Recombinant DNA technology and genetic engineering 9780071077798, 0071077790, 9781259006555, 1259006557

Table of contents :
Cover
Contents
1. Introduction to Gene Cloning
Introduction to Gene Cloning and Genetic Engineering
What is Gene Cloning?
Gene Cloning and PCR
2. Salient Features of Cloning Vectors
Essential Components of Gene Cloning
Conjugative and Nonconjugative Plasmids
Commercially Available Plasmids
Cosmids
Preparation of Genomic DNA Libraries in Cosmid Vectors
ssDNA Phages
Filamentous Phage
Phagemid Vectors
Yeast Cloning Vectors
Cloning Vectors for Higher Organisms
Direct Transfer or Integration Vectors
3. Plasmid Biology
Structural and Functional Organisation of Plasmids
Characteristics of Plasmids
Plasmid Replication
Plasmids Carrying Conjugation or Fertility Factors
Different Types of Plasmids
4. Enzymes Used in Genetic Engineering
Introduction
DNA Polymerase
Reverse Transcriptase
Terminal Deoxynucleotidyl Transferase
RNA Polymerases
Addition of Phosphate Group/Kinasing
Dephosphorelation by Alkaline Phosphatase
Ligases
Restriction Endonuclease I and II
Nick Translation
Probe Synthesis from Phagemid
5. Isolation of Genomic and Nuclear DNA
Introduction
DNA Sequencing–To Understand the Structure of a Gene
Sequencing Gel
PCR Product Sequencing
6. Cloning and Subcloning Strategy
Construction of Recombinant DNA
Diagrammatic Representation of Different Cloning Technologies
Preparation of Competent Cell-Transformation, Transfection
Insertional Inactivation (The Other Way of Screening the Clones)
Transformation of Double-Stranded DNA
Recombinant Selection and Screening
Essential Tools Required for Cloning/Subcloning
7. Selection of rDNA Clones and Their Expression Products
Introduction
Selection
Analysis of cDNA Library
Preparation of Polyclonal Antibody
ELISA (Enzyme Linked Immunosorbent Assay)
Western Blotting
SDS – PAGE
Hybridisation
Basic Mechanism of Hybridisation
8. DNA Technology
Mutagenesis
Oligonucleotide-based Mutagenesis
PCR-based Site Directed Mutagenesis
Polymerase Chain Reaction (PCR)
Applications of rDNA Technology in Diagnostics
rDNA Technology and Forensics
DNA Fingerprinting for Sex Determination
9. The Application of Gene Cloning and DNA Analysis
Production of Protein from Cloned Genes
Cloning and Expression Vectors for System
E. Coli Promoters for Gene Expression and Protein Production
Recombinant Protein Production in : General Problems
Eukaryotes for Protein Expression and Production
Recombinant Protein Production in Pichia Pastoris, Saccharomyces Cerevisiae and Kluveromyces Lactis
Filamentous Fungi for Protein Expression and Production
Gene Cloning and DNA Analysis in Medicine
Eukaryotic Gene Synthesis and Expression in
Synthesis, Cloning and Expression of other Recombinant Proteins with Therapeutic Importance
Gene Therapy
Gene Subtraction/Antisense Technology
Glossary
Index

Citation preview

Recombinant DNA Technology and Genetic Engineering

About the Author Dr K Rajagopal is currently working as Principal Scientist with the Institute of Microbial Technology (CSIR), Chandigarh. He obtained his BSc degree from Regional College of Education, Mysore (NCERT) and MSc degree from Central University, Hyderabad. In addition, Dr Rajagopal obtained his PhD from IMTECH, Chandigarh, and Postdoctoral degree from National Research Council (NRC), Ottawa, Canada. been the recombinant clot-bursting enzyme, streptokinase, for the treatment of heart attacks. He is presently working on Probiotics research for the development of microbial strains as food supplements. bestowed with the prestigious fellowships of Canadian, German, and Korean Governments for carrying out amongst school students and the present textbook is one of the steps in that direction.

Recombinant DNA Technology and Genetic Engineering

K Rajagopal Principal Scientist Institute of Microbial Technology (CSIR) Chandigarh

Tata McGraw Hill Education Private Limited NEW DELHI

New Delhi New York St Louis San Francisco Auckland Bogotá Caracas Kuala Lumpur Lisbon London Madrid Mexico City Milan Montreal San Juan Santiago Singapore Sydney Tokyo Toronto

Published by Tata McGraw Hill Education Private Limited, 7 West Patel Nagar, New Delhi 110 008 Recombinant DNA Technology and Genetic Engineering Copyright © 2012 by Tata McGraw Hill Education Private Limited. No part of this publication may be reproduced or distributed in any form or by any means, electronic, mechanical, photocopying, recording, or otherwise or stored in a database or retrieval system without the prior written permission of the publishers. The program listings (if any) may be entered, stored and executed in a computer system, but they may not be reproduced for publication. This edition can be exported from India only by the publishers, Tata McGraw Hill Education Private Limited. ISBN (13): 978-0-07-107779-8 ISBN (10): 0-07-107779-0 Vice President and Managing Director: Ajay Shukla Head—Higher Education Publishing and Marketing: Vibha Mahajan Publishing Manager—SEM & Tech Ed.: Shalini Jha Editorial Executive: Smruti Snigdha Development Editor: Renu Upadhyay Copy Editor: Preyoshi Kundu Sr Production Manager: Satinder S Baveja Proof Reader: Yukti Sharma Marketing Manager—Higher Ed.: Vijay Sarathi Product Specialist—SEM & Tech Ed.: Sachin Tripathi Graphic Designer–Cover: Meenu Raghav General Manager—Production: Rajender P Ghansela Production Manager: Reji Kumar Information contained in this work has been obtained by Tata McGraw-Hill, from sources believed to be reliable. However, neither Tata McGraw-Hill nor its authors guarantee the accuracy or completeness of any information published herein, and neither Tata McGraw-Hill nor its authors shall be responsible for any errors, omissions, or damages arising out of use of this information. This work is published with the understanding that Tata McGraw-Hill and its authors are supplying information but are not attempting to render engineering or other professional services. If such services are required, the assistance of an appropriate professional should be sought. Typeset at Script Makers, 19, A1-B, DDA Market, Paschim Vihar, New Delhi 110 063 and printed at

Cover printed at:

This book is dedicated to my parents Late Sri K Ramalingappa and Late Smt. Sarada

360° Development Program

Table of content survey amongst the expert panel of reviewers Two rounds of manuscript reviews amongst the expert panel of reviewers

First round of copyediting to check inconsistency in writing style

panel of editors First round of proofreading

All-round check by the internal panel of editors

Special Thoughts by the Author

as a guiding tool in explaining the concepts, the various methods and procedures but also supports

as a book,

K RAJAGOPAL

CONTENTS

Abbreviations

1. Introduction to Gene Cloning Introduction to Gene Cloning and Genetic Engineering What is Gene Cloning? Gene Cloning and PCR

2. Salient Features of Cloning Vectors Essential Components of Gene Cloning Conjugative and Nonconjugative Plasmids Commercially Available Plasmids Cosmids Preparation of Genomic DNA Libraries in Cosmid Vectors ssDNA Phages Filamentous Phage Phagemid Vectors Yeast Cloning Vectors Cloning Vectors for Higher Organisms Direct Transfer or Integration Vectors

3. Plasmid Biology Structural and Functional Organisation of Plasmids Characteristics of Plasmids Plasmid Replication Plasmids Carrying Conjugation or Fertility Factors Different Types of Plasmids

xvii

1 1 1 3

10 10 13 14 18 9 21 2 23 26 28 29 33 42

47 47 47 48 50 51

x

Contents

4. Enzymes Used in Genetic Engineering Introduction DNA Polymerase Reverse Transcriptase Terminal Deoxynucleotidyl Transferase RNA Polymerases Addition of Phosphate Group/Kinasing Dephosphorelation by Alkaline Phosphatase Ligases Restriction Endonuclease I and II Nick Translation Probe Synthesis from Phagemid

5. Isolation of Genomic and Nuclear DNA Introduction DNA Sequencing–To Understand the Structure of a Gene Sequencing Gel PCR Product Sequencing

6. Cloning and Subcloning Strategy Construction of Recombinant DNA Diagrammatic Representation of Different Cloning Technologies Preparation of Competent Cell-Transformation, Transfection Insertional Inactivation (The Other Way of Screening the Clones) Transformation of Double-Stranded DNA Recombinant Selection and Screening Essential Tools Required for Cloning/Subcloning

7. Selection of rDNA Clones and Their Expression Products Introduction Selection Analysis of cDNA Library

Preparation of Polyclonal Antibody ELISA (Enzyme Linked Immunosorbent Assay) Western Blotting SDS – PAGE

53 54 54 57 57 57 58 60 61 65 69 70

84 84 94 105 112

116 116 117 120 124 127 132 148

163 163 163 1 176 8 9 0 180 185 188 189

Contents xi

Hybridisation Basic Mechanism of Hybridisation

8.

197 210

DNA Technology Mutagenesis Oligonucleotide-based Mutagenesis PCR-based Site Directed Mutagenesis Polymerase Chain Reaction (PCR) Applications of rDNA Technology in Diagnostics rDNA Technology and Forensics DNA Fingerprinting for Sex Determination

9. The Application of Gene Cloning and DNA Analysis Production of Protein from Cloned Genes Cloning and Expression Vectors for System Promoters for Gene Expression and Protein Production Recombinant Protein Production in : General Problems Eukaryotes for Protein Expression and Production Recombinant Protein Production in Pichia Pastoris, Saccharomyces Cerevisiae and Kluveromyces Lactis Filamentous Fungi for Protein Expression and Production Gene Cloning and DNA Analysis in Medicine Eukaryotic Gene Synthesis and Expression in Synthesis, Cloning and Expression of other Recombinant Proteins with Therapeutic Importance Gene Therapy Gene Subtraction/Antisense Technology

230 230 233 235 242 246 250 256

260 260 261 264 272 274 275 276 280 285 286 287 292

Glossary

301

Index

321

PREFACE

S

groundbreaking discoveries and researches, for instance, biological systems contain not only small molecules but also giant molecules, the macromolecules, whose molecular weights we now know, can be many folds higher than that of hydrogen atom. This book on Recombinant DNA Technology and Genetic Engineering deals with the understanding of basic concepts and techniques for the characterisation of proteins and their interactions. It not only emphasises on learning of basic concepts but also explains how to perform an experiment such as handling nucleic acid molecules and proteins.

About the Book aims in changing the way modern biology is understood as a subject. It can also be a very handy tool to understand the basic concepts such as gene cloning, expression and biochemical characterisation, etc. It has been written in a lucid and comprehensive manner with each concept supported by illustrations. The unique feature of this book is the extensive use of illustrations for explaining concepts and experiments which will not only prove to be a very powerful guiding tool but also help in quick and easy understanding. It is aimed to serve undergraduate and postgraduate students of Life Sciences. It can also be helpful in preparing for postgraduate examinations like CSIR-UGC (NET), DBT, ICMR and SLET examinations.

Salient Features of the Book Covers all fundamental concepts of gene cloning and genetic engineering such as cloning vectors, plasmid biology, enzymes used in genetic engineering, isolation of genomic and nuclear DNA Tips, Viva voce and ‘How to perform experiments’, interspersed at appropriate places More than 400 illustrations for concept explanation More than 80 chapter-end review questions designed as per University exams

Chapter Organisation The book is organised into nine chapters. Chapter 1 forms a platform in dealing with basic concepts such as cloning, and explaining their importance in Molecular Biology. Chapter 2 explains the different plasmid vectors which are the basic tools required for cloning. Chapter 3 elucidates the mechanistic aspects of plasmid replication known as plasmid biology. Genetic Engineering contains numerous and varied tools. One among them is enzymes, which is the foremost requirement in any cloning experiment. This concept is dealt in Chapter 4. Chapter 5 discusses the restriction enzymes and its various types. It also explains their mechanism of action, along with discussing where to use or how to use these enzymes. Chapter 6 enumerates on the different kinds of cloning and its various approaches, and the technologies available for cloning. Chapter 7 deals with isolation of genomic and nuclear DNA explaining how to break the cell wall of prokaryotes and eukaryotes. It also describes

xiv Preface

Chapter 8 Chapter 9 helps in understanding the importance of gene cloning and DNA analysis pertaining to human betterment. In addition, each chapter ends with a set of review questions and a list of references which will help students in their understanding and further study. The book also contains a list of abbreviations and Glossary of important terminologies at the end.

Web Supplement The following additional information is available at http://www.mhhe.com/rajagopal/rgt1 Pictures of laboratory instruments Web links for the articles written by the author Sample chapter

Acknowledgements correctness and clarity: Prasanna and Satish who have helped at the initial stages of making a soft copy of the textbook, Dr G P S Raghava, Prof. T C Bhalla, Dr Umesh Kumar, Dr Vijaya lakshmi and Dr G Venkateswaran who appreciated my idea of illustrations for concept explanation. My special thanks to my wife, Rajeshwari, who made use of her extraordinary skills as a proofreader, scientist, editor, and logician, requiring perfection of me and of this book as she read the page proofs. I would also like to thank my mentors and well-wishers with whom I had worked for few years at the beginning of my research career Prof. M S Swaminathan, Prof. Pill soon Song, University of Nebraska Lincon, USA, Prof. Park, Prof. woo KJIST Korea, senior researchers of NRC, Canada, Dr Dennis Sprott, Dr Subash Sad, Dr Lakshmi Krishnan. I would also thank IMTECH ex-directors who appointed me as a scientist Dr S K Basu (a distinguished scientist of DBT), Dr C M Gupta, Dr Amit Ghosh and my senior colleagues and well-wishers Dr Rakesh Vohra, Dr Anand Bachawat (internationally well-known yeast technologist), Dr U C Banerjee (well-known fermentation technologist), Dr P R Patnaik (computational biology), Dr R S Mycobacterium tuberculosis), Dr K L Dixit (developed thrombolytic protein technologies), Dr Jagmohan Singh (Yeast expression systems), Dr Tapan Chakraborty (a pillar of IMTECH and the man behind MTCC development), Dr Rakesh Jain, Dr Anantah Padmanabhan (fungal taxonomist), Dr G S Prasad (fungal taxonomy at molecular level), Dr Vijay Sonawane, and some of our wellknown immunologists such as Dr G C Mishra, Dr G C Varshney and Dr Javed Agrewala (The Shanti Swarup Bhatnagar awardee). At last but not the least, I would like to thank Mrs Paramjeet Kaur a trustworthy, ever smiling and enchanting personality. I still remember the golden era of my life while I was in association with young researchers of our lab such as Dr Amitabha Chaudhary, Dr Rajesh Kumar, Dr Chaiti Roy, Dr Ritu Mahajan, Dr Nandita Garg, Dr Sneha Sudha Komat, Dr Mahavir Yadav, Dr Utpal Kumar Mukhopadhyay and Dr Deepak Nihalani. Special thanks and gratitude to my supervisor, philosopher and “GURU”, Dr Girish Sahni, who inculcated the “NEVER GIVE UP” spirit in me. I would like to thank the following reviewers who reviewed the manuscript and helped in providing constructive comments on this book. Partha Roy AjayArora Pankaj Hiradhar

Rajasthan University, Rajasthan

Preface

xv

RL Singh Vijay Kothari RB Narayanan Alexander V Ashish S Verma I am especially thankful to the editorial team of Tata McGraw Hill for their sincere help and guidance during the development of this book. High appreciations are due for extraordinary people such as Smruti Snigdha, Renu Upadhyay, Yukti Sharma, Amiya Mahapatra, editors of Tata McGraw Hill, and young and ever-charming personality, Ms Preyoshi Kundu who has put so much energy and effort in bringing this book Any constructive criticism of the book is most welcome. Readers can send their views/opinions to me at

K RAJAGOPAL

Publisher’s Note Do you have a feature request? A suggestion? We are always open to new ideas (the best ideas come from you!). You may send your comments to (don’t forget to mention the title and author name in the subject line).

ABBREVIATIONS Amp: Ampicilin APS: Ammonium persulphate Bp: Base pair(s) BSA: Bovine serum albumin ºC: Degree centigrade CD Spectra : Circular dichroism spectra cDNA: Complementary DNA Cfg : Centrifugation CIAP: Calf intestinal alkaline phosphatase Conc. : Concentration Cpm: Counts per minute DDW/ddw: Double distilled water DTT: Dithiothreitol dNTP: Deoxynucleotide triphosphate ddNTP: Dideoxynucleotide triphosphate EDTA: Ethylene diamine tetra acetic acid Epp: Eppendorf Etbr : Ethidium Bromide Etoh : Ethanol 95% Etoh : Absolute alcohol 70% Etoh : 70% ethanol g, mg, μg, ng : Gram, milligram, microgram and nanogram gDNA : Genomic DNA IPTG: Kan: Kanamycin Kb: Kilo base kDa: Kilo dalton LB: Luria Bertani broth Lit, ml, μl: Litre, millilitre and microlitre M, mM, μM, nM: Molar, millimolar, micromolar, and nanomolar MALDI- TOF: Matrix assisted laser desorption/ionisation MCS: Multiple cloning site Min, h: minutes, hours

xviii Abbreviations

Mol : moles Mol.Wt.: Molecular weight Mol.biol.: Molecular biology OD: Optical density PBS: Phosphate buffered saline Pfu : PCR : Polymerase chain reaction Q-PCR: Quantitative polymerase chain reaction RPM: Revolutions per minute RT-PCR : Reverse transcriptase polymerase chain reaction RE: Restriction enzyme Sec: Seconds Taq : TE : Tris-EDTA TEMED: N,N,N’,N’- Tetramethylethylenediamine T4DNAP : T4 DNA polymerase T4PNK : T4 polynucleotide kinase T4DNAL: T4 DNA ligase UV: Ultraviolet Vol. : Volume W/V: Weight by Volume

INTRODUCTION TO GENE CLONING 1.1 INTRODUCTION TO GENE CLONING AND GENETIC ENGINEERING Genetic recombination is a common phenomenon, usually observed in all living organisms. Genetic recombination has been observed to occur during normal sexual reproduction, which mainly consists of the breakage and rejoining of deoxyribose nucleic acid (DNA) fragments of the chromosome. This phenomenon is essential and useful in reassortment of genetic material. Recombinant DNA techniques comprising of all the cloning steps is another way of mimicking natural genetic recombination. Hence, the genetic engineering and gene cloning offer potentially unlimited opportunities for creating unique combinations of genes within a very short period of time, which do not exist presently in the natural conditions.

Chapter

1 Contents

Each chapter of the textbook begins with contents at the right side of the opening page. This explains what exactly the chapter contains.

properties of an organism by the use of recombinant DNA technology. In genetic engineering, the basic requirement is considered to be DNA.

1.1 INTRODUCTION TO GENE CLONING AND GENETIC ENGINEERING

and why? These glimpses are very useful for the students in overall understanding of the topic/chapter.

Genetic recombination is a common phenomenon, usually observed in all living organisms. Genetic recombination has been observed to occur during normal sexual reproduction, which mainly consists of the breakage and rejoining of deoxyribose nucleic acid (DNA) fragments of the chromosome. This phenomenon is essential and useful in reassortment of genetic material. Recombinant DNA techniques comprising of all the cloning steps is another way of mimicking natural genetic recombination. Hence, the genetic engineering and gene cloning offer potentially unlimited opportunities for creating unique combinations of genes within a very short period of time, which do not exist presently in the natural conditions.

out the book to help explain concepts in an

Fig. 2.7 (a) YAC cloning vector (circular map) (b) Cloning strategies in YAC

1.

Set of procedures / methods along with 2. Arrange the following in an order on vacuum blotter.

Tips boxes are inserted at various places throughout the chapters to give some extra

present at appropriate places in the text.

REVIEW QUESTIONS

b. Cre/ Lox system c. Att Lambda d. MAGIC approach

followed. followed. Terminal transferase /homo polymer tailing

REFERENCES

List of references are included at the end of each chapter for further study.

kary Banks Mullis (1990), The Unusual Origins of the Polymerase Chain Reaction. 262 (4), 56–65 (A story of how PCR has been invented).

, Nature 163(1986), pp 324. F M Ausubel, R Brent, R F Kingston, R R Moore, J G Seidman, J A Smith and K Struhl. Current Protocols in Molecular Biology, Green Publishing Associates and Wiley-Interscience, New York (1987). Guide to Molecular Cloning Techniques, Methods Enzymol 152 (1987), pp 215–304.

GLOSSARY A form DNA: The form of DNA in high humidifying conditions. This form contains more base pair per turn than B-DNA. A protein: (A+T)/ (G+C) ratio: A formula for base composition of DNA. The base content of DNA differs from organism to organism. It has been observed that those DNA isolated from organisms which are from hot springs have high GC content and so on.

Glossary at the end of the book gives

Abiotic: Pertaining to nonliving. Acid phosphotase: An enzyme that is usually found in prostate and semen. adenosine deaminase. It is a rapid and lethal disease; the diseased human can die within a short period of time. Adeno virus: Acid–fast: Unique property of mycobacterium and nocardiform. Upon their treatment with mineral acids, Aerobic: Aerosol: procedure through which common contaminations occur in microbiology labs. Aerotolerant: in nature.

terms used in the book.

INTRODUCTION TO GENE CLONING 1.1 INTRODUCTION TO GENE CLONING AND GENETIC ENGINEERING Genetic recombination is a common phenomenon, usually observed in all living organisms. Genetic recombination has been observed to occur during normal sexual reproduction, which mainly consists of the breakage and rejoining of deoxyribose nucleic acid (DNA) fragments of the chromosome. This phenomenon is essential and useful in reassortment of genetic material. Recombinant DNA techniques comprising of all the cloning steps is another way of mimicking natural genetic recombination. Hence, the genetic engineering and gene cloning offer potentially unlimited opportunities for creating unique combinations of genes within a very short period of time, which do not exist presently in the natural conditions. properties of an organism by the use of recombinant DNA technology. In genetic engineering, the basic requirement is considered to be DNA. DNA can be isolated from any cell such as plants, animal cells, bacteria, yeasts, etc. They can be fragmented with the restriction endonucleases as we desire. Such fragments can then be ligated to another piece of DNA plasmid vector. Subsequently, they are further introduced by transformation into bacteria. The host cell can be propagated in mass to characterise the genetic element such as plasmid containing the gene of interest. After the plasmid extraction from the recombinant bacteria, the plasmid DNA is further screened by PCR (Polymerase Chain Reaction) by amplifying gene of interest and also by restriction enzyme digestion in order to observe the release of the fragment which was earlier ligated and transformed. They can also be further characterised by southern blotting, by gene expression, SDS-polyacrylamide gel electrophoresis, etc. The present text book deals with all the basic and essential elements of cloning and gene expression (in prokaryotes and eukaryotes).

1.2 WHAT IS GENE CLONING? Before understanding the concept of gene cloning, it is better to know the

Gene cloning can be following sequential steps such as restriction enzyme digestion, ligation

Chapter

1 Contents

2

Recombinant DNA Technology and Genetic Engineering

and transformation. In a stepwise manner, it can be described as cutting the target gene, ligation of target gene with a vector plasmid, transformation of the ligated product into E. coli, followed by selection of right number of steps as illustrated in Fig. 1.1.

Fig. 1.1 Gene cloning The basic steps involved in gene cloning are as follows: 1. A DNA fragment coding for the gene of interest is cut and inserted into the vector known as plasmid DNA. The resultant product is known as recombinant DNA molecule. 2. Plasmid is known as vector, as it acts as a vehicle for the transport of the gene into the host cell. The host cell can be bacterium, yeasts or animal cells. 3. After introduction of recombinant plasmid in the host cell, the carrier is known as recombinant host. 4. The recombinant plasmid is passed onto its progeny or F1 generation by multiplication of the bacterium; the recombinant bacterium gets multiplied through division. 5. After multiple divisions of bacterium, a clone of identical colonies is produced. Each cell in the colony contains a single clone to multiple copies of the recombinant plasmid.

Introduction to Gene Cloning

3

As we understand, gene cloning is the process of making recombinant molecules to create recombinant organisms which can produce any drug or protein of interest in bulk amounts which further can be used for human betterment. It helped in developing new high-yielding insect, and pest-resistant plants. They are also helpful in developing protein-based drugs for their use in therapeutic purposes such as cloning, expression and production of recombinant streptokinase, a bacterial protein having clot-buster function. Many proteins are produced in bulk quantities through gene cloning. It has found vast applications in agriculture, medicine gene cloning. One of the most important and basic tool is Polymerase Chain Reaction (PCR). For any gene PCR, which was invented by Dr kary B Mullis, a Nobel Prize winning American biochemist author and lecturer. This was a major breakthrough of the decade which revolutionised gene cloning and PCR, which is and other ingredients such as dNTPs, buffers, and polymerases. The reaction mixture is processed through PCR; a machine which creates conditions such as high temperature denaturation, subsequently brought to sequentially, subsequently forming many gene copies. The mechanism of PCR is shown in Fig. 1.2.

3

5

5

3 5

3

3

5

Denaturation

3 Primer

5 5

3

3

Annealing 5

Primer 5 3

3

25–30 cycles

5 5

3

3

Extension

5

3

’ 5

5 ’ 3

3

5

5

3

3

5 Amplified products

Fig. 1.2 Steps involved in PCR

4

Recombinant DNA Technology and Genetic Engineering

Steps involved in PCR 1. The template DNA is treated at high temperature (94 – 98ºC) to break hydrogen bonds of doublestranded DNA to convert it into single-stranded DNA. Alkali denaturation method could also be followed but the alkali used may prevent polymerase function in the subsequent steps of PCR. It is known as denaturation step. 2. Once the single-stranded DNA is formed, the conditions are created to bind the primers to the target DNA by decreasing the temperature and bringing up to 50 – 62 °C. The optimal annealing temperature is found by following different softwares available online e.g., gene runner, oligo, primer design annealing. The optimal annealing conditions promote the binding of primers only, by preventing the formation of double strands as the single are complementary to each other and they are 100% homologous. 3. As soon as the primers bind to the template DNA, the temperature needs to be changed to 72ºC. This is the optimal temperature at which polymerase functions and forms extended PCR products. This step is known as extension as primer extension occurs, as soon as it binds to the template. Developments in

these polymerases are commercially available and marketed. Taq DNA polymerase is one of the most time, and can also amplify long DNA strands. There are also other robust polymerases available which 4. New double-stranded DNA is formed after extension and elongation by polymerase. For the next round of PCR, it needs to be subjected for denaturation, followed by annealing and extension further leading to form many new double-stranded DNA. The number of cycles in a PCR depends on the length of the target DNA and the quantity required. These cycles further lead to form more strands of DNA.

The most common problems observed in PCR presence of many complementary regions in the template. 2+

. Therefore, higher the concentration of dNTPs, lesser would be the concentration of Mg , available in the reaction, which 2+ is no longer available for the reaction and so no 2+

3. A smear-like appearance – It is mainly due to large amounts of template in the reaction. annealing temperature. annealing temperature.

Polymerase Chain Reaction (PCR) plays an important role in isolation of a particular gene of interest from the mixture. It is considered as the centre of molecular biology because it provides basic ingredients such as purposes as discussed earlier.

Introduction to Gene Cloning

5

Gene cloning the genomic DNA containing multiple number of genes. The isolated gene is further considered as pure, because it contains only a single type of nucleotides representing the gene. It is not a mixture of two or more genes, but is a single gene containing single type of sequences. In the process of making a library, the whole genomic DNA is restriction-digested and the different length of DNA fragments is further cloned into the plasmid vector. The fragments represent full-length as well as half-length genes; therefore, the fragments of a particular range such as 2–5 kbp are considered for cloning. These fragments also represent the whole genetic material of the organism. These fragments are further inserted into the plasmid vector to produce a family of recombinant molecules; among them one contains the gene of interest. Based on the plasmid compatibility, interest, one needs to screen multiple number of clones. Most of the gene isolation methods from the library exploit the biochemical properties of the protein, which is the product of the cloned gene. The success of a

of cloning determine the chances of getting the right clone from the library. II

Fig. 1.3 Isolation of gene of interest by cloning

6

Recombinant DNA Technology and Genetic Engineering

to obtaining clone of interest, it is further strategised for induction and expression leading to the formation of protein of our interest. Once it has been established that the protein expressed is required/desired, it can further be used for structural and functional studies. There are various kinds of technologies developed and used extensively in understanding the physico-chemical properties of protein of interest. First of all, one needs to characterise the protein by basic methods such as amino acid sequencing, based on which one present in the protein. After which CD spectra, which is used to understand its structure, is followed with

animal studies to understand its in-vivo half-life and its effect on the system, etc. Most of the proteins having feasibility as a therapeutic protein. Figure 1.3 explains the cloning of DNA fragments in plasmid vector in brief. But the availability of various number of technologies and strategies have been helping very much for

molecules will survive and grow on the selective media plates containing antibiotics.

There are many methods followed for isolation of a gene of interest but direct and indirect methods are the interest. The indirect method involves genomic DNA library construction and isolating the gene of interest

Indirect Method of Gene Isolation isolating and identifying the gene, the resulting sequences are subjected to NCBI blast as well as alignment program. This helps in understanding the close relatives as well as the domain structure at the protein level. But this method of gene isolation is time-consuming, cost-effective and the success rate is also very low. Therefore, researchers follow subtractive cDNA library preparation, wherein the organism whose library needs to be made is subjected to certain conditions in which the desired gene is hyper-expressed. From these samples complementary DNA (cDNA) is made along with the control sample. This is the reason why it has

Direct Method of Gene Isolation This method is applicable only for those gene isolations where the protein or gene sequences are already Therefore, the gene that is isolated is of our interest. In this method, the basic requirements are gene sequences, reproducible methods. One-time investment for PCR and its accessories such as polymerase and dNTPs

to the forward and reverse primers. The forward primer binds to the N-terminal end and the reverse at

Introduction to Gene Cloning

7

Here, the selection problem does not apply since the gene of our interest is selected as a result of the primer other method yet, through which one can isolate the gene of interest faster than this method. Still there are certain limitations with the PCR-based gene isolation.

Fig. 1.4

studied and sequences reposited in international agencies can be studied. PCR-based gene isolation method cannot be applicable for novel genes.

cloning is preferred. Therefore, the only way of isolating novel genes is by direct cloning. Even then PCR is used where the sequence of equivalent gene can also be used. The degenerate primers could be used for these incidents.

regions of the gene. Once these studies are completed, one can easily make the degenerate primers for

8

Recombinant DNA Technology and Genetic Engineering

subjected to DNA sequencing. The comparison of these two genes or alignment of these two wild as well as

Further uses of PCR are explained in detail in Chapter 8.

Fig. 1.5

REVIEW QUESTIONS

Introduction to Gene Cloning

9

REFERENCES kary Banks Mullis (1990), The Unusual Origins of the Polymerase Chain Reaction. 262 (4), 56–65 (A story of how PCR has been invented).

, Nature 163(1986), pp 324. F M Ausubel, R Brent, R F Kingston, R R Moore, J G Seidman, J A Smith and K Struhl. Current Protocols in Molecular Biology, Green Publishing Associates and Wiley-Interscience, New York (1987). Guide to Molecular Cloning Techniques, Methods Enzymol 152 (1987), pp 215–304.

SALIENT FEATURES OF CLONING VECTORS 2.1 ESSENTIAL COMPONENTS OF GENE CLONING In order to make a bacterium resistant to any antibiotic, it is essential that the said bacterium possesses, a plasmid which is ‘self-replicating DNA molecule’. If it does not possess a plasmid DNA, the bacterium can be made resistant to antibiotics by introducing a gene, which codes for those antibiotics such as tetracycline, ampicillin, etc. Hence, the plasmid DNA can be used as a vehicle for the transfer of a gene into the bacterium as well as the expression of a protein for commercial and domestic purposes. In order to use these plasmids as vehicles, they should have some basic features such as, the ability to propagate themselves in the bacterial system which means they should have an origin of replication. There are many types of Ori sites. If one wants to introduce a plasmid into E. coli, it needs to have E. coli origin of replication similarly, yeast origin of replication, etc. the following features: 1. Should be relatively small, 2. Should possess antibiotic resistance marker, and 3. Self-replicating ability. Based on their utilisation and function, there are many kinds of plasmids, i.e., expression plasmids, multipurpose cloning vectors and shuttle vectors.

2.1.1 Plasmid There are two different kinds of genetic material found in the bacteria, bacterial chromosomal DNA (genomic DNA) and the other is plasmid million base pairs. This is very commonly present in most of the bacteria; some species also contain one or more plasmids. A plasmid is extrachromosomal DNA which is small and has self-replicating ability. Mainly they code for resistance to antibiotic. The plasmid usually contains the genes which code for: 1. Resistance to disinfection 2. Cause disease 3. Are responsible for fermentation of milk to cheese in laboratory 4. Confers the capability to use complex chemicals as food such as hydrocarbons. Most of the commercial plasmids in use today are considered to be originated from bacteriophages. The mol.wt of the plasmid determines its stability in a given organism. Low mol.wt plasmids are very much in use, as they are more successful in genetic engineering.

Chapter

2 Contents

Salient Features of Cloning Vectors

11

Plasmids are circular self-replicating DNA molecules having origin of replication and antibiotic resistance marker. The resistance conferred by a micro-organism is mainly due to two reasons, i.e., the presence of gene coding for an antibiotic either in the plasmid or in the chromosomal DNA. However, most of the antibiotic genes are of plasmid origin. These antibiotic markers not only bring resistance but also a level of stability and survivability of that organism in antibiotic media. Selectable resistance gene can also be introduced in a plasmid through cloning. Many of the commercial plasmids have been originated through genetic engineering technology. Higher the mol.wt of the plasmid, lesser will be its stability and vice versa. Figure 2.1 shows the types of genetic material present in a cell.

