Single Cell Methods: Sequencing and Proteomics [1st ed.] 978-1-4939-9239-3;978-1-4939-9240-9

Table of contents :
Front Matter ....Pages i-xvi
Front Matter ....Pages 1-1
Setting Up a Single-Cell Genomic Laboratory (Lira Mamanova)....Pages 3-8
Tissue Handling and Dissociation for Single-Cell RNA-Seq (Felipe A. Vieira Braga, Ricardo J. Miragaia)....Pages 9-21
Front Matter ....Pages 23-23
Full-Length Single-Cell RNA Sequencing with Smart-seq2 (Simone Picelli)....Pages 25-44
CEL-Seq2—Single-Cell RNA Sequencing by Multiplexed Linear Amplification (Itai Yanai, Tamar Hashimshony)....Pages 45-56
Single-Cell RNA-Seq by Multiple Annealing and Tailing-Based Quantitative Single-Cell RNA-Seq (MATQ-Seq) (Kuanwei Sheng, Chenghang Zong)....Pages 57-71
Single-Cell RNA Sequencing with Drop-Seq (Josephine Bageritz, Gianmarco Raddi)....Pages 73-85
Chromium 10× Single-Cell 3′ mRNA Sequencing of Tumor-Infiltrating Lymphocytes (Marco De Simone, Grazisa Rossetti, Massimiliano Pagani)....Pages 87-110
Seq-Well: A Sample-Efficient, Portable Picowell Platform for Massively Parallel Single-Cell RNA Sequencing (Toby P. Aicher, Shaina Carroll, Gianmarco Raddi, Todd Gierahn, Marc H. Wadsworth II, Travis K. Hughes et al.)....Pages 111-132
Single-Cell Tagged Reverse Transcription (STRT-Seq) (Kedar Nath Natarajan)....Pages 133-153
Single-Cell RNA-Sequencing of Peripheral Blood Mononuclear Cells with ddSEQ (Shaheen Khan, Kelly A. Kaihara)....Pages 155-176
High-Throughput Single-Cell Real-Time Quantitative PCR Analysis (Liora Haim-Vilmovsky)....Pages 177-183
Single-Cell Dosing and mRNA Sequencing of Suspension and Adherent Cells Using the PolarisTM System (Chad D. Sanada, Aik T. Ooi)....Pages 185-195
Targeted TCR Amplification from Single-Cell cDNA Libraries (Shuqiang Li, Kenneth J. Livak)....Pages 197-224
Front Matter ....Pages 225-225
Sequencing the Genomes of Single Cells (Veronica Gonzalez-Pena, Charles Gawad)....Pages 227-234
Studying DNA Methylation in Single-Cell Format with scBS-seq (Natalia Kunowska)....Pages 235-250
Single-Cell 5fC Sequencing (Chenxu Zhu, Yun Gao, Jinying Peng, Fuchou Tang, Chengqi Yi)....Pages 251-267
ChIPmentation for Low-Input Profiling of In Vivo Protein–DNA Interactions (Natalia Kunowska, Xi Chen)....Pages 269-282
Front Matter ....Pages 283-283
Immunophenotyping of Human Peripheral Blood Mononuclear Cells by Mass Cytometry (Susanne Heck, Cynthia Jane Bishop, Richard Jonathan Ellis)....Pages 285-303
Classification of the Immune Composition in the Tumor Infiltrate (Davide Brusa, Jean-Luc Balligand)....Pages 305-315
Front Matter ....Pages 317-317
Combined Genome and Transcriptome (G&T) Sequencing of Single Cells (Iraad F. Bronner, Stephan Lorenz)....Pages 319-362
Simultaneous Profiling of mRNA Transcriptome and DNA Methylome from a Single Cell (Youjin Hu, Qin An, Ying Guo, Jiawei Zhong, Shuxin Fan, Pinhong Rao et al.)....Pages 363-377
Simultaneous Targeted Detection of Proteins and RNAs in Single Cells (Aik T. Ooi, David W. Ruff)....Pages 379-392
Front Matter ....Pages 393-393
CRISPR Screening in Single Cells (Johan Henriksson)....Pages 395-406
Front Matter ....Pages 407-407
Single-Cell Live Imaging (Toru Hiratsuka, Naoki Komatsu)....Pages 409-421
Front Matter ....Pages 423-423
Differential Expression Analysis in Single-Cell Transcriptomics (Luca Alessandrì, Maddalena Arigoni, Raffaele Calogero)....Pages 425-432
A Bioinformatic Toolkit for Single-Cell mRNA Analysis (Kevin Baßler, Patrick Günther, Jonas Schulte-Schrepping, Matthias Becker, Paweł Biernat)....Pages 433-455
Back Matter ....Pages 457-459

Citation preview

Methods in Molecular Biology 1979

Valentina Proserpio Editor

Single Cell Methods Sequencing and Proteomics

METHODS

IN

MOLECULAR BIOLOGY

Series Editor John M. Walker School of Life and Medical Sciences University of Hertfordshire Hatfield, Hertfordshire, AL10 9AB, UK

For further volumes: http://www.springer.com/series/7651

Single Cell Methods Sequencing and Proteomics

Edited by

Valentina Proserpio Department of Life Sciences and System Biology, University of Turin, Italian Institute for Genomic Medicine, IIGM Turin, Torino, Italy

Editor Valentina Proserpio Department of Life Sciences and System Biology University of Turin, Italian Institute for Genomic Medicine, IIGM Turin Torino, Italy

ISSN 1064-3745 ISSN 1940-6029 (electronic) Methods in Molecular Biology ISBN 978-1-4939-9239-3 ISBN 978-1-4939-9240-9 (eBook) https://doi.org/10.1007/978-1-4939-9240-9 © Springer Science+Business Media, LLC, part of Springer Nature 2019 This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, express or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Humana Press imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer Nature. The registered company address is: 233 Spring Street, New York, NY 10013, U.S.A.

Preface From the first mRNA-Seq whole-transcriptome analysis in 2009, in less than 10 years, many new technologies and strategies have been rapidly developed in order to analyze the genome, transcriptome, and proteome of individual cells, scaling from few to hundreds of thousands of cells analyzed at a time. Since then, many new biological questions have opened, and many laboratories across the world have utilized single-cell omics for their research, with a parallel massive increase in the number of publications regarding single cells. Keeping up with such a rapidly evolving technology is not an easy task, and for someone that enters the “single-cell field” for the first time, this might look like a maze, a jungle of choices and possibilities. The aim of this Methods in Molecular Biology (MIMB) book is to give readers a comprehensive overview of the available options for investigating biological questions at the level of individual cells and to help them in deciding which way is best to follow for different biological questions. Written by outstanding scientists in the field, the book is organized into eight parts that span from organizing a single-cell lab to performing single-cell DNA-Seq, RNA-Seq, and proteomic experiments. The book also covers single-cell epigenetics, single-cell multi-omics analysis, screening, and live imaging of individual cells. Each chapter lists all the materials required for the experiment and describes every protocol in a detailed, step-by-step manner, with all the precautions that should be taken when working with individual cells. The authors wrote every procedure for experts as well as for readers with no prior knowledge, making each experiment simple to perform in every lab equipped with the listed instrumentation. With very rich and detailed “Notes” sections, in which scientists included all the small tips and hints to best perform every protocol and to avoid common practical mistakes, I am confident that this book will represent a very powerful resource for any lab that will approach any experiment at the level of individual cells. I would like to thank Dr. Sarah Teichmann for introducing me to the “single-cell world,” Prof. John Walker for the opportunity to edit this book and for his constant guidance, and all the authors for their amazing job, their time, and their effort to make this book as perfect and as comprehensive as possible. Torino, Italy

Valentina Proserpio

v

Acknowledgment Valentina Proserpio is supported by the Fondazione Umberto Veronesi.

vii

Contents Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

PART I

LAB SETUP AND TISSUE PREPARATION

1 Setting Up a Single-Cell Genomic Laboratory . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Lira Mamanova 2 Tissue Handling and Dissociation for Single-Cell RNA-Seq . . . . . . . . . . . . . . . . . . Felipe A. Vieira Braga and Ricardo J. Miragaia

PART II

v xiii

3 9

SINGLE CELL TRANCRIPTOMIC ANALYSIS

3 Full-Length Single-Cell RNA Sequencing with Smart-seq2 . . . . . . . . . . . . . . . . . . Simone Picelli 4 CEL-Seq2—Single-Cell RNA Sequencing by Multiplexed Linear Amplification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Itai Yanai and Tamar Hashimshony 5 Single-Cell RNA-Seq by Multiple Annealing and Tailing-Based Quantitative Single-Cell RNA-Seq (MATQ-Seq) . . . . . . . . . . . . . . . . . . . . . . . . . . . Kuanwei Sheng and Chenghang Zong 6 Single-Cell RNA Sequencing with Drop-Seq . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Josephine Bageritz and Gianmarco Raddi 7 Chromium 10
Single-Cell 30 mRNA Sequencing of Tumor-Infiltrating Lymphocytes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Marco De Simone, Grazisa Rossetti, and Massimiliano Pagani 8 Seq-Well: A Sample-Efficient, Portable Picowell Platform for Massively Parallel Single-Cell RNA Sequencing . . . . . . . . . . . . . . . . . . . . . . . . . . Toby P. Aicher, Shaina Carroll, Gianmarco Raddi, Todd Gierahn, Marc H. Wadsworth II, Travis K. Hughes, Chris Love, and Alex K. Shalek 9 Single-Cell Tagged Reverse Transcription (STRT-Seq) . . . . . . . . . . . . . . . . . . . . . . Kedar Nath Natarajan 10 Single-Cell RNA-Sequencing of Peripheral Blood Mononuclear Cells with ddSEQ. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Shaheen Khan and Kelly A. Kaihara 11 High-Throughput Single-Cell Real-Time Quantitative PCR Analysis. . . . . . . . . . Liora Haim-Vilmovsky

ix

25

45

57 73

87

111

133

155 177

x

Contents

12

Single-Cell Dosing and mRNA Sequencing of Suspension and Adherent Cells Using the PolarisTM System . . . . . . . . . . . . . . . . . . . . . . . . . . . . 185 Chad D. Sanada and Aik T. Ooi 13 Targeted TCR Amplification from Single-Cell cDNA Libraries . . . . . . . . . . . . . . . 197 Shuqiang Li and Kenneth J. Livak

PART III

SINGLE CELL GENOMIC AND EPIGENOMIC ANALYSIS

14

Sequencing the Genomes of Single Cells. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Veronica Gonzalez-Pena and Charles Gawad 15 Studying DNA Methylation in Single-Cell Format with scBS-seq . . . . . . . . . . . . . Natalia Kunowska 16 Single-Cell 5fC Sequencing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Chenxu Zhu, Yun Gao, Jinying Peng, Fuchou Tang, and Chengqi Yi 17 ChIPmentation for Low-Input Profiling of In Vivo Protein–DNA Interactions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Natalia Kunowska and Xi Chen

PART IV 18

19

227 235 251

269

SINGLE CELL PROTEOMIC ANALYSIS

Immunophenotyping of Human Peripheral Blood Mononuclear Cells by Mass Cytometry . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 285 Susanne Heck, Cynthia Jane Bishop, and Richard Jonathan Ellis Classification of the Immune Composition in the Tumor Infiltrate. . . . . . . . . . . . 305 Davide Brusa and Jean-Luc Balligand

PART V

SINGLE CELL MULTI OMIC ANALYSIS

20

Combined Genome and Transcriptome (G&T) Sequencing of Single Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 319 Iraad F. Bronner and Stephan Lorenz 21 Simultaneous Profiling of mRNA Transcriptome and DNA Methylome from a Single Cell . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 363 Youjin Hu, Qin An, Ying Guo, Jiawei Zhong, Shuxin Fan, Pinhong Rao, Xialin Liu, Yizhi Liu, and Guoping Fan 22 Simultaneous Targeted Detection of Proteins and RNAs in Single Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 379 Aik T. Ooi and David W. Ruff

PART VI 23

SINGLE CELL SCREENING

CRISPR Screening in Single Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 395 Johan Henriksson

Contents

PART VII 24

xi

SINGLE CELL LIVE IMAGING

Single-Cell Live Imaging . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 409 Toru Hiratsuka and Naoki Komatsu

PART VIII

SINGLE CELL DATA ANALYSIS

25

Differential Expression Analysis in Single-Cell Transcriptomics . . . . . . . . . . . . . . . 425 Luca Alessandrı`, Maddalena Arigoni, and Raffaele Calogero 26 A Bioinformatic Toolkit for Single-Cell mRNA Analysis . . . . . . . . . . . . . . . . . . . . . 433 ¨ nther, Jonas Schulte-Schrepping, Kevin Baßler, Patrick Gu Matthias Becker, and Paweł Biernat

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

457

Contributors TOBY P. AICHER  Ragon Institute of MGH, Harvard, and MIT, Cambridge, MA, USA; Department of Chemistry, Institute for Medical Engineering and Sciences (IMES), MIT, Cambridge, MA, USA; Broad Institute of MIT and Harvard, Cambridge, MA, USA LUCA ALESSANDRI`  Department of Molecular Biotechnology and Health Sciences, University of Torino, Torino, Italy QIN AN  Department of Human Genetics, David Geffen School of Medicine, UCLA, Los Angeles, CA, USA MADDALENA ARIGONI  Department of Molecular Biotechnology and Health Sciences, University of Torino, Torino, Italy KEVIN BAßLER  Department for Genomics and Immunoregulation, Life and Medical Sciences Institute (LIMES), University of Bonn, Bonn, Germany JOSEPHINE BAGERITZ  Division Signaling and Functional Genomics, German Cancer Research Center (DKFZ), Heidelberg, Germany JEAN-LUC BALLIGAND  Pole of Pharmacology and Therapeutics, Institute of Experimental and Clinical Research (IREC), Medical School, Universite´ Catholique de Louvain (UCL), Brussels, Belgium MATTHIAS BECKER  Department for Genomics and Immunoregulation, Life and Medical Sciences Institute (LIMES), University of Bonn, Bonn, Germany; Platform for Single Cell Genomics and Epigenomics, German Center for Neurodegenerative Diseases (DZNE), University of Bonn, Bonn, Germany PAWEŁ BIERNAT  Department for Genomics and Immunoregulation, Life and Medical Sciences Institute (LIMES), University of Bonn, Bonn, Germany CYNTHIA JANE BISHOP  NIHR Biomedical Research Centre at Guy’s and St Thomas’ Hospital and King’s College London, London, UK IRAAD F. BRONNER  Single Cell Genomics Core Facility, Wellcome Sanger Institute, Wellcome Genome Campus, Cambridge, UK DAVIDE BRUSA  Flow Cytometry Platform, Institute of Experimental and Clinical Research (IREC), Universite´ Catholique de Louvain (UCL), Brussels, Belgium RAFFAELE CALOGERO  Department of Molecular Biotechnology and Health Sciences, University of Torino, Torino, Italy SHAINA CARROLL  Ragon Institute of MGH, Harvard, and MIT, Cambridge, MA, USA; Department of Chemistry, Institute for Medical Engineering and Sciences (IMES), MIT, Cambridge, MA, USA; Broad Institute of MIT and Harvard, Cambridge, MA, USA XI CHEN  Wellcome Sanger Institute, Wellcome Genome Campus, Cambridge, UK MARCO DE SIMONE  Istituto Nazionale Genetica Molecolare INGM ‘Romeo ed Enrica Invernizzi’, Milan, Italy RICHARD JONATHAN ELLIS  NIHR Biomedical Research Centre at Guy’s and St Thomas’ Hospital and King’s College London, London, UK GUOPING FAN  Department of Human Genetics, David Geffen School of Medicine, UCLA, Los Angeles, CA, USA SHUXIN FAN  Zhongshan Ophthalmic Center, State Key Laboratory of Ophthalmology, Sun Yat-Sen University, Guangzhou, China

xiii

xiv

Contributors

YUN GAO  Biodynamic Optical Imaging Center, Beijing Advanced Innovation Center for Genomics, School of Life Sciences, Peking University, Beijing, People’s Republic of China CHARLES GAWAD  Department of Oncology, St. Jude Children’s Research Hospital, Memphis, TN, USA; Department of Computational Biology, St. Jude Children’s Research Hospital, Memphis, TN, USA TODD GIERAHN  Koch Institute for Integrative Cancer Research, MIT, Cambridge, MA, USA VERONICA GONZALEZ-PENA  Department of Oncology, St. Jude Children’s Research Hospital, Memphis, TN, USA; Department of Computational Biology, St. Jude Children’s Research Hospital, Memphis, TN, USA PATRICK GU¨NTHER  Department for Genomics and Immunoregulation, Life and Medical Sciences Institute (LIMES), University of Bonn, Bonn, Germany YING GUO  The Second Affiliated Hospital, Xiangya School of Medicine, Central South University, Changsha, China LIORA HAIM-VILMOVSKY  EMBL-European Bioinformatics Institute, Wellcome Trust Genome Campus, Cambridge, UK; Wellcome Sanger Institute, Wellcome Genome Campus, Cambridge, UK TAMAR HASHIMSHONY  Lokey Interdisciplinary Center for Life Sciences and Engineering, Technion–Israel Institute of Technology, Haifa, Israel SUSANNE HECK  NIHR Biomedical Research Centre at Guy’s and St Thomas’ Hospital and King’s College London, London, UK JOHAN HENRIKSSON  Molecular Infection Medicine Sweden, Umea˚ University, Umea˚, Sweden TORU HIRATSUKA  Centre for Stem Cells and Regenerative Medicine, King’s College London, Guy’s Hospital, London, UK YOUJIN HU  Zhongshan Ophthalmic Center, State Key Laboratory of Ophthalmology, Sun Yat-Sen University, Guangzhou, China TRAVIS K. HUGHES  Ragon Institute of MGH, Harvard, and MIT, Cambridge, MA, USA; Department of Chemistry, Institute for Medical Engineering and Sciences (IMES), MIT, Cambridge, MA, USA; Broad Institute of MIT and Harvard, Cambridge, MA, USA KELLY A. KAIHARA  Digital Biology Center, Bio-Rad Laboratories, Pleasanton, CA, USA SHAHEEN KHAN  Department of Immunology, University of Texas Southwestern Medical Center, Dallas, TX, USA NAOKI KOMATSU  Laboratory for Cell Function Dynamics, RIKEN Center for Brain Science, Wako, Saitama, Japan NATALIA KUNOWSKA  Wellcome Sanger Institute, Wellcome Genome Campus, Cambridge, UK SHUQIANG LI  Broad Institute of MIT and Harvard, Cambridge, MA, USA; Translational Immunogenomics Lab, Dana-Farber Cancer Institute, Boston, MA, USA XIALIN LIU  Zhongshan Ophthalmic Center, State Key Laboratory of Ophthalmology, Sun Yat-Sen University, Guangzhou, China YIZHI LIU  Zhongshan Ophthalmic Center, State Key Laboratory of Ophthalmology, Sun Yat-Sen University, Guangzhou, China KENNETH J. LIVAK  Translational Immunogenomics Lab, Dana-Farber Cancer Institute, Boston, MA, USA STEPHAN LORENZ  Single Cell Genomics Core Facility, Wellcome Sanger Institute, Wellcome Genome Campus, Cambridge, UK; Clinical Genomics Laboratory, Sidra Medicine, Doha, Qatar

Contributors

xv

CHRIS LOVE  Ragon Institute of MGH, Harvard, and MIT, Cambridge, MA, USA; Broad Institute of MIT and Harvard, Cambridge, MA, USA; Koch Institute for Integrative Cancer Research, MIT, Cambridge, MA, USA; Department of Chemical Engineering, Massachusetts Institute of Technology, Cambridge, MA, USA LIRA MAMANOVA  Wellcome Sanger Institute, Wellcome Genome Campus, Hinxton, Cambridge, UK RICARDO J. MIRAGAIA  Wellcome Sanger Institute, Wellcome Genome Campus, Hinxton, Cambridge, UK KEDAR NATH NATARAJAN  Functional Genomics and Metabolism Unit, Danish Institute of Advanced Study (D-IAS), University of Southern Denmark, Odense, Denmark AIK T. OOI  Fluidigm Corporation, South San Francisco, CA, USA MASSIMILIANO PAGANI  Istituto Nazionale Genetica Molecolare INGM ‘Romeo ed Enrica Invernizzi’, Milan, Italy; Department of Medical Biotechnology and Translational ` Degli Studi di Milano, Milan, Italy Medicine, Universita JINYING PENG  State Key Laboratory of Protein and Plant Gene Research, School of Life Sciences, Peking University, Beijing, People’s Republic of China SIMONE PICELLI  German Centre for Neurodegenerative Diseases (DZNE), Bonn, Germany GIANMARCO RADDI  Wellcome Sanger Institute, University of Cambridge, Hinxton, UK; NIAID at National Institutes of Health, Bethesda, MD, USA; David Geffen School of Medicine at UCLA, Los Angeles, CA, USA PINHONG RAO  Zhongshan Ophthalmic Center, State Key Laboratory of Ophthalmology, Sun Yat-Sen University, Guangzhou, China GRAZISA ROSSETTI  Istituto Nazionale Genetica Molecolare INGM ‘Romeo ed Enrica Invernizzi’, Milan, Italy DAVID W. RUFF  Mission Bio, Inc., South San Francisco, CA, USA CHAD D. SANADA  Fluidigm Corporation, South San Francisco, CA, USA JONAS SCHULTE-SCHREPPING  Department for Genomics and Immunoregulation, Life and Medical Sciences Institute (LIMES), University of Bonn, Bonn, Germany ALEX K. SHALEK  Ragon Institute of MGH, Harvard, and MIT, Cambridge, MA, USA; Department of Chemistry, Institute for Medical Engineering and Sciences (IMES), MIT, Cambridge, MA, USA; Broad Institute of MIT and Harvard, Cambridge, MA, USA; Koch Institute for Integrative Cancer Research, MIT, Cambridge, MA, USA KUANWEI SHENG  Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX, USA FUCHOU TANG  Biodynamic Optical Imaging Center, Beijing Advanced Innovation Center for Genomics, School of Life Sciences, Peking University, Beijing, People’s Republic of China; Peking-Tsinghua Center for Life Sciences, Peking University, Beijing, People’s Republic of China; Ministry of Education Key Laboratory of Cell Proliferation and Differentiation, Peking University, Beijing, People’s Republic of China FELIPE A. VIEIRA BRAGA  Wellcome Sanger Institute, Wellcome Genome Campus, Hinxton, Cambridge, UK MARC H. WADSWORTH II  Ragon Institute of MGH, Harvard, and MIT, Cambridge, MA, USA; Department of Chemistry, Institute for Medical Engineering and Sciences (IMES), MIT, Cambridge, MA, USA; Broad Institute of MIT and Harvard, Cambridge, MA, USA ITAI YANAI  Institute for Computational Medicine, NYU School of Medicine, New York, NY, USA

xvi

Contributors

CHENGQI YI  State Key Laboratory of Protein and Plant Gene Research, School of Life Sciences, Peking University, Beijing, People’s Republic of China; Peking-Tsinghua Center for Life Sciences, Peking University, Beijing, People’s Republic of China; Department of Chemical Biology and Synthetic and Functional Biomolecules Center, College of Chemistry and Molecular Engineering, Peking University, Beijing, People’s Republic of China JIAWEI ZHONG  Zhongshan Ophthalmic Center, State Key Laboratory of Ophthalmology, Sun Yat-Sen University, Guangzhou, China CHENXU ZHU  State Key Laboratory of Protein and Plant Gene Research, School of Life Sciences, Peking University, Beijing, People’s Republic of China CHENGHANG ZONG  Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX, USA

Part I Lab Setup and Tissue Preparation

Chapter 1 Setting Up a Single-Cell Genomic Laboratory Lira Mamanova Abstract Transcriptomics has been revolutionized by massive throughput RNA-seq. To date, the ongoing decrease in sequencing cost and recent eruption of single-cell related protocols have boosted a demand for single-cell RNA sequencing projects. Although the single-cell RNA-Seq (scRNA-Seq) approach is close to the conventional “bulk” RNA-seq, several features that are unique to scRNA-seq should be taken into consideration in order to obtain high-quality libraries and unbiased sequencing data. In this chapter I give recommendations for setting up the single cell-suitable laboratory environment. Key words Single-cell RNA-seq (scRNA-seq), RNase-free, Contamination, Aliquots, Automation, Liquid handling, Musculoskeletal disorders (MSD)

1

Introduction Despite the growing interest for single-cell RNA sequencing in the scientific community, only few centers worldwide have the specialized skills and equipment to accommodate the demand for it. Single-cell RNA sequencing (scRNA-Seq) procedures are not standard and are quite challenging for individual laboratories to perform, and not many of them have an open access to specialized facilities [1]. Due to technical limitations, most of the recent research employed “population-level” techniques that should be modified to accommodate new requirements for the single-cell laboratory setup, such as sample and reagent handling, conducting experiments, and QC parameters. One of the factors that should be taken into consideration is that the handling of an individual cell is much more challenging than that of a pool of cells [2]. The minute amount of starting RNA from a single cell is prone to degradation, sample loss, and elevated background noise in sequencing data. To avoid RNA degradation samples should be always kept in a RNase free environment on ice or any other available cooler racks during preparation and reaction setup.

Valentina Proserpio (ed.), Single Cell Methods: Sequencing and Proteomics, Methods in Molecular Biology, vol. 1979, https://doi.org/10.1007/978-1-4939-9240-9_1, © Springer Science+Business Media, LLC, part of Springer Nature 2019

3

4

Lira Mamanova

Fig. 1 PCR workstation/PCR hood

Since a very low amount of RNA is used, extra effort should be taken to avoid sample and reagent contamination. The sources of contamination can be of different nature, including untreated surfaces, pipettes, gloves, equipment, and reagents [3]. An efficient and reliable decontamination procedure should be applied before and after the experiment. RNA-related work should be carried out in a specially designated clean room or in PCR workstation/PCR hood that is equipped with UV lights for sterilization (Fig. 1). In addition, RNase-free reagents, barrier tips, and ultrapure water should be used for scRNA-seq experiment setup [4]. Today’s single-cell studies are typically conducted with thousands of cells per experiment. Most of the standard laboratories employ manual liquid handling, resulting in a quite low throughput, that can be error prone, technically variable, and time-consuming. Automation of scRNA-seq protocols on robotic platforms allows for parallel processing of individual cells at an unprecedented scale and facilitates high-throughput single-cell profiling [5]. Over the past few years, the advances in benchtop automated workstations and dispensing instruments have resulted in increased throughput, accuracy, and reproducibility of scRNA-seq methods (Figs. 2 and 3). It also provides significant reduction in sample reaction volume, minimizes reagent dead volume, tip consumption, and hands-on time that overall results in cost-effective largescale single-cell studies. Another important aspect of automation exploitation is a growing concern regarding the development of musculoskeletal disorders (MSD) that are usually caused by continuous physical stress on specific body parts in repetitive tasks, including excessive pipetting, working at microscopes, and using cell counters [6]. If left

Setting Up a Single-Cell Genomic Laboratory

5

Fig. 2 Benchtop automated microplate handling workstation

Fig. 3 Benchtop liquid handling dispenser

untreated these conditions can become chronic, resulting in significant pain and discomfort to individuals, which in some instances can be career-threatening. The use of liquid handling robots can prevent development of such disorders by substitution of highly repetitive steps in protocols and can be used as a practical

6

Lira Mamanova

ergonomic solution. Therefore, while planning the single-cell laboratory setup good ergonomic design principles should be considered and employed, to eliminate where practicable, or significantly reduce, the risk factors for MSDs. Here we describe a single-cell RNA laboratory setup for both small laboratories and large institutions.

2

Materials

2.1 Experimental Procedure and QC

1. It is important to record batch or lot numbers of all reagents and plasticware used in an experiment. This information can be used during troubleshooting procedures in order to exclude these components as the potential source of contamination if such a situation occurs. 2. Reagent aliquoting should be done using a standard procedure if a reagent is supplied in a large volume, including RNase-free water. This will ensure decreasing reagent thaw–freeze cycles, significant reduction of contamination and provide protocol continuity and consistency. 3. Another essential part of the experimental design is including template and reagent controls as a QC measure of the experiment. Introduction of nontemplate and nonreagent controls allows for monitoring contamination, and commercial RNA and DNA templates verify the viability of the biological material and efficiency of the protocol. 4. Due to low reaction volumes used in scRNA protocols, singlecell samples are prone to evaporation that subsequently lead to ultimate technical experiment failure. In order to avoid this issue, suitable plasticware and plate seals should be chosen for a particular protocol. 5. Practically, standard csRNA-Seq protocols and especially commercial kits are quite costly, especially for experiments involving hundreds of thousands of samples. The use of low-bind plates and vials, and low-retention tips can diminish sample loss and decrease waste of expensive reagents by keeping the master mix dead volume to the minimum.

2.2 Workplace, Equipment, Reagents and Samples Handling

1. It is crucial to keep pre-PCR and post-PCR areas clearly divided, with pre-PCR area mainly for RNA work. In case there is limited laboratory space the PCR workstations/PCR hoods can be used to prevent contamination with exogenous oligos, DNA, or RNA. 2. Due to the low volumes used in scRNA protocols it is important to recognize the risk associated with out-of-calibration pipettes, the role of routine pipette checks, and good pipetting practice.

Setting Up a Single-Cell Genomic Laboratory

7

3. Put the necessary equipment, including a vortexer, mini centrifuge, pipetting devices, plasticware and cooler racks, inside the hood. 4. Wipe the surface, equipment, plasticware, pipetting devices, and cooler racks with fresh 80% EtOH. 5. Wipe the surface, equipment, plasticware, pipetting devices, and cooler racks with widely available RNase-removing solutions or 5% bleach. 6. Irradiate a PCR hood with UV for 20–30 min. 7. Keep reagents and samples in the fridge/freezer during decontamination procedures. 8. Wipe reagent vials with an RNase-removing solution and place in a rack for defrosting in the hood. Keep enzymes/enzyme mixes in cooling racks. 9. Spin down thawed reagents, mix by pipetting or vortexing, and spin down again. Keep reagents in cooling racks from now on. 10. Keep biological material in the fridge or freezer until the PCR hood and reagent master mix are ready to use. 11. In case you touch objects outside the sterile hood, immediately change the gloves or wipe with 80% EtOH and RNaseremoving solutions. 12. Owing to very low reaction volumes, it is important to consider a thermal cycler with a “smart lid” in order to minimize sample evaporation. Also samples should be spun down and visually inspected after every manipulation. 13. In addition, to increase throughput it is beneficial to choose multiblock PCR instruments over single-block thermocyclers (Fig. 4).

Fig. 4 Multiblock PCR instrument

8

Lira Mamanova

References 1. Haque A, Engel J, Teichmann SA, Lo¨nnberg T (2017) A practical guide to single-cell RNA-sequencing for biomedical research and clinical applications. Genome Med 9:75 2. Perkel JM (2017) Single-cell sequencing made simple. Nature 547:125–126 3. Champlot S, Berthelot C, Pruvost M, Bennett EA, Grange T, Geigl EM (2010) An efficient multistrategy DNA decontamination procedure of PCR reagents for hypersensitive PCR applications. PLoS One 5(9):1–15

4. Kroneis T (2015) Whole genome amplification. Methods Mol Biol 1347:43–55 5. Yuan J, Sims PA (2016) Automated microwell platform for large-scale single cell RNA-Seq. Nature 6:1–10 6. Haile EL, Taye B, Hussen F (2012) Ergonomic workstations and work-related musculoskeletal disorders in the clinical laboratory. Lab Medicine 43:11–12

Chapter 2 Tissue Handling and Dissociation for Single-Cell RNA-Seq Felipe A. Vieira Braga and Ricardo J. Miragaia Abstract The starting material for all single-cell protocols is a cell suspension. The particular functions and spatial distribution of immune cells generally make them easy to isolate them from the tissues where they dwell. Here we describe tissue dissociation protocols that have been used to obtain human immune cells from lymphoid and nonlymphoid tissues to be then used as input to single-cell methods. We highlight the main factors that can influence the final quality of single-cell data, namely the stress signatures that can bias its interpretation. Key words Single-cell RNA sequencing, Tissue processing, Digestion, Single-cell suspension, Immune cells

1

Introduction All single-cell protocols start with a suspension of cells. For most tissues, this means that beforehand, the extracellular matrix that holds cells together has to be processed to loosen this mesh and to induce the release of cells into suspension. Depending on the tissue in question and the cells of interest, different approaches and a variety of conditions can be used to get a cell suspension. The functions of immune cells usually require them to move within and between tissues. Not surprisingly, they are quite resilient to being removed from a 3D tissue and to remain in suspension, in contrast with structural cell types, as epithelial and endothelial cells, which heavily depend on physical interactions with neighboring cells. Additionally, as immune cells do not constitute structural blocks of the tissues they reside in, they are generally easier to release. These two main features largely influence the dissociation protocols for immune cell isolation. Dissociation of tissues for single-cell protocols can be achieved by mechanical means, such as simple mashing, dicing, or slicing. For example, for lymphoid organs as the spleen and lymph nodes, most immune cell types can easily be isolated by mashing the tissue

Valentina Proserpio (ed.), Single Cell Methods: Sequencing and Proteomics, Methods in Molecular Biology, vol. 1979, https://doi.org/10.1007/978-1-4939-9240-9_2, © Springer Science+Business Media, LLC, part of Springer Nature 2019

9

10

Felipe A. Vieira Braga and Ricardo J. Miragaia

through a cell strainer. When the cells of interest are embedded in more densely packed tissues, such as the dermis or the colonic lamina propria, enzymes that target collagen and other structural molecules must be used. The choice of enzyme for each tissue will depend on the composition of the extracellular matrices in terms of molecules such as fibronectin, different types of collagen, and accutin. In a lot of cases, dissociation protocols use a combination of both approaches to decrease the overall processing time: a mechanical step breaks up the tissue, increasing the surface area, followed by an enzymatic treatment. Addition of cell selection steps allowing for enrichment/depletion of certain cell types (e.g., dead cell removal, CD45 enrichment, flow cytometry), is common to most dissociation protocols. Despite their overall resilience, it is important to be aware that immune cell types can be affected by the harsh conditions of tissue dissociation. In single-cell RNA sequencing data of other cell types, it has been shown that enzymatic digestions can induce gene expression changes of a set of immediate-early genes, which then create artificial subpopulations in biologically homogeneous cell populations [1–3]. We have seen that similar artifacts can be detected to some extent in immune cell types such as T cells. Decreasing the time and temperature of digestions as much as possible is recommended in order to minimize these unwanted effects. Minimizing all other potential sources of stress, such as temperature changes, mechanical stress, and overall processing time, is recommended (see Note 1). In this chapter we describe several human lymphoid and nonlymphoid tissue dissociation protocols that have been used to obtain single-cell suspensions that were then successfully used as input for single-cell protocols.

2

Materials All protocols require basic lab material such as pipette aid, and different sizes of serological pipettes and pipettes. Prior to processing, tissues are kept in storage buffer, which usually consists of an organ preservation solution (e.g., University of Wisconsin (UW) solution, Hypothermosol).

2.1

Human Blood

1. 50 mL Falcon tubes. 2. Sterile phosphate buffered saline (PBS). 3. Ficoll-Paque. 4. Fetal bovine serum (FBS). 5. Centrifuge (that allows for break regulation). 6. Washing medium: PBS containing 2% FBS.

Tissue Handling and Dissociation for Single-Cell RNA-Seq

11

7. All reagents for cell counting (Subheading 2.910), red blood cells (RBC) lysis (Subheading 2.6), and dead cell removal (Subheading 2.78). 2.2

Human Spleen

1. 100 μM cell strainers. 2. 10 cm petri dish. 3. 2 mL syringe. 4. 50 mL Falcon tubes. 5. Disposable scalpels. 6. Fetal calf serum (FCS). 7. Forceps. 8. Sterile phosphate buffered saline (PBS). 9. Red blood cell lysis. 10. Washing medium: PBS containing 2% FCS. 11. All reagents for cell counting (Subheading 2.10), RBC lysis (Subheading 2.6), and dead cell removal (Subheading 2.78).

2.3 Human Lymph Node

1. Collagenase D. 2. DNAse I. 3. 50 mL Falcon tubes. 4. Sterile phosphate buffered saline (PBS). 5. 100 μM cell strainer. 6. FBS. 7. 2 mL syringe. 8. DMEM. 9. Scalpel. 10. Dissection forceps. 11. Incubator or water bath at 37  C, ideally with shaker/rocker. 12. Washing medium: PBS containing 2% fetal bovine serum (FBS). 13. Digestion medium: DMEM + 1 mg/mL collagenase D + 0.1 mg/mL DNase I. Prepare 10 mL per lymph node. 14. Complete medium: DMEM + 10% FCS. 15. All reagents for cell counting (Subheading 2.910), RBC lysis (Subheading 2.6), and dead cell removal (Subheading 2.78).

2.4

Human Lung

1. 5 mL Eppendorf tube. 2. Collagenase D. 3. DNase I. 4. 50 mL Falcon tubes.

12

Felipe A. Vieira Braga and Ricardo J. Miragaia

5. Sterile phosphate buffered saline (PBS). 6. DMEM. 7. 70 μM cell strainer. 8. FBS. 9. 2 mL syringe. 10. 5 mL Eppendorf tubes. 11. Scalpel. 12. Dissection forceps. 13. Metzenbaum scissors. 14. 6 cm petri dish. 15. 10 cm petri dish. 16. Incubator or water bath at 37  C, ideally with shaker/rocker. 17. Complete medium: DMEM with 10% FBS. 18. Digestion medium: DMEM + 1 mg/mL collagenase D + 0.1 mg/mL DNase I. Prepare 20 mL per gram of tissue. 19. All reagents for cell counting (Subheading 2.910), RBC lysis (Subheading 2.6), dead cell removal (Subheading 2.78), and immune cell enrichment (Subheading 2.89). 2.5

Human Skin

1. 100 μm cell strainer. 2. 50 mL Falcon tubes. 3. Collagenase Type IV (Worthington Biochem): Reconstituted in sterile PBS at 160 mg/mL. 4. Dermatome with Pilling-Wecprep Blade. 5. Disposable scalpels. 6. DNAse I (Roche): Reconstituted in sterile water at 10 mg/mL. 7. Human skin sample. 8. One pair of large forceps. 9. Cork, wooden or Styrofoam square. 10. Petri dishes 10 cm. 11. RPMI medium, containing 10% heat-inactivated FCS, stored at 4  C. 12. Size 8 Goulian Guard. 13. Sterile phosphate buffered saline (PBS). 14. Two pins or needles. 15. Scalpels. 16. Incubator or water bath at 37  C, ideally with shaker/rocker. 17. Digestion medium: RPMI medium, 10% heat-inactivated FCS, 1.6 mg/mL collagenase Type IV, 0.1 mg/mL DNase I.

Tissue Handling and Dissociation for Single-Cell RNA-Seq

13

18. Complete medium: RPMI, 10% heat-inactivated FCS. Store at 4  C. 19. All reagents for cell counting (Subheading 2.910), RBC lysis (Subheading 2.6), dead cell removal (Subheading 2.78), and immune cell enrichment (Subheading 2.89). 2.6 Red Blood Cell Lysis

1. Red blood cell lysis solution. 2. Sterile phosphate buffered saline (PBS). 3. Washing medium: PBS containing 2% fetal bovine serum (FBS).

2.7 Dead Cell Removal

1. 15 mL Falcon Tubes. 2. CaCl2 (1 mM). 3. EasySep Dead Cell Removal Kit. 4. EasySep magnet. Depending on the absolute number of cells, different magnets should be used and volumes adapted accordingly. Here, we use “The Big Easy” magnet, which can be used to label up to 1  109 cells. 5. Fetal bovine serum (FBS). 6. Sterile phosphate buffered saline (PBS). 7. Resuspension medium: PBS containing 2% FBS and 1 mM CaCl2.

2.8 Immune Cell Enrichment

1. 15 mL Falcon tubes. 2. CD45 MicroBeads. 3. 30 μm cell filters. 4. MACS buffer: PBS pH 7.2, +0.5% BSA, +2 mM EDTA. 5. MACS columns. Depending on the absolute number of cells, MS (max of 2  108) or LS (max of 2  109) columns should be used and volumes adapted accordingly. 6. MACS magnet. MS and LS columns require different magnets. 7. MACS stand.

2.9

Cell Counting

1. 0.5 mL Eppendorfs. 2. Cell counting chamber or alternative method. 3. Trypan blue (see Note 2).

14

3 3.1

Felipe A. Vieira Braga and Ricardo J. Miragaia

Methods Blood

3.1.1 Tissue Collection and Preparation

1. To minimize changes in transcriptome and in blood cell proportions we recommend to work with fresh blood. If that is not possible, blood stored at 4  C shows less transcriptome changes then blood stored at room temperature. 2. If blood has been stored at 4  C, adjust it to room temperature for 15–30 min before starting the protocol. 3. Prepare a number of 50 mL Falcon tubes with 15 mL Ficoll in each of them. You will need one Falcon Tube per 15 mL. 4. If the final amount of blood after diluting with PBS (see below) is less than 15 mL, adjust Ficoll amounts to keep at least a 1:1 ratio Ficoll to diluted blood. 5. If using buffy coats, prepare six tubes with 15 mL of Ficoll each. 6. Prepare approximately 500 mL of Washing medium per buffy coat.

3.1.2 Neutrophils and Mononuclear Fraction Separation

1. Dilute blood 1 to 2.2 using fresh PBS. 2. If buffy coats are being used, dilute each buffy coat five times. 3. Carefully and very slowly pipet the blood on the wall of the tube so it forms a layer on top of the Ficoll without mixing the two fractions. 4. Centrifuge for 30 min at 700  g at room temperature, with acceleration four and deceleration zero (The use of room temperature and no break is essential for adequate gradient separation). This can take between 20 and 45 min total, depending on the centrifuge. 5. After centrifugation, you should have four layers. The upper most layer will be formed mostly of serum and PBS. The yellow small ring formed between the upper layer and the clear Ficoll underneath contains your mononuclear cells. The bottom most layer contains a mixture of red blood cells and neutrophils. 6. If interested in the mononuclear cell fraction, collect the yellow ring between the upper most layer and the clear Ficoll and transfer to a new 50 mL tube. If interested in the neutrophils, discard all the upper three fractions and use the red cell pellet for the next steps. 7. Add cold PBS to 50 mL. 8. Spin down at 360  g, 10 min, 4  C. 9. Discard supernatant very carefully, as the pellet is a bit loose at this step.

Tissue Handling and Dissociation for Single-Cell RNA-Seq

15

10. Resuspend pellet in 50 mL of washing medium. 11. Spin down at 360  g, 5 min, 4  C. 12. Discard supernatant carefully. 13. Resuspend pellet in 50 mL of washing medium. 14. Spin down at 360  g, 5 min, 4  C. 15. Repeat steps 12–14 two times more. 16. Discard supernatant and proceed to red blood cell lysis. 3.1.3 RBC Lysis

1. Add 5 mL of 1 Red blood cell lysis solution to your mononuclear cell pellet. If working with neutrophils, add 10 mL of 1 red blood cell lysis solution. 2. Incubate for 5 min at room temperature. 3. Add fresh cold PBS up to 50 mL. 4. Spin down at 360  g, 5 min, 4  C. 5. Discard supernatant. 6. Resuspend pellet in 50 mL of washing medium. 7. Spin down at 360  g, 5 min, 4  C. 8. Discard supernatant. 9. Resuspend in small volume of washing medium and count live and total cells. 10. Proceed for dead cell removal.

3.1.4 Dead Cell Removal

If total number of cells is below 2.5  107, resuspend in the minimum volume and adapt all volumes to it. See Notes 2–5. 1. Centrifuge samples at 500  g for 5 min. 2. Remove supernatant and resuspend in the appropriate volume of resuspension medium (0.25–8 mL) to obtain a suspension with 1  108 cells/mL. 3. Transfer cell suspension to a 15 mL Falcon. 4. Add Dead Cell Removal (Annexin V) Cocktail to sample (50 μL per mL of sample). 5. Add Biotin Selection Cocktail to sample (50 μL per mL of sample). 6. Mix (up and down with pipette) and incubate for 3 min at room temperature. 7. Vortex RapidSpheres™ for 30 s. Particles should appear evenly dispersed. 8. Add RapidSpheres™ to sample (100 μL per mL of sample) and mix. Proceed immediately to the next step.

16

Felipe A. Vieira Braga and Ricardo J. Miragaia

9. Add Resuspension medium to top up the sample to the indicated volume. Top up to 5 mL for samples 2 mL, and to 10 mL for samples >2 mL. 10. Mix by gently pipetting up and down 2–3 times. 11. Place the tube (without lid) into the magnet and incubate for 3 min at room temperature. 12. Pick up the magnet, and in one continuous motion invert the magnet and tube, pouring the enriched cell suspension into a new tube. Leave the magnet and tube inverted for 2–3 s, then return upright. Do not shake or blot off any drops that may remain hanging from the mouth of the tube. 13. Count cells and calculate viability. 3.2

Human Spleen

3.2.1 Tissue Collection and Preparation 3.2.2 Mechanical Dissociation

Upon collection, spleen samples should be kept in storage buffer, at 4  C, up until processing.

1. Remove spleen sample from storage buffer and place onto 10 cm petri Dish. 2. Add a little of cold washing medium to prevent tissue from drying. 3. Slice spleen sample into small pieces using forceps and scalpels (approximately 1 mm3). 4. Place a 100 μM cell strainer above a 50 mL Falcon Tube and transfer spleen pieces onto the cell strainer. 5. Wash plate with 10 mL Washing medium and pass through cell strainer into the 50 mL Falcon tube. 6. Mash spleen through cell strainer using a 2 mL syringe plunger. 7. Wash cell strainer with 10 mL of Washing medium. 8. Top up to 50 mL with Washing medium. (a) Spin down at 500  g, 5 min, 4  C. (b) Discard supernatant carefully. (c) Resuspend pellet in 50 mL of Washing medium. (d) Spin down at 500  g, 5 min, 4  C. (e) Discard supernatant carefully. (f) Proceed to red blood cell lysis.

3.2.3 RBC Lysis

See Subheading 3.1.3.

3.2.4 Dead Cell Removal

See Subheading 3.1.4.

Tissue Handling and Dissociation for Single-Cell RNA-Seq

3.3 Human Lymph Node

17

Upon collection, lymph node should be kept in storage buffer, at 4  C, up until processing.

3.3.1 Tissue Collection and Preparation 3.3.2 Mechanical Dissociation and Enzymatic Digestion

1. Remove lymph nodes from storage buffer and place onto 10 cm Petri Dish. 2. Add 10 mL of cold Washing medium. 3. Dissect out the connective tissue around the lymph node. 4. Place a 100 μm cell strainer above a 50 mL Falcon Tube and transfer one lymph node on to the cell strainer. 5. Mash lymph node through 100 μm cell strainer above a 50 mL Falcon Tube using a 2 mL syringe plunger, washing through with 10 mL Digestion medium (see Note 1). 6. Incubate for 15 min at 37  C, rotating. 7. Spin down at 360  g, 10 min, 4  C. 8. Discard supernatant carefully. 9. Resuspend pellet in 10 mL of Washing medium. 10. Spin down at 360  g, 5 min, 4  C. 11. Discard supernatant carefully. 12. Resuspend in 2 mL of Complete medium.

3.3.3 Dead Cell Removal

See Subheading 3.1.4.

3.4

Upon collection, lung samples should be kept in storage buffer, at 4  C, up until processing.

Human Lung

3.4.1 Tissue Collection and Preparation 3.4.2 Mechanical Dissociation and Enzymatic Digestion

1. Transfer the piece of tissue to a 10 cm petri dish and add enough Complete medium to cover it. 2. Using forceps and scalpel cut the tissue in smaller parts of approximately 0.2 g each. 3. Transfer each 0.2 g piece to a 5 mL eppendorf with 1 mL of Digestion medium. 4. Using Metzenbaum scissors, chop the piece inside the tube as finely as possible, until they look almost like sand. 5. Transfer the mashed tissue to a 6 cm petri dish. 6. Wash the eppendorf with 1 mL of digestion medium, transferring it to the 6 cm petri dish with the tissue. 7. Add approximately 2 mL of medium or enough to completely cover the tissue and the whole surface of the petri dish.

18

Felipe A. Vieira Braga and Ricardo J. Miragaia

8. Transfer it to an incubator at 37  C for 1 h under slow shaking conditions. If automatic shaking not available, mix the solution every 10 min. 9. Collect the sample and filter the cells through a 70 μm cell strainer into a 50 mL falcon tube. Using the plunger of a syringe, repeatedly mash the filter and rinse with cold complete medium up to 25 mL. 10. Spin down at 360  g, 10 min, 4  C. Acceleration 4, brake 2. 11. Very carefully discard the supernatant. 12. Resuspend the cell pellet in 25 mL of complete medium. 13. Spin down at 360  g, 10 min, 4  C. Acceleration 4, brake 2. 14. Very carefully discard the supernatant. 15. Repeat steps 12–14 one more time. 16. Proceed to red blood cell lysis. 3.4.3 RBC Lysis

See Subheading 3.1.3.

3.4.4 Dead Cell Removal

See Subheading 3.1.4.

3.4.5 Immune Cell Enrichment

To enrich the lung cell suspensions in immune cell types, we usually use MACS as described below. See Note 6. Volumes recommended for a total of 107 cells or less, unless specifically mentioned. If above 107 cells, increase volumes proportionally. 1. To remove cell clumps and avoid clogging of the column, pass cell suspension through a 30 μm strainer. 2. Centrifuge cell suspension at 500  g for 5 min and discard supernatant. 3. Resuspend cell pellet in 80 μL of buffer. 4. Add 20 μL of CD45 MicroBeads. 5. Mix well and incubate for 15 min in the refrigerator (2–8  C). Do not place on ice. 6. Wash cells by adding 1–2 mL of buffer. Centrifuge at 500  g for 5 min and discard supernatant. 7. Resuspend up to 108 cells in 500 μL of buffer. (For higher cell numbers, scale up buffer volume accordingly). 8. Place MS or LS column on the MACS magnet and position a 15 mL Falcon tube below it. 9. Prepare column by rinsing with buffer: MS: 500 μL; LS: 3 mL. 10. Load the 1–2 mL cell suspension onto the column and wait for the column reservoir to be empty.

Tissue Handling and Dissociation for Single-Cell RNA-Seq

19

11. Wash column by adding appropriate volume of buffer and repeat for a total of three times. Wait for the reservoir to be empty between washes. MS: 3  500 μL LS: 3  3 mL. 12. Discard the flow-through, which contains unlabeled cells (mostly CD45 ). 13. Remove column from the MACS magnet and place it on a suitable collection tube. 14. Pipet the appropriate amount of buffer onto the column. MS: 1 mL; LS: 5 mL. 15. Flush out the magnetically labeled cells by firmly pushing the column plunger into the column. 3.5

Human Skin

3.5.1 Tissue Collection and Preparation

Skin can be a challenging tissue to obtain good quality single-cell suspensions from due to the harsh digestion conditions required to dissociate it. This protocol, previously described by Gunawan et al. [4], can be used for this purpose. Upon collection, skin samples should be kept in storage buffer, at 4  C, up until processing. 1. Place skin on a petri dish with little PBS to prevent it from getting dry. 2. Holding the skin with a forceps, use a disposable scalpel to scrape subcutaneous fat. After removing it, move the skin to a clean petri dish, as fat can interfere with digestion later on. 3. If samples are large enough, cut the skin into 1.5 cm  4 cm pieces using a disposable scalpel. 4. Pin one end of the skin strip onto a wooden, cork, or Styrofoam block, with the epidermis facing up. 5. Flatten and pull skin tight with large forceps. 6. Cut the skin using a dermatome by gentle horizontal movement of the hand with slight downward traction. 7. Perform steps 4–6 for all the skin pieces available, collecting all the dermatome-cut skin strips (~300 μm-thick) in a large petri dish filled with PBS with the epidermis side up.

3.5.2 Mechanical Dissociation

To decrease time of the downstream enzymatic treatment to 4 h, scalpels can be used to cut the skin strips into smaller pieces prior to digestion using scalpels.

3.5.3 Enzymatic Digestion

1. Float whole skin pieces in a petri dish, epidermis side facing upward, in Digestion medium for 12–16 h (or 4 h if mechanical digestion has been undertaken) at 37  C. 2. Pass the digest repeatedly through a 10 mL pipette until no visible material remains.

20

Felipe A. Vieira Braga and Ricardo J. Miragaia

3. Place a 100 μm filter on top of a 50 mL Falcon tube and transfer the digest onto it. 4. Wash the petri dish with 25 mL of fresh Complete medium and pass them through the strainer into the same 50 mL Falcon tube. 5. Spin cells down at 500  g for 5 min. 3.5.4 RBC Lysis

See Subheading 3.1.3.

3.5.5 Dead Cell Removal

See Subheading 3.1.4.

3.5.6 Immune Cell Enrichment

See Subheading 3.4.5.

4

Notes 1. Recently published studies [1–3] have shown that enzymatic digestion of tissues can induce gene expression artifacts that affect scRNA-seq data interpretation. It has also been shown that these effects depend on the temperature and duration of the digestion. From our observations, different cell types have different susceptibilities to this stress. Therefore, it is good practice to decrease digestion time and temperature (e.g., using psychrophilic proteases) whenever possible. When different dissociation protocols are used, it is advisable to make them as similar as possible to achieve artifact-free comparisons. For instance, enzymatic digestion of tissues such as spleen or lymph nodes could be considered. The use of transcriptional inhibitors during the enzymatic treatment should also be considered for particularly sensitive tissues [2]. Nonetheless, being aware of such potential artifacts can be used at the data analysis stage to reduce their impact. 2. Accurate estimations of cell numbers are very important when loading cell suspensions into microfluidic devices for single-cell capture. Overloading such devices can induce clogging and increased rate of cell doublets captured, whilst loading lower numbers of cells will lead to increased costs per cell. From our experience, manual counting is more accurate than commercially available automated systems. However, person-to-person variation is quite significant. 3. Cell suspensions with viability below ~70–80% should be depleted of dead cells. Higher percentages of dead cells can interfere with other steps in the process (e.g., dead cells may bind nonspecifically to MACS MicroBeads), they will increase costs per cell and might contribute to background expression

Tissue Handling and Dissociation for Single-Cell RNA-Seq

21

noise in certain scRNA-seq methods. Such enrichment can be achieved using dead cell removal kits (MACS, EasySep) or FACS sorting see also Notes 4 and 5. 4. If the absolute number of cells is low, consider the further loss of cells that dead cell removal and cell enrichment kits might cause. 5. The tissue dissociation process inevitably leads to cell death and to the release of nucleic acids into the cell suspension. Washing cells multiple times, especially just before loading onto microfluidic devices, will decrease the background noise that can otherwise interfere with data interpretation. 6. Dissociation of nonlymphoid tissue releases high number and variety of nonimmune cell types (e.g., epithelial and endothelial cells). When focusing on immune cells, using an immune cell enrichment strategy is advisable, and there are several strategies that can be adopted. Mainly, MACS and FACS, which rely on the pan-immune marker CD45, and density gradient separation, which relies on cell density. Here we use MACS purification, which yields a purer immune population than density gradients, while still circumventing the need for a cell sorter. References ´ et al (2017) 1. van den Brink SC, Sage F, Ve´rtesy A Single-cell sequencing reveals dissociationinduced gene expression in tissue subpopulations. Nat Methods 14:935–936 2. Wu YE, Pan L, Zuo Y et al (2017) Detecting activated cell populations using single-cell RNA-seq. Neuron 96:313–329.e6

3. Adam M, Potter AS, Potter SS (2017) Psychrophilic proteases dramatically reduce single-cell RNA-seq artifacts: a molecular atlas of kidney development. Development 144:3625–3632 4. Gunawan M, Jardine L, Haniffa M (2016) Isolation of human skin dendritic cell subsets. Methods Mol Biol 1423:119–128

Part II Single Cell Trancriptomic Analysis

Chapter 3 Full-Length Single-Cell RNA Sequencing with Smart-seq2 Simone Picelli Abstract In the last few years single-cell RNA sequencing (scRNA-seq) has enabled the investigation of cellular heterogeneity at the transcriptional level, the characterization of rare cell types as well as the detailed analysis of the stochastic nature of gene expression. A large number of methods have been developed, varying in their throughput, sensitivity, and scalability. A major distinction is whether they profile only 50 - or 30 -terminal part of the transcripts or allow for the characterization of the entire length of the transcripts. Among the latter, Smart-seq2 is still considered the “gold standard” due to its sensitivity, precision, lower cost, scalability and for being easy to set up on automated platforms. In this chapter I describe how to efficiently generate sequencing-ready libraries, highlight common issues and pitfalls, and offer solutions for generating high-quality data. Key words Smart-seq2, RNA-seq, Single cell, Full-length, In-house Tn5 transposase, Tagmentation, Nextera® XT kit, Automation, High-throughput

1

Introduction The rapid technological development of the single-cell sequencing field in the past 10 years has enabled researchers to answer questions that could not be addressed by the classic RNA-seq or microarray technologies. It is now well established that seemingly homogenous cell populations in vivo and cell cultures in vitro can display considerable differences in gene expression, both due to stochastic processes at the transcriptional level (e.g., transcriptional burst) or extrinsic factors such as experimental conditions [1–3]. Among all the different applications developed over the years, single-cell RNA sequencing (scRNA-seq) is the one that has seen major improvements, both in terms of sensitivity and scalability. Some of the technologies, including the latest emulsion droplet methods like Drop-seq, inDrop, and the 10 Genomics technology [4–6], characterize only the 30 -end of the RNA transcripts, which is generally sufficient for the investigation of cellular heterogeneity and the identification of population substructures. Other methods such as Smart-seq2, SUPeR-seq, and MATQ-seq [7–9]

Valentina Proserpio (ed.), Single Cell Methods: Sequencing and Proteomics, Methods in Molecular Biology, vol. 1979, https://doi.org/10.1007/978-1-4939-9240-9_3, © Springer Science+Business Media, LLC, part of Springer Nature 2019

25

26

Simone Picelli

Fig. 1 Flowchart of the Smart-seq2 library preparation. Single cells are collected manually or by FACS and deposited in single tubes or 96-/384-well plates containing a mild hypotonic lysis buffer. The cells are lysed and the RNA is released. The RT reaction begins with the annealing of an oligo-dT primer (SMART dT30VN)

Single-Cell RNA-seq with Smart-seq2

27

have the ability to capture full-length transcripts and are therefore useful for the characterization of single nucleotide variants (SNVs), splice isoform, and transcriptional start sites (TSSs), or for the detection of monoallelic and imprinted genes. Smart-seq2 relies on the SMART technology (Switching Mechanism at the 50 -end of the RNA Transcript) and exploits two intrinsic properties of the Moloney murine leukaemia virus reverse transcriptase (MMLV-RT): reverse transcription (RT) and template switching (TS) [10]. Template switching represents the ability of the MMLV-RT to introduce a few untemplated nucleotides, most commonly 2–5 cytosines, upon reaching the 50 -end of the RNA template during the RT reaction (Fig. 1). These extra nucleotides work as a docking site for a helper oligonucleotide (“template switching oligonucleotide,” TSO) carrying two riboguanosines and one locked nucleic acid (LNA) guanosine at its 30 -end. This special base configuration is crucial for a stable annealing between the TSO and the cytosine tail and is required for the MMLV-RT to “switch template” and synthesize a cDNA strand using the helper oligonucleotide as template. Thus, TS makes possible the introduction of a predefined sequence at the 30 -end end of the cDNA transcript (the 50 -end of the mRNA template) which, notably, is the same as the one used at the 50 -end of the oligo-dT primer. This allows the amplification of the entire transcriptome in a single PCR reaction (“preamplification,” below and Fig. 1). Smart-seq2 relies on the Illumina sequencing technology and, therefore, the full-length fragments generated after PCR need to be fragmented before being loaded on the flowcell. For this purpose, several methods can be used but the one that has gained popularity in the field is the tagmentation reaction, mainly due to its simplicity and ease of use [11]. “Tagmentation” is a neologism introduced by Illumina to describe the tagging and fragmentation of double-stranded DNA carried out in a single reaction by a prokaryotic Tn5 Transposase. Although the commercial kits available on the market (Nextera®, ä Fig. 1 (continued) carrying a known sequence at its 50 -end (orange bar). The mRNA is converted to cDNA by a reverse transcriptase capable of performing the template switching (TS) reaction upon reaching the opposite of the template. TS enables the incorporation of 2–5 untemplated nucleotides, most commonly three cytosines. These nucleotides functions docking site for a LNA-modified template switching oligonucleotide (LNA-TSO) carrying the same known sequence at the 50 -end as the oligo-dT primer, allowing the reverse transcriptase to “switch template” and make a complementary copy of the LNA-TSO. The result is full-length cDNA-mRNA hybrid from each polyadenylated transcript originally present in the cells that can then be preamplified via a suppression PCR reaction using a single primer (ISPCR). The library preparation is carried out in a near-to-random Tagmentation reaction by a Tn5 Transposase, followed by a second (enrichment) PCR reaction that adds the P5 and P7 sequences required for binding to the Illumina flowcell as well as S5xx and N7xx indices for multiplexing purposes. The dual-indexed libraries can then be pooled and sequenced either in the single end (SE) or paired end (PE) mode

28

Simone Picelli

Nextera® XT, and Nextera Flex®, all from Illumina) generate highquality data, they are expensive and therefore not suitable for research labs on a tight budget or for large-scale projects. A few years ago we developed a protocol for the production of a cheaper alternative of the commercial Tn5 Transposase, as well as optimized specific reaction conditions that make possible the tagmentation of very low DNA inputs [12]. Thus, the combination of such a cheaper, “in-house,” Tn5 Transposase with Smart-seq2 can be considered a complete protocol for the generation of high-quality scRNA-seq libraries from single cells [12–13]. All the steps entirely rely on off-the-shelf reagents, bringing down the cost per cell to a just a fraction of what it would be with any commercial kit. There are, however, limitations that the next generations of the protocol should address. Smart-seq2 is an oligo dT-based method and therefore enables the analysis only of polyadenylated RNAs, neglecting important species such as micro-RNAs (miRNAs), piwiinteracting RNAs (piRNAs,) and nonpolyadenylated long noncoding RNAs (lncRNAs), among others. Furthermore, Smart-seq2 does not retain the information about strand-specificity, thus making impossible to uniquely assign reads mapping to overlapping genes transcribed by opposite strands. Lastly, sample pooling is performed only posttagmentation (see below), making Smartseq2 more labor-intensive than tag- or emulsion droplet-based methods (both 30 - and 50 -based). However, this issue has been mitigated by the use of liquid handling robots and nanodispensers, as illustrated below. Here I describe a medium- to high-throughput version of the Smart-seq2 protocol that combines the use of the NS-2 nanodispenser (BioNex, http://gcbiotech.com/product/nanodrop-ii/) for reagent dispensing and the Freedom Evo 200 (Tecan, https://lifesciences.tecan.com/products/liquid_handling_and_automation/freedom_evo_series) for cleanup, index adaptor distribution, and pooling steps. Other setups can be envisioned, such as the combination of Mosquito nanopipettors (TTP Labtech) and MicroLab STAR liquid handling robots (Hamilton Robotics). The use of any automated solution is strongly recommended in order to improve reproducibility, increase processing speed, minimize reagent waste and, ultimately, reduce personnel and cost of reagents. However, sometimes researchers do not have access to or do not have experience with automated systems. For them, the following protocols can be implemented simply by increasing (e.g., doubling) the reaction volumes of most reactions and using regular pipettes or multichannel pipettes. Since many laboratories rely on Nextera®, Nextera® XT, or Nextera Flex® kits, I will describe how to carry out the library preparation both with the Nextera® XT kit as well as with in-house

Single-Cell RNA-seq with Smart-seq2

29

Tn5 Transposase. The Nextera® and Nextera Flex® kits are suitable for larger inputs, are less relevant for single-cell applications, and will not be covered here. For details about the production of Tn5 Transposase the reader is referred to [12].

2

Materials Prepare all solutions using RNase- and DNase-free water and analytical grade reagents. Prepare and store all reagents at the recommended temperatures (unless indicated otherwise). It is very important to work in sterile conditions and clean thoroughly when experiments are carried out on a normal lab bench and not in a dedicated clean room (which would be the ideal solution but not always practical for different reasons). Wipe all the working surfaces with 0.5% NaClO (sodium hypochlorite) followed by DEPC-treated water. Use separate pre- and post-PCR working areas in order to avoid contaminations. Be especially careful when handling the index primers used in the final enrichment PCR step (see below). The use of a laminar flow hood equipped with UV light for sterilization is highly recommended for eliminating traces of nucleic acids from previous experiments. All reagents except enzymes can be thawed at room temperature. All master mixes can be briefly vortexed after preparation. However, do not vortex the enzyme stock solutions, but rather mix them by gently inverting the tube.

2.1

Cell Lysis Mix

1. 0.4% Triton X-100 solution. Store at +4  C (see Notes 1 and 2). 2. Premixed dNTP solution (25 mM each). Store at 20  C. 3. Recombinant RNase Inhibitor (40 U/μL). Store at 20  C. 4. SMART dT30VN Oligonucleotide (50 Bio-AAGCAGTGGTATCAACGCAGAGTACT30VN-30 , 100 μM). “Bio” ¼ Biotin. Store at 20  C (see Note 3). 5. Optional: ERCC spike-ins, 1:40,000 dilution. Store at 80  C (see Note 4). 6. Nuclease-free water.

2.2 Reverse Transcription (RT) Mix

1. Superscript™ II kit: First Strand Buffer (5), Dithiothreitol (DTT, 100 mM), Superscript™ II Reverse Transcriptase (200 U/μL). Store at 20  C (see Note 5). 2. Betaine (5 M solution). Store at +4  C. 3. Magnesium chloride (MgCl2, 1 M solution). Store at +4  C. 4. Recombinant RNase Inhibitor (40 U/μL). Store at 20  C.

30

Simone Picelli

5. Nuclease-free water. Store at room temperature. 6. LNA-modified template-switching oligonucleotide, LNA-TSO (50 Bio-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-30 , 100 μM). “Bio” ¼ Biotin. Store at 20  C (days) or 80  C (long-term, months). 2.3 Preamplification Mix

1. KAPA HiFi HotStart ReadyMix (2X). Store at 20  C. 2. ISPCR Primer (50 Bio-AAGCAGTGGTATCAACGCAGAGT30 , 10 μM). “Bio” ¼ Biotin. The primer can be left out without any adverse effect (see Note 6). Store at 20  C. 3. Nuclease-free water. Store at room temperature.

2.4 Magnetic Beads Cleanup

1. Sera-Mag SpeedBeads™ solution containing 19% w/v Polyethylene Glycol (PEG). To prepare 50 mL of Bead Solution: withdraw 1 mL of Sera-Mag SpeedBeads™ suspension (carboxyl magnetic beads, hydrophilic, 5% suspension) and transfer it into a 1.5 mL tube. Pellet the beads by placing the tube on a magnetic stand, wait until the solution is clear and discard the supernatant. Add 1 mL of 10 mM Tris–HCl pH 8.0, 1 mM EDTA (TE buffer) and resuspend the beads off the magnet. Pellet the beads again, wait until the solution is clear, discard the supernatant and repeat one more time. Pellet the beads once more, wait until the solution is clear, discard the supernatant and resuspend off the magnet with 0.9 mL TE buffer. In a Beaker mix 2.92 g NaCl, 500 μL Tris–HCl pH 8.0 (1 M), 100 μL EDTA (500 mM), 9.5 g PEG (MW ¼ 8000). Bring everything in solution by stirring and heating to 37  C. Once the solution is clear add the resuspended beads prepared in the step 1. Add 50 μL Tween-20 (10% solution, (see Note 7)) and 250 μL sodium azide (NaN3, 10% solution (see Note 8)). Add the cleaned up beads in 0.9 mL TE buffer and adjust the volume to 50 mL with nuclease-free water. Store at +4  C. Do not freeze (see Note 9). 2. 80% v/v Ethanol. Store at room temperature (see Note 10). 3. Elution solution of your choice. Store at room temperature (see Note 11).

2.5 Library Preparation with Commercial Illumina Reagents 2.6 Library Preparation with Home-made Tn5 Transposase

1. Nextera® XT DNA Sample Preparation Kit. Store at 20  C. 2. Nextera® XT Index Kit v2. Store at 20  C (see Note 12).

In-house Tn5 Transposase (12.5 μM), preloaded with the following oligonucleotides: Tn5MErev: 50 -[phos]CTGTCTCTTATACACATCT-30 . “Phos” ¼ phosphate; this oligonucleotide should be annealed either with.

