination of their crystal structures. The crystal structures of gD alone and bound to two different receptors have provided detailed knowledge of gD/receptor interactions [12, 19–22]. The crystal structures of gB and gH/gL, determined in our laboratory, have led us to propose that gB functions as a viral fusion protein [17] whereas gH/gL serves a fusion activator [23] during cell entry and cell–cell fusion, which was confirmed in subsequent studies. The structures of all four proteins have also aided the mapping of their functional regions [11]. Finally, the ability of purified gD and gH/gL ectodomains to function in cell–cell fusion assays, albeit with reduced efficiency, suggested that membrane anchoring is not essential for the function of these proteins during cell fusion [13, 24], consistent with their regulatory roles. The ectodomains of gD, gH/gL, and gB were produced as secreted proteins in insect cells infected with recombinant baculoviruses. The use of baculovirus expression vector systems (BEVS) technology for expression of recombinant proteins, including glycoproteins, has been described elsewhere (e.g., [25]), and will not be covered here. The advantage of using insect cells is that unlike in bacterial cells, proteins expressed in insect cells can be properly folded, posttranslationally modified (glycosylated or proteolytically processed), and trafficked [25]. Insect cells are also relatively simple to propagate, can be easily grown in suspension cultures, and protein expression can be easily scaled up to large volumes at significantly lower cost than in mammalian cells. Finally, BEVS utilizes baculoviruses, which are easily manipulated and relatively safe to use. Using BEVS, recombinant genes of interest are expressed under the control of the polyhedrin promoter of baculovirus. To ensure that the glycoproteins are transported to the cell membrane or extracellular space after expression, their genes must

Expression, Purification, and Crystallization of HSV Glycoprotein Ectodomains

379

include an endogenous or heterologous signal sequence, e.g., from honeybee melittin. Detailed instructions for recombinant baculovirus generation are listed in the Bac-to-Bac™ Baculovirus Expression System manual [26]. We typically expand the initial baculovirus stock in two passaging steps. The resulting passage 3, also referred to as P3, can be used to infect insect cells for protein production. While the protocol described here uses Sf9 insect cells, Sf21 or High Five™ insect cells can also be used. Prior to expression, DNA fragments encoding the protein region of interest must be subcloned into a plasmid vector suitable for baculovirus generation. Although there are several BEVS systems currently on the market, we use the Bac-to-Bac™ Baculovirus Expression System (Thermo Fisher Scientific) [26] due to its simplicity and relative speed of generating recombinant baculoviruses because it does not require the use of a plaque assay. For the HSV-1 gB ectodomain, henceforth referred to as gB730, DNA encoding residues 31-730 was subcloned into pFastBac™ vector (Thermo Fisher Scientific), with the honeybee melittin signal sequence. Wild-type gB730 and several mutants and derivatives have been purified using this strategy [27–29], yielding 0.5–2 mg of purified protein per liter of insect cell culture. The gH and gL glycoproteins must be co-expressed for proper complex formation [7, 23, 30]. Therefore, gH and gL were subcloned into the pFastBacDual™ vector (Thermo Fisher Scientific) that allows for expression of two genes from separate late baculovirus promoters. Two versions of the soluble gH/gL complex have been expressed using this approach: gH803-H6/gL, which contains the entire gH ectodomain, residues 19-803, with a C-terminal His6 tag and full-length gL, residues 1-224, [29]; and Δ48gH803H6/gL, which lacks residues 19-47 of gH but is otherwise identical to gH803-H6/gL [23]. Δ48gH803-H6/gL is the only HSV gH/gL complex crystallized thus far [23] whereas both gH803H6/gL and Δ48gH803-H6/gL have been used in functional assays [13, 31]. Each complex was produced using the same protocol that yields ~250 μg of homogeneous complex per liter of insect cell culture. Here, we describe a general protocol for expression and purification of glycoproteins in Sf9 cells based on those developed for the ectodomains of HSV-1 gB730 (residues 31-730) and HSV-2 gH803-H6/gL (residues 19-803 of gH and full-length gL). gB is used as an example of a glycoprotein purified using immunoaffinity while gH/gL is an example of a glycoprotein purified through the use of an affinity tag. In this case, we used immobilized metal-ion affinity chromatography (IMAC) purification via a hexahistidine tag. Although yields of pure protein per liter of insect cells vary for the three glycoproteins, from 250 μg for gH/gL to 2 mg for gB to 10 mg for gD, all three have been produced in the amounts sufficient for crystallization and functional assays. Crystallization

380

Ellen M. White et al.

and freezing of crystals of HSV-1 WT gB730 and HSV-2 Δ48gH803-H6/gL (the construct described above, missing the first 47 residues of gH) is also described. These protocols can be used for the production of the WT or mutant constructs of gB or gH/gL for biochemical, structural, or functional use. With slight modification, these protocols can be adapted for the production of other HSV glycoproteins or glycoproteins from other viruses.

2

Materials

2.1 Protein Expression

1. A setup for growing insect cells in suspension in spinner flasks (see Note 1), including several 3-L spinner flasks with a 2-port airflow assemblies, a magnetic stir plate for spinner flasks, an air pump, a gas blending stand, ¼00 inner diameter autoclavable plastic tubing, and 0.2 μm air filter units (Millex-FG50 or similar). Available as a kit from Bellco or may be purchased separately. 2. Refrigerated incubator set to 27  C. 3. Laminar flow hood (biosafety cabinet) for sterile work. 4. Sf9 cells adapted to growth in suspension culture in serum-free insect cell media. 5. Serum-free insect cell growth medium (e.g., Sf-900 II SFM). 6. Pen-Strep solution: 10,000 IU penicillin, 10,000 μg/mL streptomycin in 100 mL of distilled water. 7. P3 stock of recombinant baculovirus encoding the glycoprotein gene of interest (see Note 2). 8. Trypan blue solution: 0.4% trypan blue (w/v) in PBS.

2.2 Protein Purification

1. Assembled tangential flow filtration (TFF) system (see Note 3). 2. 1-L bottle top 0.22 μm filters and 1- or 2-L compatible bottles. 3. Empty 10-mL chromatography column (e.g., Bio-Rad PolyPrep® chromatography columns). 4. Small peristaltic pump (capable of 0.1–20 mL/min flow rates). 5. PBS buffer: phosphate-buffered saline pH 7.4. 6. TN Buffer: 20 mM Tris-HCl pH 8.0, 150 mM NaCl. 7. TNE Buffer: 20 mM Tris-HCl pH 8.0, 150 mM NaCl, 1 mM EDTA. 8. Phenylmethylsulfonyl fluoride (PMSF) solution: 100 mM PMSF in isopropanol (caution: cytotoxic, use eye protection). 9. Superdex 200 10/300 GL column or a similar size-exclusion column.

Expression, Purification, and Crystallization of HSV Glycoprotein Ectodomains

381

10. Amicon Ultra-15 50K concentrator (Millipore) or a similar concentrator. 11. Amicon Ultra-4 50K concentrator (Millipore) or a similar concentrator. 12. 0.1 μm PVDF centrifugal filter. 13. Immunoaffinity column prepared by conjugating 10–15 mg of purified IgG to 1 mL of CNBr-Activated Sepharose™ 4B (GE Healthcare) or a similar resin following the manufacturer’s instructions and then packed into an empty 10-mL chromatography column. For purification of HSV-1 gB730, we typically use monoclonal antibody DL16 [32]. 14. AB-W buffer: 10 mM Tris-HCl pH 8.0, 500 mM NaCl. 15. Potassium thiocyanate (KSCN) solution: 3 M KSCN in distilled water. 16. Sodium azide solution: 0.025% sodium azide in distilled water. 17. IMAC resin: Ni Sepharose Excel (GE Healthcare Life Sciences), Nickel Sepharose 6 Fast Flow (GE Healthcare Life Sciences), or a similar Ni resin (see Note 4). 18. Nutating shaker. 19. Ni-B buffer: 20 mM Tris-HCl pH 8.0, 150 mM NaCl, 20 mM imidazole. 20. Ni-W buffer: 20 mM Tris-HCl pH 8.0, 500 mM NaCl, 40 mM imidazole. 21. Ni-E buffer: 20 mM Tris-HCl pH 8.0, 150 mM NaCl, 300 mM imidazole. 22. Imidazole stock solution: 4 M imidazole in distilled water. 23. EDTA solution: 0.5 M EDTA pH 8.0 in distilled water. 2.3

Crystallization

1. 24-well pregreased crystallization plates (Hampton Research). 2. 22 mm siliconized circle cover slides (Hampton Research). 3. Aerosol duster (Thermo Fisher Scientific) or in-house air. 4. Stereomicroscope for crystal observation. 5. gB crystallization solution: 15% PEG (polyethylene glycol) 4000 (w/v), 200 mM NaCl, 100 mM Na citrate pH 5.5, sterile filtered. 6. gH/gL crystallization solution: 20% PEG 4000 (w/v), 100 mM Na citrate pH 4.5, sterile filtered. 7. CryoLoops (Hampton Research). 8. Cryo storage vials with compatible mounting bases (e.g., CrystalCap Copper Magnetic [Hampton Research]). 9. CrystalWand handling tool and a vial clamp (Hampton Research).

382

Ellen M. White et al.

10. CryoCanes and CryoSleeves for storage of cryo storage vials (Hampton Research). 11. 0% mesoerythritol gB cryopreservation (cryo) solution: 15% PEG 4000 (w/v), 350 mM NaCl, 100 mM Na citrate pH 5.5. 12. 5% mesoerythritol gB cryo solution: 5% mesoerythritol (v/v), 15% PEG 4000 (w/v), 350 mM NaCl, 100 mM Na citrate pH 5.5. 13. 10% mesoerythritol gB cryo solution: 10% mesoerythritol (v/v), 15% PEG 4000 (w/v), 350 mM NaCl, 100 mM Na citrate pH 5.5. 14. 15% mesoerythritol gB cryo solution: 15% mesoerythritol (v/v), 15% PEG 4000 (w/v), 350 mM NaCl, 100 mM Na citrate pH 5.5. 15. gH/gL cryo solution: 20% xylitol (w/v), 20% PEG 4000 (w/v), 150 mM NaCl, 100 mM Na citrate pH 4.5. 16. Liquid nitrogen. 17. Liquid nitrogen Dewar flasks for crystal freezing and temporary crystal cane storage (Hampton Research).

3

Methods

3.1 Protein Expression

1. Wash, assemble, and autoclave 3-L spinner flasks and the 2-port airflow assemblies with 0.2 μm air filters as per the manufacturer’s instructions (see Note 5). 2. Expand Sf9 cells to obtain appropriate volume of suspension culture in log phase at a density of 2  106 cells/mL using SF900II SFM plus Pen-Strep solution. The viability should be 97% or above as determined by trypan blue staining (see Note 6). Cell culture volume should be calculated based on the required amount of pure protein and the expected yield. 1–1.6-L cultures can be grown in a 3-L flask. Our typical yields are ~2 mg HSV-1 gB730 per liter of culture or 250 μg HSV-2 gH803-H6/gL per liter of culture. 3. In a laminar flow biosafety cabinet, infect Sf9 cells with recombinant baculovirus by adding 4–10 mL of P3 per 1 L of cells (see Note 7). 4. Incubate infected cells for 72 h at 27  C, with a spinner setting of 75–90 rpm and with airflow adjusted to prevent excessive bubble accumulation (see Note 8).

3.2 Removal of Medium Components from Insect Cell Supernatants

1. Harvest the cell culture supernatant containing secreted protein by centrifuging the cell suspension at 3725  g for 35 min at 4  C. Discard the pellet. For this and all subsequent steps, a sterile environment is not required.

Expression, Purification, and Crystallization of HSV Glycoprotein Ectodomains

383

2. During the centrifugation step, begin flushing the TFF system with distilled water according to the manufacturer’s instructions. After flushing the TFF system with water, equilibrate the TFF filter with PBS for at least 15 min at 4  C in a cold room (see Note 9). 3. Vacuum filter the supernatant through a 1-L 0.22 μm bottletop filter. 4. Add PMSF solution to a final concentration of 0.1 mM to inhibit proteases. Take out a 50 μL aliquot of this sample to monitor protein loss during purification. 5. Transfer the filtered supernatant to a cold room. All subsequent steps must be done at 4  C to reduce protein degradation. 6. Properly position the tubing of the TFF system prior to starting TFF. Place the end of the large feed flow tube into the bottle containing the supernatant; this bottle will act as the feed tank (Fig. 1). Thread the rest of the large feed flow tube through the Easy-Load peristaltic pump. Direct the end of the retentate tube (coming out of the edge of the top surface of the TFF filter) back into the feed tank. Direct the permeate tube into a waste container (Fig. 1). Turn on the pump and adjust the hosecock clamp on the retentate tube to achieve the desired pressure to drive filtration (see Note 10).

Fig. 1 A schematic of the tangential flow filtration (TFF) setup described in Note 3. The supernatant is pumped into a pressurized filter. The filtrate (permeate) is removed, and the retentate is recirculated. Buffer can be added to replace lost medium. Arrows indicate the direction of the flow and the tubing

384

Ellen M. White et al.

7. Once the supernatant is reduced to the desired volume (we typically use 350–550 mL: 200–400 mL in the bottle and 150 mL in the tubing of the TFF system), begin buffer exchange (see Note 11). 8. Set up Exponential Buffer Exchange: First measure the amount of permeate being produced, in mL/min. Then set up a small peristaltic pump to add the desired buffer (PBS for gB730, or TN for gH/gL) to the supernatant at the same rate that permeate is being removed. This is the quickest way to do buffer exchange but is not suitable for all preparations (see Note 12). 9. Perform buffer exchange until the percentage of original media in the retentate has been reduced to the desired amount: 0.5% for gB730 and 0.2% for gH803-H6/gL (see Note 13). 10. When finished concentrating the supernatant or performing buffer exchange, place the feed flow tubing in a bottle that contains 200–300 mL of PBS (the retentate tubing should remain in the feed tank). Loosen the hosecock clamp on the retentate tubing and pump the PBS through the TFF filter until the PBS has flowed through the TFF system but stopping before air gets pumped through the TFF filter. Do this even if buffer exchange is not performed to help remove residual protein that may be on the TFF filter. 11. Add PMSF solution to a concentration of 0.1 mM and save 50 μL aliquots of the TFF retentate and permeate to monitor protein loss during purification. 12. For gB and other proteins purified using immunoaffinity, go to Subheading 3.3. For gH/gL and other proteins purified by Ni IMAC, go to Subheading 3.4. Purification using other affinity tags will require protocol modification based on the affinity resin manufacturer’s instructions. 3.3 Immunoaffinity Purification

1. Equilibrate the immunoaffinity column in AB-W buffer using a peristaltic pump. This and all subsequent purification steps are done at 4  C. 2. Load the TFF retentate onto the immunoaffinity column using a small peristaltic pump and adjust the flow rate such that the retentate will bind the column overnight. Save a 50 μL aliquot of the flow through to monitor protein loss during purification. 3. Wash the column with ~70 column volumes (CV) of AB-W buffer to remove nonspecifically bound proteins and other molecules. This step should be optimized for optimal protein purity and yield. Save a 50 μL aliquot of the wash fraction.

Expression, Purification, and Crystallization of HSV Glycoprotein Ectodomains

385

4. Add 20 μL of PMSF solution to an empty tube and elute into that tube at 1 mL/min with 20 CV of KSCN solution. Save a 50 μL aliquot of the eluate fraction. Concentrate the eluate to 1 mL or less in an Amicon-15 concentrator prior to further purification by size-exclusion chromatography. Go to Subheading 3.5 for the next step: size-exclusion chromatography. 5. Wash the column with 75 CV of AB-W buffer plus sodium azide solution to prevent microbial growth and seal it for storage. 3.4

IMAC Purification

1. To reduce nonspecific binding to the Ni resin, 20 mM imidazole should be added to the TFF retentate containing gH/gL (see Note 14). This step should be optimized for optimal protein purity and yield. 2. Capture gH/gL on Ni resin in a batch-binding mode by incubating 0.5 mL of Ni resin with 45 mL TFF retentate in a 50 mL conical tube for 1 h at 4  C on a nutating shaker (see Note 15). This and all subsequent steps are done at 4  C. 3. Recover the Ni resin containing bound gH/gL by centrifuging the 50 mL conical tube at 1000  g for 5 min. Remove the supernatant and collect it in a container labeled flow through. Repeat steps 2 and 3 until all the TFF retentate containing gH/gL has been mixed with the Ni resin for binding. We recommend saving all flow through in this and subsequent steps for SDS-PAGE analysis. 4. Resuspend the Ni resin with 5 mL Ni-B buffer in the 50 mL conical tube and then transfer it to an empty 10 mL chromatography column. Rinse the 50 mL conical tube with 2–3 mL of Ni-B buffer to collect residual Ni resin from the sides of the tube and add it to the chromatography column. Allow the Ni-B buffer to flow through the column and collect in container labeled wash 1. We recommend using gravity flow for gH/gL purification (see Note 16). 5. Wash the column with 10 column volumes (CV) of Ni-B buffer (see Note 17) and continue to collect the flow through in the container labeled wash 1. 6. Wash the column with 10 CV of Ni-W buffer and collect the flow through in a container label wash 2. This step is required for gH/gL to remove a 43 kDa cathepsin contaminant (see Note 18). 7. Prepare a 15 mL conical tube containing 20 μL of PMSF solution and 100 μL of EDTA solution. Elute into this tube using 10 CV of Ni-E buffer (see Note 19). Imidazole concentrations and the volume of Ni-E buffer should be optimized. Concentrate the eluate to 1 mL or less in an Amicon-15

386

Ellen M. White et al.

concentrator. Further purification is then done using sizeexclusion chromatography, as described in Subheading 3.5. 3.5 Size-Exclusion Chromatography

1. Load the concentrated protein purified by IMAC or immunoaffinity chromatography into a 0.1 μm PVDF centrifugal filter and centrifuge the protein at 17,000  g and 4  C for 10 min to remove any particulates. Load the protein onto a size-exclusion column (e.g., Superdex S200 10/30 GL) equilibrated in TNE buffer and collect the peak corresponding to monodisperse protein. gB730 elutes ~2.5 mL after the void volume while gH/gL elutes ~5.5 mL after the void volume on a Superdex S200 10/30 GL column. 2. Concentrate the protein to 3.5–4.5 mg/mL (gB730) or 1.4–1.8 mg/mL (gH803-H6/gL) using an Amicon Ultra-4 concentrator. Concentrations of 4–6 mg/mL are recommended for initial crystallization trials on other glycoproteins.

3.6

Crystallization

1. Use a pipette tip to make a notch in the grease ring around the edge of each well in a pre-greased 24-well plate. 2. Add 750 μL of filtered crystallization solution to each well that will be used (see Note 20). 3. Briefly spray a siliconized glass cover slip with air, and put it face up on a clean work surface. Add 1 μL crystallization solution and 1 μL protein to the center of the cover slip; then flip it over and use it to seal the well. Use the back of a 1 mL pipet tip to press the cover slip down evenly without smudging it. Repeat these steps with additional crystal setups. 4. Store the crystal plate in a vibration-free environment at a constant temperature. gB crystals appear as hexagonal rods after 3–6 days and grow to their final sizes of 0.1–0.5 mm after 2–4 weeks. It is normal for some granular precipitate to appear within 48 h. gH/gL crystals are tetragonal and appear after 4–5 days, growing to their final size of 0.1–0.2 mm after 2–3 weeks (Fig. 2). 5. Freezing gH/gL crystals. Working at the microscope, place a 2 μL drop of gH/gL cryo solution on a new siliconized glass cover slide. Carefully remove the cover slide with the crystal drop from the well and flip it over. Use a mounted cryoloop of appropriate size (slightly larger than the crystal) on the end of the long crystal wand to scoop up a crystal and place it in the drop of cryo solution briefly (10 s to 5 min), and then plunge the crystal into liquid nitrogen (see Note 21). Use the vial clamp to place the vial on the crystal cap without removing either from liquid nitrogen. Store vials long term in CryoCanes surrounded by cryosleeves in a liquid nitrogen Dewar flask or collect data on them immediately.

Expression, Purification, and Crystallization of HSV Glycoprotein Ectodomains

387

Fig. 2 (a) Elongated trigonal crystals of HSV-1 gB730. (b) a tetragonal crystal of HSV-2 Δ48gH803/gL

6. Freezing gB crystals. gB crystals are not all grown under the same crystal conditions. The cryo solution for gB should match the well solution in which the crystals grew plus an extra 150 mM NaCl to account for NaCl present in the protein solution and 15% mesoerythritol as a cryoprotectant. gB requires stepwise addition of cryoprotectant, so cryo solutions containing 0%, 5%, 10%, and 15% mesoerythritol should be made prior to freezing crystals. Initially transfer the crystal into a 2 μL drop of 0% mesoerythritol gB cryo solution. Then add 2 μL of the 5% mesoerythritol gB cryo solution drop and remove 2 μL of liquid from the other side of the drop, watching carefully to avoid pipetting up the crystal. Repeat this with the 10% and 15% gB cryo solutions. Finally, transfer the crystal briefly to a drop of 15% mesoerythritol gB cryo solution, and then plunge into liquid nitrogen and proceed as described for gH/gL crystals.

4

Notes 1. Use of aeration is necessary for growing insect cells in volumes of 1 L and above. Insect cells can also be grown in shaker flasks, but that method is not described here. 2. The recombinant baculovirus used for gB730 expression encodes HSV-1 gB residues 31-730 with a melittin signal sequence, described previously [17, 32]. The HSV-2 Δ48gH803-His6/gL construct used for crystallization encodes all of gL and the N-terminally truncated gH ectodomain 48-803, as well as the gH N-terminal signal sequence, residues 1-18, also described previously [23]. 3. Several complete TFF systems are available on the market. Nevertheless, due to its reliability and low cost, we recommend assembling a basic TFF system from separate components, which include an Easy-Load Peristaltic Pump (Millipore

388

Ellen M. White et al.

XX80EL000) with dedicated 3/800 inner diameter tubing (Millipore XX802GS25), a pressure gauge (Millipore YY1301015) with fittings for 5/1600 inner diameter tubing, a Prep/Scale 30 kDa TFF Filter (Millipore), a ring stand and clamps to hold the system in place, 3/1600 inner diameter tubing (Millipore XX8000T24) (for permeate), 5/1600 inner diameter tubing (for retentate), fuel hose clamps, and a hosecock clamp (Fisher 05-847Q). The TFF system should be assembled as follows: Connect 4 ft of the large feed flow tubing used for the Easy-Flow Pump (3/800 inner diameter) to the pressure gauge via the fittings. Seal the connection by wrapping the connected end of the tubing (over the fitting) with two layers of paper towel and tightening a fuel hose clamp around the paper towel. Repeat this method to connect the other end of the pressure gauge to the feed port on the bottom of the TFF filter; use paper towel plus fuel hose clamps to tighten the tubing at both the fitting on the pressure gauge and at the feed port on the TFF filter. Connect ~3 ft of 5/1600 diameter tubing to the retentate port on the TFF filter; connect ~4 ft of 3/1600 tubing to the permeate port in the middle of the top of the TFF filter. Place a hosecock clamp on the retentate tubing near its connection to the TFF filter. Flush with distilled water at 20 psi for at least 2 min to ensure that there are no leaks (loosen or tighten fuel hose clamps to eliminate leaks). See Fig. 1 and the TFF filter documentation for additional details. 4. Use of the Ni Sepharose Excel resin eliminates the need for buffer exchange before binding the protein to the Ni resin because this resin is more resistant to being stripped by the metal-chelating agents in the cell media, so the filtered supernatant can be applied directly to the resin. 5. Spinner flasks should be autoclaved twice. For the first autoclave cycle, use a 20 min liquid cycle without attaching air filters and with ~100 of distilled water at the bottom of the flask. After the first cycle, empty the water from the flask and attach the air filters to airflow ports on the flask. Then cover all caps, airflow ports, and filters on the flask with aluminum foil. For the second autoclave cycle, use a 30- or 40 min gravity cycle. 6. Take a 1 mL sample of the insect cell suspension culture. Mix 10 μL of the insect cell suspension culture sample with 10 μL of trypan blue solution to make a 1:1 dilution of the cell suspension in trypan blue. Load 10 μL of the cell suspension with the trypan blue onto a hemocytometer. Cells that appear blue are dead and cells that appear white are living. Count the living and the dead cells (separately) in one 1  1 mm square of the hemocytometer. The viability can be determined by dividing the number of living cells by the total number of cells.