Fig. 2.1 Types of genetic material present in a cell

As we discussed earlier that most of the commercial plasmids used for cloning and gene expression consist of antibiotic marker. The presence of marker also helps in eliminating the contaminants in the culture by growing the culture in the presence of certain antibiotics. How can one keep the culture pure without any contamination? The following experiment can be followed as shown in Fig. 2.2. Based on their ability to integrate into the host chromosomal DNA there are two different kinds of plasmids; integrative and non-integrative plasmids. Most of the eukaryotic plasmids are integrative plasmids and most of the prokaryotic plasmids are non-integrative plasmids. The features of non-integrative and integrative plasmids are: Integrative plasmids possess very high mol.wt, they contain the region of integration into the host chromosomal DNA by having the similar DNA sequences, and they have the capability of integration by homologous recombination. The integration is essential in those plasmids which do not contain origin of replication. Hence, in order to self-amplify, they develop an intrinsic property of integration into host DNA and are replicated. They can be maintained for generations without any problem; sometimes, they also exist as independent elements.

in-vivo

in-vitro

The stability of a plasmid in-vivo and in-vitro depends on the length and copy number of the plasmid. The length and copy number of a plasmid is one of the most important features which play an important role in genetic engineering; the shorter plasmids ranging from 4–8 kbp used for cloning. As the molecular weight drastically reduced. Hence, most of the commercially available plasmids are considered to be shorter and very much stable.

12

Recombinant DNA Technology and Genetic Engineering

Fig. 2.2 Experiment showing how to keep culture pure without contamination Table 2.1 Common cloning, expression and shuttle plasmids used in molecular biology laboratory: Plasmid 1 corresponds to multipurpose cloning vector, 2 represents E. coli expression vector, 3 and 4 corresponds to shuttle plasmids. Sr. No. 1. 2. 3. 4.

Plasmid pBlueScript II KSpET vectors pPic 9 pKluyveromyces lactis

Nucleotide length 2.6 kbp 3.6 kbp 8.0 kbp 9.0 kbp

Organism E. coli E. coli E. coli and Yeast E. coli and Yeast

Copy number is the ‘number of individual plasmid molecules found in single bacteria’. It is understood that the gene rop plays an important role in maintaining the copy number. Absence of rop gene leads to uncontrolled number of plasmid copies and vice versa. Generally, the multipurpose cloning vectors should not possess rop gene in order to maintain or amplify the gene of interest. But it should be the other way round in case of expression vectors where the copy number should be reasonable and should not be too high which can bring stability problems. Hence, moderate copy number is the preferable condition.

Salient Features of Cloning Vectors 13

Two different or many different plasmids can stay in a single cell. Based on the reports, it is understood that E. coli can maintain different plasmids (7–10) at one time. Compatibility many different plasmids together in a same cell’. Incompatibility is ‘a plasmid, which will not stay together in a single cell, and will be rapidly degraded or thrown out of the cell’. The basis of incompatibility is not well understood yet.

Bacteria adopt a natural way of plasmid propagation, a process known as conjugation. Conjugative plasmids are the ones, which propagate their plasmid through conjugation by spreading from one cell to another. The gene tra plays an important role in the transfer of plasmids from one cell to another. With the lack of tra gene, plasmid transfer is not possible. This is the main route through which the antibiotic resistance genes are transferred from one cell to the other. If conjugative and nonconjugative plasmids are compatible and live in a single and same cell, tra gene can be transferred and the conjugation can occur. Figure 2.3 (a) and (b) shows the process involved in nucleic acid distribution in bacteria and mechanism of integration.

Fig. 2.3 (a) Nucleic acid distribution in bacteria (b) Mechanism of integration

14

Recombinant DNA Technology and Genetic Engineering

The basic component required for conjugation between the cells is pilus, which forms a bridge between the cells, through which the DNA is transferred. The process is shown in Figure 2.4.

Fig. 2.4 Process showing conjugation between cells 1. Conjugative plasmids carry code for conjugation or tra gene, e.g., F plasmid of E. coli. They help in plasmid propagation and making antibiotic resistance by transfer of genes. 2. Col plasmids are the plasmids which play an antagonistic role in order for their own survival by killing other bacteria. They secrete a kind of toxin which kills the other bacteria, e.g., E. coli Col E1. 3. Suicidal plasmids engineer the metabolic activities in such a way that the bacterium synthesises toxic substances such as toluene, and salicylic acid, further killing the bacterium. 4. Virulence plasmids are involved in introduction of virulence or pathogenesis in the microbe, e.g., Ti plasmid. 5. Resistance plasmids help the bacterium to survive in antibiotic containing media. Most of the commercially available plasmids show different resistance mechanism based on the presence of antibiotic marker.

Some of the multinational companies have introduced multipurpose cloning vectors as well as expression vectors, and shuttle plasmids into the market which have been in use for decades and they are considered as one of the basic and essential requirements in a molecular biology lab. This section deals with a brief introduction of these plasmids. Figures 2.5 and 2.6 show very common cloning and expression vectors and their circular and linear maps.

Salient Features of Cloning Vectors 15

®

sequence plus an optional C-terminal His Tag® sequence. These vectors differ from pET-21a-d(+) by the ‘plain’ T7 promoter instead of the T7lac promoter and by the absence of the lacI gene. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the vector map. The f1 origin is oriented so that infection with helper phage will produce virions containing single-stranded DNA that corresponds to the coding strand. For circular and linear maps of pET vectors, refer to Fig. 2.6 (a). Figure 2.6 (b) represents the shuttle vectors which are commercially available for expression of gene of interest in E. coli as well as yeast.

Yeast Expression Systems Yeast expression systems have proven to be extremely useful for expression and analysis of eukaryotic proteins.

Advantages of protein expression in yeast

AmpR promoter

2952 246

2706 Sca

2460

Ampicillin

pBlueScript SK– 2958 bp

2214 ORF

T7 promoter Acc65 653 Kpn 657 Psp0M 659 NgoM V 675 Apa 663 Xho 668 Nae 134 Sal 674 Acc 675 f1 origin Hinc 675 pBlueseriptKS primer Psi –369 Cla 684 Hind 689 EcoRV 69 7 EcoR 701 Pst 711 Xma 713 Sma 715 BamH 719 Spe 725 pBlusescriptSK-primer 492 Xba 731 Not 738 Eag 738 Btg 747

738

Sac 750 Sac 759 T3 promoter M13 reverse primer M13 pUC rev primer Lac promoter

984

1968 1722

1230 1476

PciI 1153 NspI 1157

pBR322 origin

Fig. 2.5 (contd.)

16

Recombinant DNA Technology and Genetic Engineering

Btg 747

Sac 750 Sac 759 T3 promoter M13 reverse primer M13 pUC rev primer Lac promoter

NgoM V 132 Nae 134 f1 origin Psi –365

Sca 2526

0RF

1 Lac2 a M13 pUC fwd primer M13 forward20 primer T7 promoter Acc65 653 Kpn 657 Psp0M 659 Apa 663 Xho 668 Sal 674 Acc 675 Hinc 676 pBlueseriptKS-primer Cla 684 Hind 689 EcoRV 69 7 EcoR 701 Pst 711 Xma 713 Sma 715 BamH 719 Spe 725 pBlusescriptSK-primer Xba 731 Not 738 Eag 738 Btg 747

1000 Pci 1153 Nsp 1157 origin

2000 Ampicillin

AmpR promoter

Fig. 2.5 Circular and linear maps of common plasmids 3. Easy and less expensive to work with compared to insect or mammalian cells. 4. Can be adapted to fermentation. 6. Yeast expression systems are ideally suitable for large-scale production of recombinant eukaryotic proteins.

Key advantages of Pichia expression system 1. Deliver up to grams per liter of expressed recombinant protein. 2. Flexibility for inducible, constitutive, intracellular, or secreted expression. 4. Produce mammalian-like proteins.

Salient Features of Cloning Vectors 17

For further details, please log on to http://www.invitrogen.com/site/us/en/home/Products-and Services/ Applications/Protein-Expression-and-Analysis/Protein-Expression/Yeast-Expression.html

Aat (4567) Ssp (4449)

EcoR Apo Cla Hind

(4638) (4638) (24) (29)

Bpu 1102 (458) BamH (510)

Sca (4125)

Nde (550) Xba (588) Bgl (646) SgrA (687)

Pvu (4015) Pst (3890)

Sph (843) EcoN (903) Sal (928) PshA (993)

Eam1105 (3645)

Eag Nru ApaB BspM

HgiE (3338)

(1216) (1251) (1329) (1331)

AiwN (3168) BsM (1636) Ava (1702) Msc (1723) Bpu10 (1858) BscG (1912)

BspLU11 (2752) Afl (2752) Sap (2638) Bst1107 (2523) BsaA (2504) Tth111 (2497) BsmB (2393) Pvu (2343) Circular map T7 promoter primer #69348-3

T7 promoter I rbs AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAAGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGGAAGGAGA pET–3a I T7 Tag HI 1102 I TATACATATGGCTAGGATGACTGGTGGACAGCAAATGGGTCGCGGATCCAGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCCACCGCTGAGCAATAACTAGCATAA MetAIaSerMetThrGIyGIyGInGInMetGlyArgGIySerGIyCysEnd T7 terminator primer #69337-3 PET - 3b . . . GGT CGGA TCCGGC TGC TAAC AAA GCCGAAAGGAAGC TGAGT T GGC TGC TGCCAC CGCT GAGC AAT AAC TAGCATAA . . . G l y A r g A s P P r o A I a A I a A s n Ly s A I a A r g Ly s G l u A I a G I u L e u A I a A I a A I a T h r A I a G I u G I n E n d

PET - 3d

I . . . TACCATGGCTAGC . . . MetAIaSer . . .

PET - 3c, d

. . . GGT CGGA TCCGGC TGC TAAC AAA GCCCGAAAGGAAGC TGAGT T GGC TGCCACGCTGAGCAATAA TAGCATAA . . . G l y A r g I I e A r g l e u l c u T h r Ly s P r o G I u A r g Ly s L e u S e r Tr p L e u L e u P r o P r o l e u S e r A s n A s n E n d

T7terminator CCCCTTGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG

pET-3a-d cloning/expression region

Linear map

Fig. 2.6 (a) For DNA sequence for all T7 expression systems, log on to http://www.merck-chemicals.com/usa/life-science-research/pet-3d-dna/ EMD_BIO-69421/p_2tOb.s1OkacAAAEjWhl9.zLX?attachments=VMAP

18

Recombinant DNA Technology and Genetic Engineering

Fig. 2.6 (b) Shuttle vectors (E. coli and Yeasts)

In order to understand the genome of an organism, the best suitable way is by genome sequencing. For sequencing of a genome, one needs a strategy whereby Craig Venter followed shotgun sequencing and many more. The best possible way of sequencing requires cloning of large junks of DNA. Not all plasmids have vectors known as high capacity vectors different types of high capacity vectors available for this purpose. They are cosmids, PAC, BAC, and YACs (Table 2.2).

Table 2.2 Serial number 1.

Vector Cosmid

Capacity (Kbp) 35–45

Ori replicon

Host

ColE1

E. coli

Copy number per cell High

2.

PAC

130–145

P1

E. coli

Low

3.

BAC

125–300

F

E. coli

Low

4.

YAC

250–400

ARS

E. coli

Low

Ways of recovery Alkaline lysis miniprep Alkaline lysis miniprep Alkaline lysis miniprep Alkaline lysis miniprep

Salient Features of Cloning Vectors 19

main tools in the rapid assembly of overlapping arrays of individual clones. Each recombinant clone contains a fragment of DNA having overlapping regions with its neighbour. This mimics the chromosome walking phenomenon. These contigs are very helpful and contain the basic needs to make physical and genetic maps. The development of physical maps of eukaryotic chromosomes solely depends on the arrangement of overlapping clones. Therefore, larger vectors are preferred for construction of framework maps. It is further understood that different high capacity vectors are exploited in order to make a large possible plasmid.

s They are named so because their structural map resembles authentic yeast chromosome. Two arms of YAC vectors are exploited for ligation of large genomic DNA fragments. Subsequently, the ligation mixture is transformed into yeast. Each of the arms carries an antibiotic marker and the remaining right-oriented DNA sequences function as telomeres (arrows). YACs also contain centromere region and an origin of replication. The telomeric ends and separated DNA sequences are essential for the formation of stable chromose ends. These telomere ends are generated from Tetrahymena. Before it is used for cloning purposes, it needs to be linearised by restriction digestion.

Importance of Sup regions At the centre of the YAC vectors, there is a presence of Sup region codes for SUP4 gene, after restriction enzyme digestion the SUP4 gene gets disintegrated, forming red colonies. This is the usual methodology used

Centromeric region It can be stated as CEN4 region and is very essential for segregation of chromosomes between the daughter cells. This also determines the copy number. ARS1 region is also known as autonomously replicating sequence, and contains signals for bidirectional replication of DNA in yeast. Ori E. coli. TRP1 site is responsible for conferring trp auxotrophic property and the ability to grow in the absence of Uracil.

The DNA fragment of interest is cloned in the centre of the YACs leading to the formation of structure having two telomeres at the two terminal ends and at the centre is a cloned fragment adjoining resistance markers,

In order to understand the right clone of interest and the clone having a fragment, an insertional inactivation methodology has been followed and developed wherein, the insertion of DNA into the vector at cloning site disrupts the suppressor tRNA gene and results in formation of red colour, but control makes white

20

Recombinant DNA Technology and Genetic Engineering

colony. Most YAC libraries carry between 250 kbp and 400 kbp of foreign DNA per clone. They are the best suitable vectors for mammalian genomic DNA library construction as they are very large molecules. YACs have a major advantage as they have no packaging constraints. Hence, there are no limitations in their cloning capacity. Since the cloning capacity depends on the way of preparation of genomic DNA libraries of mammalian genomic DNA, it can accept the DNA fragments of upto 1Mb.

Main disadvantages of YAC As the YACs are maintained as low copy plasmids in E. coli chromosomes. It is also a labourious and an expensive process. Cloning strategies in YACs are described in Fig. 2.7.

Fig. 2.7 (a) YAC cloning vector (circular map) (b) Cloning strategies in YAC Choice and selection of a vector for construction of genomic libraries depends on the size of the target region a vector for making a library. They are the ease and suitability of screening the libraries, suitability of vector fragment. All the above factors depend mainly on the length of the fragment cloned.

Salient Features of Cloning Vectors 21

The DNA fragments generated after restriction enzyme digestion are ligated into the vector DNA, the resulting concatemers packaged into the bacteriophage particles (DNA virus of bacteria). These libraries can be stored and propagated in bacteriophage particles. The only difference among the bacteriophage and cosmids is that the recombinant cosmids contain no less than 28 kbp and not more than 45 kbp of foreign DNA fragments. The most suitable DNA fragments for introduction of into the cosmids are Mbo1 and Sau3AI digested fragments, which can easily be introduced into the vector digested with BamH I or BglII. After the successful creation of library, it can be propagated and subsequently stored in freezing conditions till it is further used. There are several disadvantages with cosmid vectors like, they contain a single cos site and cloning into these cos plasmids involve large amounts of labour as it requires many steps to be followed. much less, hence, generating representative libraries of large and complex genomes in single cos vectors is a failure. Therefore, new cos vectors have been developed containing more than one cos site. They are named as dual cos vectors containing two cos sites. The main advantages are that they do not require restriction cos sites, there are

Fig. 2.8 Cloning in cosmid vectors

22

Recombinant DNA Technology and Genetic Engineering

different kinds/types of vectors. They can be cosmid vectors, single cos site vectors, and double cos site vectors. The strategies of cloning differ in each of the cloning strategies for single cos site and double cos site vectors as given in Fig. 2.8. The superCos-1 is the very recently developed cos vector, which have unique characters like, it has two cos sites which are separated by a restriction enzyme site. Therefore, restriction enzyme digestion and insertion of DNA fragment leads to form a linear molecule. Further, after dephosphorelation of linear vector, it is further subjected to restriction enzyme digestion to produce two arms, each one having a cos site. The foreign DNA is ligated to cos vector leading to generate, inter alia molecule where two cos sites are oriented in the similar manner and are separated by the foreign DNA fragment. This arrangement is very essential and they

Common disadvantages observed in cloning of large fragments Frequently observed main problem with cloning of large fragments into the cos vectors are the easy ligation of shorter DNA fragments themselves, and with the cos vectors that produces the recombinants with sequences derived from 2–3 noncontiguous segments of the genome. As these clones with shorter fragments, make more substantial contribution to the number of molecules in the population ultimately reducing the right clones. Therefore, this problem results in increase in the number of undesirable chimeric clones in the libraries.

s This is also a high capacity vector used for cloning high molecular weight fragments, but they are different from YACs in their structure. BACs are circular DNA molecules carrying an antibiotic marker, a replication controlling element from E. coli (F factor), repE element for DNA replication and three different loci par A, par B, and par C for equal segregation of plasmid DNA into daughter cells. Most of the BACs are single E. coli.

But the advancement of developments in the subject has led to development of many new BAC vectors with several unique features. The main feature is the introduction of antibiotic marker for selection of recombinant nonrecombinant bacterium. As there are no packaging processes observed in BACs, hence, the post packaging errors are ruled out. They can accept up to 120 kbp – 300 kbp genomic DNA without any problem. Figure 2.9 shows the circular map of BAC plasmid.

Bacteriophage P1 vectors are linear vectors and contain antibiotic resistant marker. In addition, they also contain a positive selection marker for identifying clones that carry the foreign DNA. They can accept around 115 kbp fragments. The linear vectors along with the cloned genomic DNA are packaged in-vitro into bacteriophage P1 particles. After transformation into E. coli, the linear DNA molecules are further circularised by recombination between loxP sites. There are two replication origin sites P1 and P2. P1 plays of DNA. In order to overcome the drawbacks in packaging and post-processing processes, new versions of vectors have been developed which have strong features and the features of P1 vectors and the BACs have also been introduced.

Salient Features of Cloning Vectors 23

Fig. 2.9 Circular map of BAC plasmid

The vectors having characters of both P1 and BAC are known as P1 Here, the packaging of ligated vector and BAC has been ruled out. Therefore, they are directly transformed into E. coli as multipurpose cloning sites, antibiotic markers, and also have positive selection marker.

2.8 ss

Viruses or bacteriophages are obligate intracellular parasites, hence, they need a host for their growth. The growth of these organisms need an exploitation of living cells. Traditionally, whole animals and plants are used for the growth of the viruses. Later tissue culture technologies were in use for the growth of viruses, but it is considered to be very expensive, labourious and time consuming, and requires skilled manpower. Researchers have shown much more importance in developing bacteriophages for culturing virus particles because of these limitations. There are many advantages with the bacteriophage system. One among them is the maintenance and growth of bacteria, the technical competence and expertise required is much less, and the technologies are faster and cheaper in comparison to the growth of viruses by using plant and animalbased systems. In viruses, like other organisms, a different kind of reproduction occurs which is termed as replication form a new phage particle. Viruses are infectious agents having either DNA or RNA as genetic material, which is further surrounded by protein known as capsid. Life cycle of a bacteriophage involves three different steps, beginning with the attachment and injection of phage DNA material into the bacterium, replication of phage DNA in attachment of bacteriophage onto the surface of the bacterium, which is also known as infection, further leading to the synthesis of new phage particles they are further delivered by rupturing the bacterial cell wall. This process is known as lytic cycle, which is considered to be one of the fastest processes and

24

Recombinant DNA Technology and Genetic Engineering

requires only 20 min for its completion. As soon as DNA synthesis is completed, the next step synthesis of capsid protein begins. In this phase, DNA cannot be carried out by the bacterium; hence, no integration of phage genetic material into bacterium occurs. The structure of the bacteriophage is shown in Fig. 2.10.

Fig. 2.10 Structure of bacteriophage

Fig. 2.11 Lytic Life cyle of bacteriophage

The lysogenic cycle is the safest way followed by bacteriophage in retention of the phage DNA in the host bacterium for many generations. The cycle begins with the attachment and infection of phage particle to the bacterium, and insertion of phage DNA into bacterial genome. The integrated form of DNA is known as prophage Lysogenic cycle ends with the release of prophage and reverting back to the lytic cycle. The lysogenic cycle of bacteriophage is given in Fig. 2.12.

Salient Features of Cloning Vectors 25

Fig. 2.12 Lysogenic phase of bacteriophage There are many different kinds of phages. The most useful ones are bacteriophage and M13 phage as good cloning vehicles. In case of M13 phage, the DNA integration into bacterial genome does not occur, and phage particles are continuously produced from the cell. But the infected cells can be easily differentiated through their growth levels, where the infected bacterium will have less growth compared to uninfected cells. The infected bacterial lysis never occurs; hence, there is no death of the host bacterium. The life cycle of M13 phage is shown in Fig. 2.13.

Fig. 2.13 Life cycle of M13 phage Lysogenic bacteria which already contain the bacteriophage are considered immune from infection. Prophages code for different toxins; hence, they have potential for vaccine development. However, integration of virus DNA into host genome of an animal cell is considered as a rare event, cases have been observed of these

26

Recombinant DNA Technology and Genetic Engineering

its DNA copy from its RNA genome known as cDNA copy and this is the one which gets inserted into the genome. This DNA may remain latent for many years, once it initiates replication cycles, it leads to the formation of active AIDS virus.

DNA is 50 kbp in size and is one of the intensively studied areas with reference to location of genes, restriction enzymes of bacteriophage DNA. Here, gene expression occurs as a whole, which means that couple of genes, which are adjacent to each other are induced and expressed simultaneously. The clusters of genes, which code for capsid or integration are localised in a group, hence, the arrangement is known as clustering. Figure 2.14 shows the genetic map.

Fig. 2.14

Linear form of DNA is utilised for cloning purposes. The linear form consists of two free ends and this is the predominant form present and observed in phage head structure. But the terminal ends of phage DNA consists of single strands of 12 nucleotide stretch with complementary DNA sequences. Hence, they are very useful for the attainment of circular form. These complementary ends are referred as sticky ends. These sticky ends or cohesive ends play an important role in circularisation as soon as it is injected into the host. They are also known as cos sites. These sites also function as recognition sequences for endonuclease that cleaves to form an individual genome. This endonuclease A helps in packaging of formed phage molecules as shown in Figure 2.15 ((a) and (b)).

very less number of genes for replication, packaging, etc. It Mainly requires just three genes for capsid synthesis. But lambda requires over 15 proteins for the synthesis of head–tail structures. M13 does not require any gene for infection and integration but lambda does.

Salient Features of Cloning Vectors 27

Fig. 2.15 stranded DNA enters into the host, this is used as a template strand for the synthesis of the remaining strand leading to the formation of a double-stranded molecule. This DNA never integrates into the host genome, but multiplies by replication till the number of copies reaches 100 or more in the cell. But bacterial growth and division is never derailed, instead, it is slowed down. As the number of divisions increases, the number of copies of phage also increases. The formation of new phage particles are continuous, many new phage particles are generated and released from the infected cell.

Fig. 2.16 Infection cycle of M13

28

Recombinant DNA Technology and Genetic Engineering

The unique features, such as low molecular weight, presence of double-stranded replicative forms are very well-suited as plasmid. Therefore, they can be used as cloning vector because it is easy to obtain a single -stranded DNA for many other purposes such as DNA sequencing, and in-vitro mutagenesis, etc. The infection cycle of M13 is shown in Fig. 2.16.

They contain characters of plasmids as well as of phage; hence they are called phagemid vectors. They can easily survive and amplify in the bacteria because of the presence of E. coli origin of replication. They can also be exploited for synthesis of single-stranded DNA because they contain F1 origin of replication. The bacteriophage F1 and M13 bacteriophage are very closely related phages which infect E. coli In phagemid vectors plasmid is maintained as a single-stranded DNA, the same plasmid is maintained as a double-stranded in E. coli. F1 origin of replication gets initiated or activated upon infection of helper phage F1. The initiation leads to replication, subsequently producing single-stranded DNA which is later packaged into phage particles. In the molecular biology laboratory, the pBlueScript II KS- is the phagemid extensively used for synthesis of single-stranded DNA for sequencing and also for preparation of radiolabelled probes.

Most of the traditional plasmid vectors are originated from pUC series of plasmids. These plasmids are very compact and are multipurpose cloning vectors because any fragment of interest can be cloned without bothering much about the frame of the ORF. These plasmids contain multiple restriction endonuclease sites, which help in cloning of any DNA fragment. This criterion also helps in introduction of these sites in foreign genes, by cloning the fragment near the MCS. Figure 2.17 shows the circular map of pBluescript plasmid.

Fig. 2.17 Circular map of pBluescript plasmid . Therefore, it is feasible for selection of recombinants through blue and white selection criteria. Further, the plasmid also contains F1 plus and F1

Salient Features of Cloning Vectors 29

stranded DNA which could be obtained after the co-infection of host with a helper phage. In the absence of phage ColE1, origin of replication is used for replication. For recombinant selection, the plasmid also contains ampicillin as a antibiotic marker. Although the plasmid contains two phage promoters T7 and T3, it cannot be used for expression of a recombinant protein, because it does not have regulatory regions other than it has a very high copy number plasmid. There are some disadvantages present with the plasmid; one of them

E. coli is the basic unit or the backbone of molecular biology laboratory. It is used extensively for gene cloning, mutagenesis, structure function studies, etc. E. coli is extensively used because of its ease of handling, growing, and cloning are not only very easy but also rapid. Still E. coli system is not suitable for expression presence of rare codons, presence of glycosylation sites, etc. Hence, the lower eukaryotes come into effect. One of the very well-known lower eukaryote is yeast/ saccharomyces cerevisiae. But E. coli is still a basic microbe followed at the later steps. There are many plasmids and hosts developed for gene expression in yeasts.

It is well known since ancient times that yeast is a conventional microbe used for brewing, bread making, etc. Presently, yeast is considered as one of the most important organism in biotechnology, where it has been extensively used for cloning, and expression of eukaryotic genes. Some strains of Saccharomyces cerevisiae contain their own plasmid which is known as 2μm plasmid. It is the only plasmid found in lower eukaryotes. It is very essential to understand the characteristics of this plasmid in detail.

This plasmid has all the basic characters such as (i) It is 6 kbp plasmid, which determines its easy handling and easy transformations, (ii) It is a high copy plasmid 70–200, therefore in-vivo (iii) It has two different origins of replication, REP1 and REP2. The plasmid also contains FLP protein which helps in rearrangement in the plasmid after homologous recombination. Figure 2.18 shows the yeast plasmid map.

Fig. 2.18 Yeast plasmid map

30

Recombinant DNA Technology and Genetic Engineering

Although it looks easy to use the plasmid for yeast molecular biology, problems do occur with the plasmid, especially pertaining to the selection marker and its use. For instance, plasmid selection marker and yeast markers are not exactly similar. Some of them contain genes resistance to inhibitors such as methotrexate and copper, and most of the vectors make use of totally different type of selection system. The gene which codes for normal yeast amino acid biosynthesis is used as a selection marker. The most common gene used in conversion of pyruvate to leucine.

Transformation and selection of recombinant yeasts depend on the host used, if one plans to use 2μm plasmid with LEU 2 selection marker. We need to select or depend on the host which is LEU 2 deleted. Here, auxotrophic mutant having nonfunctional LEU 2 gene is the basic requirement. In normal conditions, this auxotrophic mutant cannot synthesise leucine, and it is essential to provide the same in the minimal media for their growth. But the yeast containing this plasmid can easily grow because it can synthesise the leucine as gene enclosed in the plasmid. The selection of recombinants is possible because transformants contain plasmid copy with LEU 2 gene, and they can grow on the minimal medium. Therefore, only the transformed cells can survive and form colonies. Figure 2.19 ((a) and (b)) illustrates the selection process in yeasts. Selection mechanism in Yeast

(a) Yeast mutant Leu2-(auxotroph)

Observations Growth of cells Leu2-colonies Medium with Leucine

Mutant yeast without Leu2 gene (b) Function of selectable marker LEU2 FLP

REP1

2μm plasmid 6 kbp

REP2

Growth of cells Leu2 colonies

transformation Minimal medium without Leucine

Leu2 gene Ori Yeast plasmid

Fig. 2.19 Selection mechanism in yeast Many yeast plasmids have been developed with the insertion of different selection markers such as genes of yeasts URA3, TRP1, and ARG4. all the plasmid of yeasts is integrative in nature. The integrative plasmids some times are not considered stable

Salient Features of Cloning Vectors 31

once the fragment is inserted and transformed into yeasts. In order to overcome these problems, many new yeast vectors have been developed like, YIP, YEP, YRp, YCp, YLp and YACp. The basic cloning experiments are carried out in E. coli system, although gene is to be expressed in yeasts. Therefore, recently, researchers have developed new plasmid vectors known as shuttle vectors. These vectors can be used for cloning and expression of the gene of interest in yeast.

Based on their function and the purpose of their use, there are two different kinds of plasmids, (i) Yeast integrative, and (ii) Yeast episomal plasmids.

Yeast Integrative Plasmids (YEP) These are basically E. coli plasmids but yeast selection markers have been inserted making them yeast plasmids. As the name indicates, the integration after transformation into yeast is the basic minimal requirement for its replication in yeast. If it does not get integrated into the yeast genome, it will not get replicated. Hence, there

Examples of YIPs Based on pBR322 plasmid, a new yeast plasmid is constructed by insertion of URA3 gene. URA3 gene and its product, codes for orotidine-5’-phosphate de-carboxylase which catalyses pyrimidine nucleotide biosynthetic pathway in yeasts. This gene is extensively used as a selection marker, replacing LEU2. YIPS cannot replicate, as they do not have replication sites or 2μm plasmids. Therefore, they depend on the integration, after transformation into yeast chromosomal DNA. Homologous recombination is the method followed in yeasts for integration of the plasmid into their chromosome. Figure 2.20 shows the different yeast plasmids.

Fig. 2.20 Yeast integrative and replicative plasmids

Yeast episomal plasmids (YEP) do not require their integration into the yeast chromosome. These plasmids are constructed with the help of 2μm plasmid as a base. The entire 2μm plasmid is used for construction of these new plasmids. Most of the are abbreviated as YEPs.

32

Recombinant DNA Technology and Genetic Engineering

Features of YEP 1. They are shuttle vectors, containing two different origins of replication sites for E. coli and yeasts. 2. They contain 2μm plasmid origin of replication, LEU2 gene and pBR322 origin of replication. 3. These vectors replicate without integration into a yeast chromosome. 4. They contain origin of replication and REP genes. 5. It is moderately stable in the yeast cell. 6. It loses its stability once the 2μm plasmid is lost from YEP. 7. They are high copy number plasmids and unstable vectors.

is true in case of integrative plasmids; therefore, episomal plasmids have been developed. It is easy and large amounts of recombinant plasmids can be obtained from the transformed yeasts, if the gene of interest not only to diagnose the right recombinant but also to isolate or purify large amounts of DNA from the transformed yeasts. Use of YIPs is considered one of the main disadvantages because it is very essential to identify the right recombinant for further analysis. In standard yeast expression experiments, the basic platform experiments such as gene cloning and expression are followed in E. coli. Once the right construct is as shown in Fig. 2.21.

Fig. 2.21 Cloning and selection of recombinants in yeasts

Salient Features of Cloning Vectors 33

Features of YRP 1. They are replicative plasmids and contain origin of replication. 2. They are made of pBR322 plasmid as well as TRP1 from yeast. 3. They contain ARS (Autonomously Replicating Sequences). 4. Stable transformation occurs through crossing over. This is shown in Fig. 2.19 above.

YCP plasmids (Yeast centromere plasmids) These function as true chromosomes and segregate during mitosis and meiosis. This plasmid contains CEN gene.

Features of YCP plasmids 1. They contain autonomously replicating sequences (ARS) and contain centromere sequences (CEN). 2. They are unstable and have low copy plasmids. 3. They are preferred for construction of genomic DNA libraries because they have low copy plasmids.

Features of YLP (Yeast linear plasmids) 1. It is a similar plasmid as YCP. 2. Linear plasmid; both the ends are occupied with telomeres. 3. Single copy and stable plasmid; do not have E. coli origin of replication.

Rapid increase in agricultural product and crop protection from the insect pests are the major developments that and the expression hosts are not only basic requirements but also essential things that have played an important the different plant and animal vectors developed and used. Based on their origin and function, there are three different kinds of plasmids: 1. Agrobacterium Ti- plasmids, natural plasmid 2. Virus-based vectors 3. Direct gene transfer vectors Each of them has been explained below.

1. Ti-plasmids Plant viruses and soil born bacteria are exploited as plant-based vectors for gene transfer. There are two (ii) single-stranded DNA viruses like, Gemini virus. A single soil born bacterium Agrobacterium Tumifaciens causes crown gall disease and Agrobacterium Rhizogenes causes hairy root disease. These two bacteria have been very well-studied and exploited for gene transfer into the plants. These bacterial plasmids have been named as Ti DNA. There are three different kinds of Ti plasmids, octopine, nopaline and agropine. The differentiation has amino acids’. They are very commonly found in plants.

34

Recombinant DNA Technology and Genetic Engineering

Basic features of Ti-plasmids 1. Contain genes coding for octopine and nopaline catabolism and metabolism. 2. Contain genes coding for arginine catabolism. 3. Plasmids also contain tra genes to help the transfer T-DNA from one bacterium to other bacterial or plant cells. 4. Also posses Onc genes for oncogenecity. 5. Contain Ori site for origin of replication and also have inc gene for incompatibility. Figure 2.22 shows different Ti-plasmids.

