TET Proteins and DNA Demethylation: Methods and Protocols (Methods in Molecular Biology, 2272) 107161293X, 9781071612934

Table of contents :
Preface
Contents
Contributors
Part I: Detection and Quantification of DNA Methylation Turnover
Chapter 1: Reduced Bisulfite Sequencing: Quantitative Base-Resolution Sequencing of 5-Formylcytosine
1 Introduction
2 Materials
2.1 General Reagents
2.2 Reduction and Bisulfite Reagents
2.3 DNA Reagents
3 Methods
3.1 Generation of C, 5mC, 5hmC, and 5fC Control Double Stranded DNA (dsDNA)
3.2 Preparation of Genomic DNA
3.3 General DNA Reduction and Bisulfite Treatment
3.4 HPLC Analysis of Single Stranded DNA (ssDNA) Controls
3.5 Sanger Sequencing Analysis of dsDNA Controls
3.6 Illumina MiSeq Analysis of dsDNA Controls
3.7 Sequencing Analysis of Genomic DNA
4 Notes
References
Chapter 2: Aba-Seq: High-Resolution Enzymatic Mapping of Genomic 5-Hydroxymethylcytosine
1 Introduction
2 Materials
2.1 Reagents
2.2 Equipment
3 Methods
3.1 Glucosylation of 5-Hydroxymethylcytosine
3.2 Phenol Extraction and Ethanol Precipitation
3.3 AbaSI Digestion
3.4 Ligation of Biotinylated Adaptor (P1b)
3.5 Cleanup of P1b Ligated DNA and Removal of Excessive Adaptors
3.6 DNA Fragmentation
3.7 Capture of Biotinylated DNA
3.8 End Repair Reaction to Generate Blunt-Ended Fragments
3.9 A-Tailing of End-Repaired DNA
3.10 Ligation of Annealed P2 Adaptor to dA-Tailed DNA
3.11 PCR Amplification
3.12 Cleanup of PCR Products
3.13 Determination of Library Quality, Quantity, and Size Using the Bioanalyzer Platform
3.14 Library Sequencing
3.15 Bioinformatics Analysis
4 Notes
References
Chapter 3: Estimating Global Methylation and Erasure Using Low-Coverage Whole-Genome Bisulfite Sequencing (WGBS)
1 Introduction
2 Materials
2.1 WGBS Library Construction Using PBAT
2.2 Computing Requirements
3 Methods
3.1 WGBS Library Preparation by PBAT
3.1.1 Cell Lysis and DNA Purification
Option 1: BOMB Genomic DNA Extraction
Option 2: Using Cell Lysate Directly for Bisulfite Conversion
3.1.2 Bisulfite Conversion
3.1.3 First Stand Synthesis
3.1.4 Exonuclease Treatment and Purification
3.1.5 Biotin Capture
3.1.6 Second Strand Synthesis
3.1.7 PCR Amplification and Analysis
3.1.8 Pooling and Library Purification
3.2 Theoretical Prediction of Margin of Error
3.3 Empirical Bootstrap Sampling
4 Notes
References
Chapter 4: ELISA-Based Quantitation of Global 5hmC Levels
1 Introduction
2 Materials
2.1 Sample and Standards Preparation
2.2 Reagents for Passive Adsorption DNA ELISA
2.3 Plasticware and Equipment
3 Methods
3.1 General Considerations and Planning
3.2 Preparation of DNA Samples and Standards
3.2.1 DNA Samples
3.2.2 5hmC Standard
3.2.3 DNA Loading Standard (See Note 13)
3.3 Denaturation of DNA
3.4 Passive Adsorption of DNA Samples and Standards
3.5 Blocking
3.6 Incubation with Primary Antibody
3.7 Incubation with HRP-Conjugated Secondary Antibody
3.8 Enzymatic Reaction and Data Acquisition
3.9 Analysis
4 Notes
References
Chapter 5: Avidin-Biotin ELISA-Based Detection of 5hmC
1 Introduction
2 Materials
2.1 Assay Buffers and Components
2.2 DNA and Antibodies
2.3 Plasticware and Equipment
3 Methods
3.1 General Considerations and Planning
3.2 Plate Coating
3.3 DNA Binding
3.4 Blocking
3.5 Incubation with a 5hmC Reader (See Note 9)
3.6 Incubation with Primary Antibody (See Note 10)
3.7 Incubation with HRP-Conjugated Secondary Antibody
3.8 Enzymatic Reaction and Data Acquisition
3.9 Analysis
4 Notes
References
Chapter 6: Quantification of DNA Methylation and Its Oxidized Derivatives Using LC-MS
1 Introduction
2 Materials
2.1 Nucleosides
2.2 UHPLC-QQQ-MS Equipment
2.3 UHPLC-QQQ-MS Setup
2.4 Reagents and Equipment for Isolation of Genomic DNA (gDNA) of Mammalian Cells
2.5 Enzymatic Digest of gDNA
3 Methods
3.1 External Calibration Curves
3.2 Internal Calibration Curves
3.3 gDNA Isolation
3.4 Enzymatic Digest to Nucleoside Level and Sample Preparation
3.5 UHPLC-QQQ-MS Measurement and Analysis
4 Notes
References
Part II: Bioinformatic Analysis of DNA Methylation and Hydroxymethylation
Chapter 7: Distinguishing Active Versus Passive DNA Demethylation Using Illumina MethylationEPIC BeadChip Microarrays
1 Introduction
2 Materials
2.1 Benchtop Assays to Detect DNA Modification Change
2.1.1 Locus-Specific High-Resolution Melt (HRM) Analysis
Equipment and Reagents
2.1.2 Global Quantification of 5hmC
ELISA-Based Assay
Equipment and Reagents
DNA Dot Blot
Equipment and Reagents
2.2 Modifications to Bisulfite Conversion Chemistry to Distinguish 5mC from 5hmC
2.2.1 TET-Assisted Bisulfite (TAB) Array
Equipment and Reagents
2.2.2 Oxidative Bisulfite (OxBS) Array
Equipment and Reagents
3 Methods
3.1 Benchtop Assays to Detect DNA Modification Change
3.1.1 Locus-Specific High-Resolution Melt (HRM) Analysis
General Procedure
3.1.2 Global Quantification of 5hmC
ELISA-Based Assay
General Procedure
DNA Dot Blot
General Procedure
3.2 Modifications to Bisulfite Conversion Chemistry to Distinguish 5mC from 5hmC
3.2.1 Tet-Assisted Bisulfite (TAB) Array
General Procedure
Preparation of gDNA
T4-β-glucosyltransferase (T4-βGT) Reaction
TET Oxidation Treatments
Bisulfite Sanger Sequencing of 5mC/5hmC Standards
3.2.2 Oxidative Bisulfite (OxBS) Method
General Procedure
3.3 Bioinformatic Pipelines for EPIC Array Analysis
3.3.1 TAB Array Processing
General Pipeline
3.3.2 OxBS Array Processing
General Pipeline
3.3.3 Comparison of TAB and OxBS Array Results
General Pipeline
3.3.4 Determining Active Versus Passive DNA Demethylation Using TAB and OxBS Arrays
TAB Array Pipeline
OxBS Array Pipeline
4 Notes
References
Chapter 8: Bioinformatic Estimation of DNA Methylation and Hydroxymethylation Proportions
1 Introduction
2 Materials
3 Methods
3.1 TAB and BS Combination Using Array
3.1.1 Loading the Data
3.1.2 Quality Control
3.1.3 Preprocessing
3.1.4 Filtering Probes
3.1.5 Estimation of 5-hmC, 5-mC, and uC Proportions
3.2 OxBS and BS Combination Using Array
3.2.1 Loading the Data
3.2.2 Quality Control
3.2.3 Preprocessing
3.2.4 Filtering Probes
3.2.5 Estimation of 5-hmC, 5-mC, and uC Proportions
4 Notes
References
Chapter 9: TAB-seq and ACE-seq Data Processing for Genome-Wide DNA hydroxymethylation Profiling
1 Introduction
2 Software
3 Methods
3.1 Data Sources
3.2 Data Download
3.3 Quality Control
3.4 Adapter Clipping
3.5 Read Alignment
3.6 5hmC Calling (CpG Context)
3.7 Visualization of 5hmC Data
3.8 Sequencing Metrics
3.9 Assessment of 5hmC Calling Accuracy
4 Notes
References
Part III: Precise Epigenome Manipulation Using TET Enzymes
Chapter 10: Genomic Targeting of TET Activity for Targeted Demethylation Using CRISPR/Cas9
1 Introduction
2 Materials
2.1 Plasmids
2.2 Molecular Biology Reagents and Equipment for Cloning
2.3 Mammalian Cell Culture Reagents
2.4 Sorting
2.5 DNA Methylation Analysis
3 Methods
3.1 Design sgRNAs
3.2 Design Targeted Bisulfite PCR Primers
3.3 Construction of dC9Sun-TET1mut
3.4 Preparation of Double Stranded sgRNA Oligonucleotides
3.5 Preparation of Vector and Cloning of sgRNA by Gibson Assembly
3.6 Plasmid Sterilization
3.7 Transfection of Plasmid into Mammalian Cells
3.8 FACS and Bisulfite Conversion
3.9 Targeted Bisulfite PCR
3.10 Targeted Bisulfite PCR Pooling and Purification
3.11 Phosphorylation and Adapter Ligation
3.12 Library Quantitation and Sequencing
4 Notes
References
Chapter 11: High-Fidelity CRISPR/Cas9-Based Gene-Specific Hydroxymethylation
1 Introduction
2 Materials
2.1 Web Tools for Designing sgRNAs
2.2 Construction of Customized All-in-One sgRNA Vectors
2.3 Cell Culture and Plasmid DNA Transfection
2.4 RNA Purification and First-Strand cDNA Synthesis
2.5 Gene Reactivation Assessment
2.6 Methylated DNA Detection by MeDIP-qPCR
3 Methods
3.1 Design CRISPR sgRNAs
3.2 Preparation of pLenti-dHFCas9-TET3CD-Myc-DDK-sgRNA
3.3 Annealing of Complementary sgRNA Oligos
3.4 Ligation and Transformation of Competent Cells
3.5 Midi-Prep DNA Purification and Positive Clone Screening
3.6 Cell Transfection
3.7 RNA Purification and cDNA Synthesis
3.8 qRT-PCR
3.9 Genomic DNA Purification and MeDIP-qPCR
4 Notes
References
Part IV: TET and DNA Hydroxymethylation Biochemistry
Chapter 12: Identifying Protein-(Hydroxy)Methylated DNA Interactions Using Quantitative Interaction Proteomics
1 Introduction
2 Materials
2.1 Nuclear Protein Extraction
2.2 DNA Probe Immobilization on Streptavidin-Coated Sepharose Beads
2.3 DNA Affinity Purification
2.4 On StageTip Dimethyl Labeling
2.4.1 Protein Elution and On-Bead Digestion to Peptides
2.4.2 Desalting and Peptide Purification on Stop-and-Go-Extraction (Stage) Tips
2.4.3 Dimethyl Labeling of Peptides
2.5 Mass Spectrometry
2.6 Data Analysis
3 Method
3.1 Nuclear Protein Extraction
3.1.1 Extraction of Nuclear Proteins from Cells/Tissues
3.1.2 Determination of Protein Concentration
3.2 DNA Probe Immobilization on Beads
3.2.1 Annealing of DNA Oligonucleotides
3.2.2 Immobilization of DNA Probes on Streptavidin-Coated Sepharose Beads
3.3 DNA Affinity Purification
3.4 On StageTip Dimethyl Labeling of Peptides
3.4.1 Protein Elution and On-Bead Trypsin Digestion
3.4.2 StageTipping and Dimethyl Labeling
3.5 Mass Spectrometry
3.5.1 Elution of Peptides for Mass Spectrometry
3.5.2 Mass Spectrometry
3.6 Data Analysis
4 Notes
References
Chapter 13: Purification of TET Proteins
1 Introduction
2 Materials
2.1 TET Protein Purification from Insect Cells
2.2 TET Protein Purification from Mammalian Cells
2.3 5caC/5fC-Sequencing
3 Methods
3.1 TET2-Catalytic Domain Protein Purification from Insect Cells
3.1.1 Baculovirus Production
3.1.2 TET Protein Purification from Insect Cells
3.2 TET2-FL Protein Purification from Mammalian Cells
3.3 TET3-FL and TET3-S Protein Purification
3.4 Sequencing Protocol for Detecting 5caC and 5fC
4 Notes
References
Chapter 14: Uncovering Sequence-Specific Transcription Factors Interacting with TET2
1 Introduction
2 Materials
2.1 Immunoprecipitation
2.2 His-Tag Affinity Purification and In Vitro Pulldown
3 Methods
3.1 Immunoprecipitation
3.1.1 Conjugating Antibodies to Magnetic Beads
3.1.2 Cell Lysis
3.1.3 Immunoprecipitation
3.1.4 Washes
3.1.5 Western Blot Analysis
3.2 His-Tag Pulldown Assays
3.2.1 Recombinant Transcription Factors Production in E. coli
3.2.2 Recombinant TET2 Production in Insect Cells
3.2.3 Transcription Factor-TET2 Pulldown
3.2.4 Analysis of the His-Tag Pulldown by Western Blot
4 Notes
References
Chapter 15: ChIP-Sequencing of TET Proteins
1 Introduction
2 Materials
2.1 Chromatin Preparation and Immunoprecipitation
2.1.1 General Materials
2.1.2 Buffers
2.2 Library Preparation
3 Methods
3.1 Chromatin Preparation and Immunoprecipitation
3.1.1 Introduction of Endogenous FLAG Epitope tag on TET2 C-Terminus
3.1.2 Cell Culture (See Note 2)
3.1.3 Crosslinking (See Note 3)
3.1.4 Cell Lysis and Sonication of Chromatin
3.1.5 Preclearing
3.1.6 Immunoprecipitation and Washing Steps (See Note 4)
3.1.7 Elution and Decrosslinking of Immunoprecipitated Protein Complexes
3.2 Quality Control and DNA Library Preparation
3.2.1 Quality Control
3.2.2 DNA Library Preparation for Illumina Sequencing
4 Notes
References
Part V: Assessing TET Protein Activity and Function
Chapter 16: Harnessing Alternative Substrates to Probe TET Family Enzymes
1 Introduction
2 Materials
2.1 PCR Syntheses of Modified DNA Substrates
2.2 Fluorometric Endpoint Read-out of TET Activity with vC-Containing DNA Substrates
2.3 Activity-Based Crosslinking of TET Enzymes with eyC-Containing DNA Substrates
2.3.1 Overexpression of TET2 or Variants in HEK293T Cells
2.3.2 Preparation of Cell Lysates
2.3.3 Activity-Based TET Crosslinking
3 Methods
3.1 PCR Syntheses of Modified DNA Substrates
3.2 Fluorometric Endpoint Read-out of TET Activity with vC-Containing DNA Substrates
3.3 Activity-Based Crosslinking of TET Enzymes with eyC-Containing DNA Substrates
3.3.1 Overexpression of TET2 or Variants in HEK293T Cells
3.3.2 Preparation of Cell Lysates
3.3.3 Activity-Based TET Crosslinking Assay
4 Notes
4.1 PCR Syntheses of Modified DNA Substrates
4.2 Fluorometric Endpoint Read-out of TET Activity with vC-Containing DNA Substrates
4.3 Activity-Based Crosslinking of TET Enzymes with eyC-Containing DNA Substrates
4.3.1 Overexpression of TET2 or Variants in HEK293T Cells
4.3.2 Preparation of Cell Lysates
4.3.3 Activity-Based TET Crosslinking Assay
References
Chapter 17: Generation and Molecular Characterization of Transient tet1/2/3 Zebrafish Knockouts
1 Introduction
2 Materials
2.1 Zebrafish Husbandry
2.2 Equipment
2.3 Consumables
2.4 Reagents
3 Methods
3.1 CRISPR/Cas9 Guide Oligo Design
3.2 Annealing and Amplification of the DNA Guide Oligo and Universal Oligo
3.3 gRNA In Vitro Transcription
3.4 Microinjection Chambers and Needles
3.5 Zebrafish Egg Collection and Preparation of the tet1/2/3 KO Microinjection Mixture
3.6 Microinjections
3.7 Embryo Collection
3.8 gDNA and RNA Extraction
3.9 Amplicon Sequencing
3.10 RRBS: MspI Digestion
3.11 RRBS: End Repair and A-Tailing
3.12 RRBS: Adaptor Ligation
3.13 RRBS: Bisulfite Conversion
3.14 RRBS: PCR Amplification
3.15 RRBS: Library Quantification and Multiplexing
3.16 qPCR Validation of Knockout Efficiencies
3.17 Software
3.18 File Names
3.19 Quality Control
3.20 Adapter Trimming
3.21 Amplicon Sequencing Analysis
3.22 Read Mapping
3.23 Methylation Calling
3.24 Data Visualization
3.25 Methylation Phenotype Analysis
4 Notes
References
Correction to: TET Proteins and DNA Demethylation
Index

