the MYC GENE : methods and protocols. [2 ed.] 9781071614754, 1071614754

Table of contents :
Preface
Acknowledgments
Contents
Contributors
Chapter 1: An ``-omycs´´ Toolbox to Work with MYC
References
Chapter 2: Methods of Expression, Purification, and Preparation of the c-Myc b-HLH-LZ for Its Biophysical Characterization
1 Introduction
2 Materials
2.1 Expression of c-Myc b-HLH-LZ Domain
2.2 Purification of the c-Myc b-HLH-LZ
3 Methods
3.1 Expression of the c-Myc b-HLH-LZ Domain
3.2 Purification of the c-Myc b-HLH-LZ
4 Notes
References
Chapter 3: Biophysical and Structural Methods to Study the bHLHZip Region of Human c-MYC
1 Introduction
2 Materials
2.1 Expression of the c-MYC bHLHZip and c-MYC:MAX bHLHZip Complex Constructs
2.2 Purification of c-MYC bHLHZip Protein and c-MYC:MAX bHLHZip Complexes
2.3 NMR Studies
2.4 Crystallization Studies
3 Methods
3.1 Expression of c-MYC bHLHZip and c-MYC:MAX bHLHZip Constructs in Rich or in Minimal Media
3.2 Purification of Cleavable His-Tag c-MYC bHLHZip Protein
3.3 Purification of c-MYC:MAX bHLHZip Complex Constructs
3.4 Production of Selectively Labeled c-MYC:MAX bHLHZip Complexes for NMR Studies
3.5 NMR Protocols to Study c-MYC bHLHZip by Itself and c-MYC:MAX bHLHZip Complex
3.6 Crystallization Protocol for c-MYC:MAX bHLHZip Complex
4 Notes
References
Chapter 4: Identifying and Validating MYC:Protein Interactors in Pursuit of Novel Anti-MYC Therapies
1 Introduction
1.1 Identifying and Validating MYC Interactors
1.2 BioID
1.3 Validation of BioID Results
2 Materials
2.1 Components of BioID
2.2 Components of In Vitro GST-Pull-Down Assay
2.3 Components of Proximity Ligation Assay
2.4 Components of Biolayer Interferometry
3 Methods
3.1 MYC-BioID (See Notes 1-3)
3.1.1 Preparation of Cells for BioID
3.1.2 Purification of Biotinylated Proteins
3.1.3 Mass Spectrometry Analysis
3.1.4 High-Confidence Interactome Network Analysis
3.2 In Vitro GST-Pull-Down Assay
3.2.1 Recombinant GST-MYC Purification
3.2.2 GST-Pull-Down
3.3 Proximity Ligation Assay
3.3.1 Immunofluorescence
3.3.2 Proximity Ligation Assay (Duolink In Situ Red Starter Kit Mouse/Rabbit)
3.4 BLI Performed on Octet System
3.4.1 Biotinylated MYC Sample Preparation
3.4.2 Running a Kinetic Experiment
4 Notes
References
Chapter 5: Detection of Post-translational Modifications on MYC
1 Introduction
2 Materials
2.1 Tissue Culture
2.2 Antibody-Bead Conjugation
2.3 Immunoprecipitation
2.4 Western-Blot Analysis
2.5 Primary and Secondary Antibodies
2.6 Cell Transfection
2.7 Cell Ubiquitination and SUMOylation Assays
2.8 Formalin-Fixed Paraffin-Embedded Tissue Staining
3 Methods
3.1 Antibody to Bead Conjugation
3.2 Immunoprecipitation for Detection of c-Myc Serine 62 Phosphorylation
3.3 Detection of c-Myc Phosphorylation by Commercially Available Phospho-Specific Antibodies
3.4 Detection of c-Myc Ubiquitination in Cells
3.5 Detection of c-Myc SUMOylation in Cells
3.6 Immunofluorescence Staining of Formalin-Fixed Paraffin-Embedded Tissue
3.7 Detection of c-Myc in Formalin-Fixed Paraffin-Embedded Tissue
4 Notes
References
Chapter 6: MYC Analysis in Cancer and Evolution
1 Introduction
2 Materials
3 Methods
3.1 Preparation and Cultivation of Avian Embryo Fibroblasts
3.2 DNA Transfection of MYC-Carrying Retroviral Vector Plasmids
3.3 Focus Assay of MYC-Transformed Cells
3.4 Testing MYC Inhibitors by Agar Colony Assay and Cell Proliferation Measurement
3.5 MYC-Protein Interactions Monitored by Protein Pull-Down Analysis
3.5.1 Detection by Radioactive Protein Labeling
3.5.2 Detection by Immunoblotting Using ECL
3.6 MYC Protein Interactions Monitored by Co-immunoprecipitation (CoIP) Analysis
3.6.1 Detection by Radioactive Protein Labeling and Fluorography
3.6.2 Detection by Immunoblotting Using ECL
3.7 Analysis of MYC Expression by In Situ Hybridization in Hydra
3.8 Analysis of MYC Expression by Northern Analysis
3.9 Protein-DNA Interaction Analysis in Hydra by Chromatin Immunoprecipitation (ChIP)
3.10 MYC-DNA Interaction Analysis by Electrophoretic Mobility Shift Assay (EMSA)
4 Notes
References
Chapter 7: Genome-Wide Analysis of c-MYC-Regulated mRNAs and miRNAs and c-MYC DNA-Binding by Next-Generation Sequencing
1 Introduction
2 Materials
2.1 RNA-Seq
2.2 miRNA-Seq
2.3 ChIP-Seq
2.3.1 ChIP
2.3.2 ChIP-Seq Library Generation
3 Methods
3.1 RNA-Seq
3.1.1 mRNA Library Preparation
Quality and Quantity Control of Total RNA Input
mRNA Purification and Fragmentation
RNA Bead Plate Preparation, Washing, and Elution
Generation/Incubation of RNA Fragmentation Plate (RFP)
First Strand cDNA Synthesis
Second Strand Synthesis
cDNA Cleanup
End Repair
3′-end Adenylation
Adapter Ligation
DNA Fragment Enrichment
3.1.2 Library Quality Control
3.1.3 mRNA Library Sequencing
3.2 miRNA-Seq
3.2.1 miRNA Library Preparation
3′-Adapter Ligation
5′-Adapter Ligation
Sample Electrophoresis and RNA Gel Extraction
Reverse Transcription and Amplification
Template Preparation
PCR
miRNA Library Purification
Recovery of miRNA Library from Gel
3.2.2 miRNA Library Validation
3.2.3 miRNA Library Sequencing
3.3 ChIP-Seq
3.3.1 ChIP
Experimental Design of ChIP for Subsequent NGS Analysis
Pre-blocking of Sepharose Beads
Cross-Linking and Sonication
Immunoprecipitation
Cross-Link Removal and Purification
Quality and Quantity Control of Immunoprecipitated DNA
3.3.2 ChIP-Seq Library
ChIP-Seq Library Generation
End Repair
Addition of ``A´´ Bases to the 3′ End of the DNA Fragments
Adapter to DNA Fragment Ligation
Size Selection of the Library
Enrichment of Adapter-Modified DNA Fragments by PCR
ChIP-Seq Library Validation
3.3.3 Library Sequencing
3.4 Bioinformatics Analyses of NGS Results
3.4.1 ChIP-Seq Bioinformatics
3.4.2 mRNA-Seq Bioinformatics
3.4.3 miR-Seq Bioinformatics
3.5 Validation of NGS Results
3.5.1 qPCR Validation of c-MYC-Regulated Transcripts
3.5.2 qPCR Validation of c-MYC-Regulated miRNAs
3.5.3 qChIP Validation of Occupancy by c-MYC
4 Notes
References
Chapter 8: Analysis of Myc Chromatin Binding by Calibrated ChIP-Seq Approach
1 Introduction
2 Materials
2.1 Reagents
2.2 Buffers
2.3 Equipment
2.4 Software
3 Methods
3.1 Cell Harvest
3.2 Chromatin Immunoprecipitation
3.3 DNA Purification
3.4 Library Preparation and Sequencing
3.5 Data Analysis
3.6 Peak Calling
3.7 GSEA for Myc-Binding Sites
3.8 Metagenome Analysis
3.9 Intersecting RNA-Seq and ChIP-Seq Data
4 Notes
References
Chapter 9: A High-Throughput Chromatin Immunoprecipitation Sequencing Approach to Study the Role of MYC on the Epigenetic Land...
1 Introduction
2 Materials
2.1 Reagents
2.2 Buffers
2.3 Equipment
2.4 Software and Bioinformatic Tools
3 Methods
3.1 Cell Harvest and Fixation
3.2 Cell Lysis and Chromatin Sonication
3.3 Chromatin Immunoprecipitation and De-crosslinking
3.4 DNA Purification with SPRI Beads and HT-ChIP Validation by qPCR
3.5 Library Preparation
3.6 Reads Quality Control, Mapping, and Visualization
3.7 Peak Calling
4 Notes
References
Chapter 10: Methods for Determining Myc-Induced Apoptosis
1 Introduction
2 Materials
2.1 In Vitro Assays
2.1.1 Cell Culture and Microscopy
2.1.2 Flow Cytometry for Annexin V
2.1.3 Western Blotting for Cleaved Caspase 3
2.2 In Vivo Assays
2.2.1 Histology
2.2.2 Haematoxylin and Eosin (H&E) Staining
2.2.3 TUNEL Staining
2.2.4 Immunohistochemistry for Cleaved Caspase 3
2.2.5 Western Blotting for Cleaved Caspase 3
2.2.6 RNA Analysis
3 Methods
3.1 Phase Contrast Microscopy
3.2 Detection of Exposed Annexin V by Flow Cytometry
3.3 Western Blotting for Cleaved Caspase 3
3.4 Haematoxylin and Eosin (H&E) Stain
3.5 Terminal Deoxynucleotidyl Transferase dUTP Nick End Labeling (TUNEL)
3.6 Immunohistochemistry for Activated Caspase 3
3.7 Western Blotting of Tissue Samples for Cleaved Caspase 3
3.8 Isolation of RNA and Determination of RNA Expression of Selected Proapoptotic Proteins
3.9 Conclusions
4 Notes
References
Chapter 11: Measuring MYC-Mediated Metabolism in Tumorigenesis
1 Introduction
2 Materials
2.1 Polar Metabolite Extraction
2.2 Lipid Extraction
3 Methods
3.1 Extraction of Polar Metabolites for LC-MS/MS Analysis
3.2 Extraction of Nonpolar Lipids for LC-MS/MS Analysis
4 Notes
References
Chapter 12: Methods to Study Myc-Regulated Cellular Senescence: An Update
1 Introduction
2 Materials
2.1 Reagents and Solutions for SA-β-gal Detection In Situ
2.2 Reagents and Solutions for EdU Labeling
2.3 Reagents and Solutions for Phalloidin and DAPI Staining
2.4 Reagents and Solutions for SA-β-gal Detection in Cell Lysates
2.5 Reagents and Solutions for Sudan Black B (SBB) Analogue GL13 Detection in Tissue Sections
3 Methods
3.1 Simultaneous Detection of Multiple Senescence Markers In Situ
3.2 Fluorogenic SA-β-gal Assay (MUG Assay)
3.3 Detection of Senescent Cells in Formalin-Fixed Paraffin-Embedded Tissues with Sudan Black B (SBB) Analogue GL13
4 Notes
References
Chapter 13: Examining Myc-Dependent Translation Changes in Cellular Homeostasis and Cancer
1 Introduction
2 Materials
2.1 35S Metabolic Labeling in Cultured Cells
2.2 O-Propargyl-Puromycin (OP-Puro) Incorporation In Vivo
2.3 Investigating Specific Alterations in mRNA Translation by Fractionating Polysome-Associated mRNAs
2.4 Toeprint Assay to Visualize the Position of Translating Ribosomes
2.5 Measuring Translation Initiation and Start Codon Usage Using a Reporter Assay
3 Methods
3.1 35S Metabolic Labeling in Cultured Cells
3.2 O-Propargyl-Puromycin (OP-Puro) Incorporation In Vivo
3.3 Investigating Specific Alterations in mRNA Translation by Fractionating Polysome-Associated mRNAs
3.4 Toeprint Assay to Visualize the Position of Translating Ribosomes
3.5 Measuring Translation Initiation and Start Codon Usage Using a Reporter Assay
4 Notes
References
Chapter 14: A Versatile In Vivo System to Study Myc in Cell Reprogramming
1 Introduction
2 Materials
2.1 AAV Vectors (see Note 2)
2.2 Mice and Injection Material
2.3 Immunochemistry Material
2.4 iPS Cells Isolation
3 Methods
3.1 AAV Vector Injection
3.2 Mouse Monitoring
3.3 Histopathological Analysis of Teratomas
3.3.1 Hematoxylin and Eosin Staining
3.3.2 Immunohistochemistry
3.4 Histopathological Evaluation of Organs
3.5 In Vivo Induced Pluripotent Stem Cells Isolation
3.5.1 iPS Cells Isolation from Teratomas
3.5.2 iPS Cells Isolation from Peripheral Blood
3.5.3 iPS Cells Isolation from Bone Marrow
4 Notes
References
Chapter 15: Using Flow Cytometry to Study Myc´s Role in Shaping the Tumor Immune Microenvironment
1 Introduction
2 Materials
2.1 Mouse Necropsy and Sample Collection
2.2 Reagents for Tumor Single-Cell Preparation
2.3 Reagents for T Cell Activation
2.4 Reagents and Antibodies for Cell Surface and Intracellular Antigen Staining
3 Methods
3.1 Mouse Necropsy and Sample Collection
3.2 Dissociation of Mouse Tumors and Single-Cell Suspension Preparation
3.3 T Cell Activation
3.4 Surface and Intracellular Flow Cytometry Staining
3.4.1 Dead Cell Labeling
3.4.2 Surface Antigen Staining
3.4.3 Intracellular Antigen Staining
Transcription Factor Staining Protocol
Intracellular Cytokines Staining Protocol
4 Notes
References
Chapter 16: Generation of a Tetracycline Regulated Mouse Model of MYC-Induced T-Cell Acute Lymphoblastic Leukemia
1 Introduction
2 Materials
2.1 Generation of the Tet-O-MYC and EμSRα-tTA Constructs
2.2 In Vitro Validation of Conditional Expression of the Tet-O-MYC Construct
2.3 Genotypic Analysis of Founders and Progeny
2.4 Identification of Founders with Conditional Gene Expression
2.5 Mouse Necroscopy and Sample Collection
2.6 FACS Analysis of Primary Tumor to Identify the Phenotype of Cells Comprising the Tumor
2.7 Generating Cell Lines from Primary Tumor Tissue
2.8 Evaluating Conditional Expression of Tet System In Vivo
2.9 In Vivo Tumor Transplantation Studies
3 Methods
3.1 Generation of the Tet-O-MYC and EμSRα-tTA Constructs
3.1.1 Preparation of the Tet-O-MYC Transgenic Construct
3.1.2 Preparation of the EμSRα-tTA Transgenic Construct
3.1.3 To Prepare the Transgenic Constructs for Microinjection
3.2 In Vitro Validation of Conditional Expression of the Tet-O-MYC Construct
3.3 Genotypic Analysis of Founders and Progeny
3.4 Identification of Founders with Conditional Gene Expression
3.5 Mouse Necropsy and Sample Collection
3.6 FACS Analysis of Primary Tumor to Identify the Phenotype of Cells Comprising the Tumor
3.7 Generating Cell Lines from Primary Tumor Tissue
3.8 Evaluating Conditional Expression of Tet System In Vivo
3.9 In Vivo Tumor Transplantation Studies
4 Notes
References
Chapter 17: Chromogenic In Situ Hybridization (CISH) as a Method for Detection of C-Myc Amplification in Formalin-Fixed Paraff...
1 Introduction
2 Materials
3 Methods
3.1 CISH Procedure (See Also Note 1)
3.2 Evaluation of Results
4 Notes
References
Chapter 18: MYC Copy Number Detection in Clinical Samples Using a Digital DNA-Hybridization and Detection Method
1 Introduction
1.1 Hybridization
1.2 Purification
1.3 Data Collection
1.4 Data Analysis
2 Materials
2.1 Fragmentation
2.2 Precipitation
2.3 Hybridization
2.4 Purification (Prep Station Step)
2.5 Data Collection (Digital Analyzer Step)
2.6 Data Analysis
3 Methods
3.1 Hybridization
3.1.1 Alu1 Restriction Enzyme Digestion
3.1.2 Covaris AFA-Based Fragmentation
3.1.3 Hybridization
3.2 Purification (Prep Station Step)
3.3 Data Collection (Digital Analyzer Step)
3.4 Data Analysis
3.4.1 Raw Data
3.4.2 Normalization
3.4.3 Quality Control
3.4.4 LogRatio Calculation
4 Notes
References
Chapter 19: Cell-Based Methods for the Identification of Myc-Inhibitory Small Molecules
1 Introduction
2 Materials
2.1 Cell Lines
2.2 Lentiviral and Retroviral Vectors
2.3 Other Reagents
2.4 Equipment
3 Methods
3.1 Overview
3.2 Procedure for Screening of Small Molecules for Myc Inhibition
3.3 Filtering for False Positives
3.3.1 Luciferase Inhibition/Quenchers
3.3.2 General Transcription Inhibition
3.4 Cell-Based Assays for Inhibition of Endogenous Myc-Dependent Phenotypes
3.4.1 Proliferation Assay
3.4.2 The Cell Cycle Distribution Assay
4 Notes
References
Index

Citation preview

Methods in Molecular Biology 2318

Laura Soucek Jonathan Whitfield Editors

The Myc Gene Methods and Protocols Second Edition

METHODS

IN

MOLECULAR BIOLOGY

Series Editor John M. Walker School of Life and Medical Sciences University of Hertfordshire Hatfield, Hertfordshire, UK

For further volumes: http://www.springer.com/series/7651

For over 35 years, biological scientists have come to rely on the research protocols and methodologies in the critically acclaimed Methods in Molecular Biology series. The series was the first to introduce the step-by-step protocols approach that has become the standard in all biomedical protocol publishing. Each protocol is provided in readily-reproducible step-bystep fashion, opening with an introductory overview, a list of the materials and reagents needed to complete the experiment, and followed by a detailed procedure that is supported with a helpful notes section offering tips and tricks of the trade as well as troubleshooting advice. These hallmark features were introduced by series editor Dr. John Walker and constitute the key ingredient in each and every volume of the Methods in Molecular Biology series. Tested and trusted, comprehensive and reliable, all protocols from the series are indexed in PubMed.

The Myc Gene Methods and Protocols Second Edition

Edited by

Laura Soucek Vall d’Hebron Institute of Oncology (VHIO), Vall d’Hebron Barcelona Hospital Campus, Barcelona, Spain; Peptomyc S.L., Vall d’Hebron Barcelona Hospital Campus, Barcelona, Spain; Department of Biochemistry and Molecular Biology, Universitat Autònoma de Barcelona, Bellaterra, Spain; Institució Catalana de Recerca i Estudis Avançats (ICREA), Barcelona, Spain

Jonathan Whitfield Vall d’Hebron Institute of Oncology (VHIO), Vall d’Hebron Barcelona Hospital Campus, Barcelona, Spain

Editors Laura Soucek Vall d’Hebron Institute of Oncology (VHIO), Vall d’Hebron Barcelona Hospital Campus Barcelona, Spain

Jonathan Whitfield Vall d’Hebron Institute of Oncology (VHIO), Vall d’Hebron Barcelona Hospital Campus Barcelona, Spain

Peptomyc S.L., Vall d’Hebron Barcelona Hospital Campus Barcelona, Spain Department of Biochemistry and Molecular Biology Universitat Auto`noma de Barcelona Bellaterra, Spain Institucio´ Catalana de Recerca i Estudis Avanc¸ats (ICREA) Barcelona, Spain

ISSN 1064-3745 ISSN 1940-6029 (electronic) Methods in Molecular Biology ISBN 978-1-0716-1475-4 ISBN 978-1-0716-1476-1 (eBook) https://doi.org/10.1007/978-1-0716-1476-1 © Springer Science+Business Media, LLC, part of Springer Nature 2021 This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer Nature. The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.

Preface Despite more than 40 years of literature and thousands of publications, MYC is still incompletely understood, its pleiotropic roles in normal and cancer cells preventing simple descriptions of how it functions and what are its targets and interactors. There are three MYC proteins (c-Myc, N-Myc, and L-Myc), belonging to a family of proteins with a common basic helix–loop–helix leucine zipper (bHLHZip) domain. MYC is intrinsically disordered but gains structure and can transactivate or transrepress targets after heterodimerizing with its partner MAX. In this heterodimeric form, MYC functions as a transcription factor that coordinates a wide range of intra- and extracellular processes associated with tissue proliferation and regeneration. MYC-coordinated programs include cell growth, cell division, metabolism, protein biosynthesis, cross-talk with the microenvironment, microRNA expression, cellular migration, angiogenesis, apoptosis, senescence, and regulation of stem cell fate. These processes are typically tightly regulated in physiological conditions, but become deregulated in cancer, where MYC is oncogenically activated. Indeed, MYC is currently a hot topic in cancer research, and its inhibition could be a therapeutic strategy for most, if not all, human cancers. The previous issue of The Myc gene: Methods and Protocols was published over 6 years ago and provided an extensive collection of techniques from MYC experts around the world. In this new edition, in addition to updating, revising, and expanding previous chapters, we provide many new ones that incorporate recent advances in MYC research and current techniques, in some cases being applied to the study of MYC for the first time. The methods and protocols described herein will help to delve into how MYC is able to coordinate these intra- and extracellular programs and explain “all things MYC,” to examine its roles both in normal cells and in pathologies. In a nod to terms such as genomics, proteomics, metabolomics, and interactomics, we have collectively called these techniques “-omycs.” We divided the chapters into three loosely defined groups, as detailed in Chapter 1 of this book and its corresponding figures: The first part of the book (summarized in Fig. 1, Whitfield and Soucek Chapter 1) deals with how to study MYC itself. This includes protocols that describe how to express and purify MYC protein, and study it by X-ray crystallography and NMR. It also includes techniques to study how MYC is modified (phosphorylation, SUMOylation, ubiquitination) and what it binds to. In this last context, this section provides details to study both proteins (immunoprecipitation, biolayer interferometry (BLI), and BioID) and DNA (EMSA, northern blots), in addition to specific techniques to look at the evolution of MYC through its ancestral forms. This section also looks at methods to determine where exactly MYC binds throughout the genome and what target genes are activated as a consequence of binding (RNA-seq, ChIP-seq, miRNA, and mRNA expression analyses). The second part (summarized in Fig. 2, Whitfield and Soucek Chapter 1) looks downstream of MYC, at the various cellular processes controlled or triggered by it and how they can be measured in vitro and in vivo. These processes include apoptosis, senescence, proliferation, metabolic changes, translation, tumorigenesis, and reprogramming—both of stem cells and the tumor microenvironment. Finally, the third section (summarized in Fig. 3, Whitfield and Soucek Chapter 1) looks at a more clinical application of MYC studies, covering methods to look at its status in

v

vi

Preface

patient samples (MYC amplification and copy number changes), as well as detection of some of the previously described downstream markers of MYC activation (apoptosis, senescence). This section also includes chapters related to screening for small molecule MYC inhibitors. These techniques are especially timely as more MYC inhibitors move into clinical testing. Notably, the authors of chapters are from leading labs around the world and are experts in their fields. We thank them all for their hard work in describing in detail the methods frequently used in their labs, including tips and tricks that will be invaluable to new users. It is a pleasure to be able to bring them all together and provide this resource to the MYC community. Barcelona, Spain

Laura Soucek Jonathan Whitfield

Acknowledgments We would like to thank several funding agencies for support provided during the assembling and editing of this book, including the European Research Council (Consolidator Grant 617473), Instituto de Salud Carlos III (PI16/01224), Ministerio de Ciencia e Innovacio´n (RTC2019-007067-1), Generalitat de Catalunya (AGAUR 2017 SGR 537), EDIReX (H2020 INFRAIA 731105-2), the Canadian Institutes of Health Research (PJT159767), and the FERO foundation. We also acknowledge kind support from VHIO and the Cellex Foundation for providing research facilities and equipment.

vii

Contents Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Acknowledgments. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

v vii xi

1 An “-omycs” Toolbox to Work with MYC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Jonathan Whitfield and Laura Soucek 2 Methods of Expression, Purification, and Preparation of the c-Myc b-HLH-LZ for Its Biophysical Characterization . . . . . . . . . . . . . . . . Patrick Delattre, Martin Montagne, and Pierre Lavigne 3 Biophysical and Structural Methods to Study the bHLHZip Region of Human c-MYC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Giovanna Zinzalla 4 Identifying and Validating MYC:Protein Interactors in Pursuit of Novel Anti-MYC Therapies. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Diana Resetca, Alannah S. MacDonald, Tristan M. G. Kenney, Yong Wei, Cheryl H. Arrowsmith, Brian Raught, and Linda Z. Penn 5 Detection of Post-translational Modifications on MYC . . . . . . . . . . . . . . . . . . . . . . Colin J. Daniel, Xiao-Xin Sun, Yingxiao Chen, Xiaoli Zhang, Mu-Shui Dai, and Rosalie C. Sears 6 MYC Analysis in Cancer and Evolution . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Markus Hartl and Klaus Bister 7 Genome-Wide Analysis of c-MYC-Regulated mRNAs and miRNAs and c-MYC DNA-Binding by Next-Generation Sequencing. . . . . . Rene Jackstadt, Markus Kaller, Antje Menssen, and Heiko Hermeking 8 Analysis of Myc Chromatin Binding by Calibrated ChIP-Seq Approach. . . . . . . . Donald P. Cameron, Vladislav Kuzin, and Laura Baranello 9 A High-Throughput Chromatin Immunoprecipitation Sequencing Approach to Study the Role of MYC on the Epigenetic Landscape. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Luca Fagnocchi and Alessio Zippo 10 Methods for Determining Myc-Induced Apoptosis . . . . . . . . . . . . . . . . . . . . . . . . . Dan Lu, Catherine Wilson, and Trevor D. Littlewood 11 Measuring MYC-Mediated Metabolism in Tumorigenesis . . . . . . . . . . . . . . . . . . . Hsin-Yao Tang, Aaron R. Goldman, Xue Zhang, David W. Speicher, and Chi V. Dang 12 Methods to Study Myc-Regulated Cellular Senescence: An Update . . . . . . . . . . . Fan Zhang, Wesam Bazzar, Mohammad Alzrigat, and Lars-Gunnar Larsson

1

ix

13

21

45

69

87

119 161

187 209 231

241

x

13

14 15

16

17

18

19

Contents

Examining Myc-Dependent Translation Changes in Cellular Homeostasis and Cancer. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Joanna R. Kovalski, Yichen Xu, and Davide Ruggero A Versatile In Vivo System to Study Myc in Cell Reprogramming . . . . . . . . . . . . . Elena Senı´s, Lluc Mosteiro, Dirk Grimm, and Marı´a Abad Using Flow Cytometry to Study Myc’s Role in Shaping the Tumor Immune Microenvironment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Sı´lvia Casacuberta-Serra Generation of a Tetracycline Regulated Mouse Model of MYC-Induced T-Cell Acute Lymphoblastic Leukemia . . . . . . . . . . . . . . . . . . . . Wadie D. Mahauad-Fernandez, Kavya Rakhra, and Dean W. Felsher Chromogenic In Situ Hybridization (CISH) as a Method for Detection of C-Myc Amplification in Formalin-Fixed Paraffin-Embedded Tumor Tissue: An Update . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Natasˇa Todorovic´-Rakovic´

255 267

281

297

313

MYC Copy Number Detection in Clinical Samples Using a Digital DNA-Hybridization and Detection Method . . . . . . . . . . . . . . . . . . . . . . . 321 Zighereda Ogbah, Francesco Mattia Mancuso, and Ana Vivancos Cell-Based Methods for the Identification of Myc-Inhibitory Small Molecules . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 337 Catherine A. Burkhart, Michelle Haber, Murray D. Norris, Andrei V. Gudkov, and Mikhail A. Nikiforov

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

347

Contributors MARI´A ABAD • Vall d’Hebron Institute of Oncology (VHIO), Barcelona, Spain MOHAMMAD ALZRIGAT • Department of Microbiology, Tumor and Cell Biology, Karolinska Institutet, Stockholm, Sweden CHERYL H. ARROWSMITH • Department of Medical Biophysics, University of Toronto, Toronto, ON, Canada; Structural Genomics Consortium, Toronto, ON, Canada LAURA BARANELLO • Department of Cell and Molecular Biology, Karolinska Institutet, Stockholm, Sweden WESAM BAZZAR • Department of Microbiology, Tumor and Cell Biology, Karolinska Institutet, Stockholm, Sweden KLAUS BISTER • Institute of Biochemistry, Center for Molecular Biosciences, University of Innsbruck, Innsbruck, Austria CATHERINE A. BURKHART • Buffalo BioLabs, Inc., Buffalo, NY, USA DONALD P. CAMERON • Department of Cell and Molecular Biology, Karolinska Institutet, Stockholm, Sweden SI´LVIA CASACUBERTA-SERRA • Peptomyc S.L., Barcelona, Spain YINGXIAO CHEN • Department of Molecular and Medical Genetics, Oregon Health and Science University, Portland, OR, USA MU-SHUI DAI • Department of Molecular and Medical Genetics, Oregon Health and Science University, Portland, OR, USA; Knight Cancer Institute, Oregon Health and Science University, Portland, OR, USA CHI V. DANG • Systems and Computational Biology Center and Molecular and Cellular Oncogenesis Program, The Wistar Institute, Philadelphia, PA, USA; Ludwig Institute for Cancer Research, New York, NY, USA COLIN J. DANIEL • Department of Molecular and Medical Genetics, Oregon Health and Science University, Portland, OR, USA PATRICK DELATTRE • De´partement de Biochimie et de Ge´nomique Fonctionnelle, Faculte´ de Me´decine et des Sciences de la Sante´, Institut de Pharmacologie de Sherbrooke et PROTE´O, Universite´ de Sherbrooke, Sherbrooke, QC, Canada LUCA FAGNOCCHI • Chromatin Biology & Epigenetics Lab, Department of Cellular, Computational, and Integrative Biology (CIBIO), University of Trento, Trento, Italy; Fondazione Istituto Nazionale di Genetica Molecolare “Romeo ed Erica Invernizzi” (INGM), Milan, Italy; Center for Epigenetics, Van Andel Research Institute, Grand Rapids, MI, USA DEAN W. FELSHER • Division of Oncology, Department of Medicine, Stanford University, Stanford, CA, USA; Department of Pathology, Stanford University, Stanford, CA, USA; Stanford Cancer Institute, Stanford University, Stanford, CA, USA AARON R. GOLDMAN • Systems and Computational Biology Center and Molecular and Cellular Oncogenesis Program, The Wistar Institute, Philadelphia, PA, USA DIRK GRIMM • Department of Infectious Diseases/Virology, Medical Faculty, University of Heidelberg, BioQuant, Heidelberg, Germany; German Center for Infection Research (DZIF) and German Center for Cardiovascular Research (DZHK), Heidelberg, Germany ANDREI V. GUDKOV • Buffalo BioLabs, Inc., Buffalo, NY, USA; Department of Cancer Biology, Wake Forest School of Medicine, Winston-Salem, NC, USA

xi

xii

Contributors

MICHELLE HABER • Children’s Cancer Institute Australia for Medical Research, Lowy Cancer Research Centre, Sydney, NSW, Australia MARKUS HARTL • Institute of Biochemistry, Center for Molecular Biosciences, University of Innsbruck, Innsbruck, Austria HEIKO HERMEKING • Experimental and Molecular Pathology, Institute of Pathology, LudwigMaximilians-Universit€ at Mu¨nchen, Munich, Germany; German Cancer Consortium (DKTK), Munich, Germany; German Cancer Research Center (DKFZ), Heidelberg, Germany RENE JACKSTADT • Experimental and Molecular Pathology, Institute of Pathology, LudwigMaximilians-Universit€ at Mu¨nchen, Munich, Germany MARKUS KALLER • Experimental and Molecular Pathology, Institute of Pathology, LudwigMaximilians-Universit€ at Mu¨nchen, Munich, Germany TRISTAN M. G. KENNEY • Department of Medical Biophysics, University of Toronto, Toronto, ON, Canada; Structural Genomics Consortium, Toronto, ON, Canada JOANNA R. KOVALSKI • Department of Urology, University of California, San Francisco, San Francisco, CA, USA; Helen Diller Family Comprehensive Cancer Center, University of California, San Francisco, San Francisco, CA, USA VLADISLAV KUZIN • Department of Cell and Molecular Biology, Karolinska Institutet, Stockholm, Sweden LARS-GUNNAR LARSSON • Department of Microbiology, Tumor and Cell Biology, Karolinska Institutet, Stockholm, Sweden PIERRE LAVIGNE • De´partement de Biochimie et de Ge´nomique Fonctionnelle, Faculte´ de Me´ decine et des Sciences de la Sante´, Institut de Pharmacologie de Sherbrooke et PROTE´O, Universite´ de Sherbrooke, Sherbrooke, QC, Canada TREVOR D. LITTLEWOOD • Department of Biochemistry, University of Cambridge, Cambridge, UK DAN LU • Department of Biochemistry, University of Cambridge, Cambridge, UK ALANNAH S. MACDONALD • Department of Medical Biophysics, University of Toronto, Toronto, ON, Canada WADIE D. MAHAUAD-FERNANDEZ • Division of Oncology, Department of Medicine, Stanford University, Stanford, CA, USA; Department of Pathology, Stanford University, Stanford, CA, USA FRANCESCO MATTIA MANCUSO • Vall d’Hebron Institute of Oncology (VHIO), Barcelona, Spain ANTJE MENSSEN • German Cancer Consortium (DKTK), Munich, Germany; German Cancer Research Center (DKFZ), Heidelberg, Germany MARTIN MONTAGNE • De´partement de Biochimie et de Ge´nomique Fonctionnelle, Faculte´ de Me´decine et des Sciences de la Sante´, Institut de Pharmacologie de Sherbrooke et PROTE´O, Universite´ de Sherbrooke, Sherbrooke, QC, Canada LLUC MOSTEIRO • Department of Discovery Oncology, Genentech, Inc., South San Francisco, CA, USA MIKHAIL A. NIKIFOROV • Department of Cancer Biology, Wake Forest School of Medicine, Winston-Salem, NC, USA MURRAY D. NORRIS • Children’s Cancer Institute Australia for Medical Research, Lowy Cancer Research Centre, Sydney, NSW, Australia ZIGHEREDA OGBAH • Vall d’Hebron Institute of Oncology (VHIO), Barcelona, Spain

Contributors

xiii

LINDA Z. PENN • Department of Medical Biophysics, University of Toronto, Toronto, ON, Canada; Princess Margaret Cancer Centre, University Health Network, Toronto, ON, Canada KAVYA RAKHRA • Division of Oncology, Department of Medicine, Stanford University, Stanford, CA, USA; Department of Pathology, Stanford University, Stanford, CA, USA; Venture Capital & Private Equity, Boston, MA, USA BRIAN RAUGHT • Department of Medical Biophysics, University of Toronto, Toronto, ON, Canada; Princess Margaret Cancer Centre, University Health Network, Toronto, ON, Canada DIANA RESETCA • Department of Medical Biophysics, University of Toronto, Toronto, ON, Canada DAVIDE RUGGERO • Department of Urology, University of California, San Francisco, San Francisco, CA, USA; Helen Diller Family Comprehensive Cancer Center, University of California, San Francisco, San Francisco, CA, USA; Department of Cellular and Molecular Pharmacology, University of California, San Francisco, San Francisco, CA, USA ROSALIE C. SEARS • Department of Molecular and Medical Genetics, Oregon Health and Science University, Portland, OR, USA; Knight Cancer Institute, Oregon Health and Science University, Portland, OR, USA; Brenden-Colson Center for Pancreatic Care, Oregon Health and Science University, Portland, OR, USA ELENA SENI´S • Vall d’Hebron Institute of Oncology (VHIO), Barcelona, Spain LAURA SOUCEK • Vall d’Hebron Institute of Oncology (VHIO), Vall d’Hebron Barcelona Hospital Campus, Barcelona, Spain; Peptomyc S.L., Vall d’Hebron Barcelona Hospital Campus, Barcelona, Spain; Department of Biochemistry and Molecular Biology, Universitat Auto`noma de Barcelona, Bellaterra, Spain; Institucio Catalana de Recerca i Estudis Avanc¸ats (ICREA), Barcelona, Spain DAVID W. SPEICHER • Systems and Computational Biology Center and Molecular and Cellular Oncogenesis Program, The Wistar Institute, Philadelphia, PA, USA XIAO-XIN SUN • Department of Molecular and Medical Genetics, Oregon Health and Science University, Portland, OR, USA HSIN-YAO TANG • Systems and Computational Biology Center and Molecular and Cellular Oncogenesis Program, The Wistar Institute, Philadelphia, PA, USA NATASˇA TODOROVIC´-RAKOVIC´ • Department of Experimental Oncology, Institute for Oncology and Radiology of Serbia, Belgrade, Serbia ANA VIVANCOS • Vall d’Hebron Institute of Oncology (VHIO), Barcelona, Spain YONG WEI • Structural Genomics Consortium, Toronto, ON, Canada JONATHAN WHITFIELD • Vall d’Hebron Institute of Oncology (VHIO), Vall d’Hebron Barcelona Hospital Campus, Barcelona, Spain CATHERINE WILSON • Department of Pharmacology, University of Cambridge, Cambridge, UK YICHEN XU • Department of Urology, University of California, San Francisco, San Francisco, CA, USA; Helen Diller Family Comprehensive Cancer Center, University of California, San Francisco, San Francisco, CA, USA FAN ZHANG • Department of Microbiology, Tumor and Cell Biology, Karolinska Institutet, Stockholm, Sweden; Vesicode AB, Solna, Sweden

xiv

Contributors

XIAOLI ZHANG • Department of Molecular and Medical Genetics, Oregon Health and Science University, Portland, OR, USA XUE ZHANG • Systems and Computational Biology Center and Molecular and Cellular Oncogenesis Program, The Wistar Institute, Philadelphia, PA, USA; Ludwig Institute for Cancer Research, New York, NY, USA GIOVANNA ZINZALLA • Department of Microbiology, Tumor and Cell Biology (MTC), Karolinska Institutet, Stockholm, Sweden ALESSIO ZIPPO • Chromatin Biology & Epigenetics Lab, Department of Cellular, Computational, and Integrative Biology (CIBIO), University of Trento, Trento, Italy; Fondazione Istituto Nazionale di Genetica Molecolare “Romeo ed Erica Invernizzi” (INGM), Milan, Italy

Chapter 1 An “-omycs” Toolbox to Work with MYC Jonathan Whitfield and Laura Soucek Abstract The MYC transcription factor coordinates a wide range of intra- and extracellular processes associated with tissue proliferation and regeneration. While these processes are typically tightly regulated in physiological conditions, they become deregulated in cancer, where MYC is oncogenically activated. The last decade has seen MYC progress from a renowned undruggable target to a hot topic in the cancer therapy field, as proof emerged from mouse models that its inhibition constitutes an effective and broadly applicable approach to fight cancer. However, there are several aspects of MYC biology that still appear to be elusive and maintain the interest in further studying this intriguing protein. Since MYC’s discovery, more than four decades ago, multiple strategies have been developed to study it, related to the many and varied facets of its biology. This new version of The Myc gene: Methods and Protocols provides valuable tips from key “inhabitants of the MYC world,” which significantly increase the reach of our investigative tools to shed light on the mysteries still surrounding MYC. Key words MYC, Transcription factor, Cell proliferation, Cancer, Cell growth, Oncogene, Apoptosis, bHLHZip, Mouse model, MYC protocols

MYC is a pleiotropic transcription factor that coordinates multiple intracellular and extracellular programs that allow for efficient proliferation and regeneration of tissues. These programs include cell growth, cell division, regulation of metabolism, protein biosynthesis, cross-talk with the microenvironment, microRNA expression, cellular migration, and angiogenesis, as well as “fail-safe” programs of apoptosis and senescence [1–7]. In addition, MYC has been identified as one of the Yamanaka factors, intimately involved in regulation of stem cell fate [8], related to its capacity to induce profound epigenetic changes [9]. MYC belongs to a family of proteins with a common basic helix–loop–helix leucine zipper (bHLHZip) domain, which include proteins such as MAX, MXD, MGA, or MLX [10]. MYC is notoriously an intrinsically disordered protein [11], but it gains structure after heterodimerizing with its partner MAX. In this dimeric form, MYC and MAX activate genes by binding mainly canonical E-Box elements (CACGTG) across the genome in target gene promoters. Laura Soucek and Jonathan Whitfield (eds.), The Myc Gene: Methods and Protocols, Methods in Molecular Biology, vol. 2318, https://doi.org/10.1007/978-1-0716-1476-1_1, © Springer Science+Business Media, LLC, part of Springer Nature 2021

1

2

Jonathan Whitfield and Laura Soucek

MYC has also been described as being able to exert a transcriptional repressing activity by binding and inactivating Miz-1 and/or recruiting the Dnmt3a DNA methyltransferase corepressor [12–14]. Although there are three members within the MYC family (c-Myc, N-Myc, and L-Myc), most somatic cells depend solely on c-Myc to coordinate the transcription of their proliferative programs. However, at least N-Myc seems to be able to functionally replace c-Myc in murine development, cellular growth, and differentiation [15]. MYC has been associated with the modulation of a huge panoply of gene targets that is estimated to encompass up to a third of the transcriptome [16–19]. In normal proliferating cells, MYC expression and activity are finely tuned and strictly dependent on external growth signals, ensuring that MYC is present only in cells instructed to proliferate. In contrast, in tumor cells, MYC expression is deregulated and its regenerative programs are aberrantly executed leading to tumorigenesis [20, 21]. Importantly, direct mutational activation of the MYC gene itself (such as amplification or chromosomal translocation) appears to be relatively rare, while the most frequent event is its constitutive induction by upstream oncogenic signals [22, 23]. One other common way to deregulate MYC activity is its stabilization through modulation of its phosphorylation and degradation cycle by the ubiquitin-mediated proteosomal process [24, 25]. Over the years, various switchable transgenic mouse models with tissue-specific, regulatable, oncogenic MYC have been generated and have served the purpose of defining the impact of overexpressed and deregulated MYC in vivo. These models demonstrated that MYC drives and maintains multiple aspects of the neoplastic phenotype, but they also showed the dramatic therapeutic potential of MYC inactivation, which results in cancer cell death, proliferative arrest, differentiation, shutdown of angiogenesis, and collapse of the tumor microenvironment, according to the “oncogene addiction” concept [26–36]. In particular, several studies making use of the Omomyc transgene, the most characterized direct MYC inhibitor known to date, have been seminal to establish MYC as a most-wanted target in cancer treatment [29, 30, 37–44]. While those studies used Omomyc as a transgene, more recently, we have directly delivered the Omomyc mini-protein drug in vivo to inhibit tumorigenesis, demonstrating its potential use for pharmacological MYC inhibition in the clinic [45–47]. All this points towards MYC as being an ideal cancer target whose inhibition could be applied to most, if not all, human cancers. Indeed, as MYC moves away from being considered undruggable, intensive efforts are now being applied around the world to directly and indirectly target MYC, including blockage of MYC expression (such as anti-sense mRNA, quadruplex-forming oligonucleotides, ribozymes, RNA interference, BET inhibitors, and

An “-omycs” Toolbox to Work with MYC

3

small molecule drugs), disruption of MYC-MAX dimerization, interference with MYC-MAX binding to DNA, inhibition of key MYC target genes, and synthetic lethality in MYC-transformed cells [48–50]. Nevertheless, after more than 40 years of literature, MYC still presents many mysteries, both from a structural and functional point of view, in normal and cancer cells. Hence, this book aims to compile a wide range of methods and protocols that can be used to study MYC and its pleiotropic responses. The previous issue of The Myc gene: Methods and Protocols, published some six years ago, provided a rich collection of techniques developed or routinely used by MYC investigators. Now, in this new version, we continue with that premise, updating previous chapters and providing many new ones that reflect recent advances in MYC research and current techniques, in some cases being applied to the study of MYC for the first time. We hope it will serve as an invaluable resource for continuing to explore the world of the pleiotropic and still puzzling MYC. We start with five chapters describing the purification of MYC proteins and how to directly study MYC: its phosphorylation state, interaction partners, expression, and DNA binding (summarized in Fig. 1). Chapter 2 from Pierre Lavigne’s group [51] describes how to express and purify the bHLHZip domain of MYC, the region most often targeted for inhibition. Chapter 3 by Giovanna Zinzalla [52] also describes how to purify the bHLHZip region of MYC—alone or in complexes with MAX—and its biophysical characterization by Nuclear Magnetic Resonance spectroscopy and X-ray crystallography. Chapter 4 from Linda Penn’s group [53] describes several techniques to define MYC interacting proteins, from the more traditional co-immunoprecipitation (co-IP), to biolayer interferometry (BLI) and BioID, a powerful discovery method to identify proximal interactions in living cells. These could be used to look for new functional partners that could modulate MYC transcriptional activity as well as screen for MYC inhibitors. Chapter 5 by Rosalie Sears’ group [54] discusses the detection of posttranslational modifications of MYC and their pivotal role in regulating its activity. Various techniques are described to look for modifications such as phosphorylation, SUMOylation, and ubiquitination, as well as for detecting MYC protein in FFPE sections. Chapter 6 from Hartl and Bister [55] offers a look into MYC evolution, providing methods to follow the functions and interactions of ancestral forms of MYC, as well as “classical” techniques such as co-immunoprecipitation, immunoblotting, northern blots, and EMSA. Chapters 7–9 focus on identifying MYC targets, a perennially challenging problem related to the pleiotropic functions of MYC in

Figure from Zinzalla (ibid) See also Delare et al. (ibid) for protein expression

Figure from Fagnochi et al. (ibid) See also: Cameron et al. (ibid) Figure from Daniel et al. (ibid) See also Hartl&Bister (ibid)

Northerns and immunostaining (mRNA and protein expression)

MYC

Figure from Mahaud et al. (ibid)

Mouse models

Figure from Resetca et al. (ibid)

PLA, co-IP, BioID (interacon partners)

Figure from Daniel et al. (ibid)

Phosphorylaon, ubiquinaon & sumoylaon (protein modificaons) Figure from Hartl & Bister (ibid)

Evoluon of the myc gene Figure from Hartl & Bister (ibid)

EMSA (DNA interacon)

Fig. 1 Tools and techniques for working on MYC. Multiple methods are described throughout the book for studying MYC itself, and how it is modified, what its interaction partners are, and where it binds to DNA

NMR, X-ray crystallography (biophysical and structural methods)

ChIP-seq & RNAseq (chroman binding and transcripon)

4 Jonathan Whitfield and Laura Soucek

Figure from Jackstadt et al. (ibid) See also Kovalski et al. (ibid)

Figure from Senis et al. (ibid)

Apoptosis Figure from Lu et al. (ibid)

Senescence Figure from Zhang et al. (ibid) Figure from Lu et al. (ibid) See also Burkhart et al. (ibid)

Proliferaon Figure from Tang et al. (ibid)

Metabolic changes

Casacuberta et al. (ibid)

Immune reprogramming

Fig. 2 Methods to study multiple biological outcomes of MYC activation or repression. As MYC is a pleiotropic transcription factor, many methods are available to study the phenotypic outcomes of its activation or repression. A number of examples are provided in the book and summarized in the figure. They encompass many of the hallmarks of cancer

Translaon & mRNA expression

Stem cell reprogramming

MYC

An “-omycs” Toolbox to Work with MYC 5

Figure from Lu et al. (ibid) See also Daniel et al. (ibid)

Figure from Zhang et al. (ibid)

Figure from Ogbeh et al. (ibid)

See Todorovic (ibid)

Figure adapted from Burkhart et al. (ibid) and Hartl & Bister (ibid)

Screening for MYC inhibitors

Fig. 3 Tools and techniques for studying MYC in the clinic (solid line) and to screen for MYC inhibitors (dotted line). Moving to in vivo for preclinical and clinical studies, several chapters describe methods for studying mouse or human samples, as well as identifying and testing MYC inhibitors. Many of the techniques described in other chapters (such as ChIP-seq, mouse modelling, immune reprogramming, etc.) could also be applied here

Immunohistochemistry

Senescence

Copy number

CISH

MYC

6 Jonathan Whitfield and Laura Soucek

An “-omycs” Toolbox to Work with MYC

7

different cellular contexts. They describe analyses of the genes to which MYC binds and potentially activates (summarized in Fig. 1). Chapter 7 by Heiko Hermeking’s group [56] provides the reader with comprehensive methodologies for the analysis of MYC-regulated mRNA and miRNA expression, as well as of DNA binding by MYC, allowing the thorough analysis of MYC function in various cellular contexts. Chapter 8 from Laura Baranello’s group [57] describes a calibrated chromatin immunoprecipitation sequencing (ChIP-seq) approach to elucidate the global effects of MYC on transcription. In addition, they provide bioinformatic possibilities for dissecting the downstream effects of MYC binding (peak calling, juxtaposing ChIP-seq and matching RNA-seq data, etc.). Chapter 9 by Alessio Zippo’s group [58] also focuses on ChIPseq; in this case, a high-throughput ChIP-seq approach for parallel mapping of genome-wide binding of MYC-associated proteins together with chromatin profiling of multiple histone modifications. Bioinformatic steps for subsequent analysis are also provided. Several chapters (10–16) then describe methods to detect the various biological outcomes linked to MYC: apoptosis, senescence, metabolism, translation, reprogramming of cells, and tumorigenesis (summarized in Fig. 2). Chapter 10 [59] elaborates on MYC-induced apoptosis in vitro and in vivo, an intrinsic tumor suppressive property embedded in MYC and the most efficient barrier to tumorigenesis to counteract MYC’s neoplastic potential. Several approaches are detailed, including flow cytometry, immunostaining, immunoblotting, and RNA expression analysis. Chapter 11 by Chi Dang’s group [60] provides precious insights in the study of MYC-dependent metabolism control, a potential Achilles’ heel in cancer biology. Chapter 12 by Lars-Gunnar Larsson’s group [61] describes several techniques to study senescence, another tumor suppressive mechanism occasionally engaged by MYC, and also reviews the most updated protocols to study this aspect of MYC in vitro and in vivo. Chapter 13 from Davide Ruggero’s group [62] details five assays to measure translational changes, to investigate how and to what degree MYC-dependent regulation of translation influences normal cellular functions and tumorigenesis. Chapter 14 by Marı´a Abad’s group [63] provides a versatile in vivo system to study cell reprogramming, enabling the study of how MYC mutants, its cofactors and targets, affect reprogramming. Chapter 15 by Sı´lvia Casacuberta [64] describes methods to study MYC-induced reprogramming of the tumor microenvironment, using multicolor flow cytometry for simultaneous analysis of different immune cell populations.

8

Jonathan Whitfield and Laura Soucek

Chapter 16 from Dean Felsher’s group [65] describes the steps involved in the generation of a tetracycline-regulated MYC dependent mouse model of T-cell acute lymphoblastic leukemia, an in vivo system to toggle MYC expression on and off. Finally, two chapters look at analysis of clinical samples for detection of MYC alterations including particularly relevant tips for the analysis of FFPE sections (summarised in Fig. 3). Chapter 17 by Natasˇa Todorovic´-Rakovic´ [66] discusses how to detect MYC amplification in human cancer by chromogenic in situ hybridization (CISH). Chapter 18 by Ana Vivancos’ group [67] continues the theme of characterizing MYC in human cancers, showing how to detect 87 genes commonly amplified or deleted in cancer, thus enabling determination of MYC copy number in clinical samples. Finally, the last chapter focuses on identifying Small Molecule Inhibitors (SMI) of MYC (Fig. 3). Chapter 19 from Mikhail Nikiforov’s group [68] offers a glance at methods designed to identify and validate small molecules inhibiting MYC function, using an MYC-reporter assay. In addition, Hartl and Bister (Chapter 6) describe a cell-based system for testing MYC inhibitors based on agar colony assay and cell proliferation measurement. Hopefully, one day, such molecules will be available in the clinic. In summary, with this book, we hope to inspire more people to approach the MYC field and provide them with an extensive collection of tools, insights, and tips to do it effectively, as well as to expand the arsenal of weapons available to current researchers in the field of cancer.

Acknowledgments We would like to thank several funding agencies for support provided during the assembling and editing of this book, including the European Research Council (Consolidator Grant 617473), Instituto de Salud Carlos III (PI16/01224), Ministerio de Ciencia e Innovacion (RTC2019-007067-1), Generalitat de Catalunya (AGAUR 2017 SGR 537), EDIReX (H2020 INFRAIA 7311052), the Canadian Institutes of Health Research (PJT-159767), and the FERO foundation. We also acknowledge kind support from VHIO and the Cellex Foundation for providing research facilities and equipment.

An “-omycs” Toolbox to Work with MYC

9

References 1. Eilers M, Eisenman RN (2008) Myc’s broad reach. Genes Dev 22(20):2755–2766 2. Cole MD, Henriksson M (2006) 25 years of the c-Myc oncogene. Semin Cancer Biol 16 (4):241 3. Whitfield JR, Soucek L (2012) Tumor microenvironment: becoming sick of Myc. Cell Mol Life Sci 69(6):931–934 4. Dang CV (2012) MYC on the path to cancer. Cell 149(1):22–35 5. Evan GI, Littlewood TD (1993) The role of c-myc in cell growth. Curr Opin Genet Dev 3 (1):44–49 6. Hoffman B, Liebermann DA (2008) Apoptotic signaling by c-MYC. Oncogene 27 (50):6462–6472 7. Ko A et al (2018) Oncogene-induced senescence mediated by c-Myc requires USP10 dependent deubiquitination and stabilization of p14ARF. Cell Death Differ 25 (6):1050–1062 8. Takahashi K, Yamanaka S (2006) Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126(4):663–676 9. Poli V et al (2018) MYC-driven epigenetic reprogramming favors the onset of tumorigenesis by inducing a stem cell-like state. Nat Commun 9(1):1024 10. Conacci-Sorrell M et al (2014) An overview of MYC and its interactome. Cold Spring Harb Perspect Med 4(1):a014357 11. Beaulieu ME et al (2020) Structural and biophysical insights into the function of the intrinsically disordered Myc oncoprotein. Cell 9 (4):1038 12. Adhikary S, Eilers M (2005) Transcriptional regulation and transformation by Myc proteins. Nat Rev Mol Cell Biol 6(8):635–645 13. Brenner C et al (2005) Myc represses transcription through recruitment of DNA methyltransferase corepressor. EMBO J 24(2):336–346 14. Schneider A et al (1997) Association of Myc with the zinc-finger protein Miz-1 defines a novel pathway for gene regulation by Myc. Curr Top Microbiol Immunol 224:137–146 15. Malynn BA et al (2000) N-myc can functionally replace c-myc in murine development, cellular growth, and differentiation. Genes Dev 14(11):1390–1399 16. Fernandez PC et al (2003) Genomic targets of the human c-Myc protein. Genes Dev 17 (9):1115–1129

17. Shiio Y et al (2002) Quantitative proteomic analysis of Myc oncoprotein function. EMBO J 21(19):5088–5096 18. Watson JD et al (2002) Identifying genes regulated in a Myc-dependent manner. J Biol Chem 277(40):36921–36930 19. O’Connell BC et al (2003) A large scale genetic analysis of c-Myc-regulated gene expression patterns. J Biol Chem 278(14):12563–12573 20. Vita M, Henriksson M (2006) The Myc oncoprotein as a therapeutic target for human cancer. Semin Cancer Biol 16(4):318–330 21. Murphy DJ et al (2008) Distinct thresholds govern Myc’s biological output in vivo. Cancer Cell 14(6):447–457 22. Meyer N, Penn LZ (2008) Reflecting on 25 years with MYC. Nat Rev Cancer 8 (12):976–990 23. Soucek L, Evan GI (2010) The ups and downs of Myc biology. Curr Opin Genet Dev 20 (1):91–95 24. Junttila MR, Westermarck J (2008) Mechanisms of MYC stabilization in human malignancies. Cell Cycle 7(5):592–596 25. Sears RC (2004) The life cycle of C-myc: from synthesis to degradation. Cell Cycle 3 (9):1133–1137 26. Felsher DW, Bishop JM (1999) Reversible tumorigenesis by MYC in hematopoietic lineages. Mol Cell 4(2):199–207 27. Pelengaris S et al (2002) Suppression of Myc-induced apoptosis in beta cells exposes multiple oncogenic properties of Myc and triggers carcinogenic progression. Cell 109 (3):321–334 28. Arvanitis C, Felsher DW (2005) Conditionally MYC: insights from novel transgenic models. Cancer Lett 226(2):95–99 29. Sodir NM et al (2011) Endogenous Myc maintains the tumor microenvironment. Genes Dev 25(9):907–916 30. Soucek L et al (2008) Modelling Myc inhibition as a cancer therapy. Nature 455 (7213):679–683 31. Pelengaris S et al (1999) Reversible activation of c-Myc in skin: induction of a complex neoplastic phenotype by a single oncogenic lesion. Mol Cell 3(5):565–577 32. Jain M et al (2002) Sustained loss of a neoplastic phenotype by brief inactivation of MYC. Science 297(5578):102–104 33. Flores I et al (2004) Defining the temporal requirements for Myc in the progression and

10

Jonathan Whitfield and Laura Soucek

maintenance of skin neoplasia. Oncogene 23 (35):5923–5930 34. D’Cruz CM et al (2001) c-MYC induces mammary tumorigenesis by means of a preferred pathway involving spontaneous Kras2 mutations. Nat Med 7(2):235–239 35. Podsypanina K et al (2008) Oncogene cooperation in tumor maintenance and tumor recurrence in mouse mammary tumors induced by Myc and mutant Kras. Proc Natl Acad Sci U S A 105(13):5242–5247 36. Shachaf CM et al (2004) MYC inactivation uncovers pluripotent differentiation and tumour dormancy in hepatocellular cancer. Nature 431(7012):1112–1117 37. Alimova I et al (2019) Inhibition of MYC attenuates tumor cell self-renewal and promotes senescence in SMARCB1-deficient group 2 atypical teratoid rhabdoid tumors to suppress tumor growth in vivo. Int J Cancer 144(8):1983–1995 38. Fiorentino FP et al (2016) Growth suppression by MYC inhibition in small cell lung cancer cells with TP53 and RB1 inactivation. Oncotarget 7(21):31014–31028 39. Annibali D et al (2014) Myc inhibition is effective against glioma and reveals a role for Myc in proficient mitosis. Nat Commun 5:4632 40. Soucek L et al (2013) Inhibition of Myc family proteins eradicates KRas-driven lung cancer in mice. Genes Dev 27(5):504–513 41. Savino M et al (2011) The action mechanism of the Myc inhibitor termed Omomyc may give clues on how to target Myc for cancer therapy. PLoS One 6(7):e22284 42. Soucek L et al (2004) Omomyc expression in skin prevents Myc-induced papillomatosis. Cell Death Differ 11(9):1038–1045 43. Soucek L et al (2002) Omomyc, a potential Myc dominant negative, enhances Myc-induced apoptosis. Cancer Res 62 (12):3507–3510 44. Soucek L et al (1998) Design and properties of a Myc derivative that efficiently homodimerizes. Oncogene 17(19):2463–2472 45. Beaulieu ME et al (2019) Intrinsic cellpenetrating activity propels Omomyc from proof of concept to viable anti-MYC therapy. Sci Transl Med 11(484):eaar5012 46. Beaulieu ME, Soucek L (2019) Finding MYCure. Mol Cell Oncol 6(5):e1618178 47. Masso-Valles D, Soucek L (2020) Blocking Myc to treat Cancer: reflecting on two decades of Omomyc. Cell 9(4):883 48. Allen-Petersen BL, Sears RC (2019) Mission possible: advances in MYC therapeutic targeting in cancer. BioDrugs 33(5):539–553

49. Dang CV et al (2017) Drugging the ‘undruggable’ cancer targets. Nat Rev Cancer 17 (8):502–508 50. Whitfield JR et al (2017) Strategies to inhibit Myc and their clinical applicability. Front Cell Dev Biol 5:10 51. Delattre P, Montagne M, Lavigne P (this volume) Methods of expression, purification, and preparation of the c-Myc b-HLH-LZ for its biophysical characterization. In: Soucek L, Whitfield J (eds) The Myc gene: methods and protocols. Springer, New York 52. Zinzalla G (this volume) Biophysical and structural methods to study the bHLHZip region of human c-MYC. In: Soucek L, Whitfield J (eds) The Myc gene: methods and protocols. Springer, New York 53. Resetca D, MacDonald AS, Kenney TMG, Wei Y, Arrowsmith CH, Raught B, Penn LZ (this volume) Identifying and validating MYC: protein interactors in pursuit of novel anti-MYC therapies. In: Soucek L, Whitfield J (eds) The Myc gene: methods and protocols. Springer, New York 54. Daniel CJ, Sun X-X, Chen Y, Zhang X, Dai MS, Sears RC (this volume) Detection of posttranslational modifications on MYC. In: Soucek L, Whitfield J (eds) The Myc gene: methods and protocols. Springer, New York 55. Hartl M, Bister K (this volume) MYC analysis in cancer and evolution. In: Soucek L, Whitfield J (eds) The Myc gene: methods and protocols. Springer, New York 56. Jackstadt R, Kaller M, Menssen A, Hermeking H (this volume) Genome-wide analysis of cMYC-regulated mRNAs and miRNAs and cMYC DNA-binding by next-generation sequencing. In: Soucek L, Whitfield J (eds) The Myc gene: methods and protocols. Springer, New York 57. Cameron DP, Kuzin V, Baranello L (this volume) Analysis of Myc chromatin binding by calibrated ChIP-Seq approach. In: Soucek L, Whitfield J (eds) The Myc gene: methods and protocols. Springer, New York 58. Fagnocchi L, Zippo A (this volume) A highthroughput chromatin immunoprecipitation sequencing approach to study the role of MYC on the epigenetic landscape. In: Soucek L, Whitfield J (eds) The Myc gene: methods and protocols. Springer, New York 59. Lu D, Wilson C, Littlewood TD (this volume) Methods for determining Myc-induced apoptosis. In: Soucek L, Whitfield J (eds) The Myc gene: methods and protocols. Springer, New York 60. Tang H-Y, Goldman AR, Xue Z, Speicher DW, Dang CV (this volume) Measuring MYC-

An “-omycs” Toolbox to Work with MYC mediated metabolism in tumorigenesis. In: Soucek L, Whitfield J (eds) The Myc gene: methods and protocols. Springer, New York 61. Zhang F, Bazzar W, Alzrigat M, Larsson L-G (this volume) Methods to study Myc-regulated cellular senescence: an update. In: Soucek L, Whitfield J (eds) The Myc gene: methods and protocols. Springer, New York 62. Kovalski JR, Xu Y, Ruggero D (this volume) Examining Myc-dependent translation changes in cellular homeostasis and cancer. In: Soucek L, Whitfield J (eds) The Myc gene: methods and protocols. Springer, New York 63. Senı´s E, Mosteiro L, Grimm D, Abad M (this volume) A versatile in vivo system to study Myc in cell reprogramming. In: Soucek L, Whitfield J (eds) The Myc gene: methods and protocols. Springer, New York 64. Casacuberta-Serra S (this volume) Using flow cytometry to study Myc’s role in shaping the tumor immune microenvironment. In: Soucek L, Whitfield J (eds) The Myc gene: methods and protocols. Springer, New York 65. Mahauad-Fernandez WD, Rakhra K, Felsher DW (this volume) Generation of a tetracycline

11

regulated mouse model of MYC-induced T-cell acute lymphoblastic leukemia. In: Soucek L, Whitfield J (eds) The Myc gene: methods and protocols. Springer, New York 66. Todorovic´-Rakovic´ N (this volume) Chromogenic in situ hybridization (CISH) as a method for detection of C-Myc amplification in formalin-fixed paraffin-embedded tumor tissue: an update. In: Soucek L, Whitfield J (eds) The Myc gene: methods and protocols. Springer, New York 67. Ogbah Z, Mancuso FM, Vivancos A (this volume) MYC copy number detection in clinical samples using a digital DNA-hybridization and detection method. In: Soucek L, Whitfield J (eds) The Myc gene: methods and protocols. Springer, New York 68. Burkhart CA, Haber M, Norris MD, Gudkov AV, Nikiforov MA (this volume) Cell-based methods for the identification of Myc-inhibitory small molecules. In: Soucek L, Whitfield J (eds) The Myc gene: methods and protocols. Springer, New York

Chapter 2 Methods of Expression, Purification, and Preparation of the c-Myc b-HLH-LZ for Its Biophysical Characterization Patrick Delattre, Martin Montagne, and Pierre Lavigne Abstract The b-HLH-LZ domain of c-Myc is a key target for the development of cancer therapies by blunting its binding to DNA with cell penetrant b-HLH-LZs and/or by stabilizing it into a state that cannot recognize Max to activate and amplify transcription of oncogenic genes. Although recent milestones have been reached with DNA binding blunting of c-Myc with the cell penetrant b-HLH-LZ Omomyc, the targeting of its b-HLH-LZ with small molecules, peptides, or proteins is lagging. As reviewed recently, the main problem relies in the intrinsically disordered nature of the b-HLH-LZ of c-Myc. This greatly complicates the classical approach of targeting a docking site with inhibitors. The solution state methods such as NMR are progressing towards the characterization of the ensembles of structures or states the b-HLH-LZ can adopt. However, the delicate balance that dictates the population of these dynamically interchanging states relies on its primary structure and the weak polar, electrostatic and hydrophobic interactions allowed. In this context, it is of the utmost importance to study the b-HLH-LZ of c-Myc in its WT background and avoid the use of tags such as His-tags. These tags could disrupt the balance of forces which could alter the conformational and physical transitions and states it can undergo and adopt. Here, we describe a robust protocol to express the WT b-HLH-LZ in E. coli and purify it, without the need of tags, to obtain the required quantities for solution state biophysical characterization such as NMR. Key words c-Myc, b-HLH-LZ, NMR, Protein expression and purification

1

Introduction The transcription factor c-Myc is deregulated in the vast majority of cancers [1]. In most cases, c-Myc itself is not mutated but its total concentration in the nucleus is increased to pathological levels [2], either by the overexpression of the myc gene or by the stabilization of its gene product through inhibition of its degradation pathway by driver oncogenes such as RAS and EGFR [3]. The elevated levels of c-Myc in the nucleus lead to maximal levels of the c-Myc/Max heterodimer, effectively increasing the activation or amplification of many genes through the heterodimer binding to specific and nonspecific enhancer boxes. Since many overexpressed genes are

Laura Soucek and Jonathan Whitfield (eds.), The Myc Gene: Methods and Protocols, Methods in Molecular Biology, vol. 2318, https://doi.org/10.1007/978-1-0716-1476-1_2, © Springer Science+Business Media, LLC, part of Springer Nature 2021

13

14

Patrick Delattre et al.

involved in proliferation and metabolism as well as apoptosis evasion [4], this exacerbated transcription leads to the addiction of tumor cells to c-Myc and this has been proven to be one of their Achilles’ heel [5]. The inhibition of the formation of c-Myc/Max complex as well as its DNA binding activity by Omomyc, a cell penetrating b-HLH-LZ protein, has recently been proven to be a viable strategy for cancer treatment with limited side effects in mice, as systemic inhibition is affecting mainly tumor cells [6]. However, the discovery and use of efficacious small-molecule inhibitors is lagging. The design of inhibitors that could prevent the dimerization of c-Myc with Max is presently an intense area of research and the goal of many research laboratories in academia and the private sector. However, the discovery of a safe and highly selective inhibitor has proved very challenging due to the fact that c-Myc, specifically its bHLH-LZ domain, does not present a stable tertiary structure to target but rather an equilibrium of multiple, poorly defined structures exchanging on the fast and medium timescale. The b-HLHLZ domain of c-Myc is therefore considered as an intrinsically disordered protein, rendering the classical design of small-molecule inhibitors quite difficult. Considering this, the design of c-Myc inhibitors requires a more thorough characterization of the transient structures it can adopt, the dynamics of these exchanges, and the rate at which these structures exchange. Such a characterization can be achieved with different biophysical techniques, such as solution-state NMR, but this approach requires large quantities of pure and isotopically labeled proteins, which can be expensive if the yield and purity are low. Furthermore, in the case of the b-HLH-LZ of c-Myc, the study of its structural and dynamical properties is of the utmost importance for the design of next-generation inhibitors. The use of an affinity tag, even as small as a His-tags, could affect or bias the subtle and puzzling equilibrium between the different structural states of the c-Myc b-HLH-LZ and further complicate and slow down the design of inhibitors targeting the WT protein. In this context, the use of affinity tags should, in our opinion, be avoided. Here, we describe the protocol we developed and currently use in our laboratory for the expression and purification of the WT bHLH-LZ domain of c-Myc without the use of an affinity tag. This protocol can be used to produce either isotopically labeled protein for NMR studies or unlabeled protein for other biophysical studies, such as CD, DLS, and SAXS. This protocol yields several mg of dry protein per L of growth medium, effectively reducing the cost per mg of isotopically protein produced. The dried protein can then easily be solubilized in the desired buffer at concentrations up to the mM range depending on pH and ionic strength.

Methods of Expression, Purification, and Preparation of the c-Myc b-HLH-LZ. . .

2

15

Materials

2.1 Expression of c-Myc b-HLH-LZ Domain

1. LB growth medium per liter: 10 g Bacto-tryptone, 5 g yeast extract, 5 g NaCl. Autoclave in 2 L Erlenmeyers. 2. M9 growth medium, for the production of isotopically labeled proteins for NMR studies (see Note 1), per liter: 0.5 g of NaCl, 3 g of KH2PO4, 6 g of Na2HPO4 ·7H2O (or 3.177 g of Na2HPO4 anhydrous), 1 mL of 1 M MgSO4, 1 mL of 0.1 M CaCl2, 1 mL of 0.01 M FeSO4, 1 g of 15NH4Cl, 3 g of 13C labeled glucose (see Note 1). 3. Carbenicillin (1000
): 50 mg/mL, stored in 1 mL aliquots at 20 C. 4. Chloramphenicol (1000
): 34 mg/mL of 95% ethanol, stored at 20 C. 5. IPTG (1000
): 0.119 g/mL, stored in 1 mL aliquots at 20 C. 6. Lysis buffer: 50 mM sodium acetate, 500 mM NaCl, pH 4.5.

2.2 Purification of the c-Myc b-HLH-LZ

1. DNAse I: Roche, from bovine serum albumin, grade II. 2. DTT: 1 M solution, stored in 100μM aliquots. 3. CI buffer: 50 mM sodium acetate, 6 M Urea, 0.5 M guanidium hydrochloride (GuHCl), pH 4.5. 4. Downs: Minimum capacity of 20 mL. 5. Ultrasonic homogenizer: 1/400 diameter tip and power range of at least 0–100 W. 6. Cationic exchange columns: 5
5 mL HiTrap™ SP-HP Sepharose columns from GE Healthcare or equivalent. 7. FPLC running buffer: 120 mM citrate/phosphate buffer, 2 M urea, pH 3.0 (see Note 2). 8. FPLC elution buffer: 120 mM citrate/phosphate buffer, 2 M urea, 3 M NaCl, pH 3.0 (see Note 2). 9. FPLC storage buffer: 200 mM sodium acetate, 20% ethanol (see Note 2). 10. SDS-PAGE: Recommended 15% acrylamide. 11. Desalting columns: 5
5 mL HiTrap™ Desalting columns (GE Healthcare or equivalent). 12. TFA buffer: 0.05% (v/v) trifluoroacetic acid in water (see Note 2).

16

3

Patrick Delattre et al.

Methods

3.1 Expression of the c-Myc b-HLH-LZ Domain

1. For the production of isotopically labeled c-Myc, inoculate 50 mL of M9 medium (or LB for unlabeled protein) containing carbenicillin and chloramphenicol with p-Lys-S Escherichia coli (E. coli) transformed with c-Myc-pET-3a construct (see Note 3) and grow at 30  C O/N with agitation. 2. The next morning, transfer 30 mL of the 50 mL culture to 1 L of isotopically labeled M9 medium (or LB for unlabeled protein). Let grow to an OD600 of 0.6 with agitation and add 1 mL of IPTG 1000
. Incubate at 30  C with agitation for 16 h. 3. Centrifuge the bacterial culture in 1 L container at 13,900
g and 4 C for 8 min. 4. Suspend the bacterial pellets in 3 mL of lysis buffer per gram of pellet. 5. Store the suspended pellets at 80 C for at least 24 h.

3.2 Purification of the c-Myc b-HLH-LZ

1. Take the suspended pellets from 80  C and immerse in hot tap water (50–60 C). 2. Once the suspension is thawed, freeze the homogenate with liquid nitrogen then thaw in hot water (see Note 4). Repeat this freeze–thaw cycle until the suspension is at maximum viscosity (3–4 cycles). 3. Add 1 mL of DNAse I and incubate at room temperature for 30 min. 4. Add DTT for a final concentration of 10 mM and incubate at room temperature for 30 min. 5. Centrifuge at 30,000
g and 4 C for 40 min to pellet the inclusion bodies and other high molecular weight debris. Conserve the supernatant, hereby referred to as the soluble fraction, at 4 C for further analyses (see Note 5). 6. Solubilize the pellet in 15 mL of CI buffer with a Downs or by vortexing and incubate for 24–48 h at 4 C. 7. Sonicate on ice at 50–60 W with an ultrasonic homogenizer. 8. Add 1:1 volume of running buffer to the solution, adjust to pH 4, and incubate O/N at 4 C. 9. Centrifuge at 30,000
g (19,500 RPM in a SS34 rotor in a Sorvall RC 5B Plus) for 60 min at room temperature (see Note 6). 10. Carefully transfer the supernatant to a clean container and purify by cation-exchange chromatography on 5
5 mL cationic exchange columns mounted in series on a

Methods of Expression, Purification, and Preparation of the c-Myc b-HLH-LZ. . .

17

¨ KTA systems. Remove the chromatography system such as A storage buffer in the columns by loading 2 column volume (CV) of running buffer before washing with 2 CV of elution buffer. Then equilibrate with the running buffer until the conductivity is back to its lowest. 11. Load the supernatant at a rate of 2 mL/min and wash with 2 CV of 15% elution buffer (see Note 7). 12. Eluate with a 15–40% gradient of elution buffer in 100 mL by collecting in 5 mL collection tube (see Note 8). 13. When the gradient is over, transfer to 100% of elution buffer and collect the final wash. To store the columns, load 2 CV of running buffer then 5 CV of storage buffer. 14. Load each fraction collected, including the soluble fraction, on an SDS-PAGE to confirm which contain pure c-Myc. If enough c-Myc is present in the soluble fraction, combine it with all non-pure fractions, dilute with 1:1 volume of running buffer, and repeat the purification steps on the FPLC. 15. Pool each fraction containing pure protein and desalt on 5
5 mL desalting columns (see Note 9) in series with the TFA buffer. Equilibrate the columns with the TFA buffer before injecting fractions of 6 mL (see Note 10) and following the elution on an OD280 detector. Collect the protein from the start in the increase in OD280 until it comes back to the standard level. Discard the solution with low OD280 and high conductivity. 16. The purified and desalted protein solution can be freeze-dried by adding 1:6 volumes of acetonitrile and flash-freezing it in liquid nitrogen. The frozen solution is then put on the freezedryer (see Note 11). 17. The freeze-dried protein can be stored at 20 C and then be suspended in the desired buffer for various experiments (see Note 12).

4

Notes 1.

13

C-glucose is used only when producing proteins for tripleresonance experiments.

2. Always check the manufacturer’s indications as to the buffers that can be used on the specific columns you are using. 3. The c-Myc construct used comprises the b-HLH-LZ domain of c-Myc (V354-S437). The C438 and A439 were not included in the sequence to prevent the formation of a disulfide bond for long NMR experiments.

18

Patrick Delattre et al.

4. Lysozyme from egg white can also be used instead of the freeze–thaw method. 5. The b-HLH-LZ domain of c-Myc is almost exclusively found in the inclusion bodies but it is worth loading a fraction on an SDS-PAGE to verify. 6. The centrifugation at 30,000
g can be viewed as a minimum and can safely go as high as 100,000
g, the latter being the better because it guarantees the precipitation of membrane residues still present in solution. 7. The flow rate is mainly dictated by the back pressure created, the columns used in our lab having a pressure limit of 1 MPa. If your columns can resist higher pressure, you can increase the flow rate accordingly. 8. The elution can be set up dependent (columns, FPLC, etc.), therefore always evaluate the conductivity at which the c-Myc b-HLH-LZ no longer adsorbs on the column and adjusts the elution accordingly. A quick way of doing so could be by applying a gradient of 0–100% and noting the conductivity range of each 5 mL fraction. These fractions, once analyzed by SDS-PAGE, can indicate the conductivity at which c-Myc is eluted. 9. Alternatively, you can use batch desalting columns and elute in the desired buffer. This will circumvent the use of a freezedryer but can limit the final concentration of the protein, depending on the manufacturer’s recommendations of the batch desalting columns. 10. The injection volume can vary depending on the type of desalting column used. Always check the manufacturer’s recommendations. 11. The freeze-drying procedure can vary from one machine to another. Check with your machine’s manufacturer for the proper protocol. 12. Some TFA can still be present in the freeze-dried protein even if TFA is very volatile. Although the quantity is negligible for biophysical experiments, it can have an effect for in vivo experiments. The use of batch desalting columns (see Note 9) can be a good alternative. References 1. Kalkat M, De Melo J, Hickman KA et al (2017) MYC deregulation in primary human cancers. Genes (Basel) 8(6):151. https://doi.org/10. 3390/genes8060151 2. Shachaf CM, Gentles AJ, Elchuri S et al (2008) Genomic and proteomic analysis reveals a

threshold level of MYC required for tumor maintenance. Cancer Res 68(13):5132–5142. https://doi.org/10.1158/0008-5472.CAN07-6192 3. Chou Y-T, Lin H-H, Lien Y-C et al (2010) EGFR promotes lung tumorigenesis by

Methods of Expression, Purification, and Preparation of the c-Myc b-HLH-LZ. . . activating miR-7 through a Ras/ERK/Myc pathway that targets the Ets2 transcriptional repressor ERF. Cancer Res 70(21):8822–8831. https://doi.org/10.1158/0008-5472.CAN10-0638 4. Venkateswaran N, Conacci-Sorrell M (2017) MYC leads the way. Small GTPases 11 (2):86–94. https://doi.org/10.1080/ 21541248.2017.1364821 5. Li Y, Choi PS, Casey SC et al (2014) MYC through miR-17-92 suppresses specific target

19

genes to maintain survival, autonomous proliferation, and a neoplastic state. Cancer Cell 26 (2):262–272. https://doi.org/10.1016/j.ccr. 2014.06.014 6. Beaulieu M-E, Jauset T, Masso´-Valle´s D et al (2019) Intrinsic cell-penetrating activity propels Omomyc from proof of concept to viable antiMYC therapy. Sci Transl Med 11(484): eaar5012. https://doi.org/10.1126/ scitranslmed.aar5012

Chapter 3 Biophysical and Structural Methods to Study the bHLHZip Region of Human c-MYC Giovanna Zinzalla Abstract The C-terminal region of the c-MYC transcription factor consists of approximately 100 amino acids that in its native state does not adopt a stable structure. When this region binds to the obligatory partner MAX via a coupled folding-and-binding mechanism, it forms a basic-helix-loop-helix–leucine zipper (bHLHZip) heterodimeric complex. The C-terminal region of MYC is the target for numerous drug discovery programs for direct MYC inhibition via blocking the dimerization event and/or binding to DNA, and a proper understanding of the partially folded, dynamic nature of the heterodimeric complex is essential to these efforts. The bHLHZip motif also drives protein–protein interactions with cofactors that are crucial for both transcriptional repression and activation of MYC target genes. Targeting these interactions could potentially provide a means of developing alternative approaches to halt MYC functions; however, the molecular mechanism of these regulatory interactions is poorly understood. Herein we provide methods to produce high-quality human c-MYC C-terminal by itself and in complex MAX, and how to study them using Nuclear Magnetic Resonance spectroscopy and X-ray crystallography. Our protein expression and purification protocols have already been used to study interactions with cofactors. Key words MYC, MAX, bHLHZip, DNA binding, Heterodimerization, Protein–protein interactions, Intrinsically disorder regions, Cofactors, NMR, X-ray crystallography

1

Introduction The c-MYC pleiotropic transcription factor coordinates the expression of a large, extremely diverse set of genes in a highly contextdependent manner [1–4]. Deregulated expression of the c-MYC protein occurs in a broad spectrum of human cancers and is particularly associated with aggressive disease and poor clinical outcome [5–7]. Targeting c-MYC is regarded as a powerful approach for anticancer therapy, and it is also emerging as a promising molecular target in inflammation and heart disease [8, 9]. MYC physiology and pathology have been extensively studied; however, we still do not know how MYC works at the molecular level, and we need a better understanding of c-MYC structure and function to be able to target it pharmacologically [10–12].

