Plant Physiology: Question Bank [First ed.] 9789354664250

Table of contents :
Cover
Half Title Page
Title Page
Copyright
Foreword by AK Singh
Preface
Contents
1. The Plant Cell
2. Water Relation
3. Transpiration and Guttation
4. Mineral Nutrition of Plants
5. Special Modes of Nutrition
6. Translocation of Organic Solutes
7. Photosynthesis
8. Respiration and Photorespiration
9. Enzymes and Vitamins
10. Carbohydrate Metabolism in Plants
11. Sulfur Assimilation and Metabolism in Plants
12. Nitrogen Metabolism and Biological Nitrogen Fixation
13. Lipid Metabolism
14. Secondary Metabolites
15. Plant Growth Regulators
16. Vernalization
17. Photoperiodism
18. The Biological Clock: Rhythms of Life
19. Eco-Physiology and Environmental Biology
20. Instrumentation in Plant Physiology
21. Physiology of Crop Plants
22. Germination and Dormancy
23. Plant Movement
24. Bioenergetics
25. Plant Molecular Biology
26. Plant Tissue Culture
27. Stress Physiology
28. System Physiology: Plant
Model Test Papers
Long and Short Study Questions
Practice Windows
Scientists and their Contribution
Nobel Prize Winners
Back Cover

Citation preview

Plant Physiology Over

8000 MCQs 1000 Study Questions

Question Bank for BSc, BSc (Agriculture), BSc (Biotechnology), BTech (Biotechnology) and MSc (Plant Physiology), MSc (Agriculture), MSc (Biochemistry), MSc (Biotechnology), MSc (Botany), MSc (Environmental Science) and MTech (Biotechnology) According to the latest syllabi prescribed by Agricultural Scientists Recruitment Board (ASRB), Agriculture Research Services (ARS)-NET, Council of Scientific and Industrial Research (CSIR) Life Science-NET, University Grants Commission (UGC)NET, Indian Council of Agricultural Research (ICAR), Tata Institute of Fundamental Research (TIFR)NCBS, IISC, GATE, IIT-JAM, Banaras Hindu University, Allahabad Central University, Central Universities Common Entrance Test (CUCET), Jananayak Chandrashekhar University (JNCU)-Uttar Pradesh, Aligarh Muslim University, Assam Agricultural University (AAU), Allahabad Agriculture University, JRF, SRF, Biology Olympiads, Eligibility for Lecturersip Life Science, All India Technical Universities, UPPCS, Civil Services Examination conducted by Union Public Service Commission (UPSC), Indian Forest Service (IFS), Uttar Pradesh Combined Agricultural and Technology Entrance Test (UPCATET), Public Service Commission-Uttarakhand, Public Service Commission-Prayagraj, Anand Agricultural University (AAU), State University in Jorhat-Assam, Telangana State Engineering, Agriculture & Medical Common Entrance Test (TSEAMCET), Andhra Pradesh Engineering, Agriculture & Medical Common Entrance Test (APEAMCET), University of Agricultural Sciences-Bengaluru, University of Agriculture Sciences-Dharwad, Punjab Agriculture University-Ludhiana, GB Pant University of Agriculture and Technology-Pantnagar, Indian Agriculture Research Institute (IARI)-New Delhi, CCS Haryana Agriculture University-Hissar, Tamil Nadu Agriculture University-Coimbatore

Plant Physiology Over

8000 MCQs 1000 Study Questions

Question Bank for BSc, BSc (Agriculture), BSc (Biotechnology), BTech (Biotechnology) and MSc (Plant Physiology), MSc (Agriculture), MSc (Biochemistry), MSc (Biotechnology), MSc (Botany), MSc (Environmental Science) and MTech (Biotechnology) According to the latest syllabi prescribed by Agricultural Scientists Recruitment Board (ASRB), Agriculture Research Services (ARS)-NET, Council of Scientific and Industrial Research (CSIR) Life Science-NET, University Grants Commission (UGC)NET, Indian Council of Agricultural Research (ICAR), Tata Institute of Fundamental Research (TIFR)NCBS, IISC, GATE, IIT-JAM, Banaras Hindu University, Allahabad Central University, Central Universities Common Entrance Test (CUCET), Jananayak Chandrashekhar University (JNCU)-Uttar Pradesh, Aligarh Muslim University, Assam Agricultural University (AAU), Allahabad Agriculture University, JRF, SRF, Biology Olympiads, Eligibility for Lecturersip Life Science, All India Technical Universities, UPPCS, Civil Services Examination conducted by Union Public Service Commission (UPSC), Indian Forest Service (IFS), Uttar Pradesh Combined Agricultural and Technology Entrance Test (UPCATET), Public Service Commission-Uttarakhand, Public Service Commission-Prayagraj, Anand Agricultural University (AAU), State University in Jorhat-Assam, Telangana State Engineering, Agriculture & Medical Common Entrance Test (TSEAMCET), Andhra Pradesh Engineering, Agriculture & Medical Common Entrance Test (APEAMCET), University of Agricultural Sciences-Bengaluru, University of Agriculture Sciences-Dharwad, Punjab Agriculture University-Ludhiana, GB Pant University of Agriculture and Technology-Pantnagar, Indian Agriculture Research Institute (IARI)-New Delhi, CCS Haryana Agriculture University-Hissar, Tamil Nadu Agriculture University-Coimbatore

R S Sengar MSc PhD Professor and Head Department of Agriculture Biotechnology, College of Agriculture Sardar Vallabhbhai Patel University of Agriculture and Technology, Meerut, UP

CBS Publishers & Distributors Pvt Ltd New Delhi • Bengaluru • Chennai • Kochi • Kolkata • Lucknow • Mumbai Hyderabad • Jharkhand • Nagpur • Patna • Pune • Uttarakhand

Disclaimer Science and technology are constantly changing fields. New research and experience broaden the scope of information and knowledge. The authors have tried their best in giving information available to them while preparing the material for this book. Although, all efforts have been made to ensure optimum accuracy of the material, yet it is quite possible some errors might have been left uncorrected. The publisher, the printer and the authors will not be held responsible for any inadvertent errors, omissions or inaccuracies. eISBN: xxxx Copyright © Authors and Publisher First eBook Edition: 2022 All rights reserved. No part of this eBook may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording, or any information storage and retrieval system without permission, in writing, from the authors and the publisher. Published by Satish Kumar Jain and produced by Varun Jain for CBS Publishers & Distributors Pvt. Ltd. Corporate Office: 204 FIE, Industrial Area, Patparganj, New Delhi-110092 Ph: +91-11-49344934; Fax: +91-11-49344935; Website: www.cbspd.com; www.eduport-global.com; E-mail: [email protected]; [email protected] Head Office: CBS PLAZA, 4819/XI Prahlad Street, 24 Ansari Road, Daryaganj, New Delhi-110002, India. Ph: +91-11-23289259, 23266861, 23266867; Fax: 011-23243014; Website: www.cbspd.com; E-mail: [email protected]; [email protected].

Branches Bengaluru: Seema House 2975, 17th Cross, K.R. Road, Banasankari 2nd Stage, Bengaluru - 560070, Kamataka Ph: +91-80-26771678/79; Fax: +91-80-26771680; E-mail: [email protected] Chennai: No.7, Subbaraya Street Shenoy Nagar Chennai - 600030, Tamil Nadu Ph: +91-44-26680620, 26681266; E-mail: [email protected] Kochi: 36/14 Kalluvilakam, Lissie Hospital Road, Kochi - 682018, Kerala Ph: +91-484-4059061-65; Fax: +91-484-4059065; E-mail: [email protected] Mumbai: 83-C, 1st floor, Dr. E. Moses Road, Worli, Mumbai - 400018, Maharashtra Ph: +91-22-24902340 - 41; Fax: +91-22-24902342; E-mail: [email protected] Kolkata: No. 6/B, Ground Floor, Rameswar Shaw Road, Kolkata - 700014 Ph: +91-33-22891126 - 28; E-mail: [email protected]

Representatives Hyderabad Pune Nagpur Manipal Vijayawada Patna

Foreword

I

feel extremely hapy to note that Dr RS Sengar, Professor and Head, Department of Agricultural Biotechnology, Sardar Vallabhbhai Patel University of Agriculture Technology, Meerut, has brought out Plant Physiology Question Bank, an objective book to help the undergraduate and postgraduate students in the field of plant physiology, crop physiology, agriculture, botany and basic sciences for developing their skills to perform better in their university and competitive examinations. The subject matter covered in this book has been documented systematically and comprehensively. Dr Sengar has done a careful job to present up-to-date information about plant physiology and has shown his acumen by contributing intelligent questions which would certainly be welcomed by the students. I believe that this book would be of immense value to the students of agricultural sciences and basic sciences appearing for various competitive examinations, i.e. ARS/NET, UGC, CSIR, Life Science JRF, SRF, ARSNET, GATE, IIT-JAM, SAU competitive examinations, UP CATET, Biology Olympiads and other competitive examinations. The main purpose of this is to bring objective questions of the subject matter to provide up-to-date information for better understanding of the readers. It would serve as a useful reference material for researchers, students and consultants engaged in agricultural and basic sciences. I congratulate Dr Sengar for his brilliant work.

Dr AK Singh Director, Indian Agricultural Research Institute New Delhi

Preface

T

he main objective of this book Plant Physiology Question Bank is to help the undergraduate and postgraduate students to quickly grasp the facts comprehensively. It is a collection and compilation work from various sources and has been endeavored to include as much information as could be possible. It is realized that the coverage of materials in this book is likely to be far from complete as the information available in plant physiology is immense. I have brought out this book basically for students who plan to appear for plant physiology discipline in the entrance examinations (held by ICAR, ASRB-NET, SRF, GATE, ICMR, CSIR_SRF_UGC_NET, NAARM, DBT, JNU, UPCATET, JARI, NDRI, UPSC, PCS, IIT-JAM, Biology Olympiads and other competitive examinations, etc.). There is a dearth of good entrance book of plant physiology for the above said examinations. Hence, I have prepared an exhaustive question bank of around 8000 MCQs and over 900 study questions with answers covering a wide spectrum of basic plant physiology topics. I have tried my best with a wide array of questions covering minutest details of the subject in simpler form. Plant Physiology Question Bank is an exclusive fundamental search-based collection of multiple choice questions prepared for students mainly to help them revise, consolidate and improve their knowledge and skills. This book is an attempt to provide concise yet comprehensive coverage of a true concept and application-based questions to develop indepth understanding of the subject. This book covers the operational mechanism of the plants which has been discussed with lucidity and with the help of various illustrations based on upto-date literature. Plant physiology is a fast developing subject and new researches are coming almost everyday. New knowledge in plant physiology is being added almost everyday through various research journals and reviews. Therefore an urgency was felt to incorporate the most up-to-date material in this edition. It is my great privilege to acknowledge the valuable help and inspiration given to me by my reverred Late Prof HS Srivastava, Ex-Dean, Department of Plant Science, MJP Rohilkhand University, Bareilly. Besides, I express my heartfelt gratitude to all those who have extended their invaluable help to me in the preparation of the manuscript. I am also thankful to Prof PP Singh, Prof MP Yadav, Prof HS Gour, Prof Gaya Prasad, Ex-Vice Chancellors, Prof RK Mittal, Vice Chancellor, SVPUAT, Meerut. I am deeply indebted to Prof DP Singh, UGC Chairman, Ex-Director National Assessment and Accreditation Council, Nagarbhavi, Bangalore, Karnataka, Ex-Vice-chancellor, Sig University, Devi Ahilya Bai University, Indore, Banaras Hindu University, Dr Arun Kumar Joshi, CIMMYT Regional Representative for Asia and Managing Director, Borlaug Institute for South Asia (BISA), Prof Arvind Kumar, Vice Chancellor of Rani Lakshmi Bai Central Agriculture University, Jhansi, Prof Shivendra Vikram Shahi, Western Kentucky University Bowling Green, USA, Prof VP Singh, Dean and Ex-Pro Vice-Chancellor, Prof SK Garg, Dr Alok Srivastava, Dept of Plant Science, MJP Rohilkhand University, Bareilly, Dr C Viswanathan, Head, Prof VP Singh, Dr Ajay Arora, Dr Pramod Kumar, Dr Renu Pandey,

viii Plant Physiology: Question Bank

Div of Plant Physiology, IARI, New Delhi; Prof MB Chetti, Prof RB Koti, Prof and Head, DI Jirali, Department of Crop Physiology, University of Agricultural Sciences, Dharwad; Prof Atul Kumar, Head, Dr SK Guru, Department of Plant Physiology, GB Pant University of Agriculture & Technology, Pantnagar, Prof RP Singh, Ex-Dean, BBA University, Lucknow, Prof Y Vimla, Pro-Vice Chancellor, CCS University, Meerut, Prof Bandana Bose, Prof JP Srivastava, Prof Pravin Prakash, Dr Vijai P Assistant Prof, Banaras Hindu University, Varanasi, Dr D Sudhakar, Tamil Nadu Agriculture University, Tamil Nadu, Dr Jagdeep Singh Sandhu, Punjab Agriculture University, Ludhiana, Prof Renu Munjol, Prof KD Sharma and Prof Neeraj Kumar, CCS, Haryana Agriculture University, Hissar, Dr RK Singh, ADG Crop Science, ICAR, Dr PS Pandy, ADG, Education, ICAR, New Delhi, Dr Anil Kumar Gupta, Dean Education, Rani Lakshmi Bai Central Agriculture University, Jhansi, Dr C Viswanathan, Division Plant Physiology, Jhansi, Dr Shelly Praveen, Principal Scientist and Head, Dr Ranjit Ranjan Kumar, Division Biochemistry, IARI, New Delhi, Dr Madan Pal Singh, Principal Scientist, Dr Ajay Arora (PS), Dr Anjali Anand (PS), Dr Pramod Kumar (PS), Dr Rakesh Pandey (PS), Dr Renu Pandey (PS), Division of Plant Physiology, IARI, New Delhi, Dr MK Kalarani, Prof and Head, Prof A Senthil, Dr D Vijayalakshmi, Asso Prof, Dr V Ravichandran, Asso Prof and Dr M Djanaguiraman, Asstt Prof, Dept of Crop Physiology, Tamil Nadu Agriculture University, Coimbatore, for their encouragement and desire to publish this experimental book for the use of students, scholars, teachers and researchers working in agriculture and other related sciences. I wish to thank my department colleagues, students and friends for their desire and support to complete this book. I extend very special thanks and gratefully acknowledge the information in the form of figures, tables and others which have been adapted in the book from various sources. It is with a deep sense of love and respect I would like to thank whole-heartedly my reverred mother Smt Kamla Sengar, father Late Dr Sanwal Singh Sengar, brother Dr Rajesh Singh Sengar, son Dr Divyanshu Sengar and Kartikey Sengar for their immense help and excellent moral support ever and always. I am also thankful to my wife Mrs Sarita Sengar, without her help, the preparation of the present manuscript would not have been possible. I would also like to put on the record, the pains taken by my publisher in publishing the book. I would definitely like to await for this opportunity to express my gratitude to all those who have directly or indirectly lent a helping hand in the completion of this book. I owe deep sense of gratitude to our Hon’ble Ex-Vice Chancellor and Ex-DDG, NARM, ICAR, Prof AK Singh for encouragement and support. I am thankful to Mr SK Jain, Chairman and Managing Director, CBS Publishers and Distributors, New Delhi, for his persistent encouragement. I am also thankful to Mr YN Arjuna, Sr Vice President Publishing, Editorial and Publicity and his team comprising Ms Ritu Chawla, Mr Kuldeep, and Mr Manish Raj for bringing out the book in the present form. They also allowed some last moment changes in the manuscript. I express my gratitude to all who have helped me directly or indirectly in writing this book, especially, my parents who always inspired me with the following words “Try to leave behind your footprints on the sands of time through some of your humble contributions to the society”. All suggestions for further improvement of the book can be sent to me at [email protected]. Though I have tried my best to minimize the typographical corrections in the manuscript, yes some errors might have crept in. I thankfully invite the readers to bring these to my notice so that they may be rectified in the next edition. RS Sengar

Contents

ix

Contents Foreword by AK Singh Preface

v vii

1. The Plant Cell

1

2. Water Relation

21

3. Transpiration and Guttation

42

4. Mineral Nutrition of Plants

54

5. Special Modes of Nutrition

88

6. Translocation of Organic Solutes

91

7. Photosynthesis

99

8. Respiration and Photorespiration

172

9. Enzymes and Vitamins

192

10. Carbohydrate Metabolism in Plants

213

11. Sulfur Assimilation and Metabolism in Plants

216

12. Nitrogen Metabolism and Biological Nitrogen Fixation

219

13. Lipid Metabolism

241

14. Secondary Metabolites

244

15. Plant Growth Regulators

265

16. Vernalization

318

17. Photoperiodism

321

18. The Biological Clock: Rhythms of Life

325

19. Eco-Physiology and Environmental Biology

329

20. Instrumentation in Plant Physiology

372

21. Physiology of Crop Plants

392

22. Germination and Dormancy

397

23. Plant Movement

400

x

Plant Physiology: Question Bank

24. Bioenergetics

402

25. Plant Molecular Biology

404

26. Plant Tissue Culture

419

27. Stress Physiology

439

28. System Physiology: Plant

454

Model Test Papers

478

Long and Short Study Questions Practice Windows Scientists and their Contribution

544 577 607

Nobel Prize Winners

612

1

The Plant Cell 1. Telome theory was proposed by: (a) W Fleming (b) Zimmermann (c) Tejo and Laven (d) None of these

8. What is the position of nucleus? (a) In old plant cells nucleus becomes eccentric in position due to enlarged vacuole (b) Usually it occupies geometric central position in cell (c) Present in such area of cell where metabolic activity is maximum (d) All of the above

2. The function of nucleolus: (a) It is the site for assembly of ribosome (b) Helps in biosynthesis of ribosome (c) Both A and B (d) None of these

9. Nucleoplasmic index is equal to: (a) Volume of cytoplasm/volume of chloroplast (b) Volume of cytoplasm/volume of nucleus (c) Volume of nucleus/volume of cytoplasm (d) None of the above

3. Usually one nucleolus is present in one nucleus, except: (a) Oocyte of xenopus (b) Onion cell (c) Both A and B (d) None of these 4. ........ ions are supposed to maintain intact organization of nucleus. (b) Ca++ (a) Na+ ++ (c) Mg (d) None of these

10. In prokaryotic cell, the nucleus is known as: (a) Central unit (b) Central mass (c) Central body (d) None of these

5. The term nucleolus was coined by: (a) Brown (b) Fontana (c) Bowman (d) None of these

11. What is the chemical composition of xanthophylls? (b) C40H55O3 (a) C41H57O2 (c) C40H56O2 (d) None of these

6. Type of nuclear pore which is found in the plant cell: (a) Annulated pore (b) Direct pore (c) Both A and B (d) None of these

12. What is the chemical composition of bacteriochlorophyll? (a) C56H72O6N4Mg (b) C56H74O6N4Mg (c) C56H71O6N4Mg (d) None of these

7. The shape of nuclear pore: (a) Circular (b) Rectangular (c) Octagonal (d) None of these Ans.

1. (b) 12. (b)

2. (c)

3. (c)

4. (b)

5. (c)

6. (b) 1

7. (c)

8. (d)

9. (c)

10. (c)

11. (c)

2

Plant Physiology: Question Bank

13. What is the chemical composition of chlorophyll d? (a) C56H72O6N4Mg (b) C54H70O6N4Mg (c) C55H71O6N4Mg (d) None of these

22. Plastidial system carrying the genetic information is called: (a) Plastogene (b) Chondrogene (c) Plastidom (d) None of these

14. What is the chemical composition of chlorophyll e? (a) C40H52O6N4Mg (b) C37H42O5N4Mg (c) C55H32O5N4Mg (d) None of these

23. DNA of mitochondria and chloroplast has: (a) More AU ratio (b) More GC ratio (c) More AT ratio (d) None of these

15. What is the chemical composition of chlorophyll b? (a) C60H72O6N4Mg (b) C55H70O6N4Mg (c) C59H72O5N4Mg (d) None of these

24. Autonomic genomic systems are found in: (a) Chloroplast (b) Mitochondria (c) Both (a) and (b) (d) None of these

16. What is the chemical composition of chlorophyll a? (a) C57H72O5N4Mg (b) C56H72O5N4Mg (c) C55H70O5N4Mg (d) None of these

25. What is the amount of DNA in chloroplast molecule? (a) 0.8% (b) 0.5% (c) 0.9% (d) None of these

17. Which of the following type of plastid other than amyloplast also stores starch grain? (a) Elioplast (b) Chloroplast (c) Chromoplast (d) None of these

26. Number of carotenoid molecule/ quantasome: (a) 150 (b) 100 (c) 50 (d) None of these

18. Environment enriched with carbon dioxide prevents destruction of chlorophyll molecule. This statement is: (a) True (b) False (c) Both (a) and (b) (d) None of these 19. Chlorophyll does not dissolve in water even after prolonged boiling. This statement is: (a) False (b) True (c) Both (a) and (b) (d) None of these 20. After careful breaking of cell which of the following organelle remains alive for some time: (a) Chloroplast (b) Mitochondria (c) Both (a) and (b) (d) None of these 21. Mitochondria and chloroplast are also called: (a) Endosymbiont of the cell (b) Semiautonomous body (c) Cell within the cell (d) All of the above Ans.

13. (b) 24. (c)

14. (c) 25. (b)

15. (b) 26. (c)

16. (b) 27. (c)

17. (b) 28. (a)

27. Number of chlorophyll molecule/ quantasome: (a) 500–600 (b) 350–450 (c) 230–300 (d) None of these 28. The thickness of quantasome is: (a) 100Å (b) 185 Å (c) 155 Å (d) None of these 29. The width of quantasome is: (a) 100Å (b) 185 Å (c) 155 Å (d) None of these 30. The length of quantasome is: (a) 100Å (b) 185 Å (c) 155 Å (d) None of these 31. What is the molecular weight of quantasome? (b) 6 × 106 (a) 4 × 106 6 (c) 2 × 10 (d) None of these 32. What is the functional unit of chloroplast? (a) Cell (b) Quantasome (c) Chloroplasts (d) None of these 18. (c) 29. (c)

19. (b) 30. (b)

20. (c) 31. (c)

21. (d) 32. (b)

22. (c)

23. (b)

The Plant Cell

33. Thylakoid membrane is supposed to be considered as ......... membrane of chloroplast: (a) 2nd (b) 3rd (c) 4th (d) None of these 34. Number of grana per chloroplast is: (a) 80–90 (b) 100–110 (c) 40–60 (d) None of these 35. The size of each grana: (a) 0.9–3.7 µm (b) 0.3–2.7 µm (c) Both (a) and (b) (d) None of these 36. Plastidial DNA was discovered by: (a) Benda (b) Ris and Plaut (c) Nass and Nass (d) None of these 37. The inner membrane of chloroplast has: (a) Low permeable (b) More protein (c) Both (a) and (b) (d) None of these 38. The outer membrane of chloroplast has: (a) High permeable (b) Low protein (c) Both (a) and (b) (d) None of these 39. What is the range of periplastidial space in the chloroplast? (a) 600–900Å (b) 300–600Å (c) 100–300Å (d) None of these 40. The diameter of the chloroplast is: (a) 10–20 µm (b) 5–10 µm (c) 30–40 µm (d) None of these 41. The shape of chloroplast in chlorella: (a) Bell shape (b) Ribbon shape (c) Satellite shape (d) None of these 42. The shape of chloroplast in Ulothrix: (a) Collar shape (b) C–shape (c) Girdle shape (d) All of these 43. In spirogyra, the shape of chloroplast: (a) Satellite shape (b) Bell shape (c) Ribbon shape (d) None of these 44. Which of the following does not contain DNA? (a) Nucleus (b) Chloroplast (c) Mitochondria (d) None of these Ans.

33. (b) 44. (d)

34. (c) 45. (b)

35. (c) 46. (a)

36. (b) 47. (b)

37. (c) 48. (b)

3

45. The term cell was coined by: (a) N Pringsheim (b) Errera (c) Haeckel (d) None of these 46. Plastid term was given by: (a) Schimper (b) Kolliker (c) Both (a) and (b) (d) None of these 47. Living mitochondria was first observed by: (a) Lewis and Altman (b) Lewis and Lewis (c) Lewis and Nass (d) None of the above 48. Largest mitochondria is found in: (a) Spinacia (b) Oocyte of amphibia (c) Yeast (d) None of the above 49. The smallest mitochondria is found in: (a) Spinacia (b) Oocyte of amphibia (c) Yeast (d) None of the above 50. Stain of mitochondria is: (a) Genus green B (b) Genus green C (c) Genus green A (d) None of these 51. The colour of mitochondria is yellow due to the presence of: (b) Vitamin B2 (a) Vitamin B6 (c) Vitamin B1 (d) None of these 52. Mitochondria is also known as: (a) Biochemical machine (b) Power house of the cell (c) Both (a) and (b) (d) None of these 53. What is the function of mitochondria? (a) It performs oxidative phosphorylation (b) It is the site for cellular respiration (c) It forms nebenkern (d) Thermogenesis (e) Help in cell division (f) Conservation of energy (g) All of the above 38. (c) 49. (c)

39. (c) 50. (a)

40. (b) 51. (b)

41. (a) 52. (c)

42. (d) 53. (g)

43. (c)

4

Plant Physiology: Question Bank

54. After fractionation of cell which of the following can be formed? (a) Mitoplast (b) Microsome (c) Both (a) and (b) (d) None of these 55. Which of the following can perform oxidative phosphorylation? (a) Mitoplast (b) Mitochondria (c) Both (a) and (b) (d) None of these 56. The mitochondria having only inner membrane and matrix is known as: (a) Mitochondrion (b) Mitoplast (c) Protoplast (d) None of these 57. In mitochondria what is the amount of DNA? (a) 0.09 (b) 0.05% (c) 0.02% (d) None of these 58. Mitochondrial DNA was discovered by: (a) Lahinger (b) Seekevitz (c) Nass and Nass (d) None of these 59. ......... gave the term ‘mitochondria‘. (a) Went (b) Altman (c) Benda (d) None of these 60. ......... named mitochondria as ‘Fila‘. (a) Fleming (b) Altman (c) Kolliker (d) None of these 61. ......... observed mitochondria and named it as ‘bioplast‘ and suggested their association with respiration. (a) Fleming (b) Altman (c) Kolliker (d) None of these 62. Who discovered mitochondria and named it as sarcosome? (a) Fleming (b) Altman (c) Kolliker (d) None of these 63. Which of the following antibiotic can stop protein synthesis on 80 ‘S‘ ribosome? (a) Chloramphenicol (b) Cyclohexamidin (c) Both (a) and (b) (d) None of these Ans.

54. (c) 65. (b)

55. (c) 66. (c)

56. (b) 67. (a)

57. (a) 68. (c)

58. (c) 69. (d)

64. Which of the following subunit of ribosomes is attached with the membrane of rough endoplasmic reticulum? (a) Larger subunit (b) Smaller subunit (c) Both (a) and (b) (d) None of these 65. In 70‘S‘ ribosome what is the amount of r-RNA? (a) 75% (b) 65% (c) 45% (d) None of these 66. In 80 ‘S‘ ribosome what is the amount of r-RNA? (a) 75% (b) 65% (c) 45% (d) None of these 67. 77 ‘S‘ ribosome is present in: (a) Fungal mitochondria (b) Animal mitochondria (c) Mammalian mitochondria (d) None of these 68. 55 ‘S‘ ribosome found in: (a) Fungal mitochondria (b) Animal mitochondria (c) Mammalian mitochondria (d) None of these 69. Ribosome is: (a) Smallest organelle of the cell (b) Negatively charged (c) Membrane less organelle (d) All of the above 70. Ribosome is also called: (a) Ribonucleoprotein (RNP) particle (b) Cell engine (c) Protein factory (d) Palade particle (e) All of the above 71. In plant cell ribosome was discovered by: (a) Palade (b) Robinson and Brown (c) Both (d) None of these 59. (c) 70. (e)

60. (a) 71. (b)

61. (b)

62. (c)

63. (b)

64. (a)

The Plant Cell

5

72. Function of lysosome is: (a) Extracellular digestion (b) Autophagy (c) Intracellular digestion (d) All of above

82. Desmotucules are found in: (a) Cytoskeleton (b) Lasmodesmata (c) Endoplasmic reticulum (d) None of these

73. Catabolic enzyme is found in: (a) Mitochondria (b) Lysosome (c) Both (a) and (b) (d) None of these

83. In plant, Golgi bodies are concerned mainly in the formation of: (a) Tonoplast (b) Cell wall (c) Plasma membrane (d) None of these

74. Enzyme of lysosome is: (a) Catabolic in nature (b) Hydrolytic in nature (c) Both (d) None of these 75. Oxidative enzyme is found in: (a) Mitochondria (b) Lysosome (c) Both (a) and (b) (d) None of these 76. Enzymes of cell acts on: (a) Basic pH (b) Neutral pH (c) Acidic pH (d) None of these 77. Enzyme of lysosome acts on: (a) Basic pH (b) Neutral pH (c) Acidic pH (d) None of these 78. Secondary lysosome is also known as: (a) Heterophagosome (b) Heterophagic vacuole (c) Both (a) and (b) (d) None of these 79. Lysosome shows polymorphism, this statement is: (a) False (b) True (c) Not known (d) None of these 80. Periplasmic space acts as lysosome in: (a) Eukaryotic cell (b) P r o k a r y o t i c cell (c) Both (a) and (b) (d) None of these 81. Lysosome was discovered by: (a) W Flemming (b) De duve (c) R Altman (d) None of these Ans.

72. (d) 83. (b)

73. (c) 84. (e)

74. (c) 85. (c)

75. (a) 86. (b)

76. (b) 87. (c)

84. What is function of Golgi body? (a) It form acrosome of sperm (b) It perform glycosidation of protein and lipid (c) It is concerned with condensation, packing, storage, transfer (d) It is mainly associated with secretion (e) All of the above 85. Golgi body originated from: (a) Smooth portion of rough endoplasmic reticulum (b) Smooth endoplasmic reticulum (c) Both (a) and (b) (d) None of these 86. Golgi body shows structural polarity. This statement is: (a) False (b) True (c) Not known (d) None of these 87. ......... is the area of cytoplasm around the Golgi body which is devoid of glycogen and organelles like ribosome, mitochondria and plastid. (a) Zone of condensation (b) Zone of Golgi (c) Zone of exclusion (d) None of these 88. Zone of exclusion is also present around: (a) Microtubule (b) Aster (c) Centriole forming area (d) Centriole (e) All of the above 77. (c) 88. (e)

78. (c)

79. (b)

80. (b)

81. (b)

82. (b)

6

Plant Physiology: Question Bank

89. Dictyosomes are found in: (a) Prokaryote (b) Animal cells (c) Plant cell (d) None of these

(c) It helps in formation of nuclear membrane and cell wall (d) It indirectly forms lysosome (e) It helps in intracellular transport of material (f) It provides increased surface area for increased rate of reaction (g) It provides endoskeleton to the cell (h) All of the above

90. Small and scattered form of Golgi body present in most of plant cells is known as: (a) Lipochondria (b) Golgi body (c) Dictyosomes (d) None of these 91. Lipochondria termed was given by: (a) Benda (b) Fillip (c) Baker (d) None of these 92. Collective name of the Golgi apparatus or Golgi bodies are discovered by: (a) Dictyosomes (b) Mitochondria (c) Lipochondria (d) None of these 93. Golgi complex or Golgi apparatus or Golgi bodies are discovered by Camillio Golgi by: (a) Iron metallic impregnation technique (b) Sodium metallic impregnation technique (c) Silver metallic impregnation technique (d) None of these 94. Endomembrane system or cytoplasmic vacuolar system includes: (a) Golgi body (b) Endoplasmic reticulum (c) Nuclear membrane (d) All of the above 95. After fractionation of cell which of the following new structures will be formed? (a) Microblast (b) Microtech (c) Microsome (d) Microcosm (e) All of the above 96. What is the function of endoplasmic reticulum? (a) It helps in intracellular conduction of impulse (b) It directly forms Golgi body/ complex Ans.

89. (c) 90. (c) 91. (c) 92. (c) 93. (c) 100. (b) 101. (b) 102. (c) 103. (b) 104. (b)

97. Endoplasmic reticulum originated from: (a) Mitochondria (b) Chloroplast (c) Nuclear membrane (d) All of the above 98. What are the main components of rough endoplasmic reticulum? (a) Tubule (b) Cisternae (c) Both (d) None of these 99. What are the main components of smooth endoplasmic reticulum? (a) Vesicle (b) Tubule (c) Both (d) None of these 100. The ground phase of the cytoplasm is known as: (a) Cell-inclusion (b) Cytosol (c) Both (d) None of the above 101. Ergastoplasm is ......... in nature: (a) Neutral (b) Basophilic (c) Acidic (d) None of these 102. Endoplasmic reticulum was named and discovered by: (a) Palade (b) Benda (c) Porter (d) None of these 103. Pinocytosis was discovered by: (a) Givindjee (b) Lewis (c) Nicolson (d) None of these 104. Phagoctyosis was discovered by: (a) Lewis (b) Metchnikoff (c) Both (a) and (b) (d) None of these 94. (d)

95. (c)

96. (h)

97. (d)

98. (c)

99. (c)

The Plant Cell

105. Gap junction is also known as: (a) Macula occludence (b) Nexus (c) Both (a) and (b) (d) None of these 106. Intermediary junction is also known as: (a) Zonula adherence (b) Terminal bar (c) Both (a) and (b) (d) None of these 107. Tight junction is also known as: (a) Zonula adherence (b) Zonula occludens (c) Terminal bar (d) None of the above 108. What is the specialization due to contact of plasma membrane? (a) Inetrmediary junction (b) Tight junction (c) Interdigitation (d) All of the above 109. What is the specialization due to evagination of plasma membrane? (a) Microvilli (b) Stereocilia (c) Flagella (d) All of the above 110. Biomembrane is: (a) Nonliving (b) Living (c) Both (a) and (b) (d) None of these 111. Which component (or flexibility) to brane? (a) Carbohydrate (c) Lipid

provides elasticity the plasma mem(b) Protein (d) None of these

112. Which component of plasma membrane provides fluidity to the plasma membrane? (a) Lipid (b) Protein (c) Both (a) and (b) (d) None of these 113. Which of the following component of plasma membrane is amphiphatic in nature? (a) Intrinsic protein (b) Phospholipid (c) Extrinsic protein (d) Both (b) and (c)

7

114. Plasma membrane remains holded primarily by or stability of plasma membrane is due to: (a) Hydrophobic attraction (b) Hydrophilic attraction (c) Covalent bond (d) None of the above 115. Due to the presence of glycocalyx (or cell coat) the plasma membrane is: (a) Symmetrical (b) Asymmetrical (c) Both (a) and (b) (d) None of these 116. Functions of glycocalyx are: (a) Reorganization of other cells (b) Antigenesis (c) As receptor (d) All of the above 117. Glycocalyx is: (a) Living (c) Not known

(b) Nonliving (d) None of these

118. Among the following which one is transported most efficiently through plasma membrane? (a) D–Galactose (b) D–Glucose (c) D–Mannose (d) None of these 119. Gramicidin, an ionophore consisting of a linear chain of ......... : (a) 18 Amino acids (b) 12 Amino acids (c) 15 Amino acids (d) None of these 120. Valinomycin, a small cyclic molecule constructed from alternating: (a) 18 Amino acids (b) 12 Amino acids (c) 20 Amino acids (d) None of these 121. Gramicidin is selective in the ions it transports, the selectively of the gramicidin channel follows the order: (a) Li > H+ > K+ > Na+ > Nh4 (b) H+ > NH4 > K+ > Na+ > Li+ (c) Li+ > H+ > NH4+ > K+ > Na+ (d) None of the above

Ans. 105. (c) 106. (c) 107. (b) 108. (d) 109. (d) 110. (b) 111. (b) 112. (a) 113. (b) 114. (a) 115. (b) 116. (d) 117. (d) 118. (b) 119. (c) 120. (b) 121. (b)

8

Plant Physiology: Question Bank

122. ......... functions as a channel former, creating a fixed transmembrane channel follows the order. (a) Gramicidin (b) Valinomycin (c) Both (a) and (b) (d) None of these 123. ......... is a mobile carrier diffusing back and forth through lipid bilayers. (a) Gramicidin (b) Valinomycin (c) Both (a) and (b) (d) None of these 124. After membranes have been isolated and purified, their protein composition is determined by extraction with the detergent ......... and fractionating the extracted polypeptide by one- or two-dimensional gel electrophoresis: (a) KCI (b) Sodium dodecyl sulfate (c) Calcium sulfate (d) None of the above

129. Long chain fatty acids have higher transition temperature than shorter chain fatty acids, which means that the membrane enriched with the long chain fatty acids tend to exhibit ......... fluidity. (a) Decreased (b) Increased (c) Both (d) None of these 130. Flip-flop movement is also known as: (a) Transverse diffusion (b) Lateral diffusion (c) Both (a) and (b) (d) None of these 131. Lipid molecule can shift its position by: (a) Lateral movement (b) Flip-flop movement (c) Both (a) and (b) (d) None of these

125. Which of the following lipid is commonly found in biological membranes? (a) Triglycerides (b) Monoglycerides (c) Diglycerides (d) None of these

132. Intrinsic protein extended throughout the thickness of phospholipid bilayer is known as: (a) Transmembrane protein (b) Tunnel protein (c) Both (a) and (b) (d) None of these

126. Which of the following is the cell adhesion molecule? (a) Integrin (b) Myosin (c) Keratin (d) Lysine

133. Protein can shift its position ......... in phospholipids bilayers: (a) Vertically (b) Laterally (c) Both (a) and (b) (d) None of these

127. ......... is the most valuable instrument used to study the behavior of the lipid films. (a) Gel electrophoresis (b) Langmuir through (c) Centrifugation of the lipid layer (d) None of the above

134. “Iceberg of protein in sea of lipid”, this statement was made by: (a) Dixon and Jolly (b) Singer and Nicholson (c) Darwin (d) None of these

128. Unsaturated fatty acid has lower transition temperature than shorter chain fatty acids, which means that membrane enriched with unsaturated fatty acids ......... fluidity: (a) Decreased (b) Increased (c) Remain same (d) None of these

135. What is the amount of carbohydrate in the plasma membrane? (a) 1–5% (b) 20–40% (c) 59–70% (d) None of these 136. What is the amount of protein in the plasma membrane? (a) 1–5% (b) 20–40% (c) 59–70% (d) None of these

Ans. 122. (a) 123. (b) 124. (b) 125. (c) 126. (a) 127. (b) 128. (b) 129. (a) 130. (a) 131. (b) 132. (c) 133. (b) 134. (b) 135. (a) 136. (c)

The Plant Cell

137. What is the % amount of lipid present in the plasma membrane? (a) 1–5% (b) 20–40% (c) 59–70% (d) None of these 138. Plasma membrane is made of: (a) Phospholipid protein and carbohydrate (b) Phospholipid protein (c) Lipoprotein (d) None of the above 139. Receptor mediated endocytosis from plasma membrane requires which one of the following coat protein? (a) Clathrin (b) Arrestin (c) Glycophori (d) Adaptin 140. Plant cell walls contain: (a) Glycosaminoglycan (b) Pectin (c) Peptidoglycan (d) Proteoglycan (e) None of these 141. Schleiden believed that new cells are formed by budding off from the: (a) Nucleus (b) Protoplasm (c) Cell wall (d) All of the above 142. Strasburger coined the term: (a) Plastids (b) Nucleoplasm (c) Cytoplasm (d) None of these 143. It is not possible to see a cell usually without the help of a microscope because: (a) Most cells are colorless (b) Resolving power of human eye is 0.1 nm (c) Cells are mostly < 100 m in size (d) All of the above 144. The existence of cell membrane was proved by: (a) Plowe (b) Nageli (c) Overton (d) None of these 145. Which of the following is a cell organelle? (a) Microtubule (b) Plasma membrane

9

(c) Mitochondrion (d) Vacuole (e) None of these 146. Unit-membrane model of cell membrane was proposed by: (a) Robertson (b) Danielli-Devson (c) Singer and Nicolson (d) None of these 147. The thickness of plasma membrane ranges from: (a) 5Å–15 Å (b) 15 Å–25 Å (c) 75 Å–215 Å (d) None of these 148. The term cell membrane was coined by: (a) Cramer and Nageli (b) Pfeffer (c) JQ Plowe (d) None of these 149. The term plasmalemma was coined by: (a) Cramer and Nageli (b) Pfeffer (c) JQ Plowe (d) None of these 150. The term plasma membrane was coined by: (a) Cramer and Nageli (b) Pfeffer (c) JQ Plowe (d) None of these 151. Which of the following has maximum percentage of cellulose? (a) Jute (b) Cotton (c) Wood (d) None of these 152. Which of the following is used to isolate the plant cell from its group? (a) Strong base (b) Lipase (c) Strong acid (d) None of these 153. Outermost layer of the plant cell wall when the plant cells are in group (attached): (a) Secondary cell wall (b) Primary cell wall (c) Middle lamella (d) None of the above

Ans. 137. (b) 138. (a) 139. (a) 140. (b) 141. (a) 142. (a) 143. (d) 144. (c) 145. (c) 146. (a) 147. (c) 148. (a) 149. (c) 150. (b) 151. (b) 152. (d) 153. (b)

10

Plant Physiology: Question Bank

154. Which of the following characteristic of the plant cell? (a) Plastid (b) Cell wall (c) Both (a) and (b) (d) None of these 155. Specific stain for lignin: (a) Acidic phloroglucin (b) Phloroglucinol hydrochloride (c) Both (a) and (b) (d) None of these 156. Find the missing in the flow chart is given below: Glucose molecule (hexose) P=? 1 Cellulose chain Q=? 1 Cellulose micelle R=? 1 Cellulose microfibril S=? Cellulose macrofibril

(a) P = 3000 molecule of glucose, enzyme-polymerase, Q = 100 molecule of cellulose chain, enzymepolymerase, R = 100 molecule of cellulose micelle, enzyme-polymerase, S = 20 molecule of cellulose microfibril, enzyme-polymerase (b) P = 3000 molecule of glucose, enzyme-polymerase, Q = 100 molecule of cellulose chain, enzymepolymerase, R = 25 molecule of cellulose micelle, enzyme-polymerase, S = 250 molecule of cellulose microfibril, enzyme-polymerase (c) P = 3000 molecule of glucose, enzyme-polymerase, Q = 150 molecule of cellulose chain, enzymepolymerase, R = 55 molecule of cellulose micelle, enzyme-polymerase, S = 250 molecule of cellulose microfibril, enzyme-polymerase (d) None of the above 157. Middle lamella consists of: (a) Calcium pectate (b) Lignin

(c) Cellulose (d) None of these 158. Continuity of protoplasm through plasmadesmata is called: (a) Endoplasmic reticulum (b) Symplast (c) Intercellular space (d) None of the above 159. The cell wall outside protoplast constitutes: (a) Symplast (b) Phragmoplast (c) Apoplast (d) None of these 160. ......... is known as intercom system of plant cells: (a) Ribosome (b) Plasmodesmata (c) Cell wall (d) None of these 161. The cell wall does not totally (or, completely) isolated (or separate) from the plant cell due to: (a) Tight junction (b) Interdigitation (c) Plasmodesmata (d) None of these 162. The concept of cell lineage was given by: (a) Jensen (b) Schleiden (c) Schwann (d) None of these 163. On the basis of his own observations, as well as those of others, Schleiden in 1883 proposed that the cell is the structural and functional the unit of life. The idea was a: (a) Generalization (b) Assumption (c) Observation (d) None of these 164. The term metabolism was given by: (a) Jensen (b) Schleiden (c) Swanson (d) Schwann 165. Cytoplasm is the part of: (a) Cell wall (b) Protoplasm (c) Plastids (d) Nucleus

Ans. 154. (c) 155. (c) 156. (b) 157. (a) 158. (b) 159. (c) 160. (b) 161. (c) 162. (c) 163. (a) 164. (d) 165. (b)

The Plant Cell

166. Plasmodesmata was discovered by: (a) Brown (b) Altman (c) Strasburger (d) None of these 167. On increasing numbers of cell wall the size of lumen of plant cell: (a) Remains unchanged (b) Increases (c) Decreases (d) All of the above 168. What is the nature of protoplasm? (a) Monophasic crystello colloidal (b) Polyphasic crystello colloidal (c) Both A and B (d) None of these 169. In the dry condition ......... is most abundant constituent of protoplasm? (a) Fat (b) Water (c) Protein (d) None of these 170. In normal condition ....... is most abundant constituent of protoplasm? (a) Fat (b) Water (c) Protein (d) None of these 171. In dry mass of protoplasm, what is the percentage of protein? (a) 30–40 (b) 50–60 (c) 10–20 (d) None of these 172. In protoplasm, what is the percentage of dry mass? (a) 30–40 (b) 50–60 (c) 10–20 (d) None of these 173. “Protoplasm is the physical basis of life”, this statement was made by: (a) Reinke (b) Huxley (c) Both (a) and (b) (d) None of these 174. ......... emphasized the importance of protoplasm. (a) Von Mohl (b) Huxley (c) Purkinjee (d) None of these

11

177. Who first highlighted the significance of protoplasm and named as sarcode? (a) Purkinjee (b) Dujardin (c) Corti (d) None of these 178. The smallest component of the cell: (a) Plastid (b) Microfilament (c) Ribosome (d) None of these 179. In the old plant cell the largest cell component of plant cell is: (a) Mitochondria (b) Nucleus (c) Plastid (d) None of these 180. Largest organelle of plant cell is: (a) Mitochondria (b) Nucleus (c) Plastid (d) None of these 181. Organelle of cell remains embedded in: (a) Deutoplasm (b) Protoplasm (c) Metaplasm (d) All of the above 182. The nonliving part of the cell is known: (a) Cell inclusion (b) Ergastic substance (c) Metaplasm (d) All of these 183. The term protoplasm was coined by: (a) Negilli (b) Hanstein (c) Both (a) and (b) (d) None of these

175. Who gave the term protoplasm? (a) Von Mohl (b) Huxley (c) Purkinjee (d) None of these

184. What is the exceptional example of animal cell in which outermost covering is nonliving structure? (a) Sperm of animal (b) Ovum of female (c) Hard shell of cledoic egg (d) None of the above

176. First observed the protoplasm: (a) Corti (b) Dujardin (c) Purkinjee (d) None of these

185. Outermost covering of animal cell: (a) Nonliving (b) Living (c) Semi living (d) All of these

Ans. 166. (c) 167. (c) 168. (b) 169. (c) 170. (b) 171. (a) 172. (c) 173. (b) 174. (a) 175. (c) 176. (b) 177. (c) 178. (b) 179. (d) 180. (c) 181. (b) 182. (d) 183. (b) 184. (c) 185. (b)

12

Plant Physiology: Question Bank

186. Write the exceptional example of plant in which cell wall is absent and only plasma membrane is outermost covering: (a) Cilia of zoospore (b) Gamete of zoospore (c) Flagella of zoospore (d) None of the above 187. Outermost covering of plant cell is: (a) Nonliving (b) Living (c) Semi living (d) All of these 188. What is the mode of cytokinesis in the plant cell? (a) Centripetal (b) Centrifugal (c) Both (a) and (b) (d) None of these 189. “Body of multicellular organism is complete mass of protoplasm which is incompletely subdivided into many small units (as cell) for proper functioning”, was proposed by: (a) Corti (b) O Hertwing (c) Sachs (d) None of these 190. “All organisms are made of protoplasm”. This statement was made by: (a) Purkinje (b) Max Schultz (c) HW Mohl (d) None of these 191. Which of the following is the exception of the cell theory? (a) Rhizopus (B) G algae (c) Bacteria (d) All of these 192. The first person to see a ‘free’ cell under the microscope was: (a) Purkinje (b) N Grew (c) Robert Hooke (d) None of these 193. Virchow discovered that the cells divide and new cell arise from the proexisting cells. His discovery: (a) Resulted in the acceptance of the cell theory (b) Had no effect on the cell theory (c) Resulted in the modification of cell theory (d) None of the above

194. The statement that cells are produced by pre-existing cells was made by: (a) Virchow (b) Mendel (c) Palade (d) None of these 195. Extension to cell theory was made by: (a) Virchow (b) Mendel (c) Palade (d) None of these 196. What was the main lacking point in cell theory of Schneider and Schwann? (a) They failed to explain cell wall organization (b) They failed to explain how the new cell arises (c) They failed to explain how the cells transport material from inner side of the cells (d) None of the above 197. Who defined that the cells are membrane enclosed nucleus containing structure? (a) T Schwann (b) MJ Schneider (c) Both (a) and (b) (d) None of these 198. “Micrographic” published by Robert Hooke is among the great classics of biology. The chapter ......... of the “Micrographic entitled” of the Schematize or Textured of cork and of the cells and pores of some other such frothy bodies” contains the observation of Robert Hooke on cells. (a) XVII (b) XVIII (c) XVI (d) None of these 199. Robert Hooke used the word ......... for the walls separating the chambers (or cells). (a) Cell wall (b) Diaphragm (c) Object plate (d) None of these 200. “Animal cell differ from plant cell in the absence of cell wall”, this statement was made by: (a) T Schwann (b) MJ Schleiden (c) Both (a) and (b) (d) None of these

Ans. 186. (b) 187. (a) 188. (b) 189. (c) 190. (b) 191. (d) 192. (d) 193. (c) 194. (a) 195. (a) 196. (b) 197. (a) 198. (b) 199. (b) 200. (a)

The Plant Cell

201. “All the plants are made up of cells”, this theory was coined by: (a) T Schwann (b) MJ Schneider (c) Both (a) and (b) (d) None of these 202. Well-defined nucleus is found in: (a) Bacteria (b) Cyanobacteria (c) Eukaryotes (d) Prokaryotes 203. Book “The Cell” was written by: (a) Benda (b) R Altman (c) CP Swanson (d) None of these 204. Father of modern cytology is: (a) Benda (b) R Altman (c) CP Swanson (d) None of these 205. Plant cell differs form animal cell is having: (a) Cytoskeleton (b) Ribosome (c) Cell wall (d) None of these 206. The idea of individuality of cells was expressed by: (a) Dujardin (b) Dutrochet (c) Schwann (d) Corti 207. What Robert Hooke had discovered in the thin section of the cork as a cell was really: (a) Cell walls (b) Protoplasm (c) Cellulose (d) Nuclei 208. The figure of the cork cells as seen by Robert Hooke was published in his book. (a) Origin of species (b) Genera Plantarum (c) Micrographia (d) None of the above 209. Robert Hooke: (a) Lived in the 17 century (b) Discovered the cork cells (c) Constructed a microscope (d) Invented the lens 210. The term cell was first of all used by: (a) Hopkins (b) Flemming (c) Harvey (d) None of these

13

211. The branch of botany dealing with the internal structure of cell and its functions is called: (a) Cytology (b) Cell biology (c) Both (a) and (b) (d) None of these 212. Cell doctrine was given by: (a) Leeuwenhoek (b) Singer and Nicolson (c) Both (a) and (b) (d) None of these 213. Angstrom, the unit of measurement transmission electron microscopy is equal to: (a) 0.0001 µm (b) 0.001 µm (c) 0.01 µm (d) None of these 214. One angstrom unit is equal to: (b) 10–8 cm (a) 10–9 cm –7 (d) 10–6 cm (c) 10 cm 215. ......... is a cell organelle among the following. (a) Mitochondrion (b) Plasma membrane (c) Vacuole (d) Microtubule 216. Unit–Membrane model of cell membrane was proposed by: (a) Danielli-Devson (b) Singe and Nicolson (c) Robertson (d) All of the above 217. Fluid–Mosaic model of cell membrane was proposed by: (a) Danielli-Devson (b) Singe and Nicolson (c) Robertson (d) All of the above 218. Middle lamella chiefly consists of: (a) Mucopolysaccharides (b) Calcium petite (c) Lignin (d) Cellulose 219. Continuity of protoplasm through plasmodeomata is called: (a) Endoplasmic reticulum (b) Symplast (c) Intercellular space (d) None of the above

Ans. 201. (b) 202. (c) 203. (c) 204. (c) 205. (c) 206. (b) 207. (a) 208. (c) 209. (b) 210. (d) 211. (b) 212. (d) 213. (a) 214. (b) 215. (a) 216. (c) 217. (b) 218. (b) 219. (b)

14

Plant Physiology: Question Bank

220. Cell wall space outside the protoplast constitutes: (a) Plasmodesmata (b) Phragmoplast (c) Symplast (d) Apoplast 221. Well-defined nucleus is found in: (a) Eukaryotes (b) Prokaryotes (c) Cyanobacteria (d) Bacteria 222. Plant cell differs from animal cells having: (a) Cytoskeleton (b) Golgi bodies (c) Ribosomes (d) Cell wall 223. Cell theory was put forward by: (a) Leeuwenhoek (b) Schleiden and Schwann (c) Singer and Nicolson (d) None of the above 224. Bacteria having a tuft of flagella at both the poles are: (a) Amphitrichous (b) Lophotrichous (c) Peritrichous (d) Atrichous 225. Polytene chromosomes were discovered in: (a) Culex (b) Musa (c) Drosophila (d) Chironomus 226. Proteins required for functioning of nucleus are formed in: (a) Mitochondria (b) Cytoplasm (c) RER (d) Nucleous 227. Select the correct statement among the following: (a) Chloroplasts are found in plant cells but not in prokaryotic or animal cells (b) Golgi apparatus is found only in the animal cells (c) Animal cells contain microtubules but the plant cells do not have microtubules (d) All cells have a cell wall 228. Teichoic acid occurs is the wall of: (a) Cyanobacteria (b) Mycoplasma (c) Gram +ve bacteria (d) Gram –ve bacteria

229. An interconnected membranous network of the cell composed of vesicles, flattened sacs and tubules is: (a) Endoplasmic reticulum (b) Nucleus (c) Mitochondria (d) Lysosomes 230. Plasmids were discovered by: (a) Messing and Vieria (b) Boliver and Rodriguez (c) Lederberg and Tatum (d) Hayes and Lederberg 231. Consider the statements regarding facilitated transport: (1) Requires ATP energy (2) Transport saturates (3) Highly selective (4) Requires special membrane properties (5) Uphill transport Of above statements (a) 1, 4 and 5 are relevant, irrelevant (b) 2, 3 and 4 are relevant, irrelevant (c) 3, 4 and 5 are relevant, irrelevant (d) 1, 2 and 3 are relevant, irrelevant

2 and 3 are 1 and 5 are 1 and 2 are 4 and 5 are

232. Consider the following statements: (A) In prokaryotic cell, an outgrowth of plasma membrane into the cell is called polysome (B) SER is major site for glycoprotein synthesis (C) RuBisCO is most abundent protein of biosphere (D) Mitochondria, chloroplasts and peroxisomes are not the part of endomembrane system Of the above statements: (a) B and D are the correct (b) A and D alone are correct (c) C and D alone are correct (d) A and B alone are correct

Ans. 220. (d) 221. (a) 222. (d) 223. (b) 224. (a) 225. (d) 226. (b) 227. (a) 228. (c) 229. (a) 230. (d) 231. (b) 232. (c)

The Plant Cell

233. Choose the wrong statements regarding bacterial cell: (A) Glycocalyx is the outer most envelop in bacteria (B) Glycocalyx could be a loose sheath called capsule (C) Glycocalyx may be thick and though slime layer (D) A special structure formed by the plasma membrane is called mesosome (E) Small bristle–like fibres sprouting out of the cell are called fimbriae (a) (C) and (D) are wrong (b) (B) and (C) are wrong (c) (A) and (C) are wrong (d) (A) and (D) are wrong 234. Among the following which is seen only prokaryotic cell? (a) DNA (b) ER (c) Dictysome (d) Mesosome 235. In which type of chromosome, one arm is very long and one arm is very short? (a) Telocentric (b) Submetacentric (c) Metacentric (d) Acrocentric 236. Prokaryotic ribosomes are: (a) 80 C (b) 70 S (c) 60 S (d) 50 S 237. Which is not found in prokaryotic cell? (a) Ribosomes (b) Cell wall (c) Nuclear membrane (d) Plasma membrane 238. The site of protein synthesis is: (a) DNA (b) Nucleus (c) Mitochondria (d) Ribosomes 239. Color of flower petals is due to: (a) Phycoerythrin (b) Anthocyanin (c) Carotenes (d) Xanthophyll

15

240. Chromosomes are concerned with: (a) Transmission of hereditary characters (b) Assimilation (c) Growth (b) Respiration 241. Plant cells are differs from animal cells by: (a) Absence of chlorophyll (b) Absence of cell wall (c) Presence of cell wall and chloroplasts (d) Presence of vacuoles 242. A chromosome with centromere nearer to one end forming shorter and longer arms is: (a) Telocentric (b) Acrocentric (c) Submetacentric (d) Metacentric 243. Axonemal arrangement of microtubules is: (a) 9 peripheral pairs of doublets and one central singlet (b) 9 peripheral pairs of doublets and one central pair of singlets (c) 6 peripheral pairs of doublets and one central singlet (d) 6 peripheral pairs of doublets and one central pair of singlets 244. Detailed structure of the membrane was studied after ther advent of electron microscope is: (a) 1990s (b) 1970s (c) 1950s (d) 1930s 245. Which cellular part is correctly described? (a) Lysosomes—Optimally active at 8.5 pH (b) Ribosomes—Those in chloroplasts are larger (80 S) while those in cytoplasm are maller (70 S) (c) Centrioles—Sites for active RNA synthesis (d) Thylakoids—Flatten of membranous sacs forming grana

Ans. 233. (b) 234. (d) 235. (d) 236. (b) 237. (c) 238. (d) 239. (b) 240. (a) 241. (c) 242. (c) 243. (b) 244. (c) 245. (d)

16

Plant Physiology: Question Bank

246. First successful tissue culture was that of: (a) Tomato root (b) Carrot root (c) Potato stem (d) Tobacco callus 247. Tissue-used by Steward et al (1957) to prove cellular totipotency was: (a) Pith of root (b) Pith of stem (c) Phloem of root (d) Phloem of stem 248. White performed successful tissue culture in: (a) 1939 (b) 1932 (c) 1929 (d) 1922 249. The smallest animal egg is that of: (a) Ostrich (b) Human female (c) Duck (d) Hen 250. Largest animal cell is that of: (a) Ostrich (b) Duck (c) Human (d) Hen 251. Human egg is larger than human sperm because it has: (a) Laisger nucleus (b) More membrane (c) More cytoplasm (d) All of the above 252. Larger sized organisms usually have: (a) Large sized cells (b) More noncellular material (c) Higher number of cells (d) More cellular excretions 253. Large cells have: (a) High metabolic rate (b) High respiration rate (c) Low surface: volume ratio (d) High surface: volume ratio 254. Metabolically activity cells have: (a) Lower nucleocytoplasmic ratio (b) Higher nucleocytoplasmic ratio (c) Higher surface volume ratio (d) Both (b) and (c) 255. Alga acetabularia is: (a) Unicellular prokaryote (b) Multicellular prokaryote

(c) Unicellular eukaryote (d) Multicellular eukaryote 256. Size of acetabularia is: (a) 10 cm (b) 10 mm (c) 1.0 mm (d) 0.1 mm 257. Largest cell of the human body is: (a) Voluntary muscle fibre cell (b) Nerve cell (c) Striated muscle fibre cell (d) Cardiac muscle fibre cell 258. Average weight of human body cells is: (a) 5–10 gm (b) 10–15 gm (c) 20–30 gm (d) 70–40 gm 259. Large plant cells are: (a) Xylem vessel cells (b) Parenchyma cells (c) Sieve tube cells (d) Sclerenchyma fibres 260. Jute fibres have a length of: (a) 30–40 mm (b) 300–400 mm (c) 30–90 cm (d) 3–9 m 261. Human egg has a volume larger than human sperm by: (a) 100,000 (b) 10,000 (c) 1000 (d) 100 262. Efficient large size cells should be: (a) Elongated (b) Branched (c) With membrane extensions (d) Any of the above 263. The term protoplasm was coined by: (a) Corti (b) Dujardin (c) Purkinje (d) Dutrochet 264. Names of Schleiden and Schwann are associated with: (a) Protoplasm as the physical basis of life (b) Cell theory (c) Theory of cell lineage (d) Nucleus functions as control center of cell

Ans. 246. (a) 247. (c) 248. (b) 249. (b) 250. (a) 251. (c) 252. (c) 253. (c) 254. (d) 255. (c) 256. (a) 257. (b) 258. (c) 259. (d) 260. (c) 261. (a) 262. (d) 263. (c) 264. (b)

The Plant Cell

17

265. Which is correct about cell theory in view of current status of our knowledge about cell structure (a) It needs modification due to discovery of subcellular structures like chloroplasts and mitochondria (b) Modified cell theory means that all living beings are composed of cells capable of reproducing (c) Cell theory does not hold good because all living beings (e.g. virus) do not have cellular organization (d) Cell theory means that all living objects consist of cells whether or not capable of reproducing

271. Letter S in the structural unit of ribosome denotes: (a) Concentration unit (b) Polymerization unit (c) Svedberg unit (d) Stability unit

266. Minimum cell size seen under light microscope is: (a) 1 µm (b) 0.1 pm (c) 0.25 gm (d) 0.5 gm

274. Cell theory was put forward by: (a) Schleiden and Schwann (b) Sutton and Boveri (c) Watson and Crick (d) Darwin and Wallace

267. An exception to cell theory is: (a) Mycoplasma (b) Virus (C) Protistans (d) Algae 268. Cellular totipotency means: (a) Synthesis of new cells (b) Formation of new species (c) Formation of new plants (d) Capability of a plant cell to form complete plant 269. Who proposed cell lineage/cell always arises from pre-existing cell? (a) Lamarck (b) Virchow (C) Schwann (d) Darwin 270. The suffix Sin ribosome unit indicates: (a) Sedimentation coefficient (b) Solubility (c) Surface area (d) Size

272. Nucleus was discovered by: (a) Robert Brown (b) Leeuwenhoek (c) Robert Hooke (d) Schleiden and Schwann 273. Purkinje coined the term protoplasm in: (a) 1739 (b) 1839 (c) 1779 (d) 1879

275. The term cell was coined by: (a) Robert Hooke (b) Leeuwenhoek (c) Schleiden and Schwann (d) Altmann and Kolliker 276. Figures of cork cells observed by Robert Hooke were published in (a) Genera Plantarum (b) Species Plantarum (c) Origin of species (d) Micrographia 277. The cells discovered in thin sections of cork by Robert Hooke were actually: (a) Cell walls (b) Cellulose (c) Protoplasm (d) Nuclei

Ans. 265. (c) 266. (c) 267. (b) 268. (d) 269. (b) 270. (a) 271. (c) 272. (a) 273. (b) 274. (a) 275. (a) 276. (d) 277. (a)

18

Plant Physiology: Question Bank

CHECK YOUR GRASP

1. The term chromatin was coined by: (a) Heitz (b) Flemming (c) Fontana (d) Bowman 2. Glyoxisomes occur in: (a) Leaf cells (b) Fatty seeds (c) Roots (d) Meristematic cells 3. Largest organelle of the cell is: (a) Nucleus (b) Chloroplast (c) Mitochondrion (d) Vacuole 4. Contractile vacuoles take part in: (a) Storage of wastes (b) Osmoregulation (c) Exretion (d) Both (b) and (c) 5. Most abundant lipid of cell membrane is (a) Cholesterol (b) Phospholipid (c) Glycolipid (d) Cerebroside 6. Balbiani rings are: (a) Uncoiling of chromonemata (b) Coiling of chromonemata (c) Enlargements of centromere (d) None of the above 7. Bacterial wall contains: (a) Cellulose (b) Peptidoglycan (c) Murein (d) Both (b) and (c) 8. ER is made of: (a) Cisternae (c) Vesicles

(b) Tubules (d) All the above

9. The term protoplast was coined by: (a) Strasburger (b) Hanstein (c) Butschli (d) Fischer 10. Secondary wall grows in thickness by: (a) Intercalation (b) Introgression (c) Accretion (d) Epiboly 11. Cell membrane is visible under: (a) Electron microscope (b) Optical microscope (c) Both optical and electron microscope (d) Oil immersion lens Ans.

1. (b) 12. (d)

2. (b) 13. (d)

3. (a) 14. (d)

4. (d) 15. (a)

5. (b) 16. (a)

12. Contractile vacuoles take part in: (a) Storage of wastes (b) Osmoregulation (c) Excretion (d) Both b and c 13. The concept of unity membrane was propounded by: (a) Overtion (b) Gorter and GRendel (c) Davson (d) Robertson 14. The term protoplasm was coined by: (a) Robert Hooke (b) Dujardin (c) Rober brown (d) Purkinje 15. Cell theory was put forward by: (a) Schleiden and Schwann (b) Sutton and Boveri (c) Watson and Crick (d) Darwin and Wallace 16. The term cell was coined by the cell was first seen by: (a) Robert Hooke (b) Leeuwenhoek (c) Schleiden and Schwann (d) Altmann and Kolliker 17. Svedberg unit is for : (a) Molecular weight (b) Density (c) Sedimentation coefficient (d) Surface tension 18. Plasmodesmata connections help in: (a) Synchronous mitotic divisions (b) Locomotion of unicellular organisms (c) Movement of substances between cells (d) Cytoplasmic streaming 19. Large plant cells are: (a) Xylem vessel cells (b) Parenchyma cells (c) Sieve tube cells (d) Sclerenchyma fibres 6. (a) 17. (c)

7. (d) 18. (c)

8. (d) 19. (c)

9. (b)

10. (c)

11. (d)

The Plant Cell

20. Study of the cell structure under microscope: (a) Cytology (b) Cell biology (c) Cytochemistry (d) Microanatomy 21. Study of cells in all aspects is: (a) Cytotaxonomy (b) Cytology (c) Cell biology (d) Cytochemistry 22. Schleiden and Schwann proposed cell theory: (a) 1836–37 (b) 1838–39 (c) 1901–02 (d) 1938–39 23. Minimum cell size seen under light microscope is: (a) 1¼ m (b) 0.1 ¼ m (c) 0.25¼ m (d) 0.5 ¼ m 24. The term microtubule was coined by: (a) De Robertis and Franchi (b) Mayer (c) Palade (d) Slautterback 25. Cellulose is stained blue with: (a) Phloroglucinol (b) Chlor-Zinc iodine (c) Eosin (d) Methylene blue 26. Who proposed that cell is a unit of life and that a tissue is made of cells? (a) Schleiden (b) Schwann (c) Dutrochet (d) Steward 27. Longest cells in human body are: (a) Nerve cells (b) Bone cells (c) Leg muscle cells (d) Heart muscle cells 28. A plant cell has potential to develop into full plant. The property is called: (a) Tissue culture (b) Pleuripotency (c) Totipotency (d) Gene cloning 29. Protoplasm forms percentage of total weight of the body: (a) 45% (b) 70% (c) 95% (d) 15% 30. According to cell theory: (a) Cells are fundamental structural units of organisms Ans.

20. (b) 31. (b)

21. (a) 32. (b)

22. (b) 33. (d)

23. (c) 34. (c)

24. (c) 35. (b)

19

(b) Cells reproduce (c) Cells are living (d) Cells have nuclei 31. Protoplasm is: (a) Emulsion (b) Complex colloidal solution (c) Molecular solution (d) Suspension 32. The term sarcode was used for living substance of cell by: (a) Hooke (b) Dujardin (c) Purkinje (d) Brown 33. Protoplasm present in cell is: (a) Nonliving matter (b) Bearer of hereditary characters (c) Living matter without function (d) Physical basis of life 34. The ability of a cell to form the whole organism is: (a) Regeneration (b) Cloning (c) Totipotency (d) Development 35. Schleiden and Schwann proposed cell theory in: (a) 1836–37 (b) 1838–39 (c) 1901–02 (d) 1938–39 36. An individual has a number of different types of cells was first stated by: (a) Dujardin (b) Robert Brown (c) Dutrochet (d) Schleiden and Schwann 37. Callus is: (a) Material used in healing in phloem (b) Secondary tissue developed by woody plants (c) An undifferentiated mass of cells (d) All of the above 38. Which one is enucleated? (a) Squamous epithelial cells (b) Mature leucocyte of man (c) Mature erythrocyte of frog (d) Mature erythrocyte of man 25. (d) 36. (c)

26. (b) 37. (c)

27. (a) 38. (d)

28. (c)

29. (c)

30. (a)

20

Plant Physiology: Question Bank

39. One of the following is anucleate: (a) Sieve tube (b) Companion cell (c) Medullary ray (d) All of the above 40. A cell can form many phenotypes. The property is called: (a) Pleuripotency (b) Totipotency (c) Parasexuality (d) Parthenogenesis 41. Living beings are made up of cells. This was first stated by: (a) Lamarck (b) von Helmont (c) Schleiden and Schwann (d) Hugo de Vries 42. In tissue culture embryoids are formed from pollen grains due to: (a) Test tube culture (b) Double fertilization (c) Cellular totipotency (d) Organogenesis 43. Cellular totipotency is demonstrated by: (a) Only gymnosperm cells (b) All plant cells (c) All eukaryotic cells (d) Only bacterial cells 44. Fertilization of an egg with sperm was discovered by: (a) Hertwig (b) Flemming (c) Waldeyer (d) Malpighi

Ans.

39. (a) 50. (b)

40. (a)

41. (a)

42. (c)

43. (b)

45. The volume of which of the following is given in right sequence? (a) Ostrich egg > Hen egg > Human egg > Smallest virus (b) Human egg > Ostrich > Smallest bacteria (c) Bacteria > Virus > Human sperm (d) Virus > Bacteria > Human sperm > Human egg 46. Basic unit of life is: (a) Cell (b) Tissue (c) Organ (d) Organ system 47. Cell is a unit of: (a) Structure (b) Function (c) Mass of protoplasm (d) All of the above 48. Study of the cell structure under microscope: (a) Cytology (b) Cell biology (c) Cytochemistry (d) Microanatomy 49. Study of cells in all aspects is: (a) Cytotaxonomy (b) Cytology (c) Cell biology (d) Cytochemistry 50. Cells were observed prior to Robert Hooke. (a) Aristole (b) Malpighi (c) Bauhin (d) Eicher Mark your score and evaluate yourself accordingly

44. (a)

45. (a)

46. (a)

47. (d)

48. (a)

49. (c)

Water Relation

21

2

Water Relation (c) Capillary water + hygroscopic water + gravitational water (d) None of the above 7. Amount of water held as thin film around soil particle due to strong force of attraction is known as: (a) Gravitational water (b) Hygroscopic water (c) Capillary water (d) None of the above

1. Instrument used to measure the water tension in soil is known as: (a) Photometer (b) Tensiometer (c) Porometer (d) None of these 2. Water available for plants is known as: (a) Echard (b) Chesard (c) Both A and B (d) None of these 3. The amount of water held in crystal structure of mineral in soil is called: (a) Chemically bounded water (b) Water of crystallization (c) Combined water (d) All of these

8. When a cell is placed in 2% NaCl then its size remains unchanged, if such cell is placed in 2% glucose solution then its size will: (a) Decrease (b) Increase (c) Unchanged (d) None of these 9. When a cell is placed in 5% glucose solution then its size remains unchanged, if such cell is placed in 5% NaCl solution then its size will: (a) Decrease (b) Increase (c) Unchanged (d) None of these 10. When a cell is placed in hypotonic solution then its size: (a) Decreases (b) Increases (c) Unchanged (d) None of these 11. When a cell is placed in isotonic solution then its size: (a) Decreases (b) Increases (c) Remain unchanged (d) None of these

4. Echard of field capacity is: (a) Gravitational water (b) Hygroscopic water (c) Capillary water (d) None of the above 5. Chesard is: (a) Hygroscopic water + gravitational water (b) Capillary water + gravitational water (c) Capillary water (d) None of the above 6. Holard is: (a) Hygroscopic water + gravitational water (b) Capillary water + hygroscopic water Ans.

1. (b)

2. (b)

3. (d)

4. (b)

5. (c)

6. (c) 21

7. (b)

8. (b)

9. (a)

10. (b)

11. (c)

22

Plant Physiology: Question Bank

12. When a cell is placed in hypertonic solution which of the following is possible: (a) Turgidity (b) Endosmosis (c) Deplasmolysis (d) All of these

19. Osmotic movement of water from cell to outside resulting in net loss of the water to cell is known as: (a) Endomosis (b) Osmosis (c) Exosmosis (d) None of these

13. After plasmolysis which of the following is present in between protoplast and cell wall? (a) Solution (b) Solvent (c) Solute (d) None of these

20. If a cell is placed in hypertonic solution which of the following is possible: (a) Cytorrhysis (b) Exosmosis (c) Plasmolysis (d) All of these

14. Complete shrinkage of protoplast and almost no connection of protoplast with the cell wall are known as: (a) Evident plasmolysis (b) Complete plasmolysis (c) Both A and B (d) None of these

21. To make DPD equal to OP the cell should be placed in: (a) Hypertonic solution (b) Isotonic solution (c) Hypotonic solution (d) None of the above

15. What is the type of incipient plasmolysis on the basis of shape of protoplast? (a) Convex plasmolysis (b) Cap plasmolysis (c) Concave plasmolysis (d) All of the above

22. To make the value of OP equal to TP a cell should be placed in: (a) Hypertonic solution (b) Isotonic solution (c) Hypotonic solution (d) None of the above

16. Shrinkage of protoplast is followed by separation of protoplast and cell wall but connection between protoplast and cell wall remains maintained at many point, and this plasmolysis is known as: (a) Cytorrhysis (b) Incipient plasmolysis (c) Evident plasmolysis (d) None of the above 17. Earliest stage of plasmolysis in plant cell is: (a) Incipient plasmolysis (b) Cap plasmolysis (c) Tonoplast plasmolysis (d) None of the above 18. Cytological effect of exosmosis resulting in shrinkage of protoplast of cell is known as: (a) Exosmosis (b) Plasmolysis (c) Flaccidity (d) None of these Ans.

12. (d) 22. (c)

13. (a) 23. (b)

14. (c) 24. (c)

15. (d)

16. (b)

23. If turgor pressure of two cells is equal but osmotic pressure is unequal then fellow of water occurs from: (a) Higher OP to lower OP (b) Lower OP to higher OP (c) Both A and B (d) None of these 24. If concentration of cell (soln) A and B is unequal or if cell A and B is heterotonic then which of the following is possible: (a) Flow of water from hypo- to hyperconcentration (b) Flow of the water from low DPD to high DPD (c) Both A and B (d) None of these 25. If DPD of cell (soln) A and B is equal then which of the following is possible? (a) Exchange of water molecule in equal quantity between A and B is possible 17. (c)

18. (b)

19. (c)

20. (d)

21. (a)

Water Relation

(a) Osmosis (c) Imbibitions

(b) Net flow of water is zero (c) Net flow of water A to B (d) Both (a) and (b) are correct (e) Both (c) and (d) are correct 26. If water is osmotically removed from a cell then: (a) DPD is increases (b) Osmotic pressure increases (c) Wall pressure decreases (d) All of the above 27. If water enters osmotically into a cell (plant) from outside then: (a) DPD is increases (b) Osmotic pressure increases (c) Wall pressure decreases (d) All of the above 28. DPD = ...... (a) Another name for suction pressure (b) 1/suction pressure (c) Suction pressure (d) None of the above 29. Chose the correct equation: (a) DPD = OP × TP (b) DPD = OP – TP (c) DPD = OP + TP (d) None of these 30. DPD term was coined by: (a) Rennor (b) Went (c) Mayer (d) None of these 31. If both plant and animal cells are placed in equally hypotonic solutions then which of the following will burst easily? (a) Plant cell (b) Animal cell (c) Both A and B (d) None of these

23

(b) Diffusion (d) All of these

34. Which of the following does not represent imbibition? (a) Wood kept in ethanol (b) Rubber kept in water (c) Rubber kept in kerosene (d) None of the above 35. What are the characters of imbibition? (a) Development of the pressure (b) In course of imbibitions the volume of system increases or swelling occurs (c) During the process of imbibition there is production of heat (d) All of the above 36. Imbibition involves: (a) Adsorption (b) Diffusion (c) Capillary action (d) All of these 37. Adsorption of water on hydrophilic substance is called: (a) Capillary action (b) Imbibition (c) Diffusion (d) More than one 38. During imbibition movement of water molecule up to the hydrophilic particle of imbibant occurs by: (a) Capillary action (b) Diffusion (c) Both (a) and (b) (d) None of these

32. In between isotonic solution net flow of water is not possible but exchange of water in the equal amount is possible. This statement is: (a) False (b) True (c) Not known (d) None of these

39. After imbibition water is held between and over the surface of hydrophilic particle of imbibant through: (a) Adsorption only (b) Capillary action only (c) Both A and B (d) None of these

33. If water enters (move) into a plant cell from outer side up to cell sap of vacuole then which of the following process will occur?

40. During the process of imbibition, water is known as: (a) Imbibant (b) Imbibed (c) Not known (d) None of these

Ans.

25. (e) 36. (d)

26. (d) 37. (b)

27. (d) 38. (c)

28. (a) 39. (c)

29. (b) 40. (b)

30. (c)

31. (b)

32. (b)

33. (d)

34. (d)

35. (d)

24

Plant Physiology: Question Bank

41. Imbibition is absorption of water/ liquid by solid substance ...... forming solution: (a) With (b) Without (c) Both (a) and (b) (d) None of these 42. What are the properties of water? (a) It has high dielectric constant (b) Water is a polar compound (c) It has more surface tension (d) All of the above 43. Consumptive use coefficient (K)= (a) Potential evapotranspiration + Actual evapotranspiration (b) Actual evapotranspiration/potential evapotranspiration (c) Potential evapotranspiration/ actual evapotranspiration (d) None of the above 44. The rate of diffusion increases if: (a) The temperature is increase (b) Density of diffusing particle is lesser (c) Both A and B (d) None of the above 45. The movement of particle from a region of higher concentration to its lower concentration is known as: (a) Inhibition (b) Osmosis (c) Diffusion (d) None of these 46. In ice, water molecules from a: (a) Triangular structure (b) Tetrahydral structure (c) Quadrangular structure (d) None of these 47. Which of the following statements is correct about diffusion? (a) It is very rapid over long distances (b) It requires an expenditure of energy by the cell (c) It is a passive process (d) It occurs when molecules move from a region of lower concentration to one of higher concentration Ans.

41. (b)

42. (d)

43. (b)

44. (c)

45. (c)

48. Osmosis is a form of diffusion in which: (a) The solute moves freely from a region of higher concentration to one of higher concentration through a semipermeable membrane (b) The solvent moves through a semi permeable membrane from region, where a solute is in higher concentration to region of lower concentration (c) The solvent moves through a semipermeable membrane from higher solvent concentration to lower solvent concentration (d) Solute as well as solvent moves freely from a region of higher concentration to one of higher concentration through a semipermeable membrane 49. I place a cell in a solution. Over a period of time, I notice that the cell shrinks, as if it is losing water which of the following seems likely? (a) The solution is a strong buffer (b) The solution is an acid (c) The solution has more dissolved solutes than the cell does (d) The solution has more dissolved solutes than the cell does 50. Water potential: (a) Of a solution is always greater than for pure water (b) Is the potential energy of water in a system (c) Is a measure of the level of the active movement of water a system (d) Is never zero 51. If a plant cell is placed in deionised water the potential of that cell becomes: (a) More positive because the pressure potential becomes more positive (b) More positive because the osmotic potential becomes more negative 46. (b)

47. (c)

48. (c)

49. (c)

50. (b)

Water Relation

(c) More positive because the pressure potential becomes more negative (d) Less negative because the pressure potential becomes more positive 52. The sap of a plant cell has an osmotic potential of –10 bars and there is a wall pressure of 2 bars. When this cell is placed in a solution with an osmotic potential of –3 bars the force causing water to enter the cell is: (a) –8 bar (b) –7 bar (c) –5 bar (d) –3 bar 53. A root cortex cell has a solute potential of –0.5 MPa. The water potential of the soil is –0.3 MPa. At what turgor pressure would the root cortex cell no longer take up water? (a) 0 MPa (b) –0.15 MPa (c) +0.15 MPa (d) +0.2 MPa 54. A limp lettuce leaf has an osmotic potential = –4 MPa. The lettuce leaf is placed into a beaker of pure water. When the cells of the lettuce leaf are fully turgid the water potential of the leaf cells will be: (a) +4 MPa (b) +8 MPa (c) –4 MPa (d) 0.0 MPa 55. Space between cell wall and plasma membrane in a plasmolysed cell is occupied by: (a) Pure water (b) Air (c) Cell sap (d) Plasmolysing solution 56. In a flaccid cell: (a) DPD = OP (c) DPD = OP-TP

(b) DPD = TP (d) None

57. A cell at incipient plasmolysis, with a solute potential of –2000 KPa, is placed in a solution of water potential –1200 KPa. The direction of flow of water will be: (a) From cell to solution (b) From solution to cell (c) Data incomplete (d) No flow of water Ans.

51. (d) 62. (c)

52. (c)

53. (d)

54. (d)

55. (d)

25

58. If both leaf water potential and leaf osmotic potential in mid afternoon on a hot summer day equals 15 bars: (a) The leaf is probably wilted (b) The whole plant is at the permanent point (c) Leaf cells have highest wall pressure (d) The soil is at the plant’s permanent wilted point 59. Which of the following plays no role in the movement of water through the xylem of plants? (a) Capillarity (b) Root pressure (c) HVATPase pump at the xylem element membrane (d) Transpirational pull 60. Water cohesion: (a) Creates the pulling force which pulls water upward in the xylem (b) Causes water to move from the xylem into the phloem in response to differences in water concentration (c) Is an energy requiring process (d) Is responsible for making the column of water 61. The class of water in the soil, that provides most of the water of plants and is thus the most important, is: (a) Gravitational (b) Field capacity (c) Capillary (d) Hygroscopic 62. Halophytes such as mangroves meet high osmotic pressures in the soil. They overcome the problem of water uptake by (a) Increase in the root to shoot ratio (b) Reduction in the number of stomata to reduce transpiration (c) Accumulation of electrolytes in the vacuoles (d) Growth at relatively high humidity to reduce transpiration 56. (a)

57. (b)

58. (a)

59. (c)

60. (d)

61. (c)

26

Plant Physiology: Question Bank

63. Root pressure is a/an: (a) Nonosmotic phenomenon (b) Osmotic phenomenon (c) Positive hydrostatic pressure (d) More than one correct

(c) Rigid cell wall, living cell membrane, and walls absent (d) Flexible cell wall, nucleus anchored to the cell membrane, end walls present

64. Which of the following statement is correct? (a) Members of gymnosperm show high root pressure (b) Actively transpiring plants show high root pressure (c) Root pressure is mainly responsible for ascent of sap (d) None 65. Transpiration pull depends on: (a) Adhesion of water molecules to the walls of phloem cells (b) Capillarity (c) The very negative water potential of the atmosphere (d) Cohesion of water molecules to each other 66. The source of energy driving the transport of water through the xylem is: (a) ATP produced by photosynthesis (b) ATP generated by respiration (c) The sun (d) Transpiration 67. The water within xylem vessels moves toward the top of a tree (long distances) as a result of: (a) Atmospheric pressure on roots (b) Active transport of ions into the vascular (c) Evaporation of water through stoma (d) The force of root pressure 68. Which combination of characteristic of a vessel element is most important for water movement in the xylem? (a) Rigid cell wall, cell death at maturity, end walls absent (b) Rigid cell wall, reduction in size of plastids and mitochondria, end walls present Ans.

63. (d)

64. (d)

65. (c)

66. (c)

67. (c)

69. Which of the following properties of water is most directly related to its ability to rise in the capillary spaces of plants? (a) Neutral pH (b) High density (c) Low compressibility (d) High surface tension 70. Which of the following observations shows that ion uptake in plants is energy dependent? (a) Ion uptake shows saturation kinetics (b) Ion uptake rates are different for different ions (c) Some ions accumulate against a concentration gradient (d) Some ions enter the symplast before reaching the endodermis 71. How does a plant accumulate ions from the soil, which has a lower concentration than that in the plant? (a) Applies pressure to push ions into the cell (b) Applies tension to pull the ions into the cell (c) Expends energy to transport ions against concentration gradient (d) Roots grow around soil particles trapping the ions in a cell 72. Which statement about the function of the casparian strip is correct? (a) It prevents excess transpiration from leaves (b) It regulates ions movement into root vascular cylinder (c) It prevent disease causing organisms from invading the plant (d) It is the pathway for nutrient transfer from xylem to phloem 68. (c)

69. (d)

70. (c)

71. (c)

72. (b)

Water Relation

73. Mark the correct statements: (a) Resistance to water flow in root cortex will be higher for symplastic pathway (b) Major pathway followed by ions from the epidermis to tracheary element of root is symplastic (c) The casparian strip prohibits H2O from passing through the apoplast (d) Absorption of ions in plants is controlled by carriers and pumps (e) All of these 74. Ion absorption by plant roots: (a) Can be explained by the nutrient — carrier hypothesis (b) Is basically ions passively soaking in root cells along with soil water (c) Explains the movement of ions from a dilute soil solution into a more concentrated solution (d) More than one correct 75. When a cell membrane moves substances from a region of lower concentration to a region or higher concentration, and expends energy in the process, this type of movement is called: (a) Osmosis (b) Diffusion (c) Active transport (d) Facilitate diffusion 76. Ion absorption by symplast occurs: (a) Passively by facilitated diffusion (b) Actively by primary and secondary active transport (c) Passively by free diffusion (d) Both a and b 77. In plant roots, the casparian strip is correctly described by which of the following? (a) It is located in the walls between endodermal cells and cortex cells (b) It provides energy for the active transport of minerals into the vascular bundle from the cortex (c) It ensures that all minerals are absorbed from the soil in equal amounts Ans.

73. (e) 84. (a)

74. (d)

75. (c)

76. (d)

77. (d)

27

(d) It ensures that all water and dissolved substances must pass through a cell before entering the vascular bundle 78. Ion transport in root occurs: (a) Passively through channels (b) Actively through channels (c) Actively through carriers (d) Through both symplast apoplast (e) (a), (b) and (c) are correct

and

79. Ion channels: (a) Always require ATP in order to function (b) Are always open (c) Are integral membrane proteins (d) Are responsible for the selective permeability of a membrane (e) (c) and (d) 80. The casparian strip (a) Limits the pathway available to water and solutes, forcing them to enter the symplast (b) Surrounds the root vascular tissue (c) Allows water to move down a water potential gradient (d) Is made of suberin (e) All of these 81. Water potential of soil at field capacity is: (a) – 0.3 bars (b) –4 bars (c) –6 bars (d) –8 bars 82. Maximum density of water is exist as: (b) 4oC (a) 0oC (c) 40°C (d) 100oC 83. Water potential of chemically pure water is: (a) –0.1 MPa (b) –0.5 MPa (c) –1MPa (d) Zero 84. Purple cabbage leaves do not lose their color in cold water but do so in boiling water because: (a) The plasma membrane gets killed in boiling water 78. (e)

79. (e)

80. (e)

81. (a)

82. (b)

83. (d)

28

Plant Physiology: Question Bank

(b) The cell is killed in boiling water (c) The pigment is not soluble in cold water (d) The cell is killed in cold water 85. Osmosis involves: (a) Cell to cell movement of water (b) Movement of water through cortical cells (c) Active absorption of water through (d) All of these 86. In osmosis, solvent flows from: (a) Its lower concentration to its higher concentration (b) Its higher concentration to its lower concentration (c) Its higher concentration to its higher concentration (d) None of these 87. Osmotic pressure is highest in: (a) Hydrophyte (b) Halophytes (c) Xerophytes (d) Mesophyte 88. The real force leading to the entry of water into a cell from other cell is: (a) Diffusion pressure deficit (b) Turgor pressure (c) Wall pressure (d) Osmotic pressure 89. The value of DPD of a cell is: (a) OP × TP (b) OP + TP (c) OP – TP (d) None of these 90. When all cell is fully turgid, which of the following is zero? (a) Osmotic pressure (b) Turgor pressure (c) Diffusion pressure deficit (d) None of these 91. The maximum value of DPD is equal to: (a) FP (b) WP (c) OP (d) All of these 92. In a plasmolyzed cell, the DPD is: (a) Equal to OP (b) Zero (c) Less than WP (d) Squall to WP Ans.

85. (d) 96. (a)

86. (b) 97. (d)

87. (b) 98. (b)

88. (a) 89. (c) 99. (a) 100. (d)

93. If a cell with OP = 5 and TP = 4 is surrounded by cell with OP = 3 and TP = 1, what will be the direction of water movement? (a) From cell A to other cells (b) From other cells to cell A (c) Water will move up (d) Water will not move up 94. Which of the following is correct? (a) DPE = OP × WP (b) WP = OP – DPD (c) OP = WP – DPP (d) DPD = WP – OP 95. Osmotic pressure depends upon: (a) Concentration of solute (b) Concentration of solvent (c) Ionization of solute (d) Temperature (e) (a), (c) and (d) 96. Water potential can be obtained by: (a) TP – OP (b) OP = WP (c) OP – TP (d) OP – DPD 97. Osmotic pontential of a solution is always: (a) Positive (b) Equal (c) Variable (d) Negative 98. Root pressure is maximum when: (a) T/A ratio is higher (b) T/A ratio is lower (c) T/A relation is equal (d) None of these 99. The cohesive force of water is due to: (a) H-bond (b) O-bond (c) OH-bond (d) C-bond 100. Field capacity includes: (a) Capillary water (b) Hygroscopic water (c) Gravitational water (d) Both (a) and (b) 101. Water will be absorbed by root hairs when: (a) Concentration of salts in the soil is high 90. (c)

91. (c)

92. (a)

93. (a)

94. (b)

95. (e)

Water Relation

(b) Concentration of solutes in the cell sap is high (c) The plant is rapidly respiring (d) They are separated from the soil by a semipermeable membrane 102. Root cap has no role in absorption because it has: (a) No direct connection with vascular system (b) Loosely arranged cells (c) No cells containing chloroplasts (d) No root hair 103. The path of water and solutes from the soil to the conducting tissue of the root is: (a) Soil–root hair–cortex–endodermis– pericycle–protoxylem–phloem (b) Soil–root hair–cortex–pericycle– endodermis–protoxylem–metaxylem (c) Soil–epidermal cells of the root– cortex–endodermis–pericycle– protoxylem–metaxylem–secondary xylem (d) Soil–root hair–cortex–endodermis– pericycle protoxylem–metaxylem 104. Form of water available to the plants is: (a) Run off water (b) Gravitational water (c) Hygroscopic water (d) Capillary water 105. Physiological dryness of soil can be defined as: (a) Actual shortage of water in the soil (b) No shortage of water but plant’s inability to avail this water of soil (c) Amount of water which does not support plant growth (d) Shortage of hygroscopic water in the soil 106. The function of root cap in plant is to: (a) Protect the growing apices (b) Act as budder

29

(c) Protect the growing apices and act like buffer (d) Pierce soil 107. In hydrophytes: (a) Root caps are well-developed (b) Root caps are not well-developed (c) Root pockets are found (d) None of the above 108. Water absorption in plants takes place in: (a) Meristematic zone (b) Elongation zone (c) Root hair zone (d) Zone differentiation 109. Water absorption in conifers takes place through: (a) Root hair (b) Mycorrhiza (c) Root pockets (d) All of the above 110. During active water absorption energy is supplied from: (a) Respiration (b) Photorespiration (c) Photosynthesis (d) All of the above processes 111. Which of the following is responsible for passive absorption of water in tall plants? (a) Root activity (b) Root pressure (c) Transpiration pull (d) Diffusion 112. The main source of water for the soil is: (a) Precipitation (b) Capillary water (c) Gravitational water (d) Estuarine water 113. Wilting of plants occurs when: (a) Xylem is removed (b) Phloem is removed (c) Both xylem and phloem are removed (d) Pith is removed

Ans. 101. (b) 102. (d) 103. (d) 104. (d) 105. (b) 106. (c) 107. (c) 108. (c) 109. (b) 110. (a) 111. (c) 112. (a) 113. (a)

30

Plant Physiology: Question Bank

114. Water absorption by roots is increased due to increase in: (a) Transpiration (b) Photosynthesis (c) Respiration (d) None 115. Water is absorbed passively by root hair when the external medium is: (a) Hypotonic (b) Hypertonic (c) Isotonic (d) Viscous 116. Root hair are formed in the zone of: (a) Cell division (b) Cell elongation (c) Cell maturation (d) Cell differentiation 117. The chief function of vessels in the plant body is: (a) Food translocation (b) Conduct water and minerals (c) Eliminate excess of water (d) Provide mechanical strength 118. Water held tightly by the soil particles around them is known as: (a) Field capacity (b) Runway water (c) Hygroscopic water (d) Chemically combined water 119. Water logged sensitive plants, when subjected to water logged condition, get physiologically dry because: (a) Capillary force does not operate (b) Oxygen is not available to roots (c) Phloem translocation is badly hampered (d) More water is absorbed 120. Temporary wilting occurs due to: (a) Atmospheric condition (b) Soil condition (c) Both atmospheric and soil condition (d) None of the above 121. Permanent wilting occurs due to: (a) Atmospheric condition (b) Both atmospheric and soil condition (c) Soil condition (d) None 122. Which of the following soil has highest water holding capacity?

(a) Sand (c) Silt

(b) Clay (d) Gravel

123. Which of the following has highest oxygen penetration? (a) Sand (b) Silt (c) Clay (d) Loam 124. Movement of water from distal part of root hair to proximal part in soil occurs along: (a) Matrix potential gradient (b) Water potential gradient (c) Pressure potential gradient (d) Osmotic potential gradient 125. Apoplastic movement of water refers to: (a) Movement of water from one cell to another (b) Movement of water from intercellular spaces (c) Movement of water through endodermis (d) All of the above 126. Water absorption is maximum at temperature: (a) 20–30°C (b) 30–40°C (c) 10–20°C (d) 5–20°C 127. Orchids absorb water through: (a) Root hair (b) Mycorrhiza (c) Velamen tissues (d) Leaves directly 128. Active absorption of water generally occurs: (a) In the situation of water stress (b) When rate of transpiration is low (c) Both (a) and (b) (d) None of the above 129. According to Atkin: (a) Entire root functions as permeable membrane (b) Entire root functions as permeable membrane (c) Only endodermis functions as differentially permeable membrane (d) Only cortex functions as differentially permeable membrane

Ans. 114. (a) 115. (a) 116. (c) 117. (b) 118. (c) 119. (b) 120. (a) 121. (c) 122. (b) 123. (a) 124. (a) 125. (b) 126. (a) 127. (c) 128. (c) 129. (a)

Water Relation

130. According to Priestley: (a) Entire root functions as differentially permeable membrane (b) Endodermis functions as differentially permeable membrane (c) Cortex functions as differentially permeable membrane (d) Exodermis functions as differentially permeable membrane 131. More water absorption occurs in: (a) Aerobic condition (b) Anaerobic condition (c) Foggy days (d) Polluted condition 132. Which of the following is an active theory of water upliftment? (a) Capillary theory (b) Imbibitional theory (c) Pulsation theory (d) Transpiration pull theory 133. Root pressure is maximum when: (a) Transpiration is high and absorption is very low (b) Transpiration is very low and absorption is very high (c) Absorption is very high and transpiration is also very high (d) Absorption is low and transpiration is also very low 134. Ascent of sap in tall trees occurs mainly due to: (a) Metabolic activity in xylem cells (b) Root pressure (c) Capillarity rise in xylem open pipes (d) Transpiration pull and cohesion of water molecules 135. Which of the following is most widely accepted explanation for ascent of sap? (a) Capillarity (b) Atmospheric pressure (c) Pulsation theory (d) Transpiration pull theory

31

136. Quiescent center is found in: (a) Root (b) Shoots (c) Leaf (d) Flower 137. Relay pump theory of sap upliftment was proposed by: (a) Godlewski (b) J C Bose (c) Dixon (d) Sachs 138. Girdling experiment in plants was first performed by: (a) Malpighi (b) Strasburger (c) Dixon (d) Curtis 139. Water absorbed by roots reaches the top of a tall tree by means of: (a) Root pressure (b) Capillary force (c) Transpirational pull and cohesion of water molecules (d) Pulsation and imbibition 140. Sap rises in the wood of a plant due to root pressure and: (a) Capillary force (b) Cohesive force (c) Tension cohesion (d) Imbibition force 141. Conduction of sap in plants occurs through: (a) Heart wood (b) Sapwood (c) Xylem (d) All the above 142. Conduction of sap in old plants where heart wood gets decayed occurs through: (a) Outermost annual rings (b) Innermost annual rings (c) Entire sap wood (d) Phloem cells 143. Flowers cut under water remain fresh for a long-time because: (a) They have sufficient supply of water (b) Water column is not blocked by air bubbles (c) These transpire very rapidly (d) There is no vascular supply to the leaf

Ans. 130. (b) 131. (a) 132. (c) 133. (b) 134. (d) 135. (d) 136. (a) 137. (a) 138. (a) 139. (c) 140. (c) 141. (c) 142. (a) 143. (b)

32

Plant Physiology: Question Bank

144. Imbibition theory for ‘ascent of sap’ is not acceptable because: (a) Water moves actually through lumen of xylem and not through xylem walls (b) It involves expenditure of energy (c) Sap rises along the walls of living cells of xylem (d) Sap moves through xylem walls and not through xylem lumen 145. Match list–I with list–II and select the correct answer using the codes given below the lists:

A. B.

C. D.

List–I (Significance of the phenomenon in cell water relation) Degree of hydration of protoplasm Stretches cell walls and and may lead to their enlargement if the walls are sufficiently plastic Increases the free energy of water molecule Indicates the direction of diffusion of water

Codes: A B C D (a) 3 4 2 1 (c) 4 3 1 2

List–II (Quantity) 1. Wall Pressure 2. Water Potential

A. B. C. D.

4. Osmotic Potential

A B C D (b) 4 1 2 3 (d) 1 3 2 4

Codes: A B C D (a) 4 1 2 3 (c) 1 4 2 3

1. 2. 3. 4.

148. Match list–I with list–II and select the correct answer using the codes given below the lists: List–I A. Field capacity

List–II 1. Forces which hold water to the soil B. Permanent wilting 2. Combined effect of accelerated water loss and retarded water absorption C. Water deficit 3. Water content of a soil D. Soil moisture 4. Loss of water from plant with little chance of regaining turgidity

Codes: A B C D (a) 3 1 2 4 (c) 1 2 3 4

3. Turgor Pressure

146. Match list–I with list–II and select the correct answer using the codes given below the lists: List–I (Essential element) Boron Copper Iron Zinc

III. Up the water potential gradient IV. Actively V. Passively (a) II and IV are the correct (b) I and IV are the correct (c) II and III are the correct (d) I and III are the correct

List–II (Deficiency symptom) Die–Back disease Interveinal chlorosis Little leaf disease Terminal leaf necrosis

A B C D (b) 4 1 3 2 (d) 1 4 3 2

147. Consider the following statements: I. Down the water potential gradient II. Up the water potential gradient

A B C D (b) 2 4 3 1 (d) 3 4 2 1

149. Match list–I (essential elements) with list–II (their respective roles) and select the correct answer using the codes given below the lists: List–I A. Chlorine B. Copper

List–II 1. Constituent of plastocyanin 2. Constituent of nitrate reductase C. Molybdenum 3. Constituent of alcohol dehydrogenase D. Zinc 4. Required for O2 evolution 5. Required for phosphate transfer

Codes: A B C D (a) 4 1 2 3 (c) 1 2 5 3

A B C D (b) 1 4 5 2 (d) 4 1 3 2

150. Match list–I with list–II and select the correct answer using the codes given below the lists: List–I A. Chloride

Ans. 144. (a) 145. (d) 146. (a) 147. (b) 148. (d) 149. (a)

List–II 1. Essential for the biosynthesis of indolent–3–acetic acid

Water Relation B. Zinc C. Boron

2. Enzyme activator for photolysis 3. Necessary for translocation of sugars

Codes: A B C (a) 3 1 2 (c) 2 1 3

A B C (b) 2 3 1 (d) 1 2 3

151. Which of the following is not a difference between sugar translocation in phloem (sieve tubes) and water movement in the xylem (vessels or tracheids)? (a) Sieve rubes are living cells, while mature xylem is dead (b) Sugar translocation is a metabolically active process, while water movement is entirely passive (c) Pressure is positive in sieve tubes, while xylem is usually under tension (d) All of the above 152. The negative impact of non-living factors organisms in a specific environment, is called: (a) Stratification (b) Fecundity (c) Biotic stress (d) Abiotic stress 153. Transport of the products of photosynthesis is throughout to occur by a pressure flow through the sieve tubes of the phloem from a source to a sink which of the following statements about phloem transport is false: (a) Solutes are swept along by the bulk flow of water in the sieve tube (b) Water and solutes move through the sieve tubes along a pressure gradient (c) Sieve tube in a source has a low hydrostatic pressure (d) Water enters the sieve tubes by osmosis 154. Which of the following observation provides direct support the Minch’s hypothesis?