Citation preview

Methods in Molecular Biology 2272

Ozren Bogdanovic Michiel Vermeulen Editors

TET Proteins and DNA Demethylation Methods and Protocols

METHODS

IN

MOLECULAR BIOLOGY

Series Editor John M. Walker School of Life and Medical Sciences University of Hertfordshire Hatfield, Hertfordshire, UK

For further volumes: http://www.springer.com/series/7651

For over 35 years, biological scientists have come to rely on the research protocols and methodologies in the critically acclaimed Methods in Molecular Biology series. The series was the first to introduce the step-by-step protocols approach that has become the standard in all biomedical protocol publishing. Each protocol is provided in readily-reproducible step-bystep fashion, opening with an introductory overview, a list of the materials and reagents needed to complete the experiment, and followed by a detailed procedure that is supported with a helpful notes section offering tips and tricks of the trade as well as troubleshooting advice. These hallmark features were introduced by series editor Dr. John Walker and constitute the key ingredient in each and every volume of the Methods in Molecular Biology series. Tested and trusted, comprehensive and reliable, all protocols from the series are indexed in PubMed.

TET Proteins and DNA Demethylation Methods and Protocols

Edited by

Ozren Bogdanovic Genomics and Epigenetics Division, Garvan Institute of Medical Research, Darlinghurst, NSW, Australia

Michiel Vermeulen Radboud University, Nijmegen, The Netherlands

Editors Ozren Bogdanovic Genomics and Epigenetics Division Garvan Institute of Medical Research Darlinghurst, NSW, Australia

Michiel Vermeulen Radboud University Nijmegen, The Netherlands

ISSN 1064-3745 ISSN 1940-6029 (electronic) Methods in Molecular Biology ISBN 978-1-0716-1293-4 ISBN 978-1-0716-1294-1 (eBook) https://doi.org/10.1007/978-1-0716-1294-1 © Springer Science+Business Media, LLC, part of Springer Nature 2021, Corrected Publication 2021 Chapters 3,7 and 17 are licensed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/). For further details see licence information in the chapter. This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer Nature. The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.

Preface DNA methylation is the best studied chemical modification of eukaryotic genomes. In mammals, DNA methylation is associated with long-term transcriptional silencing required for important biological processes such as genomic imprinting, X chromosome inactivation, and repression of mobile DNA elements. Ever since its discovery in the 1960s, DNA methylation in mammals was generally thought to be a stable epigenetic modification, and enzymes capable of converting 5-methylcytosine (5mC) to cytosine remained elusive for decades. In 2009, two groups independently reported the presence of an oxidized form of 5mC, 5-hydroxymethylcytosine (5hmC), in human Purkinje cells and mouse embryonic stem cells. One of these studies identified the enzymes, called ten-eleven translocation (TET) proteins, as being responsible for oxidation of 5mC to 5hmC. Subsequent work from a number of laboratories revealed that 5hmC can be further oxidized to 5-formyl (5fC)- and 5-carboxylcytosine (5caC). Furthermore, 5fC and 5caC form a substrate for the glycosylase TDG, after which base excision repair results in the restoration of unmethylated cytosine. Thus, TET proteins are essential proteins in an enzymatic DNA demethylation pathway in mammals. These paradigm-shifting studies opened up a new and active research field dedicated to deciphering pathways and mechanisms that are regulated by TET proteins and DNA methylation dynamics in health and disease. TET Proteins and DNA Demethylation: Methods and Protocols is a book aimed at research scientists at all levels working in the field of DNA demethylation dynamics. In this book numerous state-of-the-art methods addressing various aspects of TET proteins and their biology are described. The book is divided into five parts. The first part of the book describes technologies aimed at detecting and quantifying DNA methylation turnover using massively parallel sequencing, ELISA, and mass spectrometry approaches. The first chapter deals with reduced bisulfite sequencing to detect and quantify 5fC at nucleotide resolution. This is followed by a description of the Aba-seq protocol, a cost-effective technique aimed at generating genome-wide 5hmC profiles. Finally, a low coverage whole-genome bisulfite sequencing protocol and data analysis pipeline are described, as well as two chapters related to ELISA detection of 5hmC, and a chapter on quantification of DNA methylation and its oxidized derivatives using LC-MS. The second part of the book provides detailed data analysis protocols for distinguishing active versus passive DNA demethylation, estimation of 5mC and 5hmC levels, and exploring base-resolution 5hmC data generated by different sequencing approaches. Part III deals with a novel and exciting topic that takes advantage of modified CRISPR/Cas9 genome editing systems to target DNA demethylation activity to defined genomic loci. Two groups describe complementary approaches for the genomic targeting of TET1 and TET3 catalytic domains to sites of interest using inactive Cas9 enzymes. The fourth part provides a much-needed collection of protocols that explain in detail how to purify TET proteins, and unravel their protein interactions, as well as how to detect genomic sequences bound by TETs (ChIP-seq) and how to identify 5hmC “readers” by using quantitative interaction mass spectrometry. Finally, Part V of this book deals with the assessment of in vivo TET protein function in zebrafish and the usage of unnatural substrates to detect and quantify TET activity.

v

vi

Preface

Although recent years have witnessed tremendous progress in deciphering the molecular mechanisms through which TET proteins regulate DNA methylation dynamics in mammalian cells in health and disease, various outstanding questions remain. Which factors are responsible for regulating the processivity of TET enzymes? How is the genomic recruitment and target gene specificity of TET proteins regulated? Is there a mammalian enzyme that can convert 5caC to C in the absence of base excision repair? We are confident that at least some of these questions will be addressed in the coming decade by using methods and protocols described in this book. Finally, we would like to thank all the authors for their outstanding contributions that will undoubtedly drive this exciting field forward. Darlinghurst, NSW, Australia Nijmegen, The Netherlands

Ozren Bogdanovic Michiel Vermeulen

Contents Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

PART I

DETECTION AND QUANTIFICATION OF DNA METHYLATION TURNOVER

1 Reduced Bisulfite Sequencing: Quantitative Base-Resolution Sequencing of 5-Formylcytosine . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Michael J. Booth and Shankar Balasubramanian 2 Aba-Seq: High-Resolution Enzymatic Mapping of Genomic 5-Hydroxymethylcytosine . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Zhiyi Sun, Jolyon Terragni, Zhenyu Zhu, Yu Zheng, and Sriharsa Pradhan 3 Estimating Global Methylation and Erasure Using Low-Coverage Whole-Genome Bisulfite Sequencing (WGBS). . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Oscar Ortega-Recalde, Julian R. Peat, Donna M. Bond, and Timothy A. Hore 4 ELISA-Based Quantitation of Global 5hmC Levels . . . . . . . . . . . . . . . . . . . . . . . . . Nelly N. Olova 5 Avidin-Biotin ELISA-Based Detection of 5hmC . . . . . . . . . . . . . . . . . . . . . . . . . . . . Nelly N. Olova 6 Quantification of DNA Methylation and Its Oxidized Derivatives Using LC-MS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Franziska R. Traube, Sarah Schiffers, and Thomas Carell

PART II

v ix

3

13

29

45 65

77

BIOINFORMATIC ANALYSIS OF DNA METHYLATION AND HYDROXYMETHYLATION

7 Distinguishing Active Versus Passive DNA Demethylation Using Illumina MethylationEPIC BeadChip Microarrays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 97 Rochelle L. Tiedemann, Hope E. Eden, Zhijun Huang, Keith D. Robertson, and Scott B. Rothbart 8 Bioinformatic Estimation of DNA Methylation and Hydroxymethylation Proportions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 141 Samara Flamini Kiihl 9 TAB-seq and ACE-seq Data Processing for Genome-Wide DNA hydroxymethylation Profiling. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 163 Ksenia Skvortsova and Ozren Bogdanovic

vii

viii

Contents

PART III 10

11

Genomic Targeting of TET Activity for Targeted Demethylation Using CRISPR/Cas9 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 181 Trung Viet Nguyen and Ryan Lister High-Fidelity CRISPR/Cas9-Based Gene-Specific Hydroxymethylation . . . . . . . 195 Xingbo Xu and Elisabeth M. Zeisberg

PART IV 12

13

14

15

PRECISE EPIGENOME MANIPULATION USING TET ENZYMES

TET AND DNA HYDROXYMETHYLATION BIOCHEMISTRY

Identifying Protein–(Hydroxy)Methylated DNA Interactions Using Quantitative Interaction Proteomics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Velin Marita Sequeira and Michiel Vermeulen Purification of TET Proteins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Zhijun Huang, Jiyoung Yu, Jennifer Johnson, Seung-Gi Jin, and Gerd P. Pfeifer Uncovering Sequence-Specific Transcription Factors Interacting with TET2 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Tian V. Tian and Jose´ Luis Sardina ChIP-Sequencing of TET Proteins. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Kasper D. Rasmussen and Kristian Helin

209 225

239 251

PART V ASSESSING TET PROTEIN ACTIVITY AND FUNCTION 16

Harnessing Alternative Substrates to Probe TET Family Enzymes . . . . . . . . . . . . 265 Uday Ghanty, Juan C. Serrano, and Rahul M. Kohli 17 Generation and Molecular Characterization of Transient tet1/2/3 Zebrafish Knockouts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 281 Samuel E. Ross and Ozren Bogdanovic Correction to: TET Proteins and DNA Demethylation . . . . . . . . . . . . . . . . . . . . . . . . . . C1 Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

319

Contributors SHANKAR BALASUBRAMANIAN • Department of Chemistry, University of Cambridge, Cambridge, UK; Cancer Research UK Cambridge Institute, University of Cambridge, Cambridge, UK OZREN BOGDANOVIC • Genomics and Epigenetics Division, Garvan Institute of Medical Research, Sydney, NSW, Australia; School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney, NSW, Australia DONNA M. BOND • Department of Anatomy, University of Otago, Dunedin, New Zealand MICHAEL J. BOOTH • Department of Chemistry, University of Oxford, Oxford, UK THOMAS CARELL • Department of Chemistry, Ludwig-Maximilians-Universit€ a t Mu¨nchen and Center for Integrated Protein Science Munich (CIPSM), Munich, Germany HOPE E. EDEN • Center for Epigenetics, Van Andel Institute, Grand Rapids, MI, USA UDAY GHANTY • Department of Medicine, University of Pennsylvania, Philadelphia, PA, USA; Department of Biochemistry and Biophysics, University of Pennsylvania, Philadelphia, PA, USA KRISTIAN HELIN • Cell Biology Program and Center for Epigenetics Research, Memorial Sloan Kettering Cancer Center, New York, NY, USA; Biotech Research and Innovation Centre (BRIC), University of Copenhagen, Copenhagen, Denmark; The Novo Nordisk Foundation Center for Stem Cell Biology (DanStem), University of Copenhagen, Copenhagen, Denmark TIMOTHY A. HORE • Department of Anatomy, University of Otago, Dunedin, New Zealand ZHIJUN HUANG • Center for Epigenetics, Van Andel Institute, Grand Rapids, MI, USA SEUNG-GI JIN • Center for Epigenetics, Van Andel Institute, Grand Rapids, MI, USA JENNIFER JOHNSON • Center for Epigenetics, Van Andel Institute, Grand Rapids, MI, USA SAMARA FLAMINI KIIHL • Department of Statistics, State University of Campinas, Campinas, SP, Brazil RAHUL M. KOHLI • Department of Medicine, University of Pennsylvania, Philadelphia, PA, USA; Department of Biochemistry and Biophysics, University of Pennsylvania, Philadelphia, PA, USA; Penn Epigenetics Institute, University of Pennsylvania, Philadelphia, PA, USA RYAN LISTER • ARC Center of Excellence in Plant Energy Biology, School of Molecular Sciences, The University of Western Australia, Perth, WA, Australia; The Harry Perkins Institute of Medical Research, Perth, WA, Australia TRUNG VIET NGUYEN • ARC Center of Excellence in Plant Energy Biology, School of Molecular Sciences, The University of Western Australia, Perth, WA, Australia; The Harry Perkins Institute of Medical Research, Perth, WA, Australia NELLY N. OLOVA • Epigenetics ISP, The Babraham Institute, Cambridge, UK; MRC Human Genetics Unit, MRC Institute of Genetics and Molecular Medicine, University of Edinburgh, Edinburgh, UK OSCAR ORTEGA-RECALDE • Department of Anatomy, University of Otago, Dunedin, New Zealand JULIAN R. PEAT • Department of Anatomy, University of Otago, Dunedin, New Zealand; Eisai Inc., Cambridge, MA, USA GERD P. PFEIFER • Center for Epigenetics, Van Andel Institute, Grand Rapids, MI, USA