Laura Soucek and Jonathan Whitfield (eds.), The Myc Gene: Methods and Protocols, Methods in Molecular Biology, vol. 2318, https://doi.org/10.1007/978-1-0716-1476-1_3, © Springer Science+Business Media, LLC, part of Springer Nature 2021

21

22

Giovanna Zinzalla

c-MYC belongs to the basic-helix-loop-helix-zipper (bHLHZip) class of transcription factors. It is composed of 439 amino acids (aa) that consist of an N-terminal transactivation domain (NTD), a C-terminal domain (CTD), and a central region. The C-terminal domain (amino acids 360–439) contains the bHLHZip motif, which upon binding to its obligatory partner MAX, also a bHLHZip protein, forms an ordered helical structure [13, 14]. This four-helix bundle binds to specific DNA sequences, with a broad range of affinities, including high-affinity canonical (i.e., E-box) and low-affinity non-canonical DNA sequences [15, 16]. The dimerization event is driven by the leucine zipper and the HLH motifs, while the basic regions interact with DNA. The helix-loop-helix region of c-MYC is the target of diverse posttranslation modifications such phosphorylation, acetylation, ubiquitination, and sumoylation. [17, 18]. Furthermore, this region participates in protein–protein interactions (PPIs) that mediate and regulate c-MYC functions [19, 20]. Structural and biophysical studies of c-MYC bHLHZip by itself and in complex with MAX are relevant to both drug discovery strategies aimed at direct MYC inhibition and to understand interactions of the c-MYC:MAX complex with cofactors that are mediated by the C-terminal, as well as MYC distribution on different genome sites. These studies necessitate large amounts of highquality proteins, and herein we described protocols that allow for the production in an efficient way of large quantities of pure c-MYC:MAX bLHLZip complex and c-MYC by itself. These protocols can be adapted to obtain MYC and MAX derivatives labeled with fluorescent probes that can be used to further interrogate MYC functions as well as to setup HTS assays for drug discovery. The availability of high-level bacterial expression protocols, moreover, facilitates the use of genetic code expansion (GCE) technologies that can, for example, be used to incorporate posttranslational modifications [21]. c-MYC remains a challenging molecular target for drug discovery programs as in isolation it is an intrinsically disordered protein, and the MYC:MAX heterodimer is highly plastic in nature. A combination of different biophysical and structural techniques is therefore needed to study these proteins. In particular, we focus on the use of solution-state Nuclear Magnetic Resonance (NMR) spectroscopy and X-ray crystallography. [14] We have also employed ancillary techniques such as size exclusion chromatography with multi-angle light scattering (SEC-MALS), isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and circular dichroism (CD) [14, 19, 22]. First, we describe a procedure to express and purify the c-MYC bHLHZip protein construct from inclusion bodies, employing heterologous E. coli expression systems in high yield and purity (Subheadings 3.1 and 3.2). Next, we describe the protocols used to

The bHLHZip Region of c-MYC

23

produce and to purify large quantities of the His-tag c-MYC:MAX heterodimeric bHLHZip complex from the soluble lysis fraction employing a polycistronic co-expression strategy (Subheadings 3.1 and 3.3), which is widely used to make multi-subunit complexes in E. Coli [23, 24]. This not only allows the production of the c-MYC: MAX complex, but also a large amount of the MAX:MAX bHLHZip homodimeric complex as a “side product.” These protocols are used to produce isotopically labeled proteins for NMR studies and also have provided c-MYC:MAX complex in large quantities for X-ray crystallography studies. These procedures are derived from standard expression and purification protocols, but herein we describe key modifications to optimize yields and purity. In Subheading 3.4, we also describe how to prepare c-MYC: MAX bHLHZip complexes for NMR studies where only one binding partner of the heterodimeric complex is isotopically labeled, by reconstituting the complex from labeled or unlabeled c-MYC by itself and MAX homodimer. In Subheading 3.5, we describe instead the specific NMR methodologies required to obtain full assignments of the c-MYC:MAX complex and to study its interactions with ligands. Last, in Subheading 3.6, we report the experimental procedure for the crystallization of the heterodimer, providing useful tips to obtain the crystals of this complex that can be used to obtain high-resolution structures for drug discovery.

2

Materials

2.1 Expression of the c-MYC bHLHZip and c-MYC:MAX bHLHZip Complex Constructs

1. 2xTY (or YT) media (rich media) per liter: 16 g Bactotryptone, 10 g yeast extract, 5 g NaCl. Autoclave in 2 L Pyrex™ borosilicate glass Erlenmeyer Flask (see Note 1). 2. 10x K-MOPS buffer, 1 L: Add 209.3 g MOPS (3-(N-morpholino) propanesulfonic acid, MW 209.3 g/mol, 1 M), 17.9 g tricine (MW 179.2 g/mol, 0.1 M) to ~960 mL of nuclease-free demineralized (DM) water; mix to dissolve and adjust to pH 8 (see Note 2) with KOH (10–40 mL of 10 M solution prepared in nuclease-free DM water). Fill the mixture to the final volume of 1000 mL. Filter-sterilize or autoclave, and store at room temperature (see Note 3). 3. 10x K-MOPS minimal media: 800 mL of K-MOPS buffer; 1 mL of 10 mM FeCl2 solution (MW 198.8 g/mol, stock solution 1.0 g/500 mL) as a source Fe ions; 10 mL of 1 M CaCl2 solution (MW 147.01 g/mol, stock solution 74.5 g/ 500 mL) as a source of Ca ions; 10 mL of 1 M MgSO4 solution (MW 203.30 g/mol, stock solution 101.5 g/500 mL) as a source of Mg and SO4 ions; 10 mL of nutriments solution (stock solution: 618 mg of H3BO3/MW 61.83 g/mol, 595 mg of CoCl2/MW 237.93 g/mol, 170 mg of CuCl2/

24

Giovanna Zinzalla

MW 170.50 g/mol, 990 mg of MnCl2/MW 197.90 g/mol, 132 mg of ZnCl2/MW 132.29 g/mol, 241 mg of Na2MoO4/ MW 241.90 g/mol, in 500 mL); 100 mL of 5 M NaCl solution as a source of Na and Cl ions (MW 58.44 g/mol). Fill the mixture to the final volume of 1000 mL nuclease-free DM water. Filter-sterilize (preferred) or autoclave (see Note 4). Filter-sterilize with 1 L capacity 0.2 μm filter. 4. Vitamins solution: Dissolve in 100 mL of nuclease-free DM water 0.5 g of thiamine, 0.1 g di D-Biotin (stored at 0–4
C), 0.1 g of choline chloride, 0.1 g of folic acid, 0.1 g of niacinamide, 0.1 g of D-Pantothenic acid (stored at 0–4
C), 0.1 g of pyridoxal (stored at 20
C), and 0.01 g of riboflavin. Store at 0–4
C and protect from light. 5. Isotopic labeling of protein for NMR structure determination: Dilute 10 K-MOPS minimal media into nuclease-free DM water (1:9, MOPS:H2O) and filter-sterilize. Add 4 mL of potassium phosphate/KPi from 1 M stock (4 mM final concentration, pH 8). Then add 1 g/L of 15NH4Cl and 4 g/L of U-13C or U-12C glucose as the sole sources of nitrogen and carbon, for mono- or double-labeled samples. To make triplelabeled samples, use D2O instead of water in the preparation of the K-NOPS minimal media, and to prepare also any other reagent solution to be subsequentially added to the “growing” media. Filter-sterilize and then add 0.2 mL of vitamin solution per liter of media, which needs to be filter-sterilized separately. Filter-sterilize with 1 L capacity 0.2 μm filter. Finally add the relevant antibiotic. 6. ColiRollers™ Plating Beads (Novagen). 7. 1000 kanamycin: 50 mg/mL of kanamycin. Store in 1 mL aliquots at 20
C. 8. 1000 IPTG, per 50 mL: 0.716 g of isopropyl β-D-1-thiogalactopyranoside (IPTG). Store in 1 mL aliquots at 20
C. 2.2 Purification of c-MYC bHLHZip Protein and c-MYC: MAX bHLHZip Complexes

1. Lysis buffer (LB) for c-MYC bHLHZip: Ice-cold, 100 mM NaCl, 20 mM imidazole, 20 mM Tris–HCl, pH 7.9, and 1 EDTA-free tablet of protease inhibitor EDTA-free (see Note 5). Store at 4
C. 2. Lysis buffer (LB) for c-MYC:MAX bHLHZip complex: ice-cold, 500 mM NaCl, 5 mM MgCl2, 20 mM imidazole, 20 mM Tris–HCl, pH 7.9, and 1 tablet of EDTA-free protease inhibitor (see Note 5). Store at 4
C. 3. VCX 500-VCX 750 sonicators, Vibra-Cell Sonics & Materials Inc., or equivalent.

The bHLHZip Region of c-MYC

25

4. High-speed refrigerated centrifuge, Avanti® J-E, 200/208/ 240, Beckman Coulter, or equivalent, with a VA-25.50 fixedangle aluminum rotor, or equivalent. 5. Use EDTA-free protease inhibitor tablets: cOmplete™ ULTRA Tablets, Mini, EDTA-free, Protease Inhibitor Cocktail by Roche. Store at 4
C. 6. DNase I (bovine pancreatic DNase) solution: Dissolve 2 mg of crude pancreatic DNase I (Sigma or equivalent) in 1 mL of 500 mM NaCl, 20 mM Tris-Cl (pH 7.5), and 1 mM MgCl2. When the DNase I is dissolved, add 1 mL of glycerol (50% v/v) to the solution and mix by gently inverting the closed tube several times. Take care to avoid creating bubbles and foam. Store the solution (1 mg/mL) in aliquots at 20
C (see Note 6). 7. Resuspension buffer (RB) for c-MYC bHLHZip purification from inclusion bodies: Ice-cold, 6 M urea, 100 mM NaCl, 20 mM imidazole, 20 mM Tris–HCl, pH 8–8.5. Store at 4
C. 8. HisTrap™ Ni-NTA Sepharose affinity resin columns from GE Healthcare, or equivalent, 5 mL capacity (see Note 7). ¨ KTA™ START, or equivalent (see Note 8). 9. FPLC system, A 10. Syringe Filter Unit, 0.22. and 0.45 μm. 11. FPLC Binding Buffer (BB)/Buffer A for c-MYC bHLHZip: The same of the RB (see Note 9). 12. FPLC Binding Buffer (BB)/Buffer A for c-MYC:MAX bHLHZip complex: The same of the LB, but without MgCl2. 13. FPLC Buffer Elution Buffer (EB)/Buffer B for c-MYC bHLHZip: 6 M urea, 100 mM NaCl, 250 mM imidazole, 20 mM Tris–HCl, pH 8–8.5. Store at 4
C. 14. FPLC Buffer Elution Buffer (EB)/Buffer B for c-MYC:MAX bHLHZip complex: 500 mM NaCl, 500 mM imidazole, 20 mM Tris–HCl, pH 7.9 (see Note 10). Store at 4
C. 15. XCell SureLock Mini-Cell Electrophoresis System by Invitrogen for SDS-PAGE. 16. NuPAGE® 12% Bis-Tris Mini gels (1.0 or 1.5 mm, 15 wells) by Invitrogen, or equivalent (see Note 11), for SDS-PAGE. 17. MES or MOPS as running buffers for SDS-PAGE. 18. Sample buffers for SDS-PAGE: NuPAGE® LDS sample buffer, Tris-glycine SDS, and NuPAGE® antioxidant. 19. Novex® Sharp Pre-Stained Protein Standard by Invitrogen as standard for molecular weight estimation of the protein molecular weight. 20. Coomassie™ blue staining.

26

Giovanna Zinzalla

21. Reducing agents for the dialysis buffers: Dithiothreitol (DTT) or 2-Mercaptoethanol (BME). 22. Dialysis Buffers (DB) for c-MYC bHLHZip: DB1, 4 M urea, 100 mM NaCl, 20 mM Tris–HCl, pH 7.5; DB2, 2 M urea, 100 mM NaCl, 20 mM Tris–HCl, pH 7.5; DB3, 1 M urea, 100 mM NaCl, 20 mM Tris–HCl, pH 7.5; DB4, 150 mM NaCl, 20 mM KPi/potassium phosphate buffer, pH 7 (PBS buffer). Each of DBs also contains freshly added 1 mM DTT, or 2 mM BME. 23. Dialysis buffers (DB) for c-MYC:MAX bHLHZip complex: PBS + 1 mM DTT or 2 mM BME to be added fresh. 24. Dialysis tubes: Spectrum™Spectra/Por™ 3 RC dialysis membrane tubing 3.5 kDa MWCO (see Note 12). 25. Centriprep® Centrifugal Filter Units, 10 kDa cutoff, 15 mL volume, EMD Millipore (Merck), or equivalent. 26. Concentration determination: Thermo Scientific™ NanoDrop 2000 spectrophotometer (OD at 280) (see Note 13). 2.3

NMR Studies

1. NMR sample buffer: PBS. 2. D2O. 3. E-box DNA: 50 -GAG TAG CAC GTG CTA CTC-30 , Tm 51.2
C, MW ¼ 5.499 kDa, lipolyzed oligo (IDT/Integrated DNA Technologies). 4. NMR tubes: Wilmad® NMR tubes 5 mm diam., precision (see Note 14). 5. NMR long-tip transfer pipets. 6. NMR instrumentation ¼ 700, 800, and 950 MHz Bruker spectrometers with Cryoprobe.

2.4 Crystallization Studies

1. Crystallization sample buffer: 20 mM Tris–HCl and 100 mM NaCl, pH 7.0. 2. Crystallization plates: 96-well crystallization plate (Swissci, MRC 96 T-UVP). The original MRC 2-drop plate. Reservoir recommended volume: 80 μL. Range of useful droplet volumes: 10–1000 nL. UV transmissible. 3. Adhesive clear tape (Hampton Research, HR4–50): 3-in. wide “Duck HD-Clear” tape for sealer or manual sealing. 4. Precipitant solutions for the conditions that support crystal growth for PDB entry 6G6K: 10% PEG 8000, 20% ethylene glycol, 5% EtOH, 0.1 M MOPS/HEPES-Na pH 7.5, with 0.075% (w/v) of each additive [Additive: 0.75% menthol, 0.75% caffeic acid, 0.75% D-quinic acid, 0.75% shikimic acid, 0.75% gallic acid monohydrate, 0.75% N-vanillylnonanamide]

The bHLHZip Region of c-MYC

27

(plate LMB 22, an in-house test formulation of the MORPHEUS III® crystallization screen) [25, 26] (see Note 15). 5. Precipitant solutions for the conditions that support crystal growth for PDB entry 6G6J: 20% PEG 3350, 0.2 M sodium sulfate decahydrate, pH 7 (plate LMB 05). 6. Precipitant solutions for the conditions that support crystal growth for PDB entry 6G6L: 15% PEG 8000 15, 0.2 M ammonium sulfate, pH 7 (plate LMB 09). 7. Nanoliter dispenser MOSQUITO robot (TTP Labtech) for setting up crystallization droplets. 8. Cryoprotectant: 20% (v/v) glycerol. 9. Stereo zoom microscope with a linear rotating polarizer and analyzer. 10. Glass cutting tool, e.g., a capillary cutting stone. 11. Fine point tweezers. 12. Needle with a sharp point angled at 45
. 13. Magnetic wand (MiTeGen or Hampton Research). 14. Low-profile Dewar. 15. For crystal harvesting: Goniometer bases (MiTeGen, Reusable B3S-R (ALS Style) + Magnetic CryoVials; or Hampton Research, Magnetic CrystalCaps), and crystal loops (MiTeGen, MicroMounts/Dual Thickness MicroMounts). 16. ALS-Style Puck, or Universal Pucks (MiTeGen). 17. Puck loading tools (MiTeGen): Bent cryo-tong, puck pusher, puck separator, and puck holder. 18. Shipping accessories (MiTeGen): A puck shipping canister set, a cryo express dry shipper with its corresponding hard-shell shipping case.

3

Methods

3.1 Expression of c-MYC bHLHZip and c-MYC:MAX bHLHZip Constructs in Rich or in Minimal Media

1. Transform the appropriate c-MYC or c-MYC:MAX plasmid (see Note 16) into E. coli strain that carries the T7 polymerase (i.e., C41 DE3 chemically competent cells): Add 1 μL of DNA into 200 μL of cells, and incubate on ice for 10 min, then heat shock for 40 s at 42
C, then add the cells into of 800 μL of 2xTY(or YT) media and incubate at 37
C for 1 h to express the antibiotic-resistant gene, and plate the cells on Luria-Bertani (LB) agar supplemented with kanamycin (50 μg/mL) using the plating beads; typically 50 μL and incubate at 37
C for 12 h/overnight (see Note 17).

28

Giovanna Zinzalla

2. To obtain the starting culture transfer a single colony into 10 mL of rich media (for 1 L growing culture) containing kanamycin and incubate at 37
C for 12 h/overnight. 3. Transfer the starting culture in 1 L culture of 2XTY (2xYT) broth, or minimal media, to produce isotopically labeled proteins, containing kanamycin. 4. c-MYC by itself is expressed in inclusion bodies: thus, grow the cell culture at 37
C for around 3 h (monitoring the OD); then cool the culture down to 20 or 25
C and wait for the OD to reach 0.6–0.8 (no more than 0.95). Then induce it with 1 mM IPTG (1:1000 ¼ 1 mL for 1 L culture). Grow the induced culture for 12 h (overnight) at 37
C. 5. To carry out soluble expression of the c-MYC:MAX bHLHZip complex (either with cleavable or with short His-tag), grow the cell culture at 30
C for around 3 h (monitoring the OD); then cool the culture down to 20 or 25
C and wait for the OD to reach 0.6–0.8 (no more than 0.95). Then induce it with 1 mM IPTG (1:1000 ¼ 1 mL for 1 L culture). Grow the induced culture for 12 h (overnight) at 30
C. 6. Centrifuge the bacterial culture at 4000 rpm (2000 RCF) at 4
C for 20 min in an large-capacity refrigerated centrifuge (we use Avanti® J-HC centrifuge, Beckman Coulter) using 1 L bottles with an appropriate rotor (we use a JS-4.2A Swinging-Bucket Rotor) (see Note 18). 3.2 Purification of Cleavable His-Tag c-MYC bHLHZip Protein

1. Suspend the cell pellets at 4
C in the LB, 5–10 mL of per gram of pellet, or just use as average 20–25 mL per 1 L culture, using a roller mixer until a homogeneous mixture is obtained (see Note 19). 2. Sonicate the suspension on ice at 4
C using an ultrasonic homogenizer with a tapered microtip (3-mm diameter) at an amplitude of 40%. Apply 5 15 s on/off for a 50 –100 cycle and repeat until a nonviscous and homogenous mixture is obtained (see Note 20). Then, add 1 protease inhibitor EDTA-free tablet and dissolve it using a roller mixer keeping the mixture at 4
C. 3. Centrifuge the mixture at 18,000 rpm (35,000 RCF) at 4
C for 30 min in a high-speed refrigerated, using 50 mL bottle sample with an appropriate rotor (see Note 21). 4. Dissolve the pellet in the RB at 4
C using a roller mixer until you obtain a homogeneous mixture (see Note 19). 5. Centrifuge at 18,000 rpm at 4
C for 50 min using the same centrifuge of step 3 (see Note 22). 6. Before loading the supernatant sample on the chromatography column, clarify it by filtering with 0.45 μm syringe filter.

The bHLHZip Region of c-MYC

29

7. Purify the supernatant by immobilized metal affinity chromatography (IMAC) chromatography under denaturing conditions (see Note 23) using a 5 mL HisTrap FF (Fast Flow) ¨ KTA column, or equivalent (see Note 24), mounted on an A system, or an equivalent FPLC system. 8. Prime the system with BB/Buffer A (5 column volumes/CV, at a flow rate of 10 mL/min) and Buffer B (5 column volumes/ CV, at a flow rate of 10 mL/min), or using a priming method ¨ KTA system. already pre-set on the A 9. Equilibrate the column with at least 5 column volumes (CV) of Buffer A/BB, at a flow rate of 5 mL/min. Immerse the sample inlet tubing in the sample container (see Note 25). Load the sample at a flow rate between 1.0 and 1.5 mL/min. 10. Washout the unbound with at least 5 CV of BB at a flow rate of 1.5 mL/min, and then with at least 5 CV of 5% Buffer B. 11. Start the stepwise elution with 20% EB/Buffer B (2 CV), then 50% (around 2 CV) and 100% Buffer B (up to 2 CV), with a fractionation volume of 1 mL (see Note 26). The majority of protein elutes with 20% Buffer B, but if more than one 1 L culture/1 pellet is purified, then it finishes to elute with 50% Buffer B. 12. After elution, to wash the column, use at least 5 CV of 100% EB/Buffer B, and then rinse the system and wash the column with DM water (5 CV), and eventually for storage purposes with 5–7 CV of 20% ethanol solution. If a harsher wash is necessary simply follow the manufacturers’ protocols. A column can be used for up to 5-6 purifications before requiring stripping and regenerating the Ni2+ ions (or a new column). 13. Run an SDS-PAGE gel to pool the fractions containing the c-MYC bHLHZip protein of 95–98% purity (Fig. 1). 14. Carry out a stepwise “refolding”/re-solubilization (i.e., removal of the urea from the protein buffer) by dialyzing the pooled fractions in at least 5 L of DB1, followed by dialysis of the protein in 5 L of DB2, then in 5 L of DB3, and finally in 5 L of DB4, each of the steps at 4
C overnight (see Note 27). 15. Concentrate the dialyzed protein by centrifugation in a centrifugal filter unit with 10 kDa cutoff and 15 mL volume (see Note 28). Aliquot the protein and store it at 80
C. 16. Yields around 50 mg/L of culture in rich media and 30 mg/L of culture in minimal media. 3.3 Purification of c-MYC:MAX bHLHZip Complex Constructs

1. Suspend the cell pellet(s) at 4
C in the LB, 5–10 mL of per gram of pellet, or just use as average 20–25 mL per 1 L culture, using a roller mixer until a homogeneous mixture is obtained (see Note 19).

30

Giovanna Zinzalla

Fig. 1 Denaturing Protein Electrophoresis: an example of SDS gel of the fractions from the purification of 1H, 15 N c-MYC bHLHZip protein. M ¼ Novex® Sharp Pre-stained MW Marker; F1-F11 ¼ wash fractions; F14– 22 ¼ collected fractions of His-tag c-MYC bHLHZip protein (MW ¼ 12.56 kDa)

2. Sonicate the suspension on ice at 4
C using an ultrasonic homogenizer with a tapered microtip (3-mm diameter) at an amplitude of 40%. Apply 5 15 s on/off for a 50 –100 cycle and repeat until a non-viscous and homogenous mixture is obtained (see Note 20). Then add 1 protease inhibitor EDTA-free tablet and dissolve it using a roller mixer keeping the mixture at 4
C. 3. Add the equivalent of 150 μL of bovine pancreatic DNase I per 1 g of culture pellet and incubate for 45 min at 37
C with agitation at 90 rpm. 4. Centrifuge the mixture at 18,000 rpm at 4
C for 30 min in a high-speed refrigerated, using 50 mL bottle sample with an appropriate rotor (see Note 29). 5. Before loading the supernatant sample on the chromatography column, clarify it by filtering with 0.45 μm syringe filter. 6. Purify the supernatant by immobilized metal affinity chromatography (IMAC) (see Note 23) using a 5 mL HisTrap HP ¨ KTA column, or equivalent (see Note 24), mounted on an A system, or an equivalent FPLC system. 7. Prime the system with BB/Buffer A (5 column volumes/CV, at a flow rate of 10 mL/min) and Buffer B (5 column volumes/ CV, at a flow rate of 10 mL/min), or using a priming method ¨ KTA system. already preset on the A 8. Equilibrate the column with at least 5 column volumes (CV) of Buffer A/BB, at a flow rate of 5 mL/min. Immerse the sample

The bHLHZip Region of c-MYC

31

Fig. 2 Denaturing Protein Electrophoresis: an example of SDS gel of the fractions from the purification of unlabeled c-MYC:MAX bHLHZip complex. M ¼ Novex® Sharp Pre-stained MW Marker; F17–20 ¼ collected fractions of MAX homodimer (MAX ¼ 9.9 kDa); 24–30 ¼ collected fractions of His-tag c-MYC:MAX heterodimer (His-tag c-MYC ¼ 12.56 kDa); MYC ¼ purified unlabeled His-tag c-MYC by itself

inlet tubing in the sample container (see Note 25), and load the sample at a flow rate of 1.0 or 1.5 mL/min. 9. Washout the unbound with at least 8 CV of 2–5% EB/Buffer B at a flow rate of 1.5 mL/min. 10. Start the stepwise elution with 50% EB/Buffer B (around 6 CV), with a fractionation volume of 1 mL then 100% (around 5 CV) (see Note 30), with a fractionation volume of 3 mL (see Note 26). 11. After elution, to clean the column, use at least 5 CV of 100% EB/Buffer B, and then rinse the system and wash the column with DM water first (5 CV), and eventually for storage purposes with 5–7 CV of 20% ethanol solution. If a harsher wash is necessary, simply follow the manufacturers’ protocols. A column can used for up to 5-6 purifications before requiring stripping and regenerating the Ni2+ ions (or a new column). 12. Run an SDS-PAGE gel and pool the fractions containing the His-tag c-MYC:MAX bHLHZip complex and the MAX dimer (with no His-tag) of 95–98% purity (Figs. 2, 3 and 4). 13. Carry out dialysis of the protein complex against PBS buffer (5 L) at 4
C overnight.

32

Giovanna Zinzalla

Fig. 3 Denaturing Protein Electrophoresis: an example of SDS gel of the fractions from the purification of 1H, 15 N c-MYC:MAX bHLHZip complex. M ¼ Novex® Sharp Pre-stained MW Marker; F7–9 ¼ collected fractions of MAX homodimer (MAX ¼ 9.89 kDa); F14–16 ¼ collected fractions of His-tag c-MYC:MAX heterodimer (His-tag c-MYC ¼ 12.56 kDa)

Fig. 4 Denaturing Protein Electrophoresis: an example of SDS gel of the fractions from the purification of 2 13 15 H, C, N c-MYC:MAX bHLHZip complex. M ¼ Novex® Sharp Pre-stained MW Marker; F8-F10 ¼ collected fractions of MAX homodimer (MAX ¼ 9.89 kDa); F17–22 ¼ collected fractions of His-tag c-MYC:MAX heterodimer (His-tag c-MYC ¼ 12.56 kDa)

The bHLHZip Region of c-MYC

33

14. Concentrate the dialyzed protein by centrifugation in a centrifugal filter unit with 10 kDa cutoff and 15 mL volume. Aliquot the protein and store it at 80
C. 15. Yields around 50 mg/L of culture for His-tag c-MYC:MAX complex and 30–40 mg/mL of culture MAX dimer (with no His-tag) in rich media, and 30 mg/L of culture for His-tag c-MYC:MAX complex, and 20–25 of culture MAX dimer (with no His-tag) in minimal media (see Note 31). 3.4 Production of Selectively Labeled c-MYC:MAX bHLHZip Complexes for NMR Studies

1. Thaw an aliquot of c-MYC bHLHZip (isotopically labeled or not) (see Note 32) and an aliquot of MAX dimer complex (isotopically labeled or not). 2. To reconstitute the c-MYC:MAX complex with only either c-MYC or MAX isotopically labeled, add into the sample of c-MYC bHLHZip protein (isotopically labeled or not) sample an equimolar amount of MAX dimer complex (isotopically labeled or not) (see Note 32). 3. Concentrate the sample of the reconstituted c-MYC:MAX bHLHZip complex to the desired concentration for NMR studies by centrifugation in a centrifugal filter unit with 10 kDa cutoff and 15 mL volume (see Note 33).

3.5 NMR Protocols to Study c-MYC bHLHZip by Itself and c-MYC:MAX bHLHZip Complex

1. Preparation of samples for NMR studies of MYC by itself and in complex with MAX: (a) 500 μL in total ¼ 480 μL of protein in PBS + 20 μL of D2O. (b) Protein concentration: c-MYC bHLHZip ¼ 5–10 μM; c-MYC:MAX bHLHZip complex ¼ 150–400 μM (see Note 34). 2. Preparation of sample for NMR studies of c-MYC:MAX heterodimer bound to DNA: (a) 500 μL in total ¼ 480 μL of protein/DNA complex in PBS + 20 μL of D2O. (b) Protein/DNA complex concentration: 300–400 μM, 1:1 ratio c-MYC/MAX dimer:DNA. To prepare the DNA solution to add to the heterodimer, dialyze the required amount of DNA against PBS buffer (i.e., storage solution buffer) (see Note 35). 3. NMR data for assignment (Fig. 5) of the c-MYC:MAX dimer is collected at 298 K (see Note 36) using a Bruker Avance spectrometer with 1H resonance frequency of 800 MHz fitted with a 1H{13C,15N} triple-resonance cryoprobe. Assignment of backbone amide peaks is obtained using the following standard, deuterium decoupled (see Note 37) TROSY triple resonance spectra: trHNCO and trHN(CA)CO experiments

34

Giovanna Zinzalla

Fig. 5 HSQC spectra of 2H,13C,15N c-MYC:MAX bHLHZip complex

collected with 1024*64*128 complex points in the 1H, 15N, and 13C dimensions; trHNCA and trHN(CO)CA with 1024*64*128 complex points in the 1H, 15N, and 13C dimensions; and trHNCAB and trHN(CO)CACB with 1024*64*110 complex points in the 1H, 15N, and 13C dimensions. Datasets are collected with nonuniform sampling set at 30–50% and processed using compressed sensing (see Note 38). 4. NMR data for assignment of c-MYC bHLHzip is collected at both 298 K and 278 K (see Note 39) using the above methods with the exception that deuterium decoupling is not used as it is not necessary to deuterate the sample (see Note 40). 5. Spectral processing: Spectra were processed using the program Topspin 3.1 and analyzed using the program Sparky 3.115, with assignment aided by the program Mars [27].

The bHLHZip Region of c-MYC

35

6. NMR can used to study the interaction of the c-MYC:MAX heterodimer with proteins that bind to the C-terminal region of c-MYC. Binding sites can be identified by comparison of spectra with and without the ligand, and the Kd for interactions in the millimolar to micromolar range can be measured by analysis of the changes in chemical shift produced as a function of ligand added. Although deuteration is needed to obtain assignments, we have found that in some cases the interaction of the dimer with ligands can be carried out with non-deuterated samples by recording BEST TROSY spectra [28]. 7. NMR can also be used to study the c-MYC/MAX:DNA complex (e.g., we have investigated the binding of this complex to cofactors [19] and unpublished data). The formation of a 1:1 protein:DNA complex in solution was confirmed by NMR relaxation properties (i.e., SPIN ECO experiment) (see Note 41). 3.6 Crystallization Protocol for c-MYC: MAX bHLHZip Complex

1. Buffer exchange the purified heterodimer complex into the crystallization buffer and concentrate the sample to 10 mg/ mL, as measured on a NanoDrop 2000 spectrophotometer. 2. Dispense the sample in 96-well crystallization plate using the nanoliter dispensing MOSQUITO robot in single drops of 200 nL final volume with 1:1 ratio (100 nL protein +100 nL precipitant solution). Set the drops at room temperature (20
C), seal the plate, and move it into a cold room (4
C) (see Note 42). 3. Grow the crystals of c-MYC:MAX bHLHZip complex using the vapor diffusion method at 4
C (see Note 43) using the crystallization conditions detailed in the Subheading 2.4. Check the crystal growing after an hour, and subsequentially twice a day. 4. Place the plate with crystals on a harvesting stereo microscope with a variable zoom. Cut the cover tape in four strokes using the glass cutting tool (see Note 44). Then, use a sharp needle probe to free one or two edges of the square and carefully lift it up. The crystal bolus should remain on the bottom of the well. 5. Before harvesting the crystals, add 5 μL of precipitant solution to the well, supplemented with a cryoprotectant, if necessary, on top of the crystal bolus. 6. Increase magnification of the microscope to ~100, focus on a crystal, and adjust the polarizer and analyzer angles so that there is a good contrast between the crystal and the background, and there is still enough light to see the harvesting loop.

36

Giovanna Zinzalla

7. Harvest/fish the crystals by scooping it directly using a MiTeGen MicroMount (mounted on a magnetic goniometer base, attached to a magnetic wand) (see Note 45), with the inner diameter matching the size of the crystal. 8. Immediately plunge the MicroMount with the harvested crystal in a low-profile Dewar with liquid nitrogen to flash freeze it, and then transfer it in the puck that was previously placed in the same low-profile Dewar by releasing it from the magnetic wand (see Note 46). 9. When you finish to harvest the crystals using a cryo-tong, transfer the puck into the canister in a storage or shipping Dewar, previously filled with liquid nitrogen.

4

Notes 1. The use of baffled flasks to increase oxygenation is not required as the culture growth both in rich and minimal media is optimal in normal flasks. 2. K-MOPS buffer, and therefore the K-MOPS minimal media for cell culture growth, can also be used at pH 7.4. 3. It is important to protect the K-MOPS buffer from the light. Do not use if the solution turns dark. If it is light yellow that is OK. 4. The K-MOPS minimal media can be stored at 4
C for up to a month. 5. Make sure to fully dissolve the tablet in the buffer. The best way is to let it gently dissolve by using a roller mixer, continuously. 6. Overtime, the DNase solution would lose its activity (60% humidity) and automatic turning device. 2. Clean the egg with ethanol and open at the shallow site using a spatula. 3. Remove the broken shell with sterile forceps, and then the membrane under the egg shell with another sterile forceps. 4. Gently pull out the embryo with closed forceps under its neck. 5. Put the embryo onto a petri dish. Remove head, arms, legs, and transfer the body into a 50 ml tube. 6. Wash the body with 10 ml TS buffer (37
C), shake briefly, decant the supernatant and thoroughly homogenize the body with the round end of a spatula for 5 min. 7. Add 10 ml TR solution (37
C) and shake gently, incubate for 5 min at room temperature (RT), and then carefully pipet 5 up and down using a 10 ml wide mouth pipette. 8. Let clumps settle down for 5 min, then decant the supernatant into a prepared 50-ml tube containing 10 ml ice-cold PGM (see Note 1). 9. Repeat this washing step with following solutions kept at 37
C: 5 ml TS buffer, 5 ml TS buffer, 5 ml TR solution, 5 ml TS buffer, 5 ml TS buffer. 10. Finally, mix the cell suspension by inverting the 50-ml tube and centrifuge at 150  g for 20 min at 4
C. 11. Decant the supernatant, add 15 ml PGM to the pellet and pipet 25 up and down with a wide mouth pipette. 12. Let the clumps settle down for 5 min and transfer the supernatant into a 15-ml tube. 13. From this supernatant, dilute 0.1 ml with 9.9 ml of ISOTON™ II Diluent. 14. Count the cells using a Coulter counter, determine the number of cells/ml and the total cell number. The total number of primary quail embryo fibroblasts (QEF) should be in the range between 5  107 and 108 for a 9-days old embryo. 15. Plate 8  106 cells per 100-mm dish containing 10 ml PGM. 16. Incubate cells at 37
C in a 5% CO2 humidified atmosphere for 3 days.

3.2 DNA Transfection of MYC-Carrying Retroviral Vector Plasmids

1. For cell transfer, wash primary QEF from one 100-mm dish with 5 ml TS buffer, aspirate, add 2 ml trypsin–EDTA solution, and aspirate. 2. Incubate at 37
C for 5 min (see Note 2), then suspend the cells in 2 ml of transfer buffer and transfer into a conical 15-ml tube.

96

Markus Hartl and Klaus Bister

3. Wash the dish with 2 ml of culture medium, add to the cell suspension, and mix. 4. Count cells as described above (see Subheading 3.1) and determine the number of cells/ml. About 1.5–2.0  107 cells should be on one 100-mm dish, 3 days after plating. 5. To keep the cells in culture, seed 3–6  106 secondary QEF into a 100-mm dish containing 10 ml of avian cell culture medium and incubate at 37
C (5% CO2). 6. For DNA transfection, seed each 1.25  106 cells into 60-mm dishes containing 4 ml of growth medium (see Note 3). 7. Incubate overnight at 37
C (5% CO2). The cells should be subconfluent the next day. 8. Before transfection, replace the medium with fresh growth medium (4 ml) and incubate at 37
C for 1 h (5% CO2). 9. To prepare a transfection cocktail, add 50 μl of 2.5 M CaCl2 to 450 μl of H2O containing 4 μg of transfection-grade purified retroviral plasmid DNA (see Fig. 1a), and pipet 5 up and down. 10. Add this mixture into a 2-ml tube containing 0.5 ml of 2 HBS. Again, pipet 5 up and down. The solution becomes slightly turbid due to calcium phosphate precipitation. 11. After 15 s, evenly distribute the transfection mixture by slowly dropping the suspension onto the medium of the seeded cells. 12. Gently swirl the dishes and incubate at 37
C for 6 h to allow settlement and uptake of the calcium phosphate crystals with attached DNA. 13. Aspirate the medium, add 4 ml of avian cell culture medium and incubate cells at 37
C (5% CO2) overnight (see Note 4). 14. Three days after transfection, transfer the confluent cells onto a 100-mm dish containing 10 ml of avian cell culture medium to allow retroviral spread. This results into infection of all cells after about 1 week. 3.3 Focus Assay of MYC-Transformed Cells

1. Prepare a cell suspension from primary QEF as described above (see Subheading 3.2). 2. Seed each 0.25  106 cells into the wells of an MP-12 dish containing 1 ml of growth medium (see Note 5), and incubate overnight at 37
C (5% CO2). 3. Agitate the dishes as above (see Note 3). The next day cells should be subconfluent and evenly distributed on the dish. 4. Before transfection, replace the medium with fresh growth medium and incubate at 37
C (5% CO2) for 1 h.

MYC in Cancer and Evolution

97

Fig. 1 Transformation of quail embryo fibroblasts (QEF) by the v-myc oncogene, and specific inhibition of MYC. (a) Map of the replication-competent retroviral vector plasmid pRCAS-MC29. (b) Phase contrast micrographs showing focus formation of QEF transfected with pRCAS-MC29 in comparison to control QEF. Bright field micrographs were taken 2 weeks after DNA transfection. Adapted from [25]. (c) Colony formation of QEF/ RCAS-MC29 cells in soft agar, and inhibition by trifluoperazine (TFP) (5–20 μm), an antagonist of the MYC-interactor calmodulin (CaM). (d) Proliferation inhibition of QEF/RCAS-MC29 cells by TFP. QEF/RCASMC29 cells were seeded onto 96-well cell culture plates. The next day, TFP was added at the indicated final concentrations and cell densities measured every 8 h over a 3-day time period using an Incucyte live cell analysis system. Cells without treatment (H2O) were used as reference. Adapted from [22]. (e) Left panels: cells from the v-myc-transformed quail cells QEF/RCAS-MC29 or the methylcholanthrene-transformed cell line QT6 were treated with the inhibitor compound KJ-Pyr-9 [26]. Then, cells were counted and microphotographs were taken. Horizontal bars indicate the numbers of cells initially seeded. Right panel: Northern analysis of RNAs from QEF/RCAS-MC29, QT6, and normal QEF using an myc-specific probe. Adapted from [27]

5. Transfect cells with plasmid DNA (1.0 μg–3.0 μg per MP-12 well) in quadruplicate using the calcium phosphate method (see Subheading 3.2). Use each 250 μl from the 1-ml transfection cocktail per well (see Note 6). 6. After 6 h, aspirate the medium, and add 1 ml of growth medium per well. Incubate the cells overnight at 37
C (5% CO2).

98

Markus Hartl and Klaus Bister

7. The next day remove the medium from the confluent cells and add each 1 ml of liquid focus agar to three of the four MP-12 wells (see Note 7). 8. The medium of the fourth well, which is reserved for protein analysis, is replaced with 1 ml of avian cell culture medium. 9. Let the agar harden for 90 min at RT, then incubate the cells at 37
C (5% CO2). 10. Prepare a protein extract from the cells cultured on the residual MP-12 well 2 d after transfection: remove the medium, wash with 1 ml TS-buffer, and aspirate. 11. Add 150 μl of 1 SDS-PAGE gel-loading buffer. After cell lysis, transfer the lysate into a 1.5-ml reaction tube and store at 20
C (see Note 8). 12. Overlay the cells under agar every 3–4 days with 0.5 ml of focus agar. Micro-tumors (foci) of MYC-transformed cells emerge after 4 days and are usually scored after 14 days. 13. For foci scoring and better visualization, add 800 μl of GIEMSA fixing solution per well onto the agar and incubate overnight at RT in a fume hood. 14. The next day, carefully remove the agar block from the fixed cells using a spatula with a rounded end (see Note 9). 15. Wash the cells with water, add 800 μl GIEMSA staining solution per well, and incubate for 30 min at RT (do not rock the dishes). 16. Remove the staining solution and wash 3 with water. Air-dry the dishes and score the foci by counting and photography (see Fig. 1b) to quantify the transformation efficiency. 17. In case single foci are isolated, do not stain the cells. Instead, prepare a flexible plastic tube attached to a Pasteur pipette and MP-24 wells filled with each 1 ml of avian cell culture medium (see Note 10). 18. Under the microscope, detach the focus and carefully suck until the focus is visible in the pipette tip (see Note 11). 19. Transfer the focus into the MP-24 well and rinse the pipette with culture medium. 20. Incubate at 37
C (5% CO2) for 1 day until cells are attached. Replace the medium. 21. After the clonal cell population has grown to confluence, transfer all cells into an MP-12 well, and then subsequently to an MP-6 well, a 60-mm dish, and a 100-mm dish.

MYC in Cancer and Evolution

3.4 Testing MYC Inhibitors by Agar Colony Assay and Cell Proliferation Measurement

99

1. Transfect cells plated on 60-mm dishes, and passage as described above (see Subheadings 3.2 and 3.3), until cells have adopted a transformed morphology (3–6 passages). 2. Prepare MP-24 dishes filled with each 0.25 ml of liquid cloning bottom agarose per well, and let the agar harden for 30 min. 3. Prepare an adequate amount of cloning top agarose and keep at 45
C in a water bath. 4. Transfer trypsinized cells suspended in 8 ml of transfer buffer into a conical tube. 5. Determine the cell number and transfer each 20,000 to 80,000 cells into 2-ml tubes. 6. Add each 1 ml of liquid cloning top agarose (45
C) into the tubes and mix with the blue tip of a 1000-μl Pipetman. 7. Pipet each 0.25 ml of the mixtures in triplicate into the prepared MP-14 wells resulting into an amount of suspended cells between 5000 and 20,000. 8. Let the agar harden for at RT for 2 h, then incubate at 37
C (5% CO2). 9. Overlay the cells every 3–4 days with 0.25 ml of cloning top agarose per well. 10. Colonies consisting of transformed cells are detectable after 1–2 weeks (see Fig. 1c). 11. Determine the number of colonies formed by 1,000 cells to quantify the transformation efficiency. 12. To test the effect of compounds specifically inhibiting MYC-triggered colony formation such as the established MYC inhibitors 10058-F4, 10074-G5, KJ-Pyr9, and KJ-Pyr10, or the CaM antagonist TFP [22, 26, 27], add solutions containing the appropriate amount of compounds to bottom and top agarose in order to obtain final concentrations between 0.1 μM and 50 μM (see Fig. 1c–e). 13. To test MYC inhibitors for interference with cell proliferation, seed each 5,000 to 20,000 cells suspended in 100 μl avian cell culture medium into the wells of a 96-well dish, and incubate overnight at 37
C (5% CO2). 14. The next day, replace the medium by 100 μl avian cell culture medium containing the appropriate amount of MYC inhibitor resulting in final concentrations of 0.1 μM to 50 μM. Cells without treatment are used as a reference. 15. Incubate the dishes at 37
C (5% CO2) using a live cell imaging system (IncuCyte S3, Essen Bioscience/Sartorius). 16. Measure cell proliferation in real time for 3 days by phase contrast imaging every 8 h from four separate regions per well using a 10 objective (see Fig. 1d).

100

Markus Hartl and Klaus Bister

3.5 MYC-Protein Interactions Monitored by Protein Pull-Down Analysis 3.5.1 Detection by Radioactive Protein Labeling

We use glutathione-S-transferase (GST) fusion proteins coupled on glutathione Sepharose beads. Alternatively, the bait protein is covalently linked to agarose beads (e.g., calmodulin).

1. Seed each 6  106 MYC-transformed cells onto two 100-mm dishes containing 10 ml of avian cell culture medium and incubate overnight at 37
C and 5% CO2. 2. For metabolic labeling, remove the medium, and wash cells twice with 5 ml TS buffer. 3. Incubate the cells for 1 h at 37
C (5% CO2) in 6 ml DMEM (Met). 4. Remove the medium by aspiration and replace it with 3 ml D-MEM medium (Met) containing 100 μCi [35S]-methionine (>1000 Ci/mmol) per dish. 5. Incubate the dishes for 3 h at 37
C (5% CO2) with occasional rocking. 6. Wash the cells twice with 5 ml ice-cold TS buffer, aspirate and drain the last traces. 7. Place the dishes onto a surface chilled at 0
C. 8. To prepare lysates under native conditions, distribute each 1 ml of NDL buffer onto the 100-mm dishes and incubate at 4
C for 20 min. 9. Scrape the lysates using a handheld flexible rubber scraper (policeman), and transfer into a 5-ml reaction tube (see Note 12). 10. Shear chromosomal DNA by drawing the lysate 10 through a 20-gauge needle attached to a syringe. 11. Centrifuge at 20,000  g for 30 min at 4
C. 12. Transfer the clarified lysate (final volume: 2 ml) into cooled fresh tubes. 13. Determine the radioactive counts per minute (cpm) from 1 μl (1/2000 vol) dissolved in 10 ml ReadyMix™ (Beckmann) using a scintillation counter. 14. From the lysate, reserve one or more 25-μl aliquots as input control (5%); store at 20
C. 15. For protein pull-down, use each 500 μl of the lysate (~5  107 cpm) and add 1–10 μg of recombinant GST fusion protein bound to glutathione-Sepharose beads and equilibrated in NDL buffer (see Note 13). 16. Alternatively, add a 40-μl aliquot of calmodulin-agarose (CaM-ag) bead suspension equilibrated in NDL buffer, and supplemented with 0.5 mM CaCl2. 17. Incubate for 2 h at 4
C using an overhead shaker.

MYC in Cancer and Evolution

101

18. Centrifuge the beads at 5000  g for 2 min at 4
C and remove the supernatant. 19. Add 1 ml of NDL buffer and incubate for 5 min at 4
C using an overhead shaker. 20. Centrifuge and remove the supernatant as above. Repeat this washing step 3. 21. Add each 100 μl of boiling buffer to the pellet and to the input sample(s). 22. Pierce a hole into the cap of the tube and heat for 2 min at 100
C in a boiling water bath. 23. Cool on ice for 15 min. 24. Add each 400 μl dilution buffer to the lysates and pipet up and down several times. 25. Centrifuge at 20,000  g for 10 min at 4
C. 26. Transfer the clarified lysates (500 μl) into cooled fresh tubes and determine the activities from each 2.5 μl (0.5%) as described above using a scintillation counter. The pull-down samples may be stored at this stage at 80
C. 27. For each precipitate, prepare 1.5-ml reaction tubes containing 1–5 μl of antiserum or pre-immune serum diluted in 200 μl RIPA-BSA. 28. Mix the lysate (500 μl) with the diluted antiserum, and incubate on ice for 1–2 h. 29. Add 100 μl of RIPA-protein A-bead Sepharose slurry and incubate for 60 min at 4
C on a rocking platform. 30. Pellet the immune complexes by centrifugation at 20,000  g for 20 s at 4
C. 31. Discard the supernatant and resuspend the pellets in each 650 μl RIPA buffer. 32. Transfer this suspension onto a cushion of 650 μl RIPAsucrose 10% (w/v). 33. Centrifuge at 13,000  g for 15 min at 4
C. 34. Discard the supernatant and wash pellets with 1 ml RIPA buffer (3), and 1 ml PBS (1). 35. Suspend the pellet in 40 μl 1 SDS gel-loading buffer and incubate at 95
C for 5 min. 36. Centrifuge at 15,000  g for 5 min at RT (see Note 14). 37. Load the supernatant onto an SDS polyacrylamide gel and separate the proteins. 38. After electrophoresis, desiccate the gel using a vacuum gel dryer. 39. Detect the [35S]-emitted β-radiation with an imager (Typhoon FLA 7000, GE Healthcare) (see Fig. 2a).

102

Markus Hartl and Klaus Bister

Fig. 2 Analyzing MYC–specific protein interactions. (a) Pull-down of the Gag-Myc hybrid protein bound to CaM-agarose (CaM-ag). Lysates prepared under native conditions from metabolically [35S]-methioninelabeled QEF/RCAS-MC29 cells were loaded onto CaM-ag beads in the presence of CaCl2 (0.5 mM) or EDTA (1 mM). Bound proteins were eluted under denaturing conditions and subjected to immunoprecipitation using antibodies directed against Gag or Myc proteins, or normal rabbit serum (NRS). As input control, 5% of the lysates were used for immunoprecipitation. Proteins were resolved by SDS-PAGE (10% w/v) and detected on a molecular bioimager. Positions of protein size markers are indicated in the margin. (b) Ectopic BASP1 expression correlates with an impaired v-Myc:CaM interaction. Left panel: co-immunoprecipitation (CoIP) analysis using extracts from QEF/RCAS-MC29 and QEF/RCAS-MC29-IRES-BASP1 cells and MAX- or CaM-specific antibodies for the first precipitation under native conditions, and a v-Myc-specific antibody (anti-Myc) for the second precipitation under denaturing conditions. Precipitated proteins were dissociated, separated by SDS-PAGE and analyzed by immunoblotting. Right panel: immunoblotting of input samples using v-Myc-, CaM-, BASP1-, and α-tubulin-specific antibodies. Adapted from [22] 3.5.2 Detection by Immunoblotting Using ECL

1. Prepare cell extracts from one 100-mm dish using 1 ml of GST lysis buffer. 2. Place the dishes onto a surface chilled at 0
C and rock for 20 min. 3. Scrape cells and transfer into a 10-ml vial. Rinse the dish with 1 ml of GST lysis buffer and add to the lysate. 4. Shear chromosomal DNA by drawing the lysate 10 through a 20-gauge needle. 5. Centrifuge the homogenous lysate at 20,000  g for 60 min at 4
C. Transfer the supernatant (clarified lysate) into a fresh tube. 6. Reserve aliquots as input controls (0.5–5%) and store at 20
C until needed. 7. Preclear the lysate by adding 10 μl of glutathione-Sepharose slurry, and incubating overnight at 4
C on a rotary shaker. 8. Centrifuge at 13,000  g for 10 min at 4
C. 9. Transfer the supernatant into a fresh tube containing 1–10 μg of recombinant GST fusion protein bound to glutathioneSepharose beads equilibrated in GST lysis buffer.

MYC in Cancer and Evolution

103

10. Alternatively, add a 40-μl aliquot of calmodulin-agarose (CaM-ag) bead suspension (Sigma-Aldrich) equilibrated in GST lysis buffer, and supplemented with 0.5 mM CaCl2. 11. Incubate for 2 h at 4
C using an overhead shaker. 12. Centrifuge the beads at 5000  g for 2 min at 4
C and remove the supernatant. 13. Add 1 ml of GST lysis buffer and incubate for 5 min at 4
C using an overhead shaker. 14. Centrifuge and remove the supernatant as above. Repeat this washing step 3. 15. Suspend the pellet in 40 μl 1 SDS gel-loading buffer and incubate at 95
C for 5 min. 16. Centrifuge at 15,000  g for 5 min at RT. 17. Load the supernatant onto an SDS-polyacrylamide gel and separate the proteins. 18. After electrophoresis, detect proteins by immunoblot analysis with specific antibodies. 3.6 MYC Protein Interactions Monitored by Coimmunoprecipitation (CoIP) Analysis 3.6.1 Detection by Radioactive Protein Labeling and Fluorography

1. For detection of radioactively labeled proteins, proceed principally as described above by preparing lysates under native conditions using four 100-mm dishes (see Subheading 3.5.1, steps 1–13). 2. Distribute the lysate (4 ml) into 1.5-ml reaction vials (800 μl each). Each sample should have an activity of >5  107 counts per minute (cpm). 3. Add the appropriate amount of antiserum (1–5 μl) and incubate on ice for 2 h. 4. Add 200 μl of NDL-protein A-bead slurry, and incubate for 60 min at 4
C on a rocking platform (volume: 1 ml). 5. Pellet the immune complexes by centrifugation at 20,000  g for 20 s at 4
C. 6. Discard the supernatant and resuspend the pellets in each 1 ml of NDL buffer. 7. Centrifuge as above and repeat washing of the immune complexes with NDL buffer 3. 8. After the last wash, suspend the pellets in each 600 μl RIPA buffer, incubate overnight on ice, and then shake at 4
C for 2 h using a rotary shaker. 9. Spin samples at 13,000  g for 5 min at 4
C. Transfer the supernatants into fresh tubes. 10. Add each 200 μl RIPA-BSA and the second antibody (1–5 μl) to start the second IP, this time under denaturing conditions.

104

Markus Hartl and Klaus Bister

11. Add the supernatants from the first IP, mix, and incubate on ice for 2 h. 12. Add 200 μl RIPA-protein A-bead slurry. Incubate for 60 min at 4
C on a rocking platform. 13. Pellet the immune complexes by centrifugation at 20,000  g for 20 s at 4
C. 14. Discard the supernatant and resuspend the pellets in 650 μl RIPA buffer. 15. Carefully transfer this suspension onto a cushion of 650 μl RIPA-sucrose. 16. Centrifuge at 13,000  g for 15 min at 4
C. 17. Discard the supernatant and wash pellets with 1 ml RIPA buffer (3) and 1 ml PBS (1). 18. Suspend the pellet in 40 μl 1 SDS gel-loading buffer and incubate at 95
C for 5 min. 19. Centrifuge at 15,000  g for 5 min at RT. 20. Load the supernatant directly onto an SDS-polyacrylamide gel (see Note 14). 21. After gel electrophoresis, desiccate the gel using a gel dryer and detect the [35S]-emitted radiation by fluorography as described [25] using X-ray films. 3.6.2 Detection by Immunoblotting Using ECL

1. Seed each 3–6  106 cells on four 100-mm dishes and incubate for 2 days at 37
C (5% CO2). 2. From the four dishes, prepare lysates under native conditions principally as described above (see Subheading 3.5.2, steps 1– 5) using 1 ml NDL buffer per dish. 3. Determine the protein concentration from 1 μl of the pooled lysates (total volume: 4 ml) by using a NanoDrop spectrophotometer. 4. Reserve aliquots as input controls (0.5–5%) and store at 20
C until needed. 5. Distribute each 1 ml of the lysate (~4 mg total protein) into 1.5-ml reaction tubes. 6. Preclear the lysate by adding each 200 μl of NDL-protein A-bead slurry. Incubate at 4
C at a rotary shaker for 2 h. 7. Centrifuge at 13,000  g for 2 min at 4
C. 8. Transfer the supernatant into a fresh tube and perform IP, binding to protein A Sepharose, and washing as described above (see Subheading 3.6.1, steps 3–7). 9. After the last wash, suspend the pellets in each 100 μl of RIPA buffer.

MYC in Cancer and Evolution

105

10. Pierce a hole into the cap and heat for 2 min at 100
C in a boiling water bath, and then cool on ice for 15 min. 11. Dilute the lysate with 400 μl dilution buffer and mix. 12. Centrifuge at 20,000  g for 30 min at 4
C. Transfer the supernatants into fresh tubes. 13. Proceed as described above with the second IP (see Subheading 3.6.1, steps 10–20). 14. After gel electrophoresis, detect proteins by immunoblot analysis using specific antibodies (see Fig. 2b). 3.7 Analysis of MYC Expression by In Situ Hybridization in Hydra

1. Cultivate the strains Hydra vulgaris or Hydra magnipapillata at 18
C and feed daily with freshly hatched Artemia nauplii. For usage in experiments, collect animals 24 h after the last feeding [19]. 2. For whole mount in situ hybridization with digoxigeninlabeled RNA probes, proceed as described in [19, 21] (see Fig. 3a/b). 3. For in situ hybridizations in single-cell preparations, macerate Hydra as described in [28]. Then fix macerates in paraformaldehyde and hybridize as described in [19].

Fig. 3 Expression of Hydra myc1 and max. (a, b) In situ hybridization showing that myc1 and max are activated in cells belonging to the interstitial stem cell lineage in the gastric region of intact budding polyps. In addition, max is expressed at a lower level in the epithelium throughout the entire body column. (c) Northern analysis using poly(A)+-selected RNAs from whole Hydra animals and myc1 or max specific cDNA probes. Adapted from [19]

106

Markus Hartl and Klaus Bister

3.8 Analysis of MYC Expression by Northern Analysis

1. Grow cells to near confluence and change the medium 1 day prior to RNA isolation. 2. Aspirate the culture medium and wash cells with 5 ml of TS buffer per plate. 3. Aspirate and place the plates in tilted position to remove residual liquid. 4. Spread 2–4 ml GITC buffer per plate onto the cells and agitate plates on a rocking platform to distribute the buffer and to detach the lysed cells. 5. Put the plates in a tilted position and transfer the lysate into a plastic tube. 6. Draw the lysate 3 through a 20-gauge needle to shear the chromosomal DNA. 7. Transfer 4 ml of CsCl buffer into an ultracentrifuge polyallomer tube. 8. Carefully layer 7.5–8 ml cell lysate onto the CsCl-cushion and fill up the tube to 2 mm from the top (see Note 15). Balance the tubes with GITC buffer. 9. Insert tubes into the rotor buckets. Run at (107,000  g) (SW41 rotor) at 21
C for 16–24 h. 10. After the run has been completed, remove both phases by pipetting until approximately 1 ml liquid remains at the bottom of the tube (see Note 16). 11. Quickly invert the tube and let drain all liquid onto a paper towel. 12. Using a sterile scalpel, cut off the bottom of the tube. 13. Dissolve the RNA pellet in 2  200 μl 0.3 M sodium acetate pH 6.0 for 3 min each and transfer into a microcentrifuge tube (see Note 17). 14. Add 1 ml of absolute ethanol, and store at 80
C for 30 min. 15. Centrifuge at 13,000  g for 15 min at 4
C. 16. Wash the pellet in 70% ethanol and dry in a SpeedVac (do not dry to completion!). 17. Dissolve the RNA from ~108 cells in 100 μl H2O. Store the RNA solution at 80
C. 18. Determine the optical densities (OD); for pure RNA, the OD260nm/OD280nm ratio is 2.0. 19. Calculate the RNA concentration by using the correlation 1 OD260 ¼ 40 μg/ml. Yields vary between 0.5 mg and 2 mg of total RNA per 108 cells. 20. For poly(A)+-RNA-selection, fill 100–200 mg oligo dT-powder (for 0.5–5 mg of total RNA) into a 10 ml tube

MYC in Cancer and Evolution

107

and suspend by inverting several times in 5 ml of RNA buffer B. 21. After equilibration for 10 min, fill the suspension into a sterile Econo-chromatography column (0.7  5 cm; 2 ml). 22. Rinse the column with 4 ml of 0.1 M NaOH, 5 mM EDTA. 23. Wash the column with H2O until the pH becomes neutral (check with pH paper). 24. Equilibrate the column with 5 ml of RNA buffer A. 25. Meanwhile, heat the total RNA in a volume of 500 μl at 65
C for 5 min. 26. Add 500 μl RNA buffer A (65
C) to the RNA, mix, and leave at RT for 2 min. 27. Load the RNA solution onto the column, collect the eluate, repeat the heating at 65
C. 28. Reload the RNA as before, then wash the column 5 with 1 ml of RNA buffer B. 29. Elute the poly(A)+ RNA with 2 ml of RNA buffer C. 30. For a second round of poly(A)+-RNA selection, use a column with 50 mg of oligo dT-powder and repeat the procedure as described above. 31. Elute the poly(A)+-selected RNA with 4  450 μl buffer C into four microcentrifuge tubes. 32. To each tube add 50 μl 3 M sodium acetate pH 6.0 and 1 ml absolute ethanol, mix, and store at 80
C for 30 min. 33. Spin at 13,000  g for 20 min at 4
C. 34. Wash the pellets with 70% ethanol and centrifuge as above. 35. Dry the pellets in a SpeedVac and dissolve the poly(A)+ RNA in the appropriate amount of H2O to achieve a concentration of ~1 μg/μl. Store the RNA solution at 80
C. 36. Determine the RNA concentration. The yield after the first selection should be 5–10% from the total RNA (10–20-fold enrichment) and 1–2% after the second selection (50–100-fold enrichment). 37. For RNA gel electrophoresis, prepare a 1% (w/v) agarose/ formaldehyde gel. 38. To 4–8 μl of RNA (30 μg total RNA or 1–5 μg poly(A)+selected RNA dissolved in 4–8 μl H2O), add 16 μl of RNA sample buffer. 39. Heat samples to 65
C for 10 min, centrifuge briefly, add 1 μl of 1 mg/ml EtBr.

108

Markus Hartl and Klaus Bister

40. Load samples onto the gel and run at 30–40 V const. Overnight (500 Vh) in 1 RNA gel running buffer until the bromophenol blue dye has migrated ~10 cm. 41. Photograph the gel with an aligned ruler next to the size marker and cut the gel to an appropriate size (e.g., 15 cm  12 cm). 42. Rinse the gel in deionized water for 5 min to remove the formaldehyde. 43. Equilibrate the gel in 10 SSC for 30 min. 44. Prepare a nylon membrane sheet of the appropriate size and equilibrate first in sterile water for 10 min, then in 10 SSC for 30 min. 45. With a tray and a board prepare a blotting device and fill the tray with 10 SSC. 46. Cut two sheets of Whatman™ paper (20 cm  30 cm), soak them in 10 SSC and create a wick to support the gel. 47. Put the inverted gel onto the device and insulate the area around the gel with Parafilm™. 48. Layer the nylon membrane onto the gel and remove air bubbles with a pipette. 49. Layer three pieces of Whatman™ paper (cut to the gel size and soaked in 10 SSC) onto the membrane and remove air bubbles. 50. Layer paper towels onto the Whatman™ papers and put a 0.5–1 kg-weight onto the top. 51. Transfer for 16–24 h. 52. After the transfer, mark positions of the slots with a ball pen and put the membrane into 500 ml of 2 SSC for 10 min to remove rest of agarose. 53. Bake the membrane wrapped between two sheets of Whatman™ paper in a vacuum oven for 2 h at 80
C. 54. After baking, wrap the blot in aluminum foil and store dark and dry. 55. For detection of transferred RNAs by nucleic acid hybridization [19], pre-hybridize the filter in 100 ml hybridization solution in a plastic tray overnight at 37
C. 56. Boil a radioactive [32P]-labeled DNA probe (pierce a hole into the tube cap) for 5 min in a water bath for denaturation and then chill on ice. 57. After pre-hybridization, transfer the filter into a new tray containing 40 ml hybridization solution and the denatured radiolabeled probe.

MYC in Cancer and Evolution

109

58. Hybridize the filter overnight at 37
C. 59. The next day, wash the filter 3 for 10 min each in washing solution 2 SSC at 37
C. 60. Then wash the filter 3 for 20 min each in washing solution 0.2 SSC at 60
C. 61. Let the filter dry on a Whatman™ paper. Then wrap into a plastic foil and autoradiograph at 80
C using an intensifier screen, or use a phosphor imager (see Figs. 1e and 3c). 3.9 Protein–DNA Interaction Analysis in Hydra by Chromatin Immunoprecipitation (ChIP)

1. Suspend ~100 Hydrae animals in 3.3 ml Hydra solution. 2. Add 90 μl of 36.5% (v/v) formaldehyde to a final concentration of 1% (v/v). 3. Incubate at RT for 30 min on a rocking platform. 4. Add 340 μl (one-tenth vol) of 1.25 M glycine and incubate at RT for 5 min. 5. Pellet the Hydrae by centrifugation at 720  g for 5 min at 4
C. 6. Remove the medium and wash with 5 ml of ice-cold PBS-PI. 7. Resuspend the fixed Hydrae in 5 ml PBS-PI and centrifuge as above. 8. Add 1 ml of SDS-lysis buffer and incubate on ice for 5 min. 9. Thoroughly homogenize by 20 pipetting up and down. 10. Incubate on ice for 30 min and then transfer the lysate (~ 1 ml) into a 2-ml reaction tube. 11. Sonicate at constant 40 W with 25% power for 10 s (Branson sonifier) (see Note 18). 12. Repeat sonication 3–5 keeping the samples and the sonifier tip cooled (see Note 19). The sheared chromatin should have DNA sizes between 0.2 and 1 kbp (see below). 13. Centrifuge the extract at 15,000  g for 10 min at 4
C to pellet cell debris. 14. Save the supernatant (undiluted extract) which can be stored at 80
C. 15. To monitor sonication, mix 4 μl of 5 M NaCl with 100 μl of undiluted extract and incubate at 65
C for 4 h. Recover the liberated DNA by phenol/chloroform extraction and analyze 10-μl, 5-μl, and 2-μl aliquots from the aqueous phase by agarose gel electrophoresis. 16. For the IP, dilute the supernatant (~0.9 ml) in a tenfold vol of ChIP-dilution buffer. 17. Add 410 μl ChIP-elution buffer to 40 μl of diluted extract. Store at 20
C (input sample).

110

Markus Hartl and Klaus Bister

18. For preclearing the lysate, add 75 μl of ChIP-protein A-bead slurry to 1 ml of the sheared and diluted chromatin extract. Incubate at 4
C for 1 h using a rotary shaker. 19. Centrifuge at 1,500  g for 5 min at 4
C. 20. Transfer the precleared supernatant into a fresh 1.5-ml reaction tube and add 2 μl of specific antiserum directed against the relevant recombinant Hydra protein. Include each one reaction with pre-immune serum and without antiserum as a control. 21. Incubate overnight at 4
C using a rotary shaker. 22. Add 75 μl of ChIP-protein A-bead slurry. Incubate at 4
C for 1 h using a rotary shaker. 23. Centrifuge at 1,500  g for 5 min at 4
C. 24. Discard the supernatant and add 1 ml of ChIP-low-salt wash buffer to the pellet. 25. Incubate at 4
C for 5 min using a rotary shaker and centrifuge as above. 26. Wash as above with 1 ml of ChIP-high-salt wash buffer. 27. Wash as above with 1 ml of ChIP-LiCl wash buffer. 28. Wash 2 with each 1 ml of TE buffer. 29. Add 225 μl ChIP-elution buffer to the pellet. Incubate for 15 min at RT using the shaker. 30. Centrifuge at 1,500  g for 5 min at 4
C and recover the supernatant containing the cross-linked chromatin complexes. 31. Repeat the elution and then pool the supernatants resulting in a final volume of 450 μl. 32. Dissociate the cross-linked material (including the input sample) by adding 18 μl of 5 M NaCl to a final concentration of 192 mM and incubate at 65
C for 4 h. Samples can be stored at 20
C at this time. 33. For DNA purification and subsequent analysis, add 9 μl of 0.5 M EDTA, 18 μl 1 M Tris–HCl pH 6.5, and 1.8 μl of a 10 mg/ml proteinase K solution per sample. 34. Incubate for 1 h at 45
C. 35. Add 450 μl ROTI-phenol/chloroform/isoamyl alcohol (25:24:1) and vortex each sample for 1 min (see Note 20). 36. Centrifuge the samples at 13,000  g for 5 min at RT. 37. Transfer the supernatant to a fresh tube containing 450 μl chloroform/isoamyl alcohol (24:1) and repeat the extraction step (see Note 20). 38. Transfer the supernatant to a fresh 1.5-μl reaction tube, and add 50 μl of 3 M sodium acetate pH 5.2, 1 μl of 20 μg/μl glycogen as an inert carrier, 1 ml of absolute ethanol.

MYC in Cancer and Evolution

111

39. Mix and incubate at 80
C for 90 min. 40. Centrifuge the samples at 15,000  g for 30 min. 41. Discard the supernatant carefully and wash the pellet with 1 ml of 70% (v/v) ethanol. 42. Repeat centrifuging for 15 min, discard supernatant, and dry the pellet in a SpeedVac. 43. Resuspend the pellet in 50 μl of sterile H2O and store at 20
C. Use 5–10 μl for the polymerase chain reaction (PCR) (25–35 cycles). Appropriate PCR conditions have to be determined depending on the melting temperatures of primers and template. 44. Visualize PCR products by agarose gel electrophoresis and detect ethidium bromide-stained bands (see Fig. 4a).

Fig. 4 Analysis of MYC-specific protein-DNA interactions in Hydra. (a) The Hydra myc1 promoter region and sequence-specific binding by Hydra Tcf. Upper panel: topography of the Hydra magnipapillata genomic locus containing the Hydra myc1 gene. Exons are depicted by boxes with the coding regions in blue. The myc1 transcription start site (arrow), the binding site for the transcription factor Tcf, and the amplified region covered by chromatin immunoprecipitation (ChIP) primers (bar) are indicated. Lower panel: chromatin immunoprecipitation (ChIP) of the Hydra myc1 promoter region using chromatin from whole Hydra animals. An antiserum directed against Hydra Tcf was used for precipitation, followed by PCR amplification of the indicated fragment from the myc1 regulatory region. Reactions with normal rabbit serum (NRS) or total chromatin (Input) were used as controls. Adapted from [23]. (b) SDS/PAGE of 2-μg (Coomassie brilliant blue staining) or 50-ng (immunoblotting) aliquots of purified recombinant Hydra Myc1 p16, Hydra Max p22, and a 1:1 mixture of both proteins. (c) Electrophoretic mobility shift assay (EMSA) using the recombinant proteins shown in (b) and a [32P]-radiolabeled double-stranded deoxyoligonucleotide containing the MYC/MAX-binding motif 50 -CACGTG-30 . Antibodies were added to the binding reactions as indicated. Adapted from [19]

112

Markus Hartl and Klaus Bister

45. For quantification, apply quantitative (qRT-PCR) as described [29]. 3.10 MYC–DNA Interaction Analysis by Electrophoretic Mobility Shift Assay (EMSA)

real-time

PCR

1. To prepare a [32P]-radiolabeled double-stranded DNA probe, mix each 100 pmol of two single-stranded complementary oligonucleotides (18–22mers), 5 μl 10 annealing buffer, and H2O to 50 μl (DNA concentration: ~ 25 ng/μl). 2. Incubate at 95–100
C in a boiling water bath for 3 min. Then, switch off the heating plate. 3. Leave until the reaction mix has cooled down to RT (~3 h). Store at 20
C. 4. To 75 ng of the annealed DNA, add 1 μl 10 T4 PNK buffer, 3 μl [32P]-γ-ATP (3000 Ci/mmol), H2O to 9 μl, and 1 μl of T4 DNA polynucleotide kinase (PNK). 5. Incubate at 37
C for 1 h. 6. Add 30 μl H2O, 10 μl 5 M LiCl, 200 μl absolute ethanol, mix and store at 80
C for 1 h. 7. Collect the precipitated oligonucleotide by centrifugation at 15,000  g for 30 min at 4
C. 8. Remove supernatant and wash the pellet with 1 ml of 70% (v/v) ethanol. Recover the DNA by centrifugation as above. 9. Remove the supernatant and dry the pellet in a SpeedVac for 5 min at RT. 10. Dissolve the pellet in 50 μl 1 annealing buffer and determine ˇ erenkov activity from 1/100 vol (~0.5–1.0  108 cpm/μg the C DNA). Store the labeled DNA probe at 20
C. 11. For the EMSA reaction, dilute the DNA probe to 10,000 cpm/μl with 1 EMSA buffer resulting into a DNA concentration of 7.5 nM (~0.1 ng/μl). 12. Check the quality and identity of the applied recombinant proteins by SDS polyacrylamide gel electrophoresis and immunoblot analysis (see Fig. 4b). 13. Determine the protein concentration and the molarity of the recombinant protein (e.g., a 1 μg/μl solution of a protein with an Mr of 20,000 has a concentration of 50 μM). 14. Dilute the recombinant protein solution with 1 EMSA buffer to a concentration of 1 μM (20 ng/μl for a protein with an Mr of 20,000). 15. To 5 μl protein solution, add 17.5 μl 1 EMSA buffer, and 2.5 μl DNA probe. The final concentrations are 200 nM for the protein and 0.75 nM for the DNA. 16. To titer the optimal amount of protein, which is required to consume all DNA, set up the same binding reaction using serial

MYC in Cancer and Evolution

113

1:2 dilutions of the 1-μM protein stock solution resulting in final concentrations of 100 nM, 50 nM, 25 nM, etc. 17. Incubate the reactions (final volume: 25 μl) at 25
C for 45 min. 18. The protein concentration [P] necessary to bind to 50% of the applied DNA probe is equivalent to the dissociation constant (Kd) according to Kd ¼ [P]  [DNA]/[P-DNA]. 19. To specify the binding protein, an appropriate antibody (0.5–1 μl) can be included in the reaction (see Note 21). 20. For detection of DNA binding by gel electrophoresis, pour a 5% (w/v) polyacrylamide gel: mix 31.3 ml H2O with 6.7 ml 30% (w/v) acrylamide/0.8% (w/v) bisacrylamide, 2 ml 10 TBE, 250 μl 10% (w/v) APS, and 35 μl TEMED (N,N,N0 ,N0 tetramethylethylenediamine). 21. Cast a vertical gel using 1.5-mm spacers and let polymerize for 1 h. 22. Remove the comb; rinse the slots with 0.5 TBE, and insert the glass plates with the gel into an appropriate gel chamber. As running buffer use 0.5 TBE. 23. Load the samples using a Hamilton syringe. Into an extra slot, fill 25 μl 1 EMSA buffer containing 0.1% (w/v) bromophenol blue (BPB). 24. Electrophorese at constant 20 mA until the BPB dye has passed one-third of the gel (~2 h). 25. Rock the gel for 15 min in 10% (v/v) acetic acid at RT. 26. Put the inverted gel onto a glass plate and drain excess fluid (see Note 22). 27. Layer two sheets of Whatman™ 3MM CHR paper onto the gel and dry for 75 min at 65
C on a gel dryer. 28. Wrap the gel into a plastic foil and autoradiograph at 80
C using an intensifier screen for 2–16 h (see Fig. 4c). For quantification of radioactive signals, use a phosphor imager.

4

Notes 1. The first decantation of the cell suspension may be difficult because of high viscosity. If necessary, do not decant the entire supernatant to avoid transferring cell clumps. During the next extraction steps, the viscosity of the cell suspension becomes lower. 2. Check complete detachment of the trypsinized cells under a microscope.

114

Markus Hartl and Klaus Bister

3. After seeding, carefully move the dishes in horizontal and vertical directions to distribute the cells evenly on the surface. Do not swivel the dishes circularly! Repeat the rocking every 30 min until all cells are attached to the dish (~2 h) to avoid that most of the cells settle in the middle of the dish resulting in uneven cell distribution. 4. After the medium change, check cell viability under the microscope. Cells may look slightly different after this procedure but they will recover soon. 5. Use a 1000-μl pipetman with an attached blue tip to transfer this small volume of the cell suspension (50–100 μl) onto the MP-12 well. 6. To ensure that each of the four MP-12 wells receives an equal volume of transfection cocktail, you may want to distribute only 240 μl instead of 250 μl per well. 7. Boiling of agar or agarose preparations in a microwave oven requires special care. Wear safety glasses! Check that the agar has been completely dissolved and transfer the hot glass vessel into the 45
C water bath. Agar clumps in the overlay disturb the transparency and make scoring of foci or colonies difficult. 8. To ensure a complete transfer of the lysate, use a 1000-μl pipetman with an attached blue tip and wipe the viscous lysate in a rotating motion along the dish. 9. Do not touch the cell layer with the spatula. Agar remnants are washed off with water. 10. Pasteur pipets which have a ~30
kink, approximately 1 cm apart from the tip, are favorable because foci are then easier to detach from the dish. To produce such a device, hold a pipet into the tip of a Bunsen burner flame and wait until the glass melts locally. Then, immediately remove the pipet from the flame, let it cool, and sterilize. 11. Use a flexible polyethylene tube attached with one end to the narrow site of a blue tip. Fill the tip with a cotton plug and use this inverted tip as a mouthpiece. The other end of the tube becomes attached to the kinked Pasteur pipette. 12. Use a sterile rubber policeman to scrape the radioactive lysate from the dish. Afterwards, decontaminate the scraping device by submerging it in a 1% (w/v)-SDS solution for several days. 13. For equilibration, suspend Sepharose beads in 1 ml of the appropriate buffer. Centrifuge at 5,000  g for 2 min. Discard the supernatant. 14. Avoid that material from the Sepharose pellet is loaded onto the SDS-polyacrylamide gel. 15. Consider the maximal loading capacity per ultracentrifuge tube (lysate from 108 cells).

MYC in Cancer and Evolution

115

16. Change the tip when you enter the CsCl-phase. Try to remove any suspended precipitates of DNA or proteins before inverting the tube. 17. Pipet up and down several times to dissolve the RNA pellet completely. 18. The tip of the ultrasonic device should be immersed as close as possible towards the bottom of the tube but not touch it. Otherwise, foam could be generated by the sonication which makes subsequent pipetting difficult. 19. The optimal number of sonication cycles depends on the cellular material and can be determined in a pilot experiment with subsequent analysis of the chromatin fragment sizes obtained after various cycles of sonication. 20. It is important to remove the upper aqueous phases as accurately as possible for quantitative recovery of the released DNA fragments. 21. Addition of specific antibodies directed against the DNA-binding protein may either lead to a ternary antibody– protein–DNA complex with lower gel electrophoretic mobility, or to inhibition of DNA binding. The latter is usually observed when the epitope of the antibody is localized in the DNA-binding domain of the protein. 22. Remove the upper glass plate and leave the gel on the lower one. Submerge plate with attached gel in acetic acid solution. After fixing, use the upper glass plate to invert the gel.