Expression, Purification, and Crystallization of HSV Glycoprotein Ectodomains

389

7. It is not necessary to determine the titer of baculovirus stocks used for protein expression because the amount of baculovirus necessary to achieve optimal protein expression is best determined experimentally. In our experience, using 4–10 mL of P3 stock per 1 L cells at a density 2  106 cells/mL is typically a good starting point regardless of the glycoprotein nature and often does not require further optimization. During optimization of protein expression, we find it helpful to monitor cells death during expression. If excessive cell death, viability of 60% or less, is observed after 3 days, the amount of P3 used for infection should be decreased. If protein expression is low, the amount of P3 used for infection should be increased. Volumes within a 1–20 mL range have been used successfully. 8. Air settings of 25–50 mL/min are often used for 1 L cultures and of 50–100 mL/min for 1.6 L cultures, but airflow should be adjusted to minimize frothing on the surface of the culture (no more than a thin layer of bubbles and should not appear foamy). 9. The TFF system may be flushed with distilled water at either room temperature or at 4  C. However, it is ideal to equilibrate the system with PBS at 4  C. To equilibrate the TFF system in PBS the inlet tubing, waste tubing, and retentate tubing all go into the “feed tank” bottle of 400 mL of PBS so that the PBS is recycled as it flows through the system. Refer to Fig. 1. 10. We recommend using the maximum pressure that will not damage the filter. We use 10 psi. Higher pressures provide faster filtration but may promote protein aggregation. 11. Buffer exchange only needs to be done for immunoaffinity purification or if using standard Ni resin for purification. Longer time for TFF and buffer exchange may lead to protein aggregation on the TFF filter. 12. Exponential buffer exchange works quickly because, at every moment, the highest possible fraction of supernatant is replaced by buffer. However, it is done at low volume (high protein concentration) and high pressure; some proteins may aggregate under these conditions. In that case, either try exponential buffer exchange at a higher static volume (500 mL or more instead of 350 mL) or do buffer exchange by iterative dilution: pouring in 1 L buffer every time the total volume drops to the desired low point (350 mL, which is 200 mL in the bottle and 150 mL in the TFF system). 13. For exponential buffer exchange, the percent of original media components still present in the retentate can be calculated by using the “continuously compounded interest” equation r b ¼ ae ð v Þt , where b is the current percent of original media, a is the original percent (100, unless some buffer exchange was

390

Ellen M. White et al.

done previously), r is the permeate flow rate (mL/min), v is the retentate volume, and t is the time (minutes). For iterative dilution buffer exchange (see Note 12), the equation used for each dilution is ¼ aVV dc , where b is the current percent of original media after the retentate has been diluted, a is the percent prior to dilution, and Vc and Vd are the volumes of retentate both before and after dilution (which includes the approximately 150 mL of retentate circulating through the TFF system). We find that 0.5% works well for gB and recommend this value for other proteins purified using immunoaffinity chromatography. gH/gL requires more extensive TFF, to 0.2% or less original media, due to presence of cobalt in the insect cell medium possibly interfering with binding of the His6-tag on gH/gL to Ni resin. This step should be optimized for different constructs, and especially for different affinity tags. Contact the manufacturer of the insect cell medium to find out which components may interfere with the specific affinity purification. 14. For some His-tagged proteins, addition of 10 mM imidazole or leaving out imidazole helps improve binding. 15. Batch binding is required for effective binding of gH/gL to Ni resin. Several 50 mL conical tubes with Ni resin may be used to speed up the binding process. Other proteins may efficiently bind Ni resin using gravity or peristaltic pump-aided flow. 16. For gH/gL, yield of monodisperse protein is improved slightly when using gravity flow instead of pumps. Peristaltic flow at 2 mL/min can be used to accelerate purification during all steps and typically works well with other proteins. 17. Longer wash with Ni-B buffer may be necessary depending on the preparation size. The amount of washing and imidazole concentration may need to be optimized for other proteins. For His-tagged proteins other than gH/gL, we recommend starting with a 10 mM imidazole concentration in the initial wash buffer. 18. Longer wash with Ni-W buffer may be necessary. Imidazole concentration, salt concentration, and the amount of washing may need to be optimized for other proteins. For His-tagged proteins other than gH/gL, we recommend starting with a 20 mM imidazole and 100–150 mM NaCl in the Ni-W buffer. 19. To increase gH/gL purity, 140 mM imidazole can be used during the elution step because several contaminants bind Ni resin more tightly than gH/gL. 20. gH/gL crystallizes with 20% PEG 4000 and 100 mM Na citrate, pH 4.5. Optimization of these conditions did not improve crystals in our experience. Crystal reproducibility is low, and we recommend setting up multiple identical crystallization drops for gH/gL. gB crystallizes under multiple

Expression, Purification, and Crystallization of HSV Glycoprotein Ectodomains

391

conditions [17, 27, 28] but most easily under 15% PEG 4000, 200 mM NaCl, and 100 mM Na citrate, pH 5.5. Larger crystals can often be obtained by reducing PEG 4000 concentration to 10% or lower. gB crystallization can be optimized by a grid screen of 0.1, 0.2, 0.3, 0.4, and 0.5 M NaCl versus 1% increments of PEG 4000 from 6% to 15%. 21. Crystal drops will begin to dry out once exposed to air. 2 μL of well solution may be added to the drop to prevent crystal degradation short-term, up to 30 min, although doing so may compromise the drop if the coverslip is resealed onto the well for later use.

Acknowledgments We acknowledge the contributions of the laboratory of Roselyn Eisenberg and Gary Cohen toward the development of the initial purification protocols of HSV-1 gB730 and HSV-2 gH803/gL produced using recombinant baculoviruses. We also thank Tirumala K. Chowdary and Sapna Sharma for their work in establishing and optimizing these protocols in our laboratory. Finally, we thank past and present members of the Heldwein lab for helpful advice and discussions. References 1. Heldwein EE, Krummenacher C (2008) Entry of herpesviruses into mammalian cells. Cell Mol Life Sci 65(11):1653–1668. https://doi. org/10.1007/s00018-008-7570-z 2. Johnson DC, Baines JD (2011) Herpesviruses remodel host membranes for virus egress. Nat Rev Microbiol 9(5):382–394. https://doi. org/10.1038/nrmicro2559 3. Johnson DC, Huber MT (2002) Directed egress of animal viruses promotes cell-to-cell spread. J Virol 76(1):1–8 4. Cairns TM, Huang ZY, Whitbeck JC, Ponce de Leon M, Lou H, Wald A, Krummenacher C, Eisenberg RJ, Cohen GH (2014) Dissection of the antibody response against herpes simplex virus glycoproteins in naturally infected humans. J Virol 88(21):12612–12622. https://doi.org/10.1128/JVI.01930-14 5. Cairns TM, Huang ZY, Gallagher JR, Lin Y, Lou H, Whitbeck JC, Wald A, Cohen GH, Eisenberg RJ (2015) Patient-specific neutralizing antibody responses to herpes simplex virus are attributed to epitopes on gD, gB, or both and can be type specific. J Virol 89 (18):9213–9231. https://doi.org/10.1128/ JVI.01213-15

6. Davis-Poynter N, Bell S, Minson T, Browne H (1994) Analysis of the contribution of herpes simplex virus type 1 membrane proteins to the induction of cell-cell fusion. J Virol 68:7586–7590 7. Roop C, Hutchinson L, Johnson DC (1993) A mutant herpes simplex virus type 1 unable to express glycoprotein L cannot enter cells, and its particles lack glycoprotein H. J Virol 67 (4):2285–2297 8. Ligas MW, Johnson DC (1988) A herpes simplex virus mutant in which glycoprotein D sequences are replaced by b-galactosidase sequences binds to but is unable to penetrate into cells. J Virol 62:1486–1494 9. Cai WH, Gu B, Person S (1988) Role of glycoprotein B of herpes simplex virus type 1 in viral entry and cell fusion. J Virol 62(8):2596–2604 10. Rogalin HB, Heldwein EE (2016) Characterization of vesicular stomatitis virus pseudotypes bearing essential entry glycoproteins gB, gD, gH, and gL of herpes simplex virus 1. J Virol 90 (22):10321–10328. https://doi.org/10. 1128/JVI.01714-16

392

Ellen M. White et al.

11. Eisenberg RJ, Atanasiu D, Cairns TM, Gallagher JR, Krummenacher C, Cohen GH (2012) Herpes virus fusion and entry: a story with many characters. Viruses 4(5):800–832. https://doi.org/10.3390/v4050800 12. Krummenacher C, Supekar VM, Whitbeck JC, Lazear E, Connolly SA, Eisenberg RJ, Cohen GH, Wiley DC, Carfi A (2005) Structure of unliganded HSV gD reveals a mechanism for receptor-mediated activation of virus entry. EMBO J 24(23):4144–4153. https://doi. org/10.1038/sj.emboj.7600875 13. Atanasiu D, Saw WT, Cohen GH, Eisenberg RJ (2010) Cascade of events governing cell-cell fusion induced by herpes simplex virus glycoproteins gD, gH/gL, and gB. J Virol 84 (23):12292–12299. https://doi.org/10. 1128/JVI.01700-10 14. Atanasiu D, Saw WT, Eisenberg RJ, Cohen GH (2016) Regulation of HSV glycoprotein induced cascade of events governing cell-cell fusion. J Virol 90:10535. https://doi.org/10. 1128/JVI.01501-16 15. Stampfer SD, Heldwein EE (2013) Stuck in the middle: structural insights into the role of the gH/gL heterodimer in herpesvirus entry. Curr Opin Virol 3(1):13–19. https://doi.org/ 10.1016/j.coviro.2012.10.005 16. Backovic M, Jardetzky TS (2009) Class III viral membrane fusion proteins. Curr Opin Struct Biol 19(2):189–196. https://doi.org/10. 1016/j.sbi.2009.02.012. S0959-440X(09) 00031-1 [pii] 17. Heldwein EE, Lou H, Bender FC, Cohen GH, Eisenberg RJ, Harrison SC (2006) Crystal structure of glycoprotein B from herpes simplex virus 1. Science 313(5784):217–220 18. Fontana J, Atanasiu D, Saw WT, Gallagher JR, Cox RG, Whitbeck JC, Brown LM, Eisenberg RJ, Cohen GH (2017) The fusion loops of the initial prefusion conformation of herpes simplex virus 1 fusion protein point toward the membrane. MBio 8(4):e01268-17. https:// doi.org/10.1128/mBio.01268-17 19. Carfi A, Willis SH, Whitbeck JC, Krummenacher C, Cohen GH, Eisenberg RJ, Wiley DC (2001) Herpes simplex virus glycoprotein D bound to the human receptor HveA. Mol Cell 8(1):169–179 20. Di Giovine P, Settembre EC, Bhargava AK, Luftig MA, Lou H, Cohen GH, Eisenberg RJ, Krummenacher C, Carfi A (2011) Structure of herpes simplex virus glycoprotein D bound to the human receptor nectin-1. PLoS Pathog 7(9):e1002277. https://doi.org/10. 1371/journal.ppat.1002277

21. Lee CC, Lin LL, Chan WE, Ko TP, Lai JS, Wang AH (2013) Structural basis for the antibody neutralization of herpes simplex virus. Acta Crystallogr D Biol Crystallogr 69 (Pt 10):1935–1945. https://doi.org/10. 1107/S0907444913016776 22. Lu G, Zhang N, Qi J, Li Y, Chen Z, Zheng C, Gao GF, Yan J (2014) Crystal structure of herpes simplex virus 2 gD bound to nectin-1 reveals a conserved mode of receptor recognition. J Virol 88(23):13678–13688. https:// doi.org/10.1128/JVI.01906-14 23. Chowdary TK, Cairns TM, Atanasiu D, Cohen GH, Eisenberg RJ, Heldwein EE (2010) Crystal structure of the conserved herpesvirus fusion regulator complex gH-gL. Nat Struct Mol Biol 17(7):882–888. https://doi.org/ 10.1038/nsmb.1837. nsmb.1837 [pii] 24. Cocchi F, Fusco D, Menotti L, Gianni T, Eisenberg RJ, Cohen GH, Campadelli-Fiume G (2004) The soluble ectodomain of herpes simplex virus gD contains a membraneproximal pro-fusion domain and suffices to mediate virus entry. Proc Natl Acad Sci U S A 101(19):7445–7450 25. Kost TA, Condreay JP, Jarvis DL (2005) Baculovirus as versatile vectors for protein expression in insect and mammalian cells. Nat Biotechnol 23(5):567–575. https://doi.org/ 10.1038/nbt1095 26. Bac-to-Bac Baculovirus Expression System (2018) Bac-to-Bac Baculovirus Expression System. User guide. Revision B. Thermo Fisher Scientific, Waltham, MA 27. Stampfer SD, Lou H, Cohen GH, Eisenberg RJ, Heldwein EE (2010) Structural basis of local, pH-dependent conformational changes in glycoprotein B from herpes simplex virus type 1. J Virol 84(24):12924–12933. https:// doi.org/10.1128/JVI.01750-10 28. Vitu E, Sharma S, Stampfer SD, Heldwein EE (2013) Extensive mutagenesis of the HSV-1 gB ectodomain reveals remarkable stability of its postfusion form. J Mol Biol 425 (11):2056–2071. https://doi.org/10.1016/j. jmb.2013.03.001 29. Hannah BP, Cairns TM, Bender FC, Whitbeck JC, Lou H, Eisenberg RJ, Cohen GH (2009) Herpes simplex virus glycoprotein B associates with target membranes via its fusion loops. J Virol 83(13):6825–6836. https://doi.org/10. 1128/JVI.00301-09. JVI.00301-09 [pii] 30. Hutchinson L, Browne H, Wargent V, DavisPoynter N, Primorac S, Goldsmith K, Minson AC, Johnson DC (1992) A novel herpes simplex virus glycoprotein, gL, forms a complex with glycoprotein H (gH) and affects normal

Expression, Purification, and Crystallization of HSV Glycoprotein Ectodomains folding and surface expression of gH. J Virol 66:2240–2250 31. Atanasiu D, Cairns TM, Whitbeck JC, Saw WT, Rao S, Eisenberg RJ, Cohen GH (2013) Regulation of herpes simplex virus gB-induced cellcell fusion by mutant forms of gH/gL in the absence of gD and cellular receptors. MBio 4

393

(2):e00046–13. https://doi.org/10.1128/ mBio.00046-13 32. Bender FC, Whitbeck JC, Ponce de Leon M, Lou H, Eisenberg RJ, Cohen GH (2003) Specific association of glycoprotein B with lipid rafts during herpes simplex virus entry. J Virol 77(17):9542–9552

Chapter 24 Expression, Purification, and Crystallization of Full-Length HSV-1 gB for Structure Determination Rebecca S. Cooper and Ekaterina E. Heldwein Abstract HSV glycoproteins play important roles in the viral life cycle, particularly viral cell entry. Here we describe the protocol for expression, purification, and crystallization of full-length HSV-1 glycoprotein B. The protocol provides a framework for incorporating transmembrane domain-stabilizing amphipols into the crystallization setup and can be adapted to isolate other complete HSV glycoproteins. Key words Herpes simplex viruses, Glycoproteins, Viral entry, Ectodomain, Crystallography, Protein purification, Membrane protein

1

Introduction Herpes Simplex Viruses Type 1 and 2 (HSV-1 and HSV-2) are enveloped viruses that must fuse their surrounding membrane with those of target cells to cause infection. Of the approximately dozen glycoproteins that stud a virion’s surface, just four—gD, the gH/gL heterodimer, and gB—are required for this entry process [1, 2]. These proteins may act in series to effect fusion, beginning with the binding of gD to one of its three cellular receptors [3]. Receptor binding triggers a conformational change in gD that facilitates its interaction with gH/gL [4]. Activated gH/gL can then initiate the refolding of gB, a class III fusogen, from its prefusion to postfusion form [5–7]. This conformational change in gB is expected to be a dramatic and thermodynamically favorable rearrangement, providing the energy to merge the membranes surrounding the HSV virion and its target cell [8]. While gD is encoded only by α-herpesviruses—β- and γ-herpesviruses rely upon unrelated glycoproteins to engage receptors—the gB fusogen is highly conserved amongst all herpesviruses. gB may utilize the gH/gL heterodimer, which is also present in all herpesviruses but has a comparatively more variable sequence and domain

Russell J. Diefenbach and Cornel Fraefel (eds.), Herpes Simplex Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2060, https://doi.org/10.1007/978-1-4939-9814-2_24, © Springer Science+Business Media, LLC, part of Springer Nature 2020

395

396

Rebecca S. Cooper and Ekaterina E. Heldwein

arrangement, to act as an adaptor to this diverse pool of receptorbinding proteins [9]. Given its universal role, structural information on gB is potentially relevant to the treatment of many herpesviruses, including the design of vaccines and therapies for human cytomegalovirus [10, 11]. Many HSV glycoproteins possess at least one transmembrane region, but due to the difficulty of extracting these proteins from the membrane, most studies have focused on their soluble ectodomains. The ectodomains of several HSV glycoproteins, gD [3, 12–15], gB [5, 16], and the gH/gL heterodimer [17], have been expressed as secreted proteins and crystallized. These structures have provided a wealth of information on these proteins, identifying their functional domains and how gD interacts with its receptors [2]. Yet despite the advances made through these ectodomain studies, there are compelling reasons to study HSV glycoproteins as full-length constructs. First, of the four essential entry glycoproteins, only gD functions efficiently as a soluble or generically anchored construct [4, 18]. In gH/gL, the apparent simplicity of the complex’s single-pass transmembrane helix and unstructured tail belie the latter’s critical role in triggering fusion. Fusion is progressively reduced by shortening this tail, which may interact with the internal cytoplasmic domain (cytodomain) of the gB fusogen itself [19]. This large, trimeric domain requires contact with anionic membranes to fold and is a key regulator of the ectodomain fusion machinery [20, 21]. The cytodomain is effectively responsible for maintaining gB in its prefusion state, the architecture of which remains unknown, and engineered and clinically isolated mutations in the cytodomain lower the energetic barrier to fusion [22]. These mutations coincide with its key structural features and points of interdomain contact in the recently solved full-length gB structure [23]. Strategies for trapping the elusive prefusion conformation or investigating how input from gH/gL is registered will benefit from this more complete picture of gB. Additionally, exploration of how cytodomain changes are transmitted to the ectodomain requires structural knowledge of the intervening transmembrane and membrane proximal regions. Insect cells infected with recombinant baculovirus were used to produce gBd71 (HSV-1 gB 72-904), a construct in which the native signal sequence is replaced by a melittin signal sequence and a portion of the flexible N-terminus prone to degradation is omitted. Unlike proteins produced in bacterial cells, proteins expressed in insect cells can be properly folded, posttranslationally modified (glycosylated or proteolytically processed), and trafficked to produce soluble or membrane-embedded products [24]. Insect cells are also relatively simple to grow, and protein expression can be easily scaled up to large volumes at significantly lower cost than in mammalian cells. Finally, the baculoviruses used in baculovirus

Expression, Purification, and Crystallization of HSV-1 gB

397

expression vector systems (BEVS) are easily manipulated and relatively safe to use. The use of BEVS technology for expression of recombinant proteins, including glycoproteins, is described elsewhere [24] and will not be discussed in detail here. Although there are several BEVS systems currently on the market, we use the Bac-to-Bac® Baculovirus Expression System (Invitrogen) [25] due to its simplicity and relative speed of generating the required recombinant baculoviruses. Briefly, DNA fragments encoding the protein region of interest are subcloned into a plasmid vector suitable for baculovirus generation. The protein is then expressed from a strong lytic promoter of baculovirus. Inclusion of a native or borrowed protein signal sequence, such as honeybee melittin for gBd71, ensures that it is targeted to the proper cellular location. We typically expand the initial baculovirus stock in two passaging steps. The resulting passage 3, also referred to as P3, can be used to infect insect cells for protein production. Here, we describe a general protocol for expression, purification, and crystallization of gBd71 expressed in SF9 cells and extracted from the membrane using n-Dodecyl-β-D-Maltopyranoside (DDM). The resulting crystal structure of gBd71 (PDB ID 5V2S) has been reported [23]. While the protocol described here uses Sf9 insect cells, Sf21 or High Five insect cells can also be used. The immobilized metal ion affinity chromatography (IMAC) purification process for gBd71 uses its C-terminal hexahistidine tag, and yields ~0.7 mg of protein per liter of culture. Recommendations for adding amphipathic polymers to further stabilize the transmembrane region, as well for exchanging the protein into an alternative detergent, are given.

2

Materials

2.1 Protein Expression

1. A setup for growth of insect cells in suspension in spinner flasks (see Note 1), including several 3-L spinner flasks with a 2-port airflow assembly, a magnetic stir plate for spinner flasks, an air pump, a gas blending stand, ¼00 inner diameter autoclavable plastic tubing, and 0.2 μm air filter units (Millex-FG50 or similar). Available as a kit from Bellco (1965-86115) or may be purchased separately. 2. Refrigerated incubator set to 27  C. 3. Laminar flow hood for sterile work. 4. Sf9 cells adapted to growth in suspension culture in serum-free insect cell media. 5. Serum-free insect cell growth medium (e.g., Sf-900 II SFM).

