Harper's textbook of pediatric dermatology [4ed.] 9781119142195, 1119142199

Citation preview

Harper’s Textbook of  Pediatric Dermatology

Harper’s Textbook of Pediatric Dermatology IN TWO VOLUMES FOURTH EDITION EDITED BY

Peter Hoeger Veronica Kinsler Albert Yan EDITORIAL ADVISORS

John Harper Arnold Oranje ASSOCIATE EDITORS

Christine Bodemer Margarita Larralde David Luk Vibhu Mendiratta Diana Purvis

This edition first published 2020 © 2020 John Wiley & Sons Ltd Edition History Blackwell Publishing Ltd (1e, 2000 2e, 2006; 3e, 2011) All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted, in any form or by any means, electronic, mechanical, photocopying, recording or otherwise, except as permitted by law. Advice on how to obtain permission to reuse material from this title is available at http://www.wiley.com/go/permissions. The right of Peter Hoeger, Veronica Kinsler, Albert Yan, John Harper and Arnold Oranje to be identified as the authors of the editorial material in this work has been asserted in accordance with law. Registered Offices John Wiley & Sons, Inc., 111 River Street, Hoboken, NJ 07030, USA John Wiley & Sons Ltd, The Atrium, Southern Gate, Chichester, West Sussex, PO19 8SQ, UK Editorial Office 9600 Garsington Road, Oxford, OX4 2DQ, UK For details of our global editorial offices, customer services, and more information about Wiley products visit us at www.wiley.com. Wiley also publishes its books in a variety of electronic formats and by print‐on‐demand. Some content that appears in standard print versions of this book may not be available in other formats. Limit of Liability/Disclaimer of Warranty The contents of this work are intended to further general scientific research, understanding, and discussion only and are not intended and should not be relied upon as recommending or promoting scientific method, diagnosis, or treatment by physicians for any particular patient. In view of ongoing research, equipment modifications, changes in governmental regulations, and the constant flow of information relating to the use of medicines, equipment, and devices, the reader is urged to review and evaluate the information provided in the package insert or instructions for each medicine, equipment, or device for, among other things, any changes in the instructions or indication of usage and for added warnings and precautions. While the publisher and authors have used their best efforts in preparing this work, they make no representations or warranties with respect to the accuracy or completeness of the contents of this work and specifically disclaim all warranties, including without limitation any implied warranties of merchantability or fitness for a particular purpose. No warranty may be created or extended by sales representatives, written sales materials or promotional statements for this work. The fact that an organization, website, or product is referred to in this work as a citation and/or potential source of further information does not mean that the publisher and authors endorse the information or services the organization, website, or product may provide or recommendations it may make. This work is sold with the understanding that the publisher is not engaged in rendering professional services. The advice and strategies contained herein may not be suitable for your situation. You should consult with a specialist where appropriate. Further, readers should be aware that websites listed in this work may have changed or disappeared between when this work was written and when it is read. Neither the publisher nor authors shall be liable for any loss of profit or any other commercial damages, including but not limited to special, incidental, consequential, or other damages. Library of Congress Cataloging‐in‐Publication Data Names: Hoeger, Peter H., editor. | Kinsler, Veronica, editor. | Yan, Albert C., editor. Title: Harper’s textbook of pediatric dermatology / edited by Peter Hoeger, Veronica Kinsler, Albert Yan ; editorial advisors, John Harper, Arnold Oranje ; associate editors, Christine Bodemer, Margarita Larralde, David Luk, Vibhu Mendiratta, Diana Purvis. Other titles: Textbook of pediatric dermatology Description: Fourth edition. | Hoboken, NJ : Wiley-Blackwell, 2020. | Includes bibliographical references and index. Identifiers: LCCN 2019031032 (print) | ISBN 9781119142195 (hardback) | ISBN 9781119142805 (adobe pdf) | ISBN 9781119142737 (epub) Subjects: MESH: Skin Diseases | Child | Infant Classification: LCC RJ511 (print) | LCC RJ511 (ebook) | NLM WS 265 | DDC 618.92/5–dc23 LC record available at https://lccn.loc.gov/2019031032 LC ebook record available at https://lccn.loc.gov/2019031033 Cover image: CP Photo Art/Getty Images Cover design by Wiley Set in 9.5/11.5 pt Palatino by SPi Global, Pondicherry, India

10 9 8 7 6 5 4 3 2 1

 v

Contents

List of Contributors, xi Preface to the Fourth Edition, xxiv Dedication to Arnold P. Oranje, xxv Acknowledgements, xxvi List of Abbreviations, xxvii

VOLUME 1 Section 1 Development, Structure and Physiology of the Skin 1 Embryogenesis of the Skin, 1 Lara Wine Lee & Karen A. Holbrook 2 Molecular Genetics in Paediatric Dermatology, 36 Anna C. Thomas & Veronica A. Kinsler 3 Cutaneous Microbiome, 46 Carrie C. Coughlin & William H. McCoy IV

10 Differential Diagnosis of Neonatal Erythroderma, 121 Hagen Ott & Peter H. Hoeger 11 Vesiculopustular, Bullous and Erosive Diseases of the Neonate, 134 Caroline Mahon & Anna E. Martinez 12 Iatrogenic Disorders of the Newborn, 154 Elia F. Maalouf  & Wilson Lopez

Section 3 Atopic Dermatitis and Related Disorders 13 Epidemiology of Atopic Dermatitis, 167 Carsten Flohr, Jonathan I. Silverberg, Joy Wan & Sinéad M. Langan 14 Genetics and Aetiology of Atopic Dermatitis, 184 Elke Rodriguez & Stephan Weidinger 15 Clinical Features and Diagnostic Criteria of Atopic Dermatitis, 193 Sinéad M. Langan & Hywel C. Williams

4 Physiology of Neonatal Skin, 56 Peter H. Hoeger

16 Severity Scoring and Quality of Life Assessment in Atopic Dermatitis, 212 Christian Apfelbacher, Cecilia A.C. (Sanna) Prinsen, Daniel Heinl & Hywel C. Williams

Section 2 Skin Disorders of the Neonate and Young Infant

17 Atopic Dermatitis and Related Disorders: Special Types of Presentation, 228 Nawaf Almutairi

5 Neonatal Skin Care, 63 Peter H. Hoeger

18 Atopic Dermatitis: Complications, 245 Kevin B. Yarbrough & Eric L. Simpson

6 Transient Skin Disorders in the Neonate and Young Infant, 72 Margarita Larralde & Maria Eugenia Abad

19 Management of Atopic Dermatitis, 253 Lea Solman & Mary Glover

7 Congenital and Acquired Infections in the Neonate, 84 Scott H. James, Nico G. Hartwig, David W. Kimberlin & Peter H. Hoeger

Section 4 Other Types of Dermatitis

8 Transplacentally Acquired Dermatoses, 93 Paula Carolina Luna

20 Napkin Dermatitis, 265 Arnold P. Oranje, Ernesto Bonifazi, Paul J. Honig & Albert C. Yan

9 Developmental Anomalies, 101 Marion Wobser & Henning Hamm

21 Adolescent Seborrhoeic Dermatitis, 279 Roselyn Kellen & Nanette Silverberg

vi Contents 22 Irritant Contact Dermatitis, 287 David Luk

39 Pitted Keratolysis, Erythrasma and Erysipeloid, 456 Zhe Xu, Yuanyuan Xiao, Ying Xiu & Lin Ma

23 Allergic Contact Dermatitis, 300 Sharon E. Jacob, Hannah Hill & Alina Goldenberg

40 Lyme Borreliosis, 463 Susan O’Connell

24 Hypereosinophilic Disorders, 316 Eirini E. Merika & Nerys Roberts

41 Bartonella Infections, 475 Sonia Kamath & Minnelly Luu

25 Juvenile Plantar Dermatosis, 335 John C. Browning & Margaret Brown

42 Mycobacterial Skin Infections, 485 G. Sethuraman, Tanvi Dev & V. Ramesh

26 Perioral Dermatitis, 338 Marius Rademaker

43 Rickettsial Disease, 503 Arun C. Inamadar & Aparna Palit

Section 5 Psoriasis

44 Endemic Treponematoses: Yaws, Pinta and Endemic Syphilis, 515 Herman Jan H. Engelkens

27 Psoriasis: Epidemiology, 343 Matthias Augustin & Marc Alexander Radtke 28 Psoriasis: Aetiology and Pathogenesis, 350 Jonathan Barker 29 Psoriasis: Clinical Features and Comorbidities, 354 Derek H. Chu & Kelly M. Cordoro 30 Psoriasis: Classification, Scores and Diagnosis, 362 Nirav Patel & Megha Tollefson 31 Psoriasis: Management, 368 Marieke M.B. Seyger

Section 6 Other Papulosquamous Disorders 32 Pityriasis Rubra Pilaris, 377 Liat Samuelov & Eli Sprecher 33 Lichen Planus, 390 Vibhu Mendiratta & Sarita Sanke 34 Lichen Nitidus, 403 Jasem M. Alshaiji 35 Lichen Striatus, 408 Franck Boralevi & Alain Taïeb 36 Pityriasis Rosea, 416 Antonio A.T. Chuh & Vijay Zawar

Section 7 Bacterial Skin Infections 37 Pyodermas and Bacterial Toxin‐mediated Syndromes, 423 James R. Treat, Christian R. Millett, Warren R. Heymann & Steven M. Manders 38 Cutaneous Manifestations of Gram‐negative Infections, 434 Saul N. Faust, Diane Gbesemete & Robert S. Heyderman

45 Tropical Ulcer, 523 Vibhu Mendiratta & Soumya Agarwal

Section 8 Fungal Skin Infections 46 Superficial Fungal Infections, 527 Peter Mayser & Yvonne Gräser 47 Deep Fungal Infections, 560 María Teresa García‐Romero

Section 9 Viral Skin Infections and Opportunistic Infections 48 Molluscum Contagiosum, 579 Joachim J. Bugert, Ali Alikhan & Tor Shwayder 49 Human Papillomavirus Infection, 588 Yun Tong, Stephen K. Tyring & Zsuzsanna Z. Szalai 50 Herpes Simplex Virus Infections, 598 Manuraj Singh, Helen M. Goodyear & Judith Breuer 51 Varicella Zoster Virus Infections, 612 Manuraj Singh & Judith Breuer 52 Poxvirus Infections, 624 Susan Lewis‐Jones & Jane C. Sterling 53 HIV and HTLV‐1 Infection, 649 Neil S. Prose, Ncoza C. Dlova, Rosalia A. Ballona & Coleen K. Cunningham 54 Viral Exanthems, 660 Jusleen Ahluwalia, Pamela Gangar & Sheila Fallon Friedlander 55 Eruptive Hypomelanosis, 681 Vijay Zawar & Antonio A.T. Chuh 56 Cutaneous Infections in Immunocompromised Children, 684 Miriam Weinstein, Hagen Ott & Peter H. Hoeger

Contents vii

Section 10 Parasitic Skin Infestations and Sting Reactions 57 Leishmaniasis, 693 Bernardo Gontijo & Carolina Talhari 58 Helminthic Infections, 702 Héctor Cáceres‐Ríos & Felipe Velasquez 59 Scabies and Pseudoscabies, 711 Wingfield E. Rehmus & Julie S. Prendiville 60 Pediculosis and Cimicosis, 723 Sandipan Dhar & Sahana M. Srinivas 61 Noxious and Venomous Creatures, 733 Kam Lun Ellis Hon, Theresa Ngan Ho Leung & Ting Fan Leung 62 Aquatic Dermatoses, 746 Sarah Hill

Section 11 Urticaria, Erythemas and Drug Reactions 63 Urticaria, 751 Bettina Wedi 64 Annular Erythemas, 764 Kimberly A. Horii

Section 14  Blistering Disorders 73 Differential Diagnosis of Vesiculobullous Lesions, 859 Sharleen F. Hill & Dédée F. Murrell 74 Autoimmune Bullous Diseases, 868 Nina van Beek & Enno Schmidt 75 Childhood Dermatitis Herpetiformis, 898 Carmen Liy Wong & Irene Lara‐Corrales 76 Epidermolysis Bullosa and Kindler Syndrome, 907 Jemima E. Mellerio, Anna E. Martinez & Christina Has

Section 15 Photodermatoses, Photoprotection and Environmental Skin Disorders 77 The Idiopathic Photodermatoses and Skin Testing, 943 Erhard Hölzle & Robert Dawe 78 The Porphyrias, 957 Jorge Frank 79 Photoprotection, 969 Lachlan Warren & Genevieve Casey 80 Skin Reactions to Plants, Cold, Heat and Chemicals, 983 Tuyet A. Nguyen, Christopher Lovell & Andrew C. Krakowski

65 Gianotti–Crosti Syndrome, 771 Carlo M. Gelmetti 66 Erythema Multiforme, Stevens–Johnson Syndrome and Toxic Epidermal Necrolysis, 777 Benjamin S. Daniel, Lizbeth Ruth Wheeler & Dédée F. Murrell

Section 16  Granulomatous Diseases

67 Hypersensitivity Reactions to Drugs, 785 Mohannad Abu‐Hilal & Neil Shear

82 Granuloma Annulare, 1006 Annalisa Patrizi & Iria Neri

Section 12  Acne and Acneiform Disorders 68 Acne, 803 Marissa J. Perman, Bodo C. Melnik & Anne W. Lucky 69 Childhood Rosacea, 821 Clio Dessinioti & Andreas Katsambas 70 Hidradenitis Suppurativa, 825 Peter Theut Riis & Gregor B.E. Jemec

Section 13  Nutritional Disorders 71 Skin Manifestations of Nutritional Disorders, 831 Carola Durán McKinster & Luz Orozco‐Covarrubias 72 Skin Manifestations of Paediatric Metabolic Syndrome, 841 Gregor Holzer & Beatrix Volc‐Platzer

81 Sarcoidosis, 995 Lisa M. Arkin, Julie L. Cantatore‐Francis & Julie V. Schaffer

83 Orofacial Granulomatosis, 1017 Lisa Weibel & Martin Theiler

Section 17  Neutrophilic Dermatoses 84 Sweet Syndrome, 1023 Peter von den Driesch 85 Pyoderma Gangrenosum, 1027 Karolina Gholam

Section 18  Lymphocytic Disorders 86 Pityriasis Lichenoides, 1035 Christine T. Lauren & Maria C. Garzon 87 Jessner Lymphocytic Infiltrate of the Skin, 1040 R.M. Ross Hearn

viii Contents 88 Primary Cutaneous Lymphoma, 1044 Rebecca Levy & Elena Pope

102 Panniculitis in Children, 1207 Christine Bodemer

89 Childhood Leukaemias and Lymphomas, 1063 Keith Morley & Jennifer Huang

103 Lipodystrophies, 1221 Robert K. Semple

Section 19  Histiocytic Disorders

Section 23 Mosaic Disorders, Naevi and Hamartomas

90 Langerhans Cell Histiocytosis, 1071 Sylvie Fraitag & Jean Donadieu 91 Juvenile Xanthogranuloma and Other Non‐Langerhans Cell Histiocytoses, 1078 Gudrun Ratzinger & Bernhard W.H. Zelger

104 An Introduction to Mosaicism, 1229 Veronica A. Kinsler 105 Melanocytic Naevi, 1237 Veronica A. Kinsler 106 Epidermal Naevi, 1260 Leopold M. Groesser & Christian Hafner

Section 20  Mastocytosis 92 Paediatric Mastocytosis, 1097 Laura Polivka & Christine Bodemer

Section 21  Disorders of Connective Tissue 93 Ehlers–Danlos Syndromes, 1111 Nigel P. Burrows 94 Pseudoxanthoma Elasticum and Cutis Laxa, 1125 Sean D. Reynolds & Lionel Bercovitch 95 Buschke–Ollendorff Syndrome, Marfan Syndrome and Osteogenesis Imperfecta, 1139 Marc Lacour 96 Anetodermas and Atrophodermas, 1151 Marc Lacour 97 Hyalinoses, Stiff Skin Syndrome and Restrictive Dermopathy, 1164 David G. Paige 98 Striae in Children and Adolescents, 1172 Marcelo Ruvertoni 99 Morphoea (Localized Scleroderma), 1175 Despina Eleftheriou & Lindsay Shaw 100 Systemic Sclerosis in Childhood, 1183 Christopher P. Denton & Carol M. Black Index, i1

107 Other Naevi and Hamartomas, 1276 Jonathan A. Dyer 108 Proteus Syndrome and Other Localized Overgrowth Disorders, 1283 Veronica A. Kinsler 109 Mosaic Disorders of Pigmentation, 1296 Veronica A. Kinsler

Section 24  Nonvascular Skin Tumours 110 Differential Diagnosis of Skin Nodules and Cysts, 1313 Susanne Abraham & Peter H. Hoeger 111 Adnexal Disorders, 1325 Andrew Wang & Robert Sidbury 112 Calcification and Ossification in the Skin, 1338 Amanda T. Moon, Albert C. Yan & Eulalia T. Baselga 113 Angiolymphoid Hyperplasia with Eosinophilia, 1350 Jasem M. Alshaiji 114 Fibromatoses, 1356 Jenna L. Streicher, Moise L. Levy & Albert C. Yan 115 Carcinomas of the Skin, 1370 Karen Agnew 116 Childhood Melanoma, 1377 Birgitta Schmidt & Elena B. Hawryluk 117 Other Malignant Skin Tumours, 1382 Andrea Bettina Cervini, Marcela Bocian, María Marta Bujan & Paola Stefano

VO L U M E 2

Section 25  Vascular Tumours and Malformations

Section 22  Disorders of Fat Tissue

118 Vascular Malformations, 1399 Laurence M. Boon & Miikka Vikkula

101 Lipoma and Lipomatosis, 1195 Siriwan Wananukul & Susheera Chatproedprai

119 Infantile Haemangiomas, 1425 Anna L. Bruckner, Ilona J. Frieden & Julie Powell

Contents ix 120 Other Vascular Tumours, 1440 Ann M. Kulungowski, Taizo A. Nakano & Anna L. Bruckner

135 Focal Dermal Hypoplasia, 1706 Bret L. Bostwick, Ignatia B. Van den Veyver & V. Reid Sutton

121 Disorders of Lymphatics, 1452 Arin K. Greene & Jeremy A. Goss

136 Incontinentia Pigmenti, 1718 Elizabeth A. Jones & Dian Donnai

Section 26  Disorders of Pigmentation 122 Inherited and Acquired Hyperpigmentation, 1463 Leslie Castelo‐Soccio & Alexis Weymann Perlmutter

137 Premature Ageing Syndromes, 1725 Helga V. Toriello & Caleb P. Bupp

Section 29 Genetic Diseases Predisposing to Malignancy

123 Vitiligo, 1476 Julien Seneschal, Juliette Mazereeuw‐Hautier & Alain Taïeb

138 Xeroderma Pigmentosum and Related Diseases, 1743 Steffen Schubert & Steffen Emmert

124 Albinism, 1486 Fanny Morice‐Picard & Alain Taïeb

139 Gorlin (Naevoid Basal Cell Carcinoma) Syndrome, 1769 Kai Ren Ong & Peter A. Farndon

125 Disorders of Hypopigmentation, 1492 M.W. Bekkenk & A. Wolkerstorfer

140 Rothmund–Thomson Syndrome, Bloom Syndrome, Dyskeratosis Congenita, Fanconi Anaemia and Poikiloderma with Neutropenia, 1786 Lisa L. Wang & Moise L. Levy

126 Dyschromatosis, 1499 Liat Samuelov & Eli Sprecher

141 Other Genetic Disorders Predisposing to Malignancy, 1802 Julie V. Schaffer

Section 27 Disorders of Keratin and Keratinization 127 Review of Keratin Disorders, 1515 Maurice A.M. van Steensel & Peter M. Steijlen 128 Mendelian Disorders of Cornification (MEDOC): The Keratodermas, 1524 Edel A. O’Toole

Section 30 Neurofibromatosis, RASopathies and Hamartoma-Overgrowth Syndromes 142 The Neurofibromatoses, 1823 Amy Theos, Kevin P. Boyd & Bruce R. Korf  143 Tuberous Sclerosis Complex, 1837 Francis J. DiMario Jr

129 Mendelian Disorders of Cornification (MEDOC): The Ichthyoses, 1549 Angela Hernández, Robert Gruber & Vinzenz Oji

144 Other RASopathies, 1857 Fanny Morice‐Picard

130 Keratosis Pilaris and Darier Disease, 1599 Flora B. de Waard‐van der Spek & Arnold P. Oranje

Section 31  Vasculitic and Rheumatic Syndromes

131 The Erythrokeratodermas, 1608 Juliette Mazereeuw‐Hautier, S. Leclerc‐Mercier & E. Bourrat

145 Cutaneous Vasculitis, 1865 Joyce C. Chang & Pamela F. Weiss

132 Netherton Syndrome, 1613 Wei‐Li Di & John Harper 133 Porokeratosis, 1623 Leslie Castelo‐Soccio

Section 28 Focal or Generalized Hypoplasia and Premature Ageing 134 Ectodermal Dysplasias, 1629 Cathal O’Connor, Yuka Asai & Alan D. Irvine

146 Purpura Fulminans, 1891 Michael Levin, Brian Eley & Saul N. Faust 147 Kawasaki Disease, 1906 Wynnis L. Tom & Jane C. Burns 148 Polyarteritis Nodosa, Granulomatosis with Polyangiitis and Microscopic Polyangiitis, 1918 Paul A. Brogan 149 Juvenile Idiopathic Arthritis, Systemic Lupus Erythematosus and Juvenile Dermatomyositis, 1933 Elena Moraitis & Despina Eleftheriou 150 Behçet Disease and Relapsing Polychondritis, 1952 Sibel Ersoy‐Evans, Ayşen Karaduman & Seza Özen

x Contents 151 Erythromelalgia, 1961 Nedaa Skeik

Section 32 Cutaneous Manifestations of Systemic Disease 152 Metabolic Disorders and the Skin, 1965 Fatma Al Jasmi, Hassan Galadari, Peter T. Clayton & Emma J. Footitt 153 Cystic Fibrosis, 1988 Roderic J. Phillips

Section 37 Psychological Aspects of Skin Disease in Children 165 Assessing and Scoring Life Quality, 2241 Andrew Y. Finlay 166 Coping with the Burden of Disease, 2255 Sarah L. Chamlin 167 Physiological Habits, Self‐Mutilation and Factitious Disorders, 2262 Arnold P. Oranje, Jeroen Novak & Robert A.C. Bilo

154 Cutaneous Manifestations of Endocrine Disease, 1993 Devika Icecreamwala & Tor A. Shwayder

Section 38  Principles of Treatment in Children

155 Autoinflammatory Diseases and Amyloidosis, 2010 Antonio Torrelo, Sergio Hernández‐Ostiz & Teri A. Kahn

168 Topical Therapy, 2275 Johannes Wohlrab

156 Immunodeficiency Syndromes, 2028 Julie V. Schaffer, Melanie Makhija & Amy S. Paller

169 Systemic Therapy in Paediatric Dermatology, 2282 Blanca Rosa Del Pozzo‐Magana & Irene Lara‐Corrales

157 Graft‐Versus‐Host Disease, 2067 John Harper & Paul Veys

170 New Genetic Approaches to Treating Diseases of the Skin, 2301 Stephen Hart & Amy Walker

Section 33  The Oral Cavity

171 Surgical Therapy, 2310 Julianne A. Mann & Jane S. Bellet

158 The Oral Mucosa and Tongue, 2079 Jane Luker & Crispian Scully

172 Laser Therapy, 2319 Samira Batul Syed, Maria Gnarra & Sean Lanigan

Section 34  Hair, Scalp and Nail Disorders 159 Hair Disorders, 2103 Elise A. Olsen & Matilde Iorizzo 160 Alopecia Areata, 2139 Kerstin Foitzik‐Lau 161 Nail Disorders, 2147 Antonella Tosti & Bianca Maria Piraccini

Section 35  Anogenital Disease in Children 162 Genital Disease in Children, 2159 Gayle O. Fischer 163 Sexually Transmitted Diseases in Children and Adolescents, 2195 Arnold P. Oranje, Robert A.C. Bilo & Nico G. Hartwig

Section 36 Cutaneous Signs of Child Maltreatment and Sexual Abuse 164 Maltreatment, Physical and Sexual Abuse, 2219 Bernhard Herrmann

173 Sedation and Anaesthesia, 2330 Brenda M. Simpson, Yuin‐Chew Chan & Lawrence F. Eichenfield

Section 39 Diagnostic Procedures in Dermatology 174 Approach to the Paediatric Patient, 2341 Diana Purvis 175 Dermoscopy of Melanocytic Lesions in the Paediatric Population, 2357 Maria L. Marino, Jennifer L. DeFazio, Ralph P. Braun & Ashfaq A. Marghoob 176 The Role of Histopathology and Molecular Techniques in Paediatric Dermatology, 2378 Lori Prok & Adnan Mir

Section 40 Nursing Care of Cutaneous Disorders in Children 177 Nursing Care of the Skin in Children, 2393 Bisola Laguda, Hilary Kennedy, Jackie Denyer, Heulwen Wyatt, Jean Robinson & Karen Pett Index, i1

xi

List of Contributors

Maria Eugenia Abad, MD

Ali Alikhan

Rosalia A. Ballona

Dermatology Department Hospital Alemán Pediatric Dermatology Department Hospital Ramos Mejía Buenos Aires, Argentina

University of Cincinnati Department of Dermatology Cincinnati, OH, USA

Division of Dermatology Instituto del Salud del Niño Lima, Peru

Nawaf Almutairi, MD

Jonathan Barker, MD, FRCP, FRCPath

Susanne Abraham, MD Department of Dermatology Medical Faculty Carl‐Gustav‐Carus Technical University of Dresden Dresden, Germany

Mohannad Abu‐Hilal, MD Assistant Professor Division of Dermatology Department of Medicine McMaster University Hamilton, ON, Canada

Soumya Agarwal, MD Senior Resident Department of Dermatology Lady Hardinge Medical College and Associated Hospitals New Delhi, India

Karen Agnew, MBChB, FRACP, FNZDS Consultant Dermatologist Starship Children’s and Auckland City Hospitals Auckland, New Zealand

Jusleen Ahluwalia, MD Resident Physician Department of Pediatric and Adolescent Dermatology Rady Children’s Hospital San Diego, CA, USA

Fatma Al Jasmi, MBBS, FRCPC, FCCMG Associate Professor College of Medicine and Health Science United Arab Emirates University Al Ain, United Arab Emirates

Professor Department of Medicine Faculty of Medicine Kuwait University Kuwait

Jasem M. Alshaiji, MD Head of Dermatology Department Head of Pediatric Dermatology Unit Amiri Hospital Kuwait

Christian Apfelbacher, PhD

Professor of Dermatology St John’s Institute of Dermatology (King’s College) Guy’s Hospital London, UK

Eulalia T. Baselga, MD Pediatric Dermatology Unit Hospital de la Santa Creu I Sant Pau Universitat Autònoma de Barcelona Spain

Medical Sociology Institute of Epidemiology and Preventive Medicine University of Regensburg Regensburg, Germany

M.W. Bekkenk, MD, PhD

Lisa M. Arkin, MD

Jane S. Bellet, MD

Department of Dermatology University of Wisconsin School of Medicine and Public Health Madison, WI, USA

Associate Professor of Dermatology and Pediatrics Duke University Medical Center Durham, NC, USA

Yuka Asai, MSc, PhD, MD

Lionel Bercovitch, MD

Assistant Professor Division of Dermatology Queen’s University Kingston, ON, Canada

Professor of Dermatology Warren Alpert Medical School of Brown University Director of Pediatric Dermatology Hasbro Children’s Hospital Providence, RI, USA Medical Director PXE International, Inc. Washington, DC, USA

Matthias Augustin, MD Professor Institute for Health Services Research in Dermatology and Nursing (IVDP) University Medical Center Hamburg‐ Eppendorf (UKE) Hamburg, Germany

Dermatologist Netherlands Institute for Pigment Disorders Amsterdam University Medical Centers Amsterdam, The Netherlands

Robert A.C. Bilo Department of Forensic Medicine Section on Forensic Pediatrics Netherlands Forensic Institute The Hague, The Netherlands

xii  List of Contributors

Carol M. Black, DBE, MD, FRCP, MACP, FMedSci Principal of Newnham College Cambridge, Expert Adviser on Health and Work to NHS England and Public Health England, Chair of Think Ahead, Chair of the British Library Centre for Rheumatology Royal Free Hospital and UCL Division of Medicine London, UK

Christine Bodemer, MD, PhD Professor of Dermatology Department of Dermatology Imagine Institute Necker‐Enfants Malades Hospital Paris, France

Marcela Bocian, MD Assistant Physician Dermatology Department Hospital de Pediatría ‘Prof. Dr. Juan P. Garrahan’ Buenos Aires, Argentina

Ernesto Bonifazi, MD Professor of Dermatology Dermatologia Pediatrica Association Bari, Italy

Laurence M. Boon, MD, PhD Coordinator of the Center for Vascular Anomalies Division of Plastic Surgery Cliniques Universitaires Saint Luc and Human Molecular Genetics de Duve Institute University of Louvain Brussels, Belgium

Franck Boralevi, MD, PhD Pediatric Dermatology Unit Hôpital Pellegrin‐Enfants Bordeaux, France

Bret L. Bostwick, MD Assistant Professor Department of Molecular and Human Genetics Baylor College of Medicine and Texas Children’s Hospital Houston, TX, USA

E. Bourrat, MD Reference Center for Inherited Skin Disease Dermatology Department CHU Saint Louis Paris, France

Kevin P. Boyd, MD Clinical Assistant Professor University of Alabama at Birmingham Birmingham, AL, USA

Ralph P. Braun, MD

Jane C. Burns, MD

Dermatology Clinic University Hospital Zürich Zürich, Switzerland

Professor of Pediatrics Director, Kawasaki Disease Research Center University of California, San Diego Rady Children’s Hospital La Jolla, CA, USA

Judith Breuer, MBBS, MD, FRCPath Professor of Virology UCL Honorary Consultant Virologist Great Ormond Street Hospital UCL Division of Infection and Immunity London, UK

Paul A. Brogan, MBChB, FRCPCH, PhD Professor of Vasculitis and Honorary Consultant Paediatric Rheumatologist Section Head: Infection and Inflammation and Rheumatology Co‐Director of Education (Clinical Academics) UCL Institute of Child Health Great Ormond Street Hospital NHS Foundation Trust London, UK

Margaret Brown, MD Division of Dermatology The University of Texas Health Science Center at San Antonio San Antonio, TX, USA

John C. Browning, MD, FAAD, FAAP Assistant Professor Baylor College of Medicine Chief of Dermatology Children’s Hospital of San Antonio San Antonio, TX, USA

Anna L. Bruckner, MD, MSCS Associate Professor of Dermatology and Pediatrics University of Colorado School of Medicine Section Head Division of Dermatology Children’s Hospital Colorado Aurora, CO, USA

Nigel P. Burrows, MBBS, MD, FRCP Consultant Dermatologist and Associated Lecturer Department of Dermatology Addenbrooke’s Hospital Cambridge University Hospitals NHS Foundation Trust Cambridge, UK

Héctor Cáceres‐Ríos, MD Consultant in Pediatric Dermatology Department of Pediatric Dermatology Instituto de Salud del Niño Lima, Peru

Julie L. Cantatore‐Francis, MD Dermatology Physicians of Connecticut Shelton, CT, USA

Genevieve Casey Specialist Registrar Department of Dermatology Women’s & Children’s Hospital Adelaide, SA, Australia

Leslie Castelo‐Soccio, MD, PhD Professor of Pediatrics and Dermatology Department of Pediatrics Section of Pediatric Dermatology University of Pennsylvania Perelman School of Medicine and Children’s Hospital of Philadelphia Philadelphia, PA, USA

Andrea Bettina Cervini, MD Dermatologist, Pediatric Dermatologist Head of Dermatology Department Hospital de Pediatría ‘Prof. Dr. Juan P. Garrahan’ Buenos Aires, Argentina

Joachim J. Bugert, MD, PhD

Sarah L. Chamlin, MD

Lab Group Leader Institut für Mikrobiologie der Bundeswehr München, Germany

Professor of Pediatrics and Dermatology The Ann and Robert H. Lurie Children’s Hospital of Chicago and Northwestern University Feinberg School of Medicine Chicago, IL, USA

María Marta Bujan, MD Assistant Physician Dermatology Department Hospital de Pediatría ‘Prof. Dr. Juan P. Garrahan’ Buenos Aires, Argentina

Caleb P. Bupp, MD Medical Geneticist Spectrum Health Medical Group Grand Rapids, MI, USA

Yuin‐Chew Chan Dermatologist Dermatology Associates Gleneagles Medical Centre Singapore

List of Contributors  xiii

Joyce C. Chang, MD

Robert Dawe, MBCh, MD, FRCPE

Francis J. DiMario Jr, MD

Instructor Division of Rheumatology The Children’s Hospital of Philadelphia Philadelphia, PA, USA

Photodermatology Unit Department of Dermatology Ninewells Hospital and Medical School Dundee, UK

Susheera Chatproedprai, MD

Jennifer L. DeFazio, MD

Associate Professor of Paediatrics Head of Division of Paediatric Dermatology Department of Paediatrics Faculty of Medicine Chulalongkorn University, Bangkok, Thailand

Department of Dermatology Memorial Sloan‐Kettering Cancer Center New York, NY, USA

Professor of Pediatrics and Neurology University of Connecticut School of Medicine Farmington, CT, USA Associate Chair for Academic Affairs, Department of Pediatrics, Director, Neurogenetic‐Tuberous Sclerosis Clinic Division of Pediatric Neurology Connecticut Children’s Medical Center Hartford, CT, USA

Derek H. Chu, MD Clinical Assistant Professor of Dermatology and Pediatrics Stanford University School of Medicine Palo Alto, CA, USA

Antonio A.T. Chuh, MD Department of Family Medicine and Primary Care The University of Hong Kong and Queen Mary Hospital Pokfulam, Hong Kong JC School of Public Health and Primary Care The Chinese University of Hong Kong and the Prince of Wales Hospital Shatin, Hong Kong

Peter T. Clayton, BA, MBBS, MSc, MRCP Professor Institute of Child Health University College London with Great Ormond Street Hospital for Children NHS Trust London, UK

Kelly M. Cordoro, MD Associate Professor of Dermatology and Pediatrics University of California San Francisco San Francisco, CA, USA

Carrie C. Coughlin, MD Assistant Professor Division of Dermatology Department of Medicine and Department of Pediatrics Washington University School of Medicine St Louis, MO, USA

Coleen K. Cunningham Department of Pediatrics and Dermatology Duke University Medical Center Durham, NC, USA

Benjamin S. Daniel Department of Dermatology St George Hospital and University of New South Wales Sydney, NSW, Australia

Blanca Rosa Del Pozzo‐Magana

Ncoza C. Dlova

London Health Sciences Center and Western University London, ON, Canada

Department of Dermatology University of Kwazulu‐Natal Durban, South Africa

Christopher P. Denton, PhD, FRCP

Jean Donadieu, MD, PhD

Professor of Experimental Rheumatology Centre for Rheumatology Royal Free Hospital and UCL Division of Medicine London, UK

Jackie Denyer Clinical Nurse Specialist in Paediatric Dermatology Great Ormond Street Hospital London, UK

Clio Dessinioti Department of Dermatology Andreas Syggros Hospital University of Athens Greece

Tanvi Dev, MD Senior Resident (Fellow) Department of Dermatology All India Institute of Medical Sciences New Delhi, India

Flora B. de Waard‐van der Spek, MD, PhD Paediatric Dermatologist Department of Dermatology Franciscus Gasthuis and Vlietland Rotterdam/Schiedam, The Netherlands

Sandipan Dhar, MBBS, MD, DNB, FRCP(Edin) Professor and Head Department of Pediatric Dermatology Institute of Child Health Kolkata, West Bengal, India

Wei‐Li Di, MBBS, PhD Associate Professor in Skin Biology Infection, Immunity and Inflammation Programme Immunobiology Section Institute of Child Health University College London London, UK

Service d’Hémato‐Oncologie Pédiatrique Registre des Histiocytoses Centre de Référence des Histiocytoses Hopital Trousseau Paris, France

Dian Donnai, CBE, FMedSci, FRCP, FRCOG Professor of Medical Genetics Manchester Centre for Genomic Medicine St Mary’s Hospital Manchester University NHS Foundation Trust Manchester, UK Division of Evolution and Genomic Sciences Faculty of Biology Medicine and Health University of Manchester Manchester, UK

Carola Durán McKinster, MD Paediatric Dermatologist and Professor of Pediatric Dermatology Universidad Nacional Autonoma de México Head of the Department of Pediatric Dermatology National Institute of Paediatrics of Mexico Mexico City, Mexico

Jonathan A. Dyer, MD Associate Professor of Dermatology and Child Health Departments of Dermatology and Child Health University of Missouri Columbia, MO, USA

Lawrence F. Eichenfield, MD Professor of Clinical Dermatology Pediatric and Adolescent Dermatology Rady Children’s Hospital San Diego University of California San Diego School of Medicine San Diego, CA, USA

xiv  List of Contributors

Despina Eleftheriou, MBBS, PhD, MRCPCH

Gayle O. Fischer, MBBS, FACD, MD

Associate Professor in Paediatric Rheumatology Infection, Inflammation and Rheumatology Section UCL Institute of Child Health Paediatric Rheumatology Department, Great Ormond Street Hospital for Children NHS Foundation Trust Arthritis Research UK Centre for Adolescent Rheumatology London, UK

Associate Professor in Dermatology The Northern Clinical School The University of Sydney Sydney, NSW, Australia

Brian Eley, BSc (Hons) (Med Biochem), MBChB (Cape Town), FCP (SA) Professor of Paediatric Infectious Diseases University of Cape Town South Africa

Steffen Emmert, MD Professor of Dermatology Director Clinic for Dermatology and Venereology University Medical Center Rostock Rostock, Germany

Herman Jan H. Engelkens, MD, PhD Department of Dermatology and Venereology Ikazia Hospital Rotterdam, The Netherlands

Sibel Ersoy‐Evans, MD Professor of Dermatology Hacettepe University School of Medicine Department of Dermatology Ankara, Turkey

Peter A. Farndon, MSc, MD, FRCP Professor of Clinical Genetics (Retired) University of Birmingham Birmingham, UK

Saul N. Faust, FRCPCH, PhD Professor of Paediatric Immunology and Infectious Diseases and Director of the NIHR Southampton Clinical Research Facility University of Southampton and University Hospital Southampton NHS Foundation Trust Southampton, UK

Andrew Y. Finlay, CBE, FRCP (Lond. and Glasg.) Professor of Dermatology Division of Infection and Immunity Cardiff University School of Medicine Cardiff, UK

Carsten Flohr, MD, PhD Professor of Dermatology Unit for Population‐Based Dermatology Research St John’s Institute of Dermatology Guy’s and St Thomas’ NHS Foundation Trust and King’s College London, UK

Kerstin Foitzik‐Lau, MD Physician Skin and Vein Clinic Winterhude Hamburg, Germany

Emma J. Footitt, MB, BS, BSc, PhD Institute of Child Health University College London with Great Ormond Street Hospital for Children NHS Trust London, UK

Sylvie Fraitag, MD Dermatopathologie Pédiatrique Service d’Anatomo‐Pathologie Hôpital Necker‐Enfants Malades Paris, France

Jorge Frank, MD Professor of Dermatology Department of Dermatology, Venereology and Allergology University Medical Center Göttingen Göttingen, Germany

llona J. Frieden, MD

Pamela Gangar, MD Resident Physician University of Arizona Department of Pediatrics Tucson, AZ, USA

María Teresa García‐Romero, MD, MPH Attending Physician Department of Dermatology National Institute for Pediatrics Member of the National System of Researchers Mexico City, Mexico

Maria C. Garzon, MD Columbia University Medical Center New York, NY, USA

Diane Gbesemete, BM, MRCPCH, PGDipID Clinical Research Fellow NIHR Southampton Clinical Research Facility University of Southampton and University Hospital Southampton NHS Foundation Trust Southampton, UK

Carlo M. Gelmetti Professor of Dermatology and Venereology Department of Pathophysiology and Transplantation Università degli Studi di Milano Head Unit of Pediatric Dermatology Fondazione IRCCS Ca’ Granda ‘Ospedale Maggiore Policlinico’ Milan, Italy

Karolina Gholam, MBSS, MSc, FRCPCH, SCEderm Consultant Paediatric Dermatologist Great Ormond Street Hospital London, UK

Professor of Dermatology and Pediatrics Division of Pediatric Dermatology San Francisco School of Medicine University of California San Francisco, CA, USA

Mary Glover, MA, FRCP, FRCPCH

Sheila Fallon Friedlander, MD

Maria Gnarra, MD, PhD

Professor of Dermatology and Pediatrics Department of Pediatric and Adolescent Dermatology Rady Children’s Hospital San Diego, CA, USA

Research Fellow Paediatric Dermatology Great Ormond Street Hospital for Children NHS Trust London, UK

Hassan Galadari, MD

Alina Goldenberg, MD

Associate Professor College of Medicine and Health Science United Arab Emirates University Al Ain, United Arab Emirates

Resident in‐training Department of Dermatology University of California San Diego, CA, USA

Consultant Paediatric Dermatologist Great Ormond Street Hospital for Children NHS Foundation Trust London, UK

List of Contributors  xv

Bernardo Gontijo, MD, PhD Professor of Dermatology Federal University of Minas Gerais Medical School Belo Horizonte, MG, Brazil

Helen M. Goodyear, MB, ChB, FRCP, FRCPCH, MD, MMEd, MA Health Education England (West Midlands) Associate Postgraduate Dean Heart of England NHS Foundation Trust Birmingham, UK

Jeremy A. Goss, MD Research Fellow Department of Plastic and Oral Surgery Vascular Anomalies Center Boston Children’s Hospital Harvard Medical School Boston, MA, USA

Yvonne Gräser, PhD Professor of Molecular Mycology The National Reference Laboratory for Dermatophytes Universitätsmedizin – Charité Institute of Microbiology and Hygiene Berlin, Germany

Arin K. Greene, MD, MMSc Professor of Surgery Department of Plastic and Oral Surgery Vascular Anomalies Center Boston Children’s Hospital Harvard Medical School Boston, MA, USA

Leopold M. Groesser, Dr med. Department of Dermatology University of Regensburg Regensburg, Germany

Robert Gruber, MD Department of Dermatology and Division of Human Genetics Medical University of Innsbruck Innsbruck, Austria