Fig. 2.22 Ti Plasmids (a) Octopine and (b) Nopaline

Action and Mechanism of transfer DNA (T-DNA) A. tumifaciens is a soil bacterium, lives in soil and infects dicotyledonous plants at the root level. The injured/ wounded plant is the basic requirement for their infection at soil and surface levels. Before the infection, the to the polygalactouronic acid of plant cell wall (on the surface of the plant root). Wounded plant secrets phenolic compounds which induce the expression of vir genes of Ti-plasmid. A similar kind of nick translation, is followed when a component of vir genes nicks at both the ends of doublestranded T-DNA, leading to form single-stranded T-DNA fragment of 5’ to 3’, subsequently, this is carried into the plant cells. The process of integration of T-DNA into plant DNA is very stable, and the sequencing inside the plant cell by initiating the expression of ops gene which codes for opine synthesis. Two different genes get initiated for their expression soon after its integration, they are, cytokine and auxin, which results in disorganised proliferation of cells. That further results in the formation of callus, gall or tumor. These galls The most important feature of Ti-plasmid is its easy integration into the plant DNA and stable maintenance.

Salient Features of Cloning Vectors 35

many genes which gets expressed only in the plant cell, upon which there is the formation of crown gall, along with the synthesis of compounds like opines, which are considered to be the nutrients of the bacteria. Because of all these reasons, they are considered as natural genetic engineers. Figure 2.23 shows the genetic map of TL-DNA.

Fig. 2.23 Genetic map of TL-plasmid

Structure of tumor and its constituents Multiple genetic loci play an important role in controlling the morphology of tumor in TL-DNA of octopine tml causing larger tumors, (ii) tmr inducing tumors with larger number of roots, and (iii) tms causing tumors with larger number of shoots. These are the three loci which control over the size and locality of the tumor. Another organism known as Agrobacterium Rhizogenes contains a large plasmid named Ri-plasmid. They cause the formation of large adventitious roots. But, they do not induce the formation of growth hormones such as auxins and cytokines. They also contain T-DNA, which induces the formation of hairy roots. This condition helps in the introduction of draught resistance. These plasmids only help in introduction of large and longer roots, which are helpful for (i) stable attachment of plants to the soil, (ii) increased draught resistance and (iii) great association with soil microbes. There have been no disadvantages observed in using these plasmids for farming as well as for research features found in both Ti-and Ri-plasmids are, that both of them do not cause any kind of harmful disease, in handling and use of these Ti-plasmids, mainly because of the fact that its large size manipulations are not reference to the absence of a unique restriction site for genetic engineering use. As its mol.wt. ranges 200 kbp in size, almost all the restriction sites can be observed. Unique strategies need to be employed for new cloning experiments. The new strategies which can be followed are (i) Binary vector strategy and (ii) Cointegration strategy. (i) Co-expression or Binary vector strategy: T-DNA is separated from the Ti-plasmid, which means they are integrated into two different plasmids. Therefore, T-DNA does not need to be physically in association with the Tiplasmid. T-DNA alone is functional as normal T-DNA in the Ti-plasmid. Therefore, T-DNA plasmid is constructed, manipulated using standard techniques. When these two different plasmids containing Ti- and T-DNA were present together in the same cell, they work in association with each other for DNA transfer and integration. Another well-known strategy is the co-integration (Fig. 2.24).

36

Recombinant DNA Technology and Genetic Engineering

Fig. 2.24 Binary vector or co-expression strategy: Plasmids A and B complement each other in the host. The T-DNA of plasmid B is integrated to the plant chromosomal DNA by genes carried by plasmid A (ii) Co-integration strategy: A plasmid carrying T-DNA region is used for cloning of the gene of interest. The resulting recombinant plasmid is inserted into A.tumefaciens carrying a Ti-plasmid, and the natural recombination occurs leading to the integration of a new gene into the T-DNA. A.tumefaciens infection leads to the insertion of new gene into the plant (Fig. 2.25).

Fig. 2.25 Co-intergration for gene cloning in Ti-plasmids

Mechanism of Agrobacterium tumefaciens mediated transformation The Agrobacterium tumefaciens bacteria-mediated transformation is a natural way of transformation where an engineered Ti-plasmid is introduced into a plant. The procedure begins with an introduction of wound in

Salient Features of Cloning Vectors 37

able to introduce gene of interest in to the whole plant. Therefore, we need to follow different procedures in order to introduce gene of interest in whole plant and every cell. Figure 2.26 shows the map of recombinant Ti-plasmid after co-integration.

Fig. 2.26 Recombinant Ti -plasmid Dicots such as tomato, tobacco, potato, peas and beans have been extensively used and proved with impossible and the efforts are on to procure transgenic plants or gene cloning for monocots such as barley, rice, and wheat which are the most important crops and are also staple foods for the world. The main reason A.tumefaciens and rhizogenes these are natural phenomenon, hence now researchers have succeeded in developing new technologies, wherein a gene can be transferred in order to generate a transgenic by novel methods of gene transfer. The novel technologies such as biolistics, wherein the object is bombarded with the microprojectiles to introduce plasmid DNA directly into plant embryos. It looks to be robust and can mechanically damage the embryos, but the results suggest that, that is not the case. Also the transformation of monocots with this methodology is considered to be one of the successful methods with reproducibility. This has been proved successful with maize, a monocot until now; the efforts are on for the remaining. Many researchers do not yet know that the method followed for gene transfer is called direct gene transfer. Broadly, the mechanism involved is a super coiled DNA, which may not be able to replicate in plant cell, but has been observed to have the capacity to get integrated into a cell through homologous recombination. It does not matter with the presence or absence of plant chromosomal DNA sequences in the plasmid. Therefore, the mechanism involved is not yet known. This process of integration is independent of T-DNA-based integration. It is also considered as a different process in comparison with the yeast-based transformations. The only thing well known in this procedure is that the integration occurs randomly at any position in any part of the plant chromosome. Small plasmids such as pBR322 have been already successfully transformed into plants. They are well diagnosed with their successful transformation because of the presence of certain antibiotic markers like ampicillin and the presence of cloned gene with certain characters. The biolistics method is successful with the introduction of plasmids into embryos.

Chemical method of gene transfer in plants Molecular crowding agents such as polyethylene glycol (PEG) can also be used successfully, for the introduction of plasmids into plants. PEG containing transformation solution is very viscous in nature, and PEG is a polymeric and negatively charged. DNA after mixing with certain concentrations of PEG, leads to precipitation onto the surfaces of the protoplasts, that induces endocytosis for uptake. The other methods such

38

Recombinant DNA Technology and Genetic Engineering

as liposomes can also be used for delivery, the other methods such as DNA-coated silica needles are also used which penetrate the cell wall that leads to the transfer of DNA. After the successful transfer the cells are grown in the desired suitable media for their further growth and for regeneration of cell walls. Once the cell walls are intact and regenerated, they can be spread onto selective media, further identifying transformants to provide callus cultures, subsequently leading to the formation of grown plants. The brief descriptions of DNA transfer into protoplasts are given below.

Protoplast culture and its utilisation for gene introduction into each cell of the plant The simplest way of introducing the gene into whole plant is by introducing a gene of interest into a protoplast or plant cell cultures in liquid medium. The protoplasts can be treated as similar to micro-organisms in order to introduce the gene of interest. After which they can be plated onto a selective medium in order to isolate transformants. A mature plant developed from these transformed protoplasts contain the cloned gene in each and every cell. The same gene is subsequently passed onto the offspring.

2. Virus-based vectors Plant viruses as cloning vectors E. coli system. Viral infections in plants is a very common phenomenon, which suggests that the use of plant viruses as cloning vehicles. The natural infection process of viruses could be used for the introduction of plasmids into plants. The genomic material of viruses gets integrated into plant genome, subsequently introducing the desired gene of interest into the plant system. It is one of the natural processes, but it does not possess any direction. We may not be able to know the vicinity of its integration. Therefore, the success with these vectors is considered to be very limited. The main problem with these vectors is RNA being the genetic material of many viral genomes, which is with great success in plant biotechnology. Before the use of particular virus as vectors, one needs to study and understand about the virus and its particles. Subsequently, viral DNA/RNA vectors can be constructed that can express in host cell. The existing plant viral vectors are non-integrative and are transmitted systematically, assembled, and maintained as high copy numbers. It has been observed for many years now, that they never integrate into to carry extra nucleic acid, (ii) should possess broad host range, (iii) should be easily transmitted, and they should be able to integrate into host genome. Based on the above characteristics, three different viruses were

(a) in plants. However there are limitations for the use of these vectors, as they infect only the crucifer family. The main advantages of using this virus for the delivery is because its genome is a double-stranded DNA, and the infection through this method is very simple where the transmission occurs by rubbing the viral particles on the surface of the leaf. The transmitted viral particles are isometric in shape, and 50 nm in diameter. They can be isolated as inclusion bodies. It requires only 3–4 weeks of time for its spread in the plant, where high copy plasmids can be observed in plant cells. Figure 2.27 vectors.

Mechanism of its infection The structure of the virus DNA remains as linear open circular molecule, a single coding strand containing six major and two minor open reading frames. Reverse transcription is the major mechanism of replication.

Salient Features of Cloning Vectors 39

Subsequently after the infection, mini-chromosome formation occurs inside the nucleus. Further, the minichromosome functions as a template for RNA polymerase II, leading to the formation of RNA transcripts. These transcripts are further transferred to the cytoplasm, where translation or replication into (-) DNA occurs in the presence of reverse transcriptase. Finally, after formation of (-) and (+) DNA strands, they are packed to form viral particles. The life cycles are further repeated after the infection spreads in a new plant.

Fig. 2.27 Replication 1. Replicates by reverse transcription. 3. Subsequently, the covalently closed DNA associates with host histones, to form a super coiled mini chromosome. It further leading to the production of 35s RNA through transcription, which translates protein as well as forms dsDNA by the process of reverse transcription. 4. Finally, new viral particles are produced which gets targeted to inclusion body and is released outside. Since most of the vectors have severe problems in post- infection processing especially with the virus genome is similar to like and requires to package into protein coats. They cannot carry a big junk of DNA fragments, even after the deletion of noncoding regions. In order to overcome this problem, the phagemid mechanism has been adapted, wherein a large junk of noncoding regions of the virus has been deleted, so that it can carry a large inserted gene, but cannot direct the infections by itself. Although this approach has considerable potential, it cannot be further followed for many plant varieties because of its narrow host range. This also restricts the use of these technologies to other plant varieties because the cloning and transformations do not occur. However, these caulimo-viruses have a very important role to play in genetic engineering as they are the source of high active promoters that work in all plants. (b) Tobamo viruses: They are known as tobacco mosaic viruses, and RNA is the basic genetic material. The genetic material is present as large, linear and undivided. It is usually constructed by inserting the gene of interest at the 3’ end of the movement protein ORF.

40

Recombinant DNA Technology and Genetic Engineering

(c) Gemini vectors: They are the viruses which cause diseases in maize, cereals, cassava, tomato, and chloris. They contain single stranded linear DNA as the genetic material. They have major disadvantages in genetic engineering, as the genomes of some of these viruses undergo genome arrangement and deletions after the infection. Therefore, there is no guarantee of integration of foreign gene into the plant genome, as the cloned gene in the virus might have been deleted which is a natural process, as observed. Not much development was observed in order to use them as best cloning vectors in a plant system. The map shown in Fig. 2.27, contains 600 nucleotide long leader sequence with different ORFs ranging from 1 to 8, coding for movement protein to translation initiator protein. It was discovered at the beginning of the 1980s, by Chua and collaborators at the Rockefeller University. The promoter virus, i.e., 35S RNA is a very strong constitutive promoter which mediates for the transcription of the whole CaMV genome. It is well known for its use in plant transformation and high levels of gene expression in dicot plants. However, it is less effective in monocots, especially in cereals. The promoter is known as CaMV 35S naturally driven by this promoter. It is one of the most widely used general purpose constitutive promoters. (Fütterer et al., 1988; Pooggin et al.,1998 ). The 600 base leader sequence is followed by seven tightly arranged longer ORFs that encode all the viral proteins (reviewed by Hohn and Fütterer, 1997). The mechanism of expression of these proteins is unique, wherein, the ORF VI protein (encoded by the 19S RNA) controls the translation reinitiation of major open reading frames on the polycistronic 35S RNA, which normally happens only on bacterial mRNAs. TAV function depends on its association with polysomes and eukaryotic initiation factor eIF3 (Park et al., 2001). 1. ORF I - Movement protein 2. ORF II - Insect transmission factor 3. ORF III 4. ORF IV - Capsid protein 5. ORF V - Protease, reverse transcriptase and RNAseH 6. ORF VI - Translational activator / Inclusion body protein 7. ORF VII - Unknown (dispensable)

Advantages

2. CaMV infections are systemic, and even its DNA is infectious when inoculated on abraded plant surfaces. 3. The CaMV genome has genes II and VII, and are non-essential. As a result, only these two genes can be replaced/deleted without a loss of infectivity.

Disadvantages packaged into virions. These two factors seriously limit the size of DNA insert clonable in CaMV.

3. Animal cloning Vectors

Salient Features of Cloning Vectors 41

Because of these problems, considerable efforts have been put in constructing novel plasmid vectors for mammalian cell expression. These ultimately will be used for expression of certain therapeutic genes in mammalian system. They can also be further used for gene therapy, in order to treat many other hereditary chronic diseases such as diabetes, etc. The main objective in gene therapy will be cloning and expression of gene of interest in the given organism, by overcoming the problems of lack of genes, such as in type 2

on developing mammalian vector systems, progress has been tremendous in obtaining the insect-based vectors rapidly. Delivery of genes by a virus is termed as transduction and the infected cells are described as transduced containing DNA into monkey kidney cells. Most of the mammalian vectors are considered as virus based, similar to plant viral vectors. In order to develop a mammalian vector system, it is essential to understand the basic mechanism of infection of these viruses, which causes diseases. The infection of a virus begins with its attachment to the body surface of a host and infecting the cells. This is the basic ability, which has been exploited in making virus-based vectors. These vectors in turn, are designed suitably in order to introduce foreign DNA or gene. After the construction of the recombinant plasmid, they are transformed into the mammalian cell lines. There have been vectors developed so far. The traditional vectors are adenoviral vectors, followed by papilioma-viruses, retroviruses advanced vectors for mammalian gene expression. The retroviral vectors are the main and most commonly used for mammalian gene cloning and expression followed by insect viral vectors.

Viral vectors for gene cloning and expression should have the following characters. The construction of viral 1. Safety: These viral vectors are occasionally created from pathogenic a way as to minimise the risk of handling them. These vectors do not contain viral origin of replication. helper virus to provide the missing proteins for the production of new virions. 2. The viral vector should have minimal effect on the physiology of the cell it infects. 3. Stability: Some viruses are genetically unstable and can rapidly rearrange their genomes. Therefore, these vectors would be able to show higher stability. 4. infect as wide a range of cell types as possible. 5. Viral vectors should also contain certain genes that help identify which cells took up the viral genes. These genes are called markers; a common marker is antibiotic resistance to a certain antibiotic. They will be very useful in identifying recombinants with ease.

For basic research Viral vectors were originally developed as an alternative to transfection of naked DNA for molecular biology experiments. Compared to traditional methods of transfection such as calcium phosphate precipitation, transduction can ensure that nearly 100% of cells are infected without severely affecting cell viability and cell wall integrity. Furthermore, some viruses integrate into the cell genome, facilitating stable expression in integrative vectors.

42

Recombinant DNA Technology and Genetic Engineering

Protein coding genes can be cloned and expressed using viral vectors, commonly to study the structure and function relationship of proteins and their partners. Viral vectors, especially retroviruses, expressing stable marker genes such as GFP are widely used to permanently label cells to track them and their progeny.

For gene therapy In the era of biotechnology, only the gene therapy may provide a way to cure genetic disorders such as severe (SCI), (CF) or even Haemophilia A. Because these diseases result from mutations deliver unmutated copies of these genes to the cells of the patient’s body. There have been a large number of laboratory successes with gene therapy. However, human immune system always considers these viruses as foreign bodies. These viruses not only impede the delivery of genes to target cells but also can cause severe complications for the patient. In one of the early gene therapy trials in 1999, this led to the death of Jesse Gelsinger, who was treated using an adenoviral vector. Use of these vectors are still considered to be dangerous, because it was found that some of the viral vectors, such as lentiviruses, insert their genomes at randomly on one of the host chromosomes, which can disturb the function of cellular genes and lead to cancer. In another instance, it has been observed that in the retroviral gene therapy trial conducted in 2002, four of the patients developed leukemia because of the treatment. Finally, it was concluded that the adeno-associated virus-based vectors are much safer in this respect as they

For vaccine development Viruses expressing pathogen proteins are currently being developed as vaccines against these pathogens, based on the same rationale as DNA vaccines. Basically, infected cells are recognised by T-lymphocytes based on the foreign proteins produced within the cell. T-cell immunity is crucial for protection against viral infections. Viral vaccine induces expression of pathogen proteins within host cells similarly to the attenuated vaccines. However, since viral vaccines contain only a small fraction of pathogen genes, they are much safer and sporadic infection by the pathogen is impossible. Based on these studies, adenoviruses are being actively developed as vaccines.

Retroviruses are one of the basic components of current gene therapy approaches. The recombinant retroviruses such as the Moloney Murine Leukemia Virus (MMLV) have the capability for stable integration into the host genome. They contain an enzyme reverse transcriptase that allows preparation of DNA molecule from the existing RNA as a genetic material of the organism. They have been used in a number of FDAapproved clinical trials. Retroviral vectors are two different kinds based on their ability to replicate in the host; they can either be replication-defective or replication-competent. Replication-defective vectors are the most common choice in studies because the viruses had the coding regions for the genes necessary for additional rounds of virion replication and packaging replaced with other genes, or deleted. The replication region can be considered for the insertion of gene of interest which later delivering their viral payload, but then fail to continue the typical lytic pathway that leads to cell lysis and

Salient Features of Cloning Vectors 43

Conversely, replication-competent viral vectors contain all necessary genes for virion synthesis, and continue to propagate themselves once the infection occurs, and are bulky in nature. Because the viral genome for these vectors is much lengthier, the length of the actual inserted gene of interest is limited, compared to the possible length of the insert for replication-defective vectors. Depending on the viral vector, the typical maximum length of an allowable DNA insert in a replication-defective viral vector is usually about 8–10 kbp. While this limits the introduction of many genomic sequences, this is the only limitation observed with these vectors. The stability has been observed to be another problem present with it, because of its large molecular weight.

Main disadvantages of retroviruses 1. The primary drawback of retroviruses such as the moloney retrovirus involves the requirement of cells to be actively dividing for transduction. As a result, cells such as neurons are resistant to infection and transduction by retroviruses. Neuron transduction by using these vectors has been a big failure. 2. There is a concern that insertional mutagenesis due to integration into the host genome might lead to cancer or leukemia. Retrovirus vectors are the most commonly used viral vectors for gene cloning, because they have wider hence, large quantities are essential for transformation into fully differentiated cells like neurons, hepatocytes etc. There are three different genes which play an important role in viral replication and assembly.These genes gag, pol and Env of retro viruses are replaced with foreign DNA.The resulting foreign DNA is subsequently introduced into mammalian cells (Fig. 2.28).

Fig. 2.28 Construction of recombinant defective retroviral DNA

They are a subclass of retroviruses. In recent times, they have been developed as cloning vectors for mammalian system. They infect and integrate nondividing cells, which is the most unique feature of these lentiviral vectors. Retroviral vectors, on the other hand, infect only the highly proliferating and dividing cells. The basic genetic material of the organism is single-stranded RNA molecule. Once it is infected, RNA is

44

Recombinant DNA Technology and Genetic Engineering

transcribed to DNA in the cell, which is then integrated randomly into the host genome. Viral integrase plays an important role in integration. This is the state of provirus, it remains in the genome and is passed onto the It has been observed earlier that malfunction or uncontrollable functioning of these cellular genes provokes oncogenes, leading to cancer. This is the main concern that is present with the use of lentiviral vectors for the gene therapy. However, clinical trials have shown that used to deliver gene for gene therapy for the treatment of HIV and experienced no increase in mutagenic or oncologic events.

Their primary applications are in gene therapy and vaccination. These vectors are not integrative, as opposed to lenti-viruses, and are not replicated during cell division. This limits their use in basic research, although adenoviral vectors are occasionally used in in-vitro experiments. Since humans commonly come in contact with adenoviruses, which cause respiratory, gastrointestinal and eye infections, they trigger a rapid immune response with potentially dangerous consequences. New vectors with many advantages for gene therapy and genetic engineering are being developed in recent times.

Adeno-associated viruses AAV can infect both dividing and nondividing cells and may incorporate its genome into that of the host cell, therefore, they are integrative vectors. These features make AAV a very attractive candidate for creating viral vectors for gene therapy. Adeno-associated virus (AAV) is a small virus that infects humans and some other primate species. AAV is not currently known to cause disease and consequently the virus causes a very mild immune response.

Drosophila melanogaster. The use of this organism began in 1910 by Thomas Hunt Morgan, American evolutionary common inherited characteristics. These experiments are followed till date in conventional genetics to study inheritance and the diseases of inheritance. Homeostic selector genes are the one, which controls the overall D.Melanogaster is being used as a model for the study of human developmental processes. Many developments have occurred in the use of D.Melanogaster for experimental biology therefore, the expression vectors, plasmids are wellestablished basic components. Unlike bacteria, yeasts, plants and mammalian cells, D.Melanogaster does not possess any kind of plasmids. But there is one similarity that has been observed that it is also susceptible for bacterial and viral infections, these have not been exploited as the basis for the construction of newer cloning vectors. Instead, cloning process in D.Melanogaster depends on the new vectors known as transposons, also known as P elements.

Transposons or P elements 1. 2. 3. 4. 5. 6.

They are short pieces of DNA 2.9–10 kbp. They can move from one position to the other in the chromosome of a cell. Usually they contain short inverted repeats at the terminal ends of the DNA. Transposase enzyme plays an important role in transposition process. The inverted repeats form the recognition sequences. They can jump between chromosomes or between the plasmids.

Salient Features of Cloning Vectors 45

P elements 1. The D.Melanogaster vector contains two P elements: (a) One of the P element contains the multiple cloning sites, where the fragment of interest is cloned. (b) Once the DNA fragment is introduced into the P element, it results in disruption of its transposase gene. The second P element cannot function in the absence or malfunctioning of the other P element. After cloning the gene of interest into the vector, the recombinant DNA is microinjected into the embryos. The transposase with one of the P element disturbed, directs transfer of the engineered P element into one of the Drosophila chromosomes. If this process occurs in the germ line nucleus, then it leads to the formation of embryos carrying copies of the cloned gene in all its cells.

role in molecular biology? 2. Explain in brief: a. Plasmid compatibility b. Conjugative and Nonconjugative plasmids 3. Name some of the most common commercially available plasmids? Give an example for prokaryotic, eukaryotic and shuttle plasmids? 4. Explain in brief: a. Cosmid b. BAC c. YAC d. PAC with an example. 6. What are bacteriophages? Explain in brief the phages used in molecular biology? 8. Explain the importance of phagemid vectors in gene cloning? 9. What is yeast 2μm plasmid? Explain its features? 10. Explain in brief with two features i. YCP ii. YIP iii. YEP iv. YRP v. YLP 11. What is Ti-plasmid? Explain its mechanism of function and importance in molecular biology? 12. What is integration? Explain the different kinds of integrations?

multilayer structure’. Virology 186, 655–668. Hohn,T and Fütterer, J (1997). ‘The Proteins and Functions of Plant Para Retroviruses: Knowns and Unknowns’. Crit.Rev.Plant Sci. 16, 133–161.

46

Recombinant DNA Technology and Genetic Engineering

Park H S, Himmelbach A, Browning K S, Hohn T, Ryabova L A (2001). ‘A Plant Viral ‘Reinitiation’ Factor Interacts with the Host Translational Machinery’. Cell 106, 723–733. Pooggin, M M, Hohn, T, and Futterer, J (1998). ‘Forced Evolution Reveals the Importance of Short Open Reading Frame A and Secondary Structure in the C Mosaic Virus 35S RNA leader’. Virol 72, 4157–4169. Rothnie, H M, Chapdelaine, Y, and Hohn, T (1994b). ‘Para -retroviruses and retroviruses: A Comparative Review of Viral Structure and Gene Expression Strategies’. Adv.Virus Res. 44, 1–67. Goff S P and Berg P (1976), ‘Construction of Hybrid Viruses Containing SV40 and Lambda Phage DNA Segments and their Propagation in Cultured Monkey Cells’. Cell. 9:695–705. Entrez Pubmed 189942. McDowell N, 15 January 2003, ‘New Cancer Case Halts US Gene Therapy Trials’. New Scientist. Cavazzana-Calvo M, Hacein-Bey S, de Saint Basile G, Gross F, Yvon E, Nusbaum P, Selz F, Hue C, Certain S, Casanova J L, Bousso P, Deist F L, Fischer A (2000). ‘Gene Therapy of Human Severe Science 288 (5466): 669–72. Principles of Retroviral Vector Design. Montini E, Cesana D, Schmidt D, et al. ‘Hematopoietic Stem Cell Gene Transfer in a Tumor-Prone Mouse. Model Uncovers Low Genotoxicity of Lentiviral Vector Integration’. Nat Biotechnol. 2006 Jun; 24(6): 687–696.

PLASMID BIOLOGY 3.1 STRUCTURAL AND FUNCTIONAL ORGANISATION OF PLASMIDS There are two kinds of genetic material found in the bacteria; (i) chromosome (genomic DNA) and (ii) plasmid DNA. Genomic DNA is a single circular commonly present in most of the bacteria; some species also contain one or more plasmids. A plasmid is an extra chromosomal DNA which is small and possesses self-replicating ability. They mainly code for resistance to antibiotic. The plasmid usually contains the genes which code for: 1. Resistance to disinfection 2. Cause disease 3. Responsible for fermentation of milk to cheese in laboratory 4. Confers capability to use complex chemicals such as hydrocarbons for food 5. Conjugation/fertility or gene transfer. originated from bacteriophages. The molecular weight of the plasmid

engineering because of their stability in-vivo

3.2 CHARACTERISTICS OF PLASMIDS replication and antibiotic resistance marker. The resistance conferred by a micro-organism is mainly due to two reasons; either the presence of gene most of the antibiotic genes are of plasmid origin. These antibiotic markers in antibiotic media. Selectable resistance gene can also be introduced in originated through genetic engineering technology. Higher the molecular

Chapter

3 Contents

48

Recombinant DNA Technology and Genetic Engineering

3.3 PLASMID REPLICATION A basic unit of replication is a replicon

are in demand because of their ability to maintain large copy numbers in the host. They can maintain large fragments after the cloning. These plasmids are essential and are used for in-vivo

copy number plasmids are preferred because accumulation of high copy number of toxic genes and their used for cloning and maintenance of large DNA fragments successfully. Table 3.1 shows detailed information of different plasmids.

Table 3.1 Types of various plasmids Serial number 1. 2. 3. 4. 5. 6. 8.

Name of the Plasmid pBlueScript pBR322 pUC pMOB45 pACYC pSC101

Name of the replicon pMB1 Mutated form of pMB1 pKN402 p15A pSC101

Copy number 300 – 500 15 – 20 20 – 30 15 – 120 15 – 20 1–5 15 – 20

There is a relation between the maintenance of number of copies of a plasmid to that of the bacterial growth

Plasmid Biology

49

in a relaxed fashion are termed as relaxed

inhibited and in the presence of antibiotic chloramphenicol in the media. This further infers that inhibition of

effected by cellular growth conditions. Such plasmids are known as stringent plasmids.

There is a direct relation between the concentration of RNAI and the plasmid DNA replication. As the

protein concentration is maintained stably when the half-life of RNAI is not only short but also the rate of degradation is proportional to the rate of growth of culture. These conditions are stably maintained in normal

This mechanism helps in the maintenance of RNAI population as well as the plasmid copy number.

The Repressor of Primer (ROP)

ROP not rop gene leads to uncontrolled plasmid replication leading rop gene are

copy numbers.

50

Recombinant DNA Technology and Genetic Engineering

plasmid incompatibility. These plasmids cannot be maintained in the same cell simultaneously. It is well known that vice versa. The incompatibility problem arises when the plasmid molecular weights are similar. It is mainly because of the distribution in the initiation machinery that leads to the slowdown of the synthesis rate.

in-vivo

in-vitro)

The stability of a plasmid in-vivo and in-vitro depends on the length and copy number of the plasmid. The length and copy number of a plasmid is one of the most important features which play an important role in

stable.

3.4 PLASMIDS CARRYING CONJUGATION OR FERTILITY FACTORS conjugative plasmid and exists with many components which work in co-ordination. The components of the fertility factor is Fin O known as fertility inhibition system and Fin P known as fertility promoter system. These two factors along TraJ the tra operon. Tra tra 1. 2. 3. 4.

Ori T : Ori V : tra- genes: IS elements : This is known as insertion sequences .

driver sequence).

1. F+ Bacteria: It is an autonomous genetic material and functions independently from the host genome. It TraS

Plasmid Biology

51

and TraT surface exclusion proteins. Presence of these proteins helps in the maintenance of single kind of plasmid DNA in a single bacterium with the compatibility factor. 2. F’ Bacteria:

–

3. F – Bacteria: +

Infection

+.

4. Hfr Bacteria:

important role.

3.5 DIFFERENT TYPES OF PLASMIDS

at different speed in gel electrophoresis. Based on their electrophoretic mobility there are different kinds of 1. 2. 3. 4.

Nicked DNA Linear DNA Relaxed DNA Covalently closed circular or super-coiled

5. Super-coiled denatured to DNA being subjected to excess alkalinity.

REVIEW QUESTIONS rop

52

Recombinant DNA Technology and Genetic Engineering

REFERENCES Molecular Genetics of Bacteria plasmids and bacteriophages ).

rd

ENZYMES USED IN GENETIC ENGINEERING 4.1 INTRODUCTION As we understand, genetic engineering involves creation of new or novel recombinant plasmid DNA molecules which are the basic ingredients for further research. In order to create a recombinant molecule, one needs to follow plasmid DNA isolation, restriction enzyme digestion, dephosphorylation of digested plasmid vector, etc. It is also very essential to make the restriction digested insert DNA for cloning. Finally, these fragments are further ligated by using T4 DNA ligase. It means each step in gene cloning essentially depends not only on restriction enzymes, but also on modifying enzymes. This chapter deals with understanding the function of each enzyme and also the use of different enzymes at different stages of gene cloning. It is very essential to understand these enzymes and their mode of function before using them in the molecular biology laboratory, because there are multiple kinds of enzymes released in the market by multinational companies, causing confusion among the consumers as to which enzyme is to be used. Suppose in the case of polymerases, there are many kinds, like, klenow fragment formed after restriction digestion with sticky-end cutter. It can also be used only when the reaction mixture does not contain any substrates such as dNTPs and so on. In the presence and absence of substrate, the enzyme function can be altered as it is seen in the case of klenow as well as T4 DNA polymerases. Klenow fragment contains two subunits known as larger and shorter fragment which are extensively used in oligo-nucleotide- based site-directed mutagenesis, where it acts as a polymerase for synthesis of the remaining strand. The other common polymerases are very commonly There are some enzymes which play an important role in making new genes. They are known as Reverse Transcriptases in AIDS virus, and have the capability to synthesise DNA from RNA. The polynucleotide kinase (PNK) is another enzyme which plays an important role in the introduction of phosphate group to the DNA fragments at their the vector plasmid. It has many other functions such as making radioactive to the 5’ termini of DNA fragment. In contrast, the opposite nature is observed with the Alkaline phosphatase, an enzyme that plays an important role in removing the phosphate group from phosphoryl esters. This is very essential in preventing the background clone formation in gene cloning leads to self -ligation of the plasmid vector. The common nucleases used in

Chapter

4 Contents polymerase Transcriptase Deoxynucleotidyl Transferase polymerases phosphate group/kinasing relation by alkaline phosphatase

endonuclease I and II

form phagemid endonuclease I and II

54

Recombinant DNA Technology and Genetic Engineering

molecular cloning is S1 nuclease, which is a very important enzyme that removes single-stranded tails from double stranded DNA. But it is incapable of acting on double-stranded DNA, RNA and DNA:RNA hybrids. cDNA from mRNA for removing hairpin loops. DNA ligase is the other enzyme without which the joining of two DNA fragments is impossible. This chapter deals in conceptual understanding of the enzymes used in gene cloning and their practical approaches. The chapter begins with DNA polymerases, followed by explaining the common enzymes such as T4 polynucleotide kinase (T4 PNK), T4 DNA ligase, Calf intestinal alkaline phosphates (CIAP), and different polymerases among others. approaches where it will help in setting up a reaction, analysing the results with certain photographs, etc. Table 4.1 explains the different enzymes essentially used in molecular biology.

Table 4.1 Enzymes and their functions Restriction enzyme DNA Cutting

T4 PNK

T4 DNA ligase

T4 DNA pol

Incorporation Ligating of phosphate DNA group fragments

Strand synthesis, Blunting

Klenow large fragment DNA

Reverse DNA transcriptase polymerases RNA to DNA synthesis reactions

Strand synthesis, Blunting

on the objective, one can even select the polymerases. DNA polymerases show different activities beginning with polymerase, proofreading activity, 5’ to 3’ exonuclease activity, 3’ to 5’ exonuclease activity, etc. Many

to one termini making a double-strand DNA as a template is preferred by many of the polymerases. RNA is polymerases which use RNA as the template. They are reverse transciptase. Most of the commercially available and present polymerases are originated from E. coli and bacteriophages. There are some polymerases which known as terminal transferases.

E. coli E. coli bacterium. This is a single chain polypeptide of 109 kDa molecular weight. This is the only polymerase which shows dual roles 5’ to 3’ DNA polymerase, 5’ to 3’ exonuclease and also 3’ to 5’ exonuclease activity. It also has RNAse H activity. The main function involved by this polymerase is that it recognises a nick in the double-stranded DNA

Enzymes used in Genetic Engineering

55

molecule and synthesises a completely new strand based on the existing complementary strand. Therefore, mechanism is depicted in Fig. 4.1 ((a) and (b)). 5 3

3 5

Double-stranded DNA

3 5

Nicked DNA

3 5

Initiation of polymerisation

DNase 5 3 Addition of dNTPs

5 3

3

5

Polymerisation and synthesis

(a)

5

A 3

T T

C A

G G

G C

T ….. C

A

3 DNA polymerase A

T

G

C

3

..

