Evidence-Based Ayurveda: Defining A New Scientific Path 0367357097, 9780367357092, 100070713X, 9781000707137

Citation preview

Evidence-based Ayurveda

This groundbreaking work calls for an overhaul of traditional Ayurveda and its transformation into a progressive, evidence-based medicinal system. This book begins by looking back at the research of the last three centuries, Indian medicinal plants, and Ayurveda in a twenty-first-century context. The first part of this book explores the limitations of contemporary Ayurvedic pharmacognosy and pharmacology, discussing the challenges the practice faces from research and clinical trials. It makes a compelling argument for the necessity of change. The second part of the book defines and elaborates upon a new, scientific path, taking the reader from identification of the herb through all stages of drug development. An essential tool for herbal drug development, this text is designed for knowledgeable students, practitioners, and scholars of Ayurveda, pharmacy, and herbal medicine. C. P. Khare is the founder president of the Society for New Age Herbals, a forum for promoting evidence-based herbal medicine, in New Delhi, India. He has been an herbalist, herbal drug consultant, and herbal historian for more than 60 years.

The Old Order Changeth Yielding Place to New . . .

Evidence-based Ayurveda Defining a New Scientific Path Edited by C. P. Khare

First published 2020 by Routledge 2 Park Square, Milton Park, Abingdon, Oxon OX14 4RN and by Routledge 52 Vanderbilt Avenue, New York, NY 10017 Routledge is an imprint of the Taylor & Francis Group, an informa business © 2020 selection and editorial matter, C. P. Khare; individual chapters, the contributors The right of C. P. Khare to be identified as the author of the editorial material, and of the authors for their individual chapters, has been asserted in accordance with sections 77 and 78 of the Copyright, Designs and Patents Act 1988. All rights reserved. No part of this book may be reprinted or reproduced or utilised in any form or by any electronic, mechanical, or other means, now known or hereafter invented, including photocopying and recording, or in any information storage or retrieval system, without permission in writing from the publishers. Trademark notice: Product or corporate names may be trademarks or registered trademarks, and are used only for identification and explanation without intent to infringe. British Library Cataloguing-in-Publication Data A catalogue record for this book is available from the British Library Library of Congress Cataloging-in-Publication Data A catalog record for this book has been requested ISBN: 978-0-367-35709-2 (hbk) ISBN: 978-0-429-34126-7 (ebk) Typeset in Times New Roman by Apex CoVantage, LLC

Contents

List of contributorsvii

Introduction: the thrust: why a new scientific path?

1

PART I

The legacy and logical steps for a new therapeutic regimen5   1 The need for liberal regulations for promoting evidencebased Ayurveda

7

  2 Each and every step of AYUSH will have a far-reaching impact

29

  3 To move with the times: expand the knowledge base of Ayurveda

33

  4 The classical age in countries that are now leaders in herbal medicine

39

  5 Avoiding scientific inquiry is not possible now

57

  6 Ayurvedic pharmacognosy and pharmacology: in modern perspective

61

  7 How classical procedures lost ground

67

  8 Identification of proper herbs: a new scientific route

73

  9 Pruning of classical formulations: suggested process

121

10 The pragmatic nature of Ayurveda: no restrictions on revising old formulations

127

11 Basic steps: for restructuring Ayurvedic formulations

131

12 Hidden secrets of clinical success: super power of “Sacred Word”

155

vi  Contents PART II

Defining a new scientific path by switching over to modern pharmacognosy, pharmacology and research protocols

161

13 Identification of medicinal plants by voucher specimen

163

14 DNA barcoding: a breakthrough in authentication of raw herbs

173

15 Modern extraction methods and standardization of extracts

183

VIKRAM ANDREW NAHARWAR

16 Markers for quality control of herbal drugs

201

17 Pharmacological actions of chemical constituents

217

18 Pharmacological screening of Ayurvedic drugs by experimental studies

231

R. C. SAXENA

19 An enigmatic approach in Ayurvedic Pharmacopoeia of India: from holistic approach to disease-specific concepts

237

20 Unbiased research: lifeline of evidence-based Ayurveda

245

21 Threat to classical reputation by dubious herbs and substitutes

261

22 Red list of medicinal plants: a threat to Ayurvedic formulations

273

23 Ayurvedic education system: a path-breaking study reflecting the elements of evidence-based Ayurveda

293

List of abbreviations Index

299 301

Contributors

Vikram Andrew Nahaewar is a third-generation herbalist. For 23 years he has been Director of India’s first private-sector R&D laboratory, Amsar, which has been recognized by the Department of Scientific Industrial Research of India. He participated in the System of Conferences on Medicinal & Aromatic Plants, Vienna, 1997, organized by the United Nations Industrial Development Organization (UNIDO). Dr. Naharwar is Chief Scientific Officer at Integrated Clinical Research Sciences, an Indian CRO that has conducted clinical trials for global pharmaceutical companies, such as Pfizer, Aventis, GSK and Panacea Biotech. In 2001 he was nominated by the Central Drug Laboratory, Government of India, to the subcommittee of the Official Indian Pharmacopoeia. He has authored numerous articles on herbal medicines, including the Official Indian Pharmacopoeia monographs, and is a member of the review committee of the Indian Herbal Pharmacopoeia. Kishor Patwardhan is currently a professor in the Department of Kriya Sharir, Faculty of Ayurveda, Banaras Hindu University. His doctoral work was on identifying issues, concerns and challenges of Ayurveda education in India. He is involved in developing tools for the assessment of Ayurveda parameters, such as Prakriti and Agnibala. He has lectured on various platforms in India and abroad on topics such as academic writing, research methodology, educational research, education policy and Ayurveda physiology. He has received the AYUSH-sponsored Vaidya-Scientist Fellowship from Transdisciplinary University (TDU), Bengaluru, and has recently been awarded the Dr. C. Dwarikanath Award from the Indian Association for Study of Traditional Asian Medicine (IASTAM) for newer interpretations of Ayurveda principles. He has authored important papers on education policies and research practices. His research interests include Ayurveda biology, Ayurveda education and policies on higher education. He has worked as a member of many scientific advisory committees, editorial boards and task forces. R. C. Saxena, MBBS, MD, DIP CLIN PHARMOCOL (UK), MNASc, MNAMS, FIAMS, FIMSA, was Former Director and Head, Pharmacology, and Director Pharmacy, King George’s Medical University, Lucknow. He was the first Indian Clinical Pharmacologist qualified from the UK and trained at

viii  Contributors Hammersmit, Royal Postgraduate Medical School, University of London. Dr. Saxena occupied first faculty position in Pharmacology, represented India at the First Clinical Pharmacology and Therapeutics (CPT) conference in London and was also the first Indian faculty member of the International Union of Basic and Clinical Pharmacology (IUPHAR) conference in Japan. His first work in the field of herbal medicine was related to clinical evaluation of Glycyrrhiza Glabra in Bockharts Impetigo, Pemphigus and other diseases on antiinflammatory activity of a dual drug containing Withania ashwagandha and Cyperus rotundus. He is developing drugs for Alopecia and Vitiligo. He also published several books, in addition to a number of research papers in national and international journals.

Introduction The thrust: why a new scientific path?

During the classical period, Ayurveda was a holistic medicine. First, the Dosha was identified; then, the first component of the herb, Rasa (taste), was selected. Rasa was considered an important marker which indicated, initially, the right choice of the herb to treat not only symptoms but also the whole system by synchronizing Doshas, Vaata, Pitta and Kapha, collectively known as Tridoshas; Tridoshas represent the constitution of the patient. Thus, Ayurveda was a holistic, individually tailored medicine and was aimed at treating the whole person (body, mind, spirit and emotions). Ayurveda, as a Vedic medicine, was also employed by Hindu priests, preachers and yogis, while it is neither a holy medicine nor exclusively a Hindu medicine. Thus, Ayurveda remained the most employed medicinal system. The restructuring of Ayurveda, until now, was not possible because of stiff resistance from the exponents of holistic (holy) medicine. With the introduction of the Linnaean system, Sanskrit names were converted to botanical names. That opened the gates of India for botanists and European plant collectors. The British passed the baton to scientists, pharmacognosists and pharmacologists. Holistic medicine was caught between two worlds. The only way out was to call Ayurveda a science – disease-specific, not Tridosha-specific. Indian scientists started exploring the hidden potentials of Indian medicinal plants and tried to scan the validity of old knowledge. To protect the holistic medicine from the scientific onslaught, in 1964, 54 classical and pro-classical books (actually 58) were given legal sanction in the Drugs and Cosmetic Act (Schedule I, section 3a) as “authoritative” books, giving them the status of a knowledge-base in Ayurveda. The whole exercise remained confined to the plants and formulations mentioned in classical and pro-classical texts. As a result, only 499 medicinal plants were allowed into the Ayurvedic Pharmacopoeia of India. In monographs, classical attributes of each drug, according to the doctrine of Rasa, Guna, Virya, Vipaka and Karma, were retained. It was stated that “these were considered a reasonable basis and convenient reference point for clinical classification.” A few chemical constituents were also quoted to keep the flock together. Ultimately, it was admitted that such (holistic) parameters are not possible to measure by modern scientific methods and thus not mandatory. For three centuries, Indian scientists had been trying to use the ancient wisdom and new scientific advancements for making Ayurveda an evidence-based,

2  Introduction disease-specific medicinal system. But within the framework of a holistic system, which tries to treat the whole system, drug development for millions of people, whose prakriti (constitution) is not known, was not possible. We were the first to divide Ayurvedic medicine into two periods, classical and modern. Our first book, The Modern Ayurveda: Milestones beyond the Classical Age, was published by CRC Press in 2012. This was followed by our review of six volumes of The Ayurvedic Pharmacopoeia of India in Ayurvedic Pharmacopoeial Plant Drugs: Expanded Therapeutics to highlight the inherent weakness of Ayurveda and establish the need of modern scientific tools for standardization, modern pharmacological tools for safety and efficacy evaluation, and application of biotechnology to elicit the mechanism of drug action. This book was also published by CRC Press. In accordance with our understanding, a number of Ayurvedic scholars acknowledged the following: “No work can be ever said to be a complete work. There always remains room for further improvement. The Ayurvedic Pharmacopoeia of India and Ayurvedic Formulary of India are no exception to this. The work of revision is being undertaken by the (Pharmacopoeial) committee in this respect. It is clear that even after revision there may remain a lot of room for improvement.” It was also acknowledged that “the method of conducting clinical trials of Ayurvedic drugs still remains a controversial issue.” Holistic medicine (as Ayurvedic sciences) is still on the center stage. In this setup, scientists are facing a serious problem. We have no objection if a vaidya (Ayurvedic physician) is made secretary in the Ministry of AYUSH, and we have no objection if a vaidya is appointed as Director General of the Central Council for Research in Ayurvedic Sciences, provided research and development are accelerated and scientists get an opportunity to review various moves. There is a lot of difference between research in Ayurvedic sciences and research in Ayurveda. Those who guide the research, ask the team of scientists to prepare research findings, and produce an herbal drug, must believe in new research. The scientist who cannot climb all the steps of the ladder does half-hearted research with all possible shortcuts and gives half-baked results. The biggest drawback is that Ayurvedic drug “research” is confined to only classical plant drugs, and the whole exercise more or less remain confined to centuries-old formulations. This problem is a serious one, so serious that it may adversely affect the future growth of a promising medicinal system. Already, most of the newly launched Ayurvedic drugs are facing veiled criticism from scientists. Now, have a look at the scientific database provided by Indian scientists. The Reviews on Indian Medicinal Plants series of the Indian Council of Medical Research have already covered 4,951 medicinal plant species and cited 75,486 research papers (from A to P, May 2019) in 21 volumes. Earlier, in The Wealth of India series, 22 volumes were published by the Council of Scientific and Industrial Research. No country can ignore this scientific surge. We are giving a number of suggestions for the transformation of Ayurveda into an evidence-based system. We hope that our efforts will be taken in the right perspective and that all three of our

Introduction  3 books will inspire young academicians and scientists to see that Ayurveda gets a much-needed launch pad. While concluding, we would like to acknowledge the contribution of Dr. Vikram Andrew Naharwar, a third-generation phytochemist. He remained with me for more than three months and organized a lot of raw material for the project. Dr. C. K. Katiyar always sorted out knotty issues of Ayurveda. – C. P. Khare [email protected]

Part I

The legacy and logical steps for a new therapeutic regimen

1 The need for liberal regulations for promoting evidence-based Ayurveda

Why Ayurvedic Medicine and Herbal Medicine are treated as two rival systems with different legal regulations? Why all Indian medicinal Plants are not Ayurvedic Plants? Why the research of the last three centuries is not a part of Ayurveda?

The Drugs and Cosmetics Act, 1940 (Editor’s note: First, we will quote certain clauses of The Drugs and Cosmetics Act, 1940 (23 of 1940) (as amended up to the 31 December 2016) and The Drugs And Cosmetics Rules, 1945 (as amended up to the 31st December 2016), which need to be reviewed for an all-round growth of the 5,000-year-old traditional medicinal systems of India.) The Drugs and Cosmetics Act Chapter, 3(a): Drug [Ayurvedic, Siddha or Unani] includes all medicines intended for internal or external use for or in the diagnosis, treatment, mitigation or prevention of disease or disorder in human beings or animals, and manufactured exclusively in accordance with the formulae described in the authoritative books (of Ayurvedic, Siddha and Unani Tibb systems of medicine) specified in the First Schedule. 3(h): patent or proprietary medicine means – (i)

in relation to Ayurvedic, Siddha or Unani Tibb systems of medicine all formulations containing only such ingredients mentioned in the formulae described in the authoritative books of Ayurveda, Siddha or Unani Tibb systems of medicine specified in the First Schedule, but does not include a medicine which is administered by parenteral route and also a formulation included in the authoritative books as specified in clause (a); (ii) in relation to any other systems of medicine, a drug which is a remedy or prescription presented in a form ready for internal or external administration of human beings or animals and which is not included in the edition of the Indian Pharmacopoeia for the time being or any other Pharmacopoeia authorized in this behalf by the Central Government after consultation with the Drugs Technical Advisory Board constituted under section 5.

8  Legacy and logical steps THE FIRST SCHEDULE [See section 3(a)]1 A. Ayurvedic Books:2 contain 54 (actually 59) authoritative books. (For analysis, see chapter 3.) (1. Subs. by Act 13 of 1964, s. 31, for the Sch. The First Schedule came into force with effect from 1–2–1969.)

Drugs and Cosmetics Rules, 1945 PART X A: 122 DAC. Permission to conduct clinical trial: (1) The Licensing Authority as defined in clause (b) of Rule 21, on being satisfied that the data submitted along with the application in support of the proposed clinical trial is adequate in all respects, issue permission for conduct of clinical trial, subject to the following conditions, namely: (a) Clinical trial shall be conducted in compliance with the approved protocols, requirements of Schedule Y annexed to these rules, Good Clinical Practice Guidelines for conduct of clinical trials in India and other applicable regulations; (b) Approval of the Ethics Committee shall be obtained before initiation of the study; (c) Clinical trial shall be registered at Clinical Trials Registry of India before enrolling the first patient for the study; (d) Annual status report of each clinical trial, as to whether it is ongoing, completed or terminated, shall be submitted to the Licensing Authority and in case of termination of any clinical trial the detailed reasons for the same shall be communicated to the said Licensing Authority; (e) Any report of serious adverse event occurring during clinical trial to the subject, after due analysis, shall be forwarded within ten days of its occurrence as per Appendix XI and in compliance with the procedures prescribed in Schedule Y.

(Editor’s Note: See The Controversy on PART X A: 122 DAC and ADVISORY from AYUSH on April 2, 2019, at the end of salient features of Drugs and Cosmetics Rules, 1945, chapter 2.) Part XVI: 158(B) Guidelines for issue of license with respect to Ayurveda, Siddha or Unani drugs. I

(A)   Ayurveda, Siddha Unani Medicines under section  3(a): Ayurveda, Siddha or Unani drugs includes all medicines intended for internal or external use for or in the diagnosis, treatment, mitigation or prevention of disease or disorder in human beings or animals, and manufactured

The need for liberal regulations  9



exclusively in accordance with the formulae described in the authoritative books of Ayurvedic, Siddha and Unani Tibb system of medicine, as specified in the First Schedule; (B)   Patent or Proprietary medicine under section 3(h): (i)  In relation to Ayurvedic, Siddha and Unani Tibb system of medicine of all formulations containing only such ingredients mentioned in the formulae described in the authoritative books of Ayurveda, Siddha or Unani Tibb system of medicines specified in the First Schedule, but does not include a medicine which is administered by parenteral route and also a formulation included in the authoritative books as specified in clause (a); (iv) Aushadh Ghana (Medicinal plant extracts – dry/wet) obtained from plant mentioned in books of First Schedule of the Act include Aqueous or hydroalcoholic extracts.

 or issue of licence to the medicine with respect to Ayurvedic, Siddha II (A)  F and Unani, the conditions relating to safety study and the experience or evidence of effectiveness shall be such as specified. Guidelines for issue of license with respect to Ayurveda, Siddha or Unani drugs (Drugs and Cosmetics Rules 1945. See CCRAS Guidelines): 1 2 3 4 5 6 1 2 3 4 5 6 1 2 3 4

Category: Ayurveda, Siddha and Unani drugs, given in 158. B as referred in 3(a). Ingredients: As per texts. (54 Authoritative books) Indication(s): As per texts. (54 Authoritative books) Requirement of non-clinical Safety data: Not required Published Literature: Required Requirement of non-clinical Efficacy data: Not required Category: Any change in dosage form of Ayurveda Siddha and Unani drugs as described in section 3(a) of the Drugs and Cosmetics Act, 1940. Ingredients: As per text Indication(s): As per texts Requirement of non-clinical Safety data: Not required Published Literature: Required Requirement of non-clinical Efficacy data: Not required Category: Ayurveda, Siddha and Unani drugs referred in 3(a) to be used for new indication. Ingredients: As per text Indication(s): New*. Requirement of non-clinical Safety data: Not required

10  Legacy and logical steps 5 6

Published Literature: If required Requirement of non-clinical Efficacy data: Required

II (B) For issue of license with respect to Patent or Proprietary medicine. The condition relating to Safety studies and experience or evidence of effectiveness shall be specified as follows: 1 2 3 4 5 6

Category: Patent or Proprietary medicine containing crude drugs Ingredients: As per text Indication(s): Textual Rationale Requirement of non-clinical safety data: Not required Published Literature: Of ingredients The requirement of non-clinical efficacy data: Pilot study as per relevant protocol for ASU drugs

For the issue of license with respect to medicine Aushadh Ghana, extract of medicinal plant (dry or wet): Category: Crude drug/Aqueous extract(s)/hydro-alcoholic extracts/ dry/wet Ingredient(s): As per text Indication: Textual Rationale Requirement of non-clinical Safety data: Not Required Published Literature Not Required Requirement of non-clinical Efficacy data: Not Required Category: Aqueous extract dry/wet Ingredient(s): As per text Indication: New indications* Requirement of non-clinical Safety data: Not Required Published Literature: Not Required Requirement of non-clinical Efficacy data: Required Category: Hydro-Alcohol extract dry/wet Ingredient(s): As specified Indication: As per text Requirement of non-clinical Safety data: Not Required Published Literature If Required Requirement of non-clinical Efficacy data: Not Required Category: Hydro-Alcoholic extract dry/wet Ingredient(s): As specified Indication: New indications* Requirement of non-clinical Safety data: Required Published Literature: If Required Requirement of non-clinical Efficacy data: Required

The need for liberal regulations  11 Category: Other than Hydro/Hydro-Alcoholic extracts containing other solvents Ingredient(s): As specified Indication: As specified/claimed Requirement of non-clinical Safety data: Required for oral preparations. Single dose toxicity, Repeated systematic toxicity (long term toxicity studies in rats), Reproductive and Developmental toxicity, Genotoxicity, Carcinogenicity, metal/mineral toxicity (in cases of mineral/metal ingredients). Published Literature: If Required Requirement of non-clinical Efficacy data: Required The standard protocol will also include the concept of Anupan, Prakriti and Tridosha etc. published by Central Research Councils Ayurveda, Siddha, Unani and other Government/Research Bodies. * New indication means which is other than mentioned in 1st schedule books of Drugs and Cosmetics Act 1940.

ADVISORY from AYUSH on April 2, 2019 Subject: Scientific Studies and publication of Research Papers on AYUSH drugs and treatments by non-AYUSH researchers/scientists. Whereas it is reported that research papers and scientific studies on AYUSH (Ayurveda, Yoga, Naturopathy, Unani, Siddha and Homoeopathy systems) drugs and treatments have been published by non-AYUSH scientists/researchers with unfounded statements & conclusions to damage the credibility and sanctity of the whole system and qualified AYUSH experts were not involved/consulted in these studies and research publications. Whereas AYUSH systems are officially recognized an integral part of the country’s healthcare delivery network and are promoted and mainstreamed through various policies, strategies, and schemes of Government of India including the National Health Policy-2017, National Health Mission and National AYUSH Mission. Principles, concepts, and approaches of AYUSH systems and their drug-based interventions are not at all comparable to the prevalent modern medical system. Whereas for scientific development of AYUSH systems, Central Government has inter alia established five Research Councils (viz. Central Council for Research in Ayurvedic Sciences; Central Council for Research in Unani Medicine; Central Council for Research in Sidhha; Central Council for Research in Homoeopathy; and Central Council for Research in Yoga  & Naturopathy), published Good Clinical Practice GCP) guidelines for conduct of clinical trials in Ayurvedic, Sidhha and Unani medicine and implemented Extramural Research Scheme to support projects of scientific exploration of AYUSH, details are available in the Ministry’s website www.ayush.gov.in;

12  Legacy and logical steps Whereas potential and scope of AYUSH in public healthcare cannot be jeopardized and the people may not be distracted or dissuaded from resorting to AYUSH from arbitrary statements and unfounded conclusions in the scientific studies and research publications related to AYUSH; Considering accordingly the need of protecting public image of AYUSH, all non-AYUSH researchers, scientists, institutions and editors of the medical/scientific journals are hereby advised to involve appropriate Expert/Institution/Research Council of AYUSH in conducting any scientific study/clinical trial/research intervention to explore AYUSH drug or treatment and for vetting of the publication of its outcomes and findings to prevent incorrect, arbitrary and ambiguous statements and conclusions about AYUSH. All concerned are urged to take note of the advisory for compliance by the respective researchers/scientists/investigators. F. No. Z.2502310912018-DCC (AYUSH) For comments by Ayurvedic educationists and scientists, see “Each and every step of AYUSH will have far-reaching impact.”

General Guidelines for Clinical Evolution of Ayurvedic Intervention (CCRAS): In Drugs and Cosmetics Rules, 1945, Part XVI, legally there is no need of safety study or proof of effectiveness if an Ayurvedic drug is based on Text or Text ingredients and for treatment identified in the Texts. Water and Hydro-alcoholic extracts are also exempted. CCRAS has issued General Guidelines for Clinical Evolution of Ayurvedic Intervention (Volume III) should be referred to for Patent and Proprietary non-text based drugs or for drugs using other than water and hydro-alcoholic extracts. For researchers, this document is worth going through. Excerpts The fundamental aspects of holistic systems need adequate positioning while designing clinical trials to examine the safety and efficacy of Ayurveda approaches. Furthermore, the other challenges and issues related to quality and safety viz. dosage forms/delivery system, diverse concepts and complex approaches in trial design, diagnosis and therapy, outcomes of clinical efficacy and drug interactions also pose certain limitations in research. A holistic approach may be adopted to validate the therapies and approaches with the integration of principles of Ayurveda and bio-medicine. Such an approach with well-designed research plans could possibly facilitate to generate tangible evidence. The following approach has been suggested by CCRAS:

The need for liberal regulations  13 Evidence Base in Ayurveda: Suggested Approach Disease/Participant Classification

Ayurvedic Principles Prakrti, Dosha, Dushya etc.

Diagnosis based on Modem Methods Therapeutic classification of Drugs

Ayurvedic

Conventional

Stage I: Controlled Clinical Observations

Combined Results Conventional

Analysis based on Ayurvedic principles Stage II

Expanded Therapeutic Use

Mechanism of Action (Traditional: Modern)

General Methodologies and Guidelines of Drug Development (CCRAS): Preparatory phase (1) Prevalence survey and Formulation of drug/combination for Specific targeted indication and activity. (Appropriate basis of literary survey, previous clinical data of ingredients/any other data of claims, classical evidences, etc.) Drug development phases (2) Collection of raw drugs (2). (considering current good agricultural practices good field collection practices and classical textual methods.)

14  Legacy and logical steps Botanical identification/Pharmacogonostic/Chemical studies of ingredients (3). (Based on available guidelines and classical methodology.) Formulation of SOPs and Standardization, stability studies, Quality assurance (4). (Considering the classical methods and current available physical/ chemical, Biological parameters, microbial loads, Heavy metal estimation, pesticide residues, etc. for standardization and safety). Preclinical safety studies (5) (Acute/sub-acute-chronic studies as per intended therapeutic use with Institutional Animal Ethics Committee (IAEC) approval). Animal Studies for biological activity and /or mechanism of action for clinical correlation (6) with IAEC approval. (preparation of preclinical dossier.) Design of study and formulation of Clinical protocols (7). (As per current guidelines and adopting Classical methodology.) Execution of clinical trial (8) Bulk preparation of quality assured Drug for clinical trial, packing labeling etc. as per requirement with approval of Independent Ethics Committee (IEC)/Independent Review Board (IRB) and Clinical Trial Registery-India (CTRI) registration for trial conduct and monitoring of Data analysis. Note: Intellectual Property Rights (IPR) Protection and issues of filing of patent to be addressed at suitable stage.

Phases of clinical trial for ayurvedic drug/patent or proprietary medicines Aim and Objective: To discover or verify the clinical, pharmacological (including pharmacodynamics/pharmacokinetics), and/or adverse effects, safety and/or efficacy. Human pharmacology (Phase I) (i)

The objective of studies in this Phase is the estimation of safety and tolerability with the initial administration of an Ayurvedic Drugs/Patent or Proprietary Medicines into human(s). Studies in the Phase of development usually have non-therapeutic objectives and may be conducted in healthy volunteers or certain types of participants. Ayurvedic drug/Patent or Proprietary toxicity e.g. Ayurvedic drug/Patent or Proprietary Medicines with Schedule E-I ingredients are to be studied in participants. Phase I trials should preferably be carried out with access to the necessary facilities to closely observe and monitor the participants.

The need for liberal regulations  15 (ii)  Studies conducted in Phase I, usually intended to involve one or both of the following objectives: a

b

Maximum tolerated dose: To determine the tolerability of the dose range expected to be needed for later clinical studies and to determine the nature of adverse reactions that can be expected. These studies include both single and multiple dose administration. Early measurement of Drug activity: Preliminary studies of activity or potential therapeutic benefit may be conducted in Phase I as a secondary objective. Such studies are generally performed in later Phases but may be appropriate when the drug activity is readily measurable with a short duration of drug exposure in participants at this early stage.

Therapeutic exploratory trials (Phase II): (i)

The primary objective of Phase II trials is to evaluate the effectiveness of an Ayurvedic Patent or Proprietary Medicines for a particular indication or indications in participants with the condition under study and to determine the common short term side-effects and risks associated with the drug. Studies in Phase II should be conducted in a group of participants who are selected by relatively narrow criteria leading to a relatively homogeneous population. These studies should be closely monitored. An important goal for this Phase is to determine the dose(s) and regimen for Phase III trials.     Doses used in Phase II are usually (but not always) less than the highest doses used in Phase I. These studies should be intended to provide an adequate basis for marketing approval for Ayurvedic drug/Patent or Proprietary Medicines. (ii) Additional objectives of Phase II studies can include evaluation of potential study endpoints, therapeutic regimens (including concomitant medications) and target populations (e.g. mild versus severe disease) for further studies in Phase II or III. (iii)  These objectives may be served by exploratory analyses, examining subsets of data and by including multiple endpoints in trials. Therapeutic confirmatory trials (Phase III) (i)

Phase III studies have primary objective of demonstration or confirmation of therapeutic benefits(s). Studies in Phase III are designed to confirm the preliminary evidence accumulated in Phase II that a drug is safe and effective for use in the intended indication and recipient population. Studies in Phase III may also further explore the dose-response relationships (relationships among dose, and clinical response), use of the drug in wider populations in different stages of disease, or the safety and efficacy of the drug in combination with other drug(s).

16  Legacy and logical steps (ii)

For Ayurvedic drug/Patent or Proprietary Medicines intended to be administered for long periods, trials involving extended exposure to the drug are ordinarily conducted in Phase III, although they may be initiated in Phase II. These studies carried out in Phase III complete the information needed to support adequate instructions for use of the drug (prescribing information). (iii)  For Ayurvedic drug/Patent or Proprietary Medicines approved outside India, Phase III studies need to be carried out primarily to generate evidence of efficacy and safety of the Ayurvedic drug/Patent or Proprietary Medicines in Indian participants when used as recommended in the prescribing information. Prior to conduct of Phase III studies in Indian participants. (iv) If the application is for the conduct of clinical trials as a part of multinational clinical development of the drug, the number of sites and participants as well as the justification for undertaking such trials in India should be provided to the Licensing Authority along with the application.

Post marketing trials (Phase IV) Post Marketing trials are studies (other than routine surveillance) performed after drug approval and related to the approved indication(s). These trials go beyond the prior demonstration of the drug’s safety, efficacy and dose definition. These trials may not be considered necessary at the time of new drug approval of Ayurvedic drug/Patent or Proprietary Medicines but may be required by the Licensing Authority for optimizing the drug’s use. They may be of any type but should have valid scientific objectives. Phase IV trials include additional drug-drug interaction(s), dose-response or safety studies and trials designed to support use under the approved indication(s), e.g. mortality/morbidity studies, epidemiological studies etc.

NOTE • • •

For classical Ayurvedic drugs with the same textual indications, directly phase III/IV trial may be conducted. For classical Ayurvedic drug with new indications/Patent or Proprietary Medicines, directly phase II trial may be conducted. Patent or Proprietary Medicines with Schedule E-I ingredients, Phase I trials may be conducted as appropriate.

There are mainly two types of clinical studies: Observational and Experimental. Observational study An observational study is one which tries to explore the cause-and-effect relationships. Like experimental study the investigators are not able to control the

The need for liberal regulations  17 participants by allocating in groups or assigning any particular treatment. The Investigators only observe the participants involved and their responses by asking questions, or taking some measurements, or looking at clinical records. A sample survey is an example of an observational study. Followings are observational studies: Case series studies: Case-series is a descriptive study design wherein a series of cases of any particular disease that one might observe in one’s clinical practice, hospital and so on is presented. There is no control group in this type of study. In terms of evidence, this is a weak study design but it can help provide leads in designing research studies. Case reports: Documentation of reports on a single participant constitutes case reports. They do not use control groups and hence do not have high statistical validity or cannot provide conclusion about the causality but can provide leads to the formulation of a hypothesis for potentially high impact research studies. Case control studies: When a correlation is drawn between factors or exposures as causal in participants who have a specific health condition. These studies are retrospective when the history and reports of the participant are analyzed and a correlation is drawn if they might have been causal. This is compared with the history and reports of participants who do not have the health condition. This level of evidence in such studies is low when compared to randomized controlled trials or cohort studies because just a statistical association do not necessarily conclude cause and effect relationship. For example, tobacco and cancer. Cohort studies: A ‘cohort’ meaning is a population who are exposed to similar environmental conditions. This is a kind of observational study where one group of a cohort with exposure to a particular causative agent or a treatment is compared with a similar group who are not exposed. They are followed up prospectively. The level of evidence here is lower when compared to randomized controlled trials. For example, tobacco use among working and none working adolescents. Cross sectional studies: A cross sectional study is an observational study that aims at determining the exposure and prevalence of disease at the same point in time in a given population for e.g., prevalence of post traumatic stress disorders in people after Tsunami. It can also be used in determining the sensitivity and specificity of new diagnostic tests. Experimental study In a clinical trial, participants receive specific interventions according to the research plan or protocol created by the Investigators. These interventions may be medical products, such as drugs or devices; procedures; or changes to participants’ behavior, such as diet. Clinical trials may compare a new medical approach to a standard one that is already available, to a placebo that contains no active ingredients, or to no intervention. Some clinical trials compare interventions that

18  Legacy and logical steps are already available to each other. When a new product or approach is being studied, it is not usually known whether it will be helpful, harmful, or no different than available alternatives (including no intervention). The investigators try to determine the safety and efficacy of the intervention by measuring certain outcomes in the participants. The scientific integrity of the trial and the credibility of the data from the trial depend substantially on the trial design. Single arm trials: Single arm trial is the simplest trial design. A sample of participants with a particular disease is administered an intervention and the effect is measured after a decided period of time to observe the response. This design is adopted where placebo effect is minimal or there is no scope for incorporating or it is unethical to include a placebo arm. The level of evidence is low in this design usually. However, it is apt for validation o f Panchakarma procedures, application of leech, Agnikarma, Ksharasutra, etc. Cross over trials: In a cross over design, the objective is to compare the effect of therapies. The trial participant is randomly allocated to one treatment protocol for a period of time and then later after a wash out period, the same participant is randomly allocated to another treatment protocol and the effects of treatments are compared. Factorial Trials: Factorial designs are considered when the objective of the study is to compare effects of a minimum of two treatment protocols either alone or in combination. For example, if there are two interventions A and B then group-1 is given intervention A, group-2 is given B, group-3 is administered both A and B and group-4 is given neither. Factorial designs are considered when the effects o f more than two interventions are to be evaluated. Non inferiority trials (Active Controlled trials): This type of trial design consists of testing the effect of a particular treatment in comparison with an available standard treatment. Non inferiority trials are designed to effectively evaluate the effect of a particular intervention where incorporation of a placebo group is unethical. Parallel design: Placebo controlled trials: A placebo is an agent that produces an effect on the disease through a psychological mechanism i.e., through a non specific effect which does not comply with a definable, physiological mechanism. Therefore, placebo effect needs to be nullified to prove that drug /therapy /formulation intended to produce an effect on the disease occurs genuinely through a definable bio – physiological mechanism. Placebo controlled design with randomization and blinding produces highest evidence. They require large sample sizes. Three arms trial: Placebo and active control: This design involves inclusion of a placebo as well as an active control group and provides good internal evidence of sensitivity. Add on Study: An add on study is a placebo-controlled trial wherein a new agent is concomitantly administered in participants in addition to receiving a standard treatment. These kind of studies are useful when the existing treatment is not fully effective and there is evidence that another treatment,

The need for liberal regulations  19 in addition, can bring about better outcomes and if there are no adverse drug reactions or interactions. Three arms trial: Placebo and active control: This design involves inclusion of a placebo as well as an active control group and provides good internal evidence of sensitivity. Add on Study: An add on study is a placebo-controlled trial wherein a new agent is concomitantly administered in participants in addition to receiving a standard treatment. These kind of studies are useful when the existing treatment is not fully effective and there is evidence that another treatment in addition can bring about better outcomes and if there are no adverse drug reactions or interactions. Replacement study: In this design a new drug or placebo is randomly added to the conventional treatment and the conventional treatment is then slowly withdrawn usually by tapering. This design can effectively evaluate the ability of the participant to maintain the baseline status after withdrawal of the conventional treatment. Early escape rescue treatment: If in a trial, administration of a treatment protocol is either ineffective or if it results in worsening of the disease and who otherwise would require a rescue treatment like in seizures or angina then the trial treatment is withdrawn. Here the need to change the treatment becomes the study end point. This design evaluates short term effectiveness of a treatment protocol. Limited placebo period: In situations where it is not possible to continue the participants for long duration of placebo administration the placebo group is maintained for a short duration and then the trial would go on with an active control group without the placebo group. This design evaluates short term effectiveness of a treatment protocol. Additional doses design: This design involves randomizing participants into parallel groups of different fixed doses of a certain treatment protocol. This design evaluates dose based response. Randomized withdrawal: In this design participants getting a test treatment for a particular period of time are randomly assigned to continued test treatment and placebo. Difference between those receiving continued treatment and those on placebo reveals the effect of active treatment and evaluates the status of remission or aggravation of a particular disease and long term efficacy. No-treatment concurrent control: No treatment concurrent control design involves randomization of participants into test treatment and no treatment. This design can be used when it is not possible to use double blinding. External control (including historical control): This is a comparative trial where participants receiving an active treatment is compared with a control from another study at another setting at the same point of time (External control) or if it is taken from a study conducted at an earlier point of time (historical control) it is known as external control.

20  Legacy and logical steps Designs amenable to test ayurvedic therapies Black-box design Generally, Ayurvedic treatments are not just isolated administration of a therapeutic molecule or a single drug but, are a combination of drugs/procedures that constitute a therapy for a particular health condition for a particular individual. Therefore, a traditional treatment that may consist of a set of therapeutic procedures should be considered as one single module which is studied in comparison with either placebo or a standard treatment. This allows the Ayurvedic treatments to be determined within its theoretical framework and not compromising with the fundamental principles of traditional medicine. Reverse Pharmacology (RP) design In the realm of traditional medicines, many herb based medicinal formulations have known to have healing effects on many health conditions but such results have not been pursued rigorously through research studies to know the effect of such medications in various complex biological systems. Therefore the concept of Reverse Pharmacology (RP) helps in addressing the issue where the effect of the Ayurvedic formulation on a health condition is known but the mechanism of action is not known. In this approach, the drug candidate travels a reverse path from ‘clinics to laboratory’ rather than classical ‘laboratory to clinics. This concept has three phases as follows: RP-Phase I: This involves an experiential phase where comprehensive documentation of clinical observations of the effect of standardized Ayurvedic drug on the biological systems is done. RP-Phase II: The purpose of this phase is to evaluate the target activity of the Ayurvedic formulation/drug/Therapy under in-vitro and in-vivo models and exploratory studies for tolerability, drug-interactions and dose-range. RP-Phase III: The purpose of this phase is to carry out basic and clinical studies at several levels of biological organization and to identify and correlates of drug safety and efficacy. Studies in this phase should be able to decipher mechanisms of action at multiple biological systems and to optimize safety, efficacy and acceptability of the leads in natural products based on relevant science. Placebo controlled trials The use of a placebo generates evidence of better quality. Placebo controlled trials are intended to establish the medicinal value of many Ayurvedic single plant drugs which are preferred globally (added by the Author). It allows Investigators to distinguish specific from non-specific effects of treatment in order to determine

The need for liberal regulations  21 whether the additional cost, risk and effort of a specific treatment are worthwhile. It is also important for understanding the mechanism of a treatment. This is true for the evaluation of all drugs. It is not only of academic interest, but is also practical value, especially for developing new treatments from traditional ones. However, in some cases, where disease-based whole phytocomplex treatment is not preferred, placebo controlled trials may not be possible. The principles of Ayurveda follow the system biology approach where the response to a therapy is evaluated in terms of the body as a whole and not confined individual system. Most of the drugs are also polyformulations consisting of ingredients from plant, mineral and animal origins and not an active molecule as in case of the modem system of medicine. It is very difficult to have the trial drug and placebo prepared in a way that they are similar in colour, taste, size, weight, same smell and same consistency. Therapy in Ayurvedic system of medicine also involves procedural interventions like Panchakarma in Ayurveda and so on for which designing placebo becomes impossible. In such cases, appropriate control groups can be incorporated like active controls or no interventions etc. Different controls can be used in clinical trials to answer different questions. The use of a placebo, when possible, is desirable, because it generates evidence of better quality. Placebo controlled trials are intended to establish whether treatment is valuable over and above what might be achieved by a control treatment, and not whether treatment is valuable at all. Thus, it allows Investigators to distinguish specific from non-specific effects of treatment in order to determine whether the additional cost, risk and effort of a specific treatment are worthwhile. It is also important for understanding the mechanism of a treatment. This is true for the evaluation of all drugs. It is not only of academic interest, but is also of practical value, especially for developing new treatments from traditional ones. However, in some cases, placebo controlled trials may not be possible. Data-based studies Systematic reviews: These are studies based on already published studies. A certain review criteria is decided and with a sound methodology, the results of the published studies are scrutinized and summarized for e.g., Effect of herbal medicines with significant effect on Hamilton depression rating scale in participants suffering from depression. Meta analysis These studies are also based on already published studies. The study compiles and examines the results of number of valid studies on a particular topic and consolidated results are presented. For example Meta-analysis of RCTs on the anxiolytic effect of Ashwagandha. Data based studies on Ayurvedic drugs can provide much needed evidence to recommend use of Ayurvedic interventions among scientific community.

22  Legacy and logical steps Conventionally, the level of evidence is ranked in order of risk of bias and from top to bottom ranked as Meta-analyses, Systematic reviews, Interventional studies, Observational studies and experts’ opinions. (See Annexure III – Level of evidence.) However, due to classical textual evidence, long history of use and vast clinical experience, this hierarchical ranking of level of evidence may not be completely apt for Ayurveda and its approaches. Randomization Randomization is used to develop comparable groups to assess therapeutic interventions. It is essential to control various known, and even unknown, biases. Nevertheless, there are many situations where randomization can be impossible or unethical. The best way to solve this problem is probably by the proper selection of control treatments. Randomization method and procedure (wherever applicable) Simple random samples: This is a procedure where each individual of a population has equal probability of being selected. A  simple random sample is representative of a population and gives external validity. The results obtained have good generalize ability of results. Random number generators are available online. It can also be generated using excel sheet. Random allocation: Random allocation is a procedure of randomly allocating an identified sample to different groups. Each participant has the same probability of being assigned to a particular group. Block randomization: This randomization procedure helps in achieving same sample size in two or more groups. Block randomization is done by generating random permuted blocks (blocking). For e.g., in a block size of six consecutively enrolled participants three can be allocated to one treatment group and three to another. The ratio of allocation can also change. This method helps in interim analysis. Stratified randomization To avoid imbalances among baseline characteristics, pre-randomization stratification is done based on requirement like age, gender, prognostic factors etc. Methods of blinding Blinding is a process of ensuring that the people involved in a research study (participants or investigators) do not know about what treatment they are receiving. This procedure is incorporated to minimize the biases that arise due to differences in treatment, management, investigator who is carrying out the study, rather who assesses the participants or one who interprets the results. These biases

The need for liberal regulations  23 arise because participants who know about the active treatment might report more favorable outcomes. The Raters or Investigators who know about the treatment may over enthusiastically rate the response to a treatment or they might undermine the response to placebo or no treatment. Knowledge of treatment might influence the people to use favorable statistical tests. Open: The participants, investigators, and data analyst know about what treatment they are receiving. Single blind: Here either the participant or investigator does not know about the treatment. Double blind: Here neither the participant nor the investigator knows about the treatment. Triple blind: This is a blinding procedure in which the participant, the investigator and the data analyst does not know about the treatment. Randomization codes and procedures for breaking the code Breaking the codes/un-blinding in case of emergency Randomization codes are computer generated. Requirement for unblinding arises out of an emergency. The Investigator gets the primary information about the emergency and therefore he should have a developed mechanism for breaking the codes. The investigator should access to sealed envelopes 24 hours a day. He can also delegate a suitable person to carry out the code break. The sponsor should be notified about the code break within 24 hours. In a non emergency situation the code-break cannot be done without the approval of the sponsor. Breaking the codes/un-blinding at the end of the trial Breaking the codes/un-blinding is done by a formal request to the Sponsor and head of the Institute but should not be done until the following events have been completed: • •

Completion of last follow up of the participant All data has been entered and validated and there is no scope for further changes.

It is better that the statistician is also blinded until the analysis is complete. Information on establishment of study code, where it will be kept and when, how, and by whom it can be broken in the event of an emergency. Allocation concealment Allocation concealment is a procedure that ensures that either participants or investigators do not know what is being received by the participant. Ideally, the

24  Legacy and logical steps procedure is done as follows: The trial drug and placebo are prepared in a way that they are similar in colour, taste, size, weight and smell. In double blind study a random sequence of codes is generated centrally and assigned to the prospective participants. Sequentially numbered sealed opaque coded envelopes with aluminium foils to prevent revealing against bright light are assigned to each trial participant with details of the treatment inside. After obtaining the consent, the random code is assigned to the participant. The envelopes are generally stored in the pharmacy and the pharmacist gives the containing drug or placebo to the participant. In single blind studies where the investigator knows about what the participant is going to receive, the centrally generated random sequence of numbers is assigned to the prospective participants in terms of who is going to receive drug or placebo. The sequentially numbered sealed envelopes are coded for drug or placebo. The codes should not be in such a way that if the un-blinding is done for one participant in case of emergency then, it should not reveal the codes for all the participants. For example, if ‘0’ is used to code placebo and ‘1’ to drug, then if an emergency situation necessitates, un-blinding the information about all the participants is automatically revealed. The codes could be generated and kept by the sponsor/central funding agency and will be broken by them in case of emergency. Blind assessment Blind assessment is a critical component of conventional evaluation of therapeutic interventions. However, in the evaluation of efficacy of procedure-based therapies (such as Panchakarma therapy, Ksharasutra, Agnikarma, Jalauka therapy, etc) and Multidrug regime it may be difficult, impractical or impossible for the Investigator to be kept ignorant of what treatment the participants are receiving. Treatment blinding in the evaluation of Ayurvedic medicines should adopt the approach of conventional medicines, e.g. using active and control formulations with similar appearance, taste and weight. However, if the Ayurvedic medicine cannot be administered in a predetermined standardized formulation, it will be impossible to keep the treatment blinded.

Summary (Ayurvedic) Drug includes all medicines intended for internal or external use for or in the diagnosis, treatment, mitigation or prevention of disease or disorder in human beings or animals, and manufactured exclusively in accordance with the formulae described in, the authoritative (54) books specified in the First Schedule of The Drugs and Cosmetics Act, 1940. Patent or proprietary Ayurvedic medicine means: (1) All formulations containing only such ingredients mentioned in the formulae described in the

The need for liberal regulations 25 authoritative books of Ayurveda (2) In relation to any other systems of medicine, a drug which is not included in the edition of the Indian Pharmacopoeia for the time being or any other Pharmacopoeia authorized in this behalf by the Central Government, after consultation with the Drugs Technical Advisory Board. All non-AYUSH researchers, scientists, institutions and editors of the medical/scientific journals are advised to involve appropriate Expert/Institution/ Research Council of AYUSH in conducting any scientific study/clinical trial/ research intervention to explore AYUSH drug or treatment and for vetting of the publication of its outcomes and findings to prevent incorrect, arbitrary and ambiguous statements and conclusions about AYUSH. (ADVISORY from AYUSH on April 2, 2019.)

Final report of the AYUSH task force (Submitted to Ministry of AYUSH, Government of India, on 12 October 2015.) Salient features A few decades from now, single knowledge system based medical hospitals, clinics and even medical colleges, will become relics and even AYUSH systems will not be any exception. The best way ahead seems to be for AYUSH systems and modern medicine to collaborate on sound footing of the scientific evidence base, in the best interest of public health. 5.3 Recommendations 5.3.4 The definition of Drug of AYUSH origin is very strict and only classical formulation can be considered as drug in regulation. It should be amended in a way so that it can include new drugs and formulations of natural origin either from classics, ethnobotany origin or from the research outcomes. 5.3.5 The regulations should be upgraded to align with international standards wherever they exist like GMP and contaminants in a time bound fashion giving reasonable time to the industry to upgrade itself. Tax incentive for such upgraded industry should be offered. 5.3.10 The public lab infrastructure is in a dismal state and there is a need to think of Public-Private Partnership (PPP) model for their operation. Also rather than creating labs in government sector except for well managed referral labs, more and more labs in non-governmental and private sectors should be notified. 5.3.11 There is a need for up gradation of public labs by prescribing National Accreditation Board for Testing and Calibration Laboratories (NABL) accreditation as a requirement to upgrade our regulatory framework to international standards. Only accredited labs should be used under the D&C Act – this can be done right away.

26  Legacy and logical steps 5.3.15 The AYUSH industry needs high quality medical plants and therefore, the Medicinal plant certification scheme of National Medicinal Plants Board in collaboration with Quality Council of India (NMPB-QCI) needs to be promoted. 5.3.16 The cultivation of medicinal plants by AYUSH manufacturers based on Good Agricultural Practice (GAP) should be incentivized. 1.2  Goals underlying the recommendations 1 2 3 6

To establish safety and efficacy of AYUSH treatments for diseases of national and global importance using internationally accepted research methods and designs. To promote collaborative clinical and basic research that has the potential to transform healthcare, involving reputed AYUSH and modern medical institutional partners in India and abroad. To develop patents, novel products, services and biological concepts including tissue engineering and nano engineering medical products that have the potential to impact global health. To support high quality publications as well as peer-reviewed, indexed, high impact journals.

1.3.1. Recognize selected existing reputed autonomous health science institutions from public or private sectors, engaged in basic/applied research, clinical practice and community outreach with a track record of minimum 15  years of innovative work and possess the legal status of universities or centers of excellence and upgrade them into institutes of national importance. Such institutions whether in public or private sector should have autonomy to engage in innovative research and education. These institutes will also be expected to publish high quality publications as well as, peer-reviewed, indexed, high impact journals. 1.3.2. Support large scale multi-centric clinical research involving reputed AYUSH and modern medical colleges, universities, hospitals and research institutions both in the public or private sector. These studies should be undertaken mainly public or private sector conforming to globally accepted guidelines and suitable reporting standards, such as Consolidated Standards of Reporting Trials (CONSORT), Strengthening and Reporting of Observational Studies in Epidemiology (STROBE), Animal Research Reporting of in vivo Experiments (ARRIVE) etc. based on both International classification of diseases (ICD) and AYUSH classification system with novel and epistemologically sensitive methods and designs. 5.1.1 Industry The AYUSH industry is currently regulated under the Drugs and Cosmetics Act that also regulates the modern medicine industry. It is observed that the regulator is focused more on modern medicine than on AYUSH regulation. Consequently,

The need for liberal regulations  27 the AYUSH industry regulation gets neglected with many states not even having suitably qualified manpower for AYUSH regulation and hence on the ground the consumer does not get access to quality products as intended under the regulation. Further, there is poor inflow of samples to AYUSH labs for testing quality and the labs set up by investing considerable funds by the Ministry of AYUSH, function poorly. While international standards for GMP have been prescribed by WHO for herbal medicines, the AYUSH regulation is still short of international standards like GMP as per Schedule T and therefore AYUSH products are not globally competitive. 5.3.2 Services 1. The regulations should be based on international standards, if available, and to this end, all existing regulations should be reviewed and upgraded to such standards in a time bound manner keeping in view the relevant industry’s preparedness. Editor’s Note: The Holistic concept of Ayurveda was unique 5000 years back. It was based on Vata-Pitta-Kapha-prakriti-linked imbalance in the body. Now, Ayurvedic medicines are to be produced for millions whose prakriti is not known. Holistic medicine is an individually-tailored medicine. That is the reason its formulations contain many herbs added on the basis of a number of Ganas and Vargas which may not be required in a disease-based herbal medicinal system. For further development of Ayurveda as a disease-based system, we will be suggesting a number of steps for which regulatory liberalization will be needed. In India, the national policy on traditional and alternative medicine was introduced in 1940 in the form of Drug and Cosmetic Act 1940 and Drug and Cosmetic Rule, which was updated in several instate. In 1959, Govt of India recognized traditional Indian System of Medicine (ISM) and updated Drug and Cosmetic Act. Several expert committees for different ISM were established from time to time and the earliest was established in 1962. In the year 1969, separate chapter related to Ayurveda, Siddha and Unani drugs was inserted by act 13 of 1964 in the Act, which partly similar to those for conventional pharmaceuticals. Later the act was modified again with some substitutions in the year 1983, 1987, 1994 and 2002. In 2006 and 2008 guideline for evaluation and analysis of drugs under ISM was given under Drug and Cosmetic Rule 1945. The Central Council of Indian Medicine (CCIM) is constituted in the year 1970, which involved in the framing and implementing different regulations including the curricula and syllabii in ISM (i.e., Ayurveda, Siddha and Unani). In 2012, Sowa Rigpa system of medicine is incorporated in the CCIM. Department of Indian Medicine and Homeopathy (ISM & H) was formed with the objective to develop the ISM. In 2003, this Department was renamed as Department of Ayurveda, Yoga and Naturopathy, Unani, Siddha and Homoeopathy (AYUSH), and in 2014 separate ministry on AYUSH was formed.