Single-Cell RNA-seq with Smart-seq2

31

Tn5ME-A: 5-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-30 . or Tn5ME-B: 50 -TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-30 . Store at 20  C (see Note 13). 0

1. 10 TAPS–MgCl2 Buffer: 100 mM TAPS–NaOH pH 8.5 at 25  C, 50 mM MgCl2. Adjust the pH as indicated above. Filter with 0.22 μm filters and store at +4  C. 2. 40% w/v Polyethylene Glycol MW ¼ 8000. Store at +4  C (see Note 14). 3. 0.2% SDS solution. Store at +4  C (see Note 15). 4. KAPA HiFi non-HotStart kit includes KAPA HiFi DNA Polymerase (1 U/μL), KAPA HiFi High-Fidelity Buffer (5), dNTP mix (10 mM each). Store at 20  C (see Note 16). 5. Nuclease-free water. Store at room temperature. 6. Nextera® XT Index Kit v2. Store at 20  C (see Notes 12 and 17). 2.7 Pooling and Sequencing

1. Qubit™ dsDNA High Sensitivity Assay Kit and Qubit™ assay tubes. Store at room temperature. 2. Agilent High Sensitivity D1000 ScreenTape Assay (alternatively: Agilent High Sensitivity DNA Assay). Store at +4  C. 3. Sera-Mag SpeedBeads™ working solution (for details about preparation: see above). Store at +4  C. 4. 80% v/v ethanol. Store at room temperature. 5. Nuclease-free water. Store at room temperature. 6. NextSeq™ 550 High Output v2 kit (75 cycles), MiSeq™ Reagent Kits v3 (150 cycles) or HiSeq™ 2500 (High Output Run Mode or Rapid Run Mode) depending on sample throughput and desired read output. Other kits are also an option. Follow manufacturer’s instructions regarding storage.

2.8 Instruments and Consumables

Depending on the throughput, the protocol can be carried out in single tubes, 96- or 384-well plates. As an example, instruments and consumables required for 96- and 384-well plates processing are reported below. 1. Fully skirted 96- or 384-well plates (see Note 18). 2. Aluminum foil and adhesive plastic foil (see Note 19). 3. Plate centrifuge, this setup only. 4. Thermocycler with 96- or 384-well block. 5. NS-2 nanodispenser (BioNex), this setup only.

32

Simone Picelli

6. Freedom Evo 200 (Tecan), this setup only. 7. Low Elution (LE) Magnet Plate (when using 96-well plates) or 384 Post Magnet Plate (when using 384-well plates) (Alpaqua). 8. BD FACSAria™ III or BD Influx™. Other Fluorescent Activated Cell Sorters (FACS) may be used. 9. Agilent 4200 TapeStation system or Agilent 2100 Bioanalyzer. 10. Nextseq™ 550, MiSeq™, or HiSeq™ Sequencing Systems, depending on sample throughput and desired read output.

3

Methods For simplicity, hereafter I will describe only the high-throughput protocol, which uses 96- or 384-well plates.

3.1

Cell Lysis

1. For each sample prepare 2.3 μL of the following Cell Lysis Mix: 1.15 μL Triton X-100, 0.40 μL dNTP Mix, 0.05 μL SMART dT30VN Oligonucleotide, 0.05 μL Recombinant RNase Inhibitor, and 0.65 μL nuclease-free water. If using ERCC, add 0.025 μL/reaction for large cells or 0.0025 μL/reaction for small cells (see Note 20). The final concentration of Triton X-100 is 0.2%. 2. Mix well and gently spin down. 3. Dispense the Cell Lysis Mix into the plate of your choice. 4. If used immediately, keep the plate on ice until needed. The Cell Lysis Mix can be prepared and dispensed on plates several weeks or months in advance. The plates are then stored at 20  C until needed (see Note 21). Avoid multiple freezingthawing cycles. 5. Collect the cells either by manual picking or, more commonly, by FACS. Manual picking is time-consuming and some effort is required to master it (see Note 22). Cell sorting by FACS yields the best results when a BD FACSAria™ III or a BD Influx™ is used. To make sure the stream is perfectly centered and the single cell will hit the center of the well it is advised to check the instruments settings by using BD FACS™ Accudrop beads (see Note 23). 6. Immediately after sorting, seal the plate with aluminum foil and snap-freeze it at 80  C or by placing it on dry ice, especially if not processing immediately with RT (see Note 24). Lysed cells can be stored in these conditions for several months without appreciable decrease in RNA quality. The plate should never undergo freeze–thaw cycles for any reason.

Single-Cell RNA-seq with Smart-seq2

3.2 Reverse Transcription (RT) Mix

33

1. For each sample prepare 2.7 μL of the following RT Mix: 1 μL First Strand Buffer, 0.25 μL DTT, 1 μL betaine, 0.06 μL MgCl2, 0.125 μL RNase Inhibitor, 0.125 μL Superscript™ II Reverse Transcriptase, 0.05 μL LNA-TSO, and 0.09 μL nuclease-free water. 2. Briefly vortex and gently spin down the mix. Keep it on ice until needed. 3. If cell sorting was carried out earlier, take the plate out of the 80  C freezer and leave it for a couple of minutes at room temperature to thaw. 4. Briefly spin down to collect eventual drops that might have condensed on the lid. 5. Optional: Place the plate on a thermocycler block and perform cell lysis and mRNA denaturation incubating the plate at 72  C or 95  C for 3 min (see Note 25). 6. If denaturation is performed: remove the plate from the thermocycler and keep it on wet ice for a couple of minutes to cool. Briefly spin down to collect the lysate at the bottom of each well. 7. Dispense 2.7 μL of RT Mix in each well. The final volume is now 5 μL. 8. Seal the plate with adhesive transparent film, vortex, spin down, place it in a thermocycler and carry out the RT reaction: 42  C for 90 min, 70  C for 15 min, 4  C hold. Once the reaction is completed proceed to the next step. Alternatively, run the RT overnight but continue with the preamplification reaction the following morning (see Note 26).

3.3 Preamplification Reaction

1. Remove the KAPA HiFi HotStart ReadyMix and ISPCR primer from the 20  C storage and keep them at room temperature. 2. For each sample prepare 7.5 μL of preamplification mix: 6.25 μL KAPA HiFi HotStart ReadyMix, 0.15 μL ISPCR primer (optional, see Note 6), 1.1 μL nuclease-free water. 3. Briefly vortex and gently spin down. The preamplification mix is stable for hours at room temperature and there is no need to keep it on ice (see Note 27). 4. Once the RT is completed, spin down the plate and keep it at room temperature, if the preamplification mix is not ready yet. 5. Dispense 7.5 μL of preamplification mix in each well of the plate. The final volume is now 12.5 μL. 6. Seal the plate and place it in a thermocycler, starting the following PCR program: 98  C for 3 min, then N cycles of (98  C for 20 s, 67  C for 20 s, 72  C for 6 min), 4  C hold. The

34

Simone Picelli

number of cycles “N” should be adjusted according to the RNA content of the specific cells that you are working with. Use 1–2 cycles more, if unsure (see Note 28). It is safe to stop here and store the PCR product in a 20  C freezer until needed. 7. Spin down the tubes/plate once the reaction is completed. 3.4 Magnetic Beads Cleanup After Preamplification

1. Remove the Sera-Mag SpeedBeads™ aliquot from the +4  C storage and equilibrate it at room temperature for 15 min. 2. Add 10 μL of Sera-Mag SpeedBeads™ solution (0.8) and mix well by pipetting up and down at least 20 times or by vortexing. 3. Incubate off the magnetic stand for 5 min at room temperature. 4. Place the plate on the magnetic stand and leave it there for 5 min or until the solution appears clear. 5. Carefully remove the supernatant without disturbing the beads. 6. Optional: add 200 μL of 80% v/v ethanol, pipetting the liquid from the opposite side of the beads and incubate 30 s without removing the tube/plate from the magnetic stand. Performing a second ethanol wash is not necessary (see Note 10). 7. If an ethanol wash is performed: remove any trace of ethanol and let the bead pellet dry for 3–4 min or until small cracks appears. Do not seal the plate or remove it from the magnetic stand during this time. 8. Remove the plate from the magnetic stand, add 15 μL of nuclease-free water and mix well by pipetting or vortexing to resuspend the beads. 9. Incubate 2 min off the magnetic stand. 10. Place the plate back on the magnetic stand and incubate for 2 min or until the solution appears clear. 11. Carefully remove 14 μL of the supernatant trying to minimize the bead carryover and transfer it to a new plate. It is safe to stop here and store the cDNA in a 20  C freezer until needed (see Note 29). 12. Check the cDNA quality on the Agilent Bioanalyzer or TapeStation instruments. Follow the instructions as described in the High Sensitivity DNA chip or High Sensitivity DNA5000 ScreenTape assay user manuals. A good library is characterized by a low proportion of fragments 0.2%) is strongly inhibitory to the droplet breakage. The cell suspension should hence be washed rigorously prior to loading the sample into the syringe. 20. Repeating the droplet breakage by adding another 500 μl PFO, firmly shaking, and another centrifugation step can increase the bead recovery rate. Do not add more PFO than 1.5 of the sample volume, as this can lead to lower library quality. 21. If sample preparation and pre-PCR rooms are separated, then this is a good time to add Maxima H Minus RTase to the RT mix. 22. The use of a second microcentrifuge tube during the washing helps to get rid of residual oils that might have been carried over. 23. The bead recovery rate is usually around 20–40%. The standard settings should hence yield 24,000–48,000 recovered beads. 24. We use a microarray oven for the 42  C incubation step. 25. This is a stopping point. Beads can be stored in TE-Tween at 4  C. We have stored beads in this way for more than 3 months and do not observe any apparent effect on quantity or quality of the cDNA sample. 26. We use a microarray oven for the 37  C incubation step. 27. Resuspend beads in less than 1 ml when having a smaller bead pellet. 28. Since the beads settle fast by gravity, it is important to quickly load the hemocytometer after resuspension in a uniform motion. For this purpose, preload the P200 with a pipette tip. We found a bead concentration of about 90–100 beads/μ l prediluted in 6 loading dye (Thermo Scientific) and TE-Tween (10 μl beads +10 μl 6 loading dye +10 μl TE-Tween) makes it easier to evenly distribute the beads on the counter.

Single-Cell RNA Sequencing with Drop-Seq

85

29. For large-scale experiments we apportion 4,000 beads per tube, because we found good correlation between data derived from 2,000 and 4,000 bead aliquots. 30. The cycle number of 13 depends on the experimental conditions (e.g., cell types, cell loading concentration). For new samples, we first determine the optimal number of cycles by an initial PCR of only 2,000 beads, aiming for a concentration of 400–1000 pg/μl. 31. Multiple PCR tubes can be pooled before the cleanup, allowing to elute in less volume and this way to reduce the number of PCR cycles for cDNA amplification.

Acknowledgments J.B. was supported by a research stipend from the Fritz Thyssen Foundation. G.R. was supported by the Intramural Research Program of the Division of Intramural Research Z01AI000947, NIAID, NIH; the UCLA-Caltech MSTP, and the NIGMS T32 GM008042. References 1. Kolodziejczyk AA, Kim JK, Svensson V et al (2015) The technology and biology of singlecell RNA sequencing. Mol Cell 58:610–620 2. Kolodziejczyk AA, Lo¨nnberg T (2018) Global and targeted approaches to single-cell transcriptome characterization. Brief Funct Genomics 17:209–219 3. Svensson V, Vento-Tormo R, Teichmann SA (2018) Exponential scaling of single-cell RNA-seq in the past decade. Nat Protoc 13:599–604 4. Ziegenhain C, Vieth B, Parekh S et al (2017) Comparative analysis of single-cell RNA sequencing methods. Mol Cell 65:631–643.e4 5. Tang F, Barbacioru C, Wang Y et al (2009) mRNA-seq whole-transcriptome analysis of a single cell. Nat Methods 6:377–382 6. Macaulay IC, Svensson V, Labalette C et al (2016) Single-cell RNA-sequencing reveals a continuous spectrum of differentiation in hematopoietic cells. Cell Rep 14:966–977 7. Shalek AK, Satija R, Adiconis X et al (2013) Single-cell transcriptomics reveals bimodality in expression and splicing in immune cells. Nature 498:236–240

8. Zheng GXY, Terry JM, Belgrader P et al (2017) Massively parallel digital transcriptional profiling of single cells. Nat Commun 8:14049 9. Macosko EZ, Basu A, Satija R et al (2015) Highly parallel genome-wide expression profiling of individual cells using nanoliter droplets. Cell 161:1202–1214 10. Klein AM, Mazutis L, Akartuna I et al (2015) Droplet barcoding for single-cell transcriptomics applied to embryonic stem cells. Cell 161:1187–1201 11. Habib N, Avraham-Davidi I, Basu A et al (2017) Massively parallel single-nucleus RNA-seq with DroNc-seq. Nat Methods 14:955–958 12. Stoeckius M, Hafemeister C, Stephenson W et al (2017) Simultaneous epitope and transcriptome measurement in single cells. Nat Methods 14:865–868 13. Lo YMD, Chan KCA (2006) Setting up a polymerase chain reaction laboratory. In: Lo YMD, Chiu RWK, Chan KCA (eds) Clinical applications of PCR. Humana, Totowa, NJ, pp 11–18 14. McCarroll S (2018) Drop-seq-protocol-v3.1Dec-2015. McCarroll Lab, Boston, MA. http://mccarrolllab.com/dropseq/

Chapter 7 Chromium 10
Single-Cell 30 mRNA Sequencing of Tumor-Infiltrating Lymphocytes Marco De Simone, Grazisa Rossetti, and Massimiliano Pagani Abstract Chromium 10
30 V2 protocol is a 30 end counting single-cell mRNA sequencing protocol that allows to process and sequence RNA from thousands of cells in parallel. Chromium10
by 10
Genomics is an emulsion-based device that enables to compartmentalize single cells along with sets of uniquely barcoded primers and reverse transcription reagents into nanoscale droplets that are used as reaction chambers to generate barcoded full-length cDNA from single cells. After RT reaction single-stranded barcoded cDNAs are pooled together and processed to generate sequencing libraries compatible with the standard Illumina platforms. Here we show in detail the main steps of the protocol applied to the analysis of tumor-infiltrating T lymphocytes (TILs). The main steps are cell preparation, cDNA synthesis, library construction, and sequencing. This protocol refers specifically to the CG00052_SingleCell3_ReagentKitv2UserGuide_RevD downloadable from 10
Genomics website (https://www.10xgenomics.com) and does not substitute it. Always refer to this guide, paying attention to updates and revisions. Key words Chromium 10
, Single-cell RNA sequencing, 30 End counting, Emulsion device, Tumor-infiltrating lymphocytes

1

Introduction Chromium 10
system is a “reverse emulsion device” that creates oil-in-water emulsions producing droplets that can encapsulate single cells [1] along with hydrogel beads and reagents in droplets (gel in emulsion beads or GEMs) used to reverse-transcribe mRNA and amplify the derived cDNA. Gel beads work as delivery system of millions of oligo primers each containing (a) a partial Read 1 sequence used for sequencing on the Illumina flow cell, (b) a 16-bp cell barcode called 10
barcode that serves as the unique molecular address for that particular bead and is shared by all the oligos of a bead (Potentially, 750,000 different bead types can be used in the single-cell 30 assay, and each individual bead contains millions of identical oligos

Valentina Proserpio (ed.), Single Cell Methods: Sequencing and Proteomics, Methods in Molecular Biology, vol. 1979, https://doi.org/10.1007/978-1-4939-9240-9_7, © Springer Science+Business Media, LLC, part of Springer Nature 2019

87

88

Marco De Simone et al.

with the same, unique, 16-bp 10
barcode), (c) a 10-bp UMI (or unique molecular identifier) which is a 10-bp randomer different for each oligo of a bead used for digital mRNA counting (Each one of the millions of primers on a gel bead has its own unique, 10-bp UMI sequence), and (d) a 30-bp poly dT tail which allows the primers to hybridize to mature mRNAs for first-strand cDNA synthesis. Once partitioned with the cells and RT reagents, the gel bead dissolves and its oligo primers are released into the aqueous environment of the GEM. The cell captured in the GEM is also lysed and the content of the GEM (oligos, lysed cell components, and master mix) is incubated in an RT reaction to generate full-length, barcoded cDNA from the poly A-tailed mRNA transcripts. The reverse-transcription reaction is primed by the barcoded gel bead oligo and the reverse transcriptase incorporates a template switch oligo via a template switching reaction at the 50 end of the transcript [2]. The GEMs are then “broken” and single-stranded barcoded cDNAs from thousands of cells are pooled. A bulk cDNA PCR amplification follows to generate enough material for library generation. During library preparation after an enzymatic fragmentation Read 2 is added by adapter ligation, and finally Illumina P5 and P7 sequences and sample index sequences are added during the Sample Index PCR.

2

Materials

2.1 Chromium Reagents

1. Chromium™ Single Cell 30 Library & Gel Bead Kit v2, 16 rxns PN120237 (10
Genomics), composed by: (a) Chromium™ Single Cell 30 Library Kit v2, 16 rxns (store at 20  C) PN120234. (b) Chromium™ Single Cell 30 Gel Bead Kit v2, 16 rxns (store at 80  C) PN120235 (see Note 1). 2. Chromium™ Single Cell 30 Library & Gel Bead Kit v2, 4 rxns PN-120267 (10
Genomics) composed by: (a) Chromium™ Single Cell 30 Library Kit v2, 4 rxns (store at 20  C) PN120264. (b) Chromium™ Single Cell 30 Gel Bead Kit v2, 4 rxns (store at 80  C) PN120265 (see Note 1). 3. Chromium™ Single Cell A Chip Kit, 48 rxns (10
Genomics) (store at ambient temperature) PN120236 (see Note 2). 4. Chromium™ Single Cell A Chip Kit, 16 rxns (10
Genomics) (store at ambient temperature) PN1000009 (see Note 2).

Single Cell Sequencing of Tumor Infiltrating Lymphocytes

89

5. Chromium™ i7 Multiplex Kit, 96 rxns (10
Genomics) (store at 20  C) 120262 (see Note 3). 6. 10
™ Vortex Adapter PN 330002 (10
Genomics). 7. 10
™ Chip Holder PN 330019 (10
Genomics). 8. 10
™ Magnetic Separator PN 230003 (10
Genomics) (see Note 4). 2.2 Plastic Ware (See Note 5)

1. PCR Tubes (Eppendorf).

0.2

ml

8-tube

strips

PN

0030124286

2. DNA LoBind Tubes, 1.5 ml PN 022431021 (Eppendorf). 3. DNA LoBind Tubes, 2.0 ml PN 022431048 (Eppendorf). 4. TempAssure PCR 8-tube strip PN 1402-4700 (alternate to Eppendorf or Thermo Fisher Scientific product). 5. MicroAmp® 8-Tube Strip, 0.2 ml (Thermo Fisher Scientific, alternate to Eppendorf or USA Scientific product) PN N8010580. 6. MicroAmp® 8-Cap Strip, clear PN N8010535. 7. twin.tec® 96-Well PCR Plate Semi-skirted PN 0030129326 (Eppendorf), if using PCR plates and depending on the thermal cycler. 8. twin.tec® 96-Well PCR Plate Divisible, Unskirted PN 2231000209 (Eppendorf), if using PCR plates and depending on the thermal cycler. 9. twin.tec® 96-Well PCR Plate Unskirted PN 0030133390 (Eppendorf), if using PCR plates and depending on the thermal cycler. 2.3 Kits and Reagents

1. DynaBeads® MyOne™ Silane Beads PN37002D, Thermo Fisher Scientific. 2. Nuclease-free water. 3. PBS—phosphate-buffered saline (1
) pH 7.4. 4. Ultrapure nonacetylated bovine serum albumin (BSA). 5. Low TE Buffer (10 mM Tris–HCl pH 8.0, 0.1 mM EDTA). 6. Ethanol, pure (200 Proof, anhydrous). 7. SPRIselect Reagent Kit B23318 (Beckman Coulter). 8. 10% Tween 20. 9. Glycerin (glycerol), 50% (v/v) aqueous solution.

2.4

Equipment

1. Pipet-Lite LTS Pipette L-2XLS+ PN 17014393 (Rainin). 2. Pipet-Lite LTS Pipette L-10XLS+ PN 17014388 (Rainin). 3. Pipet-Lite LTS Pipette L-20XLS+ PN 17014392 (Rainin).

90

Marco De Simone et al.

4. Pipet-Lite LTS Pipette L-100XLS+ PN 17014384 (Rainin). 5. Pipet-Lite LTS Pipette L-200XLS+ PN 17014391 (Rainin). 6. Pipet-Lite LTS Pipette L-1000XLS+ PN 17014382 (Rainin). 7. Pipet-Lite Multi Pipette L8-10XLS+ PN 17013802 (Rainin). 8. Pipet-Lite Multi Pipette L8-20XLS+ PN 17013803 (Rainin). 9. Pipet-Lite Multi Pipette L8-50XLS+ PN 17013804 (Rainin). 10. Pipet-Lite Multi Pipette L8-200XLS+ PN 17013805 (Rainin). 11. Tips LTS 20UL FilterRT-L10FLR PN 17007957 (Rainin). 12. Tips LTS 200UL Filter RT-L200FLR PN 17007961 (Rainin). 13. Tips LTS 1ML Filter RT-L1000FLR PN 17007954 (Rainin). 14. Vortex mixer PN 10153-838 VWR. 15. Divided polystyrene reservoirs 41428. 16. Heat sealing foil, PCR clean PN 0030127854 (Eppendorf) if using PCR plates. 17. PX1™ PCR Plate Sealer PN 1814000 (Eppendorf) if using PCR plates. 18. Automated cell counter. 2.5 Quantification and Quality Control

1. Agilent 2100 Bioanalyzer Laptop Bundle G2943CA (Agilent). 2. High Sensitivity DNA Kit PN 5067-4626 (Agilent). 3. 4200 TapeStation G2291aa (Agilent). 4. High Sensitivity D1000 ScreenTape 5067-5584. 5. High Sensitivity D1000 Reagents 5067-5585. 6. High Sensitivity D5000 ScreenTape 5067-5592. 7. High Sensitivity D5000 Reagents 5067-5593. 8. Qubit® 3.0 Fluorometer Q33216 (Thermo Fisher Scientific). 9. Qubit® dsDNA HS Assay Kit PN Q32854 (Thermo Fisher Scientific). 10. Illumina® Library Quantification Kit PN KK4824 (KAPA Biosystems).

2.6 Recommended Thermal Cycles

1. Bio-Rad C1000 Touch™ Thermal Cycler with 96-Deep Well Reaction Module (PN-1851197). 2. Eppendorf MasterCycler® Pro (PN North 950030010, International 6321 000.019). 3. Thermo Fisher (PN-4375786).

Veriti©

96-Well

Thermal

America Cycler

Single Cell Sequencing of Tumor Infiltrating Lymphocytes

3 3.1

91

Methods Cell Preparation

Cell preparation is the most challenging step of the protocol because in order to isolate tumor-infiltrating T lymphocytes, tumor tissue has to be dissociated and lymphocytes enriched from the suspension of dissociated cells using gradient centrifugation and FACS Sorting. Dissociation can be both mechanical and enzymatic and dissociation protocols are strictly dependent on the tumor type [3–5]. Considering that the success of the procedure is strictly related to viability of target cells and that cell stress can induce consistent transcriptional changes that can mask the real behavior of target cells inside the tissue, an experimental setup that minimizes these effects is highly recommended before approaching this technology. After dissociation and lymphocyte purification proceed as described below: 1. Visual inspect the cells under a microscope or in an automated cell counter to confirm the quality of your suspension: a good cell suspension should be free of debris and cell aggregates and should contain cells with high viability (>80%) (see Note 6). 2. If aggregates are present filter the cell suspension using cell strainer and perform cell washes using PBS 0.04% BSA or RPMI medium plus FBS 10%. Centrifuge cells at 400 rcf for 10 min at 4  C. 3. Count cells manually or using an automated cell counter. 4. Dilute or concentrate your cell suspension according to the optimal performance range of the automated platform and count your cells again. 5. If cell stock concentration is between 700 and 1200 cells/μl and viability is >80%, you can proceed further. If viability is poor, try to eliminate dead cells with additional washes in PBS 0.04% or RPMI medium. 6. Pipet cells very gently to minimize cell lysis after quantification and before chip loading. 7. Cell suspensions should be loaded as soon as possible after preparation, ideally within 30 min to avoid formation of cellular aggregates.

3.2

GEM Generation

1. Prepare master mix on ice (see Note 7). Add reagents in the order shown below, mix by pipetting, and centrifuge briefly. Master mix: (a) RT reagent mix 50 μl; (b) RT primer 3.8 μl; (c) Additive A 2.4 μl; (d) RT enzyme mix 10 μl. Total volume 66.2 μl. RT primer is provided in lyophilized form; once resuspended, store at 80  C. Do not add Single Cell Suspension at this point. If processing more than one sample per experiment

92

Marco De Simone et al.

Fig. 1 Introducing Single Cell A Chip into the chip holder. Place Single Cell A Chip (a) is in the chip holder (b) before loading the reagents. Handle chips by the edges to avoid frictional charges on the bottom of the chip that can impact the partitioning performance. Align the chips at the upper left (beveled corners) and insert it under the guide at the left edge. Press the chip down on the right side until the spring loaded clip is engaged. Close the holder and lay the chip flat on benchtop (c)

prepare a master mix including a 10% excess (1–8 samples can be run in parallel). 2. Place a Single Cell A Chip in a 10
™ Chip Holder (Fig. 1). The order in which wells are loaded is critical to avoid failures and rows should be loaded in the labeled order: 1 followed by 2, then 3. In each chip you can load from 1 to 8 reactions (rows) and If processing fewer than eight samples the following volumes of 50% glycerol solution to each unused well must be added: 90 μl in the row labeled 1, 40 μl in the row labeled 2, and 270 μl in the row labeled 3.

Single Cell Sequencing of Tumor Infiltrating Lymphocytes

93

Table 1 Cell Suspension Volume Calculator Table1 Volume of Cell Suspension Stock (µl)/Volume of Nuclease Free Water (µl) Cell Stock Concentration (Cells/µl) 100 200 300 400 500 600 700 800 900 1000 1100 1200 1300 1400 1500 1600 1700 1800 1900 2000

TARGET CELL RECOVERY 500 8.8/25.1 4.4/29.5 2.9/30.9 2.2/31.6 1.7/32.1 1.5/32.4 1.2/32.6 1.1/32.7 1.0/32.8 0.9/32.9 0.8/33.0 0.7/33.1 0.7/33.1 0.6/33.2 0.6/33.2 0.5/33.3 0.5/33.3 0.5/33.3 0.5/33.3 0.4/33.4

1000 17.4/16.4 8.7/25.1 5.8/28.0 4.4/29.5 3.5/30.3 2.9/30.9 2.5/31.3 2.2/31.6 1.9/31.9 1.7/32.1 1.6/32.2 1.5/32.4 1.3/32.5 1.2/32.6 1.2/32.6 1.1/32.7 1.0/32.8 1.0/32.8 0.9/32.9 0.9/32.9

2000 N/A 17.4/16.4 11.6/22.2 8.7/25.1 7.0/26.8 5.8/28.0 5.0/28.8 4.4/29.5 3.9/29.9 3.5/30.3 3.2/30.6 2.9/30.9 2.7/31.1 2.5/31.3 2.3/31.5 2.2/31.6 2.0/31.8 1.9/31.9 1.8/32.0 1.7/32.1

3000 N/A 26.1/7.7 17.4/16.4 13.1/20.8 10.4/23.4 8.7/25.1 7.5/26.3 6.5/27.3 5.8/28.0 5.2/28.6 4.7/29.1 4.4/29.5 4.0/29.8 3.7/30.1 3.5/30.3 3.3/30.5 3.1/30.7 2.9/30.9 2.7/31.1 2.6/31.2

4000 N/A N/A 23.2/10.6 17.4/16.4 13.9/19.9 11.6/22.2 9.9/23.9 8.7/25.1 7.7/26.1 7.0/26.8 6.3/27.5 5.8/28.0 5.4/28.4 5.0/28.8 4.6/29.2 4.4/29.5 4.1/29.7 3.9/29.9 3.7/30.1 3.5/30.3

5000 N/A N/A 29.0/4.8 21.8/12.1 17.4/16.4 14.5/19.3 12.4/21.4 10.9/22.9 9.7/24.1 8.7/25.1 7.9/25.9 7.3/26.6 6.7/27.1 6.2/27.6 5.8/28.0 5.4/28.4 5.1/28.7 4.8/29.0 4.6/29.2 4.4/29.5

6000 N/A N/A N/A 26.1/7.7 20.9/12.9 17.4/16.4 14.9/18.9 13.1/20.8 11.6/22.2 10.4/23.4 9.5/24.3 8.7/26.6 8.0/25.8 7.5/26.3 7.0/26.8 6.5/27.3 6.1/27.7 5.8/28.0 5.5/28.3 5.2/28.6

7000 N/A N/A N/A 30.5/3.4 24.4/9.4 20.3/13.5 17.4/16.4 15.2/18.6 13.5/20.3 12.2/21.6 11.1/22.7 10.2/23.7 9.4/24.4 8.7/25.1 8.1/25.7 7.6/26.2 7.2/26.6 6.8/27.0 6.4/27.4 6.1/27.7

8000 N/A N/A N/A N/A 27.8/6.0 23.2/10.6 19.9/13.9 17.4/16.4 15.5/18.3 13.9/19.9 12.7/21.1 11.6/22.2 10.7/23.1 9.9/23.9 9.3/24.5 8.7/25.1 8.2/25.6 7.7/26.1 7.3/26.6 7.0/26.8

9000 N/A N/A N/A N/A 31.3/2.5 26.1/7.7 22.4/11.4 19.6/14.2 17.4/16.4 15.7/18.1 14.2/19.6 13.1/20.8 12.0/21.8 11.2/22.6 10.4/23.4 9.8/24.0 9.2/24.6 8.7/25.1 8.2/25.6 7.8/26.0

10000 N/A N/A N/A N/A N/A 29.0/4.8 24.9/8.9 21.8/12.1 19.3/14.5 17.4/16.4 15.8/18.0 14.5/19.3 13.4/20.4 12.4/21.4 11.6/22.2 10.9/22.9 10.2/23.7 9.7/24.6 9.2/24.6 8.7/25.1

3. Dispense 66.2 μl master mix into each well of an 8-tube strip on a chilled metal block resting on ice and then add the appropriate volume of nuclease-free water (see Cell Suspension Volume Calculator Table 1) into each well containing master mix. 4. Gently pipet-mix the tube containing the washed and diluted cells and add the appropriate volume (μl) of single-cell suspension (determined from the Cell Suspension Volume Calculator Table 1 and Note 8) to each well of the tube strip containing the master mix and nuclease-free water. 5. With a pipette set to 90 μl, gently pipet-mix the combined cells, master mix, and nuclease-free water five times while keeping the tube strip on ice. 6. Without discarding the pipette tips, transfer 90 μl master mix containing cells to the wells in the row labeled 1, taking care not to introduce bubbles. To do this, place the tips into the bottom center of the wells and raise the tips slightly above the bottom before slowly dispensing the master mix containing cells (Fig. 2a). 7. Snap the Single Cell 30 Gel Bead Strip (equilibrated at room temperature for at least 30 min, see Note 9) into a 10
™ Vortex Adapter and vortex for 30 s. A 30-s wait while vortexing the Single Cell 30 Gel Bead Strip is required to ensure proper priming of the master mix containing cells in the Single Cell A Chip. Remove the Single Cell 30 Gel Bead Strip from the

94

Marco De Simone et al.

Fig. 2 Loading the Single Cell A Chip. The loading order of reagents is critical for an optimal performance. (a) After adding cells and water to the Mater Mix, gently resuspend and transfer 90 μl in the row labeled 1. Wait for 300 seconds to allow the correct priming of the circuit and in the meantime vortex the gel beads strip for 30 s. (b) Puncture the foil seal on the beads strip of a number of wells equal to the number of sample to process. Aspirate 40 μl of gel beads very slowly because solution has a very high density and load them in the row labeled 2. (c) Pipet a total volume of 270 μl of Partitioning Oil into the wells in the row labeled 3. (d) Attach the 10
Gasket (the notched cut should be at the top left corner)

Single Cell Sequencing of Tumor Infiltrating Lymphocytes

95

vortex, flick in a sharp, downward motion, and confirm that there are no bubbles at the bottom of the tube and that liquid levels are uniform. 8. Pipet Single Cell 30 Gel Beads slowly as they have a high viscosity. Carefully puncture the foil seal and slowly aspirate 40 μl Single Cell 30 Gel Beads, taking care not to introduce air bubbles and dispense them into the bottom of the wells in the row labeled 2 (Fig. 2b). 9. Pipet 270 μl of Partitioning Oil into the wells in the row labeled 3 (Fig. 2c). 10. Attach the 10
™ Gasket. The notched cut should be at the top left corner. Ensure the 10
Gasket holes are aligned with the wells and keep the assembly horizontal to avoid wetting the 10
Gasket with Partitioning Oil (Fig. 2d). 11. Run the Chromium™ Controller. Press the button on the touchscreen of the Chromium Controller to eject the tray; place the assembled Chip, 10
Chip Holder, and 10
Gasket on the tray and press the button on the touchscreen again to retract the tray. Confirm that Chromium Single Cell A program is displayed on screen and press the play button to begin the run. At the completion of the run (~6.5 min) proceed immediately to the next step. 3.3 GEM Transferring and RT Reaction

1. Press the eject button to eject the tray and remove the Single Cell A Chip. Remove and discard the 10
™ Gasket. Press the button to retract the empty tray. 2. Open the 10
Chip Holder and fold the lid back until it clicks to expose the wells at a 45 angle. 3. Slowly aspirate 100 μl GEMs from the lowest points of the Recovery Wells (row labeled black left pointing pointed ◄) as shown in Fig. 3a without creating a seal between the tips and the bottom of the wells and avoid the introduction of air bubbles. Pipet GEMs very slowly as they have high viscosity. Visually inspect the tips to confirm the correct emulsion formation. A good emulsion should be opaque and uniform in all the tips used to recover the emulsion (Fig. 3b). A lack of uniformity (Fig. 3c) in the tips indicates that a failure, a clog (red arrow) or a wetting failure (blue arrow), has occurred during GEM generation (see also Notes 10 and 11). 4. Over the course of ~20 s, dispense the GEMs into a 96-Well PCR plate or 8-well PCR strips on a chilled metal block resting on ice with the pipette tips against the sidewalls of the wells. Keep the tips above the liquid level to minimize GEMs lost on the outside of the tips.

96

Marco De Simone et al.

Fig. 3 GEM visual inspection. (a) Open the chip holder and fold the lid back to expose the recovery wells at a 45 angle and slowly aspirate 100 μl from the bottom of the Recovery wells avoiding introduction of air bubbles. (b) Make a visual inspection of the emulsion: emulsion should appear opaque and uniform across all channels. (c) The presence of a non uniform emulsion indicates that a failure has occurred: a clog (red arrow) or a wetting failure (blue arrow)

5. Discard the used Single Cell A Chip and close the 10
™ Chip Holder. If using 96-well PCR plates seal the plate with pierceable foil heat seal. Load the sealed PCR plate or the 8-well PCR strip into a thermal cycler Thermal Protocol: Step 1: 45 min at 53  C; Step 2: 5 min at 85  C; Step 3: Hold 4  C. Lid temperature: 53  C. Reaction volume: 125 μl. For incubation use one of the suggested thermal cyclers (see Subheading 2). Store in the PCR plate or the 8-well strip at 4  C for up to 72 h or at 20  C for up to a week, or proceed directly to PostGEM-RT Cleanup. 3.4 Post-GEM-RT Cleanup

1. Add 125 μl Recovery Agent to each well containing postincubation GEMs without mixing. A biphasic mixture should form (Fig. 4a). Wait for 60 s and then if using a PCR plate transfer the entire volume to an 8-tube strip. The recovered biphasic mixture contains distinct Recovery Agent/Partitioning Oil (pink) and aqueous phases (clear), with no persisting emulsion. If an abnormal volume ratio of Recovery Agent/ Partitioning Oil (pink) and aqueous phase (clear) is present, that can indicate or confirm that a failure has occurred (Fig. 4b and Notes 10 and 11). 2. Slowly remove 125 μl Recovery Agent/Partitioning Oil (pink) from the bottom of the tubes and discard it. Be careful not to aspirate any of the clear aqueous sample because the aqueous phase contains barcoded cDNA. A small volume of Recovery Agent/Partitioning Oil will remain (Fig. 4c). If an abnormal volume ratio of Recovery Agent/Partitioning Oil (pink) and aqueous phase was observed in the previous step, these

Single Cell Sequencing of Tumor Infiltrating Lymphocytes

97

Fig. 4 Post-GEM-RT Cleanup. To purify the barcoded cDNAs using magnetic beads, GEMs are first broken adding Partitioning Oil (pink reagent) to the emulsion. (a) Adding 125 μl or Recovery Agent a biphasic mixture should form, containing a distinct Recovery Agent/Partitioning Oil phase (pink) and an aqueous phase (clear). (b) An abnormal volume ratio of Recovery Agent/Partitioning Oil (pink) and aqueous phase (clear) indicates a failure: a clog (red arrow) or a wetting failure (blue arrow). (c, d) Abnormalities are even more evident after Recovering Agent/Partitioning Oil removal in comparison to successful samples. In (c) the same samples shown in (a) after Recovering Agent/Partitioning Oil removal while in (d) the same samples shown in (b) after Recovering Agent/Partitioning Oil removal

discrepancies should be more evident at this stage (Fig. 4d and Notes 10 and 11). 3. cDNA purification is performed using magnetic beads Vortex DynaBeads MyOne Silane beads until fully resuspended. Prepare DynaBeads Cleanup Mix and Elution Solution I by adding reagents in the order shown below and vortex mix thoroughly. Cleanup Mix: (1) nuclease-free water: 9 μl; (2) Buffer Sample Cleanup: 182 μl; (3) Dynabeads MyOne SILANE: 4 μl; (4) Additive A: 5 μl. If processing more than one sample per experiment prepare a master mix including a 10% excess. Elution Solution I: (1) Buffer EB 98 μl; (2) 10% Tween 20 1 μl; (3) Additive A 1 μl. 4. Add 200 μl DynaBeads Cleanup Mix to each sample to obtain a uniform suspension and incubate at room temperature for 10 min. 5. After the 10-min incubation step is complete, place the tube strip on a magnetic separator until the supernatant is clear. Carefully remove and discard the supernatant. 6. Add 300 μl freshly prepared 80% ethanol to the pellet while on the magnet and stand for 30 s. Carefully remove and discard the ethanol, and perform a second 200 μl wash. 7. Remove and discard the second ethanol wash and allow the samples to air-dry for 1 min. Remove the tube strip from the magnet add 35.5 μl of Elution Solution I. 8. Pipet-mix thoroughly until beads are fully resuspended (pipette set to 30 μl to avoid introducing air bubbles) and incubate at room temperature for 1 min. Place the tube strip in a magnetic

98

Marco De Simone et al.

separator until the solution is clear. Transfer 35 μl of purified GEM-RT product to a new tube strip. 3.5 cDNA Amplification

1. Prepare cDNA Amplification Reaction Mix on ice. Add reagents in the order described below. cDNA Amplification Mix: (1) nuclease-free water: 8 μl; (2) amplification master mix: 50 μl; (3) cDNA additive: 5 μl; (4) cDNA primer mix: 2 μl. If processing more than one sample per experiment prepare a master mix including a 10% excess. 2. Vortex mix and centrifuge briefly and add 65 μl cDNA Amplification Reaction Mix to each tube containing 35 μl of purified GEM-RT product. 3. Cap and load the tube strip into a thermal cycler that can accommodate at least 100 μl reaction volume and proceed with the following incubation protocol. Thermal Protocol: Step 1: 3 min at 98  C; Step 2: 15 s at 98  C; Step 3: 20 s at 67  C; Step 4: 1 min at 72  C; Step 5: go to Step 2 for N cycles; Step 6: 1 min at 72  C; Step 7: Hold 4  C. Lid temperature: 105  C. Reaction volume: 100 μl. Use a compatible thermal cycler. The number of PCR cycles is to be determined according to the target cell recovery as shown in the Table 2 (see Note 12). Store the samples at 4  C in a tube strip for up to 72 h or proceed directly to SPRIselect Cleanup.

3.6 Post-cDNA Amplification Reaction Cleanup and Quality Control

1. Vortex the SPRIselect Reagent (see Notes 13 and 14) until fully resuspended and add 60 μl SPRIselect Reagent (0.6
) to each sample in the tube strip and pipet-mix. 2. Incubate the tube strip at room temperature for 5 min. Place the tube strip in a magnetic separator until the solution is clear and carefully remove and discard the supernatant. 3. Wash twice the pellet with 200 μl 80% ethanol, stand for 30 s, and carefully remove and discard the ethanol wash. Table 2 cDNA amplification Targeted cell recovery

Total cDNA amplification cycles

10,000 Optimal number of cycles

8

Single Cell Sequencing of Tumor Infiltrating Lymphocytes

99

4. Remove and discard any remaining ethanol and allow the samples to air-dry for 2 min. Do not exceed 2 min as this will lead to decreased elution efficiency. Remove the tube strip from the magnetic separator and add 40.5 μl Buffer EB. 5. Pipet-mix 15 times and incubate at room temperature for 2 min. Place the tube strip in a magnetic separator until the solution is clear and transfer 40 μl of sample to a new tube strip and cap the sample wells. Samples can be stored at 4  C in a tube strip for up to 72 h or at 20  C for up to a week or proceed directly to Post-cDNA Amplification QC and Quantification. 6. For qualitative analysis run 1 μl of sample at a 1:5 dilution in nuclease-free water on the Agilent Bioanalyzer High Sensitivity chip or on the Agilent TapeStation High Sensitivity D1000 ScreenTape. Traces should resemble the overall shape of the sample electropherograms shown in Fig. 5a. Determine the cDNA yield per sample (see Note 15). Concentration will be used to determine the appropriate number of Sample Index PCR cycles to generate sufficient concentration of the final library. 3.7 Library Construction: Fragmentation, End Repair, and A-Tailing

1. Prepare a thermal cycler with the following incubation protocol and initiate the 4  C precool block step prior to assembling the fragmentation mix. Thermal Protocol: Step 1: Precool block and Hold 4  C; Step 2 (Fragmentation): 5 min at 32  C; Step 3 (End Repair and A-Tailing): 30 min at 65  C; Step 4: Hold 4  C. Lid temperature: 65  C. Reaction volume: 50 μl. Use a compatible thermal cycler. Vortex the fragmentation buffer and verify that there is no precipitate before proceeding. Prepare the fragmentation mix on ice add the reagents in the order shown below. Fragmentation mix: (a) fragmentation enzyme blend: 10 μl; (b) fragmentation buffer: 5 μl. If processing more than one sample per experiment prepare a master mix including a 10% excess. 2. Mix thoroughly, centrifuge briefly, and dispense 15 μl fragmentation mix into each well of an 8-tube strip on a chilled metal block resting on ice. 3. Add 35 μl purified cDNA to each well of the tube strip containing the fragmentation mix. Pipet-mix and transfer the chilled tube strip into the precooled thermal cycler (4  C) and press “SKIP” to initiate the Fragmentation protocol. 4. Double Sided Size Selection (see Note 14). Resuspend SPRIselect Reagent by vortexing and add 30 μl (0.6
) to each

100

Marco De Simone et al.

Fig. 5 cDNA and library quality control. (a) Electrophoretic profile of purified cDNA after RT reaction loaded on an Agilent Bioanalyzer High Sensitivity Chip. A good cDNA profile should resemble the one shown in figure. The average size (red box) and the cDNA concentration (blue box) are automatically determined by the instrument. (b) Electrophoretic profile of the final sequencing library loaded on an Agilent Bioanalyzer High Sensitivity Chip. A good library should resemble the one shown in figure. The average size (red box) and the cDNA concentration (blue box) are automatically determined by the instrument

sample in the tube strip, pipet-mix, and incubate the tube strip at room temperature for 5 min. 5. Place the tube strip in a magnetic separator until the supernatant is clear and transfer 75 μl supernatant to a new tube strip.

Single Cell Sequencing of Tumor Infiltrating Lymphocytes

101

6. Discard the previous tube strip (containing the beads) and add 10 μl SPRIselect Reagent (0.8
) to each sample in the tube strip. Pipet-mix and incubate the tube strip at room temperature for 5 min. Place the tube strip in a magnetic separator until the solution is clear and carefully remove and discard 80 μl supernatant. 7. With the tube strip still in a separator, wash twice the pellet with 125 μl 80% ethanol, and stand for 30 s. 8. Carefully remove and discard the remaining ethanol wash and resuspend directly with Buffer EB without waiting for the beads to dry to ensure maximum elution efficiency. Remove the tube strip from the magnetic separator and add 50.5 μl Buffer EB. Pipet-mix. 9. Mix and incubate the tube strip at room temperature for 2 min. Place the tube strip in a magnetic separator until the solution is clear and transfer 50 μl of sample to a new tube strip. 3.8 Library Construction: Adaptor Ligation

1. Prepare Adaptor Ligation Mix by adding the reagents in the order shown below. Mix thoroughly and centrifuge briefly. Adaptor Ligation Mix: (1) nuclease-free water: 17.5 μl; (2) ligation buffer: 20 μl; (3) DNA ligase: 10 μl; (4) adaptor mix: 2.5 μl. If processing more than one sample per experiment prepare a master mix including a 10% excess. Add 50 μl Adaptor Ligation Mix to each tube containing 50 μl sample from the Post-Fragmentation, End Repair and A-tailing Size Selection. Pipet-mix (pipette set to 50 μl) and incubate in a thermal cycler with the following protocol. Thermal Protocol: Step 1: 15 min at 20  C; Lid temperature: 30  C. Reaction volume: 50 μl. Use a compatible thermal cycler. 2. Post-ligation cleanup. Vortex the SPRIselect Reagent until fully resuspended and add 80 μl SPRIselect Reagent (0.8
) to each sample in the tube strip. Pipet-mix 15 times and incubate the tube strip at room temperature for 5 min (see Note 13). 3. Place the tube strip in a magnetic separator until the solution is clear and carefully remove and discard the supernatant. Add 200 μl 80% ethanol to the pellet and stand for 30 s. Remove and discard the ethanol wash and repeat this step for a total of two washes. Allow the samples to air-dry for 2 min. (Do not exceed 2 min as this will lead to decreased elution efficiency.) 4. Remove the tube strip from the magnetic separator and add 30.5 μl Buffer EB. Pipet-mix and incubate the tube strip at room temperature for 2 min. 5. Place the tube strip in a magnetic separator until the solution is clear and transfer 30 μl of sample to a new tube strip.

102

Marco De Simone et al.

3.9 Library Construction. Sample Index PCR

1. Prepare Sample Index PCR Mix by adding the reagents in the order shown below. Sample index PCR mix: (a) nuclease-free water: 8 μl; (b) amplification master mix: 50 μl; sample index (SI) PCR primer: 2 μl. Mix and add 60 μl Sample Index PCR Mix to each tube containing 30 μl purified Post-Ligation sample. If processing more than one sample per experiment prepare a master mix including a 10% excess. Add 10 μl of an individual Chromium i7 Sample Index to each well and record their assignment. This index is a “molecular tag” that allows to assign sequencing reads to specific samples during the sequencing process. Mix, centrifuge briefly and index the DNA library in a thermal cycler with the following protocol. Thermal Protocol: Step 1: 45 s at 98  C; Step 2: 20 s at 98  C; Step 3: 30 s at 54  C; Step 4: 20 s at 72  C; Step 5: go to Step 2 for N cycles; Step 6: 1 min at 72  C; Step 7: Hold 4  C. Lid temperature: 105  C. Reaction volume: 100 μl. Use a compatible thermal cycler. Choose the appropriate sample index sets to ensure that no sample indices overlap in a multiplexed sequencing run. Record the 10
Sample Index name (PN-220103 Chromium™ i7 Sample Index Plate well ID) used, especially if running more than one sample. The optimal number of cycles for the Sample Index PCR reaction is a balanced compromise between obtaining enough material for sequencing and minimizing PCR amplification biases. Table 3 is a starting point for this optimization and amplification cycles should be determined according to the starting amount of cDNA. Store the tube strip at 4  C for up to 72 h or proceed directly to Post-Sample Index PCR Double Sided Size Selection.

Table 3 Sample index PCR Input into library construction, ng

Total sample index cycles

1–25

14–16

25–150

12–14

150–500

10–12

500–1000

8–10

1000–1500

6–8

>1500

5

Optimal number of cycles

Single Cell Sequencing of Tumor Infiltrating Lymphocytes

103

2. Post-Sample Index PCR Double Sided Size Selection (see Note 14). Vortex the SPRIselect Reagent and add 60 μl (0.6
) to each sample in the tube strip, pipet-mix, and incubate the tube strip at room temperature for 5 min. 3. Place the tube strip in a magnetic separator until the solution is clear and transfer 150 μl supernatant to a new tube strip and discard the previous tube strip (containing the beads). 4. Add 20 μl SPRIselect Reagent (0.8
) to each sample in the tube strip, pipet-mix 15 times, and incubate the tube strip at room temperature for 5 min. 5. Place the tube strip in a magnetic separator until the solution is clear, carefully remove and discard 165 μl supernatant and with the tube strip still in magnetic separator, add 200 μl 80% ethanol to the pellet and stand for 30 s. 6. Carefully remove and discard the ethanol wash and repeat step 5 for a total of two washes. 7. Remove the tube strip from the magnetic separator and resuspend directly with Buffer 35.5 μl of Buffer EB without waiting for the beads to dry to ensure maximum elution efficiency and incubate the tube strip at room temperature for 2 min. 8. Place the tube strip in a magnetic separator until the solution is clear and transfer 35 μl of sample to a new tube strip and cap the sample wells. Store the tube strip at 4  C for up to 72 h or at 20  C for long-term storage. 3.10 Post-library Construction QC and Quantification

1. For qualitative analysis load 1 μl of sample at 1:10 dilution on the Agilent Bioanalyzer High Sensitivity chip or on the Agilent TapeStation High Sensitivity D1000 ScreenTape. A typical electropherogram is shown in Fig. 5b. Determine the average fragment size from the Bioanalyzer/TapeStation trace. Determine the cDNA yield per sample using Kapa DNA Quantification Kit for Illumina platforms (see Note 16). Calculation of total yield can be also performed using Fluorimetric DNA Quantification methods like Qubit dsDNA HS Assay Kit (Thermofisher) or QuantiFluor dsDNA System (Promega).

3.11

1. Sequencing library Description and Depth Recommendations. A Single Cell 30 Library comprises standard Illumina pairedend constructs which begin and end with P5 and P7. Read 1 and Read 2 are standard Illumina sequencing primer sites used in paired-end sequencing. Read 1 is used to sequence the 16 bp 10
Barcode and 10 bp UMI, while Read 2 is used to sequence the cDNA fragment. Each sample index provided in the Chromium™ i7 Sample Index Kit combines 4 different sequences in order to balance across all four nucleotides.

Sequencing

104

Marco De Simone et al.

Table 4 Sequencing run parameters Sequencing read

Number of cycles

Read1

26

i7 Index

8

i5 Index

0

Read2

98

The technical performance of Single Cell 30 libraries is driven by sequencing coverage per cell. Fifty thousand raw reads per cell is recommended. This sequencing depth is optimal for libraries generated from T Lymphocytes (see Note 17). 2. Sequencing Run Parameters Single Cell 30 libraries can be sequenced using MiSeq, NextSeq 500/550, HiSeq 2500, or HiSeq 3000/4000 platforms. Libraries should be run using paired-end sequencing with single indexing. The supported number of cycles for each read is shown in Table 4.

4

Notes 1. Cell 30 library and gel bead kit v2. This kit is the most expensive reagent of the protocol. We suggest to order reagents after planning very carefully your experiment. Reagents can be sold in 16- or 4-reaction solutions and we suggest, to avoid any technical variability to perform the experiment using the same reagents Lot Number. 2. Chromium™ Single Cell A Chip Kit. Microfluidic Chips can be sold separately from reagents in a six-chip (48 reactions) or two-chip (16 reactions) solution. On each chip a total of eight independent reactions can be loaded and considering that on each channel of the chip you can load from 500 to 10,000 cells, a total of 80,000 cells per chip is the maximum number of cells analyzed per run. Chips are disposable meaning that if running a chip and you cannot fill all the channels, empty channels cannot be reused. 3. Chromium™ i7 multiplex kit, 96 rxns. This kit contains 96 independent mixes of “sample index primers.” Sample index is added by PCR (see Subheading 3.9) because partially overlapping to the adapter added by ligation during library preparation This mix is used to assign a specific index to each sample: each cell in fact is indexed during RT reaction but no index has been yet assigned to samples to distinguish them if pooled during sequencing. Remember to label the well

Single Cell Sequencing of Tumor Infiltrating Lymphocytes

105

number once you index your sample to allow a correct demultiplexing after sequencing. 4. 10
™ magnetic separator is an 8-well strip magnetic separator used in all the purification steps of the protocol that always employ magnetic beads. This magnet is replaceable with other commercially available but we strongly recommend the 10
magnet because is very efficient and allows to work very precisely with very small volumes (in some purification steps just 10 μl of beads is used). 5. Plastics and special equipment. Some plastics can interact with and destabilize GEMs. It is therefore critical to use validated emulsion-safe plastic consumables when handling GEMs. 10
Genomics® has validated Eppendorf twin.tec® PCR plates and Rainin LTS Low retention pipette tips as GEM-compatible plastics. USA Scientific, Eppendorf, and Thermo Fisher PCR 8-tube strips have also been validated. Substituting these materials can adversely affect performance. Considering the high viscosity of the reagents to be handled (especially the beads), to avoid sample and solution loss and to obtain a high reproducibility, the use of low retention tips is recommended. In Subheading 2 a list of suggested thermal cycles is provided. These cyclers have been tested for a uniform heating of the emulsion which is essential for emulsion stability and the efficiency of the protocol. 6. Cell preparation. The quality of the starting single cell suspension is one of the major factors to take into consideration for the generation of good quality single cell mRNA seq results. This suspension should have a high viability (>80%), and to guarantee a good reproducibility cell concentration should be precisely calculated. Cell viability is one of the most important aspects affecting cell recovery: dying cells have a lower amount of RNA that cannot be efficiently captured during RT reaction and this decreases the number of cells that we expect to recover. Moreover, dead cells lyse very easily releasing RNA called “ambient RNA” that can be incorporated in droplets along with intact cells increasing the background. Dead cells can be eliminated with PBS washes or using specific protocols for dead cell removal (MACS® Dead Cell Removal Kit, Miltenyi Biotec). To calculate concentration, we suggest using both manual counting and an automated cell Counter after staining cells with Trypan blue or a viability die. Like viability, the quantification of cell concentration is critical because overestimation of cell concentration decreases the expected recovery.

106

Marco De Simone et al.

7. Handling reagents and master mixes. Before starting ensure that reagents are fully thawed and thoroughly mixed before use. All enzyme components and master mixes should be kept on ice during setup and promptly moved back to the recommended storage temperature when possible. 8. Cell loading. Chromium 10
has a processing efficiency of up to 65% meaning that the number of recovered cells will be up to 65% of the cells loaded in each channel of the chip. In the User Guide 10
Genomics provides a “Cell Suspension Volume Calculator Table” (Table 1). This table is a useful tool to calculate the volume of quantified cell suspension to load on the chip in order to achieve a desired Targeted Cell Recovery. The left column lists the cell concentration in cells/μl while the row at the top of the table lists the number of cells targeted for recovery. In this table in red and blue are indicated respectively the volume of cell suspension and water to add to the master mix in order to achieve the targeted number of recovered cells for a particular sample. For example, for a cell stock concentration of 1000 cells/μl we need to add 25.1 μl of water to the master mix first, and then add 8.7 μl of the cell suspension to the master mix in order to capture 6000 cells. Another important point concerning cell loading is cell resuspension before loading. After quantification cells are usually kept on ice and if cells are sitting in the tube for a long time they begin to settle. If cells are not properly resuspended before loading the number of cells loaded can differ consistently if pipetting from the top or the bottom of the solution in the tube and the cell recovery can be widely inconsistent with the one calculated after cell quantification. 9. Gel beads storage. Single Cell 30 Gel Beads Strip should be stored at 80  C and equilibrated to room temperature before use. Unused Single Cell 30 gel beads should be stored at 80  C avoiding more than ten freeze–thaw cycles. Gel beads should be pipetted very slowly as they have a viscosity similar to high concentration glycerol. 10. Chip loading. Wetting failures. Once reagents are added to the Chromium™ Chip wells, they immediately flow into and prime the microfluidic channels on the chip. A wetting failure is the result of an incorrect priming of the chip in which, instead of a uniform emulsion, millimeter-scale droplets are formed. To favor correct priming and to minimize the occurrence of wetting failures, it is critical to add reagents in the correct order and to wait for 30 s and no more than 120 s between addition of master mix and addition of Gel Beads. Chip should be run in 120 s after loading and delays can

Single Cell Sequencing of Tumor Infiltrating Lymphocytes

107

potentially cause failures. The occurrence of a wetting failure can be easily recognized by the absence of a uniform emulsion in the outlet well or pipette tip (Fig. 3c) and can be further confirmed during the Post-GEM-RT Cleanup Step just after the addition of Recovery Agent: if a wetting failure occurs in a specific channel, the volume ratio between Partitioning Oil/Recovery Agent phase and aqueous phase is abnormal compared to normal samples (Fig. 4b, d). 11. Chip loading. Clogs. The generation of GEMs occurs in channels that are narrower than 100 μm. The presence of particles or fibers on the working station or the presence of cell aggregates in the single cell suspension due to an improper preparation can affect the emulsion generation creating clogs in the microfluidic circuits. A clog can be easily recognized in the pipette tip during the recovery phase: the volume of emulsion is reduced compared to the successful samples and an excess of oil (clear) or air is observed (Fig. 3c). To avoid clogs, it is also important to minimize exposure of reagents, chips, and gaskets to sources of particles and fibers and to check for the absence of aggregates in the single cell suspension to be loaded on the chip. Clogs can be further confirmed during the Post-GEMRT Cleanup Step just after the addition of Recovery Agent: if a clog occurs in a specific channel, the volume of aqueous phase during recovery will be decreased compared to successful reactions (Fig. 4b, d). 12. cDNA amplification cycles. In Table 2 the suggested amplification cycles in the cDNA amplification reaction are listed. Suggested cycles are determined according to the starting number of cells to “normalize” samples derived from different amount of cells and to obtain enough material for library preparation. As different cells contain different amount of RNA a range of cycles is suggested. T cells contain very low amount of RNA and for this reason it can be useful to increase the suggested cycles. As an example, when starting from 5000 T cells we suggest to use 13 cycles instead of 12 suggested by the protocol. 13. Solid-phase reversible immobilization beads (SPRI beads) are paramagnetic meaning that they are magnetic only when exposed to a magnetic field (magnetic stand in our case). These particles are coated with carboxyl groups that can bind DNA nonspecifically and reversibly. These beads are resuspended in a solution containing polyethylene glycol (PEG) whose concentration directly affects their capacity to bind DNA fragments according to their size; this property is exploited in DNA purification procedures to select specific DNA fragments from samples highly heterogeneous in size. In general, the higher the concentration of PEG and salt in the

108

Marco De Simone et al.

solution, the shorter the cutoff size, and, therefore, the lower the starting molecular weight of the purified products. Part of the reason for this effect is that DNA fragment size affects the total charge per molecule with larger DNAs having larger charges; this promotes their electrostatic interaction with the beads and displaces smaller DNA fragments. 14. Double size selection. This protocol can be used to generate DNA fragment libraries with a certain size range or to narrow fragment-size distribution; both smaller and larger fragments can, in fact, be removed. A first step enables binding of all DNA fragments longer than the desired upper limit of the interval. The beads with the unwanted larger DNA fragments are discarded (0.6
, right side selection). The supernatant, which contains DNA fragments shorter that the upper length cutoff, is transferred to a new tube to perform the second size selection step (0.8
, left side selection). 15. cDNA quality control and quantification. cDNA Quality Control is performed running 1 μl of sample at a dilution of 1 part sample: 5 parts Nuclease-Free Water on the Agilent Bioanalyzer High Sensitivity chip. Considering that PCR cycles in the cDNA Amplification Step are calculated according to the number of cells recovered it may be necessary, if working with very small cells with very low amount of RNA to load undiluted PCR product. cDNA concentration can be than extrapolated from the “Electropherogram” view choosing the “Region Table” tab on the Agilent 2100 Expert Software and manually selecting the region encompassing 200–9000 bp. Obviously the concentration is then corrected according to the initial dilution. This concentration will be used in Subheading 3.9 to determine the appropriate number of Sample Index PCR cycles to generate sufficient amount of final library. Calculation of total yield can be also performed using Fluorimetric DNA Quantification methods like Qubit dsDNA HS Assay Kit (Thermofisher) or QuantiFluor dsDNA System (Promega). 16. Library quality control and quantification. Post-Library Construction Quality Control is performed running 1 μl of sample at 1:10 dilution on the Agilent Bioanalyzer High Sensitivity chip. Traces should resemble the overall shape of the sample electropherogram shown below. Determine the average fragment size from the Bioanalyzer trace and use it as the reference insert size for accurate library quantification in qPCR. Post-Library Construction Quantification is performed using Kapa DNA Quantification Kit for Illumina platforms. This is a qPCR based quantification method that allows DNA quantification using a universal DNA standard at known concentration. A series of 1:40,000, 1:200,000,

Single Cell Sequencing of Tumor Infiltrating Lymphocytes

109

1:1,000,000, and 1:5,000,000 of the completed Single Cell 30 library is required to fall within the dynamic range of the assay. Calculation of total yield can be also performed using fluorimetric DNA quantification methods like Qubit dsDNA HS Assay Kit (Thermo Fisher) or QuantiFluor dsDNA System (Promega). 17. Sequencing depth. Chromium System from 10
is a cost effective methods to obtain shallow sequencing of thousands to tens of thousands of single cells in one run. (Each chip contains 8 loading channels. In each channel it is possible to load from 500 to 10,000 cells.) The sensitivity of the emulsion based systems, defined as the fraction of each cell’s transcriptome represented in the final sequencing library is lower compared to the ones obtained with other systems (3–10% compared with 10–20% for other methods). This bias can be partially solved increasing the depth at which libraries are sequenced. Sequencing depth is mainly limited by costs and lower sequencing depth limits the complexity of the expression profile attained per cell. At a low sequencing depth, only the most highly expressed genes will be observed and consequently the number of cell to be loaded should be decided according to the scientific questions of interest. Studies aiming at identifying cell clusters that can be defined by many genes, with an emphasis on finding rare cell populations, should prioritize a breadthbased approach (shallow sequencing of tens of thousands of cells), whereas studies aiming at distinguishing stochastic variation in individual genes should prioritize a high depth of sequencing (deeper sequencing of fewer single cells). References 1. Zheng GX, Terry JM, Belgrader P, Ryvkin P, Bent ZW, Wilson R, Ziraldo SB, Wheeler TD, McDermott GP, Zhu J, Gregory MT, Shuga J, Montesclaros L, Underwood JG, Masquelier DA, Nishimura SY, Schnall-Levin M, Wyatt PW, Hindson CM, Bharadwaj R, Wong A, Ness KD, Beppu LW, Deeg HJ, McFarland C, Loeb KR, Valente WJ, Ericson NG, Stevens EA, Radich JP, Mikkelsen TS, Hindson BJ, Bielas JH (2017) Massively parallel digital transcriptional profiling of single cells. Nat Commun 8:14049. https://doi.org/10.1038/ ncomms14049 2. Zhu YY, Machleder EM, Chenchik A, Li R, Siebert PD (2001) Reverse transcriptase template switching: a SMART approach for full-length cDNA library construction. BioTechniques 30 (4):892–897 3. De Simone M, Arrigoni A, Rossetti G, Gruarin P, Ranzani V, Politano C, Bonnal RJP,

Provasi E, Sarnicola ML, Panzeri I, Moro M, Crosti M, Mazzara S, Vaira V, Bosari S, Palleschi A, Santambrogio L, Bovo G, Zucchini N, Totis M, Gianotti L, Cesana G, Perego RA, Maroni N, Pisani Ceretti A, Opocher E, De Francesco R, Geginat J, Stunnenberg HG, Abrignani S, Pagani M (2016) Transcriptional landscape of human tissue lymphocytes unveils uniqueness of tumorinfiltrating T regulatory cells. Immunity 45 (5):1135–1147. https://doi.org/10.1016/j. immuni.2016.10.021 4. Tirosh I, Izar B, Prakadan SM, Wadsworth MH 2nd, Treacy D, Trombetta JJ, Rotem A, Rodman C, Lian C, Murphy G, Fallahi-SichaniM, Dutton-Regester K, Lin JR, Cohen O, Shah P, Lu D, Genshaft AS, Hughes TK, Ziegler CG, Kazer SW, Gaillard A, Kolb KE, Villani AC, Johannessen CM, Andreev AY, Van Allen EM, Bertagnolli M, Sorger PK, Sullivan RJ, Flaherty

110

Marco De Simone et al.

KT, Frederick DT, Jane-Valbuena J, Yoon CH, Rozenblatt-Rosen O, Shalek AK, Regev A, Garraway LA (2016) Dissecting the multicellular ecosystem of metastatic melanoma by singlecell RNA-seq. Science 352(6282):189–196. https://doi.org/10.1126/science.aad0501

5. Plitas G, Konopacki C, Wu K, Bos PD, Morrow M, Putintseva EV, Chudakov DM, Rudensky AY (2016) Regulatory T cells exhibit distinct features in human breast cancer. Immunity 45(5):1122–1134. https://doi.org/10. 1016/j.immuni.2016.10.032

Chapter 8 Seq-Well: A Sample-Efficient, Portable Picowell Platform for Massively Parallel Single-Cell RNA Sequencing Toby P. Aicher, Shaina Carroll, Gianmarco Raddi, Todd Gierahn, Marc H. Wadsworth II, Travis K. Hughes, Chris Love, and Alex K. Shalek Abstract Seq-Well is a low-cost picowell platform that can be used to simultaneously profile the transcriptomes of thousands of cells from diverse, low input clinical samples. In Seq-Well, uniquely barcoded mRNA capture beads and cells are co-confined in picowells that are sealed using a semipermeable membrane, enabling efficient cell lysis and mRNA capture. The beads are subsequently removed and processed in parallel for sequencing, with each transcript’s cell of origin determined via the unique barcodes. Due to its simplicity and portability, Seq-Well can be performed almost anywhere. Key words Seq-Well, Single-cell RNA sequencing, Single-cell genomics, Systems biology, Transcriptomics, RNA-Seq, Picowells

1

Introduction Single-cell RNA sequencing (scRNA-seq) is an emerging method that enables genome-wide expression profiling at cellular resolution. Population-level transcriptomic techniques, such as microarrays and bulk RNA-seq, average over a large number of cells and assume transcriptional homogeneity; yet even related cells of the same subtype can present dramatic heterogeneity in their transcriptional activities and states [1]. ScRNA-seq allows direct measurement of this variability, as well as analyses of expression covariation across cells. This information can be used to discover gene-expression patterns that define distinct cell types and states, as well as their molecular circuits and biomarkers, affording an unprecedented view of cellular phenotype. Over the years, technological progress and protocol improvements have resulted in a substantial increase

Junior authors, Toby P. Aicher, Shaina Carroll, and Gianmarco Raddi, and senior authors, Chris Love and Alex K. Shalek, contributed equally to this work. Valentina Proserpio (ed.), Single Cell Methods: Sequencing and Proteomics, Methods in Molecular Biology, vol. 1979, https://doi.org/10.1007/978-1-4939-9240-9_8, © Springer Science+Business Media, LLC, part of Springer Nature 2019

111

112

Toby P. Aicher et al.

in the number of cells that can be processed in parallel [2–4], enhancing statistical power and providing opportunities to look at increasingly complex systems. Current methods used to prepare single-cell libraries include manual selection [5], FACS sorting [6], microfluidic circuits [7], droplet-based techniques [8–10], and picowells [11, 12]. Seq-Well, an example of the latter, is an easy-to-use, low-cost, sample-efficient and portable platform for massively parallel scRNA-seq [11]. Seq-Well utilizes PDMS arrays containing ~88,000 subnanoliter wells in which single cells and uniquely barcoded poly(dT) mRNA beads are co-confined with a semipermeable membrane. Crucially, well size ensures that only one barcoded mRNA capture bead can fit into each well, improving cell capture efficiency. Cells, meanwhile, are loaded at a low density to minimize cell doublets, ensuring single-cell resolution. Selective chemical functionalization allows reversible attachment of a semipermeable polycarbonate membrane with 10 nm pores, permitting buffer exchange for cell lysis while trapping larger macromolecules, such as nucleic acids, to minimize cross-contamination. The co-confined mRNA capture beads are covered in oligonucleotides that consist of a universal primer, a cell barcode (unique to each bead), a unique molecular identifier (UMI; unique to each primer), and a poly-T sequence that can capture cellular mRNA upon lysis and during hybridization [13]. Following these steps, the semipermeable membrane can be peeled off for bead removal. Finally, the barcoded beads can be pooled for reverse transcription, PCR amplification, library preparation, and sequencing, with a transcript’s cell of origin and uniqueness determined via its cell barcode and UMI, respectively. Importantly, implementing Seq-Well only requires a PDMS array, a polycarbonate membrane, a pipette, a clamp, an oven/ heat source, and a tube rotator to produce stable cDNA product, making it functional in nearly every clinic and laboratory context.