33

(a) The osmotic potential of the sieve tubes in a root tip is more negative than that of in the leaf (b) Carbohydrates move within the plant from sink to source (c) Transpiration occurs from open stomata on leaves and stems during the day (d) Turgor pressure in the sieve tubes of a fully expanded tomato leaf is higher than the Turgor in the sieve tubes of a developing tomato fruit 155. If a plant cell is placed in demonized water the water potential of that cell becomes: (a) Less negative because the pressure potential becomes more positive (b) More negative because the pressure potential becomes more negative (c) More positive because the osmotic potential becomes more negative (d) More positive because the pressure potential become more positive 156. A plant’s is first line of defense against abiotic stress lines in its: (a) Leaf Apex (b) Stem (c) Root (d) Leaf 157. Abiotic stressors include: (a) Extreme temperature (b) High winds (c) Drought (d) All of the above 158. Worldwide abiotic stress is the most harmful factor concerning: (a) The productivity of the crops (b) The growth of the crops (c) Both A and B (d) None of these 159. Biotic stress includes living disturbances as: (a) Green plants (b) Fungi (c) Insects (d) Both B and C 160. The non-living variable must be influence the:

Ans. 150. (c) 151. (b) 152. (d) 153. (c) 154. (d) 155. (a) 156. (c) 157. (d) 158. (c) 159. (d)

34

Plant Physiology: Question Bank

(a) Environment (b) Tissue formation (c) Cell constituent (d) Both (b) and (c) 161. Various physiological responses of Arbidopsis upon expresser to salinity is an example of: (a) Plant movement (b) Response towards stress (c) Hormonal control (d) None of the above 162. If both leaf water potential and leaf osmotic potential in mid afternoon on a hot summer day equal –15 bars: (a) The soil is at the plant’s permanent wilting point (b) Leaf cells have highest wall pressure (c) The whole plant is at the permanent wilting points (d) The leaf is probably willed 163. Halophytes such as mangroves meet high osmotic pressure on the soil. They overcome the problem of water uptake by: (a) Growth at relatively high humidity to reduce the transpiration (b) Accumulation of electrolytes in the vacuoles (c) Reduction in the number of stomata to reduce transpiration (d) Increase in the root to shoot ratio 164. Plant phenolics are biosynthesized by: (a) Malonic acid pathway (b) Shikimic acid pathway (c) Both (a) and (b) (d) None of these 165. Which of the following statement is false regarding secondary metabolite? (a) Secondary metabolites do not have nutrient characteristics for human being (b) Secondary metabolite is of no use in the human physiology

(c) They severe various functions like protection against plants, as coloring, scent or attractants and as the plant’s own hormones (d) These are exclusively produced by plants 166. Find out the unmatched one: Metabolite Compartment (a) Brassilexin Antifungal toxin (b) Rutin Visual pollinator attractant (c) Rotenone Insect feeding deterrent (d) DIMNOA Olfactory pollinator attractant 167. Which of the following statement proves the hypothesis that secondary metabolites are not a waste product to plants? (a) Tight spatial and temporal regulation of SMs biosynthesis (b) Production of SMs in young tissues (c) Plants are autotrophs and waste products are typical and needed for heterotrophic animals that cannot degrade their food completely for energy production (d) All of those 168. Rubber is an example of: (a) Protective component or plants (b) Non useful for human (c) An essential compound to plant (d) Secondary metabolites 169. Water soluble secondary metabolites are generally stored in: (a) Trichomes (b) Vacuole (c) Resin ducts (d) Glandular hairs 170. Find out the mismatched pair: Metabolite Component (a) Chloroplast Alkaloid and terpenoids (b) Vesicles Protoberberines

Ans. 160. (a) 161. (b) 162. (d) 163. (b) 164. (c) 165. (b) 166. (d) 167. (d) 168. (d) 169. (b) 170. (c)

Water Relation

(c) ER

Hydrophilic compounds (d) Mitochondria Some amine and alkaloids 171. 29000 terpenes derived from the isopentenyl diphosphate (IPP) precursor which is ......, in nature: (a) C6 (b) C5 (c) C4 (d) C3 172. Which of the following is an example of secondary metabolites? (a) Pipecolic acid (b) Abietic acid (c) Kaurenoic acid (d) Both (a) and (b) 173. Alkaloids and flavonoids are derived from: (a) 6–Deoxyxylulose (b) Aliphatic amino acid (c) Aromatic amino acid (d) Hydroxyl benzoic acid 174. Which of the following is derived as a product of Shikimate pathway? (a) Aliphatic amino acid (b) Aromatic amino acid (c) Hydroxyl benzoic acid (d) Both (b) and (c) 175. Isoprenoids, alkaloids and flavonoids are the example of: (a) Plant scents (b) Plant hormones (c) Secondary metabolites (d) Essential nutrients 176. Pressure developed on cell wall of the plant cell caused by osmotic movement of water is called: (a) DPD (b) Suction pressure (c) Osmotic pressure (d) Turgor pressure

35

(a) Hypertonic solution (b) Hypotonic solution (c) Isotonic solution (d) Strong solution 179. Which of the following will be zero in a fully turgid cell? (a) Imbibitional pressure (b) Turgor pressure (c) Wall pressure (d) Suction pressure (DPD) 180. A cell increase in volume when it is placed in: (a) Hypotonic solution (b) Isotonic solution (c) Hypertonic pressure (d) None of the above 181. The process of imbibitions involves: (a) Capillary action (b) Absorption (c) Diffusion (d) Both (a) and (c) 182. The outer solution having equal concentration as that of the cell sap is called: (a) Neutral solution (b) Hypertonic solution (c) Isotonic solution (d) Hypotonic solution 183. Cell wall of the root hair has two layers outer and inner which are the made up of: (a) Lignin and cellulose respectively (b) Cellulose and pectin respectively (c) Pectin and lignin respectively (d) Pectin and cellulose respectively

177. Cell becomes turgid because of: (a) Diffusion (b) Endosmosis (c) Exosmosis (d) Plasmolysis

184. The membrane which allows passage of solvent as well as some selective solutes and prevents others is called: (a) Impermeable membrane (b) Selectively permeable membrane (c) Semipermeable membrane (d) Permeable membrane

178. Endosmosis occurs when the plant cell is placed in:

185. The membrane which allows the movement of only water molecules to

Ans. 171. (b) 172. (d) 173. (c) 174. (d) 175. (c) 176. (d) 177. (b) 178. (b) 179. (d) 180. (a) 181. (d) 182. (c) 183. (d) 184. (b)

36

Plant Physiology: Question Bank

pass through it and not the solute particles: (a) Not permeable membrane (b) Permeable membrane (c) Semipermeable membrane (d) Impermeable membrane 186. Diffusion of water through semipermeable membrane from dilute solution of concentrated solution is: (a) Necrosis (b) Plasmolysis (c) Osmosis (d) Imbibition 187. Osmosis is the diffusion of: (a) Energy (b) Gases (c) Solute particles (d) Water 188. When water enters the cell, one of the pressure is exerted on cell wall: (a) Root pressure (b) Turgor pressure (c) Suction pressure (d) Osmotic pressure 189. In plants, water rises upward through: (a) Xylem (b) Phloem (c) Stomata (d) Cambium 190. The part of root involved in water absorption is zone of: (a) Root cap (b) Elongation (c) Root hairs (d) Cell division 191. Most of the water taken up by the plant is: (a) Incorporated directly into organic material (b) Absorbed by the cells during their elongation (c) Spilt during photosynthesis as a source of electrons and hydrogen (d) Lot by transpiration through stomata 192. Stomatal pores open when: (a) Water moves out of the guard cells in response to a decrease in water potential of the guard cells (b) Water moves into the guard cells in response to decrease in water potential in the guard cells

(c) K + ions are pumped out of the guard cells (d) H+ ions are pumped into the guard cells 193. Which of the following statement(s) is/are correct? (a) Rate of transpiration is dependent upon vapour pressure deficit (b) Water lost by transpiration is pure water (c) The cause of guttation is mainly pressure (d) All of the above 194. Ion absorption by symplast occurs: (a) Actively by primary and secondary active transport (b) Passively by free diffusion (c) Passively by facilitated diffusion (d) Both (b) and (c) 195. Ion absorption by plant roots: (a) Is basically ions passively soaking in the root cells along with soil water (b) Explains the movements of ion from a dilute soil solution into a more concentrated solution (c) Can be explained by the nutrient– carries hypothesis (d) More than one is correct 196. Which of the following observations shows that ion uptake in plants is energy dependent? (a) Some ions enter the symplast before reaching the endodermis (b) Some ions accumulate against a concentration gradient (c) Ion uptake rates are different for different ions (d) Ion uptake shows saturation kinetics 197. Which of the following properties of water is most directly related to its ability to rise in the capillary spaces of plants? (a) High surface tension

Ans. 185. (c) 186. (c) 187. (d) 188. (b) 189. (a) 190. (c) 191. (d) 192. (b) 193. (d) 194. (d) 195. (d) 196. (b)

Water Relation

(b) Low compressibility (c) High density (d) Neutral pH 198. The source of energy driving the transport of water through the xylem is: (a) Transpiration (b) The sun (c) ATP generated by respiration (d) ATP produced by photosynthesis 199. Transpiration pull is depends on: (a) The very negative water potential of the atmosphere (b) Adhesion of water molecules to the walls of phloem cells (c) Capillarity (d) Cohesion of water molecules to each other 200. Which of the following statement is correct? (a) Root pressure is mainly responsible for ascent of sap (b) Members of gymnosperm show high root pressure (c) Actively transpiring plants show high root pressure (d) No one of the above 201. Root pressure is a/an: (a) Positive hydrostatic pressure (b) Non-osmotic phenomenon (c) Osmotic phenomenon (d) More than one correct 202. The class of water in the soil that provides most of the water to plants and is thus the most important is: (a) Hygroscopic (b) Capillary (c) Filed capacity (d) Gravitational 203. Water cohesion: (a) Is energy requiring process (b) Is responsible for making the column of water (c) Causes water to move from the xylem into the phloem in response

37

to differences in water concentration (d) Creates the pulling force which pulls water upward in the xylem 204. Which of the following plays no role in the movement of water through the xylem of plants? (a) Transpiration pull (b) H + /ATPase pump at the xylem element membrane (c) Root pressure (d) Capillarity 205. In a flaccid cell: (a) DPD = OP–TP (b) DPD = OP (c) DPD = TP (d) None of these 206. Space between cell wall and plasma membrane in a plasmolyzed cell is occupied by: (a) Plasmolysing solution (b) Pure water (c) Air (d) Cell sap 207. The sap of a plant cell has an osmotic potential of –10 bars and there is a wall pressure of 2 bars. When this cell is placed in solution with an osmotic potential of –3 bars the force causing water to enter the cell is: (a) –3 bars (b) –5 bars (c) –7 bars (d) –8 bars 208. Water potential: (a) Is never zero (b) The measure of the level of the active movement of water through a system (c) Is the potential of water in a system (d) Of a solution is always is greater than for pure water 209. Osmosis is a form of diffusion in which: (a) Solute as well as solvent moves freely from region of higher concentration to lower concentration through a semipermeable membranes

Ans. 197. (a) 198. (b) 199. (a) 200. (d) 201. (d) 202. (a) 203. (b) 204. (b) 205. (b) 206. (a) 207. (b) 208. (c)

38

Plant Physiology: Question Bank

(b) The solvent moves through a semipermeable membrane from higher solvent concentration to lower concentration (c) The solvent moves through a semipermeable membrane from region where a solute is in higher concentration to region of lower concentration (d) The solute moves freely from a region of higher concentration to lower concentration through a semi-permeable membrane

Ans. 209. (b) 210. (b)

210. Which of the following statement is correct regarding diffusion? (a) It occurs when molecules move from a region of lower concentration to one of higher concentration (b) It is a passive process (c) It requires an expenditure of energy by the cell (d) It is very rapid over long distance

Water Relation

CHECK YOUR GRASP

1. Water potential: (a) Of a solution is always greater than for pure water (b) Is the potential energy of water in a system (c) Is a measure of the level of the activity movement of water a system (d) Is never zero 2. Osmotic potential of a solution is always: (a) Positive (b) Equal (c) Variable (d) Negative 3. Which of the following is correct? (a) DPE = OP × WP (b) WP = OP – DPD (c) OP = WP – DPP (d) DPD = WP – OP 4. In a 10-year-old tree: (a) Passive absorption dominates (b) Active absorption dominates (c) Both of these (d) None of these 5. Osmotic pressure of a cell is usually equal: (a) OP – TPb (b) OP + TP (c) DPD + TP (d) DPD – OP 6. Element which maintains the solubility of calcium in the cells is: (a) B (b) Fe (c) Cu (d) Mg 7. A 0.1 M solution has a water potential of: (a) 2.3 bars (b) –2.6 bars (c) –2.3 bars (d) +2.3 bars 8. Osomotic pressure is highest in: (a) Hydrophyte (b) Halophytes (c) Xerophytes (d) Mesophyte 9. Which of the following appears logically correct for a turgid cell? (a) DPD 05 atm, OP 12 atm, TP 07 atm (b) DPD 02 atm, OP 07 atm, TP 05 atm (c) DPD 00 atm, OP 15 atm, TP 15 atm (d) DPD 10 atm, OP 05 atm, TP 06 atm Ans.

1. (b) 12. (a)

2. (d) 13. (c)

3. (b) 14. (a)

4. (a) 15. (c)

5. (c) 16. (c)

39

10. The production of nitrates from ammonia through nitrosomonas is called: (a) Ammonification (b) Nitrification (c) Denitrification (d) Nitrogen fixation 11. Which can preserve food stuff? (a) Sugar and vinegar (b) Salt and sugar (c) Vinegar (d) All the above 12. Chlorophyllous cells fewer in number, unique in shape with inner walls thicker are: (a) Guard cells (b) Passage cells (c) Subsidiary cells (d) Bulliform cells 13. The direction of water in cycas leaflets is: (a) Upward (b) Downward (c) Lateral (d) Both a and b 14. Phytohormone connected with closing of: (a) ABA (b) Kinetin (c) GA (d) IBA 15. In seed germination the first to occur is: (a) Diffusion (b) Osmosis (c) Imbibitions (d) All the above 16. The following percentage of water absorbed by herbaceous plants is lost in transpiration: (a) 80 (b) 60 (c) 99 (d) 40 17. Cohesive force of water is due to: (a) O-bonds (b) OH-bonds (c) S-bonds (d) H-bonds 18. The transport of sap from root to top of the plant is: (a) Ascent of sap (b) Conduction (c) Transport (d) Translocation 19. Root pressure is absent in: (a) Dicots (b) Monocots (c) Mango (d) Gymnosperms 20. Water passes into a cell due to: (a) OP (b) DPD (c) WP (d) Diffusion 6. (a) 17. (d)

7. (c) 18. (a)

8. (b) 19. (d)

9. (c) 20. (c)

10. (b)

11. (d)

40

Plant Physiology: Question Bank

21. Force for active water absorption is present in: (a) Xylem (b) Aerial parts (c) Root (d) Root hairs 22. Transpiration is a process related to: (a) Osmosis (b) Diffusion (c) Activated transport (d) Facilitated diffusion

29. DPD is: (a) Daynight phosphate (b) Daily photosynthetic demand (c) Diffusion pressure deficit (d) Diffusion potential deficit 30. When the cell is fully turgid, its: (a) DPD = OP (b) DPD = WP (c) WP = 0 (d) DPD = O

23. Presence of hair on the leaf surface: (a) Reduces transpiration (b) Increases transpiration (c) Helps in rapid exchange of gases (d) Prevents guttation

31. Turgidity in a cell is maintained by: (a) Wall pressure (b) Osmotic pressure (c) Diffusion pressure (d) Turgor pressure

24. Water absorbed by root hairs of a plant can rise to the highest point by means of: (a) Root pressure (b) Imbibition force (c) Force of capillary (d) Transpiration pull

32. Mark the incorrect statement: (a) Plant absorbs excess quantity of water (b) Water and salts are taken in simultaneously (c) Plant absorbs only one thing at a time, either water or nutrient (d) Plant takes in small quantity of water

25. Active absorption of water from the soil by the roots is mainly affected by: (a) Typical tissue organization (b) Sucking power of the root hairs (c) Osmotic concentration of cell sap (d) Tension due to transpiration 26. Selective permeability identifies the process of: (a) Exosmosis (b) Osmosis (c) Diffusion (d) Plasmolysis 27. When slices of beet roots are placed in cold water, the anthocyanin pigments do not come out. But it happens when placed in hot water. It indicates that for anthocyanin, plasma membrane: (a) Impermeable (b) Permeable (c) Semipermeable (d) Differentially permeable 28. When a cell is placed in a hypertonic solution, its water potential: (a) Increase (b) Decrease (c) Equal (d) First increase and then decrease Ans.

21. (c) 32. (c)

22. (b) 33. (a)

23. (a) 34. (c)

24. (d) 35. (d)

25. (b) 36. (c)

33. An example of rapid absorption is: (a) Passive absorption (b) Root absorption (c) Translocation (d) Salt absorption 34. Which of the following takes place against concentration gradience? (a) Transpiration (b) Root absorption (c) Salt absorption (d) Diffusion 35. Several seedlings do not survive on transplantation because: (a) They do not like the now soil (b) They do not get proper utrients in the soil (c) Most root hairs are damaged (d) Leaves get demand due to transplantation 36. Osmotic pressure of a cell is usually equal to: (a) OP – TP (b) OP + TP (c) DPD +TP (d) DPD – OP 26. (b)

27. (a)

28. (b)

29. (c)

30. (d)

31. (d)

Water Relation

37. In a cell the pressure exerted out wards on the cell wall is termed: (a) Root pressure (b) Osmotic pressure (c) Turgor pressure (d) Suction pressure 38. The vacuole in a plant cell contains: (a) Gases (b) Solvent (c) Water (d) Cell sap 39. In plants the value of DPD will the higher than OP when: (a) OP – TP (b) OP +TP (c) TP – ye (d) OP > TP 40. Which of the following sequences correctly explains the ascending order of DPD in root hair, cortical cell and mesophyll cell? (a) Root hair < cortical cell < mesophyll cell (b) Root hair < mesophyll cell < cortical cell (c) Mesophyll cell < root hair < cortical cell (d) Cortical cell < mesophyll cell < root hair 41. Which of the following has highest imbibing capacity? (a) Protein (b) Carbohydrate (c) Lipid (d) Cellulose 42. Bacteria fail to survive in a highly salted pickle because: (a) They are plasmolysed and get killed (b) Pickles have low nutrient value (c) Salt inhibits their multiplication (d) They cannot carry out hotosynthesis 43. Root pressure is due to: (a) Passive absorption (b) Active absorption (c) Root absorption (d) Diffusion pressure 44. Which of the following is the correct statement in reference to active and passive transport? Ans.

37. (c) 48. (c)

38. (d) 49. (c)

39. (c) 50. (a)

40. (a)

41. (d)

41

(a) Passive transport is nonselective (b) Active transport is nonselective (c) Active transport utilizes metabolic energy whereas passive transport is due to concentration gradience (d) Passive transport is related to anions whereas active transport is related to cations 45. DPD of a plasmolysed cell is: (a) Less than OP (b) Less than TP (c) Equal to OP (d) Zero 46. Which of the following appears logically correct for a turgid cell? (a) DPD 05 atm, OP 12 atm, TP 07 atm (b) DPD 02 atm, OP 07 atm, TP 05 atm (c) DPD 00 atm, OP 15 atm, TP 15 atm (d) DPD 10 atm, OP 05 atm, TP 06 atm 47. A piece of sliced potato kept in a solution loses its weight. The possible reason could be: (a) Exit of solutes (b) Exit of solvent (c) Exosmosis (d) Death of tissue 48. According to well-known theory of solute transport across cell membrane, what happens when sugar molecules are passed through it: (a) Na+ do not flow at all (b) K+ flow against the sugar molecules (c) Na+ flow in the direction of sugar molecules (d) K+ do not flow at all 49. A 0.1 M solution has a water potential of: (a) 2.3 bars (b) –2.6 bars (c) –2.3 bars (d) +2.3 bars 50. What is the capillary water name? (a) Capillary water (b) Gravitational water (c) Chemically bound water (d) Hygroscopic water Mark your score and evaluate yourself accordingly 42. (a)

43. (b)

44. (c)

45. (c)

46. (c)

47. (c)

42

Plant Physiology: Question Bank

3

Transpiration and Guttation 1. Blue light is nearly ........ times as effective as red light in case of somatal function. (a) 40 (b) 30 (c) 20 (d) 10

6. The stomatal pores open when: (a) Water moves into the guard cells in response to a decrease in water potential in the guard cells (b) H+ ions are pumped into the guard cells (c) K + ions are pumped out of the guard cells (d) Water moves into the guard cells in response to a decrease water potential of the guard cells

2. ......... measured the wavelength of light that was most effective is causing stomata to open. (a) Outlaw and Tarczynski (b) Sharkey and Rasschke (c) Both A and B (d) None of these 3. Stomata respond to light even in leaves in which photosynthesis had been reduced to zero by the application of an inhibitor. This statement is true or false: (a) False (b) True (c) Not known (d) None of these

7. In pea, radish, mustard, turnip, beet, apple and bean stomata open whole day and close down during night, known as: (a) Barley/cereal type (b) Potato type (c) Alfalfa/leucerne type (d) None of the above

4. The minimum light level for the opening of stomata in the most plants in about: (a) 1/100 to 1/10 of full sunlight (b) 1/500 to 1/20 of full sunlight (c) 1/1000 to 1/30 of full sunlight (d) None of the above 5. Root pressure is due to: (a) Passive absorption (b) Low osmotic potential in the soil (c) Increase in transpiration (d) Active absorption

9. The most common type of transpiration is: (a) Foliar (b) Lenticular (c) Cuticular (d) Stomatal

Ans.

1. (d)

2. (b)

3. (b)

4. (c)

5. (d)

8. In cucurbita, onion, portulaca, tulip and banana stomata open whole day and night expect for a few hours during evening, known as: (a) Barley/cereal type (b) Potato type (c) Alfalfa/leucerne type (d) None of the above

6. (a) 42

7. (c)

8. (b)

9. (d)

Transpiration and Guttation

43

10. Transpiration differs from evaporation in: (a) Transpiration is a physical process and evaporation is physiological process (b) Transpiration is a physiological process and evaporation is physical process (c) The frequency of water loss (d) None of the above

18. Low atmospheric pressure changes the rate of transpiration to: (a) Decrease rapidly (b) Decrease slowly (c) Increase (d) Unchanged

11. The water movement against the gravity caused by: (a) Diffusion (b) Osmosis (c) Transpiration (d) Imbibition

20. At the constant temperature, the rate of transpiration will be higher at: (a) 1.5 km above sea level (b) 1 km above sea level (c) 1 km below sea level (d) The sea level

12. The thick wall of the guard cell: (a) Outer (b) Lateral (c) Inner (d) All of these 13. PMA (phenyl mercuric acetate) results in: (a) Killing of the plants (b) Reduced the respiration (c) Reduced the photosynthesis (d) Reduced the transpiration 14. Transpiring structure in plants: (a) Cortex (b) Phloem (c) Epidermis (d) Xylem 15. In thin–leaved mesophytes, stomata open during the day and close during the night, belong to: (a) Alfalfa type (b) Barley type (c) Bean type (d) Potato type 16. The stomatal type of cereals which open only for few hours during the day? (a) Alfalfa type (b) Barley type (c) Bean type (d) Potato type 17. Which one gives the most valid explanation for the movements of the guard cells? (a) Guard cell photosynthesis (b) Starch hydrolysis theory (c) Potassium influx and efflux (d) Transpiration Ans.

10. (b) 21. (c)

11. (c) 22. (a)

12. (c) 23. (c)

13. (d) 24. (d)

14. (c) 25. (b)

19. Elements involved in stomatal regulation is: (a) Iron (b) Potassium (c) Sodium (d) Zinc

21. In the regulation of transpiration the factor, the most important factor is: (a) Light (b) Wind (c) Humidity (d) Temperature 22. Hydathodes occurs on: (a) The leaves (b) The stem (c) The roots (d) All of these 23. The nonfunctional stomata can be seen in: (a) Pea leaves (b) Mango leaf (c) Hydrila (d) Lotus 24. When half of the leaf is removed randomly, transpiration will show: (a) Both magnitude and flux decreases (b) Higher magnitude but lower flux or rate per unit (c) Both magnitude and flux increases (d) Lower magnitude and higher flux 25. Who proposed the opening and closing of stomata is connected with the daily opening and closing? (a) von Mohl (b) Loft field (c) Lyoyd (d) None of these 26. Equisetum type stomata: (a) Always close (b) Always open (c) Both A and B (d) More than one 15. (a) 26. (b)

16. (b)

17. (c)

18. (c)

19. (b)

20. (a)

44

Plant Physiology: Question Bank

27. The stomata open at night in: (a) CAM plants (b) C3 plants (d) None of these (c) C4 plants 28. In plants, the transpiration plays an important role in: (a) Ascent of sap (b) Translocation of the mineral salts (c) Regulation of the temperature (d) All of the above 29. Which of the following form of light has controlling influence on stomatal opening? (a) Green (b) Far–red (c) Blue (d) Red 30. The color of dry cobalt chloride paper when tightly pressed on the transpiring surface of a leaf changes from: (a) Blue to pink (b) Blue to green (c) Pink to blue (d) Green to blue 31. Choose the antitranspirant substances: (a) Color plastic and silicone oils (b) Low viscosits waxes and ABA (c) Very high concentration of CO2 (d) All of the above 32. The rate of transpiration in plant, usually maximum in: (a) Evening (b) Afternoon (c) Morning (d) Little before noon 33. The plant which shows phenomenon of guttation: (a) Colacasia (b) Tropaeolum (c) Garden nasturtium (d) All of the above 34. The factors that favor guttation: (a) Reduced or no transpiration (b) High water absorption (c) High root pressure (d) All of the above Ans.

27. (a) 38. (c)

28. (d) 39. (b)

29. (c) 40. (c)

30. (a) 41. (a)

31. (d)

35. Margin of mature Colocasia leaves appear withered/necrotic due to: (a) Guttated salt (b) Excess of minerals (c) Excess of transpiration (d) None of the above 36. Cobalt chloride paper test for transpiration was developed by: (a) Ganong (b) Stahl (c) Curtis (d) None of these 37. Porometer was developed by: (a) Freeman (b) Ganong (c) Darwin (d) None of these 38. Stomatal frequency indicates the: (a) Rate of water loss from per stomata (b) Length of stomata (c) Number of stomata per unit area (d) None of the above 39. The stomata are called sunken when: (a) Guard cells are in line with epidermal cells (b) Guard cells are situated below the epidermis (c) Guard cells are situated above the epidermis (d) Guard cells occur in the lower epidermis 40. In dorsiventral leaf, the number of stomata per unit area is generally: (a) Approximately same on the both surface (b) More on the upper surface (c) More on the lower surface (d) None of the above 41. In isobilateral leaf, the number of stomata per unit area is: (a) Approximately same on the both surface (b) More on the upper surface (c) More on the lower surface (d) None of the above 32. (d)

33. (d)

34. (d)

35. (a)

36. (b)

37. (c)

Transpiration and Guttation

42. An instrument that gives a rough idea about the degree of stomatal opening and closing is: (a) Porometer (b) Auxinometer (c) Potometer (d) None of these 43. The instrument for measuring as unavoidable evil. Who made this statement? (a) Porometer (b) Auxinometer (c) Potometer (d) None of these 44. Transpiration is regarded as unavoidable evil, proposed by: (a) Steward (b) Curtis (c) Both A and B (b) None of these 45. Transpiration is regarded as necessary, proposed by: (a) Steward (b) Curtis (c) Both A and B (b) None of these 46. Higher root/shoot ratio has ........ rate of transpiration. (a) Very less (b) Higher (c) Lower (d) None of these 47. The number of stomata/cm 2 upper/ lower leaf surface of Quercus eiccinea is: (a) 101002/21600 (b) 0/48000 (c) 0/103800 (d) 2100/4600 48. The number of stomata/cm 2 upper/ lower leaf surface of Morus alba is: (a) 101002/21600 (b) 0/48000 (c) 1200/13000 (d) 5200/6800 49. The number of stomata/cm 2 upper/ lower leaf surface of Solanum tuberosum is: (a) 101002/21600 (b) 1200/13000 (c) 2100/4600 (d) 5100/16600 50. The number of stomata/cm 2 upper/ lower leaf surface of Cucurbita pepo is: (a) 101002/21600 (b) 1200/13000 (c) 5200/6800 (d) 2791/27132 Ans.

42. (a) 53. (b)

43. (c) 54. (d)

44. (a) 55. (c)

45. (b) 56. (d)

46. (b) 57. (b)

45

51. The number of stomata/cm 2 upper/ lower leaf surface of Helianthus annuus is: (a) 101002/21600 (b) 2100/4600 (c) 5200/6800 (d) 8527/15504 52. The number of stomata/cm 2 upper/ lower leaf surface of Pisum sativum is: (a) 101002/21600 (b) 1200/13000 (c) 2100/4600 (d) 0/4500 53. The number of stomata/cm 2 upper/ lower leaf surface of Lycopersicon esculentum is: (a) 101002/21600 (b) 1200/13000 (c) 2100/4600 (d) 0/4500 54. The number of stomata/cm 2 upper/ lower leaf surface of Triticum aestivum is: (a) 101002/21600 (b) 1200/13000 (c) 5200/6800 (d) 2100/4600 55. The number of stomata/cm 2 upper/ lower leaf surface of Zea mayas is: (a) 101002/21600 (b) 1200/13000 (c) 5200/6800 (d) 2100/4600 56. The number of stomata/cm 2 upper/ lower leaf surface of Oxalis acetosella is: (a) 2100/4600 (b) 1200/13000 (c) 5200/6800 (d) 0/4500 57. The epithem is in close association with the: (a) Vessels (b) Tracheids (c) Both A and B (d) None of these 58. Below the water pore of the hydathodes, there is a small cavity followed by a loose tissue called: (a) Periblem (b) Perithem (c) Epiblem (d) Epithem 59. Each hydathode consists of a water pore which is ...... open. (a) Temporarily (b) Permanently (c) Not (d) None of these 47. (c) 58. (d)

48. (b) 59. (b)

49. (d)

50. (b)

51. (b)

52. (a)

46

Plant Physiology: Question Bank

60. The phenomenon of guttation is associated with the presence of special types of stomata at the margins of the leaves which are called: (a) Hydathodes (b) Water stomata (c) Both A and B (d) None of these 61. Water coming out of guttation contains: (a) Organic substance (b) Inorganic substances (c) Both A and B (d) None of the above 62. The term Guttation was coined by: (a) Curtis (b) Bergerstein (c) Steward (d) None of these 63. SPAC is: (a) Soil–animal–atmosphere continuum (b) Soil–plant–atmosphere continuum (c) Both A and B (d) None of these 64. Which of the following scientist proposed that water stress produces ABA which induces the closer of stomata? (a) Milbarrow (b) Mouravieff (c) Schwendener (d) None of these 65. ......... was the first to point out that stomatal opening and closing is due to turgor changes in guard cells? (a) Milbarrow (b) Mouravieff (c) Schwendener (d) None of these 66. The stomata remain open at relative humidity above than ........ and close below relative humidity ........ . (a) 50%, 70% (b) 70%, 50% (c) Both A and B (d) None of these 67. The transpiration ratio for C3 plants: (a) 300–500 (b) 50 (c) 100–300 (d) None of these 68. The transpiration ratio for C2 plants: (a) 300–500 (b) 50 (c) 100–200 (d) None of these Ans.

60. (c) 71. (a)

61. (c) 72. (b)

62. (b) 73. (d)

63. (b) 74. (b)

64. (a) 75. (b)

69. The transpiration ratio for C4 plants: (a) 300–500 (b) 50 (c) 100–200 (d) None of these 70. The transpiration ratio for CAM plants: (a) 300–500 (b) 50 (c) 100–200 (d) None of these 71. The amount of transpiration by Elm is: (a) 1 tons/day (b) 36–45 liters/day (c) 0.5–2.5 g/dm2/hr (d) 2 liter/day 72. The amount of transpiration by apple is: (a) 1 tons/day (b) 36–45 liters/day (c) 0.5–2.5 g/dm2/hr (d) 2 liter/day 73. The amount of transpiration by sunflower is: (a) 1 tons/day (b) 36–45 liters/day (c) 0.5–2.5 g/dm2/hr (d) 2 liter/day 74. In aquatic plants with floating leaves stomata are present on the ....... surface: (a) Lower (b) Upper (c) Both A and B (d) None of these 75. In ........ stomata are distributed equally on the both sides of the leaves: (a) Dicots (b) Monocots (c) Both A and B (d) None of these 76. Stomata are usually confined in more number on the ...... side of the leaves: (a) Upper (b) Lower (c) Both A and B (d) None of these 77. The amount of water transpaired by a plant for the synthesis of a unit dry matter is known: (a) Water requirement (b) Efficiency of transpiration (c) Transpiration ratio (d) All of the above 65. (c) 76. (b)

66. (b) 77. (d)

67. (a)

68. (a)

69. (c)

70. (b)

Transpiration and Guttation

78. A minimum amount of transpiration occurs through: (a) Cuticular transpiration (b) Lenticular transpiration (c) Stomatal transpiration (d) None of the above 79. ........ of water absorbed by a plant is lost through transpiration: (a) 93–95% (b) 98–99% (c) 90–91% (d) None of these 80. Transpiration is similar to evaporation in the loss of water vapors but differs from the same in: (a) Formation of water vapors internally (b) Occurrence of even when the air is saturated (c) Being controlled by a number of plant factors (d) All of the above 81. The living tissue is essential for: (a) Vital physical process (b) Vital physiological process (c) Both (a) and (b) (d) None of these 82. Transpiration is a: (a) Vital physical process (b) Vital physiological process (c) Both (a) and (b) (d) None of these 83. In higher angiosperm, water is lot from aerial parts of plants mainly through: (a) Stomatal transpiration (b) Lenticular transpiration (c) Cuticular transpiration (d) None of the above 84. Living cells are not required for: (a) Transpiration (b) Evaporation (c) Guttation (d) None of these 85. Evaporation is a: (a) Chemical process (b) Physical process (c) Physiological process (d) None of the above Ans.

78. (b) 89. (c)

79. (b) 90. (c)

80. (d) 91. (c)

81. (b) 92. (c)

82. (b)

47

86. Loss of water in the form of water from aerial parts of the plants is known: (a) Guttation (b) Transpiration (c) Both (a) and (b) (d) None of these 87. Loss of water in the form of vapor from aerial parts of the plants is known: (a) Guttation (b) Transpiration (c) Both (a) and (b) (d) None of these 88. If you put a cell into pure water form a wilted plant, which of the following will happen? (a) More water molecules will move out of the cell than moves in (b) There will be no change in the concentration of water inside or outside of the cells (c) More water will move into the cell than moves out (d) The cell will plasmolyse 89. In passive absorption water is absorbed due to: (a) Exosmosis (b) Osmosis (c) Transpiration pull (d) None of these 90. Most widely accepted explanation for ascent of sap in plant is: (a) Role of atm pressure (b) Capillary theory (c) Transpiration cohesion theory (d) Imbibition theory 91. The ultimate cause of water movement against the gravity is: (a) Diffusion (b) Osmosis (c) Transpiration (d) Imbibitions 92. Passive absorption of water by the root of a plant is affected by: (a) OP of root hairs (b) TP of root hairs (c) Transpiration tension (d) Anatomy of root 83. (a)

84. (b)

85. (b)

86. (a)

87. (b)

88. (c)

48

Plant Physiology: Question Bank

93. Which of the following contributes most to transport of water from the ground to the leaves of a tree? (a) Shoot pressure (b) Root pressure (c) Transpiration pull (d) Capillary water 94. Due to low atmospheric pressure, the rate transpiration will: (a) Increase (b) Decrease (c) Remain unchanged (d) Decease slowly 95. The action spectrum of transpiration is: (a) Green and red (b) Blue and red (c) Blue and tar red (d) Orange and far red 96. Pheylmercuric acetate: (a) Increase transpiration rate (b) Decrease transpiration rate (c) Reduce respiration rate (d) Reduce photosynthesis 97. The most important factor affecting transpiration is: (a) Light (b) Wind (c) Humidity (d) Temperature 98. Transpiration will be maximum when soil is: (a) Ery and atmosphere is humid (b) Wet and atmosphere is humid (c) Dry and atmosphere is dry (d) Wet and atmosphere is dry 99. The most common type of transpiration found in plant is: (a) Stomatal (b) Cuticular (c) Lenticular (d) None of these 100. Plants wilt because of excessive: (a) Respiration (b) Photosynthesis (c) Transpiration (d) Absorption 101. The metal ion involved in stomatal movement is: (b) Mg++ (a) Zn++ ++ (c) Mn (d) K+ Ans.

102. Increase in CO2 concentration upto 600 ppm in the vicinity of leaf causes: (a) Partial opening of stomata (b) Rapid opening of stomata (c) Complete closure of stomata (d) No effect on stomatal movement 103. Stomata open during the daytime because the guard cells: (a) Are thin walled on outer side and thick on inner side (b) Are been shaped (c) Have to help in gaseous exchange (d) Produce osmotically active sugars 104. Active K+ exchange theory for stomatal movement was proposed by: (a) Levitt (b) Scarth (c) Yin and Tung (d) Steward 105. What is the action spectrum of transpiration? (a) Green and ultraviolet (b) Orange and red (c) Blue and infrared (d) Blue and red 106. Which of the following is uncontrolled process: (a) Transpiration (b) Guttation (c) Respiration (d) Photosynthesis 107. Guttation occurs through: (a) Stomata (b) Leaf directly (c) Hydathodes (d) Injured tissues 108. In which of the following is cuticular transpiration almost equal to stomatal transpiration? (a) CAM plants (b) Sciophytes (c) Heliophytes (d) Mangrove plants 109. Lenticular transpiration contributes: (a) 1% of total transpiration (b) 3–9% of total transpiration (c) 15% of total transpiration (d) 11% of total transpiration

93. (c) 94. (b) 95. (b) 96. (b) 97. (c) 98. (d) 104. (a) 105. (d) 106. (b) 107. (c) 108. (b) 109. (a)

99. (a) 100. (c) 101. (d) 102. (c) 103. (d)

Transpiration and Guttation

110. Guttation occurs when: (a) T/A ratio is reduced (b) T/A ratio is enhanced (c) T/A ratio is unity (d) All of the above 111. Guttation is more common in plants growing in: (a) Dry tropical areas (b) Humid tropical areas (c) Humid and temperate areas (d) Dry and temperate areas 112. Palm toddy is an exudate of: (a) Phloem cells (b) Xylem cells (c) Cortex cells (d) Epidermal cells 113. Chloroplasts of guard cells contain: (a) Chl a and Chl b (b) Chl a and carotene (c) Chl b and xanthophy 11 (d) Chl a, Chl b and carotenoids 114. Chlorophyll of guard cells is formed in: (a) Light only (b) Dark only (c) Both in light and dark (d) Evening only 115. According to classical theory of stomatal movement guard cells accumulate: (a) Sugar during night (b) Starch during night (c) Fat during night (d) Organic acid during night 116. Guard cells show: (a) Plasmolysis in concave manner (b) A plasmolysis in convex manner (c) No plasmolysis (d) Plasmolysis in planoconcave manner 117. The mesophyll cells of dicot: (a) Accumulate starch during day (b) Accumulate sugar during day (c) Accumulate fat during day (d) Accumulate malic acid during day

49

118. Which of the followings act like elastic buffers between guard cells and epidermal cells: (a) Mesophyll cells (b) Subsidiary cells (c) Bundle sheath cells (d) Stomatal hair 119. Starch-sugar hypothesis was originally proposed by: (a) Lloyd (b) Levitt (c) Scarth (d) Steward 120. K+ transport and hormonal regulation theory explains: (a) Stomatal movement in succulents only (b) Stomatal movement in non-succulents only (c) Stomatal movement in heliophytes only (d) All the above 121. Film forming antitranspirants are: (a) Acidic (b) Basic (c) Inert (d) Neutral 122. Film forming antitranspirants reduce: (a) Cuticular transpiration (b) Stomatal transpiration (c) Lenticular transpiration (d) All kinds of transpiration 123. Natural antitranspirants are: (a) Abscisic acid (b) Phenolic acids (c) Asprin (d) All of the above 124. Which of the following is an ideal antitranspirant? (a) Phenyl mercuric acetate (b) Asprin (c) Phenolic acids (d) None of the above 125. Deficiency of which of the following elements slows stomatal movement: (a) Nitrogen (b) Phosphorus (c) Potassium (d) All the above

Ans. 110. (a) 111. (b) 112. (a) 113. (a) 114. (c) 115. (b) 116. (c) 117. (a) 118. (b) 119. (a) 120. (d) 121. (c) 122. (a) 123. (d) 124. (d) 125. (d)

50

Plant Physiology: Question Bank

126. On cool nights, following sultry days, water is found at the tips and margins of tomato leaves in the form of dew drops. Every drop marks the location of: (a) Stomata (b) Lenticle (c) Hydathode (d) Trichome 127. The condition under which transpiration is most rapid is: (a) Excess of water in soil (b) High humidity (c) Low velocity of wind (d) Low humidity and high temperature 128. Transpiration is basically helpful in: (a) Intake of CO2 (b) Opening of stomata (c) Absorption of water (d) Imbibition 129. Transpiration is regulated by the movement of: (a) Epidermal cells of the leaves (b) Guard cells of the stomata (c) Subsidiary cells (d) Mesophyll cells 130. Wilting of a plant results from excessive: (a) Respiration (b) Photosynthesis (c) Absorption (d) Transpiration 131. Spraying of phenyl mercuric acetate on leaves: (a) Increases rate of transpiration (b) Decreases rate of transpiration (c) Increases the rate of water absorption (d) Decreases the rate of water absorption 132. Wilting of leaves in hot weather at noon is due to: (a) Lack of water absorption (b) Excessive transpiration

(c) Excessive water absorption (d) Excess of transpiration in comparison to absorption 133. Temporary wilting in plants occurs when the rate of absorption is: (a) Equal to transpiration (b) Equal to respiration (c) Less than transpiration (d) Less than respiration 134. Transpiration increases by (a) High humidity (b) Low wind velocity (c) High light intensity (d) High temperature 135. The amount of water usually lost in total transpiration is (a) 55% (b) 66% (c) 75% (d) 98% 136. Under conditions with low atmospheric pressure, the rate of transpiration (a) Remain unchanged (b) First increase and than decrease (c) Decrease (d) Increase 137. Two important functions of leaves are (a) Photosynthesis and respiration (b) Transpiration and phototropism (c) Photosynthesis and transpiration (d) Photosynthesis and guttation 138. Which of the following factors affect temperature and rainfall condition? (a) Transformation (b) Transpiration (c) Photosynthesis (d) Translocation 139. Which one of the following helps in holding the leaves in position and soft stems to stay erect? (a) Stomatal cells (b) Rigidity of the cell wall (c) Turgidity of cells (d) Transpiration

Ans. 126. (c) 127. (d) 128. (c) 129. (b) 130. (d) 131. (b) 132. (d) 133. (c) 134. (d) 135. (d) 136. (d) 137. (c) 138. (b) 139. (c)

Transpiration and Guttation

CHECK YOUR GRASP

1. Which of the following factors affect temperature and rainfall condition? (a) Transformation (b) Transpiration (c) Photosynthesis (d) Translocation 2. Stomato open at night and close during day in: (a) Succulents (b) Mesophytes (c) Halophytes (d) Xerophytes 3. A change in guarde cells responsible for opening of stir ata is the: (a) Decrease in OP and TP (b) Increase in TP and WP (c) Increase in OP and TP (d) None of these 4. Most of the water taken up by the plant is: (a) Split during photosynthesis as a source of electrons and hydrogen (b) Lost by transpiration through stomata (c) Absorbed by cells during their elongation (d) Incorporated directly into organic material 5. Due to low atmospheric pressure, the rate trapspiration will: (a) Increase (b) Decrease (c) Remain unchanged (d) Decease slowly 6. The most common type of transpiration found in plant is: (a) Stomatal (b) Cuticular (c) Lenticular (d) None of these 7. Stomata are more widely open in: (a) Far red light (b) Green light (c) Blue light (d) Orange light 8. Guttation takes place through: (a) Stomata (b) Lenticies (c) Hydathodes (d) Wounds 9. The closure of stomata is affected by: (a) Auxin (b) ABA (c) IBA (d) GA Ans.

1. (b) 12. (b)

2. (a) 13. (c)

3. (c) 14. (b)

4. (b) 15. (b)

5. (b) 16. (d)

51

10. If ABA is sprayed on leaves, the stomata will: (a) Close (b) Open (c) Burst (d) No response 11. Two important functions of leaves are: (a) Photosynthesis and respiration (b) Transpiration and phototropism (c) Photosynthesis and transpiration (d) Photosynthesis and guttation 12. From epithem hydathode, the water oozes out by: (a) Imbibitions pressure (b) Osmotic pressure (c) Root pressure (d) All of these 13. Stomata are more widely open in: (a) Far red light (b) Green light (c) Blue light (d) Orange light 14. Increase in CO2 concentration around the leaf results in stomatal: (a) Opening (b) Partial closure (c) Complete closure (d) No effect 15. The action spectrum of transpiration is: (a) Green and red (b) Blue and red (c) Blue and far red (d) Orange and far red 16. Theanain cause of permanent wilting is (a) Rapid transpiration (b) Rapid translocation (c) Rapid photosynthesis (d) Poor availability of soil water 17. Stomatal movement is a kind of: (a) Chemotactic movement (b) Nastic movement (c) Geotropic movement (d) Phototropic movement 18. Percentage of water left in the soil when a plant wilts is known as: (a) Field capacity (b) Respiration capacity (c) Wilting coefficient (d) Storage capacity 6. (a) 17. (b)

7. (c) 18. (c)

8. (c)

9. (b)

10. (a)

11. (c)

52

Plant Physiology: Question Bank

19. Flood kills plants because: (a) Respiration of root is stopped (b) Food is dissolved (c) Nutrients leach sap (d) Cell sap in plants become too dilute 20. Initial transpiration rate increases with increase in temperature and wind velocity but it slows down later because: (a) Of mechanical disturbances (b) Of chemical disturbance (c) Of closure of stomata (d) Water is not made available 21. Application of phenyl mercuric acetate acts as a/an? (a) Hormones (b) Vitamins (c) Antitranspirant (d) Weedicide 22. In passive absorption water is absorbed due to: (a) Exosmosis (b) Osmosis (c) Transpiration pull (d) None of these 23. Most widely accepted explanation for ascent of sap in plant is: (a) Role of atmospheric pressure (b) Capillary theory (c) Transpiration cohesion theory (d) Imbibitions theory 24. Two important functions of leaves are: (a) Photosynthesis and respiration (b) Transpiration and phototropism (c) Photosynthesis and transpiration (d) Photosynthesis and guttation 25. Phenylmercuric acetate: (a) Increase transpiration rate (b) Decrease transpiration rate (c) Reduce respiration rate (d) Reduce photosynthesis 26. Temporary wilting in plants occurs when the rate of absorption is: (a) Equal to transpiration (b) Equal to respiration (c) Less than transpiration (d) Less than respiration Ans.

19. (a) 30. (c)

20. (c) 31. (c)

21. (c) 32. (b)

22. (c) 33. (c)

23. (c) 34. (d)

27. Temporary wilting in plants occurs when the rate of absorption is: (a) Equal to transpiration (b) Equal to respiration (c) Less than transpiration (d) Less than respiration 28. Transpiration increases by: (a) High humidity (b) Low wind velocity (c) Highlight intensity (d) High temperature 29. The amount of water usually lost in total transpiration is: (a) 55% (b) 66% (c) 75% (d) 98% 30. Under conditions with low atmospheric pressure, the rate of transpiration: (a) Remain unchanged (b) First increase and than decrease (c) Decrease (d) Increase 31. Two important functions of leaves are: (a) Photosynthesis and respiration (b) Transpiration and phototropism (c) Photosynthesis and transpiration (d) Photosynthesis and guttation 32. Which of the following factors affect temperature and rainfall condition? (a) Transformation (b) Transpiration (c) Photosynthesis (d) Translocation 33. Which one of the following helps in holding the leaves in position and soft stems to stay erect? (a) Stomatal cells (b) Transpiration (c) Turgidity of cells (d) Rigidity of the cell wall 34. Which one is not related to transpiration? (a) Regulation of plant body temperature (b) Absorption and distribution of mineral stalk (c) Circulation of water (d) Bleeding 24. (c)

25. (b)

26. (c)

27. (c)

28. (b)

29. (d)

Transpiration and Guttation

35. Water potential in the leaf cells is positive during: (a) Excessive transpiration (b) Low transpiration (c) Excessive absorption (d) Guttation 36. Transpiration pull depends on: (a) Adhesion of water molecules to the wails of phloem cells (b) Capillarity (c) The very negative water potential of the atmosphere (d) Cohesion of water molecules to each other 37. Guttation can be easily observed in Colocasia growing in: (a) Asom (b) Uttar Pradesh (c) Rajasthan (d) Uttarakhand 38. Best evidence in the support of Dixon and Jolly theory of ascent of sap comes from: (a) Porous pot experiment (b) Transpiration pull (c) Photometer (d) Porometer 39. Flood kills plants because: (a) Respiration at root is stopped (b) Food is dissolved (c) Nutrients leach sap (d) Cell sap in plants become too dilute 40. Stomato open at night and close during day in: (a) Succulents (b) Mesophytes (c) Halophytes (d) Xerophytes 41. The effective adaptation for better gaseous exchange in plants is: (a) Waxy cuticle (b) Large number of hairs of lower surface (c) Presence of stomata on lower surface of leaf (d) All of the obove 42. Increase in CO2 concentration around the leaf results in stomatal: (a) Opening (b) Partial closure Ans.

35. (a) 46. (c)

36. (c) 47. (c)

37. (a) 48. (a)

38. (a) 49. (c)

39. (a) 50. (d)

53

(c) Complete closure (d) No effect 43. Conversion of starch into organic acid is essential for: (a) Stomatal opening (b) Stomatal closure (c) Stomatal growth (d) Stomatal initiation 44. Phenylmercuric acetate: (a) Increase transpiration rate (b) Decrease transpiration rate (c) Reduce respiration rate (d) Reduce photosynthesis 45. Guttation is caused due to: (a) Osmosis (b) Transpiration (c) Root pressure (d) Shoot pressure 46. In which of the following plants would metabolism be hindered if the leaves are coated with wax on their upper surface? (a) Dydrilla (b) Spirullina (c) Nelumbo (d) Pistia 47. The primary osmolite which causes an opening and closing os stomata is: (a) Sugar (b) Carbohydrate (c) K-malate (d) Lipid 48. If ABA is sprayed on leaves, the stomata will: (a) Close (b) Open (c) Burst (d) No response 49. A change in guarde cells responsible for opening of stomata is the: (a) Decrease in OP and TP (b) Increase in TP and WP (c) Increase in OP and TP (d) None of these 50. Stomata open at night and close during daytime in: (a) Halophyte (b) Hydrophyte (c) Xerophytes (d) Succulents Mark your score and evaluate yourself accordingly

40. (a)

41. (c)

42. (b)

43. (a)

44. (b)

45. (c)

54

Plant Physiology: Question Bank

4

Mineral Nutrition of Plants 1. Neher and Sakmann proposed: (a) Single ion channels (b) Path-clamp technique (c) Ion carriers (d) None of these

(b) Applies tension to pull the ions into the cell (c) Spends energy to transport ions against the concentration gradient (d) None of the above

2. Passage of mineral from topsoil to subsoil through seepage of water is known as: (a) Conduction (b) Leaching (c) Transpiration (d) Percolation

7. Which of the following observation shown that ion uptake in plants is energy dependent? (a) Some ions enter the simplast before reaching the endodermis (b) Ion uptake rates are different for different ions (c) Ion uptake shows saturation kinetics (d) Some of the ions accumulate against a concentration gradient

3. Which of the following essential mineral is not a constituent of any enzyme but stimulates the activity of many enzymes? (a) K (b) Mn (c) Mg (d) Zn 4. Scientist credited with development of formula for balanced solution of mineral elements is: (a) Hill (b) Knop (c) Emerson (d) Went

8. Theory suggesting that carbon dioxide produced in respiration helps in mineral absorption is called: (a) Donnan equilibrium (b) Active mineral absorption (c) Contact exchange theory (d) Carbonic acid exchange theory

5. Evidence for Na +/H + antiport at the tonoplast emanated first from the experiments of ...... with tonoplast vesicles: (a) Poole (b) Blumwald (c) Both A and B (d) None of these

9. Plant ash indicates: (a) Organic matter (b) Mineral salts absorbed by the plants (c) Both mineral salts and organic matter (d) None of the above

6. How does a plant accumulate ions from the soil which has a lower concentration than that in the plant? (a) Roots grow around soil particle trapping the ions in a cell Ans.

1. (b)

2. (b)

3. (a)

4. (b)

5. (c)

6. (c) 54

7. (d)

8. (d)

9. (b)

Mineral Nutrition of Plants

10. Framework elements are: (a) Mn, Ca and N (b) Mg, Cu and Fe (c) Cu, Co and Fe (d) C, H and O 11. The importance of microelements was recognized late due to: (a) Their absence in plant ash (b) Their toxicity (c) Leaching (d) Presence as contaminants in micronutrients 12. Which of the following essential element land plants normally obtain directly from the air? (a) Hydrogen (b) Carbon (c) Phosphorus (d) Nitrogen 13. Which of the following element is necessary for translocation of sugars in plants? (a) Manganese (b) Iron (c) Mo (d) None of these 14. Mass flow of the movement of ions was first given by: (a) Neher and Sakmann (b) Hylmno and Karmer (c) Both A and B (d) None of these 15. Which of the following scientist first develop hydroponics? (a) Bennet–Clark (b) Geriche (c) Both A and B (d) None of these 16. Which of the following scientist was the first to record minerals/elements in plant ash? (a) Leibig (b) von Helmont (c) Goldarce (d) None of these 17. White bud in maize occurs due to deficiency of: (a) Ca (b) K (c) Fe (d) Zn 18. Nitrogen fixing bacteria were discovered by: (a) Pasture (b) Winogradsky (c) Lister (c) Hoch Ans.

10. (d) 21. (d)

11. (d) 22. (b)

12. (b) 23. (a)

13. (d) 24. (b)

14. (b) 25. (c)

55

19. Mineral absorption is mostly: (a) Passive process (b) Active process (c) Physical process (d) Chemical process 20. The element responsible for maintaining turgor is: (a) Hg (b) Ca (c) K (d) Na 21. The role of inorganic nutrient in plant growth and metabolism was first discovered by: (a) Steward (b) Woodward (c) De Sassure (d) Knop 22. Element essential for the photolysis of water is: (a) Nitrogen (b) Chlorine (c) Carbon (d) Oxygen 23. Bidirectional translocation of minerals takes place through: (a) Phloem (b) Xylem (c) Cambium (d) None of these 24. Enzyme catalyzed reaction can be inhibited by: (a) Zinc ion (b) Mercury ion (c) Copper ion (d) None of these 25. Permeability of protoplasm is accelerated by: (a) Calcium (b) Sodium (c) Potassium (d) None of these 26. Sand culture is a component of: (a) Soil-less culture (b) Photorespiration (c) Greenhouse effect (d) None of these 27. Inorganic nutrient are present in the soil as: (a) Molecules (b) Electric charged ions (c) Atoms (d) None of these 15. (b) 26. (a)

16. (a) 27. (b)

17. (d)

18. (b)

19. (b)

20. (c)

56

Plant Physiology: Question Bank

28. Which of the following plant seedling is used for proof of evidence that nickel is an essential element for plants? (a) Wheat (b) Rice (c) Barley (d) None of these 29. Which of the following technique is used for measurement of concentration of elements in plants, soil and nutrient? (a) Optical emission spectrometer (b) Atomic absorption spectrometer (c) Both A and B (d) None of these 30. Among the followings, which is the most studied phytosiderophore? (a) Mugineic acid (b) Avenic acid (c) Both A and B (d) None of these 31. Anion of organic acids, especially citric acid, appears to be most important for transport of ...... through the ...... : (a) Manganese, xylem (b) Zinc, phloem (c) Iron, phloem (d) All of these 32. According to Chung and Roberts, in cytosol Ca becomes ...... bound to a small protein called calmodulin: (a) Irreversible (b) Reversibly (c) Both A and B (d) None of these 33. In vacuole, Ca is frequently precipitated as insoluble: (a) Sulfate (b) Oxalates (c) Carbonates (d) All of these 34. The nitrogen concentration in dry matter (mmol/kg) considered adequate for normal growth is: (a) 1, 000 (b) 125 (c) 80 (d) 60 35. The potassium concentration in dry matter (mmol/kg) considered adequate for normal growth is: (a) 1, 000 (b) 250 (c) 80 (d) 60 Ans.

28. (c) 39. (a)

29. (c) 40. (b)

30. (c) 41. (c)

31. (d) 42. (d)

32. (b) 43. (a)

36. The calcium concentration in dry matter (mmol/kg) considered adequate for normal growth is: (a) 1,000 (b) 80 (c) 125 (d) 60 37. The magnesium concentration in dry matter (mmol/kg) considered adequate for normal growth is: (a) 1,000 (b) 125 (c) 60 (d) 80 38. The sulfur concentration in dry matter (mmol/kg) considered adequate for normal growth is: (a) 1,0000 (b) 30 (c) 80 (d) 60 39. The chlorine concentration in dry matter (mmol/kg) considered adequate for normal growth is: (a) 3.0 (b) 4.0 (c) 1.0 (d) 2.0 40. The boron concentration in dry matter (mmol/kg) considered adequate for normal growth is: (a) 1, 000 (b) 2.0 (c) 30 (d) 250 41. The iron concentration in dry matter (mmol/kg) considered adequate for normal growth is: (a) 0.05 (b) 1.0 (c) 2.0 (d) 0.001 42. The manganese concentration in dry matter (mmol/kg) considered adequate for normal growth is: (a) 3.0 (b) 2.0 (c) 0.3 (d) 1.0 43. The zinc concentration in dry matter (mmol/kg) considered adequate for normal growth is: (a) 0.3 (b) 1.0 (c) 2.0 (d) 3.0 44. The copper concentration in dry matter (mmol/kg) considered adequate for normal growth is: (a) 1.0 (b) 0.1 (c) 0.05 (d) 0.3 33. (b) 44. (b)

34. (a)

35. (b)

36. (c)

37. (d)

38. (b)

Mineral Nutrition of Plants

45. The nickel concentration in dry matter (mmol/kg) considered adequate for normal growth is: (a) 1.0 (b) 0.1 (c) 0.05 (d) 0.3 46. The molybdenum concentration in dry matter (mmol/kg) considered adequate for normal growth is: (a) 1.0 (b) 0.001 (c) 0.05 (d) 0.3 47. “Gray speck” of cereal grains, a disorder characterized by the appearance of greenish–gray, oval–shaped spots on the basal regions of young leaves, occurs to the deficiency of: (a) B (b) Mn (c) Ca (d) More than 1 48. ...... readily forms a chelate with humic acid in the organic fraction of soil and may be involved in providing copper to the surface of the root. (b) Cu+ (a) Cu2+ (c) Both (a) and (b) (d) None of these 49. “Summer dieback” in citrus plants occurs due to the deficiency of: (a) Cu (b) Fe (c) Both (a) and (b) (d) None of these 50. SOD (superoxide dismutase), which detoxifiles superoxide radicles, is an important ....... containing enzyme: (a) Cu (b) Fe (c) Both (a) and (b) (d) None of these 51. The browning of freshly cut apple and potato surface is due to the activity of copper–containing: (a) Phenolases (b) Polyphenoloxidase (c) Both (a) and (b) (d) None of these 52. “Stem Crack” in celery and ‘Heart rot’ in sugar beet is due to deficiency of: (a) Calcium (b) Boron (c) Iron (d) None of these Ans.

45. (c) 56. (c)

46. (b) 57. (c)

47. (b) 58. (b)

48. (a)

49. (a)

57

53. Phytosiderophores have a high affinity for: (b) Fe3+ (a) Fe2+ (c) Both A and B (d) None of these 54. EDTA is a synthetic acid in common commercial use. It is sold under the trade name of: (a) Sequestrene (b) Versenate (c) Versant (d) More than one 55. According to ...... there are two principle criteria by which an element can be judged essential or nonessential to any plant. First, an element is essential if the plant cannot complete its life cycle in the absence of that element. Second, an element is essential if it forms part of any molecule or constituent of the plant that is itself essential in the plant. (a) Epstein (b) Arnon and Stout (c) Both (a) and (b) (d) None of these 56. The sulfur-containing ...... are responsible for the pungent flavors of mustards, cabbage, turnips, horseradish and other plant of family Brassicaceae. (a) Isothiocuanates (b) Thiocyanates (c) Both (a) and (b) (d) None of these 57. Potassium is frequently deficient in ....... soils because of its high solubility and the ease with which K+ leached out. (a) Clay (b) Loamy (c) Sandy (d) None of these 58. At the soil pH lesser than 6.8, the predominant form phosphorus and form the most readily absorbed by roots is the: (a) Divalent orthophosphate anion (b) Monovalent orthophosphate anion (c) Both (a) and (b) (d) None of these 50. (a)

51. (c)

52. (b)

53. (b)

54. (d)

55. (a)

58

Plant Physiology: Question Bank

59. Excess nitrogen normally favors a ...... shoot/root ratio in the plants. (a) Low (b) High (c) No (d) None of these

67. Sodium is generally essential as a micronutrient to plants utilizing specifically the ...... photosynthetic pathway. (a) CAM (b) C3 (c) C4 (d) None of these

60. Zinc is toxic to plant at concentration above: (a) 100 µg–1 dry weight (b) 200 µg–1 dry weight (c) 75–100 µg–1 dry weight (d) None of the above 61. The concentration above the critical concentration where additional increment in nutrient content will have no beneficial effect on growth and the nutrient content is said to be: (a) Deficient concentration (b) Adequate concentration (c) Critical concentration (d) None of the above

69. Copper acts as an activator of which of the following enzyme? (a) Ascorbic acid oxidase (b) Laccase (c) Phemolases (d) All of the above

62. The concentration of the nutrient measured in the tissue just below the level that gives maximum growth is defined as the: (a) Deficient concentration (b) Adequate concentration (c) Critical concentration (d) None of the above 63. Astragalus is known to tolerate of the high concentration of: (a) Sodium (b) Selenium (c) Nickel (d) None of these

71. Which of the following element is involved in the destruction of indole— 3-acetic acid? (a) Sulphur (b) Iron (c) Manganese (d) None of these

64. Silicon is accumulated in cell walls, especially of ........ . (a) Pith cell (b) Epidermal cell (c) Cortex cell (d) None of these 65. Silicon may comprises of ..... present of the dry matter of Equisetum arvensis. (a) 16 (b) 21 (c) 10 (d) None of these 66. Silicon may comprises of ...... present of the dry matter of maize. (a) 12–16 (b) 9–10 (c) 4–5 (d) 1–2 Ans.

59. (b) 70. (d)

60. (c) 71. (c)

61. (b) 72. (c)

62. (c) 73. (e)

63. (b) 74. (b)

68. ...... is the activator of carbonic anhydrase. (a) Calcium (b) Potassium (c) Zinc (d) None of these

70. The sensitivity of chlorophyll to light destruction ...... under condition of ...... deficiency. (a) Decreases, iron (b) Increases, iron (c) Decreases, manganese (d) Increases, manganese (e) None of the above

72. Manganese acts as an activator of which of the following enzyme? (a) Hydroxylamine reductase (b) Nitrate reductase (c) Both (d) None of these 73. Magnesium is most frequent replacer of: (a) Mn (b) Fe (c) Zn (d) Co (e) None of these 74. ...... is an essential element in nitrogen metabolism and respiration, in both processes it functions as an enzyme activator. (a) Sulphur (b) Manganese (c) Iron (d) None of these 64. (b)

65. (a)

66. (d)

67. (c)

68. (c)

69. (d)

Mineral Nutrition of Plants

75. Which of the following form of iron is considered as metabolically active form of iron in plant? (a) Ferrous form (b) Ferric form (c) Both (d) None of these 76. Under sulphur deficiency ...... leaves showed chlorosis first. (a) No any (b) Older (c) Younger (d) None of these 77. Which of the following element is involved in the metabolic activity of biotin, thiamine, and coenzyme A? (a) Calcium (b) Magnesium (c) Sulfur (d) None of these 78. PAPS (3’phosphoadenosine–5’–phosphosulfate), an active compound is involved in the reduction of: (b) SO42– (a) CO32– (c) Both A and B (d) None of these 79. Apical dominance in several plants appears to be lacking or weak due to deficiency of: (a) Sulfur (b) Magnesium (c) Potassium (d) None of these 80. The highest concentration of potassium is found in which region of the plants? (a) Zone of the maturation (b) Meristematic region (c) Both (a) and (b) (d) None of these 81. According to Lyon and arcia, abundant supply of magnesium caused a depression of internal ...... development and an ...... of parenchymatous cells adjacent to the endodermis: (a) Xylem, decrease (b) Xylem, increase (c) Phloem, increase (d) None of these 82. Among the following enzymes involved in carbohydrate metabolism, Ans.

75. (a) 86. (b)

76. (c) 87. (c)

77. (c) 88. (b)

78. (b) 89. (b)

79. (c)

59

which has requirement of Mg2+ as an activator? (a) Phosphopenkinase (b) Enolase (c) Carboxylase (d) All of the above 83. Carbohydrate metabolism in plants is affected by the deficiency of: (a) Calcium (b) Potassium (c) Magnesium (d) None of these 84. Calcium deficiency in .... plants results in the increased level of carbohydrate in the ...... and decreased levels in the ...... and ...... (a) Sugarcane, leaves, stems, roots (b) Cotton, leaves, stems, roots (c) Cotton, stems, leaves, roots (d) None of the above 85. Among the followings, which element is the activator of many enzymes such as argenin kinase, adenosine triphosphate, adenyl kinase and potato apyrase. (a) Potassium (b) Calcium (c) Both A and B (d) None of these 86. Abnormal mitosis occurs due to the deficiency of: (a) Potassium (b) Calcium (c) Magnesium (d) None of these 87. The partial removal of calcium from the middle lamella of the cell can be done through the application of: (a) Sulfuric acid (b) Pectic acid (c) EDTA (d) All of these 88. According to Eaton, deficiency of phosphorus in synflower, soybean and black mustard causes accumulation of ...... . (a) Lipid (b) Carbohydrate (c) Protein (d) None of these 89. Purple and red anthocyanin pigmentation of leaf can occur due to deficiency of: (a) Potassium (b) Phosphorus (c) Nitrogen (d) None of these 80. (b)

81. (c)

82. (d)

83. (c)

84. (b)

85. (b)

60

Plant Physiology: Question Bank

90. Many symptoms of phosphorus deficiency can be confused with the deficiency of: (a) Potassium (b) Iron (c) Nitrogen (d) None of these

98. Deficiency of which element makes plant more susceptible to fungal infection and lodging? (a) Nickel (b) Silicon (c) Both A and B (d) None of these

91. Phosphorus is found in plants as a constituent of: (a) The coenzymes of NAD and NADP (b) Phospholipids (c) Nucleic acid (d) All of these

99. Equisetaceae (Scouring rushes) requires silicon to complete their life cycle where it may contain up to ...... % of the dry matter. (a) 16 (b) 20 (c) 10 (d) None of these

92. ...... reported a decrease in the leaf epidermal cell size due to nitrogen deficiency in millet and buckwheat. (a) Garcia (b) Lyon (c) Lutmen (d) None of these

100. Calcium is an important constituent of: (a) Middle lamella (b) Secondary cell wall (c) Primary cell wall (d) All of the above

93. In general, it is considered that symptoms of boron deficiency are the symptoms of ...... deficiency: (a) Lipid (b) Sugar (c) Protein (d) None of these

101. Magnesium is an important component of: (a) Phaeophytin (b) Chlorophylls (c) Cytochrome (d) All of these

94. ...... have built a strong case for the involvement of boron in carbohydrate transport within the plant: (a) Dugger (b) Gauch (c) Both (a) and (b) (d) None of these

102. Which of the following contains copper? (a) Plastocyanin (b) Cytochrome oxidase (c) Both (a) and (b) (d) None of these

95. Which of the following enzyme depends on zinc for their activity? (a) Pyridine nucleotide dehydrogenase (b) Carbonic anhydrase (c) Alcohol dehydrogenase (d) All of the above

103. Iron is an important component of: (a) Cytochromes (b) Siroheme (c) Ferredoxin (d) All of these

96. Most important role of manganese is in: (a) Photolysis of water and oxygen evolution in photosynthesis (b) Reduction of nitrate (c) Phosphate transfer reaction (d) All of the above 97. Which of the following is the sulfur containing amino acid? (a) Cystine (b) Methonine (c) Cysteine (d) All of the above Ans.

104. Soil less culture is also known as: (a) Aeroponics (b) Hydroponics (c) Both (a) and (b) (d) None of these 105. Among the followings, this of the following substance is used in hydroponics growth system: (a) Sand (b) Gravel (c) Vermiculite (d) All of these 106. Excluding sodium and silicon, how many different elements are considered essential for normal growth and development of majority of plants? (a) 17 (b) 20 (c) 19 (d) None of these

90. (c) 91. (d) 92. (c) 93. (b) 94. (c) 95. (d) 101. (b) 102. (c) 103. (d) 104. (b) 105. (d) 106. (a)

96. (a)

97. (d)

98. (b)

99. (a) 100. (a)

Mineral Nutrition of Plants

61

107. Which of the following enzyme contains Mo in its prosthetic group? (a) Nitrate reductase (b) Nitrogenase (c) Both (a) and (b) (d) None of these

116. Die-back of citrus and reclamation disease of cereals and leguminous plants are due to the deficiency of: (a) Copper (b) Boron (c) Zinc (d) None of these

108. Which of the following element is the cofactor of the enzyme urease in higher plants? (a) Chloride (b) Nickel (c) Mo (d) None of these

117. Mottled chlorosis of leaves occurs due to the deficiency of: (a) Calcium (b) Potassium (c) Magnesium (d) None of these

109. Whip tail disease in cauliflower occurs due to: (a) Mo deficiency (b) Nickel deficiency (c) Chloride deficiency (d) None of the above 110. Specific role of boron in plant is: (a) In hormonal synthesis (b) In respiration (c) In photosynthesis (d) None of the above 111. Leaves become coppery in texture due to the deficiency of: (a) Zinc (b) Copper (c) Boron (d) None of these 112. Which of the following element facilitates translocation of sugar? (a) Copper (b) Boron (c) Zinc (d) None of these 113. Mottle leaf disease in apple, citrus, walnut and other fruit trees are due to the deficiency of: (a) Copper (b) Boron (c) Zinc (d) Molybdenum 114. ...... deficiency causes chlorosis of the older leaves which starts from tips and margins. (a) Copper (b) Boron (c) Zinc (d) Molybdenum 115. Which of the following element has role in auxin biosynthesis? (a) Copper (b) Boron (c) Zinc (d) Molybdenum

118. Magnesium deficiency causes ...... of the leaves: (a) Marginal (b) Intervenial (c) Both (a) and (b) (d) None of these 119. Due to the calcium deficiency: (a) Malformation of younger leaves (b) There is degradation of meristematic region of plant (c) Yellowing occurs along the margins of the younger leaves (d) All of the above 120. Which of the following element act as second messenger in metabolic regulation? (a) Potassium (c) Iron (c) Calcium (d) None of these 121. Due to S deficiency: (a) Stem become hard due to the development of sckerenchyma (b) Tips of margins of the roll inward (c) Both A and B (d) None of these 122. In S deficiency ...... leaves are affected first. (a) Younger (b) Older (c) Both A and B (d) None of these 123. Due to the P deficiency: (a) Premature leaf falls (b) Leaves may change dark to blue– green in colour (c) Dead necrotic area may be developed on leaves or fruits (d) All of the above

Ans. 107. (c) 108. (b) 109. (a) 110. (d) 111. (c) 112. (b) 113. (c) 114. (c) 115. (c) 116. (a) 117. (b) 118. (b) 119. (d) 120. (a) 121. (c) 122. (a) 123. (d)

62

Plant Physiology: Question Bank

124. In nitrogen deficiency which of the following leaves are affected first? (a) Younger (b) Older (c) Both (a) and (b) (d) None of these

131. Which of the following substances is not used in hydroponic growth system? (a) Vermiculate (b) Sand (c) Gravel (d) None of these

125. Stable (or heavy) isotopes are measured quantitatively by an apparatus called: (a) Photo–spectrometer (b) Mass spectrometer (c) Both (a) and (b) (d) None of these

132. The practice of growing plants in nutrient enriched water without soil is called: (a) Hydroponics (b) Solution culture (c) Aeroponics (d) None of these

126. Radioactive isotopes are measured quantitatively by an apparatus called: (a) Geiger–Muller Counter (b) Scintillation Counter (c) Mass spectrometer (d) More than one is correct

133. Nickel deficiency in plants results in: (a) Chlorosis of leaves (b) Necrosis of leaves (c) Both (a) and (b) (d) None of the above

127. According to Epstein, there are ...... main criteria for judging essentiality of an element in plant: (a) Four (b) Three (c) Two (d) None of these 128. Excluding sodium and silicon, how many different elements are considered essential for normal growth and development of majority of plants? (a) 19 (b) 20 (c) 17 (d) 15 129. In aeroponics, the plants roots are suspended: (a) In thin film of nutrient solution (b) Freely in the air (c) In a nutrients mist chamber (d) None of the above 130. Vermiculite, which is used in hydroponic growth system as special soil is: (a) Expanded clay (b) A group of low grade micas in exfoliated form (c) Rich in nutrient (d) None of the above

134. A trace element which is cofactor of enzyme urease is: (a) Cl (b) Mo (c) Ni (d) None of these 135. Bronzing of the leaves is typically used by the deficiency of: (a) Cl (b) Mo (c) Fe (d) None of these 136. Chloride ions play an important role in: (a) Nitrogen fixation (b) Photolysis of water and O2 evolution in photosynthesis (c) Glycolysis (d) None of the above 137. Whiptail disease of cauliflower plants is caused by the deficiency of: (a) Ni (b) Fe (c) B (d) Mo 138. Which of the following enzymes contain Mo in its prosthetic group? (a) Nitrogenase (b) Nitrate reductase (c) Both (a) and (b) (d) None of the above

Ans. 124. (b) 125. (b) 126. (d) 127. (c) 128. (c) 129. (c) 130. (b) 131. (d) 132. (a) 133. (b) 134. (c) 135. (a) 136. (b) 137. (d) 138. (c)

Mineral Nutrition of Plants

139. The specific role of boron in plants is: (a) Not clear (b) In the synthesis of auxin (c) In the respiration (d) In the photosynthesis 140. An important copper deficiency symptom in plants is: (a) Necrosis of the tip of older leaves (b) Necrotic spots on the stems (c) Necrosis of the tip of young leaves (d) Interveninal chlorosis of leaves 141. Which of the following contains copper? (a) Cytochrome oxidase (b) Plastocyanin (c) Both (a) and (b) (d) None of the above 142. Typical symptoms of Mn deficiency in plants are: (a) Interveinal chlorotic and necrotic spots on the leaves (b) Interveinal chlorosis (c) Necrotic spots on the leaves (d) Chlorosis of leaves 143. Most important role of manganese is in: (a) Phosphate transfer reactions in carbohydrate metabolism (b) Photolysis of water and O2 evolution in photosynthesis (c) Reduction of nitrates (d) None of the above 144. Iron is an important component of: (a) Cytochromes (b) Ferredoxin (c) Siroheme (d) All of these 145. Typical symptoms of iron deficiency in plants is: (a) Chlorosis of leaf margins (b) Interveinal chlorosis of leaves first in older leaves (c) Interveinal chlorosis of leaves first in young leaves (d) None of the above

63

146. Regarding potassium, choose the correct statement: (a) It activates many enzymes involved in respiration and photosynthesis (b) It occurs in plants cations (c) It plays important role in the regulation of osmotic potential of the plant cells (d) All of the above 147. Typical symptom of magnesium deficiency in plants is: (a) Chlorosis of leaf margins (b) Interveinal chlorosis of leaves first in older leaves (c) Interveinal chlorosis of leaves first in young leaves (d) None of the above 148. Magnesium is an important component of: (a) Cytochromes (b) Chlorophylls (c) Phaeophytin (d) All of these 149. Calcium plays important role in plants in: (a) Signal transduction pathways as second messenger (b) Photosynthesis (c) Respiration (d) None of the above 150. Calcium is an important constituent of: (a) Secondary cell wall (b) Middle lamella (c) Primary cell wall (d) All of the above 151. Chlorosis of leaves due to sulfur deficiency usually begins first in: (a) Young leaves (b) Older leaves (c) Unfolding leaves (d) None of these 152. Which of the following amino acids does not contain sulfur? (a) Cystine (b) Cysteine (c) Methonine (d) Histidine

Ans. 139. (a) 140. (c) 141. (c) 142. (a) 143. (b) 144. (d) 145. (c) 146. (d) 147. (b) 148. (b) 149. (a) 150. (b) 151. (a) 152. (d)

64

Plant Physiology: Question Bank

153. Which of the following is not a deficiency symptom of phosphorus? (a) Dark green coloration of leaves (b) Chlorosis of leaves (c) Necrotic areas on leaves or fruits (d) Fallen of premature leaves 154. Phosphorus is not a constituent of: (a) Coenzyme A and coenzyme II (b) ATP (c) Cell membranes (d) None of the above 155. Chlorosis of leaves due to deficiency of nitrogen begins first in: (a) Older leaves (b) Young leaves (c) Unfolding leaves (d) All of these 156. An important constituent of proteins, nucleic acids, prophyrins and alkaloids is: (a) Ca (b) S (c) N (d) Mg 157. Carbon is taken by plants from the air in the form of: (a) Solid (b) Gas (c) Liquid (d) All of these 158. Which of the following elements are non-mineral essential elements? (a) P, Ca and Mg (b) C, H and O (c) F, Mn and Zn (d) None of these 159. The example of micronutrients or trace elements are: (a) N, P and K (b) Cl and Mo (d) All of these (c) 32P and 45Ca 160. Which of the following elements are tracer elements? (a) C, H and O (b) B, Cu and Ni (c) 14C, 15N and 18O (d) None of these 161. Which of the following elements are not called major elements or macronutrients? (a) Fe, Zn and Mo (b) Ca, S and Ni (c) N, P and K (d) C, H and O

162. In the following questions, a statement of assertion (A) is followed by a statement of reason (R) (a) If both Assertion and Reason are true and the Reason is the correct explanation of the Assertion, than the answer is (a). (b) If both Assertion and Reason are true and the Reason is not the correct explanation of the Assertion, than the answer is (b). (c) If the Assertion is true statement but Reason is false, than the answer will (c). (d) If both Assertion and Reason are false statements, than your answer will (d). (i) A: Soybean exports the fixed nitrogen as ureides. R: Amides contain excess nitrogen and they are transported via phloem sieve tubes. (ii) A: Ammonia is oxidized first to nitrate than to nitrite by the action of Nitrosomonas and Nitrobacter respectively. R: Nitrite thus formed is absorbed by leaves. (iii) A: All the diverse minerals element found in plants are not essential for them. R: Some plants accumulate heavy and toxic minerals such as gold and selenium from the soil. (iv) A: Jar for nutrient solution culture contains a split cover with holes which hold a bent tube for aeration. R: Regular aeration of the culture solution is necessary for proper growth and activities of the roots. (v) A: Manganese toxicity cause brown spots, chlorotic veins and inhibition of calcium translocation to shoot apex. R: Toxic effects may be due to direct excess of micronutrients or its interference in the absorption and functioning of other nutrients.

Ans. 153. (b) 154. (d) 155. (a) 156. (c) 157. (b) 158. (b) 159. (b) 160. (c) 161. (a) 162. (i) (c) (ii) (d) (iii) (b) (iv) (a) (v) (a)

Mineral Nutrition of Plants

(vi) A: Influx of ions into inner space of cells is an active process. R: Ions are available for free exchange in the free space. (vii) A: N, P, K are called critical elements. R: They become deficient easily in the soil due to leaching and higher requirement. (viii)A: Chelating agents used in improving availability of some minerals in the soil are actually electron acceptors. R: They increase solubility of some minerals in acidic soils. (ix) A: Bacteria enter only the polyploidy cells of the root cortex. R: These cells provide cytokinins to bacteria that promote bacteria cell division. (x) A: Some mineral nutrients are essential. R: They can be synthesized by the plants. 163. Roots of the plant which contains a red pigment which has affinity for oxygen: (a) Radish (b) Mustard (c) Soybean (d) Carrot 164. Nitrogen fixation in root nodules of Alnus is brought about by: (a) Frankia (b) Clostridium (c) Bradyhizobium (d) Aerohizobium 165. Leguminous plants are able to fix atmospheric nitrogen through the process of symbiotic nitrogen fixation. Which one of the following statements is not correct during this process of nitrogen fixation? (a) Nitrogenase is insensitive to oxygen (b) The enzyme nitrogenase catalyses the conversion of atmospheric N2 to NH3 (c) Nodules act as sites for nitrogen fixation (d) Leghemoglobin scavenges oxygen and is pinkish in color Ans.

(vi) (b) (vii) (a) (viii) (d) (ix) (b) 169. (a) 170. (d)

65

166. The common nitrogen–fixer in paddy fields is: (a) Oscillatoria (b) Azospirillum (c) Rhizobium (d) Frankia 167. One of the free-living anaerobic nitrogen-fixer is: (a) Rhizobium (b) Rhodospirillum (c) Beijernickia (d) Azotobacter 168. Which of the following statements is correct? (a) Extensive use of chemical fertilizers may lead to eutrophication of nearby water bodies (b) At present, it is not possible to grow maize without chemical fertilizers (c) Cynobacteria such as Anabaena and Nostoc are important mobilizers of phosphates and for plant nutrition in soil (d) Both Azotobacter and Rhizobium fix atmospheric nitrogen in root nodules of plants 169. Which of the following is a flowering plant with nodules containing filamentous nitrogen-fixing microorganism? (a) Casuarina equisetifolia (b) Cicer arietinum (c) Cycas revolute (d) Crotalaria juncea 170. If by radiation all nitrogenase enzymes are inactivated, then there will be no: (a) Conversion from ammonium to nitrate in soil (b) Conversion from nitrate to nitrite in legumes (c) Fixation of atmospheric nitrogen (d) Fixation of nitrogen in legumes

(x) (c) 163. (d) 164. (a) 165. (a) 166. (a) 167. (b) 168. (a)

66

Plant Physiology: Question Bank

171. A free living nitrogen-fixing cynobacterium which can also form symbiotic association with the water fern Azolla is: (a) Anabaena (b) Nostoc (c) Chlorella (d) Tolypothrix 172. Enzyme first used for nitrogen fixation: (a) Transaminase (b) Transferase (c) Nitroreductase (d) Nitrogenase 173. Which of one the following mineral elements play an important role in biological nitrogen fixation: (a) Molybdenum (b) Zinc (c) Manganese (d) Copper 174. Which of one the following statements is correct? (a) Legumes are incapable of fixing nitrogen (b) Legumes fix nitrogen only through specialized bacteria that live in their leaves (c) Legumes fix nitrogen independently of the specialized bacteria that live in their roots (d) Legumes fix nitrogen only through specialized bacteria that live in their roots 175. Leghemoglobin is: (a) A plant protein with high lysine content (b) An oxygen acavenger in the root nodules (c) A protein used as food supplement (d) An oxygen carrier in human blood 176. In root nodules of legumes. Leghemoglobin is important because it: (a) Act as a catalyst in transmination (b) Provides energy to the nitrogen fixing bacterium (c) Act as an oxygen scavenger (d) Transport oxygen to the root nodule

177. A prokaryotic autotrophic nitrogen fixing symbiont is found in: (a) Cicer (b) Cyas (c) Alnus (d) Pisum 178. For its action, nitrogenase requires: (a) Super oxygen radicals (b) Light (c) Mn2+ (d) High input of energy 179. The function of leghemoglobin in the root nodules of legume is: (a) Nodule differentiation (b) Oxygen removal (c) Inhibition of nitrogenase actively (d) Expression of nif gene 180. Which of one the following is the wrong statement? (a) Root nodule forming nitrogen fixer live as aerobes under free-living conditions (b) Anabaena and Nostoc are capable of fixing nitrogen in free-living state also (c) Nitrosomonas and Nitrobacter are chemoautotrophs (d) Phosphorus is a consituent of cell membranes, certain nucleic acids and all proteins 181. The first stable fixation of atmospheric nitrogen in leguminous plants is: (b) Glutamate (a) NO2– (d) Ammonia (c) MNO3– 182. Passive absorption of minerals depends on: (a) Auxin (b) Temperature (c) Metabolic inhibitor (d) Temperature and metabolic inhibitor 183. Nitrifying bacteria: (a) Convert proteins into ammonia (b) Convert free nitrogen to nitrogen compounds (c) Oxidize ammonia to nitrates (d) Reduce nitrates to free nitrogen

Ans. 171. (a) 172. (d) 173. (a) 174. (d) 175. (b) 176. (c) 177. (b) 178. (d) 179. (b) 180. (d) 181. (d) 182. (b) 183. (c)

Mineral Nutrition of Plants

184. Which two distinct microbial processes are responsible for the release of fixed nitrogen as dinitrogen gas (N2) to the atmosphere? (a) Enteric fermentation in cattle, and nitrogen fixation by Rhizobium in the root nodules of legumes (b) Decomposition of organic nitrogen and conversion of dinitrogen to ammonium compounds (c) Aerobic nitrate oxidation and nitrite reduction (d) Anaerobic ammonium oxidation and denitrification 185. The deficiencies of micronutrients are not only affects growth of plants but also vital functions such as photosynthetic and mitochondrial electron fellow. Among the given below which group of three elements shall affect most, both photosynthetic and mitochondrial electron transport? (a) Cu, Mn, Fe (b) Mn, Co, Ca (c) Ca, K, Na (d) Co, Ni, Mo 186. Grey spots of oat are caused by the deficiency of: (a) Fe (b) Mn (c) Zn (d) Cu 187. The major portion of the dry weight of plants comprises: (a) Carbon, hydrogen and oxygen (b) Carbon, nitrogen and hydrogen (c) Calcium, magnesium and sulfur (d) Nitrogen, phosphorus and potassium 188. When the plants are grown in magnesium deficient but urea rich soil, the symptoms expressed are: (a) Shoot apex die (b) Dark green leaves (c) Colorless petiole (d) Yellowish leaves

67

189. Which of the following is not caused by deficiency of mineral nutrition? (a) Chlorosis (b) Necrosis (c) Shortening of internodes (d) Etiolation 190. Necrosis in crops is due to the deficiency of: (a) Mg, S, Mn and Ca (b) N, S, Fe and Zn (c) Ca, K, S and Mo (d) N, K, S, and Mo 191. Which one of the following is not a micronutrient? (a) Zinc (b) Magnesium (c) Molybdenum (d) Boron 192. An element playing important role in nitrogen fixation is: (a) Manganese (b) Cooper (c) Molybdenum (d) Zinc 193. Manganese is required in: (a) Photolysis of water during photosynthesis (b) Plant cell wall formation (c) Nucleic acid synthesis (d) Chlorophyll synthesis 194. Which one of the following elements is not an essential micronutrient for plant growth? (a) Mn (b) Ca (c) Cu (d) Zn 195. A plant requires magnesium for: (a) Holding cells together (b) Cell wall development (c) Chlorophyll synthesis (d) Protein synthesis 196. Sulfur is an important nutrient for optimum growth and productivity in: (a) Fiber crops (b) Cereals (c) Pulse crops (d) Oil seed crops

Ans. 184. (d) 185. (a) 186. (b) 187. (a) 188. (d) 189. (d) 190. (c) 191. (b) 192. (c) 193. (a) 194. (b) 195. (c) 196. (d)

68

Plant Physiology: Question Bank

197. The most abundant element present in the plants: (a) Iron (b) Carbon (c) Nitrogen (d) Manganese 198. Boron in green plants assists in: (a) Sugar transport (b) Photosynthesis (c) Acting as enzyme cofactor (d) Activation of enzymes 199. Element necessary for the middle lamella is: (a) Cu (b) Ca (c) Zn (d) K 200. Which one of the following elements is almost non-essential for plants? (a) Mo (b) Ca (c) Na (d) Zn 201. Plant takes zinc in the form of: (a) Zn (b) ZnO (d) Zn++ (c) ZnSO4 202. Which one of the following is not essential mineral element for plants while the remaining three are? (a) Manganese (b) Cadmium (c) Phosphorus (d) Iron 203. Which one of the following is essential for photolysis of water? (a) Zinc (b) Manganese (c) Boron (d) Copper 204. Which one of the following elements in plants is not remobilized? (a) Potassium (b) Phosphorus (c) Calcium (d) Sulfur 205. Best defined function of manganese in green plants is: (a) Calvin cycle (b) Photolysis of water (c) Water absorption (d) Nitrogen fixation 206. Which one of the following element is a constituent of biotin? (a) Phosphorus (b) Calcium (c) Magnesium (d) Sulfur

207. Essential elements are: (a) C, H, O and N only (b) Micronutrients only (c) Macronutrients only (d) Both B and C 208. Ureides are preferred forms for storage and transport of amines in: (a) Allium cepa (b) Glycine max (c) Solanum nigrum (d) Triticum aestivum 299. Transported and storage form of nitrogen in plants are: (a) -ketoglutaric acid (b) Amino acids (c) Polypeptides (d) Amides 210. The amino acid which plays a central role in nitrogen metabolism is/are: (a) Aspartic acid (b) Glutamic acid (c) -ketoglutaric acids (d) Double aminated keto acids 211. Cycas and Azolla plants are associated with: (a) Rhizobium (b) Bacillus (c) Klebsiella (d) Anabaena 212. Nitrogenase enzyme found in root nodules in legumes contains: (a) Mo, B and S (b) Mo, Fe and S (c) Co, Mo and Ca (d) Mo, Mn and S 213. Select the correct statements from the given below: A: Nitrogenase is a heterodimeric protein B: Root hairs curl by the action of nitrogenase and plant ‘nod–factors’ C: During symbiotic N2 fixation ATP is provided by legume plant (a) A and B (b) B and C (c) A and C (d) Only C

Ans. 197. (b) 198. (a) 199. (b) 200. (c) 201. (d) 202. (b) 203. (b) 204. (c) 205. (b) 206. (d) 207. (d) 208. (b) 209. (d) 210. (b) 211. (d) 212. (b) 213. (c)

Mineral Nutrition of Plants

214. How many electron and protons are required to fix a dinitrogen? (a) 32 Each (b) 16 Each (c) 8 Each (d) 4 Each 215. Leghemoglobin is found in which one of the following organisms? (a) Groundnut (b) Nostoc (c) Aulosira (d) Anthoceros 216. Which is not true for nitrogenase enzyme in root nodules in legumes? (a) Resistant to O2 concentration (b) It is a Mo–Fe protein (c) Site of reduction of N2 into NH3 (d) Synthesized by nif genes of rhizobium 217. Which of the following is/are diazotrophs? (a) Rhizobium and Azotobacter (b) Anabaena and Nostoc (c) Frankia and Klebsiella (d) All of the above 218. ...... are the most common form of nitrogen uptake and usable forms for plants respectively. (a) NH2 : NO2– (b) NO3– : NH3 (c) NH3 : NO3– (d) NO3– : NO2– 219. Conversion of NO2  NO2  NH3 is called ...... and catalysed by ......: (a) Denitrification, transaminase (b) Ammonification, glutamate dehydrogenase (c) Nitrification, nitrate and nitrite reductase (d) Nitrate assimilation, nitrate and nitrite reductase 220. The process of nitrification and nitrate assimilation are: (a) Reduction and oxidation respectively (b) Oxidation and reduction respectively (c) Both are reduction (d) Both are oxidation

69

221. The process of conversion of 2NO–2  2NO–2  2NO  N2O  N2 is called ...... and is done by ...... (a) Ammonification, bacillus (b) Nitrate assimilation, nitrogenase (c) Dentrification, pseudomonas (d) Nitrification, nitrosomonas 222. The translocation of solute is: (a) Through xylem vessel (b) Equal to the rate of translocation of water (c) Dependent on the transpiration pull (d) All of the above 223. Initial phase of ion uptake: (a) Is active process (b) Is passive and apoplastic (c) Occurs through symplast (d) More than one option is correct 224. Movement of electrolytes through the roots is generally: (a) Dependent on aquaporins (b) A passive process (c) Along electrochemical gradient and does not require energy (d) Against electrochemical gradient and require energy 225. Hunger signs in the plants: (a) Symptoms due to excess water absorption in plants (b) Deficiency symptoms of mineral nutrients (c) Symptoms due to poor water absorption in plants (d) Symptoms due to photosynthesis in plants 226. Select the correct statements among the following: A: Moderate decrease of increase of microbnutrients causes deficiency and toxicity symptoms respectively B: Excess of manganese causes toxicity of iron, calcium and molybdenum

Ans. 214. (c) 215. (a) 216. (a) 217. (d) 218. (b) 219. (d) 220. (b) 221. (c) 222. (d) 223. (b) 224. (d) 225. (b)

70

Plant Physiology: Question Bank

C: A macronutrient is said to be toxic when present blow a critical concentration (a) A and C (b) B and C (c) Only B (d) Only A 227. Mineral, which is a part of CoA, Fd, thiamine and lipoic acid is: (a) Ca (b) S (c) Fe (d) Mn 228. Tryptophan synthesis, carboxylase activity and little leaf of the plants are all associated with: (a) Cu (b) Ca (c) B (d) Zn 229. Silicon, cobalt, sodium and selenium are: (a) Trace elements (b) Macronutrients (c) Absorbed by higher plants (d) Essential minerals 230. Find odd one (w.r.t. critical element): (a) Phosphorus (b) Nickel (c) Potassium (d) Nitrogen 231. Find the non–trace element: (a) K (b) Mo (c) Cu (d) Mn 232. If the chloroplast is burnt, than which of the following is left: (a) Sulfur (b) Iron (c) Manganese (d) Magnesium 233. Which of the following elements are required for chlorophyll synthesis? (a) Ca and K (b) Cu and Ca (c) Mo and Ca (d) Fe and Mg 234. Find the groups of the elements which are mobile? (a) Cl and K (b) B, K and N (c) Ca, Mg and P (d) Fe, Ca and B

235. Minerals which maintain cation– anion balance in the cells? (a) Ca and Fe (b) K and P (c) Fe and Cu (d) Cl and K 236. Minerals associated with redox reactions: (a) Mn and Mo (b) Fe and K (c) Fe and Cu (d) N and Cu 237. Deficiency of nitrogen is caused by the deficiency of: (a) S (b) Mn (c) K (d) Mo 238. Find the correct option regarding micronutrient: (a) Little role in protoplasmic structure (b) Become toxic in excess (c) No role in enzyme activation (d) Both (a) and (b) 239. Choose the incorrect statement regarding macronutrients: (a) Develop osmotic potential (b) Forms plant structure (c) Usually become toxic in excess (d) No role in electron transfer 240. Which is not a criteria for essentiality of a mineral? (a) Dispensible for growth (b) Deficiency causes hunger sign (c) Requirement is specific (d) Direct role in metabolism 241. Growing plants in a nutrient solution: (a) Requires prevention of reaction of light with roots (b) Also allows the growth of algae in containers (c) Was first demonstrated by Arnon and Hogland (d) Involves use of chelating agent Na– EDTA to keep iron unavailable to plants

Ans. 226. (d) 227. (b) 228. (d) 229. (c) 230. (b) 231. (a) 232. (d) 233. (c) 234. (a) 235. (d) 236. (c) 237. (d) 238. (d) 239. (c) 240. (a) 241. (a)

Mineral Nutrition of Plants

242. Which of the following is an amide involved in nitrogen metabolism by plants? (a) Serine (b) Asparagine (c) Cysteine (d) Glutamate 243. The function of amides is all, except: (a) Transport of nitrogen (b) Storage of excess nitrogen (c) Structural part plant protein (d) Part of the functional proteins 244. With regard to the biological nitrogen fixation by rhizobium, select the wrong statement. (a) Nitrogenase helps to convert N2 gas into two molecules of ammonia (b) Nitrogenase may require oxygen for its functioning (c) Nitrogenase is Mo–Fe protein (d) Leghemoglobin is a pink-colored pigment 245. Leghemoglobin pigment is present in the roots of: (a) Potato (b) Maize (c) Rice (d) Alfalfa 246. The following equation is referring to: N2 + 8e– + 8H+ + 16ATP  2NH3 + H2 + 16ADP + 16P1

(a) Nitrogen fixation (b) Dentrification (c) Nitrification (d) Ammonification 247. The function of leghemoglobin during N2-fixation: (a) To protect nitrogenase from oxygen (b) To supply O2 for nitrogenase activity (c) To convert NH3 to N2 (d) To convert N2 to NH3

71

248. Enzyme nitrogenase is: (a) Essential to convert NO 2– to NO 3– (b) An O2 requiring enzyme (c) Found in prokaryotes only (d) A Cu–Fe protein 249. Amides are transported to the other parts of plant through: (a) Cyclosis and active transport (b) Parenchyma (c) Phloem (d) Xylem 250. Non-symbiotic nitrogen fixing prokaryote is: (a) Rhizobium (b) Acetobacter (c) Azotobacter (d) Frankia 251. ATP are required for the formation of one molecule of NH3 by nitrogenase enzyme: (a) 16 (b) 12 (c) 16 (d) 8 252. Reaction carried out by N2 metabolism microbes include: II. 2NH3 + 3O2  2NO–2 + 2H+ + 2H2O II. 2NO2– + O2  2NO3– Which of the following statements about these equations in not true? (a) Bcteria carrying out these steps is usually photoautotrophs (b) Both steps I and II can be called nitrification (c) Step II is carried out by Nitrobacter (d) Step I is carried out by Nitrosomonas or Nitrococcus 253. The free living aerobic and saprotrophic N2–fixing microbe is: (a) Anabaena (b) Rhizobium (c) Rhodospirillum (d) Azotobacter NO2–  NO3– is 254. Conversion of NH3  called: (a) Biological N2-fixation (b) Dentrification (c) Nitrification (d) Ammonification

Ans. 242. (b) 243. (d) 244. (b) 245. (d) 246. (a) 247. (a) 248. (c) 249. (d) 250. (c) 251. (d) 252. (a) 253. (d) 254. (c)

72

Plant Physiology: Question Bank

255. A prokaryote responsible for converting ammonia to nitrites: (a) Rhizobium (b) Nitrocystis (c) Nitrobacter (d) Nitrosomonas 256. The death of leaf tissue in plants caused by deficiency of: (a) Mo and C (b) Ca and Mg (c) Zn and S (d) Mo and S 257. The group of micronutrients which is required for mitochondrial and photosynthetic electron transport: (a) N, P and K (b) Co and Ni (c) Cu and Fe (d) Ca, K and Na 258. Mark the correct sequcene of steps for the development of root nodules in legumes: A: Formation of infection thread B: Divison of cortical and pericyclic cells C: Curling of the root hairs D: Leghemoglobin synthesis (a) C, A, B, D (b) C, B, A, D (c) B, D, A, C (d) A, C, B, D 259. Boron takes part is: (a) Nitrogen metabolism (b) Transport of carbohydrates through phloem (c) Acitivation of enzymes involved in respiration (d) Photosynthesis 260. An element essential for nitrogen metabolism is: (a) Mn (b) Mg (c) Mo (d) K 261. Mineral present in cytochrome is commonly: (a) Mn (b) Mg (c) Mo (d) Fe 262. Plants absorb zinc as: (a) Zn(NO3)2 (b) Zn2+ (c) ZnSO4 (d) Zn

263. The deficiency symptom of an element tend to appear first in the young leave. It indicates that element is relatively immobile. Which one of the following elemental deficiency would show symptoms? (a) K (b) N (c) Mg (d) S 264. An element involved in the metabolism of urea is: (a) Zn (b) Ni (c) Si (d) Na 265. Which of the following is not a physiological role of potassium? (a) To synthesize auxins (b) To help in the opening and closing of stomata (c) To maintain turgidity of the cells (d) To maintain anion–cation balance in cells 266. Amino acid like methionine and cysteine contain: (a) Cl (b) B (c) S (d) Zn 267. All are the elements whose deficiency symptoms first appear in the older tissues, except: (a) Calcium (b) Potassium (c) Magnesium (d) Nitrogen 268. The essential element that activates enzymes ruBisCo and pepco, also: (a) Forms constitutents of phytol tail of chlorophyll (b) Essential for water splitting reactions (c) Helps in carbohydrate translocation (d) Needed in the activity of pyruvic acid decarboxylase 269. An immobile element present in plant tissues is: (a) K (b) Ca (c) P (d) N

Ans. 255. (d) 256. (b) 257. (c) 258. (a) 259. (b) 260. (c) 261. (d) 262. (b) 263. (a) 264. (b) 265. (a) 266. (c) 267. (a) 268. (d) 269. (b)

Mineral Nutrition of Plants

270. Component of nitrogenase and nitrate reductase is: (a) N (b) P (c) Ca (d) Mo 271. A micronutrient which is the component of all organic compounds but is not a mineral element: (a) C (b) Mg (c) Fe (d) P 272. Zinc activates the enzyme which is: (a) Alcohol dehydrogenase (c) Catalase (c) Nitrogenase (d) Nitrate reductase 273. The anion–cation balance in plants cells is due to essential element like: (a) Iron (b) Sodium (c) Calcium (d) Potassium 274. The group, whose elements are mobile: (a) Ca, N, and P (b) N, P, K (c) Ca, Mg and S (d) Ca, s and Fe 275. Plants which are deficient in zinc will show reduction in the biosynthesis of: (a) Auxin (b) Ferredoxin (c) Coenzyme A (d) Ethylene 276. An element which helps in the joining of the subunits of ribosomes is: (a) S (b) Ca (c) Mg (d) K 277. Element present in middle lamella is: (a) K (b) Ca (c) Cu (d) Zn 278. Select the wrong match: (a) Zn– Constituent of coenzyme A (b) P– Component of ATP (c) Ca– Synthesis of middle lamella (d) Mn – Photolysis of water 279. Major function of trace elements is to act as: (a) Cofactor of enzymes (b) Constituent of chlorophyll (c) Constituent of amino acids (d) Constituent of hormones