28  Legacy and logical steps

References 1 Government of India, Ministry of Health and Family Welfare (Department of Health), The Drugs and Cosmetics Act and Rules. The Drugs and Cosmetics Act, 1940 (23 of 1940) (As amended up to the 31st December, 2016) and The Drugs and Cosmetics Rules, 1945 (As amended up to the 31st December, 2016). 2 General Guidelines for Drug Development of Ayurvedic Formulations Volume 1. Published by Central Council for Research in Ayurvedic Sciences (CCRAS). 3 General Guidelines for Safety/Toxicity Evaluation of Ayurvedic Formulations, Volume II. Published by CCRAS. 4 General Guidelines for Clinical Evaluation of Ayurvedic Interventions Volume III. Published by CCRAS.

Some portions in the text have been highlighted by the Editor for emphasis.

2 Each and every step of AYUSH will have a far-reaching impact

Opinion of Ayurveda educationists A recent advisory (F. No. Z.25023–10912018-DCC (AYUSH) dated 2 April 2019) issued by the Ministry of Ayurveda, Yoga and Naturopathy, Unani, Siddha and Homoeopathy (AYUSH), Government of India, expresses concerns regarding the publication of research papers and scientific studies on AYUSH drugs and treatments “by non-AYUSH scientists/researchers with unfounded statements and conclusions to damage the credibility and sanctity of the whole system” because “qualified AYUSH experts were not involved/consulted in these studies and research publications.” This advisory further states that potential and scope of AYUSH in public healthcare cannot be jeopardized and the people may not be distracted or dissuaded from resorting to AYUSH from arbitrary statements and unfounded conclusions in the scientific studies and research publications related to AYUSH. The advisory therefore states that all non-AYUSH researchers, scientists, institutions and editors of the medical/scientific journals are hereby advised to involve appropriate Expert/ Institution/Research Council of AYUSH in conducting any scientific study/ clinical trial/research intervention to explore AYUSH drug or treatment and for vetting of the publication of its outcomes and findings to prevent incorrect, arbitrary and ambiguous statements and conclusions about AYUSH. Such steps would not only curb the much-needed unbiased research in these traditional medicine systems but also limit the freedom to think, both of which are fundamental requirements for improving our understanding in any discipline. We believe that actual disrepute to the traditional Indian healthcare systems, including Ayurveda, is caused by the mushrooming of low-quality journals that publish poor-quality research, often by AYUSH “experts” themselves. The low-quality research derives from the unsubstantiated data being included in postgraduate/ PhD theses in the numerous colleges and universities that have mushroomed. It

30  Legacy and logical steps is also a known fact that many of these AYUSH colleges retain their recognition through “ghost” patients, teachers and even students. Obviously, the pseudoresearch conducted at these institutions not only brings a bad name to AYUSH but also generates a workforce that can only do more damage to the system. The lowquality medicines being marketed by spurious pharmacies also bring disrepute to AYUSH. The ministry should be more concerned with these rather than placing a gag on studies and voices that report research findings that may not fully agree with the traditionally held views. It is possible that there are non-AYUSH researchers who also generate and publish poor research output. However, just as there are good and quality-conscious AYUSH researchers, there are non-AYUSH researchers who have contributed and continue to do so positively and significantly to the understanding of the principles and mechanisms of actions of these treatment modalities. For example, the pioneering and extensive contributions of a few organic chemists to the chemistry of herbal products, widely used in Ayurveda, are well known. Likewise, many basic science studies on modes of actions of a large variety of herbal and Ayurvedic preparations unraveled their biological mechanisms and opened new and effective therapeutic applications. Many such studies have also unraveled positive and negative interactions between herbal and modern medicines. Several genomic and molecular biologists have produced significant medicines. Several genomic and molecular biologists have discovered significant concepts of Ayurveda in terms of contemporary biology. These are but a few examples of significant contributions by primarily non-AYUSH researchers that have truly enriched the field. An unopposed faith in ancient knowledge and practices on account of their being traditional, without revalidation in the contemporary context, is indeed ominous. The AYUSH practices and formulations need to be substantiated by evidence-based understanding. Studies undertaken by AYUSH or non-AYUSH researchers that question a traditionally held belief and bring systematic evidences challenging its rationality, need to be taken seriously rather than being considered as a distraction or “insult” to the ancient wisdom. Intellect and social order move forward only with knowledge and understanding that go beyond what our predecessors knew. Actually, we need to foster more unbiased multidisciplinary research rather than making it a close-door system consisting only of allies. Asking the journal editors to ensure the inclusion of AYUSH experts as authors in a research paper is not only against the autonomy of a researcher but is also pejorative to the reputation of “science publishing.” – S. C. Lakhotia SERB Distinguished Fellow, Department of Zoology, Banaras Hindu University; Kishor Patwardhan, Professor in Kriya Sharir Banaras Hindu University and Sanjeev Rastogi, Professor (Associate), State Ayurvedic College, Lucknow. (Current Science, May 2019.)

Far-reaching impact of AYUSH  31

Comments by eminent scientists No democratic nation can regiment free research by academia. The image has to be built and not protected or projected! This advisory can have no legal validity. The quality of research has to be built with training, apprenticeship, expertise in R&D methods and proper peer review of research papers. But I do agree that AYUSH experts/researchers can be part of many investigations for drawing on their rich clinical experience and knowledge of AYUSH systems. Who decides the expertise/Institution/Research Council of AYUSH, with a proven track record and training in scientific exploration in AYUSH drug or treatment? How would the Ministry of AYUSH control drug research in other countries or pharmaceutical/nutraceutical R&D industry abroad or in India? Many of the medicinal plants used in Ayurveda are also indigenous to TCM, South Asian Medicine, African healers, etc. How can that be controlled? As per the advisory, my teacher late Dr. Rustom Jal Vakil should not have worked on Sarpagandha, that led to a revolution in therapeutics.” – Ashok D. B. Vaidya MD, PhD, FAIM Former Regional Medical Director (South Asia) Ciba-Geigy (Now Novartis); Research Director, Kasturba Health Society-Medical Research Centre; Adjunct Professor, Saurashtra University, Rajkot; Drexel University, Philadelphia; Transdisciplinary University, Bengaluru AYUSH should answer the following questions: I. Rationale for issuing such an Advisory? II. Is it evidence based? III. How to define qualified AYUSH experts? IV. Will such advisory not restrict the research in Ayurveda in modern laboratories? V. Is the research data generated in AYUSH established laboratories compatible with global standards? VI. Has AYUSH published their own journal having impact factor or global standard in spite of large funding? VII. Does AYUSH have a list of Ayurveda postgraduates/doctorate working in modern laboratories of our own country/abroad? VIII. Have AYUSH harmonized protocols/regulations? It may not be out context to mention that even today, AYUSH do not have their own Indexed journal with impact factor till date. Why young Ayurveda graduates/postgraduates perform extraordinary well at National labs ICMR/ CSIR/DBT many public/private organizations except Ayush supported labs? Most of these experienced students leave AYUSH and India, as AYUSH does not have a special scheme to absorb/tap this talent on suitable positions, nor efforts are being made in this direction. This may be analyzed critically. We endorse the views of Dr. Ashok Vaidya that the “quality of research has to be built with training, apprenticeship, expertise in R&D methods, providing state-of-art infrastructure and proper peer review of research papers” to

32  Legacy and logical steps popularise the pride of Ayurveda. It is vice versa and AYUSH-Advisory is detrimental for the department itself. – Dr. B. Dinesh Kumar, FNAMS, FAPASc, FTASc, FIPS Coordinator, Centre for Advanced Research for Pre-clinical Toxicology (PCT); President, Indian Pharmacological Society (IPS); Secretary, Nutrition Society of India (NSI); National Institute of Nutrition (NIN) Indian Council of Medical Research It is explicitly calling for censorship, albeit (one that is) voluntary for now. It is essentially an instruction to the public-sector funding agencies to ensure compliance. This is a classic ploy we have seen repeatedly used in the past few years. – Satyajit Rath Medical Immunologist and teacher Indian Institute of Science Education and Research, Pune Any attempt to discourage research in AYUSH by non-AYUSH streams would have disastrous consequences to the already struggling system facing allegations of lack of scientific evidence. In my opinion, the advisory is hyper protective knee jerk reaction by the Ministry. AYUSH had earlier signed agreements with scientific organizations like Department of Biotechnology and the Council of Scientific and Industrial Research to promote and conduct research. The same AYUSH issuing such advisories displays lack of vision and direction. – Dr. Chandra Kant Katiyar CEO (Technical) Healthcare, (Zandu) Emami Ltd, Kolkata Opinions expressed in the media indicate that scientists are worried that the advisory is intended to suppress results that might be unfavorable to AYUSH. Several researchers had in the past highlighted that even agencies meant to frame regulations for AYUSH had promoted remedies without adequate scientific evidence. Government laboratories too have released traditional remedies without adequate evidence of their health claims. Two laboratories under the Council of Scientific and Industrial Research (CSIR), about five years ago, had introduced two herbal medications for the treatment of diabetes. It was pointed out that there were no records of clinical trials on either of the two products.

3 To move with the times Expand the knowledge base of Ayurveda

Ayurveda’s future development should not be confined to the texts of 54 Authoritative books approved by AYUSH. This might preclude all new discoveries and research. As a nation, we have a responsibility to further our traditional knowledge and improve and keep it updated and valid. By relying on 54 classical books which have historical references without any means of subjecting these writings to scrutiny, we have arrested the development of Ayurveda and consigned the science to history. Current regulations of AYUSH are guided by 54 books that form the legal knowledge base of Ayurveda, on the basis of which formularies and pharmacopoeias of Ayurveda have been/are being developed. The list of authoritative books of Ayurveda is given in the first schedule of The Drugs and Cosmetics Act, 1940, amended on 1.2.1983, 31.8.1994 and 15.4.2010 (54 A, B, C, D). Following is the legal knowledge base of Ayurveda:   1   2   3   4   5   6   7   8   9 10 11 12 13 14 15 16 17 18 19

Arogya Kalpadruma. Arka Prakasha. Arya Bhishak. Ashtanga Haridaya. Ashtanga Samgraha. Ayurveda Kalpadruma. Ayurveda Prakasha. Ayurveda Samgraha. Bhaishajya Ratnavali. Bharat Bhaishajya Ratnakara. Bhava Prakasha. Brihat Nighantu Ratnakara. Charaka Samhita. Chakra Datta. Gada Nigraha. Kupi Pakva Rasayana. Nighantu Ratnakara. Rasa Chandanshu. Rasa Raja Sundara.

34  Legacy and logical steps 20 Rasaratna Samuchaya. 21 2Rasatantra Sara Va Siddha Prayoga Samgraha, Part I; 21 (a)3 Rastantra Sar Va Siddha Prayog Samgraha, Part II (Edition 2006). 22 Rasa Tarangini. 23 Rasa Yoga Sagara. 24 Rasa Yoga Ratnakara. 25 Rasa Yoga Samgraha. 26 Rasendra Sara Samgraha. 27 Rasa Pradipika. 28 Sahasrayoga. 29 Sarvaroga Chikitsa Ratnam. 30 Sarvayoga Chikitsa Ratnam. 31 Sharangadhara Samhita. 32 Siddha Bhaishajya Manimala. 33 Siddha Yoga Samgraha. 34 Sushruta Samhita. 35 Vaidya Chintamani. 36 Vaidyaka Shabda Sindhu. 37 Vaidyaka Chikitsa Sara. 38 Vaidya Jiwan. 39 Basava Rajeeyam. 40 Yoga Ratnakara. 41 Yoga Tarangini. 42 Yoga Chintamani. 43 Kashyapa Samhita. 44 Bhela Samhita. 45 Vishwanathachikitsa. 46 Vrindachikitsa. 47 Ayurvedachintamani. 48 Abhinavachintamani. 49 Ayurveda-ratnakara. 50 Yogaratnasangraha. 51 Rasamrita. 52 Dravyaguna nighantu. 53 Rasamanjari. 54 Bangasena. 154A. 2Ayurvedic Formulary of India and its parts. 54B. Ayurveda Sara Samgraha. 354C. Ayurvedic Pharmacopoeia of India. 454D. Ayurvedic Pharmacopoeia of India and its Parts. (128–8–1987; 215–4–2010; 3 11–6–2002; 415–4–2010.) 212 31–8–1994. 213 15–4–2010. 212 31–8–1994. 213 15–4–2010. 1 2 3 4

Inserted by GSR 735 (E), dt 28–8–1987. Substituted for “Ayurvedic Formulary of India” vide GSR 337(E), dt. 15–4–2010. Inserted vide GSR 423(E), dt. 11–6–2002. Inserted vide GSR 337(E), dt. 15–4–2010.

To move with the times  35 The period, name of author/editor/commentator and publisher are not mentioned. Thus the list from 1 to 54 and 54B lacks transparency. It is difficult to identify the authentic text of almost all classical treatises due to commentators of different periods and editors of different schools of thoughts. Titles by contemporary vaidyas do not reflect their original contribution or research inputs, while the titles published by Ayurvedic drug manufacturers do not fall in the category of classical texts. Bharat Bhaishajya Ratnakara (number 11) was published by Unjha Pharmacy; Rasa tantra va siddha prayog sangraha (number 21) was published by Krishna Gopal Ayurveda Bhavan, Ajmer, Siddhayoga Sangraha (number 33) was published by Baidyanath Ayurveda Bhavan, Calcutta, and Ayurveda Sar Sangraha (number 54B, placed between Ayurvedic Formulary of India and Ayurvedic Pharmacopoeia of India) was published by Sri Baidyanath Bhavan Pvt. Ltd., Nagpur. (Identity of publishers is disclosed by the Editor.) The original list has been drawn irrespective of the historical value of the content and is not arranged chronologically. Charaka Samhita is placed at 13th place and Sushruta Samhita at 34th, while Arogya Kalpadrum (Malayalam, by Kaikulangara Ramavarrier*) is at number 1; Arka Prakasha (Ravana) at number 2; Arya Bhishak (Gujarati, by Shankar Daji Pade*) at number 3; Ayurveda Sangraha (Bangla*) at number 8; Bharat Bhaishajya Ratnakara, published by Unjha Pharmacy, at number 11. Only a few titles are available in Ayurvedic colleges and research libraries. Out of 54 Ayurvedic books enlisted in the Drugs and Cosmetics Act of 1940, the Central Council for Research in Ayurvedic Sciences (CCRAS) has published/ processed the translations of 13 books: Published books: Astanga Samgraha; Basavarajeeyam; Abhinava Chintamani; Rasa Pradeepika (Telugu); Sahasra Yoga; Rasa Chandansu (Marathi, in Press). Books still being processed: Arya Bhishaka (Gujarati*); Vaidyak Chikitsa Sara (Gujarati); Ayurveda Sangraha (Bangla*); Arogya Kalpadruma (Malayalam*); Nighantu Ratnakara (Marathi); Sarva Roga Chikitsa Ratnam (Malayalam); Bhela Samhita. *Identified by the Editor. Though Sahasrayoga Sanskrit/Hindi text was published by CCRAS on November 30, 1990, Ayurvedic Formulary of India, Part II, 2000, and Ayurvedic Formulary of India, Part I (revised edition), 2003, quoted Sanskrit text from Sahasrayoga, published by Sri Ramvilasam Press, Quilon in 1963. (There are variations in Sanskrit texts and interpretations of plant drugs in both publications.) Ayurvedic compound formulations of the following “additional texts,” in addition to 54 authorized books listed in the Drugs and Cosmetics Act, were included in the Ayurvedic Formulary of India, Part I (revised edition) and Part II: 1 2

Vaidya Yoga Ratnavali (published by Indian Medical Practitioners’ Cooperative Pharmacy, Chennai) Dravya gun Vigyan (Vaidya Yadavaji Trikamji Acharya, the name of the publisher not given)

36  Legacy and logical steps 3 4 5 6 7 8

Ayurvedic Aushadhi Gunadharma Shastra (Acephali Private Ltd.) Rasa yoga Sundara (anonymous) Rasa Ratnakara (anonymous) Rasoddhar tantra (Rasasala Aushadhasrama) Brahad yoga tarangani Pharmacopoeia of Hospital of Integrated Medicine, Madras (1956)

A number of compound drugs, quoted from these “additional texts,” are neither time-tested nor validated by experimental or clinical trials. For Ayush Elective Curriculum for MBBS students (for 2019), which will be changed after the first experiment, the following “Important Resources” (books and research material) have been approved:   1 Kutumbiah P, Ancient Indian Medicine, Orient Longman, Chennai, India, 1969 (reissued 1999).   2 Srikanthamurthy KR, Biographical History of Indian Medicine, Chaukhambha Orientalia, Jaikrishnadas Ayurveda series no. 137, Varanasi, India, 2005.   3 Narayanaswamy V, Origin and development of Ayurveda: A  brief history, Ancient Science of Life, 1998, 1(1): 1–7.   4 Patwardhan K., The history of the discovery of blood circulation: Unrecognized contributions of ayurveda masters, Adv Physiol Educ, 2012, 36: 77–82.   5 Muthu CA, Short review of the history of ancient Hindu medicine, Proc R Soc Med, 1931, 6: 177–190.   6 Patwardhan K, Human Physiology in Ayurveda, Chaukhambha Orientalia, Varanasi, India, 2008.   7 Conboy LA, I Edshteyn, H Garivaltis, Ayurveda and Panchakarma: Measuring the effects of a holistic health intervention, The Scientific World Journal, 2009, 9: 272–280, doi:10.1100/tsw.2009.35.   8 Loukas M et al, Anatomy in ancient India: A focus on the Susruta Samhita. J Anat, 2010, 217: 646–650.   9 Savrikar S, B Ravishankar, Bhaishajya Kalpanaa-The ayurvedic pharmaceutics-an overview, African Journal of Traditional, Complementary and Alternative Medicines, 2010, 7(3): 174–184. 10 Chaudhary A, N Singh, Herbo mineral formulations (Rasaoushadhies) of Ayurveda: An amazing inheritance of ayurvedic pharmaceutics, Ancient Science of Life, 2010, 30(1): 18–26. 11 Kurande VH et al., Reliability studies of diagnostic methods in Indian traditional ayurveda medicine: An overview, J Ayurveda Integr Med, 2013, 4: 67–76. 12 Thakar VJ, Diagnostic methods in Ayurveda, Ancient Science of Life, 1982, 1(3): 139–145. 13 Singh RH, The psychosomatic disorders and their management in Ayurveda, Ancient Science of Life, 1981, (1): 41–48. 14 Rastogi S, Development and validation of a Prototype Prakriti Analysis Tool (PPAT): Inferences from a pilot study, Ayu, 2012, 33(2): 209–218, doi:10.4103/0974-8520.105240.

To move with the times  37 15 Juyal RC et al, Potential of Ayurgenomics approach in complex trait research: Leads from a pilot study on Rheumatoid Arthritis. Novelli G, ed. PLoS One, 2012, 7(9): e45752, doi:10.1371/journal.pone.0045752. 16 Mahalle NP et al, Association of the constitutional type of Ayurveda with cardiovascular risk factors, inflammatory markers and insulin resistance. Journal of Ayurveda and Integrative Medicine, 2012, 3(3): 150–157, doi:10.4103/0975-9476.100186. 17 Dey S, Pahwa P, Prakriti and its associations with metabolism, chronic diseases, and genotypes: Possibilities of new born screening and a lifetime of personalized prevention, Journal of Ayurveda and Integrative Medicine, 2014, 5(1): 15–24, doi:10.4103/0975-9476.128848. 18 Ajanal M et al, Adverse drug reaction and concepts of drug safety in Ayurveda: An overview, Journal of Young Pharmacists, 2013, 5(4): 116–120, doi:10.1016/j.jyp.2013.10.001. 19 Wal P et al, Pharmacovigilance of herbal products in India, Journal of Young Pharmacists, 2013, 3: 256–258, doi:10.4103/0975-1483.83780. 20 Rastogi S, Why and how? Addressing the two most pertinent questions about pharmacovigilance in Ayurveda, International Journal of Ayurveda Research, 2011, 2(1): 48–52, doi:10.4103/0974-7788.83187. 21 Chaudhary A et al, Pharmacovigilance: Boon for the safety and efficacy of Ayurvedic formulations, Journal of Ayurveda and Integrative Medicine, 2010, 1(4): 251–256, doi:10.4103/0975-9476.74427. 22 Manohar PR et al, DHARA: Digital helpline for Ayurveda research articles, Journal of Ayurveda and Integrative Medicine, 2012, 3(2): 97–101, doi:10.4103/0975-9476.96530. 23 Rotti H et al, DNA methylation analysis of phenotype specific stratified Indian population, Journal of Translational Medicine, 2015, 13: 151, doi:10.1186/s12967-015-0506-0. 24 Govindaraj P et al, Genome-wide analysis correlates Ayurveda Prakriti, Scientific Reports, 2015, 5: 15786.doi:10.1038/srep15786. 25 Wujastyk D, Interpreting the image of the human body in premodern India, Int J Hindu Studies, 2009, 13: 189–228. This list has no link with “authoritative” knowledge base because it is aimed at offering an olive branch to the students of modern medicine. The big questions that students of modern medicine will raise include, why has research of the last three centuries been ignored arbitrarily? And why is it that all the plant drugs found in India are not treated as Ayurvedic drugs? Only those plants mentioned in 54 Books are Ayurvedic plants? How can it be kept secret that the following Unani plant drugs are part of Ayurveda?   1   2   3   4

Ajwain-khurasani (Hyoscyamus niger Linn.); Parseek Yavaani (Bhavaprakasha) Aqarqarha (Anacyclus pyrethrum DC.); Aakaarkarbha (Bhavaprakasha) Banafshaa (Viola pilosa Wall.) (Ayurvedic Formulary of India, Part II) Behman safed (Centeurea behen Linn.) (Ayurvedic Formulary of India, Part II)

38  Legacy and logical steps   5 Behman surkh (Salvia haemetodes Linn.) (Ayurvedic Formulary of India, Part II)   6 Chobachini (Smilax china Linn.); Dweepaantara Vachaa (Bhavaprakasha)   7 Gheekuwaar (Aloe barbadensis Mill.) Kanyaasaara (Bhavaprakasha)   8 Gozabaan (Onosma bracteaum Wall.); Gojihvaa (Bhavaprakasha)   9 Juphaa (Hyssopus officilanis Linn.) (Ayurvedic Formulary of India, Part II) 10 Khatmi (Althea officinalis Linn.) (Ayurvedic Formulary of India, Part II) 11 Khoobakalaan (Sysmbrium iro Blume) (Ayurvedic Formulary of India, Part II) 12 Khoonkharaabaa (Dasmonorps draco Blume); Rakta-niryaas (Ayurvedic Formulary of India, Part II) 13 Papitaa Desi (Carica papaya Linn.); Erandakarkati (Ayurvedic Pharmacopoeia of India, Part I, Vol. VI.) 14 Pudinah (Mentha viridis Linn.) (Ayurvedic Pharmacopoeia of India, Part I, Vol. V.) 15 Revandachini (Rheum emodi Wall.); used as a substitute for Amlvetus (Sharangadhara Samhita) 16 Rumimustagi (Pistacia lentiscus Linn.) (Ayurvedic Formulary of India, Part II) 17 Unnaab (Zizyphus jujube Mill. (Ayurvedic Formulary of India, Part II) 18 Sapistaan (Cordia dichotama Frot. F.) (Ayurvedic Formulary of India, Part II) (116 Ayurvedic Plant drugs were adopted by Unani Tibb. Few Ayurvedic scholars will know that an Unani hakim, Bahwa Khan, during the reign of Sikandar Shah Lodi more than 500 years ago, translated the works of Charaka, Sushhruta, Vagbhat, Sharangadhara and Chakradatta into Persian. The book “Madan-us-Shifa Shahi” was published by Navalkishore Press, Lucknow.) That tomorrow is not far off when AYUSH will welcome new plant drugs. Why? The Red List is getting longer every day. See “Threat to Plant Drugs of Ayurvedic Formulations.”

4 The classical age in countries that are now leaders in herbal medicine

China The Yellow Emperor’s Internal Classic (around 300 bc) is one of the oldest and most comprehensive extant works in China. Its 18 volumes encompass basic Traditional Chinese Medicine (TCM) recorded theories of the viscera and bowels, meridians and yin and yang, information on hygiene, clinical symptoms, acupuncture and moxibustion, and prescriptions and drugs. The guiding principles behind classical TCM are four properties – cold, hot, warm and cool; five tastes – sour, bitter, sweet, acrid and salty; “Five Elements” – Fire, Earth, Metal, Water, and Wood; and Yin and Yang attributive channels or organs in the body on which a drug has a major effect.1 The popular treatment known as Traditional Chinese Medicine is actually a modern modification of the +2000-year-old Chinese Medicine and was formed in the early to mid-twentieth century. In the formation of TCM, important philosophical and practical doctrines from Classical Chinese Medicine (CCM) were left behind in order to simplify the medicine and to train new practitioners. By simplifying the medicine, some of the theoretical tools were overlooked. Here are some of the main differences between Classical Chinese Medicine and Traditional Chinese Medicine: (1) Health is an active process of nourishing life in order to maximize one’s potential (CCM) (1) Health defined as the absence of symptoms and ailments (TCM) (2) Individual diagnosis and treatment (CCM) (2) Standardized diagnosis and treatment (TCM) (3) Treating according to individual assessment in conjunction with universal factors of time and space (CCM) (3) Treating according to patterns using formulas of points (TCM)

40  Legacy and logical steps (4) Treating the whole person in a holistic approach (CCM) (4) Treating separate symptoms and systems in the body (TCM) (5) The mind is primary to the body (CCM) (5) The body is primary to mind (TCM) (6) Treating according to one’s personal qi and constitution (CCM) (6) People with similar patterns will be treated similarly (TCM) (7) Different treatment according to gender (CCM) (7) No difference between genders (TCM) (8) Different treatment according to season (CCM) (8) No consideration to the season (TCM) (9) Different techniques for treating existing conditions and preventing future ailments (CCM) (9) Similar principles for treatment and prevention (TCM)2 The Institute for Medicinal Plant Development, Beijing, founded in 1983, employs more than 350 scientists in nine departments for carrying out research on Chinese medicinal plants. Researchers include botanists, agronomists, organic and analytical scientists, and pharmacologists. The focus is on new medicinal plant resources, new production techniques of herbal drugs, new processing and extraction methods, tissue culture experimentation, and chemical and pharmacological studies.1

References 1  Herbal Emissaries by Steven Foster and Yue Chongxi, Healing Arts Press, Rochester, Vermont, 1992.) 2 www.sourcecentre.ca/classical-chinese-medicine-vs-traditional-chinese-medicine/

America Sauer’s Herbal Cures1 America’s first book of herbal healing, Sauer’s Herbal Cures, was assembled by Pennsylvania apothecary and printer Christopher Sauer (1721–1784). Theodor Zwinger (1658–1724) was a Swiss physician whose herbal was first published in 1696. He was a conservative physician, for he adhered to the system of humor, signatures, numerologies and even lunar arrangements. His book was devoted to placing herbs in their temperament of hot and cold, dry or moist so that they might be paired with the right humor governing the human body. Their active

The classical age in herbal medicine  41 quantities were defined in terms of their inherent salts, a system of evaluation that was linked to Paracelsus (1493–1541). Proper pairing of these temperaments was thought to create a healthful balance, which was determined by the various states of blood. Theodor Zwinger’s son, Friedrich, revised his father’s herbal in 1744. And this was the edition that was sold in America, from which Christopher Sauer II drew the material. Sauer decided to serialize his herbal by publishing it in installments. It took 16 years. By that time it became scientifically out of date. Only 266 medicinal herbs were listed. Ginger was the first herb that appeared in the first installment of 1762. Ingwer (Ginger): Ginger was one of the first herbs to be included in Sauer’s Herbal, appearing as it did in the first instalment of 1762. Ginger is warm and dry to the third degree and possesses numerous spicy, oily, and volatile salts. Thus, it has the very same virtues as calamus, galingale, pepper, and other spices of similar warmth and dryness. For those with a sanguinary nature, ginger should be used very little. It is good for those with a cold stomach. It promotes digestion, awakens the appetite, takes off watery vapors, and strengthens weak eyesight. Basilien (Sweet Basil): A warming and drying herb. It strengthens the head, brain, and stomach; loosens internal obstructions; cures dizziness so long as the condition is not brought on by high blood pressure. Basil cleanses the matrix, strengthens it, and gently promotes the menses. But only leaves and seeds are used in simples. Water of sweet basil and borage mixed together and a spoonful taken now and then will give very good treatment in case of depression, enliven the heart. And ward off fainting. If its seeds are soaked until soft in water, they will discharge a white mucilage. It serves as a good treatment for scurvy of the gum, and for chapped and cracked lips, cracked nipples and chapped breasts and for rawness of the privates. Water of Sweet Basil and Borage water mixed together and a spoonful taken now and then will give very good treatment in cases of depression, enliven the heart, and ward off fits of fainting. Burretsch (Borage): For medical purposes, borage is gathered when the sun moves into the sign of Gemini or into the sign of Cancer. The root. leaves, and little flowers are the parts used. They have property of warming gently, of defending the heart, of refreshing the spirit, and of opening obstructions of the spleen. Two parts of loaf sugar and one part flowers and grind in a marble or wooden mortar until reduced to fine powder. This conserve of borage is especially effective for cases of depression. A cordial can be prepared by infusing the flowers in brandy. The distilled water of borage delights and enlivens the heart, guards against fainting spells, banishes melancholy, cleanses the blood. Sauer pointed out that cooking borage destroys its medical properties.

42  Legacy and logical steps

Reference 1 Sauer’s Herbal Cures: America’s First Book of Botanic Healing, translated and edited by William Woys Weaver, Routledge, New York. 2001.

Britain The English Physitian1 In Britain, Nicholas Culpeper (1616–1654) is the household name for herbal medicine. He is famous for his herbal, The English Physitian, which first appeared in 1652 and since then has been reprinted in over 100 editions, not only in England but also in America, where it became the first medical book to be published (Boston 1708). He has undeservedly earned the reputation of a quacksalver since he was in conflict with the College of Physicians and believed in astrology, something Culpeper, however, shared with many of his contemporaries. In the seventeenth century astrology was still so deeply rooted in everybody’s mind that we can find traces of it in the writings of William Harvey and Francis Bacon.2 Culpeper followed the classical medical precepts of Hippocrates and Galen. He also subscribed to the doctrine of signatures – that is, the belief that plants contain some physical sign of what they are meant to treat: for example, the belief that walnuts are good for your brain because they look like little brains. These beliefs weren’t so uncommon for seventeenth-century academics and physicians, and some plants were identified as useful  before being assigned their “signature.” A medical populist, Culpeper’s mission was to put medicine and natural healing back into the hands of the people. According to Culpeper, physicians, by and large, used Latin to keep their knowledge out of the hands of the public. To put medical knowledge and power back into the hands of the people, Culpeper wrote an unauthorized critical translation of The London Dispensatory in English (1651), with the result that many British physicians tried to brand him as a quack and charlatan. Culpeper also translated Galen’s  Art of Physick from Latin into English. This work deals with the basic tastes, temperatures and energetics of medicinal substances and how these properties produce the whole range of therapeutic actions associated with them. Culpeper’s best known work, A Complete Herbal (The English Physician), gives the astrological indications of every herb in terms of planets and signs of the zodiac. According to Culpeper, plants were able to channel and embody the subtle life energies of the planets, which were then consumed as food and medicine. Through an elaborate system of planetary sympathies and antipathies, he found the right herb or formula to treat the patient’s illness. We are quoting just three examples from Culpeper’s Complete Herbal: Government and Virtues of Garlick: Mars owns this herb. This was anciently accounted the poor man’s treacle, it being a remedy for all diseases and hurts

The classical age in herbal medicine  43 (except those which itself breed). It provokes urine, and women’s courses, kills worms in children, cuts and voids tough phlegm, purges the head, helps the lethargy, is a good preservative against, and a remedy for any plague, sore, or foul ulcers; takes away spots and blemishes in the skin, eases pain in the ears, ripens and breaks imposthumes or other swellings. Many authors quote many diseases this is good for, but conceal its vices. Its heat is very vehement, and all vehement hot things send up by ill-flavored vapors to the brain. In choleric men it will add fuel to the fire. In men oppressed by melancholy, it will attenuate the humor, and send up strong fancies, and as many strange visions to the head; therefore let it be taken inwardly with great moderation. Government and virtues of Agrimony: It is an herb under Jupiter, and the sign of cancer; and strengthens those parts under the planet and sign and removes diseases in them by sympathy, and those under Saturn, Mars and Mercury by antipathy, if they happen in any part of the body governed by Jupiter, or under the signs Cancer, Sagittarius or Pieces; therefore must needs be good for gout, either used outwardly in oil or ointment or inwardly in an electuary, or syrup, or concerted juice. It is of a cleansing and cutting faculty, without any manifest heat, moderately drying and binding. It opens and cleanses the liver, helps the jaundice, and is very beneficial to the bowels, healing all inward wounds, bruises, hurts, and other distempers. I cannot stand and give you reason in every herb why it cures such diseases, but you will find them true throughout the book. Government and virtues of Fox-Glove: The plant is under the domination of Venus, being of a gentle cleansing nature, and withal very friendly to nature. The herb is familiarly and frequently used by the Italians to heal any fresh or green wound, the leaves being but bruised and bound thereon; and the juice thereof is also used in old sores, to cleanse, dry, and heal them. The decoction thereof made of with some sugar or honey, is available to cleanse and purge the body both upwards and downwards, sometimes of tough phlegm and clammy humours, and to open obstructions of the liver and spleen. It has been found by experience to be available for the king’s evil, the herb bruised and applied, or an ointment made with the juice thereof, and so used. I am confident that an ointment of it is one of the best remedies for scabby head.

References 1 Culpeper’s Complete Herbal, Wordsworth Editions Ltd. 1995. 2 Journal of the Royal Society of Medicine, September 1994, 87: 552.

Gerard’s Herbal1 John Gerard (also John Gerarde, c. 1545–1612) was the renowned Elizabethan herbalist, with a large herbal garden in London. He was the author of a 1,484-page

44  Legacy and logical steps illustrated  Herball, or Generall Historie of Plantes, first published in 1597. It became the most prevalent botany book in English in the seventeenth century. Except for additions of some plants from his own garden and from North America, Gerard’s Herbal is largely an unacknowledged English translation of Rembert Dodoens’s herbal, published in 1554, itself highly popular in Dutch, Latin, French and other English translations. Gerard’s Herball contains high-quality drawings of plants, largely derived from Continental European sources. Two decades after Gerard’s death, the book was corrected and expanded to about 1,700 pages. The botanical genus Gerardia is named in Gerard’s honor. We will give Gerard’s version of Herbe Gerard and three examples of his text (in sixteenth-century English): Herbe Gerard: John Gerard equated Herbe Gerarda with Herbe Gerard, Wilde Masterwort, Ashweed and German name Podagraria. (Herb-Gerard and Ashweed are common names of Aegopodium podagraria Linn. Masterwort is the common name of Angelica atropurpuria. The line drawing given with the text resembles both plants.) Herbe Gerard with his roots stamped, and laid upon members that are troubled or vexed with the gout, swageth the paine, and taketh away the selling and inflammations thereof, which occasioned the Germanes to give it the name Podagraria because of his virtues in curing the gout. Clownes Wound-wort or All-heale: The leaves hereof stamped with Axungia or hog’s grease, and applied unto greene wounds in manner of a pultesse, heal them in short time, and in such absolute manner, that it is hard for any that have not had the experience thereof to beleeve: for being in Kent about a Patient, it chanced that a poore man in mowing of Person did cut his leg with a sithe, wherein hee made a wound to the bones, and withall very large and wide, and also with great effusion of bloud; the poore man crept unto this herbe, which he bruised with his hands, and tied a great quantitie of it unto the wound with a piece of his shirt, which presently stanched the bleeding, and ceased the paine, insomuch that the poore man presently went to his daies worke againe, and so did from day to day, without resting one day until he was perfectly whole; which was accomplished in a few daies, by this herbe stamped with a little hogs greese, and so laid upon it in manner of a pultesse, which did as it were glew or sodder the lips of the wound together, and heale it according to the first intention, as wee terme it, that is, without drawing or bringing the wound to suppuration or matter; which was fully performed in seven daies, that would have required forty daies with balsam itselfe. I saw the wound and offered to heale the same for charity; which he refused, saying that I could not heale it so well as himself; a clownish answer I confess, without any thankes for my good will; whereupon I named it (plant) Clownes Wound-wort. Since which time my selfe have cured many grievous wounds, and some mortall, with the same herb. Onion: The onion do bite, attenuate or make thin, and cause dryness. Being boiled they do lose their sharpness, especially if the water be twice or thrice

The classical age in herbal medicine  45 changed, and yet for all they doe not lose their attenuating qualities. The juice of onion snuffed up into nose, purgeth the head, and draweth forth raw flegmaticke humors. Stamped with salt, rue, and honey, and so applied, they are good against the biting of a mad dog. Roasted in the embers and applied, they ripen and breaks cold Apostumues, Biles. And such alike. The juice taketh away the heat of scalding with water or oile, as also burning with fire and gunpowder. Onion sliced and dipped in the juice of Sorrell, and given unto the Sicke of a tertian Auge, to eat, takes away the fitin once or twice so taking them. The onion being eaten, yea though it is boiled, causeth headache, hurteth the eyes, and maketh the man dim sighted, dulleth the senses. (Allium cepa). African Marigold: The unpleasant smel, especially of that common sort with single floures doth shew that it is of a poisonsome and cooling qualitie; and also the same is manifested by divers experiments: for I  remember, said Dodonaeus, that I did see a boy whose lipps and mouth when he began to chewthe floures did swell extremely; as it hath often happened unto them, that playing or piping with quils or kexes of Hemlockes, do hold them a while between their lipps: likewise he saith, we gave to a cat the floures with their cups, tempered with fresh cheese, shee fortwith mightily swelled, and a little while after died. All which things doe declare that this herbe is of venomous and poysonsome facultie; and that they are not to be hearkened unto, that suppose this herb to be a harmlesse plant: so to conclude, these plants are most venomous and full of poison, and therefore not to be touched or smelled unto, much lesse is used in meat or medicine. (No line drawing with the text. African Marigold is a confusing name. The described plant shold be equated with Cineraria lyrata DC., Wild Parsley. Cineraria lyrata is a toxic plant.) 1

Gerard’s Herbal, John Gerard’s Historie of Plants, Edited by Marcus Woodward, Tiger Books International, Middlesex, UK, 1998.

Germany Hildegard von Bingen’s Physica1 In Germany, the rise of Christianity brought the art and science of healing within the deeply spiritual bounds of the church more than 2,500 years back. During this period Hildegard von (of) Bingen (1098–1179) authored the nine books of Physica (Natural Science). Hildegard of Bingen was  a German nun and polymath. Hildegard’s writings were not only the first books on herbals and medicine written by a woman but were also instrumental in establishing founding principles of nutritional treatment, herbal healing and medieval medical treatments. Natural medicine as a practice was quickly adopted and propagated by the monks. This  monastic medicine  aggregated expertise from ancient Greek, Roman and Arabic cultures. The monastic practice codified, documented, and

46  Legacy and logical steps tested various practices and their outcomes. It remained the epicenter of natural medicine for hundreds of years.1 Overview of the section about plants in Physica: (a) Physica (“Plants”) contains 230 sections on medicinal uses of plants. Hildegard makes little attempt to describe the plant for purposes of identification, and she assumes, rather than spells out, the medical and physiological theories behind the uses of the plants. She used German colloquial names of the plants to be used as herbs. The names of herb herbs change from place to place. The identical name may not be the same herb that is used now. (b) She was not always clear about the specific ailment; for example, she used gicht to cure gout, arthritis, rheumatism, lumbago and sciatica. (c) She follows the traditional view that created things consist of mixture of four elements – hot, cold wet, dry – in which one or two qualities predominate. Every herb is either warm or cold. The warmth of the herb signifies the soul and the cold of herbs signifies the body. Herbs flourish according to their type when they overflow either with warmth or cold. For if herbs are all warm, no coldness can do anything contrary to their usefulness. If, however, they are all cold and not warm in any way, they might be useless since warm things resist the cold and cold things resist the warm. (d) Certain herbs have very strong aromas, others the harshness of the most pungent aromas. They can curb many evils since evil spirits do not like them. (e) Certain herbs hold the foam of the elements. People who try to seek their own fortunes are deceived by these. The devil loves these herbs and mingles with them. (f) Hildegard combines the elements with a theological notion ultimately derived from Genesis according to which everything on earth was put there for the use of humans. (g) Since the balance of the elements and their corresponding humors determined good or bad health in people, it was important to know the elemental qualities of plants. People could then determine their effect according to whether they are in or out of humor, that is, in a balanced or unbalanced state. Germany, now a world leader With the introduction of cellular pathology in the late 1800s by the “Father of Modern Pathology,” German physician Rudolf Virchow, and the advent of modern medicine, the holistic concept of natural medicine nearly disappeared, leaving behind much of the ancient knowledge. Currently in Germany, 600 to 700 plant-based medicines are available and are prescribed by some 70% of German physicians. A 1901 law, reaffirmed in 1961, allows for the sale of German herbal medicine as drugs, giving them special status as medicinal agents, a unique situation when compared with other countries. Hopefully, this will not be the case for long. The herbs sold with the intent of

The classical age in herbal medicine  47 curing, alleviating or preventing disease or symptoms of illness have been allowed in the German market as drugs. In 1976, Germany passed a law that required all medicines on the market (including conventional drugs) to be reviewed by scientific committees. In 1978, a special committee on herbal remedies called Commission E3,4 was established. With the global interest in herbal medicine rapidly expanding, the German Commission E monographs established by the German government’s counterpart to the US Food and Drug Administration – the German Federal Institute for Drugs and Medical Devices – are being used as the foundation for other regulatory and monograph systems emerging in Europe and around the world. The European Scientific Cooperative on Phytotherapy (ESCOP)5 uses the monographs as the basis for review of scientifically accepted uses of herbal medicine throughout the European Union. The World Health Organization draws on Commission E’s work to develop a new series of herbal monographs that help regulatory agencies worldwide develop guidance for their own drug regulations.6

References 1 Hildegard’s Healing Plants, translated by Bruce W. Hozeski, Becon Press, Boston, 2001: xi–xv, 3. 2 https://healthyhildegard.com (a forum promoting holistic approach to the interconnectivity of spirit mind body. 3 The Complete German Commission E Monographs, edited by Blumenthal et al., American Botanical Council, Austin, TX, 1998. 4 Herbal Medicine: Expanded Commission E Monographs, American Botanical Council, Austin, TX, 2000. 5 ESCOP Monographs, Thieme, 2003 and 2009. 6 WHO Monographs on Selected Medicinal Plants, WHO, Geneva, Vol. 1–4, 2009.

Ancient Roman medicine Pliny the Elder’s Natural History1 Roman medicine, during the first century, was described by Pliny the Elder (Gaius Plinius Secundus, ad 23–79) in Natural History, a massive work made up of 37 volumes that covered “Materia Medica” in Books XX through XXX. A few excerpts from an authentic translation of the original text:1 Human blood for leprosy: I have said that leprosy did not occur in Italy before the time of Pompeius Magnus, and that though the plague usually begins on the face, a kind of freckle on the tip of the nose, yet presently the skin dries up over all the body, covered with spots of various colours, and uneven, in places thick, in others thin, in others hard as with rough itch-scab, finally however going black, and pressing the flesh on to the bones, while the toes and fingers swell up. This plague is native to Egypt. When kings

48  Legacy and logical steps were attacked, it was a deadly thing for the inhabitants, because the tubs in the baths used to be prepared with warm human blood for its treatment. This disease indeed quickly died out in Italy. (Book XXVI) Human blood for quinsy: The blood let from any part of the patient himself makes, we are told by Orpheus and Archelaus, a very efficacious application for quinsy; efficacious too if applied to the mouth of those who have fainted in an epileptic fit, for they rise up immediately. Some say the big toes should be pricked and the drops of blood applied to the face, or that a virgin should touch it with her right thumb; hence their conclusion that epileptics should eat virgin meat. Aeschines the Athenian used the ash of excrements for quinsy, sore tonsils, sore uvula, and carcinomata. (Book XXVIII) Woman’s milk as medicine: As to the use of woman’s milk, it is agreed that it is the sweetest and most delicate of all, very useful in long fevers and coeliac disease, especially the milk of a woman who has already weaned her baby. It is found most efficacious if she has given birth to a boy, and much the most efficacious is hers, who has borne twin boys and herself abstains from wine and the more acrid foods. The milk of a woman however who has borne a girl is excellent, but only for curing spots on the face. The saliva too of a fasting woman is judged to be powerful medicine for bloodshot eyes and fluxes, if the inflamed corners are occasionally moistened with it, the efficacy being greater if she has fasted from food and wine the day before. (Book XXVIII) Ass’s milk: It is thought that ass’s milk removes wrinkles from the face, making the skin white and soft, and it is well known that some women every day bathe their cheeks in it seven times, keeping carefully to that number. Poppaea, wife of the Emperor Nero, began this custom, even preparing her bathtubs with the milk, and for this purpose she was always attended by troops of she-asses. (Book XXVIII) Elephant’s blood as medicine: The blood of an elephant, particularly that of the male, checks all the fluxes that are called ivory shavings with Attic honey are said to remove dark spots on the face, and ivory dust whitlows. By the touch of the trunk headache is relieved, more successfully if the animal also sneezes. The right side of the trunk used as an amulet with the red earth of Lemnos is aphrodisiac. The blood too is good for consumption, and the liver for epilepsy. (Book XXVIII)

The classical age in herbal medicine  49 Aphrodisiacs and antaphrodisiac: Aphrodisiacs: An application of wildboar’s gall, pig’s marrow swallowed, or an application of ass’s suet mixed with a gander’s grease; also the fluid that Virgil too describes as coming from a mare after copulation, the testicles of a horse, dried so that they may be powdered into drink, the right testis of an ass taken in wine, or a portion of it worn as an amulet on a bracelet; or the foam of an ass after copulation, collected in a red cloth and enclosed, as Osthanes tells us, in silver. Salpe prescribes an ass’s genital organ to be plunged seven times into hot oil, and the relevant parts to be rubbed therewith, Dalion the ash from it to be taken in drink, or the urine of a bull after copulation to be drunk, or the mud itself made by it applied to the pubic parts. Antaphrodisiac for men: An application of mouse’s dung. Intoxication is kept away by the roasted lung of a wild boar or pig, taken in food the same day on an empty stomach, or the lung used may be that of a kid. (Book XXVIII) Properties of (selected) medicinal plant drugs Basil:  Ocimuni (basil) too was severely condemned by Chrysippus as injurious to stomach, urine and eyesight, adding that it causes madness, lethargus and liver troubles, and that for this reason goats refuse to touch it, so that men also ought to avoid it. Certain authorities add that pounded ocimum, if covered by a stone, breeds a scorpion, and that ocimum chewed and left in the sun breeds worms; the Africans moreover hold that a man’s life is lost if he is stung by a scorpion on the same day as he has eaten ocimum. Moreover, some hold that if a handful of ocimum be pounded up with ten sea or river crabs, all the scorpions in the neighbourhood are drawn to it. Diodorus in his Empirica says that the use of ocimum as a food breeds lice. The period that followed saw strong defenders of ocimum who said that goats do eat it, that no man’s mind has been affected by it, and that in wine and a little vinegar it cures the stings of land scorpions and the venom of those in the sea. Experience also proves, they say, that ocimum if smelt in vinegar is good for fainting; also for lethargus, and to cool inflammations; for headache, too, if used as a liniment with rose oil or with myrtle oil or with vinegar, and for eye fluxes if applied in wine. It is said too, to be beneficial to the stomach, to disperse flatulence by belching if taken in vinegar, to check looseness of the bowels if applied externally, to be diuretic, applied thus to be good for both jaundice and dropsy, and to check even the diarrhoea of cholera. Philistion therefore prescribed ocimum even for coeliac complaints and when boiled for dysentery; some against the advice of Plistonicus prescribe it in wine for tenesmus, spitting of blood and hardness of the hypochondria. Applied to the breasts it checks the flow of milk. (Book XX)

50  Legacy and logical steps Linseed: Linseed is not only used in combination with other ingredients, but also by itself removes spots on women’s faces, and its juice benefits the eyesight. With frankincense and water or with myrrh and wine it relieves fluxes from the eyes, parotid abscesses with honey or grease or wax, fluxes from the stomach when sprinkled in water like pearl barley, and quinsies when boiled in water and oil and applied externally with anise. It is roasted to check looseness of the bowels. For coeliac trouble and dysentery it is applied in vinegar. For pains of the liver it is eaten with raisins; for consumption electuaries are made from the seed with very useful results. Linseed meal, with soda or salt or ash added, softens indurations of the muscles, sinews, joints and nape of the neck, as well as the membranes of the brain. With a fig it also opens and brings to a head a parotid abscess; with the root moreover of wild cucumber it extracts bodies sticking into the flesh, including pieces of broken bone. Boiled in wine it prevents a sore from spreading, and with honey checks eruptions of phlegm. With an equal part of cress it cures scabrous nails, with resin and myrrh complaints of the testes and hernia, and in water gangrene. Stomach ache is cured by a decoction of one sextarius of linseed with an equal quantity of fenugreek in hydromel, and dangerous maladies of the intestines and lower trunk by an enema of linseed in oil or honey. (Book XX) Walnuts: Walnuts have received their name in Greek from the heaviness of the head which they being about; the trees themselves, in fact, and their leaves give out a poison that penetrates to the brain. The kernels if they are eaten have the same effect, though the pain is less severe. Freshly gathered, however, they are more agreeable. The dried nuts are more oily, and injurious to the stomach, difficult digestion, productive of headache and bad for a cough; they are good, however, for those who intend to vomit fasting, for tenesmus and for colic, as they bring away phlegm? Taken in time these nuts deaden the effects of poisons, neutralize onions and make their flavour milder. They are applied to inflammation of the ears, with rue and a little honey to the breasts and to sprains, with rue and oil to quinsy, and with onion, salt and honey to the bites of dogs and of humans. (Book XXIII) Cucumber: There is a variety of wild cucumber much smaller than the cultivated kind. The pale smooth variety is better than the grass-green and rough, and is slightly bitter. From it is made the drug called elaterium by pressing the juice out of the seed. Unless, to prepare it, the cucumber be cut open before it is ripe, the seed spurts out, even endangering the eyes. After being gathered, the cucumber is kept for one night and then cut open on the next day with a reed. The seed too is kept in ash to prevent the juice from running away. This when pressed out is received in rain water, where it falls to the bottom. Then it is thickened in the sun, and made into lozenges for the great benefit

