Sequence-Specific DNA Binders for the Therapy of Mitochondrial Diseases (Springer Theses) 9789811684357, 9789811684364, 9811684359

Table of contents :
Supervisor’s Foreword
Acknowledgments
Contents
1 Introduction
1.1 Mitochondrial Biology and Diseases
1.1.1 Mitochondrial Biology
1.1.2 Mitochondrial Diseases
1.2 Pyrrole-Imidazole Polyamides
1.2.1 Design of PIPs
1.2.2 Application of PIPs
References
2 Creation of a Synthetic Ligand for Mitochondrial DNA Sequence Recognition and Promoter-Specific Transcription Suppression
2.1 Introduction
2.2 Results
2.2.1 Design of MITO-PIPs
2.2.2 Promoter-Specific Transcription Control by MITO-PIP-LSP
2.2.3 Sequence-Selective DNA Binding of MITO-PIPs
2.2.4 Mitochondrial Accumulation of MITO-PIP-LSP
2.3 Discussion
2.4 Materials and Methods
2.4.1 General Information of Synthesis
2.4.2 Synthesis of PIP-LSP, MITO-PIP-LSP, and MITO-PIP-HSP1
2.4.3 Synthesis of MITO-PIP-TAMRA
2.4.4 Melting Temperature (Tm) Analysis
2.4.5 Cell Culture
2.4.6 Quantitative Reverse-Transcription PCR Analysis (RT-qPCR)
2.4.7 Live Cell Imaging
2.5 Characterization Data of Synthesized Compounds
References
3 Allele-Specific Replication Inhibition of Mitochondrial DNA by MITO-PIP Conjugated with Alkylation Reagent
3.1 Introduction
3.2 Results
3.2.1 Design and Synthesis of a Conjugate Recognizing Selective DNA Sequence
3.2.2 Validation of Sequence-Specific Adenine Alkylation by 8950A-Chb(Cl/OH)
3.2.3 8950A-Chb(Cl/OH) Shifts Heteroplasmy Level in Live Cells
3.3 Discussion
3.4 Materials and Methods
3.4.1 General Information of Synthesis
3.4.2 Solid-Phase Synthesis of MITO-PIPs and Chlorambucil Conjugation
3.4.3 Synthesis of 8950A-Chb(Cl/OH), Ctrl-Chb(Cl/OH) and 9037A-Chb(Cl/OH)
3.4.4 Synthesis of 8950A-Chb(OH/OH) and Ctrl-Chb(OH/OH)
3.4.5 Preparation of DMSO Solution of Each Compound
3.4.6 Melting Temperature (Tm) Analysis
3.4.7 Alkylation Assay by Capillary Electrophoresis
3.4.8 Compound Treatment and Quantitative PCR (qPCR) Analysis
3.5 Characterization Data of Synthesized Compounds
References
4 Enhanced Nuclear Accumulation of Pyrrole-Imidazole Polyamides by Incorporation of the Tri-Arginine Vector
4.1 Introduction
4.2 Results
4.2.1 Improved Nuclear Delivery of PIP–Tri-Arginine Conjugates
4.2.2 Sequence-Selective DNA Binding of PIP–Tri-Arginine Conjugates
4.2.3 Transcriptional Control of Endogenous Genes by PIP–Tri-Arginine Conjugates
4.3 Discussion
4.4 Materials and Methods
4.4.1 General Information of Synthesis
4.4.2 Synthesis of SOX2i-R3, SOX2i, Ctrl-R3, AP2i-R3, and AP2i
4.4.3 Synthesis of SOX2i-R3-TAMRA and SOX2i-TAMRA
4.4.4 Cell Culture
4.4.5 Live Cell Imaging
4.4.6 Flow Cytometry Analysis
4.4.7 Preparation of DMSO Solution of SOX2i-R3, SOX2i, Ctrl-R3, AP2i-R3, and AP2i
4.4.8 Electrophoretic Mobility Shift Assay
4.4.9 Quantitative Reverse-Transcription PCR (RT-qPCR) Analysis of 201B7 Cells
4.4.10 Quantitative Reverse-Transcription PCR (RT-qPCR) Analysis of SKBR-3 Cells
4.5 Characterization Data of Synthesized Compounds
References
Curriculum Vitae

Citation preview

Springer Theses Recognizing Outstanding Ph.D. Research

Takuya Hidaka

Sequence-Specific DNA Binders for the Therapy of Mitochondrial Diseases

Springer Theses Recognizing Outstanding Ph.D. Research

Aims and Scope The series “Springer Theses” brings together a selection of the very best Ph.D. theses from around the world and across the physical sciences. Nominated and endorsed by two recognized specialists, each published volume has been selected for its scientific excellence and the high impact of its contents for the pertinent field of research. For greater accessibility to non-specialists, the published versions include an extended introduction, as well as a foreword by the student’s supervisor explaining the special relevance of the work for the field. As a whole, the series will provide a valuable resource both for newcomers to the research fields described, and for other scientists seeking detailed background information on special questions. Finally, it provides an accredited documentation of the valuable contributions made by today’s younger generation of scientists.

Theses may be nominated for publication in this series by heads of department at internationally leading universities or institutes and should fulfill all of the following criteria • They must be written in good English. • The topic should fall within the confines of Chemistry, Physics, Earth Sciences, Engineering and related interdisciplinary fields such as Materials, Nanoscience, Chemical Engineering, Complex Systems and Biophysics. • The work reported in the thesis must represent a significant scientific advance. • If the thesis includes previously published material, permission to reproduce this must be gained from the respective copyright holder (a maximum 30% of the thesis should be a verbatim reproduction from the author’s previous publications). • They must have been examined and passed during the 12 months prior to nomination. • Each thesis should include a foreword by the supervisor outlining the significance of its content. • The theses should have a clearly defined structure including an introduction accessible to new PhD students and scientists not expert in the relevant field. Indexed by zbMATH.

More information about this series at https://link.springer.com/bookseries/8790

Takuya Hidaka

Sequence-Specific DNA Binders for the Therapy of Mitochondrial Diseases Doctoral Thesis accepted by Kyoto University, Kyoto, Japan

Author Dr. Takuya Hidaka Center for Biosystems Dynamics Research RIKEN Suita, Japan

Supervisor Prof. Hiroshi Sugiyama Graduate School of Science Kyoto University Kyoto, Japan

ISSN 2190-5053 ISSN 2190-5061 (electronic) Springer Theses ISBN 978-981-16-8435-7 ISBN 978-981-16-8436-4 (eBook) https://doi.org/10.1007/978-981-16-8436-4 © Springer Nature Singapore Pte Ltd. 2022 This work is subject to copyright. All rights are solely and exclusively licensed by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Springer imprint is published by the registered company Springer Nature Singapore Pte Ltd. The registered company address is: 152 Beach Road, #21-01/04 Gateway East, Singapore 189721, Singapore

Supervisor’s Foreword

Mitochondrial diseases are inherited metabolic and neurological disorders characterized by defects in mitochondrial function caused by mutations in nuclear or mitochondrial DNA, and approximately one in 10,000 adults are affected. Mitochondrial diseases manifest a wide range of symptoms and impair patients’ quality of life significantly, and no therapy is available to correct such mutations and cure the diseases. Although recent progress in genome editing technologies using biological tools such as zinc finger nuclease and transcription activator-like effector nuclease (TALEN) have raised promising results for gene therapies, the problem related to the possible genomic alterations and the usage of virus vectors has led to the increasing demand for compound-based approaches. In the present thesis, Dr. Takuya Hidaka has worked on the development of sequence-specific DNA binders which can modulate mitochondrial DNA mutations and nuclear transcription by utilizing a Pyrrole-Imidazole Polyamide (PIP) scaffold towards the therapy of mitochondrial diseases. Chapter 1 systematically summarizes mitochondrial function and highlights the differences between nuclear and mitochondrial DNA. The mechanism and current therapeutic approaches of mitochondrial diseases are described to give a comprehensive background of this research field. After that, the design principle of PIPs is given with examples of their applications to show their potential to be drug candidates for mitochondrial disease treatment. In Chap. 2, he achieves mitochondrial delivery of PIPs by conjugating them with a mitochondrial-penetrating peptide composed of arginine and cyclohexylalanine. The developed sequence-selective mitochondrial DNA binder named MITO-PIP enables artificial repression of mitochondrial gene transcription in a promoter-specific manner. In Chap. 3, he expands the application of MITO-PIPs to removal of mutant mitochondrial DNA from live cells by coupling MITO-PIPs with a DNA alkylating reagent. The in vitro alkylation assay clearly shows that the conjugates specifically alkylate a target mutant adenine in mitochondrial DNA sequence, and mutant mitochondrial DNA level is reduced in culture cells dose-dependently. In Chap. 4, the target is changed from mitochondrial DNA to nuclear DNA, another important factor of mitochondrial diseases. To overcome difficulties with v

vi

Supervisor’s Foreword

nuclear drug delivery, he identified the tri-arginine peptide vector which significantly enhances nuclear uptake of PIPs. The vector improves biological activity of PIPs in cells and successfully downregulates RNA expression of HER2 oncogene. I believe that these achievements could not be made without his passion and tremendous effort. This thesis would pave the way for transgene-free gene therapy for mitochondrial diseases. Kyoto, Japan August 2021

Prof. Hiroshi Sugiyama

Parts of this thesis have been published in the following journal articles: 1.

2.

3.

4.

5.

Hidaka T, Hashiya K, Bando T, Namasivayam GP, Sugiyama H (2021) Targeted elimination of mutated mitochondrial DNA by a multi-functional conjugate capable of sequence-specific adenine alkylation. Cell Chemical Biology. https:// doi.org/10.1016/j.chembiol.2021.08.003. Hidaka T, Sugiyama H (2021) Chemical approaches to the development of artificial transcription factors based on pyrrole-imidazole polyamides. The Chemical Record 21:1374–1384. Hidaka T, Sugiyama H, Namasivayam GP (2021) Sequence-Specific Control of Mitochondrial Gene Transcription using Programmable Synthetic Gene Switches called MITO-PIPs. Methods in Molecular Biology 2275:217–225. Hidaka T, Tsubono Y, Hashiya K, Bando T, Namasivayam GP, Sugiyama H (2020) Enhanced nuclear accumulation of pyrrole-imidazole polyamides by incorporation of tri-arginine vector. Chemical Communications 56:12371– 12374. Hidaka T, Namasivayam GP, Taniguchi J, Nobeyama T, Hashiya K, Bando T, Sugiyama H (2017) Creation of a Synthetic Ligand for Mitochondrial DNA sequence Recognition and Promoter-Specific Transcription Suppression. Journal of the American Chemical Society 139:8444–8447.

vii

Acknowledgments

I would like to express my sincere gratitude to my supervisor Prof. Hiroshi Sugiyama in the Chemical Biology Lab for his support with my study. He provided me not only insightful advice but also the opportunity to work in a rich academic environment with a variety of instruments and plenty of knowledge. His enthusiasm for chemical biology research grows my mind as a professional researcher. The multi-disciplinary environment of the Chemical Biology Lab allowed me to acquire knowledge and skills in a broad research field—I sincerely thank Assistant Professor Soyoung Park, Associate Professor Toshikazu Bando, Associate Professor Masayuki Endo, and Junior Associate Professor Namasivayam Ganesh Pandian, who lead each sub-groups in the Chemical Biology Lab, for their kind technical and mental supports, and also would like to thank all the members of the lab who made my life in the lab enjoyable for six years. I appreciate the financial support for my Ph.D. work, the Fellowship for Young Scientists (DC1) and Overseas Challenge Program for Young Researchers by Japan Society for the Promotion of Science (JSPS), and the Young Researchers’ Exchange Programme between Japan and Switzerland managed by ETH Zurich and funded by the Swiss State Secretariat for Education, Research and Innovation (SERI). Finally, I would like to express my gratitude and love to my parents. They always take care of me and give me tremendous support.

ix

Contents

1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1.1 Mitochondrial Biology and Diseases . . . . . . . . . . . . . . . . . . . . . . . . . . . 1.1.1 Mitochondrial Biology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1.1.2 Mitochondrial Diseases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1.2 Pyrrole-Imidazole Polyamides . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1.2.1 Design of PIPs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1.2.2 Application of PIPs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2 Creation of a Synthetic Ligand for Mitochondrial DNA Sequence Recognition and Promoter-Specific Transcription Suppression . . . . . . . 2.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.2 Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.2.1 Design of MITO-PIPs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.2.2 Promoter-Specific Transcription Control by MITO-PIP-LSP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.2.3 Sequence-Selective DNA Binding of MITO-PIPs . . . . . . . . . 2.2.4 Mitochondrial Accumulation of MITO-PIP-LSP . . . . . . . . . . 2.3 Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.4 Materials and Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.4.1 General Information of Synthesis . . . . . . . . . . . . . . . . . . . . . . . 2.4.2 Synthesis of PIP-LSP, MITO-PIP-LSP, and MITO-PIP-HSP1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.4.3 Synthesis of MITO-PIP-TAMRA . . . . . . . . . . . . . . . . . . . . . . . 2.4.4 Melting Temperature (Tm ) Analysis . . . . . . . . . . . . . . . . . . . . . 2.4.5 Cell Culture . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.4.6 Quantitative Reverse-Transcription PCR Analysis (RT-qPCR) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.4.7 Live Cell Imaging . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.5 Characterization Data of Synthesized Compounds . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

1 1 1 6 10 10 13 16 23 24 25 25 26 28 29 30 31 31 31 33 34 34 34 35 36 39

xi

xii

Contents

3 Allele-Specific Replication Inhibition of Mitochondrial DNA by MITO-PIP Conjugated with Alkylation Reagent . . . . . . . . . . . . . . . . 3.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.2 Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.2.1 Design and Synthesis of a Conjugate Recognizing Selective DNA Sequence . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.2.2 Validation of Sequence-Specific Adenine Alkylation by 8950A-Chb(Cl/OH) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.2.3 8950A-Chb(Cl/OH) Shifts Heteroplasmy Level in Live Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.3 Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.4 Materials and Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.4.1 General Information of Synthesis . . . . . . . . . . . . . . . . . . . . . . . 3.4.2 Solid-Phase Synthesis of MITO-PIPs and Chlorambucil Conjugation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.4.3 Synthesis of 8950A-Chb(Cl/OH), Ctrl-Chb(Cl/OH) and 9037A-Chb(Cl/OH) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.4.4 Synthesis of 8950A-Chb(OH/OH) and Ctrl-Chb(OH/OH) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.4.5 Preparation of DMSO Solution of Each Compound . . . . . . . 3.4.6 Melting Temperature (Tm ) Analysis . . . . . . . . . . . . . . . . . . . . . 3.4.7 Alkylation Assay by Capillary Electrophoresis . . . . . . . . . . . 3.4.8 Compound Treatment and Quantitative PCR (qPCR) Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.5 Characterization Data of Synthesized Compounds . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4 Enhanced Nuclear Accumulation of Pyrrole-Imidazole Polyamides by Incorporation of the Tri-Arginine Vector . . . . . . . . . . . . 4.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.2 Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.2.1 Improved Nuclear Delivery of PIP–Tri-Arginine Conjugates . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.2.2 Sequence-Selective DNA Binding of PIP–Tri-Arginine Conjugates . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.2.3 Transcriptional Control of Endogenous Genes by PIP– Tri-Arginine Conjugates . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.3 Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.4 Materials and Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.4.1 General Information of Synthesis . . . . . . . . . . . . . . . . . . . . . . . 4.4.2 Synthesis of SOX2i-R3, SOX2i, Ctrl-R3, AP2i-R3, and AP2i . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.4.3 Synthesis of SOX2i-R3-TAMRA and SOX2i-TAMRA . . . . 4.4.4 Cell Culture . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.4.5 Live Cell Imaging . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

41 42 43 43 45 48 50 51 51 52 54 54 55 55 55 58 59 63 67 68 69 69 72 73 74 76 76 76 78 79 79

Contents

xiii

4.4.6 4.4.7

Flow Cytometry Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Preparation of DMSO Solution of SOX2i-R3, SOX2i, Ctrl-R3, AP2i-R3, and AP2i . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.4.8 Electrophoretic Mobility Shift Assay . . . . . . . . . . . . . . . . . . . 4.4.9 Quantitative Reverse-Transcription PCR (RT-qPCR) Analysis of 201B7 Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.4.10 Quantitative Reverse-Transcription PCR (RT-qPCR) Analysis of SKBR-3 Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.5 Characterization Data of Synthesized Compounds . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

79 80 81 81 81 83 90

Curriculum Vitae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 93

Chapter 1

Introduction

Abstract Mitochondria are ubiquitous cellular organelles and generate most of the energy required for cellular function. Not only as the powerhouse of cells, but mitochondria also act as hubs for biosynthesis and metabolic waste management and as balancers to maintain cellular homeostasis. Due to the central role in cells, defects in mitochondrial function cause a critical impact on our body, making mitochondrion an attractive target for therapeutic purposes. This chapter describes the basic mitochondrial biology and diseases caused by impaired mitochondrial function—mitochondrial diseases—including current therapeutic approaches. In addition, pyrroleimidazole polyamides, a class of DNA-binding ligands with sequence programmability, are introduced as promising drug candidates to modulate DNA mutation and abnormal RNA transcription. Keywords Pyrrole–imidazole polyamide · Mitochondria · Mitochondrial diseases · DNA mutation

1.1 Mitochondrial Biology and Diseases 1.1.1 Mitochondrial Biology 1.1.1.1

Origin and Function of Mitochondria

About two billion years ago, our ancestors (expected to be archaebacteria) adapted to the rise in oxygen level on earth by having aerobic prokaryotes as endosymbionts in their bodies. During the long evolution process, the prokaryotes have transferred many of their genes to the host genome in nuclei and remain as mitochondria in eukaryotic cells today. This endosymbiotic theory was proposed by Lynn

A part of this chapter is from Hidaka T et al. (2021) Chemical Approaches to the Development of Artificial Transcription Factors Based on Pyrrole-Imidazole Polyamides. Chem Rec 21:1374–1384. Copyright© 2020 by John Wiley Sons, Inc. Reprinted by permission of John Wiley & Sons, Inc. © Springer Nature Singapore Pte Ltd. 2022 T. Hidaka, Sequence-Specific DNA Binders for the Therapy of Mitochondrial Diseases, Springer Theses, https://doi.org/10.1007/978-981-16-8436-4_1

1

2

1 Introduction

Margulis in 1967 and has been widely accepted [1]. Now, mitochondria are ubiquitous cellular organelles, except in erythrocytes, having a wide range of functions in cell metabolism, which can be divided into four types [2]. Energy production The energy from food should be converted into energy-carrying adenosine triphosphate (ATP) or guanosine triphosphate (GTP) that cells can use for their function. Metabolites from nutrients like sugar, amino acid, and fatty acid are shuttled into the tricarboxylic acid (TCA) cycle, and through consecutive oxidation reactions, reduced electron carriers NADH and FADH2 and other metabolites for the biosynthesis are produced. NADH and FADH2 deposit electrons into the electron transport chain embedded in the inner mitochondrial membrane (IMM). The electron transport chain contains a series of five complexes (I–V), which are made up of 4–45 polypeptides, and transfer protons into the intermembrane space of mitochondria making a proton gradient across the inner mitochondrial membrane. The pumped protons flow into the mitochondrial matrix through complex V (F1F0-ATP synthase) to generate ATP [3, 4]. This process is called oxidative phosphorylation (OXPHOS) and generates most of the energy required for cellular function. Biosynthesis of biomolecules Mitochondria are hubs of biosynthesis and contribute to the production of biomolecules such as nucleotides, fatty acids, cholesterol, amino acids, and glucose. For example, some enzymes required for amino acid synthesis are found in mitochondria, including glutamine synthetase, which condenses glutamate and ammonia, and pyrroline-5-carboxylate synthase (P5CS) and pyrroline5-carboxylate reductase (PYCR) which covert glutamates into prolines. Biosynthetic pathways of heme and iron-sulfur clusters in mitochondria have also been characterized [5]. Maintenance of cellular homeostasis Balancing redox equivalents in the cytosol is essential to maintain cellular homeostasis in response to stress signals. Mitochondria achieve this by indirect pathways that modulate NAD+ /NADH ratio: malate-aspartate shuttle, malate-citrate shuttle, alpha-glycerophosphate shuttle, and folate shuttle pathways. The cytosol is maintained in a more oxidizing environment (NAD+ /NADH ratio is 60 ~ 700), while mitochondria have a reductive environment (NAD+ /NADH ratio is 7 ~ 8) [6]. Metabolic waste management Metabolic reactions generate by-products. Recent studies have revealed that some by-products such as lactate, ammonia, reactive oxygen species (ROS), and hydrogen sulfide (H2 S) function as signaling molecules, and by-products highly reactive or toxic to cells should be appropriately processed. Mitochondria have several pathways to manage metabolic waste. For example, H2 S is toxic and inhibits complex IV function in the electron transport chain [7], and mitochondria detoxify H2 S by converting it into sulfate through sequential oxidation [8]. In addition to the metabolic functions, mitochondria play a pivotal role in other cellular processes, including non-shivering thermogenesis, calcium homeostasis, and apoptosis [9–12].