ix

x

Contributors

SRIHARSA PRADHAN • New England Biolabs Inc., Ipswich, MA, USA KASPER D. RASMUSSEN • Centre for Gene Regulation & Expression, School of Life Sciences, University of Dundee, Dundee, UK KEITH D. ROBERTSON • Department of Molecular Pharmacology and Experimental Therapeutics, Mayo Clinic, Rochester, MN, USA SAMUEL E. ROSS • Genomics and Epigenetics Division, Garvan Institute of Medical Research, Sydney, NSW, Australia; St Vincent’s Clinical School, Faculty of Medicine, University of New South Wales, Sydney, NSW, Australia SCOTT B. ROTHBART • Center for Epigenetics, Van Andel Institute, Grand Rapids, MI, USA JOSE´ LUIS SARDINA • Josep Carreras Leukaemia Research Institute, Badalona, Barcelona, Spain SARAH SCHIFFERS • Department of Chemistry, Ludwig-Maximilians-Universit€ a t Mu¨nchen and Center for Integrated Protein Science Munich (CIPSM), Munich, Germany; S.S. National Institutes of Health, Bethesda, MD, USA VELIN MARITA SEQUEIRA • Department of Molecular Biology, Faculty of Science, Radboud Institute for Molecular Life Sciences, Oncode Institute, Radboud University Nijmegen, Nijmegen, The Netherlands JUAN C. SERRANO • Graduate Group in Biochemistry and Molecular Biophysics, University of Pennsylvania, Philadelphia, PA, USA KSENIA SKVORTSOVA • Genomics and Epigenetics Division, Garvan Institute of Medical Research, Sydney, NSW, Australia; St Vincent’s Clinical School, Faculty of Medicine, University of New South Wales, Sydney, NSW, Australia ZHIYI SUN • New England Biolabs Inc., Ipswich, MA, USA JOLYON TERRAGNI • New England Biolabs Inc., Ipswich, MA, USA TIAN V. TIAN • Vall d’Hebron Institute of Oncology (VHIO), Barcelona, Spain ROCHELLE L. TIEDEMANN • Center for Epigenetics, Van Andel Institute, Grand Rapids, MI, USA FRANZISKA R. TRAUBE • Department of Chemistry, Ludwig-Maximilians-Universit€ at Mu¨nchen and Center for Integrated Protein Science Munich (CIPSM), Munich, Germany MICHIEL VERMEULEN • Department of Molecular Biology, Faculty of Science, Radboud Institute for Molecular Life Sciences, Oncode Institute, Radboud University Nijmegen, Nijmegen, The Netherlands XINGBO XU • Department of Cardiology and Pneumology, University Medical Center of Go¨ttingen, Georg-August University, Go¨ttingen, Germany; DZHK (German Centre for Cardiovascular Research, Partner Site), Go¨ttingen, Germany JIYOUNG YU • Center for Epigenetics, Van Andel Institute, Grand Rapids, MI, USA; Asan Medical Center, University of Ulsan, College of Medicine, Seoul, South Korea ELISABETH M. ZEISBERG • Department of Cardiology and Pneumology, University Medical Center of Go¨ttingen, Georg-August University, Go¨ttingen, Germany; DZHK (German Centre for Cardiovascular Research, Partner Site), Go¨ttingen, Germany YU ZHENG • New England Biolabs Inc., Ipswich, MA, USA ZHENYU ZHU • New England Biolabs Inc., Ipswich, MA, USA

Part I Detection and Quantification of DNA Methylation Turnover

Chapter 1 Reduced Bisulfite Sequencing: Quantitative Base-Resolution Sequencing of 5-Formylcytosine Michael J. Booth and Shankar Balasubramanian Abstract The generation of tools to study mammalian epigenetics is vital to understanding normal biological function and to identify how it is dysregulated in disease. The well-studied epigenetic DNA modification 5-methylcytosine can be enzymatically oxidized to 5-formylcytosine (5fC) in vivo. 5fC has been demonstrated to be an intermediate in demethylation, but recent evidence suggests that 5fC may have an epigenetic function of its own. We have developed reduced bisulfite sequencing (redBS-seq), which can quantitatively locate 5fC bases at single-base resolution in genomic DNA. In bisulfite sequencing (BS-seq), 5fC is converted to uracil, as happens to unmodified cytosine (C), and thus cannot be discriminated from C. However, in redBS-seq, a specific reduction of 5fC to 5-hydroxymethylcytosine (5hmC) stops this conversion, allowing its discrimination from C. 5fC levels are inferred by comparison of a redBS-Seq run with a BS-seq run. Key words DNA methylation, Epigenetics, 5-Formylcytosine, Bisulfite sequencing, Reduced bisulfite sequencing, Sodium borohydride

1

Introduction Mammalian DNA epigenetics, prior to 2009, only comprised the study of 5-methylcytosine (5mC) [1]. Sodium bisulfite sequencing (BS-Seq) was used as the gold standard method for the quantitative single-base resolution sequencing of 5mC. Sodium bisulfite treatment of DNA results in the rapid deamination of the cytosine (C) bases to uracil (U) [2]. When this DNA is sequenced, these Us, converted from Cs, are subsequently read as thymines (T). However, 5mC is resistant to bisulfite conversion, meaning it is still read as a C following BS-Seq [3]. By sequencing a population of DNAs and counting the number of Cs in each position, this enables the quantitative measure of 5mC at single-base resolution [4].

Ozren Bogdanovic and Michiel Vermeulen (eds.), TET Proteins and DNA Demethylation: Methods and Protocols, Methods in Molecular Biology, vol. 2272, https://doi.org/10.1007/978-1-0716-1294-1_1, © Springer Science+Business Media, LLC, part of Springer Nature 2021

3

4

Michael J. Booth and Shankar Balasubramanian

In 2009, it was discovered that 5mC can be enzymatically oxidized to 5-hydroxymethylcytosine (5hmC) in vivo [5, 6]. Then in 2011, it was discovered 5hmC can be further oxidized to 5-formylcytosine (5fC) by the same enzymes [7, 8]. It has been demonstrated that 5fC can be excised and repaired back to a C, acting as an intermediate in an oxidative demethylation pathway [9]. However, recently there have been numerous studies indicating that 5fC may be an epigenetic modification in its own right [10–18]. With the discoveries of these two new bases, there is ambiguity using the previously developed BS-Seq. 5hmC is resistant to bisulfite-mediated deamination, as is the case with 5mC, and so the modifications 5mC and 5hmC cannot be distinguished from each other [19]. Unlike 5hmC, 5fC does undergo deamination during bisulfite treatment and so cannot be discriminated from unmodified C [20]. We have generated two methods to differentiate 5mC, 5hmC, and 5fC. Oxidative-bisulfite sequencing (oxBS-Seq) can sequence 5mC and 5hmC quantitatively and at single-base resolution [20, 21]. Reduced bisulfite sequencing (redBS-Seq) can detect 5fC quantitatively and at single-base resolution (Fig. 1) [22]. redBS-Seq involves a specific reduction of 5fC to 5hmC with sodium borohydride. This inhibits conversion of 5fC to U, and allows 5fC to read as a C, like 5mC and 5hmC. By comparing the BS-Seq and redBS-Seq data, the only difference is that of 5fC, allowing the inference of 5fC levels. Here, we outline a detailed method for the use of redBS-Seq.

2

Materials

2.1 General Reagents

1. Milli-Q water. 2. 500 mM pH 5 Ammonium acetate. 3. 750 mM pH 5 Sodium acetate. 4. Acetic acid. 5. HPLC-grade acetonitrile.

2.2 Reduction and Bisulfite Reagents

1. 1 M Sodium borohydride (freshly prepared).

2.3

1. DNA templates (Biomers; Table 1).

DNA Reagents

2. Epitect bisulfite kit (Qiagen).

2. DNA primers (Biomers; Table 1). 3. Genomic DNA sample (100 ng–1 μg). 4. Illumina TruSeq DNA sample preparation kit (Illumina, cat. no. FC-121-2001).

Reduced Bisulfite-Sequencing of 5-Formylcytosine

5

Fig. 1 Outline of redBS-Seq to map 5fC in DNA. (a) A specific reduction can convert 5fC to 5hmC and by comparing bisulfite treated reduced and non-reduced DNA, 5fC can be elucidated. (b) 5fC is converted to uracil under bisulfite treatment. However, upon reduction of 5fC to 5hmC, this base is now converted to cytosine-5-methylsulfonate (CMS) under bisulfite treatment. (Reprinted with permission from Booth et al. 2014 [22])

5. Ampure XP beads (Beckman Coulter, cat. no. A63880). 6. GeneJet PCR purification kit (Thermo Scientific). 7. mini Quick Spin column (Roche). 8. DreamTaq DNA polymerase (Thermo Scientific). 9. KAPA HiFi uracil+ ReadyMix (KAPA Biosystems). 10. VeraSeq ULtra DNA polymerase (Enzymatics). 11. 10 mM dNTP mix. 12. 100 mM dATP. 13. 100 mM dGTP. 14. 100 mM dTTP. 15. 100 mM 5hmCTP (Bioline). 16. 100 mM 5fCTP (TriLink).

6

Michael J. Booth and Shankar Balasubramanian

Table 1 DNA sequences DNA name

Sequence (M ¼ 5-methylcytosine, H ¼ 5-hydroxymethylcytosine, F ¼ 5-formylcytosine)

Oligo-F

GTAATGFGC

Oligo-C

GAGACGACGTACAGG

Oligo-M

GAGAMGAMGTAMAGG

Oligo-H

GAGAHGAHGTAHAGG

DNA-1

CTCACCCACAACCACAAACAATAATAATAAGATTAAATAATATTAATATATTATCGA TTAAATTATTATTAATTAATATTTGATGTGATGGGTGGTATGG

DNA-2

CTCACCCACAACCACAAACAAATAATATACTATTAAATAATATTAATATATTATCGA TTAAATATTATTTAATTAATATTTGATGTGATGGGTGGTATGG

DNA-3

CTCACCCACAACCACAAACAAATTTAATACGATTAAATAATATTAATATATTATCGA TTAAATTAAATTTAATTAATATTTGATGTGATGGGTGGTATGG

DNA-4

CTCACCCACAACCACAAACAATTTAAATACGATTAAATAATATTAATATATTATCGA TTAAATAATAATTAATTAATATT

DNA-5

TCACCATCTACCATCCAACCATTTAAATACGATTAAATAACATTAATATATTATCGA TTAAATAAGAATTAATTAATATTTGATGTGATGGGTGGTATGG

DNA-6

CTCACCCACAACCACAAACAATTTAAATACGATTAACTAACATTAATACATTATCGA TTAAATAAGACTTAATTAATATTGGTTGGATGGTAGATGGTGA

Forward primer

MTMAMCCAMAACMAMAAAMA

Reverse primer

CCATACCACCCATCACATCA

Post-bisulfite forward primer

CTCACTTACAATCACAAACA

Post-bisulfite forward Illumina primer

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGA TCTCTCACTTACAATCACAAACA

Reverse Illumina primer (AD01)

CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCA GACGTGTGCTCTTCCGATCTCCATACCACCCATCACATCA

Reverse Illumina primer (AD02)

CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTCA GACGTGTGCTCTTCCGATCTCCATACCACCCATCACATCA

Reverse Illumina primer (AD05)

CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTCA GACGTGTGCTCTTCCGATCTCCATACCACCCATCACATCA

Reverse Illumina primer (AD06)

CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTCA GACGTGTGCTCTTCCGATCTCCATACCACCCATCACATCA

Reverse Illumina primer (AD012)

CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTCA GACGTGTGCTCTTCCGATCTCCATACCACCCATCACATCA

Reverse Illumina primer (AD019)

CAAGCAGAAGACGGCATACGAGATTTTCACGTGACTGGAGTTCA GACGTGTGCTCTTCCGATCTCCATACCACCCATCACATCA

The four ssDNA Oligos -F, -C, -M, and -H. The four 100-mer templates and their primers used to make dsDNA controls, with different modifications inserted in the central sequence [22]

Reduced Bisulfite-Sequencing of 5-Formylcytosine

3

7

Methods

3.1 Generation of C, 5mC, 5hmC, and 5fC Control Double Stranded DNA (dsDNA)

dsDNA containing all the cytosine modifications are vital as spikein controls to quantify the efficiency of redBS-Seq reactions in genomic DNA samples (see Note 1). 1. Prepare PCRs of the four control DNAs, DNA-1, DNA-2 and DNA-3 using d5fCTP, and DNA-4 containing d5hmCTP. PCRs should be made up with water (37.75 μL), 10 DreamTaq Buffer (5 μL), dGTP/dATP/dTTP (1 μL, 10 mM), d5fCTP or d5hmCTP (1 μL, 10 mM), Forward Primer (2 μL, 10 μM), Reverse Primer (2 μL, 10 μM), DreamTaq Polymerase (0.25 μL), and template (1 μL, 1 ng/μL). 2. Amplify these PCRs using the following thermal cycle: 95  C for 3 min, 35 (95  C for 30 s, 57  C for 30 s, 72  C for 15 s), 72  C for 5 min. 3. Purify reactions with a Thermo GeneJet PCR kit, as per the manufacturer’s instructions. 4. Quantify each DNA with an Invitrogen Qubit Fluorometer or Nanodrop.