The classical age in herbal medicine  51 of mankind, being good for dim vision, eye diseases and sores of the eyelids. It is said that if the roots of vines are touched by this juice the grapes are not attacked by birds. The root too when boiled in vinegar is used as ointment in cases of gout, and its juice cures toothache. Dried and mixed with resin it heals impetigo, itch, what are called psoriasis and lichen, parotid swellings and superficial abscesses; it restores the natural colour to scars, while the juice of the leaves mixed with vinegar and poured by drops into the ears is a remedy for deafness. Many authorities assign all these qualities to the cultivated cucumbers, which even apart from them is of great importance. For instance, the seed too, a three-finger pinch of it, when pounded with cummin and taken in wine, is beneficial for coughs, for phrenitis when drunk in woman’s milk, a dose of an acetabulum for dysentery, and with an equal weight of cummin for expectoration of pus. Taken in hydromel it is good for diseases of the liver. With sweet wine it is diuretic, while for kidney pain it is used with cumrnin as an enema. Another kind of wild gourd is called colocynthis. The fruit is smaller than the cultivated, and full of seed. The pale variety is more useful than the grassgreen. Taken by itself when dried it is a drastic purge. Used also as an enema an injection is a remedy for all complaints of the bowels, of the kidneys, and of the loins, as well as for paralysis. After the seed has been picked out, hydromel is added and boiled down to one half, which gives a very safe strength for an injection of four oboli. The stomach is benefited also by taking pills made of the dry powder mixed with boiled honey. In jaundice seven seeds of it are taken, to be followed immediately by hydromel. The pulp added to wormwood and salt cures toothache, while its juice warmed with vinegar makes loose teeth firm. Rubbed on with oil it likewise relieves pains of spine, loins and hips. Moreover, wonderful to relate, an equal a number of its seeds, fastened to the body in a cloth, is said to reduce those fevers which the Greeks call periodic. The warmed juice, also, of the shredded cultivated colocynthis cures earache, and its inner pulp without the seed corns on the feet, as well as the suppurations called by the Greeks άποστήματα. The juice obtained by boiling down the whole pulp along with the seeds makes loose teeth firm and stops toothache, and a boiled mixture of it with wine stops inflammation of the eyes. An application of the pounded leaves with fresh cypress leaves, or of the fruit alone, roasted in a clay pot, reduced to powder and added to goose grease, is a cure for wounds. Moreover, when fresh, with shreds of its bark it cools gout and inflammations of the head, especially of babies, and erysipelas by the application to the part affected of the same shreds, or of the seeds. The juice from scrapings, mixed with rose-oil and vinegar, makes a liniment which cools the heat of fevers. The dust of the dried fruit applied to burns is wonderfully healing. Chrysippus the physician disapproved of gourds as food, but there is a general agreement that they are very beneficial to the stomach, and also for ulceration of the intestines and bladder. (Book XX)

52  Legacy and logical steps Radish: Cultivated radishes moreover, besides what has been said about them, purge the stomach, loosen phlegm, promote urine and bring away bile. In addition, a decoction of the skin in wine, drunk in the morning up to three cyathi, breaks up and eliminates gall-stones. A decoction of the same in vinegar and water is used as liniment for the bites of serpents. The radish too is good for a cough if taken with honey in the morning on an empty stomach; its seed too when roasted and chewed by itself. To use a radish as an amulet and to drink either a decoction of its leaves in water or its juice neat in doses of two cyathi is good for phthiriasis. Good for inflammation is a liniment of radishes crushed by themselves, and for a fresh bruise a liniment made from the skin with honey. Lethargic persons are benefited by eating them at their hottest, asthmatics by the seed, first roasted and then beaten up with honey. Radishes are also useful for poisons, counteracting the sting of the cerastes and of the scorpion. With hands rubbed with radish or its seed you may handle these creatures without fear, and a radish placed on scorpions kills them. Radishes too counteract the poisons of fungi and of henbane, and moreover, as Nicander tells us, the effects of drinking bull’s blood. Both the physicians with the name of Apollodorus prescribe radishes to be given for mistletoe poisoning; but Apollodorus of Citium recommends the pounded seed in water, he of Tarentum the juice. Radishes also reduce the size of the spleen, and are good for the liver and pains in the loins; taken also with vinegar or mustard they are beneficial in cases of dropsy, lethargus, epilepsy and melancholia. Praxagoras would administer it to patients with iliac, and Plistonicus to those with coeliae disease. If eaten with honey they also cure ulcers of the intestines and suppurations of the chest. Some for these purposes prefer to cook them in mud; [Mayhoff’s reading: “to smear them over with mud before cooking.”] if so taken they promote, according to them, the menstrual discharge. Taken with vinegar or honey they bring away intestinal worms; a decoction of them boiled down to one third, drunk with wine, is good for intestinal hernia; so taken they draw off superfluous blood. For these purposes and for spitting of blood Medius prescribes that they should be given cooked, as well as to women lying-in to increase the supply of milk; Hippocrates that radishes should be rubbed on the head of women when the hair falls off, and that they should be placed on the navel for pains in the womb. They also bring scars back to the original colour of the skin. An application also of the seed soaked in water arrests ulcers called phagedaenae. Democritus thinks that as a food radishes are aphrodisiac; for this reason, perhaps, some have maintained that they are injurious to the voice. The leaves, but only those of the long radish, are said to improve the eyesight; should however too strong a dose of radish be applied as a remedy, they prescribe the immediate use of hyssop, for it is antipathetic. For deafness the juice of the radish is dropped into the ear. But, for those who would vomit, it is very useful to eat radishes after a meal. (Book XX)

The classical age in herbal medicine  53 Stray parsnip: A kind is staphylinus, is called stray parsnip. Its seed, crushed and taken in wine, soothes a swollen belly, and the hysterical chokings and pains of women, to such an extent that it restores the womb to normal, benefits their abdomen, moreover, if applied in raisin wine, benefiting men also when pounded with an equal part of bread and drunk in wine as a cure for bellyache. It is diuretic also, and if applied fresh with honey, or after being sprinkled dry on flour it stays phagedaenic ulcers. Its root, taken in hydromel, Dieuches prescribes against affections of the liver, spleen, loins and kidneys; Cleophantus in cases also of chronic dysentery. Philistion boils it in milk; for strangury he prescribes four ounces of the root, giving it in water for dropsy, likewise for those stricken by pitonitetanus, pleurisy and epilepsy. It is said that those who carry it are not bitten by serpents, and that those who have eaten of it, if bitten, receive no hurt; for bites it is applied with axlegrease, and its leaves are chewed as a remedy for indigestion. Orpheus said that there is in staphylinus a love-philtre, perhaps because it is a proved fact that when eaten it is an aphrodisiac; for which reason some have declared that by it conception is aided. For all other purposes the cultivated kind too is powerful, but the wild plant is more efficacious, especially that growing on rocky soils. The seed of the cultivated kind too is a cure for the sting of scorpions when taken in wine or vinegar and water. Its root used as a dentifrice is a cure for toothache. Another kind is staphylinus, which they call stray parsnip. Its seed, crushed and taken in wine, soothes a swollen belly, and the hysterical chokings and pains of women, to such an extent that it restores the womb to normal, benefits their abdomen, moreover, if applied in raisin wine, benefiting men also when pounded with an equal part of bread and drunk in wine as a cure for bellyache. It is diuretic also, and if applied fresh with honey, or after being sprinkled dry on flour it stays phagedaenic ulcers. Its root, taken in hydromel, Dieuches prescribes against affections of the liver, spleen, loins and kidneys; Cleophantus in cases also of chronic dysentery. Philistion boils it in milk; for strangury he prescribes four ounces of the root, giving it in water for dropsy, likewise for those stricken by pitonitetanus, pleurisy and epilepsy. It is said that those who carry it are not bitten by serpents, and that those who have eaten of it, if bitten, receive no hurt; for bites it is applied with axlegrease, and its leaves are chewed as a remedy for indigestion. Orpheus said that there is in staphylinus a love-philtre, perhaps because it is a proved fact that when eaten it is an aphrodisiac; for which reason some have declared that by it conception is aided. For all other purposes the cultivated kind too is powerful, but the wild plant is more efficacious, especially that growing on rocky soils. The seed of the cultivated kind too is a cure for the sting of scorpions when taken in wine or vinegar and water. Its root used as a dentifrice is a cure for toothache. Another kind is staphylinus, which they call stray parsnip. Its seed, crushed and taken in wine, soothes a swollen belly, and the hysterical chokings and pains of women, to such an extent that it restores the womb to normal, benefits their abdomen, moreover, if applied in raisin wine,

54  Legacy and logical steps benefiting men also when pounded with an equal part of bread and drunk in wine as a cure for bellyache. It is diuretic also, and if applied fresh with honey, or after being sprinkled dry on flour it stays phagedaenic ulcers. Its root, taken in hydromel, Dieuches prescribes against affections of the liver, spleen, loins and kidneys; Cleophantus in cases also of chronic dysentery. Philistion boils it in milk; for strangury he prescribes four ounces of the root, giving it in water for dropsy, likewise for those stricken by pitonitetanus, pleurisy and epilepsy. It is said that those who carry it are not bitten by serpents, and that those who have eaten of it, if bitten, receive no hurt; for bites it is applied with axlegrease, and its leaves are chewed as a remedy for indigestion. Orpheus said that there is in staphylinus a love-philtre, perhaps because it is a proved fact that when eaten it is an aphrodisiac; for which reason some have declared that by it conception is aided. For all other purposes the cultivated kind too is powerful, but the wild plant is more efficacious, especially that growing on rocky soils. The seed of the cultivated kind too is a cure for the sting of scorpions when taken in wine or vinegar and water. Its root used as a dentifrice is a cure for toothache. (Book XX) Cabbage: The earliest Greeks divided cabbage into three varieties; (a) the curly, which they called selinas from the resemblance of its leaves to those of parsley, useful for the stomach and moderately laxative; (b) the helia, with broad leaves growing out of the stem, from which some have called it caulodes, of no importance in medicine; (c) the third, crambe properly so-called, with thinner leaves of plain shape and very close together, is more bitter but very beneficial. Cato thinks most highly of the curly variety, next after it approving the smooth cabbage with large leaves and big stem. He considers it good for headache, dimness of the eyes and sparks in them, for the spleen, the stomach and the hypochondria, when taken raw in the morning with oxymel, coriander, rue, mint and root of silphium, in doses of two acetabula, saying that their power is so great that he who pounds the ingredients together feels himself growing stronger. He therefore recommends that it should either be pounded with these herbs when taken in a draught, or at least be in sauce made from them; while for gout and rheumatic joints a liniment should be made with a dash of rue, coriander and salt, along with barley flour; he adds that its water, boiled down, is wonderfully beneficial for sinews and joints, if they are fomented with it. Wounds, whether fresh or old, and even cancerous sores, which can be healed by no other treatment, should, so he prescribes, first be fomented with hot water and then have pounded cabbage applied to them twice daily. Similar treatment he prescribes for fistulas also and sprains; for tumours too, both such as must be brought to a head and those that need to be dispersed. As cabbage is the enemy of the vine, they say that it opposes wine; that if taken in food beforehand it prevents drunkenness, taken after drinking it dispels its unpleasant effects. (Book XX)

The classical age in herbal medicine 55 Large Juniper: The big Cedrus (the large Juniper), which Greek botanists call cedrelate, yields a pitch which is called cedria. It (oil) preserves dead bodies uncorrupted by time, but causes living ones to decaya strange inconsistency, to rob the living of their life and to give a quasi-life to the dead! It also makes clothes decay and kills animal life. For this reason I should not think it ought to be used as a remedy for quinsy, or for indigestion, as some have recommended, taken by the mouth. I should also be afraid to rinse the teeth with it in vinegar, when they ache, or to drop it into the ears for hardness of hearing or worms. Gossip records a miracle: that to rub it all over the male part before coition prevents conception. (Book XXIV)

Reference 1 Natural History (Rackham, Jones, & Eichholz)/Book 20 to 28, https://en.wikisource.org/ wiki/Natural_History_(Rackham,_Jones,_%26_Eichholz)/Bo., accessed March  21–22, 2019. (I = Pliny The Elder.)

These examples are enough to prove that by investing all our energy and resources in reviving and revalidating the tenets of the classical period of India, we are fighting a losing battle against an herbal renaissance.

5 Avoiding scientific inquiry is not possible now

Col. Sir Ram Nath Chopra (MRCS, England 1907; B. Ch, Cambridge, UK, 1908; MD, 1912; Sc D, Cantab; FRCS, London) wrote in 19331: • •

•

•

Attempts at the revival of Ayurvedic and Unani systems in their present form (based on classical doctrines) are bound not to succeed. When it is remembered that the Ayurvedic system of medicine has been practically stationary for about 1,500 years and that no attempt has been made to advance the knowledge in conjunction with the progress of the world, one would find it very difficult to reconcile to the old theories of 2,000 years ago, however much one may stretch their significance, with the recent advance of the world of science. After imparting instruction to the Ayurvedic students in modern physiology, bacteriology, pathology, etc., to ask them to apply the doctrine in Vayu, Pitta and Kapha etc. (4 humours in case of Unani medicine – Khoon, Balgham, Safra and Sauda, i.e., blood, phlegm, yellow bile and black bile), to explain the causation of disease, might not be convincing to them and might bring nothing but chaos and discord to their minds. The students trained under such a system might neither be good at one nor the other. History shows that many of our important pharmacopoeial drugs were known and were also used in some form or other possibly long before they were introduced into the Western medicine and before their actions were investigated on scientific lines. On the other hand, there are sure to be others of little therapeutic value that are given merely because they were mentioned in some old manuscripts, and no one has taken the trouble to confirm the truth of these statements. Attempts must be made to separate the good ones from the useless ones, and for this, a systematic investigation of these drugs must be undertaken. Medicine is a progressive science; in every department, an attempt is being made to replace empiricism by rationalism and nowhere is this more evident than in the science of pharmacology and therapeutics. When it is said that a drug like Sarca indica is useful in menorrhagia or Cephalandra indica in diabetes or Boerhavia diffusa in dropsy, the (medical) profession will not accept these assertions, as these are symptoms and not

58  Legacy and logical steps

•

• •

• • • •

diseases; what we (scientists) want to know is their particular value in these various conditions and how they help to restore the tissue to their normal condition. The active principles, responsible for their therapeutic action, have to be isolated and worked out. The way in which the effect is brought about and the manner in which the important organs of the body are affected has to be determined by animal experiments. The question of making suitable preparations and their preservation so as to make their potency independent of climatic and seasonal variations next assumes prominence. The standardization of (herbal) drugs and preparations by chemical and biological methods of the assay is an important factor to secure therapeutic uniformity so that the amount of active principle in each dose is not subjected to irregular variations. The active and useful drugs should be separated from those which are inactive and worthless. Until drugs are investigated on rational lines, their use by the profession in India must be restricted. Much more could be done in furthering the cause of indigenous medicine by a thorough study of indigenous drugs than by wholesale revival of the old system under vastly changed circumstances. The scientific mind is not satisfied by mere statements, no matter from what source they originate, unless corroborated by clinical and experimental evidence.

The first prime minister of India, Pandit Jawahar Lal Nehru, observed:2 There can be no doubt that these ancient systems (Ayurveda and Unani) of India have an honorable history and that they had a great reputation. Most people know that even now they have some very effective remedies. It is necessary, however, that every approach to the problem should be made on the basis of scientific method and persons who are Ayurvedic, Unani physicians should have also full knowledge of modern methods. This means that there should be basic training in scientific methods for all including those who wish to practice Ayurveda or Unani systems. In 1989, Dr. Nitya Anand, the then Director, Central Drug Research Institute, Lucknow, wrote: “Knowledge is greatly advanced since these (traditional, Ayurvedic) systems were developed. It is necessary to examine them in the light of modern development to rationalize their basic tenets.”3 Dr. BN Dhavan, the then Director, Central Drug Research Institute, Lucknow, also advocated scientific evaluation of herbs and observed: “The disease pattern and health care needs of the country have changed significantly in recent years; the priorities were different when the texts of traditional systems of medicine were created.”3

Avoiding scientific inquiry impossible now  59 In 1994, VV Sivarajan and Indira Balachandran wrote4: Reflecting on the decline of Ayurveda after a Brahmanic period (800 bc–ad 10005), one would find that there are three broad, all-pervading reasons for it: •

• •

A complacent attitude among men of Ayurveda that everything is written in the ancient texts and there is little scope for further studies. The faith has, over the centuries, brought in a certain amount of lethargy among them and has taken away the spirit of questioning and experimentation. A self-righteous feeling that their practice reflects ancient wisdom. Reluctance on their part to seek and get collaboration from people working in other allied fields.

According to these authors, pharmacognosy is the most neglected area of medicinal plant research in Ayurveda. The state of affairs is extremely chaotic. A number of studies are available on prepared drugs, forgetting the fact that without standards in the herbal sources of raw drugs there cannot be any standard in prepared drugs. One has to go by materials and not by literature. The plant taxonomy can provide unambiguous, universally accepted identification of plants, yet there is a subtle but firm resistance from men of Ayurveda against this unsolicited offer of assistance. “They are paranoid about ancient Ayurvedic texts and myopic in their approach to collaboration with other allied scientific disciplines.” (VV Sivarajan is Professor of Botany at University of Calicut, Kerala; Indira Balachandran is Research Officer at Herbal Garden, Arya Vaidya Sala, Kottakkal, Kerala.) In 2014, Dr. Bhushan Patwardhan wrote5: The easiest path to promote the classical period of Ayurveda is based on emotions and past glory uncritically. Already there are demands for new Universities, new research institutes, new industries, new clinical establishments exclusively for AYUSH. One can take the emotional stand that AYUSH is indigenous, divine and time-tested. Raising any questions about the evidence of efficacy, theory or practice may not be tolerated. Embracing modern methods, scientific investigation and innovations to explore and enhance ancient wisdom may be seen as an insult to its prestige and exalted status. Such an uncritical approach is not likely to lead to the desired revitalization of AYUSH in the long-term, nor to meaningful change in the health sector. Such an easy route of resisting contemporary medical trends would lead to stagnancy, and would be detrimental to the long-term sustenance and growth of AYUSH. The editors of the Reviews on Indian Medicinal Plants series of the Indian Council of Medical Research wrote: The clinical reports have been objectively included in the Monographs without comments on their validity. It is needless to mention that there are

60  Legacy and logical steps innumerable ethical, technical, logistic hindrances and bias involved in the conduct of clinical trials. A number of the reported clinical trials are scientifically unacceptable primary because of lack of adequate training in the conduct of scientific clinical trials, and lack of commitment to the scientific drill. In most of the cases, a biostatistician has not been involved at any stage of the trial. Dr. Ranjit Roy Chaudhury wrote in a WHO publication (SEARO No. 20): It has been said that those plants still being used today, which stood the test of time. . . . Natural selection needs to be examined carefully. . . . A plant which was therapeutically effective may have undergone mutation and become therapeutically ineffective due to ecological or environmental factors. Setting aside all these observations, The Ayurvedic Pharmacopoeia of India, remained firm to the traditional line.

References 1 Chopra Col. Sir RN et al, Indigenous Drugs of India, second edn, Academic Publishers, Kolkata. 2 Cited in “An Overview of Ayurveda, Yoga, Naturopathy, Unani, Siddha and Homoeopathy in India,” AYUSH, 2004. 3 Research and Development of Indigenous Drugs, 1989, Institute of History of Medicine and Medical Research, Hamdard Nagar, New Delhi-110 062. 4 Sivarajan VV, Indira Balachandran, Ayurvedic Drugs and Their Plant Sources (ADPS), 1994, Oxford and IBH Publishing Co. Pvt Ltd., New Delhi: 10–11. Kottakkal, Kerala. 5 Patwardhan B, Journal of Ayurveda & Integrative Medicine, April–June 2014, 5, www. jaim.in Editorial.

6 Ayurvedic pharmacognosy and pharmacology In modern perspective

In The Ayurvedic Pharmacopoeia of India the “properties and actions” of a herb have been assessed on the basis of Rasa (taste), Guna (physical property), Veerya (potency), Vipaaka (again, taste indicating herb’s action after ingestion) and Karma (Prabhaava or therapeutic effect of the herb). Except for Rasa, which is perceivable, other parameters are not perceivable, inferable; these are linked to physiological manifestations. Sweet (Madhura), sour (Amla), salty (Lavana), pungent (Katu), bitter (Tikta) and astringent (Kasaaya) are six Rasas (tastes). Physical properties (Guna) of herbs have been divided into 20 categories: light, heavy, cold, hot, unctuous, dry, dull, immobile, mobile, soft, hard, clear, slim, smooth, rough, minute, bulk, solid and fluid. The potency of the herb (Veerya) has been divided into Sheeta (cold) and Ushna (hot) segments. The herb is selected for medicinal use after assessing the imbalance or disharmony due to Doshas (morbidities) – Vaata (Vaayu), Pitta and Kapha, known as Tridoshas when grouped together. The entire treatment regimen of Ayurvedic treatment revolves around the theory of Tridosha. Once the Dosha (morbidity) has been identified, the first component of the herb, Rasa (taste), is selected. Rasa is considered an important marker which indicates, initially, the right choice of the herb. Sweet taste pacifies Vaata and Pitta but aggravates Kapha. Sour taste pacifies Vaata but aggravates Pitta and Kapha. Salty taste pacifies Vaata but aggravates Pitta and Kapha. Pungent taste pacifies Kapha but aggravates Vaata and Pitta. Bitter taste pacifies Pitta and Kapha but aggravates Vaata. Astringent taste pacifies Pitta and Kapha but aggravates Vaata.1 In The Ayurvedic Pharmacopoeia of India, Karma of the drug is defined by its impact on Dosha, followed by an explanatory note: Since the effort is to compile pharmacopoeial monographs of Ayurvedic drugs, the accent on classical attributes of respective drugs according to the

62  Legacy and logical steps doctrine of Rasa, Guna, Veerya, Vipaaka and Karma has not been lost sight of, though some of them appear to be abstract and subjective in the absence of an established experimental method to qualify them (emphasis added). This statement was modified in the preface of The Ayurvedic Pharmacopoeia of India, Part I, Vol. VI, 2008: “Rasa, Guna, Virya, Vipaka, and Karma are considered a reasonable basis and convenient reference point for clinical classification. Such parameters are not possible to measures by modern scientific methods thus not mandatory (emphasis added).” A large number of drugs have got no specific odour. The “odour” is examined by directly smelling 25 g of the powdered drug contained in a package or freshly powdered. If the odour is discernible, the sample is rapidly transferred to an open container and re-examined after 15 minutes. If the odour persists to be discernible, it is described as having odour. . . . The “taste” of a drug is examined by taking a small quantity of 85 mesh powder by a tip of the moist glass rod and applying on the tongue previously rinsed with water. This may not be done in case of poisonous drugs indicated in the monographs. Vaata, Pitta and Kapha were also not easy to define. Vaata was equated with breath, Pitta with fire and Kapha with mucus.2 To counteract this type of “mistranslation,” an effort was made to “reinterpret” the theory of Rasa, Guna Veerya, Vipaaka, Karma and Tridosha by some scholars of Ayurvedic medicine. Arvind Chopra and Vijai V. Doiphode opined that, to a certain degree, modern analytical chemistry has been used to assign properties of each of the tastes (Rasas). The sour, sweet, pungent and astringent tastes are determined by acids, starches and sugars, aromatics and tannins. The bitter taste is due to chemicals such as berberine. Salty taste, uncommon in plants, is found in minerals. All the three Doshas (Vaata, Pitta and Kapha) should be treated as primary dynamic physiologic forces.3 The Ayurvedic philosophy describes a unifying hypothesis linking the universe with all living and nonliving matter. Human and plant in the hierarchy of cosmic evolution consist of the same basic matter – Panchbhuutas (earth, water, air, fire and ether). Vaata (material = air + ether), the most powerful force, governs motion and controls cell division, arrangement and differentiation, impulse transmission (including cardiorespiratory and all the higher functions in the brain); movement of body fluids and excreta, parturition and, above all, the mind; it is most relevant to the nervous and musculoskeletal system. Pitta (material = fire) governs metabolism and formation of tissues and waste products; it is most relevant to the digestive and endocrine system. Kapha (material = earth + water) increases cell mass, promotes bonding of tissues, prevents the destruction of tissues, maintains strength and immunity, and determines body growth. The six tastes (Rasas) transmit the properties of Panchbhuutas; each taste has a dosha-related attribute, and drugs in Ayurveda have been classified according to their effect on Dosha. Doshic Prakriti (functional constitution) of the patient is diagnosed and treated by an Ayurvedic physician. Each Dosha has its own characteristic, physiologic and psychologic expressions. Vaata is dry, cold, light and clear. Pitta is hot, light, fluid and clear. Kapha

Ayurvedic pharmacognosy and pharmacology  63 is cold, wet, heavy, cloudy and static. Although Vaata, Pitta and Kapha often colonize in the intestines, stomach and chest, they are ubiquitous.3 Bhagwan Dash, Mahadihassan, Udupa, Asima Chatterjee and Satyesh Chandra Pakrashi also tried to validate the Tridosha hypothesis. According to Bhagwan Dash, Vaayu is responsible for all movements and sensations, including motor actions inside the body. Pitta is responsible for all physio-chemical activities of the body in the form of metabolism, production of heat and energy, and Kapha is the substance which maintains compactness or cohesiveness in the body by providing the fluid matrix to it.4 According to Mahadihassan S. and Udupa K. N., the three morbidities (Doshas) can be easily estimated by biochemical studies. These authors have equated Vaata with acetylcholine liberated by the cerebral cortex and peripheral and parasympathetic nerve endings, Pitta with catecholamines liberated by the hypothalamus, sympathetic nerve endings and adrenal medulla and Kapha with histamine secreted by the brain stem. The drugs, when administered, act by promoting or destroying the respective neurohumors or their precursors.5 These “modified interpretations” indicate that a concerted effort is made to establish the significance of the theory of Tridosha and Rasa, Guna, Veerya, Vipaaka, Prabhaava/Karma in Holistic Ayurveda, which was known to treat the whole system of the individual. But now, all other classical medicines have changed their course, from Holistic and individually tailored treatment to disease-based treatment. If a drug is not produced for millions of people whose Doshic Prakriti (functional constitution) is impossible to identify, the whole edifice may just remain a glorified museum. We must realize that the situation has changed drastically. After imparting instruction to the Ayurvedic students in modern physiology, bacteriology, pathology (and radiology), to ask them to apply the doctrine of Vaata, Pitta and Kapha to explain the causation of disease, might not be convincing to them and might bring nothing but chaos and discord to their mind. We will give only a few examples of pharmacognosy of Ayurvedic herbs to demonstrate the difficulty in understanding the proper profile of a plant drug. (a)  Brahmi (Bacopa monnieri): Rasa: Tikta; Guna: Laghu; Veerya: Ushna; Vipaaka: Katu; Prabhaava: Medhya. Pacifies Kapha-Vaata. (b) Manduukaparni (Centella asiatica): Rasa: Tikta, Anu-rasa: Kashaya; Guna: Laghu; Veerya: Sheeta; Vipaaka: Madhura; Prabhaava: Medhya. Pacifies Kapha-Pitta. (Dravya Guna Vijnana, Vol. II, 1978, by P. V. Sharma.) The Rasa, Guna, Veerya, Vipaaka complex of a number of Ayurvedic herbs, which differ in therapeutic actions, is the same! (a) Haridra (Curcuma longa): Rasa: Tikta, Katu; Guna: Ruksha; Laghu; Veerya: Ushna; Vipaaka: Katu. (b) Tulasi (Ocimum sanctum): Rasa: Katu, Tikta; Guna: Laghu, Ruksha; Veerya: Ushna; Vipaaka: Katu.

64  Legacy and logical steps Even herbs with different therapeutic actions were shown to have the same activity on Vaata, Pitta, and Kapha: (a) Paarsika Yavaani (Hyoscyamus niger): Rasa: Tikta, Katu; Guna: Ruksha; Veerya: Ushna; Vipaaka: Katu. Pacifies Kapha-Vaata. (b) Nirgundi (Vitex negundo): Rasa: Katu, Tikta; Guna: Ruksha, Laghu; Veerya: Ushna; Vipaaka: Katu. Pacifies Kapha-Vaata. (c) Bhringaraaja (Eclipta alba): Rasa: Katu, Tikta; Guna: Laghu, Ruksha; Veerya: Ushna; Vipaaka: Katu. Pacifies Kapha-Vaata. (d) Baakuchi (Psoralia corylifolia): Rasa: Katu, Tikta; Guna: Laghu, Ruksha; Veerya: Ushna; Vipaaka: Katu. Pacifies Kapha-Vaata. (Dravya Guna Vijnana, Vol. II, 1978, by P. V. Sharma) There is a caution even for cow’s milk, if these parameters are followed. India has 37 pure cattle breeds. Five of these, Sahiwal, Gir, Red Sindhi, Tharparkar and Rathi, are known for their milking prowess. A few other breeds, Kankrej, Ongole and Hariana, belong to dual breeds. Following properties have been attributed to cow’s milk in Ayurveda (Yogaratnakara, Varnabheda): Black cow’s milk: Vaatahara (pacifies Vaata). Yellow cow’s milk: Vaata-Pittahara (pacifies Vaata and Pitta). White cow’s milk: Kaphavardhaka (aggravates Kapha). Milk of a cow whose calf is very young: Tridoshakaaraka (aggravates all the three doshas).

An example of data fudging No reference of Carica papaya could be traced in classical texts. Ayurvedic Pharmacopoeia of India included it among Ayurvedic plant drugs as Erandakarkati (synonyms: Madhukarkati, Gopaalakarkati) and supported its constituents by quoting a Sanskrit verse (shloka), in classical style, composed by a contemporary Vaidya, P. V. Sharma. (API, Part I, Vol. VI: 358.) Vaidya P. V. Sharma also defined its Rasa: Katu, Tikta; Guna: Laghu, Ruksha, Tikshna; Veerya: Ushna; Vipaaka: Katu; Karma: Kaphahara, Muutral. Prabhava or Karma was obviously based on ethnomedicine or the doctrine of signatures. The relevance of signatures of plants and animal’s intuition-based selection or rejection of plants was not confined to medieval Europe or traditional Chinese medicine. Charaka also used to get feedback from shepherds who used to take animals to the jungle for grazing. Brahmi pacifies Kapha-Vaata, Manduukaparni Kapha-Pitta. This may indicate that their universal Medhya activity is not linked to Rasa, Guna, Veerya and Vipaaka or Vaata, Pitta and Kapha prakriti of the subject but to their chemical constituents that have now been characterized.

Ayurvedic pharmacognosy and pharmacology 65 Ayurvedic Pharmacopoeia of India still continues to quote Rasa, Guna, Veerya, Vipaaka and Prabhaava, even after admitting that these parameters are not possible to measures by modern scientific methods thus not mandatory (thus are redundant for the Pharmacopoeia). After the sixteenth century, Ayurvedic authors have hardly provided Rasa, Guna, Veerya, Vipaaka and Prabhaava with any new herb adopted by Ayurveda. How can both parameters – Rasa, Guna, Veerya, Vipaaka and Prabhaava and standard test procedures for identity, purity and strength of the herb go side by side? We are now concerned with the standardization of crude herbs, extracts, quality of finished products with the modern analytical tools like high-performance liquid chromatography (HPLC), high-performance thin-layer liquid chromatography (HPTLC) and gas chromatography (GC), and estimation of functional groups, marker compounds, and estimation of biologically active compounds.

References 1 Chatterjee A, Satyesh Chandra Pakrashi, Basic concepts of ayurveda, Treatise on Indian Medicinal Plants, I, 1999. 2 Balch PA, Prescription for Herbal Healing, 2002. 3 Chopra A and Vijay V. Doiphode, Ayurvedic medicine, core concept, therapeutic principles and current relevance, Medical Clinics of North America, January 2002, 86(1). 4 Dash B, Lilitesh Kashyap, Materia Medica of Ayurveda, Concept Publishing Company, New Delhi-110 015, 1980. 5 Mahadihassan S, A  comparative study of early system of Indian cosmology and Tridosha doctrine, Ind J Hist Sci, 1980; A scientific interpretation of Tridosha doctrine of humorology, Anc Sci Life, 1986, 6(1); The Tridosha doctrine traced to breath as soul, Anc Sci Life, 1989, 9(1). Udupa K.N, Ayurveda for the service of common man, Anc Sci Life, 1983, 2(3). Cited in Ayurvedic Drugs and their Plant Sources, Sivarajan and Balachandran.

7 How classical procedures lost ground

In Ayurveda, Bhaishaja-Kalpana (Pharmaceutical preparation procedures) is the next step after the herb is identified and collected. Mostly fresh herbs were used until the sixteenth century. Now, we find many important plants, stored after collection, lose their medicinal properties within one year (six months to one year). They hardly reach the consumer before the expiry period.1 Hemidesmus indicus (Saarivaa), Tinospra cordifolia (Guduchi), Adhatoda visica (Aduusaa), Abroma augusta (Ulatkambal), Sphaeranthus indicus (Mundi), Ruta graveolens (Sudaab), Lavandula stoechas (Ustukhuddus) retain their potency up to 6 months. Gymnema sylvestra (Gurmaar), Solanum indicum (Kantkari varieties), Nardostachys jatamansi (Jatamansi), Valeriana jatamansi (Tagar), Eugenia jambolana (Jaamun seeds), Clerodendron serratum (Bhaarangi), Convolvulus pluricaulis (Shankhpushpi), Ashwagandha, Emblica officinalis (Aamalaki), Curculigo orchioides (Black Musali), Asparagus adscendens (White Musali), Pueraria tuberosa (Vidarikand), Argyreia speciosa (Bidhaaraa), Asparagus racemosus (Shataavari), Blepharis edulis (Utangan), Abutilon indicum (Atibalaa), Sida cordifolia (Balaa), Boerhaavia diffusa (Punarnavaa), Chicorium intybus (Kasni), Holarrhena antidysenterica (Kutaja), Saussurea lappa (Kushtha), Swertia chirata (Chirayitaa), Acorus calamus (Vacha), Centella asiatica (Manduukaparni), Bacopa monnieri (Braahmi) and Tribulus terrestris (Gokhru) are some such herbs that start deteriorating before they are delivered to herbal pharmacies. Collection of herbs is also not being done scientifically. For example, annual plants should be collected before the ripening of seeds, biennials during spring and perennials during autumn. Twigs must be of the first year’s growth and roots, leaves and bark should be collected in the cold, hot and rainy seasons, respectively. Emblica officinalis (Aamalaki) should be collected when the fruits are fully ripe, while tons and tons of raw Aamalaki are being used in Chyavanpraasha. The consumer is not aware of all these aspects. Commercial firms and professional herb collectors never follow these instructions. After collection herbs are dumped in bundles or in gunny bags, exposing them to sun, rain, and dust, which adversely affect their therapeutic effectiveness and their active principles get deteriorated. Thus herbal medicines are prepared in total disregard of standard methods. This affected the shelf-life of Ayurvedic drugs. Ayurvedic Churna (powders) should be used within two months.2 If kept in tight containers, they can retain

68  Legacy and logical steps potency for one year.3 Kwaaath churna retains potency only for two months. Gutika vati, pills of herbal composition, retain their potency for 12 months. Avaleha, Ghrita and Taila retain their potency for 16 months. Aasavas and Arishtas can be kept for any length of time in well-closed bottles or jars.4 Now we go back to 2000 bc and try to find out how herbal medicines were processed and how they were impregnated for the preservation of their medicinal properties. Charaka in Charaka Samhita, Vimansthan 7, 22, advised the use of sukshma churna (micro-pulverized powder). The process of impregnating the herb with its own juice or decoction has also been described (7, 16). Jarjarikaran (trituration) of the micro-pulverized powder is included in Chikitsasthan, 26, 244. According to Sushruta, the churna (powder) of essential parts of the plant belonging to a group, is saturated for 7 days with the equal quantity of decoction of plants belonging to a separate group but having same properties, then only the final product is to be accepted as the churna with required medicinal properties. (Sushruta Samhita, Chikitsasthan, 10, 3; 12, 10). At this point, we would like to remember the seer who gave the Ayurvedic dictum: mardanam gunavardhanam (trituration accentuates and hidden medicinal properties of the herb). And we would like to highlight the (conveniently forgotten) formulation of Chatusshashti Prahari Pippali (Ayurveda Sarsangriha, Kasa Chikitsa Adhikar), wherein it has been advised that Piper longum should be triturated (in its own decoction) for 64 prahars (192 hours); (for 72 hours if the triturating machine is run by an electric motor). Thus, impregnating and triturating the herb was of utmost importance in the mind of the physician. It was important to ensure that the herb, as soon as administered, is absorbed quickly at the cell level and enters the body as a dynamic agent. According to Sushruta, subtlety is the quality by virtue of which a drug can penetrate into the smallest capillary and channels of the biological system (Sushruta Samhita, Sutrasthan 46, 158). This theory has also been propounded in Bhavaprakash (ad 1600). Hemaadri elaborated it in his commentary on the ad 700 text of Ashtanghridaya of Vagbhata. In Ayurveda, impregnating the herb and its trituration were supposed to go together. The process of impregnating the herb was called bhavana. Out of 100g micropulverized powder, 20 g powder was boiled in 4 parts of water till 3 parts of the water evaporate. This decoction was mixed well with the remaining powder and after drying it at 50°c, put in a porcelain mortar and trituration is done for 6 to 8 hours. This process was repeated six times. After seven bhavanas the herb is transformed into a rasayana (tonic or a potent medicinal agent). It is a matter of great concern that we slept over all these basic principles and the Ayurvedic system of medicine remained totally neglected for about three centuries. The herbal trade remained dominated by unscrupulous businessmen, semiliterate religious preachers, and priests. The unorganized sector had a heyday. The market remained flooded with substandard medicines.

How classical procedures lost ground  69 The second phase of jarjarikaran came in 1918, when J  & J DeChane of Hyderabad introduced micro-herbal medicines and incorporated the theory of rasayana in the manufacturing process, reviving the process enunciated in samhitas. DeChane produced herbal medicines by micro-pulverizing and “atomizing” the herbs so that the medicine gets absorbed from the mucous membrane into the system. The dosage of “atomized” medicines was surprisingly low when compared to that of traditional compounds which ranges from 4 g to 15 g. In an experiment, DeChane herbo-mineral medicines were further triturated homeopathically. It was found that Albosang (a tonic for general debility, containing Ashwagandha) was more effective in 3× potency than in an approximate dose of 160 mg. During the 1950s, Sundarrao Bhaskarji Vaidya, a medical practitioner from Mumbai, coined the term “Sukshma Ayurvediya Aushadhi.” He converted the medicine into sukhma medicine by diluting it in water and reduced the dose substantially. Vaidya Panchanan Gangadhar Shastri Gune, Ahmadnagar (1950), and Ayurvedacharya A. V. Astikar, Nasik (1966), prepared sukshma suvarna bhasma by triturating suvarna bhasma and milk-sugar taken in 1:10 ratio. 0.01 sukshma suvarna bhasma was as effective as 1 gm of suvarna bhasma. Similarly, sukshma Chandrakala, sukshma Ashtamurti, sukshma Vasantkusumakar, and sukshma Samirapannaga were prepared and tested. Sukshma Samirapannaga was devoid of side-effects which are usually produced by the drug. In Calcutta, Dr. Ghosh S. C. made a combination of medicinal herbs with the alcohol-water mixture, medicated the sugar globules with the combination and treated various ailments. When used singly, a dose of 10–15 ml Ocimum sanctum (Tulasi) juice is required, but when the same was used in combination with the alcohol-water mixture, 2–3 drops were sufficient to produce the same result. During recent years Kulkarni P. H., Institute of Indian Medicine, Pune, and Ranjana Y Abhang, Jnana Prabodhini Institute of Research in Ayurvedic Medicine, Pune, tried to establish the theory of Herbal Microcosm through various clinical trials. In a clinical trial by Swarge J. M. and Kulkarni P. H., juice of Aloe indica and Adhatoda vasica was mixed in a ratio of 3:2 in an equal amount of alcohol. The tincture was added to three times its weight of sugar globules. Out of 100 patients treated with this drug, 90 were relieved completely of their complaints of cough and cold.5 Kulkarni P. H. prescribed Bhuu-nimbaadi tablets (1 tablet of 250 mg three times a day) for 21 days to 50 patients suffering from amlapitta (acid dyspeptic affections). Excellent response was observed in 25 cases, while a good and fair response was seen in 22 and 3 cases, respectively. There were no side-effects. The drug was prepared by boiling equal quantities of Swertia chirata, Azadirachta indica, Terminalia chebula, T.belerica, Phyllanthus emblica, Trichosanthes dioica, Adhatoda vasica, Tinospora cordifolia, Fumaria parviflora and Eclipta alba in water.6 Ashokarishta and Lodhrasava mixture in subtle (sukshma) form (4 globules three times a day) was given to patients suffering from gynecological diseases. 92% of the patients showed excellent results. The drugs were found free of side-effects.7

70  Legacy and logical steps Vasosin, consisting of ingredients like Adhatoda vasica (Vasaka), Solanum xanthocarpum (Kantakari), Punica granatum (Daadim twak), Piper longum (Pippli) and Cinnamomum cassia (Daalchini oil), was tried in subtle form (V-3x globules) on 50 patients suffering from cough and breathlessness. V-3x globules were given three times a day for 7 days. The result was excellent in 80% of cases.7 Subtle (sukshma) Triphala guggul (TG-3x), consisting of Terminalia belerica (Baheraa), T. chebula (Haritaki), Emblica officinalis (Aamalaki) and Commiphora mukul gum-resin (Guggulu), was tried on 28 patients of obesity. Four globules, three times a day were orally administered to all patients for a period of 3 months. A significant weight loss was observed without any side-effect.7 A subtle form of a mixture of Khadirarishta, Mahamanjishthadi kwath and Sarivadyasava (four 3× globules three times a day) was given to patients suffering from various skin disorders like eczema, pruritus, acne, and vitiligo. 26% of patients got relief in 30 days and 56% needed 90 days for relief.7 Ranjana Y. Abhang’s first document on “Ayurveda and Sukshma Medicine” appeared in 1985,8 1987, and another document “The Pharmacy of Sukshma Medicines” in 1987.9 In 1992 and 1993 Ranjana carried out double-blind controlled studies to evaluate the effect of Centella asiatica (Manduukaparni) in 3× potency (1 disket of sugar and 1 drop of tincture of 3× Centella asiatica made one dose, and four doses were given every day). She also tried Bacopa monierri (Braahmi) on children having 55–90 and 100 IQ, respectively. There was a significant improvement in intelligence and performance due to the administration of the sukshma medicine.10 Jnana Prabodhni Institute of Research in Ayurvedic Medicines, Pune, prepared sukshma medicines by combining the herb with alcohol and by triturating it in milk-sugar. Piper nigrum (Maricha), Azadirachta indica (Nimba), Embelia ribes (Vidanga), Tribulus terrestris (Gokhru), Solanum xanthocarpum (Kantakaari), Iris germanica (Pushkarmuula), Hemidesmus indicus (Saarivaa), Ricinus communis (Eranda), Carum copticum (Ajmoda), Saraca indica (Ashoka), Herpestis monniera (Braahmi) and Phyllanthus emblica (Aamalaki) were prescribed, combined with alcohol, following Charaka Samhita. Sukshma suvarna bhasma, sukshma abhraka bhasma, sukshma praval pishti, sukshma mahalakshmivilas rasa, sukshma shwaschintamani rasa and sukshma vatachintamani rasa were prepared by trituration in milk-sugar in a 1:100 ratio. Only the form of the medicine is changed, but the action remains unaltered and could be used according to the basic principles of Ayurveda. These sukshma medicines were put on clinical trials in the Jnana Prabodhini Institute’s Comprehensive Health Care Scheme in 137 villages of the Shivaganga and Gunjavani river valley, about 25 km away from Pune. The sukshma medicines were found effective and devoid of side-effects and reactions, suitable for a delicate constitution. (Ranjana Y Ahhang, Journal Res Edu Indian Med, 1985, Vol IV, 59–66.) The method of triturating and tableting the herbal compounds was the same, as is being followed by homoeopathic pharmacies. Here a problem arose. Absolute

How classical procedures lost ground  71 conversion of herbal contents to a homeopathic medicine was rejected by the consumers. Thus, sukshm Ayurveda collapsed. Ayurveda, as usual, maintained its eternal and holy image, while most of the old, essential procedures, laid down by great visionaries, were mutilated by none other than the protagonists of Ayurveda. In the next chapter, we will discuss the strategy scientists are adopting to make Ayurveda a progressive disease-based system.

References   1 Singh R, Vanaushadhi Nidarshika, 1983.  2 Pharmacopoeial Standards of Ayurvedic Formulations, CCRAS, 1987.   3 Ayurvedic Formulary of India, second revised edn, 2003.   4 Pharmacological Standards for Ayurvedic Formulations, Central Council for Research in Ayurveda and Siddha, New Delhi, 1987: 445, 450, 457.   5 Deerghayu international, 1990, 6(3): 5.   6 Deerghayu international, 1995, 11–01(41): 24–26.   7 Kulkarni PH, ed, Ayurved Research Papers, II, 1995.   8 Journal of Res Edu Indian Med, IV: 59–66.   9 Deerghayu international, 1987, III–2, 18–22. 10 Journal of Research in Ayurveda and Siddha, 1992, 13(1–2): 35–47; ibid, 1993, 14(1–2): 10–24.

8 Identification of proper herbs A new scientific route

• •

• • • • •

•

•

In the Ayurvedic Formulary of India, herbal components have been reproduced from classical texts by Sanskrit names A number of Sanskrit names of the plants, over the course of time, have been linked to different plants in different parts of India. The Sanskrit name remains the same, the name of the classical drug also remains the same, while a different herb, equated with a different botanical name, having different chemical constituents, is used. Thus the classical name of the herb, equated with different botanical names, will exhibit different biological activities. Extinct herbs have been retained in compound formulations; substitute herbs have been permitted without comparing their chemical constituents and biological activity. Only revalidated herbs by clinical or experimental trials are to be retained. Traditional uses should not be taken as the final word. Those found redundant should be discarded. Properties of compound formulations are to be revised in the present context (as the drug is to be used today, not 3,000 years back). Instead of Indication Pluralism, the specific curative property is to be retained. A number of synonyms of botanical names have been Sanskritized. For example, Monochoria vaginalis has been Sanskritized as Bhaga-patra (Bhaga = vagina); Abroma Augusta as Pishaacha-kaarpaasa (= Devil’s Cotton); Equisetum arvense as Aswapuchh (= Horse tail); Dictamnus albus as Agni-jwaalaa (= Gas Plant). Nonclassical Sanskritized names have been assigned to a number of plants. For example, Vrakkaphala, Kaajutaka for Anacardium occidentale (Kaaju); Ganagaatra for Annona squamosal (custard apple); Raktagunjana for Beta vulgaris (beet root); Erandakarkati for Carica papaya (papaya); Rakta-vrantaaka for Lycopersicon esculentum (tomato); Granjana for Daucus carota (carrot). Sanskrit verses (shlokas) have been composed by contemporary vaidyas and quoted in the Ayurvedic Pharmacopoeia of India for giving a classical touch to a number of new botanical drugs as if it is religious conversion. Sanskrit shloka on Erandakarkati (Carica papaya) was composed by Prof.

74  Legacy and logical steps P. V. Sharma (API, Vol. VI); Erandakarkati is itself a nonclassical Sanskritized name of common Indian name Papitaa or papaya. Shlokas on Naahi (Enicostemma axillare, Indian Gentiana); Parnya yavani leaf (Coleus amboinicus, Pattharchuur); Patrasnuhi (Euphorbia nivulia); Takkola (Illicium verum, star anise); Vajrranna (Pennisetum typhoides, pearl millet), composed by contemporary scholars, are also quoted in API, Vol. VI. Such shlokas as a part of a Pharmacopoeia carry a pseudosanctity and are proving a more unethical trend than other adulterants. Now, we give 85 examples of the complexity of botanical drugs of Ayurvedic Pharmacopoeia of India. This will prove that effective and universally acceptable herbal drugs are possible only when validated botanicals, instead of more than ambiguous classical Ayurvedic text names, are used. The age of the Sanskrit medium was over more than three centuries back. Following list in by Botanical names, alphabetically:

Taalisha Taalisha still remains a drug of disputed source. Abies webbiana and Taxus wallichiana both are known as Taalisha patra. Two samples of needles and twigs from two different locations of central Nepal gave alpha-pinene 3.0, 10.3; fascile 3.5, 9.3; beta-pinene 5.1, 3.3; limonene 6.1, 2.3; bornyl acetate 4.2, 15.5; and carvone 5.8, 0.75%, respectively. Leaves obtained from Sikkim-Himalayan region gave a bioflavonoid, abiesin; two glycosides, methylbetuloside, and betuloside; n-triacontanol and beta-sitosterol. A new alkaloid, 1-(4’ methoxyphenyl)-aziridine was isolated. Svarna-taali (yellow-flowered sp. of rhododendron?) was used as a substitute for Taalisha patra during the sixteenth century. Leaves of Rhododendron anthopogon D.Don., R. campanulatum D.Don. And R. lepidotum Wall. are also passed on as Taalisha patra. A sample of Rhododendron anthopogon leaves from Pindari (at 4500m altitude) contained quercetin, myricetin, taxifolin, kaempferol, kaempferol-4’ methyl ether, kaempferol-3-O-beta-D-glucopyranoside, and quercetin 3-O-alpha-L-rhamnopyranoside. National Formulary of Unani Medicine equated Zarnab (Taalisapattar) with Flacourtia cataphracta, also with Cinnamomum tamala Nees. Flacourtia cataphracta leaf extracts gave beta-amyrin, alpha-amyrin, a mixture of beta-sitosterol and stigmasterol (from both leaves and stem bark); beta-sitosterol-3–0-beta-Dglucoside, 5–0-caffeoylquinic acid (from leaves). Leaves yield an essential oil (0.2–0.6%). Cinnamomum tamala Nees leaf oil resembles C. zeylanicum leaf oil which contains d-alpha-phellandrene and 78% eugenol. A sample of oil from Assam (yield 2.0%) has been found to contain as high as 80–85% eugenol (13.3 and 1.0% from Kumaun hills and Joginder Nagar, respectively. (Clove contains 60–90% eugenol. Cinnamomum tamala leaves belong to two chemotypes: eugenol type and cinnamic aldehyde type. Eugenol type trees are found in Kashmir, Tehri Garhwal, other tropical and subtropical Himalayan areas. Khasi and Jaintia hills and West Bengal. Eugenol type trees occur more widely than cinnamic aldehyde type.

Identification of proper herbs  75

Ativishaa, Atis Daughter tubers of Aconitum heterophyllum Wall. ex Royle constitutes the main drug, Atis root. Mother tubers are considered inferior. The root yielded 0.79% of total alkaloids; atisine, heterotisine, hestisine, heterophyllisine, heterophylline, heterophyllidine, atidine, hetidine, benzoylheterotisine, F-dihydroatisine, and hetisinone; atisinol closely related to atisine (Atisine yield 0.4%). Commercial Atis (Patis) of the market is not the root of A. heterophyllum. The market drug is adulterated with the roots of Chaerophyllum villosum Wall. and Aconitum kashmiricum Stapf ex Coventry.

Vacha Acorus calamus Linn. is the official drug. Roots of Alpinia galanga Willd, known as Sugandh Vachaa, are sometimes supplied as Vach. Commercial material of North-east regions is adulterated with Costus speciosus (Koen) Sims. There is a second variety of Vachaa called Shveta Vachaa or Haimavati Vachaa. This is provisionally equated with Acorus gramineus Soland or Iris germanica Linn. and Paris polyphylla Sm. Baal Vach (Paris polyphylla); Malaya Vachaa (Alpinia galanga); Dweepaantara Vachaa (Smilax china Linn.) Four chemo-types of calamus are used in herbal medicine: Type I: Acorus calamus L. var. americanus, a diploid American variety; Type II: var. vulgaris L. (var. calamus), a European triploid; Type III and IV: var. augustatus Bess. And var. versus L., subtropical tetraploids. Beta-asarone in different chemo-types: In type I, beta-asarone and other phenylpropanoids are absent. It is superior in spasmolytic activity to other types. In type II, III and IV, the major constituent is usually beta-asarone (isoasarone) up to 96%. Indian calamus oil contains up to 82% asarone and its beta-isomer. (Beta-asarone is carcinogenic in animal studies.) The American variety is isoasarone free. European form contains less than 10% isoasarone; others contain up to 96% beta-isoasarone in the volatile oil.