1.1 Mitochondrial Biology and Diseases

1.1.1.2

3

Nuclear and Mitochondrial DNA

As described above, mitochondrion works as a hub that integrates various metabolic and cellular functions. The complex function of mitochondria is maintained by approximately 1500 proteins (~10% of cellular proteome), and most of them are encoded in nuclear DNA (nDNA) [13–17]. Mitochondrial proteins transcribed in nuclei and translated in the cytosol are delivered into the mitochondrial matrix by the protein import machinery in the outer and inner mitochondrial membrane. Typically, the translocase of the outer membrane (TOM) is used for delivery into the intermembrane space, and the translocase of the inner membrane (TIM) or mitochondrial intermembrane space import and assembly (MIA) pathway is used for delivery into the mitochondrial matrix [18–20]. Mitochondria possess their genome (mtDNA) encoding 37 genes, including 13 protein-coding genes required for the electron transport chain, and 22 tRNA and two rRNA for mitochondrial translation (Fig. 1.1) [21, 22]. Each strand of mtDNA can be separated by density centrifugation due to the difference in their base composition. The heavier strand, rich in guanine, is called a heavy (H) strand, and another is called a light (L) strand [23]. While the H strand contains 12 protein-coding genes, two rRNA, and 14 tRNA, the L strand only encodes one protein-coding gene and eight tRNA. Due to its distinct origin, mtDNA is much different from nuclear DNA (nDNA). First, mtDNA has a cyclic structure and only ~16.5 kbp length (nDNA is ~3 billion bp) [24]. Over time, many mtDNA fragments have been relocated or duplicated to the nuclear genome, and genome sequencing technology revealed the presence of a large number of mtDNA fragments in nDNA (nuclear mitochondrial DNA sequences, NUMTs) [25–27]. Secondly, the genetic code in mitochondria is slightly different from that in nuclei. In vertebrate mitochondria, the AUA codon codes for methionine (isoleucine in nuclei), and the nuclear stop codon UGA is reassigned as a tryptophan. Recoding of two arginine triplets (AGA and AGG) to stop codons has also been proposed [28]. Thirdly, while the nuclear genome is compacted with histone proteins forming nucleosome structure, mtDNA is coated with proteins including mitochondrial transcription factor A (TFAM), and packaged into a nucleoid structure [29]. In mammalian cells, nucleoids have a uniform size (~100 nm), and most of the individual nucleoid contains a single copy of mtDNA [30]. Lastly, each cell and mitochondrion contain multiple copies of mtDNA (in the case of mammalian cells, 2–10 copies per mitochondrion) [31]. The number of mtDNA in an individual cell can vary depending on cell type—200–2000 copies in each somatic cell [32] and ~100,000 copies in a matured oocyte [33].

4

1 Introduction

Fig. 1.1 Human mitochondrial genome. Mitochondrial DNA (mtDNA) has ~16.6-kbp circular structure and encodes 37 genes, including 22 tRNA (black), two rRNA (green), and 13 proteincoding genes. The protein-coding genes produce seven complex I (light blue, NADH dehydrogenase), one complex III (blue, cytochrome b), three complex IV (orange, cytochrome c oxidase), and two complex V (purple, ATP synthase) subunits involved in the oxidative phosphorylation process. OriH and OriL are the origins of heavy-strand and light-strand mtDNA replication, and RNA transcription is controlled at the light-strand promoter (LSP) and the heavy-strand promoter (HSP). The displacement loop (D-loop) in mtDNA is a non-coding region containing LSP, HSP1, and OriH and is important for the regulation of mitochondrial RNA transcription and DNA replication

1.1.1.3

Transcription and Replication of Mitochondrial DNA

Unlike nuclear genes, transcription and replication of mtDNA genes are controlled at only one large non-coding region (~1100 bp) containing most of the mtDNA replication and transcription control element: the displacement loop (D-loop, Fig. 1.1). One promoter region for the L strand (LSP) and two promoters for the H strand (HSP1 and HSP2) have been proposed, but the function of HSP2 is still controversial. Transcription initiation from LSP and HSP1 requires the assembly of TFAM, mitochondrial transcription factor 2 (TFB2M), and mitochondrial RNA polymerase (POLRMT). Efficient mitochondrial transcription is supported by mitochondrial transcription

1.1 Mitochondrial Biology and Diseases

5

elongation factor (TEFM) and single-stranded DNA-binding protein 1 (SSBP1), and transcription termination is mediated by the family of mitochondrial transcription termination factors (mTERF1-mTERF4) [34]. Mitochondrial transcription occurs in a polycistronic manner, and transcripts are processed during RNA maturation as in prokaryotic cells. Several mechanisms of mtDNA replication have been proposed so far [35, 36], and the most characterized one is the strand displacement model [37]. In this model, the replication starts from the replication start point in the H strand (OriH ). At this time point, the replication of the L strand is not initiated, and the displaced parental H strand is covered with SSBP1 to prevent random RNA synthesis by POLRMT from the displaced strand. When the synthesis of the H strand proceeds and the replication start point in the L strand (OriL ) is displaced, the OriL forms a stem-loop inhibiting SSBP1 binding and enhance POLRMT binding. The POLRMT synthesizes RNA primer (~25 nt), initiating synthesis of the L strand. After replication is completed, topoisomerase 3a separates the two copies of mtDNA by resolving the hemicatenane structure [38]. Other proposed mtDNA replication mechanisms are the RITOLS model, in which processed RNA molecules hybridize to the displaced single-stranded H strand [39], and the strand-coupled DNA replication model, in which the L and H strand are newly synthesized bidirectionally from broad regions [40]. Mitochondria are primary sources of reactive oxygen species (ROS) and generate approximately 90% of ROS in eukaryotic cells [41, 42]. This is due to the oxidative phosphorylation reaction, and complex I and III in the electron transport chain have been reported to be the significant producers [43, 44]. The reduction of molecular oxygen by an electron leaked from the electron transport chain generates superoxide (·O2 ), which is a precursor of other ROS like hydrogen peroxide (H2 O2 ) and hydroxyl radical (·OH). ROS are highly reactive and cause oxidative damage to mitochondrial macromolecules that have been implicated in degenerative disease and aging. To protect from ROS damage, superoxide dismutase (SOD1 in the intermembrane space and SOD2 in the mitochondrial matrix) converts superoxide into less reactive hydrogen peroxide, and the resulting hydrogen peroxide is subjected to further enzymatic reactions or works as signaling agents to control proliferation, differentiation, and migration [45, 46]. Although there are some ROS clearance systems in mitochondria, mitochondrial ROS causes a higher mutation rate of mtDNA than nDNA [47, 48]. (It should be noted that some studies indicate that replication errors are more dominant than mutations caused by oxidative stress [49].) Unlike the nucleus, mitochondria have limited ability to repair mtDNA [50], and the base excision repair (BER) that removes and repairs deaminated, oxidized, and alkylated DNA bases are the only bona fide mitochondrial repair pathway that has been characterized so far [51]. First DNA glycosylase (UNG1 and OGG1) removes damaged bases by hydrolysis of N-glycosidic bonds, and the resulting apurinic/apyrimidinic (AP) sites are cleaved by AP endonuclease 1 (APE1). The single-stranded breaks are subjected to gap-filling and nick sealing by POLG and LIG3 (DNA ligase), respectively. In case of long patch repair, additional strand displacement by POLG and flap removal by flap endonuclease 1 (FEN1), DNA2, or EXOG are required before nick sealing. Although there is emerging evidence for

6

1 Introduction

other DNA repair pathways in mitochondria like mismatch repair (MMR) [52, 53], further characterization of other pathways such as nucleotide excision repair (NER) [54] and ribonucleotide excision repair (RER) [55] is required. Linearized mtDNA by double-strand breaks (DSB) is subjected to rapid degradation rather than the DSB repair. The exonuclease activity of POLG is required for the degradation, and without the nuclease activity, the prolonged lifetime of linear fragments increases the level of mtDNA deletion [56]. Other components of the mtDNA replication machinery (TWNK and MGME1) are also reported to be responsible for linear DNA digestion [57]. Because each cell contains multiple copies of mtDNA, degradation of cleaved mtDNA and successive propagation of intact mtDNA would be safe by avoiding possible mutations caused by incomplete DNA repair.

1.1.2 Mitochondrial Diseases Mutations of mitochondrial genes impair the function of mitochondria, and the resulting genetic disorders are called “mitochondrial diseases,” which are the most common group of inherited metabolic and neurological disorders involving any organ or tissue [24]. Most mitochondrial diseases show a primary defect in oxidative phosphorylation, so high-energy-demand tissues that are dependent on aerobic metabolisms such as skeletal muscle and brain are typically affected. Because a variety of mutations in mtDNA and nDNA can contribute to mitochondrial diseases, they show a wide range of symptoms and have any inheritance pattern, including autosomal and X-linked inheritance for nDNA mutations and maternal inheritance for mtDNA mutations. In children ( G) causing Leber’s hereditary optic neuropathy (LHON) [62, 63]. Since their discovery, an increasing number of

1.1 Mitochondrial Biology and Diseases

7

inherited pathogenic mutations in mtDNA have been reported [64–66]. For example, LHON can be caused by other mutations such as m.14484T > C in MT-ND6 and m.3460G > A in ND1 [67, 68], and the m.3243A > G mutation for MELAS syndrome (mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes syndrome) is one of the mtDNA mutations studied extensively [69]. Representative mtDNA mutations are summarized in Table 1.1. A database of polymorphism and mutations in human mtDNA (MITOMAP) is available online. It has been continuously updated since 1996 to cover most of the reported mutations (387 entries are registered as pathogenic rRNA/tRNA point mutations, and 444 entries are listed as pathogenic point mutations in the coding and control region as of November 2020) [64–66]. The presence of multiple mtDNA can lead to a mixture of mutated and wild-type mtDNA in an individual cell, a situation known as “heteroplasmy.” When each cell contains only mutated mtDNA, the state is called homoplasmy. The heteroplasmy level is an essential factor in determining cellular phenotype because when the amount of mutated genome is small, the mitochondrial function can be maintained by the residual wild-type mtDNA. Typically, a high level of heteroplasmy exceeding a critical threshold level (>50% of mutated mtDNA) is required to alter mitochondrial function (threshold effect) [70], and the biochemical threshold at which mitochondrial diseases occur can be varied among mutations and cells type (Fig. 1.2). This indicates that the elimination of mutant mtDNA is important to cure mitochondrial diseases. Currently, symptomatic treatments by low molecular weight compounds are mainly used to treat mitochondrial diseases. Although these approaches alleviate the clinical symptoms, pathogenic mutations should be corrected, or the proportion of mutated mtDNA should be reduced to cure mitochondrial diseases permanently. To date, the only option to prevent the inheritance of mutated mtDNA is mitochondrial replacement therapy (also called mitochondrial donation or transplantation) [81, 82]. In this approach, pronuclear transfer, metaphase II spindle transfer, or polar body transfer is performed between patient-derived and donor-derived oocyte (or zygote) to develop zygote with nDNA from the patients and wild-type mtDNA from donors. Although this technique was approved by the UK parliament in 2015, it has Table 1.1 Examples of pathogenic mutations in mtDNA Syndrome

mtDNA mutation

References

Leigh syndrome

m.8993T > G (MTATP6), m.8993T > C (ND4) …

[71–73]

Leber’s hereditary optic neuropathy (LHON)

m.11778G > A (ND4), m.3460G > A (ND1), m.14484T > C (ND6) …

[62, 68, 74]

Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome

m.3243A > G (MT-TL1), m.3271T > C (MT-TL1), m.3256C > T (MT-TL1), m.4332G > A (MT-TQ) …

[69, 75–77]

Myoclonic epilepsy with ragged red fibers (MERRF)

m.8344A > G (MT-TK), m.8356T > C (MT-TK), m.8363G > A (MT-TK)

[78–80]

8

1 Introduction

Fig. 1.2 Schematic illustration of heteroplasmy, homoplasmy, and threshold effect. A high level of heteroplasmy exceeding a clinical threshold level is required to alter mitochondrial function and cause mitochondrial diseases. The elimination of mutant mtDNA is required to cure mitochondrial diseases

raised numerous ethical issues concerning the “three genetic parents” problem and has not been approved in other countries [83, 84]. Also, it is reported that carryover of mutated mtDNA during nuclear transfer can compromise the effect [85, 86], and most importantly, this approach is only for prevention and cannot be applied to patients for therapeutic purposes. Several approaches towards gene therapies to eliminate mtDNA mutations have been reported. Sequence-specific induction of DSBs is effective because linearized mtDNA is rapidly removed from mitochondria, and this has been achieved by introducing mitochondrial targeting sequences (MTS) into nucleases [87]. The first report was a mitochondrially targeted restriction enzyme PstI and successfully reduced mtDNA harboring PstI sites [88]. Following this report, other restriction enzymes, including SmaI, ApaLI, ScaI, XmaI, and XhoI, have also been utilized and showed positive results of selective mtDNA degradation in culture cells and mice [88–96]. Although these approaches using restriction enzymes are promising, the availability of restriction enzymes with the proper recognition sequence limits the scope of mtDNA mutations that can be targeted with this approach. To provide sequence flexibility, mitochondrially targeted zinc finger nucleases (mtZFNs) were developed. Two types of mtZFNs have been reported so far. One is single-chain ZFNs containing two FokI nuclease domains connected to zinc finger protein with a mitochondrial targeting sequence [97], and the other is mitochondrially targeted obligate heterodimeric zinc finger nucleases using a pair of mtZFNs which bind to the target sites next to each other and form FokI heterodimer to cleave DNA [98]. Both constructs reduced mtDNA possessing m.8993T > C point mutation associated with neuropathy, ataxia, retinitis pigmentosa (NARP), and Leigh’s syndrome in cybrid cells. The latter construct was also applied to the common deletion that involves a 4977-bp region flanked by 13-bp repeats associated with adult-onset chronic progressive external ophthalmoplegia (CPEO), and elimination of mtDNA with the common deletion by mtZFNs recovered respiration function of cybrid cells [98]. A study using a mouse model of heteroplasmic mtDNA mutation in tRNA(Ala) (m.5024C > T) showed the efficacy of the mtZFNs in vivo [99].

1.1 Mitochondrial Biology and Diseases

9

Another system with programmable sequence selectivity is transcription activatorlike effector nucleases (TALENs) engineered to localize to mitochondria (mitoTALEN). After the first report of mitoTALEN in 2013 [100], it has been applied to various mutations (e.g., m.8344A > G and m.13513G > A) [101] and specific elimination of mutant mtDNA in patient-derived induced pluripotent stem cells (iPSCs) and mouse and porcine oocyte were also achieved with this system [102, 103]. Importantly, an in vivo study using a mouse model possessing m.5024C > T point mutation showed that delivery of expression construct of mitoTALEN by adeno-associated virus (AAV) 9 vector led to a robust reduction in mutant mtDNA and restored the tRNA(Ala) level, indicating the great potential as gene therapy for human [104]. Although CRISPR/Cas9 system targeting mtDNA was first reported in 2015 [105], a mechanism of mitochondrial import of sgRNA, which is a prerequisite for mitochondrial CRISPR/Cas9, is still controversial and more studies are required to validate the efficacy of the reported system [106]. Recently, a paper deposited in a preprint server reports that sgRNA conjugated with 20 nucleotide stem-loop sequences derived from nuclear ribozyme RNase P is delivered into mitochondria efficiently in a polynucleotide phosphorylase (PNPase)-dependent manner [107, 108]. The approaches described above eliminate mutant mtDNA selectively, but they cannot be used when the mutation is homoplasmy and no wild-type mtDNA is available in cells. The recent discovery of a cytidine deaminase named DddA, which can convert cytosine into uracil (read as thymine) within double-stranded DNA, led to the development of RNA-free DddA-derived cytosine base editors (DdCBEs). The system is fusions of the split-DddA halves, TALE repeat array, mitochondrial targeting sequence, and a uracil glycosylase inhibitor, and enables us the sequenceselective conversion of cytosine to thymine in mtDNA [109]. This base “editing” has the potential as a gene therapeutic tool to correct mtDNA mutations even in the homoplasmic state. The problem of protein-based approaches is that we need to deliver DNA constructs into cells to express such proteins in a stable manner, which is a potential risk of unexpected genomic alterations by random integration, and typically, virus vectors are required for efficient delivery. (It should be noted that lipid-based mitochondrial delivery vector named “Mito-Porter,” which can be applied to a wide range of cargos including DNA, RNA, and protein, has also been reported [110, 111].) This is why there is an increasing demand for compound-based approaches to treat or cure mitochondrial diseases, but currently, no compound-based drugs in clinical trials have the potential to cure mitochondrial diseases permanently by modulating mtDNA mutation [112]. One approach towards this purpose is mitochondrial delivery of peptide nucleic acid (PNA) oligomers targeting mutant mtDNA sequences. During mtDNA replication, mtDNA becomes single-stranded, and there is the opportunity for PNA oligomers to bind to the target sequence and inhibit mtDNA replication. Although conjugation of PNA oligomers with mitochondrial targeting sequence derived from cytochrome c oxidase subunit 8 (COX8) or triphenylphosphonium cation enhanced targeted delivery of PNA oligomers to mitochondria [113, 114], no reports achieved mtDNA heteroplasmy shifts in culture cells and selective inhibition of mutant mtDNA replication have been demonstrated only in the in vitro

10

1 Introduction

system [113, 115]. Accordingly, further investigation of chemical compounds which have the potential to cure mitochondrial diseases permanently by modulating mtDNA mutation is required.

1.2 Pyrrole-Imidazole Polyamides Pyrrole-imidazole polyamides (PIPs) are minor-groove DNA binders composed of N-methylpyrrole and N-methylimidazole, which were initially reported by Dervan’s group (Fig. 1.3) [116, 117]. The advantage of PIPs is that we can program their binding sequences by modifying the combination of pyrrole and imidazole rings. In this section, I describe the rules of PIP design and applications of PIPs to DNA probing, secondary structure control, and artificial gene regulation.

1.2.1 Design of PIPs PIPs are derived from natural antibiotics—netropsin and distamycin A—which contain two and three N-methylpyrrole rings and bind to the minor groove of AT-rich sequences. By replacing N-methylpyrrole with N-methylimidazole, an additional hydrogen bond is formed between the exocyclic amino group of guanines and N3 on imidazole, providing G/C selectivity to PIPs (Fig. 1.4b) [118, 119]. Although one strand of PIP is enough to bind to DNA, higher selectivity can be obtained when two strands locate in the DNA groove in an antiparallel direction. When we design PIPs targeting specific sequences, we are guided by the following principles:

Fig. 1.3 a Chemical structure of a cyclic PIP. Pyrrole and imidazole rings are shown in blue and red, respectively. The recognized DNA sequence is indicated with a schematic PIP structure. W/W base pairs indicate A/T or T/A base pairs. b Crystal structure of a DNA-PIP complex (PDB: 3OMJ) [116]. DNA and PIP molecules are shown as a surface model and a stick model, respectively

1.2 Pyrrole-Imidazole Polyamides

11

Fig. 1.4 a Chemical structure of hairpin and H-pin PIPs [121, 123]. Two PIP strands are joined by a linker to promote an antiparallel alignment in the minor groove of duplex DNA. b Base pair recognition rule of PIPs. Pyrrole/pyrrole pairs recognize A/T or T/A base pairs through two hydrogen bonds, whereas pyrrole/imidazole pairs recognize C/G base pairs through three hydrogen bonds [118, 131]. c Introduction of flexible β-alanine instead of pyrrole into long PIPs improves their binding affinity to a target sequence [132]

12

1 Introduction

Fig. 1.4 (continued)

1.

2.

3.

4.

To promote the antiparallel alignment of two PIP strands, PIPs that have two strands joined by linkers have been widely used. Structures such as cyclic- [120], hairpin- [121, 122], and H-pin-type PIPs have been proposed to date (Figs. 1.3 and 1.4a) [123, 124]. Hairpin-type PIPs are the primary choice because of their ease of synthesis by solid-phase synthesis [125, 126], but cyclic-type PIPs were reported to have better binding affinity and selectivity than hairpin-type PIPs [127–130]. Antiparallel pyrrole/pyrrole pairs recognize A/T or T/A base pairs by forming two hydrogen bonds. In contrast, pyrrole/imidazole pairs recognize C/G base pairs with three hydrogen bonds (Fig. 1.4b) [118, 131]. 4–4 or 6–6 ring-type hairpin PIPs, which have two strands containing four or six pyrrole/imidazole rings each, are commonly used. We can program their target sequences in four or six base pair lengths by rearranging the combination of pyrrole and imidazole rings. Due to over-curvature, PIPs targeting DNA sequences longer than five base pairs do not fit into the shape of the DNA minor groove, reducing their affinity and selectivity. Replacing pyrroles with flexible β-alanine relaxes the curvature and allows efficient binding of long PIPs [132]. In the case of 6–6 ring-type PIPs, one β-alanine should be introduced instead of pyrrole at the central position in each strand (Fig. 1.4c). The turn unit (e.g., γ-aminobutyric acid) and β-alanine located at the C-terminal structure of PIPs are known to have A/T or T/A selectivity [133, 134]. This effect is critical for turn units, and the desired affinity is not obtained when turn units locate on G/C or C/G base pairs.

Generally, the binding affinity and sequence selectivity of PIPs are routinely evaluated by melting curve assay of the DNA-PIP complex, surface plasmon resonance

1.2 Pyrrole-Imidazole Polyamides

13

(SPR) assay, and electrophoretic mobility shift assay (EMSA). High-throughput analyses based on microarrays and next-generation sequencing have also been reported to obtain more detailed information about sequence specificity in various sequence contexts and binding sites on the genome [135–139].