Christian Hafner, Dr med. Professor of Dermatology Department of Dermatology University of Regensburg Regensburg, Germany

Henning Hamm, MD Professor of Dermatology Department of Dermatology, Venereology and Allergology University Hospital Würzburg Würzburg, Germany

John Harper, MBBS, MD, FRCP, FRCPCH Honorary Professor of Paediatric Dermatology Great Ormond Street Hospital for Children NHS Trust London, UK

Stephen Hart, PhD Professor in Molecular Genetics Experimental and Personalised Medicine UCL Great Ormond Street Institute of Child Health London, UK

Nico G. Hartwig, MD, PhD Department of Paediatrics Franciscus Gasthuis & Vlietland Rotterdam, The Netherlands

Christina Has, MD Consultant Dermatologist and Professor Molecular Dermatology Medical Center University of Freiburg Freiburg, Germany

Elena B. Hawryluk, MD, PhD Department of Dermatology Massachusetts General Hospital Harvard Medical School; Dermatology Program Division of Allergy and Immunology Department of Medicine Boston Children’s Hospital Harvard Medical School Boston, MA, USA

R.M. Ross Hearn

Bernhard Herrmann, MD Consultant Child Protection Center Pediatric and Adolescent Gynecology Department of Pediatrics Klinikum Kassel Kassel, Germany

Robert S. Heyderman, PhD, FRCP, DTM & H Professor of Infectious Diseases University College London London, UK

Warren R. Heymann, MD Head, Division of Dermatology, Clinical Professor of Dermatology University of Pennsylvania School of Medicine Professor of Medicine and Paediatrics University of Medicine and Dentistry of New Jersey Robert Wood Johnson Medical School Camden, NJ, USA

Hannah Hill, MD Resident in‐training Department of Dermatology Mayo Clinic Scottsdale, AZ, USA

Sarah Hill, MBChB, FRACP Paediatric and General Dermatologist Department of Dermatology Waikato Hospital Hamilton, New Zealand

Sharleen F. Hill, BM BSc MRCP

Department of Dermatology and Photobiology Ninewells Hospital and Medical School Dundee, UK

Dermatology Clinical Research Fellow St George Hospital Conjoint Associate Lecturer University of New South Wales Sydney, NSW, Australia

Daniel Heinl, MD

Peter H. Hoeger, MD

Medical Sociology Institute of Epidemiology and Preventive Medicine University of Regensburg Regensburg, Germany

Professor of Paediatrics and Dermatology (University of Hamburg) Head, Departments of Paediatrics and Dermatology Catholic Children’s Hospital, Wilhelmstift Hamburg, Germany

Angela Hernández, MD Department of Dermatology Hospital Infantil del Niño Jesús Madrid, Spain

Sergio Hernández‐Ostiz, MD Department of Dermatology Hospital Infantil del Niño Jesús Madrid, Spain

Karen A. Holbrook, MD (Retired) Department of Physiology and Cell Biology Ohio State University Columbus, OH, USA

xvi  List of Contributors

Gregor Holzer, MD

Arun C. Inamadar, MD, FRCP

Department of Dermatology Donauspital SMZ Ost Vienna, Austria

Professor and Head Department of Dermatology, Venereology & Leprosy Sri B.M.Patil Medical College Hospital & Research Centre BLDE University Vijayapur, Karnataka, India

Erhard Hölzle, MD Professor of Dermatology Director Department of Dermatology and Allergology University Hospital Oldenburg, Germany

Kam Lun Ellis Hon, MBBS, MD, FAAP, FCCM, FHKCPaed, FHKAM(Paed) Honorary Professor Department of Paediatrics, The Chinese University of Hong Kong Consultant The Hong Kong Children’s Hospital Hong Kong

Paul J. Honig, MD Division of Dermatology Denver Children’s Hospital Denver, CO, USA Department of Pediatrics Perelman School of Medicine at the University of Pennsylvania Philadelphia, PA, USA

Kimberly A. Horii, MD Associate Professor of Pediatrics Division of Dermatology University of Missouri‐Kansas City School of Medicine Children’s Mercy‐Kansas City Kansas City, MO, USA

Jennifer Huang, MD Assistant Professor of Dermatology Dermatology Program Boston Children’s Hospital Boston, MA, USA

Devika Icecreamwala, MD Pediatric Dermatology Fellow Department of Dermatology Henry Ford Health System Detroit, MI, USA

Ying Liu, MD, PhD Associate Chief Physician Department of Dermatology Beijing Children’s Hospital Capital Medical University National Center for Children’s Health Beijing, China

Matilde Iorizzo, MD Private Dermatology Practice Bellinzona and Lugano Switzerland

Alan D. Irvine, MD, FRCPI, FRCP Professor Paediatric Dermatology Trinity College Dublin and Our Lady’s Children’s Hospital Dublin, Ireland

Sharon E. Jacob, MD Professor Department of Dermatology Loma Linda University Loma Linda, CA, USA

Scott H. James, MD Department of Paediatrics Division of Infectious Diseases University of Alabama Birmingham, AL, USA

Gregor B.E. Jemec, MD, DMSc Department of Dermatology Roskilde Hospital Roskilde, Denmark

Elizabeth A. Jones, MA MB, BChir, FRCP, PhD Consultant Clinical Geneticist Manchester Centre for Genomic Medicine St Mary’s Hospital Manchester University NHS Foundation Trust Manchester, UK Division of Evolution and Genomic Sciences Faculty of Biology Medicine and Health University of Manchester Manchester, UK

Teri A. Kahn, MD, MPH Associate Professor Department of Dermatology University of Maryland Baltimore, MD, USA

Sonia Kamath, MD Resident Physician Department of Dermatology Keck School of Medicine of University of Southern California Los Angeles, CA, USA

Ayşen Karaduman, MD Professor of Dermatology Hacettepe University School of Medicine Department of Dermatology Ankara, Turkey

Andreas Katsambas Professor of Dermatology Department of Dermatology Andreas Syggros Hospital University of Athens Greece

Roselyn Kellen, MD Resident Physician Icahn School of Medicine at Mount Sinai New York, NY, USA

Hilary Kennedy Clinical Nurse Specialist in Paediatric Dermatology Great Ormond Street Hospital London, UK

David W. Kimberlin, MD Department of Pediatrics Division of Infectious Diseases University of Alabama Birmingham, AL, USA

Veronica A. Kinsler, MA, MB, BChir, FRCPCH, PhD Professor of Paediatric Dermatology and Dermatogenetics Paediatric Dermatology Department Great Ormond Street Hospital for Children NHS Foundation Trust Genetics and Genomic Medicine UCL Great Ormond Street Institute of Child Health London, UK

Bruce R. Korf, MD, PhD Professor and Chairman of Department of Genetics University of Alabama at Birmingham Birmingham, AL, USA

Andrew C. Krakowski, MD Chief Department of Dermatology St Luke’s University Health Network Easton, PA, USA

Ann M. Kulungowski, MD Assistant Professor of Surgery and Pediatrics University of Colorado School of Medicine Surgical Director Vascular Anomalies Center Children’s Hospital Colorado Aurora, CO, USA

List of Contributors  xvii

Marc Lacour, MD Paediatrician Pediatric Dermatology Clinic Carouge, Switzerland

Bisola Laguda Consultant Paediatric Dermatology Chelsea and Westminster Hospital London, UK

Sinéad M. Langan, MD, PhD Associate Professor of Epidemiology Faculty of Epidemiology and Population Health London School of Hygiene and Tropical Medicine London, UK

Sean Lanigan, MD, FRCP, DCH Regional Medical Director sk:n Limited Birmingham, UK

Irene Lara‐Corrales, MD Associate Professor of Pediatrics Pediatric Dermatology Fellow Section of Dermatology Division of Paediatric Medicine Hospital for Sick Children University of Toronto Toronto, ON, Canada

Margarita Larralde, PhD, MD Head Dermatology Department Hospital Alemán Head Pediatric Dermatology Department Hospital Ramos Mejía Buenos Aires, Argentina

Ting Fan Leung, MBChB(CUHK), MD(CUHK), MRCP(UK), FRCPCH, FAAAAI, FHKCPaed, FHKAM(Paediatrics) Chairman and Professor Department of Paediatrics The Chinese University of Hong Kong Hong Kong

Michael Levin, FRCPCH, PhD Professor of Paediatrics and International Child Health Imperial College London London, UK

Moise L. Levy, MD Professor Department of Pediatrics Texas Children’s Hospital Baylor College of Medicine Houston, TX, USA Department of Pediatrics Dell Medical School/University of Texas and Dell Children’s Medical Center Austin, TX, USA

Rebecca Levy, MD, FRCPC Clinical Fellow Pediatric Dermatology University of Toronto The Hospital for Sick Children Toronto, ON, Canada

Susan Lewis‐Jones, FRCP, FRCPCH Honorary Consultant Dermatologist Ninewells Hospital & Medical School Dundee, UK

Carmen Liy Wong

Pediatrics and Pediatric Dermatology Cincinnati Children’s Hospital Cincinnati, OH, USA

David Luk, FHKAM(Paed), FHKCPaed, FRCPCH Consultant Paediatrician United Christian Hospital, Hong Kong Hong Kong Children’s Hospital Honorary Clinical Assistant Professor The Chinese University of Hong Kong The University of Hong Kong President Hong Kong Paediatric and Adolescent Dermatology Society

Jane Luker, BDS, PhD, FDSRCS Eng @ Edin DDR, RCR Consultant Dental Surgeon Bristol Dental Hospital University Hospitals Bristol NHS Foundation Trust Bristol, UK

Paula Carolina Luna, MD Dermatology Department Hospital Alemán Buenos Aires, Argentina

Minnelly Luu, MD Assistant Professor of Clinical Dermatology Department of Dermatology Keck School of Medicine of University of Southern California Los Angeles, CA, USA Division of Pediatric Dermatology Children’s Hospital Los Angeles Los Angeles, CA, USA

Lin Ma, MD, PhD

Pediatric Dermatology Fellow Section of Dermatology Division of Paediatric Medicine Hospital for Sick Children Toronto, ON, Canada

Professor, Director Department of Dermatology Beijing Children’s Hospital Capital Medical University National Center for Children’s Health Beijing, China

S. Leclerc‐Mercier, MD

Wilson Lopez, MBBS, MD, MRCP, FRCPCH, DCH, MSc

Reference Center for Rare and Inherited Skin Diseases (MAGEC) Departments of Dermatology and Pathology CHU Necker‐Enfants Malades Paris, France

Consultant Neonatologist Neonatal Unit Barking, Havering and Redbridge University Hospitals NHS Trust UK

Elia F. Maalouf, MBChB, MRCP, FRCPCH, MD

Theresa Ngan Ho Leung, MBBS, FRCPCH, FHKCPaed, FHKAM(Paed)

Christopher Lovell

Christine T. Lauren, MD Assistant Professor of Dermatology and Pediatrics Columbia University Medical Center New York, NY, USA

Clinical Associate Professor Department of Paediatrics and Adolescent Medicine The University of Hong Kong Hong Kong

Consultant Dermatologist Kinghorn Dermatology Unit Royal United Hospital Bath, UK

Anne W. Lucky, MD Adjunct Professor of Pediatrics and Dermatology Divisions of General and Community

Consultant in General Paediatrics and Neonatal Medicine Neonatal Unit Homerton University Hospital NHS Foundation Trust London, UK

Caroline Mahon, MD Consultant Paediatric Dermatologist Department of Dermatology Bristol Royal Infirmary University Hospitals Bristol NHS Foundation Trust Bristol, UK

xviii  List of Contributors

Melanie Makhija, MD, MSc

Jemima E. Mellerio, MD, FRDP

Assistant Professor of Pediatrics Department of Pediatrics Northwestern University Feinberg School of Medicine, Chicago, IL, USA

Consultant Dermatologist and Honorary Professor Paediatric Dermatology Department Great Ormond Street Hospital for Children NHS Trust and St John’s Institute of Dermatology Guy’s and St Thomas’ NHS Foundation Trust London, UK

Steven M. Manders, MD Professor of Medicine and Paediatrics Division of Dermatology University of Medicine and Dentistry of New Jersey Robert Wood Johnson Medical School Camden, NJ, USA

Julianne A. Mann, MD Assistant Professor of Dermatology Dartmouth‐Hitchcock Medical Center Lebanon, NH, USA

Ashfaq A. Marghoob, MD Department of Dermatology Memorial Sloan‐Kettering Cancer Center New York, NY, USA

Maria L. Marino, MD Department of Dermatology Memorial Sloan‐Kettering Cancer Center New York, NY, USA

Anna E. Martinez, FRCPCH Consultant Paediatric Dermatologist Paediatric Dermatology Department Great Ormond Street Hospital for Children NHS Trust London, UK

Peter Mayser, MD Professor of Dermatology Clinic of Dermatology, Allergology and Venereology Justus Liebig University (UKGM) Giessen, Germany

Juliette Mazereeuw‐Hautier, MD, PhD Professor of Dermatology Reference Center for Rare Skin Diseases Department of Dermatology CHU Larrey Toulouse, France

William H. McCoy IV, MD, PhD Resident Physician Division of Dermatology Department of Medicine Washington University School of Medicine St Louis, MO, USA

Bodo C. Melnik, MD Adjunct Professor of Dermatology Department of Dermatology, Environmental Medicine and Health Theory University of Osnabrück Osnabrück, Germany

Vibhu Mendiratta, MD Director and Professor Department of Dermatology Lady Hardinge Medical College and associated hospitals New Delhi, India

Dermatology Reference Center for Rare Skin Diseases Hôpital Saint André Bordeaux, France

Keith Morley, MD Paediatric Dermatology Fellow Dermatology Program Boston Children’s Hospital Boston, MA, USA

Dédée F. Murrell, MA(Cambridge), BMBCh (Oxford), FAAD(USA), MD (UNSW), FACD, FRCP(Edin) Head Department of Dermatology St George Hospital Professor of Dermatology University of New South Wales Sydney, NSW, Australia

Taizo A. Nakano, MD

Consultant Paediatric Dermatologist Chelsea and Westminster Hospital London, UK

Assistant Professor of Pediatrics University of Colorado School of Medicine Medical Director Vascular Anomalies Center Children’s Hospital Colorado Aurora, CO, USA

Christian R. Millett, MD

Iria Neri

Eirini E. Merika, MBBS, iBSc, MRCP Derm

Forefront Dermatology Vienna, VA, USA

Adnan Mir, MD, PhD Assistant Professor of Dermatology University of Texas Southwestern Medical Center and Children’s Medical Center Dallas Dallas, TX, USA

Amanda T. Moon, MD Departments of Pediatrics and Dermatology Perelman School of Medicine at the University of Pennsylvania Philadelphia, PA, USA Section of Dermatology Children’s Hospital of Philadelphia Philadelphia, PA, USA

Elena Moraitis, MBBS, PhD Consultant in Paediatric Rheumatology Infection, Inflammation and Rheumatology Section UCL Institute of Child Health London, UK Paediatric Rheumatology Department Great Ormond Street Hospital for Children NHS Foundation Trust London, UK

Fanny Morice‐Picard, MD, PhD Department of Dermatology and Paediatric

Professor of Dermatology Department of Specialized, Diagnostic and Experimental Medicine Division of Dermatology University of Bologna Bologna, Italy

Tuyet A. Nguyen, MD Kaiser Permanente Dermatology Los Angeles, CA, USA

Jeroen Novak GGZ Momentum Breda, The Netherlands

Susan O’Connell, MD Formerly Lyme Borreliosis Unit Health Protection Agency Microbiology Laboratory Southampton University Hospitals NHS Trust Southampton, UK

Cathal O’Connor, MD Paediatric Dermatology Trinity College Dublin and Our Lady’s Children’s Hospital Dublin, Ireland

Vinzenz Oji, MD Department of Dermatology University Hospital Münster Münster, Germany

List of Contributors  xix

Elise A. Olsen, MD

Aparna Palit, MD

Laura Polivka, MD, PhD

Professor of Dermatology and Medicine Director, Cutaneous Lymphoma Research and Treatment Center Director, Hair Disorders Research and Treatment Center Director, Dermatopharmacology Study Center Departments of Dermatology and Medicine Duke University Medical Center Durham, NC, USA

Professor Department of Dermatology Venereology and Leprosy Sri B.M.Patil Medical College Hospital & Research Centre BLDE University Vijayapur, Karnataka, India

Department of Dermatology Imagine Institute Necker‐Enfants Malades Hospital Paris, France

Amy S. Paller, MD, MSc

Consultant Clinical Geneticist West Midlands Regional Clinical Genetics Service Birmingham Women’s Hospital Birmingham, UK

Walter J. Hamlin Professor and Chair of Dermatology, Professor of Pediatrics Departments of Pediatrics and Dermatology Northwestern University Feinberg School of Medicine Chicago, IL, USA

Arnold P. Oranje, MD, PhD

Nirav Patel, MD

(Deceased) Professor of Pediatric Dermatology Kinderhuid.nl, Rotterdam, The Netherlands Hair Clinic, Breda, The Netherlands Dermicis Skin Clinic, Alkmaar, The Netherlands

Departments of Dermatology and Pediatrics Mayo Clinic Rochester, MN, USA

Kai Ren Ong, MD, MRCP

Luz Orozco‐Covarrubias, MD Paediatric Dermatologist and Associated Professor of Pediatric Dermatology Universidad Nacional Autonoma de México Attending Physician Department of Pediatric Dermatology National Institute of Paediatrics of Mexico Mexico City, Mexico

Edel A. O’Toole, MB, PhD, FRCP, FRCPI Professor of Molecular Dermatology and Honorary Consultant Dermatologist Department of Dermatology Royal London Hospital Barts Health NHS Trust and Centre for Cell Biology and Cutaneous Research Barts and the London School of Medicine and Dentistry London, UK

Hagen Ott, MD Head of the Division of Pediatric Dermatology and Allergology Epidermolysis Bullosa Centre Hannover Children’s Hospital AUF DER BULT Hannover, Germany

Seza Özen, MD Professor of Pediatrics Hacettepe University School of Medicine Department of Pediatric Rheumatology Ankara, Turkey

David G. Paige, MBBS, MA, FRCP Consultant Dermatologist Department of Dermatology, Bart’s and The London NHS Trust London, UK

Annalisa Patrizi, MD Professor Head of Dermatology Department of Specialized, Diagnostic and Experimental Medicine, Division of Dermatology University of Bologna Bologna, Italy

Marissa J. Perman, MD Assistant Professor of Pediatrics and Dermatology Children’s Hospital of Philadelphia and The University of Pennsylvania Philadelphia, PA, USA

Karen Pett Clinical Nurse Specialist in Paediatric Dermatology West Hertfordshire Hospitals NHS Trust St Albans, UK

Roderic J. Phillips, BSc(Hons), MBBS, PhD, FRACP, AMAM, CIRF Associate Professor Paediatric Dermatologist Royal Children’s Hospital Honorary Research Fellow Murdoch Children’s Research Institute Adjunct Professor Paediatrics Monash University Melbourne, VIC, Australia

Bianca Maria Piraccini, MD, PhD Dermatology Department of Experimental, Diagnostic and Specialty Medicine University of Bologna Bologna, Italy

Elena Pope, MSc, FRCPC Professor of Paediatrics University of Toronto Fellowship Director and Section Head Paediatric Dermatology The Hospital for Sick Children Toronto, ON, Canada

Julie Powell, MD, FRCPC Director Pediatric Dermatology Professor of Dermatology (Pediatrics) Division of Dermatology Department of Pediatrics CHU Sainte‐Justine University of Montreal Montreal, QC, Canada

Julie S. Prendiville, MBBCH, DCH, BAO, FRCPC Chief Pediatric Dermatology Sidra Medicine Doha, Qatar

Cecilia A.C. (Sanna) Prinsen, PhD VU University Medical Center Department of Epidemiology and Biostatistics Amsterdam Public Health Research Institute Amsterdam, The Netherlands

Lori Prok, MD Associate Professor of Dermatology and Pathology University of Colorado Denver and Children’s Hospital Colorado Denver, CO, USA

Neil S. Prose, MD Professor Department of Pediatrics and Dermatology Duke University Medical Center Research Professor of Global Health, Duke Global Health Institute Co‐Director, Duke Health Humanities Lab Durham, NC, USA

Diana Purvis, MB ChB, MRCPCH, FRACP Paediatric Dermatologist Starship Children’s Hospital Honorary Senior Lecturer Department of Paediatrics University of Auckland Auckland, New Zealand

xx  List of Contributors

Marius Rademaker, BM, FRCP(Edin), FRACP, DM Clinical Director Dermatology Department Waikato District Health Board Hon Associate Professor Waikato Clinical Campus Faculty of Medical and Health Sciences The University of Auckland Hamilton, New Zealand

Marc Alexander Radtke, MD Professor Institute for Health Services Research in Dermatology and Nursing (IVDP) University Medical Center Hamburg‐ Eppendorf (UKE) Hamburg, Germany

V. Ramesh, MD Professor of Dermatology Department of Dermatology Vardhman Mahavir Medical College & Safdarjung Hospital New Delhi, India

Gudrun Ratzinger, MD Professor of Dermatology Department of Dermatology, Venereology and Allergology Medical University Innsbruck Austria

Wingfield E. Rehmus, MD Clinical Assistant Professor Department of Pediatrics University of British Columbia and British Columbia’s Children’s Hospital Vancouver, BC, Canada

Sean D. Reynolds, MB BCh, BAO Department of Dermatology Warren Alpert Medical School of Brown University Providence, RI, USA

Nerys Roberts, MD, FRCP, MRCPCH, BSc Consultant Paediatric Dermatologist Chelsea & Westminster Hospital London, UK

Jean Robinson Clinical Nurse Specialist in Paediatric Dermatology Royal London Hospital London, UK

Elke Rodriguez, PhD Senior Researcher Department of Dermatology, Allergology and Venereology University Hospital Schleswig‐Holstein Campus Kiel Kiel, Germany

Marcelo Ruvertoni, MD

Julien Seneschal, MD, PhD

Paediatric Dermatologist and Paediatrician British Hospital Montevideo, Uruguay

Professor Department of Dermatology and Paediatric Dermatology Reference Center for Rare Skin Diseases Hôpital Saint André Bordeaux, France

Liat Samuelov, MD Vice Chair Department of Dermatology Tel Aviv Sourasky Medical Center Tel Aviv, Israel

Sarita Sanke, MD Dermatology and STD Lady Hardinge Medical College and associated hospitals New Delhi, India

Julie V. Schaffer, MD Associate Professor of Pediatrics Division of Pediatric and Adolescent Dermatology Hackensack University Medical Center Hackensack, NJ, USA

Birgitta Schmidt, MD Department of Pathology Boston Children’s Hospital Harvard Medical School Boston, MA, USA

Enno Schmidt, MD, PhD Professor of Dermatology Lübeck Institute of Experimental Dermatology (LIED) Lübeck, Germany

Steffen Schubert Department of Dermatology, Venereology and Allergology University Medical Center Göttingen Göttingen, Germany

Crispian Scully, CBE, DSc, DChD, DMed (HC), Dhc (multi), MD, PhD, PhD (HC), FMedSci, MDS, MRCS, BSc, FDSRCS, FDSRCPS, FFDRCSI, FDSRCSEd, FRCPath, FHEA

G. Sethuraman, MD Professor of Dermatology Department of Dermatology All India Institute of Medical Sciences New Delhi, India

Marieke M.B. Seyger, MD, PhD Associate Professor of Dermatology Department of Dermatology Radboud University Medical Center Nijmegen, The Netherlands

Lindsay Shaw, MBBS, MRCPCH Consultant in Paediatric Rheumatology Paediatric Dermatology Great Ormond Street Hospital for Children NHS Foundation Trust London and Bristol Children’s Hospital Bristol UK

Neil Shear, MD, FRCPC, FACP Professor of Medicine and Pharmacology Division of Dermatology Sunnybrook Health Sciences Center and University of Toronto Toronto, ON, Canada

Tor A. Shwayder, MD Director Pediatric Dermatology Department of Dermatology Henry Ford Hospital Detroit, MI, USA

Brenda M. Simpson Dermatologist El Paso Dermatology Center El Paso, TX, USA

Robert Sidbury, MD, MPH

(Deceased) Emeritus Professor of Oral Medicine at UCL Bristol Dental Hospital University Hospitals Bristol NHS Foundation Trust Bristol, UK University College London London, UK

Professor Department of Pediatrics Chief Division of Dermatology Seattle Children’s Hospital University of Washington School of Medicine Seattle, WA, USA

Robert K. Semple, PhD, FRCP

Jonathan I. Silverberg, MD, PhD

Professor of Translational Molecular Medicine Centre for Cardiovascular Sciences, Queens Medical Research Institute University of Edinburgh Edinburgh, UK

Associate Professor of Dermatology Northwestern University Feinberg School of Medicine Chicago, IL, USA

List of Contributors  xxi

Nanette Silverberg, MD

Peter M. Steijlen, MD, PhD

Amy Theos, MD

Clinical Professor of Dermatology Icahn School of Medicine at Mount Sinai Chief Pediatric Dermatology Mount Sinai Health System Director Pediatric and Adolescent Dermatology Department of Dermatology New York, NY, USA

Professor of Dermatology and Chair Department of Dermatology Maastricht University Medical Center Maastricht, The Netherlands

Associate Professor of Department of Dermatology University of Alabama at Birmingham Birmingham, AL, USA

Jane C. Sterling, MB, BChir, MA, FRCP, PhD

Peter Theut Riis, MD

Eric L. Simpson, MD Professor of Dermatology School of Medicine Department of Dermatology Oregon Health and Science University Portland, OR, USA

Manuraj Singh, MBBS, MRCP, PhD, DipRCPath (Dermpath) Consultant Dermatologist and Dermatopathologist St George’s University Hospitals London, UK

Nedaa Skeik, MD, FACP, FSVM, RPVI Associate Professor of Medicine Section Head, Vascular Medicine Department Medical Director, Thrombophilia & Anticoagulation Clinic Medical Director, Hyperbaric Medicine Medical Director, Vascular Laboratories Minneapolis Heart Institute at Abbott Northwestern Hospital – part of Allina Health Minneapolis, MN, USA

Lea Solman, MD, FRCPCH Consultant Paediatric Dermatologist Department of Paediatric Dermatology Great Ormond Street Hospital for Children NHS Trust London, UK

Eli Sprecher, MD, PhD Professor and Chair Department of Dermatology and Deputy Director General for Patient Safety Tel Aviv Sourasky Medical Center Frederick Reiss Chair of Dermatology Sackler Faculty of Medicine Tel Aviv University Tel Aviv, Israel

Sahana M. Srinivas, DNB, DVD, FRGUHS (Paediatric Dermatology) Consultant Paediatric Dermatologist Department of Pediatric Dermatology Indira Gandhi Institute of Child Health Bangalore, Karnataka, India

Paola Stefano, MD Assistant Physician Dermatology Department Hospital de Pediatría ‘Prof. Dr. Juan P. Garrahan’ Buenos Aires, Argentina

Consultant Dermatologist Department of Dermatology Cambridge University Hospitals NHS Foundation Trust Addenbrooke’s Hospital Cambridge, UK

Jenna L. Streicher, MD Clinical Assistant Professor Department of Pediatrics, Dermatology Section Children’s Hospital of Philadelphia Departments of Pediatrics and Dermatology Perelman School of Medicine at the University of Pennsylvania Philadelphia, PA, USA

V. Reid Sutton, MD Professor Department of Molecular and Human Genetics Baylor College of Medicine and Texas Children’s Hospital Houston, TX, USA

Samira Batul Syed, MBBS, DCH, DCCH, RCPEd, RCGP, FCM, BTEC Adv LASER, DPD Associate Specialist in Paediatrics Dermatology Great Ormond Street Hospital for Children NHS Trust London, UK

Zsuzsanna Z. Szalai, MD Professor and Head Department of Pediatric Dermatology Heim Pál Children’s Hospital Budapest, Hungary

Alain Taïeb, MD, PhD Professor of Dermatology Department of Dermatology and Paediatric Dermatology, Reference Center for Rare Skin Diseases Hôpital Saint André Bordeaux, France

Carolina Talhari, MD, PhD Adjunct Professor of Dermatology Amazon State University Manaus, AM, Brazil

Martin Theiler, MD Paediatric Dermatology Department University Children’s Hospital Zurich Switzerland

Department of Dermatology Roskilde Hospital Roskilde, Denmark

Anna C. Thomas, BSc, PhD Post‐doctoral Research Associate Genetics and Genomic Medicine UCL Great Ormond Street Institute of Child Health London, UK

Megha Tollefson, MD Departments of Dermatology and Pediatrics Mayo Clinic Rochester, MN, USA

Wynnis L. Tom, MD Associate Clinical Professor of Dermatology and Pediatrics University of California, San Diego Rady Children’s Hospital San Diego, CA, USA

Yun Tong, MD Clinical Research Fellow Department of Dermatology, University of California San Diego San Diego, CA, USA

Helga V. Toriello, PhD Professor Department of Pediatrics/Human Development Michigan State University College of Human Medicine Grand Rapids, MI, USA

Antonio Torrelo, MD Head Department of Dermatology Hospital Infantil del Niño Jesús Madrid, Spain

Antonella Tosti, MD Department of Dermatology and Cutaneous Surgery Miller Medical School University of Miami Miami, FL, USA

James R. Treat, MD Associate Professor of Clinical Pediatrics and Dermatology Fellowship Director, Pediatric Dermatology Education Director, Pediatric Dermatology Children’s Hospital of Philadelphia Dermatology Section Perelman School of Medicine at the University of Pennsylvania Philadelphia, PA, USA

xxii  List of Contributors

Stephen K. Tyring, MD, PhD

Peter von den Driesch, MD

Clinical Professor Department of Dermatology University of Texas Health Science Center at Houston Houston, TX, USA

Professor of Dermatology Head Center for Dermatology Klinikum Stuttgart Stuttgart, Germany

Nina van Beek, MD

Amy Walker, MRes, BSc

Department of Dermatology University of Lübeck Lübeck, Germany

Experimental and Personalised Medicine UCL Great Ormond Street Institute of Child Health London, UK

Ignatia B. Van den Veyver, MD Professor Departments of Obstetrics and Gynecology and Molecular and Human Genetics Director of Clinical Prenatal Genetics BCM and Texas Children’s Hospital Pavilion for Women Investigator Jan and Dan Duncan Neurological Research Institute at Texas Children’s Hospital Baylor College of Medicine Houston, TX, USA

Maurice A.M. van Steensel, MD, PhD Professor of Dermatology and Skin Biology Lee Kong Chian School of Medicine Singapore Research Director Skin Research Institute of Singapore Singapore

Felipe Velasquez, MD Consultant in Pediatric Dermatology Department of Pediatric Dermatology Instituto de Salud del Niño Lima, Peru

Paul Veys Director Bone Marrow Transplantation Unit Great Ormond Street Hospital for Children NHS Trust London, UK

Miikka Vikkula, MD, PhD Head of Laboratory of Human Molecular Genetics de Duve Institute University of Louvain Brussels, Belgium

Beatrix Volc‐Platzer, MD Professor of Dermatology Department of Dermatology Donauspital SMZ Ost Vienna, Austria

Lachlan Warren Consultant Dermatologist Department of Dermatology Women’s & Children’s Hospital Adelaide, SA, Australia

Joy Wan, MD, MSCE Postdoctoral Fellow of Dermatology Department of Biostatistics and Epidemiology University of Pennsylvania Perelman School of Medicine Philadelphia, PA, USA

Siriwan Wananukul, MD Professor of Paediatrics Head of Department of Paediatrics Faculty of Medicine Chulalongkorn University Bangkok, Thailand

Miriam Weinstein, BSc, BScN, MD, FRCPC (Paediatrics) FRCPC (Dermatology) Department of Paediatrics Hospital for Sick Children Toronto, ON, Canada

Pamela F. Weiss, MD, MSCE Associate Professor of Pediatrics and Epidemiology Divison of Rheumatology Children’s Hospital of Philadelphia Center for Clinical Epidemiology and Biostatistics University of Pennsylvania Philadelphia, PA, USA

Alexis Weymann Perlmutter, MD Resident Department of Dermatology Geisinger Medical Center PA, USA

Lizbeth Ruth Wheeler Department of Dermatology St George Hospital and University of New South Wales Sydney, NSW, Australia

Hywel C. Williams, MD, PhD

Brookline Dermatology Associates West Roxbury MA, USA

Director of the NIHR Health Technology Assessment Programme Co‐Director of the Centre of Evidence Based Dermatology University of Nottingham Nottingham, UK

Lisa L. Wang, MD

Lara Wine Lee, MD, PhD

Associate Professor Department of Pediatrics Texas Children’s Hospital Baylor College of Medicine Houston, TX, USA

Departments of Dermatology and Pediatrics Medical University of South Carolina Charleston, SC, USA

Andrew Wang, MD

Bettina Wedi, MD, PhD Professor of Dermatology Department of Dermatology and Allergology Hannover Medical School Hannover, Germany

Marion Wobser, MD Department of Dermatology, Venereology and Allergology University Hospital Würzburg Würzburg, Germany

Johannes Wohlrab, MD

Paediatric Dermatology Department University Children’s Hospital Zurich Switzerland

Professor of Dermatology Department of Dermatology and Venereology and Institute of Applied Dermatopharmacy Martin‐Luther‐University Halle‐Wittenberg Halle (Saale), Germany

Stephan Weidinger, MD

A. Wolkerstorfer, MD, PhD

Professor of Dermatology Deputy Head Department of Dermatology, Allergology and Venereology University Hospital Schleswig‐Holstein Campus Kiel Kiel, Germany

Netherlands Institute for Pigment Disorders Amsterdam University Medical Centers Amsterdam, The Netherlands

Lisa Weibel, MD

List of Contributors  xxiii

Heulwen Wyatt

Albert C. Yan, MD, FAAP, FAAD

Clinical Nurse Specialist in Paediatric Dermatology Dermatology Unit St Woolos Hospital, Newport, UK

Section of Dermatology Children’s Hospital of Philadelphia Philadelphia, PA, USA Departments of Pediatrics and Dermatology Perelman School of Medicine at the University of Pennsylvania Philadelphia, PA, USA

Yuanyuan Xiao, MD Associate Chief Physician Department of Dermatology Beijing Children’s Hospital Capital Medical University National Center for Children’s Health Beijing, China

Kevin B. Yarbrough, MD Staff Physician Department of Pediatric Dermatology Phoenix Children’s Hospital Phoenix, AZ, USA

Zhe Xu, MD, PhD

Vijay Zawar, MD

Chief Physician Department of Dermatology Beijing Children’s Hospital Capital Medical University National Center for Children’s Health Beijing, China

Skin Diseases Centre Nashik, India Professor Department of Dermatology MVP’s Dr Vasantrao Pawar Medical College and Research Centre Nashik, Maharashtra, India

Bernhard W.H. Zelger, MD, MSc Professor of Dermatology Department of Dermatology, Venereology and Allergology Medical University Innsbruck Austria

xxiv 

Preface to the Fourth Edition

It is with much delight and pride that we present the fourth edition of this textbook. The new edition continues to provide state‐of‐the‐art information on all aspects of skin disease in children. Existing content has been refreshed and fully updated to reflect emerging thinking and to incorporate the latest in research and clinical data  –  especially at the genetic level. The three Editors, two Editorial Advisors and five Associate Editors from across the world bring a truly global perspective to the work. Some 31 countries are represented by 313 contributors, of whom 192 are new contributors, who have extensively updated or completely rewritten the 177 chapters. The book represents a definitive reference text for dermatologists, paediatricians, clinician scientists, research workers and all other individuals involved in the care of children with skin disease.

The fourth edition appears at a time when digital instant access to information, retrievable anywhere and at anytime, is the norm. Nevertheless, the value of having a physical textbook to read and study remains an integral part of clinical practice and academia; but, in order to keep up to date, the book will also be accessible online on an interactive platform via laptops and smartphones. The book’s virtue is, in our opinion, its comprehensiveness and in‐depth information written by international experts on each subject. We hope that this fourth edition will be as warmly received as its three predecessors and will contribute to the improved care of children with skin diseases. PH VK AY JIH

 xxv

Dedication

In memory of Arnold P. Oranje, 1948–2016

This 4th edition of the textbook is dedicated to my dear friend and colleague Arnold Oranje. Arnold’s untimely death shocked us all and is a great loss to the world of paediatric dermatology. He was one of the three original editors of this book, with Neil Prose and myself, and was working on this edition at the time of his death. On a personal note, my collaboration with Arnold was unique: his enthusiasm, passion for the subject, expertise and exuberant laughter made him a joy to work with. I hope that Arnold would be immensely proud of this new edition. John Harper

Taïeb A, Stalder J‐F, de Waard‐van der Spek F, Harper J. In Memoriam: Arnold P. Oranje. Pediatr Dermatol 2017; 34: 231–4.

xxvi 

Acknowledgements

We wish to thank the following people: the Associate Editors and chapter authors for their invaluable contribution to the book; the editorial staff and production staff at Wiley‐Blackwell, freelance project editor, Alison Nick, project manager, Nik Prowse, and the copy-editors for their tireless efforts; the families who gave permission for the photographs of their children to be used in this book and our own families for their understanding and support.