Vaasaa Vaasaa is equated with Adhatoda vasica Nees (Syns. A. zeylanica Medic., Justicia adhatoda Linn.). A. beddomei C. B. Clarke, used in Kerala, also contains vasicine and vasicinone. It is considered to be more active than A. zeylanica.

Hamspaadi Hamspaadi is equated with Adiantum lunulatum Burm., Adiantum philippenese Linn. syn. A. lunulatum Burm. Fonds gave hopane-type, isohopane-type, neohopane-type, norhopane-type and fernane-type triterpenoids. The market drug

76  Legacy and logical steps consists commonly of Adiantum venustum Don. And/or A. capillus-veneris Linn. The genuine material is scarce. In Kerala, Desmodium triflorum (L.) DC. Is used as Hamsapadi. Vitis pedata Vahl is also known as Hamsapadi. In Tamil Nadu, Coldenia procumbens Linn. is the source of Hamsapadi. Ayurvedic Pharmacopoeia of India (Part I, Vol. VI) equated A. capillus-veneris Linn. with Bijapatra, which could not be found in any classical text. A. capillusveneris Linn. is known as Hamsraaj in folk medicine. The market drug is adulterated with Adiantum venustum Don.

Paashaanabheda Bergenia ciliata (Haw.) Sternb. Syn. Bergenia ligulata (Wall.) Engl. (Saxifragaceae) is the Indian pharmacopoeial name of Paashanabheda, Aerva lanata (Linn.) Juss. (Fam. Amaranthaceae) is used in Tamil Nadu, Rotula aquatica Lour. (Boraginaceae) and Homonoia riparia Lour. Syn. Adelia neriifolia Roth. (Euphorbiaceae) are used in Kerala. In Kerala, Aerva lanata is used as Bhadra.

Sthuula-Aila Sthuula-aila is the pharmacopoeial name equated with Amomum subulatum Roxb. In Kerala, fruits of Pucedanum grande C. B. Clarke are used as Sthuula-aila.

Dhava Dhava is the pharmacopoeial name equated with Anogeissus latifolia Wall. The Indian Medical Practitioners’ Cooperative Stores Ltd. (IMPCOPS), Chennai, is using Syzygium hemisphericum (Walp.) Alston, syn. Eugenia hemispherical Wight, fam. Myrtaceae, as Dhava since 1968. IMPCOPS drug sources were reviewed by the botanist, S. Usman Ali of The Captain Srinivas Murti Research Institute, Chennai. Syzygium hemisphericum (Walp.) Alston is found in South India, Western Ghats South, Maharashtra Sahyadri, Sri Lanka, up to 1,400m, also in East Indies, Malaya, Pacific Islands, Philippines (related species of Eugenia jambos). In Tamil Nadu, White Rose Apple Wood, Syzygium hemisphericum, known as Vennavalmaram, is used as Dhava, while A. latifolia is in abundance in Madurai, Tirunelveli and Tamil Nadu, also in Andhra Pradesh, Karnataka, and Kerala. Heartwoods of both (A. latifolia and S. hemisphericum), were used for preparing cart wheels, which was the identification source of Dhava. According to Ayurvedic Pharmacopoeia of India (Part I, Vol. VI), two varieties are mentioned in classical texts: Dhava of Charak: Madhura-tvaka, Madhuravalkala, Vaka-vriksha (Crane Tree). Dhava of Dhanvantari Nighantu and Raaja Nighantu (twelfth to fourteenth century): tikta (bitter) (API, VI).

Identification of proper herbs  77

Chandaa Chandaa is the pharmacopoeial name equated with Angelica archangelica Linn. In Kerala, Costus specious (Koenig) Smith is used for Chandaa and Choraka (the white and yellow varieties), while Choraka is the pharmacopoeial name equated with Angelica glauca Edgew.

Agaru Agaru is the pharmacopoeial name equated with Aquillaria agallocha Roxb. Syn. A. malaccensis Lam. In South India, Vepris bilocularis Engl. And Anaphalis neelgeeriana DC. Are used as Krishnaaguru and Dysoxylum labaricum Bedd. Ex Hiern as Sveta Aguru. Agarwood or Eaglewood of commerce is derived from the fungus-infected tree through wounds caused by species of Aspergillus, Fusarium, and Penicillium, also by some of Fungi linperfecti.

Vriddhadaaru Vriddhadaaru is the pharmacopoeial name equated with Argyreia nervosa (Burm. f.) Boj., syn. A. speciosa Sweet. Roots of Ipomoea pes-caprae (L.) Sw., syn. I. biloba Chois. And I. petaloidea Chois. are common substitutes in South and North-west India, respectively.

Naakuli In Ayurvedic Formulary of India, Part 1, page 320, Naakuli is equated with Aristolochia indica Linn. Ishvari is the pharmacopoeial name equated with Aristolochia indica Linn. Sarpagandhaa (syn. Naakuli) is also the pharmacopoeial name equated with Rauvolfia serpentina. In Ayurvedic Pharmacopoeia of India. Part I, Vo. III, Aristolochia indica Linn. is equated with Gandganaakuli. In India, Rauvolfia tetraphyla Linn. is used as a substitute when Rauvolfia serpentina is not available. Roots of R. densifolia Benth. and R. micrantha Hook. f. are sometimes found mixed in Kerala and Western India.

Dvipaantara Damanaka Dvipaantara Damanaka is the pharmacopoeial name equated with Artemisia absinthium Linn. The original name is Afsanteen of Unani medicine and Wormwood of Western herbal. Damanaka was an aromatic shrub. It was a constituent of Mahasugandhi Taila of Bhavaprakasha. Aeq-e-Afsanteen of Unani medicine is used in hepatitis, while Damanaka was used as a massage oil ingredient for reducing obesity and skin diseases.

78  Legacy and logical steps

Shataavari Shataavari is the pharmacopoeial name equated with Asparagus recemosus Willd. Mahaashataavari, mentioned in classical texts, is equated with A. sarmentosus Linn. Roots of A. sarmentosus are more commonly used as a substitute for Shataavari in South India. The trade procures three varieties as Shataavari: var. racemosus, common in plains and upper ghats in Hassan (Karnataka); var. gavanika Miq., distributed in Deccan peninsula, Karnataka, Gujarat, and Madhya Pradesh; var. subacerosa Baker distributed in Sikkim at altitudes of 300–1200m.

Braahmi Braahmi is the pharmacopoeial name equated with Bacopa monnieri (Linn.) Wettst., syn. Herpestis monnieria (Linn.) H. B. and K. Centella asiatica (L.) Urban, syn. Hydrocotyle asiatica Linn. and its two other species, H. rotundifolia Roxb. And H. javanica Thumb is being used as Braahmi in some parts of India. These have been identified as Manduukaparni.

Danti Danti is the pharmacopoeial name equated with Baliospermum montanum Muell.Arg. Croton tiglium Linn. is used as a substitute in Tamil Nadu. Dantimuula is sold as Danti, Hastidanti, and Dravanti. Hastidanti is equated with Croton oblongifolius Roxb. And Dravanti with Jatropha curcas Linn. Roots of Ricinus communis Linn. is a common adulterant.

Sahachara Sahachara is the pharmacopoeial name equated with Barleria prionitis Linn. In Kerala, other Acanthaceae spp. are used as Sahachara: Nilgirianthus ciliatus (Nees) Bremek., Ecbolium viride (Forsk.) Alston and Justicia betonica Linn.

Daaruharidra Daaruharidra is the pharmacopoeial name equated with Berberis aristata DC. B. aristata Hook. f. & Thomson (non DC.), B. asiatica Roxb., B. chitria Lindl. Are also used as Daaruharidra. The stem bark of Coscinium fenestratum Colebr. is used as a substitute in Kerala and Tamil Nadu, and is considered better thorn Berberis. It is Known as Ceylon Calamba or False Calamba. Coscinum fenestratum contains berberine up to 3.5%; while Berberis aristata DC. contains 2.76% berberine. Root and root bark of B. lycium Royle is the usual adulterant.

Identification of proper herbs  79

Rakta Punarnavaa Rakta Punarnavaa is the pharmacopoeial name equated with Boerhaavia diffusa Linn. Trianthema portulacastrum Linn. is used as a substitute in the South, and sold as Sveta punarnavaa. Trianthema portulacastrum is also equated with Kathilla (a synonym of Punarnavaa). The white variety of Punarnavaa is svetamuulaa (having white roots), Rakta punarnavaa is raktapushpaa (having red flowers). Species with red and white flowers exist in both, Boerhavia and Trianthema spp.

Shallaki Shallaki is the pharmacopoeial name equated with Boswellia serrata Roxb. Indian material is found adulterated with the gum of Garuga pennata Roxb. Substantial quantities of the oleo-gum-resin are imported from Gulf countries and North Africa, obtained from B. carteri Birdw. And B. frereana Birdw.

Karanja Karanja is the pharmacopoeial name equated with Pongamia pinnata Pierre. Three plant species are being used as Karanja because their flowers impart color to the water. Pongamia pinnata Pierre, a tree, is equated with Karanja, Karanjaka, Naktamaala (AFI synonyms) and Udakirya. Holoptelea integrifolia (Roxb.) Planch., also a tree, is equated with Chirbilva, Putika, Putikaranja (AFI synonyms) and Prakiryaa; Caesalpinia bonduc (L.) Roxb. Dandy & Exell., a shrub, has been identified as Lataakaranja (AFI synonym), Kantaki karanja and Karanji.

Priyangu Priyangu is the pharmacopoeial name equated with Callicarpa macrophylla Vahl. Aromatic buds of C. macrophylla are accepted by many scholars as Phool Priyangu and while aromatic kernels of Prunus mahaleb Linn. fruits as Gandha Priyangu. Fruits of Aglaia roxburghiana Miq. are also sold in North India as Priyangu. In Kerala, dried male flowers of Myristica fragrans Houtt. are sold as Priyangu; flower buds of M. malabarica Lam. and Orchrocarpus longifolius Benth.  & Hook. are sold in Chennai (Tamil Nadu) and fruits of Zanthoxylum budrunga Wall. in Kerala.

Paathaa Paathaa is the pharmacopoeial name equated with Cissampelos pareira Linn. The root is sometimes found adulterated with the roots of Stephania glabra Hk. f. Bigger var. (Raaja-paathaa is equated with Stephania hernandifolia Walp. and Cyclea peltata (Lamk.) Hook. f. & Thoms. True Pareira Brava is derived either

80  Legacy and logical steps from Chondrodendron tomentosum Ruiz & Pav. (a native of Peru and Brazil) or from C. platyphyllum Miers. In South India, roots of Cyclea peltata Diel are considered to be the true source of Paathaa.

Bhaarangi Bhaarangi is the pharmacopoeial name equated with Clerodendrum serratum (Linn.) Moon. None of the Clerodendrum spp. are the sources of what is available as Bhaarangi in the market. It has been found that stem bark of Elaeodendron glaucum Pers. and Gardenia turgida Roxb. or Picrasma quassioides Benn. are being used as Bhaarangi since long. Particularly in eastern India, the bark of Picrasma quassiodes is sold as Bhaarangi. (Clerodendrum serratum and Elaeodendron glaucum: distributed throughout India, common in southern and eastern India. Gardenia turgida: Bihar, Maharashtra, Karnataka, Tamil Nadu. Picrasma quassioides: North-eastern India.)

Aparaajitaa Aparaajitaa is the pharmacopoeial name equated with Clitoria ternatea Linn. The market samples of Shankhapushpi from South India, consisted largely of C. ternatea, while from other regions contained dried herb of Canscora decussata Roem. & Schult., Convolvulus microphyllus Sieb. ex Spreng. (syn. C. pluricaulis Choisy), Evolvulus alsinoides L. and Lavendula bipinnata Kuntze (syn. L. burmanii Benth.). Kerala physicians do not discriminate between Aparaajitaa and Shankhapushpi and use Clitoria ternatea in place of both. (Visnnukraantaa, a blue-flowered variety of Shankhapushpi, is treated as a synonym of Aparaajitaa in Bhavaprakasha, sixteenth century.)

Gandira Gandira is the pharmacopoeial name equated with Coleus forskohlii Briq. syn. C, barbatus Benth., Plectranthus barbatus Andr. There is great confusion regarding the identity of Gandira. Gandira may be cited as an example where the wrong use of synonyms clouds the correct identity of a drug plant. Gandira is mentioned in Sushrut Samhita (56, 46, 247). According to Sushrut, it supresses stool and urine, Ayurvedic Pharmacopoeia also listed muutrabandh and malabandh among its properties, Indian National Academy equated Gandira with Cucumus utilatissimus Linn. In Kerala, Cayratia carnosa Gaggnep. is reported as being used as Gandira. Two varieties of Gandira have been suggested by Ayurvedic scholars, sthalaja (nonaqautic) and jalaja (aquatic). Nonaquatic variety has been suggested as Coleus ambroinicus Lour. or C. barbatus Benth. (as mint species) and aquatic variety as Achyranthes acquatica Br. But none of the property of C. forskohlii matches with the Ayurvedic sources so far suggested. C. forskohlii is the source of forskolin (0.1% on dry weight basis). In none of the other Coleus spp. (C. amboinicus, C. scutellarioides, C. coninus, C. malabaricus,

Identification of proper herbs  81 and C. rotundifollius) forskolin could be detected at levels down to 1 x 10−4% on dry wt. of plant material.

Shankhapushpi Shankhpushpi is the pharmacopoeial name equated with Convolvulus pluricaulis Convolvulus pluricaulis is used as Shankhapushpi in North India; Clitoria ternatea Linn. and Canscora decussata Schult. in South India. Canscora decussata and Lavendula bipinnata O. Ktze. are used as Shankhapushpi in Bengal. Evolvulus alsinoides is treated as Vishnukraantaa, Vishnukraandi, Vishnugandhi of Siddha medicine.

Kaaliyaka Kaaliyaka is the pharmacopoeial name equated with Coscinium fenestratum (Gaertn.) Colebr. while Pita Chandan is the official name in Ayurvedic Formulary of India. Stem bark of C. fenestratum is used as a substitute of Daaruharidra (Berberis aristata) DC. in Tamil Nadu and Kerala.

Kebuka Kebuka is the pharmacopoeial name equated with Costus speciosus (Koerning ex Retz.) Smith. Not to be confused with Saussurea lappa C. B. Clarke. In the market, dried pieces of Kebuka root tuber are sold as Kalihaari (Gloriosa superba Linn.). Laangli is the pharmacopoeial name equated with Gloriosa superba Linn.

Kumkuma Kumkuma is the pharmacopoeial name equated with Crocus sativus Linn. During the classical period, the drug sources were Mimusops elengi Linn. or Mesua ferrea Linn. The heartwood of both is dark red or deep reddish brown (color of rudhir). Flower buds of Mesua ferrea contain a yellow coloring matter, flowers yield a reddish brown volatile oil. Kashmiraj was mentioned for the first time by Vagbhata (sixth–seventh century). Chakrapaani (eleventh century) interpreted Rudhira of Charaka as Kumkuma. Kesara and Keshara are difficult to define in Ayurvedic literature. Kesharaahva, in most cases, has been treated as a synonym of Naagakesara (stamens of Mesua ferrea) and where preceded by the Padma or its synonyms, as only Padmakesara or as Padma and kesara both. Kesara has also been interpreted as Bakul (Mimusops elengi). It appears (after analysis of classical references) that Kesara was never been used in the texts as a synonym of Kashmiraja kesara). In Ayurvedic Formulary of India, Part I, Second Edn. (page 317), Keshara and Kesara are synonyms of Naagakeshara equated with Mesua ferrea, while Kumkuma (page 318) is equated with Crocus sativus, and there is no entry in

82  Legacy and logical steps the column for the official name. In Ayurvedic Formulary of India, Part II, First Revised Edn., Kumkuma, and Keshara are the synonym, equated with Crocus sativus Linn. (page 330); while Naagakeshara, Naagakesara, and Kesara are synonyms, equated with Mesua ferrea (page 334).

Krishna Saarivaa, Shveta Saariva Krishna Saariva is the pharmacopoeial name equated with Cryptolepsis buchanani Roem. & Schult. Black stem pieces of C. buchanani are used and sold in Uttar Pradesh market as Anantamuula. Ichnocarpus frutescens R. Br. is used as Krishna Saarivaa and Decalepis hamiltonii Wight & Arn. As Saariva in South India. Ichnocarpus frutescens is also used as the black variety of Saarivaa in Bengal. Two varieties of Saarivaa are mentioned in Ayurvedic texts: Shveta (white) and Krishna (black). Shveta Saariva is the pharmacopoeial name equated with Hemisdesmus indicus (L.) R. Br. Tylophora fassciculata Ham. Ex Wight and Decalepis hemiltonii have been suggested by Ayurvedic scholars as to the black and white varieties.

Taalmuuli Taalmuuli is the pharmacopoeial name equated with Curculigo orchioides Gaertn. In Kerala, in practice, C. orchioides is used for both, the black and white variety of Mushali (known as Nilappana in Malayalam). A black variety of Mushali is used since long as Taalamuuli. The white variety of Mushali is equated with Chlorophytum arundinaceum Baker (Nepal, Bhutan, and Bihar) and C. borivilianum (cultivated in Jalgaon, Maharashtra). The commercial drug of the white variety contains the tubers of Chlorophytum arundinaceum, C. tuberosum Baker and C. attenuatum Baker (found on the hills in Kerala, Karnataka, Tamil Nadu and on the hills near Udaipur in Rajasthan).

Aamra Haridra Aamra Haridra is the pharmacopoeial name equated with Curcuma amada Roxb. The genuine material is available in West Bengal, Kerala, and Tamil Nadu. At the majority of trade centers, C. aromatica Salisb., wild turmeric, is sold as Aambaahaldi.

Haridra Haridra is the pharmacopoeial name equated with Curcuma longa Linn. Rajani, Nishaa, Nishi, Raatri, Nilakanth are wrong synonyms of Haridra. These should be equated with C. caesia Roxb. (cultivated mainly in West Bengal). Source of Radix curcumae in China: Curcuma wenyujin Y. H. Lee et C. Ling, C. kwangsiensis S. Lee et al., C. F. Lang, C. phaeocaulis Val.

Identification of proper herbs  83

Karchura Karchura is the pharmacopoeial name equated with Curcuma zedoaria Rosc. Rhizomes of Curcuma caesia Roxb. are sold as a substitute, especially in West Bengal. The source of Karchura in Kerala, in recent times, has been Kaempfera galanga Linn.

Shimshapaa Simshapaa is the pharmacopoeial name equated with Dalbergia sissoo Roxb. Two varieties of Shimshapaa are mentioned in Ayurveda (Dhanvantari Nighantu, prior to thirteenth century). The second variety is equated with D. latifolia Roxb. In Kerala, the heartwood of Xylia xylocarpa Roxb. Taub. is used as Shimshapaa.

Dhattuura Dhatuura is the pharmacopoeial name equated with Datura metel Linn. Indian Dhatura species contain alkaloids hyoscyamine and hyoscine, but D. metel Linn., additionally, contains meteloidine, as a specific characteristic (Indian Council of Medical Researh).

Shaalparni Shaalparni is the pharmacopoeial name equated with Desmodium gangeticum DC. The drug is sometimes adulterated or even substituted with the roots of Desmodium pulchellum Benth. ex Baker. (especially in material coming from Garhwal hills.) Roots of Flemingia chappar Ham. and F. semialata Roxb. are also used as substitutes. Kerala physicians, by and large, accepted Psuedarthria viscida (L.) W. & A. as the source plant of Shaalparni.

Bhringaraaja Bhringaraaja is the pharmacopoeial name equated with Eclipta alba Hassk. Three varieties are mentioned in Ayurvedic texts, shvetapushpi (white-flowered), nilapushpi (blue-flowered) and pitapushpi (yellow-flowered). In practice, no distinction is made between white and blue flowered varieties which are equated with E. alba. The yellow-flowered variety is considered a different drug and is equated with Wedelia chinensis (Osbeck) Merr. syn. W. calendulacea (Linn.) Less non Rich. Haliotropium brevifolium Wall. is equated wrongly with a white variety of Bhringaraaja. The adulterants include Ageratum conyzoides Linn., Caesulia axillaris, and Alternanthera sesselis.

84  Legacy and logical steps

Vidang Vidang is the pharmacopoeial name equated with Embelia ribes Brum. f. Embelia tsjeriam-cottam A. DC. syn. E. rabusta C. B. Cl. is a commonly employed substitute for Vidanga. Fruit of Myrsine africana Linn. is the main adulterant.

Hingu Hingu is the pharmacopoeial name equated with Ferula foetida Regel. Ferula narthex Boiss. is an inappropriate equation of Ferula asafoetida Linn. since its volatile oil is reported to be sulfur-free. Charaka used dried fruits of Hingu (Hinguka) in a gruel as a blood purifier and purgative (Charaka Samhita, Su. 2, 29)27, Hingu and Hingupatri in medicinal ghee for insanity. Hingupatri is the pharmacopoeial name equated with Ferula jaeschkeana Vatke. Two more botanical sources have been suggested: Ferula narthex Boiss or Gardenia gummifera Linn. f. (Naadihingu). Hinguparni (Ci 9, 63), Hingupatrikaa (Ci 9, 72), Hinguvaatikaa (Ci 15, 108) of Charaka Samhita still renain unidentified.

Parpata Parpata is the pharmacopoeial name equated with Fumaria parviflora Lam. In Kerala, Hedyotis brachypoda DC., H. corymbosa (L.) Lam. and H. diffusa Willd. are generally accepted as Parpata. IMPCOPS, Chennai, is using Mollugo cerviana Ser. as Parpataka.

Naadihingu Naadihingu is the pharmacopoeial name equated with Gardenia gummifera L. f. Leaf buds and young shoots of G. gummifera, as also of G. lucida Roxb. Syn. G. resinifera Roth. yield a resinous exudation, known as Cumbi Gum. The gum is not related to Ferula spp., nor is a substitute for any Ferula product. A flavonoid (gardenin A, its methyl ether and acetate) has been isolated from the plant gum (3.76%); six cycloartane triterpenes dikamaliartanes A-F, along with the flavonoid gardenin E, were also isolated.

Laangali Laangali is the pharmacopoeial name equated with Gloriosa superba Linn. Sliced rhizomes of Costus spiciosus (Koem.) Sims. (Kabuka) are often adulterated with the drug Laangali. Their action on uterus has been found to be nearly similar to that of Laangali.

Identification of proper herbs  85

Yashti Yashti is the pharmacopoeial name equated with Glycyrrhiza glabra Linn. A number of botanical drugs were used as a substitute for Madhuyashti during the classical period. The root of Abrus precatorius is still known as Indian liquorice as it contains glycyrrhizin. Taverniera cuneifolia Arn. syn. T. nummularia Baker (found in plains of Punjab, Gujarat and the Deccan), was known as Jetimad in Mumbai. (Common names of Yashtimadhu are Jethi Madh in Gujarat, Jeshta Madha in Maharashtra, jashtimadhu in Bengal.)

Shathi Shathi is the pharmacopoeial name equated with Hedychium spicatum Ham. ex Smith The rhizome of Hedychium coronarium Koening is the most common adulterant. H. spicatum (a Himalayan plant) is not available in South India. Curcuma zedoaria Roscoe is used as Shathi. Kaempfera galanga Linn. is used as a substitute. Wall.

Riddhi Riddhi is the pharmacopoeial name equated with Habernaria intermedia D.Don. Habernaria spp. (H. intermedia, H. acuminata Thw., H. goodyeroides D.Don.) are collected in the Dehradun region and sold as Riddhi-Vriddhi. (Riddhi-Vriddhi pair is a constituent of Ashta Varga of Classical Ayurveda.) Habernaria edgeworthii Hook. f. ex Collete. and H. intermedia are used in Kerala as Riddhi-Vriddhi. Substitute drug of Riddhi is Dioscoria bulbifera Linn. (Ayurvedic Fomulary of India).

Kutaja Kutaja is the pharmacopoeial name equated with Holarrhena antidysenterica (Roth) A. DC. and Indrayava is the pharmacopoeial name equated with Holarrhena antidysenterica Wall. Wrightia antidyserterica (L.) R. Br is the currently valid name of Kutaja (Indian Council of Medical Research, Medicinal Plants Unit). The stem bark of Wrightia tomentosa R. & S. and W. tinctoria R. Br. are often substituted for the genuine drug. Two varieties of Kutaja have been mentioned in Ayurvedic texts, male and female. Holarrheana antidysenterica is supposed to be the male, Wrightia tinctoria the female. The male variety of fruits are bigger than the female variety.

86  Legacy and logical steps Bitter Indrayava is the fruit of H. antidysenterica; sweet Indrayava is the fruit of Wrightia tinctoria R.Br.

Chirbilva Chirbilva is the pharmacopoeial name equated with Holoptelea integrifolia Planch. Two species of Karanja trees have been mentioned in texts: Puutika (Chirabilva, Prakirya) and Naktamaala (Udakirya); equated with Holoptelea integrifolia and Pongamia pinnata Lierra., respectively. The third Karanja is a shrub, Kantaki Karanja or Lata Karanja, equated with Caesalpinia bonduc (L.) Roxb. It is a later addition. (In Ayurvrdic Pharmacopoeia of India, Part I, Vol. III, therapeutic uses quoted from Bhavaprakasha in Sanskrit are about Shriphala (Bilva). (Quoted wrongly for Chirbilva.)

Paarsika Yavaani Paarsika Yavaani is the pharmacopoeial name equated with Hyoscyamus niger Linn. Seeds of H. niger and H. muticus Linn. are the official source of Paarasika yavaani. (H. muticus is Egyptian Henbane.) Commercial samples of the drug sold in Gujarat were found to be seeds of Cleome viscosa Linn.

Pushkara Pushkara is the pharmacopoeial name equated with Inula racemosa Hook. f. Roots of Saussurea lappa C. B. Clarke is commonly found mixed with commercial samples of Pushkaramèla. The plant is restricted to Western Himalayas. Even in Bhavaprakasha (sixteenth century), Kushtha (Saussurea lappa) was a substitute for Pushkaramuula. The accepted source of the drug in Kerala was Coffea travancorensis Wt. & Arn. (Psilanthus travancorensis), which is scarce.

Hapushaa Hapushaa is the pharmacopoeial name equated with Juniperus communis Linn. In South India, Sphaeranthus indicus Linn. is used as the drug source. Kerala physicians consider Hapushaa and Mundi as synonymous.

Madayanti Madayanti is the pharmacopoeial name equated with Lawsonia inermis Linn. Nil Madayantika could not be traced in classical texts. Madayanti/Madayantikaa is mentioned in Bhavaprakasha (sixteenth century), but it was equated with Mallikaa, a Jasmine species. Medini and Madyantikaa were its synonyms.

Identification of proper herbs  87 Henna (Mehendi) was originally an Unani plant drug. Classical Ayurvedic drug as Mendi, Mendikaa, Madyantikaa (Charaka, Sushruta, 1000 bc; Vagabhatta, sixth–seventh century). It was included in Mahaanila Ghrit of Sushruit which was specific for leprosy. Madayanti Kvatha (Sahasrayoga, a non-Samhita Kerala Materia Medica, CCRAS text) is a single herb preparation for bleeding disorders.

Jivanti Jivanti is the pharmacopoeial name equated with Leptadenia reticulata W. & A. The market drug, in most parts of the country, is the whole herb of Ephemerantha macraei (Lindl.) Hunt & Summerh syn. Dendrobium macraei Lindl., known as Swarna Jivanti. Roots of Holostemma ada-kodien Schult are used as Jivanti in South India, especially in Kerala. Majority of Ayurvedic practitioners has probably been using different orchid species having a similar appearance and belonging to Pholidota spp. or Desmotrichum fimbriatum Bl. syn. Dendrobium macraei Lindl.

Kaakoli Kaakoli is the pharmacopoeial name equated with Lilium polyphyllum D.Don. Tuberous roots of Roscoea procera Wall. are also used as Kaakoli. Withania somnifera Dunal. roots are used as a substitute for Kaakoli and Kshirakaakoli (in double quantities).

Kshirakaakoli Kshirakaakoli is the pharmacopoeial name equated with Fritillaria roylei Hook. In addition to Fritillaria roylei, orchids being sold in the market include Roscoea procera Wall., Nomocharis oxypetala Royle and Lilium polyphyllum D.Don., as well as Mimuscops kauki Linn.

Jivaka and Rshbhaka Jivaka and Rshbhaka is the pharmacopoeial name equated with Malaxis acuminata D.Don. Malaxis mucifera (Lindley) Kuntz. syn. Microstylis musifera Ridly is also used as Jivaka. Malax acuminata is used as Rshbhaka. Pueraria tuberosa DC. is used as a substitute of Jivaka and Rshbhaka.

Muurvaa Muurvaa is the pharmacopoeial name equated with Marsdenia tenacissima Wight. & Arn. M. tenacissima is wrongly supplied in the Northern markets under the name of Trivrit.

88  Legacy and logical steps Jingini was used as a substitute for Muurvaa during the sixteenth century. (Jingini is equated with Lannea coromandelica Merill.) In Kerala, Chonemorpha fragrans (Moon) Alston is the accepted source of Muurvaa. Sansevieria roxburghiana Schult. is used in Tamil Nadu.

Kaaka-Naasikaa Kaaka-Naasikaa is the pharmacopoeial name equated with Martynia annua Linn. Seeds of Anamirta paniculata W. & A. are used as Kaaka-Naasikaa in Tamil Nadu.

Naagakeshara Naagakeshara is the pharmacopoeial name equated with Mesua ferrea Linn. In Ayurvedic Formulary of India, Part I, Second Edn. (page 317), Keshara and Kesara are synonyms of Naagakeshara equated with Mesua ferrea, while Kumkuma (page 318) is equated with Crocus sativus, and there is no entry in the column for the official name. In Ayurvedic Formulary of India, Part II, First Revised Edn., Kumkuma and Keshara are the synonyms, equated with Crocus sativus Linn. (page 330); while Naagakeshara, Naagakesara, and Kesara are synonyms, equated with Mesua ferrea (page 334). Flower buds of Mammea suriga (Ham.) Kesterm (Fam. Cluciaceae) are known as Rakta-Naagakesara; immature fruits of Cinnamomum tamala Nees. & Eberm as Krishna-Naagakesara; and immature fruits of Dillenia pentagyna Roxb. as Malabar-kesara. In Tamil Nadu and adjacent states, tender fruits of Cinnamomum wightii or fruits of Dillenia pentagyna are used as Naagakeshara.

Jaatiphala Jaatiphala is the pharmacopoeial name equated with Myristica fragrans Houtt. East Indian nutmeg is available in three grades: (i) Banda nutmeg, considered to be the finest, contains up to 8% essential oil; (ii) Siaruw nutmeg, as good as Banda, contains c. 6.5% essential oil; and (iii) Penang nutmeg, usually wormy and moldy, derived from M. argentea Warb., suitable only for distillation purposes. Bombay nutmeg, an adulterant of true nutmeg, is obtained from M. malabarica Lam., known as False Nutmeg.

Jataamaansi Jataamaansi is the pharmacopoeial name equated with Nardostachys jatamansi DC. Rhizomes of Selinum vaginatum C. B. Cl. and S. tenuifolium Wall. (known as Muraa) are sold as a cheap substitute for Jataamaansi.

Identification of proper herbs  89

Gojihvaa Gojihvaa is the pharmacopoeial name equated with Onosma bracteatum Wall. Elephantopus scaber Linn. is the source of Gojihvaa in Kerala Not to be confused with Gaozabaan. Unani drug Gaozabaan is not derived from O. bracteatum in India. The market drug is dried leaves and nutlets of Anchusa strigosa Labill, and flowers of Echium amoenum (Gul-e-Gaozabaan). Kashmiri Gaozabaan is derived from Macrotomia benthami (Wall.) A. DC. Borago officinalis Linn. is equated with Gaozabaan in the National Formulary of Unani medicine. In Siddhayogasangraha (Vaidya Yadavji Trikamji) coined a new entity, Go-Javaana-Gojihvaa and equated it with Onosma bracteatum Wall. (Ayurvedic Formulary of India, Part II, First English Edition. Page 69. On page 332, Go-Javana, as a synonym of Gojihvaa, is spelled as Gavajavaana.)

Papata Papata is the pharmacopoeial name equated with Pavetta indica var. tomentosa Hook. (Ayurvedic Formulary of India, Part I, Second Revised Edition, equated Parpata, Parpataka, and Parpati with Fumaria parviflora Lam., page 321–322. Parpata is not to be confused with Papata which is known as Kath-champaa.) According to some authors, P. indica is confined only to South India. Plants of other regions are P. carassiculas Bremek and P. indica sensu Hook. f. A market survey reveals that Morinda pubscens Smith and Stylocoryne lucens Gamble (both Rubiaceae) are also accepted as the drug source.

Jalapippali Jalapippali is the pharmacopoeial name equated with Phyla nodiflora Greene syn. Lippia nodiflora Rich. Ayurvedic Formulary of India, Part I, page 314, equated Lippia nodiflora with Jalakarna, which is not a synonym of Jalapippali in any text. Phyla nodiflora is a pot herb, the leaves are reported to be eaten in Sri Lanka, while Jalapippali of classical texts was bitter and astringent. National Academy of Ayurveda (Rashtriya Ayurveda Vidyapeeth) equated Phyla nodiflora with Siddha drug Poduthalai. The Wealth of India, Indian Council of Medical Research, Medicinal Plant Unit, and Central Institute of Medical and Aromatic Plants did not equate P. nodiflora with any classical Ayurvedic drug. Scientists of Indian National Science Academy equated Jalapippali with Ranunculus aculeata Pers. (Poison buttercup). This created doubt about the proper identification of a classical drug. The Wealth of India equated Jalapippali with Commelina salicifolia Roxb.

Taamalaki Taamalaki is the pharmacopoeial name equated with Phyllanthus fraternus Webst.

90  Legacy and logical steps Ayurvedic Formulary of India, Part I, wrongly equated Taamalaki with Phyllanthus niruri Linn. (page 327). Indian species is identified by Prof. Webster of California University. Phyllanthus niruri Linn. is an American species. P. amarus Schum & Thonn. and P. airy-shawii Brunal & Roux, syn. P. debilis Klein ex Willd. are very common in Kerala and are used as a source of Taamalaki. P. urinaria Linn. may also be used.

Kankol Kankol is the pharmacopoeial name equated with Piper cubeba Linn. f. Adulterants include Piper crassipes Korth., P. cannum Blume, P. baccatum Blume, Litsea cubeba Pers. Also P. clusii DC. and P. guineanse DC. (African spp.).

Maricha Maricha is the pharmacopoeial name equated with Piper nigrum Linn. Whole black pepper is often adulterated with fruits of Lantana camara Linn., Vitex altissima, seeds of Carica papaya Linn., dried and roasted berries of Schinus molle Linn. In Bhavaprakasha (sixteenth century) seeds of Shigru (Moringa oleifera Lam.) are described as Shveta maricha.

Raasanaa Raasanaa is the pharmacopoeial name equated with Pluchea lanceolata Oliver & Hiern. Pluchea lanceolata is the official Raasnaa, the substitute plant drug is Alpinia galanga Willd., which is used in South India. (Ayurvedic Formulary of India, Part I, page 323.) Polygonum grabrum Willd. are sold since decades in Varanasi market as Raasanaa. Vanda roxburghii R. Br. is used in Bengal; Dodonaea viscosa Linn. in Andhra Pradesh. Heliotropium strigosum Willd. is sold as Raasanaa in Bihar.

Rakta Chitraka Rakta Chitraka is the pharmacopoeial name equated with Plumbago indica Linn. Three varieties of Chitraka are mentioned in classical texts based on the color of the flower, red, white and black (blue). Vaagabhatta (sixth–seventh century) mentions a yellow-flowered variety instead of the red one. White flowered variety (Plumbago zeylanica L.) is used in North India. The red-flowered variety (P. indica) is used in South India and Bengal. Black (blue)flowered variety is possibly P. auriculata Lam. (= P. capensis Thumb.), not used as a source of Chitraka. In South India, Rakta chiraka is considered to be therapeutically more active. The roots, as well as the root bark of P. indica, form an important indigenous drug, but less commonly used than those of P. zeylanica.

Identification of proper herbs  91

Medaa and Mahaa Medaa Medaa and Mahaa Medaa are the pharmacopoeial names equated with Polygonatum cirrhifolium Royle Polygonatum verticillatum (L.) Alloini also has been identified as Medaa, Asparagus racemosus Willd. is the substitute of Medaa and Mahaa medaa.

Lonikaa Kozuppaa is the pharmacopoeial name equated with Portulaca oleracea Linn. Kozuppaa is confined to Kerala and Tamil Nadu, while Lonikaa or Loni are classical Ayurvedic plant names of Charaka Samhita, Sushruta Samhita, and Ashtangahridaya, In Kerala, at least three different plants are currently used as the source of Lonika (Malyalam Kozuppa) in different parts of Kerala: Alternanthera sessilis Linn., Glinus oppositifolius, and Portulaca oleracea. Alternanthera sessilis (Matysakshi) has been the source of Kozuppaa since long in Kerala.

Asana Asana is the pharmacopoeial name equated with Pterocarpus marsupium Roxb. Asana is a synonym of Terminalia tomentosa W. & A. and Bridelia montana Willd. in Maharashtra. The heartwood of Terminalia tomentosa and Bridelia montana is sometimes found as adulterants.

Rakta-Chandana Rakta-Chandana is the pharmacopoeial name equated with Pterocarpus santalinus Linn. The heartwood of Adenanthera pavonia Willd. is often passed on as a substitute. The heartwood of Caesalpinia sappan Linn. is sometimes mistakenly used. Raktachandana may be used as a substitute in place of Chandan-shveta (Santalum album Linn.) and Karpura (camphor). (Rakta-chandana has no aroma.)

Sarpagandhaa Arpagandhaa is the pharmacopoeial name equated with Rauwolfia serpentina (Linn.) Benth. ex Kurz. Roots of Rauvolfia tetraphylla Linn., cultivated in various parts of India, are employed as a substitute when R. serpentina root is not available. Among major adulterants are thin roots of Tabernaemontana divaricata (L.) R. Br. Roots of Rauvolfia densiflora Benth. and R. micrantha Hook. f. are sometimes found mixed in Kerala and Western India. Sarpagandhaa of Ayurvedic texts was not Rauvolfia serpentina of modern medicine, which was identified by the German scientist Rauwolf. In Ayurvedic texts,

92  Legacy and logical steps Naakuli and Gandha Naakui were the drugs that were included in compound formulations for mental diseases. Sarpasugandhaa was a synonym of Naakuli. Dalhan’s Sarpachhatrikaa and Varshaasu chhatrakaaraa indicate that Sarpagandhaa of Ayurvedic texts was a Kavaka (mushroom) that was toxic.

Kushtha Kushtha is the pharmacopoeial name equated with Saussurea lappa C. B. Clarke. Kuth, commonly known as costus in trade, has no connection with the botanical genus Costus. Kustha is used as a substitute for Pushkar-mula (Inula racemosa Hook. f.) and Tagara (Valeriana wallichii DC.). In Unani medicine, Qust-e-Arabi (Sweet var. is equated with Iris germanica Linn.) and Qust-e-Hindi, bitter var. with S. lappa.

Gajapippli Gajapippli is the pharmacopoeial name equated with Scindapsus officinalis Schoott. In Kerala, sliced and dried inflorescence of Balanophora indica Wall. and pieces of the stem (not fruits) of Scindapus officinalis are sold as Gajapippali. Gajapippali was used as a substitute of Piper longum Linn. root.

Bhootakeshi Bhootakeshi is the pharmacopoeial name equated with Selinum vaginatum C. B. Clarke. Bhootakeshi roots are covered by hair-like fibers. Several species, Nardostachys, Selinium, and Corydalis have a similar appearance and are likely to be called Bhootakeshi, Putankeshi, and Jatilaa. Roots of S. vaginatum are frequently mixed with those of Seseli sibricum Benth. ex C. B. Clarke and sold in Jammu as a cheap substitute of Nardostachys jatamansi DC. rhizome.

Mahaa Balaa Mahaa Balaa is the pharmacopoeial name equated with Sida rhombifolia Linn. (Yellow-flowered var.) syn. S. rhomboidea Roxb. ex Fleming. (White-flowered variety.) While Sida cordifolia is a widely used source of Balaa in northern parts of India, Kerala physicians have adopted Sida rhombifolia ssp. retusa for Balaa. Sida acuta is also widely used as an adulterant in Kerala.

Kaakamaachi Kakamaachi is the pharmacopoeial name equated with Solanum nigrum Linn.

Identification of proper herbs  93 Diploid. Each form differs from the other. Tetraploids closely resemble S. luteum Mill. Hexaploid: mostly occurs in temperate parts, rarely in warmer regions. Solanum americanum Linn. syn. S. incertum Dunal; S. rubrum Mill., is also treated as S. nigrum. Solanum nigrum auct. non. Linn. syn. S. americanum Mill. is equated with Kaakamaachi in South India. Geophilla repens (Linn.) I. M. Johnson, syn. G. reniformis D.Don (Fam. Rubiaceae) is used as Karintakaali (Kaakamaachi) in Kerala. Leaves of S. nigrum sometimes occur as an adulterant of Indian belladonna.

Mundi Munditikaa is the pharmacopoeial name equated with Sphaeranthus indicus Linn. S. africanus Linn. is used as Mahaamundi. In Kerala, Sphaeranthus indicus is equated with Hapushaa (Juniperus communis Linn.); red and white varieties of Hapushaa with S. indicus and S. africanus Linn., respectively. This is not acceptable to other schools of Ayurveda. (In The Wealth of India, Vol X, page 4, Hapushaa and Shveta Hapushaa are included among synonyms of S. indicus and S. africans, respectively.)

Vishamushthi Vishmushthi is the pharmacopoeial name equated with Strychnos nux-vomica Linn. Nux-vomica seeds are often adulterated with the seeds of S. potatorum Linn. f. and S. nux-blanda A. W. Hill. Nux-vomica is a tree, while S. colubrina Linn. is a climber of the Deccan peninsula, from Konkan to Cochin. Its roots, seeds bark and wood contain strychnine and brucine. Also used as Nux-vomica.

Kiraatikta Kiratikta is the pharmacopoeial name equated with Swertia chirata Buch. Ham. Substitution of (Himalayan) Kiraatatikta by other species of Swertia (S. angustifolia Buch.-ham. and S. alata Royle) and Andrographis paniculata Nees is done to such an extent that they are passed on in the drug market as original Chirayataa. Andrographis paniculata is even known as chirayata variety.

Lodhra Lodhra is the pharmacopoeial name equated with Symplocos racemosa Roxb. In Bhavaprakasha, two varieties are mentioned: Shaavara and Pattikaa (thick bark). Shaavara Lodhra is equated with S. racemosa and Pattikaa Lodhra with S. crataegoides Buch-Ham. In Kerala, S. cochinchinensis (Lour.) S. Moore (= Symplocos spicata Roxb.) is used as Lodhra.

94  Legacy and logical steps

Sthauneya Sthauneya is the pharmacopoeial name equated with Taxus baccata Linn. Taxus baccata Linn. is European Yew. Himalayan Yew is T. wallichiana Zucc. syn. T. baccata Linn. subsp. wallichiana (Zucc.) Pilgoe; T. baccata Hook. f. non Linn. In Ayurvedic Formulary of India (Part I, page 327), Abies webbiana Lindl. is equated with Taalisa. A. pindrow Spach. and Taxus baccata Linn. have been recognized as its substitutes. In South Indian compounds, T. baccata is used as Taalispatra. All these examples will prove that due to a fundamental weakness in the identification of the proper herbs and assumptions about the final outcome, formulations of the classical periods were overloaded with many herbs and indication pluralism that could have been otherwise avoided. In “Ayurvedic Pharmacopoeial Plant Drugs” we had pointed out a number of discrepancies in the selection of herbs and clinically unreliable applications of classical drugs; Panchgavya Ghrita for treating epilepsy, Ashwagandha for phthisis, Khadirarishta for heart diseases, Sarasvatarishta for the disorder of semen and Chyanprasha for gout and heart diseases. The way out to solve the problem When we can accommodate botanical names of Ayurvedic plants, phytochemical markers and chemical constituents, why can’t we accept pharmaceutical names in Ayurvedic Prarmacopoeia of India, Ayurvedic Formulary of India and on the label of all plant drugs, to avoid wrong identification of material and adulteration? Even WHO changed its approach in monographs on botanical drugs in 1999. In all classical compounds of Ayurvedic Formulary of India, Sanskrit names with updated pharmaceutical names in brackets should be used. Sanskritized nonclassical names should be replaced with validated common vernacular or English names to avoid the impression that they were used during the classical period, while they are new entities. For proper plant parts (leaf, fruit, seed, root), international pharmaceutical names should be adopted. Himalaya Drug Company, the manufacturers of research-oriented herbal/Ayurvedic drugs, recently upgraded their label drugs’ presentation. Though they have not yet used international pharmaceutical names, both Ayurvedic and botanical names with plant parts are now mentioned. With extract, herb to extract ratio should have been mentioned. We will give some examples of pharmaceutical names of Ayurvedic plant drugs from WHO Monographs on Selected Medicinal Plants: Achillea millefolium Linn. herb Aesculus hippocastanum Linn. seed Alliun cepa Linn. bulb Allium sativum Linn. bulb

(Herba Millefolii), (Semen Hippocastani), (Bulbus Allii Cepae), (Bulbus Allii Sativi),

Identification of proper herbs  95 Althaea officinalis Linn. root Ammi majus Linn. fruit Andrographis paniculata (Burm.f.) Nees herb Berberis vulgeris Linn. bark Boswellia serrata Rox. ex Colebr. Gum

(Radix Althaceae), (Fructus Ammi Majoris), (Herba Andrographidis), (Cortex Berberidis), (Gummi Boswellii).

Pharmaceutical names have been in use since 1992 German Commission E Monographs, The Scientific Foundation for Herbal Medicinal Products (ESCOP), The British Herbal Compendium, WHO and the Pharmacopoeia of People’s Republic of China have been using pharmaceutical names since 1992. We will provide an exhaustive list of pharmaceutical names in the next pages.