398

Rebecca S. Cooper and Ekaterina E. Heldwein

6. Pen-Strep solution: 10,000 IU penicillin and 10,000 μg/mL streptomycin in 100 mL of distilled water. 7. Recombinant baculovirus from P3 encoding gBd71 (see Note 2). 8. Trypan blue solution: 0.4% trypan blue (w/v) in PBS. 2.2 Protein Purification

1. Empty 10-mL chromatography column. 2. M-110S microfluidizer (Microfluidics). 3. Phenylmethylsulfonyl fluoride (PMSF) solution: 100 mM PMSF in isopropanol (caution: cytotoxic, use eye protection). 4. n-Dodecyl-β-D-Maltopyranoside (DDM) (see Notes 3 and 4). 5. Roche protease inhibitor cocktail tablet, EDTA free. 6. Resuspension buffer (RB): 50 mM Tris-HCl pH 8.0, 150 mM NaCl, 10% glycerol, 0.1 mM PMSF (see Note 5). 7. Lysis buffer (LB): 50 mM Tris-HCl pH 8.0, 150 mM NaCl, 10% glycerol, 1 mM PMSF, 1 Roche EDTA-free protease inhibitor cocktail. 8. Solubilization buffer (SB): 600 mg of DDM dissolved in 20 mL of RB, prepared in a 50 mL tube. 9. 15 mL dounce homogenizer. 10. Nickel Sepharose 6 Fast Flow (GE Healthcare) or a similar resin. 11. 1 M imidazole stock in water, filtered to 0.22 μM. 12. Wash buffer 1 (WB1): 20 mM Tris-HCl pH 8.0, 150 mM NaCl, 5% glycerol, 0.05% DDM, 20 mM imidazole. 13. Wash buffer 2 (WB2): 20 mM Tris-HCl pH 8.0, 150 mM NaCl, 5% glycerol, 0.05% DDM, 35 mM imidazole. 14. Elution buffer (EB): 20 mM Tris-HCl pH 7.5, 150 mM NaCl, 5% glycerol, 0.05% DDM, 300 mM imidazole. 15. Gel filtration buffer (GF): 20 mM Tris-HCl pH 7.5, 150 mM NaCl, 5% glycerol, 0.05% DDM, filtered to 0.22 μM. 16. Amicon Ultra-15 100K concentrator (Millipore) or a similar concentrator. 17. Amicon Ultra-4 100K concentrator (Millipore) or a similar concentrator. 18. Centrifugal filter for aggregate removal. 19. Spectrophotometer for protein absorbance measurement. 20. Superdex 200 10/300 GL column (GE Healthcare). 21. Amphipol A8-35 (Anatrace, A835).

Expression, Purification, and Crystallization of HSV-1 gB

2.3

Crystallization

399

1. 24-well pregreased crystallization plates (Hampton Research). 2. 22-mm siliconized circle cover slides (Hampton Research). 3. Aerosol duster or in-house air. 4. Stereomicroscope for crystal observation. 5. A8-35 amphipol solution: 20 mM Tris-HCl pH 7.5, 150 mM NaCl, 5% glycerol, 0.5% A8-35, filtered to 0.22 μM. 6. Crystallization solution: 16% PEG-3350, 100 mM HEPES pH 7.2, and 150 mM sodium formate, filtered to 0.22 μM. 7. Cryoprotection solution: 3 parts gB crystallization solution with 2 parts 50% glycerol (see Note 18). 8. ALS-style crystal pucks, puck wand, puck separator tools, shelved puck shipping cane, and bent cryo tongs. 9. Assorted cryo loops, ranging from 0.05 to 0.3 μM in size (Hampton Research). 10. ALS-style puck compatible mounting bases (e.g., CrystalCap ALS (Hampton Research)). 11. CrystalWand handling tools (Hampton Research). 12. Acupuncture or another micro-needle. 13. Filtered 50% glycerol. 14. Liquid nitrogen. 15. Liquid nitrogen dewars for crystal freezing and temporary puck storage (Hampton Research).

3

Methods

3.1 Protein Expression

1. Wash, assemble, and autoclave 3-L spinner flasks and the 2-port airflow assembly with 0.2 μm air filters as per the manufacturer’s instructions (see Note 1). 2. Expand Sf9 cells to obtain an appropriate volume of suspension culture in log phase at a density of 2  106 living cells/mL using Sf9 cell culture medium. The viability should be at least 97% as determined by trypan blue staining (see Note 6). Cell culture volume should be calculated based on the required amount of pure protein and expected yield. 1–1.6 L cultures can be grown in a 3-L flask. We typically use a 1.4 L culture and obtain ~0.7 mg HSV-1 gBd71 per liter of culture. 3. In a tissue culture hood, infect the Sf9 cells with recombinant baculovirus by adding 10 mL of P3 per 1 L of cells (see Note 7). 4. Incubate infected cells for 60–72 h at 27  C with a spinner setting of 75 rpm and the airflow adjusted to prevent excessive bubble accumulation (see Note 8).

400

Rebecca S. Cooper and Ekaterina E. Heldwein

5. Harvest the cell culture pellet containing membrane proteins by centrifugation for 30 min at 4  C and 4000  g. Discard the supernatant. For this and all subsequent steps, a sterile environment is not required. 6. Resuspend the pelleted cells in 90 mL RB by stirring or gently swirling the bottles. Transfer the suspension to 50 mL Falcon tubes. 7. Pellet the cells at 4000  g for 10 min and pour off the buffer. 8. Proceed with the purification or store the cell pellets at 80  C for up to 3 months (see Note 9). 3.2 Crude Membrane Preparation and Solubilization

1. Thaw the pellets and resuspend them at 4  C in 35 mL of LB by rotating and lightly vortexing them. Try to minimize foaming. 2. Rinse the fluidizer with LB or RB and chill the outlet coil in an ice bath. Lyse the cells with three passes through the fluidizer at 80 psi, using an additional 10 mL of LB or RB to recover all lysate from the machine. Transfer the lysate to a 50 mL tube and adjust the final volume to 50 mL with LB or RB, reserving a 50 μL aliquot for analysis (see Note 10). 3. Clarify the lysate with a 25 min spin at 4000  g and 4  C. 4. Transfer the clarified lysate to two 50.2 Ti polycarbonate centrifuge bottles or the equivalent, avoiding as much of the loose cell debris pellet as possible. Add RB to bring the weight of the tube + clarified lysate + cap assembly to 55 g (approximately 50 mL). 5. Centrifuge the lysate at 145,000  g for 1.5 h at 4  C (see Note 11). 6. Remove the supernatant (soluble proteins) promptly to prevent “melting” of the gB-containing crude membrane pellet. 7. Homogenize each pellet in 10 mL RB using 30 strokes of a chilled homogenizer. Transfer the suspension to a 50 mL Falcon tube on ice. 8. Pour the crude membrane suspension into 20 mL of SB (see Note 12). 9. Increase the total volume of the crude membrane/detergent mixture to 50 mL with RB and invert gently to mix. Divide the mixture evenly between the detergent and membrane tubes. 10. Rotate the tubes gently at 4  C for 2 h, minimizing foaming, to solubilize the protein from the membrane. 11. Transfer the crude membrane-detergent mixture to ultracentrifuge tubes as in step 4 in Subheading 3.2 and centrifuge at 4  C, 145,000  g for 45 min to remove residual membrane.

Expression, Purification, and Crystallization of HSV-1 gB

401

12. Add 10 mM imidazole to the solubilized protein (supernatant, see Note 13) and combine it with 1 mL Ni Sepharose 6 Fast Flow resin. 13. Rock or rotate gently overnight at 4  C. 3.3

IMAC Purification

1. Load the Ni-NTA resin-solubilized protein mixture into an empty gravity column. This step and the remainder of the IMAC purification should be completed at 4  C. 2. Allow the unbound protein to drain through the column. 3. Wash the resin with 15 mL WB1 (see Note 14). 4. Wash the resin with 25 mL of WB2 (10 + 10 + 5 mL). 5. Elute the gBd71 into a fresh beaker or tube with 15 mL EB. 6. Measure the A280 of the eluate. 7. Concentrate the protein to 1 mL using a 100-kDa concentrator at 2000  g and 4  C. To minimize precipitation, mix frequently (5 min) but gently (see Note 15). 8. Pass the concentrated protein through a centrifugal filter or centrifuge it for 10 min at maximum speed in a 4  C benchtop centrifuge.

3.4 Size-Exclusion Chromatography

1. Slowly load the protein into a 1 mL syringe, taking care to expel any bubbles. Plunger adjustments should be minimized to control aggregation. 2. Run the protein through a Superdex 200 10/300 GL column that has been equilibrated at 4  C with GF buffer. Collect 0.5 mL fractions starting at the void (~8 mL) and continuing for 6 mL thereafter. If the gB construct is substantially shortened, a later collection window may be needed. A typical chromatogram and SDS-PAGE result for gBd71 are shown in Fig. 1a, b. 3. Concentrate the protein from the peak fraction to 3–4 mg/mL as in step 7 in Subheading 3.3.

3.5

Crystallization

1. Add A8-35 amphipol solution to a final concentration of 0.01% (w/v) and pipet gently to mix (see Note 16). Incubate the sample at room temperature for 30 min to allow the amphipol and detergent molecules to equilibrate around the protein. 2. Use a pipet tip to make a notch in the grease ring around the edge of each well in a pregreased 24-well plate. 3. Add 750 μL of filtered crystallization solution to each well that will be used. 4. Briefly spray a siliconized glass cover slip with air, and put it face up on a clean work surface. Add 1 μL crystallization solution followed by 1 μL protein to the center of the cover slip; then

402

Rebecca S. Cooper and Ekaterina E. Heldwein

Fig. 1 (a) A gel filtration chromatogram of gBd71 in 0.05% n-Dodecyl-β-DMaltopyranoside (DDM) reveals a trimer with an apparent molecular weight of 415 kDa. Vo void volume. (b) SDS-PAGE protein stain analysis of the peak fractions separated from aggregated protein. (c) P321 gBd71 crystals in 0.05% DDM and 0.01% A8-35 amphipol. (d) Representative H32 crystals of gBd71 in 0.075% n-undecyl-β-D-maltopyranoside (UM) detergent and 0.0075% A8-35 amphipol. Figure is reproduced from [23]

use tweezers to flip it over and seal the well. Use the back of a 1 mL pipet tip to press the cover slip down evenly without smudging it. Repeat these steps with additional crystal setups. 5. Store the crystal plate in a vibration-free environment at a constant temperature (RT for gBd71). gBd71 crystals in DDM/A8-35 appear as tapered wedges (orzo-shaped in profile) after 3–4 weeks and grow to their final sizes of 100–200 μm over the next week (Fig. 1c). Other detergent/ amphipol combinations yield different gemlike shapes on a similar time scale (Fig. 1d). Crystals will likely grow within a heavy layer of precipitate.

Expression, Purification, and Crystallization of HSV-1 gB

3.6 Freezing gB Crystals

403

1. Remove a cover slip containing a drop of interest and invert it under the microscope (see Note 17). 2. Add a 1 μL drop of cryoprotection solution (see Note 18) to a free area of this cover slip, or on a second adjacent coverslip. 3. Use a needle to gently free crystals from the cover slip and/or surrounding precipitate. 4. Transfer each crystal to the cryoprotection drop and incubate for 15 s to 1 min. 5. Retrieve the crystals from the cryoprotection drop, plunge freeze in LN2, and insert into the puck.

4

Notes 1. Spinner flasks should be autoclaved twice. In the first round, use a liquid cycle without attaching air filters and with ~100 distilled water at the bottom of the flask. In the second time, use a gravity cycle with attached air filters, no water in the flask, and cover all caps on the flask as well as the airflow ports and filters with aluminum foil. 2. The flexible N-terminus of gB has a role in receptor binding, but it is slowly degraded after purification, causing variability in the timing of crystallization. Removing residues 30-71 standardized the onset of crystal formation to 3–4 weeks. Although residues 72-103 were also unresolved in our structure and sometimes proteolytically cleaved, they were found to be essential to the stability of the protein during purification. The recombinant baculovirus used for gBd71 expression encodes HSV-1 gB residues 72-904 with a melittin signal sequence described previously [5, 26]. 3. High-purity, low-α isomer, Anagrade detergent must be used in the later purification stages and GF buffer to ensure that the detergent micelles have a homogeneous composition that is amenable to crystallization. If desired, a solubilization grade detergent with greater α content (e.g., Anatrace D310S) can be used during the solubilization step and exchanged for Anagrade detergent in the IMAC wash step. 4. This protocol describes purification and crystallization using DDM, but gBd71 can be crystallized in other detergents like nundecyl-β-D-maltopyranoside (UM). Detergent choice can impact crystal morphology and unit cell type, influencing which regions of the structure are well-resolved. As a starting point, detergents should be tested at ~10 their CMC for solubilization and ~3–5 their CMC for subsequent stabilization, depending on the ease of accurately weighing the needed quantities [27]. A rough detergent swap can be performed by

404

Rebecca S. Cooper and Ekaterina E. Heldwein

simply substituting the new detergent for DDM in the GF buffer. However, exchange is most thoroughly accomplished by incorporating the new detergent at an earlier stage, substituting it for DDM in an additional IMAC wash step and in all subsequent buffers. The DDM can be added to purification buffers up to a few days beforehand, which allows bubbles to subside in the filtered GF buffer. 5. Stock buffer solutions containing Tris-HCl, NaCl, glycerol and imidazole can be prepared and pH adjusted after equilibrating to 4  C. The PMSF and protease inhibitor tablet should be added directly before use to maximize their activity. 6. Take a 1 mL sample of the insect cell suspension culture using a sterile pipet. Mix 10 μL of the insect cell suspension culture sample with 10 μL of trypan blue solution to make a 1:1 dilution of the cell suspension in trypan blue. Load 10 μL of the cell suspension with the trypan blue onto a hemocytometer. Cells that appear blue are dead and cells that appear white are living. Count the living and the dead cells (separately) in one 1  1 mm square of the hemocytometer. The viability can be determined by dividing the number of living cells by the total number of cells. 7. It is not necessary to determine the titer of baculovirus stocks used for protein expression because the amount of baculovirus necessary to achieve optimal protein expression has to be determined experimentally. In our experience, using 4–10 mL of P3 stock per 1 L cells at a density 2  106 cells is typically a good starting point regardless of which glycoprotein is expressed. Although further optimization is usually not required, volumes within a 1–20 mL range have been used successfully. During optimization of protein expression, we find it helpful to monitor cell death during expression. If excessive cell death, viability of 60% or less, is observed after 3 days, the amount of P3 used for infection should be decreased. If protein expression is low, the amount of P3 used for infection should be increased. 8. Use of aeration is necessary for growing insect cells in volumes of 1 L and above. Insect cells can also be grown in shaker flasks, but that method is not described here. Air settings of 25–50 mL/min are often used for 1 L cultures and of 50–100 mL/min for 1.6 L cultures, but airflow should be adjusted to minimize frothing on the surface (no more than a “single” layer of bubbles). 9. Storage at 80  C did not have an adverse effect on gBd71. However, purifying from fresh cells should be tried if aggregation or instability is observed with other constructs. 10. Samples for SDS-PAGE and Western blot analysis should be collected throughout the purification. Western blot analysis is particularly helpful for gauging the efficiency of solubilization

Expression, Purification, and Crystallization of HSV-1 gB

405

and resin binding, stages of purification where many contaminant proteins are also present, or for quantifying gB loss during resin washes. SDS-PAGE analysis is useful for assessing the purity of the purified protein and may be sufficient once the purification process becomes routine. To compare protein quantities at different purification stages, it can be helpful to adjust samples to an even dilution level. This can be done by collecting a volume in microliters equal to the prep volume in milliliters and diluting those sample to the same total volume. For example, the amount of gB present at the solubilized protein stage (50 mL) can be compared to the amount of gB retained in the eluate (15 mL) by collecting a 50 μL sample of the former and a 15 μL sample of the latter to which 35 μL of buffer is added. Samples can then be further diluted by a universal factor to facilitate better observation by SDS-PAGE protein stain or Western blot. 11. This speed of 145,000  g is equivalent to ~40,000 rpm in a Type 50.2 Ti rotor. 12. This amount of DDM produces a final detergent concentration of ~1.2% in the 50 mL solubilization stage, adequate for the 2.5–3.0 g of crude membrane in our standard 1.4 L culture. For markedly different cell culture volumes (e.g., a doubled 2.8 L culture), optimization of the detergent concentration or adjustment of the solubilization stage volume is recommended. 13. Adding 10 mM imidazole minimizes nonspecific binding of contaminants to the resin. However, it may impair binding of some target proteins and should be omitted in these cases. 14. The imidazole content and wash volumes of WB1 and WB2 may need to be optimized for other proteins. For untested His-tagged proteins, we recommend starting with a 10 mM imidazole concentration for WB1 and 30 mM for WB2. 15. In general, gB should not be concentrated beyond 5 mg/mL to avoid aggregation. The molecular weight of gBd71 (unglycosylated, with the C-terminal “GSHHHHHH” linker-His6 tag) is 94,376 Da and the extinction coefficient is 94,255 m1 cm1, so a 1 mg/mL solution has an A280 of ~1. 16. The relative amounts of amphipol and detergent, as well as the timing of amphipol addition, should be optimized. We found that crystals could be obtained over an amphipol:detergent range of 1:10 to 1:5. gB in pure A8-35 formed oils rather than crystals, which may be the result of charge repulsion or steric hinderance by the bulky, anionic amphipol [28]. 17. Crystal drops will begin to dry out once exposed to air. 1 μL of well solution may be added to the drop to delay crystal degradation, but the best diffracting crystals tend to be the initial ones pulled from the drop, before supplementation. Although

406

Rebecca S. Cooper and Ekaterina E. Heldwein

a well can be resealed by replacing the cover slip, we have found that crystal quality is greatly reduced in these drops. 18. The composition of the cryo solution for gB should match the composition of the hanging drop in which the crystals grew— the “mother liquor”—as closely as possible, in addition to having the cryoprotectant. In a typical vapor-diffusion hanging-drop crystallization setup, a 2 μL hanging drop equilibrates to 1 μL, and the resulting mother liquor solution contains the sum of solute concentrations in the reservoir and protein solutions. However, owing to the presence of glycerol and detergent, 2 μL gBd71 hanging drops instead tend to expand in volume to ~4 μL, as measured by pipetting. An artificial mother liquor solution containing 20% glycerol as a cryoprotectant is obtained by adding 50 μL of 50% glycerol to 75 μL of reservoir solution.

Acknowledgments We thank past and present members of the Heldwein lab for helpful advice and discussions. We also acknowledge the contributions of Samuel D. Stampfer, who coauthored the Chapter “Expression, Purification, and Crystallization of HSV-1 Glycoproteins for Structure Determination” in the previous edition. References 1. Heldwein EE, Krummenacher C (2008) Entry of herpesviruses into mammalian cells. Cell Mol Life Sci 65(11):1653–1668. https://doi. org/10.1007/s00018-008-7570-z 2. Eisenberg RJ, Atanasiu D, Cairns TM, Gallagher JR, Krummenacher C, Cohen GH (2012) Herpes virus fusion and entry: a story with many characters. Viruses 4(5):800–832. https://doi.org/10.3390/v4050800 3. Krummenacher C, Supekar VM, Whitbeck JC, Lazear E, Connolly SA, Eisenberg RJ, Cohen GH, Wiley DC, Carfi A (2005) Structure of unliganded HSV gD reveals a mechanism for receptor-mediated activation of virus entry. EMBO J 24(23):4144–4153. https://doi. org/10.1038/sj.emboj.7600875 4. Atanasiu D, Saw WT, Cohen GH, Eisenberg RJ (2010) Cascade of events governing cell-cell fusion induced by herpes simplex virus glycoproteins gD, gH/gL, and gB. J Virol 84 (23):12292–12299. https://doi.org/10. 1128/JVI.01700-10 5. Heldwein EE, Lou H, Bender FC, Cohen GH, Eisenberg RJ, Harrison SC (2006) Crystal

structure of glycoprotein B from herpes simplex virus 1. Science 313(5784):217–220 6. Atanasiu D, Whitbeck JC, Cairns TM, Reilly B, Cohen GH, Eisenberg RJ (2007) Bimolecular complementation reveals that glycoproteins gB and gH/gL of herpes simplex virus interact with each other during cell fusion. Proc Natl Acad Sci U S A 104(47):18718–18723. https://doi.org/10.1073/pnas.0707452104. [0707452104 pii] 7. Atanasiu D, Whitbeck JC, de Leon MP, Lou H, Hannah BP, Cohen GH, Eisenberg RJ (2010) Bimolecular complementation defines functional regions of Herpes simplex virus gB that are involved with gH/gL as a necessary step leading to cell fusion. J Virol 84 (8):3825–3834. https://doi.org/10.1128/ JVI.02687-09, JVI.02687-09 [pii] 8. Harrison SC (2015) Viral membrane fusion. Virology 479-480C:498–507. https://doi. org/10.1016/j.virol.2015.03.043 9. Stampfer SD, Heldwein EE (2013) Stuck in the middle: structural insights into the role of the gH/gL heterodimer in herpesvirus entry.