1.2.2 Application of PIPs Sequence-selective DNA binding of PIPs enables us to deliver functional compounds to specific genomic sites. One application is the visualization of the telomere structures in nuclei. Telomeres locate at the terminal of chromosomes and have essential roles in maintaining chromosome stability and replication. Human telomeres have a repetitive 5 -(TTAGGG)n -3 sequence, and tandem PIPs conjugated with fluorescent compounds that target 12, 18, and 24 bp sequences in telomeres have been reported [140–145]. An advantage of PIP probes is that because PIPs bind to duplex DNA, denaturation steps such as heating, which are indispensable for nucleic acid probes, are not required for probing. This advantage enables us to perform live cell imaging of telomeres by using a PIP probe labeled with silicon rhodamine (SiR-TTet59B, Fig. 1.5a) that targets a 24 bp sequence in telomeres [146]. It is also possible to control the secondary structure of DNA by giving local force to DNA. In 2018, it was reported that G-quadruplex formation can be induced by pulling two DNA sequences flanking a G-quadruplex-forming sequence towards each other using PIP dimers (Fig. 1.5b) [147]. These studies indicate that PIP is a good platform to achieve artificial gene control based on the genomic sequence. In eukaryotic cells, genomic DNA is wrapped around histone octamers, forming nucleosomes and genome-wide chromatin structure. Nucleosomes restrict the access of transcription factors to DNA and act as an additional layer to regulate gene expression. Generally, transcription factors do not bind to highly packed nucleosomal DNA, and genes in this region are transcriptionally silenced. When nucleosomes are loosened and unfolded, released DNA is subjected to the binding of transcription factors enhancing gene transcription. This switching between “OFF” and “ON” states is controlled by epigenetic modification of histone proteins. Lysine acetylation in the tail region is one of the histone modifications that is extensively studied. When lysin residues are acetylated by enzymes with histone acetyltransferase (HAT) activity, the positive charge of the amine group is neutralized, and electrostatic interaction between DNA and histone is weakened. Because this loosens the nucleosome structure and activates gene expression, acetylated K9 and K27 of histone H3 are recognized as active transcription markers. Conversely, histone deacetylation is mediated by histone deacetylase (HDAC) and downregulates gene expression (Fig. 1.6a). In the earlier studies to develop artificial transcription factors that activate gene expression, suberoylanilide-hydroxamic acid (SAHA), an HDAC inhibitor used as an anticancer drug, was mainly used. Because SAHA can keep genome transcriptionally ON state by inhibiting histone deacetylation, SAHA–PIP conjugates were

14

1 Introduction

Fig. 1.5 a (top) A tandem PIP targeting repetitive telomere sequence labeled with silicon rhodamine (SiR-TTet59B) can visualize telomere structures. (bottom left) The signal from SiR-TTet59B overlapped with telomere structures labeled with an antibody against TRF2. (bottom right) Cellular delivery of SiR-TTet59B using a peptide-based transfection reagent (Endo-Porter) enables observation of telomere dynamics in living cells and telomere fusion was captured (indicated by white arrows) [146]. b PIP dimers pulling two DNA sequences flanking a G-quadruplex-forming sequence towards each other can enhance G-quadruplex formation [147]

expected to bind to a programmed sequence and activate genes around the binding site (Fig. 1.6b) [148]. A study using a SAHA–PIP library containing 32 SAHA–PIPs targeting distinct sequences showed that each SAHA–PIP activated transcription of different sets of genes in human dermal fibroblasts depending on the target sequence of SAHA–PIPs, supporting their sequence-specific gene activation (Fig. 1.6c) [149]. In the following study, a HAT activator, N-(4-chloro-3-(trifluoromethyl) phenyl)-2ethoxybenzamide (CTB), was used to obtain a similar effect to SAHA (Fig. 1.6b). Interestingly, while different genes were activated by SAHA and CTB, SAHA–PIP

1.2 Pyrrole-Imidazole Polyamides

15

Fig. 1.6 a Schematic illustration of gene expression control by histone acetylation. b Chemical structure of PIP conjugated with epigenetic modulators (SAHA and CTB) for transcription activation using histone acetylation machinery. c Heat map of gene activation derived from transcriptome analysis of human dermal fibroblasts after treatment with SAHA–PIPs targeting distinct DNA sequences [149]. Each row corresponds to one probe of microarray, and red and green colors indicate activation and repression level of each gene expression, respectively. There is no significant overlap among the gene sets activated by each SAHA–PIP. d A similar analysis was performed on samples treated with SAHA, CTB, SAHA–PIP, and CTB–PIP [150]. Whereas there was no overlap in activated gene sets between SAHA and CTB, many genes were commonly upregulated by SAHA–PIP and CTB–PIP

16

1 Introduction

and CTB–PIP conjugates targeting the same DNA sequence activated a similar set of genes (Fig. 1.6d) [150]. This result also suggests that site-specific gene activation can be achieved by combining the sequence selectivity of PIPs and epigenetic modulation by functional compounds. As explained above, extensive studies of PIPs have suggested that sequenceselective DNA binding of PIPs would enable us to target pathogenic DNA mutations or specific DNA sequences causing aberrant gene expression in nuclei and mitochondria. This advantage of PIPs makes them promising chemical tools to modulate such mutations and gene transcription for therapeutic purposes.

References 1. Sagan L (1967) On the origin of mitosing cells. J Theoret Biol 14:225–274 2. Spinelli JB, Haigis MC (2018) The multifaceted contributions of mitochondria to cellular metabolism. Nat Cell Biol 20:745–754 3. Noji H, Yasuda R, Yoshida M, Kinosita K (1997) Direct observation of the rotation of F1 ATPase. Nature 386:299–302 4. Abrahams JP, Leslie AGW, Lutter R, Walker JE (1994) Structure at 2.8 Å resolution of F1 -ATPase from bovine heart mitochondria. Nature 370:621–628 5. Maio N, Rouault TA (2020) Outlining the complex pathway of mammalian Fe-S cluster biogenesis. Trends Biochem Sci 45:411–426 6. Stein LR, Imai S (2012) The dynamic regulation of NAD metabolism in mitochondria. Trends Endocrinol Metab 23:420–428 7. Block K, Gorin Y, Abboud HE (2009) Subcellular localization of Nox4 and regulation in diabetes. Proc Natl Acad Sci USA 106:14385–14390 8. Levitt MD, Abdel-Rehim MS, Furne J (2011) Free and acid-labile hydrogen sulfide concentrations in mouse tissues: anomalously high free hydrogen sulfide in aortic tissue. Antioxid Redox Signal 15:373–378 9. Hopper RK et al (2006) Mitochondrial matrix phosphoproteome: effect of extra mitochondrial calcium. Biochemistry 45:2524–2536 10. Hughes DA, Jastroch M, Stoneking M, Klingenspor M (2009) Molecular evolution of UCP1 and the evolutionary history of mammalian non-shivering thermogenesis. BMC Evol Biol 9:4 11. Rasola A, Bernardi P (2011) Mitochondrial permeability transition in Ca2+ -dependent apoptosis and necrosis. Cell Calcium 50:222–233 12. Rizzuto R, Stefani DD, Raffaello A, Mammucari C (2012) Mitochondria as sensors and regulators of calcium signalling. Nat Rev Mol Cell Biol 13:566–578 13. Calvo SE, Clauser KR, Mootha VK (2016) MitoCarta2.0: an updated inventory of mammalian mitochondrial proteins. Nucleic Acids Res 44:D1251–D1257 14. Calvo SE, Mootha VK (2010) The mitochondrial proteome and human disease. Annu Rev Genom Hum Genet 11:25–44 15. Pagliarini DJ et al (2008) A mitochondrial protein compendium elucidates complex I disease biology. Cell 134:112–123 16. Rhee HW et al (2013) Proteomic mapping of mitochondria in living cells via spatially restricted enzymatic tagging. Science 339:1328–1331 17. Smith AC, Robinson AJ (2016) MitoMiner v3.1, an update on the mitochondrial proteomics database. Nucleic Acids Res 44:D1258–D1261 18. Chacinska A, Koehler CM, Milenkovic D, Lithgow T, Pfanner N (2009) Importing mitochondrial proteins: machineries and mechanisms. Cell 138:628–644 19. Schmidt O, Pfanner N, Meisinger C (2010) Mitochondrial protein import: from proteomics to functional mechanisms. Nat Rev Mol Cell Biol 11:655–667

References

17

20. Wiedemann N, Pfanner N (2017) Mitochondrial machineries for protein import and assembly. Annu Rev Biochem 86:685–714 21. Anderson S et al (1981) Sequence and organization of the human mitochondrial genome. Nature 290:457–465 22. Andrews RM et al (1999) Reanalysis and revision of the Cambridge reference sequence for human mitochondrial DNA. Nat Genet 23:147–147 23. Berk AJ, Clayton DA (1974) Mechanism of mitochondrial-DNA replication in mouse L-cells—asynchronous replication of strands, segregation of circular daughter molecules, aspects of topology and turnover of an initiation sequence. J Mol Biol 86:801–824 24. Gorman GS et al (2016) Mitochondrial diseases. Nat Rev Dis Primers 2:16080 25. Dayama G, Emery SB, Kidd JM, Mills RE (2014) The genomic landscape of polymorphic human nuclear mitochondrial insertions. Nucleic Acids Res 42:12640–12649 26. Mourier T, Hansen AJ, Willerslev E, Arctander P (2001) The human genome project reveals a continuous transfer of large mitochondrial fragments to the nucleus. Mol Biol Evol 18:1833– 1837 27. Tourmen Y et al (2002) Structure and chromosomal distribution of human mitochondrial pseudogenes. Genomics 80:71–77 28. Richter R et al (2010) Translation termination in human mitochondrial ribosomes. Biochem Soc Trans 38:1523–1526 29. Kukat C et al (2015) Cross-strand binding of TFAM to a single mtDNA molecule forms the mitochondrial nucleoid. Proc Natl Acad Sci USA 112:11288–11293 30. Kukat C et al (2011) Super-resolution microscopy reveals that mammalian mitochondrial nucleoids have a uniform size and frequently contain a single copy of mtDNA. Proc Natl Acad Sci USA 108:13534–13539 31. Bogenhagen D, Clayton DA (1974) Number of mitochondrial deoxyribonucleic-acid genomes in mouse L and human HeLa cells—quantitative isolation of mitochondrial deoxyribonucleicacid. J Biol Chem 249:7991–7995 32. Robin ED, Wong R (1988) Mitochondrial-DNA molecules and virtual number of mitochondria per cell in mammalian-cells. J Cell Physiol 136:507–513 33. Piko L, Taylor KD (1987) Amounts of mitochondrial-DNA and abundance of some mitochondrial gene transcripts in early mouse embryos. Dev Biol 123:364–374 34. Barshad G, Marom S, Cohen T, Mishmar D (2018) Mitochondrial DNA transcription and its regulation: an evolutionary perspective. Trends Genet 34:682–692 35. Falkenberg M (2018) Mitochondrial DNA replication in mammalian cells: overview of the pathway. Essays Biochem 62:287–296 36. Yasukawa T, Kang D (2018) An overview of mammalian mitochondrial DNA replication mechanisms. J Biochem 164:183–193 37. Robberson DL, Vinograd J, Kasamatsu H (1972) Replication of mitochondrial DNA. Circular replicative intermediates in mouse L cells. Proc Natl Acad Sci USA 69:737–741 38. Nicholls TJ et al (2018) Topoisomerase 3 alpha is required for decatenation and segregation of human mtDNA. Mol Cell 69:9–23 39. Yasukawa T et al (2006) Replication of vertebrate mitochondrial DNA entails transient ribonucleotide incorporation throughout the lagging strand. EMBO J 25:5358–5371 40. Bowmaker M et al (2003) Mammalian mitochondrial DNA replicates bidirectionally from an initiation zone. J Biol Chem 278:50961–50969 41. Adam-Vizi V (2005) Production of reactive oxygen species in brain mitochondria: contribution by electron transport chain and non-electron transport chain sources. Antioxid Redox Signal 7:1140–1149 42. Balaban RS, Nemoto S, Finkel T (2005) Mitochondria, oxidants, and aging. Cell 120:483–495 43. St-Pierre J, Buckingham JA, Roebuck SJ, Brand MD (2002) Topology of superoxide production from different sites in the mitochondrial electron transport chain. J Biol Chem 277:44784–44790 44. Chen Q, Vazquez EJ, Moghaddas S, Hoppel CL, Lesnefsky EJ (2003) Production of reactive oxygen species by mitochondria—central role of complex III. J Biol Chem 278:36027–36031

18

1 Introduction

45. Rhee SG (2006) H2 O2 , a necessary evil for cell signaling. Science 312:1882–1883 46. Schieber M, Chandel NS (2014) ROS function in redox signaling and oxidative stress. Curr Biol 24:R453–R462 47. Yakes FM, VanHouten B (1997) Mitochondrial DNA damage is more extensive and persists longer than nuclear DNA damage in human cells following oxidative stress. Proc Natl Acad Sci USA 94:514–519 48. Haag-Liautard C et al (2008) Direct estimation of the mitochondrial DNA mutation rate in Drosophila melanogaster. PLoS Biol 6:1706–1714 49. Itsara LS et al (2014) Oxidative stress is not a major contributor to somatic mitochondrial DNA mutations. PLoS Genet 10:e1003974 50. Fu Y, Tigano M, Sfeir A (2020) Safeguarding mitochondrial genomes in higher eukaryotes. Nat Struct Mol Biol 27:687–695 51. Kazak L, Reyes A, Holt IJ (2012) Minimizing the damage: repair pathways keep mitochondrial DNA intact. Nat Rev Mol Cell Biol 13:659–671 52. Mason PA, Matheson EC, Hall AG, Lightowlers RN (2003) Mismatch repair activity in mammalian mitochondria. Nucleic Acids Res 31:1052–1058 53. Souza-Pinto NC et al (2009) Novel DNA mismatch-repair activity involving YB-1 in human mitochondria. DNA Repair 8:704–719 54. Wisnovsky S, Sack T, Pagliarini DJ, Laposa RR, Kelley SO (2018) DNA polymerase theta increases mutational rates in mitochondrial DNA. ACS Chem Biol 13:900–908 55. Berglund AK et al (2017) Nucleotide pools dictate the identity and frequency of ribonucleotide incorporation in mitochondrial DNA. PLoS Genet 13:e1006628 56. Nissanka N, Bacman SR, Plastini MJ, Moraes CT (2018) The mitochondrial DNA polymerase gamma degrades linear DNA fragments precluding the formation of deletions. Nat Commun 9:2491 57. Peeva V et al (2018) Linear mitochondrial DNA is rapidly degraded by components of the replication machinery. Nat Commun 9:1727 58. Gorman GS et al (2015) Prevalence of nuclear and mitochondrial DNA mutations related to adult mitochondrial disease. Ann Neurol 77:753–759 59. Skladal D, Halliday J, Thorburn DR (2003) Minimum birth prevalence of mitochondrial respiratory chain disorders in children. Brain 126:1905–1912 60. Lebon S et al (2003) Recurrent de novo mitochondrial DNA mutations in respiratory chain deficiency. J Med Genet 40:896–899 61. Thorburn DR (2004) Mitochondrial disorders: prevalence, myths and advances. J Inherit Metab Dis 27:349–362 62. Wallace DC et al (1988) Mitochondrial DNA mutation associated with Leber’s hereditary optic neuropathy. Science 242:1427–1430 63. Holt IJ, Harding AE, Morganhughes JA (1988) Deletions of muscle mitochondrial-DNA in patients with mitochondrial myopathies. Nature 331:717–719 64. Kogelnik AM, Lott MT, Brown MD, Navathe SB, Wallace DC (1996) MITOMAP: a human mitochondrial genome database. Nucleic Acids Res 24:177–179 65. Kogelnik AM, Lott MT, Brown MD, Navathe SB, Wallace DC (1998) MITOMAP: a human mitochondrial genome database—1998 update. Nucleic Acids Res 26:112–115 66. Brandon MC et al (2005) MITOMAP: a human mitochondrial genome database—2004 update. Nucleic Acids Res 33:D611–D613 67. Howell N, McCullough D, Bodiswollner I (1992) Molecular genetic-analysis of a sporadic case of Leber hereditary optic neuropathy. Am J Hum Genet 50:443–446 68. Johns DR, Neufeld MJ, Park RD (1992) An ND-6 mitochondrial-DNA mutation associated with Leber hereditary optic neuropathy. Biochem Biophys Res Commun 187:1551–1557 69. Goto Y, Nonaka I, Horai S (1990) A mutation in the tRNA(Leu)(UUR) gene associated with the MELAS subgroup of mitochondrial encephalomyopathies. Nature 348:651–653 70. Boulet L, Karpati G, Shoubridge EA (1992) Distribution and threshold expression of the tRNA(Lys) mutation in skeletal-muscle of patients with myoclonic epilepsy and ragged-red fibers (MERRF). Am J Hum Genet 51:1187–1200

References

19

71. Lake NJ, Compton AG, Rahman S, Thorburn DR (2016) Leigh syndrome: one disorder, more than 75 monogenic causes. Ann Neurol 79:190–203 72. Tatuch Y et al (1992) Heteroplasmic mtDNA mutation (T-G) at 8993 can cause Leigh disease when the percentage of abnormal mtDNA is high. Am J Hum Genet 50:852–858 73. Vries DD, Engelen BGM, Gabreëls FJM, Ruitenbeek W, Oost BA (1993) A second missense mutation in the mitochondrial ATPase 6 gene in Leigh’s syndrome. Ann Neurol 34:410–412 74. Huoponen K, Vilkki J, Aula P, Nikoskelainen EK, Savontaus ML (1991) A new mtDNA mutation associated with Leber hereditary optic neuroretinopathy. Am J Hum Genet 48:1147– 1153 75. Bataillard M et al (2001) Atypical MELAS syndrome associated with a new mitochondrial tRNA glutamine point mutation. Neurology 56:405–407 76. Moraes CT et al (1993) Two novel pathogenic mitochondrial DNA mutations affecting organelle number and protein synthesis. Is the trRNA(Leu(UUR)) gene an etiologic hot-spot? J Clin Invest 92:2906–2915 77. Goto Y, Nonaka I, Horai S (1991) A new mtDNA mutation associated with mitochondrial myopathy, encephalopathy, lactic-acidosis and stroke-like episodes (MELAS). Biochim Biophys Acta 1097:238–240 78. Shoffner JM et al (1990) Myoclonic epilepsy and ragged-red fiber disease (MERRF) is associated with a mitochondrial DNA tRNA(Lys) mutation. Cell 61:931–937 79. Silvestri G, Moraes CT, Shanske S, Oh SJ, Dimauro S (1992) A new mtDNA mutation in the tRNA(Lys) gene associated with myoclonic epilepsy and ragged-red fibers (MERRF). Am J Hum Genet 51:1213–1217 80. Santorelli FM et al (1996) Maternally inherited cardiomyopathy and hearing loss associated with a novel mutation in the mitochondrial tRNA(Lys) gene (G8363A). Am J Hum Genet 58:933–939 81. Kang E et al (2016) Mitochondrial replacement in human oocytes carrying pathogenic mitochondrial DNA mutations. Nature 540:270–275 82. Tachibana M et al (2009) Mitochondrial gene replacement in primate offspring and embryonic stem cells. Nature 461:367–372 83. National Academies of Sciences, Engineering, and Medicine (2016) Mitochondrial replacement techniques: ethical, social, and policy considerations. The National Academies Press, Washington, DC 84. Nuffield Council on Bioethics (2012) Novel techniques for the prevention of mitochondrial DNA disorders: an ethical review. Nuffield Council on Bioethics, London 85. Yamada M et al (2016) Genetic drift can compromise mitochondrial replacement by nuclear transfer in human oocytes. Cell Stem Cell 18:749–754 86. Paull D et al (2013) Nuclear genome transfer in human oocytes eliminates mitochondrial DNA variants. Nature 493:632–637 87. Jackson CB, Turnbull DM, Minczuk M, Gammage PA (2020) Therapeutic manipulation of mtDNA heteroplasmy: a shifting perspective. Trends Mol Med 26:698–709 88. Srivastava S, Moraes CT (2001) Manipulating mitochondrial DNA heteroplasmy by a mitochondrially targeted restriction endonuclease. Hum Mol Genet 10:3093–3099 89. Bacman SR, Williams SL, Duan D, Moraes CT (2012) Manipulation of mtDNA heteroplasmy in all striated muscles of newborn mice by AAV9-mediated delivery of a mitochondria-targeted restriction endonuclease. Gene Ther 19:1101–1106 90. Bacman SR, Williams SL, Garcia S, Moraes CT (2010) Organ-specific shifts in mtDNA heteroplasmy following systemic delivery of a mitochondria-targeted restriction endonuclease. Gene Ther 17:713–720 91. Bacman SR, Williams SL, Moraes CT (2009) Intra- and inter-molecular recombination of mitochondrial DNA after in vivo induction of multiple double-strand breaks. Nucleic Acids Res 37:4218–4226 92. Xu H, DeLuca SZ, O’Farrell PH (2008) Manipulating the metazoan mitochondrial genome with targeted restriction enzymes. Science 321:575–577

20

1 Introduction

93. Alexeyev MF et al (2008) Selective elimination of mutant mitochondrial genomes as therapeutic strategy for the treatment of NARP and MILS syndromes. Gene Ther 15:516–523 94. Bacman SR, Williams SL, Hernandez D, Moraes CT (2007) Modulating mtDNA heteroplasmy by mitochondria-targeted restriction endonucleases in a ‘differential multiple cleavage-site’ model. Gene Ther 14:1309–1318 95. Bayona-Bafaluy MP, Blits B, Battersby BJ, Shoubridge EA, Moraes CT (2005) Rapid directional shift of mitochondrial DNA heteroplasmy in animal tissues by a mitochondrially targeted restriction endonuclease. Proc Natl Acad Sci USA 102:14392–14397 96. Tanaka M et al (2002) Gene therapy for mitochondrial disease by delivering restriction endonuclease Smal into mitochondria. J Biomed Sci 9:534–541 97. Minczuk M, Papworth MA, Miller JC, Murphy MP, Klug A (2008) Development of a singlechain, quasi-dimeric zinc-finger nuclease for the selective degradation of mutated human mitochondrial DNA. Nucleic Acids Res 36:3926–3938 98. Gammage PA, Rorbach J, Vincent AI, Rebar EJ, Minczuk M (2014) Mitochondrially targeted ZFNs for selective degradation of pathogenic mitochondrial genomes bearing large-scale deletions or point mutations. EMBO Mol Med 6:458–466 99. Gammage PA et al (2018) Genome editing in mitochondria corrects a pathogenic mtDNA mutation in vivo. Nat Med 24:1691–1695 100. Bacman SR, Williams SL, Pinto M, Peralta S, Moraes CT (2013) Specific elimination of mutant mitochondrial genomes in patient-derived cells by mitoTALENs. Nat Med 19:1111– 1113 101. Hashimoto M et al (2015) MitoTALEN: a general approach to reduce mutant mtDNA loads and restore oxidative phosphorylation function in mitochondrial diseases. Mol Ther 23:1592–1599 102. Yang Y et al (2018) Targeted elimination of mutant mitochondrial DNA in MELAS-iPSCs by mitoTALENs. Protein Cell 9:283–297 103. Reddy P et al (2015) Selective elimination of mitochondrial mutations in the germline by genome editing. Cell 161:459–469 104. Bacman SR et al (2018) MitoTALEN reduces mutant mtDNA load and restores tRNA(Ala) levels in a mouse model of heteroplasmic mtDNA mutation. Nat Med 24:1696–1700 105. Jo A et al (2015) Efficient mitochondrial genome editing by CRISPR/Cas9. Biomed Res Int 2015:305716 106. Gammage PA, Moraes CT, Minczuk M (2018) Mitochondrial genome engineering: the revolution may not be CRISPR-Ized. Trends Genet 34:101–110 107. Hussain SRA et al (2021) Adapting CRISPR/Cas9 system for targeting mitochondrial genome. Front Genet 12:627050 108. Wang G et al (2010) PNPASE regulates RNA import into mitochondria. Cell 142:456–467 109. Mok BY et al (2020) A bacterial cytidine deaminase toxin enables CRISPR-free mitochondrial base editing. Nature 583:631–637 110. Yamada Y, Furukawa R, Yasuzaki Y, Harashima H (2011) Dual function MITO-Porter, a nano carrier integrating both efficient cytoplasmic delivery and mitochondrial macromolecule delivery. Mol Ther 19:1449–1456 111. Yamada Y et al (2008) MITO-Porter: a liposome-based carrier system for delivery of macromolecules into mitochondria via membrane fusion. Biochim Biophys Acta 1778:423–432 112. Weissig V (2020) Drug development for the therapy of mitochondrial diseases. Trends Mol Med 26:40–57 113. Muratovska A et al (2001) Targeting peptide nucleic acid (PNA) oligomers to mitochondria within cells by conjugation to lipophilic cations: implications for mitochondrial DNA replication, expression and disease. Nucleic Acids Res 29:1852–1863 114. Chinnery PF et al (1999) Peptide nucleic acid delivery to human mitochondria. Gene Ther 6:1919–1928 115. Taylor RW, Chinnery PF, Turnbull DM, Lightowlers RN (1997) Selective inhibition of mutant human mitochondrial DNA replication in vitro by peptide nucleic acids. Nat Genet 15:212– 215