Acknowledgments This work was supported by Austrian Science Fund (FWF) grant P23652 (to K.B.), and by the Tyrolean Science Fund (TWF) grant UNI-0404/688 (to M.H.). References 1. Duesberg PH, Bister K, Vogt PK (1977) The RNA of avian acute leukemia virus MC29. Proc Natl Acad Sci U S A 74(10):4320–4324. https://doi.org/10.1073/pnas.74.10.4320 2. Bister K, Hayman MJ, Vogt PK (1977) Defectiveness of avian myelocytomatosis virus MC29: isolation of long-term nonproducer cultures and analysis of virus-specific polypeptide synthesis. Virology 82(2):431–448. https://doi.org/10.1016/0042-6822(77) 90017-4 3. Bister K, Jansen HW (1986) Oncogenes in retroviruses and cells: biochemistry and

molecular genetics. Adv Cancer Res 47:99–188. https://doi.org/10.1016/s0065230x(08)60199-2 4. Bister K (2012) MC29 avian myelocytomatosis virus. In: Maloy S, Hughes K (eds) Brenner’s encylopedia of genetics, vol 4, 2nd edn. Academic Press, San Diego, pp 330–332 5. Eilers M, Eisenman RN (2008) Myc’s broad reach. Genes Dev 22(20):2755–2766. https:// doi.org/10.1101/gad.1712408 6. Conacci-Sorrell M, McFerrin L, Eisenman RN (2014) An overview of MYC and its interactome. Cold Spring Harb Perspect Med 4(1):

116

Markus Hartl and Klaus Bister

a014357. https://doi.org/10.1101/ cshperspect.a014357 7. Stefan E, Bister K (2017) MYC and RAF: key effectors in cellular signaling and major drivers in human cancer. Curr Top Microbiol Immunol 407:117–151. https://doi.org/10.1007/ 82_2017_4 8. Dang CV (2012) MYC on the path to cancer. Cell 149(1):22–35. https://doi.org/10. 1016/j.cell.2012.03.003 9. Stine ZE, Walton ZE, Altman BJ, Hsieh AL, Dang CV (2015) MYC, metabolism, and cancer. Cancer Discov 5(10):1024–1039. https:// doi.org/10.1158/2159-8290.CD-15-0507 10. Nesbit CE, Tersak JM, Prochownik EV (1999) MYC oncogenes and human neoplastic disease. Oncogene 18(19):3004–3016. https://doi. org/10.1038/sj.onc.1202746 11. Gabay M, Li Y, Felsher DW (2014) MYC activation is a hallmark of cancer initiation and maintenance. Cold Spring Harb Perspect Med 4(6):a014241. https://doi.org/10.1101/ cshperspect.a014241 12. Tokheim CJ, Papadopoulos N, Kinzler KW, Vogelstein B, Karchin R (2016) Evaluating the evaluation of cancer driver genes. Proc Natl Acad Sci U S A 113(50):14330–14335. https://doi.org/10.1073/pnas.1616440113 13. Nair SK, Burley SK (2003) X-ray structures of Myc-max and mad-max recognizing DNA. Molecular bases of regulation by protooncogenic transcription factors. Cell 112 (2):193–205. https://doi.org/10.1016/ s0092-8674(02)01284-9 14. Wolf E, Lin CY, Eilers M, Levens DL (2015) Taming of the beast: shaping Myc-dependent amplification. Trends Cell Biol 25 (4):241–248. https://doi.org/10.1016/j.tcb. 2014.10.006 15. Dang CV (2014) Gene regulation: fine-tuned amplification in cells. Nature 511 (7510):417–418. https://doi.org/10.1038/ nature13518 16. Rahl PB, Young RA (2014) MYC and transcription elongation. Cold Spring Harb Perspect Med 4(1):a020990. https://doi.org/ 10.1101/cshperspect.a020990 17. Gallant P, Shiio Y, Cheng PF, Parkhurst SM, Eisenman RN (1996) Myc and Max homologs in Drosophila. Science 274 (5292):1523–1527. https://doi.org/10. 1126/science.274.5292.1523 18. Orian A, van Steensel B, Delrow J, Bussemaker HJ, Li L, Sawado T, Williams E, Loo LW, Cowley SM, Yost C, Pierce S, Edgar BA, Parkhurst SM, Eisenman RN (2003) Genomic binding by the Drosophila Myc, Max,

Mad/Mnt transcription factor network. Genes Dev 17(9):1101–1114. https://doi. org/10.1101/gad.1066903 19. Hartl M, Mitterstiller AM, Valovka T, Breuker K, Hobmayer B, Bister K (2010) Stem cell-specific activation of an ancestral myc protooncogene with conserved basic functions in the early metazoan Hydra. Proc Natl Acad Sci U S A 107(9):4051–4056. https:// doi.org/10.1073/pnas.0911060107 20. Young SL, Diolaiti D, Conacci-Sorrell M, Ruiz-Trillo I, Eisenman RN, King N (2011) Premetazoan ancestry of the Myc-Max network. Mol Biol Evol 28(10):2961–2971. https://doi.org/10.1093/molbev/msr132 21. Hartl M, Glasauer S, Valovka T, Breuker K, Hobmayer B, Bister K (2014) Hydra myc2, a unique pre-bilaterian member of the myc gene family, is activated in cell proliferation and gametogenesis. Biol Open 3(5):397–407. https://doi.org/10.1242/bio.20147005 22. Hartl M, Puglisi K, Nist A, Raffeiner P, Bister K (2020) The brain acid-soluble protein 1 (BASP1) interferes with the oncogenic capacity of MYC and its binding to calmodulin. Mol Oncol 14(3):625–644. https://doi.org/10. 1002/1878-0261.12636 23. Hartl M, Glasauer S, Gufler S, Raffeiner A, Puglisi K, Breuker K, Bister K, Hobmayer B (2019) Differential regulation of myc homologs by Wnt/beta-catenin signaling in the early metazoan Hydra. FEBS J 286 (12):2295–2310. https://doi.org/10.1111/ febs.14812 24. Raffeiner P, Schraffl A, Schwarz T, Ro¨ck R, Ledolter K, Hartl M, Konrat R, Stefan E, Bister K (2017) Calcium-dependent binding of Myc to calmodulin. Oncotarget 8(2):3327–3343. https://doi.org/10.18632/oncotarget.13759 25. Hartl M, Nist A, Khan MI, Valovka T, Bister K (2009) Inhibition of Myc-induced cell transformation by brain acid-soluble protein 1 (BASP1). Proc Natl Acad Sci U S A 106 (14):5604–5609. https://doi.org/10.1073/ pnas.0812101106 26. Hart JR, Garner AL, Yu J, Ito Y, Sun M, Ueno L, Rhee JK, Baksh MM, Stefan E, Hartl M, Bister K, Vogt PK, Janda KD (2014) Inhibitor of MYC identified in a Kro¨hnke pyridine library. Proc Natl Acad Sci U S A 111 (34):12556–12561. https://doi.org/10. 1073/pnas.1319488111 27. Raffeiner P, Ro¨ck R, Schraffl A, Hartl M, Hart JR, Janda KD, Vogt PK, Stefan E, Bister K (2014) In vivo quantification and perturbation of Myc-Max interactions and the impact on oncogenic potential. Oncotarget 5

MYC in Cancer and Evolution (19):8869–8878. https://doi.org/10.18632/ oncotarget.2588 28. David CN, MacWilliams H (1978) Regulation of the self-renewal probability in Hydra stem cell clones. Proc Natl Acad Sci U S A 75 (2):886–890. https://doi.org/10.1073/pnas. 75.2.886

117

29. Valovka T, Scho¨nfeld M, Raffeiner P, Breuker K, Dunzendorfer-Matt T, Hartl M, Bister K (2013) Transcriptional control of DNA replication licensing by Myc. Sci Rep 3:3444. https://doi.org/10.1038/srep03444

Chapter 7 Genome-Wide Analysis of c-MYC-Regulated mRNAs and miRNAs and c-MYC DNA-Binding by Next-Generation Sequencing Rene Jackstadt, Markus Kaller, Antje Menssen, and Heiko Hermeking Abstract The c-MYC oncogene is activated in ~50% of all tumors and its product, the c-MYC transcription factor, regulates numerous processes, which contribute to tumor initiation and progression. Therefore, the genome-wide characterization of c-MYC targets and their role in different tumor entities is a recurrent theme in cancer research. Recently, next-generation sequencing (NGS) has become a powerful tool to analyze mRNA and miRNA expression, as well as DNA binding of proteins in a genome-wide manner with an extremely high resolution and coverage. Since the c-MYC transcription factor regulates mRNA and miRNA expression by binding to specific DNA elements in the vicinity of promoters, NGS can be used to generate integrated representations of c-MYC-mediated regulations of gene transcription and chromatin modifications. Here, we provide protocols and examples of NGS-based analyses of c-MYC-regulated mRNA and miRNA expression, as well as of DNA binding by c-MYC. Furthermore, we describe the validation of single c-MYC targets identified by NGS. Taken together, these approaches allow an accelerated and comprehensive analysis of c-MYC function in numerous cellular contexts. Ultimately, these analyses will further illuminate the role of this important oncogene. Key words c-MYC/MYC, Chromatin immunoprecipitation (ChIP), mRNA, microRNA (miRNA), Next-generation sequencing (NGS), Transcriptional regulation, Target genes

1

Introduction The protein product of the proto-oncogene c-MYC is a transcription factor, which is involved in a broad range of cellular processes, such as cell cycle progression, cell growth, cell motility, metabolism, metastasis, pluripotency, and vascularization, which have been implicated in the initiation and progression of tumors [1, 2]. In tumors, c-MYC expression can be induced via several mechanisms: e.g., chromosomal translocations [3], amplification [4], loss of auto-regulation [5], increased translation of c-MYC mRNA [5, 6], stabilizing mutations [7, 8], and activating mutations in upstream regulators such as the Wnt signaling in colorectal cancer

Laura Soucek and Jonathan Whitfield (eds.), The Myc Gene: Methods and Protocols, Methods in Molecular Biology, vol. 2318, https://doi.org/10.1007/978-1-0716-1476-1_7, © Springer Science+Business Media, LLC, part of Springer Nature 2021

119

120

Rene Jackstadt et al.

[9–11]. In most cases, these alterations lead to constitutive expression of the c-MYC protein, which is normally under strict control, as its expression is restricted to mitogenic responses. As a failsafe mechanism against aberrant proliferation, deregulated c-MYC expression leads to the activation of the transcription factor p53, either by replicative stress or by induced DNA damage in human cells and by the ARF pathway in murine cells, resulting in apoptosis and/or senescence [12–15]. In addition, c-MYC has been shown to suppress an intrinsic senescence program, which depends on the induction of htert, CDK2, and the WRN genes by c-MYC (reviewed in [16]). We have shown that the activation of the NAD-dependent deacetylase SIRT1 activity by direct induction of the NAMPT (Nicotinamid-phosphoribosyl-transferase) gene by c-MYC contributes to the suppression of senescence [17]. Activated SIRT1 inactivates pro-apoptotic and senescence-mediating substrates, such as p53, by deacetylation. c-MYC belongs to the basic-helix-loop-helix-leucine-zipper (bHLH-LZ) transcription factor family. The C-terminus of c-MYC harbors a HLH-LZ motif, which mediates the heterodimerization with the bHLH-LZ transcription factor MAX. The basic regions of the c-MYC/MAX heterodimer mediate the DNA binding to the consensus E-Box sequence CA(C/T)GTG [18]. The N-terminus of c-MYC encompasses two evolutionary conserved regions, MycBox I and II, which act as transactivation domains. Upon DNA binding, the c-MYC/MAX heterodimer recruits cofactors, which mediate multiple effects of c-MYC on gene expression in a context-dependent manner [19]. So far, chromatin modifications, histone phosphorylation, transcriptional silencing, promoter clearance [20], and transcriptional elongation [21] have been described as consequences of c-MYC action at promoters. Besides with c-MYC, MAX may heterodimerize with MAD, Mxi1, and Mnt, which thereby antagonize c-MYC function [22, 23]. Whereas direct E-Box binding of MYC/MAX heterodimers generally mediates the induction of c-MYC target gene transcription, repression by c-MYC is often dependent on MYC/MAX/Miz1 complexes binding to initiator (Inr) elements [24–27]. This element consists of 17 bp pyrimidine-rich motifs, which mediate transcriptional initiation from TATA-less promoters [28]. Several hundred c-MYC-regulated genes were identified based on microarray screens and other genome-wide techniques, such as SAGE and ChIP arrays, reviewed in [29]. However, the design of the initial genome-wide analyses does not allow a distinction between direct and indirect c-MYC targets. The latter may be mediated by the c-MYC regulation of other transcription factors, such as E2F1, which is activated after c-MYC activation. In order to comprehensively identify direct c-MYC target genes, the expression analyses of mRNAs and miRNAs should be accompanied by the determination of genome-wide c-MYC-DNA binding via

NGS Analyses of c-MYC

121

Fig. 1 Experimental outline of NGS-based analyses of c-MYC targets. After the activation or inactivation of c-MYC in different biological systems, the expression of c-MYC-regulated mRNAs and miRNAs, and the genome binding is analyzed in a genome-wide manner by next-generation sequencing. The identified c-MYC targets are analyzed in multiple assays to confirm direct regulation by c-MYC, putative cell system/type dependence of the regulation and concomitant protein expression changes, before functional analyses may reveal their relevance for c-MYC-regulated cellular processes

chromatin immunoprecipitation (ChIP) (Fig. 1). The ChIP technique allows to study c-MYC binding in the cellular context of chromatin. ChIP has replaced several techniques, such as the electrophoretic mobility shift assay (EMSA) and luciferase reporter assays, which were used to detect and map DNA binding by transcription factors. ChIP followed by genome-wide analyses of enriched DNA fragments by next-generation sequencing (ChIPSeq) generates a comprehensive, genome-wide picture of c-MYCregulated target genes. Several genome-wide studies identified genes, which show binding of c-MYC in the vicinity of the promoter region and concomitant regulation of the corresponding mRNA [29, 30]. Depending on the cell type and endogenous c-MYC expression levels, these studies demonstrated that 7.8–10.4% of those genes, which had previously been reported to be regulated by c-MYC, are indeed bound by it and that c-MYC binds to 10–15% of all cellular genes [29, 31–39]. On the basis of NGS analyses, several studies demonstrated that c-MYC can act locally as well as globally on chromatin, by binding to intra- and intergenic regions via several thousand E-boxes (reviewed in [18, 40–42]). Presumably, global effects of c-MYC on chromatin states also contribute to the regulation of processes and states, such as stem cell self-renewal and pluripotency. Moreover, c-MYC has been described as a global amplifier of transcription through the release of RNA Pol II pausing via recruitment of transcription elongation factor P-TEFb [43, 44]. However, the MYC-mediated global increase in RNA transcription appears to be accompanied by a more pronounced differential regulation of distinct subsets of

122

Rene Jackstadt et al.

mRNAs which has been explained by differential MYC-binding site affinity at the promoters of different subsets of MYC-regulated genes [45–47]. In order to compare mRNA/miRNA expression and ChIP-Seq results with previously published genome-wide analyses, two comprehensive databases can be used. The MYC homepage (http://www.myccancergene.org/site/about.asp) contains an extensive list of genes shown to be responsive to c-MYC [48], and the UCSC genome-browser (http://genome.ucsc.edu/) also includes the results of several ChIP-Seq studies of c-MYC DNA binding performed in different cell lines. The latter NGS datasets can be analyzed online and compared with patterns of chromatin modification and binding of other transcription factors in a genome-wide manner. MicroRNAs (miRNAs), represent a class of small ~21-nucleotide-long, noncoding RNAs and have been implicated in cancer and may function as oncogenes or tumor suppressor genes [49]. miRNAs regulate the expression of target mRNAs by inhibiting their translation and/or mediating mRNA degradation. Several miRNA encoding genes were shown to be regulated by c-MYC [1, 50– 55]. The regulation of miRNAs by c-MYC represents another important mode by which c-MYC regulates the expression of target genes and influences numerous biological processes. The integration of genome-wide miRNA and mRNA expression data with binding profiles of c-MYC enables scientists to gain a deeper insight into the regulatory networks by which c-MYC exerts oncogenic functions. Besides the direct binding in the vicinity of the promoter of a cMYC-regulated gene, encoding a protein, an miRNA, or other noncoding RNAs, some additional criteria should be fulfilled for a bona fide c-MYC target gene [56]. It should be demonstrated that expression of the target gene mRNA is induced after activation of a conditional c-MycER (estrogen receptor) fusion protein by addition of 4-hydroxy-tamoxifen (4-OHT) [57] in the presence of a de novo protein-synthesis inhibitor cycloheximide. Thereby, gene regulations mediated indirectly through c-MYC-regulated factors such as by miRNAs or other transcription factors can be ruled out [58]. Since the expression systems used for ectopic expression of c-MYC often induce supranormal levels of c-MYC expression, they may generate artificial gene regulations. Therefore, such studies should be complemented by loss-of-function approaches. For example, inducible expression of c-MYC-specific shRNAs or transfection of siRNAs can be used to specifically downregulate the expression and activity of endogenous c-MYC. Alternatively, direct c-MYC targets can be confirmed by comparing RAT1 cell lines with wild-type and deleted c-MYC alleles upon stimulation of quiescent fibroblasts with mitogens [59]. The requirement of the new target gene for c-MYC-mediated biological functions is interrogated usually by experimental inactivation of the respective candidate gene.

NGS Analyses of c-MYC

123

NGS-based approaches have several advantages when compared to the microarray-based approaches. First, due to the superior dynamic range of NGS, a typical analysis is likely to represent transcripts, which are expressed at very low levels, with a few reads, up to highly expressed genes represented by millions of reads. Second, the number of transcripts, which can be detected, is not limited to previously known mRNAs, as in the case of microarrays. Currently, only the unbiased genome-wide NGS analyses covering all expressed exons allow the discovery of rare or novel transcripts and alternative splicing. Consequently, recent years have seen a massive increase in publicly available RNA-Seq data compared to microarray data, for instance, at the Gene Expression Omnibus (GEO)/Sequence Read Archive (SRA) [60–62]. Several NGS platforms are currently available, which use different approaches for sequencing (reviewed in [63, 64]). The most commonly used ones include the HiSeq 1 (Illumina2), SOLID (Applied Biosystems), and Ion torrent (Life Technologies) systems. For further discussion of these platforms see [63–67]. Of note, the majority of RNA-Seq data deposited at the Sequence Read Archive is generated using the Illumina short-read sequencing technology [61, 62, 64]. In this protocol collection, we will focus on approaches that employ the HiSeq platform offered by Illumina, which is one of the most frequently used NGS platforms. A typical workflow starts with the generation of a library from randomly fragmented DNA or cDNA obtained from the input material via ligation of adapter oligonucleotides. The adapterligated fragments are then PCR amplified and gel-purified. The library is then loaded onto the flow cell, where the fragments are bound to oligonucleotides complementary to the adapter sequences. Bound fragments are then clonally amplified through bridge amplification to generate distinct clusters. Subsequently, these clonal clusters are sequenced via sequencing-by-synthesis (SBS) chemistry using a universal primer complementary to the free ends of the templates and fluorophore-labeled, terminally blocked nucleotides. The nucleotides incorporated into each cluster are determined by digital imaging of the flow cell [63, 64]. By now most of the larger research institutions provide core facilities, which use, for example, the Illumina HiSeq 2000 (or higher) platform, or similar devices from other companies. These allow to obtain up to 2.5–5 billion (HiSeq 4000) reads per run. Since one sample is sufficiently covered by 10–30 million reads, single runs are generally used to analyze several samples by using adapters with specific barcodes for each sample. In addition, smaller NGS devices (such as MiSeq3, Illumina) with an output of ~15 million reads per run are available. In the following sections, detailed protocols for the analysis of c-MYC-mediated gene regulation by NGS are provided.

124

2 2.1

Rene Jackstadt et al.

Materials RNA-Seq

Materials not listed in this section are supplied with the Illumina TruSeq4 RNA Sample Prep Kit. 1. 1.5 ml RNase/DNase-free non-sticky tubes (Ambion). 2. 10 μl multichannel pipettes. 3. 10 μl barrier pipette tips. 4. 10 μl single channel pipettes. 5. 100% ethanol. 6. 200 μl multichannel pipettes. 7. 200 μl barrier pipette tips. 8. 200 μl single channel pipettes. 9. RNA extraction kit. 10. Agilent Technologies 2100 Bioanalyzer. 11. Agencourt AMPure XP 60 ml kit (Beckman Coulter Genomics). 12. RNase/DNase zapper (to decontaminate surfaces). 13. Freshly prepared 80% ethanol. 14. Microseal “B” adhesive seals (BioRad). 15. RNase/DNase-free reservoirs.

disposable

multichannel

reagent

16. RNase/DNase-free strip tubes and caps. 17. SuperScript II Reverse Transcriptase (Invitrogen). 18. 10 mM Tris–HCl, pH 8.5 with 0.1% Tween 20, or QIAGEN EB Buffer (general lab supplier, or QIAGEN). 19. Ultrapure water. 2.2

miRNA-Seq

Materials not listed in this section are supplied in the Illumina Small RNA Sample Prep Kit. 1. 1 μg Total RNA in 5 μl nuclease-free water. 2. 3 M NaOAc, pH 5.2. 3. 5 μm filter tube. 4. 5
Novex TBE buffer. 5. 6% Novex TBE PAGE gel, 1.0 mm, 10 well. 6. 200 μl, clean, nuclease-free PCR tubes. 7. Clean scalpels. 8. DNA 1000 chip Agilent. 9. DNA loading dye.

NGS Analyses of c-MYC

125

10. 100% ethanol, 15  C to 25  C. 11. 70% ethanol, room temperature. 12. Gel breaker tubes. 13. High-sensitivity DNA chip. 14. SuperScript II reverse transcriptase with 100 mM DTT and 5
first strand. 15. T4 RNA Ligase 2. 16. 10 mg/ml ultrapure ethidium bromide. 17. Agilent Technologies 2100 Bioanalyzer. 2.3

ChIP-Seq

2.3.1 ChIP

1. 1 M glycine in ddH2O. 2. Triton dilution buffer: 100 mM Tris-Cl pH 8.6, 100 mM NaCl, 5 mM EDTA pH 8.0, 0.2% NaN3, 5% Triton X-100. 3. SDS buffer: 50 mM Tris pH 8.1, 0.5% SDS, 100 mM NaCl, 5 mM EDTA. 4. Immunoprecipitation (IP) buffer: Mix 1 part of Triton X-100 dilution buffer and 2 parts SDS buffer. 5. LiCl/detergent wash: 0.5% (w/v) deoxycholic acid (sodium salt), 1 mM EDTA, 250 mM LiCl, 0.5% (v/v) NP-40, 10 mM Tris-Cl pH 8.0, 0.2% NaN3. 6. Buffer 500: 0.1% (w/v) deoxycholic acid, 1 mM EDTA, 50 mM HEPES pH 7.5, 500 mM NaCl, 1% (v/v) Triton X-100, 0.2% NaN3. 7. Blocked beads: 50% slurry protein A-Sepharose (Amersham; for polyclonal antibodies) or protein G-Sepharose (Sigma; for monoclonal antibodies). 8. 0.5 mg/ml fatty acid-free BSA (Sigma). 9. 0.2 mg/ml salmon sperm DNA (subjected to 8 sonication cycles; Promega). 10. 37% formaldehyde stock. 11. Mixed micelle buffer: 150 mM NaCl, 20 mM Tris-Cl pH 8.1, 5 mM EDTA, pH 8.0, 5.2% w/v sucrose, 0.02% NaN3, 1% Triton X-100, 0.5% SDS. 12. Elution buffer: 10 mM EDTA, 1% (w/v) SDS, 50 mM Tris/ HCL pH 8.0. 13. Protease inhibitors: Complete mini with EDTA (Roche). 14. 1
TBS: 1.5 M NaCl, 0.1 M Tris–HCl, pH 7.4 at 4  C. 15. 1
PBS: 1
13.7 mM NaCl, 2.7 mM KCl, 80.9 mM Na2HPO4, 1.5 mM KH2PO4, pH 7.4.

126

Rene Jackstadt et al.

2.3.2 ChIP-Seq Library Generation

Materials not listed in this section are supplied in the Illumina ChIP-Seq Sample Prep Kit. 1. QIAquick PCR Purification Kit (QIAGEN). 2. MinElute PCR Purification Kit (QIAGEN). 3. QIAquick Gel Extraction Kit (QIAGEN). 4. Ethidium bromide. 5. 1
TAE buffer: 40 mM Tris-acetate; 1 mM EDTA pH 8.0. 6. 2% agarose gel with TAE. 7. 100 bp DNA ladder. 8. DNA loading buffer. 9. Fast SYBR Green master mix (Ambion). 10. Light Cycler 480 (Roche).

3 3.1

Methods RNA-Seq

3.1.1 mRNA Library Preparation Quality and Quantity Control of Total RNA Input

(According to the manufacturer’s protocol, Illumina Part # 15008136 Rev. A)

This protocol is optimized for 0.1–4 μg of total RNA (see Note 1). In-line controls are available for this protocol to confirm every single step in the final sequencing and support potential trouble shooting. The use of appropriate RNA samples is essential for optimal NGS results. RNA can be obtained using different kits (see Note 2) and RNA quality control using an Agilent Bioanalyzer or similar devices should be performed. The RNA Integrity Number (RIN) value should be equal or greater than eight (see Note 3). In addition, the regulation of previously described c-MYC target genes, which are expected to be regulated in the employed biological system, should be confirmed by RT-qPCR with the same RNA samples also used for generating the NGS libraries.

mRNA Purification and Fragmentation

1. Dilute the total RNA (0.1–4 μg per sample) with nuclease-free ultrapure water to a final volume of 50 μl in a 96-well 0.3 ml PCR plate with the RNA-Bead-Plate (RBP) barcode label.

RNA Bead Plate Preparation, Washing, and Elution

2. Vortex the thawed RNA Purification Beads tube vigorously to completely resuspend the oligo-dT beads. 3. Add 50 μl of RNA Purification Beads to each well of the RBP plate using a multichannel pipette to bind the poly-A RNA to the oligo-dT magnetic beads. Gently pipette the entire volume up and down six times to mix thoroughly. Change the tips after each column.

NGS Analyses of c-MYC

127

4. Seal the RBP plate with a Microseal “B” adhesive seal. 5. Place the RBP plate on the magnetic stand (provided with the kit) at room temperature for 5 min to separate the poly-A RNA bound beads from the solution. 6. Remove the adhesive seal from the RBP plate. 7. While leaving the plate on the magnet, remove and discard all the supernatant from each well of the RBP plate using a multichannel pipette. Take care not to disturb the beads. Change the tips after each column. 8. Remove the RBP plate from the magnetic stand. 9. Wash the beads by adding 200 μl of bead washing buffer in each well of the RBP plate using a multichannel pipette to remove unbound RNA. Gently pipette the entire volume up and down six times to mix thoroughly. Change the tips after each column. 10. Place the RBP plate on the magnetic stand at room temperature for 5 min. 11. Briefly centrifuge the thawed elution buffer to 600
g for 5 s. 12. Remove and discard all the supernatant from each well of the RBP plate using a multichannel pipette. Take care not to disturb the beads. Change the tips after each column. 13. Remove the RBP plate from the magnetic stand. 14. Add 50 μl of elution buffer in each well of the RBP plate using a multichannel pipette. Gently pipette the entire volume up and down six times to mix thoroughly. Change the tips after each column. 15. Seal the RBP plate with a Microseal “B” adhesive seal. 16. Store the elution buffer tube at 4  C. 17. Place the sealed RBP plate on the preprogrammed thermal cycler. Close the lid and select mRNA elution 1 (80  C for 2 min, 25  C hold) to elute the mRNA from the beads. Remove the RBP plate from the thermal cycler when it reaches 25  C. 18. Place the RBP plate on the bench at room temperature and remove the adhesive seal from the plate. Generation/Incubation of RNA Fragmentation Plate (RFP)

1. Add 50 μl of Bead Binding Buffer to each well of the RBP plate using a multichannel pipette to allow the RNA to rebind to the beads. Gently pipette the entire volume up and down six times to mix thoroughly. Change the tips after each column. 2. Incubate the RBP plate at room temperature for 5 min and store the Bead Binding Buffer tube at 2–8  C.

128

Rene Jackstadt et al.

3. Place the RBP plate on the magnetic stand at room temperature for 5 min. 4. Remove and discard all of supernatant from each well of the RBP plate using a multichannel pipette. Take care not to disturb the beads. Change the tips after each column. 5. Remove the RBP plate from the magnetic stand. 6. Wash the beads by adding 200 μl of Bead Washing Buffer in each well of the RBP plate using a multichannel pipette. Gently pipette the entire volume up and down six times to mix thoroughly. Change the tips after each column. 7. Store the Bead Washing Buffer tube at 2–8  C. 8. Place the RBP plate on the magnetic stand at room temperature for 5 min. 9. Remove and discard all of the supernatant from each well of the RBP plate using a multichannel pipette. Take care not to disturb the beads. Change the tips after each column. 10. Remove the RBP plate from the magnetic stand. 11. Add 19.5 μl of Elute, Prime, Fragment Mix to each well of the RBP plate using a multichannel pipette. Gently pipette the entire volume up and down six times to mix thoroughly. Change the tips after each column. The Elute, Prime, Fragment Mix contains random hexamers for RT priming and serves as the first strand cDNA synthesis reaction buffer. 12. Seal the RBP plate with a Microseal “B” Adhesive seal. 13. Store the Elute, Prime, Fragment Mix tube at 15  C to 25  C. 14. Place the sealed RBP plate on the preprogrammed thermal cycler. Close the lid and run (94  C for 8 min, 4  C hold) to elute, fragment, and prime the RNA. 15. Remove the RBP plate from the thermal cycler when it reaches 4  C and centrifuge briefly. 16. Proceed immediately to synthesize first strand cDNA. First Strand cDNA Synthesis

1. Place the RBP plate on the magnetic stand at room temperature for 5 min. Do not remove the plate from the magnetic stand. 2. Remove the adhesive seal from the RBP plate. 3. Transfer 17 μl of the supernatant (fragmented and primed mRNA) from each well of the RBP plate to the corresponding well of the new 0.3 ml PCR plate labeled with the cDNA plate (CDP) barcode. Some liquid may remain in each well. 4. Briefly centrifuge the thawed First Strand Master Mix to 600
g for 5 s.

NGS Analyses of c-MYC

129

5. Add 50 μl SuperScript II to the First Strand Master Mix tube (ratio: 1 μl SuperScript II for each 7 μl First Strand Master Mix). Mix gently, but thoroughly, and centrifuge briefly. Label the First Strand Master Mix tube to indicate that the SuperScript II has been added. 6. Add 8 μl of First Strand Master Mix and SuperScript II mix to each well of the CDP plate using a multichannel pipette. Gently pipette the entire volume up and down six times to mix thoroughly. Change the tips after each column. 7. Seal the CDP plate with a Microseal “B” adhesive seal and centrifuge briefly. 8. Return the First Strand Master Mix tube back to 15  C to 25  C storage immediately after use. 9. Incubate the CDP plate on the thermal cycler, with the lid closed, using the following program: l

25  C for 10 min.

l

42  C for 50 min.

l

70  C for 15 min.

l

Hold at 4  C.

10. When the thermal cycler reaches 4  C, remove the CDP plate from the thermal cycler and proceed immediately to synthesize second strand cDNA. Second Strand Synthesis

1. Briefly centrifuge the thawed Second Strand Master Mix to 600
g for 5 s. 2. Remove the adhesive seal from the CDP plate. 3. Add 25 μl of thawed Second Strand Master Mix to each well of the CDP plate using a multichannel pipette. Gently pipette the entire volume up and down six times to mix thoroughly. Change the tips after each column. 4. Seal the CDP plate with a Microseal “B” adhesive seal. 5. Incubate the CDP plate on the preheated thermal cycler, with the lid closed, at 16  C for 1 h. 6. Remove the CDP plate from the thermal cycler, remove the adhesive seal, and let stand to bring the plate to room temperature.

cDNA Cleanup

1. Vortex the AMPure XP beads until they are well dispersed, then add 90 μl of well-mixed AMPure XP beads to each well of the CDP plate containing 50 μl of ds cDNA. Gently pipette the entire volume up and down 10 times to mix thoroughly. 2. Incubate the CDP plate at room temperature for 15 min.

130

Rene Jackstadt et al.

3. Place the CDP plate on the magnetic stand at room temperature, for at least 5 min to ensure that all of the beads are bound to the side of the wells. 4. Remove and discard 135 μl of the supernatant from each well of the CDP plate using a multichannel pipette. Some liquid may remain in each well. Take care not to disturb the beads. Change the tips after each column. 5. With the CDP plate remaining on the magnetic stand, add 200 μl of freshly prepared 80% EtOH to each well without disturbing the beads. 6. Incubate the CDP plate at room temperature for 30 s, then remove and discard all of the supernatant from each well using a multichannel pipette. Take care not to disturb the beads. Change the tips after each column. 7. Repeat steps 5 and 6 once for a total of two 80% EtOH washes. 8. Let the plate stand at room temperature for 15 min to dry and then remove the CDP plate from the magnetic stand. 9. Briefly centrifuge the thawed, room temperature Resuspension Buffer to 600
g for 5 s. 10. Add 52.5 μl Resuspension Buffer to each well of the CDP plate using a multichannel pipette. Gently pipette the entire volume up and down 10 times to mix thoroughly. 11. Incubate the CDP plate at room temperature for 2 min. 12. Place the CDP plate on the magnetic stand at room temperature for 5 min. 13. Transfer 50 μl of the supernatant (ds cDNA) from the CDP plate to the new 0.3 ml PCR plate labeled with the IMP barcode. Some liquid may remain in each well. End Repair

1. Add 40 μl of End Repair Mix to each well of the insert modification plate (IMP) containing the ds cDNA using a multichannel pipette. Gently pipette the entire volume up and down 10 times to mix thoroughly. 2. Seal the IMP with a Microseal “B” adhesive seal. 3. Incubate the IMP on the preheated thermal cycler, with the lid closed, at 30  C for 30 min. 4. Remove the IMP from the thermal cycler. 5. Remove the adhesive seal from the IMP. 6. Vortex the AMPure XP Beads until they are well dispersed, then add 160 μl of well-mixed AMPure XP Beads to each well of the IMP containing 100 μl of End Repair Mix. Gently pipette up and down 10 times to mix thoroughly. 7. Incubate the IMP at room temperature for 15 min.

NGS Analyses of c-MYC

131

8. Place the IMP on the magnetic stand at room temperature for at least 5 min, until the liquid appears clear. 9. Using a 200 μl multichannel pipette set to 127.5 μl, remove and discard 127.5 μl of the supernatant from each well of the IMP. Take care not to disturb the beads. Change the tips after each column. 10. Repeat step 9 once. Some liquid may remain in each well. 11. With the IMP on the magnetic stand, add 200 μl of freshly prepared 80% EtOH to each well without disturbing the beads. 12. Incubate the IMP at room temperature for at least 30 s, then remove and discard all the supernatant from each well. Take care not to disturb the beads. Change the tips after each column. 13. Repeat steps 11 and 12 once for a total of two 80% EtOH washes. 14. Let the IMP stand at room temperature for 15 min to dry and then remove the plate from the magnetic stand. 15. Resuspend the dried pellet in 17.5 μl Resuspension Buffer. Gently pipette the entire volume up and down 10 times to mix thoroughly. 16. Incubate the IMP at room temperature for 2 min. 17. Place the IMP on the magnetic stand at room temperature for at least 5 min, until the liquid appears clear. 18. Transfer 15 μl of the clear supernatant from each well of the IMP to the corresponding well of the new 0.3 ml PCR plate labeled with the ALP barcode. Some liquid may remain in each well. 30 -end Adenylation

1. Add 2.5 μl of Resuspension Buffer to each well of the Adapter Ligation Plate (ALP) using a multichannel pipette. 2. Adjust the multichannel pipette to 30 μl and gently pipette the entire volume up and down 10 times to mix thoroughly. 3. Add 12.5 μl of thawed A-Tailing Mix to each well of the ALP using a multichannel pipette. Change the tips after each column. 4. Seal the ALP with a Microseal “B” adhesive seal. 5. Incubate the ALP on the preheated thermal cycler, with the lid closed, at 37  C for 30 min. 6. Immediately remove the ALP from the thermal cycler, then proceed immediately to Ligate Adapters.

132

Rene Jackstadt et al.

Adapter Ligation

1. Briefly centrifuge the thawed RNA Adapter Index tubes (AR001–AR012 depending on the RNA Adapter Indexes being used), Ligase Control (if using Ligase Control), and Stop Ligase Mix tubes to 600
g for 5 s. 2. Immediately before use, remove the DNA Ligase Mix tube from 15  C to 25  C storage. 3. Remove the adhesive seal from the ALP. 4. Add 2.5 μl of DNA Ligase Mix to each well of the ALP. 5. Return the DNA Ligase Mix tube back to 15  C to 25  C storage immediately after use. 6. Add 2.5 μl of each thawed RNA Adapter Index (AR001– AR012 depending on the RNA Adapter Indexes being used) to each well of the ALP using a multichannel pipette. 7. Adjust the multichannel pipette to 40 μl and gently pipette the entire volume up and down 10 times to mix thoroughly. 8. Seal the ALP with a Microseal “B” adhesive seal. 9. Incubate the ALP on the preheated thermal cycler, with the lid closed, at 30  C for 10 min. 10. Remove the ALP from the thermal cycler. 11. Remove the adhesive seal from the ALP. 12. Add 5 μl of Stop Ligase Mix to each well of the ALP to inactivate the ligation mix using a multichannel pipette. Gently pipette the entire volume up and down 10 times to mix thoroughly. 13. Vortex the AMPure XP Beads until they are well dispersed, then add 42 μl of mixed AMPure XP Beads to each well of the ALP using a multichannel pipette. Gently pipette the entire volume up and down 10 times to mix thoroughly. 14. Incubate the ALP at room temperature for 15 min. 15. Place the ALP on the magnetic stand at room temperature for at least 5 min, until the liquid appears clear. 16. Remove and discard 79.5 μl of the supernatant from each well of the ALP using a multichannel pipette. Some liquid may remain in each well. Take care not to disturb the beads. Change the tips after each column. 17. With the ALP remaining on the magnetic stand, add 200 μl of freshly prepared 80% EtOH to each well without disturbing the beads. 18. Incubate the ALP at room temperature for at least 30 s, then remove and discard all the supernatant from each well. Take care not to disturb the beads. Change the tips after each column. 19. Repeat steps 17 and 18 once for a total of two 80% EtOH washes.

NGS Analyses of c-MYC

133

20. Let the ALP stand at room temperature for 15 min to dry and then remove the plate from the magnetic stand. 21. Resuspend the dried pellet in each well with 52.5 μl Resuspension Buffer. Gently pipette the entire volume up and down 10 times to mix thoroughly. 22. Incubate the ALP at room temperature for 2 min. 23. Place the ALP on the magnetic stand at room temperature for at least 5 min, until the liquid appears clear. 24. Transfer 50 μl of the clear supernatant from each well of the ALP to the corresponding well of the new 0.3 ml PCR plate labeled with the Cleanup ALP (CAP) barcode. Some liquid may remain in each well. Change the tips after each column. 25. Vortex the AMPure XP Beads until they are well dispersed, then add 50 μl of mixed AMPure XP Beads to each well of the CAP for a second cleanup using a multichannel pipette. Gently pipette the entire volume up and down 10 times to mix thoroughly. 26. Incubate the CAP at room temperature for 15 min. 27. Place the CAP on the magnetic stand at room temperature for 5 min or until the liquid appears clear. 28. Remove and discard 95 μl of the supernatant from each well of the CAP, using a multichannel pipette. Some liquid may remain in each well. Take care not to disturb the beads. Change the tips after each column. 29. With the CAP remaining on the magnetic stand, add 200 μl of freshly prepared 80% EtOH to each well without disturbing the beads. 30. Incubate the CAP at room temperature for at least 30 s, then remove and discard all of the supernatant from each well. Take care not to disturb the beads. Change the tips after each column. 31. Repeat steps 29 and 30 once for a total of two 80% EtOH washes. 32. Let the CAP stand at room temperature for 15 min to dry and then remove the plate from the magnetic stand. 33. Resuspend the dried pellet in each well with 22.5 μl Resuspension Buffer. Gently pipette the entire volume up and down 10 times to mix thoroughly. 34. Incubate the CAP at room temperature for 2 min. 35. Place the CAP on the magnetic stand at room temperature for at least 5 min, until the liquid appears clear. 36. Transfer 20 μl of the clear supernatant from each well of the CAP to the corresponding well of the new 0.3 ml PCR plate labeled with the PCR barcode. Some liquid may remain in each well. Change the tips after each column.

134

Rene Jackstadt et al.

DNA Fragment Enrichment

1. Add 5 μl of thawed PCR Primer Cocktail to each well of the PCR plate using a multichannel pipette. Change the tips after each column. 2. Add 25 μl of thawed PCR Master Mix to each well of the PCR plate using a multichannel pipette. Change the tips after each column. Adjust the single channel or multichannel pipette to 40 μl and gently pipette the entire volume up and down 10 times to mix thoroughly. 3. Amplify the PCR plate in the preprogrammed thermal cycler, with the lid closed, using the PCR program: l

98  C for 30 s

l

15 cycles of: – 98  C for 10 s – 60  C for 30 s – 72  C for 30 s – 72  C for 5 min

l

Hold at 4  C

4. Vortex the AMPure XP Beads until they are well dispersed, then add 50 μl of the mixed AMPure XP Beads to each well of the PCR plate containing 50 μl of the PCR amplified library using a multichannel pipette. Gently pipette the entire volume up and down 10 times to mix thoroughly. 5. Incubate the PCR plate at room temperature for 15 min. 6. Place the PCR plate on the magnetic stand at room temperature for at least 5 min, until the liquid appears clear. 7. Remove and discard 95 μl of the supernatant from each well of the PCR plate, using a multichannel pipette. Some liquid may remain in each well. Take care not to disturb the beads. 8. With the PCR plate remaining on the magnetic stand, add 200 μl of freshly prepared 80% EtOH to each well without disturbing the beads. 9. Incubate the PCR plate at room temperature for at least 30 s, then remove and discard all of the supernatant from each well. Take care not to disturb the beads. 10. Repeat steps 8 and 9 once for a total of two 80% EtOH washes. 11. Let the PCR plate stand at room temperature for 15 min to dry and then remove the plate from the magnetic stand. 12. Resuspend the dried pellet in each well with 32.5 μl Resuspension Buffer using a multichannel pipette. Gently pipette the entire volume up and down 10 times to mix thoroughly. 13. Incubate the PCR plate at room temperature for 2 min.

NGS Analyses of c-MYC

100

43

.0

0

11

3.

00

6665. .170 6

[FU]

135

80

7 743.5 76 .705 78 .50 80 .62 .7 5

60 40 20 0 35

100

200

300

400

500

700

2000

10380

[bp]

Fig. 2 Electropherogram of an mRNA library subjected to analysis with the DNA Bioanalyzer. Peaks at 35 and 10,380 bp correspond to size standards. FU: fluorescence units

14. Place the PCR plate on the magnetic stand at room temperature for at least 5 min, until the liquid appears clear. 15. Transfer 30 μl of the clear supernatant from each well of the PCR plate to the corresponding well of the new 0.3 ml PCR plate labeled with the Target sample plate 1 (TSP1) barcode. Some liquid may remain in each well. 3.1.2 Library Quality Control

To control the integrity of the generated library, add 1 μl of the library to the Agilent Bioanalyzer. The final library should have a peak at 260 bp for single-read libraries (see Fig. 2).

3.1.3 mRNA Library Sequencing

When the cDNA library material has the required quality and quantity as determined in the previous point, the material may be subjected to sequencing, e.g., with the HighSeq 2000 (or higher) device from Illumina. A sequencing depth of 10–30 million reads and a read length from 35 to 50 bp is sufficient for a representative mRNA analysis. The processing of the resulting FASTQ files is discussed in the Bioinformatics paragraph and in [64, 66, 68]. In case there is no possibility to sequence the generated library in house, the sequencing may be outsourced since several companies offer sequencing services.

3.2

The following paragraphs describe the protocol for generating cDNA libraries representing miRNAs and other small RNAs starting from total RNA preparations. This strategy may be applied to analyze c-MYC-regulated miRNAs.

miRNA-Seq

136

Rene Jackstadt et al.

3.2.1 miRNA Library Preparation

30 -Adapter Ligation

(According to the manufacturer’s protocol, Illumina Part # 15004197 Rev. A) This protocol is suitable for 1–10 μg of total RNA. The starting material, total RNA, can be isolated by a number of techniques. Here we have used the Roche High Pure RNA Isolation Kit (see Note 4). Before NGS, the regulation of miRNAs known to be regulated by c-MYC should be confirmed in the samples, which will be subjected to library generation. In order to determine the expression of mature miRNAs, stem-loop reverse transcription (RT) followed by a TaqMan PCR or LNA-based PCR (Exiqon) should be used [69]. 1. Set up the ligation reaction in a sterile, nuclease-free 200 μl PCR tube on ice using the following: l

RNA 30 adapter (RA3) (1 μl).

l

Total RNA in nuclease-free water (5 μl). Total volume (6 μl).

2. Gently pipette the entire volume up and down 6–8 times to mix thoroughly, then centrifuge briefly. 3. Incubate the tube on the preheated thermal cycler at 70  C for 2 min and then immediately place the tube on ice. 4. Preheat the thermal cycler to 28  C. 5. Prepare the following mix in a separate, sterile, nuclease-free 200 μl PCR tube on ice. Multiply each reagent volume by the number of samples being prepared (see Note 5). l

5X HM ligation buffer (HML) (2 μl).

l

RNAse inhibitor (1 μl).

l

T4 RNA ligase 2, truncated (1 μl). Total volume (4 μl).

6. Gently pipette the entire volume up and down 6–8 times to mix thoroughly, then centrifuge briefly. 7. Add 4 μl of the mix to the reaction tube from step 1 and gently pipette the entire volume up and down 6–8 times to mix thoroughly. The total volume of the reaction should be 10 μl. 8. Incubate the tube on the preheated thermal cycler at 28  C for 1 h. 9. With the reaction tube remaining on the thermal cycler, add 1 μl Stop Solution (STP) and gently pipette the entire volume up and down 6–8 times to mix thoroughly. Continue to incubate the reaction tube on the thermal cycler at 28  C for 15 min, and then place the tube on ice.

NGS Analyses of c-MYC 50 -Adapter Ligation

137

1. Preheat the thermal cycler to 70  C. 2. Aliquot 1.1
N μl of the RNA 50 adapter (RA5) into a separate, nuclease-free 200 μl PCR tube, with N being equal to the number of samples being processed for the current experiment. 3. Incubate the adapter on the preheated thermal cycler at 70  C for 2 min and then immediately place the tube on ice. 4. Preheat the thermal cycler to 28  C. 5. Add 1.1
N μl of 10 mM ATP to the aliquoted RNA 50 Adapter tube, with N equal to the number of samples being processed for the current experiment. Gently pipette the entire volume up and down 6–8 times to mix thoroughly. 6. Add 1.1
N μl of T4 RNA Ligase to the aliquoted RNA 50 Adapter tube, with N equal to the number of samples being processed for the current experiment. Gently pipette the entire volume up and down 6–8 times to mix thoroughly. 7. Add 3 μl of the mix from the aliquoted RNA 50 Adapter tube to the reaction from step 9 of Ligate 30 Adapter. Gently pipette the entire volume up and down 6–8 times to mix thoroughly. The total volume of the reaction should now be 14 μl. 8. Incubate the reaction tube on the preheated thermal cycler at 28  C for 1 h and then place the tube on ice.

Sample Electrophoresis and RNA Gel Extraction Reverse Transcription and Amplification

Repeat the sample electrophoresis and RNA gel extraction by using a 10% TBE-urea PAGE gel to separate the RNA. 1. Pipette following reaction mix: l

50 and 30 Adapter-ligated RNA (6 μl).

l

RNA RT Primer (RTP) (1 μl).

Template Preparation

Total volume (7 μl). 2. Gently pipette the entire volume up and down 6–8 times to mix thoroughly, then centrifuge briefly. 3. Incubate the tube on the preheated thermal cycler at 70  C for 2 min and then immediately place the tube on ice. 4. Preheat the thermal cycler to 50  C. 5. Prepare the following mix in a separate, sterile, nuclease-free, 200 μl PCR tube placed on ice. Multiply each reagent volume by the number of samples being prepared. Make 10% extra reagent if you are preparing multiple samples. 6. Pipette following reaction mix: l

5
first strand buffer (2 μl).

l

12.5 mM dNTP mix (0.5 μl).

138

Rene Jackstadt et al. l

100 mM DTT (1 μl).

l

RNase inhibitor (1 μl).

l

SuperScript II Reverse Transcriptase (1 μl). Total volume (5.5 μl).

7. Gently pipette the entire volume up and down 6–8 times to mix thoroughly, then centrifuge briefly. 8. Add 5.5 μl of the mix to the reaction tube from step 3. Gently pipette the entire volume up and down 6–8 times to mix thoroughly, then centrifuge briefly. The total volume should now be 12.5 μl. 9. Incubate the tube in the preheated thermal cycler at 50  C for 1 h and then place the tube on ice. PCR

1. Pipette following reaction mix: l

Ultrapure water (22.5 μl).

l

5X Phusion HF Buffer (10 μl).

l

RNA PCR Primer (RP1) (2 μl).

l

RNA PCR Primer Index (RPIX) (2 μl).

l

25 mM dNTP mix (0.5 μl).

l

Phusion DNA Polymerase (0.5 μl) Total volume (37.5 μl). For each reaction, only one of the 48 RNA PCR Primer Indices is used during the PCR step.

2. Gently pipette the entire volume up and down 6–8 times to mix thoroughly, then centrifuge briefly, then place the tube on ice. 3. Add 37.5 μl of PCR master mix to the reaction tube from step 8 of the protocol Reverse Transcription. 4. Gently pipette the entire volume up and down 6–8 times to mix thoroughly, then centrifuge briefly and place the tube on ice. The total volume should now be 50 μl. 5. Amplify the tube in the thermal cycler using the following PCR cycling conditions: l

30 s at 98  C.

l

11 cycles of: – 10 s at 98  C. – 30 s at 60  C. – 15 s at 72  C.

l

10 min at 72  C.

l

Hold at 4  C.

6. Run each sample on a high-sensitivity Bioanalyzer DNA chip according to the manufacturer’s instructions.

NGS Analyses of c-MYC miRNA Library Purification

139

At this point of the protocol, individual libraries with unique indices may be pooled and gel purified together. Combine equal volumes of the library or molar amounts and then load the samples on the gel according to the instructions below. Do not load more than 30 μl of sample per well. 1. Determine the volume of 1
TBE buffer needed. Dilute the 5
TBE buffer to 1X for use in the electrophoresis. 2. Assemble the gel electrophoresis apparatus according to the manufacturer’s instructions. 3. Mix 2 μl of Custom Ladder with 2 μl of DNA loading dye. 4. Mix 1 μl of High-Resolution Ladder with 1 μl of DNA loading dye. 5. Mix the total volume containing the amplified cDNA, (typically 48–50 μl) with 10 μl of DNA loading dye. 6. Load 2 μl of mixed Custom Ladder and loading dye in two wells on the 6% PAGE gel. 7. Load 2 μl of High-Resolution Ladder and loading dye in a different well. 8. Load two wells with 25 μl each of mixed amplified cDNA construct and loading dye on the 6% PAGE gel. A total volume of 50 μl should be loaded on the gel. 9. Run the gel for 60 min at 145 V or until the blue front dye exits the gel. Proceed immediately to the next step. 10. Remove the gel from the apparatus.

Recovery of miRNA Library from Gel

1. Open the cassette according to the manufacturer’s instructions and stain the gel with ethidium bromide (0.5 μg/ml in water) in a clean container for 2–3 min. 2. Place the gel breaker tube into a sterile, round-bottom, nuclease-free, 2 ml microcentrifuge tube. 3. View the gel on a Dark Reader transilluminator or a UV transilluminator at a wavelength not harming the DNA (i.e., larger than 320 nm). 4. Using a clean scalpel, cut out the bands corresponding to approximately the adapter-ligated constructs derived from the 22 nt and 30 nt small RNA fragments. miRNAs often vary in length (so-called iso-miRs). The tighter the band selection, the tighter size distribution of the final miRNA representation (see Fig. 3: miRNA with Adaptors should have a size of ~100 bp). 5. Place the band of interest into the 0.5 ml Gel Breaker tube from step 2. 6. Centrifuge the stacked tubes at 16,000
g in a microcentrifuge for 2 min at room temperature to move the gel through the holes into the 2 ml tube. Ensure that the gel has completely moved through the holes into the bottom tube.

140

Rene Jackstadt et al.

Fig. 3 Gel-purification of small RNA libraries. A small RNA library separated on a 6% PAGE gel before and after cutting the region containing the miRNA library out of the gel (gel pictures kindly provided by Anne Du¨ck, University of Regensburg)

7. Add 300 μl of gel elution buffer to the gel debris in the 2 ml tube. 8. Elute the DNA by rotating or shaking the tube at room temperature for at least 2 h. The tube can be rotated overnight. 9. Transfer the eluate and the gel debris to the top of a 5 μm filter. 10. Centrifuge the filter for 2 min at 16,000
g. 11. Add 2 μl of glycogen, 30 μl of 3 M NaOAc, 2 μl of 0.1X Pellet Paint (optional), and 975 μl of prechilled 100% ethanol (15  C to 25  C). 12. Immediately centrifuge in a benchtop microcentrifuge at 16,000
g for 20 min at 4  C. 13. Remove and discard the supernatant, leaving the pellet intact. 14. Wash the pellet with 500 μl of room temperature 70% ethanol. 15. Centrifuge at 16,000
g at room temperature for 2 min. 16. Remove and discard the supernatant, leaving the pellet intact. 17. Dry the pellet by placing the tube, lid open, in a 37  C heat block for 5–10 min or until dry. 18. Resuspend the pellet in 10 μl Resuspension Buffer. 3.2.2 miRNA Library Validation

Use the Agilent Technologies 2100 Bioanalyzer chip for DNA to validate your generated library (Fig. 4).

3.2.3 miRNA Library Sequencing

When the library material has the required quality and quantity, the material can be subjected to NGS. A sequencing depth of around 20 million reads and a sequencing read length of 35–50 bp is sufficient to obtain a representative result. The processing of the resulting FASTQ files is discussed in the bioinformatics paragraph.

3.3

This section describes the analysis of the genome-wide pattern of c-MYC DNA binding using a combination of chromatinimmunoprecipitation and NGS. In order to immunoprecipitate c-MYC along with DNA, several different strategies can be applied.

ChIP-Seq

NGS Analyses of c-MYC

14

5

[FU]

141

350 300 250

0 38 10

150

35

200

100

39

50 0 35

100

200

300

400

500

700

2000

10380

[bp]

Fig. 4 Analysis of a mature miRNA library using a DNA Bioanalyzer. Peaks at 35 and 10,380 bp represent the size standard. FU: fluorescence units

One approach is to analyze the binding of endogenous c-MYC after subjecting cells to treatments, which either induce or decrease the expression of endogenous c-MYC, e.g., serum-starvation and restimulation to increase c-MYC expression [35, 58, 70] or treatment with TGF-β to decrease it [71]. For the ChIP analysis of endogenous human c-MYC protein, the antibody N-262 (sc-764 from Santa Cruz) was commonly used [34, 35, 58, 70, 72]. Since this antibody is no longer available, alternative antibodies such as AF3696 (R&D) or #9402 (Cell Signaling Technology) have been used in more recent ChIP-Seq studies of c-MYC [73, 74]. As a control, pre-immune serum with a similar isotype as the c-MYCspecific antibody should be used (see Note 6). When performing ChIP analysis after ectopic expression of tagged MYC-proteins, the levels of c-MYC expression should be closely monitored since nonphysiological expression levels may result in aberrant DNA binding [29] (see Note 7). If you use a different antibody or a new lot of antibody, make sure that these allow to obtain the expected results in a conventional immunoprecipitation or in a ChIP assay. [75]. Furthermore, genome-wide ChIP analyses allow to determine the effect of c-MYC activation on the global organization of chromatin, e.g., by mapping the distribution of histone marks, representing repressive or active chromatin [40, 76] (see Note 8). In the following sections, the isolation of c-MYC-associated DNA, the validation of c-MYC binding to known binding sites, and the generation of ChIP-DNA libraries, which can be subjected to NGS, are described.

142

Rene Jackstadt et al.

3.3.1 ChIP Experimental Design of ChIP for Subsequent NGS Analysis

Pre-blocking of Sepharose Beads

For the initial antibody testing, three subconfluent 15 cm diameter culture plates per condition are enough to obtain a sufficient amount of ChIP-DNA. For the final library generation, five 15 cm diameter culture plates per condition with a cell confluency of 70% are necessary for each state. Ideally, a ChIP analysis is accompanied by several different types of control analyses in order to rule out artifacts generated by the procedure itself. As a control, the DNA present in the IP input, mock IP, and/or IgG IP may be subject to NGS analysis (see Note 9). If ectopic expression of a tagged c-MYC protein was used, DNA obtained from the empty control vector cell line after IP with the tag-specific antibody should be subjected to NGS. The different types of control experiments and other ChIP analysis-related issues are reviewed in [77]. The pre-blocking prevents unspecific binding of DNA or proteins to the beads. For this, prepare two different stocks of pre-blocking solutions: one stock for pre-clearing and the other for the IP, which will be used at different times during the protocol. 1. Calculate the total bead volume for preclearing and IP. For one sample, use 30 μl beads (bed volume, add 20% to compensate for pipetting errors) for preclearing and use 60 μl beads (bed volume, add 20% to compensate for pipetting errors) for the immunoprecipitation, for three plates of adherent cells with ~70% confluency (~5
106 cells). 2. Start with the beads for preclearing. Wash beads three times with 1 ml PBS to get rid of ethanol, which is present in the bead storage buffer. 3. Add 2.4 μl BSA fatty acid-free (50 μg/μl) and 4.8 μl (10 μg/μl) salmon sperm DNA (subjected to eight sonication cycles) per 30 μl protein A/G beads (50% slurry in PBS). 4. Pre-block total bead volume at least 3 h at 4  C on a rotating wheel for recovery of the immunoprecipitation and the pre-blocking step. 5. Wash beads four times with 1 ml PBS and once with 1 ml IP buffer after pre-blocking, by centrifugation at 400
g for 1 min.

Cross-Linking and Sonication

1. During pre-blocking of beads, dissolve Complete Mini (CM) protease inhibitors in SDS buffer (1 tablet/5 ml); always prepare freshly. Do not put on ice since SDS will precipitate. Try to keep it at room temperature. Prepare IP buffer containing CM (1 tablet/5 ml), keep on ice until usage. 2. For cross-linking, remove medium from the plate and keep it in a beaker (at room temperature). 3. Immediately add 270.3 μl from 37% stock formaldehyde (see Notes 10 and 11) per 10 ml medium from the cells (¼ 1% formaldehyde), mix and quickly add the 1% formaldehyde containing medium back onto the cells.

NGS Analyses of c-MYC

143

4. Perform cross-linking times at RT without shaking. The optimal incubation times vary between cell lines/types (e.g., HeLa: 10 min, HDF: 5 min, MCF-7: 5 min, DLD-1: 5 min, H1299: 8 min). If processing many plates, take 3–5 at a time (see Note 12). 5. To stop the cross-linking, add 1.5 ml 1 M glycine/10 ml crosslinking medium (CM ¼ 0.125 M glycine), mix and incubate for 2 min, then discard. 6. Wash twice with TBS (4  C cold) using 20 ml/15 cm plate. 7. Harvest cells from one 15 cm diameter plate in 500 μl SDS/CM buffer collect lysate and repeat harvesting step with additional 500 μl SDS buffer, combine the two fractions, and keep at room temperature in order to avoid precipitation of SDS. 8. Centrifugation (400
g for 5 min at 4  C) in a 15 ml Falcon tube. 9. Resuspend the pellet in 2 ml IP buffer. Independent of the initial cell number, use a 15 ml Falcon tube and a volume between >500 μl and up to 2 ml to guarantee efficient sonication. 10. For sonication, use standard sonication devices (as e.g., HTU SONI 130 (G. Heinemann); Sonoplus (Bandelin) etc.) or automated devices as the BioRuptor (Diagenode). For NGS of ChIP DNA, it is necessary to generate DNA fragments with an average size of 300 bp or below. As shown in Fig. 5, the number of sonication cycles has to be optimized to obtain fragments of the required size. With the Sonopulus device, we use an amplitude of 80% with following sonication cycles: 20 s sonication pulse and 50 s pause. The samples should be kept on an ethanol ice mixture to avoid denaturation of the proteins during the sonication procedure, which generates heat. 11. Distribute lysates to 2 ml reaction tubes. Centrifuge samples for 15 min at 16,000
g and 4  C, transfer supernatant into fresh 1.5 ml reaction tube for preclearing.

Fig. 5 Reduction of DNA fragment size by increasing the number of sonication cycles. 15 μl of sonicated input DNA from the indicated sonication cycles was separated on a 1.2% TAE agarose gel, 1 Kbp DNA Marker in the first lane

144

Rene Jackstadt et al.

Immunoprecipitation

1. Wash pre-blocked beads (for preclearing) four times with 1 ml PBS and once with 1 ml IP buffer. Then resuspend the beads in IP buffer. 2. Preclear the lysates for 1 h at 4  C by adding 30 μl pre-blocked beads per condition. Preclearing can be done on the entire sample volumes before subdividing into individual IPs to maintain consistency in processing as long as possible. 3. Centrifuge at 400
g for 5 min at 4  C to precipitate the beads and unspecific associated material and transfer the supernatant into fresh 1.5 ml reaction tubes. Keep about 100 μl for “Input” and store at 20  C until further analysis. Leave sticky protein aggregates at the walls of the tube. 4. Distribute the exact same amount of lysate to the individual IP tubes (see Note 13). 5. For immunoprecipitation, rotate samples overnight at 4  C with 2–10 μg antibody/sample. For ChIP analysis of c-MYC, the N-262 (SC-764, Santa Cruz) rabbit polyclonal antibody has been widely used, but is no longer commercially available. Alternative antibodies such as AF3696 (R&D) or #9402 (Cell Signaling Technology) may be applied. 2 μg antibody per dish (15 cm) is recommended. 6. During the immunoprecipitation, pre-block the washed protein A/G beads for 3 h as described above (for IP). 7. Wash the pre-blocked beads four times with 1 ml PBS and once with 1 ml IP buffer. To recover the antibody-bound protein, add 60 μl beads (bed volume)/three plates. Rotate for 2 h at 4  C. 8. Centrifuge for 1 min 400
g at room temperature and discard the supernatant (use vacuum pump with pipet tip on top of a glass Pasteur pipet). 9. Washing procedure: Add 1 ml mixed micelle buffer: rotate 5 min at room temperature, centrifuge 1 min at 1000
g, and remove the supernatant. 10. Repeat with 1 ml buffer 500. 11. Repeat with 1 ml LiCl/detergent wash solution. 12. Repeat with 1 ml TE pH 7.5. 13. Remove remaining supernatant carefully. 14. Add 100 μl freshly prepared elution buffer and incubate 10 min at 65  C in a water bath. The use of a water bath is important. Snip the tube several times in order to resuspend the beads. 15. Centrifuge at maximum speed and transfer the eluate to a fresh 1.5 ml reaction tube.

NGS Analyses of c-MYC

145

16. Again add 100 μl elution buffer to the beads and incubate for 10 min at 65  C in a water bath. 17. Centrifuge at full speed and combine both eluates. 1. Incubate the samples at 65  C in a water bath for a minimum of 6 h up to overnight (also include the tube with the input DNA).

Cross-Link Removal and Purification

2. Add 5 μl or 10 μl of a 10 mg/ml RNase solution to “input” or “IP” samples, respectively. Incubate 30 min at 37  C. 3. Before qPCR, purify the DNA (also the input sample) using the Qiagen PCR Purification Kit according to the instructions of the manufacturer. Incubate the columns after adding the elution buffer 5 min at room temperature, and elute twice with the same 40–50 μl into the same 1.5 ml reaction tube (to obtain a higher DNA amount in the samples, necessary for sequencing library production). Quality of sheared DNA should be controlled by running the input DNA on a 1.2% agarose gel. Usually, 15 μl of input DNA solution is fine to visualize DNA. 4. Store DNA solution at 20  C until use. Quality and Quantity Control of Immunoprecipitated DNA

In order to determine quality and quantity of the immunoprecipitated DNA before starting to generate the ChIP-Seq library, aliquots of the ChIP DNA should be subjected to standard qPCR analyses to determine the specificity of binding to known regions. Instructions for performing ChIP-qPCR analyses can be found in paragraph 3 of Subheading 3.5. An appropriate way to analyze the size distribution of the DNA is to use a DNA Bioanalyzer (Fig. 6).

[FU] 120 100 80 60 40 20 0

35

100

200

300

400

600

1000

3000

10380

[bp]

Fig. 6 ChIP DNA analysis with a DNA Bioanalyzer prior to library generation. [FU: fluorescence units] In this case, the average fragment size is around 233 bp. It should ideally be between 150 bp and 300 bp. Peaks at 35 bp and 10,380 represent the size standard

146

Rene Jackstadt et al.

If size and quantity of the enriched DNA is appropriate, it can be further processed using the ChIP-Seq Sample Prep Kit (Illumina) to obtain the libraries for sequencing. 3.3.2 ChIP-Seq Library ChIP-Seq Library Generation

End Repair

(According to the manufacturer’s protocol; Illumina Part # 11257047). 1. Dilute Klenow DNA polymerase 1:5 with water to a final concentration of 1 U/μl. 2. Prepare the following reaction mix: l

10 ng ChIP enriched DNA (in 30 μl).

l

Water (10 μl).

l

T4 DNA ligase buffer with 10 mM ATP (5 μl).

l

dNTP mix (2 μl).

l

T4 DNA polymerase (1 μl).

l

Klenow DNA polymerase (1 μl).

l

T4 polynucleotide kinase (1 μl). The total volume should be 50 μl.

3. Incubate in the thermo cycler for 30 min at 20  C. 4. Follow the instructions in the QIAquick PCR Purification Kit, use 34 μl of Elution Buffer. Addition of “A” Bases to the 30 End of the DNA Fragments

1. Prepare the following reaction mix: l

DNA sample (34 μl).

l

Klenow buffer (5 μl).

l

dATP (10 μl).

l

Klenow exo (30 to 50 exo minus) (1 μl). The total volume should be 50 μl.

2. Incubate for 30 min at 37  C. Follow the instructions in the MinElute PCR Purification Kit, use 10 μl of Elution Buffer. Adapter to DNA Fragment Ligation

1. Dilute the Adapter oligo mix 1:10 with water to adjust for the smaller quantity of DNA. 2. Prepare the following reaction mix: l

DNA sample (10 μl).

l

DNA ligase buffer (15 μl).

l

Diluted adapter oligo mix (1 μl).

l

DNA ligase (4 μl). The total volume should be 30 μl.

NGS Analyses of c-MYC

147

3. Incubate for 15 min at room temperature. Follow the instructions in the MinElute PCR Purification Kit, use 10 μl of Elution Buffer. Size Selection of the Library

1. Prepare a 50 ml, 2% agarose gel with TAE buffer. 2. Final concentration of EtBr 400 ng/ml. 3. Load 500 ng of 100 bp DNA ladder on the gel. 4. Add 3 μl of loading buffer to 10 μl of the DNA from the purified ligation reaction. 5. Load the entire sample on the gel, leaving at least one empty lane between ladder and sample. 6. Run gel at 120 V for 60 min. 7. Use >320 nm wavelength UV table to avoid damaging the DNA fragments. The 100 bp ladder will allow to determine the correct position to cut the library DNA out of the gel. Excise a region of gel with a clean scalpel. The gel slice should contain DNA in the 200  25 bp range. Document the gel before and after the slice is excised. 8. Cut a slice of the same size from an empty well on the same gel and take this sample through gel purification and PCR. No visible PCR product should be present. 9. Use the QIAGEN Gel Extraction Kit to purify the DNA from the agarose slices and elute DNA in 36 μl.

Enrichment of AdapterModified DNA Fragments by PCR

1. Prepare the following PCR mix: l

DNA (36 μl).

l

5
Phusion buffer (10 μl).

l

dNTP mix (1.5 μl).

l

PCR primer 1.1 (1 μl).

l

PCR primer 2.1 (1 μl).

l

Phusion polymerase (0.5 μl). The total volume should be 50 μl.

2. Amplify using the following PCR protocol: l l

30 s at 98  C. 18 cycles of: – 10 s at 98  C. – 30 s at 65  C. – 30 s at 72  C. – 5 min at 72  C. – Hold at 4  C.

3. Follow the instructions in the MinElute PCR Purification Kit, use 15 μl of Elution Buffer.

148

Rene Jackstadt et al.

[FU] 500 400 300 200 100 0 35

100

200

300

400 500

700

2000

10380

[bp]

Fig. 7 Analysis of ChIP enriched DNA after library generation using a DNA Bioanalyzer. The peak representing the library is indicated by an arrow. Peaks at 35 bp and 10,380 represent the size standard. FU: fluorescence units ChIP-Seq Library Validation

The amount of starting material is very low (10 ng), and after 18 cycles of PCR, the yield could still be too low to see on a regular gel, even though it is enough for cluster generation. It is recommended to perform a more sensitive quality control analysis of the sample library using an Agilent Bioanalyzer (Fig. 7; see Note 14).

3.3.3 Library Sequencing

When the library has the required quality and quantity, which is the case when the maximum peak at 300–400 bp is more pronounced than a side-product of the library generation having a size of ~500 bp, the material can be subjected to different sequencing machines from Illumina, e.g., the HighSeq 2000 (or higher). A sequencing depth of around 20 million reads and sequencing read length from 35 to 50 bp is sufficient to obtain representative results. The processing of the resulting FASTQ files is discussed in the Bioinformatics paragraph and in [77, 78].

3.4 Bioinformatics Analyses of NGS Results

Once you obtained the NGS result files (e.g., in FASTQ file format), these will have to be converted and subjected to multiple bioinformatics analyses. Ideally, results of the three different types of analyses suggested here will be integrated in order to generate a global picture of c-MYC-mediated regulation of mRNA, miRNA, and miRNA target expression. An outline of such a bioinformatics analysis is provided in Fig. 8. The ChIP-, miRNA-, and mRNA-Seq reads have to be mapped to a reference genome. For human genome data, this is currently the hg38 release, but older versions such as hg19 can also be used, especially for comparison with previously published NGS data. Several programs for mapping reads to the genome are available

NGS Analyses of c-MYC

type of NGS analysis

bioinformatics analyses

outcome

149

follow-up analyses

miR-Seq

miRDeep2 miRanalyzer miRge2.0

MYCregulated miRNAs

ChIP-Seq

alignment: Bowtie, BWA peak calling: FindPeaks, MACS

direct MYC target genes

miRNA-mediated down-regulation of target mRNAs

mRNASeq

alignment: TopHat, STAR, HISAT DGE: edgeR, DESeq2, limma-voom, Cufflinks

MYCregulated mRNAs

gene ontology, MSigDB, GSEA, clinical databases (e.g. TCGA) : mutations in cancer epigenetic alterations

target prediction: TargetScan, PICTAR microRNA.org miRWalk2.0

Fig. 8 Bioinformatics characterization of c-MYC-regulated mRNAs, miRNAs, and their targets. Summary of bioinformatics approaches for the comprehensive characterization of MYC-regulated mRNAs, miRNAs, and their targets. The indicated algorithms and resources facilitate the analyses of data obtained as described in the main text and in Fig. 1 DGE: differential gene expression

that can be used for ChIP- and/or RNA-Seq data. Commonly used mappers for ChIP-Seq data are Bowtie [79] and BWA [80]. For the mapping of RNA-Seq reads, TopHat2 [81], STAR [82], or HISAT [83] are widely applied. Of note, mappers such as Bowtie only perform ungapped alignments (i.e., do not detect splice site junctions), but can be applied in conjunction with splice junction mappers such as TopHat2 for the analysis of RNA-Seq data. Popular microRNA alignment tools such as miRDeep2 or miRanalyzer also use the Bowtie alignment engine [84–87], and in addition have implemented quantification steps in their workflows. A more recently developed tool for the analysis of miRNA sequencing data is miRge 2.0 [88]. 3.4.1 ChIP-Seq Bioinformatics

After the alignment to a reference genome, ChIP-Seq data are subjected to peak calling. For this several tools are available, e.g., FindPeaks [89] or MACS [90], which are discussed in [91–93]. The results may be visualized as histogram plots using, e.g., the UCSC genome browser and the distribution of c-MYC DNA binding in any genomic region can be compared to previously published ChIP-Seq analyses (Fig. 9). Additionally, a de novo motif search can be performed with the MEME software [94] to analyze whether DNA associated with the identified ChIP-Seq peaks shows the expected enrichment of the c-MYC E-Box

150

Rene Jackstadt et al. chr16: 4,305,847 - 4,325,569 (hg19) TFAP4 control

E-boxes :

5 kb

reads : 70 -

70

-

800

-

800

-

100

-

250

-

100

-

700

-

150

-

100

c-MYC-VSV

H1 ESC K562 A549 HeLa GM12878 NB4 HepG2 HUVEC

Fig. 9 c-MYC binding in the first intron of the human TFAP4/AP4 gene. A representative example of a bioinformatic analysis of ChIP-Seq results. A VSV-tagged c-MYC protein was precipitated using a VSV-specific antibody after induction of a conditional c-MYC-VSV allele in the DLD-1 colorectal cancer cell line. First row: a control ChIP analysis using a VSV-specific antibody after induction of an empty vector by addition of Doxycyline. Second row: c-MYC-VSV ChIP-Seq result with the VSV-specific antibody. c-MYC occupancy can be seen in the first intron of AP4 in close proximity to the promoter, in which the previously identified and experimentally validated c-MYC occupied E-boxes are localized [58]. The position of these four E-boxes is indicated by red vertical bars. Results were compared to several independent ChIP-Seq analyses of genomewide MYC occupancy in the indicated cell lines (lower rows) and were visualized using the UCSC genome browser

5´-CACGTG-30 motif. For example, c-MYC occupancy in the first intron of AP4, a direct c-MYC target gene, is associated with the presence of c-MYC E-boxes, which had been experimentally validated before (Fig. 9) [58]. Furthermore, the enrichment of neighboring DNA motifs, which may serve as binding sites for cooperating or antagonizing factors, may be identified using the MEME algorithm. In order to identify direct MYC target genes, ChIP-Seq peak proximity relative to the position of transcription start sites (TSSs) and/or promoters of known genes, which are differentially expressed after activation of c-MYC as detected by mRNA-Seq (see below) has to be determined. Furthermore, an analysis of the distribution of E-boxes in the promoters of induced versus repressed c-MYC-regulated genes can be performed. Furthermore, the distance of E-boxes to the TSS may vary between induced and repressed genes. An example of a bioinformatics workflow for the analysis of NGS ChIP-Seq results is also provided in [95].

NGS Analyses of c-MYC

151

3.4.2 mRNA-Seq Bioinformatics

For the further analysis of RNA-Seq data, different commercial and open-source programs are available [68, 96]. In a standard workflow, after read mapping to a reference genome (see above), the aligned reads are quantified using tools such as HTSeq [97] and featureCounts [98] that assign reads to genomic features, e.g., annotated transcripts. Subsequently, there are several R/Bioconductor-based software packages, such as EdgeR, DESeq/DESeq2, or limma-voom, which are commonly used to analyze differential gene expression (DGE) [99–102]. Alternatively, mappers such as TopHat can be used in conjunction with CuffLinks to determine differentially expressed genes [103]. Moreover, the GALAXY platform provides an integrated, web server-based collection of software tools for mapping, quantification, and normalization of sequencing reads, which can be used to analyze c-MYC-regulated differential gene expression [104].

3.4.3 miR-Seq Bioinformatics

Several software programs can be used to analyze miRNA sequencing data. For example, miRDeep2 allows to analyze deepsequencing data obtained by Illumina/HiSeq and other NGS platforms by integrating both mapping and quantification features [87]. A similar tool is the miRanalyzer [85, 86]. In addition, several other microRNA analysis pipelines are commonly used, which are discussed in [84]. For miRNA target gene identification, different algorithms, such as Targetscan [105, 106], PicTar [107], or the microRNA.org [108] and miRWalk2.0 resources [109] should be used.

3.5 Validation of NGS Results

In general, it is necessary to validate results obtained from genomewide analyses at least in an exemplary fashion. Thereby, one can confirm how robust the observed regulation is and exclude potentially false-positive target gene candidates from further analyses. Especially, if further, more laborious downstream analyses are planned, and results should be confirmed using alternative methods on a single-gene basis. Besides the analyses of already known c-MYC targets, newly discovered targets should be confirmed using an independent method. If the results for these evaluations are positive, the genome-wide data may then be subjected to gene ontology analysis, for example, by using the Molecular Signatures database (MSigDB), to discover or confirm different signatures or pathways associated with or regulated by c-MYC [110, 111]. Moreover, gene set enrichment analysis (GSEA) allows to identify significant associations of gene expression changes with predefined gene signatures—for example, predicted miRNA targets—independent of a defined expression change cutoff [112]. Thereby, the differential expression of predicted targets of MYC-regulated miRNAs can be analyzed in a genome-wide manner.

152

Rene Jackstadt et al.

3.5.1 qPCR Validation of c-MYC-Regulated Transcripts

For RNA extraction, we have used various commercial kits, which are based on the Chomchynzky RNA extraction protocol (RNAgents; Promega). For reverse transcription, kits from Abgene and Thermo scientific (Verso cDNA Kit) generally resulted in reliable qPCR results, also in the case of less abundant mRNAs. The following protocol uses the Fast SYBR Green Master Mix (Ambion) in combination with the Light Cycler 480 (Roche; see Note 15). Since cDNA concentrations may vary between the samples that will be compared, cDNA amounts should be adjusted after qPCR determination of housekeeping gene expression, such as β-actin or ELF1α (do not use GAPDH for normalizing, since it represents a c-MYC target gene). Ideally, all samples should be in the range of +/ 1 crossing point (CP; see Note 16). Finally, biological triplicate samples should be analyzed with one master mix cDNA preparation used for all determinations of target mRNA and control mRNA expression, in order to minimize pipetting errors. Master Mix Preparation 1. Thaw the Sybr Green Master Mix at room temperature and mix it gently. Prepare a 10 μM dilution of each primer. Dilute the cDNA in a range of 1:3 to 1:10, depending on the expected abundance of the genes of interest.

2. qPCR master mix preparation (per reaction) (see Note 17): (a) 7.5 μl 2
Sybr Green Master Mix. (b) 1 μl cDNA as starting point. (c) 0.75 μl forward primer (10 μM). (d) 0.75 μl reverse primer (10 μM). (e) 5 μl H2O. 15 μl total volume. 3. Mix gently without vortexing. 4. Distribute the samples in a 96-multiwell plate. 5. The thermal-cycling conditions for the Light Cycler 480 are: (a) 20 s at 95  C. (b) 40 cycles: l l

3 s at 95  C (denaturation). 30 s at 60  C (includes annealing and extension) (see Note 18).