2

Materials All buffers and solutions are to be prepared with ultrapure water and stored at room temperature, unless otherwise indicated.

2.1 Array Processing Prior to Reverse Transcription

1. Bead loading buffer (BLB): 10% BSA, 100 mM sodium carbonate, pH 10. Add 2.5 mL BSA (100 mg/mL) to a 50 mL falcon tube. Add water to ~15 mL followed by 1.25 mL 2 M sodium carbonate. Add additional water to achieve a final volume of 25 mL. Titrate with glacial acetic acid to reach pH 10 (see Note 1).

Seq-Well: A Picowell Platform for Single-Cell RNA-Sequencing

113

2. Prelysis buffer: 5 M guanidine thiocyanate, 1 mM EDTA (see Notes 2 and 3). 3. Complete lysis buffer: 5 M guanidine thiocyanate, 1 mM EDTA, 0.5% sarkosyl, 1% β-mercaptoethanol. Combine 5 mL prelysis buffer with 25 μL 10% sarkosyl and 50 μL β-mercaptoethanol (see Note 4). 4. Hybridization buffer: 2 M NaCl, 4% PEG 8000 in PBS. Combine 10 mL 5 M NaCl with 13 mL of PBS, and 2 mL 50% (w/v) PEG 8000 (see Note 5). 5. Wash buffer: 2 M NaCl, 3 mM MgCl2, 20 mM Tris–HCl (pH 8.0), 4% PEG 8000. Combine 20 mL 5 M NaCl, 150 μL 1 M MgCl2, 1 mL 1 M Tris–HCl (pH 8.0), and 4 mL 50% (w/v) PEG 8000. Add water to bring volume to 50 mL (see Note 5). 6. Polycarbonate membranes: 0.01 μm pores, 62 mm  22 mm (see Note 6). 7. mRNA capture beads (see Note 7). 8. Seq-Well arrays (see Notes 8 and 9). 9. RPMI. 10. RP-10: RPMI with 10% FBS. 11. PBS for washing. 2.2

Array Storage

1. Array quenching buffer: 100 mM sodium carbonate, 10 mM Tris–HCl (pH 8.0). Combine 2.5 mL 2 M sodium carbonate with 500 μL 1 M Tris–HCl. Add water to bring total volume to 50 mL. Arrays can be stored in array quenching buffer for up to 1 month at 4  C (see Note 10). 2. Aspartic acid solution: 20 μg/mL of L-aspartic acid, 2 M NaCl, and 100 mM sodium carbonate solution (pH 10.0). Arrays can be stored in the aspartic acid solution for up to 6 months at 4  C (see Note 10).

2.3 Reverse Transcription

1. Maxima H-RT with Maxima 5 RT buffer. 2. 30% PEG 8000. 3. dNTP mix (10 mM each). 4. RNase Inhibitor. 5. Template Switch Oligo (see Subheading 2.5). 6. TE-TW: 10 mM Tris–HCl pH 8.0, 1 mM EDTA, 0.01% Tween-20. Combine 49.5 mL water, 0.5 mL 1.0 M Tris pH 8.0, 100 μL 0.5 M EDTA, and 50 μL Tween-20. 7. TE-SDS: 10 mM Tris pH 8.0, 1 mM EDTA, 0.05% SDS. Combine 49.5 mL water, 0.5 mL 1.0 M Tris pH 8.0, 100 μL 0.5 M EDTA, and 250 μL 10% SDS.

114

Toby P. Aicher et al.

2.4 PCR and Library Preparation

1. Exonuclease I (E. coli) with buffer (NEB Cat. No. M0293S). 2. 10 mM Tris–HCl (pH 8.0). 3. Thermocycler. 4. Microseal B adhesive seal. 5. Microseal F foil. 6. Qubit assay tubes. 7. Qubit 2.0 fluorometer. 8. 96-well PCR plates, skirted. 9. SMART PCR Primer (see below). 10. KAPA HiFi Hotstart Readymix PCR Kit. 11. Ampure DNA Spri beads. 12. 80% ethanol. 13. Agilent High Sensitivity DNA Kit. 14. Nextera XT kit. 15. Custom P5-SMART PCR hybrid oligo (see Subheading 2.5).

2.5

Primers

1. Template Switch Oligo: AAGCAGTGGTATCAACGCAGAG TGAATrGrGrG. 2. SMART PCR Primer: AAGCAGTGGTATCAACGCAGAGT. 3. Custom P5-SMART PCR hybrid oligo: AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAG TGGTATCAACGCAGAGT*A*C. 4. Custom Read 1 Primer: GCCTGTCCGCGGAAGCAGTGG TATCAACGCAGAGTAC.

3

Methods

3.1 Membrane Functionalization

1. Place a precut (22  66 mm) polycarbonate membrane onto a glass slide, using a gloved finger and tweezers to carefully separate the membrane and paper. Make sure the shiny side of the polycarbonate membrane is facing up. Discard any membranes that have creases or other large-scale imperfections (see Note 11). 2. Place membranes onto a shelf in the plasma cleaner (see Note 12). 3. Close the plasma cleaner door and make sure the three-way valve lever is in the closed position. Then turn on the main power and pump switch to form a vacuum (see Note 13). 4. Allow a vacuum to form for 2 min. Once the vacuum has formed, simultaneously turn the valve clockwise to 12:00 while turning the power to the high setting.

Seq-Well: A Picowell Platform for Single-Cell RNA-Sequencing

115

Fig. 1 Functionalized membranes can be stored in 1 PBS for 24 h

5. Treat membranes with plasma for 7 min. 6. After treatment, in the following order, turn the RF level valve from HIGH to OFF, then turn off the power followed by turning off the vacuum. Then slowly open the valve until you can just barely hear air entering the chamber. Allow the chamber to slowly fill with air until the door opens. This will take about 5 min (see Note 14). 7. Pipet 1 mL of 1 PBS into each well of a four-well plate. Transfer slides with treated membranes from the plasma cleaner to the four-well plate. Quickly pipet 4 mL of 1 PBS over the membrane, preventing the membrane from folding on itself (see Note 15 and Fig. 1). 8. Remove any air bubbles underneath the membrane by gently pressing on the membrane using wafer forceps. Membranes are now functionalized and ready for use. Membranes solvated with 1 PBS should be used within 24 h. 3.2

Bead Loading

1. Aspirate storage solution and solvate each array with 5 mL of BLB (see Note 16). 2. Aliquot ~110,000 beads per array from bead stock into a 1.5 mL tube and spin on a tabletop centrifuge for 15 s to form a pellet (see Note 17). 3. Aspirate storage buffer and replace it with 500 μL of BLB. Invert the tube several times to wash the beads. Pellet the beads and then repeat the wash step with an additional 500 μL of BLB.

116

Toby P. Aicher et al.

Fig. 2 Apply beads to the array in a dropwise fashion

4. Pellet beads, aspirate BLB, and resuspend in 200 μL of BLB per 110,000 beads. 5. Before loading beads, thoroughly aspirate BLB from the dish containing the array(s), being careful not to aspirate or dry the PDMS surface of the array(s). Center the array(s) so that there is no contact between the array(s) and the sides of the fourwell dish. 6. Use a 200 μL pipette to apply 200 μL containing 110,000 beads, in a dropwise fashion, to the surface of each array. Your goal is to cover the surface of the entire array with beads (see Fig. 2). 7. Rock the four-well dish in the x and y directions for 10 min (see Notes 18–20). 8. Thoroughly wash array(s). Position each array so that it sits in the center of the four-well dish. Dispense 500 μL of BLB in the upper right corner of each array and 500 μL in the bottom right corner of the PDMS surface of each array. Be careful not to directly pipet onto the microwells, as it can dislodge beads. Using wafer forceps, push each array against the left side of the four-well dish to create a capillary flow—this will help remove excess beads from the surface. Aspirate the liquid from the bottom of the dish, reposition each array in the center of the four-well dish, and repeat, but this time pipetting BLB onto the opposite corners (see Notes 21 and 22 and Fig. 3).

Seq-Well: A Picowell Platform for Single-Cell RNA-Sequencing

1.Pipette 1 mL ofBLB onto array surface (500uLatcorners)

2. Reposition array adjacent to the edge of the dish to create a capillary flow across the array

3.Aspirate excess beads from the left side of the array surface and bottom of the dish

117

4.Rotate array and repeat washing until all excess beads are removed

Fig. 3 Create capillary flow to draw excess beads from the center of the array

9. Repeat step 8 as necessary. Periodically examine the array (s) under a microscope to verify that very few loose beads are present on the surface, as this will interfere with membrane attachment. 10. Once excess beads have been removed from the surface, solvate each array. If continuing to cell loading immediately (i.e., within 1–5 h), loaded arrays should be stored in 5 mL of BLB. Alternatively, loaded arrays can be stored for up to 2 weeks in Array Quenching Buffer. 3.3

Cell Loading

1. Obtain a cell or tissue sample and prepare a single-cell suspension using your preferred protocol. 2. Aspirate BLB from each array and soak in 5 mL of RPMI + 10% FBS (RP-10). 3. After obtaining a single-cell suspension, count cells using a hemocytometer and make a new solution of 15,000 cells in 200 μL of RP-10 (see Note 23). 4. Aspirate the RP-10 from the four-well dish, center each array in well, and then load the cell loading solution in a dropwise fashion onto the surface of each array. 5. Rock the array in the x and y directions for a total of 10 min— alternate between rocking for 20 s and letting the arrays sit for 30 s to let cells fall into wells.

118

Toby P. Aicher et al.

6. Wash array(s) 4 with PBS to remove FBS in media (see Note 24). To wash, add 5 mL of PBS to the corner of the four-well dish and then aspirate. 7. Aspirate final PBS wash and replace with 5 mL of RPMI media (no FBS). 3.4 Membrane Sealing

1. Gather the follow materials before sealing the array(s): wafer forceps, paper towels, Agilent clamps, pretreated membranes, and clean microscope slides. 2. Use the wafer forceps, transfer the array from media to the lid of a four-well dish, being careful to keep the array as close to horizontal as possible (see Note 25). 3. Use the wafer forceps to remove a pretreated membrane from the four-well dish. Gently dab away excess moisture from the glass slide on the paper towel until the membrane does not spontaneously change position on the glass slide. Avoid touching the surface of the membrane that will be sealed to PDMS array as this may affect membrane sealing. 4. Carefully position the membrane in the center of the microscope slide leaving a small (2–3 mm) membrane overhang beyond the edge of the slide (see Note 26 and Fig. 4). 5. Holding the membrane in your left hand, invert the microscope slide so that the treated surface is facing down. 6. Place the overhang of the membrane in contact with the PDMS surface of the array just above the boundary of the microwells (see Fig. 5). 7. Using a clean glass slide held in your right hand, firmly press down the overhang of the membrane against the PDMS surface of the array.

Fig. 4 Use tweezers to position the membrane on the glass slide so that there is a small overhang and touch it to the array just above the boundary of the wells

Seq-Well: A Picowell Platform for Single-Cell RNA-Sequencing

119

Fig. 5 Hold the membrane firmly against the array with a clean glass slide

Fig. 6 Slide the hand holding the membrane across the array to apply the membrane

8. While maintaining pressure with your right hand to hold the membrane in place, gently apply the membrane by shifting your left hand across the array (see Notes 27 and 28, and Fig. 6). 9. After applying the membrane, carefully pry the array and membrane from the surface of the lid and transfer to an Agilent clamp (see Fig. 7). 10. Once the array is in the clamp, place a glass slide on top of the array and then assemble the clamp, tightening it just past the point of resistance. Be careful not to tighten too far so as not to break either of the glass slides. 11. Place the assembled clamp in a 37  C incubator for 30 min (see Note 29).

120

Toby P. Aicher et al.

Fig. 7 Place the array in a clamp and heat it at 37  C for 30 min to seal the membrane 3.5 Cell Lysis and Hybridization

1. Remove the clamp from the incubator and then remove the array(s) from the Agilent clamp(s) (see Note 30). 2. Submerge each array, with top slide still attached, in 5 mL of complete lysis buffer in a new four-well dish (see Note 31). 3. Gently rock the array(s) in lysis buffer until the top glass slide lifts off. Do not pry the top slide off as this can reverse membrane sealing. The time necessary for detachment of the top slide varies (10 s to 10 min). Just be patient. 4. Once the top slide has detached, let the array(s) rotate for 20 min at 50–60 rpm. 5. After 20 min, remove the lysis buffer and wash each array with 5 mL of hybridization buffer. Use a container without bleach to collect lysis buffer waste because guanidine thiocyanate can react with bleach to create toxic gas. 6. Remove hybridization buffer and add another 5 mL of hybridization buffer to each array. Rotate arrays for 40 min at 50–60 rpm. While arrays are rocking, prepare RT master mix (see Note 32).

3.6

Bead Removal

3.6.1 Bead Removal by Pipette Washes

To remove beads from the array, either wash the arrays with a pipette or spin them down in a centrifuge with angled inserts. 1. Aspirate hybridization buffer and replace with 5 mL of wash buffer. 2. Rock for 3 min. Fill 50 mL conical tube(s) with 48 mL of wash buffer (see Note 33). 3. Remove membranes with fine-tipped tweezers (see Fig. 8). 4. Carefully position the array over the 50 mL conical tube. Repeatedly wash (~15 times) beads from the surface of the array over the 50 mL falcon tube using 1 mL of wash buffer.

Seq-Well: A Picowell Platform for Single-Cell RNA-Sequencing

121

Fig. 8 After placing the array in wash buffer, remove the membrane with tweezers

Fig. 9 Carefully position the array over a conical of wash buffer and pipet on the array to dislodge beads

Flip the array and repeatedly wash (~15 times) the other end (see Note 34 and Fig. 9). 5. Hold the array above the 50 mL conical and gently scrape the array ten times with a glass slide, dipping the glass slide into the wash buffer after every scrape. Flip the array and repeat.

122

Toby P. Aicher et al.

6. Wash again using 1 mL of wash buffer (~10 times) and inspect the array underneath a microscope to check if there are any beads remaining. If so, take a glass slide and scrape more forcefully and continue to wash until all beads have been dislodged (see Note 35). 7. Spin the 50 mL falcon tube at 2000  g for 5 min to pellet beads (see Note 36). 8. Aspirate all wash buffer except for ~1 mL. Be careful not to disturb the pellet of beads. 9. Transfer beads to a centrifuge tube and proceed to reverse transcription. 3.6.2 Alternative Method: Bead Removal with Inserts

1. Alternatively, you can remove beads using 3D-printed inserts. 2. Aspirate hybridization buffer and replace with 5 mL of wash buffer. 3. Fill a Falcon tube with 45 mL of wash buffer and label with sample name. 4. Remove membrane and place array into the Falcon tube with wash buffer. 5. Ensure that the array is angled within the tube as shown below. 6. Place the insert so the array is secured angled as shown in the image below. 7. Secure the lid and seal with parafilm, if necessary (see Note 37). 8. Put the sealed conical in a centrifuge, making certain the PDMS surface of the array is facing away from the rotor arm (see Fig. 10). 9. Centrifuge at 2000  g for 5 min to remove the beads.

Fig. 10 Make sure the array faces outward so that the beads will fall out of wells during centrifugation

Seq-Well: A Picowell Platform for Single-Cell RNA-Sequencing

123

10. At this point you should see a small, but visible, pellet of beads at the bottom of the tube. 11. Aspirate 5–10 mL of wash buffer to enable easier removal of the array. 12. Remove the array and carefully position it over the top of the 50 mL tube. 13. Repeatedly wash any remaining beads from the surface of the array over the surface of the 50 mL falcon tube using 1 mL of wash buffer remaining in the tube. 14. Spin again at 2000  g for 5 min to pellet beads. 15. Aspirate all wash buffer except for ~1 mL. Be careful not to disturb the pellet of beads. 16. Transfer beads to a 1.5 mL centrifuge tube and proceed to reverse transcription. 3.7 Reverse Transcription

1. Prepare the following Maxima RT Mastermix during the hybridization step (volumes provided are good for one array): 40 μL H2O. 40 μL Maxima 5 RT buffer. 80 μL 30% PEG 8000. 20 μL 10 mM dNTPs. 5 μL RNase inhibitor. 5 μL 100 μM Template Switch Oligo. 10 μL Maxima H-RT. 2. Centrifuge the 1.5 centrifuge tubes with beads for 1 min at 1000  g. 3. Remove supernatant and resuspend in 250 μL of 1 Maxima RT Buffer (see Note 38). 4. Centrifuge beads for 1 min at 1000  g. 5. Aspirate 1 Maxima RT buffer and resuspend beads in 200 μL of the maxima RT mastermix. 6. Incubate at room temperature for 30 min with end-over-end rotation. 7. After 30 min, incubate at 52  C for 90 min with end-over-end rotation (see Note 39). 8. Following the RT reaction, wash beads once with 0.5 mL TE-TW, once with 0.5 mL TE-SDS, and twice with 0.5 mL of TE-TW (see Notes 40 and 41).

3.8 Exonuclease I Treatment

1. Prepare the following Exonuclease I Mix: 20 μL 10 ExoI buffer. 170 μL H2O.

124

Toby P. Aicher et al.

10 μL ExoI enzyme. 2. Centrifuge beads for 1 min at 1000  g and aspirate the TE-TW solution. 3. Resuspend in 0.5 mL of 10 mM Tris–HCl pH 8.0. 4. Centrifuge beads again, remove supernatant and resuspend beads in 200 μL of Exonuclease I mix. 5. Place in a 37  C incubator for 50 min with end-over-end rotation. 6. Wash the beads once with 0.5 mL of TE-SDS, then twice with 0.5 mL TE-TW (see Note 42). 3.9 WholeTranscriptome Amplification (WTA)

1. Wash beads once with 500 μL of water, pellet beads, remove supernatant and resuspend in 500 μL of water. 2. Mix well (do not vortex) to evenly resuspend beads and transfer 20 μL of beads to a separate 1.5 mL tube to count the beads (see Note 43). 3. Pellet the small aliquot of beads, aspirate the supernatant, and resuspend in 20 μL of bead counting solution (10% PEG, 2.5 M NaCl) (see Note 44). 4. Count the beads using a hemocytometer (see Note 45). 5. Prepare the following PCR Mastermix (volumes provided are good for 2000 beads) (see Note 46): 25 μL 2 KAPA HiFi Hotstart Readymix. 24.6 μL H2O. 0.4 μL 100 μM SMART PCR Primer. 6. Pellet beads, remove supernatant, and resuspend in 50 μL of PCR Mastermix for every 2000 beads (see Note 47). 7. Pipet 50 μL of PCR Mastermix with beads into a 96-well plate, making sure to PCR the entire array (see Note 48). 8. Use the following cycling conditions to perform wholetranscriptome amplification (see Note 49). 95  C 

3 min

4 Cycles

98 C 65  C 72  C

20 s 45 s 3 min

9–12 Cycles

98  C 67  C 72  C

20 s 20 s 3 min

Final extension

72  C 4 C

5 min infinite hold

Seq-Well: A Picowell Platform for Single-Cell RNA-Sequencing

125

1. Pool PCR products in a 1.5 mL microcentrifuge tube so that you have 7–8 PCR reactions per 1.5 mL microcentrifuge tube.

3.10 Purification of PCR Products

2. Purify the product by mixing thoroughly using Ampure SPRI beads at a 0.6 volumetric ratio (beads:PCR products (see Note 50). 3. Let the tubes sit in the rack off the magnet for 5 min, then place the rack on the magnet for 5 min. 4. Perform two washes with 80% ethanol. 5. After second wash, allow the beads to dry for 10 min on the magnet, then remove the rack from the magnetic, elute the beads in 100 μL, then place the rack back on the magnet and transfer the 100 μL to a new 1.5 mL microcentrifuge tube. 6. SPRI the 100 μL at 0.8 volumetric ratio, repeating steps 6–8. 7. After the second wash, allow the beads to dry for 5–10 min on the magnet, remove the rack from the magnetic, elute the beads in 15 μL, then place the rack back on the magnet and transfer the 15 μL to a new 1.5 mL microcentrifuge tube. 8. Run a High Sensitivity DNA D5000 ScreenTape on an Agilent 4200 Tapestation to determine the length distribution of your cDNA. The distribution should be fairly smooth with an average bp size of 900–1500 bp (see Fig. 11). 9. Proceed to library preparation or store the WTA product at 4  C. 1. Make certain that your thermocyclers are set up for Tagmentation (step 5) and PCR (step 9).

3.11 Nextera Library Preparation

Lo

pe

94

Up

5

we

r

r

2. For each sample, combine 800 pg of purified cDNA with water in a total volume of 5 μL. It is ideal to dilute your PCR product in a separate tube/plate so that you can add 5 μL of that for tagmentation.

Sample Intensity [Normalized FU]

1000

800

600

400

200

10000

5000

3500

2500

1500

1000

600

400

250

100

15

0

Size [bp]

Fig. 11 An ideal WTA product distribution has a peak at 900–1100 bp and has a long tail reaching 5000 bp

126

Toby P. Aicher et al.

3. To each tube, add 10 μL of Nextera TD buffer, then 5 μL of ATM buffer (the total volume of the reaction is now 20 μL). 4. Mix by pipetting ~5 times. Spin down. 5. Incubate at 55  C for 5 min. 6. Let the thermocycler cool to 4  C after incubation, and then immediately add 5 μL of Neutralization Buffer. Mix by pipetting ~5 times. Spin down for 1 min at 1000  g. Bubbles are normal. 7. Incubate at room temperature for 5 min. 8. Add to each PCR in the following order: 15 μL Nextera PCR mix. 8 μL H2O. 1 μL 10 μM New-P5-SMART PCR hybrid oligo. 1 μL 10 μM Nextera N700X oligo. 9. After sealing the reaction tubes and spinning them down (1 min at 1000  g), run the following PCR program: 95  C 

30 s

12 Cycles

95 C 55  C 72  C

10 s 30 s 30 s

Final extension

72  C 4 C

5 min Infinite hold

10. Proceed to SPRI purification or store the WTA product at 4  C. 11. SPRI at 0.6 volumetric ratio. 12. Let the tubes sit in the rack off the magnet for 5 min, then place the rack on the magnet for 5 min. 13. Perform two washes with 80% ethanol. 14. After the second wash, allow the beads to dry for 5–10 min on the magnet, remove the rack from the magnetic, elute the beads in 100 μL, then place the rack back on the magnet and transfer the 100 μL to a new 1.5 mL microcentrifuge tube. 15. Spri 100 μL at 0.8 volumetric ratio and repeat steps b and c. 16. After the second wash, allow the beads to dry for 5–10 min on the magnet, remove the rack from the magnetic, elute the beads in 15 μL, then place the rack back on the magnet and transfer the 15 μL to a new 1.5 mL microcentrifuge tube. 17. Run a High Sensitivity DNA D1000 ScreenTape on an Agilent 4200 Tapestation. Your tagmented library should be fairly smooth, with an average bp size of 600–750 bp (see Note 51 and Fig. 12).

127

Up pe r

64 7

Lo we r

Seq-Well: A Picowell Platform for Single-Cell RNA-Sequencing

900 Sample Intensity [Normalized FU]

800 700 600 500 400 300 200 100 10000

5000

3500

2500

1500

1000

600

400

250

100

15

0

Size [bp]

Fig. 12 An ideal NTA product distribution is a smooth bell curve with a peak between 600 and 750 bp 3.12 NextSeq500 Sequencing

1. Make a 5 μL library pool at 4 nM as input for denaturation. 2. To this 5 μL library, add 5 μL of 0.2 N NaOH (make this solution fresh from a 2 M NaOH stock). 3. Flick to mix, then spin down and let tube sit for 5 min at room temperature. 4. After 5 min, add 5 μL of 0.2 M Tris–HCl pH 7.5. 5. Add 985 μL of HT1 Buffer to make a 1 mL, 20 pM library (solution 1). 6. In a new tube (solution 2), add 165 μL of solution 1 and dilute to 1.5 mL with HT1 buffer to make a 2.2 pM solution—this is the recommended loading concentration. 7. Add 6 μL of Custom Read 1 primer to 1.994 mL of HT1 buffer to make 2 mL of 0.3 μM Custom Read 1 primer. 8. Follow Illumina’s guide for loading a NextSeq500 kit. Seq-Well requires paired-end sequencing with a read structure of 20 bp read one, 50 bp read two, and 8 bp index one.

4

Notes 1. You will want ~25 mL of bead loading buffer for each array. It is important that you do not add the sodium carbonate directly to the BSA to avoid denaturing the BSA. This solution should be prepared fresh just before loading beads. The stock of BSA should be filtered prior to use with a 0.22 μm filter and should be kept at 4  C. 2. It will take some time for the guanidine thiocyanate to dissolve. Be sure that this is prepared in advance.

128

Toby P. Aicher et al.

3. Prelysis buffer is photosensitive so wrap the buffer’s container with aluminum foil. Wrapped prelysis buffer can be stored at room temperature and has a shelf life of approximately 6 months. 4. Complete lysis buffer should be prepared immediately prior to use. 5. You will want 10 mL of hybridization buffer and 50 mL of wash buffer per array. Both solutions can be made in advance and stored at room temperature for 3 months. 6. We purchase membranes from Sterlitech Corporation. 7. We purchase the mRNA capture beads from Chemgenes (Cat. No. MACOSKO-2011-10). Currently, this is the only supplier manufacturing these beads. 8. You can transport arrays by placing them in 50 mL conical tubes filled with array quenching buffer or the aspartic acid solution. Two arrays will fit per conical if they are arranged back to back with their glass slides touching. 9. An alternative transportation method is to dry the arrays and transport them in a glass slide box. To dry the arrays, remove them from the storage buffer, use a paper towel to wick off excess liquid from the glass slide (while being careful not to touch the surface of the array), and then let them sit until air dried. Rehydrate the arrays by placing them in a four-well dish with either array quenching buffer or the aspartic acid solution. Place them under vacuum until there are no air bubbles remaining in the wells of the array. Alternatively, if a vacuum chamber is not available you can let the arrays soak overnight; they will be hydrated and ready to use the following day. 10. Use array quenching storage buffer for short-term storage for up to 1 month. If storing longer than 1 month, it is advisable to store in aspartic acid solution. 11. Prepare one extra membrane in case of a mistake during membrane application. 12. If your plasma oven has multiple shelves, place membranes on the bottom shelf to reduce the risk of them flying when vacuum is released and atmospheric pressure is restored. 13. The plasma should be a bright pink color. If not, adjust the air valve to increase or decrease the amount of oxygen you are letting into the chamber. Also check to see if vacuum has formed by gently pulling on the door of the plasma oven. 14. If membranes have slightly folded over, slowly flip the membrane back using sharp tweezers. If membranes have blown off the slide entirely, repeat membrane preparation procedure to ensure you know which side was exposed to plasma.

Seq-Well: A Picowell Platform for Single-Cell RNA-Sequencing

129

15. If transporting solvated membranes (e.g., between buildings), remove all but ~1 mL of PBS to prevent membranes from flipping within the dish. Alternatively, membranes can be solvated in 1 PBS, dried out, and stored for one week at room temperature. When ready to use membranes, they can be rehydrated with 1 PBS. This is helpful when traveling with membranes or when you want to run Seq-Well in a laboratory without access to a plasma cleaner. 16. Before bead loading, use a microscope to inspect wells for air bubbles. If air bubbles are present, place array(s) under vacuum with rotation (50 RPM) for 10 min to remove air bubbles in wells. The house vacuum in most laboratories should be sufficient to remove any air bubbles from the wells. 17. Never vortex beads, as this can fragment them and interfere with bead loading and transcript capture. 18. Place a black background behind the four-well dish to better visualize bead coverage of the array. 19. Be careful not to let the surface of the array dry. Sudden movements or tilting at too steep an angle can lead to spillage. If BLB falls off the surface of the array into the four-well dish, gently pipet the BLB back onto the corners of the PDMS surface of the array, being careful not to pipet directly onto wells. 20. It can be helpful to repeatedly (every ~30 s) rest the four-well dish level to allow beads to fall into wells. After tilting forward and backward for 10 min, tilt the four-well dish in whichever direction is needed to cover poorly loaded areas with beads. 21. You can save the excess beads by pipetting the liquid into a 50 mL conical instead of aspirating it. After collecting excess beads, wash them twice by spinning down at 1000 rcf and resuspending the pellet in TE-TW. Store the washed beads in TE-TW for future loading. 22. An alternative bead removal method is to add 3 mL of BLB and rock at ~30 angles six times to get beads to roll off the surface. Repeat this procedure three times. 23. You can also load cells in DMEM with 5% FBS or PBS with 0.05% BSA. 24. Washing with PBS is critical to ensure successful membrane attachment as FBS can interfere with membrane sealing. 25. Make sure the lid of the four-well dish is dry. Position the array in the corner of the lid so the array does not slide as you apply the membrane. 26. Occasionally, the membrane will fold back on the other side of the glass slide. Readjust the membrane until there is an

130

Toby P. Aicher et al.

overhang. An alternative method to prevent this is to first invert the glass slide and then pull the membrane past the edge of the glass slide. 27. For optimal results, use little to no pressure while applying the membrane with the left hand. See Instructional Video (www. shaleklab.com/seq-well) for additional details. Attempts to manually seal the microwell device using pressure result in a “squeegee” effect, effectively removing moisture from the membrane while fixing membrane creases in place. 28. It is very important to avoid a rumpled membrane. If the membrane is creased, dip an edge of a glass slide in liquid and smooth over areas. However, there is a limited amount of remediation that is possible prior to decreasing the efficacy of sealing, so ideally create the smoothest membrane possible on the first pass. 29. This time is flexible and depends on the incubator. If you want to decrease this incubation time, please optimize on cell lines before proceeding with precious samples. 30. Sometimes the array will be stuck to the top piece of the clamp—this is fine, just carefully slide it off. 31. To make complete lysis buffer, combine 5 mL of prelysis with 25 μL of 10% sarkosyl and 50 μL β-mercaptoethanol. 32. The hybridization buffer may contain trace amounts of guanidine thiocyanate and therefore should be collected in the lysis buffer waste container. 33. Label the 50 mL conical tubes with sample names to avoid mixing up samples after removing beads from the array(s). 34. Make sure to pipet on the entire surface of the array, including the edges and corners. 35. Sometimes after scrapping empty wells will fill up with bubbles. Be careful not to mistake bubbles for beads when inspecting underneath a microscope. 36. You should see a small, but visible, pellet of beads at the bottom of the tube. 37. The array might move around at this point. This is not a problem. 38. Prepare 1 maxima by diluting 5 maxima buffer in RNAse free H2O. 39. You can also let RT continue overnight at 52  C and wash the beads the next day. 40. Salts in the RT buffer can cause SDS to precipitate, making it difficult to remove in subsequent washes, so it is best to begin with a single wash in TE-TW.

Seq-Well: A Picowell Platform for Single-Cell RNA-Sequencing

131

41. This is a stopping point; after the final TE-TW wash, beads can be resuspended in TE-TW and stored for up to 2 weeks at 4  C. 42. This is another stopping point; after the final TE-TW wash, beads can be resuspended in TE-TW and stored for up to 2 weeks at 4  C. 43. Do not vortex beads as this can result in bead fragmentation. 44. The bead counting solution aids in even dispersion of beads across a hemocytometer. 45. Sometimes the beads will not evenly disperse, making it difficult to count them. If this is the case, assume there are 60,000 beads for the following steps. 46. For instance, if you have 60,000 beads from an array, prepare a PCR mastermix with 750 μL of 2 KAPA HiFi Hotstart Readymix, 738 μL of H2O, and 12 μL of 100 μM SMART PCR Primer. 47. For instance, if you have 60,000 beads resuspend in 1500 μL of PCR mastermix. 48. Periodically resuspend the beads to make sure they are evenly dispersed in the solution. 49. The total number of PCR cycles necessary for amplification depends on the cell type used. Approximately 16 cycles are optimal for primary cells (e.g., PBMCs) and approximately 13 cycles are optimal for cell lines or larger cells (e.g., macrophages). For experiments on dissociated human tissue, start with 16 cycles and optimize from there. 50. For instance, if you have 400 μL of product add 240 μL of SPRI beads and mix for a 0.6 volumetric SPRI. 51. We have successfully sequenced NTA product with average bp sizes from 350 to 800 bp.

Acknowledgments R.G. was supported by the Intramural Research Program of the Division of Intramural Research Z01AI000947, NIAID, NIH; the UCLA-Caltech MSTP, and the NIGMS T32 GM008042. A.K.S. was supported by the Searle Scholars Program, the Beckman Young Investigator Program, the Pew-Stewart Scholars, a Sloan Fellowship in Chemistry, NIH grants 1DP2OD020839, 2U19AI 089992, 1U54CA217377, P01AI039671, 5U24AI118672, 2RM1HG006193, 1R33CA202820, 2R01HL095791, 1R01AI 138546, 1R01HL126554, 1R01DA046277, 2R01HL095791, and Bill and Melinda Gates Foundation grants OPP1139972, OPP1137006, and OPP1116944. J.C.L. was supported by NIH grants DP3DK09768101, P01AI045757, R21AI106025, and

132

Toby P. Aicher et al.

R56AI104274, the W.M. Keck Foundation, Camille Dreyfus Teacher-Scholar program, and the US Army Research Office through the Institute for Soldier Nanotechnologies, under contract number W911NF-13-D-0001. This work was also supported in part by the Koch Institute Support (core) NIH Grant P30-CA14051 from the National Cancer Institute. References 1. Kolodziejczyk AA, Lo¨nnberg T (2018) Global and targeted approaches to single-cell transcriptome characterization. Brief Funct Genomics 17:209–219. https://doi.org/10.1093/ bfgp/elx025 2. Svensson V, Vento-Tormo R, Teichmann SA (2018) Exponential scaling of single-cell RNA-seq in the past decade. Nat Protoc 13:599–604. https://doi.org/10.1038/ nprot.2017.149 3. Kolodziejczyk AA, Kim JK, Svensson V et al (2015) The technology and biology of singlecell RNA sequencing. Mol Cell 58:610–620. https://doi.org/10.1016/j.molcel.2015.04. 005 4. Ziegenhain C, Vieth B, Parekh S et al (2017) Comparative analysis of single-cell RNA sequencing methods. Mol Cell 65:631–643. e4. https://doi.org/10.1016/j.molcel.2017. 01.023 5. Tang F, Barbacioru C, Wang Y et al (2009) mRNA-Seq whole-transcriptome analysis of a single cell. Nat Methods 6:377–382. https:// doi.org/10.1038/nmeth.1315 6. Macaulay IC, Svensson V, Labalette C et al (2016) Single-cell RNA-sequencing reveals a continuous spectrum of differentiation in hematopoietic cells. Cell Rep 14:966–977. https://doi.org/10.1016/j.celrep.2015.12. 082 7. Shalek AK, Satija R, Adiconis X et al (2013) Single-cell transcriptomics reveals bimodality

in expression and splicing in immune cells. Nature 498:236–240. https://doi.org/10. 1038/nature12172 8. Klein AM, Mazutis L, Akartuna I et al (2015) Droplet barcoding for single-cell transcriptomics applied to embryonic stem cells. Cell 161:1187–1201. https://doi.org/10.1016/j. cell.2015.04.044 9. Macosko EZ, Basu A, Satija R et al (2015) Highly parallel genome-wide expression profiling of individual cells using nanoliter droplets. Cell 161:1202–1214. https://doi.org/ 10.1016/j.cell.2015.05.002 10. Zheng GXY, Terry JM, Belgrader P et al (2017) Massively parallel digital transcriptional profiling of single cells. Nat Commun 8:14049. https://doi.org/10.1038/ ncomms14049 11. Gierahn TM, Ii MHW, Hughes TK et al (2017) Seq-Well: portable, low-cost RNA sequencing of single cells at high throughput. Nat Methods 14:395–398. https://doi.org/10.1038/ nmeth.4179 12. Bose S, Wan Z, Carr A et al (2015) Scalable microfluidics for single-cell RNA printing and sequencing. Genome Biol 16:120. https://doi. org/10.1186/s13059-015-0684-3 13. Kivioja T, V€ah€arautio A, Karlsson K et al (2012) Counting absolute numbers of molecules using unique molecular identifiers. Nat Methods 9:72–74. https://doi.org/10.1038/ nmeth.1778

Chapter 9 Single-Cell Tagged Reverse Transcription (STRT-Seq) Kedar Nath Natarajan Abstract Single-cell RNA sequencing (scRNA-seq) has become an established approach to profile entire transcriptomes of individual cells from different cell types, tissues, species, and organisms. Single-cell tagged reverse transcription sequencing (STRT-seq) is one of the early single-cell methods which utilize 50 tag counting of transcripts. STRT-seq performed on microfluidics Fluidigm C1 platform (STRT-C1) is a flexible scRNAseq approach that allows for accurate, sensitive and importantly molecular counting of transcripts at singlecell level. Herein, I describe the STRT-C1 method and the steps involved in capturing 96 cells across C1 microfluidics chip, cDNA synthesis, and preparing single-cell libraries for Illumina short-read sequencing. Key words STRT-C1, scRNA-seq, 50 Tag counting, UMIs, Single-cell tagged reverse transcription, Fluidigm C1, Microfluidics

1

Introduction Single-cell RNA sequencing (scRNA-seq) is a powerful and unbiased approach for quantifying the transcriptome of individual cells and has transformed our understanding of development and disease mechanism [1]. scRNA-seq approaches has been applied to identify and distinguish subpopulation structures across different cell types including pluripotent stem cell (PSCs), immune cells (Reviewed in [1, 2]) and for all cell types in human body [3, 4]. Single-cell tagged reverse transcription sequencing (STRT or STRT-seq) is one of the early multiplexed approaches for single-cell RNA-sequencing and has been developed to be performed either in 96/384-well plates or using Fluidigm C1 microfluidics system [5, 6]. STRT-seq has further been improved including a recently published dual-index method compatible with nuclear RNA-seq on microwell platform [7, 8]. The initial step in STRT-seq isolation/capture and lysis either in tubes. Subsequently, the first-strand is synthesized using

Electronic supplementary material: The online version of this chapter (https://doi.org/10.1007/978-1-49399240-9_9) contains supplementary material, which is available to authorized users. Valentina Proserpio (ed.), Single Cell Methods: Sequencing and Proteomics, Methods in Molecular Biology, vol. 1979, https://doi.org/10.1007/978-1-4939-9240-9_9, © Springer Science+Business Media, LLC, part of Springer Nature 2019

133

134

Kedar Nath Natarajan

biotinylated Oligo-dT primer and the reverse transcriptase adds 3–6 cytosines to the 30 end. Subsequently, using a helper template switching oligonucleotide (TSO), the reverse transcriptase switches the template, continues the helper oligonucleotide synthesis, and introduces a barcode into cDNA. This barcoded cDNA is purified, PCR-amplified, immobilized on biotin beads followed by fragmentation, adapter ligation, library amplification, and sequencing using two sets of primers. The STRT-seq protocol has been improved to incorporate individual molecular counting using unique molecular identifiers (UMI) and adapted to be performed on the Fluidigm C1 platform [5, 7–9]. Herein, I describe the 50 tag counting STRT-seq protocol on 96 single mouse PSCs performed on microfluidics Fluidigm C1 platform (STRT-C1) [6]. The STRT-C1 has several advantages over older STRT-seq protocol and other tag counting scRNA-seq methods. Firstly, STRT-C1 is performed on microfluidics chip that enables accurate, sensitive, and efficient reactions in nanoliter volumes. Secondly, the introduction of UMIs allows for precise counting of unique transcripts and separate from PCR duplicates. Thirdly, the protocol allows flexibility to use in-house Tn5 transposase for tagmentation and different single-cell barcoding indices. Lastly, since the TSO and Oligo-dT have biotin tags, the pooled library can be purified by streptavidin beads and further enriched for 50 UMI transcripts by depleting PvuI restriction site containing 30 fragments. Among the disadvantages of STRT-C1 are costs associated with microfluidics instrument and chips, access to in-house Tn5 transposase, identification and quantification of 50 tags alone, and hands-on-time. The limiting step is access to microfluidics device; however, after generating cDNA, multiple libraries can be performed in parallel over 2–3 days.

2

Materials Across any scRNA-seq method, four key aspects are to be kept in mind. Firstly, individual cells have very limited starting material (RNA) and can vary in cell sizes. Secondly, the individual singlecell samples should be diligently handled to avoid RNA degradation and/or contamination. Thirdly, reference controls should be added to distinguish true biology differences from technical variation; lastly, the scRNA-seq reagents and equipment are expensive, and experiments should be carefully planned and managed. The C1 IFC accommodates cell sizes spanning from 5 to 25 μm (see Note 1), while the synthetic RNA spike-in controls provide a means to distinguish technical variation and noise (see Note 2). It is essential that dedicated pre-PCR areas or UV workstations should be used for making mastermixes and priming microfluidics C1-chip. Post-PCR areas or UV workstations should be used for

STRT-Seq on C1

135

subsequent steps involving either lysed cells or cDNA (see Note 3). Prepare and keep all reagents and mastermixes on ice throughout the protocol, unless specifically highlighted. All solutions are prepared using ultrapure nuclease-free water. 2.1 C1 Auto Prep System and Reagents

1. C1 Reagent kit for mRNA-seq consisting of two modules. Module 1 (4  C) containing cell suspension reagent, blocking reagent, Cell wash buffer and Module 2 (20  C) containing harvest buffer, DNA dilution reagent, and preloading and loading reagent. 2. C1 microfluidics chips (IFC: integrated fluidic circuits) based on average cell size. Either small (5–10 μm) or medium (10–17 μm) or large (17–25 μm) (see Note 1). 3. C1 Autoprep system.

2.2 RNA Spike-In Controls

1. RNA spike-in controls: These are several control RNA transcripts of known sequence, quantity, and concentrations. The spike-ins can be of synthetic origin, such as ArrayControl, ERCCs (External RNA control consortium), SIRVs (Spike-in variant control mixes) or sequencing spike-ins (Sequins), or RNA from a different organism than tested (plant RNA, microbial RNA etc.,) (see Note 2).

2.3 Custom Oligonucleotides

1. Oligo-dT sequence: Custom Oligo-dT sequence with a spacer sequence and 50 biotin tag. The Oligo-dT should be diluted in sterile ultrapure nuclease-free water. C1-P1-T31: 50 -Biotin-AATGATACGGCGACCACCGATCG TT30-30 . 2. Template switching oligonucleotide (TSO): Custom TSO of RNA nucleotides having a 50 biotin tag. The TSO should be diluted in sterile ultrapure nuclease-free water. C1-P1-TSO: 50 -Biotin-AAUGAUACGGCGACCACCGU NNNNNNGGG-30 . 3. Custom PCR handle sequence: Custom PCR DNA oligo primer with biotin tag. The PCR handle should also be diluted in sterile ultrapure nuclease-free water. C1-P1-PCR: 50 -Biotin-GAATGATACGGCGACCACCGAT-30 . 4. Custom oligonucleotides for single-cell barcoding and library preparation. STRT-Tn5-U: 50 -Phosphate-CTGTCTCTTATACACATCTG ACGC-30 . Ninety-six different single-cell barcodes (see Supplementary Table 1).

136

Kedar Nath Natarajan

2.4 Cell Culture and Laboratory Equipment

1. Pre-PCR and post-PCR hoods (see Note 3). 2. Cell counter. 3. Resuspension and washing buffer: Sterile 1 Dulbecco’s phosphate-buffered saline (PBS) without calcium or magnesium is used for cell culture including as washing buffer and for final resuspension of single-cell solution. 4. Single-channel (P2, P10, P20, P200, and P1000) and multichannel pipettes (P20 and P200). 5. Sterile ultrapure nuclease-free water. 6. Sterile PCR grade water. 7. RNase inhibitor (40 U/μL). 8. Magnesium chloride (1000 mM). 9. Betaine (5 M). 10. Triton X-100 (0.2%). 11. dNTPs (20 mM). 12. DTT (20 mM). 13. 5 first strand buffer (5). 14. Reverse transcriptase (200 U/μL). 15. 10 Advantage 2 PCR buffer (10). 16. 50 dNTP mix (20 mM). 17. 50 Advantage 2 Polymerase mix (50). 18. 96-well plates. 19. 96-well plate seals. 20. Fragment analyzer or Bioanalyzer station. 21. High sensitivity DNA kit reagents. 22. Bright-field microscope with 4 and 20 objectives. 23. RNAZap. 24. Ethanol.

2.5 Library Preparation

1. 2 TAPS buffer (pH 8.5): 10 mM TAPS, 50 mM MgCl2 in total 100 mL water. Set pH to 8.5. 2. 2 BWT buffer: 10 mM Tris–HCl (pH 7.5), 1 mM EDTA, 2 M NaCl, 0.02% Tween 20 in total 100 mL water. 3. TNT buffer: 20 mM Tris–HCl (pH 7.5), 50 mM NaCl, 0.02% Tween 20 in total 100 mL water. 4. Custom Tn5-tranposase. 5. 96-well plate containing oligonucleotide barcodes (list in Supplementary Table 1).

STRT-Seq on C1

137

6. Magnetic rack. 7. Plate/tube shaker with temperature control. 8. Streptavidin Dynabeads. 9. PCR purification kit. 10. Restriction enzyme (PvuI-HF) and CutSmart buffer. 11. Agencourt AMPure XP beads. 12. KAPA Illumina library quantification kit.

3

Methods Prepare and keep all reagents and mastermixes on ice throughout the protocol, unless specifically highlighted. Nuclease-free fresh filter tips and tubes should be used for all the steps. All solutions are prepared using ultrapure nuclease-free water. Extra care should be given for all steps before and during the “mRNA Seq: RT & Amp” step including addition of RNase inhibitors, since RNA is more susceptible to degradation. Dedicated pre-PCR areas should be used for making mastermixes/reagents and post-PCR areas for processing single-cell cDNA samples, sequencing indices, libraries, etc. to avoid contamination. UV sterilization step should be carried out for PCR workstations, followed by complete cleaning using RNAZap and 80% ethanol.

3.1 Preparing Reagents, Mastermixes and Setting Up the System

1. Allow the frozen (20  C) reagents: C1 preloading reagent, harvest reagent, loading reagent to thaw on ice for 15–20 min. Keep also the blocking reagent (4  C) on ice. Also keep the 80  C RNA-spikes on dry ice. 2. RNA-spike mixes and aliquots: The RNA spikes should be thawed quickly and vortexed, and several dilutions (~1:10 and 1:100 dilutions) should be made using C1 loading reagent (see Note 3). 3. Serial dilutions of 1:10 and 1:100 RNA-spikes should be further made, vortexed, and spun down, and 5 μL aliquots should be stored at 80  C for single experimental use (see Note 2). 4. Thaw the frozen (20  C) reagents: RNase inhibitor, 30 SMART CDS Primer IIA, SMARTer dilution buffer, 5 first strand buffer, DTT, dNTP mix, PCR grade water, 10 Advantage 2 PCR buffer, 50 dNTP mix, IS PCR primer, 50 Advantage 2 PCR polymerase Mix, on ice for 15–20 min. 5. Make Lysis pre-mastermix (see Note 4).

138

Kedar Nath Natarajan

Reagent

Stock concentration

Triton X-100

1%

30

0.15%

dNTP mix

20 mM

35

3.5 mM

DTT

100 mM

35

17.5mμM

C1-P1-T31

20 μM

40

4 μM

C1 loading reagent

100%

10

5%

30

–

Volume, μL

Nuclease-free water – Total volume

Final concentration

180

6. Make Lysis mastermix (see Note 5).

Reagent

Stock concentration

RNase inhibitor

40 U/μL

Lysis pre-mastermix ~1.6 RNA spike-ins

Volume, μL 1 18

–

1

Total volume

Final concentration 2 U/μL 1.5 –

20

7. Make reverse transcription (RT) pre-mastermix (see Note 6).

Reagent

Stock concentration

5 First-strand buffer 5

Volume, μL

Final concentration

116

1.75

MgCl2

1000 mM

3.5

10.5 mM

Betaine

5M

96

1.45 M

C1 loading reagent

20

12

3.6

Total volume

227.5

8. Make RT mastermix (see Note 7).

Reagent

Stock concentration

Volume, μL

Final concentration

RNase inhibitor

40 U/μL

1.3

1 U/μL

Reverse Transcriptase 200 U/μL

3

11.42 U/μL

RT pre-mastermix

2.5

22.5

1.1

C1-P1-TSO

40 μM

3

2.3 μM

Total volume

30

STRT-Seq on C1

139

9. Make PCR pre-mastermix (see Note 8).

Reagent

Stock Final concentration Volume, μL concentration

C1-P1-PCR

12 μM

30

480 nM

10 Advantage 2 PCR buffer

10

75

1

50 dNTP mix

20 mM

15

400 μM

PCR-grade water

490

C1 loading reagent

20

35

1.1

20 EvaGreen dye (optional)

20

3.2

0.1

Total volume

645

10. Make PCR mastermix (see Notes 9 and 10).

Reagent

Stock Final concentration Volume, μL concentration

50 Advantage 2 PCR polymerase mix

50

3

2.2

Reverse Transcriptase

1.173

64.5

1.12

Total volume

67.5

11. Store all mastermixes and reagents on ice or at 4  C (see Note 11). 3.2

Priming C1 IFC

1. Open a new vacuum packed C1 IFC of appropriate size (see Note 1) and make sure that seals and strips on IFC are not tampered. 2. Add 200 μL C1 harvest reagent into each of the 40 chambers, 20 μL C1 harvest reagent into four chambers, 20 μL C1 preloading reagent into a single chamber, 20 μL cell wash buffer into two chambers, and 15 μL C1 blocking reagents into two chambers (as marked in Fig. 1) (see Note 12). 3. Switch on the C1 system (see Note 13). 4. Peel the tape from the bottom of C1 IFC and place into C1 system and run the mRNA seq: Prime script. This step takes ~10 min (see Note 14). 5. During priming, prepare the single-cell suspension from tissues, primary cells or cells from culture. Dissociated single cell suspension should be suspended in relevant sterile media or sterile PBS or buffer and passed through appropriate size cell

140

Kedar Nath Natarajan A1

200 µL Harvest reagent 20 µL Harvest reagent 20 µL Preloading reagent 15 µL Blocking reagent 20 µL CellWash buffer

Fig. 1 The final C1 IFC configuration with the highlighted wells that should be filled with specific reagents and volumes prior to running the priming step

strainers (30, 40, 70, or 100 μm) to get rid of debris, clumps, and large particles. 6. Preparing cell mix: Cells should optimally be loaded at a concentration between 166,000 and 250,000 cells/mL, to enable ~600 cells to be loaded on C1 IFC (see Notes 15 and 16). Starting with the appropriate cell concentration is quite critical and it is advised to use multiple methods to count cells (see Note 17). Prepare the final cell suspension mix by adding cells (166–250 cells/μL) with C1 suspension reagent (see Note 18). Reagent

Concentration

Final volume, μL

Single-cell suspension.

166–250 cells/μL

60

Suspension reagent

–

40

Total volume

100

7. Remove the primed C1 IFC from the C1 Autoprep system into pre-PCR area, remove the flow-through C1 blocking reagent from inlet and outlet chambers (~15 μL; as marked in Fig. 2). Cells can also be optionally stained during the cell load step (see Notes 19 and 20). 8. Typically, live–dead staining is performed using ethidium homodimer that stains membranes of dead cells and with Calcein for live cells. (Note: Other dyes can be used, which do not interfere with DNA or RNA activity.) 3.3 Loading Cells in C1 IFC

1. Mix the cell mix well and add up to 20 μL of cell mix to C1 IFC (as marked in Fig. 2) (see Note 21). 2. Place the C1 IFC with cells into C1 system and run the mRNA seq: Cell Load script. This step takes ~10–30 min (see Notes 20 and 22).

STRT-Seq on C1

141

A1

20 µL LIVE/DEAD stain 5 µL Cell mix (upto 20 µL) Remove Blocking buffer

Fig. 2 After priming, the blocking reagent from C1 IFC should be removed before adding the add cell mix and optional staining solutions, and running the cell load step A1

180 µL Harvest reagent 9 µL Lysis mastermix 9 µL RT mastermix 24 µL PCR mastermix

Fig. 3 The final C1 IFC configuration with the highlighted wells filled with specified lysis, RT, and PCR reagents before the running the mRNA seq: RT & Amp script

3. During the cell load, the remaining reagents can be optionally tested as tube controls using purified RNA or whole cells (see Note 16). 4. Single-cell capture, imaging C1 IFC, and annotating cell chambers: After cell load, each of the 96 single-cell capture sites should be critically assessed under bright-field microscope (as marked in Fig. 2). Each single-cell capture site should be checked for single-cell, empty, debris, doublet or multiple cells, and should be carefully annotated (see Notes 15, 23, and 24). 3.4 Running Cell Lysis, RT, and PCR Within C1 System

1. After single-cell capture site annotation, add 180 μL of harvest reagent into the four large inlets, 9 μL of lysis mastermix, 9 μL of RT mastermix, and 24 μL each of PCR mastermix into two inlets (as marked in Fig. 3).

142

Kedar Nath Natarajan

2. Place the C1 IFC with cells into C1 system and run the mRNA seq: RT & Amp script. This step takes ~8.5 h but can be programmed and extended up to ~25 h for the researcher’s convenience (see Note 25). 3. Lysis program. Temperature,  C

Duration, min

72

3

4

10

25

1

4. Reverse transcription program. Temperature,  C

Duration, min

42

90

70

10

5. PCR. Step

Temperature,  C Duration Number of cycles

Initial denaturation 95

1 min

1

Denaturation Annealing Extension

95 58 68

20 s 4 min 6 min

5

Denaturation Annealing Extension

95 64 68

20 s 30 s 6 min

9

Denaturation Annealing Extension

95 64 68

30 s 30 s 7 min

7

Final extension

72

10 min

1

6. Harvesting amplified products: Thaw the C1 dilution reagent ~20–30 min at room temperature and transfer a new 96-well plate to clean post-PCR area and mark as “Diluted harvest cDNA.” 7. Add 10 μL of C1 dilution reagent to each well of “diluted harvest cDNA” plate (see Note 26). 8. Transfer the C1 IFC to post-PCR area once the mRNA seq: RT & Amp script gets completed. Carefully remove the white strip tapes from the C1 IFC to reveal the harvesting outlets (see Notes 27–29).

STRT-Seq on C1

143

A1

. . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . .

Harvest well

Fig. 4 The C1 IFC harvests single-cell cDNA from different cell chambers into the collection wells (grey well). Each column contains 16 harvest wells and spaced alternatively to fit an eight-channel multipipette 1

2

3

4

5

6

7

8

9

10 11

A

3

2

1

49 50

B

9

8

7

55 56 57 12 11

12

51 6

5

4

52 53 54

10 58 59 60

C 15 14 13

61 62 63 18 17 16 64 65 66

D 21 20 19

67 68 69 24 23 22 70 71 72

E 25 26 27

75 74 73 28 29 30 78 77 76

F 31 32 33

81 80 79 34 35 36 84 83 82

G 37 38 39

87 86 85

H 43 44 45

93 92 91 46 47 48 96 95 94

40

41 42 90 89 88

Fig. 5 The final configuration of single-cell cDNA from different cell chambers is collected across 96-well plate. The cell numbers on 96-well plate correspond to cell capture sites (same as imaging) on C1 IFC

9. Using an eight-channel pipette, transfer the single-cell cDNA from C1 IFC to the “diluted harvest cDNA” plate (as marked in Fig. 4) (see Notes 30–32). The “diluted harvest cDNA” plate can be stored at 20  C. The final layout of single cells is marked in Fig. 5. 10. The cDNA concentration from either a representative single cell or all single cells should be measured using either Bioanalyzer/Fragment analyzer or Picogreen. Typically, we observe

144

Kedar Nath Natarajan

between 1 and 20 ng/μL concentration depending on cell type. 11. Dilute the single-cell cDNA concentration to 1 ng/μL final concentration. 3.5 Library Preparation

1. Follow steps 1–3 to make the 10x transposome stock mix. Using a multichannel pipette, transfer 5 μL of each oligonucleotide barcode from the 96-well containing oligonucleotide barcodes (Supplementary Table 1) into a new 96-well plate (“Tn5 barcode plate”). 2. Add 5 μL of STRT-Tn5-U oligonucleotide to each well of the “Tn5 barcode plate,” briefly vortex and spin. Anneal the oligonucleotides by placing the 96-well Tn5 barcode plate in the PCR machine and run program (95  C for 2 min, ramp down to 25  C over 25 min). This plate can be stored at 20  C for long-term storage, or immediately used for next step. 3. In a new 96-well plate, transfer 1 μL each from “Tn5 barcode plate” using a multichannel pipette. Add 3.5 μL of Tn5 transposase to each well and incubate at room temperature (or 37  C) for 60 min (see Note 33). This plate is 10x transposome stock. 4. Follow steps 5–9 to prepare “Tagmentation mastermix”. Reagent

Volume Final Volume (per well), μL concentration. (100 wells), μL

Nuclease-free water 7.5

–

750

100% DMF

2

–

200

2 TAPS buffer

2

–

200

Total volume

11.5

1150

5. Add 11.5 μL of tagmentation mastermix to each well of a new 96-well plate (tagmentation plate). 6. Transfer 2.5 μL of 10 transposome stock mix to each well to tagmentation plate. 7. Add 6 μL of harvested single-cell cDNA to tagmentation plate. 8. Each well of the tagmentation plate should have 20 μL final volume containing a 6 μL of unique harvested single-cell cDNA, 2.5 μL unique 10 transposome barcode and 11.5 μL of tagment mastermix. Mix and spin the plate. Place the harvested single-cell cDNA plate back at 20  C. 9. Perform tagmentation reaction in PCR block at 55  C for 5 min followed by cooling to 4  C (see Note 34). 10. To bind Streptavidin beads to tagmented cDNA, prepare streptavidin dynabeads: Take 120 μL of Streptavidin dynabeads and

STRT-Seq on C1

145

wash twice in 2 BWT buffer. Finally resuspend in 3 mL 2 BWT buffer. 11. Add 20 μL streptavidin dynabeads to each well of the cooled tagmented plate. Incubate at room temperature for 10 min. The plate can also be left on plate shaker at 37  C and ~500–800 rpm shaking. 12. Pool all the samples from each well of 96-well plate into a single tube (see Note 35). Bind beads to the magnet and remove supernatant. This step pools all single-cell cDNA libraries into a single-tube. 13. Wash the beads in 100 μL of TNT buffer, followed by 100 μL of Qiaquick PB buffer and further 3 washes in 100 μL TNT buffer. During washing, do not remove the pooled single-cell library tube from magnet (see Notes 36 and 37). This step immobilizes the cDNA fragments on beads. 14. To remove 30 fragments, following last wash, resuspend the beads in 100 μL of below restriction mix to remove all beads bound 30 fragments. Incubate at 37  C for 60 min on shaker at interval mix (30 s at ~106  g; 2 min pause) to avoid beads clumping. Reagent

Stock Volume, Final concentration μL concentration

CutSmart buffer

10

PvuI-HF restriction enzyme

20 U/μL

Nuclease-free water Total volume

10 2

1 0.4 U/μL

88 100

15. Wash the beads thrice with 100 μL TNT buffer after restriction digestion (see Note 38). Let beads air-dry for 3–5 min and resuspend in 30 μL nuclease-free water. Incubate at 70  C for 10 min at constant mixing (850 rpm) to release the 50 fragments from beads. 16. Bind beads to magnet and carefully collect the eluate (supernatant) containing pooled single-cell libraries. 17. Follow steps 18–24 to perform cleanup of cDNA libraries and final library elution. 18. To the 30 μL of eluate library, add 54 μL (1.8 volume) AMPure XP beads. 19. Mix well and incubate at room temperature for 10 min. 20. Bind beads to magnet for 1 min and discard supernatant containing unbound fragments.

146

Kedar Nath Natarajan

21. Wash beads with fresh 70% ethanol for 30 s, wait for 1 min and remove the supernatant (see Notes 36 and 37). 22. Dry the beads at room temperature for 2–5 min (see Note 39). 23. Resuspend beads in 30 μL nuclease-free water and incubate for 10 min at room temperature. 24. Bind beads to magnet for 1 min and collect supernatant containing purified single-cell cDNA library. The final library should be quantified and stored at 20  C. 25. Follow steps 26–29 to quantify cDNA library and estimate fragment length. 26. Dilute the final single-cell cDNA library into 1:100 and 1:1000 dilutions. For 1:100 dilution, add 198 μL nuclease-free water to 2 μL cDNA library. For 1:1000, add 18 μL nuclease-free water to 2 μL of 1:100 dilution library. 27. Quantify cDNA concentration using KAPA library quantification with standard controls. Follow the below table for preparing mastermixes. Add 18 μL of mastermix to 2 μL of 1:100 and 2 μL of 1:1000 diluted cDNA libraries respectively. Stock concentration

Volume, Final μL concentration

KAPA SYBR FAST mastermix

10

12

STRT-Tn5-U primer

100 μM

2

10 μM

C1-P1-PCR primer

100 μM

2

10 μM

Reagent

Nuclease-free water

1

2

Total volume

18

28. Run below qPCR program. Initial denaturation

95  C 

Denaturation Annealing/extension

95 C 60  C

Hold

10  C

5 min 30 s 45 s

For 30 cycles

29. In parallel, the same PCR reaction should be also run for 11 cycles should be run using 2 μL of undiluted pooled library. This amplified product can be run on fragment analyzer/bioanalyzer for quantification, fragment length, and size distribution. The expected final library concentration should be ~300–1200 pM. 30. The final libraries can be sequenced across on Illumina platform using a pair of C1-P1-PCR as Read1 primer and STRTTn5-U as index read primer (Fig. 6).

STRT-Seq on C1

147

Step 1. Annealing biotinylated oligo-dT (C1-P1-T31) to polyA mRNA 5’--XXXXXXXXXXXXXXAAAAn

5’--AAUGAUACGGCGACCACCGAUNNNNNNGGGXXXXXXXXXXXXXXAAAAnCGATCGGTGGTCGCCGTATCATT TTACTATGCCGCTGGTGGCTANNNNNNCCCXXXXXXXXXXXXXXTTTT27GCTAGCCACCAGCGGCATAGTAA--5’

3’-CTTACTATGCCGCTGGTGGCTANNNNNNCCCXX..XXGACAGAGAATATGTGTAGACTGCGXXXXXXXXAGCATACGGCAGAAGACGAAC-5’

5’-AATGATACGGCGACCACCGATNNNNNNGGGXX..XXCTGTCTCTTATACACATCTGACGCXXXXXXXXTCGTATGCCGTCTTCTGCTTG TTACTATGCCGCTGGTGGCTANNNNNNCCCXX..XXGACAGAGAATATGTGTAGACTGCGXXXXXXXXAGCATACGGCAGAAGACGAAC-5’ TTACTATGCCGCTGGTGGCTA> Read 1 sequencing primer

Fig. 6 Complete overview and chemistry of the different steps during STRT-C1 experiment

148

4

Kedar Nath Natarajan

Notes 1. The C1 microfluidics IFCs can capture either small (5–10 μm) or medium (10–17 μm) or large (17–25 μm) cells. For cells between 8 and 11 μm, it is preferable to use the smaller IFC as single cells are better trapped in the capture site. 2. While a wide variety of spike-in types can be utilized (ERCCs, SIRVs, Sequins, Plant RNAs etc.), the abundances and concentration of each RNA-spikes should be known for classifying technical variation. To avoid RNA spike-in degradation, spikes should be carefully handled in RNase-free areas and resuspended in solutions containing RNase inhibitors. Once spikes as thawed, they should be diluted, aliquoted, and frozen for single use. Spikes-ins must not be subjected to repeated freeze–thaw cycles as this leads significant RNA degradation [10]. 3. Dedicated pre-PCR and post-PCR UV-workstations areas should be set up for scRNA-seq experiments to avoid nucleic acid and nuclease contamination. The workstations should be sterilized with short wavelength UV for 10–30 min before and after use. In addition, the spaces should be wiped with low-percentage bleach and 70% ethanol to remove traces of RNase and DNases. Apart from being a good laboratory practice, the use of workstations also help reduce other human sources of contaminants from saliva, skin, hair, etc. 4. The Lysis pre-mastermix is enough for ten Lysis mastermixes and should be transferred to single-use aliquots and stored at 20  C. The Lysis pre-mastermix aliquots are stable for several months. The premixes should be thawed on ice and carefully handled in areas that are cleaned for RNAses. 5. The Lysis mastermix is enough for two C1 IFCs (9 μL per IFC). It is not advisable to scale down the reagents as both spike-ins and RNase inhibitors volumes reduce below 1 μL and cannot be accurately pipetted. RNase inhibitor should be first added to lysis pre-mastermix and then diluted spike-ins of required concentration. The Lysis mastermix should be kept at 4  C at all times. 6. The RT pre-mastermix is also enough for ten RT mastermixes, and should be transferred to single-use aliquots and stored at 20  C. The RT pre-mastermix aliquots are stable for several months and should be thawed on ice. Care should be taken that both MgCl2 and C1 loading reagents are fully thawed. 7. The RT mastermix is also enough for two C1 IFCs (9 μL per IFC). The Reverse Transcriptase enzyme should be added at the end. It is important that C1-P1-TSO primer is fully thawed. The RT mastermix should be kept at 4  C at all times.

STRT-Seq on C1

149

8. The PCR pre-mastermix is also enough for ten PCR mastermixes. All the reagents and mastermix should be thawed and kept on ice throughout. 9. The PCR mastermix is only enough for a single C1 run. 10. The 50 Advantage 2 PCR reagent and reverse transcriptase (80  C) should be kept on dry ice and thawed just before adding to mastermix. 11. It is essential to keep the Lysis, RT, and PCR mastermixes on ice throughout. 12. Before priming step, the harvest reagent is generally added in excess across multiple wells with the C1 IFC. During the priming step, the harvest reagent flows through the chip to remove clogs, debris, etc. 13. It is important to switch on the C1 Autoprep system ~20–30 min before starting the reagent preparation. The C1 Autoprep system performs a set of calibration and checks, including temperature control, pressure, and vacuum control. 14. Independent of the C1 IFC size, the priming step takes ~10 min. The chips can stay within the Autoprep system for up to 1 h postpriming. 15. The range of cells to be loaded on the C1 IFCs is between 166 and 250 cells/μL. Loading fewer cells will lead to several empty capture sites, while overloading typically leads to multicell chambers (doublet, 3-cell, 4-cell), clumps, and debris. 16. Remaining pool of cells (bulk) or purified RNA from bulk cells after cell load step on C1 IFC can be used for optional tube controls and bulk RNA-seq: (a) Dilute RNA from bulk cells (20–50 ng/μL) or prepare cell mix (100–200 cells/μL). (b) Prepare positive control and no-template negative control tubes for lysis on new PCR strips, and place on thermal cycler for lysis step (same thermal cycler steps as for C1). (c) Add RT mastermix to lysis products in PCR strips and run RT program on thermal cycler (same thermal cycler steps as for C1). (d) Add PCR mastermix to each tube within PCR strip and run PCR amplification step (same thermal cycler steps as for C1). (e) After PCR, move the strips to post-PCR area and dilute the amplified product, that is, 1 μL cDNA + 45 μL C1 DNA dilution reagent. (f) Follow the quantification (step 33) and library preparation steps as with single cells (step 35 onward).