However, the biggest thank you has to be to our patients who provide the inspiration and motivation for our work on a daily basis. PH VK AY JIH

 xxvii

List of Abbreviations

AA AA AAD AAV AAV

alopecia areata amyloid A American Academy of Dermatology adeno‐associated virus antineutrophil cytoplasmic antibody (ANCA)‐ associated vasculitides ABC ATP‐binding cassette ACA acrodermatitis chronica atrophicans anticentromere antibodies ACA aplasia cutis congenita ACC ACD allergic contact dermatitis ACD amyloidosis cutis dyschromica ACE angiotensin‐converting enzyme aCGH array‐comparative genomic hybridization ACR American College of Rheumatology ACS Aicardi–Goutiéres syndrome adrenocorticotropic hormone ACTH atopic dermatitis AD AD autosomal dominant ADA adenosine deaminase ADCL autosomal dominant cutis laxa ADCL anergic diffuse cutaneous leishmaniasis attention deficit hyperactivity disorder ADHD ADR adverse drug reaction atypical dermal melanocytosis ADM ADULT acro‐dermato‐ungual‐lacrimal‐tooth autosomal‐dominant woolly hair ADWH AEC ankyloblepharon, ectodermal defects and cleft lip/ palate AEDS atopic eczema/dermatitis syndrome annular epidermolytic ichthyosis AEI AFB acid‐fast bacilli AGA androgenetic alopecia AGEP acute generalized exanthematous pustulosis aGVHD acute GVHD AGL acquired generalized lipoatrophy acrylate gelling material AGM AHA American Heart Association AHA antihistone antibody AHEI acute haemorrhagic oedema of infancy AHO Albright hereditary osteodystrophy abusive head trauma AHT AID autoinflammatory disease AIDS acquired immune deficiency syndrome AIP acute intermittent porphyria ALHE angiolymphoid hyperplasia with eosinophilia ALL acute lymphoblastic leukaemia ALN actinic lichen nitidus ALP actinic lichen planus ALT alanine transaminase ALU aphthous‐like ulceration AML acute myeloid leukaemia

AMMoL acute myelomonocytic leukaemia AMN acquired melanocytic naevi AMoL acute monocytic leukaemia AMP antimicrobial peptide adenosine monophosphate‐activated protein kinase AMPK AN acanthosis nigricans ANA antinuclear antibody ANCA antineutrophilic cytoplasmic antibody AP actinic prurigo AP adaptor protein complex AP anteroposterior antigen‐presenting cell APC APECED autoimmune polyendocrinopathy–candidiasis– ectodermal dystrophy (syndrome) acquired partial lipoatrophy APL atrichia with papular lesions APL APP atrophoderma of Pasini and Pierini APS antiphospholipid antibody syndrome APSS acral peeling skin syndrome AR androgen receptor autosomal recessive AR ARC arthrogryposis–renal dysfunction–cholestasis (syndrome) autosomal recessive congenital ichthyosis ARCI ARCL autosomal recessive cutis laxa ARD adult Refsum disease AR‐HIES autosomal recessive hyperimmunoglobulin E syndrome ARKID autosomal recessive keratoderma ichthyosis and deafness (syndrome) amplification‐refractory mutation system ARMS ASD autism spectrum disorders aggressive systemic mastocytosis ASM ASO antistreptolysin O ASPS alveolar soft part sarcoma ASST autologous serum skin test AST aspartate transaminase AST aspartate aminotransferase AT ataxia telangiectasia ATG anti‐thymocyte globulin ATGL adipose triglyceride lipase ATP adenosine triphosphate ATPase adenosine triphosphatase ATS arterial tortuosity syndrome ATT antitubercular therapy AUC area under the concentration‐time curve AUG acute ulcerative gingivitis AV arteriovenous AVF arteriovenous fistula AVM arteriovenous malformations AV atrophoderma vermiculata AZA azathioprine

xxviii  List of Abbreviations BAL bronchoalveolar lavage BB β‐blockers BCC basal cell carcinoma BCG bacillus Calmette–Guérin BCIE bullous congenital ichthyosiform erythroderma BD Behçet disease BDCS Bazex–Dupré–Christol syndrome BDD blistering distal dactylitis BDNG British Dermatological Nursing Group BER base excision repair BGS Baller–Gerold syndrome BHDS Birt–Hogg–Dubé syndrome BHPR British Health Professionals in Rheumatology BMD bone mineral density BMI body mass index BMP bone morphogenetic protein BMT bone marrow transplantation BO branchio‐otic BOR branchio‐oto‐renal BOS Buschke–Ollendorff syndrome BP blood pressure BP bullous pemphigoid BRBN blue rubber bleb naevus BRRS Bannayan–Riley–Ruvalcaba syndrome BS Bloom syndrome BSA body surface area BSCL Berardinelli–Seip congenital lipodystrophy BSI bathing suit ichthyosis BSLE benign summer light eruption BSR British Society for Rheumatology BSS Brooke–Spiegler syndrome BTK Bruton tyrosine kinase BV bacterial vaginitis BWS Beckwith–Wiedemann syndrome CA condyloma acuminata CAD chronic actinic dermatitis CADIS Childhood Atopic Dermatitis Impact Scale C‐ALCL cutaneous anaplastic large cell lymphoma CALM café‐au‐lait macules CAM cell adhesion molecule CA‐MRSA community‐associated meticillin‐resistant Streptococcus aureus CAN child abuse and neglect c‐ANCA cytoplasmic antineutrophil cytoplasmic antibody CANDLE chronic atypical neutrophilic dermatosis with lipodystrophy and elevated temperature CAPS cryopyrin‐associated autoinflammatory syndromes CAT cutaneovisceral angiomatosis with thrombocyopenia CAVB complete atrioventricular block CAVM capillary–arteriolovenular malformations CBCL cutaneous B‐cell lymphoma CBS cystathionine β‐synthase CCA congenital contractural arachnodactyly CCC congenital cutaneous candidiasis CCTN cerebriform connective tissue naevi CD coeliac disease CDLQI Children’s Dermatology Life Quality Index CDP chondrodysplasia punctata CDPX2 X‐linked dominant chondrodysplasia punctata CDS Chanarin–Dorfman syndrome CE cell envelope CEA carcinoembryonic antigen CEDNIK cerebral dysgenesis, neuropathy, ichthyosis, keratoderma (syndrome) CEP congenital erythropoietic porphyria CEVD congenital erosive and vesicular dermatosis (with reticulated supple scarring) CFCS cardiofaciocutaneous syndrome CFTR cystic fibrosis transmembrane conductance regulator

CFU CGD CGH CGL CGRP CGS cGVHD CH CHAND

colony‐forming unit chronic granulomatous disease comparative genomic hybridization congenital generalized lipodystrophy calcitonin gene‐related product contiguous gene syndrome chronic graft versus host disease congenital haemangiomas curly hair, ankyloblepheron, nail dysplasia (syndrome) CHCC Chapel Hill Consensus Conference CHH Conradi–Hünermann–Happle syndrome CHH cartilage hair hypoplasia CHIKV Chikungunya virus CHILD congenital hemidysplasia with ichthyosiform erythroderma and limb defect (syndrome) CHIME colobomas, congenital heart disease, early‐onset ichthyosiform dermatosis, mental retardation and ear abnormalities CHP cytophagic histiocytic panniculitis CHRPE congenital hypertrophy of the retinal pigment epithelium CHS Chédiak–Higashi syndrome CI congenital ichthyoses CIAD Childhood Impact of Atopic Dermatitis CID combined immunodeficiency CIE congenital ichthyosiform erythroderma CIL‐F congenital infiltrating lipomatosis of the face CL cutaneous leishmaniasis CLM cutaneous larva migrans CLOVE congenital lipomatous overgrowth, vascular malformations and epidermal naevi (syndrome) CLQI Children’s Life Quality Index CLSM confocal laser scanning microscopy CM capillary malformation CM cutaneous mastocytosis CM‐AVM capillary malformation‐arteriovenous malformation CMC chronic mucocutaneous candidiasis CML chronic myeloid leukaemia CMN congenital melanocytic naevi CMN congenital mesoblastic nephroma CMO carotenoid 15,15′‐mono‐oxygenase CMRDS constitutional mismatch repair deficiency syndrome CMTC cutis marmorata telangiectatica congenita CMV cytomegalovirus CNS central nervous system CNTP connective tissue naevus of the proteoglycan type CNV copy number variations CoA co‐enzyme A C1‐INH C1‐esterase inhibitor CoNS coagulase‐negative Staphylococcus COFS cerebro‐oculo‐facio‐skeletal CPAP continuous positive airway pressure CRP C‐reactive protein CRIE congenital reticular ichthyosiform erythroderma CRISPR clustered regularly interspaced palindromic repeats CPD cyclobutanepyrimidine dimers CS Cockayne syndrome CS Costello syndrome CSA child sexual abuse CSD cat scratch disease CSF cerebrospinal fluid CSMH congenital smooth muscle hamartoma CST Christ–Siemens–Touraine CT Chlamydia trachomatis CT computed tomography CTCL cutaneous T‐cell lymphoma CTGF connective tissue growth factor CTN connective tissue naevi

List of Abbreviations  xxix CTL cytotoxic T‐lymphocyte CTLA‐4 cytotoxic T‐lymphocyte antigen‐4 CVG cutis verticis gyrata CVID common variable immunodeficiency CVS chorionic villus sampling CVS congenital varicella syndrome CVST cerebral venous sinus thrombosis Cx connexin DADA2 deficiency of adenosine deaminase type 2 DASI Dyshidrotic Eczema Area and Severity Index DBPCDC double‐blind placebo‐controlled drug challenge DBS DeBarsy syndrome DC dyskeratosis congenita DCM diffuse cutaneous mastocytosis dcSSc diffuse cutaneous systemic sclerosis DD Darier disease DDD Dowling–Degos disease DDEB dominant dystrophic epidermolysis bullosa DE dermoepidermal DEB dystrophic epidermolysis bullosa DEJ dermoepidermal junction DEPPK diffuse epidermolytic palmoplantar keratoderma DFA direct fluorescent antibody DFI Dermatitis Family Impact DFSP dermatofibrosarcoma protuberans DG1 DGI disseminated gonoccocal infection DGS DiGeorge syndrome DH dermatitis herpetiformis DHEA dihydroepiandrosterone DHEAS dihydroepiandrosterone sulphate DI dentinogenensis imperfecta DIF direct immunofluorescence DIHS/AHS drug‐induced or anticonvulsant hypersensitivity syndrome DIRA deficiency of the IL‐1 receptor antagonist DKS dyskeratosis congenita DLE discoid lupus erythematosus DMARD disease modifying antirheumatic drugs DMEG dysplastic megalencephaly DMSA dimercaptosuccinic acid DMSO dimethyl sulphoxide DNEPPK diffuse nonepidermolytic palmoplantar keratoderma DOC disorders of cornification DOPA dihydroxyphenylalanine DP dyschromatosis ptychotropica DPR dermatopathia pigmentosa reticularis DRESS drug rash with eosinophilia and systemic symptoms DSAP disseminated superficial actinic porokeratosis DSH dyschromatosis symmetrica hereditaria DSP disseminated superficial porokeratosis DTE desmoplastic trichoepithelioma DUH dyschromatosis universalis hereditaria DVA developmental venous anomaly DVT deep vein thrombosis EAACI European Academy of Allergy and Clinical Immunology EASI Eczema Area and Severity Index EB epidermolysis bullosa EBA epidermolysis bullosa acquisita EBP emopamil binding protein EBV Epstein–Barr virus EBS epidermolysis bullosa simplex EBS‐DM epidermolysis bullosa simplex Dowling–Meara EBS‐MP epidermolysis bullosa simplex with mottled pigmentation ECCL encephalocraniocutaneous lipomatosis ECF eosinophil chemotactic factor ECG electrocardiogram ECHO enteric cytopathic human orphan

ECM1 extracellular matrix protein 1 ECP eosinophil cationic protein ECP extracorporeal photopheresis ED ectodermal dysplasia EDA ectodysplasin‐A EDP erythema dyschromicum perstans EDS Ehlers–Danlos syndrome EDTA ethylenediaminetetraacetic acid EDV epidermodysplasia verruciformis EEC ectrodactyly, ectodermal dysplasia and cleft lip/ palate EED erythema elevatum diutinum EEG electroencephalogram EF eosinophilic fasciitis EGA estimated gestational age EGF epidermal growth factor EGFR epidermal growth factor receptor EGPA eosinophilic granulomatosis with polyangiitis EGW external genital wart EH eczema herpeticum EH epithelioid haemangioma EHK epidermolytic hyperkeratosis EI epidermolytic ichthyosis EIA enzyme immunoassay EIB erythema induratum of Bazin EKA erythrokeratoderma with ataxia EKC erythrokeratoderma en cocardes EKV erythrokeratoderma variabilis EKVP erythrokeratoderma variabilis progressiva ELISA enzyme‐linked immunosorbent assay EM erythema migrans EM erythema multiforme EMG electromyogram EMLA eutectic mixture of local anaesthetics EMS electromagnetic spectrum EN epidermal naevus EN erythema nodosum EN‐D epidermal naevus – Darier type ENDA European Network for Drug Allergy ENS epidermal naevus syndrome ENT ear, nose and throat EORTC European Research and Treatment of Cancer EOS early‐onset sarcoidosis EP eccrine poroma EPDS erosive pustular dermatosis of the scalp EPI eosinophilic pustulosis of infancy EPF eosinophilic pustular folliculitis EPP erythropoietic protoporphyria ER endoplasmic reticulum ERA enthesitis‐related arthritis ES epithelioid sarcoma ESPD European Society of Pediatric Dermatology ESR erythrocyte sedimentation rate ESRD end‐stage renal disease ET exfoliative toxin ETN erythema toxicum neonatorum EULAR European League Against Rheumatism EV eczema vaccinatum EV enteroviruses EV epidermodysplasia verruciformis EV‐HPV epidermodysplasia verruciformis‐associated human papillomavirus FADH fatty alcohol dehydrogenase FAE fumaric acid ester FALDH fatty aldehyde dehydrogenase FAP familial adenomatous polyposis FAO fibroadipose hyperplasia or overgrowth FATP fatty acid transport protein FC familial cylindromatosis

xxx  List of Abbreviations FDA FDE FDEIA

US Food and Drug Administration fixed drug eruptions food‐dependent exercise‐induced urticaria/ anaphylaxis FDH focal dermal hypoplasia FFD Fox–Fordyce disease FFDD focal facial dermal dysplasias FFM focus‐floating microscopy FFP fresh frozen plasma FFPE formalin‐fixed paraffin‐embedded FGFR fibroblast growth factor receptor FH familial hypercholesterolaemia FHL familial haemophagocytic lymphohistiocytosis FII fabricated or induced illness FISH fluorescence in situ hybridization FITC fluorescein isothiocyanate 5‐FU 5‐fluorouracil FMF familial Mediterranean fever FML familial multiple lipomatosis FNAC fine needle aspiration cytology FOP fibrodysplasia ossificans progressiva FPHH familial progressive hyperpigmentation and hypopigmentation FPLD familial partial lipodystrophies FSH follicle‐stimulating hormone FTC familial tumoural calcinosis FTG full‐thickness skin graft FTI farnesyltransferase inhibitors FVC forced vital capacity GA granuloma annulare GABA γ‐aminobutyric acid GACI generalized arterial calcification of infancy GAS Group A Streptococcus GBFDE generalized bullous fixed drug eruption GCDFP gross cystic disease fluid protein GCS Giannott—Crosti syndrome GD Gaucher disease GFR glomerular filtration rate GGR global genome repair GGT gamma‐glutamyl transpeptidase GH growth hormone GI gastrointestinal GLA generalized lymphatic anomaly GM‐CSF granulocyte macrophage colony‐stimulating factor GMS Gomori’s methenamine silver GNCST granular nerve cell sheath tumour GO geroderma osteodysplastica GOSH Great Ormond Street Hospital for Children GPA granulomatosis with polyangiitis GPP generalized pustular psoriasis GPS Griscelli–Prunieras syndrome GS Griscelli syndrome GSD Gorham–Stout disease GSE gluten‐sensitive enteropathy G6PD glucose‐6‐phosphate dehydrogenase GSS granulomatous slack skin GVHD graft‐versus‐host disease GVHR graft‐versus‐host reaction GVL graft‐versus‐leukaemia GVM glomuvenous malformation GWAS genome‐wide association study HAART highly active antiretroviral therapy HAE hereditary angioedema HA‐MRSA hospital‐associated meticillin‐resistant Streptococcus aureus H&E haematoxylin and eosin HBD human β‐defensin HBT hereditary benign telangiectasia HBV hepatitis B virus

HCC harlequin colour change HCG human chorionic gonadotropin HCP hereditary coproporphyria HCT haemopoietic cell transplantation HDL high‐density lipoprotein HDN haematodermic neoplasm HE hypereosinophilia HED hypohidrotic ectodermal dysplasia HEP hepatoerythropoietic porphyria HES hypereosinophilic syndrome HFMD hand, foot and mouth disease HFS hyaline fibromatosis syndrome HGA homogentisic acid HGPS Hutchinson–Gilford progeria syndrome HHD Hailey–Hailey disease HHML hemihyperplasia–multiple lipomatosis syndrome HHT hereditary haemorrhagic telangiectasia HHV human herpesvirus HI haemangioma of infancy HI harlequin ichthyosis HI hypomelanosis of Ito HID hystrix‐like ichthyosis with deafness (syndrome) HIES hyperimmunoglobulin E syndrome HIF hypoxia inducible factor HIMS hyperimmunoglobulin M syndrome HIP helix initiation peptide HIV human immunodeficiency virus HJMD hypotrichosis with juvenile macular dystrophy HLA human leucocyte antigen HLH haemophagocytic lymphohistiocytosis HLRCC hereditary leiomyomatosis and renal cell cancer HMG high mobility group HMS Haim–Munk syndrome HOME Harmonising Outcome Measures for Eczema HOPP hypotrichosis–osteolysis–periodontitis–palmoplantar keratoderma HP hydroxylysylpyridinoline HPC haemangiopericytoma HPS Hermansky–Pudlak syndrome HPETE hydroperoxyeicosatetraenoic acid HPV human papillomavirus HR H1‐receptor HRCT high resolution computed tomography HRM high‐resolution melt PCR HS hidradenitis suppurativa HSCT haematopoietic stem cell transplantation HSD holocarboxylase synthetase deficiency HSP heat shock proteins HSP Henoch–Schönlein purpura HSV herpes simplex virus HTLV human T‐lymphotropic virus HTP helix termination peptide HUV hypocomplementemic urticarial vasculitis HUVS hypocomplementemic urticarial vasculitis syndrome HV hydroa vacciniforme IA infantile acropustulosis IBD inflammatory bowel disease IBIDS ichthyosis, brittle hair, intellectual impairment, decreased fertility and short stature IBS ichthyosis bullosa of Siemens ICAM intracellular adhesion molecule ICD irritant contact dermatitis IC1/IC2 imprinting centre 1/2 ID infective dermatitis IDQoL Infants’ Dermatitis Quality of Life Index IEM inborn errors of metabolism IF immunofluorescence IF infantile fibrosarcoma IF intermediate filament

List of Abbreviations  xxxi IFA indirect fluorescence assay IFAP ichthyosis follicularis, alopecia and photophobia IFM immunofluorescence mapping IFN interferon Ig immunoglobulin IgA1 IgA subtype 1 Ig ε RI high‐affinity IgE receptor IGF insulin‐like growth factor IGFBP insulin‐like growth factor binding protein IgM immunoglobulin M IGRA interferon‐γ release assay IH infantile haemangiomas IHCM ichthyosis hystrix of Curth–Macklin IHS ichthyosis hypotrichosis syndrome IHSC ichthyosis–hypotrichosis–sclerosing cholangitis (syndrome) IIF indirect immunofluorescence IL interleukin ILAR International League of Associations for Rheumatology ILC ichthyosis linearis circumflexia ILVEN inflammatory linear verrucous epidermal naevus IMF immunofluorescence IM infectious mononucleosis IM intramuscular IP incontinentia pigmenti iPCS inducible pluripotential stem cells IPEX immune dysregulation, polyendocrinopathy, enteropathy, X‐linked IPP infantile perineal protrusion IPS ichthyosis prematurity syndrome IR insulin resistance IRAK‐4 IL‐1 receptor associated kinase‐4 IRIS immune reconstitution inflammatory syndrome IS infantile spasms ISAAC International Study of Asthma and Allergies in Childhood ISD infantile seborrhoeic dermatitis ISH infantile systemic hyalinosis ISM indolent systemic mastocytosis ISSVA International Society for the Study of Vascular Anomalies ISU idiopathic solar urticaria IV ichthyosis vulgaris IVF in vitro fertilization IVIG intravenous immunoglobulin JAK janus kinase JDM juvenile dermatomyositis JEB junctional epidermolysis bullosa JHF juvenile hyaline fibromatosis JIA juvenile idiopathic arthritis JLI Jessner lymphocytic infiltrate JPD juvenile plantar dermatosis JSPD Japanese Society for Pediatric Dermatology JSLE juvenile systemic lupus erythematosus JSSc juvenile‐onset systemic sclerosis JXG juvenile xanthogranuloma KD Kawasaki disease KEN keratinocytic epidermal naevus KFSD keratosis follicularis spinulosa decalvans KHE kaposiform haemangioendothelioma KID keratitis, ichthyosis and deafness (syndrome) KIF keratin intermediate filaments KLA Kaposiform lymphangiomatosis KLICK keratosis linearis‐ichthyosis congenita‐keratoderma KLK kallikrein KMP Kasabach–Merritt phenomenon KPI keratinopathic ichthyoses KS Kaposi sarcoma

KS Kindler syndrome KTS Klippel–Trenaunay syndrome KWE keratolytic winter erythema LABD linear immunoglobulin IgA bullous dermatosis LAD leucocyte adhesion deficiency LAD linear IgA dermatosis LAH localized autosomal recessive hypotrichosis LAM linear atrophoderma of Moulin LAM lymphangiomyomatosis LAS loose anagen syndrome LB Lyme borreliosis LCD liquor carbonis detergens LCH Langerhans cell histiocytosis LCR locus control region lcSSC limited cutaneous systemic sclerosis LED light‐emitting diode LIC localized intravascular coagulopathy LD linkage disequilibrium LD lymphoedema‐distichiasis LDF laser Doppler flowmetry LDH lactate dehydrogenase LDL low‐density lipoprotein LDS Loeys–Dietz syndrome LE lupus erythematosus LEC lymphatic endothelial cells LEKTI lymphoepithelial Kazal‐type inhibitor LET lidocaine/epinephrine/tetracaine LFA‐3 lymphocyte function‐associated antigen‐3 LH luteinizing hormone LI lamellar ichthyosis LJ Lowenstein–Jensen (medium) LM lymphatic malformation LMP last menstrual period LMP1 latent membrane protein 1 LMS Lenz–Majewski syndrome LMS limb–mammary syndrome LMX liposomal lidocaine LN lichen nitidus LOH loss of heterozygosity LOSSI localized scleroderma severity index LOX lipoxygenase LP lichen planus LP lupus panniculitis LP lysylpyridinoline LPL lipoprotein lipase deficiency LPP lichen planopilaris LPS lipopolysaccharide LS lichen sclerosus LS lichen scrofulosorum LS lichen striatus LSC lichen simplex chronicus LSc localized scleroderma LT‐β lymphotoxin‐β LTT lymphocyte transformation test LV lentiviral vector LV livedoid vasculopathy LV lupus vulgaris LyP lymphomatoid papulosis MAC membrane attack complex MACS macrocephaly‐alopecia‐cutis laxa‐scoliosis MACS magnetic‐activated cell sorting MAD mandibuloacral dysplasia MAIC M. avium‐intracellulare complex MALDI‐TOF matrix‐assisted laser desorption/ionization time‐of‐flight MALT mucosa‐associated lymphoid tissue MAPK mitogen‐activated protein kinase MAS macrophage activation syndrome MAS McCune–Albright syndrome

xxxii  List of Abbreviations MBL MBP MBTPS2 MC MC MCAS MC&S MCL MCL M‐CM MCS MCV MDM MDP

mannose‐binding lectin major basic protein membrane‐bound transcription factor protease, site 2 mast cells molluscum contagiosum mast cell activation symptoms microscopy, culture and (antibiotic) sensitivity mast cell leukaemia mucocutaneous leishmaniasis megalencephaly‐capillary malformation mast cell lymphoma molluscum contagiosum virus minor determinant mixture mandibular hypoplasia, deafness and progeria (syndrome) MDR multidrug‐resistant MED minimal erythema dose MEDNIK mental retardation, enteropathy, deafness, peripheral neuropathy, ichthyosis, keratoderma MeDOC mendelian disorders of cornification MEN‐1 multiple endocrine neoplasia type‐1 MetS metabolic syndrome MF mycosis fungoides MFS Marfan syndrome MFT multiple familial trichoepitheliomas mHA minor histocompatibility antigen MHC major histocompatibility complex MIDAS microphthalmia, dermal aplasia and sclerocornea (syndrome) MKD mevalonate kinase deficiency MLPA multiplex ligation‐dependent probe amplification MLT multifocal lymphangioendotheliomatosis with thrombocyopenia MMA methylmalonic acidaemia MMF mycophenolate mofetil MMP matrix metalloproteinases MMP mucous membrane pemphigoid MMPH multifocal micronodular pneumocyte hyperplasia MMR mismatch repair MODY maturity‐onset diabetes of the young MPA microscopic polyangiitis MPCM maculopapular cutaneous mastocytosis MPDE maculopapular drug eruptions or exanthems MPE maculopapular exanthems MPNST malignant peripheral nerve sheath tumour MPO myeloperoxidase MPS mucopolysaccharidoses MRA magnetic resonance angiography MRI magnetic resonance imaging MRSA meticillin‐resistant Staphylococcus aureus MRSS modified Rodnan skin score MSD multiple sulphatase deficiency MSF Milton sterilizing fluid MSH melanocyte‐stimulating hormone MSL multiple symmetric lipomatosis MSS Mulvihill–Smith syndrome MSUD maple syrup urine disease MTC Mycobacterium tuberculosis complex mtDNA mitochondrial DNA mTOR mammalian target of rapamycin MTS Muir–Torre syndrome MTX methotrexate MUGA multiple uptake gated acquisition angiography MUHH Marie–Unna hereditary hypotrichosis MVP mitral valve prolapse MWS Muckle–Wells syndrome NA naevus anaemicus NAC N‐acetylcysteine NADPH nicotinamide adenine dinucleotide phosphate

NBCC NBD NBS NBT NB‐UVB NC NCAM NCIE NCP NCV ND Nd:YAG NEP NEPPK NER NET NF NFJ NF‐κB NF1 NGCO NGF NGFR NGS NHL NICE NICH NICU NIH NISCH

naevoid basal cell carcinoma nucleotide‐binding domain Nijmegen breakage syndrome nitroblue tetrazolium narrow‐band UVB naevus comedonicus neural cell adhesion molecule nonbullous congenital ichthyosiform erythroderma neonatal cephalic pustulosis nerve conduction velocity naevus depigmentosus neodymium:yttrium aluminium garnet neonatal eosinophilic pustulosis nonepidermolytic palmoplantar keratoderma nucleotide excision repair neutrophil extracellular trap necrotizing fasciitis Naegeli‐Franceschetti‐Jadassohn (syndrome) nuclear factor κB neurofibromatosis type 1 non‐gestational ovarian choriocarcinoma nerve growth factor nerve growth factor receptor next‐generation sequencing non‐Hodgkin lymphoma National Institute for Health and Care Excellence (UK) noninvoluting congenital haemangioma neonatal intensive care unit National Institutes of Health (USA) neonatal ichthyosis‐sclerosing cholangitis (syndrome) NK natural killer (cell) NL necrobiosis lipoidica NL neonatal lupus NLCH non‐Langerhans cell histiocytosis NLCS naevus lipomatosus cutaneous superficialis NLD necrobiosis lipoidica NLP nail lichen planus NLS naevus lipomatosus superficialis NLS Neu‐Laxova syndrome NLSD neutral lipid storage disease NLSDI neutral lipid storage disease with ichthyosis NMF natural moisturizing factor NOMID neonatal onset multisystemic inflammatory disorder N2O nitrous oxide NPSA National Patient Safety Agency (UK) NP‐SLE neuropsychiatric systemic lupus erythematosus NPY neuropeptide Y NS naevus sebaceus NS Netherton syndrome NS Noonan syndrome NSML Noonan syndrome with multiple lentigines NSAIDs nonsteroidal anti‐inflammatory drugs NSIP nonspecific interstitial pneumonia NSV nonsegmental vitiligo NTM nontuberculous mycobacteria NUV normocomplementemic urticarial vasculitis OA ocular albinism OC osteoma cutis OCA oculocutaneous albinism OCCS oculocerebrocutaneous syndrome OES oculoectodermal syndrome OFC oral food challenge OFG orofacial granulomatosis OI osteogenesis imperfecta OL‐EDA‐ID osteopetrosis, lymphoedema, anhidrotic ectodermal dysplasia and immune deficiency OMIM Online Mendelian Inheritance in Man OODD odonto‐onycho‐dermal dysplasia

List of Abbreviations  xxxiii OPG optic pathway glioma OPK osteopoikilosis ORF open reading frame OS Omenn syndrome OSD occult spinal dysraphism OTU operational taxonomic unit O/W oil in water PA pityriasis alba PA phytanic acid PABA para‐aminobenzoic acid PAF platelet‐activating factor PAH phenylalanine hydroxylase PAHX phytanoyl CoA hydroxylase PAI‐1 plasminogen activator inhibitor 1 PAN polyarteritis nodosa p‐ANCA perinuclear antineutrophilic cytoplasmic antibody PAP peak arterial pressure PAPA pyogenic arthritis, pyoderma gangrenosum and acne PAR2 protease‐activated receptor 2 PAS periodic acid–Schiff PASI Psoriasis Area and Severity Index PC pachyonychia congenita PCFCL primary cutaneous follicle‐centre lymphoma PCFH precalcaneal congenital fibrolipomatous hamartoma PCL primary cutaneous lymphoma PCLBCL primary cutaneous diffuse large B‐cell lymphoma PCMZL primary cutaneous marginal zone B‐cell lymphoma PCNA proliferating cell nuclear antigen PCOS polycystic ovarian syndrome PCR polymerase chain reaction PCT porphyria cutanea tarda PCT primary care trust PDGF platelet‐derived growth factor PDL pulsed‐dye laser PDT photodynamic therapy PE pulmonary embolism PEG polyethylene glycol PEH palmoplantar eccrine hidradenitis PELVIS perianal haemangioma, external genitalia malformations, lipomyelomeningocoele, vesicorenal abnormalities, imperforate anus and skin tags PEP postexposure prophylaxis PEPD paroxysmal extreme pain disorder PEN porokeratotic eccrine naevus PENS papular epidermal naevus with skyline basal cell layer PEODDN porokeratotic eccrine ostial and dermal duct naevus PET positron emission tomography PF pemphigus foliaceus PFT pulmonary function tests PG pyoderma gangrenosum PG pyogenic granuloma PGA Physician Global Assessment PGD preimplantation genetic diagnosis PGP 9.5 protein gene product 9.5 PGRP peptidoglycan recognition protein PH palmoplantar hidradenitis PH pulmonary hypertension PHA phytohaemagglutinin PHACES posterior fossa brain malformations, large or complex haemangiomas of the face, arterial anomalies, cardiac anomalies and eye abnormalities PHP pseudo‐hypoparathyroidism PHTS PTEN hamartoma tumour syndrome PhyH phytanoyl‐CoA2‐hydroxylase PICH partially involuting congenital haemangioma PID pelvic inflammatory disease PID primary immunodeficiency PILA papillary intralymphatic angioendothelioma PJS Peutz–Jeghers syndrome

PKDL post‐kala‐azar dermal leishmaniasis PKS Pallister–Killian syndrome PKU phenylketonuria pI isoelectric point PI3 proteinase inhibitor 3 PIP proximal interphalangeal PL pityriasis lichenoides PLC pityriasis lichenoides chronica PLCA primary localized cutaneous amyloidosis PLE polymorphous light eruption PLEVA pityriasis lichenoides et varioliformis acuta PLS Papillon–Lefèvre syndrome PM porokeratosis of Mibelli PML progressive multifocal leucoencephalopathy PMLE polymorphous light eruption PMN polymorphonuclear cell PN poikiloderma with neutropenia PN prurigo nodularis PNET peripheral neuroectodermal tumour PNF plexiform neurofibroma POC point of care P1cp procollagen type 1 carboxy‐terminal peptide PNT papulonecrotic tuberculid POEM Patient‐Oriented Eczema Measure POEMS polyneuropathy, organomegaly, endocrinopathy, M protein, skin changes (syndrome) POH progressive osseous heteroplasia PP prurigo pigmentosa PPAR peroxisome proliferator‐activated receptor PPGSS papular‐purpuric gloves‐and‐socks syndrome PPi inorganic pyrophosphate PPK palmoplantar keratoderma PPK phacomatosis pigmentokeratotica PPKN palmoplantar keratoderma Nagashima PPL penicilloyl‐polylysine PPP palmoplantar pustulosis PPV phakomatosis pigmentovascularis PPPD porokeratosis palmaris et plantaris disseminata PPT positive patch test PPTR positive patch test reaction PR pagetoid reticulosis PRES Paediatric Rheumatology European Society PRINTO Paediatric Rheumatology International Trials Organization PRIS propofol‐related infusion syndrome PRNT plaque‐reduction neutralization test PRO patient‐reported outcome PROM patient‐reported outcome measure PROS PIK3CA‐related overgrowth spectrum disorders PRP pityriasis rubra pilaris PRR pathogen recognition receptors PR3 proteinase 3 PS Proteus syndrome PSEK progressive symmetric erythrokeratoderma PSH premature sebaceous hyperplasia PSS peeling skin syndromes PT prothrombin time PTC premature termination codon PTEN phosphatase and TENsin homologue PTH parathyroid hormone PTHrP parathyroid‐hormone‐related peptide PTT partial thromboplastin time PUVA psoralens plus UVA PV pemphigus vulgaris PV psoriasis vulgaris PVL Panton–Valentine leukocidin PWS port wine stain PXE pseudoxanthoma elasticum QoL quality of life

xxxiv  List of Abbreviations qPCR quantitative polymerase chain reaction qRT‐PCR quantitative real‐time PCR QUADAS Quality Assessment of Diagnostic Accuracy tool RAK reticulate acropigmentation of Kitamura RAMBA retinoic acid metabolism blocking agent RAS recurrent aphthous stomatitis RAST radio‐allergosorbent test RBP retinol‐binding protein RCC renal cell carcinoma RCDP rhizomelic chondrodysplasia punctata RCT randomized controlled trial RD restrictive dermopathy RDD Rosai–Dorfman disease RDEB recessive dystrophic epidermolysis bullosa RICH rapidly involuting congenital haemangioma RF rheumatoid factor RF rib fracture RFC replication factor C RFLP restriction fragment length polymorphism RH retinal haemorrhage RMH rhabdomyomatous mesenchymal hamartoma RMS rhabdomyosarcoma RNP ribonucleoprotein ROAT repeated open application test ROS reactive oxygen species RP relapsing polychondritis RPA replication protein A RPE recurrent toxin‐mediated perineal erythema RRP recurrent respiratory papillomatosis RSC respiratory syncytial virus RT‐PCR reverse transcription polymerase chain reaction RTS Rothmund–Thomson syndrome RTX rituximab RV retroviral vector RXLI recessive X‐linked ichthyosis SA Streptococcus aureus SAA serum amyloid A SAM severe dermatitis, multiple allergies and metabolic wasting SAPHO synovitis, acne, pustulosis, hyperostosis and osteitis SASSAD six‐area, six‐sign atopic dermatitis (score) SC stratum corneum SC subcutaneous SCALP sebaceous naevus, central nervous system abnormalities, aplasia cutis, limbal dermoid and pigmented naevus (syndrome) SCAP syringocystadenoma papillifera SCC squamous cell carcinoma SCCE stratum corneum chymotryptic enzyme SCE sister chromatid exchange SCF stem cell factor SCFN subcutaneous fat necrosis SCH spindle cell haemangioma SCID severe combined immunodeficiency SCLE subacute cutaneous lupus erythematosus SCORAD SCORing Atopic Dermatitis SCT stem cell transplantation SCTE stratum corneum tryptic enzyme SD seborrhoeic dermatitis SDA Sabouraud dextrose agar SDH subdural haematoma SEGA subependymal giant cell astrocytoma SegPD segmental pigmentary disorder SEI superficial epidermolytic ichthyosis SEN scalp–ear–nipple (syndrome) SEN subependymal nodules SERCA2 sarco/endoplasmic reticulum ATPase type 2 SFD scrofuloderma

SFT SGC SHBG SHCB SHH SHFM SHP SIB SICI SID sIgE siRNA SIRS 6‐4PP SJIA SJS SLADP S‐LAM SLC27 SLE SLICC SLN SLOS SLPI SLS SLS SM SM‐AHN

solitary fibrous tumour Shprintzen–Goldberg craniosynostosis sex hormone‐binding globulin self‐healing collodion baby Sonic Hedgehog split hand–split foot syndrome Schönlein–Henoch purpura self‐injurious behaviour self‐improving congenital ichthyosis sudden infant death (syndrome) drug‐specific IgE antibodies small interfering RNA systemic inflammatory response syndrome pyrimidine‐6,4‐pyrimidone photoproducts systemic juvenile idiopathic arthritis Stevens–Johnson syndrome Latin American Society for Pediatric Dermatology spontaneous lymphangiomyomatosis solute carrier family 27 systemic lupus erythematosus Systemic Lupus International Collaborating Clinics speckled lentiginous naevus Smith–Lemli–Opitz syndrome secretory leucocyte protease inhibitor Sjögren–Larsson syndrome sodium lauryl sulphate systemic mastocytosis systemic mastocytosis with an associated haematological neoplasm SMO smoothened SNA spherical nucleic acid SNP single nucleotide polymorphism SNV single nucleotide variant SP syringocystadenoma papilliferum SPD Society for Pediatric Dermatology SPECT single‐photon emission computed tomography SPF sun protection factor SPINK serine protease inhibitor Kazal type SPRR small proline‐rich proteins SPTCL subcutaneous panniculitis‐like T‐cell lymphoma SR systemic retinoids SS Sézary syndrome SS Sjögren syndrome SS Sweet syndrome SSc systemic sclerosis SSG split‐thickness skin graft SSKI saturated solution of potassium iodide SSLR serum sickness‐like reaction SSM smouldering systemic mastocytosis SSP Schöpf–Schulz–Passarge SSPE subacute sclerosing panencephalitis SSRI selective serotonin reuptake inhibitors SSS stiff skin syndrome SSSS staphylococcal scalded skin syndrome SSTI skin and soft tissue infection STD sexually transmitted disease STI sexually transmitted infection STS sodium thiosulfate STS steroid sulphatase STS soft tissue sarcoma STSS streptococcal toxic shock syndrome SWS Sturge–Weber syndrome TA tufted angioma TA teichoic acid TAC tetracaine/adrenaline/cocaine TBE tickborne encephalitis TBSA total body surface area TCC triple‐combination cream

List of Abbreviations  xxxv TCI topical calcineurin inhibitors TCR T‐cell receptor TCS topical corticosteroids TDO trichodento‐osseous TEN toxic epidermal necrolysis TEWL transepidermal water loss TFIIH transcription factor IIH TG transglutaminase TG triacylglycerol TGF transforming growth factor TG1 transglutaminase‐1 TIMP tissue inhibitor of metalloproteinase TJ tight junction TLR toll‐like receptor TMD transmembrane domains TMEP telangiectasia macularis eruptiva perstans TMP‐SMX trimethoprim‐sulfamethoxazole TND twenty‐nail dystrophy TNF tumour necrosis factor TNFR tumour necrosis factor receptor TNPM transient neonatal pustular melanosis tPA tissue plasminogen activator TPM transient pustular melanosis TPMT thiopurine methyltransferase TPN total parenteral nutrition TRAPS TNF receptor superfamily 1A‐associated periodic fever syndrome TREC T‐cell receptor excision circle TRPS trichorhinophalangeal syndrome TRT thermal relaxation time TS tuberous sclerosis TSC tuberous sclerosis complex TSC‐IS TSC‐associated infantile spasms TSH thyroid‐stimulating hormone TSS toxic shock syndrome TST tuberculosis skin test TTD trichothiodystrophy TU tropical ulcer TV Trichomonas vaginalis UD unrelated donor uE3 unconjugated oestriol UNT unilateral naevoid telangiectasia UP urticaria pigmentosa UPD uniparental disomy URDS Urban–Rifkin–Davis syndrome US ultrasound

US/LS upper to lower segment UTR untranslated region UV ultraviolet UVA ultraviolet A UVB ultraviolet B UV‐DDB UV‐damaged DNA‐binding UVSS UV‐sensitive syndrome UVR ultraviolet radiation VACTERL vertebral anomalies, anal atresia, congenital cardiac anomalies, tracheo‐oesophageal fistula and/or oesophageal atresia, renal anomalies, radial dysplasia and other limb defects VDLR Venereal Disease Research Laboratory VEGF vascular endothelial growth factor VEGFR3 vascular endothelial growth factor receptor 3 VIG vaccinia immune globulin VIT venom immunotherapy VL visceral leishmaniasis VL visible light VLBW very low birthweight VLCFA very‐long‐chain fatty acid VLDL very low‐density lipoproteins VM venous malformation VMCM cutaneomucosal venous malformation VS Vohwinkel syndrome VZIG varicella zoster immunoglobulin VZV varicella zoster virus WAO World Allergy Organization WAS Wiskott–Aldrich syndrome WGS whole‐genome shotgun WHO World Health Organization W/O water in oil WPWS Wolff–Parkinson–White syndrome WRS Wiedemann–Rautenstrauch syndrome WS Werner syndrome XD X‐linked dominant XLA X‐linked agammaglobulinaemia XLI X‐linked ichthyosis XLMR X‐linked mental retardation XP xeroderma pigmentosum XPV xeroderma pigmentosum variant XR X‐linked recessive YNS yellow nail syndrome ZIKV Zika virus ZNS Zunich neuroectodermal syndrome

C HA PTER   1

Embryogenesis of the Skin Lara Wine Lee1 & Karen A. Holbrook2  Departments of Dermatology and Pediatrics, Medical University of South Carolina, Charleston, SC, USA  Formerly Department of Physiology and Cell Biology, Ohio State University, Columbus, OH, USA

1 2

Introduction, 1 Time‐scale of skin development, 2 Embryonic skin, 3

Embryonic–fetal transition, 10 Fetal skin, 16 Unique features of developing human skin, 20

Abstract The skin is a large and complex organ. While skin development begins during early embryogenesis, full development is not ­complete until well into the postnatal years. Studies of skin development can shed light on a number of basic problems in c­ ontemporary biology: epithelial–mesenchymal interactions that establish organs (in skin, these tissue interactions occur in follicle, sweat gland and nail formation); cell–cell interactions through soluble mediators;

­Introduction The skin is an ideal organ in which to study development because it is readily accessible for observation, sampling and evaluation. As an interface, it straddles the internal, systemic world of the individual and the external environ­ ment and is modified by both. The skin itself is a compli­ cated and complex organ, with the normal structure and function of each ‘part’ highly dependent upon what ­happens in other parts of the skin. In other words, one cannot understand, for example, changes that occur in the epidermis without understanding the nature of the der­ mis since the dermis has major influences on the activities and functions of the epidermis. This is the case for each region or structure of the skin. Development offers an opportunity to study skin structure and function under more controlled conditions because the environment of the developing skin is rea­ sonably constant (controlled light, temperature, pressure, etc.). It is therefore possible to investigate how the prop­ erties of the different regions and structures of the skin are coordinately established, presumably under the directions of a genetic programme. Some of the structures of the skin may be fully formed early in the fetal period whereas other structures or regions are not complete until well into the postnatal years. Full establishment of adult functions of the skin always requires an extended period of development beyond the stages in utero. Development is the first period

Conclusion, 35

gene regulation; apoptosis; differentiation (structural, biochemical and functional); and certain longstanding basic ­p henomena of development such as induction, pattern ­formation and differentiation. Rigorous understanding of embryogenesis ­allows ­definition of critical periods when the skin may be more vulnerable to developmental errors. Further understanding of these critical processes advances the study of developmental d ­ isorders of the skin with the promise of improving therapeutic options for these disorders.

in a continuum of events that modifies the skin. It is c­ haracterized by morphogenetic processes, activation of new genes and gain of function. In contrast, ageing may involve morpholytic processes in which genes are turned off, resulting in a loss of function. Consideration of this continuum, and the genetic and environmental interac­ tions that come into play throughout life, provides a con­ ceptual framework for discussing the place and role of the events in skin morphogenesis. Understanding the stages and events of normal human skin development is also important from a biomedical perspective. Skin embryogenesis allows the definition of critical periods when the skin may be more vulnerable to developmental errors. It provides an opportunity to study the evolution of skin function, establishing a background for understanding the natural history of expression of genetic skin disease in its earliest form. Moreover, advances in gene therapy may provide intervention rooted in understanding normal morphological processes. The unique morphological properties of developing human skin have always intrigued investigators. Specific aspects of the skin that are found only in the fetus, such as the periderm, and specific events that result in the formation of complex structures, such as follicle or sweat gland, were often described for specific ages only (reviewed in [1–4]). Expansion of studies to characterize the complete ontogeny of the tissue, region or structure then began to include data derived from

Harper’s Textbook of Pediatric Dermatology, Fourth Edition. Edited by Peter Hoeger, Veronica Kinsler and Albert Yan. © 2020 John Wiley & Sons Ltd. Published 2020 by John Wiley & Sons Ltd.

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

1

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

2

Section 1  Development, Structure and Physiology of the Skin

­ iochemical or immunohistocytochemical assays for the b expression of specific molecules that were known to correlate with the state of differentiation or with a ­specific property such as barrier function adhesion. Culturing and grafting human embryonic and fetal skin (reviewed in [5–8]) and skin‐derived cells [9,10] and evaluation of skin from fetuses affected with genoder­ matoses (reviewed in [11–13]), or under conditions of growth retardation, have also provided insight into human skin development. Our understanding of skin development continues to increase as we apply more modern tools of biology to study the skin at all stages of life. ­References 1 Holbrook KA. Structure and function of the developing human skin. In: Goldsmith LA (ed.) Physiology, Biochemistry and Molecular Biology of the Skin, 2nd edn. Oxford: Oxford University Press, 1991:63–110. 2 Holbrook KA. Structural and biochemical organogenesis of skin and cutaneous appendages in the fetus and neonate. In: Polin RA, Fox WW (eds) Neonatal and Fetal Medicine Physiology and Pathophysiology. New York: Grune & Stratton, 1992:527–51. 3 Holbrook KA, Wolff K. The structure and development of skin. In: Fitzpatrick TB, Eisen AZ, Wolff K et  al. (eds) Dermatology in General Medicine, 6th edn. New York: McGraw‐Hill, 1993:97–144. 4 Holbrook KA, Sybert VP. Basic science. In: Schachner L, Hansen R (eds) Pediatric Dermatology, 2nd edn. New York: Churchill Livingstone, 1995. 5 Holbrook KA, Minami SA. Hair follicle morphogenesis in the human: characterization of events in vivo and in vitro. NY Acad Sci 1991; 642:167–96. 6 Zeltinger J, Holbrook KA. A model system for long term, serum‐free, suspension organ culture of human fetal tissues: experiments using digits and skin from multiple body regions. Cell Tissue Res 1997; 290:51–60. 7 Lane AT, Scott GA, Day KH. Development of human fetal skin trans­ planted to the nude mouse. J Invest Dermatol 1989;93:787–91. 8 Gilhar A, Gershoni‐Baruch R, Margolis A et al. Dopa reaction of fetal melanocytes before and after skin transplantation onto nude mice. Br J Dermatol 1995;133:884–9. 9 Oliver AM. The cytokeratin expression of cultured human foetal keratinocytes. Br J Dermatol 1990;123:707–16. 10 Scott G, Ewing J, Ryan D et  al. Stem cell factor regulates human ­melanocyte–matrix interactions. Pigment Cell Res 1994;7:44–51. 11 Holbrook KA, Smith LT, Elias S. Prenatal diagnosis of genetic skin disease using fetal skin biopsy samples. Arch Dermatol 1993; 129:1437–54. 12 Sybert VP, Holbrook KA, Levy M. Prenatal diagnosis of severe ­dermatologic diseases. Adv Dermatol 1992;7:179–209. 13 Sybert VP, Holbrook KA. Antenatal pathology of the skin. In: Claireaux AE, Reed GB (eds) Diseases of the Fetus and Newborn: Pathology, Radiology and Genetics. New York: Cockburn, Chapman & Hall, 1995:755–68.