The crossing point (CP) is the cycle number at which the increase in the fluorescence signal generated by the PCR product assumes an exponential phase. The CPs are used to calculate the fold change by using the second-derivative maximum method

NGS Analyses of c-MYC

153

[113]. This method integrates the efficiency of the individual primer pairs, which is determined using a logarithmic dilution of cDNA to generate a linear standard curve with the CPs plotted against log of the template concentration. The primer pair efficiency can be calculated as follows: Efficiency E ¼ 10(1/slope) [113]. The fold induction can be calculated as: ðE DNAx ÞΔCPðsample‐controlÞ ðE ref ÞΔCPðsample‐controlÞ

¼ fold induction

For most primer pairs, an efficiency of ~1.9 in a CP range of 15–28 is observed. Crossing points above 28 are usually associated with lower PCR primer efficiencies. Therefore, primer pair efficiencies for CPs >28 should be experimentally deduced from qPCRs of serial template dilutions and are usually between 1.5 and 1.8. Furthermore, the primer pair specificity should also be confirmed by gel electrophoresis of the PCR product. Ideally, only one band of the expected length, which corresponds to a single peak in the melting curve should be detected (besides the band corresponding to primer dimers). Because transcriptional inductions or repressions of c-MYC-regulated targets are often in the range of twofold, it is particularly important to analyze biological triplicates of cDNAs, which have been adjusted for equal concentration by qPCR of a housekeeping mRNA. Primer pairs for established murine and human c-MYC targets can be found in [17, 58, 70, 72]. For the design of new qPCR primer pairs, several online tools are available that often succeed in predicting primers that generate a single-specific product using cDNA as a template (and no/minimal primer dimers), e.g., Primer3. In order to avoid amplification from contaminating genomic DNA, PCR primer should span introns. Furthermore, maximal PCR product generation of oligo-dT primed cDNA can be achieved if primer pairs are directed against exons in or close to the 30 -UTR. Ideally, for use with a Light-Cycler device, a melting temperature of 60  C +/ 3  C and a primer length of 20 bp with a GC content of 45–65% is recommended. PCR products should have a length of 80 bp–300 bp. 3.5.2 qPCR Validation of c-MYC-Regulated miRNAs

The expression of c-MYC-regulated miRNAs may be determined either at the level of the primary miRNA (pri-miRNA) transcript or of the mature miRNA. The former is analyzed essentially as described in the mRNA protocol and preferentially in combination with exon-binding primers that flank the miRNA in the pri-miRNA. This allows to demonstrate the direct transcriptional regulation of the miRNA excluding direct or indirect effects of c-MYC on the processing of the respective miRNA. In some cases, this may generate negative results since the expression of the miRNA, as detected by miR-Seq, may not be determined by

154

Rene Jackstadt et al.

the level of pri-miRNA expression, but by regulated processing. Furthermore, many pri-miRNA/miRNA assignments are not complete and have not been experimentally validated. Additional, intragenic promoters may exist, which drive the expression of uncharacterized pri-miRNAs. In order to validate differential expression of mature miRNAs, a stem-loop PCR followed by a Taqman assay (e.g., from Applied Biosystems) or an LNA-PCR (e.g., from Exiqon) should be applied. miRNA-specific primers for miR-BASE listed miRNAs can be ordered and should be used in conjunction with the respective chemicals and enzymes provided by these companies. 3.5.3 qChIP Validation of Occupancy by c-MYC

qChIP should be used for the validation of ChIP-Seq results and is performed similarly to the qPCR analysis of mRNA. However, since promoters often contain GC-rich regions, the design of functional qChIP primers is often difficult. Primer pairs for a qChIP analysis of putative c-MYC bound regions should be positioned around the predicted E-boxes following similar rules as used for mRNA primer design. Primer pairs, which can be used as negative and positive controls, have been described for human and murine cell systems [58, 70, 114]. Negative-control primers are, for example, ELF1α, a region on 16q22 or AchR [17, 58, 114] that are also used to adapt volumes for equal DNA input. In an initial PCR, positive and negative controls should be analyzed using 1 μl of each sample. For quantification of DNA, enrichment crossing-points should be between 25 and 30. To calculate the binding of c-MYC to the DNA region analyzed, such enrichment compared to the isotype control IP is commonly expressed as percentage of input. The calculation should be performed as given below [114]: 2ðCP InputÞðCP IPÞ ¼ %Input The following example shows the qChIP result prior to performing the ChIP-Seq analysis to verify the enrichment on a genomic region expected to bind to c-MYC (Fig. 10).

4

Notes 1. Lower amounts can result in inefficient ligation and low yield. 2. The High Pure RNA Isolation Kit (Roche) and the TRIzol RNA Isolation Reagents (Ambion) are suitable. 3. As an alternative method for users who do not have access to an Agilent Technologies 2100 Bioanalyzer or similar instrument, the RNA can be separated on a formaldehyde 1% agarose gel, and the integrity of RNA can be assessed after staining with ethidium bromide. RNA with high quality shows a 28S rRNA and 18S rRNA band at 4.5 kbp and 1.9 kbp without any degradations.

NGS Analyses of c-MYC

155

1.60 1.40 1.20

% Input

1.00 0.80

c-MYC

0.60

empty vector

0.40 0.20 0.00 AP4 1st intron

Chr. 16q22

Fig. 10 qPCR analysis of c-MYC ChIP in the first intron of the AP4 gene. The AP4 gene was previously shown to contain several E-boxes occupied by c-MYC [58]. ChIP analysis with a VSV-specific antibody was performed using cells treated with Doxycyclin either ectopically expressing a VSV-tagged c-MYC protein or harboring an empty vector. PCR of a genomic region on chromosome 16q22 devoid of E-boxes in a region 3 kbp up- or downstream served as negative control. The strong enrichment of c-MYC-bound DNA in the first intron of the AP4 gene was also seen in the ChIP-Seq analyses shown in Fig. 9 (Jackstadt et al., unpublished results)

4. Ensure that the total RNA was purified using a method that retains small RNA. The use of high-quality RNA is essential to generate reproducible results. RNA quality should be determined using the Agilent Bioanalyzer. The RNA Integrity Number (RIN) value should be eight or greater. 5. Prepare 10% extra reagent if you have multiple samples. 6. In order to avoid false-positive signals caused by unspecific antibody interactions, the use of highly specific antibodies directed against epitopes, which were added to the c-MYC protein, is recommended. 7. Several possibilities of performing control experiments and other ChIP-analysis related issues are also reviewed in [77]. 8. These related analyses are also described in another chapter of this book (see “Analysis of Myc chromatin binding by calibrated ChIP-Seq approach” by Cameron et al.) and may be combined with the analyses described here. 9. It is recommended to use at least the IgG IP as a control.

156

Rene Jackstadt et al.

10. Be aware of the date of expiry. Expired formaldehyde does not work well. 11. Handle formaldehyde under a fume hood. 12. Precise timing is important in this step. 13. If possible include an analysis with an isotype matched, unspecific antibody IP for each antibody. 14. Alternative method: If you do not have access to an Agilent Technologies 2100 Bioanalyzer or similar instruments, you may try using a sensitive dsDNA measurement assay such as the Quant-iT dsDNA HS Assay Kit, for use with the Qubit fluorometer (Invitrogen). Note that this will not allow you to check the size and purity of your sample. Do not use an OD260/280 ratio for concentration measurements, since this will not distinguish dsDNA from primers, and therefore cannot be used to validate the library. 15. If a different Master Mix or qPCR machine is used, the protocol needs to be adapted accordingly. 16. Some authors recommend to use up to three transcripts as normalization controls [115]. If a cDNA differs strongly in the CP, a second PCR should be performed with adapted cDNA input amounts to determine the final cDNA amount that results in roughly similar CPs as obtained for the other sample. 17. To compensate pipetting errors, prepare an excess of 10% master mix. 18. At the end of the program, a melting curve analysis to evaluate the primer specificity should be included. Although this should be confirmed prior to the final analysis, the individual cDNA and PCR conditions may affect the performance of the primer pair.

Acknowledgments Work in the Hermeking lab is supported by the German-IsraeliScience-Foundation (GIF), the Wilhelm-Sander-Stiftung, the ElseKro¨ner-Fresenius-Stiftung, the Rudolf-Bartling-Stiftung, the Deutsche Krebshilfe, the Deutsches Konsortium fu¨r translationale Krebsforschung (DKTK), and the Deutsche Forschungsgemeinschaft (DFG). Footnotes: HiSeq (1), Illumina (2), MiSeq (3) and TruSeq (4) are registered trademarks of Illumina Inc. San Diego, CA.

NGS Analyses of c-MYC

157

References 1. Dang CV (2012) MYC on the path to cancer. Cell 149(1):22–35 2. Meyer N, Penn LZ (2008) Reflecting on 25 years with MYC. Nat Rev Cancer 8 (12):976–990 3. Thorley-Lawson DA, Allday MJ (2008) The curious case of the tumour virus: 50 years of Burkitt’s lymphoma. Nat Rev Microbiol 6 (12):913–924 4. Nesbit CE, Tersak JM, Prochownik EV (1999) MYC oncogenes and human neoplastic disease. Oncogene 18(19):3004–3016 5. Marcu KB, Bossone SA, Patel AJ (1992) Myc function and regulation. Annu Rev Biochem 61:809–860 6. Chappell SA, LeQuesne JP, Paulin FE et al (2000) A mutation in the c-myc-IRES leads to enhanced internal ribosome entry in multiple myeloma: a novel mechanism of oncogene de-regulation. Oncogene 19(38):4437–4440 7. Albert T, Urlbauer B, Kohlhuber F et al (1994) Ongoing mutations in the N-terminal domain of c-Myc affect transactivation in Burkitt’s lymphoma cell lines. Oncogene 9(3):759–763 8. Salghetti SE, Kim SY, Tansey WP (1999) Destruction of Myc by ubiquitin-mediated proteolysis: cancer-associated and transforming mutations stabilize Myc. EMBO J 18 (3):717–726 9. He TC, Sparks AB, Rago C et al (1998) Identification of c-MYC as a target of the APC pathway. Science 281(5382):1509–1512 10. van de Wetering M, Sancho E, Verweij C et al (2002) The beta-catenin/TCF-4 complex imposes a crypt progenitor phenotype on colorectal cancer cells. Cell 111(2):241–250 11. Sansom OJ, Reed KR, Hayes AJ et al (2004) Loss of Apc in vivo immediately perturbs Wnt signaling, differentiation, and migration. Genes Dev 18(12):1385–1390 12. Murphy DJ, Junttila MR, Pouyet L et al (2008) Distinct thresholds govern Myc’s biological output in vivo. Cancer Cell 14 (6):447–457 13. Hermeking H, Eick D (1994) Mediation of cMyc-induced apoptosis by p53. Science 265 (5181):2091–2093 14. Vafa O, Wade M, Kern S et al (2002) c-Myc can induce DNA damage, increase reactive oxygen species, and mitigate p53 function: a mechanism for oncogene-induced genetic instability. Mol Cell 9(5):1031–1044 15. Dominguez-Sola D, Ying CY, Grandori C et al (2007) Non-transcriptional control of

DNA replication by c-Myc. Nature 448 (7152):445–451 16. Campaner S, Doni M, Verrecchia A et al (2010) Myc, Cdk2 and cellular senescence: old players, new game. Cell Cycle 9 (18):3655–3661 17. Menssen A, Hydbring P, Kapelle K et al (2012) The c-MYC oncoprotein, the NAMPT enzyme, the SIRT1-inhibitor DBC1, and the SIRT1 deacetylase form a positive feedback loop. Proc Natl Acad Sci U S A 109(4):E187–E196 18. Eilers M, Eisenman RN (2008) Myc’s broad reach. Genes Dev 22(20):2755–2766 19. Jung P, Hermeking H (2009) The c-MYC-AP4-p21 cascade. Cell Cycle 8 (7):982–989 20. Cowling VH, Cole MD (2006) Mechanism of transcriptional activation by the Myc oncoproteins. Semin Cancer Biol 16(4):242–252 21. Rahl PB, Lin CY, Seila AC et al (2010) c-Myc regulates transcriptional pause release. Cell 141(3):432–445 22. Adhikary S, Eilers M (2005) Transcriptional regulation and transformation by Myc proteins. Nat Rev Mol Cell Biol 6(8):635–645 23. Ayer DE, Lawrence QA, Eisenman RN (1995) Mad-max transcriptional repression is mediated by ternary complex formation with mammalian homologs of yeast repressor Sin3. Cell 80(5):767–776 24. Peukert K, Staller P, Schneider A et al (1997) An alternative pathway for gene regulation by Myc. EMBO J 16(18):5672–5686 25. Herold S, Wanzel M, Beuger V et al (2002) Negative regulation of the mammalian UV response by Myc through association with Miz-1. Mol Cell 10(3):509–521 26. Mao DY, Watson JD, Yan PS et al (2003) Analysis of Myc bound loci identified by CpG island arrays shows that max is essential for Myc-dependent repression. Curr Biol 13 (10):882–886 27. Staller P, Peukert K, Kiermaier A et al (2001) Repression of p15INK4b expression by Myc through association with Miz-1. Nat Cell Biol 3(4):392–399 28. Smale ST, Baltimore D (1989) The "initiator" as a transcription control element. Cell 57 (1):103–113 29. Patel JH, Loboda AP, Showe MK et al (2004) Analysis of genomic targets reveals complex functions of MYC. Nat Rev Cancer 4 (7):562–568 30. Wu CH, Sahoo D, Arvanitis C et al (2008) Combined analysis of murine and human

158

Rene Jackstadt et al.

microarrays and ChIP analysis reveals genes associated with the ability of MYC to maintain tumorigenesis. PLoS Genet 4(6):e1000090 31. Zhou L, Picard D, Ra YS et al (2010) Silencing of thrombospondin-1 is critical for myc-induced metastatic phenotypes in medulloblastoma. Cancer Res 70(20):8199–8210 32. Varlakhanova N, Cotterman R, Bradnam K et al (2011) Myc and Miz-1 have coordinate genomic functions including targeting Hox genes in human embryonic stem cells. Epigenetics Chromatin 4:20 33. Kidder BL, Yang J, Palmer S (2008) Stat3 and c-Myc genome-wide promoter occupancy in embryonic stem cells. PLoS One 3(12):e3932 34. Seitz V, Butzhammer P, Hirsch B et al (2011) Deep sequencing of MYC DNA-binding sites in Burkitt lymphoma. PLoS One 6(11): e26837 35. Perna D, Faga G, Verrecchia A et al (2012) Genome-wide mapping of Myc binding and gene regulation in serum-stimulated fibroblasts. Oncogene 31(13):1695–1709 36. Ji H, Wu G, Zhan X et al (2011) Cell-type independent MYC target genes reveal a primordial signature involved in biomass accumulation. PLoS One 6(10):e26057 37. Li Z, Van Calcar S, Qu C et al (2003) A global transcriptional regulatory role for c-Myc in Burkitt’s lymphoma cells. Proc Natl Acad Sci U S A 100(14):8164–8169 38. Orian A, Grewal SS, Knoepfler PS et al (2005) Genomic binding and transcriptional regulation by the Drosophila Myc and Mnt transcription factors. Cold Spring Harb Symp Quant Biol 70:299–307 39. Zeller KI, Zhao X, Lee CW et al (2006) Global mapping of c-Myc binding sites and target gene networks in human B cells. Proc Natl Acad Sci U S A 103(47):17834–17839 40. Varlakhanova NV, Knoepfler PS (2009) Acting locally and globally: Myc’s ever-expanding roles on chromatin. Cancer Res 69 (19):7487–7490 41. Knoepfler PS (2007) Myc goes global: new tricks for an old oncogene. Cancer Res 67 (11):5061–5063 42. Knoepfler PS, Zhang XY, Cheng PF et al (2006) Myc influences global chromatin structure. EMBO J 25(12):2723–2734 43. Lin CY, Loven J, Rahl PB et al (2012) Transcriptional amplification in tumor cells with elevated c-Myc. Cell 151(1):56–67 44. Nie Z, Hu G, Wei G et al (2012) C-Myc is a universal amplifier of expressed genes in lymphocytes and embryonic stem cells. Cell 151 (1):68–79

45. Lorenzin F, Benary U, Baluapuri A et al (2016) Different promoter affinities account for specificity in MYC-dependent gene regulation. elife 5:e15161 46. Sabo A, Kress TR, Pelizzola M et al (2014) Selective transcriptional regulation by Myc in cellular growth control and lymphomagenesis. Nature 511(7510):488–492 47. Walz S, Lorenzin F, Morton J et al (2014) Activation and repression by oncogenic MYC shape tumour-specific gene expression profiles. Nature 511(7510):483–487 48. Zeller KI, Jegga AG, Aronow BJ et al (2003) An integrated database of genes responsive to the Myc oncogenic transcription factor: identification of direct genomic targets. Genome Biol 4(10):R69 49. Lujambio A, Lowe SW (2012) The microcosmos of cancer. Nature 482(7385):347–355 50. Bui TV, Mendell JT (2010) Myc: maestro of MicroRNAs. Genes Cancer 1(6):568–575 51. Frenzel A, Loven J, Henriksson MA (2010) Targeting MYC-regulated miRNAs to combat cancer. Genes Cancer 1(6):660–667 52. Robertus JL, Kluiver J, Weggemans C et al (2010) MiRNA profiling in B non-Hodgkin lymphoma: a MYC-related miRNA profile characterizes Burkitt lymphoma. Br J Haematol 149(6):896–899 53. Kim JW, Mori S, Nevins JR (2010) Myc-induced microRNAs integrate Myc-mediated cell proliferation and cell fate. Cancer Res 70(12):4820–4828 54. Mu P, Han YC, Betel D et al (2009) Genetic dissection of the miR-17~92 cluster of microRNAs in Myc-induced B-cell lymphomas. Genes Dev 23(24):2806–2811 55. Lin CH, Jackson AL, Guo J et al (2009) Myc-regulated microRNAs attenuate embryonic stem cell differentiation. EMBO J 28 (20):3157–3170 56. Watson JD, Oster SK, Shago M et al (2002) Identifying genes regulated in a Myc-dependent manner. J Biol Chem 277 (40):36921–36930 57. Eilers M, Picard D, Yamamoto KR et al (1989) Chimaeras of myc oncoprotein and steroid receptors cause hormone-dependent transformation of cells. Nature 340 (6228):66–68 58. Jung P, Menssen A, Mayr D et al (2008) AP4 encodes a c-MYC-inducible repressor of p21. Proc Natl Acad Sci U S A 105 (39):15046–15051 59. Mateyak MK, Obaya AJ, Adachi S et al (1997) Phenotypes of c-Myc-deficient rat fibroblasts

NGS Analyses of c-MYC isolated by targeted homologous recombination. Cell Growth Differ 8(10):1039–1048 60. Lachmann A, Torre D, Keenan AB et al (2018) Massive mining of publicly available RNA-seq data from human and mouse. Nat Commun 9(1):1366 61. Kodama Y, Shumway M, Leinonen R et al (2012) The sequence read archive: explosive growth of sequencing data. Nucleic Acids Res 40(Database issue):D54–D56 62. Leinonen R, Sugawara H, Shumway M et al (2011) The sequence read archive. Nucleic Acids Res 39(Database issue):D19–D21 63. Goodwin S, McPherson JD, McCombie WR (2016) Coming of age: ten years of nextgeneration sequencing technologies. Nat Rev Genet 17(6):333–351 64. Stark R, Grzelak M, Hadfield J (2019) RNA sequencing: the teenage years. Nat Rev Genet 20(11):631–656 65. Metzker ML (2010) Sequencing technologies - the next generation. Nat Rev Genet 11 (1):31–46 66. Wang Z, Gerstein M, Snyder M (2009) RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet 10(1):57–63 67. Han H, Nutiu R, Moffat J et al (2011) SnapShot: high-throughput sequencing applications. Cell 146(6):1044, 1044.e1-2 68. Conesa A, Madrigal P, Tarazona S et al (2016) A survey of best practices for RNA-seq data analysis. Genome Biol 17:13 69. Chen C, Ridzon DA, Broomer AJ et al (2005) Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res 33 (20):e179 70. Menssen A, Hermeking H (2002) Characterization of the c-MYC-regulated transcriptome by SAGE: identification and analysis of c-MYC target genes. Proc Natl Acad Sci U S A 99(9):6274–6279 71. Alexandrow MG, Moses HL (1995) Transforming growth factor beta and cell cycle regulation. Cancer Res 55(7):1452–1457 72. Menssen A, Epanchintsev A, Lodygin D et al (2007) c-MYC delays prometaphase by direct transactivation of MAD2 and BubR1: identification of mechanisms underlying c-MYCinduced DNA damage and chromosomal instability. Cell Cycle 6(3):339–352 73. Barfeld SJ, Urbanucci A, Itkonen HM et al (2017) C-Myc antagonises the transcriptional activity of the androgen receptor in prostate cancer affecting key gene networks. EBioMedicine 18:83–93 74. Thomas LR, Adams CM, Wang J et al (2019) Interaction of the oncoprotein transcription factor MYC with its chromatin cofactor

159

WDR5 is essential for tumor maintenance. Proc Natl Acad Sci U S A 116 (50):25260–25268 75. Fernandez PC, Frank SR, Wang L et al (2003) Genomic targets of the human c-Myc protein. Genes Dev 17(9):1115–1129 76. Martinato F, Cesaroni M, Amati B et al (2008) Analysis of Myc-induced histone modifications on target chromatin. PLoS One 3(11):e3650 77. Park PJ (2009) ChIP-seq: advantages and challenges of a maturing technology. Nat Rev Genet 10(10):669–680 78. Valouev A, Johnson DS, Sundquist A et al (2008) Genome-wide analysis of transcription factor binding sites based on ChIP-Seq data. Nat Methods 5(9):829–834 79. Langmead B, Trapnell C, Pop M et al (2009) Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol 10(3):R25 80. Li H, Durbin R (2009) Fast and accurate short read alignment with burrows-wheeler transform. Bioinformatics 25(14):1754–1760 81. Kim D, Pertea G, Trapnell C et al (2013) TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol 14(4):R36 82. Dobin A, Davis CA, Schlesinger F et al (2013) STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29(1):15–21 83. Kim D, Langmead B, Salzberg SL (2015) HISAT: a fast spliced aligner with low memory requirements. Nat Methods 12 (4):357–360 84. Ziemann M, Kaspi A, El-Osta A (2016) Evaluation of microRNA alignment techniques. RNA 22(8):1120–1138 85. Hackenberg M, Sturm M, Langenberger D et al (2009) miRanalyzer: a microRNA detection and analysis tool for next-generation sequencing experiments. Nucleic Acids Res 37(Web Server issue):W68–W76 86. Hackenberg M, Rodriguez-Ezpeleta N, Aransay AM (2011) miRanalyzer: an update on the detection and analysis of microRNAs in high-throughput sequencing experiments. Nucleic Acids Res 39(Web Server issue): W132–W138 87. Friedlander MR, Mackowiak SD, Li N et al (2012) miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades. Nucleic Acids Res 40(1):37–52 88. Lu Y, Baras AS, Halushka MK (2018) miRge 2.0 for comprehensive analysis of microRNA sequencing data. BMC Bioinformatics 19 (1):275

160

Rene Jackstadt et al.

89. Fejes AP, Robertson G, Bilenky M et al (2008) FindPeaks 3.1: a tool for identifying areas of enrichment from massively parallel short-read sequencing technology. Bioinformatics 24(15):1729–1730 90. Feng J, Liu T, Qin B et al (2012) Identifying ChIP-seq enrichment using MACS. Nat Protoc 7(9):1728–1740 91. Zhu JY, Sun Y, Wang ZY (2012) Genomewide identification of transcription factorbinding sites in plants using chromatin immunoprecipitation followed by microarray (ChIP-chip) or sequencing (ChIP-seq). Methods Mol Biol 876:173–188 92. Furey TS (2012) ChIP-seq and beyond: new and improved methodologies to detect and characterize protein-DNA interactions. Nat Rev Genet 13(12):840–852 93. Nakato R, Shirahige K (2017) Recent advances in ChIP-seq analysis: from quality management to whole-genome annotation. Brief Bioinform 18(2):279–290 94. Bailey TL, Boden M, Buske FA et al (2009) MEME SUITE: tools for motif discovery and searching. Nucleic Acids Res 37(Web Server issue):W202–W208 95. Cantacessi C, Jex AR, Hall RS et al (2010) A practical, bioinformatic workflow system for large data sets generated by next-generation sequencing. Nucleic Acids Res 38(17):e171 96. Pepke S, Wold B, Mortazavi A (2009) Computation for ChIP-seq and RNA-seq studies. Nat Methods 6(11 Suppl):S22–S32 97. Anders S, Pyl PT, Huber W (2015) HTSeq--a Python framework to work with highthroughput sequencing data. Bioinformatics 31(2):166–169 98. Liao Y, Smyth GK, Shi W (2014) featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30(7):923–930 99. Law CW, Chen Y, Shi W et al (2014) Voom: precision weights unlock linear model analysis tools for RNA-seq read counts. Genome Biol 15(2):R29 100. Anders S, Huber W (2010) Differential expression analysis for sequence count data. Genome Biol 11(10):R106 101. Love MI, Huber W, Anders S (2014) Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15(12):550 102. Robinson MD, McCarthy DJ, Smyth GK (2010) edgeR: a Bioconductor package for

differential expression analysis of digital gene expression data. Bioinformatics 26 (1):139–140 103. Trapnell C, Roberts A, Goff L et al (2012) Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat Protoc 7 (3):562–578 104. Goecks J, Nekrutenko A, Taylor J (2010) Galaxy: a comprehensive approach for supporting accessible, reproducible, and transparent computational research in the life sciences. Genome Biol 11(8):R86 105. Friedman RC, Farh KK, Burge CB et al (2009) Most mammalian mRNAs are conserved targets of microRNAs. Genome Res 19(1):92–105 106. Agarwal V, Bell GW, Nam JW et al (2015) Predicting effective microRNA target sites in mammalian mRNAs. elife 4:e05005 107. Anders G, Mackowiak SD, Jens M et al (2012) doRiNA: a database of RNA interactions in post-transcriptional regulation. Nucleic Acids Res 40(Database issue): D180–D186 108. Betel D, Wilson M, Gabow A et al (2008) The microRNA.org resource: targets and expression. Nucleic Acids Res 36(Database issue): D149–D153 109. Dweep H, Gretz N (2015) miRWalk2.0: a comprehensive atlas of microRNA-target interactions. Nat Methods 12(8):697 110. Liberzon A, Birger C, Thorvaldsdottir H et al (2015) The molecular signatures database (MSigDB) hallmark gene set collection. Cell Syst 1(6):417–425 111. Liberzon A (2014) A description of the molecular signatures database (MSigDB) web site. Methods Mol Biol 1150:153–160 112. Subramanian A, Tamayo P, Mootha VK et al (2005) Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A 102(43):15545–15550 113. Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29(9):e45 114. Frank SR, Schroeder M, Fernandez P et al (2001) Binding of c-Myc to chromatin mediates mitogen-induced acetylation of histone H4 and gene activation. Genes Dev 15 (16):2069–2082 115. Pfaffl MW (2010) The ongoing evolution of qPCR. Methods 50(4):215–216

Chapter 8 Analysis of Myc Chromatin Binding by Calibrated ChIP-Seq Approach Donald P. Cameron, Vladislav Kuzin, and Laura Baranello Abstract Here, we present a strategy to map and quantify the interactions between Myc and chromatin using a calibrated Myc ChIP-seq approach. We recommend the use of an internal spike-in control for postsequencing normalization to enable detection of broad changes in Myc binding as can occur under conditions with varied Myc abundance. We also highlight a range of bioinformatic analyses that can dissect the downstream effects of Myc binding. These methods include peak calling, mapping Myc onto an integrated metagenome, juxtaposing ChIP-seq data with matching RNA-seq data, and identifying gene ontologies enriched for genes with high Myc binding. Our aim is to provide a guided strategy, from cell harvest through to bioinformatic analysis, to elucidate the global effects of Myc on transcription. Key words Myc, ChIP-seq, Spike-in normalization

1

Introduction The Myc family of transcription factors (consisting of c-Myc, n-Myc, and l-Myc) is typically upregulated in all types of cancer [1]. All Myc proteins contain a basic helix-loop-helix-leucine zipper (bHLH/ZIP) domain that can heterodimerize with another bHLH/ZIP protein Max to enable DNA binding. The Myc/Max heterodimer exhibits high affinity towards DNA motifs called E-boxes with the canonical sequence CACGTG. However, unlike other specific transcription factors, Myc binds the promoters of essentially all active genes, even in the absence of the E-box sequence [2, 3]. The variance in Myc-binding affinity is mediated by sequence, binding partners, and potentially other mechanisms [4].

Donald P. Cameron and Vladislav Kuzin contributed equally with all other contributors. Laura Soucek and Jonathan Whitfield (eds.), The Myc Gene: Methods and Protocols, Methods in Molecular Biology, vol. 2318, https://doi.org/10.1007/978-1-0716-1476-1_8, © Springer Science+Business Media, LLC, part of Springer Nature 2021

161

162

Donald P. Cameron et al.

Myc acts as a transcriptional amplifier, exponentially upregulating expression of transcribed genes depending on the degree of Myc binding to gene promoters and enhancers [2, 3]. This enables the cell to efficiently amplify global gene transcription by modulating the abundance of one protein, rather than a broad range of transcription factors [5]. However, this feature can be a doubleedged sword since overexpression of Myc can promote oncogenic transformation through priming premalignant cells to acquire further oncogenic mutations and through the maintenance of pathological levels of transcription [6]. Pairing RNA-seq data with Myc binding is essential to understand how Myc is able to regulate transcription. Because of Myc’s role as a transcription amplifier, capturing the effect of Myc on transcription is more challenging than assessing the effects of other transcription factors with specific targets. RNA-seq data from samples with differential Myc expression must be normalized to an internal spike-in control, or else the global changes in Myc-driven transcription would be obscured by library size correction [7]. This transcription data can be complemented by using chromatin immunoprecipitation (ChIP) to detect interactions between Myc and DNA. This technique uses formaldehyde to cross-link Myc to chromatin enabling enrichment of DNA bound with Myc using Myc-specific antibodies [8]. This method can be combined with next-generation sequencing to identify Myc-binding sites across the genome [9]. However, when comparing conditions with varied Myc abundance, simply identifying Myc-binding sites does not reveal the complexity of Myc transcriptional effects. It is crucial to accurately measure the comparative levels of Myc binding to encapsulate Myc function. Therefore, as with RNA-seq, spike-in controls are recommended for analyzing ChIP-seq data as traditional normalization methods using input DNA and background signal cannot fully account for global changes in transcription [10]. Here, we present a method to perform calibrated Myc ChIPseq in human cells. In Subheadings 3.1–3.4, we describe the cell fixation and harvest, ChIP, DNA purification, and library preparation for sequencing. As discussed previously, we use a spike-in control to best capture global shifts in Myc binding. Multiple methods for normalizing ChIP-seq data are currently used [11– 16], but we found that spiking our samples with Drosophila chromatin and co-immunoprecipitating with a Drosophila-specific histone modification provided the most consistent and accurate results [16]. We also outline a range of bioinformatic tools and techniques for analyzing Myc binding and subsequent effects on transcription. Subheading 3.5 describes how the sequencing data undergoes quality control checks before getting aligned to the human and Drosophila genomes. Subsequently, the human ChIP data is normalized to the spike-in control and the input sample. We then suggest a range of downstream analytical method that can be used

Analysis of Myc Chromatin Binding by Calibrated ChIP-Seq Approach

163

to assess the effects of Myc binding. In Subheading 3.6, we demonstrate how classical peak calling can be used to identify Myc-binding sites. In Subheading 3.7, we use gene set enrichment analysis (GSEA) to determine which gene ontologies are enriched for high Myc-binding sites. In Subheading 3.8, we assess global Myc binding to genes by mapping Myc to a representation of all genes overlaid onto one locus. In Subheading 3.9, we crossreference Myc binding with RNA-seq data demonstrating that Myc binding correlates with level of expression. To illustrate how this protocol functions, we processed HCT-116 cells with Myc siRNA knockdown (or scrambled siRNA control) according to the protocol described. We produced duplicate samples (labeled siNT for the control and siMYC for the knockdown) to illustrate the effectiveness of the normalization methods. We also performed ChIP-seq using an antibody recognizing the phosphorylated serine 5 repeats on the CTD of RNA Polymerase II (RNAPII) as a positive control, and we analyzed publicly available RNA-seq data from HCT-116 cells for comparison with the Myc ChIP-seq data. With this chapter, we intend to provide a comprehensive and integrated guide to assess Myc function in transcription in an unbiased way. Our approach can be applied by researchers without strong expertise in bioinformatics and aims to highlight the importance of including spike-in controls when studying Myc activity along the genome.

2 2.1

Materials Reagents

1. Tissue culture 15 cm plastic dishes and disposable pipettes. 2. Cell culture media. 3. 0.05% Trypsin–EDTA, phenol red. 4. 16% methanol-free formaldehyde. 5. Proteinase K (solution in water, 20 mg/ml). 6. Complete protease inhibitor cocktail. 7. AEBSF (50 mg/ml or 208 mM stock). 8. RNase A. 9. Agarose. 10. Anti-Myc antibody (Abcam, ab32072). 11. Anti-IgG (Santa Cruz, sc2025). 12. Anti-RNA Polymerase II CTD repeat YSPTSPS phospho S5 (Abcam, ab5408). 13. Protein A/G magnetic beads. 14. Phenol:chloroform:isoamyl alcohol 25:24:1. 15. 3 M sodium acetate pH 5.2.

164

Donald P. Cameron et al.

16. 100% ethanol. 17. GlycoBlue (Thermo Fisher, AM9515). 18. Spike-in chromatin (Active Motif, 53083). 19. Spike-in antibody (Active Motif, 61686). 20. Myc promoter forward primer: GGACTCAGTCTGGGTG GAAGG. 21. Myc promoter reverse primer: AAGGAGGAAAACGATGCC TAGA. 22. Chr12 intergenic forward primer: GGTGGCTCAGCTGCAA GATA. 23. Chr12 intergenic reverse primer: AACACAAAGCCCCATG CAAC. 24. Qubit dsDNA HS Assay Kit (Thermo, Q32854). 25. ThruPLEX DNA-seq kit (Takara, R400675). 26. DNA HT Dual Index Kit—24N (Takara, R400664). 27. AMPure XP beads (Beckman, A63880). 2.2

Buffers

All buffers must be filter-sterilized, and filter tips should be used to avoid contamination. 1. Deionized, DNase- and RNase-free water. 2. PBS buffer. 3. Glycine 1 M. 4. PBIA: PBS, 0.5% BSA, 1
protease inhibitor, 0.5 mM AEBSF. 5. RIPA: 10 mM Tris–HCl pH 8.0, 1 mM EDTA, 1% Triton X 100, 0.1% SDS, 200 mM NaCl, 0.1% Na-Deoxycholate (DOC), 1
protease inhibitor, 0.5 mM AEBSF. 6. TAE buffer: 40 mM Tris base, 20 mM acetic acid, 1 mM EDTA. 7. RIPA 300 buffer: 10 mM Tris–HCl pH 8.0, 1 mM EDTA, 1% Triton, 0.1% SDS, 300 mM NaCl, 0.1% DOC, 1
protease inhibitor, 0.5 mM AEBSF. 8. LiCl buffer: 10 mM Tris–HCl pH 8.0, 1 mM EDTA, 250 mM LiCl, 0.5% NP40, 0.5% DOC, 1
protease inhibitor, 0.5 mM AEBSF. 9. TE: 10 mM Tris–HCl pH 8.0, 1 mM EDTA, 1
protease inhibitor, 0.5 mM AEBSF. 10. TES: 10 mM Tris–HCl pH 8.0, 1 mM EDTA, 0.25% SDS. 11. TENC: 10 mM Tris–HCl pH 8.0, 1 mM EDTA, 0.5 M NaCl. 12. EB buffer: 10 mM Tris–HCl pH 8.5.

Analysis of Myc Chromatin Binding by Calibrated ChIP-Seq Approach

2.3

Equipment

165

1. Cell counter/hemocytometer. 2. Plate scrapers. 3. Sonicator suitable for shearing chromatin (see Note 1). 4. Heat blocks for PCR and 1.5 ml tubes. 5. Rotating Eppendorf rack (to be placed in the fridge). 6. Qubit Fluorometer. 7. Bioanalyzer. 8. Illumina NextSeq 550 sequencer, or any NGS platform.

2.4

Software

Newer or older versions of the software listed below may cause issues with the analysis. 1. FastQC (version 0.11.8) (www.bioinformatics.babraham.ac. uk/projects/fastqc/). 2. Samtools (version 1.8) [17]. 3. Picard (version picard).

2.10.3)

(www.broadinstitute.github.io/

4. Bowtie2 (version 2.3.5.1) [18]. 5. MultiQC (version 1.8) [19]. 6. Cutadapt (version 2.3) [20]. 7. Deeptools (version 3.1.0) [21]. 8. R (version 3.6.2) [22]. 9. RStudio (version 1.2.5033) [23]. 10. clusterProfiler (version 3.14.3) [24]. 11. Org.Hs.eg.db (version 3.10) [25]. 12. MACS (version 2.2.6) [26]. 13. Gnuparallel (version 20180822) [27]. 14. Seqplots (version 1.24.0) [28].

3 3.1

Methods Cell Harvest

1. Plate cells in 15 cm dishes in 15 ml growth media to be approximately 60–70% confluent when harvested after 48–72 h (see Note 2). For HCT-116 cells, plating 3
106 cells should yield 20
106 cells after 48 h. Prepare one extra plate for cell counting. 2. Wash the counting plate twice with PBS, then add 3 ml of trypsin and incubate at 37  C until the cells detach from the plate. 3. Neutralize the trypsin with 7 ml growth media and count the cells using a Coulter counter or hemocytometer to estimate the number of cells per plate.

166

Donald P. Cameron et al.

4. For plates to be harvested, add 1 ml of 16% formaldehyde (1% final concentration) dropwise to each plate, swirling to mix. Incubate at 37  C for 5 min (see Note 3). 5. Add 2 ml of 1 M glycine to give a final concentration of 0.125 M dropwise to each plate, swirling to mix. Incubate at room temperature for 5 min, then place plates on ice. 6. Wash plates twice with cold PBS. 7. Add 3 ml cold PBIA to each plate. Scrape cells off plate using plastic plate scrapers and transfer to 50 ml Falcon tubes. 8. Add a further 2 ml cold PBIA to each plate. Scrape any remaining cells from the plate and add to the Falcon tubes (see Note 4). 9. Centrifuge cells at 800
g for 4 min at 4  C. 10. Aspirate supernatant and resuspend in RIPA to a final concentration of 107 cells/ml. 11. Sonicate chromatin until the majority of DNA fragments are between 200 and 400 bp in size (see Note 1). 12. Centrifuge chromatin at 20,000
g for 15 min at 4  C, decant and keep supernatant and discard insoluble pellet (see Note 5). 13. Proceed to Subheading 3.2, or snap-freeze chromatin in liquid nitrogen and store at 80  C until ready to continue. 3.2 Chromatin Immunoprecipitation

All steps in this section are performed on ice unless otherwise specified. 1. Mix stock of Protein A/G magnetic beads by repeatedly inverting 10–20 times until all beads are resuspended. 2. Transfer sufficient amount of Protein A/G beads for experiment—assuming 35 μl per ChIP—into an Eppendorf tube (see Note 6). 3. Place tube with beads into magnetic rack. Allow beads to bind to the wall of the tube (about 30–45 s) and aspirate the supernatant. 4. Remove the tube from the magnetic rack and add 700 μl of RIPA. Resuspend beads by inverting tube 30 times and vortex 3–4 s at low setting (see Note 7). Pulse spin to eject buffer from the lid (no more than 1000
g for 10 s). Place in a magnetic rack until solution clears and aspirate buffer. 5. Repeat step 4 twice. 6. Remove the tube from the magnetic rack and add enough RIPA buffer to allow for 200 μl per ChIP. Resuspend beads by inverting tube 30 times. Pulse spin to eject buffer from the lid. 7. Aliquot 200 μl of bead mixture into Eppendorf tubes for each IP.

Analysis of Myc Chromatin Binding by Calibrated ChIP-Seq Approach

167

8. For Myc ChIP, add 2 μg of anti-Myc antibody to the beads. For negative control, add 2 μg of IgG to the beads. For positive control, add 2 μg of anti-Polymerase II pS5 to the beads (or use any preferred antibody for histones or abundant transcription factors). Also, add 1 μg of spike-in antibody to each tube containing the other antibodies. 9. Incubate at 4  C on a rotating platform for 6 h. 10. Place tubes onto magnetic rack, remove supernatant and wash beads with 700 μl of cold PBS. Resuspend beads by inverting tube 30 times. Pulse spin to eject buffer from the lid (see Note 8). 11. Place tubes onto magnetic rack, remove supernatant, and add 1 ml of chromatin (equivalent of 1
107 cells, prepared in Subheading 3.1, step 12) to each tube. Add 2 μl (20 ng) of spike-in chromatin control to each tube. 12. Save 50 μl of chromatin (prepared in Subheading 3.1, step 12), which will represent the input DNA control. This sample can be set aside at 4  C until step 20. 13. Incubate at 4  C on a rotating platform overnight. 14. Place tubes onto magnetic rack, remove supernatant, and wash beads with 700 μl of cold RIPA. Resuspend beads by inverting tube 30 times and vortex 3–4 s at low setting. Pulse spin to eject buffer from the lid. 15. Repeat step 14 once more. 16. Repeat step 14 twice, except with RIPA 300 buffer. 17. Repeat step 14 twice, except with LiCl buffer. 18. Repeat step 14 twice, except with TE buffer. 19. After the last wash (try to remove as much TE buffer as possible without touching the beads), add 125 μl TES buffer to the beads. 20. Add 75 μl TES to input samples, to get a final volume of 125 μl. 21. Add 3 μl proteinase K (approx. 500 μg/ml final concentration) solution to each tube, including input samples. Invert—and vortex if necessary—until all beads are resuspended. 22. Incubate tubes at 65  C on a shaking heat block for 4 h (or overnight). 23. Place ChIP tubes (not input tubes) onto the magnetic rack, and transfer supernatant with eluted DNA into fresh tubes. 24. Add 125 μl TENC to beads, resuspended beads by inverting and vortexing, place tubes into magnetic rack, and add supernatant to eluted DNA sample (see Note 9). For input samples, add 125 μl TENC directly to samples. From this point, process input samples alongside ChIP samples.

168

3.3

Donald P. Cameron et al.

DNA Purification

1. Add 250 μl of phenol–chloroform solution to each tube. Shake by hand for 2 s, then vortex on high setting for 5–10 s until sample is cloudy and homogeneous. Spin at max speed (15,000–20,000
g) for 10 min. 2. Carefully remove 245 μl of the top aqueous layer without touching the phenol layer and transfer to another tube. 3. Repeat steps 1 and 2, except removing only 230 μl. 4. Precipitate DNA by adding 23 μl 3 M Na-acetate (1/10 volume), 633 μl ice-cold 100% ethanol (2.5
volume), and 1.5 μl GlycoBlue (see Note 10). Vortex well and incubate overnight at 20  C. 5. Spin at max speed at 4  C for 30 min to pellet DNA. 6. Pour off the supernatant and wash pellet in 1 ml 70% ethanol. 7. Spin at max speed at 4  C for 30 min to pellet DNA. 8. Pour off the supernatant and carefully aspirate remaining liquid, taking care to avoid the DNA pellet. Allow the pellet to dry (approximately 10–30 min). 9. Resuspend the pellet in 30 μl EB buffer. Allow to resuspend for 1 h at room temperature. 10. If validation by qPCR is desired, take 5 μl of each sample and dilute to 100 μl with EB buffer. Dilute the input in the same way, then create at least two further tenfold dilutions (for 5%, 0.5%, 0.05% input samples). Perform qPCR using preferred primers. We test using positive (Myc promoter) and negative (chromosome 12 intergenic region) control primer sets listed in Subheading 2.1. 11. Store ChIP DNA at 20  C until ready to sequence.

3.4 Library Preparation and Sequencing

This section describes how to perform the library preparation and DNA sequencing using the Illumina NextSeq platform. If the user chooses the service of a sequencing core facility for library preparation and sequencing, this step can be skipped. 1. Quantify the DNA from ChIP and input samples with the Qubit dsDNA HS Assay Kit. 2. Take 10 μl of each sample and input as a control for library preparation with the ThruPLEX DNA-seq kit. It is important to keep track of the starting amount of DNA as this will affect further library amplification. For example, in our case, 10 μl corresponded to approximately 1–1.5 ng of DNA for the MYC ChIP samples and 6 ng of DNA for the RNAPII ChIP sample. 3. Generate the sequencing libraries according to the ThruPLEX DNA-seq kit protocol (see Note 11).

Analysis of Myc Chromatin Binding by Calibrated ChIP-Seq Approach

169

4. Check the amplification and fragment size distribution with the Agilent High Sensitivity DNA Kit on the Bioanalyzer. If the amplified samples show low yield (not detectable by Qubit, or no peak between 200 and 700 bp visible on Bioanalyzer), they can be further amplified with repeated cycles of 20 s at 98  C and 50 s at 72  C. 5. Perform library size selection using AMPure XP beads (see Note 12). 6. Add EB buffer to the library to obtain a final volume of 100 μl. 7. Add 65 μl of AMPure XP beads to each sample. 8. Mix carefully by pipette at least ten times. 9. Incubate at room temperature for 8 min. 10. Place on magnetic separation device. 11. Collect supernatant (fragments < 700 bp) and move it to tubes prefilled with 40 μl of beads. 12. Mix carefully by pipette at least ten times. 13. Incubate at room temperature for 8 min. 14. Place the tubes into magnetic separation device for 10 min or until the solution clears completely. 15. Remove the supernatant containing small DNA fragments including primers and primer dimers. 16. Add 200 μl of freshly prepared 80% ethanol, wait 30 s, and remove the ethanol. 17. Repeat step 16 once. 18. Spin briefly and remove any remaining ethanol. 19. Let the pellet dry for 12 min or until tiny cracks become visible in the beads. 20. Remove from magnetic rack and resuspend the beads in 20 μl of EB by mixing carefully with a pipette until the solution becomes homogenous without bead clumps. 21. Put the tubes into a magnetic separation device for at least 5 min or until the solution clears. 22. Transfer the library to a new tube avoiding beads carryover. This process should have selected for library fragments between 200 and 700 bp. 23. Check DNA size selection with the Agilent High Sensitivity DNA Kit on the Bioanalyzer. There should be a clear peak between 200 and 700 bp. If there are some additional peaks—e.g., primer dimers or longer DNA fragments—repeat the size selection. Calculate the average size of each sample.

170

Donald P. Cameron et al.

24. Measure the concentration of the samples with the Qubit dsDNA HS Assay Kit. 25. Based on the measurements of DNA length and concentration, calculate how much of each sample library should be combined to create a pooled library with equimolar amounts of each sample. 26. Take an aliquot of the pooled library for sequencing on the NextSeq (see Note 13). 27. Start the sequencing run following the NextSeq guide. 28. After the run is finished, download the fastq files for every sample. 3.5

Data Analysis

Code for the analysis is described as commands in the Linux/Unix shell. All the additional software is listed in Subheading 2.4. To begin the analysis, you should have one fastq.gz file for each of the samples, including input controls. 1. Prepare your working directory (${path}) for the analysis and create all the needed folders. mkdir fastq_untrimmed FastQC_untrimmed fastq_trimmed FastQC_trimmed bam bam_markdup bw_spike_in_norm ref UCSC expression_data

2. Download the human and Drosophila reference genomes from the UCSC website into the ref folder. In this protocol, we downloaded hg38.fa.gz from hgdownload.soe.ucsc.edu/goldenPath/hg38/bigZips/ and dm3.fa.gz from hgdownload.soe. ucsc.edu/goldenPath/dm3/bigZips/. 3. Unzip the genome files. > gunzip hg38.fa.gz > gunzip dm3.fa.gz

4. Use bowtie2 to index the reference genomes. > bowtie2-build –threads 4 ${path}/ref/hg38.fa hg38 > bowtie2-build –threads 4 ${path}/ref/dm3.fa dm3

5. Transfer all of the ChIP-seq fastq.gz files to the fastq_untrimmed folder.

Analysis of Myc Chromatin Binding by Calibrated ChIP-Seq Approach

171

6. Check the quality of the sequencing reads using FastQC. > for i in ${path}/fastq_untrimmed/*fastq.gz > do >

fastqc $i -t 4 --extract --outdir ${path}/FastQC_un-

trimmed > done > multiqc ${path}/FastQC_utrimmed

Open the file “multiqc_report.html” which is created in the FastQC_untrimmed folder. Important parameters to look at are: l

Sequence counts. You should expect to see a similar number of reads for each sample.

l

Sequence length distribution. All samples should be around same size.

l

Per sequence quality scores and per base sequence content. You can see if the run had any errors or biases and decide on the quality filtering.

l

Adapter content. Determine if there is adapter contamination and—if there is—which adapter to trim.

7. Trim the adapter sequences from the sequencing reads and filter out sequencing reads that are too short or low quality (see Note 14). > for file in ${path}/fastq_untrimmed/*.fastq.gz > do >

f="$(basename $file)"

>

h="${f%%.*}"

>

cutadapt -a AGATCGGAAGAGC -j 4 --trim-n --nextseq-trim

25 -m 30 -o ${path}/fastq_trimmed/$h".trimmed.fastq"

$file

> done

8. Confirm that the quality of the remaining reads has been improved by trimming and filtering by rerunning FastQC and MultiQC from step 4. > for i in ${path}/fastq_trimmed/* > do >

fastqc $i -t 4 --extract --outdir ${path}/FastQC_trimmed

> done > multiqc ${path}/FastQC_trimmed

172

Donald P. Cameron et al.

All adapter sequences should no longer be detected and the quality scores should improve. If not, repeat the trimming adjusting the parameters. You can set higher/lower threshold for the quality trimming or set another adapter sequence to be trimmed. 9. Align the reads to the human and Drosophila genomes and covert them to more memory-efficient bam files. > for i in ./fastq_trimmed/* > do >

f="$(basename $i)"

>

h="${f%%.*}"

>

bowtie2 -p 16 -x ${path}/ref/hg38

${path}/bam/$h.bam >

$i

| samtools sort -o

$i

| samtools sort -o

-@ 16

bowtie2 -p 16 -x ${path}/ref/dm3

${path}/bam/$h_dm3.bam

-@ 16

> done

10. Sort, mark duplicates and index reads. > for i in ${path}/bam/*.bam > do >

f="$(basename $i)"

>

h="${f%%.*}"

>

java -Xmx24g -jar $PICARD_HOME/picard.jar SortSam I=$i O=

${path}/bam/$h".sorted.bam" SORT_ORDER=coordinate >

java -Xmx24g -jar $PICARD_HOME/picard.jar MarkDuplicates

INPUT=${path}/bam/$h".sorted.bam" OUTPUT=${path}/bam_markdup/ $h".markdup.sorted.bam" METRICS_FILE=$h".metrics.txt" >

java -Xmx24g -jar $PICARD_HOME/picard.jar BuildBamIndex

I=${path}/bam_markdup/$h".markdup.sorted.bam" O=${path}/bam_markdup/$h".markdup.sorted.bam.bai" > done

11. Normalize human alignment to the Drosophila spike-in controls. For every sample, calculate the normalization factor, choose the sample with the lowest number of mapped Drosophila reads, and calculate the ratio of every samples read count to this value. In Table 1, the number of reads mapped to the human and Drosophila genomes is listed, along with the computed normalization factors and the normalized library sizes showing reduced reads in the Myc knockdown sample. 12. Create bigwig files to visualize ChIP-seq data. Repeat the below command with each sequencing sample.

512,014 370,621/512,014 ¼ 0.724 33,775,142
0.724 ¼ 24,453,203

370,621

370,621/370,621 ¼ 1

24,783,724
1 ¼ 24,783,724

Dm3 mapped reads

Norm. factor

Norm. library size

29,133,850
0.696 ¼ 20,277,160

370,621/532,323 ¼ 0.696

532,323

29,133,850

siMyc1

26,983,337
0.724 ¼ 19,535,936

370,621/511,756 ¼ 0.724

511,756

26,983,337

siMyc2

The total numbers of unique reads mapped to the Hg38 and Dm3 genomes for the four Myc ChIP samples are outline in the first two rows. The normalization factor (shown in bold) is calculated by dividing the number of reads mapped to the control genome from the sample with the lowest number of mapped reads—in this case, the siNT1 reads mapped to the Dm3 genome—by the number of reads mapped to the control genome from each sample. This is the factor used in Subheading 3.5, step 12. The normalized library size— calculated by multiplying the human mapped reads by the normalization factor—is also shown in bold in the final row illustrating the reduction in normalized Myc binding after Myc knockdown

33,775,142

24,783,724

Hg38 mapped reads

siNT2

siNT1

Sample

Table 1 Summary of normalized and unnormalized mapped ChIP-seq reads

Analysis of Myc Chromatin Binding by Calibrated ChIP-Seq Approach 173

174

Donald P. Cameron et al. > bamCoverage -b ${path}/bam_markdup/(sample_name).markdup. sorted.bam -o ${path}/bw_spike_in_norm/"(sample_name).bw" -scaleFactor (calculated in step 3.5.11) -bs 10 -p max -v

13. Load the bigwig files into a genome viewer such as IGV [29] or online genome browsers such as the UCSC (genome.ucsc. edu). In our experiment, Myc binding at the promoter of the two genes (RPL8 and ZNF34) is clearly shown to be reduced (Fig. 1a) in samples following Myc knockdown (Fig. 1b, c). 3.6

Peak Calling

Peak calling is useful to identify regions of the genome enriched for protein binding. However, the practically of using peak calling to study Myc is limited. Firstly, peak calling in general required semiarbitrary cutoffs for determining what is considered to be a “peak.” Also, since Myc does not have a specific set of target genes, peak calling will typically just identify actively transcribed gene promoters and open enhancers. While Myc has high affinity towards E-boxes, its recruitment to a gene promoter will be dependent on the level of gene transcription and the presence of other binding partners [2–4]. The peak calling method described briefly here could be used to see if Myc binding is lost at certain sites following knockdown/ overexpression of other transcription factors. But to observe the broader effects of Myc across the entire genome, it is more useful to perform metagenome analysis as described in the Subheading 3.8. 1. Create a folder in the ${path} directory called “peaks” which will contain the peak calling analysis. > mkdir ${path}/peaks

2. Create a single column text list of the sample names used in Subheading 3.5 for peak calling and save as sample_names.txt in the above peaks folder. 3. From the ${path}/bam_markdup/ folder, execute the following command to call ChIP peaks using MACS2 (see Note 15). In Table 2, we have outlined the number of peaks detected in our Myc ChIP-seq samples using different q-value (i.e., stringency) cutoff values. > cat ${path}/peaks/sample_names.txt | parallel --max-procs=6 ’macs2 callpeak -t {}.markdup.sorted.bam -g hs -n {}-sharpmodel -q 0.01 --outdir .${path}peaks/{}-sharp-model-peaks 2> {}-sharp-model.stderr’

Analysis of Myc Chromatin Binding by Calibrated ChIP-Seq Approach

A

B

175

C

siMyc1 siMyc2

100%

si M yc

siNT2

si NT

Relative Myc expression

siNT1

Myc

50%

Actin 0%

siNT

siMyc

RefSeq genes

D

GO:0003735 – structural constituent of ribosome

F high

25

6

Normalized RPM 2 3 4 5 6

siNT

Normalized RPM 5 10 15 20 25

E

med low

0

0

1

1

5

2

10

3

15

4

20

5

siMyc

-1kb −1kb

TSS 0bp

+1kb 1kb

-1kb −1kb

TSS 0bp

+1kb 1kb

Fig. 1 (a) Normalized Myc ChIP binding profiles (left) at chromosome 8:144,786,000–144,793,000 for four samples treated with nontargeting (siNT1 and siNT2) or Myc (siMyc1 and siMyc2) siRNA. The promoter regions of the RPL8 and ZNF34 genes are clearly bound by Myc protein. (b, c) Myc expression is reduced in the siMyc sample at the RNA and protein levels, as shown by qPCR (b) and Western blot (c). This is reflected in the ChIP profiles where Myc promoter binding is reduced in the siMyc samples. (d) GSEA plot of the running enrichment score of the gene ontology set GO:0003735 (structural constituent of ribosome) with genes ranked by level of Myc binding. The high maximal enrichment score (marked by the red dashed line) indicates that genes from this gene set exhibit high levels of Myc binding at the promoter. (e) Myc at the integrated transcription start site (TSS) region. Binding of Myc to loci within 1000 bp of gene TSS region is integrated into a single metagene region. Myc is enriched at the TSS, while Myc binding is reduced in the siMyc samples compared to the siNT samples. (f) Myc binding to the TSS correlates with gene expression. Using RNA-seq data from HCT-116 cells, expressed genes were sorted based on expression into high (top 5%), medium (top 5–50%), and low (bottom 50%) expression groups. Average Myc binding at the TSS of the genes in each group was plotted showing Myc binding correlation with gene expression level

176

Donald P. Cameron et al.

Table 2 Summary of the number of Myc peaks detected for each sample Sample

siNT1

siNT2

siMyc1

siMyc2

Total # of peaks

36,637

38,357

19,542

17,703

q-Value < 0.01

29,205

35,612

19,019

16,163

q-Value < 0.001

24,661

29,666

15,008

12,540

q-Value < 0.0001

21,370

25,941

11,984

10,041

The table illustrates how the number of “significant” peaks changes as the stringency of the peak calling—i.e., the q-value cutoff value—is modulated

3.7 GSEA for MycBinding Sites

Gene set enrichment analysis is a method for statistically measuring the prevalence of genes at either end of a ranked gene list within a gene ontology [30]. While Myc has been demonstrated to bind to the promoters of all expressed genes [2, 3], these promoters have varied affinity towards Myc depending on their sequences and binding cofactors [4]. Using the data produced from the previous steps, it is possible to use gene set enrichment analysis (GSEA) to determine which gene ontologies are enriched for Myc-bound genes. The following analysis is performed using R through the user-friendly RStudio interface with working directory set to ${path}, except for where stated in Subheading 3.7, step 6. 1. Install the required packages for the GSEA analysis. If prompted to install other dependencies, type a (for all), or yes, where necessary. > install.packages("BiocManager") > BiocManager::install("clusterProfiler") > library(clusterProfiler) > BiocManager::install("org.Hs.eg.db") > library(org.Hs.eg.db) > BiocManager::install("biomaRt") > library(biomaRt) > library(readr) > library(data.table)

2. Import transcription start site gene coordinates from the Ensembl Biomart. > human gene_coords=getBM(attributes=c("chromosome_name", "transcription_start_site", "hgnc_symbol"), mart=human)

Analysis of Myc Chromatin Binding by Calibrated ChIP-Seq Approach

177

3. Calculate the genomic coordinates from 400 bp from the transcription start site to set the region for Myc binding. > gene_coords$tss_minus=gene_coords$transcription_start_site400 > gene_coords$tss_plus=gene_coords$transcription_start_site +400

4. Simplify the table, remove lines without gene names, and convert chromosome names to the same as the bigwig files created in Subheading 3.5 (see Note 16). > gene_coords gene_coords gene_coords gene_coords$chromosome_name write.table(format(gene_coords,

scientific

=

FALSE),

file="genes_tss+-400.bed",row.names=FALSE, col.names = FALSE, sep="\t", quote=FALSE)

6. Exit RStudio, open the command line and navigate to the (${path}) folder. Use the deeptools software to count the number of normalized reads within each transcription start site region. It will count Myc reads for each bigwig file in the ${path}/bw_spike_in_norm/ folder. > multiBigwigSummary BED-file --bwfiles ${path}/bw_spike_in_norm /*bw --BED genes_tss+-400.bed --smartLabels -out scores_per_tss.npz --outRawCounts scores_per_tss.tab

7. Open RStudio again and prepare compatible files from the transcription start site bed files from step 5 (file1) and the Myc-binding counts from step 6 (file2). In our case, we calculated the average Myc binding from the duplicate Myc samples which were in columns 4 and 5 of file2.

178

Donald P. Cameron et al. > file1 setnames(file1, old = c("V1","V2","V3","V4"),new=c("Chr", "Start", "End", "Gene")) > file2 file2$average_high=(file2[4]+file2[5])/2

8. Merge both files and convert into a data table. > Myc_TSS400 require(data.table) > DT=as.data.table(merged)

9. Many genes have multiple transcripts with different transcription start sites. To collapse this list for GSEA, we selected the transcript with the highest Myc binding at the promoter so that each gene was only represented once on the list. > Myc_TSS400 gl names(gl) gl gsea gseadf View(gseadf)

Analysis of Myc Chromatin Binding by Calibrated ChIP-Seq Approach

179

12. Visualize the GSEA result for individual GO terms. Here, we plot the GO term “GO:0003735—structural constituent of ribosome” from our Myc ChIP-seq data (Fig. 1d). This GO term has been previously shown to be enriched within gene with high Myc-binding affinity [4]. > gseaplot(gsea, geneSetID = "GO:0003735")

3.8 Metagenome Analysis

Since Myc binds to all active promoters, it is more informative to visualize global changes in Myc binding rather than binding at individual genes. This is achieved by integrating multiple genes into a single metagene and plotting the average Myc-binding profile. Here, we demonstrate how to plot Myc binding at transcription start sites (TSS) using the Seqplots software [28]. Using the bed file containing the gene TSS from Subheading 3.7 and the normalized bigwig files from Subheading 3.6, we can plot the integrated Myc-binding profiles from each sample. Once again, the analysis described here is performed in RStudio, and it is assumed that the programs installed in Subheading 3.7 remain attached. 1. Create a bed file from the list of genes from Subheading 3.7, step 9, where the list of TSS has been collapse to have one TSS site per gene (see Note 17). > Myc_TSS write.table(Myc_TSS, file="Myc_TSS.bed",row.names=FALSE, col.names = FALSE, sep="\t", quote=FALSE)

2. Download and install the Seqplots R package (update and install all dependencies when prompted). > BiocManager::install("seqplots") > library(seqplots)

3. Run the Seqplots package to open a GUI from RStudio. > run()

4. Under the “Upload files” tab, click “Add files.” Click “Add files. . .,” then select both the bigwig files generated in Subheading 3.5, step 12, and the bed file Myc_TSS.bed created in Subheading 3.8, step 1. Include a user name for each sample. Click “Start upload” and exit window when completed.

180

Donald P. Cameron et al.

5. Under the “Create new plot array” tab, click “New plot set.” Under the “Tracks” tab, select the desired bigwig files to plot. Under the “Features” tab, select the bed file. In the options at the bottom of the display, select “Midpoint Features” and input the numbers of base pairs to map upstream and downstream of the TSS. Click “Run calculation.” 6. Select the features to plot and click “Profile.” This will show the integrated Myc-binding profile at the TSS. The panel on the left allows you to customize the plot labeling and style. In Fig. 1e, we illustrate how binding of Myc to the TSS is reduced in the siMyc samples. This difference can only be accurately determined by using normalized bigwig files for this analysis. 3.9 Intersecting RNA-Seq and ChIPSeq Data

To understand how Myc binding relates to transcription activation, it is useful to overlay and contrast Myc ChIP-seq data with RNAseq data. When performing comparative analysis, the Seqplots program is a useful platform as it enables the mapping of sequencing data to any list of genes or genomic regions. In this case, we used RNA-seq data from HCT-116 cells [31] and sorted the list of genes by FPKM (fragments per kilobase of transcript per million mapped reads), or in other words, by level of expression. We could then bin this list and demonstrate that Myc is most highly bound to the promoters of highly expressed genes (Fig. 1f). 1. Take RNA-seq data for your desired cell line and sort list by FPKM. Trim gene list by removing genes with no expression (FPKM ¼ 0). Bin genes as desired. Create new gene lists as .txt files with each gene listed in a different line (see Note 19). Save the gene lists expression_data folder. 2. Import the .txt files into R. Here, we split the genes by expression into the top 5% (high.txt), top 5%–50% (med.txt), and bottom 50% (low.txt). > high med low high_bed med_bed low_bed write.table(high_bed, file="expression_data/high.bed",row. names=FALSE, col.names = FALSE, sep="\t", quote=FALSE) > write.table(med_bed, file="expression_data/med.bed",row. names=FALSE, col.names = FALSE, sep="\t", quote=FALSE) > write.table(low_bed, file="expression_data/low.bed",row. names=FALSE, col.names = FALSE, sep="\t", quote=FALSE)

5. Run Seqplots as described in Subheading 3.8, steps 3–6, except importing the bed files created in the previous step. In Fig. 1f, we show how Myc binding is enriched at the promoter regions of highly transcribed genes.

4

Notes 1. There are many platforms available for chromatin sonication. We have had success using both the Bandelin probe sonicator and the Covaris ME220, but other platforms should be suitable. Care should be taken to prevent heat buildup during sonication as this can lead to decrosslinking of the chromatin. To avoid this, pulse sonicate in a chilled water bath. 2. Cells should be in the exponential growth phase to ensure transcription is not impaired. 3. Cells should not be fixed for more than 5 min as increased fixation time will result in nonspecific signal [32]. Therefore, care must be taken to ensure all plates are fixed for the same amount of time. We recommend starting a timer as soon as formaldehyde is added to the first plate, then staggering formaldehyde addition every 15 s. As soon as the formaldehyde is mixed into the final plate, place the plates immediately into the incubator. Ensure there is enough time to transfer the plates from the incubator to the hood before the 5 min are up. Add the glycine to neutralize the formaldehyde in a staggered manner as with the addition of formaldehyde to guarantee all plates are fixed for 5 min exactly. If more than four plates are being fixed, we recommend fixing the plates in batches. 4. This step is optional but serves to ensure that all cells on the plate are harvested. 5. It is important to not collect any of the insoluble fraction. If the pellet becomes dislodged from the side of the tube, respin it to affix. If using a probe sonicator, the pellet will probably be partially gray due to degradation of the probe tip. A more

182

Donald P. Cameron et al.

compact pellet can be achieved by centrifuging for 10 min, turning the tube 180 in the centrifuge, then centrifuging for 5 more minutes. This may allow the removal of more soluble chromatin without dislodging the pellet. 6. All pipetting of Protein A/G beads should be performed using filter tips with the tip cut off using sterile scissors to prevent clogging. Preparing beads for one extra IP will also limit the possibility of running out of beads in the final ChIP sample due to pipetting variability. 7. Consistency is essential to ensure reproducible ChIP results. It is best to resuspend the beads in exactly the same manner for all samples throughout this protocol. If inversion is not sufficient to fully resuspend the beads, vortexing at low setting can be done. 8. This step is important to remove unbound antibody and will improve chromatin immunoprecipitation significantly. 9. This step has the effect of washing the beads to elute any further DNA and to add salt to the eluted sample to prevent SDS precipitation during phenol–chloroform extraction. 10. GlycoBlue makes it easier to see the DNA pellet, but regular glycogen would also work fine. 11. At all steps preparing 10% extra Master Mix is very helpful to adjust for pipetting errors. All samples were amplified for ten cycles. 12. This step can be performed in either 1.5 ml or PCR tubes. The final step of library size selection can be difficult if magnet used is not strong enough. If you encounter carry over of beads during first separation, put the new tubes into the magnetic rack again and repeat separation. It is very important not to carry over beads into sequencing library. To be safe, one could also take smaller aliquots for the library pool while the tube is in the magnetic separation device. Retaining all eluates is recommended until correct size selection has been determined so that samples are not lost. 13. The NextSeq protocol describes working with 0.5, 1, 2, and 4 nM starting library pools; so depending on your pool’s molarity, select the highest. 14. In this instance, we trimmed off the adapter (-a AGATCGGAA GAGC) which was added during our library protocol, used -trim-n option to remove all flanking N bases from the reads, performed quality trimming specific for two-color chemistry used in NextSeq (--nextseq-trim 25), and removed all the reads which are shorter than 30 nucleotides (-m 30). 15. Description of MACS2 arguments we used: -t is the path to your bam file. -n is the name for output files, and -outdir is the directory where these files will be placed. -g is the genome size

Analysis of Myc Chromatin Binding by Calibrated ChIP-Seq Approach

183

which can be sequenced. Values for some genomes are already calculated in MACS2, for example, setting hs (homo sapiens) value equals to 2.7e9. -q is the q-value (minimum false discovery rate) which is calculated from p-values using the Benjamin-Hochberg procedure. In some versions of MACS2, peak calling might fail if it does not detect peaks with any individual chromosome. This can happen if the q-value cutoff is too strict, though version 2.2.6 does not seem to have this problem. 16. Chromosome names from Biomart have the format 1, 2, X, etc. Chromosome names generated during alignment have the format chr1, chr2, chrX, etc. 17. Any non-number values in bed file coordinates will result in downstream analysis failing. You can check if your coordinates have any symbols other than integers using awk by running a command. awk -F "\t" ’$2 !~ /^[0-9]+$/ {print $0}’ genes_tss+-400.bed

For example in our case, the output was: chrY 5e+06 5000800 PCDH11Y This can be fixed with search and replace by sed: sed -i ’s/5e+06/5000000/g’ genes_tss+-400.bed

18. keyType allows to choose the input for the genes. ENTREZID can be used here. ont allows you to choose to specifically look at biological process (“BP”), cellular component (“CC”), or molecular function (“MF”). minGSSize and maxGSSize set the minimum and maximum sizes of the gene ontologies tested. 19. Gene names can be in any standard format (i.e., Ensembl, gene symbol) as long as they match the format of the gene names from the bed files generated in Subheadings 3.7 and 3.8.

Acknowledgments The computations and data storage were enabled by resources in project SNIC 2018/8-390 provided by the Swedish National Infrastructure for Computing (SNIC) at UPPMAX, partially funded by the Swedish Research Council through grant agreement no. 2018-05973.

184

Donald P. Cameron et al.

References 1. Dang CV (2012) MYC on the path to cancer. Cell 149:22–35. https://doi.org/10.1016/j. cell.2012.03.003 2. Nie Z, Hu G, Wei G et al (2012) c-Myc is a universal amplifier of expressed genes in lymphocytes and embryonic stem cells. Cell 151:68–79. https://doi.org/10.1016/j.cell. 2012.08.033 3. Lin CY, Love´n J, Rahl PB et al (2012) Transcriptional amplification in tumor cells with elevated c-Myc. Cell 151:56–67. https://doi. org/10.1016/j.cell.2012.08.026 4. Lorenzin F, Benary U, Baluapuri A et al (2016) Different promoter affinities account for specificity in MYC-dependent gene regulation. Elife 5:e15161. https://doi.org/10.7554/eLife. 15161 5. Levens DL (2013) Cellular MYCro economics: balancing MYC function with MYC expression. Cold Spring Harb Perspect Med 3: a014233. https://doi.org/10.1101/ cshperspect.a014233 6. Gabay M, Li Y, Felsher DW (2014) MYC activation is a hallmark of cancer initiation and maintenance. Cold Spring Harb Perspect Med 4:a014241. https://doi.org/10.1101/ cshperspect.a014241 7. Love´n J, Orlando DA, Sigova AA et al (2012) Revisiting global gene expression analysis. Cell 151:476–482. https://doi.org/10.1016/j. cell.2012.10.012 8. Fernandez PC, Frank SR, Wang L et al (2003) Genomic targets of the human c-Myc protein. Genes Dev 17:1115–1129. https://doi.org/ 10.1101/gad.1067003 9. Zeller KI, Zhao X, Lee CWH et al (2006) Global mapping of c-Myc binding sites and target gene networks in human B cells. Proc Natl Acad Sci U S A 103:17834–17839. https://doi.org/10.1073/pnas.0604129103 10. Chen K, Hu Z, Xia Z et al (2015) The overlooked fact: fundamental need for spike-in control for virtually all genome-wide analyses. Mol Cell Biol 36:662–667. https://doi.org/10. 1128/MCB.00970-14 11. Baluapuri A, Hofstetter J, Dudvarski Stankovic N et al (2019) MYC recruits SPT5 to RNA polymerase II to promote processive transcription elongation. Mol Cell 74:674–687.e11. https://doi.org/10.1016/j.molcel.2019.02. 031 12. Zeid R, Lawlor MA, Poon E et al (2018) Enhancer invasion shapes MYCN-dependent transcriptional amplification in neuroblastoma.

Nat Genet 50:515–523. https://doi.org/10. 1038/s41588-018-0044-9 13. Bonhoure N, Bounova G, Bernasconi D et al (2014) Quantifying ChIP-seq data: a spiking method providing an internal reference for sample-to-sample normalization. Genome Res 24:1157–1168. https://doi.org/10.1101/gr. 168260.113 14. Orlando DA, Chen MW, Brown VE et al (2014) Quantitative ChIP-Seq normalization reveals global modulation of the epigenome. Cell Rep 9:1163–1170. https://doi.org/10. 1016/j.celrep.2014.10.018 15. Hu Z, Chen K, Xia Z et al (2014) Nucleosome loss leads to global transcriptional up-regulation and genomic instability during yeast aging. Genes Dev 28:396–408. https:// doi.org/10.1101/gad.233221.113 16. Egan B, Yuan C-C, Craske ML et al (2016) An alternative approach to ChIP-Seq normalization enables detection of genome-wide changes in histone H3 lysine 27 trimethylation upon EZH2 inhibition. PLoS One 11: e0166438. https://doi.org/10.1371/journal. pone.0166438 17. Li H, Handsaker B, Wysoker A et al (2009) The sequence alignment/map format and SAMtools. Bioinformatics 25:2078–2079. https://doi.org/10.1093/bioinformatics/ btp352 18. Langmead B, Salzberg SL (2012) Fast gappedread alignment with Bowtie 2. Nat Methods 9:357–359. https://doi.org/10.1038/nmeth. 1923 19. Ewels P, Magnusson M, Lundin S, K€aller M (2016) MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics 32:3047–3048. https://doi.org/10.1093/bioinformatics/ btw354 20. Martin M (2011) Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J 17:3–12. https://doi.org/ 10.14806/ej.17.1.200 21. Ramı´rez F, Du¨ndar F, Diehl S et al (2014) deepTools: a flexible platform for exploring deep-sequencing data. Nucleic Acids Res 42: W187–W191. https://doi.org/10.1093/nar/ gku365 22. R Core Team (2017) R: a language and environment for statistical computing 23. RStudio Team (2015) RStudio: integrated development for R. RStudio, Inc., Boston, MA 24. Yu G, Wang L-G, Han Y, He Q-Y (2012) clusterProfiler: an R package for comparing

Analysis of Myc Chromatin Binding by Calibrated ChIP-Seq Approach biological themes among gene clusters. OMICS 16:284–287. https://doi.org/10. 1089/omi.2011.0118 25. Carlson M (2019) org.Hs.eg.db: genome wide annotation for human 26. Feng J, Liu T, Qin B et al (2012) Identifying ChIP-seq enrichment using MACS. Nat Protoc 7:1728–1740. https://doi.org/10.1038/ nprot.2012.101 27. Tange O (2011) GNU parallel – the command-line power tool. USENIX Mag 36:42–47. https://doi.org/10.5281/zenodo. 1146014 28. Stempor P, Ahringer J (2016) SeqPlots – interactive software for exploratory data analyses, pattern discovery and visualization in genomics. Wellcome Open Res 1:14. https://doi. org/10.12688/wellcomeopenres.10004.1

185

29. Robinson JT, Thorvaldsdo´ttir H, Winckler W et al (2011) Integrative genomics viewer. Nat Biotechnol 29:24–26. https://doi.org/10. 1038/nbt.1754 30. Subramanian A, Tamayo P, Mootha VK et al (2005) Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A 102:15545–15550. https:// doi.org/10.1073/pnas.0506580102 31. Baranello L, Wojtowicz D, Cui K et al (2016) RNA polymerase II regulates topoisomerase 1 activity to favor efficient transcription. Cell 165:357–371. https://doi.org/10.1016/j. cell.2016.02.036 32. Baranello L, Kouzine F, Sanford S, Levens DL (2016) ChIP bias as a function of cross-linking time. Chromosome Res 24:175–181. https:// doi.org/10.1007/s10577-015-9509-1

Chapter 9 A High-Throughput Chromatin Immunoprecipitation Sequencing Approach to Study the Role of MYC on the Epigenetic Landscape Luca Fagnocchi and Alessio Zippo Abstract MYC is a transcription factor playing multiple functions both in physiological and pathological settings. Biochemical characterizations, combined with the analyses of MYC chromatin binding, have shown that its pleiotropic activity depends on the chromatin context and its protein–protein interactions with different cofactors. In order to determine the contribution of MYC in a certain biological condition, it would be relevant to analyze the concomitant binding of MYC and its associated proteins, in relationship to the chromatin environment. To this end, we here provide a simple method to parallel map the genome-wide binding of MYC-associated proteins, together with the chromatin profiling of multiple histone modifications. We detail the procedure to perform high-throughput ChIP-seq (HT-ChIP-seq) with a variety of biological samples. In addition, we describe simple bioinformatic steps to determine the distribution of MYC binding with respect to the chromatin context and the association of its cofactors. The described approach will permit the reproducible characterization of MYC activity in different biological contexts. Key words MYC, ChIP-seq, Epigenetics, Chromatin, Histone modifications

1

Introduction MYC belongs to a basic helix-loop-helix-leucine-zipper family of transcription factors (TFs), comprising MYCN and MYCL, which are evolutionarily conserved and share significant protein sequence similarities. Functionally, MYC proteins modulate multiple basic cellular processes including cell-cycle progression, cell growth, energy metabolism, RNA biosynthesis and maturation, differentiation, and apoptosis [1]. In somatic cells, MYC abundance is tightly controlled by transcriptional, posttranscriptional, and posttranslational regulatory mechanisms, tuning its transient expression during tissue homeostasis. The same regulatory circuitries are frequently disturbed in cancer cells, leading to MYC overexpression in more than 70% of tumors [2]. In addition, in certain tumorigenic settings, MYC deregulation is guided by genomic alterations

Laura Soucek and Jonathan Whitfield (eds.), The Myc Gene: Methods and Protocols, Methods in Molecular Biology, vol. 2318, https://doi.org/10.1007/978-1-0716-1476-1_9, © Springer Science+Business Media, LLC, part of Springer Nature 2021

187

188

Luca Fagnocchi and Alessio Zippo

including translocation, amplification, or enhancer hijacking [3]. Of importance, MYC deregulation is involved in multiple steps of tumorigenesis, including tumor initiation, maintenance, and also metastatic outgrowth [4, 5]. These observations, combined with the wide range of MYC protein levels retrieved in different oncogenic settings, indicate that this TF can elicit multiple regulatory functions, depending on the diverse cellular and environmental contexts. This point is further exemplified by analyzing the contribution of MYC in the maintenance of self-renewal capacity and pluripotency of embryonic stem cells (ESCs), as well as its function in cell reprogramming towards pluripotent stem cells [6– 10]. In this context, MYC participates to the self-propagating transcriptional regulatory network of ESCs by enforcing the Wnt/β-catenin signaling through the PRC2-dependent epigenetic silencing of Wnt antagonists [8]. This diversity of MYC biological functions has been explained by the fact that MYC is not a canonical transcription factor regulating a small subset of well-defined genes, but rather it works as a hub, interconnecting different TFs and cofactors on different regulatory elements of a wide set of targets. Genome-wide profiling in multiple cellular models showed that MYC preferentially binds to cis-regulatory elements, which are in an open chromatin state and enriched for its consensus sequences, the canonical E-box, and several noncanonical variants [11]. Upon its overexpression in cancer cells, MYC can invade most of the active promoters and multiple enhancers, alone or throughout cooperative binding with other TFs or cofactors such as MIZ-1 [12] or the H3K4-methylation reader WDR5 [13]. Besides its hetero-dimerization with MAX required for its DNA binding activity, MYC can interact with multiple proteins throughout the N-terminal transactivation domain (TAD), which is characterized by several conserved motifs (MB0-MBIV) that specify the recruitment of other regulators. Several proteomic approaches attempted to define the interactome of MYC, identifying multiple MYC-associated proteins, which could explain the diversity of its activity. MYC may alter the epigenetic landscape by interacting with chromatin regulators, such as the SWR1-related multiprotein complexes, SRCAP and p400/TIP60, or the chromatin remodeling complexes SWI/SNF (BRG1 and BAF60 components) and NuRD (CHD4 and GATAD2A). It also interacts with the chromatin topology regulators including the condensing-associated TFIIIC complex, the cohesin component RAD21 and the topoisomerases TOP2A/2B [14]. In addition, MYC modulates transcription elongation either by directly recruiting elongation factors such as such as SSRP1 and SPT5 or by indirectly favoring the recruitment of P-TEFb [15, 16]. Given this wide protein– protein interaction network, it is not surprising the finding that MYC binding is not only associated with gene activation but also with repression. MYC binds and represses promoters by several

High-Throughput ChIP-seq to Study MYC and Epigenetics

189

mechanisms, including cobinding and recruitment of histone methyl transferases, antagonizing the MIZ1 transcription factor, interacting with PRC1/2 proteins, and cooperating with the NCoR/SMRT corepressor [12, 17, 18]. Of importance, only a minority of MYC targets respond to its binding with a change in gene expression indicating that in multiple cases MYC binding at cis-regulatory elements does not result in transcription modulation. For this reason, it is important to combine mapping of MYC binding with the genome-wide profiling of its cofactors and histone marks, in order to determine the overall epigenetic outcome. Here, we present a method to perform genome-wide parallel mapping of MYC, its associated cofactors, and histone modifications by high-throughput chromatin immunoprecipitation sequencing (HT-ChIP-seq) [19, 20]. The methodology is based on chromatin immunoprecipitation (ChIP) of formaldehyde crosslinked biological samples, using antibodies specifically recognizing the protein of interest. Following the immunoprecipitation procedure, the bound DNA regions are purified, enriched throughout the library preparation, and detected by next-generation sequencing. The genome-wide mapping of the retrieved reads permits to identify the enriched genomic regions and to determine differential binding of the investigated proteins in response to MYC perturbation. By performing multiple profiling of chromatin factors and histone modifications, it is also possible to correlate the chromatin state of cis-regulatory elements with the relative enrichment of chromatin binding of MYC-associated proteins. Finally, the HTChIP-seq is suitable to integrate gene expression profiling (RNAseq) in the attempt to establish a functional link between chromatin binding and changes in gene expression. In Subheadings 3.1 and 3.2, we describe the methodology for sample preparation, including cell fixation and harvest, followed by cell lysis and chromatin preparation. In Subheadings 3.3 and 3.4, we detail the methodology for chromatin immunoprecipitation and purification of the enriched DNA samples, followed by size selection. In Subheading 3.5, we describe the methodology for in-house preparation of the libraries, which are compatible with Illumina sequencing platforms. Finally, in Subheadings 3.6 and 3.7, we describe a simple methodology for reads alignment and peak calling to identify the genomic regions bound by MYC and its associated proteins or enriched by specific histone marks.