73

280. Select the wrong statement w.r.t. micronutrients: (a) Concentration is less than 10 millimole kg–1 of dry matter (b) Involved in the building of protoplasmic constituents (c) Involved in the activation of enzymes (d) Become toxic in excess 281. Which of the following is not a beneficial element? (a) Si (b) K (c) Co (d) Na 282. Find the micronutrient among the following: (a) Ni (b) K (c) Mg (d) Ca 283. Select the odd one out of the following w.r.t. macronutrient: (a) Sulfur (b) Nitrogen (c) Phosphorus (d) Iron 284. A macronutrient is: (a) Magnesium (b) Iron (c) Zinc (d) Manganese 285. The element which is essential for all plants: (a) Ni (b) Mo (c) Co (d) Mg 286. The concentration of elements such as carbon and nitrogen in plants is: (a) Between 1–10 millimole kg–1 of dry matter (b) Equal to 10 millimole kg –1 of dry matter (c) Less than 10 millimole kg–1 of dry matter (d) Higher than 10 millimole kg–1 of dry matter 287. How many elements have been found to be essential for plants? (a) 9 (b) 17 (c) 60 (d) 18

Ans. 270. (d) 271. (a) 272. (a) 273. (d) 274. (b) 275. (a) 276. (c) 277. (b) 278. (a) 279. (a) 280. (b) 281. (b) 282. (a) 283. (d) 284. (a) 285. (c) 286. (d) 287. (b)

74

Plant Physiology: Question Bank

288. Select the incorrect statement w.r.t. criteria of essentiality of the minerals: (a) Element must be directly involved in the plant metabolism (b) Disorders caused by the absence/ deficiency of an element can be corrected only by adding that specific element (c) Element must be replaceable by another element (d) Element must be necessary for normal growth and reproduction 289. Hydroponics refers to growing plants in: (a) Water (b) Soil culture (c) Tissue culture medium (d) Solution of mineral nutrients 290. All the given statements are correct w.r.t. fate of ammonia, expect: (a) Glutamic acid is the main amino acid that provides NH 2 group during the transamination process (b) Amides are transported through sieve tubes (c) -ketoglutaric acid provides carbon skeleton for the process of reductive amination process (d) Glutamine and asparagines are the two more important amides in the plants 291. Enzyme nitrogenase is: (a) Essential to convert NH3 to N2 (b) An O2 requiring enzyme (c) Found in prokaryotes only (d) Cu–Fe protein 292. Find the correct set of requirements to fix a molecule of atmospheric nitrogen (N2): (a) 16e–, 16H+, 8 ATP (b) 8e–, 8H+, 16 ATP (c) 16e–, 16H+, 16 ATP (d) 8e–, 8H+, 8 ATP

293. Rhizobium and Frankia: (a) Are strictly anaerobic (b) Are free living in soil, but as symbionts, can fix tomospheric nitrogen (c) Produces nodules on the roots of leguminous plants (d) More the one option is correct 294. Select the pair which is mismatched: (a) Azotobacter – Free living, aerobic N2 fixer (b) Alnus – Frankia (c) Bacillus – Symbiotic N2 fixer (d) Ehodospirillum – Photosynthetic nitrogen fixer 295. Which of the following plants do not contain Rhizobium in their root nodules? (a) Garden pea and broad bean (b) Alnus and casuarinas (c) Sweet pea and lentils (d) Alfalfa and sweet clover 296. A free living nitrogen fixing bacteria is: (a) Nitrococcus (b) Rhizobium (c) Azotobacter (d) Both B and C 297. Decomposition of organic nitrogen of dead plant and animals into ammonia is called: (a) Denitrification (b) Nitrate assimilation (c) N2 fixation (d) Ammonification 298. In ecosystem, dentrification is possible by: (a) Nitrocystis (b) Nitrosomonas (c) Thiobacillus (d) Nitrobacter 299. Nitrosomonas, Nitrococcus and Nitrocystis are involved in the process of: (a) Denitrification (b) Nitrification (c) Nitrate assimilation (d) Ammonification

Ans. 288. (c) 289. (d) 290. (b) 291. (c) 292. (b) 293. (b) 294. (c) 295. (b) 296. (c) 297. (d) 298. (c) 299. (b)

Mineral Nutrition of Plants

300. Select the correct statement: A: Soil is reservoir of all mineral elements that are essential for the proper growth and development of plants B: Initial uptake of minerals is slow, into the symplast C: Uptake of minerals in inner space is rapid (a) Only A is correct (b) Only C is correct (c) Both B and C are incorrect (d) All statements are correct 301. The primary symptom of manganese toxicity is: (a) Reclamation disease (b) Little leaf disease (c) Loss of apical dominance (d) Appearance of brown spots surrounded by chlorotic veins 302. The deficiency of set of minerals firs appear in the older leaves: (a) Mg, Ca, Fe (b) S, B, Mg (c) N, Mg, Ca (d) N, K, Mg 303. Lack or low level of ..... causes an inhibition of the cell division: (a) Zn, Mo, Mn (b) N, K, Mg, S, Fe (c) N, K, S, Mo (d) Ca, Mg, Cu, K 304. Select the mismatched pair: (a) Ca – Synthesis middle lamella (b) S – Constituent of coenzyme A (c) Fe – Carbohydrate and water translocation (d) Mn – Photolysis of water 305. Which one of the following is not a beneficial element? (a) Ni (b) Si (c) Na (d) Co 306. Which of the following minerals element is required by plants in greatest amount? (a) Potassium (b) Nitrogen (c) Sulfur (d) Phosphorus

75

307. Mark the correct statement w.r.t. hydroponics: (a) Out of season vegetables and flowers can be obtained (b) It can avoid problem of soil brone pathogens (c) It avoid problem of weeding (d) All of the above 308. Select the correct statement: A: Essential elements are the components of energy releated compounds B: Essential elements are the components of structural elements of the cells C: Mn2+ is an activator of alcohol dehydrogenase (a) Only A is incorrect (b) Only C is incorrect (c) Only B is incorrect (d) All statements are correct 309. Which of the following is an example of secondary active transport of solutes in plants? (a) Contransport (b) Symport (c) Antiport (d) All of these 310. Which of the following is most important in transport of ionisable solute across the membrane? (a) Electrochemical potential gradient (b) Electric potential gradient (c) Concentration of the solutes (d) Chemical potential gradient 311. Secondary active transport is also known as: (a) Primary mechanism (b) Cotransport mechanism (c) Both A and B (d) None of these 312. H+–ATPase of plasma membrane and tonoplast are inhibited by: (a) Cd ion (b) Vandate ions (c) Nitrate ion (d) None of these

Ans. 300. (c) 301. (d) 302. (d) 303. (c) 304. (c) 305. (a) 306. (b) 307. (d) 308. (b) 309. (d) 310. (a) 311. (b) 312. (b)

76

Plant Physiology: Question Bank

313. H+–ATPase of plasma membrane and tonoplast are: (a) Same (b) Different (c) Not known (d) None of these 314. Na+/K+–ATPase, first discovered by: (a) R Mackinnon (b) Jens C Skou (c) Neher and Sakmann (d) None of the above 315. H + -ATPase of inner membrane of mitochondria and chloroplast are also known as thylloid membrane of: (a) F–type ATPase (b) P–type ATPase (c) L–type ATPase (d) None of these 316. H+-ATPase pumps are also known as: (a) Q-type ATPase (b) P-type ATPase (c) L-type ATPase (d) None of these 317. H + -ATPase, H + -PPase and Ca +2 ATPase are most common electrogenesis pump in plant cells and directions of these pumps are: (a) Lateral (b) Inward (c) Outward (d) None of these 318. H+–PPase mainly found in: (a) Plasma membrane (b) Chloroplast membrane (c) Tonoplast (d) None of these 319. Na+/K + –ATPase of the animal cells is the example of: (a) Electroneutral pump (b) Electrogenic pump (c) Both (a) and (b) (d) None of these 320. In plant cell membrane the direction of electrogenic pump such as H + ATPase is: (a) Outward (b) Inward (c) Both (a) and (b) (d) None of these 321. In primary active transport, the required energy derived mainly from: (a) Hydrolysis of ATP (b) Hydrolysis of GTP (d) Both (a) and (b) (d) None of these

322. Among the followings, which ion can diffuse both outward and inward through channels across the plasmamembrane of the plants? (b) K+ (a) Ca2+ (c) Both (a) and (b) (d) None of these 323. Which of the following is an example of electroneutral pumps? (a) H+/K+–ATPase (b) Ca2+–ATPase (d) None of these (c) H+–ATPase 324. The rate of carrier mediated transport of solute is: (b) 108–109 (a) 104– 105 1 2 (c) 10 –10 (d) None of these 325. K+ channels are: (a) Inward rectifying (b) Outward rectifying (c) Both (a) and (b) (d) None of these 326. Ca2+ channels are always: (a) Inward rectifying (b) Outward rectifying (c) Both (a) and (b) (d) None of these 327. Anion channels are always: (a) Inward rectifying (b) Outward rectifying (c) Both (a) and (b) (d) None of these 328. The rate of ion diffusion through open channel is: (b) 103 g–1 (a) 108 g–1 2 –1 (c) 10 g (d) None of these 329. Patch–clamp technology was invented by: (a) Neher and Sakmann (b) R Mackinnon (c) Both (a) and (b) (d) None of these 330. As we know the ions carry a charge and are mobile, then diffusion across the membrane channel established an electric current, which can be detected by a special technique known as: (a) Voltage gate technology (b) Patch–clamp technology (c) Both (a) and (b) (d) None of these

Ans. 313. (b) 314. (b) 315. (a) 316. (b) 317. (c) 318. (c) 319. (b) 320. (a) 321. (a) 322. (b) 323. (a) 324. (a) 325. (c) 326. (a) 327. (b) 328. (a) 329. (a) 330. (b)

Mineral Nutrition of Plants

331. If a cell contains certain fixed COO– in it and placed in solution of cation and anion both, then Donnan’s equilibrium will result in: (a) Accumulation of both cation and anion inside the cells (b) Accumulation of cation inside the cells (c) Accumulation of anion inside the cells (d) None of the above 332. If a cell contains certain fixed NH4+ in it and placed in solution of cation and anion both, then Donnan’s equilibrium will result in: (a) Accumulation of both cation and anion inside the cells (b) Accumulation of cation inside the cells (c) Accumulation of anion inside the cells (d) None of the above 333. The mineral salts in their ionic form move from one cell to another by: (a) Transmembrane pathways (b) Symplastic pathways (c) Apoplastic pathways (d) All of the above 334. Facilitated diffusion of solute through transport proteins across the membrane is: (a) Passive transport (b) Active transport (c) Both (a) and (b) (d) None of these 335. Which of the following enzyme has no role in Bennet–Clark’s protein– lecithin theory? (a) Choline esterase (b) Choline acetylase (c) Lecithinase (d) None of these 336. Protein associated with phosphatide is called: (a) Glycine betaine (b) Lecithin (c) Proline (d) None of these

77

337. The main defect of Lundegardh’s cytochrome pump theory is: (a) It does not explain selective uptake of ions (b) It envisages active absorption of only anions (c) Both A and B (d) None of these 338. Which of the following assumption is a basis of Lundegardh’s cytochrome pump theory? (a) Cations are absorbed passively (b) Anions are absorbed through cytochrome chain active process (c) Mechanism of anion and cation absorption is different (d) All of the above 339. The inhibition of salt respiration and accompanying absorption of anion by CO and cyanide ...... the Lundegardh’s cytochrome pump theory. (a) Declines (b) Supports (c) Not known (d) None of these 340. Lundegardh’s cytochrome pump theory believed that there was a definite correlation between ...... and ...... absorption. (a) Respiration, anion (b) Photosynthesis, anion (c) Both A and B (d) None of these 341. Which of the following observation strongly supports the carrier concept of active absorption of mineral salts? (a) Specificity (b) Isotopic exchange (c) Saturation effects (d) All of the above 342. According to Carrier Concept, the plasma membrane is ...... to free ions. (a) Permeable (b) Impermeable (c) Both (a) and (b) (d) None of these 343. Protein–lecithin theory for absorption of mineral salts was first proposed by: (a) Bennet–Clark (b) Donnan (c) Lundegarth and Burstrom (d) All of the above

Ans. 331. (b) 332. (c) 333. (d) 334. (a) 335. (d) 336. (b) 337. (b) 338. (d) 339. (b) 340. (a) 341. (d) 342. (b) 343. (a)

78

Plant Physiology: Question Bank

344. Cytochrome pump theory for absorption of mineral salts was first proposed by: (a) Bennet–Clark (b) Donnan (c) Lundegarth and Burstrom (d) All of the above 345. In alga ...... the cell sap accumulated K+ and phosphate ions to such an extent that their concentration was thousands time greater than in the pound water in which plant was growing. (a) Chlorella (b) Nitella (c) Both A and B (d) None of these

351. Which part of the root is involved in absorption of mineral salts in higher plants? (a) Meristematic region (b) Zone of root hair (c) Root cap (d) None of these 352. Mineral salts are absorbed from the soil solution in the form of: (a) Anion (b) Cation ions (c) Both A and B (d) None of these

346. When a plant is transferred from water to a salt solution, the rate of respiration increases? This is called: (a) Activated respiration (b) Ions respiration (c) Salt respiration (d) None of the above

353. Essential elements are: (a) Not required for normal reproduction (b) Not replaceable by other elements (c) Not directly involved with metabolism (d) Required only in those metabolic processes leading to increased growth

347. In contact exchange theory, the ions adsorbed on clay particle may be exchanged with the ions adsorbed on the root–surface directly without first being dissolved in soil solution. This statement is true/false: (a) False (b) True (c) Not known (d) None of these

354. Which of the following is an incorrect match of essential and function? (a) Manganese structural component of chlorophyll (b) Calcium-component of the middle lamella (C) Zinc-enzyme activator (d) Iron-component of ferredoxin

348. There is the requirement of metabolic energy in: (a) Contact exchange of the ions (b) Active absorption of mineral salts (c) Passive absorption of mineral salts (d) None of the above

355. Legume root nodules contain leghemoglobin. Its function is to regulate: (a) Expression of nif genes (b) Dinitrogenase activity (C) Oxygen supply (d) Nodule growth

349. Ion–exchange does not require metabolic energy but it generally facilitates mineral salt absorption. This statement is: (a) False (b) True (c) Not known (d) None of these 350. First–step in the absorption of mineral salts is the process of: (a) Imbibition (b) Ion–Exchange (c) Diffusion (d) None of these

356. How many ATP are required for the conversion of one N2 to 2Ni-1+4 during nitrogen fixation? (a) 8 ATP (b) 10 ATP (c) 12 ATP (d) 16 ATP 357. Conversion of NO–3 to NO–2, occurs in plant cell (a) Occur in the cytosol (b) Catalyzed by nitrate reductase (c) Requires Mo and FAD as cofactor

Ans. 344. (c) 345. (b) 346. (c) 347. (b) 348. (b) 349. (b) 350. (b) 351. (a) 352. (c) 353. (b) 354. (a) 355. (c) 356. (d)

Mineral Nutrition of Plants

(d) Reduced ferredoxin acts as electron (e) (a), (b), and (c) 358. Carnivorous adaptations of plants mainly compensate for soil that has a relatively low content of: (a) Potassium (b) Nitrogen (c) Phosphate (d) Calcium 359. A mineral deficiency is likely to affect older leaves more than younger leaves if the mineral is: (a) Micronutrient (b) The mineral is very mobile within the plant (c) The mineral is required for chlorophyll synthesis (d) The deficiency, persists for a long time 360. Which of the following would be likely to develop deficiency symptoms? (a) A plant growing in a tropical rainforest with associated mycorrhizae (b) Cacti growing the desert (c) A plant growing naturally on calcareous soil (d) A crop plant growing in a field that has been cultivated for many years 361. Which of the following is correct about nitrate reductase? (a) FAD, Mo and heme act as prosthetic groups (b) Catalyzes conversion of NO–3 to NH4++ (c) FADH2 acts as electron donor (d) Very sensitive to O2 362. Which of the following is not correct about nitrogen fixation? (a) It requires metabolic energy (b) Carried out only by few prokaryotic organisms termed diazatrophs (c) Enzyme that catalyzes the reduction of N called nitrogenase complex (d) None

79

363. Which of the following is false statement? (a) All NH4-+seems to be converted first into amide group of glutamine (b) Conversion of organic nitrogen to NH 4- + by soil microbes is called ammonification (c) Cl- is required for photochemical reaction involved in photolysis of water (d) Plant roots absorb ions as well as the salts 364. An example of a parasitic plant that is also strictly epiphytic is: (a) Cuscuta (Dodder) (b) Viscum (Mistletoe) (c) Rafflesia (d) Orbanche 365. Which of the following is an example of insectivorous plants? (a) Cuscuta (b) Orbanche (c) Drosera (d) Nepenthes 366. Growing of plant in soilless nutrient solution is referred as: (a) Aeroponics (b) Hydroponics (c) Xeroponies (d) None 367. Heterotrophic nutrition if found in: (a) Pistia (b) Opuntia (c) Drosera (d) Vallisneria 368. The example of a saprophyte is a: (a) Nepenthes (b) Ultricularia (c) Dionaea (d) Monotropa 369. The dodder (Cuscuta) is a: (a) Total stem parasite (b) Total root parasite (c) Partial stem parasite (d) Partial root parasite 370. In Orobanche, which is a root parasite, germination of seed is dependent on? (a) Auxins released by roots of host (b) Exudates from roots of host (c) Exudates released from parasite (d) Gibberellins released by the parasitic roots

Ans. 357. (e) 358. (b) 359. (b) 360. (c) 361. (a) 362. (d) 363. (d) 364. (b) 365. (d) 366. (b) 367. (c) 368. (d) 369. (a) 370. (b)

80

Plant Physiology: Question Bank

371. Total root parasite is: (a) Loranthus (b) Viscum (c) Santalum album (d) Orbanche 372. The orbanche plant is: (a) Partial parasite (b) Total root parasite (c) Symbiont (d) Total stem parasite 373. Which of the following is an insectivorous plant? (a) Cuscuta (b) Orbanche (c) Drosera (d) Rafflesia 374. Plant such as ‘sundews and ‘pitcher plant’ are termed: (a) Carnivorous (b) Parasitic (c) Symbiotic (d) Autotrophic 375. Insectivorous plants: (a) Are heterotrophic (b) Cannot manufacture their own protein (c) Only get supplementary protein food (d) Cannot manufacture their food other than carbohydrates 376. Which of the following is obtained by insectivorous plants from bodies? (b) CO2 (a) O2 (c) N2 (d) SO2 377. The insects captured by the insectivorous plants partially fulfill their requirement of: (a) Enzyme (b) Oxygen (c) Nitrogen (d) Water 378. Insectivorous plants are usually adapted to (a) Water rich soils (b) Soil deficient in sugars (c) Soils rich in trace elements (d) Soils deficient in nitrogenous compounds 379. Mg++ and Fe++are needed by plants for (a) Energy transfer

(b) Chlorophyll synthesis (c) Carbohydrate translocation (d) Stomata’ opening 380. Which of the following is a micronutrient: (a) Calcium (b) Phosphorus (c) Copper (d) Magnesium 381. A micro essential element is one which: (a) Is less important than the major essential elements (b) Is more important than the major essential elements (c) Is present small quantities in the soil (d) Is needed in very small amounts but is as important as major essential element 382. Which one of the following nutrient serve as microelements for plant growth? (a) Manganese, copper, calcium (b) Sodium, potassium, boron (c) Sodium, nickel, chlorine (d) Copper, molybdenum, zinc 383. When chlorophyll is burnt, which one is obtained? (a) Fe (b) Mg (c) Both (a) and (b) (d) Ca and Mn 384. A plant material is dried and burnt in a crucible, the residue would contain (a) Oxides and carbonates of about ten elements (b) Carbon and phosphorus (c) Nitrates and sulfates only (d) Oxides and carbonates of Ca and Mg only 385. Which of the following elements has not been proved to be essential for plants? (a) Potassium (b) Sodium (c) Zinc (d) Iron 386. Which one of the following is not a macronutrient? (a) Sulfur (b) Phosphorus (c) Manganese (d) Calcium/magnesium

Ans. 371. (d) 372. (b) 373. (c) 374. (a) 375. (c) 376. (c) 377. (c) 378. (d) 379. (b) 380. (c) 381. (d) 382. (d) 383. (b) 384. (a) 385. (b) 386. (c)

Mineral Nutrition of Plants

387. Which once of the following is not an essential micronutrient? (a) Boron (b) Nickel (c) Manganese (d) Cobalt 388. The micronutrient among the following is: (a) N (b) P (c) Zn (d) Ca 389. Which one of the following is not a major element? (a) Zn (b) Ca (c) Mg (d) P 390. An essential micronutrient of plant, which is also used in cancer therapy is: (a) Calcium (b) Sodium (c) Cobalt (d) Iron 391. An element non-essential for the proper growth of all plant is: (a) Cobalt (b) Magnesium (c) Chlorine (d) Calcium 392. Which elements facilitates the translocation of carbohydrates in plants? (a) Fe (b) Mo (c) Zn (d) B 393. Which one of the following is a micronutrient? (a) Mg (b) Ca (c) Mn (d) S 394. Which of the following is a trace element? (a) Carbon (b) Phosphorus (c) Sulfur (d) Molybdenum 395. A trace element is that which is: (a) Traced by Geiger counter (b) Required in very minute quantities (c) Draws other elements out of protoplasm (d) Discovered first in cell 396. Which one of the following is a trace element? (a) Phosphorus (b) Nitrogen (c) Potassium (d) Zinc

81

397. Which one of the following elements is not required by plants for their normal healthy growth? (a) Magnesium (b) Lead (c) Calcium (d) Iron 398. Which one of the following are micronutrients? (a) Mg and Fe (b) Fe and Zn (c) Zn and Ca (d) Ca and P 399. In some insectivorous plants, there is secretion of acidic enzymes by which trapped insects are killed and digested, this enzyme is: (a) Erepsin (b) Tripsin (c) Strypsin (d) Amylopsin 400. The small rootless aquatic herb in which a portion of the leaf forms a tiny sac or bladder which trap water insects is: (a) Dionaea (b) Utricularia (c) Sarracenia (d) Drosera 401. Insectivorous plant are called so because: (a) All insects eat these plants (b) They catch insects for food (c) They are herbivorous (d) Insects like such plants 402. Dionaesunuscipula is commonly known as: (a) Butterwort (b) Venus fly trap (c) Water fly trap (d) Bladderwort 403. In Drosera, an insectivorous plant, the insect catching mechanism is: (a) Valvular arrangement in the bladder (b) Secretion of glandular hairs on the leaves (c) Pitcher covered with lid (d) Secretion of glandular hairs in the pitcher 404. The insectivorous plant having glandular structures on its leaf secretes sticky fluid is: (a) Venus fly trap (b) Sundew plant (c) Aldrovanda (d) Bladderwort

Ans. 387. (b) 388. (c) 389. (a) 390. (c) 391. (a) 392. (d) 393. (c) 394. (d) 395. (b) 396. (d) 397. (b) 398. (b) 399. (b) 400. (b) 401. (b) 402. (b) 403. (b) 404. (b)

82

Plant Physiology: Question Bank

405. In ‘sundew’ (Drosera), the part of plan which attracts the insects is: (a) Leaf blade (b) Leaf apex (c) Leaf base (d) Leaf petiole 406. Which one is an organic nutrient? (a) Protein (b) Calcium (c) Cellulose (d) Vitamin 407. In Nepenthes, the pitcher is modified: (a) Leaf apex (b) Leaf base (c) Leaf petiole (d) Leaf blade 408. The plant ash is an indication of: (a) Mineral salts absorbed by the plant (b) Organic matter of the plant (c) Both the mineral salts and organic matter (d) None of the above 409. Which group of elements is not essential for a normal plant? (a) Potassium, calcium, magnesium (b) Iron, zinc, manganese, boron (c) Lead, nickel, iodine, sodium (d) Magnesium, iron, molybdenum 410. Which one of the following is not an essential element for plants? (a) Iron (b) Zinc (c) Potassium (d) Iodine 411. An essential element is one which: (a) Is available in soil (b) Improves plant growth (c) Is indispensable and irreplaceable for growth (d) In present in plant ash 412. Most abundant elements in a living cell are: (a) C, O, H, N (b) C, O, S, P (c) C, O, N, S (d) C, O, H, P 413. Micronutrients: (a) Are as important as macronutrients (b) Are less important than macronutrients (c) Are called ‘micro’ as the play only a minor role in plant nutrition (d) May be omitted from culture media

without any detrimental effects on the plants 414. An independent role in energy metabolism is: (a) Li (b) Ca (c) P (d) Na 415. Which of the following elements is responsible for maintaining turgor? (a) Na (b) K (c) Ca (d) Mg 416. Premature leaf fall is caused due to the deficiency of: (a) Potassium (b) Calcium (c) Nitrogen (d) Phosphorus 417. The element which is required in largest quantities by plant is: (a) Nitrogen (b) Calcium (c) Sulfur (d) Phosphorus 418. Mineral salts absorbed by the roots from the soil are in the form of: (a) Very dilute solution (b) Dilute solution (c) Concentrated solution (d) Very concentrated solution 419. The theory suggesting that carbon dioxide produced in respiration helps in mineral absorption is called: (a) Carbonic acid exchange theory (b) Contact exchange theory (c) Active mineral absorption (d) Donnan equilibrium 420. Which of the following does not require carrier molecules during transport through cell membranes? (a) Simple diffusion (b) Facilitated diffusion (c) Ne-R transport (d) Active transport of sugars and amino acids 421. Minerals absorbed by roots move to the leaf through: (a) Phloem (b) Sieve tube (c) Xylem (d) None of these

Ans. 405. (a) 406. (b) 407. (d) 408. (a) 409. (c) 410. (d) 411. (c) 412. (a) 413. (a) 414. (c) 415. (b) 416. (c) 417. (b) 418. (a) 419. (a) 420. (a) 421. (c)

Mineral Nutrition of Plants

422. The possible sources of phosphorus ions and nitrogen ions in soil generally get depleted because they are usually found as: (a) Positively charged ions (b) Negatively charged ions (c) A disproportionate mixture of negatively and positively charged ions (d) Particles carrying no change 423. EDTA which is used more in tissue cultures is a: (a) Hormone (b) Vitamin (c) Buffer (d) Nutrient 424. Mineral absorption in plant occurs: (a) Independent of water (b) Independent of water absorption (c) If soil solution is hypertonic to cell sap (d) If soil solution is hypotonic to cell sap 425. By what method are ions absorbed by plants? (a) Along DPD gradient (b) Along water potential gradient (c) By carriers and pumps (d) By molecular diffusion 426. Minerals are absorbed in: (a) Meristematic zone (b) Root hair zone (c) Elongation zone (d) Root cap zone 427. The rate of diffusion of uncharged particles is: (a) Proportional to their solubility in fat solvents (b) Inversely proportional to their molecular size (c) Both (a) and (b) (d) None of the above 428. Lecithin carrier theory of mineral absorption was proposed by: (a) Bennet Clark (b) Pfeffer (c) Lundegardh (d) Donnan

83

429. Respiration when plant root is kept in distilled water is called: (a) Anion respiration (b) Ground respiration (c) Floating respiration (d) Salt respiration 430. Electrochemical gradient theory of mineral salts absorption was proposed by: (a) Bennet Clark (b) P Mitchell (c) Lundegardh (d) Pfeffer 431. Which of the following is selenium indicator plant? (a) Neptunia amplexicaulis (b) Equisetum debile (c) Lichens (d) Members of poaceae 432. “Alkali disease” in animals and plants is caused by consuming: (a) Selenium accumulating plants (b) Lead accumulating plants (c) Silica accumulating plants (d) Aluminum accumulating plants 433. In some insectivorous plants, there is secretion of acidic enzymes by which trapped insects are killed and digested, this enzyme is: (a) Erepsin (b) Trypsin (c) Strypsin (d) Amylopsin 434. The small rootless aquatic herb in which a portion of the leaf forms a tiny sac or bladder which trap water insects is: (a) Dionaca (b) Utricularia (c) Sarracenia (d) Drosera 435. Insectivorous plant are called so because: (a) All insects eat these plants (b) They catch insects for food (c) They are herbivorous (d) Insects like such plants

Ans. 422. (b) 423. (c) 424. (b) 425. (c) 426. (c) 427. (c) 428. (a) 429. (b) 430. (b) 431. (a) 432. (a) 433. (b) 434. (b) 435. (b)

84

Plant Physiology: Question Bank

436. Dionaearauscipula is commonly known as: (a) Butterwort (b) Venus fly trap (c) Water fly trap (d) Bladderwort

443. Which group of elements is not essential for a normal plant: (a) Potassium, calcium, magnesium (b) Iron, zinc, manganese, boron (c) Lead, nickel, iodine, sodium (d) Magnesium, iron, molybdenum

437. In Drosera, an insectivorous plant, the insect catching mechanism is: (a) Valvular arrangement in the bladder (b) Secretion of glandular hairs on the leaves (c) Pitcher covered with lid (d) Secretion of glandular hairs in the pitcher

444. Which one of the following is not an essential element for plants? (a) Iron (b) Zinc (c) Potassium (d) Iodine

438. The insectivorous plant having glandular structures on its leaf secretes sticky fluid is: (a) Venus fly trap (b) Sundew plant (c) Aldrovanda (d) Bladderwort 439. In ‘sundew’ (Drosera), the part of plant which attracts the insects is: (a) Leaf blade (b) Leaf apex (c) Leaf base (d) Leaf petiole 440. Which one is an organic nutrient? (a) Protein (b) Calcium (c) Cellulose (d) Vitamin 441. In Nepenthes, the pitcher is modified: (a) Leaf apex (b) Leaf base (c) Leaf petiole (d) Leaf blade 442. The plant ash is an indication of: (a) Mineral salts absorbed by the plant (b) Organic matter of the plant (c) Both the mineral salts and organic matter (d) None of the above

445. An essential element is one which: (a) Is available in soil (b) Improves plant growth (c) Is indispensable and irreplaceable for growth (d) Is present in plant ash 446. Most abundant elements in a living cell are (a) C, O, H, N (b) C, O, S, P (c) C, O, N, S (d) C, O, H, P 447. Micronutrients: (a) Are as important as macronutrients (b) Are less important than macronutrients (c) Are called ‘micro’ as the play only a minor role in plant nutrition (d) May be omitted from culture media without any detrimental effects on the plants 448. An independent role in energy metabolism is: (a) Li (b) Ca (c) P (d) Na 449. Which of the following elements is responsible for maintaining turgor? (a) Na (b) K (c) Ca (d) Mg 450. Premature leaf fall is caused due to the deficiency of: (a) Potassium (b) Calcium (c) Nitrogen (d) Phosphorus

Ans. 436. (b) 437. (b) 438. (b) 439. (a) 440. (b) 441. (d) 442. (a) 443. (c) 444. (d) 445. (c) 446. (a) 447. (a) 448. (c) 449. (b) 450. (c)

Mineral Nutrition of Plants

(a) Sulfur (b) Phosphorus (c) Manganese (d) Calcium/magnesium

CHECK YOUR GRASP

1. Micronutrients: (a) Are as important as macronutrients (b) Are less important than macronutrients (c) Are called micro as they play only a minor role in plant nutrition (d) May be omitted from culture media without any detrimental effects on the plants 2. Deficiency symptoms of elements in plants may vary from: (a) Individual to individual (b) Species to species (c) Genus to genus (d) Family to family 3. Bidirectional translocation of minerals occurs in: (a) Xylem (b) Phloem (c) Parenchyma (d) Cambium 4. Which of the following does NPK denote? (a) Nitrogen, potassium, kinetin (b) Nitrogen, protein, kinetin (c) Nitrogen, protein, potassium (d) Nitrogen, phosphorus, potassium 5. The framework elements of plants are: (a) Magnesium, copper and iron (b) Copper, carbon and oxygen (c) Manganese, calcium and nitrogen (d) Carbon, hydrogen and oxygen 6. Which of the following is a macronutrient? (a) Ca (b) Mo (c) Zn (d) Mn 7. Insectivorous plants eat the insect for: (a) Nitrogen (b) Phosphorus (c) Chloride (d) Sodium 8. Plants absorb N2 in the form of: (a) Nitrites (b) Nitrates (c) N2 gas (d) HNO2 9. Which one of the following is not a macronutrient? Ans.

1. (a) 12. (d)

2. (b) 13. (a)

3. (a) 14. (c)

4. (d) 15. (a)

5. (d) 16. (b)

85

10. When chlorophyll is burnt, which one is obtained? (a) Fe (b) Mg (c) Both Fe and Mg (d) Ca and Mn 11. An element non-essential for the proper growth of all plant is: (a) Cobalt (b) Magnesium (c) Chlorine (d) Calcium 12. Which elements facilitates the translocation of carbohydrates in plants? (a) Fe (b) Mo (c) Zn (d) B 13. Nitrogen fixing bacterium is: (a) Frankia (b) Acetobacter (c) Mycoplasma (d) Chlamydia 14. Inorganic nutrients are present in the soil as: (a) Molecules (b) Atoms (c) Electrically charged ions (d) Colloids 15. A sulfur containing amino acid is: (a) Methionine (b) Asparaginic (c) Serine (d) Proline 16. Plant ash indicates: (a) Organic matter of plant (b) Mineral salts absorbed by plant (c) Both mineral salts and organic matter (d) Silica absorbed by plants 17. Soil nitrate is more likely to leach than ammonium due to its: (a) Small size (b) Negative charge (c) Being useless to soil flora (d) Abundance 18. The largest reservoir of nitrogen is: (a) Rocks (b) Sea (c) Air (d) Soil 6. (a) 17. (b)

7. (a) 18. (c)

8. (b)

9. (c)

10. (b)

11. (a)

86

Plant Physiology: Question Bank

19. Sinks are related to: (a) Transport minerals (b) Stomata (c) Enzymes (d) Phytochrome 20. Existence of nitrogen fixing bacteria in soil was discovered by: (a) Robert Koch (b) Louis Pasteur (c) J Lister (d) SN Winogradsky 21. The enzyme responsible for the reduction of molecular nitrogen to the level of ammonia in leguminous root nodule is: (a) Nitrogenase (b) Nitrate reductase (c) Nitrite reductase (d) All of the above 22. A plant material is dried and burnt in a crucible, the residue would contain: (a) Oxides and carbonates of about ten elements (b) Carbon and phosphorus (c) Nitrates and sulfates only (d) Oxides and carbonates of Ca and Mg only 23. Which of the following elements has not been proved to be essential for plants? (a) Potassium (b) Sodium (c) Zinc (d) Iron 24. Dionaeamuscipula is commonly known as: (a) Butterwort (b) Venus fly trap (c) Water fly trap (d) Bladderwort 25. The dodder (Cuscuta) is a: (a) Total stem parasite (b) Total root parasite (c) Partial stem parasite (d) Partial root parasite 26. In some insectivorous plants, there is secretion of acidic enzymes by which trapped insects are killed and digested, this enzyme is: Ans.

19. (a) 30. (b)

20. (d) 31. (b)

21. (a) 32. (a)

22. (a) 33. (b)

23. (b) 34. (d)

(a) Erepsin (c) Strypsin

(b) Trypsin (d) Amylopsin

27. The small rootless aquatic herb in which a portion of the leaf forms a tiny sac or bladder which trap water insects is: (a) Dionaca (b) Utricularia (c) Sarracenia (d) Drosera 28. Insectivorous plant are called so because: (a) All insects eat these plants (b) They catch insects for food (c) They are herbivorous (d) Insects like such plants 29. Dionaeamuscipula is commonly known as: (a) Butterwort (b) Venus fly trap (c) Water fly trap (d) Bladderwort 30. In Drosera, an insectivorous plant, the insect catching mechanism is: (a) Valvular arrangement in the bladder (b) Secretion of glandular hairs on the leaves (c) Pitcher covered with lid (d) Secretion of glandular hairs in the pitcher 31. The insectivorous plant having glandular structures on its leaf secretes sticky fluid is: (a) Venus fly trap (b) Sundew plant (c) Aldrovanda (d) Bladderwort 32. In ‘sundew’ (Drosera), the part of plant which attracts the insects is: (a) Leaf blade (b) Leaf apex (c) Leaf base (d) Leaf petiole 33. Which one is an organic nutrient? (a) Protein (b) Calcium (c) Cellulose (d) Vitamin 34. In Nepenthes, the pitcher is modified: (a) Leaf apex (b) Leaf base (c) Leaf petiole (d) Leaf blade 24. (b)

25. (a)

26. (b)

27. (b)

28. (b)

29. (b)

Mineral Nutrition of Plants

35. The plant ash is an indication of: (a) Mineral salts absorbed by the plant (b) Organic matter of the plant (c) Both the mineral salts and organic matter (d) None of the above 36. Which group of elements is not essential for a normal plant? (a) Potassium, calcium, magnesium (b) Iron, zinc, manganese, boron (c) Lead, nickel, iodine, sodium (d) Magnesium, iron, molybdenum 37. Which one of the following is not an essential element for plants? (a) Iron (b) Zinc (c) Potassium (d) Iodine 38. An essential element is one which: (a) Is available in soil (b) Improves plant growth (c) Is indispensable and irreplaceable for growth (d) Is present in plant ash 39. Most abundant elements in a living cell are: (a) C, 0, H, N (b) C, 0, S, P (c) C, 0, N, S (d) C, 0, H, P 40. Micronutrients: (a) Are as important as macronutrients (b) Are less important than macronutrients (c) Are called ‘micro’ as the play only a minor role in plant nutrition (d) May be omitted from culture media without any detrimental effects on the plants 41. An independent role in energy metabolism is: (a) Li (b) Ca (c) P (d) Na 42. Which of the following elements is responsible for maintaining turgor?

Ans.

35. (a) 46. (d)

36. (c) 47. (a)

37. (d) 48. (b)

38. (c) 49. (c)

39. (a) 50. (b)

(a) Na (c) Ca

87

(b) K (d) Mg

43. Premature leaf fall is caused due to the deficiency of: (a) Potassium (b) Calcium (c) Nitrogen (d) Phosphorus 44. The element which is required in largest quantities by plant is: (a) Nitrogen (b) Calcium (c) Sulfur (d) Phosphorus 45. Which of the following is a macronutrient? (a) Mn (b) Mg (c) Zn (d) Cu 46. The framework elements of plants are: (a) Magnesium, copper and iron (b) Copper, carbon and oxygen (c) Manganese, calcium and nitrogen (d) Carbon, hydrogen and oxygen 47. Which of the following is a macronutrient? (a) Ca (b) Mo (c) Zn (d) Mn 48. Mg++ and Fe ++ are needed by plants for: (a) Energy transfer (b) Chlorophyll synthesis (c) Carbohydrate translocation (d) Stomatal opening 49. Which of the following is a micronutrient? (a) Calcium (b) Phosphorus (c) Copper (d) Magnesium 50. When chlorophyll is burnt, which one is obtained? (a) E (b) Mg (c) Both Fe & Mg (d) Ca and Mn Mark your score and evaluate yourself accordingly

40. (a)

41. (c)

42. (b)

43. (c)

44. (a)

45. (b)

88

Plant Physiology: Question Bank

5

Special Modes of Nutrition 1. Predominantly ...... are involved in ectomycorrhizal symbiotic relationships. (a) Basidiomycetes (b) Zygomycetes (c) Ascomycetes (d) None of these

8. What is the feature of utricularia? (a) Small herbaceous (b) Is an aquatic plant (c) Free-floating (d) All of these 9. ...... is also known as bladdewort. (a) Dionaea (b) Utricularia (c) Striga (d) None of these

2. Ectomycorrhizal are found primarily in: (a) Subtropical region (b) Temperate region (c) Tropical region (d) None of the above

10. ...... plant is also known as sundew. (a) Neottia (b) Monotropa (c) Deosera (d) None of these

3. Mycorrhizae are the fungus–root associations, first discovered by ...... . (a) TGR Gray (b) ST Williams (c) AB Frank (d) None of these

11. In the insectivorous plant, pitcher is formed by the modification of: (a) Petiole of the leaves (b) Lamina of the leaves (c) Midribs of the leaves (d) None of the above

4. Insectivorous plan its digest the bodies of insects by secreting chiefly: (a) Carbohydrates (b) Proteolytic enzymes (c) Both A and B (d) None of these

12. The insectivorous plants grow in swampy soils which are deficient in: (a) Phosphorus (b) Potassium (c) Nitrogen (d) None of these

5. Which plant is known as butterwort? (a) Striga (b) Orobanche (c) Pinguicula (d) None of these

13. In insectivorous plants, nectar gland is present at: (a) Mouth of the pitcher (b) Base of the pitcher (c) Middle of the pitcher (d) None of the above

6. Rosette of leaves are found in: (a) Dionaea (b) Pinguicula (c) Both A and B (d) None of these 7. Which of the following is known as venus fly trap? (a) Dionaea (b) Striga (c) Utricularia (d) None of these Ans.

1. (b) 12. (b)

2. (b) 13. (a)

3. (c) 14. (b)

4. (b)

5. (c)

14. The pitcher contains ...... at its base. (a) Neutral fluid (b) Acidic fluid (c) Basic fluid (d) None of these 6. (c) 88

7. (a)

8. (d)

9. (b)

10. (c)

11. (b)

Special Modes of Nutrition

15. In pitcher plants, ...... are modified into pitchers: (a) Roots (b) Leaves (c) Shoots (d) None of these 16. The pitcher plants are usually ...... . (a) Shrubs (b) Small herbs (c) Both (a) and (b) (d) None of these 17. Santalum album is very common example of: (a) Partial stem parasite (b) Total root parasite (c) Total stem parasite (d) Partial root parasite 18. Which of the following flower is known as the largest in diameter among the plant kingdom? (a) Dalbergia (b) Rafflesia (c) Albizzia (d) None of these 19. Which of the following is a saprophytic angiosperms? (a) Monotropa (b) Dionaea (c) Striga (d) Santalum 20. In partial stem parasite, the Houstoria penetrate the host tissue and make connection only with its: (a) Phloem (b) Xylem (c) Both A and B (d) None of these 21. Orobanche, Striga, Balanophora and Rafflesia are the examples of: (a) Partial stem parasite (b) Total root parasite (c) Total stem parasite (d) Partial root parasite 22. Laranthus, Viscum or Mistletoe are the best example of: (a) Partial stem parasite (b) Total root parasite (c) Total stem parasite (d) Partial root parasite 23. Dodder or Cuscuta is very common example of: (a) Partial stem parasite (b) Total root parasite Ans.

15. (b) 26. (c)

16. (c) 27. (d)

17. (c) 28. (d)

18. (b) 29. (a)

19. (a) 30. (c)

89

(c) Total stem parasite (d) Partial root parasite 24. What are the types of parasitic angiosperm? (a) Partial stem parasite (b) Total root parasite (c) Total stem parasite (d) All of the above 25. Parasitic angiosperms obtain their nutrition from other living plants by means of special roots called: (a) Hauspie (b) Haustoria (c) Both A and B (d) None of these 26. Which of the following groups of plants can grow in nitrogen stressed soils? (a) Lichens (b) Ferns (c) Carnivorous plants (d) Saprophytes 27. Which of the following is an obligate stem parasite? (a) Orobanche (b) Raffiesia (c) Monotropa (d) Cuscuta 28. Botanical name of venus fly trap is: (a) Drosera (b) Nepenthes (c) Sarracenia (d) Dionaea 29. Which of the following pitcher plant is non-insectivorous? (a) Dischidia rafflesiana (b) Nepenthes khasiana (c) Sarracenia purpurea (d) Cephalotus sp 30. Nepenthes is commonly called: (a) Venus-fly trap (b) Water flea trap (c) Pitcher plant (d) Bladder wort 31. Which of the following plants is commonly called butterwort? (a) Nepenthes (b) Pinguicula (c) Dionea (d) Utricularia 20. (b) 31. (b)

21. (b)

22. (a)

23. (c)

24. (d)

25. (b)

90

Plant Physiology: Question Bank

32. Which of the following is a facultative root parasite? (a) Rafflesia (b) Santalum album (c) Neottia (d) Striga 33. Which of the following is an obligate root parasite? (a) Neottia (b) Striga (c) Monotropa (d) Loranthus 34. Which of the following is a saprophytic angiosperm? (a) Eucalyptus (b) Loranthus (c) Monotropa (d) V tscum 35. The plant that has largest flower in the world is a: (a) Total stem parasite (b) Total root parasite (c) Partial stem parasite (d) Partial root parasite 36. Insectivorous plants grow in the soil which is deficient in: (a) Magnesium (b) Calcium (c) Nitrogen (d) Sulfur

Ans.

32. (b)

33. (b)

34. (c)

35. (b)

36. (c)

37. Carnivorous plants kill insects because: (a) Insects eat their leaves (b) Insects eat their fruits (c) They obtain nitrogen from killed insects (d) They hate insects 38. In sarracenia pitchers are modified: (a) Petiolate leaves (b) Sessile leaves (c) Inflorescence (d) Roots 39. Which of the following does not show symbiosis? (a) Lichens (b) Coralloid root of cycas (c) Mycorrhiza (d) Loranthus 40. Dew drops which glitter in sun are secreted by: (a) Tip of the tentacle of Drosera (b) Base of the tentacle of Drosera (c) Inflorescence axis of Dionaea (d) All the above

37. (c)

38. (b)

39. (c)

40. (a)

Translocation of Organic Solutes

91

6

Translocation of Organic Solutes 1. Typically, the mesophyll cells of trees have an osmotic potential of ...... Mpa, whereas sieve elements in leaves have an osmotic potential of about ......Mpa. (a) –2.0 to –3.0, –1.3 to –1.8 (b) –1.3 to 1.8, –2.0 to –3.0 (c) Both A and B (d) None of these

6. According to ...... combinations, plant growth regulation may have additive, synergistic or inhibitory effects on assimilations partitioning. (a) Fenson and Spanner (b) Van den Honert (c) Mason and Phillis (d) Gifford and Evans

2. In most of the species, the maximum velocity of transport is: (a) 700–900 mmh–1 (b) 500–1500 mmh–1 (c) Both (a) and (b) (d) None of these

7. According to ...... phloem uploading in potato tubers from sieve elements to cortical cells is a symplastic passive process. (a) Fenson and Spanner (b) Van den Honert (c) Mason and Phillis (d) Oprka

3. The quantity of material passing through a given cross section of sieve tubes per unit of the time is known as: (a) Mass flow rate (b) Mass transfer rate (c) Both (a) and (b) (d) None of these

8. Protoplasmic streaming theory for translocation of organic solutes was given by: (a) De Varies and Curtis (b) Fenson and Spanner (c) Van den Honert (d) Mason and Phillis

4. Munch’s hypothesis accounts for translocation of organic solutes only in: (a) Upward direction (b) Downward direction (c) Both (a) and (b) (d) None of these

9. Protoplasmic theory has been re-emphasized by: (a) Cany and Thaine (b) Fenson and Spanner (c) Van den Honert (d) Mason and Phillis

5. Pressure flow hypothesis is also known as: (a) Fenson and Spanner hypothesis (b) Munch’s hypothesis (c) Both (a) and (b) (d) None of these Ans.

1. (b)

2. (b)

3. (b)

4. (b)

5. (b)

6. (d) 91

7. (d)

8. (a)

9. (a)

92

Plant Physiology: Question Bank

10. Interfacial flow hypothesis for translocation of organic solutes was proposed by: (a) De Varies and Curtis (b) Fenson and Spanner (c) Van den Honert (d) Mason and Phillis

18. The ability of sink to mobilize photosynthates or assimilates toward it is known as: (a) Sink activity (b) Sink size (c) Sink strength (d) None of these

11. Activated diffusion hypothesis for translocation of organic solutes was given by: (a) De Varies and Curtis (b) Fenson and Spanner (c) Van den Honert (d) Mason and Phillis

19. In higher plants, among the followings is not related to translocation of organic solutes in higher plants: (a) Electro-osmotic hypothesis (b) Protoplasmic streaming theory (c) Interfacial flow hypothesis (d) All of the above

12. Electro-osmotic theory for translocation of organic solutes was given by: (a) De Varies and Curtis (b) Fenson and Spanner (c) Van den Honert (d) Mason and Phillis

20. The translocation of sugars from mesophyll cells to sieve tube elements in leaf is called: (a) Phloem loading (b) Phloem unloading (c) Both (a) and (b) (d) None of these

13. The signal between source and sink may be: (a) Chemical (b) Physical (c) Both A and B (d) None of these 14. The rate of photosynthesis ...... when sink/source ratio is decreased. (a) Increases (b) Not affected (c) Declines (d) None of these

21. Movement of photosynthetic assimilates from sieve tube elements to receiver cells of sink is called: (a) Phloem loading (b) Phloem unloading (c) Both A and B (d) None of these

16. Total weight of sink tissue is known as: (a) Sink activity (b) Sink size (c) Both (a) and (b) (d) None of these

22. Which of the following is the controlling factor in assimilate partitioning and translocation of assimilates? (a) Long distance signals between sources and sinks and plasmadesmata (b) Rate of photosynthesis and sink demand (c) Competition among sink tissues for available translocated assimilates (d) All of the above

17. Sink strength is equal to: (a) Sink size + sink activity (b) Sink size – ssink activity (c) Sink size × sink activity (d) None of the above

23. Assimilate partitioning is ...... distribution of photoassimilates a different sinks of plant: (a) Uniform (b) Differential (c) No (d) None of these

15. The rate of uptake of assimilates per unit weight of the sink is known as: (a) Sink size (b) Sink activity (c) Both (a) and (b) (d) None of these

Ans.

10. (c) 21. (c)

11. (d) 22. (d)

12. (b) 23. (b)

13. (c)

14. (a)

15. (b)

16. (b)

17. (c)

18. (a)

19. (d)

20. (a)

Translocation of Organic Solutes

24. Phloem loading and unloading occurs in higher plant through: (a) Apoplastic Pathways (b) Symplatic Pathways (c) Both (a) and (b) (d) None of the above 25. In symplastic loading, the number of plasmodesmata connecting the sieve tubes (including companion cells) to surrounding cells is: (a) Abundant (b) Fewer (c) Both (a) and (b) (d) None of these 26. In apoplastic loading, the number of plasmodesmata connecting the sieve tubes (including companion cells) to surrounding cells is: (a) Abundant (b) Fewer (c) Both (a) and (b) (d) None of these 27. In symplastic loading, type of companion cells in the small veins is: (a) Ordinary or transfer cells (b) Intermediary cells (c) Both (a) and (b) (d) None of the above 28. In apoplastic loading, type of companion cells in the small veins is: (a) Ordinary or transfer cells (b) Intermediary cells (c) Both (a) and (b) (d) None of the above 29. In which form of sugar the symplastic loading takes place? (a) Maltose (b) Glucose (c) Sucrose (d) None of these 30. In symplastic loading the transport of sugars occurs mainly: (a) Only oligosaccharides (b) Sucrose (c) Sucrose and other oligosaccharides (d) None of the above 31. In girdled plant, which part die first: (a) Shoots (b) Leaves (c) Roots (d) All of these Ans.

24. (c) 35. (b)

25. (a) 36. (a)

26. (b) 37. (b)

27. (b) 38. (d)

28. (a)

93

32. The example of sink tissue or organs in higher plants is mainly: (a) Roots (b) Stem (c) Seed (d) All of these 33. Translocation of organic solutes in higher plants takes place mainly through: (a) Phloem sieve tubes (b) Xylem vessels (c) Both A and B (d) None of these 34. Translocation of organic solutes always takes place from the region of ...... concentration of soluble to ...... concentration of soluble form. (a) Lower, higher (b) Higher, lower (c) No flow (d) None of these 35. The movement of organic food materials or the solutes in soluble form from one place to another in higher plants is called: (a) Transformation of organic solute (b) Translocation of organic solute (c) Both (a) and (b) (d) None of these 36. The phenomenon wherein an ion species present in excess in the nutrient medium may depress the uptake of another ion species has been called: (a) Ion-antagoniam (b) Ion-inhibition (c) Ion-suppression (d) None of these 37. Main function of arbuscles in VAM is: (a) To provide the strength to host cells (b) To increase surface area between fungus and the host cell (c) To decrease the volume of host cells (d) None of the above 38. Mycorrhizal formation tends to be suppressed in soil that is: (a) Very rich in nutrient supply (b) Flooded (c) Very poor in nutrient supply (d) All of the above 29. (c)

30. (c)

31. (c)

32. (d)

33. (a)

34. (b)

94

Plant Physiology: Question Bank

39. Which of the following mineral element is less soluble and comparatively immobile in soil? (a) N (b) K (c) P (d) None of these 40. Choose the wrong statement among the followings: (a) Mycorrhizae reduce the rhizosphere and nutrient depletion zone in the soil (b) VAM forms thick mantle around root surface (c) The arbuscles formed by VAM penetrate protoplasts of cortical cell of host root (d) All of the above 41. Mycorrhizae are seldom present in: (a) Plants of the families Brassicaceae and Chenopodiaceae (b) Aquatic plants (c) Hydroponically grown plants (d) All of the above 42. Hartig net is the characteristic of: (a) VAM (b) Ectotrophic mycorrhizae (c) Both A and B (d) None of the above

46. The direction of electrogenic pumps such as H+–ATPases in plants, is: (a) Diffused (b) Outward (c) Inward (d) Both B and C 47. Which of the following is an example of electroneutral pump? (a) Ca2+–ATPase (b) H+/K+–ATPase (c) H+–PPase (d) H+–ATPase 48. In primary active transport, the energy required comes chiefly from: (a) Proton motive force (b) Hydrolysis of ATP (c) Hydrolysis of GTP (d) All of the above 49. Mark out the correct statement: (a) Ca2+ and anion channels are inward (b) Ca 2+ channels are outward while anion channels are inward (c) Ca 2+ and anion channels are outward (d) Ca 2+ channels are inward while anion channels are outward

43. Which of the following is not an example of secondary active transport of solutes in plants? (a) Antiport (b) Contraport (c) Symport (d) None of these

50. Which of the following ions can diffuse both outward and inward through channels across the membrane in plants? (a) Anions (b) Ca2+ + (c) K (d) All of these

44. Which of the following can trigger opening of calcium channels in tonoplast? (a) GTP (b) IP3 (c) ATP (d) None of these

51. Transport of ions through channels is always: (a) Active (b) Passive (c) Both (a) and (b) (d) None of these

45. Secondary active transport of solutes utilizes energy: (a) From sunlight (b) From hydrolysis of ATP (c) That is stored in proton–electrochemical potential gradient (d) All of the above Ans.

39. (c) 50. (c)

40. (d) 51. (b)

41. (d) 52. (d)

42. (b)

43. (d)

52. Which of the following is not an example of membrane transporter proteins? (a) Symporters and antiporters (b) Channels and carriers (c) Pumps (d) None of these 44. (b)

45. (c)

46. (b)

47. (b)

48. (b)

49. (d)

Translocation of Organic Solutes

53. Which of the following most important in the transport of ionisable solutes across the membrane? (a) Electric potential gradient (b) Electrochemical potential gradient (c) Chemical potential gradient (d) Concentration of solutes 54. Facilitated diffusion of solutes through transporter proteins across the membrane is: (a) Secondary active transport process (b) Passive transport process (c) Active transport process (d) Both (b) and (c) 55. The mineral salts after being absorbed by epidermal cells of roots are transported to xylem by: (a) Symplastic pathway (b) Transmembrane pathway (c) Apoplastic pathway (d) All of the above 56. If a cell contain fixed cations in it and is placed in a salt solution containing cations and anions, then Donnan’s equilibrium will result in: (a) Equal numbers of cations and anions inside the cell (b) Accumulation of anions inside the cell (c) Accumulation of cations inside the cell (d) None of the above 57. Which of the following enzymes has no role in Bennet–Clark’s protein– lecithin theory? (a) Choline esterase (b) Lecithinase (c) Choline acetylase (d) None of these 58. Protein–lecithin theory of absorption of mineral salts was first proposed by: (a) Donnan (b) Lundegardh and Burstrom (c) Bennet–Clark (d) None of the above Ans.

53. (b) 64. (d)

54. (b) 65. (d)

55. (d)

56. (b)

57. (d)

95

59. Which of the following assumptions is not a basis of Lundegardh’s cytochrome pump theory? (a) Cations are absorbed passively (b) Mechanism of cations and anions absorption is different (c) Anions are absorbed through cytochromes chain by active process (d) None of the above 60. When a plant transferred from water to a salt solution, the rate of respiration increases. This process is called: (a) Activated respiration (b) Ions respiration (c) Salt respiration (d) None of the above 61. Metabolic energy is required in: (a) Contact exchange of ions (b) Passive absorption of mineral salts (c) Active absorption of mineral salts (d) None of the above 62. According to contact exchange theory, the ions absorbed on the root surface to be exchanged with: (a) Oppositely charged ions present in soil solution (b) Similarly charged ions absorbed on clay micelles (c) Oppositely charged ions absorbed on clay micelles (d) None of the above 63. First step in absorption of mineral salts by plants is: (a) Ion exchange (b) Imbibition (c) Diffusion (d) None of these 64. Mineral salts are absorbed by plants: (a) As anions (b) As cations (c) As much (d) Both (a) and (b) 65. Which part of the roots is involved in absorption of mineral salts in higher plants? (a) Root hair zone (b) Zone of elongation (c) Root cap (d) Meristematic region 58. (c)

59. (d)

60. (c)

61. (c)

62. (b)

63. (a)

96

Plant Physiology: Question Bank

66. Which of the following is not a controlling factor in translocation and assimilates partitioning in higher plants? (a) Long distance signals between sources and sinks and plasmodesmata (b) Competition among sink tissues for available translocated assimilates (c) Photosynthesis and sink demand (d) None of the above 67. Differential distribution of photoassimilates in different sinks of the plant is called: (a) Consumption of photoassimilates (b) Storage of photoassimilates (c) Assimilates partitioning (d) Separation of assimilates 68. Sucrose–H + symport or cotransport mechanism explains the transfer of sugars in phloem loading from: (a) Symplast to apoplast (b) Apoplast to symplast (c) Both (a) and (b) (d) None of the above 69. Phloem loading and unloading occur in higher plant through: (a) Symplastic pathway (b) Apoplastic pathway (c) Both (a) and (b) (d) None of the above 70. Transfer of photosynthates from sieve tube elements to receiver cells of sink is called: (a) Translocation of photosynthesis (b) Phloem loading (c) Phloem unloading (d) All of the above 71. The transfer of sugars from mesophyll cells to sieve tube elements in the leaf is called: (a) Phloem unloading (b) Phloem loading (c) Both (a) and (b) (d) None of the above Ans.

66. (d) 77. (b)

67. (c) 78. (b)

68. (b) 79. (b)

69. (c)

70. (c)

72. Which of the following is not related to translocation of organic solutes in higher plants? (a) Activated diffusion hypothesis and electro-osmotic theory (b) Protoplasmic streaming theory (c) Interfacial flow hypothesis (d) None of the above 73. Munch’s hypothesis accounts for translocation of organic solutes only in: (a) Downward direction (b) Upward direction (c) Both (a) and (b) (d) None of the above 74. Mass flow or pressure flow hypothesis was first put forward by: (a) Vries (b) Craft (c) Munch (d) None of these 75. Which of the following constitute sources of photoassimilates in the plants? (a) Flowers (b) Leaves (c) Seeds (d) Fruits 76. Sink tissues or organs in higher plants are mainly: (a) Fruits and seeds (b) Young leaves (c) Stems and roots (d) All of these 77. Photosynthates are translocated from sources to sink organs mainly in the form of: (a) Starch (b) Sucrose (c) Fructose (d) Glucose 78. Translocation of organic solutes in higher plants takes place mainly through: (a) Xylem vessels (b) Phloem sieve tubes (c) Pith (d) Both (a) and (b) 79. Translocation of sugar in flowering plants occurs in the form of: (a) Glucose (b) Sucrose (c) Starch (d) Galactose 71. (b)

72. (d)

73. (a)

74. (c)

75. (b)

76. (d)

Translocation of Organic Solutes

80. Which element is essential for the translocation of sugars in plants? (a) Fe (b) Mn (c) Mo (d) B 81. Path of sugar translocation in dicot plants can be demonstrated by: (a) Girdling (b) Grafting (c) Defoliation (d) Root pressure 82. The removal of a ring of bark from trunk of a tree eventually kills it because: (a) Roots are starved of photosynthetase (b) Foliar parts are starved of water (c) Foliar parts are starved of minerals (d) Photosynthesis gets inhibited 83. When a plant is girdled (phloem removed): (a) Roots will the first (b) Shoot will die first (c) Both root and shoot system will die together (d) Plant will not be affected adversely 84. Which would do maximum damage to a tree? (a) The loss of half of its leaves (b) The loss of entire leaves (c) The loss of half of its branches (d) The loss of its bark 85. Which of the following trees would die quicker? (a) Hollow hearted (b) Girdled (c) Deciduous (d) Pruned 86. Munch’s mass flow hypothesis explains: (a) Translation (b) Transcription (c) Translocation (d) Transpiration 87. Ringing experiments cannot be done successfully in: (a) Gymnosperms (b) Some monocots (c) Monocots and cucurbits (d) Dicots Ans.

80. (d) 91. (b)

81. (a) 92. (d)

82. (a) 93. (c)

83. (a) 94. (b)

84. (d) 95. (c)

97

88. If a girdle is made below the leaves in mango tree: (a) Fruits would be smaller in size (b) Fruits would be larger in size (c) Fruits would not be formed (d) Fruit size will remain unchanged 89. If ringing is done between fruit and leaves: (a) Fruits would be smaller in size (b) Fruits would be larger in size (c) Fruits size would not be affected (d) Fruits would not be formed at all 90. Transcellular strand theory of phloem transport was proposed by: (a) Thaine (b) Fensom (c) Munch (d) Spanner 91. Which of the following ions, play a vital role in phloem translocation? (b) K+ (a) Na+ (c) Ca++ (d) Fe++ 92. Starch is accumulated in potato tuber because of: (a) Synthesis of sugar in leaf (b) Transportation of sugars from the leaf to tuber through phloem (c) Conversion of sugars to starch (d) All the above 93. Rate of translocation of photosynthetase in sugarcane is: (a) 40–60 cm/h (b) 85–100 cm/h (c) 270 cm/h (d) 300 cm/h 94. ‘Activated diffusion theory’ of phloem translocation was proposed by: (a) Van-den Honert (b) Mason and Phillis (c) Salisbury (d) Spanner 95. Which of the following explains/ explain bidirectional transport of metabolites in phloem tissue? (a) Mass flow hypothesis (b) Electro-osmotic theory (c) Transcellular streaming theory (d) All the above 85. (b)

86. (c)

87. (c)

88. (b)

89. (a)

90. (a)

98

Plant Physiology: Question Bank

96. According to “protoplasmic streaming theory” movement of solutes in phloem is caused by the process of: (a) Diffusion (b) Cytoplasmic streaming (c) Both diffusion and cytoplasmic streaming (d) Charging of sieve plates 97. On the basis of symptoms of chlorosis in leaves a student inferred that this was due to deficiency of nitrogen. This inference could be correct only if yellowing appeared first in:

Ans.

96. (c)

97. (b)

98. (d)

99. (b)

(a) Old leaves followed by young leaves (b) Young leaves (c) Old leaves (d) None of these 98. Cytochrome oxidae contains: (a) Co (b) Na (c) Mg (d) Fe 99. Plastocyanin is a protein containing: (a) Ca (b) Cu (c) Mg (d) Fe

Photosynthesis

99

7

Photosynthesis 1. Green non-sulfur bacterium chloroflexus via: (a) C3-cycle (b) C4-cycle (c) Hydroxy propionate pathway (d) None of the above

(c) Chloroplast, nuclear (d) Both (a) and (b) 7. In plants, RuBisCo consists of ...... larger and ...... Smaller subunits. (a) Seven, seven (b) Nine, nine (c) Eight, eight (d) None of these

2. Photosynthetic green sulfur fix carbon via: (a) Calvin cycle (b) Hydroxyl propionate pathway (c) Reductive carbocylic acid cycle (d) None of the above

8. Find the missing in the figure which shows the PS I electron carriers and their kinetic behavior.

3. Structural formula of RuBisCo is: (a) LS (b) LS (where L = larger subunit and S = smaller subunit) (c) LS (d) None of these 4. How many enzymes are involved in regeneration phase of Calvin cycle? (a) 12 (b) 11 (c) 10 (d) None of these 5. How many enzymes are required in Calvin cycle? (a) 14 (b) 13 (c) 12 (d) None of these

(a) R = P700, Ao = Monomeric chlorophyll a, A1 = Phylloquinone, Fx and Fa = a series of additional electron carriers that include three different Fe-S centres (b) R = P700, A1 = Monomeric chlorophyll a, Ao = Phylloquinone, Fx and Fa = a series of additional electron carriers that include three different Fe-S centers

6. In most of the eukaryotes, larger subunits are encoded by the ..... genome and smaller subunits are encoded by the genome. (a) Nuclear, nuclear (b) Chloroplast, chloroplast Ans.

1. (c)

2. (c)

3. (a)

4. (c)

5. (b)

6. (c) 99

7. (c)

8. (a)

100

Plant Physiology: Question Bank

(c) R = P700, Ao = Monomeric chlorophyll a, A1 = Phylloquinone, A1 and Fa = a series of additional electron carriers that include three different Fe-S centers (d) None of the above

11. Find the correct matching of protein subunit of the PSH core complex: Protein Gene

Location Mol of gene mass Hydrophilic subunits Stromal orientation (a) Psa C psa C Chloroplast 9

9. Find the correct matching of polypeptide subunit of PSI core complex:

(b) Psa D

psa D

Nucleus

18

Protein Gene

(c) Psa E

Psa H

Nucleus

10

Location of gene

Mol mass (KDa)

Hydrophobic subunits (a) PsaA psaA Chloroplast 83 (b) PsaB

psaB

Chloroplast 82

(c) PsaG

psaG

Nucleus

(d) PsaI (e) PsaJ,

psaI psaJ, psaM PsaL

Chloroplast 4 Chloroplast 5,3,5

(f) PsaK,

Nucleus

Function

Reaction center protein Reaction centre protein Reaction centre protein Unknown Unknown

11

8,4, 18 Unknown

Hydrophilic subunits Stromal orientation (g) Psa C psa C Chloroplast 9 (h) Psa D

psa D

Nucleus

18

(i) Psa E

Psa H

Nucleus

10

(j) Psa H psa H Nucleus 10 Lumenal orientation (k) Psa F psa F Nucleus 17 (l) Psa N psa N Nucleus 10 (m) All of the above matching are correct

Fe-S Apo protein Ferredozin docking Cyclic electron transport LHC-I linker PC docking Unknown

10. Find the correct matching of polypeptide subunits of the cytochrome b6f complex: Protein Gene (a) Cyt f

pet A

Location Mol of gene mass Chloroplast 32

(b) Cyt b6

pet B

Chloroplast 24

(c) RfeS

pet C

Nucleus

19

(d) Subunit pet D Chloroplast 17 IV (e) Pet G , Pet M Nucleus 4.0 (f) Pet I pet G , Chloroplast 3.4 (g) All of the above

Ans.

9. (m) 10. (g)

11. (d)

Function Cyt apoprotein Cyt apoprotein Rieske Fe-S apoprotein Quinone binding at Qp Unknown Unknown

12. (b)

13. (d)

(d) Psa H psa H Nucleus 10 Lumenal orientation (e) Psa F psa F Nucleus 17 (f) Psa N psa N Nucleus 10 (m) All of the above matching is correct

Function

Fe-S Apo protein Ferredozin docking Cyclic electron transport LHC-I linker PC docking Unknown

12. Choose the correct alternative for polypeptide subunits of ATP synthase complex: Protein Gene (a) Cyt f

pet A

Location Mol of gene mass Chloroplast 32

(b) Cyt b6

pet B

Chloroplast 24

(c) RfeS

pet C

Nucleus

19

(d) Subunit IV pet D Chloroplast 17 (e) Pet G , Pet M Nucleus 4.0 (f) Pet I pet G , Chloroplast 3.4 (g) All of the above

Function Cyt apoprotein Cyt apoprotein Rieske Fe-S apoprotein Quinone binding at Qp Unknown Unknown

13. The thylakoid ATP synthase consists of two segment a transmembrane segment called ...... and a hydrophilic segment on the stromal surface, called ...... . (a) CF1, CF1 (b) CF0, CF0 (c) CF1, CF0 (d) CF0, CF1 14. The overall stoichiometry of CF1 is: (a) a 169y 595 (b) a 262 y (c) a 363y (d) None of these 15. Chloroplast ATP synthase is a ..... KDa enzyme that contains ..... different subunits and includes both chloroplast and nuclear, encoded gene products: (a) 800, four (b) 700, five (c) 400, nine (d) None of these 14. (b)

15. (c)

Photosynthesis

16. First stable product of the dark reaction of photosynthesis is: (a) 1, 3-bis PGA (b) 3 PGA (c) 3PGALD (d) None of these 17. Which of the following does not occur in cyclic electron transport and phosphorylation? (a) Formation of reduced NADPH (b) Photolysis of water (c) Oxygen evolution (d) All of the above 18. In photosynthesis, dark reaction or Blackman‘s reaction is: (a) Enzymatic and independent of light (b) Non-enzymatic and occurs in absence of light (c) Enzymatic and occurs in absence of light (d) None of the above 19. Ferredoxin (Fd) is a: (a) Copper containing protein (b) Non-heme iron-protein (c) Heme iron-protein (d) None of the above 20. Noncyclic electron transport in photosynthesis is also known by the name of: (a) Q-Scheme (b) Z-Scheme (c) S-Scheme (d) None of these 21. Which of the following does not form one electron redox system? (a) Cytochrome (b) Plastoquinone (c) Plastocyanin (d) None of these 22. The head of ATP-synthetase (CF1) in thylakoids consists of how many different polypeptides? (a) Three (b) Five (c) Ten (d) None of these 23. Which of the following is not a component of electron transport chain in chloroplast? (a) Ubiquinone (b) Lipid soluble plastoquinone Ans.

16. (b) 27. (a)

17. (d) 28. (c)

18. (a) 29. (b)

19. (b) 30. (c)

20. (b)

101

(c) Water soluble plastocyanin (d) None of the above 24. The photosynthetic process is a complicated: (a) Only reduction process (b) Oxidation reduction process (c) Hydrogenation process (d) None of the above 25. In photosynthesis, ultimate source of electron is: (a) Phaeophytin (b) Sunlight (c) Water (d) None of these 26. In photosynthesis, assimilatory power is generated during: (a) Photolysis of water (b) Dark reaction (c) Light reaction (d) None of these SZ+P 680  27. SZP 680  SZP 680+  + S ZP 680 The above equation is of: (a) Oxidation and reduction of P 680 during oxygenic photosynthesis (b) Oxidation of water (c) ~Q-cycle in the chloroplast (d) None of these 28. DBMIB is an inhibitor of the: (a) Qb (b) Qa (c) Cyt b6f complex (d) PSI (e) None of the above 29. DCMU is an inhibitor of: (a) PSI (b) PSII (c) Both (d) None of these 30. 2HO  O2 + 4H+4e–: (a) Contribution of pH and membrane potential to the proton motive force (b) Oxidation and reduction of P680 during oxygenic photosynthesis (c) Oxidation of water (d) None of the above 31. PQH2 + 2PC2 + 2H+  PQ + 2PC + 4H+: (a) Oxidation and reduction of P during oxygenic photosynthesis (b) Oxidation of water 21. (b)

22. (c)

23. (a)

24. (b)

25. (c)

26. (c)

102

Plant Physiology: Question Bank

(c) Q-cycle in the chloroplast (d) None of the above 32. PE  PC  APC  Chlorophyll a where, PE = Phycocyanin, PC = Phycocyanin, APC = Allophycocyanin The above equation describes: (a) Energy transfer is phycobilisome (b) Primary charge separation in reaction center (c) Photochemistry in reaction center (d) None of the above 33. Chl A0A1A2  Chl A0A1A2 light  Chl +A0–A1A2  Chl +A0A1–A2  Chl +A0A1A2– The above equation describes: (a) Energy transferrin phycobilisome (b) Primary charge separation in reaction center (c) Photochemistry in reaction center (d) None of the above light

34. Chl A  Chl A  Chl+A–: The above equation describes: (a) Energy transferrin phycobilisome (b) Primary charge separation in reaction center (c) Photochemistry in reaction center (d) None of the above 35. Pigment + acceptor  Pigment + acceptor  Pigment + acceptor: The above equation describes: (a) Energy transferrin (b) Primary (c) Photochemistry (d) None of the above 36.  

No. of product formed photochemically No. of quanta absorbed

The above equation is known as: (a) Relaxation time (b) Photochemistry (c) Quantum yield (d) None of these Ans.

31. (c) 42. (c)

32. (a) 43. (b)

33. (b) 44. (c)

34. (c) 45. (b)

35. (c)

37. Plastoquininine is ...... soluble: (a) Lipid (b) Water (c) Both (d) None of these 38. Plastocyanin is ...... soluble copper protein: (a) Lipid (b) Water (c) Both (d) None of these light

39. H 2 O + A  1/2 O 2 + H 2A, where A = electron acceptor: This reaction is also known as: (a) Mayer reaction (b) Calvin reaction (c) Hill reaction (d) Arnon reaction (e) None of the above 40. In photosynthetic reaction, there is change of ...... kJ per molecule of free energy, for formation of one molecule of hexose: (a) – 3840 (b) + 3840 (c) – 2840 (d) + 2840 (e) None of the above 41. Most of C4 species are ...... : (a) Dicots (b) Monocots (c) Both (d) None of these 42. All gymnosperm, bryophytes and algae and most of pterdophyta that have been studies are ....... plants: (a) CAM (b) C4 (c) C3 (d) None of these 43. Which of the following plants is known as obligate sun plant? (a) Solidago virgaurea (b) Helianthus (c) Alocosia (d) None of these 44. Which of the following plant is known as obligate shade plant? (a) Solidago virgaurea (b) Helianthus (c) Alocosia (d) None of these 45. Optimum temperature for photosynthesis in CAM plants is: (b) ~35°C (a) 15–25° C (c) 30–47° C (d) None of these 36. (c)

37. (a)

38. (b)

39. (c)

40. (d)

41. (a)

Photosynthesis

46. Optimum temperature for photosynthesis in C4 plants is: (a) – 35°C (b) 30–47°C (c) 15–25°C (d) None of these 47. Optimum temperature for photosynthesis is C3 plant is: (a) – 35°C (b) 30–47°C (c) 15–25°C (d) None of these 48. CO 2 compensation point (µ mol –1 CO2) of CAM plants is: (a) 0–5 in dark (b) 0–10 (c) 30–70 (d) None of these 49. CO 2 compensation point (µ mol –1 CO2) of C4 plants is: (a) 0–5 in dark (b) 0–10 (c) 30–70 (d) None of these 50. CO 2 compensation point (µ mol –1 CO2) of C3 plants is: (a) 0–5 in dark (b) 0–10 (c) 30–70 (d) None of these 51. Leaf chlorophyll a to b ratio in CAM plant is: (a) 2.5–3.0 (b) 3.9 = 0.6 (c) 2.8 = 0.4 (d) None of these 52. Lead chlorophyll a to b ratio in C 4 plant is: (a) 2.5–3.0 (b) 3.9 + 0.6 (c) 2.8 = 0.4 (d) None of these 53. Leaf chlorophyll a to b ratio in C 3 plant is: (a) 2.5–3.0 (b) 3.9 = 0.6 (C) 2.8 = 0.4 (d) None of these 54. Transpiration ratio of C4 plants is: (a) 18–125 (b) 250–350 (c) 400–950 (d) None of these 55. Transpiration ratio of CAM plants is: (a) 18–125 (b) 250–350 (c) 400–950 (d) None of these 56. Transpiration ratio of C3 plants are: (a) 18–125 (b) 250–350 (c) 400–950 (d) None of these 57. Theoretical energy requirement(CO2: ATP: NADPH) for CAM plant is: Ans.

46. (b) 57. (a)

47. (a) 58. (b)

48. (a) 59. (c)

49. (b) 60. (a)

50. (c) 61. (c)

103

(a) 1:6:5:2 (b) 1:5:2 (c) 1:3:2 (d) None of these 58. Theoretical energy requirement(CO2: ATP: NADPH) for C4 plant is: (a) 1:6:5:2 (b) 1:5:2 (c) 1:3:2 (d) None of these 59. Theoretical energy requirement(CO2: ATP: NADPH) for C plant is: (a) 1:6:5:2 (b) 1:5:2 (c) 1:3:2 (d) None of these 60. Photosynthetic efficiencies of crop plant never exceed the theoretical ...... percent of absorbed PAR (photosynthetic active radiation). (a) 18 (b) 15 (c) 10 (d) None of these 61. Find the maximum photosynthesis rate of temperate zone herbs and C3 pathway crop plants such as glycine max under natural conditions: (a) 20–24 (b) 10–24 (c) 10–20 (d) 3–12 62. Find the maximum photosynthesis rate of temperate zone deciduous trees and shrubs such as Fagus sylvatica under natural conditions: (a) 20–24 (b) 10–24 (c) 10–20 (d) 3–12 63. Find the maximum photosynthesis rate of temperate zone deciduous trees and shrubs such as Fagus sylvatica under natural conditions: (a) 3–9 (b) 3.9–5.6 (c) 20–40 (d) None of these 64. Find the maximum photosynthesis rate of temperate zone deciduous trees and Agave Americana (century plant) such as Fagus sylvatica under natural conditions: (a) 3–9 (b) 3.9–5.6 (c) 0.6–2.4 (d) None of these 65. Thomas Engelmann illuminated a filament of algae with light that passed through a prism, thus exposing different segments of the algal filament to different wavelength of light. He added aerobic 51. (a) 62. (d)

52. (b) 63. (a)

53. (c) 64. (c)

54. (b)

55. (a)

56. (c)

104

Plant Physiology: Question Bank

bacteria and found that these bacteria congregated in the area illuminated by red and blue light. If you run the dame experiment without passing light through a prism, what would you predict? (a) There would be no difference in results (b) The number of bacteria would decrease along the entire length of the filament (c) The bacteria would be relatively evenly distributed along the length of the filament (d) The number of bacteria would increase along the entire length of the filament 66. When DCPIP (Hill reagent) accepts electron from water, its color changes to: (a) Colorless (b) Red (c) Blue (d) None of these 67. The diagram given below shows the relation between light intensity and CO2 concentration on rate of photosynthesis:

Which of the following explains the diagram correctly? (a) The numer of chlorophyll molecules prevent the rate of photosynthesis (b) Photosynthesis is independent of light intensity (c) Chlorophyll respond equally to light intensities and CO2 concentration, thereby limiting the rate of photosynthesis (d) At low intensity, the light dependent reaction is rate limiting but at Ans.

65. (c)

66. (a)

67. (d)

68. (c)

69. (d)

high light intensity, the light independent reaction involving CO2 is rate limiting 68. Which of the following plots P, Q, R and S in the given graph show the effect of light intensity on the rate of photosynthesis?

P

(a) P (b) Q (c) R (d) S 69. Photosynthesis is an oxidation reduction process. The material that is oxidized is: (a) P (b) Q (c) R (d) S 70. The correlation between Kranz anatomy and C4 photosynthesis was first established by: (a) Arnold (b) Hill and Bendall (c) Dowton and treguna (d) Calvin (e) None of these 71. Rate of photosynthesis is independent of: (a) Intensity of light (b) Quality of light (c) Temperature (d) None of these 72. During photosynthesis, when PGA is changed into phosphoglyceraldehyde, which of the following reaction occurs? (a) Electrolysis (b) Oxidation (c) Reduction (d) Hydrolysis (e) None of these 70. (c)

71. (d)

72. (c)

Photosynthesis

73. The experimental material which helped advances in photosynthesis research is: (a) Clamydomonas (b) Hydrilla (c) Chlorella (d) None of these 74. Photo-oxidation of water in photosynthesis is in association of: (a) Cytochrome B6 (b) Plastocyanin (c) Pigment system II (d) Pigment system I (e) None of the above 75. In the process of photosynthesis, chlorophyll functions as: (a) An energy converter (b) An end-product (c) A raw material (d) A hydrogen acceptor (e) None of the above 76. The plastids engaged in starch synthesis and storage are called: (a) Leucoplasts (b) Chromoplasts (c) Amyloplasts (d) Glucoplasts (e) None of the above 77. Quantasome contains: (a) 200 chlorophyll molecules (b) 230 chlorophyll molecules (c) 250 chlorophyll molecules (d) 300 chlorophyll molecules (e) None of the above 78. The unit of photosynthesis is: (a) Nanometer (b) Angstrom (c) Quantasome (d) None of these 79. Which of the following technique has been most useful for investigation of Calvin cycle? (a) X-ray technique (b) Flash light experiment (c) Radioactive isotope technique (d) None of the above 80. Evidence for the existence of two photochemical systems in photosynthesis was proposed by: (a) Arnon (b) Emerson (c) Hill (d) None of these Ans.

73. (c) 84. (b)

74. (c) 85. (b)

75. (a) 86. (c)

76. (c) 87. (d)

77. (c)

105

81. Chemical phase in photosynthesis was discovered for the first time by: (a) Calvin (b) Hill (c) Arnon (d) Blackman (e) None of the above 82. The percentage of light energy fixed in photosynthesis is generally around: (a) 30 (b) 10 (c) 3 (d) 1 83. The ultimate biological energy comes from: (a) ATP (b) Glucose (c) Mitochondria (d) Sunlight (e) None of the above 84. The exact mechanism of photosynthesis is a process of converting light energy into chemical energy, was established by: (a) Ingen Housz (b) Robert Hill (c) Jean Sensbier (d) None of these 85. Who among of the following, who gave chemical composition of chlorophyll, carotenes and xanthophyll’s? (a) Flemming and Waksman (b) Willstatter and Stoll (c) Park and Biggins (d) Meyer and Calvin 86. The bulk fixation of carbon through photosynthesis takes place in: (a) Tropical rain forest and crop plants (b) Tropical rain forest (c) Ocean (d) Crop plants 87. The research on photosynthesis began: (a) In the early 20th century (b) In the 19th century (b) In the 17th early (d) In the 18th century 88. Huber, Michel and Dissenhoffer analyzed the structure of photosynthetic reaction center of the bacterium Rohodobacter using: (a) Electron microscopy (b) Autoradiography 78. (c)

79. (c)

80. (b)

81. (d)

82. (d)

83. (d)

106

Plant Physiology: Question Bank

(c) X-ray diffraction (d) Spectrophotometry 89. Find the correct statement: (a) C4 plants are more enriched in 12C than C3 plants (b) C4 plants are more enriched in 14C than C3 plants (c) C3 plants are more enriched in 14C than C4 plants (d) None of the above 90. Table sugar manufactured from sugarcane can be distinguished from that manufactured from sugar beet by: (a) Hydrogen isotope ratio analysis (b) Carbon isotope ratio analysis (c) Chemical analysis (d) None of the above 91. RuBP carboxylase was crystallized in 1971 from: (a) Tobacco leaves (b) Maize leaves (b) Rice leaves (d) Chlorella 92. Phosphorylation in a chloroplast is the most similar to which of the under mentioned mitochondrial reactions? (a) Oxidative phosphorylation (b) Oxidative decarboxylation (c) Substrate level phosphorylation (d) None of the above 93. Which of the following element is essential for the photolysis of water? (a) Oxygen (b) Chlorine (c) Nitrogen (d) None of these 94. “Vegetables are not formed of water but of a certain peculiar terrestrial matter. It has been shown that there is considerable quantity of this matter contained in rain, spring and river water; that the greatest part of the fluid mass that ascends up into plants does not settle there but passes through their pores and exhales up into the atmosphere; that a great part of the terrestrial matter, mixed with water, passes up into the plant along with it and that the plant is more or Ans.

88. (c)

89. (b)

90. (b)

91. (d)

92. (a)

less augmented in proportion as the water contains a greater or less quantity of that matter; from all of which I’ve may reasonably infer, that earth, and not water, is the matter that constitutes vegetables”. This famous statement was made by which famous scientist? (a) De Saussere (b) Woodward (c) Helmont (d) None of these 95. “Plants, instead of affecting the air in the same manner with animal respiration, reserve the effects of breathing and tend to keep the atmosphere sweet and wholesome when it has become noxious in consequence of animals either living and breathing or dying and putrefying in it”. This statement was made by: (a) Priestly (b) Woodward (c) Mayer (d) None of these 96. “Plants very probably draw through their leaves some part of their nourishment from the air ...... may not light, also by freely entering surfaces of leaves and flowers, contribute much to ennobling the principles of vegetables”. This famous statement was made by which famous scientist among the following? (a) Ingenhouse (b) Hales (c) Priestley (d) None of these 97. During daylight hours, the rate of photosynthesis is higher than that of respiration, and the ratio of oxygen produced to that of consumed is: (a) 50:1 (b) 1:1 (c) 5:1 (d) 10:1 98. Algae float in water during daytime and sink during night-time because: (a) They lose weight at night (b) They come up to enjoy sunlight (c) They become buoyant in light due to accumulation of oxygen bubbles released in photosynthesis (d) They become light due to consumption of food materials in respiration 93. (b)

94. (b)

95. (a)

96. (b)

97. (d)

98. (c)

Photosynthesis

99. The quantum yield in photosynthesis is: (a) 50% (b) 25% (c) 12.5% (d) 8.5% 100. In photosynthetic experiments, which plant would behave as a single chloroplast? (a) Pisum sativum (b) Ulothrix (c) Chlorella pyrenoidosa (d) Both 101. The thylakoids are removed and kept in a culture medium containing CO2 and H2O. If the set-up is exposed to a light, hexose sugars are not formed as the end product. The most appropriate reason for this will be that: (a) Carbon assimilation cannot takes place (b) The pigments (P700 and P680) are not linked (c) Photosynthetic enzymes are not available (d) The light-trapping device is nonfunctional 102. The rate limiting step in photosynthesis is: (a) Dark reaction (b) Light reaction (c) Oxygen evolution (d) None of the above 103. Decreased rate of photosynthesis at the high concentration of oxygen is referred to as: (a) Emerson effects (b) Warburg effect (c) Pasture effects (d) None of these 104. It is advantageous to use Hydrilla to demonstrate photosynthesis than land plant because: (a) It does not respire (b) It photosynthesizes rapidly (c) It respire slowly (d) None of the above 105. CO2 is necessary for photosynthesis, the chemical used to remove this gas Ans.

107

most effectively from entering a control apparatus is: (a) Potassium hydroxide solution (b) Sodium carbonate (c) Distilled water (d) Calcium oxide 106. The main limiting factor which limits the rate of photosynthesis on a clear day is: (a) Chlorophyll (b) Light (c) Carbon dioxide (d) None of these 107. During the daytime, the rate of CO2 produced to that of CO2 consumed is: (a) 1:50 (b) 1:10 (c) 1:5 (d) 1:1 108. The bacterial photosynthesis is different from that of the higher plants as: (a) Energy is not required (b) Oxygen is not released (c) Light is not required (d) None of the above 109. In green sulfur bacteria, the reductant is: (a) Lactate (b) H2O (c) H2S (d) None of these 110. In organisms such as plants, algae and cyanobacteria, the reductant is: (a) Lactate (b) H2O (c) H2S (d) None of these 111. In C 4 plants, phosphenol pyruvate carboxylase is located in: (a) Cytosol (b) Mitochondria (c) Peroxysome (d) Chloroplast 112. Dibromothymoquinone, an inhibitor of cytochrome of complex of photosynthetic electron transport chain, was added to the green alga Chlamydomonas. After illumination it was found the alga: (a) Plastoquinone was reduced state (b) P700 was in reduced state (c) Plastocyanin was in reduced state (d) None of the above

99. (c) 100. (c) 101. (d) 102. (d) 103. (b) 104. (d) 105. (a) 106. (c) 107. (b) 108. (b) 109. (c) 110. (b) 111. (c) 112. (c)

108

Plant Physiology: Question Bank

113. Among the following components of chloroplasts membranes, which one is the strongest reducing agent? (a) NADPH2 (b) Reduced ferredoxin (c) Reduced cytochrome b6 (d) None of the above 114. Plastocyanin is a ...... electron carrier between ...... : (a) PSI and ferrwdoxin (b) Mobile, PSII and cytochrome b complex (c) Immobile, cytochrome b complex and PSI (d) None of the above 115. The largest subunit of RuBisCo is coded by: (a) Mitochondrial genome (b) Nuclear genome (c) Chloroplast genome (d) None of the above 116. C 3 cycle represents which of the following reaction? (a) Reductive carboxylation (b) Oxidative carboxylation (c) Salt respiration (d) Substrate level phosphorylation 117. Which of the following organism does not evolve oxygen in photosynthesis? (a) Rhodospirillium (b) Higher plants (c) Anabaena (d) Anbaena 118. C4 plants are mostly abundant in: (a) Temperate region with dry condition (b) Temperate region with more humid condition (c) Tropical region with more dry condition (d) Tropical region with more humid condition 119. Starch synthesis in leaves: (a) Occurs in the cytosol (b) Increases with build-up of phosphoglyceraldehyde in the stroma

(c) Is promoted in the light (d) None of the above 120. The flow of electrons from donor to acceptor molecule in electron transport chain occurs along: (a) Constant redox potential value (b) Increasing redox potential value (c) Decreasing redox potential value (d) None of the above 121. Rieske center is: (a) DI protein (b) Core complex I (c) Cytochrome bc–f complex (d) None of the above 122. The numbers of oxygen molecules released per photon of light in photosynthesis is called: (a) Photosynthetic yield (b) Quantum yield (c) Quantum requirement (d) None of the above 123. Which of the following has more energy per photon of light? (a) Blue light (b) Red light (c) UA–light (d) More than one 124. Emerson’s enhancement effect and red drop have been instrumental in the discovery of: (a) Photophosphorylation and cyclic electron transport (b) Photophosphorylation and non– cyclic electron transport (c) Two photosystem (d) None of the above 125. Inulin is an unbranched polymer of about ...... units joined by  -2,1linkages: (a) 20 galactose (b) 35 fructose (c) 25 glucose (d) None of these 126. The carotenoids that consist of carbon and hydrogen are termed ......, and carotenoids that contain oxygen are called ...... . (a) Xanthophylls, carotenes (b) Xanthophylls, chlorophyll

Ans. 113. (b) 114. (c) 115. (c) 116. (a) 117. (a) 118. (c) 119. (b) 120. (b) 121. (c) 122. (b) 123. (d) 124. (c) 125. (b)

Photosynthesis

(c) Carotenes, xanthophylls (d) None of the above 127. The chemical difference between -carotene and -carotene is that: (a) –carotene consists of the two ion one rings and -carotene consists of one  and two -ion one ring (b) -carotene consists of the two -ion one rings and -carotene consists of one  and one -ion one ring (c) -carotene consists of the two -ion one rings and -carotene consists of two  and one -ion one ring (d) None of the above 128. Which of the following is considered as derivative of carotenoids? (a) Lycopene, a yellow pigment (b) Lycopene, a purple pigment (c) Lycopene, a blue pigment (d) None of the above 129. Carotene, the first carotenoid to be named, was isolated from ...... tissue by Wackenroder in 1831. (a) Carrot shoot (b) Carrot root (c) Carrot leaf (d) None of these 130. The intermediate precursor of chlorophyll a is: (a) Chlorophyllide a (b) Protochlorophyll (c) Protoporphyrin IX (d) None of the above 131. An absorption spectrum is a measure of the extent to which a given substance absorbs the light of different colors or wavelengths? It is a function of the relationship between: (a) Wavelength (b) Absorption (c) Both A and B (d) None of these 132. Phycobilins consist of an conjugated system of four pyrrol rings and lacks Mg and the phytol chain, this statement is true or false? (a) Not known (b) True (c) False (d) None of these

109

133. The chlorophyll a and b differs from each other because in chlorophyll b, there is a –CHO group instead of -CH3 group at the ...... C atom in ...... pyrole ring. (a) 2nd, II (b) 2nd, I (c) 3rd, I (d) 3rd, II 134. Chlorophyll is formed from protochlorophyll in light. The protochlorophyll lacks two hydrogen atoms one each at ...... and ...... C atoms in IV pyrole ring. (a) 10th and 11th (b) 7th and 8th (c) 8th and 9th (d) None of these 135. During phosphorylation, the proton electrochemical gradient across the thylakoid membrane is from: (a) Lumen of one thylakoids to lumen of another thylakoids (b) Stroma to lumen of thylakoids (c) Lumen of thylakoids to stroma (d) None of the above 136. Dimorphic chloroplasts are found in the leaves of: (a) CAM plants (b) C4 plants (c) C3 plants (d) None of these 137. Which of the following green alga was used by Melvin Calvin in his experiment to determine sequence of dark reaction of photosynthesis? (a) Chlorella and Ulothrix (b) Chlorella and Chlamydomonas (c) Chlorella and Scenedesmus (d) None of the above 138. How many molecules of NADPH and ATP respectively are required for the reduction of 6CO 2 molecules to generate one molecule of hexose sugar in photosynthesis? (a) 12 NADP + 18 ATP (b) 18 NADP + 18 ATP (c) 18 NADP + 12 ATP (d) 12 NADP + 12 ATP

Ans. 126. (c) 127. (b) 128. (d) 129. (b) 130. (a) 131. (c) 132. (b) 133. (d) 134. (b) 135. (c) 136. (b) 137. (c) 138. (a)

110

Plant Physiology: Question Bank

139. NAD + –Me Type C 4 – pathway is found in: (a) Atriplex and amaranthus (b) Sugarcane and maize (c) Panicum maximum (d) None of the above 140. How many molecules of NADPH and ATP respectively are required for the reduction of 6CO 2 molecule in C 4 pathway? (a) 1 NADPH + 2 ATP (b) 2 NADPH + 3 ATP (c) 2 NADPH + 5 ATP (d) None of the above 141. The size of chlorophyll molecule is: (a) Head 15 × 15Å, tail 20Å (b) Head 15 × 15Å, tail 25Å (c) Head 20 × 20Å, tail 25Å (d) None of the above 142. Who first of all indicated that water is the electron donor in photosynthesis? (a) Blakeslee (b) Arnon (c) Calvin (d) Van Niel 143. During photosynthesis when PGA is changed into phosphoglyceraldehyde, which of the following reaction occurs? (a) Oxidation (b) Hydrolysis (c) Reduction (d) None of these 144. CO2 is necessary for photosynthesis. The chemical used to remove this gas effectively from entering a control apparatus is: (a) Sodium carbonate (b) Calcium oxide (c) Potassium hydroxide solution (d) Distilled water 145. Bacteriochlorophyll absorbs light rays heavily in: (a) Red region of the spectrum (b) Near infrared region of the spectrum (c) UV region of the spectrum (d) None of the above

146. Molecular formula of chlorophyll b is: (a) C55H70O4N5Mg (b) C40H56O2 (c) C55H72O5N4Mg (d) C55H70O6N4Mg 147. Molecular formula of chlorophyll a is: (a) C55H70O4N5Mg (b) C40H56O2 (c) C55H72O5N4Mg (d) None of these 148. The absorption bend shown by the chlorophylls ...... regions is also called soret bend. (a) Green–blue (b) Violet–blue (c) Red–blue (d) None of these 149. Absorption spectra of different chlorophylls differ in vivo and in vitro. This statement is true or false: (a) False (b) True (c) Not known (d) None of these 150. Which one is the most efficient converter of the sunlight? (a) Sugarcane (b) Rice (c) Wheat (d) None of these 151. The term assimilation number or photosynthetic number is coined by: (a) Dicker and Tio (b) Warburg (c) Willstatter and Stoll (d) None of the above 152. Find the missing compound in outline of the chlorophyll biosynthesis pathways:

Ans. 139. (b) 140. (b) 141. (a) 142. (d) 143. (c) 144. (c) 145. (b) 146. (d) 147. (c) 148. (b) 149. (b) 150. (a) 151. (c)

Photosynthesis

(a) P = Delta ALA, Q = IX; R= protoporphyrin; S= Hemed and open tetrapyrroles; T = Protochlorophyllide (b) P= Beta ALA, Q= IX; R = Protoporphyrin; S= Hemes and open tetrapyrroles; T= Protochlorophyllide (c) p = Delta ALA, Q= XII; R = Protoporphyrin; S= Hemes and open tetrapyrroles T= Protochlorophyllide (d) P = Delts ALA, Q= VIII; R = Protophyrin; S= Hemes and open tetrapyrroles; T= Protochlorophyllide 153. Moll’s Half Leaf experiment is the test for: (a) Carbon dioxide is necessary for photosynthesis (b) Oxygen is evolved during photosynthesis (c) Photosynthesis (d) None of the above 154. Which of the following is known as universal precursor of tetrapyrroles? (a) -aminolevulinic acid (b) -aminolevulinic acid (c) -aminolevulinic acid (d) None of the above 155. According to ...... law, all objects with temperature above absolute zero emit radiant energy: (a) Stefan–Boltzmann law (b) Lambert’s law (c) Beer’s law (d) None of these 156. A leaf emits radiation according to: (a) Stefan–Boltzmann law (b) Lambert’s law (c) Beer’s law (d) None of these 157. According to ...... law, each layer of equal thickness absorbs an equal fraction of the light that traverses it. (a) Stefan–Boltzmann law (b) Lambert’s law

111

(c) Beer’s law (d) None of these 158. According to ...... law, each molecule of a dissolved pigment absorbs the same fraction of light incident upon it. Thus, in a non-absorbing medium, the light absorbed should be proportional to dissolved pigment concentration. The law often holds for dilute solution but fails as the lightabsorbing properties of the pigment molecules change at higher concentrations: (a) Stefan–Boltzmann law (b) Lambert’s law (c) Beer’s law (d) None of the above 159. A leaf has an absorptivity coefficient of about: (a) 0.0098 (b) 0.98 (c) 0.098 (d) None of these 160. Absorption spectra of phycoerythrins is: (a) In green part of the spectrum (b) In near red part of the spectrum (c) In orange part of the spectrum (d) None of the above 161. Absorption spectra of phycocyanins is: (a) In green part of the spectrum (b) In near red part of the spectrum (c) In orange part of the spectrum (d) None of the above 162. Absorption spectra of allophycocyanin is: (a) In green part of the spectrum (b) In near red part of the spectrum (c) In orange part of the spectrum (d) None of the above 163. The unit name of quantity spectral irradiance (moles and photons) is: (a) Moles per square meter per second per nanometer

Ans. 152. (a) 153. (a) 154. (a) 155. (a) 156. (a) 157. (b) 158. (c) 159. (b) 160. (a) 161. (c) 162. (b)

112

Plant Physiology: Question Bank

(b) Watts per square meter (c) Moles per square meter per second (d) None of the above 164. The unit name of quantity irradiance (moles and photons) is: (a) Moles per square meter per second per nanometer (b) Watts per square meter (c) Moles per square meter per second (d) None of the above 165. The unit name of quantity spectral irradiance (energy) is: (a) Moles per square meter per second per nanometer (b) Watts per square meter (c) Moles per square meter per second (d) None of the above 166. Nonherbicidal compounds that behave as energy transfer inhibitors include the antibiotics such as: (a) TBT (b) Dio–9 (c) DCCD (d) All of the above 167. ...... group inhibits electron transport as well as ATP formation in coupled system: (a) Uncouplers (b) Energy transfer inhibitors (c) Inhibitory uncouplers (d) None of the above

(c) Both A and B (d) None of these 170. Urea, triazines, uracils and phenolics tend to act in ...... way. (a) Noncompetitive (b) Competitive (c) Both A and B (d) None of these 171. Which of the following photosynthetic inhibitor is known as immobile herbicides? (a) Phenolics (b) Ioxinil (c) Bromoxynil (d) All of these 172. Which of the following photosynthetic inhibitor is known as mobile herbicides? (a) Phenolics (b) Uracils (c) Triazines (d) More than one 173. In the question, a scheme shows photosynthetic electron flow within the chloroplast from water to NADP+. There are number of sites of the action of different electron transport inhibitors in the reaction. So in this figure find the site of action of ureas, triazines and phenol-type herbicides:

168. Uncouplers act by dissociating ATP synthesis of electron transport by dissipating the energized site of the thylakoid membrane, so among the followings which is the best example of uncouplers: (a) Garmicidin (b) Carbonyl cyanide phenylhydrazine (c) Carbonyl cyanide chlorophenylhydrazine (d) All of the above 169. Dinitrocresol, Bromoxynil, ioxinil and phenolics tends to act in ...... way: (a) Noncompetitive (b) Competitive

(a) D (c) S

(b) Q (d) P

Ans. 163. (c) 164. (c) 165. (b) 166. (d) 167. (b) 168. (d) 169. (a) 170. (a) 171. (d) 172. (d) 173. (c)

Photosynthesis

174. In the above question find the site of action of bipyridyls: (a) D (b) Q (c) S (d) P 175. In the above question find the site of action of analogues of plastoquinone: (a) D (b) Q (c) S (d) P 176. Lycopene is most widely distributed carotenoid in: (a) Higher plants (b) Red alga (c) Both A and B (d) None of these 177. Phytol tail of the chlorophyll molecules is: (a) Hydrophillic (b) Lipophilic (c) Both A and B (d) None of these 178. Mg–porphyrin ‘head’ is: (a) Hydrophillic (b) Lipophilic (c) Both A and B (d) None of these 179. Bacteriochlorophyll–g is distributed in: (a) Purple bacteria (b) Heliobacteria (c) Green bacteria (d) None of these 180. Bacteriochlorophyll–a is distributed in: (a) Purple bacteria (b) Green bacteria (c) Both A and B (d) None of these 181. Chlorophyll-e is distributed in: (a) Zoospores of Vaucheria (b) Tribonema (c) Both (a) and (b) (d) None of the above 182. Chlorophyll c is distributed in: (a) Dinoflagellates (b) Brown algae (c) Distoms (d) All of these 183. Chlorophyll b is distributed in: (a) Green algae (b) Higher plants (c) Both A and B (d) None of these 184. Chlorophyll a is distributed in all plant kingdoms expect: (a) Algae (b) Bacteria (c) Both A and B (d) None of these

113

185. ...... are known as carotenoids: (a) Carotenes (b) Xanthophylls (c) Both A and B (d) None of these 186. Phycobillins are ...... in water: (a) Soluble (b) Insoluble (c) Both A and B (d) None of these 187. Chlorophyll and carotenoids are ...... in water and can be extracted only with ...... solvents: (a) Soluble, inorganic (b) Insoluble, water (c) Insoluble, organic (d) None of the above 188. In chloroplast photo damage is prevented by: (a) Carotenoids (b) Phycobillins (c) Chlorophyll (d) None of these 189. Green algae and higher plants contain: (a) Chlorophyll–a and chlorophyll–d (b) Chlorophyll–a and chlorophyll–c (c) Chlorophyll–a and chlorophyll–b (d) All of the above 190. Which of the following is not found in chloroplast? (a) Ribosome (b) DNA (c) Carotenoids (d) None of these 191. Photoinhibition: (a) Can result in the production of toxic oxygen molecules (b) Results in damage to proteins in the reaction center (c) Is less common in C3 plants relative to C4 plants (d) Is the inhibition of photosynthesis due to absorption of excessive light energy 192. For the synthesis of one hexose sugar, how many Calvin cycle takes place? (a) 3 (b) 6 (c) 12 (d) None of these 193. Which of the following is known as assimilatory power of dark reaction? (a) Water and oxygen (b) RUDP and RUMP

Ans. 174. (a) 175. (c) 176. (c) 177. (b) 178. (a) 179. (b) 180. (c) 181. (c) 182. (d) 183. (c) 184. (b) 185. (b) 186. (a) 187. (c) 188. (a) 189. (c) 190. (a) 191. (d) 192. (b)

114

Plant Physiology: Question Bank

(c) ATP and NADPH (d) None of the above 194. Photosynthetic pigments are found in chloroplast in the form of pigment– protein complexes chiefly in: (a) Thylakoids (b) Stroma lamellae (c) Stroma (d) None of these 195. Which of the following pigment has open conjugated system of four pyrole rings in their molecules? (a) Carotenoids (b) Phycobillins (c) Chlorophylls (d) None of these 196. Generally, the chloroplasts of higher plants are ...... in shape. (a) Ellipsoidal (b) Discoid (c) Both A and B (d) None of these 197. The time required to build up the necessary levels of PCR cycle intermediates in transition from dark to light is called the: (a) Photosynthetic reaction time (b) Photosynthetic induction time (c) Photosynthetic incubation time (d) None of the above 198. The pathway by which all photosynthetic eukaryotic organisms ultimately incorporate CO 2 into carbohydrate is known as: (a) Photosynthetic carbon cycle (b) Carbon fixation (c) Calvin cycle (d) All of the above 199. The guard cells would be unable to respond to light levels below the photosynthetic light compensation point. This statement is true or false: (a) False (b) True (c) Not known (d) None of these 200. Chemiosmotic theory proposed by: (a) Huber (b) Hatch and Slack (c) Emerson (d) Mitchell

201. Who found that the carbon in plants comes from carbon dioxide in the air? (a) Huber (b) Hatch and Slack (c) Liebig (d) Emerson 202. The scientist who found that monochromatic light of more than 680 nm shows a sharp reduction in photosynthetic yield, which is known as red drop? (a) Huber (b) Hatch and Slack (c) Emerson (d) Arnon 203. Photophosphorylation was discovered by: (a) Huber (b) Hatch and Slack (c) Emerson (d) Arnon 204. The scientist who established the light and dark phase with the help of light flashes: (a) Emerson and Arnold (b) Willstatter and Stoll (c) Blackman (d) None of these 205. The scientist who first used light fleshes for the study of photosynthesis: (a) Blackman (b) Bossingault (c) Warburg (d) Engelmann 206. The scientist who studied structure of photosynthetic pigments: (a) Willistatter and Stoll (b) Blackman (c) Bossingault (d) Engelmann 207. The scientist who obtained action of spectra of photosynthesis: (a) Willistatter and Stoll (b) Blackman (c) Bossingault (d) Engelmann 208. The scientist who obtained pure fractions of chlorophyll a and chlorophyll b: (a) Willistatter and Stoll (b) Blackman

Ans. 193. (c) 194. (a) 195. (c) 196. (c) 197. (b) 198. (d) 199. (b) 200. (d) 201. (c) 202. (d) 203. (c) 204. (a) 205. (c) 206. (a) 207. (d) 208. (a)

Photosynthesis

(c) Bossingault (d) None of the above 209. “In photosynthesis the volume of O2 released is equal to the volume of CO2 absorbed”, this concept was given by: (a) Emerson and Arnold (b) Willistatter and Stoll (c) Bossinagult (d) None of these 210. “Starch is formed as reserve product of photosynthesis”, this idea was given by: (a) Sachs (b) Dutrochet (c) GG Stokes (d) von Mayer 211. “In Photosynthesis, solar energy is changed to chemical energy”, this concept was given by: (a) De Sassure (b) Dutrochet (c) GG Stokes (d) von Mayer 212. The scientist who established the importance of chlorophyll in photosynthesis: (a) De Sassure (b) Dutrochet (c) GG Stokes (d) von Mayer 213. “Water is essential for photosynthesis along with carbon dioxide. The volume of oxygen evolved is equal to the volume of carbon dioxide absorbed”, this concept was given by: (a) Jan Ingen–Housz (b) Senebier (c) Stephen Hales (d) De Sassure 214. The idea of both green parts and sunlight are required for air purification and plant nourishment, was given by: (a) Jan Ingen–Housz (b) Senebier (c) Stephen Hales (d) De Sassure 215. Photorespiration has been called metabolic adjunct to Calvin cycle by: (a) AA Benson (b) Krotokov (c) Hatch and Slack(d) None of these 216. The term photorespiration was coined by:

115

(a) Warburg (b) Krotokov (c) Hatch & Slack (d) None of these 217. The law of limiting factors was enunciated by: (a) AA Benson (b) FF Blackman (c) Both (a) and (b) (d) None of these 218. Who among the following first reported that 4–C containing dicarboxylic acids, malate and aspartate were major labeled products when sugarcane leaves were allowed to photosynthesize for short periods in 14 CO2? (a) Kortschak, Harti and Burr (b) Hatch and Slack (c) Melvin and Calvin (d) None of the above 219. The idea that O 2 comes from water and not from CO2 was first given by: (a) Ruben and Kamen (b) Van Niel (c) Arnon (d) None of these 220. Radioactive isotope of Carbon (14C) was discovered by: (a) Ruben and Kamen (b) AA Benson (c) Melvin Calvin (d) None of these 221. Main credit for investigation of sequence of dark reaction of photosynthesis goes to: (a) J Bassham (b) AA Benson (c) Melvin Calvin (d) None of these 222. Water oxidizing clock model of photolysis of water was given by: (a) Emerson (b) Hill (c) Bessel kok et al (d) None of these 223. Which of the following scientist has contributed a lot in our understanding of electron transport system and phosphorylation in chloroplast? (a) Kok et al (b) Hill (c) Van Niel (d) None of these 224. The scientist, who first showed that the process of photosynthesis takes place in chloroplast:

Ans. 209. (c) 210. (d) 211. (d) 212. (b) 213. (d) 214. (a) 215. (c) 216. (b) 217. (b) 218. (a) 219. (b) 220. (a) 221. (c) 222. (c) 223. (b)

116

Plant Physiology: Question Bank

(a) Stephan Hales (b) Julius Sachs (c) Jean Senebier (d) None of these

(c) Jan Ingenhouse (d) None of these

225. Several observations leading to discovery of photosynthesis were made by: (a) Stephan Hales (b) Piestley (c) Jean Senebier (d) All of these

233. Which of the following gas is called “dephlogisticated air” by Priestley? (a) Argon (b) Oxygen (c) Carbon dioxide (d) None of these

226. Most of the photosynthesis on the earth is carried out by: (a) Marine alga (b) Forests (c) Photosynthetic alga (d) None of the above

234. Chemosynthetic bacteria obtain energy by oxidizing ...... substance: (a) Organic (b) Inorganic (c) Both A and B (d) None of these

227. During the photosynthesis, which component is not required by the plants? (a) Water (b) Light (c) Carbon dioxide (d) None of these 228. The end product of photosynthesis is: (a) Inorganic compound (b) Organic compound (c) Both A and B (d) None of these 229. The light–driven split, i.e. photolysis of water in the absence of CO2 fixations become known as: (a) Arnon reaction (b) Hill reaction (c) Niel’s hypothesis (d) None of these 230. The nature of the end product of photosynthesis-organic matter was demonstrated by: (a) Van Sachs (b) Jan Ingenhouse (c) von Hill (d) None of these 231. The first quantitative measurement of photosynthesis was done by: (a) Jean Senebier (b) von Hill (c) Jan Ingenhouse (d) None of these 232. In 1782, which of the following scientist showed that the presence of the noxious gas produced by animals and by the plants in darkness stimulated production of “purified air” (O2) in light? (a) Jean Senebier (b) von Hill

235. Photosynthesis is the: (a) Catabolic process (b) Amphibolic process (c) Anabolic process (d) None of the above 236. Photosynthesis is essentially the only mechanism of energy ...... into the living world except chemosynthetic bacteria: (a) Output (b) Input (c) Both A and B (d) None of these 237. Chlororespiration occurs in: (a) Matrix (b) Stroma (c) Mitochondria (d) Chloroplasts 238. Which of the following shows phenomenon of kleptoplasty? (a) Jelly fish (b) Euglena (c) Elysia chlorotica (d) None of these 239. The proton electrochemical gradient in purple bacteria during bact. photosynthesis: (a) Outside to inside (b) Inside to outside (c) Both the sides (d) None of these 240. Cyt bef complex is chemically analogous to: (a) Complex IV (b) Complex III (c) Complex II (d) Complex I 241. How much carbon. That lost in photorespiration, is salvaged back by glycolate cycle associated with at?