Pharmacopoeia of People’s Republic of China Pharmaceutical names

While we are still trying to promote Sanskrit names as Pharmaceutical Names, Chinese have already adopted both Botanical and Pharmaceutical Names, used by German Commission E, European Scientific Cooperative on Phytotherapy (ESCOP), and WHO. AYUSH should have a look at the pharmaceutical names of Pharmacopoeia of the People’s Republic of China, which will be referred to by the researchers worldwide. Botanical Name

Pharmaceutical Drug Name

Chinese Name Roman

Abrus cantoniensis Abutilon theophrastii Acacia catechu Acanthopanax gracilistylus Achyrantes bidentata Aconitum carmichaeli Aconitum kusnezoffii Aconitum kusnezoffii Acorus calamus Acorus tatarinowii Adenophora stricta Adenophora tetraphylla Aesculus chinensis Aesculus chinensis var. chekiangensis Agrimonia pilosa Ailanthus altissima Akebia quinata Akebia trifoliata Akebia trifoliata var. australis Albizia julibrissin Albizia julibrissin Alisma orientalis Allium chinensis Allium macrostemon

Herba Abri Semen Abutili Catechu Cortex Acanthopanacis Radix Achyranthis Bidentatae Radix Aconiti Folium Aconiti Kusnezoffii Radix Aconiti Kusnezoffii Rhizoma Acori Calami Rhizoma Acori Tatarinowii Radix Adenophorae Radix Adenophorae Semen Aesculi

Jigucao Qingmazi Ercha Wujiapi Niuxi Chuanwu Caowuye Caowu Zangchangpu Shichangpu Nanshashen Nanshashen Suoluozi

Semen Aesculi Herba Agrimoniae Cortex Ailanthi Fructus Akebiae Fructus Akebiae Fructus Akebiae

Suoluozi Xianhecao Chunpi Yuzhizi Yuzhizi Yuzhizi

Flos Albiziae Cortex Albiziae Rhizoma Alismatis Bulbus Alii Macrostemonis Bulbus Alii Macrostemonis

Hehuanhua Hehuanpi Zexie Xiebai Xiebai

Botanical Name

Pharmaceutical Drug Name

Chinese Name Roman

Allium tuberosum Aloe barbadensis et spp. Aloe ferox et spp. Alpinia galanga Alpinia katsumadai Alpinia officinarum Alpinia oxyphylla Amomum compactum Amomum kravanh Amomum longiligulare Amomum tsaoko Amomum villosum Amomum villosum var. xanthioides Ampelopsis japonica Andrographis paniculata Anemarrhena asphodeloides Anemone raddeana Angelica dahurica Angelica pubescens Angelica sinensis Apocynum venetum Aquilaria sinensis Arctium lappa Areca catechu Areca catechu Arisaema amurense Arisaema erubescens Arisaema heterophyllum Aristolochia contorta Aristolochia contorta Aristolochia debilis Aristolochia debilis Aristolochia debilis Aristolochia fangchi Aristolochia manshuriensis

Semen Allii Tuberosi Aloe Aloe Fructus Galangae Semen Alpiniae Katsumadai Rhizoma Alpiniae Officinarum Fructus Alpiniae Oxyphyllae Fructus Amomi Rotundus Fructus Amomi Rotundus Fructus Amomi Fructus Tsaoko Fructus Amomi Fructus Amomi

Jiucaizi Luhui Luhui Hongdoukou Caodoukou Gaoliangjiang Yizhi Doukou Doukou Sharen Caoguo Sharen Sharen

Radix Ampelopsis Herba Andrographis Rhizoma Anemarrhenae Rhizoma Anemones Raddeanae Radix Angelicae Dahuricae Radix Angelicae Pubescentis Radix Angelicae Sinensis Folium Apocyni Veneti Lignum Aquilariae Resinatum Fructus Arctii Pericarpium Arecae Semen Arecae Rhizoma Arisaematis Rhizoma Arisaematis Rhizoma Arisaematis Fructus Aristolochiae Herba Aristolochiae Fructus Aristolochiae Herba Aristolochiae Radix Aristolochiae Radix Aristolochiae Fangchi Caulis Aristolochiae Manshuriensis Radix Arnebiae Radix Arnebiae Herba Artemisiae Annuae Folium Artemisiae Argyi Herba Artemisiae Scopariae Herba Artemisiae Scopariae Herba Asari

Bailian Chuanxinlian Zhimu Liangtoujian Baizhi Duhuo Danggui Luobumaye Chenxiang Niubangzi Dafupi Binglang Tiannanxing Tiannanxing Tiannanxing Madouling Tianxianteng Madouling Tianxianteng Qingmuxiang Guangfangji

Herba Asari

Xixin

Radix Asparagi Radix Asteris Semen Astragali Complanati

Tiandong Ziwan Shayuanzi

Arnebia euchroma Arnebia guttata Artemisia annua Artemisia argyi Artemisia capillaris Artemisia scoparia Asarum heterotropoides var. mandshuricum Asarum sieboldii, A. sieboldii var. seoulense Asparagus cochinchinensis Aster tataricus Astragalus complanatus

Guanmutong Zicao Zicao Qinghao Aiye Yinchen Yinchen Xixin

(Continued)

(Continued) Botanical Name Astragalus membranaceus var. mongholicus Atractylodes chinensis Atractylodes lancea Atractylodes macrocephala Atropa belladonna Aucklandia lappa Bambusa textilis Bambusa tuldoides Baphicacanthus cusia Baphicacanthus cusia Belamcanda chinensis Benincasa hispida Bletilla striata Bolbostemma paniculatum Brassica juncea Brassica juncea Broussonetia papyrifera Brucea javanica Buddleja officinalis Bupleurum chinense, B. scorzonerifolium Buxus mierophyila var. sinica et spp. Caesalpinia sappan Calvatia gigantea Calvatia lilacina Camellia meiocarpa Camellia oleifera Campsis grandiflora Campsis radicans Canarium album Canavalia gladiata Cannabis sativa Carpesium abrotanoides Carthamus tinctorius Cassia acutifolia Cassia angustifolia Cassia obtusifolia Cassia tora Celosia argentea Celosia cristata Centella asiatica Centipeda minima Chaenomeles speciosa Changium smyrnioides Choerospondias axillaris Chrysanthemum indicum Chrysanthemum morifolium

Pharmaceutical Drug Name

Chinese Name Roman

Radix Astragali Rhizoma Atractylodis Rhizoma Atractylodis Rhizoma Atractylodis Macrocephalae Herba Belladonnae Radix Aucklandiae Concretio Silicea Bambusae Caulis Bambusae in Taeniam Indigo Naturalis Rhizoma et Radix Baphicacanthis Cusiae Rhizoma Belamcandae Exocarpium Benincasae Rhizoma Bletillae Rhizoma Bolbostematis Semen Sinapsis Semen Brassicae Junceae Fructus Broussonetiae Fructus Bruceae Flos Buddlejae Radix Bupleuri

Huangqi Cangzhu Cangzhu Baizhu

Cyclovirobuxinum D

Huanweihuangyangx­ing D

Lignum Sappan Lasiosphaera seu Calvatia Lasiosphaera seu Calvatia Oleum Camelliae Oleum Camelliae Flos Campsis Flos Campsis Fructus Canarii Semen Canavaliae Fructus Cannabis Fructus Carpesii Flos Carthami Folium Sennae Folium Sennae Semen Cassiae Semen Cassiae Semen Celosiae Flos Celosiae Cristatae Herba Centellae Herba Centipedae Fructus Chaenomelis Radix Changii Fructus Choerospondiatis Flos Chrysanthemi Indici Flos Chrysanthemi

Sumu Mabo Mabo Chayou Chayou Lingxiaohua Lingxiaohua Qingguo Daodou Huomaren Heshi Honghua Fanxieye Fanxieye Juemingzi Juemingzi Qingxiangzi Jiguanhua Jixuecao Ebushicao Mugua Mingdangshen Guangzao Yejuhua Juhua

Dianqiecao Muxiang Tianzhuhuang Zhuru Qingdai Nanbanlangen Shegan Dongguapi Baiji Tubeimu Jiezi Jiezi Chushizi Yadanzi Mimenghua Chaihu

Botanical Name

Pharmaceutical Drug Name

Chinese Name Roman

Cibotium barometz Cichorium glandulosum Cichorium intybus Cimicifuga dahurica Cimicifuga foetida Cimicifuga heracleifolia Cinnamomum camphora et spp. Cinnamomum cassia Cinnamomum cassia Cinnamomum cassia Cirsium japonicum

Rhizoma Cibotii Herba Cichorii Herba Cichorii Rhizoma Cimicifugae Rhizoma Cimicifugae Rhizoma Cimicifugae Oleum Eucalypti

Gouji Juju Juju Shengma Shengma Shengma Anyou

Cortex Cinnamomi Oleum Cinnamomi Ramulus Cinnamomi Herba Cirsii Japonici, Radix Cirsii Japonici Herba Cirsii Herba Cissampelotis

Rougui Rouguiyou Guizhi Daji

Herba Cistanches Fructus Aurantii Immaturus Fructus Aurantii Exocarpium Citri Grandis Exocarpium Citri Grandis Fructus Citri Fructus Citri Sarcodactylis

Roucongrong Zhishi Zhiqiao Huajuhong Huajuhong Xiangyuan Foshou

Pericarpium Citri Reticulatae

Chenpi

Pericarpium Citri Reticulatae Viride Exocarpium Citri Rubrum

Qingpi

Semen Citri Reticulatae

Juhe

Fructus Aurantii Immaturus Fructus Citri Caulis Clematidis Armandii Radix Clematidis Radix Clematidis Radix Clematidis Caulis Clematidis Armandii Herba Clinopodii Herba Clinopodii Fructus Cnidii

Zhishi Xiangyuan Chuanmutong Weilingxian Weilingxian Weilingxian Chuanmutong Duanxueliu Duanxueliu Shechuangzi

Radix Codonopsis Radix Codonopsis Semen Coicis

Dangshen Dangshen Yiyiren

Herba Commelinae Rhizoma Coptidis Rhizoma Coptidis Rhizoma Coptidis

Yazhicao Huanglian Huanglian Huanglian

Cirsium setosum Cissampelos pareira var. hirsuta Cistanche deserticola Citrus aurantium Citrus aurantium Citrus grandis Citrus grandis “Tomentosa” Citrus medica Citrus medica var. sarcodactylis Citrus reticulata and its cultivars Citrus reticulata and its cultivars Citrus reticulata and its cultivars Citrus reticulata and its cultivars Citrus sinensis Citrus wilsonii Clematis armandii Clematis chinensis Clematis hexapetala Clematis manshurica Clematis montana Clinopodium chinensis Clinopodium polycephalum Cnidium monnieri Codonopsis pilosula, C. pilosula var. modesta Codonopsis tangshen Coix lacrymajobi var. ma-yuen Commelina communis Coptis chinensis Coptis deltoidea Coptis teeta

Xiaoji Yahunu

Juhong

(Continued)

(Continued) Botanical Name

Pharmaceutical Drug Name

Chinese Name Roman

Cordyceps sinensis Cornus officinalis Corydalis decumbens

Cordyceps Fructus Corni Rhizoma Corydalis Decumbentis Rhizoma Corydalis Fructus Crataegi Fructus Crataegi

Dongchongxiacao Shanzhuyu Xiatianwu

Corydalis yanhusuo Crataegus pinnatifida Crataegus pinnatifida var. major Cremastra appendiculata Cremastrae seu Pleiones Crocus sativus Croton tiglium Curculigo orchioides Curcuma kwangsiensis Curcuma kwangsiensis Curcuma longa Curcuma longa Curcuma phaeocaulis Curcuma phaeocaulis Curcuma wenyujin Curcuma wenyujin Curcuma wenyujin Cuscuta chinensis Cyathula officinalis Cynanchum atratum Cynanchum glaucescens Cynanchum paniculatum Cynanchum stauntonii Cynanchum versicolor Cynanchum versicolor Cynomorium songaricum Cyperus rotundus Daemonorops draco Dalbergia odorifera Daphne genkwa Datura metel Daucus carota Dendrobium candidum Dendrobium chrysanthum Dendrobium fimbriatum var. oculatum Dendrobium loddigesii Dendrobium nobile Descurainia sophia Desmodium styracifolium Dianthus chinensis Dianthus superbus Dichroa febrifuga Dictamnus dasycarpus Dimocarpus longan

Yanhusuo Shanzha Shanzha

Pseudobulbus Shancigu Stigma Croci Fructus Crotonis Rhizoma Curculiginis Radix Curcumae Rhizoma Curcumae Rhizoma Curcumae Longae Radix Curcumae Radix Curcumae Rhizoma Curcumae Radix Curcumae Rhizoma Wenyujin Concisum Rhizoma Curcumae Semen Cuscutae Radix Cyathulae Radix Cynanchi Atrati Rhizoma Cynanchi Stauntonii Radix Cynanchi Paniculati Rhizoma Cynanchi Stauntonii Radix Cynanchi Atrati Radix Cynanchi Atrati Herba Cynomorii Rhizoma Cyperi Sanguis Draxonis Lignum Dalbergiae Odoriferae Flos Genkwa Flos Daturae Fructus Carotae Herba Dendrobii Herba Dendrobii

Xihonghua Badou Xianmao Yujin Ezhu Jianghuang Yujin Yujin Ezhu Yujin Pianjianghuang Ezhu Tusizi Chuanniuxi Baiwei Baiqian Xuchangqing Baiqian Baiwei Baiwei Suoyang Xiangfu Xuejie Jiangxiang Yuanhua Yangjinhua Nanheshi Shihu Shihu

Herba Dendrobii Herba Dendrobii Herba Dendrobii Semen Descurainiae Herba Desmodii Styracifolii Herba Dianthi Herba Dianthi Radix Dichroae Cortex Dictamni Arillus Longan

Shihu Shihu Shihu Tinglizi Guangjinqiancao Qumai Qumai Changshan Baixianpi Longyanrou

Botanical Name

Pharmaceutical Drug Name

Dioscorea futschauensis

Rhizoma Dioscoreae Septemlobae Rhizoma Dioscoreae Hypoglaucae Rhizoma Dioscoreae Rhizoma Dioscoreae Septemlobae Calyx Kaki Radix Dipsaci Semen Lablab Album Rhizoma Drynariae Rhizoma Dryopteris Crassirhizomatis Radix Echinopsis Radix Echinopsis Thallus Eckloniae Herba Ecliptae Herba Ephedrae Herba Ephedrae Radix Ephedrae Herba Ephedrae Radix Ephedrae Herba Epimedii Herba Epimedii Herba Epimedii Herba Epimedii Herba Epimedii Herba Equiseti Hiemalis Folium Eriobotryae Flos Eriocauli Herba Erodii Caulis Erycibes Caulis Erycibes Oleum Eucalypti Cortex Eucommiae Flos Caryophylli Herba Eupatorii Herba Euphorbiae Humifusae Radix Kansui Semen Euphorbiae Herba Euphorbiae Humifusae Radix Euphorbiae Pekinensis Semen Euryales Fructus Evodiae Fructus Evodiae

Dioscorea hypoglauca Dioscorea opposita Dioscorea septemloba Diospyros kaki Dipsacus asperoides Dolichos lablab Drynaria fortunei Dryopteris crassirhizoma Echinops grijisii Echinops latifolius Ecklonia kurome Eclipta prostrata Ephedra equisetina Ephedra intermedia Ephedra intermedia Ephedra sinica Ephedra sinica Epimedium brevicornum Epimedium koreanum Epimedium pubescens Epimedium sagittatum Epimedium wushanense Equisetum hiemale Eriobotrya japonica Eriocaulon buergerianum Erodium stephanianum Erycibe obtusfolia Erycibe schmidtii Eucalyptus globulus et spp. Eucommia ulmoides Eugenia caryophyllata Eupatorium fortunei Euphorbia humifusa Euphorbia kansui Euphorbia lathyris Euphorbia maculata Euphorbia pekinensis Euryale ferox Evodia rutaecarpa Evodia rutaecarpa var. bodinieri Evodia rutaecarpa var. officinalis Fagopyrum dibotrys Ferula fukanensis Ferula sinkiangensis

Chinese Name Roman Mianbixie Fenbixie Shanyao Mianbixie Shidi Xuduan Baibiandou Gusuibu Mianmaguanzhong Yuzhou loulu Yuzhou loulu Kunbu Mohanlian Mahuang Mahuang Mahuanggen Mahuang Mahuanggen Yinyanghuo Yinyanghuo Yinyanghuo Yinyanghuo Yinyanghuo Muzei Pipaye Gujingcao Laoguancao Dinggongteng Dinggongteng Anyou Duzhong Dingxiang Peilan Dijincao Gansui Qianjinzi Dijincao Jingdaji Qianshi Wuzhuyu Wuzhuyu

Fructus Evodiae

Wuzhuyu

Rhizoma Fagopyri Dibotryis Resina Ferulae Resina Ferulae

Jinqiaomai Awei Awei (Continued)

(Continued) Botanical Name

Pharmaceutical Drug Name

Chinese Name Roman

Foeniculum vulgare Forsythia suspensa Fraxinus chinensis Fraxinus rhynchophylla Fraxinus stylosa Fraxinus szaboana Fritillaria cirrhosa Fritillaria delavayi Fritillaria hupehensis Fritillaria pallidiflora Fritillaria przewalskii Fritillaria thunbergii Fritillaria unibracteata Fritillaria ussuriensis Fritillaria walujewii Ganoderma lucidum Ganoderma sinensis Gardenia jasminoides Gastrodia elata Gentiana crassicaulis Gentiana dahurica Gentiana macrophylla Gentiana manshurica Gentiana ringescens Gentiana scabra Gentiana straminea Gentiana triflora Geranium carolinianum Geranium wilfordii Ginkgo biloba Ginkgo biloba Glechoma longituba Gleditsia sinensis Gleditsia sinensis Glehnia littoralis Glycine max Glycyrrhiza glabra Glycyrrhiza inflata Glycyrrhiza uralensis Hedysarum polybotrys Helwingia japonica Hippophae rhamnoides Homalomena occulta Hordeum vulgare Houttuynia cordata Hyoscyamus niger Ilex cornuta Illicium defengpi Illicium verum Impatiens balsamina

Fructus Foeniculi Fructus Forsythiae Cortex Fraxini Cortex Fraxini Cortex Fraxini Cortex Fraxini Bulbus Fritillariae Cirrhosae Bulbus Fritillariae Cirrhosae Bulbus Fritillariae Hupehensis Bulbus Fritillariae Pallidiflorae Bulbus Fritillariae Cirrhosae Bulbus Fritillariae Thunbergii Bulbus Fritillariae Cirrhosae Bulbus Fritillariae Ussuriensis Bulbus Fritillariae Pallidiflorae Ganoderma Ganoderma Fructus Gardeniae Rhizoma Gastrodiae Radix Gentianae Macrophyllae Radix Gentianae Macrophyllae Radix Gentianae Macrophyllae Radix Gentianae Radix Gentianae Radix Gentianae Radix Gentianae Macrophyllae Radix Gentianae Herba Geranii Herba Geranii Folium Ginkgo Semen Ginkgo Herba Glecomae Fructus Gleditsiae Abnormalis Spina Gleditsiae Radix Glehniae Semen Sojae Preparatum Radix Glycyrrhizae Radix Glycyrrhizae Radix Glycyrrhizae Radix Hedysari Medulla Helwingiae Fructus Hippophae Rhizoma Homalomenae Fructus Hordei Germinatus Herba Houttuyniae Semen Hyoscyami Folium Ilicis Cornutae Cortex Illicii Oleum Anisi Stellati Semen Impatientis

Xiaohuixiang Lianqiao Qinpi Qinpi Qinpi Qinpi Chuanbeimu Chuanbeimu Hubeibeimu Yibeimu Chuanbeimu Zhebeimu Chuanbeimu Pingbeimu Yibeimu Lingzhi Lingzhi Zhizi Tianma Qinjiao Qinjiao Qinjiao Longdan Longdan Longdan Qinjiao Longdan Laoguancao Laoguancao Yinxingye Baiguo Lianqiancao Zhuyazao Zaojiaoci Beishashen Dandouchi Gancao Gancao Gancao Hongqi Xiaotongcao Shaji Qiannianjian Maiya Yuxingcao Tianxianzi Gouguye Difengpi Bajiao Huixiangyou Jixingzi

Botanical Name

Pharmaceutical Drug Name

Chinese Name Roman

Imperata cylindrica var. major Inula britannica Inula helenium Inula japonica Inula japonica Inula linariifolia Inula racemosa Isatis indigotica Isatis indigotica Isatis indigotica Juglans regia Juncus effusus Kaempferia galanga Knoxia valerianoides Kochia scoparia Laminaria japonica Lasiosphaera fenzlii Leonurus japonicas Leonurus japonicus Lepidium apetalum Ligusticum chuanxiong Ligusticum jeholense Ligusticum sinense Ligustrum lucidum Lilium brownii var. viridulum Lilium lancifolium Lilium pumilum Lindera aggregata Lindera communis Linum usitatissimum Liquidambar formosana Liquidambar formosana Liquidambar orientalis Liriope muscari Liriope spicata var. prolifera Litchi chinensis Lithospermum erythrorhizon Litsea cubeba Lonicera confusa Lonicera dasystyla Lonicera hypoglauca Lonicera japonica Lonicera japonica Lophatherum gracile Luffa cylindrica Lycium barbarum Lycium barbarum Lycium chinense Lycopodium japonicum

Rhizoma Imperatae

Baimaogen

Flos Inulae Radix Inulae Flos Inulae Herba Inulae Herba Inulae Radix Inulae Folium Isatidis Radix Isatidis Indigo Naturalis Semen Juglandis Medulla Junci Rhizoma Kaempferiae Radix Knoxiae Fructus Kochiae Thallus Laminariae Lasiosphaera seu Calvatia Fructus Leonuri Herba Leonuri Semen Lepidii Rhizoma Chuanxiong Rhizoma Ligustici Rhizoma Ligustici Fructus Ligustri Lucidi Bulbus Lilii

Xuanfuhua Tumuxiang Xuanfuhua Jinfeicao Jinfeicao Tumuxiang Daqingye Banlangen Qingdai Hetaoren Dengxincao Shannai Hongdaji Difuzi Kunbu Mabo Chongweizi Yimucao Tinglizi Chuanxiong Gaoben Gaoben Nüzhenzi Baihe

Bulbus Lilii Bulbus Lilii Radix Linderae Oleum Linderae Semen Lini Fructus Liquidambaris Resina Liquidambaris Styrax Radix Liriopes Radix Liriopes Semen Litchi Radix Lithospermi Fructus Litseae Flos Lonicerae Flos Lonicerae Flos Lonicerae Flos Lonicerae Caulis Lonicerae Herba Lophatheri Retinervus Luffae Fructus Cortex Lycii Fructus Lycii Cortex Lycii Herba Lycopodii

Baihe Baihe Wuyao Xiangguozhi Yamazi Lulutong Fengxianzhi Suhexiang Shanmaidong Shanmaidong Lizhihe Zicao Bichengqie Jinyinhua Jinyinhua Jinyinhua Jinyinhua Rendongteng Danzhuye Sigualuo Digupi Gouqizi Digupi Shenjincao (Continued)

(Continued) Botanical Name

Pharmaceutical Drug Name

Chinese Name Roman

Lycopus lucidus var. hirtus Lygodium japonicum Lysimachia christinae Magnolia biondii Magnolia denudata Magnolia officinalis Magnolia officinalis Magnolia officinalis var. biloba Magnolia officinalis var. biloba Magnolia sprengeri Mahonia bealei Mahonia fortunei Malva verticillata Melia azedarach Melia toosendan Melia toosendan Menispermum dauricum Mentha haplocalyx Mentha haplocalyx

Herba Lycopi Spora Lygodii Herba Lysimachiae Flos Magnoliae Flos Magnoliae Cortex Magnoliae Officinalis Flos Magnoliae Officinalis Cortex Magnoliae Officinalis

Zelan Haijinsha Jinqiancao Xinyi Xinyi Houpo Houpohua Houpo

Flos Magnoliae Officinalis

Houpohua

Flos Magnoliae Caulis Mahoniae Caulis Mahoniae Fructus Malvae Cortex Meliae Cortex Meliae Fructus Toosendan Rhizoma Menispermi Herba Menthae Oleum Menthae Dementholatum Semen Momordicae Fructus Momordicae Radix Morindae Officinalis Fructus Mori Folium Mori Ramulus Mori Cortex Mori Herba Moslae Folium et Cacumen Murrayae Folium et Cacumen Murrayae Semen Myristicae Radix seu Rhizoma Nardostachyos Radix seu Rhizoma Nardostachyos Folium Nelumbinis Plumula Nelumbinis Receptaculum Nelumbinis Nodus Nelumbinis Rhizomatis Semen Nelumbinis Stamen Nelumbinis Semen Nigellae Rhizoma et Radix Notopterygii Rhizoma et Radix Notopterygii Oleum Ocimi Gratissimi Omphalia Radix Ophiopogonis Semen Oroxyli

Xinyi Gonglaomu Gonglaomu Dongkuiguo Kulianpi Kulianpi Chuanlianzi Beidougen Bohe Bohesuyou

Momordica cochinchinensis Momordica grosvenori Morinda officinalis Morus alba Morus alba Morus alba Morus alba Mosla chinensis Murraya exotica Murraya paniculata Myristica fragrans Nardostachys chinensis Nardostachys jatamansi Nelumbo nucifera Nelumbo nucifera Nelumbo nucifera Nelumbo nucifera Nelumbo nucifera Nelumbo nucifera Nigella glandulifera Notopterygium forbesii Notopterygium incisum Ocimum gratissimum Omphalia lapidescens Ophiopogon japonicus Oroxylum indicum

Mubiezi Luohanguo Bajitian Sangshen Sangye Sangzhi Sangbaipi Xiangru Jiulixiang Jiulixiang Roudoukou Gansong Gansong Heye Lianzixin Lianfang Oujie Lianzi Lianxu Heizhongcaozi Qianghuo Qianghuo Dingxiang Luoleyou Leiwan Maidong Muhudie

Botanical Name

Pharmaceutical Drug Name

Chinese Name Roman

Oryza sativa Paeonia lactiflora Paeonia suffruticosa Paeonia veitchii Panax ginseng Panax ginseng Panax japonicus Panax japonicus var. bipinnatifidus Panax japonicus var. major Panax notoginseng Panax quinquefolium Papaver somniferum Paris polyphylla var. chinensis Paris polyphylla var. yunnanensis Perilla frutescens Perilla frutescens Perilla frutescens Periploca sepium Peucedanum decursivum Peucedanum praeruptorum Pharbitis nil Pharbitis pupurea Phaseolus angularis Phaseolus calcaratus Phellodendron amurense Phellodendron chinensis Phragmitis communis Phyllanthus emblica Phyllostachys nigra var. henonis Physalis alkekengi var. franchetii Physochlaina infundibularis Phytolacca acinosa Phytolacca americana Picrasma quassioides Picrorhiza scrophulariiflora Pinellia ternata Pinus massoniana et spp. Pinus spp. Pinus tabulaeformis et spp. Piper kadsura Piper longum Piper nigrum Plantago asiatica Plantago asiatica Plantago depressa Plantago depressa

Fructus Oryzae Germinatus Radix Paeoniae Rubra Cortex Moutan Radix Paeoniae Rubra Radix Ginseng Folium Ginseng Rhizoma Panacis Japonici Rhizoma Panacis Majoris

Daoya Chishao Mudanpi Chishao Renshen Renshenye Zhujieshen Zhuzishen

Rhizoma Panacis Majoris Radix Notoginseng Radix Panacis Quinquefolii Pericarpium Papaveris Rhizoma Paridis

Zhuzishen Sanqi Xiyangshen Yingsuqiao Chonglou

Rhizoma Paridis

Chonglou

Fructus Perillae Folium Perillae Caulis Perillae Cortex Periplocae Radix Peucedani Radix Peucedani Semen Pharbitidis Semen Pharbitidis Semen Phaseoli Semen Phaseoli Cortex Phellodendri Cortex Phellodendri Rhizoma Phragmitis Fructus Phyllanthi Caulis Bambusae in Taeniam

Zisuzi Zisuye Zisugeng Xiangjiapi Qianhu Qianhu Qianniuzi Qianniuzi Chixiaodou Chixiaodou Huangbo Huangbo Lugen Yuganzi Zhuru

Calyx seu Fructus Physalis

Jindenglong

Radix Physochlainae Radix Phytolaccae Radix Phytolaccae Ramulus et Folium Picrasmae Rhizoma Pircrorhizae Rhizoma Pinelliae Pollen Pini Oleum Terebinthinae Pollen Pini Caulis Piperis Kadsurae Fructus Piperis Longi Fructus Piperis Herba Plantaginis Semen Plantaginis Herba Plantaginis Semen Plantaginis

Huashanshen Shanglu Shanglu Kumu Huhuanglian Banxia Songhuafen Songjieyou Songhuafen Haifengteng Bibo Hujiao Cheqiancao Cheqianzi Cheqiancao Cheqianzi (Continued)

(Continued) Botanical Name

Pharmaceutical Drug Name

Chinese Name Roman

Platycladus orientalis Platycladus orientalis Platycodon grandiflorum Pleione bulbocodioides

Semen Platycladi Cacumen Platycladi Radix Platycodonis Pseudobulbus Cremastrae seu Pleiones Pseudobulbus Cremastrae seu Pleiones Herba Pogostemonis Radix Polygalae Radix Polygalae Rhizoma Polygonati Rhizoma Polygonati Rhizoma Polygonati Odorati Rhizoma Polygonati Herba Polygoni Avicularis Rhizoma Polygoni Bistortae Rhizoma Polygoni Cuspidati Radix Polygoni Multiflori Caulis Polygoni Multiflori Fructus Polygoni Orientalis Folium Polygoni Tinctorii Indigo Naturalis Polyporus Poria Herba Portulacae Herba Potentillae Chinensis Nux Prinsepiae Spica Prunellae Semen Armeniacae Amarum Semen Armeniacae Amarum

Baiziren Cebaiye Jiegeng

Semen Armeniacae Amarum Semen Armeniacae Amarum Semen Persicae Semen Pruni Semen Pruni Flos Mume Fructus Mume Semen Pruni Semen Persicae Cortex Pseudolaricis Radix Pseudostellariae Fructus Psoraleae Radix Puerariae Radix Puerariae Radix Pulsatillae Pericarpium Granati Herba Pyrolae Herba Pyrolae Folium Pyrrosiae

Kuxingren Kuxingren Taoren Yuliren Yuliren Meihua Wumei Yuliren Taoren Tujingpi Taizishen Buguzhi Gegen Gegen Baitouweng Shiliupi Luxiancao Luxiancao Shiwei

Pleione yunnanensis Pogostemon cablin Polygala sibirica Polygala tenuifolia Polygonatum cyrtonema Polygonatum kingianum Polygonatum odoratum Polygonatum sibiricum Polygonum aviculare Polygonum bistorta Polygonum cuspidatum Polygonum multiflorum Polygonum multiflorum Polygonum orientale Polygonum tinctorium Polygonum tinctorium Polyporus umbellatus Poria cocos Portulaca oleracea Potentilla chinensis Prinsepia uniflora Prunella vulgaris Prunus armeniaca Prunus armeniaca mandshurica Prunus armeniaca sibirica Prunus armeniaca var. ansu Prunus davidiana Prunus humilis Prunus japonica Prunus mume Prunus mume Prunus pedunculata Prunus persica Pseudolarix kaempferi Pseudostellaria heterophylla Psoralea corylifolia Pueraria lobata Pueraria thomsonii Pulsatilla chinensis Punica granatum Pyrola calliantha Pyrola decorata Pyrrosia lingua

Shancigu Shancigu Guanghuoxiang Yuanzhi Yuanzhi Huangjing Huangjing Yuzhu Huangjing Bianxu Quanshen Huzhang Heshouwu Shouwuteng Shuihonghuazi Liaodaqingye Qingdai Zhuling Fuling Machixian Weilingcai Ruiren Xiakucao Kuxingren Kuxingren

Botanical Name

Pharmaceutical Drug Name

Chinese Name Roman

Pyrrosia petiolosa Pyrrosia sheareri Quisqualis indica Ranunculus ternatus Raphanus sativus Rehmannia glutinosa Rhaponticum uniflorum Rheum officinale Rheum palmatum Rheum tanguticum Rhododendron dauricum Rhododendron dauricum Rhododendron molle Rhus chinensis Rhus potaninii Rhus punjabensis var. sinica Ricinus communis Ricinus communis Rosa chinensis Rosa laevigata Rosa rugosa Rubia cordifolia Rubus chingii Salvia miltiorrhiza Sanguisorba officinalis, S. officinalis var. longifolia Santalum album Saposhnikovia divaricata Sarcandra glabra Sargassum fusiforme Sargassum pallidum Sargentodoxa cuneata Saururus chinensis Schisandra chinensis Schisandra sphenanthera

Folium Pyrrosiae Folium Pyrrosiae Fructus Quisqualis Radix Ranunculi Ternati Semen Raphani Radix Rehmanniae Radix Rhapontici Radix et Rhizoma Rhei Radix et Rhizoma Rhei Radix et Rhizoma Rhei Folium Rhododendri Daurici Oleum Rhododendri Daurici Flos Rhododendri Mollis Galla Chinensis Galla Chinensis Galla Chinensis Oleum Ricini Semen Ricini Flos Rosae Chinensis Fructus Rosae Laevigatae Flos Rosae Rugosae Radix Rubiae Fructus Rubi Radix Salviae Miltiorrhizae Radix Sanguisorbae

Shiwei Shiwei Shijunzi Maozhaocao Laifuzi Dihuang Loulu Dahuang Dahuang Dahuang Manshanhong Manshanhongyou Naoyanghua Wubeizi Wubeizi Wubeizi Bimayou Bimazi Yuejihua Jinyingzi Meiguihua Qiancao Fupenzi Danshen Diyu

Lignum Santali Albi Radix Saposhnikoviae Herba Sarcandrae Sargassum Sargassum Caulis Sargentodoxae Herba seu Rhizoma Saururi Fructus Schisandrae Chinensis Fructus Schisandrae Sphenantherae Herba Schizonepetae Concretio Silicea Bambusae Radix Scrophulariae Radix Scutellariae Herba Scutellariae Barbatae Herba Sedi Herba Selaginellaceae Herba Selaginellaceae Radix Semiaquilegiae Semen Sesami Nigrum Oleum Sesami Fructus Setariae Germinatus Herba Siegesbeckiae Herba Siegesbeckiae Herba Siegesbeckiae

Tanxiang Fangfeng Zhongjiefeng Haizao Haizao Daxueteng Sanbaicao Wuweizi

Schizonepeta tenuifolia Schizostachyum chinense Scrophularia ningpoensis Scutellaria baicalensis Scutellaria barbata Sedum sarmentosum Selaginella pulvinata Selaginella tamariscina Semiaquilegia adoxoides Sesamum indicum Sesamum indicum Setaria italica Siegesbeckia glabrescens Siegesbeckia orientalis Siegesbeckia pubescens

Nanwuweizi Jingjie Tianzhuhuang Xuanshen Huangqin Banzhilian Chuipencao Juanbai Juanbai Tiankuizi Heizhima Mayou Guya Xixiancao Xixiancao Xixiancao (Continued)

(Continued) Botanical Name

Pharmaceutical Drug Name

Chinese Name Roman

Sinapsis alba Sinocalamus beecheyanus var. pubescens Sinomenium acutum Sinomenium acutum var. cinereum Sinopodophyllum emodi Smilax glabra Sophora flavescens Sophora japonica Sophora japonica Sophora tonkinensis Sparganium stoloniferum Spatholobus suberectus Spirodela polyrrhiza Stachyurus chinensis Stachyurus himalaicus Stellaria dichotoma var. lanceolata Stemona japonica Stemona sessilifolia Stemona tuberosa Stephania tetranda Sterculia lychnophora Strychnos nux-vomica Styrax tonkinensis Swertia mileensis Tamarix chinensis Taraxacum mongolicum et spp. Taraxacum sinicum et spp. Taxillus chinensis Terminalia bellerica Terminalia chebula Terminalia chebula var. tomentella Tetrapanax papyriferus Tinospora capillipes Tinospora sagittata Torreya grandis Toxicodendron vernicifluum Trachelospermum jasminoides Trachycarpus fortunei Tribulus terrestris Trichosanthes kirilowii Trichosanthes kirilowii Trichosanthes kirilowii Trichosanthes kirilowii Trichosanthes rosthornii

Semen Sinapsis (Albae)

Jiezi

Caulis Bambusae in Taeniam Caulis Sinomenii Caulis Sinomenii

Zhuru Qingfengteng Qingfengteng

Fructus Sinopodophylli Rhizoma Smilacis Glabrae Radix Sophorae Flavescentis Fructus Sophorae Flos Sophorae Radix Sophorae Tonkinensis Rhizoma Sparganii Caulis Spatholobi Herba Spirodelae Medulla Stachyuri Medulla Stachyuri Radix Stellariae

Xiaoyelian Tufuling Kushen Huaijiao Huaihua Shandougen Sanleng Jixueteng Fuping Xiaotongcao Xiaotongcao Yinchaihu

Radix Stemonae Radix Stemonae Radix Stemonae Radix Stephaniae Tetrandae Semen Sterculiae Lychnophorae Semen Strychni Benzoinum Herba Swertiae Mileensis Cacumen Tamaricis Herba Taraxaci

Baibu Baibu Baibu Fangji Pangdahai Maqianzi Anxixiang Qingyedan Xiheliu Pugongying

Herba Taraxaci Herba Taxilli Fructus Terminaliae Billericae Fructus Chebulae Fructus Chebulae

Pugongying Sangjisheng Maohezi Hezi Hezi

Medulla Tetrapanacis Radix Tinosporae Radix Tinosporae Semen Torreyae Resina Toxicodendri Caulis Trachelospermi

Tongcao Jinguolan Jinguolan Feizi Ganqi Luoshiteng

Petiolus Trachycarpi Fructus Tribuli Fructus Trichosanthis Pericarpium Trichosanthis Radix Trichosanthis Semen Trichosanthis Fructus Trichosanthis

Zonglu Jili Gualou Gualoupi Tianhuafen Gualouzi Gualou

Botanical Name

Pharmaceutical Drug Name

Chinese Name Roman

Trichosanthes rosthornii Trichosanthes rosthornii Trichosanthes rosthornii Trigonella foenum-graecum Tussilago farfara Typha angustifolia et spp. Typha orientalis et spp. Typhonium giganteum Uncaria hirsuta Uncaria macrophylla Uncaria rhynchophylla Uncaria sessilifructus Uncaria sinensis Vaccaria segetalis Verbena officinalis Viola yedoensis Viscum coloratum Vitex negundo var. cannabifolia Vitex negundo var. cannabifolia Vitex trifolia Vitex trifolia var. simplicifolia Vladimiria souliei Vladimiria souliei var. cinerea Xanthium sibiricum Zanthoxylum bungeanum Zanthoxylum nitidum Zanthoxylum schinifolium Zingiber officinale Zingiber officinale Ziziphus jujuba Ziziphus jujuba var. spinosa

Pericarpium Trichosanthis Radix Trichosanthis Semen Trichosanthis Semen Trigonellae Flos Farfarae Pollen Typhae Pollen Typhae Rhizoma Typhonii Ramulus Uncariae cum Uncis Ramulus Uncariae cum Uncis Ramulus Uncariae cum Uncis Ramulus Uncariae cum Uncis Ramulus Uncariae cum Uncis Semen Vaccariae Herba Verbenae Herba Violae Herba Visci Folium Viticis Negundo

Gualoupi Tianhuafen Gualouzi Huluba Kuandonghua Puhuang Puhuang Baifuzi Gouteng Gouteng Gouteng Gouteng Gouteng Wangbuliuxing Mabiancao Zihuadiding Hujisheng Mujingye

Oleum Viticis Negundo

Mujingyou

Fructus Viticis Fructus Viticis

Manjingzi Manjingzi

Radix Vladimiriae Radix Vladimiriae

Chuanmuxiang Chuanmuxiang

Fructus Xanthii Pericarpium Zanthoxyli Radix Zanthoxyli Pericarpium Zanthoxyli Rhizoma Zingiberis Recens Rhizoma Zingiberis Fructus Jujubae Semen Ziziphi Spinosae

Cang’erzi Huajiao Liangmianzhen Huajiao Shengjiang Ganjiang Dazao Suanzaoren

Source: Southern Cross University, Australia.

International pharmaceutical names

Pharmaceutical Name

Botanical Name

Common English Name(s)

Absinthii herba Aconiti herba

Artemisia absinthium Aconitum napellus

Aconiti tuber

Aconitum napellus

Adonidis herba Agni casti fructus Agrimoniae herba Agrimoniae herba Alchemillae alpinae herba Alchemillae herba Allii cepae bulbus Allii cepae bulbus Allii cepae bulbus Allii sativi bulbus Allii satwi bulbus Aloe barbadensis Aloe barbadensis Aloe barbadensis Aloe capensis Aloe gel Althaeae folium Althaeae radix Ammeos visnagae fructus Ammeos visnagae fructus Ammi majoris fructus Andrographidis herba Anethi fructus Anethi herba Angeliaceae sinensis radix Angelicae fructus Angelicae herba Angelicae radix Anisi aetheroleum Anisi fructus Anisi stellati

Adonis vernalis Vitex agnus castus Agrimonia eupatoria Agrimonia procera Alchemilla alpine Alchemilla vulgaris Allium cepa Allium esculentum Allium porrum Allium sativum Porvium sativum Aloe barbadensis Aloe barbadensis Aloe vera Aloe ferox Aloe vera Althaea officinalis Althaea officinalis Ammi daucoides Ammi visnaga Ammi majus Andrographidis paniculata Anethum graveolens Anethum graveolens Angelica sinensis Angelica archangelica Angelica archangelica Angelica archangelica Pimpinella anisum Pimpinella anisum Illicium return

Wormwood Aconite herb, Monkshood herb Aconite tuber, Monkshood tuber Pheasant’s Eye herb Chaste Tree fruit Agrimony Cocklebur Alpine Lady’s Mantle herb Lady’s Mantle Onion Onion Onion Garlic Garlic Aloe Curacao aloe Aloe Cape aloe Aloe vera gel Marshmallow leaf Marshmallow root Bishop’s Weed fruit Bishop’s Weed fruit Bishop’s Weed fruit Chiretta herb Dill seed Dill herb Chinese Angelica root Angelica seed Angelica herb Angelica root Aniseed essential oil Anise/Aniseed Star Anise

Pharmaceutical Name

Botanical Name

Common English Name(s)

Antennariae dioicae flos

Antennaria dioica

Apii fructus Apii herba Apii radix Apium graveolens Armeniacae semen Armoraciae rusticanae radix Armoraciae rusticanae radix Arnicae flos Arnicae flos Artemisiae vulgaris herba Artemisiae vulgaris radix Asparagi herba Asparagi rhizoma Astragali radix Astragali radix Aurantii flos Aurantii flos aetheroleum Aurantii pericarpium Avenae fructus Avenae herba Avenae stramentum Azadirachti folium Balsamum peruvianum Balsamum tolutanum Bardanae radix Bardanae radix Bardanae radix Barosmae folium Barosmae folium Basilici aetheroleum Basilici herba Belladonnae folium

Apium graveolens Apium graveolens Apium graveolens Apium graveolens Prunus armeniaca Armoracia rusticana

Cat’s Ear flower, Cat’s Foot flower Celery seed Celery herb Celery root Celery Apricot seed Horseradish

Cochlearia armoracia

Horseradish

Arnica chamissonis Arnica montana Artemisia vulgaris Artemisia vulgaris Asparagus officinalis Asparagus officinalis Astragalus membranaceus Astragalus mongholicus Citrus aurantium Citrus aurantium Citrus aurantium Avena sativa Avena sativa Avena sativa Azadirachta indica Myroxylon balsamum Myroxylon balsamum Arctium lappa Arctium minus Arctium tomentosum Agathosma betulina Barosma betulina Ocimum basilicum Ocimum basilicum Atropa belladonna

Belladonnae radix

Atropa belladonna

Berberidis cortex Berberidis fructus Berberidis radicis cortex Berberidis radix Betulae folium Betulae folium Boldo folium Boraginis flos Boraginis herba Bromelainum Bruceae fructus Bryoniae radix

Berberis vulgaris Berberis vulgaris Berberis vulgaris Berberis vulgaris Betula pendula Betula pubescens Peumus boldus Borago officinalis Borago officinalis Ananas comosus Brucea javanica Bryonia alba

Arnica flower Arnica flower Mugwort herb Mugwort root Asparagus herb Asparagus root Astragalus root Astragalus root Bitter Orange flower Bitter Orange flower oil Bitter Orange peel Oats Oat herb Oat straw Neem tree leaf Peruvian Balsam Tolu Balsam Burdock root Burdock root Burdock root Buchu leaf Buchu leaf Basil oil Basil herb Belladonna leaf, Deadly Nightshade leaf Belladonna root, Deadly Nightshade root Barberry bark Barberry Barberry root bark Barberry root Birch leaf Birch leaf Boldo leaf Borage flower Borage herb Bromelain Brucea fruit Bryonia root (Continued)

(Continued) Pharmaceutical Name

Botanical Name

Common English Name(s)

Bryoniae radix Bupleuri radix Bupleuri radix Bursae pastoris herba Cacao semen Cacao testes Cajuputi aetheroleum Calendulae flos Calendulae herba Callunae vulgaris flos Callunae vulgaris herba Camphora Capsicum Cardamomi fructus Cardui mariae fructus Cardui mariae herba Caricae fructus Caricae papayae folium Caricis rhizoma Carthami flos Carvi aetheroleum Carvi fructus Caryophylli flos Caryophylli flos Caryophylli flos Castaneae folium Castaneae folium Castaneae folium Centarii herba Centarii herba Centaurii herba Centaurii herba Centellae herba Centellae herba Chamomillae flos Chamomillae romanae flos Chamomillae romanae flos Chelidonii herba Chrysanthemi vulgaris flos Chrysanthemi vulgaris flos Chrysanthemi vulgaris herba Chrysanthemi vulgaris herba Cichorium intybus Cimicifugae racemosae rhizoma Cinchonae cortex Cinchonae cortex Cinnamomi cassiae cortex

Bryonia cretica Bupleurum chinense Bupleurum falcatum Capsella bursa pastoris Theobroma cacao Theobroma cacao Melaleuca leucodendra Calendula officinalis Calendula officinalis Calluna vulgaris Calluna vulgaris Cinnamomum camphora Capsicum frutescens Elettaria cardamomum Silybum marianum Silybum marianum Ficus carica Carica papaya Carex arenaria Carthamus tinetorius Carum carvi Carum carvi Eugenia caryopfryllata Jambosa caryoplvyllus Syzigium aromaticum Castanea sativa Castanea vesca Castanea vulgaris Centaurium erythraea Centaurium minus Centaurium umbellatum Erythraea centaurium Centella asiatica Trisanthus cochinchineusis Chamomilla rucutita Anthemis nobilis Chamaemelum nobile Chelidonium majus Chrysanthemum vulgare Tanacetum vulgare Chrysanthemum vulgare

Bryonia root Chinese thorowax root Bupleurum root Shepherd’s Purse Cocoa seed Cocoa Cajeput oil Calendula flower Calendula herb Heather flower Heather herb Camphor Cayenne (Paprika) Cardamom Milk Thistle fruit Milk Thistle herb Figs Papaya leaf Sarsaparilla root, German Safflower flower Caraway oil Caraway seed Cloves Cloves Cloves Chestnut leaf Chestnut leaf Chestnut leaf Centaury herb Centaury herb Centaury herb Centaury herb Asiatic pennywort herb Asiatic pennywort herb Chamomille, German Chamomile, Roman Chamomile, Roman Celandine herb Tansy flower Tansy flower Tansy herb

Tanacetum vulgare

Tansy herb

Cichorium infybus Cimicifuga racemosa

Chicory Black Cohosh root

Cinchona pubescens Cinchona succirubra Cinnamomum aromaticum

Cinchona bark Cinchona bark Cinnamon bark, Chinese

Pharmaceutical Name

Botanical Name

Common English Name(s)

Cinnamomi cassiae cortex Cinnamomi ceylanici cortex Cinnamomi ceylanici cortex Cinnamomi cortex Cinnamomi flos Cinnamomi flos Citri sinensis pericarpium Cnici benedicti herba Coffeae carbo Coffeae carbo Coffeae carbo Coffeae carbo Colae semen Colchicum, Colchicum autumnale Colocynthidis fructus Condurango cortex Convallariae herba Coptidis rhizoma Coriandri fructus Crataegi flos Crataegi flos Crataegi folium Crataegi folium Crataegi folium cum flore Crataegi folium cum flore Crataegi folium cum flore Crataegi folium cum flore Crataegi folium cum flore Crataegi fructus Crataegi fructus Croci stigma Cucurbitae peponis semen Curcumae longae rhizoma Curcumae longae rhizoma Curcumae longae rhizoma Curcumae xanthorrhizae rhizoma Cyani flos Cymbopoginis citrati aetheroleum Cymbopoginis citrati herba Cymbopoginis nardi herba Cymbopoginis winteriani aetheroleum Cynarae folium Cynoglossi herba Cynoglossi herba Cytisi scoparii flos

Cinnamomum cassia Cinnamomum verum

Cinnamon bark, Chinese Cinnamon bark

Cinnamomum zeylanicum

Cinnamon bark

Cinnamomum cassia Cinnamomum aromaticum Cinnamomum cassia Citrus sinensis Cnicus benedictus Coffea Arabica Coffea canephora Coffea liberica Coffea spp. Cola nitida Colchicum autumnale

Cinnamon bark Cinnamon flower Cinnamon flower Orange peel Blessed Thistle herb Coffee charcoal Coffee charcoal Coffee charcoal Coffee charcoal Cola nut Autumn Crocus

Citruiius colocynthis Marsdenia condurango Convallaria majalis Coptis chinensis Coriandrum sativum Crataegus laevigata Crataegus monogyna Crataegus laevigata Crataegus monogyna Crataegus azardus Crataegus laevigata Crataegus monogyna Crataegus oxycanthoides Crataegus pentagyna Crataegus laevigata Crataegus monogyna Crocus sativa Cucurbita pepo Curcuma aromatica Curcuma domestica Curcuma longa Curcuma xanthorrhiza

Colocynth Condurango bark Lily-of-the-valley herb Chinese goldthread rhizome Coriander Hawthorn flower Hawthorn flower Hawthorn leaf Hawthorn leaf Hawthorn leaf and flower Hawthorn leaf and flower Hawthorn leaf and flower Hawthorn leaf and flower Hawthorn leaf and flower Hawthorn berry Hawthorn berry Saffron Pumpkin seed Turmeric root Turmeric root Turmeric root Turmeric, Javanese

Centaurea cyanus Cymbopogon citratus

Cornflower West Indian lemongrass oil

Cymbopogon citratus Cymbopogon nardus Cymbopogon winterianus

West Indian lemongrass Ceylon citronella grass Java citronella oil

Cynara scolymus Cynoglossum clandestinum Cynoglossum officinale Cytisus scoparius

Artichoke leaf Hound’s Tongue herb Hound’s Tongue herb Scotch Broom flower (Continued)

(Continued) Pharmaceutical Name

Botanical Name

Common English Name(s)

Cytisi scoparii flos Cytisi scoparii herba Cytisi scoparius flos Cytisi scoparius flos Cytisi scoparius herba Cytisi scoparius herba Delphinii flos Droserae herba Droserae herba Droserae herba Droserae herba Dulcamarae stipites Echinaceae angustifoliae herba Echinaceae angustifoliae radix Echinaceae pallidae herba Echinaceae pallidae radix Echinaceae purpureae herba Echinaceae purpureae radix Eleutherococci radix Ephedrae herba Ephedrae herba Equiseti herba Eschscholziae Eucalypti aetheroleum Eucalypti aetheroleum Eucalypti aetheroleum Eucalypti aetheroleum Eucalypti folium Euphrasiae herba Faex medicinalis Faex medicinalis Farfarae flos Farfarae folium Farfarae herba Farfarae radix Filicis maris folium Filicis maris herba Filicis maris rhizoma Filipendula ulmaria Filipendulae ulmariae herba Foeniculi aetheroleum Foeniculi fructus Foenugraeci semen Fragariae folium Fragariae folium Frangulae cortex

Sarothamnus scoparius Cytisus scoparius Cytisus scoparius Sarothamnus scoparius Cytisus scoparius Sarothamnus scoparius Delphinium consolida Drosera intermedia Drosera longifolia Drosera ramentacea Drosera rotundifolia Solanum dulcamara Echinacea angustifolia

Scotch Broom flower Scotch Broom herb Broom flower, Scotch Broom flower, Scotch Broom herb, Scotch Broom herb, Scotch Delphinium flower Sundew herb Sundew herb Sundew herb Sundew herb Woody Nightshade Echinacea Angustifolia herb

Echinacea angustifolia

Echinacea Angustifolia root

Echinacea pallida Echinacea pallida Echinacea purpurea

Echinacea Pallida herb Echinacea Pallida root Echinacea Purpurea herb, Purple Coneflower herb Echinacea Purpurea root Siberian Ginseng root Ephedra Ephedra Horsetail herb California Poppy Eucalyptus oil Eucalyptus oil Eucalyptus oil Eucalyptus oil Eucalyptus leaf Eyebright herb Yeast, Brewer’s Yeast, Brewer’s Coltsfoot flower Coltsfoot leaf Coltsfoot herb Coltsfoot root Male fern leaf Male fern herb Male fern rhizome Meadowsweet Meadowsweet flowering tops Fennel oil Fennel seed Fenugreek seed Strawberry leaf Strawberry leaf Buckthorn bark

Echinacea purpurea Acanthopanax senticosus Ephedra shennungiana Ephedra sinica Equisetum arvense Eschscholzia californica Eucalyptus fructicetorum Eucalyptus globulus Eucalyptus polybractea Eucalyptus smithii Eucalyptus globulus Euphrasia officinalis Candida utilis Saccaromyces cerevisiae Tussilago farfara Tussilago farfara Tussilago farfara Twssilago farfara Dryopteris filix-mas Dryopteris filix-mas Dryopteris filix-mas Spiraea ulmaria Filipendula ulmaria Foeniculum vulgare Foeniculum vulgare Trigonella foenum-graecum Fragaria vesca Fragaria viridis Frangula alnus

Pharmaceutical Name

Botanical Name

Common English Name(s)

Frangulae cortex Fraxini cortex Fraxini folium Fucus Fucus Fumariae herba Galangae rhizoma Galegae officinalis herba Galeopsidis herba Galeopsidis herba Galii odorati herba Gelsemii rhizoma Gentianae radix Ginkgo folium

Rhamnus frangula Fraxinus excelsior Fraxinus excelsior Ascophyllum nodosum Fucus vesiculosus Fumaria officinalis Alpinia officinarum Galega officinalis Galeopsis ochroleuca Gakopsis segetum Galium odoratum Gelsemiums sempervirens Gentiana lutea Ginkgo biloba

Ginseng radix Glycyrrhizae radix Graminis flos Graminis rhizoma Grindeliae herba Grindeliae herba Guaiaci lignum Guaiaci lignum Gugguli gummi

Panax ginseng Glycyrrhiza uralensis Poa spp. Agropyron repens Grindelia robusta Grindelia squarrosa Guaiacum officinale Guaiacum sanctum Commiphora mukul

Gypsophilae radix Hamamelidis cortex Hamamelidis folium Harpagophyti radix

Gypsophila paniculata Hamamelis virginiana Hamamelis virginiana Harpagophytum procumbens Harungana madagascariensis

Buckthorn bark Ash bark Ash leaf Bladderwrack Bladderwrack Fumitory Galangal Goat’s Rue herb Hempnettle herb Hempnettle herb Sweet Woodruff herb Yellow Jessamine rhizome Gentian root Ginkgo Biloba leaf/leaf extract Ginseng root Licorice root Hay flower Couch grass rhizome Gumweed herb Gumweed herb Guaiac wood Guaiac wood Indian boledlium oleo-gum resin Soapwort root, White Witch Hazel bark Witch Hazel leaf Devil’s Claw root

Harunganae madagascariensis cortex et folium Hederae helicis folium Helenii radix Helichrysi flos Hepatici nobilis herba Herniariae Herniariae Hibisci flos Hippocastani cortex Hippocastani flos Hippocastani folium Hippocastani semen Hydrastis rhizoma Hyoscyami folium Hyperici herba Hyssopi aetheroleum Hyssopi herba Ipecacuanhae radix

Hedera helix Inula helenium Helichrysum arenarium Hepatica nobiiis Herniaria glabra Herniaria hirsute Hibiscus sabdariffa Aesculus hippocastanum Aesculus hippocastanum Aesculus hippocastanum Aesculus hippocastanum Hydrastis canadensis Hyoscyamus niger Hypericum perforatum Hyssopus officinalis Hyssopus officinalis Cephaelis ipecacuanha

Haronga bark and leaf Ivy leaf Elecampane root Sandy Everlasting flower Liverwort herb Rupturewort Rupturewort Hibiscus flower Horse Chestnut bark Horse Chestnut flower Horse Chestnut leaf Horse Chestnut seed Goldenseal rhizomes, roots Henbane leaf St. John’s Wort flowering tops Hyssop oil Hyssop herb Ipecac root (Continued)

(Continued) Pharmaceutical Name

Botanical Name

Common English Name(s)