3.2 Preparation of Genomic DNA

RedBS-Seq can be performed in different ways depending on the area of the genome you wish to sequence. Two examples are given for a whole genome [23] or reduced representative [21, 24] sequencing (see Note 2). 1. Sonicate or digest genomic DNA, as per literature protocols for a whole genome [23] or reduced repetitive [24] sequencing, respectively. 2. Add the four dsDNA controls (1 μL, 0.6 ng/μL) to all genomic samples. 3. Perform an Illumina library preparation as per the manufacturer’s protocol, using a 1/10 dilution of adapters. 4. Purify the library preparation with AMPure XP beads, according to the TruSeq protocol. For the last AMPureXP purification from the TruSeq protocol, the DNA should be left to dry for 30 min and eluted in water.

3.3 General DNA Reduction and Bisulfite Treatment

This general DNA reduction and bisulfite treatment can be used for many applications. Here, you can apply it to the subsequent sections for analysis of 5fC in synthetic dsDNA and genomic DNA. 1. Prepare a fresh sodium borohydride solution (1 M) in water (see Note 3). 2. DNA (up to 1 μg of genomic DNA or 20 ng of control DNA) should be made up to 15 μL in water.

8

Michael J. Booth and Shankar Balasubramanian

3. Add 5 μL of the freshly prepared 1 M sodium borohydride to the DNA. This will give a 250 mM sodium borohydride concentration. 4. Vortex and centrifuge the reactions, then hold at room temperature in the dark, under a piece of aluminum foil, for 1 h. Keep the lids open to release any pressure. Vortex then centrifuge the reactions every 15 min, to remove the bubbles generated from gas generation. 5. After completion, add a sodium acetate solution (10 μL, 750 mM, pH 5) very slowly to quench the reaction (see Note 4). A violent release of hydrogen gas occurs upon addition. Hold the reaction at room temperature for 10 min or until no further gas is released. 6. Prepare bisulfite reactions of these reduced DNA samples with a Qiagen Epitect Bisulfite kit with the following alterations: DNA (30 μL), bisulfite mix (80 μL), and DNA protect buffer (30 μL). 7. Subject these reactions to two cycles of the FFPE thermal cycle, and work up as per the manufacturer’s protocol for FFPE samples. 3.4 HPLC Analysis of Single Stranded DNA (ssDNA) Controls

This section can be used to perform and analyze the reduction of 5fC in ssDNA oligonucleotides. 1. Perform a general DNA reduction only (no bisulfite treatment) on the four ssDNA templates, Oligo-F, Oligo-C, Oligo-M, and Oligo-H (2 μL, 100 μM). 2. Filter these ssDNAs with a Roche mini Quick Spin column, with four water washes (500 μL) at 1000 rcf for 1 min. 3. Digest this ssDNA as per a literature protocol [25]. 4. Wash an Amicon Ultra 30 kDa column with 400 μL water. Then add the digestion reactions to the column to purify away the enzymes. Spin as per the manufacturer’s protocol. 5. Inject the flow through from the Amicon column into an Agilent 1100 HPLC system using an Eclipse XDB-C18 3.5 μm, 3.0  150 mm column. Use a flow rate of 1 mL/ min. Maintain the column temperature at 45  C. Use Buffer A (500 mM Ammonium Acetate, pH 5), Buffer B (Acetonitrile), and Buffer C (H2O). Hold Buffer A at 1% throughout the whole run and use a gradient for the remaining buffers of 0 min—0.5% B, 2 min—1% B, 8 min—4% B, 10 min—95% B.

3.5 Sanger Sequencing Analysis of dsDNA Controls

This section can be used to perform and analyze the redBS-Seq in dsDNA with Sanger sequencing.

Reduced Bisulfite-Sequencing of 5-Formylcytosine

9

Fig. 2 Validation of redBS-Seq methodology on synthetic DNA. Using BS-Seq, 5fC reads as T, (a) however by employing redBS-Seq, 5fC reads as C, (b) in 100mer dsDNA with Sanger sequencing. The conversion efficiency of 5hmC and 5fC in a 100mer dsDNA with BS-Seq and redBS-Seq was quantified with Illumina sequencing, (c) where 5fC efficiency reads as C in redBS-Seq but as T in BS-Seq, with little change in the conversion of 5hmC. Data are mean  standard deviation. (Reprinted with permission from Booth et al. 2014 [22])

1. Perform a general DNA reduction and bisulfite treatment separately on the four dsDNA templates, DNA-1, DNA-2 and DNA-3 using 5fC, and DNA-4 containing 5hmC (20 ng of each). 2. Amplify each of these DNAs using VeraSeq ULtra DNA polymerase, with the Reverse Primer and the Post-Bisulfite Forward Primer (see Note 5). Add water (25 μL), 5 VeraSeq Buffer (10 μL), dNTPs (2 μL, 10 mM), Post-Bisulfite Forward Primer (5 μL, 10 μM), Reverse Primer (5 μL, 10 μM), bisulfite treated DNA template (2 μL), and VeraSeq Polymerase (1 μL). Perform the following thermal cycle: 98  C for 30 s, 20 (98  C for 10 s, 50  C for 20 s, 72  C for 15 s), 72  C for 5 min. 3. Purify these PCRs using Thermo GeneJet PCR columns, as per the manufacturer’s protocol. 4. Analyze this DNA with Sanger sequencing (Fig. 2a, b). 3.6 Illumina MiSeq Analysis of dsDNA Controls

This section can be used to perform and analyze the redBS-Seq in dsDNA with an Illumina MiSeq instrument. 1. Perform a general DNA reduction and bisulfite treatment separately on the four dsDNA templates, DNA-1, DNA-2 and DNA-3 using 5fC, and DNA-4 containing 5hmC (20 ng of each). 2. Amplify each of the bisulfite-treated DNAs using Enzymatics VeraSeq ULtra DNA polymerase, with Post-Bisulfite Forward Illumina Primer and Reverse Illumina Primer (see Note 6). Add water (25 μL), 5 VeraSeq Buffer (10 μL), dNTPs (2 μL, 10 mM), Post-Bisulfite Forward Illumina Primer (5 μL, 10 μM), Reverse Illumina Primer (5 μL, 10 μM), bisulfite

10

Michael J. Booth and Shankar Balasubramanian

treated DNA template (2 μL), and VeraSeq Polymerase (1 μL). Perform the following thermal cycle: 98  C for 30 s, 20 (98  C for 10 s, 50  C for 20 s, 72  C for 15 s), 72  C for 5 min. 3. Purify these PCRs using Thermo GeneJet PCR columns, as per the manufacturer’s protocol. 4. Measure the concentrations of these DNAs using an Agilent TapeStation with a D1K ScreenTape. Combine the PCR products to equal concentration and sequence on an Illumina MiSeq with a 70 base pair single end configuration (Fig. 2c). 3.7 Sequencing Analysis of Genomic DNA

This section can be used to perform the redBS-Seq on genomic DNA, containing the synthetic dsDNA controls. 1. Perform a general DNA reduction and bisulfite treatment on half the genomic DNA samples previously prepared. On the other half, perform the bisulfite treatment only. 2. Amplify these BS-Seq (bisulfite treatment only) and redBS (reduction and bisulfite treatment) DNA libraries using the KAPA HiFi Uracil+ Polymerase with TruSeq primers. Add water (10 μL), 2 KAPA HiFi Uracil+ master mix (25 μL), Illumina Primer Mix (5 μL, 10 μM each), and bisulfite-treated DNA template (10 μL). 3. Perform the following thermal cycle: 98  C for 45 s, 12 (98  C for 15 s, 60  C for 30 s, 72  C for 30 s), 72  C for 60 s. 4. Purify the amplified libraries with 50 μL of AMPure XP beads, as per the manufacturer’s protocol. 5. Sequence on an Illumina HiSeq 2000 (see Note 7). 6. Following sequencing, check the levels of conversion using the synthetic DNA controls.

4

Notes 1. Other DNA sequences can be used. The major consideration when choosing new sequences is length of template, different lengths will require different purification methods. PCR reaction conditions must also then be re-optimized. 2. Two genome sequencing examples are given here. However, we anticipate that this method will work with all other genome sequencing methods that are compatible with bisulfite sequencing. 3. It is vital that a fresh solution of sodium borohydride is used for each reduction, as the reagent will degrade in water. It should be prepared just prior to use.

Reduced Bisulfite-Sequencing of 5-Formylcytosine

11

4. Be extra careful with addition of sodium acetate to the sodium borohydride solution, as bubbles are given off violently. If addition occurs too fast, then you will lose material as it splashes out of the tube. 5. As only one strand contained methylated Cs in the 50 primer region (from the Forward Primer), only this strand will act as a template for the PCR following bisulfite treatment. If this was not the case, then the signal of the changing C base in the center of the strand in Sanger sequencing would be diluted to 50%, due to amplification from the corresponding G base on the opposite strand. 6. These Illumina primers will add the sequences required for Illumina sequencing, along with TruSeq indexes AD01, 02, 05, 06, 12, or 19 (Table 1). 7. While we highlight the use of an Illumina HiSeq, it is anticipated that other sequencing platforms may also be used.

Acknowledgements We thank the Biotechnology and Biological Sciences Research Council for a studentship to M.J.B. M.J.B. is currently funded by a Royal Society University Research Fellowship. S.B. is a Senior Investigator of The Wellcome Trust and the Balasubramanian group is core-funded by Cancer Research UK. References 1. Ndlovu ‘Matladi N, Denis H, Fuks F (2011) Exposing the DNA methylome iceberg. Trends Biochem Sci 36:381–387. https://doi.org/10. 1016/j.tibs.2011.03.002 2. Hayatsu H, Wataya Y, Kai K, Iida S (1970) Reaction of sodium bisulfite with uracil, cytosine, and their derivatives. Biochemistry 9:2858–2865. https://doi.org/10.1021/ bi00816a016 3. Shapiro R, Servis RE, Welcher M (1970) Reactions of uracil and cytosine derivatives with sodium bisulfite. J Am Chem Soc 92:422–424. https://doi.org/10.1021/ ja00705a626 4. Frommer M, McDonald LE, Millar DS et al (1992) A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands. Proc Natl Acad Sci U S A 89:1827–1831. https://doi. org/10.1073/pnas.89.5.1827 5. Tahiliani M, Koh KP, Shen Y et al (2009) Conversion of 5-methylcytosine to

5-hydroxymethylcytosine in mammalian DNA by MLL partner TET1. Science 324:930–935. https://doi.org/10.1126/science.1170116 6. Kriaucionis S, Heintz N (2009) The nuclear DNA base 5-hydroxymethylcytosine is present in Purkinje neurons and the brain. Science 324:929–930. https://doi.org/10.1126/sci ence.1169786 7. Ito S, Shen L, Dai Q et al (2011) Tet proteins can convert 5-methylcytosine to 5-formylcytosine and 5-carboxylcytosine. Science 333:1300–1303. https://doi.org/10. 1126/science.1210597 8. Pfaffeneder T, Hackner B, Truß M et al (2011) The discovery of 5-formylcytosine in embryonic stem cell DNA. Angew Chem Int Ed Engl 50:7008–7012. https://doi.org/10. 1002/anie.201103899 9. Maiti A, Drohat AC (2011) Thymine DNA glycosylase can rapidly excise 5-formylcytosine and 5-carboxylcytosine. J Biol Chem

12

Michael J. Booth and Shankar Balasubramanian

286:35334–35338. https://doi.org/10. 1074/jbc.C111.284620 10. Raiber E-A, Beraldi D, Ficz G et al (2012) Genome-wide distribution of 5-formylcytosine in embryonic stem cells is associated with transcription and depends on thymine DNA glycosylase. Genome Biol 13: R69. https://doi.org/10.1186/gb-2012-138-r69 11. Song C-X, Szulwach KE, Dai Q et al (2013) Genome-wide profiling of 5-formylcytosine reveals its roles in epigenetic priming. Cell 153:678–691. https://doi.org/10.1016/J. CELL.2013.04.001 12. Wu X, Zhang Y (2017) TET-mediated active DNA demethylation: mechanism, function and beyond. Nat Rev Genet 18:517–534. https:// doi.org/10.1038/nrg.2017.33 13. Iurlaro M, Ficz G, Oxley D et al (2013) A screen for hydroxymethylcytosine and formylcytosine binding proteins suggests functions in transcription and chromatin regulation. Genome Biol 14:R119. https://doi.org/10. 1186/gb-2013-14-10-r119 14. Iurlaro M, McInroy GR, Burgess HE et al (2016) In vivo genome-wide profiling reveals a tissue-specific role for 5-formylcytosine. Genome Biol 17:141. https://doi.org/10. 1186/s13059-016-1001-5 15. Bachman M, Uribe-Lewis S, Yang X et al (2015) 5-Formylcytosine can be a stable DNA modification in mammals. Nat Chem Biol 11:555–557. https://doi.org/10.1038/ nchembio.1848 16. Su M, Kirchner A, Stazzoni S et al (2016) 5-Formylcytosine could be a semipermanent base in specific genome sites. Angew Chem Int Ed Engl 55:11797–11800. https://doi. org/10.1002/anie.201605994 17. Kellinger MW, Song C-X, Chong J et al (2012) 5-formylcytosine and 5-carboxylcytosine reduce the rate and substrate specificity of RNA polymerase II transcription. Nat Struct

Mol Biol 19:831–833. https://doi.org/10. 1038/nsmb.2346 18. Zhu C, Gao Y, Guo H et al (2017) Single-cell 5-formylcytosine landscapes of mammalian early embryos and ESCs at single-base resolution. Cell Stem Cell 20:720–731.e5. https:// doi.org/10.1016/J.STEM.2017.02.013 19. Huang Y, Pastor WA, Shen Y et al (2010) The behaviour of 5-hydroxymethylcytosine in bisulfite sequencing. PLoS One 5:e8888. https://doi.org/10.1371/journal.pone. 0008888 20. Booth MJ, Branco MR, Ficz G et al (2012) Quantitative sequencing of 5-methylcytosine and 5-hydroxymethylcytosine at single-base resolution. Science 336:934–937. https://doi. org/10.1126/science.1220671 21. Booth MJ, Ost TW, Beraldi D et al (2013) Oxidative bisulfite sequencing of 5-methylcytosine and 5-hydroxymethylcytosine. Nat Protoc 8:1841–1851. https://doi.org/10.1038/ nprot.2013.115 22. Booth MJ, Marsico G, Bachman M et al (2014) Quantitative sequencing of 5-formylcytosine in DNA at single-base resolution. Nat Chem 6:435–440. https://doi.org/10.1038/ nchem.1893 23. Cokus SJ, Feng S, Zhang X et al (2008) Shotgun bisulphite sequencing of the Arabidopsis genome reveals DNA methylation patterning. Nature 452:215–219. https://doi.org/10. 1038/nature06745 24. Meissner A, Gnirke A, Bell GW et al (2005) Reduced representation bisulfite sequencing for comparative high-resolution DNA methylation analysis. Nucleic Acids Res 33:5868–5877. https://doi.org/10.1093/ nar/gki901 25. Quinlivan EP, Gregory JF (2008) DNA digestion to deoxyribonucleoside: a simplified one-step procedure. Anal Biochem 373:383–385. https://doi.org/10.1016/J. AB.2007.09.031