150

Kedar Nath Natarajan

17. It is essential that multiple cell counting methods are used for determining the number of cells due to the inherent biases in counting methods. Different labs may use either commercial systems or traditional hemocytometer, but cross-validation should be performed either with a live–dead stain or nuclear staining. 18. The ratio 166–250 cells/μL typically works for most spherical cell types. However, for cells with unusual morphology, size, or volume, it would be better to optimize the dilution and capture on C1 IFC. 19. The cell load step of the mRNA-seq program is different between small C1 IFC and medium as well as large C1 IFC. It takes ~15 min for loading cells onto a small C1 IFC, while it takes ~30 min for medium and large C1 IFC. The cell load step can be usually combined with staining of live–dead marker or fluorescent protein expression within cells. 20. It is advisable to survey the C1 IFC cell capture sites after priming and before cell load step, for any clogs, debris, and/or blockage. 21. The maximum volume of diluted cell mix (Cells + Suspension reagent) that can be loaded to C1 IFC is 20 μL, while the minimum volume is 5 μL. The actual volume that is loaded into the C1 IFC is ~5 μL. 22. Care should be taken that cells are properly mixed prior to adding to C1 IFC. The primed C1 IFC should not be left beyond 1 h on the C1 Autoprep system. 23. The individual cell positions are marked on the top left of capture chamber within C1 IFC. These should be used to annotate well numbers and whether single, multiplet, or empty of debris is captured. If live–dead staining is performed during the cell loading step in the C1 IFC or cells express fluorescent markers, it is advised to have a semiautomated or automated fluorescent microscope. The specific grids and positions of wells for automated microscopy can be obtained online from C1 Autoprep system website. 24. The C1 IFC after cell load step should be quickly imaged as cells are still live within the cell capture sites. The staining/ imaging time should be minimized to further reduce stress on live cells. 25. The key advantage of the C1 Autoprep system is that harvesting time for cDNA from C1 IFCs can be programmed to suit the needs of researcher. Typically, the C1 run is performed on day 1 (afternoon/evening) and harvest is scheduled for next day (day 2 a.m.), to allow cDNA quantification and library preparation on the same day.

STRT-Seq on C1

151

26. When performing repeat pipetting steps across 96-well plates and with critical, expensive reagents, we prefer electronic repeater pipettes that sensitively and accurately dispense liquid. Care should be taken with repeater pipettes that tips should not touch the plate or individual wells. Dispensing the reagents to side or middle of the well at low speed is advised to avoid liquid spilling and cross-contamination. 27. Once the C1 IFC is removed from the Autoprep system, care should be taken that white strips covering the harvest wells are still stuck. 28. Typically, if the white strips covering the harvest wells are undone or loose, there is some cDNA evaporation from individual wells. It is advised to carefully measure the quantity of harvested cDNA from different wells and annotate the volume difference. 29. The white strips covering harvest reagents can be removed easily using the strip clipper along with C1 IFC. If strip clipper is not available, a nuclease-free unused pipette tip can be used to wedge the harvest strips. 30. The layout of collection wells (harvested cDNA) is distinctly different to the capture sites. The C1 IFC contains 16 rows and 8 columns (128 wells), where the first and the last collections columns are empty and should be ignored. 31. The cDNA is harvested using eight-channel pipette that fits alternative collecting wells within C1 IFC. Care should be taken that pipette tips do not touch other collection wells within C1 IFCs. 32. The individual cell layout in the collected 96-well plate should be updated to correspond to cells within C1 IFC. 33. For each batch of Tn5 transposase generated, the binding of mosaic sequences and tagmentation should be titrated. Typically, serial dilution of oligonucleotides for same cDNA concentration is performed with different Tn5 transposase concentration. 34. The Tn5 concentration and tagmentation efficiency is critical for each Tn5 batch. Excess Tn5 or cDNA or tagmentation time can lead to over tagmentation and extremely small fragments, or under-tagmentation resulting in large fragments. 35. The pooled cDNA libraries should be collected in 1.5/2 mL low-bind tubes to help with cleanup and elution of magnetic beads. 36. During bead immobilization and cleanup steps, care should be taken to not remove the tube containing beads from the magnetic rack. The beads on the magnetic rack usually form a tight

152

Kedar Nath Natarajan

blob/spot and the remaining liquid should be taken off from the other side of tube, without removing from magnetic rack. 37. Care should be taken that no residual liquid is present on the lid of 1.5/2 mL tubes. It is advisable to do a short spin before binding of beads to magnetic rack. 38. Any residual liquid after washing steps should be carefully removed using both P200 and P20 pipettes. Beads can be quickly spun and then placed on magnetic rack for 1–2 min, before removing excess liquid. 39. Before final elution, it is important to make sure beads are dried to remove traces of 70% ethanol. A good visual check is appearance of small cracks in between spot/blob of beads, which typically happens between 3 and 10 min. Care should be taken not to over dry the beads, since this affects their resuspension in elution buffer. References 1. Natarajan KN, Teichmann SA, Kolodziejczyk AA (2017) Single cell transcriptomics of pluripotent stem cells: reprogramming and differentiation. Curr Opin Genet Dev 46:66–76. https://doi.org/10.1016/j.gde.2017.06.003 2. Papalexi E, Satija R (2018) Single-cell RNA sequencing to explore immune cell heterogeneity. Nat Rev Immunol 18(1):35–45. https:// doi.org/10.1038/nri.2017.76 3. Regev A, Teichmann SA, Lander ES, Amit I, Benoist C, Birney E, Bodenmiller B, Campbell P, Carninci P, Clatworthy M, Clevers H, Deplancke B, Dunham I, Eberwine J, Eils R, Enard W, Farmer A, Fugger L, Gottgens B, Hacohen N, Haniffa M, Hemberg M, Kim S, Klenerman P, Kriegstein A, Lein E, Linnarsson S, Lundberg E, Lundeberg J, Majumder P, Marioni JC, Merad M, Mhlanga M, Nawijn M, Netea M, Nolan G, Pe’er D, Phillipakis A, Ponting CP, Quake S, Reik W, Rozenblatt-Rosen O, Sanes J, Satija R, Schumacher TN, Shalek A, Shapiro E, Sharma P, Shin JW, Stegle O, Stratton M, Stubbington MJT, Theis FJ, Uhlen M, van Oudenaarden A, Wagner A, Watt F, Weissman J, Wold B, Xavier R, Yosef N, Human Cell Atlas Meeting P (2017) The Human Cell Atlas. Elife 6. doi:https://doi. org/10.7554/eLife.27041 4. Rozenblatt-Rosen O, Stubbington MJT, Regev A, Teichmann SA (2017) The Human Cell Atlas: from vision to reality. Nature 550 (7677):451–453. https://doi.org/10.1038/ 550451a

5. Islam S, Kjallquist U, Moliner A, Zajac P, Fan JB, Lonnerberg P, Linnarsson S (2012) Highly multiplexed and strand-specific single-cell RNA 50 end sequencing. Nat Protoc 7 (5):813–828. https://doi.org/10.1038/ nprot.2012.022 6. Pollen AA, Nowakowski TJ, Shuga J, Wang X, Leyrat AA, Lui JH, Li N, Szpankowski L, Fowler B, Chen P, Ramalingam N, Sun G, Thu M, Norris M, Lebofsky R, Toppani D, Kemp DW 2nd, Wong M, Clerkson B, Jones BN, Wu S, Knutsson L, Alvarado B, Wang J, Weaver LS, May AP, Jones RC, Unger MA, Kriegstein AR, West JA (2014) Low-coverage single-cell mRNA sequencing reveals cellular heterogeneity and activated signaling pathways in developing cerebral cortex. Nat Biotechnol 32(10):1053–1058. https://doi.org/10. 1038/nbt.2967 7. Hochgerner H, Lonnerberg P, Hodge R, Mikes J, Heskol A, Hubschle H, Lin P, Picelli S, La Manno G, Ratz M, Dunne J, Husain S, Lein E, Srinivasan M, Zeisel A, Linnarsson S (2017) STRT-seq-2i: dual-index 50 single cell and nucleus RNA-seq on an addressable microwell array. Sci Rep 7(1):16327. https://doi.org/10.1038/s41598-01716546-4 8. Islam S, Kjallquist U, Moliner A, Zajac P, Fan JB, Lonnerberg P, Linnarsson S (2011) Characterization of the single-cell transcriptional landscape by highly multiplex RNA-seq. Genome Res 21(7):1160–1167. https://doi. org/10.1101/gr.110882.110

STRT-Seq on C1 9. Zeisel A, Munoz-Manchado AB, Codeluppi S, Lonnerberg P, La Manno G, Jureus A, Marques S, Munguba H, He L, Betsholtz C, Rolny C, Castelo-Branco G, Hjerling-Leffler J, Linnarsson S (2015) Brain structure. Cell types in the mouse cortex and hippocampus revealed by single-cell RNA-seq. Science 347 (6226):1138–1142. https://doi.org/10. 1126/science.aaa1934

153

10. Svensson V, Natarajan KN, Ly LH, Miragaia RJ, Labalette C, Macaulay IC, Cvejic A, Teichmann SA (2017) Power analysis of single-cell RNA-sequencing experiments. Nat Methods 14(4):381–387. https://doi.org/10.1038/ nmeth.4220

Chapter 10 Single-Cell RNA-Sequencing of Peripheral Blood Mononuclear Cells with ddSEQ Shaheen Khan and Kelly A. Kaihara Abstract Peripheral blood mononuclear cells (PBMCs) are blood cells that are a critical part of the immune system used to fight off infection. However, due to the complexity of PBMCs, which contain multiple different cell types, studying the function of the individual cell types can be difficult, and often studies rely on bulk measurements. Here, we describe the analysis of PBMCs using single-cell RNA-sequencing in droplets. Data from these studies allow for the identification and quantification of the subpopulation of cells that make up the PBMC sample. In addition, differential gene expression between cell types and samples can be assessed. Key words Single-cell, RNA-sequencing, ddSEQ, PBMC, CD14 monocytes

1

Introduction The immune system is complex, and its function involves interplay of a variety of cells, tissues, and secreted molecules such as cytokines and chemokines. It plays a crucial role in recognition and removal of foreign or “nonself” material, pathogens, cancer cells, and graft transplantations [1–4]. Failure of the immune system to recognize tissue or cells as “self” can lead to autoimmune diseases and, on the other hand, defects in immune system ability to fight foreign invaders results in immune deficiency and susceptibility to infections. Failure in regulating immune system responses results in myriad of inflammatory diseases. Harnessing the power of the immune system to fight against cancer, such as immune checkpoint therapy, has been successful against a variety of cancer types. To delineate the mechanisms that drive immune function in both health and disease states, researchers often perform gene expression studies on immune cells isolated from peripheral blood, including PBMCs, which include lymphocytes (B- and T-cells), dendritic cells, macrophages, and NK-cells [5]. RNA- Sequencing (RNA-Seq) provides an accurate method with which to measure gene expression of the

Valentina Proserpio (ed.), Single Cell Methods: Sequencing and Proteomics, Methods in Molecular Biology, vol. 1979, https://doi.org/10.1007/978-1-4939-9240-9_10, © Springer Science+Business Media, LLC, part of Springer Nature 2019

155

156

Shaheen Khan and Kelly A. Kaihara

whole transcriptome without prior knowledge of the genes expressed. However, traditional RNA-Seq is performed on cells processed in bulk, which averages gene expression and conceals the underlying heterogeneity [6]. Single-cell RNA-Seq of PBMCs can provide in-depth assessment of gene expression of individual immune cell types that can reveal novel immune cell populations, identify pathogenic subsets of immune cells and transcriptional modules driving the pathogenesis, and identify biomarkers of efficacy and response to therapy [7]. Furthermore, single-cell RNA-Seq of PBMCs would be a key assay in analyzing a longitudinal sample in a large cohort of human patients since it is more readily available than tumor or tissue biopsies. PBMCs can be further enriched for rare subsets of immune cells, such as dendritic cells and monocytes, by selection protocols or cell sorting to gain detailed analysis of the transcriptome. The Illumina® Bio-Rad Single-Cell Sequencing Solution combines Bio-Rad’s innovative Droplet Digital PCR (ddPCR) technology with Illumina next generation sequencing (NGS) library preparation, sequencing, and analysis (Fig. 1). This solution provides a comprehensive, userfriendly workflow for single-cell RNA-Seq that enables controlled experiments with multiple samples, treatment conditions, and time points. Built and supported in collaboration between technology leaders, the Illumina Bio-Rad Single-Cell Sequencing Solution enables transcriptome analysis of hundreds to thousands of single cells across a wide range of cell sizes in a single experiment. The simple push-button analysis for alignment, cell decoding, and library quality control (QC) in the SureCell™ RNA Single-Cell App in the BaseSpace™ Sequence Hub is combined with data reduction and population identification tools using the Seurat package for RStudio Software. Here, we demonstrate the highquality single-cell RNA-Seq data achieved with the Illumina

Fig. 1 Illumina Bio-Rad single-cell sequencing workflow. PBMCs are isolated and prepared into a single-cell suspension. Cell and barcode mixes are loaded onto the ddSEQ single-cell isolator and droplets are generated. First strand synthesis occurs in the droplets. Droplets are disrupted, and second strand cDNA synthesis is carried out in bulk. Illumina library preparation is carried out with the Nextera transposase followed by PCR and sequencing on the Illumina NextSeq Sequencer using the 500/550 high output 150 cycle kit. FASTQ files are then processed using the Illumina BaseSpace SureCell Single-Cell App. The data are then processed using RStudio Software and the “Seurat” package

Single-Cell RNA-Sequencing of PBMCs with ddSEQ

157

Bio-Rad Single-Cell Sequencing Solution with fresh and frozen PBMCs from healthy human donors. We also performed singlecell RNA-Seq on positively selected monocytes isolated from the same human donor PBMCs. This technology can be utilized in basic, translational, and clinical studies to gain deeper insight into the role and function of the immune system across normal and diseased states.

2

Materials

2.1 Single-Cell Preparation of PBMCs (Fresh/Frozen)

1. BD Vacutainer CPT cell preparation tube with sodium citrate. 2. RPMI-1640 Media. 3. Heat-inactivated fetal bovine serum (FBS)/fetal calf serum (FCS). 4. Freezing media (90% FBS/FCS + 10% DMSO). 5. Standard cell freezing container. 6. 2-Propanol. 7. Cryotube vials, 1 ml. 8. Sterile pipettes (10 and 5 ml). 9. Heated water bath (37
C). 10. Pipettes and tips. 11. 50 ml polypropylene centrifuge tubes. 12. 15 ml polypropylene centrifuge tubes. 13. PBS (phosphate buffered saline, pH 7.4) 1 without calcium and magnesium. 14. Bovine serum albumin (BSA): 20 mg/ml. 15. 30–40 μm cell strainer. 16. Benchtop centrifuge for 15 and 50 ml conical tubes and microcentrifuge. 17. Centrifuge capable of up to 1800 RCF with swinging bucket. 18. RBC lysis Buffer. 19. PBS + 0.1% BSA. 20. Cell counter. 21. Cell counting slides. 22. 0.4% trypan blue dye solution. 23. Vortexer. 24. DNase- and RNase-free 1.5 ml tubes.

2.2 CD14 Positive Monocyte Isolation

1. EasySep Human CD14 Positive Selection Kit (Stemcell Technologies). 2. The Big Easy EasySep Magnet (Stemcell Technologies).

158

Shaheen Khan and Kelly A. Kaihara

3. PBS + 2% FBS + 1 mM EDTA (e.g., Stemcell Technologies EasySep Buffer). 4. 5 ml (12  75 mm) polystyrene round-bottom tube. 5. 30–40 μm cell filters. 2.3 SureCell WTA 30 Library Prep

1. ddSEQ single-cell isolator (Bio-Rad). 2. SureCell WTA 30 Library Prep Kit for the ddSEQ System (Illumina). 3. Deep well thermal cycler. 4. Magnetic peg stand (Thermo Fisher). 5. DynaMag 96 side magnet (Thermo Fisher) or the DynaMag 96 side skirted magnet (Thermo Fisher). 6. Microplate centrifuge. 7. Pipettes and tips (Rainin) (see Note 1). 8. 96-well cooling block. 9. Bio-Rad ddPCR plate (Bio-Rad) (see Note 7). 10. PCR tubes 8-tube strip, clear. 11. Optical flat 8-cap strips. 12. 1.5 ml DNAse/RNAse free tubes. 13. Multichannel pipette reservoir. 14. Nuclease-free water. 15. 2100 Bioanalyzer (Agilent Technology). 16. 2100 Bioanalyzer Technology).

high

sensitivity

DNA

kit

(Agilent

2.4 Sequencing on an Illumina Sequencer

1. NextSeq™ 500/550 High Output Kit 150 cycles (Illumina).

2.5 Bioinformatic Analysis

1. RStudio software.

3

2. PhiX Control v3 (Optional) (Illumina).

Methods This section describes the process for isolation of PBMCs from blood collected using standard venipuncture into blue-top BD Vacutainer CPT Tubes. In addition, it describes the PBMC cell preparation method used for freshly isolated PBMCs and previously frozen PBMCs. The method has been developed and tested with the Illumina Bio-Rad SureCell WTA 30 Library Prep for PBMC Demonstrated Protocol and the ddSEQ single-cell isolator (see Note 2). Samples were sequenced on an Illumina NextSeq

Single-Cell RNA-Sequencing of PBMCs with ddSEQ

159

Sequencer and processed through Illumina’s BaseSpace SureCell RNA Single-Cell App. Tertiary analysis was conducted using RStudio Software and the R package “Seurat” developed by the Satija lab [8]. In the first experiment, we performed single-cell RNA-Seq using fresh PBMCs isolated from a healthy donor. CD14 monocytes were isolated from this same donor using a positive selection protocol and compared to the total PBMC population. Principal component analysis (PCA) was used for data analysis. In experiment 2, fresh and frozen PBMCs were compared from the same healthy donor and data were analyzed using canonical correlation analysis (CCA) [7]. 3.1 Single-Cell Preparation of PBMCs (Fresh/Frozen) 3.1.1 PBMC Cell Preparation from BD Vacutainer CPT Tube for Single-Cell RNASequencing

1. Remix blood sample immediately prior to centrifugation by gently inverting the tube 8–10 times. 2. Centrifuge CPT tube(s) at 1800 RCF (approximately 2800 rpm on a Sorvall RT6000 centrifuge) for 20 min at 20
C without break. 3. After centrifugation, bring the CPT tube(s) to a biological safety hood and carefully open the tops. After centrifugation, mononuclear cells and platelets will be in a whitish layer just under the plasma layer. Aspirate approximately half of the plasma without disturbing the cell layer. Collect the cell layer with a Pasteur pipette and transfer to a 15 ml conical centrifuge tube with a cap. Collection of cells immediately following centrifugation will yield best results. 4. Add PBS to bring the volume to 15 ml. Cap the tube and mix the cells by inverting the tube five times. Centrifuge for 15 min at 120  g. Aspirate as much supernatant as possible without disturbing the pellet. 5. Resuspend the cell pellet by gently vortexing or tapping tube with your index finger. Add PBS to bring the volume to 10 ml. Cap the tube and mix the cells by inverting the tube five five times. Centrifuge for 10 min at 450  g. Aspirate as much supernatant as possible without disturbing the pellet. Resuspend the cells in cold 1 PBS with 0.1% BSA if used immediately for single-cell capture. 6. Filter the cells through the 30 μm strainer. Keep the cells on ice and proceed to counting. 7. In order to freeze PBMCs for later use, resuspend the pellet in the freezing medium and gently mix the cells. Immediately dispense aliquots into cryovials, place the cryovials into a freezing container (site standard cell freezing container or Nalgene Mr. Frosty), and place the container into a 80
C freezer. The following day, cryovials in the freezing container can be moved to standard 80
C storage (or transferred to liquid nitrogen if available) until further use.

160

Shaheen Khan and Kelly A. Kaihara

3.1.2 PBMC Cell Preparation Using Ficoll for Single-Cell RNA-Seq

1. Invert the blood sample 8–10 times and add twice the volume of 1 PBS + 2% FBS. 2. Add Ficoll to the SepMate tube by carefully pipetting it through the central hole of the SepMate insert. 3. Mix the diluted blood sample from step 1 gently. Keeping the SepMate tube vertical, add the diluted sample by pipetting it down the side of the tube. 4. Centrifuge at 1200  g for 20 min at room temperature, with the brake on. 5. Immediately pour off the top layer that contains the PBMCs into a new 50 ml conical tube. 6. Wash two times with PBS + 2% FBS. If the pellet appears red or pinkish, perform the RBS lysis step. 7. RBC lysis step: Add 5 ml of RBC lysis buffer to the pellet and gently pipet three times with a 5 ml pipette. Let it sit for 5 min. Add 10% RPMI media and spin down for 5 min. 8. Resuspend the pellet in appropriate media based on the downstream application.

3.1.3 Preparation of Frozen PBMCs for SingleCell RNA-Seq

1. Make sure the water bath is at 37
C before starting the protocol. 2. Prepare 1 PBS with 0.1% BSA (1 mg/ml) for the final resuspension. 3. Remove a single cryovial of frozen mixed cells and place it in a 37
C water bath to thaw (should not take more than 1–3 min; do not leave it in the water bath for longer than 3 min). Remove the tube from the water bath as soon as it has thawed. 4. Pipet-mix the cells and transfer the entire volume to a 1.5 ml Eppendorf tube. Add 500 μl of 10% RPMI and centrifuge the cells at 450  g for 5 min. 5. Carefully remove the supernatant without disturbing the pellet. Add 1 ml of cold 1 PBS with 0.1% BSA to the tube and gently pipet-mix five times to slowly dislodge and resuspend the pellet. 6. Centrifuge the cells at 200 RCF for 3 min. Carefully remove the supernatant without disturbing the pellet. Perform two washes, and add 1 ml of cold 1 PBS with 0.1% BSA and gently pipet-mix 15–18 times until the cells are completely resuspended. 7. Carefully filter the cells by passing them through the 30 μm strainer to get rid of any clumps and keep them on ice.

Single-Cell RNA-Sequencing of PBMCs with ddSEQ

3.2 CD14 Positive Monocyte Isolation 3.2.1 Monocyte Cell Isolation from PBMCs for Single-Cell RNASequencing

161

In this protocol, monocytes were isolated using the CD14 positive selection kit from Stemcell Technologies. 1. Perform an RBC lysis step on the PBMCs before proceeding with monocyte isolation. 2. Resuspend the PBMCs in PBS + 2% FBS + 1 mM EDTA. Gently mix and pass the mixture through a 30 μm filter. 3. Follow CD14 positive monocyte isolation as per the manufacturer’s instructions in their entirety. 4. Resuspend positively selected monocytes in ice cold PBS with 0.1% BSA.

3.2.2 Cell Counting of Fresh PBMCs, Frozen PBMCs, and Monocytes Isolated from PBMCs for Single-Cell RNA-Seq

1. Mix the cells very gently three times using a wide-bore pipette tip. Pulse vortex the cells for 1 s for a total of three times (3 s) to mix them and then determine the cell count using the Bio-Rad TC20 Cell Counter by mixing 10 μl of the cells with 10 μl of 0.4% trypan blue. Make note of the total count, viable cell count, and viability (see Note 3). 2. The viability should be >80%. Repeat step 1 for a total of four counts. Take an average of the four viable cell counts and use that to dilute the cells to 3000 cells/μl using cold 1 PBS with 0.1% BSA. 3. Determine the final cell count and viability and make note of it. Take two readings and use the average. The final count should be within 10% of the target concentration (3000 cells/μl); if not, adjust accordingly. The final viability should be >95%. 4. Keep the cell mixture on ice until use; preferably use within 1–2 h of preparation.

3.3 SureCell WTA 30 Library Prep

Prepare reagents and follow the protocol outlined in the Illumina Bio-Rad SureCell WTA 30 library prep for PBMC demonstrated protocol (Illumina 1000000044179 v00) (see Note 2).

3.3.1 Prepare the Cell and Barcode Suspension Mixes

1. Prepare the SureCell Enzyme Mix according to Table 1 and store on ice. l

Use Rainin pipettes and tips (see Note 1).

l

Thaw and mix the reagents according to the SureCell protocol.

l

Prepare one master mix for all cartridges, leaving out the cells, which are added separately.

l

Two samples or four wells are combined in the PBMC protocol to increase the cDNA yield for downstream Nextera™ NGS library prep.

162

Shaheen Khan and Kelly A. Kaihara

Table 1 Preparation of SureCell enzyme mix

Cell enzyme mix component

Volume for one cartridge, μl (two samples)

Cell suspend buffer

60

DTT

8

RNA stabilizer

6

RT enzyme

13.2

Enhancer enzyme

12

Total

99.2

Table 2 Preparation of sure cell suspension mix Cell suspension mix component

Volume for one sample Volume for one cartridge, (two chambers) μl (two samples)

Cell enzyme mix

43

86

9

18

Cells (>2500 cells/ μl)

Table 3 Preparation of Barcode Suspension Mix

Barcode suspension mix component

Volume for one cartridge, μl (two samples)

Barcode buffer

60

0

3 Barcode mix

60

2. Prepare the SureCell Cell Suspension Mix according to Table 2 and store on ice. l

Prepare separate tubes for the number of different samples being used.

l

To load the same cell sample across multiple wells or multiple cartridges, make a master mix.

l

For accurate loading of cell number, vortex the cells for 1 s, and repeat three times before adding to the Cell Enzyme Mix.

3. Prepare the SureCell Barcode Suspension Mix according to Table 3 and store on ice. l

Before adding the 30 Barcode Mix, vortex for 1 s, repeat three times, and immediately add to the Barcode Buffer.

Single-Cell RNA-Sequencing of PBMCs with ddSEQ 3.3.2 Isolate Single Cells with Barcodes in the ddSEQ Single-Cell Isolator

163

1. Place the cartridge in the cartridge holder. 2. Place the cartridge in the cartridge holder. 3. Prime the cartridge with Priming Solution for 1 min and no longer than 3 min. 4. Vortex the Barcode Suspension Mix for 1 s, and repeat three times (see Note 4). 5. After vortexing the Barcode Suspension Mix, load 20 μl into the blue ports of the cartridge. 6. Vortex the Cell Suspension Mix for 1 s, and repeat three times (see Note 4). Add 20 μl of Cell Suspension Mix to the red ports in the cartridge, numbered 1–4. 7. Follow manufacturer’s guidance in observing proper loading of the cartridge—adding sample first and avoiding introduction of air bubbles into the chamber well (see Note 5). 8. Add 80 μl Encapsulation Oil into the eight companion oil wells. 9. Place the cartridge holder into the ddSEQ single-cell isolator and press the silver button to begin single-cell isolation. The process will take approximately 5 min. Single-cell isolation is complete when all three indicator lights are solid green. 10. Transfer the droplets from the cartridge output wells to eight wells of a 96-well ddPCR plate using an 8-channel P50 pipettor. Aspirate slowly at a ~70
angle, and dispense slowly into the ddPCR plate, along the sides of the wells (see Notes 6 and 7). 11. Repeat as needed for all cartridges. 12. Seal the wells with an 8-tube strip cap and keep the samples on the 96-well cooling block on ice.

3.3.3 ReverseTranscribe Samples

1. Load the droplet plate onto a thermal cycler and run the Reverse Transcription program in Table 4. Table 4 Reverse transcription program Step

Temperature,
C

Time

# of cycles

1

37

30 min

1

2

50

60 min

1

3

85

5 min

1

4

4

Hold

1




Choose the preheat lid option and set to 105 C Set the reaction volume to 50 μl

164

Shaheen Khan and Kelly A. Kaihara

3.3.4 Break Emulsion, Clean Up First Strand Synthesis, and Synthesize Second Strand cDNA

1. After completion of the reverse transcription protocol, break open the droplets with the droplet disruptor reagent. 2. Clean up first stand using the sample purification beads (SPB), magnetic peg stand, and DynaMag 96 side magnet (see Note 8). l Use freshly prepared 80% ethanol. l

Mix the disrupted droplets with the SPB, ensuring that, after mixing, the top layer is an entirely homogenous brown aqueous layer (see Note 9).

l

After cleanup, combine the four wells for each sample into a single well (see Note 2).

3. Prepare the Second Strand Synthesis Mix according to Table 5 and add the appropriate volumes to the samples. 4. Load the plate onto a thermal cycler and run the Second Strand Synthesis (SSS) program in Table 6. This is a safe stopping point. 3.3.5 Clean Up cDNA, Tagment cDNA, and Amplify Tagmented cDNA

1. Clean up double stranded cDNA using the SPB cleanup protocol. 2. Check cDNA on the Agilent Technology 2100 Bioanalyzer using a High Sensitivity DNA chip. l

DNA yields for PBMC samples are on average 1.85 ng.

3. Prepare the Tagmentation Mix according to Table 7 and add the appropriate volumes to the samples.

Table 5 Preparation of second strand synthesis mix

Second strand synthesis component

Volume for oneartridge, μl (two samples)

Second strand buffer (SSB)

18

Second strand enzyme (SSE)

9

Table 6 Second strand synthesis program Step

Temperature,
C

Time

# of cycles

1

16

120 min

1

2

4

Hold

1

Turn off the heated lid function Set the reaction volume to 80 μl

Single-Cell RNA-Sequencing of PBMCs with ddSEQ

165

Table 7 Preparation of tagmentation mix

Tagmentation mix component

Volume for one cartridge, μl (two samples)

Tagment buffer (TCB)

44

Tagment enzyme (TCE)

22

Table 8 Tagmentation program Step

Temperature,
C

Time

# of cycles

1

55

5 min

1

2

4

Hold

1

# of cycles




Choose the preheat lid option and set to 105 C Set the reaction volume to 40 μl

Table 9 Library amplification program Step

Temperature,
C

Time

1

95

30 s

1

2

95

10 s

15

3

60

45 s

15

4

72

60 s

15

5

72

5 min

1

6

4

Hold

1




Choose the preheat lid option and set to 105 C Set the reaction volume to 100 μl

4. Load the plate onto a thermal cycler that is preheated to 55
C and run the Tagmentation Program in Table 8. 5. Remove the plate from the thermal cycler as soon as the temperature reaches 4
C and stop the reaction by adding Tagment Stop Buffer. 6. Incubate at room temperature for five min. 7. Amplify the tagmented DNA by adding the Tagmentation PCR Mix, Tagment PCR Adapter, and DNA adapters to tag each sample with a unique i7 index. 8. Load the plate onto a thermal cycler and run the Library Amplification program in Table 9.

166

Shaheen Khan and Kelly A. Kaihara

3.3.6 Clean Up Libraries and Assess Libraries

1. Clean up the libraries using the SPB protocol according to the manufacturer’s protocol. 2. Perform two back-to-back cleanups. 3. Check libraries on the Agilent Technology 2100 Bioanalyzer using a High Sensitivity DNA chip. l

3.4 Sequencing on a NextSeq Illumina Sequencer

Library yields are on average 1.5–2.5 nM, but yields as low as 0.5 nM have been observed and successfully sequenced.

1. Before starting, thaw the reagent cartridge for 1 h in a water bath. Alternatively, thaw overnight at 4
C. 2. Leave the flow cell at room temperature for 30 min before starting a run. 3. Prepare libraries for sequencing. (a) Make fresh 0.2 N NaOH (tenfold dilution) using stock 2 N NaOH + water. 2 N NaOH is labeled HP3 Illumina reagent (see Note 10). (b) Calculate the amount of sample of each library to add to create a total pooled library of 2 nM (or the concentration of the lowest library) in a 10 μl volume. Use the results of the Bioanalyzer to balance the libraries and load equal amounts across samples. Add the required amount of Resuspension Buffer for a final volume of 10 μl of a 2 nM pooled library. Vortex and spin down. (c) Add 10 μl of 0.2 N NaOH to the library pool. Vortex and centrifuge at 280  g for 1 min. (d) Incubate for 5 min at room temperature. (e) Add 10 μl of 200 mM TRIS, pH 7. Vortex briefly and centrifuge at 280  g for 1 min. (f) Add the calculated amount of HT1 buffer to stop the reaction and dilute the library pool to 20 pM. Vortex and centrifuge at 280  g for 1 min. (g) Make 2.1 ml of Sequencing Primer at 300 nM by diluting with HT1 buffer as shown in Table 10. (h) Add the following to get a 3.0 pM library with or without a 5% PhiX spike-in as indicated in Table 11. Vortex and spin down. Table 10 Preparation of sequencing primer Volume, μl HT1 Sequencing primer

2087.4 12.6

Single-Cell RNA-Sequencing of PBMCs with ddSEQ

167

Table 11 Preparation of 3.0 pM library with or without PhiX spike-in With PhiX (5%), μl 20 pM denatured library

195

20 pM denatured PhiX HT1

3.25 1101.75

l

Without PhiX, μl 195 N/A 1105.00

Target 3 pM loading. The cluster density target is 165 k/mm2. If overclustered, reduce to 2.3–2.7 pM load.

4. Prepare the reagent cartridge for sequencing. (a) Remove the reagent cartridge from the water bath and dry the base using a Kimwipes. (b) Invert the reagent cartridge 5 gently to mix. (c) Wipe clean the foil seal covering reservoir #10 and pierce the seal with a 1 ml pipette tip. Dispense 1300 μl (total volume) of pooled library. (d) Load 2 ml of the 300 nM Sequencing Primer to reservoir #7. 5. Setup run in Illumina’s BaseSpace Sequence Hub. (a) Click the Prep tab. (b) Select Biological Samples under Manual Prep. (c) Create a new sample. Give the sample a name, select the project folder, select the species, and select RNA. (d) Select Save & Continue later. Repeat for all samples in the pool. (e) Select all samples and click prep library (Select SureCell WTA 30 ). Give the pooled library a name. (f) Drag each sample to the correct N70X index. (g) Click pool libraries. (h) Select Plan Run. (i) Select NextSeq. (j) Below are the parameters that will automatically be selected for sequencing of the SureCell libraries. l

Use Custom Primer R1.

l

Paired End.

l

Read 1 Cycles 68.

l

Read 2 Cycles 75.

l

Single Index.

168

Shaheen Khan and Kelly A. Kaihara l

Index 1 Cycles 8.

l

Index 2 Cycles 0.

6. Load the NextSeq sequencer. (a) Enter your BaseSpace user name and password. (b) Select Next. (c) Remove the used flow cell. (d) Open a new flow cell and wipe gently with a Kimwipes. Align the flow cell over the alignment pins. Select load. (e) Remove the used buffer cartridge and load a new one. (f) Empty the liquid waste from the removable reservoir and place it back into the machine. (g) Remove the used reagent cartridge and load a new one (with samples and primers loaded). (h) Select Next. Select the appropriate BaseSpace run. Wait for the automated checks and then start the run. 3.5 Bioinformatic Analysis 3.5.1 Secondary Analysis Using Illumina’s BaseSpace SureCell Single-Cell App

Once the run is complete and the FASTQ files have been generated, proceed to analysis. 1. On BaseSpace, select Apps. 2. Select the SureCell RNA Single Cell app. 3. Select the sample(s) for analysis. 4. Select the project (use the project folder created for the run). 5. Press the blue continue button. 6. Rename the analysis (or BaseSpace will name it automatically). An example of data from a technical replicate of the PBMC experiment is shown in Fig. 2. Sequencing metrics give an indication of the quality of the experiment, including the quality of the starting cellular material and the quality of the molecular biology technique employed throughout the SureCell protocol (see Note 11).

3.5.2 Export Data from BaseSpace for Downstream Analysis in RStudio Software

3.5.3 Tertiary Analysis Using RStudio Software and Seurat Tutorial by Bio-Rad

1. Select Files. 2. For each sample, open the sample folder and download the following three files: l

S1.cell.summary.csv.

l

S1.counts.abundantReadCounts.csv.

l

S1.counts.umiCounts.passingKneeFilter.table.zip.

1. Create a “Basespace_data” folder and, within this folder, create folders for each sample. Each sample folder should contain the three files exported from BaseSpace.

Single-Cell RNA-Sequencing of PBMCs with ddSEQ

169

Fig. 2 Secondary analysis metrics from Illumina’s BaseSpace SureCell RNA Single-Cell App. (a) An example of a technical replicate from the PBMC experiment. The Illumina BaseSpace SureCell Single-Cell App takes the primary data of the FASTQ files and through secondary analysis. This includes deconvoluting the cellular barcodes, determining the barcodes that are associated with cells, and aligning the reads to a reference genome of choice. Sample Information provides general information about the sequencing run for that sample. Cell Information portrays the number of cells passing knee filter for that sample, as well as critical metrics such as the number of UMIs per cell passing filter and the number of genes per cell passing filter. The Alignment Quality Information provides statistics for the alignment of the reads to the reference genome. The Abundant Sequence Information refers to reads that align to mitochondrial, ribosomal, or small nuclear or cytoplasmic RNA

170

Shaheen Khan and Kelly A. Kaihara

Fig. 2 (continued) (b) Plot of UMIs per cell for each bead barcode in descending order by genic UMI count. The steep drop in genic UMI count determines what is considered a cell passing filter (to the left of the red line) and what is considered cellular debris (to the right of the red line). (c) Knee plot of the cumulated fraction of genic transcripts assigned to cell barcodes. The inflection point (otherwise known as the knee) is used to determine the number of barcoded cells detected and indicates that a high fraction of transcripts are assigned to single cells

2. Rename the files to have the following structure: condition— condition—condition _S1. . . . For example, a condition could be an experimental treatment, an experimental replicate, a different subject, or different days. The conditions that are separated by dashes will be used in the downstream Seurat tutorial by Bio-Rad to visualize the data and calculate differential expression based on these conditions. 3. Launch RStudio Software and create a New Project using the main directory that contains the “Basespace_data” folder. 4. The Seurat tutorial by Bio-Rad is in r-markdown (.rmd) format. This allows the output of the final analysis to be in .html format for easy sharing. There are two tutorials, one for PCA analysis and the other for CCA analysis (see Note 12). 5. Within the r-markdown files, the text can be changed to whatever the user desires. The code chunks should be run sequentially, and one at a time at first, in order to customize the code for the dataset being analyzed. Parameters that need customization include: l Define experimental conditions. l

Select filtering parameters for cells (nGene, nUMI, pct. rRNA, pct.mito, pct.sncRNA, novelty, etc.) (see Note 13).

Single-Cell RNA-Sequencing of PBMCs with ddSEQ

171

l

Select variables to regress out (nUMI, pct.mito, cell-cycle phase, etc.).

l

Select the number of PCs or CCs to use.

l

Determine the perplexity of the t-SNE analysis.

l

Select the final resolution and thus the number of subpopulations in the final analysis (see Note 14).

l

Define the experimental conditions for downstream comparison by statistical analysis.

l

Indicate select markers to visualize for specific cell types.

6. Once the parameters have been defined, all R code chunks have been run, and the text has been customized, knit the object to create an .html output (Figs. 3 and 4).

4

Notes 1. Avoid low-quality pipette tips that may shed plastic particulates into the SureCell solutions and/or the ddSEQ Cartridge. This can result in shredded droplets. 2. In addition to the standard SureCell WTA 30 Library Prep Reference Guide (Illumina 1000000021452 v01), the SureCell WTA 30 PBMC Demonstrated Protocol (Illumina 1000000044179 v00), which is used here, and the SureCell WTA 30 Nuclei Demonstrated Protocol (Illumina 1000000044178 v00) are also available. Due to the low RNA content of PBMCs, two samples are combined in the PBMC Demonstrated Protocol, and the volumes for SPB cleanups and elutions are appropriately adjusted. 3. To load cells at the proper concentration of 3000 cells/μl, accurately count the cells by vortexing the cells for 1 s, three times, and then load the cell counter. Use the Live Cell Count as opposed to the Total Cell Count to make the final 3000 cells/μl dilution. 4. Just before loading the ddSEQ Cartridge, vortex the Cell and Barcode Suspension Mixes. This ensures even distribution of the cells and barcodes into the droplets. 5. To avoid getting air bubbles in the microfluidics of the cartridge, follow these tips. Use P-20 pipette tips. Gently slide the pipette tip down the side of the well until it reaches the bottom. The tip should be ~15
from the vertical. Holding the tip in this position, gently begin dispensing the sample. After dispensing half of the sample, slowly begin drawing the pipette tip up the side of the well. Expel the last of the sample. Do not push the pipette plunger past the first stop. This technique will

172

Shaheen Khan and Kelly A. Kaihara

Fig. 3 Tertiary analysis using the Seurat tutorial by Bio-Rad for PCA analysis. (a) PBMCs from a healthy patient were isolated and run through the Illumina Bio-Rad SureCell single-cell workflow. Data were exported from

Single-Cell RNA-Sequencing of PBMCs with ddSEQ

173

ensure the sample wets the bottom of the well and wicks into the microchannel for optimal droplet generation. 6. To transfer the droplets to a 96-well ddPCR plate, follow these tips. Use a P-50 pipetman with a P-200 tip and gently press the pipette tip at a ~20
angle from the vertical into the junction where the side wall meets the bottom of the well. Slowly draw 40 μl into the pipette tip (should take ~5 s and air is expected at the bottom of the tip). To dispense the droplets into the 96-well ddPCR plate, position the pipette tip along the side of the well, near, but not at, the bottom of the well, and slowly dispense the droplets (should take ~5 s). 7. Use 96-well ddPCR plates that have been specially formulated to support stable droplets. Do not use 96-well plates by other manufacturers for any steps involving droplets in wells. 8. Critical steps in the SureCell protocol include the proper execution of the SPB cleanups, which bind DNA and determine

Fig. 4 Analysis of PBMCs and isolated CD14 positive monocytes obtained from the same subject. (a) CD14 monocytes were positively selected and run through the Illumina Bio-Rad SureCell single-cell workflow. PBMCs and CD14 isolated monocytes from the same patient were analyzed by the Seurat tutorial by Bio-Rad for PCA. The t-SNE plot shows subpopulations of the PBMCS. The first percentage is the percentage of the cells from that subpopulation to the total number of cells in the total PBMC experiment while the second percentage is for the isolated monocyte experiment. Of note, the monocyte isolation led to 90% purity of monocytes. (b) A t-SNE plot showing cells from the total PBMC sample and the isolated CD14 monocyte sample. (c) Differential gene expression between the CD14 monocyte sample and the total PBMC sample. Only upregulated genes, expressed in at least 25% of cells and with a log-fold change of >0.25, are shown  Fig. 3 (continued) the BaseSpace App and imported into RStudio Software. The Seurat tutorial by Bio-Rad for PCA was used to cluster the cells, which are displayed on a t-SNE plot. Percentages indicate the percentage of the subpopulation to the total number of cells. (b) Heat map showing the top ten genes for each cluster ranked by log-fold change. Genes were statistically determined by comparing the cells in each cluster to all other cells. The gene markers were used to determine the identity of the subpopulations

174

Shaheen Khan and Kelly A. Kaihara

the DNA yield for downstream steps. Helpful tips include slowly aspirating the SPB into the pipette tip and completely expulsing of the SPB into the sample by dispensing the SPB from the pipette tips, waiting, and then expunging the tip again. This ensures that the correct quantity of SPB is used for binding of the correctly sized DNA. Mix vigorously to ensure that the SPB binds the DNA in the sample. When air drying the pellet, ensure that all the ethanol has evaporated from the wells. When eluting into Resuspension Buffer, ensure that the pellet is not overdried. Adhere to all of the incubation times for maximal binding of DNA to the SPB. For additional tips, refer to: https://support.illumina.com/sequencing/ sequencing_kits/nextera_dna_kit/best_practices.html 9. The first SPB cleanup occurs after first-strand synthesis and is carried out on the aqueous phase above the oil phase. Care should be taken not to go into the bottom oil layer when mixing the SPB with the top aqueous phase. Ensure that the aqueous phase is well mixed until the entire layer is homogenously brown. This step is critical in capturing the singlestranded cDNA produced in the cells. 10. Prepare a fresh 0.2 N NaOH solution before preparing the libraries for sequencing. 11. Additional metrics that can be useful to compute from the data output from the BaseSpace SureCell Single-Cell App include “Number of Reads per Cell” and “Read Utilization.” To compute the “Number of Reads per Cell,” divide the “Total Reads” by the “Cells Passing Knee Filter.” To compute the “Read Utilization,” divide the “Reads Aligned to Unique Genes” by the “Total Reads.” 12. There are two main analyses described here, PCA and CCA. We use PCA to compare total PBMCs to isolated monocytes from the same subject. When comparing multiple different subjects or conditions, for instance, the fresh PBMCs versus frozen PBMCs, then we perform CCA. CCA identifies shared correlation structures and aligns these dimensions to allow for clustering based on conserved markers across subjects or conditions, rather than clustering due to differences between subjects or conditions (Fig. 5). 13. In the Seurat tutorial by Bio-Rad, there are parameters that the user must determine and input. When deciding what factors to regress out, select those that make sense for the experiment. For instance, it may not make sense to regress out the cell cycle stage if this parameter determines downstream gene expression that is of interest. Clustering is typically better when fewer variables are regressed out.

Single-Cell RNA-Sequencing of PBMCs with ddSEQ

175

Fig. 5 Tertiary analysis using the Seurat tutorial by Bio-Rad for CCA analysis of fresh versus frozen PBMCs. (a) Analysis of PBMCs comparing a sample from freshly isolated PBMCs to previously frozen PBMCs from the same subject. Data were analyzed by the Seurat tutorial by Bio-Rad for CCA, which aligns the scRNA-seq datasets from two conditions and allows for better clustering and comparison versus PCA. The first percentage is from the sample of fresh PBMCs and the second percentage is from the sample of previously frozen PBMCs. There is no statistical difference in gene expression between the samples or within each subpopulation between the fresh and frozen samples (data not shown). (b) The t-SNE plot is labeled by sample type, fresh or frozen. Each cluster has a similar number of cells in the fresh and the frozen sample

14. Selecting the resolution and ultimately the number of subpopulations is an important step in the analysis. It is helpful to assess the heat maps to determine if the subpopulations have distinct expression markers that distinguish them from other subpopulations. Alternatively, subpopulations can be marked by expression of known cellular markers.

Acknowledgments This work was supported by the University of Texas Southwestern Medical Center Genomics Core. We would like to thank Gunjan Choudhary for her careful reading and editing of this book chapter. Bio-Rad, Droplet Digital PCR, and ddPCR are trademarks of Bio-Rad Laboratories, Inc. in certain jurisdictions. All trademarks used herein are the property of their respective owners. References 1. Abbas AK, Leichtman AH (2009) Basic immunology: functions and disorders of the immune System, 3rd edn. Saunders/Elsevier, Philadelphia, PA 2. Neller MA, Burrows JM, Rist MJ, Miles JJ, Burrows SR (2013) High frequency of herpesvirusspecific clonotypes in the human T-cell

repertoire can remain stable over decades with minimal turnover. J Virol 87(1):697–700 3. Haen SP, Rammensee HG (2013) The repertoire of human tumor-associated epitopes— identification and selection of antigens and their application in clinical trials. Curr Opin Immunol 25(2):277–283

176

Shaheen Khan and Kelly A. Kaihara

4. Meyer EH, Hsu AR, Liliental J et al (2013) A distinct evolution of the T-cell repertoire categorizes treatment refractory gastrointestinal acute graft-versus host. Blood 121 (24):4955–4962 5. American Autoimmune Related Diseases Association (2011) The cost burden of autoimmune disease: the latest front in the war on healthcare spending. AARDA, Eastpointe, MI. www. diabetesed.net/page/_files/autoimmune-dis eases.pdf. Accessed 22 Sept 2017.

6. Kolodziejczyk AA, Kim JK, Svensson V, Marioni JC, Teichmann SA (2015) The technology and biology of single-cell RNA sequencing. Mol Cell 58(4):610–620 7. Orit-Rozenblatt-Rosen MJT, Regev A, Teichmann SA (2017) Single-cell transcriptomics to explore the immune system in health and disease. Science 358(6359):58–63 8. Butler A, Hoffman P, Smibert P, Papalexi E, Satija R (2019) Integrating single-cell transcriptomic data across different conditions, technologies, and species. Nat Biotechnol 36:411–420

Chapter 11 High-Throughput Single-Cell Real-Time Quantitative PCR Analysis Liora Haim-Vilmovsky Abstract Examining transcriptomics of populations at the single-cell level allows for higher resolution when studying functionality in development, differentiation, and physiology. Real-time quantitative PCR (qPCR) enables a sensitive detection of specific gene expression; however, processing a large number of samples for singlecell research involves a time-consuming process and high reagent costs. Here we describe a protocol for single-cell qPCR using nanofluidic chips. This method reduces the number of handling steps and volumes per reaction, allowing for more samples and genes to be measured. Key words Quantitative real-time PCR, Single cells, Targeted assays, Gene expression, Transcripts

1

Introduction Differences in gene expression determine the development, differentiation, and physiology of an organism. The most common methods to explore gene expression average the expression profiles over large numbers of cells. This obscures population heterogeneity and whether there are one or more distinct cell types within a population [1–3]. Quantitative PCR (qPCR), also known as real-time PCR, is one method to determine transcript or DNA region levels in a sample. Gene-specific assays are used to amplify the corresponding gene using PCR, and additional fluorescence probe for monitoring the amplification. The major difficulty when applying qPCR to singlecell study is the enormous number of reactions required and the reagent cost for those experiments, due to the need of increased sample number. The use of the nanofluidic system offers the option to automatically combine up to 96 assays (measured genes) with 96 samples and detect the amplification process of all the combined reactions, which allows for higher throughput of cell number. The systems uses nanofluidic chips which results in a much lower costs for reagents.

Valentina Proserpio (ed.), Single Cell Methods: Sequencing and Proteomics, Methods in Molecular Biology, vol. 1979, https://doi.org/10.1007/978-1-4939-9240-9_11, © Springer Science+Business Media, LLC, part of Springer Nature 2019

177

178

Liora Haim-Vilmovsky

Further advantages of this method include reproducibility, sensitivity, and specificity [4–6]; however, it is still limited to less than a hundred assays/samples per chip, and lower accuracy when measuring low expressed transcripts [7]. Other methods are available today to detect the general transcriptomics of a large number of cells with lower costs. However, this technique can be used to validate the findings and can be used in case there is urgency in the required results and its analysis.

2

Materials Work in an RNAse, DNase, DNA, and PCR products-free laminar flow hood.

2.1

FACS

1. 96-Well PCR plates (see Note 1). 2. RNase inhibitor. Store at

20  C.

3. CellDirect 2 reaction Mix (Invitrogen). Store at

20  C.

4. Lysis buffer: CellDirect 2 reaction Mix, 2% RNase inhibitor. Store at 20  C. 5. FACS instrument. 6. Adhesive plate seals. 7. Dry ice. 2.2 Reverse Transcription and Specific Target Amplification

1. 20 TaqMan Gene Expression Assays (see Notes 2 and 3). Store at 20  C. 2. DNA suspension Buffer: 10 mM Tris, pH 8.0, 0.1 mM EDTA. Store at 4  C. 3. 0.2 Assay mix: Each assay in final concentration of 0.2, in DNA suspension Buffer (see Note 4). Store at 20  C. 4. SuperScript III RT/Platinum Taq Mix. Store at

20  C.

5. PCR certified water. Store at room temperature. 6. 96-Well thermal cycler. 2.3

Real-Time PCR

1. 2 Assay Loading Reagent (Fluidigm) (see Note 5). Store at 20  C. 2. Quanta PerfeCTa qPCR Fast Mix, low ROX. Store at

20  C.

3. 20 GE Sample Loading Reagent (Fluidigm) (see Note 5). Store at 20  C. 4. 96.96 dynamic array (Chip). 5. Integrated Fluidic Circuit (IFC) Controller HX. 6. Biomark HD System.

Single Cell qPCR

3

179

Methods This protocol is for a 96.96 chip (containing 96 single cells and 96 assays per plate). Vortex and spin down all reagents and reaction mixes before use.

3.1 Samples and Assays Preparation

1. Add 5.1 μl of the 2 Lysis buffer to each well of 96-well PCR plate and seal the plate with film (see Notes 6 and 7). 2. Sort single cells directly into each well, seal the plate, vortex it for 10 s, and spin down at 450,180  g for 1 min (see Notes 8–12). 3. Immediately place the plate on dry ice and store at

80  C.

4. Prepare the reverse transcription and specific target amplification reaction mix by combining 300 μl 0.2 Assay mix, 24 μl SuperScript III RT/Platinum Taq Mix, and 144 μl PCR certified water into 1.5 ml sterile tube. Vortex for 10 s and spin down at 450,180  g for 1 min. 5. Add 3.9 μl of the mix to each well. Seal the plate. Vortex for 10 s and spin down at 450,180  g for 1 min (see Notes 13–15). 6. Place the plate onto a thermal cycler and use the following program: 50  C, 15 min; 95  C, 2 min; 22  (95  C, 15 s; 60  C, 4 min) (see Note 16). 7. Dilute the cDNA 1:5 with DNA Suspension Buffer (see Notes 17 and 18). 8. Prepare 10 Assay dilution by mixing 3 μl from each 20 TaqMan Gene Expression Assays with equal volume of 2 Assay Loading Reagent to make the assay running plate (see Note 19). 9. Prepare a Sample Mix by combining 360 μl Master Mix and 20 GE Sample Loading Reagent. 10. Aliquot 3.3 μl of the Sample mix to each well of a new 96-plate (see Notes 13 and 14). 11. Transfer 2.7 μl from each well of the diluted cDNA to the plate with aliquoted sample mix to make the “sample running” plate (see Note 20). 12. Seal the plate, vortex for 10 s, and spin down at 450,450  g for 1 min. 3.2 On-Chip Real Time PCR

1. Open the chip packaging and inject control line fluid into each accumulator on the chip (see Notes 21 and 22). 2. Place the chip into the IFC controller and run the Prime (136) script.

180

Liora Haim-Vilmovsky

3. Vortex both the assay and the sample running plates for 10 s and spin down at 450,180  g for 1 min. 4. Once the Prime script has finished, transfer 5 μl of each assay from the assay running plate to the assay inlets on the chip and 5 μl of each sample on the sample running plate to the sample inlets on the chip (see Notes 23 and 24). 5. Put the chip back into the IFC controller and run the Load mix (136) script (see Note 25). 6. Once Load script is done, remove the chip from the IFC controller. 7. Clean the IFC surface (see Note 26). 8. Load the chip into the Biomark, choose: Gene expression as the application type, ROX as the passive reference, Single probe as the assay, and FAM-MGB as the probe type. Run the protocol “GE 96  96 Standard v1.pcl”. Confirm Auto Exposure (see Note 27). 3.3

Analysis

1. Within the analysis software, open the chip run file (.bml). Choose the appropriate container type and container format for both the sample and assay, and add names. 2. Assess the failed quality value by viewing the amplification curves. If the graph looks exponential, change the value to pass. 3. Export the data to a .csv file. 4. Choose your reference genes by testing the correlation between the housekeeping genes. 5. Calculate the delta value for each gene in each sample according to the determined references.

4

Notes 1. Make sure the plates are compatible with the FACS instrument and the thermal cycler. 2. Choose 96 assays corresponding to the 96 genes of interest. Choose at least five housekeeping genes for normalization (not highly expressed if possible), two genes which should not be expressed as negative controls, and a few genes as positive control (the cell type markers). It is best to choose assays that were used before by others. 3. Validate assay functionality by running the assay the first time with melting curve option on the software. Replace assays if needed. 4. Pipet 4 μl of each 20 assay and add 16 μl DNA Suspension Buffer to get a volume of 400 μl. 300 μl are needed for the

Single Cell qPCR

181

reaction. Be very careful not to contaminate the assays; switch tips between wells. It is possible to store the mix at 20  C. 5. Leave the reagent at room temperature for 20 min before use. 6. Steps 1–5, 7, 9, and 10, need to be done in an RNAse, DNase, DNA, and PCR products-free laminar flow hood. 7. Keep the plate on ice if used immediately, or at within a few days.

20  C if used

8. Calibrate the FACS instrument before sorting. 9. Sort fluorescent beads to a flat 96-well plate and check by fluorescent microscope that the beads are located in the middle of the well. Dry spots can also be detected by eye against a source of light. 10. If possible, sort different samples in the same plate to reduce batch effects. If more cells are needed, sort into additional plates. 11. Leave three wells empty spread randomly over the plate. These will be negative controls to verify the absence of contamination. 12. Keep the plate on ice or on a cool plate holder while sorting, if possible. 13. To reduce technical variation, divide the reaction mix equally to each tube of an 8 or 12-well PCR strip, and transfer the specific volume using a multichannel pipette. Make sure the liquid level in each tip is the same. 14. Add the drop to the side of the well. 15. Seal the plate properly using a plate sealer or a roller to avoid evaporations, especially at edges. 16. The number of cycles can vary between 18 and 22, depending on the cell size. We find the best results when using 22 cycles, for many different cell size ranges. 17. This step needs to be done outside the DNA-free hood. 18. cDNA can be stored at

20  C.

19. For one plate 6 μl of each diluted assay is needed. A stock plate can be prepared (50–100 μl) and kept at 20  C. Using a multichannel pipette, aliquots can be easily transferred to a new plate when required. 20. Use a multichannel pipette, put the drop on the side of the well (opposite side of the Sample Mix), and change tips between samples. 21. Press the accumulator once with the syringe and then inject the fluid when the syringe is tilted.

182

Liora Haim-Vilmovsky

Fig. 1 Scheme for transferring of samples/assays from the 96-well running plate into the 96.96 chip inlet

22. Use chip within 24 h of opening the package. Load the chip as soon as possible after priming, not later than an hour. 23. While adding the volume to the chip, put the pipette at an angle and do not pass the first stop on the pipette. This is done to prevent bubbles. If you do find bubbles, use a thin needle to pop them. If the bubble is on the surface and not on the bottom of the well, it can be left in the well. 24. Use a multichannel pipette with eight tips, and move column 1 from the running plate to the first column of the chip, start at the top (so that A1 from the running plate is on number 1 in the chip inlet), then column 2 from the running plate to the second column on the chip, start at the top, and so on until column number 6. Then add column 7–12 of the running plate on columns 1–6, but start at the second well of the column (A6 from the running plate goes to number 7 in the chip inlet (Fig. 1). When analyzing the plate on the software, remember to choose SBS96 as the container format. 25. Start the loading within 1 h of adding the samples and assays onto the chip. 26. Use Sellotape to remove particles or dust. 27. For the first run with the specific assay, run the script with additional phase of melting curves. This will allow to assess the quality of the assay within the pool assay environment. Any assay that does not have a normal melting curve should be replaced.

Single Cell qPCR

183

Acknowledgments This work was supported by EMBO (award number ALTF 698-2012), Directorate-General for Research and Innovation (FP7-PEOPLE-2010-IEF, ThPLAST 274192) and an EMBL Interdisciplinary Postdoctoral fellowship, supported by H2020 Marie Skłodowska-Curie Actions. References 1. Shen-Orr SS, Tibshirani R, Khatri P et al (2010) Cell type-specific gene expression differences in complex tissues. Nat Methods 7:287–289 2. Hebenstreit D, Fang M, Gu M et al (2011) RNA sequencing reveals two major classes of gene expression levels in metazoan cells. Mol Syst Biol 7:497 3. Hebenstreit D, Teichmann SA (2011) Analysis and simulation of gene expression profiles in pure and mixed cell populations. Phys Biol 8:035013 4. Spurgeon SL, Jones RC, Ramakrishnan R (2008) High throughput gene expression

measurement with real time PCR in a microfluidic dynamic array. PLoS One 3:e1662 5. Jang JS, Simon VA, Feddersen RM et al (2011) Quantitative miRNA expression analysis using Fluidigm microfluidics dynamic arrays. BMC Genomics 12:144 6. Devonshire AS, Elaswarapu R, Foy CA (2011) Applicability of RNA standards for evaluating RT-qPCR assays and platforms. BMC Genomics 12:118 7. Bengtsson M, Hemberg M, Rorsman P, Sta˚hlberg A (2008) Quantification of mRNA in single cells and modelling of RT-qPCR induced noise. BMC Mol Biol 9:63

Chapter 12 Single-Cell Dosing and mRNA Sequencing of Suspension and Adherent Cells Using the PolarisTM System Chad D. Sanada and Aik T. Ooi Abstract Single-cell functional analysis provides a natural next step in the now widely adopted single-cell mRNA sequencing studies. Functional studies can be designed to study cellular context by using single-cell culture, perturbation, manipulation, or treatment. Here we present a method for a functional study of 48 single cells by single-cell isolation, dosing, and mRNA sequencing with an integrated fluidic circuit (IFC) on the Fluidigm® Polaris™ system. The major procedures required to execute this protocol are (1) cell preparation and staining; (2) priming, single-cell selection, cell dosing, cell staining, and cDNA generation on the Polaris IFC; and (3) preparation and sequencing of single-cell mRNA-seq libraries. The cell preparation and staining steps employ the use of a universal tracking dye to trace all cells that enter the IFC, while additional fluorescence dyes chosen by the user can be used to differentiate cell types in the overall mix. The steps on the Polaris IFC follow standard protocols, which are also described in the Fluidigm user documentation. The library preparation step adds Illumina® Nextera® XT indexes to the cDNA generated on the Polaris IFC. The resulting sequencing libraries can be sequenced on any Illumina sequencing platform. Key words Single-cell perturbation, Differentiation, Adherent culture, Extracellular matrix (ECM), Time-lapse imaging, Single-cell functional study, Phenotype–genotype correlation, Dose response, Time course, Microfluidics

1

Introduction Understanding cell function using gene expression information alone is often not sufficient, due to the loss of cellular context. To make better links between gene expression and cellular context, researchers often subject the cells to different treatment groups, then harvest the cells for gene expression analysis. When those studies are done in bulk, there is a lack of resolution in terms of how many cells are actually driving the changes seen in gene expression. Indeed, this is an area of study where single-cell techniques can be powerful. However, even if the cells from bulk treatments are subsequently singulated for downstream analysis, the effects on gene expression due to cell–cell interactions and changes in microenvironment caused by other cells cannot be

Valentina Proserpio (ed.), Single Cell Methods: Sequencing and Proteomics, Methods in Molecular Biology, vol. 1979, https://doi.org/10.1007/978-1-4939-9240-9_12, © Springer Science+Business Media, LLC, part of Springer Nature 2019

185

186

Chad D. Sanada and Aik T. Ooi

deconvoluted from the resulting data [1]. Thus, it is critical to have methods where treatments or stimuli can be applied on isolated single cells followed by single-cell cDNA generation. A handful of existing approaches achieve this to some extent [2–6] but fail to integrate the process into a single device. In addition, most of those approaches suffer from being labor-intensive or are not easily reproducible due to the requirement for in-house fabrication of custom devices and systems. The Fluidigm Polaris system overcomes these challenges by providing an off-the-shelf solution to automate and reproduce these multistep single-cell experiments [7]. The Polaris system enables users to perform experiments on an IFC that integrates single-cell isolation (one or two populations), dosing with stimuli, time-lapse imaging to track cell response to stimuli, and subsequent single-cell mRNA sequencing. The three major workflows offered on the Polaris system include No Treatment (for controls), Dose and Feed (simultaneous dosing and feeding of cells), and Time Course (staggered dosing for different treatment durations). Cells can be cultured under these conditions for up to 24 h, during which fluorescence imaging occurs automatically at least once per hour for all cell culture chambers. After dosing is complete, users can perform an optional cell staining step to track cell status, such as activation or viability. The IFC can then be imaged off instrument using a fluorescence microscope before proceeding to single-cell cDNA generation on Polaris. The following protocol describes a typical Dose and Feed experiment on the system, using the Polaris Single-Cell Dosing IFC. The users will define which dosing and feeding reagents they wish to use for the experiment. Typical examples of dosing reagents could include but are not limited to: antibodies for stimulating immune cells, water-soluble drugs, growth factors and cytokines, and viruses or vectors aimed at altering gene expression [8]. At the end of the Dose and Feed experiment, the users will generate single-cell cDNA on the IFC and harvest all samples from individual outlets, which can then be indexed as desired for downstream sequencing.

2 2.1

Materials Polaris Workflow

1. Fluidigm Polaris system (Fluidigm). 2. Polaris Single-Cell Dosing mRNA Seq IFC (Fluidigm). 3. Polaris Single-Cell mRNA Seq Reagent Kit (Fluidigm). 4. Polaris Sponge Pack—5 Pack (Fluidigm). 5. (Optional) Single-Cell IFC Barrier Tape (Fluidigm). 6. SMARTer® Ultra™ Low RNA Kit for the Fluidigm C1™ System, 10 IFCs—includes Boxes 1 of 2 and 2 of 2 and Advantage® 2 PCR Kit (Takara Bio USA).

Single-Cell Dosing and mRNA-Seq

187

7. Universal cell labeling fluorescence dye for cell tracing and imaging purposes. For example: CellTracker™ Orange CMRA Dye (Thermo Fisher Scientific), CellTracker Green CMFDA Dye (Thermo Fisher Scientific), or CellTracker Deep Red Dye (Thermo Fisher Scientific). 8. (Optional) Zombie Yellow™ Fixable Viability Kit (BioLegend). 9. INCYTO C-Chip™ Disposable Hemocytometer (Neubauer Improved) (INCYTO). 2.2 Library Preparation

1. Nextera XT DNA Sample Preparation Kit (Illumina). 2. Nextera XT Index Kit (Illumina; select an appropriate kit for the desired indices). 3. Quant-iT™ PicoGreen® dsDNA Assay Kit (Thermo Fisher Scientific). 4. Agencourt® AMPure® XP (Beckman Coulter). 5. Magnetic stand for PCR tubes. 6. 2100 Bioanalyzer® (Agilent Technologies). 7. High Sensitivity DNA Kit (Agilent Technologies).

3

Methods

3.1 Configure the Experimental Profile on Polaris (See Note 1)

1. Select one of the three available experiments: Dose and Feed, Time Course, and No Treatment (see Note 2). 2. For a dose response experiment, select Dose and Feed. Select this option if you desire to dose all 48 sites individually, or if you want to feed all 48 sites from a common reservoir, or some combination of the two. 3. Name and add description of the Dose and Feed experiment, if desired. 4. Set up the Prime step for either suspension or adherent cells by tapping the default Suspension Cell Priming box. Toggle to choose between Suspension Cell Priming or Adherent Cell Priming at the pop-up screen. 5. Set up the Cell Selection step by selecting the Sample box. Editable parameters in the pop‑up screen are Selection Pressure (Standard or Low), Cell Input (Standard Cell Input or Low Cell Input), Number of Cell Populations (1 Population or 2 Populations), sample Name, and Input Volume (1–5 inlets of 25 μL/inlet). 6. Select the cell population 1 box to edit the selection settings based on fluorescence staining. Choose the appropriate fluorescence Channels, set Lower Bound and Upper Bound of fluorescence intensity, and select Exposure time. Edit the channel

188

Chad D. Sanada and Aik T. Ooi

name under Alias if desired. The parameters for Lower Bound, Upper Bound, and Exposure can be adjusted later. 7. Repeat for Cell Population 2 if two populations of cells are to be selected in the experiment. 8. Tap the Dose and Feed area for a pop-up screen to configure the dosing experimental setup. Available duration parameters are Exchange Interval, Pre Dose Duration, Dose Duration, and Post Dose Duration. Use the (+) or ( ) sign to adjust the duration for these parameters. 9. Rename the eight dosing groups for the experiment by tapping Condition A through H. 10. Configure the Post Stain/Wash settings by tapping the Stain & Wash box for the pop-up screen. Toggle between Stain & Wash and Wash Only under the Stain/Wash option. If Stain & Wash is selected, additional parameters are available to choose the number of stains, staining duration, number and choice of fluorescence channels, and exposure time for each selected channel. 3.2 Prime the Polaris IFC

1. Pipet the Actuation Fluid, Valve Priming Reagent, Polaris Blocking Reagent, Cell Wash Buffer, Polaris Imaging Reagent, and Initialization Reagent into appropriate inlets on the IFC. All the reagents used in this step are from the Polaris SingleCell mRNA Seq Reagent Kit (Fluidigm) (see Notes 2–4). 2. If the experiment is set up for adherent cells, pipet 25 μg/mL fibronectin, or an appropriate extracellular matrix (ECM) of choice into the IFC to coat the cell chamber (see Note 5). 3. Place the IFC into the Polaris instrument with the Environmental Control Interface Plate (EC IP), then run the first Prime step. 4. After the first Prime step is finished, prepare the Cell Capture Bead Mix according to the user guide and pipet the mix into the IFC. Run the second Prime step on the Polaris.