References

21

116. Chenoweth DM, Dervan PB (2010) Structural basis for cyclic Py-Im polyamide allosteric inhibition of nuclear receptor binding. J Am Chem Soc 132:14521–14529 117. Trauger JW, Baird EE, Dervan PB (1996) Recognition of DNA by designed ligands at subnanomolar concentrations. Nature 382:559–561 118. Kielkopf CL, Baird EE, Dervan PB, Rees DC (1998) Structural basis for G•C recognition in the DNA minor groove. Nat Struct Biol 5:104–109 119. Kopka ML, Yoon C, Goodsell D, Pjura P, Dickerson RE (1985) The molecular origin of DNA-drug specificity in netropsin and distamycin. Proc Natl Acad Sci USA 82:1376–1380 120. Cho J, Parks ME, Dervan PB (1995) Cyclic polyamides for recognition in the minor groove of DNA. Proc Natl Acad Sci USA 92:10389–10392 121. Gottesfeld JM, Neely L, Trauger JW, Baird EE, Dervan PB (1997) Regulation of gene expression by small molecules. Nature 387:202–205 122. Mrksich M, Parks ME, Dervan PB (1994) Hairpin peptide motif. A new class of oligopeptides for sequence-specific recognition in the minor groove of double-helical DNA. J Am Chem Soc 116:7983–7988 123. Mackay H et al (2008) Sequence specific and high affinity recognition of 5 -ACGCGT-3 by rationally designed pyrrole-imidazole H-pin polyamides: thermodynamic and structural studies. Bioorg Med Chem 16:9145–9153 124. Mrksich M, Dervan PB (1994) Design of a covalent peptide heterodimer for sequence-specific recognition in the minor groove of double-helical DNA. J Am Chem Soc 116:3663–3664 125. Wurtz NR, Turner JM, Baird EE, Dervan PB (2001) Fmoc solid phase synthesis of polyamides containing pyrrole and imidazole amino acids. Org Lett 3:1201–1203 126. Baird EE, Dervan PB (1996) Solid phase synthesis of polyamides containing imidazole and pyrrole amino acids. J Am Chem Soc 118:6141–6146 127. Li BC, Montgomery DC, Puckett JW, Dervan PB (2013) Synthesis of cyclic Py-Im polyamide libraries. J Org Chem 78:124–133 128. Chenoweth DM, Harki DA, Dervan PB (2009) Cyclic pyrrole−imidazole polyamides targeted to the androgen response element. J Am Chem Soc 131:7182–7188 129. Herman DM, Turner JM, Baird EE, Dervan PB (1999) Cycle polyamide motif for recognition of the minor groove of DNA. J Am Chem Soc 121:1121–1129 130. Hirose Y, Hashiya K, Bando T, Sugiyama H (2021) Evaluation of the DNA alkylation property of a chlorambucil conjugated cyclic pyrrole-imidazole polyamide. Chem Eur J 27:2782–2788 131. Kielkopf CL et al (1998) A structural basis for recognition of A·T and T·A base pairs in the minor groove of B-DNA. Science 282:111–115 132. Turner JM, Swalley SE, Baird EE, Dervan PB (1998) Aliphatic/aromatic amino acid pairings for polyamide recognition in the minor groove of DNA. J Am Chem Soc 120:6219–6226 133. Swalley SE, Baird EE, Dervan PB (1999) Effects of gamma-turn and beta-tail amino acids on sequence-specific recognition of DNA by hairpin polyamides. J Am Chem Soc 121:1113– 1120 134. Parks ME, Baird EE, Dervan PB (1996) Optimization of the hairpin polyamide design for recognition of the minor groove of DNA. J Am Chem Soc 118:6147–6152 135. Erwin GS et al (2016) Synthetic genome readers target clustered binding sites across diverse chromatin states. Proc Natl Acad Sci USA 113:7418–7427 136. Chandran A et al (2016) Genome-wide assessment of the binding effects of artificial transcriptional activators by high-throughput sequencing. ChemBioChem 17:1905–1910 137. Erwin GS, Bhimsaria D, Eguchi A, Ansari AZ (2014) Mapping polyamide-DNA interactions in human cells reveals a new design strategy for effective targeting of genomic sites. Angew Chem Int Ed 53:10124–10128 138. Meier JL, Yu AS, Korf I, Segal DJ, Dervan PB (2012) Guiding the design of synthetic DNAbinding molecules with massively parallel sequencing. J Am Chem Soc 134:17814–17822 139. Puckett JW et al (2006) Defining the sequence-recognition profile of DNA-binding molecules. Proc Natl Acad Sci USA 103:867–872 140. Sasaki A et al (2016) Telomere visualization in tissue sections using pyrrole-imidazole polyamide probes. Sci Rep 6:29261

22

1 Introduction

141. Kawamoto Y et al (2016) Targeting 24 bp within telomere repeat sequences with tandem tetramer pyrrole-imidazole polyamide probes. J Am Chem Soc 138:14100–14107 142. Kawamoto Y et al (2015) Tandem trimer pyrrole-imidazole polyamide probes targeting 18 base pairs in human telomere sequences. Chem Sci 6:2307–2312 143. Hirata A et al (2014) Structural evaluation of tandem hairpin pyrrole-imidazole polyamides recognizing human telomeres. J Am Chem Soc 136:11546–11554 144. Kawamoto Y et al (2013) Development of a new method for synthesis of tandem hairpin pyrrole-imidazole polyamide probes targeting human telomeres. J Am Chem Soc 135:16468– 16477 145. Maeshima K, Janssen S, Laemmli UK (2001) Specific targeting of insect and vertebrate telomeres with pyrrole and imidazole polyamides. EMBO J 20:3218–3228 146. Tsubono Y et al (2020) A near-infrared fluorogenic pyrrole-imidazole polyamide probe for live cell imaging of telomeres. J Am Chem Soc 142:17356–17363 147. Obata S, Asamitsu S, Hashiya K, Bando T, Sugiyama H (2018) G-quadruplex induction by the hairpin pyrrole-imidazole polyamide dimer. Biochemistry 57:498–502 148. Ohtsuki A et al (2009) Synthesis and properties of PI polyamide–SAHA conjugate. Tetrahedron Lett 50:7288–7292 149. Pandian GN et al (2014) Distinct DNA-based epigenetic switches trigger transcriptional activation of silent genes in human dermal fibroblasts. Sci Rep 4:3843 150. Han L et al (2015) A synthetic DNA-binding domain guides distinct chromatin-modifying small molecules to activate an identical gene network. Angew Chem Int Ed 54:8700–8703

Chapter 2

Creation of a Synthetic Ligand for Mitochondrial DNA Sequence Recognition and Promoter-Specific Transcription Suppression

Abstract Synthetic ligands capable of DNA sequence recognition in human mitochondria are in increasing demand because more and more studies have revealed the relation between mitochondrial genome and diseases. In this chapter, a new type of synthetic DNA-binding ligands, termed MITO-PIPs, was developed by conjugating a mitochondria-penetrating peptide with pyrrole-imidazole polyamides (PIPs). A MITO-PIP that inhibits the binding of mitochondrial transcription factor A to the light-strand promoter (LSP) triggered targeted transcriptional suppression of a downstream gene. A melting temperature analysis revealed sequence-specific DNA binding of the MITO-PIP, and mitochondrial accumulation in HeLa cells was also observed. The tunability of PIPs suggests the potential of the MITO-PIPs as potent modulators of mitochondrial gene transcription and mitochondrial DNA mutations. Keywords MITO-PIP · Pyrrole–imidazole polyamide · Mitochondria-penetrating peptide · Mitochondrial DNA · DNA transcription inhibitor

This chapter is adapted with permission from Hidaka T et al. (2017) Creation of a Synthetic Ligand for Mitochondrial DNA Sequence Recognition and Promoter-Specific Transcription Suppression. J Am Chem Soc 139:8444–8447. Copyright 2017 American Chemical Society. © Springer Nature Singapore Pte Ltd. 2022 T. Hidaka, Sequence-Specific DNA Binders for the Therapy of Mitochondrial Diseases, Springer Theses, https://doi.org/10.1007/978-981-16-8436-4_2

23

24

2 Creation of a Synthetic Ligand for Mitochondrial DNA Sequence …

2.1 Introduction Mitochondria are ubiquitous cellular organelles and have a wide range of cellular metabolism functions like energy production, biosynthesis of biomolecules, maintenance of cellular homeostasis, and metabolic waste management. They also play a pivotal role in other processes, including non-shivering thermogenesis, calcium homeostasis, and apoptosis. Impaired mitochondrial metabolism and translation are known to be associated with several diseases [1, 2]. Mitochondria have their own ~16.6 kbp circular DNA (mtDNA). Each DNA strand is named based on its guanine content as a heavy (H) strand or a light (L) strand. Human mtDNA encodes 37 genes including 13 protein-coding genes required for the electron transport chain, 22 tRNAs, and two rRNA. Mitochondrial gene expression occurs polycistronically from three transcription initiation sites in mtDNA: the L-strand promoter (LSP), the H-strand promoter 1 (HSP1), and the H-strand promoter 2 (HSP2) [3]. HSP initiates the transcription of the H strand and produces two rRNAs, 12 mRNAs, and eight tRNAs. In contrast, LSP, located near HSP, produces only one mRNA and eight tRNAs. The fundamental mechanism of mitochondrial DNA transcription has been revealed [4] and three factors: mitochondrial RNA polymerase (POLRMT), mitochondrial transcription factor A (TFAM), and mitochondrial transcription factor B2 (TFB2M) are involved in mitochondrial transcription initiation [5–7]. TFAM has two high-mobility groups (HMG) box domains capable of intercalating into the minor groove at two different sites in LSP and HSP1 [8], and the C-terminal tail is required to activate transcription machinery [9]. TFAM-mediated activation of transcription from LSP is known to be associated with the U-turn structure imposed by TFAM in its responsive element-binding site, which, in turn, brings the C-terminal tail closer to the transcription start site [10]. In the case of HSP1, the U-turn structure is not required because, unlike the binding pattern in the LSP site, TFAM binds to the HSP1 site in the reverse orientation to the C-terminal HMG box located near the transcription start site [8]. Although recent progress in genome engineering has developed zinc finger nuclease (ZFN) and transcription activator-like effector nuclease (TALEN)-based mitochondrial gene editing techniques [11, 12], no synthetic ligands are capable of mtDNA sequence recognition have been developed. Pyrrole-imidazole polyamides (PIPs) are synthetic ligands composed of Nmethylpyrrole (Py) and N-methylimidazole (Im) that bind to the minor groove of double-stranded DNA (dsDNA). A hairpin form of PIPs containing two polyamide strands with a turn linker connecting the C-terminal of one strand with the N-terminal of the other strand has been most commonly used. Their target DNA sequence can be programmed by rearranging the Py and Im rings, i.e., Py/Py pairs recognize A/T or T/A base pairs and Py/Im pairs recognize C/G base pairs [13]. Some PIPs have been reported to accumulate in nuclei efficiently without additional transfection vehicles

2.1 Introduction

25

[14]. Sequence-selective DNA binding of PIPs enables us to deliver compounds to specific genomic sites, and PIPs have been applied to gene expression regulation. For example, PIPs inhibiting the binding of nuclear transcription factors to DNA repress therapeutically relevant genes [15]. They have also been conjugated with epigenetic regulators such as suberoylanilide-hydroxamic acid (SAHA) and N-(4chloro-3-(trifluoromethyl) phenyl)-2-ethoxybenzamide (CTB) to generate synthetic genetic ON switches to activate the expression of cell-fate-governing genes and noncoding RNAs [16]. Although PIPs are expected to be powerful tools to regulate transcription and replication status of the mitochondrial genome, the default nuclear accumulation of PIPs hinders their application to mitochondria. Mitochondria have double membrane structure, and their inner membrane is much more hydrophobic than the plasma membrane and functions as a barrier limiting diffusive transport. This makes it difficult to deliver drug molecules into mitochondria. To overcome this delivery issue, mitochondria-penetrating peptides (MPPs) composed of cyclohexylalanine and D-arginine have been developed [17]. While hydrophobic cyclohexylalanine reduces energy barrier during mitochondrial membrane permeation, cationic arginine provides electrostatic driving force for uptake depending on membrane potential of plasma and mitochondrial membrane. Because the MPP is known to redirect nuclei-localizing compounds such as doxorubicin and chlorambucil to mitochondria [18, 19], this peptide is also expected to deliver PIPs into mitochondria. To investigate this hypothesis, I evaluated intracellular distribution and DNA-binding properties of MITO-PIPs, conjugates of PIPs and the MPP, to develop a new type of mitochondria-specific PIP as a new paradigm to gain chemical control over mitochondrial DNA (Fig. 2.1).

2.2 Results 2.2.1 Design of MITO-PIPs MITO-PIPs targeting TFAM binding sequence in LSP and HSP1 sites are designed (MITO-PIP-LSP and MITO-PIP-HSP1, Fig. 2.2) [8]. A PIP without the MPP was also prepared to delineate the effect of the MPP (PIP-LSP). Substitution of β-alanine instead of Py at the central position of each PIP is expected to increase the binding affinity to DNA by reducing structural strain to fit the minor groove [20]. The successful inhibition of TFAM binding to LSP or HSP1 by MITO-PIPs should result in a reduction in the level of expression of downstream genes. Mitochondrially encoded NADH dehydrogenase 6 (ND6) located downstream of LSP plays a key role in mitochondrial metabolism, respiratory electron transport, and ATP synthesis. Accordingly, ND6 is associated with several mitochondrial disorders, including Leber’s hereditary optic neuropathy and mitochondrial myopathy [21].

26

2 Creation of a Synthetic Ligand for Mitochondrial DNA Sequence …

Fig. 2.1 Chemical structure of a mitochondria-specific PIP (MITO-PIP) conjugated with a mitochondria-penetrating peptide and schematic illustration of transformed localization preference of MITO-PIPs. Pyrrole and imidazole rings are shown in blue and red, respectively. Cha, cyclohexylalanine; Arg, D-arginine: Ac, acetyl group

2.2.2 Promoter-Specific Transcription Control by MITO-PIP-LSP The effect of MITO-PIPs on the endogenous expression of ND6 was investigated by quantitative PCR (qPCR). HeLa cells were used in this study because their mitochondria have been extensively studied and their large mitochondria are suitable for imaging experiments. Although mtDNA in HeLa cells was reported to have numerous haplotypes, it was confirmed that there is no reported mutation on the TFAM binding sequences in LSP or the HSP1 site [22]. HeLa cells treated with each compound were harvested after 24 h. To validate the promoter specificity, relative expression

2.2 Results

27

Fig. 2.2 Chemical architecture of compounds used in this study and schematic illustration of their target sequences

Fig. 2.3 Relative RNA expression ratio ([ND6]/[MT-16S]) in HeLa cells was quantified by RTqPCR after compound treatment with PIP-LSP and MITO-PIP-LSP (a), and MITO-PIP-HSP1 (b) for 24 h

level of ND6 to MT-16S located downstream of HSP1 was evaluated. As shown in Fig. 2.3a, MITO-PIP-LSP reduced the relative expression ratio ([ND6]/[MT16S]) by about 60% at 5 μM and 90% at 10 μM. The targeted suppression of ND6

28

2 Creation of a Synthetic Ligand for Mitochondrial DNA Sequence …

suggests the sequence-specific bioactivity of MITO-PIP-LSP inside living cells. In contrast, the PIP-LSP that lacked the MPP only show slight reduction, indicating that the introduction of the MPP is required for effective bioactivity in mitochondria. Unexpectedly, MITO-PIP-HSP1 did not show any notable transcriptional change (Fig. 2.3b).

2.2.3 Sequence-Selective DNA Binding of MITO-PIPs The discrepancy in bioactivity of MITO-PIP-HSP1 is expected to be caused by low binding affinity to the HSP1 site due to the preference of the turn unit to W/W base pairs (W = A or T) [23]. To clarify this notion and to evaluate the binding affinity of MITO-PIPs, the thermal stability of DNA and DNA-PIP complex was analyzed by thermal melting temperature (T m ) analysis. Two dsDNA sequences that possess one TFAM binding sequence in LSP or HSP1 (underlined) were prepared: 5 -d (GGGTGACTGTTCGC) (DNA-LSP) and 5 -CTGTGGTTCGGAGC (DNAHSP1). The results of T m analysis (Table 2.1) corroborate the high selectivity and binding affinity of MITO-PIP-LSP to DNA-LSP, which was comparable to that of PIP-LSP. MITO-PIP-HSP1 did not cause a significant T m shift with DNA-HSP1, thereby indicating its low affinity towards the HSP1 targeting sequence. Together, the data shows that the binding pattern of MITO-PIPs confirms the distinct genesuppression ability of MITO-PIP-LSP and MITO-PIP-HSP1. Table 2.1 Shift of T m values by PIP-LSP, MITO-PIP-LSP, and MITO-PIP-HSP1a DNA

+PIP-LSP

+MITO-PIP-LSP

+MITO-PIP-HSP1

T m /°C

T m /°C

T m /°C

T m /°C

T m /°C

T m /°C

T m /°C

DNA-LSP

47.7 (±0.6)

74.1 (±0.9)

26.5

71.7 (±1.2)

24.0

49.6 (±0.5)

2.0

DNA-HSP1

48.7 (±0.2)

58.2 (±0.2)

9.4

50.0 (±1.3)

1.3

49.8 (±1.4)

1.1

a Averages of T values are calculated from three melting temperature analyses and each standard m deviation is indicated in parentheses. T m = T m (compound–DNA complex) − T m (DNA)

2.2 Results

29

2.2.4 Mitochondrial Accumulation of MITO-PIP-LSP To confirm mitochondrial accumulation of MITO-PIPs, a live cell imaging was performed. HeLa cells treated with a fluorescently labeled MITO-PIP (MITO-PIPTAMRA) were imaged with a confocal laser microscope (Fig. 2.4). Mitochondria and

Fig. 2.4 Live cell fluorescence imaging of HeLa cells treated with MITO-PIP-TAMRA at a concentration of 4 μM for 24 h. Nuclei and mitochondria were labeled with Hoechst 33342 and GFP coupled with the leader sequence of E1 alpha pyruvate dehydrogenase, respectively. Scale bars represent 10 μm

30

2 Creation of a Synthetic Ligand for Mitochondrial DNA Sequence …

nuclei were visualized by mitochondria-specific GFP and Hoechst 33342, respectively. Consistent with the gene expression studies, MITO-PIP-TAMRA showed signals in the cytosol, and the signal is overlapped with the signal of mitochondriaspecific GFP, thereby confirming that the MITO-PIP-TAMRA are efficiently accumulated into mitochondria. It is important to note here that the MITO-PIPs did not accumulate inside the nuclei.

2.3 Discussion In summary, I developed a new type of mitochondria-specific DNA-based synthetic ligand, called MITO-PIPs, that can recognize a particular sequence of mtDNA. The designed LSP-specific MITO-PIP inhibited binding of TFAM to the LSP site in a promoter-specific manner and validated the conclusion that the synthetic ligand can distinguish the target sequence in LSP from that in HSP1. The live cell imaging study confirmed that MITO-PIPs could accumulate into the mitochondria. Notably, MITO-PIPs are the first DNA-based programmable synthetic molecules capable of inducing targeted suppression of ND6, which is an essential factor of the respiratory chain complex in mitochondria. Previously, targeting peptide nucleic acid (PNA) oligomers conjugated with triphenylphosphonium cation have been synthesized to manipulate mtDNA replication [24]. Whereas the designed PNA oligomers repressed mtDNA replication under in vitro conditions, bioactivity inside living cells was not achieved. Given that MITO-PIPs can trigger promoter-specific transcription suppression in live cells, they could be developed further to target and alter the transcription and replication status of mtDNA. MITO-PIPs also have merit over PNA oligomers in that the double-strand structure of DNA could be maintained. Also, a fluorenelabeled polyamide derivative was reported to localize to mitochondria of human ovarian adenocarcinoma cells [25]. However, the DNA-recognition property of this derivative was negligible, as the structure encompassed only three pyrroles. Because of the automated synthesis of MITO-PIPs, it is easy to vary the target sequence of MITO-PIPs. Although the HSP1-targeting MITO-PIP reported in this study did not induce gene expression changes, a combinatorial set of PIPs targeting different DNA sequences could facilitate the targeted modulation of HSP1. Likewise, flexibility is a prime advantage of MITO-PIPs because preferred function(s) could be bestowed by the supplementation of other functional molecules. It is also possible to adjust the hydrophobicity and the number of positive charges to maximize and facilitate mitochondrial localization. Compared with nuclear DNA, mtDNA has a higher mutation rate because of the reactive oxygen species that are formed as by-products of oxidative phosphorylation. Although most mutations in mtDNA have a minimal effect on cellular function, recent evidence has revealed that some mutations can cause mitochondrial diseases [26]. Furthermore, the mtDNA haplotype is related to the risk of other diseases such as diabetes [27]. Because MITO-PIPs can be programmed to read the mutant

2.3 Discussion

31

mtDNA sequence to distinguish it from normal mtDNA, they are promising candidates towards clinical applications. MITO-PIPs can be developed further to generate a new functional compound that can exert bioactivity on either a normal or a mutated mtDNA in a defined manner. This proof-of-concept study provides a fresh platform that opens new avenues for DNA-based functional ligands that can alter the mitochondrial genome in a sequence-specific manner.