Iridis rhizoma

Iris florentina [Iris germanica var. florentina] Iris germanica Iris pallida Juglans regia Juglans regia Juniperus communis

Orris root Orris root Orris root Walnut leaf Walnut hull Juniper berry

Lamium album Lamium album Laminaria cloustonii Laminaria hyuperborea Lavandula angustifolia Lavandula angustifolia Glycine max Ledum palustre Leonurus cardiac Levisticum officinale Cetraria islandica Linum usitatissimum Glycyrrhiza glabra Humulus lupulus Lycopus europaeus Lycopus virginicus Majorana hortensis Origanum majorana Majorana hortensis Origanum majorana Alcea rosea Althaea rosea Malva sylvestris Malva sylvestris Fraxinus ornus Marrubium vulgare Ilex paraguariensis Chamomilla rucutita Matricaria recutita Meraleuca alternifolia

White Dead Nettle flower White Dead Nettle herb Kelp Kelp Lavender essential oil Lavender flower Soy Lecithin March Tea Motherwort herb Lovage root Iceland Moss Flaxseed/Linseed Licorice root Hops strobili Bugleweed Bugleweed Marjoram oil Marjoram oil Marjoram herb Marjoram herb Hollyhock flower Hollyhock flower Mallow flower Mallow leaf Manna Horehound herb Maté Chamomille flower, German Chamomile flower, German Australian tea tree oil

Melilotus altissimus Melilotus officinalis Melissa officinalis Mentha arvensis

Sweet clover herb Sweet clover/Melilot herb Lemon balm leaf Mint oil

Mentha x piperita

Peppermint oil

Mentha x piperita Mentzelia cordifolia Menyanthes trifoliate Achillea millefolium

Peppermint leaf Mentzelia Bogbean leaf Yarrow flower

Iridis rhizoma Iridis rhizoma Juglandis folium Juglandis fructus cortex Juniperi fructus pseudofructus Lamii albi flos Lamii albi herba Laminariae stipites Laminariae stipites Lavandulae aetheroleum Lavandulae flos Lecithin ex soja Ledi palustris herba Leonuri cardiacae herba Levistici radix Lichen islandicus Lini semen Liquiritiae radix Lupuli strobulus Lycopi herba Lycopi herba Majoranae aetheroleum Majoranae aetheroleum Majoranae herba Majoranae herba Malvae arboreae flos Malvae arboreae flos Malvae flos Malvae folium Manna Marrubii herba Mate folium Matricariae flos Matricariae flos Melalencae alternifolia aetheroleum Meliloti herba Meliloti herba Melissae folium Menthae arvensis aetheroleum Menthae piperitae aetheroleum Menthae piperitae folium Mentzeliae cordifoliae Menyanthis folium Millefolii flos

Pharmaceutical Name

Botanical Name

Common English Name(s)

Millefolii herba Myristica aril Myristica fragrans Myrrha gummi Myrtilli folium Myrtilli fructus

Achillea millefolium Myristica fragrans Myristica fragrans Commiphora molmol Vaccinium myrtillus Vaccinium myrtillus

Nasturtii herba Niauli atheroleum Ocimi Sancti folium Oenotherae oleum Oleae folium/oleum Oleandri folium Ononidis radix Origani vulgaris herba Orthosiphonis folium

Nasturtium officinale Melaleuca viridiflora Ocimum sanctum Oenothera biennis Olea europaea Nerium oleander Ononis spinose Origanum vulgare Orthosiphon spicatus

Orthosiphonis folium

Orthosiphon stamineus

Paeoniae flos Paeoniae flos Paeoniae radix Paeoniae radix Paeoniae radix Papainum crudum Passiflorae herba Petasitidis folium Petasitidis rhizoma Petroselini fructus Petroselini herba/radix Phaseoli fructus sine semine Phospholipide ex soja Piceae aetheroleum Piceae aetheroleum Piceae aetheroleum Piceae aetheroleum Piceae aetheroleum Piceae turiones recentes Pimpinellae herba Pimpinellae herba Pimpinellae radix Pimpinellae radix Pini aetheroleum Pini aetheroleum Pini aetheroleum Pini aetheroleum Pini turiones Piperis methystici rhizoma Plantaginis lanceolatae folium/herba

Paeonia mascula Paeonia officinalis Paeonia lactifolia Paeonia mascula Paeonia officinalis Carica papaya Passiflora incarnata Petasites spp. Petasites hybridus Petroselinum crispum Petroselinum crispum Phaseolus vulgaris

Yarrow herb Mace Nutmeg Myrrh oleo-gum resin Bilberry leaf Bilberry fruit, Blueberry fruit Watercress herb Niauli oil Holy Basil leaf Evening primrose oil Olive leaf/oil Oleander leaf Restharrow root Oregano herb Java tea/dried leaves and tops Java tea/dried leaves and tops Peony flower Peony flower Peony root Peony root Peony root Papain Passionflower herb Petasites leaf Petasites root Parsley seed Parsley herb/root Kidney bean pods (without seeds) Soy Phospholipid White Spruce oil Fir Needle oil Fir Needle oil Fir Needle oil Fir Needle oil Fir shoots, fresh Pimpinella herb Pimpinella herb Pimpinella root Pimpinella root Pine Needle oil Pine Needle oil Pine Needle oil Pine Needle oil Pine sprouts Kava Kava rhizome Ribwort Plantain leaf/herb

Glycine max Abies alba Abies sachalinensis Abies sibirica Picea abies Picea excels Abies alba Pimpinella major Pimpinella saxifraga Pimpinella major Pimpinella saxifraga Pinus mugo Pinus nigra Pinus pinaster Firms sylvestris Pinus sylvestris Piper methysticum Plantago lanceolata

(Continued)

(Continued) Pharmaceutical Name

Botanical Name

Common English Name(s)

Plantaginis ovatae semen Plantaginis ovatae semen Plantaginis ovatae testa Platycodi radix

Plantago isphagula Plantago ovata Plantago isphagula Platycodon grandiforum

Podophylli peltati resina Podophylli peltati rhizoma Polygalae radix Polygalae radix Polygoni avicularis herba Populi cortex Populi folium Populi gemma Potentillae anserinae herba Primulae flos Primulae flos Primulae radix Primulae radix Pruni africanae cortex Pruni africanae cortex Pruni spinosae fructus Pruni spinosae flos Psyllii semen Psyllii semen Psyllii semen Psyllii semen Ptychopetali lignum Ptychopetali lignum Pulmonariae herba Pulsatillae herba Pulsatillae herba Quercus cortex Quercus cortex Raphani sativi radix Ratanhiae radix Rauwolfiae radix Rehmanniae radix Rhamni cathartici fructus Rhamni purshianae cortex Rhei radix Rhei radix Rhododendri ferruginei folium Rhoeados flos Ribis nigri folium Rosae flos Rosae flos Rosae fructus Rosae pseudofructus Rosae pseudofructus cum fructibus

Podophyllum peltatum Podophyllum peltatum Polygala senega Polygala tenuifolia Polygonum aviculare Populus spp. Populus spp. Populus spp. Potentilla anserina Primula elatior Primula veris Primula elatior Primula veris Prunus Africana Pygeum africanum Prunus spinose Prunus spinose Plantago afra Plantago arenaria Plantago indica Plantago psyllium Ptychopetalum olacoides Ptychopetalum unicatum Pulmonaria officinalis Pulsatilla pratensis Pulsatilla vulgaris Quercus petraea Quercus robur Raphanus sativus Krameria triandra Rauvolfia serpentina Rehmannia glutinosa Rhamnus catharticus Frangula purshiana Rheum officinale Rheum palmatum Rhododendron fermgineum

Psyllium seed, Blonde Psyllium seed, Blonde Psyllium seed husk, Blonde Chinese-Japanese bellflower root Mayapple resin Mayapple root Senega Snakeroot Polygala root Knotweed herb Aspen bark Aspen leaf Poplar bud Potentilla herb Primrose flower Primrose flower Primrose root Primrose root Pygeium bark Pygeum bark Blackthorn berry Blackthorn flower Psyllium seed, Black Psyllium seed, Black Psyllium seed, Black Psyllium seed, Black Muira Puama Muira Puama Lungwort herb Pasque flower Pasque flower Oak bark Oak bark Radish Rhatany root Indian Snakeroot Figwort root Buckthorn berry Cascara Sagrada bark Rhubarb root Rhubarb root Rhododendron, Rustyleaved Corn Poppy Blackcurrant leaf Rose flower Rose flower Rose hip seed Rose hip Rose hip and seed

Papaver rhoeas Ribes nigrum Rasa centifolia Rosa gallica Rosa spp. Rosa spp. Rosa spp.

Pharmaceutical Name

Botanical Name

Common English Name(s)

Rosmarini folium Rubi fruticosi folium Rubi fruticosi radix Rubi idaei folium Rubiae tinctorum radix Rusci aculeati rhizoma Rutae folium Rutae herba Sabal fructus Sabal fructus/Serenoea repentis fructus Saccharomyces cerevisiae Salicis cortex Salicis cortex Salicis cortex Salicis cortex Salviae folium Sambuci flos Saniculae herba Santali albi lignum Santali lignum rubrum Saponariae rubrae herba Saponariae rubrae radix Sarsaparillae radix Sarsaparillae radix Sarsaparillae radix Scillae bulbus Scopolia rhizoma Scutellariae radix Secale cornutum Selenicerei grandiflori flos

Rosmarinus officinalis Rubus fruticosus Rubus fruticosus Rubus idaeus Rubia tinctorum Ruscus aculeatus Ruta graveolens Ruta graveolens Sabal serrulata Serenoa repens

Rosemary leaf Blackberry leaf Blackberry root Raspberry leaf Madder root Butcher’s Broom rhizome Rue leaf Rue herb Saw Palmetto berry Saw Palmetto berry

Saccaromyces cerevisiae Salix alba Salix daphnoides Salix fragilis Salix purpurea Salvia officinalis Sambucus nigra Sanicula europaea Santalum album Pterocarpus santalinus Saponaria officinalis Saponaria officinalis Smilax aristolochiaefolii Smilax febrifuga Smilax regelii Urginea maritima Scopolia carniolica Scutallaria baicalensis Claviceps purpurea Selenicereus grandiflorus

Selenicerei grandiflori herba Senecionis herba Sennae folium Sennae folium Sennae folium Sennae folium Sennae fructus Sennae fructus Sennae fructus Sennae fructus Serpylli herba Sinapis albae semen Solidago virgaureae herba Sorbi aucupariae fructus Spinaciae folium Stramonii folium Stramonii semen Strychni semen Symphyti folium

Selenicereus grandiflorus

Brewer’s yeast White Willow bark Willow bark White Willow bark White Willow bark Sage leaf Elder flower Sanicle herb White Sandalwood Sandalwood, Red Soapwort herb, Red Soapwort root, Red Sarsaparilla root Sarsaparilla root Sarsaparilla root Squill bulb Scopolia root Baical Skullcap root Ergot Night-blooming Cereus flower Night-blooming Cereus herb Senecio herb Senna leaf Senna leaf Senna leaf Senna leaf Senna pod Senna pod Senna pod Senna pod Wild Thyme herb White Mustard seed European Goldenrod herb Mountain Ash berry Spinach leaf Spiny Jimsonweed leaf Jimsonweed seed Nux Vomica seed Comfrey leaf

Senecio nemorensis Cassia acutifolia Cassia angustifolia Cassia senna Senna alexandrina Cassia acutifolia Cassia angustifolia Cassia senna Senna alexandrina Thymus serphyllum Sinapis alba Solidago virgaurea Sorbus aucuparia Spinacia oleracea Datura stramonium Datura stramonium Strychnos nuxvomica Symphytum officinale

(Continued)

(Continued) Pharmaceutical Name

Botanical Name

Common English Name(s)

Symphyti herba Symphyti radix Syzygii cumini cortex Syzygii cumini cortex Syzygii cumini semen Syzygii cumini semen Tanceti parthenii herba Taraxaci herba Taraxaci radix cum herba Terebinthina laricina Terebinthina veneta Terebinthinae aetheroleum rectificatum Thymi herba Thymi herba Tiliae carbo Tiliae flos Tiliae flos Tiliae folium Tiliae folium Tiliae lignum Tiliae lignum Tiliae tomentosae flos Tiliae tomentosae flos Tormentillae rhizoma Tormentillae rhizoma Tropaeolum majus Turnerae diffusae folium Turnerae diffusae herba Uncariae cortex Urticae folium Urticae herba Urticae radix Usnea Uvae ursi folium Valerianae radix Verbasci flos Verbasci flos Verbenae herba Veronicae herba Vincae minoris herba Violae odoratae rhizoma and herba Violae tricoloris herba Visci albi fructus Visci albi herba Visci albi stipitis Yohimbehe cortex Zedoariae rhizoma Zingiberis rhizoma Zizyphi fractus

Symphytum officinale Symphytum officinale Syzygium cumini Syzygium jambolona Syzygium cumini Syzygium jambolona Tanacetum parthenium Taraxacum officinale Taraxacum officinale Larix decidua Larix decidua Pinus spp.

Comfrey herb Comfrey root Jambolan bark Jambolan bark Jambolan seed Jambolan seed Feverfew herb Dandelion herb Dandelion root with herb Larch Turpentine Venetian Turpentine Turpentine oil, Purified

Thymus vulgaris Thymus zygis Tilia cordata Tilia cordata Tilia platyphyllos Tilia cordata Tilia platyphyllos Tilia cordata Tilia platyphyllos Tilia argentea Tilia tomentosa Potentilla erecta Potentilla tormentilla Tropaeolum majus Turnera diffusa Turnera diffusa Uncaria tomentosa Urtica spp. Urtica spp. Urtica spp. Usnea spp. Arctostaphylos uva-ursi Valeriana officinalis Verbascum densiflorum Verbascum thapsus Verbena officinalis Veronica officinalis Vinca minor Viola odorata

Thyme herb Thyme herb Linden charcoal Linden flower Linden flower Linden leaf Linden leaf Linden wood Linden wood Silver Linden flower Silver Linden flower Tormentil root Tormentil root Nasturtium Damiana leaf Damiana herb Cat’s claw bark Nettle leaf Nettle herb Nettle root Usnea Uva Ursi leaf Valerian root Mullein flower Mullein flower Verbena herb Veronica herb Periwinkle Sweet Violet root and herb

Viola tricolor Viscum album Viscum album Viscum album Pausinystalia yohimbe Curcuma zedoaria Zingiber officinale Zizyphus jujuba Mill.

Heart’s Ease herb Mistletoe berry Mistletoe herb Mistletoe stem Yohimbe bark Zedoary rhizome Ginger root Chinese jujube fruit

Source: The complete German Commission E Monographs, Blumenthal et al, American Botanical council, Austin, Texas; ESCOP Monographs, Second revised edn, Thieme, Stuttgard, Germany; British Herbal Medicine Association; Selected Medicinal Plants (Vol. 1, 2, 3), WHO, Geneva.

9 Pruning of classical formulations Suggested process

A widespread perception that prevails among Ayurvedic scholars is that there is no need for carrying out any research in Ayurveda because whatever has been written in ancient classical texts is the ultimate truth and has been written only after sound research. However, they fail to recognize that in classical texts, too, it has been clearly stated that accepting any theory without repeatedly examining it is not a sign of a rationally minded physician. Further, the descriptions that were documented hundreds of years ago need not necessarily match with the presentday situation. There might have also been a loss of information during its transfer from one version of the text to the next. Therefore, there is a need for inculcating the habit of questioning among Ayurveda teachers and students, and only then will good research questions emerge. Col. Ram Nath Chopra wrote against this trend and raised the issue in 1933 when he suggested that attempts must be made to separate the good herbs from the useless ones and for this, a systematic investigation of these drugs must be undertaken.1 Prof. (Dr.) A. J. Baxi (Gujarat Ayurved University, Jamnagar) wrote in 1986: Dashamuula Kwaath Churna and Dashamuulaarishta contain powders of the roots of ten different plants. These plants belong to different families and some of them contain chemical compounds which under favorable conditions may interact or undergo enzymatic reactions causing oxidation of the hydroxyl group or reduction of keto group or breaking up of double bounds, etc., forming altogether different compounds in the final product. To study this possibility it is necessary to plan an elaborate scheme. We may take each plant separately one by one and process it under similar experimental conditions and study the changes in chemical constituents at every stage. Then, permutations and combinations will have to be carried out by mixing plant 1 and 2; 1 and 3; 1 and 4; 2 and 3; 2 and 4; 2 and 5; 1, 2 and 3; 1, 2, 3 and 4; and like that as many combinations as possible will be required to be studied. Such an elaborate study would indicate as to what were the intermediate products and what is the final constitution. An instrumental study at every stage will be more helpful and would give us the information about the genuineness and quality of each drug.2

122  Legacy and logical steps Redundant herbs can be easily removed from the compound. The same process has been advised recently by A. Subramoniam: “In the development of a polyherbal formulation, using active extract/fraction/compound from 3 herbs (Herb 1, 2 and 3) first pharmacological evaluation of each plant has to be carried out, using 3 or 4 reasonable doses; if active the optimum dose may be fixed in each case. Then, combinations of 2 plants (1 + 2, 2 + 3 and 1 + 3) in different ratios (generally optimum dose in each case and lower than that) have to be evaluated. Finally, the combinations with the 3 plants (1 + 2 + 3) in different rations are to be done. The safety study (toxicological evaluation) for the most promising combinations should be carried out. When the number of plant ingredients in the combination increases, the work to be carried out increases tremendously when various permutations are considered. Numerous plants with widely varying degrees of the same therapeutic action are occurring. For example, in India, more than 100 plants are reported to have antidiabetes and/or hypoglycemic property. In such cases, potential plants have to be compared for efficacy and safety and the most promising plants are to be used for further studies aimed at drug development.”2a Ayurvedic Formulary of India (AFI), Part I, first edn, 1978, included the roots of all the ten plants: Aegle marmelos, Oroxylum indicum, Gmelina arborea, Stereosperumum suaveolens, Premna integerifolia (Mahat panchmuula), and Desmodium gangeticum, Uraria picta, Solanum indicum, Solanum xanthocarpum, and Tribulus terrestris (Kshudra panchamuula) in the compound, while in its second revised edition, 2003, an option has been provided to use either the root or the stem-bark of the first five plants (Mahat panchmuula), and aboveground parts of the remaining five plants (Kshudra panchamuula). The Dashamuula complex is based on Sushruta’s classification of plant drugs (Gana). Kshudra panchamuula and Mahat panchmuula taken together constitute Dashamuula (Sushruta, Sutra 38: 66–70). The Dashmuula group alleviates all the three doshas. It cures kaasa (bronchitis), sannipaata (high fever due to vitiation of all the three doshas), shirorti (headache), shvaasa (asthma) and hikkaa (hiccup). Apatantraka (convulsion) was added in the sixteenth century. In classical Ayurvedic medicine, plant parts like root, bark, flower, seed, fruit and leaves are used for their specific therapeutic activities.3 If an old medicinal plant, described in the ancient texts, is sought to be prepared in a different manner from that described in the literature, then, even if this difference consists of a few different chemical steps or a new ingredient, or has one ingredient less, this medicine will be treated as any new drug.4 Thus, Dashamuulaarishta and all Dashmuula products are now new drugs and all of them are to be rechristened and removed from the status of classical drugs so that consumers are not misled. Keeping the therapeutic target in mind, only those herbs which can play an active role can be retained and others can easily be discarded.

Pruning classical formulations  123 Like many other drugs of the classical period, the profile of Dashamuulaarishta also changed with the passage of time. Label herbs remained the same, but expensive or extinct herbs were modified as per individual’s discretion. Ayurvedic Formulary of India recommended Dashamuulaarishta for following therapeutic uses in 1978: emesis, malabsorption syndrome, abdominal lump, cough, asthma, tissue wasting, neurological affections, and piles. This was expanded in its second edition, 2003: fistula-in-ano, anemia, jaundice, diseases of the skin, excessive flow of urine, digestive impairment, diseases of the abdomen, gravel in urine, calculus, dysuria, infertility, emaciation, deficiency of semen and debility. (This expansion is obviously arbitrary.) Dabur recommends Dashamuulaarishta as a general tonic and restorative for women; Baidyanath Ayurved Bhavan for nervous diseases, anemia, cough, piles and as an alterative and bitter tonic; Emami (Zandu) for cough, piles, anorexia, alcoholism, asthma, vomiting, as a stimulant, alterative and bitter tonic; Indian Medical Practitioner’s Cooperative Pharmacy (IMPCOPS), Chennai, as a restorative, digestive, cardiac and nervine tonic. Now, let us see the biological activities of Classical Dashamuula Kwaath. Its extract produced CNS depressant effect in albino mice; reduced the spontaneous motor activity, potentiated the pentobarbitone hypnosis and antagonized the amphetamine-induced hyperactivity. It also exhibited a tranquilo-sedative activity like a major tranquilizer and blocked the condition avoidance response in rats.5 Another study indicated that Dashamuula Kwaath extract effectively produced an aspirinlike analgesic, antipyretic and anti-inflammatory effect in mice.6 Dey et al. (1968) reported that Solanum indicum induced drowsiness, motor activity alertness in mice and significantly potentiated barbiturate hypnosis in locomotor-decreased mice.7 Dhawan et al. (1977) reported that the entire plant extract of Uraria picta exhibited CNS depressant activity.8 Marmin, a coumarin, isolated from the root of Aegle marmelos, showed an anti-inflammatory effect against carrageenaninduced inflammation in rats. The methanolic extract of the rootbark inhibited the beating rate of cultured mouse myocardial cells. Among the isolated constituents, aurapten is found to be the most potent inhibitor comparable with verapamil.9 The root of Desmodium gangeticum gave gangetin, one of the pterocarpans isolated from the hexane extract of the root. It showed significant anti-inflammatory activity in rats.10 Alcoholic extract of the stem bark of Gmelina arborea showed antiinflammatory activity comparable to phenylbutazone.”11 Thus, if we scan the published literature, on the basis of leads already available, the number of herbs can be reduced from so-called Dashmuulaarishta, Dashmuula Kwaath, and other Dashmuula products that contain many additional herbs. A Srilankan compound formulation, Karvi Panchakadasha Kashaaya, consisted of 50 herbs, was shortened to five herbs, Carum carvi, Inula racemosa, Ricinus communis, Bacopa monnieri, and Boerhavia diffusa, and was prescribed in the form of decoction (made by boiling 50 g crude drugs in 400 ml water, reducing to one-eighth) to 80 randomly selected patients of essential hypertension, as

124  Legacy and logical steps an adjuvant with modern hypertensive drugs, also as an independent drug). At the end of 28 days, both the groups showed significant symptomatic improvement and reduction in systolic and diastolic blood pressure.12 Shunthi Guggulu, a CCRAS drug for rheumatoid arthritis, can be quoted as another example. It contains only two herbs: Zingiber officinale Rhizome and Commiphora wightii gum resin. A multicenter observational study revealed the satisfactory improvement of symptoms, namely reduction in pain, morning stiffness, swelling in joints besides reduction in ESR levels. Out of 497 patients, about 67% of patients, under a course of 6 weeks treatment, showed general functional capability and improvement in general condition. The clinical study was conducted at the then CRI, Bhubaneswar, on 63 patients of rheumatoid arthritis recruited into two groups, namely Group-A (Shunthi Guggulu) and Group-B (Yogaraja guggulu, Amavata-Rasa/Vatagajankusha-rasa and Maharasanadi-kwatha). The result indicated a better effect of Shunthi guggulu (Group A) as compared to the other set of medicines (Group B). (Group B drugs belong to Ayurvedic classics and contain 28, 8, 15, and 32 herbo-mineral drugs, respectively.) The observations in another clinical trial of Shunthi-Guggulu on 50 patients of rheumatoid arthritis showed a significant effect as about 80% of the patients who completed the full course of treatment showed either marked or complete relief (complete relief 13, marked relief 19). A clinical trial with four single drugs – Commiphora mukul oleoresin, Acorus calamus. Inula racemosa and Terminalia arjuna (against placebo) may provide sufficient leads for pruning complicated cardioprotective formulations.13 All the four drug-treated groups showed mild to moderate improvement in symptoms of chest pain and dyspnea. Commiphora mukul oleoresin and Inula racemosa groups showed a significant reduction in body weight as well as correction of lipid profile. However, restoration of HDL was significant only in Terminalia arjuna group. Favourable ECG changes of mild to a moderate degree were noted in all the four groups. Total Lipid Atherogenicity Index was significant in Inula racemosa group: Commiphora mukul oleoresin +, Acorus calamus −, Inula racemosa ++, Terminalia arjuna +. In an earlier clinical trial, dried and powdered roots of Inula racemosa and purified oleoresin of Commiphora mukul in 1:1 (w/w) proportion were prescribed (6–8 g/day in divided doses) for six months, and gave encouraging results in hyperlipidemia.14 Now that a good number of single herbs are exhibiting CNS-CVS active, antihypertensive, hypolipidemic and cardioprotective potential in experimental and clinical trials, a concerted effort should be made to review and restructure complicated compound formulations of classical medicine. Only scientifically validated and therapeutically substantiated herbs should be retained. It is no more possible to accept the herb selection procedure of the sixteenth century in the twenty-first century.

Pruning classical formulations  125 In the chapter, “Basic Steps for Restructuring Ayurvedic Formulations,” we will discuss the classification of herbs (the group of herbs) by Charaka, Sushruta, and Vagbhata, which were used for formulating classical polyherbal drugs. Each classification is to be screened as suggested by Dr. A. J. Baxi and A. Subramoniam for its therapeutic strength. We suggest this as a basis of restructuring classical formulary.

References   1 Chopra Col. Sir RN, Indigenous Drugs of India, 1933, first edn, 1958, second reprint 1994, Academic Publishers, Kolkata-700 009: page 6.  2 CCRAS, Perspectives in Pharmaceutical Aspects of Indian Medicinal Plants, Scientific Seminar on Medicinal Plants Research, Pune, 1986.2a, Subramoniam A, Annals of Phytomedicine, 2014, 3(1): 31–36.   3 Shah DC, SN Sannd, Regional Research Centre, CCRAS, Rehari Chowk, Jammu, Scope of Research and Development on Ayurvedic Medicinal Plants with Reference to Their Useful Parts.   4 Chaudhury Dr Ranjit Roy, Herbal Medicine for Human Health, WHO, Regional Publication, SEARCO. No. 20: 59.   5 Gupta RA et al, Pharmacological Studies on Dashammula Kwaath, JRAS, 1983, IV: 73–84.   6 Ibid 1984, JRAS, V(1–4): 38, 50.   7 Neuropharmacological properties of several Indian medicinal plants, Jour Res Ind Med, 3(1): 9–18.   8 Screening of Indian plants for biological activity, Part IV, Ind Jour Exp Biol, 15: 208–219.   9 Kakiuchi et al, Planta Med, 1991, 57: 43; Handa et al, Fitoterapia, 1992, 63: 3. 10 Handa et al, Fitoterapia, 1992, 63: 12. 11 Agrawal et al, Ind J Nat Prod, 1994, 19(1): 14. 12 Ariyawansa HAS, RH Singh, supervisor, 1999. Ph. D. thesis, Dept of Kayachikitsa, Banaras Hindu University, Varanasi. 13 Singh RH, Institute of medical sciences, Banaras Hindu university, Varanasi, Ayu International, Gujarat Ayurved University, Jamnagar, January–March 2001, 1(1). 14 Ramji Singh et al, JRAS, 1991, XIII: 1–18.

10 The pragmatic nature of Ayurveda No restrictions on revising old formulations

Ayurvedic Drug Formulations, which were based on Ganas or Vargas devised by Charaka and Sushruta, were revised from time to time during the classical period, why we can not revise them for after assessing them on drug parameters of twenty-first century. We would like to give a few examples to prove our point: 1

2

During the period of Sushruta (first century bc.), Triphala was composed of one part of Haritaki (Terminalia chebula), two parts of Vibhitaki (Terminalia bellerica), and four parts of Aamalaki (Emblica officinalis) (Sushruta, sutra 38: 56, 57). During the period of Bhavamisra (sixteenth century) all the three components were used in equal parts (Bhavaprakasha, Haritakyaadi Varga, 41). Therapeutic properties remained the same. Pancha Gavya Ghrita (Charaka Samhita, Chi. 10: 16) was composed of cow’s urine, dung filtrate, milk, sour curd and ghee (purified butter), in equal quantities. It was used for Apasmaara (epilepsy), Kaamalaa (jaundice) and Jvara (fever). If these ingredients were collected from aja (goat), the drug was called Panchaaja; if collected from mahishaa (buffalo), the drug was called Panch Mahisha. After adding Kaashisha (mineral, green vitriol), Katu rohini (Picrorhiza kurroa), roots of Jati (Jasminum officinale) and Haridra (Curcuma longa), either Panch Gavya or Panchaaja or Panch Mahisha was used for cleansing ulcers. Maha Panch Gavya Ghrita (Ashtangahridaya) contained 42 extra herbs (Ayurvedic Formulary of India, Part I, Second Revised Edition: 95, 96.). This can be prescribed for Apasmaara (epilepsy), Kaamalaa (jaundice), Jvara (fever), and also for Udara roga (diseases of abdomen), Bhagandara (fistulain-ano), Visham jvara (intermittent fever), Shopha (edema), Arsha (piles), Paandu (anemia), Gulma (abdominal lump), Kaasa (cough), Graharoga (diseases due to ill effects of planets, psychotic syndrome). This formulation can be easily revalidated as it contains Dashamuula, Triphala, Haridraadi Gana, Tryuushana Gana and other components of Dashemaani. Pancha Gavya Ghrita of Sahasrayoga (Non-Samhita, Kerala Materia Medica) contains only basic five components (to be used for Apasmaara (epilepsy), Kaamalaa (jaundice) and Jvara (fever).

128  Legacy and logical steps

3

4

5

6

Second variation of Sahasrayoga, does not contain Dashamuula, but contains Triphala, and 14 additional plant drugs, a totally different formulation, to be used as a rejuvenating tonic with fertility promoting properties (Putradaa), and for retarding ageing, protecting from the onslaught of planets (Mahaagraha-pidaa-naashaka) and fear from ghosts (Bhuuta-bhaya-naashana). (Sahasrayoga, CCRAS text, page 316.) Elaadi Churna: Elaadi Churna (Gadanigraha, twelfth century) contained eight components: cardamoms 1 part, cinnamon bark 2 parts, cinnamon leaves 3 parts, naagakesara stamens 4 parts, black pepper 5 parts, long pepper 6 parts, dry ginger 7 parts, and sugar 28 parts. In Bhaishajya ratnavali (seventeenth century), only three components were retained (cardamoms, naagakesara stamens and long pepper), clove, jujuba pulp, priyangu (Callicarpa macrophylla flowers), shaali (Oryza sativa), Cyperus rotundus rhizome and chandana (Santalum album) were added. Draksharishta: Gadanigraha (twelfth century) formulation was revised in Sharangadhara Samhita (thirteenth century). Nutmeg, cloves, cubebs, date fruits and chandana were dropped. Kumaryaasava: Sharangadhara Samhita (thirteenth century) text contains 44 ingredients, while the formulation of Yoga-rtnakara (sixteenth century) contained only 16 ingredients. Both have been incorporated in Ayurvedic Formulary of India, Part I, as A & B. Navaayasa Churna: In Ashtangahridaya (seventh century), the formulation contains Loha bhasma (clax of iron) 27 parts, while in Bhaishajya ratnavali (seventeenth century), the content of Loha bhasma was reduced to 9 parts.

These examples show that there was no bar to add or drop ingrediants from formulations during the classical period (which was regulated by shashtras); all the time, while we are afraid of our shastras, actually we are afraid of results if our formulations are x-rayed. For the sake of better therapeutic results, we will have to add some and drop some ingredients.

Logistics of Ayurvedic formulations Ayurvedic formulations were a part of holistic healing. The imbalances of the whole system of the patient were treated along with the symptoms of the disease. Charaka, Sushruta, and Vagbhat worked out different classifications (Ganas or Vargas) containing identified herbs, three, ten or more, in each). One formulation may contain either one Gana or Varga or even two or three Ganas, depending upon nature of the ailment. These were meant for kuti or in-house treatment, based on the constitution of a particular patient.

The pragmatic nature of Ayurveda  129 Now, Ayurvedic drugs have emerged as OTC drugs and millions of people are buying them directly from chemists without consulting a qualified vaidya. Millions of people are showing interest in Ayurvedic medicines and their constitution is also not known. It has become imperative to modify Classical formulations based on main herbs and supporting herbs for bioavailability and subject them to an experimental or clinical trial. Thus Classical formulations will emerge as a standardized disease-based Ayurvedic medicine. All Ganas and Vargas are first to be screened as the base-strength of classical formulations are to be checked by the architects of evidence-based Ayurveda. After that, each herb can be screened on the basis of the last 200 hundred years’ research. which overweighs the foundation material we had in the sixteenth century. We have at our disposal 22 volumes of The Wealth of India series, published by NISCAIR, CSIR (Council of Scientific and Industrial Research). The original series was in 11 volumes which covered 5,000 plant species belonging to about 1,730 genera under 233 families. The last volume was published in 1976. After that revised and enlarged editions were published as 1A, 1B, and 2i. After 1992, the First Supplement series was published in five volumes (during 2000–2004). The Second Supplement series was published during 2006–2009. The Supplement series covered 2,000 plant species belonging to over 1,000 genera. The main emphasis was on chemical constituents in the Supplementary series. After the closure of The Wealth of India series, the Indian council of Medical Research (ICMR) brought out the first volume of “Reviews on Indian Medicinal Plants” in 2004. This on-going series is covering details of botanical, pharmacognostic, chemical, pharmacological/biological, clinical and toxicological aspects of Indian medicinal plants. Through May 2019, 21 volumes (A to P) covered 4,951 species. The text is based on 75,486 research papers (reference material is preserved in ICMR, Medicinal Plant Unit). Such a monumental work is not available in any Asian region. This scientific progress will prove a boon to Ayurveda, and all old data can be revalidated for further growth of an evidence-based medicinal system. In the next chapter, we will be giving basic details of Ganas and Vargas of the classical period.

11 Basic steps For restructuring Ayurvedic formulations

Understanding the criteria of drug formulation during the classical period Sushruta’s Classification of Ayurvedic Drugs is the pharmacological classification which will help drug researches in weeding out superfluous herbs from the classical formulations which are having multiple herbal components of different families of different geographical regions The classification of Charaka is known as Dashemaani, 50 classifications having 10 herbs in each. His classification will not prove of much help in revalidating Ayurvedic formulations. We will try to correlate Charaka’s Varga with Sushruta and Vagbhata classifications in our text. Sushruta Samhita (second century bc), and later on Vagabhata (ad sixth century) classified the group of drugs based on their multiple therapeutic indications and for their synergistic or holistic action  – for example, Madhuka (Glycyrrhiza glabra) is included in Haridraadi Gana, Brhatyaadi Gana, Kaakolyaadi Gana, Saarivaadi Gana, Anjanaadi Gana, Ambaashthaadi Gana, Nyagrodhaadi Gana and Utpalaadi Gana (in nine places); Chitraka (Plumbago zeylanica) in Aaragvadhaadi Gana, Varunaadi Gana, Mushkakaadi Gana, Krishnaadi Gana, Aamalakyaadi Gana (in five places); Vacha (Acorus calamus) in Vachaadi Gana, Vatsakaadi Gana, Mustaadi Gana, Vamanaoushadha Gana, and Niroohana Dravya, used for Niroohavasti Gana (in five places); Guduchi (Tinospora cordifolia) in Guduchyaadi Gana, Aaragvadhaadi Gana, Salsaaraadi Gana, Shyaamaadi Gana, Patolaadi Gana, and Vallija panchamuula Gana (in six places); Paathaa (Cissampelos pareira) in Aaragvadhaadi Gana, Krishnaadi Gana, Brhatyaadi Gana, Patolaadi Gana, Mustaadi Gana (in five places). Now that scientifically validated clinical profile of all plant drugs are available, and main herbs, synergistic herbs, and herbs which promote bioavailability can be identified, it will be much easier to review Ayurvedic formulations which are based on multiple classifications covering multiple indications. Researchers can understand and interpret varied names of herbs and their disease-based applications and restructure a disease-based Ayurvedic formulary. Sushruta’s vision was broad-based. He emphasized that components of a Gana can be used jointly or separately. He gave liberty to add drugs of other Ganas

132  Legacy and logical steps or Vargas if so required. (Sushruta: Sutra 38: 82.) This was misconstrued, and, mainly due to lack of confidence, a number of other Vargas entered into Ayurvedic formulations to achieve Holistic effect of Ayurvedic drug. The inclusion of Dashmuula in a number of formulations is an example of this approach. Such formulations can be easily identified and restructured. We find that Sushruta’s text has also been modified at many places by commentators. In the sixth century ad, Vagbhata revised the constituents and added one new Gana, Vatsakaadi, and changed the names of Kaakolyaadi and Saalasaaraadi Gana as Padmakaadi and Asanaadi, respectively. In the main text, we have added the plant drugs of Ganas of Vagbhat for pointing out certain variations. In the sixteenth century, in Bhavaprakasha Nighantu, eight Vargas of the text comprise near about 480 drugs. Possible adverse effects of 196 drugs of herbal origin were included so that while preparing formulations, herb to herb interaction is taken care of. We will be giving details at the end of the main text. While concluding, we have also given some suggestions, based on our study of classical texts. We have taken the main text from Ayurveda Saukhyam text1 (sixteenth century) and Dravya Guna Vijnana (1993).2 In the main text, we have identified a number of obscure herbs of the Classical period and equated them with botanical names, though it was very tedious and time-consuming work.

Sushrut’s Ganas (Pharmacological Classifications) with Charaka’s Vargas (Dashemaani) 1

Vidaarigandhaadi Gana: Vidaari (Pueraria tuberosa), Vidaarigandhaa (Desmodium gangeticum), Vishvadevaa (Abutilon indicum), Sahadevaa (Sida rhombifolia), Shvadamshtra (Tribulus terrestris), Prthakparni (Uraria picta, also Marsdenia tenacissima), Shrgaala vinnaa (? Shrgaalikaa  = Vidaari kanda, Ipomoea digitata), Shataavari (Asparagus racemosus), Saariva (Hemidesmus indicus), Jivaka, Rshabhaka (extinct), Mahaa sahaa (Teramnus labialis), Kshudra sahaa (Phaseolus trilobus), Brhati (Solanum indicum), Kantakaari (Solanum xanthocarpum), Punaranavaa (Boerhaavia diffusa), Eranda (Ricinus communis), Hamsapadi (Adiantum lunulatum), Vrischikaali (Tragia involucrata) and Rshabhi (Mucuna pruriens). The Vidaarigadhaadi Gana ameliorate Vaayu and Pitta, cure sosha (wasting diseases), gulma (tumor), angamarda (bodily soreness), urdhwa-swaasa (dyspnea), and kaasa (cough, bronchitis). Charaka’s Varga: Brahaniya (nourishing), Hikkaanigraha (curative of hiccup), kaasahara (curative of cough), angamarda prashman (relieves bodily soreness), prajaasthaapana (curative of sterility), vayahasthaapana (prevents ageing).

Basic steps for restructuring  133 Vagbhat’s Vidaaryaadi Gana: Vidaari, Eranda, Vrischikaali, Vrischeeva (Boerhaavia verticillata), Devaahvaya (Cedrus deodra), Mudgaparni (Phaseolus trilobus), and Maasaparni (Teramnus labialis), Kanduukari (Mucuna prurita) Jeevana Panchamuula (Mahaa shataavari, Kaakoli, Jivanti, Jivaka and Rshabhaka), Hraswa (Laghu) panchamuula, Gopasutaa (Saarivaa) and Tripaadi (Hamsapadi). 2 Aaragvadhaadi Gana: Aaragvadha (Cassia fistula), Madana (Randia dumetorum), Gopa (Hemidesmus indicus) Ghontaa (Ziziphus jujuba). Kantaki (Solanum indicum), Kutaja (Holarrhena antidysenterica), Paathaa (Cissampelos pareira), Paatalaa (Stereospermum suaveolens), Muuvaa (Marsdenia tenacissima), Indrayava (Wrightia tinctoria), Saptaparnaa (Alstonia scholaris), Nimba (Azadirachta indica), Kurantaka (Barleria prionitis), Guduchi (Tinospora cordifolia), Chitraka (Plumbago zeylanica), Shaarngeshthaa (Physalis minima or Cardiospermum halicacabum), Paruushaka (Grewia asiatica), Karanjadwai (Karanja: Pongamia pinnata), Lataa Karanja: Caesalpinia bonduc), Patola (Trichosanthes dioica), Kiraata-tikta (Andrographis paniculata), and Sushavi (Calycoptris floribunda). Drugs of Aaragwadhaadi Gana alleviate Kapha and visha (poisoning, toxemia), and cures meha (urinary disorders), kushta (obstinate skin diseases including leprosy) jvara (fever), vami (vomiting) and kanduu (pruritus, itching), purifies dushta vrana (nonhealing ulcers) Charaka’s Varga: Kushthaghna (curative of obstinate skin diseases), kanduughna (curative of pruritus), vishaghna (the antidote to poisoning). Vagbhat’s Aaragwadhaadi Gana: Aaragvadha, Indrayava (Wrightia tinctoria seed), Paatali (Mushkaka = Schrebera swieteniodes), Kaakatiktaa, Nimba, Amritaa (Guduchi), Madhurasaa (Muurvaa  =  (Marsdenia tenacissima), Sruva-vrksha (Vikankata  =  Flacourtia indica), Paathaa (Cissampelos pareira), Bhuunimba (Andrographis paniculata), Sairyaka (Sahachara  =  Barleria prionitis), Patola (Trichosanthes dioica), Karanja-yugma (Karanja (Pongamia pinnata), Lataa Karanja (Caesalpinia bonduc), Saptachhada (Saptaparna), Agni (Chitraka), Sushavi (Kaaravi), Phala (Madana phala  =  (Randia dumetorum), Baana (Sahachara) and Ghontaa. 3

Saalsaaraadi Gana: Saalasaara (Shorea robusta), Ajakarna (Dipterocarpus turbinatus), Khadira (Acacia catechu), Kaala skandha (Diospyros embryopteris), Kramuka (Areca catechu), Bhuurja (Betula utilis), Meshashrngi (Gymnema sylvestre), Tinisha (Ougeinia dalbergioides), Chandana (Santalum album), Kuchandana (Pterocarpus santalinus), Shimshipaa (Dalbergia sissoo), Shirisha (Albizzia lebbeck), Asana (Pterocarpus marsupium), Dhava (Anogeissus latifolia), Arjuna (Terminalia arjuna), Naktamaala (Pongamia

134  Legacy and logical steps pinnata), Ashvakarna (Dipterocarpus alatus), Shaaka (Tectona grandis), Guduchi (Tinospora cordifolia), and Kaaliyaka (Coscinium fenestratum). Drugs of Saalsaaraadi Gana cure kushtha (obstinate skin diseases including leprosy), meha (urinary disorders, excessive urination), and paandu (anemia). They also cleanse Kapha and medas (adiposity). Charaka’s Varga: Kushthagna (curative of obstinate skin diseases), muutra sangrahaniya (corrective of excessive urination), udardaprashaman (curative of urticaria). Vagbhat’s Asanaadi Gana (Sushruta’s Saalasaaraadi Gana): Asana, Tinisa, Bhuurja, Swetavaaha (Arjuna), Prakeerya (Puutikaranja = Caesalpinia bonduc), Khadira, Kadara (Acacia suma), Bhandi (Albizzia lebbeck), Sinsapaa, Meshasringee, Trihima (Chandana, Raktachandana and Daaruharidraa), Tala (Taala), Palaasa, Jongaka (Agaru), Saaka (Tectona grandis), Saala, Kramuka (Puuga), Dhava, Kulinga (Kaaliyaka?), Chaagakarna (Vateria indica) and Ashvakarna. 4

Varunaadi Gana: Varuna (Crataeva nurvala), Aartgala (Xanthium strumarium), Shigru (Moringa pterygosperma, white variety), Madhu shigru (Red variety), Tarkaari (Clerodendrum phlomidis), Meshashrngi (Gymnema sylvestre), Puteeka (Holoptelea intgrifolia), Naktamaala (Pongamia pinnata), Morata (Maerua arenaria), Agnimantha (Premna integrifolia), Saireyaka dwai (Barleria prionitis and B. cristata), Bimbi (Coccinia indica), Vasuka (Osmanthus fragrans), Vasira (not identified), Chitraka (Plumbago zeylanica), Shataavari (Asparagus racemosus), Bilva (Aegle marmelos), Ajashrngi (Pistacia integerrima), Darbha (Imperata cylindrica), Brhati dwai (Solanum indicum and Solanum melongena). Drugs of Varunaadi Gana alleviate Kapha and reduce medas (adiposity). They cure shirahshuula (headache), gulma (tumor) and aabhyantara vidradhi (internal abscess).

5 Viratarvaadi Gana: Virataru (Terminalia arjuna or Viravriksha  =  Dichrostachys cinerea), Sahachara dwai (Barleria cristata and B. prionitis), Darbha (Imperata cylindrical), Vrkshaadani (Loranthus longiflorus), Gundra (Typha angustata), Nala (Phragmites karka or Arundo donax), Kusha (Desmostachya bipinnata), Kaasha (Saccharum spontaneum), Ashmabhedaka (Bergenia ligulata), Agnimantha (Premna obtusifolia), Morataa (Maerua arenaria), Vasuka (Osmanthus fragrans), Vasira (Achyranthes aspera), Bhalluka (Dioscorea species or Prunus species; fruit (red) juicy, cooling, sweet and sour, as described in text), Kurantika (Celosia argentea), Indivara (Nelumbo nucifera), Kapota vankaa (Bacopa monnieri), Shvadamshtra (Tribulus terrestris).

Basic steps for restructuring  135 The drugs of Viratarvaadi Gana cure diseases caused by Vaayu, ashmari (stone in urinary tract), sharkaraa (sediments in the urine), mutra krchhra (dysuria), and muutraghaata (anuria). Charaka’s Varga: Muutravirechaniya (diuretic). Vagbhat’s Viratarvaadi Gana: Vellaantara (Virataru or Dirgha patra  =  Diospyros melanoxylon), Aranika (Agnimantha), Booka (?), Vrisha (Vaasaa), Asmabheda (Paashaanabheda), Gokantaka (Gokshura), Itkataa, Saaachara, Baana (Barleria prionitis), Kaasa, Vrikshaadani, Nala, Kusadwai (Sthuula Darbha and Suukshma Darbha), Gunthaa (Typha australis), Gundraa (Typha angustata), Bhalluuka (Syonaaka), Moraa, Kuranta (Sitivaaraka), Karambha (Uttamaarani), Paarthaa (Terminalia arjuna). 6 Rodhraadi Gana: Rodhra = Lodhra, Saavar rodhra (Symplocos racemosa and S. crataegoides), Palaasha (Butea monosperma), Kutannta (Shyonaaka: Oroxylum indicum), Ashoka (Saraca asoca), Phanji (Bhaargi: Clerodendrum serratum), Katphala (Myrica nagi), Elavaaluka (Prunus avium), Shallaki (Boswellia serrata), Jingini (Odina wodie, Jingi: Rubia cordifolia), Kadamba (Anthocephalus cadamba), Shaala (Shorea robusta) and Kadali (Musa paradisiaca). The drugs of Rodhraadi Gana reduce medas (adiposity), and Kapha. They cure yoni dosha (ailments of female genital tract), promote stambhana (retention power), improve complexion, and cure visha (poisoning, internal toxemia). Charaka’s Varga: Vedanaathaapana (anodyne), vishaghna (the antidote to poisoning), purishasangrahaniya (renders fecal matter consistent). Vagbhat’s Rodhraadi Gana: Rodhra, Saavaraka Rodhra, Palaasa, Jingini, Sarala (Devadaaru), Katphala, Kutsitaamba (Kadamba), Kadali, Gatasoka (Asoka), Elavaalu, Paripelava (Kutannata = Oroxylum indicum) and Mocha (Salmalia malabarica exudate). 7

Arkaadi Gana: Arka (Calotropis gigantea), Alarka (Calotropis procera), Karanjadwai (Udkirya: Pongamia pinnata, Prkirya: Caesalpinia crista), Naagadanti (Croton oblongifolius. Baliospermum montanum is used for both Danti and Naagadanti), Mayuuraka (Apaamaarga: Achyranthes aspera), Shvetaa (Clitoria ternatea), Mahaa Shvetaa (Kshira Vidaari: Ipomoea digitata), Vrshchhikaali (Heliotropium indicum), Alavanaa (Celastrus paniculatus), and Taapasa vrksha (Balanites aegyptica). Drugs of Arkaadi Gana reduce Kapha and medas (adiposity). They cure visha (poisoning, toxemia), krmi (a parasitic infection) and kushtha (obstinate skin diseases including leprosy). They especially help in cleansing ulcers. Charaka’s Varga: Vishaghna (the antidote to poisoning), kushthagnna (cures obstinate skin diseases including leprosy).

136  Legacy and logical steps Vagbhat’s Arkaadi Gana: Arka, Alarka, Naagadanti, Vishalyaa (Langali = Gloriosa superba), Bhaargi (Clerodendrum serratum), Raasnaa (Pluchea lanceolata), Vrshchhikaali (Heliotropium indicum), Prakiryaa, Pratyakpushpi (Achyranthes aspera), Peeta-taila (Celastrus paniculatus), Udakirya (Karanja), Swetaa Yugm (Shvetaa and Mahaa Shvetaa), and Taapasa vrksha. 8

Surasaadi Gana Surasaa (Ocimum sanctum), Shveta surasaa (White-flowered Ocimum basilicum, common English name; ‘Magic White’), Phanijjaka (Origanum majorana), Arjaka (Ocimum canum), Bhuustrna (Cymbopogon martini), Sugandhaka (Nigella sativa or Suvarchalaa: Malva rotundifolia), Sumukha (Wild Ocimum pilosum), Kaalamaala (Ocimun gratissimum black variety), Kaasmarda (Cassia occidentalis), Kshavaka (Centipeda orbicularis), Kharapushpa (A variety of Centipera minuta), Vidanga (Embelia ribes), Katphala (Myrica esculenta), Surabhi (Punnaaga: Calophyllum inophyllum), Nirgundi (Vitex negundo), Kulaahala (Celsia coromandelina), Unduru karnikaa (Ipomoea reniformis), Phanji (Bhaargi: Clerodendrum serratum), Praachibala (Peristrophe bicallyculata), Kaakamaachi (Solanum nigrum), and Vishamushti (Strychnos nux-vomica). Drugs of Sursaadi Group alleviate Kapha and cure krmi (Parasitic infection), pratishyaaya (rhinitis), aruchi (anorexia), shvaasa (asthma), and kaasa (cough, bronchitis). They help in cleansing ulcers. Charak’s Varga: Krmighna (curative of worms), shvaasahara (curative of labored breathing), shitaprashamana (curative of the sensation of cold). Vagbhat’s Surasaadi Gana: Surasayugma (Krishna Tulasi and Sweta Tulasi), Phanijja, Kaalamaalaa, Vidanga, Kharabusa (Kharapushpa  =  Origanum majorana), Vrishakarni (Muushikakarni = Ipomoea reniformis), Katphala (Myrica nagi), Kaasamarda, Kshavaka, Sarasi (?), Bhaargi, Kaamukaa (Hiptage benghalensis), Kaakamaachi, Kaalahala, Vishamushti, Bhuustrina (Cynbopogeon species), and Bhuutakeshi (Selinum tenuifolium).