3.3

Prepare Cell Mix

1. Bring the Cell Suspension Reagent (Fluidigm) to room temperature before use. Wash and stain cells with a universal cell labeling fluorescence dye, following the recommended staining condition for the chosen dye (see Notes 6–8). 2. After cell staining, wash and resuspend cells in phenol red-free complete culture medium or appropriate buffer (HBSS or PBS, with 3% FBS). 3. Count cells and adjust the cell concentration in culture medium in the range of 150–550 cells/μL, depending on the purity of the target cell population. Refer to the protocol guide

Single-Cell Dosing and mRNA-Seq

189

for the reference table on recommended input volume and cell mix concentration (see Note 2). The absolute minimum cell concentration needed for an experiment is 20 cells/μL, which requires the use of the Low Cell Input option at the Cell Selection step. 4. Vortex the Cell Suspension Reagent for 15 s (do not centrifuge), then mix the cells with Cell Suspension Reagent at a ratio ranging from 3:2 to 3:1, depending on cell type. For example, 120 μL of cells with 80 μL of Cell Suspension Reagent for a 3:2 ratio. Refer to protocol guide for notes on optimizing Cell Suspension Reagent ratio (see Notes 2 and 9). This is the final cell mix to be loaded onto the Polaris IFC. Save an aliquot of cells without the addition of Cell Suspension Reagent for imaging with a hemocytometer on the subsequent step. 3.4 Image Cells on Polaris with a Hemocytometer

1. Pipet 10 μL of fluorescence-stained cells (prepared in Subheading 3.3) without the addition of Cell Suspension Reagent into an empty chamber of a hemocytometer. 2. Place the hemocytometer onto the hemocytometer holder, then load the holder into the Polaris. 3. Adjust the parameters for Channels to select the number of channels between 1 and 3 to be included in the imaging process. 4. Tap a Channel box to select a specific fluorescence channel. The first channel will be used as the focusing reference for all images. 5. Adjust the imaging Exposure time for each selected channel. 6. Tap Image to begin imaging of all selected channels. 7. After imaging is complete, images and histograms are displayed on the Hemocytometer images acquired screen. If multiple channels are used, select to view the image and histogram of individual channel by tapping the channel name on the upper-left area of the screen (see Note 10). 8. To optimize display of the hemocytometer image, adjust the parameters for Low Contrast Limit, High Contrast Limit, and Exposure time. Repeat for each channel as needed. 9. Tap Image again to capture new images based on the updated parameters. 10. Tap Done to continue to the next step.

3.5 Cell Selection on the Polaris

1. Remove leftover reagents and waste from the IFC after priming, following the protocol guide (see Notes 2 and 4). 2. Prepare the IFC for cell selection by pipetting PCR-grade water, cell selection medium (see Notes 11 and 12), and final cell mix into appropriate inlets in the IFC. One to five inlets are

190

Chad D. Sanada and Aik T. Ooi

available for the final cell mix according to the workflow specified during experimental setup. Number of cell inlets used for selection will depend on cell concentration and target cell purity. 3. Load the IFC and EC IP into Polaris and tap Initialize. 4. After initialization, tap Configure for the Configure cell selection screen. 5. Adjust upper and lower thresholds of fluorescence intensity for cell selection. 6. The low- and high-contrast limits can be adjusted to optimize the display of the imaged cells. 7. If needed, the imaging exposure time can be adjusted. Image cells again to apply the new exposure time. 8. Repeat the configuration of upper and lower thresholds for each channel used in cell selection. 9. If no candidate cells are visible, tap Load Cells to load another set of cells for configuration of cell selection parameters. 10. Once all the cell selection settings are adjusted to satisfaction, select Save, followed by Start Selection to begin cell selection. 11. During selection, cell selection settings can be changed by tapping Configure to allow adjustments on the exposure time and the upper and lower thresholds of fluorescence intensity. 3.6 Dose and Feed on the Polaris

1. When cell selection is complete, retrieve the IFC from Polaris and remove remaining reagents and waste from the IFC according to user guide (see Notes 2 and 4). 2. Prepare the IFC by pipetting cell culture medium (see Notes 11 and 12) and dosing reagents of choice into the designated IFC inlets. 3. Eight groups of dosing conditions are available, where unique or replicated dosing reagents can be used for each group. 4. Pipet 2.0 mL of PCR-grade water onto the hydration sponge that is inserted into the sponge holder, then clip the sponge holder onto the EC IP. Remove excess water with a lint-free wiper. 5. Place the IFC and EC IP into the Polaris to start the Dose and Feed step.

3.7 Post Stain/Wash Cells on the Polaris

1. Remove the IFC from the Polaris instrument when the Dose and Feed step is complete. 2. Pipet off any excess water accumulated on the IFC, especially in the furrow around the center of the IFC.

Single-Cell Dosing and mRNA-Seq

191

3. Remove remaining reagents and waste from the IFC inlets according to protocol guide (see Notes 2 and 4). 4. Prepare the IFC for the post-stain step by pipetting viability stain (for example, the Zombie Yellow from BioLegend), an optional second stain, Polaris Imaging Reagent, Cell Wash Buffer, and Harvest Reagent onto the specified IFC inlets (see Notes 13 and 14). 5. Alternatively, if a Wash Only step is used, prepare the IFC by pipetting Cell Wash Buffer and Harvest Reagent onto the IFC (see Note 15). 6. Load the IFC along with the EC IP into Polaris and start the Post Stain or Wash step. 3.8 Run the mRNA Seq Chemistry on the Polaris

1. Prepare the Lysis Mix, RT Mix, and PCR Mix (see Notes 2 and 16). 2. When Post Stain/Wash step is complete, remove the IFC from the Polaris instrument. 3. Carefully remove the black tape underneath the IFC without inverting the IFC. 4. With the tape removed, it is possible to image the cells on the IFC with a microscope or any suitable imaging system. Imaging is recommended to record higher resolution of cell images (see Notes 17 and 18). 5. Remove remaining reagents and waste from the IFC inlets according to user guide (see Notes 2 and 4). 6. Prepare the IFC for the chemistry step by pipetting Harvest Reagent, Cell Wash Buffer, Preloading Reagent, Lysis Mix, RT Mix, and PCR Mix into the designated IFC inlets. 7. Load the IFC along with the EC IP into the Polaris. 8. Move the slider to select the desired time for the protocol to finish.

3.9 Harvest, Quantify, and Dilute Amplified cDNA

1. Remove the IFC from the Polaris instrument once the mRNA Seq step is finished. 2. Aliquot 5 μL of DNA Dilution Reagent into 48 wells of a new 96-well plate and label it “Diluted Harvest Plate” (see Note 19). 3. Using a multichannel pipette, transfer the 48 amplified products from the IFC harvest outlets to the prepared Diluted Harvest Plate (see Note 2). 4. Quantify the diluted harvest products by using the Quant-iT PicoGreen dsDNA Assay (Thermo Fisher Scientific) on each sample following the plate-based assay protocol. Alternatively, other DNA quantitation methods can be used, such as the

192

Chad D. Sanada and Aik T. Ooi

Qubit® dsDNA HS Assay Kit (Thermo Fisher Scientific) or a NanoDrop™ instrument. It is recommended that cDNA also be qualified using an Agilent Bioanalyzer with the High Sensitivity DNA chip, or a similar fragment analyzer system. 5. Based on the quantification results, dilute and normalize each sample to the optimal concentration range of 0.10–0.30 ng/μL. 3.10 Prepare Nextera XT Library

1. Label a new 96-well plate “Library Prep.” 2. Prepare Tagmentation PreMix: 2.5 μL Tagment DNA Buffer (Illumina) and 1.25 μL Amplicon Tagment Mix (Illumina) for each sample. 3. Add 3.75 μL Tagmentation PreMix to 48 wells on the Library Prep plate. 4. Pipet 1.25 μL of diluted sample to each of the 48 wells. Seal the plate with an adhesive film, vortex, and centrifuge the plate. 5. Place the Library Prep plate into a thermal cycler for 10 min at 55  C, then hold at 10  C. 6. Pipet 1.25 μL of NT Buffer (Illumina) into each well to neutralize the tagmented samples. Seal the plate with an adhesive film, vortex, and centrifuge for 5 min at 300  g. 7. Pipet 3.75 μL of Nextera PCR Master Mix (Illumina) into each sample well. 8. Select appropriate Index 1 (N7xx) and Index 2 (S5xx) primers to form 48 unique pairs of indexing primers. 9. Pipet 1.25 μL of Index 1 (N7xx) primer and 1.25 μL of Index 2 (S5xx) primer into each sample well, based on the selected indexing scheme. Seal the plate with an adhesive film, vortex, and centrifuge for 2 min at 300  g. 10. Place the Library Prep plate into a thermal cycler and run the following PCR program:

3.11 Pool and Clean Up the Library

Temperature ( C)

Time

72

3 min

1

95

30 s

1

95 55 72

10 s 30 s 60 s

12

72 10

5 min Hold

Cycles

1

1. When the PCR step in finished, prepare a dual-indexed library pool by pipetting 1 μL of PCR product from each of the 48 sample wells.

Single-Cell Dosing and mRNA-Seq

193

2. Perform two rounds of cleanup using 90% of total pool volume of AMPure XP beads (Beckman coulter) (e.g., add 44 μL of AMPure XP beads to 48 μL of library pool) following the standard AMPure XP beads protocol. 3. The final library eluted from the AMPure XP beads is ready to be prepared for sequencing on any Illumina sequencing platform.

4

Notes 1. For detailed instructions on instrument and software operation, refer to the Polaris User Guide (Fluidigm 100-9580). 2. For detailed instructions on the experimental protocol, refer to the Generate cDNA Libraries with the Polaris Single-Cell Dosing mRNA Seq IFC Protocol (Fluidigm 101-0082). 3. To prevent bubbles from forming, push only to the first stop on the pipette when pipetting into the IFC inlets. If a bubble is created, use a pipette tip to either burst the bubble or move it to the top surface of the solution. 4. For a quick reference guide on IFC preparation in each step, refer to the Generate cDNA Libraries with the Polaris SingleCell Dosing mRNA Seq IFC Quick Reference (Fluidigm 101-0075). 5. Be sure that any ECM used is clean and free of particulates that may clog the microfluidic channels. Some ECMs, such as collagen and Matrigel®, are highly likely to cause clogs and are not currently recommended for use on the Polaris. Other possible ECM choices may include laminin and vitronectin, at a concentration 50 μg/mL. ECM can be diluted in Cell Wash Buffer, PBS, or another simple buffer of choice, given that it is filtered to remove particulates prior to use. 6. Cells can be stained with additional dyes chosen by the user as long as they are verified to work with the excitation and emission filters available on Polaris. Recommended universal dyes include CellTracker Orange CMRA, CellTracker Green CMFDA, and CellTracker Deep Red (all from Thermo Fisher Scientific). Cell preparation and staining are very critical to the success of the Polaris workflow, so it is recommended to optimize these steps in advance of a Polaris experiment. 7. If the cells of interest have green fluorescent protein (GFP), then CellTracker Orange CMRA is not recommended, as it will quench the GFP signal. Using a universal dye such as CellTracker CM-DiI Dye (Thermo Fisher Scientific) is recommended as a replacement for the CMRA dye.

194

Chad D. Sanada and Aik T. Ooi

8. Use the Hemocytometer function on Polaris to optimize your cell stains before beginning the experiment on the IFCs. The Hemocytometer function can be accessed from the start menu on Polaris at any time that an active experiment is not running. 9. To prevent bubbles from forming, push only to the first stop on the pipette when pipetting into the IFC inlets. If a bubble is created, use a pipette tip to either burst the bubble or move it to the top surface of the solution. 10. In general, cells with fluorescence intensities below 5000 will be difficult to identify during the Cell Selection step of an IFC run. It is recommended that cell fluorescence intensities on a hemocytometer be 8000 for exposure of 0.5–1.0 s. For exposure times longer than 1.0 s, the cell intensities should be 10,000. 11. Cell selection medium must be free of particulates or cell clumps larger than 40 μm diameter, as they might clog the microfluidic channels of the IFC. Cell media containing serum or BSA should be sterile-filtered. Any cell suspension with cell clumps should be strained through a 40 μm mesh filter before use. 12. The cell selection media should be phenol-red free and free of any autofluorescence within the fluorescence spectra used in the experiment to prevent interference on cell selection efficiency. 13. For Zombie Yellow stain, it is recommended to dilute 1:100–1:500 in Cell Wash Buffer. User can optimize further as needed. 14. Although DAPI cannot be imaged directly on Polaris, the IFC can be imaged for DAPI staining on a microscope upon completion of the post stain step. If using DAPI as the staining reagent for Post Stain, a dilution of 1:1000–1:3000 DAPI in Cell Wash Buffer is recommended. 15. If running Wash Only and no Post Stain, it is possible to remove the black tape underneath the IFC and image the IFC on a microscope right after the Dose and Feed step. 16. For a quick reference guide on making these reagent mixes, refer to the Prepare the Reagent Mixes for mRNA Seq Chemistry on Polaris Quick Reference (Fluidigm 101-2819). 17. If cells were stained with DAPI in the Post Stain step, this is the step to collect images for cell viability analysis. 18. An inverted microscope with phase-contrast imaging capability is recommended. Use 10 or 20 objectives for adequate cell imaging. Criteria for selection of a compatible imaging system are outlined in Minimum Specifications for Imaging Cells in Fluidigm Integrated Fluidic Circuits (Fluidigm 100-5004).

Single-Cell Dosing and mRNA-Seq

195

19. If low cDNA output is expected, or if a higher concentration of sample is desired, aliquot a smaller amount of DNA Dilution Reagent into the plate. Alternatively, collect the amplified cDNA from the IFC without any dilution. References 1. Guo G, Pinello L, Han X et al (2016) Single human T cells stimulated in the absence of feeder cells transcribe interleukin-2 and undergo long-term clonal growth in response to defined monoclonal antibodies and cytokine stimulation. Cell Rep 14:956–965. https://doi.org/ 10.1016/j.celrep.2015.12.089 2. Kimmerling RJ, Lee Szeto G, Li JW et al (2016) A microfluidic platform enabling single-cell RNA-seq of multigenerational lineages. Nat Commun 7:10220. https://doi.org/10.1038/ ncomms10220 3. Sunder-Plassmann R, Breiteneder H, Zimmermann K et al (1996) Single human T cells stimulated in the absence of feeder cells transcribe interleukin-2 and undergo long-term clonal growth in response to defined monoclonal antibodies and cytokine stimulation. Blood 87 (12):5179–5184 4. Prakadan SM, Shalek AK, Weitz DA (2017) Scaling by shrinking: empowering single-cell ’omics’ with microfluidic devices. Nat Rev

Genet 18(6):345–361. https://doi.org/10. 1038/nrg.2017.15 5. Dura B, Dougan SK, Barisa M et al (2015) Profiling lymphocyte interactions at the singlecell level by microfluidic cell pairing. Nat Commun 6:5940. https://doi.org/10.1038/ ncomms6940 6. Etzrodt M, Schroeder T (2017) Illuminating stem cell transcription factor dynamics: longterm single-cell imaging of fluorescent protein fusions. Curr Opin Cell Biol 49:77–83. https:// doi.org/10.1016/j.ceb.2017.12.006 7. Ramalingam N, Fowler B, Szpankowski L et al (2016) Fluidic logic used in a systems approach to enable integrated single-cell functional analysis. Front Bioeng Biotechnol 4:70. https://doi. org/10.3389/fbioe.2016.00070 8. Wills QF, Mellado-Gomez E, Nolan R et al (2017) The nature and nurture of cell heterogeneity: accounting for macrophage geneenvironment interactions with single-cell RNA-Seq. BMC Genomics 18(1):53

Chapter 13 Targeted TCR Amplification from Single-Cell cDNA Libraries Shuqiang Li and Kenneth J. Livak Abstract Single-cell sequencing of TCR alleles enables determination of T cell specificity. Here we describe a sensitive protocol for targeted amplification of TCR CDR3 regions from single-cell full-length cDNA libraries. By exploiting the specificity of RNase H-dependent PCR (rhPCR), the protocol achieves amplification of TCR alleles and addition of cell barcodes in a single PCR step. Key words T cell receptor repertoire, Paired TCRαβ single-cell sequencing, RNase H-dependent PCR

1

Introduction The diversity of individual T cell receptor (TCR) chains has been used as a measure of clonal diversity in the analysis of the immune response to pathogens and vaccines [1]. The recent successes of immunotherapy for cancer have intensified interest in TCR analysis because T cells are the primary effector cells of immune response to tumor [2]. Interaction of a TCR with a peptide antigen bound to a major histocompatibility complex (MHC) molecule occurs mainly through the paired alpha- and beta-CDR3 regions. Thus, determining the sequence of these CDR3 segments is a necessary component in characterizing the antigen specificity of a T cell. Identification of which TCR interacts with a particular antigen requires single-cell sequencing so the exact pairing of TCR-alpha and TCR-beta chains is known. Programs such as TraCeR [3] enable extraction of TCR sequences from single-cell RNA-seq data as long as the sequencing uses whole transcript libraries rather than end counting libraries. Due to read-depth limitations of single cell RNA-seq, this type of analysis does not always detect both TCR alpha and beta sequences in the same single cell. Also, it sometimes recovers only partial CDR3 sequences. Complete CDR3 sequence information is critical for the cloning and expression of TCRs, which is required for determining the specificity of discovered

Valentina Proserpio (ed.), Single Cell Methods: Sequencing and Proteomics, Methods in Molecular Biology, vol. 1979, https://doi.org/10.1007/978-1-4939-9240-9_13, © Springer Science+Business Media, LLC, part of Springer Nature 2019

197

198

Shuqiang Li and Kenneth J. Livak

TCRs. Thus, there is a need to improve the sensitivity of determining TCR sequences in single-cell cDNA libraries. Here we present a protocol that starts with full-length singlecell cDNA libraries suitable for preparing whole transcript sequencing libraries and achieves specific, targeted amplification of TCR alleles plus addition of cell barcodes in a single PCR step, as opposed to a nested PCR strategy such as the one described by Han et al. [4].

2

Materials 1. 96-Well PCR plates. 2. 20 mg/mL Proteinase K (800 units/mL). Store at

20  C.

3. Prionex: Sigma-Aldrich G0411. 4. NEBNext Single Cell/Low Input RNA Library Prep Kit: New England BioLabs, E6420L. 5. 25 mM AAPV protease inhibitor: Dissolve 5 mg Elastase Inhibitor III (Sigma-Aldritch 324745-5MG) in 400 μL DMSO. Dispense into 20 μL aliquots and store at 80  C. This is a peptide inhibitor with the amino acid sequence AAPV. 6. Thermal cycler. 7. ProNex beads: Promega NG2001(see Note 1). Product includes Promega Wash Buffer concentrate and Promega Elution Buffer. 8. Ethanol: Used to dilute Promega Wash Buffer concentrate and to prepare 80% ethanol. 9. Magnetic stand for 96-well plate. 10. DNA Suspension Buffer: 10 mM Tris–HCl, pH 8.0 and 0.1 mM EDTA. 11. Set of 96 barcode primer mixes: Each mix consists of 6 μM rhPCR primer P5.IDT***.Rd1x.x1 and 6 μM rhPCR primer P7.IDT***.Rd2x.x1, where IDT*** refers to the different barcodes. The sequences of the 192 primers are in Table 1. These are mixed in pairwise combinations, one P5 primer with one P7 primer. Store at 20  C. 12. RNase H2 Enzyme Kit: Integrated DNA Technologies 11-0212-01. The kit contains 2 U/μL RNase H2 Enzyme and RNase H2 Dilution Buffer. 13. 1 M Tris–HCl, pH 8.4. 14. 1 M KCl. 15. 1 M MgCl2.

Sequence

AATGATACGGCGACCACCGAGATCTACACCATTGCCTACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACCTAGGTGAACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACTCCGTATGACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACACGATGACACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACGTCGGTAAACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACTCGAAGGTACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACAGAAGCGTACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACCTCTACTCACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACCTAGGCATACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACTGGAGTTGACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACGAGGACTTACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACCAATCGACACACTCTTTCCCTACrACGACa/ 3SpC3/

Name

P5.IDT289. Rd1x.x1

P5.IDT290. Rd1x.x1

P5.IDT291. Rd1x.x1

P5.IDT292. Rd1x.x1

P5.IDT293. Rd1x.x1

P5.IDT294. Rd1x.x1

P5.IDT295. Rd1x.x1

P5.IDT296. Rd1x.x1

P5.IDT297. Rd1x.x1

P5.IDT298. Rd1x.x1

P5.IDT299. Rd1x.x1

P5.IDT300. Rd1x.x1

Notes

(continued)

Table 1 Primers used in targeted amplification and barcode addition for templates derived from TCR transcripts as described in Subheading 3.2

Single-Cell TCR Sequencing 199

Sequence

AATGATACGGCGACCACCGAGATCTACACTCTAACGCACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACTCTCGCAAACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACATCGGTGTACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACGAGATACGACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACGTCTCCTTACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACAGTCGACAACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACCGGATTGAACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACCACAAGTCACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACTACATCGGACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACAGCTCCTAACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACACTCGTTGACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACCTGACACAACACTCTTTCCCTACrACGACa/ 3SpC3/

Name

P5.IDT301. Rd1x.x1

P5.IDT302. Rd1x.x1

P5.IDT303. Rd1x.x1

P5.IDT304. Rd1x.x1

P5.IDT305. Rd1x.x1

P5.IDT306. Rd1x.x1

P5.IDT307. Rd1x.x1

P5.IDT308. Rd1x.x1

P5.IDT309. Rd1x.x1

P5.IDT310. Rd1x.x1

P5.IDT311. Rd1x.x1

P5.IDT312. Rd1x.x1

Table 1 (continued) Notes

200 Shuqiang Li and Kenneth J. Livak

AATGATACGGCGACCACCGAGATCTACACCAACCTAGACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACAAGGACACACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACTGCAGGTAACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACACCTAAGGACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACAGTCTGTGACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACAGGTTCGAACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACGACTATGCACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACTTCAGGAGACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACTGTGCGTTACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACCGAGACTAACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACCTCAGAGTACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACGCCATAACACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACTTACCGAGACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACGCTCTGTAACACTCTTTCCCTACrACGACa/ 3SpC3/

P5.IDT313. Rd1x.x1

P5.IDT314. Rd1x.x1

P5.IDT315. Rd1x.x1

P5.IDT316. Rd1x.x1

P5.IDT317. Rd1x.x1

P5.IDT318. Rd1x.x1

P5.IDT319. Rd1x.x1

P5.IDT320. Rd1x.x1

P5.IDT321. Rd1x.x1

P5.IDT322. Rd1x.x1

P5.IDT323. Rd1x.x1

P5.IDT324. Rd1x.x1

P5.IDT325. Rd1x.x1

P5.IDT326. Rd1x.x1

(continued)

Single-Cell TCR Sequencing 201

Sequence

AATGATACGGCGACCACCGAGATCTACACCGTTATGCACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACGTCTGATCACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACTAGTTGCGACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACTGATCGGAACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACCCAAGTTGACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACCCTACTGAACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACCTTGCTGTACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACTGCCATTCACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACTTGATCCGACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACAGTGCAGTACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACGACTTAGGACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACCGTACGAAACACTCTTTCCCTACrACGACa/ 3SpC3/

Name

P5.IDT327. Rd1x.x1

P5.IDT328. Rd1x.x1

P5.IDT329. Rd1x.x1

P5.IDT330. Rd1x.x1

P5.IDT331. Rd1x.x1

P5.IDT332. Rd1x.x1

P5.IDT333. Rd1x.x1

P5.IDT334. Rd1x.x1

P5.IDT335. Rd1x.x1

P5.IDT336. Rd1x.x1

P5.IDT337. Rd1x.x1

P5.IDT338. Rd1x.x1

Table 1 (continued) Notes

202 Shuqiang Li and Kenneth J. Livak

AATGATACGGCGACCACCGAGATCTACACTACCAGGAACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACCGTCAATGACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACGAAGAGGTACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACGACGAATGACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACAGGAGGAAACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACCTTACAGCACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACGAGATGTCACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACTACGGTTGACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACCTATCGCAACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACTCGAACCAACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACGAACGCTTACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACCAGAATCGACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACATGGTTGCACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACGCTGGATTACACTCTTTCCCTACrACGACa/ 3SpC3/

P5.IDT339. Rd1x.x1

P5.IDT340. Rd1x.x1

P5.IDT341. Rd1x.x1

P5.IDT342. Rd1x.x1

P5.IDT343. Rd1x.x1

P5.IDT344. Rd1x.x1

P5.IDT345. Rd1x.x1

P5.IDT346. Rd1x.x1

P5.IDT347. Rd1x.x1

P5.IDT348. Rd1x.x1

P5.IDT349. Rd1x.x1

P5.IDT350. Rd1x.x1

P5.IDT351. Rd1x.x1

P5.IDT352. Rd1x.x1

(continued)

Single-Cell TCR Sequencing 203

Sequence

AATGATACGGCGACCACCGAGATCTACACGATGCACTACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACACCAATGCACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACGTCCTAAGACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACCCGACTATACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACTTGGTCTCACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACGCCTTGTTACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACGATACTGGACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACATTCGAGGACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACGTCAGTTGACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACGTAGAGCAACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACACGTGATGACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACTAAGTGGCACACTCTTTCCCTACrACGACa/ 3SpC3/

Name

P5.IDT353. Rd1x.x1

P5.IDT354. Rd1x.x1

P5.IDT355. Rd1x.x1

P5.IDT356. Rd1x.x1

P5.IDT357. Rd1x.x1

P5.IDT358. Rd1x.x1

P5.IDT359. Rd1x.x1

P5.IDT360. Rd1x.x1

P5.IDT361. Rd1x.x1

P5.IDT362. Rd1x.x1

P5.IDT363. Rd1x.x1

P5.IDT364. Rd1x.x1

Table 1 (continued) Notes

204 Shuqiang Li and Kenneth J. Livak

AATGATACGGCGACCACCGAGATCTACACTGTGAAGCACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACCATTCGGTACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACTTGGTGAGACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACCAGTTCTGACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACAGGCTTCTACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACGAATCGTGACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACACCAGCTTACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACCTCATTGCACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACCGATAGAGACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACTGGAGAGTACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACGTATGCTGACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACCTGGAGTAACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACAATGCCTCACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACTGAGGTGTACACTCTTTCCCTACrACGACa/ 3SpC3/

P5.IDT365. Rd1x.x1

P5.IDT366. Rd1x.x1

P5.IDT367. Rd1x.x1

P5.IDT368. Rd1x.x1

P5.IDT369. Rd1x.x1

P5.IDT370. Rd1x.x1

P5.IDT371. Rd1x.x1

P5.IDT372. Rd1x.x1

P5.IDT373. Rd1x.x1

P5.IDT374. Rd1x.x1

P5.IDT375. Rd1x.x1

P5.IDT376. Rd1x.x1

P5.IDT377. Rd1x.x1

P5.IDT378. Rd1x.x1

(continued)

Single-Cell TCR Sequencing 205

Sequence

AATGATACGGCGACCACCGAGATCTACACACATTGCGACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACTCTCTAGGACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACCGCTAGTAACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACAATGGACGACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACGATAGCGAACACTCTTTCCCTACrACGACa/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACACCGACCATTACACTCTTTCCCTACrACGACa/ 3SpC3/

CAAGCAGAAGACGGCATACGAGATCTGATCGTGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATACTCTCGAGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATTGAGCTAGGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATGAGACGATGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATCTTGTCGAGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATTTCCAAGGGTGACTGGAGTTCAGArCGTGTa/3SpC3/

Name

P5.IDT379. Rd1x.x1

P5.IDT380. Rd1x.x1

P5.IDT381. Rd1x.x1

P5.IDT382. Rd1x.x1

P5.IDT383. Rd1x.x1

P5.IDT384. Rd1x.x1

P7.IDT001. Rd2x.x1

P7.IDT002. Rd2x.x1

P7.IDT003. Rd2x.x1

P7.IDT004. Rd2x.x1

P7.IDT005. Rd2x.x1

P7.IDT006. Rd2x.x1

Table 1 (continued) Notes

206 Shuqiang Li and Kenneth J. Livak

CAAGCAGAAGACGGCATACGAGATCGCATGATGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATACGGAACAGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATCGGCTAATGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATATCGATCGGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATGCAAGATCGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATGCTATCCTGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATTACGCTACGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATTGGACTCTGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATAGAGTAGCGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATATCCAGAGGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATGACGATCTGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATAACTGAGCGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATCTTAGGACGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATGTGCCATAGTGACTGGAGTTCAGArCGTGTa/3SpC3/

P7.IDT007. Rd2x.x1

P7.IDT008. Rd2x.x1

P7.IDT009. Rd2x.x1

P7.IDT010. Rd2x.x1

P7.IDT011. Rd2x.x1

P7.IDT012. Rd2x.x1

P7.IDT013. Rd2x.x1

P7.IDT014. Rd2x.x1

P7.IDT015. Rd2x.x1

P7.IDT016. Rd2x.x1

P7.IDT017. Rd2x.x1

P7.IDT018. Rd2x.x1

P7.IDT019. Rd2x.x1

P7.IDT020. Rd2x.x1

(continued)

Single-Cell TCR Sequencing 207

Sequence

CAAGCAGAAGACGGCATACGAGATGAATCCGAGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATTCGCTGTTGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATTTCGTTGGGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATAAGCACTGGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATCCTTGATCGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATGTCGAAGAGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATACCACGATGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATGATTACCGGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATGCACAACTGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATGCGTCATTGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATATCCGGTAGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATCGTTGCAAGTGACTGGAGTTCAGArCGTGTa/3SpC3/

Name

P7.IDT021. Rd2x.x1

P7.IDT022. Rd2x.x1

P7.IDT023. Rd2x.x1

P7.IDT024. Rd2x.x1

P7.IDT025. Rd2x.x1

P7.IDT026. Rd2x.x1

P7.IDT027. Rd2x.x1

P7.IDT028. Rd2x.x1

P7.IDT029. Rd2x.x1

P7.IDT030. Rd2x.x1

P7.IDT031. Rd2x.x1

P7.IDT032. Rd2x.x1

Table 1 (continued) Notes

208 Shuqiang Li and Kenneth J. Livak

CAAGCAGAAGACGGCATACGAGATGTGAAGTGGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATCATGGCTAGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATATGCCTGTGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATCAACACCTGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATTGTGACTGGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATGTCATCGAGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATAGCACTTCGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATGAAGGAAGGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATGTTGTTCGGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATCGGTTGTTGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATACTGAGGTGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATTGAAGACGGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATGTTACGCAGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATAGCGTGTTGTGACTGGAGTTCAGArCGTGTa/3SpC3/

P7.IDT033. Rd2x.x1

P7.IDT034. Rd2x.x1

P7.IDT035. Rd2x.x1

P7.IDT036. Rd2x.x1

P7.IDT037. Rd2x.x1

P7.IDT038. Rd2x.x1

P7.IDT039. Rd2x.x1

P7.IDT040. Rd2x.x1

P7.IDT041. Rd2x.x1

P7.IDT042. Rd2x.x1

P7.IDT043. Rd2x.x1

P7.IDT044. Rd2x.x1

P7.IDT045. Rd2x.x1

P7.IDT046. Rd2x.x1

(continued)

Single-Cell TCR Sequencing 209

Sequence

CAAGCAGAAGACGGCATACGAGATGATCGAGTGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATACAGCTCAGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATGAGCAGTAGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATAGTTCGTCGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATTTGCGAAGGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATATCGCCATGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATTGGCATGTGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATCTGTTGACGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATCATACCACGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATGAAGTTGGGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATATGACGTCGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATTTGGACGTGTGACTGGAGTTCAGArCGTGTa/3SpC3/

Name

P7.IDT047. Rd2x.x1

P7.IDT048. Rd2x.x1

P7.IDT049. Rd2x.x1

P7.IDT050. Rd2x.x1

P7.IDT051. Rd2x.x1

P7.IDT052. Rd2x.x1

P7.IDT053. Rd2x.x1

P7.IDT054. Rd2x.x1

P7.IDT055. Rd2x.x1

P7.IDT056. Rd2x.x1

P7.IDT057. Rd2x.x1

P7.IDT058. Rd2x.x1

Table 1 (continued) Notes

210 Shuqiang Li and Kenneth J. Livak

CAAGCAGAAGACGGCATACGAGATAGTGGATCGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATGATAGGCTGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATTGGTAGCTGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATCGCAATCTGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATGATGTGTGGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATGATTGCTCGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATCGCTCTATGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATTATCGGTCGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATAACGTCTGGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATACGTTCAGGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATCAGTCCAAGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATTTGCAGACGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATCAATGTGGGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATACTCCATCGTGACTGGAGTTCAGArCGTGTa/3SpC3/

P7.IDT059. Rd2x.x1

P7.IDT060. Rd2x.x1

P7.IDT061. Rd2x.x1

P7.IDT062. Rd2x.x1

P7.IDT063. Rd2x.x1

P7.IDT064. Rd2x.x1

P7.IDT065. Rd2x.x1

P7.IDT066. Rd2x.x1

P7.IDT067. Rd2x.x1

P7.IDT068. Rd2x.x1

P7.IDT069. Rd2x.x1

P7.IDT070. Rd2x.x1

P7.IDT071. Rd2x.x1

P7.IDT072. Rd2x.x1

(continued)

Single-Cell TCR Sequencing 211

Sequence

CAAGCAGAAGACGGCATACGAGATGTTGACCTGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATCGTGTGTAGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATACGACTTGGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATCACTAGCTGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATACTAGGAGGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATGTAGGAGTGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATCCTGATTGGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATATGCACGAGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATCGACGTTAGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATTACGCCTTGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATCCGTAAGAGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATATCACACGGTGACTGGAGTTCAGArCGTGTa/3SpC3/

Name

P7.IDT073. Rd2x.x1

P7.IDT074. Rd2x.x1

P7.IDT075. Rd2x.x1

P7.IDT076. Rd2x.x1

P7.IDT077. Rd2x.x1

P7.IDT078. Rd2x.x1

P7.IDT079. Rd2x.x1

P7.IDT080. Rd2x.x1

P7.IDT081. Rd2x.x1

P7.IDT082. Rd2x.x1

P7.IDT083. Rd2x.x1

P7.IDT084. Rd2x.x1

Table 1 (continued) Notes

212 Shuqiang Li and Kenneth J. Livak

CAAGCAGAAGACGGCATACGAGATCACCTGTTGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATCTTCGACTGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATTGCTTCCAGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATAGAACGAGGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATGTTCTCGTGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATTCAGGCTTGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATCCTTGTAGGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATGAACATCGGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATTAACCGGTGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATAACCGTTCGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATTGGTACAGGTGACTGGAGTTCAGArCGTGTa/3SpC3/

CAAGCAGAAGACGGCATACGAGATATATGCGCGTGACTGGAGTTCAGArCGTGTa/3SpC3/

ctctttccctacacgacgctcttccgatctAACTGCACGTACCAGACATCTrGGGTTa/ 3SpC3/

ctctttccctacacgacgctcttccgatctTCATCGCTGCTCATCCTCCrAGGTGa/3SpC3/

P7.IDT085. Rd2x.x1

P7.IDT086. Rd2x.x1

P7.IDT087. Rd2x.x1

P7.IDT088. Rd2x.x1

P7.IDT089. Rd2x.x1

P7.IDT090. Rd2x.x1

P7.IDT091. Rd2x.x1

P7.IDT092. Rd2x.x1

P7.IDT093. Rd2x.x1

P7.IDT094. Rd2x.x1

P7.IDT095. Rd2x.x1

P7.IDT096. Rd2x.x1

Rd1.AV01.x1

Rd1.AV02.x1

(continued)

Amplifies TRAV2

Amplifies TRAV1-1, TRAV1-2

Single-Cell TCR Sequencing 213

ctctttccctacacgacgctcttccgatctCCTGGTTAAAGGCAGCTATGGrCTTTGc/ 3SpC3/

ctctttccctacacgacgctcttccgatctGCCGACAGAAAGTCCAGCrACTCTa/3SpC3/

ctctttccctacacgacgctcttccgatctTCTGCGCATTGCAGACACrCCAGAa/3SpC3/

ctctttccctacacgacgctcttccgatctTGAAGGTCACCTTTGATACCACCrCTTAAc/ 3SpC3/

ctctttccctacacgacgctcttccgatctCCGTGCAGCCTGAAGATTCrAGCCAa/3SpC3/

Rd1.AV03.x1

Rd1.AV04.x1

Rd1.AV05.x1

Rd1.AV06.x1

Rd1.AV07.x1

Amplifies TRAV8-1

Amplifies TRAV7

Amplifies TRAV6

Amplifies TRAV5

Amplifies TRAV4

Amplifies TRAV3

Notes

Rd1.AV14.x1

ctctttccctacacgacgctcttccgatctACCTTGTCATCTCCGCTTCArCAACTa/3SpC3/ Amplifies TRAV14/ DV4

Amplifies TRAV13-2

Amplifies TRAV12-1, TRAV12-1,TRAV12-3

Rd1.AV13-2.x1 ctctttccctacacgacgctcttccgatctTGCAGCTACTCAACCTGGArGACTCc/3SpC3/

ctctttccctacacgacgctcttccgatctCAGTGATTCAGCCACCTACCTrCTGTGa/ 3SpC3/

Rd1.AV12.x1

Amplifies TRAV10

Amplifies TRAV13-1

ctctttccctacacgacgctcttccgatctCACAAAGCAAAGCTCTCTGCArCATCAa/ 3SpC3/

Rd1.AV10.x1

Amplifies TRAV9-1, TRAV9-2

Rd1.AV13-1.x1 ctctttccctacacgacgctcttccgatctACAAGACAGCCAAACATTTCTCCrCTGCAa/ 3SpC3/

ctctttccctacacgacgctcttccgatctGAAACCACTTCTTTCCACTTGGArGAAAGc/ 3SpC3/

Rd1.AV9.x1

Rd1.AV08-3.x1 ctctttccctacacgacgctcttccgatctGGAAACCCTCTGTGCATTGGrAGTGAc/3SpC3/ Amplifies TRAV8-3

Rd1.AV08-2/4/ ctctttccctacacgacgctcttccgatctAAGGACTCCAGCTTCTCCTGrAAGTAg/3SpC3/ Amplifies TRAV8-2, 6.x1 TRAV8-4,TRAV8-6

Rd1.AV08-1.x1 ctctttccctacacgacgctcttccgatctTGGTCAACACCTTCAGCTTCTrCCTCAc/ 3SpC3/

Sequence

Name

Table 1 (continued)

214 Shuqiang Li and Kenneth J. Livak

ctctttccctacacgacgctcttccgatctCAGTTCCTTCCACCTGGAGArAGCCCa/3SpC3/ Amplifies TRAV18

ctctttccctacacgacgctcttccgatctCACAGCCTCACAAGTCGTGrGACTCc/3SpC3/

ctctttccctacacgacgctcttccgatctCTGCACATCACAGCCCCTArAACCTa/3SpC3/

ctctttccctacacgacgctcttccgatctACATTGCAGCTTCTCAGCCTrGGTGAa/3SpC3/ Amplifies TRAV21

ctctttccctacacgacgctcttccgatctTCCTCTTCCCAGACCACAGArCTCAGa/3SpC3/ Amplifies TRAV22

ctctttccctacacgacgctcttccgatctGATTCCCAGCCTGGAGACTCrAGCCAa/3SpC3/ Amplifies TRAV23/ DV6

ctctttccctacacgacgctcttccgatctGTACATCAAAGGATCCCAGCCTrGAAGAa/ 3SpC3/

ctctttccctacacgacgctcttccgatctGCCACCCAGACTACAGATGTrAGGAAa/3SpC3/ Amplifies TRAV25

Rd1.AV18.x2

Rd1.AV19.x1

Rd1.AV20.x1

Rd1.AV21.x1

Rd1.AV22.x1

Rd1.AV23.x1

Rd1.AV24.x1

Rd1.AV25.x1

Amplifies TRAV26-1

Amplifies TRAV24

Amplifies TRAV20

ctctttccctacacgacgctcttccgatctTGCAAGAAAGGACAGTTCTCTCCrACATCc/ 3SpC3/

ctctttccctacacgacgctcttccgatctTGGAGACTCTGCAGTGTACTTCTrGTGCAa/ 3SpC3/

ctctttccctacacgacgctcttccgatctGCAAAGCTCCCTGTACCTTACGrGCCTCa/ 3SpC3/

ctctttccctacacgacgctcttccgatctCCAGCCATGCAGGCATCTArCCTCTa/3SpC3/

ctctttccctacacgacgctcttccgatctGCATCCATACCTAGTGATGTAGGCrATCTAa/ 3SpC3/

ctctttccctacacgacgctcttccgatctAGCATCCTGAACATCACAGCCrACCCAa/ 3SpC3/

Rd1.AV27.x1

Rd1.AV29.x1

Rd1.AV30.x1

Rd1.AV34.x1

Rd1.AV35.x1

Rd1.AV36.x1

(continued)

Amplifies TRAV36/ DV7

Amplifies TRAV35

Amplifies TRAV34

Amplifies TRAV30

Amplifies TRAV29/ DV5

Amplifies TRAV27

Rd1.AV26-2.x1 ctctttccctacacgacgctcttccgatctTGGCAATCGCTGAAGACAGArAAGTCa/3SpC3/ Amplifies TRAV26-2

Rd1.AV26-1.x1 ctctttccctacacgacgctcttccgatctCGCTACGCTGAGAGACACTrGCTGTa/3SpC3/

ctctttccctacacgacgctcttccgatctAGTCACGCTTGACACTTCCArAGAAAc/3SpC3/ Amplifies TRAV17

Rd1.AV17.x1

Amplifies TRAV19

ctctttccctacacgacgctcttccgatctGGCGAGACATCTTTCCACCTrGAAGAc/3SpC3/ Amplifies TRAV16

Rd1.AV16.x1

Single-Cell TCR Sequencing 215

ctctttccctacacgacgctcttccgatctTGCATGACCTCTCTGCCACrCTACTc/3SpC3/

ctctttccctacacgacgctcttccgatctCCCCCATTGTGAAATATTCAGTCCrAGGTAc/ 3SpC3/

ctctttccctacacgacgctcttccgatctCCCATCCCAGAGACTCTGCrCGTCTc/3SpC3/

ctctttccctacacgacgctcttccgatctTCTGAAGATCCGGTCCACAAAGrCTGGAa/ 3SpC3/

ctctttccctacacgacgctcttccgatctCAATTCCCTGGAGCTTGGTGArCTCTGa/ 3SpC3/

ctctttccctacacgacgctcttccgatctTCTCACCTGAATGCCCCAACrAGCTCc/3SpC3/ Amplifies TRBV4-1, TRBV4-2,TRBV4-3

Rd1.AV39.x1

Rd1.AV40.x2

Rd1.AV41.x1

Rd1.BV02.x1

Rd1.BV03.x1

Rd1.BV04.x1

Amplifies TRBV6-1, TRBV6-2,TRBV6-3, TRBV6-4,TRBV6-5, TRBV6-6

Rd1.BV061to6.x1

Rd1.BV07-2/6. ctctttccctacacgacgctcttccgatctCTCCACTCTGACGATCCAGCrGCACAa/3SpC3/ Amplifies TRBV7-2, x1 TRBV7-6

Rd1.BV06-8/9. ctctttccctacacgacgctcttccgatctCCTGGTATCGACAAGACCCAGrGCATGa/ x1 3SpC3/

Amplifies TRBV6-8, TRBV6-9

Amplifies TRBV5-4, TRBV5-5,TRBV5-6, TRBV5-7,TRBV5-8

Rd1.BV05-4/5/ ctctttccctacacgacgctcttccgatctCTCTGAGCTGAATGTGAACGCrCTTGGc/ 6/8.x1 3SpC3/

ctctttccctacacgacgctcttccgatctACATCTGTGTACTTCTGTGCCAGrCAGTGc/ 3SpC3/

Amplifies TRBV5-1

Rd1.BV05-1.x1 ctctttccctacacgacgctcttccgatctCGCTCTGAGATGAATGTGAGCArCCTTGa/ 3SpC3/

Amplifies TRBV3-1, TRBV3-2

Amplifies TRBV2

Amplifies TRAV41

Amplifies TRAV40

Amplifies TRAV39

Amplifies TRAV38-1, TRAV38-2

ctctttccctacacgacgctcttccgatctGCAGCCAAATCCTTCAGTCTCArAGATCc/ 3SpC3/

Rd1.AV38.x1

Notes

Sequence

Name

Table 1 (continued)

216 Shuqiang Li and Kenneth J. Livak

Amplifies TRBV7-4, TRBV7-6,TRBV7-7 Amplifies TRBV7-8 Amplifies TRBV7-9 Amplifies TRBV9

Rd1.BV07-4/6/ ctctttccctacacgacgctcttccgatctCGGTTCTCTGCAGAGAGGCrCTGAGt/3SpC3/ 7.x1

Rd1.BV07-8.x1 ctctttccctacacgacgctcttccgatctGGATCCGTCTCCACTCTGAAGrATCCAa/ 3SpC3/

Rd1.BV07-9.x1 ctctttccctacacgacgctcttccgatctTCCACCTTGGAGATCCAGCrGCACAa/3SpC3/

Rd1.BV09.x1

Amplifies TRBV10-3 Amplifies TRBV11-1, TRBV11-2,TRBV11-3

Rd1.BV10-3.x1 ctctttccctacacgacgctcttccgatctGCTACCAGCTCCCAGACATrCTGTGc/3SpC3/

ctctttccctacacgacgctcttccgatctAGGCTCAAAGGAGTAGACTCCArCTCTCc/ 3SpC3/

ctctttccctacacgacgctcttccgatctATCCAGCCCTCAGAACCCrAGGGAa/3SpC3/

ctctttccctacacgacgctcttccgatctGAACTGAACATGAGCTCCTTGGArGCTGGa/ 3SpC3/

ctctttccctacacgacgctcttccgatctCTACTCTGAAGGTGCAGCCTrGCAGAc/3SpC3/ Amplifies TRBV14

ctctttccctacacgacgctcttccgatctCAGGAGGCCGAACACTTCTTTrCTGCTc/ 3SpC3/

ctctttccctacacgacgctcttccgatctACGAAGCTTGAGGATTCAGCArGTGTAc/ 3SpC3/

ctctttccctacacgacgctcttccgatctGCATCCTGAGGATCCAGCArGGTAGc/3SpC3/

ctctttccctacacgacgctcttccgatctCCAAAAGAACCCGACAGCTTTCTrATCTCc/ 3SpC3/

Rd1.BV11.x1

Rd1.BV12.x1

Rd1.BV13.x1

Rd1.BV14.x1

Rd1.BV15.x1

Rd1.BV16.x1

Rd1.BV18.x1

Rd1.BV19.x1

(continued)

Amplifies TRBV19

Amplifies TRBV18

Amplifies TRBV16

Amplifies TRBV15

Amplifies TRBV13

Amplifies TRBV12-3, TRBV12-4,TRBV12-5

Amplifies TRBV10-2

Rd1.BV10-2.x1 ctctttccctacacgacgctcttccgatctCCCCTCACTCTGGAGTCAGrCTACCa/3SpC3/

Rd1.BV10-1.x1 ctctttccctacacgacgctcttccgatctCCTCACTCTGGAGTCTGCTGrCCTCCa/3SpC3/ Amplifies TRBV10-1

ctctttccctacacgacgctcttccgatctACGATTCTCCGCACAACAGTTrCCCTGc/ 3SpC3/

Amplifies TRBV7-3

Rd1.BV07-3.x1 ctctttccctacacgacgctcttccgatctCTACTCTGAAGATCCAGCGCArCAGAGa/ 3SpC3/

Single-Cell TCR Sequencing 217

ctctttccctacacgacgctcttccgatctTCTCCCTGTCCCTAGAGTCTGrCCATCa/ 3SpC3/

ctctttccctacacgacgctcttccgatctACAGTCTCCAGAATAAGGACGGArGCATTc/ 3SpC3/

ctctttccctacacgacgctcttccgatctCCCCAACCAGACCTCTCTGTArCTTCTa/ 3SpC3/

ctctttccctacacgacgctcttccgatctCCAGCACCAACCAGACATCTrATGTAa/3SpC3/ Amplifies TRBV28

ctctttccctacacgacgctcttccgatctGAGCAACATGAGCCCTGAAGArCAGCAa/ 3SpC3/

ctctttccctacacgacgctcttccgatctCTCTCAGCCTCCAGACCCrCAGGAa/3SpC3/

gtgactggagttcagacgtgtgctcttccgatctTCAGCTGGTACACGGCArGGGTCt/ 3SpC3/

gtgactggagttcagacgtgtgctcttccgatctTCTCTGCTTCTGATGGCTCArAACACc/ 3SpC3/

AATGATACGGCGACCACCGAGATCTACAC

CAAGCAGAAGACGGCATACGAGAT

Rd1.BV24.x1

Rd1.BV25.x1

Rd1.BV27.x1

Rd1.BV28.x1

Rd1.BV29.x1

Rd1.BV30.x1

Rd2.AC.x1

Rd2.BC.x1

P5

P7

Amplifies TRBV30

Amplifies TRBV29-1

Amplifies TRBV27

Amplifies TRBV25-1

Amplifies TRBV24-1

ctctttccctacacgacgctcttccgatctCAGTGCCCATCCTGAAGACArGCAGCc/3SpC3/ Amplifies TRBV20-1

Rd1.BV20.x1

Notes

Sequence

Name

Table 1 (continued)

218 Shuqiang Li and Kenneth J. Livak

Single-Cell TCR Sequencing

219

16. dNTPs: Mix of 25 mM dATP, 25 mM dCTP, 25 mM dGTP, and 25 mM TTP. Store at 20  C. 17. Rd1.AV.x1–Rd1.BV.x1 primer mix: Mix of 69 rhPCR primers at a concentration of 5 μM each. These primers are specific for the V segments of the human alpha and beta TCR genes and are designed to amplify all productive alpha and beta alleles. The sequences are in Table 1. Store at 20  C. 18. Rd2.AC.x1–Rd2.BC.x1 primer mix: Mix of two rhPCR primers at a concentration of 5 μM each. These primers are specific for the C segments of the human alpha and beta TCR genes. The sequences are in Table 1. Store at 20  C. 19. Hot start Taq DNA polymerase: 5 units/μL. Store at

20  C.

20. AMPure XP beads: Beckman Coulter A63880. 21. Beads Buffer: 2.5 M NaCl, 20% polyethylene glycol (PEG). 22. Magnetic stand for 1.5-mL Eppendorf tube. 23. 10 μM P5 primer: sequence in Table 1. 24. 10 μM P7 primer: sequence in Table 1. 25. 2 Hot start high fidelity PCR master mix. Store at

20  C.

26. Agilent HS DNA BioAnalyzer. 27. Illumina sequencer.

3

Methods

3.1 Preparation of Single-Cell cDNA Libraries (See Note 2)

1. Dry sort single cells into a 96-well PCR plate. Immediately centrifuge the plate at 800  g for 1 min at 4  C and place on dry ice. Store the plate at 80  C. 2. On ice, dilute 800 units/mL (20 mg/mL) proteinase K 1:10 by mixing 3 μL with 27 μL Prionex. 3. On ice, combine 12 μL 10 NEBNext Cell Lysis Buffer, 6 μL Murine RNase Inhibitor, 24 μL diluted 80 units/mL proteinase K in Prionex, 24 μL NEBNext Single Cell RT Primer Mix, and 174 μL H2O. Dispense 2 μL to each of the wells in the 96-well plate. Vortex vigorously and collect samples by centrifugation. 4. Transfer plate to a thermal cycler. Run protocol: 50  C for 30 min, 72  C for 5 min, hold at 4  C. 5. On ice, combine 120 μL NEBNext Single Cell RT Buffer, 9.6 μL 25 mM AAPV protease inhibitor, 24 μL NEBNext Template Switching Oligo, 48 μL NEBNext Single Cell RT Enzyme Mix, and 38.4 μL H2O. Add 2 μL to each well. Gently vortex and collect by centrifugation.

220

Shuqiang Li and Kenneth J. Livak

6. Transfer plate to a thermal cycler. Run protocol: 42  C for 90 min, 70  C for 10 min, and hold at 4  C. 7. On ice, combine 1200 μL NEBNext Single Cell cDNA PCR Master Mix, 48 μL NEBNext Single Cell cDNA PCR Primer, and 672 μL H2O. Add 16 μL to each well. Gently vortex and collect by centrifugation. 8. Transfer plate to a thermal cycler. Run protocol: 98  C for 45 s, 22 cycles of (98  C for 10 s, 62  C for 15 s, 72  C for 3 min), 72  C for 5 min, hold at 4  C. 9. At room temperature, add 21 μL ProNex beads to each well and incubate at room temperature for 10 min. Place the plate in 96-well magnetic stand, wait for 2 min for beads to collect, then discard supernatants. With plate remaining in the magnetic stand, wash the beads by adding 100 μL Promega Wash Buffer per well, waiting for 30 s, and discarding the supernatants. Repeat this wash step one time. After air-drying the beads for 10 min, elute with 17 μL Promega Elution Buffer. Transfer 15 μL from each well to a fresh plate. Store at 20  C. 10. The fragment size distribution of one or more of the cDNA libraries can be measured using the Agilent HS DNA BioAnalyzer or similar instrumentation. Figure 1 shows a typical profile analyzing 1 μL of a 1:10 diluted cDNA library. 11. Determine the DNA concentration of each cDNA library (see Note 3). Normalize the libraries to approximately 0.15 ng/μL (range 0.1–0.2 ng/μL) by combining an aliquot of each library with the appropriate volume of DNA Suspension Buffer in a fresh 96-well plate. Store at 20  C.

Fig. 1 Bioanalyzer profile of single-cell cDNA library prepared as described in Subheading 3.1. The x-axis is the size of DNA fragments in bp; the y-axis is arbitrary fluorescence units

Single-Cell TCR Sequencing

221

Start with single-cell, full-length cDNA library

TRBC

TRBV

69 rhPCR primers

2 rhPCR primers TRAC

TRAV

V

(D)

J

C

Pool samples & perform P5/P7 PCR

Fig. 2 Diagram of targeted amplification and barcode addition on a template derived from a TCR transcript 3.2 Targeted Amplification of TCR Segments

As depicted in Fig. 2, this protocol achieves targeted amplification of TCR alleles and single-cell barcoding in a single PCR step by exploiting the specificity of rhPCR technology [5]. In this method, inclusion of a single ribo residue in each PCR primer and the use of thermostable RNase H2 in the amplification reaction means that a functional primer is generated only when the oligonucleotide is hybridized to its intended target. In order to avoid the problem of index switching, this protocol uses dual indexing [6, 7] to encode the identity of each cell. For processing a 96-plate of single cells, there are 96 barcodes for index 1 and 96 barcodes for index 2. The sequences of all primers (Integrated DNA Technologies, Coralville, IA) used in the protocol are provided in Table 1. 1. Per well of a 96-well plate on ice, combine 2 μL (approximately 300 pg) of cDNA library material (from step 11 in Subheading 3.1) with 2 μL of a barcode primer mix containing rhPCR primer P5.IDT***.Rd1x.x1 and rhPCR primer P7.IDT***. Rd2x.x1. For example, well A1 receives P5.IDT289.Rd1x.x1 and P7.IDT001.Rd2x.x1. Vortex and collect by centrifugation. 2. Dilute RNase H2 to 20 mU/μL by mixing 1 μL 2 U/μL RNase H2 Enzyme with 99 μL RNase H2 Dilution Buffer. Keep on ice. 3. On ice, combine 10.8 μL 1 M Tris–HCl, pH 8.4, 18 μL 1 M KCl, 2.9 μL 1 M MgCl2, 11.5 μL 25 mM each dNTP, 7.2 μL Rd1.AV.x1–Rd1.BV.x1 primer mix, 7.2 μL Rd2.AC.x1/Rd2. BC.x1 primer mix, 18 μL diluted 20 mU/μL RNase H2, 28.8 μL 5 units/μL hot start Taq DNA polymerase (see Note 4), and 135.6 μL H2O. Add 2 μL to each of the 96 wells. Gently vortex and collect by centrifugation. 4. Transfer plate to a thermal cycler. Run protocol: 95  C for 5 min, 18 cycles of (96  C for 20 s, 60  C for 6 min), and hold at 4  C.

222

Shuqiang Li and Kenneth J. Livak

5. Pool 2 μL of each sample (192 μL final volume). Store remainder of samples at 20  C. At room temperature, add 19.2 μL AMPure XP beads and 96 μL Beads Buffer to the pooled sample. Incubate at room temperature for 5 min, then place in magnetic stand. After 2 min to allow beads to collect, transfer supernatant to a fresh tube. Add 6.4 μL AMPure XP beads plus 32 μL Beads Buffer and incubate at room temperature for 5 min. Place tube in magnetic stand, wait for 2 min for beads to collect, then discard supernatant. With tube remaining in the magnetic stand, wash the beads by adding 500 μL freshly prepared 80% ethanol, waiting for 30 s, and discarding the supernatant. Repeat this wash step one time. After air-drying the beads for 5 min, elute by adding 21 μL DNA Suspension Buffer and transferring 20 μL eluate to a fresh tube. 6. Clean up again by adding 16 μL AMPure XP beads and incubating for 5 min at room temperature. Place tube in magnetic stand, wait for 2 min for beads to collect, then discard supernatant. With tube remaining in the magnetic stand, wash the beads by adding 100 μL freshly prepared 80% ethanol, waiting for 30 s, and discarding the supernatant. Repeat this wash step one time. After air-drying the beads for 5 min, elute with 20 μL DNA Suspension Buffer. Store at 20  C. 7. On ice, combine 5 μL PCR product from step 6, 2.5 μL 10 μM P5 primer, 2.5 μL 10 μM P7 primer, 25 μL hot start high fidelity PCR master mix (see Note 5), and 15 μL H2O in a PCR tube. Gently vortex and collect by centrifugation. 8. Transfer sample to a thermal cycler. Run protocol: 98  C for 30 s, 12 cycles of (98  C for 10 s, 62  C for 2 min), 75  C for 2 min, and hold at 4  C. 9. At room temperature, add 40 μL AMPure XP beads and incubate at room temperature for 5 min. Place tube in magnetic stand, wait for 2 min for beads to collect, then discard supernatant. With tube remaining in the magnetic stand, wash the beads by adding 100 μL freshly prepared 80% ethanol, waiting for 30 s, and discarding the supernatant. Repeat this wash step one time. After air-drying the beads for 5 min, elute with 20 μL DNA Suspension Buffer. Store at 20  C. 10. Use 1 μL of the purified PCR product to measure the fragment size distribution and estimate concentration using the Agilent HS DNA BioAnalyzer or similar instrumentation. Figure 3 shows a typical profile. 11. Sequence the library on an Illumina sequencer using pairedend reads (see Note 6). Read 1 needs to be 250 nt or longer in order to capture CDR3 information. 12. The details of data processing are beyond the scope of this protocol. Identification of CDR3 sequences and of alpha and

Single-Cell TCR Sequencing

223

Fig. 3 Bioanalyzer profile of targeted TCR library from 96 human CD3+ T cells prepared as described in Subheading 3.2. The x-axis is the size of DNA fragments in bp; the y-axis is arbitrary fluorescence units Table 2 Results for detecting complete CDR3 sequences for both TCR alpha and TCR beta in single cells from the analysis of 96 human CD3+ T cells Both alpha and beta

Alpha or beta

Multiple cells or contamination

Failed

70

7

11

8

beta V and J alleles is done using the program MiXCR [8]. Results from the analysis of 96 human CD3+ T cells are shown in Table 2.

4

Notes 1. The protocol can be adapted to use AMPure XP beads. 2. This protocol is written using the reagents from the NEBNext Single Cell/Low Input RNA Library Prep Kit because this provides the simplest workflow. Smart-seq2 cDNA libraries prepared following the original protocol of Picelli et al. [9], the modified protocol of Trombetta et al. [10] or the SMARTSeq v4 Ultra Low Input RNA Kit for Sequencing from Takara can also be used for the targeted TCR amplification protocol in Subheading 3.2. 3. We have used the Quant-iT High Sensitivity dsDNA Assay Kit (Thermo Fisher Q33120). Any DNA quantification method should be suitable as long as its detection limit is 0.1 ng/μL or lower.

224

Shuqiang Li and Kenneth J. Livak

4. We have used Hot Start Taq DNA Polymerase from New England BioLabs (M0495L). Other nonproofreading hot start Taq DNA polymerases should work as well. 5. We have used Q5 Hot Start HiFi PCR Master Mix from New England BioLabs (M0543L). Other hot start high fidelity PCR master mixes should work as well, but may require adjusting the PCR hot start, denaturation, and annealing temperatures and times. 6. We sequence on the MiSeq using the 300-cycle kit. Read lengths are: 248 nt for read 1, 8 nt for index 1, 8 nt for index 2, and 48 nt for read 2. By changing the Illumina-specific segments in the primers to the appropriate sequences, it may be possible to adapt this protocol to sequencers from other vendors.

Acknowledgments We thank Jing Sun and Rosa Allesøe for their help in analyzing the sequencing data. This work was supported by Dana-Farber Cancer Institute. References 1. Becattini S, Latorre D, Mele F, Foglierini M, De Gregorio C, Cassotta A, Fernandez B, Kelderman S, Schumacher TN, Corti D, Lanzavecchia A, Sallusto F (2015) T cell immunity. Functional heterogeneity of human memory CD4+ T cell clones primed by pathogens or vaccines. Science 347:400–406 2. Gajewski TF, Schreiber H, Fu YX (2013) Innate and adaptive immune cells in the tumor microenvironment. Nat Immunol 14:1014–1022 3. Stubbington MJT, Lo¨nnberg T, Proserpio V, Clare S, Speak AO, Dougan G, Teichmann SA (2016) T cell fate and clonality inference from single-cell transcriptomes. Nat Methods 13:329–332 4. Han A, Glanville J, Hansmann L, Davis MM (2014) Linking T-cell receptor sequence to functional phenotype at the single-cell level. Nat Biotechnol 32:684–692 5. Dobosy JR, Rose SD, Beltz KR, Rupp SM, Powers KM, Behlke MA, Walder JA (2011) RNase H-dependent PCR (rhPCR): improved specificity and single nucleotide polymorphism detection using blocked cleavable primers. BMC Biotechnol 11:80

6. Kircher M, Sawyer S, Meyer M (2012) Double indexing overcomes inaccuracies in multiplex sequencing on the Illumina platform. Nucleic Acids Res 40:e3 7. MacConaill LE, Burns RT, Nag A, Coleman HA, Slevin MK, Giorda K, Light M, Lai K, Jarosz M, McNeill MS, Ducar MD, Meyerson M, Thorner AR (2018) Unique, dual-indexed sequencing adapters with UMIs effectively eliminate index cross-talk and significantly improve sensitivity of massively parallel sequencing. BMC Genomics 19:30 8. Bolotin DA, Poslavsky S, Mitrophanov I, Shugay M, Mamedov IZ, Putintseva EV, Chudakov DM (2015) MiXCR: software for comprehensive adaptive immunity profiling. Nat Methods 12:380–381 ˚ K, 9. Picelli S, Faridani OR, Bjo¨rklund A Winberg G, Sagasser S, Sandberg R (2014) Full-length RNA-seq from single cells using Smart-seq2. Nat Protoc 9:171–181 10. Trombetta JJ, Gennert D, Lu D, Satija R, Shalek AK, Regev A (2014) Preparation of singlecell RNA-Seq libraries for next generation sequencing. Curr Protoc Mol Biol 107:4.22.1–4.2217

Part III Single Cell Genomic and Epigenomic Analysis

Chapter 14 Sequencing the Genomes of Single Cells Veronica Gonzalez-Pena and Charles Gawad Abstract Single-cell genome sequencing can detect low-frequency genetic alterations present in complex tissues. However, the experimental procedures are technically challenging. This includes dissociation of the tissue, isolation of single cells, whole-genome amplification, sequencing library preparation, and an optional target enrichment. Here we describe how to perform each of these processes to obtain high-quality single-cell genome sequencing data. Key words Single-cell isolation, Genomics, Sequencing library preparation, WGA, Whole-genome amplification (WGA), Target enrichment, MDA, DOP-PCR

1

Introduction Sequencing the genomes of small numbers of immune cells requires whole-genome amplification prior to sequencing library preparation. This may be necessary when working with sorted populations of rare immune cell subsets [1], immune cells infiltrating tissues such as tumors [2, 3], or when sequencing the genomes of single normal or malignant immune cells [4]. This process generally requires three steps that are driven by the hypothesis being tested. The first step is isolating the cells of interest. Depending on the number of cells available, as well as the number that will be analyzed, this can be accomplished with manual manipulation, flow-activated cell sorting (FACS), or isolation in a microfluidic device. The second step is amplifying the genomes of the isolated cells. There are now a number of whole-genome amplification methods available, so the method chosen for a given experiment will depend on whether the question requires the detection of large regions of copy number variation (CNV) or smaller regions of nucleotide variation such as single nucleotide variants (SNV) or indels. The final step is to select how the amplification products will be interrogated. This, again, should be tailored to the questions that

Valentina Proserpio (ed.), Single Cell Methods: Sequencing and Proteomics, Methods in Molecular Biology, vol. 1979, https://doi.org/10.1007/978-1-4939-9240-9_14, © Springer Science+Business Media, LLC, part of Springer Nature 2019

227

228

Veronica Gonzalez-Pena and Charles Gawad

the study is trying to answer. The amplification products generally undergo low-pass whole-genome sequencing for CNV detection. For SNV detection, the samples can undergo whole-genome sequencing, but investigators generally focus on coding regions using target enrichment.

2 2.1

Materials Cell Isolation

Most methods of cell isolation from solid tissues comprise both mechanical and enzymatic dissociation. Specific enzyme combinations and dissociation times should be optimized and selected based on optimal viable cell yield and representation of expected cell populations or cell type of interest. 1. For cryopreserved suspension cells: ThawStar automated cellthawing system. 2. For solid tissue cells: Tissue dissociation enzymes or Miltenyi tissue dissociation kit and heated shaker or gentleMACS Dissociator System. 3. PluriStrainer cell strainer (PluriSelect). 4. Washing buffer (PBS with 1% BSA). 5. Fluorescence-based cell counter (Luna FL cell counter or similar). 6. Single cell isolation device (Micromanipulator, FACS sorter, microfluidic device).

2.2 Whole-Genome Amplification (WGA)

The method chosen to amplify the genomes of single cells depends on whether the experiment is designed to detect CNV or SNV. There are a number of different technologies on the market, but we have included the kits that we recommend for each of these applications. 1. For evaluating CNV, we recommend a PCR-based wholegenome amplification method such as DOP-PCR from Sigma or PicoPlex from Takara. 2. For detecting SNV or indels, we recommend using multiple displacement amplification (MDA) with either Qiagen REPLIg Single-Cell or GE GenomiPhi V2 kit. 3. Agencourt AMPure XP beads for purifying amplified DNA. 4. EB Buffer (Qiagen). 5. Fluorometer for DNA quantification (Qubit or similar). 6. 1% agarose gel or BioAnalyzer for DNA size determination. 7. Appropriate magnetic Stand.

Single-Cell Genome Sequencing

2.3 Sequencing Library Preparation

229

There are a variety of commercially available kits that provide the reagents necessary to perform all steps of library construction (DNA fragmentation, end-preparation, adapter ligation, and library amplification). We recommend using the KAPA HyperPlus Library Preparation kit for its simplified workflow and compatibility with low-input samples. 1. KAPA HyperPlus Library Preparation kit (Roche). 2. We recommend ordering sequencing adapters from Illumina (illumina.com) or Integrated DNA Technologies (www.idtdna. com). 3. Agencourt AMPure XP beads for purifying libraries. 4. Qubit or similar fluorometer for library quantification. 5. 1% agarose gel or BioAnalyzer for DNA size determination.

2.4 Library Enrichment (Optional)

Targeted library enrichment encompasses a variety of methodologies that have been developed to selectively isolate genomic regions of interest, ranging from whole exomes to small panels of single nucleotide polymorphisms (SNPs). This step, while optional, is a cost-effective way to increase depth of coverage and uniformity across the regions of interest. 1. For exome or targeted panel enrichment, we recommend xGen Capture Oligonucleotides and Enrichment Reagents from Integrated DNA Technologies (www.idtdna.com). 2. KAPA HiFi HotStart ReadyMix (Roche). 3. Agencourt AMPure XP beads for purifying libraries. 4. Qubit or similar fluorometer for DNA quantification. 5. 1% agarose gel or BioAnalyzer for DNA size determination.