2.4 Materials and Methods 2.4.1 General Information of Synthesis The reagents were purchased from standard suppliers and used without further purification. The solid-phase synthesis of compounds was performed on automated solidphase synthesizer PSSM-8 (Shimadzu). Analytical reversed-phase high performance liquid chromatography (HPLC) was performed on a JASCO Engineering PU-2089 plus series system using Chemcobond 5-ODS-H reversed-phase column (4.6 × 150 mm) heated to 40 °C in H2 O/0.1% TFA with acetonitrile as the mobile phase at a flow rate of 1.0 mL/min and a linear gradient elution of 0 to 100% acetonitrile in 40 min with detection at 254 nm. MALDI-TOF mass spectroscopy was performed with the microflex system (Bruker).

2.4.2 Synthesis of PIP-LSP, MITO-PIP-LSP, and MITO-PIP-HSP1 Synthetic scheme of MITO-PIP-LSP is shown in Fig. 2.5. Each Fmoc monomer unit (Fmoc-D-Arg(Pbf)-OH, Fmoc-cyclohexylalanine(Cha)-OH, Fmoc-β-alanineOH, Fmoc-Dab(Boc)-OH, Fmoc-Py-OH and Fmoc-Im-OH) was introduced sequentially to Fmoc-D-Arg(Pbf)-Alko resin or Py-coupled oxime resin using an automated synthesizer, PSSM-8 (Shimadzu). Each coupling reaction was performed at room temperature for one hour in N-methyl-2-pyrrolidone (NMP) containing 4 eq of HCTU, N, N-diisopropylethylamine (DIEA), and each Fmoc monomer unit, followed by Fmoc deprotection in 20% piperidine in N, N-dimethylformamide (DMF). After the solid-phase synthesis, the resin was incubated with 20% acetic anhydride in DMF at room temperature to cap the N-terminal with an acetyl group. Synthesized compounds were cleaved with N, N-dimethylaminopropylamine at 55 °C for 3 h. The reaction solution was drained into ether, and the resulting solid was dried in vacuo. For MITO-PIP-LSP and MITO-PIP-HSP1, a mixture of trifluoroacetic acid (TFA): triisopropylsilane: water (95:2.5:2.5 v/v%) was added to the dried sample and was shaken at room temperature for 50 min to deprotect the arginine residues. The crude

32

2 Creation of a Synthetic Ligand for Mitochondrial DNA Sequence …

Fig. 2.5 Synthetic scheme of MITO-PIP-LSP

sample was purified by reversed-phase column chromatography using the CombiFlash Rf with 4.3 g C18 RediSep Rf reversed-phase flash column (Teledyne Isco, Inc) or by reversed-phase HPLC using a JASCO Engineering UV2075 HPLC UV/vis detector and a PU-2080 plus series system with a preparative column (YMC-Pack Pro C18 , 150 × 20 mm or Chemcobond 5-ODS-H, 4.6 × 150 mm) and the mobile phases were acetonitrile and H2 O/0.1% TFA. HPLC and MALDI-TOF mass spectroscopy were used to identify the compounds.

2.4 Materials and Methods

33

2.4.3 Synthesis of MITO-PIP-TAMRA Synthetic scheme of MITO-PIP-TAMRA is shown in Fig. 2.6. After the solidphase synthesis, the compounds were cleaved from the resin by shaking with 3,3 diamine-N-methyldipropylamine at 55 °C for 3 h. After the powderization, the crude samples were purified by reversed-phase column chromatography using the CombiFlash Rf with 4.3 g C18 RediSep Rf reversed-phase flash column (Teledyne Isco, Inc). The mobile phases were acetonitrile and H2 O/0.1% TFA. After the purification, the compounds were coupled with 5-TAMRA by adding 1.2 eq of 5-TAMRA, succinimidyl ester, and 8 eq of N, N-diisopropylethylamine (DIEA) and shaking at room temperature. HPLC tracked the reactions and additional reagents were used based on the progress of the reactions. The same powderization, deprotection, purification, and identification processes as described above were used after this step.

Fig. 2.6 Synthetic scheme of MITO-PIP-TAMRA

34

2 Creation of a Synthetic Ligand for Mitochondrial DNA Sequence …

2.4.4 Melting Temperature (Tm ) Analysis The buffer for T m analysis was an aqueous solution of 10 mM sodium chloride and 10 mM sodium cacodylate at pH 7.0 containing 2.5 v/v% DMF. The concentration of polyamides and dsDNA was 5 and 2.5 μM, respectively (2:1 stoichiometry). Before the analyses, the samples were annealed from 95 to 15 °C at 1.0 °C/min. Absorbance at 260 nm was recorded from 15 to 95 °C at a rate of 1.0 °C/min using a spectrophotometer V-650 (JASCO) with a thermocontrolled PAC-743R cell changer (JASCO) and a thermal circulator F25-ED (Julabo).

2.4.5 Cell Culture HeLa cell line (JCRB9004) purchased from JCRB Cell Bank (Japan) were cultured and maintained in Dulbecco’s Modified Eagle Medium (ThermoFisher Scientific) supplemented with 10% fetal bovine serum (Sigma) and 1% MEM Non-Essential Amino Acids Solution (ThermoFisher Scientific). Incubation of cell lines was done at 37 °C in a humidified atmosphere of 5% CO2 .

2.4.6 Quantitative Reverse-Transcription PCR Analysis (RT-qPCR) Cells were trypsinized and seeded in 12 well plates (NIPPON Genetics) at the concentration of 5 × 104 cells/well one day before treatment. DMSO solution of compound 1–3 was prepared and the concentration was determined using an extinction coefficient of 9900 M−1 cm−1 per one pyrrole or imidazole moiety at λmax near 310 nm. The medium was replaced with the complete medium containing each compound and 0.1% DMSO and incubated at 37 °C in 5% CO2 . 24 h later, total RNA was extracted from each sample using RNeasy Mini Kit (QIAGEN), and reverse transcription was performed from 250 ng of total RNA using ReverTra Ace qPCR RT Kit (Toyobo) according to the manufacturer’s instructions. The expression level of mitochondrial RNA was analyzed by the LightCycler® 480 II (Roche) using Thunderbird SYBR qPCR mix (Toyobo). The relative expression ratio ([ND6]/[MT-16S]) was calculated from the average Cp value of 3 replicates of each sample and normalized to the value of DMSO-treated samples. The primer pairs used in this experiment are listed in Table 2.2.

2.4 Materials and Methods

35

Table 2.2 The primer list for qPCR experiments Primer

Sequence

MT-16S forward

5 -ACTTTGCAAGGAGAGCCAAA

MT-16S reverse

5 -GCTATCACCAGGCTCGGTAG

ND6 forward

5 -GGGTTAGCGATGGAGGTAGG

ND6 reverse

5 -GATCCTCCCGAATCAACCCT

2.4.7 Live Cell Imaging Cells were trypsinized and seeded in 8-well ibi-treat μ-slides (ibidi) at the concentration of 1 × 104 cells/well one day before the treatment. DMSO solution of compound 1–3 was prepared and the concentration was determined using an extinction coefficient of 91,000 M−1 cm−1 at λmax near 545 nm. The culture medium was removed and incubated with MITO-PIP-TAMRA and CellLight Mitochondria-GFP, BacMam 2.0 (ThermoFisher Scientific) in the complete medium for 24 h (DMSO: 0.5%). Hoechst 33342 was added to the medium (1 μg/mL) 15 min before the end of treatment. After the treatment, cells were washed twice with the complete medium and imaged by the FV1200 Laser Scanning Microscope (Olympus). The same imaging conditions were adopted for all samples. Image analysis was performed using FV10-ASW (Olympus).

36

2 Creation of a Synthetic Ligand for Mitochondrial DNA Sequence …

2.5 Characterization Data of Synthesized Compounds

2.5 Characterization Data of Synthesized Compounds

37

38

2 Creation of a Synthetic Ligand for Mitochondrial DNA Sequence …

References

39

References 1. Nicholls TJ, Rorbach J, Minczuk M (2013) Mitochondria: mitochondrial RNA metabolism and human disease. Int J Biochem Cell Biol 45:845–849 2. Boczonadi V, Horvath R (2014) Mitochondria: impaired mitochondrial translation in human disease. Int J Biochem Cell Biol 48:77–84 3. Gustafsson CM, Falkenberg M, Larsson NG (2016) Maintenance and expression of mammalian mitochondrial DNA. Annu Rev Biochem 85:133–160 4. Taanman JW (1999) The mitochondrial genome: structure, transcription, translation and replication. Biochim Biophys Acta 1410:103–123 5. Zollo O, Tiranti V, Sondheimer N (2012) Transcriptional requirements of the distal heavy-strand promoter of mtDNA. Proc Natl Acad Sci USA 109:6508–6512 6. Litonin D et al (2010) Human mitochondrial transcription revisited: only TFAM and TFB2M are required for transcription of the mitochondrial genes in vitro. J Biol Chem 285:18129–18133 7. Chang DD, Clayton DA (1984) Precise identification of individual promoters for transcription of each strand of human mitochondrial DNA. Cell 36:635–643 8. Ngo HB, Lovely GA, Phillips R, Chan DC (2014) Distinct structural features of TFAM drive mitochondrial DNA packaging versus transcriptional activation. Nat Commun 5:3077 9. Dairaghi DJ, Shadel GS, Clayton DA (1995) Addition of a 29 residue carboxyl-terminal tail converts a simple HMG box-containing protein into a transcriptional activator. J Mol Biol 249:11–28 10. Rubio-Cosials A et al (2011) Human mitochondrial transcription factor A induces a U-turn structure in the light strand promoter. Nat Struct Mol Biol 18:1281–1289 11. Gammage PA et al (2018) Genome editing in mitochondria corrects a pathogenic mtDNA mutation in vivo. Nat Med 24:1691–1695 12. Bacman SR, Williams SL, Pinto M, Peralta S, Moraes CT (2013) Specific elimination of mutant mitochondrial genomes in patient-derived cells by mitoTALENs. Nat Med 19:1111–1113 13. Trauger JW, Baird EE, Dervan PB (1996) Recognition of DNA by designed ligands at subnanomolar concentrations. Nature 382:559–561 14. Lai YM et al (2005) Synthetic pyrrole-imidazole polyamide inhibits expression of the human transforming growth factor-beta1 gene. J Pharmacol Exp Ther 315:571–575 15. Syed J et al (2014) Targeted suppression of EVI1 oncogene expression by sequence-specific pyrrole-imidazole polyamide. Chem Biol 21:1370–1380 16. Pandian GN et al (2014) Distinct DNA-based epigenetic switches trigger transcriptional activation of silent genes in human dermal fibroblasts. Sci Rep 4:3843 17. Horton KL, Stewart KM, Fonseca SB, Guo Q, Kelley SO (2008) Mitochondria-penetrating peptides. Chem Biol 15:375–382 18. Mourtada R et al (2013) Re-directing an alkylating agent to mitochondria alters drug target and cell death mechanism. PLoS ONE 8:e60253 19. Chamberlain GR, Tulumello DV, Kelley SO (2013) Targeted delivery of doxorubicin to mitochondria. ACS Chem Biol 8:1389–1395 20. Watanabe T et al (2016) Double β-alanine substitutions incorporated in 12-ring pyrroleimidazole polyamides for lengthened DNA minor groove recognition. Adv Tech Biol Med 04:175 21. Mposhi A, Van der Wijst MG, Faber KN, Rots MG (2017) Regulation of mitochondrial gene expression, the epigenetic enigma. Front Biosci 22:1099–1113 22. Herrnstadt C et al (2002) A high frequency of mtDNA polymorphisms in HeLa cell sublines. Mutat Res 501:19–28 23. Farkas ME, Li BC, Dose C, Dervan PB (2009) DNA sequence selectivity of hairpin polyamide turn units. Bioorg Med Chem Lett 19:3919–3923 24. Muratovska A et al (2001) Targeting peptide nucleic acid (PNA) oligomers to mitochondria within cells by conjugation to lipophilic cations: implications for mitochondrial DNA replication, expression and disease. Nucleic Acids Res 29:1852–1863

40

2 Creation of a Synthetic Ligand for Mitochondrial DNA Sequence …

25. Sharma SK, Morrissey AT, Miller GG, Gmeiner WH, Lown JW (2001) Design, synthesis, and intracellular localization of a fluorescently labeled DNA binding polyamide related to the antibiotic distamycin. Bioorg Med Chem Lett 11:769–772 26. Gorman GS et al (2016) Mitochondrial diseases. Nat Rev Dis Primers 2:16080 27. Crispim D, Estivalet AAF, Roisenberg I, Gross JL, Canani LH (2008) Prevalence of 15 mitochondrial DNA mutations among type 2 diabetic patients with or without clinical characteristics of maternally inherited diabetes and deafness. Arq Bras Endocrinol Metab 52:1228–1235

Chapter 3

Allele-Specific Replication Inhibition of Mitochondrial DNA by MITO-PIP Conjugated with Alkylation Reagent

Abstract Pathogenic mutations in mitochondrial DNA cause genetic disorders named mitochondrial diseases. Although mutated mitochondrial DNA should be eliminated from cells, no chemical-based drugs in clinical trials have the potential to modulate mtDNA mutation and cure mitochondrial diseases permanently. To achieve selective elimination of mitochondrial DNA with mutant adenine base, I develop a conjugate of MITO-PIP and chlorambucil (Chb), which can alkylate an adenine base in a sequence-specific manner. The in vitro alkylation assay shows that a conjugate targeting the point mutation in HeLa S3 cells (m.8950G > A) alkylates the adenine at the mutation site. The conjugate also reduces the proportion of mutant mtDNA in cultured HeLa S3 cells. MITO-PIP–Chb conjugates would be drug candidates to cure mitochondrial diseases caused by pathogenic mutations in mtDNA and paves the way to the gene therapy of mitochondrial diseases by a chemical approach. Keywords Mitochondrial DNA · Mitochondrial diseases · DNA mutation · DNA alkylation

This chapter is reprinted from Cell Chem Biol, XX, Hidaka T et al., Targeted elimination of mutated mitochondrial DNA by a multi-functional conjugate capable of sequence-specific adenine alkylation, https://doi.org/10.1016/j.chembiol.2021.08.003. Copyright 2021, with permission from Elsevier. © Springer Nature Singapore Pte Ltd. 2022 T. Hidaka, Sequence-Specific DNA Binders for the Therapy of Mitochondrial Diseases, Springer Theses, https://doi.org/10.1007/978-981-16-8436-4_3

41

42

3 Allele-Specific Replication Inhibition of Mitochondrial DNA …

3.1 Introduction Mitochondria are ubiquitous cellular organelles and have a wide range of cellular metabolism functions like energy production, biosynthesis of biomolecules, maintenance of cellular homeostasis, and metabolic waste management [1]. Mitochondria also play a pivotal role in other processes, including non-shivering thermogenesis, calcium homeostasis, and apoptosis [2–5]. Proteomic analyses revealed that mitochondrial function is maintained by ~1500 proteins (approximately 10% of cellular proteome), and some mitochondrial genes are encoded in mitochondrial DNA (mtDNA). Human mtDNA encodes 37 genes including 13 protein-coding genes required for the electron transport chain, 22 tRNAs, and two rRNA. Individual cells contain multiple copies of mtDNA—200–2000 copies in each somatic cell and around 100,000 copies in a matured oocyte [6, 7]. Mitochondrial diseases are inherited disorders characterized by deficiencies in mitochondrial function caused by mutations in nuclear DNA (nDNA) and mtDNA, and mtDNA mutations cause approximately 80% of adult-onset mitochondrial diseases [8]. The first two mtDNA mutations were identified in 1988, one is deletions in mitochondrial myopathies, and another is a point mutation in the MT-ND4 gene (m.11778A > G) causing Leber’s hereditary optic neuropathy [9, 10]. To date, over 800 point mutations are registered in the human mitochondrial genome database (MITOMAP) [11]. The presence of multiple copies of mtDNA can lead to a mixture of mutant and wild-type mtDNA in individual cells, known as a heteroplasmy state. Although mitochondrial function can be maintained by residual wild-type mtDNA when the heteroplasmy level is low, a high proportion of mutant mtDNA exceeding a critical threshold level impairs mitochondrial function (threshold effect) [12]. To cure mitochondrial diseases permanently, mutant mtDNA should be eliminated from the

3.1 Introduction

43

cells. This has been experimentally achieved by mitochondria-directed gene editing tools such as zinc finger nucleases (mtZFNs) [13–15], and transcription activatorlike effector nucleases (mito-TALENs) which are programmed to digest the mutant sequence selectively [16, 17]. Although these approaches showed promising results towards gene therapies, the problems related to the possible genomic alterations by expression vector and the usage of virus vectors are concerned. Compound-based approaches are expected to avoid such issues, but no chemical-based drugs in clinical trials have the potential to modulate mtDNA mutation and cure mitochondrial diseases permanently [18]. Pyrrole-imidazole polyamides (PIPs) are DNA minor-groove binders composed of N-methylpyrrole (Py) and N-methylimidazole (Im). The recognized DNA sequence can be designed with the combination of Py and Im—antiparallel Py/Py pairs recognize A/T or T/A base pairs, while Im/Py pairs recognize G/C base pairs [19]. In Chap. 2, I developed MITO-PIPs, which can bind to a programmed sequence in mtDNA by introducing a mitochondria-penetrating peptide to PIPs and achieved promoter-specific transcriptional control [20, 21]. PIPs have been applied to sequence-specific DNA alkylation in combination with DNA alkylating reagents, and alkylation of oncogenic KRAS mutation successfully showed an antitumor effect [22]. Encouraged by this previous research, I expected that MITO-PIPs are applicable to selective alkylation of mutated bases and inhibit expansion of mutant mtDNA. To investigate this approach, the sequence specificity of DNA alkylation by MITO-PIPs conjugated with DNA alkylating agent and their effect on heteroplasmy level in live cells were evaluated.

3.2 Results 3.2.1 Design and Synthesis of a Conjugate Recognizing Selective DNA Sequence The chemical structures of compounds used in the study are shown in Fig. 3.1a. I designed a MITO-PIP targeting the adjacent sequence to a point mutation (m.8950G > A) in HeLa S3 cells [23] and introduced chlorambucil (Chb) as DNA alkylating agent (8950A-Chb(Cl/OH)). Because MITO-PIPs position chlorambucil in minor grooves and only adenine bases provide reactive nitrogen atoms (N3 position), 8950A-Chb(Cl/OH) is expected to alkylate mutant adenine selectively (Fig. 3.1b). Control compounds were designed not to bind to the same sequence (Fig. 3.1a). To reduce non-selective alkylation of proteins, a monoalkylating chlorambucil, which has one inactivated alkylating group via partial hydrolysis, was used [24]. Firstly, to confirm the sequence-selective DNA binding of the conjugates, the thermal stability of DNA and DNA–compound complex was analyzed by thermal melting temperature (T m ) analysis. In this experiment, both alkylating groups in chlorambucil were inactivated by hydrolysis to prevent covalent bond formation

44

3 Allele-Specific Replication Inhibition of Mitochondrial DNA …

Fig. 3.1 a Chemical structures of MITO-PIP–Chb conjugates used in this study. b Schematic illustration of selective DNA alkylation at the m.8950G > A point mutation by 8950A-Chb(Cl/OH)

3.2 Results

45

Table 3.1 The shift of T m values by 8950A-Chb(OH/OH) and Ctrl-Chb(OH/OH)a DNA only

8950A-Chb(OH/OH)

T m /°C

T m /°C

T m /°C

Ctrl-Chb(OH/OH) T m /°C

Tm /°C

34.24 (±0.28)

44.20 (±0.06)

9.97

34.75 (±0.33)

0.52

a Averages

of T m values are calculated from three melting temperature analyses, and each standard deviation is indicated in parentheses. T m = T m (compound–DNA complex) − T m (DNA)

(Fig. 3.1a, 8950A-Chb(OH/OH) and Ctrl-Chb(OH/OH)). The double-stranded DNA sample was prepared with the following sequences (the binding site is underlined): 5 -d(TCCCCATACTAATTA). The results of the T m analysis and representative melting curves are shown in Table 3.1 and Fig. 3.2a, respectively. While no significant T m shift was observed with Ctrl-Chb(OH/OH), 8950A-Chb(OH/OH) increased the T m value by around 10 °C, indicating that only 8950A-Chb(OH/OH) bound to the target sequence. Despite the fact that the melting curves of the alkylationactive compounds (Fig. 3.1a, 8950A-Chb(Cl/OH) and Ctrl-Chb(Cl/OH)) showed a notable variation and T m values of the 8950A-Chb(Cl/OH) samples could not be calculated, only a slight increase of T m value (less than 5 °C) was observed with CtrlChb(Cl/OH). This result indicates that off-target binding caused by DNA alkylation is not significant (Table 3.2 and Fig. 3.2b).