Chapter 2 Aba-Seq: High-Resolution Enzymatic Mapping of Genomic 5-Hydroxymethylcytosine Zhiyi Sun, Jolyon Terragni, Zhenyu Zhu, Yu Zheng, and Sriharsa Pradhan Abstract Aba-Seq (DNA modification-dependent restriction endonuclease AbaSI coupled with sequencing) provides a cost-effective and non-chemical based method for the high-resolution mapping of genomic 5-hydroxymethylcytosine (5hmC). The high specificity of the AbaSI enzyme allows sensitive detection of 5hmC in the genome. Here, we describe the Aba-Seq technique that was used for the high-resolution mapping of 5hmC in the genome of mouse embryonic stem cells (E14). Key words Aba-Seq, AbaSI, 5-Hydroxymethylcytosine, DNA modification-dependent restriction endonuclease, Genome-wide

1

Introduction In the deoxyribonucleic acid (DNA) of higher organisms, particularly in vertebrates, cytosine occurs in several chemical forms, including unmodified cytosine (C) and fifth carbon modified 5-methylcytosine (5mC) along with its other derivatives 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) [1–6]. The modified nucleobases 5hmC, 5fC, and 5caC are oxidative derivatives of 5mC mediated by a family of 10–11 translocation (Tet) dioxygenases, Tet1, Tet2, and Tet3. 5hmC is a stable epigenetic modification linked with epigenetic reprogramming and is detectable in different tissues and cell types at various levels [7, 8]. In humans, 5hmC levels are high in brain, liver, kidney, and colorectal tissues, lower in lung and lowest in heart, breast, and placenta [9]. Both 5mC and 5hmC play a major role in tissue-specific gene expression [10]. Therefore, it is important to understand the genomic distribution of 5hmC in various biological contexts. Until recently it has not been possible to sensitively quantify 5hmC at base-pair resolution in the genome across large numbers of samples. Furthermore, many of the existing

Ozren Bogdanovic and Michiel Vermeulen (eds.), TET Proteins and DNA Demethylation: Methods and Protocols, Methods in Molecular Biology, vol. 2272, https://doi.org/10.1007/978-1-0716-1294-1_2, © Springer Science+Business Media, LLC, part of Springer Nature 2021

13

14

Zhiyi Sun et al.

Fig. 1 Recognition and cleavage sites of AbaSI

methods routinely used sodium bisulfite (BS) conversion and methylation-sensitive restriction enzyme cleavage to interrogate DNA methylation. These methods were unable to discriminate between 5mC and 5hmC [11, 12]. A chemical method dependent on oxidative bisulfite (oxBS) treatment is being used currently, which involves a two-step process with oxidation of 5hmC to 5fC before BS conversion, thus offering a direct measurement of 5mC and a proxy measure of 5hmC [13]. However, DNA complexity and integrity are further compromised after these treatments which may hamper the amplification steps and the subsequent read mapping [14]. In addition, sequencing depth for each cytosine must be considerably high to detect low-level 5hmCs in the genome. Here we describe an alternative method, with a facile application format, that complements the existing approaches by using the AbaSI restriction enzyme. AbaSI is a member of the PvuRts1I-family of modification-dependent restriction endonucleases that cleaves double stranded deoxyribonucleic acid (DNA) containing 5-hydroxymethylcytosine (5hmC) and glucosylated 5hmC (g5hmC), but not DNA containing unmodified cytosine [15–17]. AbaSI cleaves with some variability 30 to the modified cytosine, 11–13 nt away on the modified (‘top’) strand and 9–10 nt away on the complementary (“bottom”) strand, producing fragments with short 30 -overhangs (Fig. 1) [18]. AbaSI has no recognition sequence (“context”) specificity, but optimal cleavage occurs when two (g)5hmC residues occur 21–23 bp apart on opposite DNA strands, whereupon cleavage takes place mid-way between them. Cleavage is less efficient if one of these two cytosines is unmodified, and much less efficient if the second cytosine is missing altogether.

2 2.1

Materials Reagents

1. Molecular biology grade water. 2. NEB Buffer 4 (10): 500 mM potassium acetate, 200 mM Tris-acetate, 100 mM magnesium acetate, 10 mM DTT, pH 7.9 (New England BioLabs).

Aba-Seq: High-Resolution Mapping of 5hmC

15

3. T4 Phage β-glucosyltransferase (T4-βGT): 10,000 U/ml (New England BioLabs). 4. Uridine diphosphoglucose (UDP-Glc): 2 mM (New England BioLabs). 5. Buffer-saturated phenol/chloroform/isoamyl (25:24:1), pH 7–8 (see Note 1).

alcohol

6. Phase Lock Gel™ Light tube (5 PRIME). 7. Sodium acetate: 3 M, brought to pH 5.2 with glacial acetic acid. 8. Ethanol, 100%. 9. Annealing buffer 10: 0.2 M Tris–HCl, pH 7.5–8.0, 0.5 M NaCl. 10. Adaptors for Illumina sequencing (see Note 2): (a) First biotinylated adaptor (P1b): top strand (50 ! 30 ): (biotin) ACACTCTTTCCCTACACGACGCTCTTCC GATCTNN , N ¼ randomized A/T/C/G); bottom strand (50 ! 30 : AGATCGGAAGAGCGGTTCAGCAG GAATGCCGAG). (b) Second adaptor (P2): top strand (50 ! 30 : (phos)GATCG GAAGAGCGGTTCAGCAGGAATGCCGAG ); bottom strand (50 ! 30 : ACACTCTTTCCCTACAC GACGCTCTTCCGATCT). For each adaptor, mix 5 μl top strand oligo (100 μM), 5 μl bottom strand oligo (100 μM), 5 μl 10 Annealing Buffer, and 35 μl nuclease-free water in a nuclease-free PCR tube. Anneal oligos in a thermal cycler using a gradual cooling program as follows: 95  C for 3 min; 65  C 5 min; 42  C 5 min; 37  C 10 min; 20  C 10 min, 15  C hold. The final concentration of both annealed adaptors is 10 μM. Store at 20  C. 11. T4 DNA ligase buffer (10): 500 mM Tris–HCl, 100 mM MgCl2, 10 mM ATP, 100 mM DTT, pH 7.5. 12. T4 DNA ligase: 2,000,000 U/ml (New England BioLabs). 13. ATP: 10 mM. 14. AMPure® XP Beads: (Beckman Coulter). 15. Tris-EDTA buffer (TE 1): 10 mM Tris–HCl, 1 mM EDTA, pH 8.0. 16. Dynabeads® MyOne™ C1 streptavidin-coated magnetic beads (Invitrogen). 17. Wash and binding buffer for streptavidin-coated beads (2): 10 mM Tris–HCl, pH 7.5, 1 mM EDTA, 2 M NaCl. Store at room temperature.

16

Zhiyi Sun et al.

18. End repair reaction buffer (10): 500 mM Tris–HCl, 100 mM MgCl2, 100 mM DTT, 10 mM ATP, 4 mM dATP, 4 mM dCTP, 4 mM dGTP, 4 mM dTTP, pH 7.5. 19. End repair enzyme mix: 10,000 U/ml T4 polynucleotide kinase (PNK), 3000 U/ml T4 DNA polymerase (see Note 3). 20. dA-tailing reaction buffer (10): 100 mM Tris–HCl, 100 mM MgCl2, 500 mM NaCl, 10 mM DTT, 2 mM dATP, pH 7.9. 21. Klenow fragment (30 ! 50 exo): 5000 U/ml (New England BioLabs). 22. PCR primers for Illumina sequencer (see Note 2): Primer I ( AATGATACGGCGACCACCGAGATCTACACTCTTTCCC TACACGACGCTCTTCCGATC); Primer II ( CAAGCAGAAGACGGCATACGA GATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCC GATC). 23. Phusion® high-fidelity PCR master mix (2) with HF buffer: Phusion® high-fidelity polymerase (New England BioLabs). 24. Agilent 2100 Bioanalyzer High Sensitivity DNA Kit (Agilent Technologies). 25. 6% or 10% polyacrylamide gels: such as Novex® TBE gels (Invitrogen). 26. DNA ladder for 35 bp–10 kb size range: such as 1 kb Plus DNA Ladder (0.1–10.0 kb) and Low Molecular Weight DNA Ladder (25-766 bp) (New England BioLabs). 27. Gel loading dye, 6. 28. SYBR® Gold Nucleic Acid Gel Stain (Invitrogen). 2.2

Equipment

1. 1.5 ml microcentrifuge tubes. 2. 0.6 ml PCR tubes. 3. DNA LoBind® tubes (Eppendorf). 4. Manual pipettes and tips. 5. Vortex. 6. Microcentrifuge. 7. Minifuge. 8. Covaris® S2 sonication system with clear microTUBE (Covaris). 9. Magnetic rack. 10. Tube rotator. 11. Thermal cycler. 12. 2100 Bioanalyzer instrument (Agilent Technologies). 13. Gel electrophoresis equipment.

Aba-Seq: High-Resolution Mapping of 5hmC

3

17

Methods The procedures described in this protocol have been optimized to produce a next generation sequencing library from 50 ng to 1 μg of starting DNA (Fig. 2). Use molecular biology grade water for all reactions unless otherwise specified. Please note that all reactions are concentration-dependent, and that the volumes of each can be scaled according to the amount of input DNA used. If preparing from larger amounts of DNA, scale up all the reaction volumes and reagents proportionally.

3.1 Glucosylation of 5-Hydroxymethylcytosine

1. Mix the following components in a 1.5 ml nuclease-free microcentrifuge tube (see Note 4): DNA (50 ng–1 μg), 4 μl of 10 NEBuffer 4, 2 μl of 2 mM UDP-Glc, 1 μl of 10,000 u/ml T4-BGT and add appropriate amount of water to a total reaction volume of 40 μl.

Fig. 2 Schematic overview of Aba-Seq method. (1) Glucosylated genomic DNA was digested with AbaSI. (2) Digested DNA was ligated to a biotinylated adaptor P1b with 2-base 30 -overhang. (3) DNA fragmentation by sonication. (4) Capture of the biotinylated DNA onto streptavidin-coated beads. (5 and 6) On-bead DNA end repair and dA-tailing. (7) On-bead ligation with adaptor P2 containing one blunt end and one unligatable end. (8) PCR using primers specific to the P1b and P2

18

Zhiyi Sun et al.

2. Mix by pipetting followed by a brief spin to drive all liquid to the tube bottom. 3. Incubate at 37  C overnight. 3.2 Phenol Extraction and Ethanol Precipitation

1. Add 210 μl water to the glucosylation reaction followed by an equal volume (250 μl) of phenol/chloroform/isoamyl alcohol and mix well by pipetting and/or inverting the tube until the phases are completely mixed (see Note 5). Avoid vortexing during this step (see Note 6). 2. Carefully transfer the DNA/phenol mixture into a pre-spun Phase Lock Gel™ Light tube and spin at 12,000  g for 10 min (see Note 7). 3. Transfer the upper aqueous phase to a new microcentrifuge tube. Add 0.1 volume (25 μl) of 3 M sodium acetate pH 5.2 and mix (see Note 8). 4. Add 3 volumes (750 μl) of 100% ethanol. Mix by inverting the tube several times. 5. Precipitate DNA on dry ice or at 20  C for at least 1 h. 6. Spin at 15,000  g for at least 20 min at 4  C. Carefully decant supernatant without disturbing the pellet. 7. Wash the DNA pellet with 1 ml of 70% ethanol, spin at 15,000  g for 10 min at 4  C. Carefully decant the supernatant. 8. Air dry the pellet for approximately 30 min or briefly vacuum dry the pellet. 9. Resuspend the pellet in 34 μl (or appropriate volume for next step) of nuclease-free water.

3.3

AbaSI Digestion

1. Mix the following components in a nuclease-free tube: 34 μl glucosylated DNA, 4 μl of 10 NEBuffer 4 and 20 U of AbaSI enzyme for a total reaction volume of 40 μl (see Note 9). 2. Mix by pipetting, followed by a quick spin to collect all liquid from the sides to the tube. 3. Incubate at room temperature for 1 h. 4. Heat-inactivate the enzyme at 65  C for 20 min (see Note 10) (Fig. 3a).

3.4 Ligation of Biotinylated Adaptor (P1b)

1. Add 30 pmole (e.g., 3 μl of 10 μM) P1b adapters (see Note 11) to the AbaSI-digested solution and mix well by pipetting (see Note 12). 2. Add 1 μl of 10 T4 ligase buffer and 4 μl of 10 mM ATP to the AbaSI-digested DNA and adapter mixture. Adjust the volume to 49 μl with water and mix well.

Aba-Seq: High-Resolution Mapping of 5hmC

19

Fig. 3 Quality control of Aba-Seq. DNA was run on 10% polyacrylamide gels and stained with SYBR® Gold. (a) AbaSI digestion of mouse E14 genomic DNA (~50 ng) and M.HapII methylated E. coli DNA (negative control). (b) M: DNA marker (1 kb Plus DNA Ladder + Low Molecular Weight DNA Ladder). (1) AbaSIdigested E14 gDNA (~200 ng DNA) ligated with P1b adapters for overnight. The dark band between 75 and 100 bp is excessive adapters (~20:1 molar ratio of adapter: DNA fragments). (2) P1b ligated DNA after AMPure (1.4) cleanup and size selection. All the excessive adapters are removed from the sample. (3) DNA fragments after sonication. Fragment size is expected to center at 200 bp

3. Add 1 μl of concentrated T4 DNA ligase (2,000,000 U/ml) and mix by pipetting. Quickly spin the tube to collect all liquid from the sides of the tube. 4. Incubate at room temperature overnight for optimal ligation efficiency (see Note 13) (Fig. 3b). 3.5 Cleanup of P1b Ligated DNA and Removal of Excessive Adaptors

1. Warm AMPure XP bead solution to room temperature. Resuspend AMPure XP beads by vortexing. 2. Add 1.4 volumes (70 μl) of resuspended AMPure XP beads to the AbaSI reaction (see Note 14). Mix well by pipetting up and down at least ten times. 3. Incubate for 5 min at room temperature. 4. Pulse-spin the tube and place it on a magnetic stand for at least 1 min until the beads have collected to the wall of the tube and the solution is clear. 5. Carefully remove and discard the supernatant without disturbing the beads. 6. Keep the tube on the magnet and add 400 μl freshly prepared 75% ethanol (see Note 15). Incubate at room temperature for 30 s, and then carefully remove and discard the supernatant.