Newly synthesised

dATP, dTTP, dCTP, dGTP Mg++ 5

A

T

C

G

G

T

T

A

C

G 3

3

T

A

G

C

C

A

A

T

G

C

(b)

Fig. 4.1 (a) Nick translation by DNA polymerase (b) Polymerisation Mechanism Polymerase is also used for many genetic engineering purposes beginning with nick translation for

polymerisation function, when there are no dNTPs in the reaction, it leads to the removal of protruding ends of the strand at 3’.This has been depicted in Fig. 4.2.

56

Recombinant DNA Technology and Genetic Engineering

Fig. 4.2 5’ to 3’ Exonuclease activity by DNA polymerase The whole enzyme codes for many different kinds of functions. Further studies were conducted in order to understand the importance of different regions of DNA polymerase. The structure and function studies have shown that the functions such as polymerase and nuclease are under the control of different parts of the enzyme. Deletion of C-terminal region from 323 amino acid residues (323 up) shows only the nuclease activity, but no polymerase activity. Similarly, the N-terminal 323 amino acid removal leads to no nuclease activity. Hence, the whole enzyme can be divided as two domains N and C–terminal domain. Figure 4.3 shows the domain feature of Klenow fragment.

Fig. 4.3 Domain of Klenow fragment

Nick translation is the suitable technology where klenow fragment is used extensively. The most commonly used DNA polymerase for normal PCR is Taq DNA polymerase, which is also a DNA polymerase 1 enzyme from the bacterium Thermus aquaticus. There are many enzymes of such kind such as T4 DNA polymerase, T7DNA polymerase and Taq, and so on.

Enzymes used in Genetic Engineering

57

Taq DNA polymerase but not other polymerases because denaturation step occurs at 94ºC or more for 4–5 min. Other than Taq, all others are thermolabile. They cannot withstand those temperatures, and It is very well-understood that Taq is thermostable enzyme and does not get inhibited after incubation at higher temperatures. So most of the commercial enzymes available for PCR are thermostable, and there are

strand. Longer the strand synthesised, more will be the mutations, and hence, the other enzyme such as Pfu polymerase is preferred. This enzyme is not only thermostable but also shows proofreading activity, which is not observed in case of Taq DNA polymerase. There are new enzymes such as phire DNA polymerase, Fusion DNA polymerase and hot start

The most important enzyme with very high potential use in molecular biology is reverse transcriptase which is found in viruses. This enzyme is involved in the replication of several kinds of viruses, mainly the AIDS virus. Reverse transcriptase utilises RNA as a template and not DNA; hence, it is called RNA-dependent DNA polymerase. This is the protein which initiated the term cDNA (complementary DNA). There are two different kinds of reverse transcriptase and their names are based on their origin, AMV (avian myoloblastosis) reverse transcriptase and MLV (murine leukemia virus) reverse transcriptase. Both these enzymes lack exonuclease activity.

Mechanism and action Avian reverse transcriptase is a bidomain (some are single domain) 84 kDa polypeptide. Both the domains show two different functions polymerase and RNAse H activity. When transcription occurs from the RNA as a template, at the beginning of the reaction, there is a competition for both the functions, i.e., polymerase and RNAses H activity. RNAse H functions as soon as there is a formation of hybrid DNA: RNA thereby cleaving the template near 3’ terminus of the growing DNA strand. These enzymes are very sensitive for temperature and pH. They can be used for probe synthesis from DNA or RNA as templates.

It is a single domain 60 kDa polypeptide, and is found only in pre-lymphocytes and at initial stages of differentiating lymphoid tissues. Similar to the polymerase enzyme, this also has the capability to incorporate dNTPs and ddNTPs at the 3’end of the template. The incorporation of pyramidines and purines depends on the presence of divalent cations. In the presence of Mg2+ of CO2+, pyramidines are incorporated. The enzyme uses many different kinds of template DNAs with 3’OH termini, blunt end and sticky 3’ ends. Presence of CO2+ co-factor ensures its wide spectrum activity.

There are three different kinds of RNA polymerases, bacteriophage SP6, T7, and T3 RNA polymerases.

Recombinant DNA Technology and Genetic Engineering

58

molecule from double-stranded DNA, which has been cloned at the downstream of the promoter. All the bacteriophage RNA polymerases show similar functions, most of these polymerases have been cloned and expressed in E. coli

Uses 2. Substrate synthesis for in-vitro translation system. 3. T7 RNA polymerase has been utilised for the development of T7 expression system by studier, which E. coli.

T4 polynucleotide kinase to a 5’ terminus of either double-stranded DNA or RNA. The kinase has been used in two different reactions : forward and exchange reactions. Forward reaction is very commonly used in molecular biology where the Forward reaction is represented in the following manner: DNA OH 5’ or RNA OH 5’…T4…PNK………………………5’ [32 VATP,

5 A

T

C

G

G

T

…..

3

Mg++

2+

5

T4PNK

A

T

C

G

G

T

…..

3

P

Precautions 1. Try to include spermidine in the kinasing reactions which stimulates incorporation. 3. Ammonium ions are the inhibitors of kinasing reaction. Hence, prior to kinasing, DNA should not be subjected to ammonium ion based precipitation. 4. Low concentrations of phosphate inhibit polynucleotide kinase.

T4 PNK catalyses the transfer of terminal phosphate group of ATP to the 5’ OH termini of dS, ssDNA and RNA. It also catalyses the exchange of terminal 5’ P group of ds, ssDNA and RNA. 1. Addition of phosphate group by T4 polynucleotide kinase. X stock) T4 PNK ddw (double distilled water) Total volume

1 l 7 l 20 l

Requirements

Enzymes used in Genetic Engineering

Incubate at 37°C for 1 hour. 2. Heat inactivation.

75°C for 10–15 min.

Reaction set up

T4 PNK ddw Total volume

1 l 4 l 20 l

Incubate at 37°C for 1 hr. 1. Heat inactivation at 75°C for 15 min.

59

60

Recombinant DNA Technology and Genetic Engineering

Presently, there are two different alkaline phosphatases commercially available: Bacterial Alkaline Phosphatase (BAP) and Calf Intestinal Alkaline Phosphatase (CIAP) which catalyse the removal of 5’ phosphate from nucleic acids and nucleotides such as DNA, RNA, rNTP, and dNTPs.

Uses 1. Inhibits self-ligation of plasmid vector by removing 5’ phosphate from restriction digested plasmid vectors. 2. Alkaline phosphatases are considered to be resistant to heat and detergents. 3. Proteinase K inhibits CIP. 4. It can also be inactivated by heating to 65°C for 60 min or 75°C for 10 min. 5. In order to make sure that there is no more CIP in the reaction, the reaction mix should be phenol:chloroform

Mechanism 5’pDNA or 5’ pRNA

5 P

Alkaline phosphatase

Alkaline phosphatase

A

T

C

Before

G

G

T … 3

5’OH DNA or 5’OH RNA.

5 O

A

T After

C

G

G

T … 3

Enzymes used in Genetic Engineering

61

1. Reaction mixture: 10X

Incubate at 37°C for 30 min.

DNA for ammonium sulfate mediated precipitation after enzymatic treatment.

step being the ligation of vector and the insert to make a recombinant molecule. The enzyme which plays an important role in ligation is ligase that catalyses to join two pieces of DNA. In the ligation reaction, the enzyme forms a phosphodiester bond between the adjacent 3’ hydroxyl and 5’ phosphate termini in DNA. The ligation may be of a different kind like blunt end ligation, and sticky end ligation, etc. The simple mechanism of ligation is depicted in Fig. 4.4.

Fig. 4.4 Illustration of ligase function

Mechanism There are multiple metabolic pathways, physiological conditions, DNA replications, recombinations, etc., during which there are chances for DNA phosphodiester bond breakage between adjacent nucleotides. This brings the discontinuity in the continuous chain of nucleic acid. DNA ligases play an important role in

62

Recombinant DNA Technology and Genetic Engineering

and joining of the two different DNA molecules through phosphodiester bond. In the laboratory, these ligases depicts the mechanism involved in cohesive and blunt-end ligations.

Fig. 4.5 Cohesive and Blunt-end ligations

Different ligation reactions [Fig. 4.6(a) and (b)] show two blunt-end DNA fragments joined together by ligase.

common problem can be overcome by increasing the ratio of vector and the insert. The recently developed reaction, (ii) Incubation of the reaction mixture at room temperature for ligation, (iii) Heating and spontaneous cooling of the reaction mix, and (iv) Introduction of high concentrated ligase are considered to be very cohesive ends onto a blunt end DNA by linkers or adapters.

Enzymes used in Genetic Engineering

63

enzyme to work on. The transient and stable structures play an important role in making the basic platform

introducing linkers into the gene of interest to be cloned. The traditional methods conclude by introducing linkers to the fragment of interest by ligation, where huge amounts of linker could be introduced in the reaction since it is time consuming and is a labour-intensive process. Hence, the recent technology of introducing the

which generates cohesive termini.

Single chain 68 kDa polypeptide involved in catalysing the formation of phosphodiester bond between 3’ hydroxyl and 5’ phosphate termini in DNA. This function plays an important role in joining cohesive and

monovalent cations and certain concentrations of polyethylene glycol.

4.8.4 E. coli Its functions are similar to that of the above enzymes, but do not show RNA fragment ligation.

well as RNA to 3’ hydroxyl group of single-stranded DNA or RNA.

64

Recombinant DNA Technology and Genetic Engineering

Ligase Reaction set up

T4 DNA ligase ddw

1 l 7 l

1. Incubate at 16°C for 5–6 hrs at room temperature or at 14–16°C. 2. Run 0.9–1.0% agarose gel and visualise under UV transilluminator.

Ligation Tips as it is received. prevented. temperature for ligation. complete ligation.

Fig. 4.6 Agarose gel electrophoresis separation of ligated / concatemerised DNA fragments

Conclusion After ligation, 2.5 kbp DNA fragment will attain 5, 7.5 kbp and above. Since we can see clearly, the 5 and 7.5 kbp fragments, this indicates that the ligation is complete.

Enzymes used in Genetic Engineering

65

Most bacteria consist of restriction endonucleases, which provide protection against foreign DNA. Whenever foreign DNA invades the system, it is rapidly cleaved by the restriction enzymes. Similarly, there is one more mechanism that is present in bacteria, known as , through which bacteria can recognise by their particular restriction enzyme, thus rendering it resistant to cleavage. In molecular biology, there are instances where synthesis of desired DNA in in-vitro reactions catalysed it synthesises the complementary DNA strand. These are commonly known as polymerases which have the ability to synthesise DNA strands of 10 kbp or more. During the process of cloning, there are many steps other than the restriction enzyme digestion such which are considered for the above functions. Other than that, there are many enzymes used in gene cloning, i.e., exonucleases, and endonucleases (restriction endonucleases).

Figure 4.7 depicts exo and endonucleases.

Fig. 4.7 Action of exonuclease and endonuclease

These are the DNA binding proteins which act like scissors for cutting DNA fragments at different sites restriction restriction enzymes came into use only after 1980s, prior to which cutting or joining the DNA fragments was not known.

66

Recombinant DNA Technology and Genetic Engineering

There are four different kinds of restriction enzymes, Type 1 to 4. It is very well established that Type1 and 2 are large molecules having endonuclease and methylation activities. E. coli B – K system comes under

usually 15 bp long and cleavage site is around 800–1000 bp away from the 5’end of the recognition site. Methylation enzymes can be considered as an example.

2+

as E. coli strain RY. For the discovery of these enzymes, Nobel Prize has been honored to W Arber, H Smith and Nathans in 1978.

5 C CAT G G 3 3 G G TAC C 5

Requirements 4141414

to create blunt cuts. Very rarerly do they create 2 bp overhangs which For example, enzymes that create cohesive ends. 5 C CAT G G 3 3 G GAT C C 5

Table 4.2 Reaction set up Sr.No. 1. 2. 3. 4. 5.

Components Buffer DNA DDW

Stock Concentration 10X

Final conc. 1X 500–3000 ng 1–5 units

Total Volume

Volume Added 3 4 22 1 30

Enzymes used in Genetic Engineering

67

2. Incubate the reaction mix at 37° C for 5–6 hrs.

6. Heat inactivate the enzyme by incubating at 70° C water bath for 10 min and spin.

(b) 0.8% agarose gel electrophoresis run at 80–100 V.

(e) See under UV on transilluminater, the pattern of complete digested DNA products can be seen in Fig. 4.8.

Fig. 4.8 Agarose gel electrophoresis of restriction enzyme digested DNA along with the undigested.

68

Recombinant DNA Technology and Genetic Engineering

Tips to differentiate by agarose gel. should be maintained optimally. concentration. Increase or decrease of salt concentration or glycerol concentration show star activity, due to which the DNA subjected for digestion will show up many bands. if it is double digestion.

Table 4.3 Some of the most frequently used restriction endonucleases and their recognition sequences Enzyme

Source microbe

Recognition sequence

Type of fragment

Anabaena Flos-aqua

Sticky

Bam H1

Bacillus amyloliquefaciens

Sticky

Bgl II

Bacillus Globigi

Sticky

Escherichia coli

Sticky

Escherichia coli

Blunt

HindIII

Sticky

Kpn1

Klensiella pnemoniae

Sticky

Mfe1

Mycoplasma fermentans

Sticky

Nco1

Nocardia corallina

Sticky

Nde1

Sticky

Not1

Nocardia otididis- caviarum

Sticky

Pst1

Providencia stuartii

Sticky

Sac1

Streptomyces achromogenes

Sticky

Sal1

Streptomyces albus

Sticky

Sma1

Serratia marcescens

Blunt

Xba1

Xanthomonas badrii

Sticky

Xho1

Xanthomonas holcicola

Sticky

Enzymes used in Genetic Engineering

69

Nucleic acid is the basic necessity of a molecular biology laboratory. Similarly, the hybridisation of a nucleic

beginning with the DNA and the method of labelling followed. The other comes the metabolic labelling, where radioactive precursors are directly introduced into the cells that synthesise DNA of interest. But there are too many disadvantages that have been observed with the method such as large amounts of radioactivity

to the earlier ones. They are (i) kinasing reaction which has been exploited whereby T4 polynucleotide kinase nick translation, where E. coli DNA polymerases have been used for replacement of nonradiolabelled nucleotides by the

very high in obtaining radiolabelled probes, they have certain limitations. The kinasing method of labelling, activity will be much lesser. Nick translation has the ability to introduce the radiolabelling at many places of single or double-stranded DNA but it results in generation of fragmented radiolabelled DNA, representing both the strands of the template DNA. This incident later resulted in the formation of double-stranded DNA probes, which interfered or competed in hybridisation reaction by inhibiting the binding of target strands. The development of phage vectors were very useful in the construction of single-stranded DNA probes, where bacteriophages were used for the production of single-stranded DNA. But, problems have been observed in the separation of radiolabelled single stranded probes with the unlabelled probes which are considered to be one of the tedious processes. Melton et al. succeeded in developing a new method, in which single-stranded radiolabelled RNA has been obtained by transcription of cloned DNA segments. These probes are highly stable and can be easily separated with DNA template without gel electrophoresis. It has also been observed that the RNA probes can make a hybrid with DNA molecule, and they are much more stable than the RNA: RNA hybrids. Both the DNA: RNA and RNA: RNA hybrids are resistant to RNAses. Therefore, RNAses can extensively used for making single stranded probes. The present section deals with the understanding of nick translation, a process that is well accepted and followed for radiolabelling of DNA molecules.

Nick translation is one of the well-accepted method used for radiolabelling of double-stranded DNA molecules. The name nick translation E. coli DNA polymerase I incorporates nucleotides (dNTP s) to the 3’-hydroxyl end of the nicked strand of the double-stranded DNA. It has been named as nick translation because the E. coli DNA polymerase, also shows the 5’ to 3’ exonuclease activity. This phenomenon establishes the removal of nucleotides from the 5’ end and the addition of nucleotides from the 3’-hydroxyl end. The process of simultaneous addition and elimination results in the movement of nick,

70

Recombinant DNA Technology and Genetic Engineering

Fig. 4.9 Mechanism of nick translation

M13 bacteriophage infection leads to the formation of different products, one among them is the production in making probes for hybridisation. Bacteriophage-based vectors have been very useful not only in the generation of gene libraries but also in the expression of different proteins. There are few technologies for which M13-based site-directed mutagenesis and synthesis of radiolabelled probe. Very small number of bacterial vi-

random hexamer, and g . Random hexamer probe is a single-stranded DNA labelled with radioactive material. This probe can be used for hybridisation with any kind of nucleic acid material in order

followed for probe preparation:

Probe It is a single-stranded oligonucleotide labelled with radioactive material.

Enzymes used in Genetic Engineering

Random hexamers

Heating at 95°C for 5 – 10 min or denaturation by alkaline pH or conditions

Random hexamers will have more than one template

Klenow Klenow 5

3 5 3

3

5

Radiolabelled probe extension with klenow fragment

Annealing at 50°C for 5 min

Fig. 4.10 Random primer extension method

Mechanism involved in random primer extension 1. Annealing tube.

Random Hexamer: Six oligonucleotides, one among them is radiolabelled. Random: Out of six only one is labelled as below: P32

71

72

Recombinant DNA Technology and Genetic Engineering

(b) Incubate the micro-centrifuge tube in boiling water bath for 3–5 min.

3 – 5 min

For successful random primer labelling, the template should be linearised and completely denatured prior to labelling.

Polymerisation 1. Components are:

d-

32P

10X Klenow buffer Tris.Cl 75 mM pH 7.6 DTT 55 mM MgCl2 50 mM *C* dNTP mix 5 mM, dATP, etc.

Enzymes used in Genetic Engineering

3. Incubate the reaction mix at 37 °C for 30 min.

Stop solution: 0.1% SDS 10 mM Tris Cl

1. Spin column chromatography.

(a) Spin column contains 1. 1 ml of glass wool. Spin at 3000 rpm for 1 min. (b) Standard assay : Prepare reaction mix on ice: Template DNA 10 – 2,000 ng DNA

Klenod enzyme H2 Incubation for 30 min at 37°C.

2 units

73

74

Recombinant DNA Technology and Genetic Engineering

Nick Translation Protocol

Fig. 4.11 Mechanism of nick translation protocol

stranded DNA at low enzyme concentrations and in presence of Mg2 +. E. coli DNA polymerase 1 synthesises DNA 5’ to 3’ direction using 3’ OH termini of the nicks as primers. nucleotides in the direction of synthesis that are replaced by nucleotides supplemented to the reaction. 1. Reaction mixture: 10X ( H2 Incubate at 0°C for 5–10 sec.

Requirements

mol.)

Enzymes used in Genetic Engineering

Nick translation buffer Tris-Cl 0.5M MgSO4 0.1M DTT 1 mM

3. Add 2.5 units of DNA polymerase 1 and vortex.

4. Incubate at 16°C for 30 – 60 min.

75

76

Recombinant DNA Technology and Genetic Engineering

6. Spin column chromatography.

Single-stranded DNA probe (a) ss DNA Template (b) Primer (c) DNA polymerase

Mechanism involved in single-standed DNA probe

1. Annealing (a) Add the following components into micro-centrifuge:

Total volume

20.0

Enzymes used in Genetic Engineering

(b) Heat at 85 °C for 3 min. Then immediately transfer it to 37 °C bath.

Labelling Reaction 1. To the annealing tube add the following : ( -32p)

2. Incubate reaction mix at 37 °C for 1 hr.

77

78

Recombinant DNA Technology and Genetic Engineering

Ethanol

–70°C for 15 min

7. Wash with 70% ethanol.

8. Speed vacuum for drying the pellet.

Probe - Double-stranded DNA - Denaturation - Polyacryl amide gel electrophoresis - Isolation of probe from the gel 1. DNA DNA pellet 10 l 10X buffer 2 l

4°C for 15 min 10,000 rpm

Discard the supernatant

Enzymes used in Genetic Engineering

2. Tap and spin for a second.

3. Incubate at 37 °C for 2–3 min.

5. Denaturation at 75 °C for 2 min.

79

80

Recombinant DNA Technology and Genetic Engineering

Deionised formamide 98% Xylene cyanol 0.025% Bromophenol blue 0.025% 6. Immediately cool on ice.

7. 5% polyacrylamide gel electrophoresis.

8. Wrap the gel in a plastic wrap.

Enzymes used in Genetic Engineering

Electro Elution 1. Keep the band in a dialysis tubing.

81

82

Recombinant DNA Technology and Genetic Engineering

1 hr. 12 11

1 2

10 9

3

8

4 7

5 6

4. Take out the buffer.

Ethanol

–70°C for 15 min

4°C for 15 min 10,000 rpm

Discard the supernatant

4°C for 15 min 10,000 rpm

Discard the supernatant

6. Wash with 70% ethanol.

Ethanol

–70°C for 15 min

7. Dissolve the pellet in desired volume of ddw.

Enzymes used in Genetic Engineering

83

to avoid star activity.

Jacobsen et al Amino Acid S Polymerase I from E. coli and of the Large and Small Fragments Obtained by a Limited Proteolysis’, European Journal of Biochemistry, 45, 623–7. Molecular Cell Biology, Lodish, Harvey F. 5th ed: New York : W H Freeman and Co., 2003. Prizes for the Studies on DNA Restriction nzymes. Postepy biochemii 25 (2): 251–3 Medicine and Physiology, 1978’. The Johns Hopkins Medical Journal 143 (5). Adapters for Cloning DNA’. Methods , 1979, 68, pp 98–109. Smith et al ’ Journal of Molecular Biology, 1970, 51, pp 379–91.

ISOLATION OF GENOMIC AND NUCLEAR DNA 5.1 INTRODUCTION

Chapter

5

genomic DNA extraction

Contents

Isolation of Genomic and Nuclear DNA 85

Mycobacterium Tuberculosis Lactobacillus and Listeria

Genomic DNA isolation from blood Procedure in Brief

Requirements

Protocol

5 ml

Vacutainer tube containing EDTA

–70°C

86

Recombinant DNA Technology and Genetic Engineering

5 ml

5 ml

0.8 ml 1X SSC buffer

2

Mix

Centrifuge

Isolation of Genomic and Nuclear DNA 87

88

Recombinant DNA Technology and Genetic Engineering

Isolation of Genomic and Nuclear DNA 89

Genomic DNA Isolation from Yeast

Requirements Harju buffer

Procedure

90

Recombinant DNA Technology and Genetic Engineering

Isolation of Genomic and Nuclear DNA 91

92

Recombinant DNA Technology and Genetic Engineering

Genomic DNA from bacteria Requirements ACD solution: Acid Citrate Dextrose solution

2

Extraction buffer:

Cell lysis solution

Isolation of Genomic and Nuclear DNA 93

94

Recombinant DNA Technology and Genetic Engineering

Fig. 5.1 Genomic DNA

Isolation of Genomic and Nuclear DNA 95

Table 5.1 History of DNA sequencing

I

96

Recombinant DNA Technology and Genetic Engineering

Fig. 5.2 Sequencing result in a present-day sequencer

Sanger-Coulson chain termination method

Primer annealing

Fig. 5.3 Flow chart of DNA sequencing

Isolation of Genomic and Nuclear DNA 97

Description of dNTPs and ddNTPs 2 at 3

Fig. 5.4 chain termination method

98

Recombinant DNA Technology and Genetic Engineering

Extension and synthesis of the complementary strand

Sequencing gel electrophoresis

32

Sequence reading

Maxam and Gilbert chemical degradation method

Isolation of Genomic and Nuclear DNA 99

5

3 5

3

GTAGCTACGATC 5 primer

DNA polymerase and dNTP s

+ddGTP (G)

+ddATP (A)

+ddTTP (T)

+ddTTP (C)

3 -GTAGCTACGATC-5 5 -CATCG 5 -CATCGATG 5 -CATCGATGCTAG-3

3 --GTAGCTACGATC-5 5 -CA 5 -CATCGA 5 -CATCGATGCTA

3 -GTAGCTACGATC-5 5 -CAT 5 -CATCGAT 5 -CATCGATGCT

3 -GTAGCTACGATC-5 5 -CAT 5 CATCG 5 -CATCGATGCT

G

A

T

C

(–) 5 -G A T C G T

Denaturing polyacrylamide gel electrophoresis

(+)

Fig. 5.5 Schematic representation of sequencing 32

32

Procedures followed ‘Sequenase’ mediated DNA sequencing: Klenow fragment E. coli Reverse transcriptase

100

Recombinant DNA Technology and Genetic Engineering

Taq DNA polymerase sequenase

Annealing Annealing

Isolation of Genomic and Nuclear DNA 101

Alkaline denaturation

102

Recombinant DNA Technology and Genetic Engineering

Isolation of Genomic and Nuclear DNA 103

l l

Termination Reaction

ddG termination mix

ddA termination mix

ddT termination mix

ddC termination mix

104

Recombinant DNA Technology and Genetic Engineering

–

\

Stopping solution

Isolation of Genomic and Nuclear DNA 105

Percentage of gel required based on the molecular weight of the fragment

Gel Siliconisation

Siliconising solution Siliconising solution

106

Recombinant DNA Technology and Genetic Engineering

Isolation of Genomic and Nuclear DNA 107

Gel Solution

10X TBE buffer

2

2

40% Acryl amide solution

108

Recombinant DNA Technology and Genetic Engineering

Casting Gel

Isolation of Genomic and Nuclear DNA 109

110

Recombinant DNA Technology and Genetic Engineering

Processing the gel

Isolation of Genomic and Nuclear DNA 111

112

Recombinant DNA Technology and Genetic Engineering

Fig. 5.6 Schematic representation of chemical method of sequencing

Isolation of Genomic and Nuclear DNA 113

thermal cycle sequencing

Fig. 5.7

114

Recombinant DNA Technology and Genetic Engineering

Lynx Therapeutics’ Massively Parallel Signature Sequencing (MPSS):

Polony Sequencing:

E. coli

454 Pyrosequencing:

Illumina (Solexa) Sequencing:

Solid Sequencing:

Isolation of Genomic and Nuclear DNA 115

Table 5.2 Manual

Automated

Proceedings of the National Academy of Sciences of the USA, et al Nature et al Science Proceedings of the National Academy of Sciences of the USA, Journal of Molecular Biology

.

CLONING AND SUBCLONING STRATEGY 6.1 CONSTRUCTION OF RECOMBINANT DNA DNA into a plasmid vector. There are multiple methods of cloning based

Chapter

6 Contents

explained below.

of recombinant DNA

6.1.1 Restriction Digest Approach 1. Standard restriction enzyme digestion approach:

plasmid vector. The resulting recombinant plasmid DNA is further

restriction sites. 2. Restriction Enzyme Cpo1-based approach / Directional cloning: Cpo1-based directional cloning methCpo1 Cpo1 CG/GTCCG; or CG/GACCG CG Cpo1 digestion will not change its frame after cloning at this site.

representation of different cloning technologies competent celltransformation, transfection inactivation (the other way of screening the clones)

Advantages

stranded DNA selection and screening

6.1.2 Recombination-Based Approach for cloning 1. Cre / Lox system: plasmid and the Cre the Cre Lox P site.

ox P site containing

Cloning and Subcloning Strategy

117

Advantage Once cloning into a suitable Cre/Loxtransformation. lambda

2. att Lambda phage approach: phage att att location.

Advantage

6.1.3 Approaches Based on Bacterial Mating MAGIC approach: MAGIC stands for ‘ in-vivo DNA cleavage and homologous ‘recipient’ plasmids.

Advantage

these clonings are shown in Fig. 6.1.

CLONING TECHNOLOGIES

directional cloning. This method reduces the labour in the following manner.

118

Recombinant DNA Technology and Genetic Engineering

Fig. 6.1 Blunt-end cloning

Fig. 6.2 Restriction enzyme digestion and resulting terminal ends of plasmid

Cloning and Subcloning Strategy

119

Fig. 6.3 Directional cloning

cloning 1. Blunt-end cloning directionless cloning, as the

essential. 2. Cohesive-end cloning: This method is also named as directional cloning and is one of the most followed

120

Recombinant DNA Technology and Genetic Engineering

TRANSFORMATION, TRANSFECTION 6.3.1 Mechanism involved

. These cells are used for chemical

2

transformation.

Method 1: CaCl2 method E. coli cells that had been incubated in ice-cold CaCl2 2

. 2 2

treated cells.

Fig. 6.4 Basic mechanism of transformation

Method 2: Preparation of Frozen Electro-competent Cells

Viva Voce

as well as rubidium

Cloning and Subcloning Strategy

Requirements

overnight.

121

122

Recombinant DNA Technology and Genetic Engineering

TFB 1: Transformation buffer1 Potassium Acetate 30 mM Calcium chloride 10 mM Rubidium chloride

100 mM

TFB2: Transformation buffer2

Rubidium chloride

10 mM

of TFB 1.

Viva Voce

Methods of selection of transformed cells

Cloning and Subcloning Strategy

123

r s

able to form colonies on an agar medium containing ampicillin. amp The transformants having no plasmid will not grow on ampicillin antibiotic plates.

Fig. 6.5 Selection of transformants using a pBluescript plasmid

Fig. 6.6 Distinguishing transformants and nontransformants

and

124

Recombinant DNA Technology and Genetic Engineering

Screening of recombinants by replica plating

process begins with plating of all the transformants onto the LB agar

right recombinant based on the replica plating results.

Fig. 6.7 Replica plating to identify a right recombinant

Steps involved in replica plating 1. Plating the recombinants on antibiotic plate.

4. Incubation of the plate for the growth of the colonies.

Cloning and Subcloning Strategy

right recombinants.

Fig. 6.8 Colour- based selection of recombinants on X-gal and IPTG plates

X-gal is light sensitive hence; it should be stored in amber colour reagent bottles.

Inactivation

Fig. 6.9 Blue and white colonies

125

126

Recombinant DNA Technology and Genetic Engineering

Flow Diagram

The protocol in detail

Spectrophotometer and handling for taking OD Leave unopened for 10 min for initialisation. Caution: There should not be any bubbles in the cuvette).

Cloning and Subcloning Strategy

127

Components of LB Broth

600

What will happen if the OD is above 0.6?

2 2

Mechanism involved chemical and electrocompetent cells. l cells not more than 10 l of DNA can be used. in-vivo conditions E. coli

E. coli. The amount of DNA we use for

128

Recombinant DNA Technology and Genetic Engineering

which is termed as clone

Fig. 6.9

reaction).

6.5.1 Transformation by Chemical Method The competent cells prepared through CaCl2 2

of the E. coli

not be able to grow. There are some plasmids which are sensitive to higher temperatures. Those plasmids will

Cloning and Subcloning Strategy

129

contains both the -lactamase

2

and CTAB*.

Procedure XLIBLUE BL21, DH5 , 10 min.

ICE

–70°C

130

Recombinant DNA Technology and Genetic Engineering

-1

-2

-3

to follow the serial dilutions as shown below. 100 l

100 l

100 + 900 l

900 l LB

900 l LB

10–1

10–2

10–3

900 l LB 10–4

Cloning and Subcloning Strategy

131

Fig. 6.11 Possibilities

through a small experiment explained below.

Experiment for insertional inactivation E. coli same plasmid is digested and inserted in the DNA fragment at ampicillin region. The resulting recombinants

132

Recombinant DNA Technology and Genetic Engineering

Fig. 6.12

6.6 RECOMBINANT SELECTION AND SCREENING 6.6.1 Characterisation of the Recombinants/ Transformants

Cloning and Subcloning Strategy

133

Plasmid DNA preparation by conventional methods The basic

weight is too high. extra-chromosomal DNA to episomal DNA.

bacteria. The procedure for preparation of phage DNA from M13 is similar to that of bacterial plasmid DNA

Preparation of Genomic DNA/Plasmid DNA

1. Growth and harvesting of bacteria in sterile conditions.

4. Resuspension of the resulting pellet. For genomic DNA, please refer to pages 117 to 125 of Chapter 5.

Mechanism involved in plasmid DNA preparation

Fig. 6.13

134

Recombinant DNA Technology and Genetic Engineering

Fig. 6.14 Bacterium after treatment with solution 1

get a pure plasmid.

Alkaline lysis method Flow Diagram

(contd.)

Cloning and Subcloning Strategy

Inoculation, Harvesting and Lysis of Bacteria Inoculation

135

136

Recombinant DNA Technology and Genetic Engineering

which is dangerous.

Solution 1

100 ml preparation and then autoclaved.

also contain RNA

Cloning and Subcloning Strategy

Solution 2

NaOH: It denatures plasmid DNA.

Solution 3

O 2 Total

60 ml

137

138

Recombinant DNA Technology and Genetic Engineering

10. Transfer the supernatant to another tube.

Cloning and Subcloning Strategy

Fig. 6.15

139

140

Recombinant DNA Technology and Genetic Engineering

Viva Voce

Functions of different solutions in the alkaline lysis method

DNA and precipitation.

1. Characterisation of the plasmid b. Use of chromogenic substrates. c. Insertional inactivation.

a.

Fig. 6.16

Viva Voce

Cloning and Subcloning Strategy

2. Recombinants. Observations and Conclusions for the above gel

b. Restriction Enzyme Digestion

Fig. 6.17

recombinant.

6.6.2 Characterisation of Recombinants by Restriction Enzyme Digestion Restriction Enzymes and their Use in Genetic Engineering Introduction and Methodology

141

142

Recombinant DNA Technology and Genetic Engineering

transforming into bacterial host. The term host controlled restriction

Fig. 6.18 Role of restriction enzymes in self-defense

Cloning and Subcloning Strategy

143

E. coli

ends.