3.2.2 Validation of Sequence-Specific Adenine Alkylation by 8950A-Chb(Cl/OH) To examine the sequence selectivity of DNA alkylation by 8950A-Chb(Cl/OH), in vitro alkylation assay using capillary electrophoresis was performed (Fig. 3.3a). The sequence of mtDNA (ChrM: 8763-9147) with and without m.8950G > A mutation was amplified by PCR using a forward primer labeled with TexasRed and a non-labeled reverse primer. The strand containing the target mutation is labeled with TexasRed. After alkylation reaction with each compound, the product was subjected to heat treatment to cleave the DNA at the alkylated site (Fig. 3.3b). The resultant DNA fragments were separated by capillary electrophoresis, and chromatograms of TexasRed signal were obtained (Fig. 3.3c). While no difference was observed in the alkylation pattern between wild-type and mutant sequence alkylated by Ctrl-Chb(Cl/OH) (Fig. 3.3c, left), an alkylation peak specific to mutant sequence appeared in samples alkylated by 8950A-Chb(Cl/OH) (Fig. 3.3c, right). To confirm that this peak was derived from the alkylation of the target adenine, the sample was analyzed along with the Sanger sequencing sample prepared with ddATP (Fig. 3.4a). After manual alignment of peaks in the chromatograms to the adenine bases, the alkylation peak specific to the mutant sequence was positioned on the base before the target one (Fig. 3.4b). It should be noted that the alkylation peak in chromatograms appears one base before the actual alkylated base because

46

3 Allele-Specific Replication Inhibition of Mitochondrial DNA …

Fig. 3.2 a Representative melting curves obtained in the T m assay of 8950A-Chb(OH/OH) and Ctrl-Chb(OH/OH). b All melting curves derived from the T m assay using the alkylation-active compounds (8950A-Chb(Cl/OH) and Ctrl-Chb(Cl/OH)). The absorbance values in these graphs are normalized with the lowest and highest values of each sample in 15–55 °C Table 3.2 The shift of T m values by 8950A-Chb(Cl/OH) and Ctrl-Chb(Cl/OH)a DNA only

8950A-Chb(Cl/OH)b

T m /°C

T m /°C

T m /°C

T m /°C

T m /°C

34.43 (±0.08)

N/a

N/a

36.22 (±2.55)

1.79

a Averages

Ctrl-Chb(Cl/OH)

of T m values are calculated from three melting temperature analyses, and each standard deviation is indicated in parentheses. T m = T m (compound–DNA complex) − T m (DNA) b The melting curves of the 8950A-Chb(Cl/OH) samples could not be fitted with the second derivative method

3.2 Results

47

Fig. 3.3 a Schematic illustration of the in vitro alkylation assay by capillary electrophoresis. b The scheme of DNA fragmentation during the heat treatment. c Chromatograms from the capillary electrophoresis of DNA sequences (ChrM: 8763-9147, with and without the m.8950G > A mutation) alkylated with Ctrl-Chb(Cl/OH) and 8950A-Chb(Cl/OH)

48

3 Allele-Specific Replication Inhibition of Mitochondrial DNA …

Fig. 3.4 a Schematic illustration of ddATP Sanger sequencing sample preparation. b Determination of the alkylated base specific to the mutant sequence alkylated by 8950A-Chb(Cl/OH). The peaks assigned to adenine bases are indicated with black arrows, and the alkylation peak is indicated with a gray arrow. The target adenine is shown in orange

the alkylated base is removed from the DNA fragment during the sample preparation (Fig. 3.3b), and this result supports the selective alkylation of the target adenine by 8950A-Chb(Cl/OH). Furthermore, we newly designed 9037A-Chb(Cl/OH) targeting adenine base at 9037, and performed an additional in vitro alkylation assay (Fig. 3.5a). In accordance with our notion, 9037A-Chb(Cl/OH) alkylated the target adenine, which supports the sequence programmability of our compounds (Fig. 3.5b).

3.2.3 8950A-Chb(Cl/OH) Shifts Heteroplasmy Level in Live Cells Lastly, the effect of the conjugates on heteroplasmy level in HeLa S3 cells was investigated by quantitative PCR (qPCR). HeLa S3 cells were treated with 8950AChb(Cl/OH) and Ctrl-Chb(Cl/OH) (Fig. 3.6a). The cells were passaged to a new plate every five days, and the medium was changed one and three days after the passaging with a fresh medium containing each compound. On days 10 and 20, the treated cells were passaged to a new plate and incubated for additional five days without compounds to let mtDNA recover from alkylation because alkylated mtDNA can be fragmented when the samples are heated during qPCR. After total DNA extraction, the nuclear genome was digested with exonuclease V to avoid contamination of nuclear mitochondrial DNA sequences (NUMTs), which can cause an experimental bias [25]. The heteroplasmy level was determined by qPCR using forward

3.2 Results

49

Fig. 3.5 a Chemical structure of 9037-Chb(Cl/OH). b Determination of alkylated sites by capillary electrophoresis. The peaks assigned to adenine bases are indicated with black arrows, and the alkylation peak is indicated with a gray arrow. The target adenine is shown in orange

primers with the target base at their 3 end and a common reverse primer (Fig. 3.6b) along with DNA polymerase possessing high discrimination ability to mismatches at the 3 -terminus (amplification refractory mutation system (ARMS)-based qPCR) [26, 27]. Although no significant change was observed at day 10, a stable reduction in heteroplasmy level was observed from days 10 to 20 with 8950A-Chb(Cl/OH) in a dose-dependent manner while Ctrl-Chb(Cl/OH) produced slight changes at day 10 and lack further reduction at day 20 (Fig. 3.6c). No heteroplasmy shift by 8950A-Chb(OH/OH) supports the requirement of active chlorambucil (Fig. 3.6d). Together with the result from the in vitro alkylation assay, this reduction in the heteroplasmy level indicates that the selective alkylation of the mutant adenine by 8950A-Chb(Cl/OH) is effective to reduce the copy number of mutant mtDNA in live cells.

50

3 Allele-Specific Replication Inhibition of Mitochondrial DNA …

Fig. 3.6 a Schedule of the MITO-PIP–Chb conjugates treatment of HeLa S3 cells. b Design of ARMS-based qPCR primers. c Heteroplasmy level in HeLa S3 was evaluated after incubation with 8950A-Chb(Cl/OH) and Ctrl-Chb(Cl/OH) (c), and 8950A-Chb(Cl/OH) and 8950AChb(OH/OH) (d). The relative ratio of mutant ([8950A]) to wild-type ([8950G]) mtDNA was determined by ARMS-based qPCR. The individual values are shown as black dots and values derived from the same replicates are connected with broken lines. Each value is normalized to the mean of vehicle control containing the same concentration of DMSO as other samples (final concentration: 0.1%) at corresponding time points. Each bar represents the mean ± SD (n = 3) and statical significance was determined by the Student t-test: *P < 0.05, **P < 0.01

3.3 Discussion In the current study, MITO-PIP–Chb conjugates could alkylate the target adenine in a sequence-specific manner and shift the heteroplasmy level in live cells. While the mechanism of alkylated mtDNA degradation needs to be clarified, the recent study suggests the potential role of mitochondrial transcription factor A (TFAM). Base excision repair (BER) system that repairs deaminated and oxidized bases also repair alkylated bases [28]. During BER, abasic (AP) sites with high chemical reactivity are generated, and BER and mtDNA degradation are the major pathways to deal with AP sites [29]. Recently, TFAM was reported to promote degradation of mtDNA containing AP sites by inducing single-strand breaks and DNA-TFAM cross-links. Accordingly, the TFAM-mediated pathway is expected to eliminate the mtDNA alkylated by our compounds [30]. This proof-of-concept study provides a new chemical

3.3 Discussion

51

approach to develop conjugates for the gene therapy of mitochondrial diseases, which has only been demonstrated with biological tools so far. Mitochondrial DNA mutations are difficult to target and until now, there are no small molecule drug conjugates available capable of eliminating mutated mitochondrial DNA inside live cells. Previously, peptide nucleic acid (PNA) oligomers targeting mtDNA mutations were applied to replication inhibition of mutant mtDNA. Although mitochondrial-targeting peptides or triphenylphosphonium cation-enhanced mitochondrial delivery of PNA oligomers, their activity has only been demonstrated in in vitro systems and heteroplasmy shift in live cells has not been achieved [31–34]. Here, we successfully demonstrated that our multifunctional PIP conjugate shifts the heteroplasmy level in live cells by alkylating the target mutation. The major advantage of our multi-functional conjugates is that we can preprogram them to recognize specific DNA sequences by rearranging the combination of pyrrole and imidazole rings. This proof-of-concept study targeting a nonpathogenic mutation (m.8950G > A) in HeLa S3 cells can be extended to the point mutations generating adenine (or thymine) ensuing several mitochondrial diseases including Leber’s hereditary optic neuropathy (m.11778G > A and m.3460G > A) and MELAS syndrome (m.3697G > A and m.13513G > A) [9, 35–37]. Modulation of the pathogenic mtDNA mutations will be addressed in future studies to advance their application as therapeutic tools for mitochondrial diseases. Nevertheless, our multifunctional conjugate could open new vistas of opportunities to drug the undruggable mutations inside live cells.

3.4 Materials and Methods 3.4.1 General Information of Synthesis The reagents were purchased from standard suppliers. The solid-phase synthesis was performed using an automated synthesizer, PSSM-8 (Shimadzu), with a computerassisted operation system. Analytical reversed-phase high performance liquid chromatography (HPLC) was performed on a JASCO HPLC system (JASCO Engineering UV2075 UV/vis detector and a PU-2089 plus gradient pump) equipped with Chemcobond 5-ODS-H reversed-phase column (4.6 × 150 mm). H2 O (+0.1% trifluoroacetic acid) and acetonitrile were used as the mobile phase, and the program was a linear gradient of 0 to 100% acetonitrile in 20 min (for 9037A-Chb(Cl/OH)) or 40 min (for the other compounds) at a flow rate of 1.0 mL/min. Absorbance at 254 nm was monitored. MALDI-TOF mass spectroscopy was performed with the microflex system (Bruker).

52

3 Allele-Specific Replication Inhibition of Mitochondrial DNA …

3.4.2 Solid-Phase Synthesis of MITO-PIPs and Chlorambucil Conjugation Each Fmoc monomer unit (Fmoc-D-Arg(Pbf)-OH, Fmoc-cyclohexylalanine (Cha)OH, Fmoc-β-alanine-OH, Fmoc-Dab(Boc)-OH, Fmoc-Py-OH and Fmoc-Im-OH) was introduced sequentially to Fmoc-D-Arg(Pbf)-Alko resin using an automated synthesizer, PSSM-8 (Shimadzu). To overcome the difficulty of coupling Py after Im, Fmoc-PyIm-OH dimer unit was also used to improve synthesis efficiency [38, 39]. Each coupling reaction was performed at room temperature for one hour in Nmethyl-2-pyrrolidone (NMP) containing 4 eq of HCTU, N, N-diisopropylethylamine (DIEA), and each Fmoc monomer unit, followed by Fmoc deprotection in 20% piperidine in N, N-dimethylformamide (DMF). After the solid-phase synthesis, the resin was incubated with 20% acetic anhydride in DMF at room temperature to cap the N-terminal with an acetyl group. Synthesized compounds were cleaved with N, N-dimethylaminopropylamine at 55 °C for 3 h. The reaction solution was drained into ether, and the resulting solid was dried in vacuo. The synthetic scheme summarizing the above steps is shown in Fig. 3.7.

Fig. 3.7 Synthetic scheme of solid-phase synthesis of MITO-PIPs and the following resin cleavage

3.4 Materials and Methods

53

Before coupling reaction with chlorambucil, the Boc group of the turn unit (Dab) was removed with a deprotection cocktail (trifluoroacetic acid (TFA): dichloromethane (DCM) (30:70 v/v%)) at room temperature for five minutes. The reaction solution was drained into the ether, and the resulting solid was dried in vacuo. After Boc deprotection, the compounds were coupled with chlorambucil in DMF by adding 2–4 eq of chlorambucil, 3–6 eq of 1-[Bis(dimethylamino)methylene]1H-benzotriazolium 3-Oxide Hexafluorophosphate (HBTU) and 4–8 eq of DIEA and shaking at room temperature for 3.5 h to overnight. The reaction solution was drained into ether, and the resulting solid was dried in vacuo. After chlorambucil coupling, the protecting groups of arginine residues (Pbf groups) were removed with a deprotection cocktail (TFA: triisopropylsilane: water (95:2.5:2.5 v/v%)) at room temperature for 30 min. The reaction solution was drained into ether, and the resulting solid was dried in vacuo, obtaining 8950A-Chb(Cl/Cl), 9037A-Chb(Cl/Cl), and Ctrl-Chb(Cl/Cl). Synthetic scheme of 8950A-Chb(Cl/Cl) is shown in Fig. 3.8.

Fig. 3.8 Synthetic scheme of 8950A-Chb(Cl/Cl)

54

3 Allele-Specific Replication Inhibition of Mitochondrial DNA …

3.4.3 Synthesis of 8950A-Chb(Cl/OH), Ctrl-Chb(Cl/OH) and 9037A-Chb(Cl/OH) To synthesize 8950A-Chb(Cl/OH), 11.2 mg of 8950A-Chb(Cl/Cl) was hydrolyzed in acetonitrile/water (+0.1% TFA) (300 μL and 750 μL, respectively) at 50 °C for 1 h 15 min after Pbf deprotection and purified by reversed-phase HPLC using a JASCO HPLC system (JASCO Engineering UV2075 UV/vis detector and a PU-2089 plus gradient pump) with a preparative C18 (ODS) column (COSMOSIL 5C18-MS-II, 10ID × 150 mm). Deionized water (+0.1% TFA) and acetonitrile were used as the mobile phase. HPLC and MALDI-TOF mass spectroscopy was performed for the characterization of the purified compounds. Analytical HPLC: t R = 17.7 min. MALDI-TOF-MS m/z calcd for C121 H169 ClN41 O21 + : 2569.31 [M + H]+ , found 2567.20. To synthesize Ctrl-Chb(Cl/OH), 4.1 mg of Ctrl-Chb(Cl/Cl) was hydrolyzed in acetonitrile/water (+0.1% TFA) (200 μL each) at 55 °C for 2 h. Purification and characterization were performed as explained above. Analytical HPLC: t R = 17.5 min. MALDI-TOF-MS m/z calcd for C120 H168 ClN42 O21 + : 2568.31 [M + H]+ , found 2568.04. To synthesize 9037A-Chb(Cl/OH), 8.0 mg of 9037A-Chb(Cl/Cl) was hydrolyzed in acetonitrile/water (+0.1% TFA) (300 μL and 750 μL, respectively) at 45 °C for 2 h. Purification and characterization were performed as explained above. Analytical HPLC: t R = 11.6 min. MALDI-TOF-MS m/z calcd for C121 H169 ClN41 O21 + : 2567.31 [M + H]+ , found 2567.74.

3.4.4 Synthesis of 8950A-Chb(OH/OH) and Ctrl-Chb(OH/OH) To synthesize 8950A-Chb(OH/OH), 6.2 mg of 8950A-Chb(Cl/Cl) was hydrolyzed in acetonitrile/water (+0.1% TFA) (300 μL each) at 55 °C overnight. Purification and characterization were performed as explained above. Analytical HPLC: t R = 17.0 min. MALDI-TOF-MS m/z calcd for C121 H170 N41 O22 + : 2549.34 [M + H]+ , found 2549.10. To synthesize Ctrl-Chb(OH/OH), 4.7 mg of Ctrl-Chb(Cl/Cl) was hydrolyzed in acetonitrile/water (+0.1% TFA) (300 μL each) at 55 °C overnight. Purification and characterization were performed as explained above. Analytical HPLC: t R = 17.7 min. MALDI-TOF-MS m/z calcd for C120 H169 N42 O22 + : 2550.34 [M + H]+ , found 2550.17.

3.4 Materials and Methods

55

3.4.5 Preparation of DMSO Solution of Each Compound The powder of each compound was dissolved in DMSO, and the concentration was determined from the calculation formula below using the maximum absorbance in 300–310 nm measured by a Nanodrop ND-1000 (ThermoFisher Scientific): c=

Abs (M) 9900 × a × d

a: total number of pyrrole and imidazole rings, d (cm): optical path length (0.1 cm for Nanodrop ND-1000), Abs = Maximum absorbance in 300–310 nm.

3.4.6 Melting Temperature (Tm ) Analysis The buffer for T m analysis was an aqueous solution of 10 mM sodium chloride and 10 mM sodium cacodylate at pH 7.0 containing 2.5 v/v% DMSO. The concentration of polyamides and dsDNA was 5 and 2.5 μM, respectively (2:1 stoichiometry). Before the analyses, the samples were annealed from 65 to 5 °C at a rate of 1.0 °C/min. For annealing of 8950A-Chb(Cl/OH) and Ctrl-Chb(Cl/OH) samples, samples without conjugates were heated to 70 °C for 5 min and cooled to room temperature by natural cooling. The samples were mixed with each conjugate just before the analyses on ice to avoid hydrolysis of chlorambucil during the annealing step. Absorbance at 260 nm was recorded from 5 to 65 °C at a rate of 1.0 °C/min using a spectrophotometer V-650 (JASCO) with a thermocontrolled PAC-743R cell changer (JASCO) and a thermal circulator F25-ED (Julabo). T m values were calculated from melting curves with Spectra Manager software (JASCO) by using the 2nd derivative method. The mean T m values and standard deviations were calculated from three T m analyses.

3.4.7 Alkylation Assay by Capillary Electrophoresis 3.4.7.1

Cloning of mtDNA Sequence (ChrM: 8763-9333) into pGEM-T-Easy Vector

mtDNA was prepared from HeLa cells by total DNA extraction using QIAamp DNA mini kit (QIAGEN), nuclear DNA digestion with exonuclease V (New England Biolabs), and clean-up with AMPure XP beads (Beckman Coulter) following the manufacture’s protocol. The mtDNA sequence (ChrM: 8763-9333) was amplified by PCR from the extracted mtDNA using GoTaq® Green Master Mix (Promega) and PCR primers (forward primer: 5 -TGCCACAACTAACCTCCTCG, reverse primer:

56

3 Allele-Specific Replication Inhibition of Mitochondrial DNA …

5 -GGAGCGTTATGGAGTGGAAGT). After PCR clean-up with Wizard® SV Gel and PCR Clean-Up System (Promega), the PCR product was ligated with pGEM® -T Easy Vector (Promega) using Ligation high Ver. 2 (Toyobo). The ligation sample was transformed into Competent high JM109 cells (Toyobo) and subjected to single-cell cloning and amplification (pGEM-8950G).

3.4.7.2

Introduction of m.8950G > A Point Mutation into the Cloned Sequence

The m.8950G > A point mutation was introduced into the cloned sequence by invert PCR using KOD-Plus-Mutagenesis Kit (Toyobo) with PCR primers possessing the target point mutation (forward primer: 5 ATTATTATCGAAACCATCAGCCTACTCATTCAAC, reverse primer: 5 TAGTATGGGGATAAGGGGTGTAGGTG, the target point mutation is underlined). The invert PCR and successive DpnI digestion and ligation reaction were performed following the manufacture’s protocol. The ligation sample was transformed into ECOS JM109 cells (Nippon Gene) and subjected to single-cell cloning and amplification (pGEM-8950A).

3.4.7.3

Sequencing of the Cloned mtDNA Sequence

The mtDNA sequence (ChrM: 8763-9333) with and without the m.8950G > A point mutation introduced into the pGEM-T-easy vector was confirmed by DNA sequencing. Sequencing reactions were performed in a BioRad DNA Engine Dyad PTC-220 Peltier Thermal Cycler using ABI PRISM® BigDye® Terminator v3.1 Cycle Sequencing Kits (Applied Biosystems), following the protocols supplied by the manufacturer. Single-pass sequencing was performed on each template using the same primers used for the PCR amplification of the mtDNA sequence. The fluorescent-labeled fragments were purified from the unincorporated terminators with an ethanol precipitation protocol. The samples were resuspended in distilled water and subjected to electrophoresis in an ABI 3730xl sequencer (Applied Biosystems).

3.4.7.4

Preparation of Non-labeled and TexasRed-Labeled Template DNA

The mtDNA sequence (ChrM: 8763-9147) with and without the m.8950G > A point mutation in the pGEM-T-easy vector was subjected to PCR amplification using GoTaq® Green Master Mix (Promega) with non-labeled (5 -TGCCACAACTAACCTCCTCG) or TexasRed-labeled forward primers (5 TexasRed-TGCCACAACTAACCTCCTCG) and non-labeled reverse primer (5 GGCGACAGCGATTTCTAGGATAG). The PCR product was purified using

3.4 Materials and Methods

57

Wizard® SV Gel and PCR Clean-Up System (Promega) to obtain non-labeled and TexasRed-labeled template DNA.

3.4.7.5

Alkylation of TexasRed-Labeled mtDNA Fragments by 8950A-Chb(Cl/OH) and Ctrl-Chb(Cl/OH)

The labeled template DNA with and without the m.8950G > A point mutation (200 nM) was mixed with each compound (800 nM) in sodium phosphate buffer (50 mM, pH 7) containing 10% DMSO and incubated at 37 °C for 20 h. After the alkylation reaction, the samples were heated at 95 °C for 5 min to remove alkylated bases and cleave the DNA strand, and the residual sugar moiety was removed by further incubation at 95 °C for 25 min in the presence of 1 M of piperidine. The fragmented samples were purified using Performa® DTR Gel Filtration Cartridges (Edge Biosystems) and lyophilized. The terminal phosphate group was removed by phosphatase treatment (New England Biolabs), and the samples were purified again using Performa® DTR Gel Filtration Cartridges (Edge Biosystems). The samples were lyophilized and dissolved in Hi-Di™ Formamide (Applied Biosystems) and subjected to capillary electrophoresis.

3.4.7.6

Preparation of Sanger Sequencing Sample with DideoxyATP (ddATP)

The Sanger sequencing sample was prepared by Thermo Sequenase Cycle Sequencing Kit (Applied Biosystems) (Fig. S2c). The non-labeled template DNA (ChrM: 8763-9147) with the m.8950G > A point mutation was mixed with the TexasRed-labeled primer (5 -TexasRed-TGCCACAACTAACCTCCTCG) and Thermo Sequenase DNA polymerase in the reaction buffer, and the mixture was added to ddATP termination mix containing 150 μM of each dNTPs and 1 μM of ddATP. The amplification reaction was performed with the following thermocycling condition: 95 °C, 3 min > [95 °C, 30 s > 60 °C, 30 s > 72 °C, 1 min] (40 cycles) > 72 °C, 5 min > 12 °C. The TexasRed-labeled fragments were purified using Performa® DTR Gel Filtration Cartridges (Edge Biosystems) and lyophilized. The dried samples were dissolved in Hi-Di™ Formamide (Applied Biosystems) and subjected to capillary electrophoresis.

3.4.7.7

Capillary Electrophoresis

The samples dissolved in Hi-Di™ Formamide (Applied Biosystems) were subjected to capillary electrophoresis in a 3500xl Genetic Analyzer (Applied Biosystems). The chromatograms of TexasRed signal saved in ab1 format were visualized in DNA Baser Assembler software (Heracle BioSoft S.R.L.) and exported as bitmap images.

58

3 Allele-Specific Replication Inhibition of Mitochondrial DNA …

To determine the alkylated base, the chromatogram of a mixture of the alkylation sample and the Sanger sequencing sample was compared with that of the only Sanger sequencing sample. Both chromatograms were manually aligned, and each peak was assigned to adenine bases in the DNA sequence.