3 3.1

Methods Cell Isolation

1. The first step in performing single-cell sequencing is to obtain a single-cell suspension from freshly collected or cryopreserved suspension cells. Please note that special precautions should be taken when thawing cryopreserved cells as inadequate handling will lead to significant cell death/loss (see Note 1). Alternatively, single cell suspensions can be obtained from solid tissues by performing enzymatic digestion. Tissue should be dissociated per the manufacturer’s protocol for that specific tissue (see Notes 2 and 3). 2. Cells then need to be washed and filtered prior to isolation: (a) Wash cells once in 5 mL of Washing buffer and pelleting at 300  g.

230

Veronica Gonzalez-Pena and Charles Gawad

(b) Discard supernatant. (c) Wash three more times in 1 mL of washing buffer, removing 900 μL of the supernatant each time the cells are pelleted. (d) Resuspend cells after the last wash and filter solution to remove large cell clumps and debris (see Notes 4 and 5). (e) Cells should be pelleted one final time at 150  g. Ninehundred microliters of PBS should be removed, and the cells should be resuspended in the remaining 100 μL. 3. Count cells and confirm that viability is greater than 90% (see Note 3). 4. The most commonly used methods for isolating cells are manual manipulation methods such as micropipetting, FACS, limiting dilution, microwell dilution, and valve or droplet microfluidic-based isolation. Detailed descriptions of these methods are beyond the scope of this chapter, as each of these methods requires specialized equipment and training. For more details, please see these recent review articles [5–7] (see Note 6). 5. Perform single cell isolation using the method that will best allow you to address the question that you are trying to answer and the number of input cells available (see Note 6). 3.2 Whole-Genome Amplification

Extreme care should be taken when working with reagents that will be included in the whole-genome amplification, as minute quantities of contaminating DNA will be amplified in the reaction. Ultrapure reagents tested for contaminating DNA should be used. In addition, reagents that do not contain oligonucleotides or proteins, such as buffers and plasticware, can be treated with UV light [8]. 1. The volume of solution each cell is isolated in should be taken into account, and adjusted as necessary based on the manufacturer’s instructions for the WGA method being used. 2. Perform the whole-genome amplification following manufacturer’s instructions. 3. Clean up the DNA using Ampure XP beads with a 2:1 beadsto-sample ratio to isolate most fragments that are larger than 125 bp. 4. Add 100 μL of thoroughly resuspended, room-temperature AMPure XP beads to 50 μL of sample and mix well. 5. Incubate at room temperature for 10 min and then place on magnetic stand for 2 min or until solution clears. 6. Discard supernatant and wash beads twice with 200 μL of freshly prepared 80% ethanol. 7. Discard ethanol and allow the beads to air-dry for 5 min.

Single-Cell Genome Sequencing

231

8. Elute DNA from beads with 52 μL of EB Buffer. Place tube on magnetic stand and transfer 50 μL of the eluted DNA to a new tube while avoiding bead carryover (see Note 7). 9. Quantify DNA using fluorometer and run amplification products on a gel or BioAnalyzer to determine the size (see Note 8). 3.3 Sequencing Library Preparation

1. If the product is of the expected size distribution, dilute the DNA to 3 ng/μL and add 35 μL to the fragmentation reaction. Follow manufacturer’s instructions and fragment for 30 min (see Note 9). 2. Follow manufacturer’s instruction for library preparation. We recommend using 15 μM adapter concentration and 8–10 cycles of PCR (see Notes 10 and 11). 3. After PCR amplification, clean up the reaction using equal volume of Ampure XP beads to sample per manufacturer’s instructions and elute in 30 μL. 4. Quantify DNA using fluorometer and run amplification products on a gel or BioAnalyzer to determine the size. The ideal library has a Gaussian distribution with most fragments between 200 and 700 bp (see Fig. 1). 5. The libraries are now ready to be sequenced if whole-genome sequencing is being performed. If the library will be enriched for specific genomic regions, continue to Subheading 3.4.

Fig. 1 BioAnalyzer trace of a library with an ideal size distribution obtained using a high sensitivity chip

232

Veronica Gonzalez-Pena and Charles Gawad

Fig. 2 Example of a typical BioAnalyzer trace of a postcapture library using a DNA 1000 chip 3.4 Target Enrichment

1. Pool 250 ng of each library (up to 12 libraries, and up to 3 μg total per pool) into a single tube. 2. Follow xGen Lockdown for hybridization and washing protocol (see Notes 12 and 13). 3. Perform PCR using KAPA HiFi HotStart ReadyMix with the library amplification primers provided in the KAPA HyperPlus Kit (Roche) (see Note 14). 4. After PCR amplification, clean up using equal volume of Ampure XP beads per manufacturer’s instructions and elute the enriched library in 30 μL of EB buffer. 5. Quantify DNA using fluorometer and run amplification products on a gel or BioAnalyzer to determine the size. The ideal post-capture library has a Gaussian distribution with a narrower distribution than before capture with most fragments now between 200 and 500 bp (see Fig. 2). 6. The target-enriched libraries are now ready to be sequenced (see Note 15).

4

Notes 1. We recommend ThawSTAR system from Astero Bio, as we have found the automated thawing procedure results in higher cell viability than conventional thawing methods. 2. There are many tissue dissociation protocols available. We recommend consulting protocols from Worthington Biochemical (www.worthington-biochem.com) and Miltenyi Biotec (www. miltenyibiotec.com).

Single-Cell Genome Sequencing

233

3. We recommend counting and measuring the viability of the cells using a system with a fluorescence-based viability reporter, such as the LUNA-FL counter from Logos Biosystems (http://logosbio.com) or similar. 4. We recommend the 10, 20, or 30 micron PluriStrainer filters (PluriSelect) depending on the diameter of the cells being used. 5. Cells should be examined to insure that cell clumps and cell debris are removed from the cell suspension as these can result in carryover contamination and clogging of microfluidic devices. 6. Some cell isolation strategies are not compatible with small number of input cells. Manual manipulation, FACS, and dilutional methods allow for small numbers of input cells, while microfluidic-based methods generally require thousands or tens of thousands of input cells. 7. The beads-to-sample volume ratio can be adjusted if the aim is to examine smaller or larger fragments. Elution volume will need to be adjusted based on the yield of the method being used. We recommend eluting in a volume greater than 20 μL in an elution buffer that does not contain EDTA as this inhibits DNA fragmentation. 8. Correct size distribution will depend on the WGA method utilized. Refer to the manufacturer’s instructions in the kit for the correct size distribution. 9. Fragmentation time may need to be adjusted depending on the amplicon size generated during amplification. 10. When using a sequencer with a patterned flow cell (i.e., Illumina HiSeq 400 or NovaSeq), we recommend ordering adapters with unique dual indices to prevent index hopping, which are available from both the listed vendors. 11. It is important to use adapters with different indices for each sample if they are going to be sequenced on the same lane or pooled for enrichment. 12. Exome, gene-specific, disease-specific, as well as custom probes and panels can be obtained from IDT DNA. 13. Be sure to use appropriate blocking oligos for adapters used in library preparation. 14. Number of PCR cycles will depend on panel size and number of libraries pooled per capture. If there are less than 1000 targets, a second enrichment may be required to get target rates >90%. Contact Integrated DNA Technologies for a detailed protocol. 15. Make sure that each library loaded on the same sequencing lane has a unique index so that they can be accurately demultiplexed.

234

Veronica Gonzalez-Pena and Charles Gawad

References 1. Genovese P, Schiroli G, Escobar G, Tomaso TD, Firrito C, Calabria A, Moi D, Mazzieri R, Bonini C, Holmes MC, Gregory PD, van der Burg M, Gentner B, Montini E, Lombardo A, Naldini L (2014) Targeted genome editing in human repopulating haematopoietic stem cells. Nature 510(7504):235–240. https://doi.org/ 10.1038/nature13420 2. De Simone M, Arrigoni A, Rossetti G, Gruarin P, Ranzani V, Politano C, Bonnal RJP, Provasi E, Sarnicola ML, Panzeri I, Moro M, Crosti M, Mazzara S, Vaira V, Bosari S, Palleschi A, Santambrogio L, Bovo G, Zucchini N, Totis M, Gianotti L, Cesana G, Perego RA, Maroni N, Pisani Ceretti A, Opocher E, De Francesco R, Geginat J, Stunnenberg HG, Abrignani S, Pagani M (2016) Transcriptional landscape of human tissue lymphocytes unveils uniqueness of tumorinfiltrating T regulatory cells. Immunity 45 (5):1135–1147. https://doi.org/10.1016/j. immuni.2016.10.021 3. Kleppe M, Comen E, Wen HY, Bastian L, Blum B, Rapaport FT, Keller M, Granot Z, Socci N, Viale A, You D, Benezra R, Weigelt B, Brogi E, Berger MF, Reis-Filho JS, Levine RL, Norton L (2015) Somatic mutations in leukocytes infiltrating primary breast cancers. NPJ

breast cancer 1:15005. https://doi.org/10. 1038/npjbcancer.2015.5 4. Gawad C, Koh W, Quake SR (2014) Dissecting the clonal origins of childhood acute lymphoblastic leukemia by single-cell genomics. Proc Natl Acad Sci U S A 111(50):17947–17952. https://doi.org/10.1073/pnas.1420822111 5. Gawad C, Koh W, Quake SR (2016) Single-cell genome sequencing: current state of the science. Nat Rev Genet 17(3):175–188. https://doi. org/10.1038/nrg.2015.16 6. Gross A, Schoendube J, Zimmermann S, Steeb M, Zengerle R, Koltay P (2015) Technologies for single-cell isolation. Int J Mol Sci 16 (8):16897–16919. https://doi.org/10.3390/ ijms160816897 7. Hu P, Zhang W, Xin H, Deng G (2016) Single cell isolation and analysis. Front Cell Dev Biol 4:116. https://doi.org/10.3389/fcell.2016. 00116 8. Tamariz J, Voynarovska K, Prinz M, Caragine T (2006) The application of ultraviolet irradiation to exogenous sources of DNA in plasticware and water for the amplification of low copy number DNA. J Forensic Sci 51(4):790–794. https:// doi.org/10.1111/j.1556-4029.2006.00172.x

Chapter 15 Studying DNA Methylation in Single-Cell Format with scBS-seq Natalia Kunowska Abstract DNA methylation at cytosine is a major epigenetic mark, heavily implicated in controlling key cellular processes such as development and differentiation, cellular memory, or carcinogenesis. Bisulfite treatment in conjunction with next generation sequencing has been a powerful tool for studying this modification in a quantitative manner in the context of the whole genome and with a single nucleotide resolution. This chapter describes a protocol for bisulfite sequencing adapted to a single-cell format that allows for capturing the methylation signal from up to 50% CpG nucleotides in each cell. Key words DNA methylation, Bisulfite sequencing, Epigenetics, Heterogeneity, Single cell, Genome-wide

1

Introduction In mammals, 70–80% of CpG dinucleotide sequences are methylated on the C5 position of cytosine [1]. 5-Methylcytosine (5mC) in the DNA constitutes a true epigenetic mark, which can be inherited through cell divisions and which is pivotal in cell-type definition and stemness and in maintaining cellular memory [2, 3]. It plays a vital role in controlling key biological processes such as gene expression, development and differentiation, genomic imprinting, or silencing the repetitive elements [3, 4]. Consequently, DNA methylation (DNAme) patterns were found to be altered during aging and in pathological processes such as carcinogenesis or neurological and autoimmune disorders [2]. Given its importance, multiple methods to study this modification have been developed, ranging from mass spectroscopy to enzymatic and affinity assays [5]. Among them, bisulfite sequencing (BS-seq) is considered to be the “gold standard.” In BS-seq protocol, the treatment of denatured DNA with bisulfite (BS) salts in highly acidic environment leads to the deamination of cytosine base into uracil, which will then be read as thymine during

Valentina Proserpio (ed.), Single Cell Methods: Sequencing and Proteomics, Methods in Molecular Biology, vol. 1979, https://doi.org/10.1007/978-1-4939-9240-9_15, © Springer Science+Business Media, LLC, part of Springer Nature 2019

235

236

Natalia Kunowska

subsequent analysis by sequencing. However, 5mC residues are resistant to deamination. Therefore, by comparing the sequencing results from a sample following bisulfite treatment to untreated control sequences, the modified cytosines can be identified and quantified with a single-nucleotide resolution [6]. Combining BS with next-generation sequencing (NGS) allowed for analyzing DNA methylation on a genome-wide scale [7]. Recent advances in the field have enabled studying DNA methylation in the single-cell format [8–11], adding an important layer of information in chartering the cellular heterogeneity. In the somatic cells the DNAme is a particularly stable epigenetic mark, closely linked to the cell identity [2, 12]. Therefore, single-cell studies of DNAme patterns have a potential to significantly contribute to the single-cell community efforts to distinguish between bona-fide cell types and cell states. The protocol described here has been developed by Smallwood et al. [8, 13] who adapted PBAT (post-bisulfite adaptor tagging) approach [14] to study DNAme on the level of the single cells. In PBAT, the BS-treatment is used to both convert the unmethylated cytosines and to fragment the DNA before tagging it with sequencing adapters. This allows to circumvent BS-induced degradation of the tagged libraries, significantly reducing the input requirements. To study DNA methylation in individual cells, the PBAT strategy has been combined with five rounds of preamplification of the modified template with random primers harboring sequencing adapters. The sample is then treated with exonuclease I to remove the excess of the primers and purified. Subsequently, the second adapter oligo is introduced also by random priming. The resulting double-tagged libraries are amplified by PCR. In this step, sequencing indexes can be introduced to allow for multiplexing of the samples (Fig. 1). This scBS-seq protocol allows to capture DNA methylation signal at up to 50% of individual CpGs in genome [8]. In addition, it can be easily adapted for multiomics approaches based on physical separation of mRNAs and gDNA, such as M&T-seq (DNAme and transcriptome) [15] or NMT-seq (nucleosome positioning, DNAme, and transcriptome) [16]. Such combined approaches have great potential to shed a light on the relationships between the chromatin state and the transcriptional output with the singlecell resolution. The major challenge in performing the BS-seq protocol in the single-cell format is the very limited starting material. A mammalian cell would normally contain only two copies of each DNA molecule. Therefore, it is critical to limit the losses of material, especially at the preamplification stages of the protocol, as each molecule carries unique information. Moreover, the very low starting material which makes multiple rounds of amplification necessary, renders the method particularly vulnerable to contamination, making it paramount to work in clean, “pre-PCR” conditions.

Oligo 2 tagging

G U C G T U A C G A T U

5‘

3‘ +

5‘

3‘

Exo I-treatment and purification

Preamp oligo tagging

T A G A C G A G

PCR amplification with indexing

T A G A C G A G G C C G T C A C G A T C

237

+

× 10 - 14

×5 QC, sequencing and data analysis

BS-treatment

Cell capture and lysis

Studying DNA Methylation in Single Cells

Fig. 1 The single cells are captured and lysed and the isolated DNA is subjected to BS-treatment, which results in both conversion of unmodified cytosines to uracil and fragmentation. The methylated cytosines are protected against conversion. After desulfonation, the DNA is preamplified by random priming with oligos containing the first sequencing adapter. The tagged sample is then treated with exonuclease I and purified, and the second sequencing adapter is introduced by one round of random priming. The resulting libraries are PCR amplified. At this stage, the multiplexing indexes can be introduced. The ready libraries should be QC-ed, including checking the size distribution profiles. The successful samples are then sequenced and analyzed

1.1

2

Abbreviations

5mC 5-Methylcytosine BS Bisulfite DNAme DNA methylation mtDNA Mitochondrial DNA PBAT Post-bisulfite adapter tagging QC Quality control RT Room temperature U Unit

Materials 1. DNA and DNase decontamination reagent. 2. Low-bind tubes, plates, and filter tips. 3. RLT Plus Buffer (QIAGEN). 4. Ultrapure H2O, nuclease-free. 5. Unmethylated Lambda DNA or other controls for BS conversion efficiency, as needed.

238

Natalia Kunowska

6. EZ DNA Methylation-Direct™ Kit (Catalog Nos.: D5020, D5021, D5044, and D5045; depending on the size). 7. Optional: PureLink PCR micro kit. 8. High concentration (50,000 U/ml) Klenow 30 ! 50 exo (for example from Enzymatics). 9. Blue buffer for Klenow reaction, or a corresponding equivalent. 10. Exonuclease I (E. coli) at 20,000 U/ml. 11. AMPure XP SPRI beads. 12. 80% ethanol (vol/vol). 13. KAPA HiFi HotStart Polymerase 1000 U/ml (or an equivalent hot start, high-fidelity polymerase). 14. 5 KAPA HiFi Fidelity buffer, or a corresponding equivalent. 15. EB buffer (QIAGEN). 16. Agilent BioAnalyser and high-sensitivity DNA Kit or an equivalent setup. 17. Optional: KAPA Library Quantification Kit or other PCR-based library quantification method. 18. Optional: MiSeq Kit. 19. HiSeq or other compatible instrument. 20. Heating block. 21. Magnetic racks for tubes and plates, as appropriate. 22. PCR thermocycler. 23. “Pre-PCR” laminar flow cabinet with UV light. 24. Oligos [17]: Oligo

Sequence

Preamp oligo

CTACACGACGCTCTTCCGATCTNNNNNN

Oligo 2

TGCTGAACCGCTCTTCCGATCTNNNNNN

PE1.0

AATGATACGGCGACCACCGAGATCTACAC TCTTTCCCTACACGACGCTCTTCCGA TC*T

iPCRTag

CAAGCAGAAGACGGCATACGAGATXXXX XXXXGAGATCGGTCTCGGCATTCC TGCTGAACCGCTCTT CCGATC*T

iTag sequencing primer

AAGAGCGGTTCAGCAGGAATGCCGAGAC CGATCTC

N—random nucleotide *—phosphorothioate X—8-base sequencing index

Studying DNA Methylation in Single Cells

239

iTag index sequences: Primer

Tag sequence

iPCRtag 1

AACGTGAT

iPCRtag 2

AAACATCG

iPCRtag 3

ATGCCTAA

iPCRtag 4

AGTGGTCA

iPCRtag 5

ACCACTGT

iPCRtag 6

ACATTGGC

iPCRtag 7

CAGATCTG

iPCRtag 8

CATCAAGT

iPCRtag 9

CGCTGATC

iPCRtag 10

ACAAGCTA

iPCRtag 11

CTGTAGCC

iPCRtag 12

AGTACAAG

iPCRtag 13

AACAACCA

iPCRtag 14

AACCGAGA

iPCRtag 15

AACGCTTA

iPCRtag 16

AAGACGGA

iPCRtag 17

AAGGTACA

iPCRtag 18

ACACAGAA

iPCRtag 19

ACAGCAGA

iPCRtag 20

ACCTCCAA

iPCRtag 21

ACGCTCGA

iPCRtag 22

ACGTATCA

iPCRtag 23

ACTATGCA

iPCRtag 24

AGAGTCAA

iPCRtag 25

AGATCGCA

iPCRtag 26

AGCAGGAA

iPCRtag 27

AGTCACTA

iPCRtag 28

ATCCTGTA

iPCRtag 29

ATTGAGGA

iPCRtag 30

CAACCACA

iPCRtag 31

CAAGACTA

iPCRtag 32

CAATGGAA (continued)

240

Natalia Kunowska

Primer

Tag sequence

iPCRtag 33

CACTTCGA

iPCRtag 34

CAGCGTTA

iPCRtag 35

CATACCAA

iPCRtag 36

CCAGTTCA

iPCRtag 37

CCGAAGTA

iPCRtag 38

CCGTGAGA

iPCRtag 39

CCTCCTGA

iPCRtag 40

CGAACTTA

iPCRtag 41

CGACTGGA

iPCRtag 42

CGCATACA

iPCRtag 43

CTCAATGA

iPCRtag 44

CTGAGCCA

iPCRtag 45

CTGGCATA

iPCRtag 46

GAATCTGA

iPCRtag 47

GACTAGTA

iPCRtag 48

GAGCTGAA

All oligos should be HPLC-purified and resuspended in EB buffer at 100 μM.

3

Methods

3.1 General Overview of the Protocol

Before starting, check that you have all the necessary materials and that the experimental setup is correct (see General Notes) Safe stopping point after step completion

Protocol step

Time needed

1. Cell Lysis

Depending on the cell number and collection method

Yes

2. Bisulfite conversion

3.5–4 h

Not recommended, proceed immediately to the next step

1.5–2 h 3. Desulfonation and purification of BS-converted samples

Not recommended, proceed immediately to the next step

4. Preamp oligo tagging 1.5 h

Yes

5. Preamplification

Yes, after each full round of first-strand synthesis

4h

(continued)

Studying DNA Methylation in Single Cells

3.2

Cell Lysis

3.3 Bisulfite Conversion

241

Protocol step

Time needed

Safe stopping point after step completion

6. Exonuclease I treatment

1 h 15 min

Yes

45 min to 1 h 7. Purification of exonuclease I-treated samples

Yes

8. Oligo 2 tagging

2h

Yes

9. Purification of double-tagged libraries

45 min to 1 h

Yes

10. Library amplification

1h

Yes

11. Amplified library purification

45 min to 1 h

Yes

FACS-sort the single cells of the population of interest into plates containing 2.5 μl RLT Plus. At this stage, cell can be stored at 80  C for up to 1 month (see Notes 1 and 2). 1. Prepare CT Conversion Reagent, following the manufacturer’s instructions. The exact volumes depend on the size of EZ DNA Methylation-Direct™ Kit used; please refer to the manual provided with the kit. The volumes listed here correspond to the smallest kit size (Catalog No. D5020), which is sufficient to BS-convert 20 samples (using half of the volumes recommended in the kit). Add 790 μl M-Solubilization Buffer and 300 μl of M-Dilution Buffer and vortex until all visible particles are dissolved. Add 1.6 ml of M-Reaction Buffer and vortex again for an additional 4 min (see Note 3). 2. Add 7.5 μl H2O to each sample. It is recommended to add control of BS conversion efficiency, such as 60 fg of unmethylated Lambda DNA (see Note 4). 3. Add 65 μl of prepared CT Conversion reagent solution. Incubate in the thermocycler with the following program: Temperature

Time

98  C

8 min



65 C 

8 C

3h HOLD

242

Natalia Kunowska

4. Proceed immediately to the next step: Desulfonation and purification of BS-converted samples (see Note 5). 3.4 Desulfonation and Purification of BS-Converted Samples

1. Prepare a deep-well plate with 5 μl of MagBinding beads and 200 μl of M-binding buffer in each well (see Note 6). Preheat an appropriate heating block to 55  C. 2. Transfer the whole volume (75 μl) of the BS-treated samples from the point 2.3. To the deep-well plate containing MagBinding beads and M-binding buffer. 3. To improve sample recovery, rinse the wells of the BS-conversion plate with 100 μl of M-binding buffer, and combine this with the MagBinding beads and M-binding buffer mixture. Mix by vortexing. 4. Incubate at RT for 5 min to allow the BS-treated DNA to bind to the magnetic beads. 5. Place on the magnet and wait until the solution becomes clear (3–6 min). Remove and discard the supernatant. 6. Remove the plate from the magnet and resuspend the beads in 100 μl of M-Desulfonation buffer. 7. Incubate the plate at RT for 15 min (see Note 7). 8. Place the plate on the magnet and allow the solution to clear (3–6 min). Discard the supernatant. 9. Again, remove the plate from the magnet and add 200 μl of M-wash buffer to the beads. Resuspend well. 10. Place the plate on the magnet and allow the solution to clear (3–6 min). Discard the supernatant. 11. Repeat the wash with the M-wash buffer (Subheading 3.4, steps 9 and 10). 12. Dry the beads by incubating the plate on the heating block that has been preheated to 55  C for 15 min. Proceed immediately to the next step: Preamp oligo tagging.

3.5 Preamp Oligo Tagging

1. To elute the DNA, resuspend the beads in 31 μl of 1 blue buffer. Incubate at 55  C for 4 min. Spin down briefly to concentrate the liquid at the bottom of the wells. 2. Place the plate on the magnet and allow the solution to clear (3–6 min). 3. Transfer 30 μl of the supernatant to a new PCR plate containing 9 μl of the following mix in each well:

Studying DNA Methylation in Single Cells

243

Reagent

Stock concentration

Volume

Final concentration

Blue buffer

10

1 μl

1

dNTP mix

10 mM

1.6 μl

0.4 mM

Preamp oligo

10 μM

1.6 μl

0.4 μM

H2O

–

4.8 μl

–

4. Incubate at 65  C for 3 min. 5. Cool immediately to 4  C by placing the PCR plate on an aluminum rack on ice. 6. Add 1 μl (50 units) of high concentration Klenow 30 ! 50 exo and mix well. Spin down briefly (see Note 8). 7. Incubate in the thermocycler with the following program: Temperature

Time

Ramp speed

4 C

5 min

–

4 ! 38 C

8 min 30 s

4  C/1 min

37  C

30 min

–

8 C

HOLD

–



The first-strand synthesis product can be safely stored overnight at 4  C or for up to 1 month at 20  C. 3.6

Preamplification

1. Prepare the preamplification mix (2.5 μl per sample). For each sample add (see Note 9):

Reagent

Stock concentration

Volume

Final concentration

Blue buffer

10

0.25 μl

1

dNTP mix

10 mM

0.1 μl

0.4 mM

10 μM

1 μl

4 μM

50,000 U/ml

0.5 μl

10 U/μl

–

0.65 μl

–

Preamp oligo 0

0

Klenow 3 ! 5 exo H2O



244

Natalia Kunowska

2. Denature the preamp oligo tagging reaction mixture from the point 4.7. At 95  C for 45 s. 3. Cool immediately to 4  C by placing the PCR plate on an aluminum rack on ice. 4. Add 2.5 μl of the preamplification mix from point 5.1. To each sample and mix well. Spin down briefly. 5. Incubate in the thermocycler with the following program: Temperature

Time

Ramp speed

4 C

5 min

–

4 ! 38 C

8 min 30 s

4  C/1 min

37  C

30 min

–

8 C

HOLD

–



6. Repeat Subheading 3.6, steps 1–5 three times to complete the five rounds of first-strand synthesis. The final volume should be 50 μl. The preamplification reaction can be safely stopped after each full cycle and safely stored overnight at 4  C or for up to 1 month at 20  C. 3.7 Exonuclease I Treatment

1. To remove the excess of the preamp oligos, add 2 μl (corresponding to 40 U) of E. coli exonuclease I and 48 μl of H2O (final volume 100 μl). Mix well. 2. Incubate at 37  C for 1 h in a thermocycler with a lid heated to 50  C.

3.8 Purification of Exonuclease I-Treated Samples

1. To each sample, add 80 μl of SPRI beads, equilibrated to RT and well resuspended. Mix thoroughly (see Note 10). 2. Incubate at RT for 10 min to allow the DNA to bind to the beads. 3. Place the samples on the magnet and incubate until the solution clears (2–5 min). Remove and discard the supernatant. 4. While keeping the samples on the magnet, wash the beads with 200 μl 80% ethanol. Wait till the beads settle completely (1–2 min) and remove the supernatant. 5. Repeat the ethanol wash (Subheading 3.8, step 4), trying to remove as much residual ethanol as possible without disturbing the beads on the magnet. 6. Dry the SPRI beads at RT for 5–10 min. Make sure not to overdry the beads, as it will result in impaired sample recovery. As soon as the beads are dry, proceed immediately to the elution (see Note 11). 7. Add 41 μl of 1 blue buffer to the dried beads, resuspend well.

Studying DNA Methylation in Single Cells

245

8. Incubate for 10 min at the RT. 9. Place on the magnet and wait for the liquid to clear (1–3 min). Collect 40 μl of the supernatant containing the DNA. The samples can be safely stored for up to 1 month at 20  C. 3.9

Oligo 2 Tagging

1. Prepare the oligo 2 tagging mix (9 μl per sample). For each sample add (see Note 12): Reagent

Stock concentration

Volume

Final concentration

Blue buffer

10

1 μl

1

dNTP mix

10 mM

2 μl

0.4 mM

Oligo 2

10 μM

2 μl

0.4 μM

H2O

–

4 μl

–

2. Add 9 μl of the oligo 2 tagging mix (from point 8.1) to each SPRI-purified sample from point 7.9. Mix well. 3. Denaturate the preamp oligo tagging reaction mixture from the point 4.7 at 95  C for 45 s. 4. Cool immediately to 4  C by placing the PCR plate on an aluminum rack on ice. 5. Add 1 μl (50 units) of high concentration Klenow 30 ! 50 exo and mix well. Spin down briefly. 6. Incubate in the thermocycler with the following program: Temperature

Time

Ramp speed

4 C

5 min

–

4 ! 38 C

8 min 30 s

4  C/1 min

37  C

90 min

–

8 C

HOLD

–



The samples after oligo 2 tagging can be safely stored for up to 1 month at 20  C. 3.10 Purification of Double-Tagged Libraries

1. Dilute the libraries by adding 50 μl of ultra-pure H2O. Add 80 μl of well resuspended SPRI beads that have been equilibrated to RT. 2. Perform SPRI beads purification in an analogous manner to Subheading 3.8, steps 2–6. 3. As soon as the beads are dry, immediately elute the DNA by adding 41 μl of 1 KAPA HiFi Fidelity buffer. 4. Incubate for 10 min at the RT.

246

Natalia Kunowska

5. Place on the magnet and wait for the liquid to clear (1–3 min). Collect 40 μl of the supernatant containing the DNA. The samples after purification can be safely stored for up to 1 month at 20  C. 3.11 Library Amplification

1. Prepare the PCR mix (10 μl per sample). For each sample add (see Note 13):

Reagent

Stock Final concentration Volume concentration

KAPA HiFi Fidelity buffer

5

2 μl

1

dNTP mix

10 mM

1 μl

0.2 mM

PE1.0

10 μM

2 μl

0.4 μM

iPCRTag

10 μM

2 μl

0.4 μM

KAPA HiFi HotStart polymerase

1000 U/ml

1 μl

2 U/ml

H2O

–

2 μl

–

2. Mix the samples well and spin down. 3. Amplify in a thermocycler with the following program: Temperature

Time

Number of cycles

95  C

2 min

1



1 min 20 s



65 C

30 s

72  C

30 s

72  C

3 min

1

8 C

HOLD

1

94 C

3.12 Amplified Library Purification

10–14 (to be determined for the cell type studied)

1. Dilute the PCR-amplified libraries by adding 50 μl of ultrapure H2O. Add 80 μl of well resuspended SPRI beads that have been equilibrated to RT. 2. Perform SPRI beads purification in an analogous manner to Subheading 3.8, steps 2–6. 3. As soon as the beads are dry, immediately elute the DNA by adding 20 μl of EB buffer. 4. Incubate for 10 min at the RT. 5. Place on the magnet and wait for the liquid to clear (1–3 min). Transfer 18 μl of the supernatant containing the DNA to a new,

Studying DNA Methylation in Single Cells

247

clean plate. The ready, purified libraries are very stable and can be stored at 20  C  year. 3.13 Quality Control and Sequencing

4

The quality of the ready libraries should be assessed by checking the size distribution profiles. Run 1 μl of each sample on Agilent BioAnalyzer using the high-sensitivity DNA chip or an equivalent set up. Smooth profiles with a single wide peak between 200 and 700 bp is expected. The concentration should be 2 nM. Optionally, the final library concentration can also be examined using PCR-based library quantification kits, such as KAPA Library Quantification Kit. Again, the concentration should be between 2 and 10 nM. To assess the BS-conversion rate, presence of contaminations and the mapping efficiency of the samples before performing fullscale sequencing, an additional QC step is highly recommended. The pooled libraries can be sequenced by a low-coverage 50 bp MiSeq run using the custom iTag primer. For the final sequencing on HiSeq, paired end, 2 100 bp run is recommended aiming for a depth of at least 20 million mapped reads (optimally 50–60 million) (see Note 14). For basic troubleshooting, see Notes 15–20.

Notes General notes: Due to its high sensitivity, the scBS-seq is very sensitive to contaminations. Therefore, negative controls should always be introduced for cell collection and lysis (empty wells with lysis buffer only). Optimally, the negative controls for each stage of the protocol (ultra-pure H2O or EB buffer) should be used. This is especially important when significant contamination has been detected. The negative controls for each step will then allow to identify the source of the contamination. Additionally, a positive control (10–100 pg of purified DNA) is recommended to assess the efficiency of cell collection and lysis. To limit contamination, the protocol should be performed in designated pre-PCR laminar flow hood, which has been UV-irradiated and treated with DNA and DNase decontaminating solution prior to use. Use ultrapure reagents, when possible UV-treated, in small aliquots. To obtaining successful libraries and to ensure good yield, using low DNA binding tubes, plates and tips is essential. For small sample numbers, PCR tubes and eppendorfs can be used instead of PCR and deep-well plates. All magnetic beads purifications steps can be automatized, using liquid handlers such as PerkinElmer Zephyr G3 NGS workstation or Agilent Bravo.

248

Natalia Kunowska

1. Other methods such as mouth pipetting can be used at this step, depending on the cell type and cell numbers. 2. Similarly, other cell lysis buffers compatible with BS-conversion can be used such as appropriate for the cell type studied. At this stage poly-A mRNAs can be isolated for single-cell multiomics approaches such as M&T-seq or NMT-seq. 3. If the CT Conversion Reagent particles persist, heat the solution to 50  C. The CT Conversion Reagent is light sensitive; therefore, exposure to light should be minimized. Prepared CT Conversion Reagent solution can be stored up to 1 month at 20  C. Stored CT Conversion Reagent solution must be warmed to 37  C and vortexed thoroughly prior to use. 4. At this step, 60 fg of unmethylated phage Lambda DNA is spiked into the buffer as the control for the BS conversion efficiency. Alternatively, other controls can be used such as synthetic methylated and unmethylated oligonucleotides. 5. After the BS conversion, the DNA is single stranded and therefore unstable. It is recommended to keep the incubation at 8  C to a minimum and proceed to the next steps. 6. For small numbers of samples, tubes and column-based purification kits (such as PureLink PCR micro kit) are used. 7. Important: samples must not remain in the M-Desulfonation buffer for more than 20–25 min. 8. To obtain good yield, it is essential to use highly concentrated Klenow 30 ! 50 exo. 9. Remember to prepare an excess of the preamplification mix to account for pipetting errors. 10. Due to a large volume of the combined sample, be extra careful when mixing the exonuclease I digestion product with the SPRI beads. Make sure that the beads are well resuspended and have been equilibrated to RT before adding them to the sample. 11. It is important to observe the SPRI beads while drying to make sure that they do not overdry. The beads will turn from dark and glistening into rusty brown and matte. As soon as the first cracks on the surface start to appear, add the elution mix immediately. Keep in mind that due to manual processing times, some samples may be dry sooner than others. 12. Remember to prepare an excess of the oligo 2 tagging mix to account for pipetting errors. 13. When preparing a master mix for multiple samples, remember to prepare an excess of the PCR mix to account for pipetting errors.

Studying DNA Methylation in Single Cells

249

14. During the sequencing, a PhiX spike-in control needs to be used, as the BS-treated samples have unbalanced genomic composition with most of the cytosines having been converted to thymidines. 15. The rate of conversion of the unmethylated Lambda DNA (if added) can be used to assess the efficiency of BS conversion. Alternatively, for mammalian cells mtDNA can be used for this purpose, as it is practically unmethylated in most of the cell types. 16. The expected BS-conversion efficiency is >95%. Low conversion efficiencies suggest problems with the bisulfite reagent. Prepare a fresh aliquot and repeat the experiment. 17. Though it is not unusual for the negative controls to produce libraries that can be detected in the BioAnalyzer QC step, the mapping efficiency of the “empty” samples should be much lower (about 8–10 times) than for the cell-containing wells and should be below 5%. If the contamination is detected, a series of negative controls should be used to pinpoint its source. The contaminated reagents should be discarded and the experimental conditions and the “cleanness” of the setup should be reassessed. 18. The high ratio of PCR duplicates suggests that too many PCR cycles were used during the final library amplification step. Repeat the experiment using less cycles. 19. Conversely, low yield might suggest insufficient number of PCR cycles. The libraries might be “rescued” by performing additional 2–5 PCR cycles and higher number of cycles should be used for the subsequent experiments. 20. Library with size distribution profile shifted towards lower molecular size with visible sharp peaks and low mapping efficiencies can result from samples with very DNA content, such as empty wells or when the cell lysis was inefficient. Such experiments need to be repeated, and positive control (purified DNA) should be used in parallel to check for the efficiency of cell collection and lysis. However, libraries with such profiles might also be a result of a too high SPRI beads-to-sample ratio during the final library purification. This might be due to sample evaporation or imprecise pipetting of the viscous SPRI bead solution. In such cases, an additional round of 0.8 SPRI bead purification is recommended. References 1. Jabbari K, Bernardi G (2004) Cytosine methylation and CpG, TpG (CpA) and TpA frequencies. Gene 333:143–149

2. Fernandez AF, Assenov Y, Martin-Subero JI et al (2012) A DNA methylation fingerprint

250

Natalia Kunowska

of 1628 human samples. Genome Res 22:407–419 3. Bird A (2002) DNA methylation patterns and epigenetic memory. Genes Dev 16:6–21 4. Law JA, Jacobsen SE (2010) Establishing, maintaining and modifying DNA methylation patterns in plants and animals. Nat Rev Genet 11:204–220 5. Kurdyukov S, Bullock M (2016) DNA methylation analysis: choosing the right method. Biology 5. https://doi.org/10.3390/ biology5010003 6. Frommer M, LE MD, Millar DS et al (1992) A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands. Proc Natl Acad Sci U S A 89:1827–1831 7. Lister R, Pelizzola M, Dowen RH et al (2009) Human DNA methylomes at base resolution show widespread epigenomic differences. Nature 462:315–322 8. Smallwood SA, Lee HJ, Angermueller C et al (2014) Single-cell genome-wide bisulfite sequencing for assessing epigenetic heterogeneity. Nat Methods 11:817–820 9. Farlik M, Sheffield NC, Nuzzo A et al (2015) Single-cell DNA methylome sequencing and bioinformatic inference of epigenomic cellstate dynamics. Cell Rep 10:1386–1397 10. Gravina S, Dong X, Yu B, Vijg J (2016) Singlecell genome-wide bisulfite sequencing

uncovers extensive heterogeneity in the mouse liver methylome. Genome Biol 17:150 11. Guo H, Zhu P, Wu X et al (2013) Single-cell methylome landscapes of mouse embryonic stem cells and early embryos analyzed using reduced representation bisulfite sequencing. Genome Res 23:2126–2135 12. Bogdanovic´ O, Lister R (2017) DNA methylation and the preservation of cell identity. Curr Opin Genet Dev 46:9–14 13. Clark SJ, Smallwood SA, Lee HJ et al (2017) Genome-wide base-resolution mapping of DNA methylation in single cells using singlecell bisulfite sequencing (scBS-seq). Nat Protoc 12:534–547 14. Miura F, Enomoto Y, Dairiki R, Ito T (2012) Amplification-free whole-genome bisulfite sequencing by post-bisulfite adaptor tagging. Nucleic Acids Res 40:e136 15. Angermueller C, Clark SJ, Lee HJ et al (2016) Parallel single-cell sequencing links transcriptional and epigenetic heterogeneity. Nat Methods 13:229–232 16. Clark SJ, Argelaguet R, Kapourani C-A et al (2018) scNMT-seq enables joint profiling of chromatin accessibility DNA methylation and transcription in single cells. Nat Commun 9:781 17. Quail MA, Otto TD, Gu Y et al (2011) Optimal enzymes for amplifying sequencing libraries. Nat Methods 9:10–11

Chapter 16 Single-Cell 5fC Sequencing Chenxu Zhu, Yun Gao, Jinying Peng, Fuchou Tang, and Chengqi Yi Abstract Active DNA demethylation plays important roles in the epigenetic reprogramming of developmental processes. 5-formylcytosine (5fC) is produced during active demethylation of 5-methylcytosine (5mC). Here, we describe a technique called CLEVER-seq (Chemical-labeling-enabled C-to-T conversion sequencing), which detects the whole genome 5fC distribution at single-base and single-cell resolution. CLEVER-seq is suitable for the analysis of precious samples such as early embryos and laser microdissection captured samples. Key words CLEVER-seq, 5-Formylcytosine, Bisulfite-free sequencing, Chemical labeling, Single cell

1

Introduction

1.1 Methods to Analyze 5-Formylcytosine

5-Formylcytosine (5fC) is produced during active demethylation of 5-methylcytosine (5mC): 5mC is sequentially oxidized by ten-eleven translocation (TET) family proteins to give 5-hydroxymethylcytosine (5hmC), 5fC and 5-carboxylcytosine (5caC); the latter two can be reversed to cytosine by thymine DNA glycosylase (TDG)-mediated DNA base-excision repair [1–6]. Active DNA demethylation is shown to have has crucial roles in multiple biological processes, including embryo development, neurogenesis, carcinogenesis, and stem cell pluripotency and differentiation [7–9]. Unlike 5mC and 5hmC, 5fC could not be distinguished from 5caC and unmodified cytosine during bisulfite treatment [10]. Various modified bisulfite-dependent methods have been developed to profile 5fC at single-base resolution [11]. fCAB-seq (chemicalassisted bisulfite sequencing for 5fC) uses EtONH2 to react specifically with 5fC and makes it resistant to bisulfite treatment. After bisulfite conversion, 5fC could be identified by subtracting traditional BS-seq signal [12, 13]. redBS-seq (reduced bisulfite sequencing) converts 5fC to 5hmC by NaBH4 treatment; thus, the converted 5fC stays intact in the bisulfite treatment, so 5fC signal

Valentina Proserpio (ed.), Single Cell Methods: Sequencing and Proteomics, Methods in Molecular Biology, vol. 1979, https://doi.org/10.1007/978-1-4939-9240-9_16, © Springer Science+Business Media, LLC, part of Springer Nature 2019

251

252

Chenxu Zhu et al.

could be resolved by subtracting traditional BS-seq signal [14]. In MAB-seq (M.SssI methylase-assisted bisulfite sequencing), M.SssI was used to convert unmodified cytosine (C) into 5mC in a CpG context in vitro and the methylated DNA was then subjected to bisulfite treatment. Hence, 5fC and 5caC could be indiscriminately identified [15–18]. Meanwhile, bisulfite-free 5fC profiling methods have also been developed: 5fC-targeted antibody-based [19] or chemical labeling-based [12, 20, 21] enrichment of target DNA for sequencing, and converting 5fC to 5hmC then using 5hmCsentitive restriction enzyme for detection [22]. We have also developed a bisulfite-free, single-base resolution 5fC sequencing method, fC-CET [23]. However, these methods are all limited to analysis of bulk samples. scMAB-seq and liMAB-seq could be adopted for single cell or limited cells [24] as start material but identify 5fC/5caC indiscriminately. In this chapter, we provide a detailed description of “CLEVER-seq,” a single-base and single-cell resolution 5fC mapping technology that we recently developed [25]. 1.2 Principle and Application of CLEVERseq

CLEVER-seq was developed based on the reactivity of malononitrile to 5fC (Fig. 1a, b) [25]. Malononitrile is a stable and commercially available small molecule and is highly water-soluble. Singlecells are lysed in individual tubes and labeled with malononitrile. This labeling reaction is performed under mild condition and causes no DNA degradation. After chemical treatment, the 5fC-adduct (“5fC-M”) is read as a dT during DNA amplification by various DNA polymerases, which enables single-base resolution detection. The labeled single-cell genomic DNA can be amplified by wholegenome amplification (WGA) technology such as MALBAC (multiple annealing- and looping-based amplification cycles)[26]. Cell lysis, DNA labeling, and single-cell whole genome amplification are performed in a “one-tube” fashion without any purification step: this chemical is highly biocompatible and does not inhibit the activity of commonly used DNA polymerases. After producing sufficient amount of DNA by WGA, universal library construction procedures are then performed on the amplified DNA. Libraries quality controls have been implemented by monitoring spike-in DNA conversion ratio, amplification efficiency, and fragment distribution. Libraries are sequenced on a next-generation sequencing platform including Illumina HiSeq 2500 or HiSeq 4000. CLEVER-seq enables the single-cell, single-base resolution 5fC detection of rare cell types, for example, mammalian early embryos or laser microdissection captured samples. CLEVER-seq depends on the chemical labeling by a small molecule and, thus, has no bias on base composition. With a reasonable 3
sequencing depth of a single mouse embryonic stem cell, CLEVER-seq could stably cover 27% of CpG sites in the entire genome[25]. CLEVERseq could also be combined with other library preparation methods, such as reduced-representative sequencing and target-

Single Cell 5fC Sequencing

a O

NH 2

N

NH 2

N

N

N N

253

N O

O

N

N

DNA

DNA

5fC

Malononitrile

“5fC-M”

b

One-tube reaction

Single cell

Single cell lysis 5mC 5hmC

5fC 5caC

5mC 5hmC

M

M 5fC 5caC

Malononitrile

Malononitrile Labeling

DNA amplification

T T T T T T T

-200

-100

5fC

+100

+200

High-throughput sequencing

Fig. 1 Principle of CLEVER-seq. (a) Labeling reaction of 5fC. (b) Steps of CLEVERseq. Single-cells were picked into individual tubes, lysed and labeled with malononitrile. The single-cell genome is then subjected to whole genome amplification in the labeling mixture directly. After obtaining sufficient amount of DNA, library preparation and sequencing is then performed

enriched sequencing, to obtain desired formylome with lower sequencing cost.

2 2.1

Materials (See Note 1) Cell Lysis

1. Lysis Buffer (Tris–EDTA, 20 mg/mL Protease, Triton X-100, KCl; for details see Table 1)

254

Chenxu Zhu et al.

Table 1 Lysis buffer composition Lysis buffer (common)

Lysis buffer for sperm

Final concentration

Volume (μL)

Final concentration

Volume (μL)

0.1 M Tris–EDTA, pH 8.0 (1 M Tris–HCl + 0.1 M EDTA)

10 mM

0.5

10 mM

0.5

Protease (20 mg/mL)

1 mg/mL

0.25

1 mg/mL

0.25

10% Triton X-100

0.3%

0.15

0.3%

0.15

1 M KCl

20 mM

0.1

20 mM

0.1

0.1 M DTT

/

/

15 mM

0.75

Nuclease-free water

/

4

/

3.25

Total

/

5

/

5

Component

Table 2 Primer sequences Name

Sequence (50 -30 )

Spike-in

CCTCACCATCTCAACCAATATTATATTACGCGTATAT5fCGCGTATTTCGCGTTA TAATATTGAGGGAGAAGTGGTGAATACTGAATAAGAATGTAGTCCAGGTAGG ATGGGTGGTTGATGGTAGTGATAATGTCGGAG

Spike-in-RC CTCCGACATTATCACTACCATCAACCACCCATCCTACCTGGACTACA TTCTTA TTCAGTATTCACCACTTCTCCCTCAATATTATA ACGCGAAATACGCGATA TACGCGTAATATAATATTGGTTGAGATGGTGAGG SP-Test-F

CTCCGACATTATCACTACCA

SP-Test-R

CCTCACCATCTCAACCAATATTATATT

2. 200 μL thin wall PCR tubes. 3. Thermocycler. 2.2 Chemical Labeling

1. Unmethylated phage λ DNA. 2. Spike-in DNA containing 5fC (see Table 2). 3. Malononitrile. 4. 200 μL thin wall PCR tubes. 5. Mineral oil. 6. 100 mM Tris–HCl, pH 8.0. 7. Eppendorf ThermoMixer.

Single Cell 5fC Sequencing

2.3 Quasilinear Preamplification

255

1. MALBAC Single Cell WGA Kit (Yikon Genomics). 2. 200 μL thin wall PCR tubes. 3. Thermocycler.

2.4 Exponential Amplification

1. MALBAC Single Cell WGA Kit (Yikon Genomics). 2. 200 μL thin wall PCR tubes. 3. Thermocycler.

2.5 Postamplification DNA Purification and Fragmentation

1. Zymo DNA Clean & Concentrator-5 (Zymo).

2.6 Library Preparation

1. NEBNext Ultra II DNA Library Prep Kit for Illumina.

2. 1.5 mL microcentrifuge tubes. 3. Covaris Focused-ultrasonicator.

2. Agencourt AMPure XP beads. 3. 200 μL reaction tubes. 4. Magnetic separation rack. 5. Thermocycler.

2.7 Library Amplification

1. NEBNext Ultra II Q5 Master Mix. 2. NEBNext Multiplex Oligos for Illumina. 3. 200 μL thin wall PCR tubes. 4. Thermocycler.

2.8 Library Purification and Quality Control

1. Agencourt AMPure XP beads. 2. 1.5 mL and 200 μL microcentrifuge tube. 3. NEBNext Ultra II Q5 Master Mix. 4. SP-Test-F and SP-Test-R primers (see Table 2). 5. Thermocycler. 6. Fragment Analyzer (Advanced Analytical) or Bioanalyzer (Agilent). 7. Qubit Fluorometer and Quant-iT dsDNA HS Assasy Kit.

2.9 Next-Generation Sequencing of CLEVER-seq Libraries and Bioinformatics Analysis

1. Illumina TruSeq Index Sequencing Primer Box. 2. Illumina HiSeq 2500 Sequencer.

256

3 3.1

Chenxu Zhu et al.

Methods Cell Lysis

1. Prepare the cell Lysis Buffer (see Table 1) freshly each time before performing the experiments. For analysis of mammalian sperm, prepare the Lysis Buffer according to Lysis Buffer for Sperm; for analysis of other single cell samples, prepare the Lysis Buffer according to Lysis Buffer (Common). 2. Use 5 μL Lysis Buffer for each cell, capture single cell (with ¼ 18,000  g (top speed), shake for 5 h or overnight. This step denatures the Tn5 and does reverse cross-linking. 11. Spin down beads using the table top microcentrifuge at top speed, 30 s. Use magnetic rack to remove the beads, and purify with Qiagen MinElute PCR Purification Kit. Elute with 12.5 Elution Buffer from the kit (end up with ~10 μL). 12. The purified DNA can be stored in 80
C for a long time. (A period of 6 months has been tested without any problems.) Day 4: Library Construction

1. Set up PCR reaction as follows (50 μL reaction): 10 μL DNA template (eluted from MinElute kit). 10 μL H2O. 2.5 μL N5xx (10 μM, desalted oligos). 2.5 μL N7xx (10 μM, desalted oligos). 25 μL NEBNext High-Fidelity 2 PCR Master Mix. 2. PCR cycle conditions: 72
C 5 min. 98
C 30 s. [98
C 10 s, 63
C 30 s, 72
C 20 s]  4. 4
C hold. 3. Take 9 μL from the original reaction, add 1 μL 10 EvaGreen, run a real time PCR with 98
C 30 s, [98
C 10 s, 63
C 30 s, 72
C 20 s]  20, to see the amplification curve. Qualitatively decide the cycle number N where the curve reach around half way of saturation (Fig. 2, dotted line). Do N more cycles for the rest of 41 μL reaction.

Relative intensity

Robust Low Input ChIP-seq: ChIPmentation

279

105 100 95 90 85 80 75 70 65 60 55 50 45 40 35 30 25 20 15 10 5 0 -5

0

2

4

6

8

9

10

12

14

16

18

Cycles

Fig. 2 A typical qPCR amplification plot of the ChIPmentation libraries

4. AmpureXP beads purification: add 20 μL AmpureXP beads to the 41 μL amplified libraries. Pipette up and down to mix well. Leave at room temperature for 5 min. Put on a magnet and wait until the solution is clear. Transfer the supernatant to a new eppendorf tube, and discard the beads. Add 30 μL AmpureXP beads to the supernatant. Pipette up and down to mix well. Leave at room temperature for 5 min. Put on a magnet and wait until the solution is clear. Remove the supernatant and add 100 μL 80% ethanol without taking the tube off the magnet. Wait about 15 s and remove the ethanol. Repeat ethanol wash two more times. Air-dry the beads, and elute the library from the beads by resuspending the beads in 30 μL 10 mM Tris–HCl, pH 8.0. Leave at room temperature for 5 min, and transfer elutes to a new tube. 5. Run 1 μL of the purified library on BioAnalyzer or TapeStation, and send for sequencing. 50 bp, either single-end or pair-end, is generally used for ChIP-seq and ChIPmentation (see Note 2). Some examples of library profiles on Agilent Bioanalyzer are shown in Fig. 3 (see Note 3).

4

Notes 1. Sonication is the most efficient way of breaking down DNA. However, it can also destroy the protein epitope recognized by the antibody. Therefore, it is critical not to oversonicate.

280

Natalia Kunowska and Xi Chen

Fig. 3 Four examples of Bioanalyzer profiles from ChIPmentation experiments in the Jurkat cell line using 105 cells. The active histone marks (H3K4me3 and H3K27ac) have shorter fragments compared to the repressive mark (H3K27me3). For some difficult-to-sonicate cells, multiple peaks representing nucleosomes are observed

Histones are generally more tolerant to sonication comparing to transcription factors. In general, 100–500 bp and 200–1000 bp are good starting points for histone and transcription factor ChIP respectively. 2. Using qPCR to check enrichment on known loci is useful to tell whether the ChIP experiments work or not. However, this is not always possible, and enrichment in qPCR does not guarantee the success of a ChIP-seq or ChIPmentation experiment. Therefore, sequencing data need to be examined. One million reads are enough to tell whether a ChIP-seq or ChIPmentation experiment work or not for most factors. A shallow sequencing of a library is a good and economical way of assessing the quality of the experiment. We have found that the most efficient way of telling whether a ChIP experiment work or not is by visual inspection. First, reads should be mapped to the reference genome using an aligner, such as Hisat2 [27]. Then the aligned reads can be used to perform peak calling using programs such as MACS [28]. Many peak callers also have the functionality to generate coverage files that can be viewed via UCSC genome browser (Fig. 4). Visual inspection on known target genes and the shape of the peak is informative about the quality of the experiments. A successful experiment should exhibit many bell-curve shaped peaks, and the peaks can be clearly identified from background.

Robust Low Input ChIP-seq: ChIPmentation

281

Fig. 4 UCSC genome browser screen shot across a gene dense region. ChIP: traditional ChIP-seq. ChM: ChIPmentation. H3K4me3 and H3K27ac marks exhibit clear and punctate peaks, while H3K27me3 mark exhibits broad domain of enrichment, which appears in different places comparing to H3K4me3 and H3K27ac

3. In most cases, the majority of the fragments should be within 200–1000 bp. Occasionally, some large fragments will be observed. This could be a combination of biology (such heterochromatin associated proteins) and the artifacts of Agilent Bioanalyzer, which artificially concentrate large fragments (note it is not a proper log scale like the traditional agarose gel). However, we found the large fragment does not affect sequencing, and we still get good sequencing results from libraries with large fragments. References 1. Kouzarides T (2007) Chromatin modifications and their function. Cell 128:693–705 2. Helin K, Minucci S (2017) The role of chromatin-associated proteins in cancer. Annu Rev Cancer Biol 1:355–377

3. Lambert SA, Jolma A, Campitelli LF, Das PK, Yin Y, Albu M, Chen X, Taipale J, Hughes TR, Weirauch MT (2018) The human transcription factors. Cell 172:650–665

282

Natalia Kunowska and Xi Chen

4. Barski A, Cuddapah S, Cui K, Roh TY, Schones DE, Wang Z, Wei G, Chepelev I, Zhao K (2007) High-resolution profiling of histone methylations in the human genome. Cell 129:823–837 5. Johnson DS, Mortazavi A, Myers RM, Wold B (2007) Genome-wide mapping of in vivo protein-DNA interactions. Science 316:1497–1502 6. Mikkelsen TS, Ku M, Jaffe DB et al (2007) Genome-wide maps of chromatin state in pluripotent and lineage-committed cells. Nature 448:553 7. Solomon MJ, Larsen PL, Varshavsky A (1988) Mapping protein-DNA interactions in vivo with formaldehyde: evidence that histone H4 is retained on a highly transcribed gene. Cell 53:937–947 8. Schmidt D, Wilson MD, Spyrou C, Brown GD, Hadfield J, Odom DT (2009) ChIP-seq: using high-throughput sequencing to discover protein-DNA interactions. Methods 48:240–248 9. Farnham PJ (2009) Insights from genomic profiling of transcription factors. Nat Rev Genet 10:605–616 10. Brind’Amour J, Liu S, Hudson M, Chen C, Karimi MM, Lorincz MC (2015) An ultralow-input native ChIP-seq protocol for genome-wide profiling of rare cell populations. Nat Commun 6:6033. https://doi.org/10. 1038/ncomms7033 11. Dahl JA, Jung I, Aanes H et al (2016) Broad histone H3K4me3 domains in mouse oocytes modulate maternal-to-zygotic transition. Nature 537:548–552 12. Lara-Astiaso D, Weiner A, Lorenzo-Vivas E et al (2014) Immunogenetics. Chromatin state dynamics during blood formation. Science 345:943–949 13. Adli M, Zhu J, Bernstein BE (2010) Genomewide chromatin maps derived from limited numbers of hematopoietic progenitors. Nat Methods 7:615–618 14. Shankaranarayanan P, Mendoza-Parra M-A, Walia M, Wang L, Li N, Trindade LM, Gronemeyer H (2011) Single-tube linear DNA amplification (LinDA) for robust ChIP-seq. Nat Methods 8:565–567 15. O’Neill LP, VerMilyea MD, Turner BM (2006) Epigenetic characterization of the early embryo with a chromatin immunoprecipitation protocol applicable to small cell populations. Nat Genet 38:835–841 16. Zwart W, Koornstra R, Wesseling J, Rutgers E, Linn S, Carroll JS (2013) A carrier-assisted

ChIP-seq method for estrogen receptorchromatin interactions from breast cancer core needle biopsy samples. BMC Genomics 14:232 17. Rotem A, Ram O, Shoresh N, Sperling RA, Goren A, Weitz DA, Bernstein BE (2015) Single-cell ChIP-seq reveals cell subpopulations defined by chromatin state. Nat Biotechnol 33:1165–1172 18. Skene PJ, Henikoff S (2017) An efficient targeted nuclease strategy for high-resolution mapping of DNA binding sites. eLife 6:e21856 19. Hainer SJ, Boskovic A, Rando OJ, Fazzio TG (2018) Profiling of pluripotency factors in individual stem cells and early embryos. bioRxiv 286351 20. Schmid M, Durussel T, Laemmli UK (2004) ChIC and ChEC; genomic mapping of chromatin proteins. Mol Cell 16:147–157 21. Schmidl C, Rendeiro AF, Sheffield NC, Bock C (2015) ChIPmentation: fast, robust, low-input ChIP-seq for histones and transcription factors. Nat Methods 12:963–965 22. Stadhouders R, Vidal E, Serra F et al (2018) Transcription factors orchestrate dynamic interplay between genome topology and gene regulation during cell reprogramming. Nat Genet 50:238–249 23. Rodrı´guez-Carballo E, Lopez-Delisle L, Zhan Y, Fabre PJ, Beccari L, El-Idrissi I, THN H, Ozadam H, Dekker J, Duboule D (2017) The HoxD cluster is a dynamic and resilient TAD boundary controlling the segregation of antagonistic regulatory landscapes. Genes Dev 31:2264–2281 24. Akay A, Di Domenico T, Suen KM et al (2017) The helicase Aquarius/EMB-4 is required to overcome intronic barriers to allow nuclear RNAi pathways to heritably silence transcription. Dev Cell 42:241–255.e6 25. Bolte C, Flood HM, Ren X, Jagannathan S, Barski A, Kalin TV, Kalinichenko VV (2017) FOXF1 transcription factor promotes lung regeneration after partial pneumonectomy. Sci Rep 7:10690 26. Akhtar J, More P, Kulkarni A, Marini F, Kaiser W (2018) TAF-ChIP: An ultra-low input approach for genome wide chromatin immunoprecipitation assay. bioRxiv 27. Kim D, Langmead B, Salzberg SL (2015) HISAT: a fast spliced aligner with low memory requirements. Nat Methods 12:357–360 28. Zhang Y, Liu T, Meyer CA et al (2008) Modelbased analysis of ChIP-Seq (MACS). Genome Biol 9:R137

Part IV Single Cell Proteomic Analysis

Chapter 18 Immunophenotyping of Human Peripheral Blood Mononuclear Cells by Mass Cytometry Susanne Heck, Cynthia Jane Bishop, and Richard Jonathan Ellis Abstract Mass cytometry is a variation of conventional flow cytometry using metal tagged antibodies for cell staining instead of fluorochromes and detection in a mass cytometer, a modified mass spectrometer that allows for separation of discrete masses of these metal tags by time of flight (TOF). Currently, up to 50 different metal tags are available for cell analysis. The lack of any significant mass spectral overlap and autofluorescence background makes mass cytometry uniquely suited for complex high-dimensional phenotypic and functional analysis at the single cell level, thus accelerating biomarker discovery and drug screening. Here we describe a workflow for phenotyping of human peripheral blood mononuclear cells (PBMCs) covering cell staining, instrument setup of a Fluidigm Helios™ mass cytometer, and sample acquisition, and summarize a basic workflow of data analysis. Key words Mass cytometry, MaxPar™, Lanthanide, Metal conjugated antibody, Rhodium intercalator (103Rh), Iridium cell ID marker (191/193Ir), CyTOF, Helios™, EQ bead, Normalization

1

Introduction For mass cytometry, traditional inductively coupled plasma mass cytometry (ICP-MS) has been modified to allow for the introduction and measurement of metal isotope-labeled cell material. Since the introduction of the mass cytometry platform (CyTOF™ and MaxPar™ reagents) in 2009, it has had a tremendous impact on the field of cytometry, immune-monitoring, and biomarker discovery [1–6]. Currently, about 50 purified stable isotopes, mostly of the lanthanide (rare-earth metal) group of elements, have been selected to tag probes mostly using the proprietary Fluidigm MaxPar™ reagent system and covering a mass range of 89–209 kDa (see Note 1). Lanthanides are typically absent from biological matter non radioactive and their masses are distinct from elements composing biological matter, making them ideally suited probes [2]. While we do not observe background equivalent to spectral

Valentina Proserpio (ed.), Single Cell Methods: Sequencing and Proteomics, Methods in Molecular Biology, vol. 1979, https://doi.org/10.1007/978-1-4939-9240-9_18, © Springer Science+Business Media, LLC, part of Springer Nature 2019

285

286

Susanne Heck et al.

Fig. 1 Schematic overview of the mass cytometry workflow. A liquid sample containing fixed cells labeled with metal-tagged antibodies/probes and EQ beads for later data normalization (a) is introduced into the mass cytometer front end via a nebulizer at a rate of ~500 cells/s creating an aerosol (b). Cells are then transported toward the torch where they enter a hot argon plasma of ~7500 K (c) to be atomized and ionized. Approximately 50% of injected cells are lost in the system before entering the mass cytometer apparatus. The resulting ion cloud is introduced into the mass cytometer via a series of metal cones bringing the ions from atmospheric pressure to an internal vacuum. After filtering out noncharged particles and photons and selective removal of low mass ions (such as elements composing biological matter, argon, and argon dimers) in the quadrupole (d), the ion cloud containing the isotopic metal tags used for labeling the cells enters the TOF chamber where probes are separated by time of flight based on their mass-to-charge ratio as they accelerate toward the detector (e). The time-resolved detector measures a mass spectrum that corresponds to the identity and quantity of each isotopic probe on a per-cell basis (f), delivering a “mass fingerprint” of each cell. Data is saved in .fcs format (g) and can be analyzed using third party software (h). Figure modified from [4]

overlap known from fluorescent flow cytometry, it is important for panel design to consider the impact of isotopic impurities, oxidation and abundance sensitivity on population resolution [4–7] (see Note 2). Many readily conjugated antibodies are now commercially available; however, it is often necessary to produce custom reagents for a given project (see Note 1). In addition to antibodies we also use metal isotopes as cell identifiers: a 103-Rhodium (103 Rh) (103 Rh) based intercalator as well as cisplatin (194/195Pt platinum isotopes) are used to identify dead cells and Iridium (191/193Ir), intercalating into DNA/RNA, is used to identify nucleated cell events. Figure 1 summarizes the workflow of a complete mass cytometry experiment. At the time of measurement fixed labeled cells are resuspended in water and introduced as single cells into a

Immunophenotyping by Mass Cytometry

287

Fig. 2 Rain plot of mass cytometry raw data (example) as seen during data acquisition. A human PBMC sample was labeled using the panel described in Table 1. The rain plot shows two independent nucleated events (boxes A and B). On top of the rain plot all available mass channels are displayed with markers added according to panel composition. Channel 140Ce EQ-beads as this metal is uniquely reserved for the normalization beads and never to tag antibodies. (C) List of channels and panel components. Cell events are identified by the presence of CD45 (D) as leukocytes and Iridium (191/193Ir) (E) as nucleated events. Arrows indicate positive signals observed in individual mass channels corresponding to event A or B, resulting in these cells’ typical mass fingerprint

hot argon plasma where they are atomized and ionized. After removal of non-informative low mass ions those ions resulting from lanthanide tags enter the detection chamber of the mass cytometer. Here they are separated by time of flight and counted on the detector where they arrive at defined intervals with increasing mass-to-charge ratio (lightest ions arrive first, heaviest ions arrive last). A typical rain plot showing raw mass cytometry data as seen during acquisition on the mass cytometer is shown in Fig. 2. Resulting high-dimensional data are saved in .fcs file format. Data are normalized using a “spiked in” 4-element bead calibrator solution (EQ-beads) to correct for sensitivity changes of the apparatus during acquisition [8]. While analytical software packages for traditional flow cytometry can be valuable for a first quality control of results, data files are typically analyzed by unsupervised methods using novel algorithms such as SPADE, viSNE, Citrus, or Phenograph to name the most popular ones at this stage [9–12]. Detailed advance planning of a mass cytometry experiment is essential for success. After developing a clear scientific question/ hypothesis researchers must procure sufficient sample material and controls, carefully design the marker panel (see Note 2), validate and optimize reagents as well as the full panel, and finally plan for and conduct sample acquisition and data analysis. Staining protocols for mass cytometry are largely comparable to those used for traditional fluorescent flow cytometry. We will use

288

Susanne Heck et al.

the example of a 20-marker surface phenotyping panel, combining eighteen metal-tagged antibodies as well as 103Rhodium intercalator as viability marker and 191/193-Iridium to identify nucleated cell events on cryopreserved human peripheral blood mononuclear cells (PBMC) to describe a typical mass cytometry experiment. Cryopreserved human PBMCs are the specimen of choice preserved during clinical and translational research projects and, thus, frequently used for immune-monitoring, giving the protocol wide applicability.

2

Materials All solutions and consumables used for mass cytometry must be free of contaminating background metals detectable in mass range 89–209 kDa as these can interfere with signals of interest and impact on the sensitivity and longevity of the detector. When first establishing mass cytometry technologies and when using novel reagents or buffers aliquots of all nonisotopic reagents should be analyzed for metal contaminants on the mass cytometer prior to handling biological specimen. Frequently observed contaminants are Barium (138Ba, contained in many commercial detergents), Iodine (127I, observed in some plastic consumables and in samples collected after skin sterilization with iodine-containing solutions) and lead (204/206/207/208Pb), resulting in regions with leadcontaining municipal water pipes. The use of disposable plasticware or glassware reserved solely for mass cytometry and proven free of contaminants is best to avoid background. Ultrapure Milli-Q® water (sensitivity 18 MΩ-cm at 25
C) is used for dilutions/cell suspensions where required. 1. Complete RPMI: RPMI medium, 10% FBS, 1 penicillin–streptomycin solution, 1 glutamine. 2. Cell thawing medium: Complete RPMI, 25 U/ml benzonase (Sigma). 3. 1 PBS and 10 PBS (Ca2+/Mg2+ free). 4. PBMC samples, cryopreserved and stored in liquid nitrogen. 5. Sterile CSM buffer: 1 PBS, 0.5% BSA, 0.02% sodium azide. 6. Sterile CSM-S buffer: 1 PBS, 0.5% BSA, 0.02% sodium azide, 0.3% Saponin. 7. Saponin stock solution: Dissolve 1 g saponin in 10 ml 1 PBS at 37
C, sterile filter using a 0.2 μm syringe filter and store at 4
C for up to 2 months. 8. Milli-Q®-grade water. 9. 0.4% trypan blue solution, filter sterilized. 10. Commercial Fc-receptor blocking solution for human cells.