9

Mushkakaadi Gana: Mushkaka (Moha Tree: Schrebera swietenioides), Palaasha (Butea monosperma), Dhava (Anogeissus latifolia), Chitraka (Plumbago zeylanica), Madana (Randia dumetorum), Vrikshaka (Vrikshavalli = Vidaarikanda: Ipomoea digitata), Shimshapaa (Dalbergia sissoo), Vajra vrksha (Vajra  =  Euphorbia neriifolia) and Triphala (Terminalia chebula, Terminalia bellirica, Emblica officinalis fruits) Drugs of Mushkakaadi Gana reduce medas (adiposity) and correct the vitiation of shukra (semen). They cure meha (excessive flow of urine), arsha (piles), paandu (anemia), and sharkara (sediment in the urine). Charaka’s Varga: Arshaghna (curative of piles and haemorrhoids).

Basic steps for restructuring  137 Vagbhat’s Mushkakaadi Gana: Mushkaka (Mokshaka), Snuk (Euphorbia neriifolia), Varaa (Triphalaa) Dweepi (Karanji = Caesalpinia crista), Palaasha, Dhava and Simsapaa. 10 Krishnaadi Gana: Krishnaa (Piper longam mature fruits), Granthika (Piper longum root), Chavya (Piper chava), Chitraka (Plumbago zeylanica), Vishaa (Ativishaa: Aconitum heterophyllum), Vishvaushadha (Zingiber officinale dried rhizome), Ajaaji (Cuminum cyminum), Paathaa (Cissampelos pareira), Ramattha (Ferula foetida), Renukaa (Piper aurantiacum), Madhurasaa (Muurva: Marsdenia tenacissima), Siddhaartha (Brassica alba), Tiktaa (Picrorhiza kurroa), Ushna (any one drug of Trikatu Group), Drekkaa (Melia azedarach), Shakra yava (Wrightia tinctoria), Ajmoda (Trachyspermum roxburghianum), Truti (Elettaria cardamomum), Bhaargi (Clerodendrum serratum), and Vidanga (Embelia ribes). Drugs of Krishnaadi Gana stimulate the power of digestion. They cure gulma (tympanitis, abdominal lump, chlorosis), and shula (colic pain). They help in paachana of aama (impaired digestion), alleviate Kapha, stimulate appetite and cure jvara (fever). Charaka’s Varga: Dipaniya (promoter of digestion), shuulaprashamana (cures colic pain), shitaprashamana (curative of the sensation of cold), svaasahara (curative of labored breathing). 11 Elaadi Gana: Elaa (Elettaria cardamomum), Tagara (Valeriana wallichii), Kushtha (Saussurea lappa), Maansi (Nardostachys jatamansi), Dhyaamaka (Andropogan lamgier species), tvak (Cinnamomum zeylanicum thin bark), Patra (Cinnamomum tamala), Naaga pushpa (Mesua ferrea), Priyangu (Callicarpa macrophylla or Prunus mahaleb), Harenukaa (Vitex agnuscastus), Vyaaghra nakha (Capparis horrida), Shukti (Tamarindus indica sour fruit), Chandaa (Angelica archangelica), Sthauneyaka (Taxus baccata), Shriveshtaka (Pinus roxburghii exudate), Chocha (Reddish powder of thick bark of Cinnamomum zeylanicum), Choraka (Angelica glauca), Vaaluka (AFI: Cinnamomun cecidodephne), Guggulu (Commiphora wightii gum-resin), Sarja rasaa (Vateria indica resin), Turushka (Liquidambar orientalis balsam), Kunduruka (Boswellia serrata), Aguru (Aquilaria agallocha), Sprkkaa (Anisomeles malabarica), Ushira (Vetiveria zizaniodes), Bhadra daaru (Cedrus deodara), Kumkuma (Crocus sativus stigma of flowers), and Punnaga keshara (Mesua ferrea stamens). Drugs of Elaadi Gana alleviate Vaayu and Kapha, cure visha (toxemia) and promote complexion (varnaprasaadana). They also cure Kanduu (pruritus, itching), pidaka (pimples) and kotha (urticarial rashes). Charak’s Varga: Varnya (improves complexion), kanduughna (curative of pruritus).

138  Legacy and logical steps Vagbhat’s Elaadi Gana: Elayugma (Suukshma Elaa and Sthuula Elaa), Turushka, Kushtha, Phalini (Prunus mahaleb), Maamsi (Nardostachys jatamansi), Jala (Hrivera = Coleus vettiveroides), Dhyaamaka (Andropogan lamgier species), Sprkkaa, Choraka, Chocha, Patra (Cinnamomum tamala), Tagara (Valeriana wallichii), Sthoneya (Taxus baccata), Jaati rasa (Bola  =  Commiphora myrrha), Sukti (Tamarindus indica sour fruit or Zizyphus jujube fruit), Vyaagra nakha, Amaraahwa (Devadaaru), Aguru, Shriveshtaka, Kunkuma, Chandana, Guggulu, Devadhuupa (Sarjarasa = Vateria indica resin), Khapura (Kunduruka = Boswellia serrata), Punnaaga (Calophyllum inophyllum), and Naagaahwaya (Naagakesara). 12 Vachaadi Gana: Vacha (Acorus calamus), Ativisha (Aconitum heterophyllum), Jimuuta (Luffa pentandra), Japaa (Hibiscus rosa-sinensis), Daaru (Berberis aristata) and Shunthi (Zingiber officinale dried rhizome). Charaka’s Varga: Stanyashodhana (purifier of breast milk). Vagbhat’s Vachaadi Gana: Vacha, Jalada (Cyperus rotundus), Devaahwa (Cedrus deodara), Naagara (Sunthi), Ativishaa (Aconitum heterophyllum), and Abhayaa (Terminalia chebula). 13 Haridraadi Gana: Haridraa (Curcuma longa), Daaru haridraa (Berberis aristata), Kalshi (Prshniparni: Uraria Picta), Yashti (Glycyrrhiza glabra), and Kutaja seeds (Indrayava = Wrightia tinctoria, Kutaja: Holarrhena antidysenterica). Drugs belonging to Vachaadi Gana and Haridraadi Gana (12, 13) help in the purification of breast milk (stanavishodhana) and alleviate aama as well as atisaara (diarrhea), and aamaatisaara (diarrhea due to malabsorption). They especially help in paachana (toning up the whole digestive system). Charaka’s Varga: Stanyashodhana (purifier of breast milk). Vagbhat’s Haridraadi Gana: Haridraa, Daaruharidraa, Yastyaahwa (Yashti), Kalasi (Prisniparni), and Kutajodbhava (Indrayava = Wrightia tinctoria seeds). 14 Shyaamaadi Gana: Trivrit (Operculina turpethum), Bidhaara (Ipomoea petaloidea), Danti (Baliospermum montanum), Shankhni (Ipomoea nil), Tilvaka (Viburnum prunifolium), Kampillaka (Mallotus phillipinensis), Mahaanimba (Melia azedarach), Kramuka (Areca catechu), Dravanti (Croton tiglium), Indraayana (Citrullus colocynthis), Aaragvadha (Cassia fistula), Karanja (Pongamia pinnata), Lataa Karanja (Caesalpinia bonduc shrub), Guduchi (Tinospora cordifolia), Saptalaa (Euphorbia pilosa), Vrddhadaaru bheda (Argyreia speciosa), Snuhi (Euphorbia neriifolia), Svarnakshiri (Euphorbia thomsoniana).

Basic steps for restructuring  139 Drugs of Shyaamaadi Gana are purgative (bhedana) in cases of obstinate constipation (anaaha) and distention of the abdomen (udaavarta). They cure gulma (abdominal lump) and visha (poisoning, toxemia). Charaka’s Varga: Bhedaniya (purgative). Vagbhat’s Syaamnadi Gana: Syaamaa (Syaama = trivrit), Danti, Dravanti, Kramuka (Areca catechu nut or Symplocos crataegoides), Kutarani (Ipomoea turpethum), Sankhini, Charmasaahwaa (Euphorbia pilosa), Swarnakshiri, Gavaakshi (Trichosanthus palmata), Sikhari (Achyranthes aspera), Rajanaka, Karanja (Karanja and Lataa Karanja: Pongamia pinnata, and Caesalpinia bonduc), Bastaantri (Argyreia speciosa), Vyaadhighata (Cassia fistula), Bahurasa (Ikshu = Saccharum officinarum) and Teekshna-vriksha-phala (Pilu = Teekshna-vriksha, Salvadora persica fruit). 15 Brhatyaadi Gana: Brhati (Solanum indicum), Kantakaarikaa (Solanum xanthocarpum), Kutaja phala (Holarrhena antidysenterica fruits), Paathaa (Cissampelos pareira), and Madhuka (Glycyrrhiza glabra). Drugs of Brhatyaadi Gana are paachaneeya (carminative). They alleviate Pitta, Vaayu, and Kapha. They cure arochaka feeling (anorexia), hrdroga (heart disease) and muutrakrchha (dysuria). Charaka’s Varga: Hikkaanigraha (curative of hiccup). 16 Patolaadi Gana: Patola (Trichosanthes dioica), Chandana (Santalum album), Kuchandana (Pterocarpus santalinus), Muuvaa (Marsdenia tenacissima), Guduchi (Tinospora cordifolia), Paathaa (Cissampelos pareira), and Katu rohini (Picrorhiza kurroa). Patolaadi drugs cure aruchi (anorexia), jvara (fever), chardi (vomiting), kandu (pruritus, itching), and visha (poisoning, toxemia). Charaka’s Varga: Triptighna (cures anorexia). Vagbhat’s Patolaadi Gana: Patola, Katurohini, Chandana, Madhusravaa (Muuvaa), Guduchi and Paathaa. 17 Kaakolyaadi Gana: Kaakoli (extinct), Kshira Kaakoli (extinct), Jivaka (extinct), Rshabhaka (extinct), Medaa (exitnct), Mahaa Medaa (extinct), Rddhi (extinct), Vrddhi (extinct) (see chapter “Threat to Classical Reputation” for detailed discussion on Ashta Varga), Mudgaparni (Phaseolus trilobus), Maashaparni (Teramnus labialis), Chinnaruhaa (Tinospora cordifolia) Karakata-shrngi (Pistacia integerrima), Tugaakshiri (Vanshalochana: Bamboo-manna), Padmaka (Prunus cerasoides), Prapaundarika (Nelumbium speciosum, white variety, roots), mrdvikaa (Vitis vinifera raisins), Jivanti (Leptadenia reticulata), and Madhuka (Glycyrrhiza glabra).

140  Legacy and logical steps Drugs of Kaakolyaadi Gana alleviate Pitta and anil-shonita (gout). They are vitalizing, nourishing and aphrodisiac, galactagogue and produce Kapha. Charaka’s Varga: Jivaniya (promoter of longevity). stanyajanana (promoter of lactation), shukrajanana (promoter of semen generation), prajaasthaapana (curative of sterility), vayahsthaapana (prevents aging). Vagbhat’s Padmakaadi Gana (= Sushruta’s Kaakolyaadi Gana): Padmaka, Pundra (Nelumbo nucifera) Vriddhi (extinct), Tugaa (Bamboomannaa), Riddhi (extinct), Sringi (Karkata-sringi), Amritaa (Guduchi) and the drugs constituting Jivantyaadi Gana. Vagbhat’s Jivantyaadi Gana: Jivanti (Leptadenia reticulata), Kaakoli (extinct), Kshira kaakoli (extinct), Medaa (extinct), Mahaa Medaa (extinct), Mudgaparni (Phaseolus trilobus), Maashaparni (Teramnus labialis), Rshabhaka (extinct), Jivaka (extinct) and Madhuka (Yashtimadhu). 18 Uushakaadi Gana: Uushaka (a variety of alkaline soil which could not be identified or Dorema ammoniacum exudate), Saindhava (rock salt), Shilaajatu (Asphalt, Rock’s mineral exudate), Guggulu (Commiphora wightii exudate), Kaasisa (green vitreol), Hingu (Ferula foetida), Tutthaka (blue vitreol). Drugs of Uushakaadi Gana alleviate Kapha and help in the depletion of fat (medovishoshana). They cure ashmari (stone in the urinary tract), sharkaraa (sediments in the urine), muutrakrchhra (dysuria), shuula (colic pain), and gulma (abdominal lump). Vagbhat’s Uushakaadi Gana: Uushaka, Tuththaka, Hingu, Kaasisadwai (Pushpakaasisa and Paansukaasisa), Saindhava, Shilaajatu. 19 Saarivaadi Gana: Saariva (Hemidesmus indicus), Madhuka (Glycyrrhiza glabra), Chandana (Santalum album), kuchandana (Pterocarpus santalinus), Padmaka (Prunus cerasoides), Kaashmarya phala (Gmelina arborea fruits), Madhuuka pushpa (Madhuca indica flowers), and Ushira (Vetiveria zizaniodes). Drugs of Saarivaadi Gana cure pipaasaa (morbid thirst), rakta-pitta (bleeding disorders), and Pitta jvara (fever due to Pitta). They especially cure daaha (burning syndrome). Charak’s Varga: Trshnaanigrahana (curative of morbid thirst), jvarahara (curative of fever), daahaprashaman (curative of burning sensation). Vagbhat’s Saarivaadi Gana: Saarivaa, Usheera, Kaashmarya, Madhuuka, Sisiradwai (Chandana and Raktachandana), Yashti (Yeshtimadhu) and Paruushaka (Grewia asiatica). 20 Anjanaadi Gana: Anjana (one of the five variants of collyriums, uparasa group of eight minerals, or could be the ash or Memecylon umbellatum or Hardwickia binata),

Basic steps for restructuring  141 Rasaanjana (dry extract of Berberis aristata heartwood), Naaga pushpa (Minsops elangi flowers or stamen), Priyangu (Callicarpa macrophylla or Prunus mahaleb), Nilotpala (Nymphaea stellata), Nalada (Vetiveria zizaniodes), Nalina (Nelumbo nucifera), Kesara (Mesua ferrea), and Madhuka (Glycyrrhiza glabra). Drugs of Anjanaadi Gana cure rakta-pitta (bleeding disorders, haemoptysis). They cure visha (poisoning, toxemia) and an acute form of burning sensation inside the body (aabhyantara daaha). Charaka’s Varga: Shonitasthaapana (haemostatic), daahaprashamana (curative of burning sensation), vishagna (the antidote to poisoning). Vagbhat’s Anjanaadi Gana: Anjana, Priyangu, Maamsi, Padma (Nelumbo nucifera), Utpala (Nymphaea stellata), Rasaanjana, Elaa (Elettaria cardamomum), Madhuka, Naagakesara (Mesua ferrea). 21 Paruushakaadi Gana: Paruushaka (Grewia asiatica), Draakshaa (Vitis vinifera bigger raisins), Katphala (Myrica nagi), Daadima (Punica granatum), Raajaadana (Mimusops indica fruits), Kataka (Strychnos potatorium fruits), Shaaka phala (Tectona grandis fruits), and Triphala (Terminalia chebula, Terminalia bellirica, Emblica officinalis fruits). The drugs of Paruushakaadi Gana alleviate Vayu and cure muutra dosha (urinary disorders). They are hrdya (cardiac tonic). They cure pipaasaa (morbid thirst) and ruchiprada (stimulate appetite). Charaka’s Varga: Virechanopaga (purgative, due to Triphala), shrmahara (curative of fatigue), hrdya (cordial), trshnaanigrahana (curative of morbid thirst) Vagbhat’s Paruushakaadi Gana: Paruushaka, Varaa (Triphala), Draakshaa, Katphala, Raajaahva (Aaragvadha = Casia fistula), Daadima, Shaaka (Tectona grandis). 22 Priyangvaadi Gana: Priyangu (Callicarpa mavrophylla flower-buds or Prinus mahaleb kernel of fruits), Samangaa (Mimosa pudica), Dhaataki (Woodfordia fruticosa), Punnaga (Calophyllum inophyllum), Naagakeshara (Mesua ferrea), Chandana (Santalum album), Rakta chandana (Pterocarpus santalinus), Mocharasa (exudate of Bombax ciba tree), Rassanjana (extract of Daaru haridraa, Berberis aristata), Kumbheeka (Pistia stratiotes), Srotonjana (one of the five variants of collyriums, uparasa group of eight minerals or could be ash of Memecylon umbellatum or Hardwickia binata), Padma keshara (Nelumbo nucifera filament), Manjishthaa (Rubia cordifolia) Dhanvayaasa (Fagonia cretica). Charaka’s Varga: Purisha-sangrahaniya (renders fecal matters consistent), sandhaaniya (promote the union of fractured parts, promote cell generation), shonitasthaapana (heamostatic), sangyaasthaapana (resuscitative).

142  Legacy and logical steps Vagbhat’s Priyangvaadi Gana: Priyangu, Pushpaanjana (Pushpaanjana is a variety of Anjana (Collyrium), white in color, used for eye diseases, and fever), Anjanayugmam (Srotonjana and Souveeranjana), Padmaa (Nelumbo nucifera), Padmaadrajah (Padma stamen), Yojanavalli (Manjishtaa = Rubia cordifolia), Anantaa (Yavaasaa = Alhagi pseudalhagi), Maanadruma (Saalmali = Salmalia malabarica), Mocharasa (Saalmali gum-resin), Samangaa, Punnaaga, Sitha (Chandana  =  Santalum album), Madaniyahetu (Dhaataki = Woodfordia fruticosa). 23 Ambaashthaadi Gana: Ambashthaa (Cissampelos pariera), Dhaataki pushpa (Woodfordia fruticosa flowers), Samangaa (Mimosa pudica), Katvanga (Allanthus excelsa), Madhuka (Glycyrrhiza glabra), Bilva (Aegle marmelos), Saavar Rodhra (Symplocos crataegoides), Palaasha (Butea monosperma), Nandivraksha (Ficus arnottiana’; in a text, it was interpreted as Gambhaari, Gmelina arborea), and Padma keshara (Nelumbo nucifera filament). Charaka’s Varga: Sandhaaniya (promote the union of fractured parts, promote cell generation), purisha-sangrahaniya (renders fecal matters consistent). Vagbhat’s Ambashtaadi Gana: Ambaashtaa, Madhuka (Glycyrrhiza glabra), Namaskari (Samangaa), Nandivriksha (Prarohi), Palaasha, Kachchura (Fagonia cretica), Rodhra (Symplocos racemosa), Dhaataki, Bilvapesika (Aegle marmelos fruit pulp), Katvanga, and Kamalodbhava rajah (Nelumbo nucifera filament). Drugs of Priyangvaadi Gana and Ambaashthaadi Gana possess the same properties. They alleviate Pitta, promote stambhana (retention power), and are sandhaaniya (promote the union of fractured parts, promote cell generation), also heal the ulcer. They are beneficial in pakvaatisaara (chronic diarrhea). 24 Nyagrodhaadi Gana: Nyagrodha (Ficus benghalensis), Udunbara (Ficus racemosa), Ashvattha (Ficus religiosa), Plaksha (Ficus lacor), Madhuuka (Madhuca indica), Aamraataka (Spondias pinnata), Aamra (Mangifera indica), Koshaamra (Laakshaa vrksha = Schleichera oleosa), Arjuna (Terminalia arjuna), Jambudwai (Syzygium cuminii, Syzygium jambos), Priyaala (Buchanania lanzan), Madhuka (Glycyrrhiza glabra), Katphala (Myrica nagi), Vetasa (Salix caprea), Kadamba (Anthocephalus cadamba), Badari (Zizyphus jujuba), Tinduka (Diospyros peregrina), Shallaki (Boswellia serrata), Rodhra (Lodhra, Saavar rodhra: Symplocos crataegoides and S. racemosa), Bhallaataka (Semecarpus anacardium), Palaasha (Butea monosperma), and Paarshva pippala (Ficus arnottiana). Drugs of Nyagrodhaadi Gana are graahi (astringent), sandhaaniya (promote the union ofractured parts, promote cell generation), vrnya (heal ulcer), raktipitta shamana (styptic), daaha prashamana (alleviate burning

Basic steps for restructuring  143 sensation). Used for treating ulcers or wounds, fractures, rakta-pitta (bleeding disordrs), daaha (burning sensation), prameha (urinary disorders), and yoni vikaara (disorders of female genital tract). Vagbhat’s Nyagrodhaadi Gana: Nyagrodha, Ashvattha, Udumbara, Rodhrayugma (Rodhara and Saavara Rodhra), Jambudwai, Arjuna, Kapitana (Albizia lebbeck), Somavalka (Acacia suma), Plaksha, Aamra, Vanjula (Salix caprea), Piyaala (Buchanania lanzen), Palaasa, Nandi (Cidrus toona), Kolaa (Zizyphus jujuba), Kadamba, Viralaa (Diospyros tomentosa), Madhuka and Madhuuka. Charaka’s Varga: Chhardinigraha (nausea preventing), purisha-sangrahaniya (renders fecal matters consistent), muutra sangrahaniya (corrective of excessive urination). 25 Guduchyaadi Gana: Guduchi (Tinospora cordifolia), Nimba (Azadirachta indica), Dhaanyaka (Coriandrum sativum), Padmaka (Prunus cerasoides), and Rakta chandana (Pterocarpus santalinus). The drugs of Guduchyaadi Gana cure trshnaa (morbid thirst), daaha (burning syndrome), aruchi (anorexia), chardi (vomiting), and jvara (fever). They have dipana property (stimulate the power of digestion). Charaka’s Varga: Trshnaanigrahana (curative of morbid thirst). Vagbhat’s Guduchyaadi Gana: Guduchi, Padmaka, Arista (Azadirachta indica), Dhaanyaka and Raktachandana. 26 Utpalaadi Gana: Utpala (Nymphaea alba), Kumuda (Nymphaea stellata), Padma (Nelumbo nucifera), Kalhaara (Nymphaea rubra), and Madhuka (Glycyrrhiza glabra). Drugs of Utpalaadi Gana alleviate rakta-pitta (bleeding disorders), and cure visha (poisoning, toxemia), and chardi (vomiting). Charaka’s Varga: Daahaprashamana (curative of burning sensation), Trshnaanigrahana (curative of morbid thirst), Muutravirajaniya (curative of coloured urine). 27 Mustaadi Gana Musta (Cyperus rotundus), Paathaa (Cissampelos pareira), Nishaadwai (Curcuma longa, Berberis aristata), Tikta (Picrorhiza kurroa), Vacha (Acorus calamus), Elaa (Elettaria cardamomum), Ruk (Kushtha: Saussurea lappa), Vishaa (Ativishaa: Aconitum heterophyllum), Chaara (Priyaala: Buchanania lanzan fruit), Elaa (bigger variety: Amomum subulatum), and Shaarngishtha (Physalis minima or Cardiospermum halicacabum). Drugs of Mustaadi Gana contain shodhana (internal cleansing) components; paachana (carminative) and stanya (galactogogue) properties. They cure stana roga (diseases of the breast), and jvara (fever).

144  Legacy and logical steps Charaka’s Varga: Lekhaniya (reducing obesity and scarifying), stanyashodhana (purifier of breast milk). Vagbhat’s Mustaadi Gana: Mustaa, Vacha, Agni (Chitraka = Plumbago zeylanica), Dwinisaa (Haridraa and Daaruharidraa), Dwitiktaa (Katurohini and Kaakatikta  =  Picrorhiza kurroa and Cardiospermum helicacabum), Bhallaataka (Semecarpus anacardium), Paathaa, Triphala, Vishaakhyaa (Aconitum heterophyllum), Kushtha, Truti (Elettaria cardamomum), Haimavati (Sweta vacha = Iris germanica) 28 Triphlaa: Triphala or Phala trika: fruits of Haritaki (Terminalia chebula, one part), Vibhitaki (Terminalia bellirica, two parts), and Aamalaki (Emblica officinalis, four parts). Triphalaa complex alleviates Kapha as well as Pitta and cures meha (urinary diseases), as well as kushtha (obstinate skin diseases including leprosy). It is laxative, chaakshushya (promoter of eye sight) and digestive stimulant. It cures visham jvara (irregular fever). Charaka has described another variety of Triphala/Phala trika. It contains Draakshaa (Vitis vinifera raisins), Kaashmarya (Gmelina arborea fruit), and Parushaka (Grewia asiatica fruit). This was used for rakta-pitta (bleeding disorders). (Charaka Samhita, Sutrasthan 26: 28, 64, 86.). 29 Tryuushana Gana: Pippali (Piper longum), Maricha (Piper nigrum) and Shunthi (Zingiber officinale dried rhizome), as a group, is also known as Trikatu (Three Pungents). It reduces Kapha and medas (adiposity), cures meha (urinary diseases), kushtha (obstinate skin diseases including leprosy) and tvagaamya (dermatitis). It is a digestive stimulant. Also cures gulma (abdominal lump), pinasa (chronic rhinitis) and mandaagni (dyspepsia). 30 Aamalakyaadi Gana: Aamlaki (Emblica officinalis), Abhayaa (Terminalia chebula), Krshnaa (Piper longam), Chitraka (Plumbago zeylanica). Drugs of Aamalakyaadi Gana cure jvara (fever). They are Chaakshushya (promote eye sight), vrshya (aphrodisiac, age-sustaining), bhedi (purgative), and agni prdipaka (a digestive stimulant). Charaka’s Varga: Jvarahara (curative of fever). 31 Trapvaadi Gana (calcined minerals): The group consists of calcined trapu (tin), sisa (lead), taamra (copper), rajata (silver), krshna lauha (old iron), suvarna (gold) and lauha mala (sludge iron). Mineral drugs of Trapvaadi Gana are rakta-krmi-hara (cure blood and parasitic infection), alleviate pipaasaa (morbid thirst), visha (poisoning,

Basic steps for restructuring  145 toxemia), cure hrdroga (heart diseases), paandu (anemia), meha (urinary disorders). 32 Lakshaadi Gana: Lakshaa (lac: twigs of plants covered with the resinous bodies of the lac insect, Laccifer lacca), Aarevata (Aaragavadha: Cassia fistula), Kutaja (Holarrhena antidysenterica), Ashvamaara (Karavira: Nerium indicum), Katphala (Myrica nagi fruit), Haridradwai (Curcuma longa and Berberis aristata), Nimba (Azadirachta indica), Saptachhada (Alstonia scholaris), Maalati (Jasminum officinale var. grandiflorum) and Traayamaanaa (Gentiana kurroo). The drugs of Lakshaadi Gana are kashaaya-tikta-madhura (astringent, bitter and sweet). They alleviate the vitiation of Kapha and Pitta. They cure kushtha (obstinate skin diseases including leprosy), and krmi (a parasitic infection). They help in cleansing of dushta vrana (nonhealing ulcer). Charaka’s Varga: Krmighna (curative of worms), kushthaghna (curative of obstinate skin diseases). 33 Kshudra panchamuula (Laghu panchamuula): Prshniparni (Uraria picta), Shaaliparni (Desmodium gangeticum), Brhatidwai (Solanum indicum and Solanum xanthocarpum), and Gokshura (Tribulus terrestris) roots. All these five roots taken together are brhana (nourishing), alleviate Vaayu and Pitta. The group is kashaaya (astringent), tikta (bitter) and madhura (sweet). It cures diseases caused by vitiation of all the three doshas, and sannipaata (high fever due to vitiation of all the three doshas) and shirorti (headache). 34 Mahat panchmuula: Bilva (Aegle marmelos), Agnimantha (Premna integrifolia), Shyonaaka (Oroxylum indicum), Kaashmari (Gmelina arborea) and Paatala (Stereospermum suaveolens) roots. All the five roots taken together are deepana (stimulate digestion) KaphaVaataghna (alleviates Kapha as well as Vaayu). Dashamuula: Both Kshudra panchamuula and Mahat panchmuula, taken together constitute Dashamuula (Sushruta, Sutra 38: 66–70). Dashmuula group alleviate all the three doshas. It cures kaasa (bronchitis), sannipaata (high fever due to vitiation of all the three doshas), shirorti (headache), shvaasa (asthma) and hikkaa (hiccup). Charaka’s Dashmuula Varga: Shothahara (anti-inflammatory). (See Editor’s Note.) 35 Vallija panchamuula: Roots of Vidaari (Vidaari (Pueraria tuberosa), Saariva (Hemidesmus indicus), Chhagashrngi (Ajashrngi: Pistacia integerrima), Vatsaadani

146  Legacy and logical steps (=Guduchi: Tinospora cordifolia), and Nishaa (Curcuma longa or Curcuma caesia). All the roots taken together are vrshya (aphrodisiac) and alleviate pittaanil (Pitta as well as Vaayu). Charaka’s Varga: Shukra shodhana (purifier of semen). 36 Panchakantaka: Karamardaka (Carissa carandas), Saireya (Barleria prionitis), Trikantaka (Tribulus terrestris), Shataavari (Asparagus racemosus) and Grdhanakhi (Capparis sepiaria). All the five drugs, taken together, cure rakta-pitta (bleeding disorders), shopha (edema), shukra meha (spermaturia) and shukra dosha (vitiation of semen). Charaka’s Varga: Shukra shodhana (purifier of semen). 37 Trna panchamuula: Kusha (Desmostachya bipinnata), Kaasha (Saccharum spontaneum), Nala (Arundo donax or Phragmites karka), Kaandekshu (Ikshu: Saccharum officinarum). (Charaka: Shaali (Oryza sativa), Kaasha (Saccharum spontaneum), Shara (Saccharum munja), Darbha (Imperata cylindrica), and Ikshu (Saccharum officinarum). “The roots of five-grasses,” when taken together, alleviate daaha (burning syndrome), vitiation of pitta, treat disorders of the urinary bladder by vasti-shodhana and remove visha (toxemia). Charaka’s Varga: Muutravirechaniya (diuretic).

Additional groups mentioned in Sushruta texts 1

Vatsakaadi Gana: Vatsaka (Holarrhena antidysenterica), Ativishaa (Aconitum heterophyllum), Muurva (Marsdenia tenacissima), Bhaargi (Clerodendrum serratum), Elaa (Elettaria cardamomum), Katuka (Picrorhiza kurroa), Ushna (Zingiber officinale dried rhizome or Piper longum or Piper nigrum, any one of Trikatu Group), Vacha (Acorus calamus), Shyonaaka (Oroxylum indicum), Ugraa (Mahaabhari Vacha: Alpinia galanga), Panch kolaa (see after Tri karshita Gana), Ajamoda (Apium graveolens), Vella (= Vdanga: Embelia ribes), Ajagandhaa (Gynandropsis gynandra), Siddhaartha (Brassica alba), Jirakadwai (Cuminum cyminum and Carum carvi, white and black, respectively), and Hingu (Ferula foetida). Drugs of Vatsakaadi Gana alleviate Vaayu and Kapha, and cure gulma (abdominal lump), arsha (piles), jvara (fever), and shuula (colic pain).

Basic steps for restructuring  147 2

Kadambaadi Gana: Kadamba (Anthocephalus cadamba), Vaaji karna (Ashwa karna: Vatica robusta), Karanja (Pongamia pinnata), Kshavaka (Chhikkini: Centipeda orbicularis), and Gudaa (Drakshaa: Vitis vinifera raisins). Drugs of (Kadambaadi Gana cure vitiated Kapha, paandu (anemia), tvaka roga (skin diseases), kushtha (obstinate skin diseases including leprosy), meha (urinary disorders), and visha (toxemia).

3

Karanjaadi Gana: Karanja (Pongamia pinnata), Vatsa (Kutaja: Holarrhena antidysenterica), Sairiya (Barleria prionitis), Sushavi (Calycoptris floribunda), and Saptaparna (Alstonia scholaris). Drugs of Karanjaadi Gana cure meha (urinary disorders), kushtha (obstinate diseases including leprosy), jvara (fever), chardi (vomiting), visha (toxemia), and vitiation of Kapha.

4

Tri karshita: Naagara (Zingiber officinale dried rhizome), Ativishaa (Aconitum heterophyllum), and Musta (Cyperus rotundus) taken together are called Tri karshita. Drugs of Tri karshita alleviates Kapha, Pitta, and Vaayu, and cures jvara (fever). It is graahi (astringent) and possesses dipan (digestive stimulant) property.

5

Panch Kola: Pippali (Piper longam), Pippali muula (Piper longam root), Chavya (Piper chaba), Chitraka (Plumbago zeylanica) and Naagara (Zingiber officinale dried rhizome). Drugs of Pancha kola are deepniya (stimulate the power of digestion), and cure diseases caused by Kapha and Vaayu.

Vagbhata (sixth century ad) added some Panchakarmaspecific and Vaata, Pitta, Kapha alleviative drugs among its 31 Ganas. 1

Vamanaoushadha Gana (Emetics): Madana (Randia dumetorum), Madhuka (Glycyrrhiza glabra), Tumbi (Lagenaria siceraria), Nimba (Azadirachta indica), Bimbi (Coccinia indica), Visaalaa (= Indravaruni: Citrullus colocynthis), Trapusa (Cucumis sativus), Kutaja (Holarrhena antidysenterica), Muurvaa (Marsdenia tenacissima), Devadaali (Luffa echinata), Krimighna (Vidanga  =  Embelia ribes), Vidula (Salix alba), Dahana (Plumbago zeylanica), Chitraa (Ricinus communis), Ghantaalikaa (Crotalaria juncea), Karanja (Pongamia pinnata), Kanaa (Piper longam), Lavana (Rock-salt), Vacha (Acorus calamus), Elaa (Elettaria cardamomum), and Sarshapa (Brassica campestris) are used as emetics.

148  Legacy and logical steps 2 Virechanaoushdha Gana (Purgatives): Nikumbha (Danti  =  Baliospermum montanum), Kumbha (Trivrit  =  (Operculina turpethum), Triphalaa, Gavaakshi (Trichosanthes palmata), Snuk (Euphorbia neriifolia), Sankhini (Euphorbia dracunculoides), Nilini (Indigofera tinctoria), Tilwaka (Symplocos racemosa), Samyaaka (Cassia fistula), Kampillaka (Mallotus philippinensis), Hemadugdhaa (Svarnakshiri = AFI: Euphorbia thomsoniana or Argemone maxicana), Dugdha (milk), Muutra (urine of cow) are used as purgatives. 3

Niroohana Dravya Gana (used for Niroohavasti): Madana phala (Randia dumetorum), Kutaja (Holarrhena antidysenterica bark), Kushtha (Saussurea lappa), Devadaali (Luffa echinata), Madhuka (Glycyrrhiza glabra), Vacha (Acorus calamus), Dasamuula (see Susruta’s classification of drugs), Daaru (Devadaaru = Cidrus deodara), Raasnaa (Pluchea lanceolata), Yava (Hordeum vulgare), Misi (Satapushpaa = Anethum sowa), Kritavedhana (Luffa acutangula), Kulattha (Dolichos biflorus), Madhu (honey), Lavana (Rock-salt) and Trivrit (Operculina turpethum).

4

Shirsha virechaniya Gana (Sodhana Nasya): Vella (Vidanga = Embelia ribes), Apaamaarga (Achyranthes aspera), Tryuushana Gana, Daarvi (Berberis aristata), Suraalaa (Vateria indica resin), Shirisha beeja (Albizzia lebbeck seeds), Baarhata beeja (Brhati beeja = Solanum indicum seeds), Saigrava beeja (Sigru beeja  =  Moringa oleifera seeds), Madhuuka Saara (Madhuca indica flower extract), Saindhava (Rock-salt), Taarkshya shaila (Rasaanjana Ayurvedic collyrium), Trutyou (Elettaria cardamomum and Amomum subulatum), and Prithvikaa (Carum carvi or Hingupatri = Ferula jaeschkeana or Gardenia gummifera).

5 Vaatahara Gana: Bhadradaaru (Cedrus deodara), Nata (Tagara = (Valeriana wallichii),) Kushtha (Saussurea lappa), Dasamuula, Balaa (Sida cordifolia) and Atibala (Abutilon indicum) constitute Bhadradaarvaadi Gana. Bhadradaarvaadi Gana, Viratarvaadi Gana and Vidaaryadi Gana were used Vaatahara Gana. 6

Pittahara Gana: Duurvaa (Cynodon dactylon), Anantaa (Yavaasaa  =  Alhagi pseudalhagi), Nimba (Azadirachta indica), Vaasaa (Adhatoda vasica), Aatmaguptaa (Mucuna prurita), Gundraa (Typha angustata), Abhiru (Shataavari  =  Asparagus racemosus), Shitapaaki (Sida cordifolia fruit), and Priyangu dhaanya (Setaria italica). Duurvaadi Gana checks Pitta.

Basic steps for restructuring  149 7

Kaphahara Gana: Aargvadhaadi Gana, Arkaadi Gana, Mushkakaadi Gana, Asanaadi Gana, Surasaadi Gana, Mustaadi Gana and Vatsakaadi Gana.

8

Vatsakaadi Gana: Vatsaka (Kutaja: Holarrhena antidysenterica), Vanatiktaka (Wild Picrorhiza kurroa), Muurvaa (Marsdenia tenacissima), Bhaargi (Clerodendrum serratum), Katukaa (Picrorhiza kurroa), Maricha (Piper nigrum), Ghunapriyaa (Aconitum heterophyllum), Gandira (Euphorbia neriifolia), Elaa (Elettaria cardamomum), Paathaa (Cissampelos pareira), Ajaaji (Cuminum cyminum), Katvanga phala (Araluka = Ailanthus excels fruit), Ajamoda (Apium graveolens), Siddhaartha (Brassica alba), Vacha (Acorus calamus), Jiraka (Cuminum cyminum), Hingu (Ferula foetida), Vidanga (Embelia ribes), Pashugandhaa (Ajagandhaa = Gynandropsis gynandra), and Pancha kolaa (Pippali, Pippalimuula, Chavya, Chitraka and Sunthi). Vatsakaadi Gana checks Vaata, Kapha and medas (adiposity), peenasa (chronic cold, sinusitis, rhinitis), Gulma (tumour), jvara (fever), shuula (colic pain) and durnaaman (piles).

The Eight Vargas of Bhavprakasha Nighantu8 1

Haritakyaadi Varga: In this Varga, out of 94 plants, possible adverse effect of 26 drugs have been reported including four drugs belonging to Lavana (salt) and Kshaara (alkali) category. Bibhitaka (Terminaliia bellirica), Paarsikayavaani (Hyosymus niger), Bhanga (Cannabis sativa) and Khaskhasa (Papaver somniferum seeds) were reported with Madakrut (intoxicating) action. Contraindications for therapeutic uses of Haritaki (Terminalia chebula) and Aardraka (Zingiber officinale), and probable adverse effects of the specific parts viz. Bibhitaka Majja (fruit pulp of Terminalia bellarica) and avasthaa (status of the drug) viz. dry Maricha (Piper nigrum) and Pippali (Piper longum). Fourteen drugs have been mentioned for their Pitta Dosha elevating property. Parsikayavani (Hyosymus niger) and Jiraka (Cuminum cyminum) are reported with grahini action (therapeutic absorptive measure) effective in the treatment of atisaara (diarrhea), grahini (irritable bowel syndrome) but drugs with this action should be avoided in constipation. Yavaani (Trachyspermum ammi), Dhanyaka (Coriandrum sativum), Shatapushpa (Foeniculum vulgare), and Khasakhasa (Papaver somniferum seeds) are mentioned for their adverse effect on shukradhaatu (male reproductive system). (Coriandrum sativum), Shatapushpa (Foeniculum vulgare), and Khasakhasa (Papaver somniferum seeds) are mentioned for their adverse effect on shukradhatu (male reproductive system).

150  Legacy and logical steps 2

Karpuraadi Varga: Drugs of this group consist of 58 aromatic drugs like Karpura (Cinnamomum camphora), Chanadana (Santalum album). Among these, some drugs are to be administered with care because of their properties and action. Three drugs, Aguru (Aquailaria agallocha), Guggulu (Commiphora wightii), Tvakapatra (Cinnamomum cassia) vitiate Pitta and one drug, Padmaka (Prunus cerasoides) vitiate Vaata Dosha. Priyangu (Prunus mahaleb fruits or Callicarpa macrophylla flowers) leads to constipation and Renuka (Vitex negundo) is reported with Garbhapatini (abortive) action.

3

Guduchyaadi Varga: In this Varga, details of 124 drugs were mentioned. Out of these, 44 drugs are to be administered with care because of their properties and action. Sixteen drugs are Vaataprakopaka (vitiate Vaata Dosha), 14 Pittaprakopaka (vitiate Pitta Dosha) and 3 are Kaphadosha prakopaka (vitiate Kapha Dosha). Kalihari (Gloriosa superba) is reported as Garbhapatini (abortifacient) and Karaveera (Nerium odorum) as Vishavat (poisonous). Dhatuura (Dhatura metel), Shyma Trivrut (Operculina turpenthum) are reported with Madakrut (narcotics) action, Shigru (Moringa pterygosperma) seeds and Bhutruna (Cymbopogon citrates) are stated as Avrushya (decrease sexual interest). Eranda (Ricinus communis) leaves are Rakapitta-prakopaka (vitiate Rakta and Pitta Dosha), fruit pulp as purgative.

4

Pushpa Varga: In this group, out of 33 drugs, 11 are reported for side effect on Dosha, Dhaatu (seven tissues) and Mala (excreta). Tulasi (Ocimum sanctum) and its variety Barbari (Ocimum basilicum) are reported as Pittakrut (vitiate Pittadosha). Vishtambhi (heavy to digest) action has been shown for Padmini (Nelumbium speciosum), Kalhar (Nymphaea alba) and Kadamba Pushpa (Anthocephalus cadumba).

5 Vataadi Varga: Eight, out of 40 big trees, described under this group, are mentioned with their possible side effects. Among them, Shinshapa (Dalbergia sissoo) and Arishtaka (Sapindus mukorossi) were reported for their Garbhapatini (abortificant) and Katabhi (Careya arborea) and Moksha (Schrebera swietenioides) for their Shukrahat (antispermatogenic) properties. 6

Phalaadi Varga: This group describes edible fruits which are otherwise considered healthy but still pose problems when consumed recklessly. Out of 56 fruits, 39 fruits are reported for their possible side effects. Mango, in unripe condition, leads to vitiation of Tridosha and Rakta Dhatu. Mango may hamper

Basic steps for restructuring  151 the digestive system and eyes if more is consumed. Among all fruits, five may hamper Agni (digestive system), two may hamper eye, while three may act on CNS, reported with moha (confusion), madakrut action (intoxication), if used irrationally. Panasa (Artocarpus integrifolia) is contraindicated in gulma (abdominal disorders) and mandagni (decrease digestivepower). Kharbuuja (Dashaangula = Cucumis melo), turned into amla (sour), Madhura Rasa (sweet taste) and Kshaara (alkaline) are reported as Rakta-pittakara (causing blood disorder) and muutrakrachhakara (causing dysuria). Ripe fruit of Trapusa (Cucumis sativus) vitiate Pitta Dosha. 7

Dhaanya Varga: This group consists of 33 plants of different varieties of Dhaanya (Grains), Shaali (cereals), Shashtika (a type of rice), Shuka (awned grains), Shimbi (pulses) and Kshudra Dhanya (grains of lower grade). All the members of this Dhaanya Varga are reported for their badhaalpavarchasa (constipative) properties and the Shimbi as Adhmankaraka (causes distention of abdomen) except Mudga (Phaseolus radiatus) and Masura (Lens esculentus). Among the drugs of Dhanya Varga, 23 are reported with side effects. Nishpava (Dolichos lablab), Kulattha (Dolichos biflorus) and Atasi (Linum usitatissimum) are Shukraghna (antispermatogenic), while Yava-naala (Sorghum vulgare) is Avrushya (decreases sexual interest). Dry and roasted Chanaka (Cicer arietinum) is Kushtha-prakopaka (causes skin diseases), while Triputa (Lathyrus sativus) is Khanjatwa-pangutvakari (hampers mobility). Atasi (Linum usitatissimum) has been reported for its possible harmful effect on eye/eyesight.

8

Shaaka Varga: Some vegetables were considered harmful to eyesight. They also reduce sexual potency, mental power, and strength. Among 66 different Shaaka (vegetables); 28 are reported with side effects. Shimbi shaaka (not to be confused with Mudgaparni = Phaseolus radiatus), and Sarshapa (Brassica campestris) is reported as Tridoshkrut (vitiating Vaata, Pitta and Kapha) and are especially mentioned as Nindita (condemn for lowest quality) among all vegetables. It has been advised to avoid Surana (Amorphophallus campanulatus) in Rakatapitta (bleeding disorders), Dadru and Kushtha (skin disorders).

Editor’s note: a number of classifications need total restructuring. A few examples: 1

All Dashmuula and Panchmuula formulations are to be rechristened and should be considered as new drugs, traditional or textual names are misleading and deceptive due to changes in plant parts. Ayurvedic Formulary of India

152  Legacy and logical steps provided stem bark and whole plant as substitutes for roots of Dashmuula. We suggest that the classical formulation should be replaced with the following components: Aegle marmelos leaves possess highly significant acute and subacute antiinflammatory activity which may be due to the presence of lupeol and skimmianine in the leaves. In a study, the alcoholic extract of the leaves antagonized the histamine induced contractions and demonstrated positive relaxant effect in isolated guinea pig ileum and tracheal chain, suggesting inhibition of H1 receptor activity this extract may underlie these effects.9 Crude ethyl acetate, methanolic and water extracts of leaves of Oroxylum indicum showed significant antioxidant activity with IC50 values of 49.0, 55.0, respectively, at 100 µg/ml concentration.10 Crude extracts of Gmelina arborea plant are reported to possess woundhealing properties, antidiarrheal activity, antioxidant activity, antidiabetic activity, and antiulcer act. Stereospermum suaveolens flowers are used with honey to stop cough. Phytoconstituents such as 6-O-glucosyls-cutellarein7 dinatin, dinatin7-glucuroniside, dinatin-7-glucuronide, quinones, stereochenols A and B, naphthoquinones, sterekunthal B, sterequinone C and stereolensin have been reported from the leaves of this plant. The juice of Clerodendron phlomoides leaves is used as an alternative and bitter tonic. The plant is reported to be useful in inflammation, glycosuria, pox, coryza, scrotal enlargement, and postnatal complaints.11

2

3

The five roots (Laghu Panchamuula) have already been replaced with their plant parts. From additional plant drugs of Dashmuula formulations, only the following can be retained, if found necessary, Lodhra, Guduchi, Manjishtha, and Pippali. All Ashvagangha (Withania) formulations are to be subjected to experimental and clinical studies, due to change in its chemo-type. It has now been identified as Withania Ashvagandha sp. novo. All formulations containing Mesua ferrea and Crocus sativa are to be reexamined for their therapeutic properties, as Kesara and Keshara are synonyms, equated with Naagakesara (Mesua ferrea) in Ayurvedic Formulary of India, Part I, Second Revised Edition, 2003, page 317, and Keshara is not a synonym of Kumkuma, Crocus sativa, page 318) while Keshara is equated with Croccus sativa (Kumkuma) in Ayurvedic Formulary of India, Part II, 2000, page 330, which was published earlier to the revised edition of Vol. II. The equation changed after 3  years. In the monograph of Crocus sativa, Ayurveda Pharmacopoeia of India, Part I, Vol. IV did not include Chyavanprasha among important formulations. In Samhitas, Mesua ferrea was used as Kesara. Kaashmiraj, Vahleeka, Rudhir and Sankoch were synonyms of Kumkuma (Crocus sativa).

Basic steps for restructuring  153 4

All formulations of Bhaargi (Bhaarangi) are to be checked for their botanical components, as Clerodendrum serratum or none of the Clerodendrum spp. are the sources of what is available in the market. Pygmaeopremna herbacea is also known as Bharangi Tree (Qian jie cao, Chinese). During the sixteenth century, Bhaargi was scarce and in Bhavaprakasha the root of Kantakaari (Solnum xathocarpum) was used as a substitute in Sudarshan Churna. Powdered barks of Clerodendrum serratum, Gardenia turgid, and Gardenia latifolia (used as “Bhaarangi”) together with Kantakaari (Solnum xathocarpum), and Rhus succedanea (Karkatashringi) formed a common anti-asthmatic drug during the classical period.

5

All Nishaa (till now equated with Curcuma longa) formulations are to be reviewed. Synonyms of Curcuma longa are Haridra, Priyaka, Haridruma, Kaanchni, Hatta-vilaasini. Yoshitapriya, Vara-varnini. Other synonyms, Nisha, Rajani, Raatri, Nilakanth and Varna-vinaasini have no link to the synonyms of Curcuma longa. There are 32 formulations in Bhavaprakasha that contain Nishaa as a component. Nishaa was equated with Daaru nishaa, which was very yellow in color. Curcuma caesia in known as Kaali Haldi in West Bengal. All Nishaa formulations should be revalidated by using Curcuma caesia. Nishaamalaki Churna (Ashtangahridya) was prescribed for diabetes. The powdered drug contained Nishaa and Aamalaki (Emblic myrobalan) in equal quantity. The methanol extract of Curcuma caesia rhizome showed antidiabetic activity by lowering blood glucose in in vivo studies and controlled intestinal absorption of monosaccharides by inhibiting alpha amylase and alpha glucosidase. It also enhanced the glucose uptake in yeast cells, proving proper glucose utilization. Rajnayaadi Churna (Ashtangahridaya) contains Rajani rhizome. Used in Ayurveda for diarrhea, dysentery, and jaundice. Curcuma caesia powder is utilized by several tribals of the district Nadia of West Bengal, India, to treat fevers, stomach problems, diarrhea, heartburn, wind, bloating, colic, flatulence, and jaundice and other liver ailments.

6

Madhuka and Madhuuka are synonyms of Glycyrrhiza glabra and Madhuca indica, respectively. In Ayurvedic Formulary of India, Part I, page 319, Madhuuka is equated with Glycyrrhiza glabra and Madhuka with Madhuca indica. In Ayurvedic Formulary of India, Part II, page 338, Madhuka and Madhuuka, both are synonyms of Glycyrrhiza glabra. In Bhavaprakasha, 99 formulations contain Madhuka; 10 Madhuuka; 9 Yashtimadhu (Madhuyashti, Madhuyashtika), 6 Yashtimadhu; 7 Yashtimadhuka; 16 Yashtyaahva (synonym of Yashtimadhu). Even in 100 bc. Madhukaahva (synonyms: Klitaka, Madhuyashtikaa, Madhuyashti, Yashtimadhu, Yasti, and Yashtaahva) was mentioned at more than 100 places in Charaka Samhita. In Charaka Samhita (Su, 1.80) Klitaka is a synonym of Glycyrrhiza glabra (Ayurvedic Formulary of India, page

154  Legacy and logical steps 317). It has been included among the purgative fruit drugs (there is no record of the use of Glycyrrhiza glabra fruits and seeds in literature.) Two varieties of Klitaka, terrestrial and aquatic, and the poisonous property of its root indicate that all classical formulations of Madhuka and its synonyms do not contain Glycyrrhiza glabra which was an imported drug. There is a possibility that Taverniera cuneifolia, locally known as Jethimadh (a folk version of Yashtimadhu), found in the plains of Punjab, Gujarat and Deccan peninsula, was used during the classical period. Jethimadh is used by the tribes of Barda Hills of Jamnagar in Western India as a substitute of Licorice, the plant itself is considered to be G. glabra. It is known for its medicinal uses as an expectorant, blood purifier, antiulcer, anti-inflammatory and wound healing. Thus all formulations containing Madhuka are to be revalidated. Further work should be done on Ganas, Vargas, and formulations on the basis of detailed research available in Reviews on Indian Medicinal Plants series, published by Indian Council of Medical Research, Medicinal Plant Unit.