Expression, Purification, and Crystallization of HSV-1 gB Curr Opin Virol 3:13. https://doi.org/10. 1016/j.coviro.2012.10.005 10. Burke HG, Heldwein EE (2015) Crystal structure of the human cytomegalovirus glycoprotein B. PLoS Pathog 11(10):e1005227. https://doi.org/10.1371/journal.ppat. 1005227 11. Chandramouli S, Ciferri C, Nikitin PA, Calo S, Gerrein R, Balabanis K, Monroe J, Hebner C, Lilja AE, Settembre EC, Carfi A (2015) Structure of HCMV glycoprotein B in the postfusion conformation bound to a neutralizing human antibody. Nat Commun 6:8176. https://doi.org/10.1038/ncomms9176 12. Carfi A, Willis SH, Whitbeck JC, Krummenacher C, Cohen GH, Eisenberg RJ, Wiley DC (2001) Herpes simplex virus glycoprotein D bound to the human receptor HveA. Mol Cell 8(1):169–179 13. Di Giovine P, Settembre EC, Bhargava AK, Luftig MA, Lou H, Cohen GH, Eisenberg RJ, Krummenacher C, Carfi A (2011) Structure of herpes simplex virus glycoprotein D bound to the human receptor nectin-1. PLoS Pathog 7(9):e1002277. https://doi.org/10. 1371/journal.ppat.1002277 14. Zhang N, Yan J, Lu G, Guo Z, Fan Z, Wang J, Shi Y, Qi J, Gao GF (2011) Binding of herpes simplex virus glycoprotein D to nectin-1 exploits host cell adhesion. Nat Commun 2:577. https://doi.org/10.1038/ ncomms1571 15. Lu G, Zhang N, Qi J, Li Y, Chen Z, Zheng C, Gao GF, Yan J (2014) Crystal structure of herpes simplex virus 2 gD bound to nectin-1 reveals a conserved mode of receptor recognition. J Virol 88(23):13678–13688. https:// doi.org/10.1128/JVI.01906-14 16. Stampfer SD, Lou H, Cohen GH, Eisenberg RJ, Heldwein EE (2010) Structural basis of local, pH-dependent conformational changes in glycoprotein B from herpes simplex virus type 1. J Virol 84(24):12924–12933. https:// doi.org/10.1128/JVI.01750-10 17. Chowdary TK, Cairns TM, Atanasiu D, Cohen GH, Eisenberg RJ, Heldwein EE (2010) Crystal structure of the conserved herpesvirus fusion regulator complex gH-gL. Nat Struct Mol Biol 17(7):882–888. https://doi.org/ 10.1038/nsmb.1837. nsmb.1837 [pii] 18. Jones NA, Geraghty RJ (2004) Fusion activity of lipid-anchored envelope glycoproteins of herpes simplex virus type 1. Virology 324 (1):213–228

407

19. Rogalin HB, Heldwein EE (2015) The interplay between the HSV-1 gB cytodomains and the gH cytotail during cell-cell fusion. J Virol 89:12262. https://doi.org/10.1128/JVI. 02391-15 20. Chowdary TK, Heldwein EE (2010) Syncytial phenotype of C-terminally truncated herpes simplex virus type 1 gB is associated with diminished membrane interactions. J Virol 84 (10):4923–4935. https://doi.org/10.1128/ JVI.00206-10 21. Silverman JL, Greene NG, King DS, Heldwein EE (2012) Membrane requirement for folding of the herpes simplex virus 1 gB cytodomain suggests a unique mechanism of fusion regulation. J Virol 86(15):8171–8184. https://doi. org/10.1128/JVI.00932-12 22. Chen J, Zhang X, Jardetzky TS, Longnecker R (2014) The Epstein-Barr virus (EBV) glycoprotein B cytoplasmic C-terminal tail domain regulates the energy requirement for EBV-induced membrane fusion. J Virol 88 (20):11686–11695. https://doi.org/10. 1128/JVI.01349-14 23. Cooper RS, Georgieva ER, Borbat PP, Freed JH, Heldwein EE (2018) Structural basis for membrane anchoring and fusion regulation of the herpes simplex virus fusogen gB. Nat Struct Mol Biol 25(5):416–424. https://doi.org/10. 1038/s41594-018-0060-6 24. Kost TA, Condreay JP, Jarvis DL (2005) Baculovirus as versatile vectors for protein expression in insect and mammalian cells. Nat Biotechnol 23(5):567–575. https://doi.org/ 10.1038/nbt1095 25. Invitrogen (2010) Bac-to-Bac® Baculovirus Expression System. Version F. Invitrogen, Carlsbad, CA 26. Bender FC, Whitbeck JC, Ponce de Leon M, Lou H, Eisenberg RJ, Cohen GH (2003) Specific association of glycoprotein B with lipid rafts during herpes simplex virus entry. J Virol 77(17):9542–9552 27. Newby ZE, O’Connell JD III, Gruswitz F, Hays FA, Harries WE, Harwood IM, Ho JD, Lee JK, Savage DF, Miercke LJ, Stroud RM (2009) A general protocol for the crystallization of membrane proteins for X-ray structural investigation. Nat Protoc 4(5):619–637. https://doi.org/10.1038/nprot.2009.27 28. Zoonens M, Popot JL (2014) Amphipols for each season. J Membr Biol 247 (9-10):759–796. https://doi.org/10.1007/ s00232-014-9666-8

Chapter 25 The Use of Microfluidic Neuronal Devices to Study the Anterograde Axonal Transport of Herpes Simplex Virus-1 Kevin Danastas, Anthony L. Cunningham, and Monica Miranda-Saksena Abstract Understanding how herpes simplex virus-1 (HSV-1) interacts with different parts of the neuron is fundamental in understanding the mechanisms behind HSV-1 transport during primary and recurrent infections. In this chapter, we describe a unique neuronal culture system that is capable of compartmentalizing neuronal cell bodies from their axons to study the transport of HSV-1 along axons. The ability to separate neuronal cell bodies and axons provides a unique model to investigate the mechanisms used by HSV-1 for viral transport, assembly, and exit from different parts of the neuron. Key words Microfluidics, Neurons, Herpes simplex virus, Axons, Transport

1

Introduction One of the major features of herpes simplex virus (HSV) 1 and 2 is the ability of the virus to infect neuronal cells and undergo retrograde transport along axons to establish a life-long latent infection in the cell body of sensory neurons. Upon cellular stresses, the latent virus can then be reactivated and following replication, undergo anterograde transport back along the axons to reinfect epithelial cells causing recurrent infections. Given the length of neuronal axons, the virus must interact with host cytoskeletal structures and host cellular proteins to be actively transported along these axons during both primary and recurrent infections [1, 2]. Therefore, understanding the mechanisms behind viral transport and the interactions between viral and host proteins are imperative for developing new antiviral strategies targeting these processes. This chapter will focus on the use of microfluidic neuronal devices (Xona Microfluidics, USA) composed of a silicon polymer (polydimethylsiloxane) for studies on HSV-1 infection of sensory neurons in a compartmentalized culture system. Microfluidics involves the use of small volumes of liquid (in the micrometre

Russell J. Diefenbach and Cornel Fraefel (eds.), Herpes Simplex Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2060, https://doi.org/10.1007/978-1-4939-9814-2_25, © Springer Science+Business Media, LLC, part of Springer Nature 2020

409

410

Kevin Danastas et al.

Fig. 1 Schematic diagram showing the layout of the neuronal devices. The neuronal device is divided into two compartments (shown in orange and green), each made up of two circular wells connected by a main channel. These two compartments are connected by microgrooves, which allow the growth of axons from the cell body side (orange) to the axonal side (green). If set up correctly, the cell body side is fluidically isolated from the axonal side

range) in a multicompartment system, which allows the separation of neuronal cell bodies from axons [3, 4]. In the system described here, two compartments are separated by microgrooves, which allow the growth of axonal processes across the compartments (Fig. 1). The major advantage of this system is that if set up correctly, the two compartments are fluidically isolated which allows separate physical and chemical treatment of each neuronal compartment [5]. This provides a unique approach in isolating axons from the originating cell body to study both the anterograde and retrograde transport of HSV-1 [6–9]. These neuronal devices are also suitable for microscopy as they are optically transparent. The neuronal devices are placed on a cover glass, allowing for immunofluorescence staining and imaging of the neuronal cell bodies and axons in each compartment. The neuronal devices can be set up in different ways best suited for the experiments being conducted. One method, which is described in this chapter, involves exposing the neuronal device and a cover glass to oxygen plasma, to render the neuronal device sterile and to form an irreversible bond [10]. This forms a tight seal to prevent leakage and makes the neuronal device hydrophilic, which aids in the addition of liquids. However, the neuronal devices cannot be separated from the cover glass and therefore immunofluorescence staining has to be performed with the neuronal device intact. Alternatively, the neuronal device can be reversibly bonded to the cover glass (i.e., through magnetic bonding) [10]. While reversible bonding allows the neuronal device to be detached if necessary for downstream applications, the neuronal devices remain hydrophobic making the addition of liquids difficult. Furthermore, the bond

Preparation of Neuronal Devices to Study HSV-1 Transport

411

between the neuronal device and the cover glass could be easily detached if jolted and leaking may occur. In this chapter, we describe the procedure used to set up the neuronal devices for the growth of sensory neurons (isolated from rat dorsal root ganglia) for studies on the mechanisms of HSV-1 infection, axonal transport, and exit from neurons [11, 12]. This technique allows the analysis of HSV-1 transport along axons and how viral transport can be modulated by the addition of inhibitors or other compounds targeted against different viral and/or host cellular processes. In addition to neurons, nonneuronal cells (e.g., Vero cells) can be added to the axonal chamber 24 h prior to infection to study the transport of the virus from axons to adjacent cells. For our studies, plasma bonding is performed to ensure there is no leakage of liquids between the two compartments. Once bonded, the neuronal devices are coated with poly(D)lysine (PDL) and laminin to aid in cell attachment. Primary dissociated neurons are added to the cell body compartment and incubated at 37
C and 5% CO2 until sufficient axon growth is observed in the axonal compartment, usually after 3–4 days in our system.

2

Materials

2.1 Materials to Set Up Neuronal Devices

1. Class II biological safety cabinet. 2. Plasma cleaning system (Pelco EasyGlow™ Glow discharge Cleaning System, Ted Pella, Inc., USA). 3. Sterile 60 and 100 mm plastic petri dishes. 4. Sterile forceps #1 or 4. 5. No. 1 24 mm  40 mm cover glass. 6. Neuronal devices. For our studies, 450 μm neuronal devices (Xona Microfluidics, USA) were used. 7. Borate buffer: 52 mM boric acid, 12.4 mM sodium tetraborate in dH2O. pH adjusted to 8.5. Store at 4
C. 8. 0.5 mg/mL Poly(D)Lysine (PDL): Make fresh each time by dissolving 5 mg of lyophilized PDL in 10 mL of borate buffer. 9. 10 μg/mL laminin: Make fresh each time by diluting in sterile dH2O. 10. Incubator set at 37
C and 5% CO2. 11. Ultrasonic cleaner.

2.2 Cells, Viruses and Cell Culture Materials

1. Class II biological safety cabinet. 2. Primary culture of neurons (e.g., dissociated neurons derived from Wistar rat neonatal dorsal root ganglia).

412

Kevin Danastas et al.

3. Herpes simplex virus (any strain, wild-type or deletion mutant virus can be used). 4. Complete Neurobasal medium (variable depending on the type of neurons being used). Neurobasal medium (Life Technologies, Australia) supplemented with 1 B-27 supplement, 200 mM L-glutamine, 5 ng/mL brain-derived neurotrophic factor, and 100 ng/mL of 7S nerve growth factor. 5. Nonneuronal cell line (e.g., Vero cells; if required). 2.3 Fixatives and Buffers

1. Sterile Dulbecco’s phosphate buffered saline (PBS). 2. 3% paraformaldehyde (PFA) solution: made up in sterile PBS from a 16% stock solution. 3. 0.1% Triton X solution: made up in sterile PBS. 4. Blocking buffer: 5% BSA, 5% goat serum, 0.2% cold water fish skin (CWSF) gelatin, 5% sodium azide in PBS. Store at 20
C. 5. Antibody dilution buffer: 2% acetylated BSA (BSAc), 5% sodium azide in PBS. Store at 20
C. 6. Fluoromount-G™ mounting liquid.

3

Methods

3.1 Setup of Microfluidic Neuronal Devices

1. Place the neuronal device and a cover glass into the plasma cleaner and expose to plasma for 45 s under 0.39 m Bar (see Note 1). Using sterile forceps, bond the neuronal device to the cover glass by placing the surface of the neuronal device exposed to the plasma face-down on the exposed surface of the coverslip, pushing down gently with the forceps to form a tight bond. After plasma bonding, the neuronal device is sterile and will remain hydrophilic for 10 min (see Note 2). 2. Place and transport the bonded neuronal devices inside a sterile 60 mm plastic petri dish to a biological safety cabinet, add 200 μL of 0.5 mg/mL PDL to the top left (cell body side) and top right (axonal side) wells, and allow the liquid to flow through the channels into the bottom wells (see Fig. 1). Top up the wells by adding a further 200 μL of 0.5 mg/mL PDL to the top left and right wells (see Note 3). 3. Place the 60 mm plastic petri dish inside a 100 mm petri dish to limit evaporation, and incubate the neuronal devices for 24–48 h at 37
C and 5% CO2. 4. Remove excess PDL from all the wells, add 200 μL of sterile dH2O to the top left, and right wells and allow the liquid to flow through the channels into the bottom wells.

Preparation of Neuronal Devices to Study HSV-1 Transport

413

5. Add a further 200 μL of sterile dH2O to the top left and right wells, and allow the liquid to flow through the channels into the bottom wells. 6. Remove all the dH2O from the bottom left and right wells, and add a further 200 μL of sterile dH2O to the top left and right wells. 7. Repeat steps 5 and 6 two more times to ensure all traces of borate buffer are removed from the channels (see Note 4). 8. Remove excess dH2O, add 200 μL of 10 μg/mL laminin to the top left and right wells, and allow the liquid to flow through the channels into the bottom wells. Top up the wells by adding a further 200 μL to the top left and right wells and incubate overnight, or for a minimum of 3 h at 37
C and 5% CO2. 3.2 Growth of Neuronal Cells in Neuronal Devices

1. Remove excess laminin from the wells, add 200 μL of complete Neurobasal medium to the top left and right wells, and allow the liquid to flow through the channels into the bottom wells. Top up the wells by adding a further 200 μL of complete Neurobasal medium to the top wells (see Note 5). Incubate at 37
C and 5% CO2 until ready to load the neuronal cells. 2. Remove all medium from the wells in the cell body compartment, ensuring to remove as much medium as possible to facilitate the addition of cells. 3. The required density of dissociated neuronal cells should be resuspended in a maximum volume of 5 μL per compartment and slowly pipetted directly into the channel while keeping the neuronal device at an approximate 45
angle (see Note 6). Maintain the neuronal device at this angle for 20 min to ensure the neuronal cells settle as close to the microgrooves as possible (Fig. 2a). 4. Gently add 200 μL of complete Neurobasal medium to the top well in the cell body compartment, and allow the liquid to flow through. 5. Top up by adding a further 200 μL of complete Neurobasal medium to the top well. 6. Remove medium from the axonal compartment, add 200 μL of fresh complete Neurobasal medium to top well, and allow the liquid to flow through. 7. Top up by adding a further 200 μL of complete Neurobasal medium to the top well. 8. Incubate the neuronal devices at 37
C and 5% CO2 for 3–4 days to allow sufficient axonal growth into the microgrooves and into the axonal compartment prior to HSV-1 infection (Fig. 2b).

414

Kevin Danastas et al.

Fig. 2 Images of neuronal devices of the cell body compartment at the time of cell seeding showing the neurons settling close to the microgrooves (a) and the axonal compartment after 3 days incubation showing the growth of branching axons (b). Scale bar ¼ 100 μm 3.3 Addition of Vero Cells to Axonal Compartment (Optional)

1. Remove all medium from the wells in the axonal compartment, ensuring to remove as much medium as possible to facilitate the addition of cells (see Note 7). 2. Resuspend 50,000 Vero cells in a maximum volume of 5 μL per compartment, and slowly pipette directly into the channel as in Subheading 3.2. 3. Gently add 200 μL of complete Neurobasal medium to each well in the axonal compartment as in Subheading 3.2. 4. Incubate at 37
C and 5% CO2 for 24 h prior to HSV-1 infection.

3.4 Infection of Neuronal Cells

1. Remove medium from the cell body compartment, add 175 μL of fresh complete Neurobasal medium containing the desired strain and MOI of virus, and allow the liquid to flow through

Preparation of Neuronal Devices to Study HSV-1 Transport

415

the channels into the bottom wells. Top up the wells by adding a further 175 μL of fresh complete Neurobasal medium. In our studies, HSV-1 was added at a MOI of 10 (see Note 8). 2. At 2 h post infection (hpi), remove the inoculum from the wells of the cell body compartment, and wash the neurons by adding 200 μL of complete Neurobasal medium to the top wells. 3. Allow the liquid to flow through the channel into the bottom well, and top up the wells by adding a further 200 μL of complete Neurobasal medium to the top well. 4. Remove all the medium from the bottom well of the cell body compartment, and add a further 200 μL of complete Neurobasal medium, allowing the liquid to flow through into the bottom well. 5. Repeat steps 3 and 4 once more to ensure all free virus is removed from the cell body compartment. 6. Incubate at 37
C plus 5% CO2. 3.5 Fixation of Neurons

1. In our studies, the neurons were fixed between 28 and 30 hpi. For fixation, remove medium from all wells, and add 200 μL of sterile PBS to the top left and right wells. 2. Allow the liquid to flow through the channels into the bottom wells. Add a further 200 μL of sterile PBS to the top wells. 3. Remove all the PBS from the bottom left and right wells, and add a further 200 μL of sterile PBS to the top left and right wells. 4. Repeat steps 2 and 3 once more to ensure all traces of medium are removed from the channels. 5. Remove all PBS from the wells, add 200 μL of 3% PFA to the top left and right wells, and allow the liquid to flow through the channels into the bottom wells. Add a further 200 μL of 3% PFA to the top wells. 6. Incubate the neuronal devices for 30 min at room temperature to allow for sufficient fixation of the cells and virus particles. 7. Remove excess PFA from the wells, add 200 μL of sterile 0.1% Triton X to the top left and right wells, and allow the liquid to flow through the channels into the bottom wells. 8. Incubate the neuronal devices for 4 min at room temperature to allow for sufficient permeabilization of the neurons. 9. Remove excess 0.1% Triton X from all the wells, add 200 μL of sterile PBS to the top left and right wells, and allow the liquid to flow through the channels to the bottom wells. 10. Add a further 200 μL of sterile PBS to the top left and right wells, and allow the liquid to flow through the channels into the bottom wells.

416

Kevin Danastas et al.

11. Remove all the PBS from the bottom left and right wells, and add a further 200 μL of sterile PBS to the top left and right wells. 12. Repeat steps 10 and 11 two more times to ensure all traces of 0.1% Triton X are removed from the channels (see Note 9). 13. The neuronal devices can then be stored in PBS at 4
C until ready for staining. 3.6 Staining of Cells in Neuronal Device

1. Remove all PBS from the wells, add 200 μL of blocking buffer to the top left and right wells, and allow the liquid to flow through the channels into the bottom wells. Top up the wells by adding a further 200 μL of blocking buffer to the top wells. 2. Incubate at room temperature for 30 min. 3. Remove all blocking buffer from the wells, add 150 μL of primary antibody made up in antibody dilution buffer, and allow the liquid to flow through the channels into the bottom wells. 4. Incubate at 4
C overnight. 5. Remove all primary antibody from the wells, and add 200 μL of PBS to the top left and right wells. 6. Allow the liquid to flow through the channels into the bottom wells. Add a further 200 μL of PBS to the top wells. 7. Remove all the PBS from the bottom left and right wells, and add a further 200 μL of PBS to the top left and right wells. 8. Repeat steps 6 and 7 four more times to wash all unbound antibody from the main channel. 9. Remove all PBS from the wells, add 150 μL of secondary antibody made up in antibody dilution buffer, and allow the liquid to flow through the channels into the bottom wells. 10. Incubate at room temperature for 90 min. 11. Remove all secondary antibody from the wells, and add 200 μL of PBS to the top left and right wells. 12. Allow the liquid to flow through the channels into the bottom wells. Adding a further 200 μL of PBS to the top wells. 13. Remove all the PBS from the bottom left and right wells, and add a further 200 μL of PBS to the top left and right wells. 14. Repeat steps 12 and 13 four more times to wash all unbound antibody from the main channel. 15. Remove all PBS from the wells and slowly add 100 μL of Fluoromount-G to each top well, allowing the mounting medium to flow into the channels. 16. Add a further 100 μL of Fluoromount G to each bottom well. 17. Store the neuronal devices at 4
C until ready for imaging.

Preparation of Neuronal Devices to Study HSV-1 Transport

4

417

Notes 1. Cover glasses need to be cleaned using an ultrasonic cleaner for 15 min at room temperature to ensure they are free of dust and debris. The feature side of the neuronal device (the side containing the channels and microgrooves) must also be free of debris to ensure a proper seal is formed. 2. Ensure the feature side is face-up when placed into the plasma cleaner, as this is the side that is exposed to the plasma and will be bonded to the cover glass. It is important to note that this bonding is permanent and cannot be reversed. 3. It is important to avoid introducing bubbles into the channels at any stage during the process as they are difficult to remove and will compromise the neuronal device. 4. Borate buffer can be absorbed into the neuronal device’s polymer and can become toxic to cultured cells. Therefore, all traces of borate buffer must be removed to ensure the cells are not affected. 5. The addition of complete Neurobasal medium allows the neuronal device to equilibrate to the culture conditions of the neuronal cells. 6. Cell density will need to be optimised depending on the type of cell used and its source. In our study, approximately 40,000–50,000 dissociated neurons derived from rat dorsal root ganglia were added to each cell body compartment. Ensure the cells are pipetted directly into the channel, not into the well. Keeping the neuronal devices at an angle helps the neurons settle as close as possible to the microgrooves for the axons to grow through into the axonal compartment. 7. The addition of Vero cells to the axonal compartment should be done 24 h prior to infection. 8. Once the virus has been added, it is important to ensure that the liquid in the cell body and axonal compartments are maintained at the same volumes. This will ensure that the two compartments remain fluidically isolated and that there is no leakage of the virus from the cell body compartment to the axonal compartment. 9. Prolonged exposure to 0.1% Triton X will damage the cells and can be detrimental to staining.

Acknowledgments This work was supported by the Australian National Health and Medical Research Grants (APP1069193 and APP1130512).

418

Kevin Danastas et al.

References 1. Miranda-Saksena M, Denes CE, Diefenbach RJ et al (2018) Infection and transport of herpes simplex virus type 1 in neurons: role of the cytoskeleton. Viruses 10:e92 2. Denes CE, Miranda Saksena M, Cunningham AL et al (2018) Cytoskeletons in the closet: subversion in alphaherpesvirus infections. Viruses 10:e79 3. Taylor AM, Rhee SW, Tu CH et al (2003) Microfluidic multicompartment device for neuroscience research. Langmuir 19:1551–1556 4. Whitesides GM (2006) The origins and the future of microfluidics. Nature 442:368–373 5. Taylor AM, Rhee SW, Jeon NL (2006) Microfluidic chambers for cell migration and neuroscience research. In: Microfluidic techniques: reviews and protocols. Humana Press, Totawa, NJ 6. Liu WW, Goodhouse J, Jeon NL et al (2008) A microfluidic chamber for analysis of neuron-tocell spread and axonal transport of an alphaherpesvirus. PLoS One 3:e2382 7. Howard PW, Howard TL, Johnson DC (2013) Herpes simplex virus membrane proteins gE/gI and US9 act cooperatively to promote transport of capsids and glycoproteins from

neuron cell bodies into initial axon segments. J Virol 8:403–441 8. Howard PW, Wright CC, Howard T et al (2014) Herpes simplex virus gE/gI extracellular domains promote axonal transport and spread from neurons to epithelial cells. J Virol 88:11178–11186 9. Dohner K, Ramos-Nascimento A, Bialy D et al (2018) Importin alpha1 is required for nuclear import of herpes simplex virus proteins and capsid assembly in fibroblasts and neurons. PLoS Pathog 14:e1006823 10. Neto E, Leitao L, Sousa DM et al (2016) Compartmentalized microfluidic platforms: the unrivaled breakthrough of in vitro tools for neurobiological research. J Neurosci 36:11573–11584 11. Miranda-Saksena M, Boadle RA, Diefenbach RJ et al (2016) Dual role of herpes simplex virus 1 pUS9 in virus anterograde axonal transport and final assembly in growth cones in distal axons. J Virol 90:2653–2663 12. Diefenbach RJ, Davis A, Miranda-Saksena M et al (2016) The basic domain of herpes simplex virus 1 pUS9 recruits kinesin-1 to facilitate egress from neurons. J Virol 90:2102–2111

Chapter 26 A Model of In Vivo HSV-1 DNA Transport Using Murine Retinal Ganglion Cells Jennifer H. LaVail Abstract Mammalian nervous tissues are heterogeneous. The retina, brain, spinal cord, and peripheral sensory and autonomic ganglia are each composed of neuronal and glial cell partners embedded in a connective tissue bed and supplied by vascular and immune cells. This complicated structure presents many challenges to neuroscientists and cell biologists (e.g., how to carry out a quantitative study of neurons surrounded by the hormonal and immune stimuli of supporting cells). A reductionist view has led investigators to study tissue slices and cultures of isolated neurons in vitro, subtracting the immune and vascular components to simplify the problem. Recently, investigators have extended the approach and produced organoids which are derived from embryonic neurons from induced pluripotent stem cells (Muffat et al., Proc Natl Acad Sci U S A 115:7117–7122, 2018). Using this approach advances have been made in the study of viral infections of the nervous system. For example, by using a genetically modified carrier virus, they can compare the effect of different viral envelope proteins on viral tropism and viral response pathways. However, the timed delivery of hormonal stimuli and interactions with immune cells remain problematic. We present an alternative method for studying these issues using the axonal transport of Herpes simplex virus in mature retinal neurons in vivo. Using genetically identical mice and carefully controlling the delivery of virus, an investigator can obtain insight into the transport of virus to and from the neuron cell body within the cellular environment of an intact, mature animal. This allows confirmation and extension of results seen in vitro. Key words HSV-1, Axonal transport, Retinal ganglion cell, DNA, In vivo assay

1

Introduction One of the defining features of Herpes simplex virus (HSV) infections is the intracellular and bidirectional spread of virus in neurons. In the case of human ocular infections, HSV particles spread between epithelial cells of the ocular mucous membrane to the trigeminal nerve endings and then they are transported retrograde within the neuron axon back to cell bodies of the trigeminal ganglion (Fig. 1). After replication newly synthesized viral components travel anterograde within the same axon to the peripheral sensory