Ans. 224. (c) 225. (d) 226. (a) 227. (d) 228. (c) 229. (b) 230. (a) 231. (b) 232. (a) 233. (b) 234. (b) 235. (c) 236. (b) 237. (d) 238. (c) 239. (a) 240. (b)

Photosynthesis

(a) 75% (c) 50%

(b) 25% (d) None of these

242. Which of the following shows facultative CAM? (a) Mesembryanthemum crystallinum (b) Kalanchoe (c) Cacti (d) All of the above 243. T.W. Engelmann performed his classical experiments (in 1880s) on action spectra of photosynthesis by using: (a) Red algae (b) Green algae (c) Brown algae (d) All of these 244. D1 and D2 are the two large membrane proteins in thylakoids in: (a) Cyt b–e f complex (b) PS I (c) PS II (d) None 245. Which of the following Nobel Laureates is created with first complete synthesis of chlorophyll? (a) H Fischer (b) E Fischer (c) Woodward (d) Willstatter 246. Which of the following is not an example of xanthophylls? (a) Lutein (b) Zeaxanthin (c) Violaxanthin (d) None of these 247. In carotenes of oxygenic plants, the cyclic rings present on either side of their molecule structure are closed expect in: (a) Lycopene (b) -carotene (c) -carotene (d) None of these 248. In PS II, charge separation occurs when: (a) P–680 remains unexcited (b) P–680 is oxidized and Pheo, reduced (c) P–680 is reduced and H2O oxidized (d) None of the above 249. Which of the following lacks phytol chain? (a) Pheophytin (b) Chl–c (c) Chl–b (d) Chl–a

117

250. Which part of the chlorophyll–a absorbs light? (a) Phytol chain (b) Mg–prophyrin head (c) Both A and B (d) Not known 251. Which of the following herbicides are analogues of plastoquinone in non– cyclic electron transport? (a) Paraquat (b) Atrazine (c) Diuron (d) Both (b) and (c) 252. Calvin cycle is completed in: (a) Four stages (b) Three stages (c) Two stages (d) One stage 253. Immediate electron donor to oxidized P–680’ in PS II is: (b) Mn++ ions (a) Cl– ions (c) H2O (d) Redox–active tyrosine residue of the D1 protein 254. In PS II, the electron from excited P-680 is transferred to pheophytin in: (a) Microseconds (b) Femtoseconds (c) Picoseconds (d) Not known 255. The activity of which of the following Calvin cycle enzyme is not completely independent of light: (a) Fr–1, 6–bisphosphatase and Sedoheptulose–1, 7–bisphosphatase (b) Rubisco (c) 3–PGAld dehydrogenase and Ribulose–5P kinase (d) All of these 256. The idea of Z–scheme in photosynthesis was first given by: (a) Jagendrof (b) Arnon (c) Hill and Bendall (d) Ruben and Kamen 257. Ultimate precursor for biosynthesis of chlorophyll is: (a) 5–aminolevulinic acid (ALA) (b) Protoporphyrin IX (c) Protochlorophyll (d) Glutamic acid

Ans. 241. (a) 242. (a) 243. (b) 244. (c) 245. (b) 246. (b) 247. (a) 248. (b) 249. (b) 250. (b) 251. (d) 252. (b) 253. (d) 254. (c) 255. (d) 256. (c) 257. (d)

118

Plant Physiology: Question Bank

258. A new form of chlorophyll called chlorophyll f, has recently been discovered by Chen et al (2010) from stromatolites of: (a) Western Canada (b) USA (c) Western Australia (d) Newzealand 259. Which of the following Nobel Laureates is not credited with first successful crystallization and X-ray diffraction of bacterial photosynthetic reaction centers? (a) M Calvin (b) H Michel (c) R Huber (d) J Deisenhofer 260. The model mechanism to explain the flow of protons and electrons through cyt bef complex is known as: (a) Calvin cycle (b) Q cycle (c) Redox cycle (d) None of these 261. From excited P 680 ’ the primary electron acceptor in PS II is: (a) Cyt bef complex (b) Quinone (c) Pheophytin (d) None of these 262. In different photosynthetic bacteria, carbon assimilation can be done by: (a) Reductive carboxylic acid cycle (b) Using simple organic compounds (c) Calvin–cycle (d) Either of the above 263. Lycopene is most widely distributed carotenoid in: (a) Photosynthetic bacteria (b) Higher plants (c) Red algae (d) Green algae 264. Bacteriochlorophylls absorb light rays heavily in: (a) UV–region of the spectrum (b) Near infrared region of the spectrum (c) Far–red region of the spectrum (d) Red region of the spectrum

265. Chlorosomes are found in: (a) Heliobacteria (b) Purple nonsulfur bacteria (c) Purple sulfur bacteria (d) Green bacteria 266. Chromatophores constitute the photosynthetic apparatus in: (a) Heliobacteria (b) Green bacteria (c) Purple bacteria (d) All of these 267. With regard to bacterial photosynthesis, which of the following statements is correct? (a) Instead of NADPH, NAD + is reduced to NADH (b) There is only one pigment system which is analogous to pigment system I of algae and higher plants (c) O2 is not involved (d) All of the above 268. Which of the following organisms use H2S to reduce CO2 in photosynthesis? (a) Cyanobacteria (b) Photosynthetic bacteria (c) Chemosynthetic bacteria (d) None of the above 269. By far, the most abundant protein on the earth is: (a) Ribulose bisphosphate oxygenase (b) RuBisCo (c) Fd–NADP–reductase (d) None of the above 270. The substrate for ribulose bisphosphate carboxylase/oxygenase is: (a) RuBP (b) 3 PGA (c) Glycolate (d) All of these 271. Assembly of smaller and larger subunits of RuBisCo occurs in: (a) Nucleus (b) Cytosol (c) Chloroplast (d) All of these 272. RuBisCo is exclusively found in: (a) Cytosol (b) Mitochondrial matrix (c) Chloroplast stroma (d) None of the above

Ans. 258. (c) 259. (a) 260. (b) 261. (c) 262. (d) 263. (a) 264. (b) 265. (d) 266. (c) 267. (d) 268. (b) 269. (b) 270. (a) 271. (c) 272. (c)

Photosynthesis

273. Approximately how many tones of CO 2 from air is fixed annually by RuBisCo? (b) 1010 (a) 1011 20 (c) 10 (d) None of these 274. The distinctive diurnal fluctuation in acidity shown by CAM plants in predominantly due to the changes I the amounts of: (a) Cytosolic citric acid (b) Vacuolar malic acid (c) Cytosolic malic acid (d) Vacuolar citric acid 275. Stomata open at night and close during the day in: (a) C4–plants (b) CAM plants (c) C3–plants (d) None of these 276. Which of the following is not a CAM plant? (a) Crasulla (b) Bryophyllum (c) Kalanchoe (d) None of these 277. Concentration of atmospheric CO2 is: (a) 0.003% by volume (b) 0.03% by volume (c) 0.3% by volume (d) None of these 278. Choose the correct statement regarding chemosynthetic bacteria: (a) They use chemical energy to synthesize organic food from CO2 and H 2O (b) They do not have chlorophyll (c) They are aerobic bacteria (d) All of the above 279. Photorespiration has been called metabolic adjunct to Calvin cycle by: (a) Hatch and Slack (b) Krotokov (c) AA Benson (d) None of these 280. Respiration is inhibited by: (a) CMU and DCMU (b) 2, 4–Dinitrophenol (c) –Hydroxysulphonates (d) None of the above

119

281. Photorespiration appears to be a wasteful process, because in photorespiration: (a) Input energy (ATP) is required to drive the process (b) There is no net conservation of energy (c) ATPs and reduced coenzymes are not formed (d) All of the above 282. During photorespiration, oxygen is consumed at: (a) Three places (b) Two places (c) One place (d) None of these 283. During photorespiration, one mol. of CO2 and one mol of NH3 are released in: (a) Chloroplast (b) Peroxysome (c) Mitochondrion (d) None of these 284. The photorespiration is also known as: (a) C2–cycle (b) Glycolate cycle (c) Both A and B (d) None of these 285. Photorespiration is accomplished in: (a) Mitochondrion (b) Peroxisome (c) Chloroplast (d) All of the above 286. The term photorespiration was coined by: (a) Hatch–Slack (b) Krotkov (c) Warburg (d) None of these 287. Under saturating light conditions the conc. of atm. CO 2 at which rate of photosynthesis equals to the rate of respiration is called: (a) Carbon dioxide compensation point (b) Light compensation point (c) Extinction point (d) None of the above 288. In many plants, an increase in O 2 conc. results in decrease the rate of photosynthesis. This phenomenon of inhibition of photosynthesis by O2 is called: (a) McAlister and Myers effect (b) Warburg’s effect (c) Gibb’s effect (d) None of these

Ans. 273. (a) 274. (b) 275. (b) 276. (d) 277. (b) 278. (a) 279. (a) 280. (c) 281. (d) 282. (a) 283. (c) 284. (c) 285. (d) 286. (b) 287. (a) 288. (b)

120

Plant Physiology: Question Bank

289. The rate of photosynthesis is greater in: (a) White light (b) Intermittent light (c) Blue light (d) Red light 290. The law of limiting factors was enunciated by: (a) FF Blackman (b) AA Benson (c) Both A and B (d) None of these 291. C4-pathway requires more ATPs for fixation of 1 CO 2 molecule than in C3-cycle, even then C4-plants are more efficient photosynthetically than C 3 -plants. It is because C 4 –plants have: (a) Low CO2 compensation point (b) Very little or no photorespiration (c) Krantz anatomy in their leaves (d) All of the above 292. C 4 -plants differ from C 3 -plants in having: (a) Low CO2 compensation point (b) Very little or no photorespiration (c) Krantz anatomy in their leaves (d) All of the above 293. NAD+–Me Type C4–pathway is found in: (a) Panicum maximum (b) Atriplex and amaranthus (c) Sugarcane and maize (d) All of the above 294. How many molecules of NADPH and ATP respectively are required for the fixation of 1 CO2 mol in C4–pathway? (a) 1 NADPH + 2 ATP (b) 2 NADPH + 5 ATP (c) 2 NADPH + 3 ATP (d) None of the above 295. How many carboxylation reactions occur in C4–pathway? (a) Three (b) One (c) Two (d) None of these 296. Dimorphic chloroplasts are found in the leaves of: (a) C4–plants (b) C3–plants (c) Both (a) and (b) (d) None of these

297. Which of the following plants do not show krantz anatomy in their leaves? (a) Atriplex and Amaranthus (b) Maize and Soughum (c) Wheat and Barley (d) Sugarcane 298. C4–pathway is also known as: (a) Hatch–Slack pathway (b) C4–dicarboxylic acid pathway (c) Both (a) and (b) (d) None of these 299. Who among the following have first reported that 4–C containing dicaboxylic acids, malate and aspirate were the major labeled products when sugarcane leaves were allowed to photosynthesize for short periods in 14 CO2? (a) Melvin Calvin (b) Hatch and Slack (c) Kortschak Hartt and Burr (d) All of the above 300. Which of the following green algae were used by Melvin Calvin in his experiments to determine sequence of dark reaction of photosynthesis? (a) Chlorella and Ulothrix (b) Chlorella and Scenedesmus (c) Chlorella and Chlamydomonas (d) None of the above 301. Which of the following acceptors of CO 2 in dark reaction of photosynthesis? (a) Xu–5–P (b) RuBP (c) Ru–5–P (d) 3 PGA 302. How many molecules of NADH and ATP respectively are required for the reduction of 6CO2 molecules to generate one molecule of hexose sugar in photosynthesis? (a) 12 NADPH + 12 ATP (b) 18 NADPH + 18 ATP (c) 18 NADPH + 12 ATP (d) 12 NADPH + 18 ATP 303. The idea that O 2 comes from water and not from CO2, was given by:

Ans. 289. (a) 290. (a) 291. (b) 292. (d) 293. (c) 294. (b) 295. (c) 296. (a) 297. (c) 298. (c) 299. (c) 300. (b) 301. (b) 302. (d)

Photosynthesis

(a) Hill (b) Arnon (c) Van Niel (d) Ruben and Kamen 304. Temperature coefficient (Q 10 ) for photosynthesis under normal conditions is: (a) 4 (b) 3 (c) 2 (d) 1 305. As a result of photosynthesis, hexose sugars are formed which are often converted into sucrose and starch in: (a) In the chloroplast only (b) In the cytosol only (c) Chloroplast and cytosol respectively (d) Cytosol and chloroplast respectively 306. Which of the following phosphorylated sugar is not involved in Calvin cycle? (a) Erythrose–4–phosphate (b) Erythulose–4–phosphate (c) Xylulose–5–phosphate (d) Ribulose–5–phosphate 307. First stable product of the dark reaction of photosynthesis is: (a) 1, 3–bis PGA (b) 3 PGA (c) 3 PGAld (d) None of these 308. Calvin cycle is also known as: (a) PCR pathway (b) C3 pathway (c) Reductive pentose phosphate (RPP) cycle (d) All of the above 309. In dark reaction of photosynthesis, assimilatory power (NADPH and ATP) is used, in: (a) Phosphorylation of 3 PGA to 1,3-bis PGA (b) Carboxylation of RuBP to 3 PGA (c) Reduction of 3 PGA to 1,3-bis PGAld (d) All of the above 310. Radioactive isotope of carbon ( 14 C) was discovered by:

121

(a) Melvin Calvin (b) AA Benson (c) Ruben and Kamen (d) None of these 311. Main credit for investigating the sequences of dark reaction of photosynthesis goes to Nobel Laureate: (a) Melvin Calvin (b) AA Benson (c) Ruben and Kamen (d) J Bassham 312. In photosynthesis, dark reaction or Blackman’s reaction is: (a) Enzymatic and independent of light (b) Enzymatic and occurs in the absences of light (c) Nonenzymatic and occurs in the absence of light (d) None of the above 313. Which of the following does not occur in cyclic electron transport and photophosphorylation? (a) O2 evolution (b) Formation of reduced NADPH (c) Photolysis of the water (d) All of the above 314. During photophosphorylation, the proton electrochemical gradient across the thylakoid membrane is from: (a) Lumen of one thylakoid to lumen of another thylakoid (b) Inside (lumen of thylakoid) to outside (stroma) (c) Outside (stroma) to inside (lumen of thylakoid) (d) All of the above 315. Noncyclic electron transport in photosynthesis is also known by the name of: (a) S-scheme (b) Q-scheme (c) Z-scheme (d) None of these 316. Which of the following does not form one electron redox system? (a) Cytochromes (b) Plastoquinone (c) Plastocyanin (d) P–680

Ans. 303. (c) 304. (c) 305. (d) 306. (b) 307. (b) 308. (d) 309. (c) 310. (c) 311. (a) 312. (a) 313. (d) 314. (b) 315. (c) 316. (b)

122

Plant Physiology: Question Bank

317. Noncyclic electron transport and O2 evolution are inhibited by: (a) CMU and DCMU (b) Bongkrekic acid (c) Atractylic acid (d) 2, 4–Dinitrophenol 318. Ferredoxin (Fd) is a: (a) Copper containing protein (b) Heme-iron protein (c) Non-heme iron-protein (d) None of the above 319. The flow of electrons from donor to acceptor molecule in electron transport chain occurs along: (a) Increasing redox potential (E 0 ) values (b) Decreasing redox potential (E 0 ) values (c) Both A and B (d) None of the above 320. During noncyclic electron transport, photophosphorylation occurs at: (a) Three places (b) Two places (c) One place (d) None of these 321. Which of the following scientists has contributed a lot in our understanding of electron transport system and photophosphorylation in chloroplasts? (a) Van Niel (b) Arnon (c) Bessel Kok et al (d) Hill 322. Water oxidizing clock model of photolysis of water was given by: (a) Emerson (b) Hill (c) Bessel Kok et al (d) None of these 323. Photolysis of water in photosynthesis requires the presence of: (a) K+ and Cl– ions (b) Mn++ and CI– ions (c) Mg++ ions (d) Mn++ ions 324. In photosynthesis, ultimate source of electrons is: (a) Pheophytin (b) Antenna pigments (c) Water (d) Chlorophyll–a

325. In photosynthesis, assimilatory power is generated during: (a) Photolysis of water (b) Dark reactions (c) Light reactions (d) None of the above 326. The process of photosynthesis is a complicated: (a) Carboxylation process (b) Reductive process (c) Oxidation-reduction process (d) None of the above 327. The head piece of ATP–synthase (CF1) in thylakoids consists of how many different polypeptides? (a) Five (b) Four (c) Three (d) Two 328. Which of the following is not a component of electron transport chain in chloroplast? (a) Cytochrome bc–f complex (b) Ubiquinone (c) Plastocyanin (d) Plastoquinone 329. ATP–synthase are found in thylakoid membranes at those regions which are in direct contact with: (a) Stroma of chloroplast (b) Other thylakoid membranes (c) Lumen of thylakoids (d) All of the above 330. Rieske center is: (a) Core complex II (b) Cytochrome bc-f complex (c) Core complex I (d) None of these 331. Core complexes (CCI and CCII) in two photosystems consists of: (a) Reaction centers, electron donors and electron acceptors (b) Reaction centers I & II respectively (c) Reaction centers and electron donors (d) None of the above

Ans. 317. (a) 318. (c) 319. (a) 320. (c) 321. (b) 322. (c) 323. (b) 324. (c) 325. (c) 326. (c) 327. (a) 328. (b) 329. (a) 330. (b) 331. (a)

Photosynthesis

332. Light harvesting complexes (LHCI & LHCII) in two photosystems consist of: (a) Cytochrome be –f complex (b) Reaction center I and II (c) Antenna pigments associated with proteins (d) None of the above 333. Reaction center of pigment system I is: (a) P–700 (b) P–680 (c) P–690 (d) All of these 334. Red drop and Emerson’s enhancement effect have been instrumental in the discovery of: (a) Noncyclic electron transport and photophosphorylation (b) Two pigment systems (photosystems) (c) Cyclic electron transport and photophosphorylation (d) None of the above 335. A plot of the intensity of a certain phenomenon such as rate of photosynthesis as a function of different wavelengths of lights is called: (a) Spectrum of light (b) Absorption spectrum (c) Action spectrum (d) None of the above 336. The number of O2 molecules released per photon of light in photosynthesis is called: (a) Quantum yield (b) Photosynthetic yield (c) Quantum requirement (d) None of the above 337. Metastable triplet state of chlorophyll–a has half-life of: (a) 10–3 seconds (b) 10–12 seconds (c) 10–9 seconds (d) None of these 338. As compared to incident light, the fluorescent light is of: (a) Equal wavelengths (b) Higher wavelengths

123

(c) Lower wavelengths (d) None of the above 339. Which of the following has more energy per photon of light? (a) Infrared light (b) UV light (c) Blue light (d) Red light 340. Which of the following pigments do not absorb light energy in green part of the spectrum? (a) Phycocyanins (b) Phycoerythrins (c) Xanthophylls (d) Carotenes 341. Accessory or antenna pigments absorb and transfer light energy to: (a) Pheophytin (b) Chlorophyll a (c) Chlorophyll b (d) Chlorophyll c 342. Violet blue and red parts of spectrum of radiant energy are respectively in between: (a) 200–400 and 550–650 mm (b) 390–500 and 650–700 mm (c) 500–600 and 700–1000 mm (d) None of the above 343. Characteristic absorption peaks shown by chlorophyll–a and chlorophyll b in vitro are respectively at: (a) 480, 650 and 435, 670 mm (b) 452, 642 and 410, 660 mm (c) 410, 660 and 452, 642 mm (d) None of the above 344. Which of the following pigments have open conjugated system of four pyrrole rings in their molecule? (a) Carotenoids (b) Chlorophylls (c) Phycobillins (d) All of above 345. In chloroplasts, photodynamic damage is preserved by: (a) Carotenoids (b) Chlorophyll b (c) Phycobillins (d) None of these 346. Photosynthesis is: (a) Anabolic process (b) Amphibolic process (c) Catabolic process (d) None of the above

Ans. 332. (c) 333. (a) 334. (b) 335. (c) 336. (a) 337. (a) 338. (b) 339. (b) 340. (a) 341. (b) 342. (b) 343. (c) 344. (c) 345. (a) 346. (b)

124

Plant Physiology: Question Bank

347. Molecular formulae of chlorophyll a and which another chlorophyll respectively are: (a) C40H56O2 and C40Hh56 (b) C40Hh56 and C40H56O2 (c) C55H72O5N6Mg and C55H70O6N4Mg (d) C55H70O6N4Mg and C55H72O5N6Mg 348. End products of photosynthesis are: (a) O2 and proteins (b) CO2 and carbohydrates (c) O2 and fat (d) O2 and hexose sugar 349. In algae and higher plants, the photosynthetic pigments absorb light energy in: (a) Visible part of spectrum (b) Red and infrared region of spectrum (c) UV and blue regions of spectrum (d) Blue and red parts of spectrum 350. Which of the following is not required for photosynthesis? (a) Green plants (b) CO2 and H2O (c) Light (d) None of these 351. Pheophytin (phaeophytin) is a chlorophyll in which central Mg atom is replaced by: (a) An oxygen atom (b) An iron atom (c) 2 hydrogen atoms (d) None of these 352. Most of the photosynthesis in the world is carried out by: (a) Grass lands (b) Forests (c) Photosynthetic bacteria (d) Marine algae 353. In photosynthesis, the light energy is converted into: (a) Chemical energy (b) Heat energy (c) O2 and hexose sugar (d) None of these

354. Photosynthesis maintains equilibrium of which of the following gases in atmosphere? (a) N2 (b) CO2 (c) O2 (d) All of these 355. Classical observation leading to discovery of photosynthesis were made by: (a) Nicolas Theodore de Sassure, Meyer (b) Van Helmot, Stephan Hales (c) Priestley, Ingen houz, Jean Senebier (d) All of the above 356. What organelle is responsible for photosynthesis in plants and algae? (a) Cellular Membrane (b) Chlorophyll (c) Mitochondria (d) Chloroplast 357. Which of the following is not found in chloroplast? (a) Carotenoids (b) Bacteriochlorophyll (c) Ribosomes (d) DNA 358. Green algae and higher plants contain: (a) Chlorophyll–a and chlorophyll–d (b) Chlorophyll–a and chlorophyll–b (c) Chlorophyll–a and chlorophyll–c (d) All of the above 359. Bacteriochlorophyll g is found in: (a) Heliobacteria (b) Purple bacteria (c) Green bacteria (d) All of these 360. Glycolysis takes place in: (a) Nerve cells (b) All cells (b) Muscle cells (d) Eukaryotic cells 361. Before combining with OAA, pyruvic acid is changed into: (a) Citric acid (b) Acetyl CoA (c) Malic acid (d) Succinic acid 362. Which one is the last electron acceptor over ETC in oxidative phosphorylation: (b) Cyt b (a) CO2 (d) H2 (c) Cyt a3

Ans. 347. (d) 348. (d) 349. (d) 350. (b) 351. (c) 352. (d) 353. (a) 354. (c) 355. (d) 356. (d) 357. (b) 358. (b) 359. (a) 360. (b) 361. (b) 362. (c)

Photosynthesis

363. In respiration: (a) 8 PGAL in glycolysis, 3 PGAL in Krebs cycle (b) 6 PGAL in glycolysis, 3 PGAL in Krebs cycle (c) PGAL formation does not occur in respiration (d) 2 PGAL are formed in glycolysis, and none in Krebs cycle 364. RQ sprouting potato is: (a) Zero (b) < 1 (c) > 1 (d) 1 365. Match the items of column I and II and choose the correct option: Column I a Krebs cycle b Glycolysis c Calvin cycle

(a) a–r, b–s, c–q (c) a–r, b–s, c–p

p q r s

Column II Stroma Grana Mitochondrial matrix Cytoplasm

(b) a–s, b–r, c–p (d) a–s, b–r, c–q

366. What occurs in glycolysis? (a) Oxidation (b) Dehydrogenation (c) Reduction (d) Fixation 367. In aerobic respiration one glucose produces: (a) 10NADH + 2FADH 2 + 2ATP + 2GTP (b) 12 NADH + 30 ATP + H2O (c) 12 NADH + 2 FADH2 + 38 ATP (d) 8 NADH + 2 FADH2 + 2 ATP 368. The end product of anaerobic respiration is: (a) CO2 + C2H3–OH (b) NADH and FADH2 (c) Lactic acid + H2O (d) Either (a) or (c) 369. At the end of citric acid cycle most of the energy is transferred to: (a) ATP (b) Citric acid (c) Oxaloacetic acid (d) NADH and FADH2

125

370. RQ is more than one indicating: (a) Anaerobic respiration (b) Aerobic respiration (c) Both A and B (d) None of these 371. When malic acid is respiratory substrate, the amount of CO2 released is: (a) CO2 is not released (b) Equal to O2 consumed (c) Less than O2 released (d) More than O2 consumed 372. What is required in both photosynthesis and respiration? (a) Cytochromes (b) O2 (c) CO2 (d) Chlorophyll 373. Anaerobic respiration takes place in: (a) Cytoplasm (b) Vacuole (c) Nucleus (d) Ribosome 374. Glycolysis is conversion of: (a) Glucose to citric acid (b) Glucose to pyruvic acid (c) Glycogen to glucose (d) Glucose to glycogen 375. Fermentation is: (a) Excretory process (b) Incomplete oxidation (c) Anaerobic respiration (d) None of the above 376. Enzymes of Krebs cycle occur in mitochondrial matrix except one which is attached to inner mitochondrial membrane: (a) Malate dehydrogenase (b) Succinate dehydrogenase (c) -ketoglutarate dehydrogenase (d) Citrate synthetase 377. In glycolysis: (a) Oxygen is required (b) No ATP is synthesized (c) Reactions occur in cytoplasm (d) Glucose is produced 378. The cooperative photosynthesis is found in:

Ans. 363. (d) 364. (d) 365. (c) 366. (a) 367. (a) 368. (d) 369. (d) 370. (c) 371. (d) 372. (a) 373. (a) 374. (b) 375. (c) 376. (b) 377. (c)

126

Plant Physiology: Question Bank

(a) Succulents (c) C3–plants

(b) C2–plants (d) C4– Plants

379. The light phase consists of: (a) Two chloroplast parts (b) Two photochemical reactions (c) Two photosynthetic units (d) None of the above 380. The first stable product in CAM/C4 plants is: (a) Malic acid (b) Sugar (c) Oxaloacetic acid (d) Starch 381. Photosynthesis proceeds in the sequence of: (a) Light phase and dark phase (b) Dark phase and light phase (c) Dark phase alone (d) Light phase alone 382. The carbon dioxide acceptor in CAM plants is: (a) Phosphenol pyruvic acid (b) Oxaloacetic acid (c) Pyruvic acid (d) Malic acid 383. The photosynthetic unit having 250 chlorophyll molecules is called: (a) Quantum (b) Quanatasome (c) Oxysomes (d) Photon 384. In C 4–plants, Calvin cycle enzymes are absent in: (a) Epidermal chloroplasts (b) Guard cell chloroplasts (c) Bundle sheath chloroplasts (d) Mesophyll chloroplasts

387. Emerson effect indicates the existence of: (a) Two photophosphorylations (b) Two pigment systems (c) Two photosynthetic units (d) None of the above 388. Stroma is the ground matrix of: (a) Chloroplasts (b) Lysosomes (c) Oxysomes (d) Ribosomes 389. The by-product of photosynthesis is: (a) Energy (b) Water (c) Oxygen (d) Organic compound 390. Red drop is: (a) Drop in photosynthetic yield (b) Drop in organic yield (c) Drop in quantum yield (d) Drop in oxygen yield 391. Photophosphorylation consists of: (a) Oxidative phosphorylation (b) Cyclic and noncyclic phosphorylation (c) Substrate phosphorylation (d) None of the above 392. The number of light quanta required for evolution in the one molecule of oxygen is called: (a) Organic yield (b) Quantum yield (c) Oxygen yield (d) Photosynthetic yield 393. Light energy is converted into chemical energy through the formation of: (a) ATP (b) NADPH2 (c) Both A and B (d) None of these

385. In C4–plants, photosystem II absent in the chloroplasts of: (a) Spongy cells (b) Plastid cells (c) Bundle sheath cells (d) Mesophyll cells

394. How much energy is utilized in the synthesis of one molecule of glucose? (a) 969 kCal (b) 666 kCal (c) 686 kCal (d) 673 kCal

386. In light phase of photosynthesis there is formation of: (a) Carbohydrates (b) ATP (d) Both B and C (c) NADPH2

395. Net yield of aerobic respiration with Krebs cycle per glucose molecule is: (a) 38 ATP (b) 36 ATP (c) 8 ATP (d) 2 ATP

Ans. 378. (d) 379. (a) 380. (a) 381. (a) 382. (a) 383. (b) 384. (d) 385. (c) 386. (b) 387. (d) 388. (a) 389. (c) 390. (a) 391. (c) 392. (b) 393. (b) 394. (c) 395. (a)

Photosynthesis

396. Steps in respiration are controlled by: (a) Body juices (b) Hormones (c) Substrates (d) Enzymes 397. Pentose monophosphate cycle is more advantageous than Krebs cycle because it: (a) Produces ribose sugar (b) Consumes less oxygen (c) Consumes more oxygen (d) Yields more ATP 398. Respiration in developing seed is high but with maturation it: (a) Alternatively increases and decreases (b) Remain high (c) Decreases (d) Increases 399. A molecule of FADH2: (a) Forms 2 ATP (b) Consumes one O2 (c) Consumes one H2O molecule (d) All of the above 400. During oxidative phosphorylation, the following provides energy for ATP synthesis: (a) Efflux of protons to cytoplasm (b) Pyruvic Acid (c) NADH (d) CoA 401. Sequence of organic acids in Krebs cycle is: (a) Oxalosuccinic acid  isocitric acid  citric acid (b) Isocitric acid  Oxalosuccinic acid  citric acid (c) Citric acid  isocitric acid  Oxalosuccinic acid (d) Citric acid  Oxalosuccinic acid  isocitric acid 402. Select the correct match for the following (a) Net ATP produced in glycolysis (b) Positive Benedict’s test (c) Genes unable to express in the presence of their alleles (d) A character controlled by many genes: (a) 8, fructose, dominant, polygenic

127

(b) 32, sucrose, recessive, polygenic (c) 8, glucose, recessive, polygenic (d) 36, glucose, recessive, polygenic 403. Alcoholic fermentation uses: (a) Cytoplasmic enzymes (b) Mitochondrial enzymes (c) Golgi bodies (d) Ribosomes 404. Common step in aerobic and anaerobic respiration is: (a) Terminal oxidation (b) Fermentation (c) Krebs cycle (d) Glycolysis 405. Anaerobic respiration following glycolysis is: (a) Fermentation (b) Oxidative phosphorylation (c) Krebs cycle (d) Both B and C 406. Cytochrome is: (a) Glycoprotein (b) Lipid (c) Fe–containing prophyrin pigment (d) Metalloflavoprotein 407. Glyceraldehyde 3–phosphate is oxidized to 1–3 by phosphoglyceric acid along with: (a) Release of H + and e – for forming NADH (b) Release of phosphate group (c) Synthesis of ATP (d) Release of electrons for reducing NAD+ 408. Isocitric acid is changed to  -oxaloglutaric acid by: (a) Hydrogenation and decarboxylation (b) Dehydrogenation (c) Oxidative decarboxylation (d) Oxidative carboxylation 409. The end product of anaerobic respiration is:

Ans. 396. (d) 397. (a) 398. (c) 399. (a) 400. (c) 401. (c) 402. (c) 403. (a) 404. (d) 405. (b) 406. (c) 407. (a) 408. (c)

128

Plant Physiology: Question Bank

(a) Glyceraldehyde phosphate (b) Lactic acid (c) Pyruvic acid (d) Phosphoglyceric acid 410. During glycolysis, the glucose is first changed to: (a) Fructose 1, 6–phosphate (b) Glucose 1, 6–phosphate (c) Fructose 6–phosphate (d) Glucose 6–phosphate 411. Net get of ATP molecules formed in glycolysis is: (a) 38 (b) 36 (c) 2 (d) 4 412. Bond between first phosphate and adenosine in ATP is: (a) Adenophosphate bond (b) Phosphoanhydride bond (c) Nitrophosphate bond (d) Phosphoester bond 413. A sudden change from anaerobic to aerobic process produces: (a) Chargaff’s rule (b) Blackan’s law (c) Emerson effect (d) Pasteur effect 414. Coenzyme NAD + and FAD are connected with respiratory reactions as they: (a) Are reducing agents (b) Act as hydrogen carrier (c) Function in Krebs cycle and terminal oxidative phosphorylation (d) Are involved in each step of ATP synthesis 415. Iron porphyrin occurs in: (a) FAD (b) Cytochrome (c) Phytochrome (d) Anthocyanin 416. In the following questions, a statement of assertion (A) is followed by a statement of reason (R) (a) If both Assertion and Reason are true and the Reason is the correct explanation of the Assertion, than the answer is (a). (b) If both Assertion and Reason are true and the Reason is not the

correct explanation of the Assertion, than the answer is (b). (c) If the Assertion is true statement but Reason is false, than the answer will (c). (d) If both Assertion and Reason are false statements, than your answer will (d). (i) A: Tropical Plants are more efficient in the utilization of CO2. R: Plants ensure that RuBisCo functions as carboxylate minimizing oxygenase activity. (ii) A: Most of the photosynthesis takes place in the blue and red region of spectrum. R: Action spectrum shows the amount of energy of different wavelength of light absorbed by the pigments. (iii) A: Biosynthetic phase of photosynthesis depend directly on the presence of light. R: Both ATP and NADPH are not essential for assimilation of CO2 carbohydrates. (iv) A: Carotenoids protect plant from excessive heat and prevent photooxidation of chlorophyll. R: Carotenoids enable a wider range of wavelength of the incoming light to be utilized for photosynthesis. (v) A: For every CO2 molecule entering C3 cycle, three molecules of ATP and two NADPH are required. R: Cyclic photophosphorylation takes place to meet the difference in number of ATP. (vi) A: Light harvesting coplexes (LHC) on thylakoid membrane broaden the range of light absorption. R: They transfer e – to the reaction centre. (vii) A: Assimilatory power in photosynthesis is generated in ETS occurring in thylakoid membrane.

Ans. 409. (b) 410. (d) 411. (c) 412. (d) 413. (d) 414. (b) 415. (b) 416. (i) (a) (ii) (a) (iii) (b) (iv) (a) (v) (c) (vi) (a) (vii) (c)

Photosynthesis

R: They are needed for CO2 reduction and RuBP regeneration. (viii) A: Dark acidification occurs in CAM plants. R: Organic acids are decarboxylated during night. (ix) A: Dark reactions of photosynthesis are temperature controlled processes. R: Most of the reactions are enzymatic in nature.

129

(b) Secondary growth (c) Conserving water (d) Reproduction 422. The law of limiting factors’ was proposed by: (a) Arnon (b) Blackman (c) Hatch and Slack(d) Leibig 423. Study the pathway given below:

(x) A: In C4 plants, chloroplasts of bundle sheath cells are granal. R: PS II is mostly found in appressed part of granum. 417. Photosynthesis in C 4 plants is relatively less limited by atmospheric CO2 levels because: (a) The primary fixation of CO 2 is mediated via PEP carboxylase (b) Four carbon acids are the primary initial CO2 fixation products (c) RuBisCo in C 4 plants has higher affinity for CO2 (d) Effective pumping of CO 2 into bundle sheath cells 418. Plants adapted to low light intensity have: (a) Leaves modified to spines (b) More extended root system (c) Higher rate of CO 2- fixation then the sun plants (d) Longer photosynthetic unit size than the sun plants 419. The rate of photosynthesis is higher in: (a) Green light (b) Red light (c) Continuous light (d) Very high light 420. Maximum absorption of light occurs in the region of: (a) 700–900 nm (b) 400–700 nm (c) 1500–2000 nm (d) 1000–1200 nm 421. CAM helps the plant in: (a) Disease resistance Ans. (viii) (a) (ix) (b) 425. (b)

In which of the following options correct words for all the three blanks A, B and C are indicated? A 1. Decarboxylation 2. Fixation 3. Fixation 4. Carboxylation

B Reduction

C Regeneration

Transamination Regeneration Decarboxylation Regeneration Decarboxylation Reduction

424. Kranz anatomy is one of the characteristics of the leaves of: (a) Mustard (b) Sugarcane (c) Wheat (d) Potato 425. C4 plants are more efficient in photosynthesis than C3 plants due to: (a) Presence of thin cuticle (b) Presence of larger number of chloroplasts in the leaf cells (c) Higher leaf area (d) Lower rate of photorespiration

(x) (d) 417. (a) 418. (a) 419. (b) 420. (b) 421. (c) 422. (b) 423. (c) 424. (b)

130

Plant Physiology: Question Bank

426. In the leaves of C4 plants, malic acid formation during CO2 fixation occurs in the cells of: (a) Mesophyll (b) Epidermis (c) Phloem (d) Bundle sheath 427. Whih one of the following is wrong regarding to photorespiration? (a) It is a characteristic of C3 plants (b) It is a characteristic of C4 plants (c) It occurs in the daytime only (d) Ist oxidation in chloroplast 428. In sugarcane plant, 14CO2 is fixed in malic acid. Which of the enzyme that fixes CO2? (a) Fructose phosphatase (b) Ribulose phosphate kinase (c) Phosphenol pyruvic acid carboxylase (d) Ribulose biphosphate carboxylase 429. Select the wrong pair: (a) Hatch and OAA Slack cycle (b) Calvin cycle PGA Kranz anatomy (c) C4 Maize (d) C3 430. Which is the first CO 2 acceptor enzyme in C4 plants? (a) PEP carboxylase (b) RuBisCo (c) Phosphoric acid (d) RuBP carboxylase 431. In C4 plants, CO2 combines with: (a) Ribulose monophosphate (b) Phosphoglyceric acid (c) Phosphoglyceraldehyde (d) Phosphenol pyruvate 432. In C4 plants, CO2 fixation is done by: (a) Guard cells (b) Mesophyll cells (c) Sclerenchyma (d) Chlorenchyma and hypodermis 433. The CO2 fixation during C4 pathway occurs in the chloroplast of: (a) Spongy parenchyma (b) Guard cells (c) Bundle sheath cells (d) Mesophyll cells

434. In the leaves of C4 plants malic acid synthesis during CO2 fixation occurs in: (a) Spongy parenchyma (b) Guard cells (c) Bundle sheath cells (d) Mesophyll cells 435. The C4 plants are photosynthetically more efficient than C3 plants, because: (a) The CO2 efflux is not prevented (b) CO2 generated during photorespiration is recycled through PEP carboxylase (c) The CO 2 compensation point is more (d) They have more chloroplasts 436. In C4 plants, the bundle sheath cells: (a) Have a high density of chloroplasts (b) Are rich in PEP carboxylase (c) Have a large intercellular space (d) Have thin walls to facilitate gaseous exchange 437. Presence of bundle sheath is a characteristic of: (b) C4 plants (a) C3 plants (c) Members of the grass family (d) Xerophytic plants 438. In Kranz anatomy, the bundle sheath cells have: (a) Thick walls, no many intercellular spaces and few chloroplasts (b) Thin walls, no many intercellular spaces and few chloroplasts (c) Thick walls, many intercellular spaces and few chloroplasts (d) Thin walls, no intercellular spaces and large no. of chloroplasts 439. Which one of the following organisms is correctly match with its three characteristics? (a) Maize: C3 pathway, closed vascular bundles, Scutellum (b) Onion: Bulb, imbricate aestivation, axile placentation (c) Tomato: Twisted aestivation, axile placentation, berry (d) Pea: C 3 Pathway, endospermic seed, vexillary aestivation

Ans. 426. (a) 427. (b) 428. (a) 429. (b) 430. (c) 431. (d) 432. (a) 433. (d) 434. (b) 435. (c) 436. (d) 437. (d) 438. (a) 439. (b)

Photosynthesis

440. Bundle sheath cells: (a) Lack both RuBisCo and PEP carboxylase (b) Lack RuBisCo (c) Are rich in PEP carboxylase (d) Are rich in RuBisCo 441. During photorespiration, the oxygen consuming reaction(s) occur in: (a) Grana of chloroplasts and peroxisomes (b) Stroma of chloroplasts and peroxisomes (c) Stroma of chloroplasts and mitochondria (d) Stroma of chloroplasts 442. The correct sequence of cell organelles during photorespiration is: (a) Peroxisome—Chloroplast—Vacuole (b) Mitochondria—Chloroplast—Peroxisome (c) Chloroplast—mitochondria-peroxisome (d) Chloroplast—vacuole-peroxisome 443. The cooperative photosynthesis is found in: (a) Succulents (b) C2 plants (d) C4 Plants (c) C3 plants 444. The light phase consists of: (a) Two chloroplast parts (b) Two photochemical reactions (c) Two photosynthetic units (d) None of the above 445. The first stable product in CAM/C4 plants is: (a) Malic acid (b) Sugar (c) Oxaloacetic acid (d) Starch 446. Photosynthesis proceeds in the sequence of: (a) Light phase and dark phase (b) Dark phase and light phase (c) Dark phase alone (d) Light phase alone 447. The carbon dioxide acceptor in CAM plants is: (a) Phosphenol pyruvic acid (b) Oxaloacetic acid (c) Pyruvic acid (d) Malic acid

131

448. The photosynthetic unit having 250 chlorophyll molecules is called: (a) Quantum (b) Quanatasome (c) Oxysomes (d) Photon 449. In C4 plants, Calvin cycle enzymes are absent in: (a) Epidermal chloroplasts (b) Guard cell chloroplasts (c) Bundle sheath chloroplasts (d) Mesophyll chloroplasts 450. In C4 plants, photosystem II absent in the chloroplasts of: (a) Spongy cells (b) Plastid cells (c) Bundle sheath cells (d) Mesophyll cells 451. In light phase of photosynthesis there is formation of: (a) Carbohydrates (b) ATP (c) NADPH (d) Both B and C 452. Emerson effect indicates the existence of: (a) Two photophosphorylations (b) Two pigment systems (c) Two photosynthetic units (d) None of the above 453. Stroma is the ground matrix of: (a) Chloroplasts (b) Lysosomes (c) Oxysomes (d) Ribosomes 454. The by-product of photosynthesis is: (a) Energy (b) Water (c) Oxygen (d) Organic compound 455. Red drop is: (a) Drop in photosynthetic yield (b) Drop in organic yield (c) Drop in quantum yield (d) Drop in oxygen yield 456. Photophosphorylation consists of: (a) Oxidative phosphorylation (b) Cyclic and noncyclic phosphorylation (c) Substrate phosphorylation (d) None of the above 457. The number of light quanta required for evolution in the one molecule of oxygen is called: (a) Organic yield (b) Quantum yield

Ans. 440. (a) 441. (d) 442. (c) 443. (d) 444. (b) 445. (c) 447. (a) 447. (a) 448. (b) 449. (d) 450. (c) 451. (c) 452. (c) 453. (a) 454. (c) 455. (c) 456. (b) 457. (b)

132

Plant Physiology: Question Bank

(c) Oxygen yield (d) Photosynthetic yield 458. Light energy is converted into chemical energy through the formation of: (a) ATP (b) NADPH2 (c) Both A and B (d) None of these 459. How much energy is utilized in the synthesis of one molecule of glucose? (a) 969 kCal (b) 666 kCal (c) 686 kCal (d) 673 kCal 460. PEPco is associated with: (a) CAM plants (b) C4 plants (d) Both (a) and (b) (c) C3 plants 461. Steps in noncyclic photophosphorylation include passage of electrons along: (a) PQ  Cyt b6  Cyt f  PC  PS1  FRS  FD (b) Chl a  Cyt b6  Cyt f  PC  PS1  FRS  FD (c) Chl a  PO  Cyt b6  Cyt f  PC  PS1  FRS  FD (d) FRS  FD  Cyt b6  Cyt f  PC  Chl a 462. C 4 and C3 pathways of CAM plants are separated by: (a) Time (b) Bundle sheath (c) Mesophyll and bundle sheath chloroplasts (d) Mesophyll and bundle sheath cells 463. The ground substance of chloroplast is: (a) Cisterna (b) Stoma (c) Stroma (d) Granum 464. A photosynthetic cell is provided with 14CO2 and H218O. They form: (a) C6H12O6 + O2 (b) 14C6H12O6 + 18O2 (c) 14C6H12O6 + O2‘ (d) C6H12O6 + O2 465. PS I and PS II occur over: (a) Inner membrane of mitochondrion (b) Stroma of chloroplast (c) Matrix of mitochondria (d) Grana of chloroplast 466. The product of respiration and reagent in photosynthesis:

(b) CO (a) N2 (c) CO2 (d) O2 467. Select the wrong pair: (a) C4 Kranz anatomy (b) Hatch and Slack cycle  OAA (c) Calvin cycle  PGA (d) C3 Maize 468. Loading of phloem means: (a) Pouring of sugar into phloem (b) Strengthening of phloem fibers (c) Separation of phloem parenchyma (d) Elongation of phloem cells 469. Photolithotrophs (photoautotrophs) obtain energy from: (a) Inorganic compounds (b) Organic compounds (c) Radiations and carbon from organic compounds (d) Radiations and carbon from inorganic compounds 470. In the presence of high concentration of oxygen, RuBP carboxylase converts RuBP to: (a) PGA and phosphoglycolate (b) PGA and malic acid (c) PGA and PEP (d) Malic acid and PEP 471. Match the columns: Column I a Girdling b Cobalt chloride

Column II p Growth experiment q Transpiration paper test c Crescograp r Unequal transpiration on two leaf surface d Bell jar experiment s Translocation in phloem

(a) a–q, b–p, c–s, d–r (b) a–s, b–r, c–p, d–q (c) a–s, b–p, c–q, d–r (d) a–q, b–r, c–s, d–q 472. First stable product of C4 photosynthesis is: (a) Phosphoglyceraldehyde (b) Malic acid (c) Ribulose 1,5–biphosphate (d) Phosphoglyceric acid

Ans. 458. (c) 459. (c) 460. (d) 461. (a) 462. (a) 463. (b) 464. (b) 465. (d) 466. (c) 467. (d) 469. (a) 469. (d) 470. (a) 471. (b) 472. (b)

Photosynthesis

473. Given below are assertion and reason. Point out if both are true and reason in correct explanation (A), both is ture but reason is not correct explanation (B), assertion is true but the reason is wrong (c) and both are wrong (D). Assertion: Plant girdled up to bast shows signs of degeneration of the lower portion. Reason: Water transportation will cease. (a) A (b) B (c) C (d) D 474. Blakman’s law was conceived in connection with: (a) Root pressure (b) Transpiration (c) Respiration (d) Photosynthesis 475. The number of organelles required for photorespiration is: (a) 4 (b) 3 (c) 2 (d) 1 476. Scientist awarded with Nobel Prize in 1960 for tracing the path of carbon in photosynthesis was: (a) Ruben (b) Calvin (c) Huber (d) Hatch 477. Calvin discovered: (a) Krebs cycle (b) EMP (c) Dark reactions of photosynthesis (d) Light reactions of photosynthesis 478. The rate of photosynthesis will be higher in: (a) Intermittent light (b) Red light (c) Blue light (d) Green light 479. In C 4 plants, first carbon dioxide acceptor enzyme is: (a) Oxidase (b) PEPCO (c) RuBP carboxylase (d) RuBP oxygenase 480. The hypothesis that all photosynthetic organisms require a source of hydrogen was given by: (a) Hatch and Slack (b) Van Niel (c) Ruben and Kamen (d) Hill 481. Most widely accepted theory of carbohydrate translocation is: (a) Transpiration theory

133

(b) Mass Flow theory (c) Root pressure theory (d) Imbibition theory 482. ATP molecules required to synthesize one molecule of glucose by C4 pathway are: (a) 36 (b) 30 (c) 18 (d) 12 483. Given below are assertion and reason. Point out if both are true and reason in correct explanation (A), both is ture but reason is not correct explanation (B), assertion is true but the reason is wrong (C) and both are wrong (D), Assertion: Submerged plants get the carbon dioxide in the form of carbonates and bicarbonates. Reason: Stomata are not present in submerged plants. (a) A (b) B (c) C (d) D 484. Pigment system connected with oxidation of water is: (a) Carotenoids (b) Phycobilisome (c) Photosystem II (d) Photosystem I 485. Which one is dephosphorylation? (a) Glucose 6-phosphate  Fructose 6– phosphate (b) Fructose 1–phosphate  Fructose 6–phosphate (c) Fructose 1,6–bisphosphate  Fructose 1–phosphate (d) Fructose 1–phosphate  Fructose, 1, 6–bisphosphate 486. Noncyclic photophosphorylation differs from cyclic photophosphorylation in that the latere has: (a) Reduction of NADP+ (b) Evolution of the oxygen (c) Only PSI (b) Both A and B 487. Carotenes protect plants from: (a) Photosynthesis (b) Photorespiration (c) Desiccation (d) Photo-oxidation 488. Hill used a dye for his famous Hill’s reaction:

Ans. 473. (b) 474. (d) 475. (b) 476. (b) 477. (c) 478. (b) 479. (c) 480. (b) 481. (b) 482. (b) 483. (c) 484. (c) 485. (b) 486. (c) 487. (d)

134

Plant Physiology: Question Bank

(a) Dichlorophenol indophenol (b) Sulfur Green (c) Eosine (d) Methylene blue 489. Anatomy of C4 plant leaf shows: (a) Absence of the bundle sheath cells (b) Presence of peroxisomes (c) Absenced of mitochondria (d) Presence of bundle sheath cells 490. The chemical which absorbs light energy and convert it into chemical energy: (a) Chlorophyll c (b) Chlorophyll b (c) Chlorophyll a (d) Xanthophyll 491. Evidence for liberation of O 2 from water during photosynthesis comes from: (a) Photosynthetic bacteria do not liberate O2 and they use H2S for obtaining reducing power (b) The release of 18O if water contains the same (c) Isolated chloroplast supplied with reducing agentg like potassium ferrocyanide evolves O2 even in the absence of CO2 (d) All of the above 492. Starch is stored in potato tuber as: (a) In the tuber sugar is changed to starch (b) Sugar is synthesized in the leaves (c) Sugar is transported from leaves to tubers (d) All of the above 493. The process of assimilation of CO2 to produce carbohydrates is: (a) Catabolic (b) Reductive (c) Oxidative (d) All of these 494. Which of the following occurs in dark reaction of photosynthesis? (a) The formation of ATP (b) Synthesis of PGA/PGAL (c) Release of O2 (d) Release of H2 495. The first reaction in photosynthesis is: (a) Fixation of CO2 (b) Formation of ATP

(c) Excitation of chlorophyll molecules (d) Photolysis of the water 496. Enzyme required in early CO 2 fixation in C4 cycle is: (a) PGA dehydrogenase (b) PEP carboxylase (c) RuBP oxygenase (d) RuBP carboxylase 497. For the fixing of one molecule of CO2 in Calvin cycle, are required: (a) 3 ATP + 3 NADPH2 (b) 2 ATP + 3 NADPH2 (c) 3 ATP + 2 NADPH2 (d) 3 ATP + 1 NADPH2 498. Sugar moves in phloem vessels as: (a) Sucrose (b) Starch (c) Glucose (d) Cellulose 499. What is the site of the light-dependent reactions? (a) Thylakoids (b) Chemiosmosis (c) Chloroplasts (d) Stroma 500. The synthesis of ATP in the chloroplast is associated with: (a) Electron fellow between PS–II and PS–I (b) Non-cyclic electron fellow (c) An accumulation of H + in the thylakoid lumen (d) All of the above 501. Which of the following is not required by the light independent reactions? (a) Oxygen (b) RuBP–C5 Sugar (c) ATP (d) NADPH 502. Reaction of NADP into NADPH during light reaction occurs in: (a) Stroma Lamella (b) Stroma (c) Lumen of thylakoid (d) Membrane of thylakoid 503. The relationship of respiration and photosynthesis are: (a) No relationship (b) Recipical (c) Reverse (d) Same 504. When electrons in the reaction–center chlorophyll become so excited, they escape to a nearby:

Ans. 488. (b) 489. (d) 490. (c) 491. (d) 492. (d) 493. (c) 494. (b) 495. (c) 496. (b) 497. (c) 498. (c) 499. (a) 500. (d) 501. (a) 502. (b) 503. (c)

Photosynthesis

(a) Cellular membrane (b) Chloroplast (c) Secondary electron acceptor molecule (d) Primary electron acceptor molecule 505. Select the light–independent reaction: (a) Calvin cycle (b) PS–I (c) Electron pathway (d) Chemiosmosis 506. What are stacks of flattened sacs that contain the pigment chlorophyll called? (a) Chloroplast (b) Chemiosmosis (c) Thylakoid (d) Stroma 507. One of the following is a C4 plant: (a) Mango (b) Apple (c) Tomato (d) Sugarcane 508. Match the items of column I and column II: Column I a Mitchell

b Gibbs c Arnon d Calvin

Column II p Steps of dark reaction of photosynthesis q Photophosphorylation r Concept of fee energy s Chemiodmotic hypothesis t Mass flow hypothesis

(a) a–s, b–r, c–q, d–p (b) a–r, b–s, c–p, d–q (c) a–s, b–r, c–p, d–q (d) a–s, b–t, c–r, d–q 509. Cytochrome b 6 and cytochrome f occur in: (a) Lysosomes (b) Chloroplasts (c) Mitochondria (d) Ribosomes 510. Green plants do not give out CO 2 during daytime because they: (a) Consume it in photosynthesis (b) Store the same (c) Respire very slowly (d) Do not respire 511. Ferredoxin in: (a) Carbohydrate (b) Phenol (c) Protein (d) Fat 512. Three carbons of phosphoglyceric acid formed during carbon fixation are derived from:

135

(a) RuBP + CO2 (b) CO2 (c) RuBO (d) PEP + CO2 513. In maize, mesophyll cells perform photosynthetic cycle: (b) C2 (a) C1 (c) C3 (d) C4 514. Protoplasmic streaming theory of trnaslocation of organic solutes was first proposed by: (a) Curtis (b) De Varies (c) Cany and Thaine (d) Van Der Honert 515. Light reaction of photosynthesis is also called: (a) TCA cycle (b) Calvin cycle (c) Hill reaction (d) All of these 516. Radioactive tracer studies with 14C have shown that: (a) Xylem transports organic nutrients (b) Xylem transports inorganic nutrients (c) Phloem transports organic nutrients (d) Phloem transports inorganic nutrients 517. In photosynthesis, the oxygen is liberated during: (a) Hydrolysis of water (b) Reduction of CO2 (c) Breakdown of the proteins (c) Hydrolysis of carbohydrates 518. Direction of conduction of food through phloem is: (a) Phloem never conducts food (b) From leaves to roots (c) From tip to bottom (c) From below to upwards 519. Carbon dioxide is fixed in: (a) Light reaction (b) Anaerobic respiration (c) Dark reaction (d) Aerobic respiration 520. The pigment present universally in all green oxygenic plants is: (a) Chlorophyll d (b) Chlorophyll c (c) Chlorophyll b (d) Chlorophyll a

Ans. 504. (d) 505. (a) 506. c) 507. (d) 508. (a) 509. (b) 510. (a) 511. (c) 512. (a) 513. (d) 514. (b) 515. (c) 516. (c) 517. (a) 518. (b) 519. (c) 520. (d)

136

Plant Physiology: Question Bank

521. The wavelength of visible light is: (a) 100–200 nm (b) 200–400 nm (c) 400–700 nm (d) 700–900 nm 522. The favoring conditions of phosphorylation is: (a) Anaerobic and low light intensity (b) Aerobic and optimum light (c) Aerobic and low light intensity (d) Anaerobic environment 523. Copper containing element among the following: (a) Plastoquinone (b) Plastocyanin (d) Quinone (c) Cyt bs 524. Special feature of the C4 plants is: (a) Kranz anatomy (b) Thin cuticle (c) Multilayered epidermis (d) Both B and C 525. Maximum photosynthesis occurs in: (a) Green light (b) Blue light (c) White light (d) Red light 526. Photosynthesis occurs in: (a) Chloroplasts (b) Plants (c) Leaf cells (d) Leaves 527. Photosynthetic synthesis of carbohydrates uses CO2 and: (a) The presence of sunlight (b) Water with the help of chlorophyll (c) Water in the presence of sunlight with the help of chlorophyll (d) Water in the presence of energy 528. The number of cell organelles involved in photorespiration is: (a) 4 (b) 1 (c) 2 (d) 3 529. In photosynthesis photolysis of water is used in: (a) Oxidation of FAD (b) Reduction of NADP+ (c) Oxidation of NADP (d) None of the above 530. Protochlorophyll differs from chlorophyll in lacking: (a) 1 hydrogen atom in one pyrrole ring (b) 2 hydrogen atoms in two pyrrole rings

(c) 2 hydrogen atoms in one pyrrole ring (d) 4 hydrogen atom in two pyrrole rings 531. The factor which is not normally limiting in photosynthesis is: (b) Water (a) CO2 (c) Light (d) Chlorophyll 532. The pigments of PS I occur in:. (a) Stroma (b) Appressed part of geenra; thylakoids (c) Stromal thylakoids and nonspressed parts of granal thylakoids (d) Both spressed and nonspressed parts of granal thylakoids 533. Which element is required for photosynthetic evolution of oxygen? (a) Mn (b) Zn (c) Fe (d) Cu 534. The wavelength of light most absorbed during photosynthesis is: (a) 440 nm (b) 550 nm (c) 660 nm (d) 700 nm 535. Which one of the following contain agranal chloroplasts? (a) Hydrophytes (b) C3 plants (c) C4 plants (d) Succulents 536. In green cell the enzyme catalase is localized in: (a) Vacuoles (b) Lysosomes (c) Chloroplasts (d) Peroxisomes 537. Main substanced involved in transfer of electrons in photosynthesis is: (a) Cytochrome (b) FAD (c) Phytochrome (d) Both A and C 538. C4 plants differ from C3 plants in: (a) Substrate for CO2 in carbon assimilation (b) Number of ATPs consumed per hexose molecule (c) Type of the end product (d) Type of pigments

Ans. 521. (c) 522. (c) 523. (a) 524. (a) 525. (c) 526. (a) 527. (c) 528. (d) 529. (b) 530. (c) 531. (d) 532. (c) 533. (a) 534. (a) 535. (c) 536. (d) 537. (a) 538. (b)

Photosynthesis

539. A specific function of light in the process of photosynthesis is: (a) Split water molecules (b) Reduction of CO2 (c) Activate other molecules (d) None of the above 540. Terms apoplast and symplast were first used by: (a) Dixon (b) Fisher (c) Clark (d) Munch 541. Primary carboxylation occurs in C 3 and C4 plants with the help of: (a) RuBP carboxylase and pyruvate carboxylase (b) RuBP carboxylase and PEP carboxylase (c) PEP carboxylase and RuBP carboxylase (d) PEP carboxylase and pyruvate carboxylase 542. Accessory pigments transfer their energy to chlorophyll molecules through: (a) Transduction (b) Radiation (c) Resonance (d) Fluorescence 543. Action spectrum of photosynthesis was discovered in 1883 by: (a) Hill (b) Engelmann (c) Calvin (d) Arnon 544. C4 plants have higher net photosynthetic rate as they have: (a) Photosynthesis even at low light intensity (b) Kranz anatomy (c) PEP as CO2 acceptor (d) No photorespiration 545. Which one is required for photosynthetic evolution of oxygen? (a) M–enzyme (b) Coenzyme (c) Z–enzyme (d) F–enzyme 546. RuBisCo content of chloroplast is: (a) 10% (b) 11% (c) 5% (d) 20% 547. Core metal of chlorophyll is: (a) Ni (b) Fe (c) Mg (d) Cu

137

548. Photo-oxidation is: (a) Light and oxygen induced breakdown (b) Photolysis (c) Photorespiration (d) All of the above 549. C4 Pathway of CO2 fixation was discovered by: (a) Emerson and Arnold (b) Arnon (c) Hatch and Slack (d) Blackman 550. C4 Plants differ from C3 plants with respect to: (a) Number of ATP molecules consumed (b) First product (c) Substrate which accepts carbon dioxide (d) All of the above 551. Warburg effect is decrease in the rate of photosynthesis at: (a) High carbon dioxide concentration (b) Low carbon dioxide concentration (c) High oxygen content (b) Both B and C 552. The ATP formation in chloroplast and mitochondrion is explained by: (a) Relay pump theory of Godlewski (b) Munch’s mass flow theory (c) Chemi–osmotic theory of Mitchell (d) Cholodny–Went model 553. At carbon atom III, chlorophyll a has: (a) Magnesium (b) Carboxyl group (c) Aldehyde group (d) Methyl group 554. Photorespiration is affected by: (b) Temperature (a) CO2 and O2 (c) Light intensity (d) All of these 555. Photorespiration occurs in: (a) All living cells (b) Mitochondria (c) Root (d) Green parts

Ans. 539. (a) 540. (d) 541. (b) 542. (c) 543. (b) 544. (d) 545. (c) 546. (c) 547. (c) 548. (d) 549. (c) 550. (d) 551. (c) 552. (c) 553. (d) 554. (d) 555. (a)

138

Plant Physiology: Question Bank

556. Supply end in solute transport is: (a) Stem (b) Root (c) Xylem and phloem (d) Green leaves and storage organs 557. Element essential for photolysis of water is: (a) Carbon (b) Chlorine (c) Oxygen (d) Nitrogen 558. C4 cycle is: (a) With PEP carboxylase in bundle sheath cells (b) With high RuBP carboxylase efficiency (c) Independent cycle (d) Adjunct to Calvin cycle 559. Plants purify the air during: (a) Desiccation (b) Transpiration (c) Respiration (d) Photosynthesis 560. Calvin cycle involves: (a) Oxidative phosphorylation (b) Phosphorylation (c) Reductive carboxylation (d) Oxidative carboxylation 561. Calvin cycle occurs in: (a) Chloroplasts (b) Glyoxysomes (c) Mitrochondria (d) Cytoplasm 562. Noncyclic phosphorylation performed by: (a) PS II (b) Dark reaction (c) PS I (d) Both A and C 563. Enzymes PEP carboxylase and RuBP carboxylase are located in chloroplasts of: (a) CAM plants (b) C4 plants (c) C3 plants (d) Both (a) and (b) 564. Chlorophyll consists of: (a) Porphyrin head and phosphate tail (b) Phytol head and porphyrin tail (c) Phosphate head and porphyrin tail (d) Porphyrin head and phytol tail 565. Thylakoids possess photosynthetic units called: (a) Ribosomes (b) Polysomes (c) Glyoxysomes (d) Quantasomes

566. Constituents of pigment system I are located on: (a) Outer surface of granal and stomatal thylakoids (b) Granal thylakoids (c) Stromal thylakoids (d) Stroma 567. Chlorophyll is soluble in: (a) Organic solvents (b) Water (c) Both A and B (d) None of these 568. In C 4 plants, initial carbon dioxide fixation occurs in chloroplasts of: (a) Palisade tissue (b) Guard cells (c) Spongy parenchyma (d) Hypodermis and chlorenchyma 569. The number of Calvin cycles required to generate a molecule of hexose is: (a) 8 (b) 6 (c) 4 (d) 2 570. Photorespiration is favored by: (a) High humidity and temperature (b) High oxygen and low carbon dioxide (c) High carbon dioxide and low oxygen (c) High temperature and low oxygen 571. C4 cycle was discoverd in: (a) Apple (b) Chrysanthemum (c) Sugarcane (d) Ground nut 572. Chlorophyll a has: (b) – CHO group (a) – CH3 group (c) – COOH group (d) No group 573. Carbon dioxide assimilation occurs through: (a) Anaerobic respiration (b) Glycolysis (c) Calvin cycle (d) Krebs cycle 574. In C 4 plants, chloroplasts are also found in: (a) Bundle sheath cells (b) Guard cells

Ans. 556. (d) 557. (d) 558. (d) 559. (d) 560. (c) 561. (a) 562. (a) 563. (b) 564. (d) 565. (d) 566. (a) 567. (a) 568. (c) 569. (d) 570. (b) 571. (c) 572. (a) 573. (c) 574. (a)

Photosynthesis

(c) Epidermal cells (d) Spongy parenchyma 575. Photosystem has main light harvesting pigments: (a) Chlorophyll a–700, chl a–880, chl–b, chl a–685 and phycobilins (b) Chlorophyll a–680, chl a–685, chl a– 695 and xantophyll (c) Chlorophyll a–660, chl–b, chl a–700, chl – 800, and carotenoid (d) Chlorophyll a–660, chl a–670, chl a– 680, chl a–690, chl a–700 576. Who first of all indicated that water is electron donor in photosynthesis? (a) Van Niel (b) Blakeslee (c) Calvin (d) Arnon 577. In C 4 plants, the fixation of carbon dioxide occurs in: (a) Spongy mesophyll and bundle sheath cells (b) Transfusion tissue (c) Palisade tissue (d) Cortex of stem 578. Photosynthesis is a process in which: (a) CO2 is reduced (b) ATP is generated (c) Oxidative phosphorylation occurs (d) NADH is reduced to NAD 579. Which one is the common product of both respiration and photosynthesis? (a) Chlorophyll (b) Cytochrome (c) Quinone (d) ATP 580. Calvin cycle is: (a) Hindered by light (b) Supported by light (c) Independent of light (d) Dependent upon light 581. ATP synthesis during light reaction is: (a) Phosphorylation (b) Photophosphorylation (c) Photolysis (d) Oxidative phosphorylation 582. Balance between CO2 and O2 is maintained by:

139

(b) Transpiration (a) C4 pathway (c) Photosynthesis (d) Photorespiration 583. Liberation of the oxygen when green cells in water are exposed in sunlight in the presence of suitable acceptor is: (a) Arnon reaction (b) Hill reaction (c) Blackman’s reaction (d) Emerson effect 584. Quantasomes occur on the surface of: (a) Thylakoids (b) Nuclear envelope (c) Plasmalemma (d) Cristae 585. Who demonbstrated for the first time that in photosynthesis, oxygen is evolved from water: (a) Govindji (b) R Hill (c) Calvin (d) Ruben and Kamen 586. The correct option regarding chlorophyll a and b in the leaves of higher plants: (a) Chlorophyll b is ten times more than chlorophyll a (b) Chlorophyll a is less than chlorophyll b (c) Chlorophyll a is more than chlorophyll b (d) Both are present in equal proportion 587. Which one is a C4 plant? (a) Sorghum (b) Maize (c) Sugarcane (d) All of these 588. Assimilatory power formed in light reaction of photosynthesis is: (a) NADPH2 (b) ATP (c) ADP + NADH2 (d) ATP + NADPH2 589. Photorespiration is the characteristic of: (a) CAM plants (b) C3 plants (d) All of these (c) C4 plants

Ans. 575. (d) 576. (a) 577. (a) 578. (a) 579. (d) 580. (d) 581. (b) 582. (c) 583. (b) 584. (a) 585. (b) 586. (c) 587. (d) 588. (d) 589. (b)

140

Plant Physiology: Question Bank

590. Light energy is converted into chemical energy in the presence of: (a) Mesosomes (b) Ribosomes (c) Pyrenoids (d) Chloroplasts 591. The first product of photorespiration is: (a) Glycine (b) Phosphoglycolate (c) Glycolate (d) None of these 592. C4 cycle is connected with: (a) Transpiration (b) Respiration (c) Growth and development (d) Photosynthesis 593. Organelles involved in photorespiration are: (a) Mitrochondria, peroxisomes and glyoxysomes (b) Mitochondria, nucleus and ribosomes (c) Mitochondria, peroxisomes and chloroplasts (d) Mitochondria, chloroplasts and ribosomes 594. During dark reaction the three carbon atoms of 3–PGA is derived from: (a) RuBP + CO2 + PEP (b) RuBP + CO2 (c) CO2 Only (d) RuBP only 595. Chlorophylls absorb visible light of wavelengths: (a) 400–500 nm only (b) 500–400 nm only (c) 300–400 nm only (d) 600–800 nm only 596. Which one occurs both during cyclic and noncyclic modes of photophosphorylation: (a) The formation of NADPH (b) Release of CO2 (c) Formation of ATP (d) Involvement of both PS I and PS II 597. Pigment acting as a reaction center during photosynthesis:

(a) Cytochrome (c) Phytochrome

(b) P700 (d) Carotene

598. Cytochromes are: (a) H2O acceptors (b) O2 acceptors (c) Electron acceptors (d) H2 acceptors 599. The plant shows chloroplast dimorphism: (a) Sugarcane (b) Sugar beet (c) Wheat (d) Rice 600. If plants stop photosynthesis which gas will disappear? (b) O2 (a) NH3 (c) N2 (d) CO2 601. The dark reaction of photosynthesis is: (a) Noncyclic photophosphorylation (b) Cyclic photophosphorylation (c) Calvin cycle (d) Hill reaction 602. Light energy is used in photosynthesis for: (a) The breakdown of C6H12O6 (b) The activation of chlorophyll (c) The breakdown of CO2 (d) The breakdown of H2O 603. Main difference between chlorophyll a and chlorophyll b is: (a) Chlorophyll a has no Mg (b) – CH3 of chlorophyll a is replaced by – CHO in chlorophyll b (c) Chlorophyll a is linear while chlorophyll b is branched (d) All of the above 604. Two types of photosynthetic pigments are: (a) Chlorophyll a and chlorophyll b (b) Chlorophylls and carotenoids (c) Chlorophyll b and carotenoids (d) Chlorophyll a and carotenoids 605. In photosynthesis: (a) Both ATP and glucose are formed in light and dark (b) Both ATP and glucose are produced in light reaction

Ans. 590. (d) 591. (b) 592. (d) 593. (c) 594. (b) 595. (a) 596. (c) 597. (b) 598. (c) 599. (a) 600. (b) 601. (c) 602. (b) 603. (b) 604. (b)

Photosynthesis

(c) Both ATP and glucose are produced in dark reaction (d) ATP is formed in light reaction and glucose in dark reaction 606. A photosynthesizing plant is releasing 18O more than the normal. The plant must have been supplied with: (a) C6H12O6 with 18O (b) CO2 with 18O (c) H2O with 18O (d) O3 607. Maximum solar energy is trapped by: (a) Growing grasses (b) Cultivating crops (c) Planting trees (d) Growing algae in tanks 608. CAM occurs in: (a) Fleshy green leaves (b) Thin colored leaves (c) Thin green leaves with parallel venation (d) Thin green leaves with reticulate venation 609. Photorespiration occurs in: (a) Lysosomes (b) Peroxisomes (c) Mitochondria (d) Ribosomes 610. Photosynthate is translocated through: (a) Latex ducts (b) Xylem vessels (c) Tracheids (d) Sieve tubes/phloem cells 611. Kranz anatomy occurs in: (a) Seed (b) Flower (c) Stem (d) Leaves 612. PS II performs: (a) Formation of water (b) Liberation of energy (c) Photolysis of water (d) Reduction of CO2 613. Synthesis of ADP + Pi  ATP in grana/photosynthesis is: (a) Photolysis (b) Phosphorylation (c) Photophosphorylation (d) Oxidative phosphorylation

141

614. Photophosphorylation was discovered by: (a) Hill (b) Arnon (c) Park and Biggins (d) Willstatter and Stoll 615. Photosynthesis is: (a) Chemical process (b) Oxidation process (c) Reduction process (d) Photochemical process 616. When daylight hours are increased, the rate of photosynthesis: (a) Decreases (b) Increases (c) Unchanged (d) None of these 617. In the two light reactions of photosynthesis: (a) PS I produce ATP which is not performed by PS II (b) PS I emits electrons for PS II (c) PS I produces strong oxidant while PS II a strong reductant (d) PS I produces strong reductant NADPH while PS II a strong oxidant 618. Oxygen containing carotenoids are: (a) Anthocyanins (b) Phycobilins (c) Xanthophylls (d) Carotenes 619. Mass flow hypothesis explains: (a) Translocation (b) Transcription (c) Translation (d) Transpiration 620. Gradient of turgor pressure as the possible mechanism of nutrient translocation was given by: (a) Dixon and Joly (b) Mason and Maskell (c) Curtis (d) Munch 621. The loss of which will harm the tree most: (a) All the leaves (b) Half the branches (c) Half the leaves (d) Bark 622. Which of the following tree will die first:

Ans. 605. (d) 606. (c) 607. (d) 608. (a) 609. (b) 610. (d) 611. (d) 612. (c) 613. (c) 614. (b) 615. (d) 616. (c) 617. (d) 618. (c) 619. (a) 620. (d) 621. (d)

142

Plant Physiology: Question Bank

(a) Girdled (b) Hollowed trunk (c) Pruned (d) Deciduous 623. Complete girdling ultimately kills the tree due to: (a) Nonmovement of the water (b) Nonmovement of the minerals (c) Stoppage of the photosynthesis (d) Starvation of the root 624. Which one dies first when a ring of bark is removed? (a) Root (b) Shoot (c) Both simultaneously (d) None 625. Translocation of carbohydrate nutrients usually occurs in the term of: (a) Sucrose (b) Starch (c) Maltose (d) Glucose 626. The presence of organic substances in the phloem can be demonstrated by means of: (a) Defoliation (b) Ringing of stem (c) Grafting (d) Root pressure 627. The food is transported to the different parts of the plant through: (a) Cortex (b) Pith (c) Phloem (d) Xylem 628. For the synthesis of a molecule of glucose the requirement of ATP and NADPH is respectively: (a) 18 and 12 (b) 12 and 8 (c) 33 and 22 (d) 15 and 10 629. ATP is: (a) Adenine tetraphosphate (b) Adenosine tetraphosphate (c) Adenosine triphosphate (d) Adenine triphosphate 630. Bacterial photosynthesis differs from that of higher plants in: (a) Requirement of the host organism (b) Nonfixation of the energy (c) Nonrequirement of the light (d) Not liberating oxygen

631. The source of oxygen evolved during the photosynthesis is: (a) Photosynthetic curve (b) Carbohydrate (c) H2O (d) CO2 632. Chlorophyll a occurs in: (a) All plants except fungi (b) All oxygen liberating autotrophs (c) In all the higher plants (d) All photosynthetic autotrophs 633. All types of plastids possess essentially the same structure because they: (a) Can transform from one form to another (b) Occur in aerial parts (c) Store food materials like starch, fat and protein (d) Perform the same function 634. Photosystem II occurs in: (a) Mitochondrial surface (b) Cytochrome (c) Grana (d) Stroma 635. Photo-oxidation or photolysis of water (in photosynthesis) occurs in the association of: (a) Plastocyanin (b) PS II (c) PS I (d) Cytochrome 636. Ferredoxin is a constituent of: (a) Hill reaction (b) P680 (c) PS II (d) PS I 637. The enzyme that catalyses carbon dioxide fixation in C4 plants is: (a) Carboxydismutase (b) Carbonic anhydrase (c) PEP carboxylase (d) RuBP carboxylase 638. Most effective wavelength of light for photosynthesis is: (a) Yellow (b) Red (c) Violet (d) Green 639. Quantosomes occur in: (a) Lysosomes (b) Nucleus (c) Mitochondria (d) Chloroplasts

Ans. 622. (a) 623. (d) 624. (a) 625. (a) 626. (b) 627. (c) 628. (b) 629. (c) 630. (d) 631. (c) 632. (a) 633. (a) 634. (c) 635. (b) 636. (d) 637. (c) 638. (b) 639. (d)

Photosynthesis

640. At high oxygen concentration the rate of photosynthesis decreases due to: (a) Richmond Lang effect (b) Emerson’s effect (c) Pasture’s effect (d) Warburg’s effect 641. Emerson found photosynthesis to increase with light flashes. Blackman observed increase in photosynthesis with the increase in light and CO2 till temperature became limiting. Which of the following true in light of above observation: (a) One factor is limiting photosynthesis at one time (b) Photosynthesis has two phases, that is light and dark (c) Light harvesting occurs only in the presence of CO2 (d) Light intensity is temperature dependent 642. Through which of the following does an electron pass to NADP + in light reaction: (a) Plastocyanin (b) Plastoquinone (c) Cytochrome (d) Ferredoxin 643. Cheif functions of the leaves are: (a) Respiration and transpiration (b) Respiration and digestion (c) Respiration and photosynthesis (d) Transpiration and photosynthesis 644. Path of dark reaction of photosynthesis was traced through the use of: (a) X–rays (b) 32P (d) 18O2 (c) 14CO2 645. Photosynthetic enhancement with flashing light was first observed by: (a) Emerson and Arnold (b) Hatch and Slack (c) Hill and Calvin (d) Benson and Calvin 646. The site of O2 evolution of photophosphorylation is:

143

(a) Stroma (b) Granal stacks (c) Chloroplast surface (c) Inner membrane of chloroplasts 647. During monsoon, the rice crop of eastern state of India shows lesser yield due to limiting factor of: (a) Water (b) Temperature (c) Light (d) CO2 648. Which one of the following does not perform C4 photosynthesis? (a) Triticum aestivun = T. vulgare/Crotalaria (b) Euphorbia milli = E. splendens (c) Zea mayas (d) Saccharum 649. Downward movement of organic and inorganic solutes from leaves occurs through: (a) Phloem by mass flow (b) Parenchymatous cells by diffusion (c) Phloem by protoplasmic streaming (d) Phloem by diffusion 650. The technique which has helped in investigation of Calvin cycle: (a) Intermittent light (b) Radioactive isotope technique (c) X-ray technique (d) X-ray crystallography 651. Maximum O2 evolution occurs from: (a) Land mass (b) Crops (c) Marine phytoplankton (d) Forests 652. Cyclic photophosphorylation is carried out by: (a) Photolysis and PS II (b) PS I (c) PS II (d) Both PS I and PS II 653. Chlorophyll b is: (a) C45H72O5N-4Mg (b) C55H72O5N-4Mg (c) C55H70O6N-4Mg (d) C54H70O6N-4Mg

Ans. 640. (d) 641. (b) 642. (d) 643. (c) 644. (c) 645. (a) 646. (a) 647. (c) 648. (a) 649. (a) 650. (b) 651. (d) 652. (b) 653. (c)

144

Plant Physiology: Question Bank

654. Aerobic bacteria collect near illuminated phytoplankton due to: (a) Light (b) Oxygen (c) Reduced CO2 concentration (d) Manufactured food 655. Conversion of PGA to PGAL involves: (a) Photolysis (b) Hydrolysis (c) Oxidation (d) Reduction 656. Green light has a wavelength of: (a) 720–800 nm (b) 660–720 nm (c) 500–580 nm (d) 400–450 nm 657. Algae employed by Calvin et al in experiments on photosynthesis belong to: (a) Chlorella (b) Chlamydomonas (c) Chara (d) Euglena 658. Pigment system I performs independently: (a) Phytolysis (b) Oxidative phosphorylation (c) Cyclic photophosphorylation (d) Noncyclic photophosphorylation 659. Kranz anatomy is typical of: (a) CAM plants (b) C2 plants (c) C3 plants (d) C4 plants 660. Flashing light experiments on photosynthesis were performed by: (a) Emerson and Arnold (b) Hill (c) Calvin (d) Blackmann 661. The oxygen evolved in photosynthesis comes from water was proved by: (a) Ruben, Hassid and Kamen (b) Blackmann (c) Calvin (d) Mayer 662. A very efficient converter of solar energy with net productivity of 2–4 kg/m2 or more is the crop of: (a) Bajra (b) Rice (c) Sugarcane (d) Wheat

663. The dark reactions of photosynthesis occur in: (a) Periplastidial space (b) Stroma outside photosynthesis lamella (c) Stromal lamella membranes (d) Granal thylakoid membranes 664. The size of chlorophyll molecule is: (a) Head 10 × 12 Å, tail 15 Å (b) Head 15 × 15 Å, tail 20 Å (c) Head 20 × 20 Å, tail 25 Å (d) Head 15 × 15 Å, tail 25 Å 665. The product of Hill’s reaction is used in Blackman’s reaction: (a) ATP, NAD (b) ADP, NAD (c) ATP, NADH (d) ATP, NADPH 666. Sensitive to longer wavelengths of the light: (a) Photolysis (b) Phosphorylation (c) PS I (d) PS II 667. Sugarcane shows high efficiency of CO2 fixation because it performs: (a) TCA cycle (b) Hatch and Slack pathway (c) EMP pathway (d) Calvin cycle 668. C4 plants belong to: (a) Monocots (b) Dicots (c) Gramineae (d) Both (a) and (b) 669. The greatest producers of organic matter are: (a) Phytoplankton of oceans (b) Plants of the land area (c) Crop plants (d) Forests 670. As compared to chlorophyll a, bacteriochlorophyll has: (a) One pyrrole ring with one hydrogen (b) One pyrrole ring with two hydrogen (c) One pyrrole ring with three hydrogen (d) One pyrrole ring with four hydrogen

Ans. 654. (b) 655. (d) 656. (c) 657. (a) 658. (c) 659. (d) 660. (a) 661. (a) 662. (c) 663. (b) 664. (b) 665. (d) 666. (a) 667. (b) 668. (b) 669. (a) 670. (b)

Photosynthesis

671. Ribulose biphosphate carboxylase oxygenase is located inside: (a) Peroxisomes (b) Golgi bodies (c) Mitochondria (d) Chloroplasts 672. Photosynthesis has two reaction complexes, one followed by other. The second reaction complex: (a) Fixes carbon dioxide (b) Functions in the presence of light (c) Synthesises starch (d) Traps light energy 673. In C4 plants, Calvin cycle operates in: (a) Stroma of mesophyll chloroplasts (b) Grana of mesophyll chloroplasts (c) Grana of bundle sheath chloroplasts (d) Stroma of bundle sheath chloroplasts 674. C4 plants are also known as: (a) Emerson type (b) Hatch and Slack type (c) Calvin–Bassham type (d) Calvin type 675. When the rate of translocation is slow, the rate of photosynthesis shall: (a) Become zero (b) Unchanged (c) Decrease (d) Increase 676. Which photosynthetic bacteria possess both PS I and PS II? (a) Green sulfur bacteria (b) Purple nonsulfur bacteria (c) Cyanobacteria (d) Purple sulfur bacteria 677. Photosynthetic pigments found in the chloroplasts occur in: (a) Chloroplast envelope (b) Matrix (c) Plastoglobules (d) Thylakoid membranes 678. Chemosynthesis and photosynthesis are similar in being: (a) Autotrophic in nutrition (b) Dependent on solar energy (c) Associated with heterotrophs (d) Found in embryophytes

145

679. The formation of ATP in photosynthesis and respiration is an oxidation process which utilizes the energy from: (a) Carbon dioxide (b) Electrons (c) Ferredoxin (d) Cytochromes 680. NADP+ is reduced to NADH in: (a) Noncyclic photophosphorylation (b) Calvin cycle (c) PS II (d) PS I 681. Which one results in energy wastage? (a) Glycolysis (b) Dark respiration (c) Photorespiration (d) Photosynthesis 682. The evidence that during photosynthesis oxygen comes from water: (a) Isotopic 18 O provided as H 2 18 O apperates as 18 O 2 liberated in photosynthesis (b) Photosynthetic bacteria employ H 2 S and CO 2 to form carbohydrates, water and sulfur (c) Isolated illuminated chloroplasts release oxygen if provided with potassium ferrocyanide (d) All of the above 683. PS II contains a monochlorophyllous pigment in blue–green algae: (a) Cytochrome c (b) Phycocyanin (c) Zeaxanthin (d) -carotene 684. A photosynthetic organism which does not release oxygen is: (a) Green sulfur bacterium (b) Algal component of lichen (c) Blue–green alga (d) Green alga 685. Nobel Prize was awarded to the scientist for discovering the pathway of carbon assimilation? (a) Parnas (b) Calvin (c) Krebs (d) Watson 686. Carbon dioxide joins the photosynthetic pathway in:

Ans. 671. (d) 672. (a) 673. (d) 674. (b) 675. (c) 676. (c) 677. (d) 678. (a) 679. (b) 680. (d) 681. (c) 682. (d) 683. (b) 684. (d) 685. (b)

146

Plant Physiology: Question Bank

(a) Dark reaction (c) PS II

(b) PS I (d) Light reaction

687. The substrate for photorespiration is: (a) Glycine (d) Serine (c) Glycolate (d) Phosphoglyceric acid 688. The products of photochemical reaction are: (a) Organic compounds especially carbohydrates (b) ATP and NADPH (c) O2 (d) O2, ATP and NADPH 689. In C4 plants, synthesis of sugar/final CO2 fixation occurs in: (a) Bundle sheath cells (b) Undifferentiated mesophyll cells (c) Spongy cells (d) Palisade cells 690. Which of the following constitutes Hill’s reaction: (a) Photolysis of water liberating oxygen and hydrogen by illuminated isolated chloroplasts (b) Photolysis of water by isolated illuminated chloroplast causing reduction of some chemicals and liberation of oxygen (c) Photolysis of water by isolated chloroplasts forming ATP and NADPH (d) Photolysis by chloroplasts 691. Hill’s reaction occurs in: (a) Light (b) Dark (c) Both A and B (d) All the time 692. Isotopes employed to study photosynthesis are: (a) 14N and 18O (b) 16C and 15N 15 32 (c) C and P (d) 11C and 32P 693. Both respiration and photosynthesis require: (a) Organic substrate (b) Cytochromes (c) Green cells (d) Sunlight

694. For the synthesis of carbohydrate is not required: (a) Carbon dioxide (b) Nitrogen (c) Water (d) Chlorophyll 695. Quanta required for assimilation of one molecule of CO2 or liberation of the molecule of oxygen are: (a) 2 (b) 4 (c) 8 (d) 16 696. Thylakoids removed from chloroplasts were kept in illuminated culture having CO2 and water. It did not produce sugar because of: (a) Nonformation of assimilatory power (b) Absence of light trapping (c) Nonlinking of PS I and PS II (d) Absence of enzymes 697. Algae often float on the surface of water during day but sink down during night due to: (a) Release of absorbed air by warming of water (b) Warming action of sun during the day (c) Becoming light as they consume most of their food in the night (d) Evolution and trapping of oxygen bubbles during the day in their photosynthesis 698. Hydrilla is used for demostrating photosynthesis because it shows: (a) Evolution of O2 bubbles which can be collected over the water (b) Rapid photosynthesis (c) Little transpiration (d) Little respiration 699. In aquaria, green plants are grown for: (a) Oxygen (b) CO2 (c) Fish food (d) Both B and C 700. In a chlorophyll molecule, magnesium is present: (a) Between prophyrin head and phytol tail

Ans. 686. (a) 687. (c) 688. (d) 689. (a) 690. (b) 691. (a) 692. (a) 693. (b) 694. (b) 695. (c) 696. (a) 697. (d) 698. (a) 699. (a)

Photosynthesis

(b) Phytol tail (c) Center of porphyrin (d) At the one end of porphyrin 701. In bacterial photosynthesis, the hydrogen donor is: (a) H2S (b) NH3 (c) H2SO4 (d) H2O 702. The purification of air in light by green plants, discovered by (Ben jar experiment): (a) Mayer (b) De Saussure (c) Ingenhousz (d) Priestley 703. Bacterial photosynthesis contains: (a) PS II (b) PS I (c) Both A and B (d) None of these 704. Cyclic photophosphorylation produces: (a) ATP only (b) ATP, NADP and O2 (c) ATP and NADPH (d) NADPH 705. Conservation of ATP to ADP produces: (a) Enzymes (b) Hormones (c) Energy (d) Electricity 706. The ingredient required for ATP synthesis is: (a) Fe (b) P (c) S (d) Ca 707. NAD is: (a) Nicotine adenosine diphosphate (b) Nicotinamide adenine diphosphate (c) Nicotinamide adenosine dinucleotide (d) Nicotinamide adenine dinycleotide 708. Chloroplasts fix: (a) Hydrogen (b) Carbon dioxide (c) Oxygen (d) Nitrogen 709. Chlorophyll takes part in: (a) Absorption of light and photochemical splitting of water (b) Absorption of electrons (c) Absorption of CO2 (d) Absorption of light

147

710. Leaves are green because they: (a) Absorb and reflect green light (b) Utilize the green light (c) Do not absorb but reflect green light (d) Absorb green light 711. What is true about photosynthesis: (a) Carbon dioxide is oxidized and water reduced (b) Carbon dioxide is reduced and water oxidized (c) Both carbon dioxide and water are reduced (d) Both carbon dioxide and water are oxidized 712. Energy change in photosynthesis is: (a) Light  electrical  chemical (b) Electrical  chemical (c) Light  chemical (d) Chemical  light  electrical 713. Which one of the following is the common storage product of photosynthesis: (a) Sucrose/glucose (b) Starch (c) Fat (d) Protein 714. Maize, sugarcane and some other tropical plants have high efficiency of CO2 fixation because they operate: (a) PP pathway (b) TCA cycle (c) Hatch–Slack cycle (d) Calvin cycle 715. NADP+ is hydrogen acceptor of: (a) Hexose monophosphate shunt (b) Photolysis (c) Krebs cycle (d) both A and B 716. Compensation point is the value of a factor where there is: (a) Photosynthesis equal to the rate of respiration (b) Beginning of the photosynthesis (c) Neither photosynthesis nor respiration (d) Little photosynthesis

Ans. 700. (c) 701. (a) 702. (d) 703. (b) 704. (a) 705. (c) 706. (b) 707. (d) 708. (b) 709. (a) 710. (c) 711. (b) 712. (c) 713. (b) 714. (c) 715. (d) 716. (b)

148

Plant Physiology: Question Bank

717. Which one directly transfers electrons to NADP+ during light reaction? (a) Plastocyanin (b) Cytochromes (c) PS II (d) PS I 718. Which of the following have high CO2 compensation point? (a) Alpine herbs (b) C3 plants (d) C2 plants (c) C4 plants 719. A plant is kept in 300 ppm CO 2 concentration. What will happen to it? (a) Respiration will be greatly decreased (b) Plant will show normal photosynthesis (c) Plant will grow but will not die (d) Plant will die soon 720. The experimental material that has largely been responsible for making rapid advances in research on photosynthesis is: (a) Hydrilla (b) Spinach leaf (c) Chlorella (d) Chlamydomonas 721. Which of the following is least effective in photosynthesis: (a) Green light (b) Blue light (c) Red light (d) Sunlight 722. The precentage of light energy utilized for photosynthesis by the higher plants is: (a) 1–2 (b) 10 (c) 50 (d) 100 723. Much of the starch is deposited in banana fruit as it matures. Which of the following explains how the starch get there: (a) A sugar solution passes through phleom cells to the fruit where it is changed to starch (b) Starch solution passes through companion cells to fruit (c) Starch grains pass through cells from xylem to fruit (d) Starch solution passes through cells from phloem to fruit

724. Starch is detected in food by its: (a) Granular form even if cooked (b) Presence as an energy store (c) Blue reaction with iodine solution (d) White appearance 725. Moll’s experiment shows: (a) Chlorophyll is essential for photosynthesis (b) Relation between transpiration and absorption (c) CO2 is essential for photosynthesis (d) Unequal transpiration from two surfaces of the leaf 726. Which one of the following would not be limiting factor in photosynthesis? (a) Light (b) Chlorophyll (c) O2 (d) CO2 727. The C4 plants are different from the C3 plants with reference to the: (a) The substance that accepts CO2 in carbon assimilation (b) The number of NADPH that are consumed in preparing sugar (c) Typs of end products of photosynthesis (d) Types of the pigments involved in photosynthesis 728. Starch is insoluble in water. Yet it accumulates in large quantities in potato because: (a) It is useful for consumption (b) Soil microorganisms deposit starch in the tuber (c) It is translocated from the leaves to the tuber in the form of sugar (d) It is synthesized in potato tuber itself 729. Glycolate accumulates in chloroplasts when there is: (a) Low CO2 (b) Low temperature (c) Bright light (d) High CO2 730. Nine-tenth of all photosynthesis of the world (85–90%) is carried out by: (a) Scientists in the laboratories