­Time‐scale of skin development There are several schemes for categorizing stages of skin development (Fig. 1.1) [1]. Development is defined by estimated gestational age (EGA) starting at the time of fertilization, which differs from calculations based on the last menstrual period (LMP). Fertilization occurs on average 2 weeks after the LMP. Human development is separated into the embryonic period, before the onset of bone marrow function, which corresponds to fertiliza­ tion to 2 months EGA, and the fetal period from 2  months EGA until birth. The first trimester includes the entire embryonic period and the first stages of the

fetal period. Histogenesis of all skin regions is initiated in the embryo, and differentiation of some of those tis­ sues begins to occur in the first trimester [2]. The boundary between the first and second trimesters, at 3 months of age, is based only on fetal age and not on any specific changes in structure, composition or function of any region of the skin. The second trimester includes many important events in skin development. Morphogenesis of new structures is initiated and there is terminal differentia­ tion of others. During the third trimester, all parts of the skin are assembled and the functions of each of them are unfolding. The end of this period is not the final state of the skin, as there is significant reorganiza­ tion of certain units of the skin (e.g. the vasculature), additions to the skin in volume (e.g. the dermal matrix) and functional maturation of many structures of the skin (e.g. nerves, sweat glands and stratum corneum) after birth [3–7]. Other important times that should be recognized in skin development are the ages at which diagnostic proce­ dures are performed for the purpose of evaluating the condition of a fetus at risk for a genetic skin disease (reviewed in [8]). Fetal deoxyribonucleic acid (DNA) can be extracted from chorionic villi sampled around 10 weeks EGA and amniotic fluid cells can be obtained at around 14–16 weeks EGA. Fetal skin can be sampled as early as 16 weeks EGA, however this technique is largely obsolete and has been replaced by more advanced diag­ nostic and genetic methods. Newer technology allows isolation of fetal DNA from maternal plasma as early as 9 weeks EGA. The cell‐free DNA testing is currently not widely used for microdeletion syndromes but offers promising noninvasive first‐trimester testing in the future. In addition, preimplantation genetic diagnosis has been used successfully for diagnosis of severe skin d ­ isease (reviewed in [8]). ­References 1 Holbrook KA, Odland GF. The fine structure of developing human epidermis: light, scanning and transmission electron microscopy of the periderm. J Invest Dermatol 1975;65:16–38. 2 Holbrook KA, Dale BA, Smith LT et al. Markers of adult skin expressed in the skin of the first trimester fetus. Curr Prob Dermatol 1987;16:94–108. 3 Holbrook KA. Structure and function of the developing human skin. In: Goldsmith LA (ed.) Physiology, Biochemistry and Molecular Biology of the Skin, 2nd edn. Oxford: Oxford University Press, 1991:63–110. 4 Holbrook KA. Structural and biochemical organogenesis of skin and cutaneous appendages in the fetus and neonate. In: Polin RA, Fox WW (eds) Neonatal and Fetal Medicine Physiology and Pathophysiology. New York: Grune & Stratton, 1992:527–51. 5 Holbrook KA, Wolff K. The structure and development of skin. In: Fitzpatrick TB, Eisen AZ, Wolff K et al (eds) Dermatology in General Medicine, 6th edn. New York: McGraw‐Hill, 1993:97–144. 6 Holbrook KA, Sybert VP. Basic science. In: Schachner L, Hansen R (eds) Pediatric Dermatology, 2nd edn. New York: Churchill Livingstone, 1995. 7 Holbrook KA. A histologic comparison of infant and adult skin. In: Boisits E, Maibach HI (eds) Neonatal Skin: Structure and Function. New York: Marcel Dekker, 1982:3–31. 8 Luu M, Cantatore‐Francis L, Glick S. Prenatal diagnosis of genodermatoses: current scope and future capabilities. Int J Derm 2010;49:353–61.

Chapter 1  Embryogenesis of the Skin

3

Histogenesis Maturation Amniocentesis: biochemical, chromosomal analysis

Chorionic villus sampling: DNA analysis

1

2

3

4

Fetal skin biopsy: morphological analysis

5

6

7

8

9

Months

First trimester

Second trimester

Embryonic Fig. 1.1  Time‐scale diagram identifying specific stages of skin development and identifying the ages at which prenatal diagnosis can be performed using each of the various methods currently employed. Source: Adapted from Polin RA, Fox WW. Fetal and Neonatal Physiology, 2nd edn. Vol. 1. Philadelphia: W.B. Saunders, 1998:730.

Third trimester

Fetal

Embryonic-fetal transition

Follicular keratinization

Interfollicular epidermal keratinization

*Dashed lines suggest that the starting/ending point for these events is uncertain

­Embryonic skin The primitive ectoderm of the developing blastocyst is established at 1 week EGA, and by 20–50 days EGA the development of major organs and organ systems of the human embryo is initiated. The integumentary system exhibits characteristics of the skin at 30 days EGA. The epidermis, dermoepidermal junction (DEJ) and dermis are well delineated and the tissue is innervated and vas­ cularized (Fig.  1.2). The boundary between the dermis and subcutaneous tissue is not clearly defined in all body sites, but in some regions these two zones are distinct from one another on the basis of a greater density of cells and matrix in the dermis compared with the hypodermis. The skin is closely associated with the underlying devel­ oping striated muscle or cartilage on the appendages. There is no morphological evidence that epidermal appendages have begun to form. In most regions of the embryo, the epidermis is a sim­ ple, flat, two‐layered epithelium consisting of basal and periderm cells (Figs 1.2 and 1.3). The periderm is a dis­ tinct embryonic layer that is eventually shed. Both types of cells are mostly filled with glycogen, a molecule that is characteristic of the cytoplasm of developing and regenerating tissues, where it most likely serves as a source of energy [1] (Fig.  1.3). Microvilli project from the peridermal surface into the amniotic fluid (Figs 1.3b and 1.4). The nucleus is centrally located in periderm and basal cells, and the cytoplasmic organelles are sparse and distributed either around the nucleus or at the periphery of the cell (Fig. 1.3b). Both layers contain distinct keratin intermediate filament proteins (Fig. 1.5)

(a)

(b) Fig. 1.2  (a) Tissue of the body wall of a 36‐day EGA human embryo and (b) the skin from a 45‐day EGA human embryo. Note the two‐layered epidermis, dermis and subcutaneous tissue and the more linear orientation of dermal cells in contrast to the pleomorphic shapes of the subcutaneous mesenchyme. In (b) note the periderm and basal cells of the epidermis, the closely associated fibroblastic cells in the dermis proximal to the epidermis and a nerve–vascular plane separating the dermis from the subcutaneous tissue (×200).

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

*Organogenesis

Section 1  Development, Structure and Physiology of the Skin

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

4

P

Fig. 1.3  Transmission electron micrographs of the embryonic epidermis. In (a) note the glycogen (G)‐filled basal (B) and periderm (P) layer cells. Desmosomes are evident between basal cells and between basal cells and periderm cells. The DEJ is flat and shows few sites of increased density, suggesting sites of desmosome formation. In (b) one periderm cell and portions of two basal cells are shown. Note the nature and disposition of cytoplasmic organelles within both cell types, the keratin filaments associated with desmosomes (arrow) and the microvilli extending from the periderm surface (a, ×11 525; b, ×25 000).

G

B

(a)

Fig. 1.4  Scanning electron micrograph of the surface of 55‐day EGA embryonic skin from the surface of the developing foot. The layer of cells shown is the periderm. Note the microvilli and the variable size and shape of the cells (×1000).

(b)

[2,3], and unique cell‐surface molecules [4]. The latter markers may reflect the differences in environments ­surrounding each layer. The columnar‐shaped basal cells of the embryonic epidermis express the keratins, K5 (58 kDa) and K14

(50 kDa), that are characteristic of adult basal layer keratinocytes [2,3] and additional keratin polypep­ tides, K19 (40 kDa) and K8 (52 kDa), that are specific to embryonic/fetal basal cells and periderm cells [2,3]. At least one keratin polypeptide expressed in periderm cells is different from those in the basal cells, K18 (45 kDa), although it is a marker for Merkel cells [5]. In contrast to the adult tissue, the filaments in fetal embryonic epidermis are dispersed in the cytoplasm or assembled in small, seemingly short, bundles that are associated primarily with desmosomes and hemidesmosomes (see Fig.  1.3b). Periderm cells and basal cells also differ in the expression of many growth factors, growth factor receptors (Fig. 1.6), cell adhesion molecules and other cytoplasmic and cell‐surface ­molecules [6–8]. Two of the immigrant cells that are prominent in adult epidermis, melanocytes (neural crest in origin) and Langerhans cells, are present in the embryonic epidermis among basal cells and associated with the basement membrane. Sheets of embryonic epider­ mis immunostained with an antibody that recognizes m elanocytes specifically (HMB‐45, an inducible, ­

5

(a)

Fig. 1.6  Section of skin from a 78‐day EGA human fetus showing differential expression of the A‐chain of platelet‐derived growth factor (PDGF) in the basal and intermediate cell layers (green) and an absence of staining in peridermal cells. The receptor for PDGFA, PDGFR‐α (red), is expressed by cells in the dermis (×350). (b)

(c)

(d) Fig. 1.5  Immunostained samples of (a) early (∼50‐day EGA) and (b–d) later (∼60‐day) human embryonic epidermis showing positive staining of both periderm and basal layers with the AE1 (a) and AE3 (d) monoclonal antibodies that recognize keratins. Both layers are negative when reacted with the AE2 (c) antibody, which recognizes the differentiation‐specific keratins (×350). (a)

cytoplasmic antigen common to melanoma and embryonic/ fetal melanocytes [9,10]) show a remarkably high den­ sity (∼1000 cells/mm2) of these cells organized in a regular pattern of distribution (Fig. 1.7). They are den­ dritic as early as 50 days EGA in general body skin but there is no evidence of ­melanosomes in the cytoplasm [11]. Langerhans cells are recognized in embryonic skin as early as 42 days EGA on the basis of a reaction prod­ uct for membrane‐bound Mg2+ adenosine triphos­ phatase (ATPase) and histocompatibility locus antigen (HLA‐DR) on the plasma membrane [12–14]. Their truncated or dendritic morphology is also apparent (Fig. 1.8). Interestingly, they are present in skin before the bone marrow begins to function leading to a hypothesis that they are derived from the yolk sac or fetal liver at this age. At 7 weeks EGA, the density of Langerhans cells is about 50 cells/mm2 [13,14].

(b) Fig. 1.7  Embryonic skin from a 54‐day EGA human embryo immunostained with the HMB‐45 monoclonal antibody, which recognizes an antigen in the melanocyte. (a) Section of skin. Note the abundance and position of these cells within the two‐layered epidermis. (b) Epidermal sheet. Note the density, spacing and dendritic morphology of these cells (a, ×350; b, ×25).

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

Chapter 1  Embryogenesis of the Skin

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

6

Section 1  Development, Structure and Physiology of the Skin

Fig. 1.8  Epidermal sheet from a 53‐day EGA human embryo immunostained to recognize HLA‐DR antigen in epidermal Langerhans cells (×400). Source: Micrograph courtesy of Dr Carolyn Foster.

The third immigrant cell, the Merkel cell, can be rec­ ognized in embryonic palmar skin as early as 55–60 days EGA (see Eccrine sweat gland formation) at a den­ sity of ∼130 cells/mm2 [15], using as a marker any one of the set of keratins expressed by Merkel cells (K8, K18, K10 and K20) [5,16–18]. K20 is the only keratin found exclusively in Merkel cells [18]. At this embryonic age, they are distributed randomly and in a suprabasal posi­ tion. Merkel cells are neuroendocrine cells that were originally thought to function primarily as slow‐adapting mechanoreceptors. Studies that have found soluble mediators produced by these cells such as nerve growth factor (NGF) and brain‐derived neurotrophic factor [19,20] suggest that it is likely that Merkel cells are tar­ gets for ingrowing nerve fibres or other cells such as the smooth muscle cells of the arrector pili muscle [21,22]. Their presence in selected sites of developing epidermal appendages (e.g. sweat glands and hair follicles) has also been suggested to stimulate or to correlate with active proliferation of the tissue. It is generally accepted that Merkel cells are derived from keratinocytes in situ [16,18,21,23,24].

A continuous basal lamina (lamina densa) underlies the two‐layered epidermis and defines, morphologically, one structural component of the basement membrane zone [25–27]. The basal lamina is patchy, however, in regions of the body where the epidermis may be only a single layer, for example, superior to the spinal cord. The molecules and antigens characteristic of all basal laminae (type IV colla­ gen, laminin, heparan sulphate proteoglycan, nidogen/ entactin) are present in the earliest recognized basal lamina of the skin; skin‐specific molecules are recognized later during the first trimester in accord with the more promi­ nent development of the attachment structures [28,29]. A thin, mat‐like layer of microfilaments lies just inside the basal plasma membrane of the basal cell keratinocytes (Fig. 1.9). It may reinforce this surface of the epidermis and add to the strength of the DEJ at this stage when the struc­ tural modifications associated with dermoepidermal adhe­ sion (hemidesmosomes, anchoring filaments, anchoring fibrils) are rudimentary [30]. The same organization of fila­ ments is observed in cultured keratinocytes, which do not typically form hemidesmosomes and anchoring fibrils in vivo, and in basal keratinocytes under pathological situa­ tions, such as j­unctional epidermolysis bullosa, in which the epidermis separates from the dermis. The antigens associated with the attachment structures (laminin 5/epiligrin/kalinin and 19 DEJ‐1 for hemides­ mosomes and anchoring filaments [31–34]; type VII ­collagen for anchoring fibrils [35]) are not seen by light microscopic immunostaining methods until early in the fetal period. It is likely, however, that keratinocytes begin to synthesize these proteins in the embryonic period but that the methods used for detection are not sensitive enough to demonstrate their low levels of expression. The dermoepidermal boundary is flat in the embryonic skin (Figs  1.2, 1.3 and 1.9) and thus presents a limited surface area for nutrients to traverse between the dermis and the epidermis. This may be relatively less important in the developing skin than in infant and adult skin because the dermis is thin and the small, dispersed bun­ dles of dermal matrix proteins and the hydrated condition

Fig. 1.9  Enlarged view of the DEJ of human embryonic epidermis showing the microfilament network within the basal epidermal cell (arrows), sites where desmosomes are forming (arrowhead) and the lamina densa. Note collagen fibrils (C) surrounding the dermal fibroblastic cells (×11 625).

(a)

(b) Fig. 1.10  Transmission (a) and scanning (b) electron micrographs of the embryonic dermis at 48 days EGA beginning at the DEJ. The matrix is less evident in the sectioned sample (a) than in the whole‐mount specimen (b) (a, ×4500; b, ×1500).

7

of the interstitial matrix permit more rapid diffusion of substances than the mature skin. The dermis in the embryo is highly cellular (Figs  1.2 and 1.10), but it also contains the extracellular fibrous matrix proteins, types I, III, V and VI interstitial collagens, characteristic of adult dermis [30,36–43]. Small bundles of collagen accumulate in a thin, dense layer, called the retic­ ular lamina, immediately beneath the dermoepidermal interface (Figs 1.2b, 1.5 and 1.9). They are also dispersed throughout the dermis in varying densities according to the collagen type and age of the embryo. Types I, III and VI collagen are distributed uniformly throughout the dermis. Type V collagen is concentrated primarily along basement membranes (at the DEJ and around blood ves­ sels) and surrounding cells (Fig.  1.11). Fibre bundles within the interstitial spaces are widely dispersed by a hydrated, hyaluronic acid‐rich proteoglycan matrix [44,45] (Figs 1.11 and 1.12). The fluidity of the matrix at this stage permits migration of mesenchymal cells to sites of active tissue morphogenesis. A broader zone of sulphated proteoglycan‐rich matrix, called the compact mesenchyme, is delineated beneath the epidermis on the basis of its rich concentration of cells that express growth factor receptors – the platelet‐derived growth factor receptor β (PDGFR‐β) and PDGFR‐α (see Fig. 1.6), nerve growth factor receptor (NGFR) – and cell adhesion molecules (e.g. neural cell adhesion molecule, NCAM) [44,45]. Evidence from the skin of non‐human species during development has shown enlargement of the composition of growth factors and receptors and adhesion molecules that are included in this dermal zone (reviewed in [44] and [46–48]). The compact mesenchyme may be involved in the exchange of signals between the epidermis and dermis and may be very important in stimulating the onset of appendage formation. Many of the growth factors that correspond to the receptors on the mesenchymal cells are produced by cells of the develop­ ing epidermis (e.g. PDGF‐AA, PDGF‐BB and NGF) (Fig. 1.6). The compact mesenchyme may also be the earli­ est evidence of a papillary dermis. In the adult, the modi­ fied composition and structure of the papillary dermis probably reflects molecular interactions between the epi­ dermal and dermal cells, similar to the situation of the compact mesenchyme. Elastic fibres are not formed in the embryonic skin, but fibrillin (the microfibrils of elastic fibres) (Fig.  1.13) and elastin proteins of the elastic fibre can be identified immu­ nohistochemically [30,36–40,42] and microfibrils can be seen by electron microscopy [30]. Fine nerve fibres and capillaries are present within the compact mesenchyme and deeper dermis (Fig.  1.14a), and large nerve trunks and vessels are readily apparent in the subcutaneous region. Reconstructions of vessels from serial sections of developing first‐trimester skin have shown that the basic pattern of cutaneous vasculature is established in the first trimester [49]. New vessels pre­ sumably both form de novo from dermal mesenchyme and sprout from deeper, established vessels through a process that includes endothelial cell migration, capillary budding and vessel remodelling [50]. Pieces of full‐thickness

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

Chapter 1  Embryogenesis of the Skin

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

8

Section 1  Development, Structure and Physiology of the Skin

(a)

(b)

(c)

(d)

Fig. 1.11  Samples of embryonic skin immunostained with antibodies that recognize type I (a), III (b), V (c) and VI (d) collagens. Note that all of the collagens are concentrated beneath the DEJ but types III and V, especially, are found in association with all basement membranes. Types I, III and VI are found in the matrix throughout the dermal and subcutaneous tissue (a–c, ×150; d, ×300). Source: Immunostaining courtesy of Dr Lynne T. Smith.

Fig. 1.12  Section of the body wall from a 57‐day EGA embryo treated with the Alcian blue/periodic acid–Schiff (PAS) histochemical stains. The bright pink staining of the epidermis (glycogen) and DEJ (glycoproteins) indicates a PAS‐positive reaction. The blue dermis reflects the high content of hyaluronic acid. The dermal–subcutaneous boundary is marked by a transition to a lighter slightly purple reaction indicating more of the collagen–glycosaminoglycan complex (×300). Source: Immunohistochemistry courtesy of Dr Richard Frederickson.

Fig. 1.13  Section of skin from a 57‐day EGA human embryo immunostained with an antifibrillin antibody. Note staining throughout the dermis (×200). Source: Immunostaining courtesy of Dr Lynne T. Smith.

(a)

(b)

(c) Fig. 1.14  Sections of human embryonic skin at 42 days EGA (a) and 59 days EGA (b) immunostained with PGP 9.5, which recognizes all cutaneous nerves, and of a sample of 52‐day EGA embryonic skin (c) immunostained with p75 antibody, which recognizes the low‐affinity NGFR. Note the large nerve trunks deep in the subcutaneous tissue (a), the significant density of the fine fibres in the tangential section of the dermis of (b) and the distribution of both nerves and vessels (c) (a, ×100; b, ×200; c, ×200).

skin and sections of skin immunostained with an anti­ body that demonstrates all cutaneous nerves (protein gene product 9.5 or PGP 9.5) [51,52] reveal finely beaded nerve filaments distributed in an impressive density in the subepidermal region and in association with blood vessels (Fig. 1.14b and c). The number of fibres recognized by this antibody increases during development as the

9

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

Chapter 1  Embryogenesis of the Skin

Fig. 1.15  Nerves and vessels in the skin of a 79‐day EGA human fetus immunostained with an anti‐neurofilament antibody. Note the positively stained nerve network, the immunopositive cells (presumably Merkel cells) and the vascular network (clear) (×25). Source: Immunostaining courtesy of Dr Mark Bressler.

fibres become organized in networks throughout the ­ ermis and in relation to developing epidermal append­ d ages [53]. At 7 weeks EGA, a few calcitonin gene‐related product (CGRP)‐immunopositive fibres, denoting sen­ sory fibres, are also evident [53], but autonomic nerves are not yet recognized in the skin. Staining the tissue with the p75 low‐affinity NGFR antibody also reveals the pat­ terns of nerve fibres and specific concentrations of mesen­ chymal cells (e.g. around developing hair follicles) [54]. Both nerves and vessels are visible in stained, full‐thickness samples of the nearly transparent skin (Fig. 1.15). ­References 1 Sharp F. A quantitative study of the glycogen content of human fetal skin in the first trimester. J Obstet Gynaecol Br Commonw 1971;78:981–6. 2 Dale BA, Holbrook KA, Kimball JR et al. Expression of the epidermal keratins and filaggrin during fetal human development. J Cell Biol 1985;101:1257–69. 3 Moll R, Moll I, Wiest W. Changes in the pattern of cytokeratin poly­ peptides in epidermis and hair follicles during skin development in human fetuses. Differentiation 1983;23:170–8. 4 Dabelsteen E, Holbrook KA, Clausen H et  al. Cell surface carbohy­ drate changes during embryonic and fetal skin development. J Invest Dermatol 1986;87:81–5. 5 Moll R, Moll I. Early development of human Merkel cells. Exp Dermatol 1992;1:180–4. 6 Piepkorn M, Underwood RA, Henneman C et  al. Expression of amphiregulin is regulated in cultured human keratinocytes and in developing fetal skin. J Invest Dermatol 1996;105:802–9. 7 Nanney LB, Stoscheck CM, King LE et  al. Immunolocalization of ­epidermal growth factor receptors in normal developing human skin. J Invest Dermatol 1990;94:742–8. 8 Fujita M, Furukawa F, Fujii K et al. Expression of cadherin molecules during human skin development: morphogenesis of epidermis, hair follicles and eccrine sweat ducts. Arch Dermatol Res 1992; 284:159–66. 9 Gown AM, Vogel AM, Hoak D et al. Monoclonal antibodies specific for melanocytic tumors distinguish populations of melanocytes. Am J Pathol 1986;123:195–203. 10 Smoller BR, Hsu A, Krueger J. HMB‐45 monoclonal antibody recog­ nizes an inducible and reversible melanocyte cytoplasmic protein. J Cutan Pathol 1991;8:315–22. 11 Holbrook KA, Underwood RA, Vogel AM et al. The appearance, den­ sity and distribution of melanocytes in human embryonic and fetal skin revealed by the anti‐melanoma monoclonal antibody, HMB45. Anat Embryol 1989;180:443–55.

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

10

Section 1  Development, Structure and Physiology of the Skin

12 Foster CA, Holbrook KA, Farr AG. Ontogeny of Langerhans cells in human embryonic and fetal skin: expression of HLA‐DR and OKT‐6 determinants. J Invest Dermatol 1986;86:240–3. 13 Drijkoningen M, DeWolf‐Peeters C, VanDerSteen K et al. Epidermal Langerhans cells and dermal dendritic cells in human fetal and neo­ natal skin: an immunohistochemical study. Pediatr Dermatol 1987;4:11–17. 14 Foster CA, Holbrook KA. Ontogeny of Langerhans cells in human embryonic and fetal skin: cell densities and phenotypic expression relative to epidermal growth. Am J Anat 1989;84:157–64. 15 Kim D‐G, Holbrook KA. The appearance, density and distribution of Merkel cells in human embryonic and fetal skin: their relation to sweat gland and hair follicle development. J Invest Dermatol 1995;104:411–16. 16 Moll I, Moll R, Franke W. Formation of epidermal and dermal Merkel cells during human fetal skin development. J Invest Dermatol 1986;87:779–87. 17 Moll R, Löwe A, Laufer J et al. Cytokeratin 20 in human carcinomas: a new histodiagnostic marker detected by monoclonal antibodies. Am J Pathol 1992;140:427–47. 18 Moll I, Kuhn C, Moll R. Cytokeratin 20 is a general marker of cutane­ ous Merkel cells while certain neuronal proteins are absent. J Invest Dermatol 1995;104:910–15. 19 Vos P, Stark F, Pittman RN. Merkel cells in vitro: production of nerve growth factor and selective interactions with sensory neurons. Dev Biol 1991;144:281–300. 20 Reed‐Geaghan EG, Wright MC, See LA et al. Merkel cell‐driven BDNF signaling specifies SAI neuron molecular and electrophysiological phenotypes. J Neurosci 2016;36:4362–76. 21 Narisawa Y, Hashimoto K, Nakamura Y et al. A high concentration of Merkel cells in the bulge prior to the attachment of the arrector pili muscle and the formation of the perifollicular nerve plexus in human fetal skin. Arch Dermatol Res 1993;285:261–8. 22 Moore SJ, Munger BL. The early ontogeny of the afferent nerves and papillary ridges in human digital and glabrous skin. Dev Brain Res 1989;48:119–41. 23 Moll I, Lane AT, Franke WW et al. Intraepidermal formation of Merkel cells in xenografts of human fetal skin. J Invest Dermatol 1990; 94:359–64. 24 Tilling T, Wladykowski E, Failla AV et al. Immunohistochemical anal­ yses point to epidermal origin of human Merkel cells. Histochem Cell Biol 2014;141:407–21. 25 Marinkovich MP, Keene DR, Rimberg CL. Cellular origin of the der­ mal–epidermal basement membrane. Dev Dyn 1993;196:255–67. 26 Christiano AM, Uitto J. Molecular complexity of the cutaneous base­ ment membrane zone: revelations through the paradigms of epider­ molysis bullosa. Exp Dermatol 1996;5:1–11. 27 Uitto J, Pulkkinen L. Molecular complexity of the cutaneous basement membrane zone. Mol Biol Rep 1996;23:35–46. 28 Fine JD, Smith LT, Holbrook KA et al. The appearance of four base­ ment membrane zone antigens in developing human fetal skin. J Invest Dermatol 1984;83:66–9. 29 Smith LT, Sakai LY, Burgeson RE et al. Ontogeny of structural compo­ nents at the dermal–epidermal junction in human embryonic and fetal skin: the appearance of anchoring fibrils and type VII collagen. J Invest Dermatol 1988;90:480–5. 30 Holbrook KA. Structure and function of the developing human skin. In: Goldsmith LA (ed.) Physiology, Biochemistry and Molecular Biology of the Skin, 2nd edn. Oxford: Oxford University Press, 1991:63–110. 31 Hopkinson SB, Riddelle KS, Jones JCR. Cytoplasmic domain of the 180‐kD bullous pemphigoid antigen, a hemidesmosomal component: molecular and cell biologic characterization. J Invest Dermatol 1992;99:264–70. 32 Ishiko A, Shimizu H, Kikuchi A et al. Human autoantibodies against the 230 kD bullous pemphigoid antigen (BPAG1) bind only to the intracellular domain of hemidesmosome, whereas those against the 180 kD bullous pemphigoid antigen (BPAG2) bind along the plasma membrane of hemidesmosome in normal human and swine skin. J Clin Invest 1993;91:1608–15. 33 Verrando P, Blanchet‐Bardon C, Pisani A et al. Monoclonal antibody GB3 defines a widespread defect of several basement membranes and a keratinocyte dysfunction in patients with lethal junctional epider­ molysis bullosa. Lab Invest 1991;64:85–92. 34 Fine J‐D, Horiguchi Y, Couchman JR. 19‐DEJ‐1, a hemidesmosomal– anchoring filament complex associated monoclonal antibody: definition

of a new skin basement membrane antigenic defect in junctional and dystrophic epidermolysis bullosa. Arch Dermatol 1989; 125:520–3. 35 Burgeson RE. Type VII collagen, anchoring fibrils and epidermolysis bullosa. J Invest Dermatol 1993;101:252–5. 36 Holbrook KA. Structural and biochemical organogenesis of skin and cutaneous appendages in the fetus and neonate. In: Polin RA, Fox WW (eds) Neonatal and Fetal Medicine Physiology and Pathophysiology. New York: Grune & Stratton, 1992:527–51. 37 Holbrook KA, Wolff K. The structure and development of skin. In: Fitzpatrick TB, Eisen AZ, Wolff K et al. (eds) Dermatology in General Medicine, 6th edn. New York: McGraw‐Hill, 1993:97–144. 38 Holbrook KA, Sybert VP. Basic science. In: Schachner L, Hansen R (eds) Pediatric Dermatology, 2nd edn. New York: Churchill Livingstone, 1995. 39 Smith LT, Holbrook KA, Byers PH. Structure of the dermal matrix during development and in the adult. J Invest Dermatol 1982; 79:93S–104S. 40 Smith LT, Holbrook KA. Development of dermal connective tissue in human embryonic and fetal skin. Scan Electron Microsc 1982: 1745–51. 41 Smith LT, Holbrook KA, Madri JA. Collagens types I, III and V in human embryonic and fetal skin. Am J Anat 1986;175:507–22. 42 Smith LT, Holbrook KA. Embryogenesis of the dermis. Pediatr Dermatol 1986;3:271–80. 43 Smith LT. Patterns of type VI collagen compared to types I, III, and V collagen in human embryonic and fetal skin and in fetal skin‐derived cell cultures. Matrix Biol 1994;14:159–70. 44 Holbrook KA, Smith LT, Kaplan ED et al. The expression of morphogens during human follicle development in vivo and a model for studying follicle morphogenesis in vitro. J Invest Dermatol 1993;101:39S–49S. 45 Kaplan ED, Holbrook KA. Dynamic expression patterns of tenascin, proteoglycans and cell adhesion molecules during human hair follicle morphogenesis. Dev Dyn 1994;199:141–55. 46 Chuong C‐M, Widelitz RB, Jiang T‐X. Adhesion molecules and home­ oproteins in the phenotypic determination of skin appendages. J Invest Dermatol 1993;101:10S–15S. 47 Chuong C‐M, Widelitz RB, Ting‐Berreth S et al. Early events during avian skin appendage regeneration: dependence on epithelial–mes­ enchymal interaction and order of molecular reappearance. J Invest Dermatol 1996;107:639–46. 48 Widelitz RB, Jiang T‐X, Noveen A et  al. FGF induces new feather buds from developing avian skin. J Invest Dermatol 1996;107: 797–803. 49 Johnson CL, Holbrook KA. Development of human embryonic and fetal dermal vasculature. J Invest Dermatol 1989;93:10S–17S. 50 Karelina TV, Goldberg GI, Eisen AZ. Matrix metalloproteinases in blood vessel development in human fetal skin and in cutaneous tumors. J Invest Dermatol 1995;105:411–17. 51 Dalsgaard CJ, Rydh M, Haegerstrand A. Cutaneous innervation in man visualized with protein gene product 9.5 (PGP 9.5) antibodies. Histochemistry 1989;92:385–9. 52 Gulbenkian S, Wharton J, Polak JM. The visualisation of cardiovascu­ lar innervation in the guinea pig using an antibody to protein gene product 9.5. J Autonom Nerv Syst 1987;18:235–47. 53 Terenghi G, Sundaresan M, Moscoso G et  al. Neuropeptides and a neuronal marker in cutaneous innervation during human foetal development. J Comp Neurol 1993;328:595–603. 54 Holbrook KA, Bothwell MA, Schatteman G et al. Nerve growth factor receptor labelling defines developing nerve networks and stains ­follicle connective tissue cells in human embryonic and fetal skin. J Invest Dermatol 1988;90:609A.

­Embryonic–fetal transition The most remarkable time in skin development is the embryonic–fetal transition, which occurs at approxi­ mately 2 months’ gestation, when the embryo measures about 31 mm in length (crown–rump), weighs about 2.5 g and has a humanoid appearance. The skin and the under­ lying tissues of the body wall are translucent, revealing the ribs and solid organs. The skin has a mucoid quality (Fig. 1.16). In spite of this structural simplicity, the cells in

11

c

n

c n

(a)

M Fig. 1.16  Sample of human fetal skin of 80 days EGA held at the tips of a forceps and demonstrating the mucoid quality of the tissue.

the skin begin to express characteristics of adult skin. The 2‐month age is thus identified as an important landmark in skin development (see Fig.  1.1). Since this period of development begins the establishment of adult character­ istics of the skin, it is a stage that is vulnerable to errors in development. The most apparent change in the skin is the stratification of the epidermis from two to three cell layers (Fig. 1.17a and b). An intermediate cell layer is added as the product of basal cell mitoses. Basal cells divide asyn­ chronously to produce an epidermis that, initially, remains two‐layered at some sites and at others becomes three lay­ ers thick. Intermediate cells are both similar to and distinct from basal and periderm cells. Keratins are more abundant and distributed in a more specific distribution than in the cells in the basal and periderm layers; small bundles of keratin filaments associated with desmosomes outline the boundaries of the intermediate cells (Fig. 1.17b). The expression of the major keratin pairs in both basal‐ and intermediate‐layer keratinocytes in the early fetal epi­ dermis is now identical to the expression of the keratins in the fully keratinized adult epidermis. The K5 and K14 basal cell keratins are downregulated in the intermedi­ ate cells and a new keratin pair, K1 (56.5 kDa) and K10 (67  kDa), the high‐molecular‐weight differentiation‐ specific keratins, is synthesized [1,2] (Fig.  1.18). Other markers of keratinocyte differentiation (e.g. pemphigus antigen [3], cornified cell envelope proteins [4,5], blood group antigens [6] and cell‐surface glycoproteins [7]; reviewed in [8–11]) are also expressed in the cytoplasm or

n

(b) Fig. 1.17  Skin from a human fetus of approximately 70–89 days EGA shown at the light (a) and electron (b) microscopic levels. Note the intermediate layer of cells between basal and periderm epidermal layers, the distinction between dermis and subcutaneous tissue based on differences in the orientation of fibroblastic cells, the density of collagenous matrix and the subcutaneous vascular plane. Small nerves (n) and capillaries (c) are evident in the dermis. Segments of melanocytes (M) are evident within the basal layer and collagen is accumulated beneath the DEJ (×3675).

on the surface of intermediate‐layer cells. Like the peri­ derm and basal cells, the first intermediate cells still con­ tain glycogen as the primary cytoplasmic component (Fig. 1.17a and b). Thus, at this stage, when the epidermis is only a few cell layers thick, and has few similarities in morphology to adult epidermis, it possesses all of the keratins and many of the other markers that are typical of the epidermis throughout life. Therefore, genetic ­diseases that involve mutations in keratin proteins have the potential of being expressed as early as the first trimester in development.

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

Chapter 1  Embryogenesis of the Skin

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

12

Section 1  Development, Structure and Physiology of the Skin

(a)

(b) Fig. 1.18  Keratin filaments in the cells of the intermediate layer of 77‐day EGA fetal skin stain positively with the AE2 monoclonal antibody, which recognizes the K1 and K10 differentiation‐specific keratins (a). The reaction pattern is even stronger when a second intermediate layer is added at the beginning of the second trimester (b) (a, ×120; b, ×120). Fig. 1.20  Scanning electron micrograph of the periderm of a 60‐ to 70‐day EGA human fetus showing the blebs and microvilli that modify the amniotic surface (×8000).

Fig. 1.19  Skin from a 72‐day EGA fetus immunoreacted with an anti‐epidermal growth factor receptor showing a reaction pattern on the membranes of basal and intermediate layer cells and on the basal and lateral borders of periderm cells (×120).

Initially, the keratinocytes of both basal and intermediate cell layers express epidermal growth factor (EGF) recep­ tors [12] (Fig. 1.19), respond to EGF and retain the ability to proliferate [13,14]. Near the end of the first trimester, however, the proliferative cells become restricted primar­ ily to the basal layer [13,14]; only the basal cells express P‐cadherin [15], a marker of proliferative ability. Basal cells change in morphology and cell‐surface properties after stratification. A greater volume of the cytoplasm is occupied by organelles and keratin filaments than with glycogen, and cell‐surface carbohydrates that correlate with stratification and differentiation are differentially expressed by cells of the basal and intermediate layers [7,16]. Selected basal‐ and intermediate‐layer keratino­ cytes participate in the formation of the epidermal appendages: the pilosebaceous structures, nails and teeth, and the eccrine sweat glands in thick skin. The morpho­ genesis of these structures is described under Unique fea­ tures of developing human skin. The cells of the periderm increase in size and develop microvilli‐covered blebs that extend from the outermost surface of the cell into the amniotic cavity (Fig. 1.20). The molecular species of keratins remain the same as they were in the embryonic periderm cells, but the cells lose their ability to divide and to express P‐cadherin [13,17]. Because the epidermal cells that are located in the more superficial layers express differentiation‐related antigens, it is appealing to link stratification and the onset of

Fig. 1.21  Section of skin from an 82‐day EGA fetus immunostained with the HMB‐45 antibody, which recognizes melanocytes. Note the high density of the cells and their position within the basal epidermal layer (×200).

­ ifferentiation. There must be more processes involved, d however, than simply the addition of cell layers because embryonic skin maintained in suspension organ culture stratifies to become several layers thick but will not dif­ ferentiate in the manner characteristic of early fetal skin in vivo [18,19]. Melanocytes are easily recognized in sections of fetal epidermis at 8 weeks EGA by their position along the basement membrane, dense cytoplasm, an absence of glycogen and a heterochromatic nucleus [20]. Around 80 days EGA, they are present in the epidermis in maxi­ mal density (∼3000 cells/mm2) [20] compared with all other stages of skin development, and in a nonrandom distribution among cells of the basal layer (Fig. 1.21). The numbers decrease towards birth then continue to decline over the decades of postnatal life. The high numbers of melanocytes around the embryonic–fetal transition may reflect the fact that these cells arrive early in the skin, pro­ liferate and remain close together before there is substan­ tial growth of the fetus. The labelling index of keratinocytes is also high [13] at this stage, suggesting that the paracrine interactions between melanocytes and keratinocytes that occur in the adult skin may be established early in devel­ opment [20]. Melanosomes are recognized late in the third month of development (Fig.  1.22) and show some

Fig. 1.22  Section through late embryonic–early fetal skin showing developing melanosomes in a melanocyte positioned between keratinocytes in the basal layer. The early age of the tissue is confirmed by the immature structure of the DEJ (×25 000).

Fig. 1.23  Epidermal sheet from an 80‐day EGA fetus reacted to demonstrate ATPase. Note the regular distribution and density of these highly dendritic cells (×120).

evidence of pigment formation in selected sites of the body. Understanding the density of melanocytes and the onset of pigment synthesis had been previously useful in prenatal diagnosis of tyrosinase‐negative oculocutaneous albinism, a technique no longer used [15,21]. Langerhans cells are also abundant in the epidermis at this stage (∼50/mm2) [22,23]. Unlike melanocytes, which migrate into the epidermis only during the embryonic period, the bone marrow‐derived Langerhans cells migrate into the epidermis continually throughout life; their numbers do not increase significantly, however, until the third trimester and after birth [22,23]. Langerhans cells at 80 days EGA are highly dendritic (Fig.  1.23), begin to express CD1a at the surface [22–24] and develop Birbeck granules in the cytoplasm, suggesting that they may be capable of processing and presenting antigen in utero. The number of cells that are HLA‐DR positive is ­significantly greater than the number that express CD1a at this stage;

13

Fig. 1.24  Section of skin from the palm of an 83‐day EGA fetus immunostained to recognize keratin 18 (green), an antibody that recognizes Merkel cells within the basal layer. Note the regular distribution of cells, presumably marking the sites of primary epidermal ridge location. The skin of the hand is more advanced in development than that of the trunk at an equivalent age (×300). Source: Immunostaining courtesy of Dr Dong‐Kun Kim.

however, by about 13 weeks EGA Langerhans cells seem to express both markers with reasonable consistency. By the end of the first trimester, Merkel cells are located along the primary epidermal ridges of palmar skin in regular alignment relative to the sites of origin of the sweat duct primordia and at a maximum density of ∼1400 cells/mm2 [25,26] (Fig.  1.24). In hair‐bearing skin, they first become evident in association with the developing hair germs. At later stages in follicle development, they concentrate in the infundibulum and bulge regions of the hair pegs and bulbous hair pegs [27,28]. It is likely that the dermal Merkel cells originate in the follicular or interfol­ licular epidermis and migrate into the dermis, where they are suggested to play a role at early stages of develop­ ment in attracting and organizing nerve fibres in the upper dermis and around developing appendages [29]. Merkel cells in the interfollicular epidermis lack NGF receptors (and produce NGF [30]), but dermal Merkel cells and Merkel cells of the developing follicle are immu­ nopositive when the tissue is reacted with the p75 NGF antibody [29]. It must be recognized, however, that nerve fibres are already apparent in the embryonic dermis before dermal Merkel cells are detectable; thus, other fac­ tors must also attract or direct nerves into the skin. Other morphological markers that are characteristic for Merkel cells in postnatal skin, such as dense core granules, are not apparent in dermal Merkel cells at this stage. Merkel cells decrease in number during the later stages of fetal development [29]. The DEJ has acquired all of the adult features that are characteristic for this region (Fig. 1.25). Hemidesmosomes, anchoring filaments and anchoring fibrils are structurally complete, and the antigens related to these attachment structures, the skin‐specific markers of the DEJ, are also expressed [31–33]. Immunostaining with an antibody to type VII collagen outlines the DEJ with high intensity [32] and stains basal cell cytoplasm (the primary source of this protein) with low intensity. Nonetheless, the structural organization of the DEJ appears delicate in contrast to the

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

Chapter 1  Embryogenesis of the Skin

Section 1  Development, Structure and Physiology of the Skin

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

14

(a) Fig. 1.25  Transmission electron micrograph of the DEJ of a 78‐day EGA human fetus. Note the well‐formed hemidesmosomes and associated keratin filaments, anchoring filaments within the lamina lucida and fine anchoring fibrils (×47 500).