N—C—C—C—G—G—G—N—

N—C—C—C

N—G—G—G—C—C—C—N—

N—G—G—G

G — G — G — N — Sma1 digestion at C — C — C — N — Room temparature

Four overhang sticky N—C—C—A—T—G—G—N N—G—G—T—A—C—C—N

N—C N—G—G—T—A—C

After RE-digestion

determining the molecular weight of these fragments.

C—A—T—G—G—N C—N

144

Recombinant DNA Technology and Genetic Engineering

manner = a b (log ) in which D that depends on the conditions of electrophoresis.

for molecular weight and a b are constants

digested bands in the two different lanes corresponding to control with the test. Determination of molecular weight of

Fig. 6.19

Performing restriction enzyme digestion in the laboratory

Increase or decrease of DNA concentration. In the reaction leads to incomplete or no digestion. In case of

which helps in stabilising the reaction and prevents its inactivation.

Cloning and Subcloning Strategy

145

2+

Table 6.1 Common restriction Endo-nucleases used in molecular biology laboratory with their sequences and resulting ends after digestion Name of the enzyme Not 1

buffer.

Reaction set up Requirements Precautions

hours.

Organism Nocardia otitidia-caviarum Bacillus amyloliquefaciens

Recognition sequence GCGGCCGC GGATCC AAGCTT

Resulting ends

146

Recombinant DNA Technology and Genetic Engineering

For RE-digestion

Table 6.2 Components required for RE-Digestion Sl. No. 1. 2. 3. 4.

Components Plasmid DNA Buffer

Stock concentration

Final concentration

10 X

1X

ddw

2. Centrifuge for 30 sec.

Run 1% agarose gel Load as shown below.

900 kbp

Volume added

Cloning and Subcloning Strategy

147

Viva Voce

Analysis

see the presence of another higher molecular weight band just below the wells and running above the DNA Conclusions Clones containing inserts in them are considered to be recombinants.

Tips

two different buffers. If the two buffers

and substrate reactions.

E. coli

148

Recombinant DNA Technology and Genetic Engineering

Mechanism involved in gene (LaC Z

of

6.7 ESSENTIAL TOOLS REQUIRED FOR CLONING/ SUBCLONING

Making genomic and cDNA libraries in plasmids and phages

a representation of many genes cloned in a plasmid vector

shorter DNA fragments feasible for cloning. One can either follow mechanical shearing or (partial digestion) A library

E. coli E. coli are transferred into bacterial sizes it is advised to use phage

transformed in E. coli and propagated in-vivo to increase the number of copies of the cloned fragment. This

Cloning and Subcloning Strategy

Fig. 6.20 E. coli

cDNA library

149

150

Recombinant DNA Technology and Genetic Engineering

it is cloned into the plasmid vector.

Phase II of cDNA synthesis

as demonstrated in Fig. 6.21.

5 cap structure

mRNA

3 AAA(A)n poly A tail

3 5 OH oligo dT (12–18 primer) 5 cap structure 3 AAA(A)n poly A tail Add dNTPs, Mg2+ reverse transcriptase

3 5 OH oligo dT (12-18 primer)

3 AAA(A)n poly A tail

5 cap structure

3 5 OH oligo dT (12-18 primer) 3 AAA(A)n poly A tail

Fig. 6.21

Cloning and Subcloning Strategy

Fig. 6.22

RNA replacement method of cDNA synthesis

4

ligase

Construction of cDNA library with suitable restriction enzyme sites

demonstrated in Fig. 6.24 can be followed for blunt cloning of cDNA.

151

152

Recombinant DNA Technology and Genetic Engineering

Fig. 6.23

Cohesive-end cloning of cDNA fragments

T4

understanding of the phenomenon.

Cloning and Subcloning Strategy

153

Fig. 6.24 Major problems with the above strategy of cloning cDNA library

that the cloned cDNA could have got inserted into the vector either in the right direction as well as reverse.

dephosphorelases.

methyltransferase

oligos are

154

Recombinant DNA Technology and Genetic Engineering

Fig. 6.25

Dephosphorelases for cloning of cDNA library

important role in increasing the ligation of desirable DNA fragments such as vector to insert and forth soon so.

Cloning and Subcloning Strategy

I

I

I

Fig. 6.26

Terminal transferases or homopolymer tailing for cDNA cloning

in-vitro

Screening of cDNA clones

E. coli

155

156

Recombinant DNA Technology and Genetic Engineering

\

Fig. 6.27

6.8.1 Linkers and Adapters

has been further proved that the introduction of molecular crowding agents such as polyethylene glycol in the

Cloning and Subcloning Strategy

restriction site is observed in the fragment also as shown in Fig .6.29.

How to process and use linkers?

I

I

I I D

Fig. 6.28

I

I

157

158

Recombinant DNA Technology and Genetic Engineering

The result of this experiment needs to be compared with the earlier Nco I digestion experiment of linkers Nco I

Nco I

Nco I Nco I

DNA fragment Linkers Nco I digestion

Cleavages in the DNA fragment as well as in the linkers

Fig. 6.29

Adapters adapter

it does not solve the above mentioned problems.

Cloning and Subcloning Strategy

Fig. 6.30 Structure of adapter and its problems

Fig. 6.31 Mechanism of use of adapter

159

160

Recombinant DNA Technology and Genetic Engineering

Frequent and common problems observed with the adapters 2. Maximum amount of adapters get used up in self-ligating. 3. Bright chances for attachment of dimers or trimers of adapters to the fragment.

Homopolymer or T/A Tailing

Fig. 6.32 Mechanism and action of terminal transferase / Homopolymer tailing

Cloning and Subcloning Strategy

b. Cre/ Lox c. Att Lambda d. MAGIC approach

followed. followed.

REFERENCES et al. Restriction Endonuclease Cleavage at the Termini of PCR Prducts, Mead et al. Aslanidis et al. Ligation Independent Cloning of PCR Products,

Cloning Without Restriction,

161

162

Recombinant DNA Technology and Genetic Engineering

et al. Cloning Without Restriction,

Gubler Young et al Feinberg et al

Terminal deoxynucleotidyl

SELECTION OF rDNA CLONES AND THEIR EXPRESSION PRODUCTS

Chapter

7

7.1 INTRODUCTION In the previous chapters, we learned the basic methodology or concepts used to clone genes, and understood the different kinds of plasmid vectors that exist and are used with bacteria, plants, yeasts and mammalian cells. We also understood the basic mechanism involved in cloning of a gene of interest as a whole. Once we obtain a clone of interest, the next step involved is identifying the right and desired recombinants from the mixture. It is isolation of the right recombinants. The methodology has to be precise, constructive, and extremely sensitive to allow an accurate detection of single clone from thousands. Once the right clone has been obtained, the molecular biologist can make use of many techniques in order to understand the functions of the gene. The details of these techniques have been dealt with in the later chapters.

Contents Introduction Selection Clone n

e

7.2 SELECTION When we make an E. coli genomic DNA library, we begin with restriction digestion of E. coli genomic DNA which contain several thousand genes. Upon restriction digestion of the DNA leads to formation of not only the fragment carrying the desired gene, but also many other DNA fragments carrying all other genes. Subsequently after ligation, there is a formation of numerous varieties of recombinant DNA molecules. They all contain different pieces of DNA. After transformation and plating, numerous number of recombinants are obtained. The most important question here is, how to obtain the right and the desired clone of interest? What are the problems that exist in identifying them? What are the different methods available? These common problems have been illustrated in Fig. 7.1. There are two different ways to obtain a clone of interest. They are direct and indirect methods. 1. Direct selection method: This method depends mainly on the strategy and planning of a cloning experiment, where the cloning experiment is designed in such a way that the clones obtained are the clones of the required gene only. The selection occurs at the plating stage. This method

protein

Linked ) SDS–PAGE n

n

164

Recombinant DNA Technology and Genetic Engineering

has many advantages and is the preferred method since it reduces the time in order to procure the right clone

Fig. 7.1 Selection of recombinants 2. Indirect selection method: This method primarily depends on genomic library, where shotgun cloning experiment is followed leading to the formation of library representing all or most of the genes present in the

7.2.1 Direct Selection This method is feasible for the plasmid containing antibiotic resistance markers which are used for cloning experiment. It can also be used for mutant strains of E. coli as the host for transformations. As soon as the completion of the transformation of the genomic DNA library or ligation mixtures into E. coli, in order to select for a cloned gene, it is very essential to plate the transformants onto an agar medium on which only the right recombinants can grow. The media should be selected to differentiate between the recombinants and nonrecombinant clones. This method makes sure that all the clones obtained in the plates are of the desired recombinants (Fig. 7.2). One very commonly followed direct method is the exploitation of antibiotic resistance marker that exists in most of the plasmid DNA vectors.

Selection of rDNA Clones and their Expression Products

165

(a) Direct selection

(b)

Fig. 7.2 Selection of desired clone through direct selection method A simple experiment for direct selection is followed and there are two different ways through which it resistance marker gene by making a library.

Experiment (i): Cloning a gene by making a library

166

Recombinant DNA Technology and Genetic Engineering

Another method of recombinant selection, i.e., insertional inactivation cannot be followed in this case cloned gene is used as the selectable marker, hence the site of cloning plays an important role. Transformants are plated onto normal agar plate, and all the cells will grow irrespective of the presence of a plasmid. One can

Fig. 7.3 Steps involved in direct selection method

Visual and direct methods of selection of recombinants Direct method of selection of recombinants based on antibiotic markers In another example, let us consider an experiment to clone the gene for ampicillin reistance marker from a plasmid Krg22. This gene carries four different genes which code for different antibiotics such as ampicillin,

no antibiotic marker). Upon ligation, it results in various recombinant molecules, among them only one recombinant posseses the gene for ampicillin (Fig. 7.4(b)).

Selection of rDNA Clones and their Expression Products

167

cloning of the respective gene from another plasmid. Subsequently, after the ligation the transformation is gene can grow on the LB agar plate containing ampicillin as shown in Fig. 7.4(b).

Fig. 7.4 Direct selection for the cloned krg22 amplicillin resistance gene antibiotic marker-based direct selection Limitations of direct selection It is feasible with the cloning of antibiotic resistant genes or visually effective genes.

Advantages applicable for mutant strains of E. coli as the hosts for transformation.

Direct selection for trpA gene cloned in mutant strains of E. coli In this experiment, the trpA gene from E. coli is to be cloned trpA gene codes for tryptophan synthase, which is essential for the synthesis of tryptophan amino acid. The auxotrophic mutant strain of E. coli, which cannot synthesise tryptophan amino acid is deciphered as trpA. It is able to survive only if tryptophan is available

168

Recombinant DNA Technology and Genetic Engineering

transformed into mutant E. coli strain. Upon digestion and ligation, it produces various recombinant DNA clones. Among them, only one or two will carry intact copy of the trpA gene. This is a functional gene as it is obtained from the wild-type E. coli strain. The ligation mix is subsequently transformed into mutant strain of E. coli, trpA– cells. These resulting transformants after plating onto the minimal agar, one can easily observe the growth of recombinant colonies. Only the recombinant DNA containing trpA gene colonies will grow in these plates, and the remaining cannot grow since they are unable to synthesise tryptophan amino acid. These recombinant E. coli strains do not require tryptophan, as the cloned gene is under a promoter they can directly synthesise the respective amino acid. Therefore, they can grow on the minimal agar plate. Auxotrophs cannot grow on minimal media, as they cannot synthesise tryptophan because they contain mutant or nonfunctional trpA gene. The whole procedure is shown in Fig. 7.5.

Fig. 7.5 Utilisation of mutant E. coli strain for direct selection

Direct selection of recombinants containing trpA gene This method has two important limitations: 1. Mutant strain is a basic and essential requirement. 2. A special media where only the wild type can grow is essential. This methodology can also be used for different systems such as yeasts and fungi because auxotrophic strains also exist widely. This methodolgy has universal applicability where one can use selection of genes from other organisms.

Selection of rDNA Clones and their Expression Products

169

Many genes cannot be selected based on antibiotic marker rescue, therefore we require a unique and easy methodologies. Similarly, many bacteria are not auxotrophic mutants, so the mutant and wild-type strains methods are not only effective but also not feasible in cloning and selection of genes in bacteria, as most of the eukaryotic genes does not function in E. coli after their hyper expression. Therefore, the direct selection methodology for the selection of recombinants.

Direct selection methodologies for gene libraries the available clone selection technologies, especially from the gene library. Genomic library as a collection of numerous clones that contain every single gene of an organism. It represents large number of genes cloned in a plasmid DNA. The generated library represents all the genes of an organism. Usually, restriction enzyme digestion which forms different fragments which can then be further cloned in a plasmid vector which is treated similarly. The fragments can be cloned in BACs, YACs, and replacement vectors. The selection of cloning vector depends on the size of the genome of an organism. The selection of a right and desired clone from E. coli genomic DNA library is not a tough task, as the genome is considered much of a gene from the mammalian genomic DNA library, as they are considered too complex and very large. In library can be made from different organs or the cell types of an organism. Figure. 7.6 shows construction of a genomic DNA library in cosmid vector.

role in the development of distinct receptors. As transcriptome is considered to be one of the most complex process which occurs in higher organisms, it is never considered as a complete single system in-vivo. This is mainly because all genes are never expressed simultaneously in the same tissue. Cells transcribe particular genes based on their requirement by the system. The housekeeping genes, which are very essential, are transcribed at all times because their transcript products are essential for the maintenance of the system. But the other luxury genes are expressed in a very regulated manner, because their requirement is rare. In a similar fashion, the post-translational processes are considered

have housekeeping functions. A small portion of them will splice variants of the same primary transcripts. It all genes are not expressed simultaneously. In order to understand the expression levels, one needs to study

170

Recombinant DNA Technology and Genetic Engineering

Gene library construction in a cosmid vector Sau3AI Partial digestion Sau3A1 25–35 kbp fragments

Ligation

cos

cos

In-vitro packaging and infection in E.coli

colonies

Fig. 7.6 Construction of genomic DNA library in a cosmid vector

Fig. 7.7 Preparation of cDNA library

Selection of rDNA Clones and their Expression Products

171

1. By preparation of cDNA libraries or differential cDNA libraries. 2. DNA arrays or hybridisation analysis. It is a fact that all genes are not expressed in a given cell simultaneously. Analysis of a gene expression and comparing expression patterns between two different cells or two similar cells treated in a different manner cDNA library helps in identifying the genes which are expressed in a particular cell in different physiological conditions. The genes which are activated or generated at particular conditions are expressed, and transcribed

can help in isolating that gene from wheat seeds.

can be translated into protein. But most prokaryotes have no introns, and hence, they do not require any processing. Sometimes, it is very essential to express eukaryotic gene in prokaryotes, but because of introns in the

it requires regulatory regions such as promoter start codon, etc. There are many reasons as to why a cDNA NAses,

NA formation of double-stranded DNA which can be cloned into expression plasmid for further studies. As the

7.3 CLONE IDENTIFICATION

few among them are translational product-based detection of a clone of interest. It is not only an expensive and labourious method but the reproducibility is questioned. The only technique considered to be in much on complementary nucleic acid strands which hybridise each other. Single-stranded complementary DNA

172

Recombinant DNA Technology and Genetic Engineering

can base pair to make a double-stranded DNA. But the stability of the double-stranded DNA depends on complementarity is less, the stability of the bond formed among the strands will be much less, therefore they are not stable. This is a very common phenomenon which occurs in single-stranded DNA as well as single-

which are shown in Fig. 7.8. (a) Nonhomologous DNA strands

Unstable hybrid molecule

(b)

Complementary strands moderately stable hybrid molecules

(c) RNA Highly complementary DNA strands form DNA:RNA which are hybrid. very stable.

Fig. 7.8 on sequence complementerity among them Nucleic acid hybridisation is developed based on the hypothesis that the complementary DNA strands probe, which is radiolabelled. Because of its complementarity, it has the capability to recognise and bind to Nucleic acid hybridisation is a very labourious process, containing many steps, beginning with transfer of colonies to nitrocellulose or nylon membrane, treating the membrane in such a way that the membrane carries only the naked DNA. During the process of transfer, the hydrogen bonds in the double-stranded DNA are broken further, leading to the formation of single-stranded DNA which are still very well attached to the membrane. The attachment and stability of single-stranded DNA is much less, in order to make stable binding C backbones. Now the nucleotide bases are free and are surface exposed to make stable bonds with the singlestranded complementary DNA probe. The hybridisation of the probe is usually followed in a hybridisation chamber, where the radiolabelled DNA probe after denaturation is applied to the membrane in a chemical solution that promotes hybridisation. The binding of probe is a very slow process and requires a long time. After overnight incubation of the reaction mix for hybridisation, the nitrocellulose membrane is further washed to remove unbound radiolabelled

Selection of rDNA Clones and their Expression Products

173

this purpose, unique ways of probe making is followed, such as random priming methods (Fig. 7.9). These

the position of the hybridisation signal is further determined by autoradiography. It is a well-established fact that use of radioactive material is not only harmful, but also dangerous for the environment. The use of radioactive material also requires to follow many restrictions when it is used and requires to take permissions. In order to overcome these problems new methods of labelling with nonradioactive method of labelling is biotin labelling and horse radish peroxidase labelling.

Fig. 7.9 Random priming

(dUTP) nucleotides are prepared after a chemical reaction with biotin. Biotin is an organic molecule having

.

Mechanism involved in biotin or digoxigenin labelling Biotin is a vitamin and digoxigenin is a steroid from foxglove plant. Both are used as molecular tags for DNA labelling. Both of them are linked through uracil, therefore, uracil must be incorporated into DNA as they do not contain uracil, but thymine. Polymerases cannot incorporate uridine triphosphate (UTP) and they need deoxy type of uridine. Therefore, deoxyuridine triphosphate (deoxyUTP) is introduced in the reaction mix. synthesis and resulting in the incorporation of the said.

Hybridisation probing and its uses strand can further be labelled and used as a probe. The probe should have similarity or complementarity with of all we need to decide the gene for which we are looking for, based on which one can isolate very near or

174

Recombinant DNA Technology and Genetic Engineering

Fig. 7.10 Structure of biotin

Fig. 7.11 Nonradioactive methods of labelling: Biotin and HRP

Selection of rDNA Clones and their Expression Products

175

(a) Colony transfer to nitrocellulose or nylon membrane Nylon membrane

Colonies transferred onto the membrane cDNA (b) Alkaline and protease treatment of the colonies on the membrane DNA Loosely bound

Alkali and protease

(c) Cross linking

80ºC for 60–120min or UV irradiation

Surface with exposed nucleotide bases

Sugar phosphate backbone Stably bound DNA

Nylon membrane

(d) Hybridisation of probe with the membrane bound DNA Specific binding

DNA probe Washing to remove nonspecifically bound

Autoradiogram

Nonspecific binding

(e)

Positive colony

Fig. 7.12 Colony hybridisation (i) It is always possible that the desired gene is expressed in high levels in a particular cell or tissue or organism, from where one can make cDNA library. For example, keratin protein which is abundantly present not more than 7–8 amino acid residues based on which one can go further for NCBI blasting, which gives the information regarding the sequence such as, what protein the sequence belongs to, (iii) If it is novel protein it and cloning, etc. If it is unique protein, NCBI blast predicts the conserved domains of the protein, based on

176

Recombinant DNA Technology and Genetic Engineering

7.4 ANALYSIS OF cDNA LIBRARY It is done to understand the percentage of different varieties of recombinant clones in a prepared library. For example, in a cDNA library prepared from human hair, a large portion of the copies of clones represent bases of keratin protein. The clone selected to make a probe is done randomly. This can be used to probe all

to identify abundant clones in a library.

Fig. 7.13 Utilisation of probe for colony hybridisation

It is very easy to make a oligonucleotide probe for a known gene, since thousands of genes are characterised by cloning and their expression in suitable hosts. Prior to this, these sequences are submitted and stored in bank. In most of the cases, degenerate oligonucleotides have been made for these genes which is predicted

Selection of rDNA Clones and their Expression Products

177

codons (codon redundancy). In order to overcome this problem, degenerate probes are planned and prepared to identify a protein of interest. It is also possible to identify and isolate known genes or very closely related NCBI blast that helps in identifying gene from the library. If homology is much less, one can check for the presence of conserved sequences/domains, based on which one can predict the sequence as to which gene it codes for and so on.

Use of degenerate synthetic labelled oligonucleotides to identify a clone of interest Based on the amino acid sequence obtained from the gene bank degenerate oligonucleotides are synthesised. Degenerate probes will have many different populations based on the amino acids. More redundancy means more will be the degenerate primer sequences. Among them, there are some which can essentially identify particular clone of interest from the library. The hybridisation signal indicates which clone carries the gene of interest. Subsequently, by following second probing with a mixture of oligonucleotides or with degenerate probes, degenerate oligo has been made must be very cautiously chosen. This process has been described in Fig. 7.14. (a) First probing

Random oligonucleotides are used

Synthetic end labelled oligonucleotide

Probing by colony hybridisation Library of colonies Hybridisation of oligonucleotide Development of autoradiogram Probable clone

Nonspecific clones

(b) Second probing for specific identification of the clone from probable clones Predicted oligonucleotides are used

7.14

Definite and specific clone of interest

178

Recombinant DNA Technology and Genetic Engineering

7.5 IDENTIFICATION OF TWO RELATED GENES BY HETEROLOGOUS PROBING Two similar genes of two different organisms will have similarities in different aspects such as amino acid and the conservation of gene structure during evolution. Therefore, a single probe can function in identifying gene can easily make a stable hybrid with the other gene also. Stable hybrid formation is possible because of their sequence similarities among them. Based on the above phenomenon, a new and novel method has been developed known as heterologous probing.

two similar genes from two different organisms. For example, the XFP gene (codes for fructose-6-phosphate

Fig. 7.15 Various methods of probing

Selection of rDNA Clones and their Expression Products

179

phosphoketolase) of lactobacillus is used to make a probe which is used for probing of similar gene from

detected on autoradiogram. Based on the level of sequence similarity, the probe needs to be prepared, and the conditions need to be changed accordingly. These conditions should stable the hybrid formed till the from different organisms. But it is very essential to have a single gene sequence in order to begin the process of other genes from different organisms. The whole process has been represented in Fig. 7.15.

7.6 EXPLOITATION OF TRANSLATIONAL PRODUCTS AS TOOLS FOR IDENTIFICATION OF CLONE Till now we have learned to identify clone of interest from thousands of cDNA library by following the hybridisation method. The hybridisation technique is very useful in screening large genomic libraries in a very short period of time. Although, the technique requires a small DNA probe having complementarity In such cases, one needs a different strategy, such as immunological screening which is one of the reliable replacement techniques for hybridisation probing. The differences between the two process are that the hybridisation probing is an exclusively DNA-based an important role. In the case of immunological screening, protein coded by the cloned gene is detected. In order to follow immunological methods, it is essential to have a cloned gene expressed successfully, the expressed protein being utilised and not present in the host. Immunoscreening has been represented in Fig. 7.16.

(a) Antibodies for screening colonies

Cell lyses by chemical means

Membrane

Antibody addition Specific binding of antibodies to clone specific antigen

Lysed cells on the membrane

Add125 I labeled protein A (b) Autoradiogarm

Antigen from the lysed cells Specific antibody Labelled protein A Recombinant protein

Fig. 7.16 Antibody based protein detection

180

Recombinant DNA Technology and Genetic Engineering

As soon as human, or animal system is invaded by foreign organisms such as bacteria, virus or any other organism, it triggers an activation of defense mechanism by synthesising and secreting antibodies that prevent diseases or curb infections. A similar phenomen has been exploited in raising the antibodies against a

to expose the proteins in the cells and stably crosslinked to the membrane. antibody (Fig. 7.16) binds to immunoglobulins by which antibodies have been made. Protein A is a bacterial protein that has

Limitations of antibody-based protein detection 1. The basic requirement for this method is the successful expression of clone of interest. It may not be guaranteed always, especially if the library is of eukaryotic origin, where the expression of eukaryotic proteins in bacterial cells is not always successful. Therefore, the method requires reasonably good expressing clonal library. 2. But recent advances have achieved successful expression of any gene in bacteria by using specialised E. coli plasmid vectors.

7.8 PREPARATION OF POLYCLONAL ANTIBODY 7.8.1 Introduction Polyclonal Antibodies (PAB) are glycoproteins which are used in a variety of biochemical experiments, e.g., immunoblotting, immunoprecipitation and diagnostic tests. In order to make an antibody, it is very essential

Selection of rDNA Clones and their Expression Products

181

to have the antigen as a basic requirement (which stimulates antibody production by the body). Antigens response to the antigen. Usually rabbits are considered to be the best suitable organisms for PAB production because of ease in handling, their size and most importantly, rabbits show strong immune response. Mycobacterium tuberculosis and,

is used for booster immunisation purposes, after immunisation with FCA. Disadvantages are also observed because of use of FCA such as anaphylactics reactions, granuloma formation, tissue necrosis and fever. Before immunisation, emulsion of antigen and FCA or FIA is made and used. FCA, which contains heat killed mycobacterila cell wall is to be carefully used because accidental sensitisation to tuberculin which negates future tuberculin reactions. It is advisable to always protect one self by using protective gloves, and eye wear. FCA is understood to be one of the potentially hazardous methods, effective for research use. For e

Procedure The antigen is m antigen mix at 4ºC until used. It is advisable that the primary immunisations should not be conducted in an animal house but carried out in a well-ventilated aseptically maintained room. Before immunisation, it is also recommended to sedate the animal but not anaesthetised. It is very essential to collect blood samples of

l approx.) subcutaneously footpad immunisations are not acceptable and against the ethics of animal use, hence it should be avoided.

4 cm from the spinal column. This process helps in greater titers while reducing the incidence of severe local After immunisation, return the rabbit into its cage very gently, and monitor its recovery. A register must

nerves must be avoided.

Collection of blood Always use the marginal ear vein before collecting the blood, the animal should be sedated. The site of the ear where vein puncture needs to be carried out should be wiped with alcohol.

182

Recombinant DNA Technology and Genetic Engineering

1. Immunisation of rabbit 1.1 Preparation of antigen for immunising the rabbit. Cl). Mix well in an eppendorf.

NaCl 8g KCl Na2 1.44 g 4 PO4 2 2. The antigen mix should not contain any air bubbles during the immunisation.

Selection of rDNA Clones and their Expression Products

183

C

If pure antigen is not available, it may be essential to make good quantities of the antigen by

184

Recombinant DNA Technology and Genetic Engineering

Cl solution for 5–15 min.

(d) Pippette it out into an eppendorf tube. This can be further used for immunisation of rabbit.

(f) Serum testing.

Selection of rDNA Clones and their Expression Products

185

(h) Preparation of rabbit for bleeding: Always follow the animal ethics when using animals for experiments. should be done by rubbing the ear or warming it with hot water.

ear only. The other ear will be required for large bleeds.

Processing of blood and coagulating plasma (b) Transfer the upper aqueous plasma layer into a fresh eppendorf. (c) If possible add 1–5 units of thrombin and mix well.

diseases. It is also used to measure total antibody content in the blood, and it cannot be used or rarely used

Flow Diagram for Direct ELISA antigen. The binding of antigen to the solid surface is independent of the condition and temperature.

incubation, antibodies bind to antigen.

186

Recombinant DNA Technology and Genetic Engineering

stopping reagent is added followed by the measurement of the colour formed spectrophotometrically.

Procedure in detail (ELISA) performing in the laboratory LISA

g/ml of BSA and add antigen.

Selection of rDNA Clones and their Expression Products

2. Wrap the antigen coated, 96 well plate with kim wipes and CO2

l of PBS.

7. Add primary antibody solution of 82.5 l per well and incubate further for 1–1.5 hr.

187

188

Recombinant DNA Technology and Genetic Engineering

9. Add 75

Alkaline phosphate substrate buffer: 97 mg Diethanol amine 2

O Alkaline phosphate substrate p-nitrophenyl phosphate disodium 2

7.10 WESTERN BLOTTING the process is also known as protein immunoblotting. The process begins with separation of whole cell

The name Western blot was given to the technique by W Neal Burnette based on the earlier names for DNA detection developed by Northern blotting. The detection of of protein is termed as Eastern blotting. Names for all the blotting methods is a mere misnomer.

Selection of rDNA Clones and their Expression Products

189

the sample preparation should be well planned, based on the type of separation to be followed. Most of the separations for small molecules is based on polyacrylamide gels, with sodium dodecyl sulfate as one of

separation of the protein based on its molecular weight. SDS treatment of protein leads to the attainment of negative charge by the protein, hence, all the proteins in a sample are negatively charged and they move to positively charged electrode through the acrylamide mesh of the gel. The mobility of the proteins depend on the molecular weight, hence, higher the molecular weight of the protein, slower will be the mobility and vice versa. The resolution of protein bands on the gel depends on the pore size, hence, higher the concentration of the acryl amide, smaller will be the pore size and higher will be the resolution.

Sodium dodecyl sulphate polyacrylamide gel electrophoresis based on the similar charge and mass ratio. The proteins SDS resulting in denaturation of the protein. As the electrophoresis of the protein and its separation totally depend on the SDS so it is named as SDS polyacryl amide gel electrophoresis. As soon as protein is treated with SDS, it leads to expansion and opening up of the protein, and the molecules are separated based on their mass. The reagent SDS used in this procedure is considered to be highly stable, chemically inert and transperant. On treating protein with SDS, denaturation occurs, leading to the introduction of negative charge for all the proteins in the sample. During the separation, weight and high molecular weight proteins separate gels of different concentrations of acrylamide should be size.

Common problems faced during SDS-PAGE and tips to overcome Most common problem faced

Solution

- Gel taking very long time to run

Use fresh running buffer

problems such as shrinking.

190

Recombinant DNA Technology and Genetic Engineering

Requirements

Use very carefully. 1.5 M Tris-C C

2. Minigel components: Components

Separating gel

4

separating buffer

6.25 ml

4

stacking buffer

-

APS

Stacking gel

-

Selection of rDNA Clones and their Expression Products

Polymerisation

Acrylamide Acrylamide Concentration

Linear range of protein size (KD)

-Butanol overlay on separating gel.

Water saturated n-butanol helps in removing the air bubbles.

191

192

Recombinant DNA Technology and Genetic Engineering

6. Add stacking gel solution. Immediately keep the comb.

Preparation of sample human blood for loading into SDS-PAGE.

Selection of rDNA Clones and their Expression Products

SDS sample buffer.

193

194

Recombinant DNA Technology and Genetic Engineering

9. When the loading dye enters into the gel tank it should be stopped and processed further by coomassie blue staining. Finally the gel looks like as shown below.

Fig. 7.17

gel to the membrane. The transfer system is arranged in such a way that the membrane (positive end) is placed

stain can easily be removed after detection of transferred protein bands and is water soluble.

Blocking Blocking is a process of coating a membrane with Bovine Serum Albumin (BSA) or skim milk in order to the surface of the membrane in all places where the target proteins have not attached. Therefore, the antibody has no place to bind, other than on the binding sites of the target protein. This process drastically reduces noise in the Western blot.

Detection It is a biochemical reaction where enzyme and substrate come into force. It has two main steps– treatment of primary antibody followed by secondary antibody. The membrane is exposed to primary antibody containing

Selection of rDNA Clones and their Expression Products

195

The membrane is now exposed to another antibody known as secondary antibody which is directed at a recognise and bind to antimouse primary antibody. Secondary antibodies are target-oriented, hence, they are known as antimouse or antirabbit. Secondary antibodies are commercially available with tags such as alkaline phosphotase, horse radish peroxidase, etc. After addition of secondary antibody, the signal is enhanced because many secondary antibodies bind to a single primary antibody. Finally, the protein will be detected by following autoradiography or by chemiluminescent assay.

Radioactive detection P labelling is very common and does not require enzyme substrates, but rather allow the placement of

radioactive methods for detection of proteins is discouraged because they are very expensive and health multinationals provide a useful alternative.

Fig. 7.18 Protein band visualisation on a X-ray sheet after Western blotting

Requirements 1. Transfer buffer 2. PBS p 7.4

Procedure

2. Cut the nitrocellulose membrane to the size of the gel. min. 4. Similarly soak six pieces of the W

196

Recombinant DNA Technology and Genetic Engineering

Prepare the sandwich

2. Place gel on the paper. 4. Put the second sheet of paper. 5. Close the pads. or before running the gel, check the arrangement again. Transfer occurs from –ve to +ve charge. So NC (Nitrocellulose) membrane should be placed in.

Fig. 7.19

Selection of rDNA Clones and their Expression Products

197

Detection of proteins 1. Carefully lift and soak the membrane in the blocking solution. Incubate in blocking solution for overnight.

4. Incubate the membrane in blocking buffer containing secondary antibody.

6. Develop the colour with DAB. O 2.

2

7.12 HYBRIDISATION

template or substance needs to be well exposed on the surface of the membrane, so that the probe can easily bind to the desired location. There are three different kinds of transfer methods that exist. These methods have been named based on the person who discovered them while some are misnomers.

ybridisation (

proteins.

198

Recombinant DNA Technology and Genetic Engineering

described by Southern (1975). The process begins with isolation of pure genomic DNA from organism of interest. Subsequently, it is restriction enzyme digested, and separated with good resolution by agarose gel electrophoresis. The separated DNA fragment is denatured and transferred to nylon or nitrocellulose

sequence at which hybridisation has taken, autoradiography is used .This technique is universally applicable for any kinds of DNA or organisms. There are many important parameters that play an important role in southern hybridization. They are size of the probe, length of the sequence of the probe, complementarities DNA can be transferred to Nylon membranes through three different methods: 1. Capillary transfer

Separation of restriction fragments

Reaction buffer Tris. Buffer NaCl” ionic strength MgCl2 : co-factor

Procedure for restriction enzyme digestion

l.

Selection of rDNA Clones and their Expression Products

x loading dye and load onto agarose gel.

199

200

Recombinant DNA Technology and Genetic Engineering

6X Loading dye

Agarose % dye migration BPB

XC

concentration).