20

Zhiyi Sun et al.

7. Repeat step 6 once, for a total of two washes. 8. Pulse-spin the tube, return it to the magnet, and remove any residual ethanol by pipetting. 9. Keep the tube in the magnetic rack with the cap open to air-dry the beads for 1–5 min at room temperature. 10. Resuspend the beads in 50 μl nuclease-free water. 11. Pulse-spin the tube, return it to the magnet. 12. After the solution is clear (>1 min), carefully collect and transfer the supernatant to a fresh tube. 13. Repeat the cleanup process (steps 2–12) (see Note 16), but in step 10 resuspend the beads in 50 μl 1 TE buffer instead of water (see Note 17) (Fig. 3b). 3.6 DNA Fragmentation

Shear DNA to 200–300 bp fragments using an appropriate DNA shearing system. We recommend using a Covaris S2 system with microTUBEs. 1. Carefully transfer the entire DNA sample to a Covaris microTUBE (see Note 18). 2. Insert the microTUBE into the Covaris machine and shear the DNA with the following settings: duty cycle of 10%, intensity level of 5, cycles per burst of 200, frequency sweeping for 60 s 3. 3. Slowly transfer the entire sample to a fresh PCR tube with a pipette (Fig. 3b).

3.7 Capture of Biotinylated DNA

1. Wash 10–25 μl (see Note 19) of Dynabeads MyOne Streptavidin C1 beads according to the manufacturer’s instructions. 2. Place the tube containing the washed beads on a magnet for 1–2 min and then remove the supernatant by aspiration with a pipette. Remove the tube from the magnet and resuspend the washed beads in 50 μl of 2 Wash/Binding buffer. 3. Incubate 5 μl DNA sample with MyOne Streptavidin beads for at least 15 min at room temperature with gentle rotation. 4. Wash beads three times in 100 μl of 1 Wash Buffer as described in Subheading 3.7, step 1. 5. Wash beads in 100 μl nuclease-free water. 6. Resuspend the beads in 44 μl of nuclease-free water.

3.8 End Repair Reaction to Generate Blunt-Ended Fragments

1. Mix 44 μl DNA fragments bound to beads with 5 μl 10 NEB End Repair reaction buffer. 2. Add 1 μl End Repair enzyme and mix well by pipetting up and down several times. 3. Incubate at 20  C for 30 min in a thermal cycler.

Aba-Seq: High-Resolution Mapping of 5hmC

21

4. Wash beads two more times in 1 wash buffer and once in nuclease-free water. 5. Resuspend beads in 42 μl of nuclease-free water. 3.9 A-Tailing of EndRepaired DNA

1. Mix 42 μl on-bead blunt end repaired DNA with 5 μl 10 dA-tailing reaction buffer. 2. Add 3 μl Klenow fragment (30 –50 exo) and mix well. 3. Incubate at 37  C for 30 min in a thermal cycler. 4. Wash beads two times in 1 wash buffer and once in nucleasefree water. 5. Resuspend beads in 42 μl of nuclease-free water.

3.10 Ligation of Annealed P2 Adaptor to dA-Tailed DNA

1. Mix 42 μl on-bead dA-tailed DNA with 5 μl 10 T4 ligase buffer and 2 μl of 10 μM annealed P2 adaptor (see Note 13). 2. Add 1 μl concentrated T4 ligase and mix well. 3. Incubate at room temperature overnight with gentle rotation. 4. Wash beads three times in 1 wash buffer and once in nucleasefree water. 5. Resuspend beads in 3 μl of nuclease-free water.

3.11 PCR Amplification

1. Prepare PCR reaction by mixing 23 μl of on-bead adaptor ligated DNA with 1 μl of 10 μM PCR primer I and 1 μl of 10 μM PCR primer II and 25 μl NEB 2 Phusion® HighFidelity PCR Master Mix with HF Buffer (see Note 20). 2. Perform PCR amplification with the following thermal cycling program: 1 cycle:

30 s at 98  C (initial denaturation)

10–12 cycles (see Note 21)

10 s at 98  C (denaturation) 15 s at 70  C (annealing) 15 s at 72  C (extension)

1 cycle:

10 min at 72  C (final extension)

1 cycle:

Hold at 4  C

3. Spin down the beads and collect the supernatant on a magnetic stand. 3.12 Cleanup of PCR Products

1. Allow AMPure XP solution to warm to room temperature. Resuspend AMPure XP beads by vortexing. 2. Add 1.0 volumes (50 μl) of resuspended AMPure XP beads to the PCR product. Mix well by pipetting up and down at least ten times. 3. Incubate for 5 min at room temperature.

22

Zhiyi Sun et al.

4. Pulse-spin the tube and place it on a magnetic stand for at least 1 min, until the beads have collected to the wall of the tube and the solution is clear. 5. Carefully remove and discard the supernatant without disturbing the beads. 6. Keep the tube on the magnet and add 400 μl freshly prepared 75% ethanol. Incubate at room temperature for 30 s and then carefully remove and discard the supernatant. 7. Repeat step 6, for a total of two washes. 8. Pulse-spin the tube, return to the magnet, and remove any residual ethanol by pipetting. 9. Keep the tube in the magnetic rack with the cap open to air-dry the beads for 1–2 min at room temperature. 10. Resuspend the beads in 30 μl 10 mM Tris–HCl, pH 8.0. 11. Pulse-spin the tube, return it to the magnet. 12. After the solution is clear (>1 min), carefully transfer the supernatant to a new tube. 3.13 Determination of Library Quality, Quantity, and Size Using the Bioanalyzer Platform

1. Dilute the library five-fold with nuclease-free water and check the size distribution on an Agilent Bioanalyzer 2100 Expert high sensitivity DNA chip. 2. After the Bioanalyzer run, gate the peak that represents the library and estimate the average fragment size and molarity in nM (Fig. 4c) (see Note 22). 3. Calculate the original library concentration and adjust the library concentration to that required by the sequencing facility with 0.1 TE buffer. 4. Store the library at 20  C.

3.14 Library Sequencing

Sequence DNA amplicons by Illumina sequencing (see Note 23).

3.15 Bioinformatics Analysis

Data analysis overview: Aba-Seq data should be analyzed following the guidelines for standard next generation sequencing data prior to 5hmC calling; for example, using FastQC (http://www.bioinfor matics.babraham.ac.uk/projects/fastqc/) for quality control, cutadapt [19] for low quality base trimming and removing adapter sequences and Bowtie [20] for alignment to the reference genome. After retrieving genomic positions of AbaSI cut sites from the alignment, check the flanking sequence for the presence of cytosines at the expected distance (11–13 nucleotides upstream of the cut site on the same strand or 9–11 nucleotides downstream on the opposite strand). When consecutive cytosines are found, choose the cytosine that is closer to the cut site [15]. Coverage of individual

Aba-Seq: High-Resolution Mapping of 5hmC

23

Fig. 4 Bioanalyzer trace examples of Aba-Seq libraries (a) after PCR amplification (10 diluted); (b) after first AMPure (1.0) cleanup (5 diluted). A small amount of adapter dimer still persists in the library; (c) the final library after the second AMPure (1.0) cleanup (5 diluted) and estimated average fragment size, concentration, and molarity

cytosines is an indicator of the relative hydroxymethylation levels and can be used to compare hydroxymethylation levels between different sites [18] (see Note 24).

4

Notes 1. Isoamyl alcohol helps with stabilizing the interphase. Phase Lock Gel centrifuge tubes help increase DNA recovery. 2. The sequences provided here are suitable for Illumina sequencing of Singleplex Single-End (SE) or Paired-End (PE). For Illumina Multiplex sequencing or other sequencing platforms, change the adapter sequences accordingly. 3. Reagents 18 and 19 can be purchased together as the NEBNext End Repair Module from New England BioLabs. 4. Use DNA LoBind tubes for a low amount of DNA input to minimize DNA loss caused by an interaction with the plastic surface of the tube.

24

Zhiyi Sun et al.

5. The phenol/chloroform/isoamyl extraction step is required because T4-βGT must be removed from the genomic DNA for efficient AbaSI digestion. T4-βGT binds tightly to the 5hmC substrate and other DNA purification methods may not remove T4-βGT completely. 6. CAUTION: Phenol causes severe burns and respiratory irritation. Please take appropriate cautions when using this reagent. 7. Immediately prior to use of the Phase Lock Gel tube, pellet Phase Lock Gel at 12,000–16,000  g in a microcentrifuge for 30 s. If not using a Phase Lock Gel tube, spin the DNA/phenol mixture at max speed for 10 min to separate the phases. 8. When DNA amount is low, add 1 μl glycogen (20 mg/ml) to facilitate precipitation. 9. Reduce the amount of AbaSI to 10 U (half of the original amount) for DNA of less than 100 ng. 10. If making an Aba-Seq library for the first time, it’s highly recommended to run a small amount of sample (20 ng) on a 0.6% or 1.0% agarose gel after the key steps (e.g., AbaSI digestion, P1b ligation, and AMPure cleanup and fragmentation) for quality control purpose (Fig. 3). 11. If input DNA is 1.5 * 106 for f5dC* and 8oxodG* and >2 * 105 for ca5dC as sufficient. If the integrated MS signal is below these limits for any of the nucleosides of interest, we recommend checking the ionization source and cleaning it if necessary, changing the buffers or the column. 7. External calibration curves for UV-based quantification and internal calibration curves for MS-based quantification are only valid in the same machine setup. They can be used if the UHPLC-QQQ-MS, the type of the UHPLC column, and the type of buffer are not changed. It is not necessary to re-measure them when the buffer or the column is exchanged for the same type of buffer or column, respectively. 8. If you expect to use your external UV-based calibration curves for limited amounts n of gDNA (5 μg per technical replicate), the calibration curve should include very high amounts of n. 9. Based on existing literature you can estimate how abundant your DNA modification will be. The calibration curves that we use for routine measurements and which can be applied to a very broad range of sample types and gDNA amounts (e.g., primed stem cells with a very high content of m5dC derivatives and tumor cells with a very low content of the m5dC derivatives, gDNA amounts from 0.2 to 20 μg) span ranges from 0.1 to 229 pmol for m5dC, 0.1 to 73 pmol for hm5dC, 0.71 to 515 fmol for f5dC, 2.0 to 497 fmol for ca5dC, and 0.65 to 475 fmol for 8oxodG.

Quantification of DNA Modifications

93

10. It is essential that sample preparation does not cause any DNA damage, e.g., deamination of cytosine (derivatives) or oxidative damage. To keep the damage at a minimum during the isolation of gDNA, BHT, which prevents oxidative damage, and DFOA, which inhibits deaminases, are added to the lysis and the first wash buffer. 11. Genomic Lysis Buffer already contains RNase A. Therefore, if you wish to isolate RNA from the same samples, use a different lysis buffer (e.g., RLT buffer, Qiagen, Hilden, Germany) add 2ME, BHT, and DFOA as described and collect the first flowthrough after loading the lysate on the DNA binding column. This flow-through contains the RNA and proteins that can be also precipitated for further usage. 12. If you are working with tissue, use 1.5 mL of lysis buffer per 50 mg of tissue and homogenize them in the bead mill at 30 Hz for 1 min and at 20 Hz for additional 4 min. These conditions work fine for soft tissue like brain or liver. Firmer tissues like heart need additional minutes of homogenization in the bead mill. gDNA from 50 mg of tissue can be isolated with one DNA binding column. 13. Do not alter the time and frequency of homogenization substantially if not necessary. Longer/harsher homogenization will shear DNA to very small fragments that do not bind to the DNA binding column anymore, shorter or none homogenization often results in RNA impurities as RNA is sheared faster to small fragments than DNA. 14. A good indication of salt impurities is the 260/230 absorption signal when the DNA is quantified using a photometer. Ideally, the ratio between the absorption at 260 nm and at 230 nm is >2. Salt impurities decrease the ratio and along with pH variations they can cause a shift in retention time on the UHPLC. Usually this problem only occurs in samples from complex material, e.g., tissue. Try to wash the gDNA more often with DNA pre-Wash and gDNA Wash Buffer. A good indication of RNA in the sample is an increased 260/280 absorption signal (> 1.90). However, minor RNA contaminations that do not interfere with the UV signal of dC and dG, does not impair the MS measurement. 15. Incomplete enzymatic digest of gDNA results in DNA oligonucleotides that might pass the filter, but contaminate the UHPLC-QQQ-MS system, which results in higher pressure.

94

Franziska R. Traube et al.