(b) Fig. 1.27  Light micrograph of 78‐day EGA human skin showing the vascular pattern organized in a series of horizontal plexuses and vertical connecting vessels (a, b). Note that the diameters of the vessels become increasingly smaller towards the epidermal surface. In the higher‐magnification image, the rounder cells of the papillary dermis are distinct from the more elongated fibroblastic cells of the reticular dermis and subcutaneous region (a, ×25; b, ×100). Source: Micrographs courtesy of Dr Greg Hébert.

Fig. 1.26  Light micrograph of 72‐day EGA fetal dermis stained with the Alcian blue/periodic acid–Schiff (PAS) histochemical stain. The low‐ magnification image shows the clear demarcation between the dermal and subcutaneous tissue and the different concentrations of fibrous and glycosaminoglycan matrix proteins in the two regions. A vascular plane also demarcates the two regions. Skeletal muscle is evident in the lower right corner of the micrograph (×200). Source: Histochemical staining courtesy of Dr Richard Frederickson.

robust structure of the basal lamina and anchoring fibrils in adult skin. The dermoepidermal interface is still flat although modifications of individual basal cells begin to alter the smoothness of this junction. The dermis and subcutaneous tissue are distinguished on a morphological basis by differences in the organiza­ tion and composition of the matrix (Fig. 1.26). Dermal and

subcutaneous mesenchymal cells still retain glycogen in the cytoplasm, but they have assumed a distinctly fibro­ blastic morphology and are responsible for the synthesis of all of the matrix molecules that are characteristic of adult dermis. There is accumulation of small bundles of fibrous proteins within the interstitial space and papillary and reticular regions of the dermis are demarcated on the basis of increased cell density proximal to the epidermis (the papillary region) and larger collagen fibril diameter and fibre bundle size in the reticular region [9,34–36] (Fig.  1.27b). The position of the subpapillary vascular plexus of arterioles and postcapillary venules also forms an approximate boundary between these two dermal zones. In spite of the significant accumulation of matrix protein, the dermis remains highly cellular, with the matrix accounting for substantially less of the bulk of the skin than it does in the postnatal infant and the adult. The skin is still transparent enough to permit the net­ works of vessels and nerves to be seen through the body wall of the fetus (Fig. 1.28). The vessels are organized in the dominant pattern of adult skin, with one plexus located at the dermosubcutaneous boundary and another

15

lumina of some of these structures suggest that they may belong to the venous side of the vasculature although the simplicity of the wall structure would suggest they could be lymphatics.

Fig. 1.28  Whole‐mount sample of unfixed 74‐day EGA fetal skin showing the vascular network of the skin through the translucent tissue of the body wall (×63). Source: Micrograph courtesy of Dr Carole Johnson.

Fig. 1.29  Section of skin from a 77‐day EGA fetus immunostained with the PGP 9.5 antibody, which recognizes all cutaneous nerves. Note the larger trunks deep in the dermis and the fine network of fibres that supplies the epidermis (×100). Source: Immunostaining courtesy of Dr Dong‐Kun Kim.

at the boundary between the papillary and reticular der­ mis (Fig. 1.27a). Vertically orientated vessels connect the two horizontal plexuses, and fine capillaries extend into the papillary dermis [8–11]. Nerves are also readily appar­ ent in both sections and whole‐mount preparations of skin that are immunostained with the p75 antibody to NGFR [37], neurofilament protein, PGP 9.5 (Fig.  1.29), CGRP and neuropeptide Y (NPY). NPY recognition of certain fibres associated with blood vessels signifies the presence of autonomic fibres [38]. Like the vessels, large subcutaneous nerve trunks branch to finer and finer fibres that terminate beneath the DEJ. The nerve and vascular networks are at times parallel but are also separate from one another (see Fig. 1.15). The hypodermis appears to have markedly fewer cells than either region of the dermis, and smaller bundles of fibrous matrix. Dilated channels course through the hypo­ dermis, distinguishing it from deeper tissue of the body wall (see Figs 1.26 and 1.27). Red blood cells within the

­References 1 Dale BA, Holbrook KA, Kimball JR et al. Expression of the epidermal keratins and filaggrin during fetal human development. J Cell Biol 1985;101:1257–69. 2 Moll R, Moll I, Wiest W. Changes in the pattern of cytokeratin poly­ peptides in epidermis and hair follicles during skin development in human fetuses. Differentiation 1983;23:170–8. 3 Lane AT, Helm HF, Goldsmith LA. Identification of bullous pemphig­ oid, pemphigus, laminin and anchoring fibril antigens in human fetal skin. J Invest Dermatol 1985;84:27–30. 4 Holbrook KA, Underwood RA, Dale BA et al. Formation of the corni­ fied cell envelope in human fetal skin: presence of involucrin, kerato­ linin, loricrin and transglutaminase correlated with the onset of transglutaminase activity. J Invest Dermatol 1991;96:542A. 5 Akiyama M, Smith LT, Yoneda K et al. Expression of transglutaminase 1 (TG1) and cornified cell envelope (CCE) proteins during human epi­ dermal development. J Invest Dermatol 1997;108:598. 6 Dabelsteen E, Holbrook KA, Clausen H et  al. Cell surface carbohy­ drate changes during embryonic and fetal skin development. J Invest Dermatol 1986;87:81–5. 7 Watt FM, Keeble S, Fisher C et al. Onset of expression of peanut lectin binding glycoproteins is correlated with stratification of keratinocytes during human epidermal development in vivo and in vitro. J Cell Sci 1989;94:355–9. 8 Holbrook KA. Structure and function of the developing human skin. In: Goldsmith LA (ed.) Physiology, Biochemistry and Molecular Biology of the Skin, 2nd edn. Oxford: Oxford University Press, 1991:63–110. 9 Holbrook KA. Structural and biochemical organogenesis of skin and cutaneous appendages in the fetus and neonate. In: Polin RA, Fox WW (eds) Neonatal and Fetal Medicine Physiology and Pathophysiology. New York: Grune & Stratton, 1992:527–51. 10 Holbrook KA, Wolff K. The structure and development of skin. In: Fitzpatrick TB, Eisen AZ, Wolff K et al. (eds) Dermatology in General Medicine, 6th edn. New York: McGraw‐Hill, 1993:97–144. 11 Holbrook KA, Sybert VP. Basic science. In: Schachner L, Hansen R (eds) Pediatric Dermatology, 2nd edn. New York: Churchill Livingstone, 1995. 12 Nanney LB, Stoscheck CM, King LE et  al. Immunolocalization of ­epidermal growth factor receptors in normal developing human skin. J Invest Dermatol 1990;94:742–8. 13 Bickenbach JR, Holbrook KA. Label retaining cells (LRCs) in human embryonic and fetal epidermis. J Invest Dermatol 1986;88:42–6. 14 Bickenbach JR, Holbrook KA. Proliferation of human embryonic and fetal epidermal cells in organ culture. Am J Anat 1986;177:97–106. 15 Gershoni‐Baruch R, Benderly A, Brandes JM et al. Dopa reaction test in hair bulbs of fetuses and its application to the prenatal diagnosis of albinism. J Am Acad Dermatol 1991;24:220–2. 16 Fisher C, Holbrook KA. Cell surface and cytoskeletal changes associ­ ated with epidermal stratification in organ cultures of embryonic human skin. Dev Biol 1987;119:231–41. 17 Piepkorn M, Underwood RA, Henneman C et  al. Expression of amphiregulin is regulated in cultured human keratinocytes and in developing fetal skin. J Invest Dermatol 1996;105:802–9. 18 Holbrook KA, Minami SA. Hair follicle morphogenesis in the human: characterization of events in vivo and in vitro. NY Acad Sci 1991;642:167–96. 19 Holbrook KA, Smith LT, Kaplan ED et al. The expression of morpho­ gens during human follicle development in vivo and a model for studying follicle morphogenesis in vitro. J Invest Dermatol 1993;101:39S–49S. 20 Holbrook KA, Underwood RA, Vogel AM et al. The appearance, den­ sity and distribution of melanocytes in human embryonic and fetal skin revealed by the anti‐melanoma monoclonal antibody, HMB‐45. Anat Embryol 1989;180:443–55. 21 Eady RAJ, Gunner DB, Garner A et al. Prenatal diagnosis of oculocu­ taneous albinism by electron microscopy. J Invest Dermatol 1983;80:210–12. 22 Drijkoningen M, DeWolf‐Peeters C, VanDerSteen K et al. Epidermal Langerhans cells and dermal dendritic cells in human fetal and

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

Chapter 1  Embryogenesis of the Skin

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

16

Section 1  Development, Structure and Physiology of the Skin

neonatal skin: an immunohistochemical study. Pediatr Dermatol 1987;4:11–17. 23 Foster CA, Holbrook KA. Ontogeny of Langerhans cells in human embryonic and fetal skin: cell densities and phenotypic expression relative to epidermal growth. Am J Anat 1989;84:157–64. 24 Foster CA, Holbrook KA, Farr AG. Ontogeny of Langerhans cells in human embryonic and fetal skin: expression of HLA‐DR and OKT‐6 determinants. J Invest Dermatol 1986;86:240–3. 25 Moll R, Moll I, Franke W. Identification of Merkel cells in human skin by specific cytokeratin antibodies: changes in cell density and distri­ bution in fetal and adult plantar epidermis. Differentiation 1984; 28:136–54. 26 Moll R, Moll I. Early development of human Merkel cells. Exp Dermatol 1992;1:180–4. 27 Kim D‐G, Holbrook KA. The appearance, density and distribution of Merkel cells in human embryonic and fetal skin: their relation to sweat gland and hair follicle development. J Invest Dermatol 1995;104:411–16. 28 Narisawa Y, Hashimoto K, Nakamura Y et al. A high concentration of Merkel cells in the bulge prior to the attachment of the arrector pili muscle and the formation of the perifollicular nerve plexus in human fetal skin. Arch Dermatol Res 1993;285:261–8. 29 Narisawa Y, Hashimoto K, Pietruk T. Biological significance of dermal Merkel cells in development of cutaneous nerves in human fetal skin. J Histochem Cytochem 1992;40:65–71. 30 Vos P, Stark F, Pittman RN. Merkel cells in vitro: production of nerve growth factor and selective interactions with sensory neurons. Dev Biol 1991;144:281–300. 31 Fine JD, Smith LT, Holbrook KA et al. The appearance of four base­ ment membrane zone antigens in developing human fetal skin. J Invest Dermatol 1984;83:66–9. 32 Smith LT, Sakai LY, Burgeson RE et al. Ontogeny of structural compo­ nents at the dermal–epidermal junction in human embryonic and fetal skin: the appearance of anchoring fibrils and type VII collagen. J Invest Dermatol 1988;90:480–5. 33 Hertle MD, Adams JC, Watt FM. Integrin expression during human epidermal development in vivo and in vitro. Development 1991; 112:193–206. 34 Smith LT, Holbrook KA, Byers PH. Structure of the dermal matrix during development and in the adult. J Invest Dermatol 1982; 79:93S–104S. 35 Smith LT, Holbrook KA, Madri JA. Collagens types I, III and V in human embryonic and fetal skin. Am J Anat 1986;175:507–22. 36 Smith LT, Holbrook KA. Embryogenesis of the dermis. Pediatr Dermatol 1986;3:271–80. 37 Holbrook KA, Bothwell MA, Schatteman G et al. Nerve growth factor receptor labelling defines developing nerve networks and stains ­follicle connective tissue cells in human embryonic and fetal skin. J Invest Dermatol 1988;90:609A. 38 Terenghi G, Sundaresan M, Moscoso G et  al. Neuropeptides and a neuronal marker in cutaneous innervation during human foetal development. J Comp Neurol 1993;328:595–603.

­Fetal skin Conclusion of the first trimester The first stages of fetal skin development occur from the time of the embryonic–fetal transition at 2 months to the end of the first trimester at 3 months, when a template of the adult skin is established. There are notable features of adult skin that are still lacking. The epidermis has yet to keratinize and one of the key proteins of keratinization, filaggrin, is not yet expressed in any region of the skin. The dermoepidermal interface lacks rete ridges and rete pegs. The dermis lacks fully formed elastic fibres and an elastic fibre network. Ectodermal appendages are just starting formation in limited areas; for example, sweat gland development is initiated only on the palms and soles and apocrine glands have not begun to develop. Hair and nails are not synthesized. Adipose tissue has not differentiated within the mesenchyme of the hypodermis.

All of these features will be initiated and/or fully acquired during the second trimester, and changes will continue to occur in the structures and regions of the skin that have been established but not finalized.

Second‐trimester fetal skin At 12 weeks’ gestation, the fetus measures about 85 mm in length (crown–rump) and has a body form similar to that of the newborn. The skin and body wall are opaque. All of the events in skin morphogenesis initiated during the first trimester continue in the second trimester in parallel with the onset of formation of those structures that were iden­ tified as lacking in first‐trimester skin. Landmark events in the second trimester include completion of the forma­ tion of the lanugo hair follicle and synthesis of the hair (around 17–19 weeks EGA), completion of the formation of the nail (around 20–22 weeks EGA) and keratinization of the interfollicular epidermis (around 22–24 weeks EGA). The timing is variable because the formation of the hair follicle and epidermal keratinization are regionally dependent. Sweat glands on the general body surface only begin to form around 17–18 weeks EGA (see Unique features of developing human skin). The 24‐week‐old fetus is fully formed and has hair on the scalp and body surface. The length is about 228 mm (crown–rump). One or two additional intermediate cell layers are added to the epidermis by proliferation of basal keratino­ cytes and upward migration of the first intermediate cells. By 100–110 days EGA, there are typically three supraba­ sal, intermediate cell layers, which become progressively more flattened towards the epidermal surface (Fig. 1.30). The cells of the most superficial layer have large bundles of keratin filaments, which can be seen in stained specimens at the light microscopic level as a reticulate cytoskeleton (Fig.  1.30). Glycogen is still a major constituent of the cytoplasm. As the epidermis thickens, the interface it forms with the dermis becomes less flattened and smooth, due largely to changes in the basal surface of each keratinocyte rather than to convolutions of the layer itself. Basal cells stain with less intensity than the intermediate‐layer cells because there is less glycogen, the bundles of keratin ­filaments are smaller and the cytoplasm is more ribosome rich, dense and organelle filled (Fig. 1.30). At the end of the second trimester, the five‐layered interfollicular ­epidermis keratinizes. Skin of the trunk shows signs of keratinization around 21 weeks EGA in the uppermost intermediate cell layers and the overlying periderm (Fig. 1.31). Changes in the structure and composition of the plasma membrane mark the formation of a cornified cell enve­ lope [1,2], and lamellar granules are identified in the cyto­ plasm (Fig. 1.31) and in the spaces between intermediate and periderm layers. The modified intermediate cells remain associated with the overlying periderm cells by infrequent and tenuous‐appearing desmosomal attach­ ments. Cells are also evident in which the nucleus is pyk­ notic and the cytoplasm contains dense bundles of filaments, vacuoles and other remnants of the cytoplasm. Cells beneath these seemingly incompletely keratinized

17

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

Chapter 1  Embryogenesis of the Skin

(a)

(b)

Fig. 1.30  Light (a) and electron (b) micrographs of a section of skin from a 104‐day EGA human fetus showing additional intermediate cell layers, changes in periderm morphology, the reticulate keratin cytoskeleton in upper intermediate cells, less intense staining of basal cells (a, b) and the smaller bundles of collagen fibrils in the papillary dermis (a). A melanocyte is evident (a, arrow). Several capillaries (a) and nerves (b, n) lie within the papillary region (a, ×300; b, ×3500).

squames contain very small, stellate keratohyalin gran­ ules and react immunopositively with an antibody that recognizes profilaggrin and filaggrin proteins of the gran­ ule [3] (Fig. 1.31). The two or three subjacent intermediate cell layers can now be called spinous cells. At this stage, periderm cells are very large in diameter, flattened and also display a thickened cell envelope. Each cell covers a cluster of underlying epidermal cells. The periderm stains differently from the underlying epidermal cells, probably owing to a lesser amount of structural protein within the cytoplasm. A few layers of thin, flattened, keratinized cells, organ­ ized in the manner of a true stratum corneum, are first apparent around 22–24 weeks EGA (Fig. 1.32). The granu­ lar cell layer is now more typical of an adult granular layer in that keratohyalin granules are larger and the cytoplasm contains less glycogen. The numbers of layers of the stratum corneum continue to increase in the third trimester to reach a more mature appearance by 34 weeks gestation [4]. Of note, premature birth hastens develop­ ment of mature stratum corneum and epidermal thick­ ness with histologically similar appearance to term infants seen within 2–3 weeks after birth regardless of gestational age [4]. By 22–24 weeks EGA, 1700 Merkel cells/mm2 can be measured in the epidermis [5,6] and the number of Langerhans cells begins to increase (∼200 cells/mm2),

although the adult level of approximately 650 cells/mm2, or about 8500 cells/mm3, is not achieved until after birth [7]. Melanosomes are transferred to keratinocytes in the fifth month of gestation. All of the structures of the DEJ were formed in the first trimester, and only a few antigens of the DEJ (AF‐1 and AF‐2 associated with anchoring fibrils) remain to be rec­ ognized at this age [8]. By 19–21 weeks EGA, the hemides­ mosomes are present at the basal keratinocyte plasma membrane with adult‐like frequency and show a strong association with basal cell keratin filaments. Anchoring filaments and banded anchoring fibrils are well formed (reviewed in [9–12]). Small bundles of interwoven, fibrous connective tissue occupy the interstitial space within the dermis (Fig. 1.33a), although they remain loosely organized because the sul­ phated proteoglycans and fibrous proteins of the intersti­ tial matrix are still very hydrated. Elastin is detectable biochemically, and elastic fibres can be recognized as granular‐appearing structures along the borders of ­collagen fibre bundles in immunostained samples of skin and by electron microscopy. The structure of the elastic fibres, however, even in the deepest portions of the reticu­ lar dermis, is similar to that of the elaunin fibres of adult skin, which have only sparse amounts of elastin associ­ ated with the microfibrillar bundles. The extent to which elastic fibres are developed is dependent upon the region

Section 1  Development, Structure and Physiology of the Skin

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

18

(a)

Fig. 1.32  Electron micrograph of the keratinized epidermis from a fetus at the end of the second trimester. There are a few layers of cornified cells, a single granular cell layer and three layers of spinous cells, which retain a significant quantity of glycogen. Note the greater irregularity in the basal border of the basal cells at the DEJ (×3000).

Third‐trimester fetal skin

(b) Fig. 1.31  Electron micrographs of the skin from two 21‐week EGA fetuses showing early (a) and late (b) changes in the upper intermediate layers (spinous) at the onset of keratinization. Note the regressed periderm separating from the upper epidermal layers (a), lamellar granules in the top few layers (arrows), the small particulate (a) then stellate (b) keratohyalin granules, and the few layers of incompletely keratinized cells (black material) to demonstrate the permeability of the epidermis to tracers (a, ×12 150; b, ×9500). Source: Micrograph (b) courtesy of Dr Richard Frederickson.

of the skin. In addition to fibroblasts, mast cells, mac­ rophages and smooth muscle cells are present in the ­dermis [9–12]. The hypodermis remains distinct from the dermis by its less dense matrix and cellularity. Around 15–16 weeks EGA, mesenchymal cells collect in globular arrays sur­ rounded by a capsule‐like assembly of matrix (Fig. 1.33b). This is the first stage of adipose tissue formation. Small vessels are present within these cellular aggregations. By 18 weeks EGA, lipid droplets are evident within some of the mesenchymal cells, and by 20 weeks lobules of fat are established.

The skin in the third trimester appears structurally similar to postnatal skin (reviewed in [9–13]) (Fig.  1.34). The ­epidermis is fully keratinized, contours are beginning to form at the DEJ, the regions of the dermis are well defined, the adnexa are fully formed and reside deeply in the ­dermis, and large fat lobules fill the hypodermis. There are, however, some notable differences in structure in all regions: suprabasal epidermal cells retain a significant amount of glycogen in the cytoplasm and the dermis remains relatively thin. The bundles of collagen matrix are small elastic fibres and are immature in structure and composition, and the stratum corneum has fewer cell ­layers than infant or adult skin. Studies of the function of skin of the premature infant provide some understanding of the status of the skin dur­ ing the third trimester. In general, various functions of the skin, such as barrier properties, temperature regulation, sweating, response to tactile and mechanical stimuli [14], that have been measured reflect the gestational age more than the birthweight. The epidermis, even though keratinized and possessing several layers of stratum corneum cells, is a less effective barrier than the infant epidermis. Transepidermal water loss, for example, decreases in a steep slope from 26 weeks EGA to 38 weeks EGA. It decreases even further and with a similarly rapid decline over the first 10–15 postnatal days (reviewed in [15,16]). Disorders of keratinization or

19

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

Chapter 1  Embryogenesis of the Skin

(a)

Fig. 1.34  A section through skin obtained from a third‐trimester (34‐week) human fetus showing all regions of the skin and the presence of hair follicles and eccrine sweat glands (×40).

Fig. 1.33  Scanning electron (a) and light (b) micrographs of the human fetal dermis at 15 weeks EGA showing the density of the fibrous matrix, the differences in textures between papillary and reticular regions (a), and the boundary between the dermis and subcutaneous regions (a, b). The developing hair follicles are evident in cross‐section in (a) and in longitudinal section in (b). A lobule of subcutaneous fat (arrows) is evident in (b) (a, ×80; b, ×100).

(reviewed in [15,16]). These compromised epidermal ­ arrier properties, coupled with the fact that the preterm/ b neonatal infant’s body surface‐to‐volume ratio is very high, can place the premature infant at significant risk. Although the structure and cellular differentiation of the sweat glands in the preterm infant and term newborn (see Unique features of developing human skin) appear little, if any, different from those of the infant, the sweat­ ing function requires a period of maturation after birth, presumably for the innervation to become fully estab­ lished. The sweating response is limited or absent in the preterm infant to an extent that correlates with the gesta­ tional age (reviewed in [13]). Apocrine glands begin to secrete during this trimester [9–12]. Some aspects of the vasculature are less organized in the third‐trimester fetus and the newborn than is charac­ teristic in the infant. The marked redness of the newborn reflects the high density of superficial vessels in the der­ mis and the thinness of the epidermis. Remodelling of the microcirculation occurs as appendages and regions of the skin are completed. At birth, the capillary network is still disorganized and will stabilize only after birth (reviewed in [9–12]).

infection of the skin may give an even greater disadvan­ tage to the premature newborn in its ability to regulate substances crossing the skin. The stratum corneum of the preterm infant is more permissive to absorption of sub­ stances from the external environment and those applied to skin to protect, treat or cleanse it in the neonatal nursery

­References 1 Holbrook KA, Underwood RA, Dale BA et  al. Formation of the cornified cell envelope in human fetal skin: presence of involucrin, keratolinin, loricrin and transglutaminase correlated with the onset of transglutaminase activity. J Invest Dermatol 1991;96:542A. 2 Akiyama M, Smith LT, Yoneda K et al. Expression of transglutaminase 1 (TG1) and cornified cell envelope (CCE) proteins during human epi­ dermal development. J Invest Dermatol 1997;108:598 (Abstract).

(b)

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

20

Section 1  Development, Structure and Physiology of the Skin

3 Dale BA, Holbrook KA, Kimball JR et al. Expression of the epidermal keratins and filaggrin during fetal human development. J Cell Biol 1985;101:1257–69. 4 Evans NJ, Rutter N. Development of the epidermis in the newborn. Biol Neonate 1986;49:74–80. 5 Moll R, Moll I, Franke W. Identification of Merkel cells in human skin by specific cytokeratin antibodies: changes in cell density and distri­ bution in fetal and adult plantar epidermis. Differentiation 1984;28:136–54. 6 Kim D‐G, Holbrook KA. The appearance, density and distribution of Merkel cells in human embryonic and fetal skin: their relation to sweat gland and hair follicle development. J Invest Dermatol 1995;104:411–16. 7 Foster CA, Holbrook KA. Ontogeny of Langerhans cells in human embryonic and fetal skin: cell densities and phenotypic expression relative to epidermal growth. Am J Anat 1989;84:157–64. 8 Lane AT, Helm HF, Goldsmith LA. Identification of bullous pemphig­ oid, pemphigus, laminin and anchoring fibril antigens in human fetal skin. J Invest Dermatol 1985;84:27–30. 9 Holbrook KA. Structure and function of the developing human skin. In: Goldsmith LA (ed.) Physiology, Biochemistry and Molecular Biology of the Skin, 2nd edn. Oxford: Oxford University Press, 1991:63–110. 10 Holbrook KA. Structural and biochemical organogenesis of skin and  cutaneous appendages in the fetus and neonate. In: Polin RA, Fox  WW (eds) Neonatal and Fetal Medicine Physiology and Pathophysiology. New York: Grune & Stratton, 1992:527–51. 11 Holbrook KA, Wolff K. The structure and development of skin. In: Fitzpatrick TB, Eisen AZ, Wolff K et al. (eds) Dermatology in General Medicine, 6th edn. New York: McGraw‐Hill, 1993:97–144. 12 Holbrook KA, Sybert VP. Basic science. In: Schachner L, Hansen R (eds) Pediatric Dermatology, 2nd edn. New York: Churchill Livingstone, 1995. 13 Holbrook KA. A histologic comparison of infant and adult skin. In: Boisits E, Maibach HI (eds) Neonatal Skin: Structure and Function. New York: Marcel Dekker, 1982:3–31. 14 Andrews K, Fitzgerald M. The cutaneous withdrawal reflex in human neonates: sensitization, receptive fields, and the effects of contralat­ eral stimulation. Pain 1994;56:95–101. 15 Cartlidge PAT, Rutter N. Skin barrier function. In: Polin RA, Fox WW (eds) Fetal and Neonatal Physiology, Vol. 1. Philadelphia: W.B. Saunders, 1992:3133–42. 16 Chiou YB, Blume‐Peytavi U. Stratum corneum maturation. A review of neonatal skin function. Skin Pharmacol Physiol 2004;17:57–66.

­ nique features of developing human U skin Periderm The periderm is the outermost, transient cellular layer of the developing skin of some mammals and birds. These embryonic epidermal cells are larger than basal keratino­ cytes and cover the entire surface of the early epidermis. The origin of the periderm is not fully elucidated in humans but mouse studies may give some clue to its development. It is possible that the amnion contributes cells to periderm that grow over the single‐layered epidermis. This is sup­ ported by the fact that the amnion and periderm are similar in keratin composition [1,2] and surface morphology and in the expression of other antigens [3,4]. Studies from early mouse embryos, however, suggest that a continuous sheet of tissue may not cover the epidermis as proposed by this model, because patches of periderm cells are present in some sites [5]. The single, ectodermal layer of the early embryo may divide and give rise to a second cell layer that becomes superficial to the basal layer [6]. This is supported by whole‐mount studies showing expression of basal‐layer keratinocytes K5 and K14 in both the single‐layer ectoderm and the periderm [7].

The most remarkable features of the periderm are the morphological changes that the periderm cells undergo with progressive stages of development [8]. Studies of the surface of the developing skin using scanning electron microscopy, and of corresponding tissue sections exam­ ined by light and transmission electron microscopy from consistent regions of the body, have established the stages of human skin development [8] (Fig. 1.35). The early embryo is covered by a thin, flattened pave­ ment epithelium that is the periderm (Fig. 1.4). Around 8–11 weeks, when the epidermis stratifies, the periderm cells increase in volume and develop a rounded external surface. By 10–14 weeks, single blebs extend from the amniotic surface of each cell and the cell increases in diameter (see Fig. 1.20). All of the cell surface, including the blebs, is modified by microvilli. A network of micro­ filaments is organized beneath the plasma membrane. Later in the second trimester, the surfaces of the peri­ derm cells project multiple blebs, the larger of which have the configuration of a blackberry (Figs  1.30 and 1.36). The cell diameter continues to increase as the cells become thinly stretched over the epidermis. By 16–23 weeks EGA, the blebs flatten and the periderm regresses (Fig.  1.37). It once again becomes a very thin layer of cells, which, at this stage, rarely contain a nucleus, have few if any organelles and are composed largely of disor­ ganized, fine filaments [8]. The periderm cells do not undergo the events of dif­ ferentiation that are typical for the keratinocyte. The ­composition of keratins in the periderm cells remains unchanged throughout development and, since neither the K1/K10 keratin proteins nor profilaggrin are present in the periderm cells of any stage, it is clear that they do not undergo full keratinization. The plasma membrane of the early second‐trimester fetal periderm cell, however, appears similar to a cornified envelope (Fig.  1.38a) and the presence of several cornified cell envelope proteins, involucrin, loricrin, keratolinin (cystatin), small proline‐ rich proteins (SPRR) 1 and 2, and the transglutaminase 1 (TG1) enzyme, in the cytoplasm [9,10] of these cells has been demonstrated (Fig.  1.38b–d). The expression of cornified envelope proteins in conjunction with ultras­ tructural studies suggests that periderm cells do contrib­ ute to the cornified envelope. Towards the end of the second trimester, individual periderm cells loosen from the underlying epidermal cells and are desquamated over the sites of elevated and exposed hair canals (follicular epidermis). They remain associated, however, with the interfollicular epidermis until the stratum corneum is formed. At this time, the periderm is mostly gone from the skin surface. The events that lead to disengagement of this layer are not known. Abnormality of periderm shedding is hypothesized to contribute to collodion formation. The structural properties of periderm cells may provide clues as to the function of the layer. The blebs and micro­ villi increase the surface area of the periderm as it faces the amniotic fluid, suggesting that these cells may be important in the exchange of substances between the fetus and the amniotic fluid, across the skin, in one or

21

160 days

Fig. 1.36  Scanning electron micrograph of the periderm from a mid‐second‐ trimester fetus showing multiple, complex blebs and microvilli extending from the amniotic surface (×1500).

Fig. 1.37  Scanning electron micrograph of the surface of the flexor forearm of a late‐second‐trimester fetus showing the large, thin, regressed periderm cells (×800).

both directions. Direct evidence for this role in humans is limited. A morphological study of the intramembranous modifications of the periderm plasma membrane sug­ gests that the cells have a role in regulating water trans­ port [11], and Koren [12] has suggested that the skin absorbs nicotine dissolved in amniotic fluid; in the sheep

fetus, the periderm has been shown to be involved in the uptake of drugs from the amniotic fluid [13]. It has also been postulated that the periderm is a secretory epithe­ lium that adds material to the amniotic fluid [14] and that it serves as a protective layer for the developing epidermis (also reviewed in [15–17]). In mouse models of aberrant

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

Chapter 1  Embryogenesis of the Skin

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

22

Section 1  Development, Structure and Physiology of the Skin

(a)

(b)

(c) (d) Fig. 1.38  Transmission image of the periderm cornified cell envelope from fetal skin of 21 weeks EGA (a). The periderm expresses involucrin early in the first trimester. (b) Data from a 98‐day EGA fetus. Epidermal transglutaminase (c) is also expressed early in the periderm but does not appear to function until the end of the first trimester, when it first demonstrates cross‐linking of dansyl cadaverine to substrate in the tissue (d) (a, ×41 250; b, ×300; c, ×300; d, ×300).

or absent periderm development, pathological adhesions developed at sites of apposed tissues [18]. This is likely the mechanism behind popliteal pterygium syndrome and cocoon or fetal encasement syndrome. The periderm is regionally variable in its properties and timing of development [2]. Periderm of the plantar surface of the toe, for example, shows a very late stage of development at 70 days compared with trunk skin. At this time, the epidermis of the appendage is thicker and more differentiated than trunk skin. This suggests that the nature of the underlying epidermis determines the rate of modification of the periderm. This is supported by similarities in keratin patterning between the basal keratinocytes and the periderm cells [7]. The pattern of development of the mature stratum corneum follows periderm disaggregation, suggesting a functional relationship between these two processes which coin­ cides with the limits of fetal viability between 22 and 26 weeks EGA [19]. The periderm is thus a distinct layer of cells that is defined early in development from the remainder of the epidermis. Many genetic disorders, for example, that modify cells of the basal and intermediate layers during development appear to have no direct or indirect consequences for

periderm cells. Keratin filaments are aggregated in the second‐trimester skin of fetuses affected with epidermo­ lytic hyperkeratosis (EHK) [20] and epidermolysis bullosa simplex Dowling–Meara (EBS‐DM) [21], but none of the filaments clump in periderm cells, nor are there other consequences for the periderm layer. The absence of clumping would be expected in the case of EHK since the keratins involved in this disorder are not keratins that are present in periderm cells, but basal cells and periderm cells do share keratins in common. The persistence of ­periderm cells with no adverse outcome in an environ­ ment of severe cell destruction in layers proximal to the periderm in EHK is surprising and argues for autonomy of this layer. To the contrary, however, animal models of ­disorders where mature epidermal barrier function is not achieved (e.g. ichthyosis) show incomplete shedding of the periderm suggesting a complex interplay that is not yet understood fully [22].

Regionalization in developing skin Regional differences in properties of the skin are well documented in adult skin. Regionalization is also a ­phenomenon of developing skin even at very early ages of gestation. Few systematic studies have been done to

document these regional differences consistently through­ out development [8,23]. Without a clear appreciation and accurate knowledge of differences in normal morphology at various sites, structural evaluation of skin samples that may be from unknown regions can be difficult. At the same time, it is essential to appreciate whether the disease of concern is also expressed with regional variation not only in the adult but also at the onset of expression of the disease during development [24,25]. In at least one situa­ tion, the understanding of regional variability of expres­ sion of a disease at its first presentation was gained from samples obtained for prenatal diagnosis [26] (Fig.  1.39). Systematic studies of affected fetal skin from multiple regions are valuable to undertake when tissue becomes available. Such efforts also expand our knowledge of the natural history of the disorder.

23

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

Chapter 1  Embryogenesis of the Skin

(a)

Keratinization Keratinization of the nails, hair follicles (follicular epider­ mis), intraepidermal sweat ducts and the interfollicular epidermis occurs at different times during gestation. The nails are the earliest structures of the skin to keratinize in utero, with the appearance of cornified cells as early as 11–12 weeks EGA. The timing of keratinization of follicu­ lar epidermis is consistent with the cephalocaudal direc­ tion of follicle morphogenesis [25]; the interfollicular epidermis keratinizes first in thick skin and then in thin skin, with the latter also proceeding in a regionally dependent manner. The timing of keratinization for a given region appears to follow a rigidly specified pro­ gramme during development. The molecular mediators of keratinization are beginning to be elucidated and in many instances disruption of these pathways causes ­diseases of abnormal keratinization [26]. Even in these situations of abnormal keratinization, for example in fetuses affected with lamellar ichthyosis, harlequin ich­ thyosis and EHK, there is no evidence for early or delayed onset of the keratinization process in either the follicular or interfollicular epidermis (reviewed in [27–30]).

Appendage formation The embryonic epidermis gives rise to diverse structures collectively known as the ectodermal appendages. Despite their diverse structure and function in the mature skin, the hair follicles, nails, sweat glands, mammary glands and teeth have similar early inductive events. Interactions between the embryonic ectoderm and under­ lying dermis are important in the development of the skin appendages. Experimental studies of appendage forma­ tion have revealed the early molecular events that occur stepwise to control various aspects of appendage forma­ tion (reviewed in [31]). Epithelial and mesenchymal cells lie in close proximity at the sites of appendage formation, and in some cases make physical contact (Fig. 1.40). These structures are thought to develop in response to epithe­ lial–mesenchymal interactions that initiate the process through instructive messages, sustain the process through permissive interactions and then support differentiation and maintenance of the fully developed appendage.

(b) Fig. 1.39  Sections of skin obtained in utero by fetal skin biopsy from a fetus at risk of lamellar ichthyosis. Note the difference in morphology between the two samples. One sample shows an epidermis of normal thickness and state of development for 19 weeks EGA (a). The second sample shows a thickened epidermis, still covered by periderm (b). In both samples, hair canals were excessively keratinized. This disorder is expressed in utero with regional variation (a, ×300; b, ×300).

After the embryo–fetal transition, around 10–11 weeks EGA, basal epidermal cells, through various molecular events, undergo proliferation at specifically patterned sites to form buds that grow down into the dermis as hair germs and sweat ducts, or as a fold of tissue that establishes the nail fold. These earliest induc­ tive events lead to the formation of an epidermal thick­ ening, the placode. The epithelial layers then proliferate with growth into the mesenchyme, forming a bud. After bud formation, specific characteristics of the diverse appendages emerge. Nerves and vessels, cell adhesion molecules (CAMs), soluble mediators and homeobox genes (homeoproteins) have been implicated in the pat­ tern formation of certain appendages (reviewed in [32–37). Several molecular pathways, including Wnt/β‐catenin, fibroblast growth factor (FGF), transforming growth factor (TGF)β/bone morphogenetic protein (BMP) and hedgehog pathways, are well established as mediators of these early interactions (reviewed in [31]). The

Section 1  Development, Structure and Physiology of the Skin

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

24

(a) Fig. 1.40  Developing hair germ showing the close proximity between the epithelial cells of the germ and the mesenchymal cells of the dermis, which will follow the developing appendage and influence its development and differentiation (×8250).

e­ vidence for these interactions in the development of the epidermal appendages in human skin is best docu­ mented for formation of the pilosebaceous apparatus [38–40].

Nail formation The formation of the nail unit is highly dependent on dor­ sal–ventral patterning of the limb bud. As with other ecto­ dermal appendages, epithelial–mesenchymal pathways are critical for proper patterning (reviewed in [41]). Mutations in factors critical in dorsal–ventral patterning of the mammalian limb, such as Wnt7a, engrailed 1 (EN1) and LIM homeobox transcription factor 1β (LMX1B), give rise to developmental nail anomalies such as nail–patella syndrome. The distal rays of the digit are evident on the hand of the 50‐day EGA embryo, and within the next 7 days the digits separate [42]. Formation of the nail on the dorsal surface of the digits and the eccrine sweat glands on the ventral surface is initiated at approximately the same time after embryo–fetal transition. By 70 days’ gestation, the boundaries of the nail field are estab­ lished externally by proximal, lateral and distal folds (Fig. 1.41a) and sections through the digit reveal a shal­ low nail fold (Fig.  1.41b). Development of the epider­ mis over the nail bed is furthest advanced at its distal‐most margin [43,44].

(b) Fig. 1.41  Developing nail. (a) Scanning electron micrograph of a digit from an 85‐day EGA fetus showing the boundaries of the nail field recognized by proximal (identifying the position of the nail fold), lateral and distal folds. (b) A section through the digit of a 70‐day EGA fetus shows the position of the nail fold and the thicker and more advanced epidermis over the nail bed (a, ×100; b, ×150).

By 90 days EGA, the dorsal ridge is evident superfi­ cially and is delineated from the plantar surface of the digital pad by a deep constriction (Fig. 1.42a). The nail fold has invaginated deeply into the dermis and organized into dorsal (roof of the fold) and ventral (floor of the fold) layers that are distinguished from one another morphologically and functionally (Fig. 1.42b). The ventral fold becomes the nail matrix, which is primarily responsible for the synthesis of the nail plate. The earliest nail, which is formed late in the first trimes­ ter, consists of several layers of keratinized cells that are evident primarily at the distal margin of the nail bed and

25

(b)

(a)

(c)

(d) Fig. 1.42  Developing digit and nail. (a) Scanning electron micrograph of the ventral surface of the developing digit of an 80‐day EGA fetus showing the dorsal ridge and the large volar pads. (b) Transverse section through the nail fold of a digit from an 85‐day EGA fetus showing the distinction between dorsal and ventral (presumptive nail matrix) surfaces of the nail fold. The higher‐magnification section shows more detail of the epidermal surface and the mesenchyme beneath the nail fold. (c) Transverse sections through the digit and distal‐most tip of the nail bed of a digit from a 105‐day fetus showing keratinization of the superficial cells forming the ‘preliminary’ nail. (d) Scanning electron micrograph of a nail of a 140‐day EGA fetus showing the fragile nature of the nail plate (a, ×60; b, ×100; c, ×200; d, ×100).

over the dorsal ridge. By 15 weeks EGA, a thick cornified layer covers the nail bed (Fig.  1.42c). This ‘preliminary’ nail is easy to slough from the surface and thus may be composed to a greater extent of keratinized epidermal cells from the nail bed rather than derived from the matrix of the nail fold. The nail of a 19‐week EGA fetus is estab­ lished by both the nail matrix and the nail‐bed epidermis, although the nail is still fragile (Fig. 1.42d). The nail that is present at birth is actually a composite of layers of cells derived from the dorsal nail fold (contributes the outer­ most layer of the nail) and the nail matrix (contributes the intermediate layer of the nail); the distal half to two‐thirds of the nail bed contributes the inner layer of the nail. The layers are more evident in the fetus than in the postnatal individual [45].