2 2.1

Materials Reagents

1. Formaldehyde solution, 37% in H2O. 2. Glycine,
99.0%. 3. Complete EDTA-free protease inhibitor cocktail.

CATGCTTA

GCACATCT

TGCTCGAC

AGCAATTC

AGTTGCTT

CCAGTTAG

TTGAGCCT

B

C

D

E

F

G

H

AAGGATGT

TCGGAATG

CACATCCT

AACTTGAC

TTCGCTGA

GTATAACA

GGTCCAGA

ACCAACTG

2

TACTTAGC

CCTACCAT

ATTATGTT

TGTCGGAT

CAGGAGCC

CATAGCGA

TCTGGCGA

GCACACGA

3

ATTCTAGG

GTCGCCTT

ATAGCGTC

TCGCCTTG

CCTATGCC

GACAGTAA

AGGATCTA

GAAGAAGT

4

CCAGAGCT

TCCAGCAA

CAGCAAGG

AAGACACT

TTGAATAG

TTACGCAC

GTCTGATG

CGTTACCA

5

TAATGAAC

GAACCTAG

ATTGTCTG

TCTCGGTC

CCTTCGCA

GTCATCTA

AGGTTATC

TCCTTGGT

6

TATCCAGG

GACCAGGA

CAGCGGTA

AATGTTCT

TAAGCACA

CTGTAATC

CAACTCTC

AACGCATT

7

TGCTGCTG

GCCTAGCC

CGCCTTCC

ACTAAGAC

TATCTGCC

GCCGTCGA

CCAACATT

ACAGGTAT

8

TTGTCTAT

GTCCACAG

CTATGCGT

ATTATCAA

TGTAATCA

GTAACATC

CTAACTCG

AGGTAAGG

9

TCTGCAAG

GACCGTTG

CAATAGTC

ACAGTTGA

TCGCTAGA

GAAGGAAG

ATTCCTCT

AACAATGG

10

TGTAACTC

GATATCCA

CGCTATGT

AGCATGGA

TGCAAGTA

GACCTAAC

CCAGCACC

ACTGTATC

11

TTATATCT

GCCGCAAC

CTGTGGCG

AGGTGCGA

TTAATCAG

GCAGCCGT

CTGCGGAT

AGGTCGCA

12

The list of Illumina compatible adapters is reported here, with the sequence of the specific barcode. Adapters can be purchased from IDT as annealed duplexes (HPLC purification), resuspended at 15 μM. Each duplex is then diluted to a working concentration of 0.75 μM

CTACCAGG

A

1

Table 1 List of barcode adapters

High-Throughput ChIP-seq to Study MYC and Epigenetics

191

4. Phenylmethylsulphonyl fluoride (PMSF). 5. Phenol:chloroform:isoamyl alcohol 25:24:1. 6. 100% ethanol. 7. 3 M sodium acetate pH 5.2. 8. Agarose. 9. Anti-c-Myc (D84C12), rabbit monoclonal antibody (Cell Signaling Technology, 5605). 10. Anti-trimethyl histone H3 Lys4 (H3K4me3), rabbit polyclonal antibody (Millipore, 07-473). 11. Anti-monomethyl histone H3 Lys4 (H3K4me1), rabbit polyclonal antibody (Abcam, ab8895). 12. Anti-acetyl histone H3 Lys27 (H3K27ac), rabbit polyclonal antibody (Abcam, ab4729). 13. Anti-trimethyl histone H3 Lys27 (H3K27me3), rabbit polyclonal antibody (Millipore, 07-449). 14. Anti-trimethyl histone H3 Lys36 (H3K36me3), rabbit polyclonal antibody (Abcam, ab9050). 15. Anti-Suz12 (D39F6), rabbit monoclonal antibody (Cell Signaling Technology, 3737). 16. Anti-MIZ-1 (10E2), rabbit monoclonal antibody [12]. 17. Anti-WDR5, rabbit polyclonal antibody (Bethyl, A302-430A). 18. Anti-SPT5 (D-3), mouse monoclonal antibody (Santa Cruz Biotech., sc-133217). 19. Anti-RNApol ab26721).

II,

rabbit

polyclonal

antibody

(Abcam,

20. Normal Mouse IgG, polyclonal antibody (Millipore, 12-371). 21. Protein G-coupled Dynabeads. 22. Sonicated salmon sperm DNA. 23. BSA solution, 20 mg/ml in in H2O. 24. Agencourt AMPure XP Solid Phase Reversible Immobilization (SPRI) beads (Beckman, A63882). 25. Polyethylene glycol (PEG)-8000. 26. T4 PNK, 10000 U/ml (NEB, M0201L). 27. T4 POL, 3000 U/ml (NEB, M0203L). 28. T4 DNA Ligase Buffer, 10 (NEB, B0202S). 29. Klenow Fragment, 30 ! 50 exo-, 5000 U/ml (NEB, M0212L). 30. NEBuffer 2 (NEB, B7002S). 31. dATP solution, 100 mM (NEB, N0440S). 32. Quick Ligation Kit (NEB, M2200L).

192

Luca Fagnocchi and Alessio Zippo

33. PfuUltra II Fusion HS DNA Pol kit (Agilent, 600674). 34. dNTP solution set, 100 mM (NEB, N0446S). 35. Illumina compatible universal adapter (50 -phospho): 50 -p ACACTCTTTCCCTACACGACGCTCTTCCGATC *T-30 (* ¼ phosphorotioate modification) (IDT). 36. Illumina compatible indexed adapter (50 -phospho): 50 p- GATCGGAAGAGCACACGTCTGAACTCCAGT CAC NNNNNN ATCTCGTATGCCGTCTTCTGCTTG -30 (IDT) (see Table 1). 37. Reverse amplification primer: 50 - CAAGCAGAAGACGGCA TACGAGAT-30 (Sigma). 38. Forward amplification primer: 50 - AATGATACGGCGACCACCGAGATCTACACTCTT TCCCTACACGAC-30 (Sigma). 39. Qubit dsDNA HS Assay Kit (Thermo, Q32854). 40. High-Sensitivity DNA Kit (Agilent, 5067-4626). 2.2

Buffers

All buffers are sterilized by filtration and stored at room temperature, up to one month (see Note 1), unless differently specified. 1. Deionized, DNase- and RNase-free water (Invitrogen, AM9932). 2. PBS buffer (Invitrogen, 10010023). 3. Glycine solution, 1.25 M in H2O (see Note 2). 4. Lysis buffer: 50 mM Tris–HCl pH 8, 0.1% SDS, 10 mM EDTA, 1 complete EDTA-free protease inhibitor cocktail, 1 mM PMSF. 5. IP buffer: 50 mM Tris–HCl pH 8, 140 mM NaCl, 1 mM EDTA, 1% TRITON, 0.1% DOC, 0.1% SDS, 1 complete EDTA-free protease inhibitor cocktail, 1 mM PMSF. 6. Blocking buffer: 50 mM Hepes pH 7.9, 140 mM NaCl, 1 mM EDTA, 1% TRITON, 0.1% DOC, 0.1% SDS, 1 complete EDTA-free protease inhibitor cocktail, 1 mM PMSF, 1 mg/ ml sonicated salmon sperm DNA, 1 mg/ml BSA. 7. RIPA buffer: 10 mM Tris–HCl pH 8, 0.1% SDS, 1 mM EDTA pH 8, 140 mM NaCl, 1% DOC, 1% Triton, 1 complete EDTA-free protease inhibitor cocktail, 1 mM PMSF. 8. RIPA-500 buffer: 10 mM Tris–HCl pH 8, 0.1% SDS, 1 mM EDTA pH 8, 500 mM NaCl, 1% DOC, 1% Triton, 1 complete EDTA-free protease inhibitor cocktail, 1 mM PMSF. 9. LiCl buffer: 10 mM Tris–HCl pH 8, 0.1% SDS, 1 mM EDTA pH 8, 250 mM LiCl, 0.5% DOC, 0.5% NP-40, 1 complete EDTA-free protease inhibitor cocktail, 1 mM PMSF.

High-Throughput ChIP-seq to Study MYC and Epigenetics

193

10. TE buffer: 10 mM Tris–HCl pH 8, 1 mM EDTA pH 8, 1 complete EDTA-free protease inhibitor cocktail, 1 mM PMSF. 11. Direct elution buffer: 10 mM Tris–HCl pH 8, 0.5% SDS, 5 mM EDTA pH 8, 300 mM NaCl. 12. SPRI buffer: 20% PEG, 2.5 M NaCl pH 5.5. 13. ER buffer: 1 T4 DNA Ligase Buffer, 0.1 mg/ml BSA, 0.1 mM dNTPs, nuclease-free water (see Note 3). 14. AB buffer: 1 NEB buffer 2, 167 mM dATP, nuclease-free water (see Note 3). 15. ER mix (volumes for each sample): 25 μl ER buffer, 1 μl T4 PNK (10 U/μl), 1 μl T4 POL (3 U/μl). 16. AB mix (volumes for each sample): 17 μl AB buffer, 3 μl Klenow exo (5 U/μl). 17. AL mix (volumes for each sample): 29 μl 2 DNA Quick Ligase Buffer, 5 μl DNA Quick Ligase. 18. Amplification mix (volumes for each sample): 2 μl amplification primers (25 μM/each), 0.4 μl dNTPs (25 mM/each), 5 μl 10 PfuUltra II buffer, 1 μl PfuUltra II Fusion, 1.6 μl water. 2.3

Equipment

1. Tube/plate shaker. 2. Plate scrapers. 3. Chromatin sonication device (see Note 4). 4. Refrigerated bench centrifuge. 5. Heat blocks for 1.5 ml tubes. 6. NanoDrop (Thermo Scientific). 7. Qubit Fluorometer (Thermo Scientific). 8. Low adhesion 2 ml tubes. 9. Rotating wheel for 2 ml tubes. 10. Magnetic rack for 2 ml tubes. 11. 96-Well plates. 12. 96-Side skirted magnet (Thermo Scientific, 12027). 13. Multichannel pipettes. 14. Thermal cycler for 96-well plates. 15. Handheld vacuum aspirator (Sigma, CLS4930). 16. Vacuum aspirator 8-channel adapter (Sigma, CLS4931). 17. 2100 Bioanalyzer Instrument (Agilent).

2.4 Software and Bioinformatic Tools

1. fastQC (https://www.bioinformatics.babraham.ac.uk/pro jects/fastqc/). 2. multiqc [21].

194

Luca Fagnocchi and Alessio Zippo

3. Trimmomatic [22]. 4. Bowtie2 [23]. 5. SAMtools [24]. 6. deepTools [25]. 7. MACS2 [26]. 8. SICER [27]. 9. UCSC genome browser [28]. 10. IGV [29].

3

Methods

3.1 Cell Harvest and Fixation

1. The protocol could be applied to both adherent and liquid cultured cells and was proven to be effective with as low as 1  105 cells. Cells are harvested during exponential growth phase (~80% confluence) and fixed directly in their cultured medium. 2. Cross-link the cells by adding dropwise formaldehyde to a final concentration of 1% directly to culture medium (e.g., 270 ml of 37% formaldehyde stock solution in 10 ml of culture medium) and incubate 10 min at room temperature with gentle mixing on a shaker (see Note 5). 3. Quench formaldehyde by adding glycine to a final concentration of 125 mM (e.g., 1 ml of 1.25 M glycine stock in 10 ml of culture medium) and incubate for 5 min at room temperature. 4. From this point on, all following steps should be performed on ice or at 4  C to prevent degradation of proteins fixed to the DNA. Wash the cells three times with 1 ml ice-cold PBS. Adherent cells can be washed directly in the plates, while cells grown in suspension should be collect by spinning them at 1000  g for 5 min at 4  C. 5. Discard PBS and collect adherent fixed cells using a silicon scraper by adding a final 1 ml of ice-cold PBS. Both cells from adherent and liquid cultures are pelleted at 1000  g for 5 min at 4  C. 6. Discard supernatant. At this point, the fixed cell pellets can be stored at 20  C or further processed as in Subheading 3.2 (see Note 6).

3.2 Cell Lysis and Chromatin Sonication

All steps in this section are performed on ice or at 4  C, unless differently specified. 1. Carefully resuspend cell pellets in lysis buffer at a final concentration of 106 cells/ml.

High-Throughput ChIP-seq to Study MYC and Epigenetics

195

2. Sonicate suspension using calibrated conditions in order to reach an average DNA fragments size of 250–400 bp (see Note 7). 3. Centrifuge sonicated samples for 10 min at 20,000  g at 4  C, collect the cleared lysate, and transfer to a new tube. Discard the pellet. 4. In order to check the chromatin fragmentation, dilute 50 μl of sonicated sample in 450 μl of direct elution buffer and incubate at 65  C overnight (O/N) (see Note 8). 5. Perform phenol:chloroform extraction of sheared DNA, by adding 500 μl of phenol:chloroform:isoamyl alcohol 25:24:1 to the sample. Incubate 5 min at room temperature and centrifuge for 5 min at 20,000  g at room temperature. Place the supernatant in a new tube. 6. Precipitate the sheared DNA, by adding 1 the volume of 100% ethanol and sodium acetate to a final concentration of 0.3 M. Mix gently and store the solution 20 min at 20  C. 7. Centrifuge for 30 min at 20,000  g at room temperature 4  C and discard the supernatant. Wash once with 75% ethanol, discard supernatant, and resuspend in water. 8. Check sonication on agarose gel to confirm the expected average DNA fragments size of 250–400 bp (see Fig. 1a). 9. The quality-checked sonicated chromatin can be store at 20  C O/N or 80  C for longer conservation. Alternatively, proceed to Subheading 3.3. 3.3 Chromatin Immunoprecipitation and De-crosslinking

All steps in this section are performed on ice or at 4  C, unless differently specified. All buffers used in this section are ice-cold and contain protease and phosphatase inhibitors, added before use, with the only exception of the direct elution buffer. 1. Quantify chromatin by measuring the DNA amount at the NanoDrop and use 40–80 μg of sonicated chromatin for each immunoprecipitation (see Note 9). Save 1:10 of the immunoprecipitation volume for each chromatin sample, as the input DNA controls for each ChIP. 2. Bring each chromatin sample to 1 ml volume with IP buffer in 2 ml low adhesion tubes (see Note 10). 3. Add the desired antibody to the chromatin in the IP buffer. Add 4 or 2 μg of each antibody for MYC, other transcription/ chromatin and normal mouse IgG or histone marks, respectively (see Note 11). 4. Preclear 30 μl of protein G-coupled Dynabeads for each sample, by washing twice the beads in 1 ml IP buffer. Recover the beads using the magnetic rack after each washing step.

196

Luca Fagnocchi and Alessio Zippo

5. Resuspend the protein G-coupled Dynabeads in 1 ml blocking buffer. 6. Incubate both the immunoprecipitation reactions and the protein G-coupled Dynabeads on a rotating wheel O/N at 4  C. 7. The day after, wash twice beads in 1 ml IP buffer. Recover the beads using the magnetic rack after each washing step. 8. Resuspend the protein G-coupled Dynabeads in IP buffer with double of the starting volume (e.g., 60 μl for each sample). 9. Add 60 μl of precleared and blocked protein G-coupled Dynabeads to each immunoprecipitation reaction. 10. Incubate on a rotating wheel 3 h at 4  C. 11. Recover the immunoprecipitated complexes attached to the protein G-coupled Dynabeads using the magnet rack and remove the supernatant. 12. Resuspend each sample in 180 μl of RIPA buffer and transfer to chilled 96-well plates. 13. Using the 96-side skirted magnet and the handheld vacuum aspirator with the 8-channel adapter, remove the supernatant from the immunoprecipitated complexes attached to the protein G-coupled Dynabeads, and perform the following washing steps (see Note 12). 14. For each washing step, allow the beads to attach to the magnet by waiting ~30 s and remove supernatant with vacuum aspiration, with pipette tips facing the opposite well-side where beads adhere to the magnet. 15. Add the required washing buffer using a multichannel pipette. Do not resuspend the beads by pipetting, move the 96-well plate to the next right row of the 96-side skirted magnet and back. This will allow the beads to move from one side of the well to the other and gently mix with the washing buffer. 16. Wash beads with 180 μl cold RIPA buffer, five times. Aspirate supernatant. 17. Wash twice with 180 μl cold RIPA-500 wash buffer. Aspirate supernatant. 18. Wash twice with 180 μl cold LiCl wash buffer. Aspirate supernatant. 19. Wash once with 180 μl cold TE wash buffer. Aspirate supernatant. 20. Move the 96-well plate at room temperature and add 60 μl of direct elution buffer to each sample. From this step on, include the input DNA controls in separated wells, by bringing the initial volume of saved sonicated chromatin to 60 μl in direct elution. 21. Reverse cross-link by incubating the samples in the 96-well plate in the thermal cycler at 65  C O/N.

High-Throughput ChIP-seq to Study MYC and Epigenetics

A

197

B MYC HT-ChIP control qPCR

Chromatin sonication control

0.5

100 bp 1 kb sonicated chromatin ladder ladder % of input

0.4

3000

0.2 0.1

1000

500 400 300 200 100

0.3

500 250

0.02 0.01

D HT-ChIP-seq library control

L C

N

N

M

-5 FA S

C

E1

'

IG

0.00

2 kb

MYC K4me3 K27ac K4me1 K27me3 input

TSPAN31

CDK4

MIR6759

MYC K4me3 K27ac K4me1 K27me3 input

[FU] 50 0 35

150

300 500

10380

[bp]

100 kb

HOXB1 HOXB2 HOXB-AS1 HOXB3

HOXB8 PRAC1 HOXB4 HOXB9 PRAC2 HOXB7 HOXB13 HOXB5 HOXB6 HOXB-AS3

CALCOCO2 TTLL6

2 kb

MYC K4me3 K27ac K4me1 K27me3 input chr17:70,289,457-70,297,720

Fig. 1 (a) Representative chromatin sonication control, showing the expected 250–400 bp range for all the purified DNA samples, loaded on a 1% agarose gel. (b) Control qPCR experiment to show the signal-tobackground enrichment of an MYC HT-ChIP experiment. Negative and positive controls are shown in gray and red, respectively. All values represent the mean and the standard error (SEM) from three independent biological replicates and are shown as percentage of the input. To take into account background signals, we subtracted the values obtained with a nonimmune serum to the relative ChIP signals (anti-mouse IgG). (c) Representative HT-ChIP-seq control as visualized at the Agilent Bioanalyzer using the High-Sensitivity DNA Kit. The curve shows a mean fragment size of ~400 bp and any primer dimers contamination. (d) Representative genome browser tracks, showing from the top to the bottom: the active promoters of CDK4 (which is bound by MYC) and TSPAN31 (which is not), marked with H3K4me3 and H3K27ac; the HOXB cluster repressed region, covered by H3K27me3; and an active enhancer region of SOX9, marked by H3K4me1 and H3K27ac, and enriched for MYC binding. All the tracks are from IMEC and represent normalize read counts

198

Luca Fagnocchi and Alessio Zippo

3.4 DNA Purification with SPRI Beads and HT-ChIP Validation by qPCR

The steps in this and the following section are based on the utilization of SPRI beads and their ability to reversibly and specifically bind DNA of different sizes, according to the concentration of PEG and salts in the reactions. Any subtle change of indicated volumes and ratios will result in unwanted size selection of DNA (see Note 13). 1. Add 132 μl of SPRI beads to 60 ml of each de-crosslinked and input DNA. Carefully mix by pipetting 25 times with the multichannel pipette and incubate at room temperature for 4 min. 2. Separate the supernatant from SPRI beads by placing the 96-well plate on the 96-side skirted magnet for 5 min. Carefully remove supernatant by vacuum aspiration, with pipette tips facing the opposite well-side where beads adhere to the magnet. 3. Leave the plate on the magnet and wash twice with 100 μl of 70% EtOH without disturbing the beads. Incubate for 30 s and discard the supernatant completely. 4. Move the 96-well plate off the 96-side skirted magnet and air-dry residual EtOH for 4 min at room temperature. 5. Add 60 μl of Tris–HCl pH 8.0 to each sample. 6. Mix well by pipetting 25 times with the multichannel pipette and incubate 2 min at room temperature. 7. Quantify DNA at the Qubit. These DNA samples represent the ChIP DNA to be submitted to library preparation and sequencing and can be stored at 20  C. 8. Before proceeding with library preparation, a qPCR validation of the HT-ChIP experiment may be performed, in particular to assess MYC and other transcription/chromatin factors binding enrichment over the background signal (see Fig. 1b). Dilute the input DNA 1:10 and load 1 μl of each sample in the qPCR mix using preferred control primers (see Note 14). Control primers for MYC used in human immortalized mammary epithelial cells (IMEC) are listed in Table 2. 9. Proceed to Subheading 3.4.

3.5 Library Preparation

Library preparation is performed in the 96-well plate on the thermal cycler, with saved programs for each step. 1. Dilute 1–5 ng of each ChIP and input DNA in 40 μl of 10 mM Tris–HCl pH 8.0. 2. End repair (ER). Add 27 μl of ER mix to each sample in each well (total reaction volume is 67 μl).

High-Throughput ChIP-seq to Study MYC and Epigenetics

199

3. Seal the 96-well plate and transfer to the thermal cycler running the “ER” program: 12  C for 15 min, 25  C for 15 min, 4  C hold. 4. ER SPRI cleanup. Add 147 μl of SPRI beads (2.2) to each well. Carefully mix by pipetting 25 times and incubate at room temperature for 5 min. 5. Separate supernatant from beads by placing the 96-well plate on the 96-side skirted magnet for 5 min. Carefully remove supernatant by vacuum. 6. Leave the plate on the 96-side skirted magnet and wash twice with 100 μl of 70% EtOH without disturbing the beads. Incubate for 30 s and discard the supernatant completely. 7. Move the 96-well plate off the 96-side skirted magnet and air-dry residual EtOH for 4 min at room temperature. 8. Add 40 μl of 10 mM Tris–HCl pH 8.0 to each well and carefully mix by pipetting 25 times. 9. Proceed to A-Base addition step (including the SPRI beads). 10. A-Base addition (AB). Add 20 μl of AB mix to each sample in each well (total reaction volume is 60 μl). 11. Seal the 96-well plate and transfer to the thermal cycler running the “AB” program: 37  C for 30 min, 4  C hold. 12. AB SPRI cleanup. Add 132 μl of SPRI buffer (2.2) to each well. Carefully mix by pipetting 25 times and incubate at room temperature for 5 min. 13. Separate supernatant from beads by placing the 96-well plate on the 96-side skirted magnet for 5 min. Carefully remove supernatant by vacuum. 14. Leave the plate on the 96-side skirted magnet and wash twice with 100 μl of 70% EtOH without disturbing the beads. Incubate for 30 s and discard the supernatant completely. 15. Move the 96-well plate off the 96-side skirted magnet and air-dry residual EtOH for 4 min at room temperature. 16. Add 21 μl of 10 mM Tris–HCl pH 8.0 to each well and carefully mix by pipetting 25 times. Incubate 3 min at room temperature. 17. Place the plate on the magnet for 3 min and transfer 19 μl of supernatant into a new 96-well plate. Proceed with adaptor ligation step (without SPRI beads) (see Note 15). 18. Adaptor ligation (AL). Add 34 μl of AL mix to each sample in each well. 19. Add 5 μl of AL mix to diluted indexed adaptor (0.75 μM) to each well (total reaction volume is 58 μl).

200

Luca Fagnocchi and Alessio Zippo

20. Seal the 96-well plate and transfer to the thermal cycler running the “AL” program: 25  C for 15 min, 4  C hold. 21. AL SPRI cleanup. Add 58 μl of 10 mM Tris–HCl pH 8.0 to each well. Add 56 μl SPRI beads to each well. The resulting PEG ratio of 0.7 (note that some PEG is present in the ligation mix) allows for removal of free adapters. 22. Carefully mix by pipetting 25 times and incubate at room temperature for 5 min. 23. Separate supernatant from beads by placing the 96-well plate on the 96-side skirted magnet for 5 min. Carefully remove supernatant by vacuum. 24. Leave the plate on the 96-side skirted magnet and wash twice with 100 μl of 70% EtOH without disturbing the beads. Incubate for 30 s and discard the supernatant completely. 25. Move the 96-well plate off the 96-side skirted magnet and air-dry residual EtOH for 4 min at room temperature. 26. Add 42 μl of 10 mM Tris–HCl pH 8.0 to each well and carefully mix by pipetting 25 times. Incubate 3 min at room temperature. 27. Place the plate on the magnet for 3 min and transfer 40 μl of supernatant into a new 96-well plate. Proceed with amplification step (without SPRI beads) or store the samples at 20  C. 28. Amplification. Add 10 μl of amplification mix to each sample in each well (total reaction volume is 50 μl). 29. Seal the 96-well plate and transfer to the thermal cycler running the “amplification” program: 95  C for 2 min, (95  C for 30 s, 55  C for 30 s, 72  C for 1 min) * 14 cycles, 72  C for 10 min, 4  C hold. 30. First amplification SPRI cleanup. Add 35 μl of SPRI beads (0.7) to each well. 31. Carefully mix by pipetting 25 times and incubate at room temperature for 5 min. 32. Separate supernatant from beads by placing the 96-well plate on the 96-side skirted magnet for 5 min. Carefully remove supernatant by vacuum. 33. Leave the plate on the 96-side skirted magnet and wash twice with 100 μl of 70% EtOH without disturbing the beads. Incubate for 30 s and discard the supernatant completely. 34. Move the 96-well plate off the 96-side skirted magnet and air-dry residual EtOH for 4 min at room temperature. 35. Add 50 μl of 10 mM Tris–HCl pH 8.0 to each well and carefully mix by pipetting 25 times. Incubate 3 min at room temperature.

High-Throughput ChIP-seq to Study MYC and Epigenetics

201

Table 2 List of MYC ChIP control primers Name

Sequence

Target

pos-1_for

GGGAGTGGGTTAGGTGAGGAGT

Human metastasis control, nm23-H1 (NME1)

pos-1_rev

CGTCGCGGTCTGACGAG

Human metastasis control, nm23-H1 (NME1)

pos-2_for

AAACTTTTGCGACGCGTACG

Human nucleolin (NCL)

pos-2_ rev

GGGACTCCGACTAGGGCC

Human nucleolin (NCL)

neg-1_for

GCAAAACAAAGAAATAGGACACA

Human gene for Fas ligandE (FAS-50 )

neg-1_ rev

CCCTGTTATGGTTGCCAGAT

Human gene for Fas ligandE (FAS-50 )

neg-2_for

GATCAAGTCAGGCTGAATACACG

Intergenic region (IG)

neg-2_rev

TCTGTGCTCCTAGCTTGTCCC

Intergenic region (IG)

The list of primers to control the efficiency of MYC HT-ChIP in IMEC cells is reported here (see also Fig. 1b). Adapters can be purchased from Sigma with standard purification (desalted)

36. Place the plate on the magnet for 3 min and transfer all supernatant into a new 96-well plate. Discard beads. 37. Second amplification SPRI cleanup. Add 35 μl of SPRI beads (0.7) to each well. 38. Carefully mix by pipetting 25 times and incubate at room temperature for 5 min. 39. Separate supernatant from beads by placing the 96-well plate on the 96-side skirted magnet for 5 min. Carefully remove supernatant by vacuum. 40. Leave the plate on the 96-side skirted magnet and wash twice with 100 μl of 70% EtOH without disturbing the beads. Incubate for 30 s and discard the supernatant completely. 41. Move the 96-well plate off the 96-side skirted magnet and air-dry residual EtOH for 4 min at room temperature. 42. Add 40 μl of 10 mM Tris–HCl pH 8.0 to each well and carefully mix by pipetting 25 times. Incubate 3 min at room temperature. 43. Place the plate on the magnet for 3 min and transfer all supernatant into a new 96-well plate. This represent the purified HT-ChIP-seq library. 44. Quantify the libraries with the Qubit dsDNA HS Assay Kit. Expected amplification rate is around 40–50 times the starting ChIP DNA amount. 45. Evaluate the size distribution and adapter dimers contamination of the libraries with the High-Sensitivity DNA Kit at the Bioanalyzer (see Fig. 1c). If contamination of adapters is

202

Luca Fagnocchi and Alessio Zippo

present, an additional SPRI cleanup could be performed as in steps 37–43 of this section. 46. Multiplex and sequence the libraries according to the sequencing device, to obtain at least 20 M non-duplicated reads mapped to the genome, in order to have high-quality HTChIP-seq profiles (see Fig. 1d and Note 16). 3.6 Reads Quality Control, Mapping, and Visualization

1. Summarize the quality of the reads using the fastQC and multiqc tools. Evaluate adapter contamination and the “per base sequence content,” to decide how to process the reads. Check the “sequence length distribution” and the “sequence quality score” to decide length and quality cutoff. 2. Process the read accordingly, by trimming the adapters and removing low-quality and short reads and cutting the bases with unexpected “per base sequence content,” with Trimmomatic (see Note 17). Rerun the fastQC and multiqc tools on the processed reads to visualize the obtained results. 3. Map the high-quality and processed reads to the genome, using Bowtie2 (with the “--very-sensitive” parameter). High mappability of at least 85% should be expected from high-quality reads. 4. Process the mapped .bam files to sort reads, remove the duplicated ones, and index them, by using the samtools sort, samtools rmdup, and samtools index commands, respectively. At least 20 M non-duplicated reads should be mapped to the genome, for each sample, to ensure visualization of high-quality HTChIP-seq profiles (see Fig. 1d). 5. Generate .bw files for visualization in genome browsers, with the bamCoverage command from the deepTools suite. The .bw files can be visualized on UCSC genome browser (https:// genome.ucsc.edu) or on the Integrative Genomics Viewer (IGV) (http://software.broadinstitute.org/software/igv/).

3.7

Peak Calling

Peak calling is based on selection of arbitrary cutoff to determine the regions enriched over the background (input), which are identified as peaks. This is largely dependent on the quality of the data. Therefore, the cutoff criteria and the simple commands described here are just indications and may need to be set in agreement with each HT-ChIP-seq profile. Visualization of the peaks on a genome browser will help understand the success of the calling and the identification of false-positive/negative peaks. This information is used to refine the criteria for the analysis. 1. MYC peak calling: we suggest using MACS2 with a p-value cutoff of 1  106 for MYC peak calling. Using other peak caller (e.g., SICER) or lowering the cutoff will largely increase the number of false-positive peaks called.

High-Throughput ChIP-seq to Study MYC and Epigenetics

203

2. Broad histone marks (e.g., H3K27me3 or H3K36me3): use SICER with window size ¼ 1000, gap size ¼ 1000, and FDR < 0.01. 3. Narrow histone marks (e.g., H3K4me3) and transcription/ chromatin factors: use either SICER with window size ¼ 200, gap size ¼ 200, and FDR < 0.01 or MACS2. 4. Load the .bed or .wig output from MACS2 and SICER to evaluate the quality and visualize the peaks called.

4

Notes 1. All the solutions can be prepared without detergents and protease/phosphatase inhibitors to be stored at room temperature. Both detergents and protease/phosphatase inhibitors can be added directly to the stock solutions, upon usage. Do not store complete stock solutions. In addition, the 0.1% DOC could be removed from the IP, blocking, RIPA, and RIPA500 buffers, in order to increase the efficacy of immunoprecipitation and reduce stringency of washing. Removal of DOC may need to be tested, according to the antibody used for the ChIP. 2. As glycine tends to change pH over time, affecting its activity as a quencher, it is recommended to make fresh glycine solution the day of fixation or, at least, every month. At the correct pH, the cell medium color will turn to yellow after adding glycine. 3. It is important to make small aliquots (according to the number of samples that are generally processed in parallel) for the ER and AB buffers, and immediately store them at 20  C. Always, discard leftover ER and AB buffers after a single use, avoiding freeze–thaw cycles. 4. The sonication step is a key point to obtain high-quality results from the HT-ChIP protocol. This is highly dependent on the cell type and the sonication device used for the experiment and may require proper calibration. An example of properly sonicated chromatin is shown in Fig. 1a. We successfully obtained this range of fragmentation on multiple cell types (including ESCs, IMEC, NSCs, and cells derived from mammospheres, neurospheres, and xenograft tumors [4, 8, 30]), using the following devices: Bioruptor Plus (Diagenode, B01020001), with high power, ten sonication cycles (3000 ON, 3000 OFF), and 1 M cells/200 μl of sample in each tube; Branson 450 Digital Sonifier with a cooling chamber, 20% amplitude, four sonication cycles (3000 ON, 3000 OFF), and 5 M cells/600 μl of sample in each tube. With both devices, the cooling system should be set at 4  C. Avoid heating the samples or produce

204

Luca Fagnocchi and Alessio Zippo

bubbles when mixing, as these could lead to de-crosslinking and inefficient sonication, respectively. 5. The cross-linking of protein to the DNA is another key step to obtain high-quality results. Formaldehyde tends to oxidize; therefore, fresh stock solution should be prepared regularly. If the consumption of formaldehyde is limited, we suggest using fresh formaldehyde ampulla in every experiment. The timing of fixation is also crucial. When processing multiple samples, take care to incubate them for exactly 10 min, as increase in fixation may lead to unspecific signal in the ChIP. A limited number of samples should be processed in parallel to ensure the correct fixation timing. 6. We strongly recommend processing the fixed cell pellets immediately and stop when sonicated chromatin is ready. Fixed cell pellets tend to aggregate, limiting the efficacy of sonication. If it is not possible to immediately proceed to sonication, attention should be made on thawing the cell pellets on ice and finely resuspending them, to avoid any aggregate. 7. The optimal range of sonication (250–400 bp) is shown in Fig. 1a. This could be checked directly on 1% agarose gels or at the Bioanalyzer, after DNA purification. This fragment size and the sonication conditions were proven suitable to immunoprecipitate both transcription/chromatin factors (e.g., MYC) and histone modification. While other protocols may suggest a lower fragment size, achieved by longer/harsher sonication, we suggest limiting the shearing of chromatin to avoid the disruption of binding of transcription/chromatin factors to DNA, limiting the efficacy of the ChIP. Empirically setting up the balance between the sonication and the immunoprecipitation steps may be required for specific transcription/chromatin factors. 8. An alternative and faster protocol to check the chromatin sonication may be applied in order to continue with the immunoprecipitation step the same day of sonication. This is identical to the one reported in steps 4–8 of Subheading 3.2 with the only exception that the samples are incubated for 10 min at 95  C to favor the rapid de-crosslinking. 9. Even though the quantification of DNA with the NanoDrop represents just an estimate of the chromatin amount in each sample, this was proven effective to be able to always load comparable amount of chromatin for each ChIP and to keep constant chromatin/antibody ratios. An alternative way to control the starting amount of chromatin for the ChIP would be to start the protocol with the same number of cells. However, we discourage this approach, because it represents a less direct estimation of the chromatin and it assumes all the cell

High-Throughput ChIP-seq to Study MYC and Epigenetics

205

samples will behave identically in all the steps that lead to the ChIP section. 10. For convenience, the immunoprecipitation reaction could be easily assembled by preparing a 2 IP buffer. In this case, each ChIP reaction mix will always comprise 500 μl of 2 IP buffer and the required amount of chromatin, resuspended in a final volume of 500 μl of 50 mM Tris–HCl pH 8. 11. The ratio between chromatin and antibody is crucial for the efficacy of the immunoprecipitation. For MYC ChIP (and generally for other transcription/chromatin factors), we strongly suggest sticking to the indicated condition of 4 μg of antibody for 80 μg of chromatin. The histone marks can be processed with 2 μg of antibody for 40 μg of chromatin. The indicated conditions were suitable when using the antibodies reported in the reagents section, but they may need to be experimentally setup for other antibodies. 12. The washing steps indicated were proven successful to obtain good signal-to-noise ratio, with the antibodies reported in the reagent section. However, the stringency of these washing steps may be adjusted to other antibodies, either by reducing the number of washing steps with RIPA buffer or by removing the 0.1% DOC RIPA and RIPA-500 buffers. 13. Particular attention should be made when using the SPRI beads, to avoid inefficient or unwanted fragment size selection. The SPRI beads are kept in fridge and should be allowed to reach room temperature before use. Make sure the beads are homogeneously resuspended. If inversion is not sufficient to fully resuspend them, they could be gently vortexed at low speed. Each step involving the SPRI beads should comprise enough time for magnet and sample binding (4–5 min), efficient mixing of the SPRI beads with the buffer (25 mixing by gently pipetting), and avoid dispensing the buffer directly on the SPRI beads attached to the magnet. 14. We highly recommend checking the HT-ChIP results before performing the library preparation module. An expected enrichment of positive controls over background or negative regions should be >200–500 times the percentage of immunoprecipitated input (see Fig. 1b). Design of primers for positive/negative control regions is highly cell-dependent and must be optimized. The MYC primers reported in Table 2 were proven to be effective in human cells (IMEC, and those derived from mammospheres and xenograft tumors). 15. As the adaptor ligation buffer contains PEG, it is critical to remove all SPRI beads from the sample to avoid their reactivity. 16. The multiplexed pool of the HT-ChIP-seq libraries must be designed in order to obtain enough high-quality reads from

206

Luca Fagnocchi and Alessio Zippo

each experiment, according to the sequencing device (we used the Illumina HiSeq2500 device) and the total amount of available reads generated. To produce good profiles for all the factors and histone marks analyzed (see Fig. 1d), at least 20 M non-duplicated reads should be mapped on the genome, for each experiment. Considering an average loss of 20% of reads during processing, we suggest designing the multiplex to obtain ~25/30 M of raw reads. 17. The “per base sequence content” of the first five bases of nextgeneration sequencing reads may often be altered, resulting in reduced efficacy of mapping. For this reason, we suggest to sequence at least 75 bp in order to process the raw reads and map high-quality reads with at least 50 bp to be aligned. References 1. Dang CV (2013) MYC, metabolism, cell growth, and tumorigenesis. Cold Spring Harb Perspect Med 3(8). https://doi.org/10. 1101/cshperspect.a014217 2. Ciriello G, Miller ML, Aksoy BA, Senbabaoglu Y, Schultz N, Sander C (2013) Emerging landscape of oncogenic signatures across human cancers. Nat Genet 45 (10):1127–1133. https://doi.org/10.1038/ ng.2762 3. Fagnocchi L, Poli V, Zippo A (2018) Enhancer reprogramming in tumor progression: a new route towards cancer cell plasticity. Cell Mol Life Sci 75(14):2537–2555. https://doi.org/ 10.1007/s00018-018-2820-1 4. Poli V, Fagnocchi L, Fasciani A, Cherubini A, Mazzoleni S, Ferrillo S, Miluzio A, Gaudioso G, Vaira V, Turdo A, Gaggianesi M, Chinnici A, Lipari E, Bicciato S, Bosari S, Todaro M, Zippo A (2018) MYC-driven epigenetic reprogramming favors the onset of tumorigenesis by inducing a stem cell-like state. Nat Commun 9(1):1024. https://doi. org/10.1038/s41467-018-03264-2 5. Lawson DA, Bhakta NR, Kessenbrock K, Prummel KD, Yu Y, Takai K, Zhou A, Eyob H, Balakrishnan S, Wang CY, Yaswen P, Goga A, Werb Z (2015) Single-cell analysis reveals a stem-cell program in human metastatic breast cancer cells. Nature 526 (7571):131–135. https://doi.org/10.1038/ nature15260 6. Cartwright P, McLean C, Sheppard A, Rivett D, Jones K, Dalton S (2005) LIF/STAT3 controls ES cell self-renewal and pluripotency by a Myc-dependent mechanism. Development 132(5):885–896. https://doi. org/10.1242/dev.01670

7. Smith KN, Singh AM, Dalton S (2010) Myc represses primitive endoderm differentiation in pluripotent stem cells. Cell Stem Cell 7 (3):343–354. https://doi.org/10.1016/j. stem.2010.06.023 8. Fagnocchi L, Cherubini A, Hatsuda H, Fasciani A, Mazzoleni S, Poli V, Berno V, Rossi RL, Reinbold R, Endele M, Schroeder T, Rocchigiani M, Szkarlat Z, Oliviero S, Dalton S, Zippo A (2016) A Myc-driven self-reinforcing regulatory network maintains mouse embryonic stem cell identity. Nat Commun 7:11903. https://doi. org/10.1038/ncomms11903 9. Fagnocchi L, Mazzoleni S, Zippo A (2016) Integration of signaling pathways with the epigenetic machinery in the maintenance of stem cells. Stem Cells Int 2016:8652748. https:// doi.org/10.1155/2016/8652748 10. Fagnocchi L, Zippo A (2017) Multiple roles of MYC in integrating regulatory networks of pluripotent stem cells. Front Cell Dev Biol 5:7. https://doi.org/10.3389/fcell.2017. 00007 11. Sabo A, Amati B (2014) Genome recognition by MYC. Cold Spring Harb Perspect Med 4 (2). https://doi.org/10.1101/cshperspect. a014191 12. Walz S, Lorenzin F, Morton J, Wiese KE, von Eyss B, Herold S, Rycak L, Dumay-Odelot H, Karim S, Bartkuhn M, Roels F, Wustefeld T, Fischer M, Teichmann M, Zender L, Wei CL, Sansom O, Wolf E, Eilers M (2014) Activation and repression by oncogenic MYC shape tumour-specific gene expression profiles. Nature 511(7510):483–487. https://doi. org/10.1038/nature13473

High-Throughput ChIP-seq to Study MYC and Epigenetics 13. Thomas LR, Wang Q, Grieb BC, Phan J, Foshage AM, Sun Q, Olejniczak ET, Clark T, Dey S, Lorey S, Alicie B, Howard GC, Cawthon B, Ess KC, Eischen CM, Zhao Z, Fesik SW, Tansey WP (2015) Interaction with WDR5 promotes target gene recognition and tumorigenesis by MYC. Mol Cell 58(3):440–452. https://doi. org/10.1016/j.molcel.2015.02.028 14. Baluapuri A, Wolf E, Eilers M (2020) Target gene-independent functions of MYC oncoproteins. Nat Rev Mol Cell Biol 21(5):255–267. https://doi.org/10.1038/s41580-020-02152 15. Baluapuri A, Hofstetter J, Dudvarski Stankovic N, Endres T, Bhandare P, Vos SM, Adhikari B, Schwarz JD, Narain A, Vogt M, Wang SY, Duster R, Jung LA, Vanselow JT, Wiegering A, Geyer M, Maric HM, Gallant P, Walz S, Schlosser A, Cramer P, Eilers M, Wolf E (2019) MYC recruits SPT5 to RNA polymerase II to promote processive transcription elongation. Mol Cell 74(4):674–687.e611. https://doi.org/10.1016/j.molcel.2019.02. 031 16. Zippo A, Serafini R, Rocchigiani M, Pennacchini S, Krepelova A, Oliviero S (2009) Histone crosstalk between H3S10ph and H4K16ac generates a histone code that mediates transcription elongation. Cell 138 (6):1122–1136. https://doi.org/10.1016/j. cell.2009.07.031 17. Tu WB, Shiah YJ, Lourenco C, Mullen PJ, Dingar D, Redel C, Tamachi A, Ba-Alawi W, Aman A, Al-Awar R, Cescon DW, HaibeKains B, Arrowsmith CH, Raught B, Boutros PC, Penn LZ (2018) MYC interacts with the G9a histone methyltransferase to drive transcriptional repression and tumorigenesis. Cancer Cell 34(4):579–595.e578. https://doi. org/10.1016/j.ccell.2018.09.001 18. Zhuang Q, Li W, Benda C, Huang Z, Ahmed T, Liu P, Guo X, Ibanez DP, Luo Z, Zhang M, Abdul MM, Yang Z, Yang J, Huang Y, Zhang H, Huang D, Zhou J, Zhong X, Zhu X, Fu X, Fan W, Liu Y, Xu Y, Ward C, Khan MJ, Kanwal S, Mirza B, Tortorella MD, Tse HF, Chen J, Qin B, Bao X, Gao S, Hutchins AP, Esteban MA (2018) NCoR/ SMRT co-repressors cooperate with c-MYC to create an epigenetic barrier to somatic cell reprogramming. Nat Cell Biol 20(4):400–412. https://doi.org/10.1038/s41556-018-0047x 19. Garber M, Yosef N, Goren A, Raychowdhury R, Thielke A, Guttman M, Robinson J, Minie B, Chevrier N, Itzhaki Z, Blecher-Gonen R, Bornstein C, AmannZalcenstein D, Weiner A, Friedrich D,

207

Meldrim J, Ram O, Cheng C, Gnirke A, Fisher S, Friedman N, Wong B, Bernstein BE, Nusbaum C, Hacohen N, Regev A, Amit I (2012) A high-throughput chromatin immunoprecipitation approach reveals principles of dynamic gene regulation in mammals. Mol Cell 47(5):810–822. https://doi.org/10.1016/j. molcel.2012.07.030 20. Ostuni R, Piccolo V, Barozzi I, Polletti S, Termanini A, Bonifacio S, Curina A, Prosperini E, Ghisletti S, Natoli G (2013) Latent enhancers activated by stimulation in differentiated cells. Cell 152(1–2):157–171. https://doi.org/10.1016/j.cell.2012.12.018 21. Ewels P, Magnusson M, Lundin S, Kaller M (2016) MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics 32(19):3047–3048. https://doi.org/10.1093/bioinformatics/ btw354 22. Bolger AM, Lohse M, Usadel B (2014) Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30 (15):2114–2120. https://doi.org/10.1093/ bioinformatics/btu170 23. Langmead B, Salzberg SL (2012) Fast gappedread alignment with Bowtie 2. Nat Methods 9 (4):357–359. https://doi.org/10.1038/ nmeth.1923 24. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R, 1000 Genome Project Data Processing Subgroup (2009) The sequence alignment/map format and SAMtools. Bioinformatics 25(16):2078–2079. https:// doi.org/10.1093/bioinformatics/btp352 25. Ramirez F, Ryan DP, Gruning B, Bhardwaj V, Kilpert F, Richter AS, Heyne S, Dundar F, Manke T (2016) deepTools2: a next generation web server for deep-sequencing data analysis. Nucleic Acids Res 44(W1):W160–W165. https://doi.org/10.1093/nar/gkw257 26. Zhang Y, Liu T, Meyer CA, Eeckhoute J, Johnson DS, Bernstein BE, Nusbaum C, Myers RM, Brown M, Li W, Liu XS (2008) Modelbased analysis of ChIP-Seq (MACS). Genome Biol 9(9):R137. https://doi.org/10.1186/ gb-2008-9-9-r137 27. Xu S, Grullon S, Ge K, Peng W (2014) Spatial clustering for identification of ChIP-enriched regions (SICER) to map regions of histone methylation patterns in embryonic stem cells. Methods Mol Biol 1150:97–111. https://doi. org/10.1007/978-1-4939-0512-6_5 28. Kent WJ, Sugnet CW, Furey TS, Roskin KM, Pringle TH, Zahler AM, Haussler D (2002) The human genome browser at UCSC.

208

Luca Fagnocchi and Alessio Zippo

Genome Res 12(6):996–1006. https://doi. org/10.1101/gr.229102 29. Robinson JT, Thorvaldsdottir H, Winckler W, Guttman M, Lander ES, Getz G, Mesirov JP (2011) Integrative genomics viewer. Nat Biotechnol 29(1):24–26. https://doi.org/10. 1038/nbt.1754 30. Sessa A, Fagnocchi L, Mastrototaro G, Massimino L, Zaghi M, Indrigo M,

Cattaneo S, Martini D, Gabellini C, Pucci C, Fasciani A, Belli R, Taverna S, Andreazzoli M, Zippo A, Broccoli V (2019) SETD5 regulates chromatin methylation state and preserves global transcriptional fidelity during brain development and neuronal wiring. Neuron 104(2):271–289.e213. https://doi.org/10. 1016/j.neuron.2019.07.013

Chapter 10 Methods for Determining Myc-Induced Apoptosis Dan Lu, Catherine Wilson, and Trevor D. Littlewood Abstract Although many oncoproteins promote cell growth and proliferation, some also possess the potential to induce cell cycle arrest or cell death by apoptosis. Elevated and deregulated expression of the Myc protein promotes apoptosis in both cultured cells and in some tissues in vivo. Here we describe techniques to detect Myc-induced apoptosis in vitro using flow cytometry, microscopy, and immunoblotting, and in vivo using immunohistochemical staining, immunoblotting, and analysis of RNA expression. Key words Apoptosis, Flow cytometry, Microscopy, Annexin V, TUNEL, Immunohistochemistry, Cleaved caspase 3, Hematoxylin and eosin, RNA expression

1

Introduction Many oncogenes promote cell growth and proliferation and are often aberrantly expressed in tumour cells. Intriguingly, many oncogenes, including Myc [1], can also induce cell cycle arrest or apoptosis thus reducing the likelihood of tumour formation and progression, a phenomenon often referred to as intrinsic tumour suppression [2] (Fig. 1). For example, Myc-induced apoptosis suppresses tumourigenesis in various tumour models [3–5]. However, if Myc-induced apoptosis is suppressed by elevated expression of antiapoptotic proteins such as Bcl-xL, then invasive tumours develop [3]. Moreover, synthetic lethality screens have revealed additional targets that, when inhibited, promote Myc’s apoptotic activity in tumours (reviewed [6, 7]). c-Myc was the first oncogene demonstrated to have this innate ability to induce apoptosis [8] and activation of the ectopically switchable MycER protein in serumdeprived rat fibroblasts induces apoptosis within hours [8, 9]. Conversely, inhibition (or deactivation) of Myc in established tumours results in apoptosis of the tumour cells and tumour regression [10], probably due to the involution of the supportive microenvironment [11, 12].

Laura Soucek and Jonathan Whitfield (eds.), The Myc Gene: Methods and Protocols, Methods in Molecular Biology, vol. 2318, https://doi.org/10.1007/978-1-0716-1476-1_10, © Springer Science+Business Media, LLC, part of Springer Nature 2021

209

210

Dan Lu et al.

Mitogenic signals

Proliferation

Tumor

Myc Oncogenic activation

Apoptosis

Survival factors

Fig. 1 Intrinsic tumour suppression. Endogenous Myc expression is tightly regulated and coordinates cell cycle progression whereas deregulated (oncogenic) Myc expression (as observed in many tumours) drives both cell proliferation and, in some circumstances, cell death. In conditions where apoptosis is suppressed by survival factors or cooperating oncogenes (e.g., Bcl-xL) then Myc promotes tumourigenesis

c-Myc sensitizes cells to various apoptotic stimuli by potentiating both the intrinsic and extrinsic apoptotic pathways rather than inducing apoptosis per se [13]. For example, Myc functionally cooperates with Bax, a central effector of cell death, causing the release of holocytochrome C from the mitochondria and activation of caspase 9 and apoptosis [14]. In addition, deregulated c-Myc expression leads to the stabilization and activation of p53 (which promotes the expression and activity of proapoptotic proteins) in both p19ARF-dependent and independent manners [15–18]. Interestingly, elevated levels of c-Myc protein are required to induce p19ARF in mice implying that low endogenous, but deregulated, levels of Myc may drive tumourigenesis without eliciting an apoptotic response [5]. c-Myc also induces expression of the proapoptotic protein Bim independently of p53 [19] and potentiates extrinsic, death receptor-dependent death [20]. Finally, c-Myc also inhibits the synthesis of superoxide dismutases via NFκB leading to an increase in reactive oxygen species that contribute to apoptosis [21]. In addition to death ligands that promote death, cell survival is likewise promoted by extracellular survival factors. In culture, the cocktail of factors present in calf serum act as potent inhibitors of cell death. Factors in serum reduce ROS accumulation in cells [21], abrogate death receptor signaling [20], and stimulate the activity of the serine/threonine kinase Akt that modulates the activity and degradation of several proteins involved in apoptosis. For example, Akt-dependent phosphorylation of the proapoptotic Bad protein promotes its degradation [22, 23]. In the absence of Bad,

Myc-Induced Apoptosis

211

antiapoptotic proteins such as Bcl-2 and Bcl-xL are free to bind and inhibit other proapoptotic mediators including Bax. Cells undergoing Myc-induced apoptosis in vitro show distinct morphological changes including nuclear condensation, membrane blebbing, and cytoplasmic condensation ending in cell fragmentation [8] (Fig. 2a). More quantitative analysis of apoptosis can be achieved using flow cytometry by measuring the proportion of cells positive for propidium iodide (PI) and/or Annexin V (Fig. 2b). PI is incorporated into fully membrane porous cells binding to their DNA content therefore staining all dying and dead cells with permeable plasma membranes whereas Annexin V specifically binds phosphatidylserine, a phospholipid exposed on the exterior of apoptotic cells only. Activation of the executioner proteases (caspases) requires their cleavage and assembly into specific protein species. Thus, an antibody specific for the cleaved (activated) form of caspase 3 can be used to determine apoptosis by western blotting of protein lysates and in tissue sections by immunohistochemistry. The presence of pyknotic nuclei (those with condensed chromatin) and fragmented DNA that can be detected by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) are both characteristic of apoptotic cells (Fig. 3). Moreover, the demonstration of Myc-dependent transcriptional activation of genes encoding proapoptotic proteins by RT-qPCR can be useful for in vivo studies (Fig. 4). These techniques are described below.

2

Materials Prepare all solutions using ultrapure water (DW, prepared by purifying deionized water to 18 MΩ cm at 25
C) and analytical grade reagents. Prepare and store all reagents at room temperature unless indicated otherwise.

2.1

In Vitro Assays

2.1.1 Cell Culture and Microscopy

In theory, any mammalian cell exhibiting deregulated and elevated Myc expression is likely to undergo apoptosis when deprived of survival signals. Here we describe experiments with rat fibroblasts (Rat-1 cell line) engineered to constitutively express the ectopically switchable fusion protein MycERTam [9]. In the absence of the specific ERTam ligand, 4-hydroxytamoxifen (4OHT), MycERTam is inactive. Addition of 4OHT to the culture medium renders MycERTam functionally active within minutes. 1. Cell culture growth media: Dulbecco Modified Eagle’s Medium (DMEM) supplemented with 2 mM L-glutamine and either 10% heat-inactivated fetal bovine serum (FBS) for general cell maintenance or 0.1% for apoptosis assays (see Note 1).

212

A

Dan Lu et al.

control

+ 4OHT

Propidium Iodide

B

Annexin V - APC Fig. 2 Myc-induced apoptosis in vitro. (a) Representative phase-contrast microscopy images of Rat-1/ MycERTam fibroblasts cultured in medium containing 0.1% BGS in the absence (control) or presence of 100 nM 4OHT (for 48 h) to activate MycERTam. Apoptosis is characterized by distinct morphological changes including membrane blebbing, cytoplasmic condensation, and cell fragmentation. Scale bars ¼ 100μm or 50μm (inset). (b) Flow cytometric analysis of control and 4OHT-treated cells as above. Apoptotic cells with exposed Annexin V are present in the lower right (Q1-LR) quadrant. Late apoptotic and necrotic cells are fully membrane permeable therefore both Annexin V and PI positive are present in the upper right (Q1-UR) quadrant

2. Cell culture incubator capable of maintaining 37
C and a humidified atmosphere containing 5% CO2. 3. Class II microbiological safety cabinet. 4. Plasticware appropriate for cell culture. 5. Phosphate-buffered saline (PBS) buffer without Ca2+ and Mg2 + : 0.2 g KCl, 0.2 g KH2PO4, 8 g NaCl, 1.15 g Na2HPO4 anhydrous made up in 1 L H2O, pH 7.0 (see Note 2).

Myc-Induced Apoptosis control

213

MycERTam

Insulin (24h)

Ki67 (24h)

TUNEL (3d)

H&E (6d)

Fig. 3 Myc-induced apoptosis in vivo. Expression of the switchable MycERTam protein was directed to the insulin-secreting pancreatic β-cells of mice and activated by injection with 4OHT. Control mice were untreated. Sections demonstrate Myc-induced β-cell proliferation (Ki67) 24 h after 4OHT injection and apoptosis at 3 days (TUNEL). Note that 6 days after 4OHT administration, the pancreatic islet has involuted due to Myc-induced apoptosis exceeding Myc-induced proliferation (H&E staining). Scale bar ¼ 50μm. (Reproduced from [3] with permission from Cell Press)

6. 0.05% Trypsin-EDTA. 7. Prepare 100μM 4-hydroxytamoxifen (z-isomer, Sigma, St. Louis, MO, USA) in 100% ethanol. Store at 20
C in the dark (see Note 3). 8. Inverted microscope for live cell imaging: Any model with suitable bright field (e.g., phase or DIC) and image capture ability. 2.1.2 Flow Cytometry for Annexin V

1. 1 Annexin V binding buffer: Dilute 10 binding buffer (eBioscience, San Diego, CA, USA) in PBS to provide a 1 working solution. Store at 4
C. 2. 10μM propidium iodide (PI) staining solution. Store at 4
C. 3. APC-conjugated Annexin V: Allophycocyanin (APC) is a fluorescent molecule. Annexin V Apoptosis Detection Kit APC (see Note 4). No dilution required. Store at 4
C. 4. Flow cytometer: For example, BD Accuri® C6 flow cytometer (see Note 5).

214

Dan Lu et al.

A Rosa26

B

C

CAG

Myc

STOP

p53

CC3

c-Myc

c-Myc

Hoechst

ER

IRES

P-p53

D MycERTam

GFP

p21

p21

Single cell tissue suspension GFP -ve cells GFP +ve cells

p19ARF

Puma

FACS Laser

Detector -

Charge

+ +

-

Collection tubes

Fig. 4 Myc-induced apoptosis in vivo. (a) Design of transgene in genetically altered mice [24]. Inhalation of Adenovirus encoding the Cre recombinase excises the STOP resulting in sporadic coexpression of elevated levels of both MycERTam and GFP in the same lung epithelial cells. MycERTam was activated by injection of tamoxifen. (b) Immunohistochemical staining indicates expression of cleaved caspase 3 (CC3), stabilized p53, phospho-p53 and p21 in MycERTam-expressing cells. (c) FACS enrichment of the GFP (and MycERTam)expressing cells. (d) RT-qPCR analysis of RNA expression of MycERTam, the cell cycle inhibitor p21, and the proapoptotic proteins Puma and p19ARF in GFP negative (not expressing MycERTam) and GFP positive (MycERTam expressing) cells

Myc-Induced Apoptosis 2.1.3 Western Blotting for Cleaved Caspase 3

215

1. Vertical gel electrophoresis apparatus (e.g., Invitrogen Life Technologies, Carlsbad, CA, USA), suitable blotting module and gel cassettes (e.g., Novex, ThermoFisher). 2. Darkroom equipped with facilities for developing X-ray film (either manually or via automatic film processor) or, if available, a fluorescent imaging system (e.g., Li-Cor Odyssey CLx) (see Note 6). 3. Protein lysis buffer: 50 mM Tris–HCl pH 6.8, 2% SDS, 0.02% bromophenol blue, 5% β-mercaptoethanol, 10% glycerol (see Note 7). 4. Reagents for determining protein concentration of cell lysates (e.g., Pierce™ BCA protein assay kit). 5. Spectrophotometer capable of reading at a wavelength of 562 nm. 6. Resolving gel buffer: 1.5 M Tris–HCl, pH 8.8. 7. Stacking gel buffer: 0.5 M Tris–HCl, pH 6.8. 8. 30% acrylamide/bis-acrylamide (37.5:1) solution stored at 4
C and protected from light (see Note 8). 9. N,N,N,N0 -Tetramethyl-ethylenediamine (TEMED). 10. Ammonium persulphate (APS) made up as a 10% solution in water and stored at 4
C (or in aliquots for longer term storage at 20
C). 11. Immobilon P PVDF membrane for chemiluminescence or Immobilon FL membrane (Millipore, Billerica, MA, USA) for fluorescent imaging. 12. 10 SDS-PAGE running buffer: 0.25 M Tris, pH 8.3, 1.9 M glycine, 1% SDS. 13. 10 Western blotting buffer: 0.25 M Tris, pH 8.3, 1.9 M glycine. 14. Dried skimmed milk powder (e.g., Marvel) for ECL or other “blocking buffer” (e.g., Li-Cor Intercept blocking buffer) for fluorescent detection. 15. Tris-buffered saline: 25 mM Tris–HCl, pH 7.4, 144 mM NaCl. 16. Primary antibodies specific for cleaved caspase 3 (e.g., Cell Signaling, Danvers, MA, USA, catalogue number 9664) (see Note 9). Also see Note 10. 17. Secondary antibodies: For example, horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG or fluorescentconjugated anti-rabbit antibodies (e.g., Li-Cor IRDye 800CW goat anti-rabbit). 18. ECL detection kit or fluorescent imaging system (e.g., Li-Cor Odyssey CLx). 19. Fuji SuperRX X-ray film (or similar).

216

2.2

Dan Lu et al.

In Vivo Assays

2.2.1 Histology

1. Formalin-fixed and paraffin-embedded tissue sections ideally 4–6μm thick and mounted onto glass slides. Formalin-fixed, paraffin-embedded human tonsil sections can be used as a positive control for apoptosis—apoptotic bodies can be seen in tingible-body macrophages within germinal centres. 2. Slide staining apparatus (e.g., Coplin jars, etc., see Note 11). 3. Hydrophobic barrier pen (e.g., Vector ImmEdge™ pen, Burlingame, CA, USA).

Laboratories

4. Microscope preferably with image analysis software capable of simple measurements (area, pixel density, etc., e.g., Zeiss Axio Imager, Oberkochen, Germany). 2.2.2 Haematoxylin and Eosin (H&E) Staining

1. Hematoxylin solution, Harris modified. 2. Eosin Y solution. 3. Destain solution: 250 mL 50% methanol, 250 mL DW, 5 mL 11.6 M HCl. 4. Scott’s solution: 20 mg magnesium sulphate, 2 mg sodium bicarbonate in 1 L DW. 5. Mounting medium: DPX.

2.2.3 TUNEL Staining

1. Xylene, ethanol at various concentrations. 2. 50μg/mL proteinase K prepared in 10 mM Tris-Cl, pH 7.5 (see Note 12). 3. Terminal transferase (TdT) enzyme. 4. Digoxigenin-dUTP. 5. TdT buffer: 200 mM potassium cacodylate, 25 mM Tris–HCl, pH 6.6 at 25
C, 0.25 mg/mL bovine serum albumin, 5 mM cobalt chloride. 6. TB buffer: 300 mM sodium chloride, 30 mM sodium citrate. 7. 0.1 M Tris-Cl buffer, pH 7.5 (TBS). 8. 10% bovine serum albumin (BSA) in TBS. 9. Anti-digoxigenin-alkaline phosphatase (Fab fragments). 10. Substrate solution: 0.19 mg/mL 5-bromo-4-chloro-3-indolyl phosphate (BCIP), 0.4 mg/mL nitroblue tetrazolium (NBT) in 100 mM Tris-Cl, pH 9.5, 50 mM MgSO4 (see Note 13). 11. Mounting medium, e.g., Glycergel.

2.2.4 Immunohistochemistry for Cleaved Caspase 3

1. Formalin-fixed, paraffin-embedded human tonsil sections as a positive control. 2. 0.1 M citrate buffer, pH 6. 3. PBS with 0.1% Tween 20 (PBS-T).

Myc-Induced Apoptosis

217

4. Rabbit polyclonal primary antibody specific for cleaved caspase 3 (Asp175) (Cell Signaling, Danvers, MA, USA, catalogue number 9661) (see Notes 9 and 10). 5. Rabbit Vectastain elite ABC kit (Vector Laboratories, Burlingame, CA, USA). 6. 3,30 -Diaminobenzidine (DAB) substrate kit (Vector Laboratories, Burlingame, CA, USA) (see Note 14). 7. Mounting medium: DPX. 2.2.5 Western Blotting for Cleaved Caspase 3

Materials as listed in Subheading 2.1.3, with the addition of the following: 1. Protein lysis buffer: 1% SDS, 50 mM Tris pH 6.8 and 10% glycerol. 2. Clear bottom immunoassay microplates for determination of protein concentration and suitable for reading in a spectrophotometer at a wavelength of 562 nm. 3. Sonicator water bath (e.g., Clifton™ stainless steel DU-4 heated ultrasonic bath). 4. Laemmli sample buffer (see Note 15).

2.2.6 RNA Analysis

1. Laser capture microdissection (e.g., Zeiss PALM laser microdissection system) or FACS to sort cells in which Myc is fused to a fluorescent protein (e.g., GFP) or in cells that coexpress both Myc and the fluorescent protein. 2. RNA extraction kit (e.g., Qiagen RNAeasy micro kit). 3. Trizol reagent. 4. Isopropanol. 5. 75% ethanol in RNase-free water. 6. Clean work area with RNase inhibitor (e.g., RNaseZAP, Ambion), use only RNase-free reagents and tips. 7. Nuclease-free PET membrane covered slides (Carl Zeiss) UV-treated (254 nm for 30 min) and Poly-L-Lysine (0.1%, Sigma) coated for 30 min, air-dried overnight. 8. PALM adhesive cap tubes. 9. Spectrophotometer for determining DNA and RNA concentration in small volumes. 10. High-Capacity cDNA Reverse Transcription Kit. 11. Fast SYBR-Green RT-PCR mix. 12. RNase-free water. 13. Optical reaction plate such as MicroAmp™ Optical 384-well reaction plate with barcode (Thermo Fisher Scientific) and

218

Dan Lu et al.

Table 1 Recommended primers for RT-qPCR of the following mouse RNAs Gene

Forward primer (50 –30 )

Reverse primer (50 –30 )

mycERTam

ATTTCTGAAGACTTG TTGCGGAAA

GCTGTTCTTAGAGCGTTTGATCA TGA

puma

AGCAGCACTTAGAGTCGCC

CCTGGGTAAGGGGAGGAGT

noxa

GCAGAGCTACCACCTGAGT

CTTTTGCGACTTCCCAGGCA

Cdkn2A (p19ARF)

GGGTTTTCTTGGTGAAGTTCG

TTGCCCATCATCATCACCT

β-actin

GACGATATCGCTGCGCTGGT

CCACGATGGAGGGGAATA

gapdh

AGGTCGGTGTGAACGGATTTG

TGTAGACCATGTAGTTGAGGTCA

optical adhesive film such as MicroAmp™ Optical adhesive film (Thermo Fisher Scientific). 14. PCR machine for RT-qPCR such as QuantStudio 5 (Thermo Fisher Scientific). 15. Suitable primers for analysis of the expression of selected RNAs (see Table 1).

3

Methods Carry out all procedures at room temperature unless otherwise specified.

3.1 Phase Contrast Microscopy

1. Plate 5  104 Rat1 MycERTam cells [6] into each well of a six-well plate in 3 mL of DMEM containing 10% FCS and incubate overnight at 37
C (see Note 16). 2. Aspirate the media and wash twice with 3 mL PBS. 3. Replace the culture media with the following: (a) 3 mL of DMEM containing 0.1% BGS and 3μL ethanol or (b) 3 mL of DMEM containing 0.1% BGS and 3μL of 100μM 4OHT (i.e., final concentration of 100 nM 4OHT). Incubate at 37
C. 4. Apoptotic cells are observed by microscopy after a few hours in the presence of 4OHT (approximately 50% death within 24 h). Apoptotic cells show a distinct morphology characterized by detachment from the substratum, pyknotic nuclei, membrane blebbing, and cell fragmentation (Fig. 2a) (see Note 17).

Myc-Induced Apoptosis

3.2 Detection of Exposed Annexin V by Flow Cytometry

219

1. Culture cells as described in steps 1–3 (Subheading 3.1). 2. Depending on the kinetics of apoptosis induction, collect culture media containing detached cells and harvest the adherent cells by treating with trypsin (see Note 18) and pool together. 3. Collect cell pellet by centrifugation at 250  g for 5 min at 4
C. Do not exceed 300  g to avoid cell damage. 4. Discard supernatant and wash cells once with 5 mL 1 binding buffer and repeat step 3. 5. Discard supernatant and resuspend cells in 1 binding buffer at 1  106 cells/mL. Store in the dark at 4
C. 6. Dispense cell suspension into 4  100μL aliquots labeled as (1) unstained, (2) PI only, (3) Annexin V APC only, (4) PI and Annexin V APC (see Note 19). 7. Store (1) untreated at 4
C in the dark. 8. To (3) and (4), add 5μL of APC-conjugated Annexin V (at supplied concentration) and incubate 10–15 min at room temperature. 9. Add 500μL of 1 binding buffer to all samples (1–4) and centrifuge at 250  g for 5 min to pellet cells. 10. Resuspend each cell pellet in 200μL of 1 binding buffer and store at 4
C in the dark. 11. To (2) and (4), add 5μL PI staining solution (at supplied concentration). Store at 4
C in the dark for 5 min. 12. Analyze by flow cytometer using a flow rate of 35μL/min with a core size of 16μm sampling 10,000 events for each sample. 13. Gating should be performed on unstained samples (1) using forward scatter (cell size) versus side scatter (cell density) to eliminate small cell debris. 14. PI only (2) and Annexin V only (3) single stained should be detected in FL2 and FL4 channels, respectively. Normalization should be performed to avoid signal spillage into adjacent channels (consult flow cytometer manufacturer’s manual). 15. Annexin V and/or PI positive cells distinguish between viable, early apoptotic, and late apoptotic/necrotic cells (Fig. 2b) (see Note 4).

3.3 Western Blotting for Cleaved Caspase 3

This method can be applied to the detection of any proapoptotic protein for which suitable antibodies are available (see Note 10). 1. Harvest cells as described in steps 1–3 in Subheading 3.2. 2. Resuspend cell pellet in suitable volume (e.g., 100μL per 106 cells, see Note 20) of protein lysis buffer and shear the DNA by sonication or passing 5–6 times through a 25G needle attached to a 1 mL syringe (see Note 21).

220

Dan Lu et al.

3. Heat samples at 95
C for 3 min, allow to cool, and briefly centrifuge (10,000  g for 2 min). Store at 20
C or load 10–15μL per well immediately onto prepared gels (see below). 4. Resolving gel (10% acrylamide): mix 2.5 mL resolving gel buffer, 3.3 mL acrylamide/bis-acrylamide (37.5:1), 100μL 10% SDS, 12.5μL TEMED, and water to 10 mL final volume. Add 75μL 10% APS, mix and cast immediately into 10 cm gel cassettes (with either 1.0 or 1.5 mm spacers) leaving sufficient space (~1 cm) for the stacking gel. Carefully overlay with watersaturated butanol to exclude air and prevent menisci forming. 5. When the resolving gel is set wash off the water-saturated butanol (three times). Mix 1.25 mL stacking gel buffer, 0.75 mL acrylamide/bis-acrylamide (37.5:1), 50μL 10% SDS, 5μL TEMED, and water to 5 mL final volume. Add 100μL 10% APS, cast on top of resolving gel, and carefully insert a suitable comb. 6. When set, remove comb and paper strip from bottom of the cassette and assemble in electrophoresis apparatus. Add sufficient 1 SDS-PAGE running buffer to cover wells and electrodes. Load centrifuged samples (10–15μL per well) as well as pre-stained protein markers in at least one well. 7. Electrophorese at 150 V for 80 min. 8. After electrophoresis, separate the gel cassette by prising apart, scrape off and discard the stacking gel and transfer the resolving gel into 1 Western blotting buffer supplemented with 20% methanol. 9. Cut a PVDF membrane the same size as the gel and pre-wet in methanol. Assemble in the following order: fibre pad, blotting paper, PVDF membrane, gel, blotting paper, fibre pad, and place into blotting module so that the membrane is closest to the positive electrode. Add sufficient 1 Western blotting buffer/20% methanol to cover gel and electrodes and transfer at 30 V for 60 min. The blotting process generates heat so keep cool either by conducting electrophoresis in a cold room or by packing ice around the blotting apparatus. 10. After electrophoresis disassemble the blotting module and incubate the membrane in 4% dried skimmed milk (e.g., Nestle´ Marvel) in TBS for one hour (or follow manufacturer’s instructions if using fluorescent detection). 11. Incubate membrane in an appropriate dilution of primary antibody specific for cleaved caspase 3 (see Notes 9 and 10) in TBS supplemented with 0.1% Tween-20 (TBST) for one hour at room temperature with gentle rocking (or follow manufacturer’s instructions if using fluorescent detection). 12. Wash three times (3 min per wash) with TBST.

Myc-Induced Apoptosis

221

13. Incubate with appropriate dilution of secondary horseradish peroxidase (HRP)-conjugated antibody in TBST or fluorescent-labeled antibody in the dark (following manufacturer’s instructions) (see Note 22) for one hour at room temperature with gentle rocking. 14. Wash three times (3 min per wash) with TBST. 15. Detect binding of secondary antibody with enhanced chemiluminescence (ECL) (following manufacturer’s instructions) by coating membrane with ECL reagents for 1 min. Expose membrane to X-ray film for between 10 s and 10 min depending on signal intensity and develop (see Note 23). 16. Alternatively, for fluorescent detection, capture image using suitable equipment (e.g., Li-Cor Odyssey CLx). 3.4 Haematoxylin and Eosin (H&E) Stain

1. Deparafinize 4–6μm sections in xylene for 10 min. 2. Rehydrate in descending series of ethanol solutions (100%, 70%, 5 min each). 3. Rinse in tap water, then in DW. 4. Place slides in haematoxylin solution for 5 min. 5. Briefly dip slides eight times in destain solution. 6. Place slides in Scott’s solution to “blue” for 5 min. 7. Place slides in Eosin solution for 6 min. 8. Quickly rinse in DW. 9. Rapidly dehydrate through graded alcohols to two changes of xylene. 10. Coverslip and mount with DPX. 11. Examine under microscope.

3.5 Terminal Deoxynucleotidyl Transferase dUTP Nick End Labeling (TUNEL)

1. Prepare slides as described in steps 1–5 in Subheading 3.4. 2. Circumscribe tissue section with a hydrophobic barrier pen. 3. Incubate in 50μg/mL proteinase K for 3–5 min at room temperature (see Note 24). If human tonsil sections are not available, then a positive control can be generated by treating one tissue section with micrococcal nuclease or DNase 1 (grade 1) to induce DNA strand breaks before proceeding (see Note 25). 4. Wash in DW four times (2 min each time). 5. Immerse in TdT buffer for 5 min at room temperature. 6. Tip off excess TdT buffer. 7. Incubate with TdT enzyme (0.05–0.2 U/μL) (see Note 26) and 0.005 nmol/μL digoxigenin-dUTP in TdT buffer (prepared immediately before use) in humid atmosphere at 37
C for 30 min (see Note 27). Generally 50μL of solution

222

Dan Lu et al.

is adequate for each slide providing that they are kept in a humidified chamber (see Note 11). 8. Terminate the reaction by transferring the slides to TB buffer for 15 min at RT. 9. Gently rinse in DW. 10. Place slides in 0.1 M Tris buffer, pH 7.6 (TBS) for 5 min. 11. Cover sections with 10% BSA in TBS (blocking buffer) for 10 min at room temperature (see Note 28). 12. Incubate with 1 U/mL anti-digoxigenin-alkaline phosphatase (Fab fragments) in blocking buffer for 1 h at room temperature. 13. Rinse with TBS for 5 min. 14. Incubate with the BCIP/NBT chromogenic substrate solution. The intensity of the colour reaction should be monitored under the microscope and terminated when desired (see Note 29). 15. Terminate the reaction by rinsing in DW. 16. Counterstain if desirable (with 1% eosin for BCIP/NBT or 1% light green or fast red). 17. Mount sections using aqueous mounting medium, e.g., Glycergel. 18. Examine under microscope (see Note 30). 3.6 Immunohistochemistry for Activated Caspase 3

1. Prepare formalin-fixed, paraffin-embedded described in steps 1–3 in Subheading 3.4.

sections

as

2. Microwave sections in pre-boiling citrate buffer pH 6 for 10 min at medium power. 3. Cool in running tap water immediately. 4. If blocking for endogenous peroxidases is required, incubate sections in 3% hydrogen peroxide in water for 20 min. 5. Wash sections twice for 5 min each in PBST (PBS supplemented with 0.1% Tween-20). 6. Circumscribe tissue section with a hydrophobic barrier pen. 7. Incubate sections with goat serum from the Vectastain ABC kit in PBST for 20 min at room temperature in a humidity chamber (see Note 11). Do not let tissue sections dry out. 8. Tap off excess serum and incubate sections with an appropriate dilution of cleaved caspase 3 antibody (see Notes 9 and 10) in PBST for 1 h at room temperature or overnight at 4
C. 9. Wash twice for 5 min each in PBST.