(d) Destain the gel for 15 min in 1X

Selection of rDNA Clones and their Expression Products

Reasoning/Tips blunt end tips are essentially used during pipetting. Use of sharpend tips may lead to shearing of DNA. in most of the cases it forms clumps in which only surface exposed DNA is well digested. In order to overcome this problem, it is better to incubate

temperature, intermittent stirrings are followed. the digestion results in formation of very large DNA fragments. These well dissolved and settled before running the gel.

Agarose Gel Electrophoresis X till it is well dissolved.

201

202

Recombinant DNA Technology and Genetic Engineering

2. Warm the agarose solution and add onto the mould.

Agarose gel % W/V

X

DNA size

for 1–2 hr.

Selection of rDNA Clones and their Expression Products

203

Lane 1– kbp Ladder Figure showing the separated DNA band on agarose gel

Optional requirement.

Processing the gel 1. Transfer the gel to the pyrex dish for depurination. Depurination: Maintains the capillaries on the gel without getting blocked. Weak acid depurinates strong base and hydrolyses the phosphodiester backbone at depurinated vicinity.

Depurination: DNA exposure to weak acid is partial depurination. Why do we require depurination?

denaturation solution for 15 min.

204

Recombinant DNA Technology and Genetic Engineering

Denaturation solution Cl.

5. Neutralisation solution

Neutralisation solution for 15 min. Neutralisation solution C 1.5 mM NaCl.

Selection of rDNA Clones and their Expression Products

205

Gel is ready after washing with denaturation and neutralisation solution. This DNA can be transferred to nitrocellulose, nylon membrane by three different methods: 1. Capillary transfer

Capillary transfer

fragments. As the size of DNA increases, the movement decreases. To maintain the capillaries as good fragments. The basic mechanism involved in transfer is that buffer is absorbed and passed through the gel into a stack of paper towels. Through the capillary movement, DNA is eluted from the gel and after crossing paper towels and W throught the system.

Advantages and Disadvantages 1. The method requires high concentration of DNA

DNA.

Experimental procedure X SSC: Cl

Requirements X SSC

206

Recombinant DNA Technology and Genetic Engineering

Cut a piece of NC membrane about 1 mM large. It should be larger than the gel in both dimensions. NC should be dipped well in ddw subsequently with the transfer buffer. Make sure that there are no air bubbles between the gel and NC membrane. Presence of air bubbles inhibit the transfer of bands from gel to NC membrane.

1. Arrange as follows:

5 mM paper

Nylon membrane Gel

10 x SSC

2. (a)

(b)

Selection of rDNA Clones and their Expression Products

(c)

3 mM paper

support

(d)

(e)

(f)

(g) Never submerge the solid support in transfer buffer.

207

208

Recombinant DNA Technology and Genetic Engineering

X

crosslinker.

Vacuum transfer Introduction and Mechanism involved

Selection of rDNA Clones and their Expression Products

5 mM paper

Nylon membrane

10 X SSC

2. Arrange the following in an order on vacuum blotter.

4. Keep the gel on wrap.

Gel Wrap

Transfer pattern

Membrane 3 mM paper

209

210

Recombinant DNA Technology and Genetic Engineering

staining. is denatured.

7.13 BASIC MECHANISM OF HYBRIDISATION the nitrocellulose or nylon membrane. There are many methods available, but they differ in their 1. Components and conditions such as solvent and temperature used for hybridisation. 2. Amount of solvent used and length of hybridisation.

5. Use of substances for enhancing the reassociation of nucleic acids.

less harsh on membranes. But both the solutions give good and reproducible results. It is always suggested

should take care that the membrane should always be covered with the buffer and membrane should not be left dried. Agitation is not recommended for hybridisation of a single membrane. For multiple membrane hybridisation, it is very essential as it prevents adhering or stacking of membranes, which further inhibits binding of probe to its target.

binding, and they contain 5X

Selection of rDNA Clones and their Expression Products

211

strength solutions and at room temperature. The buffer with greater buffering capacity are preferred for hybridisations.

Procedure [Hybridisation by using Denhardt’s Solution] Smaller the volume of hybridisation solution, the better it is.

Prehybridisation solution

Background could be reduced by following prehybridisation step.

solvent and temperature. Basic steps in the method are: a. Method of shaking (continuous or stationary) matrix). d. Temperature and solvent e. Use of compounds which enhances the association of nucleic acids.

Denaturation of double-stranded DNA probe. Washing solution 2X SSC 5 times washing of 2 min each C O 2 They enhances the binding of the DNA to the membrane. Hybridisation solution 2X

212

Recombinant DNA Technology and Genetic Engineering

Check the background radioactivity by using Geiger-Muller counter.

Washing:

Requirements 1. Plastic tray/pyrex dish 2. Washing solution

Selection of rDNA Clones and their Expression Products

213

Signal generation/detection 1. First keep the NC paper where DNA has been transferred. 2. Upon it keep X

2. Wash with double-distilled water. 4. Washing with double-distilled water. 5. Drying by exposing it to air.

is then transferred to a membrane subsequently probed with a labelled complement of a sequence of interest (probe). James Alwine, David Kemp and George Stark discovered it in 1977. The term ‘Northern blot’ is a misnomer, where the process followed is similar to Southern blot. The only difference among them is that capillary transfer of DNA to the membrane. The results may be visualised through a variety of ways depending

The procedure is commonly used to study and quantify gene expression levels, by measuring how much of under what conditions, certain genes are expressed in living tissues.

Procedure

its rigidity and pore size. Nylon membranes are mostly preferred because of their positive charge where

214

Recombinant DNA Technology and Genetic Engineering

hybridisation is followed in hybridisation chamber with labelled probe in very less volumes of buffer and

Formaldehyde agarose gel electrophoresis

formaldehyde and urea gels. These two reagents have the ability to relieve the structures formed. Before NAses.

DNA/RNA probes , chemiluminiscent material or horse radish peroxidase which is feasible for the detection.

Advantages and Disadvantages enormous amounts of

Fig. 7.19 representation of Northern blotting

Selection of rDNA Clones and their Expression Products

Requirements

Formaldehyde, DMSO and Glyoxal are denaturing agents.

GIT solution Guanidine Isothiocyanate 94.57 gms

GIT is a denaturing agent. to chop the tissue or to break tissue.

215

216

Recombinant DNA Technology and Genetic Engineering

sarcosinate.

5.7 M CsCl cushion CsCl 95.97 gms O

Selection of rDNA Clones and their Expression Products

CsCl. TES Buffer Tris.C

217

218

Recombinant DNA Technology and Genetic Engineering

well.

ethanol

Selection of rDNA Clones and their Expression Products

Denaturation solution Gn Thiocyanate 4 mM

219

220

Recombinant DNA Technology and Genetic Engineering

Absolute Alcohol

– 20 – 70°C

RNA DNA

(i) Dry the pellet in a vacuum. Two ways of denaturating gel electrophoresis based on denaturating agent used: 1. Glyoxal/DMSO denaturing gel electrophoresis. 2. Formaldehyde denaturing gel electrophoresis.

Denaturing RNA molecules Add the following in a sequence order into centrifuge tube:

l (2 mg/ l

Selection of rDNA Clones and their Expression Products

C base pair.

221

222

6.

Recombinant DNA Technology and Genetic Engineering

Selection of rDNA Clones and their Expression Products

223

very easy to handle in comparison to glyoxal /DMSO containing gels. Glyoxal /DMSO gels should run more slowly and are also required to recirculate the electrophoresis buffer. This method results in

Glyoxal / DMSO gel loading buffer

224

Recombinant DNA Technology and Genetic Engineering

16s, 28s, and 5.8s.

Formaldehyde RNA denaturing gel electrophoresis

Requirements X formaldehyde gel running buffer.

-Bromophenol blue - Xylene Cyanol Add the following components to an eppendorf:

samples for 5 sec.

Selection of rDNA Clones and their Expression Products

2. Incubate on ice.

5. Staining solution:

225

226

Recombinant DNA Technology and Genetic Engineering

Formaldehyde gel is very delicate and is instructed to handle very carefully. It may break..

Hybridisation

X

Selection of rDNA Clones and their Expression Products

X SSC.

4. Follow the next step. (a) Pyrex dish support

(b)

X SSC (do not submerge the solid support). (c) 3 mM paper 3 mM paper

20X SSC support

227

228

Recombinant DNA Technology and Genetic Engineering

(d)

(e)

(f)

(g)

support

Transfer should be for

REVIEW QUESTIONS

b. Biotin labelling

Selection of rDNA Clones and their Expression Products

229

c. Colony hybridisation

c. Types of hybridisation.

REFERENCES Benton et al. Screening lgt Recombinant Clones by Hybridisation to single Plaques in Situ. Science, Grunstein et al. Colony Hybridisation: A Method for the Isolation of Cloned cDNAs that Contain a Young et al. . Kemeny et al Burden et al. Practice and Theory of Enzyme Immuno Assays. 1985, Science publishers, The Netherlands.

GENE MODIFICATION AND APPLICATION OF RECOMBINANT DNA TECHNOLOGY 8.1 MUTAGENESIS

8 Contents

in-vitro in-vitro

8.1.1 Random Mutagenesis

Chapter

Mutagenesis Oligonucleotidebased mutagenesis PCR-based site directed mutagenesis Polymerase chain reaction (PCR) Applications of rDNA technology in diagnostics rDNA technology and forensics DNA

random mutagenesis

for sex determination

231

8.1.2 Methods of Mutation and Selection

per se

232

8.1.3 Direct Mutagenesis

in-vitro

C to G At N2 position

Gene

Gene expression and protein production

Mutagenesis Introduction of terminator/ changing the active site residue

Inactive GFP GFP

Normal GFP is produced hence, the bacteria also looks as green colour

Fig. 8.1

No GFP is produced Bacteria does not look green

233

in-vitro

Fig. 8.2.

E. coli E. coli in-vivo

E. coli

234

E. coli

Fig. 8.3

E. coli in-vivo

235

Primer planning

Strategy for Mutagenesis

5 GAA CTT

Mutagenic primer

5

Downstream primer

Given sequence 5

Write antisense sequence Required sequence 5

236

PCR has three main steps

Planning a primer (oligo) 5

Upstream primer sequence: 27 mer 5

Downstream primer sequence Given Sequence: - 27 mer 5

Write antisense sequence Required sequence 5 5

Fig. 8.4

237

* What will happen if it is opened as soon as it is taken out from –20°C freezer?

238

239

Conversions

g(of oligo)

Primer Planning: 5

Upstream primer 5 5 5

Downstream primer 5 5 5 5 Basic rules and regulations

106 pg 1 g

1 Pmol 330 Pg

1 N

g of oligo N

3, 03

240

1. PCR: Polymerase Chain Reaction Requirements O O

241

Phenol preparation

Preparation of Phenol

Aqueous phase Organic phase

Transfer aqueous phase again

500 mM of 100 mM tris [ph 8.0]

Mix well Separator phase

Phenol: Chloroform: Isoamyl alcohol

Store at –70°C 10–15 min.

242

Vortex and use 1–5 l DNA for PCR

Heat if for 15 min

8.4.1 Introduction

Requirements Master mix for PCR

243

8.4.2 Methodology

1. Denaturation

Genomic dDNA (double stranded DNA)

Forward Primer Reverse Primer

5 3

Double-stranded DNA

3 5

Step 1 Denaturation/ Heating

Step 2: Annealing 5

3 3

5

Step 3: Extension 5

3

3

Fig. 8.4 2. Renaturation

3. Extension by DNA polymerase

Requirements

PCR 5

244

PCR precautions

Protocol (How to Perform a PCR)

Master mix preparation

PCR reaction mix

245

Regarding dNTPs

246

8.5 APPLICATIONS OF rDNA TECHNOLOGY IN DIAGNOSTICS

Mycobacterium tuberculosis

Fig. 8.5

247

Fig. 8.5

et al

in-vitro

in-vitro in-vitro

Mycobacterium tuberculosis

248

5’ Template DNA 5’

Denaturation primer annealing

Extension

Final extension

Amplified fragments

Fig. 8.6

249

Fig. 8.7

8.5.2 Use of DNA Fingerprinting Techniques

250

8.5.3 Culture Independent Methods

8.6 RDNA TECHNOLOGY AND FORENSICS Forensics

8.6.1 DNA Fingerprinting

251

Developing cures for inherited diseases

8.6.2 How is DNA Fingerprinting Done?

252

Suspect’s blood Sample

Evidence from the crime scene

Membrane with DNA fingerprint

DNA isolation

Restriction enzyme digestion of DNA

Southern blotting

Separation by electrophoresis

DNA denaturation

Fig. 8.8

253

CASE STUDY OJ Simpson and Anna Nicole Smith

Fig. 8.9

254

(a) G TAA C T G A C G T T G TAT C G

Single nucleotide change alternatively, point mutation

Insertion or deletion

USEFUL FOR RFLP- BASED FINGERPRINTING G TAA C C G A C G T T G TAT C G

G TAA C C G A C G T T G TAT C G

G TAA C C G A C G T T G TAT C G

G -A A C C G A C G T T G TAT C G

G TAA C C G A C G T T G TAT C G

G TAA C C GA C G T T G T - T C G

G TAA C C GA C G T T G TAT C G

G TAA C C GA C G T T G TAT g C G G TAA C C GA C G T T a G TAT C G

(b) Tandem repeats AATA GAAC GAAC TGCATTC

AATA GAAC GAAC GAAC TGCATTC

TWO REPEATS

THREE REPEATS

6 REPEATS USEFUL FOR STR-BASED FINGERPRINTING

Fig. 8.10

Deletion

insertion

255

Advantages

Fig. 8.11

256

8.7 DNA FINGERPRINTING FOR SEX DETERMINATION

257

Fig 8.12

258

1

2

3

4

300bp 150 112 bp 100

50

X Y sa m pl e

X X sa -ve control m pl e

Fig. 8.13

sequencing and alignment

REVIEW QUESTIONS

in-vitro

259

REFERENCES et al et al PNAS USA

THE APPLICATION OF GENE CLONING AND DNA ANALYSIS

Chapter

9

9.1 PRODUCTION OF PROTEIN FROM CLONED GENES Biotechnology deals with the use of biological processes in industry as well in technology development. This chapter deals with how the techniques, which have been studied so far, are used in research and developsuch as cancer, tuberculosis, Alzheimer’s were big threats to human lives and now they have been eradicated to some extent. It is in the belief of our society that the solution to these chronic diseases can come through biotechnology. This will undoubtedly be true, for single gene changes. The causes for arise of chronic diseases are most probably not due to single gene changes, but mainly due to complex and cascading series of biological events interacting with the environment. Biotechnology can play an important role in maintaining normal human functions and a high personal level of health. There is a direct relation between human health care and pharmaceutical biotechnology innovations, which have the earliest commercial realisations. Alexander Fleming had initiated the use of microbes in industry for the development of various drugs in 1929. The use of penicillium for synthesis of a potential antibacterial agent initiated the use of fungi and bacteria in large-scale production of antibiotics. In the recent past, researchers main interest has been to purify antibacterial, anticancer and health care protein products through native organisms. Since the population has increased several folds, one needs large quantities of health care products and are engineered in a very limited fashion. Therefore, new technologies are very essential in order to increase the level of production, which is only possible by using the tools of biotechnology, i.e., cloning and expression of protein of interest in bacterial systems. One of the main reasons behind the focus that has been generated towards biotechnology is because of a single technique known as ‘gene cloning’. It has not only revolutionised the health care system, but also improved the quality of life. In ancient times, many microbes were used for the production of certain drugs, useful secondary metabolites by fermentations such as batch culture and continuous cultures. However, this may not be suitable for all organisms, as many important healthcare products were also produced. Therefore, the

Contents Production of protein from cloned genes Cloning and Expression vectors for E. coli system E. coli promoters for gene expression and protein production Recombinant protein production in E. coli: General problems Eukaryotes for protein expression and production Recombinant protein production in Pichia pastoris, Saccharomyces cerevisiae and Kluveromyces Lactis Filamentous fungi for protein expression and production Gene cloning and DNA analysis in medicine Eukaryotic gene synthesis and expression in E. coli Synthesis, cloning and expression of other recombinant proteins with therapeutic importance Gene therapy Gene subtraction/ Antisense technology

The Application of Gene Cloning and DNA Analysis

261

same process of obtaining these products cannot be followed for higher organisms. The entry of gene cloning technologies have revolutionised the production of healthcare products in large quantities. Gene cloning host, further inserted into a plasmid cloning vector. Subsequently, this genetic material is introduced into a bacterium or any heterologous system’. If the cloning procedure has no errors, the gene will be expressed and the protein synthesised by the bacterial cell. This will ultimately help in procuring large amounts of protein of interest. The cloning and expression of a gene of interest leading to the production of large amounts of product is not as easy as it sounds. Based on the gene of interest and its features one needs special vectors, heterologous hosts, etc. In this chapter, our main emphasis is to look for cloning vectors for recombinant protein production and examine some of the problems associated. Figure 9.1 shows a scheme for cloning, expression and production of protein in bacteria.

Fig. 9.1 A short scheme for cloning, expression and production of a protein in bacteria

9.2 CLONING AND EXPRESSION VECTORS FOR E. COLI SYSTEM Not all plasmids commercially available such as pBluescript, pUC and pBR322 are expression vectors. There are two different kinds of plasmid vectors; (i) Multipurpose cloning vectors and (ii) Expression vectors.

Multipurpose cloning vectors Multipurpose cloning vectors are those that contain Multiple Cloning Sites (MCS), antibiotic marker and an origin of replication. However, they lack regulatory regions such as promoter, terminator and ribosome binding site. They are named so because these plasmids contain multiple restriction sites. Therefore, any gene can also be utilised for in-vivo expression vector. Hence, cloning of a gene of interest in a multipurpose cloning vector does not guarantee on expression leading to protein production.

262

Recombinant DNA Technology and Genetic Engineering

Expression vectors Most of the commercial expression vectors such as pET, pTRC, and pQE are low copy plasmid vectors. They contain rop gene, which controls the copy number. These plasmids contain regulatory regions for expression. They are (i) Ribosome Binding Site (RBS) or Shine Dalgarno (SD) sequence (AGGA), (ii) Start codon (ATG) and (iii) Terminator. The expression always depends upon the gene and its surrounding regulatory elements that can be recognised by host system. The regulatory elements stated above are short nucleotide sequences that indicate for the presence of a gene and also initiate transcriptional and translational mechanisms of the cell. The regulatory elements have been described in Fig. 9.2.

Fig. 9.2 Structure of a cloned gene with regulatory regions 1. The promoter: It is also known as transcription start region recognises and binds to this region, initiating transcription. InT7 expression system, the total promoter region is approx.100 kbp in length. 2. The terminator: It is also termed as transcription stop region. Terminator region contains complementary DNA sequences, which initiates formation of secondary loop structures that stops transcription. 3. The ribosome binding site: It is a Shine Dalgarno (SD) sequence and it is AT rich region, where the ribosome recognises the sequence and binds, thus, initiating for translation. Ribosome binding is sequence 4. Start codon: ATG is the initiation codon from where the translation begins leading to formation of protein of interest. The distance between SD sequence and start codon are conserved with 7–9 bases only. 5. Terminator region: TGA, TAG, TAA are terminator codons and presence of these codons in the ORF indicates the termination of translation. Near the vicinity of the terminter, there is also a presence of complementary nucleotide sequences, which forms strong secondary structures, initiating for termination. The promoter regions of eukaryotic and prokaryotic systems are very different from each other but both the promoter regions are surrounded by regulatory regions or expression signals. There are sequence similarities among the prokaryotic and eukaryotic regulatory regions that do not guarantee the recognition of prokaryotic promoter by eukaryotic system and vice versa. This can be further described with a schematic representation of prokaryotic and eukaryotic promoters as shown in Fig. 9.3. A foreign gene with its own promoter cannot guarantee for a good expression because the regulatory regions of eukaryotes cannot be recognised by a prokaryotic system. Therefore, expression cannot be expected. In order to overcome these problems, new commercial E. coli plasmid vectors have been developed. These plasmids possess their own regulatory or promoter regions which are easily recognised by E. coli system, hence, the gene of interest would be inserted into the vector in such a way that it is placed under the control of E. coli set of expression signals. The plasmids that provide these signals for gene expression can therefore be

The Application of Gene Cloning and DNA Analysis

263

used in the production of gene expression leading to the protein production in E. coli; hence, these plasmids are expression vectors.

Fig. 9.3 Prokaryotic and eukaryotic promoter regions

Fig. 9.4 Strategy for cloning and expression of eukaryotic gene in E. coli

9.2.1 Critical Components of Prokaryotic Expression Vector As discussed earlier, the promoter region and surrounding nucleotide sequences play an important role in hyper expression of a protein. Hence, each nucleotide sequence of a promoter region plays a very crucial role. The nucleotide number, sequence of their arrangement, such as the distance between the ribosome binding site and start codon in E. coli promoter system is very well conserved and maintained with 7–9 bases only with AT rich regions. The increase or decrease of the distance drastically affects the expression levels. Hence, one should not manipulate these sequences. The gene expression is initiated when the RNA starts scrolling for translation.

264

Recombinant DNA Technology and Genetic Engineering

9.3 E. COLI PROMOTERS FOR GENE EXPRESSION AND PROTEIN PRODUCTION Most of the promoters contain conserved sequences among them; still one can observe the differences. These differences differentiate them as strong, medium and weak promoters. Strong promoters possess high rate of transcription, ultimately leading to the production of large amounts of protein of interest (Fig. 9.5). Strong system. This phenomenon leads to the production of large quantities of protein product, which is more than the host cellular protein. It is always suggested that toxic proteins do not require strong promoters because expression of this leads to cell death due to toxicity. and direct transcription of genes whose products are needed in very small amounts. Especially the gene products, which are toxic for the host are required to be produced in small amounts (Fig. 9.5). The proteins of promoter-based plasmids come into effect. These genes are cloned and transcribed at the highest possible rates under strong promoters.

Fig. 9.5

9.3.1 Regulatory or Inducible Promoters known as regulatory / inducible promoters. Most of the presently existing plasmids have this kind of options for regulating promoters for expression. E. coli system exists with two different kinds of gene regulation chemical incorporation to the growth medium. This chemical reagent is the one which functions as substrate for the enzyme coded by the inducible gene as shown in Fig. 9.5. There are some commercial vectors where the gene expression is controlled in such a manner that in the absence of inducer they never express the gene. It is known as controlled expression; this kind of system reduces not only the background or host proteins but also protects the host from the toxic effects of gene products. The expression vector does contain not only the promoter region and its sequences; but there are some more essential sequences present along with the promoter in and around. These sequences also play an important role in hyper expression of gene of interest.

The Application of Gene Cloning and DNA Analysis

265

The stringent expression vectors are very essential for the system as the recombinant protein, which is toxic for the system; the synthesis must be carefully monitored in order to prevent accumulation of toxic levels. This is possible by judicious use of the inducer to control expression of the cloned gene.

The importance of inducer and repressor Almost all the prokaryotic expression vectors are inducible with synthetic inducers such as isopropyl E. coli, optimal concentrations of inducer are introduced into the growth system of E. coli, which initiates the gene expression. Here, most of the expression vectors or They are also known to have strong promoters, indicating for stringent gene expression only in the presence

the inducer and repressor as they play an important role not only in sturdier vector systems, but also helps in understanding how exactly lac system works. The understanding of inducer and repressor relationship leads in further understanding the gene regulation or regulation of gene expression. In bacteria control of gene expression occurs by regulating the level of mRNA transcription, hence, transcriptional control mechanisms at this level play an important role. In most of the bacteria, the genes with related functions are located adjacent to each other and they are controlled in a coordinative manner. Coordinate regulation of genes subsequently leads to the production of polycistronic mRNA, which contains information of all the genes related. Therefore, in a bacterial system, they are able to sense the environmental conditions based on which the gene expression is triggered. In order to understand the relationship between the inducer and the repressor it is very essential to understand the lac operon system. Lactose operon system contains different structural genes, regulatory genes, operator, and inducer.

9.3.2 Lactose Operon and its Structural Genes The system contains three structural genes and they are involved in lactose metabolism. Their arrangement is given below in Fig. 9.6.

Fig. 9.6 Lac operon model

266

Recombinant DNA Technology and Genetic Engineering

Regulator is placed adjacent to the ORF or gene of interest that needs to be regulated. Inducer and regulatory gene both plays an important role in expression of structural gene.

Fig. 9.7 Mechanistic aspects of operon model showing importance of inducer

Operator

absence of inducer determines the binding of repressor to the operator. One can therefore understand that the inducer has the ability to inactivate repressor. Repressor is inactive in the presence of inducer, and will not bind to the operator which results in transcription of structural genes. Similarly, in the absence of an inducer, the repressor is active and therefore, it binds to the operator, further leading to inhibition of transcription of the structural genes. Here, the transcription process has been inhibited.Therefore, this is known as negative control mechanism.

Inducer Transcription of the lac genes depends on the inducer presence and absence. The inducers are synthetic versa in the absence of the inducer.

Common promoters used in expression vectors Based on the inducer or chemical used for expression and repression, there are four different kinds of promoters, (i) The lac promoter, (ii) The trp promoter, (iii) The tac promoter and (iv) L promoter.

The Application of Gene Cloning and DNA Analysis

267

The lac promoter (Table 9.1) One of the very well known and extensively used promoters for hyper expression of cloned genes in E. coli. protein from this promoter requires inducer or chemical reagent. Hence, addition of this chemical switches on transcription of a gene inserted downstream of the promoter carried over by the expression vector. This inducer gets recycled after initiation of a gene expression, hence it does not require to add large amounts for the expression studies. Most of the present day commercial vectors such as pET system, pQE system and many more have such promoters.

The trp Promoter (Table 9.1) Here tryptophan functions as a repressor, hence, in the presence of this chemical reagent in the media,

The tac promoter promoters.

The PL promoter A strong promoter responsible for transcription of the DNA molecule and well recognised by the E. coli RNA polymerase. It is one of the well-studied promoter, based on which many variants of E. coli have been made in order to regulate the gene expression. These vectors are best suitable for mutant E. coli, which have the capacity to synthesise the repressor cI protein. At lower temperatures, the cI protein represses the L promoter, and at higher temperatures, the protein is inactivated resulting in transcription.

Table 9.1 Common promoters used in E. coli expression vectors Sr No. 1. 2. 3. 4.

Name of the promoter Lac trp tac L

Inducer / repressor used Tryptophan Temperature

Remarks Initiates transcription Repressor Inducer Inducer

9.3.3 The Structure of Expression Vectors have terminator, ribosome binding site and possible multiple cloning sites adjacent to the start codon. Most of the vectors contain a cassette of restriction sites mostly between the start codon and the terminator. It is also very essential that the cloning sites should be able to create a start codon after the cloning of a gene. However, the distance between the start codon and RBS should not be tapped, as it is one of the most sensitive parts of the promoter that effects expression levels drastically. The cloning of the gene of interest should always be in the right position, which should not leave an extra amino acid or delete an amino acid from the cloned gene. Most of the commercial expression vectors such as pET system contain either NdeI or NcoI sites as cloning sites which are adjacent to the promoter regions. Cloning at these sites does not create an extra amino acid and by cloning at these sites, it automatically creates a start codon. However, the gene to to be GTG, GAG, GCC, GCT, etc. Sometimes, it may not be possible, since the ORF may also contain these

268

Recombinant DNA Technology and Genetic Engineering

many expression vectors, which made the life of a molecular biologist as well the protein chemist very easy in purifying the protein of their interest. Most of the expression vectors contain tags, which can be N-terminal of recombinant proteins. Therefore, in these vectors the tags such as Histidine TAG, or T7 tags are localised immediately adjacent to the ribosome binding site, followed by cloning sites. Therefore, cloning of a foreign gene into this restriction site must be performed to make a fusion with the tag already existing in the plasmid vector. This kind of cloning should be able to give a single and hybrid polypeptide without any interruptions. There are many advantages with this system,

Use of TAG containing expression vector

Fig. 9.8 Structural arrangement of E. coli expression vector, showing promoter and TAG regions

Strategy to construct a hybrid gene and synthesis of a fusion protein

Fig 9.9 Construction of a chimeric fusion gene One of the most important factors which effects cloned gene expression is the gene sequence at the start of the coding region, or the sequences present at the downstream of the start codon, ‘ATG’. If there, are any complementary sequences in and between the N-terminal regions of ORF, it can result in the formation of secondary structures because of intra-strand base pairing. This can mask the RBS and interferes in ribosome binding, further leading to the prevention of translation, hence, no product will be formed. This possibility can be avoided at the initial stages of cloning the gene into expression vector, where the complementary sequences in the ORF can be removed by site directed mutagenesis. The formation of intra-strand base

The Application of Gene Cloning and DNA Analysis

269

pairing or secondary loop structures are diagnosed by online freely available software Zuker’s m-fold programme’. This software predicts the formation of these translation inhibition structures and are further Fig. 9.10.

Fig. 9.10 A secondary structure shown by Zuker’s m-fold programme*

Fig. 9.11 Schematic representation of secondary structure Eukaryotic proteins contain different codons, which are easily recognised by eukaryotic system but not by E. coli system. These codons are known as rare codons. This process occurs because of lack of certain *http://mfold.rna.albany.edu/?q=mfold/download-mfold

270

Recombinant DNA Technology and Genetic Engineering

tRNAs coding for certain amino acids. Hence, expression of eukaryotic proteins in bacterial system is very

Table 9.2 gives the amino acids and their status in recognising different hosts. Some of the prokaryotic E. coli; it is mainly because of the formation of secondary loop structures. Therefore, it is very essential to relieve these secondary structures by silent mutagenesis. The Alexander Varshavsky (1986) hypothesis plays an important role in gene expression and stability of the expressed protein. This is known as N-end rule; and it suggests that the presence of Degran ‘degradative amino acid’ at the downstream of the start codon decides proteins’ half life. If there is a presence of amino acid such as Lys at the downstream of ATG, the synthesised or expressed protein is degraded, as its half life is very short around 30 seconds only. The presence of multiple number of amino acid residues after start

whole protein forming peptides. This is the major pathway followed for the removal of undesired protein based on the requirement.

Table 9.2 N-end rule in E. coli and saccharomyces cerevisiae Amino acid residue Arginine Lysine Leucine Tryptophan Tyrosine Histidine Isoleucine Aspartic acid Glutamic acid Asparagine Alanine Serine Threonine Glycine Valine Methionine

In-vivo half life in E. coli in min 2 2 2 2 2 2 600 600 600 600 600 600 600 600 600 600 600 600

In-vivo half life in yeasts in min. 3 3 3 3 3 10 3 30 3 30 3 1200 1200 1200 1200 1200 1200 1200

There are some sequences known as signal peptides which are responsible for directing the expressed protein to its native structure in the cell. If there is a presence of signal peptide such as omp A or mal E genes at the downstream of ribosome binding site, the protein is exported by the cell into the periplasmic region or

The Application of Gene Cloning and DNA Analysis

271

The introduction or presence of a tag (his-six histidine residues in tandem, or T7) has its own advantages. These tags may be very small ranging from 6–15 amino acids to large proteins such as glutathione –S-transferase and Ubiquitin, etc. Most of the commercially available plasmid expression vectors, such as pET system contain Histidine as a tag either at N-terminal or C-terminal as well as at both ends. This kind of fusion is

chromatography and ion exchange chromatography require skilled manpower and are cost effective and labourious. However, His-TAG, or T7 TAG–based plasmids are very short in size, therefore, no problems are observed with transformation and expression. As the tag, selection should be crucial because increase in the molecular weight of the tag brings in many disadvantages beginning with fusion, cloning and transformation,

Fig. 9.12

TAG

272

Recombinant DNA Technology and Genetic Engineering

tagged proteins, they are the presence of the tag at the N-terminal region of the protein that may alter the properties of the recombinant protein. There are different methods such as chemical or enzymatic based for are as follows. 1. Cyanogen Bromide (CNBr) mediated cleavage: This is one of the easiest methods and the mechanism involved in removal of the fusion tag is given in Fig. 9.13.

Fig. 9.13 CnBr mediated cleavage of polypeptide has many disadvantages compared to any other method. Therefore,

subjected for this kind of cleavage should possess a single methionine; presence of more than one can break recognises, binds and cleaves. 2. Enzymatic cleavage of hybrid protein to release TAG: Histidine and Glutathione tagged proteins are cleaved by different enzymatic methods. The use of enzymes for cleavage depends upon the kind of tag removes histidine amino acid residues. Some fusions require factor-Xa for cleavage, which cuts at Gly-Arg. cleavage, before selecting a particular enzyme one needs to clarify for the presence of said amino acid residue.

9.4 RECOMBINANT PROTEIN PRODUCTION IN E. COLI: GENERAL PROBLEMS Although E. coli

The Application of Gene Cloning and DNA Analysis

273

(i) problems due to foreign gene to be cloned and expressed and (ii) due to the limitations of the host and its suitability for recombinant protein production.

Problems resulting from the foreign gene As we discussed earlier, the sequences at the downstream of the foreign gene decides expression and production of the protein of interest. Other than these, there are many other causes as given below. 1. Most of the eukaryotic, proteins contain introns in the gene, cloning of the whole gene with intron E. coli system does not have the splicing ability to remove the introns and express the gene of interest. Hence, eukaryotic genes, which are expressed in E. coli should be cloned. 2. TAA and TAG code for stop or termination codons in E. coli, but these two codons may be coded for some other amino acid in different organisms. The gene of those organisms when cloned and expressed in E. coli, forms a truncated protein because there is a presence of TAA or TAG at the centre of the ORF. This is because this codon is treated or recognised as a termination codon in E. coli. Hence, before cloning, it is essential to check for such kind of problems. 3. As described earlier, the presence of rare codons is the other very commonly observed phenomenon because of which gene expression is altered. The codon bias is the phenomenon wherein certain codons are very well recognised by each system. The same may not be recognised by the other system, which leads to either no expression or negligible amount of expression. It is because each organism has a bias towards preferred codons. If a cloned gene contains large proportions of rare codons, it may have negative effect in translating the gene because of lack of host cell tRNAs and their ability to recognise these codons. 4. Presence of Degrans: According to Varshavsky’s N-end rule, the presence of degradative amino acid such as Lys, Arg, etc., at the downstream of start codon may lead to negligible amounts of stable expression. Degrans are amino-acid residues whose half life is 2–3 minutes, upon whose expression they are degraded because they will be targeted by 26s proteosome. Almost all the above problems can be usually solved, although the required manipulations are time consuming and cost effective. Beginning with intron associated problem, there are tools developed where one can make cDNA prepared from the mRNA and so lacking introns, may be used as an alternative. Site tool, leading to the introduction of E. coli accessible codons, could also reduce C rich regions. The formed secondary structures can also be removed by following m-fold program and then modifying the sequences according to E. coli system.