Ans. 717. (b) 718. (b) 719. (b) 720. (c) 721. (a) 722. (a) 723. (a) 724. (c) 725. (c) 726. (c) 727. (a) 728. (c) 729. (a)

Photosynthesis

(b) Chlorophyll containing ferns of the forests (c) Algae of the oceans (d) Large trees with millions of branches and leaves 731. The process of photosynthesis is: (a) Reductive, endegonic and anabolic (b) Reductive, exergonic and anabolic (c) Reductive, endergonic and catabolic (d) Reductive, exergonic and cataboilc 732. The carbon dioxide acceptor in Calvin cycle/C3 plants is: (a) Ribulose monophosphate (RMP) (b) Phosphoglyceric acid (PGA) (c) Ribulose 1, 5–diphosphate (RuBP) (d) Phosphoenol pyruvate (PEP) 733. The first carbon dioxide acceptor in C4 plants is: (a) Phosphoglyceric acid (b) Oxaloacetic acid (c) Ribulose 1,5-diphosphate (d) Phosphoenol–pyruvate 734. Red drop discovered by Emerson is due to disruption of photochemical activity of: (a) PS II (b) Carotenoids (c) PS I (d) Both A and C 735. The isotope of the carbon used extensively for the studies in photosynthesis is: (b) 15C (a) 16C (c) 14C (d) 13C 736. In C3 plants the first stable product of photosynthesis during dark reaction is: (a) Oxaloacetic acid (b) RuBP (c) PGAL (d) PGA 737. The dark reaction of photosynthesis occurs in: (a) Cytoplasm (b) Matrix (c) Stroma (d) Grana

149

738. Which one is the most converter of the sunlight? (a) Rice (b) Wheat (c) Papaya (d) Sugarcane 739. During daylight hours the rate of photosynthesis is higher than that of respiration and the ratio of O2 produced to that of consumed is: (a) 5:1 (b) 50:1 (c) 10:1 (d) 1:1 740. During dark reaction of photosynthesis: (a) 6C sugar is broken down into 3C sugar (b) Chlorophyll is activated (c) CO 2 is reduced to organic compounds (d) Water is split 741. C4 cycle was discovered by: (a) Hatch and Slack (b) Hill (c) Arnon (d) Calvin 742. Calvin cycle occurs in: (a) Glyoxysomes (b) Mitochondria (c) Cytoplasm (d) Chloroplasts 743. The law of limiting factors for photosynthesis was enunciated by: (a) Krebs (b) R Hill (c) Blackman (d) Calvin 744. In C4 pathway initial carbon dioxide fixation occurs in chloroplast of: (a) Mesophyll (b) Bundle sheath (c) Gaurd cells (d) All of these 745. Which of the following enzyme is used for carboxylation of RuBP? (a) Peroxidase (b) Hexose kinase (c) Phosphopentokinase (d) Carboxydismutase 746. Ribulose bisphosphate carboxylase enzyme catalyses the reaction between: (a) PGA and dihydroxy acetone phosphate

Ans. 730. (c) 731. (c) 732. (c) 733. (d) 734. (a) 735. (b) 736. (d) 737. (c) 738. (d) 739. (c) 740. (c) 741. (a) 742. (a) 743. (c) 744. (a) 745. (d)

150

Plant Physiology: Question Bank

(b) Ribulose bisphosphate and phosphoglyceraldehyde (c) CO2 and ribulose 1,5-bisphosphate (d) Oxaloacetic acid and acetyl CoA

754. The two pigment system theory of photosynthesis was proposed by: (a) Blackman (b) Emerson (c) Arnon (d) Hill

747. During photosynthesis the oxygen in glucose comes from: (a) CO2 (b) H2O (c) Oxygen in air (d) Both A and B

755. For the process of photosynthesis all except one of the following items are essential. Point out the exception: (a) CO2 optimum temperature (b) O2, sucrose (c) Light, chlorophyll (d) Water, minerals

748. Which one is a C4 plant? (a) Maize/corn (b) Potato (c) Papaya (d) Pea 749. During photosynthesis when PGA is changed into phosphoglyceraldehyde, which of the following reactions occurs? (a) Electrolysis (b) Oxidation (c) Reduction (d) Hydrolysis 750. In case of C4 pathway: (a) CO2 combines with RMP (b) CO2 first combines with RuBP (c) CO2 combines with PEP (d) CO2 combines with PGA 751. CO2 is necessary for photosynthesis. The chemical used to remove this gas most effectively from entering a control apparatus is: (a) Distilled water (b) Sodium carbonate (c) Calcium oxide (d) Potassium hydroxide solution 752. Carbon dioxide is formed in all the following except: (a) The burning of sugar (b) Heating of lime stone (c) Photosynthesis of the plants (d) Respiration in the plants 753. Dark reaction of photosynthesis is called so because of: (a) It occurs more rapidly at night (b) It cannot occur during daytime (c) It does not require direct light energy (d) It can occur in the dark alone

756. The color of light gives maximum absorption peak of chlorophyll a: (a) Blue (b) Yellow (c) Red (d) Green 757. That oxygen produced during photosynthesis comes from water was proved by: (a) Blackman (b) Robert Mayer (c) Ruben (d) M Calvin 758. The process of photophosphorylation was discovered by: (a) Warburg (b) Calvin (c) Arnon (d) Priestley 759. The number of chlorophyll molecules in a quantasome is: (a) 500–600 (b) 300–400 (c) 200–250 (d) 50–100 760. The wavelength of light, at which bacteria carry-out photosynthesis: (a) Far-red (near infrared) (b) Red (c) Ultraviolet (d) Blue 761. Chlorophyll absorbs: (a) Blue as well as red light (b) Only blue light (c) Only red light (d) Only green light 762. Which of the following pigments does not occur in chloroplast: (a) Xanthophyll (b) Anthocyanin (c) Carotene (d) Chlorophyll

Ans. 746. (c) 747. (a) 748. (a) 749. (c) 750. (c) 751. (c) 752. (c) 753. (c) 754. (b) 755. (b) 756. (a) 757. (c) 758. (c) 759. (c) 760. (a) 761. (a) 762. (c)

Photosynthesis

763. Grana refer to: (a) By-product of photosynthesis (b) Glycolysis of glucose (c) A constant in quantum equation (d) Stacks of thylakoids in plastids of higher plants 764. Water soluble pigment is: (a) Xantophyll (b) Anthocyanin (c) Carotene (d) Chlorophyll 765. Assimilatory power produced in Hill reaction and used in Blackman’s reaction refers to: (a) Disintegration of plastids (b) Splitting of water (c) Reduction of CO2 (d) Generation of ATP and NADPH2 766. Where does the primary photochemical reaction occur in chloroplast: (a) Inner membrane of chloroplast (b) Quantasomes (c) Periplast cavity (d) Stroma 767. Which one is the precursor of the chlorophyll? (a) Chlorophyllide (Protochlorophyll) (b) Tryptophan (c) Bacterioviridin (d) Bacteriochlorophyll 768. The site for light reaction is: (a) Cytoplasm (b) ER (c) Stroma (d) Grana 769. During ATP synthesis, electrons pass through: (a) Cytochromes (b) CO2 (c) O2 (d) H2O 770. In pigment system II, the active chlorophyll is: (a) P720 (b) P700 (c) P680 (d) P673 771. The basic structure of chlorophyll comprises of: (a) Flavoprotein only (b) Plastocyanin system (c) Cytochrome system (d) Porphyrin system

151

772. Which of the following wavelength of light is absorbed maximum for photosynthesis? (a) 700 nm (b) 680 nm (c) 660 nm (d) 440 nm 773. Besides water and light which is more essential as a raw material for food formation: (a) Mineral salts (b) CO2 (c) NAD (d) O2 774. The discovery of Emerson effect has clearly shown the existence of: (a) Photorespiration (b) Photophosphorylation (c) Light and dark reactions in photosynthesis (d) Two distinct photochemical reactions or processes 775. The process in which water is split during photosynthesis is: (a) Hemolysis (b) Plasmolysis (c) Hydrolysis (d) Photolysis 776. Chloroplats contains maximum quantity of: (a) Pyruvic carboxylase (b) RuBP–carboxylase (c) Hexokinase (d) None of these 777. Pigment system is concerned with: (a) Photolysis of water (b) Flowering (c) Reduction of CO2 (d) None of the above 778. Chlorophyll is present: (a) In the grana chloroplasts (b) In the stroma chloroplasts (c) Dispersed throughout chloroplast (d) On the surface of the chloroplast 779. ATP formation during photosynthesis is: (a) Oxidative phosphorylation (b) Phosphorylation (c) Photophosphorylation (d) None of the above

Ans. 763. (d) 764. (b) 765. (d) 766. (b) 767. (a) 768. (d) 769. (a) 770. (c) 771. (d) 772. (d) 773. (b) 774. (d) 775. (d) 776. (b) 777. (a) 778. (a) 779. (c)

152

Plant Physiology: Question Bank

780. Photophosphorylation means that the synthesis of: (a) NADP (b) PGA (c) ADP from ATP (d) ATP from ADP 781. When the cell converts the light energy into chemical energy, than which of the following reaction would took place? (a) GDP + iP = GTP (b) AMP + iP = ADP (c) ATP – iP = ADP (d) ADP + iP = ATP 782. The specific function of light energy in the process of photosynthesis is to: (a) Synthesize glucose (b) Reduce carbon dioxide (c) Split water (d) Activate the chlorophyll 783. The first step in photosynthesis is the: (a) Excitement of an electron of chlorophyll by photon of light (b) Ionization of the water (c) Formation of ATP (d) Joining of 3-carbon atom to form glucose 784. Photophosphorylation is the process in which: (a) Light energy is converted into chemical energy through the production of ATP (b) CO2 and O2 unite (c) Phosphoglyceric acid is produced (d) Aspartic acid is formed 785. In which of the following process the light energy is convered into chemical energy? (a) Photosynthesis (b) Digestive action (c) Respiration (d) Fermentation 786. Thomas Engelmann illuminated a filament of algae with light that passed a prism, thus exposing different segment of the algal filament to

different wavelengths of light. He add aerobic bacteria and found that these bacteria congregated in the areas illuminated by red and blue light. If you run the same experiment without passing light through a prism, would you predict? (a) There would be no difference in results (b) The number of bacteria would decrease along the entire length of the filament (c) The bacteria would be relatively evenly distributed along the length of the filament (d) The number of bacteria would increase along the length of the filament 787. Photosynthetic yield will be more in: (a) Continuous red light (b) Continuous blue light (c) Intermittant white light (d) Green 788. The individual (or individuals) who demonstrated, using isolated chloroplasts, that splitting of water by light could reduce a dye solution as well as release oxygen is / are (a) R Hill (b) Ruben and Kamen (c) FF Blackman (d) Melvin Calvin 789. When DCPIP (Hill reagent) accepts electron from H2O, its color change to (a) Blue (b) Red (c) Colorless (d) None 790. Which statement about oxygenic photosynthesis is false? (a) Oxygenic photosynthesis is a type of photosynthesis in which carbon dioxide and water, in the presence of light and chlorophyll, is converted into glucose and oxygen (b) Oxygenic photosynthesis is responsible, at least in part, for the oxygen present in today’s earth’s atmosphere

Ans. 780. (d) 781. (d) 782. (d) 783. (a) 784. (a) 785. (a) 786. (c) 787. (c) 788. (a) 789. (c)

Photosynthesis

(c) Oxygenic photosynthesis, occurs in the cyanobacteria algae and plants (d) Oxygenic photosynthesis is the only type of photosynthesis in existence today 791. Which organism does not evolve oxygen in photosynthesis? (a) Anabaena (b) Funaria (c) Higher plants (d) Rhodospirillum 792. In anoxygenic photosynthesis, the green and purple bacteria do not use the following one as electron source: (b) H2 (a) H2O (c) H2S (d) S (elemental sulfur) 793. Chlorella is a suitable plant for an astronaut in space travel because: (a) It provides oxygen to the astronaut and carbon dioxide released is utilized for its food manufacture (b) It supplies abundant food to the astronaut (c) It is a single celled autotrophic plant and slow growing (d) Its growth is quite rapid during spice flight 794. Discovery of Emerson effect showed the existence of: (a) Photorespiration (b) Light and dark reaction in photosynthesis (c) Photophosphorylation (d) Two distinct pigment systems 795. Which of the following most precisely designates the position of the photosystems in higher plants? (a) Membranes surrounding the chloroplast (b) The thylakoid space or compartments (c) Membranes of the thylakoid that form the grana (d) Storm of the chloroplast

153

796. In chloroplast, PSI present on the: (a) Appressed membrane of the thylakoid (b) Nonappressed membrane of the thylakoid (c) Lumen of the thylakoid (d) Inner membrane of chloroplast 797. Table sugar manufactured from sugarcane can be distinguished from that manufactured from sugarbeet by: (a) Chemical analysis (b) Carbon isotope ratio analysis (c) Hydrogen isotope ratio analysis (d) Oxygen isotope ratio analysis 798. RuBP carboxylase was crystallized in 1971 from: (a) Chlorella (b) Maize leaves (c) Tobacco leaves (d) Rice leaves 799. Choose the incorrect statement: (a) CO 2 fixation in C 3 plants reaches saturation at much lower light intensities then C4 plants (b) Optimum temperature for photosynthesis is higher as compared to C3 photosynthesis (c) C3 plants are able to use water move efficiently than C4 plants (d) Under ideal conditions, the rate of photosynthesis in C4 plants is 2–3 times that of C3 plants 800. Peroxisomes are present: (a) Abundantly in mesophyll cells of C3 and C4 plants (b) Abundantly in bundle sheath cells of C3 and C4 plant (c) Mostly in mesophyll cells of C 3 plants and bundle sheath cells in C4 plants (d) Mostly in bundle sheath cells of C3 plants and mesophyll cells of C 4 plants 801. Most C4 plants are native to: (a) Aquatic habitats (b) Mesic habitats

Ans. 790. (d) 791. (a) 792. (a) 793. (a) 794. (b) 795. (c) 796. (b) 797. (b) 798. (c) 799. (c) 800. (c)

154

Plant Physiology: Question Bank

(c) Xeric habitats (d) Nothing can be said definitely 802. Warburg effect is due to: (a) Competition of CO 2 and O 2 for enzyme RuBP carboxylase (b) Competition of CO 2 and O 2 for enzyme PEP carboxylase (c) Competition of CO2 and N2 for PEP carboxylase (d) Competition of CO2 and O2 for both RuBP carboxylase and PEP carboxylase 803. Which of these is not a characteristic feature of C4 plants as compared to C3 plants? (a) They are more efficient in utilizing low levels of CO 2 in the external environment (b) They have greater ability to use water efficiently (c) Slime moulds 804. Plants do not store carbohydrates in the form of glucose because: (a) Glucose dissolve in water thereby altering the osmotic balance (b) Glucose attracts insects herbivores (c) Glucose in an unstable molecule (d) Glucose would replace ribose 805. The layer of cytoplasm lining the vertical walls of sieve elements: (a) Provide a differentially permeable membrane across which a difference in sugar .... concentration is (b) Is the site of active transport, of sugar molecules during loading and unloading (c) Permits the osmosis of water to take place across it (d) All the above are true 806. Photosynthesis is plants prepare food materials in the way: (a) Carbohydrates are formed using CO 2 and H 2 O in the presence of sunlight with the help of chlorophyll

(b) Carbohydrates are formed using CO 2 and H 2 O with the help of chlorophyll (c) Carbohydrates are formed by the use of CO2 and H2O (d) Carbohydrates are formed using CO2 in the presence of sunlight 807. Photosynthesis is process in which: (a) CO2 is reduced to carbohydrate (b) NADH is reduced to NAD (c) ATP is generated (d) Oxidative phosphorylation occurs 808. Nine-tenth of all the photosynthesis is the world is carried out by: (a) Chlorophyll containing ferns of the forests (b) Scientists in the laboratories (c) Algae of the oceans (d) Large trees with millions of branches and leaves 809. Photosynthesis is mainly responsible for the existence of: (a) Animals on this earth (b) Plants on the earth (c) Both plants and animal (d) None of the above 810. Total amount of the dry weight of photosynthates produced by all types of plants per annum is: (a) 1.7 Million tones (b) 17 Million tones (c) 170 Million tones (d) 1700 Million tones 811. The two photosystem I and II during noncyclic photophosphorylation acts in: (a) Parallel (b) Series only (c) Parallel and series only (d) None 812. The mechanism of ATP formation both in chloroplast and mitochondria is explained by: (a) Relay pump theory of godlewski (b) Cholodnywent’s model

Ans. 801. (c) 802. (a) 803. (b) 804. (a) 805. (d) 806. (a) 807. (a) 808. (c) 809. (c) 810. (d) 811. (b)

Photosynthesis

(c) Chemiosmotic theory (d) Munch’s pressure/mass model

flow

813. Phototrophs trap sunlight whereas chemotrophs derive their energy form the oxidation of a fuel. On this basis which among the following observations’ in true? (a) Spirulina sp. are chemotrophs whereas hydrogen bacteria are phototrophs (b) Both Spirulina sp. and hydrogen bacteria are phototrophs (c) Both Spirulina sp. and hydrogen bacteria are chemotrophs (d) Spirulina sp. is a phototrophs while hydrogen bacteria are chemotrophs 814. A scientist who worked on a singlecelled green plant (an alga) treated it with ultraviolet and produced mutant cells that did not contain chloroplast. To keep these cells alive, the scientist had to: (a) Provide them with highlight intensity (b) Keep them in the dark (c) Provide them with a sugar solution (d) Give them chlorophyll 815. Which of the following is correct concerning the evolution of photosystem II in cyanobacteria? (a) It made photosystem I in these organisms unnecessary for photosynthetic fixation of carbon dioxide (b) It provided these organisms with an almost inexhaustible supply of electron from water (c) It allowed these organisms to use any electron donor to replace electrons lost form excited chlorophyll a molecules (d) It allowed these organisms to generate ATP for the fixation of carbon dioxide into sugars without chemiosmosis

155

816. Reaction center of Rhodopseudomonas viricils: (a) Absorbs light of >900 nm (b) Transfers electrons form QH2 b to a cytochrome (c) Special pair chlorophyll molecules reduced by electrons from H2O (d) Special pair chlorophyll molecules reduced through cytochrome (e) (a), (b), and (d) 817. The porphyrin ring of chlorophyll molecule is a complex ring structure of (a) Double bonds (b) Triple bonds (c) Alternating double and single bond (d) Alternating double and triple bonds 818. Most plants contain chlorophyll ‘a’ which in amount is: (a) Equal to chlorophyll b (b) Less than chlorophyll b (c) Twice or thrice more than chlorophyll b (d) Five or six times more than chlorophyll b 819. Chlorella as a suitable material for the studies on photosynthesis was introduced by: (a) Emerson (b) Warburg (c) Arnold (d) Engelmann 820. Huber, Michel and Dissenhofferanalysed the reaction of photosynthetic reaction center of the bacterium rhodobacter using: (a) Electron microscopy (b) Autoradiography (c) X-ray diffraction (d) Spectrophotometry 821. In the presence of high concentration of oxygen, RuBP carboxylase functions as: (a) Oxidase (b) Oxygenase (c) Isomerase (d) Hydrolase 822. The rate of photosynthesis in plants growing under the canopy decreases greatly because of lesser availability of:

Ans. 812. (c) 813. (d) 814. (c) 815. (b) 816. (e) 817. (c) 818. (c) 819. (b) 820. (c) 821. (b)

156

Plant Physiology: Question Bank

(a) CO2 (b) Water (c) Blue and red light (d) Change in temperature 823. Choose the correct statement: (a) C4 plants are more enriched in 13C than C3 plants (b) C4 plants are more enriched in 12C than C3 plants (c) C4 plants are more enriched in 14C than C3 plants (d) C3 plants are more enriched in 14C than C4 plants 824. Chlorophyll in the membrane of thylakoid is: (a) All directly active in photosystern I and II (b) Embedded in the lipid via hydrophobic side (c) Not associated with membrane (d) Present entirely as Chl a 825. The pigment molecules responsible photosynthesis bare located in the: (a) Cytoplasm of the cell (b) Stroma of the chloroplast (c) Thylakoid membrane of the chloroplast (d) All of the above 826. Antenna pigments: (a) Are bound specifically in pigment protein complexes (b) Donate electrons directly to the electron transport chain (c) Absorb light energy and transfer it efficiently to the reaction center (d) Often include carotenoids and/or xanthophylls (e) (a), (c) and (d) 827. A carotenoid-less mutant plant was grown under normal sunlight, it will experience: (a) Increased photosynthetic rate (b) Increased chlorophyll biosynthesis (c) Reduced photorespiration (d) Increased chlorophyll oxidation and necrosis

828. Photo-oxidation of chlorophyll is prevented by: (a) Carotenoid (b) Anthocyanin (c) Phycobilin (d) Funcoxanthin 829. Antenna pigments transfer light energy to a reaction center: (a) By means of a process known as fluorescence (b) By means of a process known as inductive resonance (direct transfer of energy) (c) By the conduction of heat (d) All of the above 830. Which pigment will have higher absorbance in red region? (a) Chl a (b) Chl b (c) Both have same absorbance (d) Carotene 831. Some bacteria contain extensive internal membranes that are involved in specific function one example of such membranes is chromatophores, which are: (a) Photosynthetic membranes where light is convert to chemical energy in the form of ATP (b) Convolution of the inner membrane that extend into the interior of the mitochondrion (c) Internal membranes where inorganic nitrogen containing compounds oxidize to generate ATP (d) Internal compartment of chloroplast where fixation of CO2 occurs 832. Colors of light most useful in photosynthesis are: (a) Green, yellow and orange (b) Red, violet and blue (c) Infrared, red and yellow (d) Red, white and blue 833. Light energy is changed into chemical energy the process of: (a) Transpiration (b) Photosynthesis (c) Digestion (d) Respiration

Ans. 822. (c) 823. (a) 824. (b) 825. (c) 826. (e) 827. (d) 828. (a) 829. (b) 830. (a) 831. (a) 832. (d) 833. (b)

Photosynthesis

834. Light reaction accomplishes: (a) Photolysis of water (b) Evolution of oxygen (c) Production of energy rich compounds (d) All the above events 835. Evolution of oxygen takes place in: (a) Light reaction (b) Dark reaction (c) Both light reaction and dark reaction (d) Electron transport chain between PSI and PS II 836. Splitting of water is associated with: (a) Pigment system I (P 700) (b) Pigment system II (P 680) (c) Pigment system I (P 890) (d) All of the above 837. Electrons are transported from water to PS II reaction center through water oxidising complex theory of: (a) Kok et al (b) Hill and Bendall (c) Arnon (d) Mitchell 838. Ruben, Hassid and Kamen (1941) confirmed using isotopic technique that in photosynthesis: (a) Oxygen comes from carbon dioxide (b) Oxygen comes from water (c) Oxygen comes from carbon dioxide and water both (d) Oxygen comes from nitrogen peroxide 839. ‘z’ scheme of photosynthetic electron transport was discovered by: (a) Robert Hill (b) Kok et al (c) Hill and Bendall (d) Van–Niel 840. Chemiosmotic coupling theory of phosphorylation was proposed by: (a) P Mitchell (b) Huber et al (c) R Emerson (d) Lewis 841. Chlorophyll a differs from chlorophyll b in having:

157

(a) Methyl group at tetrapyrrole ring I (b) Aldehyde group at tetrapyrrole ring I (c) Methyl group at tetrapyrrole ring II (d) Aldehyde group at tetrapyrrole ring II 842. Solarization is a phenomenon of: (a) Absorption of light by etiolated leaves (b) Absorption of light by green leaves (c) Oxidation of reaction center of PS II by high intensity of light (d) Oxidation of antenna molecules of PS II by high intensity of light 843. Light dependent step of chlorophyll synthesis is conversion of: (a) Protochlorophyllide to chlorophyllide (b) Protoporphyrinogen to protoporphyrin (c) Chlorophyllide a to chlorophyll a (d) Uroporphyrinogen to coproporphyrinogen 844. Thylakoids are not stacked in granum in: (a) Algae (b) Bryophytes (c) Angiosperms (d) Conifers 845. A quantasome comprises of: (a) Pigment system I only (b) Pigment system H only (c) Pigment system I and pigment system II both (d) Two photosynthetic units 846. Each photosystem comprises of: (a) Antenna molecules (b) Antenna chlorophylls (c) Antenna molecules and reaction center (d) Antenna chlorophylls and reaction center 847. In green light maximum photosynthesis occurs in: (a) Red algae (b) Blue green algae (c) Green algae (d) Brown algae

Ans. 834. (d) 835. (a) 836. (b) 837. (a) 838. (b) 839. (c) 840. (a) 841. (a) 842. (c) 843. (a) 844. (a) 845. (c) 846. (c) 847. (a)

158

Plant Physiology: Question Bank

848. “Sorer band’ is shown by chlorophyll molecules in: (a) Violet blue region (b) Red region (c) Yellow-orange region (d) Indigo-green region 849. Which one of the following is synthesized in the dark reaction? (a) PGA (b) ATP (d) O2 (c) NADPH+ 850. RuBisCo is made up of: (a) 14 subunits (b) 15 subunits (c) 16 subunits (d) 18 subunits 851. Photosynthesis is maximum in: (a) Red light as both pigment systems lie in this region (b) Blue light as it has more energy (c) Green light as it is absorbed by red pigments (d) White light as it comprises of all colors 852. Which of the following is called ‘assimilatory power’: (a) NADPH + H+ (b) NADH+ (c) NADPH + H+ + ATP (d) NADH+ + ATP 853. Dichlorophenyl dimethyl urea (DCMU) inhibits flow of electrons: (a) In non-cyclic electron transport system (b) In cyclic electron transport system (c) Both cyclic and noncyclic electron transport system (d) In none of the electron transport system 854. Photophosphorylation takes place in: (a) Mitochondria (b) Chloroplast (c) Cytoplasm (d) All of the above 855. First stable product of Calvin cycle is a: (a) 3-carbon compound (b) 2-carbon compound (c) 4-carbon compound (d) 6-carbon compound

856. C4 cycle occurs in: (a) Temperate plants (b) Tropical plants (c) Shade loving plants (d) Both temperate and tropical plants 857. Which of the following enzyme has dual role: (a) PEP carboxylase (b) RuBisCO (c) Phosphorylase (d) Aldolase 858. Photorespiration does not occur in: (b) CAM plants (a) C4 plants (c) C3 plants (d) Temperate plants 859. Product synthesis phase comprises of: (a) Formation of fructose (b) Formation of RuDP (c) Formation of starch (d) All the above 860. ‘Kranz type’ of anatomy is shown by: (a) C3 plants leaves (b) C4 plants leaves (c) CAM plants (d) CAM plants and C4 plants both 861. Which of the following is not shown by C4 plants: (a) Low CO2 compensation point (b) High CO2 compensation point (c) Kranz type of anatomy of leaves (d) Primary carbon acceptor is C3 compound 862. Peroxisome is associated with: (a) Photorespiration (b) Dark respiration (c) Glyoxylate cycle (d) Pentose phosphate pathway 863. Asymmetrical distribution of radiocarbon in glucose and glucose-6phosphate is called: (a) Pasteur effect (b) Gibbs effect (c) Lang effect (d) Crab-tree effect

Ans. 848. (a) 849. (a) 850. (c) 851. (d) 852. (c) 853. (a) 854. (b) 855. (a) 856. (b) 857. (b) 858. (a) 859. (c) 860. (b) 861. (b) 862. (a) 863. (b)

Photosynthesis

864. Noncyclic photophosphorylation in photosynthetic bacteria comprises of: (a) Pigment system I (P 700) and pigment system 11 (P 680) (b) Pigment system I (P 890) (c) Pigment system I (P 890) and pigment system II (P 680) (d) Pigment system I (P 700) and (P 890) 865. During dark reaction of photosynthesis: (a) Water is split (b) CO2 is reduced to carbohydrate (c) Glucose is broken to CO2 and water (d) ATP is synthesized 866. About 90% of the world photosynthesis is carried out by: (a) Algae (b) Bryophytes (c) Conifers (d) Angiosperms 867. Primary process of light reaction is: (a) Splitting of water (b) Excitation of chlorophyll a molecules (c) Synthesis of ATP (d) Production of reducing power 868. If atmospheric CO 2 concentration raises to 500 ppm, the possible result will be: (a) There will be no effect on photosynthetic yield (b) Photosynthesis will be enhanced (c) Photosynthesis will be decreased (d) First it will decrease then increase 869. Proportion of O2 consumed in respiration and O2 evolved in photosynthesis is: (a) 10 : 1 (b) 50 : 1 (c) 20 : 1 (d) 1 : 1 870. In C 4 plants primary CO 2 fixation occurs in chloroplasts of: (a) Bundle sheath cells (b) Palisade tissue (c) Spongy mesophyll (d) Guard cells

159

871. C4 plants are more efficient as they are devoid of: (a) Photorespiration (b) EMP pathway (c) Calvin cycle (d) Hatch-Slack cycle 872. Porphyrin is found in the structure of: (a) Chlorophyll (b) Cytochrome (c) Phytochrome (d) All of the above 873. Most abundant electron transport pigment is: (a) Plastoquinone (b) Cytochrome (c) Ferredoxin (d) Ferredoxin reducing substances 874. Pseudocyclic photophosphorylation was discovered by: (a) Ruben (b) Amon (c) Emerson (d) Lewis 875. C4 plants are adapted to: (a) Hot and dry climate (b) Temperate climate (c) Cold and dry climate (d) Hot and humid climate 876. The conversion of phosphoglyceric acid into phosphoglyceraldehyde in photosynthesis is a: (a) Oxidation process (b) Reduction process (c) Polymerization (d) Isomerization 877. The discovery of ‘Emerson effect’ has shown the existence of: (a) Light and dark-reactions in photosynthesis (b) Two distinct photochemical reactions (c) Photorespiration (d) Photophosphorylation 878. Red drop in photosynthesis in green algae refers to decrease in the rate of photosynthesis in: (a) Blue light (b) Green light (c) Red light > 680 mn (d) Red light < 680 nm

Ans. 864. (b) 865. (b) 866. (a) 867. (b) 868. (b) 869. (a) 870. (c) 871. (a) 872. (d) 873. (a) 874. (b) 875. (a) 876. (b) 877. (b) 878. (c)

160

Plant Physiology: Question Bank

879. Double fixation of CO2 takes place both in C4 and CAM plants. Which one of the following statement brings out the main difference between the two? (a) The two carboxylizing enzymes in the two plants are different (b) CO 2 fixation in C 4 plants is separated by space, whereas in CAM plants it is separated by time (c) The two pathways of CO2 fixation are different in these two plants (d) The compensation points in these two plants are different 880. Which one of the following statements best supports the fact that photorespiration process commonly occurs in C3 plants? (a) C 3 plants do not possess Kranz anatomy (b) C 3 plants are usually high CO 2 compensation species (c) C 3 plants are less efficient in photosynthesis (d) C3 plants are characterized by RuBP oxygenase activity under high oxygen supply 881. Which one of the following hemeproteins serves as electron carrier in both respiration and photosynthesis? (a) Phytochrome (b) Ferredoxin (c) Cytochrome (d) Cryptochrome 882. In the photosynthetic electron transport system the hydrogen transporter is: (a) Pheophytin (b) Plastoquinone (c) Cytochrome f (d) Plastocyanin

885. DCMU (Dichlorophenyl dimethyl urea) is a herbicide which kills the plant by: (a) Inhibition of respiration (b) Destroying the chloroplasts (c) Inhibiting how of electrons from water to NADI (d) Inhibiting PSI and photolysis of water 886. Most of our knowledge of photosynthesis has been gained by working on: (a) Chlamydomonas (b) Chlorella (c) Hydrilla (d) Spinach leaves 887. Our present view regarding photosynthesis is that it: (a) Converts light energy into chemical energy (b) Creates useful energy (c) Fixes CO2 into carbohydrates (d) Reverses the action of respiration 888. Bacterial photosynthesis is different from photosynthesis of higher plants because: (a) Light is not required (b) Oxygen is not evolved (c) Energy is not fixed (d) All the above 889. Which of the following bacteria have both PS I and PS II? (a) Purple sulfur bacteria (b) Green sulfur bacteria (c) Cyanobacteria (d) Actinomycetes

883. Metal component of oxygen evolving complex of chloroplast is: (a) Fe (b) Mg (c) Mn (d) Cu

890. A copper containing protein involved in electron transfer from PS II to PS I during photosynthesis is: (a) Cytochrome b/f (b) Cytochmme a3 (c) Plastoquinone (d) Plastocyanin

884. The green wavelength of sunlight is absorbed by: (a) Xanthophylls (b) Phycocyanin (c) Chlorophyll b (d) Phycoerythrin

891. The C2 glycolate cycle is also known as: (a) PCR (photosynthetic carbon reduction cycle)

Ans. 879. (b) 880. (a) 881. (c) 882. (b) 883. (c) 884. (d) 885. (c) 886. (b) 887. (a) 888. (b) 889. (c) 890. (d)

Photosynthesis

(b) PCO (photorespiratory carbon oxidation cycle) (c) PPP (Pentose phosphate pathway) (d) EMP (Embden Meyerhoff Parnas pathway) 892. In the synthesis of one mole of glucose by C 3 and C 4 plants, the number of moles of ATP used by C3 and C4 plants is respectively: (a) 15 and 30 (b) 10 and 20 (c) 18 and 30 (d) 15 and 20 893. Match list I with list II and select the correct answer using the codes given below the lists:

List I List II A. Photophospho- 1. Transformation of radiant rylation energy into chemical form B. Phytochrome 2. Emitting back the radiations absorbed C. Fluorescence 3. Photoreceptor pigment of plant D. Quantum con- 4. ATP synthesis in chloroversion codes plast

Codes: (a) A-4, B-3, C-2, D-1 (b) A-3, B-4, C-1, D-2 (c) A-4, B-3, C-1, D-2 (d) A-3, B-4, C-2, D-1 894. Match list I (a feature of the bacterium) with list II (name of the bacterium) and select the correct answer using the codes give below the lists: (a) (b) (c) (d)

List I Aerobic bacteria Anaerobic bacteria Chemosynthetic bacteria Photosynthetic bacteria

1. 2. 3. 4.

List II Clostridium Thiobacillus Azotobacter Rhodosprillum

Codes: (a) A-3, B-1, C-4, D-2 (b) A-1, B-3, C-4, D-2 (c) A-1, B-3, C-2, D-4 (d) A-3, B-1, C-2, D-4 895. Pine trees in northern hemisphere are typically adapted to the shade of the forests due to possession of: (a) High LHC LI: core complex II ratio (b) Low LHC II: core complex II ratio

161

(c) LHC11: core complex II ratio unity (d) None of the above 896. The source of electron for glyoxylic acid reductases which reduce glyoxylate back to glycolate is: (a) NADPH + H+ (b) FADH2 (c) FdH2 (d) H2O 897. The substrate for photorespiration is: (a) C6 acid (b) C4 acid (c) C3 acid (d) C2 acid 898. Match list I with list II and select the correct answer using the codes given below the lists: List I A. Z-scheme of photosynthesis B. One gene-one enzyme concept C. Chemiosmotic concept D. Concept of catalytic RNA

List II 1. Beadle and Tatum 2. Hill and Bendall 3. Cech and Altman 4. Jacob and monod 5. P Mitchell

Codes: (a) A-2, B-1, C-5, D-3 (b) A-1, B-2, C-5, D-4 (c) A-2, B-1, C-4, D-3 (d) A-2, B-3 C-4, D-5 899. The total output of photosynthesis including the organic matter used up in respiration during the period of measurement is called: (a) Net primary productivity (b) Gross primary productivity (c) Net community productivity (d) Secondary productivity 900. When does the cyclic electron pathway begin? (a) When photosystem II complex absorbs light (b) When photosystem I complex absorbs light (c) When both photosystem I and photosystem II absorb light (d) Before operation of EMP pathway

Ans. 891. (c) 892. (a) 893. (a) 894. (d) 895. (a) 896. (a) 897. (d) 898. (a) 899. (b) 900. (b)

162

Plant Physiology: Question Bank

901. Select the true statement: I. NADH yields less ATP than FADH2+ II. More NADH is produced in the Krebs+ cycle than in glycolysis III. The final acceptor of electrons is ATP synthase IV. ETS pumps H+ into the intermembrane space (a) I, II and IV (b) II and IV (c) II and III (d) Only I 902. Match list–I with list–II and select the correct answer using the codes given below the lists: List–I A. Peripheral reticulum B. RuBP–carnoxylase– oxygenase C. CO2–fixation in the dark D. Cyclic Photophosphorylation

List–II 1. C3–plants 2. CAN – Plants

905. Match list–I with list–II and select the correct answer using the codes given below the lists: List–I A. Biotin B. Coenzyme–A

List–II 1. Carboxylation 2. Active aldehyde transfer C. Thymine pyrophosphate 3. Sugar transfer D. Uridine diphosphate 4. Acyl group transfer

Codes: A B C D (a) 4 1 3 2 (c) 1 4 3 2

3. Photosystem-I 4. C4 – Plants 5. Photosystem-II

Codes: A B C D (a) 3 5 1 4 (c) 2 5 4 1

IV. Total of 10 H + are translocated from the matrix across the inner membrane per electron pair moving from NADH to O2– (a) I, II, III and IV (b) I, II and III (c) I and II (d) I and III

A B C D (b) 4 1 2 3 (d) 1 4 2 3

903. Consider the following: I. Cytochrome–b6 II. Cytochrome–f III. Plastocyanin IV. Plastoquinone What is the sequence of these in the photoinduced electron carrier between PS–II and PS–I in photosynthesis? (a) II, III, IV and I (b) I, II, III and IV (c) III, IV, I and II (d) IV, I, II and III 904. Which of the following statement is correct? I. Electron transport generates the proton motive force II. Peroxisomal oxidation of fatty acids generates no ATP III. Proton motive force in mitochondria is largely due to voltage gradient across the membranes

A B C D (b) 4 1 2 3 (d) 1 4 2 3

906. Match list–I with list–II and select the correct answer using the codes given below the lists: List–I List–II A. Conversion of glucose to 1. Krebs’ cycle pyruvate B. Conversion of pyruvate 2. Electron transport to acetyl Co–A system C. Breakdown acetyl–Co–A 3. Glycolysis to yield reduced coenzymes D. Synthesis of ATP 4. Oxidative decarboxylation

Codes: A B C D (a) 3 1 4 2 (c) 3 4 2 1

A B C D (b) 4 3 2 1 (d) 3 4 1 2

907. Consider the following statements: I. Copper is present in cytochrome oxidase II. Pantothenic acid is the precursor of coenzyme A III. Thiamine pyrophosphate is the prosthetic group in decarboxylation IV. Zinc is present in RNA and DNA polymerases

Ans. 901. (b) 902. (b) 903. (d) 904. (b) 905. (c) 906. (d)

Photosynthesis

Select the correct statements: (a) I, III and IV (b) I, II, III and IV (c) II, III and IV (d) I and II 908. Match list–I with list–II and select the correct answer using the codes given below the lists: List–I A. The amount of energy accumulation in green plants through the process of photosynthesis B. The total organic matter synthesized by the producers in the process of photosynthesis per unit time and area C. Rate of the storage of organic matter in plant tissues in excess of the respiratory utilization D. Rate of energy storage at consumer level

List–II 1. Gross primary productivity 2. Primary productivity

3. Secondary productivity 4. Net primary productivity

Codes: A B C D A B C D (a) 2 1 4 3 (b) 1 3 4 2 (c) 2 1 3 4 (d) 1 2 3 4 909. Choose the mismatch one: (a) B Cell elongation (b) Mo N2-fixation (c) Na C3 pathway (d) CI Photosynthesis of water 910. Which statement regarding ATP synthesis is false? (a) ATP synthesis are protein complexes that allows protons to cross membrane (b) Proton motive force (proton gradient) derives the formation of the ATP in mitochondria (c) ATP synthesis in the chloroplast occurs in the thylakoid region of this organelle (d) ATP is synthesized only in chloroplast and mitochondria 911. F1 ATPase, part of ATP synthase synthesizes ATP when proton process through it:

163

(a) Down their electrochemical proton gradient (b) Against their electrochemical proton gradient (c) Gown their K+ gradient (d) All of the above 912. In ATP synthase, F0 acts as: (a) ATPase (b) Electron carrier (d) H+ channel (c) CI– carrier 913. In the chemosmatic hypothesis for energy generation in the mitochondria: (a) Electron transport carriers, use energy of moving electron in uphill direction to from ATP (b) ATP must be continually translocated into mitochondria (c) Electron transport carriers set up a proton gradient (d) A pH gradient derives the hydrolysis of ATP to ADP 914. Pumping of H + across the inner membrane, from the matrix space to inter membrane space in mitochondria cause: (a) Higher pH in matrix than in cytosol (b) Lower pH in matrix than in cytosol (c) Both (a) and (b) (d) None of these 915. The electrons from all substrates are transferred to the common acceptor, ATP. The place in the mitochondrion where the pH is lower during aerobic respiration in the: (a) Mitochondrial ribosome (b) Intermembrane space (c) Cytosol (d) Matrix 916. It is possible for variety of substrates to use a common pathway for the transfer of electrons to oxygen because: (a) The substrates are all oxidized by the same enzymes (b) The substrates are oxidized in the mitochondria (c) Many of the substrates are oxidized in the mitochondria (d) None of the above

Ans. 907. (d) 908. (a) 909. (c) 910. (d) 911. (a) 912. (d) 913. (c) 914. (a) 915. (b) 916. (c)

164

Plant Physiology: Question Bank

917. DCCD is a reagent that reacts with Asp residue. The addition of DCCD blocks the ATP synthesizing activity F0F1–ATPase by inhibiting the: (a) Protonation and deprotonation of alpha subunit (b) Release of ATP from beta subunit (c) Binding the ADP with beta subunits (d) Flow of protons by F0 918. Which of the following statement correctly describes the relationship between the Krebs cycle and electron transport pathways? (a) NADH produced by Krebs cycle is used to make ATP by electron transport (b) ATP produced by the Krebs cycle drives electron transport and the formation of a H+ gradient (c) The electron transport pathway obtains electrons from the CO 2 produced by the Krebs cycle (d) The Krebs cycle releases H+ used by the electron transport 919. The electron transport system is located in the: (a) Cytosol (b) Cristae (c) Matrix (d) Stroma 920. The electrons that enter the electron transport system are carried there by: (b) NADH (a) FADH2 (c) Both A and B (d) None of these 921. Which C–Atom of glucose was tagged with 14 C so that after one cycle of glycolysis and Krebs cycle none of the radioactive C–Atom is found in intermediates? (a) C–2 (b) C–3 (c) C–1 (d) C–6 922. If 1 mol of acetyl bycoenzyme–A labeled with 14 C in both carbon position of the acetate moiety goes through one turn of the TCA cycle, how many moles of the 14CO2 would be produced?

(a) 4 (b) 2 (c) 1 (d) 0 923. In a radiolabeling metabolic experiment radiolabeled (4–14C) oxaloacetate is fed of mitochondria. After one turn of the CAC, which carbon(s) of succinate would be labeled? (a) Equally distributed between C–2 and C–3 (b) C–4 (c) Equally distributed between C–1 and C–4 (d) None of the above 924. Substrate level phosphorylation in the citric acid cycle depends directly on the energy of the: (a) FAD–dependent oxidation of succinate to fumarate (b) Thioester bond of succinyl CoA (c) Oxidative decaroxylation of isocitrate to –ketoglutarate (d) Formation of citrate from oxaloacetate and acetyl CoA 925. The release of carbon dioxide results from which of the following reactions in the YCA cycle? I. Isocitrate to a formation of citrate from oxaloacetate and acetyl CoA to ketoglutarate II. Malate to oxaloacetate III. –ketoglutarate to succinyl CoA IV. Succinate to fumarate (a) I, II, III and IV (b) I, II and III (c) I and II (d) I and II 926. Most carbon dioxide from catabolism of glucose is released during: (a) Lactate fermentation (b) Oxidative phosphorylation (c) The Krebs’s cycle (d) Glycolysis 927. Ferredoxin is a constituent of: (b) Hill reaction (a) P680 (c) PS–I (d) PS–II

Ans. 917. (d) 918. (a) 919. (b) 920. (c) 921. (b) 922. (d) 923. (d) 924. (b) 925. (c) 926. (a) 927. (c)

Photosynthesis

928. Cyclic photophosphorylation produces: (a) ATP (b) ATP, NADPH and O2 (c) ATP and NADPH (d) NADPH 929. Carbon dioxide joins the photosynthetic pathway in: (a) Light reaction (b) Dark reaction (c) PS–II (d) PS–I 930. Carbon dioxide is fixed in: (a) Anaerobic respiration (b) Light reaction (c) Dark reaction (d) Aerobic respiration 931. Bundle sheath chloroplast of C 4 plants are: (a) Small and Agarnal (b) Small and Granal (c) Large and Granal (d) Large and Agarnal 932. ATP synthesis during light reaction is: (a) Phosphorylation (b) Photophosphorylation (c) Photolysis (d) Oxidative phosphorylation 933. Non-cyclic photophosphorylation in photosynthesis activates: (a) PS–I and PS–II simultaneously (b) PS–II then PS–II (c) PS–I then PS–II (d) PS–II only 934. The experiment model used by Van Nail, to prove that O2 comes out from the water was: (a) Scendesmus (b) Blue green algae (c) Chromatilum vinosum (d) Chlorella pyrenoidosa 935. When DCZPIP (Hill regent) accepts electron from H2O its color changes to: (a) Colorless (b) Blue (c) Red (d) None of these

165

936. Which of the following is a false statement? (a) CI– is required for photochemical reaction involved in photolysis of water (b) Plant roots absorb ions as well as the salts (c) Conversion of organic nitrogen to NH 4 + by soil microbes is called ammonification (d) All NH4+ seems to be converted first into the amide group of glutamine 937. The photochemical process in photosynthesis which needs both PS–I and PS–II also involves: (a) Synthesis of assimilatory power (b) Photolysis of water (c) Z–Scheme of electron transfer (d) All of the above 938. In C4–pathway the first stable compound is: (a) RuDP (b) PGA (c) OAA (d) PGAL 939. During photosynthesis the reaction when PGA is converted into PGAL, is called: (a) Phosphorylation (b) Oxidation (c) Reduction (d) Isomerization 940. Which of the following protest is a photoautotroph? (a) Chlorobium (b) Diatoms (c) Ferrobacillus (d) Thiobacillus 941. Assimilatory powers produced during photosynthesis are: (a) C6H12O6 and PGAL (b) H2O and O2 (c) ATP and NADPH (d) RuBP and RuBisCo 942. The two photosystem–I and II during non–cyclic photophosphorylation acts in: (a) Series (b) Parallel (c) Both (a) and (b) (d) None of these

Ans. 928. (a) 929. (b) 930. (c) 931. (d) 932. (d) 933. (a) 934. (c) 935. (a) 936. (b) 938. (d) 938. (b) 939. (c) 940. (b) 941. (c) 942. (a)

166

Plant Physiology: Question Bank

943. In chloroplast, PS–I present on the: (a) Inner membrane of the chloroplast (b) Lumen of the thylakoid (c) Non-appeared membrane of the thylakoid (d) Appeared membrane of the thylakoid 944. In anoxygenic photosynthesis, the green and purple bacteria do not use the following one as electron source: (a) Elemental sulfur (b) H2S (c) H2 (d) H2O 945. Ribbon-shaped chloroplast is present in: (a) Chromatinum (b) Chlorobium (c) Spirogyra (d) Zygnema 946. Reduction of coenzyme NADP depends on: (a) Formation of ATP (b) Photolysis of water (c) Evolution of O2 (d) Reduction of CO2 947. Which is sensitive to longer wavelength of light? (a) Photophosphorylation (b) PS–II (c) Photolysis (d) PS–I 948. In the Calvin cycle, the assimilatory power is used during: (a) Formation of glucose, from fructose–1, 6–diphosphate (b) Formation of fructose–1, 6–diphosphate from PGAL (c) Conversion of –3 PGAL to –3PGAL (d) Formation of –3PGA 949. The organism does not evolve oxygen in photosynthesis: (a) Rhodospirillum (b) Higher plants (c) Funaria (d) Anobaena 950. The function of water in photosynthesis is to: (a) Provide O 2 for the light independent reactions (b) Transport H+ ions in the light independent reactions

(c) Supply electrons in the light dependent reactions (d) Absorbs light energy 951. The prerequisites of the Calvin cycles are: (a) NADPH2 and H2O, CO2 (b) CO2, ATP and NADPH2 (c) ATP, H2O and NADPH2 (d) H2O, CO2 and ATP 952. For the process of photosynthesis all expect one of the following items is essential. Point out the exception: (a) Light and chlorophyll (b) Water and minerals (c) Glucose and oxygen (d) CO2, optimum temperatures 953. Photosynthesis yield will be more in: (a) Green light (b) Intermittent white light (c) Continuous blue light (d) Continuous red light 954. Photooxidation of chlorophyll and cell contents as a result of high intensity is known as: (a) Photorespiration (b) Photoperiodism (c) Photolysis (d) Solarization 955. What will happen to the rate of photosynthesis if sodium bicarbonate is added in the water having Hydrilla plant in a beaker? (a) It will be accelerated (b) It will be stopped (c) It will be decreased (d) It will remain normal 956. In Calvin cycle: (a) 1,3 di PGA undergo phosphorylation (b) Fructose–1,6–diphosphate undergoes dephosphorylation (c) ATP is formed during dephosphorylation of fructose (d) None of the above

Ans. 943. (c) 944. (d) 945. (c) 946. (b) 947. (d) 948. (c) 949. (a) 950. (c) 951. (b) 952. (c) 953. (b) 954. (d) 955. (a) 956. (b)

Photosynthesis

957. Name the plant, which do not perform photosynthesis is: (a) Pitcher plant (b) Cuscutta (c) Bryophyllium (d) Algae 958. Colors of the light most useful in photosynthesis are: (a) Infrared, red and yellow (b) Red, white and blue (c) Red, violet and blue (d) Green, yellow and orange 959. The pigment, which will have higher absorbance in the red region: (a) Carotene (b) Chlorophyll b (c) Chlorophyll a (d) Both have same absorption 960. Photo-oxidation of chlorophyll is prevented by: (a) Fucoxanthin (b) Phycobilin (c) Anthocyanin (d) Carotenoid 961. The pigment molecules responsible for photosynthesis are located in the: (a) Thylakoid membrane of the chloroplast (b) Stroma of the chloroplast (c) Cytoplasm of the cell (d) All of the above 962. Dimorphic chloroplast are present in: (a) Sorghum bicolor (b) Saccharum officinale (c) Zea naya (d) All of the above 963. The source of CO2 during Calvin cycle in C4 plant is: (a) RuDP (b) PEP (c) OAA (d) Malic acid 964. Which one of the following compound in non-cyclic photophosphorylation in light reaction contains copper? (a) Plastocyanin (b) Plastoquinone (c) Ferredoxin (d) Cytochrome 965. The proton motive force develops across the thylakoid membrane in the presence of light in results of:

167

(a) Sum of both pH and voltage gradient (b) Only voltage gradient (c) Only pH gradient (d) None of the above 966. In the presence of light, pH of the lumen of thylakoid: (a) Remain same (b) Decreases (c) Increases (d) None of these 967. Cooperation of the two photosystems of the chloroplast is required: (a) Generation of proton motive force (b) Oxidation of the reaction center of PS-I (c) Reduction of NADP (d) For ATP synthesis 968. Electron carriers in non-cyclic flow of electrons: (a) Pass electrons from a more positive to more negative reduction potential (b) Pass electrons from higher free energy to lower energy (c) Pass electrons from a more negative to a more positive reduction potential (d) Both (a) and (b) 969. During non-cyclic photophosphorylation, plants and cyanobacteria produce: (a) NADH and ATP (b) NADPH and ATP (c) NADPH (d) ATP 970. Glycolytic reversal is a part of: (a) Dark phase of photosynthesis (b) Light phase of photosynthesis (c) Anaerobic respiration (d) Aerobic respiration 971. The visible product of photosynthesis is: (a) Fructose (b) Starch (c) Cellulose (d) Glucose 972. During light phase of photosynthesis ......, is oxidized and ......, is reduced: (a) NADPH2 and CO2

Ans. 957. (a) 958. (b) 959. (c) 960. (b) 961. (a) 962. (d) 963. (d) 964. (a) 965. (d) 966. (b) 967. (c) 968. (d) 969. (b) 970. (a) 971. (d)

168

Plant Physiology: Question Bank

(b) Water and NADP (c) Water and CO2 (d) CO2 and Water 973. In which of the following light, rate of photosynthesis is maximum: (a) Blue (b) Red (c) Discontinuous white (d) White 974. In young leaves ratio of carotene to xanthophylls is: (a) 1:2 (b) 1:3 (c) 3:1 (d) 2:1 975. Oxygen evolving complex, involved to the photolysis of water contain: (a) Mn2+, CI– and CO (b) Mn2+, CI– and Ca3+ (c) Mg3+, CO– and Ca3+ (d) Mn2+, CI– and K+ 976. What happen in chloroplast in the presence of light? (a) Electrons are moving (b) Hydrogen’s protons accumulate in thylakoid spaces

(c) Water is being spilt (d) All of the above 977. Which of the following pigment is involved in photochemical reaction in the pigment system? (a) Xanthophylls (b) Carotene (c) Chlorophyll–a (b) Chlorophyll–b 978. Photochemical reaction occurs in: (a) Inner membrane of chloroplast (b) Membrane of thylakoid (c) Stroma of chloroplast (d) Lumen of thylakoid 979. The first step in photosynthesis is: (a) Electron release by chlorophyll–a (b) Conversion of PG in PGA (c) Carboxylation of RuBP (d) Photolysis of water 980. ......, ions help in photolysis of water. (b) Mn2+ (a) CI– 2+ (c) Mg (d) Both (a) and (b)

Ans. 972. (b) 973. (c) 974. (a) 975. (b) 976. (d) 977. (c) 978. (b) 979. (a) 980. (d)

Photosynthesis

CHECK YOUR GRASP

1. In mesophyll cells which of the following CO2 fixation takes place? (a) C1 (b) C2 (c) C3 (d) C4 2. Which element is essential for photolysis of water? (a) Nitrogen (b) Chlorine (c) Carbon (d) Oxygen 3. Which pigment is present universally in all green plants? (a) Chlorophyll a (b) Chlorophyll b (c) Chlorophyll c (d) Chlorophyll m 4. Photorespiration takes place only in (a) Survive more efficiently in humid conditions (b) Survive arid conditions (c) Fix carbon dioxide during the day and night (d) Prevent the enzyme RuBisCo from being denatured 5. Which pigment is present universally in all green plants? (a) Chlorophyll a (b) Chlorophyll b (c) Chlorophyll c (d) Chlorophyll m 6. CAM plants have an adapted photosynthetic process that primarily allows them to: (a) Survive more efficiently in humid conditions (b) Survive arid conditions (c) Fix carbond dioxide during the day night (d) Prevent the enzyme RuBisCo from being denatured 7. In calvin cycle, RuBisCo incorporates CO2 into ribulose 1,5 bisphosphate which rapidly splits into (a) Glyceraldehydes-3-phosphate (b) 2,3 phosphoglyceric acid (c) 3-phosphoglycerate (d) 1,3-diphosphoglycerate 8. In CAM plants, CO2 acceptor in the night is: (a) RUBP (b) PEP (c) OAA (d) PGA Ans. 899. (b) 900. (b) 10. (b) 11. (b)

1. (d) 12. (d)

2. (b) 13. (b)

3. (a) 14. (b)

169

9. In C4 plants the carbon dioxide fixation occurs in: (a) Guard cells (b) Spongy cells (c) Palisade cells (d) Bundle sheath cells 10. Synthesis of sucrose during photosynthesis occurs in: (a) Chloroplast (b) Cytosol (c) Vacuoles (d) Arnyloplast 11. In C4 plants, initial CO 2 fixation at place in the chloroplasts of wakes: (a) Guard cells (b) Spongy mesophyll (c) Palisade tissue (d) Bundle sheath 12. Assimilatory powers produced during photosynthesis are: (a) H2O and O2 (b) RuBP and RuMP (c) C6H12O6 and PGAL (d) ATP and NADPH2 13. Which one is the last electron acceptor over ETC in oxidative phosphorylation? (b) Cyta3 (a) H2 (c) Cytb (d) CO2 14. Before combining with OAA, pyruvic acid is changed into: (a) Succinic acid (b) Malic acid (c) Acetyl CoA (d) Citric acid 15. Glycolysis takes place in: (a) All cells (b) Only eukaryotic cells (c) Muscle cells (d) Nerve cells 16. Total energy requirement for fixing one CO2 by combined C4 and C3 cycle is (a) 5 ATP + 4 NADP1-1 (b) 3 ATP + 4 NADPH (c) 5 ATP + 2 NADPH (d) 8 ATP + 2 NADPH 17. In which of the following cells of a C3 leaf would you fine the highest concentration of enzyme RuBisCo? (a) Epidermal cell (b) Mesophyll cell (c) Bundle sheath cell (d) (b) and (c) 4. (a) 15. (a)

5. (a) 16. (c)

6. (b) 17. (b)

7. (b)

8. (b)

9. (b)

170

Plant Physiology: Question Bank

18. Which of the following are true of C4 photosynthesis? (a) It seems to be advantageous in cooler climates (b) It has high compensation point for CO2 (c) Similar to the CAM photosynthesis pathway (d) All of the above 19. RuBisCo: (a) Catalyzes the carboxylation of CO2 to ribulose 1, 5 bisphosphate (b) Initiates photorespiration when the CO2/O2 ratio is law (c) Catalyzes the reduction of two molecules of PGAL to form glucose d, a, b but not c 20. If asked to pinpoint precisely the site of 20 synthesis of 3-phosphoglyceraldehyde in piants, you would have to say that it takes place within the: (a) Mesophyll (b) Grana (c) Stroma (d) Chloroplast 21. The mass flow hypothesis was first described by: (a) Kurosawa (b) Swanson (c) Munch (d) Buchanan 22. Radioactive tracer studies with 14C have confirmed that: (a) Phloem transports organic nutrients (b) Xylem transports inorganic nutrients (c) Xylem transports organic nutrients (d) Phloem transports inorganic nutrients 23. What is the name of cycle which generates energy and splits water into hydrogen and oxygen? (a) Citric acid cycle (b) Photolysis (c) Leucogenolysis (d) Electron transport chain 24. Bacterial photosynthesis differs from the crosses of photosynthesis in eukaryotes by: (a) No. of photosynthetic phases Ans.

18. (c) 29. (c)

19. (d) 30. (b)

20. (c) 31. (b)

21. (c) 32. (b)

22. (a) 33. (c)

(b) Product of first cycle (c) Type reductant (d) All of the above 25. Mitch can readily respire without oxygen? (a) Anabaena (b) Saccharomyces (c) Mushroom (d) Fish 26. Photophosphorylation takes place in: (a) Ribosomes (b) Mitochondria (c) Gram (d) Stroma 27. Photophosphorylation takes place during: (a) Night (b) Light (c) Ultraviolet rays (d) Night and days 28. Cu photosynthetic pathway is not in: (a) Corn (b) Mustard (c) Water hyacinth (d) potato 29. A cell that lacks chloroplast does not: (a) Utilize carbohydroplast (b) Evalue carbon dioxide (c) Liberate oxygen (d) Require water 30. Photorespiration is induced by: (a) High temperature (b) High oxygen content (c) High CO2 content (d) High light intensity 31. If a photosynthesis plant releases it is concluded that the plant has been supplying: (a) 18O from H218O (b) 8O from 18CO2 (c) 8O from H22 O6 (d) Now 32. End product of photosynthesis is: (a) RuBP (b) Starch (c) PEP (d) Pyruvic acid 33. Aerobic atmosphere on earth is maintained by: (a) Prokaryotes (b) Protists (c) Plants (d) Fungi 34. The bulk fixation of carbon through photosynthesis takes place in: (a) Crop plants (b) Tropical rain forests and crop plants 23. (b)

24. (b)

25. (b)

26. (c)

27. (b)

28. (c)

Photosynthesis

(c) Tropical rain forests (d) Oceans 35. The researches on photosynthesis began: (a) In the 17th century (b) In the 18th century (c) In the 19th century (d) In the early 20th century 36. Scientist who first discovered the role of light in photosynthesis: (a) Sachs (b) Priestley (c) Scenbier (d) Ingenhousz 37. Impure air is purified in the presence of light and green plants, was first said by: (a) De Saussure (b) Priestly (c) Von Helmont (d) Ingenhousz 38. Who demonstrated that O2 is given out in photosynthesis: (a) Kamen (b) Arnon (c) Blackmann (d) Park and Biggins 39. Who among the following gave chemical composition of chlorophyll, carotenes and xanthophylls? (a) Fleming and Waksman (b) Willstatter and Stoll (c) Park and Biggins (d) Meyer and Calvin 40. The exact mechanism of photosynthesis is a process of converting light energy into chemical energy, is established by: (a) Jean Senebier (b) Robert Hill (c) Ingenhousz (d) None of the above 41. The process in which carbohydrates are synthesized by green plants from carbon dioxide and water in the presence of light is known as: (a) Respiration (b) Photosynthesis (c) Transpiration (d) Absorption 42. The ultimate biological energy comes from: Ans.

34. (d) 45. (d)

35. (b) 46. (d)

36. (d) 47. (a)

37. (b) 48. (b)

38. (a) 49. (c)

171

(a) Mitochondria (b) Sunlight (c) Glucose (d) ATP 43. Light energy is changed into chemical energy during the process of: (a) Transpiration (b) Photosynthesis (c) Digestion (d) Respiration 44. Our present day view regarding photosynthesis is that: (a) Creates useful energy (b) Converts light energy into chemical energy (c) Reverses the action of respiration (d) Fixes CO2 into carbohydrates with the help of assimilation power 45. The percentage of light energy fixed in photosynthesis is generally around (a) 50 (b) 3 (c) 10 (d) 1 46. The source of energy for carbon assimilation is: (a) Chlorophyll (b) CO2 (c) Water (d) Sunlight 47. The percentage of light energy utilized for photosynthesis by higher plants is: (a) 1–2 (b) 10 (c) 50 (d) 100 48. The process of taking in CO2 by and releasing O2 is termed: (a) Endo-osmosis (b) Photosynthesis (c) Transpiration (d) Respiration 49. The process of photophosphorylation was discovered by: (a) Priestly (b) Warburg (c) Arnon (d) Calvin 50. Photosynthesis is the conversion of light energy into chemical energy within a plant was first stated by: (a) Willstatter and Stoll (b) Mayor and Anderson (c) Benson and Calvin (d) Robert Mayer Mark your score and evaluate yourself accordingly 39. (b) 50. (d)

40. (d)

41. (b)

42. (b)

43. (b)

44. (d)

172

Plant Physiology: Question Bank

8

Respiration and Photorespiration 1. Total ATP output (Net gain) after complete oxidation (or aerobic oxidation) of 1 glucose molecule through ETS (oxidative phosphorylation) in eukaryote is: (a) 34 ATP (b) 32 ATP (c) Both A and B (d) None of these

brane during single turn of ETS starting with one FADH? (a) One proton (b) Two proton (c) Three proton (d) None of these 6. How many protons are pumped from matrix to PMS through inner membrane during single turn of ETS starting with one NADH? (a) One proton (b) Two proton (c) Three proton (d) None of these

2. Total ATP output (Net gain) after complete oxidation (or aerobic oxidation) of 1 glucose molecule through ETS (oxidative phosphorylation) in prokaryote is: (a) 34 ATP (b) 32 ATP (c) Both A and B (d) None of these

7. ATP is produced in which of the following step of ETS: (a) Cytb–Cytc (b) Cyta–Cytas (c) NAD–FM/FAD (d) All of the above

3. 1 molecule of FADH 2 has sufficient energy to generate 3 ATP through ETS. The value of this energy present in FADH2 is: (a) 55 kCal (b) 50 kCal (c) 40 kCal (d) None of these 4. One molecule of NADH 2/1NADPH2 has sufficient energy to generate 3 ATP through ETS. The value of this energy present in 1 NADH2/1NADPH2 (per mole) is: (a) 24.5 kCal (b) 52 kCal (c) 15.2 kCal (d) None of these 5. How many protons are pumped from matrix to PMS through inner memAns.

1. (b)

2. (a)

3. (c)

4. (b)

5. (b)

8. Final terminal/ultimate electron acceptor in ETS is: (a) Cyt a (b) Cyt C (c) Cyt b (d) Cyt as 9. Final terminal/ultimate electron acceptor in ETS is: (a) Cyt c (b) Cyt b (d) None of these (c) Cyta3 10. Final terminal/ultimate electron acceptor in ETS is: (a) Cyt b (b) Cyta3 (c) Oxygen (d) More than one 6. (c) 172

7. (d)

8. (a)

9. (d)

10. (c)

Respiration and Photorespiration

11. Chemiosmosis theory deals with: (a) Formation of ATP by utilizing the energy liberated due to diffusion of the proton pair through proton channel (b) How proton gradient is established (c) Both A and B (d) None of these 12. Which one of the following arrangements of hydrogen carrier and cytochrome used during ETS is according to increasing order of potential: (a) FMN/FAD–Cytb–CoQ–CytC1– Cyta–Cyta3–Cytc (b) FMN/FAD–CoQ–Cytb–CytC1– Cyta–Cyta3 (c) Both A and B (d) None of these 13. Energy liberated due to which of the following movement of proton pair (2H+) is responsible for the synthesis of ATP: (a) From PMS to matrix (b) From matrix to PMS (c) Both (a) and (b) (d) None of these 14. What is proton gradient? (a) High concentration of H + ion in perimitochondrial space and high concentration of H+ in matrix (b) Low concentration of H + ion in perimitochondrial space and low concentration of H+ in matrix (c) High concentration of H + ion in perimitochondrial space and low concentration of H+ in matrix (d) None of the above 15. Cytochrome oxidase is: (a) Cyt b (b) Cyt c (c) Cyt a (d) None of these 16. Cytochrome a and a3 are collectively known as: Ans.

11. (c)

12. (c)

13. (b)

14. (c)

15. (b)

173

(a) F1 complex (b) F1–F0 complx (c) F0 – F1 complex (d) None of these 17. Which of the following is the common oxidation pathway of carbohydrate, protein and fat metabolism? (a) Krebs cycle (b) Glycolysis (c) Link reaction (d) All of the above 18. Name the intermediate compounds of Krebs cycle which can produce glutamic acid and aspartic acid, respectively: (a) OAA produces aspartic acid (b) -ketoglutaric acid produces glutamic acid (c) Both A and B (d) None of these 19. Krebs cycle is also called amphibolic cycle because of: (a) The production of ATP (b) The breakdown of Acetyl CoA (c) Some intermediate of Krebs’ cycle like -ketoglutaric acid and oxaloacetic acid are used to produce important biomolecules like glutamic acid and aspartic acid respectively (d) All of the above 20. Net gain of ATP molecule in oxidation of one molecule of glucose in glycolysis is: (a) One (b) Two (c) Three (d) Four 21. ATP molecule in glycolysis is synthesized by: (a) Photophosphorylation (b) Subtractive level phosphorylation (c) Oxidative phosphorylation (d) None of the above 16. (b)

17. (a)

18. (c)

19. (d)

20. (b)

21. (b)

174

Plant Physiology: Question Bank

22. Most of the reactions of glycolysis requires the presence of: (b) Ca++ ions (a) K+ ions ++ (d) Mg++ ions (c) Mn ions

30. Which organic compound donates its to FAD+ during Krebs cycle: (a) -ketoglurate (b) Succinate (c) Both (d) None of these

23. Except succinate dehydrogenase, all other mitochondrial enzymes of TCA cycle are found in: (a) Matrix (b) Outer membrane (c) Inner membrane (d) All of the above

31. Which organic compound donates its hydrogen to FAD+ during Krebs cycle? (b) NAD+ (a) FAD+ (c) Both (d) None of these

24. In mitochondria, succinate dehydrogenase is located in: (a) Matrix (b) Outer membrane (c) Inner membrane (d) Intermemebrane space 25. Which of the following is not a form of anaerobic respiration? (a) Butyric acid fermentation (b) Lactic acid fermentation (c) Alcoholic fermentation (d) None of the above 26. Who among the following is not Nobel laureate? (a) Paul Boyer and John Walker (b) Peter Mitchell (c) Hans A Krebs (d) None of the above 27. TCA cycle is also known as: (a) Citric acid cycle (b) Krebs cycle (c) Both (d) None of the above 28. Name the organic compound which gives ATP by substrate phosphorylation during Krebs cycle: (a) Isocitrate (b) Succinyl –CoA (c) Both (d) None of these 29. Which organic compound donates its hydrogen to NAD + during Krebs cycle (a) -ketoglurate (b) Isocitrate (c) Malate (d) All the above Ans.

22. (d) 33. (b)

23. (a) 34. (c)

24. (c) 35. (e)

25. (d) 36. (d)

26. (d) 37. (c)

32. Name the hydrogen acceptor or carrier used during Krebs cycle: (b) NAD+ (a) FAD+ (c) Both (d) None of these 33. Name the organic compound which undergoes simultaneous oxidative decarboxylation during Krebs cycle: (a) Malate (b) -ketoglurate (c) Succinate (d) None the above 34. Name the organic decarboxylated during Krebs cycle: (a) Isocitrate (b) -ketoglutarate (c) Both A and B (d) None of these 35. Name the organic compound dehydrogenated during Krebs cycle: (a) Malate (b) Succinate (c) a-ketoglutarate (d) Isocitrate (e) All of the above 36. Name the organic compound produced in citric acid cycle having 6C atom: (a) Cis-A conitate (b) Oxalosuccenic acid (c) Isocitrate acid (d) All of the above 37. Name the organic compound produced in citric acid cycle having 5C atom: (a) Oxalosuccenic acid (b) Isocotric acid (c) -keoglutaric acid (d) None of the above 27. (c)

28. (b)

29. (d)

30. (b)

31. (c)

32. (c)

Respiration and Photorespiration

38. What are the proper sequences of organic compound produced in citric acid cycle on the basis of number of carbon atom? (a) 5C–4C–6C (b) 6C–5C–4C (c) 4C–5C–6C (d) None of these 39. What are the possible organic compounds produced in citric acid cycle on the basis of number of carbon atom? (a) 2C (b) 6C (c) 4C (d) More than one 40. How many ATP are gained during citric acid cycle during aerobic respiration of one glucose? (a) More than one (b) 12 (c) 24 (d) 30 41. Glycolysis is: (a) Facultative anaerobe (b) Obligate anaerobe (c) Facultative aerobe (d) Obligate aerobe 42. Glycolysis is the part of: (a) Aerobic respiration (b) Anaerobic respiration (c) Both A and B (d) None of these 43. ATP is the ...... universal energy carrier of the cells: (a) Stagnate (b) Mobile (c) Both A and B (d) None of these 44. ....... is a highly coordinated multistep process; carried out by living organisms in their cells at body temperature, that involves the biological oxidation of organic substance (through electron transfer) consequent but gradual and stepwise release of the energy: (a) Combustion (b) Respiration (c) Photosynthesis (d) None of these 45. Respiration differs from combustion because in combustion: (a) Flame is produced (b) Light is produced (c) ATPs are not synthesized (d) All of the above Ans.

38. (b) 49. (d)

39. (d) 50. (b)

40. (c) 51. (b)

41. (c)

42. (c)

175

46. The process of respiration in green plants takes place: (a) Only when photosynthesis is in progress (b) Only when stomata are open (c) Only when photosynthesis ceases (d) At the all time 47. In plants, most common respiratory substrate is: (a) Carbohydrate (b) Proteins (c) Organic acids (d) None of these 48. Respiration is: (a) A chemical process (b) A catabolic process (c) An anaerobic process (d) All of the above 49. Which of the following is false about glyoxylate cycle? (a) It is a variant of citric acid cycle (b) It occurs in glyoxisome (c) It results in the formation of succinate from acetyl CoA (d) It occurs in all eukaryotic cells 50. All of the following occurs in mitochondria except: (a) Citric acid cycle (Krebs’ cycle) (b) Glycogenolysis (c) Fatty acid oxidation (d) Electron transport chain 51. Glucose is metabolized through glycolysis and Krebs’ cycle. How do amino acids and fat get metabolized? (a) There are separate cycle and pathways for such metabolism (b) They are broken down, modified, and fed into various points in the same pathway as is used by glucose (c) They are first converted to glucose molecules (d) Only the amino group on the amino acids can be used for energy, the rest is just degraded, while fats are only stored 43. (c)

44. (b)

45. (d)

46. (d)

47. (a)

48. (d)

176

Plant Physiology: Question Bank

52. The function of the TCA cycle is catalyzed by all of the following statements except: (a) It generates reduced NAD + and reduced FAD (b) It generates guanosine triphosphate (c) It catalyses the complete oxidation of acetate to carbon dioxide and water (d) It causes the net synthesis of oxaloacetate from acetyl CoA 53. Which of the reactions of Tricarboxylic Acid Cycle listed below results in the formation of a high energy phosphate compounds? (a) Isocitrate dehydrogenase (b) Succinyl coenzyme A synthase (c) Succintate dehydrogenase (d) Citrate synthetase 54. Most carbon dioxide from catabolism of glucose is released during: (a) Glycolysis (b) The Krebs’ cycle (c) Lactate fermentation (d) Oxidative phosphorylation 55. All of the following enzymes of the TCA cycle are located in the mitochondrial matrix except (a) Citrate synthetase (b) -ketoglutarate dehydrogenase (c) Succinate dehydrogenase (d) Fumarate 56. Which of the following citric acid cycle products is disposed of by our respiratory system when we exhale? (b) ATP (a) CO2 (c) NADH (d) FADH2 57. The release of carbon dioxide results from which of the following reactions in the TCA cycle? I. Isocitrate to -ketoglutarate II. Malate to oxaloacetate III. -ketoglutarate to succinyl CoA IV. Succinate to fumarate Ans.

52. (d) 63. (d)

53. (b)

54. (b)

55. (c)

56. (a)

(a) I and II (c) I, II and III

(b) I and III (d) I, II, III and IV

58. Substrate level phosphorylation in the citric acid cycle depends directly on the energy of the (a) Thioester bond of succinyl CoA (b) Oxidative decarboxylation of isocitrate to -ketoglutarate (c) Formation of citrate from oxaloacetate and acetyl CoA (d) FAD-dependent oxidation of succinate to fumarate 59. In a radiolabeling metabolic experiment radiolabeled (4–14 C) oxaloacetate is fed to mitochondria. After one turn of the CAC, which carbon(s) of succinate would be labeled? (a) C 4 (b) Equally distributed between C 1 and C 4 (c) Equally distributed between C 2 and C 3 (d) None of the above 60. If 1 mol of acetyl coenzyme A labeled with “C in both carbon position of the acetate moiety goes through one turn of the TCA cycle, how many moles of the 14CO2 would be produced? (a) 0 (b) 1 (c) 2 (d) 4 61. Which C-atom of glucose was tagged with 14C so that after one cycle of glycolysis and Krebs’ cycle none of the radioactive C-atom is found in intermediates? (a) C-6 (b) C-1 (c) C-3 (d) C-2 62. The electrons that enter the electron transport system are carried there by: (a) NADH (b) FADH2 (c) Both (d) None of these 63. The electron transport system is located in the: (a) Stroma (b) Matrix (c) Cytosol (d) Cristae 57. (b)

58. (a)

59. (d)

60. (a)

61. (c)

62. (c)

Respiration and Photorespiration

64. Which of the following statement correctly describes the relationship between the Krebs’ cycle and electron transport pathways? (a) The Krebs’ cycle releases IV used by the electron transport (b) The electron transport pathway obtains electrons from the CO 2 produced by the Krebs’ cycle (c) ATP produced by the Krebs’ cycle derives electron transport and formation of a lit gradient (d) NADH produced by the Krebs’ cycle is used to make ATP by electron transport 65. All of the following electron carriers are components of the mitochondrial electron transport chain export: (a) Nicotinamide-adenine dinucleotide (b) Nicotinamide-adenine dinucleotide phosphate (c) Flavin mononucleotide (d) Flavin-adenine dinucleotide 66. All of the following statement about NAD+ are ture except: (a) NAD+ is reduced to NADH during both glycolysis and the Krebs’ cycle (b) NAD + has more chemical energy than NADH (c) NAD + is reduce by the action of anzymes called dehydrogenases (d) NAD+ can receive electron or used in oxidative phosphorylation 67. Electrons from NADH enter the mitochondrial electron transport chain at the level of: (a) Coenzyme Q (b) NADH-Q reductase (complex I) (c) CoH2-cytochrome-C reductase (complex III) (d) cytochrome-C oxidase (complex IV) 68. ATP synthetase is multifunctional enzyme with a subunit constitution of Ans.

64. (d)

65. (c)

66. (d)

67. (b)

68. (c)

177

the pair constituent subunits taking part in nucleotide binding and catalysis is: (a) a11 (b) a12 (c) a33 (d) a44 69. Some of the free energy released in the mitochondrial electron transport chain can be harnessed to the formation of ATP. How many moles of ATP can be formed per mole-pair of electrons transferred from NADH to oxygen? (a) 0 (b) 1 (c) 2 (d) 2.5 70. In aerobic cellular respiration, which generates more ATP substrate level phosphorylation or chemiosmosis? (a) Substrate level phosphorylation (b) Chemiosmosis (c) Both generate the same amount of ATP (d) Neither generates any ATP 71. The uncoupling of oxidative phosphorylation in a mitochondrial system describes which of the following actions? (a) The phosphorylation of ADP continues but oxygen uptake stops (b) The phosphorylation of ADP stops but oxygen uptake continues (c) Oxygen uptake stops (d) The phosphorylation of ADP to ATP accelerates 72. Uncoupling of oxidative phosphorylation implies that (a) The ATPase activity of mitochondria is abolished (b) The mitochondria cease to oxidize succinate (c) ATP formation ceases but respiration continues (d) ATP formation continue but respiration ceases 69. (d)

70. (b)

71. (b)

72. (c)

178

Plant Physiology: Question Bank

73. DCCD is a reagent that reacts with Asp residue. The addition of DCCD blocks the ATP synthesizing activity FoF 1ATPase by inhibiting the: (a) Flow of protons by F0 (b) Binding of ADP with beta subunits (c) Release of ATP from beta subunit (d) Protonation and deprotonation of alpha subunit 74. It is possible for variety of substrates to use a common pathway for the transfer of electrons to oxygen because: (a) The substrates are oxidized in the mitochondria (b) Many of the substrates are oxidized by enzymes linked to oxidized NAD+ or FAD (c) The substrates are all oxidized by the same enzymes (d) None of the above 75. The electrons from all substrates are transferred to the common acceptor, ATP. The place in the mitochondrion where pH is lower during aerobic respiration in the: (a) Matrix (b) Cytosol (c) Intermembrane space (d) Mitochondrial ribosome 76. Pumping of H+ across the inner membrane, from the matrix space to inter membrane space in mitochondria cause: (a) Lower pH in matrix than in cytosol (b) Higher pH in matrix than in cytosol (c) Both (a) and (b) (d) None of the above 77. In the chemiosmatic hypothesis for energy generation in mitochondria: (a) Electron transport carriers set up a proton gradient (b) A pH gradient drives the hydrolysis of ATP to ADP (c) ATP must be continually translocated into the mitochondria Ans.

73. (a)

74. (b)

75. (c)

76. (b)

77. (a)

(d) Electron transport carriers, use energy of moving electron in up hill direction to form ATP 78. In ATP synthase, F0 acts as: (b) Cl– carrier (a) H+ channel (c) Electron carrier (d) ATPase 79. F1 ATPase, part of ATP synthase synthesize ATP when proton passes through it: (a) Against their electrochemical proton gradient (b) Down their IC+ gradient (c) Down their electrochemical proton gradient (d) All of the above 80. Which statement about ATP synthesis is false? (a) ATP is synthesized only in chloroplast and mitochondria (b) ATP synthesis in the chloroplast occurs thylakoid region of this organelle (c) Proton motive force (proton gradient) drives the formation of ATP in mitochondria (d) ATP synthesis are protein complexes that allow protons to cross membrane 81. Essential elements are: (a) Required for normal reproduction (b) Not replaceable by other elements (c) Not directly involved with metabolism (d) Required only in those processes leading to increased growth 82. Which of the following is an incorrect match of the essential element and function? (a) Mn-structural component of chlorophyll (b) Ca-component of the middle lamella (c) Zn-enzyme activator (d) Fe-component of ferredoxin 78. (a)

79. (c)

80. (a)

81. (a)

82. (a)

Respiration and Photorespiration

(b) Causing methane gas to be consumed (c) Causing methane gas to be produced (d) Causing antibiotic production in bacteria which leads to antibiotic resistance

83. Legume root nodules contain leghaemoglobin. Its function is to regulate: (a) Expression of nif genes (b) Dinitrogenase activity (c) Oxygen supply (d) Nodule growth 84. How many ATP are required for the conversion of one N2 to 2NH4 during biological nitrogen fixation? (a) 8 ATP (b) 10 ATP (c) 12 ATP (d) 16 ATP 85. Carnivorous adaptation of plants mainly compensate for soil that has a relatively low content of: (a) K (b) N2 (c) PO4 (d) Ca 86. Which of the following is not correct about nitrogen fixation? (a) It requires metabolic energy (b) Carried out only by few prokaryotic organism termed Diazatrophs (c) Enzyme that catalyses the reduction of nitrogen is taked nitrcgenase complex (d) None of the above 87. Nitrogen fertilizers disrupt ecosystem structure and function by: (a) Promoting heterotrophic growth causing an imbalance in CO2 levels (b) Decreasing filamentous fungal development which causes loss of soil crumb structure and subsequent soil fertility (c) Causing more antibiotic producing bacteria to grow and produce antibiotics which stunt the growth of plants (d) Reducing the number of nitrogen fixing bacteria in soils 88. Addition of nitrogen-containing fertilizers affects gas exchange processes in the soil: (a) Resulting in release of NO and N20 which are greenhouse gasses Ans.

83. (c)

84. (d)

85. (b)

86. (b)

87. (b)

179

89. The reservoir for nitrogen is: (a) The atmosphere (b) Rocks (c) Ammonia (d) Nitrates 90. Biological Nitrogen Fixation (BNF) occurs when atmospheric nitrogen is converted into ammonia by an enzyme called: (a) Ammonia synthase (b) Nitrogenase (c) ATPase (d) Glutamate synthase 91. Choose the mismatch: Mineral Function nutrient (a) B Cell elongation (b) MO N2 fixation (c) Na C3 pathway (d) Cl Photosynthesis of water 92. Conversion of NO–3 to NO–2 occurs in plant cells: I. Occur in the cytosol. II. Catalyzed by nitrate reductase. III. Requires MO and FAD as cofactor. IV. Reduced ferredoxin acts as electron donor. Which of the following is correct? (a) I and IV (b) I, II and III (c) I, II, III and IV (d) II Only 93. Which of the following statement is correct about nitrate reductase? (a) FAD, Mo and haeme act as prosthetic groups (b) Catalyzes conversion of NO –3 to NH+4 (c) FADH2 acts as electron donor (d) Very sensitive to O2 88. (a)

89. (a)

90. (b)

91. (c)

92. (b)

93. (a)

180

Plant Physiology: Question Bank

94. Match list I with list II and select the correct answer using the codes given below the lists. List I

List II

A. The amount of energy 1. accumulation in green plants through the process of photosynthesis B. The total organic matter 2. synthesized by the producers in the process of photosynthesis per unit time and area C. Rate of storage of organic 3. matter inplant tissues in excess of the respiratory utilization during the measurement period D. Rate of energy storage 4. at consumer level

Codes A (a) 1 (b) 2 (c) 1 (d) 2

B 2 1 3 1

Gross primary productivity Primary productivity

Secondary productivity

Net primary productivity

D 4 4 2 3

95. Consider the following statements. I. Copper is present in cytochrome oxidase II. Pantothine pyrophosphate is the precursor of coenzyme A III. Thiamine pyrophosphate is the prosthetic group in decarboxylases IV. Zinc is present in RNA and DNA polymerases Which of these statements are correct? (a) I and II (b) II, III and IV (c) I,II, III and IV (d) I, III and IV 96. Match list I with list II and select the correct answer using the codes given below the lists. List II

A. Nitrogen fixation B. Denitrification

Ans.

94. (d)

NH+4

1. Conversion of into nitrite and nitrate 2. Conversion of nitrite or nitrate into atmospheric nitrogen

95. (a)

3. Conversion of atmospheric nitrogen into ammonia 4. Conversion of organic nitrogen into ammonia

D. Ammonification

Codes A (a) 3 (b) 2 (c) 3 (d) 3

B 2 1 2 2

C 1 3 4 1

96. (a)

97. (a)

98. (b)

D 4 4 1 4

97. Match list I with list II and select the correct answer using the codes given below the lists. List I

C 3 3 4 4

List I

C. Nitrification

List II

A. Conversion of glucose to 1. Krebs’ cycle pyruvate B. Conversion of pyruvate 2. Electron transport to acetyl coA system C. Breakdown of acetyl3. Glycolysis to yield CoA reduced coenzymes D. Synthesis of ATP 4. Oxidative decarboxylation

Codes A (a) 3 (b) 2 (c) 3 (d) 3

B 2 1 2 2

C 1 3 4 1

D 4 4 1 4

98. Match list I with list II and select the correct answer using the codes given below the lists. List I

List II

A. Biotin B. Coenzyme-A C. Thymine pyrodiphosphate D. Uridine

Codes A (a) 1 (b) 1 (c) 4 (d) 1

1. Carboxylation 2. Active aldehyde transfer 3. Sugar transfer 4. Acetyl group transfer

B 4 4 1 4

C 2 3 2 3

D 3 2 3 2

Respiration and Photorespiration

99. Which of the following statement is correct? I. Electron transport generates the proton motive force. II. Peroxisomal of fatty acid generates no ATP. III. Proton motive force in mitochondria is largely due to voltage gradient across the membrane. IV. Total of 10 H+ are translocated from the matrix across the inner membrane per electron pair moving from NADH to O2. (a) I and II (b) I and III (c) I, II and III (d) I, II, III and IV 100. Consider the following: I. Cytochrome b6 II. Cytochrome f III. Plastocyanin IV. Plastoquinone What is the sequence of these in the photoinduced electron carriers between PS II and PS I in photosynthesis? (a) IV,I,II and III (b) III,IV,I and II (c) I, II, III and IV (d) II, III, IV and I 101. Match list I with list II and select the correct answer using the codes given below the lists. List I

List II

A. Peripheral reticulum B. RuB-carboxylaseoxygenase C. CO2 fixation in the dark D. Cyclic photophosphorylation

Codes A (a) 1 (b) 2 (c) 4 (d) 3 Ans.

B 4 5 1 5

C 3 4 2 1

1. C3 plants 2. CAM plants 3. Photosystem I 4. C4 plants 5. Photosystem

D 2 1 3 3

181

102. Which of the following are ture? I. NADH yields less ATP than FADH2. II. More NADH is produced in the Krebs’ cycle than in glycolysis. III. The final acceptor of electrons is ATP synthase. IV. ETS pumps H+ into the intermembrane space. (a) I only (b) I and II (c) II and IV (d) I,II and IV 103. Anaerobic respiration and fermentation are alike processes which share the following features: (a) Same respiratory substrates (b) Same intermediates (c) Same enzyme zymase (d) All the above 104. Anaerobic respiration differs from fermentation in that: (a) Former is intracellular while latter is both extracellular and intracellular (b) In former, final electron acceptors are inorganic compounds while in the latter final the can acceptors are organic molecules (c) In the former no effervescence takes place while in the latter it does occur (d) They have all the above features 105. Glycolysis is also called: (a) EMP pathway (b) Pentose phosphate pathway (c) Gluconeogenesis (d) Citric acid cycle 106. Glycolysis is oxidative breakdown of sugar glucose to pyruvic acid which involves (a) Oxidation by molecular oxygen (b) Oxidation by dehydrogenation (c) Oxidation by molecular oxygen and dehydrogenation (d) Oxidation by removal of electrons

99. (c) 100. (d) 101. (c) 102. (c) 103. (d) 104. (d) 105. (a) 106. (b)

182

Plant Physiology: Question Bank

107. Glycolysis involves following events: (a) Phosphorylation and isomerization (b) Phosphorylation and splitting of hexose sugar (c) Phosphorylation and isomerization, hexose splitting, oxidation and dehydration (d) Phosphorylation and hexose splitting, oxidation and dehydration 108. Oxidation by dehydrogenation takes place in glycolysis in between: (a) 1-3 diphosphoglyceraldehyde and 1-3 diphosphoglyceric acid (b) 1-3 diphosphoglyceraldehyde and 3 phosphoglyceric acid (c) Phosphoenol pyruvic acid and pyruvic acid (d) 3 phosphoglyceraldehyde to 1-3 diphosphoglyceraldehyde 109. Link reaction takes place in: (a) Cytoplasm (b) Mitochondria (c) Chloroplast (d) Both cytoplasm and mitochondria 110. Link reaction is a part of: (a) Glycolysis (b) Krebs cycle (c) E transport system (d) None of the above 111. Conversion of pyruvic acid into acetyl CoA requires: (a) Mg++, coenzyme A and NAD+ (b) Mg++, TPP and lipoic acid (c) TPP, NAD+, Mg++ lipoic acid (d) Mg++, TPP, NAD+, CoA, lipoic acid 112. Substrate level phosphorylation in glycolysis takes place between: (a) 1-3 diphosphoglyceric acid and 3 phosphoglyceric acid (b) Phosphoenol pyruvic acid and pyruvic acid (c) (a) and (b) both (d) 1-3 diphosphoglyceraldehyde and 1-3 diphosphoglyceric acid 113. The first product of Krebs cycle is: (a) Citric acid

(b) Cis-asconitic acid (c) Oxalo succinic acid (d) Phosphoglyceric acid 114. Tricarboxylic acid cycle was discovered by: (a) Hans Krebs (b) R. Hill (c) Emerson (d) Emerson and Lewis 115. First product of Krebs cycle is: (a) A dicarboxylic acid (b) Monocarboxylic acid (c) Tricarboxylic acid (d) Tetracarboxylic acid 116. Krebs cycle is also called: (a) Catabolic process (b) Anabolic process (c) Amphivolic process (d) Physical catabolic process 117. Substrate level phosphorylation takes place in Krebs cycle in between: (a) Succinyl CoA and succinic acid (b) Succinic acid and fumaric acid (c) Fumaric acid and malic acid (d) Malic acid and oxaloacetic acid 118. Oxidation by dehydrogenation in Krebs cycle takes place between: (a) Pyruvic and acetyl CoA (b) Isocitric acid and oxalosuccinic acid (c) -ketoglutaric acid and succinyl CoA (d) Both (b) and (c) 119. In Krebs cycle: (a) 4-molecules of NADH + H + are produced (b) 3-molecules of NADH + H + are produced (c) 5-molecules of NADH + H + are produced (d) 4-molecules of NADH + H+ and 1 molecule of FADH2 are produced 120. According to recent theory cytocolic NADH + H+ on oxidation by ETS in plants produces:

Ans. 107. (c) 108. (a) 109. (b) 110. (d) 111. (d) 112. (c) 113. (a) 114. (a) 115. (c) 116. (c) 117. (a) 118. (d) 119. (b)

Respiration and Photorespiration

(a) 3 molecules of ATP each molecule oxidized (b) 2 molecules of ATP each molecule oxidized (c) 4 molecules of ATP each molecule oxidized (d) 1 molecule of ATP each molecule oxidized 121. When carbohydrate serves as respiratory fuel, that respiration is called: (a) Protoplasmic respiration (b) Floating respiration (c) Induced respiration (d) Gluconeogenesis 122. When damaged fat is oxidised in presence of carbohydrate in non-oily tissues, is called: (a) Induced respiration (b) Protoplasmic respit Ltion (c) Floating respiration (d) Gluconeogenesis 123. When immediate substrate of floating respiration is a diose sugar, it is called: (a) Induced respiration (b) Photorespiration (c) Normal respiration (d) Protoplasmic respiration 124. Penrose phosphate pathway is a: (a) Direct oxidative pathway (b) Indirect oxidative pathway (c) Direct reductive pathway (d) Indirect reductive pathway 125. During fasting: (a) Induced respiration takes place (b) Protoplasmic respiration takes (c) Floating respiration takes place (d) Photorespiration takes place 126. Freshly sliced potato tubers shows enhanced rate of respiration due to: (a) Enhanced photorespiration (b) Floating respiration (c) Enhanced protoplasmic respiration (d) Induced respiration

183

127. The ratio of CO 2 evolved and O 2 utilized in a biological process is called: (a) Photosynthetic quotient (b) Respiratory quotient (c) Temperature coefficient (d) Rf value of gas 128. In anaerobic respiration the value of RQ will be: (a) 1 (b) Infinite (c) Less than 1 (d) More than 1 129. The value of RQ can be had from: (a) Respirometer (b) Photosynthetometer (c) Photometer (d) Respiroscope 130. Closed young buds respire by: (a) Aerobic respiration (b) Anaerobic respiration (c) Induced respiration (d) All the above 131. Anaerobic respiration and fermentation are alike processes which share the following features: (a) Same respiratory substrates (b) Same intermediates (c) Same enzyme zymase (d) All the above 132. Anaerobic respiration differs from fermentation in that: (a) Former is intracellular while latter is both extracellular and intracellular (b) In former, final electron acceptors are inorganic compounds while in the latter final the electron acceptors are organic molecules (c) In the former no effervescence takes place while in the latter it does occur (d) They have all the above features 133. Glycolysis is also called: (a) EMP Pathway (b) Pentose phosphate pathway (c) Giuconeogenesis (d) Citric acid cycle

Ans. 120. (b) 121. (a) 122. (a) 123. (b) 124. (a) 125. (b) 126. (d) 127. (b) 128. (b) 129. (a) 130. (b) 131. (d) 132. (d) 133. (a)

184

Plant Physiology: Question Bank

134. Glycolysis is oxidative breakdown of sugar glucose to pyruvic acid which involves: (a) Oxidation by molecular oxygen (b) Oxidation by dehydrogenation (c) Oxidation by molecular oxygen and dehydrogenation (d) Oxidation by removal of electrons 135. Glycolysis involves following events: (a) Phosphorylation and isomerization (b) Phosphorylation and splitting of hexose sugar (c) Phosphorylation and isomerization, hexose splitting, oxidation and dehydration (d) Phosphorylation and hexose splitting, oxidation and dehydration 136. Oxidation by dehydrogenation takes place in glycolysis in between: (a) 1-3 diphosphoglyceraldehyde and 1-3 diphoshoglyceric acid (b) 1-3 diphosphoglyceraldehyde and 3 phoshoglyceric acid (c) Phosphoenol pyruvic acid and pyruvic acid (d) 3 phosphoglyceraldehyde to 1-3 diphosphoglyceraldehyde 137. Link reaction takes place in: (a) Cytoplasm (b) Mitochondria (c) Chloroplast (d) Both cytoplasm and mitochondria

140. Substrate level phosphorylation in glycolysis takes place between: (a) 1-3 diphosphoglyceric acid and 3 phosphoglyceric acid (b) Phosphoenol pyruvic acid and pyruvic acid (c) A and B (d) 1-3 diphosphoglyceraldehyde and 1-3 diphosphoglyceric acid 141. The first product of Krebs cycle is: (a) Citric acid (b) Cis-aconitic acid (c) Oxalosuccinic acid (d) Phosphoglyceric acid 142. The very first step in the formation of acetyl CoA is the: (a) Formation of a complex between thiamine pyrophosphate and pyruvate (b) Release of the acetyl group from lipoic acid to CoA (c) Decarboxylation of pyruvate (d) Transfer of electrons from reduced lipoic acid to NAD+ 143. During aerobic respiration the substrate level phosphorylation takes place in: (a) Cytoplasm only (b) Mitochondria only (c) Cytoplasm and mitochondria (d) Cytoplasm and Golgi complex

138. Link reaction is a part of: (a) Glycolysis (b) Krebs cycle (c) E transport system (d) None of the above

144. The membrane bound enzyme involved in Krebs cycle in mitochondria is: (a) Malate dehydrogenase (b) Fumarase (c) Succinate dehydrogenase (d) Cisaconitase

139. Conversion of pyruvic acid into acetyl CoA requires (a) Mg++, coenzyme A and NAD+ (b) Mg++, TPP, and lipoic acid (c) TPP, NAD+, Mg++ lipoic acid (d) Mg++, TPP, NAD+, CoA, lipoic acid

145. In which component of mitochondria is ATP synthesized: (a) Cista (b) Matrix (c) Oxysome (d) Outer membrane

Ans. 134. (b) 135. (c) 136. (a) 137. (b) 138. (d) 139. (d) 140. (c) 141. (a) 142. (a) 143. (c) 144. (c) 145. (c)

Respiration and Photorespiration

146. The first dicarboxylic acid formed in Krebs cycle is: (a) Succinic acid (b) Fumaric acid (c) -ketoglutaric acid (d) malic acid 147. Total ATP production during EMP pathway is: (a) 24 ATP molecule (b) 8 ATP molecule (c) 38 ATP molecule (d) 6 ATP molecule 148. Glycolysis operates in (or the site of glycolysis in a cell is): (a) Golgi body (b) Protoplasm (c) Chloroplast (d) Mitochondria 149. The net gain of ATP molecules in glycolysis is: (a) 3 (b) 4 (c) 2 (d) 1 150. Enzymes taking part in glycolysis are present in: (a) Mitochondria (b) Cytoplasm (c) Both a and b (d) Vacuole 151. The number of molecule of pyruvic acid formed from one molecule of glucose at the end of glycolysis is: (a) 1 (b) 2 (c) 3 (d) 4 152. The enzyme which converts glucose to glucose-6-phosphate is: (a) Hexokinase (b) Phosphorylase (c) Glucose synthetase (d) Glucose-6-phosphate 153. The end product of glycolysis is (or which one of the following product is formed during glycolysis of glucose): (a) Glucose (b) Citric acid (c) Pyruvic acid (d) None of these 154. The intermediate compound common for aerobic and anaerobic respiration is: (a) PGA (b) Acetic acid (c) Pyruvic acid (d) Succinic acid

185

155. Respiratory enzyme are located in: (a) Mitochondria (b) Cristae (c) Outer membrane (d) Perimitochondrial space 156. The oxidation of glucose of pyruvates and their subsequent breakdown is brought about by: (a) Electron transfer system (b) Respiratory enzyme system (c) Cyclic electron system (d) Respiratory phosphorylation 157. Oxidative phosphorylation occurs in: (a) Inner membrane of mitochondria (b) Stroma of chloroplast (c) Gram of chloroplast (d) Outer membrane of mitochondria 158. Oxidative phosphorylation is formation of: (a) NADPH2 in respiration (b) ATP in respiration (c) NADPH2 in photosynthesis (d) ATP in photosynthesis 159. Which of the following oxidative phosphorylation occurs during electron transport? (a) Mitochondria (b) Ribosome (c) Chloroplast (d) Glyoxysome 160. Oxidative phosphorylation involves simultaneous oxidation and phosphorylation to finally form: (a) NADP (b) DPN (c) ATP (d) Pruvate 161. Pyruvate dehydrogenase is used in converting: (a) Pyruvate to glucose (b) Glucose to pyruvate (c) Pyruvic acid to lactic acid (d) Pyruvate to acetyl CoA 162. Which is the connecting link between glycolysis and Krebs cycle? (a) Pyruvic acid (b) Cytochrome (c) Oxaloacetic acid (d) Acetyl CoA

Ans. 146. (c) 147. (b) 148. (b) 149. (c) 150. (b) 151. (b) 152. (a) 153. (c) 154. (c) 155. (a) 156. (d) 157. (a) 158. (b) 159. (a) 160. (c) 161. (d) 162. (d)

186

Plant Physiology: Question Bank

163. Which of the following processes is used in the conversion of pyruvate to acetyl CoA: (a) Oxidative dehydration (b) Oxidative phosphorylation (c) Oxidative decarboxylation (d) Oxidative dehydrogenation 164. The formation of Acetyl coenzyme A from pyruvic acid is the result of its: (a) Reduction (b) Dehydration (c) Dephosphorylation (d) Oxidative decarboxylation 165. Which of the following is important in carbohydrate and fat metabolism? (a) Carbon dioxide (b) Acetyl coenzyme A (c) Pyruvic acid (d) Citric acid 166. Organelles which are regarded as “power house” of the cell and in which the oxidative reaction of the respiratory process takes place are: (a) Chloroplasts (b) Ribosome (c) ER (d) Mitochondria 167. The number of ATP molecules released in the complete oxidation of one molecule of pyruvic acid is (or upon the oxidation of the one mole of pyruvate by mitochondrial respiration, the moles of ATP generated are): (a) 2 (b) 8 (c) 15 (d) 30 168. Which of the following is the site of respiration within the cell? (a) Ribosomes (b) Nucleus (c) Golgi body (d) mitochondria 169. Select the true statement: I. NADH yields less ATP than FADH2+ II. More NADH is produced in the Krebs+ cycle than in Glycolysis III. The final acceptor of electrons is ATP synthase IV. ETS pumps H+ into the intermembrane space

(a) I, II and IV (b) II and IV (c) II and III (d) Only I 170. Which of the following statement is correct? I. Electron transport generates the proton motive force. II. Peroxisomal oxidation of fatty acids generates no ATP. III. Proton motive force in mitochondria is largely due to voltage gradient across the membranes IV. Total of 10 H + are translocated from the matrix across the inner membrane per electron pair moving from NADH to O2– (a) I, II, III and IV (b) I, II and III (c) I and II (d) I and III 171. Match list–I with list–II and select the correct answer using the codes given below the lists: List–I A. Biotin B. Coenzyme–A

1. 2.