References   1 Bhagwan Dasha V, Vaidya Lalitesh Kashyap, Materia Medica of Ayurveda (Based on Ayurveda Saukhyam of Todaraanda), Concept Publishing Company, New Delhi, 1987: 412–427.   2 Dravya Guna Vijnana, Vol. I, Prof. P.V. Sharma, Chaukhambha Bharati Academy, Varanasi, 1993: 41–65.   3 Chunekar Prof. KC, Dr NP Hota, Plants of Bhavaprakasha, National Academi Ayurveda, New Delhi, 1999.   4 Balwant Singh T, Glossary of Vegetable Drugs in Brhattrayi, Chaukhambha Amarabharati Prakashana, Varanasi, 1999.  5 Ayurvedic Formulary of India, part I, second revised edn, 2003, Government of India.   6 Ray P, HN Gupta, M Roy, Sishruta Samhita: A  Scientific Synopsis, Indian National Science, New Delhi, 1993.   7 Khare CP, Dictionary of Synonyms: Indian Medicinal Plants, IK International, New Delhi, 2012.   8 Kolhe R and Rabinarayan Acharya, Ayurpharm Int J Ayur Alli Sci., 2015, 4(10): 183–196.   9 Dhankhar S, Ruhil S, Balhara M, Dhankhar S, Chhillar A, Aegle marmelos (Linn.) Correa: A potential source of phytomedicine. J Med Plant Res., 2011, 5(9): 1497–1507. 10 Gupta RC et al, Journal of Pharmacy Research, 2008, 1(1): 65–72. 11 Dr. Sonawane Suvarna Rambhau et al, International Journal of Ayurvedic & Herbal Medicine, September–October 2014, 4(5): 1615–1621.

12 Hidden secrets of clinical success Super power of “Sacred Word”

German Professor Rudolf Hansel wrote in the Preface of Rational Phytotherapy: Approximately two-thirds of phytomedicine prescriptions written by German doctors are for single-herb products. But 10 herbs accounted for approximately 80% of these prescriptions, and 20 herbs accounted for more than 90%. This is surprising when we consider that German Commission E evaluated the therapeutic use of some 400 medicinal herbs from 1982 to 1944 and recommended approximately 250 of them. Clearly, the prescriptions written today no longer reflect the rich historical diversity of herbal remedies (in Germany). We were surprised to see a 4-page text on “Drug Therapy and the Doctor’s Word”: Today the therapeutic benefit of drugs is assessed mainly by outcome measures that were established in the artificial realm of clinical double-bound studies. In the official drug official process and in most evaluation for setting therapeutic guidelines, the efficacy of pharmacologic treatment is considered equal to the difference between the true drug and the placebo. . . . A differentiated analysis of representative numbers from placebo-controlled studies has shown that the psychodynamic components of antidepressant therapy (the “Herb Doctor,” measurable as the “placebo effect”) accounts for between two-thirds and one-third of the overall effect related to the pharmacodynamic components. This discovery is by no means limited to the treatment of depression. It is equally valid for a great many important indications in general. This is proven by quantitative analyses of the placebo contribution to the overall efficacy of pharmacologic therapies in controlled clinical studies. The pharmacodynamic properties of the active ingredients generally account for only about 20–40% of the overall therapeutic effect of the indications (insomnia, depression, anxiety states, gastric symptoms, symptoms from varicose veins, irritable bowel syndrome, headaches, BPH symptoms (IPSS), influenza syndrome, dysmenorrhea, widespread pains, rheumatic complaints, cardiac pain syndrome).

156  Legacy and logical steps In India, Ayurvedic medicine has very deep roots in religion and rituals, even one pinch of “holy ash” will save a patient from “bhuuta-baadhaa” (ghost syndrome) or a few illegible Sanskrit shlokas (verses from holy texts) will cure a patient suffering from “graha-baadhaa” All “god-men” are prepraring and prescribing Ayurvedic medicines to millions of followers. Instead of “Doctor’s Word,” it can be said that indigenous Ayurvedic medicine combined with “sacred Word” is a panacea. We have said earlier that Ganas and Vargas (classification of herbs based on their therapeutic properties) must be validated first before pruning polyherbal formulations. In many formulations “Doctor’s Word” or “Sacred Word” as placebo must be influncing the patient recovery. That also should be assessed. For example, if a patient is suffering from acute stress or depression, also with hyperacidity and irritable bowel syndrome, the holistic formulation will contain three Ganas or Vargas in the formulation. The drug or “Sacred Word” or “Doctor’s Word” or placebo will free the patient from acute stress or depression, and hyperacidity and irritable bowel syndrome will get cured on its own. We will analyze a few such formulations in this chapter. While a number of drugs for psychological disorders contain validated herbs (Saraswatarishta, Saraswata Churna, and Brahmi Ghrit, to name a few), there are drugs which contain components which are still unidentified. Once Sanskrit names are replaced with botanical names, formulations of Ayurvedic Formulary should be subjected to experimental or clinical trials. It is possible that a number of placebos may surface among popular drugs (adopting the method we recommended in “Pruning of Ayurvedic Formulations”) which survived for centuries. The best example will be that of drugs meant for epilepsy, insanity and psychological disorders, which contain only a few scientificlly validated herbs with a number of “supporting” herbs, which might be working like placebos. Panch Gavya Ghrita contains filtered cow’s dung, cow’s milk, curd, urine and ghee. Mahaa Panch Gavya Ghrit contains all the five constituents of Panch Gavya Ghrita, plus Dashamuula Gana, Trphala Gana, Tryuushna, plus 26 additional herbs from other Ganas and Vargas. Both are used for Unmaada (insanity), Apasmaara (epilepsy), Kaamalaa (jaundice) and fever. Manasmitra Vataka contains Shankhpushpi (Convolvulus pluricaulis) with 72 other herbs drawn from different Ganas and Vargas. Prescribed for Manodosha and Manovikaara (mental disorders), Unmaada insanity, Apasmaara (epilepsy) and Bhuuta baadhaa (Ghost-syndrome = psychological disorder). There are drugs for Bhuutonmaada (insanity due to ghost influence = exogenous psychosis), Kalyaanaka Ghrita and Maha Kalyaanaka Ghrita contain 27 and 32 plant drugs respectively. Kalyaanaka Ghrita contains Tagara (Valeriana wallichii), Triplala and 24 other plant drugs from different Ganas and Vargas. Maha Kalyaanaka Ghrita does not contain Tagara (Valeriana wallichii) and included Kapikachhu (Mucuna prurita). Vacha (Acoras calamus) is common to both.

Hidden secrets of clinical success  157 For Graha dosha (Planetary evil influnce syndrome), Arvinda Asava and Panch Mahagavya Ghrita have been identified. Arvinda Asava contains Jataamaamsi (Nardostachys jatamansi), Vacha (Acorus calamus) and Mura (Salinium tenuifolium) with 22 herbs from different Ganas and Vargas. 2 For Baala Graha Dosha (Child’s illness due to Planetary evil influnce), Kalyanaka, Maha Kalyaanaka Ghrita and Phala Ghrita are indicated. Phala Ghrita contains Tagara (Valeriana wallichii) and Vacha (Acorus calamus) with Triphala with 13 other herbs. 3 For Napunsakataa (impotency) Vishnu Taila has been identified. It contains seven herbs. In the original text of Bhaishajya ratnavali, it was a drug to be prescribed for age-related debility (not for Napunsakataa), and for Angina pectoris, Pthisis, Calculus, facial palsy and bleeding disorders. (Ayurvedic Formulary of India, Part I and II.) 4 For epilepsy, 36 Ayurvedic herbal and mineral drugs have been identified in Ayurvedic Formulary of India, for insanity 24, for jaundice 48, for fever 97. 1

The impact of placebo Now, we will elaborate on the impact of placebo in the treatments which survived for centuries. Placebos have been shown to produce measurable physiological changes and exert therapeutic response in chronic pains, headache, depression, anxiety disorders, cough, erectile dysfunction, insomnia, dysmenorrhea, irritable bowel syndrome, Parkinson’s disease, epilepsy, benign prostatic hyperplasia symptoms and psycho-neurosis. Brain imaging studies have found measurable changes in the neural activity of people experiencing placebo analgesia. Areas that have been implicated include parts of the brain stem, spinal cord, nucleus accumbens and amygdala.1 Strong placebo responses have also been linked to increases in dopamine and opioid receptor activity. Both of these chemicals are involved in reward and motivation pathways in the brain. Conversely, nocebos have been found to reduce dopamine and opioid receptor activity. Some of these neurological changes occur in areas of the brain that are often targeted by antidepressant drugs. This might account for the 50% to 75% placebo response rate in antidepressant trials. The following conditions have demonstrated positive responses to the placebo effect:1 Pain: A placebo’s ability to reduce pain is referred to as placebo analgesia. Either the placebo initiates the release of natural painkillers and endorphins or they change the individual’s perception of the pain. Additionally, genuine analgesics have been found to be more effective if a person knows they are being given the drug, rather than the drug being

158  Legacy and logical steps given without the person’s knowledge. In this case, the placebo effect can be viewed as assisting a genuine intervention. Depression: The effect of antidepressants is believed to be largely reliant on the placebo effect. One overview of eight studies found that over a 12-week period, placebo antidepressants were effective, demonstrating the potentially long-lasting impact of placebos. Anxiety disorders: The placebo effect is particularly prevalent in trials for anti-anxiety drugs and significantly interrupts the discovery and trials of new forms of medication. Coughs: A  review of cough medication trials found that “85  percent  of the reduction in cough is related to treatment with placebo, and only 15 percent attributable to the active ingredient.” Erectile dysfunction: In one study, participants were split into three groups. The first group was told they would receive treatment for erectile dysfunction, the second group was told they would receive either a placebo or an actual treatment, and the third group was told they would receive a placebo. All three groups were, in fact, given placebo starch tablets, but the erectile dysfunction in all three groups improved significantly without any differences between the three groups. Irritable Bowel Syndrome: A meta-analysis found that the placebo response rate in people with Irritable Bowel Syndrome (IBS) ranged from 16.0% to 71.4%. It was also noted that the placebo effect is greater in trials where the participants are required to take medication less frequently, and individuals with lower anxiety levels appear to be more susceptible to the placebo effect. In a trial, even when the participants were aware they were taking a placebo, their IBS symptoms improved. Parkinson’s disease: A  review of 11 clinical trials  found that 16% of participants with Parkinson’s disease in the placebo groups showed significant improvements, sometimes lasting for 6 months. The effect seems to be partly due to dopamine release in the striatum. Epilepsy: Participants in anti-epilepsy drug trials have a 0% to 19% placebo response. A “placebo response” for this trial was defined as a 50% decrease in their normal seizure frequency.1 Critically reviewed placebo studies: There is increasing evidence that placebo interventions also affect end-organ functions regulated by the autonomic nervous system (ANS). After discussing three psychological models for autonomic placebo effects, a study provides an anatomical framework of the autonomic system and then critically reviews the relevant placebo studies in the field, thereby focusing on gastrointestinal, cardiovascular and pulmonary functions. The findings indicate that several autonomic organ functions can indeed be altered by verbal suggestions delivered during placebo and nocebo interventions. In addition, three experimental studies provide evidence for organ-specific effects, in agreement with the current knowledge on the central control of the ANS. It is suggested that the placebo effects on autonomic organ functions are best explained by the model

Hidden secrets of clinical success  159 of “implicit affordance,” which assumes that placebo effects are dependent on “lived experience” rather than on the conscious representation of expected outcomes.2 Placebo response rates in clinical trials: A recent study investigated the impact of placebo response rates on the relative risk of response to drug versus placebo in randomized, double-blind, placebo-controlled clinical trials of pharmacological therapy in Bipolar Depression (BPD). Medline/ PubMed publication databases were searched for randomized, doubleblind, placebo-controlled trials of oral drugs used as monotherapy for the treatment of BPD. The search was limited to articles published between January 1980 and September 2015. Data extracted from 12 manuscripts and one poster with yet unpublished results, representing a total of 17 clinical trials were pooled (n = 6,578). Pooled response rates for drug and placebo were 55.1% and 39.2%, corresponding to a risk ratio (RR) for responding to active treatment versus placebo of 1.29 (p  30 were 55.0% versus 41.6%. These results suggest that the relative efficacy of the active drug compared to placebo in clinical trials for BPD is highly heterogeneous across studies with different placebo response rates, with a worse performance in showing the superiority of the drug versus placebo for studies with placebo response rates >30%. It is important to maintain placebo response rates below this critical threshold since this is one of the most challenging obstacles for new treatment development in BPD.3 A more caring approach from clinicians (“Doctor’s Word”) was found to  enhance the placebo effect. Psychodynamic effect of Ayurvedic medicines works miraculously because medicine carries a divine aura.

References 1 Summarized from the post by Tim Newman, News Editor at Medical News Today, September 7, 2017, Reviewed by Timothy J. Legg, PhD, CRNP. 2 Meissner K, The placebo effect and the autonomic nervous system: Evidence for an intimate relationship, Philos Trans R Soc Lond B Biol Sci., June 27, 2011, 366(1572): 1808–1817. 3 Nadia Iovieno et al, Relationship between placebo response rate and clinical trial outcome in bipolar depression, Journal of Psychiatric Research, March 2016, 74: 38–44. Sciencedirect.com.

Part II

Defining a new scientific path by switching over to modern pharmacognosy, pharmacology and research protocols

13 Identification of medicinal plants by voucher specimen

In the pharmaceutical community, herbarium specimens are essential for documenting the source material used for drug discovery. A voucher typically consists of a herbarium specimen, a pressed and dried sample of an individual plant, containing aboveground structures (leaves, stems, flowers, and/or fruits) and belowground structures when possible. The use of vouchers for taxon identity is crucial in ethnobotanical research in which botanical information collected from native inhabitants of an area is frequently limited to common plant names, often in local dialects. Vouchers provide a verifiable means to identify and distinguish these plants from one another, especially if they share the same common name. Unknown plant species may also serve as the supporting material for published studies of the taxon. The Oxford University Herbarium, the oldest in the UK and fourth-oldest in the world, was founded in 1621 to document plants from the Oxford Physic Garden. Institutions worldwide now host herbaria whose collections, in their entirety, may house many different specimens from a particular species, collected at different times and places. Such holdings in total are the best record of morphological and anatomical variation as well as the distribution of that species.1 In India, Indian Institute of Integrative Medicine (Formerly RRL) Jammu, Herbarium is the main source of the original collection from all over India by col. Sir R. N. Chopra, Shri R. L. Bhadwar and Dr. S. L. Nayar, which include specimens dated even prior to 1935, some of even dating back to nineteenth century. Many journals focused on the plant sciences, including the Botanical Society of America’s journals, Applications in Plant Sciences (APPS) and the American Journal of Botany, require submission of vouchers as a condition for publication of articles. This is not new, as there have been repeated calls for requiring voucher citations within publications as a means to document scientific data.2. The International Code of Botanical Nomenclature requires that a “holotype,” a specimen that permanently fixes the identity of the new taxon, be prepared or designated from previously collected material and that the herbarium where it is conserved be named. Voucher specimens can serve as a source of plant tissue for DNA analyses. Most journals require that DNA and amino acid sequences used in publications be submitted to a database such as GenBank.

164  Defining a new scientific path The United States Department of Agriculture (USDA) Forest Service in northwestern states also requires that researchers conducting floristic surveys collect a voucher from each vascular plant species at each sampling site and that the specimen be placed in a public repository for verification of identification.3 The misidentification of a sample can dramatically hamper drug development.4 The classical example is that of Ashwagandha. Five forms of Indian Ashwagandha have been identified by CK Atal. Form I  is the Ashwagandha of commerce which is cultivated in Madhya Pradesh. Form II grows in the sandy desert of Pilani (Rajasthan). Form III grows in Chandigarh and mountainous areas of Punjab and Uttar Pradesh. Form IV is found growing near Delhi, Form V grows wild near Delhi and Ahmedabad. A separate species status, W. ashwagandha, was suggested for the cultivated forms in the W. somnifera germplasm. Now, Indian species of Withania has been identified as Withania ashwaganda sp. novo (Bilal Ahamad Mir and Sushma Kaul). A considerable degree of variation in bioactive withanolides, withanolide A (WS-1), withanone (WS-2) and withaferin A (WS-3) and morphological characters were detected among the populations. Plant height and plant biomass were the highest in plants collected from Manasa population followed by Hyderabad. Leaves were found to be the principle organ for WS-3 accumulation while roots mainly accumulate WS-1, suggesting a spatial variation of withanolides. Plants of Manasa population alone showed the presence of WS-2 accumulation was also the highest in Manasa population, with 1.312% WS-3 in the leaves and 0.083% WS-1 in roots. Withanolide accumulation correlated positively with developmental stages and the highest content of these withanolides was found at maturity in both roots and leaves. Thus, all Ashwagandha products must specify the chemotype of Ashwagandha. Same is the case of different chemo types of Acorus calamus. In literature, Acorus calamus has been classified into four chemo-types which are found in different locations worldwide. Type I: Acorus calamus L. var. americanus, a diploid American variety; Type II: var. vulgaris L. (var. calamus), a European triploid; Type III and IV: var. augustatus Bess. and var. versus L., subtropical tetraploids. (Chief constituents of the volatile oil are heavily dependent upon the chemical strain (dis-, tri-, tetraploid.) North American chemo-type I is virtually isoasaronefree. Western European chemo-type II contains less 10% isoasarone. The two other chemo-types (III and IV) have been found to contain up to 96% isoasarone in the volatile oil. All the 27 Indian genotypes of  A. calamus  were also analyzed for α and β-asarone contents, and percentage of essential oil. The genotype (Ac13) from Kullu (Himachal Pradesh) showed maximum (9.5%) percentage of oil, while the corresponding minimum (2.8%) was obtained from the genotypes from Pangthang (Sikkim). Similarly, the highest α and β-asarone contents (16.82% and 92.12%) were obtained from genotypes from Renuka (Himachal Pradesh) and Udhampur (Jammu and Kashmir), while lowest α and β-asarone contents (0.83% and 65.96%) resulted from Auranwa (Uttar Pradesh) and Pangthang (Sikkim) genotypes, respectively.

Identification of medicinal plants  165 One more example of intraspecific variation in plants. Artemisia dracunculus has been used medicinally and as a culinary herb in many parts of its vast range (western North America, Asia, and Eastern Europe). The plant contains a wide array of phytochemicals but also presents an extensive series of polyploid cytotypes (diploid, hexaploid, octoploid, and decaploid), each distinct in phytochemical composition. Studies of samples from many sources found that some cytotypes contain specific antidiabetic compounds while others do not. Vouchering of materials subjected to study made it possible to confirm that varying results were really due to variation within a single species5 and not to misidentification of samples.Voucher specimens not only are a source for correct botanical identification but also can serve as a repository for the chemical compounds of a plant at any given time during its life cycle. Vouchers collected at different intervals and in different areas can thus clearly reflect compound composition as influenced by edaphic and harvest conditions. Apart from providing a clear reference for a certain batch of material, voucher specimens also allow a follow-up in case taxonomic concepts change. If processed or powdered material is purchased, it should be compared with chemical assays available is standard reference works or should be identified rigorously by morphological, chemical, or molecular analysis. For example, Curcuma longa should contain not less than 4.0% of volatile oil and not less than 3.0% of curcuminoids. Quantitative assay for total curcuminoids by spectrophotometric or by high-performance liquid chromatographic methods. Without identifying the fertile parts, no plant should be used in herbal medicine. The voucher must contain all plant parts (e.g. bark, roots, seeds) that are actually used for the herbal preparation.

The Janaki Ammal Herbarium Indian Institute of Integrative Medicine (Formerly RRL), Jammu, India The original collection from all over India by col. Sir R. N. Chopra, Shri R. L. Bhadwar and Dr. S. L. Nayar, include specimens dated even prior to 1935, some of them even dating back to the nineteenth century. The herbarium was further enriched through the collections made by Dr. L. D. Kapur, Dr. S. N. Sobti and Dr. B. K. Abrol. These collections represent mostly to the areas of Jammu and Kashmir and some parts of Himachal Pradesh. Dr. Y. K. Sarin joined as the full time Curator of the herbarium in 1961, who in collaboration with Shri A. K. Dutt, Dr. S. K. Kapur, Dr. B. M. Sharma, and Dr. B. K. Kapahi, reorganized the herbarium on contemporary lines. Further thousands of voucher specimens were collected, identified and housed in this herbarium. In 1994, the herbarium was named as Janaki Ammal Herbarium. The collections in herbarium were further enriched by Dr. T. N. Srivastava in close collaboration with Dr. B. K. Kapahi and Dr. Virendra Singh. Currently, Dr. S. N. Sharma is managing the affairs of this herbarium. The structure or organization of Janaki Ammal Herbarium is based on Bentham and Hooker system of classification. International code of Botanical nomenclature incorporating the latest changes has been used in naming the plants. In case of name change of taxon, the correct name is on the top followed by relevant

166  Defining a new scientific path synonyms. If the correct name has a basionym, the basionym follows the correct name and other synonyms follow the basionym. This herbarium is recognized internationally. The acronym RRLH has been assigned to it which is registered in Index Herbariorum at New York. The preserved specimens in this herbarium include a large number of medicinal, aromatic and other economic plants from different parts of India and foreign countries, while the flora of the North-West Himalayan region is very well represented. The herbarium at present houses more than 21,500 specimens representing 3,254 species, 1,152 genera and 218 families of Angiosperms, Gymnosperms and Pteridophytes. Besides technical details, habit, habitat, flowering and fruiting time of every specimen has been recorded in this herbarium for making it a ready reference and for use by the herbal drug industry for authentication of plant material.

Plant Families6: 1 Acanthaceae 2 Aceraceae 3 Agavaceae 4 Aizoaceae 5 Alangiaceae 6 Alliaceae 7 Alismataceae 8 Amaranthaceae 9 Amaryllidaceae 10 Anacardiaceae 11 Apiaceae 12 Apocynaceae 13 Aquifoliaceae 14 Araceae 15 Arecaceae; Palmae 16 Araliaceae 17 Araucariaceae 18 Aristolochiaceae 19 Arecaceae 20 Asclepidaceae

132 52 179 88 93 182 194 138 178 56 93 115 46 199 196 94 174 145 196 116

1 2 3 4 5 6 7 8

155 38 7 165 36 132 17 121

Balanophoraceae Balsaminaceae Berberidaceae Betulaceae Biebersteiniaceae Bignoniaceae Bixaceae Boraginaceae

9 Brassicaceae 10 Burseraceae 11 Buxaceae

12 41 158

1 Cactaceae 2 Caesalpiniaceae 3 Campanulaceae 4 Cannabaceae 5 Cannaceae 6 Capparaceae 7 Caprifoliaceae 8 Caryophyllaceae 9 Celastraceae 10 Ceratophyllaceae 11 Chailleticeae 12 Chenopodiaceae 13 Cochlospermaceae 14 Colchicaceae 15 Combertaceae 16 Commelinaceae 17 Convolvulaceae 18 Cordiaceae 19 Coriariaceae 20 Cornaceae 21 Crassulaceae 22 Cucurbitaceae 23 Cupressaceae 24 Cuscutaceae 25 Cyperaceae

89 60 103 161 179 13 97 21 47 169 43 142 16 190 74 193 124 122 57 95 68 86 171 125 203

Identification of medicinal plants  167 1 2 3 4 5 6 7

Datiscaceae Dilleniaceae Dipsacaceae Dipterocarpaceae Dioscoriaceae Dracaenaceae Droseraceae

88 3 100 27 185 189 69

1 2 3 4 5 6 7 8 9

Ebenaceae Ehretiaceae Elaeagnaceae Elatinaceae Ephedraceae Ericaceae Eriocauleaceae Erythroxylaceae Euphorbiaceae

112 123 152 153 170 104 201 33 157

1 2 3 4 5

Fagaceae Ficoideae Flacourtiaceae Flagellarieae Fumariaceae

167 90 18 194 11

1 2 3 4 5

Gentianaceae Geraniaceae Gesneriaceae Grossulariaceae Guttiferae

118 35 131 67 25

1 Haemodoraceae 2 Haloragidaceae 3 Hamamelidaceae 4 Hernandiaceae 5 Hippuridaceae 6 Hydrangeaceae 7 Hydrocharitaceae 8 Hypoxidaceae 9 Hypericaceae

180 71 70 149 72 65 176 182 24

1 2 3

Icacinaceae Illecebraceae Iridaceae

45 140 181

1 2

Juglandaceae Junacaceae

164 195

1 2 3 4 5 6 7 8 9 10 11

Lamiaceae/Labiata Leeaceae Lauraceae Lecythidaceae Lemnaceae Lentibulariaceae Liliaceae Linaceae Loganiaceae Loranthaceae Lythraceae

137 51 148 77 78 130 187 31 117 154 80

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18

Magnoliaceae Malpighiaceae Malvaceae Martyniaceae Melastomaceae Meliaceae Menispermaceae Menyanthaceae Mimosaceae Molluginaceae Monotropaceae Moraceae Morinaceae Moringaceae Myricaceae Myristicaceae Myrsinaceae Myrtaceae

4 33 28 134 78 42 6 119 61 92 107 162 101 58 165 147 110 75

1 2 3

Najadaceae Nyctaginaceae Nymphaeaceae

76 139 9

1 2 3 4 5 6

Olacaceae Oleaceae Onagraceae Orchidaceae Orobanchaceae Oxalidaceae

44 114 82 177 129 37

1 2 3 4

Paeoniaceae Pamanaceae Papaveraceae Papilionaceae

2 197 10 59

168  Defining a new scientific path 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27

Passifloraceae Parnassiaceae Pedaliaceae Philadelphaceae Phytolacaceae Pinaceae Piperaceae Pittosporaceae Plantaginaceae Platanaceae Plumbaginaceae Poaceae Podophyllaceae Polemoniaceae Polygalaceae Polygonaceae Potamogetonaceae Pontederiaceae Portulacaceae Primulaceae Proteaceae Punicaceae Pyrolaceae

1 Ranunculaceae 2 Resedaceae 3 Rhamnaceae 4 Rhizophoraceae 5 Rosaceae 6 Rubiaceae 7 Rutaceae

85 64 133 66 143 175 146 19 138 163 108 204 8 120 20 144 202 192 22 109 150 81 105 1 14 48 73 62 98 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14

Sabiaceae Salicaceae Samydaceae Santalaceae Sapindaceae Sapotaceae Saxifragaceaae Scrophulariaceae Selaginaceae Simaroubaceae Solanaceae Staphyleaceae Sterculiaceae Symplocaceae

55 168 84 156 52 111 63 127 128 40 126 54 29 113

1 Tamaricaceae 2 Taxaceae 3 Taxodiaceae 4 Thymelaeaceae 5 Theaceae 6 Tiliaceae 7 Trapaceae 8 Trichopodaceae 9 Trilliaceae 10 Typhaceae

23 173 172 151 26 30 83 186 191 198

1 2

Ulmaceae Urticaceae

160 159

1 2 3

Zygophyllaceae Zingiberaceae Zanichelliaceae

34 178 5

Other Indian Herbariums 1 2 3

NBRI: LWH Virtual Herbarium7 Deccan Regional Herbarium:8 It houses approximately 11,000 herbarium specimens including 890 Mangrove specimens. About 1,250 specimens received as a gift from other institutions in Floristic work. Central National Herbarium, Howrah:9 The Central National Herbarium, popularly known as CNH. It is one of the oldest and largest herbaria in the world, established in 1795 by Dr. William Roxburgh, the first regular Superintendent of the East India Company’s Garden at Shibpore. Presently the Central National Herbarium possesses about 2.5 million of herbarium sheets belonging to nearly 350 families of plants.

Identification of medicinal plants  169 4

5

6

French Institute of Pondicherry (The Western Ghats Forest Biodiversity Portal):10 The herbarium of French Institute of Pondicherry known as HIFP (Herbier Institut Français de Pondichéry). HIFP houses a large number of collections from the Western Ghats, especially for tree species, the other parts of India and also from different parts of the globe. The herbarium has a collection of over 24,000 specimens belonging to 268 families and 4,659 species. ENVIS Centre on Medicinal Plants (Digital Herbarium):11 It was established in 1993 is a specialized herbarium with a focus on medicinal plants used in Indian Systems of Medicine (ISM). It consists of 1,107 unique species. Kerala Forest Research Institute (Herbarium):12 Kerala Forest Research Institute was started in the early 1980s. Presently it has a collection of 11,074 specimens and recognized internationally by the acronym “KFRI” by the International Association of Plant Taxonomists (IAPT). It has a collection of medicinal plants in South India. It has a collection of 11,074 specimens representing more than 2,200 species form 159 families.

The Museum of Materia Medica Institute of Natural Medicine, Toyama, Japan The museum was started in 1973 as a crude drug specimen room belonging to the Department of Development of Natural Drug Resources, Research Facilities for Wakan-Yaku under Faculty of Pharmaceutical Sciences, Toyama University. In In 1980, a crude drug specimen room in Research Institute for Wakan-Yaku, Toyama Medical and Pharmaceutical University was founded. Crude drug samples were moved from Toyama University. In 1985, the ground floor of a preservation building for pharmaceutical materials was developed as the Museum of Materia Medica under the care of the Department of Development of Natural Drug Resources. Crude drug samples were moved from the Research Institute for Wakan-Yaku. The Museum of Materia Media is also a natural drug resource for almost all important regions of the world: European crude drugs (Herbs) Tibetan crude drugs from Tibet Tibetan crude drugs from Tibet and Qinhai Prov. Tibetan crude drugs from India and Bhutan Tibetan crude drugs from Nepal Ayurvedic crude drugs from Nepal Ayurvedic crude drugs from India Ayurvedic crude drugs from Sri Lanka Plant specimens from Nepal Crude drugs from Myanmar Unani medicines from Pakistan and Bangladesh

170  Defining a new scientific path

Medicinal Plant Names Services, Kew Garden, London Medicinal Plant Names Services at Kew Gardens offer information service related to medicinal plants, nutraceuticals, and poisonous plants. Dr. Bob Allkin, in a personal communication13: Researchers are familiar with current confusions that the use of different plant names can cause for practitioners, manufacturers, suppliers, and regulators: • • • • •

Out of date or ambiguous names are being used in legislation. Organizations are failing to communicate with one another because they use different names for the same plant. Prescribing the wrong drug or manufacturers receiving the wrong plant material from their suppliers cause serious problems. It is becoming difficult to find previously published literature due to being unaware of the synonyms of that plant. The problem becomes acute to communicate with those working in different countries, different disciplines or using older literature. The situation becomes more complicated as 10,000 plant name changes are published each year.

Medicinal Plant Names Services (MPNS)  is working to make people aware of these issues and to help overcome them. MPNS have been collecting pharmacopoeia names, common names (in alternative languages) and scientific (Latin) names used in the medicinal literature and mapping them onto the comprehensive global scientific nomenclatures managed by Kew. MPNS use this resource to offer information services addressing the problems faced by medicinal plant users and clients.

References   1 Eisenman SW, AO Tucker, L Struwe, Voucher specimens are essential for documenting source material used in medicinal plant investigations. Journal of Medicinally Active Plants, January 26, 2012, 1(1): 30–43.   2 Goldblatt P, PC Hoch, LM McCook, Documenting scientific data: The need for voucher specimens. Annals of the Missouri Botanical Garden, 1992, 79: 969–970. Funk VA et al, The importance of vouchers, Taxon, 2005, 54: 127–129.   3 USDA Forest Service, Memorandum Regarding the Vouchering Policy for Bryophytes, Lichens, Fungi, Vascular Plants, Mollusks, and All Other Invertebrates, 2011.   4 Eisenman SW et al, Voucher specimens are essential for documenting source material used in medicinal plant investigations. Journal of Medicinally Active Plants, 2012, 1: 30–43.   5 Bilal Ahmad Mir (Indian Institute of Integrative Medicine, Jamu),  Jabeena Khazir (Indian Institute of Integrative Medicine), Khalid R. Hakeem (Universiti Putra Malaysia), Withanolides array of Withania ashwagandha sp. novo populations from India, Industrial Crops and Products, 2014, 59: 9–13.   6 https://iiim.res.in/herbarium/introduction.h

Identification of medicinal plants  171   7   8   9 10

www.nbri.res.in LWH Virtual Herbarium http://164.100.52.111/circles/Deccan/Herbarium.shtm http://164.100.52.111/cnh/aboutus.shtm www.ifpindia.org/biodiversityportal/index.php? option=com_content&view=article&i d=58&Itemid=63&lang=en 11 http://envis.frlht.org.in/digital-herbarium-main.php 12 www.kfri.res.in/herbarium.asp 13 [email protected], August 28, 2018.

14 DNA barcoding A breakthrough in authentication of raw herbs

A recent (2015–2016) study by Sophie Lorraine Vassou, Stalin Nithaniyal, Balaji Raju, and Madasamy Parani (Department of Genetic Engineering, Center for DNA Barcoading, SRM University, Kattankulathue, Tamil Nadu, India) is the first attempt to DNA barcode the medicinal plants that are listed in Ayurveda Pharmacopoeia of India (API) so as to develop a molecular tool to identify them in fresh as well as raw drug form, and to generate API-Reference DNA Barcode Library (API-RDBL).1 The monographs in the API contain the Sanskrit and botanical names of the plants. Since these monographs were written between the year 1990 and 2008 (Ayurvedic Pharmacopoeia of India Part I, Volumes I  to VI), the name of the plants was updated by incorporating the currently accepted botanical names as given in Tropicos and The Plants List database. API plant list that contains the Sanskrit names, the botanical names used in the API and the currently accepted botanical names for the 395 plants has been placed after the introductory note. Four medicinal plants in the API plant list are not available in India and hence imported as raw drugs from other countries. Some medicinal plants in the API plant list were difficult to collect due to their seasonal occurrence or distribution in the high altitude ranges of the Himalayas. Most of the fresh specimens of the medicinal plants were collected from open forests, cultivated fields and botanical gardens of research institutions. Some specimens were derived from the seedlings that were raised from seeds in the greenhouse. Altogether, the researchers collected fresh specimens for 347 medicinal plants in the API plant list. Name of the plant, Sample ID, Field ID, and the place of the collection are given in the main document which is in open access. Genomic DNA was extracted from either 100 mg of fresh leaf tissue or 25 mg of raw drugs using the cetyl trimethyl ammonium bromide (CTAB) method.2 The DNA was checked on 0.8% Agarose gel and quantified for PCR amplification. Polymerase chain reaction (PCR) was performed using  rbcLaF (ATGTCACCACAAACAGAGACTAAAGC), rbcLajf634R (GAAACGGTCTCTCCAACGCAT) primers. The amplicons were checked on 1% agarose gel and purified using EZ-10 Spin Column PCR Purification Kit (Bio Basic Inc. Ontario, Canada). Samples were sequenced using 3,130 xl Genetic analyzer (Applied Biosystems, CA, USA). The sequences were manually edited using Sequence Scanner Software v1.0

174  Defining a new scientific path (Applied Biosystems, CA, USA), and full-length sequences were assembled using local alignment algorithm of CodonCode Aligner, version 4.2.4 (CodonCode Corporation, MA, USA). BLAST (Basic Local Alignment Search Tool) search was performed against GenBank3 and BOLD (Barcode of Life Database) databases. TaxonDNA v. 1.6.2 (http://taxondna.sf.net/) was used to calculate pairwise divergence. Phylogenetic tree based on Neighbor-Joining (NJ) method was constructed using MEGA version 5.1 Best match method was used for the authentication of the raw drug market samples.4 Unmatched samples were analyzed by BLAST search against the NCBI nucleotide database and BOLD database. API-Reference DNA Barcode Library was created with high quality and authentic rbcL barcodes for 374 out of the 395 medicinal plants that are included in the API. The  rbcL  DNA barcode differentiated 319 species (85%) with the pairwise divergence ranging between 0.2 and 29.9%. PCR amplification and DNA sequencing success rate of rbcL marker was 100% even for the poorly preserved medicinal plant raw drugs that were collected from local markets. DNA barcoding revealed that only 79 of raw drugs were authentic, and the remaining 21% of samples were adulterated. Further, adulteration was found to be much higher with powders (ca. 25%) when compared to seeds (ca. 5%). This library was used to authenticate 100 medicinal plant raw drugs, which were in the form of powders (82) and seeds (18) The study demonstrated the utility of DNA barcoding in authenticating medicinal plant raw drug and found that approximately one fifth of the market samples was adulterated. Powdered raw drugs, which are very difficult to be identified by taxonomists as well as common people, seem to be the easy target for adulteration. Developing a quality control protocol for medicinal plant raw drugs by incorporating DNA barcoding as a component is essential to ensure safety to the consumers. 395 medicinal plants of API were selected for barcoding. A number of botanical names were corrected before DNA barcoding.

Currently accepted Botanical names of API medicinal plants1,5 Sanskrit name

Botanical name as given in API

Currently accepted Botanical name

Kasturilatika Talisa Arimeda Babbula

Hibiscus abelmoschus Linn. Abies webbiana Lindl. Acacia leucophloea Willd. Acacia nilotica (Linn.) Willd. ex Del. sp. Indica (Benth.) Brenan Acacia suma Buch.-Ham. Adiantum cappillus-veneris L. Adiantum lunulatum Burm Aegle marmelos Corr. Albizzia lebbeck Benth.

Abelmoschus moschatus Medik. Abies spectabilis (D.Don) Spach Acacia leucophloea (Roxb.) Willd. Acacia nilotica subsp. indica (Benth.) Brenan Acacia polyacantha Willd. Adiantum capillus-veneris L. Adiantum lunulatum Burm. f. Aegle marmelos (L.) Corrêa Albizia lebbeck (L.) Benth.

Kadara Bijapatra Hamsapadi Bilva Sirisa

Sanskrit name

Botanical name as given in API

Currently accepted Botanical name

Alhagi pseudalhagi (M. Bieb.) Desv. ex Keller & Shap. Kanyasara Aloe barbadensis Mill. Aloe vera (L.) Burm.f. Granthimula Alpinia calcarata Rosc. Alpinia calcarata (Haw.) Roscoe Kulanjan Alpinia galanga Willd. Alpinia galanga (L.) Willd. Matsyaksi Alternanthera sessilis (Linn.) R. Br. Alternanthera sessilis (L.) R.Br. ex DC. Surana Amorphophallus campanulatus Amorphophallus sylvaticus (Roxb.) (Roxb.) Bl. Kunth Akarakarabha Anacyclus pyrethrum DC. Anacyclus pyrethrum (L.) Lag. Satahva Anethum sowa Roxb. ex Flem. Anethum graveolens L. Dhava Anogeissus latifolia Wall. Anogeissus latifolia (Roxb. ex DC.) Wall. ex Guill. & Perr. Kitamari Aristolochia bracteata Retz. Aristolochia bracteolata Lam. Danti Baliospermum montanum Muell-Arg. Baliospermum solanifolium (Burm.) Suresh Kancanara Bauhinia variegata Blume Bauhinia variegata L. Kusmanda Benincasa hispida (Thunb.) Cogn. Benincasa hispida (Thunb.) Cogn. Utingana Blepharis persica (Burm.f.) O. Blepharis ciliaris (L.) B. L. Burtt Kuntze. Svetapunarnava Boerhaavia verticillata Poir. Boerhavia plumbaginea Cav. Kunduru Boswellia serrata Roxb. Boswellia serrata Roxb. ex Colebr. Sarsapa Brassica campestris Linn. Brassica rapa L. Priyala Buchanania lanzan Spreng. Buchanania cochinchinensis (Lour.) M. R. Almeida Palasa Butea monosperma (Lam.) Kuntze Butea monosperma (Lam.) Taub. Arka Calotropis procera (Ait.) R. Br. Calotropis procera (Aiton) Dryand. Madana Xeromphis spinosa (Thunb.) Keay Catunaregam spinosa (Thunb.) Tirveng. Devadaru Cedrus deodara (Roxb.) Loud. Cedrus deodara (Roxb. ex D.Don) G.Don Brhat Dugdhika Euphorbia hirta L. Chamaesyce hirta (L.) Millsp. Kebuka Costus speciosus Cheilocostus speciosus (J. Koenig) (Koerning ex Retz.) Smith. C. D. Specht Usira Vetiveria zizanioides (Linn.) Nash Chrysopogon zizanioides (L.) Roberty Karpura Cinnamomum camphora Cinnamomum camphora (L.) J.Presl (L.) Nees & Eberm. Tvak Cinnamomum zeylanicum Blume Cinnamomum verum J. Presl Indravaruni Citrullus colocynthis Schrad. Citrullus colocynthis (L.) Schrad. Nimbu Citrus limon (Linn.) Burm. f. Citrus limon (L.) Osbeck Gandira Coleus forskohlii Briq. Coleus forskohlii (Willd.) Briq. AmragandhiBalsamodendron caudata Mauch Commiphora caudata Engl. guggulu Sankhapuspi Convolvulus pluricaulis Choisy Convolvulus prostratus Forssk. Sukanasa Corallocarpus epigaeus Benth.ex Corallocarpus epigaeus (Rottler) Hook. f. Hook.f. Slesmataka Cordia dichotoma Forst. f. Cordia dichotoma G.Forst. Maramanjal Coscinium fenestratum Coscinium fenestratum (Gaertn.) Colebr. (Goetgh.) Colebr. Jivak Malaxis acuminata D.Don Crepidium acuminatum (D.Don) Szlach. Yavasaka

Alhagi pseudalhagi (Bieb.) Desv.

(Continued)

(Continued) Sanskrit name

Botanical name as given in API

Currently accepted Botanical name

Krsnasariva

Cryptolepis buchanani Roem. & Schult. Cucumis melo var. utilissimus Duthie & Fuller Psoralea corylifolia Linn. Curcuma zedoaria Rosc.

Cryptolepis dubia (Burm. f.) M. R. Almeida Cucumis melo L.

Ervaru

Bhrngaraja Rudraksa

Cullen corylifolium (L.) Medik. Curcuma zedoaria (Christm.) Roscoe Cyclospermum leptophyllum (Pers.) Sprague Dalbergia sissoo DC. Desmodium gangeticum (L.) DC. Desmodium oojeinense (Roxb.) H.Ohashi Desmostachya bipinnata (L.) Stapf Diospyros malabarica (Desr.) Kostel. Eclipta prostrata (L.) L. Elaeocarpus serratus L.

Pullani Gangeru

Enicostema axillare (Poir. ex Lam.) A.Raynal Erythrina variegata L. Euphorbia prostrata Aiton Ferula assa-foetida L. Ficus arnottiana (Miq.) Miq. Ficus hispida L. f. Flacourtia indica (Burm. f.) Merr. Fritillaria cirrhosa D.Don Garcinia pedunculata Roxb. ex Buch.-Ham. Getonia floribunda Roxb. Grewia tenax (Forssk.) Fiori

Bakuci Karcura Ajamoda Simsapa Salaparni Tinisha Kusa Tinduka

Apium leptophyllum (Pers.) F.V.M. ex Benth. Dalbergia sissoo Roxb. Desmodium gangeticum DC. Ougeinia oojeinensis (Roxb.) Hochr. Desmostachya bipinnata Stapf. Diospyros peregrina Gurke

Eclipta alba Hassk. Elaeocarpus sphaericus Gaertn. K. Schum Nahi Enicostemma axillare (Lam.) A. Raynal. Paribhadra Erythrina indica Lam. Dugdhika Euphorbia prostrata W. Ait. Hingu Ferula foetida Regel. Nandi Ficus arnottiana Miq. Phalgu Ficus hispida Linn. Sruvavrksa Flacourtia indica Merr. Ksirakakoli Fritillaria roylei Hook. Vrantamlaphala Garcinia pedunculata Roxb.

Mesasrngi Sati Sveta Sariva Madhavi Kutaja Kokilaksa Darbha Siva-nili Vasa Granthiparni Jivanti Dronapuspi

Calycopteris floribunda Lam. Grewia tenax (Forsk.) Aschers & Schwf. Gymnema sylvestre R.Br.

Gymnema sylvestre (Retz.) R.Br. ex Sm. Hedychium spicatum Ham. ex Smith Hedychium spicatum Sm. Hemidesmus indicus (Linn.) R. Br. Hemidesmus indicus (L.) R. Br. ex Schult. Hiptage benghalensis L. Hiptage benghalensis (L.) Kurz Holarrhena antidysenterica Holarrhena pubescens (Roth) A. DC. Wall. ex G. Don Asteracantha longifolia Nees Hygrophila auriculata Heine Imperata cylindrica (Linn.) Beauv. Imperata cylindrica (L.) Raeusch. Indigofera aspalathoides Indigofera aspalathoides DC. Vahl ex DC. Adhatoda vasica Nees Justicia adhatoda L. Leonotis nepetaefolia R. Br. Leonotis nepetifolia (L.) R. Br. Leptadenia reticulata W.& A. Leptadenia reticulata (Retz.) Wight & Arn. Leucas cephalotes Spreng. Leucas cephalotes (Roth) Spreng.

Sanskrit name

Botanical name as given in API

Currently accepted Botanical name

Limonia acidissima Groff Litsea glutinosa (Lour.) C. B. Rob. Lodoicea maldivica (J.F.Gmel.) Pers. Madhuka Madhuca indica J. F. Gmel. Madhuca longifolia (J. Koenig ex L.) J. F. Macbr. Champaka Michelia champaca Linn. Magnolia champaca (L.) Baill. ex Pierre Kampilla Mallotus philippinensis Muell.-Arg. Mallotus philippensis (Lam.) Müll. Arg. Marsdenia tenacissima Murva Marsdenia tenacissima (Roxb.) Moon Wight. & Arn. Grismachatraka Mollugo cerviana Seringe. Mollugo cerviana (L.) Ser. Indivara Monochoria vaginalis Presl. Monochoria vaginalis (Burm.f.) C.Presl Atmagupta Mucuna prurita Hook. Mucuna pruriens (L.) DC. Vrscikakanda Doronicum hookeri C. B. Clarke Nannoglottis hookeri (C.B. Clarke ex Hook. f.) Kitam. Jatamansi Nardostachys jatamansi DC. Nardostachys jatamansi (D.Don) DC. Kadamba Anthocephalus cadamba Miq. Neolamarckia cadamba (Roxb.) Bosser Karavira Nerium indicum Mill. Nerium oleander L. Utpala Nymphaea stellata Willd Nymphaea nouchali Burm. f. Syonaka Oroxylum indicum Vent. Oroxylum indicum (L.) Kurz Ketaki Pandanus tectorius Pandanus tectorius Soland. ex Parkinson Parkinson ex Du Roi Kakajangha Peristrophe bicalyculata Linn. Peristrophe bicalyculata (Retz.) Nees Jalpippalika Phyla nodiflora Greene Phyla nodiflora (L.) Greene Amalaki Emblica officinalis Gaertn. Phyllanthus emblica L. Nikocaka Pinus gerardiana Wall. Pinus gerardiana Wall. ex D.Don Karkatasrngi Pistacia chinensis Burgo Pistacia chinensis Bunge Parnayavani Coleus amboinicus Lour. Plectranthus amboinicus (Lour.) Spreng. Rasna Pluchea lanceolata Oliver & Hiem. Pluchea lanceolata (DC.) C. B. Clarke Mahameda Polygonatum cirrhifolium Royle Polygonatum cirrhifolium (Wall.) Royle Karanja Pongamia pinnata (Linn.) Merr. Pongamia pinnata (L.) Pierre Sami Prosopis cineraria Druce Prosopis cineraria (L.) Druce Elavaluka Prunus avium Linn. f. Prunus avium (L.) L. Padmaka Prunus cerasoides D.Don Prunus cerasoides Buch.-Ham. ex D.Don Raktacandana Pterocarpus santalinus Linn. Pterocarpus santalinus L. f. Vidari Pueraria tuberosa DC. Pueraria tuberosa (Willd.) DC. Bharangi Clerodendrum serratum Linn. Rotheca serrata (L.) Steane & Mabb. Ashoka Saraca asoca (Rosc.) DC. Willd. Saraca asoca (Roxb.) Willd. Kustha Saussurea lappa C. B. Clarke Saussurea lappa (Decne.) Sch. Bip. Kapittha Medasakah Aklari

Feronia limonia (Linn.) Swingle Litsea chinensis Lam. Lodoicea maldivica Pers.

(Continued)

(Continued) Sanskrit name

Botanical name as given in API

Currently accepted Botanical name

Scindapsus officinalis (Roxb.) Schott Mura Selinium candollei DC. Selinum wallichianum (DC.) Raizada & H. O. Saxena Semecarpus anacardium L. f. Bhallataka Semecarpus anacardium Linn. Svarnapatri Cassia angustifolia Vahl. Senna alexandrina Mill. Prapunnada Cassia tora Linn. Senna tora (L.) Roxb. Itkata Sesbania bispinosa W. F. Wight Sesbania bispinosa (Jacq.) W.Wight Kantakari Solanum surattense Burm. f. Solanum virginianum L. Patalai Stereospermum suaveolens DC. Stereospermum colais (Buch.Ham. ex Dillwyn) Mabb. Kiratatikta Swertia chirata Buch.-Ham. Swertia chirata Buch.-Ham. ex Wall. Aranya-surana Synantherias syeatica Synantherias sylvatica Schott Gen.Aocja (Roxb.) Schott Syzygium aromaticum Lavanga Syzygium aromaticum (Linn.) (L.) Merr. & L. M. Perry Merr. & M.Perry Tectona grandis L. f. Saka Tectona grandis Linn. Masaparni Teramnus labialis Spreng. Teramnus labialis (L. f.) Spreng. Terminalia arjuna (Roxb. ex DC.) Arjuna Terminalia arjuna W. & A. Wight & Arn. Terminalia bellirica Bibhitaka Terminalia belerica Roxb. (Gaertn.) Roxb. Guduci Tinospora cordifolia (Willd.) Miers. Tinospora sinensis (Lour.) Merr. Tuni Cedrela toona Roxb. Toona ciliata M. Roem. Yavani Trachyspermum ammi Trachyspermum ammi (Linn.) Sprague ex Turril (L.) Sprague Visala Trichosanthes bracteata Trichosanthes tricuspidata Lour. (Lam.) Voigt Prsniparni Uraria picta Desv. Uraria picta (Jacq.) DC. Tagara Valeriana wallichii DC. Valeriana jatamansi Jones Asphota Vallaris solanacea Kuntze Vallaris solanacea (Roth) Kuntze Vanyajiraka Centratherum anthelminticum Vernonia anthelmintica (L.) Willd. (L.) Kuntze Sahadevi Vernonia cinerea Lees. Vernonia cinerea (L.) Less. Mudga Phaseolus radiatus Linn. Vigna radiata (L.) R. Wilczek Kesaraja Wedelia calendulacea Wedelia calendulacea Rich. Less non Rich. Asvagandha Withania somnifera Dunal. Withania somnifera (L.) Dunal LaghupatraTrianthema decandra L. Zaleya decandra (L.) Burm.f. varsabhu Ghonta Ziziphus xylopyrus Willd. Ziziphus xylopyrus (Retz.) Willd. Kola Zizypus jujuba Lam. Ziziphus mauritiana Mill. Gajapippali

Scindapsus officinalis Schoott.

Source: Madasamy Parani and Sophie Lorraine Vassou conceived and designed the experiment. Stalin Nithaniyal SN and Balaji Raju performed the experiments. Madasamy Parani, Sophie Lorraine Vassou, Stalin Nithaniyal, and Balaji Raju analyzed the data. Madasamy Parani and Sophie Lorraine Vassou wrote the Text.

DNA barcoding  179 Views of Indian researchers Views of DB A. Narayana, Member, Expert Working Group, Phytopharmaceuticals Group of Indian Pharmacopoeia Commission, Member Expert Committee (Non Specified Food and Food Ingredients) of Food Safety and Standards Authority of India, New Delhi, India; and T Sudhakar Johnson, Department of Biotechnology and Center for Innovation, Incubation and Entrepreneurship; Coordinator, DST-NIDHI-Technology Business Incubator, K.L.E.F deemed to be University, Green Fields, Guntur, Andhra Pradesh, India: Several conventional techniques such as macroscopy, powder microscopy, and other pharmacognostic testing; organoleptic methods; chemotaxonomy; and chemical methods such as thin layer chromatography, high-performance liquid chromatography, Fourier-transform infrared spectroscopy, and liquid chromatography/mass spectrometry (LC/MS) have their own advantages as well as disadvantages. Due to the dearth of trained taxonomists, botanists, and pharmacognosists with the competency to authenticate botanical identity is shifting from the scientific approach to molecular-level studies. This led to the emergence of DNA barcode testing for botanicals as well for their identity. DNA barcode makes use of short (