Problems resulting from the host cells Most of the problems existing with E. coli for recombinant protein expression and production are inherent in nature. The most commonly observed and expected problems from the host are as follows. 1. E. coli are not the suitable heterologous host for the expression and production of eukaryotic proteins, mainly because of the cytosolic environment of E. coli formation does not occur. Eukaryotic proteins essentially requires E. coli system does not posses into its native structure, it will not have any activity. One of the most important post-translational E. coli system. 2. Most of the proteins are hyper expressed in E. coli, if they do not posses any problems discussed above. Hyper expression causes misfolding of protein further leading to aggregation to form insoluble

274

Recombinant DNA Technology and Genetic Engineering

because refolding to get its native structure is very cumbersome and cost effective. 3. Sometimes, it is preferred to use mutant varieties of E. coli host in order to prevent protein degradation. There are many limitations with E. coli for protein expression and production especially with regard to eukaryotic proteins. Hence, it is very essential to study the basics pertaining to protein expression and production in eukaryotic hosts.

9.5 EUKARYOTES FOR PROTEIN EXPRESSION AND PRODUCTION

protein production in eukaryotes. Some progress has been made with Bacillus as expression host, but it is lower eukaryotes E. coli. They can also be further used for large-scale production of proteins as they are similar to microbes, easy to system is well feasible for expression and production of eukaryotic proteins. The major problem observed with protein expression in E. coli is that it is cost effective, labourious and requires skilled labour.

9.5.1 Lower and Higher Eukaryotes for Cloning, Expression and Protein Production The basic requirement for cloning, expression and protein production in lower and higher eukaryotes is expression vectors (vectors that are used for animal cell as hosts for expression). E. coli vectors are not suitable for lower eukaryotes. The system may not be able to recognise the promoters of one and the other. lower eukaryotes are the GAL promoter, the glucoamylase, alcohol oxidase and cellobiohydrolase. All these promoters are inducible promoters.

Table 9.3 Various kinds of promoters Sr No. 1. 2. 3. 4. 5.

Name of the promoter AOX GAL Glucoamylase Cellobiohydrolase

Inducer Methanol Galactose Starch Cellulose Copper

Remarks Transcription occurs Initiates transcription Initiates transcription Initiates transcription Initiates transcription

The Application of Gene Cloning and DNA Analysis

275

9.6 RECOMBINANT PROTEIN PRODUCTION IN PICHIA PASTORIS, SACCHAROMYCES CEREVISIAE AND KLUVEROMYCES LACTIS 9.6.1 Pichia Pastoris There are many organisms developed or exploited for the expression and production of eukaryotic proteins especially pichia pastoris have been exploited for their ability to hyper production. In pichia pastoris, there are commercial strains and

strains of pichia commercially available are GS115. Expression of protein of interest in pichia has its own advantages. One of them is that expressed protein levels have been observed to reach up to 30% of the total cell protein, and also it has a similar pattern of glycosylation with animal cells. Although slight differences pichia does not induce an antigenic reaction during its in-vivo studies. However, severe problems were encountered when protein and methanol inducible (AOX) alcohol oxidase promoter. If a protein of interest is toxic in nature, it can be controlled by presence and absence of methanol. One of the disadvantages with pichia system is the slight hyper glycosylation and degradation of recombinant proteins expressed. However, the causes for degradation of protein expressed in pichia system is considered one of the best because easier, as very less host proteins are observed in the broth. However, as it is developed and commercialised by private companies, their utilisation requires sharing of royalties.

9.6.2 Kluveromyces lactis The yeast which is considered for protein expression and production is Kluveromyces lactis, also known as edible yeast. The development of technologies for the protein production through this system is cheaper as these organisms can also grow on waste products from the food industry. Industrial isolates of the K. lactis strains has no auxotroph, they rapidly grow to very high cell density, and secretes heterologous proteins K. lactis suitable promoter LAC4 drives expression. This is also an integration plasmid, hence, the preliminary cloning experiments need to be completed in E. coli. K. Lactis system is unique in having a marker fungal acetamidase gene providing for selection of yeast containing an integrated expression cassette. The presence of this marker has an edge where in integration of multiple fragments in the system can be detected by increasing the concentration of acetamidase. Higher the resistance, larger will be the number of inserts hence more recombinant protein. The pathway of expression and secretion (MF) domain directs translocation into the endoplasmic reticulum where the signal sequence is cleaved and removed. Fusion protein is further transported into Golgi where the MF domain is cleaved with kex endoprotease, releasing mature form of the desired protein. This protein is subsequently, transported to the plasma membrane.

276

Recombinant DNA Technology and Genetic Engineering

9.6.3 Saccharomyces Cerevisiae Expression System Promoters

promoter. The foreign termination codons are not recognised by yeast system hence, these promoters contain yeast termination codons. In order to express and purify protein of interest from yeast system, the gene of interest is cloned and expressed under the control of GAL promoter, which is placed upstream of the gene coding for galactose epimerase, an enzyme involved in the galactose metabolism. There are many problems with the saccharomyces expression systems. Codon bias is one of the major problems observed. However, the yields of any recombinant protein

Saccharomyces cerevisiae considered for recombinant protein expression and production.

9.7 FILAMENTOUS FUNGI FOR PROTEIN EXPRESSION AND PRODUCTION There are two fungal organisms which have been extensively studied for protein production purposes; Aspergillus nidulans and Trichoderma resei. Based on the preliminary studies, these fungal organisms are best suitable as they secrete protein of interest in larger quantities and have good glycosylation pattern. A. nidulans contain glucoamylase promoter; which are induced by starch and repressed by xylose. T. resei makes use of cellobiohydrolase promoter, which makes use of cellulose as an inducer. However, the yeasts or fungal organisms may not be the right organisms for expression of human immunoglobulin. Hence, it is very essential to develop new plasmid and host systems. Animal cell line such as CHO is considered one

9.7.1 Mammalian Cell Culture for Protein Production etc., are mammalian proteins which have tremendous potentialities for commercialisation. However, the native cells produce very limited number of these proteins. Hence, it is very essential for hyper production of these, which can later be used for therapeutic purposes. Therefore, it is very essential for cloning, expression and gram level production of these proteins. As usual, the gene of interest is cloned and expressed under certain promoters in order to produce large quantities. The promoters may not be their native promoters; one can use any promoter such as virus origin, yeast origin, etc. Here, most of the mammalian promoter developed until now contained SV40 promoters, the protein produced under this promoter is considered to be similar in their activity, function, and structure. Hence, SV40 is considered as one of the reliable promoters for mammalian gene expression. However, the question arises that SV40 is a viral promoter; use of this promoter may lead to some other disadvantages.

The Application of Gene Cloning and DNA Analysis

277

for the production of important therapeutic proteins especially human recombinant antibodies or immunoglobulins. The main disadvantage with the mammalian cell culture is the repetitive culture contaminations, since our country is tropical in nature. Temperatures are always maintained as optimal for the rapid growth of contaminant bacteria or viruses. The mammalian culture growth and culturing is one of the cost-effective method, where the skilled labour is a basic requirement. For the growth of these mammalian cells such as CHO cell line or any other requires a solid surface, hence, growing in these conditions by maintaining at Here, small cellulose beads are introduced for the growth, but the cell densities are much less as compared to micro-organisms.

9.7.2 Gene Expression and Protein Production in Insect Cells considered for hyper production of native protein. They have a natural expression system and they can be easily used for hyper expression of recombinant proteins. There are viruses which require insects as hosts, but they do not infect vertebrates. They are known as baculoviruses. These viruses genome contain polyhedran gene. These viruses have typical lifecycle where the accumulation of polyhedran gene product occurs at the end of the infection cycle. 50% of cell protein is polyhedran gene product at this stage. Therefore, replacement of this gene product with our gene of interest can lead to similar levels of protein production. Many genes have been cloned and expressed under the baculovirus system, but it has been well established very recently, that glycosylation does not occur in baculovirus system. Hence, it is not suitable for the production of proteins

Transgenic animal is created by microinjection of a cloned gene into a fertilised egg cell. A very recent and advanced technology for production of a protein of interest is by using transgenic animal technology. development or production of transgenic animal is considered one of the most expensive processes with no gene to its offsprings based on Mendelian principles. Farm animals are considered for bulk protein expression and production. Here, the cloned gene has secretary signal in their promoter region, hence, the recombinant protein is secreted out, and therefore protein expected whereby, the recombinant protein is secreted in the milk. Therefore, consumption of milk is similar to consumption of the therapeutic protein. During the adult stage of life, the milk production can be continuous hence, the gene, which is cloned along with it, results in high yield of protein of interest. Since these farm animals are mammals, the protein secreted by these organisms will have the native structure. abilities as animal cell. Hence, they should also be considered for expression. Genetic manipulation of plants into the plasmid DNA and then integrated into the plant genome. Transformants were selected; plants are not work for maize, wheat and rice. The same methodology is used to make transgenic plants producing culture.

278

Recombinant DNA Technology and Genetic Engineering

Prokaryotic gene expression procedure 1. Streak on a LB ampicillin plate from the glycerol stock to get a single isolated colony and inoculate a single isolated colony in 5–10 ml LB ampicillin.

Requirements E.coli

2. Grow at 37 °C for overnight at 200 rpm.

3. Subculture into fresh LB ampicillin in 4% inoculum. Grow until the OD600 reaches to 0.4–0.6.

3 hr. 5. Harvest by centrifugation by just taking 3 ml of culture.

6. Loosen the pellet by vigorous vortexing without adding any liquid and (100 μl of 5X SDS) add sample buffer. Boil the samples for 50–10 min.

The Application of Gene Cloning and DNA Analysis

279

7. Centrifuge at 12000 rpm for 15–20 min.

the destaining procedure.

Results The thick bands observed in the gel are protein of our interest. As expected uninduced cells, lysate should have less amounts of protein and induced needs to have larger amounts. The protein runs parallel to 17 kDa; therefore, the protein observed is 16 kDa molecular weight (approx.)

Viva Voce

280

Recombinant DNA Technology and Genetic Engineering

9.8 GENE CLONING AND DNA ANALYSIS IN MEDICINE After India attained independence to become one of the biggest democratic countries, the real problems of health, nutrition and food came to the fore front. The mortality rates were also too high; infant mortality was 25%; childhood mortality was also up to 25%, various kinds of diseases killed people of all ages, irrespective of women, children, etc. The life expectancy during those days was more or less 65 years. Slowly and gradually, with improved sanitation and living conditions, vaccination and antibiotics, there has been an increase in life expectancy in the last 50 or more years. Today, in developed countries, infectious diseases and infections are very rare. However, chronic diseases such as diabetes, cancer, cardiovascular diseases, and Alzheimer’s disease are of much more concern. The only solution for all these diseases can come through genetic engineering or modern biology which play a crucial role in eradicating and curing of these diseases. It may be partly true in eradication of the diseases with single gene mutations, but it may not be true for complex diseases or chronic diseases mostly since a single gene is not involved here, or

may help in maintaining normal human functions and a high level of health. vulnerable to these diseases because of changes in lifestyle, etc. Various human disorders can be detected to the malfunction of a protein normally synthesised in the body. Most of these diseases are treated by supplying the patient with the right protein and right amounts at the right stages. Availability of larger amounts of this protein is at most important and can be contained through biotechnology tools such as cloning and expression in suitable hosts. Most of the time this shortcoming can be overcome by using donated blood, but the emergence of deadly diseases like AIDS and chronic infections have posed a major problem. The other option is the use of animal proteins for human disorders, but there are not many disorders that can be treated with animal proteins. There are always bright chances for side effects of using them such as allergic reactions and so on. In many medical procedures, the demand for proteins is rapidly increasing. These include therapeutic proteins, which are essentially produced through the gene cloning technologies, which result in producing large quantities of recombinant human proteins for therapy. This section deals with how molecular biology, and genetic engineering tools are being applied to the production of recombinant proteins for use as pharmaceuticals.

9.8.1 Pharmaceuticals, Biopharmaceutical and Biotechnology produced in bulk quantities. There are some pharmaceutical molecules, which are derived from biological are protein drugs, which may be native or recombinant. Recombinant proteins, vaccines and monoclonal and recombinant antibodies comes under this category. The revolution in biotechnology in India has led to the development of many recombinant protein drugs for therapeutic purposes, such as Insulin by Biocon maceuticals.

The Application of Gene Cloning and DNA Analysis

281

Thrombolytic proteins

Streptococcus aureus or Streptococcus equisimilus. The eukaryotic

therefore, was out of reach of most of the patients. The basic protocol followed for the production of large amounts of streptokinase is shown in Fig. 9.14.

Fig. 9.14

E. coli

Action and mechanism of streptokinase

soon as there is a formation of complex, the structural changes occur in the complex, leading to formation of active complex also known as virgin active complex

282

Recombinant DNA Technology and Genetic Engineering

is a bacterial protein, after injection into human bloods, it is recognised as a foreign protein, therefore, there will be a formation of antibodies against the protein. Hence, it is advised to use only once in human life. The mechanism can be described as shown in Fig. 9.15.

For the function they have to make a complex The molecules are in active, when they are separate just like the two blades of scissors. Streptokinase

Plasminogen

SK: Plasminogen complex

Plasminogen Streptokinase

Streptokinase

To form Plasmin

Streptokinase – Plasminogen complex

These plasmins circulate freely in the blood and lyses the blood proteins

Cuts other Pg molecules

The SK-Pg complex then acts on other plasminogens

Fig. 9.15 Action and mechanism of streptokinase

Streptokinase cloning and expression Streptokinase is synthesised and secreted by strains of Streptococcus. The gene corresponding to the protein

concatemerised by ligation in order to internalise the cloning sites NcoI and XhoI, which are present in the primers at the termini. Subsequently, the concatemerised long DNA strand was restriction digested with cloning sites as mentioned above. The resulting digested fragment is subsequently used for ligation reaction with the plasmid vector, which is also digested and dephosphorylated in similar fashion. The ligated product is transformed and screened for right clone and was further subjected to expression studies. In order to get for its biological activity.

The Application of Gene Cloning and DNA Analysis

283

Cloning, expression and production of insulin

amounts or negligible amounts of insulin leads to the onset of diabetes mellitus. There are two different kinds of diabetes; Type 1 and Type 2, the former is also known as autoimmune disease destroyed by macrophages on the system. The Type 2 diabetes is metabolic disorder wherein the insulin is

order to survive external insulin injected into the system. The advancement in modern day biology has played a tremendous role in saving thousands of lives, wherein the gene of interest insulin is cloned and expressed in E. coli or other expression vector in order to get active insulin for therapy. The insulin, which has been used in these treatments, is obtained from pancreas of pigs and cows slaughtered for meat production. Animal insulin is also prescribed for therapeutic purposes, but it has some side effects. The main problem observed is that difference between human and animal insulin brings different kinds of side effects in different human beings. animal insulin were considered as labourious, and potentially dangerous because of contaminants. Getting no reproducibility is observed. There are two most important concerns for easy cloning and expression of insulin in bacteria. First is therefore, the insulin synthesised and produced in E. coli should also be active. The other most important character is that it is a very short molecule which can be easily cloned and expressed in E. coli, problems like stability and expression should not arise. The insulin is bi-domain protein, having a domain of 21 (A The protein show no activity when the domains are disrupted. In humans, these domains are synthesised as a precursor, which is also a pro-insulin, which contain three domains A, B linked by C domain and preceded by a signal chain. After biological processing, the C-chain and the leader sequence is deleted out, leaving A does not occur in E. coli, formation strategies are essential in order to make biologically active protein and the best possible way of cloning, expression and obtaining biologically active protein is by using lower eukaryotic organisms such as yeast and pichia pastoris bond formation occurs without any trouble.

Synthesis, cloning and expression of insulin gene cloned insulin and its successful expression in E. coli. The conventional method followed by scientists during that time was the synthesis of gene by oligonucleotide based method. In the next step, these oligonucleotides coding for the insulin were ligated to one another in order to get the amino acid sequences of A and B chains, that would specify the correct polypeptides. The co-expression technology was the right choice followed by many at that time. Here, the two chains such as A and B were synthesised, cloned in two different expression plasmids. Subsequently, they were transformed into the same host for expression. The resulting protein is

nucleotide sequences as the original gene sequences for A and B chains. Still, they code for the insulin gene specifying the correct polypeptides. The two chains, i.e., A and B are synthesised and cloned in two different plasmid, which does not change the frame of the protein. The insulin genes were therefore, under the control of

284

Recombinant DNA Technology and Genetic Engineering

strong promoter such as T7 system and were expressed as fusion protein. The fusion consisting of six histidines either at the N-termini or at the C-terminal regions of the protein followed by either A or B polypeptides (Fig.

biological activity as it requires obtaining its native structure in order to show biological activity. The oxidative further subjected to refolding by oxidative refolding in the presence of osmolytic agents such as glycerol. The developments further created easy ways of synthesising, cloning and expression of proteins. In the new technologies, A and B chains are synthesised as a single oligonucleotide having feasible

and the resulting fragment is directly cloned into the expression plasmid for expression. As the gene of interest is under a strong promoter, the expression levels will be very high. There are some E. coli strain’s expression of this protein in those strains not only give hyper expression but also, results in biologically active protein. This technology does not require the in-vitro oxidation process because the protein obtained is already biologically active. The other method is cDNA synthesis mediated approach, which is considered labourious, cost effective and lacks reproducibility to obtain the gene of interest from the human cells. During the synthesis of this approach, most of the cases are incompletely synthesised genes. Therefore, many more cycles need to be followed for full-length gene synthesis.

Fig. 9.16 Cloning and co-expression of synthetic insulin gene in E. coli

The Application of Gene Cloning and DNA Analysis

(a) Insulin

30 Amino acid residues

285

B Chain Disulfide bond

21 Amino acid residues

A Chain

(b) Processing of insulin Leader B

C

A

Pre-prolnsulln

Refolding L

B

S

S

S

S

Processing/Cleavage B

A S

S S

S C

A

Fig. 9.17 A strategy of insulin molecule

9.9 EUKARYOTIC GENE SYNTHESIS AND EXPRESSION IN E. COLI The proteins somatostatin and somatotrophin are the two growth harmones or proteins they work in conjunction to control growth processes in human body. The loss of function of these two hormones result

E. coli. The same strategy of cloning and expression is followed as similar to insulin cloning and expression. The second growth hormone somatotrophin is a bigger molecule compared to somatostatin, with 191 amino

and subsequently the cDNA is prepared. Two clones are obtained, one is of shorter sequence and the other is n-terminally truncated 240–191 amino acid residues. This is the clone, which is further utilised for construction of full-length gene. The small oligonucleotide sequences are synthesised and used as linkers for making a fusion with the truncated version of somatotrophin to make 1–191 amino acid residues. The fusion with the promoter region and with the inframe Open Reading Frame (ORF). The synthesised gene is further digested with the right restriction enzyme sites and ligated with the suitable vector with similar digestions. The resulting construct is further transformed into E. coli is shown in Fig. 9.18.

286

Recombinant DNA Technology and Genetic Engineering

Fig. 9.18 Synthetic Somatotrophin gene cloning and Expression in E. Coli

9.10 SYNTHESIS, CLONING AND EXPRESSION OF OTHER RECOMBINANT PROTEINS WITH THERAPEUTIC IMPORTANCE The other therapeutically important proteins such as human thrombin, factor VIII, and many other blood related proteins of human origin were considered to be impossible during 1970s. As most of these proteins are eukaryotic proteins, therefore, the protein coding regions are interrupted by noncoding regions. Hence,

cultures. Most important human protein, human factor VIII, is a protein that plays an important role in blood clotting, malfunction or misfolding or a lack of this protein in the human system may lead to the development of blood without any termination. Until 1970, there were no novel technologies or therapies for the cure

removing virus particles such as AIDS and Hepatitis. Earlier, there were reports of infections like AIDS and hepatitis in patients, hence before injecting it is advised to check for the presence of viruses. The only best probable way for making a recombinant factor VIII free from all these is by biotechnology tools.

The Application of Gene Cloning and DNA Analysis

287

Eukaryotic proteins contain introns as well as exons in the genome. Hence, the isolation of gene of biology has been made very simple that any gene of interest can be easily synthesised having no intervening sequences. That results in easy cloning and expression of desired gene of interest in any possible plasmids and expressed in heterologous hosts. Similar thing has been observed in the factor VIII gene, which is very large, over 186 kbp in length, containing 26 exons and 25 introns. Before processing the mRNA which is the formation of a dimeric protein having larger subunit and a smaller subunit, both of them originated from the upstream and the downstream regions of the original polypeptide. Both the subunits before becoming a E. coli Now, there are many well-developed heterologous hosts for the production of eukaryotic proteins such as mammalian cells, Pichia pastoris and Kluveromyces lactis active recombinant factor VIII protein is from the mammalian system. Two different methods were recently followed for cloning and expression of factor VIII. cDNA of factor VIII has been cloned and further followed for expression in hamster cells. The yields were unexpectedly very low. The main reason may be the posttranslational events, although they are carried out similar to the human system, but failed to convert all of the N-terminal larger fragment and C-terminal shorter fragments which were independently placed in two different plasmids. Both were co-expressed and the results were encouraging where, large amounts of biologically active proteins were obtained. Both the fragments were expressed under SV40 signal; the plasmid was transfected into hamster cell line. The resulting protein was biologically active. expression and secretion. Here, the ORF has been attached to the constitutive hyperactive expression protein along with its promoter. This directs not only the synthesis of protein but also the secretion of protein into

9.11 GENE THERAPY Therapeutic proteins are named so because the protein plays an important role for therapy and eradication of diseases. Similarly, in gene therapy, ‘gene’ is the basic tool and exploited for therapy. It is one of the most far reaching and controversial areas of gene engineering of humans. This can be further explained as a treatment of disease by transfer of gene of interest into the patient cells in order to restore normal cellular functions. There are two different kinds of gene therapy germ cell gene therapy and somatic cell gene therapy. In germ cell gene therapy, the changes are directed at the genome of an individual, which can be stably transferred

inherited in nature and the single nucleotide changes in these genes have been observed which is the main causative agent. The gene therapy technology is the most effective in these cases, where the gene of interest is successfully transferred to the required one correcting the single gene defects. Existing technologies such as using recombinant protein for therapy may no longer be preferred as it has its own disadvantages. Hence, gene therapy may be one of the best suitable methods and may show long-term positive effects. Table 9.4 shows various human diseases which essentially require gene therapy.

288

Recombinant DNA Technology and Genetic Engineering

Table 9.4 Sr. No. 1. 2. 3. 4. 5.

Disease Duchene muscular dystrophy Hemophilia A Hemophilia B Thalassamia

Target region Liver Muscle/brain Liver Fibroblast Bone marrow

Frequency 1 : 500 1 : 300 1 : 6000 1 : 30000 1 : 600

their venture by initiating and completing human genome projects in order to understand the basic causes of these diseases. The main aim of these projects is to develop genetic maps, in order to locate the relative position know the exact sequence of bases in the DNA. Since it is a very high investment program, it is important that it is able to deliver useful information based on which the gene therapy may be developed. The gene therapy is one of the multidisciplinary programs wherein molecular biology, cell biology, virology, pharmacology, clinical biology and pharmacology as a network play an important role. In order to understand the importance of gene therapy, it is very essential to understand the effects of the gene by eukaryotes such as yeasts and in mice and rabbits. The subsequent results were utilised further to follow for human beings. Gene therapy is illustrated in Fig. 9.19.

Fig. 9.19 A mechanistic view of gene therapy transfer of the gene of interest into the tissue.

The Application of Gene Cloning and DNA Analysis

289

9.11.1 Gene Cloning and DNA Analysis in Agriculture Agriculture is one of the main industries for India, as well as for many developed nations. The agricultural emergence of biotechnology, the developed nations started utilising for agricultural productivity. Application of genetic engineering for pest resistant, high yielding varieties is one of the focuses in agricultural biotechnology. These technologies will be helpful to allow higher quality standards with lower costs of demonstrate annual increase in productivity. There are many countries in the world who are still not selfand lack the ability to take advantage of biotechnology. Such countries can become developed only when the developed countries extend a helping hand by training and transferring the technologies so that they can be easily available. Cultivation of plants is one of the oldest biotechnologies ever followed till date by many developed and developing countries. During this period, farmers were not only in the process of developing but also in the process of searching for new and improved varieties of crop plants: having varieties with better nutritional values, higher yield, etc. The development of different plant varieties began with plant breeding centuries back. However, these developed processes are labourious, costlier and not feasible for many farmers for their use. Later, development of plant varieties have began with tissue culture technologies, but this technology has its own disadvantages. Hence, it is not feasible for all plant varieties to be subjected for tissue culture. The recent gene technologies which came into existence, provide a new dimension to crop breeding by target oriented introduction of changes to obtain new varieties in a very short period. Two different strategies have been used for the development of new varieties; (i) Gene introduction, where cloning is usually followed for introduction of genes which ultimately gives new varieties and (ii) Subtraction of gene which is a process of inactivating a gene and subsequently the gene function by using gene technologies. Based on gene addition and deletion technologies, many projects have been carried out around the world. Many commercial companies such as Monsanto, Agro biotech, etc., have exploited these technologies in order to develop new crop varieties. The present section deals with the utilisation of deletion and addition technologies for crop improvement and development of new varieties.

9.11.2 Gene Cloning Approach to Plant Genetic Engineering Gene cloning technologies and their application in plants resulted in development of many new plant varieties. The introduction of new genes in plants has helped in developing disease resistant and high yielding varieties. One of the best examples can be the cloning, expression and utilisation of cloned genes, which are insecticidal for not only for prevention but also for better yield.

9.11.3 Making Insecticide Producing Plant Varieties Like human beings, plants are also susceptible to certain kinds of bacteria, viruses, fungi and animals. One of the most effective and destructive item for plant and its varieties are insects, further leading to decrease in and different varieties). There are many insects, which can be demarcated as harmful for plants, and useful for insects. The use of insecticides kills not only harmful insects, but also useful insects. It is a very dangerous situation and a loss for the environment. Synthetic insecticides are toxic for the environment as well as for

290

Recombinant DNA Technology and Genetic Engineering

human beings. In addition, by spraying insecticides, the environment is also damaged and due to increase in pollution, some insecticides are also not biodegradable. Therefore, these unbiodegradable agents are and poisonous lands, which are not useful for further farming. Hence, it is important for environmentalists, to develop environmental friendly insecticides.

After the disastrous environmental destructions in many parts of the world by extensive use of insecticide, it has been a major concern to overcome these problems by developing target-oriented insecticides. These insecticide should also be a biodegradable. It should not be toxic for the environment or for humans and animals. The developed insecticide should be able to percolate to all parts of the plant, and not restrict only to the surface of the plant. The development of such kind of synthetic insecticide is impossible. Now the question arises, is there any biological molecule which can have such kind of features. There are some Bacillus thurungenesis.

Bacillus thurungeinesis for plant protection There is an association among bacteria and plants. Therefore, when insects eat plants, they also consume bacteria which is associated with the plant system and that forms a part of diet for insects. Here, not the plant but the bacterium developes a kind of defense mechanism against the insects. For example, Bacillus thurungienesis is a bacterium with different stages of life cycle. The most common stage is the sporulation,

toxic than synthetic organophosphate insecticide. There are different varieties of toxins produced by different 1 to 3 are insecticidal on Lepidoptera and Diptera insects, the

Mechanism of action of Bacillus toxin The toxin crystals synthesised by bacillus are inactive precursors which can be called precursor proteins. out, the proteases present in the vicinity cleaves the endotoxin forming small peptides. Subsequently, these

in their action hence, there will be different kinds of peptides formed after their action on the endotoxin. These

Recent developments in Bacillus thurungenesis genes The use of Bacillus thurungenesis endotoxin is considered labourious and expensive. They are also biodegradable, therefore, they can be sprayed frequently. Hence, it becomes a cost-effective process. Due to their cost, they have been neglected for their use in agriculture. The recent development of molecular biology tools, have opened new doors for utilisation of these endotoxins, wherein the researchers use protein engineering tools to produce large amounts of toxin in-vitro and also for making stable toxins for use in produce Bacillus thurungenesis toxins.

The Application of Gene Cloning and DNA Analysis

291

Many multinational companies have exploited simple molecular biology tools to make new plant varieties, Ciba-Geigy Laboratories of American origin. The researchers understood the life cycle of the corn borer, which is one of the deadliest farm infections in Europe and North America. Ostrinia Nubilialis, an European corn borer, and a major pest which builds tunnels into the plant from the under surface of the leaves. This is the escape mechanism played by the borer in order to escape from the lethal effects of insecticides. In order to eradicate corn borer, and its defensive mechanisms and its spread the researchers utilised CRY 1 protein. This protein has 1155 amino acid residues. By structure function, relationship studies by these researchers, it was concluded that only the N-terminal region 29–607 amino acid region play an important role as a toxin. The gene structure studies and their analysis has further led to the understanding that it is Adenine and Thymine (AT) rich, but not Guanine and Cytocine and (G:C), therefore, a new truncated gene has been constructed corresponding to 29–607 amino acids resulting in optimal GC content. Since Adenine and Thymine rich acid residues has been named as CRY1A. The gene is further synthesised and subsequently cloned in plant expression vector under (CaMv). The resulting molecule is introduced into maize embryos by following DNA bombardment of DNA coated micro-projectiles. The resulting embryos are further grown into mature plants. The resulting transformants are screened and the presence of the gene

Fig. 9.20

292

Recombinant DNA Technology and Genetic Engineering

The plant expression vectors are integrative plasmids; hence, the site of integration determines the

infections. It is understood that the cloned synthetic gene is active but the production of this protein differs more than one copy of the endotoxin gene. However, researchers have further subjected the plants having the length of bore made in transgenic and wild type plants showed a huge difference. The technology worked well and presently the same approach is being followed for generation of cotton plants and the resulting technology known as Bt cotton is already in the market (Fig. 9.21).

Fig. 9.21 Contruction of genetically engineered plants coding for endotoxins, glucanases, carbomyl transferases, and nitrilases, etc. Many projects are proposed to make pest and insect resistant crops. Genetic engineering also has been utilised for metabolic pathway engineering where the banana ripening has been postponed, as required. Not only maize but also many plants such as tomato, potato, cotton and rice have been genetically engineered.

9.12 GENE SUBTRACTION / ANTISENSE TECHNOLOGY As we understand, the term ‘subtraction’ means removal, but here it is a misnomer, therefore, the gene subtraction means ‘inactivation’. Various technologies have been developed for inactivation of genes. One antisense technology. Here, single gene of interest or many genes can be inactivated through this technology. This is the technology extensively used for the development

The Application of Gene Cloning and DNA Analysis

293

9.12.1 The Basic Theme of Antisense Technology Antisense RNA technology emerged in the 1980s. It is based on short DNA oligonucleotides that are designed to pair with a piece of mRNA to block the translation. The antisense molecules or oligonucleotides are usually translation by the ribosome to a functional protein.

Fig. 9.22 Antisense RNA technology In order to develop disease resistant varieties and drugs for human beings for different deadly diseases, the contemporary biotechnologists are trying out a new type of technologies known as antisense RNA technologies. They work within the cell to interrupt the protein biosynthetic pathways. These technologies can also be used for agriculture for development of resistance varieties, inactivating the gene of interest and increasing the crop yield.

Mechanism of antisense technology In this technology, it is very essential to understand the basic protein synthesis pathway, where the DNA present in the nucleus, forms mRNA by transcription. Subsequently, protein is produced after translation. In antisense a synthetic mRNA is made that has complementary base. Antisense RNA sequence is complementary to the sense RNA sequences. Biotechnology has revolutionised the crop system, wherein many technologies have been used for preserving, delaying of the ripening, and delaying of decay of fruits. Tomato is one of the ineventiable children, men, and women. Still, there are some fruits which need much more emphasis for their development in delaying the ripening of the fruit. Tomatoes are grown and picked from the farm before they fully ripe. This process is followed in order to allow them to be transported to the market before they are spoiled. However, in this type of harvesting not all fruits will ripen before they reach the market place. Those fruits which are These tomatoes infact are not encouraged by the consumer as they are not tasty. American researchers have developed a RNA antisense technology, where they can postpone the decay of the plant by leaving the fruits on the plant for a longer time. Once a tomato starts ripening, the expression of

294

Recombinant DNA Technology and Genetic Engineering

is a protein, which acts on the cell walls of ripened tomato, further leading to decay. This enzyme has no value for farmers, hence, it is inactivated. The inactivation prevents the formation and accumulation of polygalactouranase, hence, there is a prevention of ripening and decay. In the antisense technology, the antisense RNA binds to the sense RNA therefore, no translation occurs and hence no protein production (Fig. 9.23).

Fig. 9.23 Antisens RNA technology for prevention of fruit decay

9.12.2 Antisense RNA Technology for Prevention of Tomato Ripening or Decay In the case of tomato as shown in Fig. 9.24, the presence of DNA in the nucleus can be seen and mRNA in the cytoplasm. As soon as RNA is synthesised, it gets into the cytosol and here, the antisence RNA introduced by the researchers is also present in the cytosol. The bases of both the RNAs are complementary to each other; hence, they form a pair by making a bond among them. This process eliminates further processing of RNA to form protein by translation. The effects can be seen instantly.