Russell J. Diefenbach and Cornel Fraefel (eds.), Herpes Simplex Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2060, https://doi.org/10.1007/978-1-4939-9814-2_26, © Springer Science+Business Media, LLC, part of Springer Nature 2020

419

420

Jennifer H. LaVail

Fig. 1 Bidirectional spread of HSV in the course of infection of a sensory neuron. HSV replicates in skin or mucosal epithelial cells. Virus is released by these cells and binds to and enters sensory nerve endings. The viral envelope is lost in the endings and viral capsids and particular tegument proteins are transported in a retrograde direction within the peripheral nerve. The DNA is delivered to the sensory neuron’s nucleus. After new viral DNA and enveloping proteins are synthesized, the HSV is retransported in an anterograde direction within the peripheral nerve to the sensory nerve endings in the mucous membranes. It may also be transported centrally to the CNS where it can be released for transneuronal spread [1]

endings and then to mucous membrane epithelial cells (Fig. 1). In addition, they may travel within the central axonal branch of the trigeminal ganglion neuron to enter the CNS with more severe consequences. Although HSV infections of the trigeminal ganglia are clinically important, the study of viral transport in this system is complicated by the bidirectional and in some case simultaneous transport (to and from the ganglion cell body) after a single infection. To simplify the study of HSV transport, we have chosen to employ the retinal ganglion cell as a model for the anterograde transport phase of viral reinfection. Historically the retinal ganglion cell has been a model of choice for study of anterograde axonal transport [2]. Weiss demonstrated protein transport in optic nerves in 1965 [3]. Grafstein demonstrated two waves of protein delivery in fish [4] and then later in the mouse retinal ganglion cells [5]. This cell type continues to remain a popular cell model for study [6]; for example, currently 617 papers are listed in the National Library of Medicine database. Within retinal ganglion cells models, mouse cells have been favorable models for several reasons. Isogenic mouse strains provide immunologically and genetically comparable mice; variations in candidate genetic strains can be used to identify genes that resemble human diseases [7]. The murine retinal ganglion cell bodies are concentrated within the limits of the orbit (Fig. 2). Thus, the deposition of virus in the intravitreal portion of the eye limits its spread to the optic nerve head. There are approximately 45,000 murine retinal ganglion cells and they represent about 41
4% of the density of total neurons in the retina [8]. A much smaller subset of retinal neurons, displaced amacrine cells, also provide axons to

Transport and Isolation of HSV-1 DNA in Retinal Ganglion Cell Axons In Vivo

421

Fig. 2 Retinal ganglion cells can be infected without direct damage to the neurons. GCL, retinal ganglion cell layer; L, lens; R, retina; V, vitreous chamber; ∗, tip of injection needle

the optic nerve. The remaining retinal cells include photoreceptor cells, bipolar cells, horizontal cells, Mu¨ller glial cells, and vascular cells; none of these contributes cellular processes to the optic pathway [9]. After intraocular injection, new virus is made essentially synchronously by retinal ganglion cells and then transported from cell body toward terminals via their axons. The axons of retinal ganglion cells bundle to form the optic nerve (ON) and ultimately the optic tract (OT) (Fig. 3). The axons supply terminals and synaptic ending on neurons of the lateral geniculate nucleus (LGN) and superior colliculus. The murine optic nerve model also has some limitations. The retinal axons are enwrapped in glial cells and supplied by vascular cells in the nerve. Thus, any leakage of virus from the nerves to glial cells, although slower than transport, can complicate a quantitative analysis of viral transport within the nerves. Any leakage of virus from the vasculature can also be a problem. We have adopted a pharmacological approach to limit these complications. We deliver the antiviral drug Valacyclovir in the drinking water 24 h after initial infection. This reduces both the vascular and intercellular spread and reduces secondary replication in periaxonal glial cells [10]. In a previous publication, we compared the strengths and weaknesses of many of the experimental approaches used to study the anterograde axonal transport of herpesviruses [11]. Other review articles have concentrated on the steps necessary to isolate and maintain neurons in an in vitro chamber and to study viral transport in them [10]. In this chapter, I have concentrated on the steps to use mouse retinal ganglion cells for in vivo study of anterograde transport. I describe in detail the steps to be followed to study the axonal transport of HSV DNA in murine retinal ganglion cell bodies from their cell bodies in the orbit to the distal portion of axons in the OT. The OT is a 6 mm section of tissue that begins central to the optic chiasm (OC) and extends to the entry point at the dorsal thalamus (Fig. 3).

422

Jennifer H. LaVail

Fig. 3 The anterograde transport of virus can be assayed from retinal ganglion cell bodies, in the optic nerve (ON), in the optic chiasm (OC), and in the optic tract (OT) to the site of termination in the lateral geniculate nucleus of the thalamus

This procedure has been used in a number of applications [7, 11]. It can be used to assay the anterograde axonal transport of viral DNA, viral proteins, viral RNA in both wt and genetically distinct mouse strains [12–14]. Modifications have also been used to compare the efficiency of transport of different viral strains in mice of identical genetic backgrounds [14] and the ratio of ipsilateral to contralateral projecting axons in the optic path [7]. The basic advantage of the technique is that one can study the delivery of each component in intact whole neurons in situ. The chapter is divided into four parts: (1) the assembly of the injection apparatus; (2) the loading of the pump and tubing; (3) the dissection of the optic pathway, and (4) a summary of the steps to isolate and quantify the concentration of viral DNA in the OT.

2

Materials

2.1 Delivery of Viral Solution to the Posterior Chamber of the Eye

1. Male BALB/c mice, 5-to-6-weeks-old (see Note 1). 2. Anesthetic: Avertin [15]. 3. Analgesic: proparacaine–atropine (1:1) eye drops. 4. Sterile cotton swabs. 5. The F (wt) strain of HSV-1, diluted in minimal essential medium to a concentration of approximately 107 plaque forming units (see Note 2). 6. Hamilton repeater pump (P8-600) (Fig. 4a) and Hamilton microliter syringe, 25 μL volume (Hamilton #705) (Fig. 4b). 7. 27.5 gauge needles, intact (Fig. 4c). 8. PE tubing (Intramedic) Clay Adams (I.D. 038 mm; O.D, 1.09 mm) (Fig. 4d).

Transport and Isolation of HSV-1 DNA in Retinal Ganglion Cell Axons In Vivo

423

Fig. 4 Components of the assembled injection apparatus. Hamilton repeater pump (a); Hamilton 25 μL syringe (b); PE tubing attached to syringe via the plastic collar (c); the PE tubing (d); the 27.5 gauge needle broken from collar and the blunt end inserted into the distal end of tubing (e)

9. 27.5 gauge needles separated from plastic collar (Fig. 4e) (see Note 3). 10. 1 mL tuberculin syringe. 11. Hemostat. 12. Valacyclovir Hydrochloride (Valtrex, Glaxo Wellcome, Inc., Greenville, NC): Crushed Valtrex tablets are diluted in water to final concentration of 1 mg/mL. 2.2 Anesthesia, Intracardiac Perfusion, Sample Preparation, and Analysis

1. Avertin [15]. 2. Saline solution: (0.9% NaCl). 3. 30 mL syringe. 4. 20 gauge needle. 5. 96 well plates. 6. Autoclaved surgical instruments (#5 Dumont forceps and surgical scissors). 7. Applied Biosystems 7500 Real-Time PCR system. 8. PicoPure DNA extraction kit with 1 mg/mL proteinase K (supplied in kit). 9. Quant PicoGreen solution, including Lambda DNA standard (supplied in kit). 10. Nuclease-free H2O. 11. Stock TE buffer (20): 10 mM Tris–HCl, 1 mM EDTA, pH 7.5.

424

Jennifer H. LaVail

12. Dilute TE buffer (1 part diluted into 19 mL of Nuclease free H2O) in a 50 mL Falcon tube. Total volume of solution needed is dependent upon the number of samples. 13. Aluminum foil. 14. Two 15 mL Falcon tubes. 15. 1.5 mL sterile Eppendorf tubes. 16. Branson 2510 ultrasonic water bath. 17. Primers and probes specific for sequences within the HSV-1 thymidine kinase gene: forward 50 -AAA ACC ACC ACC ACG CAA CT-30 , reverse 0 5 -TCA TCG GCT CGG GTA CGT A-30 , probe 50 -FAM-TG GGT TCG CGC GAC GAT ATC G-TAMRA-30 . 18. Taqman Universal PCR Master Mix. 19. Purified HSV-1 DNA.

3

Methods

3.1 Preparation of Viral Solution and Loading the Injection Apparatus

1. Insert an intact needle into one end of a 30 mm length of the PE tubing (Fig. 4c). Attach the collar of the needle to a 1 mL tuberculin syringe. Draw up distilled water into the PE tubing and rinse several times. Fill the tubing with water. Remove 1 mL syringe. 2. Draw water into the Hamilton repeater syringe. 3. Attach the collar of the needle on the filled tubing to the Hamilton repeater pump and expel all of the water possible by pressing in the plunger. Pull back gently on the plunger to get a small air bubble in the end of the tubing. This bubble will serve as a marker for the limit of fill of the viral solution. 4. Draw up virus into the tubing by pulling on Hamilton syringe plunger. Monitor how much is loaded by the movement of the bubble and the number of “clicks” available on the plunger. Do not allow the virus to flow into the Hamilton syringe.

3.2 Viral Injection into the Vitreal Chamber

1. Anesthetize the mouse with an intraperitoneal injection of Avertin (~0.2 mL) per 10 g body weight. The mouse will be asleep in about 5 min. Place a drop of the atropine: proparacaine mixture on the cornea of each eye for 10 s. Wipe the eyes with a sterile cotton swab. 2. Hold the shank of the needle in a hemostat with the bevel down. Insert about 3 mm of the needle into each eye at the limbus (Fig. 2). Press pump 4 times, that is, deliver 4 μL. Check that the bubble in the tubing moves with the click. Hold in place for at least 30 s and withdraw (see Note 4).

Transport and Isolation of HSV-1 DNA in Retinal Ganglion Cell Axons In Vivo

425

3. Provide a fresh solution of Valacyclovir to the mice 24 h after viral infection and then every day thereafter at approximately the same time. 4. Reserve an uninfected mouse as a control. 3.3 Dissection of the Optic Tract ( See Note 5)

1. Anesthetize the mouse by intraperitoneal injection of fresh Avertin. Perfuse the mouse intracardially with normal saline delivered through a 20 gauge needle attached to a 30 mL syringe. 2. The retina may be isolated at this time to include this portion of the optic path in the analysis [16]. Retina can be collected, but the amount of viral DNA in retinal ganglion cells will be only a portion of the DNA detected because HSV-1 will replicate in other cell populations. 3. Remove the skin from the head. Using blunt scissors cut the cranium along the midline and separate the frontal bones to reveal the brain (Fig. 5a). Lift the two cerebral hemispheres slowly until the two (ON) can be identified (Fig. 5b). Using surgical scissors cut the two nerves as near as possible to the points where they enter the orbital foramen. The brain can be flipped over by pulling back the frontal lobes. The ON will fall onto the ventral surface of the brain (Fig. 5c) and the OC (∗) and two OT will be exposed. Use #5 forceps to pull back the temporal lobe of the brain to expose the OT extension to the thalamus. Cut as close to the thalamus as possible (Fig. 5d). Lastly, cut the OT at the OC (see Note 6). Gently peel off each OT from the brain tissue.

3.4 DNA Extraction and Total DNA Quantification (See Note 7)

1. Deposit both OT into 155 μL of PicoPure DNA extraction buffer containing 1 mg/mL proteinase K. Sonicate for 15 min, incubate samples for 3 h at 65  C, then for 10 min at 95  C. 2. Dilute the PicoGreen solution with TE and protect from light by wrapping tubes in aluminum foil. 3. Serially dilute the lambda DNA supplied in the kit with the dilute TE buffer. A series from 10 ng/μL to 10 pg/μL should be prepared. 4. Plate the samples in duplicate in 96 well plates and analyze using the Real-Time PCR system. 5. The resulting fluorescence data is normalized against a standard curve of lambda DNA with an R2 greater than 0.98.

3.5 Determination of Viral Copy Number by Quantitative PCR

1. Mix Taqman Universal PCR Master mix containing forward and reverse primers, and fluorescent probe with 5 μL of each OT sample.

426

Jennifer H. LaVail

Fig. 5 Exposure of the brain and optic pathway of mouse. (a) The dorsal surface of the brain is exposed and the cerebral hemispheres (CH) lie on either side of the midline (m). The cerebellum can be seen at the top of the photo. (b) The cerebral hemispheres (CH) are reflected up to expose the optic chiasm (∗) and optic nerves (ON) (arrow). The ON extend laterally to the optic foramina. At the opposite end of the ON, the ON is continuous with the optic chiasm (OC). The right trigeminal ganglion (tg) can be seen just lateral to the ON. (c) The two ON are cut near the optic foramina and lie on the undersurface of the CH (arrow). The ON, OC (∗) and OT (arrow) can be seen. The temporal lobe of the CH covers the distal part of the OC. (d) Carefully dissect the OT away from the temporal lobe. Cut the OT at the point where it bifurcates at entry to the thalamus (at tip of forceps). Bar ¼ 2.5 mm (see Note 6)

2. Run samples in duplicate using the Real-Time PCR system under standard cycle conditions. 3. Plot a standard curve based on tenfold dilutions of purified HSV-1 DNA from 101 to 107 copies of genome. 4. To compare the number of copies of viral DNA in individual experiments, measure the copies of viral DNA in each sample and divide that by the total viral and cellular DNA for the same sample. This ratio can be expressed as copies of viral DNA/ng total DNA in each sample (see Note 6).

4

Notes 1. We use male mice of standard age (5–6 week-old) and strain (BALB/c) and from a single breeder (Simonsen Laboratories, Gilroy, CA). Avoid older mice, because the rates of transport vary with animal age [7]. There are also strain differences in the

Transport and Isolation of HSV-1 DNA in Retinal Ganglion Cell Axons In Vivo

427

immune response to HSV-1 [17]. We use BALB/c mice for their intermediate resistance to HSV-1 infection; the strain is susceptible, but not so susceptible as to produce very rapid and widespread HSV-1 infection. It is important to include an uninfected mouse for each experiment as a negative control. 2. The stock solution of F strain of HSV-1 is propagated in African green monkey kidney (Vero) cells as described previously [9]. Viral titers are determined in triplicate by standard plaque purification assay [18]. 3. To prepare the needle, grip the metal part of the needle with a hemostat at the junction of the metal needle and plastic collar. Hold the plastic part and rock the part back and forth while twisting it at the same time. The needle should break off at the plastic mount. Check that the needle end is patent. Prepare several needles for use at one time. 4. Clean the pump system after each use by rinsing with distilled water and 100% ethanol. Separate tubing and needles are used for each viral stock. 5. Autoclave surgical instruments before dissections of each animal for DNA analysis. Use separate autoclaved #5 Dumont forceps and surgical scissors for each OT of each animal. 6. The optic tract is cut slightly distal to the optic chiasm. Some of the axons of retinal ganglion cells innervate the hypothalamus at this region. To avoid contamination of retinal axons with hypothalamic neurons, we cut the OT from the optic chiasm for OT dissections. 7. This ratio can be used to compare HSV-1 transport rapidly in different strains of mice as well as different mutant strains of virus in one strain of mouse. A more complete description of the DNA analysis has been published [12].

Acknowledgments I thank the artist Ms. Suling Wang and Drs. Kimberly Topp and Jolene Draper at UCSF and Dr. Judy Garner at USC for their help in developing the procedure. This work was supported by PHS grants EY008773, EY019159, and EY002162 and by funds from That Man May See, San Francisco, CA and by an unrestricted grant from Research to Prevent Blindness. References 1. Margolis TP, LaVail JH, Setzer PY, Dawson CR (1989) Selective spread of herpes simplex virus in the central nervous system after ocular inoculation. J Virol 63(11):4756–4761

2. LaVail JH, Draper JM, Chang WC, Sretavan DW (2011) The anterograde axonal transport of herpesviruses: a review of experimental approaches. In: Diefenbach RJ, Cunningham

428

Jennifer H. LaVail

AL (eds) Viral transport, assembly and egress. Research Signpost, Kerala, India, pp 1–20 3. Taylor AC, Weiss P (1965) Demonstration of axonal flow by the movement of tritiumlabeled protein in mature optic nerve fibers. Proc Natl Acad Sci U S A 54:1521–1527 4. Grafstein B (1967) Transport of protein by goldfish optic nerve fibers. Science 157:196–198 5. Grafstein B, Murray M, Ingoglia NA (1972) Protein synthesis and axonal transport in retinal ganglion cells of mice lacking visual receptors. Brain Res 44:37–48 6. Yu DY, Cringle SJ, Balaratnasingam G, Morgan WH, Yu PK, Su EN (2013) Retinal ganglion cells: energetics, compartmentation, axonal transport, cytoskeletons and vulnerability. Prog Retin Eye Res 36:217–246 7. LaVail J, Nixon R, Sidman R (1978) Genetic control of retinal ganglion cell projection. J Comp Neurol 182(3):399–422 8. Jeon C-J, Stretto E, Masland RH (1998) The major cell populations of the mouse retina. J Neurosci 18(21):8936–8946 9. LaVail JH, Tauscher AN, Aghaian E, Harrabi O, Sidhu SS (2003) Axonal transport and sorting of herpes simplex virus components in mature mouse visual system. J Virol 77(11):6117–6127 10. Curanovic´ D, Ch’ng TH, Szpara M, Enquist L (2009) Compartmented neuron cultures for

directional infection by alpha herpesviruses. Curr Protoc Cell Biol 43:26.24.21–26.24.23 11. Garner JA, LaVail JH (1999) Differential anterograde transport of HSV type 1 viral strains in the murine optic pathway. J Neurovirol 5:140–150 12. Draper JM, Huang G, Stephenson GS, Bertke AS, Cortez DA, LaVail JH (2013) Delivery of Herpes simplex virus to retinal ganglion cell axon is dependent on viral protein Us9. Invest Ophthalmol Vis Sci 54(2):962–967 13. Harrabi O, Tauscher AN, LaVail JH (2004) Temporal expression of herpes simplex virus type 1 mRNA in murine retina. Curr Eye Res 29(2-3):191–194 14. LaVail JH, Tauscher AN, Hicks JW, Harrabi O, Melroe GT, Knipe DM (2005) Genetic and molecular in vivo analysis of herpes simplex virus assembly in murine visual system neurons. J Virol 79(17):11142–11150 15. Lumb WV (1963) Small animal anesthesia. Lea and Febiger, Philadelphia, PA 16. Winkler BS (1972) The electroretinogram of the isolated rat retina. Vision Res 12:1183–1198 17. Lopez C (1975) Genetics of natural resistance to herpesvirus infections in mice. Nature 258:152–153 18. Burleson FG, Chambers T, Wiedbrauk DL (1992) Virology: a laboratory manual. Academic Press, Inc., San Diego, CA

Chapter 27 The Murine Intravaginal HSV-2 Challenge Model for Investigation of DNA Vaccines Joshua O. Marshak, Lichun Dong, and David M. Koelle Abstract DNA vaccines have been licensed in veterinary medicine and have promise for humans. This format is relatively immunogenic in mice and guinea pigs, the two principle HSV-2 animal models, permitting rapid assessment of vectors, antigens, adjuvants, and delivery systems. Limitations include the relatively poor immunogenicity of naked DNA in humans and the profound differences in HSV-2 pathogenesis between host species. Herein, we detail lessons learned investigating candidate DNA vaccines in the progesteroneprimed female mouse vaginal model of HSV-2 infection as a guide to investigators in the field. Key words Herpes simplex virus, Animal model, DNA vaccine, Antibody, Polymerase chain reaction, Latency, Dorsal root ganglia

1

Introduction There is no licensed vaccine for herpes simplex virus type 1 (HSV-1) or herpes simplex virus type 2 (HSV-2). Inbred mice do not recapitulate some of the features of HSV infections in humans. For example, murine infections tend to be either fatal at high inoculum or fail to establish themselves at low inoculum, while human primary infections are rarely fatal. The infectious inoculum dose is not known in humans. Additionally, humans have spontaneous reactivations leading to shedding of infectious virus at epithelial surfaces [1, 2] while mice at best have rare molecular evidence of reactivation, even when stressed or immune suppressed, and seldom reactivate all the way to shedding of infectious virus [3, 4]. Nonetheless, both species exhibit the establishment of HSV latency in dorsal root ganglia (DRG) that innervate sites of epithelial inoculation, and both show worsening of disease course with immune suppression. Recently, epigenetic or signaling pathway drugs have shown some activity for inducing recurrence in murine ganglia [5]. Full recurrences have been achievable in some HSV-1 mouse models, and are beginning to be studied in combination

Russell J. Diefenbach and Cornel Fraefel (eds.), Herpes Simplex Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2060, https://doi.org/10.1007/978-1-4939-9814-2_27, © Springer Science+Business Media, LLC, part of Springer Nature 2020

429

430

Joshua O. Marshak et al.

with vaccines [6]. The animal efficacy phase of the preclinical study of a candidate HSV vaccine typically sequences murine immunogenicity and then protection studies and then progresses to guinea pig and first-in-human stages [7]. Un-manipulated female mice have a 4 day estrus cycle and are refractory to vaginal HSV-2 inoculation. Exogenous progesterone pretreatment alters vaginal physiology [8], HSV receptor levels [9], and perhaps immune mechanisms [10] to render animals more susceptible. Animal age [8] and strain [11] are other critical variables for HSV susceptibility for some viral strains and routes of inoculation. Balb/c mice tend to be more susceptible to virus challenge [11], and in general are easier to handle. However, C57BL/6 mice have a thoroughly characterized CD8 T-cell response [12, 13], HSV TCR transgenics [14], and many genetic variants such that they may be preferable for some experiments. 1.1 DNA Vaccines and Vaccination

At the time of writing there is no DNA vaccine licensed for use in humans. Despite this, DNA vaccines continue to be attractive. Advantages are the ability to produce broad immune responses including CD4, CD8, and antibody [15], storage and shipping stability, ease of production, predictable cost, the potential for in vivo posttranslational modification of vaccine product, and a long duration of antigen presentation. Sequences can be modified to reflect microbial strain changes, to target the MHC class I pathway through the addition of ubiquitin or other motifs, to optimize codon utilization, or to include immunostimulatory CpG motifs. DNA vaccines can also be delivered by diverse routes and in concert with adjuvants or enhancers aimed at increasing the uptake or protein expression or creating an immunogenic microenvironment [16, 17]. In mice, vaccine route can be varied to mimic potential human delivery routes, or to target different immune pathways. With intramuscular (IM) injections of DNA vaccine, antigen processing and immune priming likely occur in the draining lymph nodes. In contrast, antigen-presenting cells (APC) in the immediate area are thought to play a key role in the immune response to DNA vaccines delivered to the dermis [2, 18]. Additionally, vaccination in the skin has been reported to be up to tenfold more potent than the IM route [2] and therefore to have the potential for dose-sparing. DNA vaccines can be prepared in-house or manufactured by third party contractors. In general these vaccines consist of (1) a bacterial plasmid backbone with an antibiotic resistance gene and bacterial origin of replication, (2) a strong eukaryotic promoter, and (3) a DNA-coded vaccine insert. Our group’s experience with the pVAX1 vector, manufactured by Invitrogen, is detailed herein. This nonproprietary molecule is commercially available but other vectors with similar features can also be used. pVAX1 is specifically designed for DNA vaccine development with a CMV promoter,

DNA Vaccines and HSV-2 Mouse Vaginal Infection Model

431

multiple cloning site, and kanamycin resistance for selection in E. coli. It is recognized that DNA vaccines for clinical trial administration to humans typically lack antibiotic resistance markers. A strategic decision is required as to whether to move directly to one of these proprietary vectors for preclinical testing Plasmid backbones without antibiotic resistance genes are now technically compatible for large scale manufacturing and are beginning to be used in murine HSV studies and human trials [19, 20]. When producing vaccine in-house, make enough vaccine to complete your studies. With vaccine doses as high as 100 μg each, a 100 animal study with two doses/animal could easily require over 20 mg of vaccine. Outsourcing can be attractive but requires additional decisions concerning good manufacturing process (GMP) specifications and costs. Special efforts must be made to monitor the purity and identity of DNA vaccines. We recommend resequencing the final vaccine construct and checking for expression of the bona fide protein as outlined below. In situations where we have not had a mAb, we have used polyclonal human immune sera or human CD8 T-cell clones specific for the HSV-2 gene of interest [15]. E. coli strains typically used to manufacture plasmid are derivatives of the “safe” lab strain K-12 but still have an altered endotoxin. This TLR4 agonist that could have an unrecognized adjuvant effect and level should be carefully monitored. There are several design considerations for DNA vaccines. HSV sequences are GC rich and some coding regions have repeat elements; these features can lead to cloning difficulties or instability. Codon optimization is important in some viral systems and has been reported for HSV-2 [21, 22]. Intellectual property, institutional review board (ethics), and cost considerations may favor synthesis of the gene of interest or routine PCR cloning to obtain the initial HSV-2 inserts. The relatively fast turn-around time, welldefined clinical and immune end points, and the consistency of the vaginal HSV-2 challenge model have made it attractive for testing various types of molecular adjuvants encoded by DNA and chemical or mechanical gene delivery enhancers. Examples include plasmid-encoded cytokines [23], cationic lipids with known cellular DNA delivery properties [16], electroporation [24], microparticle delivery [25], and percutaneous microneedles [2]. 1.2 Virus and Virus Challenge

Several challenge strains of HSV-2 are in use. A nearly complete genome is available (GenBank JX112656.1) for the virulent strain 186. The prototype strain HG52 has mutations rendering it less virulent [26] and is therefore disfavored. Some researchers are using low-passage, near wild-type strains in animal HSV-2 research and finding them more challenging to obtain protection. While we have not yet applied this to DNA vaccines, this is a quite rational reality check [27, 28].