Eccrine sweat gland formation Human skin has the highest density of eccrine sweat glands amongst mammals. The development of the digits and the morphogenesis of eccrine sweat glands and nails occur on the hand in advance of the foot and on the distal pads ahead of the middle and proximal phalanges and the palm [32,42]. Eccrine sweat glands form on the gen­ eral body surface at least 4–6 weeks later than on the palms and soles. They are the last of the epidermal appendages to be formed (reviewed in [32]). The struc­ tural events have been much better characterized for the ridged skin of the palmar plantar and digital skin than for trunk skin (reviewed in [15–17]). About 8.5–9 weeks EGA, the shape of the terminal digit is evident. Volar pads, tran­ sient mounds of mesenchyme that accumulate beneath

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

Chapter 1  Embryogenesis of the Skin

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

26

Section 1  Development, Structure and Physiology of the Skin

the epidermis on the ventral surface of the digits, are well formed (Fig. 1.42a). Their presence in the first trimester is presumed to influence the dermatoglyphic patterns [46,47] and the development of those flexion creases that are not considered to be dependent upon movements of the hand [42,48,49]. Interest in the development of flexion creases relates to the aberrant patterns they assume in cer­ tain congenital disorders. Volar pads begin to regress around 10.5–11 weeks EGA and are nearly gone by 12.5– 13 weeks EGA [42] when, presumably, their influence is no longer needed for morphogenesis. The primary epidermal ridges are first formed around 10–11 weeks EGA [50]. They are recognized in sectioned specimens as localized aggregations of basal epidermal cells on the digits, palms and soles (Fig. 1.43a); in sheets of epidermis viewed basally, they appear first as discontinu­ ous then as continuous ridges [51]. At this stage, the epi­ dermis on the plantar surface consists of five or six layers of intermediate cells and the periderm. Merkel cells con­ taining the characteristic granules are distributed along the primary epidermal ridges, where they may attract periglandular nerve fibres to this position of the structure [52] (Fig. 1.43b). Electron microscopy has revealed nerve fibres associated with basal laminae underlying the ridges and Merkel cells, and occasionally extending into the ­epidermal tissue [32]. Merkel cell–nerve complexes are evident in digital skin before the primary ridges begin to form, and remain prominent in the primary ridges after the appearance of the sweat gland anlagen (Fig.  1.43a). They do not appear to migrate, however, into any region of the developing appendage. The sweat gland primordia are recognized around 13–14 weeks at regular sites along the now flattened ridges as narrowed, solid, epithelial cords of cells that contain basal cell keratins and express classical carci­ noembryonic antigen (CEA) on all cells [50,52]. There is no evidence of condensed mesenchyme associated with the onset of sweat gland development as there is in fol­ licle development, thus suggesting that other sources of signalling molecules, possibly the volar pad mesenchyme, or nerves and/or other cell–cell interactions (perhaps within the epithelium) may instruct the sites for appendage formation and trigger the onset of gland development. As the cords of epithelial cells elongate into the der­ mis, a thickening at the terminus defines the glandular segment from the duct [53] (Fig. 1.44a). Ductal, secre­ tory, myoepithelial and acrosyringial cell types differ­ entiate in the dermal and intraepidermal regions of the gland and duct, and are easily distinguished from one another by light and electron microscopy (Fig.  1.44) and by immunostaining patterns using antibodies to keratin intermediate filament proteins [53]. All cells continue to express CEA [52]. The secretory cells bor­ der a central lumen within the gland; myoepithelial cells are evident at the periphery of the structure. Cells of layers of the duct and of the gland are distinct from one another at 15 weeks EGA by their morphological properties and by differences in expression of keratins (duct) and vimentin (gland) and CAMs [53,54]. Coexpression of the two intermediate filament proteins

(a)

(b)

(c) Fig. 1.43  Developing sweat glands on the ventral surfaces of the digit. (a) Cross‐section through the digit of a 95‐day EGA fetus showing the primary epidermis ridges organized from the basal layer of the epidermis. Note the abundance of nerves and vessels in the proximal dermis. (b) Immunolabelled section through the palm of a 105‐day fetal hand showing the position of Merkel cells (green) marked by an antibody that recognizes keratin 18. The red labelling recognizes neurofilaments in dermal nerve fibres. (Source: Micrograph courtesy of Dr Dong Kun Kim.) (c) Immunolabelled section through the palm of a 163‐day fetal hand showing the position of Merkel cells (green) marked by an antibody that recognizes keratin 20. The red labelling recognizes neurofilaments in dermal nerve fibres. Note the well‐established sweat ducts and the secondary epidermal ridges alternating with the primary ridges from which the ducts are formed. (Source: Micrograph courtesy of Dr Dong‐Kun Kim.) (a, ×300; b, ×300; c, ×100.)

27

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

Chapter 1  Embryogenesis of the Skin

(a)

(c)

(d)

(b) Fig. 1.44  Developing sweat glands and ducts. (a) Scanning electron micrograph of the palm of a 19‐week EGA fetus showing the elongated ducts and the club‐like terminal gland. (b) A section through the palm of a 147‐day EGA fetus shows the position of the duct and gland in the dermis and the canalization (keratinization) of the intraepidermal portion of the duct. A higher‐magnification image of the gland and duct in the palmar dermis of a 126‐day EGA fetus (c) shows the cell layers of the duct and the cells of the gland (arrows). (d) Scanning electron micrograph of the undersurface of palmar epidermis of a 19‐week EGA fetus showing the primary epidermal ridges with the remnants of torn sweat ducts spaced periodically and the secondary ridges that do not give rise to sweat ducts (a, ×80; b, ×120; c, ×300; d, ×80).

in the same cells of the secretory segment of the devel­ oping gland is unique to this appendage, but it is char­ acteristic of other glandular tissues such as mammary and salivary glands [53].

Secondary ridges form between the primary ridges (see Figs 1.43c and 1.44d). They do not give rise to sweat glands or contain Merkel cells. Globular keratohyalin granules are evident in the cytoplasm of the circumferentially

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

28

Section 1  Development, Structure and Physiology of the Skin

organized cells of the intraridge, the intraepidermal por­ tion of the duct (the acrosyringium) at about 15 weeks EGA, signalling the onset of canalization in the acrosyrin­ gium (Fig.  1.45). The lumen of the duct forms by the fusion of cytoplasmic vesicles within ductal cells. The duct remains partially occluded even in the third trimes­ ter [55]. By 22–24 weeks EGA, the sweat glands on the palms and soles have attained the structure of the adult glands, with a coiled secretory gland. The absence of sweat glands is a hallmark of the ectodermal dysplasias due to mutations in ectodysplasin pathway genes [56]. The ectodysplasin pathway interacts with the Wnt/β‐catenin pathway, amongst others, to con­ trol eccrine gland formation from induction through secretory duct differentiation [57]. While these pathways are shared with other skin appendages, the molecular mechanisms leading to specification of eccrine glands specifically is not well established.

Pilosebaceous apparatus formation The pilosebaceous apparatus is best described as a com­ posite epithelial–mesenchymal structure with critical molecular ‘cross‐talk’ between the two. Morphogenesis of the hair follicle begins on the head and face at around 70–80 days EGA, shortly after the epidermis stratifies, then proceeds in a cephalocaudal direction [20]. The pro­ cess is completed at around 19–20 weeks EGA, when hairs extend from the lanugo follicle through the peri­ derm‐covered surface of the skin. Follicles form in regular patterns in all body regions, with the distances separating each dependent upon the specific site (Fig.  1.46). The stages of follicle development, including hair germ, hair peg, bulbous hair peg and lanugo follicle stages of follicle formation (Fig. 1.47), are based on the vellus hairs on the trunk [58]. Follicles form only during development and decline in numbers as a function of ageing. The induction of follicles, their stages of development, maintenance in the adult and the cyclical growth and regression of the scalp follicles are all dependent upon an association of the follicle epithelium with dermal mesen­ chymal cells that form a cellular and matrix sheath around the developing and mature follicle and establish the dermal papilla as a special collection of mesenchymal cells that modulate the production and elongation of hairs [59].

(a)

(b) Fig. 1.45  Formation of the intraepidermal sweat duct by the development and coalescence of vesicles and subsequent keratinization of the lining cells (a). Note the globular keratohyalin granules that are characteristic of acrosyringial keratinization (×9100). Source: Micrograph originally published in Odland G, Holbrook K. Curr Prob Derm 1981;9:29–49. Reproduced with permission of Karger Publishers.

Fig. 1.46  Scanning electron micrograph of the undersurface of the epidermis from a 15‐week EGA fetus showing the pattern of hair follicles in the hair peg and hair germ stages of development. Note the longitudinal grooves in the epidermis that mark the position of intraepidermal hair canals (×100).

29

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

Chapter 1  Embryogenesis of the Skin

Fig. 1.47  Diagram of the stages of hair follicle formation including the prefollicle two‐layered epidermis, pregerm, hair germ, early hair peg, late hair peg/early bulbous hair peg and lanugo follicle stages.

The epithelial and mesenchymal cells have been exten­ sively characterized at each stage of follicle formation with regard to the expression of growth factors, growth factor receptors, cytokines, other signalling molecules and growth regulators, and structural proteins and enzymes (reviewed in [60–63]). Experimental studies in animal models, transgenic animals, tissue recombination preparations and various cell and organ culture systems have revealed the functions of specific populations of cells in developing follicles (e.g. dermal papilla and cells of the bulge) and events that signal early and sequential steps in the induction of other appendage primordia [31,36,37]. Thus, the data can be used only to infer what may be occurring in utero at the time the human follicles form de novo as most studies are done on postnatal human hair follicles. The sites of follicle formation can be recognized, even before the hair germs are visible, in sections of fetal skin by immunostaining the tissue with an antibody that recog­ nizes the matrix molecule tenascin [33,34]. Patches of reac­ tion product at the basement membrane zone correspond to pregerms, or sites where basal keratinocyte nuclei are closely spaced and mesenchymal cells are aggregated (Fig. 1.48) [64,65]. Cells from the basal epidermal layer bud into the dermis to become hair germs (Fig.  1.48b). Condensed mesenchymal cells associate closely with the germs, often extending processes that contact the basal lamina (Fig. 1.40); this collection of mesenchymal cells is intensely immunoreactive with antibodies to NGFR (p75) (Fig.  1.49), NCAM and other growth factor receptors. Little if any collagenous matrix is present around the cells as a consequence of either downregulated production or enhanced degradation (reviewed in [33,34]). Merkel cells are recognized in some of the developing germs. As is the case with the other appendages in which Merkel cells are prominent, they may play a role in targeting nerve fibres towards the developing appendage.

At around 13–14 weeks EGA, the hair germs elongate into the dermis as cords of cells called hair pegs (Figs 1.46 and 1.50). The hair peg consists of an inner core of cuboi­ dal cells and outer layer of columnar cells that is associ­ ated with the basal lamina surrounding the follicle and continuous with that of the interfollicular epidermis. Cells of the outer layer contain the same keratins as the basal epidermal keratinocytes and the cells of the inner core contain intermediate cell keratins (Fig.  1.50a), thus implicating the origins of follicle cells from two epider­ mal layers. Merkel cells are distributed among the outer root sheath keratinocytes. Early hair pegs are cylindrical, but as they elongate further they develop three regions: (i) a constricted, neck‐ like connection with the epidermis (the presumptive infundibulum); (ii) a central, cylindrical region (the presumptive isthmus); and (iii) a terminal zone that ­ becomes widened at its most distal end (the lower follicle and the presumptive bulb) (Fig.  1.50). The length of the hair peg and the three zones of the developing follicle are exaggerated in some regions of the skin but more ­subtle in others. Changes occur in all three regions, with the first notable events taking place at the proximal and distal ends. Elongated core cells in the neck of the follicle continue into the epidermis, where they form a strand of cells that lies between the basal and intermediate cell layers (see Fig. 1.50). This is the hair tract that marks the position and pathway of the presumptive hair canal (Fig. 1.50c) [66]. The distal end of the hair peg flattens and the epithelial cells along this basal border elongate to form a distinct layer that establishes the matrix (Fig.  1.50a and b). The flattened end of the follicle begins to invaginate into the cord, shaping the bulb with the matrix as the roof of the bulb. Mitotic figures are evident in matrix cells, and lon­ gitudinally orientated cells, presumably the progeny of the dividing matrix cells, move out of the matrix into the

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

30

Section 1  Development, Structure and Physiology of the Skin

(a)

(b) Fig. 1.48  Immunolabelled section of human fetal skin at 70–75 days EGA showing tenascin‐positive sites where hair germs have formed or are expected to form (a and b). The clustering of basal keratinocytes is apparent at sites where tenascin is strongly expressed in the basement membrane zone (a) (a, ×100; b, ×350). Source: Micrograph courtesy of Dr Beth Kaplan.

(a)

(b)

(c)

Fig. 1.49  Hair germs in the skin of a 97‐day fetus immunostained to recognize the p75 neurotrophic receptor, which recognizes NGFR. Note the concentration of this immunoreactive material within the mesenchymal cells surrounding the hair germ (×120).

Fig. 1.50  Late‐stage hair pegs (a, b) showing the continuity of the intermediate‐layer keratins into the upper core cells of the follicle (a), the regions of the peg and the mesenchymal cells surrounding the peg and aggregated at its tip (the presumptive dermal papilla) in association with the presumptive matrix of the follicle. Note the differences in cell orientation in the inner and outer and the distal and proximal regions of the peg (b). (c) Section through the upper end of a hair peg showing the continuation of cells into the epidermis as the hair track (a, ×300; b, ×300; c, ×300).

centre of the cord, thereby establishing the first layers of the inner root sheath and the hair (the hair cone). Cells of the outer layer of the follicle located adjacent and lateral to the matrix appear to become more loosely associated with one another, perhaps permitting the inward migra­ tion of the cells derived from the matrix. Melanocytes aggregate in the matrix and produce melanin ahead of melanocytes in the general body skin, thus making the bulbs of developing hair follicles ideal sites to examine when evaluating skin biopsy samples from a fetus at risk of tyrosinase‐negative oculocutaneous albinism (reviewed

in [27]) (Fig. 1.51). Such samples can be induced to syn­ thesize melanin by the dihydroxyphenylalanine (DOPA) reaction if the fetus is normal [67,68]. During these events, the cord is surrounded in its entirety by several layers of elongated mesenchymal cells that form a sheath. The connective tissue matrix is sparse within this cellular sheath and appears to be devoid of the fibrillar collagens that are present in the surrounding subepidermal and interstitial matrix (Fig.  1.52). Diffe­ rences in matrix molecules are observed at different levels

(a)

(b)

(a)

(b)

Fig. 1.51  The bulb of a hair peg (a) and lanugo follicle (b) in skin from different regions obtained at ages 115 days and 125 days EGA. Note the concentration of melanocytes in the matrix of the follicle (a, ×300; b, ×300).

of the hair peg and when comparing the dermal papilla with the follicle sheath [33,34]. Between 15 and 17 weeks EGA, bulges of epithelial cells begin to grow out from the epithelial cord on the posterior surface of the follicle and the adult layers of the follicle differentiate into the hair and internal root sheath. Once these bulges form, the follicle is called a bulbous hair peg (Fig. 1.53a). The factors that stimulate the devel­ opment of these structures to arise from the follicle, at a precise stage in the hair peg formation and at precise sites along the hair peg, are unknown. There are no obvious landmarks along the hair peg that provide morphological clues as to how the bulges might originate. The most superior bulge is the primordium of the sebaceous gland (Fig.  1.53a). Cells begin to produce sebum soon after this structure is evident. Analysis of epidermal lipids from fetal skin at this stage reveals a sterol/wax ester content, which suggests that the mate­ rial is similar to adult sebum [69]. The second bulge, the ‘true bulge’, forms concurrently with and slightly distal to the sebaceous gland. It is the site of follicular stem cells

(c) Fig. 1.52  Sections of fetal skin immunolabelled with antibodies to collagens of the dermis. Note the decreased staining for types I (a), III (b) and V (c) collagens in the developing hair germs (a, ×300; b, ×300; c, ×300). Source: Immunolabelling studies by Dr Lynne T. Smith.

31

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

Chapter 1  Embryogenesis of the Skin

Section 1  Development, Structure and Physiology of the Skin

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

32

(a)

(b)

(a)

(b)

Fig. 1.53  Bulbous hair peg in the skin of a 15‐week EGA fetus. (a) In the longitudinal section through the follicle, note the sebaceous gland, the bulge located just distal to the sebaceous gland, the cell layers of the inner root sheath (inner bar) and the outer layers of the outer root sheath (outer bar). The infundibulum is the region of the follicle that lies between the sebaceous gland and the epidermis. Note the cells of the dermal papilla within the bulb. (b) A cross‐section through a region between the two bars shows the layers of the outer root sheath and the inner root sheath (a, ×300; b, ×300).

[70] and the point of attachment of the arrector pili mus­ cle (Fig. 1.53a). Multipotent epithelial stem cells reside in the bulge [71]. The stem cell population is maintained throughout development and postnatal life, giving rise to the cells responsible for regenerating the cycling folli­ cle as well as having an important role in wound healing. Merkel cells also concentrate in the bulge at early stages of bulge formation. They may be important in establish­ ing this structure, stimulating proliferation or attracting nerve fibres and smooth muscle cells to the site. A third bulge may form superior to the sebaceous gland as the primordium of the apocrine sweat gland. These struc­ tures are located in the restricted sites of the body where apocrine sweat glands are present in the postnatal infant

Fig. 1.54  The hair canal. (a) Section through the skin of a 138‐day EGA fetus showing the floor of an opened hair canal. Keratinization of this structure stands out in contrast to the non‐keratinized epidermis. (b) Scanning electron micrograph of the skin of a 21‐week EGA fetus showing hair canals within (beneath the surface of) the epidermis. Note that one hair has emerged and others are evident through the thinned epidermal layers above the canal (a, ×100; b, ×185).

(axilla, areola, scalp, external eyelid, auditory meatus and anogenital regions). The cylindrical layers of the follicle differentiate and keratinization begins in several different structures of the follicle concurrently: the outer layer of cells of the inner root sheath (layer of Henle); the cuticle and cortex of the hair (Fig. 1.53b); the sebaceous duct; and the hair canal. Continued production of cells of the three layers of the inner root sheath and the hair gradually creates the kerati­ nized tube of the inner root sheath and the hair. Keratinization within the hair tract canalizes the cord of cells and forms a keratin‐lined channel that courses diag­ onally through the epidermis (Figs 1.50c and 1.54a) [69]. The granular and cornified cell layers of the hair canal form a sharp contrast with the remainder of the, as yet non‐keratinized, epidermis (Fig. 1.54a). The angle of the canal with the epidermis and the intraepidermal length of the canal are regionally variable. On the eyebrow, for example, the hair canals are closely spaced and their paths are very short. In other regions of the body, such as the appendages, the canals can be very long. By examining

33

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

Chapter 1  Embryogenesis of the Skin

Fig. 1.55  Cross‐section of the hair canals from a fetal skin sample obtained at 23 weeks EGA from a fetus affected with harlequin ichthyosis. Keratinization of these structures is extraordinarily thick (×300).

Fig. 1.57  Skin from a 117‐day EGA fetus, immunostained with the AE13 antibody, which recognizes a hair keratin (×120).

whole‐mount preparations of tissue at this stage by the presence of melanin‐producing melanocytes in the matrix and the melanin pigment in the hair (Fig. 1.51b). Antibodies to hair keratins also highlight the forming hair in sections of skin (Fig.  1.56). The first hairs of the fetus are in the anagen phase of the hair cycle. By 24–28 weeks EGA, the fetal follicles enter catagen and then telogen phase. There is shedding of the first lanugo hairs into the amniotic fluid prior to re‐entry into second anagen. Due to synchronous cycling in newborns, a sig­ nificant number of follicles will enter telogen postna­ tally and be shed, ­creating alopecia that can last up to 6 months. Fig. 1.56  A lanugo follicle associated with an epidermal sheet from a 126‐day EGA fetus. Note the hair, sebaceous gland, bulge and sebum‐ filled infundibulum (×150). Source: Micrograph courtesy of Dr Carolyn Foster.

the surface of the fetal skin at this stage, even with a hand lens, it is possible to see these canals (Fig. 1.54b). Scanning electron microscopy reveals sites where the roof of the canal is eroded and the hair is visible (Fig. 1.54b). These sites expose the keratinized lining of the hair canal and loose squames attached to the portion of the hair that lies within the canal. It is important to understand that kerati­ nization of the canals occurs earlier in the follicular epi­ dermis than in the interfollicular epidermis because this information permits the hair canals to be used for evaluat­ ing fetal skin biopsies obtained for prenatal diagnosis of one of the severe disorders of keratinization (Fig. 1.55). Production of the hair marks the establishment of the lanugo follicle at 19–21 weeks EGA (Figs 1.56 and 1.57). The hair and its cells of origin are well outlined in the

­References 1 Dale BA, Holbrook KA, Kimball JR et al. Expression of the epidermal keratins and filaggrin during fetal human development. J Cell Biol 1985;101:1257–69. 2 Regauer S, Franke WW, Virtanen I. Intermediate filament cytoskele­ ton of amnion epithelium and cultured amnion epithelial cells: expression of epidermal cytokeratins in cells of a simple epithelium. J Cell Biol 1985;100:997–1009. 3 Nanbu Y, Fujii S, Konishi I et  al. CA 125 in the epithelium closely related to the embryonic ectoderm: the periderm and the amnion. Am J Obstet Gynecol 1989;161:462–7. 4 Lane AT, Negi M, Goldsmith LA. Human periderm: a monoclonal antibody marker. Curr Prob Dermatol 1987;16:83–93. 5 M’Boneko V, Merker H‐J. Development and morphology of the peri­ derm of mouse embryos (days 9–12 of gestation). Acta Anat 1988;133:325–36. 6 Sanes JR, Rubenstein JLR, Nicolas J‐F. Use of a recombinant retrovirus to study post‐implantation cell lineage in mouse embryos. EMBO J 1986;5:3133–42. 7 Byrne C, Talbsky M, Fuchs E. Programming gene expression in devel­ oping epidermis. Development 1994;120: 2369–83. 8 Holbrook KA, Odland GF. The fine structure of developing human epidermis: light, scanning and transmission electron microscopy of the periderm. J Invest Dermatol 1975;65:16–38.

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

34

Section 1  Development, Structure and Physiology of the Skin

9 Holbrook KA, Underwood RA, Dale BA et al. Formation of the corni­ fied cell envelope in human fetal skin: presence of involucrin, kerato­ linin, loricrin and transglutaminase correlated with the onset of transglutaminase activity. J Invest Dermatol 1991;96:542A. 10 Akiyama M, Smith LT, Yoneda K et al. Periderm cells form cornified cell envelope in their regression process during human epidermal development. J Invest Dermatol 1999;111:903–9. 11 Riddle CV. Intramembranous response to cAMP in fetal epidermis. Cell Tissue Res 1985;241:687–9. 12 Koren G. Fetal toxicology of environmental tobacco smoke. Curr Opin Pediatr 1995;7:128–31. 13 Mears GJ, Van Petten GR. Fetal absorption of drugs from the amniotic fluid. Proc West Pharmacol Soc 1977;20:109–14. 14 Lind T, Kendal A, Hytten FE. The role of the fetus in the formation of amniotic fluid. J Obstet Gynaecol Br Commonw 1972;79:289–98. 15 Holbrook KA. Structural and biochemical organogenesis of skin and cutaneous appendages in the fetus and neonate. In: Polin RA, Fox WW (eds) Neonatal and Fetal Medicine Physiology and Pathophysiology. New York: Grune & Stratton, 1992:527–51. 16 Chu DH. Development and structure of skin. Chapter 7. In: Goldsmith LA, Katz SI, Gilchrest BA et  al. (eds) Fitzpatrick’s Dermatology in General Medicine, 8th edn. New York: McGraw‐Hill, 2012. 17 Holbrook KA, Sybert VP. Basic science. In: Schachner L, Hansen R (eds) Pediatric Dermatology, 2nd edn. New York: Churchill Livingstone, 1995. 18 Richardson RJ, Hammond NL, Coulombe PA et  al. Periderm prevents pathological epithelial adhesions during embryogenesis. J Clin Invest 2014;124:3891–900. 20 Hardman MJ, Moore L, Ferguson MW, Byrne C. Barrier formation in the human fetus is patterned. J Invest Dermatol 1999;113:1106–13. 21 Holbrook KA, Dale BA, Sybert VP et al. Epidermolytic hyperkerato­ sis: ultrastructure and biochemistry of skin and amniotic fluid cells from two affected fetuses and a newborn infant. J Invest Dermatol 1983;81:222–7. 21 Holbrook KA, Wapner R, Jackson L et al. Diagnosis and prenatal diag­ nosis of epidermolysis bullosa herpetiformis (Dowling–Meara) in a mother, two affected children and an affected fetus. Prenatal Diagn 1992;12:725–39. 22 Okano J, Lichti U, Mamiya S et  al. Increased retinoic acid levels through ablation of Cyp26b1 determine the processes of embryonic skin barrier formation and peridermal development. J Cell Sci 2012;125:1827–36. 23 Holbrook KA, Odland GF. Regional development of the human epidermis in the first trimester embryo and the second trimester fetus (ages related to the timing of amniocentesis and fetal biopsy). J Invest Dermatol 1980;80:161–8. 24 Akiyama M, Dale BA, Smith LT et al. Regional difference in expres­ sion of characteristic abnormality of harlequin ichthyosis in affected fetuses. Prenat Diagn 1998;18:425–36. 25 Pinkus H. Embryology of hair. In: Montagna W, Ellis RA (eds) The Hair Growth. New York: Academic Press, 1958:1–32. 26 Sasaki K, Akiyama M, Yanagi T et al. CYP4F22 is highly expressed at the site and timing of onset of keratinization during skin develop­ ment. J Dermatol Sci 2012;65:156–8. 27 Holbrook KA, Dale BA, Williams ML et al. The expression of congeni­ tal ichthyosiform erythroderma in second trimester fetuses of the same family: morphologic and biochemical studies. J Invest Dermatol 1988;91:521–31. 28 Holbrook KA, Smith LT, Elias S. Prenatal diagnosis of genetic skin disease using fetal skin biopsy samples. Arch Dermatol 1993; 129:1437–54. 29 Sybert VP, Holbrook KA, Levy M. Prenatal diagnosis of severe derma­ tologic diseases. Adv Dermatol 1992;7:179–209. 30 Sybert VP, Holbrook KA. Antenatal pathology of the skin. In: Claireaux AE, Reed GB (eds) Diseases of the Fetus and Newborn: Pathology, Radiology and Genetics. New York: Cockburn, Chapman & Hall, 1995:755–68. 31 Biggs LC, Mikkola ML. Early inductive events in ectodermal appendage morphogenesis. Semin Cell Dev Biol 2014;25‐26:11–21. 32 Moore SJ, Munger BL. The early ontogeny of the afferent nerves and papillary ridges in human digital and glabrous skin. Dev Brain Res 1989;48:119–41. 33 Holbrook KA, Smith LT, Kaplan ED et al. The expression of morpho­ gens during human follicle development in vivo and a model for studying follicle morphogenesis in vitro. J Invest Dermatol 1993;101:39S–49S.

34 Kaplan ED, Holbrook KA. Dynamic expression patterns of tenascin, proteoglycans and cell adhesion molecules during human hair follicle morphogenesis. Dev Dyn 1994;199:141–55. 35 Chuong C‐M, Widelitz RB, Jiang T‐X. Adhesion molecules and home­ oproteins in the phenotypic determination of skin appendages. J Invest Dermatol 1993;101:10S–15S. 36 Noveen A, Jiang T‐X, Ting‐Berreth SA et al. Homeobox genes Msx‐1 and Msx‐2 are associated with induction and growth of skin append­ ages. J Invest Dermatol 1995;104:711–9. 37 Noveen A, Jiang T‐X, Chuong C‐M. Protein kinase A and protein kinase C modulators have reciprocal effects on mesenchymal con­ densation during skin appendage morphogenesis. Dev Biol 1995;171:677–93. 38 du Cros DL. Fibroblast growth factor influences the development and cycling of murine hair follicles. Dev Biol 1993;156:444–53. 39 Moore GPM, du Cros DL, Isaacs K et al. Hair growth induction: roles of growth factors. Ann NY Acad Sci 1991;624:308–25. 40 Millar SE. Molecular mechanisms regulating hair follicle development. J Invest Dermatol 2002;118:216–25. 41 Maito M, Ohyama M, Amagai M. Exploring the biology of the nail: An intriguing but less‐investigated skin appendage. J Dermatol Sci 2015; 79:187–93. 42 Kimura S. Embryologic development of flexion creases. Birth Defects: Original Article Series 1991;27:113–29. 43 Zaias N. Embryology of the human nail. Arch Dermatol 1996; 87:37–53. 44 Hashimoto K, Gross BG, Nelson R et al. The ultrastructure of the skin of human embryos. III. The formation of the nail in the 16–18 weeks old embryo. J Invest Dermatol 1996;47:205–17. 45 Lewis BL. Microscopic studies, fetal and mature nail and surrounding soft tissue. Arch Dermatol 1954;70:732–47. 46 Mulvihill JJ, Smith DW. The genesis of dermatoglyphics. J Pediatr 1969;75:597–9. 47 Hirsch W, Schweichel JU. Morphological evidence concerning the problem of skin ridge formation. J Ment Defic Res 1973;17:58–72. 48 Kimura S, Kitagawa T. Embryological development of human palmar, plantar and digital flexion creases. Anat Rec 1990;226:249–57. 49 Hale AR. Morphogenesis of volar skin in the human fetus. Am J Anat 1952;91:147–81. 50 Metze D, Bhardwaj R, Amann U et al. Glycoproteins of the carcinoem­ bryonic antigen (CEA) family are expressed in sweat and sebaceous glands of human fetal and adult skin. J Invest Dermatol 1966; 106:64–9. 51 Kim D‐G, Holbrook KA. The appearance, density and distribution of Merkel cells in human embryonic and fetal skin: their relation to sweat gland and hair follicle development. J Invest Dermatol 1995; 104:411–16. 52 Narisawa Y, Hashimoto K, Pietruk T. Biological significance of dermal Merkel cells in development of cutaneous nerves in human fetal skin. J Histochem Cytochem 1992;40:65–71. 53 Moll I, Moll R. Changes of expression of intermediate filament pro­ teins during ontogenesis of eccrine sweat glands. J Invest Dermatol 1992;98:777–85. 54 Fujita M, Furukawa F, Fujii K et al. Expression of cadherin molecules during human skin development: morphogenesis of epidermis, hair follicles and eccrine sweat ducts. Arch Dermatol Res 1992;284:159–66. 55 Hashimoto K, Gross BG, Lever WF. The ultrastructure of the skin of human embryos. I. The intraepidermal eccrine sweat duct. J Invest Dermatol 1965;45:139–51. 56 Itin PH. Etiology and pathogenesis of ectodermal dysplasias. Am J Med Genet A 2014;164A:2472–7. 57 Cui CY, Yin M, Sima J, et  al. Involvement of Wnt, Eda and Shh at defined stages of sweat gland development. Development 2014; 141(19):3752–60. 58 Holbrook KA, Minami SA. Hair follicle morphogenesis in the human: characterization of events in vivo and in vitro. NY Acad Sci 1991;642:167–96. 59 Reynolds AJ, Oliver RF, Johoda CAB. Dermal cell populations show variable competence in epidermal support: stimulatory effects of hair papilla cells. J Cell Sci 1991;98:75–83. 60 Millar SE. Molecular mechanisms regulating hair follicle development. J Invest Dermatol 2002;118:216–25. 61 Lee J, Tumbar T. Hairy tale of signaling in hair follicle development and cycling. Semin Cell Dev Biol 2012;23:906–16. 62 Messenger A. The control of hair growth: an overview. J Invest Dermatol 1993;201:4S–9S.

63 Jahoda CAB, Reynolds AJ, Forrester JC et al. Hair follicle regeneration following amputation and grafting into the nude mouse. J Invest Dermatol 1996;107:904–7. 64 Chiquet‐Ehrismann R, Mackie EJ, Pearson CA et  al. Tenascin: an extracellular matrix protein involved in tissue interactions during fetal development and oncogenesis. Cell 1986;47:131–9. 65 Erickson HP, Bourdon MA. Tenascin: an extracellular matrix protein prominent in specialized embryonic tissues and tumors. Annu Rev Cell Biol 1989;5:71–91. 66 Holbrook KA, Odland GF. Structure of the hair canal and the initial eruption of hair in the human fetus. J Invest Dermatol 1978;71:385–90. 67 Eady RAJ, Gunner DB, Garner A et al. Prenatal diagnosis of oculocu­ taneous albinism by electron microscopy. J Invest Dermatol 1983;80:210–12. 68 Kikuchi A, Shimizu H, Nishikawa T. Epidermal melanocytes in nor­ mal and tyrosinase‐negative oculocutaneous albinism fetuses. Arch Dermatol Res 1995;287:529–33. 69 Williams ML, Hincenbergs M, Holbrook KA. Skin lipid content dur­ ing early fetal development. J Invest Dermatol 1988;91:263–8. 70 Cotsarelis G, Sun T‐T, Lavker RM. Label‐retaining cells reside in the bulge area of pilosebaceous unit: implications for follicular stem cells, hair cycle and skin carcinogenesis. Cell 1990;61:1329–37. 71 Akiyama M, Dale BA, Sun T‐T et al. Characterization of hair follicle bulge in human fetal skin: the human fetal bulge is a pool of undif­ ferentiated keratinocytes. J Invest Dermatol 1995;105:844–50.

35

­Conclusion Human embryonic development is complex and wrought with opportunity for developmental missteps leading to congenital malformation. Skin development is no exception. The study of skin development has been based largely on the foundation of descriptive work. Fortunately, many of the methods for developing these data also provide information about composition, and thus the morphological approaches have allowed a rea­ sonable story of skin development to unfold. Continuing advances in molecular techniques and animal models have further contributed to understanding the pathways and interactions needed for normal skin development. In addition, advancing knowledge of genetic skin dis­ ease continues to shed further light on these pathways and how perturbations in developmental pathways lead to cutaneous disease. Further advances in understand­ ing skin development will undoubtedly lead to new therapeutic approaches.

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

Chapter 1  Embryogenesis of the Skin

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

36 

CHA PTER 2

Molecular Genetics in Paediatric Dermatology Anna C. Thomas1 & Veronica A. Kinsler1,2 1 2

 Genetics and Genomic Medicine, UCL Great Ormond Street Institute of Child Health, London, UK  Paediatric Dermatology Department, Great Ormond Street Hospital for Children NHS Foundation Trust, London, UK

Introduction, 36 Genetics and inheritance in brief, 36 Consent for genetic testing and incidental findings, 38

Which samples to take for genetic testing, 39 How to interpret genetic results, 39 What to do with a genetic result, 39

Abstract Molecular genetics is the study of the structure of genes at molecular level, and the impact of gene expression and regulation on the biology of the organism. The interplay between these two fields, genetics and biology, is a burgeoning area in all disease. In recent years the process of disease gene identification and clinical genetic diagnostic reporting has been revolutionized by the technologies discussed in this chapter, most prominently next‐generation ­sequencing (NGS). These techniques have increased the speed and

­Introduction Molecular genetics is the study of the structure of genes at a molecular level, and the impact of gene expression and regulation on the biology of the organism. The interplay between these two fields, genetics and biology, is a burgeoning area in all disease. For essential terminology in molecular genetics, see Table 2.1. A large number of skin conditions have now had their genetic aetiology identified and this information can be easily accessed through many of the online curated databases available, for example Online Mendelian Inheritance in Man (www.omim.org) and the Decipher database (https://decipher.sanger.ac.uk), as well as from published literature. In recent years, the process of disease gene identification and clinical genetic diagnostic reporting has been revolutionized by the technologies discussed in this chapter, most prominently next‐generation sequencing (NGS). These techniques have increased the speed and volume of genetic data generation, and have made the transition from the research sphere to the diagnostic laboratories. Storage and analysis of this data however, is still fraught with difficulties, not least in the interpretation of novel (undescribed) variants. In addition, functional analysis of the implications of any novel findings still requires validation by cell biology and animal model generation. The implications of genetic diagnosis have changed in recent years. Whereas this used to serve only to

Concept of personalized medicine, 39 Molecular genetics techniques, 40

volume of genetic data generation, and have made the transition from the research sphere to the diagnostic laboratories. The identification of disease‐causing genetic mutations in both inherited and sporadic paediatric dermatological conditions has begun to influence clinical management, allowing preimplantation genetic diagnosis, stratification for targeted personalized medical therapies, or gene therapy in some cases. This chapter reviews the essential terminology, key techniques and important advances needed to update paediatric dermatologists in this field, forming a basis for the detailed disease‐specific chapters that follow.

confirm a diagnosis or to subclassify disease, the i­dentification of disease‐causing genetic mutations in both inherited and sporadic paediatric dermatological conditions has begun to be clinically relevant in clinical management. Preimplantation genetic diagnosis (PGD) as part of the in vitro fertilization (IVF) process can be offered for future pregnancies where there is a family history and the genetic defect is known, for example in epidermolysis bullosa and the autosomal recessive ichthyoses. In other instances the genetic defect will stratify patients towards targeted medical therapies, such as in the vascular overgrowth disorders. In addition, paediatric dermatology is now in the era of personalized genetic therapy, and this will surely be an area of tremendous growth in the decade to come. Techniques of gene therapy will be discussed in Chapter 170.

­Genetics and inheritance in brief The human genome is comprised of deoxyribonucleic acid (DNA) neatly contained within 23 pairs of chromosomes in the human, one of each pair inherited maternally and one paternally. The sex chromosomes are inherited XX for a female and XY for a male, and the other 22 pairs are described as autosomes. It should also be noted that cellular mitochondria house 37 genes within a circular genome that is inherited maternally. DNA is transcribed

Harper’s Textbook of Pediatric Dermatology, Fourth Edition. Edited by Peter Hoeger, Veronica Kinsler and Albert Yan. © 2020 John Wiley & Sons Ltd. Published 2020 by John Wiley & Sons Ltd.

Chapter 2  Molecular Genetics in Paediatric Dermatology

37

Allele Allele‐specific Array Base/nucleotide Biallelic mutations Chimaera Compound heterozygous mutations Copy number Copy number variation De novo mutation Digenic mutation Exons Frameshift mutation Gain‐of‐function/activating mutation Germline mutation Hemizygous mutation Heterozygous mutation Homozygous mutation Hybridization Imprinting Introns In silico Knockdown Knockout Ligation Loss‐of‐function mutation Missense mutation Monoallelic expression Mosaicism Mutant or minor allele frequency Mutation

Nonsense mutation Novel Oligonucleotide Overexpression Panel/targeted panel Polymorphism Post‐zygotic Segregation Sequencing Single nucleotide polymorphism (SNP) or variant (SNV) Somatic mutation Splice site Sporadic Transcription Translation Uniparental disomy (UPD) Validation

The alternative form of a gene’s sequence A test or treatment directed at only one allele An ordered arrangement of probes on a solid surface A DNA or RNA nucleotide (ACTG or ACUG) Two different mutations at the same site in a gene An organism resulting from the fusion of two or more zygotes Two different mutations at different sites in a gene Number of copies of a DNA sequence, usually at chromosomal or gene level but can be applied to repeats in the DNA sequence A change in the copy number of a portion of DNA, which is described in the normal population and therefore considered to be a variant rather than pathogenic Not inherited from either parent, but arisen for the first time in the patient A condition which is caused by mutations in two different genes The parts of the DNA sequence that code for proteins A mutation that causes a shift in the reading frame of the DNA sequence A mutation that increases the function of the gene A mutation that affects all the cells of an organism including the gametes Having only a single copy of a gene, which results in monoallelic expression The occurrence of a mutation in one copy of a gene but not in the other The occurrence of the same mutation in both copies of a gene Binding of DNA or RNA to complementary strands or probes Natural silencing of one allele, leading to monoallelic expression The parts of the DNA sequence of the genome that do not code for proteins The analysis of the effects of a mutation using bioinformatics rather than laboratory experiments The deliberate reduction in expression of a gene (e.g. in an experiment to see what it does) The deliberate obliteration of expression of a gene (e.g. in a mouse model) Joining together of fragments of DNA A mutation that reduces or obliterates the function of a gene A single base change in the DNA sequence that alters an amino acid in the protein but does not truncate it Expression of only one allele instead of two. This occurs with X inactivation and with imprinted genes The presence of two or more genotypes in an organism arising from a single zygote The proportion of a sample or a population affected by a mutation A change in the DNA sequence that is thought or known to be pathogenic. Non‐synonymous mutations are those that alter the amino acid code in an exon whereas synonymous mutations do not A mutation that truncates the protein product A mutation that has not previously been described in the literature or in public databases A short synthetic sequence of DNA or RNA bases Increased expression of a gene, usually deliberately to analyse the effects A selected set of genes for DNA sequencing A change in the sequence of DNA that is commoner than 1% frequency in a population, and therefore considered to be a variant rather than pathogenic A mutation that occurs in utero The co‐occurrence of a phenotype in members of a family who are affected by a particular genotype, and the absence of that phenotype in unaffected family members Elucidation of the sequence of the bases in DNA or RNA A single base pair change in DNA that is seen in more than 1% of a normal population A mutation within a tissue A sequence of DNA that indicates the junction of an exon and intron A disorder that does not appear to be inherited or passed on The process of making RNA from a DNA template The process of making protein from an RNA template The inheritance of two copies of a gene or genes from one parent The use of secondary or functional tests to confirm a DNA mutation

into messenger ribonucleic acid (mRNA) and mRNA is translated into protein. Proteins are the molecules in each cell that perform the vital functional tasks required in the human body. It is the chemical properties of the amino acids and the exact order in which they are aligned that causes the protein to fold into a particular shape, and therefore determines its functional properties.

The genetic code of DNA occurs in the form of four chemicals or ‘bases’, namely cytosine (C), thymine (T), guanine (G) and adenine (A). Complementary pairing occurs between C bases and G via three hydrogen bonds, and between T with A via two hydrogen bonds, at the centre of the famous DNA double helix [1,2]. Long runs of these four bases are grouped into regions known as exons

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

Table 2.1  Essential terminology in molecular genetics

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

38

Section 1  Development, Structure and Physiology of the Skin

and introns. Exons are known to be the regions that ‘code’ for RNA and therefore for protein products, and they make up only around 1% of the whole DNA sequence. Introns make up the rest of the sequence and their function is still not completely understood. Early on in the study of molecular genetics they were considered to be ‘junk DNA’, however it is now well established that intronic sequences are crucial for the functioning and control of the exonic areas and their protein products. The four bases of the exons and their flanking sequences are ‘transcribed’ into RNA by the process of transcription. In this process an RNA molecule is made from the DNA sequence transcript, with the intronic sequences removed, and the thymine base of DNA replaced by the uracil base of RNA. The four RNA molecule bases (UCGA) can be arranged into groups of three in 64 different ways, called codons. Sixty one of these codons code for one of 20 amino acids, and three code for a so‐called stop codon. This is known as the genetic code, and the excess of codons for amino acids is known as the redundancy or degeneracy of the genetic code. Amino acids are the building blocks of proteins, and stop codons tell the protein when the exonic instructions are finished. The process of forming a string of amino acids from the RNA code is known as translation. DNA mutations can occur anywhere in the human genome, and in some cases lead directly to or contribute to disease. Broadly speaking the most damaging mutations are found within exons, however they are increasingly being discovered outside coding regions, for example in important regulatory regions outside the gene itself such as the promoter. Mutations can be classified into (i) point mutations, similar to a spelling mistake where a single base is replaced by another, and (ii) insertions or deletions, where part of the DNA message is missing or a part is added. Point mutations can be subdivided into synonymous or non‐synonymous and, where non‐synonymous, into missense or nonsense. Synonymous mutations are base changes that do not change the amino acid which is coded for and therefore the protein product remains the same. These are usually but not always benign, and therefore usually without apparent functional consequence. Non‐synonymous mutations are those that alter the amino acid code in an exon. Within this group missense mutations are those that change the amino acid but not to a stop codon, producing a protein, although this protein is abnormal in sequence. Nonsense mutations on the other hand lead to an absent or truncated protein product by changing the codon to a stop codon. For mutations that are deletions or insertions of sequence this can be ′in‐frame’ or leading to a ′frameshift’. In‐frame insertions or deletions lead to one codon being changed, either to a different codon or a stop codon, and frameshift alter the reading frame of the gene – in other words the three‐ letter codons are no longer read in the correct groups of three, which leads to a nonsense protein product and sometimes to a premature stop codon. Large deletions, duplications and insertions can also occur at gene level, causing whole exons or multiple exons to be removed

or disrupted, and on a larger scale there can be chromosomal structural aberrations such as translocations and inversions. In many cases a disease manifests itself because the flow of molecular information from DNA to RNA to protein contains a mutation, usually originating from the DNA code. Many diseases can be described as ‘dominant’ or ‘recessive’ in inheritance pattern, where either one or both copies of the gene are required to be faulty respectively in order to cause the resultant disease. As males have one copy of the X chromosome, all genes in males that do not lie on the pseudoautosomal regions of the X/Y chromosomes cannot be described as heterozygous or homozygous and in this situation are referred to as ‘hemizygous’. X‐linked disorders in general are therefore more likely to be severe in males as there is only one copy of the gene. A disease is described as monogenic if there is only one gene involved in the phenotype; however this is a rapidly‐ disappearing concept, as the background genotype of the patient will almost inevitably have some phenotype‐ modifying effect in any disease situation. Polygenic disorders are those in which more than one gene is known to be involved in the phenotype. Mosaic disorders are dealt with in Section 23. ­References 1 Watson JD, Crick FH. Molecular structure of nucleic acids; a structure for deoxyribose nucleic acid. Nature 1953;171:737–8. 2 Watson JD, Crick FH. Genetical implications of the structure of deoxyribonucleic acid. Nature 1953;171:964–7.