Immunophenotyping by Mass Cytometry

289

11. Phenotyping antibodies: MaxPar™ conjugated metal tagged antibodies (Fluidigm, or tagged in house (see Note 1). Ensure that sufficient quantities of each antibody reagent are present before starting an experiment. 12. Viability stain 103 Rhodium intercalator (103 Rh, 500 stock solution, Fluidigm). Upon delivery aliquot 10 μl of the 103 Rh stock solution in 0.2 ml microcentrifuge tubes, store at 20
C. Once thawed, store at 4
C and use within 1 week. 13. 16% paraformaldehyde (PFA) stock solution, methanol-free, electron microscopy grade. 14. 191/193 Iridium DNA intercalator (500 μM stock solution, Fluidigm). Upon delivery aliquot 5 μl of the 191/193 Ir stock solution to 0.2 ml microcentrifuge tubes, store at 20
C. Once thawed, store at 4
C and use within 1 week. 15. EQ four-element calibration beads (Fluidigm) (see Note 3). 16. Ice bucket with dry ice to transport frozen cells. 17. Ice bucket with ice. 18. 37
C water bath. 19. Biosafety cabinet for tissue culture work (BSL2 grade). 20. Fume hood. 21. Household bleach. 22. Spray bottle with 70% isopropanol. 23. Tissue culture incubator, 37
C, 5% CO2 (for resting cells). 24. Tissue culture centrifuge. 25. High-speed microcentrifuge, min 10,000  g. 26. Vacuum aspirator with clean sterile tips (optional). 27. 1.5 ml microcentrifuge tubes, low protein binding. 28. Sterile plastic pastettes, 5 ml. 29. Cell strainer with 40 μm filter mesh. 30. Falcon 5 ml test tube with cell strainer snap cap. 31. 15 ml conical tubes. 32. 50 ml conical tubes. 33. Sterile serological pipettes (2 ml, 5 ml, and 10 ml). 34. Pipette aid for serological pipettes. 35. Calibrated adjustable volume pipettes (0.2–1000 μl). 36. Sterile filter tips, various sizes (0.2–1000 μl) (see Note 4). 37. Racks for 0.5 ml, 1.5 ml, 15 ml, and 50 ml conical tubes. 38. Vortex mixer.

290

Susanne Heck et al.

39. Nonlint paper wipes. 40. Gloves (powder free), laboratory coat, and goggles. 41. Waterproof marker pens. 42. Hemocytometer Neubauer cell counting chamber, handheld cell counter, and microscope (see Note 5). 43. Mass cytometer with argon supply (Fluidigm Helios™).

3

Methods

3.1 Cell Preparation from Frozen PBMC

1. Locate cells for thawing in liquid nitrogen log.

3.1.1 Preparation Prior to Thawing Cells

3. Centrifuge (for 15 ml Falcon tubes), set to room temperature (R/T).

2. Prewarm water bath to 37
C.

4. Prepare per PBMC 2 pastettes, label 1 15 ml tube with a unique identifier. 5. Prepare complete RPMI and cell thawing medium, prewarm to 37
C: Each sample will require one 15 ml conical tube with 10 ml of cell thawing medium and 15 ml of complete RPMI medium. Calculate the amount needed to thaw all samples used on the day. 6. Have the tissue culture hood prepared and running. (Wipe surface with 70% isopropanol, wipe all items to be taken into the tissue culture hood with 70% isopropanol, and follow sterile techniques throughout.) 7. Prepare a waste container (one-tenth filled with bleach) to dispose media supernatant. 8. Set tissue culture centrifuge to room temperature (R/T). 3.1.2 Thawing PBMC Samples

1. Remove samples from liquid nitrogen and transport to lab on dry ice. 2. Thaw frozen vials in 37
C water bath, being careful not to submerge tube or lid. 3. When cells are nearly completely thawed with the remaining frozen core the size of a grain of rice take out cryovial, dry outside with a paper towel sprayed with 70% isopropanol, and carry into the tissue culture hood. 4. Remove 15 ml conicals with 10 ml prewarmed cell thawing medium from water bath, wipe outside with a paper towel sprayed with 70% Isopropanol, and carry into the tissue culture hood.

Immunophenotyping by Mass Cytometry

291

5. Remove lids of 15 ml conical and cryovial containing PBMC sample. 6. Working quickly using a pastette add 1 ml of warm cell thawing medium slowly to the cells, then transfer the cells to their designated 15 ml conical tube. Rinse vial with more of the cell thawing medium to retrieve all cells. When working with multiple samples make sure to have a clear system to avoid mixing them up. Close 15 ml conical tubes. 7. Continue with any remaining samples without delay repeating steps 5 and 6. 8. Spin at 400  g for 10 min, R/T. 9. Wipe tubes with a paper towel sprayed with 70% isopropanol and carry into the tissue culture hood and remove lid. 10. Remove supernatant by decanting or aspirating medium and loosen the pellet by tapping the tube. 11. Gently resuspend pellet in 1 ml warm complete RPMI medium. Add 9 ml warm complete RPMI medium resulting in 10 ml total volume. Filter cells using a 40 μm cell strainer if needed (i.e., if you observe any clumps). 12. Spin at 400  g for 10 min, R/T. 13. Remove supernatant from the cells and resuspend the pellet by tapping the tube. 14. Resuspend cells in 5 ml complete RPMI medium. 15. Using a Neubauer chamber (hemocytometer): Mix cells up right before counting, take 20 μl cells and mix with 80 μl 0.4% trypan blue solution. Count trypan-blue negative live cells following standard procedure and calculate the live cell number per ml: ðAverage number of cells=squaresÞ  5 ðDilution factorÞ  104 ¼ Cell number=ml: Total cell number ¼ 5  cell number per ml as cells were resuspended in 5 ml of medium in step 14 (see Note 6). Expect 10–20% of dead cells in a typical PBMC sample. Samples with significantly more dead cells may result in poor material for mass cytometry acquistion as they are more likely to disintegrate when transferred into water before injection. Keep a close record on cell viabilty to develop your own sample inclusion/ exclusion criteria and track potential sources of poor sample quality. 16. For optimal detection of cryo-sensitive markers and better cell robustness cells are transferred into a 50 ml conical tube and

292

Susanne Heck et al.

allowed to rest for 2 h in complete RPMI in a tissue culture incubator. 17. While letting the cells rest calculate the volume needed to obtain two million viable cells for surface staining. 18. After rest period wipe outside of 50 ml conical with a paper towel sprayed with 70% isopropanol and carry into the tissue culture hood. 19. Open lid, mix up cells using a 5 ml serological pipette, and transfer volume corresponding to two million viable cells into a fresh, clearly labeled 15 ml conical tube. 20. Spin at 400  g for 10 min, R/T, and discard supernatant. 21. Gently tap and loosen pellet in 1 ml of warm PBS. Add 9 ml warm PBS resulting in 10 ml total volume. 22. Spin at 400  g for 10 min, R/T, and discard supernatant. 23. Gently tap and loosen pellet and resuspend in warm PBS to a concentration of 2  106 cells/ml. 24. Transfer a 1 ml aliquot of evenly resuspended cells at 2  106 cells per ml into a low protein-binding 1.5 ml microcentrifuge tube and proceed to Subheading 3.2 (see Note 7). 3.2 Viability Stain Using 103Rhodium and FcR Blocking

Viability staining is highly recommended to identify dead cells in conventional flow cytometry, however it is absolutely crucial in mass cytometry experiments to avoid artifacts in staining and high-dimensional data interpretation. Do not omit viability staining! The incubation period in 103 Rhodium viability stain [5] and Fc block reagents can be used to prepare the master mix of the antibody panel (see Notes 8 and 9). 1. Remove aliquot of 500 103 Rhodium (103Rh) stock solution from 20
C, allow to thaw and prepare fresh working solution by adding 1 μl 500 103Rh stock solution to 499 μl sterile 1 PBS. 2. Spin cells (400  g, 5 min, R/T), aspirate supernatant. 3. Disperse pellet and resuspend in 500 μl of 1Rh103-intercalator in 1 PBS. 4. Incubate for 15 min at R/T. 5. Spin cells (400  g, 5 min, R/T) and aspirate supernatant. 6. Wash by adding 1 ml CSM buffer and inverting the closed tube 3 times. 7. Spin cells (400  g, 5 min, R/T) and aspirate supernatant, being careful not to touch the cell pellet. 8. Disperse pellet in CSM buffer, add FcR block reagent for 2  106 cells (volume of FcR block according to manufacturer’s instructions) to reach a final volume of 50 μl of cell suspension (see Note 10).

Immunophenotyping by Mass Cytometry

293

9. Incubate for 10 min at R/T, then move on to Subheading 3.3 for surface antibody staining. 3.3 Surface Antibody Staining 3.3.1 Preparation Prior to Surface Staining with Metal-Conjugated Antibodies

1. Prepare a printout of all panel antibodies and titration values to have next to you when working in the lab. An example is shown in Table 1. The total stain volume (cells + staining buffer + Fc block + antibodies) must always be constant for all samples in an experimental series as staining is dependent on cell and antibody concentration. Typical total stain volumes for samples of ~1 to 5  106 cells are 100–150 μl. 2. Let your mass cytometry facility know in advance which metal channels you wish to record, the channel names (e.g., antibody name/viability stain/barcode) and panel names so that they can enter them into the mass cytometer in advance. This step is time-consuming for each new panel; however, good file annotation at this stage is essential to have meaningful metadata for downstream analysis.

3.3.2 Cell Surface Staining with Metal Tagged Antibodies

1. Remove antibodies from refrigerator and keep them on ice while working. 2. Centrifuge all antibodies before use to pellet potential antibody precipitates for 5 min, 10,000  g, 4
C, then only take solution from the top. 3. Prepare a master mix of antibodies (in CSM buffer as a diluent) in a 1.5 ml low protein binding microcentrifuge tube, labeled with the panel name: As in the example in Table 1, add 39.5 μl of CSM buffer to the tube and pipet in 0.5 μl or 1 μl of each antibody as listed. Scale up master mix for multiple samples. Make sure you have a clear system so that you know which antibodies you already added (see Note 11). 4. Vortex the master mix and spin for 5 min, at 10,000  g, 4
C to remove potential precipitates. Pipet only from the top, leaving any precipitate behind in this tube. 5. Add the antibody cocktail to 50 μl of cells (Subheading 3.2, step 8) and mix well immediately by gentle vortexing or gently pipetting sample up and down three times. 6. Incubate sample on ice for 60 min. 7. Wash by adding 1 ml of CSM buffer. 8. Spin at 400  g, 5 min, R/T, aspirate supernatant. 9. Disperse pellet and repeat wash with 1 ml of CSM buffer, aspirate supernatant. 10. Using the washed cell pellet, proceed to the cell fixation procedure in Subheading 3.4 (see Note 12).

294

Susanne Heck et al.

Table 1 Example of stain preparation worksheet for mass cytometry staining

Mass

Volume per stain Metal (μl)

P11K2108A NA

103

Rh

0

P11K3104B NA

191/ 193

Ir

0

89

Y

0.5

G034E3 141

Pr

0.5

RPA-T4

145

Nd

0.5

3146001B 0261618

RPA-T8

146

Nd

0.5

mIgG1

In house

2H7

147

Sm

0.5

Hu

mIgG1

3148004B 2191530

3G8

148

Nd

0.5

CCR4/CD194

Hu

mIgG2b 3149003A 1691504

205,410 149

Sm

0.5

CD3

Hu

mIgG1

UCHT1 154

Sm

0.5

CD45RA

Hu

mIgG2b 3155011B 1191694

HI100

155

Gd

0.5

CCR7

Hu

mIgG2a

3159003A 1891504

G043H7 159

Tb

0.5

CD14

Hu

mIgG2a

3160001B 0261612

M5E2

160

Gd

0.5

CXCR3/ CD183

Hu

mIgG1

3163004B 2951501

G025H7 163

Dy

0.5

CD45RO

Hu

mIgG2a

3165011B 2191526

UCHL1 165

Ho

0.5

CD27

Hu

mIgG1

3167002B 0141518

O323

167

Er

0.5

CD25

Hu

mIgG1

3169003B 1031505

2A3

169

Tm

1.0

CD25

Hu

mIgG1

In house

M-A251 169

Tm

1.0

CD57

Hu

mIgM

3172009B 0621514

HCD57

172

Yb

0.5

HLA-DR

Hu

mIgG2a

3174001B 0261619

L243

174

Yb

0.5

CD127

Hu

mIgG1

3176004B 0261616

A019D5 176

Yb

0.5

Isotype

Reagent catalogue Reagent number lot number

Stain

Target

Rhodium

L/dead n/a

201103B

Iridium

DNA

n/a

201192B

CD45

Hu

mIgG1

3089003B 3061505

CCR6/CD196

Hu

MIgG2B 3141003A 3061502

CD4

Hu

mIgG1

In house

CD8a

Hu

mIgG1

CD20

Hu

CD16

In house

N/A

N/A

N/A

N/A

Clone

HI30

Total Ab vol

10.5

100 - Ab vol

90.5

For example only—volumes will vary for each panel

3.4 Cell Fixation and Iridium Staining

All work is done in a fume cabinet to avoid exposure to formaldehyde fumes. 1. Remove aliquot of 500 μM 191/193Iridium stock solution from 20
C store, allow to thaw in fume hood (see Note 13).

Immunophenotyping by Mass Cytometry

295

2. Prepare fresh Fix-Perm buffer with Iridium in a 15 ml conical tube; per sample 500 μl of this solution is needed: Add 0.8 ml 10 PBS to 5.9 ml Milli-Q® grade water and mix well by pipetting up and down. Add 1 ml 16% PFA stock solution and 0.3 ml 10% saponin stock solution and mix well by carefully pipetting up and down with a serological pipette, avoiding producing foam. Add 2 μl 191/193Ir-intercalator (500 μM stock solution) and mix well by carefully pipetting up and down with a serological pipette, avoiding producing foam. Wrap tube in aluminum foil and store in the dark, lid tightly closed and protected from light. Use within 48 h. 3. Disperse the cell pellet from Subheading 3.3.2, step 10 and resuspend it in 500 μl of Fix-perm buffer with Iridium (191/193Ir). 4. Leave cells at room temperature for 1 h before placing at 4
C overnight (see Notes 14–16). 3.5 Sample Preparation and Acquisition

The following steps are done on the day of sample acquisition on the mass cytometer. Sample acquisition is usually done by manufacturer trained and experienced operators, typically in a central facility, due to the complexity of the apparatus. The operator will set up and tune the mass cytometer according to manufacturer’s SOP as detailed in the manufacturer user manual and samples will only be acquired after all QC parameters were passed. It is best to communicate the panel composition to the operator prior to arriving for sample acquisition as entering these data into the Helios™ acquisition software will take up time best used for sample run. Work to prepare the samples for injection is done in a fume cabinet to avoid exposure to toxic formaldehyde fumes. 1. Remove samples from 4
C storage and spin at 600  g, 7 min, R/T in a microcentrifuge (see Note 17). Aspirate supernatant, being careful to not dislodge the cell pellet. 2. Resuspend pellet in 500 μl of 1 PBS. 3. Spin down at 600  g, 7 min, R/T in a microcentrifuge. 4. Aspirate supernatant, being careful to not dislodge the cell pellet. 5. Wash cells in 500 μl 1 PBS (600  g, 7 min, R/T). OPTIONAL: Count cells before centrifugation using a hemocytometer or an automated cell counter following manufacturer’s instructions to determine the cell number before water washes (see Note 18). 6. Aspirate supernatant, leaving pellet covered with a small volume (~10 μl) of 1 PBS. Place tubes on ice.

296

Susanne Heck et al.

7. When the Helios™ mass cytometer is ready for sample acquisition proceed with the first sample while any further samples will remain on ice (see Note 19). 8. Prepare an aliquot of Fluidigm EQ-beads in a 15 ml conical tube: Vortex and sonicate (30 s) the EQ bead stock solution, then prepare a 1/10 working dilution by adding 500 μl of EQ beads to 4.5 ml of Milli-Q water. 9. Wash cells with 1 ml Milli-Q® water and aspirate supernatant with pipette tip. (Vacuum is more efficient at removing the saline solution without disturbing the cell pellet.) 10. Repeat wash step. 11. Resuspend cells in 500 μl 1/10 EQ beads in Milli-Q® water. Filter sample into a 5 ml round bottom test tube with cell strainer snap cap. Clearly write the sample identifier, concentration, and volume on the side of the tube. 12. Determine cell number with hemocytometer or automated cell counter. Observe the quality of the single cell suspension: cells should be >95% single cells. This count is not optional -samples must be at a consistent concentration for injection into the mass cytometer 13. Adjust the cell concentration to 0.5  106 cells per ml using 0.1  EQ beads in Milli-Q® water (see Note 20). 14. The sample is introduced into the mass cytometer via the automated sample loader station of the Helios™ mass cytometer. Either a total number of events or a run time can be chosen as the stopping parameter. The Helios™ sample introduction rate is fixed at 0.03 ml/min. The operator will observe the acquisition and ensure that the sample will not run dry to prevent introduction of air into the fine capillaries transporting cells into the nebulizer (see Note 21). 15. To prevent sample carryover the instrument is cleaned between samples by placing a 5 ml round bottom test tube with 2 ml Milli-Q® water via the sample injection port. Water is run until the rain plot on the acquisition pane is free of events (see Fig. 2). Typically, this step takes between 10 and 20 min (see Note 22). Prepare the next sample following steps 9–14. 16. Normalize raw .fcs files using the normalization algorithm provided by Fluidigm’s CyTOF Software version 6.7. This essential step can be performed by the operator or the user and will generate a data file ready to analyze by third-party software (see Note 23). 17. Export normalized data in .fcs file format for downstream analysis.

Immunophenotyping by Mass Cytometry

297

Fig. 3 Initial data cleanup of mass cytometry data in preparation for high-dimensional phenotyping and data quality control. Plots shown were generated in CytoBank™ using data from a PBMC sample and the panel listed in Table 1. Gated events are encircled by blue lines and were applied in hierarchical order from plot A to E. include (a) Gating out of EQ bead events (time vs. 140Ce, a metal isotope only occurring in EQ beads in the mass cytometry data files), (b) Gating out cell doublets (191Ir vs. cell length) (see Note 24), (c) Gating on Iridium (191Ir vs. 193Ir) to remove noncell events, (d) Gate out dead cells (time vs. 103Rh), (e) Purity check on 191 Ir vs. CD45 (or other universal cell marker) to remove any remaining non-CD45 positive cell events 3.6 Initial Data Cleanup for HighDimensional Data Analysis

4

Strategies for unsupervised analysis of high-dimensional mass cytometry data usually apply a set of algorithms [9–12] to obtain readouts on biomarkers and will due to the complexity of the steps involved not be covered in this chapter. However, there are common steps for initial data cleanup in preparation for unsupervised analysis which have to be performed for all files. These steps include (1) gating out of EQ bead events (time vs. 140Ce, a metal isotope only occurring in EQ beads in the mass cytometry data files), (2) gating out cell doublets (191Ir vs. cell length) (see Note 24), (3) Gating on Iridium (191Ir vs. 193Ir) to remove noncell events, (4) gating out dead cells (time vs. 103Rh), (5) check on 191 Ir vs. CD45 (or other universal cell marker) to remove any remaining non-CD45 positive cell events, and (6) OPTIONAL, IF POSSIBLE IN THE CHOSEN PANEL: use a combination of biologically non overlapping markers to exclude further aggregates (such as CD3 (only on T cells) vs. CD20 (only on B cells), CD3 (only on T cells) vs. CD14 (only on monocytes) or CD20 (only on B cells) vs. CD14 (only on monocytes). Events resulting in the final cleanup gate after step 5 (or step 6 if panel allowed for the optional step) are exported as a new .fcs file and used for further analysis steps. Figure 3 illustrates a typical data cleanup of mass cytometry data.

Notes 1. While many antibodies are available in metal tagged format most panels do require tagging in-house, following the same procedure used by the vendor. For in-house conjugation 100 μg of antibody in a protein-free formulation (no BSA, no gelatin) and a MaxPar™ metal labeling kit (Fluidigm) is required. Published protocols work best with IgG subclass

298

Susanne Heck et al.

antibodies, although other subclasses can be tested. Clones need to be validated after conjugation for metal content and functionality as the tagging process occasionally can affect the binding capacity of the reagent. MaxPar™ labeling kits are not available for Yttrium (89Y) and Wismut (209Bi) while there is a limited set of antibodies to highly expressed antigens are commercially available. In addition to lanthanides paladium and platinum isotopes, silver nanoparticles, and Q-dots (cadmium core) have been used to produce metal conjugated clones, albeit some showing lower sensitivity than the lanthanide reagents [15, 16]. 2. Panel design for mass cytometry requires careful consideration with respect to isotopic impurities inherent to enriched lanthanides. Most tags used for mass cytometry naturally occur as mixtures of stable isotopes with various masses. Most isotopes used for mass cytometry are sold at purities >98% purity, however some isotopes contain up to 4% contamination of another isotope of the same element (for details see tracesciences.com). It is important not to place antibodies to highly expressed antigens on tags with high impurities to avoid spill into neighboring channels where low expression antigens are to be measured. Equally careful titration of antibodies tagged with more impure tags will reduce spillover into neighboring channels. Rules for panel design are taken into account in the MaxPar™ panel designer (Fluidigm), a free online tool supporting complex panel design for mass cytometry. 3. ICP-MS instruments like the mass cytometer show slight signal drift over the course of the day, between days and between different instruments resulting in small differences in sensitivity between data sets. To normalize mass cytometry EQ beads are spiked into each sample. Four-element EQ beads (Fluidigm) are a mixture of naturally occurring cerium (140/142Ce), europium (151/153Eu), holmium (165Ho), and lutetium (175/176Lu). Data are normalized to a global reference standard determined for each lot of EQ by the manufacturer. 4. Do not use non filter tips for mass cytometry experiments to avoid metal carryover between samples. 5. If frequently running mass cytometry experiments consider the use of an automated cell counter (e.g., Life Technologies® Countess II used with Countess slides for easier workflows). 6. Typical recovery from healthy adult human donors is 4–8  106 cells from a vial frozen at 10  106 cells/vial, cell recovery from patient material and children can vary. 7. The total number of cell required depends on the specific research question and has to be determined during assay optimization. Generally, the population with the lowest expected

Immunophenotyping by Mass Cytometry

299

frequency will determine the total number of events required to achieve statistically significant results with acceptable CV during data analysis. Contrary to fluorescent cytometry it is not possible to put a stopping gate on a specific subpopulation at the time of writing this chapter, but rather only to collect total counts. Furthermore, a loss of ~50% of the introduced cell number has to be respected when calculating the total number of cells required. 8. Cisplatin is often preferred for its more robust signal and quicker workflow [13]. 103Rhodium DNA intercalator is however less toxic and the preferred solution when using cell suspension after enzymatic tissue digest, where cisplatin can lead to unspecific background. Cisplatin must not be used on cell samples derived from patients that have undergone treatment with a cisplatin containing regiment (cancer therapy). 9. Below is the alternative workflow for using cisplatin as viability stain. As this protocol is significantly faster it is advisable to prepare master mixes of antibodies prior to starting the cisplatin stain. Additional material not listed under paragraph 2: cisplatin stock solution (Sigma-Aldrich, Catalogue number 479306, linear formula Pt(NH3)2Cl2, MW 300.05) and DMSO. All work is done in a fume hood, carefully avoiding skin and eye contact with cisplatin (toxic). 1. Prepare cisplatin master stock at 100 mM in DMSO, dispense in 0.35 ml aliquots in Eppendorf tubes and freeze at 80
C. 2. From the master mix prepare a working stock solution: dilute 1 in 10 for a 10 mM working stock in DMSO (10–20 μl aliquots) and freeze at 80
C. 3. On day of experiment thaw an aliquot of the working stock solution. (Master stock is thawed only when you need to make a set of new working stock aliquots.) 4. Add 2.5 μl of the working stock to 997.5 μl of 1 PBS per sample (final cisplatin stain concentration 25 μM). 5. Make sure you have all of the following items ready before you start: vortex, timer, CSM buffer to quench, pipettes, and centrifuge. 6. Dispense a 1 ml aliquot of evenly resuspended cells at 2  106 cells per ml into a 5 ml round bottom test tube. Use capped tubes. 7. Spin at 400  g, 5 min, R/T, and aspirate supernatant. 8. Disperse pellet in PBS (no BSA, i.e., no extra protein), spin down at 400  g, 5 min, R/T, and aspirate supernatant.

300

Susanne Heck et al.

9. Resuspend pellet in 1000 μl of PBS, make sure there are no clumps, and filter through a 40 μm filter mesh if required. 10. Add 2.5 μl of cisplatin working stock by pipette and immediate vortex. Start timer set to 1 min. 11. Incubate at R/T and quench each after exactly 1 min by adding 3 ml CSM. 12. Spin at 400  g, 5 min, R/T, and aspirate supernatant. 13. Wash by adding 1 ml CSM and inverting tube 3. 14. Resuspend cells in 1 ml CSM buffer and transfer to low protein binding 1.5 ml microcentrifuge tube. Continue protocol as described from Subheading 3.2, step 7. 15. FcR blocking is essential when working with cells of hematopoietic origin such as PBMCs, whole blood, bone marrow or spleen suspensions to block unspecific antibody binding via their cell surface FcγR receptors while it can be omitted for other tissue and cell types. 16. Volumes of antibodies must be determined using your specific biological sample type in titration experiments prior to running final samples. Separate master mixes must be made if you perform a surface and intracellular staining procedure. Master mixes are not stable when stored in CSM buffer but must be used on the day of preparation. 17. If the workflow also includes intracellular staining you will now move to the fixation permeabilization step, followed by staining with a cocktail of intracellular antibodies and a number of washes. It is best to finish surface and intracellular staining on the same day, then fix the stained sample overnight. Some transcription factors/cytokines do not stain well if cells are fixed overnight prior to the intracellular stain. Once completed the cells will follow the workflow in Subheading 3.4. For phosphoflow samples fixed in methanol can be stored for a prolonged time at 80
C. 18. Ensure to have sufficient good quality paraformaldehyde (PFA) fixative: A 16% stock solution of electron-microscopy grade material gives good results. The stock solution is usually shipped in 10 ml glass ampoules which can be opened when required and transferred to a 15 ml tube wrapped in foil (protected from light) and stored in the chemicals cupboard. The 16% PFA stock solution can be kept for 1 month before being discarded. Working dilutions (2%, in PBS) are made fresh and can be stored for 48 h (again, protected from light) before being discarded. 19. A minimum fixation time of 1 h at R/T is required, but will result in significant cell loss. A fixation time of 4 h gives better cell preservation, but overnight fixation is recommended which

Immunophenotyping by Mass Cytometry

301

gives the best fixation. Longer incubations of up to 48 h have also been successful. 20. If it is not possible to acquire the sample within 48 h of staining on a mass cytometer it is advisable to freeze samples to avoid variation in data quality and continue with Subheading 3.5 after recovering the stored material according to protocol [14]. 21. For cells which are already permeabilized after intracellular stain with a detergent based perm solution, prepare the fixation solution as follows: Prepare fresh Fix-Perm buffer with Iridium in a 15 ml conical tube; per sample 500 μl of this solution is needed: Add 0.8 ml 10 PBS to 6.2 ml Milli-Q grade water and mix well by pipetting up and down. Add 1 ml 16% PFA stock solution and mix well by carefully pipetting up and down. Add 2 μl 191/193Ir-intercalator (500 mM stock solution) and mix well by carefully pipetting up and down with a serological pipette. Wrap tube in aluminum foil, store in the dark, lid tightly closed and protected from light. Use within 48 h. 22. After incubation in FixPerm buffer with Iridium it is important to spin the cells at a higher speed to avoid cell loss. For PBMC samples 600  g, 7 min, R/T are sufficient; however, other sample types may require different conditions, which must be determined by the researcher. Fixed cells are smaller than their fresh equivalents and, thus, do not pellet as easily. Also, the pellet is more transparent and more easily dislodged from the tube than unfixed cells. Place the tubes into the centrifuge rotor always in the same orientation with the hinge of the lid facing outward so that you can expect the pellet always in the same location. Any mixing steps for fixed cells should be less vigorous—short pulse vortex or gentle pipetting is recommended from this point. 23. Counting cells prior to Subheading 3.5, step 9 can be informative: Extensive cell loss during water washes is indicative of poor fixation and/or fragile cells and will help guide your further experiments. If the cell count shows that there are more cells than required to achieve your target event rate consider perhaps to take an aliquot of the sample and reserve the remaining material in case you encounter any problem during the injection of the first portion. Once cells have proceeded to Subheading 3.5, step 10 they can no longer be salvaged. 24. Usually several samples will be acquired per experiment on a single day. Assuming 250,000 events will be saved per sample it is possible to read ~10 samples during normal working hours.

302

Susanne Heck et al.

It is NOT advisable to rebuffer all samples at once into water/ EQ beads as cells will disintegrate the longer they stay exposed to water. Therefore single samples are prepared as described while remaining cell pellets stay on ice. While acquisition of sample 1 is progressing, the second sample will be prepared for injection. 25. For barcoded samples slightly higher cell concentrations can be used (0.75–1.0  106), however the concentration should be constant for any given type of experiment. Using concentrations above 0.75–1  106 cells/ml leads to loss in resolution resulting from ion clouds of single cells overlapping each other during acquisition on the mass cytometer and hence to loss of data. 26. The number of required events will depend on the experimental question and has to be determined by the user during the experimental design phase. If any cells remaining at the bottom after finishing the first tube run have to be acquired as well they can be resuspended in ~0.25 ml of Milli-Q® water and injected as well. 27. If more stringent washing is required the operator will run Helios cleaning solution (Fluidigm) followed by Milli-Q® water. 28. Normalization software contained in Helios 6.7 software can be downloaded from Fluidigm. (Create account at http:// www.dvssciences.com/create-account.php., then navigate to Data Processing Software & Documents > Helios >6.7 Software Package for Stand-alone Workstations and download Helios 6.7 software for stand-alone workstations.) Another option delivering equally good results has been published [8] and can be run in MATLAB (MATLAB Compiler Runtime (MRC) version 8.1 (R2013a). For normalization software see https://github.com/nolanlab/bead-normalization/releases. 29. In addition to cell length it is possible to add other Gaussian parameters characterizing the signal pulses on the mass cytometer: Center, Offset, Width, and Residual are saved as metadata alongside cell event date in each .fcs files acquired on a Helios™ mass cytometer. References 1. Bandura DR, Baranov VI, Ornatsky OI, Antonov A, Kinach R, Lou X, Pavlov S, Vorobiev S, Dick JE, Tanner SD (2009) Mass cytometry: technique for real time single cell multitarget immunoassay based on inductively coupled plasma time-of-flight mass spectrometry. Anal Chem 81(16):6813–6822

2. Ornatsky OI, Kinach R, Bandura DR, Lou X, Tanner SD, Baranov VI, Nitz M, Winnik MA (2008) Development of analytical methods for multiplex bio-assay with inductively coupled plasma mass spectrometry. J Anal At Spectrom 23(4):463–469

Immunophenotyping by Mass Cytometry 3. Bendall SC, KSimonds EF, Qiu P, Amir ED, Krutzik PO, Finck R, Bruggner RV, Melamed R, Trejo A, Ornatsky OI, Balderas RS, Plevritis SK, Sach K, Pe’er D, Tanner SD, Nolan GP (2011) Single cell mass cytometry of differential immune and drug responses across a human hematopoietic continuum. Science 332:687–696 4. Virani F, Tanner SD (2015) Mass cytometry: an evolution in ICP-MS enabling novel insights in single-cell biology. Spectroscopy 30(5). http://www.spectroscopyonline.com 5. Ornatsky O, Bandura D, Baranov V, Nitz M, Winnik MA, Tanner S (2010) Highly multiparametric analysis by mass cytometry. J Immunol Methods 36:1–20 6. Tanner SD, Baranov VI, Ornatsky OI, Bandura DR, George TC (2013) An introduction to mass cytometry: fundamentals and applications. Cancer Immunol Immunother 62 (5):955–965 7. Takahashi C, Au-Yeung A, Fuh F, RamirezMontagut T, Bolen C, Mathews W, O’Gorman WE (2017) Mass cytometry panel optimization through the designed distribution of signal interference. Cytometry A 91A:39–47 8. Finck R, Simonds EF, Jager A, Krishnaswamy S, Sachs K, Fantl W, Pe’er D, Nolan GP, Bendall SC (2013) Normalization of mass cytometry data with bead standards. Cytometry A 83(5):483–494 9. Qiu P, Simonds EF, Bendall SC, Gibbs KD Jr, Bruggner RV, Linderman MD, Sachs K, Nolan GP, Plevritis SK (2011) Extracting a cellular hierarchy from high-dimensional cytometry data with SPADE. Nat Biotechnol 29:886–891

303

10. Amir ED, Davis KL, Tadmor MD, Simonds EF, Levine JH, Bendall SC, Shenfeld DK, Krishnaswamy S, Nolan GP, Pe’er D (2013) viSNE enables visualization of high dimensional single-cell data and reveals phenotypic heterogeneity of leukemia. Nat Biotechnol 31:545–552 11. Bruggner RV, Bodenmiller B, Dill DL, Tibshirani RJ, Nolan GP (2014) Automated identification of stratifying signatures in cellular subpopulations. Proc Natl Acad Sci U S A 111(26):E2770–E2777 12. Levine JH, Simonds EF, Bendall SC, Davis KL, Amir e-AD, Tadmor MD, Litvin O, Fienberg HG, Jager A, Zunder ER, Finck R, Gedman AL, Radtke I, Downing JR, Pe’er D, Nolan GP (2015) Data-driven phenotypic dissection of AML reveals progenitor-like cells that correlate with prognosis. Cell 162(1):184–197 13. Fienberg HG, Simonds EF, Fantl WJ, Nolan GP, Bodenmiller B (2012) A platinum-based covalent viability reagent for single-cell mass cytometry. Cytometry A 81(6):467–475 14. Sumatoh HR, Teng KW, Cheng Y, Newell EW (2017) Optimization of mass cytometry sample cryopreservation after staining. Cytometry A 91(1):48–61 15. Mei HE, Leipold MD, Maecker HT (2016) Platinum-conjugated antibodies for application in mass cytometry. Cytometry A 89 (3):292–300. https://doi.org/10.1002/cyto. a.22778 16. Hartmann FJ, Simonds EF, Bendall SC (2018) A Universal Live Cell Barcoding-Platform for Multiplexed Human Single Cell Analysis. Sci Rep 8:10770. https://doi.org/10.1038/ s41598-018-28791-2

Chapter 19 Classification of the Immune Composition in the Tumor Infiltrate Davide Brusa and Jean-Luc Balligand Abstract Flow cytometry is one of the most suitable techniques for analyzing and classifying different cell suspensions derived from blood or others compartments. The characterization of all different cellular subtypes is made with different antibodies that detect surface or intracytoplasmic antigens. Here we describe the technique to thoroughly characterize immune cells from tumor infiltrates and proceed to isolation using single-cell sorting. Key words Flow cytometry, FACS analysis, Immune system, Immune infiltrate, Tumor immunology, Single-cell sorting

1

Introduction Fluorescence-activated cell sorting (FACS) is increasingly used worldwide in several areas of clinical and translational research [1, 2], for phenotypic characterization and functional activity by measuring cytokines, intracellular signaling and cell proliferation. It is a rapid, sensitive, quantitative, single-cell analysis technique that still may give impetus to new developments, such as the identification of circulating tumor cells (CTS) [3] or microvesicles [4, 5]. A flow cytometer is constituted of three main systems: fluidics, optics and electronics. The fluidics is the system used for particles transportation, in a single-cell suspension, through the hydrodynamic focusing in front of the laser beam, in the so-called interrogation point. Here cells are enlighten by the lasers and all the characteristics are sent to the optical system, where the fluorescence is divided by band pass filters to select each wavelength detected by photomultipliers (PMT). PMTs are the electronic system converting light signals in electronic signals, for further processing by the computer. Flow cytometry is used for characterization of cells through scatter analysis and fluorescence.

Valentina Proserpio (ed.), Single Cell Methods: Sequencing and Proteomics, Methods in Molecular Biology, vol. 1979, https://doi.org/10.1007/978-1-4939-9240-9_19, © Springer Science+Business Media, LLC, part of Springer Nature 2019

305

306

Davide Brusa and Jean-Luc Balligand

Scatter analysis describes the size (forward-scattered light or FSC) and internal complexity (side-scattered or SSC) according to the presence of granules and polylobate nuclei. Fluorescence identifies the different types of white blood cells in lymphocyte, monocyte, macrophage, and granulocyte compartments. Inside the lymphocyte compartment there are many subpopulations, as T, B, NK, T-reg cell subsets that we cannot identify with scatter analysis. Consequently, we need surface markers to identify the specific cell subsets. These markers are called Cluster Designation (CD) and are identified by monoclonal antibodies that in flow cytometry are conjugated by fluorochromes [6]. Fluorochromes are particular molecules that, once irradiated by a laser source, emit fluorescence in a higher wavelength then the excitation one. Emission lights are recorded by the flow cytometer PMTs and data are showed as dots in a Cartesian plane called dot plot. The two axes represent the emission fluorescences and cells are represented as dots according to the amount of fluorescences expressed. Since flow cytometry has always been used to detect different cell subpopulations in different blood diseases, we apply this method to detect immune subpopulations in tumor infiltrates. For this purpose, we process the surgical biopsies of different tumors in order to get a single-cell suspension. Subsequently we stained these samples with a large number of antibodies in order to obtain as much information as possible on cellular subpopulations. Identified cells can be easily isolated with a single-cell sorter: this instrument is suitable for recovering all the needed cells from the total suspension, making them available for further protein, RNA, and DNA analysis by next generation sequencing (NGS).

2

Materials All antibodies and buffers should be stored at 4
C and used within the expiration date. Renew and filter the buffers each week.

2.1 Samples Preparation Buffers

1. Washing buffer: phosphate buffered saline (PBS) without Ca2 + /Mg2+ with 0.5% BSA (see Note 1). 2. Digestion buffers: trypsin, Accutase, or collagenase type 1 (10 μg/mL) þ DNAse (10 μg/mL). Prepare and use according to the type of the tissue (see Note 2). 3. Gradient buffer: Ficoll (see Note 3). 4. Blocking buffer: PBS 1–2% BSA or commercially available solutions blocking the Fragment Crystallizable (FcR) receptors (see Note 4). 5. Viability dyes: PI, 7-AAD, DRAQ5, DRAQ7, or DAPI.

Single Cell Analysis by Flow Cytometry

2.2

FACS Buffers

307

1. Staining buffer: PBS w/o Ca2+/Mg2+, 1% BSA, 1–2 mM EDTA (see Note 5). 2. Fixation buffer: 2–4% paraformaldehyde (PFA) solution (see Note 6). 3. Permeabilization buffers: 0.1% saponin PBS (see Note 7).

2.3 Antibodies and Beads

1. Purified monoclonal antibodies or fluorochrome-conjugated antibodies (Abs) according to the analysis needed (see Note 8) should be titrated before use by each laboratory. 2. Compensation beads to set the right compensation between fluorochromes in a multiparametric staining. 3. Calibration beads to check the daily performances of the instrumentation.

2.4

Tubes and Filters

1. 5 mL 12  75 mm FACS tubes. 2. 70–100 μm tube filters.

2.5

Sorting Buffers

1. Resuspension buffer: PBS, 1–2% BSA, 1–2 mM EDTA. 2. Recovering buffers: Complete medium (5–10%FBS, 25 mM HEPES in DMEM/RPMI).

3

Methods All procedures have to be performed at room temperature except where differently indicated.

3.1 Samples Preparation

1. Partially digest the tumors or biopsies using the digestion buffer and make 3–5 different injections into the tissue with a syringe according to the size of tumor tissue, in order to smash easily the tissue afterward. Incubate for 30 min at 37
C. 2. Take the sample and place it on a 100 μm nylon strain and use the syringe plunger to smash and get the single-cell suspension through the strainer. Block the digestion before proceeding with further steps with ice-cold complete medium and wash out the buffer (see Note 9). 3. Tissue homogenate can be stratified on Ficoll (density of 1077 g/mL) to separate the white blood cells (WBC) from parenchymal and dead cells or debris. Add 5 mL of Ficoll in a 15 mL Falcon tube and stratify 10 mL of tissue homogenate on it (see Note 10). Centrifuge at 400  g for 30 min at room temperature (RT) with no brakes (see Note 11). 4. Leukocytes are separated by red blood cells (RBC), tissue cells, and debris. Leukocytes will form an opaque layer between the Ficoll and medium, all other cells will be in the pellet at the bottom of tube. Remove and discard the top part over the layer

308

Davide Brusa and Jean-Luc Balligand

to recover better the opaque interphase layer containing leukocytes. Take the interphase using a pipette and add to a fresh 50 mL Falcon tube containing PBS w/o Ca2+/Mg2+. Centrifuge and perform three washes with PBS to remove any trace of the Ficoll (see Note 12). 5. Resuspend the cell pellet in staining buffer and count the cells always before proceeding with staining. Divide the cells in the 12  75 mm tubes with minimum of 105 cells up to 1.5  106 cells maximum (see Note 13). 3.2 Staining Procedure

1. Take the amount of cells needed and proceed with FcR blockade at 4
C for 10–15 min if your cells express high levels of Fc receptors. 2. Proceed directly with staining without washing. Abs are added in 100 μL of staining buffer for the pellet resuspension in the right concentration according to datasheet of the producer or according to the laboratory titrations [7]. 3. Incubate for 15–20 min at room temperature (RT) protecting from light (see Note 14). 4. Resuspend the cells in wash buffer and centrifuge to discard the surnatant. Add 100–200 μL of resuspension buffer for the analysis (see Note 15). 5. If Abs are unconjugated, an indirect staining is needed. Primary Abs against the cell antigen is added with the same conditions as for a direct staining. After two washes in washing buffer, the cells are resuspended again in staining buffer for the binding with secondary conjugated Abs against primary Abs. Incubate for 10 min at RT in the dark and wash the cells. Resuspend as in step 4. 6. If the sample cannot be read in the same day of the preparation, proceed with the fixation with the Fixation buffer. 7. PI, 7-AAD, or DAPI (if UV or violet laser is provided) is added for dead cells discrimination just before analysis (see Note 16) and only if the cells are not fixed (see Note 17).

3.3

FASC Analysis

1. The tumor infiltrate analysis consists of detecting many subpopulations in the white blood cell compartment. A multiparametric staining will be necessary to identify all the different subpopulations. In this case, a wide range of fluorochromes can be used for a variety of Abs. The compatible fluorescences and the most widely adopted are: FITC, PE, PE-Cy5, PrCP-Cy5.5, PE-Cy7, APC, APC-Cy7, BV421, BV510 [8]. 2. Single color controls are required to set up the compensation matrix. It is good practice to use the BD CompBeads or polystyrene microparticles coupled to an antibody specific for the

Single Cell Analysis by Flow Cytometry

309

Fig. 1 Representative flow-cytometric panel of human blood cell sample analysis. (a) CD45þ gate on leukocytes. (b) Monocytes isolation identified as CD11b+CD14+ cells. (c) Morphological gate on the lymphocytes discriminating the cellular debris according to FSC and SSC. (d) Identification of T cells (CD3+), NK (CD16+CD56+CD3), and NKT (CD3+CD16dim) subsets. (e) Gated on CD3CD16CD56 it is possible to identify B cells (CD19+). (f) CD4+ (Th) and CD8+ (CTL) expression gated on CD3+ cells. Identification of naı¨ve

310

Davide Brusa and Jean-Luc Balligand

Kappa light chain of mouse, rat, or rat/hamster Ig to perform the single staining controls according to the manufacturer’s protocol [7] (see Note 18). 3. Panel Design Strategy: The different Abs against antigens for a tumor infiltrate analysis are many, according to the analysis the researchers are interested in. The most studied are CD45, CD3, CD8, CD4, CD11b, CD11c, CD14, CD19, CD20, CD62L, CD27, CD28, CD68, CD86, CD138, CD206, MHCII, etc. in order to detect all different subpopulations of T, B, macrophages, monocytes, etc. (see Note 19). 4. Before starting with the analysis proceed always and every day with the check performance and tracking (CS&T) (see Note 20). 5. Design the correct gates, discriminating between positive and negative cells and accordingly perform the sample recording. Gating strategy is the fundamental part of flow cytometry analysis in order to take into consideration the right subpopulation to be studied and sorted. The best way to determine the fluorescence gating strategy is to use fluorescence minus one (FMO) controls [9] (see Note 21). 6. Representative results: all different leukocytes subpopulations can be analyzed. Since the analysis is to be done on tumor infiltrate, it is better to select all the leukocytes with CD45 as first (Fig. 1a). Then, a morphological gate is necessary to identify the lymphocytes (Fig. 1c, d) detected as T cells (CD3+) divided in the two major subsets T helper (CD4+) and cytotoxic T lymphocytes (CD8+) (Fig. 1f). Both CD4+ and CD8+ cells could be further divided on the basis of CD45RA and CCR7 (or in alternative CD62L) staining into maturational subsets, defined as naı¨ve CCR7+CD45RA+, central memory CCR7+CD45RA, effector memory   CCR7 CD45RA , and terminally differentiated memory cells CCR7CD45RA+ (Fig. 1g, h). T-reg cells gated on CD4+ as CD127CD25hiFoxP3+ [10] is very important in the tumor infiltrate analysis because T-regs represent one of the immunosuppressive subpopulations that drive the tumor escape mechanisms. B cells (Fig. 1e) can be identified as CD19+CD20+, with the subpopulation of B-regs [11] identified as IgDIgMCD1dhiCD24hiCD38hi. Naı¨ve (CD27) and memory (CD27+) B cells can be also analyzed. Plasma cells ä Fig. 1 (continued) (CCR7+CD45RA+), central memory (CM, CCR7+CD45RA), effector memory (EM, CCR7CD45RA), and terminally differentiated effector RAþ (CCR7CD45RA+) subpopulations gated on CD4+ (g) and CD8+ (h) cells. (i) Morphological gate on granulocytes identified as higher SSC in comparison to lymphocytes and monocytes. (j) Subsequent gate on myeloid cells (CD11b+) and identification of neutrophils (CD16high) and eosinophils (CD16dim) (k)

Single Cell Analysis by Flow Cytometry

311

(PC) can be identified as CD19+CD20CD138+. NK cells as CD16+CD56+ gated on CD3CD19 cells, but NKT as CD3+CD16+CD56+ are easily identified (Fig. 1d). Monocytes can be identified as CD14+CD11b+ (Fig. 1b) and eventually also as CD4dim gated on higher SSC width respect to lymphocytes. Macrophages are selected as CD11b+CD68+ and divided in proinflammatory M1 (MHCII+) and tumor associated macrophages M2 (CD206+) [12]. For myeloid derived suppressor cells (MDSC) there is still no complete accordance but they can be identified as CD14+/-CD33+MHC-II [13]. Dendritic cells are selected as SSChiCD14CD11b+CD11c+MHCII+CD86+CD83+ [10]. Gated on granulocyte scatter (SSChi) it is possible to identify eosinophils as CD66b+CD16, neutrophils as CD66b+CD16+, and basophils as + + CD66b CD16 CD294+ [9] (Fig. 1). 3.4 Single-Cell Sorting

FACS is a highly sophisticated technique for purifying cell populations at the highest degree of purity, reaching 95–100% of the sorted population [7]. Therefore, this technique shows its best results in experiments where high purity is an essential requirement (e.g., microarray analysis) [14]. In the last years the development of ultrahighspeed sorters has further extended the possibilities of application of flow sorting in clinical settings. The FACS potential clinical applications may now include purification of blood stem cells from human blood for therapeutic purposes [15], applications in cancer therapy [1], amniocentesis replacement [7], and sorting human sperm [16]. Single-cell sorting has a great impact on cellular development analysis [17]. Lymphocyte development of Ig or TCR gene rearrangement can be amplified by PCR and the genetic basis of the immune response characterized [18]. With the development of the clone sorting system, it becomes possible to identify the phenotype of the single cell that selfrenewed or gave rise to differentiated progeny. 1. Once the populations have been determined, select them with a designated gate and recover only the specific cells into collection tubes. Up to four gated populations can be sorted at once. For plate sorting, only one population at a time can be taken. 2. Select the appropriate nozzle depending on the cell type to be sorted. For sterile sort, sterilize the instrument. If a sterile sort is performed, the cells can be cultured. 3. Run the experimental sample tube at 4
C, turn on deflection plates, and sort the sample. 4. Set the selection and sorting mask on the single-cell sorting, in order to discard all doublets and to take just one cell in one well

312

Davide Brusa and Jean-Luc Balligand

of 96-or 384-well plate containing a lysis buffer to lyse the cells and at the same time preserve the RNA/DNA content. 5. Store the plate at 80
C for further analysis of gene expression and RNAseq or single cell NGS.

4

Notes 1. The use of Ca2+/Mg2+ buffers may increase the formation of cellular aggregates or doublets that will be discarded in the analysis, with the consequence of a reduction in number of analyzed cells. 2. Many organs from mouse or human tissue biopsies need to be digested before staining to get a single-cell suspension. All different tissues need to be tested for the best enzymatic digestion in order not to interfere with the epitope expression. Moreover, the enzymatic treatment can interfere on cell viability. For this reason, it is best to add a viability marker (PI, 7-AAD, DAPI, etc.) during the analysis. 3. As a gradient separator, Ficoll is appropriate to isolate the viable cells and remove dead cells, fragments and debris. 4. Stain without FcR blockade may incur to unspecific binding especially if staining involved B cells, monocytes, and macrophages. In this case, FcR blocking is always required. Alternatively, there are many new Abs that are mutated in the Fc sequence: these Abs do not bind in an unspecific way. In this case, this step can be avoided. 5. EDTA buffers help to maintain the single-cell suspension avoiding the cluster and doublets formation. Check always which is the best concentration of EDTA for the cells, normally 1 to 2 mM of EDTA is ok. 6. The fixatives use depends on the type of intracellular staining needed. For staining of intracytoplasmic antigenic proteins, cytokines, and chemokines, 2–4% PFA buffer is the most widely used. This buffer is used also at the end of staining to fix and keep the cells in the fridge before the analysis. Other buffers may contain ethanol 70% for staining of intranuclear transcription factors. Alternatively, commercially available Fix&Perm Buffers from different suppliers are used. 7. Fix&Perm buffer is suitable for intracytoplasmic staining. In this case, cells should be kept at 4
C for longer and particularly difficult staining. Fixed cells cannot be recovered from cell sorting for cellular culture. 8. Monoclonal Abs are to be used in preference to the polyclonal Abs due to high unspecific binding.

Single Cell Analysis by Flow Cytometry

313

9. Homogenization of tissues should always be performed on ice, working on a petri dish to cut and smash the tissue. 10. Pay attention not to mix the sample with the Ficoll, otherwise it will prevent the white blood cell band formation. 11. Brakes during start and stop of centrifugation may interfere with the layer formation of WBC; deactivate this option from the centrifuge. Set the centrifuge at RT and not at 4
C because low temperatures interfere with the WBC layer formation. 12. Ficoll is a glucose-based solution and may interfere with cell viability if not removed correctly after the stratification. Proceed always with at least three washes. 13. If the amount of cells is low, it is also possible to seed the cells into a 96-well plate and proceed with staining directly there. Add the mixture of Abs, wash the cells adding 150–200 μL of washing buffer, and centrifuge the plate with the plate adaptor. Discard the supernatant quickly flipping the plate into the sink. 14. Perform staining always in the dark to prevent fluorochromes from being destroyed by direct light, above all if tandem dyes are used. 15. If the cells are prone to clump, make sure to have a single-cell suspension without aggregates before analysis, check on the microscope and if any proceed with a further filtration step with a 70 μm strainer. 16. PI and 7-AAD are detected on PrCP channel but may interfere with the PE. Make sure to set all the compensations with the other channels in the correct way. 17. If fixation is performed, it will not be possible to use discriminator of viable staining because these particular dyes are able to pass the membrane of injured cells and bind the DNA. If cells are already fixed the membrane could not be intact anymore. Pay attention to avoid this step if cells are fixed. 18. Compensation is necessary to remove the spectrum overlap of one fluorescence between two detectors. CompBeads (BD) allow to make an automatic compensation by calculating an algebraic matrix for all the fluorophores used in the experiment. In a multiparametric experiment, it is a good practice, and it is very helpful for the researcher as it reduces the setup times of the experiment. 19. For best results, the panel design should consider the fluorochromes brightness. Bright fluorochromes should be conjugated to antibodies detecting low expressed markers. On the contrary, markers that are well expressed and provide a good separation between negative and positive cell populations must be used with less brilliant fluorochromes.

314

Davide Brusa and Jean-Luc Balligand

20. CS&T is a daily check made by the operator in order to see if the laser power has the same performance during the time. The CS&T beads (BD) are required to run the software in an automatic way. This performance check is always required in order to work always in the same condition during the experiment progress in different days. 21. In an FMO (fluorescence minus one) control tube, all reagents used in the experiment, are included except one. Create as much FMO tubes as the number of fluorochromes used. For example, if staining is made of three Abs conjugated with FITC, PE, and APC, the FMO tubes will be FMO FITC (only with PE and APC fluorescence), FMO PE (only with FITC and APC), and FMO APC (only with FITC and PE). The FMO helps to discriminate between dimly stained and broad negative populations. The FMO tubes are useful to determine where to place the positivity markers in a plot. References 1. Jaye DL, Bray RA, Gebel HM, Harris WAC, Waller EK (2012) Translational applications of flow cytometry in clinical practice. J Immunol 188(10):4715–4719 2. Ma W, Gilligan BM, Yuan J, Li T (2016) Current status and perspectives in translational biomarker research for PD-1/PD-L1 immune checkpoint blockade therapy. J Hematol Oncol 9:47 3. Koonce NA, Juratli MA, Cai C, Sarimollaoglu M, Menyaev YA, Dent J, Quick CM, Dings RPM, Nedosekin D, Zharov V, Griffin RJ (2017) Real-time monitoring of circulating tumor cell (CTC) release after nanodrug or tumor radiotherapy using in vivo flow cytometry. Biochem Biophys Res Commun 492(3):507–512 4. Menck K, Bleckmann A, Wachter A, Hennies B, Ries L, Schulz M, Balkenhol M, Pukrop T, Schatlo B, Rost U, Wenzel D, Klemm F, Binder C (2017) Characterisation of tumour-derived microvesicles in cancer patients’ blood and correlation with clinical outcome. J Extracell Vesicles 6(1):1340745 5. Burger D, Oleynik P (2017) Isolation and characterization of circulating microparticles by flow cytometry. Methods Mol Biol 1527:271–281 6. McLaughlin BE, Baumgarth N, Bigos M, Roederer M, De Rosa SC, Altman JD, Nixon DF, Ottinger J, Oxford C, Evans TG, Asmuth DM (2008) Nine-color flow cytometry for accurate measurement of T cell subsets and cytokine responses. Part I: Panel design by an

empiric approach. Cytometry A 73 (5):400–410 7. Basu S, Campbell HM, Dittel BN, Ray A (2010) Purification of specific cell population by fluorescence activated cell sorting (FACS). J Vis Exp (41):e1546 8. Herzenberg LA, De Rosa SC, Herzenberg LA (2000) Monoclonal antibodies and the FACS: complementary tools for immunobiology and medicine. Immunol Today 21:383–390 9. Tung JW, Heydari K, Tirouvanziam R, Sahaf B, Parks DR, Herzenberg LA, Herzenberg LA (2007) Modern flow cytometry: a practical approach. Clin Lab Med 27(3):453–468 10. Brusa D, Carletto S, Cucchiarale G, Gontero P, Greco A, Simone M, Ferrando U, Tizzani A, Matera L (2011) Prostatectomy restores the maturation competence of blood dendritic cell precursors and reverses the abnormal expansion of regulatory T lymphocytes. Prostate 71:344–352 11. Gorosito Serra´n M, Fiocca Vernengo F, Beccaria CG, Acosta Rodriguez EV, Montes CL, Gruppi A (2015) The regulatory role of B cells in autoimmunity, infections and cancer: perspectives beyond IL10 production. FEBS Lett 589(22):3362–3369 12. Allavena P, Chieppa M, Bianchi G, Solinas G, Fabbri M, Laskarin G, Mantovani A (2010) Engagement of the mannose receptor by tumoral mucins activates an immune suppressive phenotype in human tumor-associated macrophages. Clin Dev Immunol 2010:547179. https://doi.org/10.1155/2010/547179

Single Cell Analysis by Flow Cytometry 13. Brusa D, Simone M, Gontero P, Spadi R, Racca P, Micari J, Degiuli M, Carletto S, Tizzani A, Matera L (2013) Circulating immunosuppressive cells of prostate cancer patients before and after radical prostatectomy: Profile comparison. Int J Urol 20:971–978 14. Hu P, Zhang Z, Xin H, Deng G (2016) Single cell isolation and analysis. Front Cell Dev Biol 4:116 15. Reitsma MJ, Lee BR, Uchida N (2002) Method for purification of human hematopoietic stem cells by flow cytometry. Methods Mol Med 63:59–77 16. Karabinus DS, Marazzo DP, Stern HJ, Potter DA, Opanga CI, Cole ML, Johnson LA,

315

Schulman JD (2014) The effectiveness of flow cytometric sorting of human sperm (MicroSort®) for influencing a child’s sex. Reprod Biol Endocrinol 12:106 17. Battye FL, Light A, Tarlinton DM (2000) Single cell sorting and cloning. J Immunol Methods 243:25–32 18. Six A, Mariotti-Ferrandiz ME, Chaara W, Magadan S, Pham HP, Lefranc MP, Mora T, Thomas-Vaslin V, Walczak AM, Boudinot P (2013) The past, present, and future of immune repertoire biology – the rise of nextgeneration repertoire analysis. Front Immunol 4:413

Part V Single Cell Multi Omic Analysis

Chapter 20 Combined Genome and Transcriptome (G&T) Sequencing of Single Cells Iraad F. Bronner and Stephan Lorenz Abstract The simultaneous examination of a single cell’s genome and transcriptome presents scientists with a powerful tool to study genetic variability and its effect on gene expression. In this chapter, we describe the library generation method for combined genome and transcriptome sequencing (G&T-seq) originally described by Macaulay et al. (Nat Protoc 11(11):2081–2103, 2016; Nat Methods 12(6):519–522, 2015). This includes some alterations we made to improve robustness of this process for both the novice user and laboratories that want to deploy this method at scale. Using this method, genomic DNA and full-length mRNA from single cells are separated, amplified, and converted into Illumina sequencer-compatible sequencing libraries. Key words Single cell, Transcriptome, Genome, MDA, WGA, SNV detection, Copy number variation, Gene expression, NGS

1

Introduction Recently, a sequencing library-generation method for combined genome and transcriptome sequencing (G&T-seq) on single cells was described by Macaulay et al. [1, 2]. Until then, single-cell sequencing methods had only allowed to either determine individual cellular expression profiles or to examine genomic variation (i.e., copy-number variations or single nucleotide variants). By combining transcriptome and genome amplification methods in one protocol, a tool was created that could correlate genetic variability and its effect on gene expression [1]. We have seen a great need for the implementation of the G&T-seq protocol as part of our automated high-throughput single-cell pipeline at the Wellcome Sanger Institute. The original Nature Protocol written by Macaulay et al. [1] gives a very accurate description of the process and can be implemented by skilled scientists. However, it is a very complex protocol that is hard to scale to high sample numbers and is also sensitive to experimental errors. During the implementation

Valentina Proserpio (ed.), Single Cell Methods: Sequencing and Proteomics, Methods in Molecular Biology, vol. 1979, https://doi.org/10.1007/978-1-4939-9240-9_20, © Springer Science+Business Media, LLC, part of Springer Nature 2019

319

320

Iraad F. Bronner and Stephan Lorenz

into our high-throughput pipeline, we have identified potential pitfalls, which might not be obvious to less-experienced users, and improved on the robustness of this protocol to allow for its routine use in high-throughput genomics laboratories. Before endeavoring into the G&T library preparation method, one should understand that the scientific question will have a great impact on the cost per sample and the complexity of the experiment. The G&T method itself provides a robust separation of cellular nucleic acids into distinct single-cell RNA and DNA samples that can be subjected to a range of library preparation methods from these materials. For the RNA, we recommend preparing fulllength cDNA samples to maximize insights; however, 30 or 50 enrichment methods will also yield valuable gene expression data. For the DNA, the operator must make a decision that fundamentally impacts on the analysis that is available later on. For single-cell single-nucleotide variant (SNV) analysis of genomic DNA, a phi29-based multiple displacement amplification (MDA) method is the best choice since phi29 has been shown to have very high DNA amplification accuracy [3]. To get accurate SNV data from amplified DNA products, we suggest using a subsequent no-PCR library preparation method and sequencing of the individual cells to sufficient coverage (e.g., 10–30) to accurately determine SNVs in lower coverage regions. At the time of writing, sequencing individual cells to 10 coverage is still expensive. We therefore suggest to perform an up-front genotyping assay on the individually amplified DNA samples to assess the coverage of the amplified single-cell product and enable cherrypicking of a high-quality subset of samples for library preparation and sequencing. We have observed that genotyping assays correlate with the amount of locus and allelic dropout that is observed after PCR-free library preparation and sequencing, meaning that samples with high-quality genotyping results will generally yield highquality sequencing data. PCR-based methods like the commercial MALBAC or PicoPLEX method are more quantitative than phi29-based amplification methods and will grant better ability to discriminate copy number variations and genomic microinsertions and microdeletions. Library preparation can be done with more general methods (e.g., Nextera XT) that are easier to perform and more costeffective. Genomic coverage needed for this type of analysis is substantially lower. We have routinely sequenced 96–384 samples on an individual HiSeq 4000 lane yielding 300  106 paired-end reads. At the heart of the G&T method is the capture and separation of the genomic (DNA) and transcriptomic (RNA) material of individual cells. After the lysis of individual cells, the polyadenylated mRNA is hybridized with oligonucleotides containing a universal amplification site, a large stretch of 30 thymine residues, and a VN anchor site (V ¼ A, G, or C; N ¼ A, G, C, or T). These primers are

G&T-Sequencing

321

synthesized to contain a 50 biotin, which is conjugated to magnetic streptavidin-coated beads to enable magnetic retention and separation of materials. During this process, captured mRNA molecules are thoroughly washed in order to rinse the beads of all unbound material, including the cellular DNA. The supernatant from these washes is then deposited into a separate receptacle where it is further processed. The bound poly-A mRNA is converted to cDNA and amplified using a process similar to Smart-seq2 [4, 5]. The DNA contained in the wash buffer supernatant is precipitated using solid-phase reversible immobilization (SPRI) beads and amplified using MDA or PicoPLEX. Efficient lysis of the individual cells subjected to this protocol is essential. To make sure that the cellular content containing DNases, RNases, and DNA-binding proteins is denatured and cellular membranes, including the nuclear envelope, are successfully disrupted, cells are sorted into a commercially available lysis buffer (i.e., RLT plus, QIAGEN Ltd, UK) containing the denaturing agent guanidinium chloride and sodium dodecyl sulfate (SDS), a strong anionic detergent. To get a better understanding of the sensitivity and amplification bias of the RNA transcripts present during sequencing, we recommend the addition of external RNA controls to the lysis buffer. We routinely use those developed by the External RNA Controls Consortium (ERCC); however, other commercial spikein controls are available. The ploidy level of the cells (e.g., monoploid, diploid, or tetraploid) will affect the DNA content of the cell and with it the potential amount of captured and amplified DNA. S-phase cells are ideally omitted since replication events look like copy number variation (CNV) events in the data. Specifically selecting for cells in G2 allows to increase DNA coverage since cells will have four copies of each chromosome instead of two. To determine each cell’s DNA content and cell state, a nuclear DNA marker (e.g., Hoechst) should be used during cell sorting.

2

Materials The G&T-seq protocol is very modular and can be matched with various other protocols to suit the experimenter’s needs. We therefore have structured this chapter into the different modules and options. For the successful completion of the protocol, all reagents and instruments indicated in the individual sections of relevance are required. It is critical that reagents need to be free of contaminating DNA, RNA, and guaranteed nuclease free (see Notes 1 and 2). Since RNase and DNA contamination are the most frequent failure causing issues of this method, it is vital that the experimenter wear a clean lab coat and gloves all the time and liquid handling of all reactions are done in a clean UV PCR workstation (see Note 3).

322

Iraad F. Bronner and Stephan Lorenz

2.1 Lysis Buffer Plate Generation

1. ERCC RNA Spike-In Mix. 2. RLT Plus Lysis buffer (QIAGEN Ltd, UK, 79216). 3. 96-well plates for sorting. 4. UV cross-linker to irradiate plastic labware.

2.2 Preparation of Biotin-dT30 Bound Streptavidin Beads in Resuspension Buffer

1. UV Shaker with 1.5 mL tube adapter. 2. 1.5 mL tube magnet. 3. Dynabeads MyOne Streptavidin C1 (Thermo Fisher #65002). 4. Superscript II 5 first strand buffer (Thermo Fisher, part of the superscript II kit # Y02321). 5. Nuclease-free water. 6. 10 M Sodium hydroxide solution. 7. 5 M NaCl solution. 8. 1 M Tris–HCl solution pH 7.5. 9. 0.5 M EDTA pH 8.0. 10. Solution A: 0.1 M NaOH, 0.05 M NaCl solution. Make up in a 50 mL Falcon tube and store at 4  C. Make fresh every 2 months. 11. Solution B: 0.1 M NaCl solution. Make up in a 50 mL Falcon tube and store at 4  C. Make fresh every 2 months. 12. 2 B&W: 0.5 mM Tris–HCl pH 7.5, 0.1 mM EDTA pH 8.0, 2 M NaCl. Make up in a 50 mL Falcon tube and store at 4  C. Make fresh every 2 months. 13. Resuspension Buffer (without RNase inhibitor): 1.2 mL Superscript II 5 first strand buffer, 4.5 mL nuclease-free water. This is enough for processing four plates. Store in the fridge until directed. 14. Biotinylated G&T dT30 primers: Order your biotinylated primer RNase free purified. When ordering from IDT, one can copy and paste the following sequence: /5BiotinTEG/ AAG CAG TGG TAT CAA CGC AGA GTA CTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TVN. Dilute the biotinylated dT30 primer to 100 μM. Make aliquots of 300 μL. Label the tubes “G&T DT30” and store at 20  C.

2.3 DNA, RNA Separation and RNA Amplification

1. Alpaqua 96 low elution plate magnet (A000350). 2. Three 96-well plates. 3. Filter pipette tips and a fresh box. 4. UV cross-linker to irradiate plastic labware. 5. Plate seals or plate sealer with PCR friendly seals. 6. Wipeable cool box and cooling block. 7. Repeater pipette (e.g., Eppendorf Stream).

G&T-Sequencing

323

8. UV PCR workstation. 9. Heated shaker with heated lid (e.g., Eppendorf Thermomixer C with heated lid). 10. Shaker at room temperature with 96-well plate insert (e.g., Eppendorf Thermomixer C). 11. Biotin-dT30 bound streptavidin beads in resuspension buffer (without RNase inhibitor; see previous section for the preparation). 12. Nuclease-free water. 13. MMLV RNase H Reverse Transcriptase (e.g., Superscript II). 14. Reverse Transcriptase reaction buffer, supplied with reverse transcriptase. 15. RNase inhibitor (e.g., NEB Murine, M0314L). 16. 100 mM DTT. 17. 5 M betaine. 18. 1 M MgCl2. 19. 100 μM template switching oligonucleotide (TSO; 50 -AAG CAG TGG TAT CAA CGC AGA GTA CAT rGrG+G-30 ; the last three bases consist of two riboguanosines (rG) and one locked nucleic acid (LNA)-modified guanosine (+G)). 20. 25 mM dNTP mix (each); combine 250 μL 100 mM dATP with 250 μL 100 mM dTTP, 250 μL 100 mM dCTP, and 2650 μL 100 mM dGTP and create aliquots of 200 μL. Each of these aliquots will have enough dNTPs to amplify four plates. Label the tubes “dNTP mix” and store at 20  C. The final concentration of each of the dNTPs is 25 mM. 21. 1 M Tris–HCl pH 8.3 solution; 6.77 g recalibrated Tris Buffer salt pH 8.3 (Sigma-Aldrich, T8943). Make up to 50 mL with nuclease-free water in a 50 mL Falcon tube and store at 4  C. These crystals have been shown to be consistently nuclease free. Make fresh every 2 months. 22. G&T wash buffer; 50 mM Tris–HCl pH 8.3, 75 mM KCl, 3 mM MgCl2, 0.5% Tween 20 Solution (for accurate pipetting use a positive displacement pipette), and 10 mM M DTT. Use nuclease-free water for dilutions. Make batches of 100 mL and divide these into 7  14 mL aliquots and store at 20  C. Each 14 mL aliquot contains enough reagent for four plates 23. PCR polymerase (e.g., Kapa Hifi PCR polymerase). 24. 100 μM IS PCR primers (50 -AAG CAG TGG TAT CAA CGC AGA GT-30 ). 25. OPTIONAL: Commercial total RNA to be used as positive control.