432

Joshua O. Marshak et al.

Sequence matching between vaccine and challenge strain is important when working with candidates, such as DNA vaccines, that present only a limited amount of the HSV proteome. In our work, we sequenced strain 186 and wild-type HSV-2 tegument genes UL46 and UL47, found consistent differences compared to HG52, and therefore chose to match DNA vaccines to the wildtype consensus and the challenge strain [15]. Over the last several years, hundreds of full-length and near full-length HSV-2 and HSV-1 genomes have become available [29–32]. These should be consulted during the design phase of subunit vaccines using nucleic acid or other formats. Some genes, such as UL23, show high variability, while others, such as US6 encoding vaccine candidate glycoprotein D, show very little. Complexity is added by the frequent detection of HSV-2 clinical strains that are HSV-2
HSV-1 interspecies recombinants [33, 34]. We use a replication-competent, attenuated HSV-2 strain delivered vaginally as positive control vaccine. We selected a strain based on availability [35] and a track record of near-sterilizing, durable immunity that appears to depend on CD4 T-cells [36]. This attenuated strain is made from HSV-2 strain 333, which also has a GenBank sequence. The relatively minor differences between 186 and 333, in the context of the large overall proteome do not preclude protection. Diverse attenuated strains bridging the spectrum between replication-competent and replication-incompetent are available and suitable as vaccine positive controls [28, 37]. These are also helpful for studying immune responses in infection versus vaccination to compare the two contexts. Live attenuated vaccines set a high bar and help to differentiate simple survival from higher levels of protection. One disadvantage of the TK-minus positive control is that the establishment of DRG latency, making DRG HSV DNA measures a problematic vaccine end point. 1.3 Murine Challenge End Points 1.3.1 Survival

When HSV-2 strain 186 is introduced vaginally to progesteronetreated mice and infection establishes itself as indicated by local lesions and viral replication, death usually occurs by day 6–8. There is a very narrow window near the 50% lethal dose (LD50) within which some animals seroconvert but survive. With specific criteria for euthanasia, including hind limb paralysis, ataxic gait, immobility, or dehydration, survival is a relatively objective and unambiguous end point. Very occasionally, challenged mice treated with negative control vaccines have survived to 21 days. To determine infection, we compare preinfection and day 21 serum from survivor mice in a simple ELISA using whole UV-inactivated HSV-2 as a coating antigen and survivor animal serum at 1:100 and 1:300 dilution as detailed elsewhere [15]. A threefold increase in OD450 is consistent with infection. Mice that fail to mount specific antibody responses could have either had sterilizing immunity or been

DNA Vaccines and HSV-2 Mouse Vaginal Infection Model

433

improperly inoculated. Attention to detail in progesterone treatment, vaginal inoculation, and the titration and storage of challenge virus are important to minimize this ambiguous situation. To study anamnestic immunity that is primed by vaccine and boosted by infection in mouse groups not expected to survive, we will sometimes include additional mice for sacrifice on day 6 after challenge to permit both immune boosting and survival end points. 1.3.2 Clinical Score

Many HSV-2 murine challenge models use a 0–4 scoring scale. Scores of 3 or 4, as detailed below, trigger humane euthanasia. Mice typically show few symptoms through day 5, but their condition can deteriorate rapidly thereafter and twice daily monitoring is appropriate. Scores provide a continuous variable of overall efficacy to distinguish otherwise similar vaccines.

1.3.3 Vaginal HSV-2 DNA Copy Number Assessed by Quantitative PCR

Measure of microbial titer is a regular part of preclinical vaccine studies and many groups have used plaque assays to titer vaginal swabs and other tissues after HSV-2 challenge. We prefer PCR based on cost and the local availability of a sensitive and accurate assay [38]. The main value is ranking of test vaccines that lead to 100% survival. Many HSV-2 vaccines are based on glycoprotein D (gD, encoded by gene US6), known for several years to lead to complete mouse protection when administered as a DNA vaccine [39]. The failure, to date, of gD2 vaccines in humans is another story altogether [40, 41]. A measure of vaginal replication such as PCR can distinguish vaccines leading to survival only from vaccines that decrease early mucosal replication. Day 1 (24 h) vaginal HSV-2 DNA copy number is correlated with survival [2] and DRG HSV-2 DNA load at latent time points in survivor mice (Koelle et al. unpublished). The useful TK-minus positive control typically leads to near-sterilizing immunity, especially by day 5 [21].

1.3.4 Specific Immunity

Antibody and T-cell assays are typically used to confirm immunogenicity and the delivery of the desired antigen. It is less clear that we have a good correlate of efficacy for mouse survival, and as no vaccine has consistently worked in humans, targeting of such assays is still uncertain. Pure antigen is best to detect specific antibodies, and given the multiple protein targets available within HSV-2 and the proprietary nature of some candidate protein antigens [40] this may be difficult to obtain. We have substituted commercially available gD1 for the desired gD2 in some work [2, 16], and used relatively crude HSV-2 protein made by eukaryotic host cell transient transfection for tegument proteins [15]. T-cell responses mediated by CD4 and CD8 T-cells are widely sought after and can be detected by several methods. One can consult the literature for commonly used HSV-2 proteins such as gD2, recalling that epitopes are mouse H-2 haplotype-specific. To test other HSV-2 proteins, preliminary vaccine-only (no challenge) experiments are

434

Joshua O. Marshak et al.

done in which immune splenocytes are tested for interferon-γ responses to overlapping peptide sets covering the HSV-2 protein (s) of interest. The phenotype (CD4 versus CD8) of responding cells are established in depletion studies as detailed [15]. It is helpful to independently establish that the same T-cell epitopes are also recognized by immune splenocytes in the context of actual HSV-2 infection. The attenuated TK-minus HSV-2 strain is used for this purpose [15]. We specifically note that splenocytes harvested from noninfected mice sometimes show high background in IFN-γ ELISPOT. This problem has occurred in temporal waves in our animal facility and while likely related to inflammation or infection, veterinary care staff can have difficulty identifying a discrete problem that can be fixed. Detailed antibody and T-cell assay methods are not addressed herein but myriad primary or methods sources are available. It is now appreciated that vaccine protection against HSV inoculated via skin or the reproductive tract may be mediated by tissue resident-memory T cells (TRM), as recently reviewed [42], and indeed the flank scarification model of HSV-1 was instrumental in the modern definition of TRM [43]. In the context of candidate HSV vaccines tested in mice, the measurement of HSV-specific T cells in the female reproductive tract (FRT) after enzymatic digestion, using genetically marked T cells or functional assays, is an attractive end point. This has been performed for various vaccine platforms [44–46] and is rational for DNA vaccines as well. Similarly, antibody levels and functional antibody titers can be measured in FRT specimens, and HSV-specific B cells can be enumerated at anatomically relevant sites [47–49]. These local immunity measures are technically difficult but likely more physiologically relevant than blood or splenocytes-based assays. 1.3.5 HSV-2 Latency in DRG

Controversy exists as to whether HSV-2 vaccines for human use should be sterilizing, preventing local infection and the establishment of DRG latency, or merely ameliorate disease [7]. HSV-2 does establish latency in mice, and careful dissection followed by explant culture or PCR can detect and measure this variable. While explant culture proves infectious virus, we prefer PCR for the reasons outlined above. Animal models support the contention that DRG HSV-2 load is related to reactivation [50]. There is a learning curve in establishing the dissection method, throughput is limited even for skilled operators, and the TK-minus positive control virus leads to positive DRG PCR such that this end point is not useful for this vaccine unless a strain-specific PCR is designed. We generally measure the number of HSV-2 genomes present and the number of mouse genomes present using GAPDH as a diploid housekeeping gene. Results are expressed as HSV-2 DNA copy number per million mouse cells [16]. Regarding timing, most

DNA Vaccines and HSV-2 Mouse Vaginal Infection Model

435

investigators wait between 60 and 100 days after inoculation, although valuable immunology research has been done in latently infected DRG at 30 days [51].

2

Materials Materials and reagents comparable to the standards in our lab can be used at the discretion of the specific lab.

2.1

Mice

2.2 Vaccines and Vaccine Delivery

Female Balb/c or C57BL/6 mice at sexual maturity, age 5–6 weeks (see Note 1). Vaccine composition and route will be tailored to specific research. We include as gold standard positive control a replicationcompetent HSV-2 strain attenuated through deletion of part of gene UL23 encoding thymidine kinase (TK). This TK-minus virus requires specific institutional approval. Though it is less virulent than wild-type HSV-2, TK-minus strains are acyclovir resistant, leading to occupational health concerns (see Note 2). 1. Positive control TK-minus HSV-2 strain at a titer of 108 PFU/mL or higher. 2. Positive control amino acids 1-340 glycoprotein D (gene US6) of HSV-2 cloned into commercially available pVAX1 (Invitrogen) described below. This is an alternative positive control. 3. Negative control pVAX1 plasmid. 4. Researcher-selected and -sourced test vaccine(s) with or without adjuvants, excipients, stabilizers, preservatives, etc. 5. Appropriate negative controls for test vaccines, typically containing the same buffers, adjuvants, etc. but no active compound. Note that TLR agonists delivered locally can protect the vagina [52]. Innate immunity-stimulating adjuvants, if used, should therefore be incorporated into controls. 6. TK-minus positive control virus: Seed stocks were obtained from Dr. Greg Milligan at the University of Texas Medical Branch, Galveston, Texas and originally published by Stanberry et al. [35]. Stocks should be regrown in Mycoplasma negative Vero or similar cells, tittered by standard plaque assay, and stored in single-use aliquots at 80  C. We confirmed deletion within UL23 by PCR comparing virulent strain 186 and TK-minus using PCR primers at the 50 and 30 ends of the coding region followed by agarose gel electrophoresis and sequencing. Strain 186 lead to a product of approximately 1.1 kb while product from the TK-minus strain was considerably shorter, reflecting internal deletion.

436

Joshua O. Marshak et al.

7. pVAX1-gD2 positive control vaccine: Please see our publication for details [2]. Briefly, gD2 amino acids 1-340 were cloned by PCR from a random clinical HSV-2 isolate into pVAX1 (Invitrogen). Similar results have been obtained by gene synthesis. pVAX1 expresses the insert under the control of a CMV promoter. Plasmid was harvested from small scale E. coli cultures under kanamycin selection and sequenced to prove identity. Seed was provided to a commercial DNA manufacturer for near-GMP material for pVAX1 and PVAX1-gD2 at 1 mg/mL with defined endotoxin levels. With regard to amount, three IM injections of 10 μg per mouse at 21 day intervals lead to solid protection. Plan ahead and make a single large batch for the positive control group. The gD2 construct is predicted not to localize to cell membranes due to deletion of the C-terminal transmembrane domain within amino acids 341-393 [53]. To check expression of gD2 we used flow cytometry [2]. Briefly, vaccine from the manufacturer was transfected into Cos-7 cells (obtained from ATCC) with Fugene 6 (Roche) per the package insert. After 48 h cells were permeabilized with Cytoperm/ Cytofix (Pharmingen) per the manufacturer’s instructions and stained for flow cytometry using as first antibody, mouse antigD mAb 2C10 (Santa Cruz Technologies), and as secondary antibody allophycocyanin-labeled goat anti-mouse IgG (Biolegend). The result was that pVAX-1 control-transfected Cos-7 were negative for specific fluorescence while pVAX-1-gD2transfected cells were 20–40% positive. Vaccine stocks were stored at 20  C until use. 8. pVAX1 empty vector control: Prepare identically to pVAX1gD2. 9. Test vaccines: Prepare investigator-specific DNA vaccines, optimally in a manner similar to that of a positive control DNA vaccine such as the one discussed above. Regarding amount, plan for in the range of 10–100 μg per mouse per vaccination and two to three vaccinations per mouse. Single large batches are therefore preferable. We have found that Qiagen “EndoFree” Midi- or Maxi-prep kits are adequate if one is not using a commercial vendor. In addition to sequencing the final vaccine, it is preferable to verify expression of the bona fide HSV-2 protein. The use of a specific mAb as outlined for gD2 can be pursued if such a reagent is available. In our work with DNA vaccines encoding HSV-2 tegument proteins, we used both humoral and cellular human immunology probes. VM92 cells were transfected with the candidate DNA vaccines and supernatants collected and plated onto ELISA plates, and probed with pooled human serum obtained either from HSV-2infected persons or HSV-1/HSV-2 dually seronegative persons. Specific binding of only the immune sera was observed

DNA Vaccines and HSV-2 Mouse Vaginal Infection Model

437

for each HSV-2 protein tested [15]. For CD8 T-cell tests, Cos-7 cells were cotransfected with both the test vaccine and the relevant HLA class I heavy chain cDNA and coincubated with CD8 T-cell clones specific for the HSV-2 protein under study, as detailed in a previous methodology paper [54]. The expected result is that only cells transfected with both the HLA and HSV-2 protein trigger specific interferon-γ release [15]. 2.3 Intramuscular (IM) Vaccine Delivery to the Rectus Femoris Quadriceps Muscle

1. 70% Ethanol. 2. 200
200 Gauze sponges. 3. Vaccine and diluent such as PBS (40 g NaCl, 1 g KCl, 5.7 g Na2HPO4, 1 g KH2PO4, add H2O to a final volume of 5000 mL, adjust pH to 7.4, autoclave, store at 4  C). 4. 29 Gauge, ½00 , 0.3 cm3 insulin syringes (see Note 3).

2.4 Intradermal (ID) Vaccine Delivery to the Pinna (Ear)

1. Anesthetic: Ketamine–xylazine anesthetic. Ketamine is obtained from the clinical pharmacy at 100 mg/mL and xylazine at 20 mg/mL. Please note that xylazine stocks also come at 100 mg/mL and care is required to check each bottle. Both are stored at room temperature. A premix is made and stored at room temperature for up to 28 days. Mix 0.65 mL (100 mg/ mL) ketamine with 0.22 mL (20 mg/mL) xylazine and 9.13 mL sterile saline. The final solution contains 6.5 mg/ mL ketamine and 0.44 mg/mL xylazine and is dosed at 20 μL/g of body weight (see Notes 4 and 5). 2. Needle and syringe 25 gauge 5/800 Safety-Lok™ syringes (Becton Dickinson) for intraperitoneal (IP) injection of anesthesia. 3. Vaccine and diluent such as PBS (see Subheading 2.3, item 2). 4. Optional: Blu-Tack™ (manufactured by Bostik) (see Note 6). 5. 30 gauge, ½00 , 0.3 cm3 ultrafine insulin syringe (Becton Dickinson #328280). One per ear to be injected. We recommend this specific product for this application.

2.5

Virus Challenge

Virus culture/preparation is not detailed herein. Researchers should be competent in virus handling and growth at BSL-2 levels. We use Mycoplasma-negative stocks of Vero cells originally obtained from the American Type Culture Collection (ATCC) to grow virus. Obtain institutional approvals for each strain used including the TK-minus strain if appropriate. Store stocks in small ~100 μL aliquots at 80  C in screw-cap, O-ring style tubes. 1. Biosafety cabinet certified to BSL-2. 2. Medroxyprogesterone 150 mg/mL. This is obtained from the clinical pharmacy as Depo-Provera™. Amount needed is 2 mg/animal. Also required prior to TK-minus virus immunization used for positive vaccine control.

438

Joshua O. Marshak et al.

3. 1 mL sterile syringes 25 gauge 5/800 Safety-Lok™ syringes (Becton Dickinson) for medroxyprogesterone injection, one per animal. 4. HSV-2 strain 186 or other virulent strain with titer of 108 PFU/mL or higher (see Note 7). 5. Normal mouse serum prepared from naı¨ve animals 0.1% solution in PBS (see Note 8). 6. Sterile 1.7 mL DNase/RNase-free microfuge polypropylene conical-bottom tubes for virus dilution. 7. Ketamine–xylazine anesthetic premix (see Subheading 2.4, item 1). 8. Sterile syringes for anesthetic (see Subheading 2.4, item 2). 9. Calcium alginate swab (Fisher), one per animal. 10. 2–20 μL range adjustable pipette and sterile nuclease-free filter pipette tips. 11. 10% bleach in water. 2.6 Challenge Study End Points 2.6.1 Survival

1. Record keeping materials in animal facility. 2. Excel spreadsheet with two columns for each day (morning and evening) and one row per animal. 3. Institutionally and facility approved method for getting paper data out of animal room, for example plastic bags with disinfectant spray to outside of bag.

2.6.2 Clinical Score

1. Record keeping materials in animal facility. 2. Excel spreadsheet with two columns for each day (morning and evening) and one row per animal. 3. Reference sheet/card with disease score criteria for disease score 0–4.

2.6.3 Vaginal Swab for HSV-2 DNA Copy Number via PCR

1. 2 mL Polypropylene sterile O-ring tubes (Sarstedt) with 1 mL PCR digestion buffer, one tube per animal per day. Prelabel tube with animal ID number and day. 2. Digestion buffer is 100 mM KCl, 10 mM Tris–HCl pH 8.0, 25 mM EDTA, 0.5% Nonidet P-40. Store at room temperature prior to use. Digestion buffer can be made as a 5
solution. For 5
, 3.7 g KCl, 50 mL Tris–HCl, 1 M, pH 8.0250 mL EDTA, 0.5 M, pH 8.0, 50 mL Igepal CA-630 and bring volume up to 1000 mL with deionized molecular biology grade water. Dilute 1:5 to make working solution. Note that Ipegal CA-630 (Sigma-Aldrich) is chemically indistinguishable from Nonidet P-40, which is no longer commercially available. 3. Sterile mini-tip urethral swabs (Copan), one per animal per day. 4. Small sharp scissors.

DNA Vaccines and HSV-2 Mouse Vaginal Infection Model 2.6.4 Blood Collection for Serologic End Points (See Note 9)

439

1. Ketamine–xylazine anesthetic (see Subheading 2.4, item 1). 2. Glass Natelson blood capillary collection tubes (Fisher), nonsterile. 3. 200
200 Gauze sponges (Fisher). 4. Blood collection: “Microtainer™” nonsterile serum separator tubes (Becton Dickinson) or sterile Eppendorf tubes if downstream cell-culture based assays such as neutralization assays that require sterility are anticipated. 5. Optional: Artificial tears ointment sterile ophthalmic petrolatum and mineral oil lubricant (NDC). 6. Disposable plastic 3 mL transfer pipettes with bulb that can be trimmed away. 7. Benchtop microcentrifuge with capability up to 9300
g.

2.6.5 DRG Dissection

1. Dissecting scope such as SMZ-800 Zoom stereo (Nikon). 2. Light source such as NI-30 single gooseneck illuminator (Nikon). 3. Low quality dissection forceps. 4. Low quality dissection scissors. 5. Student Vannas spring scissors for laminectomy (Fine Science Tools #91500-09). We specifically recommend this item. 6. Vannas spring scissors for DRG excision and lower spine laminectomy (Fine Science Tools #15012-12). We specifically recommend this item. 7. Two of each high quality forceps (Fine Science Tools #1127130 and #11272-30). We specifically recommend these items. 8. Dry ice. 9. Acceptable surface on which to perform dissections such as disposable dissecting board or dense sturdy Styrofoam covered with Kimtech science benchtop protector (Fisher); one piece large enough to cover the dissection work surface for each animal. 10. Sterile O-ring cryovials (2 mL, Sarstedt), one per animal, prelabel. 11. Digestion Buffer 150 μL/animal: 10 mM Tris–HCl, 25 mM EDTA, 10 mM KCl, 1% Igepal C-630. 12. 20 Gauge syringe needles. 13. 70% Ethanol in water. 14. 10% Bleach in water.

440

3 3.1

Joshua O. Marshak et al.

Methods (See Note 10) Mouse Restraint

1. Place the mouse on a surface it can grasp. 2. Gently pull on mouse tail and maintain light pressure; the mouse will try to pull away. 3. Grasp the scruff of the neck with the thumb and the forefinger of the other hand. 4. Maintain hold of tail. 5. A mouse can be restrained with one hand large/flexible enough to hold the tail against the pad of the hand with the little finger while scruffing the neck with the thumb and the forefinger. This causes hand fatigue over time.

3.2 Mouse Husbandry

1. Ensure that institutional approval is in place. 2. Follow facility/institutional requirements concerning work with HSV-2. In the USA, HSV-2 is a biosafety level 2 (BSL-2) agent. Nomenclature may vary internationally. Comply with housing and procedure room standards at all steps after mice are vaccinated with attenuated HSV-2 positive control, if used, or challenged with live HSV-2. 3. Order mice through your commercial vendor, or source mice according to your study design. Adjust age at purchase to allow 1-week acclimatization for animals before starting study (see Note 11).