Acknowledgements F.R.T. thanks the Boehringer Ingelheim Fonds for a PhD fellowship. We thank the Deutsche Forschungsgemeinschaft (DFG) for financial support through the programs: SFB646, SFB749 and SFB1032, SFB1309, as well as the DFG Priority program SPP1784. References 1. Traube FR, Carell T (2017) The chemistries and consequences of DNA and RNA methylation and demethylation. RNA Biol 14:1099–1107 2. Guo F, Li X, Liang D et al (2014) Active and passive demethylation of male and female pronuclear DNA in the mammalian zygote. Cell Stem Cell 15:447–459 3. Hodges E, Molaro A, Dos Santos Camila O et al (2011) Directional DNA methylation changes and complex intermediate states accompany lineage specificity in the adult hematopoietic compartment. Mol Cell 44:17–28 4. Sanz LA, Kota SK, Feil R (2010) Genomewide DNA demethylation in mammals. Genome Biol 11:110–110 5. Globisch D, Mu¨nzel M, Mu¨ller M et al (2010) Tissue distribution of 5-hydroxymethylcytosine and search for active demethylation intermediates. PLoS One 5: e15367 6. Chen Z, Shi X, Guo L et al (2017) Decreased 5-hydroxymethylcytosine levels correlate with cancer progression and poor survival: a systematic review and meta-analysis. Oncotarget 8:1944–1952 7. Pfeifer GP, Xiong W, Hahn MA et al (2014) The role of 5-hydroxymethylcytosine in human cancer. Cell Tissue Res 356:631–641 8. Branco MR, Ficz G, Reik W (2012) Uncovering the role of 5-hydroxymethylcytosine in the epigenome. Nat Rev Genet 13:7–13 9. He Y-F, Li B-Z, Li Z et al (2011) TET-mediated formation of 5-carboxylcytosine and its excision by TDG in mammalian DNA. Science 333:1303–1307 10. Song C-X, Szulwach Keith E, Dai Q et al (2013) Genome-wide profiling of

5-formylcytosine reveals its roles in epigenetic priming. Cell 153:678–691 11. Feederle R, Schepers A (2017) Antibodies specific for nucleic acid modifications. RNA Biol 14:1089–1098 12. Lentini A, Lagerwall C, Vikingsson S et al (2018) A reassessment of DNAimmunoprecipitation-based genomic profiling. Nat Methods 15:499–504 13. Pitt JJ (2009) Principles and applications of liquid chromatography-mass spectrometry in clinical biochemistry. Clin Biochem Rev 30:19–34 14. Annesley TM (2003) Ion suppression in mass spectrometry. Clin Chem 49:1041–1044 15. Bru¨ckl T, Globisch D, Wagner M et al (2009) Parallel isotope-based quantification of modified tRNA nucleosides. Angew Chem Int Ed Engl 48:7932–7934 16. Iwan K, Rahimoff R, Kirchner A et al (2018) 5-Formylcytosine to cytosine conversion by C–C bond cleavage in vivo. Nat Chem Biol 14:72–78 17. Mu¨nzel M, Globisch D, Bru¨ckl T et al (2010) Quantification of the sixth DNA base hydroxymethylcytosine in the brain. Angew Chem Int Ed Engl 49:5375–5377 18. Schiesser S, Pfaffeneder T, Sadeghian K et al (2013) Deamination, oxidation and C–C bond cleavage reactivity of 5-hydroxymethylcytosine, 5-formylcytosine and 5-carboxycytosine. J Am Chem Soc 135:14593–14599 19. Buhrman DL, Price PI, Rudewiczcor PJ (1996) Quantitation of SR 27417 in human plasma using electrospray liquid chromatography-tandem mass spectrometry: a study of ion suppression. J Am Soc Mass Spectrom 7:1099–1105

Part II Bioinformatic Analysis of DNA Methylation and Hydroxymethylation

Chapter 7 Distinguishing Active Versus Passive DNA Demethylation Using Illumina MethylationEPIC BeadChip Microarrays Rochelle L. Tiedemann, Hope E. Eden, Zhijun Huang, Keith D. Robertson, and Scott B. Rothbart Abstract The 5-carbon positions on cytosine nucleotides preceding guanines in genomic DNA (CpG) are common targets for DNA methylation (5mC). DNA methylation removal can occur through both active and passive mechanisms. Ten-eleven translocation enzymes (TETs) oxidize 5mC in a stepwise manner to 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC). 5mC can also be removed passively through sequential cell divisions in the absence of DNA methylation maintenance. In this chapter, we describe approaches that couple TET-assisted bisulfite (TAB) and oxidative bisulfite (OxBS) conversion to the Illumina MethylationEPIC BeadChIP (EPIC array) and show how these technologies can be used to distinguish active versus passive DNA demethylation. We also describe integrative bioinformatics pipelines to facilitate this analysis. Key words DNA methylation, DNA hydroxymethylation, Active demethylation, Passive demethylation, Illumina MethylationEPIC BeadChip, Tet-assisted bisulfite (TAB), Oxidative bisulfite (OxBS), TETs, DNMTs, Epigenetics

1

Introduction Methylation on the 5-carbon of cytosine nucleotides in genomic DNA of eukaryotes is the most extensively studied epigenetic modification. To date, over 70,000 research papers, methods chapters, and review articles have been dedicated to the study of DNA methylation (5mC). 5mC provides diverse functionality in the regulation of gene expression, genome stability, chromatin compaction, and developmental timing [1]. Indeed, DNA methylation is largely regarded as one of the most stable epigenetic modifications, as its inheritance to daughter cells following cell division is

The original version of this chapter was revised. The correction to this chapter is available at https://doi.org/ 10.1007/978-1-0716-1294-1_18 Ozren Bogdanovic and Michiel Vermeulen (eds.), TET Proteins and DNA Demethylation: Methods and Protocols, Methods in Molecular Biology, vol. 2272, https://doi.org/10.1007/978-1-0716-1294-1_7, © The Author(s) 2021, Corrected Publication 2021

97

98

Rochelle L. Tiedemann et al.

faithfully copied during DNA replication by the maintenance methylation machinery, DNA methyltransferase 1 (DNMT1) and Ubiquitin-like, containing PHD and RING finger domains, 1 (UHRF1) [2–5]. 5mC patterning is conserved across most somatic tissues, with the most dynamics occurring at enhancers and other distal regulatory regions of the genome that influence gene expression [6, 7]. Additional dynamic changes in 5mC are observed in disease transformation and in early mammalian development, as further described below. DNA methylation can be passively removed in dividing cells that lack DNA methylation maintenance activity. An active mechanism for 5mC removal remained elusive until 2009, when the existence of an oxidized form of DNA methylation, DNA hydroxymethylation (5hmC) was thrust into the spotlight with the discovery of its abundance in neuronal tissue and the identification of an enzyme that could oxidize 5mC to 5hmC, Ten-eleven translocation 1 (TET1) [8– 10]. Subsequently, two additional TET enzymes, TET2 and TET3, also demonstrated the ability to oxidize 5mC in a stepwise manner to 5hmC, 5-formylcytosine (5fC), and 5-carboxylcytoine (5caC) [11, 12]. Oxidation of 5mC to 5fC and 5caC allows for base-excision repair of the oxidized nucleotide by thymidine deglycosylase (TDG) and replacement by unmodified cytosine (5C) [13–15]. Combined, these discoveries laid the foundation for what is now widely accepted as the active DNA demethylation pathway. While recent evidence suggests that the oxidized forms of 5mC can act in a regulatory manner through the recruitment of reader proteins [16, 17], perhaps the most well-studied roles for the active DNA demethylation pathway are in the early stages of mammalian development [18]. Following fertilization, both the paternal and maternal genomes undergo massive changes in DNA methylation patterning that occurs through both active and passive DNA demethylation, respectively [19–23]. Primordial germ cells (PGCs) also undergo a dramatic loss of DNA methylation that can be attributed to both passive and active DNA demethylation mechanisms [24, 25]. Embryonic stem cells (ESCs) also rely on TET proteins to maintain self-renewal properties as well as to direct lineage specification upon induction of differentiation [11, 26]. Given the importance of 5mC for maintaining proper control of chromatin structure and function, aberrant patterning of 5mC has been widely studied in the context of aging, psychiatric and developmental disorders, and cancer [27–30]. As hypermethylation of tumor suppressor genes is a hallmark of cancer, significant effort has been devoted to developing therapies that induce DNA demethylation of these genes in order to restore their expression and function in cancer cells [27]. Accordingly, both passive and active DNA demethylation mechanisms are now being targeted for combination cancer therapies with DNMT inhibitors like 5-aza-20 -deoxycytidine (DAC) and with L-ascorbic acid (Vitamin C, VitC), a co-factor for TET dioxygenase activity [31–33].

Detecting Active Versus Passive DNA Demethylation

99

In this chapter, we use DAC and VitC to induce active and passive DNA demethylation in the human germ cell tumor-derived cell line NCCIT, known to express TET enzymes [34, 35]. To distinguish between active and passive DNA demethylation at base-resolution, we coupled Tet-assisted bisulfite (TAB) and oxidative bisulfite (OxBS) conversion chemistries to DNA methylation analysis with the Illumina MethylationEPIC BeadChIP (EPIC array) [36–40]. The EPIC array is a high-throughput platform that interrogates the DNA methylation status of approximately 850,000 individual CpG dinucleotides at base-resolution across multiple features of the genome (e.g., CpG islands, promoters, enhancers). Using bisulfite-converted genomic DNA (gDNA) as an input, single-stranded DNA probes hybridize to the bisulfiteconverted gDNA, and single base-pair extensions with fluorescently labeled nucleotides reveal the underlying modification status of the gDNA (Fig. 1a). For example, if a cytosine nucleotide is unmodified in the gDNA, bisulfite conversion will deaminate the cytosine to uracil, which will then be read as thymine following whole-genome amplification. Once the probe for this specific CpG hybridizes to the bisulfite-converted gDNA, an adenine nucleotide will be incorporated and give off a fluorescent signal to indicate that the cytosine was unmethylated (Fig. 1a). Vice versa, cytosine nucleotides that are modified (5mC/5hmC) are protected from bisulfite conversion and will remain cytosines [41]. Following bisulfite conversion, whole-genome amplification, and hybridization, a fluorescently labeled guanine nucleotide will be incorporated, informing that the underlying cytosine was methylated (Fig. 1a). TAB conversion is an upstream modification to the standard bisulfite conversion method that allows for only 5hmC nucleotides to be read as modified cytosines [38, 42]. 5hmC nucleotides in gDNA are first protected from downstream steps by addition of a glucose moiety mediated by T4 β-glucosyltransferase (β-GT) (Fig. 1b). 5mC nucleotides are targeted for TET-mediated stepwise oxidation to 5hmC, 5fC, and 5caC by incubating β-GT-treated gDNA with the recombinant catalytic domain of TET2 and its required co-factors. Following bisulfite conversion and amplification, only 5hmC nucleotides will be read as cytosine by the EPIC array, and 5mC/5C nucleotides are read as thymine (Fig. 1b). With OxBS conversion, 5hmC nucleotides in gDNA are oxidized by potassium perruthenate (KRuO4) to 5fC prior to bisulfite conversion (Fig. 1c) [43]. Following EPIC array processing, 5mC will be read as cytosine while all oxidized cytosines and 5C will be thymine (Fig. 1c). In this chapter, we demonstrate the utility of EPIC arrays for determining active versus passive DNA demethylation using the techniques shown in Fig. 1. We provide bioinformatic pipelines that can be used to analyze the 5mC and 5hmC signals from TAB and OxBS arrays. Additionally, we detail assays that can be used to determine relative global change in 5mC and 5hmC across gDNA samples, which we use to check samples prior to EPIC array

100

Rochelle L. Tiedemann et al.

A

B

BS ARRAY 5mC

5hmC

5mC

5C

C

TAB ARRAY 5hmC

OxBS ARRAY 5mC

5C

5hmC

β−GT

KRuO4 Oxidation

gluc

5mC

5hmC

5C

5C

TET2-CD Oxidation

5mC

5fC

5C

gluc

5f/caC

5hmC

Bisulfite Reaction

5C

Bisulfite Reaction

Bisulfite Reaction

gluc

5hmC

U

U

5hmC

C

C

T

U

U

Amplification

EPIC array

Amplification

EPIC array

Amplification

5mC

U

T

C

T

EPIC array

5mC

C

T

T

Fig. 1 Coupling TAB and OxBS to EPIC array analysis to enable distinction of 5mC and 5hmC. (a) Sodium bisulfite (BS) conversion of genomic DNA (gDNA) deaminates unmodified cytosine (5C) residues to uracil (U). 5-methylcytosine (5mC) and 5-hydroxymethylcytosine (5hmC) are protected from deamination. Bisulfiteconverted gDNA is PCR amplified and hybridized to the Illumina Infinium MethylationEPIC BeadChip (EPIC array) for analysis. Both 5mC and 5hmC are read as C, while 5C residues are read as T on this platform. (b) TET-assisted bisulfite conversion (TAB) incorporates transfer of a sugar moiety (gluc) to 5hmC by β-glucosyltransferase (β-GT). Prior to bisulfite conversion, β-GT-modified gDNA is reacted with the catalytic domain of TET2 (TET2-CD), which catalyzes stepwise oxidation of 5mC to 5hmC, 5-formylcytosine (5fC), and 5-carboxycytosine (5caC). Gluc-5hmC is protected from further oxidation and is resistant to bisulfite conversion. 5fC, 5caC, and 5C are converted as described above. (c) With Oxidative Bisulfite conversion (OxBS), gDNA is treated with potassium perruthenate (KRuO4) to oxidize 5hmC to 5fC prior to reaction with sodium bisulfite. Image of EPIC array modified from Illumina

Detecting Active Versus Passive DNA Demethylation

101

analysis. Finally, we provide a comparison of the TAB array and OxBS array approaches and discuss how to determine which platform is best suited for different experiments.

2

Materials

2.1 Benchtop Assays to Detect DNA Modification Change

1. NanoDrop spectrophotometer.

2.1.1 Locus-Specific High-Resolution Melt (HRM) Analysis

4. Heat block, water-bath or thermocycler capable of holding temp at 37 and 50  C.

Equipment and Reagents

2. ZYMO EZ DNA Methylation Kit. 3. Bio-Rad Precision Melt Supermix.

5. Nuclease-free water. 6. Real-Time PCR instrument with SYBR detection capabilities. 7. Compatible Real-Time PCR plates (96-well). 8. Compatible Real-Time PCR plate seals.

2.1.2 Global Quantification of 5hmC

1. EpiGentek MethylFlash Global DNA Hydroxymethylation (5-hmC) ELISA Easy Kit (Colorimetric).

ELISA-Based Assay

2. 8-channel pipette.

Equipment and Reagents

3. Aerosol resistant pipette tips. 4. Incubator at 37  C. 5. Microplate reader capable of reading absorbance at 450 nm.

DNA Dot Blot

1. 1 M NaOH.

Equipment and Reagents

2. 10 M ammonium acetate. 3. 20 SSC buffer: 3 M NaCl, 300 mM sodium citrate. 4. 1 TE buffer: 10 mM Tris–HCl pH 8.0, 1 mM EDTA pH 8.0. 5. 1 PBST: 2.68 mM KCl, 1.47 mM KH2PO4, 136.9 mM NaCl, 9.5 mM Na2PO4, 1% Tween-20. 6. Stripping buffer: 5% acetic acid, 500 mM NaCl. 7. 5% methylene blue stain. 8. Thermo Scientific Superblock T20 blocking buffer. 9. Nitrocellulose membrane and two pieces of filter paper cut to 4.500  3.100 . 10. NanoDrop spectrophotometer. 11. Stratagene UV Stratalinker 2400. 12. Hybridization oven. 13. Bio-rad Bio-Dot apparatus. 14. 12-channel pipette. 15. Multi-channel filtered pipette tips.