Myc-Induced Apoptosis

223

10. Incubate sections with secondary antibody from the ABC Vectastain kit (biotinylated goat anti-rabbit immunoglobulins) for 30 min at room temperature. 11. Wash twice for 5 min each time in PBST. 12. Incubate sections with ABC complex Vectastain kit for 30 min at room temperature. 13. Wash twice for 5 min each with PBST. 14. Apply DAB solution for 5 min (see Notes 13, 14, and 31). 15. Wash thoroughly with DW for 5 min. 16. Counterstain with hematoxylin as required. 17. Dehydrate, clear in two changes of xylene, coverslip, and mount with DPX. 18. Examine under the microscope. 3.7 Western Blotting of Tissue Samples for Cleaved Caspase 3

1. Harvest tissues and freeze in 2–5 mm pieces at 80
C. 2. Grind tissues in liquid nitrogen using a pestle and mortar, resuspend in lysis buffer and incubate on ice for 30 min. 3. Boil lysate for 10 min, cool on ice. 4. Sonicate lysate for 15 min at room temperature. 5. Centrifuge 10,000  g for 15 min at 4
C and transfer supernatant into a fresh tube. 6. Determine protein concentration using Pierce BCA assay kit. 7. Add Laemmli sample buffer to protein lysate, heat samples at 95
C for 3 min, and allow to cool. 8. Load equivalent amounts (50μg/lane) of total protein onto SDS-PAGE gels and electrophorese as described in Subheading 3.3. 9. Transfer resolved proteins to Immobilon membranes and incubate with appropriate antibodies (see Notes 9 and 10) as described in Subheading 3.3.

3.8 Isolation of RNA and Determination of RNA Expression of Selected Proapoptotic Proteins

1. Large areas of tissue can be isolated by manual dissection, and small areas (102–105 cells) can be recovered from sections by laser capture microscopy if available (we use a Zeiss PALM laser capture microdissection system). If the cells of interest are tagged (e.g., expressing a fluorescent protein), then FACS of dissociated single cells can be used. 2. Work areas used for isolating RNA should be cleaned with an RNase inhibitor such as RNaseZAP (Thermo Fisher). 3. For microdissected material, isolate RNA with Qiagen RNAeasy micro kit following manufacturer’s instructions. Sorted cells are collected directly into 1 mL of Trizol reagent.

224

Dan Lu et al.

4. For Trizol extraction, add 200μL of chloroform per mL of Trizol, vortex to emulsify, and centrifuge at 12,000  g for 15 min at 4
C. 5. Transfer upper aqueous phase containing RNA to a fresh tube and precipitate RNA with 500μL isopropanol for 10 min and centrifuge at 12,000  g for 15 min at 4
C. 6. Discard supernatant and carefully wash RNA pellet (see Note 32) with 1 mL of 75% ethanol and centrifuge at 12,000  g for 15 min at 4
C. 7. Remove ethanol and air-dry for 30 min, resuspend RNA in 10–50μL RNase-free water. 8. Determine RNA concentration on spectrophotometer. 9. Generate cDNA from RNA by combining with 2 reverse transcription master mix and placing on a thermal cycler for 10 min at 25
C, 120 min at 37
C, and finally 85
C for 5 min. 10. Dilute cDNA as appropriate (see Note 33). 11. Several programs are available for primer design (see Note 34). For example, we have used Primerbank (https://pga.mgh. harvard.edu/primerbank/) to design primers suitable for detecting apoptotic genes such as p19ARF, p21, Puma, Bim, Noxa (see Table 1). In addition, primers for detecting housekeeping genes such as β-actin or Gapdh should be included. 12. Prepare SYBR green master mix together with water and primers, distribute cocktail to 384-well optical plate, and add 1–2μL of cDNA. Perform each reaction in triplicate. 13. Reactions can be performed on Applied Biosystems QuantStudio 5 Real-Time PCR System (or similar). We run a standard curve for each primer set and determine the relative quantity of cDNA per sample. The fold change of RNA between samples can be estimated by first comparing to housekeeping genes and then to control samples. 3.9

Conclusions

Intriguingly, elevated oncogene activity is often associated with either cell cycle arrest or cell death via activation of p53 [2]. For example, elevated levels of Myc induces apoptosis both in vitro and in vivo but persistent expression of physiological levels, although sufficient to cooperate with oncogenic Ras proteins in tumourigenesis, neither activate p53 nor induce apoptosis in mouse models [5]. Most (perhaps all) features of apoptosis induced by oncogene activation, including stabilization of the p53 protein, are shared with other apoptotic triggers, and the methods described here are not necessarily specific to Myc-induced apoptosis (Table 2). Here, we have restricted ourselves to methods that are regularly used in our laboratory for detection of Myc-induced apoptosis rather than describe all of the methods that could be employed.

Myc-Induced Apoptosis

225

Table 2 Features of apoptosis and recommended methods for detection Feature

Method of detection

Cell detachment and surface blebbing

Microscopy

Exposure of surface Annexin V

Flow cytometry

Chromatin condensation

Microscopy

DNA fragmentation

TUNEL

Activation of caspase 3 (cleavage of the inactive pro-caspase 3 into the active form)

Western blotting, immunohistochemistry

Expression of selected proapoptotic proteins (e.g., p53, Puma, p19ARF)

Western blotting, immunohistochemistry

Expression of RNA of selected proapoptotic proteins (e.g., Puma, p19ARF)

Cell isolation and RT-qPCR

Please note that this is not an exhaustive list and represents only methods that the authors routinely use

4

Notes 1. In our experience, media and serum from various commercial sources is equally suitable. 2. PBS must be sterilized by filtering through 0.45μm filter. Alternatively, sterile PBS is commercially available from several suppliers. The use of calcium and magnesium ion-free PBS is recommended for harvesting of cells with trypsin. 3. It is essential to use the z isomer of 4OHT (Sigma, St. Louis, CA, USA). 4. Alternate fluorophores such as Annexin V-FITC conjugate can also be used; however, this may lead to signal overflow into FL2 channel in the flow cytometer contaminating PI absorbance. Normalization of samples will then be required (see flow cytometer manufacturer’s protocols). Cells exhibiting Annexin V only are considered to be “early apoptotic” cells whereas those exhibiting both PI and Annexin V are considered to be “late apoptotic,” possibly undergoing secondary necrosis. Therefore, the kinetics of apoptosis induction should be taken into account when analyzing such data. 5. Other flow cytometers can be used but the protocol may need to be adapted to suit manufacturer’s guidelines. 6. Fluorescent detection systems for Western blots provide a larger linear range of signal, increased sensitivity and quantitative data, for example, when comparing the expression of a

226

Dan Lu et al.

particular posttranslationally modified species with the total amount using antibodies conjugated to dyes with different emission spectra. 7. β-mercaptoethanol can be replaced by freshly added 2 mM dithiothreitol (DTT). A stock solution of 1 M DTT can be stored in aliquots at 20
C. 8. Acrylamide is a neurotoxin and carcinogen in high concentrations and can be adsorbed through the skin. It should be handled with care with reference to local safety guidelines. 9. Caspase 3 (like all caspases) is present as a larger inactive pro-caspase of ~32 kDa and on activation is cleaved to smaller subunits—antibodies specific for the larger of the cleaved subunits (17–21 kDa) can therefore be used to detect its activation. Alternatively, specific cleaved caspase 3 (Asp175) antibodies directly coupled to various conjugates are available. For example, Alexa Fluor 488 (Cell Signaling, Danvers, MA, USA) or biotinylated (Cell Signaling, Danvers, MA, USA, catalogue number 9654) conjugates can be used. 10. It is also possible to detect other proapoptotic genes known to be induced directly or indirectly by Myc (e.g., p19ARF, Bim, Puma) for which specific antibodies are available. 11. A simple humidified chamber can be constructed by fixing plastic pipettes to the bottom of a 245  245 mm assay dish (Corning, NY, USA,) and placing moistened tissue paper inside the chamber. 12. Proteinase K should be certified nuclease-free so as not to generate false-positive results. 13. Alternatively a BCIP/NBT substrate kit is also suitable. 14. Alternatively dissolve 6 mg of DAB in 9 mL of 50 mM Tris-Cl, pH 7.5 and add 1 mL 0.3% NiCl2 if required. 15. 2 Laemmli sample buffer can be prepared as follows: 125 mM Tris–HCl, pH 6.8, 4% SDS, 20% glycerol, 400 mM DTT, 0.004% bromophenol blue. 16. If using a greater/reduced culture area size, adjust cell numbers linearly proportional (e.g., for 25 cm2 flask, plate 1,25,000 cells). 17. One of the first manifestations of apoptosis in vitro is the rounding up and detachment of the cell from the substratum. In many cases, this cannot be distinguished from the early stages of cell division. Time-lapse microscopy is extremely useful in distinguishing dividing cells (that readhere to the substratum) and those that are apoptotic (and do not reattach) and exhibit membrane blebbing.

Myc-Induced Apoptosis

227

18. Trypsin treatment of adherent cells in culture must be performed with care as it could disrupt the plasma membrane causing phosphatidylserine to flip, allowing Annexin V stains to bind giving false readings. Alternatively, cells can be gently scraped into 2 mL of cold PBS. To avoid cell damage and increased plasma membrane permeability, cells should be not be centrifuged above 400  g. 19. Annexin V binding is reversible therefore perform staining and flow cytometry procedures as quickly as possible to reduce errors. Analyze by flow cytometry within 4 hours of initial collection of cells. 20. Count cells with a simple hemocytometer counting chamber at this stage in order to calculate volume of binding buffer to add. Alternatively, the protein concentration of the lysate can be determined using one of the commercially available protein assay kits (e.g., Thermo Scientific Pierce BCA protein assay, Rockford, IL, USA, catalogue number 23227). 21. Alternatively, cells can be lysed with other methods prior to protein analysis. For example, cells can by lysed directly in Laemmli sample buffer (see Note 15), although the high concentration may preclude determination of protein concentration with some commercial assay kits. DNA in lysates can also be sheared using a sonicator to reduce sample viscosity. 22. Appropriate antibody concentrations are normally indicated on the supplied data sheet. 23. Equal loading of the protein gel and transfer to the membrane can be assessed by Ponceau S staining of the membrane or re-probing with an antibody to a “housekeeping protein” where the protein assumed to be expressed equally in all cells under all conditions (for example, β-actin or γ-tubulin). 24. The optimum incubation time and concentration of proteinase K may need to be determined empirically. Other methods employ pepsin or trypsin or, for tissues with extensive extracellular matrix, microwave treatment in 0.1 M citrate buffer, pH 6.0 (instead of proteinase K treatment). 25. Incubate the tissue in 3 U/mL DNase 1 in 50 mM Tris–HCl, pH 7.5, 10 mM MgCl2, 1 mg/mL BSA for 10 min at room temperature. 26. Pilot experiments in which the concentration of TdT is titrated between 0.05 and 0.2 U/μL should be conducted. 27. A negative control should be included in which TdT is omitted. 28. BSA can be substituted with 10% FCS.

228

Dan Lu et al.

29. BCIP/NBT gives a purple/bluish color. Other substrates such as fast red may be used. Intensity of colour can be optimized by varying incubation time and can be modified by user accordingly. 30. Trouble shooting: (1) false-negative results may be due to restricted access of TdT enzyme due to extensive extracellular matrix, (2) false positives may be due to extensive DNA damage occurring in late stages of necrosis or DNA strand breaks in cells exhibiting high proliferative rates and/or high metabolic activity. Accompanying morphological (e.g., pyknotic nuclei) changes should be used to confirm apoptosis. 31. DAB produces a brown stain, if a more intense colour is required then nickel chloride may be added to the substrate to produce a grey/black colour—see kit instructions (see also Note 14). 32. It is not always possible to see a pellet of RNA if small numbers of cells are collected. 33. If only a few cells are captured do not dilute cDNA. 34. Taqman probes can also be used.

Acknowledgments This work was supported by Cancer Research UK. We are indebted to our colleagues for advice on the methods presented in this chapter. References 1. McMahon SB (2014) MYC and the control of apoptosis. Cold Spring Harb Perspect Med 4: a014407. https://doi.org/10.1101/ cshperspect.a014407 2. Lowe SW, Cepero E, Evan G (2004) Intrinsic tumour suppression. Nature 432:307–315 3. Pelengaris S, Khan M, Evan GI (2002) Suppression of Myc-induced apoptosis in beta cells exposes multiple oncogenic properties of Myc and triggers carcinogenic progression. Cell 109:321–334 4. Dansen TB, Whitfield J, Rostker F et al (2006) Specific requirement for Bax, not Bak, in Myc-induced apoptosis and tumor suppression in vivo. J Biol Chem 281:10890–10895 5. Murphy DJ, Junttila MR, Pouyet L et al (2008) Distinct thresholds govern Myc’s biological output in vivo. Cancer Cell 14:447–457

6. Li X, Zhang XA, Li X, Xie W, Huang S (2015) MYC-mediated synthetic lethality for treating tumors. Curr Cancer Drug Targets 15:99–115 7. Cermelli S, Jang IS, Bernard B, Grandori C (2014) Synthetic lethal screens as a means to understand and treat MYC-driven cancers. Cold Spring Harb Perspect Med 4:a014209. https://doi.org/10.1101/cshperspect. a014209 8. Evan GI, Wyllie AH, Gilbert CS et al (1992) Induction of apoptosis in fibroblasts by c-myc protein. Cell 69:119–128 9. Littlewood TD, Hancock DC, Danielian PS et al (1995) A modified oestrogen receptor ligand-binding domain as an improved switch for the regulation of heterologous proteins. Nucleic Acids Res 23:1686–1690 10. Soucek L, Whitfield JR, Sodir NM, MassoValles D, Serrano E, Karnezis AN, Swigart LB, Evan GI (2013) Inhibition of Myc family

Myc-Induced Apoptosis proteins eradicates KRas-driven lung cancer in mice. Genes Dev 27:504–513 11. Kortlever RM, Sodir NM, Wilson CH, Burkhart DL, Pellegrinet L, Brown Swigart L, Littlewood TD, Evan GI (2017) Myc cooperates with Ras by programming inflammation and immune suppression. Cell 171:1301–1315 12. Sodir NM, Kortlever RM, Barthet VJA, Campos T, Pellegrinet L, Kupczak S, Anastasiou P, Brown Swigart L, Soucek L, Arends MJ, Littlewood TD, Evan GI (2020) Myc instructs and maintains the pancreatic adenocarcinoma phenotype. Cancer Discov 10 (4):588–607. https://doi.org/10.1158/ 2159-8290.CD-19-0435 13. Iaccarino I, Hancock D, Evan G et al (2003) c-Myc induces cytochrome c release in Rat1 fibroblasts by increasing outer mitochondrial membrane permeability in a Bid-dependent manner. Cell Death Differ 10:599–608 14. Juin P, Hunt A, Littlewood T et al (2002) c-Myc functionally cooperates with Bax to induce apoptosis. Mol Cell Biol 22:6158–6169 15. Wagner AJ, Kokontis JM, Hay N (1994) Myc-mediated apoptosis requires wild-type p53 in a manner independent of cell cycle arrest and the ability of p53 to induce p21waf1/cip1. Genes Dev 8:2817–2830 16. Zindy F, Eischen CM, Randle DH et al (1998) Myc signaling via the ARF tumor suppressor regulates p53-dependent apoptosis and immortalization. Genes Dev 12:2424–2433 17. Hermeking H, Eick D (1994) Mediation of cMyc-induced apoptosis by p53. Science 265:2091–2093

229

18. Hoffman B, Liebermann DA (2008) Apoptotic signaling by c-MYC. Oncogene 27:6462–64672 19. Muthalagu N, Junttila MR, Wiese KE, Wolf E, Morton J, Bauer B, Evan GI, Eilers M, Murphy DJ (2014) BIM is the primary mediator of MYC-induced apoptosis in multiple solid tissues. Cell Rep 8:1347–1353 20. Hueber A, Zo¨rnig M, Lyon D et al (1997) Requirement for the CD95 receptor-ligand pathway in c-Myc-induced apoptosis. Science 278:1305–1309 21. Tanaka H, Matsumura I, Ezoe S et al (2002) E2F1 and c-Myc potentiate apoptosis through inhibition of NF-kappaB activity that facilitates MnSOD-mediated ROS elimination. Mol Cell 9:1017–1029 22. Kauffmann-Zeh A, Rodriguez-Viciana P, Ulrich E et al (1997) Suppression of c-Mycinduced apoptosis by Ras signalling through PI (3)K and PKB. Nature 385:544–548 23. Juin P, Hueber AO, Littlewood T et al (1999) c-Myc-induced sensitization to apoptosis is mediated through cytochrome c release. Genes Dev 13:1367–1381 24. Kreuzaler P, Clarke MA, Brown EJ, Wilson CH, Kortlever RM, Piterman N, Littlewood T, Evan GI, Fisher J (2019) Heterogeneity of Myc expression in breast cancer exposes pharmacological vulnerabilities revealed through executable mechanistic modeling. Proc Natl Acad Sci U S A 116:22399–22408

Chapter 11 Measuring MYC-Mediated Metabolism in Tumorigenesis Hsin-Yao Tang, Aaron R. Goldman, Xue Zhang, David W. Speicher, and Chi V. Dang Abstract The MYC gene regulates normal cell growth and is deregulated in many human cancers, contributing to tumor growth and progression. The MYC transcription factor activates RNA polymerases I, II, and III target genes that are considered housekeeping genes. These target genes are largely involved in ribosome biogenesis, fatty acid, protein and nucleotide synthesis, nutrient influx or metabolic waste efflux, glycolysis, and glutamine metabolism. MYC’s function as a driver of cell growth has been revealed through RNA sequencing, genome-wide chromatin immunoprecipitation, proteomics, and importantly metabolomics, which is highlighted in this chapter. Key words MYC, Transcription, Cancer metabolism, Metabolomics, Mass spectrometry

1

Introduction The MYC gene encodes a basic-helix-loop-helix-leucine zipper (bHLH-LZ) transcription factor which dimerizes with its partner bHLH-LZ Max to bind DNA and mediate transcriptional responses involved in cell growth, metabolism, and proliferation [1, 2]. The MYC gene emerges as a central regulator of cell growth and proliferation through its ability to increase metabolism, by inducing carbohydrate, lipid, nucleotide, and protein synthesis [1, 2]. A key nexus that integrates many of these pathways is MYC-induced ribosome biogenesis, which requires ribosomal protein synthesis and ribosomal RNA synthesis from de novo production of ribose from glucose and nucleotide synthesis (Fig. 1) [3, 4]. These physiological and other roles of MYC, such as modulating inflammatory signaling, are hijacked when MYC is deregulated either downstream of oncogenic signaling or through MYC gene amplification, rendering MYC-driven tumorigenesis dependent on dysregulated, heightened anabolic metabolism [5]. As a transcription factor, MYC was first found to induce genes involved and metabolism, such as lactate dehydrogenase and

Laura Soucek and Jonathan Whitfield (eds.), The Myc Gene: Methods and Protocols, Methods in Molecular Biology, vol. 2318, https://doi.org/10.1007/978-1-0716-1476-1_11, © Springer Science+Business Media, LLC, part of Springer Nature 2021

231

232

Hsin-Yao Tang et al.

Maintenance metabolism glucose

Rhythmic metabolism Homeostasis

glucose

SLC2A1

NADH LDHA NAD+ lactate

pyruvate acetyl-CoA

Nucleic acids Fay acids

oxaloacetate malate fumarate succinate

citrate isocitrate Maintenance Biomass

a-ketoglutarate

glutamate ->(GSH)

glutamine

GLS

glutamine

SLC1A5

Amino acids

aa-tRNA Ribosomes

Amino acids

SLC7A5

Myc-induced proliferave metabolism glucose

glucose SLC2A1

Deregulated metabolism Growth NADH

LDHA pyruvate

MYC

NAD+ lactate

acetyl-CoA Nucleic acids Fay acids

oxaloacetate malate fumarate succinate

citrate isocitrate increase Biomass

a -ketoglutarate

glutamate ->(GSH)

GLS

glutamine SLC1A5

Amino acids

glutamine

aa-tRNA Ribosomes SLC7A5

Amino acids

Fig. 1 The diagram depicts maintenance metabolism versus Myc transcriptional amplification of proliferative metabolism through inducing metabolic genes and altering metabolism as gleaned from transcriptomic and

MYC Regulation of Cancer Metabolism

233

ornithine decarboxylase [1, 2]. In the ensuing years after these initial discoveries, MYC was uncovered to broadly stimulate proliferative metabolism as compared to maintenance metabolism [5]. In adult organisms, except for stem cell compartments, >90% of cells have differentiated into various tissues and no longer could proliferate. The terminally differentiated cells undergo maintenance metabolism that largely provides ATP for maintenance of membrane potentials and sufficient biosynthesis for replacement of damaged molecules and organelles. In maintaining the integrity of a nonproliferating cell, MYC does not appear to play an important role in “turbo-charging” metabolic pathways to move large amounts of nutrient-derived building blocks into the construction of new macromolecules and organelles for cell growth, DNA replication, and cell division [5]. By contrast, when MYC is stimulated in normal cells, such as T cells, or oncogenically activated in cancers, the open chromatin of metabolic genes permits MYC to bind these genes and amplify their expression [6, 7]. The resulting production of enzymes across many intermediary pathways together with production of ribosomes allows for the growing cell to drive nutrientderived building blocks into cell mass. A key difference between normal MYC and oncogenic MYC is the ability of normal cells to return to maintenance metabolism after MYC is turned off and the cells no longer proliferate. By contrast, deregulated MYC induces deregulated metabolism and biosynthesis, rendering MYC-addicted cells dependent on continuous sources of nutrients [5]. Intriguingly, maintenance metabolism is largely affected by the circadian clock which regulates cellular metabolism in a 24-h cycle (Fig. 1), coupled with organismal fasting (sleep) and feeding (wake) cycles to optimize organismal metabolic fitness [8]. During the sleep cycle, the cell intrinsic clock induces repair mechanisms to renew damaged molecules and organelles, while during the ä Fig. 1 (continued) metabolomic studies. While maintenance metabolism is largely influenced by the circadian clock, which regulates hundreds of metabolic genes diurnally, MYC is able to disrupt the circadian clock to drive increased anabolic metabolism for cell growth and proliferation. The sizes of the arrows depict fluxes, the triangles from extracellular nutrients reflect the concentration gradients, and letter font sizes reflect expression or concentration levels. Notably, MYC induces many genes encoding nutrient transporters that allow for the import of building blocks as they are depleted intracellularly by enhanced incorporation into macromolecules and increased concentration gradient. Counterintuitively, the intracellular levels of glucose, for example, is lowered by oncogenic MYC, which drives free intracellular glucose into biomass and thereby increasing the gradient and inward flux. Glucose, glutamine, and amino acids are shown as key nutrient sources driven into cells by mass action to provide the essential building blocks, generated through glycolysis (glucose conversion to pyruvate) and the tricarboxylic acid cycle. Translational amplification by mTOR, which is activated by amino acids, increases incorporation of building for biomass accumulation or cell growth and subsequent cell division. LDHA, lactate dehydrogenase A. GLS glutaminase, GSH glutathione, aa-tRNA aminoacyl-tRNAs

234

Hsin-Yao Tang et al.

metabolic active wake phase, the clock allows for heightened metabolism to support the function of cells in various tissues and organs. Interestingly, oncogenic MYC (or MYCN) was found to profoundly disrupt the circadian clock and circadian metabolism as it induces proliferative metabolism (Fig. 1) [9]. Over the years, the role of MYC in metabolism has been enriched by many studies linking MYC to many different metabolic pathways. Many of these studies were enabled by metabolomics studies using mass spectrometry [10, 11]. In this regard, to measure MYC-mediated metabolism, a number of factors should be considered for sample preparation, which is provided here. Because metabolic pathways are highly dynamic and many metabolites have a fast turnover rate, rapid quenching and extraction of polar or nonpolar compounds are critical steps for consistently measuring MYC-mediated metabolic changes at the time of sample collection. The following provides protocols for extracting polar and nonpolar metabolites so that they can be properly analyzed by mass spectrometry. With specific reference to MYC, experimental inducible systems are most desirable to determine the effect of MYC on metabolism in a controlled isogenic cell system.

2

Materials

2.1 Polar Metabolite Extraction

1. Methanol, LC-MS grade (Acros Organics). 2. Water, Milli-Q (Millipore). 3. Stable isotope-labeled (SIL) amino acid mix standard MSK-A2-1.2 (Cambridge Isotope Laboratories). 4. Dulbecco’s phosphate-buffered saline (DPBS, Corning) or Hanks’ Balanced Salt Solution (HBSS, Thermo Fisher Scientific) with calcium and magnesium. 5. 1.5 ml polypropylene centrifuge tubes. 6. Disposable polyethylene cell lifters. 7. Positive displacement pipettes and tips.

2.2

Lipid Extraction

1. Chloroform, LC-MS grade (OmniSolv). 2. Methanol, LC-MS grade (Acros Organics). 3. Water, LC-MS grade (OmniSolv). 4. Dulbecco’s phosphate-buffered saline (DPBS, Corning) or Hanks’ Balanced Salt Solution (HBSS, Thermo Fisher Scientific) with calcium and magnesium. 5. EquiSPLASH Lipidomix internal standard (Avanti Polar Lipids). 6. Sodium chloride (Sigma).

MYC Regulation of Cancer Metabolism

235

7. Disposable polyethylene cell lifters (Fisherbrand). 8. Disposable glass tubes (10 or 15 ml) and caps with Teflon/ PTFE septums (Corning). 9. Disposable glass pipets 10 ml (Fisherbrand). 10. Positive displacement pipettes and tips.

3

Methods

3.1 Extraction of Polar Metabolites for LC-MS/MS Analysis

Effective, reproducible extraction of metabolites is critical to the success of any metabolomics experiment. The 80% methanol used in this protocol will extract a broad range of metabolites including amino acids, organic acids, phosphates, sugars, cofactors, and nucleotides. Many small polar molecules involved in the central carbon metabolism are also efficiently extracted. Extracted metabolites are subsequently separated and analyzed using hydrophobic interaction liquid chromatography (HILIC) and liquid chromatography tandem mass spectrometry (LC-MS/MS). This protocol is suitable for quantifying steady-state metabolite levels or, in a separate experiment, evaluation of metabolic fluxes using stable isotope tracers such as U-13C6-glucose or U-13C5-glutamine (see Note 1). 1. Prepare extraction solution containing 80% methanol, 20% water, and 0.2 μM SIL standard. Store at
20  C until use. Transfer to dry ice on the day of extraction. 2. Culture cells in appropriate dishes or flasks. A minimum of three biological replicates for extraction and a fourth parallel replicate to be used for cell counts are required per condition. Aim for two million cells or approximately 300 μg total protein per sample. In parallel, incubate several dishes or flasks with media but without cells to identify background compounds (see Note 2). 3. For adherent cells, determine cell counts from a separate, parallel culture immediately before the end of the incubation period (see Note 3 if working with suspension cells). 4. Place the culture dishes on a bed of ice and remove media completely by aspiration. Save an aliquot of the conditioned media if changes in metabolite levels in media are of interest (see Note 4). 5. Wash cells twice with ice-cold HBSS or DPBS while keeping the culture dishes on the bed of ice. After the final wash, completely remove all wash solution (see Note 5). 6. Add 700 μl of ice-cold extraction solution to each sample (see Note 6).

236

Hsin-Yao Tang et al.

7. Scrape cells with a disposable cell lifter and transfer cell suspension to a precooled 1.5 ml polypropylene centrifuge tube on dry ice. 8. Rinse the dish and cell lifter using 300 μl of ice-cold extraction solution. Transfer to the same 1.5 ml polypropylene tube on dry ice. 9. Vortex thoroughly for 30 s. Place tube on dry ice for at least 30 min. 10. Centrifuge at maximum speed in a microfuge (>16,000  g) for 15 min at 4  C to pellet the cell debris. 11. Carefully transfer supernatant to LC vials while taking care to not disturb the pellet. Air-dry the pellet and determine the protein concentration using a commercial colorimetric protein assay (see Note 7). 12. Analyze extracted metabolites in supernatant using a suitable LC-MS/MS system with chromatographic separation on a HILIC column (see Note 8). 3.2 Extraction of Nonpolar Lipids for LC-MS/MS Analysis

This protocol describes the extraction of nonpolar lipids from cells using liquid-liquid extraction based on the modified Folch method [12, 13]. Extraction with chloroform:methanol:0.88% NaCl results in the formation of a biphasic solution with nonpolar lipids partitioned into the lower phase and a protein pellet suspended between the phases. Extracted lipids are analyzed by high-resolution reversed-phase LC-MS/MS. More than 1000 lipid species spanning more than 25 classes are routinely identified and quantified. 1. Prepare 0.88% (w/v) NaCl in water. Filter (0.2 μm) and store at 4  C. 2. Prepare synthetic lower phase by mixing chloroform:methanol:0.88% NaCl at 2:1:1 ratio. Using a glass pipet, transfer lower phase to a glass bottle with Teflon/PTFE-lined cap. Store synthetic lower phase, chloroform and methanol at
20  C (see Note 9). 3. Culture cells in appropriate dishes or flasks. A minimum of three biological replicates are required per condition for extraction plus a fourth replicate for cell counting. Aim for at least four million cells or approximately 600 μg total protein per sample. In parallel, incubate several dishes or flasks with media without cells for extraction and identification of background compounds (see Note 2). 4. For adherent cells, determine cell counts from a separate, parallel culture immediately before the end of the incubation period (see Note 3 if working with suspension cells). 5. Place the culture dishes on a bed of ice and remove media by aspiration. Save an aliquot of the conditioned media if changes

MYC Regulation of Cancer Metabolism

237

in nonpolar metabolite levels in media are of interest (see Note 4). 6. Wash cells twice with ice-cold HBSS or DPBS while keeping the culture dishes on the bed of ice. After the final wash, completely remove all the wash solution (see Note 5). 7. Add 0.75 ml of ice-cold methanol per four million cells to the dish. Scrape cells with a disposable cell lifter and transfer cell suspension to a 10 ml glass tube. 8. Rinse dish and cell lifter with 0.75 ml of ice-cold methanol and transfer to the same 10 ml glass tube. 9. Add 5 μl EquiSPLASH to each sample (see Note 10). 10. Add 1.5 ml of ice-cold 0.88% NaCl and 3 ml of ice-cold chloroform. 11. Vortex vigorously for 30 s. 12. Sonicate in ice-cooled water bath for 5 min. Vortex vigorously for another 30 s. 13. Centrifuge at 250  g, at 4  C, for 15 min. 14. Transfer lower phase containing nonpolar lipids into a new glass tube using 900 glass Pasteur pipets. 15. Reextract upper phase with 3 ml of synthetic lower phase by repeating steps 11–13. 16. Combine this lower phase with the previously collected lower phase (step 14) and dry under nitrogen. 17. Solubilize dried lipids in 100 μl 1:9 chloroform:methanol (see Note 11). 18. Centrifuge for 2 min and transfer samples to glass LC vials with Teflon/PTFE-lined caps for reversed-phase LC-MS/MS analysis (see Note 12). 19. Air-dry protein pellet and determine the protein concentration (see Note 7).

4

Notes 1. For stable isotope tracing experiments, replace media with the same media where a natural metabolite of interest has been replaced with its stable isotope version (such as U-13C6-glucose or U-13C5-glutamine). Culture cells until steady state labeling is reached; typically, 24 h is sufficient. Use the appropriate isotopic tracer for the pathway of interest [14]. 2. For smaller sized cells (e.g., T-cells), aim for the number of cells per replicate that is equivalent to ~300 μg protein for polar metabolites and ~600 μg protein for nonpolar metabolites. If

238

Hsin-Yao Tang et al.

cells are limiting, proportionally scale-down the volume of extraction solution to achieve the targeted concentration of extracted metabolites. 3. For suspension cells, count cells in each sample. Pellet cells by centrifugation at 180  g for 5 min at 4  C. Wash cells twice with cold DPBS and transfer to 1.5 ml polypropylene tube. To extract polar metabolites, add 1 ml of ice-cold extraction solution to cell pellet. Continue with steps 9–12 (Subheading 3.1). For nonpolar metabolites, add 1.5 ml of methanol to cell pellet, vortex, and transfer to a 10 ml glass tube. Continue with steps 9–19 (Subheading 3.2). 4. Metabolites from conditioned media can be extracted and analyzed in parallel with cell extracts. For polar metabolites, add 950 μl of ice-cold extraction solution to 50 μl of media in a 1.5 ml polypropylene tube. Continue with steps 9–12 (Subheading 3.1). For nonpolar metabolites, transfer 500 μl of media to a 15 ml glass tube and add 2.5 ml of methanol. Continue with steps 9–19 (Subheading 3.2) but use 2 ml of 0.88% NaCl, 5 ml of chloroform, and 5 ml of synthetic lower phase. 5. Use HBSS for poorly adhering cells. It is critical to perform this step as quickly as possible and on ice with ice-cold solutions to minimize perturbation of metabolites. Retention of excess HBSS or DPBS after centrifugation could potentially interfere with LC-MS analysis. 6. 80% methanol will lyse cells and stop cellular metabolism. The relative broad range of metabolites effectively extracted makes this protocol suitable for untargeted metabolomic analysis. For targeted analysis of specific metabolites, alternative extraction solutions could be more appropriate. SIL internal standards in the extraction solution are used to assess extraction reproducibility and LC-MS/MS system performance. 7. Do not overdry protein pellet, and ensure the pellet is completely solubilized in appropriate buffer (e.g., 1% SDS, 150 mM NaCl, 1 mM EDTA, 50 mM Tris-Cl, pH 7.5). Protein concentration determined using a colorimetric protein assay, such as the BCA assay, can be used for normalizing metabolite and lipid levels across samples. 8. Our LC-MS/MS system consists of a high mass resolution Q Exactive HF-X mass spectrometer and Vanquish Horizon UHPLC (Thermo Fisher Scientific). Polar metabolites are separated by HILIC chromatography on a ZIC-pHILIC 2.1 mm  150 mm column (EMD Millipore). However, recent batches of this column were observed to contain high levels of 212.1 m/z contaminant and displayed poor separation of phosphate-containing metabolites. An alternative HILIC

MYC Regulation of Cancer Metabolism

239

column with good performance is the Amide XBridge column (Waters). 9. Chloroform is toxic and incompatible with plastics. All transfers involving chloroform should be conducted in a chemical fume hood. Solutions and samples containing chloroform should only be handled using glass pipets and stored in glass tubes with Teflon/PTFE-lined caps. All organic solvents should be added using positive displacement pipettes. 10. EquiSPLASH contains a mixture of 13 deuterated lipid internal standards from different lipid classes that are used to assess extraction reproducibility, LC-MS/MS system performance, and normalization of lipid quantitation across samples. 11. To effectively solubilize dried lipids, first add 10 μl of chloroform to samples, vortex, then add 90 μl of methanol, and vortex again. 12. We typically separate lipids by reversed-phase chromatography on an Accucore C30 2.1 mm  150 mm column (Thermo Fisher Scientific). References 1. Dang CV (2012) MYC on the path to cancer. Cell 149:22–35 2. Eilers M, Eisenman RN (2008) Myc’s broad reach. Genes Dev 22:2755–2766 3. Johnston LA et al (1999) Drosophila myc regulates cellular growth during development. Cell 98:779–790 4. van Riggelen J, Yetil A, Felsher DW (2010) MYC as a regulator of ribosome biogenesis and protein synthesis. Nat Rev Cancer 10:301–309 5. Dang CV (2016) A time for MYC: metabolism and therapy. Cold Spring Harb Symp Quant Biol 81:79–83 6. Wang R et al (2011) The transcription factor Myc controls metabolic reprogramming upon T lymphocyte activation. Immunity 35:871–882 7. Kress TR, Sabo` A, Amati B (2015) MYC: connecting selective transcriptional control to global RNA production. Nat Rev Cancer 15:593–607 8. Bass J, Takahashi JS (2010) Circadian integration of metabolism and energetics. Science 330:1349–1354

9. Altman BJ et al (2015) MYC disrupts the circadian clock and metabolism in cancer cells. Cell Metab 22:1009–1019 10. Le A et al (2012) Glucose-independent glutamine metabolism via TCA cycling for proliferation and survival in B cells. Cell Metab 15:110–121 11. Murphy TA, Dang CV, Young JD (2013) Isotopically nonstationary 13C flux analysis of Myc-induced metabolic reprogramming in B-cells. Metab Eng 15:206–217 12. Folch J, Lees M, Sloane Stanley GH (1957) A simple method for the isolation and purification of total lipides from animal tissues. J Biol Chem 226:497–509 13. Schug ZT et al (2015) Acetyl-CoA synthetase 2 promotes acetate utilization and maintains cancer cell growth under metabolic stress. Cancer Cell 27:57–71 14. Jang C, Chen L, Rabinowitz JD (2018) Metabolomics and isotope tracing. Cell 173:822–837

Chapter 12 Methods to Study Myc-Regulated Cellular Senescence: An Update Fan Zhang, Wesam Bazzar, Mohammad Alzrigat, and Lars-Gunnar Larsson Abstract Cellular senescence plays a role in several physiological processes including aging, embryonic development, tissue remodeling, and wound healing and is considered one of the main barriers against tumor development. Studies of normal and tumor cells both in culture and in vivo suggest that MYC plays an important role in regulating senescence, thereby contributing to tumor development. We have previously described different common methods to measure senescence in cell cultures and in tissues. Unfortunately, there is no unique marker that unambiguously defines a senescent state, and it is therefore necessary to combine measurements of several different markers in order to assure the correct identification of senescent cells. Here we describe protocols for simultaneous detection of multiple senescence markers in situ, a quantitative fluorogenic method to measure senescence-associated β-galactosidase activity (SA-β-gal), and a new method to detect senescent cells based on the Sudan Black B (SBB) analogue GL13, which is applicable to formalin-fixed paraffin-embedded tissues. The application of these methods in various systems will hopefully shed further light on the role of MYC in regulation of senescence, and how that impacts normal physiological processes as well as diseases and in particular cancer development. Key words MYC, Cellular senescence, SA-β-gal, EdU, Phalloidin, MUG assay, Sudan Black B GL13

1

Introduction Cellular senescence is defined as a state of cell cycle arrest that differs from quiescence in that it is permanent, induced by cell damage, and not responsive to mitogenic signals, while cells remain metabolically active and produce number of secretory factors that communicate with the microenvironment [1–6]. The phenomenon of cellular senescence was originally linked to cellular aging due to telomere dysfunction, but was later shown to be involved in other physiological processes such as embryonic development, tissue remodeling, and wound healing and seems to be more heteroge-

Laura Soucek and Jonathan Whitfield (eds.), The Myc Gene: Methods and Protocols, Methods in Molecular Biology, vol. 2318, https://doi.org/10.1007/978-1-0716-1476-1_12, © Springer Science+Business Media, LLC, part of Springer Nature 2021

241

242

Fan Zhang et al.

neous and dynamic than once assumed [2, 3, 5–7]. Senescence can be induced by various stress conditions including DNA damage, oxidative stress, radiation, cytotoxic agents, hypoxia, cytokine signaling, and oncogenic stress [1–6]. The latter is referred to as oncogene-induced senescence (OIS) and can for instance be triggered by RAS activation [8]. Together with apoptosis, OIS represents a major barrier by which normal cells are restrained from malignant transformation and that needs to be overcome for tumor development to occur [9]. The p53 and RB tumor suppressor pathways are crucial for the induction and maintenance of senescence in cells in vitro and in vivo [1–6]. However, senescence can also be viewed as a “double-edged sword,” since certain factors secreted from senescent cells can promote tumor development, and since cells bypassing or escaping from senescence seem to have an increased tumorigenic potential [2, 3, 5–7]. MYC has been implicated in suppressing and bypassing senescence induced by for instance RAS, BRAF, STAT5, and mTOR [10–17] or by the TGF-β tumor suppressor pathway [18] in cell cultures and in vivo, thereby contributing to initiation and maintenance of tumorigenesis. Further, inactivation of MYC using MYC ON/OFF systems in mouse tumor models often results in tumor regression through apoptosis, senescence, or differentiation depending on the context [15, 16, 19, 20]. On the other hand, MYC has been shown to trigger senescence under certain conditions, for instance, in cells lacking CDK2 or WRN [12, 21–25]. Cellular senescence can, in addition to cell cycle arrest, be monitored through a variety of biomarkers: senescence-associated β-galactosidase (SA-β-gal) activity due to high lysosomal activity, increased expression of the cyclin-dependent kinase (CDK) inhibitors p16INK4A (p16, CDKN2A) and p21CIP1 (p21, CDKN1A), increased cellular and nuclear size, senescence-associated heterochromatin foci (SAHF), induction of DNA damage response, high metabolic activity, as well as senescence-associated secretory phenotype (SASP) [2–7, 26]. It is worth mentioning that there is no single marker that unambiguously defines a senescent state. It is therefore necessary to combine measurements of several different markers that when taken together increase fidelity of the senescence analysis during normal development as well as in disease [2, 3, 6]. In a previous edition of The Myc Gene: methods and protocols, we contributed with a chapter where we described in detail several of the most common methods used to measure cellular senescence in relation to MYC [27]. Here we have updated some of these protocols and also added new methods to monitor cellular senescence in cells and in vivo.

MYC-Regulated Senescence

2

243

Materials

2.1 Reagents and Solutions for SA-β-gal Detection In Situ

1. SA-β-gal fixing solution: 5.4 mL of 4% formaldehyde and 0.8 mL of 25% glutaraldehyde in 100 mL PBS. Prepare freshly before use (see Note 1). 2. 0.1 M citric acid solution: 4.2 g citric acid monohydrate in 200 mL distilled deionized water. 3. 0.2 M sodium phosphate solution: 5.68 g sodium phosphate dibasic in 200 mL distilled deionized water. 4. 0.2 M citric acid/sodium phosphate buffer, pH 6.0: mix 92.1 mL of 0.1 M citric acid and 157.9 mL of 0.2 M sodium phosphate solution, and adjust pH to 6.0. 5. 1 M magnesium chloride solution: 10.17 g magnesium chloride in 50 mL distilled deionized water. 6. 5 M NaCl solution: 292 g of NaCl in 800 mL of distilled deionized water and adjust the volume to 1 L with water. 7. SA-β-gal staining stock solution: 0.412 g potassium ferricyanide (III), 0.528 g potassium ferrocyanide (II) (see Note 2), 7.5 mL of 5 M NaCl solution, 0.5 mL of 1 M magnesium chloride solution in 250 mL of 0.2 M citric acid/sodium phosphate buffer. 8. 20
X-gal solution: 20 mg 5-bromo-4-chloro-3-indolyl-β-Dgalactopyranoside (X-gal, Thermo Scientific) in 1 mL dimethylformamide (DMF) (see Note 3); stored in dark at 20  C. 9. SA-β-gal staining working solution: 50μL of 20
X-gal solution freshly added into 950μL SA-β-gal staining stock solution.

2.2 Reagents and Solutions for EdU Labeling

1. Click-iT® EdU Alexa Fluor® (594) Imaging Kit (Thermo scientific).

2.3 Reagents and Solutions for Phalloidin and DAPI Staining

1. Alexa Fluor™ 488 Phalloidin (Thermo scientific) was dissolved in methanol as 40
stock solution (66μM), which was diluted in PBS with 1% bovine serum albumin (BSA) as 1
phalloidin staining solution.

2. Permeabilizing solution: 0.5 mL Triton X-100 in 100 mL PBS.

2. DAPI was dissolved in distilled water at a concentration of 1 mg/mL as 1000
stock solution and stored in 4  C for short term or at 20  C for long-term storage. 3. Mounting medium (Thermo scientific).

244

Fan Zhang et al.

2.4 Reagents and Solutions for SA-β-gal Detection in Cell Lysates

1. 0.1 M citric acid solution: 4.2 g citric acid monohydrate in 200 mL distilled deionized water. 2. 0.1 M sodium phosphate buffer (pH 7.4): 3.1 g of NaH2PO4∙H2O and 10.9 g of Na2HPO4 (anhydrous) to distilled H2O to make a volume of 1 L. The pH of the final solution will be 7.4. 3. 1 M benzamidine hydrochloride solution (Sigma). 4. 10 mM phenylmethanesulfonyl fluoride (PMSF) solution: 17.4 mg PMSF dissolved in 10 mL isopropanol; stored at 20  C. 5. 5 M NaCl solution: 292 g of NaCl in 800 mL of distilled deionized water and adjust the volume to 1 L with water. 6. 1 M magnesium chloride solution: 10.17 g magnesium chloride in 50 mL distilled deionized water. 7. 2-Mercaptoethanol (14.3 M, Sigma). 8. Cell lysis buffer: mix 50μL of 1 M benzamidine hydrochloride solution, 40 mL of 0.1 M citric acid solution, and 40 mL of 0.1 M sodium phosphate buffer. Dissolve 0.307 g 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate [CHAPS] in the mixture and freshly added 2.5 mL of 10 mM PMSF solution; adjust pH to 6.0 and volume to 100 mL with water. 9. 2
reaction buffer: mix 6 mL of 5 M NaCl solution, 0.4 mL of 1 M magnesium chloride solution, 40 mL of 0.1 M citric acid solution, and 40 mL of 0.1 M sodium phosphate buffer; adjusted pH to 6.0 and volume to 100 mL with water. Freshly add 70μL 2-mercaptoethanol before use (see Note 4). 34 mM MUG (4-methylumbelliferyl-β-D-galactopyranoside) stock solution in DMSO was added into the reaction buffer at a final concentration of 1.7 mM immediately prior to use. 10. 400 mM sodium carbonate stop solution: dissolve 0.424 g Na2CO3 in 10 mL distilled water, pH 11.0. 11. BCA protein assay kit (Thermo scientific).

2.5 Reagents and Solutions for Sudan Black B (SBB) Analogue GL13 Detection in Tissue Sections

1. Goat anti-biotin antibody (Novus biologicals, NB120-6643). 2. Rabbit anti-goat HRP-conjugated secondary antibody (Vector Laboratories, BA-5000). 3. SenTraGor detection kit (PAN biotech, AR8850020). 4. ImmPACT DAB (Vector Laboratories, SK-4105). 5. Vectastain ABC kit (Peroxidase) (Vector Laboratories, PK-6100). 6. Avidin/Biotin blocking kit (Vector Laboratories, SP-2001). 7. Mayers hematoxylin (Histolab, 01820).

MYC-Regulated Senescence

245

8. Tris-buffered saline-Tween (TBS-T): 50 mM Tris-Cl, 150 mM NaCl, pH 7.5, 0.1% Tween-20. 9. Phosphate-buffered saline-Tween (PBS-T): 137 mM NaCl, 2.7 mM KCl, 8 mM Na2HPO4, and 2 mM KH2PO4, pH 7.4, 0.1% Tween-20. (TBS), 0.5% Triton X or PBS-T: PBS. 10. Pertex Mounting Medium (Histolab, 00811-EX).

3

Methods

3.1 Simultaneous Detection of Multiple Senescence Markers In Situ

Chromogenic senescence-associated β-galactosidase (SA-β-gal) assay is considered as a “golden standard” in senescence research, in part due to its convenience and cost-efficiency. As first described by Dimri et al. [28], senescent cells display increased β-gal enzymatic activity, which can be detected at pH 6.0 in human cells (pH 5.5 in mice) both in vitro and in vivo. At pH 4.0, all cells, irrespective of their proliferating status, will score positive for β-gal enzymatic activity. One limitation with this assay is that it is not entirely specific, since β-gal activity can for instance also increase due to cell confluency and in certain differentiated cells [28]. SA-β-gal can therefore not be used as a single marker for determining the senescent state of the cell. Proliferative arrest is the most typical marker of senescence, as all of the senescent cells cease to proliferate. However, due to the lack of growth factor stimulation, cells can enter a state of quiescence, which is also characterized by the cell growth arrest. Proliferative arrest can be assessed in several different ways. One can measure cell number over several days (usually 5–7 days) by for instance trypan blue dye exclusion or automated cell counters. Proliferative arrest can also be measured by the absence of DNA replication measured by lack of nucleotide analogue 5-ethynyl-20 -deoxyuridine (EdU) incorporation, which can be visualized in cells by the addition of a cell permeable fluorescent dye binding EdU. Absence of EdU incorporation might not be a sign of cells entering cellular senescence per se, as cells might temporarily exit the cell cycle, as it is the case with quiescence. An additional common marker of proliferative arrest is diminished Ki67 positivity. Other feature of adherent senescent cells is that they enlarge in size and flatten out, and also show extensive vacuolization. These differences in the morphology can be observed by the normal bright light-transmitted microscopy, but phalloidin staining of F-actin filaments is an alternative method that easily can be combined with other immunofluorescence markers. As mentioned in the introduction, there is no reliable single marker of senescent cells. However, if several senescence markers in combination score positive, it can be a very strong indicator of a senescent state. Dimri and colleagues previously described a

246

Fan Zhang et al.

Fig. 1 Combined multi-marker staining for SA-β-gal, EdU, and DAPI in BL melanoma cells in response to treatment with the MYC:MAX inhibitor 10058F4. The cells were treated with 50μM 10058-F4 or DMSO for 6 days, harvested, and stained for SA-β-gal, EdU, and DAPI according to the protocol in Subheading 3.1. Long arrows indicate senescent cells. The short arrow indicates a non-senescent EdU-staining cell staining slightly for β-gal. The latter represents background β-gal staining in this type of cells and is seen both in some of the 10058-F4- and DMSO-treated cells. The images were taken under 20
magnification

combined assay suitable for both cultured cells and tissues [29]. Here we describe a modified protocol to detect multiple senescence markers simultaneously. This can be used in a highthroughput format to measure SA-β-gal activity, EdU incorporation, cell size via phalloidin staining, and DAPI staining all together to determine both cell number and nuclear size in situ (Figs. 1 and 2). 1. Prior to cell harvest, refresh cells with cell media containing 10% fetal bovine serum (FBS) and 3μM EdU provided as ClickiT® EdU Alexa Fluor® (594) Imaging Kit for intended time (see Note 5). 2. Firstly, to perform SA-β-gal staining, remove cell media and wash the cells in PBS twice to remove leftover media, 2 min per wash. 3. Fix cells immediately with freshly prepared SA-β-gal fixation solution at room temperature for 3–5 min (see Note 6).

MYC-Regulated Senescence

247

Fig. 2 Combined multi-marker staining for phalloidin, EdU, and DAPI in A375 melanoma cells in response to treatment with the BRD4 inhibitor JQ1. The cells were treated with 5μM JQ1 or DMSO for 6 days, harvested, and stained for phalloidin, EdU, and DAPI according to the protocol in Subheading 3.1. JQ1 reduces MYC expression in these cells (data not shown). The figure shows that most cells have enlarged and do not under undergo replication in response to JQ1, suggesting that they undergo senescence. The arrow indicates a large cell incorporating EdU. This cell has either not completed the senescence process or is escaping senescence. The images were taken under 10
magnification

4. Remove the fixation solution and wash cells by PBS twice. 5. Add 100μL of SA-β-gal staining solution per well (96-well plate) or 50–100μL per 10 mm glass slide, and incubate for 12–16 h at 37  C in a humid environment (see Note 7). 6. Remove the staining solution and wash the cells with PBS twice, each time 3–5 min, and continue the following assay for EdU labeling. 7. Permeabilize cells in 100μL of permeabilizing solution per well (96-well plates) and incubate for 5 min at room temperature. 8. Wash cells twice in PBS. 9. Incubate cells with 50μL per well of Click-iT® reaction cocktail, prepared according to the manufacturer’s instructions, for 30 min at room temperature, protected from light. 10. Remove the reaction solution and wash cells with PBS twice. 11. Incubate each sample with 50μL of 1
phalloidin staining solution for 30 min at room temperature, protected from light.

248

Fan Zhang et al.

12. Wash cells with PBS twice. 13. Counterstain each sample with 50μL of DAPI solution diluted in PBS (1μg/mL) for 5 min at room temperature, protected from light. 14. Wash cells with PBS twice and add mounting medium (Thermo Scientific). The samples can be stored at 4  C protected from light. 15. Assess the staining of cells under the microscope, SA-β-gal staining in bright field and EdU, phalloidin, and DAPI staining as immunofluorescence (Figs. 1 and 2). 3.2 Fluorogenic SA-β-gal Assay (MUG Assay)

Though chromogenic SA-β-gal assay is widely accepted, it has several limitations. For example, this method normally requires long incubation time (12–16 h) with the substrate X-gal. Further, quantitation of chromogenic SA-β-gal assay is dependent on cell count, which is tedious, semiquantitative, and somewhat subjective, for instance, due to problems with determining the cut-off level for background staining, variation in staining in different areas depending on confluency, etc. Several fluorogenic SA-β-gal assays that tries to overcome these limitations have been described in the literature. For example, replacement of the X-gal substrate with fluorescein di-β-D-galactopyranoside (FDG), which can be hydrolyzed by β-gal to fluorescein and detected as fluorescence with excitation at 485 nm and emission at 535 nm and measured in a fluorometer [30]. A drawback with this method is that it does not provide an internal control for cell number. As an alternative method, FDG can be used to quantitate the fluorescence in the cell population by FACS analysis [31]. A limitation with this protocol is that involves alkalinization of lysosomes using chloroquine or bafilomycin A1 and that the procedure is relatively expensive. To overcome these problems, Gary and Kindell developed a yet another quantitative assay to determine SA-β-gal activity in cell lysates via the rate of conversion of colorless 4-methylumbelliferyl-β-D-galactopyranoside (MUG) to the fluorescent hydrolysis product 4-methylumbelliferone (4-MU) at pH 6.0 with excitation at 360 nm and emission at 465 nm, followed by normalization to total amount of protein [32]. Here we describe the latter method in detail and an example of its application (Fig. 3). 1. Wash adherent cells six times in PBS in order to fully remove protein from cell media. 2. Lyse cells in 450μL lysis buffer (adapted for six-well plates (10 cm2/well)) on ice for 30 min followed by scraping. 3. Collect the lysates in 1.5 mL tubes, vortex vigorously, followed by centrifugation for 5 min at 12,000
g at 4  C. Collect the supernatants and keep on ice until the next step.

MYC-Regulated Senescence

249

Fig. 3 MUG assay in A375 melanoma cells in response to treatment with the BRAF inhibitor vemurafenib. The cells were treated with 1μM of vemurafenib for 3 days, harvested, and subjected to MUG assay according to the protocol in Subheading 3.2. The fluorescence was measured in a Tecan GENios automated plate reader, 40μs integration, and gain held constant at 46

4. Add an equal volume of 2
reaction solution to each tube and incubate at 37  C for various reaction times. To determine the initial reaction velocity, collect 50μL reaction aliquots, for example, at 0, 30, 60, and 90 min, respectively. 5. Mix each aliquot (50μL) with 500μL of stop solution to terminate the reaction and preserve at 4  C until measurement of fluorescence (see Note 8). 6. Measure the fluorescence in a fluorometer, for instance a plate reader, excitation at 360 nm and emission at 465 nm. 7. Dispensed each stop reaction mix in triplicates in a 96-well plate (150μL per well) for signal measurement. 8. Measure protein concentrations of clarified lysates for instance using a BCA protein assay kit (see Subheading 2), where total amount of protein can be calculated. 9. Normalize fluorescence intensity to corresponding protein amount to calculate the SA-β-gal activity (Fig. 3). 3.3 Detection of Senescent Cells in Formalin-Fixed Paraffin-Embedded Tissues with Sudan Black B (SBB) Analogue GL13

SA-β-gal staining can be performed not only for cultured cells but also for detecting senescent cells in tissue sections [26]. However, a limitation with this method is that it can only be used on freshly cut frozen sections and is not compatible with traditional immunohistochemistry staining protocols for formalin-fixed paraffinembedded (FFPE) tissues. To find alternative markers of senescence in tissues, Georgakopoulou et al. [33] validated the use of Sudan Black B (SBB), which stains lipofuscin—a cytoplasmic aggregate of oxidized proteins, lipids, and metals—and found that these granules accumulate during the senescence process. Senescent cells of different origins were found to stain positive for SBB while non-senescent cells did not, and importantly, this staining was

250

Fan Zhang et al.

Fig. 4 BL13 (SenTraGor) staining of BRAFV600E-induced mouse lung tumor tissue in vivo with or without activation of MycER by tamoxifen. Lung tumor formation in BRAFV600E/MycER mice [15] was initiated by inhalation of Ad-Cre in the presence or absence of tamoxifen, and the mice were terminated at the endpoint (45 and 82 days from tumor initiation, respectively). FFPE lung tumor tissues were stained with BL13 (SenTraGor) according to the protocol in Subheading 3.3. The images were taken under 40
magnification

compatible with FFPE tissues. However, although this technique is easy to perform, it can be quite challenging to detect senescent cells at lower magnification and to discriminate positive signals from background noise. Evangelou et al. [34] recently developed this method further, by synthesizing an SBB analogue called GL13 (commercially available as SenTraGor™) that reacts with the lipofuscin granules in the same way as SBB, and which is conjugated with biotin and therefore can be visualized using immunohistochemistry. Here we describe a modified version of the latter method in detail and example of its application (Fig. 4). 1. Prepare the SenTraGor reagent according the manufacturer instructions. 2. Preheat the tissue sections in an oven at 60  C for 45 min. 3. Rehydrate the sections by serially immersing them in the following solutions: l Xylene/histoclear (for 15 min). l

Xylene/histoclear (for 7 min).

l

100% ethanol (for 3 min).

l

100% ethanol (for 3 min).

l

95% ethanol (for 3 min).

l

95% ethanol (for 3 min).

l

80% ethanol (for 3 min).

l

70% ethanol (for 3 min).

l

Deionized water (for 3 min).

MYC-Regulated Senescence

251

4. Block endogenous peroxidase activity by incubating the tissue sections with 3% H2O2 in PBS for 20 min (see Note 9). 5. Wash the tissue sections for three times in PBS-T, 5 min each wash. 6. Incubate with biotin blocking reagent A (Avidin) for 20 min (see Note 10). 7. Briefly rinse the slides with PBS-T. 8. Incubate with biotin blocking reagent B (Biotin) for 20 min. 9. Wash the sections 3
for 5 min each in TBS-T/PBS-T. 10. Wash the tissue sections in 50% ethanol for 5 min, at room temperature. 11. Wash the tissue sections in 70% ethanol for 5 min, at room temperature. 12. Incubate the tissue sections with the SenTraGor reagent at room temperature for 3–8 min (see Note 11). 13. Gently remove excess SenTraGor reagent with soft paper and wash three times in 50% ethanol, for 3 min each. Renew the ethanol each time (see Note 12). 14. Wash with PBS for 5 min to remove excess ethanol. 15. Incubate the tissue sections with the primary anti-biotin antibody in blocking buffer for 1 h at 37  C or overnight at 4  C. 16. Wash the tissue sections three times with PBS-T/TBS-T, for 5 min each, at room temperature. 17. Incubate the tissue sections with the secondary anti-goat antibody in blocking buffer for 90 min at 37  C. 18. Wash the sections 3
for 5 min each in TBS-T/PBS-T. 19. Prepare the ABC HRP solution according to the manufacturer instructions, and incubate the tissue sections with the ABC HRP Kit for 30 min at room temperature. The ABC solution should be prepared 30 min before addition. 20. Wash the tissue sections for three times in PBS-T, 5 min each wash. 21. Prepare the ImmPACT DAB Peroxidase substrate solution according to the manufacturer instructions, and incubate the tissue sections with the ImmPACT DAB Peroxidase (HRP) substrate kit for 1–10 min. 22. Wash the tissue sections three times with PBS-T, 3 min each, and incubate with hematoxylin solution for 5 min. 23. Incubate the tissue sections under running tap water for 5 min. 24. Dehydrate the tissue sections by serially immersing in the following solutions: l 95% ethanol (for 5 min). l

95% ethanol (for 3 min).

252

Fan Zhang et al. l

100% ethanol (for 3 min).

l

100% ethanol (for 3 min).

l

Xylene/histoclear (for 3 min).

l

Xylene/histoclear (for 3 min).

25. Mount the tissue slides using Pertex mounting medium, and allow to dry on room temperature before microscopy (Fig. 4).

4

Notes 1. Caution: Hazardous. Formaldehyde and glutaraldehyde are toxic and corrosive solutions. Wear personal protective clothing when handling solution and use in a fume hood. 2. Caution: Dangerous for the environment. Wear personal protective clothing when handling solution. Discard in an appropriate manner. 3. Caution: Dimethylformamide is toxic and harmful. Wear personal protective clothing when handling solution. Use a fume hood. 4. It is necessary to store the 2
reaction buffer at room temperature to prevent substrate precipitation. 5. Depending on whether the question is to get a snapshot of ongoing replication or whether replication has occurred during a longer time interval, one might opt for shorter EdU exposure times of 2–4 h, or longer periods such as 24 or 48 h. Maximally one can extend the EdU incorporation time to 72 h, while longer exposures can be cytotoxic. 6. Avoid prolonged fixation, as it will diminish enzymatic activity. 7. Do not incubate the samples in a CO2 incubator. The 5–10% CO2 will lower the pH of the buffer, which will result in unspecific staining. 8. Sodium carbonate raises the pH to approximately 11.0, thereby not only terminating the SA-β-gal reaction but also maximizing the fluorescence yield of 4-MU. 4-MU has a pKa of approximately 8.0, and the most efficient fluorescence will occur at a pH above 9.4 [35]. 9. Other nuclear staining, such as 0.1% nuclear fast red staining, can be used instead of hematoxylin to provide more contrast during imaging of the alkaline phosphatase detection assay. 10. Alternatively, the UltraVision Quanto Detection System HRP DAB (Thermo Fisher) can be used as described by Evangelou et al. [34]. In this case, steps 6–9 and steps 16–19 can be omitted and replaced by the alternative procedure.

MYC-Regulated Senescence

253

11. The SenTraGor reagent should be filtered with a 0.22μm membrane before its added to the tissue section and covered by a glass coverslip. The incubation time may have to be optimized to achieve the best staining results. 12. This is an important step to minimize background that removes excess stain from the tissue sections.

Acknowledgments This work was supported by the Swedish Cancer Society (L.G.L.), the Swedish Childhood Cancer Society (M.A., L.G.L.), the Knut and Alice Wallenberg Foundation (L.G.L.), the O. E. och Edla Johanssons foundation (M.A.) and the Karolinska Institutet Foundations (M.A., L.G.L.). References 1. Campisi J, d’Adda di Fagagna F (2007) Cellular senescence: when bad things happen to good cells. Nat Rev Mol Cell Biol 8 (9):729–740. https://doi.org/10.1038/ nrm2233. nrm2233 [pii] 2. Gorgoulis V, Adams PD, Alimonti A et al (2019) Cellular senescence: defining a path forward. Cell 179(4):813–827. https://doi. org/10.1016/j.cell.2019.10.005 3. Hernandez-Segura A, Nehme J, Demaria M (2018) Hallmarks of cellular senescence. Trends Cell Biol 28(6):436–453. https://doi. org/10.1016/j.tcb.2018.02.001 4. Kuilman T, Michaloglou C, Mooi WJ et al (2010) The essence of senescence. Genes Dev 24(22):2463–2479. https://doi.org/10. 1101/gad.1971610 5. Munoz-Espin D, Serrano M (2014) Cellular senescence: from physiology to pathology. Nat Rev Mol Cell Biol 15(7):482–496. https://doi.org/10.1038/nrm3823 6. Sharpless NE, Sherr CJ (2015) Forging a signature of in vivo senescence. Nat Rev Cancer 15(7):397–408. https://doi.org/10.1038/ nrc3960 7. Lee S, Schmitt CA (2019) The dynamic nature of senescence in cancer. Nat Cell Biol 21 (1):94–101. https://doi.org/10.1038/ s41556-018-0249-2 8. Serrano M, Lin AW, McCurrach ME et al (1997) Oncogenic ras provokes premature cell senescence associated with accumulation of p53 and p16INK4a. Cell 88(5):593–602 9. Lowe SW, Cepero E, Evan G (2004) Intrinsic tumour suppression. Nature 432

(7015):307–315. https://doi.org/10.1038/ nature03098. nature03098 [pii] 10. Hydbring P, Bahram F, Su Y et al (2010) Phosphorylation by Cdk2 is required for Myc to repress Ras-induced senescence in cotransformation. Proc Natl Acad Sci U S A 107 (1):58–63. https://doi.org/10.1073/pnas. 0900121106 11. Juan J, Muraguchi T, Iezza G et al (2014) Diminished WNT ! beta-catenin ! c-MYC signaling is a barrier for malignant progression of BRAFV600E-induced lung tumors. Genes Dev 28(6):561–575. https://doi.org/10. 1101/gad.233627.113 12. Larsson LG (2011) Oncogene- and tumor suppressor gene-mediated suppression of cellular senescence. Semin Cancer Biol 21 (6):367–376. https://doi.org/10.1016/j. semcancer.2011.10.005 13. Mallette FA, Gaumont-Leclerc MF, Huot G et al (2007) Myc down-regulation as a mechanism to activate the Rb pathway in STAT5Ainduced senescence. J Biol Chem 282 (48):34938–34944. https://doi.org/10. 1074/jbc.M707074200 14. Ruggero D, Montanaro L, Ma L et al (2004) The translation factor eIF-4E promotes tumor formation and cooperates with c-Myc in lymphomagenesis. Nat Med 10(5):484–486. https://doi.org/10.1038/nm1042 15. Tabor V, Bocci M, Alikhani N et al (2014) MYC synergizes with activated BRAFV600E in mouse lung tumor development by suppressing senescence. Cancer Res 74

254

Fan Zhang et al.

(16):4222–4229. https://doi.org/10.1158/ 0008-5472.CAN-13-3234 16. Wu CH, van Riggelen J, Yetil A et al (2007) Cellular senescence is an important mechanism of tumor regression upon c-Myc inactivation. Proc Natl Acad Sci U S A 104 (32):13028–13033. https://doi.org/10. 1073/pnas.0701953104. 0701953104 [pii] 17. Zhuang D, Mannava S, Grachtchouk V et al (2008) C-MYC overexpression is required for continuous suppression of oncogene-induced senescence in melanoma cells. Oncogene 27 (52):6623–6634. https://doi.org/10.1038/ onc.2008.258. onc2008258 [pii] 18. van Riggelen J, Muller J, Otto T et al (2010) The interaction between Myc and Miz1 is required to antagonize TGFbeta-dependent autocrine signaling during lymphoma formation and maintenance. Genes Dev 24 (12):1281–1294. https://doi.org/10.1101/ gad.585710 19. Soucek L, Whitfield J, Martins CP et al (2008) Modelling Myc inhibition as a cancer therapy. Nature 455(7213):679–683. https://doi.org/ 10.1038/nature07260. nature07260 [pii] 20. Swartling FJ, Grimmer MR, Hackett CS et al (2010) Pleiotropic role for MYCN in medulloblastoma. Genes Dev 24(10):1059–1072. https://doi.org/10.1101/gad.1907510 21. Campaner S, Doni M, Hydbring P et al (2010) Cdk2 suppresses cellular senescence induced by the c-myc oncogene. Nat Cell Biol 12 (1):54–59. https://doi.org/10.1038/ ncb2004 22. Grandori C, Wu KJ, Fernandez P et al (2003) Werner syndrome protein limits MYC-induced cellular senescence. Genes Dev 17 (13):1569–1574. https://doi.org/10.1101/ gad.1100303. 17/13/1569 [pii] 23. Moser R, Toyoshima M, Robinson K et al (2012) MYC-driven tumorigenesis is inhibited by WRN syndrome gene deficiency. Mol Cancer Res 10(4):535–545. https://doi.org/10. 1158/1541-7786.MCR-11-0508 24. Post SM, Quintas-Cardama A, Terzian T et al (2010) p53-dependent senescence delays Emu-myc-induced B-cell lymphomagenesis. Oncogene 29(9):1260–1269. https://doi. org/10.1038/onc.2009.423. onc2009423 [pii] 25. Reimann M, Lee S, Loddenkemper C et al (2010) Tumor stroma-derived TGF-beta limits myc-driven lymphomagenesis via Suv39h1dependent senescence. Cancer Cell 17 (3):262–272. https://doi.org/10.1016/j.ccr. 2009.12.043

26. Collado M, Serrano M (2006) The power and the promise of oncogene-induced senescence markers. Nat Rev Cancer 6(6):472–476. https://doi.org/10.1038/nrc1884 27. Tabor V, Bocci M, Larsson LG (2013) Methods to study MYC-regulated cellular senescence. Methods Mol Biol 1012:99–116. https://doi.org/10.1007/978-1-62703-4296_8 28. Dimri GP, Lee X, Basile G et al (1995) A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci U S A 92(20):9363–9367 29. Itahana K, Itahana Y, Dimri GP (2013) Colorimetric detection of senescence-associated beta galactosidase. Methods Mol Biol 965:143–156. https://doi.org/10.1007/ 978-1-62703-239-1_8 30. Yang NC, Hu ML (2004) A fluorimetric method using fluorescein di-beta-D-galactopyranoside for quantifying the senescenceassociated beta-galactosidase activity in human foreskin fibroblast Hs68 cells. Anal Biochem 325(2):337–343. https://doi.org/10.1016/j. ab.2003.11.012 31. Debacq-Chainiaux F, Erusalimsky JD, Campisi J et al (2009) Protocols to detect senescenceassociated beta-galactosidase (SA-betagal) activity, a biomarker of senescent cells in culture and in vivo. Nat Protoc 4(12):1798–1806. https://doi.org/10.1038/nprot.2009.191. nprot.2009.191 [pii] 32. Gary RK, Kindell SM (2005) Quantitative assay of senescence-associated beta-galactosidase activity in mammalian cell extracts. Anal Biochem 343(2):329–334. https://doi.org/ 10.1016/j.ab.2005.06.003 33. Georgakopoulou EA, Tsimaratou K, Evangelou K et al (2013) Specific lipofuscin staining as a novel biomarker to detect replicative and stress-induced senescence. A method applicable in cryo-preserved and archival tissues. Aging (Albany NY) 5(1):37–50. https://doi. org/10.18632/aging.100527 34. Evangelou K, Lougiakis N, Rizou SV et al (2017) Robust, universal biomarker assay to detect senescent cells in biological specimens. Aging Cell 16(1):192–197. https://doi.org/ 10.1111/acel.12545 35. Hendrikx PJ, Martens AC, Visser JW et al (1994) Differential suppression of background mammalian lysosomal beta-galactosidase increases the detection sensitivity of LacZmarked leukemic cells. Anal Biochem 222 (2):456–460. https://doi.org/10.1006/abio. 1994.1516

Chapter 13 Examining Myc-Dependent Translation Changes in Cellular Homeostasis and Cancer Joanna R. Kovalski, Yichen Xu, and Davide Ruggero Abstract A central component of Myc’s role as a master coordinator of energy metabolism and biomass accumulation is its ability to increase the rate of protein synthesis, driving cell cycle progression, and proliferation. Importantly, Myc-induced alterations in both global and specific mRNA translation is a key determinant of Myc’s oncogenic function. Herein, we provide five assays to enable researchers to measure global protein synthesis changes, to identify the translatome uniquely regulated by Myc and to investigate the mechanisms generating the tailored Myc translation network. Metabolic labeling of cells with 35S-containing methionine and cysteine in culture and O-propargyl-puromycin (OP-Puro) incorporation in vivo are presented as methods to measure the overall rate of global protein synthesis. Isolation of polysome-associated mRNAs followed by quantitative real-time PCR (qRT-PCR) and the toeprint assay enable the detection of altered translation of specific mRNAs and isoforms, and visualization of differential ribosomal engagement at start codons uniquely mediated by Myc activation, respectively. Finally, the translation initiation reporter assay is utilized to uncover the molecular mechanism mediating altered translation initiation of a specific mRNA. Together, the protocols detailed in this chapter can be used to illuminate how and to what degree Myc-dependent regulation of translation influences homeostatic cellular functions as well as tumorigenesis. Key words Myc, Translation, Protein synthesis, Ribosome, Cancer

1

Introduction Myc has an evolutionarily conserved function in global transcriptional regulation of the processes that promote cell proliferation, including DNA replication, cell cycle progression, apoptosis, and energy metabolism. Central to the myriad functions of Myc is its ability to increase protein synthesis, which is also a key contributor to Myc’s oncogenic capacity. In fact, numerous studies have shown that Myc orchestrates increased expression of many components of the protein synthesis machinery. Key Myc transcriptional targets are translation initiation and elongation factors, tRNA synthetases,

Joanna R. Kovalski and Yichen Xu contributed equally. Laura Soucek and Jonathan Whitfield (eds.), The Myc Gene: Methods and Protocols, Methods in Molecular Biology, vol. 2318, https://doi.org/10.1007/978-1-0716-1476-1_13, © Springer Science+Business Media, LLC, part of Springer Nature 2021

255

256

Joanna R. Kovalski et al.

PolIII, ribosomal RNAs, proteins of the small and large ribosomal subunits, and cofactors required for ribosomal assembly [1– 5]. Consequently, a major function of Myc is to promote ribosome biogenesis, thereby regulating mRNA translation. A clear picture of how Myc impacts both global and specific mRNA translation in both homeostasis and pathological conditions is only beginning to come into focus. Previous research has demonstrated that in the context of oncogenic Myc, restoring protein synthesis to normal levels results in decreased cell growth and impedes tumorigenesis [6]. Furthermore, active Myc has been shown to alter the translational control of specific mRNAs under endoplasmic reticulum (ER) stress, in mitosis leading to genomic instability and in evading immune surveillance [6–8]. Therefore, Myc activation promotes a tailored oncogenic mRNA translational program, engaging a multitude of cellular processes across multiple stages of cancer initiation and progression [9–11]. The purpose of this chapter is to describe in detail several methods to examine the effects of Myc on protein synthesis. The first set of protocols details methods to measure the rate of global protein synthesis with 35S metabolic labeling in cultured cells and O-propargyl-puromycin (OP-Puro) incorporation in vivo. The activation of Myc increases the expression of almost all components of the translation machinery, which in turn results in increased global protein synthesis [12]. Importantly, Myc-mediated protein synthesis is a key determinant of Myc’s promotion of tumorigenesis. For example, the oncogenic behavior of Myc in driving lymphomagenesis is significantly compromised when the increased protein synthesis is restored to a normal level [6]. In this regard, understanding the dynamics of protein synthesis upon Myc activation can provide mechanistic explanations into the increased cell growth, division, and genomic instability mediated by Myc in cancer. The second set of protocols describes how to analyze genespecific changes in translation through investigating specific alterations in mRNA translation by fractionating polysome-associated mRNAs and the toeprint assay to visualize the position of translating ribosomes. Although Myc controls global protein synthesis through the regulation of almost all components of the translational machinery, including ribosomal RNA, ribosomal proteins, and translation initiation factors [2, 13], emerging evidence demonstrates that the translation of a specific subset of mRNAs is exquisitely sensitive to Myc activation [7, 14, 15]. Analyzing genome-wide Myc-induced specific alterations in mRNA translation can be achieved by polysome fractionation followed by nextgeneration RNA sequencing as well as by ribosome profiling. Ribosome profiling together with next-generation sequencing (NGS) is a powerful technology to not only quantify protein synthesis but also provide insight into the mechanisms of translational regulation

Myc-Dependent Translational Control

257

at a single codon resolution, particularly in the context of oncogenic signaling [16, 17]. As the detailed protocol of ribosome profiling, and NGS library preparation and sequencing, is published elsewhere [18], we will focus on the analysis of changes in the translation of specific mRNAs using polysome fractionation and mRNA abundance quantification. In comparison to ribosome profiling, polysome fractionation has the advantages of (1) quantifying the ribosomes on specific mRNAs; (2) distinguishing mRNA distribution among the 80S ribosome and n-mer polysome fractions; and (3) determining the differences in the translation of specific splice variants of an mRNA. Furthermore, the toeprint assay provides a complementary method to capture and visualize the position of initiating ribosomes on start codons of selected mRNAs, including both the annotated start codon and any alternative translation initiation sites (ATIS) upstream or downstream of the canonical start codon. Translation initiation at an ATIS can produce an extended or truncated isoform of a protein when it is in frame with the main open reading frame (ORF) or, alternatively, it can function as the initiation codon of an upstream open reading frame (uORF), which usually dampens the translation of the main ORF [19, 20]. Utilizing cytoplasmic lysate from cells harboring Myc activation, toeprinting can enable insights into how Myc drives altered protein synthesis of a specific gene at codon resolution. Together, these methods can identify and quantify the unique Myc-regulated translatome as well as reveal potential mechanism underlying the selective regulation. The third protocol describes measuring translation initiation and start codon usage using a reporter assay. As detailed above, Myc can modulate the translation of specific mRNAs, which can be identified and investigated through polysome profiling and the toeprint assay. Recent studies have demonstrated that Myc influences not only the initiation of translation at the annotated start codon but also alternative isoform expression and use of translation regulatory elements, such as uORFs, to alter the synthesis of specific proteins and coordinate a cellular response [7]. However, the precise molecular mechanisms underlying Myc’s differential regulation of translation initiation remain outstanding. Myc can impact the levels and activity of certain translation initiation factors, which are important for start codon selection [9]. For example, Myc can modify the activity of eukaryotic initiation factor 2α (eIF2α) through its induction of tRNA expression that leads to excess uncharged tRNA and activation of general control nonderepressible 2 (GCN2). GCN2 in turn phosphorylates eIF2α, thereby selecting for translation of particular mRNAs [8]. Additionally, Myc can orchestrate the cellular repertoire of expressed RNA-binding proteins to mediate the translation of specific mRNAs [21]. Therefore, empirical and focused experiments are required to elucidate the poorly understood molecular mechanisms

258

Joanna R. Kovalski et al.

mediating activated Myc-tailored alterations in translation initiation. Taken together, these protocols provide the tools to probe the impact of Myc on global protein synthesis rates, the translational regulation of specific genes, and the molecular mechanisms underlying changes in translation initiation. These protocols can be applied to a variety of tissue and cell types in culture and in vivo under both physiological and pathological conditions, in order to unravel outstanding questions regarding the role of Myc-dependent translation in homeostasis and cancer.

2

Materials

2.1 35S Metabolic Labeling in Cultured Cells

1. Radioactivity license. 2. EasyTag™ EXPRESS Elmer).

35

S Protein Labeling Mix (Perkin

3. Tissue culture equipment. 4. Methionine- and cysteine-free culture medium (Thermo Fisher Scientific). 5. Phosphate-buffered saline (PBS). 6. RIPA buffer (150 mM NaCl, 25 mM Tris pH 7.4, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS) supplemented with protease and phosphatase inhibitors (Roche). 7. Gel electrophoresis equipment and buffers. 8. Bradford assay. 9. Autoradiography equipment. 10. Internal control antibody (e.g., tubulin and β-actin). 11. Secondary anti-mouse and anti-rabbit conjugated to Horseradish peroxidase (HRP). 12. Image analysis software. 2.2 O-PropargylPuromycin (OP-Puro) Incorporation In Vivo

1. Mice. 2. O-propargyl-puromycin: (MedChemExpress).

20

mM

solution

in

PBS

3. Ca2+- and Mg2+-free PBS, and Hank’s Balanced Salt Solution (HBSS). 4. Fetal bovine serum (FBS). 5. Surgical tools. 6. 0.5-ml sterile insulin syringes. 7. Paraformaldehyde solution (PFA). 8. Triton X-100.

Myc-Dependent Translational Control

259

9. Donkey serum. 10. TAMRA azide, or Alexa Fluor™ 555 Azide (Thermo Fisher Scientific). 11. Click-iT™ Cell Reaction Buffer Kit (Thermo Fisher Scientific). 12. Flow cytometer. 13. Optional: Formalin and fluorescence microscope. 2.3 Investigating Specific Alterations in mRNA Translation by Fractionating Polysome-Associated mRNAs

1. Tissue culture equipment. 2. Refrigerated ultracentrifuge (Beckman Coulter) with Swinging-Bucket SW 40 (or equivalent) rotor and matching tubes. 3. Gradient maker and fractionator (BioComp Instruments). 4. Cycloheximide: 10 mg/ml in 100% ethanol. 5. PBS. 6. Polysome fractionation lysis buffer: 10 mM Tris, pH 8.0, 140 mM NaCl, 1.5 mM MgCl2, 0.25% NP-40, 0.1% Triton X-100, 20 mM DTT, 0.15 mg/ml cycloheximide, 0.6 U/ml RNasin. 7. Sucrose. 8. Gradient buffer: 25 mM Tris pH 7.4, 25 mM NaCl, 5 mM MgCl2. 9. Heparin: 50 mg/ml in RNase-free water. 10. DTT: 1 M in DEPC water. 11. Trizol solution (Thermo Fisher Scientific). 12. RNA purification kit.