C. Thymine pyrophosphate 3. D. Uridine diphosphate 4.

List–II Carboxylation Active aldehyde transfer Sugar transfer Acyl group transfer

Codes: A B C D A B C D (a) 4 1 3 2 (b) 4 1 2 3 (c) 1 4 3 2 (d) 1 4 2 3 172. Match list–I with list–II and select the correct answer using the codes given below the lists:

List–I List–II A. Conversion of glucose to 1. Krebs’ Cycle pyruvate B. Conversion of pyruvate 2. Electron Transport to acetyl Co–A system C. Breakdown acetyl–Co–A 3. Glycolysis to yield reduced coenzymes D. Synthesis of ATP 4. Oxidative decarboxylation

Codes: A B C D (a) 3 1 4 2 (c) 3 4 2 1

A B C D (b) 4 3 2 1 (d) 3 4 1 2

Ans. 163. (c) 164. (d) 165. (b) 166. (d) 167. (c) 168. (d) 169. (b) 170. (b) 171. (c) 172. (d)

Respiration and Photorespiration

173. Consider the following statements: I. Copper is present in cytochrome oxidase II. Pantothenic acid is the precursor of Co–enzyme A III. Thiamine pyrophosphate is the prosthetic group in decarboxylation IV. Zinc is present in RNA and DNA polymerases Select the correct statements: (a) I, III and IV (b) I, II, III and IV (c) II, III and IV (d) I and II 174. Match list–I with list–II and select the correct answer using the codes given below the lists:

List–I A. The amount of energy accumulation in green plants through the process of photosynthesis B. The total organic matter synthesized by the producers in the process of photosynthesis per unit time and area C. Rate of the storage of organic matter in plant tissues in excess of the respiratory utilization D. Rate of energy storage at consumer level

List–II 1. Gross primary productivity

2. Primary productivity

3. Secondary productivity 4. Net primary productivity

Codes: A B C D A B C D (a) 2 1 4 3 (b) 1 3 4 2 (c) 2 1 3 4 (d) 1 2 3 4 175. Select the correct statement regarding nitrate reductase among the following: (a) Very sensitive to O2 (b) FADH2 acts as electron donor (c) Catalyses conversion of NO 3 - to NH4+ (d) FAD, Mo and haeme act as prosthetic group 176. Conversion of NO3+ to NoO2– occurs in the plants cells: I. Occur in cytosol. II. Catalyzed by nitrate reductase. III. Requires Mo and FAD as cofactor. IV. Reduced ferredoxin acts as electron donor

187

Which of the following is correct? (a) I, II, III and IV (b) Only II (c) I, II and III (d) I and IV 177. Which statement regarding ATP synthesis is false? (a) ATP synthesis are protein complexes that allows protons to cross membrane (b) Proton motive force (proton gradient) derives the formation of the ATP in mitochondria (c) ATP synthesis in the chloroplast occurs in the thylakoid region of this organelle (d) ATP is synthesized only in chloroplast and mitochondria 178. F1 ATPase, part of ATP synthase synthesizes ATP when proton process through it: (a) Down their electrochemical proton gradient (b) Against their electrochemical proton gradient (c) Gown their K+ gradient (d) All of the above 179. In ATP synthase, F0 acts as: (a) ATPase (b) Electron carrier (c) CI– carrier (d) H+ channel 180. In the chemosmatic hypothesis for energy generation in the mitochondria: (a) Electron transport carriers, use energy of moving electron in uphill direction to from ATP (b) ATP must be continually translocated into mitochondria (c) Electron transport carriers set up a proton gradient (d) A pH gradient derives the hydrolysis of ATP to ADP 181. Pumping of H + across the inner membrane, from the matrix space to inter membrane space in mitochondria cause: (a) Higher pH in matrix than in cytosol (b) Lower pH in matrix than in cytosol (c) Both (a) and (b) (d) None of these

Ans. 173. (d) 174. (a) 175. (d) 176. (c) 177. (d) 178. (a) 179. (d) 180. (c) 181. (a)

188

Plant Physiology: Question Bank

182. The electrons from all substrates are transferred to the common acceptor, ATP. The place in the mitochondrion where the pH is lower during aerobic respiration in the: (a) Mitochondrial ribosome (b) Intermembrane space (c) Cytosol (d) Matrix 183. It is possible for variety of substrates to use a common pathway for the transfer of electrons to oxygen because: (a) The substrates are all oxidized by the same enzymes (b) The substrates are oxidized in the mitochondria (c) Many of the substrates are oxidized in the mitochondria (d) None of the above 184. DCCD is a reagent that reacts with Asp residue. The addition of DCCD blocks the ATP synthesizing activity F 0F 1– ATPase by inhibiting the: (a) Protonation and deprotonation of alpha subunit (b) Release of ATP from beta subunit (c) Binding the ADP with beta subunits (d) Flow of protons by F0 185. Some of the free energy released in the mitochondrial electron transport chain can be harnessed to the formation of ATP. How many moles of ATP can be formed per mole–pair of electrons transferred from NADH to oxygen? (a) 2.5 (b) 2 (c) 1 (d) 0 186. ATP synthase is multifunctional enzyme with a subunit constitution of  3 3Y . The pair constituent subunits taking part in nucleotide binding and catalysis is: (b) 33 (a) 44 (c) 22 (d) 11 187. Electrons from NADH enter the mitochondrial electron transport chain at the level of: (a) Cytochrome–c oxidase (Complex IV)

(b) C 0 H 2 –cytochrome–c reductase (Complex III) (c) NADH – Q reductase (Complex I) (d) Coenzyme Q 188. All of the following statement regarding NAD+ are true except: (a) NAD+ can receive electrons for use in oxidative phosphorylation (b) NAD + reduced by the action of enzymes called dehydrogenasees (c) NAD + has more chemical energy than NADH (d) NAD + reduced to NADH during both glycolysis and the Krebs’ cycle 189. All of the following electron carriers are components of the mitochondrial electron transport chain expect: (a) Flavin–Adenine Dinucleotide (b) Flavin Mononucleotide (c) Nicotinamide–Adenine Dinucleotide phosphate (d) Nicotinamide–Adenine Dinucleotide 190. Which of the following statement correctly describes the relationship between the Krebs cycle and electron transport pathways? (a) NADH Produced by Krebs cycle is used to make ATP by electron transport (b) ATP produced by the Krebs cycle drives electron transport and the formation of a H+ gradient (c) The electron transport pathway obtains electrons from the CO 2 produced by the Krebs cycle (d) The Krebs cycle releases H+ used by the electron transport 191. The electrons that enter the electron transport system are carried there by: (a) FADH2 (b) NADH (c) Both A and B (d) None of these 192. Which of the following citric acid cycle products is disposed of by our respiratory system when we exhate? (b) NADH (a) FADH2 (c) ATP (d) CO2

Ans. 182. (b) 183. (c) 184. (d) 185. (a) 186. (b) 187. (c) 188. (a) 189. (b) 190. (a) 191. (c) 192. (d)

Respiration and Photorespiration

(c) ATP in respiration (d) ADPH2 in respiration

CHECK YOUR GRASP

1. Anaerobic respiration of the glycolysis is also called: (a) Fermentation (b) Restoration (c) Fragmentation (d) Multiplication 2. Net gain of ATP molecules during aerobic reaction is: (a) 36 molecules (b) 38 molecules (c) 46 molecules (d) 46 molecules 3. A molecules of acetyl coenzyme A has carbon atoms numbering: (a) 3 (b) 4 (c) 2 (d) 4 4. Pyruvic acid formed in glycolysis is produced to CO2 and H2O in a cycle called: (a) Hill reaction (b) Krebs cycle (c) Calvin cycle (d) Nitrogen cycle 5. Pyruvic acid is produced it the end of which of the following: (a) Calvin cycle (b) Glycolysis (c) Krebs cycle (d) Sulfur cycle 6. The end products of respiration in plants: (a) Sugar and O2 (b) H2O and energy (c) CO2, H2O and energy (d) Starch and O2 7. The intermediate compound that connect glycolysis of Krebs cycle is: (a) Oxalic acid (b) Acetyl coA (c) Pyruvic acid (d) Citric acid

189

10. Cyanides resistant respiration characteristic of: (a) Plants (b) Viruses (c) Bacteria (d) Animals 11. Ethylene is involved in: (a) Aerobic respiration (b) Climacteric respiration (c) Anaerobic respiration (d) Fermentation 12. The site of EM Pathway in all is: (a) Cytoplasm (b) Matrix of mitochondrion (c) Peroxisome (d) Inner membrane of mitochondrion 13. A sudden change from anaerobic to aerobic process is called: (a) Chargaff rule (b) Pasteur effect (c) Emersan’s effect (d) Blackman’s law 14. The energy liberated during the conversion of ATP into ADP is: (a) 730 cal (b) 7300 cal (c) 73000 cal (d) 71000 cal 15. The oxidation of one NADH2 yields: (a) 2ATP (b) 3ATP (c) 38 ATP (d) 36 ATP 16. RQ is more than one in case of: (a) FAT (b) Glucose (c) Fructose (d) Organic acid

8. One mode of glucose through aerobic respiration products: (a) 32 ATP (b) 36 ATP (c) 38 ATP (d) 42 ATP

17. The number of oxidations involving NADH in Krebs cycle is: (a) 2 (b) 3 (c) 4 (d) 5

9. An oxidation phosphorylation is the formation of: (a) ATP in photosynthesis (b) NADPH2 in photosynthesis

18. The enzymes that convert glucose to glucose 6-phosphate is: (a) Phosphatase (b) Hexokinase

Ans.

1. (a) 12. (a)

2. (a) 13. (b)

3. (c) 14. (b)

4. (b) 15. (b)

5. (b) 16. (d)

6. (c) 17. (b)

7. (b) 18. (b)

8. (c)

9. (c)

10. (a)

11. (b)

190

Plant Physiology: Question Bank

(b) 8 ATP molecule (c) 38 ATP molecule (d) 6 ATP molecule

(c) Phosphorylase (d) Glucose synthetose 19. The amount of energy released during the hydrolysis of a high energy bond of ATP is: (a) 73 kcl/mole (b) 0.73 Kcl/mole (c) 7.3 kcl/mole (d) 3.4 Kcl/mole 20. Cynlde kills the plants by: (a) By interfering in respiratory and food mechanism (b) By increasing transpiration (c) Reducing water potential (d) Reducing the water uptake 21. The formula for the process of glycolysis is: (a) 2H2O + 6CO2  C6H12O6 + 6O2 (b) C6H12O6  2C3H4O3 + 4H (c) C6H12O6 + 6CO2  6CO2 + 6H2O (d) None of these 22. Electron transport system in mitochondria is located in: (a) Outer membrane (b) Intracrista space (c) Inner membrane space (d) Inner membrane 23. Last electron called receptor is called: (b) CO2 (a) H2 (c) O2 (d) NADH2 24. During fermentation in yeast cell alcohol is fermented from: (a) Sugar (b) CO2 (c) Protein (d) Nucleus 25. The mechanism of ATP formation both in chlorophyll as well as mitochondria is explained by: (a) Relay pump theory of Godiewski (b) Munch’s pressure/mass flow model (c) Chemiosomotic theory of Mitchell (d) Cholodny wents model 26. Total ATP production during EMS pathway is: (a) 24 ATP molecule Ans.

19. (c) 30. (b)

20. (a) 31. (a)

21. (b) 32. (c)

22. (d) 33. (c)

23. (c) 34. (a)

27. Glycolysis operates in (or the site of glycolysis in a cell is): (a) Golgi body (b) Protoplasm (c) Chloroplast (d) Mitochondria 28. The net gain of ATP molecules in glycolysis is: (a) 3 (b) 4 (c) 2 (d) 1 29. Enzymes taking part in glycolysis are present in: (a) Mitochondria (b) Cytoplasm (c) Both a and b (d) Vacuole 30. The number of molecule of pyruvic acid formed from one molecule of glucose at the end of glycolysis is: (a) 1 (b) 2 (c) 3 (d) 4 31. The enzyme which converts glucose to glucose-6-phosphate is: (a) Hexokinase (b) Phosphorylase (c) Glucose synthetase (d) Glucose-6-phosphate 32. The end product of glycolysis is (or which one of the following product is formed during glycolysis of glucose): (a) Glucose (b) Citric acid (c) Pyruvic acid (d) None of these 33. The intermediate compound common for aerobic and anaerobic respiration is: (a) PGA (b) Acetic acid (c) Pyruvic acid (d) Succinic acid 34. Respiratory enzyme are located in: (a) Mitochondria (b) Cristae (c) Outer membrane (d) Perimitochondrial space 35. The oxidation of glucose of pyruvates and their subsequent breakdown is brought about by: (a) Electron transfer system (b) Respiratory enzyme system 24. (a) 35. (d)

25. (c)

26. (b)

27. (b)

28. (c)

29. (b)

Respiration and Photorespiration

(c) Cyclic electron system (d) Respiratory phosphorylation 36. Oxidative phosphorylation occurs in: (a) Inner membrane of mitochondria (b) Stroma of chloroplast (c) Gram of chloroplast (d) Outer membrane of mitochondria 37. Oxidative phosphorylation is formation of: (a) NADPH2 in respiration (b) ATP in respiration (c) NADPH2 in photosynthesis (d) ATP in photosynthesis 38. Which of the following oxidative phosphorylation occurs during electron transport? (a) Mitochondria (b) Ribosome (c) Chloroplast (d) Glyoxysome 39. Oxidative phosphorylation involves simultaneous oxidation and phosphorylation to finally form: (a) NADP (b) DPN (c) ATP (d) Pruvate 40. Pyruvate dehydrogenase is used in converting: (a) Pyruvate to glucose (b) Glucose to pyruvate (c) Pyruvic acid to lactic acid (d) Pyruvate to acetyl CoA 41. Which is the connecting link between glycolysis and Krebs cycle? (a) Pyruvic acid (b) Cytochrome (c) Oxaloacetic acid (d) Acetyl CoA 42. Which of the following processes is used in the conversion of pyruvate to acetyl CoA (a) Oxidative dehydration (b) Oxidative phosphorylation (c) Oxidative decarboxylation (d) Oxidative dehydrogenation 43. The formation of Acetyl CoA from pyruvic acid is the result of its: Ans.

36. (a) 47. (a)

37. (b) 48. (a)

38. (a) 49. (a)

39. (c) 50. (c)

40. (d)

191

(a) Reduction (b) Dehydration (c) Dephosphorylation (d) Oxidative decarboxylation 44. Which of the following is important in carbohydrate and fat metabolism? (a) Carbon dioxide (b) Acetyl CoA (c) Pyruvic acid (d) Citric acid 45. During ATP synthesis, electron pass through (a) Cytochromes (b) Water (d) CO2 (c) O2 46. Which is the final electron acceptor in respiration? (a) Oxygen (b) Hydrogen (c) Cytochrome (d) Dehydrogenase 47. Conversion of oxaloacetic acid to citric acid requires one molecule of: (b) CO (a) H2O (d) CO2 (c) CO3 48. How many ATP will be produced during the production of 1 molecule of acetyl CoA from 1 molecule of pyruvic acid? (a) 3 ATP (b) 5 ATP (c) 8 ATP (d) 38 ATP 49. During conversion of one pyruvic acid molecule into one molecule of acetyl CoA, how many molecules of CO2 are produced: (a) 1 (b) 2 (c) 3 (d) 4 50. Synthesis of ATP in mitochondria takes place: (a) In the matrix (b) At the outer membrance (c) A the crisae (d) In the intracristal space Mark your score and evaluate yourself accordingly 41. (d)

42. (c)

43. (d)

44. (b)

45. (a)

46. (a)

192

Plant Physiology: Question Bank

9

Enzymes and Vitamins 1. The modern system of enzyme classification was introduced by International Union of Biochemistry (IUB) in: (a) 1963 (b) 1962 (c) 1961 (d) None of these

(c) Three dimensional (d) None of the above 8. Iodoacetate is an irreversible inhibitor of the enzyme: (a) Glyceraldehyde 3-phosphate dehydrogenase (b) Papain (c) Both A and B (d) None of these 9. For the majority of enzymes, the Km values are in the range of: (a) 10–6 to 10–3 moles (b) 10–9 to 10–6 moles (c) 10–5 to 10–2 moles (d) None of these 10. Km is not dependent on the concentration of: (a) Substrate (b) Enzyme (c) Both A and B (d) None of these 11. Induced fit model has sufficient experimental evidence from the: (a) Auto radiography (b) Tracer technique (c) X–ray diffraction (d) None of the above 12. When the velocity of reaction is almost proportional to the substrate concentration, the rate of reaction is said to be: (a) Zero order reaction (b) First order reaction (c) Second order reaction (d) None of the above

2. The essential chemical components of many coenzymes are: (a) Carbohydrate (b) Vitamins (c) Protein (d) None of these 3. Proenzyme is the ...... precursor of an enzyme. (a) Inactive (b) Active (c) Both A and B (d) None of these 4. ...... enzymes are thermolabile. (a) Most of (b) All (c) Few (d) None of these 5. A ..... is obtained when velocity is plotted against the substrate concentration. (a) Rectangular parabola (b) Rectangular hyperbola (c) Liner (d) None of these 6. Abzymes were first reported by: (a) James B Sumner (b) Lerner and Tramontano (c) Northrop (d) None of these 7. All the enzymes have a specific ...... structure. (a) One dimensional (b) Two dimensional Ans.

1. (c) 12. (b)

2. (b)

3. (a)

4. (b)

5. (b)

6. (b) 192

7. (c)

8. (c)

9. (a)

10. (b)

11. (c)

Enzymes and Vitamins

13. Which of the following enzymes is known as meat tenderizer because of its continued action even at the high temperature of cooking? (a) Mutases (b) Papain (c) Oxaloacetic acid (d) None of these 14. Mitochondria account for ......% of a cell volume: (a) 30 (b) 50 (c) 70 (d) None of these 15. Allosteric enzymes have: (a) Allosteric sites (b) Active sites (c) Both A and B (d) None of these 16. If an enzyme substrate system has lower value of Km. then binding of substrate to its enzyme will be: (a) Inhibited (b) More stronger (c) Less stronger (d) None of these 17. The enzyme act by: (a) Conserving the energy of activation of the reaction (b) Lowering the energy of activation of the reaction (c) Increasing the energy of activation of the reaction (d) None of the above 18. Most vitamins are: (a) Pressure of the coenzymes (b) Synthesized by humans (c) Covalently linked to enzymes (d) None of the above 19. Pantothenic acid is a constituent of the coenzyme involved in which of the following event: (a) Dehydrogenation (b) Acetylation (c) Reduction (d) Decarboxylation Ans.

13. (b) 24. (d)

14. (c) 25. (c)

15. (c) 26. (a)

16. (b) 27. (b)

17. (b) 28. (c)

193

20. Which of the following coenzyme acts as an electron sink to promote catalysis? (a) Biotin (b) Pyridoxal phosphate (c) Lipoamide (d) CoA 21. Which of the following vitamin can act without phosphorylation? (a) Pyridoxine (b) Niacin (c) Lipoamide (d) Thiamine 22. The deficiency of niacin causes: (a) Color blindness (b) Pellagra (c) Low vision (d) None of these 23. Which of the following is the fat soluble vitamin? (a) Vitamins A (b) Vitamins K (c) Vitamins D (d) All of the above 24. Which of the following is the water soluble vitamin? (a) Pyridoxine (b) Thaimines (c) Cobalamin (d) All of these 25. Which of the following is a cofactor and not a coenzyme? (a) Tetrahydrofolic (b) Biotin (c) Copper (d) Methylcobalamin 26. Km specifies affinity of enzyme with substrate when: (b) K2  K1 (a) K2 = K1 (c) K1  K2 (d) None of these 27. At what[S] the velocity[V 0 ] of an enzyme-catalyzed reaction is 25% of the Vmax? (a) 1/4 km (b) 1 km (c) 4 km (d) 2/4 km 28. Which of the following vitamin is necessary for coenzyme A synthesis? (a) Biotin (b) Pyridoxine (c) Pantothenic acid (d) None of these 18. (a)

19. (b)

20. (c)

21. (c)

22. (b)

23. (d)

194

Plant Physiology: Question Bank

29. An uncompetitive inhibitor of enzyme binds to: (a) Site of other than the active site (b) Any other site and modifies part of an enzyme (c) The active site of an enzyme (d) None of the above 30. Catalytic antibodies function as enzymes on the principle of: (a) Antigen-antibody affinity (b) Enzymatic conversion of antibodies (c) Monoclonal antibodies with chemical capability (d) None of the above 31. The metabolic process in which bacteria is directly inhibited by the antibiotic penicillin: (a) Synthesis of the fats (b) Cellular respiration (c) ATP hydrolysis (d) None of the above 32. Which of the following vitamin is a precursor of coenzyme that is required in enzymatic reactions involving transfer of acyl groups? (a) p-aminobenzoic (b) Lipoic acid (c) Riboflavin (d) Biotin 33. Lactic dehydrogenase (LDH) is essential for lactic acid formation. This is an example of: (a) Chemienzyme (b) Apoenzyme (c) Abzyme (d) Isoenzyme 34. Which one of the following coenzyme pair correctly with the group transferred? (a) Thiamin-pyrophosphate (b) Biotin-carbon dioxide (c) NADP = phosphoryl (d) None of the above 35. An allosteric modulator influences enzyme activity by: (a) Changing the specificity of the enzyme for its substrate Ans.

29. (d) 40. (a)

30. (c) 41. (d)

31. (d)

32. (b)

33. (d)

(b) Competing for the catalytic site with the substrate (c) Binding to a site on the enzyme molecule distinct from the catalytic site (d) None of the above 36. An enzyme that catalyzes the conversion of an aldose sugar to a ketose sugar would be classified as one of the: (a) Oxidoreductase (b) Hydrolases (c) Transferase (d) Isomerases 37. The Km value of an enzyme is: (a) A dissociation constant (b) The substrate concentration that gives ½ maximal velocity (c) ½ of the Vmax (d) None of the above 38. The product of an enzyme–catalyzed reaction can act as inhibitor of the reaction. This mechanism of control known as: (a) Competitive inhibition (b) Metabolic (c) Feedback inhibition (d) None of the above 39. The active site of the enzymes is formed by some of it’s: (a) Exposed sulfur bonds (b) Amino groups of amino acids (c) Carboxyl groups of the amino acids (d) None of the above 40. Most of the digestive enzymes belong to: (a) Hydrolases (b) Lyases (c) Isomerases (d) Oxidoreductase 41. Pepsinogen (in active form of enzyme pepsin) is converted into its active form are: (a) Oxidation (b) Reduction (b) Isomerism (d) Hydrolysis 34. (b)

35. (c)

36. (d)

37. (c)

38. (c)

39. (b)

Enzymes and Vitamins

42. Malonic acid inhibits the activity of the enzyme: (a) Hexokinase (b) Succinic dehydrogenase (c) Threonine dehydratase (d) None of the above 43. Among of the following, which enzyme has lowest turnover number? (a) Lipase (b) Catalase (c) Lysozyme (d) None of these 44. Among of the following, which enzyme has highest turnover number? (a) Lipase (b) Catalase (c) Lysozyme (d) None of these 45. Allosteric enzymes have: (a) Active sites (b) Allosteric sites (c) Both A and B (d) None of these 46. Most of the enzymes show optimum activity is: (a) Acidic medium (b) Alkaline medium (c) Neutral medium (d) Any of the above 47. Induced fit theory of enzyme action was proposed by: (a) Went (b) Koshland (c) Fisher (d) None of these 48. Abzymes are: (a) Antibodies that have catalytic activity (b) Enzymes that hydrolyze antibodies (c) Both A and B (d) None of these 49. Which of the following statement is true regarding noncompetitive inhibition? (b) Vmax decreases (a) Km increases (c) Vmax increase (d) Km decreases 50. Biotin is involved in which of the following type of reaction? (a) Decarboxylations (b) Hydroxylations (c) Carboxylations (d) Dehydrations Ans.

42. (b) 53. (b)

43. (c) 54. (b)

44. (b) 55. (c)

45. (c) 56. (b)

46. (d) 57. (c)

195

51. Which one of the following vitamins does not act as a precursor for coenzymes? (a) Folic acid (b) Thiamine (c) Biotin (d) None of these 52. Sulpha drugs are effective antibiotics which inhibit the formation of folic acid by acting as a: (a) Competitive inhibitor (b) Uncompetitive inhibitor (c) Noncompetitive inhibitor (a) None of the above 53. The enzyme glutathione peroxidase which catalyzes destruction of H2O2 contains: (a) Zn (b) Se (c) Fe (d) Mo 54. The enzymes where catalysis involves transfer of electrons are named: (a) Isomerases (b) Oxidoreductase (c) Lyases (d) Transferases 55. Transformation of 1 mol of substrate per second into product is known: (a) Rate of constant (b) Enzyme unit (c) The Katal (Kat) (d) None of these 56. The amount of enzyme causing transformation of one molecule of substrate per minute at 25 ° C under optimal conditions of measurement is known as: (a) Rate of constant (b) Enzyme unit (c) The Katal (Kat) (d) None of these 57. Among the following, which one is the accepted SI unit of enzyme activity? (a) Latka (b) Talka (c) Katal (d) None of these 47. (b)

48. (a)

49. (b)

50. (c)

51. (d)

52. (a)

196

Plant Physiology: Question Bank

58. Which of the following is the example of ribozyme? (a) Hepatitis dalta virus (b) Tetrahymena (c) Hammer head (d) All of these 59. The first ribozyme was discovered by: (a) L Orgel (b) F Crick (c) C Woese (d) R Cech 60. Which of the following coenzyme is the carrier of acyl group? (a) Coenzyme A (b) Coenzyme Q (c) Coenzyme II (d) None of these 61. Which of the following is the carrier of sulfate group? (a) TPP (b) UDP (c) PAPS (d) None of these 62. Which of the following organic compound acts as prosthetic groups in some enzymatic reactions and as cofactors in some others? (a) Heme iron (b) Biotin (c) FMN (d) All of these 63. Which of the following hydrolyzing enzyme does not hydrolyze ester bonds? (a) Phophatase (b) Lipases (c) Both A and B (d) None of these 64. According to the new system of classification the enzymes are grouped into: (a) Four major classes (b) Five major classes (c) Six major classes (d) None of the above 65. A non-protein substance is required at the active center for enzymes activity which is bound ...... to the enzyme protein by ...... linkage and is known as ...... . (a) Tightly, coordinate cofactors (b) Tightly, covalent, prosthetic group (c) Loosely, covalent, prosthetic group (d) None of the above Ans.

58. (d) 69. (d)

59. (d) 70. (c)

60. (a) 71. (b)

61. (c) 72. (d)

62. (d)

66. Each enzyme has been assigned a specific code number consisting of ...... digits. The first digit indicates the ...... class, the second digit indicates the ......, the third digit indicates its ...... while the fourth digit denotes the systematic specific name of the enzyme the first of which indicates the name of the ...... and the second part of the ...... . (a) Four, substrate, nature of reaction, subclass sub-subclass. (b) Four, major, subclass sub-subclass, substrate, nature of reaction (c) Five, major, subclass sub-subclass, substrate, nature of reaction (d) None of the above 67. The self-splicing group I introns and RNAse P are the example of: (a) Isoenzyme (b) Zymogens (c) Ribozymes (d) None of these 68. Pepsinogen, trypsinogen, thymotrypsinogen and procarboxypeptides are the example of: (a) Isoenzyme (b) Zymogens (c) Ribozymes (d) All of these 69. Some enzymes are synthesized in the cells in an inactive state and are called: (a) Pre-enzyme (b) Proenzyme (c) Zymogens (d) All of the above 70. ...... different types of peroxidase isoenzyme have been isolated from maize. (a) 22 (b) 20 (c) 18 (d) None of these 71. The substrate for ribozyme is: (a) Fat (b) RNA (c) DNA (d) None 72. Which of the following is not a zymogen? (a) Procarboxypeptidase (b) Pepsinogen (c) Trypsinogen (d) None of the above 63. (d)

64. (c)

65. (b)

66. (b)

67. (c)

68. (b)

Enzymes and Vitamins

73. How many forms of LDH have been discovered? (a) Six (b) Five (c) Four (d) None of these 74. One of the first enzymes discovered in isozyme forms is: (a) Lipase (b) Phosphatase (c) Lactate dehydrogenase (d) None of the above 75. Multiple forms of enzymes with the same catalytic activity but different structures are known as: (a) Isozymes (b) Isoenzymes (c) Both (d) None of these 76. An excellent example of inducible enzyme in higher plant is: (a) -amylase (b) Nitrate reductase (c) Both (d) None of these 77. Lactate dehydrogenase (LDH) which catalyses pyruvate to lactate is an example of: (a) Apoenzyme (b) Isoenzyme (c) Coenzyme (d) None of these 78. The lower value of Km means: (a) Higher substrate affinity of enzyme (b) Higher enzyme activity (c) Lower affinity of enzyme with substrate (d) None of the above 79. An example of inductive or inducible enzyme of E. coli is: (a) -amylase (b) Nitrate reductase (c) Both (d) None of these 80. The enzyme which are always present in the organisms in constant amount regardless of its metabolic state are called ……. . (a) Isoenzymes (b) Inducible enzyme (c) Constitutive enzymes (d) None of the above Ans.

73. (b) 84. (b)

74. (c) 85. (c)

75. (c) 86. (c)

76. (b) 87. (b)

77. (b) 88. (d)

197

81. Majority of enzymes belongs to ...... category: (a) Exoenzymes (b) Endoenzymes (c) Both (d) None of these 82. The nonprotein part of enzyme is called: (a) Holoenzyme (b) Apoenzyme (c) Prosthetic group (d) None of these 83. The enzymes which act normally within cells are called: (a) Apoenzymes (b) Endoenzymes (c) Exoenzymes (d) Ferment 84. Which of the following enzyme was first isolated and purified in the form of crystal? (a) Amylase (b) Urease (c) Pepsin (d) Ribonuclease 85. Enzymes are basically made up of: (a) DNA (b) Fat (c) Proteins (d) None of these 86. A competitive inhibitor: (a) Increases both the Vmax and the Km of an enzyme (b) Decrease the Km but increases the Vmax of an enzyme (c) Increases the Km of an enzyme (d) Decreases the Km of an enzyme 87. In a chemical reaction, transition state species have free energies: (a) Higher than either the reactant or the products (b) Higher than products but lower than reactant (c) Higher than reactant, but lower than products (d) None of the above 88. Heterotrophic enzymes are: (a) Stimulates and inhibited by an affecters or modulator molecule other than substrate (b) Different isoenzymes (c) Modified by their substrate concentration (d) All of the above 78. (a)

79. (d)

80. (c)

81. (b)

82. (c)

83. (b)

198

Plant Physiology: Question Bank

89. The graph V versus V/[S] is called

(a) Eadie–Hofstee plot (b) Double reciprocal plot (c) Both (a) and (b) (d) None of these 90. Which of the following is the common characteristic of any enzyme? (a) Most (but not all) enzymes are proteins (b) Enzymes are highly specific (c) Enzymes exhibit enormous catalytic power (d) All of the above 91. First enzyme to be isolated in pure crystalline form is: (a) Urease (b) Zymase (c) Diastase (d) Invertase 92. EC number of the enzyme to be isolated in pure crystalline form is: (a) 1.1.1.1 (b) 9.0.1.2 (c) 0.1.1.1 (d) None of these 93. The turnover number for catalase is: (b) 12 × 107 (a) 17 × 107 7 (c) 9 × 10 (d) 4 × 107 (e) None of the above 94. The world enzyme was coined by: (a) FW Kuhne (b) Gobindjee (c) Willstate (d) None of these 95. Which of the following is considered as good source for studies of enzymes? (a) Germinating seeds (b) Microorganism (c) Both (d) None of these Ans.

89. (a) 90. (d) 91. (a) 92. (a) 100. (c) 101. (a) 102. (d) 103. (a)

93. (d)

96. According to …………, an enzyme is “simple or combined proteins acting as specific catalysts”: (a) Traube (b) Louis Pasture (c) Sumner and Myrback (d) None of the above 97. In higher plant which of the following is the rich source of enzyme and are widely used in experimental work? (a) Immature flowers (b) Matured flowers (c) Germinating seeds (d) Matured seeds (e) None of the above 98. Which of the following coenzyme is the carrier of hexose sugar molecules? (a) UDP (b) PAPS (c) TPP (d) None of these 99. Michaelis-Menton constants (km) for enzyme-substrate pair of carbonic anhydrase and HCO is: (a) 9 mM (b) 8 mM (c) 7 mM (d) None of these 100. Michaelis-Menton constant (km) for enzyme-substrate pair of chymotrypsin and N-Benzoyltyrosinamide is: (a) 111 mM (b) 26 mM (c) 2.5 mM (d) None of these 101. Michaelis-Menton constants (km) for enzyme-substrate pair of chymotrypsin and Glycytyrosingycine is: (a) 108 mM (b) 9 mM (c) 2.5 mM (d) None of these 102. Michaelis-Menton constants (km) for enzyme-substrate pair of hexokinase and D-Fructose is: (a) 0.05 mM (b) 0.4 mM (c) 25 mM (d) None of these 103. Michaelis-Menton constants (km) for enzyme-substrate pair of hexokinase and D-glucose is: (a) 0.05 mM (b) 0.04 mM (c) 25 mM (d) None of these 94. (a)

95. (c)

96. (c)

97. (c)

98. (a)

99. (a)

Enzymes and Vitamins

104. Michaelis-Menton constants (Km) for enzyme-substrate pair of hexokinase and ATP is: (a) 0.05 mM (b) 0.4 mM (c) 25 mM (d) None of these 105. Michaelis-Menton constants (Km) for enzyme-substrate pair of Catalse and HO is: (a) 0.05 mM (b) 0.04 mM (c) 25 mM (d) None of these 106. Which of the following represent Henri-Michaelis-Menten equation?

199

112. Enzymes are basically made up of: (a) Proteins (b) Vitamins (c) Carbon (d) Fats 113. How many categories of enzymes have been recognized by IUB? (a) 5 (b) 6 (c) 7 (d) 8 114. An enzyme can be synthesized by chemically bonding together the molecules of: (a) Carbohydrates (b) Amino acids (c) Lipase (d) CO2

km  [S] Vmax [S] (b) V  Vmax [S] km  [S] Vmax  [S] (c) V  (d) None of these km  [S] 107. In plants, enzymes are present: (a) Only in leaves (b) Only in storage organs (c) Only in flowers (d) In all the living cells of the plant body

115. Enzymes are polymers of: (a) Amino acids (b) Hexose carbon (c) Fatty acids (d) Inorganic phosphate

108. Ezymes are useful because they: (a) Catalyse biochemical reactions in the plant body (b) Supply energy (c) Enhance the absorption of water (d) Are important structural components

117. Which enzyme is not proteinaceous? (a) Isozyme (b) Ribozyme (c) Holozyme (d) Trypsin

(a) V 

109. The enzymes which act normally within cells are called: (a) Endoenzymes (b) Exoenzymes (c) Apoenzymes (d) Ferment 110. The scientists associated with the study of enzymes include: (a) Buchner (b) Went (c) Sumner (d) Both (a) and (c) 111. Number of enzymes known nowadays is approximately: (a) 1,000 (b) 2,000 (c) 3,000 (d) 40,00

116. Which one of the following statement if true for the enzyme? (a) All enzymes are proteins (b) All proteins are enzymes (c) All enzymes are not proteins (d) All enzymes are vitamins

118. Ribozyme is: (a) RNA without sugar (b) RNA without phosphate (c) RNA having enzyme activity (d) RNA with extra phosphate 119. Enzymes are proteins was suggested by: (a) Pasteur (b) Leeuwenhoek (c) Miller (d) Sumner 120. Noble prize for discovering enzyme was given to: (a) Fischer (b) Altmann (c) Fleming (d) Buchner 121. Which of the following enzymes was first isolated and purified in the form of crystal? (a) Amylase (b) Ribonuclease (c) Urease (d) Pepsin

Ans. 104. (b) 105. (c) 106. (a) 107. (d) 108. (a) 109. (a) 110. (d) 111. (b) 112. (a) 113. (b) 114. (b) 115. (a) 116. (c) 117. (b) 118. (c) 119. (d) 120. (d) 121. (c)

200

Plant Physiology: Question Bank

122. Urease, the first enzyme crystallized, was crystallized by: (a) J Northrop (b) E Buchner (c) Louis Pasteur (d) JB Sumner 123. The nonprotein part of an enzyme is called (a) Holoenzyme (b) Prosthetic group (c) Apoenzyme (d) None of the above 124. The protein part of an enzyme is called: (a) Holoenzyme (b) Prosthetic group (c) Apoenzyme (d) All of the above 125. When coenzyme combines with apoenzymes, it is called: (a) Holoenzyme (b) Cofactor (c) Isoenzyme (d) Prosthetic group 126. Coenzyme is: (a) Always a protein (b) Often a vitamin (c) Always an inorganic compound (d) Often a metal 127. Cytochrome oxidase contains: (a) Iron (b) Magnesium (c) Cobalt (d) Mercury 128. What will happen to an enzyme when apoenzyme is separated from its metal component? (a) Activity will be increased (b) Activity will be lost (c) Activity will be decreased (d) There will be no change in the activity 129. NADP is: (a) An enzyme (b) A part of soluble RNA (c) A part of transfer RNA (d) A coenzyme 130. FAD or FMN is a coenzyme. Which vitamin is incorporated in its structure?

(b) Vitamin B2 (a) Vitamin B1 (C) Vitamin B6 (d) Vitamin C 131. The nature of coenzyme is: (a) Nonproteinaceous (b) Proteinaceous (c) Both (a) and (b) (d) None of these 132. During enzyme activity, the coenzyme (a) Acts as a donor or acceptor of atoms which are added to or removed from the substrates (b) Are important in oxidation-reduction reactions (c) Both a and b (d) None of the above 133. Which of the following are coenzymes (a) NAD, NADP, FAD, FMN (b) Vitamin, Fe, Cu (c) NADPH2, Ca, Co (d) NAD, K, CoA 134. Out of total enzymes present in the cell, mitochondrion alone has: (a) 95% (b) 20% (c) 64% (d) 70% 135. Which of the following is iron porphyrin coenzyme or cofactor? (a) Coenzyme A (b) Cytochrome (c) NAD (d) FAD 136. The ratio of enzyme : substrate molecules can be as high as: (a) 1:1000 (b) 1:10,000 (C) 1:50,000 (d) 1:100,000 137. The turnover enzyme is: (a) 105 (b) 104 4 (c) 18 × 10 (d) 4 × 106 138. Which among the following has highest turnover number? (a) Urease (b) Catalase (c) Carbonic anhydrase (d) Pepsin 139. Which among the following has highest catalytic efficiency? (a) Catalse (b) Urease (c) Carbonic anhydrase (d) Pepsin

Ans. 122. (d) 123. (b) 124. (c) 125. (a) 126. (b) 127. (a) 128. (b) 129. (d) 130. (b) 131. (a) 132. (c) 133. (a) 134. (d) 135. (b) 136. (d) 137. (d) 138. (b) 139. (c)

Enzymes and Vitamins

201

140. The number of enzyme units per mg of protein is known as: (a) Molecular activity (b) Specific activity (c) Turnover number (d) Molar activity

148. On boiling/treating with strong acid or alkali/treating with pepsin, an enzyme loses its catalytic activity because: (a) It is a protein (b) It burns (c) It is a functional substances (d) It is a lipoprotein

141. Amount of enzyme transforming 1µ mole of substrate per minute at 25°C under optimal conditions of measurement is called: (a) Specific activity (b) Unit of enzyme (activity) (c) Catalytic center activity (d) Enzyme purity 142. Which of the following statements is incorrect? (a) At optimum pH, the activity of enzyme is maximum (b) Enzymes are not affected by hydrogen ion concentration (c) The optimum pH for pepsin is 2.0 (d) The optimum pH for trypsin is 8.8

149. Which part of an active denatured by heat? (a) Apoenzyme (b) Holoenzyme (c) Coenzyme (d) Activator

143. At temperature below the freezing point, an enzyme is: (a) Slightly activated (b) Killed (c) Inactivated (d) Unaffected 144. How is the rate of enzyme-catalyzed reactions affected by every 10°C rise of temperature? (a) Halves (b) Doubles (c) Becomes four times (d) Remains unchanged 145. At which temperature, the enzyme activity would be maximum? (a) 35°C (b) 45°C (c) 55 °C (d) 60 °C 146. Most of the enzymes are inactivated at temperature above: (a) 25 °C (b) 45°C (c) 55°C (d) 80 °C 147. At boiling temperature, an enzyme is: (a) Killed (b) Denatured (c) Inactivated (d) Unaffected

150. Enzymes catalyses a reaction in: (a) Forward direction (b) Backward direction (c) Both ways (d) Either ways 151. Enzymes differ from inorganic catalysts in: (a) Having a high diffusion rate (b) Working at high temperature (c) Not being used up in reactions (d) Being proteinaceous in nature 152. What is true about enzymes? (a) All act best at pH 7.0 (b) All are amino acids (c) All are proteins (d) All act best at 0°C 153. Which of the following is not an attribute of enzymes? (a) These are proteinaceous in nature (b) These speed up the rate of biochemical reaction (c) These are specific in nature (d) These are used up in reaction 154. Enzymes are sensitive to: (a) Light (b) Wind velocity (c) Change in pH (d) Rainfall 155. Dry seeds can endure higher temperature than the germinating seeds because: (a) Dry seeds are hard (b) Seedlings are tender (c) Dry seeds have more reserve food (d) Hydration makes the enzyme more sensitive to temperature

Ans. 140. (b) 141. (b) 142. (b) 143. (c) 144. (b) 145. (a) 146. (b) 147. (b) 148. (a) 149. (a) 150. (d) 151. (d) 152. (c) 153. (d) 154. (c) 155. (d)

202

Plant Physiology: Question Bank

156. Zymogens are: (a) Enzyme acting upon starch (b) Groups of zymase enzymes (c) Inactive enzyme precursors (d) None of the above 157. Lactic dehydrogenase (LDH) which catalyses pyruvate to lactate is an example of: (a) Apoenzyme (b) Antienzyme (c) Isoenzyme (d) Coenzyme 158. An enzyme which catalyses the rearrangement of molecular structure and forms a compound of same molecular weight is called: (a) Ligase (b) Oxidoreductase (c) Isomerase (d) Hydrolase 159. The transfer of a group from a donor acceptor molecule is molecule to an catalysed by: (a) Transferase (b) Isomerase (c) Protease (d) Hydrolytic enzymes 160. Transferase are involved in the transfer of: (a) Methyl group (b) Amino group (c) Phosphate group (d) All of these 161. Oxidative enzymes occur in: (a) Lysosomes (b) Golgi bodies (c) Mitochondria (d) Ribosomes 162. Hydrolases are involved in the hydrolysis of: (a) Esters (b) Lipids (c) Proteins (d) All of these

165. Which of the following is a hydrolytic enzyme: (a) Esterase (b) Carbohydrase (c) Protease (d) All of these 166. The enzyme converting starch into maltose is: (a) Invertase (b) Hydrogenase (c) Maltase (d) Diastase 167. Diastase enzyme helps in the digestion of: (a) Starch (b) Proteins (c) Fats (d) Amino acids 168. Which of the following enzymes acts upon fatty acids? (a) Amylase (b) Lipase (c) Trypsin (d) Peptidase 169. Lipase enzyme acts upon (a) Water (b) Protein (c) Fat (d) Sugar 170. Which enzyme is required to digest the reserve food material (lipid) in castor seeds? (a) Lipase (b) Diastase (c) Amylase (d) Protease 171. In seeds, digestion is made possible at relatively low temperature by: (a) Auxins (b) Proteins (c) Enzymes (d) Nitrogenous complex substances 172. In the cell, digestive enzymes are mostly located in: (a) Lysosomes (b) Cell wall (c) Chromosomes (d) Ribosome

163. Ligases are involved in the synthesis of: (a) C–C bonds (b) C–N bonds (c) C–O bonds (d) All of these

173. An enzyme acts by: (a) Reducing activation energy (b) Increasing activation energy (c) Increasing reaction time (d) Decreasing reaction time

164. Esterase belongs to: (a) Oxidoreductases (b) Carboxylases (c) Hydrolases (d) Transferases

174. Turnover number of enzyme depends upon: (a) Molecular weight of enzyme (b) Size of enzyme molecule

Ans. 156. (c) 157. (c) 158. (c) 159. (a) 160. (d) 161. (c) 162. (d) 163. (d) 164. (c) 165. (d) 166. (d) 167. (a) 168. (b) 169. (c) 170. (a) 171. (c) 172. (a) 173. (a)

Enzymes and Vitamins

(c) Active sites of enzyme molecule (d) Concentration of substrate molecule 175. Which of the following is the best evidence for template theory of enzyme action? (a) Compounds similar in structure to the substrate inhibit the reaction (b) Enzymes speed up reaction by definite amount (c) Enzymes determine the direction of a reaction (d) Enzymes are found in living organisms and increase the rate 176. The enzyme is said to be working at maximum efficiency: (a) When substrate concentration is increased to point of saturation (b) When substrate concentration is low (c) When substrate coming in contact with active site are negligible (d) None of the above is true 177. When the action of the enzyme is inhibited in the presence of a substance which closely resembles the substrate molecule, then the inhibition is known as: (a) Feedback inhibition (b) Noncompetitive inhibition (c) Allosteric inhibition (d) Competitive inhibition 178. The enzyme bromelain is obtained from: (a) Papaya (b) Pineapple (c) Saliva (d) Witches broom 179. The evolution of oxygen from H2O2 in a living tissue is catalysed by (a) Mn O2 (b) Peroxidase (c) SnO2 (d) Invertase 180. The enzyme sucrase acts on: (a) Sucrose only (b) Any disaccharide (c) Starch and sucrose (d) Any organic molecule

203

181. The active site of an enzyme is formed by some of its: (a) R groups on the amino acids (b) Amino groups of amino acids (C) Carboxyl groups of the amino acids (d) Exposed sulfur bonds 182. Upon binding the substrate at one site, other sites on an enzyme become more reactive. This is called: (a) Allosteric inhibition (b) Specificity (c) Cosoperativity (d) Activation 183. Which of these inactivates an enzyme by changing enzyme shape? (a) Allosteric inhibitor (b) Competitive inhibitor (C) Irreversible inhibitor (d) Multienzyme complex 184. Which of these inactivates an enzyme by denaturing it? (a) Allosteric inhibitor (b) Competitive inhibitor (c) Irreversible inhibitor (d) Multienzyme complex 185. The specificity of an enzyme is governed by the tertiary structure. In forming a tertiary structure, bonds develop between certain amino acids. The resulting shape provides for the substrate: (a) Spatial fit (b) Bonding fit (c) Spatial and bonding fit both (d) Neither spatial nor bonding fit 186. Only a substrate with a particular shape is help by the enzyme. It is due to: (a) Spatial fit of the active site (b) Bonding fit of the active site (c) Both spatial and bonding fit of the active site (d) Neither spatial nor bonding fit of the active site

Ans. 174. (c) 175. (a) 176. (a) 177. (a) 178. (b) 179. (b) 180. (a) 181. (a) 182. (c) 183. (a) 184. (c) 185. (c) 186. (a)

204

Plant Physiology: Question Bank

187. Bonding fit of an enzyme is the presence of certain active sites: (a) Within the grooves in the surface of tertiary structure (b) Outside the grooves on the surface of tertiary surface (c) Both within and outside the grooves in the surface of tertiary structure (d) Formed as a result of quaternary structure 188. Specificity of the bonding fit for a particular reaction is the result of: (a) R groups on the amino acids (b) Amino groups of amino acids (c) Carboxyl groups of the amino acids (d) Exposed sulfur bonds 189. Which of the following statements is correct? (a) Enzymes can substitute one another (b) No other enzyme can substitute for a missing enzyme (c) A few enzymes can substitute a given enzyme (d) While some enzymes can be substituted by other enzymes, there is no substitute for most of the enzymes 190. All the enzymes of a multienzyme complex are arranged together in: (a) Solution of ATP (b) Membrane (c) Quaternary protein (d) Coenzyme 191. During feedback inhibition, the high concentrations of the end product of a metabolic pathway: (a) Slow down the enzymes which control earlier steps in the pathway (b) Switch off the enzymes which control earlier steps in the pathway (c) Slow down or switch off the enzymes which control earlier steps in the pathway (d) Denature the enzymes which control earlier steps in the pathway

192. Glutamate pyruvate transaminase enzyme is an example of: (a) Qxidoreductases (b) Transferases (c) Lyases (d) Ligases 193. The pentose phosphate pathway erythrocytes against hemolysis by assisting the enzyme: (a) Superoxide dismutase (b) Catalase (c) Glutathionic peroxidase (d) Cytochrome oxidase 194. Hemolytic anemia is caused by the deficiency of certain enzymes of the pentoste phosphate pathway the principal enzyme involved is: (a) Glucose-6-phosphate dehydrogenase (b) Aldolase (c) Fructose 1, 6 bisphosphatase (d) Phosphohexoseisomerase 195. The sites for gluconeogenesis are: (a) Liver and kidney (b) Skin and pancreas (c) Lung and brain (d) Intestine and lens of eye 196. An enzyme involved in gluconeogenesis is: (a) Pyruvate kinase (b) Pyruvate carboxylase (c) Hexokinase (d) Phosphohexoseisomerase 197. The enzyme pyruvate carboxylase is present in: (a) Cytosol (b) Mitochondria (c) Nucleus (d) Golgi bodies 198. The enzyme phosphoenol pyruvate carboxy kinase catalyses the conversion of oraloacetate to phosphoenolpyruvate requires: (a) ATP (b) ADP (c) AMP (d) GTP

Ans. 187. (a) 188. (a) 189. (b) 190. (b) 191. (c) 192. (b) 193. (c) 194. (a) 195. (a) 196. (b) 197. (b) 198. (d)

Enzymes and Vitamins

199. The enzyme glucose 6 phosphatase is present in: (a) Liver (b) Muscle (c) Adipose tissue (d) Brain 200. In gluconeogensis, an allosteric activator required in the synthesis of oxaloacetate from bicarbonate and pyruvate, which is catalyzed by the enzyme pyruvate carboxylase is: (a) Acetyl CoA (b) Succinate (c) Isocitrate (d) Citrate 201. The term enzyme was coined by: (a) Kuhne (b) Buchner (c) Thomas Cech (d) Sumner 202. Proteinaceous nature of enzymes was discovered by: (a) Kuhne (b) Buchner (c) Sumner (d) Pasteur. 203. The first enzyme isolated from seeds of Jack bean was: (a) Zymase (b) Urease (c) Peptidase (d) Phosphorylase 204. A Living cell has: (a) 1000 types of enzymes (b) 2000 types of enzymes (c) 3000 types of enzymes (d) 5000 types of enzymes 205. Which of the following have no enzymes of their own? (a) Bacteria (b) Cyanobacteria (c) Viruses (d) all the above 206. Which of the following cell organelles have 72–75% of entire enzyme distribution: (a) Chloroplasts (b) Mitochondria (c) Lysosome (d) Nucleus 207. Which of the enzyme has lowest, turn over number? (a) Phosphorylase (b) Lysozyme (c) PEP carboxylase (d) Carbonic anhydrase 208. Which of the enzyme has highest turn over number?

205

(a) Carbonic anhydrase (b) Nitrogenase (c) Urease (d) Peroxidase 209. Which of the following enzyme is not proteinaceous in nature? (a) Urease (b) Peptidase (c) Phosphatase (d) Ribozyme 210. Ribozyme enzyme term was given by: (a) Sumner (b) Bucher (c) Thomas Cech and Sydney Altman (d) Kelly Kruger et al 211. Thomas Cech and Sydney Altman got Nobel Prize in 1989 for: (a) Isolating enzyme ribozyme from a protozoa (b) Isolating enzyme ribozyme from a fungus (c) Isolating enzyme ribozyme from cyanobacteria (d) Isolating restriction enzyme from a bacterium. 212. Maximum numerical relation between an enzyme molecule and substrate molecule is: (a) 1:100 (b) 1:10000 (c) 1:100000 (d) 1:10000000. 213. Minimum numerical relation between an enzyme molecule and subtrate molecule is: (a) 1: 10 (b) 1:100 (c) 1:1000 (d) 1:5. 214. An enzymatic reaction was carried out at 22°C room temperature. Room temperature was increased by 10°C which resulted into increase in enzymatic reaction twice. Further, temperature was increased by 10°C. What you expect now? (a) Enzymatic reaction will increase twice (b) Enzymatic reaction will not be affected (c) Enzymatic reaction will be inhibited (d) Enzymatic reaction will decrease

Ans. 199. (a) 200. (a) 201. (a) 202. (c) 203. (b) 204. (c) 205. (c) 206. (b) 207. (b) 208. (a) 209. (d) 210. (d) 211. (a) 212. (d) 213. (b) 214. (d)

206

Plant Physiology: Question Bank

215. Which of the following are allosteric enzymes? (a) Phosphofructokinases (b) RuBisCo (c) PEP carboxylases (d) All the above

223. Inhibition of enzyme cytochrome oxidase is an example of: (a) Competitive inhibition (b) Non-competitive inhibition (c) Feedback inhibition (d) None

216. The marker enzyme of mitochondrial intermembrane space is: (a) Succinate dehydrogenase (b) Monoamine oxidase (c) Nucleoside phosphokinase (d) All of the above

224. Organic substances of which site of synthesis and site of action are same are called: (a) Hormones (b) Activators (c) Enzymes (d) Juice

217. Hexokinase enzyme belongs to class: (a) Oxidoreductase (b) Transferase (c) Hydrolases (d) Isomerase 218. Endonuclease enzyme belongs to class: (a) Hydrolase (b) Oxidoreductase (c) Lygases (d) Lyases 219. Restriction enzymes which are obtained from E. coil belongs to class: (a) Oxidoreductase (b) Hydrolases (c) Transferase (d) Isomerase 220. Competitive inhibition shows that: (a) Enzymes are made up of proteins (b) Enzymes are biocatalysts (c) Enzymes have many active sites (d) Enzymes are specific in nature 221. Competitive inhibition overcome by adding substrate shows that: (a) Enzymes are specific in nature (b) Enzymes have many active sites (c) Enzymes are made of protein (d) Enzymes are pH-dependent 222. Antibiotics kill bacteria by: (a) Competitive inhibition of enzymes (b) Noncompetitive inhibition of enzymes (c) Feedback inhibition (d) All of the above

225. Enzyme nitrogenase is: (a) An obligate anaerobe (b) Facultative anaerobe (c) An obligate aerobe (d) A facultative aerobe 226. Formation of acetyl CoA from pyruvic acid is carried out by: (a) Enzyme complex (b) Isoenzyme (c) Allosteric enzyme (d) All of the above 227. Which one of the following enzymes is responsible for the synthesis of DNA from RNA polymerase? (a) RNA polymerase (b) DNA polymerase (c) Reverse transcriptase (d) DNA ligase 228. The marker enzyme of mitochondrial inner membrane is: (a) Aldolase (b) Amylase (c) Succinic dehydrogenase (d) Pyruvate dehydrogenase 229. Which one of the following enzymes is used in PCR reaction? PCR polymerase chain reaction: (a) Taq polymerase (b) RNA polymerase (c) Ribonuclease (d) Endonuclease 230. RuBisCo is made up of: (a) 14 subunits (b) 15 subunits (c) 16 subunits (d) 18 subunits

Ans. 215. (d) 216. (c) 217. (b) 218. (a) 219. (b) 220. (d) 221. (b) 222. (a) 223. (b) 224. (c) 225. (d) 226. (a) 227. (c) 228. (c) 229. (a) 230. (c)

Enzymes and Vitamins

231. Which one of the following enzyme is known to monomerize pyrimidine dimers in DNA? (a) Photolyase (b) Endonuclease (c) Polymerase (d) Ligase 232. Which one of the following enzyme is inactivated by oxygen? (a) Dehydrogenase (b) Nitrogenase (c) Phosphatase (d) Urease 233. Which one of the following enzyme is used to disintegrate the prokaryotic cell wall? (a) Amylase (b) Protease (c) Lipase (d) Lysozyme 234. Which one of the following enzyme is found in the bacteriophage? (a) Dehydrogenase (b) Protease (c) Nitrogenase (d) Lysozyme 235. Cofactor of enzyme IAA oxidase is: (a) Monophenol (b) Polyphenol (c) Diphenol (d) None 236. The coenzyme involved in transamination reaction is: (a) Adenosine phosphate (b) Pyridoxal phosphate (c) Coenzyme A (d) Ccetyl coenzyme A 237. An enzyme acts by: (a) Reducing the energy of activation (b) Increasing the energy of activation (c) Decreasing the pH (d) Increasing the pH 238. Enzymes are the polymers of: (a) Hexose carbon (b) Fatty acids (c) Amino acids (d) Inorganic phosphates 239. At high temperature enzymes are: (a) Killed (b) Denatured (c) Inactivated (d) Highly effective 240. At temperature near freezing point, the enzymes are: (a) Inactivated (b) Activated (c) Slightly activated (d) Slightly inactivated

207

241. Dry seeds endure higher temperature than germinating seeds because: (a) Hydration makes the enzymes more sensitive to temperature (b) Dry seeds have a hard covering (c) Dry seeds have more reserve food (d) Seedlings are tender 242. Coenzyme FMN and FAD contain which of the following: (a) Vit C (b) Vit B (d) Vit B6 (c) Vit B2 243. Enzymes, vitamins and hormones have one thing in common: (a) All are synthesized in organisms (b) All are proteins (c) All aid in regulating metabolism (d) All enhance oxidative metabolism 244. Enzymes are different from inorganic catalysts in: (a) Not being used up in reactions (b) Being proteinaceous in nature (c) Having a high diffusion rate (d) Working at high temperature 245. An enzyme extract when subjected to electric field, separates into two fractions each catalysing the same reaction. These fractions are: (a) Allosteric enzyme (b) Coenzyme (c) Inducible enzyme (d) Isoenzyme 246. Inorganic part of the holoenzyme is called: (a) Hormone (b) Coenzyme (c) Activator (d) Modulator 247. Which of the following coenzyme is involved in acyl and carboxyl group transfer? (a) TPP (b) ATP (c) FAD (d) Pyridoxal phosphate (PALP) 248. Which of the following coenzyme carries out transfer of formyl group? (a) Tetrahydrofolate (COF) (b) Biotin (c) Coenzyme A (d) Lipoic acid

Ans. 231. (a) 232. (b) 233. (d) 234. (d) 235. (a) 236. (b) 237. (a) 238. (c) 239. (b) 240. (a) 241. (a) 242. (c) 243. (c) 244. (b) 245. (d) 246. (c) 247. (d) 248. (a)

208

Plant Physiology: Question Bank

249. Which of the following is/are acyl group transferring coenzyme/coenzymes? (a) Lipoic acid (b) Coenzyme A (c) Thiamine pyrophosphate (d) All of the above 250. Carboxyl group transferring coenzyme is: (a) Biotin (b) PALP (c) Phosphatase (d) TPP 251. DNA polymerases are: (a) Metalloenzymes (b) Isoenzymes (c) Simple enzymes (d) Coenzymes 252. The prosthetic group of dehydrogenases is known as: (a) Flavin (b) Riboflavin (c) Ferredoxin (d) Niacin 253. The number of moles of substrate converted per minute by one mole of enzyme is called: (a) Turn over number (b) Substrate number (c) Enzyme number (d) Peptide number 254. The bonds between the enzyme and substrate must be: (a) Weak and long lived (b) Weak and short lived (c) Strong and long lived (d) Strong and short lived 255. Nitrate reductase is classified as: (a) Zinc protein (b) Iron protein (c) Molybdenum protein (d) Copper protein 256. The most abundant protein enzyme found in plants is: (a) RuBP carboxylase (b) PEP carboxylase (c) Catalase (d) Peroxidase 257. During the germination of coconut, the major stored food is digested by: (a) -amylase (b) Lipase (c) Protease (d) Trypsin

258. Which of the following enzyme is used for removing nitrogenous stain? (a) Proteases (b) Amylases (c) Rennet (d) Lactases 259. The enzyme used in the beverage industry to flavor soft drinks and in the baking industry to sweeten biscuits and cakes is: (a) Amylase (b) Protease (c) Glycoamylase (d) Glucoamylase and glucoisomerases 260. The function of restriction endonuclease is to: (a) Cut DNA sequences (c) Polymerase DNA (b) Join the DNA sequences (d) Carry DNA 261. Histidine decarboxylase enzyme belongs to the category: (a) Qxidoreductases (b) Isomerases (c) Lyases (d) Ligases 262. Which enzyme requires energy for their action and obtain it from the hydrolysis of ATP? (a) Qxidoreductases (b) Transferases (c) Ligases (d) Lyases 263. The enzyme pyruvate carboxylase combines pyruvic acid and CO 2 to form oxaloacetic acid at the expense of ATP. The enzyme is: (a) An isomerase (b) A ligase (c) A lyase (d) A transferase 264. The activity of an enzyme declines: (a) Above the optimum temperature (b) Below the optimum temperature (c) Both above and below the optimum temperature (d) Below the minimum and above the maximum temperature 265. Pepsinogen (inactive form of enzyme pepsin) is converted into its active form by: (a) Isomerism (b) Hydrolysis (c) Oxidation (d) Reduction

Ans. 249. (a) 250. (d) 251. (a) 252. (d) 253. (a) 254. (b) 255. (c) 256. (a) 257. (b) 258. (a) 259. (d) 260. (a) 261. (c) 262. (c) 263. (b) 264. (c) 265. (b)

Enzymes and Vitamins

266. Most intracellular enzymes function best: (a) At neutral pH (b) In acidic conditions (c) In basic conditions (d) Either neutral or acidic conditions 267. The protein-digesting enzyme trypsin functions best is: (a) pH 7.0 (b) pH 6.5 (c) pH 7.5 (d) pH 8.5 268. On reaching the stomach, the enzyme salivary amylase is inactivated by: (a) Pepsinogen (b) Pepsin (c) Hydrochloric acid (d) Mucous 269. The inhibition of succinic acid dehydrogenase by malonic acid is an example of: (a) Competitive inhibition (b) Allosteric inhibition (c) Feedback inhibition (d) Irreversible inhibition 270. Sulpha drugs are used for the control of bacterial pathogens because they cause: (a) Competitive inhibition of folic acid synthesis (b) Allosteric inhibition of folic acid synthesis (c) Feedback inhibition of folic acid synthesis (d) Irreversible inhibition of folic acid synthesis 271. Cyanide kills an organism by inhibiting: (a) Hexokinase (b) Cytochrome oxidase (c) Succinate dehydrogenase (d) Histidine decarboxylase 272. Which ion is toxic for enzyme activity (a) Mn++ (b) K+ ++ (c) Na (d) Hg++ 273. The enzyme hexokinase which catalyses glucose to glucose-6-phosphate in glycolysis is inhibited by glucose-6phosphate. This is an example of:

209

(a) Feedback allosteric inhibition (b) Positive feedback (c) Competitive inhibition (d) Noncompetitive inhibition 274. If temperature is increased from 3–45°C, the rate enzyme activity will: (a) Only increase (b) Only decrease (c) Initially increase then decrease (d) Initially decrease then increase 275. The compound which has the lowest density is: (a) Chylomicron (b) -lipoprotein (c) -lipoprotein (d) Pre -lipoprotein 276. Nonsteroidal anti-inflammatory drugs, such as aspirin act by inhibiting the activity of the enzyme: (a) Lipoxygenase (b) Cyclo-oxygenase (c) Phospholipase A2 (d) Lipoprotein lipase 277. From arachidonate, synthesis of prostaglandins is catalysed by: (a) Cyclo-oxygenase (b) Lipoxygenase (c) Thromboxane synthase (d) Isomerase 278. A holoenzyme is: (a) Functional unit (b) Apoenzyme (c) Coenzyme (d) All of these 279. Gaucher’s disease is due to the deficiency of the enzyme: (a) -fucosidase (b) -galactosidase (c) -glucosidase (d) Sphingomyelinase 280. Niemann-pick disease is due to the deficiency of the enzyme: (a) Hexosaminidase a and b (b) Ceramidase (c) Ceramide lactosidase (d) Sphingomyelinase 281. Krabbe’s disease is due to the deficiency of the enzyme: (a) Ceramide lactosidase (b) Ceramidase (c) -glucosidase (d) GM1 -galactosidase

Ans. 266. (a) 267. (d) 268. (c) 269. (a) 270. (a) 271. (b) 272. (b) 273. (d) 274. (a) 275. (c) 276. (a) 277. (b) 278. (a) 279. (d) 280. (c) 281. (d)

210

Plant Physiology: Question Bank

CHECK YOUR GRASP

1. End product inhibition is called: (a) Substrate regulation (b) Feedback regulation (c) Irreversible inhibition (d) Noncompetitive inhibition 2. Noncompetitive inhibition often results in: (a) Change in enzyme structure (b) Blocking of active site (c) Nonsynthesis of enzymes (d) Nonavailability of cofactor 3. Enzyme amylase belongs to: (a) Oxidoreductase (b) Hydrolases (c) Isomerase (d) Transferase 4. Enzymes functional in cell are: (a) Inducible only (b) Repressible only (c) Inducible and repressible (d) Inducible, constitutive and repressible 5. An enzyme acts as catalyst because: (a) Enzyme catalysed reactions are reversible (b) It accelerates the chemical reaction (c) It remains unchanged (d) All of the above 6. Which determines specificity of enzymes? (a) Inorganic factor (b) Coenzyme (c) Protein part (d) Full holoenzyme 7. Induced fit theory of enzyme action was given by: (a) Koshland (b) Harshey and Chase (c) Fischer (d) Sumner 8. Which enzyme is most abundantly found on earth? (a) Invertase (b) Catalasase (c) RuBisCo (d) Nitrogenase Ans.

1. (b) 12. (c)

2. (a) 13. (a)

3. (b) 14. (d)

4. (d) 15. (a)

5. (d) 16. (d)

9. Identify the protein that does not contain any metal: (a) Cytochrome (b) Glycoprotein (c) Ferritin (d) Phytochrome 10. The enzyme which hydrolyses starch to maltose is: (a) Protease (b) Amylase (c) Lactase (d) Maltase 11. Enzymes are sensitive to as: (a) Cold (b) Cell wall (c) Heat (d) Pressure 12. Aillosteric enzymes have modulator for: (a) Activation only (b) Inhibition only (c) Both activation and inhibition (d) Reduction in activation energy 13. Which of the following enzyme incorporates inorganic phosphate into the substrate? (a) Phosphoglycerate kinase (b) G l y c e r a l d e h y d e - 3 - p h o s p h a t e dehydrogenase (c) Pyruvate kinase (d) Enolase 14. Rapoport-Luebering cycle is located in: (a) Liver (b) Muscles (c) Brain (d) Erythrocytes 15. Glycerol can enter glycolytic pathway via: (a) Dihydroxyacetone phosphate (b) 1,3-Biphospoglycerate (c) 3-Phosphoglycerate (d) 2-Phosphoglycerate 16. HMP shunt is present in: (a) Erythrocytes (b) Liver (c) Testes (d) All of these 17. Which of the following intermediates of metabolism can be both a precursor and a product of glucose? (a) Lactate (b) Pyruvate (c) Alanine (d) Acetyl CoA 18. Mitochondrial membrane is freely preamble to: (a) Pyruvate (b) Malate (c) Oxaloacetate (d) Fumarate 6. (c) 17. (a)

7. (a) 18. (b)

8. (c)

9. (b)

10. (b)

11. (c)

Enzymes and Vitamins

19. The reaction of Krebs cycle which does not require cofactor of vitamin B group is: (a) Citrate, isocitrate (b) -Ketoglutarate, succinate (c) Malate, oxaloacetate (d) Succinate, fumarate 20. In enzyme kinetics Vmax reflects: (a) The amount of an active enzyme (b) Substrate concentration (c) Half the substrate concentration (d) Enzyme substrate complex 21. In b-oxidation the coenzyme for acylCoA dehydrogenase is: (a) FMN (b) NAD (c) NADP (d) FAD 22. In the cell, digestive enzyme mostly located in: (a) Lysosomes (b) Chromosomes (c) Cell wall (d) Ribosome 23. An enzyme acts by: (a) Reducting activation energy (b) Increasing activation energy (c) Increasing reaction time (d) Decreasing reaction time 24. Urease, the first enzyme crystallized, was crystallized by: (a) J Northrop (b) E Buchner (c) Louis Pasteur (d) JB Sumner 25. Number of enzymes known nowadays is approximately: (a) 1,000 (b) 2,000 (c) 3,000 (d) 4,000 26. Most of the digestive enzymes belongs to the category: (a) Qxidoreductases (b) Transferases (c) Hydrolases (d) Lyases 27. Histidine decarboxylase enzyme belongs to the category: (a) Qxidoreductases (b) Isomerases (c) Lyases (d) Ligases Ans.

19. (a) 30. (c)

20. (a) 31. (b)

21. (d) 32. (a)

22. (a) 33. (d)

23. (a) 34. (c)

211

28. Which enzyme require energy for their action and obtain it from the hydrolysis of ATP? (a) Qxidoreductases (b) Transferases (c) Ligases (d) Lyases 29. The enzyme pyruvate carboxylase combines pyruvic acid and CO 2 to form oxaloacetic acid at the expense of ATP. The enzyme is: (a) An isomerase (b) A ligase (c) A lyase (d) A transferase 30. The activity of an enzyme declines: (a) Above the optimum temperature (b) Below the optimum temperature (c) Both above and below the optimum temperature (d) Below the minimum and above the maximum temperature 31. Pepsinogen (inactive form of enzyme pepsin) is converted into its active form by: (a) Isomerism (b) Hydrolysis (c) Oxidation (d) Reduction 32. Most intracellular enzymes function best: (a) At neutral pH (b) In acidic conditions (c) In basic conditions (d) Either neutral or acidic conditions 33. The protein-digesting enzyme trypsin functions best is: (a) pH 7.0 (b) pH 6.5 (c) pH 7.5 (d) pH 8.5 34. On reaching the stomach, the enzyme salivary amylase is inactivated by: (a) Pepsinogen (b) Pepsin (c) Hydrochloric acid (d) Mucous 35. The inhibition of succinic acid dehydrogenase by malonic acid is an example of: (a) Competitive inhibition (b) Allosteric inhibition (c) Feedback inhibition (d) Irreversible inhibition 24. (d) 35. (a)

25. (b)

26. (c)

27. (c)

28. (c)

29. (b)

212

Plant Physiology: Question Bank

36. Sulpha drugs are used for the control of bacterial pathogens because they cause: (a) Competitive inhibition of folic acid synthesis (b) Allosteric inhibition of folic acid synthesis (c) Feedback inhibition of folic acid synthesis (d) Irreversible inhibition of folic acid synthesis 37. Cyanide kills an organism by inhibiting: (a) Hexokinase (b) Cytochrome oxidase (c) Succinate dehydrogenase (d) Histidine decarboxylase 38. How many categories of enzymes have been recognized by IUB: (a) 5 (b) 6 (c) 7 (d) 8 39. Which ions are toxic for enzyme activity? (a) Mn++ (b) K+ (c) Na++ (d) Hg++ 40. The enzyme hexokinase which catalyses glucose to glucose-6-phosphate in glycolysis is inhibited by glucose-6phosphate. This is an example of: (a) Feedback allosteric inhibition (b) Positive feedback (c) Competitive inhibition (d) Noncompetitive inhibition 41. If temperature is increased from 3°–45°C, the rate enzyme activity will: (a) Only increase (b) Only decrease (c) Initially increase then decrease (d) Initially decrease then increase 42. The compound which has the lowest density is: (a) Chylomicron (b) -lipoprotein (c) -lipoprotein (d) Pre -lipoprotein 43. Nonsteroidal anti-inflammatory drugs, such as aspirin act by inhibiting the activity of the enzyme: Ans.

36. (a) 47. (d)

37. (b) 48. (c)

38. (b) 49. (a)

39. (d) 50. (b)

40. (a)

(a) Lipoxygenase (b) Cyclo-oxygenase (c) Phospholipase A2 (d) Lipoprotein lipase 44. From arachidonate, synthesis of prostaglandins is catalysed by: (a) Cyclo-oxygenase (b) Lipoxygenase (c) Thromboxane synthase (d) Isomerase 45. A holoenzyme is: (a) Functional unit (b) Apoenzyme (c) Coenzyme (d) All of the above 46. Gaucher’s disease is due to the deficiency of the enzyme: (a) -fucosidase (b) -galactosidase (c) -glucosidase (d) Sphingomyelinase 47. Niemann-pick disease is due to the deficiency of the enzyme: (a) Hexosaminidase a and b (b) Ceramidase (c) Ceramide lactosidase (d) Sphingomyelinase 48. Krabbe’s disease is due to the deficiency of the enzyme: (a) Ceramide lactosidase (b) Ceramidase (c) -glucosidase (d) GM1 -galactosidase 49. Fabry’s disease is due to the deficiency of the enzyme: (a) Ceramide trihexosidase (b) Galactocerebrosidase (c) Phytanic acid oxidase (d) Sphingomyelinase 50. Farber’s disease is due to the deficiency of the enzyme: (a) -galactosidase (b) Ceramidase (c) -glucocerebrosiased (d) Arylsulase a Mark your score and evaluate yourself accordingly 41. (c)

42. (a)

43. (b)

44. (a)

45. (d)

46. (c)

Carbohydrate Metabolism in Plants

213

10

Carbohydrate Metabolism in Plants 6. Which of the following has a (1  4) glycosidic linkage in its molecule? (a) Sucrose (b) Cellulose (c) Maltose (d) None of these

1. Among the following, which one is known as most abundant organic polysaccharide on the earth? (a) Starch (b) Chitin (c) Cellulose (d) None of these

7. Pick the correct statement: (a) O-linked glycosylation is inhibited by the passage of the newly synthesized protein through the Golgi complex (b) O-linked glycosylation, N-acetylgalactosamine is added via Oglycosidic bonds to the OH groups of Sir and Thr after which other sugars are added sequentially (c) In O-linked glycosylation, performed oligosaccharides are attached to the relevant protein (d) In O-linked glycosylation, sugars are attached to the protein via Oglycosidic bonds to the carboxyl groups of Asp and Glu

2. Mutarotation is phenomenon where: (a)  and -forms of sugar change into one another to maintain the equilibrium (b)  and -forms of sugar change into on another to maintain the equilibrium (c)  and -forms of the sugar change into one another to maintain equilibrium (d) All of the above 3. Diastase enzyme consists of: (a) Maltase (b) -amylase and -amylase (c) R-enzyme (d) All of the above 4. Which of the following is known as optically active and dextrorotatory? (a) Fructose (b) Glucose (c) Both (d) None

8. One of the carbon atoms of a glucose molecule is [14C]-labeled. If 14-CO is released during the conversion of pyruvate to acetyl coenzyme A, which carbon atom of glucose was radiolabeled? (a) C1 but not C6 (b) C3 or C6 (c) C3 or C4 (d) C3 but not C4

5. Which of the following stage is known as reactive form of monosaccharide? (a) Phosphorylated (b) Sulphonated (c) De-phosphorylated (d) None of the above Ans.

1. (c)

2. (c)

3. (d)

4. (b)

5. (a)

6. (c) 213

7. (b)

8. (d)

214

Plant Physiology: Question Bank

9. Which of the following is a mucopolysaccharide? (a) Hemi-cellulose (b) Chitin (c) Pectin (d) None 10. In general, it is considered that plant metabolism is highly: (a) Rigid (b) Flexible (c) Both (d) None 11. The enzyme invertase hydrolyzed sucrose into: (a) Fructose (b) Glucose and fructose (c) Glucose phosphate and fructose (d) None of the above 12. In polysaccharide inulin, the fructofurnase units are jointed together by: (a)  (21) glycosidic bonds (b)  (12) glycosidic bonds (c)  (12) glycosidic bonds (d) None of the above 13. Which of the following is the component of hemi-cellulose? (a) Galactans and arabogalactans (b) Xylans (c) Mannans and glucomannans (d) All of the above 14. Which of the following is not a component of pectic substances? (a) Liginin (b) Galacturonan (c) Arabinan (d) None of these 15. Raffinose consists of how many monosaccharide units? (a) 5 (b) 4 (c) 3 (d) None 16. Sucrose is a: (a) Reducing sugar (b) Nonreducing sugar (c) Both (d) None of these 17. Maltose is a reducing sugar because one of the glucose units has free OH at carbon number….. (a) 3 (b) 2 (c) 1 (d) None Ans.

9. (b) 20. (c)

10. (b) 21. (c)

11. (b) 22. (a)

12. (d) 23. (g)

13. (d) 24. (d)

18. D-fructose is also known as: (a) Fruit sugar (b) Levulose (c) Both (d) None 19. D-glucose is also known as: (a) Dextrose (b) Grape sugar (c) Both (d) None of these 20. Arabinose is also known as: (a) N-sugar (b) M-sugar (c) L-sugar (d) None of these 21. The highest number of asymmetric carbon atom is present in: (a) Fructose (b) Glucose (c) Arabinose (d) None of these 22. Almost all the sugars in plant are: (a) L-sugars (b) D-sugars (c) Both (d) None of these 23. Among the followings, which one is structural polysaccharide? (a) Mucilage (b) Gum (c) Chitin (d) Pectic substance (e) Hemi-cellulose (f) Cellulose (g) All of the above 24. What are the characteristics of polysaccharides? (a) Insoluble in water (b) Tasteless (c) Amorphous in nature (d) All of the above 25. The sugar residue of amylase is: (a) Galactose units only (b) In 4 linkages (c) Fructose unit only (d) None of the above 26. Which of the following statement is best suited for identification of glucose? (a) Carbon 2 is the anomeric carbon atom (b) It is a ketose (c) It form part of the disaccharide sucrose (d) None of the above 14. (a) 25. (d)

15. (c) 26. (c)

16. (b)

17. (c)

18. (c)

19. (c)

Carbohydrate Metabolism in Plants

(b) These are simplest of carbohydrate and are known as sugar (c) These are the building units of complex carbohydrate (d) These cannot be hydrolysed (e) All of the above

27. Six membered ring structure of aldohexoses is known as: (a) Cyclic form (b) Furanose form (c) Both (d) None of these 28. Which of the following is not an oligosaccharide? (a) Inulin (b) Maltose (c) Sucrose (d) Raffinose 29. Which of the following is not a reducing sugar? (a) Glucose (b) Ribose (c) Maltose (d) Sucrose 30. Which of the following is the example of trisaccharides? (a) Gentianose (b) Raffinose (c) Both (d) None of these 31. Which of the following is the example of disaccharides? (a) Lactose (b) Sucrose (c) Maltose (d) All of the above 32. Which of the following is the correct regarding oligosaccharides: (a) They are soluble sugar (b) They are sweet in test (c) They are crystalline (d) All of the above 33. In ketose sugars, reducing center always lies as carbon number: (a) 3 (b) 1 (c) 2 (d) None of these 34. In aldose sugar, aldehyde group or reducing center always lies at carbon number: (a) 3 (b) 1 (c) 2 (d) None of these 35. What are the characteristics of monosaccharides? (a) These are sweet tasting crystalline and soluble in water

Ans.

27. (d) 38. (d)

28. (a) 39. (c)

29. (d) 40. (c)

30. (c) 41. (d)

31. (d)

215

36. Among the following which one is known as polysaccharide? (a) More than one (b) Insulin (c) Starch (d) Cellulose 37. Among the following which one is known as polysaccharide? (a) More than one (b) Inulin (c) Starch (d) Cellulose 38. Which of the following statement is correct? (a) Carbohydrate is polyhydroxyaldehydes (b) Carbohydrates correspond to general formula (CH2O)n (c) Carbohydrates are hydrates of carbon (d) All of the above 39. Carbohydrate is commonly referred as: (a) Polyhydroxyketones (b) Polyhydroxyaldehydes (c) Both (d) None of the above 40. Besides containing C, H and O some carbohydrate also contains: (a) Sulfur (b) Nitrogen (c) Both (d) None of these 41. Some organic compound follows the general formula of carbohydrate but these compounds are not carbohydrate. Which is an example of such type of compound? (a) Lactic acid (b) Formaldehyde (c) Acetic acid (d) All of the above

32. (d)

33. (c)

34. (b)

35. (e)

36. (a)

37. (d)

216

Plant Physiology: Question Bank

11 Sulfur Assimilation and Metabolism in Plants 1. Sulfate activation is catalyzed by: (a) ATP kinase (b) ATP sulfotransferase (c) ATP sulfurylase (d) None of the above 2. Sulfate assimilation can be divided into three steps such as: (a) Incorporation of sulfide into cysteine (b) Activation (c) Reduction to sulfide (d) All of the above 3. The reduction of sulfate to sulfite is an energy intensive process that consumes ...... kJ per mol. (a) 532 (b) 732 (c) 632 (d) None of these 4. Sulfur uptake is meditated by a transporter that is powered by a ...... across root cell plasma membranes: (a) Potassium gradient (b) Proton gradient (c) Sodium electrogenic gradient (d) None of the above 5. What are the roles of DMSO? (a) Repellant against planktonic herbivores (b) Osmoprotectant (c) Cryprotectants (d) All of the above Ans.

1. (c)

2. (d)

3. (b)

4. (b)

5. (c)

6. Marina alga produced ...... a tertiary sulfur analog of the quaternary nitrogen compound known as betains: (a) Oxidized product of DMSP, i.e DMSO (b) Dimethylsulfoniopropionate (DMSP) (c) Both (a) and (b) (d) None of the above 7. ...... is the greatest contributor of atmospheric sulfur. (a) Cultivation of soil (b) Burning of fossil fuels (c) Atmospheric lightning (d) None of the above 8. Some anaerobic bacteria use sulfate as a terminal electron acceptor analogous to the way that aerobic organisms use oxygen. This process is known as: (a) Utilization (b) Assimilation (c) Dissimilation (d) None of these 9. The inter conversion of oxidized and reduced sulfur states on earth is known as: (a) Oxidation cycle of sulfur (b) Reduction cycle of sulfur (c) Biogeochemical cycle of sulfur (d) None of the above 6. (b) 216

7. (b)

8. (c)

9. (c)

Sulfur Assimilation and Metabolism in Plants

10. In crop plants, particularly ......, are methionine deficient: (a) Oil seeds (b) Legumes (c) Cereals (d) None 11. Sulfur containing phytoalexins such as ......, are produced by members of the Brassicaceae in response to pathogen attack. (a) Zamalexin (b) Pamadexin (c) Pamalexin (d) None of these 12. Which of the following compound is sometimes referred to as vitamin U? (a) SAM (b) Biotin (c) S-methyl methionine (d) None 13. Glutathione produced during sulfur assimilation is involved in: (a) Response to environmental stress (b) Metabolism of herbicides (c) Transport of reduced sulfur (d) Storage of reduced sulfur (e) Redox control (f) All of the above 14. “Glucosinolates contain both reduced and oxidized sulfur”. This statement is: (a) False (b) True (c) Not known (d) None of these 15. Teritary structure of proteins is stabilized by: (a) Ionic bonds (b) Disulfide bonds (c) H-bond (d) All of the above 16. Disulfide bond can be formed by ….. of thiol groups of two cysteine residues: (a) Reduction (b) Oxidation (c) Both (d) None of these 17. Which of the following amino acid is considered as sulfur donor in many reactions? (a) Aspartate (b) Methionine (c) Cysteine (d) None of these Ans.

10. (b) 21. (a)

11. (c) 22. (d)

12. (c) 23. (d)

13. (f) 24. (c)

14. (b)

217

18. Synthesis of methionine from cysteine occurs in: (a) Amyloplast in roots (b) Chloroplast in shoots (c) Chloroplast in leaves (d) None of the above 19. Assimilation of sulfate into cysteine in higher plants is: (a) Oxidative process (b) ATP-dependent reductive process (c) ATP-dependent oxidative process (d) None of the above 20. Sulfur assimilation in higher plants occurs mainly in: (a) Leaves (b) Fruits (c) Roots (d) None 21. Higher plants absorb sulfur from the surrounding environment mainly in the form of: (a) Sulfate (b) Sulfite (c) Sulfide (d) None of these 22. Reduction of sulfate into cysteine entails transfer of: (a) 12 electrons (b) 8 electrons (c) 10 electrons (d) 6 electrons 23. Which of the following compound does not contain sulfur? (a) Biotin and lipoic acid (b) Cysteine and thiamine (c) Coenzyme A and glutathione (d) None of the above 24. Sulfur containing amino acids which constitute proteins are: (a) Cysteine and serine (b) Methionine and histidine (c) Cysteine and methionine (d) None of the above 25. What are the roles of Sulfur in higher plants? (a) It plays important role in electron transport through iron-sulfur cluster 15. (d)

16. (b)

17. (c)

18. (c)

19. (b)

20. (a)

218

Plant Physiology: Question Bank

(b) Disulfide linkage in proteins helps to stabilize their structure and also play important regulatory role (c) Sulfur is important constituent of amino acid cysteine and methionine (d) All of the above 26. Reduction of sulfate and its assimilation takes place in: (a) Plastids of leaves (b) Plastids of shoot (c) Plastids of root (d) More than one 27. In the process of sulfur uptake, reduction and transport in plants, sulfate is stored in: (a) Mitochondria (b) Chloroplast (c) Vacuole (d) None of these 28. Which of the following is the correct equation of reduction of sulfate to sulfide? (a) SO42 + ATP + 5e– + 8H+  S2 + 3H2O + AMP + PPi (b) SO42 + ATP + 6e– + 8H+  S2 + 2H2O + AMP + PPi (c) SO42 + ATP + 8e– + 8H+  S2 + 6H2O + AMP + PPi (d) None of the above

Ans.

25. (d)

26. (d)

27. (c)

28. (c)

29. (b)

29. Sulfate enters a plant primarily through the roots by way of ...... Uptake mechanism. (a) Passive (b) Active (c) Both (d) None of these 30. Which of the following is sulfur containing amino acid? (a) Glycine (b) Threonine (c) Methionine (d) All the above 31. Sulfur assimilation in higher plants occur chiefly in: (a) Leaves (b) Roots (c) Fruits (d) Immature seeds 32. Which of the following is an early product of sulfur assimilation in plants? (a) Coenzyme A (b) Methionine (c) Cysteine (d) None of these 33. Major source of acid rain is: (b) HCl (a) H2SO4 (c) HNO3 (d) All of these

30. (c)

31. (a)

32. (c)

33. (a)

Nitrogen Metabolism and Biological Nitrogen Fixation

219

12 Nitrogen Metabolism and Biological Nitrogen Fixation 1. In most of the plants, activation of nif genes transcription is done by the nitrogen sensitive ...... protein. (a) NifC (b) NifB (c) NifA (d) None of these

7. What are the characteristics of genus Rhizobium? (a) Genes of nitrogen fixation and nodulation resides on symplasmaid (b) Grow fast on culture media (c) Both (d) None of these

2. The concept “altruism in the rhizosphere” was suggested by: (a) SA Frank (b) I Olivieri (c) Both (a) and (b) (d) None of these

8. Agrobacterium is closest relative genus: (a) Azorhizobium (b) Rhizobium (c) Bradyrhizobium (d) None of these

3. Actinomycete association with pant roots is called: (a) Gigaspora (b) Mycorrizae (c) Actinorhizae (d) None of these 4. Rhizobium is: (a) Gram +ve (c) Not known

9. Heterotrophic nutrition is found in: (a) Vallisneria (b) Drosera (c) Optunia (d) Pistia

(b) Gram –ve (d) None of these

10. “Soil ecology is the study of the interactions among soil organisms and between biotic and abiotic aspects of the soil environment”. This statement is: (a) False (b) True (c) Not known (d) None of these

5. What are the characteristics of genus Azorhizobium? (a) Capable of free-living nitrogen fixation (b) Genes of nitrogen fixation and nodulation reside on chromosome (c) Grow slow on culture media (d) All of the above

11. Successful infections of Rhizobia may be visible ...... to ...... days after inoculation and active N2 fixation beginning ...... to ...... days thereafter. (a) 1 to 2, 8 to 15 days (b) 10 to 16, 8 to 15 days (c) 5 to 6, 8 to 15 days (d) None of the above

6. What are the characteristics of genes Bradyrhizobium? (a) Genes of nitrogen fixation and nodulation reside on chromosome (b) Grow slow on culture media (c) Both (d) None of these Ans.

1. (c)

2. (c)

3. (c)

4. (b)

5. (d)

6. (c) 219

7. (c)

8. (b)

9. (b)

10. (b)

11. (c)

220

Plant Physiology: Question Bank

12. Nodules which have a large ...... or ...... region, will usually be active in N 2 fixation, and are said to be effective. If the module is ...... or ...... region is said to be senescing: (a) White, black, violet, pink (b) Greenish, pink, red, white (c) Pink, white, red, greenish (d) Pink, red, white, greenish 13. In root nodules the oxygen level regulated by a special hemoglobin-leghemoglobin. The globin protein is encoded by ...... but the heme cofactor is made by the ...... . (a) Plant genes, plant genes (b) Symbiotic bacteria, plant genes (c) Plant genes, symbiotic bacteria (d) None of the above 14. The first Rhizobia was isolated from nodules by ...... . (a) Tate (b) Ladha (c) Beijerinck (d) None of these 15. “All diazotroph contain iron-molybdenum nitrogenase system”. This statement is: (a) False (b) True (c) Not known (d) None of these 16. ...... is an organism that is able to grow without external source of fixed nitrogen: (a) Postgate (b) Dixon (c) Diazotroph (d) None of these 17. What is the EC number for nitrogenase enzyme? (a) 1.16 .5.1 (b) 1.17.6.1 (c) 1.18.6.1 (d) None of these 18. What is the pH for Rhizobium fertilizer? (a) 4.5–5.5 (b) 2.5–3.5 (c) 6.5–7.5 (d) None of these 19. What is the viable cell count of Rhizobium biofertilizers? (b) 108 cell/g (a) 109cell/g (d) None of these (c) 107 cell/g Ans.

12. (d) 23. (d)

13. (c) 24. (a)

14. (c) 25. (c)

15. (b) 26. (d)

16. (c) 27. (c)

20. Which of the following stage of Rhizobium is nitrogen fixing form? (a) Nod factor stage (b) Symbiosome stage (c) Bacteroid stage (d) None of these 21. Which scientist first described rhizosphere? (a) TRG Gray (b) Lorenz William (c) Lorenz Hiltner (d) None of these 22. The Rhizobia enter into roots of leguminous host plant through: (a) Meristematic regions (b) Epidermal cells (c) Root hairs (d) None of the above 23. Which of the following is not required for biological nitrogen fixation? (a) Reduced ferredozin (b) ATP (c) Mg++ (d) None of the above 24. From root hairs, Rhizobia penetrate deep into cortex of host root through: (a) Infection thread (b) Plasmodesmata (c) Cortical cell walls (d) All of the above 25. Which of the following is not found in root nodules of legumes? (a) Uninfected diploid cells (b) Infected tetraploid cells (c) Infected diploid cells (d) None of the above 26. Which of the following enzyme(s) is involved in assimilation of ammonia in plants? (a) GS (b) GOGAT (c) GDH (d) All of the above 27. Fe-protein of nitrogenase complex is encoded by: (a) Nif K (b) Nif D (c) Nif H (d) None of these 17. (c)

18. (c)

19. (c)

20. (b)

21. (c)

22. (c)

Nitrogen Metabolism and Biological Nitrogen Fixation

28. The midpoint reduction potential of the reaction catalyzed by Dinitrogenease reductase is about: (a) –100 m V (b) –200 m V (c) –400 m V (d) None of these 29. Dinitrogenease is ..... KDa heterotetramer enzyme. (a) 150 (b) 200 (c) 240 (d) None of the above 30. The amount of nitrogen fixed by biological nitrogen fixation in marine system is: (a) 80 Tg/year (b) 30–300 Tg/year (c) 90–140 Tg/year (d) 100,000 X (c) Chromogenic stains which consist of a single dye rather than several antibodies to detect are known as basic status (d) All of the above 144. Electron microscope does not help in indentifying the section of bacterial spore: (a) Capsule (b) Spore cortex (c) Core (d) All of these 145. Differential staining of bacteria spore is related to: (a) Indian ink preparation (b) Molar’s staining (c) Albert‘s staining (d) Lugol‘s staining 146. Treponema pallidum can be best identified using: (a) Dark field microscope (b) Bright field microscope (c) Fluorescence microscope (d) All of these 147. A 3-dimensional appearance with higher resolution than SEM can be obtained by TEM by: (a) Using fluorescent dyes (b) Staining (c) Shadowing (d) Casting 148. In ...... type of microscope, the field surrounding a specimen appears black, while the object itself is brightly illuminated: (a) Fluorescence microscope (b) Dark field microscope (c) Phase contrast microscope (d) Compound microscope

Ans. 137. (c) 138. (d) 139. (a) 140. (d) 141. (b) 142. (b) 143. (c) 144. (a) 145. (d) 146. (b) 147. (c) 148. (a)

386

Plant Physiology: Question Bank

149. If green light of wavelength 500 nm objective with NA 1.4 is used, then the resolution will be: (a) 178 m (b) 78 nm (c) 178 X (d) None of these 150. ...... is the ability to reveal closely adjacent points as separate and distinct: (a) Numerical aperture (b) Resolution (c) Magnification (d) None 151. The ...... is the focal length divided by the ‘effective‘ aperture: (a) F-number (b) Numerical aperture (c) Resolution (d) Magnification 152. Which type of electrons is responsible in image formation in TEM? (a) Secondary electrons emited by primary electrons (b) Secondary electrons reflected from the object (c) Primary electrons of the beam which transmitted through object (d) All of these 153. Which of the following statement is false? (a) Negative stains color the structures of interest a deep black (b) Dark field microscopy is best for visualizing live, motile microorganism (c) Even on the best microscope, increasing total magnification beyond 1500 cannot result in between resolution of the image (d) Objective lenses with the higher magnification generally have shorter working distance 154. In EM, the passage of the electrons beam through a very small aperture at the back focal plane of the objective ...... its numerical aperture significantly, firming the image: (a) Decreases; reflected (b) Increase; reflected

(c) Decreases; scattered (d) Increase; scattered 155. Among the following statement is incorrect? (a) Fluorescence stains color the structures of interest a deep black (b) Mineral field microscopy is best for visualizing live, motile microorganism (c) Polarization microscope, increasing total magnification beyond 1500 cannot result in between resolution of the image (d) The objective lenses with the higher magnification generally have shorter working distance 156. How does an oil immersion lens enhance the power of resolution of a microscope? (a) Preventing direct light rays from reaching the eyepiece lens systems (b) Decreasing the chromatic aberrations of lens systems (c) Reducing the spherical aberration of lens system (d) Increasing the numerical aperture of the objective 157. Which of the following statement is incorrect? (a) Fluorescence microscopy must be done on fixed and stained microorganism (b) The fluorescence microscope has become an essential tool in medical microbiology to identify bacterial pathogens (c) Microscope resolution increases as the wavelength of radiation used to illuminate the specimen decreases (d) In a compound microscope, the primary image is formed by an objective lens and enlarged by the optical lends to reveal the virtual image

Ans. 149. (b) 150. (b) 151. (a) 152. (c) 153. (a) 154. (c) 155. (c) 156. (d) 157. (a)

Instrumentation in Plant Physiology

158.

I. EEG represents the spontaneous electrical activity of the brain II. Alpha waves are found in normal awake adults III. Beta waves appear during faster activity IV. Delta waves found during deep sleep Select the correct statement regarding electroencephalograph (EEG)? (a) I, III and IV (b) I, II, III and IV (c) II, III and IV (d) I, II and III

159. Match List–I with List–II and select the correct answer using the codes given below the lists: List–II List–II A. ECG 1. Developed by Godfrey Hounsfield B. CAT 2. Based on the detection of positrons emitted by radioisotopes C. PET 3. Map internal tissues D. MRI 4. Record the electric activity of the heart

Codes: A B C D (a) 2 4 3 1 (c) 3 2 1 4

A B C D (b) 1 3 4 2 (d) 4 1 2 3

160. Most C elegans electrophysiology so far has been done on the: (a) Pharynx (b) Heat (c) Brain (d) Lungs 161. Electropharyngeograms (EPGs) are analogous to: (a) EMG (b) ECG (c) EEG (d) Both (b) and (c) 162. Levamisole used in electrophysiological experiments, is an: (a) Acetylcholine blocker (b) Acetylcholine inhibitor (c) Acetylcholine agonist (d) Acetylcholine antagonic 163. A 60-year-old man with unstable angina on long-term digoxin was being monitored on the ward with telemetry when the monitor displayed a tachycardia of 180 bqm. The printout

387

showed discrete P waves before each QRS complex and there was an acceleration in the rate after initiation of the arrhythmia. The QRS width was 0.12 s. which of the following is the most likely arrhythmia? (a) Intra–atrial re-entry (b) Bypass tract-ediated macroentrant tachycardia (c) AV nodal re-entrant tachycardia (d) Automatic supreventricular tachycarrhythmias 164. A 60-year-old man’s ECG shows a combination of a prolonged QT interval with tall T-waves this is suggestive of: (a) Metabolic alkalosis (b) Uremia (c) Hypocalcemia (d) Hypokalemia 165. A patient with an arotic valve replacement develops right hemiparesis. CT scan shows cerebral infraction. There is no evidence of cerebral hemorrhage. The INR is 2.0. How mould you manage this case? (a) Continue warfarin and intravenous heparin (b) Increase the dose of warfarin (c) Stop warfarin and start intravenous heparin (d) Reverse the anticoagulation with vitamin K 166. A 50-year-old professor of economics presents with a 6-week history of progressive breathlessness and bilateral ankle swelling. The ECG shows inverted p in V and partial LBBB. Echoradiography confirms pathy. Which of the following statement is true? (a) Viral illness in the past in unrelated (b) Past cytotoxic drug therapy is relevant (c) A family history of similar problem is unrelated

Ans. 158. (b) 159. (d) 160. (a) 161. (d) 162. (c) 163. (d) 164. (b) 165. (c) 166. (b)

388

Plant Physiology: Question Bank

(c) Intravenous flecainide (d) Intravenous amiodarone

(d) There is no relevance of history of alcohol abuse 167. A 78-year-old man present to causality with a history of syncope. An ECG shows inverted in bilateral heart block. Which of the following physical signs is consistent with the diagnosis? (a) Basal systolic pressure (b) Low volume pulse (c) Soft first heart sound (d) Regular cannon waves on JVP 168. The WHO criteria for the diagnosis of acute myocardial infraction requires the presence of: (a) Rise and fall in serum cardiac markers (b) Evolutionary ECG changes (c) History of is chaotic type chest discomfort (d) All of the above 169. A 50- year-old male is brought to A and E with acute onset central chest pain that started 1 ½ hours ago. His ECG taken on arrival ST elevation of 4 mm in leads II, III,aVF and V4–V6 with hyperacute T waves. His pulse was 60 per minute and his BP was 146/60. The SaO-2 was 92%. He was given O2 by mask and two large intravenous cannulas were inserted. Which of the following blood tests would be most useful prior to definitive treatment? (a) LDH (b) Myglobin (c) Troponin I (d) None of these

171. A 68-year-old woman recently diagnosed with multiple myeloma presents to her GP with progressively increasing breathlessness, exercise in tolerance and a ankle swelling. On examination, there is bilateral pitting leg edema to her thighs, ascites and released JVP. The apical impulse in impalpable. An ECG shows diffusely diminished voltage. Chest X-ray is normal and the echocardiogram shows small thick ventricles and dilated atria with a thickened instratrial septum. The ventricular myocardium has a granular sparking texture on echo, and the minimal fluid in the pericardial space is noted. What is the most diagnosis? (a) Restrictive cardiomyopathy (b) Constrictive pericarditis (c) Chronic pericardial effusion without tamponade (d) Chronic pericardial effusion with tamponade 172. Which of the following statements represent the most correct interpretation of the ECG shown below:

170. A 32-year-old man with WolfParkinson-White syndrome presents with a 2-hour history of palpitations and breathblesness. On examination, his heart rate is 190 beats/min. ECG shows broad-complex tachycardia. What would be your first line of treatment? (a) DC cardioversion (b) Intravenous adenosine Ans. 167. (a) 168. (d) 169. (d) 170. (b) 171. (a) 172. (b)

z

(a) The path of spread of excitation was normal (b) Both heart sounds would have been present at X beat (c) X beat reset the cardiac rhythm (d) X beat originated from an atrial focus

Instrumentation in Plant Physiology

173. Suppose you constantly faces headache problem and the doctor advised you to go for a ECG scan. When you close your eyes and relaxed a ECG signal is recorded. Which of the following wave pattern more likely you can expect:

389

(c) It provides much greater contrast between the different (d) It is based on the magnetic resonance principle 176. In some embryons there is no distinction of plumule, radicle and cotyledons at the time of shedding of seeds. It is of: (a) Orobanche (b) Utricularia (c) Orchis (d) All of the above 177. In patch clam setup, the word ‘patch‘ represents: (a) Open tip of micropipette with a membrane surface (b) The open tip of micropipette (c) The open tip of micropipette (d) The shape of glass micropipette

174. Which of the following statement is correct regarding tMRI? (a) It has come to dominate the brain mapping field due to its low invasiveness (b) Ti is a type of specialized MRI scan and one of the most recently developed forms of neuron (c) Both (a) and (b) (d) All of these 175. Which of the following statement is false regarding MRI scanning technique? (a) It is especially useful in neurological (b) It uses to ionizing powerful magnitude

178. Which of the following statement is correct regarding single unit recording? (a) The recorded is especially useful in neurological (b) Recordings uses to ionizing powerful magnitude (c) Microelectrons provides much greater contrast between the different (d) All of the above 179. Electrophysiological studies deal with: (a) Lungs (b) Spinal cord (c) Heart (d) Brain 180. Which of the following statements are correct in sense of Lincoln Peterson method application. I. Reproductive history of the population II. Mortality pattern of species III. Seasonal pattern of activity and movement IV. Effects of marking on behavior and physiology of animals (a) I, III and IV (b) I, II, III and IV (c) II, III and IV (d) I, II and III

Ans. 173. (c) 174. (d) 175. (b) 176. (d) 177. (a) 178. (d) 179. (d) 180. (b)

390

Plant Physiology: Question Bank

181. Consider the following statements. I. Frequencies density and dominance are summarizing in quadrate data II. Line intercept analysis of individuals cover area and frequency III. Importance value index is the sum of RF and RD Which of the above statements is an a correct? (a) I and III (b) II and III (c) I and II (d) I, II and III 182. As per quartet of species sampling, which of the following statement is correct for the following areas?