3.4.8 Compound Treatment and Quantitative PCR (qPCR) Analysis HeLa S3 cells were seeded on a 24-well plate at 1 × 104 cells/well one day before the treatment. The cells were passaged to a new 24-well plate in a growth medium every five days, and the medium was changed one and three days after the passaging with OPTI-MEM medium (ThermoFisher Scientific) supplemented with 2% FBS, 0.1% DMSO and each compound. On days 10 and 20, the cells were passaged to a 12-well plate at 2 × 104 cells/well in growth medium (without the compounds) and incubated for five days for recovery from DNA alkylation. After the recovery period, total DNA was extracted by the QIAamp DNA mini kit (Qiagen). The extracted DNA (1 μg) was digested with exonuclease V (New England Biolabs) to remove genomic DNA and purified again with QIAquick PCR Purification Kit (Qiagen). The obtained mtDNA was diluted to 5 ng/mL with nuclease-free water. PCR reaction mixture was prepared with the HiDi® 2x PCR Master Mix (myPOLS Biotec.) and GreenDye 20x (myPOLS Biotec.), and the qPCR reaction was performed and monitored on LightCycler 480 System II (Roche). The primer sequences used in this experiment are listed in Table 3.3. In quantitative PCR experiments, Cp values were calculated from amplification curves using LightCycler® 480 Software, Version 1.5 (Roche), and the relative amount of mutant mtDNA ([8950A]) to wild-type mtDNA ([8950G]) was calculated from the averaged Cp values of three replicates of each sample. The calculated ratio was normalized to the mean value of non-treated samples. Statistical analysis was performed using a student’s unpaired two-tailed t-test. Table 3.3 The primer list for qPCR experiments

Primer

Sequence

8950A forward

5 -ACCCCTTATCCCCATACTAA

8950G forward

5 -ACCCCTTATCCCCATACTAG

G8950A reverse

5 -AGGGTGGCGCTTCCAATTA

3.5 Characterization Data of Synthesized Compounds

3.5 Characterization Data of Synthesized Compounds

59

60

3 Allele-Specific Replication Inhibition of Mitochondrial DNA …

3.5 Characterization Data of Synthesized Compounds

61

62

3 Allele-Specific Replication Inhibition of Mitochondrial DNA …

3.5 Characterization Data of Synthesized Compounds

63

References 1. Spinelli JB, Haigis MC (2018) The multifaceted contributions of mitochondria to cellular metabolism. Nat Cell Biol 20:745–754 2. Hopper RK et al (2006) Mitochondrial matrix phosphoproteome: effect of extra mitochondrial calcium. Biochemistry 45:2524–2536 3. Hughes DA, Jastroch M, Stoneking M, Klingenspor M (2009) Molecular evolution of UCP1 and the evolutionary history of mammalian non-shivering thermogenesis. BMC Evol Biol 9:4 4. Rasola A, Bernardi P (2011) Mitochondrial permeability transition in Ca2+ -dependent apoptosis and necrosis. Cell Calcium 50:222–233 5. Rizzuto R, De Stefani D, Raffaello A, Mammucari C (2012) Mitochondria as sensors and regulators of calcium signaling. Nat Rev Mol Cell Biol 13:566–578 6. Robin ED, Wong R (1988) Mitochondrial-DNA molecules and virtual number of mitochondria per cell in mammalian-cells. J Cell Physiol 136:507–513

64

3 Allele-Specific Replication Inhibition of Mitochondrial DNA …

7. Piko L, Taylor KD (1987) Amounts of mitochondrial-DNA and abundance of some mitochondrial gene transcripts in early mouse embryos. Dev Biol 123:364–374 8. Gorman GS et al (2015) Prevalence of nuclear and mitochondrial DNA mutations related to adult mitochondrial disease. Ann Neurol 77:753–759 9. Wallace DC et al (1988) Mitochondrial DNA mutation associated with Leber’s hereditary optic neuropathy. Science 242:1427–1430 10. Holt IJ, Harding AE, Morganhughes JA (1988) Deletions of muscle mitochondrial-DNA in patients with mitochondrial myopathies. Nature 331:717–719 11. Kogelnik AM, Lott MT, Brown MD, Navathe SB, Wallace DC (1996) MITOMAP: a human mitochondrial genome database. Nucleic Acids Res 24:177–179 12. Boulet L, Karpati G, Shoubridge EA (1992) Distribution and threshold expression of the tRNA(Lys) mutation in skeletal-muscle of patients with myoclonic epilepsy and ragged-red fibers (MERRF). Am J Hum Genet 51:1187–1200 13. Gammage PA et al (2018) Genome editing in mitochondria corrects a pathogenic mtDNA mutation in vivo. Nat Med 24:1691–1695 14. Gammage PA, Rorbach J, Vincent AI, Rebar EJ, Minczuk M (2014) Mitochondrially targeted ZFNs for selective degradation of pathogenic mitochondrial genomes bearing large-scale deletions or point mutations. EMBO Mol Med 6:458–466 15. Minczuk M, Papworth MA, Miller JC, Murphy MP, Klug A (2008) Development of a singlechain, quasi-dimeric zinc-finger nuclease for the selective degradation of mutated human mitochondrial DNA. Nucleic Acids Res 36:3926–3938 16. Bacman SR et al (2018) MitoTALEN reduces mutant mtDNA load and restores tRNA(Ala) levels in a mouse model of heteroplasmic mtDNA mutation. Nat Med 24:1696–1700 17. Bacman SR, Williams SL, Pinto M, Peralta S, Moraes CT (2013) Specific elimination of mutant mitochondrial genomes in patient-derived cells by mitoTALENs. Nat Med 19:1111–1113 18. Weissig V (2020) Drug development for the therapy of mitochondrial diseases. Trends Mol Med 26:40–57 19. Trauger JW, Baird EE, Dervan PB (1996) Recognition of DNA by designed ligands at subnanomolar concentrations. Nature 382:559–561 20. Hidaka T et al (2017) Creation of a synthetic ligand for mitochondrial DNA sequence recognition and promoter-specific transcription suppression. J Am Chem Soc 139:8444–8447 21. Horton KL, Stewart KM, Fonseca SB, Guo Q, Kelley SO (2008) Mitochondria-penetrating peptides. Chem Biol 15:375–382 22. Hiraoka K et al (2015) Inhibition of KRAS codon 12 mutants using a novel DNA-alkylating pyrrole-imidazole polyamide conjugate. Nat Commun 6:6706 23. Herrnstadt C et al (2002) A high frequency of mtDNA polymorphisms in HeLa cell sublines. Mutat Res 501:19–28 24. Jean SR, Pereira MP, Kelley SO (2014) Structural modifications of mitochondria-targeted chlorambucil alter cell death mechanism but preserve MDR evasion. Mol Pharm 11:2675–2682 25. Mourier T, Hansen AJ, Willerslev E, Arctander P (2001) The human genome project reveals a continuous transfer of large mitochondrial fragments to the nucleus. Mol Biol Evol 18:1833– 1837 26. Newton CR, Graham A, Heptinstall LE, Powell SJ, Summers C, Kalsheker N, Smith JC, Markham AF (1989) Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS). Nucleic Acids Res 17:2503–2516 27. Venegas V, Halberg MC (2012) Quantification of mtDNA mutation heteroplasmy (ARMS qPCR). Methods Mol Biol 837:313–326 28. Fu Y, Tigano M, Sfeir A (2020) Safeguarding mitochondrial genomes in higher eukaryotes. Nat Struct Mol Biol 27:687–695 29. Kozhukhar N, Spadafora D, Fayzulin R, Shokolenko IN, Alexeyev M (2016) The efficiency of the translesion synthesis across abasic sites by mitochondrial DNA polymerase is low in mitochondria of 3T3 cells. Mitochondrial DNA A DNA Mapp Seq Anal 27:4390–4396 30. Xu W, Boyd RM, Tree MO, Samkari F, Zhao L (2019) Mitochondrial transcription factor A promotes DNA strand cleavage at abasic sites. Proc Natl Acad Sci USA 116:17792–17799

References

65

31. Chinnery PF et al (1999) Peptide nucleic acid delivery to human mitochondria. Gene Ther 6:1919–1928 32. Flierl A et al (2003) Targeted delivery of DNA to the mitochondrial compartment via import sequence-conjugated peptide nucleic acid. Mol Ther 7:550–557 33. Muratovska A et al (2001) Targeting peptide nucleic acid (PNA) oligomers to mitochondria within cells by conjugation to lipophilic cations: implications for mitochondrial DNA replication, expression and disease. Nucleic Acids Res 29:1852–1863 34. Taylor RW, Chinnery PF, Turnbull DM, Lightowlers RN (1997) Selective inhibition of mutant human mitochondrial DNA replication in vitro by peptide nucleic acids. Nat Genet 15:212–215 35. Huoponen K, Vilkki J, Aula P, Nikoskelainen EK, Savontaus ML (1991) A new mtDNA mutation associated with Leber hereditary optic neuroretinopathy. Am J Hum Genet 48:1147– 1153 36. Kirby DM et al (2004) Mutations of the mitochondrial ND1 gene as a cause of MELAS. J Med Genet 41:784–789 37. Santorelli FM et al (1997) Identification of a novel mutation in the mtDNA ND5 gene associated with MELAS. Biochem Biophys Res Commun 238:326–328 38. Baird EE, Dervan PB (1996) Solid phase synthesis of polyamides containing imidazole and pyrrole amino acids. J Am Chem Soc 118:6141–6146 39. Minoshima M, Bando T, Sasaki S, Fujimoto J, Sugiyama H (2008) Pyrrole-imidazole hairpin polyamides with high affinity at 5 -CGCG-3 DNA sequence; influence of cytosine methylation on binding. Nucleic Acids Res 36:2889–2894

Chapter 4

Enhanced Nuclear Accumulation of Pyrrole-Imidazole Polyamides by Incorporation of the Tri-Arginine Vector

Abstract Mutations in mitochondrial genes encoded in nuclear DNA cause mitochondrial diseases and are important targets to treat the diseases. Although approaches utilizing pyrrole-imidazole polyamides (PIPs) have potential to modulate nuclear DNA transcription and replication based on DNA sequence information, their application in living cells has achieved limited success due to the moderate or poor nuclear accumulation of PIPs. In this chapter, I show that the tri-arginine moiety enhances nuclear accumulation of 12-ring PIPs without compromising their sequence-selective DNA binding. The tri-arginine vector improves biological activity of PIPs and PIP–tri-arginine conjugates achieve efficient transcription inhibition of SOX2-downstream genes in induced pluripotent stem (iPS) cells and HER2 oncogene in human breast cancer cells. This simple vector expands the application of long PIPs by overcoming the compound delivery problems. Keywords Tri-arginine peptide · Nuclear drug delivery · DNA transcription inhibitor

This chapter is republished with permission of the Royal Society of Chemistry, from Hidaka T et al. (2020) Enhanced nuclear accumulation of pyrrole-imidazole polyamides by incorporation of the tri-arginine vector. Chem. Commun. 56:12371–12374; permission conveyed through Copyright Clearance Center, Inc. © Springer Nature Singapore Pte Ltd. 2022 T. Hidaka, Sequence-Specific DNA Binders for the Therapy of Mitochondrial Diseases, Springer Theses, https://doi.org/10.1007/978-981-16-8436-4_4

67

68

4 Enhanced Nuclear Accumulation of Pyrrole-Imidazole Polyamides …

4.1 Introduction Pyrrole-imidazole polyamides (PIPs) are synthetic ligands composed of Nmethylpyrrole (Py) and N-methylimidazole (Im) that bind to the minor groove of double-stranded DNA (dsDNA). A hairpin form of PIPs containing two polyamide strands with a turn linker connecting the C-terminal of one strand with the N-terminal of the other strand has been most commonly used [1]. Their target DNA sequence can be programmed by rearranging the Py and Im rings, i.e., Py/Py pairs recognize A/T or T/A base pairs and Py/Im pairs recognize C/G base pairs [2]. This sequenceselective DNA-binding property enables the targeting of specific genomic regions, and various PIP-based compounds have been reported to achieve artificial control of gene expression [3, 4]. To achieve control over biological activity in living cells, PIPs must be delivered into nuclei and bind to nuclear DNA. Although some PIPs have been reported to accumulate in nuclei efficiently [5], their application in living cells has achieved limited success due to the moderate or poor nuclear accumulation of PIPs. The influence of the structural features of PIPs on nuclear delivery has been studied extensively. Structural variation in molecular size, Py/Im content, fluorescence moiety, and chemical modification of turn units significantly altered the efficiency of nuclear accumulation, making it difficult to predict the uptake efficiency of PIPs a priori [6–9]. In general, while short hairpin PIPs containing eight Py/Im rings are favorable for efficient delivery, long PIPs containing more than ten Py/Im rings and β-alanine residues offer advantages in binding affinity to DNA and sequence selectivity [10, 11]. To solve this ‘trade-off’ relationship, robust and efficient delivery of long PIPs to nuclei is required. Introduction of an aryl group at a γ-diaminobutyric acid turn unit of eight-ring hairpin PIPs was reported to enhance cellular uptake, but this approach has not been applied to longer PIPs [12].

4.1 Introduction

69

Oligoarginines have been widely used as cellular delivery tools for macromolecules including proteins, nucleic acids, and liposomes. However, while oligoarginines offer the potential to enhance the cellular uptake of PIPs, several problems are predicted in their application to PIPs. Oligoarginines used as delivery vectors contain 6–12 arginine residues because peptides containing fewer arginine residues do not display efficient cellular uptake [13]. Synthesis of PIPs and long peptide conjugates is also challenging because more coupling steps are required in a solid-phase synthesis, which reduces the total yield. Furthermore, arginine residues are positively charged at physiological pH and their non-selective interaction with the negatively charged DNA phosphate backbone is expected to impair the sequence selectivity of PIPs. Since some PIPs without any modification effectively enter nuclei, I predicted that the number of arginine residues in PIPs could be reduced while efficient nuclear delivery was retained. In this chapter, PIPs were conjugated with tri-arginine peptides and their cellular permeability and bioactivity were evaluated.

4.2 Results 4.2.1 Improved Nuclear Delivery of PIP–Tri-Arginine Conjugates To test my hypothesis that a tri-arginine vector enhanced cellular uptake of PIPs, a PIP targeting a SOX2-binding sequence (SOX2i) was conjugated with tri-arginine (SOX2i-R3) (Fig. 4.1). D-Arginine was used to provide resistance to proteolytic degradation and improve stability in cells [14]. SOX2i has been reported to repress the expression of SOX2 downstream genes, including SOX2 itself, by inhibiting the DNA binding of SOX2 in induced pluripotent stem (iPS) cells and human prostate and ovarian cancer cells [11, 15]. Therefore, the cellular uptake and bioactivity of SOX2i and SOX2i-R3 were investigated to reveal the effect of the tri-arginine moiety. First, flow cytometry was performed using fluorescently labeled compounds (Fig. 4.1, SOX2i-TAMRA, and SOX2i-R3-TAMRA) to evaluate their cellular uptake efficiency (Fig. 4.2). HeLa cells were treated with each compound at a concentration of 5 μM for 24 h and subjected to flow cytometry assay after trypsinization and phosphate-buffered saline (PBS) wash. The resultant data clearly demonstrate that SOX2i-R3-TAMRA was taken up by the cells more efficiently than SOX2iTAMRA, indicating that the introduction of three arginine residues is sufficient to enhance the cellular uptake of SOX2i. The intracellular distribution was also examined using fluorescence imaging of living cells (Fig. 4.3). While almost no signal was observed with SOX2i-TAMRA, SOX2i-R3-TAMRA produced strong signals within cells. SOX2i-R3-TAMRA mainly accumulated into nuclei and cytosolic vesicles, which are predicted to be

70

4 Enhanced Nuclear Accumulation of Pyrrole-Imidazole Polyamides …

Fig. 4.1 Chemical structure of pyrrole-imidazole polyamides (PIPs) used in this study. Pyrrole and imidazole rings are indicated in blue and red, respectively. Schematic illustrations of DNA sequence recognition by PIPs conjugated with tri-arginine are also shown (W = A or T)

endosomes and lysosomes. Together with the results from the flow cytometry assay, these data indicate that the tri-arginine moiety enhances cellular uptake and nuclear accumulation of PIPs.

4.2 Results

71

Fig. 4.2 Flow cytometry analysis to evaluate cellular uptake of SOX2i-TAMRA and SOX2i-R3TAMRA. HeLa cells were treated with each compound at a concentration of 5 μM and the signal intensity of TAMRA from individual cells was measured

Fig. 4.3 Fluorescence imaging of HeLa cells treated with SOX2i-TAMRA or SOX2i-R3-TAMRA for 24 h. Nuclear DNA was stained with 1 mg/mL Hoechst 33342. Scale bars represent 50 μm

72

4 Enhanced Nuclear Accumulation of Pyrrole-Imidazole Polyamides …

4.2.2 Sequence-Selective DNA Binding of PIP–Tri-Arginine Conjugates Although the introduction of tri-arginine produced promising results in terms of compound delivery, a possible reduction in sequence selectivity due to non-selective interactions between the peptide and DNA remained a concern. Therefore, to reveal the effect of tri-arginine on the sequence selectivity of PIPs, a PIP–tri-arginine conjugate targeting a different sequence other than SOX2i was synthesized (Fig. 4.1, Ctrl-R3) and its DNA binding was examined using electrophoretic mobility shift assay (Fig. 4.4). Two dsDNAs were prepared: 5 -d(CCGCATAACAAAGTGCC)-3 (SOX2-DNA) and 5 -d(CCTCAGCCGCCTTCC)-3 (Ctrl-DNA), and each dsDNA contained one binding site of SOX2i-R3 and Ctrl-R3, respectively (binding sites are underlined). A/T base pairs were placed at the 5 end of the binding sites because γ-diaminobutyric acid turn units are known to have A/T and T/A selectivity [16]. dsDNA (1 μM) was incubated with each compound (1 μM) and unbound and bound DNA was separated using polyacrylamide gel. In the case of SOX2i, a complete band shift of SOX2-DNA was observed, while no binding to Ctrl-DNA occurred. Similar selective binding was also observed with SOX2i-R3, but some free SOX2-DNA remained. It is expected that the tri-arginine moiety would cause steric hindrance when SOX2i-R3 bound to DNA and reduce binding affinity. In contrast to SOX2iR3, Ctrl-R3 only bound to Ctrl-DNA and not to SOX2-DNA and this is consistent with the designed target sequence of the PIP moiety of Ctrl-R3. This result indicates that the tri-arginine moiety has limited interaction with dsDNA and does not compromise the sequence selectivity of PIPs.

Fig. 4.4 Electrophoretic mobility shift assay of SOX2i, SOX2i-R3, and Ctrl-R3. Two dsDNAs containing each binding sequence were used (binding sites are underlined): 5 CCGCATAACAAAGTGCC-3 (SOX2-DNA, represented as “S”) and 5 -CCTCAGCCGCCTTCC3 (Ctrl-DNA, represented as “C”). Shifted bands of PIP-DNA complexes are indicated with black arrowheads

4.2 Results

73

4.2.3 Transcriptional Control of Endogenous Genes by PIP–Tri-Arginine Conjugates To test the bioactivity of SOX2i-R3, I investigated the effect of SOX2i-R3 on endogenous gene expression. 201B7 cells were treated with each compound for 48 h and the level of SOX2 RNA expression was quantified (Fig. 4.5). Interestingly, while 2 μM SOX2i was required to down-regulate SOX2 expression by 60%, only 100 nM SOX2i-R3 was sufficient to achieve comparable repression. Furthermore, almost no SOX2 expression was observed when the cells were treated with >1 μM SOX2i-R3 (Fig. 4.5a). It is important to note that Ctrl-R3 had no effect on SOX2 expression, which supports the sequence-specific transcription control by SOX2i-R3 (Fig. 4.5b).

Fig. 4.5 Relative RNA expression level of SOX2 downstream genes in 201B7 cells treated with SOX2i, SOX2i-R3, and Ctrl-R3 for 48 h. Mean values calculated from three culture wells are indicated as a bar chart. Each value is normalized to the control samples. HPRT1 was used in a and c and 18S were used in b as housekeeping genes. Error bars represent ±SD (n = 3)

74

4 Enhanced Nuclear Accumulation of Pyrrole-Imidazole Polyamides …

Fig. 4.6 a Design of AP2i and AP2i-R3 targeting AP2 binding sequence in HER2 promoter region (chemical structures are shown in Fig. S4.1). b Schematic illustration of HER2 repression by AP2iR3. c Relative expression level of HER2 in SKBR-3 cells treated AP2i and AP2i-R3 for 48 h. Mean values calculated from three culture wells are shown and each value is normalized to the control samples. ACTB was used as housekeeping gene. Error bars represent ±SD (n = 3)

Expression levels of other genes controlled by SOX2 (Nanog and FBXO15) were also examined, and both genes were also repressed by SOX2i-R3 more efficiently than SOX2i (Fig. 4.5c). This result suggests that the enhanced nuclear accumulation of SOX2i-R3 also improved the bioactivity in living cells. To check whether the tri-arginine vector can be widely applied to other PIPs, I synthesized 12-ring PIPs with and without the tri-arginine moiety targeting the AP-2 binding sequence in the HER2 promoter region (AP2i-R3 and AP2i, respectively) to repress HER2 transcription (Fig. 4.6a, b). AP-2 is a transcription factor known to cause overexpression of the HER2 gene in breast cancer [17, 18]. Although in vitro transcription repression of HER2 by PIPs was previously reported [19], several papers mention that insufficient nuclear delivery of PIPs hampers their application to live cells [6, 7]. To check whether the tri-arginine vector can overcome this barrier, SKBR3 (HER2-positive breast cancer cell line) cells were treated with each compound and the relative expression level of HER2 was calculated (Fig. 4.6c). While no significant repression was observed in AP2i-treated samples, AP2i-R3 showed dose-dependent repression of HER2 expression. This result supports the generality of the tri-arginine vector and suggests that genes that have been difficult to control with PIPs in live cells can be targeted by using the tri-arginine vector.