2.4 Toeprint Assay to Visualize the Position of Translating Ribosomes

1. Radioactivity license. 2. Tissue culture equipment. 3. Tissue homogenizer. 4. Hypotonic lysis buffer: 20 mM Tris–HCl, pH 7.4, 10 mM NaCl, 10 mM MgCl2, 4 mM DTT, and Complete protease inhibitor (Roche). 5. Oligo d(T) beads (New England Biolabs Inc. or Thermo Fisher Scientific). 6. mMESSAGE mMACHINE T7 Transcription Kit (Thermo Fisher Scientific). 7. MEGAclear Transcription Clean-up Kit (Thermo Fisher Scientific). 8. Plasmid containing the gene of interest’s 50 untranslated region (UTR) and at least part of the coding sequence under the control of a T7 promoter.

260

Joanna R. Kovalski et al.

9. Restriction endonuclease. 10. γ-ATP (Perkin-Elmer). 11. Reverse primer targeting the downstream coding sequence. 12. T4 Polynucleotide Kinase (PNK) (New England Biolabs Inc.). 13. Gel electrophoresis equipment and buffers. 14. Autoradiography equipment. 15. Heat block. 16. G25 column (GE healthcare). 13. Cycloheximide: 10 mg/ml in 100% ethanol. 17. 2 mM Mg(Ac)2 18. 100 mM KCl. 19. Primer extension buffer: 50 mM Tris–HCl pH 7.5, 40 mM KCl, 6 mM MgCl2, 5 mM DTT, 110 μg/ml cycloheximide, and 575 μM of each dNTP. 20. Superscript II Reverse Transcriptase kit (Thermo Fisher Scientific). 21. Phenol:chloroform. 22. 3 M NaOAc solution. 23. GlycoBlue (Thermo Fisher Scientific). 24. Fixing solution: 20% EtOH and 10% acetic acid in water. 2.5 Measuring Translation Initiation and Start Codon Usage Using a Reporter Assay

1. Plasmids containing 50 UTR of gene of interest in frame with firefly luciferase with a promoter mammalian expression (see Note 1). 2. Transfection control Renilla luciferase plasmid. 3. Lipofectamine 3000 (Life Technologies). 4. 0.25% trypsin-EDTA (Thermo Fisher Scientific). 5. Cell culture media containing FBS. 6. PBS. 7. Dual-Luciferase Assay Kit (Promega). 8. RNA purification kit. 9. cDNA synthesis reagents. 10. Luminometer.

3

Methods

3.1 35S Metabolic Labeling in Cultured Cells

1. Culture cells in 6-well plates to approximately 80% confluency (see Note 2).

Myc-Dependent Translational Control

261

2. Aspirate medium, and wash cells twice with methionine/cysteine-free medium (see Note 3). 3. Incubate cells with methionine/cysteine-free medium containing 30 μCi of EasyTag™ EXPRESS 35S Protein Labeling Mix in a radioactivity procedure room, and return the plate to 37  C cell culture incubator for 1 h. 4. Remove the medium and wash cells with PBS twice, discard waste into radioactive waste bottle following institutional guidelines for handling and disposal of radioactive materials. 5. Lyse cells in 50 μl of RIPA lysis buffer supplemented with protease and phosphatase inhibitors, and incubate on ice for 20 min, followed by centrifuging at 16,000  g, 4  C for 15 min. 6. Measure the concentration of the supernatant using a Bradford assay, and run samples on an SDS-PAGE 4–15% gradient gel, followed by transferring to a PVDF membrane (see Note 4). 7. Expose the membrane with film for 30 min to 48 h to obtain suitable signal intensity. The intensity represents the rate of overall protein synthesis. 8. After obtaining 35S radioactive signal, membrane can be processed for Western blot analysis against internal control antibodies, such as tubulin or β-actin. 9. Use Image J or other imaging software to calculate the intensity of scanned images. The data is expressed as a ratio of 35S signal intensity/loading control signal intensity. 3.2 O-PropargylPuromycin (OP-Puro) Incorporation In Vivo

1. Inject 100 μl of a 20 mM solution of OP-puro in PBS intraperitoneally into mice from experimental groups (e.g., with or without Myc activation). As a negative control, 100 μl of PBS should be injected into a control mouse. 2. Allow 1 h for labeling, euthanize the mice, and harvest organs of interest (see Note 5). 3. Dissociate cells of interests from harvested organs and fix cells in 1% PFA in PBS for 10–15 min on ice. 4. Permeabilize the cells at room temperature for 5 min with 0.3% Triton X-100 in PBS. 5. Block the cells with 10% Donkey serum in PBS for 30 min at room temperature. 6. Stain cells with TAMRA azide or Alexa Fluor™ 488 Azide using Click-iT™ Cell Reaction Buffer Kit following manufacturer instructions. 7. Acquire OP-puro incorporation rate by flow cytometry.

262

Joanna R. Kovalski et al.

3.3 Investigating Specific Alterations in mRNA Translation by Fractionating Polysome-Associated mRNAs

1. For analyzing mRNA translation in cultured cells, grow cells in 15 cm cell culture dishes until 80–90% confluent (see Note 6). 2. Treat cells with 100 μg/ml cycloheximide and incubate for 5 min in 37  C cell culture incubator. 3. Wash cells twice with PBS containing 100 μg/ml cycloheximide, scrape and pellet cells (see Note 7). 4. Resuspend cells in polysome fractionation lysis buffer (~300 μl per 15 million cells). Lyse cells at 4  C for 30 min. 5. Centrifuge lysate at 10,000  g 4  C for 5 min. 6. Transfer supernatant to a clean RNase free tube. Save 1% of the lysate to analyze total cellular RNA levels. 7. Prepare 10% and 50% sucrose solutions in gradient buffer. Cooldown to 4  C. Supply 0.1 mg/ml heparin and 2 mM DTT and make 10–50% sucrose gradient in ultracentrifuge tubes (see Note 8). 8. Carefully layer cleared lysate onto the gradient, and proceed to ultracentrifuge at 256,824  g (at maximum radius) (38,000 rpm with SW 40 rotor) at 4  C for 2.5 h. 9. After centrifugation, collect the standard 12 or desired number of fractions from the top of the tube. 10. Isolate RNA from the fraction using Trizol and RNA purification kit, or precipitation. 11. At this point, RNA samples can either be prepared as a library for next-generation sequencing or reverse-transcribed to cDNA and analyzed by qPCR using specific primers of interest.

3.4 Toeprint Assay to Visualize the Position of Translating Ribosomes

1. Extract cytoplasmic lysate from cells with or without Myc activation using hypotonic lysis buffer (200 μl per 10 million cells, aiming for a final concentration of 5–10 mg/ml). 2. Incubate on ice for 15 min and homogenize with a tissue homogenizer for 20 strokes. 3. Centrifuge at 10,000  g for 5 min. 4. Remove supernatant and proceed with removal of cellular mRNAs with Oligo d(T) beads, following the manufacturer’s protocol. Incubate on an agitator for 10 min at room temperature. 5. Linearize the plasmid containing a T7 promoter followed by the mRNA sequence of interest with a restriction endonuclease downstream of the sequence of interest. 6. In vitro transcribe (IVT) the capped-mRNA using mMESSAGE mMACHINE T7 Transcription Kit overnight at 37  C.

Myc-Dependent Translational Control

263

7. Purify IVT mRNA with MEGAclear Transcription Clean-up Kit and confirm the quality and length of the mRNA transcript by gel electrophoresis. 8.

32

P label the reverse primer targeting the downstream coding sequence with 4 μl of 5 μM primer, 2 μl of 10 PNK buffer, 6 μl of 32P γ-ATP, and 2 μl of T4 PNK. Incubate at 37  C for 30 min in the heat block.

9. Clean up the 32P labeled primer by passing through G25 column. The labeled primer can be stored at ~1 μM at 20  C until needed. 10. Anneal 1.5 pmol of RNA with 4.5 pmol of 32P-labeled primer per reaction and incubate for 1 min at 65  C followed by 8 min at 37  C. 11. Prepare the ribosome binding reaction with 45 μl of cytoplasmic cell lysate (precleared of cellular mRNA with Oligo d (T) beads), 18 μl of 900 μg/ml cycloheximide, 4 μl of 2 mM Mg(Ac)2, and 10 μl of 100 mM KCl for a final volume of 100 μl. 12. Combine 25 μl of ribosome binding reaction with 2 μl of pre-annealed primer-RNA mix and incubate at 25  C for 10 min. 13. Dilute the mixture 1:4 with primer extension buffer and add 1 μl of Superscript II into 100 μl of the mixture. Incubate at 25  C for 10 min for primer extension. 14. Immediately add phenol:chloroform to quench the reaction, vortex, and centrifuge at top speed at room temperature. Transfer the upper phase to a new tube containing one-tenth volume of 3 M NaOAc, 1 μl of GlycoBlue, and 2 volumes of 100% ethanol to precipitate the cDNA. 15. Analyze the cDNA by electrophoresis on 8% TBE gel. 16. Fix gel in fixing solution for 10 min. 17. Dry gel using gel dryer with vacuum at 80  C for 2 h. Expose with a film overnight. 3.5 Measuring Translation Initiation and Start Codon Usage Using a Reporter Assay

1. Seed cells of interest in a 6-well plate (see Note 9). 2. Transfect cells of interest with reporter plasmids. For mouse embryonic fibroblasts (MEFs) use 1 μg total (900 ng of F-Luc reporter plasmid + 100 ng of R-Luc control) (see Notes 10 and 11). 3. Incubate cells 24–36 h. If cells are sensitive, the media can be changed 4–6 h post-transfection. 4. Harvest cells via trypsinization with 0.25% trypsin-EDTA, quench with media containing FBS and resuspend in PBS. Aliquot approximately two-thirds of cells for RNA prep.

264

Joanna R. Kovalski et al.

5. Use the remaining cells to perform the Dual-Luciferase Assay according to manufacturer’s protocol (see Notes 12 and 13). 6. Purify the RNA per the manufacturer’s protocol. 7. Measure the amount of firefly reporter and control Renilla mRNA by quantitative PCR and normalize the luciferase readings (see Note 14).

4

Notes 1. Stably expressed single-expression construct encoding a dual fluorescent reporter with GFP as the reporter for translation initiation and mCherry as a control can also be employed. As fluorescent proteins are more stable than luciferase, a degron or other destabilization tag should be considered for dynamic knockdown or drug treatment experiments. 2. Cells should be seeded at a density that will ensure the cells are metabolically active while performing 35S metabolic labeling. If the different cellular conditions (i.e., Myc overexpression) result in altered rates of proliferation, care should be taken to seed the cells to provide equivalent numbers during labeling. If using cells freshly isolated from living tissue, first culture for 30 min in methionine/cysteine-free medium and minimize the time between harvest and 35S metabolic labeling. 3. Methionine and cysteine starvation is performed to increase the uptake of 35S-labeled methionine and cysteine. The incubation time necessary will vary between cell types and should be optimized to prevent amino acid starvation and altered cellular protein synthesis rates. 4. Alternatively, the 35S-labeled cell lysate can be used for an immunoprecipitation assay using antibodies specific proteins of interest, before SDS-PAGE. In this scenario, the detected 35 S radioactive signal represents the protein synthesis rate of the specific protein of interest. 5. At this step, the OP-Puro labeled cells can alternatively be processed for fluorescence microscopy. For immunofluorescence staining, fix the harvested organs in formalin overnight. Next embed the tissue in paraffin, section, and wash with xylene to remove the paraffin. To visualize the incorporation of OP-puro, rehydrate the tissues with TBS and proceed with the standard immunostaining protocol, using TAMRA azide, or Alexa Fluor™ 555 Azide. Finally, image the tissues with fluorescence microscopy. 6. Ideally start with greater than ten million cells.

Myc-Dependent Translational Control

265

7. For analyzing mRNA translation in mouse tissues, tissues should be snap-frozen in liquid nitrogen. Tissues are then crushed to a powder before lysing. A single-cell suspension must be generated from tissue or cultured cells prior to beginning the lysis protocol. 8. Gradient percentage can be customized depending on experimental needs. 9. In order to measure luminescence and normalize to RNA, use at least a 6-well of cells. If RNA normalization is not required, the assay can be scaled down to a 24-well plate format. 10. The optimal amount of transfected DNA will vary depending upon cell type. 11. Alternatively, this protocol can also be applied to in vitro transcribed (IVT) RNA, if there are concerns about differential RNA stability, levels of transcription, or a need to measure a more acute response (4–8 h incubation). Plasmids must contain the appropriate promoter for IVT, such as T7 or SP6. 12. It is optimal to measure F-Luc for longer as the overall signal is weaker. R-Luc is stronger so measurement time should be kept shorter. The goal is to have a 1:1 ratio of F-/R-Luc in the control sample. 13. Initially, it is advised to run two technical replicates of a single sample to validate the consistency of the readings. If a high degree of variability between technical replicates is observed, spin down the lysed cells and read only the supernatant. 14. Normalize all values to internal control, housekeeping mRNA, such as GAPDH. Next normalize the firefly and Renilla luciferase values to their respective qPCR values. Finally use the normalized Renilla values to normalize firefly signal across all samples. References 1. Dai MS, Lu H (2008) Crosstalk between c-Myc and ribosome in ribosomal biogenesis and cancer. J Cell Biochem 105(3):670–677. https://doi.org/10.1002/jcb.21895 2. Grandori C, Gomez-Roman N, Felton-Edkins ZA, Ngouenet C, Galloway DA, Eisenman RN, White RJ (2005) c-Myc binds to human ribosomal DNA and stimulates transcription of rRNA genes by RNA polymerase I. Nat Cell Biol 7(3):311–318. https://doi.org/10. 1038/ncb1224 3. Zeller KI, Zhao X, Lee CW, Chiu KP, Yao F, Yustein JT, Ooi HS, Orlov YL, Shahab A, Yong HC, Fu Y, Weng Z, Kuznetsov VA, Sung WK, Ruan Y, Dang CV, Wei CL (2006) Global

mapping of c-Myc binding sites and target gene networks in human B cells. Proc Natl Acad Sci U S A 103(47):17834–17839. https://doi.org/10.1073/pnas.0604129103 4. Fernandez PC, Frank SR, Wang L, Schroeder M, Liu S, Greene J, Cocito A, Amati B (2003) Genomic targets of the human c-Myc protein. Genes Dev 17 (9):1115–1129. https://doi.org/10.1101/ gad.1067003 5. Gomez-Roman N, Grandori C, Eisenman RN, White RJ (2003) Direct activation of RNA polymerase III transcription by c-Myc. Nature 421(6920):290–294. https://doi.org/10. 1038/nature01327

266

Joanna R. Kovalski et al.

6. Barna M, Pusic A, Zollo O, Costa M, Kondrashov N, Rego E, Rao PH, Ruggero D (2008) Suppression of Myc oncogenic activity by ribosomal protein haploinsufficiency. Nature 456(7224):971–975. https://doi. org/10.1038/nature07449 7. Xu Y, Poggio M, Jin HY, Shi Z, Forester CM, Wang Y, Stumpf CR, Xue L, Devericks E, So L, Nguyen HG, Griselin A, Gordan JD, Umetsu SE, Reich SH, Worland ST, Asthana S, Barna M, Webster KR, Cunningham JT, Ruggero D (2019) Translation control of the immune checkpoint in cancer and its therapeutic targeting. Nat Med 25(2):301–311. https://doi.org/10.1038/s41591-018-03212 8. Tameire F, Verginadis II, Leli NM, Polte C, Conn CS, Ojha R, Salas Salinas C, Chinga F, Monroy AM, Fu W, Wang P, Kossenkov A, Ye J, Amaravadi RK, Ignatova Z, Fuchs SY, Diehl JA, Ruggero D, Koumenis C (2019) ATF4 couples MYC-dependent translational activity to bioenergetic demands during tumour progression. Nat Cell Biol 21 (7):889–899. https://doi.org/10.1038/ s41556-019-0347-9 9. Truitt ML, Ruggero D (2016) New frontiers in translational control of the cancer genome. Nat Rev Cancer 16(5):288–304. https://doi.org/ 10.1038/nrc.2016.27 10. Chen H, Liu H, Qing G (2018) Targeting oncogenic Myc as a strategy for cancer treatment. Signal Transduct Target Ther 3:5. https://doi.org/10.1038/s41392-018-00087 11. van Riggelen J, Yetil A, Felsher DW (2010) MYC as a regulator of ribosome biogenesis and protein synthesis. Nat Rev Cancer 10 (4):301–309. https://doi.org/10.1038/ nrc2819 12. Iritani BM, Eisenman RN (1999) c-Myc enhances protein synthesis and cell size during B lymphocyte development. Proc Natl Acad Sci U S A 96(23):13180–13185. https://doi.org/ 10.1073/pnas.96.23.13180 13. Boon K, Caron HN, van Asperen R, Valentijn L, Hermus MC, van Sluis P, Roobeek I, Weis I, Voute PA, Schwab M, Versteeg R (2001) N-myc enhances the expression of a large set of genes functioning in ribosome biogenesis and protein synthesis. EMBO J 20

(6):1383–1393. https://doi.org/10.1093/ emboj/20.6.1383 14. Yoon A, Peng G, Brandenburger Y, Zollo O, Xu W, Rego E, Ruggero D (2006) Impaired control of IRES-mediated translation in X-linked dyskeratosis congenita. Science 312 (5775):902–906. https://doi.org/10.1126/ science.1123835 15. Mezquita P, Parghi SS, Brandvold KA, Ruddell A (2005) Myc regulates VEGF production in B cells by stimulating initiation of VEGF mRNA translation. Oncogene 24(5):889–901. https://doi.org/10.1038/sj.onc.1208251 16. Ingolia NT (2014) Ribosome profiling: new views of translation, from single codons to genome scale. Nat Rev Genet 15(3):205–213. https://doi.org/10.1038/nrg3645 17. Hsieh AC, Liu Y, Edlind MP, Ingolia NT, Janes MR, Sher A, Shi EY, Stumpf CR, Christensen C, Bonham MJ, Wang S, Ren P, Martin M, Jessen K, Feldman ME, Weissman JS, Shokat KM, Rommel C, Ruggero D (2012) The translational landscape of mTOR signalling steers cancer initiation and metastasis. Nature 485(7396):55–61. https://doi.org/ 10.1038/nature10912 18. Ingolia NT, Brar GA, Rouskin S, McGeachy AM, Weissman JS (2012) The ribosome profiling strategy for monitoring translation in vivo by deep sequencing of ribosomeprotected mRNA fragments. Nat Protoc 7 (8):1534–1550. https://doi.org/10.1038/ nprot.2012.086 19. Johnstone TG, Bazzini AA, Giraldez AJ (2016) Upstream ORFs are prevalent translational repressors in vertebrates. EMBO J 35 (7):706–723. https://doi.org/10.15252/ embj.201592759 20. Zhang H, Wang Y, Lu J (2019) Function and evolution of upstream ORFs in eukaryotes. Trends Biochem Sci 44(9):782–794. https:// doi.org/10.1016/j.tibs.2019.03.002 21. Singh K, Lin J, Zhong Y, Burcul A, Mohan P, Jiang M, Sun L, Yong-Gonzalez V, Viale A, Cross JR, Hendrickson RC, Ratsch G, Ouyang Z, Wendel HG (2019) c-MYC regulates mRNA translation efficiency and start-site selection in lymphoma. J Exp Med 216 (7):1509–1524. https://doi.org/10.1084/ jem.20181726

Chapter 14 A Versatile In Vivo System to Study Myc in Cell Reprogramming Elena Senı´s, Lluc Mosteiro, Dirk Grimm, and Marı´a Abad Abstract Cellular reprogramming is a process by which adult differentiated cells lose their identity and are converted into pluripotent stem cells, known as induced pluripotent stem (iPS) cells. This process can be achieved in vitro and in vivo and is relevant for many fields including regenerative medicine and cancer. Cellular reprogramming is commonly induced by the ectopic expression of a transcription factor cocktail composed by Oct4, Sox2, Klf4, and Myc (abbreviated as OSKM), and its efficiency and kinetics are strongly dependent on the presence of Myc. Here, we describe a versatile method to study reprogramming in vivo based on the use of adeno-associated viral (AAV) vectors, which allows the targeting of specific organs and cell types. This method can be used to test Myc mutations or genes that may replace Myc, or be combined with different Myc regulators. In vivo reprogramming can be scored by the presence of teratomas and the isolation of in vivo iPS, thereby providing a simple surrogate for the function of Myc in dedifferentiation and stemness. Our protocol can be divided into five steps: (1) intravenous inoculation of AAV vectors; (2) monitoring the animals until the appearance of teratomas; (3) analysis of teratomas; (4) histopathological analysis of mouse organs; and (5) isolation of in vivo-generated iPS cells from teratomas, blood, and bone marrow. The information obtained by this in vivo testing platform may provide relevant information on the role of Myc in tissue regeneration, stemness, and cancer. Key words Cellular reprogramming, in vivo, AAV vectors, Oct4, Klf4, Sox2, Myc, Teratomas, Induced pluripotent stem cells, iPS cells

1

Introduction Cellular reprogramming into pluripotency is a process by which terminally differentiated cells can be reverted into a pluripotent stem cell status, generating the so-called induced pluripotent stem (iPS) cells [1]. Since its discovery in 2006, this process has absorbed the attention of the entire biomedicine community because of its tremendous implications in a wide variety of fields, such as regenerative medicine, cancer, disease modeling, drug screening, and

Elena Senı´s and Lluc Mosteiro contributed equally to this work. Laura Soucek and Jonathan Whitfield (eds.), The Myc Gene: Methods and Protocols, Methods in Molecular Biology, vol. 2318, https://doi.org/10.1007/978-1-0716-1476-1_14, © Springer Science+Business Media, LLC, part of Springer Nature 2021

267

268

Elena Senı´s et al.

developmental biology (reviewed by [2]). Myc transcription factor is a very important player in this process. In fact, it was present in the original transcription factor reprogramming cocktail used by Takahashi and Yamanaka to reprogram in vitro mouse embryonic fibroblasts (MEFs), which also included Oct-4, Sox2, and Klf4 (together abbreviated as OSKM) [1]. We and others have used the same cocktail to achieve full reprogramming also in vivo [3, 4]. In vitro, the role of Myc in reprogramming has been widely studied. Early on, it was shown that the absence of Myc in the reprogramming cocktail significantly delayed the process and decreased its efficiency [5, 6]. Moreover, endogenous Myc activity is necessary for reprogramming [7, 8]. Initially, it was proposed that Myc accelerates the stochastic events that lead to the formation of iPS cells [9]. A few years later, Araki et al. proposed that Myc had an essential role in reprogramming by controlling histone acetylation and, indeed, iPS cells generated in the absence of ectopic Myc had low levels of histone acetylation [10]. Soon after, Soufi et al. showed that Myc facilitated the binding of the other three pioneer factors (OSK) to inaccessible chromatin in the first 48 h of reprogramming [11, 12]. Other proposed roles for Myc in reprogramming are the activation of an alternative splicing network that leads to the early acquisition of pluripotency-associated splicing events [13] and the generation of an OXPHOS/glycolysis hybrid metabolic status that marks cells prone to reprogramming [7]. Finally, one of the latest reports indicates that Myc activates the biosynthetic pathways that are essential for reestablishing pluripotency in somatic cells [8]. All in all, exogenous Myc seems to boost the reprogramming process by targeting many different cellular processes. Despite the efforts made to characterize the role of Myc during in vitro reprogramming, very little is known about the functions of Myc when reprogramming occurs in vivo. Recently, we have tackled this question using adeno-associated viral (AAV) vectors to independently deliver the reprogramming transcription factors (O, S, K, and M) in mice [14]. AAV vectors are small, single-stranded DNA vectors extensively used for gene therapy approaches (reviewed in [15]). One of the main advantages of these vectors is that they can be pseudotyped with different viral capsids with diverse tropisms in vivo, which allows to target specific organs and cell types (reviewed in [16]). Moreover, AAVs are nonpathogenic in humans and vectors derived thereof are replication-deficient, which makes them inherently safe (reviewed in [17]). To assess the achievement of in vivo reprogramming and the acquisition of full pluripotency, we used three different read-outs: (1) the presence of teratomas, (2) events of dedifferentiation within tissues, and (3) the presence of circulating iPS cells in the blood and/or bone marrow. The presence of teratomas is the most easily recognized event and it is noticeable by mouse palpation, therefore it will determine the

Myc and In Vivo Reprogramming

269

endpoint of the experiment. Teratomas are benign and heterogeneous tumors derived from the differentiation of pluripotent stem cells. Therefore, they are composed of a mixed population of tissues that belong to the three embryonic germ layers (endoderm, mesoderm, and ectoderm). We have shown that when Myc is absent from the reprogramming cocktail (OSK reprogramming), there is a substantial delay in the development of teratomas (from 6 weeks with Myc to 53 weeks without it) and a significant decrease in the incidence of reprogramming: OSKM induces teratomas in 100% of the mice in the liver and in several other organs, but only one-third of the mice reprogrammed with OSK develop teratomas and only in the pancreas [14]. These results demonstrate that Myc improves the kinetics and efficiency of the reprogramming process in vivo, suggesting that the effect of Myc during in vivo reprogramming is very similar to the one described in vitro. However, the molecular mechanisms by which Myc promotes in vivo reprogramming have not been explored. In this chapter, we present an AAV vector-based method to induce in vivo reprogramming, which can be easily modified to test the effect of Myc mutations, of genes that may replace Myc, or be combined with different Myc regulators. The protocol described here is based on our previous work [14] and can be adapted to address a variety of questions regarding Myc (see Note 1). Our method consists of five steps: (1) AAV vector injection; (2) animal monitoring; (3) teratoma characterization; (4) histopathological organ evaluation; and (5) in vivo iPS cells isolation (Fig. 1).

2

Materials

2.1 AAV Vectors (see Note 2)

1. scAAV8-SFFV-hCO-Oct4: AAV serotype 8 (AAV8) capsid containing a self-complementary (sc) AAV vector genome encoding a human codon-optimized (hCO) version of Oct4 under the control of the spleen focus-forming virus (SFFV) promoter. 2. scAAV8-SFFV-hCO-Sox2: AAV8 capsid containing a scAAV vector genome encoding hCO-Sox2 under the control of the SFFV promoter. 3. scAAV8-SFFV-hCO-Klf4: AAV8 capsid containing a scAAV vector genome encoding hCO-Klf4 under the control of the SFFV promoter. 4. scAAV8-SFFV-hCO-Myc: AAV8 capsid containing a scAAV vector genome encoding hCO-Myc under the control of the SFFV promoter.

270

Elena Senı´s et al.

teratomas characterization

AAV vector injection

mice monitoring histopathological evaluation

+c-myc

-c-myc

4x1012 vg/mouse

+c-myc:~6 weeks -c-myc:~1 year

iPSC isolation

Fig. 1 Schematic representation of the method for in vivo cell reprogramming into pluripotency using AAV vectors. The following steps are represented in the figure: (1) AAV vector injection; (2) mouse monitoring; (3) teratoma characterization; (4) histopathological organ evaluation; and (5) iPS cells isolation

5. scAAV8-SFFV-GFP: AAV8 capsid containing a scAAV vector genome encoding green fluorescent protein (GFP) under the control of the SFFV promoter. 2.2 Mice and Injection Material

1. 15 weeks old C57BL/6 wild-type mice. 2. Syringes. 3. 27G needles. 4. Isoflurane. 5. Heating mat or red lamp.

2.3 Immunochemistry Material

1. 10% neutral buffered formalin (4% formaldehyde in solution). 2. Paraffin. 3. Superfrost® Plus slides (Thermo Fisher Scientific). 4. Xylene. 5. Ethanol. 6. Hematoxylin and eosin. 7. Automated immunostaining platform (recommended: Ventana Discovery, XT, Roche). 8. High pH Tris-based buffer (recommended: CC1, Roche).

Myc and In Vivo Reprogramming

271

9. 3% hydrogen peroxide. 10. Phosphate-buffered saline (PBS). 11. Recommended primary antibodies. Anti-Oct4 (recommended: ab19857, Abcam, 1:500). Anti-Tfe3 (recommended: HPA023881, Atlas Antibodies, 1:500). 12. Secondary antibodies conjugated with horseradish peroxidase (recommended: Chromomap, Ventana, Roche). 13. 3,30 -Diaminobenzidine tetrahydrochloride (recommended: DAB, Ventana, Roche). 14. Tissue-Tek Glas Mounting Media (Sakura). 15. Slide scanner (recommended: Mirax Scan, Zeiss). 16. Panoramic Viewer Software (3DHISTECH). 2.4 iPS Cells Isolation

1. 40 μm cell strainers. 2. 50 ml Falcon tubes. 3. 5 ml syringes. 4. 21G needles. 5. 18G needles. 6. Ammonium chloride (Ammonium Chloride Solution, STEMCELL Technologies: 0.8% NH4Cl, 0.1 mM EDTA in water, buffered with KHCO3 for a final pH of 7.2–7.6). 7. 0.1% gelatin in PBS. 8. Feeders: mouse embryonic fibroblasts inactivated with mitomycin C at 10 μg/ml for 2.5 h [18]. 9. iPS cells medium: High-glucose DMEM, 15% KnockOut™ Serum Replacement (Invitrogen), 1% non-essential amino acids, 1% penicillin-streptomycin, 1% glutamax, 1000 U/ml LIF (Leukemia inhibitory factor), 100 μM ß-mercaptoethanol.

3

Methods

3.1 AAV Vector Injection

1. Calculate the volume to have 1  1012 vector genomes (vg) of each vector in PBS solution (see Note 3). 2. Mix 1  1012 vector genomes of each vector (4  1012 vg in total): l OSKM pool: scAAV8-SFFV-hCO-Oct4 + scAAV8-SFFVhCO-Sox2 + scAAV8-SFFV-hCO-Klf4 + scAAV8-SFFVhCO-Myc.

272

Elena Senı´s et al. l

OSK pool: scAAV8-SFFV-hCO-Oct4 + scAAV8-SFFVhCO-Sox2 + scAAV8-SFFV-hCO-Klf4 + scAAV8-SFFVGFP.

3. Prepare the syringes in the tissue culture hood to maintain the viral vector preparation as aseptic as possible. Use syringes with 27G (or smaller) needle. Be aware that 50–70 μl of the injectable will be lost in the dead space of the syringe hub and needle. 4. Anesthetize the mice. When using an inhalant anesthetic (recommended due to fast anesthesia and recovery), place the mice in a Plexiglas chamber over a heat mat or under a red lamp to maintain the animals’ body temperature and induce anesthesia with 4% isoflurane. 5. Restrain the mouse with the left hand (for a right-handed operator). 6. Apply gentle pressure to the skin dorsal and ventral to the eye to partially protrude the eyeball from the eye socket. Care must be taken to avoid excessive pressure [19]. 7. Carefully insert the needle at an approximately 30 angle into the medial canthus (Fig. 1). Insert the needle until the needle tip is at the base of the eye. The needle must be placed with the bevel facing down to reduce damage to the eyeball [19]. 8. Slowly and carefully inject the viral vectors. 9. Withdraw the needle slowly and smoothly to allow the injectable to redistribute and avoid leakage. 10. Place the mice into the pre-warmed cage to recover from anesthesia. 3.2 Mouse Monitoring

After the injection, mice need to be monitored at least once a week for any sign of morbidity. After the first 4 weeks, perform abdominal palpation for the early detection of teratomas: 1. Restrain the mouse with the left hand (for a right-handed operator). 2. Thoroughly examine the abdominal cavity of the mouse by palpation with the right thumb. 3. Identify the animal’s main organs that are easily tangible (kidneys, spleen, liver), to avoid confusion with teratomas. Soft organs like the pancreas will be harder to identify, but teratomas are usually solid palpable masses. 4. Mark the mice with any solid palpable mass. 5. Monitor the marked mice twice a week. Teratomas are usually slow-growing solid and heterogeneous masses. We recommend monitoring the recognized mass over time as palpation can give

Myc and In Vivo Reprogramming

273

rise to false positives. This will avoid sacrificing the mice without any teratoma. 6. If the mass is palpable in the following three examinations and/or is clearly growing, sacrifice the mouse and extract the teratoma (see Note 3 for further details on the experimental timeline). If isolation of iPS cells from the teratoma is desired, take a piece of the teratoma (about 0.5 cm diameter) and put it on ice until subsequent isolation (see Subheading 3.5.1). The rest of the teratoma will be histopathologically analyzed (see Subheading 3.3). We also recommend the extraction of all the major tissues for histopathological examinations, since events of dedifferentiation or reprogramming as well as microteratomas that are not visible macroscopically at the time of necropsy could be detected under the microscope (see Subheading 3.4). We also recommend extracting the bone marrow and blood to assess the presence of circulating iPS cells (see Subheadings 3.5.2 and 3.5.3). 3.3 Histopathological Analysis of Teratomas 3.3.1 Hematoxylin and Eosin Staining

If properly differentiated, teratomas should contain tissues belonging to the three embryonic germ layers (endoderm, mesoderm, and ectoderm). Hematoxylin and eosin staining followed by trained evaluation of the structures observed is the most convenient way to assess proper differentiation into the three embryonic germ layers. 1. Fix tissue samples in 10% neutral buffered formalin (4% formaldehyde in solution) during 24 h. 2. Dehydrate samples in 70% ethanol during 24 h. 3. Embed them in paraffin blocks and cut into 3 μm sections. 4. Mount them onto Superfrost® Plus slides and air-dry them. 5. Deparaffinize the slides in xylene and rehydrate them through a series of graded ethanol until water. 6. Stain serial sections with hematoxylin and eosin. 7. To facilitate the analysis, you can digitalize the slides with a slide scanner and visualize the teratomas with the Panoramic Viewer Software or similar programs. 8. Examine the teratoma histopathologically and determine the degree of differentiation by searching for structures belonging to the three embryonic germ layers (see examples below in Fig. 2). Some teratomas can also have areas of undifferentiated cells (see example below in Fig. 2). Examples of structures frequently found are: l Ectoderm: immature and mature neuroectoderm, keratinized epithelium, melanocytes, hair, sebaceous glands. l

Mesoderm: muscle cells, adipocytes, chondrocytes (cartilage), osteoblasts, bone marrow cells.

274

Elena Senı´s et al.

C

A

(2) Melanocytes

Bone

Muscle

Pancreas

Ciliated epithelium

Ectoderm

(1)

Mesoderm

(3)

Undifferentiated area

Endoderm

B

Keratinized epithelium

Fig. 2 Histopathological analysis of teratomas. (a) Section of a fully differentiated teratoma exemplifying differentiation towards the three embryonic germ layers. Endoderm is represented by respiratory-like epithelium (1); mesoderm by adipocytes (2); and ectoderm by keratinized epithelium (3). (b) Section of an undifferentiated area in a teratoma. (c) Details of typical structures found in teratomas l

3.3.2 Immunohistochemistry

Endoderm: respiratory-like ciliated epithelium, intestinallike epithelium, goblet cells, exocrine pancreas.

Another way to demonstrate achievement of full pluripotency is to determine by immunohistochemistry whether teratomas express typical pluripotency markers, such as Oct4 and Tfe3 (other markers, such as Nanog, could also be used). For immunohistochemistry, an automated immunostaining platform can be used (such as Ventana Discovery XT, Roche). 1. Fix tissue samples in 10% neutral buffered formalin (4% formaldehyde in solution) during 24 h. 2. Dehydrate samples in 70% ethanol during 24 h. 3. Embed them in paraffin and cut into 3 μm sections. 4. Mount them onto Superfrost® Plus slides and air-dry them. 5. Deparaffinize the slides in xylene and rehydrate them through a series of graded ethanol until water. 6. Perform antigen retrieval with high pH Tris-based buffer.

Myc and In Vivo Reprogramming

275

7. Wash with 1 PBS for 10 min (repeat twice). 8. Block endogenous peroxidase with 3% hydrogen peroxide in PBS. 9. Wash with 1 PBS for 10 min (repeat twice). 10. Incubate slides with the appropriate primary antibodies, e.g., anti-Oct4 or anti-Tfe3. 11. Wash with 1 PBS for 10 min (repeat twice). 12. Incubate slides with the species-matched secondary antibodies conjugated with horseradish peroxidase. 13. Wash with 1 PBS for 10 min (repeat twice). 14. Develop the immunohistochemical reactions using 3,30 -diaminobenzidine tetrahydrochloride as a chromogen, and counterstain nuclei with hematoxylin. 15. Dehydrate the slides, clean them, and mount them with a permanent mounting medium for microscopic evaluation. 16. To facilitate the analysis, the slides can be digitalized and visualized with the Panoramic Viewer Software or alternative programs. 3.4 Histopathological Evaluation of Organs

As mentioned before, even if teratomas are not detected macroscopically, several tissues could present signs of dedifferentiation. Therefore, we recommend looking for the events indicated in Note 4 in the following organs and tissues: liver, pancreas, intestine, heart, muscle, bone marrow, spleen, thymus, kidney, lungs, stomach, adipose tissue, lymph nodes, and brain. 1. Fix the organs in 10% neutral buffered formalin (4% formaldehyde in solution) during 24 h. 2. Dehydrate samples in 70% ethanol during 24 h. 3. Embed them in paraffin and cut into 3 μm sections. 4. Mount them onto Superfrost® Plus slides and air-dry them. 5. Deparaffinize the slides in xylene and rehydrate them through a series of graded ethanol until water. 6. Stain serial sections with hematoxylin and eosin. 7. Analyze (if possible, with a trained pathologist) the presence of any sign of reprogramming or dedifferentiation (see details in Note 4).

3.5 In Vivo Induced Pluripotent Stem Cells Isolation

Isolation of iPS cells from fresh teratomas is possible in most of the cases since some cells will most likely remain undifferentiated. Another proof to demonstrate that full pluripotency has been achieved is to be able to isolate iPS cells from blood and bone marrow (circulating iPS cells). Here, we describe in detail the protocols to isolate and culture the in vivo-generated iPS cells.

276

Elena Senı´s et al.

3.5.1 iPS Cells Isolation from Teratomas

1. Take a maximum of 0.5 cm  0.5 cm piece of teratoma. From now on, work inside a tissue culture hood. 2. Place a 40 μm cell strainer on a 50 ml Falcon tube. 3. Place the teratoma piece on the cell strainer and rinse it with 1–2 ml of iPS cells medium. 4. Pull out the plunger from a 5 ml syringe without touching the plunger flange. 5. Disaggregate the teratoma on the strainer using the flat part of the plunger flange while adding iPS cells medium. Carefully and smoothly rotate the plunger so the furrows grind the teratoma against the strainer. Add iPS cells medium (maximum of 50 ml) while grinding, so that cells are filtered through. 6. Centrifuge (300  g, 5 min at room temperature (RT)). 7. Resuspend the pellet into 3 ml of ammonium chloride to lyse the erythrocytes (5–10 min, RT). Add 15 ml of iPS cells medium and centrifuge (300  g, 5 min at RT). 8. Plate the cells on gelatin-coated plates (i.e., plates incubated at 37  C with 0.1% gelatin during at least 15 min and, afterwards, rinsed twice with PBS) and culture them with iPS cells medium, at 37  C and 5% CO2. Note: The disaggregated teratoma can result in an enormous amount of different cell types. It is recommended to plate the 3 ml into at least three wells of a 6-well plate or into a 100 mm plate (without a feeder layer) to avoid overcrowding and possible cell layer detachment. 9. Change media every 2 days and monitor for iPS cells colony formation. 10. Pick the iPS cells colonies to isolate single clones as previously described [20].

3.5.2 iPS Cells Isolation from Peripheral Blood

1. Collect peripheral blood (0.3–0.5 ml) directly from the heart of the mice right after sacrificing the mice. 2. Subject the blood to two rounds of erythrocyte lysis in ammonium chloride solution. Perform the first round of lysis with 10 ml of ammonium chloride for 15 min at RT and centrifuge (300  g, 5 min at RT). 3. Perform the second round of lysis with 3 ml for 15 min at RT and neutralize it with 12 ml of iPS cells medium. 4. Pellet cells and count them. Expected is a recovery of around 106 cells per mouse. 5. Resuspend the cells, plate them on gelatin-coated plates (see above) over a feeder layer, and culture them in iPS cells medium at 37  C and 5% CO2. 6. Monitor for iPS cells formation and pick the iPS cells colonies as previously described [20].

Myc and In Vivo Reprogramming 3.5.3 iPS Cells Isolation from Bone Marrow

277

1. Collect the femora and tibiae. On a petri dish, cut the tips of the femora or tibiae (previously cleaned from skin and muscle). Use a 10 ml syringe with a 21G needle and flush the bone marrow cells using iPS cells medium. The bone will turn white or transparent when the bone marrow is completely removed. Disaggregate the bone marrow cells by pipetting up and down with a syringe coupled to an 18G needle and transfer it into a Falcon tube. Centrifuge at 300  g for 5 min at RT. 2. Subject the samples to erythrocyte lysis in ammonium chloride solution (3 ml for 5 min). 3. Neutralize the reaction with 12 ml iPS cells medium. 4. Pellet cells (300  g, 5 min, RT) and resuspend them in iPS cells medium. 5. Plate the cells on gelatin-coated plates (see above) over a feeder layer and culture them in iPS cells medium at 37  C and 5% CO2. 6. Monitor for iPS cells formation and pick the iPS cells colonies as previously described [20].

4

Notes 1. Dissecting Myc’s role in in vivo reprogramming. The method presented here may set the basis for future studies on Myc’s functions during in vivo reprogramming. This method can be used to include in the reprogramming cocktail Myc mutants, genes that may replace Myc or Myc regulators. These studies can be combined with detailed analysis of the kinetics of dedifferentiation and the specific cell types undergoing dedifferentiation (see below, Signs of reprogramming in tissues). Inspired by previous reports describing the role of Myc during in vitro reprogramming [5–8, 10–13], we believe it would be interesting to analyze the transcriptional changes specifically induced by Myc (in reprogrammed tissues and in in vivo iPS cells), to map the genomic regions targeted by Myc and reprogramming factors by Chip-seq, as well as to analyze the histone acetylation patterns and the metabolic status of reprogramming tissues (OXPHOS/glycolysis rate), among others. 2. AAV vectors. Before starting this procedure, the AAV vectors should be produced. The AAV vector production protocol is not in the scope of this book chapter, but it is described in detail in previous publications [14, 21]. In order to have appropriate volumes for injection, the titers of the AAV vector preparations should be >1  1013 vector genomes/ml. 3. Experimental timeline and suggested variations on the protocol. In our hands, using AAV serotype 8 and a dose of

278

Elena Senı´s et al.

1  1012 vector genomes/vector/mouse, OSKM induces palpable teratomas 6 weeks after injection but OSK does not induce palpable teratomas at this early time point. We only observed OSK-induced teratomas in the pancreas of one-third of the mice upon necropsy, 53 weeks after injection. It would be easy to perform some variations on the protocol in order to increase the reprogramming efficiency of particular tissues: l

Increase the dosage: AAV8 vector dose can be increased up to 7.2  1012 vector genomes/mouse without toxicity, as it has been performed in other studies [22].

l

Change the AAV serotype: Potentially, any tissue can be targeted by choosing the appropriate the capsid. For a recent update, see [16, 23].

When using other AAV capsids and/or doses, we recommend performing time-course experiments and analyzing signs of reprogramming by histopathology (see below). Considering that some teratomas might not be detected by palpation (especially if they are not in the liver), establishing the proper time points to euthanize the animals may be required to identify reprogramming events. 4. Signs of reprogramming in tissues. Some examples of the signs of reprogramming that we found in mouse organs are the presence of undifferentiated cells, pleomorphic or dysplastic cells, and increased proliferation or regeneration-like events (as in the case of muscle fibers). The tissues that show signs of reprogramming can be stained for markers of pluripotency (Oct4, Tfe3, or Nanog), markers of dedifferentiation (for example, the loss of cytokeratin 19 expression in epithelial cells), markers of proliferation (from example, PCNA or Ki67), or specific tissue progenitor markers (for example, alpha-fetoprotein as a marker of fetal liver). The selection of dedifferentiation and progenitor markers will therefore depend on the tissue that shows signs of dedifferentiation or reprogramming. References 1. Takahashi K, Yamanaka S (2006) Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126:663–676. https://doi.org/10.1016/ j.cell.2006.07.024 2. Liu G, David BT, Trawczynski M, Fessler RG (2020) Advances in pluripotent stem cells: history, mechanisms, technologies, and applications. Stem Cell Rev Rep 16:3–32. https:// doi.org/10.1007/s12015-019-09935-x

3. Abad M, Mosteiro L, Pantoja C et al (2013) Reprogramming in vivo produces teratomas and iPS cells with totipotency features. Nature 502:340–345. https://doi.org/10.1038/ nature12586 4. Ohnishi K, Semi K, Yamamoto T et al (2014) Premature termination of reprogramming in vivo leads to cancer development through altered epigenetic regulation. Cell

Myc and In Vivo Reprogramming 156:663–677. https://doi.org/10.1016/j. cell.2014.01.005 5. Wernig M, Meissner A, Cassady JP, Jaenisch R (2008) c-Myc is dispensable for direct reprogramming of mouse fibroblasts. Cell Stem Cell 2:10–12. https://doi.org/10.1016/j.stem. 2007.12.001 6. Nakagawa M, Koyanagi M, Tanabe K et al (2008) Generation of induced pluripotent stem cells without Myc from mouse and human fibroblasts. Nat Biotechnol 26:101–106. https://doi.org/10.1038/ nbt1374 7. Prieto J, Seo AY, Leo´n M et al (2018) MYC induces a hybrid energetics program early in cell reprogramming. Stem Cell Rep 11:1479–1492. https://doi.org/10.1016/j. stemcr.2018.10.018 8. Zviran A, Mor N, Rais Y et al (2019) Deterministic somatic cell reprogramming involves continuous transcriptional changes governed by Myc and epigenetic-driven modules. Cell Stem Cell 24:328–341. https://doi.org/10. 1016/j.stem.2018.11.014 9. Meissner A, Wernig M, Jaenisch R (2007) Direct reprogramming of genetically unmodified fibroblasts into pluripotent stem cells. Nat Biotechnol 25:1177–1181. https://doi.org/ 10.1038/nbt1335 10. Araki R, Hoki Y, Uda M et al (2011) Crucial role of C-Myc in the generation of induced pluripotent stem cells. Stem Cells 29:1362–1370. https://doi.org/10.1002/ stem.685 11. Soufi A, Donahue G, Zaret KS (2012) Facilitators and impediments of the pluripotency reprogramming factors’ initial engagement with the genome. Cell 151:994–1004. https://doi.org/10.1016/j.cell.2012.09.045 12. Soufi A, Garcia MF, Jaroszewicz A et al (2015) Pioneer transcription factors target partial DNA motifs on nucleosomes to initiate reprogramming. Cell 161:555–568. https://doi. org/10.1016/j.cell.2015.03.017 13. Hirsch CL, Akdemir ZC, Wang L et al (2015) Myc and SAGA rewire an alternative splicing network during early somatic cell reprogramming. Genes Dev 29:803–816. https://doi. org/10.1101/gad.255109.114

279

14. Senı´s E, Mosteiro L, Wilkening S et al (2018) AAVvector-mediated in vivo reprogramming into pluripotency. Nat Commun 9:2651. https://doi.org/10.1038/s41467-01805059-x 15. Wang D, Tai PWL, Gao G (2019) Adenoassociated virus vector as a platform for gene therapy delivery. Nat Rev Drug Discov 18:358–378. https://doi.org/10.1038/ s41573-019-0012-9 16. Srivastava A (2016) In vivo tissue-tropism of adeno-associated viral vectors. Curr Opin Virol 21:75–80. https://doi.org/10.1016/j.coviro. 2016.08.003 17. Colella P, Ronzitti G, Mingozzi F (2018) Emerging issues in AAV-mediated in vivo gene therapy. Mol Ther Methods Clin Dev 8:87–104. https://doi.org/10.1016/j.omtm. 2017.11.007 18. Conner DA (2001) Mouse embryo fibroblast (MEF) feeder cell preparation. Curr Protoc Mol Biol 51:23.2.1–23.2.7. https://doi.org/ 10.1002/0471142727.mb2302s51 19. Yardeni T, Eckhaus M, Morris HD (2011) Retro-orbital injections in mice. Lab Anim 40:155–160. https://doi.org/10.1038/ laban0511-155 20. Rajarajan K, Engels MC, Wu SM (2012) Reprogramming of mouse, rat, pig, and human fibroblasts into iPS cells. Curr Protoc Mol Biol 97:23.15.1–23.15.32. https://doi. org/10.1002/0471142727.mb2315s97 21. Grimm D, Pandey K, Kay MA (2005) Adenoassociated virus vectors for short hairpin RNA expression. Methods Enzymol 392:381–405. https://doi.org/10.1016/S0076-6879(04) 92023-X 22. Nakai H, Fuess S, Storm TA et al (2005) Unrestricted hepatocyte transduction with adenoassociated virus serotype 8 vectors in mice. J Virol 79:214–224. https://doi.org/10.1128/ jvi.79.1.214-224.2005 23. Weinmann J, Grimm D (2017) Nextgeneration AAV vectors for clinical use: an ever-accelerating race. Virus Genes 53:707–713. https://doi.org/10.1007/ s11262-017-1502-7

Chapter 15 Using Flow Cytometry to Study Myc’s Role in Shaping the Tumor Immune Microenvironment Sı´lvia Casacuberta-Serra Abstract Myc is deregulated in most—if not all—cancers, and it not only promotes tumor progression by inducing cell proliferation but is also responsible for tumor immune evasion. In a nutshell, MYC promotes the development of tumor-associated macrophages, impairs the cellular response to interferons, induces the expression of immunosuppressive molecules, and excludes tumor infiltrating lymphocytes (TILs) from the tumor site. Based on the insights into the role of MYC in promoting and regulating immune evasion by cancer cells, it is of special interest to study the different immune cell populations infiltrating the tumors. MYC inhibition has emerged as a potential new strategy for the treatment of cancer, directly inhibiting tumor progression while also counteracting the immunosuppressive tumor microenvironment, allowing an optimal anti-tumor immune response. Hence, this chapter describes a flow cytometry-based method to study the different immune cell subsets infiltrating the tumor by combining surface, cytoplasmic, and nuclear multicolor protein stainings. Key words MYC, Multicolor flow cytometry, Immune evasion, Immune surveillance, Tumor infiltrating lymphocytes, Cytokines

1

Introduction Tumors are sophisticated structures whose complexity resembles, or may even outpace, that of normal and healthy tissues. From this point of view, the biology of a tumor can only be understood by characterizing all the different cells that compose it, including immune cells. The concept that the immune system can recognize and destroy nascent tumors was described for the first time more than a century ago, when Paul Ehrlich formulated the hypothesis that the host’s defenses could prevent transformed cells from developing into tumors [1]. It was not until the late 1950s when the formal hypothesis of cancer immune surveillance was postulated by Burnet and Thomas, who suggested that the immune system can eliminate newly arising tumors through the recognition of tumorspecific neo-antigens on tumor cells, similarly to allograft rejection

Laura Soucek and Jonathan Whitfield (eds.), The Myc Gene: Methods and Protocols, Methods in Molecular Biology, vol. 2318, https://doi.org/10.1007/978-1-0716-1476-1_15, © Springer Science+Business Media, LLC, part of Springer Nature 2021

281

282

Sı´lvia Casacuberta-Serra

[2, 3]. This hypothesis was abandoned shortly afterwards due to the lack of sufficient experimental evidence and inadequacy of experimental tools and knowledge at the time. After many years of intense research and advances in the field, tumor immune surveillance has been widely demonstrated, and now immune evasion has become one of the hallmarks of cancer [4, 5]. Until recently, it was thought that oncogenes contributed to tumor proliferation and survival only through tumor cell-intrinsic mechanisms. However, it is now evident that they not only drive relentless cell division and corollary intracellular programs but also contribute to the instruction of the tumor microenvironment. The latter is intimately related to immune evasion, the mechanism through which cancer cells avoid host immune surveillance mechanisms, by inducing an immunosuppressive microenvironment and immune edition. One of the best examples of this is the MYC oncogene. MYC is a pleiotropic transcription factor that is implicated in up to 70% of all human cancers [6, 7] and upon binding to its obligate partner, Max (MYC-associated protein X) [8, 9], controls several cellular functions related to proliferation, growth, metabolism, and cell death, as well as programs of tissue remodeling and regeneration [10–12]. In addition, MYC has the capacity to promote active immune evasion by cancer cells, protecting them from attack and subsequent destruction by immune cells. By remodeling the microenvironment, tumor infiltrating immune cells can no longer antagonize tumor growth and instead enhance tumor development and progression. MYC orchestrates immune evasion through different mechanisms, effecting the secretion of soluble immune modulators and regulating the expression of immune inhibitory receptors. These include: (1) promoting the development and activation of tumor-associated macrophages with an immunosuppressive phenotype [13, 14]; (2) impairing the tumor response to interferons [15–17] and the production of type I interferons by dendritic cells [18]; (3) inducing expression of the immunosuppressive molecules Programmed Death Ligand 1 (PD-L1)—a “don’t kill me” signal—and the phagocytosis-inhibitory protein CD47—a “don’t eat me” signal [19]—thus making tumor cells invisible to the host immune system; and (4) excluding tumor infiltrating lymphocytes (TILs) and natural killer (NK) cells from the tumor microenvironment in lung cancer [20, 21] and pancreatic cancer [17] models. These features are reverted by MYC depletion using both genetic and pharmacological approaches. Based on the insights into the role of MYC in promoting and regulating immune evasion by cancer cells, MYC inhibition has emerged as a potential new strategy for the treatment of cancer, directly inhibiting tumor progression while also counteracting the immunosuppressive tumor microenvironment [22], fostering an effective anti-tumor immune response that could overcome—or

Using Flow Cytometry to Study Myc’s Role in Shaping the Tumor Immune. . .

283

potentially prevent—immunotherapeutic resistance [20, 23]. In order to study the role of MYC in shaping the tumor immune microenvironment, different approaches can be used, such as inducing expression of exogenous MYC in tumor cells or by inhibiting MYC through many different strategies [24]. This chapter addresses the issue of how to study the different immune cell populations that infiltrate mouse tumors, in particular the different T cell populations and their activation status. A wide number of cell surface receptors, transcription factors, and even soluble proteins have been extensively described in the literature as markers to identify the different immune cells, but unfortunately for the majority of them there is no single marker that can unambiguously identify a specific immune cell type, thus it is necessary to combine several different makers that analyzed together can precisely define immune subsets. For this reason, this chapter focuses on flow cytometry, which allows simultaneous analysis of multiple markers, describing common methods and markers to study the different immune cell populations that infiltrate tumors.

2

Materials

2.1 Mouse Necropsy and Sample Collection

1. Ice-cold sterile phosphate-buffered saline (PBS) at pH 7.4. 2. 4% paraformaldehyde (PFA). 3. 70% ethanol.

2.2 Reagents for Tumor Single-Cell Preparation

1. 70 μM cell strainers. 2. 30 μM cell strainers. 3. Sterile PBS at pH 7.4. 4. Dulbecco’s Modified Eagle Medium (DMEM) or Roswell Park Memorial Institute (RPMI) cell culture medium. 5. Dulbecco’s Modified Eagle Medium (DMEM) or Roswell Park Memorial Institute (RPMI) cell culture medium supplemented with 10% of heat-inactivated fetal bovine serum (FBS), 5% of Lglutamine, and 5% of penicillin-streptomycin solution. Referred to as supplemented medium in the rest of the protocol. 6. Mouse Tumor Dissociation Kit (Miltenyi Biotec). 7. Trypan blue 0.4% solution.

2.3 Reagents for T Cell Activation

1. RPMI or Iscove’s Modified Dulbecco’s Medium (IMDM) cell culture medium supplemented with 10% of heat-inactivated fetal bovine serum (FBS), 5% of L-glutamine, and 5% of penicillin-streptomycin solution. Referred to as supplemented medium in the rest of the protocol.

284

Sı´lvia Casacuberta-Serra

2. Cell culture-grade ionomycin calcium salt (Sigma-Aldrich). 3. Cell culture-grade phorbol 12-myristate 13-acetate (PMA; Sigma-Aldrich). 4. GolgiStop™ (BD Biosciences), a protein transport inhibitor containing monensin. 5. GolgiPlug™ (BD Biosciences), a protein transport inhibitor containing brefeldin A. 6. BD Vacutainer™ 5 mL serum collection tubes without additives, red cap (BD). 2.4 Reagents and Antibodies for Cell Surface and Intracellular Antigen Staining

The reagents and antibodies listed in this section are just examples, any equivalent reagent or antibody can be used. Fluorochromes should be carefully selected considering the technical characteristics of the flow cytometer used for the analysis and the rest of the fluorochromes used in the same panel (see Note 1). 1. 30 μM cell strainers. 2. Phosphate-buffered saline (PBS) at pH 7.4. 3. eBioscience™ 1 Red Blood Cell (RBC) Lysis Buffer (Thermo Fisher Scientific). 4. BD Horizon™ Fixable Viability Stain 510 (FVS510; BD Biosciences). 5. PBS + 1% of bovine serum albumin (BSA) + 0.1% sodium azide (PBS-azide). 6. Anti-mouse CD16/32 purified antibody (Clone 93; BioLegend) to block Fc receptors. 7. eBioscience™ FoxP3/Transcription Factor Staining Buffer Set (Thermo Fisher Scientific). 8. BD Cytofix/Cytoperm™ (BD Biosciences).

Fixation/Permeabilization

kit

9. The surface and intracellular antibodies used for flow cytometry characterization of the different immune cell subsets are listed in Table 1.

3

Methods

3.1 Mouse Necropsy and Sample Collection

At the end of the experiment, tumor-bearing mice can be euthanized either by carbon dioxide asphyxiation or through cervical dislocation. 1. Pin down the mouse and spray it with 70% ethanol to avoid contamination of the samples that will be collected. 2. Collect the tissue samples of interest. This will vary depending on the tumor model used.

Using Flow Cytometry to Study Myc’s Role in Shaping the Tumor Immune. . .

285

Table 1 Antibodies and isotypes used for tumor infiltrating immune cell characterization Antibody

Fluorochrome

Isotype

Clone

Manufacturer

Anti-mouse CD3e

FITC

ArmHamster IgG

145-2C11

eBioscience

Anti-mouse CD4

PerCP-eFluor710

Rat IgG2a,k

RM4-5

eBioscience

Anti-mouse CD8a

APC-H7

Rat IgG2a,k

53-6.7

BD

CD11c

PE

ArmHamster IgG

N418

BioLegend

CD25

PE

Rat IgG1,λ

PC61.5

eBioscience

Anti-mouse CD45

BV605

Rat IgG2b,k

30-F11

BioLegend

CD45R (B220)

APC-H7

Rat IgG2a,k

RA3-6B2

BD

CD49b (pan NK)

PE/Cy7

Rat IgG, M

DX5

BioLegend

CD206 (MMR)

APC

Rat IgG2a,k

C068C2

BioLegend

F4/80

PE

Rat IgG2a,k

BM8

eBioscience

FoxP3

APC

Rat IgG2a,k

FJK-16s

eBioscience

I-A/I-E (MHC-II)

BV421

Rat IgG2b,k

M5/114.15.2

BioLegend

IFN-γ

APC

Rat IgG1,k

XMG1.2

BD

IL-4

APC

Rat IgG1, k

11B11

BD

IL-17A

PE

Rat IgG1, k

TC11-18H10

BD

Ly-6G

APC-H7

Rat IgG2a,k

1A8

BD

PD-1 (CD279)

BV421

Rat IgG2a,k

29F.1A12

BioLegend

PD-L1 (CD274)

BV421

R IgG2b,k

10F.9G2

BioLegend

Tim-3 (CD366)

PE/Cy7

R IgG2a,k

RMT3-23

eBioscience

ArmHamster IgG

FITC

ArmHamster IgG1,k

HTK888

BioLegend

ArmHamster IgG

PE

ArmHamster IgG

HTK888

BioLegend

Rat IgG2a,k

PerCP-eFluor710

Rat IgG2a,k

eBR2a

eBioscience

Rat IgG2a,k

APC-H7

Rat IgG2a,k

R35-95

BD

Rat IgG1,λ

PE

Rat IgG1,λ

G0114F7

BioLegend

Rat IgG2b,k

BV605

Rat IgG2b,k

RTK4530

BioLegend

Rat IgG, M

PE/Cy7

Rat IgG, M

T4-22

BD

Rat IgG2a,k

APC

Rat IgG2a,k

eBR2a

eBioscience

Rat IgG2a,k

PE

Rat IgG2a,k

eBR2a

eBioscience

Rat IgG2b,k

BV421

Rat IgG2b,k

RTK4530

BioLegend

Rat IgG1,k

APC

Rat IgG1,k

RTK2071

BioLegend

Rat IgG1, k

PE

Rat IgG1, k

RTK2071

BioLegend

Rat IgG2a,k

BV421

Rat IgG2a,k

RTK2758

BioLegend

R IgG2a,k

PE/Cy7

R IgG2a,k

RTK2758

BioLegend

286

Sı´lvia Casacuberta-Serra

3. Cut the tumors in two pieces. Fix one piece in 4% PFA overnight to make paraffin embedded blocks. Tissue sections can then be used for future analysis of tumor morphology and grading by hematoxylin and eosin stainings (H&E). Put the other half of the tumor in a tube containing 5 mL of ice-cold PBS and keep the tube on ice. Small pieces of tumor can also be snap-frozen and stored at 80  C for future protein (Western blot) or RNA (PCR) analysis. 3.2 Dissociation of Mouse Tumors and Single-Cell Suspension Preparation

Tumor tissues can be dissociated into single suspensions by combining mechanical dissociation and enzymatic digestion of the extracellular matrix. The purpose of preparing a single-cell suspension is to quickly isolate cells from tissues so they can be labeled for flow cytometric acquisition while avoiding cell death and aggregation. The protocol described here for dissociating mouse tumors uses a commercial enzyme mixture, nevertheless, any other mixture of enzymes (i.e., combination of collagenase and DNAase) can also be used. However, it is vital that the selected enzyme combination ensures cell viability and the full integrity of cell surface antigens for flow cytometry effective immunophenotyping (see Note 2). Keep the samples on ice through all the process when not manipulating them. 1. Prepare enzyme mix (Tumor Dissociation Kit; Miltenyi Biotec) in a 50 mL tube by adding: l

2.39 mL of DMEM (RPMI can also be used).

l

100 μL of Enzyme D.

l

10 μL of Enzyme R (see Note 3).

l

12.5 μL of Enzyme A.

Prepare as many tubes as different tumor samples. The quantities of each enzyme listed in this chapter are the ones recommend by the manufacturer’s instructions (see Note 4). 2. Put the tumor piece into a 6 cm dish using sterilized tweezers. Remove fat, fibrous, and necrotic areas from the tumor sample. Using two scalpels, cut the tumor into the smallest possible pieces until it looks like a paste. 3. Transfer the tumor paste into the 50 mL tube containing enzyme mix. 4. Spin down (very gently; up to 250  g maximum) the tubes with the tumor samples. 5. Incubate them at 37  C in continuous agitation for 40 min using an orbital shaker at 150 rpm (see Note 5). 6. Put a 70 μm cell strainer into a 6 cm dish and add 3 mL of supplemented DMEM. RPMI can also be used.

Using Flow Cytometry to Study Myc’s Role in Shaping the Tumor Immune. . .

287

7. Transfer the tumor suspension to the 70 μm cell strainer. Gently smash the remaining tumor pieces with a small syringe plunger until all the pieces have been completely disaggregated. Leave all the fat and connective tissue on the filter (see Note 6). 8. Transfer the cell strainer and then the newly prepared cell suspension into a new 50 mL tube. Wash the plate and the strainer with 5 mL of supplemented medium and transfer it to the new tube. 9. Centrifuge the cell suspension for 5 min at 400  g. 10. Place a 30 μm cell strainer into a new 50 mL tube. 11. Discard the supernatant and resuspend the cell pellet in 1 mL of supplemented medium. Pass the cell suspension through the 30 μm strainer and wash the filter by adding 4 mL of supplemented medium. 12. Centrifuge the cell suspension for 5 min at 400  g. 13. Discard the supernatant and resuspend the cell pellet in 3 mL of supplemented medium (see Note 7). 14. Count the cells using a Neubauer chamber using trypan blue dye exclusion to assess cell viability or using an automated cell counter instrument to count viable cells. 3.3

T Cell Activation

T cells usually display low or undetectable amounts of spontaneous cytokine expression, thus efficient detection usually requires in vitro activation using antigenic, mitogenic, or pharmacological stimulation. For detection of most T cell cytokines, PMA and ionomycin are the most common stimuli, although they are not the most physiological ones, they are able to induce potent, polyclonal, and nonspecific cytokine production. Ionomycin is a Ca2+ ionophore and PMA is a protein kinase C activator, together these two reagents synergize to activate T cells and trigger cytokine production. In order to efficiently detect intracellular cytokines, protein transport inhibitors like monensin (GolgiStop™) and/or brefeldin A (GolgiPlug™) must be added to the culture media. Both compounds enhance intracellular cytokine staining signaling by blocking transport processes during T cell activation and thus increasing the amount of cytokines within cells. 1. Put 4 mL of supplemented RPMI medium in the Vacutainer tubes. Use as many tubes as samples. IMDM can also be used. 2. Add 10–20  106 viable cells in each stimulation tube (see Note 8). 3. Add 1 μM of ionomycin, 50 ng/mL of PMA, 2.7 μL of GolgiStop™, and 4 μL of GolgiPlug™ to each tube and mix thoroughly (see Note 9).

288

Sı´lvia Casacuberta-Serra

4. Incubate the cells with the stimuli and protein transport inhibitors for a period of 4–12 h at 37  C (see Note 10). 5. Centrifuge the cell suspension for 5 min at 400  g. 6. Discard the supernatant and resuspend the cell pellet in 1 mL of PBS. 7. Place a 30 μm cell strainer into a flow cytometry tube and pass the cell suspension through the 30 μm strainer to eliminate cell aggregates. 8. Count the cells using a Neubauer chamber using trypan blue dye exclusion to assess cell viability or using an automated cell counter instrument to count viable cells (see Note 11). 3.4 Surface and Intracellular Flow Cytometry Staining

Both surface and intracellular stainings can be performed either in flow cytometry tubes or in 96-well plates. The amounts of reagents listed here are recommended for flow cytometry tubes. When using 96-well plates, the volumes of the washing and fixation/permeabilization steps should be modified accordingly.

3.4.1 Dead Cell Labeling

1. (Optional) Prior to flow cytometry staining, depending on the tumor particularities and tissue of origin, red blood cells may need to be lysed. If the content of red blood cells is significant then proceed with their lysis using the RBC Lysis Buffer following manufacturer’s instructions. 2. Put 1–2  106 viable cells in each flow cytometry tube and add 1 mL of PBS (see Note 12). 3. Centrifuge the cells for 5 min at 400  g. 4. Discard the supernatant and resuspend cells with 1 mL of PBS. 5. Add 1 μL of the BD Horizon™ FVS 510 Stock Solution to each tube and vortex immediately (see Note 13). 6. Incubate the mixture for 15 min at room temperature (RT) protected from light. 7. Add 2 mL of PBS-azide and centrifuge the cells for 5 min at 400  g, repeat this step twice.

3.4.2 Surface Antigen Staining

1. Discard the supernatant and pulse vortex to disrupt the cell pellet. 2. Block the cells by adding 1 μL of anti-mouse CD16/32 antibody to the remaining volume (~50 μL). 3. Vortex and incubate 10 min at RT. 4. Prepare the cocktail of surface antibodies that yields the optimal final concentration of each single antibody (see Note 14). 5. Without washing, add the antibody mixture and the isotype controls to the corresponding tubes.

Using Flow Cytometry to Study Myc’s Role in Shaping the Tumor Immune. . .

289

6. Pulse vortex to resuspend the cells and incubate 20 min at 4  C protected from light (see Note 15). 7. Add 1 mL of PBS-azide and centrifuge the cells 5 min at 400  g. 3.4.3 Intracellular Antigen Staining Transcription Factor Staining Protocol

When staining for cytokines and transcription factors in the same panel, use this protocol to stain both type of proteins at the same time using the eBioscience™ FoxP3/Transcription Factor Staining Buffer Set (Thermo Fisher Scientific). 1. After Subheading 3.4.2, step 7, discard the supernatant and vortex cells. 2. Add 1 mL of 1 Foxp3 Fixation/Permeabilization Solution (Thermo Fisher Scientific) and pulse vortex to avoid cell aggregation. 3. Incubate 30 min at RT or overnight at 4  C protected from light (see Note 16). 4. Centrifuge the cells for 5 min at 400  g and discard the supernatant. 5. Add 2 mL of 1 Permeabilization Buffer and centrifuge the cells 5 min at 400  g. 6. Discard the supernatant and vortex cells. 7. Prepare the cocktail of intracellular antibodies that yields the optimal final concentration of each single antibody (see Note 14). 8. Add the antibody mixture and isotype controls to the corresponding tubes and incubate 30 min at RT protected from light. 9. Add 2 mL of 1 Permeabilization Buffer and centrifuge the cells for 5 min at 400  g, repeat this step twice. 10. Resuspend cells with 250 μL of PBS-azide and acquire in the cytometer (see Note 17).

Intracellular Cytokines Staining Protocol

When staining only for cytokines, this protocol can be used as an alternative using the BD Cytofix/Cytoperm™ Fixation/Permeabilization kit (BD Biosciences). 1. After Subheading 3.4.2, step 7, discard the supernatant and vortex cells. 2. Add 250 μL of Fixation/Permeabilization Solution (BD Biosciences) and pulse vortex to avoid cell aggregation. 3. Incubate 20 min at 4  C protected from light. 4. Add 1 mL of 1 BD Perm/Wash and centrifuge the cells for 5 min at 400  g. Discard the supernatant and vortex cells. Repeat this step twice.

290

Sı´lvia Casacuberta-Serra

Table 2 Cell markers to identify different immune populations Immune cell population

Markers

T cells

CD45+CD3+

Helper T (Th) cells

CD45+CD3+CD4+

Cytotoxic T cells

CD45+CD3+CD8+

Regulatory T cells

CD45+CD3+CD4+FoxP3+CD25+

Activated Th cells

CD45+CD3+CD4+FoxP3 CD25+

Activated cytotoxic T cells

CD45+CD3+CD8+CD25+

NK cells

CD45+CD3 CD49b+

NK T cells

CD45+CD3+CD49b+

Tumor-specific CD4 T cells [25, 26] CD45+CD3+CD4+PD-1+Tim-3+/ Tumor-specific CD8 T cells [25, 26] CD45+CD3+CD8+PD-1+Tim-3+/ B cells

CD45+B220+

M2 macrophages

CD45+CD11b+F4/80+CD206+

Neutrophils

CD45+CD11b+F4/80 Ly6G+

Myeloid dendritic cells

CD45+CD11b+CD11c+MHC-IIhigh

Th1 T cells

CD45+CD3+CD4+IFN-γ+

Th2 T cells

CD45+CD3+CD4+IL-4+

Th17 T cells

CD45+CD3+CD4+IL-17A+

5. Prepare the cocktail of anti-cytokine antibodies that yields the optimal final concentration of each single antibody (see Note 14). 6. Add the anti-cytokine antibody mixture and isotype controls to the corresponding tubes and incubate for 30 min at 4  C protected from light. 7. Add 1 mL of 1 BD Perm/Wash and centrifuge the cells for 5 min at 400  g. Discard the supernatant and vortex cells. Repeat this step twice. 8. Resuspend cells with 250 μL of PBS-azide and acquire in the cytometer (see Note 17). When using the antibodies listed in Table 1, the following immune populations can be identified (Table 2). Some representative flow cytometry dot plots are shown in Fig. 1.

Using Flow Cytometry to Study Myc’s Role in Shaping the Tumor Immune. . .

291

Fig. 1 Representative flow cytometry dot plots of immune populations infiltrating the tumors that can be analyzed using this protocol

292

4

Sı´lvia Casacuberta-Serra

Notes 1. In order to obtain optimal results from the flow cytometry analysis, especially when combining multiple markers in the same panel, it is crucial that the appropriate combination of fluorochromes is used. When choosing the fluorochromes one has to take into account the following parameters: l

The particular flow cytometer used and instrument configuration. The type and number of lasers and detectors determine fluorochrome selection. Each fluorochrome has an optimal excitation and emission wavelength, thus the selected fluorochromes must be excited by the lasers and their emissions detected by the optical filters of the instrument. Using wide band-pass filters can increase the sensitivity to detect certain fluorochromes, but may also increase the amount of spillover coming from neighboring fluorochromes.

l

Avoid fluorescence spillover as much as possible by selecting fluorochromes with the minimal emission spectral overlap. One way to assess your fluorochrome selection is to test it using spectra viewer web tools. These tools show predicted spillovers for particular fluorochromes, laser and filter combinations. The more colors one attempts to resolve, the more spillover between those colors that will have to be dealt with.

l

Pay special attention to the level of expression of the proteins you want to study. Use the brightest fluorochromes for proteins with low expression and the dimmest fluorochromes for the highly expressed ones.

2. When using “homemade” enzyme combinations, it is recommended that the digestion protocol is first validated using immune cells (splenocytes or blood cells) to ensure that the digestion protocol does not affect epitope integrity of the relevant makers for the phenotypic analysis. 3. Related to the note above, according to the manufacturer’s recommendations, enzyme R is known to strongly affect the integrity of the CD25 antigen. Thus, a lower amount of this enzyme is added if this marker is present in any of the flow cytometry panels analyzed. If this marker is not in the panel, then 50 μL of enzyme R can be added to the mixture. It should be noted that reducing the amount of enzyme R may lead to lower cell yields and lower viability of endothelial cells, epithelial cells, and tumor-associated fibroblasts (according to the manufacturer).

Using Flow Cytometry to Study Myc’s Role in Shaping the Tumor Immune. . .

293

4. The quantities of each enzyme are recommended for tumor tissues of up to 1 G. When using smaller pieces of tough tumor (subcutaneous) or tumors from soft tissues (lung or colon), smaller amounts of the enzymes can be used. However, any change of the protocol should be validated before implementing it. 5. The manufacturer recommends using the gentleMACS C Tubes (Miltenyi Biotec) and the gentleMACS Dissociator (Miltenyi Biotec) Instrument to dissociate the tumor tissues. However, I have found that the method described here works sufficiently well and provides a good cell yield. 6. Depending on the size, type of tumor, and tissue of origin, some pieces may remain stuck to the tube walls. If that happens, rinse the tube by adding 2 mL of supplemented medium. Then add this extra volume to the 6 cm dish. 7. The final volume in which the cell pellet is resuspended will vary depending on the amount of tumor tissue. This volume should be modified accordingly. Depending on each sample, it may need further dilution prior to cell counting. 8. Every type of tumor may present different amounts of immune cell infiltration, thus the number of viable cells needed for T cell stimulation may vary depending on the proportions of T cells present in the cell suspension and the incubation times used. 9. The amounts of each stimuli and protein transport inhibitors listed in this protocol are the most standard ones. However, they should be optimized and tested for every experimental system, and they may vary depending on the cytokines to be analyzed. The quantities used should be modified accordingly. 10. Between 4 and 6 h of stimulation should be usually enough to detect the most common T cell cytokines. However, due to technical constraints (duration of the whole protocol) or particularities of the experimental system or cytokines tested, this incubation time can be increased up to 12 h, although this may lead to decreased viability of immune cells. Of note, both protein transport inhibitors should not be kept in cell culture for longer than 12 h. 11. This step may not be necessary for short incubation times (4–6 h) since the viable cell number might not vary. However, when longer incubations times are used (10–12 h) this step is highly recommended to accurately determine the number of remaining viable cells. 12. The number of cells needed may vary depending on the proportions of your cells of interest in the tumor single-cell suspension. Thus, lower amounts may be needed if the population of interest is present in a high proportion within the tumor and vice versa.

294

Sı´lvia Casacuberta-Serra

13. The amount of FVS 510 described in this protocol is the one recommended by the manufacturer to stain 1  106 cells. However, when using fewer cells or resuspending them with less volume of PBS, this amount can be reduced, always keeping the recommended dye concentration. In addition, it is recommended to titrate the dye for optimal performance, as different cell types can present a staining variability. 14. To optimize the staining for flow cytometry, antibody titration is highly recommended, especially when working with multicolor panels. It is very important to use antibodies at the right concentration. Antibodies will bind to high-affinity epitopes, but if they are present in excess, they will also bind to low-affinity targets. This will result in an increased background and will reduce the ability to properly resolve different cell populations. In addition, if the antibody concentration is too high, its fluorescence emission will interfere with the neighboring fluorochromes increasing the amount of spillover. On the other hand, if the antibody concentration is too low it may result in a false negative. 15. From that moment on, keep the samples in the dark as much as possible and avoid exposing them to bright light as many fluorochromes are light sensitive and subject to photobleaching. Tandem fluorochromes are more sensitive and direct light exposure may lead to tandem dissociation. 16. Overnight incubation may help increase the ability to resolve different cell populations identified by intracellular markers. 17. When acquiring the samples in the cytometer, if no carousel is used, keep the samples on ice and protected from light as long as possible.