The Application of Gene Cloning and DNA Analysis

295

Fig. 9.24 Mechanism of inhibition of gene expression by antisense technology In this case, the enzyme, which is responsible for fruit decay, is no longer produced. The rotting is postponed, hence, the fruit can be left on the plant itself for some more time.

Experimental approaches to antisense RNA technology started during the year 1980. First step began with the procurement of partial N-terminal sequence of polygalactouranase, either by restriction enzyme digestion or by synthesising the desired DNA fragment. The the polyadenylation signal was introduced for transcription termination. Resulting construct was introduced into the Ti plasmid vector pBIN19. As soon as the gene gets integrated into the plant system, transcription

reduce or prevent translation of the target mRNA by hybridising and inhibiting further process. There are two different steps involved before transfecting the plant with the construct. They are (i) Transformation of the construct into the Agro bacterium tumefaciens and (ii) Infection of the recombinant Agrobacterium tumefaciens into the tomato plant. The Agrobacterium tumefaciens functions as gene recombinant bacteria, they are allowed to infect tomato stem segments. As this plasmid contains an antibiotic resistant marker, hence, the resulting callus can grow on the media containing kanamycin, which indicates the further to obtain large number of callus or cells leading to the development of a mature plant. Screening for the presence of cloned gene can be tested in the following manner: 1. Southern hybridisation is normally followed in order to check the presence of cloned antisense gene. 2. Northern hybridisation is followed in order to validate the presence of antisense RNA with singlestranded DNA probe. polygalactouranase mRNA in the cells of ripening tomato.

296

Recombinant DNA Technology and Genetic Engineering

4. Biochemical assays could be followed in order to quantify amounts of polygalctouranase presence in wild type and the plant subjected for antisense technologies.

plant varieties treated and untreated with the antisense technologies. Ethics play an important role for application of antisense technologies in the development of varieties

a voice against this activity, the real question is do we really need GE/GM brinjal? or GE/GM cotton? These questions are yet to be answered.

9.12.3 Useful and Harmful Effects of Using Genetically Engineered Plants or Crops successful expression, integration into the plant genome. These plasmids are foreign genetic material, which others. Most of the plant plasmids contain nptII, neomycin phosphotransferase a bacterial gene. As soon as plasmid gets integrated into the plant, transcription and translation occurs, and every cell has the protein of nptII. This may be harmful for human beings in the long-term perspective. The consumption of fruits, vegetables or leaves from these genetically engineered crops, may also introduce the antibiotic markers as mentioned above into the system. This will again bring harmful effects by chances of transferring these into the domestic bacteria. Subsequently, these will become antibiotic resistance. There will be a chain of events, may prove to be very dangerous. However, based on the requirement of the population, it is also very essential to develop and use these technologies not only in crop improvement but also in different areas of medical sciences, veterinary sciences and so on. Similar kinds of hazards can also be expected with reference to Cre genes and their products. There are also possibilities that the introduced antibiotic resistance markers, Cre genes, etc., can also enter the environment, which may be harmful to both plants and humans.

REVIEW QUESTIONS 1. Name different cloning and expression vectors of E. coli ? 2. Differentiate between cloning vector and expression vector. 4. Explain in brief the structure of a regulatory regions of a promoter? 5. Differentiate between prokaryotic and eukaryotic promoter regions. 6. Describe the regions of a prokaryotic expression vector ?

a. Regulatory promoter, inducible promoter b. Inducer and repressor c. Operator d. Regulator e. Inducer

The Application of Gene Cloning and DNA Analysis

297

a. Rare codon and Gene expression b. Varshavasky’s hyprothesis and Degron c. Types of cleavage of fusion tag d. Common problems observed in protein production in E. coli

a. Filamentous fungi for protein expression and production 14. Explain in brief protein production in mammalian cells, yeast and insect cells. a. Type of cells used c. Advantages and disadvantages 15. Explain some of the medicinally important proteins which need to be produced through recombinant DNA technology. 16. Explain the different technologies followed in obtaining insulin protein for therapeutic purposes.

c. How do they differ from normal gene?

REFERENCES et al. (1994) Antisense Expression of Poylphenol Oxidase Genes Inhibits Enzymatic Browing in Potato Tubers. Biotechnology, 12. 1101–5. Bacillus Thuringiensis: Insect and Beyond. genetic engineering]. et al. (1987) Insect Tolerant Transgenic Tomato Plants. Biotechnology Flavell, R B, Dart, E, Fuchs, RL and Fraley, RT (1992) Selectable Marker Genes : Safe for Plants. Biotechnology, 10, 141–4 [Describes the possible hazards posed by kanR & other marker genes in engineered plants]. et al. (1988) Antisense RNA Inhibition of Polygalacturonase Gene Expression in Transgenic Tomatos. Nature, 334, 724–6. et al. (1993) Transgenic Potato Plants Expressing Mammalian 2’–5’ oligoadenylate Synthetase Protected from Potato Virus X Infection Under Field Conditions. Biotechnology, 11, 1048–52 [Engineering virus resistance by gene addition]. ransformation Systems for Generating Marker-Free Transgenic Plants. Biotechnology, 12, 263–7. [Includes a description of the Cre excision system].

298

Recombinant DNA Technology and Genetic Engineering

Fisher, R and Emans, N (2000) Molecular Farming of Pharmaceutical Proteins. Transgenic research, 9, 279–99. A review of a recombinant protein production in plants. Application of Yeasts in Gene Expression Studies: A Comparison of Saccharomyces Cerevaciae, Hansenula Polymorpha, and Kluveromyces Lactis–A Review. Gene, 190, 87–97. Recombinant Baculovirus as Expression Vectors for Insect and Mammalian Cells. Current Opinion in Biotechnology, 10, 428–33. Transgenic Animal Bioreactors–Where We Are. Transgenic Research, 9, 301–4. Primrose, S B (1990). Principles of Gene Manipulations–An Introduction to Genetic Engineering. Opportunities and Problems in Plant Biotechnology the royal society of Edinburgh, 99B. Rexroad, C E (1995). Transgenic Livestock in Agriculture and Medicine. Chemistry and Industry, 372–5. Straughan R (1989). The Genetic Manipulation of Plants, Animals and Microbes–The Social and Ethical Issues for Consumers: A Discussion Paper. National Consumer Council, London.

GLOSSARY A form DNA: The form of DNA in high humidifying conditions. This form contains more base pair per turn than B-DNA. A protein: (A+T)/ (G+C) ratio: A formula for base composition of DNA. The base content of DNA differs from organism to organism. It has been observed that those DNA isolated from organisms which are from hot springs have high GC content and so on. Abiotic: Pertaining to nonliving. Acid phosphotase: An enzyme that is usually found in prostate and semen. adenosine deaminase. It is a rapid and lethal disease; the diseased human can die within a short period of time. Adeno virus: Acid–fast: Unique property of mycobacterium and nocardiform. Upon their treatment with mineral acids, Aerobic: Aerosol: procedure through which common contaminations occur in microbiology labs. Aerotolerant: in nature. AFLP: detecting DNA polymorphism. The process begins with restriction enzyme digestion of DNA, subsequently Agar: Agglutination: A state of clumping together or joining by adhesion. Alkaline phosphatase: blood stream indicates for liver and bone diseases. AIDS: an immuno compromised condition arising Allele: Before the term ‘gene’ was introduced, ‘allele’ was considered as gene. Different forms of gene that

300

Recombinant DNA Technology and Genetic Engineering

Alternative splicing: which can code for many protein products subsequently. The name for the family came because of the presence of Alu I restriction endonuclease abundantly. A family of repetitive DNA sequences, which are present about three hundred thousand copies Alzheimer’s disease: A neurological disorder which results in the loss of memory rapidly. Amber codon: A stop or nonsense codon UAG, presence of which stops translation. Amphitrichous: Amino acids: Anaerobes: Annealing (of DNA): Binding of complementary single-stranded DNA to the other strand to form a double strand. It is a common phenomenon observed in PCR steps for annealing of primer to the denatured template DNA. Antibiotic: microbial infections in humans as well as in animals. Antigen: A foreign protein upon its introduction into the human body elicits immune response. It is mostly a protein. Antiseptic: A chemical substance that is applied to the body surface to prevent infections. The substance Antimicrobial agent: Any chemical or biological agent showing growth inhibitory activity of certain microbes. Antiparellel: A terminology which describes the opposite orientations of a double-stranded DNA. Here 5’ end of a one strand aligns with 3’ end of the other strand. Antisense RNA: Antisense strand: It is mRNA as well as for coding strand. Antiserum: ARS: A small segment of DNA that is essentially required for initiation of replication. A type of reproduction that undergoes without fusion of gamets. Attenuated viruses: Viruses that have lost their ability to cause disease but retain the ability to infect. It is the most frequent method used for developing live vaccines. Attenuation: Autoimmune disease: A technique followed to locate a radioactive labelled DNA/ RNA/Protein by its capacity Autotroph: A self-feeding organism which basically survives on inorganic matter. A mutant which essentially requires growth supplements for their growth but the wild type does not need them for the growth.

Glossary

301

B-cell: Lymphocytes upon their maturation, transform into plasma cells subsequently producing antibodies. B-form: double-helical DNA. BAC: Bacillus: Rod shaped, aerobic and spore forming gram positive bacterium. Bactericidal: Bacteriocin: A protein molecule usually synthesised and secreted by lactobacillus spp, and shows antagonistic activity on very closely related bacteria. Bacteriophage: Bacteriostatic: An agent that can prevent bacterial growth. Bacterium: Bacteroid: It is the survival and growth stage of rhizobium in the roots. The structure is irregular and highly degenerate. Base: Base pair: Beta galactosidase: An enzyme that cleaves lactose into glucose and galactose in the lac operon of E. coli. Bioluminescence: Production of light by living organisms/microbes. Biolistics: A overlayed with DNA, then they are bombarded to the cell surface leading to penetration and depositing in the cell. Biomass: Bioreactor (fermenter): It is a closed method of high density growing of bacteria. Biosensor: A devise in which biological molecules are basic and most important components. They are used Bovine somatotropin: A growth hormone produced by recombinant DNA technology and used for increasing

BLAST: A computer program used to identify related and identical DNA sequences. Blotting: A method that is used for transferring DNA or proteins onto a membrane. Blunt-end ligation: The attachment of two blunt end fragments to obtain a chimera. A measure of density of DNA by ultracentrifugation. Budding: Capsid: A very common protein protective coat observed in viruses. Carcinogen: A substance that can induce cancer. Carcinoma: An uncontrollable growth of epithelial cells. Casein: Cationic: A positively and electrostatically charged molecule or substance. CD: A Cluster of Design.

302

Recombinant DNA Technology and Genetic Engineering

CD4: till date. cDNA: Complementary DNA strand. It is made from RNA template by reverse transcriptase enzyme. A pool of complementary DNA clones produced by cDNA cloning of total mRNA from a A single layer of cells that forms on the glass or plastic surfaces. Cell passage: Cell line: J774, RAW, etc. Cellulose: A major polysaccharide components of plant cell wall. Cell wall: A tough and rigid cell membrane that gives structure and protects the cell. Centriole: Chaperone: native form of a protein. Chelator: A chemical substance that can bind to particular ions, which participate in the reactions, for 2+ a divalent cations. Chemotroph: An organism that uses chemical compound for its energy supply. Chimera: In molecular biology, it is a fusion of two different genes or DNA fragments in tandem. In Chitin: A cell wall material of fungi, insects and arthopods, having N-acetylglucosamine as a major component. Chloroplast: plastids. Cholera: Water-borne life threatening infectious diarrhea caused by . Chromosomes: cell is constant. Not all the genetic material is carried over by chromosomes. The other organs such as mitochondria and chloroplasts contain their own DNA. Cidal: Cilium: Clone: A pool of genetically identical organisms that originated from single and common ancestor. Cloning vehicle/vector: A small plasmid DNA which can accept foreign DNA fragments which can later be used to transform into bacteria. Coat protein: A major protein coat that covers or encloses the entire nucleic acid core of a virus. Coccus: A round shaped bacterium. Coding strand: The DNA strand containing the same sequence as the transcribed mRNA. Codon: A cluster of DNA or RNA that codes for amino acid. Three nucleotides code for single or more amino acids. Codon preference: this codon is preferred in microbes, which may not be preferred by other organisms. Co-immunoprecipitation: A biochemical method of studying protein interaction, wherein two related

Glossary

303

Col plasmid: reduce the competition. Co-integrate: A fusion product of two circular molecules.

plate. wall. A matching sequences which can form double-stranded structure. ATGC complementary sequence is TACG. Concatemer: Conditional lethal mutation: A mutation that is lethal under one condition but not in another condition. Conjugation: in bacteria or the process of transfer of genetic material from one cell to another. Conjugation tube: of genetic material to the acceptor E. coli.

E. coli which helps in attachment and transfer

A common DNA or amino acid sequences among the homologous regions of related DNA or protein or RNA. A similar or identical or invariant protein or DNA sequence. These sequences are used

Cosmid: A hybrid plasmid which contains cos sites at both the terminis. cos sites are essential in order to

Cot value: Cot refers to concentration of denatured DNA and time. Therefore, it is concentration and time DNA sample. Cregenes. cAMP: Contact inhibition: A process whereby the division of the cell inhibited by surrounded similar cells. Very common phenomenon observed in scar formation and cell monolayers in tissue culture. Continuous cell line: Continuous cultures: chemostat and turbidostat.

usually observed with chest infections. A protein containing haem acts as an electron carrier. A morphological change observed after viral infection. Protoplasm that is observed /present in the cell.

304

Recombinant DNA Technology and Genetic Engineering

Dalton: Daughter cells: Resulting cells of reproductive division during mitosis or meiosis. dNTP:

NTP

used for chain elongation process in PCR. DNA polymerase can not differentiate between dNTP and not inhibit chain elongation because it has 3 OH which is essential for elongation or synthesis of the strand. ddNTP: by hydrogens so they cannot be used for elongation purposes. Instead, they act as chain terminators so

sequencing reactions, they are much bigger substrate molecules, therefore, in order to incorporate in the DNA polymerase. The ratio of incorporation of these nucleotides is very important as higher the concentration, longer will be the strand synthesised, and lesser will be the concentration of very short fragments which are synthesised and terminated. Death phase: A bacterial growth phase which is usually observed in batch culture. During this phase number of viable cells decreases. Defective virus: A virus particle having no capacity to infect on its own. Deionised water: Deletion: Removal or loss of a DNA fragment or a single nucleotide based on the requirement. Degenerate code: A genetic code where several code words having a similar meaning. A genetic code is degenerate which means that a single amino acid is coded by different codons. DGGE: separation of DNA fragments based on their differential mobilities on increasingly denatured conditions. Denaturation:

Dendrogram: usually observed in bioinformatics. Denhardt’s solution: A solution used in hybridisations. A method of separating macromolecules based on sedimentation and differential buoyant density. Diploid nucleus: It is a form of nucleus containing pair of chromosomes. D-loop: mitochondreal chromosomes where ori sites differ in both the strands. DNA: phosphodiester bonds to adjacent nucleotides. As they are double-stranded molecules, the strands are DNA integration: A natural process by which a DNA fragment associates with the genome of a host cell. Homologus recombination is the most common way of integrating DNA. DNAse: or DNAse is

Glossary

305

It is the basic component of nucleic acids. The major components are phosphate, sugar A chain termination method of DNA sequencing. OH group necessary for continued synthesis of 5 to 3 DNA

dNTP: Doubling time: It is the time required for microbial population to double the number. Downstream: fermentation. Directed mutagenesis: introduced into the organism. Directional cloning: A cloning method in which the vector and insert plasmid DNAs are digested with two

Di-uretics: DNA probes: A single-stranded DNA labelled with radioactive material or biotin and used as very sensitive biological detector. DNA clone: are replicated to increase their number. DNA cloning: A methodology followed in introduction of DNA fragment into a population of DNA vector they are separately grown and then screened for desired recombinants for the presence of the DNA of interest. It is the technique used/followed to identify identical DNA sequences or also

relatedness, complementarity, repetition and so on. A specialised technology used for crime detection and solving paternity problems. The method begins with restriction digestion of genomic DNA followed by autoradiography of DNA banding

A topoisomerase enzyme which relieves super coiling of double-stranded DNA by transient DNA ligase: formation of diester bonds between 3

PO ends.

DNA marker: determination of molecular weight.

A chromosomal locus with different sequences DNA replication:

306

Recombinant DNA Technology and Genetic Engineering

A method used for quantifying DNA and RNA relatedness. Here the DNA and RNA molecules are heated to their denaturation. The resulting single strands get annealed based on their complementarity as soon as they are cooled. A specialised technology used for determining sequence of a DNA fragment. There are

Dot Blotting: resis are not followed. Autoradiography reveals the presence/absence of related DNA sequences.

-

3 end or downstream: A termini from where transcription begins. 5 end or upstream: A termini from where polymerase has come during the synthesis. Usually, DNA sequences, gene maps and RNA sequences are drawn from either transcription or translation start from left to right. Therefore, downstream is always towards the right. Durham tube: fermentation of carbohydrates. An early transcript produced immediately after viral infection. This RNA codes for proteins which are necessary for viral replication within the infected host cell. ED50: Electroporation: A method of transitory opening of membrane pores by electric pulse. ELISA:

An embryonic cell that can replicate continuously resulting in transformation into many different types of cells. It further functions as a source of new cells. Endogenous: To grow within a structure. Endonuclease: a polynucleotide chain. Endospore: Endothelial cells: Layer of cells that coat internal surfaces of organs. E. coli for therapy. Enrichment media: selective isolation of particular microbe. -

Envelop: teins. A protein molecule that can control biological reactions. Episome: Epithelial cells:

Ethidium bromide: A chemical substance which has the capacity to intercalate DNA helices. It is a Euchromatin: Unstainable regions of chromosome. These regions usually contain gene coding regions.

Glossary

307

by a nuclear membrane. Cytosol containing many organelles. A natural process of replacing damaged/faulty DNA with new DNA molecules by using undamaged DNA strand as a template. Growing outside a structure/arising from outside source. An enzyme that cleaves phosphodiester bonds either from 3 end or from 5 end of DNA. can be mapped by genetic mapping procedures through which one can identify a gene locus. carrying inserts from a single species.

F factor: F’ (prime) factor: It is also incorporated. F+ factor: A male E. coli cell having a free fertility factor. F- cell: A female E. coli cell having no fertility factor. +

and Hfr bacterium. This pili forms a contact/ bridge between two bacteria, further helping in transfer of genetic material from donor to acceptor. F protein: also be made with these proteins. Factor VIII: is a heriditary disease. Facultative anaerobe: False negative: Result showing no evidence of disease. False positive: Result showing evidence of disease. Fermentation: A metabolic process where organic compounds are used to release energy without the use process. Fibrin: Fibrinogen: F1 generation: F2 generation:

.

Fimbria: Fingerprint: A banding pattern produced by electrophoretic separation of polypeptides after denaturation of

308

Recombinant DNA Technology and Genetic Engineering

FISH: for detection.

in-

hybridisation.

Common yeast that divides by splitting into two progenitors. Fibroblast: Flagellin: Flanking region: equipment used for analysis of biological samples by detection of light absorbing ability when they

fractionation is done through cell sorters, followed by further analysis into different diffractions. Fluorescence: Fluorescein: Fluorochrome: A chemical substance that absorbs short wavelength light and emits longer wavelength. It is used for conversion of UV light into visible light. Footprinting:

Frameshift: It is a mutation wherein addition or deletion of a single nucleotide or two in a gene results in change in the DNA sequence frame, resulting in different unrelated protein sequence. Frameshift mutation: An addition or deletion of a single or two nucleotide bases into the gene sequence, causing a disruption of the gene sequences. Fungicide: Fusion gene: A hybrid gene formed by fusion of two different regions of gene resulting in the formation of hybrid protein. G-banding: type of chromosome. GABA: Gamma Amino Butyric Acid or GABA is a major inhibitory neurotransmitter of the nervous system. GC rich: DNA sequences carrying long stretch of G and C nucleotide bases indicates for GC rich. Gelatin: Generalised transduction: A random method of transfer of bacterial genome from a donor to recipient. Gene: Gene mapping: A method to determine the location of genes on a DNA and the distance between them.

treated in the same fashion. Gene transfer: A process of introducing genetic material into other organism to obtain desired characteristics.

Glossary

Genetic Engineering (GE): Tools/technologies used to isolate genes, manipulate them

309

and introduce

protein production. Tools and techniques used for engineering an organism in order to Genus: Closely related organisms. Genome/genomic DNA: Genetic material of an organism. Cloned DNA fragments of a genome of an organism. Genetic components of an organism. Germicidal agent: Giemsa stain: Glucan: A polymer of glucose. attached. Gp41: A glycoprotein of HIV that helps in fusion of virion with the plasma membrane. Gp120: A glycoprotein of HIV that helps in the attachment to the CD4 receptor of lymphocytes. This plays an important role in cell to cell infection of HIV. Gradient: Gram-negative: Gram-positive: microscope. Green revolution: A dramatic increase in crop productivity during twentieth century, which occurred due to the advances in agriculture, petrochemicals and machinery. Growth curve: A characteristic period in the growth of a bacterium which is further indicated by sigmoid curve in the graph between time period and absorbance. H-Y antigen: Haemoglobin: Haem-agglutination:

E. coli strains have the capability to lyse. Haemophilia: clotting factors due to which bleeding can not be stopped. Haemorrhage: A process in which blood escapes from the vessels. Hairpin: DNA sequences in the single-stranded DNA because of presence of complementary sequences HAT medium:

310

Recombinant DNA Technology and Genetic Engineering

Halophile: A microbe which can grow in high salt conditions. Haploid: An organism having a single set of chromosome. Heat shock protein:

Helicase: A DNA unwinding protein. forms two helices which is separated by a loop. The loop independently functions as DNA binding domain. A motif or a sequence found in DNA binding proteins. This motif contains two helices recognition and stabilisation which are separated by a loop. Hepatitis B-surface antigen: antigen appears much faster than the symptoms. Herbicide: Characters which are passed on generations genetically. Heterochromatin: Genetically inert densely stained chromosomal regions and they are tightly coiled structures. A double-stranded DNA having two different DNA strands originated from two different sources. Hfr strain:

the chromosomal genes that they carry. Histone: Homolog: Homologous recombination: the interference of RecA, B, C, and D genes.

E. coli with

Human growth hormone: A human protein produced in the pituitary glands. HGH stimulates the growth of bone and muscle. related and identical DNA sequences. A fusion product of spleen and myeloma cells. They are basic substances for monoclonal antibody production. bond. It means “water fearing” nonpolar molecules which can not dissolve in water. The most

A particle containing more dissolved particles than cellular contents.

Glossary 311

A part of variable region which is found in immunoglobulin that differentiates one to the other immunoglobulin molecule. Icosahedral: vertices. The ability of an organism to resist infection. It is of intrinsic nature which comes from parents.

Immunisation: A process in which an individuals immune system gets rejuvenated. There are two different foreign molecule into a body. Passive is followed by introduction of pre-synthesised elements into the body. Immunisations are done by vaccination such as polio vaccine, BCG infection. Immunogen: in foreign host. Antibody formation occurs in humoral immune responces. Immunoglobulin: They are blood globular/glyco proteins which constitute antibodies. Large molecular weight tetrameric proteins, containing two identical heavy and two identical light chains. Immunosorbence: Clumps of inactive and denatured protein bodies found in E. coli large amounts of protein leads to form inclusion body. Inducer: A chemical substance whose presence can initiate transcription from operon. Induction: Inoculum: growth in order to obtain multiple and large amounts. In-situ: In place. In-situ A method used/followed to detect complementary DNA sequences in cloned bacterial or mammalian cells by hybridisation by using DNA or RNA probes.

Insertional mutation: mutations in the DNA. These mutations may be lethal, deletion, or change in the frame. Intercalating agent: It is Intergenic regions: DNA sequences which are present in between the genes, which do not code for any Intron: to form a coding sequences. Isoschizomer: cleaves accordingly, similar to other enzyme. In-vitro: A procedure followed outside the living body, in a test tube or in a controlled environment.

312

Recombinant DNA Technology and Genetic Engineering

In-vivo: Isotonic solution: Joining segment: It is most commonly observed in immunoglobulin sequences. These are short DNA Junk DNA: molecules. K antigen: Kbp: Knock down: technology. Knock out: Lambda phage: Lac operon: in E. coli

Lag phage: A microbial initial growth phase where no growth occurs, but this is the period in which microbes adjust to their new environment. The lag phase ends as soon as growth phase begins. Lagging strand: In DNA replication, short fragments are synthesised from 3 to 5 they are ligated 5 to 3 synthesised strand. Lampbrush chromosomes: Latent period: A initial growth phase of bacteriophage life cycle. Latent period is the time required from the Lateral inhibition: It is The upstream untranslated sequences at 5 end to the start codon. They can also be considered as promoter regions. Leading strand: The DNA strand which is synthesised continuously during DNA replication from 5 to 3 direction. Lethal gene: Leucine zipper: A DNA binding protein in which leucine residues stabilises their structures by formation of A white blood cell. Ligand: Ligase: An enzyme that can join disrupted phosphodiester bonds in DNA molecule. Lineage: Linker: in turn facilitates easy cloning of the fragment.

Glossary

313

of gram-negative bacterium Logarithmic growth: A white blood cell which is formed with in the lymphoid tissue. A bacteriophage cell cycle, where cell ruptures and new viruses are released. release of new progeny.

A life cycle stage of bacteriophage in which bacterial cell lysis results in the release of new virus particles. charge.

physiologically but not physically. Melting point: nature. A way of modifying DNA by addition of a methyl group. Gene products or proteins which appear on the surface of the

MHC

A micro/nano/miniature chemical reaction surface area on which DNA, RNA or protein can be tested. Microinjection: pipette. Microaerophile: growth. Minimal medium: A basic microbial growth media that contains minimal necessity for growth of wild type bacteria. They contain inorganic salts, carbon source and water. A single type of antibody that is produced through cell fusion technology by fusion of antibody producing cell and a type of cancer cell. Monomer: A single unit upon polymerisation forms nonamers. : A major cell wall component of

. It has a high molecular weight

N-end rule: Hypothesis made based on the presence of n-terminal amino acid at downstream of start codon. a noble laureate. A monomeric unit of chitin and sugar found in peptidoglycans. It is usually observed as a cell wall component.

314

Recombinant DNA Technology and Genetic Engineering

NIH: National Institute of Health or NIH is the world’s foremost research center which began as laboratory ,. direction. Nick translation:

Nicked DNA: which disrupts super coiling structure. Nicking: Nitrogen base: NMR/ MRI: used to visualise body structures and their functions. Northern blot: A method of transfer of electrophoretically separated RNA molecules onto membrane. Nuclease: An enzyme that degrades DNA in a random fashion. It can degrade DNA as well as RNA. Nucleoside: Nucleotide: The sequence of nucleotide arrangement in the nucleic acid molecule. Any DNA will of nucleotides results in formation of nucleic acid DNA/RNA. Obligate anaerobe: Obligate intracellular parasite: A microbe which can replicate inside a living cell. Most of these microbes Okazaki fragment: A short segment of DNA that is formed during discontinuous DNA replication. Oligo: Oligonucleotide: Oligonucleotide probe: A short single-stranded DNA/RNA fragment labelled with radioactive material. This is used in outhern, N new /novel related DNA sequences. Oncogene: A gene that plays an important role in the development of cancer. Most of the oncogenes are of viral or cellular origin. Open Reading Frame (ORF): Operator: Operon: A bunch of bacterial structural genes arranged one after the other and they are under the control of the same operator. Ori site/ origin of replication: A segment of E. coli will have their own ori presence or absence of ori site.

Glossary

315

Overlapping readingframe: Presence of start codon in different reading frames to generate different polypeptides from single DNA sequence. Organelle: Osmosis: A process which occurs across a semipermeable membrane where dilute solution moves into concentrated solution. Outer membrane: A major cell membrane of gram negative bacteria. It is mainly composed of Outer membrane protein: A major protein component of a gram negative bacterial outer membrane. They play an important role in transportation into and out of periplasmic space. assays.

Palindrome: Adam”. Recognition sequences of many restriction enzymes. Papain: Pasteurisation: advantage of the method lies in utilisation of mild temperatures for longer term, which helps in prevention of spoilage of vegetables or food or beverages. Pathogen: A microbe’s capability of causing a disease. Ability of a microbe to cause disease. Pepsin: Peptide: A bond which is formed between amino acids and is usually observed in proteins. and muramic acid alternate chains. Peptone: A component of microbial growth media which is mainly a hydrolysed protein. A process in which a foreign particle is engulfed by a cell in a phagosome. Phagosome: The physical characteristics of an organism, which relies on its genetic constitution. Phosphodiester bond: A bond formed between two sugar groups and a phosphate. Pilus: during the process of conjugation.

A population of immunoglobulins secreted against particular antigen, each one recognises different epitope. Positional cloning: A method used to identify disease causing genes.

316

Recombinant DNA Technology and Genetic Engineering

Promotor: A region of DNA to which RNA polymerase binds and initiates transcription. to 5

Proofread:

Pseudogene: A derivative of ancestral active gene which is inactive in nature. R plasmid: Plasmid carrying multiple genes coding for resistance to different drugs/antibiotics. Repetitive DNA: DNA sequences that are present in many copies in a chromosome. Replica plating: A rapid and simple method of transferring bacterial clones/colonies from a master plate in Reporter gene:

Restriction endonuclease: RFLP A method in which restriction enzyme digested fragments are separated to understand their pattern which also infers their relative sequence similarity or restriction enzyme pattern. A restriction enzyme which is present in one individual may not be present at the same locus or may be absent. This method helps in understanding the restriction enzyme pattern. RFLP mapping: A conserved sequence where RNA polymerase binds and initiates translation process. Tetrahymena. RNA editing: A process of addition/ insertion of uridines into mRNA even after completion of transcription. This process is controlled or regulated by guide RNA. Also edits RNA sequence by introduction of cytidines by removing certain bases. Rolling circle replication: A method of replication wherein the circular double-stranded DNA produces linear DNA strands. RT-PCR: Reverse Transcriptase Polymerase Chain Reaction or RT-PCR is a type of PCR through which cDNA is synthesised where reverse transcriptase has been used. The resulted cDNA is subsequently

Satellite DNA: DNA upon ultracentrifugation forms different layers of bands indicating for variation of density in comparison with the whole cell DNA. Selectable marker: selection of recombinants. Selective media: A part of nucleic acid material of the genome, which does not have any function other than its own replication. Sense strand: A DNA strand having identical sequence of transcribed mRNA. A method which is used for cloning of large population of different DNA fragments .

Glossary

317

Shuttle vector: A plasmid vector which has the capacity to replicate in two different organisms such as E. coli and yeast, E. coli replication sites as above one for E. coli and the other for yeast. N-terminal sequence / region of a secretary protein which helps in protein transport to periplasmic space. Signal transduction: Silent mutation: A mutation which does not change amino acid residue sequence and therefore, the function of protein. All N3 mutations are silent mutations such as AAT to AAA where third nucleotide has been changed without changing amino acid sequence. A single nucleotide variation that brings variation in the DNA sequence. Small nuclear RNA: ribonucleoproteins which participate in RNA processing. Small nuclear ribonuclear proteins SnRNP: Southern blot: A method followed for transfer of electrophoretically transferred bands onto the membrane in Spacer DNA: Nontranscribed intergenic DNA sequences which are located between ribosomal RNA genes Spliceosome: In an adverse reaction conditions restriction enzymes cleave similar sequences but not identical The E. coli growth phase in which cell number remains constant. Here the rate of formation Stringent plasmid: A low copy number plasmid only replicates along with the host chromosome. Structural gene: Nonregulatory region or a gene sequence that codes for a protein. Subcloning: A process of transferring a DNA fragment from one plasmid vector to the other. Subunit vaccine: from the virus or pathogenic microbe. Supercoil: A closed circular double-stranded DNA molecule. T-cell: It is a type of white blood cell. T-DNA: Transfer DNA or Tumor DNA, a small portion of the Ti-plasmid which gets integrated into the plant chromosomal DNA. Tandem duplication: Adjacent identical chromosome arrangement. A short stretch of similar DNA sequences followed one after the other. They are Template or noncoding strand: DNA strand which acts as a template for transcribed mRNA as well as coding DNA strand. A DNA sequence that signals for termination of transcription to RNA polymerase. It is different from stop codon. that helps in infection of bacterium to the Ti plasmid: A circular plasmid from plant cells.

318

Recombinant DNA Technology and Genetic Engineering

2μ plasmid: A basic common and naturally available plasmid in yeasts. Many advanced and recent vectors have been developed based on this plasmid. A small molecule which binds to the proteins, ubiquitin labelled proteins are recognised and subsequently degraded by proteosome mediated pathway. A portion of 5 translation. Position or direction of RNA polymerase transcription (5 to 3 Virion: A virus particle. Viroid: Virulence: The ability to cause disease. Western blotting: A genotype or a phenotype that is usually found in nature. X linked: It indicates inheritance pattern of loci located on the X chromosome. X linked disease: A disease caused due to a mutation in the X chromosome. Xeroderma pigmentosum: A disease caused due to the mutation in the UV mutation repair system. Y linkage: Indicates for inheritance pattern of loci located on the y chromosome. YAC: telomeric regions. It is used for cloning of large DNA fragments. Z DNA: It is binding a zinc ion. It is transcription regulatory protein.

INDEX A

Agrobacterium tumefaciens A A AMV(Avian myeloblastosis virus A A A

E

A

B Bacillus thurungenesis

F F+

C G

D H H H H

320

Index

H H H

R

I

K Kleveromyces lactis

L

RNA

M

S

N

O

T P

Ti

W Y