4.3 Discussion In summary, I successfully enhanced the cellular uptake and nuclear accumulation of SOX2i by introducing three arginine residues. Previously, octa-arginine was reported to enhance nuclear uptake and DNA binding of tri-pyrrole, but its sequence selectivity was limited to short (3–5 bp) AT-rich sequences [20]. Although conjugation

4.3 Discussion

75

of various cell-penetrating peptides including TAT peptide and nona-arginine with eight-ring PIPs has also been attempted, quantitative analysis of cellular uptake and transcription control using these conjugates has not been described previously [21]. In the current study, I demonstrated that tri-arginine can be used as a peptide vector for the efficient nuclear delivery of long PIPs containing 12 pyrrole/imidazole rings and β-alanine residues, which significantly reduce the concentration of PIPs required for transcription control. Although tri-arginine is a promising vector for the delivery of PIPs, several problems need to be addressed in future studies. First, compared to SOX2i, SOX2i-R3 had a lower affinity for DNA, which is probably due to steric hindrance between DNA and the tri-arginine moiety. In this study, short β-alanine was used as a linker between PIP and the tri-arginine moiety, so further optimization using longer linkers is required to maximize the binding capability of PIP–tri-arginine conjugates. Second, live cell imaging revealed that a detectable amount of SOX2i-R3-TAMRA remained in the cytoplasmic vesicles, which reduced the amount of compound delivered into cell nuclei. Entrapment of exogenous molecules in vesicles like endosomes and lysosomes is a common problem faced in drug delivery, and there are several studies that have achieved efficient endosomal escape by modifying peptide sequences and structures [22, 23]. Similar approaches can be applied to PIP-peptide conjugates to achieve nuclear accumulation with higher efficiency. Lastly, although multiple pathways are proposed to be associated with the cellular penetration of arginine-rich peptides, the precise mechanisms for the cellular uptake of PIP–tri-arginine conjugates are still to be elucidated fully. For example, electrostatic interactions between arginine and negatively charged proteoglycan, and formation of hydrogen bonds between guanidino groups of peptides and sulfates of cellular components, are suggested to be important for efficient membrane translocation, by increasing the local concentration of peptides near the cell membrane [24]. This interaction between arginine peptides and membraneassociated proteoglycan was also reported to activate the signaling pathway mediated by the Rac protein and induce actin organization and micropinocytosis [25]. In addition to this endocytotic pathway, arginine peptides are expected to utilize other pathways, because the peptides are internalized by cells even at 4 °C, where energydependent endocytosis is suppressed [26]. Further investigations based on these studies should reveal the detailed mechanism of cellular uptake of PIP–tri-arginine conjugates and lead to the development of better vectors for PIPs. Although further studies are required to solve these problems, tri-arginine vectors can be readily incorporated into PIPs, because PIPs are commonly synthesized using Fmoc solid-phase synthesis [27]. This simple vector can expand the application of PIPs in living cells by overcoming the inability of some PIPs, especially long PIPs, to penetrate cell membranes. Therefore, PIP-tri-arginine conjugates should become powerful chemical tools to target specific genomic regions more selectively than short PIPs and control cellular function based on DNA sequence information.

76

4 Enhanced Nuclear Accumulation of Pyrrole-Imidazole Polyamides …

4.4 Materials and Methods 4.4.1 General Information of Synthesis The reagents were purchased from standard suppliers. The solid-phase synthesis was performed using an automated synthesizer PSSM-8 (Shimadzu) with a computerassisted operation system. Analytical reversed-phase high performance liquid chromatography (HPLC) was performed on a JASCO HPLC system (JASCO Engineering UV2075 UV/vis detector and a PU-2089 plus gradient pump) equipped with Chemcobond 5-ODS-H reversed-phase column (4.6 × 150 mm). H2 O (+0.1% trifluoroacetic acid) and acetonitrile were used as the mobile phase and the program was a linear gradient of 0–100% acetonitrile in 40 min at a flow rate of 1.0 mL/min. Absorbance at 254 nm was monitored. MALDI-TOF mass spectroscopy was performed with the microflex system (Bruker).

4.4.2 Synthesis of SOX2i-R3, SOX2i, Ctrl-R3, AP2i-R3, and AP2i Synthetic scheme of SOX2i-R3 is shown in Fig. 4.7. Each Fmoc monomer unit (Fmoc-D-Arg(Pbf)-OH, Fmoc-β-alanine-OH, Fmoc-GABA-OH, Fmoc-Py-OH, and Fmoc-Im-OH) was introduced sequentially to Fmoc-D-Arg(Pbf)-Alko resin for synthesis of SOX2i-R3, Ctrl-R3, and AP2i-R3, and to PyIm-coupled clear resin or Im-coupled oxime resin for synthesis of SOX2i and AP2i, respectively. To overcome the difficulty of coupling Py after Im, Fmoc-PyIm-OH dimer unit was also used in the synthesis of SOX2i-R3 to improve synthesis efficiency [28, 29]. Each coupling reaction was performed at room temperature for one hour in N-methyl-2pyrrolidone (NMP) containing 4 eq of HCTU, N, N-diisopropylethylamine (DIEA), and each Fmoc monomer unit, followed by Fmoc deprotection in 20% piperidine in N, N-dimethylformamide (DMF). N-terminal was capped with acetyl group by mixing with 20% acetic anhydride in DMF. Synthesized compounds were cleaved with N, Ndimethylaminopropylamine at 55 °C for 3 h. The reaction solution was drained into ether and the resulting solid was dried in vacuo. Protecting group of arginine residues (Pbf group) of SOX2i-R3, Ctrl-R3, and AP2i-R3 were removed with deprotection cocktail (trifluoroacetic acid: triisopropylsilane: water (95:2.5:2.5 v/v%)) at room temperature for 30 min. The crude sample was purified by reversed-phase HPLC using a JASCO HPLC system (JASCO Engineering UV2075 UV/vis detector and a PU-2089 plus gradient pump) with a preparative C18 (ODS) column (COSMOSIL 5C18-MS-II, 10ID × 150 mm). H2 O (+0.1% trifluoroacetic acid) and acetonitrile were used as the mobile phase. HPLC and MALDI-TOF mass spectroscopy was performed for the characterization of the purified compounds.

4.4 Materials and Methods

Fig. 4.7 Synthetic scheme of SOX2i-R3

77

78

4 Enhanced Nuclear Accumulation of Pyrrole-Imidazole Polyamides …

4.4.3 Synthesis of SOX2i-R3-TAMRA and SOX2i-TAMRA Synthetic scheme of SOX2i-R3-TAMRA is shown in Fig. 4.8. After the solidphase synthesis, the compounds were cleaved from the resin with 3, 3 -diamino-Nmethyldipropylamine at 55 °C for 3 h. The crude samples were purified by reversedphase column chromatography using the CombiFlash Rf system equipped with a 4.3 g C18 RediSep Rf reversed-phase flash column (Teledyne Isco, Inc). H2 O (+0.1% trifluoroacetic acid) and acetonitrile were used as the mobile phase. The coupling reaction was performed by adding 1.3 eq of 5-TAMRA-NHS ester and 3 eq of DIEA in DMF and shaking at room temperature overnight. Powderization, deprotection, purification, and characterization were performed as described above.

Fig. 4.8 Synthetic scheme of SOX2i-R3-TAMRA

4.4 Materials and Methods

79

4.4.4 Cell Culture HeLa (JCRB9004) and 201B7 cells were provided by JCRB Cell Bank (Japan) and the RIKEN BRC (Japan) respectively. SKBR-3 cells were purchased from ATCC. All cells were maintained in a humidified CO2 incubator at 37 °C. HeLa cells were maintained in Dulbecco’s Modified Eagle Medium (ThermoFisher Scientific) supplemented with 10% fetal bovine serum (Sigma) and 1% MEM Non-Essential Amino Acids Solution (ThermoFisher Scientific). 201B7 iPS cells were cultured on Matrigel Matrix (hESC-qualified, Corning) in mTeSR1 medium (Stemcell Technologies) supplemented with 0.5× penicillin/streptomycin (Nacalai Tesque). Cells were passaged using TrypLE Express Enzyme (no phenol red, ThermoFisher Scientific) as dissociation reagent and seeded in medium supplemented with 2.5 μM of Y-27632 (Wako). Medium change with fresh medium (without Y-27632) was performed every day from the next day of the passaging. SKBR-3 cells were maintained in McCoy’s 5A Medium (ThermoFisher Scientific) supplemented with 10% fetal bovine serum (Sigma).

4.4.5 Live Cell Imaging Exponentially growing HeLa cells were trypsinized and seeded on 8-well ibi-treat μ-slides (ibidi) at the density of 1.5 × 104 cells/well one day prior to the treatment. DMSO solution of SOX2i-R3-TAMRA and SOX2i-TAMRA was prepared and the concentration was determined using an extinction coefficient of 91,000 M−1 cm−1 at λmax near 565 nm. The medium was changed with OPTI-MEM (ThermoFisher Scientific) containing 2% FBS (Sigma) and 5 μM of each compound (DMSO: 0.5%) and cells were treated for 24 h. After the treatment, the culture medium was removed and FluoroBrite DMEM (ThermoFisher Scientific) supplemented with 10% FBS (Sigma) and Hoechst 33342 (1 μg/mL) was added and incubated for 10 min. Cells were washed twice with FluoroBrite DMEM and imaged by the FV1200 Laser Scanning Microscope (Olympus). The same imaging conditions were adopted for all samples. Image analysis was performed using FV10-ASW (Olympus).

4.4.6 Flow Cytometry Analysis Exponentially growing HeLa cells were trypsinized and seeded on a 12-well plate (NIPPON Genetics) at the concentration of 5 × 104 cells/well one day prior to the treatment. The medium was changed with OPTI-MEM (ThermoFisher Scientific) containing 2% FBS (Sigma) and 5 μM of each compound (DMSO: 0.5%) and the treatment was performed for 24 h. After the treatment, the cells were detached from the plate by trypsinization and subjected to D-PBS wash twice. The washed cells

80

4 Enhanced Nuclear Accumulation of Pyrrole-Imidazole Polyamides …

Fig. 4.9 FSC/SSC plot and the gate setting to remove debris and electrical noise in the flow cytometry analysis

were resuspended in D-PBS. Samples were analyzed using a BD FACS AriaII (BD Biosciences) after removal of cell clumps using polystyrene tubes with cell strainer caps (Corning). 20,000 events were recorded for each sample, and FSC (Forward Scatter)/SSC (Side Scatter) plot was used for population gating to remove data points obtained from debris and electrical noise (Fig. 4.9). After the selection, signal intensity of TAMRA of 13,082 events of the negative control sample, 12,330 events of the SOX2i-R3-TAMRA treated sample, and 13,834 events of the SOX2i-TAMRA treated sample were plotted in the histogram.

4.4.7 Preparation of DMSO Solution of SOX2i-R3, SOX2i, Ctrl-R3, AP2i-R3, and AP2i The powder of each compound was dissolved in DMSO, and the concentration was determined from the calculation formula below using the maximum absorbance in 300–310 nm measured by a Nanodrop ND-1000 (ThermoFisher Scientific): c=

Abs (M) 9900 × a × d

a: total number of pyrrole and imidazole rings, d (cm): optical path length (0.1 cm for Nanodrop ND-1000), Abs = Maximum absorbance in 300–310 nm.

4.4 Materials and Methods

81

4.4.8 Electrophoretic Mobility Shift Assay Each template DNA (1 μM) was mixed with 1 μM of SOX2i-R3, SOX2i, or Ctrl-R3 in aqueous buffer containing 10 mM sodium chloride, 10 mM sodium cacodylate, and 2.5 v/v% DMSO at pH 7.0. Before electrophoresis samples were annealed by heating to 95 °C for 3 min and cooled to 25 °C at speed of −0.5 °C/5 s. 8 μL of each sample was mixed with 2 μL of Novex Hi-Density TBE Sample Buffer (ThermoFisher Scientific) and 1 μL of each loading mixture was loaded. NativePAGE was performed with 20% polyacrylamide gel at 200 V for 60 min in TBE buffer. The gel was stained with SYBR Gold (ThermoFisher Scientific) and imaged with the FLA-3000 system (Fujifilm).

4.4.9 Quantitative Reverse-Transcription PCR (RT-qPCR) Analysis of 201B7 Cells 201B7 iPS cells were seeded on a Matrigel-coated 24-well plate (Greiner) in mTeSR1 medium supplemented with 2.5 μM of Y-27632 at the concentration of 6 × 104 cells/well one day prior to the treatment. The medium was replaced with differentiation medium (Advanced RPMI 1640 (ThermoFisher Scientific) supplemented with 0.2% FBS and 1× L-glutamine) containing each compound and 0.1% DMSO. 48 h later, total RNA was extracted from each well using FastGene RNA Basic Kit (NIPPON Genetics), and reverse transcription was performed from 500 ng of total RNA using ReverTra Ace qPCR RT Master Mix with gDNA Remover (Toyobo) following the manufacturer’s instructions. Reaction mixture was prepared with Thunderbird SYBR qPCR mix (Toyobo) and qPCR reaction was performed and monitored on LightCycler 480 System II (Roche). The relative expression level of each gene was calculated from the average Cp value of three replicates of each sample and normalized to the mean value of negative control samples. The primer pairs used in this experiment are listed in Table 4.1.

4.4.10 Quantitative Reverse-Transcription PCR (RT-qPCR) Analysis of SKBR-3 Cells SKBR-3 cells were seeded on a 12-well plate (Greiner) in growth medium at the concentration of 1 × 105 cells/well one day prior to the treatment. The medium was replaced with fresh growth medium containing each compound and 0.1% DMSO and the cells were treated for 48 h. The successive RNA extraction, reverse transcription, and qPCR were performed as explained above.

Sequence 5 -GGCGAACCTCTCGGCTTTC 5 -TCATCACTAATCACGACGCCA 5 -GGGAAATGGGAGGGGTGCAAAAGAGG 5 -TTGCGTGAGTGTGGATGGGATTGGTG 5 -AAACGGCTACCACATCCAAG 5 -CCTCCAATGGATCCTCGTTA 5 -AATACCTCAGCCTCCAGCAGATG 5 -TGCGTCACACCATTGCTATTCTTC 5 -TGGCTGTGACAGACTCATTCGG 5 -GATAGTAGCCGAGCCTAATGTGC 5 -GAGCACCCAAGTGTGCAC 5 -TTGGTTGTGAGCGATGAG 5 -CAATGTGGCCGAGGACTTTG 5 -CATTCTCCTTAGAGAGAAGTGG

Primer

HPRT1 forward

HPRT1 reverse

SOX2 forward

SOX2 reverse

18S forward

18S reverse

Nanog forward

Nanog reverse

FBXO15 forward

FBXO15 reverse

HER2 forward

HER2 reverse

ACTB forward

ACTB reverse

Table 4.1 The primer list for qPCR experiments

82 4 Enhanced Nuclear Accumulation of Pyrrole-Imidazole Polyamides …

4.5 Characterization Data of Synthesized Compounds

4.5 Characterization Data of Synthesized Compounds

83

84

4 Enhanced Nuclear Accumulation of Pyrrole-Imidazole Polyamides …

4.5 Characterization Data of Synthesized Compounds

85

86

4 Enhanced Nuclear Accumulation of Pyrrole-Imidazole Polyamides …

4.5 Characterization Data of Synthesized Compounds

87

88

4 Enhanced Nuclear Accumulation of Pyrrole-Imidazole Polyamides …

4.5 Characterization Data of Synthesized Compounds

89

90

4 Enhanced Nuclear Accumulation of Pyrrole-Imidazole Polyamides …

References 1. Mrksich M, Parks ME, Dervan PB (1994) Hairpin peptide motif. A new class of oligopeptides for sequence-specific recognition in the minor groove of double-helical DNA. J Am Chem Soc 116:7983–7988 2. Trauger JW, Baird EE, Dervan PB (1996) Recognition of DNA by designed ligands at subnanomolar concentrations. Nature 382:559–561 3. Syed J et al (2014) Targeted suppression of EVI1 oncogene expression by sequence-specific pyrrole-imidazole polyamide. Chem Biol 21:1370–1380 4. Han L et al (2015) A synthetic DNA-binding domain guides distinct chromatin-modifying small molecules to activate an identical gene network. Angew Chem Int Ed 54:8700–8703 5. Lai YM et al (2005) Synthetic pyrrole-imidazole polyamide inhibits expression of the human transforming growth factor-beta1 gene. J Pharmacol Exp Ther 315:571–575 6. Belitsky JM, Leslie SJ, Arora PS, Beerman TA, Dervan PB (2002) Cellular uptake of Nmethylpyrrole/N-methylimidazole polyamide-dye conjugates. Bioorg Med Chem 10:3313– 3318 7. Best TP, Edelson BS, Nickols NG, Dervan PB (2003) Nuclear localization of pyrrole–imidazole polyamide–fluorescein conjugates in cell culture. Proc Natl Acad Sci USA 100:12063–12068 8. Edelson BS et al (2004) Influence of structural variation on nuclear localization of DNA-binding polyamide-fluorophore conjugates. Nucleic Acids Res 32:2802–2818 9. Nishijima S et al (2010) Cell permeability of Py-Im-polyamide-fluorescein conjugates: influence of molecular size and Py/Im content. Bioorg Med Chem 18:978–983 10. Watanabe T et al (2016) Double β-alanine substitutions incorporated in 12-ring pyrroleimidazole polyamides for lengthened DNA minor groove recognition. Adv Tech Biol Med 04:175 11. Taniguchi J et al (2017) A synthetic DNA-binding inhibitor of SOX2 guides human induced pluripotent stem cells to differentiate into mesoderm. Nucleic Acids Res 45:9219–9228 12. Meier JL, Montgomery DC, Dervan PB (2012) Enhancing the cellular uptake of Py-Im polyamides through next-generation aryl turns. Nucleic Acids Res 40:2345–2356 13. Futaki S et al (2001) Arginine-rich peptides. An abundant source of membrane-permeable peptides having potential as carriers for intracellular protein delivery. J Biol Chem 276:5836– 5840 14. Najjar K, Erazo-Oliveras A, Brock DJ, Wang TY, Pellois JP (2017) An l- to d-amino acid conversion in an endosomolytic analog of the cell-penetrating peptide TAT influences proteolytic stability, endocytic uptake, and endosomal escape. J Biol Chem 292:847–861 15. Malinee M et al (2020) Targeted suppression of metastasis regulatory transcription factor SOX2 in various cancer cell lines using a sequence-specific designer pyrrole-imidazole polyamide. Bioorg Med Chem 28:115248 16. Swalley SE, Baird EE, Dervan PB (1999) Effects of γ-turn and β-tail amino acids on sequencespecific recognition of DNA by hairpin polyamides. J Am Chem Soc 121:1113–1120 17. Hollywood DP, Hurst HC (1993) A novel transcription factor, OB2-1, is required for overexpression of the proto-oncogene c-erbB-2 in mammary tumour lines. EMBO J 12:2369–2375 18. Bosher JM, Williams T, Hurst HC (1995) The developmentally regulated transcription factor AP-2 is involved in c-erbB-2 overexpression in human mammary carcinoma. Proc Natl Acad Sci USA 92:744–747 19. Chiang SY et al (2000) Targeting the Ets binding site of the HER2/neu promoter with pyrroleimidazole polyamides. J Biol Chem 275:24246–24254 20. Vazquez O et al (2008) Efficient DNA binding and nuclear uptake by distamycin derivatives conjugated to octa-arginine sequences. ChemBioChem 9:2822–2829 21. Best TP (2005) Localization of DNA-binding polyamides in living cells. Dissertation (Ph.D.), California Institute of Technology. https://doi.org/10.7907/MQ0D-8P65 22. Qian Z et al (2013) Efficient delivery of cyclic peptides into mammalian cells with short sequence motifs. ACS Chem Biol 8:423–431

References

91

23. Meng Z et al (2017) Histidine-enriched multifunctional peptide vectors with enhanced cellular uptake and endosomal escape for gene delivery. J Mater Chem B 5:74–84 24. Rothbard JB, Jessop TC, Lewis RS, Murray BA, Wender PA (2004) Role of membrane potential and hydrogen bonding in the mechanism of translocation of guanidinium-rich peptides into cells. J Am Chem Soc 126:9506–9507 25. Nakase I et al (2007) Interaction of arginine-rich peptides with membrane-associated proteoglycans is crucial for induction of actin organization and macropinocytosis. Biochemistry 46:492–501 26. Nakase I et al (2004) Cellular uptake of arginine-rich peptides: roles for macropinocytosis and actin rearrangement. Mol Ther 10:1011–1022 27. Wurtz NR, Turner JM, Baird EE, Dervan PB (2001) Fmoc solid phase synthesis of polyamides containing pyrrole and imidazole amino acids. Org Lett 3:1201–1203 28. Baird EE, Dervan PB (1996) Solid phase synthesis of polyamides containing imidazole and pyrrole amino acids. J Am Chem Soc 118:6141–6146 29. Minoshima M, Bando T, Sasaki S, Fujimoto J, Sugiyama H (2008) Pyrrole-imidazole hairpin polyamides with high affinity at 5 -CGCG-3 DNA sequence; influence of cytosine methylation on binding. Nucleic Acids Res 36:2889–2894

Curriculum Vitae

Dr. Takuya Hidaka Department of Chemistry, Graduate School of Science, Kyoto University, Kyoto, Japan Current affiliation RIKEN Center for Biosystems Dynamics Research, Osaka, Japan Education • Ph.D. in Graduate School of Science, Kyoto University (Apr. 2018–Mar. 2021) (supervisor: Prof. Hiroshi Sugiyama) • M.Sc. in Graduate School of Science, Kyoto University (Apr. 2016–Mar. 2018) (supervisor: Prof. Hiroshi Sugiyama) • B.Sc. in Faculty of Science, Kyoto University (Apr. 2012–Mar. 2016) Academic Appointments • Research Fellow (PD) of Japan Society for the Promotion of Science (Apr. 2021–present) © Springer Nature Singapore Pte Ltd. 2022 T. Hidaka, Sequence-Specific DNA Binders for the Therapy of Mitochondrial Diseases, Springer Theses, https://doi.org/10.1007/978-981-16-8436-4

93

94

Curriculum Vitae

• Visiting Researcher, Institute for Advanced Study, Kyoto University (Apr. 2021–present) • Visiting Researcher, RIKEN Center for Biosystems Dynamics Research (Apr. 2021–present) • Research Fellow (DC1) of Japan Society for the Promotion of Science (Apr. 2018–Mar. 2021) Awards and Honors • Awarded with Young Researchers’ Exchange Programme between Japan and Switzerland (Feb. 2020–Mar. 2020) • Won the CSJ student oral presentation award in the 99th Annual Conference of Chemical Society of Japan (Mar. 2019) • Awarded with Overseas Challenge Program for Young Researchers, Japan Society for the Promotion of Science (Sep. 2018–Nov. 2018) • Won the excellent poster award in the 39th Annual Meeting of the Molecular Biology Society of Japan (Dec. 2016)