­ onsent for genetic testing and C incidental findings Individual hospitals usually have their own standards and protocols for obtaining consent for genetic testing. This will vary depending on the method to be used, and whether the test is a diagnostic laboratory test or being done on a research basis. Oral consent for genetic testing may be sufficient for established diagnostic tests, but any research testing should have fully informed written consent recorded in the hospital and research notes. In most diagnostic tests the issue of incidental findings does not arise as only a single gene is being tested. However, with the increase in gene panel testing and of clinical exome testing there may be genes being tested which are known to affect clinical outcome in other ­diseases, such as tumour suppressor genes or oncogenes. In these cases, there is no international consensus as yet for whether specific consent needs to be taken in advance, however, a gradual consensus is emerging, and in general it is good practice to inform families that there is a possibility that other mutations may be uncovered which could affect their health in other areas. Ideally there is a specific option after informed consent for the patient/family to choose whether they would like to be told of incidental findings. Recent US and European publications in this area may help with consideration of issues around consent for incidental findings [1–6].

­References 1 Evans BJ. Minimizing liability risks under the ACMG recommendations for reporting incidental findings in clinical exome and genome sequencing. Genet Med 2013;15:915–20. 2 Green RC, Berg JS, Grody WW et al. ACMG recommendations for reporting of incidental findings in clinical exome and genome sequencing. Genet Med 2013;15:565–74. 3 Hehir‐Kwa JY, Claustres M, Hastings RJ et al. Towards a European consensus for reporting incidental findings during clinical NGS testing. Eur J Hum Genet 2015;23:1601–6. 4 May T. On the justifiability of ACMG recommendations for reporting of incidental findings in clinical exome and genome sequencing. J Law Med Ethics 2015;43:134–42. 5 Anderson JA, Hayeems RZ, Shuman C et al. Predictive genetic testing for adult‐onset disorders in minors: a critical analysis of the arguments for and against the 2013 ACMG guidelines. Clin Genet 2015;87:301–10. 6 Kalia SS, Adelman K, Bale SJ, et al. Recommendations for reporting of secondary findings in clinical exome and genome sequencing, 2016 update (ACMG SF v2.0): a policy statement of the American College of Medical Genetics and Genomics. Genet Med 2017;19:249–55.

­ hich samples to take for genetic W testing Blood DNA Methods of DNA extraction from whole blood can vary dependent on the local laboratory, and it is always worth checking before obtaining a sample. Very commonly 1–5 mL is sufficient from children, collected into an EDTA‐ containing vial. The sample is safe overnight at room temperature if need be.

Cheek swab or saliva DNA Increasingly it is possible to get good‐quality DNA from a cheek swab, however this will also depend on the local laboratory. These samples require a specialized swab (not a normal skin swab), and instructions for collection should be followed. Generally lower quantities of DNA are obtainable than from blood. The method is, however, particularly suitable for young babies if it is difficult to obtain a blood sample, or from family members who are not able to attend clinic to have blood taken, when a cheek swab or saliva sample can be sent remotely by following the manufacturer’s instructions.

Skin DNA Skin biopsy is required for DNA extraction where it is possible that the mutation is not present in the germline and therefore not detectable in blood but only in affected tissue. A skin biopsy for DNA extraction must not be put into formalin. It can be transported fresh to the laboratory on a saline‐soaked gauze, or snap‐frozen in liquid nitrogen, or placed in a medium that stabilizes nucleic acids. Most diagnostic laboratories when presented with a skin sample for DNA extraction will culture fibroblasts from it by default, and then extract DNA from the fibroblasts. This may not be appropriate in a mosaic disorder as the mutation may not be present in that cell type, and therefore DNA extraction from whole skin should be specifically requested.

­How to interpret genetic results Once a clinical or research test has been ordered it is useful to be able to understand the result. The full genetic

39

result as reported should be inserted into the patient’s medical notes, as the exact mutation may be extremely important. Reading the results of a DNA sequence mutation is explained in Table 2.2.

­What to do with a genetic result In general terms it is best to refer the family to Clinical Genetics for the result to be given. Even if the paediatric dermatologist feels confident of their knowledge in the area, they are not trained in genetic counselling and may not be aware of all the implications for all family members. In referral of the family, mention that the whole family may need to attend, and certainly both parents where possible, and warn that further testing may be required. Clinical geneticists can also deal with the issues surrounding incidental findings where relevant.

­Concept of personalized medicine A rapidly evolving area of science is that of personalized medicine, or precision medicine [1,2]. This is a broad term to describe the use of genetic data on an individual to tailor the treatment of a disorder to that individual. There are two principal ways in which this research is being driven. First, genetic information is being analysed retrospectively from cohorts of patients who have had successful or unsuccessful responses to therapy to create a model of genotypic association with outcomes including side‐ effects. Second, where disorders are found to be caused by or driven by a specific mutation, researchers and clinicians are prescribing therapies targeted to these mutations or to the known effects of these mutations. In paediatric dermatology this is currently being used in trials such as of AKT1 inhibitors in Proteus syndrome, rapamycin in the PIK3CA‐related overgrowth spectrum, and collagen VII Table 2.2  Terminology used in genetic testing results _ > c. c.(83G=/83G>C) del dup fs fs*#

g. ins inv m. n. p. p.(Arg97Profs*23)

r.

(Underscore) is a range (e.g. c.76_78delACT) Indicates a substitution at DNA level (e.g. c.76A>T) Position of base pair in cDNA Describes the two genotypes of a mosaic case Indicates a deletion (e.g. c.76delA) Indicates a duplication (e.g. c.76dupA) Frameshift *# Indicates at which codon position the new reading frame ends in a stop codon (*). The position of the stop in the new reading frame is calculated starting at the first amino acid that is changed by the frameshift, and ending at the first stop codon (*#) Position of base pair in genomic DNA Indicates an insertion (e.g. c.76_77insG) Indicates an inversion (e.g. c.76_83inv) Position in mitochondrial DNA Position in noncoding RNA Position of amino acid in protein Frameshifting change with arginine‐97 as the first affected amino acid, changing into a proline, and the new reading frame ending in a stop at position 23 Position in RNA (e.g. r.76a>u)

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

Chapter 2  Molecular Genetics in Paediatric Dermatology

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

40

Section 1  Development, Structure and Physiology of the Skin

replacement therapy in recessive dystrophic epidermolysis bullosa. This personalized medicine approach will change the face of medicine and is likely to improve patient outcome in response to drug therapies, reducing the requirement for multiple therapies and avoidable side‐effects.

of complementary sequence in the gene of interest. Polymerase chain reaction (PCR) is then performed to amplify DNA fragments followed by dideoxynucleotide chain termination sequencing to obtain a sequencing readout that can be compared to the known ‘wild‐type’ reference version. An example is shown in Fig. 2.1.

­References 1 Ashley EA. Towards precision medicine. Nat Rev Genet 2016; 17:507–22. 2 Collins DC, Sundar R, Lim JS, Yap TA. Towards precision medicine in the clinic: from biomarker discovery to novel therapeutics. Trends Pharmacol Sci 2017;38:25–40.

Next‐generation sequencing (NGS) of DNA [3]

­Molecular genetics techniques Key reviews are referenced for further reading.

Karyotype A karyotype test is used to determine chromosomal number, structure and integrity. The test has to be performed on actively dividing live cells, and therefore the specimens need to be freshly delivered to the laboratory. Karyotyping can be performed on blood or skin. Single nucleotide polymorphism (SNP) arrays are increasingly replacing karyotyping for the assessment of chromosomal number and integrity (detection of duplications and deletions); however if structural rearrangements are to be detected (for example inversions or translocations) then karyotyping is still required.

Mutation identification by DNA sequencing All methods of DNA sequencing rely on the existence of what is known as the reference sequence, which is the accepted and curated version of the human genome. There are various version of the reference sequence, and new ‘builds’ of these become available at intervals of a few years, when the current version is updated with the latest data. The reference sequence can be found at various websites such as the University of California Santa Cruz (UCSC) genome browser, https://genome.ucsc.edu. The production of the reference sequence was made possible as a result of the revolutionary Human Genome Project [1].

Sanger sequencing Sanger sequencing is a technique of sequencing DNA that was discovered by Frederick Sanger and coworkers [2]. The method is to design numerous pairs of oligonucleotide DNA ‘primers’ that cover the coding region of the gene of interest. Primers are essentially small pieces of DNA of around 20 base pairs in length that bind to DNA

G C

C T G A

G C

C G

G C

G C

G T C A

#70 C C G G

#130

G C

NGS is the best way to sequence DNA on a large scale. Sequencing that would previously have taken years can now be done in around a week by hand or 3 days when using a robotic automated system. Over the years there have been different technologies for NGS, and there are still a wide variety of methods available. However, the principles behind NGS are similar in all cases, and there are also certain major categories of experiment. These categories vary in how the DNA of interest is captured: 1 Whole exome: all predicted coding regions of the genome are sequenced. 2 Whole genome: all DNA regardless of its known function is sequenced. 3 Targeted capture: only preselected DNA is enriched for and sequenced. This is often in the form of a set of known and/or candidate genes added to a screening panel or it could be a region on a particular chromosome. This is the most commonly used type within a diagnostic context, where only known genes are being investigated. NGS panels are now validated in many paediatric dermatology diseases [4–7]. There are a number of different protocols available depending on the concentration of DNA collected, for example a total concentration of 3 μg or as low as 200 ng. This is extremely helpful if there are only small quantities of material to begin with. Recently adapted protocols have been optimized to obtain good‐quality sequencing data from DNA extracted from formalin‐fixed paraffin‐ embedded (FFPE) blocks. This is advantageous as it means archived pathology samples can be analysed from skin samples (as well as other tissues). This has previously been difficult as DNA extracted from FFPE blocks is often of lower quality and often more fragmented than a fresh sample. How NGS works: 1 A ‘library’ is prepared by randomly fragmenting a genomic DNA sample. 2 Ligation adapters are then added to both ends of each DNA fragment. 3 Adapter‐ligated fragments are PCR amplified and subjected to purification.

C G

G T C A

G C

C G

C G

C G

#80 A C T G

C G

A T

C G

#130

Fig. 2.1  A typical Sanger sequencing trace after importing the data into an appropriate analysis software tool. Bases are represented in different colours.

4 At this stage the library is loaded onto a flow cell so that the DNA fragments can hybridize to the surface of the flow cell via surface‐bound oligonucleotides that are complementary in sequence to the attached adapters. 5 Each bound fragment goes through an amplification process to produce a cluster that becomes clonally identical. 6 Sequencing reagents, including a differently labelled fluorescent nucleotide for each base, are used to identify each base.

Library preparation

41

7 Data analysis is then carried out by sequence‐read alignment to a selected reference genome with the use of specialized software. After alignment, any differences between patient samples and the reference genome are identified (Fig. 2.2). If hunting for new genes on a research basis, the ideal scenario is to find gene variants in all/most of the affected individuals that are not present in the reference genome and other control populations and, if looking for an inherited disease, are present in the parental DNA where the

Cluster amplification

Genomic DNA Fragmentation Row cell Adapters Bridge amplification cycles Ligation

Sequencing library 1

2

3

4 Clusters

NGS library is prepared by fragmenting a gDNA sample and ligating specialized adapters to both fragment ends.

(a)

Library is loaded into a flow cell and the fragments hybridize to the flow cell surface. Each bound fragment is amplified into a clonal cluster through bridge amplification. (b)

Alignment & data anaylsis

Sequencing

2

1

A T C G

4

3

Sequencing cycles

T G

Reads

ATGGCATTGCAATTTGACAT TGGCATTGCAATTTG AGATGGTATTG GATGGCATTGCAA GCATTGCAATTTGAC ATGGCATTGCAATT AGATGGCATTGCAATTTG

Reference genoma

AGATGG TATTGCAATTTGACAT

A C Digital image

Data is exported to an output file Cluster 1 > Read 1: GAGT... Cluster 2 > Read 2: TTGA... Cluster 3 > Read 3: CTAG... Cluster 4 > Read 4: ATAC...

Text file

Sequencing reagents, including fluorescently labelled nucleotides, are added and the first base is incorporated. The flow cell is imaged and the emission from each cluster is recorded. The emission wavelength and intensity are used to identify the base. This cycle is repeated ”n” times to create a read length of “n” bases. (c)

Reads are aligned to a reference sequence with bioinformatics software. After alignment, differences between the reference genoma and the newly sequenced reads can be identified.

(d)

Fig. 2.2  Overview of the workflow of an Illumina next‐generation sequencing (NGS) method. Source: Courtesy of Illumina, Inc.

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

Chapter 2  Molecular Genetics in Paediatric Dermatology

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

42

Section 1  Development, Structure and Physiology of the Skin

p15.31

p15.1

p14.1

p13.2

p12

q11.2

q12.2

q13.2

q14.1

q14.3

q15

q21.2

q22.2

q23.2

q31.1

q31.3

q33.1

q34

q35.2

41 bp 140,207,950 bp

140,207,960 bp

140,207,970 bp

140,207,980 bp

T T

C C C

Typical representation of the output of NGS, with 'reads' represented as grey horizontal bands aligned with the reference genome build using Integrative Genomics Viewer (Broad Institute). Each of these is the equivalent to one of the Sanger sequencing traces shown in Figure 2.1. A heterozygous mutation is demonstrated by the blue cytosine change. (e) Fig. 2.2  (Continued)

inheritance can be explained. However, we also know that diseases can be sporadic and mutations can appear de novo so this has to be considered during the analysis phase. At this point there is still a requirement for DNA variations within candidate genes to be validated by Sanger sequencing. It is always important to ensure that any result is not due to an NGS artefact that has happened by chance.

Other types of NGS In the last few years NGS protocols have been adapted to perform sequencing of RNA in a process known as RNA‐ seq. This has the huge advantage of being able to analyse the sequence of alternatively spliced mRNA transcripts. Splicing is the editing of an early mRNA into a mature form, where introns (noncoding DNA) are removed and exons (protein‐coding parts of DNA) are joined together. In this manner a single gene can give rise to different proteins depending on the composition of the exons ligated together during the splicing stage. Different tissues of the body can contain differentially spliced forms of the same mRNA. RNA‐seq can capture this information and additionally gather quantitative information on how highly a particular transcript is expressed at a given time point. There are different types of RNA that have specialized biological functions and, depending on the precise methods used, small RNAs, microRNA (miRNA) and transfer RNA (tRNA) as well as total RNA can be analysed using RNA‐seq. Other types of NGS include chromatin immunoprecipitation sequencing (CHIP‐seq), which extracts data on protein interactions with DNA (DNA‐binding sites), and methylated DNA immunoprecipitation (MeDIP‐seq), which extracts data on DNA methylation.

Copy number changes Copy number mutations or copy number variations (CNVs) can be challenging to identify when using DNA sequencing methods, especially if they occur in heterozygous form. CNVs occur if a copy of all or part of a gene is either deleted or duplicated by one or more copies. There are a number of different methods by which to identify CNVs.

Array techniques [8–14] One preferred method of detection is array‐comparative genomic hybridization (aCGH). In simple terms aCGH has RNA oligonucleotides or ‘oligos’ spaced at specific distances along the human genome that bind DNA complementary in sequence. In each case a patient DNA sample under investigation is labelled with a red fluorescent dye and a reference DNA sample is labelled with a different dye which fluoresces green. Differentially labelled samples are mixed 50 : 50 and then hybridized to the array surface. After a time of hybridization, samples can be analysed for CNVs. In areas of normal copy number, equal binding of red and green labelled DNA is assumed. However, in cases of a patient deletion the software would detect more or all green fluorescence compared with red in a genomic location depending on the presence of a homozygous or heterozygous deletion. Conversely, in the case of a patient duplication there would be a higher detection of red fluorescence than green, depending on the number of duplicated copies (Fig. 2.3). SNP DNA arrays can also be used to read copy number. These work by fragmentation of the patient DNA and labelling with fluorescent dye, and then hybridization onto a solid surface peppered with allele‐specific oligonucleotide probes. These probes are allele‐specific at sites of known common variation in the population, and are

Chapter 2  Molecular Genetics in Paediatric Dermatology Ratio plot

143.39 Mbp. 9q34.3, no genes, no CNVs

34.3

33.3

34.11 34.13

33.2

33.1

31.2 31.3 32

31.1

22.31 22.32 22.33

21.2 21.31 21.32 21.33 22.1

21.13

13 21.11 21.12

12

13.3 13.2 13.1 12 11.2 11.1

21.1

21.2

21.3

22.1

23

22.3

24.3 24.2 24.1

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

4.00 3.75 3.50 3.25 3.00 2.75 2.50 2.25 2.00 1.75 1.50 1.25 1.00 0.75 0.50 0.25 0.00 –0.25 –0.50 –0.75 –1.00 –1.25 –1.50 –1.75 –2.00 –2.25 –2.50 –2.75 –3.00 –3.25 –3.50 –3.75 –4.00

43

Fig. 2.3  Array comparative genomic hybridization ratio plot depicting a deletion of a large part of chromosome 9p (shown in red), and two small areas of closely related deletion/duplication (red and green). The chromosomal bands are laid out at the bottom of the figure.

therefore able to give information not only on copy number but also on genotype at these loci, and on large areas of homozygosity or hemizygosity.

Multiplex ligation‐dependent probe amplification [15] Often the results of aCGH require validation by another method; the gold standard here is multiplex ligation‐ dependent probe amplification (MLPA). There are companies that provide validated and optimized panels with probes annealing at many points along a certain gene. MLPA works on a multiplex PCR basis after specific probes have annealed to the designated DNA regions. Using specialized analysis software the designed probes can identify CNVs in the gene under investigation. A schematic showing the interpretation of MLPA results is explained in Fig.  2.4. MLPA is the preferred method for diagnostic reporting where pathological CNVs are known to be causative of a particular disease.

Quantitative real‐time PCR [16] Expression analysis of a particular gene can be extremely useful for validating involvement in a particular disease, and quantitative real‐time PCR (qRT‐PCR) is often used. Put simply, this works by obtaining mRNA and using the retroviral enzyme reverse transcriptase to convert RNA back to DNA to a form known as complementary DNA

(cDNA). cDNA contains all the relevant information on expression level and is preferable to work with as it is more stable than mRNA and therefore less likely to degrade during the handling process. It is now possible to extract mRNA directly from blood using specialized kits, however this is only useful if the gene of interest is expressed in white blood cells and this is not always the case. Luckily for dermatologists, skin can be easily biopsied. Different cell types such as fibroblasts and keratinocytes can be extracted from a fresh skin biopsy and then cultured to obtain a large number of cells to work with. Additionally, the skin biopsy as a whole can be used to extract mRNA, resulting in mRNA from all the cell populations in the skin in one sample. Two methods are used, differing in how the experiment technically works: an intercalated dye method such as SYBR® green, or a probe method such as TaqMan® where a fluorescent reporter dye is analysed. Both obtain data on the basis that the amount of cDNA (equating to the original relative amounts of mRNA) can be quantified as each round of PCR cycle causes the amount of cDNA to double during the exponential amplification phase. By comparing to the expression of a gene that is expressed to the same level in all cells, known as a ‘housekeeping gene’, such as glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) or beta‐actin (ACTB), the expression level of the gene of interest can be calculated. For example, if

Section 1  Development, Structure and Physiology of the Skin

2.5

Peak ratio

2

1.5

1

0.5

0 100

150

200

250

Size (bps)

(a) 2.5 2

Peak ratio

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

44

1.5

1

0.5

0 100 (b)

150

200 Size (bps)

250

Fig. 2.4  Schematic representation of multiplex ligation‐dependent probe amplification (MLPA) data. Blue squares on the right are reference probes showing normal copy number over different chromosomes. Squares on the left indicate probes for a particular gene. (a) In this case the gene under investigation shows probes in red and above the cut‐off for normal copy number (depicted by the green lines). This indicates a duplication of the whole gene. (b) Shows partial deletion of the same gene as five probes are in green and below the normal cut‐off, but the rest of the gene is of normal copy number as shown by three blue squares within the lines.

the gene of interest has a significantly lower level of expression or lacks detectable expression in patient samples compared to control samples, this can provide further evidence that the mutation is causative of the disease under investigation.

Fluorescence in situ hybridization [17] Fluorescence in situ hybridization (FISH) is another method that can be used for copy number variations of genes or indeed whole chromosomes. This works via the attachment of fluorescently labelled probes to a specified chromosomal location in an individual cell where the chromosomes can be visualized microscopically. Fig. 2.5 shows the presence of three copies of chromosome 21, which is the karyotype of an individual with Down syndrome, in a cell during metaphase of cell division.

Genome‐wide association studies [18] Sometimes it is extremely challenging to find specific gene candidates associated with a disease. This is especially the case for disorders that are likely to be polygenic. In these cases a genome‐wide association study (GWAS) may be helpful. This works by analysing the genotype of a set of patients with a particular condition, for example

Fig. 2.5  Fluorescence in situ hybridization showing three copies of chromosome 21 during metaphase as depicted by the red fluorescent probe in a single cell of an individual with Down syndrome. The two control green probes are hybridized to chromosome 13. Chromosomes are stained in blue.

psoriasis, compared to a control cohort without clinical signs or a family history of psoriasis. By genotype in this example we are interested in single base variations at locations throughout the genome known as SNPs. If there is an association with a particular set of SNPs in the disease cohort compared to the control cohort, this may give valuable information regarding areas of the genome that require further investigation.

Other commonly‐encountered techniques Polymerase chain reaction (PCR) PCR is a technique whose discovery revolutionized molecular biology [19,20], earning its inventor Kary Mullis a Nobel Prize in 1993. It forms the basis of many other techniques in molecular genetics. It exploits a class of enzymes known as DNA polymerases, which will copy double‐stranded DNA from single‐stranded DNA. The function of PCR is to selectively amplify one area of the genome, such as the area carrying a mutation of interest, so that large quantities of DNA just from that area are produced. Taq polymerase is combined with the DNA template (from a patient), two specific oligonucleotide primers which are designed by the researcher to flank either side of the area of interest, and other reagents including base pairs for construction of new DNA. The reaction involves multiple rounds of increasing the temperature to around 96° C to cause double‐stranded template DNA denaturation (separation of the two strands), lowering of the temperature (variable) to allow the primers to stick to their relevant complementary strands, and increasing the temperature again to 72° C which is the optimum temperature for Taq polymerase function. This process is usually repeated 35 times and the production of DNA proceeds exponentially. The DNA produced is known as the PCR product, and is used then in Sanger sequencing, genotyping or cloning.

Methods for genotyping specific base pair changes There are various methods used for genotyping specific base pair changes that avoid the need to sequence the DNA. These rely on the difference in the sequence at the particular base pair in question, either by using a restriction enzyme which recognizes one of the alleles (wild‐ type or mutant), or by recognition of the differing properties of the two alleles during changes of temperature. Examples of such genotyping methods are high‐ resolution melt PCR (HRM), restriction fragment length polymorphisms (RFLPs) and amplification‐refractory mutation system (ARMS).

Small interfering RNA [21] Small interfering RNAd (siRNA) are synthetic RNA ­oligonucleotides which are designed to be complementary to the RNA transcript of a DNA sequence of interest. When the DNA is transcribed to RNA in the presence of the siRNA, the siRNA binds to the specific RNA transcript,

45

creating double‐stranded RNA. Owing to a n ­atural mechanism within cells this double‐stranded RNA is then degraded by the cell. This therefore prevents translation of the RNA into protein, and effectively stops or reduces expression of the protein. This molecular genetic technique is therefore useful for studying the effects of removal of the protein product from the cell, and by inference can help with working out what that gene usually does. Alternatively, siRNA has been suggested to be used as therapy for diseases in paediatric dermatology where a mutation is leading to overexpression of a protein. This is therefore a type of gene therapy for skin disease and is being researched in paediatric dermatology conditions. ­References 1 Lander ES, Linton LM, Birren B et  al. Initial sequencing and analysis of the human genome. Nature 2001;409:860–921. 2 Sanger F, Coulson AR. A rapid method for determining sequences in DNA by primed synthesis with DNA polymerase. J Mol Biol 1975;94:441–8. 3 Goodwin S, McPherson JD, McCombie WR. Coming of age: ten years of next‐generation sequencing technologies. Nat Rev Genet 2016;17:333–51. 4 Lai‐Cheong JE, McGrath JA. Next‐generation diagnostics for inherited skin disorders. J Invest Dermatol 2011;131:1971–3. 5 Takeichi T, Liu L, Fong K, et al. Whole‐exome sequencing improves mutation detection in a diagnostic epidermolysis bullosa laboratory. Br J Dermatol 2015;172:94–100. 6 Bhoj EJ, Yu Z, Guan Q et al. Phenotypic predictors and final diagnoses in patients referred for RASopathy testing by targeted next‐generation sequencing. Genet Med 2017;19:715–8. 7 Scott CA, Plagnol V, Nitoiu D et al. Targeted sequence capture and high‐throughput sequencing in the molecular diagnosis of ichthyosis and other skin diseases. J Invest Dermatol 2013;133:573–6. 8 Rodriguez‐Revenga L, Mila M, Rosenberg C et  al. Structural variation in the human genome: the impact of copy number variants on clinical diagnosis. Genet Med 2007;9:600–6. 9 Lee C, Iafrate AJ, Brothman AR. Copy number variations and clinical cytogenetic diagnosis of constitutional disorders. Nat Genet 2007;39:S48–S54. 10 Carter NP. Methods and strategies for analyzing copy number variation using DNA microarrays. Nat Genet 2007;39:S16–S21. 11 Shen Y, Wu BL. Microarray‐based genomic DNA profiling technologies in clinical molecular diagnostics. Clin Chem 2009;55:659–69. 12 Barnes MR. Genetic variation analysis for biomedical researchers: a primer. Methods Mol Biol 2010;628:1–20. 13 Dumanski JP, Piotrowski A. Structural genetic variation in the ­context of somatic mosaicism. Methods Mol Biol 2012;838:249–72. 14 Hall IM, Quinlan AR. Detection and interpretation of genomic structural variation in mammals. Methods Mol Biol 2012; 838:225–48. 15 Schouten JP, McElgunn CJ, Waaijer R et al. Relative quantification of 40 nucleic acid sequences by multiplex ligation‐dependent probe amplification. Nucleic Acids Res 2002;30:e57. 16 Mocellin S, Rossi CR, Pilati P et al. Quantitative real‐time PCR: a powerful ally in cancer research. Trends Mol Med 2003;9:189–95. 17 Trask BJ. Gene mapping by in situ hybridization. Curr Opin Genet Dev 1991;1:82–7. 18 Visscher PM, Brown MA, McCarthy MI, Yang J. Five years of GWAS discovery. Am J Hum Genet 2012;90:7–24. 19 Mullis K, Faloona F, Scharf S et al. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harb Symp Quant Biol 1986;51:263–73. 20 Saiki RK, Gelfand DH, Stoffel S et  al. Primer‐directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 1988;239:487–91. 21 Sarkies P, Miska EA. Small RNAs break out: the molecular cell biology of mobile small RNAs. Nat Rev Mol Cell Biol 2014;15: 525–35.

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

Chapter 2  Molecular Genetics in Paediatric Dermatology

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

46 

CHA PTER 3

Cutaneous Microbiome Carrie C. Coughlin1 & William H. McCoy IV2  Division of Dermatology, Department of Medicine, and Department of Pediatrics, Washington University School of Medicine, St. Louis, MO, USA  Division of Dermatology, Department of Medicine, Washington University School of Medicine, St. Louis, MO, USA

1 2

Introduction, 46 Evolution of the cutaneous microbiome, 47

Methods of collection and analysis, 50 Cutaneous diseases and the microbiome, 51

Abstract Bacteria, fungi and viruses comprise the cutaneous microbiome. Exposures starting in utero shape our initial microbiome, which then evolves over time through exposure to external microbial communities (delivery method, close contacts, environment) and changes in our skin’s biochemical nature (adrenarche, hygiene, skin disease).

Key points • The cutaneous microbiome encompasses bacteria, viruses, fungi and parasites living on and in the skin. • The microbiome has many different influences, and starts developing in utero.

Introduction The cutaneous microbiome made up of bacteria, fungi, parasites and viruses evolves over time and differs by body site. Epithelial bacteria on skin and mucosal sur­ faces have been shown to be important contributors to health and illness [1–3]. This chapter will discuss changes in cutaneous bacterial microbiota from infancy to adoles­ cence. Specifically, we will explore its establishment, general composition, changes in response to external and internal pressures, variations with disease states, interac­ tions with the gut microbiome, and relation to the virome and fungal microbiota. Though the classification of many types of bacteria has changed with the availability of new research techniques, there are four phyla and a subset of their representative genera that are commonly referenced in discussions of the cutaneous microbiome (Table 3.1). Familiarity with these bacteria helps frame discussions of their contributions to cutaneous health and disease. Bacteria on the skin play an important role in host immunity, affecting both skin barrier function and immunological defences. These defences involve both innate mechanisms, such as antimicrobial peptides

Fungal microbiota, virome and parasites, 54 Conclusion, 55

This chapter investigates the composition of the microbiome throughout childhood, interactions of the microbiome with the skin barrier and immune system, and microbial contributions to health and disease. Current skin microbiome research related to several common diseases (atopic dermatitis, acne, psoriasis) suggests that incorporation of this information may be beneficial in disease treatment, thus underscoring the need for further studies in this field.

• Different skin environments (sebaceous, moist, dry) harbour distinct microbial communities. • The composition of the cutaneous microbiome changes from infancy to adulthood. • Microbes provide targets to influence disease states, as well as substrates of potential therapies.

(human β‐defensins [HBDs] and cathelicidins), and adaptive responses, with the latter potentially depend­ ent on the commensal microbiota [4]. These host– microbe interactions are the subject of investigations into the effect of the microbiome on cutaneous disease states (see, for example, Atopic dermatitis). Conceivably, patients with impaired immune systems may have dif­ ferent responses to the bacteria they encounter and different microbiome compositions than those with intact immune systems. To  investigate the microbiota of patients with primary immunodeficiencies, research­ ers have studied primary immunodeficiency patients with eczematous dermatitis and compared them to patients with atopic dermatitis. Patients with primary immunodeficiency had decreased site‐to‐site variation of bacteria [5]. These authors have postulated that ‘eco­ logical permissiveness” may contribute to the recurrent infections of patients with primary immunodeficiencies [5]. To understand how these interactions occur and change over time, we will examine how a human infant is colo­ nized by microbes and how this microbial community is  moulded by the host, environment and exposures (Fig. 3.1; see Table 3.2 for definitions of terminology).

Harper’s Textbook of Pediatric Dermatology, Fourth Edition. Edited by Peter Hoeger, Veronica Kinsler and Albert Yan. © 2020 John Wiley & Sons Ltd. Published 2020 by John Wiley & Sons Ltd.

Chapter 3  Cutaneous Microbiome

47

Phyla

Gram staining

Common cutaneous genera

Actinobacteria

Gram positive

Actinomyces Corynebacterium Cutibacterium Micrococcus Propionibacterium

Bacteroidetes

Gram negative

Prevotella

Firmicutes

Gram positive (predominantly)

Enterococcus Lactobacillus Staphylococcus Streptococcus

Proteobacteria

Gram negative

Escherichia Pseudomonas

Table 3.2  Common terms used in discussions of the microbiome Term General Metaorganism Microbiome Microbiota Prebiotics Probiotics Synbiotics Virome

Definition

Microbes and host organism (e.g. human) The microbes and their genes in a particular environment The microbes living in a particular environment Chemical/nutrient supplementation that selectively stimulates growth/activity of one or more microbes of a metaorganism to benefit the host organism [43] Microbe supplementation to selectively modify a microbiome of a metaorganism to benefit the host organism [44] Combinations of prebiotics and probiotics The viruses living on or with a host

Statistics and methods of identification Alpha diversity The mean species diversity (Chao1 Index, Simpson’s Diversity, Shannon Index, etc.) in a habitat on a local scale Beta diversity The differentiation between habitats based on species diversity Colony‐forming unit (CFU) A measure of viable bacteria or fungi in a sample Gamma diversity Total species diversity across a landscape (human) Next‐generation sequencing ‘High‐throughput DNA sequencing’ performed on a variety of platforms. Faster and more comprehensive than the (NGS) older Sanger sequencing method Metagenome Set of genes and genomes from a sample. Usually restricted to microbiota Operational taxonomic units Groups (‘clusters’) of bacteria with similar (often 97% similarity when compared pairwise) 16S rRNA sequences, with (OTUs) one representative sequence representing the group for analysis Quantitative PCR (qPCR) Amplification of nucleic acids (DNA or RNA) by polymerase chain reaction that is monitored in real time for quantification Relative abundance Amount of one organism as compared with other similar organisms. 16S ribosomal RNA (rRNA) Sequencing a portion of a bacterium’s 16S ribosomal subunit to allow identification of the bacterium. This technique sequencing does not distinguish organism status (alive/dead), unlike culture techniques used to identify bacteria Relationships between organisms Colonization Organisms living on/within a host or surface Commensalism Two separate organisms living in contact with one another where one organism benefits from this interaction without affecting the other organism Dysbiosis A change in normal microbial ecology on/inside a host or surface due to microbial community imbalance/ maladaptation leading to disease (opposite of symbiosis) Mutualism Two separate organisms living in contact with one another where both derive benefit from this interaction Parasitism Two separate organisms living in contact with one another where one organism benefits from this interaction at the expense of the other organism Symbiosis Two separate organisms living in close association with one another (commensalism, mutualism, parasitism)

Evolution of the cutaneous microbiome First exposures contribute to the microbiome The dogma that fetuses develop in a sterile environment has recently been challenged, as bacteria similar to those found in the vagina (Prevotella and Lactobacillus spp.) have

been identified by quantitative PCR (qPCR) from surface swabs from the endometrium and upper endocervix [6]. Further, Lactobacillus and several other species have been identified in cultured curettings from the endometrium [7]. Interestingly, Propionibacterium spp. have been grown by culture‐based methods from the upper genital tract [6]. Multiple studies have now shown bacteria in the placenta

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

Table 3.1  Commonly encountered cutaneous bacteria

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

48

Section 1  Development, Structure and Physiology of the Skin

Exposure

Microbiome

Immunity

Prenatal exposure vs.

Immune response development

Delivery method

‘NATURAL’ microbiome Home environment TPN

Nutrition

Hygiene

Dysbiosis

Microbiome-related diseases Gastrointestinal • Clostridium difficile colitis • Inflammatory bowel disease (CD, UC)

Antibiotics

ALTERED microbiome Urbanization

Cutaneous

Mucosal

• Atopic dermatitis • Acne • Psoriasis

• Bacterial vaginosis • Candidiasis • Chronic periodontitis

Fig. 3.1  Exposures affecting the human microbiome. Upper panel: exposures proposed to mould the ‘NATURAL’ microbiome of an individual without clearly favouring development of disease. Lower panel: exposures known to or proposed to perturb established microbial communities to create an ALTERED microbiome that favours the development of various diseases.

[8–10], but the validity of a ‘placental microbiome’ has been challenged due to methodological concerns in these studies, specifically the concern for contamination during sample acquisition [11,12]. Amniotic fluid [8] and meco­ nium [13,14] also harbour bacteria. Thus, neonates have several potential influences on their microbiome even before birth. Method of delivery has a clear impact on an infant’s cuta­ neous microbiome. Neonates born via vaginal delivery have early skin colonization by vaginal flora (Lactobacillus and Prevotella spp.), while infants born via caesarean section are colonized by typical skin flora including Staphylococcus, Corynebacterium and Propionibacterium spp. [15]. Further, the bacterial composition of a mother’s vaginal flora was more similar to the microbiome of her vaginally delivered baby than to other vaginally delivered infants. The uniqueness of an infant’s cutaneous microbiome transmitted via vaginal delivery was not observed in caesarean deliveries, as there was no difference between the skin floras of infants born via caesarean section [15,16]. While microbial colonization of the skin would seem to be the most pertinent to dermatolo­ gists, the intestinal flora may also affect allergic and inflam­ matory reactions in patients [3,17], thus an examination of the oropharyngeal and intestinal flora of infants is relevant to paediatric dermatologists. Much as observed for cutaneous microbial colonization, the mode of delivery has been shown to dictate oropharyn­ geal microbial colonization with infants born vaginally having increased Firmicutes (trending to more Lactobacillus) and infants born via caesarean section having increased Actinobacteria (Propionibacterium, notably) and Proteo­

bacteria [16]. Samples taken less than 5 minutes after birth from neonates’ skin, oral mucosa and nasopharyngeal aspirate in the study by Dominguez‐Bello et al. showed similar microbial composition [15]. This is in contrast to the diversity that develops later (see the next section, Neonates and infants). However, in other work, bacteria from stool in the first 1–2 days of life were different than those of the oropharynx [16]. Thus, the lower gut flora may be distinct from other sites starting from birth. Regardless of the human microenvironment, it appears that initial external exposure has a profound effect on microbial colonization, which may dictate susceptibility to a variety of diseases. A number of studies have demonstrated an association between caesarean section delivery and increased risk for allergies [18], asthma [19,20], immunodeficiency [20] and obesity [21] (though there are mixed results in the litera­ ture [19,22]), thus leading to a recent investigation dem­ onstrating that infants born via caesarean section but intentionally exposed to vaginal fluids can be colonized by bacteria from these fluids [23]. While this study estab­ lishes how a ‘normal’ microbiome can be fostered in an infant born via caesarean section through the introduc­ tion of an available probiotic source, the link between dis­ tinct microbiome communities and/or specific bacteria with inflammatory skin disease requires further study. Another external source supporting maintenance and expansion of a physiological microbiome is breast milk. Diversity of the infant gut microbiome is proportional to the amount of daily breast milk intake even after intro­ duction of solid foods [24].

The potential links between skin inflammation and cuta­ neous bacteria include both intrinsic host–microbe and extrinsic microbe–microbe interactions. While the intrinsic link between a specific bacterial strain and a disease state may seem straightforward (see Atopic dermatitis), extrin­ sic effects can be less clear. Extrinsic links may include the influence of one type of bacteria on the colonization of [25,26], virulence of [27] and/or host response to [28] an unrelated bacterium. The last link is particularly concern­ ing in the setting of increasing emergence of multidrug‐ resistant organisms, leaving some patients with limited or no therapeutic options. Of note, antibiotic resistance genes carried by maternal bacteria can transfer to neonates and the mode of delivery influences this transfer [14,29]. Thus, the transfer of bacteria from one host to another can affect the ability of the new host to fight infection.

Neonates and infants After delivery, environment is the next major influence on a neonate’s microbiome. Broadly, for neonates, environ­ ment can be split into hospital/nursery and home set­ tings. Infants requiring prolonged hospital stays have different influences on their microbiota than children dis­ charged to home [30]. Incubators, cribs, bedding, moni­ tors, leads, tubes, catheters, gloves, nutrition, medications, caregivers, family and more all contribute to the environ­ ment encountered by a hospitalized infant. Due to changes in the epidermal barrier over time, the effects of these influences can also change. Infant skin evolves in structure and barrier function over weeks to months [31,32]. Consideration of these exposures is important when seeing neonates in the hospital, as their microbial flora can be quite different from that encountered in the outpatient setting. The cutaneous microbiome starts to change within the first 3 months of life and continues to evolve over the first year of life, as shown by Capone et  al. [33]. Diversity increases and, in contrast to the uniformity in oral and skin samples at birth [15], skin flora evolves to be site‐ specific. This evolution also is in contrast to the relative stability of the adult microbiome over time (see Adults) [34]. Firmicutes (specifically staphylococci and strepto­ cocci) predominate, in contrast to the Proteobacteria dominance in adults [33]. Of note, the colonization seen by Capone et al. was not influenced by mode of delivery of the infant, even in the samples from infants 1–3 months of age. Thus, an infant’s initial cutaneous microbiome (dictated by mode of delivery) may dissipate by 1–3 months of age and yet still have lifelong effects (immunity, skin maturation, barrier function).

Preadolescents and adolescents Bacterial colonization continues to evolve from early childhood through adolescence. Young children have increased microbial diversity compared to adolescents, and their cutaneous bacterial communities resemble those of infants more than adults (Firmicutes predomi­ nate, in contrast to Actinobacteria of adolescents and adults) [35,36]. Furthermore, older children have more lipophilic bacteria on their skin than younger children,

49

paralleling the increased sebaceous gland activity seen in adolescents and adults [35].