(b) Frequency; absorb (c) Wavelength; emit (d) Frequency; emit 185. Which of the following statements is true? (a) A greater area can be covered in oblique rather than vertical remote sensing imagery (b) A greater area can be covered in vertical rather than oblique remote sensing imaginary (c) An equal area is covered by both vertical and obliqe remote sensing imagery (d) All of the above 186. Footprint identification technique (FIT) is sued for: (a) Rhinos (b) Snakes (c) Fishes (d) Insects

(a) Species A will be counted white species (b) Species A and B will not be counted (c) Species A and B both will be counted (d) Species A will be counted while B is under revision 183. Bird Life International is in the presence of documenting sites of global importance for conservation in its species are categorized in Endemic Bird Area (ERA): (a) Congregator species (b) Biome restricted species (c) Globally threatened species (d) Restricted range species 184. Ground based devices are categorized by the ...... of the electromagnetic signal they: (a) Wavelength; absorb

187. Which of the following is experimental design in file biology experiments? (a) Mixed model designs (b) Regression designs (c) ANOVA designs (d) All of these 188. In the first ecosystem which of the field biology tools you will prefer for species area curves? (a) Importance values of trees along a gradient of elevation (b) Basal area (c) Dominance (d) All of the above 189. Arrange the different steps as they are followed during comparative protein structure modeling: I. Target sequences II. Identify related structures III. Select templates IV. Align target sequence with template structure V. Evaluate model (a) I, III and IV (b) I, II, III and IV (c) II, III and IV (d) I, II and III

Ans. 181. (d) 182. (a) 183. (d) 184. (c) 185. (a) 186. (a) 187. (d) 188. (d) 189. (b)

Instrumentation in Plant Physiology

190. Which of the following tool is not used for homology modeling? (a) PROSPECT (b) CONGEN (c) MODELLER (d) COMPOSER 191. Which of the following step is a part if the homology modeling? (a) Evaluation of the quality of the model (b) Building a model for the query protein based on its alignment with the template structure (c) Identification of protein templates with alignment and its templates (d) All of the above 192. Bio Carat, WIT and Gene Net database in an example of protein, DNA and small molecule interaction database? (a) Operon database (b) Metabolic and signaling pathway database (c) Gene expression database (d) None of the above 193. Which of the following database is not useful for interaction studies of protein, DNA and/or small molecules? (a) ECOCYC (b) MINT (c) LIGAND (d) BIND 194. Which of the following web server is used to identify post-translational modification or cleavage? (a) NetPico (b) Net PHos (c) Prosite (d) All of these 195. Which of the following web server is used to identify protein domains? (a) DomFISH (b) SMART (c) BLOCKS (d) All of these 196. ...... is the number of different alignment with score equal to or better than substitution score that are expected to occur by chance in a database search of this particular database: (a) G-score (b) S-score (c) E-value (d) F-value 197. FASTA program is more sensitive for the comparison of: (a) Protein comparison sequence

391

(b) DNA comparison sequence (c) DNA-protein comparison sequence (d) DNA-RNA comparison sequence 198. PROCAT is an example of: (a) Database for energetic based protein family (b) Database for structure based protein family (c) Database for function based protein family (d) Database for sequence based protein family 199. Find the unmatched. I. Reproductive history of the population II. Mortality pattern of species III. Seasonal pattern of activity and movement IV. Effects of marking on behavior and physiology of animals (a) I, III and IV (b) I, II, III and IV (c) II, III and IV (d) I, II and III 200. Which of the following BLAST program do not involve the comparing protein/nucleotide queries from a nucleotide database? (a) TBLASTX (b) TBLASTN (c) BLASTX (d) BLASTN 201. ...... program compares a protein query from a protein database: (a) TBLASTN (b) BLASTX (c) BLASTN (d) BLASTP 202. How many types of BLAST programs have been developed to support sequence similarity searching using variety of nucleotide and protein sequence queries and databases? (a) 9 (b) 5 (c) 3 (d) 2 203. Which of the following method is useful in computing the probability that an amino acid belongs to a particular secondary structure data? (a) Helical wheel method (b) EMBL NN method (c) PSA method (d) None of these

Ans. 190. (a) 191. (d) 192. (b) 193. (a) 194. (d) 195. (d) 196. (c) 197. (b) 198. (c) 199. (b) 200. (c) 201. (d) 202. (b) 203. (c)

392

Plant Physiology: Question Bank

21

Physiology of Crop Plants 1. Removal of inflorescence in tobacco is known as: (a) Plugging (b) Nipping (c) Topping (d) None of these

8. In soybean, the oxygen requirement and nutrient uptake were greater during ...... stages than during ...... stages. (a) Flowering, seedling (b) Reproductive, vegetative (c) Vegetative, reproductive (d) None of the above

2. The characteristic leaf number for sorghum is: (a) 12–14 (b) 10–11 (c) 7–14 (d) None of these

9. “Shoot-root ratio can be increased by increasing the amount of nitrogen in the soil”. This statement is: (a) Unpredictable (b) False (c) True (d) None of these

3. The characteristic leaf number for wheat, oat and barley is: (a) 12–14 (b) 10–11 (c) 7–9 (d) None

10. If we increase bulk density of soil then root growth will be: (a) Not affected (b) Increasing (c) Decreasing (d) None of these

4. The interval of time between the appearance of successive of the tip of successive leaves is termed: (a) Phyllomer (b) Phyllochron (c) Both (d) None of these

11. Adventitious roots are also referred to as: (a) Coronal root (b) Crown root (c) Nodal root (d) All of the above

5. The interval of time between the appearances of successive leaf primodia termed: (a) Phyllochron (b) Plastochron (c) Both (d) None

12. The average lifespan of root hair is ...... at moderate temperature: (a) 100 h (b) 20 h (c) 50 h (d) None

6. Phytomers develop: (a) Indeterminately (b) Acromegaly (c) Both (a) and (b) (d) None of these

13. Formation of lateral roots is the result of which of the following factor? (a) A balance or interaction between growth-promoting and growthinhibiting substances

7. ...... is considered as carbohydrate factories of the crop plants. (a) Root (b) Leaf (c) Shoot (d) None of these Ans.

1. (c) 12. (c)

2. (c)

3. (c)

4. (b)

5. (c)

6. (c) 392

7. (b)

8. (c)

9. (c)

10. (a)

11. (d)

Physiology of Crop Plants

Leaf dry weight (g) Total fresh weight (g) Leaf dry weight (g) (b) LAR = Total dry weight (g) Total dry weight (g) (c) LAR = Leaf dry weight (g) Leaf fresh weight (g) (d) LAR = Total dry weight (g)

(b) Production of growth-promoting substances in the shoot, which are transported to the roots (c) Production of -inhibitor in root tip, which is related to apical dominance (d) All of the above 14. Quiescent center is not present in apical meristems of: (a) Root (b) Stem (c) Both (d) None of these 15. What is the unit of biomass duration? (a) AT (b) T (c) WT (d) None of these

(a) LAR =

20. What is the formula of relative growth rate (RGR)? dw 1  dt w dt 1 (b) RGR =  dt w 0 dw 1  (c) RGR = dt w0

(a) RGR =

16. What is the unit of leaf area duration? (a) AT (b) T (c) WT (d) None of these 17. What is the formula of net assimilation rate (NAR)? w – w2 InLA 2 – InLA1  (a) NAR = 1 T2 – T1 LA1 – LA 2 w2 – w1 InLA 2 – InLA1 (b) NAR =  T1 – T2 LA1 – LA 2 w – w1 InLA 2 – InLA1 (c) NAR = 2  T2 – T1 LA 2 – LA1 w2 – w1 InLA1 – InLA 2 (d) NAR =  T1 – T2 LA 2 – LA1 18. What is the formula of specific leaf area (SLA)?

(a) SLA =

Leaf by weight (g) Leaf area (cm 2 )

(b) SLA =

Leaf area (cm 2 ) Leaf by fresh weight (g)

(c) SLA =

Leaf area (cm 2 ) Leaf by weight (g)

(d) SLA =

Leaf area (cm 2 ) Leaf by any weight (g)

19. What is the formula of leaf area ratio (LAR)? Ans.

13. (d) 24. (c)

14. (b)

15. (c)

16. (b)

17. (c)

393

dw0 1  dt w 21. Which of the following stains is used in the staining of root cell? (a) Congo pink (b) Congo blue (c) Congo red (d) None of these

(d) RGR =

22. Which of the following technique is used for studying of root growth in plant? (a) Allometry method (b) Raioactive isotope method (c) Core sampling method (d) Framed monolith and pinboard method (e) Trench profile method (f) Soil moisture depletion method (g) Minirhizotron method (h) All of the above 23. ...... expresses the leafiness during the period of crop growth. (a) CGR (b) NAR (c) LAD (d) None 24. Biomass duration is analogous to: (a) CGR (b) LAI (c) LAD (d) None 18. (c)

19. (b)

20. (c)

21. (c)

22. (h)

23. (c)

394

Plant Physiology: Question Bank

25. Which of the following is the prerequisites for differentiation processes in plants? (a) A proper enzyme system to mediate the differentiation process (b) A favorable temperature (c) Available assimilate in excess of most metabolic uses (d) All of the above 26. “The increase in any crop produced by a unit increment of a deficient factor is proportional to the decrement of that factor from the maximum”. This famous statement was made by: (a) Macy (b) Mitscherlich (c) FF Blackman (d) None of these 27. Law of diminishing returns for plant growth was given by: (a) Macy (b) Mitscherlich (c) FF Blackman (d) None of these 28. “When a process is conditioned as to its rapidity by a number of separate factors, the rate of the process is limited by the pace of the slowest factors.” This famous statement was made by: (a) Macy (b) Mitscherlich (c) FF Blackman (d) None of these 29. Theory of ‘’optimum and limiting factors” was given by: (a) Macy (b) Mitscherlich (c) FF Blackman (d) None of these 30. “A deficiency or absence of one necessary constituent, all others being present renders the soil barren for crops for which that nutrient is needed”. This statement was made by: (a) Macy (b) JV Liebig (c) FF Blackman (d) None of these 31. What are the internal factors which affect the growth and development of plants? (a) Resistance to climate, edaphic and biological stresses (b) Partitioning of assimilates Ans.

25. (d) 36. (c)

26. (b)

27. (b)

28. (c)

29. (c)

(c) Type and location of meristems (d) Epistasis (e) Heterosis (f) Differentiation (g) Respiration (h) Photosynthetic rate (i) All of the above 32. Plant development includes: (a) Only differentiation of plant (b) Only growth of plant (c) Both growth and differentiation of plant (d) None of the above 33. Plant growth can be expressed as: (a) Genotype – environment (b) Genotype + environment (c) Genotype × environment (d) None of the above 34. The relationship between the growth rates of individual parts of an organ or organism is referred to as: (a) Leaf area ratio (b) Allometer (c) Allometry (d) None of the above 35. Photosynthesis produced and deposited in grain come from: (a) Remobilization of assimilates from storage pars (b) Current photosynthesis from parts other than leaf (c) Current leaf photosynthesis (d) All of the above 36. The movement of compounds from an area where they were once deposited to an area where they can be reutilized is referred to as: (a) Utilization (b) Mobilization (c) Remobilization (d) None of these 37. Yield component = (a) Grain yield + number of reproductive units per unit of ground area the number of grain per 30. (b)

31. (a)

32. (c)

33. (c)

34. (c)

35. (d)

Physiology of Crop Plants

reproductive units × the average weight of the grain (b) Grain yield × number of reproductive units per units of ground area × the number if grains per reproductive units × the average weight of the grain (c) Grain yield + number of reproductive units per unit of ground area + the number of grains per reproductive unit + the average weight of the grain (d) None of the above 38. Specific mass transfer (SMT) rate for several species is: (a) 12–15 g cm–2 hr–1 (b) 9–10 g cm–2 hr–1 (c) 3–5 g cm–2 hr–1 (d) None of these 39. Specific mass transfer (SMT) = (a) Weight of the assimilate produced per cross-sectional area of phloem per unit of time (b) Weight of the assimilate moved per cross-sectional area of xylem per unit of time (c) Weight of assimilate moved per cross-sectional area of phloem per units of time (d) None of the above 40. What is the concentration of nonreducing sugar in phloem sap? (a) 5–10% (b) 30–45% (c) 10–25% (d) None 41. “Partitioning of assimilates and inorganic nutrients affects both productivity and survival of the plant”. This statement is: (a) False (b) True (c) Not known (d) None of these 42. What are the strategies for maximizing solar radiation utilization and crop yields? (a) Planting at a time that provides total ground cover during the period of maximum solar radiations level Ans.

37. (c) 48. (c)

38. (c) 49. (c)

39. (c)

40. (c)

41. (b)

395

(b) Planting at seedling rate (c) Early planting for earlier leaf area development (d) All of the above 43. Photosynthetic response to radiation is ...... and radiation efficiency is greatest at ......, the ...... leaf is more efficient per unit of radiation intercepted. (a) Curvilinear, low radiation level, horizontal (b) Curvilinear, high radiation level, vertical (c) Curvilinear, low radiation level, vertical (d) None of the above 44. Planhile canopy is predominant in: (a) Fruit plants (b) Vegetables (c) Legumes (d) Cereals 45. Theoretically, a ...... canopy would be more efficient if radiations were distributed more evenly over leaf surfaces: (a) Erectophile (b) Planophile (c) Both (d) None of above 46. Erectophile canopy are mostly found in: (a) Fruit plants (b) Vegetables (c) Legumes (d) Cereals 47. In electrophile canopy most of the leaves are ..... The angle formed by the leaf from the perpendicular of the mainstem is more than ...... . (a) Vertical, 30° (b) Horizontal, 70° (c) Vertical, 60° (d) None of these 48. The concept of leaf inclination was given by: (a) Leopold (b) Lang (c) De Wit (d) None of these 49. In grasses the critical LAI is attained at an LAI of: (a) 11 (b) 10 (c) 9 (d) None 42. (d)

43. (c)

44. (c)

45. (b)

46. (d)

47. (c)

396

Plant Physiology: Question Bank

(a) g·m2 (land area) day-1 (b) G·m–2 (land area) day (c) G·m–2 (leaf area) day–1 (d) None of the above

50. A legume canopy intercepts 95% of radiation at LAI of ...... . (a) 7 (b) 6 (c) 5 (d) None 51. Optimal LAI mostly found in: (a) Legumes (b) Grasses (c) Cereals (d) None of these 52. Critical LAI mostly found in: (a) Grasses (b) Cereals (c) Both (a) and (b) (d) None 53. LAI at which there is maximum CGR is known as: (a) Optimal LAI (b) Critical LAI (c) Both (a) and (b) (d) None 54. Leaf area idex at which the canopy first reaches maximum CGR is known as: (a) Optimal LAI (b) Critical LAI (c) Both (d) None 55. CGR = (a) NAR + LAI (c) NAR × LAI

(b) NAR/LAI (d) None of these

56. What is the unit of NET assimilation rate (NAR)? (a) g.m2 (land area) day–1 (b) G.m–2 (land area) day (c) G.m–2 (leaf area) day–1 (d) None of the above 57. What is the unit of crop growth rate (CGR)?

Ans.

50. (c) 61. (d)

51. (a) 62. (c)

52. (c) 63. (c)

53. (a)

54. (b)

58. LAI term was coined by: (a) Naylor (b) Mann (c) Watson (d) None of these 59. Glucose is completely converted to CO in approximately ...... steps: (a) 50 (b) 40 (c) 30 (d) None 60. Leaf resistance CO assimilation = (a) ra (b) ra + rs (c) ra + rs + rm (d) All of these 61. What are the factors that influence the amount of solar radiation received in one day? (a) The amount of atmospheric particle (b) Day length (c) Angle of sun’s rays (d) All of the above 62. PAR is ......% of total solar radiation entering the earth’s atmosphere: (a) 75–85% (b) 55–65% (c) 44–50% (d) None of these 63. The value of solar constant is ...... cal cm–2 min–1. (a) 6 (b) 4 (c) 2 (d) None

55. (c)

56. (c)

57. (c)

58. (c)

59. (c)

60. (c)

Germination and Dormancy

397

22

Germination and Dormancy (a) Dormant (b) Dry seeds (c) Quiescent (d) All of these 8. Seeds which have lifespan ranging from 15 years to 100 years or more are known as: (a) Macrobiotic (b) Microbiotic (c) Mesobiotic (d) None of these 9. Seeds which have lifespan ranging from 3 years to 15 years are known: (a) Macrobiotic (b) Microbiotic (c) Mesobiotic (d) None of these 10. Seeds which have lifespan of a few weeks to 4 years are known as: (a) Macrobiotic (b) Microbiotic (c) Mesobiotic (d) None of these 11. The process of seed germination starts with: (a) Osmosis (b) Imbibition (c) Diffusion (d) None of these 12. ...... is done by alternating the layers of seeds with layers of wet sphagnum, sand or some other suitable material and keeping them at the low temperatures. (a) Artificial scarification (b) Artificial stratification (c) Both (a) and (b) (d) None of these 13. The process of breaking the seed dormancy of some plants in which seeds are treated in the moist medium at low temperature (5–10°C) for sufficient period of time is known as:

1. The best example of important prolamins in cereals includes: (a) Gliadin in wheat (b) Hordenin in barley (c) Zein in maize (d) All of these 2. Oat is an exception, with a protein composition of 80% ...... instead of prolamins: (a) Prolamins (b) Glutelins (c) Globulins (d) Albuminus 3. Legumes seeds are generally rich in: (a) Prolamins (b) Albuminus (c) Globulins (d) Glutelins 4. In general, cereals are high in: (a) Prolamins (b) Glutelins (c) Globulins (d) More than one 5. Based on solubility and the method of separation, osborne divided proteins into four groups: (a) Prolamins (b) Glutelins (c) Globulins (d) All of these 6. Bewley and black classified seeds relative to storage structure into three types: (a) Perisperm (beet, yucca, coffee) (b) Endosperm (grasses, caster bean, tomato, buckwheat) (c) Embryo (legumes, lettuce) (d) All of the above 7. The seeds which just wait for suitable environmental conditions to germinate are called: Ans.

1. (d) 12. (b)

2. (b)

3. (c)

4. (d)

5. (d)

6. (d) 397

7. (b)

8. (a)

9. (c)

10. (b)

11. (b)

398

Plant Physiology: Question Bank

(a) Scarification (b) Stratification (c) Both (a) and (b) (d) None of these 14. The seeds of many plants are capable of germinating immediately after harvest become dormant if kept in environment in which at least one of the factors essential for germination is unfavorable. This induced dormancy is known as: (a) Primary dormancy of the seeds (b) Declining secondary dormancy of the seeds (c) Secondary dormancy of the seeds (d) None of the above 15. The seeds of Hellebrus niger, Nigella damascene, Silene armeria are ...... photoblastic. (a) – ve (b) + ve (c) Non (d) None of these 16. The seeds of Loctuca sativa, Capsella bursa pastoris, Lepidium vigrinicum, Nicotiana tabacum, Lycopersicum esculentrum are ...... photobastic. (a) –ve (b) +ve (c) Non (d) None of these 17. In certain plants, seeds do not germinate immediately after harvest even under favorable conditions for seed germination due to: (a) The dormancy of seeds (b) Scotoperiodism (c) Both (a) and (b) (d) None of these 18. Which of the following is the common germination inhibitor? (a) Prasorbic acid (b) Dehydroacetic acid (c) Phthalides (d) All of the above 19. Which of the following is germination stimulatory substance? (a) KNO3 (b) Thiourea (c) Both (a) and (b) (d) None of these 20. Which of the following causes dormancy in seeds? (a) Mechanically resistant seed coats (b) Seed coats impermeable to water Ans.

13. (a) 24. (c)

14. (c) 25. (d)

15. (a) 26. (b)

16. (b) 27. (a)

17. (a)

(c) Immaturity of the embryo (d) All of the above 21. In oat, the inhibitors of seed dormancy is present in: (a) Gluines (b) Testa (c) Embryo (d) Endosprem 22. The seed dormancy of certain orchid, Ginkgo biloba, Anemone nemorosa, Fraxinus excelsior are due to: (a) The germination inhibitors (b) Immaturity of embryo (c) Seed coats impermeable to water (d) Mechanically resistant seed coats 23. Seed dormancy of certain weeds such as Amaranthus, Capsella and Alisma are due to: (a) The germination inhibitors (b) Immaturity of embryo (c) Seed coats impermeable to water (d) Mechanically resistant seed coats 24. The dormancy of seeds of families such as Leguminosae, Convovulaceae, Solanaceae, Chenopodiaceae are due to: (a) The germination inhibitors (b) Immaturity of embryo (c) Seed coats impermeable to water (d) Mechanically resistant seed coats 25. In xanthium and many grasses and some members of Compositae, seed dormancy is due to: (a) The germination inhibitors (b) Immaturity of embryo (c) Seed coats impermeable to water (d) Seed coats impermeable to oxygen 26. The seed dormancy of certain orchid, Ginkgo biloba, Anemone nemorosa, Fraxinus excelsior are due to: (a) The germination inhibitors (b) Immaturity of embryo (c) Seed coats impermeable to water (d) Mechanically resistant seed coats 27. Which of the following dye is used for testing the viability of seeds? (a) 2,3,5-triphenyl tetrazolium chloride (b) 2,6-dichlorophenol indophenols (c) Safranine (d) None of these 18. (d)

19. (c)

20. (d)

21. (a)

22. (b)

23. (d)

Germination and Dormancy

28. In certain plants, seeds do not germinate immediately after harvest even under favorable conditions for seed germination due to: (a) Dormancy of seeds (b) Vernalization (c) Photoperiodism (d) All of the above 29. Seeds are positively photoblastic in: (a) Lettuce (b) Shepherd’s purse (c) Tomato (d) All of the above 30. Dormancy of seeds can be broken by: (a) Sacrification (b) Stratification (c) Hydraulic pressure (d) All of the above 31. Which of the following plants are known to produce orthodox seeds? (a) Avocado and cacao (b) Jack fruit and litchi

Ans.

28. (a)

29. (d)

30. (d)

31. (c)

32. (a)

399

(c) Guava and cashew (d) Coconut and mango 32. Recalcitrant seeds are also termed: (a) Desiccation sensitive seeds (b) Desiccation tolerant seeds (c) Freezing sensitive seeds (d) Freezing tolerant seeds 33. Credit for oldest 14C-dated seed goes to: (a) India lotus seed (b) Judean date palm seed (c) Cassia bicapsularis seed (d) None of these 34. Dormancy of buds in potato tubers can be prolonged during storage by: (a) Gibberellin (b) -naphthalene acetic acid (c) Ethylene (d) Phthalids

33. (b)

34. (b)

400

Plant Physiology: Question Bank

23

Plant Movement 1. Starch-Statolith hypothesis pertains to: (a) Gravitropism (b) Phototropism (c) Hydrotropism (d) All of these

6. Which of the following is not vital movement? (a) Movement of locomotion (b) Movement of curvature (c) Hygroscopic movement (d) All of the above

2. Which of the following cells in root cap are most sensitive to gravity stimulus? (a) Peripheral cells (b) Outer cells of columella (c) Inner most cells of columella (d) None of these

7. In plants, movement of locomotion in response to external stimulus are called: (a) Tactic movements (b) Tropic movement (c) Amoeboid movements (d) None of the above

3. Roots growing at some intermediate angle between 0 and 90° to the vertical, are called: (a) Plagiogeotropic (b) Diageotropic (c) Ageotropic (d) None of these

8. Movement of curvature which occur in response to external stimulus are called: (a) Autonomous (b) Paratonic (c) Hygroscopic (d) None of the above

4. In primary roots, the gravity stimulus is perceived by: (a) Root tip (b) Root cap (c) Zone of cell elongation (d) None of these

9. The movement of antherozoids towards archegonia in bryophytes are: (a) Chemotactic (b) Chemotropic (c) Ciliary (d) All of the above

5. Elaters and peristome teeth in bryophytes show: (a) Hygroscopic movements (b) Variation movements of curvature (c) Growth movement of curvature (d) Movement of locomotion Ans.

1. (a)

2. (c)

3. (a)

4. (b)

5. (a)

10. Phenomenon of gravitropism can be demonstrated by using: (a) Clinostat (b) Auxanometer (c) Horizontal microscope (d) None of the above 6. (c) 400

7. (a)

8. (b)

9. (a)

10. (a)

Plant Movement

11. Turgorins are believed to be involved in: (a) Tropic movements (b) Nastic movements (c) Hygroscopic movements (d) None of these 12. Besides unilateral white light, which of the following unilateral light is effective in causing phototropic curvature? (a) Red light (b) UV light (c) Yellow light (d) Blue light 13. Tropical movements occur in response to: (a) Internal stimulus (b) External diffused stimulus (c) External unilateral stimulus (d) All of the above 14. Telegraph plant (Desmodium gyrans) exhibits: (a) Autonomic movement of variation (b) Autonomic movements of growth (c) Paratonic movements of variation (d) Paratonic movements of growth 15. Variation movements of curvature are:

Ans.

11. (b)

12. (d)

13. (c)

14. (a)

15. (b)

401

(a) Permanent (b) Temporary (c) Not found (d) None of the above 16. Fungal hyphae and pollen tubes exhibit: (a) Chemotropic movements (b) Chemotactic movements (c) Phototropic movements (d) Phototactic movements 17. Nastic movements are: (a) Growth movements of curvature (b) Hygroscopic movements (c) Variation movements of curvature (d) None of the above 18. Sensitive plant (Mimosa pudica) exhibits: (a) Nyctinastic movements (b) Thigmonastic movements (c) Photonastic movements (d) Seismonastic movements 19. Thigmonastic (haptonastic) movements are found in the leaves of: (a) Oxalis sp. (b) Drosera and Dionaea (c) Mimosa pudica (d) None of the above

16. (a)

17. (c)

18. (d)

19. (b)

402

Plant Physiology: Question Bank

24

Bioenergetics 1. J mol–1k–1 is the unit of: (a) Enthalpy (b) Entropy (c) Free-energy (d) None of these

(a) American (b) British (c) Dutch (d) German

2. According to third law of thermodynamics, at absolute zero, the entropy of a pure substance is: (a) Unchanged (b) Maximum (c) Zero (d) None of these

9. The study of energy transformations in living organisms is called: (a) Thermodynamics (b) Bioenergetics (c) Thermochemistry (d) None of these

3. The symbol of entropy is: (a) E (b) H (c) S (d) None of these

10. The science that deals with flow of heat and other forms of energy into or out of a system, is known as: (a) Thermodynamics (b) Bioenergetics (c) Thermochemistry (d) None of these

4. Isothermally unavailable energy and entropy is related to: (a) Kinetic energy (b) Radiant energy (c) Energy of molecular motion (d) None of these 5. The symbol of enthalpy is: (a) E (b) H (c) G (d) None of these 6. In exothermic reactions,  H is: (a) Positive (b) Negative (c) Zero (d) None of these

11. In thermodynamics, the term universe means: (a) Environment (b) Reactants and products (c) System plus surroundings (d) All of these

7. In spontaneous reactions,  H is always: (a) Negative (b) Positive (c) Zero (d) None of these

12. There is no interaction between system and surroundings in: (a) Isolated system (b) Closed system (c) Open system (d) All of these

8. J Willard Gibbs, after whose name free energy is called Gibbs free energy, was:

13. A living organism is an example of: (a) Isolated system (b) Closed system (c) Open system (d) All of these

Ans.

1. (b) 12. (a)

2. (c) 13. (b)

3. (c)

4. (c)

5. (b)

6. (b) 402

7. (a)

8. (a)

9. (b)

10. (a)

11. (c)

Bioenergetics

14. The principle of conservation of energy pertains to: (a) First law of thermodynamics (b) Second law of thermodynamics (c) Third law of thermodynamics (d) All of these 15. The second law of thermodynamics involves concept of: (a) Enthalpy (b) Entropy (c) Free energy (d) None of these 16. Entropy is a thermodynamic state quantity that is a measure of: (a) Randomness of universe (b) Order of universe (c) Vastness of universe (d) None of these 17. If randomness of a system increases, its entropy will:

Ans.

14. (a)

15. (b)

16. (a)

17. (c)

18. (a)

403

(a) Decrease (b) Remain the same (c) Increase (d) None of these 18. In spontaneous process, S is: (a) Positive (b) Negative (c) Zero (d) None of these 19. According to second law of thermodynamics, the entropy of the universe tends towards a: (a) Minimum (b) Maximum (c) Constant (d) None of these 20. During melting of ice and oxidation of glucose, the entropy: (a) Increases (b) Decreases (c) Decreases and increases respectively (d) Increases and decreases respectively

19. (b)

20. (a)

404

Plant Physiology: Question Bank

25

Plant Molecular Biology 1. Long-lived mRNA is found in which of the following? (a) Leaves (b) Seeds (c) Roots (d) None of these 2. Which of the following is the predominant cap type in higher eukaryotes? (a) Cap 0 (b) Cap 2 (c) Cap 1 (d) None of these 3. Which of the following cap is found in the lower eukaryotes? (a) Cap 0 (b) Cap 2 (c) Cap 1 (d) None of these

7. If the total number of codon in a mRNA is 10, codon located before start codon is 2 and codon located after a stop codon is 2 then what is total number of amino acids in protein chain synthesized? (a) Seven (b) Eight (c) Six (d) None of these 8. In eukaryote which of the following is the start codons? (a) GUG (b) AUG (c) Both (a) and (b) (d) None of these 9. Find the most common start codons among the following: (a) GUG (b) AUG (c) Both (a) and (b) (d) None of these

4. If the total number of base including stop codon mRNA is 27 and the number of amino acids in protein chain synthesized such mRNA is 9 then the codon is: (a) No overlapping (b) Overlapping (c) Both (a) and (b) (d) None of these

10. Which of the following are the start codons? (a) GUG (b) AUG (c) Both (a) and (b) (d) None of these

5. If the total number of base on mRNA is 12 and the number of amino acids in protein chain synthesized such mRNA is 3 then the codon on mRNA is: (a) No overlapping (b) Overlapping (c) Both (a) and (b) (d) None of these

11. What is the name of codon UGA? (a) Opal or Umber (b) Ocher (c) Amber (d) None of these 12. What is the name of codon UAG? (a) Opal or Umber (b) Ocher (c) Amber (d) None of these

6. Codon is nonoverlapping except: (a)  × 176 bacteriophage (b)  × 178 bacteriophage (c)  × 174 bacteriophage (d) None of the above Ans.

1. (b) 12. (c)

2. (c) 13. (b)

3. (a)

4. (b)

13. What is the name of codon UAA? (a) Opal or Umber (b) Ocher (c) Amber (d) None of these 5. (a)

6. (c) 404

7. (d)

8. (b)

9. (b)

10. (c)

11. (a)

Plant Molecular Biology

14. What are the properties of codon? (a) Codon is overlapping (b) Codon is no ambiguous (c) Codon is triplet (d) All of the above 15. ...... factor helps in the recognition and initiating of correct side and correct strand of citrons for transcription. (a) Delta factor (b) Sigma factor (c) Rho factor (d) None of these 16. Class C RNA polymerase synthesizes: (a) tRNA (b) mRNA (c) rRNA (d) None of these 17. Class B RNA polymerase synthesizes: (a) tRNA (b) mRNA (c) rRNA (d) None of these 18. Class A RNA polymerase synthesizes: (a) tRNA (b) mRNA (c) rRNA (d) None of these 19. In which of the following DNA replication is continuous? (a)  31 adenovirus (b)  29 adenovirus (c)  30 adenovirus (d) None of these 20. What are the properties of DNA replication? (a) DNA replication is uni or bidirectional (b) DNA replication is semi-discontinuous (c) DNA replication is semi-conservative (d) All of the above 21. Topisomerase ...... is known as DNA gyrase: (a) II (b) I (c) Both (a) and (b) (d) None of these 22. The synthesis of new complementary polynucleotide chain over the old polynucleotide chain of mother DNA is known as: Ans.

14. (c) 25. (c)

15. (b) 26. (c)

16. (c) 27. (c)

17. (a) 28. (b)

18. (b) 29. (b)

(a) Translation (c) Replication

405

(b) Transcription (d) None of these

23. Usually DNA is double stranded in most of the organism expect: (a) M13 bacteriophase (b)  × 174 bacteriophase (c) S 13 coliphas (d) All of these 24. ...... is the example of largest palindrome. (a) tRNA (b) rRNA (c) mRNA (d) None of these 25. Right left handed DNA was reported by: (a) V Shashisekharan (b) GA Rodley’s group (c) Both (a) and (b) (d) None of these 26. Distance between two base pairs of D-DNA is: (a) 4.03 Å (b) 5.03 Å (c) 3.03 Å (d) None of these 27. Base pair per turn of helix of D-DNA is: (a) Ten (b) Nine (c) Eight (d) None of these 28. Base pair per turn of helix of Z-DNA is: (a) 32 (b) 12 (c) 22 (d) None of these 29. Base pair per turn of helix of A-DNA is: (a) 13 (b) 11 (c) 21 (d) None of these 30. Base pair per turn of helix of B-DNA is: (a) 30 (b) 20 (c) 10 (d) None of these 31. Pith of the helix A-DNA is: (a) 25 Å (b) 34 Å (c) 35 Å (d) None of these 32. Pith of the helix B-DNA is: (a) 50 Å (b) 34 Å (c) 40 Å (d) None of these 19. (b) 30. (c)

20. (d) 31. (a)

21. (a) 32. (b)

22. (c)

23. (d)

24. (b)

406

Plant Physiology: Question Bank

33. Tilt per base pair of A-DNA is: (a) + 22° (b) + 19° (c) +20° (d) None of these 34. Angle between base pair and main axis of B-DNA is: (a) 80° (b) 70° (c) 90° (d) None of these 35. Angle of curvature between two consecutive major and minor groves is: (a) 300° (b) 360° (c) 280° (d) None of these 36. Vertical distance between two consecutive base pairs of B-DNA is: (a) 3.0 Å (b) 3.4 Å (c) 3.96Å (d) None of these 37. Angle of curvature between two consecutive base pairs of B-DNA is: (a) – 36° (b) + 36° (c) + 20° (d) None of these 38. Tilt/monomer of Z-DNA is: (a) – 90° (b) – 40° (c) – 30° (d) None of these 39. Tilt/dimer of Z-DNA is: (a) – 30° (b) –60° (c) Both (a) and (b) (d) None of these 40. Repeating unit of Z-DNA is: (a) Mononucleotide (b) Dinucleotide (c) Both (a) and (b) (d) None of these 41. What is the role of cap in eukaryotic mRNA? (a) Cap help the mRNA to recognized and bind with the ribosome, during protein synthesis (b) Cap help in formation mRNA– ribosomal complex during protein synthesis (c) Both (a) and (b) (d) None of these 42. Informosome stage of mRNA is absent in: (a) Eukaryote (b) Prokaryote (c) Both (a) and (b) (d) None of these Ans.

33. (b) 44. (c)

34. (c) 45. (b)

35. (b) 46. (c)

36. (b) 47. (c)

37. (b) 48. (c)

43. In prokaryotic mRNA, cap and tail both are: (a) Not known (b) Present (c) Absent (d) None of these 44. Cap and tail is part of: (a) mRNA (b) hnRNA (c) Both (a) and (b) (d) None of these 45. In methylation process, there is addition of methyl group at ...... position of adenine of internal adenylate of pony A tail. (a) 8th (b) 6th (c) 7th (d) None of these 46. The orientation of sugar of 7- methyl guanosine triphosphate remains inverted at an angle of ...... with respect to hnRNA or mRNA. (a) 160° (b) 170° (c) 180° (d) None of these 47. Capping occurs at the ...... end of hnRNA: (a) 2 (b) 3 (c) 5 (d) None of these 48. Capping is the addition of ...... at 5’ end of hnRNA: (a) 2 methyl guanosine triphosphate (b) 5 methyl guanosine triphosphate (c) 7 methyl guanosine triphosphate (d) None of these 49. Polyadenylation occurs at ...... end of hnRNA. (a) 5’ (b) 3 (c) Both (d) None of these 50. Removal of unwanted base of hnRNA is known as: (a) Splicing (b) Editing (c) Both (a) and (b) (d) None of these 51. In eukaryote, ………..is known as precursor of mRNA. (a) hnRNA (b) tRNA (c) rRNA (d) None of these 38. (c) 49. (b)

39. (c) 50. (a)

40. (b) 51. (a)

41. (c)

42. (b)

43. (c)

Plant Molecular Biology

52. “rRNA has both paired and unpaired condition of base”. This statement is: (a) False (b) True (c) Not known (d) None of these 53. Which of the following is the most stable RNA? (a) mRNA (b) tRNA (c) rRNA (d) None of these 54. According to 3-D model of tRNA, it is ...... shaped with thickness of 20A. (a) M (b) S (c) L (d) None 55. 3-D model of tRNA was given by: (a) SH Kim (b) Wilson (c) Robert Holly (d) None of these 56. Clover leaf model of tRNA was given by: (a) SH Kim (b) Wilson (c) Robert Holly (d) None of these 57. Which of the following ion provides stability to tRNA? (a) K+ (b) Mg2+ + (c) Na (d) None of these 58. What are the unusual bases of tRNA? (a) Ribothymine (b) Methyl guanine (c) Dihydrouridine (d) All of the above 59. Sedimentation coefficient of tRNA? (a) 4.8 ‘S’ (b) 5.8 ‘S’ (c) 3.8 ‘S’ (d) None of these 60. Molecular weight of tRNA? (a) 6.5 × 104 to 3 × 104 (b) 2.5 × 104 to 3 × 104 (c) 4.5 × 104 to 6 × 104 (d) None of these

52. (b) 63. (d)

53. (c) 64. (c)

54. (c) 65. (b)

55. (a) 66. (c)

62. Which of the following RNA is known as smallest RNA in the cell? (a) rRNA (b) tRNA (c) mRNA (d) None of these 63. tRNA is also known as : (a) Adopter RNA (b) Soluble RNA (c) Transfer RNA (d) All of the above 64. Informosome stage is: (a) tRNA + Protein (b) rRNA + protein (c) nRNA + Protein (d) None of these 65. In eukaryotic cell mRNA is synthesized from DNA by transcription inside nucleus and then such mRNA comes in cytoplasm in form of: (a) Carboform (b) Informosome (c) Both (d) None of these 66. Minimum sedimentation coefficient of mRNA is: (a) 15‘S‘ (b) 10 ‘S‘ (c) 8 ‘S (d) None of these 67. Minimum length of mRNA is: (a) 300 codon (b) 200 codon (c) 100 codon (d) None of these 68. “Prokaryotic mRNA is metabolically less stable than eukaryotic mRNA”, this statement is: (a) False (b) True (c) Not known (d) None of these 69. Amount of mRNA in cell is: (a) 40–60% (b) 20–30% (c) 5–10% (d) None of these 70. mRNA is also known as: (a) Template RNA (b) Messenger RNA (c) Both (a) and (b) (d) None of these

61. What is the size of tRNA: (a) 200 nucleotides (b) 100 nucleotides (c) 80 nucleotides (d) None of these Ans.

407

71. In eukaryotes how many types of RNA are found? (a) rRNA (b) tRNA (c) mRNA (d) All of these 56. (c) 67. (c)

57. (b) 68. (b)

58. (d) 69. (c)

59. (c) 70. (c)

60. (b) 71. (d)

61. (c)

62. (b)

408

Plant Physiology: Question Bank

72. In most of the organisms RNA is single stranded structure except: (a) Rheo group of virus (b) Wound tumor virus (c) Both (a) and (b) (d) None of these 73. Which of the following is known as antisense RNA? (a) tRNA (b) mRNA (c) rRNA (d) None of these 74. Among the followings, which one is the smallest? (a) hnRNA (b) tRNA (c) mRNA (d) None of these 75. The translation process occurs in association with which of the following? (a) Ribosome and RNA (b) Mitochondria (c) ER (d) tRNA 76. The process of transcription of rRNA is completed in which of the following: (a) Nucleolus (b) Nucleus (c) Cytoplasm (d) None of these 77. tRNA is found in which of the following part of the cell? (a) Cytoplasm (b) Vacuole (c) ER (d) None of these 78. The process of protein synthesis is generally known as: (a) Ester bond (b) Peptide bond (c) Salt bridge (d) Phosphodiester bond 79. The term ‘Protein’ was proposed by: (a) Berzelius (b) Mulder (c) Dalton (d) None of these 80. Who is regarded as the father of biochemical genetics? (a) Tatum (b) Beadle (c) Galton (d) Garrod 81. Replica-plating technique was suggested by: (a) Lederberg (b) Southern (c) Woodward (d) None of these Ans.

72. (c) 83. (a)

73. (a) 84. (a)

74. (b) 85. (d)

75. (a) 86. (a)

76. (a) 87. (a)

82. One-gene-one-enzyme hypothesis was proposed by: (a) Lederberg (b) Southern (c) Woodward (d) Beadle and Tatum 83. The classical book “In born error in Metabolism” was written by: (a) Garrod (b) Tatum (c) Beadle (d) None of these 84. In prokaryotic DNA polymerase III, which of the following constitutes the catalytic core? (a) , ,  (b) , ,  (c) ,  (d) None of these 85. Pilot proteins have been studied in: (a)  × 174 (b) M 13 (c) MS 2 (d) All of these 86. For the discovery of polymerase enzyme, Kornberg was awarded Nobel Prize in which of the following years? (a) 1959 (b) 1962 (c) 1955 (d) None of these 87. Among the following, which of the DNA polymerase is involved in DNA repair only? (a) DNA polymerase II (b) DNA polymerase III (c) DNA polymerase I (d) None of the above 88. In case of E. coli, what is the approximate rate of fork movement under optimum conditions? (a) 100, 000 bp/minute (b) 75, 0000 bp/minute (c) 50, 0000 bp/minute (d) 30, 0000 bp/minute 89. Under optimum conditions, one complete replication of E. coli chromosomes takes approximately how much time? (a) 40 minute (b) 10 minute (c) 20 minute (d) None of these 77. (a) 88. (c)

78. (b) 89. (a)

79. (b)

80. (d)

81. (a)

82. (d)

Plant Molecular Biology

90. E. coli DNA polymerase III is known for: (a) Primer digestion and gap filling (b) DNA replication (c) DNA repair (d) None of the above 91. Which of the following mode of transposition is most damaging to the genome? (a) Conservative (b) Neoconservative (c) Replicative (d) None of these 92. Which of the following genes does not have introns? (a) Histone gene (b) Globin gene (c) Actin gene (d) None of these 93. In which of the following stage C-value represents DNA content of a nucleus? (a) Somatic cell metaphase (b) Meiotic telophase II (c) Somatic cell telophase (d) Somatic cell G 1 phase 94. Which of the following has the smallest genome size? (a) MS 2 (b) Phase  (c) SV 40 (d) None of these 95. Which of the following scientist discovered repetitive DNA in eukaryotes? (a) Sanger and Berg (b) Taylor and Temin (c) Britten and Waring (d) None of the above

409

(c) Hedges and Jacob (d) None of the above 98. Which form of DNA is common is vivo? (a) Z-DNA (b) C-DNA (c) B-DNA (d) A-DNA 99. Which form of DNA has the longest pitch? (a) Z-DNA (b) C-DNA (c) B-DNA (d) A-DNA 100. Which form of DNA has the greatest diameter? (a) Z-DNA (b) C-DNA (c) A-DNA (d) B-DNA 101. A nucleotide consists of which of the following: (a) Pentose, base and phosphate (b) Phosphate and organic base (c) Pentose sugar and organic base (d) Phosphate and pentose base 102. Genetic material of viroids consists of which of the following? (a) DNA (b) RNA (c) Protein (d) Nucleoprotein 103. Precosity theory of synapsis was given by: (a) Moses (b) JH Taylor (c) CD Darlington (d) None of these 104. Theory of organic evolution was given by: (a) JH Taylor (b) Moses (c) O Winge (d) C Darwin

96. Viral genome is packed into which of the following? (a) Nucleoids (b) Capsules (c) Nuclei (d) Capsids

105. The theory of polyploidy as basis of evolution was given by: (a) JH Taylor (b) Moses (c) O Winge (d) C Darwin

97. Who was the first to use the term transposon? (a) Singer and Gilbert (b) Leder and Flavel

106. Wobble hypothesis of codon–anticodon base pairing was given by: (a) G Gammow (b) FHC Crick (c) O Winge (d) None of these

Ans.

90. (b) 91. (b) 92. (a) 93. (b) 94. (a) 95. (c) 101. (c) 102. (b) 103. (c) 104. (d) 105. (c) 106. (b)

96. (d)

97. (c)

98. (c)

99. (a) 100. (c)

410

Plant Physiology: Question Bank

107. If polynucleotide chain has 20[A], 30[C] and 40[G] and deoxyribose sugar then it is part of: (a) RNA (b) DNA (c) Both (a) and (b) (d) None of these 108. A polynucleotide chain has 20[20], 30[C] and 40[G], this is part of: (a) Unpredictable (b) DNA (c) RNA (d) Both (b) and (c) 109. In most of the animal viruses genetic material is DNA except: (a) Mumps virus (b) Polio virus (c) Toga virus (d) All of these 110. RNA is a genetic material in: (a) Most of the animal virus (b) Most of the plant virus (c) Most of organism (d) More than one 111. In most of the organisms, genetic material is: (a) Protein (b) DNA (c) RNA (d) More than one 112. Transformation experiment was explained by: (a) Avery, MacLeod and McCarty (b) Frankel–Conrat and Singer (c) Hershey and Chase (d) None of the above 113. Before the explanation of Avery, MacLeod and McCarty, which of the following was considered as genetic material? (a) DNA (b) Protein (c) RNA (d) More than one 114. It is unreasonable to think that a dsDNA has which of the following type of bases? (a) 10 (b) 5 (c) 3 (d) More than one 115. Which of the following is not consistent with DNA double helix? (a) According to X-ray diffraction pattern DNA is double helical structure

(b) The ratio of A + G and G + C is not consistent in different organisms of same species (c) A + G/T + C equal to one (d) Density of DNA decreasing on heating 116. If a B-DNA has 20[A] then what is the total number of nucleotide in that DNA? (a) 100 (b) 80 (d) 40 (d) None of these 117. What is the total number of nucleotide in short length of a DNA double helix having 200[A] and 200[C] base? (a) 440 (b) 400 (c) 220 (d) None of these 118. If a B-DNA has 400 base pairs then what is the total number of nucleotide in such DNA? (a) 800 (b) 400 (c) 200 (d) None of these 119. In a B-DNA total numbers of base pairs is 200. If there is 80[C], then what is the total number of [A] and [T]? (a) 20 (b) 70 (c) 80 (d) 140 120. In a B-DNA total numbers of base pairs is 200. If there is 80[C], then what is the total number in such DNA: (a) 80 (b) 40 (c) 20 (d) None of these 121. If the DNA of somatic cell of plant has 40[A] then what will be the number of [G] in such DNA? (a) Unpredictable (b) 20 (c) 10 (d) More than one 122. The transformation principle was demonstrated to be DNA by which of the following? (a) Avery, MacLeod and McCarty (b) Frankel–Conrat and Singer (c) Hershey and Chase (d) None of the above

Ans. 107. (b) 108. (a) 109. (d) 110. (b) 111. (b) 112. (a) 113. (b) 114. (d) 115. (b) 116. (d) 117. (a) 118. (a) 119. (d) 120. (c) 121. (a) 122. (a)

Plant Molecular Biology

123. If DNA of somatic cell of plant has 31% [A] then what is % of [G] in such cell: (a) 9.5% (b) 19% (c) 31% (d) None of these 124. Frankel–Conrat and Singer demonstrated that RNA is a genetic material in: (a) Cauliflower mosaic virus (b) Tobacco mosaic virus (c) Tomato leaf curl virus (d) M13 bacteriophage 125. If DNA of somatic cell of plant has 31% [A] and 19% [C] then what is the % of [G] in DNA of germ cell: (a) 31% (b) 9.5% (c) 19% (d) None of these 126. The process of identification of genetic material began in 1928 with the experiments by: (a) Castle (b) Griffth (c) Bridges (d) None of these

411

130. How many water molecules will be released to unite two nucleotides? (a) One (b) Two (c) Three (d) None of these 131. How many water molecules will be released to make dinucleotide from two nucleotides? (a) Five (b) Four (c) Three (d) None of these 132. How many water molecules will be released to make a nucleotide? (a) Seven (b) Six (c) Five (d) None of these 133. How many water molecules will be released to make a nucleoside from a nucleoside? (a) Three (b) One (c) Two (d) None of these 134. The basis of naming of DNA and RNA is: (a) Phosphate (b) Base (c) Sugar (d) None of these 135. DNA differs from RNA in: (a) Phosphate (b) Base (c) Sugar (d) None of these

127. Which of the following organism was used by Hershey and Chase for their experiment to demonstration that DNA is the genetic material? (a) T1 phase and E. coli (b) T4 phase and E. coli (c) T2 phase and E. coli (d) None of these

136. DNA differs from RNA in: (a) Phosphate (b) Base (c) Sugar (d) More than one

128. Transformation phenomenon was discovered by ...... in ...... . (a) Griffth, Bacillus subtilis (b) Griffth, Diplococcus pneumoniae (c) Griffth, E. coli (d) None of these

137. One gene one polypeptide hypothesis was proposed by: (a) M Kimura (b) S Ohno (c) VM Ingram (d) None of these

129. How many water molecules will be released to make polynucleotide chain by joining the number of nucleotide: (a) n-3 H2O molecules (b) n-1 H2O molecules (c) n-2 H2O molecules (d) None of the above

138. Epigenesis theory was proposed by: (a) KW Wolff (b) J Belling (c) HJ Müller (d) None of these 139. ‘Dosage compensation’ was proposed by: (a) KW Wolff (b) J Belling (c) HJ Müller (d) None of these

Ans. 123. (b) 124. (b) 125. (c) 126. (b) 127. (c) 128. (b) 129. (b) 130. (a) 131. (c) 132. (c) 133. (b) 134. (c) 135. (c) 136. (d) 137. (c) 138. (a) 139. (c)

412

Plant Physiology: Question Bank

140. Copy choice theory of recombination was proposed by: (a) KW Wolff (b) J Belling (c) HJ Müller (d) None of these

149. Which of the following is not a part of a gene? (a) Ori (b) Operon (c) Promoter (d) Terminator

141. Classical or two plane theory was proposed by: (a) FA Janssen (b) E Wilson (c) FHC Crick (d) LW Sharp

150. Which of the following is not a character of unique intergenic DNA? (a) Mutant genes (b) Pseudogenes (c) Palindromes (d) Nonfunctional gene fragments 151. Match the list–I (Cloning vector) with list–II (Character) and select the correct answer using the codes given below the lists:

142. Chiasma type or one plane theory was proposed by: (a) FA Janssen (b) E Wilson (c) FHC Crick (d) LW Sharp 143. Central dogma of molecular biology was given by: Classical or two plane theory was proposed by: (a) FA Janssen (b) E Wilson (c) FHC Crick (d) LW Sharp 144. Chromosomal theory of heredity was given by: (a) Strasburger (b) Sutton and Bovary (c) W Fleming (d) None of these 145. ...... proposed the term chromosome. (a) W Fleming (b) Tejo and laven (c) W Waldeyer (d) None of these 146. Enzymes important in engineering are: (a) Ligases (b) Respiration enzymes (c) Edonuclease (d) All of these

genetic

147. Which is the most short-lived RNA? (a) mRNA (b) sRNA (c) rRNA (d) tRNA 148. When a single anticodon can recognize more than one codon of mRNA, it refers to: (a) Template hypothesis (b) Wobble hypothesis (c) Colinearity hypothesis (d) Gene flow hypothesis

List–I (Cloning vectors) A. Yeast episomal plasmid (YEp) B. Yeas integrative plasmid (YIP) C. Yeast replicative plasmid (YRp)

List–II (Characters) 1. Integrates with host chromosome for replication 2. Carries a chromosomal origin of replication 3. Carries origin of replication of the 2 mm plasmid

Codes: A B C A B C (a) 2 3 1 (b) 3 1 2 (c) 2 1 3 (d) 3 2 1 152. Match the list–I (enzyme) with list–II (characteristic/activity) and select the correct answer using the codes given below the lists: List–I (Enzymes) A. Terminal transferases B. Polynucleotide kinases C. Taq DNA polymerase D. Exonucleases

Codes: A B C D (a) 4 3 2 1 (c) 4 3 1 2

List–II (Characteristic/ Activity) 1. Stable above 90°C 2. Cleave the ends of linear DNA 3. Adds phosphate to 5’-OH end of DNA or RNA 4. Adds a numbers of nucleotides to 3’-end of the DNA or RNA 5. Regulate the level of supper coiling of DNA molecules

A B C D (b) 3 4 5 1 (d) 5 4 1 2

Ans. 140. (b) 141. (a) 142. (a) 143. (c) 144. (b) 145. (c) 146. (d) 147. (d) 148. (b) 149. (a) 150. (c) 151. (b) 152. (c)

Plant Molecular Biology

153. Restriction endonucleases are the enzymes that: I. Cleave the 5’-terminal nucleotides from duplex DNA molecules II. Make a sequences–specific cuts in both strands of duplex DNA molecules III. Promote circularization of the duplex DNA molecule by removal of the 5’-terminal nucleotides IV. Generate 3’-hydroxyl and 5’phosphate ends in the cut DNA strands (a) I, II, III and IV (b) II and III (c) I and II (d) I and III 154. An analysis of chromosomal DNA, using the Southern blot technique, involves the following five major steps: I. Autoradiography II. Blotting III. Cleavage IV. Electrophoresis V. Hybridization Which of the following sequences of the steps best illustrates this technique? (a) III, IV, II, V and I (b) III, V, II IV and I (c) I, III, II, IV and V (d) I, II, III, IV and V 155. Match the following lists: A. B. C. D.

List–I Biolistic Agrobacterium Electroporation Microinjection

List–II 1. Genes Pulser 2. PDS 1000 He 3. Micromanipulator 4. Silicon carbide 5. Vir operon

Codes: A B C D A B C D (a) 1 2 3 4 (b) 5 4 3 2 (c) 2 1 3 4 (d) 2 5 1 3 156. Consider the following statements: Tissue culture is recommended for: I. Multiplication of elite genotypes of useful trees II. Developing virus free plants III. Production of secondary metabolites

413

IV. Induction of polyploidy Which of these statements are correct? (a) II, III and IV (b) I, III and IV (c) I, II and III (d) I, II and IV 157. Consider the following steps: I. Isolation of tissues from the plant. II. Digestion of cell walls with cellular enzymes. III. Preparation of the culture medium. IV. Preparation of naked protoplasts and culturing them in the medium. The correct sequence of the steps to be followed to culture protoplasts is? (a) IV, II, I and III (b) IV, I, II and III (c) I, III, II and IV (d) I, II, III and IV 158. Yeast has become important in genetic engineering because it: (a) Allows the study of eukaryotic genes regulation and expression (b) Has RNA splicing machinery (c) Has plasmids that can be genetically engineered (d) All of the above 159. The role of restriction enzymes in DNA technology is to: (a) Reseal ‘sticky ends’ after base– pairing of the complementary bases (b) Produce a cut (usually staggered) at specific recognition sequences on DNA (c) Produce cDNA from mRNA (d) Provide a vector for the transfer of recombinant DNA 160. A crop scientist spliced genes for disease resistance into Ti plasmids and then treated tomato plants with the plasmids. Some parts of the some plants resisted the disease but most of the plants eventually died. The researcher could increase his chances for success by: (a) Inserting the genes into the cells of the tomato plants with a needle (b) Using R plasmids rather than Ti plasmids to introduce the genes

Ans. 153. (b) 154. (a) 155. (d) 156. (c) 157. (d) 158. (d) 159. (b)

414

Plant Physiology: Question Bank

(c) Treating single cells and cloning whole plants from the cells (d) Using molecular probes to figure out where to put the genes 161. Complementary DNA does not create as complete a gene library as the shotgun approach because: (a) cDNA is not as easily integrated into plasmids or phage genomes (b) The shotgun approach produces more restriction fragments (c) A cell produces mRNA for only a small portion of its genes at any one time (d) It has eliminated introns from the genes 162. Scientists wished to create an organism capable of breaking down several kinds of toxic wastes, so they combined the genes of several bacteria to create a single ‘superbacterium’. They probably did not need to use which of the following in creating the superbacterium? (a) Restriction enzyme (b) Plasmids (c) F Factors (d) Nucleic acid probes 163. When recombinant plasmids are added to E. coli, not all the bacteria take them in. this makes it difficult to spot the bacteria that actually contain the plasmids. For this reason, R plasmids are often used as the gene vectors in recombinant DNA experiments. Using R plasmids would allow experimenters to find the bacteria with recombinant DNA easily by: (a) Watching what happens when the bacteria reproduce (b) Exposing the bacteria to the restriction enzymes (c) Using a molecular probe (d) Killing off the bacteria without the R plasmids 164. Which of the following is not true of recognition sequences?

(a) Cutting a recognition sequence in the middle of a functional and identifiable gene is used to screen clones that have taken up foreign DNA (b) They signal the attachment of RNA polymerase (c) They are usually symmetrical sequences of four to eight nucleotides (d) Modification by methylation of bases within them prevents restriction of bacterial DNA 165. In recombinant DNA experiments, ...... is used to cut pieces of DNA and ...... joints these segments to form recombinant DNA: (a) DNA ligase; a restriction enzyme (b) A plasmid; DNA ligase (c) A transposons; a restriction enzyme (d) A restriction enzyme; DNA ligase 166. A genetic marker is: (a) A radioactive probe used to find a gene (b) A nucleotide sequences near a particular gene (c) A chart that traces the family history of a genetic trait (d) A place where a restriction enzyme cuts DNA 167. A genomic library is: (a) A collection of cloned DNA pieces from an organism‘s genome (b) All the genes contained in one kind of cell (c) A listing of the known nucleotide sequences for a particular species (d) Where you look to find ot how to make recombinant DNA 168. VNTRs are valuable tool for: (a) DNA fingerprinting (b) Acting as probes in northern blots (c) Infecting dichotomous plant cells with recombinant DNA (d) Forming overlapping section in chromosomes walking

Ans. 160. (c) 161. (c) 162. (c) 163. (d) 164. (b) 165. (d) 166. (b) 167. (a) 168. (a)

Plant Molecular Biology

169. A plasmid has two antibiotic-resistance, genes, one for ampicillin and one for tetracline. It is treated with a restriction enzyme that cuts in the middle of the ampicillin gene. DNA fragments containing a human globin gene were cut with the same enzyme. The plasmids and fragments are mixed, treated with ligase, and used to transform bacterial cells: (a) Can grow on plates with tetracycline and are not blue (b) Can grow on plates with tetracycline but not with ampicillin (c) Can grow on plates with ampicillin but not with tetracyclin (d) Can grow on plates with ampicillin but not with antibiotics 170. It is sometimes necessary to genetically engineer mammalian cells to produce proteins because they: (a) Are easier to grow than bacteria (b) Can adds sugars to make glycoprotein’s and bacteria cannot (c) Can read eukaryotic genes and bacteria cannot (d) Can produce larger quantities of protein than bacteria 171. Scientists have produce a smallpox virus that contains genes from several other disease causing microorganism. They have to use to the virus: (a) As a tool for diagnosing various infectious diseases (b) To perfect a germ warfare weapon with no antidote (c) As a compact genomic library (d) In a vaccine against several diseases 172. A nucleic acid probe might be used to: (a) Find a nucleotide sequence (b) Cut pieces of DNA down to manageable size (c) Make DNA for gene cloning (d) Insert genes into a host cell 173. The human genome project officially began in: (a) 1995 (b) 1992 (c) 1990 (d) 1988

415

174. In the creating of a microarray, fragments of DNA are placed on a: (a) Membrane (b) Silicone chip (c) Circuit board (d) Microscope slide 175. RAPD banding patterns prone to: (a) Different PCR machines or related equipment used in conducting PCR (b) Different Taq DNA polymerases (c) DNA template concentration and quality (d) All of the above 176. In a DNA molecule cytosine is 18%. Percentage of adenine would be: (a) 18% (b) 36% (c) 64% (d) 32 % 177. A method used to prevent disulphide bond interference with protein sequencing method is: (a) Reducing disulphide bridges and preventing their reformation by further modifying the SH groups (b) Removing cystines from protein sequences by proteolysis cleavage (c) Protecting the disulphide bridge against spontaneous reduction to ctsteinyl groups (d) Cleaving proteins with proteases that specially recognize disulfide bonds 178. You restriction map a vector using Bam HI, Eco RI and Hae III and obtained fragments of the following sizes: (a) Bam III cuts the smaller fragments from the Hae III digestion (b) Bam HI away from eco (c) There are three sites in this vector (d) None of the above 179. You discover a novel eukaryotic organism that glows in the dark. You believe this trait is due to a single gene and you wish to clone the gene. Which of the following strategies is most likely to be successful? (a) Isolate mRNA from the organism, reverse transcribe and generate cDNA, insert into a plasmid vector

Ans. 169. (b) 170. (b) 171. (d) 172. (a) 173. (c) 174. (d) 175. (d) 176. (d) 177. (a) 178. (d) 179. (a)

416

Plant Physiology: Question Bank

and transform into eukaryotic cells such as yeast. Screen colonies for the ability to glow in the dark (b) Isolate mRNA form the organism digest with a restriction endonucleases, insert into a plasmid screen colonies for the ability to glow in the dark (c) Isolate the genome DNA from the organism insert with a restriction endonuclease. Screen colonies for the dark (d) All of these 180. Recombinant DNA research is dependent on: (a) Vectors (b) Hosts (c) Cloning (d) All of these 181. You want to clone a fragment of DNA into a plasmid vector such as pBR322. The plasmid is 4.36 km ling and has a single restriction will the result? (a) Two (b) One (c) Four (d) Three 182. What sequence is a palindrome? (a) AGGCCT (b) CCATT (c) ATG (d) ACGGATTCGC 183. The principle of the yeast two-hybrid system is: (a) The detection of protein-protein interaction between the phage coat proteins and target proteins (b) The detection of protein- protein interactions by studying the hybridization of two cDNA sequences (c) The detection of protein interaction in a poor of hybrid yeas strains (d) The detection of protein-proteins interactions by assembling a functional transcription factor from two fusion proteins 184. A mouse in which one particular gene has been replaced by its inactivated form generated in vitro is called: (a) Mutant mouse (b) Nude mouse (c) Knockout mouse (d) Transgenic gene

185. Positional cloning refers to: (a) Mapping a gene to a chromosomal region and then indentifying and choosing a genomic copy of the gene from the region (b) Isolating a gene from a specific tissue in which it is being expressed (c) Isolating a gene by PCR using primers from another species (d) Using a selection procedures to clone a cDNA 186. Which of the following could not give rise to a restriction fragment length polymorphism? (a) An error in RNA splicing that mistakenly removes an exon during RNA processing (b) A single base change within the introns sequence of a gene (c) A silent mutation with the protein coding region of a gene (d) A misense mutation within the protein coding region of a gene 187. Restriction Fragment Length Polymorphism (RFLP) is: (a) The difference in the restriction maps between two individuals of two species (b) The difference in the restriction maps between two individuals of one species (c) The difference in the restriction maps between the two alleles in a diploid cell (d) The technique use to fingerprint patterns of inheritance 188. The DNA fingerprinting process involves: (a) RFLPs (b) VNTR loci (c) Degenerate oligonucletide (d) Chain terminators 189. In order to identify the person who committed a crime. Forensic expert will need to extract DNA from the tissue sample collected at the crime scene and conduct one of the following procedures for DNA fingerprinting analysis:

Ans. 180. (d) 181. (b) 182. (a) 183. (d) 184. (c) 185. (a) 186. (a) 187. (b) 188. (b)

Plant Molecular Biology

(a) Determine the sequence of the subclones (b) Cut the DNA and hybridize with specific micro satellite probes (c) Cut the DNA and sub-clones the fragments (d) C is followed by A 190. A certain purified DNA sample was cut with two restriction endonucleases E1 and E2. The following results were obtained from agarose gel electrophoresis: Sample cut with E2 alone two bands of size 35 kb and 15 kb Sample cut with E2 alone two bands of size 40 kb and 10 kb Sample cut simultaneously with E 1 and E2 three bands of size 35 kb, 10 kb and 5kb From these data, it can be inferred that the DNA has (a) Three sites for E1 and one site for E2 (b) One site for each E1 and E2 (c) One site for E1 and two sites for E2 (d) Two sites for E1 and one site for E2 191. Which of the following methods would give the most precise and accurate information about where and when a given gene is expressed? (a) Reporter gene fusion including introns (b) Protein microarray (c) In situ hybridization (d) DNA microarray 192. In agarose gel electrophoresis: (a) EtBr can be used to visualize the DNA (b) Larger molecules migrate faster than smaller molecules (c) Supercoiled plasmid migrate slower than their nicked counterparts (d) DNA migrates forwards the negative electrode 193. There are two different ways to determining the nucleotide sequence

417

of a nucleic acid the chemical sequencing (Maxam–Gilbert) method and the enzymatic sequencing (Sanger) Method. The basic principle/advantage of the Sanger method is: (a) The correlation of restriction sites with end–label of the DNA (b) The ability to ‘sequence’ both strands of the DNA duplex simultaneously (c) Extension of a synthetic primer and the reliable termination of DNA repair synthesis (d) The differential interaction of the bases with particular dyes 194. Which of the following would not be possible to address using a northern blot? (a) mRNA size (b) Temporal expression of a particular gene (c) Location of restriction sites in a particular gene (d) Spatial expression of a particular gene 195. Which of the following types of information cannot be determined from the traditional northern blotting technique? (a) The amino acid sequence of the protein coded by an mRNA species (b) The strand of DNA that is transcribed into mRNA (c) The half life of an mRNA species (d) The size of an mRNA species 196. An analysis of chromosomal DNA, using the southern blot technique, involves the following five major steps: I. Autoradiography II. Blotting III. Cleavage IV. Electrophoresis V. Hybridization Which of the following sequences of steps best illustrates this technique?

Ans. 189. (b) 190. (b) 191. (d) 192. (a) 193. (b) 194. (c) 195. (a)

418

Plant Physiology: Question Bank

(a) I, II, III, IV, V (b) III, IV, II, IV, I (c) III, V, II, IV, I (d) I, III, II, IV, V 197. The genome sequencing of rice is important because: (a) It has a rapid life cycle and has many identifiable mutations (b) The rice genome is very unique and contains genes not found in other plants (c) The rice genome is very large compared to the DNA of other grains and so more genes will be identified (d) It can identify genes associated with disease resistance, growth capacity, etc. 198. Dideoxy DNA sequencing exclusively depends on one of the followings: (a) Vector primer (b) Plasmid vector (c) Termination (d) ATP 199. What clones should a eukaryotic cDNA library contain? (a) Clones representing transcribing DNA in frequencies that reflect their level of expression (b) Clone representing transcribed DNA in approximately equal frequencies (c) Clones that represent one copy of every coding region (d) Clones that represent every fragment of DNA in approximately equal frequencies 200. The term cDNA library means that: (a) It is manual for cDNA research (b) Pool of cDNAs generated from a specific tissue inserted into an appropriate vector that can be used as a source of the cDNA of interest (c) Compilation of cDNA sequences in the database (d) Collection of cDNA cones by an individual researcher 201. Which one of the following statement regarding genomic libraries is false? (a) The DNA must be fragmented to an appropriate size for the vector that is used

(b) Genomic libraries must contain a minimum number of recombinants if they are to contain all the genes in an organism (c) Genomic libraries are made from cDNA (d) Genomic libraries must be representative if they are to contain all the genes in an organism 202. Shotgun approach is used for the construction of: (a) Genomic library (b) cDNA library (c) Both (a) and (b) (d) None of these 203. Most common reporter gene whose product can be directly visualized in transformed cell is: (a) GFP (green fluorescent protein) (b) -Galactosidase (c) CAT (chloramphenicol acetyl transferase) (d) NPTII (neomycin phosphotransferase) 204. A reporter gene: (a) Interacts with RNA polymerase (b) Enhance mRNA stability (c) Allows gene expression to be readily measured (d) Acts as repressor 205. Which of the following is not a potential problem associated with expressing a eukaryotic, protein coding nuclear gene in prokaryotic cells? (a) Differences in transcriptional signals between eukaryotic cells and prokaryotic cells (b) Stability of mRNA in prokaryotic cells (c) Lack of intron–splicing mechanism in prokaryotes (d) Differences in the translation initiation codons used by eukaryotic cells and prokaryotic cells

Ans. 196. (b) 197. (d) 198. (c) 199. (a) 200. (b) 201. (c) 202. (a) 203. (b) 204. (c) 205. (d)

Plant Tissue Culture

419

26

Plant Tissue Culture 1. Tissue culture medium (MS) is adjusted to a pH of ...... before autoclaving: (a) 3.5–5.6 (b) 5.6–6.0 (c) 6.0–7.0 (d) None of these

6. What is the medicinal value of Moringa oleifera? (a) Antiviral (b) Anticholinergic (c) Antilleukemic (d) Antimalarial

2. What is the medicinal value of Panax ginseng? (a) Antispasmolytic (b) Anticholinergic (c) Tonic (d) Antimalarial

7. What is the medicinal value of Datura innoxia? (a) Agglutination (b) Anticholinergic (c) Antilleukemic (d) Antimalarial

3. What is the medicinal value of Hyoscyamus niger? (a) Antispasmolytic (b) Anticholinergic (c) Antilleukemic (d) Antimalarial

8. What is the medicinal value of Catharanthus roseus? (a) Agglutination (b) Anticholinergic (c) Antilleukemic (d) Antimalarial

4. What is the medicinal value of Tarasacum officinale? (a) Antispasmolytic (b) Anticholinergic (c) Antilleukemic (d) Antimalarial

9. What is the medicinal value of Sanatalum album? (a) Agglutination (b) Anticholinergic (c) Antilleukemic (d) Essential oil

5. What is the medicinal value of Delonix regia? (a) Antispasmolytic (b) Anticholinergic (c) Agglutination (d) Antimalarial

10. What is the medicinal value of Artimisia annua? (a) Agglutination (b) Anticholinergic (c) Antilleukemic (d) Antimalarial

Ans.

1. (b)

2. (c)

3. (a)

4. (a)

5. (c)

6. (a) 419

7. (b)

8. (c)

9. (d)

10. (d)

420

Plant Physiology: Question Bank

parents. Such somatic hybrids are called: (a) Asymmetric hybrids (b) Symmetric hybrids (c) Both (a) and (b) (d) None of these

11. Young plant explanta (i.e. soften) are more susceptible to vitrification. This statement is: (a) False (b) True (c) Not known (d) None of these 12. In the diagram find C = ?

15. Through suspension culture, Ojima and Ohira selected two cell lines of ...... tolerant to Al and Mn by subculturing cells in excessive amount of AlCl3 for several months. (a) Cabbage (b) Carrot (c) Cauliflower (d) None of these 16. Which of the following institute is engaged in preservation of plant germplasm based on cryopreservation technology? (a) International Plant Germplasm Research Institute (b) National Bureau of Plant Genetic Resources, New Delhi (c) IRRI, Philippines (d) All of these

(a) C = Cybrid (b) C = Heterokaryon (c) Both (a) and (b) (d) None of these 13. Cybrids can be obtained by using any one of the following methods: (a) Selective elimination of chromosome of one parent at a later stage after fusion of the nuclei (b) Selective elimination of one of the nuclei from the heterokaryon (c) Fusion of normal protoplast from one parent and protoplast containing nonviable nuclei from the other parent (d) Fusion of normal protoplast from one parent with enucleated protoplast from the other parent 14. When normal protoplasts of two species are fused, the resulting somatic hybrid plants have somatic chromosome complement of both the fusion Ans.

11. (b)

12. (a)

13. (d)

14. (b)

15. (b)

17. ...... is done by removing the specimen from frozen state (liquid nitrogen stage) and transferring them in a water bath at 35–40°C or about 1–2 min. or until specimen is warmed up. (a) Freezing (b) Thawing (c) Regeneration (d) None of these 18. Polyploid shows chromosomal abnormalities ...... than diploids: (a) Less (b) Very less (c) More (d) None of these 19. “Ruseet Burbank” cultivars of potato have originated from ...... protoplast. (a) Root (b) Leaf (c) Shoot (d) None of these 20. Which of the following technology is used for virus indexing for biological material? (a) Sap of plants to test virus infection (b) TEM serology (c) ELISA (d) All of the above 16. (d)

17. (b)

18. (c)

19. (b)

20. (d)

Plant Tissue Culture

21. When somatic embryos are transferred on induction medium they give rise to secondary somatic embryos. This method obtaining embryos recurrently is termed: (a) Cyclic embryogenesis (b) Repetitive embryogenesis (c) Both (a) and (b) (d) None of these 22. In case of indirect embryogenesis cells require redetermination through in a period in culture and this is termed: (a) Induced embryogenic determined cells (b) Pre-embryogenic determined cells (c) Both (a) and (b) (d) None of these 23. In case of direct embryogenesis cells of explanted tissues are already determined for embryogenic development, and this is known as: (a) Induced embryogenic determined cells (b) Pre-embryogenic determined cells (c) Both (a) and (b) (d) None of these 24. When explants produce callus and the callus forms embryos then it is called: (a) Indirect embryogenesis (b) Direct embryogenesis (c) Both (a) and (b) (d) None of these 25. When embryogenesis occurs directly on the explants without production of callus, it is known as: (a) Indirect embryogenesis (b) Direct embryogenesis (c) Both (a) and (b) (d) None of these 26. What is the intensity of fluorescent light, in general, in environmentally controlled culture room? (a) 3000 lux (b) 1000 lux (c) 2000 lux (d) None of these Ans.

21. (c) 32. (c)

22. (a)

23. (b)

24. (a)

25. (b)

421

27. What is the percentage of relative humidity that is maintained normally in environmentally controlled culture room? (a) 30–40 (b) 20–30 (c) 60–70 (d) None of these 28. The ratio of light; dark period in environmentally controlled culture room normally is: (a) 11:8 (b) 14:6 (c) 16:8 (d) None of these 29. In which plant, virus, vein mottle virus, ring spot virus can be eliminated by meristem culture: (a) Dianthus barbatus (b) Ipomoea batata (c) Allium sativum (d) Chrysanthemum sp. 30. In which plant turnip mosaic virus and CaMV were shown to be eliminated by meristem culture: (a) Brassica oleracea (b) Ipomoea batata (c) Allium sativum (d) Chrysanthemum sp. 31. In which plant, virus B has been shown to be eliminated by meristem culture: (a) Brassica oleracea (b) Dianthus barbatus (c) Allium sativum (d) Chrysanthemum sp. 32. In which plant mosaic virus was demonstrated to be eliminated by meristem culture? (a) Brassica oleracea (b) Dianthus barbatus (c) Allium sativum (d) Chrysanthemum sp. 26. (a)

27. (c)

28. (c)

29. (a)

30. (a)

31. (d)

422

Plant Physiology: Question Bank

33. Sugars, sugars alcohols, polyvinyl pyrrolidone, polyethylene glycol (PEG), polyethylene oxide (PEO), hydroxystarch are the examples of ...... type of cryoprotectants. (a) Nonpermeating (b) Permeating (c) Both (a) and (b) (d) None of these

40. The method which employed for producing virus free plants? (a) Grafting of meristems on virus–free plants (b) Heat treatment followed by meristems culture (c) Adventitious shoots formation followed by meristems culture (d) All of the above

34. Glycerol, DMSO and methanol are ...... type of cryoprotectants. (a) Nonpermeating (b) Permeating (c) Both (a) and (b) (d) None of these

41. “Mingo”—the first licensed cultivar of ...... was produced using haploid induced in vitro based on chromosome elimination, bulbosum method. (a) Oat (b) Barley (c) Wheat (d) None of these 42. Which of the following propagules are mostly used for synthetic seeds production in Arachis hypogaea, Asparagus cooperi, Camellia japonica, Doucus carota, Eucalyptus citriodora? (a) Axillary buds (b) Shoot buds (c) Somatic embryos (d) All of these 43. Which of the following propagules are mostly used for synthetic seeds production in Actinidia dliciosa, Musa sp., Betula pendula, Brassica campestris, Zingiber officinale, Rubus sp.? (a) Axillary buds (b) Shoot buds (c) Somatic embryos (d) All of these 44. An encapsulation machine can produce ...... single embryos per hour: (a) 2000 (b) 4000 (c) 6000 (d) None of these

35. All conventional methods of storage failed to prevent losses caused by: (a) Economic and political issues (b) Natural disorders (c) Attack of pathogens and pests (d) All of the above 36. The concept of cryopreservation is based on arrest of ...... of biological material stored at the low temperature (–196°C): (a) Imbibition (b) Diffusion (c) Osmosis (d) None of these 37. Hydroxyprolie resistant lines of potato showed increased tolerance to: (a) Forest (b) Salinity (c) Both (a) and (b) (d) None of these 38. The first report on mutant isolation through plant tissue cultures is on the selection of ...... suspension cells tolerant to high temperature. (a) Cicer (b) Antirhinum (c) Linum (d) None of these 39. The possible mechanism of metal tolerance in plants is: (a) Chelating by specific metal binding proteins (b) Binding of metal to cell wall (c) Compartmentation of ions in vacuoles (d) All of the above Ans.

33. (a) 44. (c)

34. (b) 45. (d)

35. (d) 46. (c)

36. (d)

37. (c)

45. Alginate artificial seeds are: (a) Transparent (b) Noninhibitory (c) Spherical (d) All of the above 46. Shoot tips excised from the shoot culture of banana are generally encapsulated in ......% sodium alginate solution: (a) 1 (b) 2 (c) 3 (d) None of these 38. (b)

39. (d)

40. (d)

41. (b)

42. (c)

43. (b)

Plant Tissue Culture

47. ...... gave the concept of artificial seeds for the first time. (a) Ganapathy (b) T Murashige (c) Both (a) and (b) (d) None of these 48. Desiccated synthetic seeds are produced by coating somatic embryo in: (a) Polyoxyethylene glycol (b) Calcium alginate (c) Both (a) and (b) (d) None of these 49. In hydrated synthetic seed, somatic embryos are encapsulated in: (a) Polyoxyethylene glycol (b) Calcium alginate (c) Both (a) and (b) (d) None of these 50. Water soaking was described as “Vitrification” by: (a) Hussey (b) Debergh (c) Anonymus (d) None of these 51. Which auxin is required for embryo induction as in case of cereal crops? (a) IBA (b) NAA (c) IAA (d) 2,4-D 52. The somatic embryo can be used for production of synthetic seeds for direct sowing in the field. This statement is true/false: (a) False (b) True (c) Not known (d) None of these 53. ...... coined the turn “totipoten” to denote the capacity of cell to develop into an organism by regeneration. (a) White (b) Steward (c) Morgan (d) None of these 54. Microorganism may be present in nutrient medium at the time of its preparation. These microorganisms can be destroyed by proper plugging and autoclaving the culture flasks. Medium is sterilized completely by maintaining it at ...... °C for about 20 minutes at pressure of ...... kg cm2 in autoclave. Ans.

47. (b) 58. (d)

48. (a) 59. (c)

49. (b) 60. (d)

50. (b) 61. (b)

51. (d)

423

(a) 121, 2.0–2.5 (b) 121, 1.0–1.5 (c) 96, 2.0–2.5 (d) None of these 55. The explants may carry microorganisms hence these are surface sterilized by: (a) Sodium hypochlorite (b) Mercuric chloride (c) Both (a) and (b) (d) None of these 56. Among the followings, which of the culture is known as ”mericloning”: (a) Meristem culture (b) Stem culture (c) Root culture (d) None of these 57. Successful culture of tomato roots was demonstrated by: (a) Carlson (b) Philip White (c) Steward (d) Morel and Martin 58. Fast achievement of protoplast fusion was by: (a) Moral and Martin (b) Steward (c) Carlson (d) Power 59. Selection of biochemical mutants in vitro was done by: (a) Philip White (b) Skoog and Miller (c) Carlson (d) Tekebe 60. First successful isolation from a suspension culture of Hapoppus grecilis was by: (a) Morel and Martin (b) Gautheret (c) Philip White (d) Erikson and Jonassen 61. Publication of first extensive handbook on plant tissue culture was made by: (a) Morel and Martin (b) Gautheret (c) Philip White (d) Erikson and Jonassen 52. (b)

53. (d)

54. (b)

55. (c)

56. (a)

57. (d)

424

Plant Physiology: Question Bank

62. Somatic hybridization of tomato and potato was demonstrated by: (a) Melchers (b) Kohn (c) Krens (d) Chilton 63. Discovery of Ti-plasmid was made by: (a) Pierik (b) Chilton (c) Larebeke (d) Melchers 64. Methods to double the chromosome number in microspores of Datura and Nicotiana were given by: (a) Nitsch (b) Seibert (c) Melchers (d) None of these 65. The production of transformed tobacco plants following single cell transformation or gene insertion was shown by: (a) Melchers (b) Chilton (c) Krens (d) Kohn 66. Protoplast able to incorporate naked DNA was demonstrated by: (a) Melchers (b) Chilton (c) Krens (d) Kohn 67. Shoot initiation from cryopreserved shoot apices of carnation was demonstrated by: (a) Melchers (b) Chilton (c) Krens (d) Seibert 68. The term “Somaclonal variation” was coined by: (a) Melchers (b) Chilton (c) Larkin and Scowcroft (d) Kohn 69. Embryogenesis from nuclei of unfertilized ovules of Citrus sinensis and Citrus aurantifolia is reported by: (a) Scowcroft (b) Chilton (c) Mitra and Chaturvedi (d) None of these 70. When a plant organ or tissue is put on a culture medium and maintained under optimum growth conditions, Ans.

62. (a) 73. (d)

63. (c) 74. (c)

64. (a) 75. (b)

65. (b) 76. (c)

66. (c)

the meristematic cells de-differentiate and proliferate to form a mass of cells called: (a) Embryoids (b) Callus (c) Both (a) and (b) (d) None of these 71. Which of the following species is highly responsive for haploids regeneration? (a) Ranunculaceaae (b) Gramineae (c) Solanaceae (d) All of these 72. Cause of cyanogenesis in plant is: (a) Abortive pollen (b) Allen pollen (c) Delayed pollination (d) All of these 73. ...... and ...... obtained the first haploid plants from isolated Anthers of Nicotiana tabacum. (a) C Maheshwari (b) Bourgin (c) Nitsch (d) None of these 74. ...... and ...... reported the direct development of embryoids from microspores of Datura innaxia by the culture excised anther. (a) C Maheshqawri (b) Sipra guha (c) Both (a) and (b) (d) None of these 75. …………… for the first time showed that mature pollen grains of Ginkgo biloba can be induced to proliferate in culture to produce haploid callus: (a) C Maheswari (b) Tulecke (c) Sipra guha (d) None of these 76. Which of the following is the best example of Cybrid? (a) Brassica oleracea + B. napus (b) Nicotiana tabacum + N. sylvestris (c) Both (a) and (b) (d) None of these 67. (d)

68. (c)

69. (c)

70. (b)

71. (c)

72. (d)

Plant Tissue Culture

77. Which of the following is the best example of interfamilial hybrid? (a) Oryza sativa + Daucus carota (b) Nicotiana tabacum + N. sylvestris (c) Both (a) and (b) (d) None of these 78. Which of the following is the example of intergeneric hybrid? (a) Medicago sativa + Onobrychis vicifolia (b) Nicotiania tabacum + N. rustica (c) Brassica napus + B. nigra (d) All of the above 79. Which of the following is the example of interspecific hybrid? (a) Nicotiana tabacum + N. rustica (b) Solanum pinnoatisectum + S tuberosum (c) Brassica napus + C. sativus (d) All of the above 80. To isolate the fusion products and for selection of plant cells for desirable traits, various strategies have been developed: (a) Resistance to antimetabolites (b) Fluorescence activated cell sorting (c) Direct isolation (d) All of the above 81. The nuclei of two protoplast may or may not fuse together even after fusion of cytoplasm. The binucleate cells are known as heterokaryon. The nuclei when get fused, the cell is called hybrids, and when only cytoplasm fuse and genetic information from one of the two nuclei is lost, is called: (a) Heteroplast (b) Cybrid (c) Cytoplasmic hybrids (d) All of the above 82. In electric fusion of protoplast, fusion is initiated by the field pulse of voltage range from .... for .... microseconds: (a) 100V–1 Kv cm–1, 10–1000 (b) 500V–3 Kv cm–1, 10–1000 Ans.

77. (c) 88. (c)

78. (d)

79. (d)

80. (d)

81. (d)

425

(c) 900V–5 Kv cm–1, 10–1000 (d) None of the above 83. In some species protoplasts can directly form somatic embryos, these are: (a) Brassica juncea (b) Citrus (c) Medicago (d) All of these 84. The isolated protoplast regenerates new walls around themselves. This can be demonstrated by staining the reconstructed protoplast for 5 min. with a fluoresecent dye ...... . (a) Evans blue (b) Fluorescein diacetate (b) Calcofluor white (d) All of the above 85. The fusion and fusion product of protoplasts are observed in: (a) Electron microscope (b) Inverted microscope (c) Phase contrast microscope (d) None of the above 86. High Ca2+ ion concentration and pH (10.5) of the incubation mixture ...... fusion process. (a) Decreases (b) Facilitates (c) Do not affect (d) None of these 87. There are several chemical and physical agents, known as fusogen or fusion agents, which help in fusion between protoplasts. These are: (a) Dextran sulfate (b) Sodium nitrate (c) Polyethylene glycol (d) All of these 88. The positively charged plasma membrane can be obtained in the presence of: (a) Synthetic phospholipids (b) Poly L-lysine (c) Both (a) and (b) (d) None of these 82. (b)

83. (d)

84. (d)

85. (b)

86. (b)

87. (d)

426

Plant Physiology: Question Bank

89. The outer membrane surface is negatively charged and varies from: (a) –10 to 20 mV (b) –10 to –50 mV (c) –20 to 60 mV (d) None of the above 90. The contact of protoplasts depends on surface: (a) Heat (b) Charge (c) Permeability (d) None of these 91. The protoplast fusion requires ...... contact between membrane surfaces: (a) Indirect (b) No contact (c) Direct (d) All of these 92. A short heat treatment at 45°C for 5 minute improved protoplast division in: (a) Pennisetum (b) Wheat (c) Rice (d) All of these 93. Suitable temperature for protoplast culture is: (a) 20–28°C (b) 19–28°C (c) 24–28°C (d) None of these 94. Protoplasts from highly differentiated cell culture require high: (a) Auxin-kinetin (b) Auxin/kinetin (c) Kinetin/auxin (d) None of these 95. Protoplasts from actively growing cell culture require high: (a) Auxin–kinetin (b) Auxin/kinetin (c) Kinetin/auxin (d) None of these 96. The presence of ammonium in culture medium is toxic to protoplast of: (a) Several fruit tree species (b) Some species of compositae (c) Potato (d) All of these 97. Protoplast viability size test can be done through: (a) Change in protoplast size induced by changes in the level of osmoticum (b) Measure of photosynthetic and respiratory activities (c) Exclusion of Evans blue dye (d) All of the above Ans.

89. (b) 90. (b) 91. (c) 92. (d) 93. (c) 100. (b) 101. (d) 102. (d) 103. (b) 104. (c)

98. Intact protoplast form pellet. This statement is: (a) False (b) True (c) Not known (d) None of these 99. Protoplast suspension is centrifuged at the speed of: (a) 200–250 × g/5 min (b) 100–150 × g/5 min (c) 50–100 × g/5 min (d) None of the above 100. Protoplasts are counted by: (a) Gigermuller counter (b) Hemocytometer (c) Protocytometer (d) None of the above 101. Isolation of protoplast using mechanical methods involves isolation from vacuolated cells of storage tissue such as: (a) Mesocarp of cucumber (b) Onion (c) Radish (d) All of the above 102. Somatic embryogenesis involves many stages/phases that include: (a) Regeneration of plants (b) Culture of protoplast (c) Choice of plant material (d) All of the above 103. The first release of a commercial cultivar obtained from protoplast fusion was in: (a) 1980 (b) 1990 (c) 1999 (d) None of these 104. ...... et al. obtained the first interspecific hybrid between protoplast of normal Nicotiana sylvisteris and X-ray irradiated protoplast of male sterile N. tabacum: (a) Fromm (b) Melchers (c) Zelcer (d) None of these 94. (c)

95. (b)

96. (d)

97. (d)

98. (b)

99. (c)

Plant Tissue Culture

105. The first intergeneric hybrid (Pomato) between potato and tomato was demonstrated by: (a) Fromm (b) Melchers (c) Zelcer (d) None of these 106. Which of the following scientist, was successful in obtaining the first interspecific somatic hybrid using protoplast fusion between Nicotiana glauca and Nicotiana longsdroffui? (a) Carlson (b) Klerckel (c) Takabe (d) None of these 107. Which of the following scientist, with the help of commercially available enzymes, isolated protoplast and able to regenerate whole tobacco plant from mesophyll protoplast? (a) Carlson (b) Klerckel (c) Takabe (d) None of these 108. Which of the following scientist tried to isolate protoplast from plasmolyzed higher plant cells by mechanically cutting the cells? (a) Carlson (b) Klerckel (c) Takabe (d) None of these 109. Protoplast is a ...... individual cell: (a) Nonfunctional (b) Functional (c) Not known (d) None of these 110. Protoplasts are the plant cells with a plasma membrane but no: (a) Ribosome (b) Mitochondria (c) Cell wall (d) None of these 111. Cryopreservation of tissue culture materials in liquid nitrogen is at: (a) –90°C (b) –190°C (c) –96°C (d) –196°C 112. Dimethyl sufoxide is used as……….in tissue culture: (a) Osmaticum (b) Growth regulator (c) Cryoprotectant (d) None of the above

427

113. The term somaclone was proposed by…… . (a) Skoog (b) Murashige (c) Larkin and Scowcroft (d) None of the above 114. Ono is a somaclonal variety of …… (a) Alfa alfa (b) Citronella (c) Sugarcane (d) Geranium 115. A plant derived from a somatic embryo is referred as……… (a) Embling (b) Seedling (c) Both (a) and (b) (d) None of the above 116. Hydrated synthetic seeds are developed by…… (a) Redenbergh (b) Maheswari (c) Kim and Janick (d) Larkin and scowcraft 117. Varuna is a somaclonal variety of …… (a) Citronella (b) Brassica juncea (c) Geranium (d) Sugarcane 118. Dessicated synthetic seeds are developed by…… (a) Kim and janick (b) Redenbergh (c) Both (a) and (b) (d) None of the above 119. Bio 13 is a somaclonal variety of …… (a) Citronella (b) Geranium (c) Brassica juncea (d) Sugarcane 120. Velvet rose is a somaclonal variety of …… (a) Citronella (b) Geranium (c) Alfalfa (d) Sugarcane 121. Addition of …..found to increase the success rate of androgenesis. (a) Nutrients specific to certain genotype (b) Sucrose (c) Ethrel (d) All of the above 122. The protoplast isolation by enzymatic by……… (a) Takebe (b) Klecker (c) EC Cocking (d) None of these

Ans. 105. (b) 106. (a) 107. (c) 108. (b) 109. (b) 110. (c) 111. (d) 112. (c) 113. (c) 114. (c) 115. (a) 116. (a) 117. (b) 118. (a) 119. (a) 120. (b) 121. (d) 122. (c)

428

Plant Physiology: Question Bank

123. For protoplast fusion ………… is/are used. (a) High pH and high Ca2+ (b) PEG (c) NaNO3 (d) All of the above 124. The culturing of single protoplast in liquid media is done by ……… (a) Microdoplet cultures (b) Multiple drop array technique (c) Microchamber culture (d) Drop culture method 125. The variability in chromosome number in somatic hybrids could be due to ………… (a) Somaclonal variation in cultured cells (b) Asymmetric hybrids (c) Multiple fusions give a higher chromosome number (d) All of the above 126. Which of the auxin is widely used as a selective weedicide? (a) 2,4-T (b) 2,4-D (c) IAA (d) IBA 127. In tissue culture medium embryoids formed from the pollen grain due to: (a) Test tube culture (b) Double fertilization (c) Organogenesis (d) Cellular totipotency 128. Meristem culture of banana enables: (a) Rapid multiplication (b) Elimination of bunch top virus disease (c) Both (a) and (b) (d) Slow growth 129. Somaclonal variation method refers to: (a) Large number of plant cells (b) Small number of species having limited commercial potential (c) Genetic isolation (d) Heritable change 130. The leaf has been the most favorite source of plant protoplasts isolation because ……….

(a) Mesophyll cell is loosely arranged and enzymes have an easy access to the cell wall (b) Isolation of a large number of relatively uniform cells without the necessity of killing the plants (c) Both (a) and (b) (d) None of the above 131. The first report of plant regeneration from isolated protoplasts was from ……… (a) Zea mays (b) Petunia hybrid (c) Nicotiana tabacum (d) None of the above 132. Which is/are the naturally occurring plant auxins? (a) IAA (b) NAA (c) 2,4-D (d) All of the above 133. Neutralized activated charcoal is occasionally added to young regenerating cultures to (a) Help to remove plant growth regulators introduced at an earlier stage (b) Remove toxic phenolics produced by stressed plants (c) Both (a) and (b) (d) Maintain pH of medium 134. When plated only in nutrient medium how much time is required for the protoplast to synthesize new cell wall? (a) 5–10 days (b) 15–17 days (c) 2–5 days (d) 5–15 days 135. In tissue culture, the multiplication is through: (a) Enhanced axillary branching (b) Callusing (c) Adventitious bud formation (d) All the above 136. Multiplication of genetically identical copies of a cultivar by asexual reproduction is called……... (a) Vegetative propagation (b) Clonal propagation (c) Apomixes (d) None of these

Ans. 123. (d) 124. (a) 125. (d) 126. (b) 127. (d) 128. (c) 129. (d) 130. (c) 131. (c) 132. (a) 133. (c) 134. (a) 135. (d) 136. (b)

Plant Tissue Culture

137. Pollen dimorphism is exhibited by: (a) Wheat (b) Barley (c) Tobacco (d) All the above 138. The capacity for haploid production ………… (a) Unaffected with age of donor plants (b) Increases with age of donor plants (c) Declines with age of donor plants (d) None of the above 139. Ovule culture is first attempted in ………….. (a) Cruciferae (b) Malvaceae (c) Fabaceae (d) Orchidaceae 140. Bulbosum technique is used for ………….. (a) Monoploid production (b) To overcome seed dormancy (c) Embryo rescue (d) All the above 141. Ovary culture is first reported …………. (a) Cotton (b) Sorghum (c) Barley (d) None of the above 142. Synthetic seeds are produced by encapsulating embryo with: (a) Sodium nitrate (b) Sodium acetate (c) Sodium alginate (d) Sodium chloride 143. Cybrids are produced by: (a) Nucleus of one species but cytoplasm of both the parent species (b) Fusion of two same nucli from same species (c) Fusion of two different nuclei from same species (d) None of the above 144. Which of the plant cell will show totipotency? (a) Crok cell (b) Sieve tubes (c) Meristem (d) Xylem vessels

429

145. Synthetic seeds are: (a) Seeds of plants modified genetically (b) Somatic embryos encapsulated in suitable matrix (c) Artificially synthesized seeds (d) None of these 146. Plants with gametic chromosome number are termed which of the following? (a) Monoploid (b) Dihaploid (c) Haploid (d) Diploid 147. A simple method for large scale electrofusion of protoplasts was developed by ...... . (a) King (b) Watts (c) Both (a) and (b) (d) None of the above 148. Ploidy changes occur due to …….. during mitosis. (a) Spindle fusion (b) Endoreduplication (c) Endomitosis (d) All the above 149. Pusa Jai Kisan (BIO 902) somaclone of Indian mustard was isolated from which of the following variety? (a) Karuna (b) Kranti (c) Varuna (d) Pusa bold 150. Soamaclonal variation generally serves the purpose as which of the following? (a) Hybrid sorting (b) Mutational breeding (c) Back cross breeding (d) Analytical breeding 151. Triploidy is exploited in………… (a) Banana (b) Watermelon (c) Apple (d) All of the above 152. Endosperm is ……….in nature. (a) Diploid (b) Monoploid (c) Tetraploid (d) Triploid 153. In vitro fertilization can take place through……….

Ans. 137. (d) 138. (c) 139. (d) 140. (c) 141. (c) 142. (b) 143. (a) 144. (c) 145. (b) 146. (c) 147. (c) 148. (d) 149. (c) 150. (b) 151. (d) 152. (d)

430

Plant Physiology: Question Bank

(a) Fertilization of an isolated ovule without a placenta (b) Placental fertilization (c) Stigma fertilization (d) All the above 154. Somatic hybridization is achieved through (a) rDNA technology (b) Conjugation (c) Protoplast fusion (d) Grafting 155. The growth hormone not used in embryo culture medium is……….. (a) Cytokinin (b) Gibberellins (c) Auxin (d) None of the above 156. Ovary culture is first reported by ………… (a) Kano (b) San noem (c) Northern (d) None of the above 157. Ovule culture is first attempted by ……….. (a) Kano (b) Nimoto and sagawa (c) Northern (d) None of the above 158. Bulbosum technique is…………….. (a) Chromosome elimination following intraspecific hybridization (b) Chromosome elimination following interspecific hybridization (c) Chromosome elimination (d) None of the above 159. In pollen culture, isolation of pollen grains from the cultured anthers is by………… (a) Float culture method (b) Mechanical method (c) Both (a) and (b) (d) None of these 160. The development of numerous pollen plantlets in anther culture of Datura Innoxia was first reported by……….

(a) Maheswari (b) Guha (c) Both (a) and (b) (d) None of the above 161. In tissue culture, the multiplication through: (a) Enhanced axillary branching (b) Adventitious bud formation (c) Callusing (d) All the above 162. The crucial stage in tissue culture is (a) Rooting of shoots (b) Multiplication (c) Initiation of culture (d) Preparative stage 163. The oxidation of phenolic compounds leached out from the cut surface of the explants in tissue culture leads to …………. (a) Whitening of the medium (b) Blackening of the medium (c) Browning of the medium (d) None of the above 164. The suitable explants for producing virus free plant is ………….. (a) Leaf (b) Stem (c) Meristem (d) None of these 165. ………. stage involves the preparation of mother plants in micropropagation. (a) 3 (b) 2 (c) 1 (d) 0 166. Vegetative propagation is by………… (a) Regeneration of new plants from vegetative parts (b) Seed development without meiosis and fertilization (c) Both (a) and (b) (d) None of these 167. Embryo culture is used for ……. (a) To overcome seed dormancy and self-sterility of seeds (b) To overcome embryo abortion due to incompatibility barriers (c) Embryo rescue in distant hybridization (d) All the above

Ans. 153. (d) 154. (c) 155. (c) 156. (b) 157. (b) 158. (b) 159. (c) 160. (c) 161. (d) 162. (b) 163. (c) 164. (c) 165. (d) 166. (a) 167. (d)

Plant Tissue Culture

168. The localized meristematic cells on a callus which give rise to shoots and/or roots are termed ………. (a) Meristemoids (b) Organoids (c) Both (a) and (b) (d) None of the above 169. Abnormal structures developed during organogenesis are called……….. (a) Meristemoids (b) Organoids (c) Both (a) and (b) (d) None of the above 170. A developmental sequence involving an intervening callus stage is termed: (a) Direct organogenesis (b) Morphogenesis (c) Indirect organogenesis (d) None of the above 171. The Osmoticums used in tissue culture medium are: (a) Fructose and galactose (b) Sucrose (c) Sorbitol and mannitol (d) All the above 172. Growth hormone responsible for apical dominance: (a) Ethylene (b) Auxin (c) Gibberellin (d) Cytokinin 173. Anther culture was discovered by: (a) Maheshwari (b) Guha (c) Both (a) and (b) (d) None of these 174. Prezygotic barriers to hybridization can be overcome by………. (a) Pod culture (b) Ovule culture (c) Embryo culture (d) In vitro fertilization 175. In vitro methods used to generate haploids......... (a) Culture of excised anthers and pollen (b) Bulbosum technique of embryo culture

431

(c) Culture of excised ovaries and ovules (d) All the above 176. Cell differentiation in plants is……….. (a) Reversible (b) Irreversible (c) Both (a) and (b) (d) None of the above 177. The medium in tissue culture should provide………. (a) Optimal physical condition of pH, osmotic pressure, etc. (b) Nutrients for the survival of the plant cells, tissues and organs under culture (c) Both (a) and (b) (d) None of the above 178. The standard carbon source is………… (a) Glucose (b) Sucrose (c) Fructose (d) None of the above 179. Vitamin(s) used in tissue culture medium is/are………… (a) Pyridoxine HCl (b) Nicotinic acid (c) Calcium pantothenate (d) All the above 180. The auxins are diluted in ……… (a) Dilute NaOH (b) Ethanol (c) Both (a) and (b) (d) None of the above 181. High auxin and low cytokinin ration favors ………… (a) Chloroplast formation and other processes (b) Induce formation of adventitive or axillary shoots (c) Initialize root formation, embryogenesis and callus formation (d) None of the above 182. …………. is used most successfully to obtain rapid growth of somatic embryos into plants.