324

Iraad F. Bronner and Stephan Lorenz

2.4 DNA Amplification for Copy Number Variation (PicoPLEX)

1. Plate heat sealer or adhesive plate seals. 2. Repeater pipette (e.g., Eppendorf Stream). 3. UV PCR workstation. 4. 80% DNA-free and nuclease-free ethanol solution; combine 40 mL of pure 100% Ethanol with 10 mL nuclease-free water into a 50 mL Falcon tube (see Note 4). 5. Heated shakers with heated lid set to 42  C (e.g., Eppendorf Thermomixer C with heated lid). 6. Shakers at room temperature with 96-well plate insert (e.g., Eppendorf Thermomixer C). 7. Thermocycler. 8. PicoPLEX WGA Kit (50 reactions; Rubicon Genomics) containing: (a) Cell extraction buffer. (b) Extraction enzyme dilution buffer. (c) Cell extraction enzyme. (d) Pre-Amp buffer. (e) Pre-Amp enzyme. (f) Amplification buffer. (g) Amplification enzyme. (h) Nuclease-free water. 9. 1.5 mL Eppendorf tube. 10. 15 mL Falcon tube. 11. Cooling block for Eppendorf tubes.

2.5 Multiple Displacement Amplification (QIAGEN REPLI-g Single Cell Kit)

1. Plate heat sealer or adhesive plate seals. 2. Repeater pipette (e.g., Eppendorf Stream). 3. UV PCR workstation. 4. 80% DNA-free and nuclease-free ethanol solution; combine 40 mL of pure 100% ethanol with 10 mL nuclease-free water into a 50 mL Falcon tube (see Note 4). 5. Shaker with 96-well plate insert (e.g., Eppendorf Thermomixer C). 6. Thermocycler. 7. QIAGEN REPLI-g Single Cell Kit, containing: (a) 4 REPLI-g sc DNA Polymerase. (b) 4 REPLI-g sc Reaction Buffer. (c) 2 Buffer DLB. (d) Stop Solution. (e) 4 PBS sc 1.

G&T-Sequencing

325

(f) DTT, 1 M. (g) 4 H2O sc. 8. 1.5 mL Eppendorf tube. 9. 15 mL Falcon tube. 10. Cooling block for Eppendorf tubes. 11. Cooling block for 96-well plate. 2.6 Nextera XT (For Transcriptome and PicoPLEX DNA) and SPRI Cleanup

1. Nextera XT DNA Library Preparation Kit, containing: (a) TDB (Tagment DNA Buffer). (b) ATM (Amplicon Tagment Mix). (c) NT (Neutralize Tagment Buffer). (d) NPM (Nextera PCR Mix). 2. Nextera XT Index Kit v2. (a) i7 index primers-i7 (12 orange capped vials). (b) i5 index primers-i5 (eight white capped vials.) 3. TruSeq Index Plate Fixture. 4. Replacement caps (orange and white). 5. 96-well PCR plate. 6. Cooling block. 7. Multichannel pipette. 8. Plate vortex or heated shaker with 96-well plate adapter. 9. UV PCR workstation. 10. PCR clean Eppendorf tube. 11. Plate seals. 12. Thermocycler. 13. Tube magnet.

3

Methods Since most human cells only contain marginal (0.5–50 pg) amounts of RNA and approximately ~3 pg of DNA per monoploid chromosome set, even minor contamination with exogenous nucleic acids or nucleases will have major effects on the efficacy of the G&T-seq protocol. To avoid contamination with genetic material or nucleases during processing, it is important all work is done in a containment hood, such as a PCR hood or a laminar flow cabinet that is clean and subjected to UV light before operation, while the experimenter wears gloves and a clean lab coat. Prior to any experiment, we recommend to wipe all surfaces and equipment using bleach diluted to 5000 ppm. To remove bleach residues, subsequently rinse surfaces with Milli-Q filtered and sterilized water.

326

Iraad F. Bronner and Stephan Lorenz

3.1 Lysis Buffer Plate Generation

To isolate both DNA and RNA from cells or nuclei, these need to be sorted into an effective lysis buffer. As described by Macaulay et al. [1], we recommend using 96-well PCR plates filled with 2 μL RLT Plus lysis buffer (QIAGEN, UK). We also recommend adding ERCC controls to the lysis buffer to enable transcript normalization and assessment of expression noise parameters [6]. We recommend to leave two wells empty so they can be used for positive and negative controls after cell deposition. While cells can be picked using an automated cell picker or manual picking with a Stripette, we generally recommend using flow cytometry with index sorting, which can be helpful during troubleshooting. We use a commercially available RNA as a positive control. This commercial RNA (Human brain total RNA, Promega) contains trace amounts of DNA, meaning that this is both an effective positive RNA and DNA amplification control (see Subheading 3.3). When using ERCC spike-in controls, defrost the original ERCC spike-in control tube and dilute it (e.g., 1:50) in nucleasefree water, divide into 1 μL aliquots to avoid freeze–thaw cycles and store the residual aliquots at 80  C. Dilute one of your individual aliquots to a final dilution of 1:5  106 in RLT lysis buffer. This dilution has been shown to be generally a good starting point (see Note 5). 1. OPTIONAL: Put the 96-well PCR plate in a UV cross-linker and set it to 600 mJ/cm2. This will eliminate potentially contaminating RNA and DNA on the plates. 2. Dispense 2 μL of RLT lysis buffers with ERCC spike ins into 94 wells of the plate. Keep two wells empty for the positive control and negative control. 3. Freeze the plates and store at 20  C until sorting. 4. Make sure that the lysis buffer is defrosted before sorting the cells into the lysis buffer (see Note 6). 5. After the plates have been sorted, store the plates at 80  C for up to 6 months.

3.2 Preparation of Biotin-dT30 Bound Streptavidin Beads

This section assumes all reagents described in Subheading 2.2 have been purchased/made up already. Before starting, make sure that all reactions are done in an UV PCR workstation and the experimenter wears gloves and a clean lab coat to reduce the risk of contamination. 1. Retrieve an aliquot of G&T dT30 and leave to thaw on ice until directed. 2. Take the Dynabeads MyOne Streptavidin C1 bottle out of the fridge and resuspend by vortexing the bottle. 3. Label a 1.5 mL Eppendorf tube “Dynabeads” and indicate the number of plates this aliquot is intended to supply and add your name and the date.

G&T-Sequencing

327

4. Take 75 μL Dynabeads per plate (up to 300 μL for four plates) and transfer to the 1.5 mL Eppendorf tube. 5. Place the tube on the tube magnet and leave beads to settle. When the beads are settled (approx. 2 min), remove and discard supernatant. 6. Remove the tube from the magnet and resuspend the beads in 300 μL (per plate) Solution A. Do not vortex (see Note 7). 7. Place on magnet and leave to settle. When the beads are settled (approx. 2 min), remove and discard supernatant. 8. Repeat steps 6 and 7. 9. Remove the tube from the magnet and resuspend the beads in 300 μL (per plate) Solution B. Do not vortex. 10. Place on magnet and leave the beads to settle. When the beads are settled (approx. 2 min), remove and discard supernatant. 11. Resuspend the beads in 75 μL (per plate) of 2 B&W. Do not vortex. 12. Add 75 μL (per plate) of 100 μM G&T dT30 and incubate the tube on a thermomixer with a 1.5 mL tube adapter for 20 min at 1200 rpm (2.4  g) at 20  C. 13. Per plate, make 1.5 mL of 1 B&W by diluting 750 μL of 2 B&W in 750 μL Nuclease-free. (For four plates use 3 mL of 2 B&W in 3 mL nuclease-free water in a 15 mL Falcon tube). Vortex to mix. 14. Once the thermomixer has finished, place the beads on the magnet and leave to settle. When the beads are settled (approx. 2 min), remove and discard supernatant. 15. Remove the tube from the magnet and resuspend the beads in 300 μL (per plate) 1 B&W buffer. Do not vortex. 16. Place on magnet and leave to settle. When the beads are settled (approx. 2 min), remove and discard supernatant. 17. Repeat steps 15 and 16 three times. NB: Make sure that you do these four washes to make sure that all unbound biotin primers are washed away! 18. Resuspend the beads in 1.425 mL of bead resuspension buffer per plate. If preparing more beads than 1.425 mL, resuspend and transfer the beads to a 15-mL tube containing the remaining volume and mix by vortexing. 19. Label the new tube with the same information as the parent tube and store at 4  C until directed. These beads can be used for up to 2 months and possibly longer. 20. To make sure that the beads are functional and have not been contaminated follow Subheading 3.13.

328

Iraad F. Bronner and Stephan Lorenz

3.3 DNA/RNA Separation and RNA Amplification

Before starting this part of the method, make sure that all reagents described in Subheading 2.3 have been prepared. Since individual batches can be made beforehand it is not part of this section. This protocol assumes that you have prepared and defrosted G&T wash buffer and biotin-dT30 bound streptavidin beads in resuspension buffer (without RNase inhibitor) as described in previous section. This also assumes you have already sorted the cells in RLT Plus lysis buffer outlined in Subheading 3.1. 1. OPTIONAL: Put three 96-well plates in a cross-linker and set it to 600 mJ/cm2 (see Note 8). 2. Label one plate as “wash buffer” plate, one as “beads” plate and one as “DNA” plate. 3. Get a 3.75 mL G&T wash buffer aliquot from the freezer, thaw, add 18.75 μL RNase inhibitor (700 U), and mix well. 4. Pipet 30 μL of the wash buffer into each well of the wash buffer plate, seal it and spin it down to retrieve all liquid in the bottom of the well. 5. Retrieve biotin-dT30 bound streptavidin beads in resuspension buffer (without RNase inhibitor) from the fridge, and vortex thoroughly. Ensure that the beads are fully resuspended. 6. From the original tube, transfer 1.425 mL beads to another tube and add 75 μL RNase inhibitor (3000 U). Mix well with a pipette and place into the cooling block. Label the original bead aliquot “opened” with your name and the date and place back into the fridge. These beads will be stable for at least 2 months (see Note 9). 7. It is good practice to run a positive control. Dilute the control RNA (e.g., total human brain RNA) in RLT plus to 12.5 pg/μ L. Pipet 2 μL into the positive control well. 8. Run a negative control to control for contamination after the cell sort. Dispense 2 μL of RLT plus into the negative control well. 9. The next step can be automated using liquid dispensers. In case you do not have access to a liquid dispenser, dispense 10 μL of the beads to your cells and controls using a multichannel pipette or dispensing pipette (e.g., Eppendorf Stream). 10. Mix the beads (using a multichannel pipette) by slowly pipetting up and down 10 times or until fully resuspended. Avoid pipetting air as this will lead to excessive foam formation. Put the tips back into a tip box; they are to be reused for all subsequent steps. Spin the plate for 10 s at 100  g to collect the beads in the bottom of the well (see Note 10). 11. Incubate the beads for 20 min into the Eppendorf Thermomixer C with heated lid at room temperature while shaking at 1200 rpm (2.4  g). 12. After 20 min take the plate off and put it on the low elution plate magnet. Wait for the beads to settle.

G&T-Sequencing

329

13. Aspirate the supernatant making sure not to disturb the beads and transfer the supernatant to the DNA collection plate. Make sure that you reuse the same tips for the same wells in order to avoid cross-contamination between samples. The plate with the beads now contains all your polyadenylated RNA bound to the beads and will subsequently be called RNA plate. 14. Take the RNA plate of the magnet. With the same tips, dispense 10 μL of wash buffer from your wash buffer plate into the same wells and resuspend the beads by slowly mixing 10 times. Try to resuspend the beads as thoroughly as possible but do it gently in order to not damage the beads. 15. Incubate the RNA plate with the beads for 20 min onto the Eppendorf Thermomixer C with heated lid at room temperature while shaking at 1200 rpm (2.4  g). While the program is running proceed to the next step to prepare the RT master mix. 16. Prepare the RT master mix as described below. The preparation time is approximately 20 min. Component

Volume per plate (μL)

Volume per reaction (μL)

Nuclease-free water

258.9

2.1575

Superscript II 5 first strand buffer

120

1

1

5 M betaine

120

1

1M

100 mM DTT

30

0.25

5 mM

25 mM each dNTP mix

24

0.2

1 mM each

1 M MgCl2

3.6

0.03

6 μM

100 μM TSO

6

0.05

1 μM

RNase inhibitor 7.5 murine (20 U/μL)

0.0625

0.5 U/μL

Superscript II reverse 30 transcriptase (200 U/μL)

0.25

10 U/μL

Total volume

5

600

Final concentration

17. Vortex the RT master mix briefly or mix thoroughly with a 1 mL pipette and store in your cooling block until directed. 18. Turn on another thermomixer on and preheat it to 42  C. 19. After 20 min, take the RNA plate off the Thermomixer and put it on the low elution plate magnet. Wait for the beads to settle. 20. Aspirate the supernatant out of the RNA plate, making sure not to disturb the beads and transfer the supernatant to the DNA collection plate. Make sure that you reuse the same tips.

330

Iraad F. Bronner and Stephan Lorenz

21. After this second wash, wash your tips with another 5 μL of wash buffer to rinse the tips. Dispense this wash buffer into your DNA collection plate. Some of the genomic material could still have been bound to the tip’s surface and this step will make sure that you harvest as much of the genomic material as possible into your DNA plate. 22. Take the DNA plate, seal it, spin the plate at 1000  g for 1 min and then store at 20  C until ready to proceed to the DNA amplification protocol. 23. Take the RNA plate to the UV PCR workstation and proceed to the next step immediately. 24. Dispense 5 μL of the RT master mix to each well of the RNA plate. 25. Seal the plate, spin it at 100  g for 15 s only (DO NOT spin faster or longer, since this will settle the beads). 26. Place the RNA plate on the thermomixer and incubate for 1 min at RT at 2000 rpm (6.7  g) to resuspend the beads. Check whether the beads are resuspended. If so continue to the next step, if not repeat this step. 27. Place the RNA plate on the thermomixer (with a PCR 96 adapter) and tape the plate down to keep it in place. 28. Incubate the plate running the following steps on the preheated (42  C) thermomixer. It will take 1:42 h for the program to complete. Step

Temperature

Time (min)

Speed (rpm)

1

42

2

2000

2

42

60

1500

3

50

30

1500

4

60

10

1500

29. Prepare the following PCR master mix a few minutes before the end the program in a 1.5 mL Eppendorf tube. Component

Volume per reaction (μL)

Volume per plate (μL)

Kapa Hifi

6.25

687.5

100 μM IS PCR primers

0.0125

1.4

Nuclease-free water

1.2375

136.1

Total volume

7.5

825

G&T-Sequencing

331

30. Centrifuge the RNA plate, which now contains cDNA at 100  g for 15 s, to make sure that all liquid is collected in the bottom of the plate. 31. Dispense 7.5 μL PCR master mix to each well. 32. Seal the plate and spin it at 100  g for 15 s only (see Note 11). 33. Place the RNA plate on the thermomixer and incubate for 1 min at RT at 2000 rpm (6.7  g) to resuspend the beads. Check whether the beads are resuspended. If so continue to the next step, if not repeat this step. 34. Incubate the plate on a thermocycler using the following conditions: Step

Temperature ( C) Time (m:s)

1

98

3:00

Cycle for an additional 19–24 cycles 98 67 72

0:10 0:15 6:00

3

72

5:00

4

10

For ever

35. This program will take approximately 3 h to complete and can be left overnight. Alternatively, one can continue with Subheading 3.4 to clean the amplified cDNA or continue with the DNA amplification Subheading 3.6. 3.4

SPRI Cleanup

To clean amplified cDNA from primer dimers and reagents, we recommend a SPRI bead cleanup of the material. Because successfully amplified material from healthy cells will be high molecular weight, a 1:1 cDNA to SPRI bead ratio (i.e., 13 μL of beads to 13 μL of reaction mix) is usually sufficient. In case the amplified cDNA is of low yield or to make sure that contaminating low-molecular weight products ( 0.99), thus enabling accurate sample quantification. 16. Please note that as a cost saving measure, we generally suggest performing a genotyping assay (e.g., Fluidigm access array, SNPlex, or PCR-based genotyping assay) to select samples for PCR-free library preparation. These genotyping assays correlate with the amount of locus and allelic dropout that is observed after PCR-free library preparation and sequencing and can help select the samples with high coverage and low locus dropout (results not shown).

362

Iraad F. Bronner and Stephan Lorenz

17. We use this kit because it gives a much better positive to negative control ratio than most MDA kits. 18. Do not do this in the UV hood you will be subsequently using since you might risk contaminating the hood with DNA, invalidating this experiment.

Acknowledgments We would like to thank the Wellcome Trust for funding. We would like to acknowledge our colleagues from the Single Cell Genomics Core Facility and in particular: Howerd Fordham and Emily Hinkley; our collaborators: Dr. Iain Macaulay, Dr. Mabel Teng, Scott Thurston, Dr. Jose Garcia-Bernardo, and Dr. Daniel Brown; and for cell sorting our colleagues from the Cytometry Core Facility: Bee Ling Ng, Christopher Hall, Jennie Graham, and Sam Thompson. References 1. Macaulay IC, Teng MJ, Haerty W, Kumar P, Ponting CP, Voet T (2016) Separation and parallel sequencing of the genomes and transcriptomes of single cells using G&T-seq. Nat Protoc 11(11):2081–2103. https://doi.org/10.1038/ nprot.2016.138 2. Macaulay IC, Haerty W, Kumar P, Li YI, Hu TX, Teng MJ, Goolam M, Saurat N, Coupland P, Shirley LM, Smith M, Van der Aa N, Banerjee R, Ellis PD, Quail MA, Swerdlow HP, Zernicka-Goetz M, Livesey FJ, Ponting CP, Voet T (2015) G&T-seq: parallel sequencing of single-cell genomes and transcriptomes. Nat Methods 12(6):519–522. https://doi.org/10. 1038/nmeth.3370 3. Esteban JA, Salas M, Blanco L (1993) Fidelity of phi 29 DNA polymerase. Comparison between protein-primed initiation and DNA polymerization. J Biol Chem 268(4):2719–2726 4. Picelli S, Faridani OR, Bjorklund AK, Winberg G, Sagasser S, Sandberg R (2014)

Full-length RNA-seq from single cells using Smart-seq2. Nat Protoc 9(1):171–181. https://doi.org/10.1038/nprot.2014.006 5. Picelli S, Bjorklund AK, Faridani OR, Sagasser S, Winberg G, Sandberg R (2013) Smart-seq2 for sensitive full-length transcriptome profiling in single cells. Nat Methods 10(11):1096–1098. https://doi.org/10.1038/nmeth.2639 6. Svensson V, Natarajan KN, Ly LH, Miragaia RJ, Labalette C, Macaulay IC, Cvejic A, Teichmann SA (2017) Power analysis of single-cell RNA-sequencing experiments. Nat Methods 14 (4):381–387. https://doi.org/10.1038/ nmeth.4220 7. Wei Z, Shu C, Zhang C, Huang J, Cai H (2017) A short review of variants calling for single-cellsequencing data with applications. Int J Biochem Cell Biol 92:218. https://doi.org/10. 1016/j.biocel.2017.09.018

Chapter 21 Simultaneous Profiling of mRNA Transcriptome and DNA Methylome from a Single Cell Youjin Hu, Qin An, Ying Guo, Jiawei Zhong, Shuxin Fan, Pinhong Rao, Xialin Liu, Yizhi Liu, and Guoping Fan Abstract Single-cell transcriptome and single-cell methylome analysis have successfully revealed the heterogeneity in transcriptome and DNA methylome between single cells, and have become powerful tools to understand the dynamics of transcriptome and DNA methylome during the complicated biological processes, such as differentiation and carcinogenesis. Inspired by the success of using these single-cell -omics methods to understand the regulation of a particular “-ome,” more interests have been put on elucidating the regulatory relationship among multipleomics at single-cell resolution. The simultaneous profiling of multiple-omics from the same single cell would provide us the ultimate power to understand the relationship among different “-omes,” but this idea is not materialized for decades due to difficulties to assay extremely tiny amount of DNA or RNA in a single cell. To address this technical challenge, we have recently developed a novel method named scMT-seq that can simultaneously profile both DNA methylome and RNA transcriptome from the same cell. This method enabled us to measure, from a single cell, the DNA methylation status of the most informative 0.5–1 million CpG sites and mRNA level of 10,000 genes, of which 3200 genes can be further analyzed with both promoter DNA methylation and RNA transcription. Using the scMT-seq data, we have successfully shown the regulatory relationship between DNA methylation and transcriptional level in a single dorsal root ganglion neuron (Hu et al., Genome Biol 17:88, 2016). We believe the scMT-seq would be a powerful technique to uncover the regulatory mechanism between transcription and DNA methylation, and would be of wide interest beyond the epigenetics community. Key words Single-cell sequencing, Single-cell DNA methylome, Single-cell transcriptome, Multiomics profiling

1

Introduction DNA methylation is among the best studied epigenetic modification, which has been shown to be related to many critical biological progress [1–3]. Integrative analysis of bisulfite sequencing data

Youjin Hu, Qin An, and Ying Guo contributed equally to this work. Valentina Proserpio (ed.), Single Cell Methods: Sequencing and Proteomics, Methods in Molecular Biology, vol. 1979, https://doi.org/10.1007/978-1-4939-9240-9_21, © Springer Science+Business Media, LLC, part of Springer Nature 2019

363

364

Youjin Hu et al.

with RNA-seq data revealed how DNA methylation correlates with genes’ expression level and a measurement of the relationship between DNA methylation and RNA transcription with higher resolution will inspire a more faithful hypothesis about how DNA methylation and other epigenetic modification interact with gene expression. Recently, advance in technology has made it possible to profile transcriptome or DNA methylome at single-cell level [4–6], such as single-cell RNA-seq [7–9], single-cell bisulfite sequencing scBS-seq [4], and single-cell reduced representative bisulfite sequencing (scRRBS) [5]. Based on these techniques, growing evidence supporting the existence of transcriptional and epigenetic heterogeneity in previously thought “pure” cell populations, and the heterogeneity in transcriptome and DNA methylome impose a huge challenge to understand the true relationship between them. Recently, we and other groups have developed methods to simultaneously profile DNA methylome and transcriptome from one single cell (scMT-seq) [10–14]. Integrative analysis of these multi-omics from the same single cell can provide detailed subgrouping picture of a complex cell population and accurate temporal cellular roadmap of differentiation progress. scMT-seq includes four steps: (1) the cell membrane is selectively lysed and the nucleus are physically separatedform the cytoplasm; (2) the cytoplasm containing the majority of mRNA is used for single-cell RNA sequencing by Smart-seq2; (3) the nucleus which contains all genomic DNA is used for DNA methylome profiling by single-cell RRBS (scRRBS); (4) next-generation sequencing and data analysis. The experimental part of the protocol takes 3 weeks.

2

Materials

2.1 Equipment and Consumables

1. High Sensitivity DNA Kit Chips and Reagents (Agilent Technologies). 2. Qubit dsDNA HS Assay Kit (Thermo Fisher). 3. MethyCode kit (Thermo Scientific). Other bisulfite conversion kits can also be used.

2.2 Solutions (The Solutions Were Prepared for Ten Reactions)

1. Cell membrane-selective lysis buffer: 2% Triton-X100 19 μl, 40 U/μl RNase inhibitor 1 μl, 10 μM oligo-dT30VN primer 10 μl, and 10 mM dNTP 10 μl. Pipet 4 μl lysis buffer to each PCR tube for one sample. 2. RRBS lysis buffer: Protease 11.25 μl and 1.2 pg/μl lambda DNA (dam–, dcm–; Thermo Scientific, cat. no. SD0021) 0.55 μl.

mRNA Transcriptome and DNA Methylome from a Single Cell

365

3. RT mix: SuperScript III first-strand buffer 20 μl, SuperScript III reverse transcriptase (ThermoFisher, 18080044) 5 μl, 40 U/μl RNase inhibitor 2.5 μl, 100 mM DTT 5 μl, 5 M Betaine 20 μl, 1 M MgCl2 0.6 μl, 100 μM TSO primer (Invitrogen) 2 μl, and 1:1000 diluted ERCC (ThermoFisher, 4456740) 5 μl. The total volume for one sample is 60.1 μl. The amount of ERCC added to the reaction mix should be optimized with different cell types. 4. cDNA PCR amplification mix: 2
KAPA HiFi HotStart readyMix (Kapa Biosystems, KK2601) 125 μl, 10 μM IS PCR primers 2.5 μl, and nuclease-free water 22.5 μl. 5. Tagmentation reaction mix: Tagmentation DNA buffer 40 μl, Tagmnetation enzyme mix 16.7 μl, Resuspension buffer 13.3 μl, DNA (input 0.1 ng) 10 μl. Dilute amplified cDNA to 0.1 ng/μl before prepare the tagmentation mix. 6. NT buffer: 0.2% SDS solution. Also commercially available from Nextera XT DNA sample preparation kit (Illumina, FC-131-1096). 7. Tagmented cDNA PCR reaction mix: KAPA 2
polymerase 150 μl. 8. MspI reaction mix: 10
Tango buffer (Thermo Scientific, cat. no. BY5) 20 μl, 10 U/μl MspI (Thermo Scientific, cat. no. ER0541) 9 μl, and nuclease-free water 101 μl. 9. Ligation reaction mix: 10
Tango buffer 5 μl, 30 U/μl HC T4 ligase 10 μl, 10 mM ATP 12.5 μl, and nuclease-free water 12.5 μl. 10. First-round PCR reaction mix: 10
Reaction buffer 50 μl, 10 mM dNTP Mix 10 μl, 10 μM PCR Primer 15 μl, 5 U/μl Pfu Turbo Cx (Agilent Technologies, cat. no. 600412) 4 μl, and nuclease-free water 121 μl. 11. Second-round PCR reaction mix: 5
Phusion HF buffer 100 μl (New England BioLabs, cat. no. M0531S), 10 mM dNTP Mix 10 μl, 10uM PCR Primer 15 μl, Phusion HF 5 μl, and nuclease-free water 50 μl. 12. Ampure XP beads. Commercially available from Beckman Coulter. 13. EB solution: 10 mM Tris–HCl, adjust pH to 8.5. Also commercially available. 14. Klenow fragment exo–: 5 U/μl. Available from Thermo Scientific. 15. TrueSeq methylated no. FC-121-2001.

adaptors:

From

Illumina,

16. GlycoBlue from Thermo Fisher, cat. no. AM9516.

cat.

366

2.3

Youjin Hu et al.

Oligos

1. TSO primer: Sequence: 50 -AAGCAGTGGTATCAACGCAGA GTACATrGrG+G-30 . Please not that there are two riboguanosines (rG) and one LNA-modified guanosine (+G) at the 30 end of the primer. These modified nucleotides are critical for TSO primer to function. 2. Oligo-dT30VN: Sequence: 50 -AAGCAGTGGTATCAACGCA GAGTACT30VN-30 . At the 30 end of this oligo there are 30 tandem T (T30), followed by a V (A, C, or G) and an N (A, T, C, or G). 3. ISPCR oligo: Sequence: 50 -AAGCAGTGGTATCAACGCA GAGT-30 . 4. PCR primers for the first and second round of PCR in scRRBS: QP1: 50 -AATGATACGGCGACCACCGA-30 QP2: 50 -CAAGCAGAAGACGGCATACGA-30 .

2.4 Software and Databases

1. Trim Galore! (Version 0.4.5). Freely available from https:// github.com/FelixKrueger/TrimGalore. 2. Bowtie (Version 1.2.2). Freely available from http://bowtiebio.sourceforge.net/index.shtml. 3. Bismark [15] (Version 0.19). Freely available from https:// github.com/FelixKrueger/Bismark. 4. Samtools. Download from http://samtools.sourceforge.net/. 5. STAR [16] (Version 2.5.4b). Download from https://github. com/alexdobin/STAR. 6. featureCounts. Available from http://bioinf.wehi.edu.au/ featureCounts/. 7. SNPsplit (Version 0.3.2). Available from https://www.bioinfor matics.babraham.ac.uk/projects/SNPsplit/. 8. Mouse strain-specific SNP dataset. Obtained from Mouse Genome Project database (http://www.sanger.ac.uk/science/ data/mouse-genomes-project). 9. Mouse reference genome and gene annotation. Obtained from GENCODE database (https://www.gencodegenes.org/).

3

Methods

3.1 Isolation of Nucleus and Cytoplasm from a Single Cell 3.1.1 Preparing SingleCell Samples

1. Clean the hood with RNaseZap and DNA-OFF solutions before setting up the working plates. Spray pipettes with RNaseZap. 2. Add 4 μl of cell membrane-selective lysis buffer on the wall of a PCR tube. Add 4 μl RRBS lysis buffer at the bottom of another PCR tube. 3. Pick a single cell using mouth pipetting with glass microcapillary pipette under the microscope, and transfer the cell into the

mRNA Transcriptome and DNA Methylome from a Single Cell

367

cell membrane-selective lysis buffer droplet. Make sure the cell is transferred with as little liquid in the pipette as possible (ideally 13,000
g for 30 min at 4  C. Longer contrifuge time will likely increase the DNA recovery. 14. Oen the lid and air-dry pellet for up to 10 min at room temperature to remove residual ethanol. 15. Resuspend pellet in 12 μl TE Buffer or nuclease-free water. 16. Quantify the concentration of libraries with Qubit assay and check the size of libraries with bioanalyzer.

374

Youjin Hu et al.

3.4

Sequencing

1. The scRRBS library sequencing is performed on Illumina HiSeq sequencer with five to ten million reads per cell. Paired-end sequencing mode is recommended other than single-end mode. The scRNA-seq libraries can be sequenced in single-end mode (see Note 7).

3.5

Data Processing

1. Trim RNA-seq reads using Trim Galore! trim_galore -q 20 --phred33 --gzip --length 30

2. Generate STAR index. STAR --runMode genomeGenerate --genomeDir --genomeFastaFiles --sjdbGTFfile

3. Align seqeucing data using STAR. STAR

--runMode alignReads --readFilesIn --readFilesCommand

zcat

--outSAMtype BAM Unsorted --genomeDir --outFileNamePrefix

4. Count reads using featureCounts. featureCounts -a

-o readscount.txt

5. Build bismark genome index. bismark_genome_preparation --verbose

6. Trim RRBS reads. trim_galore--quality20--phred33--stringency3--gzip--length36--rrbs--paired--trim1 --output_dir

7. Align RRBS reads using bismark in the directional mode. Bismark

-1 -2

8. Deduplicate alignment results and call methylation level on CpG sites. deduplicate_bismark

--bam

mRNA Transcriptome and DNA Methylome from a Single Cell

375

9. Extract methylation level. bismark_methylation_extractor --comprehensive --merge_non_CpG --gzip -o Bismark_methextract_out --bedGraph --CX_context

--cytosine_report

--split_by_chromosome

10. scMT-seq data can be analyzed according to the user’s demand. Example analysis results can be found in our original scMT-seq paper [10], and papers by Angermueller et al. [11] and Guo et al. [13]. We recommend to use RnBeads [17] for scRRBS quality control and preliminary analysis. For Smartseq2 part of the data, many pipelines have been established and comprehensive reviews can be found elsewhere [18–20].

4

Notes 1. Different strategies can be used to isolate DNA and RNA from the same cell beside mouth pipette. For example, after selective lysis of cell membrane, the nucleus can be separated from the cytoplasm by centrifuge and antibody pulling down. All of the methods have been successfully used to isolate high-quality nucleus for genome sequencing or bisulfite sequencing. Users can choose different methods for nucleus isolation according to the cost, the number of samples, and availability of reagents and equipment. 2. To obtain the scRNA-seq libraries with the best quality, try to minimize the exposure of oligos to freeze–thaw cycle as much as possible, by aliquoting the stock solution. TSO primer contains modified nucleotides, and can be stored at 80  C for up to 6 months. Also, try to avoid store cytoplasm containing mRNA before reverse transcription for more than 1 week. 3. Do add spike-in to control the quality; ERCC can be added into cellular mRNA and used as a spike-in control. Make sure the ERCC is diluted to the optimal concentration so that the ERCC originated reads take 1–5% of total RNA-seq reads. One can run the amplified cDNA on a PAGE gel to tell if the ERCC is excessive. If added at right concentration, ERCC bands can be barely seen on the gel. 4. Lambda DNA can be added to nucleus before lysis, to serve as a control for bisulfite conversion. The ideal amount of lambda to genomic DNA is 5% (w/w), resulting in 5% of reads are from lambda DNA. 5. To optimize the quality of scRRBS libraries, make sure the protease is of good activity, and the nucleus is lysed completely

376

Youjin Hu et al.

and all DNA is disassociated from histone protein. Insufficient lysis will result in uneven coverage among different CpG islands, and absence of CpG islands with high nucleosome density. 6. When performing the bisulfite conversion, make sure to use freshly prepared bisulfite reagent, or the reagent is stored properly according to the manufacturer’s instruction. Expired bisulfite reagents can impair the conversion. 7. We recommend to sequence the scRRBS libraries in paired-end mode to have more CpG sites covered given the same amount of library fragments sequenced.

Acknowledgments The work was supported by National Key R&D Program of China (2017YFA0104100, 2017YFC1001300) and National Natural Science Foundation of China (31700900). References 1. Smith ZD, Meissner A (2013) DNA methylation: roles in mammalian development. Nat Rev Genet 14(3):204 2. Robertson KD (2005) DNA methylation and human disease. Nat Rev Genet 6(8):597 3. Lister R, Pelizzola M, Dowen RH, Hawkins RD, Hon G, Tonti-Filippini J, Nery JR, Lee L, Ye Z, Ngo Q-M (2009) Human DNA methylomes at base resolution show widespread epigenomic differences. Nature 462 (7271):315 4. Smallwood SA, Lee HJ, Angermueller C, Krueger F, Saadeh H, Peat J, Andrews SR, Stegle O, Reik W, Kelsey G (2014) Single-cell genome-wide bisulfite sequencing for assessing epigenetic heterogeneity. Nat Methods 11 (8):817–820 5. Guo H, Zhu P, Wu X, Li X, Wen L, Tang F (2013) Single-cell methylome landscapes of mouse embryonic stem cells and early embryos analyzed using reduced representation bisulfite sequencing. Genome Res 23(12):2126–2135 6. Ramsko¨ld D, Luo S, Wang Y-C, Li R, Deng Q, Faridani OR, Daniels GA, Khrebtukova I, Loring JF, Laurent LC (2012) Full-length mRNAseq from single-cell levels of RNA and individual circulating tumor cells. Nat Biotechnol 30 (8):777–782 7. Patel AP, Tirosh I, Trombetta JJ, Shalek AK, Gillespie SM, Wakimoto H, Cahill DP, Nahed BV, Curry WT, Martuza RL, Louis DN,

Rozenblatt-Rosen O, Suva ML, Regev A, Bernstein BE (2014) Single-cell RNA-seq highlights intratumoral heterogeneity in primary glioblastoma. Science 344 (6190):1396–1401. https://doi.org/10. 1126/science.1254257 8. Picelli S, Bjorklund AK, Faridani OR, Sagasser S, Winberg G, Sandberg R (2013) Smart-seq2 for sensitive full-length transcriptome profiling in single cells. Nat Methods 10 (11):1096–1098. https://doi.org/10.1038/ nmeth.2639 9. Usoskin D, Furlan A, Islam S, Abdo H, Lonnerberg P, Lou D, Hjerling-Leffler J, Haeggstrom J, Kharchenko O, Kharchenko PV, Linnarsson S, Ernfors P (2015) Unbiased classification of sensory neuron types by largescale single-cell RNA sequencing. Nat Neurosci 18(1):145–153. https://doi.org/10. 1038/nn.3881 10. Hu Y, Huang K, An Q, Du G, Hu G, Xue J, Zhu X, Wang CY, Xue Z, Fan G (2016) Simultaneous profiling of transcriptome and DNA methylome from a single cell. Genome Biol 17:88. https://doi.org/10.1186/s13059016-0950-z 11. Angermueller C, Clark SJ, Lee HJ, Macaulay IC, Teng MJ, Hu TX, Krueger F, Smallwood SA, Ponting CP, Voet T, Kelsey G, Stegle O, Reik W (2016) Parallel single-cell sequencing links transcriptional and epigenetic

mRNA Transcriptome and DNA Methylome from a Single Cell heterogeneity. Nat Methods 13(3):229–232. https://doi.org/10.1038/nmeth.3728 12. Cheow LF, Courtois ET, Tan Y, Viswanathan R, Xing Q, Tan RZ, Tan DS, Robson P, Loh Y-H, Quake SR (2016) Single-cell multimodal profiling reveals cellular epigenetic heterogeneity. Nat Methods 13 (10):833 13. Guo F, Li L, Li J, Wu X, Hu B, Zhu P, Wen L, Tang F (2017) Single-cell multi-omics sequencing of mouse early embryos and embryonic stem cells. Cell Res 27(8):967 14. Clark SJ, Argelaguet R, Kapourani C-A, Stubbs TM, Lee HJ, Alda-Catalinas C, Krueger F, Sanguinetti G, Kelsey G, Marioni JC (2018) scNMT-seq enables joint profiling of chromatin accessibility DNA methylation and transcription in single cells. Nat Commun 9(1):781 15. Krueger F, Andrews SR (2011) Bismark: a flexible aligner and methylation caller for Bisulfiteseq applications. Bioinformatics 27 (11):1571–1572

377

16. Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, Batut P, Chaisson M, Gingeras TR (2013) STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29(1):15–21 17. Assenov Y, Mu¨ller F, Lutsik P, Walter J, Lengauer T, Bock C (2014) Comprehensive analysis of DNA methylation data with RnBeads. Nat Methods 11(11):1138 18. Bacher R, Kendziorski C (2016) Design and computational analysis of single-cell RNA-sequencing experiments. Genome Biol 17(1):63 19. Dal Molin A, Baruzzo G, Di Camillo B (2017) Single-cell RNA-sequencing: assessment of differential expression analysis methods. Front Genet 8:62 20. Lun AT, McCarthy DJ, Marioni JC (2016) A step-by-step workflow for low-level analysis of single-cell RNA-seq data with bioconductor. F1000Res 5:2122

Chapter 22 Simultaneous Targeted Detection of Proteins and RNAs in Single Cells Aik T. Ooi and David W. Ruff Abstract Simultaneous detection of both RNA and protein in individual single cells offers a powerful tool for genotype-to-phenotype investigations. Proximity extension assay (PEA) is a quantitative, sensitive, and multiplex protein detection system that has superb utility in single-cell omic analysis. We implemented PEA using the flexible microfluidic workflow of the Fluidigm® C1™ system followed by real-time quantitative polymerase chain reaction (RT-qPCR) on the Fluidigm Biomark™ HD system. With this workflow, targeted quantification of RNAs and proteins within individual cells is readily conducted. Key words Single-cell analysis, Proximity extension assay (PEA), Protein quantification, Multi-omics, Protein–RNA correlation, qPCR, RT-qPCR, Antibody detection, Single-cell protein detection, Microfluidics

1

Introduction The recent advent of high-throughput single-cell analysis platforms has greatly accelerated the pace of understanding cell types and characterizing cellular states and heterogeneity. Much of the progress has been elucidated from single-cell transcriptomic analysis using targeted RT-qPCR assays and RNA sequencing regimens [1, 2]. Ideally, RNA levels should indicate protein levels. However, previous studies indicate that levels of individual mRNAs and their respective translated proteins often display discordance [3]. Consequently, direct profiling of cellular protein levels offers a more accurate picture of protein-related cellular activities, while the ability to link RNA levels to protein expression would generate the most complete view of genotype-to-phenotype relationships in dynamic biological pathways. Quantification of proteins at the single-cell level relies on antibody-based detection approaches. While methods based on fluorescence-activated cell sorting (FACS) are widely used, this technology is often limited to cell surface markers. Another

Valentina Proserpio (ed.), Single Cell Methods: Sequencing and Proteomics, Methods in Molecular Biology, vol. 1979, https://doi.org/10.1007/978-1-4939-9240-9_22, © Springer Science+Business Media, LLC, part of Springer Nature 2019

379

380

Aik T. Ooi and David W. Ruff

single-cell protein detection method based on proximity ligation assay has sensitivity limitations and cannot be multiplexed [4]. To overcome these limitations, an improved detection format for protein analysis has been developed using proximity extension assay (PEA) [5]. For a protein target, PEA requires two independent antibodies, each conjugated with an oligonucleotide that carries a short sequence that is complementary to the other. When the pair of antibody probes bind to their antigen in close proximity, the complementary ends anneal, followed by strand extension to generate a full-length RT-qPCR template. The two-antibody system reduces background and thus enables simultaneous detection of multiple targets. With RT-qPCR as the end-point analysis, PEA overcomes the limitation of overlapping fluorescence spectra faced by the FACS technology and in turn allows for a higher number of possible targets in a single experiment. A single-cell version of the method has been developed for the Fluidigm C1 system with RT-qPCR readout on the Biomark HD system [6, 7], where the use of custom PEA antibody probes for multiplex targets has been reported. Constructing custom panels requires time-consuming antibody–oligonucleotide conjugation procedures and verification [8]. The above-mentioned single-cell C1 microfluidic protocols can be readily adapted to using commercially available and validated PEA antibody panels from the Proseek® Multiplex96x96 Kit (Olink® Proteomics). We incorporate at the front end a mild cell lysis condition that allows the binding of PEA antibody probes to their antigen targets while preserving cellular RNA. Furthermore, by utilizing the polymerase activity of a reverse transcriptase on both RNA and DNA, cDNA generation and PEA oligonucleotide extension can be coordinately accomplished in the isolated C1 reaction chambers (Fig. 1). This enables targeted detection of both RNA and protein from individual cells processed on C1 and Biomark HD via RT-qPCR readouts. Here we

Fig. 1 C1 microfluidic chamber reaction overview. First, single-cell capture occurs in the 4.5 nL chamber. Lysis and antibody probes binding occur next at 37
C for 120 min and 10
C for 1 min. Reverse transcription and oligonucleotide extension are carried out next at 42
C for 60 min followed by heat inactivation at 85
C for 5 min and 10
C for 1 min. The final preamplification step engages all the chambers. The thermal cycling parameters are 95
C for 5 min, 20 cycles of 96
C for 20 s, and 60
C for 6 min, and 10
C for 1 min

Single-Cell Protein and RNA Detection

381

describe the homogenous and simultaneous single-cell protein and RNA co-detection of up to 96 targets each, using readily available reagents.

2

Materials

2.1 Simultaneous Protein and RNA Detection Workflow on C1

1. Fluidigm C1 system (Fluidigm) with the appropriate scripts installed (see Notes 1 and 2). 2. C1 Single-Cell Open App™ IFC (integrated fluidic circuit; Fluidigm). Select the IFC needed based on cell size: C1 Single-Cell Open App IFC, 5–10 μm; C1 Single-Cell Open App IFC, 10–17 μm; or C1 Single-Cell Open App IFC, 17–25 μm. 3. C1 Single-Cell Reagent Kit (Fluidigm). 4. Proseek Multiplex96x96 Kit (Olink Proteomics). Choose from the available 12 human target panels or 1 mouse target panel (see Note 3). 5. (Recommended) LIVE/DEAD® Viability/Cytotoxicity Kit for Mammalian Cells (Thermo Fisher Scientific). Prepare 1 LIVE/DEAD stains: 1250 μL C1 Cell Wash Buffer (Fluidigm), 2.5 μL ethidium homodimer (Thermo Fisher Scientific), 0.625 μL Calcein AM (Thermo Fisher Scientific). Prepare on the day of experiment and keep on ice in the dark until use. 6. 5 lysis buffer: 2.5% NP-40 (dilute in water from 10%), 250 mM Tris–HCl, pH 8.4, 5 mM EDTA. Store at room temperature. 7. Lysis and Probe Mix: 21 μL 5 Lysis Buffer, 8.4 μL Incubation Solution (Olink Proteomics), 8 μL Incubation Stabilizer (Olink Proteomics), 1 μL A-probes (Olink Proteomics), 1 μL B-probes (Olink Proteomics), 5.2 μL C1 Loading Reagent (Fluidigm), 25.4 μL nuclease-free water. Prepare on the day of experiment and keep on ice until use. 8. RT Mix: 8 μL 5 Reverse Transcription Master Mix (Fluidigm), 1.8 μL C1 Loading Reagent, 27 μL nuclease-free water. Prepare on the day of experiment and keep on ice until use. 9. PCR Mix: 20 μL 5 Preamp Master Mix (Fluidigm), 10 μL pooled 500 nM preamplification primers (see Note 4), 1 μL PEA Solution (Olink Proteomics), 2.2 μL C1 Loading Reagent, 11.6 μL nuclease-free water. Prepare on the day of experiment and keep on ice until use.

382

Aik T. Ooi and David W. Ruff

2.2 Protein Target Detection by RealTime Quantitative PCR on Biomark HD

1. Fluidigm Biomark HD (see Note 5). Biomark HD Data Collection software v3.0.2 or higher is required. 2. 96.96 Dynamic Array™ IFC for gene expression (Fluidigm) (see Note 6). 3. IFC Controller HX (see Note 7) or the Juno™ system (see Note 8). 4. Proseek Multiplex96x96 detection kit (Olink Proteomics). 5. Detection Mix: 550 μL Detection Solution (Olink Proteomics), 230 μL nuclease-free water, 7.8 μL Detection Enzyme (Olink Proteomics), 3.1 μL PCR Polymerase (Olink Proteomics). Prepare on the day of experiment and keep on ice until use. 6. 2 Assay Loading Reagent (Fluidigm). This is only needed if fewer than 96 protein targets are being investigated in the realtime PCR.

2.3 RNA Target Detection by RealTime Quantitative PCR on Biomark HD

1. Fluidigm Biomark HD (see Note 5). Biomark HD Data Collection software v3.0.2 or higher is required. 2. 96.96 Dynamic Array IFC for gene expression (Fluidigm) (see Note 6). 3. IFC Controller HX (see Note 7) or the Juno system (see Note 8). 4. Sample premix: 360 μL 2 SsoFast™ EvaGreen® Supermix with Low ROX (Bio-Rad), 36 μL 20 DNA Binding Dye (Fluidigm). Prepare on the day of experiment, vortex and centrifuge briefly, then keep on ice until use. 5. 2 Assay Loading Reagent (Fluidigm). 6. 1 DNA Suspension Buffer (TEKnova). 7. 100 μM combined forward and reverse primers. These are the primers used in the C1 step for the preamplification of cDNA targets (see Note 4).

3

Methods An overview of the protocol and the estimated time for each step is outlined in Fig. 2.

3.1

Prime the C1 IFC

1. Pipet 200 μL of C1 Harvest Reagent (Fluidigm) into each of the two accumulators on the IFC (see Note 9). 2. Pipet 20 μL of C1 Harvest Reagent into each of the 36 control line inlets (4 groups of 9 inlets on both sides of the accumulators) and 4 hydration inlets (2 middle inlets on the outside columns on each side of the IFC). 3. Pipet 20 μL of C1 Preloading Reagent (Fluidigm) into inlet 2.

Single-Cell Protein and RNA Detection

1. Prime

2. Prepare cells

Prepare the IFC

5 min

Run the Prime script: • Small-cell IFC 11 min • Medium- or large- 12 min cell IFC

3. Load cells 15 min

Count, dilute, and 10 min mix cells with C1 Suspension Reagent

Prepare the IFC Run the Cell Load or Cell Load & Stain script: • Small-cell IFC with staining • Small-cell IFC without staining • Medium- or large-cell IFC with staining • Medium- or large-cell IFC without staining

5. Generate protein and RNA target amplicons

4. Image (optional) Image cells with a microscope

Wash cells

15–30 min

383

Prepare reagents

30 min 20 min 60 min 30 min

6. Harvest 15 min

Prepare the IFC

5 min

Harvest amplified 10 min products from the IFC

5 min

Run the Sample Prep 8 hr 7 min script (irrespective of (end time can be cell size) adjusted to a later time for convenience)

1. Prime Inject control line fluid into the IFC Run the Prime script

2. Load samples and assays

3. Run real-time PCR

5 min

Prepare sample and assay mixes

10–30 min

20 min

Pipet sample and assay mixes into the IFC

10 min

Run the real-time PCR program on Biomark HD: • Protein target detection 2 hr 3 min thermal protocol 1 hr 14 min • RNA target detection thermal protocol

Run the Load Mix script on the IFC controller

1 hr 30 min

Fig. 2 An overview of the protocol for both the C1 and Biomark workflows including the estimated time required for each step. The Biomark workflow will be performed twice, once for protein detection and once for RNA detection

4. Pipet 15 μL of C1 Blocking Reagent (Fluidigm) into each cell inlet and outlet. 5. Pipet 20 μL of C1 Cell Wash Buffer into inlet 5. 6. Remove and discard the protective film from the bottom of the IFC. 7. Place the IFC into the C1 system, tap LOAD, and run the Single-Cell Targeted Protein & RNA: Prime script. The prime step takes 11–12 min, depending on the IFC. Tap EJECT to remove the IFC when the Prime script is finished. 8. Proceed to Subheading 3.3 within an hour after Prime is finished.

384

3.2

Aik T. Ooi and David W. Ruff

Prepare Cells

1. Prepare a cell suspension in native medium. 2. Wash cells twice with 1 mL of C1 Cell Wash Buffer. Centrifuge at 300  g for 5 min between washes. 3. Resuspend washed cells in C1 Cell Wash Buffer to a concentration of 166–250/μL (see Note 10).

3.3 Cell Load (and Stain) on the C1 IFC

1. Prepare final cell mix for loading into the IFC. Vortex C1 Suspension Reagent (Fluidigm) for 5 s, then combine cells (properly prepared and diluted—see Subheading 3.2) with C1 Suspension Reagent at a ratio of 3:2 (see Note 11). For example: 30 μL of cells (at a concentration of 166–250/μL) with 20 μL of C1 Suspension Reagent. Mix by pipetting the cell mix five to ten times. Do not vortex the final cell mix. 2. Pipet and remove the remaining C1 Blocking Reagent from the cell inlet and outlet. 3. Pipet 5 μL of the final cell mix prepared in Subheading 3.1 to the cell inlet on the IFC (see Note 12). 4. (Optional) Pipet 20 μL of staining solution into inlet 1. Use either 1 LIVE/DEAD stains outlined in Subheading 2, or a suitable staining solution of choice. 5. Place the IFC into the C1 system, tap LOAD, and run the Single-Cell Targeted Protein & RNA: Cell Load or SingleCell Targeted Protein & RNA: Cell Load & Stain script. The cell loading step takes 20–60 min, depending on IFC type and whether a staining step is used. Tap EJECT to remove the IFC when the script is finished. 6. (Optional) Prior to proceeding to the next step, image the captured cells on a compatible microscope or imaging system (see Note 13).

3.4 Prepare C1 IFC for Protein and RNA Detection

1. Pipet 180 μL of C1 Harvest Reagent into each of the four reservoirs on the four corners of the IFC. 2. Prepare Lysis and Probe Mix, RT Mix, and PCR Mix as outlined in Subheading 2. 3. Pipet 8 μL of Lysis and Probe Mix into inlet 3. 4. Pipet 27 μL of RT Mix into inlet 7. 5. Pipet 25 μL of PCR Mix into inlet 8. 6. Place the IFC into the C1 system, tap LOAD, and select the Single-Cell Targeted Protein & RNA: Sample Prep script. The run time for this script is 8 h, 7 min. 7. Select a convenient time for the program to finish by sliding the orange bar to the desired end time. Tap START.

Single-Cell Protein and RNA Detection

385

8. The program end time can be rescheduled until 2 h before the selected time. Tap Reschedule to change the end time on the sliding bar. 3.5 Harvest the Amplified Products

1. When the script is finished, tap EJECT to remove the IFC (see Note 14). 2. Aliquot 25 μL of DNA Dilution Reagent (Fluidigm) into each well of a clean 96-well plate (see Note 15). 3. Carefully pull back the barrier tape covering the harvesting inlets of the IFC using the provided plastic removal tool. 4. Using an 8-channel pipette set at 6 μL, pipet the entire volume of amplified products from the harvest outlets into the 96-well plates with DNA Dilution Reagent. Figure 3 provides stepwise detailed instructions on pipetting the amplified products. 5. Seal the plate with adhesive film. Briefly vortex and centrifuge the plate. Label the plate “Diluted Harvest Plate.” After harvesting, materials from the capture sites are arranged in the plate as depicted in Fig. 4. 6. Proceed immediately to real-time PCR on the Biomark HD system, or store the plate at 20
C.

3.6 Protein Target Detection by RealTime PCR on Biomark HD

1. Prepare a 96.96 Dynamic Array IFC for priming step by injecting control line fluid into each of the two accumulators on the IFC, using the prefilled syringes provided (see Note 16). Figure 5 shows the location of the accumulators. 2. Remove and discard the blue protective film from the bottom of the IFC. 3. Place the IFC into the IFC controller and run the prime script: Prime (136) if using the IFC Controller HX; Prime 96.96 GE if using the Juno system. The run time for the prime script is 20 min. 4. Thaw, then briefly vortex and centrifuge the Primer Plate (Olink Proteomics). Keep on ice until use. 5. Prepare the Detection Mix as outlined in Subheading 2. Vortex and centrifuge the Detection Mix briefly. Aliquot 95 μL of the Detection Mix into each well of an 8-well strip tube. 6. Label a new 96-well plate “Sample Plate” and pipet 7.2 μL of the Detection Mix into each well of the Sample Plate using a multichannel pipette. 7. Thaw the Diluted Harvest Plate, vortex, and centrifuge briefly. 8. Remove the adhesive film and transfer 2.8 μL of sample from each well of the Diluted Harvest Plate into the Sample Plate using a multichannel pipette.

386

Aik T. Ooi and David W. Ruff

Fig. 3 The 12 pipetting steps to harvest the amplified products onto a 96-well plate containing DNA Dilution Reagent

Single-Cell Protein and RNA Detection

387

Fig. 4 Arrangement of samples by capture site numbers on the C1 IFC

9. Seal the Sample Plate with a new adhesive film, vortex, and centrifuge briefly. 10. When the prime script is finished, remove the IFC from Juno or the HX loader. 11. Remove the adhesive film on the Primer Plate. Be extra careful when handling the Primer Plate to avoid introducing contamination among wells. 12. Using a multichannel pipette, transfer 5 μL of primer and probe mix from each well the Primer Plate to the corresponding assay inlets of the primed 96.96 Dynamic Array IFC. Assays inlets are located on the left side of the IFC (Fig. 5). 13. Using a multichannel pipette, transfer 5 μL from each well of the Sample Plate into the sample inlets of the IFC. Sample inlets are located on the right side of the IFC (Fig. 5). 14. Fill unused inlets. Do not leave any inlets empty. For unused assay inlets, use 3.0 μL 2 Assay Loading Reagent and 3.0 μL DNA-free water per inlet. For unused sample inlets, use 3.3 μL of Detection Mix and 2.7 μL of DNA-free water per inlet. 15. Place the IFC into the IFC controller and run the load script: Load Mix (136) if using the IFC Controller HX; Load Mix 96.96 GE if using the Juno system. The Load Mix script takes 1 h, 30 min to complete. 16. Remove the IFC from the controller once the load script is finished. Proceed to the real-time PCR workflow within an hour of loading samples. 17. On Biomark HD, launch the Data Collection software (see Note 5).

388

Aik T. Ooi and David W. Ruff

Fig. 5 Location of the accumulators, assay inlets, and sample inlets on the 96.96 Dynamic Array IFC

18. Create, name, and save the following thermal protocol. Program stage

Temperature


Time

Cycle

Thermal mix

50 C 70
C 25
C

120 s 1800 s 600 s

1

Hot start

95
C

300 s

1

15 s 60 s

40

Denature Extend




95 C 60
C

19. Click Start a New Run, place the IFC into the instrument, and click Load. 20. Select the following settings: Load Mix (136) if using the IFC Controller HX; Load Mix 96.96 GE if using the Juno system. The Load Mix script takes 1 h, 30 min to complete. Load Mix (136) if using the IFC Controller HX; Load Mix 96.96 GE if using the Juno system. The Load Mix script takes 1 h, 30 min to complete. Passive reference: ROX Assay: Single probe Probe type: FAM-MGB. 21. Select the thermal protocol created in step 18, and confirm that Auto Exposure is selected. 22. Verify the run information and click Start Run. The real-time PCR program takes 2 h, 3 min to complete. 23. When the real-time-PCR is complete, view and analyze data on the Fluidigm Real-Time PCR Analysis software (see Note 17). You can export data to a spreadsheet for further analysis on protein target detection (see Note 18).

Single-Cell Protein and RNA Detection

3.7 RNA Target Detection by RealTime PCR on Biomark HD

389

1. Prepare a 96.96 Dynamic Array IFC for priming step by injecting control line fluid into each of the two accumulators on the IFC, using the prefilled syringes provided (see Note 16). Figure 5 shows the location of the accumulators. 2. Remove and discard the blue protective film from the bottom of the IFC. 3. Place the IFC into the IFC controller and run the prime script: Prime (136) if using the IFC Controller HX; Prime 96.96 GE if using the Juno system. The run time for the prime script is 20 min. 4. Prepare sample premix as outlined in Subheading 2. Vortex and centrifuge briefly before use. 5. Pipet 3.3 μL of sample premix into each well of a 96-well plate. 6. Prepare final sample mix by adding 2.7 μL of sample from each well of the Diluted Harvest Plate to individual wells with the sample premix. 7. Seal the plate with an adhesive film, vortex for 20 s, then centrifuge briefly to collect the samples. 8. Prepare final assay mix by combining 3.0 μL 2 Assay Loading Reagent (Fluidigm) with 2.7 μL 1 DNA Suspension Buffer (TEKnova) and 0.3 μL 100 μM combined forward and reverse primers for each target. Transfer the assay mixes into individual wells of a 96-well plate to assist pipetting into the IFC inlets. 9. Seal the plate with an adhesive film, vortex for 20 s, then centrifuge briefly to collect the samples. 10. Remove the IFC from the controller once the prime script is finished. 11. Using a multichannel pipette, transfer 5 μL of each final assay mix and 5 μL of each final sample mix into their respective inlets on the IFC (Fig. 5). 12. Fill unused inlets. Do not leave any inlets empty. For unused assay inlets, use 3.0 μL 2 Assay Loading Reagent and 3.0 μL DNA-free water per inlet. For unused sample inlets, use 3.3 μL of sample premix and 2.7 μL of DNA-free water per inlet. 13. Place the IFC into the IFC controller and run the load script: Load Mix (136) if using the IFC Controller HX; Load Mix 96.96 GE if using the Juno system. The Load Mix script takes 1 h, 30 min to complete. 14. Remove the IFC from the controller once the load script is finished. Proceed to the real-time PCR workflow within an hour of loading samples. 15. On Biomark HD, launch the Data Collection software (see Note 5).

390

Aik T. Ooi and David W. Ruff

16. Click Start a New Run, place the IFC into the instrument, and click Load. 17. Select the following settings: Application type: Gene Expression Passive reference: ROX Assay: Single probe Probe type: EvaGreen. 18. Select the thermal protocol GE Fast 96x96 PCR þ Melt v2. pcl and confirm that Auto Exposure is selected. 19. Verify the run information and click Start Run. The real-time PCR program takes 1 h, 14 min to complete. 20. When the real-time-PCR is complete, view and analyze data on the Fluidigm Real-Time PCR Analysis software (see Note 17). You can export data to a spreadsheet for further analysis on RNA target detection.

4

Notes 1. For detailed instructions on instrument and software operation, refer to the C1 System User Guide (Fluidigm 100-4977). 2. Scripts for Protein & RNA can be downloaded from Fluidigm Script Hub™ at www.fluidigm.com/c1openapp/scripthub. 3. Select the appropriate panel of protein target based on your research interest. Available panels are listed at www.olink.com/ products. 4. This is a pool of forward and reverse primer pairs to amplify target cDNA for downstream quantitative real-time PCR detection. Primers can be the Fluidigm Delta Gene™ assays or obtained from other major laboratory suppliers. It is possible to multiplex up to 96 primer pairs for the detection of 96 RNA targets. 5. For detailed instructions on instrument and software operation, refer to the Biomark HD Data Collection User Guide (Fluidigm 100-2451). 6. For a different number of samples and targets arrangement, the 192.24 Dynamic Array IFC for gene expression (Fluidigm) or the 48.48 Dynamic Array IFC for gene expression (Fluidigm) may be used. 7. For detailed instructions on instrument and software operation, refer to the IFC Controller MX and IFC Controller HX User Guide (Fluidigm 68000112).

Single-Cell Protein and RNA Detection

391

8. For detailed instructions on instrument and software operation, refer to the Juno System User Guide (Fluidigm 100-7070). 9. To prevent bubbles from forming, push only to the first stop on the pipette when pipetting into the IFC inlets. If a bubble is created, use a pipette tip to either burst the bubble or move it to the top surface of the solution. 10. Depending on the cell type, concentration outside of this range might be needed to ensure better single-cell capture efficiency. 11. Depending on the cell type, the ratio for cells to C1 Suspension Reagent may be optimized to improve single-cell capture efficiency. See the Fluidigm Single-Cell Preparation Guide (Fluidigm 100-7697). 12. Up to 20 μL can be pipetted into the cell inlet, but only 5 μL will enter the IFC. 13. Criteria for selection of a compatible imaging system are outlined in Minimum Specifications for Imaging Cells in Fluidigm Integrated Fluidic Circuits (Fluidigm 100-5004). 14. Continue the remaining steps in a post-PCR lab environment. 15. If a higher concentration of sample is desired, aliquot smaller amount of DNA Dilution Reagent into the plate. A minimum volume of 5.5 μL per sample is required for downstream detection steps. 16. Different types of Dynamic Array IFC require different volumes of control line fluid in the accumulators. Please use the 96.96 syringes filled with 150 μL of control line fluid for the 96.96 Dynamic Array IFC. 17. For detailed instructions on software operation, refer to the Real Time PCR Data Analysis User Guide (Fluidigm 68000088). 18. Refer to Olink Proteomics Proseek Multiplex96x96 User Manual and website (www.olink.com) for instructions and options on data analysis. References 1. Livak KJ, Wills QF, Tipping AJ, Datta K, Mittal R, Goldson AJ, Sexton DW, Holmes CC (2013) Methods for qPCR gene expression profiling applied to 1440 lymphoblastoid single cells. Methods 59(1):71–79 2. Shalek AK, Satija R, Adiconis X, Gertner RS, Gaublomme JT, Raychowdhury R, Schwartz S, Yosef N, Malboeuf C, Lu D, Trombetta JJ, Gennert D, Gnirke A, Goren A, Hacohen N, Levin JZ, Park H, Regev A (2013) Single-cell

transcriptomics reveals bimodality in expression and splicing in immune cells. Nature 498 (7453):236–240 3. Taniguchi Y, Choi PJ, Li GW, Chen H, Babu M, Hearn J, Emili A, Xie XS (2010) Quantifying E. coli proteome and transcriptome with singlemolecule sensitivity in single cells. Science 329 (5991):533–538 ˚ man P 4. Sta˚hlberg A, Thomsen C, Ruff D, A (2012) Quantitative PCR analysis of DNA,

392

Aik T. Ooi and David W. Ruff

RNAs, and proteins in the same single cell. Clin Chem 58(12):1682–1691 5. Assarsson E, Lundberg M, Holmquist G, Bjo¨rkesten J, Thorsen SB, Ekman D, Eriksson A, Rennel Dickens E, Ohlsson S, Edfeldt G, Andersson AC, Lindstedt P, Stenvang J, Gullberg M, Fredriksson S (2014) Homogenous 96-plex PEA immunoassay exhibiting high sensitivity, specificity, and excellent scalability. PLoS One 9(4):e95192 6. Genshaft AS, Li S, Gallant CJ, Darmanis S, Prakadan SM, Ziegler CG, Lundberg M, Fredriksson S, Hong J, Regev A, Livak KJ, Landegren U, Shalek AK (2016) Multiplexed, targeted profiling of single-cell proteomes and

transcriptomes in a single reaction. Genome Biol 17(1):188 7. Gong H, Wang X, Liu B, Boutet S, Holcomb I, Dakshinamoorthy G, Ooi A, Sanada C, Sun G, Ramakrishnan R (2017) Single-cell proteinmRNA correlation analysis enabled by multiplexed dual-analyte co-detection. Sci Rep 7 (1):2776 8. Gong H, Holcomb I, Ooi A, Wang X, Majonis D, Unger MA, Ramakrishnan R (2016) Simple method to prepare oligonucleotide-conjugated antibodies and its application in multiplex protein detection in single cells. Bioconjug Chem 27(1):217–225

Part VI Single Cell Screening

Chapter 23 CRISPR Screening in Single Cells Johan Henriksson Abstract The combination of single-cell RNA-seq and CRISPR allows for efficient interrogation of possibly any number of genes, only limited by the sequencing capability. Here we describe the current protocols for CRISPR screening in single cells, from cloning and virus production to generating sequencing data. Key words Single-cell, CRISPR, CRISPRi, Multiplexing, Lentivirus, Pooling, Droplets, 10
, Cloning, Virus production, Transduction, Transfection, RNA-seq

1

Introduction One of the key advances in next generation sequencing is the ability to multiplex. For example, sequencing has been made easy to scale by pooling multiple barcoded libraries. The single-cell transcriptomics field has pushed library pooling technology to the limit, in the quest to minimize cost. If each cell can be made an individual experiment, this can be harnessed to perform large-scale knock-out or perturbation phenotyping experiments. To date, there have been six studies published for CRISPRscreening at the single cell level [1–6]. In one of these papers, the multiwell plate method MARS-seq is used as the basis [2]. This method is however not commonly used and because it relies on multiwell plates, it is unable to scale to large number of cells. SC-CRISPR will most likely be applied to millions of cells in the future. This method will thus not be discussed further. The other studies utilize droplet-based system for the screen. Examples are Drop-seq [7] and 10
Chromium droplet RNA-seq [8]. However, essentially any droplet system can be used here. An overview of a single-cell CRISPR screen is shown in Fig. 1a. The cells are each expressing Cas9 and one sgRNA. The challenge is to identify which sgRNA is expressed in each cell, allowing them to be separated. Unfortunately the sgRNA is not a polyadenylated RNA molecule and will not be captured by standard single-cell

Valentina Proserpio (ed.), Single Cell Methods: Sequencing and Proteomics, Methods in Molecular Biology, vol. 1979, https://doi.org/10.1007/978-1-4939-9240-9_23, © Springer Science+Business Media, LLC, part of Springer Nature 2019

395

396

Johan Henriksson

Fig. 1 Single-cell CRISPR screening. (a) Overview of the procedure. Targeted sgRNA viruses are cloned, individually or pooled. These are transfected to packaging cells that produce virus. Cells of interested, already expressing Cas9, are transduced by the virus. Single-cell libraries are produced and sequenced. Optionally, and ideally, sgRNA reads are amplified and sequenced separately. (b) A typical barcoded sgRNA-plasmid. The barcode is here attached the BFP molecule whose mRNA is polyadenylated and captured using standard scRNA-seq chemistry. The sgRNA is transcribed by Pol III using the U6 promoter. The barcode and the sgRNA are far apart and cloning is more demanding. (c) The CROP-seq system. Only the sgRNA need be cloned in. Upon viral integration the 30 LTR is copied to the 50 . One of these copies is expressed as part of the virus and polyadenylated, while other copy is transcribed by Pol III as required for CRISPR to function. (d) The distribution of number of viruses per cell (k) as a function of infection rate (λ), or MOI

chemistries (e.g., derivatives of CEL-Seq [9] or Smart-seq2 [10]). Two solutions have so far been used. In Perturb-seq and Mosaicseq [1, 6], a separate barcode is coded into the end of the BFP selection marker (Fig. 1b). It is thus at the 30 end which is typically captured using droplet RNA-seq methods. The disadvantage is that the barcode has to be matched with the sgRNA, and the location on the plasmid of the barcode versus the sgRNA target sequence makes cloning tedious. A much more elegant solution was presented as CROP-seq [3]. This method uses the fact that the 30 LTR of lentiviruses are copied to the 50 during integration (Fig. 1c). The sgRNA sequence and promoter is thus located in the 30 , which is expressed by Pol II along with the rest of the virus content, and the transferred 50 copy is expressed as usual for CRISPR, using Pol III. Since no separate barcode is required, cloning is much easier for CROP-seq than that for Perturb-seq. Care needs, however, to be taken in producing similar constructs—within our lab, we have struggled with poor infection efficiency, likely due to reduced

CRISPR Screening in Single Cells

397

function of the LTR’s. Nevertheless, few cells (