Acknowledgments The author would like to thank Dr. Jonathan Whitfield for critical reading and editing assistance. This work was supported by the ´ ; grant Catalan Agency for Trade and Investment (ACCIO no. PAT15-0005), the European Research Council (CoG grant no. 617473), the BBVA Foundation and by Peptomyc S.L. References 1. Ehrlich P (1909) Ueber den jetzigen Stand der Karzinomforschung. Ned Tijdschr Geneeskd 5:273–290 2. Thomas L (1959) In: Lawrence HS (ed) Discussion of cellular and humoral aspects

of hypersensitive states. Hoeber-Harper, New York 3. Burnet M (1957) Cancer: a biological approach. I. The processes of control. Br Med J 1:779–786

Using Flow Cytometry to Study Myc’s Role in Shaping the Tumor Immune. . . 4. Hanahan D, Weinberg RA (2011) Hallmarks of cancer: the next generation. Cell 144:646–674 5. Fouad YA, Aanei C (2017) Revisiting the hallmarks of cancer. Am J Cancer Res 7:1016–1036 6. Dang CV (2012) MYC on the path to cancer. Cell 149:22–35 7. Dang CV, O’Donnell KA, Zeller KI et al (2006) The c-Myc target gene network. Semin Cancer Biol 16:253–264 8. Lavigne P, Crump MP, Gagne SM et al (1998) Insights into the mechanism of heterodimerization from the 1H-NMR solution structure of the c-Myc-Max heterodimeric leucine zipper. J Mol Biol 281:165–181 9. McDuff FO, Naud JF, Montagne M et al (2009) The Max homodimeric b-HLH-LZ significantly interferes with the specific heterodimerization between the c-Myc and Max bHLH-LZ in absence of DNA: a quantitative analysis. J Mol Recognit 22:261–269 10. Dang CV (2013) MYC, metabolism, cell growth, and tumorigenesis. Cold Spring Harb Perspect Med 3 11. Evan GI, Vousden KH (2001) Proliferation, cell cycle and apoptosis in cancer. Nature 411:342–348 12. Meyer N, Penn LZ (2008) Reflecting on 25 years with MYC. Nat Rev Cancer 8:976–990 13. Pello OM (2016) Macrophages and c-Myc cross paths. Onco Targets Ther 5:e1151991 14. Pello OM, De Pizzol M, Mirolo M et al (2012) Role of c-MYC in alternative activation of human macrophages and tumor-associated macrophage biology. Blood 119:411–421 15. Schlee M, Holzel M, Bernard S et al (2007) C-myc activation impairs the NF-kappaB and the interferon response: implications for the pathogenesis of Burkitt’s lymphoma. Int J Cancer 120:1387–1395 16. Tulley PN, Neale M, Jackson D et al (2004) The relation between c-myc expression and

295

interferon sensitivity in uveal melanoma. Br J Ophthalmol 88:1563–1567 17. Muthalagu N, Monteverde T, RaffoIraolagoitia X et al (2020) Repression of the type I interferon pathway underlies MYC- and KRAS-dependent evasion of NK and B cells in pancreatic ductal adenocarcinoma. Cancer Discov 10:872–887 18. Kim T, Hong S, Lin Y et al (2016) Transcriptional repression of IRF7 by MYC is critical for type I interferon production in human pDC. J Immunol 197:3348–3359 19. Casey SC, Tong L, Li Y et al (2016) MYC regulates the antitumor immune response through CD47 and PD-L1. Science 352:227–231 20. Topper MJ, Vaz M, Chiappinelli KB et al (2017) Epigenetic therapy ties MYC depletion to reversing immune evasion and treating lung cancer. Cell 171:1284–1300.e1221 21. Kortlever RM, Sodir NM, Wilson CH et al (2017) Myc cooperates with Ras by programming inflammation and immune suppression. Cell 171:1301–1315.e1314 22. Beaulieu M-E, Jauset T, Masso´-Valle´s D et al (2019) Intrinsic cell-penetrating activity propels Omomyc from proof of concept to viable anti-Myc therapy. Sci Transl Med 11(484): eaar5012 23. Han H, Jain AD, Truica MI et al (2019) Smallmolecule MYC inhibitors suppress tumor growth and enhance immunotherapy. Cancer Cell 36:483–497.e415 24. Whitfield JR, Beaulieu ME, Soucek L (2017) Strategies to inhibit Myc and their clinical applicability. Front Cell Dev Biol 5:10 25. Gros A, Robbins PF, Yao X et al (2014) PD-1 identifies the patient-specific CD8(+) tumorreactive repertoire infiltrating human tumors. J Clin Invest 124:2246–2259 26. Simon S, Labarriere N (2017) PD-1 expression on tumor-specific T cells: friend or foe for immunotherapy? Onco Targets Ther 7: e1364828

Chapter 16 Generation of a Tetracycline Regulated Mouse Model of MYC-Induced T-Cell Acute Lymphoblastic Leukemia Wadie D. Mahauad-Fernandez, Kavya Rakhra, and Dean W. Felsher Abstract The tetracycline regulatory system provides a tractable strategy to interrogate the role of oncogenes in the initiation, maintenance, and regression of tumors through both spatial and temporal control of expression. This approach has several potential advantages over conventional methods to generate genetically engineered mouse models. First, continuous constitutive overexpression of an oncogene can be lethal to the host impeding further study. Second, constitutive overexpression fails to model adult onset of disease. Third, constitutive deletion does not permit, whereas conditional overexpression of an oncogene enables the study of the consequences of restoring expression of an oncogene back to endogenous levels. Fourth, the conditional activation of oncogenes enables examination of specific and/or developmental state-specific consequences. Hence, by allowing precise control of when and where a gene is expressed, the tetracycline regulatory system provides an ideal approach for the study of putative oncogenes in the initiation as well as the maintenance of tumorigenesis and the examination of the mechanisms of oncogene addiction. In this protocol, we describe the methods involved in the development of a conditional mouse model of MYC-induced T-cell acute lymphoblastic leukemia. Key words Tetracycline inducible, Reversible expression, Doxycycline, MYC On, MYC Off

1

Introduction The development of genetically engineered mouse models (GEMM) of cancer has been invaluable to the study of oncogenes in tumorigenesis [1, 2]. The development of these transgenic mice enabled the interrogation of the function of specific genes. The more recent development of conditional transgenic models has enabled the study of both the adult onset of oncogene activation that would be characteristic of most types of human neoplasia and the influence of the suppression of oncogene expression to study its role in the maintenance of a neoplastic phenotype. To augment the utility of conventional GEMMs, several strategies have been employed to provide conditional transgene expression: (1) the tetracycline regulatory system (Tet system) [3], (2) the

Laura Soucek and Jonathan Whitfield (eds.), The Myc Gene: Methods and Protocols, Methods in Molecular Biology, vol. 2318, https://doi.org/10.1007/978-1-0716-1476-1_16, © Springer Science+Business Media, LLC, part of Springer Nature 2021

297

298

Wadie D. Mahauad-Fernandez et al.

Cre-Lox system [4], (3) hormone regulated expression of oncogenes via estrogen receptor or ecdysone inducible system [5], (4) hormone-based estrogen receptor (ER)-tamoxifen system [6], and (5) Lac repressor IPTG inducible system [7]. Each system has unique advantages and disadvantages. The Tet system enables reversible expression of a transgene. The Cre-Lox approach allows for irreversible activation or inactivation of endogenous gene expression. In the ER-tamoxifen system, regulation of transgene activity occurs posttranslationally, allowing for induction in a graded and rapid manner. In this chapter, we describe the generation of a GEMM of human c-MYC-induced T-cell acute lymphoblastic leukemia (T-ALL) using the Tet system and discuss some of the unique advantages of this experimental system. The Tet system was developed by the laboratory of Dr. Hermann Bujard [3] by modifying genetic elements of the bacterial tetracycline resistance operon for use in mammalian cells [3]. This genetic system can be used to conditionally induce or suppress target gene expression. In the Tet-OFF version of the system, the tetracycline transactivating protein (tTA), consisting of the bacterial tet-repressor protein fused to the herpes simplex virus (HSV) VP16 transactivating domain, binds with high affinity to tet operator (tetO) sequences and activates expression of a downstream gene. In the absence of tetracycline or a tetracycline analog such as doxycycline, there is robust expression induced by tTA binding to tetO. When doxycycline is present, tTA can no longer bind the tetO sequences and gene expression is turned off. Conversely, the Tet-ON system utilizes a reverse tetracycline transactivating protein (rtTA); tetracyclines induce the ability of rtTA to bind to tetO resulting in induction of gene expression, whereas in the absence of tetracyclines gene expression is suppressed [8]. We have used both the Tet-OFF and Tet-ON versions of the Tet system to conditionally regulate oncogene expression (Fig. 1). The Tet-ON version of the system is useful to rapidly induce gene expression. The Tet-OFF version is most useful to enable the rapid shutdown of gene expression. The choice of which system to use is dictated by the length of time for which mice will be treated with tetracycline. For long-term tumor initiation studies, the Tet-OFF system allows for oncogene expression without requiring continuous administration of tetracycline, while for short-term studies, the Tet-ON system provides rapid induction of oncogene expression upon treatment with tetracycline. We used the Tet-OFF system to generate a transgenic mouse line in which our gene of interest, the human c-MYC oncogene, can be reversibly expressed [9]. The expression of human c-MYC is induced in the hematopoietic tissues of FVB/N mice and results in a disease resembling human T-cell acute lymphoblastic leukemia

Reversible Mouse Model of MYC Induced T-ALL

299

X Tissue specific promoter

Tetracycline transactivator

MYC ON (- doxycycline)

Tet-responsive promoter

Gene of interest

MYC OFF (+ doxycycline)

Fig. 1 The Tet-Off System. A transgenic mouse line that expresses the tetracycline transactivator (tTA) downstream of a tissue-specific promoter (Eμ-SRα) is crossed with a mouse line carrying the MYC oncogene downstream of a tetracycline sensitive promoter (tetO). The progeny of this cross now contains both transgenes. In the absence of doxycycline, tTA can bind to the tetO promoter turning on MYC expression. However, when doxycycline is present, tTA binds to doxycycline and undergoes a conformational change, preventing it from binding the tetO promoter and thus MYC expression is shutdown

(T-ALL). We discuss below how we characterized this model system [9]. Our protocol focuses on the application of the Tet system to regulate the human c-MYC oncogene in hematopoietic cells, but similar strategies can be used for the inducible expression of any gene of interest in other cellular lineages. The Tet system is a bi-transgenic system and here we will describe the generation of two transgenic mouse lines. One transgenic mouse line expresses the tetracycline transactivator (tTA) gene downstream of a tissue-specific promoter while the other carries the human c-MYC transgene downstream of a tTA/tetracycline-dependent (tetO) promoter (Fig. 1). The following protocols will be described below: (1) Generating Tet-O-MYC and EμSRα-tTA constructs, (2) In vitro validation of conditional expression of the tet-O-MYC construct, (3) Genotypic analysis of founders and progeny, (4) Identification of founders with Conditional Gene Expression, (5) Mouse necroscopy and sample collection, (6) FACS analysis of primary tumor to identify the phenotype of cells comprising the tumor, (7) Generating cell lines from primary tumor tissue, (8) Evaluating conditional expression of Tet system in vivo, and (9) In vivo tumor transplantation studies.

300

2

Wadie D. Mahauad-Fernandez et al.

Materials

2.1 Generation of the Tet-O-MYC and EμSRα-tTA Constructs

1. c-Myc pSP65 plasmid (received from M. Bishop). 2. pUHD10-3 (received as a gift from H. Bujard). 3. pUHD15-1 (received as a gift from H. Bujard). 4. EμSRα plasmid (received as a gift from J. Adams). 5. EcoRI, BamH1, XhoI, HindIII, and NotI enzymes. 6. T4 DNA ligase. 7. Klenow fragment of DNA polymerase. 8. 1% and 0.8% agarose gel. 9. Standard gel extraction kit (i.e., Qiagen QIAEX II gel extraction kit).

2.2 In Vitro Validation of Conditional Expression of the Tet-O-MYC Construct

1. 20 ng/ml doxycycline hydrochloride in cell growth medium.

2.3 Genotypic Analysis of Founders and Progeny

1. 10 mg/ml proteinase K.

2. Mammalian cell lines with optimized expression of either tTA or rtTA, CHO-tTA, and HELA-tTA.

2. 1
digestion buffer: Mix 5 ml of 1 M Tris–HCl pH 8.0, 20 ml of 0.5 M ethylenediaminetetraacetic acid (EDTA), 2 ml of 5 M NaCl, 10 ml of 10% sodium dodecyl sulfate (SDS), and 63 ml sterile distilled water. 3. 1
TE buffer: Mix 10 ml of 1 M Tris–HCl pH 7.5, 2 ml of 0.5 M EDTA pH 8.0, and 988 ml of sterile distilled water. 4. 100% ethanol. 5. 70% ethanol. 6. Primer sequences to identify the tet-O-MYC founders: MYC1: 50 -TAG TGA ACC GTC AGA TCG CCT G-30 . MYC2: 50 -TTT GAT GAA GGT CTC GTC GTC C-30 . 7. Primer sequences to identify the EμSRαtTA founders: EμSRαtTA1: 50 -CCT AAC TCC GCC CAG TTC C-30 . EμSRαtTA2: 50 -GTA ACG GCG CAG AAC AGA A-30 . 8. PCR mixture used for genotyping: l

Template DNA.

l

Primer Mix.

l

Taq DNA polymerase (5 U/μl).

l

dNTP mixture (10 mM).

l

QIAGEN PCR buffer (10
).

Reversible Mouse Model of MYC Induced T-ALL l

301

Autoclaved distilled water. Details are provided in Subheading 3.

9. DNA loading buffer. 10. 1% agarose gel. 11. Ethidium bromide. 2.4 Identification of Founders with Conditional Gene Expression

1. 1
phosphate buffer saline (PBS). 2. 100 μg/ml filter-sterilized solution of doxycycline hydrochloride in PBS. 3. Needles. 4. Syringes. 5. 100 μg/ml solution of doxycycline hydrochloride in the drinking water.

2.5 Mouse Necroscopy and Sample Collection

1. Dissection scissors. 2. Styrofoam board. 3. 70% ethanol. 4. 10% neutral buffered formalin. 5. Optimal cutting temperature (OCT) freezing medium. 6. Liquid nitrogen.

2.6 FACS Analysis of Primary Tumor to Identify the Phenotype of Cells Comprising the Tumor

1. 100 μm cell strainers. 2. 50 ml conical tubes. 3. PBS. 4. Hemocytometer. 5. FACS buffer: 2% bovine serum albumin in PBS. 6. FACS tubes. 7. Fluorescently labeled antibody for various markers of hematopoietic cells such as cluster of differentiation 3 (CD3), CD4, CD8, CD19, Mac1 (CD11b/CD18), and Gr1 (Ly-6G/Ly6C). 8. Flow cytometer.

2.7 Generating Cell Lines from Primary Tumor Tissue

1. Ice-cold and filter-sterilized or autoclaved PBS. 2. RPMI-1640 medium. 3. RPMI-1640 medium with 20% fetal bovine serum (FBS): Mix 500 ml of RPMI 1640, 100 ml of FBS, 5 ml of penicillinstreptomycin (100
) and 0.55 ml of β-mercaptoethanol. 4. Incubator at 37  C and 5% CO2. 5. Freezing medium: Mix 45 ml of heat-inactivated FBS and 5 ml dimethyl sulfoxide (DMSO).

302

Wadie D. Mahauad-Fernandez et al.

2.8 Evaluating Conditional Expression of Tet System In Vivo

1. Cell culture six-well plates.

2.9 In Vivo Tumor Transplantation Studies

1. Hemocytometer.

2. 20 ng/ml of doxycycline.

2. Cold sterile PBS. 3. Electric shaver or depilatory cream. 4. 27-G needles. 5. Syringes.

3

Methods

3.1 Generation of the Tet-O-MYC and EμSRα-tTA Constructs 3.1.1 Preparation of the Tet-O-MYC Transgenic Construct

3.1.2 Preparation of the EμSRα-tTA Transgenic Construct

1. Set up a restriction digest of MYC-containing pSP65 plasmid (made in Michael Bishop’s laboratory) using EcoRI. Resolve the digested DNA on a 1% agarose gel and purify the 1.4 kb fragment corresponding to human c-MYC cDNA using a standard gel extraction kit. Also digest pUHD10-3 with EcoRI and purify the linearized plasmid. 2. Ligate the purified 1.4 kb c-MYC fragment from pSP65 into the linearized pUHD10-3 using T4 DNA ligase, generating pUHD10-3-c-MYC (see Fig. 2a for plasmid map). 1. Set up a double digest of pUHD15-1 with EcoRI and BamHI. Resolve the digested DNA on a 1% agarose gel and purify the 1 kb fragment containing the tTA coding sequence. Generate blunt ends by treating the tTA fragment with the Klenow fragment of DNA polymerase. Also digest the EμSRα plasmid with EcoRV. Resolve the digested DNA on a 1% agarose gel and purify the linearized plasmid using a standard gel extraction kit. 2. Ligate the 1 kb blunted tTA fragment into the linearized EμSRα plasmid using T4 DNA ligase, generating EμSRα-tTA (see Fig. 2b for plasmid map).

3.1.3 To Prepare the Transgenic Constructs for Microinjection

1. Set up a digest of 50 μg of pUHD10-3-c-MYC plasmid with XhoI and HindIII, and a separate digest of 50 μg of EμSRα-tTA with NotI. Resolve the digested DNA on a 0.8% agarose gel. From the pUHD10-3-c-MYC digest, excise the 2.37 kb fragment containing the tet-O-MYC sequence, and from the EμSRα-tTA digest, excise the 3.7 kb fragment containing the EμSRα-tTA sequence. Purify each fragment using a standard DNA purification kit. 2. Microinjection is a specialized procedure usually carried out by a transgenic animal facility. Details of a standard microinjection protocol are outlined in [10].

Reversible Mouse Model of MYC Induced T-ALL

303

Fig. 2 Plasmids used to generate transgenic mice. (a) The human c-MYC cDNA is excised from the pSP65 plasmid and cloned into the pUHD-10-3 plasmid downstream of the tetO promoter. (b) The tTA fragment is excised from plasmid pUHD15-1 and cloned downstream of the SR-α promoter in the Eμ-SRα plasmid 3.2 In Vitro Validation of Conditional Expression of the Tet-O-MYC Construct

Prior to the use of the constructs for the generation of transgenic mice, it is critical to ascertain that their conditional expression can be regulated by doxycycline. There are several commercially available mammalian cell lines with optimized expression of either tTA or rtTA for the purpose of testing your tet-responsive construct including CHO-tTA and HELA-tTA. In vitro validation involves transfection of a tTA/rtTA-expressing cell line with your tetO plasmid and a gene of interest in the presence and absence of doxycycline and assessing both mRNA and protein levels of your gene using quantitative real-time PCR and Western blotting, respectively. Transcriptional downregulation will be very rapid (within 4 h), while the downregulation of protein levels will mainly depend on the natural turnover of the protein. MYC protein has an extremely short half-life of 20–30 min [11] (see Note 1).

3.3 Genotypic Analysis of Founders and Progeny

The tet-O-MYC and EμSRαtTA founders will be identified by a PCR-based screening assay using DNA isolated from the tails of transgenic mice as described below. 1. When mice are between 15 and 20 days of age, use a pair of dissection scissors to cut the ends of their tails (0.4–0.6 cm) that are placed in a previously labeled 1.5 ml centrifuge tube. After the tail is cut, control the bleeding at the end of the tail by applying pressure or rubbing the tail in styptic powder (see Notes 2 and 3). 2. Add 600 μl of digestion buffer and 25 μl of proteinase K (10 mg/ml) to each tube containing a single tail biopsy. 3. Incubate the tubes containing a clipping of the tails for approximately 6 h at 55  C with constant shaking or rotation until tissue is completely homogenized.

304

Wadie D. Mahauad-Fernandez et al.

4. After this incubation, spin tubes for 15 min at full speed in a centrifuge to obtain a clear supernatant. 5. Transfer 500 μl of the supernatant into a centrifuge tube containing 1 ml of absolute ethanol at room temperature. 6. Gently invert the tubes several times. Precipitation of DNA should be visible as white transparent strands. 7. Spin the tubes briefly (15 s) in the centrifuge and discard the supernatant. 8. Add 400 μl of 70% ethanol, spin briefly again, and discard the supernatant. 9. Dry the DNA pellets by leaving the centrifuge tubes with their caps open for 10 min at room temperature. 10. Dissolve the DNA in 200 μl of TE buffer. 11. Use this DNA to perform PCR assays to check for the presence or absence of tTA and human c-MYC. Use the primers MYC1 and MYC2 (sequences are provided in Subheading 2.3) to identify the tet-O-MYC founders and the primers EμSRαtTA1 and EμSRαtTA2 (sequences are provided in Subheading 2.3) to identify the EμSRαtTA founders. The size of the amplicon is 450–500 and 421 bp, respectively. The PCR and the PCR cycle conditions used for genotyping are described below. PCR mixture used for genotyping: Component

Volume (μl)

Template DNA

1

Primer mix (10 μM each)

0.5 (X2)

Taq DNA polymerase (5 U/μl)

0.15

dNTP mixture (10 mM)

0.5

Qiagen PCR buffer (10
)

2.5

Autoclaved distilled water

20

PCR cycle conditions for genotyping: Step 1: 94  C for 3 min. Step 2: 94  C for 30 s (Denature). Step 3: 51  C for 35 s (Anneal). Step 4: 72  C for 35 s. Step 5: Cycle steps 2–5 35 times. Step 6: 72  C for 5 min (Extend). Step 7: 4  C for 99 h (End Hold).

Reversible Mouse Model of MYC Induced T-ALL

305

12. Once the PCR is complete, add DNA loading buffer to the samples and run them on a 1% agarose gel containing ethidium bromide to detect the appropriate PCR products. Based on the results of the genotyping, the correct founders must be chosen for each transgene, tet-O-MYC and EμSRαtTA. The founders that are chosen for breeding must express the transgenic protein and have the ability to pass on the transgene to their progeny. 3.4 Identification of Founders with Conditional Gene Expression

1. Obtain the appropriate founders and establish stable breeding lines. 2. Cross the tet-O-MYC mice with the EμSRαtTA mice to obtain a progeny that possesses both the transgenes that are necessary to mate male and female pairs of mice each with one of the Tet system transgenes. When using the Tet-Off version of the system, the Tet-regulated transgene (in this case MYC) is expressed in the absence of tetracycline or its derivatives like doxycycline. Notably, constitutive activity of a transgene in some tissues can be associated with rapid disease onset. Indeed, we have noted that constitutive expression of MYC in the liver is associated with rapid mortality due to liver cancer. Hence, it is important that mice are carefully observed at least twice a week for signs of disease such as ruffled fur, lethargy, hunched posture, and loss of appetite. Constitutive expression of MYC in the hematopoietic compartments is associated with neoplastic disease onset as early as 8 weeks and in all mice by 12 weeks of age. Tumor formation due to MYC overexpression is apparent in the increased size of lymphoid organs such as the thymus, spleen, and lymph nodes (see Fig. 3a, MYC ON). Enlargement of the liver was also seen in about 10% of mice due to infiltration of tumor cells. The mice succumbed to invasive tumors within 5 months of age. 3. Rapidly turn off MYC expression in transgenic mice by injecting intraperitoneally (i.p.) 100 μl of a 100 μg/ml filtersterilized solution of doxycycline hydrochloride in PBS. 4. Maintain doxycycline dosing through oral administration of a 100 μg/ml solution of doxycycline hydrochloride in the drinking water (see Notes 4 and 5). 5. After treatment with doxycycline, mice with tumors will begin to show evidence for regression within 2 days with full recovery within 1 week (see Fig. 3b, MYC OFF). In some cases, especially in mice with very large tumor burden, the rapid regression of tumors is associated with tumor lysis syndrome and mice rapidly die.

306

Wadie D. Mahauad-Fernandez et al.

A)

B)

MYC ON

MYC OFF

Thymus

Liver Spleen

Lymph nodes 10 mm

10 mm

Fig. 3 Gross pathological phenotype of transgenic mice during MYC-driven tumorigenesis (MYC ON) and following MYC inactivation (MYC OFF). Gross pathology images of thymi, livers, spleens, and lymph nodes from 3-month-old tet-O-MYC X EμSRαtTA mice that were treated with (a) a vehicle control (Water, MYC ON) or (b) doxycycline (MYC OFF) in drinking water for 4 days. Scale bar ¼ 10 mm. Mouse cartoon on the left depicts the anatomic location of these lymphoid organs. Doxycycline addition results in rapid tumor regression in tetO-MYC X EμSRαtTA mice 3.5 Mouse Necropsy and Sample Collection

When mice are moribund with tumor, they can be euthanized through carbon dioxide asphyxiation, and necropsies can be performed to analyze the characteristics of the MYC-induced tumorigenesis. After euthanasia: 1. Pin all four extremities of the mouse to a Styrofoam board and spray down with 70% ethanol to avoid contamination of the murine tissues that will be harvested. 2. Use dissection scissors to cut the mouse from the pubis till the neck in a vertical line through the middle of the body. 3. Cut open the peritoneal cavity to display the organs in the thorax and abdomen. 4. Lymphomas cause enlargement of organs including the spleen, lymph nodes, thymus, and liver (see Fig. 3a). 5. From each organ, remove the tumors and cut them into pieces that are about 5 mm
5 mm in size. Fix one piece in 10% neutral buffered formalin overnight to make paraffinembedded blocks. Tissue sections from these blocks can be used to perform hematoxylin and eosin (H&E) staining to study tissue morphology or to perform immunohistochemistry. One of the tumor pieces should be frozen in an embedding

Reversible Mouse Model of MYC Induced T-ALL

307

compound such as optimal cutting temperature (OCT) freezing medium and frozen at 80  C to preserve the antigen integrity of the tissue so that it can be stained to study the expression of different proteins of interest via immunofluorescence or other methods. Pieces of tumor about 2 mm
2 mm in size are also flash-frozen in liquid nitrogen and stored at 80  C for PCR and Western blotting analysis in the future. Tumors that arise spontaneously from a mouse are referred to as primary tumors for the rest of this chapter, to distinguish them from tumors that will be obtained from cell lines derived from primary tumors. 3.6 FACS Analysis of Primary Tumor to Identify the Phenotype of Cells Comprising the Tumor

1. Gently crush a piece of the tumor tissue obtained from the mouse necropsy in between the ends of two frosted glass slides or by using the back of a syringe plunger to pass the tumor pieces through a 100 μm cell strainer in a 50 ml conical tube. 2. Wash these cells with 30 ml of PBS. 3. Count the cells using a hemocytometer and make a cell suspension of 107/ml in FACS buffer (PBS with 2% bovine serum albumin). This serves as a blocking buffer while staining the cells with FACS antibodies. 4. For each antibody being used, mix 100 μl of this cell suspension (~1
106 cells) with 1 μl of fluorescently labeled antibody solution in a FACS tube. For MYC-induced lymphomas, we typically stain for various markers of hematopoietic cells, (e.g., CD3, CD4, CD8, CD19, Mac1, and Gr1) to identify the specific lineage and differentiation stage of the tumor. 5. Incubate for 20 min at 4  C protected from light to prevent the fluorescent label of the FACS antibodies from photobleaching. 6. Wash the cells in FACS buffer twice and centrifuge the cells at 300
g and discard the supernatant. 7. Resuspend the cell pellet in 500 μl of PBS and run the sample on a flow cytometer. More than 80% of the tumors we analyze are immature CD4+CD8+ T-cell lymphomas also positive for Thy1, CD3, and CD5. However, rare tumors arise from the myeloid lineage and stain positive for Gr1 and Mac1 surface markers. Also, introduction of other genetic events can be associated with a change in the phenotype of the resulting tumors suggesting that it is important to characterize multiple tumors to study the consequence of ectopic oncogene overexpression (see Note 6).

3.7 Generating Cell Lines from Primary Tumor Tissue

Here we describe a protocol to develop cell lines from T-cell lymphomas. This protocol is adapted from T cell Protocols found in [12]. For many experimental purposes, it is useful to generate

308

Wadie D. Mahauad-Fernandez et al.

tumor-derived cell lines. We have found that these lines can be readily generated and that they continue to conditionally express the MYC oncogene as regulated by the Tet system. 1. Dissect tumor pieces from the necropsy of a tet-O-MYC X EμSRαtTA mouse in which MYC has been turned on from birth and lymphomas have developed (this will occur at around 6–8 weeks of age). 2. Wash these tumor pieces several times with ice-cold and filtersterilized or autoclaved PBS. 3. Cut the tumor piece into several small pieces (1–2 mm) and transfer them into a tissue culture plate with 5 ml of complete RPMI-1640 medium with 20% FBS. 4. Transfer the tumor pieces and the medium into a 15 ml centrifuge tube and add complete RPMI-1640 medium to make up the volume to 13 ml. Place this tube in a stand and allow the tumor pieces to settle for 2–3 min. 5. Once tumor pieces have settled to the bottom of the tube, the free-floating cells remain in suspension, which will become turbid. Remove the turbid suspension without disturbing the settled tumor tissue. 6. Add 13 ml of complete RPMI-1640 medium to the tube and gently shake it to allow the tumor pieces to settle once again and remove the cells in suspension. 7. Repeat this process (4–5 times) until the medium appears clear after shaking with the tumor pieces. 8. Remove the tumor pieces from the bottom of the tube with the remaining medium and transfer these into a 25 cm2 sterile tissue culture flask. Rinse out the tube with 5 ml of complete RPMI-1640 medium twice and add this medium to the flask. 9. Transfer the flask into an incubator at 37  C and 5% CO2 and observe the flask carefully for the next few days. A layer of adherent cells will form along with some cells in suspension as well. Replace 50% of the medium in the flask as it turns acidic or yellow in color. 10. After 2–4 weeks, you will observe tumor cells growing in suspension as clumps. These cells can be split into fresh medium by taking 1 ml of these cells and transferring them into a new flask containing 10 ml complete RPMI-1640 medium. Once cell lines have been adapted to growth in vitro, they can be maintained using complete RPMI medium containing 10% FBS. 11. Once in vitro cell line growth has been achieved, freeze down aliquots of cells after they have reached the late log phase of growth. Cells are frozen at a density of 6–10
106 cells/ml in

Reversible Mouse Model of MYC Induced T-ALL

309

10% DMSO in heat-inactivated FBS and store at 80  C. The frozen vials can be stored in liquid nitrogen for long-term storage. This is the first passage of the new lymphoma cell line. 3.8 Evaluating Conditional Expression of Tet System In Vivo

Once a lymphoma cell line is generated from tumor bearing tet-OMYC X EμSRαtTA mice, it is imperative to check whether or not these tumor cell lines express MYC and to test whether MYC expression in these cell lines is inducible to confirm that the tumor generated in the mouse was indeed due to MYC expression using the Tet system. 1. From a cell line grown in vitro, set up a seed culture of 6 ml at a density of 100,000 lymphoma cells per ml in all the wells of two 6-well plates. 2. To generate samples in triplicate, in nine of these wells (six from one plate and three from the other plate), add 20 ng/ml of doxycycline. In the remaining three wells, add the same volume of medium as a control. At various time points after the addition of doxycycline (4, 8, 12, 24, and 48 h), spin down the cells from each of three wells treated with doxycycline and snapfreeze the pellets in liquid nitrogen before storing at 80  C. Similarly, pellet out cells from the three untreated wells as samples for the 0-h time point. 3. Perform PCR and Western blotting on the samples generated to check for the expression of the human c-MYC gene and protein to test whether its expression is inhibited by doxycycline treatment.

3.9 In Vivo Tumor Transplantation Studies

To further study the behavior of a single primary tumor in vivo, cell lines obtained from the primary tumor using the protocol described above are transplanted into mice subcutaneously. 107 tumor cells are injected underneath the skin of a shaved area on the back of the mouse. 1. Count in vitro passaged cell line using a hemocytometer. 2. Measure out the appropriate volume of your required cell culture and centrifuge to spin down the cells at 300
g for 5 min. 3. Decant the supernatant without disturbing the cell pellet. Resuspend the cell pellet in ice-cold sterile PBS. Centrifuge this at 300
g rpm for 5 min and repeat this wash twice. 4. After the last wash, resuspend the cell pellet in ice-cold sterile PBS at a concentration of 108 cells per ml. 5. Before injecting these cells, shave a small area on the back of the mouse using an electric shaver or a depilatory cream. Load this cell suspension into a syringe with a 27-G needle and inject 100 μl into the subcutaneous space on the shaved back of the mouse (see Note 7).

310

Wadie D. Mahauad-Fernandez et al.

The tumor will grow to a size of 1 cm
1 cm within 9–14 days. Once the tumors have been established, mice can be treated with doxycycline orally or intraperitoneally as described before to test for responsiveness to doxycycline and to carry out further studies in vivo. Subcutaneous tumors can be harvested like the primary tumors described above. The initial characterization of this transgenic model is described in [9]. This model has been used to test how tumor cells behave in vivo when MYC is turned off, how the oncogenic potential of MYC varies at different stages of development, how to titrate the amount of MYC required to initiate tumorigenesis [13], how to evaluate the influence of MYC expression on the regulation intracellular pathways [14, 15], how to study the involvement of immune cells in the mechanisms of tumor regression following MYC inactivation [16, 17], and how to test the mechanisms of collaboration of multiple oncogenes in cancer progression and metastasis [18]. Similar strategies can be used to reversibly express MYC in various tissues such as liver [19], bone [20], and other tissues of interest depending on the tissue specific promoter/ enhancer elements used. Similarly, other conditional mouse models can help understand the nuanced role of oncogenes in tumor initiation and discover new phenomena like oncogene addiction.

4

Notes 1. Our experience for many different constructs is that we observe significant downregulation of protein levels within 2–4 h after addition of doxycycline. 2. It is preferable to perform tail biopsies in young mice since they yield more DNA. If they are being performed in older mice, the use of anesthesia is recommended. 3. Make sure that instruments are cleaned thoroughly with ethanol and/or chlorhexidine when moving from one mouse to the next as DNA from one sample might contaminate other samples and yield erroneous PCR genotyping results. 4. As doxycycline hydrochloride is sensitive to light, amber drinking water bottles must be used to administer doxycycline orally and must be replaced every week. Alternatively, mouse chow with doxycycline is commercially available from some vendors. 5. Doxycycline stock solutions (20 mg/ml) can be prepared and stored at 20  C for up to 6 months at this temperature. Doxycycline solutions when stored at 4  C are stable for at least 2 weeks. 6. When the EμSRα construct is expressed upstream of c-MYC in the FVB/N strain of mice, MYC expression is restricted to

Reversible Mouse Model of MYC Induced T-ALL

311

T-cells and T-cell lymphomas arise [21]. In contrast, in the C57BL6 background, the tumors arise in B-cells. 7. To inject cells subcutaneously in the mouse, make sure to prepare an excess volume of cells to account for loss of cells in the syringe. For example, to inject five mice, make up at least 700 μl of cell suspension for injection.

Acknowledgments We would like to thank Peter Choi and members of the Felsher laboratory for the advice. The work described in this chapter was supported by the following grants to Dr. Dean Felsher: Burroughs Welcome Fund Career Award, the Damon Runyon Foundation Lilly Clinical Investigator Award, NIH RO1 grant number CA 089305, 105102, 208735, 184384, and U01CA188383, National Cancer Institute’s In-vivo Cellular and Molecular Imaging Center grant number CA 114747, Integrative Cancer Biology Program grant number CA 112973, NIH/NCI PO1 grant number CA034233, the Leukaemia and Lymphoma Society Translational Research grant number R6223-07. Dr. Wadie Mahauad-Fernandez is supported as a fellow of the Translational Research and Applied Medicine (TRAM) program at Stanford University. References 1. Politi K, Pao W (2011) How genetically engineered mouse tumor models provide insights into human cancers. J Clin Oncol 29:2273–2281 2. Sharpless NE, DePinho RA (2006) The mighty mouse: genetically engineered mouse models in cancer drug development. Nat Rev Drug Discov 5:741–754 3. Gossen M, Bujard H (1992) Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc Natl Acad Sci U S A 89:5547–5551 4. Utomo ARH, Nikitin AY, Lee WH (1999) Temporal, spatial of and cell type-specified control of cre-mediated DNA recombination in transgenic mice. Nat Biotechnol 17:1091–1096 5. No D, Yao TP, Evans RM (1996) Ecdysoneinducible gene expression in mammalian cells and transgenic mice. Proc Natl Acad Sci U S A 93:3346–3351 6. Littlewood TD, Hancock DC, Danielian PS, Parker MG, Evan GI (1995) A modified oestrogen receptor ligand-binding domain as an improved switch for the regulation of

heterologous proteins. Nucleic Acids Res 23:1686–1690 7. Cronin CA, Gluba W, Scrable H (2001) The lac operator-repressor system is functional in the mouse. Genes Dev 15:1506–1517 8. Zhou X, Vink M, Klaver B, Berkhout B, Das AT (2006) Optimization of the Tet-On system for regulated gene expression through viral evolution. Gene Ther 13:1382–1390 9. Felsher DW, Bishop JM (1999) Reversible tumorigenesis by MYC in hematopoietic lineages. Mol Cell 4:199–207 10. Cho A, Haruyama N, Kulkarni AB (2009) Generation of transgenic mice. Curr Protoc Cell Biol. Chapter 19, Unit 19.11 11. Hann SR, Eisenman RN (1984) Proteins encoded by the human c-myc oncogene: differential expression in neoplastic cells. Mol Cell Biol 4:2486–2497 12. Jinadasa R, Balmus G, Gerwitz L, Roden J, Weiss R, Duhamel G. Derivation of thymic lymphoma t-cell lines from atm-/- and p53-/- mice. J Vis Exp. 2011;(50) 13. Shachaf CM, Gentles AJ, Elchuri S, Sahoo D, Soen Y, Sharpe O, Perez OD, Chang M,

312

Wadie D. Mahauad-Fernandez et al.

Mitchel D, Robinson WH, Dill D, Nolan GP, Plevritis SK, Felsher DW (2008) Genomic and proteomic analysis reveals a threshold level of MYC required for tumor maintenance. Cancer Res 68:5132–5142 14. Li Y, Choi PS, Casey SC, Dill DL, Felsher DW (2014) MYC through miR-17-92 suppresses specific target genes to maintain survival, autonomous proliferation, and a neoplastic state. Cancer Cell 26:262–272 15. Gouw AM, Margulis K, Liu NS, Raman SJ, Mancuso A, Toal GG, Tong L, Mosley A, Hsieh AL, Sullivan DK, Stine ZE, Altman BJ, Schulze A, Dang CV, Zare RN, Felsher DW (2019) The MYC oncogene cooperates with sterol-regulated element-binding protein to regulate lipogenesis essential for neoplastic growth. Cell Metab 30:556–572 16. Casey SC, Tong L, Li Y, Do R, Walz S, Fitzgerald KN, Gouw AM, Baylot V, Gu¨tgemann I, Eilers M, Felsher DW (2016) MYC regulates the antitumor immune response through CD47 and PD-L1. Science 352:227–231 17. Swaminathan S, Heftdal L, Liefwalker D, Dhanasekaran R, Deutzmann A, Horton C, Mosley A, Liebersbach M, Maecker HT, Felsher DW (2018) MYC functions as a switch

for natural killer cell-mediated immune surveillance of lymphoid malignancies. bioRxiv 503086. https://doi.org/10.1101/503086 18. Dhanasekaran R, Baylot V, Kim M, Kuruvilla S, Bellovin DI, Adeniji N, Rajan Kd A, Lai I, Gabay M, Hu T, Barbhuiya MA, Gentles AJ, Kannan K, Tran PT, Felsher DW (2020) MYC and Twist1 cooperate to drive metastasis by eliciting crosstalk between cancer and innate immunity. Elife 9:e50731 19. Shachaf CM, Kopelman AM, Arvanitis C, Karlsson A, Beer S, Mandl S, Bachmann MH, Borowsky AD, Ruebner B, Cardiff RD, Yang Q, Bishop JM, Contag CH, Felsher DW (2004) MYC inactivation uncovers pluripotent differentiation and tumour dormancy in hepatocellular cancer. Nature 431:1112–1117 20. Jain M, Arvanitis C, Chu K, Dewey W, Leonhardt E, Trinh M, Sundberg CD, Bishop JM, Felsher DW (2002) Sustained loss of a neoplastic phenotype by brief inactivation of MYC. Science 297:102–104 21. Kemp DJ, Harris AW, Cory S, Adams JM (1980) Expression of the immunoglobulin Cμ gene in mouse T and B lymphoid and myeloid cell lines. Proc Natl Acad Sci U S A 77:2876–2880

Chapter 17 Chromogenic In Situ Hybridization (CISH) as a Method for Detection of C-Myc Amplification in Formalin-Fixed Paraffin-Embedded Tumor Tissue: An Update Natasˇa Todorovic´-Rakovic´ Abstract In situ hybridization (ISH) allows evaluation of genetic abnormalities, such as changes in chromosome number, chromosome translocations, or gene amplifications, by hybridization of tagged DNA (or RNA) probes with complementary DNA (or RNA) sequences in interphase nuclei of target tissue. However, chromogenic in situ hybridization (CISH) is also applicable to formalin-fixed, paraffin-embedded (FFPE) tissues, besides metaphase chromosome spreads. CISH is similar to fluorescent in situ hybridization (FISH) regarding pretreatments and hybridization protocols but differs in the way of visualization. Indeed, CISH signal detection is similar to that used in immunohistochemistry, making use of a peroxidase-based chromogenic reaction instead of fluorescent dyes. In particular, tagged DNA probes are indirectly detected using an enzyme-conjugated antibody targeting the tags. The enzymatic reaction of the chromogenic substrate leads to the formation of strong permanent brown signals that can be visualized by bright-field microscopy at 40 magnification. The advantage of CISH is that it allows the simultaneous observation of gene amplification and tissue morphology, and the slides can be stored for a long time. Key words c-myc amplification, Chromogenic in situ hybridization (CISH)

1

Introduction c-myc is involved in cell growth and proliferation, as a sequencespecific DNA-binding protein, transcription factor which manifests its effects through transcriptional modulation acting as a activator or repressor of main biological processes [1]. The frequency of MYC amplification in different types of cancer is estimated at approximately 14% [2, 3], which makes it relatively common cancer alteration [4]. Its potential as prognostic and/or predictive marker is investigated in a clinical practice [5–10], but rigorous studies with consistent methodologies are needed. The widely used methods for the evaluation of c-myc amplification in cancer are chromogenic in situ hybridization (CISH) and fluorescence in situ hybridization (FISH). Comparative analysis between these two

Laura Soucek and Jonathan Whitfield (eds.), The Myc Gene: Methods and Protocols, Methods in Molecular Biology, vol. 2318, https://doi.org/10.1007/978-1-0716-1476-1_17, © Springer Science+Business Media, LLC, part of Springer Nature 2021

313

314

Natasˇa Todorovic´-Rakovic´

methods was well presented by Hsi et al. [11]. Although well correlated, both the methods have their distinct advantages. However, CISH is emerging as a practical, cost-effective, and valid alternative to FISH in testing different kinds of genetic alterations [12]. In a study by Rummukainen and colleagues [13], for example, c-myc amplification by CISH yielded a stronger association with survival, in comparison to FISH. The authors suggested that the better survival stratification by CISH was attributed to the high sensitivity of the probe detection, excellent visibility of the gene copy signals, and, in particular, the possibility to restrict the copy number counting to cells that are truly malignant by morphologic criteria. Recent studies also confirm the superiority of CISH method compared to FISH and immunohistochemistry also, indicating its higher effectiveness, specifity, and sensibility [14–19]. Moreover, a combination of IHC and CISH assays (gene-protein assay, GPA) were developed to study the relationship between gene status and protein expression on the same tissue section, and more importantly, these applications can be optimized using an automated tissue slide processing system to generate reproducible results [20]. Here we present a CISH protocol specific for detection of c-myc amplification. The protocol for CISH detection of c-myc amplification represented here is adapted, with minor modifications, from the manufacturer’s instructions of the Spot Light CISH polymer detection kit (Zymed/Invitrogen) for detection of digoxigenin-labeled probes on formalin-fixed paraffin-embedded tissue sections. The Zymed Spot Light c-myc probe is a doublestranded digoxigenin-labeled probe in hybridization buffer and binds specifically the c-myc gene locus on chromosome band 8q24.12–8q24.13. In this probe, repetitive sequences have been removed by Zymed SPT™ technology, so that such probe does not require repetitive sequence blocking.

2

Materials 1. Deionized water. 2. Xylene. 3. 70%, 85%, 95%, and 100% ethanol. 4. 30% hydrogen peroxide. 5. 100% methanol. 6. 50% Tween 20. 7. 20 SSC buffer: 3 M NaCl, 0.3 M sodium citrate. 8. PBS:10 mM phosphate-buffered saline, pH 7.4. 9. 0.025%Tween/PBS: 0.025% Tween 20 in PBS.

CISH for C-Myc Amplification Detection

315

10. Heat pretreatment solution: Tris-EDTA buffer, ready-to-use reagent from Zymed/Invitrogen. 11. Enzyme: pepsin solution with 0.05% sodium azide and detergent, ready-to-use reagent from Zymed/Invitrogen. 12. Formamide. 13. Denaturation buffer: for 100 ml mix 10 ml 20 SSC, 20 ml deionized water, and 70 ml formamide. 14. Quenching solution: 3% hydrogen peroxide in absolute methanol. 15. Superfrost slides. 16. UnderCover slips or coverslips with rubber cement. 17. Spot-Light c-myc probe (Zymed/Invitrogen). 18. Spot-Light CISH polymer detection kit (Zymed/Invitrogen): (a) CAS Block (reagent containing buffer, stabilizer and 0.01% sodium azide, ready to use). (b) Mouse anti digoxigenin antibody (containing BSA, buffer, and 0.1% sodium azide, ready to use). (c) Goat anti-mouse HRP polymer conjugate (containing stabilizer, buffer, 0.005% gentamycin sulfate, and 0.1% Proclin 300, ready to use). (d) DAB (20) concentrated chromogen solution. (e) Histomount (mounting solution). 19. Mayer hematoxylin (Invitrogen).

3

Methods

3.1 CISH Procedure (See Also Note 1)

Preparation of formalin-fixed paraffin-embedded slides: Tissue sections should be fixed in 10% neutral buffered formalin up to 48 hrs prior to paraffin embedding. The optimal tissue section thickness is 4 μm on SuperFrost/Plus microscope slides. Bake slides for 4 h at 60  C and dry them at 37  C (or air-dry) overnight, prior to deparaffinization. Deparaffinization: Submerge slides in Xylene, 2  10 min (see Note 2); then put them in 100% ethanol, 3  3 min; finally, submerge them in deionized water, 3  3 min. Pretreatment and enzyme digestion: Heat the pretreatment solution in a glass on a hot plate at 98  C and cover it with aluminum foil to prevent evaporation (see Note 3); submerge slides in boiling solution, cover and boil for 15 min. After boiling, immerse slides in PBS (or deionized water), 2  3 min. Cover the tissue sections with enough enzyme solution (about 100 μl) and incubate at RT for 10–15 min (see Note 4). Finally, submerge slides in PBS (or deionized water), 2  3 min.

316

Natasˇa Todorovic´-Rakovic´

Dehydration: dehydrate slides in graded ethanol series (70%, 85%, 95%, 2  100%) for 2 min each. Air-dry. Store ethanol solutions in a freezer at 20  C for later use. Denaturation (see Note 5) could be done in two ways: (a) Concomitant denaturation: add 15 μl probe to the middle of the slide, seal with coverslip, and denature at 94–95  C in the slide block of a PCR machine or hot plate. Or (b) Prepare a Coplin jar with 100 ml of denaturation buffer and put it in a water bath at 78  C (this temperature is suitable for simultaneous work with four slides maximum). When the denaturation solution reaches 78  C, immerse slides and incubate for 5 min. At the same time, immerse tubes with aliquoted probes (15 μl) in a water bath under the same conditions (78  C for 5 min.). After denaturation, put the tubes with probe quickly on ice (to prevent renaturation). Slides should be dehydrated in cold ( 20  C) graded ethanol series (70%, 85%, 95%, 2  100%) for 2 min each and air-dried. Hybridization: add 15 μl probe to the central area of the tissue section or in the middle of the coverslip, then place the coverslip on the appropriate area covering the tissue section. Seal coverslip with rubber cement to prevent evaporation or, if using UnderCover slips, simply stick them to the tissue section and seal. Place slides in a humidifying chamber or in the slide block of PCR machine at 37  C overnight. Stringent wash (see Note 6): Prepare two Coplin jars with 0.5 SSC buffer, one at room temperature and the other in a water bath at 75  C. Carefully remove coverslips (or rubber cement). Immerse slides in the jar at room temperature for 5 min and, after that, in the jar at 75  C for 5 min. Wash in PBS (or deionized water). Immunodetection using Spot-Light CISH polymer detection kit (Invitrogen): Immerse slides for 10 min in peroxidase quenching solution. Wash in PBS or in 0.025% PBS/Tween 20, 3  2 min. Add enough CAS-block (blocking reagent for reducing nonspecific background staining) to cover the tissue section and incubate for 10 min at room temperature. Blot off the CAS block reagent. Add approximately 100 μl anti-digoxigenin (mouse) antibody to cover the tissue section and incubate for 30–45 min at room temperature. Wash in PBS or in 0.025% PBS/Tween 20, 3  2 min. Add approximately 100 μl of polymerized HRP-conjugated goat antimouse antibody and incubate at room temperature for 30–45 min. Wash in PBS or in 0.025% PBS/Tween 20, 3  2 min. Add enough DAB chromogen to cover tissue section (approximately 150 μl) and incubate at room temperature for 30 min. Wash under running tap water for 3 min. Cover tissue sections with hematoxylin incubate them for 5–10 s (see Note 7). Wash under running tap water for

CISH for C-Myc Amplification Detection

317

3 min. Dehydrate slides in graded ethanol series (70%, 85%, 95%, 2  100%) for 2 min each. Immerse in xylene, 2  2 min (see Note 8). Apply mounting solution before xylene evaporates. 3.2 Evaluation of Results

4

In CISH, the analysis of results requires bright-field microscopy. It is possible to easily distinguish signals by using 40 magnification, but for better identification of dots/clusters 100x magnification could be used as well. Typical signals appear as small, brown (DAB stained) discreet dots within the nucleus, or clusters, in which single dots cannot be counted. Scoring: Normal, diploid cells have usually one or two signals (brown dots); aneuploid cells might have less or more than two signals. The presence of more than five signals is considered to be the cutoff for amplification: the visualization of 6–10 dots or a small cluster per nucleus in >50% of cells is an indication of low amplification and of more than 10 dots or large clusters in >50% of cells is a sign of high amplification.

Notes 1. General rule: As pointed by Monteiro et al. [21] in the context of CISH assays, for which it is necessary that the tissue has been properly fixed (fixative pH, tissue fixation time, amount of time elapsed prior to sample fixation, storage conditions), allowing both the preservation of its genetic material and its cytoarchitecture, it is not always possible to have control over fixation of the tissue to be analyzed. Therefore, it is impossible to know if a negative result for a particular probe is due to the absence of the targeted sequence in the cells or due to tissue degradation. Formalin fixation leads to nucleic acid crosslinking to proteins and other cellular constituents, making it difficult to bind to complementary probes. Therefore, the recovery step, which allows the breaking of some of these bonds and precedes the binding with the probe, becomes very important. Moreover, poorly conserved genetic material may imply false-negative results, which could be avoided by using control probes, depending on the primary target being aimed for. 2. General rule: during the procedure, slides should not be allowed to dry, except after alcohol treatment. All reagents should be brought at room temperature before use. 3. Depending on tissue thickness and fixation, xylene treatment in deparaffinization section could be longer, up to 12 h before analysis. Longer xylene treatment is recommended for thicker samples. 4. Optimal heat pretreatment procedure is essential for the test. Inadequate heat pretreatment procedure, regarding time and

318

Natasˇa Todorovic´-Rakovic´

temperature could result in weak or no signal at all. Keep the temperature at 98–100  C for 15 min before starting. 5. Optimal enzyme digestion procedure is crucial for the test. Inadequate enzyme digestion procedure (excessive digestion or under-digestion) could result in weak or no signal at all or poor tissue morphology. If the samples are stored for years, stronger pretreatment of the tissue sections should be applied, by increasing the incubation periods proteases [22]. Depending on tissue thickness (optimal 4 μm), enzyme digestion time should be decreased or increased (up to 15 min). Different tissues may need different enzyme concentrations, if not “ready-to-use” enzyme solutions (pepsin, trypsin, proteinase K) are used. This also may vary depending on sample thickness and quality. Recent findings suggest that the treatment with trypsin in comparison with pepsin or proteinase K subsequent to heat treatment might improve CISH results, because trypsin has a substrate specificity to cleave lysine and arginine, and could effectively degrade histones rich in lysine and arginine and remove it from DNA [23]. Leong et al. even established protocol for CISH in which a microwave-induced target retrieval step is introduced as a replacement step for heat pretreatment and following enzyme digestion to produce consistent signals in amplified and nonamplified cells that are both larger in size and numbers when compared with those produced by the conventional protocol [24]. 6. Inadequate denaturation and hybridization time, due to shorter incubation and/or lower temperature, could result in weak or no signal and poor tissue morphology. Always check the temperature and be sure that it is maintained during the whole process. Be sure that humidity in the humidifying chamber is satisfactory. Alternatively, denaturation and hybridization steps could be done simultaneously (add sufficient probe to the section place coverslip and seal with rubber cement) with 95–98  C on PCR thermal cycler or 80–90  C on heating block for 5 min. 7. Stringent wash temperature should be properly adjusted according to the number of slides. Recommended temperature is 72  C for one slide. For each additional slide, the temperature should be increased by 1  C, up to a maximum temperature of 80  C. Stringent wash temperature under 70  C could cause background staining and stringent wash temperature exceeding 80  C could cause loss of signal. 8. Excessive hematoxylin counterstaining could result in poor signal evaluation. Best results are obtained when tissue is counterstained for 3–5 s. If you are not sure about time, check under microscope before applying coverslips.

CISH for C-Myc Amplification Detection

319

Acknowledgments This work was supported by the research Grant No. 175068 from the Fund for basic science of the Ministry of Education and Science of the Republic of Serbia. References 1. Evan GI, Littlewood TD (1993) The role of c-myc in cell growth. Curr Opin Genet Dev 3:44–49. https://doi.org/10.1016/S0959437X(05)80339-9 2. Ciriello G, Miller ML, Aksoy BA, Senbabaoglu Y, Schultz N, Sander C (2013) Emerging landscape of oncogenic signatures across human cancers. Nat Genet 45:1127–1133. https://doi.org/10.1038/ ng.2762 3. Zhang Y, Xu H, Frishman D (2016) Genomic determinants of somatic copy number alterations across human cancers. Hum Mol Genet 25:1019–1030. https://doi.org/10.1093/ hmg/ddv623 4. Deming SL, Nass SJ, Dickson RB, Trock BJ (2000) C-myc amplification in breast cancer: a meta-analysis of its occurrence and prognostic relevance. Br J Cancer 83:1688–1695 5. Masramon L, Arribas R, Tartola S, Perucho M, Peinado MA (1998) Moderate amplifications of the c-myc gene correlate with molecular and clinicopathological parameters in colorectal cancer. Br J Cancer 77:2349–2356 6. Augenlicht LH, Wadler S, Corner G, Richards C, Ryan L, Multani AS et al (1997) Low-level c-myc amplification in human colonic carcinoma cell lines and tumors: a frequent, p53-independent mutation associated with improved outcome in a randomized multi-institutional trial. Cancer Res 57:1769 7. Baker VV, Borst MP, Dixon D, Hatch KD, Shingleton HM, Miller D (1990) C-myc amplification in ovarian cancer. Gynecol Oncol 38:340–342 8. Mitani S, Kamata H, Fujiwara M, Aoki N, Tango T, Fukuchi K, Oka T (2001) Analysis of c-myc DNA amplification in non-small cell lung carcinoma in comparison with small cell lung carcinoma using polymerase chain reaction. Clin Exp Med 1:105–111 9. Rodriguez-Pinilla MS, Jones RL, Lambros MBK, Arriola E, Savage K, James M et al (2007) MYC amplification in breast cancer: a chromogenic in situ hybridisation study. Clin Pathol 60:1017–1023

10. Todorovic´-Rakovic´ N, Nesˇkovic´-Konstantinovic´ Z, Nikolic´-Vukosavljevic´ D (2011) C-myc as a predictive marker for chemotherapy in metastatic breast cancer. Clin Exp Med 12(4):217–223. https://doi.org/ 10.1007/s10238-011-0169-y 11. Hsi B-L, Xiao S, Fletcher JA (2003) Chromogenic in situ hybridization and FISH in pathology. Methods Mol Biol 204:343–351 12. Madrid MA, Lo RW (2004) Chromogenic in situ hybridization (CISH): a novel alternative in screening archival breast cancer tissue samples for HER-2/neu status. Breast Cancer Res 6:R593–R600 13. Rummukainen JK, Salminen T, Lundin J et al (2001) Amplification of c-myc oncogene by chromogenic and fluorescence in situ hybridization in archival breast cancer tissue array samples. Lab Investig 811:545–1551 14. Atabati H, Raoofi A, Amini A, Farahani RM (2018) Evaluating HER2 gene amplification using chromogenic in situ hybridization (CISH) method in comparison to immunohistochemistry method in breast carcinoma. Open Access Maced J Med Sci 6:1977–1981. https://doi.org/10.3889/oamjms.2018.455. eCollection 2018 15. Ali AHM, Yahya AQ, Mohammed HL (2019) Chromogenic in situ hybridization technique versus immunohistochemistry in assessment of HER2/neu status in 448 Iraqi patients with invasive breast carcinoma. Open Access Maced J Med Sci 7:1917–1925. https://doi.org/10. 3889/oamjms.2019.342. eCollection 2019 16. Sarli A, Mozdarani H, Rakhshani N, Mozdarani S (2019) Relationship study of the verified human epidermal growth factor receptor 2 amplification with other tumor markers and clinicohistopathological characteristics in patients with invasive breast cancer, using chromogenic in situ hybridization. Cell J 21:322–330. https://doi.org/10.22074/ cellj.2019.6219 17. Khaleghian M, Shakoori A, Razavi AE, Azimi C (2015) Relationship of amplification and expression of the C-MYC gene with survival among gastric cancer patients. Asian Pac J Cancer Prev 16:7061–7069

320

Natasˇa Todorovic´-Rakovic´

18. Khaleghian M, Jahanzad I, Shakoori A, Emami Razavi A, Azimi C (2016) Association between amplification and expression of C-MYC gene and clinicopathological characteristics of stomach cancer. Iran Red Crescent Med J 18: e21221. https://doi.org/10.5812/ircmj. 21221. eCollection 2016 Feb 19. Khaleghian M, Jahanzad I, Shakoori A, Ardalan FA, Azimi C (2015) Study of C-MYC amplification and expression in Iranian gastric cancer samples using CISH and IHC methods. Adv Biomed Res 4:116. https://doi.org/10.4103/ 2277-9175.157841. eCollection 2015 20. Nitta H, Kelly B (2019) Chromogenic tissuebased methods for detection of gene amplifications (or rearrangements) combined with protein overexpression in clinical samples. Methods Mol Biol 1953:301–314. https:// doi.org/10.1007/978-1-4939-9145-7_19 21. Monteiro RL, Damaceno DS, Kimura LM, Cirqueira CS, Guerra JM, Arau´jo LJT (2019)

Validation of chromogenic in situ hybridization reactions for DNA and RNA detection in formalin-fixed paraffin-embedded tissue. J Bras Patol Med Lab 55. https://doi.org/10. 5935/1676-2444.20190008 22. Li X, Chew S, Chay W et al (2013) Optimizing Ventana chromogenic dual in-situ hybridization for mucinous epithelial ovarian cancer. BMC Res Notes 6:562. https://doi.org/10. 1186/1756-0500-6-562 23. Nakamura N, Fujii T, Soejima Y, Sawabe M (2019) Optimization of trypsin treatment condition utilizing immunohistochemistry for chromogenic in situ hybridization. Pathol Int. https://doi.org/10.1111/pin.12855 24. Leong S-Y, Haffajee Z (2011) Microwaves for chromogenic in situ hybridization. Methods Mol Biol 724:79–89. https://doi.org/10. 1007/978-1-61779-055-3_5

Chapter 18 MYC Copy Number Detection in Clinical Samples Using a Digital DNA-Hybridization and Detection Method Zighereda Ogbah, Francesco Mattia Mancuso, and Ana Vivancos Abstract Clinical tumor specimens are routinely formalin-fixed and paraffin-embedded (FFPE) in Pathology departments worldwide. FFPE blocks are convenient, long-term stable, and easy to archive and manipulate. However, nucleic acids extracted from FFPE tissues generally show a high degree of fragmentation as well as chemical modifications, mainly due to the fixation process. Methods to determine copy number alterations (CNAs) from FFPE clinical samples have proven challenging, in the fact that they are low-plex, only able to profile single genes or gene clusters (such as in situ hybridization-based methods), and/or show a low degree of robustness with partially degraded samples (array-based, NGS-based) as well as being timeconsuming, costly, and with limitations in resolution. The NanoString nCounter® System is a mediumplex, extremely FFPE-robust system, that overcomes several of the frequent issues when dealing with clinical samples. The technique is based on hybridization of molecular barcoded probes directly to FFPEderived DNA, followed by single molecule imaging to detect hundreds of unique molecules in a single reaction without any amplification steps that might introduce undesired biases. Here we describe nCounter v2 Cancer Copy Number Assay, a robust and highly reproducible method for detecting the copy number status of 87 genes commonly amplified or deleted in cancer, including the MYC proto-oncogene. Key words Copy number alterations, Amplification, Deletion, Gain, Loss, NanoString

1

Introduction Copy number alteration (CNA) represents frequent mechanisms driving the oncogenic process [1]. The analysis of CNAs in routine clinical practice is still limited, partly due to several technical challenges to obtain reliable data from samples archived by formalin fixation and paraffin embedding (FFPE). Even though FFPE is the standard method for long-term preservation of most archived pathological specimens, the fixation and embedding process modifies and degrades DNA, making CNAs genomic detection complex [2]. Several methods have been attempted for detecting CNAs in FFPE-derived DNA. FISH is the gold standard for CNA detection, but limited by its low-plex, as is qPCR [3]. In these regard, genomic-based technologies such as microarrays or NGS have

Laura Soucek and Jonathan Whitfield (eds.), The Myc Gene: Methods and Protocols, Methods in Molecular Biology, vol. 2318, https://doi.org/10.1007/978-1-0716-1476-1_18, © Springer Science+Business Media, LLC, part of Springer Nature 2021

321

322

Zighereda Ogbah et al.

become more attractive [4–6]. However, these approaches suffer from low robustness with FFPE-degraded samples, involve timeconsuming workflows, are costly, and require a significant amount of expertise. The nCounter (NanoString, Seattle) technology is based on direct digital detection of nucleic acid (DNA or RNA) molecules of interest by using multiplexed target-specific color-coded probe pairs that directly hybridize to target molecules. Since nCounter does not require any amplification step, it is free from any bias and errors introduced by PCR. Extremely robust in FFPE, this technology is quickly expanding its presence in Pathology departments worldwide, in particular for RNA gene expression profiling [7–9]. Our lab has optimized a Cancer CNA Assay, a DNA-based medium-plex panel that contains probes to test copy number status of 87 genes commonly amplified or deleted in cancer, MYC among them. In order to increase accuracy when analyzing FFPE samples, a density of three probes per gene has been selected in addition to 54 backbone probes targeting all chromosome arms, bringing the total number of probes of the CodeSet to 315. The assay is designed to process 12 samples simultaneously. A reference diploid FFPE sample is added to every cartridge and used downstream for copy number calling. The diploid sample should be derived from FFPE, in order to cancel out region-specific quality biases. The procedure is divided into the following steps (Fig. 1a). 1.1

Hybridization

The Cancer CNA Assay is performed as per manufacturer’s instructions. Two methods of fragmentation are recommended: Alu1 restriction enzyme digestion or Covaris AFA-based fragmentation. When using intact genomic DNA from cell lines, blood, or fresh or frozen tissue, NanoString recommends using Alu1-based fragmentation. For degraded genomic DNA, as from FFPE samples, NanoString recommends the Covaris-based fragmentation method, although Alu1 can also be used. DNA is typically double-stranded in its biological conformation, and nCounter probes are designed to hybridize with a single-stranded target. Therefore, DNA must be denatured prior to hybridization. The denaturation step yields single-stranded targets for hybridization with nCounter probes (Fig. 1b). Each target gene of interest is detected using a pair of reporter and capture probes consisting each of them of a 50-base targetspecific sequence. In addition, each reporter probe carries a unique color-code at the 50 end that enables molecular barcoding of the genes of interest, while the capture probe carries a biotin label at its 30 end that provides a molecular handle for attachment of target genes on the cartridge and facilitates downstream digital detection (Fig. 1b).

MYC Copy Number Detection in Clinical Samples Using a Digital DNA. . .

323

a

b Genomic DNA

Fragmented DNA

Denatured DNA

ssDNA Target

Target DNA+ Probes complex

Solution phase hybridization

Reporter Probe Capture Probe

c

Excess probes

TUBE STRIPS

ELECTRODES

TIP CARRIER

PREPARATION PLATES

TIP SHEATHS

CARTRIDGE

WASTE

Cartridge

Fig. 1 Nanostring workflow. (a) Nanostring procedure overview. (b) Solution Phase Hybridization. Genomic DNAs are first fragmented and then denatured at 95  C. Single stranded DNAs are then mixed with Capture and Reporter probes in a tube strip and hybridized overnight at 65  C. (c) Purification. The tube strip is then transferred to The Prep station where excess probes are removed and DNA/Probes complexes are immobilized and aligned. (d) Data Acquisition. Cartridge is placed in the digital analyzer for data collection. Fluorescent barcodes on the surface of the cartridge are counted and tabulated for each gene target. (e) Data QC. (Left panel) Global gene level variation before and after normalization. (Central panel) Proportion of missing values vs mean expression by sample. (Right panel) The mean vs the standard deviation. Green dots are endogenous genes and orange are controls, with the symbol indicating the specific type. The grey line is a best fit loess curve through the data. Generally, good housekeeping genes should have high mean and low sd. (f) Normalization. (Left panel) Raw data distribution: samples with median counts lower than 90 are considered of bad quality and rejected. (Right panel) Normalized data distribution. (g) CN Calling. A breast cancer sample is shown as an example of result visualization at the gene level (left panel) and probe/ gene level (right panel); probes/genes that do not present variation are colored in light blue, in green those that have a gain and in red those with loss (not in this case). Final results for this sample are: TERT (n ¼ 9.5); FGFR1 (n ¼ 5); MYC (n ¼ 14); CCND1 (n ¼ 8); FGF19 (n ¼ 6). (Images from (b) to (d) belong to Nanostring www.nanostring.com)

324

Zighereda Ogbah et al.

Fig. 1 (continued)

MYC Copy Number Detection in Clinical Samples Using a Digital DNA. . .

325

1.2

Purification

After solution-phase hybridization between target DNA and reporter-capture probe pairs, excess probes are washed away using a two-step magnetic bead-based purification on the nCounter® Prep Station. Finally, the DNA/Probe complexes are aligned and immobilized in the cartridge for data collection (Fig. 1c).

1.3

Data Collection

The cartridge is then transferred to the nCounter® Digital Analyzer for image acquisition and counts collection. At the highest standard data resolution, 555 fields of view (FOV), digital images are collected and processed on the nCounter Digital Analyzer using a microscope objective and a CCD camera. These images are collected by counting the number of times the color-coded barcode for each gene and then transformed into a numeric value that represents the number of counts of a specific transcript in each sample (Fig. 1d).

1.4

Data Analysis

The barcode counts are then tabulated in a comma-separated text (. csv) file format named Reporter Code Count (RCC) file which contains the counts for each target gene per sample. Data can be easily exported and analyzed with nSolver™ Analysis Software or other software packages. For the Cancer CNA test, data processing is performed using the R package NanoStringNorm [10, 11], a suite of tools used to normalize, run diagnostics, and visualize nCounter expression data. An in-house R script calculates copy number gains and losses relative to a reference diploid FFPE sample (Fig. 1e–g).

2 2.1

Materials Fragmentation

1. DNA samples. 2. 0.2 mL PCR tubes. 3. 10 AluI fragmentation buffer. 4. CNV DNA Prep Control. 5. AluI fragmentation enzyme. 6. NanoDrop ND-2000 NanoDrop Technologies®. 7. Thermal cycler. 8. Covaris AFA Instrument, Covaris, Inc.®. 9. Agilent High-Sensitivity DNA Kit. 10. Instrument Manufacturer Technologies®.

2.2

Precipitation

Bioanalyzer

2100

1. DNA samples. 2. TE buffer: (10 mM Tris pH 8, 1 mM EDTA). 3. 1.5 mL Eppendorf tubes.

Agilent

326

Zighereda Ogbah et al.

4. Ethanol. 5. 3 M sodium acetate; pH 5.5. 6. 5 mg/mL linear acrylamide (Ambion®). 7. Heat block. 8. RNase-free water. 2.3

Hybridization

1. Reporter probes (green cap). 2. Capture probes (gray cap). 3. Hybridization buffer. 4. 12-Tube strips and caps. 5. Tube-strip Picofuge. 6. Thermal cycler.

2.4 Purification (Prep Station Step)

1. One nCounter Cartridge. 2. Two nCounter Prep Plates (foil-sealed 96-well plates used by the Prep Station). 3. Two tip sheaths. 4. One racked tips and foil piercers. 5. 12-Tube strips. 6. Cartridge adhesive covers. 7. Plate centrifuge. 8. nCounter® Prep Station.

2.5 Data Collection (Digital Analyzer Step)

1. NanoString USB with RLF specific assay. 2. CDF template. 3. nCounter® Digital Analyzer.

2.6

Data Analysis

1. nSolver™ Analysis. 2. RCC collector. 3. R package NanoStringNorm (http://cran.r-project.org/web/ packages/NanoStringNorm).

3

Methods 1. Isolate DNA from FFPE. Ensure that the genomic DNA is free of contaminating RNA. 2. Confirm DNA yield by checking concentration with a NanoDrop™ instrument or a fluorescent-based dye detection method.

MYC Copy Number Detection in Clinical Samples Using a Digital DNA. . .

3.1

Hybridization

3.1.1 Alu1 Restriction Enzyme Digestion

327

The nCounter v2 Cancer Copy Number Assay requires the genomic DNA to be fragmented prior to hybridization. 1. Set up the restriction digest in a 0.2 mL PCR tube. Recommended DNA input is 300 ng in 7 μL of sample (minimum of 200 ng). The minimum concentration of genomic DNA should be 29 ng/μL prior to its addition to the restriction digest. Use the following volumes for each component for a total volume of 10 μL per digest: l

1 μL 10 AluI fragmentation buffer.

l

1 μL 10 CNV DNA Prep Control.

l

1 μL AluI fragmentation enzyme.

l

7 μL containing 300 ng DNA in RNase-free water.

2. Mix and spin briefly to bring contents to the bottom of each tube. 3. Incubate the AluI restriction digest at 37  C for 1–2 h in a heat block or a thermal cycler with the heated lid turned on. 4. As a quality control, the quality of the digested DNA can be checked on Bioanalyzer HS DNA chip. 5. Proceed to the hybridization protocol. 3.1.2 Covaris AFA-Based Fragmentation

1. Dilute between 500 ng and 1 μg of DNA in 130 μL of TE buffer. 2. Fragment the diluted DNA with a Covaris AFA instrument. Use the settings defined by the manufacturer to produce 200 bp fragments (actual settings may vary depending on the instrument model). 3. After fragmentation is complete, assay 1 μL of sample on an Agilent® 2100 Bioanalyzer using a High-Sensitivity DNA Kit to confirm the desired degree of fragmentation. Successful sonication should produce a single peak centered between 200 and 300 bp with an average mass between 250 and 450 bp. 4. Isolate the fragmented DNA via ethanol precipitation using linear acrylamide (see Note 1). 5. Add the following reagents to 130 μL of the sonicated sample: l

2 μL linear acrylamide.

l

14.7 μL sodium acetate.

l

367 μL ethanol.

6. Cool at 20  C for at least 2 h. 7. Spin down at 4  C at max speed (16,000 rcf) for 30 min using a microcentrifuge.

328

Zighereda Ogbah et al.

8. Carefully remove the supernatant. 9. Add 250 μL 70% ethanol. 10. Spin down at 4  C at max speed for 5 min. 11. Carefully remove the ethanol, being careful not to disturb the pellet. 12. Resuspend the precipitated DNA in 11.5 μL of 10 mM Tris. 13. Proceed to the hybridization protocol. 3.1.3 Hybridization

1. Program the thermal cycler using 20 μL volume, preheat to 65  C and heated lid at 70  C, and ramp reactions down to 4  C. 2. Remove aliquots of both reporter and capture probes reagents from the freezer to thaw at room temperature. Invert several times to mix well and spin down reagent (see Note 2). 3. Create a master mix by adding 70 μL of hybridization buffer to the tube of reporter probes. Do not remove the reporter probes from the tube. Invert repeatedly to mix and spin down master mix. 4. Label a 12-tube strip (see Note 3). 5. Add 8 μL of master mix to each tube. NanoString recommends using a fresh tip for each pipetting step (see Note 4). 6. Denature DNA samples at 95  C for 5 min. Immediately place DNA samples on ice for 2 min to minimize re-annealing. Denaturation of DNA samples is critical for optimal assay performance. 7. Add up to 10 μL of sample to each tube of the strip. 8. Briefly spin down denatured DNA samples in a Picofuge. If necessary, add RNase-free water to bring the volume of each assay to 18 μL. 9. Invert the Capture ProbeSet tube to mix and spin down the contents. Add 2 μL of Capture ProbeSet to each tube. Cap tubes and mix the reagents by inverting the tubes several times and flicking with a finger to ensure complete mixing. Briefly spin down and immediately place the tubes in the preset 65  C thermal cycler (see Note 5). 10. Incubate reactions for at least 16 h. Maximum hybridization time should not exceed 48 h. Ramp reactions down to 4  C. Do not leave the reactions at 4  C for more than 24 h or increased background may result (see Note 6).

3.2 Purification (Prep Station Step)

1. Turn on the nCounter Prep Station using the power switch located on the side of the machine. The nCounter Prep Station has a user-friendly touch screen which guides the user through the steps that must be followed to load the deck. Once powered, select Life Sciences mode (green, on the right).

MYC Copy Number Detection in Clinical Samples Using a Digital DNA. . .

329

2. To set up a new run, touch “Start processing” from the Main Menu screen. 3. Select the “High Sensitivity” protocol which increases the binding of all molecules to the slide by about twofold vs. prior protocols and adds an extra 30 min to the processing time (see Note 7). 4. Select the sample positions that will be processed on the screen. Blue tubes will be processed, and gray tubes will not be processed. If processing fewer than 12 tubes, begin with tube 1. Press next. 5. Cartridges and Prep Plates must be at room temperature prior to processing. Remove the nCounter Prep Plates from storage at 4  C and the nCounter Cartridge from storage at 20  C. Allow them to equilibrate to room temperature for 15–30 min (see Note 8). 6. Centrifuge the Prep Plates at 2000  g for 2 min to collect all liquids in the bottom of the wells prior to loading the Prep Plates onto the Prep Station. After centrifugation, visually inspect plates to ensure that reagents have been collected at the bottom of each well. Press next. 7. Slide open the door of the Prep Station and empty the solid waste (if containing tips) and liquid waste receptacles. Press next. 8. Place the Prep Plates on the deck. Make sure plates are oriented with the green label facing the operator (see Note 9). Press next. 9. Remove the metal tip carrier from the Prep Station deck by lifting straight up. Place the tips and the foil piercers into the carrier. Replace the loaded tip carrier back onto the Prep Station deck with the dark gray foil piercers closest to the user. 10. Place the tip sheaths on the deck and press firmly into place (see Note 10). Press next. 11. Place a cartridge under the electrode fixture in the correct orientation in the machined depression. If the cartridge is not seated properly, the electrodes may become bent. 12. Carefully lower the electrode fixture in place over the cartridge. The 24 electrodes should insert into the 24 wells (see Note 11). Press next. 13. Place two empty tube-strips without caps on the deck. Use only strip tubes provided by NanoString. Press next. 14. Lift the lid and place the tube strip on the deck of the Prep Station, ensuring that well 1 aligns with position 1 (see Note 3). Press next. 15. Press start when ready to begin processing.

330

Zighereda Ogbah et al.

16. Once completed the purification step, open the electrode fixture, remove the cartridge, seal it with an adhesive cover, and transfer it to the Digital Analyzer (see Note 12). 3.3 Data Collection (Digital Analyzer Step)

1. Turn on the Digital Analyzer using the power switch located at the back of the machine. The Digital Analyzer has a userfriendly touch screen interface that guides the user through the steps required to start image acquisition and data processing. 2. Upload the reporter library file (RLF) from the NanoString USB onto the analyzer. Save the RLF on the local analyzer drive (see Note 13). 3. Place the cartridge in the correct orientation into one of the six-stage positions, each of which can be loaded with a cartridge. Be sure that the cartridge is seated flat in the slot and close the magnetic clips gently. 4. Select the cartridge position for which cartridge information will be entered by touching that cartridge position on the screen. The selected cartridge will appear in green. Press next. 5. Select the Cartridge Definition File (CDF) to be used and press next (see Note 14). 6. If a CDF was already created and uploaded/saved to the system, press “Load existing” on the screen. 7. If a CDF need to be created, press “Create new.” 8. Cartridge ID: assign an identification for a cartridge. 9. Data resolution: select one of the following options (see Note 15). Low resolution

25 FOVs

Medium resolution

100 FOVs

High resolution

280 FOVs

Very high resolution

490 FOVs

Max resolution

555 FOVs

and press enter. 10. Write an email address where the RCC files will be sent. Press enter (see Note 16). 11. Sample ID: Enter a unique sample identification. 12. Upload the specific reporter library file (RLF) corresponding to the CodeSet, previously saved on the local analyzer drive (see Note 13). Then, press enter. 13. Select an existing folder or create a new folder in which to save the CDF. Press next.

MYC Copy Number Detection in Clinical Samples Using a Digital DNA. . .

331

14. Shut the door of the instrument and select Start Counting from the Main Menu on the touch screen (see Note 17). 15. Once imaging begins, the door remains locked until the system is paused, or the run is completed. On the screen, the information about the cartridge ID for the active cartridge (the cartridge currently being scanned) will be displayed (see Note 18). 3.4

Data Analysis

3.4.1 Raw Data

The data produced by the nCounter Digital Analyzer are exported as a Reporter Code Count (RCC) file which is a comma-separated text (.csv) file. This file contains the barcode counts from each target gene and controls including the CodeSet. The counts for each sample can be analyzed for automated quality controls, normalization and analysis by using with nSolver™ Analysis Software or manually using other tools such as R scripts. The basic output of the Custom CNV Assay is a spreadsheet containing the CodeSet probe identifiers, sample identifiers, and the digital “counts” recorded for each probe in each sample. The RCC file can be uploaded to the nCounter CNV Collector Tool. To do so, open the RCC collector file in Excel and click the “Import RCC Files” button. The probes reported in the excel file fall into one of the following categories: 1. Positive controls. The CodeSet contains six positive synthetic dsDNA control probes, each targeting a unique DNA sequence present in every assay. The concentrations of DNA targets range from 0.125 to 128 fM in the hybridization reaction. 2. Negative controls. The CodeSet contains eight negative control probes, for which there is no DNA target present in the hybridization reaction. These probes monitor the nonspecific, or background, counts for every assay. 3. Invariant region. The CodeSet contains a set of ten probes designed to autosomal genomic regions predicted not to contain common CNVs. In cancer samples, this assumption cannot be made, and they will not be used down the line for CN calling. 4. Restriction site. The CodeSet contains four control probes to monitor the efficiency of the AluI DNA fragmentation and denaturation steps of the CNV Assay Protocol. Probes A and B are designed to a DNA sequence containing an AluI restriction site and will return low count when the AluI fragmentation is working correctly. Probes C and D are designed to sequences that lack an AluI restriction site and serve as controls for the presence of target DNA in the sample preparation step. The Cancer CNA Assay is run after Covaris AFA fragmentation, so these will be ignored in the QC steps. 5. Endogenous. The Custom CNV Assay probes specified by the user, designed to specific regions of the genome.

332

Zighereda Ogbah et al.

3.4.2 Normalization

The R package NanostringNorm can be used to normalize, run diagnostics, and visualize the expression data. Raw count data can be exported from nCounter to structured Excel spreadsheet that can be imported into R: > require(’NanoStringNorm’); > NanoString.File NanoString.File.norm Plot.NanoStringNorm(x = NanoString.File.norm, label.best. guess = TRUE, plot.type = c(’cv’,’mean.sd’,’RNA.estimates’, ’missing’,’norm.factors’));

Also, distribution of raw and normalized counts is important to determine which sample has to be rejected for low quality. > boxplot(log2(NanoString.File $x[,4:dim(NanoString.mRNA$x) [2]]),las=2,cex.lab=0.9 , main="Raw data distribution", ylab="log2(counts)") > boxplot(NanoString.File.norm,las=2,cex.lab=0.9, main="Normalized data distribution", ylab="log2(counts)")

3.4.4 LogRatio Calculation

For each probe of each sample, a Fold Change (FC) is calculated as the log2 ratio between the normalized counts of the sample probe and the reference probe. > Ratios