102

Rochelle L. Tiedemann et al.

16. 96-well plate with concave bottom wells. 17. Active Motif anti-rabbit 5hmC antibody (pAb: 39791). 18. Film developer. 2.2 Modifications to Bisulfite Conversion Chemistry to Distinguish 5mC from 5hmC 2.2.1 TET-Assisted Bisulfite (TAB) Array Equipment and Reagents

1. Covaris E220 evolution sonicator. 2. Covaris microtube (130 μL volume). 3. Thermocycler. 4. PCR-tube strips (200 μL). 5. Heat block or incubator to 37  C. 6. DynaMag magnet. 7. Invitrogen Qubit fluorometer. 8. Invitrogen Qubit assay tubes. 9. Transilluminator (312 nm). 10. Agarose gel electrophoresis apparatus. 11. QUMA analysis software [44]. 12. 3 M Sodium Acetate pH 4.8. 13. 100% Ethanol. 14. Nuclease-free water. 15. Invitrogen Qubit dsDNA HS assay kit. 16. T4-Phage β-glucosyltransferase (T4-βGT). 17. ZYMO 5-Methylcytosine and 5-Hydroxymethylcytosine DNA Standard Set. 18. KAPA Biosystems KAPA Pure beads. 19. Tet oxidation reagent #1: 1.5 mM Fe(NH4)2(SO4)2. 20. Tet oxidation reagent #2: 83.3 mM NaCl, 167 mM HEPES pH 8.0, 4 mM ATP, 8.3 mM DTT, 3.33 mM α-ketoglutaric acid, 6.7 mM L-ascorbic acid. 21. TET2 catalytic domain (TET2-CD) 2.0 mg/mL. 22. ZYMO EZ DNA Methylation Kit. 23. Taq polymerase. 24. Agarose. 25. DNA Gel Extraction Kit. 26. Promega pGEM-T Vector System I. 27. DH5a high-efficiency competent cells. 28. X-gal. 29. Ampicillin agar bacterial plates. 30. illustra TempliPhi DNA Sequencing Template Amplification Kit.

Detecting Active Versus Passive DNA Demethylation 2.2.2 Oxidative Bisulfite (OxBS) Array

103

1. NuGEN TrueMethyl oxBS Module, Tecan Genomics, Inc. (Catalog #: 0414-32).

Equipment and Reagents

3

Methods

3.1 Benchtop Assays to Detect DNA Modification Change

We treated NCCIT cells (biological duplicate) with PBS (NoTx), 1 μM DAC to induce passive DNA demethylation, and 1 μM DAC with 57 μM VitC (DAC + VitC) to induce both passive and active DNA demethylation (Fig. 2a). In order to conduct TAB array or OxBS array, each gDNA sample must undergo two different treatments: (1) bisulfite conversion and (2) TAB/OxBS conversion. Both treatments of an individual gDNA sample are then submitted for processing on the EPIC array, meaning that the user cost is doubled for analysis of each sample. Depending on the nature of the experiment, querying both 5mC and 5hmC on the EPIC array can become quite expensive. In this section, we describe quick, low-cost benchtop assays commonly used in our laboratory to detect locus-specific and global changes in 5mC and 5hmC across gDNA samples of interest prior to submission on the EPIC array.

3.1.1 Locus-Specific High-Resolution Melt (HRM) Analysis

High-resolution melt (HRM) analysis is a quantitative, real-time PCR-based method that allows the user to determine the relative nucleotide composition of a region of double-stranded DNA by analyzing the melting curve of a PCR amplicon [45]. Initially designed to identify mutations and polymorphisms in a gDNA sample, HRM has been adapted for use in epigenetics research to determine the relative amount of DNA modifications at a given locus [46, 47]. Following DNA isolation, a sodium bisulfite conversion step is performed to make single nucleotide polymorphisms (SNPs) to the DNA that indicate if a cytosine nucleotide was modified. If the cytosine is modified (either 5mC or 5hmC), the C will stay a C, but if the cytosine is unmodified, it will be deaminated to uracil (and converted into thymine during PCR amplification). HRM takes advantage of these methylation-specific SNPs. After bisulfite conversion, regions of interest in the genome are amplified by real-time qPCR, and then a high-resolution melt step, in which the temperature is raised in very small increments and fluorescence is detected after each increment, is conducted to determine the melting temperature of the amplicon. The more Ts (unmodified cytosines) in the amplicon, the lower the melting temperature; the more Cs (modified cytosines) in the amplicon, the higher the melting temperature. By using differences in melting temperature of an amplicon across samples, the relative DNA modification state of a sample can be determined.

104

Rochelle L. Tiedemann et al.

A

0 hr

24 hr PBS PBS DAC PBS DAC + Vitamin C Vitamin C

NoTx DAC DAC+VitC

Start Treatments

Seed cells

Re-treat

48 hr

PBS PBS Vitamin C

Re-treat

72 hr

Harvest

B 2500

-d(RFU)/dT

2000

2000

PPP1R18

RPL30

1500

NoTx DAC DAC+VitC DKO1

1000

1500 1000 1000

0

500

500

500

70

75

80

Temp (C)

-500

C

1500

DAXX

0.20

85

0

0 70

Temp (C)

-500

pval < 0.0001 pval = 0.019

D

75

NoTx

DAC

70

80 -500

DAC+VitC

75

80

85

Temp (C)

NoTx

DAC

DAC+VitC

%5hmC

0.15

0.10

0.05

α-5hmC

Methylene Blue

DAC+VitC

DAC

NoTx

0.00

Fig. 2 Assays to measure DNA methylation changes in isolated gDNA samples prior to EPIC array analysis. (a) Drug treatment paradigm in NCCIT cells. Cells were treated with PBS (NoTx), 1 μM DAC (DAC), or 1 μM DAC and 57 μM Vitamin C (DAC + VitC) for 72 h as shown. (b) High-resolution melt (HRM) curve analysis of candidate modified (exons of PPP1R18 and DAXX) and unmodified (promoter of RPL30) regions in NCCIT cells. An average of technical duplicates is shown. gDNA from HCT116 cells with knockout of DNMT1 and DNMT3B alleles (DKO1) is included as a positive control for DNA demethylation. (c) Global quantification of 5hmC in NCCIT cells (treated as described in a) with the ELISA-based MethylFlash Hydroxymethylated DNA 5-hmC Quantification Kit (EpiGentek). Error bars represent SEM among biological duplicates and technical duplicates. Unpaired t-tests were conducted to determine p-values. (d) DNA dot blot analysis for 5hmC in NCCIT cells (treated as described in a). 800 ng of DNA was loaded on the top row followed by serial twofold dilutions in the subsequent rows. Methylene blue staining is a loading control for total DNA

Detecting Active Versus Passive DNA Demethylation

105

In our treatment paradigm (Fig. 2a), we measured a decrease in the peak melting temperature for DAC and DAC + VitC samples relative to the NoTx group, indicating that the genomic loci being queried (PPP1R18, DAXX) have less modified cytosines than the NoTx group (Fig. 2b). The RPL30 promoter served as a negative control for cytosine modifications, as it is completely unmodified in NCCIT (Fig. 2b). RPL30 also served as a positive control for bisulfite conversion, as amplification of this region could not occur without high conversion efficiency. Collectively, these results demonstrate that the DAC treatment was effective in reducing the overall modification level of cytosines at known regions of modification in the NoTx sample, indicating that these samples and treatment paradigms were good candidates for EPIC array analysis. General Procedure

1. Design bisulfite qPCR primers for regions of interest, including a known fully modified region and a known fully unmodified region, using MethPrimer [48] with the following specifications: (a) Primer Length: between 20 and 30 bp. (b) Amplicon Length: between 100 and 150 bp. (c) Tm of primer set: between 58 and 61  C. (d) May allow one CpG in the first 1/3 of the primer. (e) Aim to have at least three CpGs in the amplicon so that melting temperatures will be noticeably divergent. 2. Using the ZYMO EZ DNA Methylation kit, bisulfite convert 500 ng of sample gDNA as described in the kit protocol. Elute in 10 μL of nuclease-free water, then dilute sample with 42 μL of nuclease-free water (see Notes 1–3). 3. Optimize primers by real-time qPCR on bisulfite-converted gDNA. Ensure that only one amplicon (one peak in the melting curve) is produced. 4. Set up each PCR reaction as follows: Reagent

Amount (μL)

10 Bio-Rad Precision Supermix

10

Bisulfite primers (2 μM)

2

Nuclease-free water

3

Bisulfite-converted gDNA

5

5. Set up the PCR protocol as follows: Step 1

95  C

2 min

Step 2

95  C

10 s

Step 3

Annealing Temp

30 s

106

Rochelle L. Tiedemann et al.

Repeat Steps 2 and 3 39. Step 4

95  C 

Step 5

60 C

Step 6

Melt Curve

30 s 1 min

65–95  C—10 s/step—increase temperature by 0.1  C each step, and capture fluorescence at end of each step. 6. The CFX manager software will automatically calculate the melting temperature of each sample. All fluorescence data can also be exported for each individual temperature measurement (“Melt Curve Derivative Results.xlsx”) to build the plots as shown in Fig. 2b (see Note 4). 3.1.2 Global Quantification of 5hmC

As 5mC is substantially more abundant in the genome than 5hmC (approximately 14-fold higher), quantification by HRM for passive loss of DNA methylation is sufficient. However, detecting global changes in 5hmC and active DNA demethylation is challenging due to the low level of this modification on cytosine nucleotides. In this section, we discuss two approaches to determine the global level of 5hmC across samples: (1) ELISA-based quantification and (2) 5hmC DNA Dot Blot.

ELISA-Based Assay

HRM analysis of DAC and DAC + VitC treated samples suggested substantial loss in cytosine modifications relative to NoTx (Fig. 2b). As 5mC is the most abundant cytosine modification, detection of changes in 5hmC are likely masked by 5mC changes in the HRM assay. Using the EpiGentek MethylFlash Global DNA Hydroxymethylation (5-hmC) ELISA Easy Kit (Colorimetric), we profiled global 5hmC levels in our gDNA samples to determine if treatment with DAC or DAC + VitC induced changes in 5hmC. Indeed, while DAC treatment did not significantly affect global 5hmC levels relative to NoTx, the addition of VitC to the DAC treatment lead to a significant increase in 5hmC detectable by this assay (Fig. 2c). Taken together with our HRM results of these gDNA samples, we concluded that our treatment conditions induced changes to both 5mC and 5hmC.

General Procedure

1. Prepare gDNA samples in a 96-well plate at a concentration of 25 ng/μL. A total of 100 ng gDNA is added to the assay wells. 2. Follow all assay instructions in the EpiGentek MethylFlash Global DNA Hydroxymethylation (5-hmC) ELISA Easy Kit (Colorimetric) manual (see Notes 5 and 6). 3. Follow analysis instructions as outlined in the EpiGentek MethylFlash Global DNA Hydroxymethylation (5-hmC) ELISA Easy Kit (Colorimetric) manual (see Note 7). Analyze all biological and technical duplicates separately.

Detecting Active Versus Passive DNA Demethylation DNA Dot Blot

General Procedure

107

For additional confirmation that our treatments sufficiently promoted changes in 5hmC levels, we performed gDNA dot blot analysis. Briefly, gDNA is denatured and immobilized on a nitrocellulose membrane prior to being probed with a 5hmC antibody. With this assay, changes in global 5hmC were detected in samples treated with DAC and DAC + VitC relative to NoTx (Fig. 2d). Complimenting the results of our HRM analysis and ELISA-based assays, we further concluded that both active and passive DNA demethylation would be observed in our samples after application to TAB array and OxBS array. 1. Pre-chill 10 M ammonium acetate on ice. 2. Use a NanoDrop spectrophotometer to measure gDNA sample concentration. 3. For each sample, prepare 2 μg gDNA in 225 μL 1 TE buffer (see Note 8). 4. Denature samples in 0.1 M NaOH at 95  C for 10 min. 5. Neutralize samples with 1 M ammonium acetate on ice. Incubate sample on ice for 10 min. 6. Load 240 μL of each sample into the top row of a 96-well plate. Load 120 μL 1 TE buffer in each sequential row. Using a multichannel pipette, ensure the samples in the top row containing gDNA are thoroughly mixed and transfer 120 μL to the row below. Repeat this process working down the rows to achieve twofold serial dilutions. 7. Equilibrate nitrocellulose membrane and two sheets of filter paper in 6 SSC buffer. 8. Secure membrane on top of filter papers in the dot blot apparatus. Tighten knobs as much as possible, apply vacuum, and re-tighten knobs. 9. Wash wells with 200 μL 1 TE buffer (see Note 9). 10. Using a multichannel pipette, apply 109 μL of each sample to the membrane. Final amount of gDNA is 800 ng followed by twofold serial dilutions. Allow samples to sit on membrane 2–5 min before applying vacuum (see Note 9). 11. Apply vacuum to pull samples through the manifold. Once each well has cleared, wash wells in 200 μL 2 SSC buffer. 12. Remove membrane from apparatus, mark corners with a pencil to maintain orientation, place in a covered container (we use pipette tip box lids), and dry at 80  C for 45 min in a hybridization oven. 13. UV-crosslink gDNA to membrane at 120,000 μJ. 14. Block for 1 h in Superblock at room temperature.

108

Rochelle L. Tiedemann et al.

15. Incubate blot overnight at 4  C in Active Motif anti-rabbit 5hmC antibody (pAb: 39791) diluted 1:5000 in Superblock. 16. Wash blot 3  5 min in 1 PBST buffer (see Note 10). 17. Incubate blot in rabbit secondary antibody diluted 1:5000 in Superblock at room temperature for 1 h. 18. Wash blot 3  5 min in 1 PBST buffer (see Note 10). 19. Use chemiluminescence to visualize blot. 20. For verification of gDNA loading, incubate blot in stripping buffer for 20–30 min. Rinse with distilled water and incubate in 5% methylene blue stain for 15–20 min. Rinse with distilled water and place between plastic to scan image. 3.2 Modifications to Bisulfite Conversion Chemistry to Distinguish 5mC from 5hmC

1. Quantify gDNA by Invitrogen Qubit fluorometer dsDNA HS assay and dilute 5 μg gDNA in nuclease-free water to a final volume of 130 μL. 2. Transfer prepared gDNA to a Covaris microtube, and shear sample with Covaris E220 sonicator to a final size of