3.3 IM Vaccine Delivery

1. This requires two persons and is frequently done the same day as blood collection (see Note 12). 2. The first person restrains the mouse using standard neck scruff/tail method. 3. The hind leg to be injected must also be held fully extended by person 1. The leg should be held extended in a natural direction, neither straight back nor straight out perpendicular to the spine. Leaving the leg slightly loose makes it easier to pinch and locate the quadriceps muscle. 4. Person 1 holds the mouse so that its ventral side faces person 2. 5. Person 2 wipes the anterior of the mouse thigh with 70% ethanol applied with the 2
2 gauze. Be careful to avoid genital/rectal areas as this will agitate the animal. 6. Person 2 gently squeezes the quadriceps femoris muscle group with the thumb and the forefinger. 7. Person 2 inserts needle and injects while maintaining gentle pressure on muscle with the thumb and the forefinger. The muscle should feel like a large round grain of rice. On second and later injections, it will feel and possibly look larger. As you

DNA Vaccines and HSV-2 Mouse Vaginal Infection Model

441

push the syringe plunger you should feel the muscle swell and stay swollen. If you do not feel this, you have missed. Practice with dye if allowed by your institution including dissection of leg to locate the injection point to gain skill at IM injections. Use a sharp/new needle at least every four injections. We typically inject bilaterally 50 μL per side per injection; thus, we use a new needle every two mice. 8. Remove needle and discard in appropriate sharps container. 3.4 ID Vaccine Delivery to the Ear Pinna

1. Anesthetize mouse using ketamine–xylazine mouse mix (see Note 13) 2. Place a small amount of Blu-Tack on forefinger or middle finger. 3. Place mouse prone (face down) in front of you. 4. Using the thumb, gently press the inner, ventral of the mouse ear against the Blu-Tack so that pinna is as flat and planar as possible with no wrinkles or folds. 5. With the bevel of the syringe-mounted 30 gauge needle facing up very carefully push the needle tip into the dermis. Catch the skin and then slide gently until the beveled tip and 1 mm of the shaft of the needle are completely covered by skin. The needle tip should still be visible through the very thin skin even though it is intradermal (see Note 14). 6. Gently and slowly push on the syringe plunger to form a small bleb of vaccine in the pinna. The maximum volume is 10 μL. 7. Slowly without shaking remove the syringe from the ear. 8. Gently remove ear from Blu-Tack and finger to prevent vaccine from being pushed or squeezed out. 9. Discard sharp in appropriate sharps container. 10. Use a new sharp needle for each ear.

3.5

Virus Challenge

3.5.1 Administration of Medroxyprogesterone

1. Six days prior to wild type virus challenge or administration of TK-minus vaccine virus, mice will be treated with 2 mg/animal of medroxyprogesterone. 2. Dilute medroxyprogesterone to 20 mg/mL in sterile PBS on the day of administration. 3. Administer 100 μL (2 mg) subcutaneously. Holding the awake mouse by the loose skin on the back of the neck with the thumb and the index finger/forefinger, insert the needle into the subcutaneous space between the back of the mouse’s head and your fingers. Inject 100 μL of 20 mg/mL medroxyprogesterone solution (see Note 15).

442

Joshua O. Marshak et al.

3.5.2 Establish the 50% Lethal Dose (LD50)

It is necessary to establish the LD50 for each specific viral challenge strain, virus batch, mouse strain, and mouse chronologic age prior to carrying out experiments with vaccines (see Note 16).

3.5.3 Live Virus Challenge

Set up your work area as to eliminate unwanted spread of virus and to maintain workflow (see Note 17). 1. Dilute virus in PBS/0.1% naı¨ve mouse serum so the desired inoculum is in 10 μL (see Note 18). 2. Chose the desired challenge dose(s) based on the scientific goals of the study. We typically challenge at 50–100
LD50. To differentiate between moderately and highly active vaccines, some studies may use a dose range including lower or higher challenges. In our hands, effective DNA vaccines can provide 100% protection at up to 500
LD50 [21]. Some investigators use a two-dimensional matrix in which both vaccine dose and HSV-2 challenge dose are independently varied to rank vaccine candidate efficacy. 3. Anesthetize mice. We prefer ketamine–xylazine as isoflurane will not keep mice motionless long enough to ensure vaginal residence of the inoculum. 4. Avoid handling mice for 5 min after they have been inoculated to minimize the amount of inoculum that exits the vagina. 5. Scruff anesthetized mice such that spine is straight and stretched to full length without hunching, holding the tail with the little finger. 6. Remove mucus from the vaginal introitus. Using a calcium alginate swab, clean the vagina. Thick, even gelatinous mucus is normal. Often gently rotating the swab a few times can wind up the mucus to ease removal. 7. Draw 10 μL of diluted virus into a filter-tip 2–20 μL pipette tip. 8. Gently insert pipette tip into mouse vagina. 9. Slowly push pipette plunger. If you see inoculum spilling out, readjust pipette tip or your restraint of the mouse. A fully stretched out mouse optimizes retention of the inoculum. 10. Place pipette tip in bleach gently pipet up and down. 11. Discard pipette tip in sharps container. 12. Gently place mouse supine (face up) in cage to sleep for 5–15 min. 13. Observe that all mice are awake prior to leaving area.

DNA Vaccines and HSV-2 Mouse Vaginal Infection Model

3.6 Challenge Study End Points 3.6.1 Survival

443

1. Check mice according to your protocol and animal care and use standards. We are generally required to check mice twice per day for 21 days. 2. It is best for consistency if one researcher completes all animal evaluations for premorbid conditions requiring euthanasia. 3. Humanely euthanize animals showing premorbid grade 3 or 4 changes (see Subheading 3.6.2 and Note 19).

3.6.2 Clinical Score

1. It is best for consistency if one researcher completes all animal evaluations. 2. Gently grab mouse by tail taking care not to startle. Lift by the tail so that the anal/genital region is visible and note of any abnormal appearance. 3. Asses fur, posture, gait, and hydration level. 4. Assign a score based on appearance of animal and disease scoring criteria. 5. Disease score: 0—Normal. 1—Perianal/genital erythema. 2—Perianal swelling and erythema. May have slightly ataxic gait and/or slightly ruffled coat. The normal mouse coat is glossy and shiny. 3—purulent lesions, partial or complete paralysis in one or both hind limbs, visible weight loss or dehydration, very poor grooming, perianal urine staining due to loss of bladder control. 4—immobile, complete hind limb paralysis, severe dehydration, little or no grooming.

3.6.3 Vaginal HSV-2 DNA Measurement by PCR ( See Note 20)

1. Aliquot 1 mL digestion buffer to each prelabeled 2 mL sterile, nuclease-free O-ring cryovial tube. 2. Restrain the nonanesthetized mouse using the one-hand method (see Subheading 3.1). Turn mouse supine so that the head is away from you and the tail is toward you. Having two persons, one holding and the other taking the sample, enables less operator hand fatigue but is overall more challenging. 3. Gently insert sterile swab into mouse vagina and rotate swab 360 within 2 s. The main difficulty is inadequate restraint or a hunched mouse posture. Inflammation should not be limiting on days 1–5. The entire cotton tip of the swab should be inserted. 4. Place swab in designated tube with digestion buffer.

444

Joshua O. Marshak et al.

5. Use scissors to trim plastic handle of swab, leaving the swab tip behind in the tube. Trim enough that you can be sure to close the tube. Scissors should be sharp and tubes in a secure holder to avoid recoil and spilling after swab snipping. 6. Secure cap onto tube. 7. Store samples at 20  C until they are ready for processing for PCR. 3.6.4 Blood Collection (See Note 21)

1. Obtain institutional approval for all bleeds including schedule. Ensure operators are trained. 2. Anesthetize animals using ketamine-xylazine mouse mix or isoflurane. Do not anesthetize too many animals with mouse mix or some may awaken too early. Generally ten animals anesthetized at a time will sleep long enough for a less skilled operator to bleed them all. 3. Place mouse on its side, on a clean, cushioned, and thermal neutral or warmed surface so all four legs point toward you. As you will alternate left and right eye with serial blood collections, mice laying on their right flank for the initial collection will be lying on their left flank for the next collection. We generally limit the total number of retro-orbital bleeds to four in the life of the mouse, two from each side, with an interval of at least 2 weeks between bleeds from any one eye. 4. The head should be oriented toward your dominant side and the hand you will use to collect blood. Keep mice warm; if slow to awaken, rewarm. Some twitching is normal during anesthesia but they should not withdraw to noxious forepaw stimulation, it is often associated with lighter anesthesia or with an early waking state. 5. Using your thumb and forefinger to gently pull the skin above and below the eye away from the eye. The forefinger is above the eye and the thumb below. 6. The eye should be slightly protruding from the socket. 7. Gently and decisively push blood capillary collection tube behind the eye between the upper eyelid and the top of the eyeball. The tip of the capillary tube is puncturing the capillary bed behind the eye. 8. Hold capillary tube in place until the blood flows up to the point where you have predetermined your collection volume. 9. Using 200
200 gauze, gently close the eye and hold pressure for several seconds. 10. Place capillary tube into blood collection tube. Using your trimmed transfer pipette, apply pressure to push the blood into the BD separator tube (nonsterile) or sterile

DNA Vaccines and HSV-2 Mouse Vaginal Infection Model

445

microcentrifuge tube. Work quickly before the blood clots in the capillary tube. 11. Apply ophthalmologic ointment to the eye (optional). 12. Allow blood to clot in the secondary collection tube at least 60 min at room temperature. 13. Spin samples at approximately 9300
g, which is the equivalent of about 10,000 rpm on a standard small benchtop microcentrifuge for 10 min. 3.6.5 Lumbosacral DRG Dissection ( See Note 22)

1. Euthanize mice using CO2 overdose or another approved nonphysical method (see Note 23). 2. Spray carcass completely with 70% ethanol to constrain hair and particulates. 3. Completely remove skin. Make a small incision in the skin of mouse flank using common dissecting scissors. Gently grasp the skin on either side of the incision, pull toward the head and tail until the skin is mostly removed. 4. Use common dissecting scissors to trim away skin (see Note 24). 5. Remove all thoracic and abdominal viscera using common forceps and scissors. 6. Trim away the most ventral portion of the rib cage using common scissors (see Note 25). 7. Label mice so you can track animal identity. Store in an airtight container at 4  C to prevent drying of carcasses. 8. Pin mouse down on dissection surface ventral side down. Pin hind legs out from body fully extended at about a 45 angle from spine in the caudal direction. 20 Gauge syringe needles work well. Pins directly through the middle of the footpads will hold the best. 9. Pin the front legs. Gently pull on them so the entire spine is stretched out. 10. Using the student Vannas scissors carefully cut through the muscle on either side of the spine down the length of the spine (see Note 26). 11. Carefully fillet away the muscle from the dorsal bony spinal column. 12. Place prelabeled sample tube in dry ice and remove cap (no buffer). 13. Locate the first or second thoracic vertebrae finding the first or second most rostral sets of ribs. 14. Using the student Vannas scissors make a cut into the spine, perpendicular to the length of the spine. This cut should be a

446

Joshua O. Marshak et al.

half cross section. You are cutting only through the dorsal part of the spinal column. The ventral half of the bony spinal column should be left intact (see Note 27). 15. Alternating between sides, cut at about the dorsal/ventral margin down the spine toward the tail (see Note 28) 16. As you cut the spine away you can excise the DRG or you can wait until you complete the laminectomy to excise them all at once. 17. Gently grasp the nerve fiber on either side of the DRG using either of the fine science tools forceps. Using the finer Vannas spring scissors trim the nerve fiber away from either side best you can (see Note 29). 18. Carefully place the DRG into the labeled tube that is resting in dry ice. The moist tissue should stick to the very cold tube wall. 19. Remove all DRG that are relevant to your study design. We typically aim for 10–14 DRG from each side from the lumbosacral region. 20. Cap tube and spin at high speed in a microcentrifuge to get all DRG to the bottom of the sample tube. 21. Add 150 μL of PCR digestion buffer. 22. Store at 20  C until delivery to the PCR lab.

4

Notes 1. Purchase females from commercial vendors or breed HLA or other transgenics [55] at your facility. Animals born the same day are more expensive than animals within an age range. We usually tolerate a small range and buy animals at sexual maturity at 5–6 weeks. Adjust age at purchase to allow 1 week acclimatization prior to vaccination, and so that the age at HSV-2 challenge corresponds to that age at which the LD50 was established. Strain is important. Balb/c mice tend to be more susceptible to HSV. We use this strain to set a higher bar for survival and allow lower viral inoculums. CD4 and CD8 epitopes in selected HSV-2 proteins have been identified in some strains but not others, thus influencing strain choice depending on the ORF under study. Balb/c mice are behaviorally easier to manipulate than are C57BL/6 mice in the nonanesthetized state. C57BL/6 mice have a thoroughly characterized CD8 T-cell response [12], HSV TCR transgenics, and many genetic variants such that they may be preferable for some experiments. The number of mice per experimental group is a critical parameter set in consultation with a biostatistician based on preliminary data from the user’s lab and/or the literature, the

DNA Vaccines and HSV-2 Mouse Vaginal Infection Model

447

expected effect size, and the desired degree of certainty concerning the results. At our institution, ethical committee approval includes group size. Small groups may lead to failure to detect differences while large groups lead to unnecessary animal suffering. 2. A variety of replication-competent attenuated or replicationincompetent HSV-2 strains can be used in the place of TK-minus if available to the investigator. We also include a DNA vaccine positive control containing partial-length gene US6, encoding glycoprotein D of HSV-2, detailed herein. Acyclovir in drinking water at 1 mg/mL is an alternative positive control. Acyclovir requires daily drug dilution and water bottle changes for 21 days. Obtain acyclovir for intravenous injection from a clinical pharmacy at 50 mg/mL, and hold concentrated drug at room temperature. Each day, dilute to 1 mg/mL in sterile water and refill water bottles. The cost is low. There is less protection of the DRG than with effective vaccines. Occasional late deaths have been noted after day 21 for acyclovir. 3. Typically 50 μL is the maximum dose that can be administered to the quadriceps, or 100 μL/mouse if injected bilaterally. If multiple injections with a single syringe are permitted we do not recommend more than four per needle, as the needles dull quickly. When using this method, fill syringes to 200 μL. 4. The amount needed is 300–350 μL per mouse per anesthesia depending on weight and age. We estimate weight visually. We typically use 300 μL for younger Balb/c mice for the first and second administration, but by the age of challenge, typically 10–12 weeks, we use 350–400 μL. Follow institutional guidelines concerning controlled substance licensing, storage, disposal, and frequency of administration. Animals may develop tolerance if used too frequently. In our experience, C57BL/6 mice have less development of tolerance and we use 300 μL/ dose and 350 μL at challenge. In general, if at the last administration prior to challenge seems at all inadequate, increase the dose for challenge. Do not exceed 400 μL of drug/mouse. Overdose is possible and generally lethal. Ketamine will not inhibit the hind leg withdrawal reflex. Use forepaw withdrawal to noxious stimulation to test the depth of anesthesia. 5. We typically draw 600–800 μL per syringe/needle and reuse for two mice total per syringe/needle. 6. The optional nature of this product is partly a safety issue. The alternative to using Blu-Tack™ is to use only a gloved finger. 7. Stocks may lose titer at 80  C at the rate of about 0.3 log10/ year and should be periodically retitrated. LD50 will need to be pre-established by titration in mice of the same strain and target

448

Joshua O. Marshak et al.

age in prior experiments. While stocks are being grown and titrated, observe microscopically for large syncytia formation. Scattered syncytia are normal for strain 186 but very large syncytia may indicate mutations that can influence virulence. 8. This is used at 0.1% in PBS to dilute virus prior to inoculation. 9. We use commercially available truncated glycoprotein D of HSV-1 as test antigen when we use test vaccines that contain gD2 as a protein or DNA construct. gD1 and gD2 have highly similar amino acid sequences. ELISA details are published [2]. For other test vaccines, investigator-specific ELISA antigens will be required. Neutralizing antibody titers are also frequently performed, especially if the test vaccines contain the glycoproteins typically associated with HSV neutralizing antibodies: gB, gD, and/or gH/gL. Neutralizing assays are not detailed herein. 10. The outline of animal procedures is not a substitute for adequate hands-on training. Follow all institutional requirements regarding training for specific procedures, such as retrobulbar bleeds, subcutaneous, intramuscular, intradermal, and intraperitoneal injections, use of anesthetics and restraint and euthanasia techniques. Follow institutional guidelines and preferences regarding housing, restraint, blood sampling, anesthesia and euthanasia. Training in vaginal inoculation, vaginal swabs, and DRG collection may not be available from your institution and practice animals, if allowed, may be reasonable. 11. Consider ordering a few extra animals for critical studies as some may die due to shipping stress. Stressed animals may impact on study outcomes. Observe each mouse for inflammation or irregular health before beginning study. Young Balb/c can be very skittish, jump from great heights and run away. Therefore operate with extreme care. 12. It is best to do IM injection before retrobulbar blood collection requiring anesthesia, or when animals are awake enough to crawl around after blood collection. Animals with quadriceps muscle tone are much easier for IM injection as one can find the muscle and also palpate the expected small swelling after successful injection. 13. Isoflurane will not work mice because need to be under anesthesia for at least a couple minutes. It is best to have two persons with one giving anesthesia and the second giving vaccine. 14. It is very helpful to pay attention to the reflectivity of the needle. Depending on operator’s vision the only difference you may see between a needle lying flat on mouse ear and a needle that is properly inserted intradermal is that the inserted needle will have a “matte” appearance in comparison.

DNA Vaccines and HSV-2 Mouse Vaginal Infection Model

449

15. This is difficult for one person with skittish C57BL/6 mice. One person can restrain and another inject. An alternate injection site of loose skin on the rump can be used. If there is significant visible leakage of drug, repeat the procedure with estimation of the amount of leakage and record the extra injection. We prefer to use a single needle/syringe for every two animals. Preparing multiple syringes ahead of time does not work well because the drug is formulated as a suspension that settles out very rapidly. The master concentrate and diluted drug vials should be swirled prior to each use. Two operators are therefore preferable. 16. In brief, mice are obtained or aged in the facility to reach the proper age and then inoculated with virulent HSV-2 vaginally as Subheading 3.5.3, after medroxyprogesterone pretreatment. Typically we range from 10 pfu to 10,000 pfu/mouse in ½ log10 increments and test 8–10 animals per dose. We have found that the LD50 is typically between 100 and 1000 pfu/ mouse dependent on virus strain and batch and mouse strain. LD50 values in our hands are typically moderately (three- to fivefold) higher for C57BL/6 mice than for Balb/c mice; that is, Balb/c mice are moderately more susceptible. Specific institutional approval is required at our institution prior to carrying out LD50-finding studies. We use the same end points for humane euthanasia for LD50-finding studies that are used in vaccine studies. 17. This is much easier with two operators. One person can anesthetize, clean the vaginal area and/or bleed while the second person performs the inoculation. Diluted virus, bleach, and a sharps container should be accessible to the person doing inoculations. Space for at least one mouse cage should also be available within reach. Pretear the paper off the back of the individual paper pouches of the cleaning swabs so that the ends are accessible. 18. Transport virus to animal room on dry ice and thaw gently at room temperature. Then place leftover concentrated virus on wet ice. Dilute by two- to tenfold dilutions using a fresh pipette tip each time and gentle vortexing. Dilute the virus in a PBS 0.1% normal mouse serum. Diluted virus can be used over 1–2 h held at room temperature. We dilute enough virus for about 40 mice. If the experiment is larger, we go back to the concentrated stock held on wet ice and prepare a second working tube. Wear personal protective equipment. 19. Operators should become certified in and comfortable with one or more modes or humane euthanasia following institutional guidelines and preferences. We use CO2 overdose followed in some instances by cervical dislocation.

450

Joshua O. Marshak et al.

20. Perform this procedure on the days that are appropriate for your study. We generally study days 1, 3, and 5 after inoculation. This allows differentiation of vaccines that allow survival but still permit brisk local replication from vaccines that provide sterilizing or near-sterilizing local protection in addition to survival. 21. General instructions are given here for retro-orbital bleed. Operators should be trained and certified at their local facility. The maximum volume we obtain by this method is 1% of body weight every 2 weeks. For a 20 g mouse this is 200 μL. The amount needed per antigen for ELISA is generally on the order to 10 μL depending on starting dilution and number of Ig types tested. It is always a good idea to use artificial tears when using ketamine anesthesia as mouse eyes remain open and will dry out. This increases the risk of eye bleed complications. It is very important to place pressure on eye both to stop bleeding and prevent blood from building up behind the eye. This increases the risk of eye loss or scaring. 22. Detailed photomicrographs and a protocol are available [56]. Perform this procedure on a limited number of mice per day and increase as experience builds. There is a steep learning curve, especially for those unaccustomed to microscope work. This work requires sitting still for long periods of time. Make the workstation as comfortable as possible, optimizing chair height, bench height, microscope eye piece angle, and distance from edge of bench to work area. Breaks, stretching, and eye exercise (distant focus) reduce fatigue. While HSV-2 is not thought to disseminate or to cause latent or lytic infection outside of the DRG in mice at late time points, the entire dissection should be performed carefully using personal protective equipment. The initial dissection of skin and viscera removal should be performed in a BSL-2 biosafety cabinet. 23. Do not use cervical dislocation or a guillotine. Nonphysical methods are preferred to maintain the spinal integrity. This is especially important for the spinal cord dissection. The pinning of the carcass to the dissection board will be simpler and the intact spine makes the laminectomy much easier. 24. When you remove the skin from the legs by the pulling, be especially careful, particularly with the front legs. It is possible to pull too hard and disrupt the integrity of the joints. Gently grasp the leg near the shoulder or hip and using your other hand pull the skin down the leg. 25. Removal of the ventral portion of the rib cage allows the carcass to lie flat during dissection. It is helpful to leave most of the rib

DNA Vaccines and HSV-2 Mouse Vaginal Infection Model

451

cage intact however as the ribs can be used as reference points to locate specific DRG levels. 26. At this point it is important to be mindful of not cutting through any bone. The idea of this step is to fillet the muscle away from the spine making it more accessible for a clean dissection. Especially for beginners, the more muscle that is removed from the dorsal and lateral sides of the spine the easier the laminectomy will be to perform. 27. A laminectomy is much easier to perform when the ventral half of the spine is intact. An intact ventral portion of the spine stabilizes the carcass during dissection. 28. Depending on comfort with this procedure and eyesight this step may be done without a microscope. When performing several of these dissections, rest breaks are advisable. It may be helpful to visualize cutting the entire dorsal half of the bony spinal canal off, leaving behind the intact spinal cord, DRG, and nerves cradled in the ventral half of the spinal column. If you imagine that the spinous processes (the most dorsal vertebral processes) are in the 12 o’clock position, the DRG are located at about 4 and 8 o’clock on either side of the spine. At the lumbosacral transition the spine curves ventral and the hips can get in the way of your scissors. Go slowly and carefully, from this point on in the caudal direction it is easy to lose DRG as they are smaller and the dissection trickier. After passing this little transition the finer Vannas spring scissors are better suited for the laminectomy. This portion of the laminectomy is easiest performed with the microscope. 29. The nerve fibers can be fairly elastic. If the fiber wraps up around the DRG it may be difficult to untangle the DRG from the fiber. Take care to avoid tangling nerve fibers. This can be slightly exacerbated by the fact that even the fine forceps may not provide a solid grip on the nerve tissue. References 1. Tronstein E, Johnston C, Huang ML, Selke S, Magaret A, Warren T, Corey L, Wald A (2011) Genital shedding of herpes simplex virus among symptomatic and asymptomatic persons with HSV-2 infection. JAMA 305:1441–1449 2. Kask AS, Chen X, Marshak JO, Dong L, Saracino M, Chen D, Jarrahian C, Kendall MA, Koelle DM (2010) DNA vaccine delivery by densely-packed and short microprojection arrays to skin protects against vaginal HSV-2 challenge. Vaccine 28:7483–7491 3. Feldman LT, Ellison AR, Voytek CC, Yang L, Krause P, Margolis TP (2002) Spontaneous

molecular reactivation of herpes simplex virus type 1 latency in mice. Proc Natl Acad Sci U S A 99:978–983 4. Freeman ML, Sheridan BS, Bonneau RH, Hendricks RL (2007) Psychological stress compromises CD8+ T cell control of latent herpes simplex virus type 1 infections. J Immunol 179:322–328 5. Cliffe AR, Wilson AC (2017) Restarting lytic gene transcription at the onset of herpes simplex virus reactivation. J Virol 91:e01419-16 6. Roy S, Coulon PG, Srivastava R, Vahed H, Kim GJ, Walia SS, Yamada T, Fouladi MA, Ly VT, BenMohamed L (2018) Blockade of LAG-3