Adults After the hormonal shifts of adolescence, adults have dis­ tinct sebaceous, moist and dry zones on their skin [37,38]. Researchers have compared the bacterial composition of these sites with an aim to inform work on diseases such as acne and atopic dermatitis that tend to have site predilec­ tions [34]. Propionibacteria dominate the microbial com­ munities of sebaceous sites, such as the face [38,39]. Of note, P. acnes has been reclassified under the genus Cutibacterium (C. acnes), which is important when com­ paring older and more recent research. Moist locations, such as the axilla and antecubital fossa, harbor corynebac­ teria and staphylococci [38,39]. Flavobacteria and Proteobacteria are found at dry sites [38]. Not only the dominant phyla, but also the diversity of the microbial community correlates with skin microenvironment, as sebaceous sites have the least, and dry sites have the most, community diversity [38]. In contrast to the changes seen in the microbiome from infancy to maturation, recent work shows the adult cuta­ neous microbiome is relatively constant over time [34]. Bacterial communities are maintained by the host, rather than reacquired over time, and remain particular to the individual. Cutaneous sites with lower diversity (such as the face) were more stable than sites with higher diversity (such as the feet). Moreover, left/right symmetry of the cutaneous microbiota has been noted [39,40], which could have implications for interventional trials. However, studies looking specifically at the axillae show differences in bacteria at left versus right sites, with handedness potentially influencing these results [41,42]. The microbi­ ome differences revealed through studies of life stage and body site have begun to reveal important considerations for therapeutic targets for diseases associated with per­ turbations in the microbiome (see Cutaneous diseases and the microbiome). References 1 Grice EA. The intersection of microbiome and host at the skin inter­ face: genomic‐ and metagenomic‐based insights. Genome Res 2015; 25:1514–20. 2 Johnson CL, Versalovic J. The human microbiome and its potential importance to pediatrics. Pediatrics 2012;129:950–60. 3 Lim ES, Wang D, Holtz LR. The bacterial microbiome and virome milestones of infant development. Trends Microbiol 2016;24:801–10. 4 Naik S, Bouladoux N, Wilhelm C et al. Compartmentalized control of skin immunity by resident commensals. Science 2012;337:1115–9. 5 Oh J, Freeman AF, Program NCS et  al. The altered landscape of the human skin microbiome in patients with primary immunodeficiencies. Genome Res 2013;23:2103–14. 6 Mitchell CM, Haick A, Nkwopara E et  al. Colonization of the upper genital tract by vaginal bacterial species in nonpregnant women. Am J Obstet Gynecol 2015;212:611 e1–9. 7 Cowling P, McCoy DR, Marshall RJ et al. Bacterial colonization of the non‐pregnant uterus: a study of pre‐menopausal abdominal hysterec­ tomy specimens. Eur J Clin Microbiol Infect Dis 1992;11:204–5. 8 Collado MC, Rautava S, Aakko J et al. Human gut colonisation may be initiated in utero by distinct microbial communities in the placenta and amniotic fluid. Sci Rep 2016;6:23129. 9 Stout MJ, Conlon B, Landeau M et  al. Identification of intracellular bacteria in the basal plate of the human placenta in term and preterm gestations. Am J Obstet Gynecol 2013;208:226 e1–7.

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

Chapter 3  Cutaneous Microbiome

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

50

Section 1  Development, Structure and Physiology of the Skin

10 Aagaard K, Ma J, Antony KM et  al. The placenta harbors a unique microbiome. Sci Transl Med 2014;6(237):237ra65. 11 Lauder AP, Roche AM, Sherrill‐Mix S et al. Comparison of placenta samples with contamination controls does not provide evidence for a distinct placenta microbiota. Microbiome 2016;4:29. 12 Kliman HJ. Comment on “the placenta harbors a unique microbiome”. Sci Transl Med 2014;6:254le4. 13 Gosalbes MJ, Llop S, Valles Y et al. Meconium microbiota types domi­ nated by lactic acid or enteric bacteria are differentially associated with maternal eczema and respiratory problems in infants. Clin Exp Allergy 2013;43:198–211. 14 Gosalbes MJ, Valles Y, Jimenez‐Hernandez N et al. High frequencies of antibiotic resistance genes in infants’ meconium and early fecal samples. J Dev Orig Health Dis 2016;7:35–44. 15 Dominguez‐Bello MG, Costello EK, Contreras M et  al. Delivery mode shapes the acquisition and structure of the initial microbiota across multiple body habitats in newborns. Proc Natl Acad Sci U S A 2010;107:11971–5. 16 Brumbaugh DE, Arruda J, Robbins K et al. Mode of delivery deter­ mines neonatal pharyngeal bacterial composition and early intestinal colonization. J Pediatr Gastroenterol Nutr 2016;63:320–8. 17 West CE, Ryden P, Lundin D et  al. Gut microbiome and innate immune response patterns in IgE‐associated eczema. Clin Exp Allergy 2015;45:1419–29. 18 Papathoma E, Triga M, Fouzas S, Dimitriou G. Cesarean section delivery and development of food allergy and atopic dermatitis in early childhood. Pediatr Allergy Immunol 2016;27:419–24. 19 Cuppari C, Manti S, Salpietro A et al. Mode of delivery and risk for development of atopic diseases in children. Allergy Asthma Proc 2015;36:344–51. 20 Sevelsted A, Stokholm J, Bonnelykke K, Bisgaard H. Cesarean section and chronic immune disorders. Pediatrics 2015;135:e92–8. 21 Rutayisire E, Wu X, Huang K et al. Cesarean section may increase the risk of both overweight and obesity in preschool children. BMC Pregnancy Childbirth 2016;16:338. 22 Robson SJ, Vally H, Abdel‐Latif ME et al. childhood health and devel­ opmental outcomes after cesarean birth in an Australian cohort. Pediatrics 2015;136:e1285–93. 23 Dominguez‐Bello MG, De Jesus‐Laboy KM, Shen N et al. Partial resto­ ration of the microbiota of cesarean‐born infants via vaginal microbial transfer. Nat Med 2016;22:250–3. 24 Pannaraj PS, Li F, Cerini C et  al. Association between breast milk bacterial communities and establishment and development of the infant gut microbiome. JAMA Pediatr 2017;171:647–54. 25 Bomar L, Brugger SD, Yost BH et  al. Corynebacterium accolens releases antipneumococcal free fatty acids from human nostril and skin surface triacylglycerols. mBio 2016;7:e01725–15. 26 Christensen GJ, Scholz CF, Enghild J et  al. Antagonism between Staphylococcus epidermidis and Propionibacterium acnes and its genomic basis. BMC Genomics 2016;17:152. 27 Lo CW, Lai YK, Liu YT et al. Staphylococcus aureus hijacks a skin commensal to intensify its virulence: immunization targeting beta‐ hemolysin and CAMP factor. J Invest Dermatol 2011;131:401–9. 28 Cogen AL, Nizet V, Gallo RL. Skin microbiota: a source of disease or defence? Br J Dermatol 2008;158:442–55. 29 Alicea‐Serrano AM, Contreras M, Magris M et al. Tetracycline resist­ ance genes acquired at birth. Arch Microbiol 2013;195:447–51. 30 Hartz LE, Bradshaw W, Brandon DH. Potential NICU environmental influences on the neonate’s microbiome: a systematic review. Adv Neonatal Care 2015;15:324–35. 31 Evans NJ, Rutter N. Development of the epidermis in the newborn. Biol Neonate 1986;49:74–80. 32 Nikolovski J, Stamatas GN, Kollias N, Wiegand BC. Barrier function and water‐holding and transport properties of infant stratum corneum are different from adult and continue to develop through the first year of life. J Invest Dermatol 2008;128:1728–36. 33 Capone KA, Dowd SE, Stamatas GN, Nikolovski J. Diversity of the human skin microbiome early in life. J Invest Dermatol 2011;131: 2026–32. 34 Oh J, Byrd AL, Park M et  al. Temporal stability of the human skin microbiome. Cell 2016;165:854–66. 35 Oh J, Conlan S, Polley EC et al. Shifts in human skin and nares micro­ biota of healthy children and adults. Genome Med 2012;4:77. 36 Shi B, Bangayan NJ, Curd E et al. The skin microbiome is different in pediatric versus adult atopic dermatitis. J Allergy Clin Immunol 2016;138:1233–6.

37 Findley K, Oh J, Yang J et al. Topographic diversity of fungal and bac­ terial communities in human skin. Nature 2013;498:367–70. 38 Grice EA, Kong HH, Conlan S et  al. Topographical and temporal diversity of the human skin microbiome. Science 2009;324:1190–2. 39 Costello EK, Lauber CL, Hamady M et al. Bacterial community variation in human body habitats across space and time. Science 2009;326:1694–7. 40 Gao Z, Perez‐Perez GI, Chen Y, Blaser MJ. Quantitation of major human cutaneous bacterial and fungal populations. J Clin Microbiol 2010;48:3575–81. 41 Callewaert C, Kerckhof FM, Granitsiotis MS et al. Characterization of Staphylococcus and Corynebacterium clusters in the human axillary region. PloS One 2013;8:e70538. 42 Egert M, Schmidt I, Hohne HM et al. rRNA‐based profiling of bacteria in the axilla of healthy males suggests right‐left asymmetry in bacte­ rial activity. FEMS Microbiol Ecol 2011;77:146–53. 43 Gibson GR, Roberfroid MB. Dietary modulation of the human colonic microbiota: introducing the concept of prebiotics. J Nutr 1995;125(6): 1401–12. 44 Fuller R. Probiotics in man and animals. J Appl Bacteriol 1989;66(5): 365–78.

Methods of collection and analysis When evaluating a microbiome investigation, it is impor­ tant to review the experimental design of the authors, as this field lacks standardization, leading to varying results from different investigators. Identifying the sample source is the first step in this process, as it will dictate the overall microbial community being assessed. As reviewed earlier in the chapter, the skin microbiome community profiles of the three main skin environments (sebaceous, moist, dry) are quite distinct [1,2]. Recent work has also shown that fungal colonization is affected by site with feet harbouring more diversity than the rest of the body [3]. Cutaneous disease at the sites sampled can also affect the microbial community even if that is not the focus of the investigation. While body site can have a profound effect on the study, the method of skin sampling (cutaneous swab, scrape and biopsy) has generally been found to be equivalent on a ‘phylotype level’ (operational taxonomic units, OTUs) between samples when examining skin microbes [4]. However, more recent work has found differences in bacteria isolated from the epidermis, dermis and adi­ pose tissue [5]. Unlike pilosebaceous units, the dermis and subcutis are not in direct communication with the skin surface, and demonstration of varied bacterial com­ munities in different levels of biopsy specimens broadens the potential impact of sampling technique. When look­ ing at the acne microbiome, an alternative method to these three commonly used sampling techniques is the use of pore strips to selectively sample pilosebaceous units [6]. Further, hair‐specific studies have sampled indi­ vidual follicular units (‘plucked hairs’) and found higher amounts of human papillomavirus (HPV) than skin biop­ sies [7]. Beyond reviewing sample site and acquisition, critically assessing sample preparation and the use of appropriate negative controls (background microbial signal) is critically important, as contaminants can skew results. The sensitivity of next‐generation sequencing (NGS) tech­ niques can often reveal microbial signal from even classi­ cally ‘sterile’ techniques, such as sterile cotton swabs used for skin swabs (personal data). Cleaning and sterilizing the skin to avoid introducing surface contaminants when

assessing the microbiome of deeper structures and changing gloves between sample sites can be crucial. Beyond sample collection and basic preparation, the techniques used to analyse the microbial community structure should be considered as well. While culture‐ based methods previously dominated the literature, they have now largely taken a secondary role. Investigators are using more powerful techniques, such as 16S ribo­ somal DNA (rDNA) sequencing and whole‐genome shotgun (WGS) metagenomic sequences. NGS uses hypervariable rDNA regions to differentiate OTUs instead of the full rDNA sequence, as was used in classical Sanger sequencing. The choice of which hypervariable region to use as a proxy for the sequence can affect the data, as the V1–V3 region was found to be more accurate (closer to whole metagenomic data) for skin samples than V4, which is more helpful in gut microbiome studies [8,9]. Further, species discrimination for various microbes may require particular hypervariable region primer sets or may not be able to be resolved using standard 16S rDNA NGS. It is important to consider that as techniques evolve, results from studies using different methodologies may no longer be comparable. References 1 Grice EA, Kong HH, Conlan S et  al. Topographical and temporal diversity of the human skin microbiome. Science 2009;324:1190–2. 2 Perez Perez GI, Gao Z, Jourdain R et al. Body site is a more determinant factor than human population diversity in the healthy skin microbiome. PloS One 2016;11:e0151990. 3 Findley K, Oh J, Yang J et  al. Topographic diversity of fungal and bacterial communities in human skin. Nature 2013;498:367–70. 4 Grice EA, Kong HH, Renaud G et al. A diversity profile of the human skin microbiota. Genome Res 2008;18:1043–50. 5 Nakatsuji T, Chiang HI, Jiang SB et  al. The microbiome extends to subepidermal compartments of normal skin. Nat Commun 2013;4:1431. 6 Craft N, Li H. Response to the commentaries on the paper: Propionibacterium acnes strain populations in the human skin micro­ biome associated with acne. J Invest Dermatol 2013;133:2295–7. 7 Schneider I, Lehmann MD, Kogosov V et al. Eyebrow hairs from actinic keratosis patients harbor the highest number of cutaneous human papillomaviruses. BMC Infect Dis 2013;13:186. 8 Kong HH. Details matter: designing skin microbiome studies. J Invest Dermatol 2016;136:900–2. 9 Meisel JS, Hannigan GD, Tyldsley AS et al. Skin microbiome surveys are strongly influenced by experimental design. J Invest Dermatol 2016;136:947–56.

Cutaneous diseases and the microbiome The contribution of bacteria and fungi to cutaneous disease is a booming field of research. Here, we review the links between atopic dermatitis (AD), acne and psoria­ sis to bacterial communities on the skin.

Atopic dermatitis Bacterial colonization and bacterial/viral superinfection of AD are recognized as challenges in the management of this disease. Interestingly, Kennedy et  al. found that infants without staphylococcal colonization of the antecu­ bital fossa at 2 months were more likely to have AD at 12 months, raising the possibility of early bacteria modu­ lating the risk for AD [1]. However, this study showed no

51

difference in staphylococcal colonization at other sites (popliteal fossa, nasal tip, cheeks) and no difference at other time points in the first year of life. Older patients with AD are more often Staphylococcus aureus carriers [2,3]. Staph. aureus can produce toxins that affect mast cell degranulation and drive atopic disease, thus mechanisti­ cally linking the presence of bacteria and the maintenance of disease [2]. In addition, Staph. aureus is associated with Th2 inflammation and immunoglobulin E (IgE) response [4]. The benefit of commensal bacteria is exemplified by data that Staph. epidermidis has counter‐regulatory effects on cutaneous inflammation [4] and can interfere with Staph. aureus biofilms [5]. In an attempt to utilize bacteria to modify inflamma­ tion in patients with AD, one group has investigated applying lysates of Vitreoscilla filiformis, a bacterium found in some thermal springs, directly to the skin in a com­ pounded cream [6]. Both AD disease activity and pruritus decreased in the intervention group treated with the compound versus controls treated with vehicle only. The authors then investigated the mechanism behind this improvement using a mouse model, which showed that this treatment resulted in high levels of interleukin (IL)‐10 in dendritic cells via toll‐like receptor (TLR)2 leading to increased regulatory T‐cell activity [7]. This study proposes that AD therapy could utilize disease‐modifying bacteria that are not typical cutaneous colonizers or commensals. Microbial diversity differs between affected and ­normal skin. In patients with AD, microbial diversity decreases at an affected site during a flare and increases (improves, approaching levels seen in control patients) with treat­ ment [8]. Additionally, even intermittent treatment of a  site before a flare can affect microbial diversity [8]. Moreover, Staph. aureus as well as Staph. epidermidis are over‐represented during flares, showing how dysbiosis can contribute to disease. Manipulating the microbiome of these patients is seen as a possible new way to treat and/or prevent AD. Dilute bleach baths are commonly recommended to decrease Staph. aureus counts in children with AD [9–11]. Topical antibiotics such as mupirocin are used to treat infection or decrease colonization, as well. The effect of topical corti­ costeroids on the microbiome has been investigated more recently. Early work showed a reduction of Staph. aureus with topical corticosteroid use [12], and more recently treatment with fluticasone cream was shown to normalize the microbiome at lesional sites [13]. As topical corticos­ teroids do not directly target bacteria, this work demon­ strates the intimate cross‐talk between an inflammatory dermatosis and the cutaneous flora that can drive disease. These studies support the use of topical corticosteroids even on overtly infected lesions. There is an inverse correlation between AD severity and skin colonization with Streptococcus salivarius [14]. Interestingly, regular use of emollients in infants at risk of developing AD was associated with a lower skin pH and increased skin colonization with Strep. salivarius [14]. These two effects are thought to contribute to the preven­ tive effect of emollients in high‐risk infants.

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

Chapter 3  Cutaneous Microbiome

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

52

Section 1  Development, Structure and Physiology of the Skin

The role of dysbiosis in AD has been investigated by  multiple groups leading to attempts to modify the development and course, and/or improve treatment of AD through prebiotics [15,16], probiotics [15,17,18] and synbi­ otics [19]. One such study is investigating the effect of sup­ plementing pregnant women with probiotics to decrease risk of atopy [18]. Unfortunately, these investigations have not yielded consistent results nor have they improved care recommendations. At this point, there is not sufficient evi­ dence to recommend routine pre‐/pro‐/synbiotic supple­ mentation for patients with or at risk for AD. Clothing materials have also been studied as means to change the microbiome in patients with AD. For example, chitosan (a biopolymer derived from crustacean shells with inhibitory properties against Staph. aureus) was explored as a coating on cotton to alter the microbiome. In one study, there was no difference in Staph. aureus between participants who slept in chitosan‐coated pyjamas and those who did not, but the amount of coagulase‐negative Staphylococcus (CoNS) increased in the chitosan group [20]. While this might appear to be a negative result, the increased CoNS may help to control Staph. aureus (as described previ­ ously) and thus decrease disease activity. Additionally, fab­ rics incorporating silver have been investigated for treatment of AD. Silver dressings and topical preparations have long been used in wound care for their broad antimi­ crobial properties. More recently, fabrics made with silver mesh [21] and cellulose fibres of seaweed‐impregnated sil­ ver [22–24] have been shown to decrease microbial counts in patients with AD. Pruritus [24] and disease severity [21,23,24] also decreased in patients wearing the fabrics. These studies were performed with small numbers of patients, which limits the ability to generalize the findings. Investigations of antimicrobial fabrics are representative of ongoing research to further manipulate microbial dysbio­ sis, infection and inflammation in AD.

Acne The predominant bacterium found at sebaceous sites asso­ ciated with acne in adults is Cutibacterium acnes (formerly Propionibacterium acnes) [25,26]. This bacterium has long been linked to acne, and the amount of C. acnes recovered from these sites changes over time [27,28]. More recently, distinct C. acnes ribotypes (RT; a surrogate descriptor for C. acnes strains) have been significantly associated with acne skin (RT4, 5, 8, 10) or normal skin (RT6) [29], which suggests dysbiosis of the C. acnes community may lead to clinically apparent acne. Interestingly, though, younger children have comedonal acne and more Streptococcus than C. acnes (personal data), which correlates with their tendency to have less sebaceous gland activity. Though antibiotics have been a mainstay to treat inflammatory acne for generations of dermatologists, the increasing incidence of antibiotic resistance and general movement to increased antimicrobial stewardship has led some researchers to investigate more specific treatment targets. Understanding the drivers behind bacterial activity may help us better understand acne pathogenesis and develop such treatments. To this end, it has been shown that the vitamin B12 synthesis pathway at the mRNA

level is downregulated in C. acnes from acne skin and that host supplementation with B12 can further modify C. acnes transcription of multiple genes possibly leading to skin inflammation via increased porphyrin production [30]. These initial investigations are beginning to illumi­ nate the specific role(s) that the cutaneous microbiome plays in acne, but further research is required before these findings can be translated to clinical treatments.

Psoriasis Acute flares of psoriasis can be triggered by infections, including streptococcal infections of the oropharynx or perianal skin. In fact, the strength of this association has led to the proposal that the potential life‐threatening sequelae of streptococcal infections have exerted evolu­ tionary pressure to select for the psoriasis phenotype (Fig. 3.2) [31,32], though an alternative evolutionary argu­ ment has also been proposed for Mycobacterium leprae [33]. The potential link between the microbiome and chronic psoriasis is under investigation, with only a limited number of studies published. Researchers are examining psoriasis in relation to both the cutaneous and gut microbiomes at least in part due to the finding that patients with Crohn disease are more likely to develop psoriasis. In addition, these diseases have overlapping genetic associations and immune activation pathways, which has led some authors to suggest that both psoriasis and Crohn’s are related to alterations in immune toler­ ance to the microbiota (Fig. 3.2) [31]. This proposed dys­ biosis must be differentiated from true infection, as psoriatic lesions have a very low incidence of infection due to high expression of antimicrobial peptides such as HBDs 2/3 and cathelicidin LL‐37 [31]. Alekseyenko and colleagues have recently published microbiome data suggesting that there are distinct cutaneotypes associated with normal skin (cutaneotype 1: Proteobacteria) versus psoriatic lesional skin (cutaneotype 2: Firmicutes, Actinobacteria), with the latter carrying an odds ratio for psoriasis of 3.52 (95% confidence interval [CI] 1.44 to 8.98, P 50 10–15 (≥10–15) Deep rete ridges Deeper dermis, fully active Elastic fibre network, mature

­Epidermis

Water 80.5% Proteins 10.3% Other lipids 6.4% Barrier lipids 2.72% Cholesterol 1.1% FFA 0.6% Phospholipids 0.4% Ceramides 0.7% Fig. 4.1  Composition of human vernix caseosa. FFA, free fatty acid. Source: Adapted from Pickens et al. 2000 [1] and Hoeger et al. 2002 [2].

Unlike postnatal skin, sebum and keratinocytes are not shed in the fetal period but adhere to the skin; accumulation of vernix might thus compensate for the relative lack of barrier lipids in fetal skin. Application of vernix to normal adult skin has been shown to increase surface hydration [7]. Vernix contains antimicrobial peptides, e.g. cathelicidin, lysozyme and lactoferrin, which along with free fatty acids provide antimicrobial protection against fungi, bacteria and parasites [8,9]. ­References 1 Pickens WL, Warner RR, Boissy YL et  al. Characterization of vernix caseosa: water content, morphology, and elemental analysis. J Invest Dermatol 2000;115:875–81. 2 Hoeger PH, Schreiner V, Klaassen IA et al. Epidermal barrier lipids in human vernix caseosa: corresponding ceramide patterns in vernix and fetal epidermis. Br J Dermatol 2002;146:194–201. 3 Stewart ME, Quinn MA, Downing DT. Variability in the fatty acid composition of wax esters from vernix caseosa and its possible relation to sebaceous gland activity. J Invest Dermatol 1982;78:291–5. 4 Oku H, Mimura K, Tokitsu Y. Biased distribution of the branched‐ chain fatty acids in ceramides of vernix caseosa. Lipids 2000;35: 373–81. 5 Sheu H‐M, Chao S‐C, Wong T‐W et al. Human skin surface lipid film: an ultrastructural study and interaction with corneocytes and intercellular lipid lamellae of the stratum corneum. Br J Dermatol 1999;140:385–91. 6 Checa A, Holm T, Sjödin MOD et al. Lipid mediator profile in vernix caseosa reflects skin barrier development. Sci Rep 2015;5:15740. 7 Bautista MIB, Wickett RR, Visscher MO et  al. Characterization of vernix caseosa as a natural biofilm: comparison to standard oil‐based ointments. Pediatr Dermatol 2000;17:253–60. 8 Akinbi HT, Narendran V, Pass AK et  al. Host defense proteins in vernix caseosa and amniotic fluid. Am J Obstet Gynecol 2004; 191:2090–6. 9 Tollin M, Bergsson G, Kai‐Larsen Y et al. Vernix caseosa as a multi‐ component defence system based on polypeptides, lipids and their interactions. Cell Mol Life Sci 2005;62:2390–9.

The epidermis protects against evaporation, percutaneous absorption of toxic substances, physical damage and microbial infection. These properties depend largely on the thickness and barrier lipid content of the epidermis, both of which are directly related to gestational age [1,2]. As shown in Fig. 4.2, the number of epidermal cell layers and, from about the beginning of the third trimester, the thickness of the stratum corneum increase progressively with age. Scanning electron microscopy of the epidermal surface showed high anisotropy with irregular corneocyte clusters in young infants indicating a poorly controlled process of corneocyte desquamation while in older children the distribution of superficial corneocytes was more regular [3]. The most important lipids required for barrier function (i.e. ceramides, cholesterol and free fatty acids) are synthesized in the lamellar bodies within the granular layer. There is a patterned succession of epidermal expression of mRNA and of enzymes involved in lipid synthesis preceding the formation of an effective epidermal barrier [4,5]. Among the most important factors regulating the sequence of epidermal differentiation and stratum corneum formation is the peroxisome proliferator‐activated receptor‐α (PPAR‐α). PPARs are expressed abundantly in early fetal epidermis; they regulate the activity of key enzymes required for barrier ontogenesis (e.g. β‐glucocerebrosidase and steroid sulphatase) [5,6]. Similar to what happens in maturation of the lung, glucocorticoids, thyroid hormones and oestrogens accelerate barrier formation, while androgens retard it [5]. Initiation of skin barrier formation in the human fetus starts at around 20–24 weeks’ gestation [7]. The process of keratinization reveals an interesting temporal and spatial pattern, starting at and spreading from distinct epidermal initiation sites such as forehead, palms and soles [7,8]. Filaggrin  –  derived from profilaggrin in the keratohyalin granules – aggregates keratin filaments in the stratum corneum. Small molecules known as natural moisturizing factor (NMF) are proteolytically cleaved from filaggrin. They are responsible for hydration and plasticity (flexibility) of the skin surface and help to prevent TEWL [9]. Forty percent of the NMF are formed by hygroscopic free amino acids such as urocanic acid; their concentration at birth is extremely low, and increases slowly over the first months in parallel with stratum corneum hydration [10,11]. Intraepidermal concentrations of the pro‐inflammatory cytokine interleukin 1‐alpha (IL‐1α) are higher in infants than in adults, and higher in premature than in mature infants. Its release is stimulated by the rapid transition

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

Table 4.1  A comparison of skin anatomy between preterm and term neonates and older children

Section 1  Development, Structure and Physiology of the Skin

(a)

(b)

(c)

(d)

Fig. 4.2  Embryonic, fetal and neonatal skin: (a) at 13 weeks’ gestation; (b) at 18 weeks’ gestation; (c) at 25 weeks’ gestation; (d) in a mature neonate.

from high to low humidity at birth, and in response to epidermal damage in order to induce the recovery process [12,13]. The same applies to the antimicrobial peptides (human β‐defensins [HBD] and cathelicidins) which are reduced in neonates [14] while the antimicrobial proteins lysozyme and lactoferrin are present in neonatal epidermis at levels five times higher than in adults [15].

­Transepidermal water loss The intactness of the epidermal barrier can be assessed by measuring the TEWL. The TEWL is proportional to the vapour pressure gradient measured with an evaporimeter [16,17]. It is influenced by gestational age, site and ambient humidity [16–18]. In term neonates, the TEWL ranges from 4 to 8 g/m2/h. This is slightly lower than in adults [19] owing to the fact that eccrine sweating is low or absent in the newborn infant. In the premature infant, TEWL is inversely proportional to gestational age (Fig. 4.3). In very immature infants (24–26 weeks’ gestation), it can be as high as 100 g/m2/h, which means that these infants, if left in a dry atmosphere, could lose 20–50% of their body weight within 24 hours. This degree of TEWL would rapidly lead to hypernatraemia, polyglobulia and hypothermia, resulting eventually in periventricular haemorrhage and death. As TEWL represents passive diffusion of water

80

TEWL (g/m2/hr)

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

58

60

40

20

0 0

5

10

15

20

Postnatal age (days) Fig. 4.3  The effect of gestational age on transepidermal water loss (TEWL). Serial measurements from abdominal skin in 17 infants of 25–29 weeks’ gestation. Shaded bar represents TEWL in term infants. Source: Cartlidge and Rutter 1998 [18]. Reproduced with permission of Elsevier.

along a water vapour gradient, it can be prevented by raising the ambient humidity. It is now common practice to humidify incubators for premature babies, particularly those of less than 32 weeks’ gestation [20]. Humidity needs to be as high as 80–90% within the first days in order to prevent heat and fluid loss. Pre­vention of hypothermia and TEWL can also be ascertained by using polyethylene

caps or wraps immediately after delivery [21]. Randomized controlled trials in Pakistan and India where incubators are not readily available have demonstrated that postnatal application of topical emollients (sunflower seed oil, coconut oil or mineral oils [petrolatum]) can (i) reduce TEWL in VLBW preterm babies [22] and (ii) improve skin integrity and reduce the risk of bloodstream infections in preterm infants [23] if started immediately after birth [24]. The effectiveness of this approach in primary care settings needs to be further explored since a meta‐analysis of previous reports could not demonstrate benefits of topical emollients with respect to infection rate and mortality [25]. There is a striking regional variability on the skin surface regarding TEWL; it is usually highest through the abdominal skin, where maturation of the epidermal barrier occurs latest [7,8]. Preterm infants nursed under a radiant heater exhibit higher rates of evaporation because the level of ambient water vapour is lower [26]. It is likewise increased (by 20%) during phototherapy, even if relative humidity and ambient temperature are tightly controlled; this is probably caused by increased dermal blood flow during phototherapy [27,28]. Maintenance fluid intake of preterm

Skin surface pH Acidification of the skin surface is effected by acidic components in the sweat, sebum and horny layer (Fig. 4.4a) [34]. 140

7.0

120

6.5

100 Corneometer units

pH

infants should therefore be adequately increased during phototherapy. Neonatal epidermis can easily be damaged (e.g. by removal of plastic adhesives), which induces a measurable disruption of the skin barrier function [29]. Interestingly, air exposure leads to acceleration of postnatal barrier maturation. As depicted in Fig. 4.3, TEWL in most premature infants approaches that of term infants within 10–15 days. Studies in rodents have shown that this functional maturation is paralleled by an increase in stratum corneum thickness, the number of lamellar bodies in stratum granulosum cells and the barrier lipid content of the stratum corneum [30,31]. In ultra‐low‐birthweight infants (23–25 weeks of gestational age), this process can, however, take significantly longer [32]. As demonstrated recently, even in mature babies it takes up 12 months until TEWL normalizes to levels seen in older children and adults; this process is paralleled by a constant increase of NMF levels within the epidermis [33].

7.5

6.0 5.5 5.0 4.5 4.0

59

80 60 40 20

3

30 RZ Din

(a)

0

90

3

30

90

Ra

(b) 30

160 140

25

120 20

80

μm

μm

100

60

15 10

40 5

20 0 (c)

3

30 Age (days)

0

90 (d)

3

30

90

Age (days)

Fig. 4.4  Development of skin surface parameters in neonates and young infants (n = 180 healthy neonates). (a) Skin surface pH. (b) Stratum corneum hydration (both measured on the frontal area). (c and d) Microtopography (parameters of skin roughness). Rz Din, mean depth of roughness; Ra, arithmetic mean surface roughness.

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

Chapter 4  Physiology of Neonatal Skin

SECTION 1: DEVELOPMENT, STRUCTURE AND PHYSIOLOGY

60

Section 1  Development, Structure and Physiology of the Skin

Three classes of molecules are considered to be the most likely sources of protons in the epidermis [35]: some amino acids and filaggrin‐derived breakdown products such as urocanic acid and pyrrolidone carboxylic acid; α‐hydroxy acids such as lactic acid; and acidic lipids such as cholesterol sulphate and free fatty acids. At birth, neonates exhibit a characteristic neutral or alkaline skin surface pH of 6.2–7.5 [27,28]. In both term [36] and preterm infants [37], the pH declines rapidly in the first week, and slowly thereafter up to the fourth week of life, when a range of 5.0–5.5 is reached, which is similar to that in older children and adults [34–39]. Acidity of the stratum corneum facilitates homeostasis of colonizing commensal bacteria and inhibits replication of pathogenic bacteria and fungi.

Stratum corneum hydration and skin roughness Neonatal skin is relatively dry and rough compared with that of older infants (Fig. 4.4b–d) [38–40]. Stratum corneum hydration and skin roughness are correlated [34,38]. In healthy term neonates, corneal layer hydration increases and skin roughness decreases proportionate to age. The skin surface of the newborn is rather hydrophobic, which limits epidermal adsorption of water [41]. The heat loss caused by evaporation of amniotic fluid from the skin of the newborn is thus minimized. ­References 1 Evans NJ, Rutter N. Development of the epidermis in the newborn. Biol Neonate 1986;49:74–80. 2 Fairley JA, Rasmussen JE. Comparison of stratum corneum thickness in children and adults. J Am Acad Dermatol 1983;8:652–4. 3 Fluhr JW, Lachmann N, Baudouin C et al. Development and organization of human stratum corneum after birth: electron microscopy isotropy score and immunocytochemical corneocyte labelling as epidermal maturation’s markers in infancy. Br J Dermatol 2014; 17:978–86. 4 Williams ML, Hincenbergs M, Holbrook KA. Skin lipid content during early fetal development. J Invest Dermatol 1988;91:263–8. 5 Williams ML, Hanley K, Elias PM et al. Ontogeny of the epidermal permeability barrier. J Invest Dermatol Symp Proc 1998;3:75–9. 6 Schmuth M, Schoonjans K, Yu QC et al. Role of peroxisome proliferator‐activated receptor α in epidermal development in utero. J Invest Dermatol 2002;119:1298–303. 7 Holbrook KA, Odland GF. Regional development of the human epidermis in the first trimester embryo and the second trimester fetus. J Invest Dermatol 1980;74:161–8. 8 Hardman MJ, Moore L, Ferguson MWJ et al. Barrier formation in the human fetus is patterned. J Invest Dermatol 1999;113:1106–13. 9 Visscher M, Narendran V. The ontogeny of skin. Adv Wound Care 2014;3:291–303. 10 Visscher MO, Utturkar R, Pickens WL et al. Neonatal skin matu­ration— vernix caseosa and free amino acids. Pediatr Dermatol 2011;28:122. 11 Chittock J, Cooke A, Lavender T et  al. Development of stratum corneum chymotrypsin‐like protease activity and natural moisturizing factors from birth to 4 weeks of age compared with adults. Br J Dermatol 2016;175:713–20. 12 Ashida Y, Ogo M, Denda M. Epidermal interleukin‐1 alpha generation is amplified at low humidity: implications for the pathogenesis of inflammatory dermatoses. Br J Dermatol 2001;144:238. 13 Jiang YJ, Lu B, Crumrine D et  al. IL‐1alpha accelerates stratum corneum formation and improves permeability barrier homeostasis during murine fetal development. J Dermatol Sci 2009;54:88. 1 4 Strunk T, Doherty D, Richmond P et al. Reduced levels of antimicrobial proteins and peptides in human cord blood plasma. Arch Dis Child Fetal Neonatal Ed 2009;94:F230–1.

15 Walker VP, Akinbi HT, Meinzen‐Derr J et al. Host defense proteins on the surface of neonatal skin: implications for innate immunity. J Pediatr 2008;152:777. 16 Hammarlund K, Sedin G, Stromberg B. Transepidermal water loss in newborn infants. VIII. Relation to gestational age and postnatal age in appropriate and small for gestational age. Acta Paediatr Scand 1983;72:721–8. 17 Hammarlund K, Sedin G. Transepidermal water loss in newborn infants. III. Relation to gestational age. Acta Paediatr Scand 1979; 68:795–801. 18 Cartlidge PHT, Rutter N. Skin barrier function. In: Polin RA, Fox WW, eds. Textbook of Fetal and Neonatal Physiology, 2nd edn. Philadelphia: W.B. Saunders, 1998:771–88. 19 Cunico RL, Maibach HI, Khan H et al. Skin barrier properties in the newborn. Biol Neonate 1977;32:177–82. 20 Harpin VA, Rutter N. Humidification of incubators. Arch Dis Child 1985;60:219–24. 21 McCall EM, Alderdice F, Halliday HL et al. Interventions to prevent hypothermia at birth in preterm and/or low birthweight infants. Cochrane Database Syst Rev 2010;3:CD004210. 22 Nangia S, Paul VK, Deorari AK et  al. Topical oil application and transepidermal water loss in preterm very low birthweight infants – A randomized trial. J Trop Pediatr 2015;61:414–20. 23 Salam RA, Darmstadt GL, Bhutta ZA. Effect of emollient therapy on clinical outcomes in preterm neonates in Pakistan: a randomised controlled trial. Arch Dis Child Fetal Neonatal Ed 2015;100:F210–15. 24 Darmstadt GL, Ahmed S, Ahmed ASMN, Saha SK. Mechanism for prevention of infection in preterm neonates by topical emollients: a randomized, controlled clinical trial. Pediatr Infect Dis J 2014;33:1124–7. 25 Cleminson J, McGuire W. Topical emollient for preventing infection in preterm infants. Cochrane Database Syst Rev 2016;(1):CD001150. 26 Kjartansson S, Arsan S, Hammarlund K et al. Water loss from the skin of term and preterm infants nursed under a radiant heater. Pediatr Res 1995;37:233–8. 27 Maayan‐Metzger A, Yosipovitch G, Hadad E et  al. Transepidermal water loss and skin hydration in preterm infants during phototherapy. Am J Perinatol 2001;18:393–6. 28 Grünhagen DJ, de Boer MGJ, de Beaufort AJ et  al. Transepidermal water loss during halogen spotlight phototherapy in preterm infants. Pediatr Res 2002;51:402–5. 29 Lund C, Nonato LB, Kuller JM et al. Disruption of barrier function in neonatal skin associated with adhesive removal. J Pediatr 1997;131: 367–72. 30 Hanley K, Jiang Y, Elias PM et al. Acceleration of barrier ontogenesis in vitro through air exposure. Pediatr Res 1997;41:293–9. 31 Denda M, Sato J, Masuda Y et  al. Exposure to a dry environment enhances epidermal permeability barrier function. J Invest Dermatol 1998;111:858–63. 32 Kalia YN, Nonato LB, Lund CH et  al. Development of skin barrier function in premature infants. J Invest Dermatol 1998;111:320–6. 33 Nikolovski J, Stamatas GN, Kollias N, Wiegand BC. Barrier function and water‐holding and transport properties of infant stratum corneum are different from adult and continue to develop through the first year of life. J Invest Dermatol 2008;128:1728–36. 34 Abe T, Mayuzumi J, Kikuchi N et  al. Seasonal variations in skin temperature, skin pH, evaporative water loss and skin surface lipid values on human skin. Chem Pharm Bull 1980;28:387–92. 35 Seidenari S, Giusti G. Objective assessment of the skin of children affected by atopic dermatitis: a study of pH, capacitance and TEWL in eczematous and clinically uninvolved skin. Acta Derm Venereol (Stockh) 1995;75:429–33. 36 Behrendt H, Green M. Skin pH pattern in the newborn infant. Am J Dis Child 1958;35:1958. 37 Green M, Carol B, Behrendt H. Physiologic skin pH patterns in infants of low birth weight. Am J Dis Child 1968;115:9–16. 38 Hoeger PH, Enzmann CC. Skin physiology of the neonate and young infant: prospective study of functional skin parameters during early infancy. Pediatr Dermatol 2002;19:256–62. 39 Fox C, Nelson D, Wareham J. The timing of skin acidification in very low birth weight infants. J Perinatol 1998;18:272–5. 40 Saijo S, Tagami H. Dry skin of newborn infants: functional analysis of the stratum corneum. Pediatr Dermatol 1991;8:155–9. 41 Okah FA, Wickett RR, Pompa K et  al. Human newborn skin: the effect of isopropanol on skin surface hydrophobicity. Pediatr Res 1994;35:443–6.

­Dermis and skin appendages The dermis supplies sweat, sebum and, most importantly, nutrients to the epidermis. Dermal vessels are most important for the regulation of skin and body temperature. The dermis connects the epidermal sheath with the underlying fatty tissue and, through a network of collagenous and elastic fibres, provides stability and protection against trauma to the skin. With its papillary ridges, the epidermis is intertwined with the dermis, thus protecting against shearing or abrasive forces. The basal cell layer to surface length ratio gives an indication of the undulation of the epidermal–dermal interface [1]. In term infants, it increases from 1.07 ± 0.07 to 1.2 ± 0.13 within the first 4 months [1]. As long as the rete ridges are not or only incompletely formed, the epidermis is prone to abrasive injuries caused for instance by shearing movements of the patients’ own hands or by the removal of plasters. This effect is augmented by the relative thinness of the epidermis.

Sebaceous gland activity Sebum is composed of squalenes and monoester waxes [2]. Sebum levels during the first month tend to be as high as those in adults [3,4], but they decline significantly towards the end of the first trimester and remain low until the beginning of puberty. Stimulation of sebaceous glands by maternal androgens starts before birth [3]. Accordingly, transient sebaceous gland hypertrophy is a common finding in term neonates. Rates of maternal and neonatal sebum secretion are correlated [4].

Thermoregulation Neonates, and particularly premature babies, are at an increased risk of heat loss. Heat loss is largely caused by evaporative rather than radiative loss during the first week of life [5]. In term infants thermogenesis is largely driven by brown adipose tissue which is located around the kidney and in the interscapular areas and represents about 1% of fetal weight at term [6]. Regional heat loss is closely related to the external temperature. The vasoconstrictive response to reduced temperature, which can be assessed by laser Doppler flowmetry, appears to be diminished in the newborn infant [7]. Occlusive wrapping of VLBW infants has been shown to prevent the dangerous postnatal evaporative heat loss [8]. Although their density of sweat glands is even higher than that in adults, thermal sweating is reduced in the term neonate (i.e. the induction threshold for sweating is higher than in adults) [9,10]. Sweating occurs first on the forehead and later on the trunk and extremities. The intensity of sweating in response to a thermal stimulus depends on gestational age [10]. Unlike term neonates, preterm babies are usually unable to sweat in response to heat during the first days of life. On the other hand, sweating can be induced chemically as early as 32 weeks’ gestation, suggesting that hypohidrosis results from immaturity of neurological regulation rather than anatomical immaturity [11]. Similar to their adaptation regarding TEWL, however, the development of sweating

61

is hastened postnatally so that nearly all preterm infants are able to sweat at the age of 13 days, although the thermal stimulus required is higher and sweat output lower than in term neonates [10]. Emotional sweating, which is particularly prominent on the palmoplantar regions, represents a response to hunger or pain independent of ambient temperature. It is not present before 36–37 weeks’ gestation [12]. Functional immaturity of the sweat glands appears to be without clinical significance in the neonatal period. Even in children with anhidrotic ectodermal dysplasia, who are completely unable to sweat, hyperpyrexia does not occur until late infancy/early childhood.

Percutaneous respiration The absorption of oxygen and excretion of carbon dioxide through the skin is an often quoted and much overrated phenomenon. In adults and mature neonates, it accounts for