452

Joshua O. Marshak et al.

immune checkpoint combined with therapeutic vaccination restore the function of tissueresident anti-viral CD8(+) T cells and protect against recurrent ocular herpes simplex infection and disease. Front Immunol 9:2922 7. Johnston C, Koelle DM, Wald A (2011) HSV-2: in pursuit of a vaccine. J Clin Invest 121:4600–4609 8. Parr MB, Kepple L, McDermott MR, Drew MD, Bozzola JJ, Parr EL (1994) A mouse model for studies of mucosal immunity to vaginal infection by herpes simplex virus type 2. Lab Invest 70:369–380 9. Linehan MM, Richman S, Krummenacher C, Eisenberg RJ, Cohen GH, Iwasaki A (2004) In vivo role of nectin-1 in entry of herpes simplex virus type 1 (HSV-1) and HSV-2 through the vaginal mucosa. J Virol 78:2530–2536 10. Cherpes TL, Busch JL, Sheridan BS, Harvey SA, Hendricks RL (2008) Medroxyprogesterone acetate inhibits CD8+ T cell viral-specific effector function and induces herpes simplex virus type 1 reactivation. J Immunol 181:969–975 11. Lopez C (1975) Genetics of natural resistance to herpes virus infections in mice. Nature 258:1352–1353 12. St Leger AJ, Peters B, Sidney J, Sette A, Hendricks RL (2011) Defining the herpes simplex virus-specific CD8+ T cell repertoire in C57BL/6 mice. J Immunol 186:3927–3933 13. Treat BR, Bidula SM, Ramachandran S, St Leger AJ, Hendricks RL, Kinchington PR (2017) Influence of an immunodominant herpes simplex virus type 1 CD8+ T cell epitope on the target hierarchy and function of subdominant CD8+ T cells. PLoS Pathog 13: e1006732 14. Gebhardt T, Whitney PG, Zaid A, Mackay LK, Brooks AG, Heath WR, Carbone FR, Mueller SN (2011) Different patterns of peripheral migration by memory CD4+ and CD8+ T cells. Nature 477:216–219 15. Muller WJ, Dong L, Vilalta A, Byrd B, Wilhelm KM, McClurkan CL, Margalith M, Liu C, Kaslow D, Sidney J, Sette A, Koelle DM (2009) Herpes simplex virus type 2 tegument proteins contain subdominant T-cell epitopes detectable in BALB/c mice after DNA immunization and infection. J Gen Virol 90:1153–1163 16. Shlapobersky M, Marshak JO, Dong L, Huang ML, Wei Q, Chu A, Rolland A, Sullivan S, Koelle DM (2012) Vaxfectin-adjuvanted plasmid DNA vaccine improves protection and immunogenicity in a murine model of genital herpes infection. J Gen Virol 93:1305–1315

17. Sin JI, Kim JJ, Zhang D, Weiner DB (2001) Modulation of cellular responses by plasmid CD40L: CD40L plasmid vectors enhance antigen-specific helper T cell type 1 CD4+ T cell-mediated protective immunity against herpes simplex virus type 2 in vivo. Hum Gene Ther 12:1091–1102 18. Chen X, Kask AS, Crichton ML, McNeilly C, Yukiko S, Dong L, Marshak JO, Jarrahian C, Fernando GJ, Chen D, Koelle DM, Kendall MA (2010) Improved DNA vaccination by skin-targeted delivery using dry-coated densely-packed microprojection arrays. J Control Release 148:327 19. Dutton JL, Woo WP, Chandra J, Xu Y, Li B, Finlayson N, Griffin P, Frazer IH (2016) An escalating dose study to assess the safety, tolerability and immunogenicity of a Herpes Simplex Virus DNA vaccine, COR-1. Hum Vaccin Immunother 12:3079–3088 20. Dutton JL, Li B, Woo W-P, Marshak JO, Xu Y, Huang M-L, Dong L, Frazer IH, Koelle DM (2013) A novel DNA vaccine technology conveying protection against a lethal herpes simplex challenge in mice. PLoS One 8:e76407 21. Dutton J, Li B, Woo W-P, Marshak K, Xu Y, Huang ML, Dong L, Frazer I, Koelle D (2012) Protection against viral challenge in a murine model of HSV-2 infection conferred by mixed DNA vaccines. Presented at 37th International Herpesvirus Workshop, 37th International Herpesvirus Workshop, Calgary, Alberta, Canada, Abstract 6.52 22. Liu W, Gao F, Zhao KN, Zhao W, Fernando GJ, Thomas R, Frazer IH (2002) Codon modified human papillomavirus type 16 E7 DNA vaccine enhances cytotoxic T-lymphocyte induction and anti-tumour activity. Virology 301:43–52 23. Sin J-I, Weiner DB (2000) Improving DNA vaccines targeting viral infection. Intervirology 43:233–246 24. Bagley KC, Schwartz JA, Andersen H, Eldridge JH, Xu R, Ota-Setlik A, Geltz JJ, Halford WP, Fouts TR (2017) An interleukin 12 adjuvanted herpes simplex virus 2 DNA vaccine is more protective than a glycoprotein d subunit vaccine in a high-dose murine challenge model. Viral Immunol 30:178–195 25. Braun RP, Dong L, Jerome S, Herber R, Roberts LK, Payne LG (2008) Multi-antigenic DNA immunization using herpes simplex virus type 2 genomic fragments. Hum Vaccin 4:36–43 26. Everett RD, Fenwick ML (1990) Comparative DNA sequence analysis of the host shutoff genes of different strains of herpes simplex virus: type 2 strain HG52 encodes a truncated

DNA Vaccines and HSV-2 Mouse Vaginal Infection Model UL41 product. J Gen Virol 71 (Pt 6):1387–1390 27. Dudek TE, Torres-Lopez E, Crumpacker C, Knipe DM (2011) Evidence for differences in immunologic and pathogenesis properties of herpes simplex virus 2 strains from the United States and South Africa. J Infect Dis 203:1434–1441 28. Petro CD, Weinrick B, Khajoueinejad N, Burn C, Sellers R, Jacobs WR Jr, Herold BC (2016) HSV-2 DeltagD elicits FcgammaReffector antibodies that protect against clinical isolates. JCI Insight 1:e88529 29. Renner DW, Szpara ML (2018) Impacts of genome-wide analyses on our understanding of human herpesvirus diversity and evolution. J Virol 92:e00908-17 30. Greninger AL, Roychoudhury P, Xie H, Casto A, Cent A, Pepper G, Koelle DM, Huang ML, Wald A, Johnston C, Jerome KR (2018) Ultrasensitive capture of human herpes simplex virus genomes directly from clinical samples reveals extraordinarily limited evolution in cell culture. mSphere 3:e00283-18 31. Casto AM, Roychoudhury P, Xie H, Selke S, Perchetti GA, Wofford H, Huang ML, Verjans GMGM, Gottlieb GS, Wald A, Jerome KR, Koelle DM, Johnston C, Greninger AL (2019) Large, stable, contemporary interspecies recombination events in circulating human herpes simplex viruses. J Infect Dis. pii: jiz199. doi: 10.1093/infdis/jiz199. [Epub ahead of print] PMID: 31016321 32. Johnston C, Magaret A, Roychoudhury P, Greninger AL, Reeves D, Schiffer J, Jerome KR, Sather C, Diem K, Lingappa JR, Celum C, Koelle DM, Wald A (2017) Dual-strain genital herpes simplex virus type 2 (HSV-2) infection in the US, Peru, and 8 countries in sub-Saharan Africa: a nested cross-sectional viral genotyping study. PLoS Med 14:e1002475 33. Koelle DM, Norberg P, Fitzgibbon MP, Russell RM, Greninger AL, Huang ML, Stensland L, Jing L, Magaret AS, Diem K, Selke S, Xie H, Celum C, Lingappa JR, Jerome KR, Wald A, Johnston C (2017) Worldwide circulation of HSV-2 x HSV-1 recombinant strains. Sci Rep 7:44084 34. Burrel S, Boutolleau D, Ryu D, Agut H, Merkel K, Leendertz FH, Calvignac-Spencer S (2017) Ancient recombination events between human herpes simplex viruses. Mol Biol Evol 34:1713–1721 35. Stanberry LR, Kit S, Myers MG (1985) Thymidine kinase-deficient herpes simplex virus type 2 genital infection in guinea pigs. J Virol 55:322–328

453

36. Nakanishi Y, Lu B, Gerard C, Iwasaki A (2009) CD8(+) T lymphocyte mobilization to virusinfected tissue requires CD4(+) T-cell help. Nature 462:510–513 37. Halford WP, Puschel R, Gershburg E, Wilber A, Gershburg S, Rakowski B (2011) A live-attenuated HSV-2 ICP0 virus elicits 10 to 100 times greater protection against genital herpes than a glycoprotein D subunit vaccine. PLoS One 6:e17748 38. Magaret AS, Wald A, Huang ML, Selke S, Corey L (2007) Optimizing PCR positivity criterion for detection of herpes simplex virus DNA on skin and mucosa. J Clin Microbiol 45:1618–1620 39. McClements WL, Armstrong ME, Keys RD, Liu MA (1996) Immunization with DNA vaccines encoding glycoprotein D or glycoprotein B, alone or in combination, induces protective immunity in animal models of herpes simplex virus-2 disease. Proc Natl Acad Sci U S A 93:11414–11420 40. Belshe RB, Leone PA, Bernstein DI, Wald A, Levin MJ, Stapleton JT, Gorfinkel I, Morrow RL, Ewell MG, Stokes-Riner A, Dubin G, Heineman TC, Schulte JM, Deal CD (2012) Efficacy results of a trial of a herpes simplex vaccine. N Engl J Med 366:34–43 41. Cattamanchi A, Posavad CM, Wald A, Baine Y, Moses J, Higgins TJ, Ginsberg R, Ciccarelli R, Corey L, Koelle DM (2008) Phase I study of a herpes simplex virus type 2 (HSV-2) DNA vaccine administered to healthy, HSV-2-seronegative adults by a needle-free injection system. Clin Vaccine Immunol 15:1638–1643 42. Masopust D, Soerens AG (2019) Tissueresident t cells and other resident leukocytes. Annu Rev Immunol 37:521 43. Allan RS, Smith CM, Belz GT, van Lint AL, Wakim LM, Heath WR, Carbone FR (2003) Epidermal viral immunity induced by CD8alpha+ dendritic cells but not by Langerhans cells. Science 301:1925–1928 44. Shin H, Iwasaki A (2012) A vaccine strategy that protects against genital herpes by establishing local memory T cells. Nature 491:463–467 45. Iijima N, Iwasaki A (2014) T cell memory. A local macrophage chemokine network sustains protective tissue-resident memory CD4 T cells. Science 346:93–98 46. Srivastava R, Roy S, Coulon PA, Vahed H, Prakash S, Dhanushkodi N, Kim GJ, Fouladi MA, Campo J, Teng AA, Liang X, Schaefer H, BenMohamed L (2019) Therapeutic mucosal vaccination of HSV-2 infected guinea pigs with the ribonucleotide reductase 2 (RR2) protein

454

Joshua O. Marshak et al.

boosts antiviral neutralizing antibodies and tissue-resident CD4(+) and CD8(+) TRM cells associated with protection against recurrent genital herpes. J Virol 93:e02309-18 47. Xia J, Veselenak RL, Gorder SR, Bourne N, Milligan GN (2014) Virus-specific immune memory at peripheral sites of herpes simplex virus type 2 (HSV-2) infection in guinea pigs. PLoS One 9:e114652 48. Milligan GN, Meador MG, Chu CF, Young CG, Martin TL, Bourne N (2005) Long-term presence of virus-specific plasma cells in sensory ganglia and spinal cord following intravaginal inoculation of herpes simplex virus type 2. J Virol 79:11537–11540 49. Petro C, Gonzalez PA, Cheshenko N, Jandl T, Khajoueinejad N, Benard A, Sengupta M, Herold BC, Jacobs WR (2015) Herpes simplex type 2 virus deleted in glycoprotein D protects against vaginal, skin and neural disease. Elife 4 50. Lekstrom-Himes JA, Pesnicak L, Straus SE (1998) The quantity of latent viral DNA correlates with the relative rates at which herpes simplex virus types 1 and 2 cause recurrent genital herpes outbreaks. J Virol 72:2760–2764

51. Khanna KM, Bonneau RH, Kinchington PR, Hendricks RL (2003) Herpes simplex virusspecific memory CD8(+) T cells are selectively activated and retained in latently infected sensory Ganglia. Immunity 18:593–603 52. Herbst-Kralovetz MM, Pyles RB (2006) Quantification of poly(I:C)-mediated protection against genital herpes simplex virus type 2 infection. J Virol 80:9988–9997 53. Strasser JE, Arnold RL, Pachuk C, Higgins TJ, Bernstein DI (2000) Herpes simplex virus DNA vaccine efficacy: effect of glycoprotein D plasmid constructs. J Infect Dis 182:1304–1310 54. Koelle DM (2003) Expression cloning for the discovery of viral antigens and epitopes recognized by T-cells. Methods 29:213–226 55. Laing KJ, Dong L, Sidney J, Sette A, Koelle DM (2012) Immunology in the Clinic Review Series; focus on host responses: T cell responses to herpes simplex viruses. Clin Exp Immunol 167:47–58 56. Malin SA, Davis BM, Molliver DC (2007) Production of dissociated sensory neuron cultures and considerations for their use in studying neuronal function and plasticity. Nat Protoc 2:152–160

INDEX A

F

Adjuvants .......................31–47, 112, 125, 430, 431, 435 Affinity purification .............................328, 329, 331, 390 Amplicon vector helpervirus-free ..................................... 112, 116, 128 Animal models............................................... v, 21–23, 36, 43–45, 75, 194, 195, 220, 232, 263, 264, 434 Antibody ..................................................... 24, 32–34, 36, 37, 42–45, 47, 103, 116, 124–127, 161, 164, 165, 168, 189, 193–195, 220, 225, 226, 234, 235, 238, 272, 308, 310–312, 320, 321, 323–325, 356, 358, 361–363, 381, 412, 416, 430, 432–434, 436, 448 Antigens................................................18, 24, 33, 35, 37, 38, 40–47, 112, 116, 126, 127, 132, 161, 168, 191, 195, 267, 272, 320, 321, 323, 430, 432, 433, 448, 450 Assay in vivo ............................................................. 421, 430

Flat embedding ................. 353, 355, 356, 358–361, 363 Flow analysis ............................................................ 289–302 cytometry nano ................................................................... 290 sorting............................................................. 289–302 virometry ........................................................ 289–302 Fluorescence in situ hybridization (FISH)......... 185–195 Freeze-substitution ............................................. 355, 356, 358–361, 363

B BioID .................................................................v, 327–340 Biotin ligase .......................................................... 328, 329 Blot dot................................................................... 319–325 immuno .........................................112, 155, 322, 329

C Clinical .......................................................3–5, 31–33, 39, 42–45, 80, 186, 199–215, 220, 242, 431–433, 436, 438, 443, 447 Conformational changes..............................319–325, 395 CRISPR/Cas9..............................................169–182, 337

D Deep sequencing .................................................. 201, 237 Differential centrifugation ............................................ 309 DNA polymerase .......................................... 18, 161, 171, 176, 242, 244, 249–254, 257, 271

E Escherichia coli β-galactosidase ....................................... 222, 226, 236

G galK recombineering ...................................131–150, 153 Gene therapy .......................................................v, 73–88, 93 transfer .................................................................91, 92 Genital ...................................................v, 3, 4, 31–33, 35, 38, 39, 42–44, 47, 200, 440, 443 Genome editing .................................. 131–150, 169–182

H Herpes simplex virus (HSV) biology .......................................................v, 1–26, 132 glycoprotein ectodomain ..............................378, 379, 387, 396 growth ................................................57–72, 355–363 latency ......................................... v, 18, 21, 24, 76, 77, 185–187, 220, 222, 232, 263–275, 429, 434 life cycle ..........................................................v, 1, 3, 4, 75, 279, 280, 306, 351 reactivation ................................................ v, 4, 18, 21, 22, 24, 34, 38, 39, 92, 186, 187, 226, 263–275, 429, 434 recombinant multi-fluorescent .......................................365–375 rescue ............................................. 132, 137, 153–168 type 1 ........................................................v, 1, 91–108, 111, 241, 280, 292, 345, 365–375, 377–391 Herpesvirus................................................v, 1, 3, 5, 8, 16, 18, 21, 25, 32, 73, 327–340 Homology directed repair (HDR)............ 170, 175–178, 180–182

Russell J. Diefenbach and Cornel Fraefel (eds.), Herpes Simplex Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2060, https://doi.org/10.1007/978-1-4939-9814-2, © Springer Science+Business Media, LLC, part of Springer Nature 2020

455

HERPES SIMPLEX VIRUS : METHODS

456 Index

AND

PROTOCOLS

I

O

Image processing......................................... 366, 367, 370 Immuno assay ...............................................194, 320, 322, 325 fluorescence ................................................... 112, 115, 121, 122, 126, 187–189, 193–195, 267, 272, 289, 311, 320, 410 histochemistry (IHC) .....................87, 234, 235, 237 labeling .......................................................... 195, 355, 356, 358, 360–363 Innate immunity ...............................23, 35–36, 132, 435 Interleukin 12 mouse....................................................................... 137 In vitro system.................................................36, 74, 137, 200, 232, 241, 264, 269, 328, 421

Oligonucleotide enrichment ............................... 199–215 Oncolytic virotherapy ................................................... 131 Oral ........................................................3, 4, 57, 127, 200

L Lentiviral delivery........................................ 264, 270, 272 Low input.................................................................. 72, 150 pH ................................................................... 319, 320 Lytic infections.................... 4, 19, 25, 75, 237, 238, 450

M Marker rescue ....................................................... 132, 133 Mass spectroscopy ................................................ 327–340 Membrane fusion ............................. 3, 16, 20, 21, 320, 377, 378 nitrocellulose ................................. 156, 164, 320–324 Microfluidics................................................ 398, 409, 411 Microscopy confocal laser scanning .................................. 115, 366 live cell imaging............................. 365–367, 371, 372 transmission electron immuno .....................................................355–363

N Neuron axon transport ........................... 75, 220, 345, 409–417 dorsal root ganglia (DRG) ............................. 33, 345, 351, 352, 355–363, 411, 417, 429 growth cones .................................................. 345, 351 retinal ganglion cells ...................................... 419–427 sensory .....................................................3, 47, 57, 75, 219, 221, 264, 345, 355, 356, 409, 411, 420 trigeminal ganglion (TG) ..................... 185, 419, 426 Nomenclature............................................ 5–15, 305, 440

P Polycistronic transgene cassette ..................................112, 119–121, 124, 125 Polymerase chain reaction (PCR) .......................... 77, 84, 87, 133–135, 137, 139, 141, 143–146, 149, 150, 156, 171, 200, 202, 205–211, 232, 244, 245, 249, 250, 255, 256, 258, 259, 339, 423, 425, 431, 433–436, 438, 443, 444, 446 Promoter-reporter............................................... 220–223, 228, 232, 234–236 Protein composition........................................... 285, 289, 327 crystallography ........................................................ 396 membrane .................................................6, 16, 20, 21 purification ..................................................... 380, 397 Proteomics.............................. v, 279–287, 334, 337, 339

R Resistance genotypic ........................................................ 241–260 phenotypic ...................................................... 241–260 RNA interference ................................................. 169, 264

S Selection marker..................................132, 133, 170, 179 Swabs ................................................. 200, 212, 213, 236, 422, 424, 433, 438, 442, 443, 448, 449

T T cells ................................. 24, 32–45, 47, 264, 433, 434 Thymidine kinase (TK)......................................... 4, 8, 19, 242, 249, 250, 252, 253, 424, 435 Tissue culture ............................................. 58, 59, 62–65, 67, 69, 70, 74, 81–83, 96, 97, 101–106, 108, 120, 122, 123, 128, 156–158, 172, 224, 227, 232, 236, 282, 291, 300, 306, 307, 309, 311, 312, 340, 345, 349, 366, 371, 399 Transfection................................................ 81, 82, 92–94, 101, 104, 107, 108, 114, 119–121, 128, 132, 153, 154, 156, 157, 166, 177–179, 181, 182, 227, 228, 236, 267, 273, 329, 331, 332, 433 Transgene expression ................. 132, 149, 155, 163–164

HERPES SIMPLEX VIRUS : METHODS V Vaccine development ................................ v, 5, 32, 33, 47, 430 DNA .................................................. 33, 46, 429–451 Varicella..................................................3, 32, 33, 73, 200 Vesicles extracellular .................................................v, 305–315 micro ......................................................... 86, 305–315 Viral DNA ...............................................................v, 2, 3, 6, 17–20, 75, 81, 84, 92, 161, 187, 194, 200, 201, 205, 211, 214, 222, 227, 232, 236, 243–245, 249, 259, 270, 273, 292, 300, 420, 422, 425, 426 entry ............................................................3, 322, 377 gene expression ................................... 17, 18, 22, 132 mutants ............................................17, 221, 222, 232 particles ......................................................75, 85, 160, 161, 166, 279, 284, 289–291, 293, 294, 296–301, 319, 352, 355 Virion purification ..................................................... 158, 282 Virus arming..................................... 22, 134, 139, 144, 177 engineering ....................... 73–88, 132, 133, 169–171

AND

PROTOCOLS Index 457

entry.................................... 8, 42, 319–325, 343, 345 growth curve ....................................................... 62, 69, 70 plaque assay ....................................................... 61, 67, 69, 71, 160–162, 267, 272, 292, 302, 379, 433, 435 purification .. 157, 158, 180, 182, 220, 221, 228, 230, 427 titration .............................................61, 62, 67, 69 production ........................................... 76, 79, 85, 165 purification ......................................77, 80, 84, 87, 88 recombinants ............................................... 33, 81–84, 88, 103, 107, 132, 133, 153, 156–161, 163, 165–167, 171, 177, 179–181, 266, 292, 365 replication kinetics .................................................. 231 stock .......................................................58, 63–70, 82, 84–88, 103, 107, 126, 221, 228, 230, 232, 236, 266, 294, 295, 371 vectors ............................................................... 78, 105 Virus-like particles (VLPs).................................. 111, 112, 115, 123–125, 129

W Whole tissue ........................................221, 225, 237, 238