Ans. 168. (a) 169. (b) 170. (c) 171. (d) 172. (b) 173. (c) 174. (d) 175. (d) 176. (d) 177. (c) 178. (b) 179. (d) 180. (c) 181. (c)

432

Plant Physiology: Question Bank

(a) Cytokinin (b) Gibberellic acid (c) Auxin (d) None of the above 183. High concentration of ……… favors shoot initiation. (b) IAA (a) GA3 (c) Kinetin (d) None of the above 184. The predetermination theory was proposed by………. . (a) Tisserat (b) Street (c) Halperin (d) Steward 185. Ethylene is involved in ………… (a) Abscission (b) Senescence (c) Fruit maturation (d) All the above 186. The cell isolation theory was proposed by…………. (a) Tisserat (b) Halperin (c) Street (d) Steward 187. The somatic embryogenesis was first observed by………… (a) Reinert (b) Steward (c) Both (a) and (b) (d) None of the above 188. The genesis of shoot from the explants or calli is termed ……… (a) Organogenesis (b) Caulogenesis (c) Rhizogenesis (d) None of the above 189. The relatively high level of cytokinin to auxin favored………….. during organogenesis (a) Shoot formation (b) Both root and shoot formation (c) Root formation (d) None of the above 190. Fusion of two protoplast is brought about by: (a) Cytokinin (b) Agarose gel (c) Poly ethylene glycol (PEG) (d) Pectinase

191. The phenomenon of morphogenesis depends on the factors like………. (a) Regeneration of individual cells (b) Differentiation (c) Polarity (d) All the above 192. The phenomenon of conversion of component cells of callus tissue to whole plant or plant organs is called ………… (a) Redifferentiation (b) Dedifferentiation (c) Both (a) and (b) (d) None of the above 193. For a differentiated cell, to express its totipotency, it should undergo (a) Redifferentiation (b) Dedifferentiation (c) Both (a) and (b) (d) None of the above 194. The term totipotency was coined by………. (a) Rechinger (b) Haberlandt (c) Morgan, TH (d) Duharmel du Monceau 195. The term totipotency means……….. (a) The capability of a cell to form an individual plant (b) The capability of cell to form an individual cell (c) Both (a) and (b) (d) None of the above 196. Father of plant tissue culture is……….. (a) Morgan, TH (b) Haberlandt (c) Rechinger (d) Duharmel du Monceau 197. A(n) ……is an excised piece of leaf or stem tissue used in micropropagation. (a) Scion (b) Explant (c) Medium (d) Microshoot 198. The embryo culture was first demonstrated by……… (a) Kotte (b) Harrison (c) Liabach (d) Robbins

Ans. 182. (b) 183. (a) 184. (a) 185. (d) 186. (d) 187. (c) 188. (b) 189. (a) 190. (c) 191. (d) 192. (a) 193. (c) 194. (c) 195. (b) 196. (b) 197. (b) 198. (c)

Plant Tissue Culture

199. Father of micropropagation is………. (a) Kotte (b) Harrison (c) Robbins (d) Ball 200. Protoplasts can be produced from suspension cultures, callus tissues or intact tissues by enzymatic treatment with: (a) Proteolytic enzymes (b) Both cellulolytic and pectolytic enzymes (c) Pectolytic enzymes (d) Cellulolytic enzymes 201. The nurse culture technique was established by………. (a) Braun (b) Muir (c) White (d) None of the above 202. The somatic embryo formation from callus cultures of carrot grown on an agarified medium was observed by……….. (a) Reinert (b) Muir (c) Hildebrandt (d) All the above 203. The technique of isolation and culture of protoplasts after digesting the cell wall senzymatically was discovered by………… (a) Cocking (b) Muir (c) Hildebrandt (d) All the above 204. The plating technique was invented by…………… (a) Bergmann (b) Riker (c) Muir (d) Bergmann 205. Which of the following is considered as the disadvantage of conventional plant tissue culture for clonal propagation? (a) Multiplication of sexually derived sterile hybrids (b) Less multiplication of disease free plants (c) Storage and transportation of propogates (d) Both (a) and (c)

433

206. Organogenesis is (a) Formation of callus tissue (b) Formation of root and shoots on callus tissue (c) Both (a) and (b) (d) Genesis of organs 207. The phenomenon of the reversion of mature cells to the meristematic state leading to the formation of callus is known: (a) Redifferentiation (b) Dedifferentiation (c) Either (a) or (b) (d) None of these 208. Subculturing is similar to propagation by cuttings because (a) It uses scions to produce new microshoots (b) They both use in vitro growing conditions (c) It separates multiple microshoots and places them in a medium (d) All of the above 209. What is/are the benefit(s) of micropropagation or clonal propagation? (a) Multiplication of sexually derived sterile hybrids (b) Multiplication of disease free plants (c) Rapid multiplication of superior clones (d) All of the above 210. The production of secondary metabolite requires use of: (a) Axillary buds (b) Cell suspension culture (c) Meristem (d) Protoplasts 211. Tissue culture technique has been successfully used for producing: (a) Alcoholic beverages (b) Cheese (c) Shikonin (d) Insulin 212. The potential use of protoplast fusion technology is:

Ans. 199. (d) 200. (b) 201. (b) 202. (a) 203. (a) 204. (d) 205. (c) 206. (b) 207. (b) 208. (c) 209. (d) 210. (b) 211. (c)

434

Plant Physiology: Question Bank

(a) Production of somatic hybrids of genetically diverse species (b) Transfer of cell organelles from one species to antoher (c) Transfer of a few chromosomes or genes between divergent species (d) All of the above 213. Which among the following statements are true? Write T for true and F for False. (a) Haploid plants can be obtained by anther culture (b) Only certain cells can behave like a zygote when provide with appropriate essential nutrient, hormones, vitamins and growth conditions (c) The regeneration of plant from organ culture is independent of growth hormones supplied in the medium (d) Naked plant cells, i.e. cells without cell wall are called protoplasts. 214. Tissue culture technique can be applied for: (a) Crop improvement (b) Synthetic seed production (c) Propagation of rare plants (d) All the above 215. Who among the following is called “Father of tissue culture”? (a) Nitsch (b) Haberlandt (c) SC Maheshwari (d) Stephen Hales 216. Who among the following is called “Father of Indian plant tissue culture”? (a) SC Maheshwari (b) TM Varghese (c) P Maheshwari (d) CM Sanna 217. In India tissue culture technology was first developed at: (a) Department of Botany, Delhi University, Delhi (b) Haryana Agriculture University Hissar Ans. 212. (d) 213. (a)-T, (b)-F, (c)-F, (d)-T 220. (c) 221. (a) 222. (c)

(c) Central Rice Research Institute, Cuttack (d) Department of Botany, Patna University, Patna 218. Tissue culture is: (a) Gene biotechnology (b) Non-gene biotechnology (c) Both (a) and (b) (d) None of the above 219. Tissue culture is: (a) Multicellular culture (b) Unicellular culture (c) Acellular culture (d) All the above 220. Virus free clonal plants can be produced: (a) From cutting (b) By anther culture (c) By shoot tip culture (d) By micropropagation 221. Totipotency of cell is the ability of: (a) Permanent cells to divide if proper nutrient supply is maintained exogenously (b) Permanent cells to divide even in stress condition (c) Meristematic cells not to divide in stress condition (d) Nonliving cells to divide if proper nutrient supply is maintained exogenously 222. In India first plantlet regenerated from pollen grain through tissue culture technique was: (a) Solanum nigrum (b) Nicotiona tabaccum (c) Datura annoxia (d) Daucas carota 223. Bamboos generally flower once in a multiple of 12 years, now a technique has been developed to induce early flowering in tissue cultured bamboos at:

214. (d)

215. (b) 216. (a) 217. (a) 218. (c) 219. (a)

Plant Tissue Culture

(a) University of Delhi (b) Haryana Agriculture University (c) Rajendra Agriculture University (d) University of Hyderabad 224. Basic need/needs of tissue culture is/ are: (a) Nutrient medium (b) Aseptic condition (c) Aeration (d) All the above 225. High auxin/cytokinin ratio favors: (a) Shoot formation (b) Root formation (c) Both (a) and (b) (d) Leaf formation 226. Acclimatization is a process of: (a) Hardening (b) subculture (c) Inoculation (d) Callus formation 227. Which of the following is not organ culture? (a) Anther culture (b) Embryo culture (c) Ovary culture (d) Leaf culture 228. Plant tissue culture technique is a redefined method of ...... (a) Hybridization (b) Vegetative propagation (c) Asexual reproduction (d) Selection 229. Polyethylene glycol is: (a) Fusogenic chemical (b) Electrofusion stimulant (c) Callus stimulant (d) Differentiation stimulant 230. The production of secondary metabolites require the use of: (a) Protoplast (b) Cell suspension (c) Meristem (d) Axillary buds 231. Synthetic seed is produced by encapsulating somatic embryo with:

435

(a) Sodium chloride (b) Sodium alginate (c) Sodium acetate (d) Sodium nitrate 232. Hormone pair required for a callus to differentiate are: (a) Auxin and cytokinin (b) Auxin and ethylene (c) Auxin and abscisic acid (d) Cytokinins and gibberellin 233. DMSO (dimethyl sulfoxide) is used as: (a) Gelling agent (b) Alkylating agent (c) Chelating agent (d) Cryoprotectant 234. The most widely used chemical for protoplast fusion, as fusogen is: (a) Mannitol (b) Sorbitol (c) Mannol (d) Polyethylene glycol 235. Cybrids are produced by: (a) Fusion of two different nuclei from two different species (b) Fusion of two same nuclei from same species (c) Nucleus of one species but cytoplasm from both the parent species (d) None of the above 236. Callus is: (a) Tissue that forms embryo (b) An insoluble carbohydrates (c) Tissue that grows to form embryoid (d) Unorganized actively dividing mass of cells maintained in cultured 237. Part of plant used for culturing is called: (a) Scion (b) Explant (c) Stock (d) Callus 238. Growth hormone producing apical dominance is: (a) Auxin (b) Gibberellin (c) Ethylene (d) Cytokinin

Ans. 223. (a) 224. (d) 225. (b) 226. (a) 227. (b) 228. (b) 229. (a) 230. (b) 231. (b) 232. (a) 233. (d) 234. (d) 235. (c) 236. (d) 237. (b) 238. (a)

436

Plant Physiology: Question Bank

239. A medium which is composed of chemically defined compound is called: (a) Natural media (b) Synthetic media (c) Artificial media (d) None of these 240. To obtain haploid plant, we culture: (a) Entire anther (b) Nucleus (c) Embryo (d) Apical bud 241. Somaclonal variations are the ones: (a) Caused by mutagens (b) Produce during tissue culture (c) Caused by gamma rays (d) Induced during sexual embryogeny 242. Which of the following plant cell will show totipotency? (a) Xylem vessels (b) Sieve tube (c) Meristem (d) Cork cells 243. Which vector is mostly used in crop improvement? (a) Plasmid (b) Cosmid (c) Phasmid (d) Agrobacterium 244. Somatic hybridization is achieved through: (a) Grafting (b) Protoplast fusion (c) Conjugation (d) Recombinant DNA technology 245. The enzymes required to obtain wallfree/naked protoplasts are: (a) Cellulase and proteinase (b) Cellulase and pectinase (c) Cellulase and amylase (d) Amylase and pectinase

248. Which of the following is considered as the disadvantage of conventional plant tissue culture for clonal propagation? (a) Multiplication of sexually derived sterile hybrids (b) Less multiplication of disease free plants (c) Storage and transportation of propagates (d) Both (b) and (c) 249. What is meant by ‘Organ culture’ ? (a) Maintenance alive of a whole organ, after removal from the organism by partial immersion in a nutrient fluid (b) Introduction of a new organ in an animal body with a view to create genetic mutation in the progenies of that animal (c) Cultivation of organs in a laboratory through the synthesis of tissues (d) The aspects of culture in community which are mainly dedicated by the need of a specified organ of the human body 250. Which method of plant propagation involves the use of girdling? (a) Grafting (b) Cuttings (c) Layering (d) Micropropagation

246. The first transgenic crop was: (a) Pea (b) Tobacco (c) Flax (d) Cotton

251. Which of the following is used in the culture of regenerating protoplasts, single cells or very dilute cell suspensions? (a) Nurse medium (b) Nurse or feeder culture (c) Both (a) and (b) (d) None of these

247. A(n) ...... is an excised piece of leaf or stem tissue used in micropropagation. (a) Microshoot (b) Medium (c) Explant (d) Scion

252. Organogenesis is: (a) Formation of callus tissue (b) Formation of root and shoots on callus tissue

Ans. 239. (b) 240. (a) 241. (b) 242. (c) 243. (d) 244. (b) 245. (b) 246. (b) 247. (c) 248. (c) 249. (a) 250. (c) 251. (c) 252. (b)

Plant Tissue Culture

(c) Both (a) and (b) (d) Genesis of organs 253. In a callus culture: (a) Increasing level of cytokinin to a callus induces shoot formation and increasing level of auxin promote root formation (b) Increasing level of auxin to a callus induces shoot formation and increasing level of cytokinin promote root formation (c) Auxins and cytokinins are not required (d) Only auxin is required for root and shoot formation 254. Protoplast are the cells devoid of: (a) Cell membrane (b) Cell wall (c) Both (a) and (b) (d) None of these 255. Which breeding method uses a chemical to strip the cell wall of plant cells of two sexually incompatible species? (a) Mass selection (b) Protoplast fusion (c) Transformation (d) Transpiration 256. The phenomenon of the reversion of mature cells to the meristematic state leading to the formation of callus is known as: (a) Redifferentiation (b) Dedifferentiation (c) Either (a) or (b) (d) None of these 257. Cell fusion method includes the preparation of large number of: (a) Plant cells stripped of their cell wall (b) Single plant cell stripped of their cell wall (c) Plant cells with cell wall (d) Cells from different species 258. Subculturing is similar to propagation by cuttings because:

437

(a) It separates multiple microshoots and places them in a medium (b) It uses scions to produce new microshoots (c) They both use in vitro growing conditions (d) All of the above 259. The ability of the component cells of callus to form a whole plant is known as: (a) Redifferentiation (b) Dedifferentiation (c) Either (a) or (b) (d) None of these 260. What is/are the benefit(s) of micropropagation or clonal propagation? (a) Rapid multiplication of superior clones (b) Multiplication of disease free plants (c) Multiplication of sexually derived sterile hybrids (d) All of the above 261. When plated only in nutrient medium, how much time is required for the protoplast to synthesize new cell wall? (a) 2–5 days (b) 5–10 days (c) 10–15 days (d) 15–17 days 262. Cellular totipotency is the property of: (a) Plants (b) Animals (c) Bacteria (d) All of these 263. Agrobacterium based gene transfer is efficient: (a) Only with dicots (b) Only with monocots (c) Both (a) and (b) (d) With majority monocots and few dicots 264. Who is the father of tissue culture? (a) Bonner (b) Haberlandt (c) Laibach (d) Gautheret 265. Tissue culture refers to: (a) Anther culture (b) Ovule culture (c) Protoplast culture (d) All of these

Ans. 253. (a) 254. (b) 255. (b) 256. (b) 257. (b) 258. (a) 259. (a) 260. (d) 261. (b) 262. (a) 263. (a) 264. (b) 265. (d)

438

Plant Physiology: Question Bank

266. Naked cell is called: (a) Plastid (b) Proplastid (c) Protoplast (d) Cytoplast 267. The plant part which is used for regeneration is called: (a) Clone (b) Callus (c) Explant (d) None of these 268. A mass of unorganized regenerated cells in culture medium is called: (a) Embryoid (b) Somatic (c) Callus bud (d) All of these 269. The ability of a plant cell to develop into a whole plant in culture medium is known as: (a) Viability (b) Longevity (c) Totipotency (d) Prepotency 270. The process of differentiation of root and shoot from somatic embryos in culture medium is called: (a) Gametogenesis (b) Sporogenesis (c) Organogenesis (d) Embryogenesis 271. Organ culture refers to: (a) Anther culture (b) Ovule culture (c) Embryo culture (d) All of these 272. Callus refers to a mass of: (a) Cells (b) Unorganized cells (c) Organized cells (d) All of these 273. The term somaclonal variation was first used by: (a) Baraski (b) Bunn (c) Larkin and Scowcroft (d) Davidson 274. Larkin and Scowcroft first used the term somaclonal variation in: (a) 1960 (b) 1901 (c) 1985 (d) 1991

275. The anther culture technique was first developed by: (a) Bahaduri (b) Maheshwari (c) Guha and Maheshwari (d) Barski 276. Guha and Maheshwari developed anther culture technique in the year: (a) 1954 (b) 1964 (c) 1967 (d) 1971 277. Guha and Maheshwari developed anther culture technique working with: (a) Brassica (b) Corn (c) Datura (d) Oenothera 278. The nutrient medium for tissue culture was first developed by: (a) Gamberg, et al (b) Murashige and Skoog (c) Maheshwari (d) Bahaduri 279. Murashige and Skoog first developed nutrient medium for tissue culture in: (a) 1952 (b) 1960 (c) 1962 (d) 1965 280. Micropropagation is widely used in: (a) Horticulture (b) Floriculture (c) Forestry (d) All of these 281. In vegetatively propagated species, somaclonal variation is: (a) Low (b) Moderate (c) High (d) Very high 282. Hoploid plants can be obtained from ...... (a) Anther culture (b) Bud culture (c) Leaf culture (d) Root culture

Ans. 266. (c) 267. (c) 268. (c) 269. (c) 270. (c) 271. (d) 272. (b) 273. (c) 274. (b) 275. (c) 276. (b) 277. (c) 278. (b) 279. (c) 280. (d) 281. (d) 282. (a)

Stress Physiology

439

27

Stress Physiology 9. Hypersensitive response of plants includes: (a) Synthesis of phytohormones (b) Formation of pathogen related protein (c) Formation of phytoalexins (d) All of the above

1. The size of HSP class 60 is: (a) 15–30 kDa (b) 100–114 kDa (c) 57–60 kDa (d) 80–94 kDa 2. The size of HSP class 70 is: (a) 69–71 kDa (b) 100–114 kDa (c) 57–60 kDa (d) 80–94 kDa 3. The size of HSP class 90 is: (a) 15–30 kDa (b) 100–114 kDa (c) 57–60 kDa (d) 80–94 kDa

10. Phytoalexins are: (a) Synthetic compounds (b) Plant hormones (c) Secondary metabolites (d) None of the above

4. The size of HSP class 100 is: (a) 15–30 kDa (b) 100–114 kDa (c) 57–60 kDa (d) 80–94 kDa 5. Cellular location of HSP (Heat-Shock Protein) class 60 is: (a) Chloroplast (b) Mitochondria (c) Both (a) and (b) (d) None of these 6. Cellular location of HSP class 70 is: (a) Chloroplast (b) Mitochondria (c) Cytosol (d) All of these 7. Cellular location of HSP class 60 is: (a) ER (b) Cytosol (c) Both A and B (d) None of these

11. Choose the chill-tolerant pant, among the following: (a) Arabidopsis (b) Dieffenbachia (c) Coleus (d) Croton 12. Drought resistance in plant is related to: (a) –ve water potential (b) +ve water potential (c) Both (a) and (b) (d) None of these 13. After acclimation in plants, what will be the tolerance level of plants against a particular stress? (a) Decreased (b) Increased (c) Unaffected (d) None of these

8. Cellular location of HSP class 100 is: (a) Chloroplast (b) Mitochondria (c) Cytosol (d) All of these Ans.

1. (c) 12. (a)

2. (a) 13. (b)

3. (d) 14. (d)

4. (b)

5. (c)

14. Which of the following is antidigestive protein? (a) Proteolytic inhibitors (b) -amylase inhibitors (c) Lectins (d) None of these 6. (d) 439

7. (c)

8. (d)

9. (d)

10. (c)

11. (a)

440

Plant Physiology: Question Bank

15. The transmission rate of SAR signal from infection site to other parts of the plants is: (a) 6 cm/h (b) 3 cm/h (c) 10 cm/h (d) None of these 16. ...... is considered to be the pathway of SAR signal. (a) Xylem (b) Phloem (c) Both (a) and (b) (d) None of these 17. Tidestromia oblongifolia, a native of very hot climate of the Death Valley, California, belongs to the family: (a) Fabaceae (b) Brassicaceae (c) Amaranthaceae (d) None of these 18. Which of the following acts as ice nucleators? (a) Protein (b) Polysaccharides (c) Both (a) and (b) (d) None of these 19. Ice nucleation means: (a) Formation of ice crystals around large polysaccharides and proteins in the cell walls (b) Formation of ice under the influence of nucleus (c) Formation of ice in chloroplast (d) None of the above 20. Morphological symptom of plants suffering from salt injury is: (a) Lesion of leaves (b) Chlorosis of leaves (c) Lesser growth (d) All of these 21. Among the choices, which of the following amino acid chiefly accumulates in cells of water stressed plants and also hydrophytes to maintain osmotic relations of the cells? (a) Leucine (b) Glycine (c) Proline (d) More than one 22. Which of the following plant is most sensitive to frost injury? (a) The burning of leaf edge (b) Temperate zone plants (c) Tropical zone plants (d) None of the above Ans.

15. (b) 26. (b)

16. (b) 27. (b)

17. (c) 28. (c)

18. (c) 29. (b)

19. (a)

23. In the choice given below, which of the plant(s) is the example of resurrection plant? (a) Polypodium (b) Selaginella lepiodophylla (c) Both (a) and (b) (d) None of these 24. The presence of salt glands on leaf surface is the characteristic of: (a) Atriplex spongiosa (b) Tamarix pentandra (c) Suaeda fruticosa (d) None of the above 25. ...... is more sensitive to water stress than the rate of ...... : (a) Leaf expansion, respiration (b) Leaf expansion, photosynthesis (c) Photosynthesis, leaf expansion (d) None of the above 26. The halophytes which can resist a wide range of salt concentrations are called: (a) Stenohaline (b) Euryhaline (c) Both (a) and (b) (d) None of these 27. Which of the following is considered to be the indicator of heavy metal stress? (a) Phytochelatins accumulation in nucleus (b) Phytochelatins accumulation in vacuole (c) Phytochelatins accumulation in chloroplast (d) None of the above 28. The most abundant thiol (–SH) compound in the plants is: (a) Glutamate (b) Glycophytes (c) Glutathione (d) None of these 29. Which of the following heavy metal forms complexes with histidine in Alyssum lesbiacun? (a) Pb (b) Ni (c) Cd (d) None of these 20. (d)

21. (c)

22. (b)

23. (c)

24. (a)

25. (b)

Stress Physiology

30. Astragalus ans Stanleya pinnata are hyperaccumulator plants of heavy metal: (a) Chromium (b) Cadmium (c) Selenium (d) More than one 31. Viola calaminaria is a hyperaccumulator plant of heavy metal: (a) Lead (b) Chromium (c) Zinc (d) More than one 32. Thlaspi goesingenase is a hyperaccumulator plant of heavy metal: (a) Nickel (b) Chromium (c) Cadmium (d) More than one 33. Heavy metal accumulator plant absorbs heavy metals and accumulates them into their: (a) Chloroplast (b) Mitochondria (c) Nucleus (d) None of these 34. Medicarpin, glyceolin, rishitin and capsidiol are the examples of: (a) Pathogen related proteins (b) Phytoalexins (c) PCD (d) None of these 35. Jasmonate is synthesized in plant from ...... . (a) Diphosphatidylglycerol (b) Linolenic acid (c) Both (a) and (b) (d) None of these 36. Jasmonate is a ...... carbon unsaturated fatty acid: (a) 20 (b) 17 (c) 15 (d) 12 37. Which one of the following is the initial response of mesophyte plants to water stress? (a) Decreased cellular growth and leaf area (b) Declining of respiration (c) Declining of photosynthesis (d) Beginning of leaf stimulation Ans.

30. (d) 41. (b)

31. (d) 42. (a)

32. (a) 43. (b)

33. (d) 44. (b)

34. (b) 45. (c)

441

38. In which of the followings, heat-shock proteins were first discovered? (a) Bacillus thruingensis (b) Arabidopsis (c) Drosophila (d) None of these 39. Biotic stress in plant is caused by: (a) Blue bull (b) Bacteria and fungi (c) Insects (d) All of these 40. Among the following, creosote bush is a: (a) Drought tolerant plant (b) Cold tolerant plant (c) Salt tolerant plant (d) None of the above 41. Among the following, which of the following substance acts as a volatile airborne SAR inducing signal? (a) Salicylic acid (b) Methyl salicylate (c) Jasmonate (d) None of these 42. There is a accumulation of phytochelatins in vacuoles of plant cells and it is the indication of: (a) Heavy metal stress (b) Drought stress (c) Heat stress (d) None of these 43. The originator of elicitor molecules are: (a) Cell walls of pathogen (b) Plasmamembrane of plant cell (c) Phytoalexins (d) All of the above 44. The transportation of systemin occurs through: (a) Phloem (b) Xylem (c) Both (a) and (b) (d) None of these 45. It is believed that on being wounded by insect or other herbivore, the host plant produces a short polypeptide (of 18 amino acids) called: (a) Proline (b) Leucine (c) Systemin (d) None of these 35. (b)

36. (d)

37. (a)

38. (c)

39. (d)

40. (a)

442

Plant Physiology: Question Bank

moves from the equator until it reaches sea level some distance above the Arctic Circle. This phenomenon is known as: (a) Larcher’s law (b) Humboldt’s law (c) Both (a) and (b) (d) None of these

46. Sugerbeet and date palms are ...... . (a) Moderately salt tolerant (b) Highly salt tolerant (c) Sensitive to salt (d) None of the above 47. Cotton and barley are ...... . (a) Moderately salt tolerant (b) Highly salt tolerant (c) Sensitive to salt (d) None of the above 48. Among the crop plants, maize, peas, beans, onion, citrus, lettuce, etc. are ...... . (a) Moderately salt tolerant (b) Highly salt tolerant (c) Sensitive (d) None of the above 49. The halophytes which can resist a narrow range of salt concentrations are called: (a) Sentnohaline (b) Euryhaline (c) Both (a) and (b) (d) None of these 50. Several higher plants are able to grow and even flower under the snow, where the temperature is close to 0°C or sometimes below. Such plants are known as: (a) Spring ephemerals (b) Geophytes (c) Both (a) and (b) (d) None of these 51. The halophytes which can resist wide range of salt concentrations are called as: (a) Sentnohaline (b) Euryhaline (c) Both (a) and (b) (d) None of these 52. The ability of a single plant to produce morphologically and physiologically different seed is known as: (a) Monoblasty (b) Heteroblasty (c) Both (a) and (b) (d) None of these 53. The upper tree limit (tree line) occurs at the lower elevations when one Ans.

46. (c) 57. (d)

47. (a) 58. (b)

48. (c) 59. (b)

49. (a)

50. (c)

54. The process whereby adjustments are made to the structure and function of the photosynthetic apparatus in response to changes in growth irradiance is called: (a) Thermal denaturation (b) Transition temperature (c) Photoacclimation (d) More than one 55. Plants grown in the shade of a canopy are frequently subjected to sudden transient fluctuations influence rate, known as: (a) Absorption cross-section (b) Sunflecks (c) Time-nested response (d) All of the above 56. The ...... leaf generally thinner than the ...... leaf. (a) C3, C4 (b) C4, C3(c) Both (a) and (b) (d) None of these 57. High growth rates are supported by at least three factors: (a) High stomatal conductance (b) High photosynthetic rates (c) A high shoot-ratio (d) All of the above 58. In sun plant, the ratio of chlorophyll a to chlorophyll b is: (a) 7–7.5 (b) 3–3.6 (c) 5–5.5 (d) None of these 59. In shade adapted plant species exhibit ...... ratio chlorophyll a to chlorophyll b is. (a) 7–7.5 (b) 2–2.5 (c) 5–5.5 (d) None of these 51. (b)

52. (b)

53. (b)

54. (c)

55. (b)

56. (b)

Stress Physiology

60. Shade adapted plant species exhibit ...... ratio of chlorophyll a to chlorophyll b. (a) Higher (b) Lower (c) No (d) None of these 61. Leaves of ...... plants exhibit higher chlorophyll contents than those of ...... plants. (a) Sun, shade (b) Shade, sun (c) Both (a) and (b) (d) None of these 62. ...... are adapted to survive extreme shade conditions and not exhibit minimal capacity to acclimate to highlight conditions. (a) Obligate shade plants (b) Facultative shade plants (c) Both (a) and (b) (d) None of these 63. Adaption is the consequence of: (a) Complement of gene found in the genome (b) Natural selection (c) Both (a) and (b) (d) None of these 64. ...... refers to heritable modifications in the structure and function that increases the fitness of the organism in a stressful environment. (a) Acclimation (b) Adaption (c) Both (a) and (b) (d) None of these 65. The photoreduction of oxygen by PSP is called the ...... and results in the production of another toxic reactive oxygen species known as a superoxide radical. (a) Asada–Halliwell pathway (b) Mehler reaction (c) Both (a) and (b) (d) None of these 66. ...... is an eight KDa Protein involved in targeting other proteins for proteolytic degradation. (a) HSP 110 (b) HSP 90 (c) Ubiquitin (d) None of these 67. In Pisum sativum, the ratio of unsaturated/saturated fatty acids of membrane lipids of mitochondria Ans.

60. (b) 71. (b)

61. (b) 72. (c)

62. (a)

63. (c)

64. (b)

443

isolated from chilling-sensitive and chilling-resistant tissues are? (a) 3.8 (shoot) (b) 2.1 (shoot) (c) 1.7 (shoot) (d) 2.8 (shoot) 68. In Zea maize the ratio of unsaturated/ saturated fatty acids of membrane lipids of mitochondria isolated from chilling-sensitive and chilling-resistant tissues are? (a) 3.8 (shoot) (b) 2.1 (shoot) (c) 1.7 (shoot) (d) 2.8 (shoot) 69. In Ipomoea batatas (sweet potato), the ratio of unsaturated/saturated fatty acids of membrane lipids of mitochondria isolated from chilling-sensitive and chilling-resistant tissues are? (a) 2.8 (tuber) (b) 2.1 (tuber) (c) 1.7 (tuber) (d) 2.8 (tuber) 70. In Phaseolous vulgaris (bean), the ratio of unsaturated/saturated fatty acids of membrane lipids of mitochondria isolated from chilling-sensitive and chilling-resistant tissues are? (a) 2.8 (shoot) (b) 2.1 (shoot) (c) 1.7 (shoot) (d) 2.8 (shoot) 71. One of the immediate plant responses to a chilling stress in the light dependent inhibition of photosynthesis. Because low temperature inhibits the D 1 repair cycle, this leads to chronic photoinhibition of ...... and ...... in cucumber. (a) PS I, PS II (b) PS II, PS I (c) Both (a) and (b) (d) None of these 72. If the samples are exposed to a light intensity sufficiently strong to initiate photosynthesis, a fluorescence signal characterized by complex transient can be detected. This is called the ...... effect. (a) PAM effect (b) Photon counter (c) Kautsky effect (d) None of these 65. (b)

66. (c)

67. (a)

68. (b)

69. (c)

70. (a)

444

Plant Physiology: Question Bank

73. Both photochemical quenching and nonphotochemical quenching capacity can be estimated in vitro using: (a) Kautsky effects (b) P u l s e – a m p l i t u d e – m o d u l a t e d chlorophyll fluorescence chlorophyll fluorescence (PAM) (c) Both (a) and (b) (d) None of these 74. ...... reflects the capacity to dissipate excess absorbed energy as heat. (a) Nonphotochemical quenching (b) Photochemical quenching (c) Both (a) and (b) (d) None of these 75. ...... measured as qP, reflects the capacity to utilize excess absorbed energy through metabolism and growth. (a) Nonphotochemical quenching (b) Photochemical quenching (c) Both (a) and (b) (d) None of these 76. Example of water collectors (succulents, have CAM photosynthesis, shallow root system, salt secretion, dew absorption are: (a) Mosses (b) Lichens (c) Cacti (d) None of these 77. Example of water spenders (deep tap roots) are: (a) Palms (b) Alfalfa (c) Mesquite (d) More than one 78. Example of drought escapers are: (a) Palms (b) Alfalfa (c) Mesquite (d) Desert annuals 79. Thawing means ...... : (a) Solidifying (b) Liquefying (c) Both (a) and (b) (d) None of these 80. The beginning of ice crystal formation is called: (a) Water nucleation (b) Ice nucleation (c) Both (a) and (b) (d) None of these 81. The cell membrane of chill-sensitive species has ...... proportion of saturated Ans.

73. (b) 84. (b)

74. (a) 85. (c)

75. (b) 86. (b)

76. (c)

77. (d)

fatty acid while those of chill-resistant species has ...... proportion of unsaturated fatty acids in their lipid bilayers. (a) Higher, lower (b) Lower, higher (c) Higher, higher (d) None of these 82. Among ornamental, coleus, Croton, Passiflora, Diffenbachia are the examples of chill ...... plants. (a) Sensitive (b) Free (c) Tolerant (d) None of these 83. Arabidopsis is chill ...... plant. (a) Sensitive (b) Free (c) Tolerant (d) None of these 84. Among the vascular plants, the highest known temperature tolerance is found among ...... and ...... which can withstand temperature of 60°C or more. (a) Coleus, croton (b) Agaves, cacti (c) Both (a) and (b) (d) None of these 85. The study of functioning of plant under adverse environmental conditions is called: (a) Environmental physiology (b) Ecological physiology (c) Stress physiology (d) None of the above 86. According to ...... we should speak of a state of stress. When the stress factor is first experienced, there is the alarm reaction, in which the function of interest deviates markedly from the norm. Then comes the resistance stage (or restitution phase), in which the organism adapts to the stress factor and the function often returns toward its normal state factor increasing or continues for a long-time, the stage of exhaustion may be reached, in which the function may again strongly deviate from the norm; this can eventually leads to death. (a) Levitt (b) Larcher (c) Both (a) and (b) (d) None of these 78. (d)

79. (b)

80. (b)

81. (c)

82. (a)

83. (c)

Stress Physiology

87. According to ...... stress was a syndrome of reactions within an organism in response to one or more stress factors and any environmental factors could act as an agent of stress when it deviated from its optimum level for the organism. (a) Hans Selye (b) Levitt (c) Both (a) and (b) (d) None of these 88. According to ...... biological stress is any change in environmental conditions that might reduce or adversely change a plant’s growth or development (its biological function). (a) Hans Selye (b) Levitt (c) Both (a) and (b) (d) None 89. Which of the following is not an abiotic stress? (a) Temperature (b) Light (c) Cutting of herbs for fuel (d) Air pollutants 90. In low light intensity: (a) Sciophytes develop (b) Heliophytes develop (c) Halophytes develop (d) Alien species develop 91. Ammonia poisoning occurs in temperature sensitive plants at: (a) Low temperature (b) High temperature (c) Moderate temperature (d) Low light intensity 92. A tourist from Bihar visited Shimla and carried apple plantlet with him. He planted them in Patna. The plants failed to grow and yield improperly be due to: (a) Salt stress (b) Temperature stress (c) Biotic stress (d) Water stress 93. Heat-shock protein is formed at: (a) 42°C (b) 15°C (c) 30°C (d) 0°C Ans.

87. (b) 98. (d)

88. (b) 89. (c) 99. (a) 100. (a)

90. (a)

91. (b)

445

94. Which of the following is more resistant to high temperature stress? (a) Low hydrated tissues (c) High hydrated tissues (b) Moderate hydrated tissues (d) Very high hydrated tissues 95. High temperature resistant plants can be characterized by having high level of: (a) Bound water (b) Protoplasmic viscosity (c) Photosynthetic rate (d) All of the above 96. Cold acclimation proteins (CAPs) are formed in: (a) Cold sensitive plants (b) Cold resistant plants (c) Cold enduring plants (d) High temperature stress plants 97. Banana get destroyed when kept in fridge because of: (a) Chilling stress (b) Freon gas pollution stress (c) Osmotic stress (d) Water stress 98. Chilling sensitive plants below 10°C show: (a) Decreased root growth (b) Increase in ion leakage (c) Increase in CO 2 and ethylene production (d) All of the above 99. Which of the following withstands high manganese concentration stress: (a) Helianthus annus (b) Snow butter cup (c) Sequoea gigantea (d) Opuntia dilleli 100. Phytochelatin, a protein is found in roots of: (a) Plants growing in metal polluted water (b) Plants growing in nonmetal polluted water 92. (b)

93. (a)

94. (a)

95. (d)

96. (b)

97. (a)

446

Plant Physiology: Question Bank

(c) Plants growing in saline water (d) Plants growing in icy water 101. Which of the following get accumulated during salt stress in plants: (a) Auxins (b) Gibberellins (c) Abscisic acid (d) Ascorbic acid 102. Osmotic stress tolerant plants have high accumulation of: (a) Proline (b) Methionine (c) Heat-shock protein (d) All of the above 103. Nodulation in leguminous plants is inhibited by: (a) Osmotic stress (b) Water stress (c) Light stress (d) Air pollution stress 104. Potassium stressed barley plants have accumulation of: (a) Polyamines (b) Auxins (c) ABA (d) None of these 105. Match column A with column B. Column A contains plant responses while column B contains type of stresses: `

Column A (i) Accumulation of betanine (ii) ADH (iii) Photoinhibition (iv) Chitinase (v) Proteinase inhibitor

Column B (a) Flooding (b) Water stress or light stress (c) Wounding (d) Infection by fungi (e) Osmotic stress

(a) (i)-E, (ii)-A, (iii)-B, (iv)-D, (v)-C (b) (i)-C, (ii)-A, (iii)-B, (iv)-D, (v)-E (c) (i)-D, (ii)-B, (iii)-A, (iv)-E, (v)-C (d) (i)-E, (ii)-D, (iii)-B, (iv)-A, (v)-C 106. The study of functions of plant under adverse environmental conditions is called: (a) Stress physiology (b) Environmental physiology (c) Ecological physiology (d) None of the above

107. Reduced or changed function of the plant in response to stress is called: (a) Physical strain (b) Chemical strain (c) Biological strain (d) All of the above 108. Which of the following are reversible? (a) Plastic biological strains (b) Elastic biological strains (c) Both (a) and (b) (d) None of the above 109. During acclimation, tolerance of a plant against a particular stress is: (a) Decreased (d) Increased (c) Not affected (b) All of the above 110. Drought resistance in plants is related to: (a) Negative water potentials (b) Positive water potential (c) Surplus water (d) None of the above 111. Which of the following are more prone to water stress? (a) Xerophytes (b) Mesophytes (c) Both xerophytes and mesophytes (d) Hydrophytes 112. Creosote bush is a: (a) Drought tolerant plant (b) Salt tolerance (c) Cold resistant plant (d) None of the above 113. Which of the following is commonly known as resurrection plant? (a) Creosote bush (b) Sagebrush (c) Selaginellalepidophylla (d) All of the above 114. Which of the following are concerned in desiccation avoidance or postponment in xerophytes? (a) Drought escapers and water spenders (b) Water collectors and water

Ans. 101. (c) 102. (a) 103. (b) 104. (a) 105. (a) 106. (a) 107. (c) 108. (b) 109. (b) 110. (a) 111. (d) 112. (a) 113. (c)

Stress Physiology

(c) Osmotic adjustment (d) All of the above 115. In mesophytes, earliest response of plants to water stress is: (a) Decreased cellular growth and leaf area (b) Stimulation of leaf abscission (c) Decreased photosynthesis (d) Decreased respiration 116. Concentration of which of the following hormone is increased in water stressed plants that results in stomatal closure? (a) ABA (b) IAA (c) Gibberellin (d) All of the above 117. Which of the following organic compound contributes to osmotic adjustment in increasing resistance of plants to water stress? (a) Glycine betaine (b) Proline (c) Sorbitol (d) All of the above 118. In cells of water stressed plant, the compatible solutes: (a) Lower the water potential of cells (b) Lower the osmotic potential of cells (c) Do not interfere with enzymes functions (d) All of the above 119. Which of the following amino acid chiefly accumulated in cell of water stressed plant? (a) Glycine (b) Proline (c) Leucine (d) None of these 120. Saline soils are: (a) Beneficial to growth of crop plants (b) Determental to growth of crop plants (c) Not of much concern in agriculture (d) None of the above 121. High concentration of salts in the soil is due to: (a) Situation of land near sea-shores and estuaries

447

(b) Sepage of salts from geological marine deposits to adjacent inland areas (c) Acumulation of salts in soil from irrigation water (d) All of the above 122. Which of the following ions chiefly contribute to soil salinity? (a) NaCl and HCO (b) Mgi and SO (c) Mg and SO4 (d) All of the above 123. The halophytes which can resist a wide range of salt concentrations are called: (a) Glycophytes (b) Stenohaline (c) Euryhaline (d) None of the above 124. External symptoms of salt injury to plants are: (a) Leaf edge burns (b) Necrotic spot on leaves (c) Chlorophyll bleach (d) All of the above 125. Which of the following methods are adopted by plants to cope with salt stress? (a) Avoiding salinity (b) Evading salinity (c) Tolerate salinity (d) All of the above 126. Which of the following is not a halophyte? (a) Suaedafruticosa (b) Atriplexspongiosa (c) Tamarixpentandra (d) None of the above 127. Presence of salt glands on leaf surfaces is characteristic of: (a) Atriplexspongiosa (b) Suaedafruticosa (c) Tamarixpentandra (d) all of the above

Ans. 114. (d) 115. (a) 116. (a) 117. (d) 118. (d) 119. (b) 120. (b) 121. (d) 122. (d) 123. (c) 124. (d) 125. (d) 126. (d) 127. (a)

448

Plant Physiology: Question Bank

128. Which of the following crop plants are high salt tolerant? (a) Maize and beans (b) Sugarbeet and datepalm (c) Cotton and barley (d) All of the above 129. External symptoms of chilling injury to plants are: (a) Reduced growth (b) Chlorosis and lesions on leaves (c) Appearance of foliage as if soaked in water for long (d) All of the above 130. Which of the following are more susceptible to chilling injury? (a) Tropical plants (b) Subtropical (c) Both (a) and (b) (d) Temperate zone 131. Chilling injury in plants results due to: (a) Low temperature well above their freezing point (b) Low temperature at freezing point (c) Low temperature below the freezing point (d) All of the above 132. Which of the following is a chilltolerant plant? (a) Dieffenbachia (b) Croton (c) Sysdopiqoay (d) None of the above 133. Lipid bilayers of cell membranes in chill-resistant species have: (a) Higher proportion of saturated fatty acids (b) Higher proportion of unsaturated fatty acids (c) Equal proportion of saturated and unsaturated fatty acids (d) Only saturated fatty acids 134. In freezing injury to plants, ice nucleation means: (a) Formation of ice under the influence of nucleus

(b) Formation of ice in nucleus (c) Formation of ice crystals around large polysaccharides and proteins in cell wall (d) None of the above 135. In freezing or frost injury to plants, ice formation begins: (a) Exactly at freezing point (b) At several degrees below its freezing point (c) At slightly above the freezing point (d) All of the above 136. Which of the following are most susceptible to frost injury? (a) Tropical plants (b) Subtropical (c) Temperate zone plants (d) All of the above 137. Which of the following hormones is involved in drought and frost resistance of plant (a) ABA (b) IAA (c) Ethylene (d) None of the above 138. Which of the following is lethal to plant tissues? (a) Formation of ice in intercellular spaces (b) Formation of ice in xylem vessels (c) Formation of ice intracellulary (d) None of the above 139. Which of the following does not have cryoprotective function in plant tissues: (a) Antifreeze proteins (b) Sugar such as sucrose (c) Saturated fatty acid (d) None of the above 140. Heat-shock proteins were first discovered in: (a) Drosophila melanogaster (b) Arabidopsis (c) Cacti (d) None of the above

Ans. 128. (b) 129. (d) 130. (c) 131. (a) 132. (d) 133. (b) 134. (c) 135. (b) 136. (c) 137. (a) 138. (c) 139. (c) 140. (a)

Stress Physiology

141. Which of the following is most susceptible to heat-stress? (a) RuBisCo (b) Photosystem (c) Respiration (d) None of the above 142. Relatively higher proportion of saturated fatty acids in membrane lipida is characteristic: (a) High temperature sensitive plants (b) High temperature tolerant crop (c) C3 plant (d) All of the above 143. Which of the following are heavymetals? (a) Lead and cadmium (b) Mercury and chromium (c) Nickel, zinc and copper (d) All of the above 144. Heavy-metal toxicity in plants causes: (a) Increased lipid peroxidation in membrane (b) DNA damage (c) Oxidation of sulfhydryl groups of proteins (d) All of the above 145. Accumulation of phytochelatins in plant cell vacuoles is indicative of (a) Salt stress (b) Heavy-metal stress (c) Heat stress (d) All of the above 146. Which of the following hormones plays dual role of a plant growth regulator and an important signalling agent in plant defense responses? (a) Ethylene (b) Brassinosteroids (c) Jasmonic acid (d) Cytokinins 147. Jasmonate is biosynthesized from linalenic acid that is completed in: (a) Chloroplast and peroxisome (b) Chloroplast and mitochondrion (c) Chloroplast and mitochondrial (d) All of the above

449

148. Which of the following compounds is an 18-C unsaturated fatty acid with three double? (a) Jasmonate (b) Linolenic acid (c) Oleic acid (d) None of the above 149. Which of the following are antidigestive proteins? (a) -amylase inhibitors (b) Lectins (c) Proteolytic inhibitors (d) All of the above 150. Jasmonates are known to strongly promote: (a) Abscission of leaf (b) Senescence of leaves (c) Apical dominance (d) None of the above 151. Biotic stress in plants is caused by: (a) Herbivore insects (b) Fungal and bacterial infection (c) Plant nematodes (d) All of the above 152. Which of the following is not a part of the hypersensitive response in plants (a) Biosynthesis of phytoalexins (b) Formation of PR proteins (c) PCD (d) None of the above 153. Hypersensitive response in plant is preceded by? (a) Oxidative burst (b) Accumulated of NO (c) Both (a) and (b) (d) None of the above 154. AVR genes are carried by: (a) Host plant (b) Pathogens (c) Both (a) and (b) (d) None of the above 155. Elicators originate usually: (a) Cell wall of pathogen (b) Phytoalexin (c) Plasma membrane (d) None of the above

Ans. 141. (b) 142. (b) 143. (d) 144. (d) 145. (b) 146. (c) 147. (a) 148. (b) 149. (d) 150. (b) 151. (d) 152. (d) 153. (c) 154. (b) 155. (a)

450

Plant Physiology: Question Bank

156. The receptors protein encoded by R genes are located on: (a) Plasma membrane (b) ER (c) Golgi body (d) Nuclear weapons envelope 157. Which of the following substance act as a volatiles airborne SAR inducing signals? (a) Salicylic acid (b) Methyl salicylate (c) Jasmonate (d) All of the above 158. During drought situations water use efficiency ...... (a) Increase (b) Decrease (c) No changes (d) First increase than decrease 159. Pigment molecules synthesized more during high light is ...... (a) Violaxanthin (b) Zeaxanthin (c) Antheraxanthin (d) All of the above 160. Instantaneous measurement of WUE done by ...... (a) Infrared gas analyzer (b) Isotopic ratio mass spectrophotometer (c) Pressure bomb (d) Spectrophotometer 161. Increased heavy-metal concentration in the environment is mainly: (a) Natural (b) Anthropogenic (c) Due to activities of microorganisms (d) None of the above 162. Resurrection plants lose chlorophyll during drying condition are referred as ...... (a) Poikilochlorophyllous (b) Homoiochlorophyllous (c) Matachlorophyllous (d) Prochlorophyllous 163. Strategy adopted by plant to mitigate flooding stress are ...... (a) Low oxygen escape syndrome

(b) Quiescence strategy (c) Shorten diffusion pathway (d) All of the above 164. A waterlogged soil is physiologically dry because of ...... (a) Anaerobic condition (b) Acrobic condition (c) Inability of water (d) Less mineral content 165. At freezing soil temperature the rate of water absorption ...... (a) Increase (b) Decrease (c) Remain same (d) None 166. Soil salinity is measured by ...... (a) Porometer (b) Calorimeter (c) Conductivity meter (d) Spectrophotometer 167. Stress term proposed by: (a) Arnon (b) RD Sharma (c) Levitt (d) Stephan hales 168. Most sensitive enzyme during drought stress is: (a) PEPC (b) Pyruvate arthophosphate dikinase (c) RuBisCo (d) F-1,6-bis phosphate 169. Drought escapers plants manage drought situations by: (a) Reducing transpiration (b) Shortened life cycle (c) Maintaining water potential (d) Accumulation of osmosis 170. Xeromorphic plants have: (a) Small leaves (b) Gridling of phloem (c) Leaf pubescence (d) All of the above 171. Enzyme alleviate under oxidative stress are: (a) Carotenoids (b) Reduced glutathione (c) Tocopherol (d) All of the above

Ans. 156. (a) 157. (b) 158. (a) 159. (d) 160. (c) 161. (b) 162. (b) 163. (d) 164. (a) 165. (b) 166. (c) 167. (b) 168. (c) 169. (c) 170. (d) 171. (b)

Stress Physiology

172. Drought thizogenic is an adaptive strates in drought present in: (a) Gramincae (b) Maldacena (c) Brassicaceac (d) All of the above 173. Major compatible solutes during drought stress are: (a) Proline (b) Glycine betaine (c) Trehalose (d) All of the above 174. Nonenzyme alleviate under oxidative stress are: (a) Carotenoids (b) Ascorbic acid (c) Tocopherol (d) All of the above 175. Photo-oxidation of chlorophyll is presented by: (a) Carotenoid (b) Phycobilin (c) Anthocyanin (d) All of the above 176. Which of the following are stress proteins? (a) HSP (b) Dehydrins (c) LEA (d) All of the above 177. Primary and natural source of salinization is: (a) Weathering of present rock (b) Human interference (c) Agricultural (d) Deforestation 178. Salinity value is measured in: (a) Ppm (b) Ppb (c) Ppt (d) Mole 179. Example of highly salinity tolerant plant which can tolerate CL-level up to 400 mM? (a) Saudea maritime (b) Salt brush (c) Both (a) and (b) (d) Sugar beet 180. Example of highly salt sensitive plants is: (a) Tomato (b) Cotton (c) Soybean (d) Citrus 181. Pneumatophore is adaptation for salt stress found in, which type of vegetation (a) Mangrove (b) Aquatic plant

451

(c) Tumdra vegetation (d) Alpine vegetation 182. Vivipary is adaptation for salt stress present in: (a) Grass species (b) Tundra vegetation (c) Alpine vegetation (d) Rhizophore 183. Screaming method used for salinity stress tolerance are: (a) Infrared thermography (b) Hydroponics (c) Sand culture (d) All of the above 184. Which one of the wheat species more tolerant to salinity? (a) Emmer wheat (b) Mexican dwarf wheat (c) Tread wheat (d) Marconi wheat 185. Threshold value of salinity stress for most plant species is: (a) 20 mM NaCl (b) 40 mM NaCl (c) 60 mM NaCl (d) 80 mM NaCl 186. Mechanisms adapted by plant to tolerate salinity are ...... (a) Exclution (b) Extrusion (c) Compartmentalization (d) All of the above 187. Transporters involved in salinity tolerance are ...... (a) HKT/SOSI (b) NHX/AVP (c) SOS3/SnRK (d) All of the above 188. Which of the following is increased during cold stress ...... (a) Saturation of lipid (b) Unsaturation of lipid (c) Both (a) and (b) (d) No change 189. Cold tolerance plant has (a) Lower transition (b) Higher transitional temperature (c) No changes in transition temperature (d) Both (b) and (c)

Ans. 172. (c) 173. (d) 174. (d) 175. (a) 176. (d) 177. (a) 178. (d) 179. (c) 180. (d) 181. (a) 182. (b) 183. (d) 184. (a) 185. (d) 186. (d) 187. (d) 188. (a) 189. (b)

452

Plant Physiology: Question Bank

190. Ways to improve chilling tolerance in plant are ...... (a) Low temperature hardening (b) Thermal conditioning (c) Intermediate warming (d) All of the above 191. Aerenchyma provides adaptation of plant in flooding stress by ...... (a) High resistance for internal gas diffusion (b) Low resistance for internal gas diffusion (c) Both (a) and (b) (d) No resistance for internal gas diffusion 192. Lysigenous aerenchyma formed by: (a) Cell division (b) Cell enlargement (c) Separation of connected cell (d) Cell death 193. Schzogenous aerenchyma formed by: (a) Cell division (b) Cell enlargement (c) Separation of connected cell (d) Cell death 194. Most noticecable, effect of high temperature on reproductive processes in tomato is the: (a) Exerted style (b) Shoot reduction (c) Leaf scorching (d) Reduction of biomass 195. Function of HSP are: (a) Chaperon (b) Shuttling protein (c) Protein translocation (d) All of the above 196. Floral movements in members of Liliaceae such as Tulip and Crous are the best examples of: (a) Slightly effects of photoperiods (b) Effects of temperature differentials (c) Both (a) and (b) (d) None of the above

197. Tidestromia oblongifolia, is a deciduous ...... perennial native to death valley. (b) C3 (a) C2 (c) C4 (d) None of these 198. ...... has studied the distribution of C3 and C 4 grasses along an elevation gradient in Hawaii: (a) M Black (b) PW Rundel (c) Bothe (a) and (b) (d) None of these 199. The adiabatic lapse rate for dry air is constant about: (a) 1°C/1 m elevation (b) 1°C/10 m elevation (c) 1°C/1000 m elevation (d) 1°C/100 m elevation 200. The decrease in temperature with elevation is called: (a) Isothermal lapse (b) Adiabatic lapse (c) Both (a) and (b) (d) None of these 201. The effects of temperature on physiology and metabolism in turn influence plant distribution, it is called: (a) Biodistribution (b) Biometry (c) Biogeography (d) None of these 202. A cocklebur contains two seeds: an upper ...... and a lower ...... seed: (a) Nondormant, dormant (b) Dormant, non-dormant (c) Both (a) and (b) (d) None of these 203. Many seeds have pores that are blocked with plug called the ......, which must be mechanically disloged before water and oxygen can enter: (a) Scarification plug (b) Hilum (c) Strophiolar plug (d) None of these 204. In poplar species, ...... gene has been implicated in bud dormancy.

Ans. 190. (d) 191. (a) 192. (d) 193. (c) 194. (d) 195. (d) 196. (c) 197. (c) 198. (b) 199. (d) 200. (b) 201. (c) 202. (b) 203. (c)

Stress Physiology

(a) PtLCF (c) PtFCL

(b) PtFLC (d) All of these

205. Temperature near or just above freezing appear to be ...... effective at breaking dormancy: (a) Less (b) Not (c) More (d) All of these 206. The onset of dormancy in buds is a typical ...... response: (a) Day natural (b) Long-day (c) Short-day (d) None of the above 207. Bud dormancy is an example of: (a) Endodormancy (b) Paradormancy (c) Ecodormancy (d) All of the above 208. In which dormancy, the dormancy is an inherent property of the dormant structure itself: (a) Endodormancy (b) Paradormancy (c) Ecodormancy (d) All of the above 209. In which dormancy, the growth is imposed by limitations in environment: (a) Endodormancy (b) Paradormancy (c) Ecodormancy (d) All of the above 210. In which dormancy, the inhibition of growth arises from another part of the plant (e.g. apical dominance)? (a) Endodormancy (b) Paradormancy (c) Ecodormancy (d) All of the above

453

211. The leaf development in grasses is probably influenced more by: (a) Air temperature (b) Soil temperature (c) Both (a) and (b) (d) None of the above 212. Both air and soil temperatures have an impact on plant growth. This statement is: (a) Not sure (b) True (c) False (d) None of these 213. Those plants that grow optimally at the lower temperatures (between 0°C and 10°C) are called: (a) Mesophiles (b) Psychrophiles (c) Both (a) and (b) (d) None of these 214. Green plants probably first evolved involved in the ...... region, not so much because of warmer temperatures, but because the temperatures there were relatively stable: (a) Temperate (b) Tropical (c) Both (a) and (b) (d) None of these 215. Plants are the machine of chemical metabolism, and one universal characteristic of chemical metabolism machines chemical metabolism, and one universal characteristic the temperatures there were relatively stabis their sensitivity to ...... (a) Light (b) Water (c) Temperature (d) All of the above

Ans. 204. (c) 205. (c) 206. (c) 207. (a) 208. (c) 209. (b) 210. (b) 211. (b) 212. (b) 213. (b) 214. (b) 215. (d)

454

Plant Physiology: Question Bank

28

System Physiology: Plant 1. Consider the following: 1. Plastoquinone 2. Plastocyanin 3. Cytochrom f 4. Cytochrom b6 What is the correct sequence of these in the photo-induced electron carriers between PS I and PS II in photosynthesis? (a) 2, 3, 4, 1 (b) 1, 2, 3, 4 (c) 3, 4 1, 2 (d) 4, 1, 2, 3 2. Consider the following processes: 1. O2 evolution 2. CO2 fixation 3. NADPH formation 4. Chlorophyll biosynthesis Which of these do not occur in thylakoids? (a) 2 and 4 (b) 3 and 4 (c) 2 and 3 (d) 1 and 2 3. Consider the following fatty acids: 1. Linolenic acid 2. Oleic acid 3. Palmitic acid 4. Stearic acid Which of these is/are unsaturated fatty acids? (a) 2, 3 and 4 (b) 2 and 3 (c) 1 and 2 (d) 1 only 4. Consider the following compounds: 1. Phosphoenol pyruvate 2. Malic acid 3. Pyruvic acid 4. Oxaloacetic acid Ans.

1. (c)

2. (c)

3. (c)

4. (a)

5. (a)

What is the correct sequence of these intermediate compounds as they form in C 4 – dicarboxylic acid pathway following the PEP–carboxylation reaction? (a) 4, 2, 3, 1 (b) 4, 1, 2, 3 (c) 2, 4, 3, 1 (d) 1, 2, 3, 4 5. Consider the following families: 1. Amaranthaceae 2. Cyperaceae 3. Euphorbiaceae 4. Nyctaginaceae Which of these families have plants with C4 metabolism of photosynthesis? (a) 1, 2, 3 and 4 (b) 2, 3 and 4 (c) 1, 2 and 4 (d) 1 and 3 6. The following enzymes participate in the initial CO2 fixation through Calvin cycle: 1. RuBisCO 2. Triose phosphate dehydrogenase 3. Phosphoglyceric kinase The correct sequence in which these enzymes participate in CO2 fixation is: (a) 3, 2, 1 (b) 1, 2, 3 (c) 2, 3, 1 (d) 1, 2, 3 7. Consider the following statements: 1. Acetaldehyde is an electron acceptor during respiration 6. (d) 454

System Physiology: Plant

1. Cytokinins make dormant buds active 2. The richest concentration of cytokinins generally occurs in endosperm 3. Ethylene involved in the formation of aerenchyma in submerged roots and stems 4. Gibberellins are involved in the break of seed dormancy Which of these statements are correct? (a) 1, 2 and 3 (b) 1 and 4 (c) 2, 3 and 4 (d) 1, 2, 3 and 4

2. In citric acid cycle, pyruvate is transported from cytosol to mitochondrial matrix 3. The pentose phosphate pathway occurs in cytosol Which of these statements are correct? (a) 1 and 3 (b) 2 and 3 (c) 1 and 2 (d) 1, 2 and 3 8. Consider the following events: 1. Excitation of chlorophyll 2. Light absorption 3. Transfer of electron 4. Synthesis of ATP The correct sequence of these events in photosynthesis is: (a) 1, 2, 3, 4 (b) 2, 1, 3 4 (c) 2, 1, 4, 3 (d) 1, 2, 4, 3 9. Consider the following statements: 1. Copper is present in cytochrome enzyme A 2. Pantothenic acid is the precursor of coenzyme A 3. Thiamine pyrophosphate is the prosthetic group in decarboxylases 4. Zinc is present in RNA and DNA polymerase Which of these statements are correct? (a) 1, 3 and 4 (b) 1, 2, 3, and 4 (c) 2, 3, and 4 (d) 1 and 2 10. Which of the following components are associated with nitrate reductase activity? 1. Reduced pyridine nucleotide 2. Flavin adenine dinucleotide 3. Molybdenum 4. Boron Select the correct answer using the codes given below: Codes: (a) 1, 3 and 4 (b) 2, 3 and 4 (c) 1 and 2 (d) 1, 2 and 3 11. Consider the following statements regarding the plant growth substances: Ans.

7. (b)

8. (c)

9. (b)

10. (d)

11. (b)

455

12. Consider the following statements: In a ripe tomato, as compared to an unripe tomato, the amount of: 1. Vitamins is higher 2. Carbohydrates is less 3. Minerals are less 4. Proteins is higher Of these statements: (a) 1, 2 and 3 are correct (b) 2, 3 and 4 are correct (c) 1, 2 and 4 are correct (d) 1, 3 and 4 are correct 13. Consider the following statements: Photorespiratory carbon oxidation cycle involves the cooperative interaction of: 1. Chloroplast 2. Peroxisome 3. Mitochondria 4. Lysosome Which of the above statements are correct? (a) 2, 3 and 4 (b) 1, 2 and 4 (c) 1, 3 and 4 (d) 1, 2 and 3 14. Consider the following statements about senescence and death: 1. In case of formation of heartwood from sapwood, the xylem parenchyma first embark on the biosynthesis of an assemblage of secondary metabolites and develop tyloses into the adjacent tra12. (c)

13. (d)

456

Plant Physiology: Question Bank

cheary elements; they then export most of their mineral nutrients to younger sapwood zone and finally die 2. In the course of differentiation of xylem element, specific regions of the primary walls are hydrolyzed; the tonoplast then breaks done, followed by degradation of the cytoplasmic membranes and the nucleus in one of the last constituents of the protoplast to die 3. In the senescence of leaves, it is commonly found that the chloroplasts are the last organelles to show clear evidence of death Of these statements: (a) 1, 2 and 3 are correct (b) 1 and 3 are correct (c) 2 and 3 are correct (d) 1 and 2 are correct 15. Consider the following statements: Conversion of N 2 to NH4+ in all the organisms studied thus far requires: 1. ATP 2. NADP 3. Ferredoxin 4. NADPH Of these statements: (a) 1 and 3 are correct (b) 1 and 2 are correct (c) 3 and 4 are correct (d) 2 and 4 are correct 16. Which of the following photosynthetic characteristics are presents in C3 plants but not in C4 plants? 1. CO2 compensation point of 45 ppm 2. Relatively higher rate of photorespiratory CO2 evolution 3. Presence of well-developed bundle sheath 4. Initial involvement of RuBP carboxylase (RuBisCO) in CO2 assimilation Select the correct answer using the codes given below: Ans.

14. (d)

15. (c)

16. (c)

17. (c)

18. (a)

Codes: (a) 2 and 4 (c) 1, 2 and 4

(b) 1, 3 and 4 (d) 1, 2 and 3

17. Consider the following statements about carotenoids: 1. They are secondary metabolic plant products 2. They are tetraterpenoids 3. They are formed from the basic isoprene units Of these statements: (a) 1 and 2 are correct (b) 1 and 3 are correct (c) 2 and 3 are correct (d) 1, 2 and 3 are correct 18. Which of the following enzymes are located in the cytoplasm? 1. Enzymes of glycolysis 2. Enzymes of hexose monophosphate shunt 3. Enzymes of oxidative phosphorylation Select the correct answer using the codes given below: Codes: (a) 1 and 2 (b) 2 and 3 (c) 1 and 3 (d) 1, 2 and 3 19. Consider the following statements: Osmosis is a process of transport of water across a semipermeable membrane 1. Down the water potential gradient 2. Up the water potential gradient 3. Actively 4. Passively Of these statements: (a) 1 and 4 are correct (b) 2 and 4 are correct (c) 2 and 3 are correct (d) 1 and 3 are correct 20. Which of the following statements are correct? 1. Gibberellins can substitute light treatment 19. (a)

System Physiology: Plant

2. Gibberellins can convert biennials into annuals 3. Gibberellins favor flowering in long-day plants 4. Gibberellins induce flowering in short-day plants Select the correct answer using the codes given below: Codes: (a) 1, 2 and 3 (b) 1, 3 and 4 (c) 2 and 4 (d) 1, 2, 3 and 4 21. Consider the following statements regarding growth movements in plants: 1. Growth movements in flowering plants are always induced by external stimuli such as light and gravity 2. Differential growth of cells in different parts of the affected organ is responsible for growth movements 3. Growth movements are very slow and can be absorbed only through time lapse photography Of these statements: (a) 1 and 3 are correct (b) 2 and 3 are correct (c) 1 and 2 are correct (d) 1, 2 and 3 are correct 22. Match the list first with list second and select the correct answer using the codes given below the lists. List I Examples of meristem culture to elimination virus 1. Musa sp. 2. Solanumtuberosum 3. Petunia sp.

List II Virus elimination A. Cucumber mosaic virus B. Potato virus-X C. TMV

(a) 1:B 2:C 3:A (b) 2:B 3:C 2:A (c) 1:C 2:A 3:B (d) 3:A 2:B 1:A 23. Match the list first with list second and select the correct answer using the codes given below the lists.

Ans.

20. (c)

21. (b)

22. (d)

23. (d)

24. (d)

457

List I List II Examples of Traits somaclonal variation in some crops 1. Sugarcane A. Resistance to Helminthosporiumsacchari 2. Potato B. Resistance to phytophthora infestans 3. Tobacco C. Resistance to Pseudomonas sp.

(a) 1:B 2:C 3:A (c) 1:C 2:A 3:B

(b) 2:B 3:C 2:A (d) 1:C 2:A 3:B

24. Match the list first with list second and select the correct answer using the codes given below the lists. List I List II Examples of somaTraits clonal variation in some crops 1. Tomato A. Resistance to Fusarium oxysporum 2. Wheat B. Adhisozyme 3. Rice C. Resistance to xanthomonas oryzae

(a) 1:B 2:C 3:A (c) 1:C 2:A 3:B

(b) 2:B 3:C 2:A (d) 1:C 2:A 3:B

25. Match the list first with list second and select the correct answer using the codes given below the lists. List I List II Somaclonal variaTraits tion induced in morphological traits in some crops 1. Tobacco A. Leaf number, plant height, yield, inflorescence type 2. Potato B. Abnormal leaves, slow growth, large pollens, multiple stem branching 3. Tobacco C. Number of tillers per plant, frequency of fertile seed

(a) 1:B 2:C 3:A (b) 2:B 3:C 2:A (c) 1:C 2:A 3:B

(d) 1:C 2:A 3:B

26. Match the list first with list second and select the correct answer using the codes given below the lists. 25. (d)

458

Plant Physiology: Question Bank

List I List II Somaclonal variaTraits tion having improved traits in some crop plants 1. Wheat A. Tolerance to drought stress 2. Rice B. Lysine content 3. Potato C. Resistance to Fusarium sp.

(a) 1:B 2:C 3:A (c) 1:C 2:A 3:B

(b) 2:B 3:C 2:A (d) 1:C2:A 3:B

27. Match the list first with list second and select the correct answer using the codes given below the lists. List I List II Somaclonal variaTraits tion having improved traits in some crop plants 1. Brassica A. Tolerance to salt stress 2. Sugarcane B. Resistance to eyespot 3. Tobacco C. Herbicide resistance

(a) 1:B 2:C 3:A (c) 1:C 2:A 3:B

(b) 2:B 3:C 2:A (d) None of these

28. Match the list first with list second and select the correct answer using the codes given below the lists. List I List II Examples of in vitro Traits raised stress tolerant plant 1. Medicago sativa A. Salt tolerance cells require salt for plant growth 2. Brassica juncea B. Salt tolerant plant 3. Cicerareitinum C. Salt tolerant callus selected

(a) 1:C 2:A 3:B (c) 1:C 2:A 3:B

(b) 2:B 3:C 2:A (d) None of these

29. Match the list first with list second and select the correct answer using the codes given below the lists. List I List II Example of in vitro Traits raised stress tolerant plant 1. Medicago sativa A. Salt tolerance cells require salt for plant growth Ans.

26. (d)

27. (c)

28. (a)

29. (c)

30. (b)

2. Brassic ajuncea 3. Cicerareitinum

B. Salt tolerant plant C. Salt tolerant callus selected

(a) 1:C 2:A 3:B (b) 2:B 3:C 2:A (c) 1:C 2:A 3:B (d) None of the above

30. Match the list first with list second and select the correct answer using the codes given below the lists. List I Examples of in vitro raised stress tolerant plant 1. Cymbopogon mar- A. tinii 2. Saccharum offici- B. narum 3. Datura innoxia C.

List II Traits Salt (NaCl) tolerance plant Iron (Fe) efficient plant Zinc tolerant plant

(a) 1:B 2:C 3:A (b) 1:A 2:B 3:C (c) 1:C 2:A 3:B (d) None of the above 31. Match the list first with list second and select the correct answer using the codes given below the lists.

List I 1. Saturation 2. Saur genes 3. Sclereid

List II A. A maximum state B. In soybean C. A type of non-elongated sclerenchyma cell commonly found in hard structure such as seed coats 4. Sclerenchyma D. Plant tissue composed of cells often dead at maturity with thick, lignified secondary cell wall

(a) 1:A 3:B 4:C 2:D (b) 1:A 2:B 3:C 4:D (c) 1:D 4:A 2:B 3:C (d) None of the above

32. Match the list first with list second and select the correct answer using the codes given below the lists. List I

List II

Term 1. S. lignin

Significance A. Sinapyl alcohol

2. S. phase

B. DNA replication

3. S-type channels C. A type of rated channels 4. SAG gene 31. (b)

D. Senescence associated gene

System Physiology: Plant

(a) 1:A 3:B 4:C 2:D (b) 1:A 2:B 3:C 4:D (c) 4:A 2:B 3:C 1:D (d) None of the above 33. The coefficient of viscosity (centipoises) at 20oC is 1. 2. 3. 4.

List I Water Ethyl alcohol Mercury Glycerine

A. B. C. D.

List II 1.60 830.0 1.002 1.200

(a) 1:A 3:B 4:C 2:D (b) 3:A 4:B 1:C 2:D (d) 4:A 2:B 3:C 1:D (d) None of the above 34. Empirically determined osmotic potentials of leaves of the following plants were. 1. 2. 3. 4.

List I Sunflower Chíckweed Pickleweed Mandarin orange

A. B. C. D.

List II –8.9 –1.9 –4.8 –0.74

(a) 1:A 3:B 4:C 2:D (b) 3:A, 4:B, 1:C, 2:D (c) 4:A 2:B 3:C 1:D (d) None of the above 35. Stomates are variously arranged in various plants. 1. 2. 3. 4.

List I Waterlily Submerged plants Grasses Pine

A. B. C. D.

List II None at all On both sides equally On top Substomatal crypt

(a) 1:A 3:B 4:C 2:D (b) 3:A 1:B 2:C 4:D (c) 4:A 2:B 3:C 1:D (d) None of the above 36. Quantity and units (with symbols) are given below, correspond to each other, match them. List I 1. Frequency 2. Pressure 3. Energy/work/ heat 4. Force Ans. 32. (b) 33. (b)

List II A. Pascal (P(a)) B. Newton (N) C. Joules (J) D. Hertz (Hz) 34. (b) 35. (c) 36. (c)

459

(a) 1:A 3:B 4:C 2:D (b) 4:A 1:B 3:C D:2 (c) 4:A 2:B 3:C 1:D (d) None of the above 37. At 20°C, match the atmospheric water potential with relative humidity (RH) percent as given below. 1. 2. 3. 4.

List I 98% of RH 90% of RH 50% of RH 10% of RH

A. B. C. D.

List II –14.2 MPa –311 MPa –2.72 MPa –93.5 MPa

(a) 1:A 3:B 4:C 2:D (b) 3:A 1:B 4:C 2:D (c) 4:A 2:B 3:C 1:D (d) None of the above 38. Match the texture class with the diameter range as specified in World System of Soil Classification. 1. 2. 3. 4.

List I Coarse sand Fine sand Silt Clay

List II A. 0.02–0.002 mm B. 0.002 mm and less C. 2.0–0.2 mm D. 0.2–0.02

(a) 1:A 3:B 4:C 2:D (b) 3:A 4:B 1:C 2:D (c) 4:A 2:B 3:C 1:D (d) None of the above

39. Match the salts and their molarity as in Hoagland’s solution. 1. 2. 3. 4.

List I KNO3 Ca(NO3)2 H2PO4 MgSO47H2O

A. B. C. D.

List II 0.003 0.230 0.490 0.010

(a) 1:A 3:B 4:C 2:D (b) 4:A 1:B 2:C 3:D (c) 4:A 2:B 3:C 1:D (d) None of the above 40. The following are the concentrations of some essential elements considered adequate for most of the higher plants (in dry tissues), match them suitably. List I 1. Molybdenum 2. Copper 37. (b)

38. (b)

39. (b)

List II A. 20 ppm B. 0.10 ppm

460

Plant Physiology: Question Bank 3. Zinc 4. Iron

C. 100 ppm D. 6.0 ppm

(a) 1:A 3:B 4:C 2:D (b) 4:A 2:B 3:C 1:D (c) 3:A 1:B 4:C 2:D (d) None of the above

(a) 4:A 1:B 2:C 3:D (b) 1:A 3:B 4:C 2:D (c) 4:A 2:B 3:C 1:D (d) None of the above 41. Match the following elements with their available form. 1. 2. 3. 4.

List I Copper Molybdenum Zinc Boron

A. B. C. D.

A. B. C. D.

List I 1. For photosynthesis 2. For aerobic respiration 3. For respiration 4. For mitosis/synthesis of DNA/RNA

List II 5,000 ppm 2,000 ppm 1,000 ppm 10,000 ppm

A. B. C. D.

(a) 1:A 3:B 4:C 2:D (b) 2:A 3:B 4:C 1:D (c) 4:A 2:B 3:C 1:D (d) None of the above

List II 50 ppm 2000 ppm 15,000 ppm 100 ppm

1. 2. 3. 4. Ans.

40. (a)

41. (b)

A. B. C. D. 42. (b)

List II A. Nuclei B. In mitochondria C. In chloroplast D. In cytosol

47. Match the following enzymes with their general reactions. List I 1. Proteinases 2. Transferases 3. Lyases

44. Nutrient List I Hydrogen Carbon Boron Manganese

List II Fe3+, Fe2+ H2PO4–, HPO4– SO4– NO3–

(a) 1:A 3:B 4:C 2:D (b) 3:A 2:B 4:C 1:D (c) 4:A 2:B 3:C 1:D (d) None of the above

43. Nutrient 1. 2. 3. 4.

A. B. C. D.

46. Enzymes are not uniformly mixed throughout cells, but are located at different sites to catalyse different processes

(a) 1:A 3:B 4:C 2:D (b) 3:A 2:B 1:C 4:D (c) 4:A 2:B 3:C 1:D (d) None of the above List I Phosphorus Nitrogen Chlorine Manganese

List I Nitrogen Iron Phosphorus Sulfur

(a) 1:A 3:B 4:C 2:D (b) 4:A 1:B 2:C 3:D (c) 4:A 2:B 3:C 1:D (d) None of the above

42. Match the following concentrations with the essential (considered adequate on dry tissue basis for most of the plants). 1. 2. 3. 4.

1. 2. 3. 4.

List II MoO4– Cu+, Cu2+ H3BO3 Zn2+

(a) 1:A 3:B 4:C 2:D (b) 2:A 1:B 4:C 3:D (c) 4:A 2:B 3:C 1:D (d) None of the above

List I Sulfur Magnesium Calcium Potassium

45. The form of essential nutrients available to plant and the nutrients are as follows, match them:

4. Lipases

List II 45,0000 ppm 50 ppm 60,0000 ppm 20 ppm 43. (b)

44. (c)

List II A. Transfers phosphate group especially from ATP B. Hydrolyzes lipids (esters) C. From double bonds by elimination of a chemical group D. Hydrolyze proteins

(a) 4:A 1:B 3:C 2:D (b) 1:A 3:B 4:C 2:D (c) 4:A 2:B 3:C 1:D (d) None of the above 45. (c)

46. (b)

47. (a)

System Physiology: Plant

48. Match the enzyme with their general reactions. List I 1. Ribonucleases 2. Deoxyribo nucleases 3. Isomerases 4. Hydrolases

List II A. Rearrange atom/molecule to lower form B. Hydrolyze RNA C. Breakdown chemical bonds D. Hydrolyse DNA

(a) 1:A 3:B 4:C 2:D (b) 3:A 4:B 1:C 2:D (c) 4:A 2:B 3:C 1:D (d) None of the above 52. Match the scientists with the observation which they made? List I 1. Stephen Hales, 1927

List II A. Implicated oxygen (deph-logisticated air) 2. Joseph Priestley, B. Light, necessary for 1771 air purification 3. Jan Ingenhou C. Noxious gas CO2 stimulated O2 production by plants 4. Jean Senebier, D. Partial nourishment 1782 from atmosphere and light, participation

(a) 1:A 3:B 4:C 2:D (b) 2:A 4:B 1:C 3:D (c) 4:A 2:B 3:C 1:D (d) None of the above 49. Match the carbohydrate content of the following seeds. 1. 2. 3. 4.

List I Maize Wheat Soybean Sunflower

A. B. C. D.

(a) 1:A 3:B 4:C 2:D (b) 3:A 4:B 2:C 1:D (c) 4:A 2:B 3:C 1:D (d) None of the above

List II 2% 14% 51.74% 60–75%

(a) 1:A 3:B 4:C 2:D (b) 4:B 1:B 2:C 3:D (c) 4:A 2:B 3:C 1:D (d) None of the above 53. Match the following sterols: List I 1. Sitosterol

List II A. Widespread in trace amounts in plants 2. Cholestrol B. Sex attraction in aquatic fungus 3. Ergosterol C. Most abundant in green algae and higher plants 4. Antheridiol D. Rare in plant, common in some fungi

50. Match the plants with the temperature at which they can photosynthesize. List I 1. Bacteria, BOA 2. Conifers (extremely slowly) 3. Exposed to bright sunshine 4. Antarctic lichens

(a) 4:A 1:B 2:C 3:D (b) 1:A 3:B 4:C 2:D (c) 4:A 2:B 3:C 1:D (d) None of the above

List II A. –60°C B. 35°C C. 18°C D. 70°C

51. Match the following plants with their maximum photosynthetic rate under natural conditions in µmol CO 2 per square meter per second. 1. 2. 3. 4. Ans.

List I Maize (C-4 pathway) Soybean (C-3 pathway) Century plant (CAM) European beech

48. (b)

49. (b)

50. (a)

461

A. B. C. D. 51. (b)

(a) 1:A 3:B 4:C 2:D (b) 3:A 1:B 4:C 2:D (c) 4:A 2:B 3:C 1:D (d) None of the above 54. Match the phytoalexins (Greek, phyton, plants; alexin, a warding off substance) with their plant parts wherein they occur. 1. 2. 3. 4.

List II 0.6–2.4 3–12 20–40 10–20 52. (b)

List I Pisatin Phaseolin Isocoumarin Trifolirhizin

A. B. C. D.

List II Carrot roots Bean pods Red clover roots Pea pods

(a) 1:A 3:B 4:C 2:D (b) 4:A 2:B 1:C 3:D (c) 4:A 2:B 3:C 1:D (d) None of the above 53. (b)

54. (b)

462

Plant Physiology: Question Bank

55. Match the alkaloids with the plants, they are associated with.

List I 1. Morphine

2. Nicotine 3. Meascaline

List II A. Flowering heads of cactus Lophophora williamsii B. Cultivated tobacco varieties C. Poisonous black night shade

59. Match the organisms with compatible solute and increase in their cells during osmotic adjustment: 1. 2. 3. 4.

(a) 1:A 3:B 2:C (b) 3:A 2:B 1:C (c) 1:A 2:B 3:C (d) None of the above 56. Match the following plant responses to the environment.

List I 1. Gravitroplasm 2. Phototropism

List II A. Growth towards light B. Nastic movement due to touch 3. Thigmotropism C. Growth of several organs on intermediate angles 4. Plagiotropis D. Response to gravity

(a) 1:A 3:B 4:C 2:D (b) 4:A 2:B 3:C 1:D (c) None of the above (d) 4:A 1:B 2:C 3:D 57. Match the longevity of the seeds of the plants given below.

1. 2. 3. 4.

List I Cocklebur (Xanthlumstrumariumy) Canada thistle (Circlumarvense) Kentucky blue grass (Poapratensis) Sensitive plant (Mimosa glonlerata)

List II A. 221 year B. 21 year C. 16 year D. 30 year

A.

2. Long-day plant

B.

3. Intermediate C. day plant 4. Day neutral plant D.

55. (b)

56. (d)

List II Kidney bean (phasealus vulgaris) Sugarbeet (beta sacchariferase Soybean (glycine max) Tarweed (madlaelegans)

57. (b)

58. (b)

List II Sucrose Sodium chlolride Proline Arabitol

(a) 2:A 4:B 1:C 3:D (b) 1:A 3:B 4:C 2:D (c) 4:A 2:B 3:C 1:D (d) None of the above 60. Match the following: 1. 2. 3. 4.

List I R.Q. for carbohydrates R.Q. for succulents R.Q. for protein R.Q. for organic acids

59. (a)

A. B. C. D.

List II 1 0

(a) 1:A 3:B 4:C 2:D (b) 2:A 4:B 1:C 3:D (c) 4:A 2:B 3:C 1:D (d) None of the above 61. Match the following. List I 1. Term photorespiration 2. Glycolysis also called organelle 3. First observed anaerobic respiration 4. Mitochondria pathway

List II A. Krotkov B. Respiratory C. W Cruickshank D. Embden Meyerhof Paranas

62. Match the following: List I 1. Named chlorophyll

List II A. Schleiden and Schwann 2. Term protoplasm B. F Mescher 3. Isolated nucleic acid C. Pelletier Caventou 4. Introduced the cell theory D. JE Purkinje

(a) 1:A 3:B 4:C 2:D (b) 4:A 2:B 3:C 1:D (c) 3:A 4:B 2:C 1:D (d) None of the above

(a) 1:A 3:B 4:C 2:D (b) 3:A 2:B 4:C 1:D (c) 4:A 2:B 3:C 1:D (d) None of the above

Ans.

A. B. C. D.

(a) 1:A 3:B 4:C 2:D (b) 1:A 4:B 3:C 2:D (c) 4:A 2:B 3:C 1:D (d) None of the above

(a) 1:A 3:B 4:C 2:D (b) 3:A 2:B 4:C 1:D (c) 4:A 2:B 3:C 1:D (d) None of the above 58. Match the following: List I 1. Short-day plant

List I Bacteria Fungi Microalgal Angiosperms

60. (b)

61. (b)

62. (d)

System Physiology: Plant

63. Match Column-I with Column–II and select the correct answer: A. B. C. D.

Column–I Water adsorption Mass flow Excessive osmosis No movement of water

Codes: A B C (a) 3 4 2 (c) 3 4 1

D 1 2

1. 2. 3. 4.

Column–II Plasmolysis Isotonic solution Imbibition Transpiration pull

A B (b) 3 4 (d) 1 2

C 1 3

D 2 4

64. Match Column-I with Column–II and select the correct answer: A. B. C. D.

Column–I Transpiration pull theory Sugar transport Free space theory Pulsation theory

Codes: A B C (a) 1 2 3 (c) 4 3 2

2. Dixon and Jolley 3. Munch 4. Hope and Stevens

D 4 1

A B (b) 3 4 (d) 2 3

C 1 4

D 2 1

B. C. D.

Column–I Cytochrome pump theory Girdle experiment Potometer Hydathodes

Codes: A B C (a) 4 3 2 (c) 2 3 1

A. B. C. D.

Column–I Stomata Bark Cambium Lenticels

D 1 4

A B (b) 3 4 (d) 3 2

C 1 4

D 2 1

Ans.

63. (c)

64. (d)

Column–II 1. Turgor pressure 2. Wall pressure 3. Munch 4. Osmotic Potential

65. (b)

66. (c)

67. (a)

C 2 1

D 4 4

D 1 3

Column–II Secondary growth Gaseous exchange Transpiration Protection

A B (b) 1 2 (d) 1 2

C 3 3

D 4 4

68. Match Column-I with Column–II and select the correct answer: Column–I A. Phosphorus B. Potassium C. Manganese D. Calcium

Column–II 1. Activator of enzymes 2. Premature leaf fall 3. The death of root and shoot tips 4. Photolysis of water

Codes: A B C (a) 4 3 1 (c) 2 1 3

D 2 4

A B (b) 2 1 (d) 3 2

C 4 1

D 3 4

69. Match Column-I with Column–II and select the correct answer: A. B. C. D.

Column–I Little leaf disease Die–back disease Whip tail disease Brown heart disease

66. Match Column-I with Column–II and select the correct answer: Column–I A. Pressure by turgid protoplast B. Direction of the water movement C. Measure of change in a solution due to solute concentration D. Counter pressure exerted by cell wall

A B (b) 3 1 (d) 2 3

1. 2. 3. 4.

Codes: A B C (a) 4 3 2 (c) 2 1 4

Column–II 1. Transpiration 2. Guttation 3. Carrier concept 4. Phloem transport

D 1 2

67. Match Column-I with Column–II and select the correct answer:

Column–II 1. JC Bose

65. Match Column-I with Column–II and select the correct answer: A.

Codes: A B C (a) 4 2 3 (c) 1 3 4

463

Codes: A B C (a) 2 1 3 (c) 4 3 2

D 4 1

1. 2. 3. 4.

Column–II Copper Zinc Molybdenum Boron

A B (b) 4 3 (d) 3 2

C 1 4

D 2 1

70. Match Column-I with Column–II and select the correct answer: Column–I A. Rhizobium

Column–II 1. Asymbiotic N2–fixer (aerobic) B. Azotobacter 2. Symbiotic N2–fixer C. Clostridium 3. Photosynthetic and anaerobic D. Rhodospirillum 4. Anaerobic N2–fixer 68. (b)

69. (a)

464

Plant Physiology: Question Bank

Codes: A B C D A B C D (a) 1 2 4 3 (b) 4 3 2 1 (c) 1 2 3 4 (d) 2 1 4 3 71. Match Column-I with Column–II and select the correct answer: A. B. C. D.

Column–I Nitrogenase Leghemoglobin Lectins Nod genes

1. 2. 3. 4.

Column–II Root hair surface Fe–Mo complex Legume Plant Proteinnaceous

Codes: A B C D A B C D (a) 2 4 1 3 (b) 4 1 3 2 (c) 2 1 3 4 (d) 1 2 4 3 72. Match Column-I with Column–II and select the correct answer: A. B. C. D.

Column–I Energy transfer Middle lamella Chlorophyll Nitrate reduction

Codes: A B C (a) 4 3 1 (c) 2 3 4

1. 2. 3. 4.

D 2 1

Column–II Magnesium Molybdenum Calcium Phosphorus

A B (b) 3 2 (d) 4 2

Column–I Vein ending Kidney shaped Necessary evil Semipermeable membrane

1. 2. 3. 4.

Column–I

Photoperiodism ABA Low temperature Mimosa

Ans.

Codes: A B C (a) 4 3 1 (c) 3 2 1 70. (d)

1. 2. 3. 4.

D 2 4

C 1 3

71. (c)

Column–II

Vernalization Pulvinus Geotropism Garner and Allard

72. (a)

73. (a)

C 1 4

C. Oncogenes D. Human immunideficiency virus

Codes: A B C (a) 4 3 1 (c) 4 3 2

D 2 1

Column–I A. Single circular DNA molecule B. Jacob & Monod

Codes: A B C (a) 4 3 1 (c) 1 2 4

C 4 4

D 1 3

Column–II 1. Protein coat of viruses 2. Processing of m-RNA molecules 3. One gene one enzyme concept 4. X-ray crystallography

D 2 3

A B (b) 3 2 (d) 2 1

C 1 4

D 4 3

77. Match Column-I with Column–II and select the correct answer: A. B. C. D.

Column–I Bryophyllum Sugar cane Wheat Rhizophora

Codes: A B C (a) 2 4 3 (c) 2 4 1

1. 2. 3. 4.

D 1 3

Column–II C3–plants CAM plants Mangrove plants C4–plants

A B (b) 4 2 (d) 1 2

C 3 3

D 1 4

78. Match Column-I with Column–II and select the correct answer: A. B. C. D.

Column–I Kamen and Ruben Mitchell Krotokov Hatch and Slack

Codes: A B C (a) 1 4 3 (c) 1 3 4

D 3 3 74. (a)

A B (b) 2 3 (d) 2 1

76. Match Column-I with Column–II and select the correct answer:

D 4 1

Column–II Transpiration Osmosis Transpiration pull Guttation

A B (b) 4 2 (d) 2 1

Column–II 1. Causes AIDS 2. Component of bacterial chromosomes 3. Lac-operon concept 4. Increase in cell number or cell sac

D. Growth

Codes: A B C D A B C D (a) 4 3 1 2 (b) 4 2 1 3 (c) 3 2 1 4 (d) 2 1 4 3 74. Match Column-I with Column–II and select the correct answer: A. B. C. D.

Column–I A. Bacteriophages B. Capsid

C. Splicing

73. Match Column-I with Column–II and select the correct answer: A. B. C. D.

75. Match Column-I with Column–II and select the correct answer:

75. (a)

76. (a)

77. (c)

1. 2. 3. 4.

D 2 2

Column–II Chemiosmotic theory C4–cycle Evolution of O2 Photorespiration

A B (b) 3 1 (d) 3 1

78. (d)

C 2 4

D 4 2

System Physiology: Plant

79. Match Column-I with Column–II and select the correct answer: A. B. C. D.

Column–I Hill reaction Quantasome Red–Drop Z–Scheme

Codes: A B C (a) 4 2 3 (c) 4 3 2

1. 2. 3. 4.

D 1 1

Column–II Emerson and Lewis Photolysis of water Hill and Bendall Park and Pon

A B (b) 2 4 (d) 1 4

C 1 3

D 3 2

80. Match Column-I with Column–II and select the correct answer: A. B. C. D.

Column–I Undifferential mesophyll Kranz anatomy Proxisome Stroma

Codes: A B C (a) 1 2 3 (c) 2 3 1

C 2 4

D 1 1

81. Match Column-I with Column–II and select the correct answer: A. B. C. D.

Codes: A B C (a) 1 2 3 (c) 3 4 2

2. Blue region

C 4 1

D 3 2

82. Match Column-I with Column–II and select the correct answer: A. B. C. D.

Column–I Conversion of pyru 1. vate to acetyl CoA Formation of ATP 2. Breakdown of acetyl 3. CoA to form reduced coenzymes Conversion of glucose 4. to pyruvate

Ans.

79. (b)

80. (b)

Codes: A B C (a) 4 1 2 (c) 3 2 1

Glycolysis Oxidative decarboxylation Electron transport system 82. (d)

D 3 4

Column–I A. Krebs’ cycle B. Glycolysis

A B (b) 4 3 (d) 2 1

C 1 4

D 2 3

Column–II 1. Cytoplasm 2. Matrix of mitochondria 3. CF0–CF1

C. Electrone transport system D. Oxidative phosphory- 4. Inner membrane of lation mitochondria

Codes: A B C (a) 2 1 3 (c) 2 1 4

D 4 3

Column–I A. Pentose phosphate pathway B. Citric acid cycle C. Anaerobic respiration D. Glycolysis

Codes: A B C (a) 3 1 2 (c) 4 2 3

Column–II Krebs’ cycle

81. (b)

D 3 2

A B (b) 1 2 (d) 2 4

C 4 3

D 3 1

85. Match Column-I with Column–II and select the correct answer:

3. Red and far red region 4. Green region

A B (b) 2 1 (d) 4 3

C 4 1

Column–I Column–II A. Pyruvic Acid 1. Lohmann B. Adenno triphosphate 2. Alcoholic fermentation 3. Krebs’ cycle C. C2H5OH and CO2 D. Acetyl CoA 4. Glycolysis

Column–II 1. Red region

D 4 1

A B (b) 1 2 (d) 3 4

84. Match Column-I with Column–II and select the correct answer:

2. Photorespiration 3. C4–plants 4. Monocots

A B (b) 4 3 (d) 3 2

D 4 1

83. Match Column-I with Column–II and select the correct answer:

Column–II 1. Dark reaction

D 4 4

Column–I Maximum absorption of light Most effective wavelength Most ineffective wavelength Red–Drop

Codes: A B C (a) 2 1 3 (c) 4 3 2

465

83. (a)

Column–II 1. Phosphogluconate pathway 2. Fermentation 3. Tricarboxylic acid cycle 4. Embden–Meyerhof parans pathway

D 4 1

A B (b) 1 3 (d) 2 1

C 2 4

D 4 3

86. Match Column-I with Column–II and select the correct answer: Column–I Column–II A. Pasteur 1. Citric acid cycle B. Krebs’ cycle 2. Hexose monophosphate shunt 84. (c)

85. (b)

466

Plant Physiology: Question Bank

C. Warburg D. Kostychev

3. Anaerobic respiration 4. Zymosis

Codes: A B C D A B C D (a) 2 3 1 4 (b) 3 2 4 1 (c) 4 1 2 3 (d) 1 2 3 4 87. Match Column-I with Column–II and select the correct answer:

A. B. C. D.

Column–I Auxin Phytochrome Vernalin Florigen

1. 2. 3. 4.

Column–II Boysen-Jenser Melchers Chailkhyan Butler & coworkers

Codes: A B C D A B C D (a) 3 2 1 4 (b) 2 3 1 4 (c) 2 1 4 3 (d) 1 2 3 4 88. Match Column-I with Column–II and select the correct answer:

A. B. C. D.

Column–I Cytokinin Ethylene Gibberellins Auxin

1. 2. 3. 4.

Column–II Promotes senescence Internodal elongation Herbicides Delay of senescence

Codes: A B C D A B C D (a) 3 2 1 4 (b) 3 2 4 1 (c) 2 3 4 1 (d) 2 1 3 4 89. Match Column-I with Column–II and select the correct answer: A. B. C. D.

Column–I Bolting Apical dominance Dormin Ripening hormone

1. 2. 3. 4.

Column–II Ethylene Abscisic acid Auxin Gibberellins

Codes: A B C D A B C D (a) 4 3 2 1 (b) 2 3 4 1 (c) 3 2 1 4 (d) 2 1 3 4 90. Match Column-I with Column–II and select the correct answer: A. B. C. D.

Column–I Isopentenyl adenine Indole acetic acid 6-fufuryl amino purine Terpenes

Ans.

Codes: A B C (a) 4 3 1 (c) 1 2 3 86. (c)

D 2 4

87. (b)

1. 2. 3. 4.

Column–II Auxin Cytokinin Gibberellins Kinetin

A B (b) 1 2 (d) 2 1 88. (c)

89. (a)

C 4 4

91. Match Column-I with Column–II and select the correct answer: A. B. C. D.

Column–I Zeatin Gibberellins Auxins Photoperiodism

Codes: A B C (a) 3 2 4 (c) 3 1 4

D 1 2

Column–II Kurosawa Garner & Allard Letham Went

A B (b) 2 3 (d) 1 4

C 1 3

D 4 2

92. Match Column-I with Column–II and select the correct answer: Column–I Column–II A. Mitchell 1. Steps of dark reaction of photosynthesis B. Gibbs 2. Photophosphorylation C. Arnon 3. Concept of free energy D. Calvin 4. Chemiosomotic hypothesis

Codes: A B C (a) 4 3 2 (c) 4 3 1

D 1 2

A B (b) 3 4 (d) 4 5

C 1 3

D 2 2

93. Match Column-I with Column–II and select the correct answer: Column–I Column–II A. Girdling experiment 1. Growth B. Cobalt chloride 2. Transpiration paper test C. Cresograph 3. Unequal transpiration on two leaf surfaces D. Bell jar experiment 4. Translocation in phloem

Codes: A B C (a) 2 1 4 (c) 4 1 2

D 3 3

A B (b) 3 1 (d) 4 3

C 4 1

D 2 2

94. Match Column-I with Column–II and select the correct answer: A. B. C. D.

Column–I Germs of chloroplast 1. Aroma of chloroplast 2. Cytoplasm 3. Mitochondrial matrix 4.

D 3 3 90. (d)

1. 2. 3. 4.

91. (c)

Codes: A B C (a) 3 4 1 (c) 1 2 4 92. (a)

93. (d)

D 2 3

Column–II Krebs cycle Light reaction Dark reaction Glycolysis

A B (b) 2 3 (d) 4 3

94. (c)

C 4 2

D 1 1

System Physiology: Plant

95. Match Column-I with Column–II and select the correct answer: A. B. C. D. E.

Column–I Carboxylation Phosphorylation Photolysis of water Phosphoglycolate Nitrosomonas

Codes: A B (a) 5 4 (b) 1 3 (c) 2 3 (d) 3 5 (e) 1 2

C 3 4 5 1 3

1. 2. 3. 4. 5.

D 2 2 4 2 4

Column–II Oxygen evolution Photorespiration RuBisCo Chemosynthesis ATP

D. Wright effect

Codes: A B C (a) 3 2 1 (c) 2 1 3

E 1 1 1 4 5

D 4 4

Column–I A. H+, OHB. Pyruvic acid C. C2H5OH, CO2

A B (b) 4 3 (d) 4 1

C 2 3

D 1 2

97. Match Column-I with Column–II and select the correct answer: A. B. C. D.

Column–I Visible light Ultraviolet X-rays Infrared

1. 2. 3. 4.

Codes: A B C (a) 5 4 3 (c) 4 3 2

D 2 1

Column–II 0.1–1.0 nm 400–700 nm Longer than 700 nm 100–400 nm

A B (b) 2 4 (d) 3 2

C 1 1

D 3 5

98. Match Column-I with Column–II and select the correct answer: Column–I Column–II A. Warburg effect 1. Change in gene frequency by chance B. Pasteur effect 2. Postponing senescence of leaves cytokinin C. Emerson effect 3. Decline in consumption of substrate during transportation to aerobic conditions Ans.

95. (d)

96. (d)

97. (b)

98. (b)

D 2 3

A B (b) 4 3 (d) 5 3

C 5 1

D 1 4

99. Match Column-I with Column–II and select the correct answer:

Column–II 1. Law of limiting 2. Dark reaction 3. Photosynthetic phosphorylation 4. Chemiosmotic hypothesis

D. Melvin Calvin

4. Enhancement of photosynthesis by two different wavelengths of light

Codes: A B C (a) 5 4 1 (c) 4 5 2

Column–II 1. Glycolysis 2. Alcoholic fermentation 3. Photolysis of water

Codes: A B C (a) 4 3 2 (c) 5 4 1

96. Match Column-I with Column–II and select the correct answer: Column–I A. Peter Mitchell B. Blackmann C. Daniel Arnon

467

A B (b) 4 1 (d) 4 2

C 2 1

100. Match Column-I with Column–II and select the correct answer: Column–I A. Krebs cycle B. Glycolysis C. Calvin cycle

1. 2. 3. 4.

Column–II Stroma Grana Mitochondrial matrix Cytoplasm

Codes: A B C A B C (a) 3 4 2 (b) 4 3 1 (c) 3 4 1 (d) 4 3 2 101. Match Column-I with Column–II and select the correct answer: A. B. C. D.

Column–I 4C 2C 5C 3C

1. 2. 3. 4. 5.

Column–II Acetyl CoA Pyruvate Citric acid Ketoglutaric acid Malic acid

1. 2. 3. 4. 5.

Column–II Acetyl CoA Pyruvate Citric acid Ketoglutaric acid Malic acid

Codes: A B C D A B C D (a) 5 1 4 2 (b) 3 5 1 2 (c) 2 1 5 3 (d) 4 2 3 5 102. Match Column-I with Column–II and select the correct answer: A. B. C. D.

Column–I 4C compound 2C compound 5C compound 3C compound

99. (b) 100. (c) 101. (a)

468

Plant Physiology: Question Bank

Codes: A B C (a) 3 4 1 (c) 3 1 4

D 5 2

A B (b) 5 3 (d) 5 1

C 1 4

D 2 2

103. Match Column-I with Column–II and select the correct answer: A. B. C. D.

Column–I Oxalacetate Ph 5C compound 3C compound

1. 2. 3. 4. 5.

Codes: A B C (a) 3 4 1 (c) 3 1 4

Column–II 6C compound Pyruvate Citric acid Ketoglutaric acid Malic acid

D 5 2

A B (b) 5 3 (d) 5 1

C 1 4

D 2 2

104. Match Column-I with Column–II and select the correct answer: A. B. C. D.

Column–I Auxin Gibberellin Cytokinins Ethylene

1. 2. 3. 4.

Codes: A B C (a) 4 3 2 (c) 4 3 1

Column–II Coloring test in lemon Cell division test in plants Avena curvaturs test Dwarf corn test

D 1 2

A B (b) 2 1 (d) 3 4

C 4 2

D 3 1

105. Match Column-I with Column–II and select the correct answer: Column–I A. Phototaxis

1.

B. Thermotaxis 2. C. Chemotaxis D. Hyponasty

3. 4.

E. Seismonasty 5.

Codes: A B (a) 2 5 (b) 2 3 (c) 4 5 (d) 5 1

Column–II Circular movement of protoplasm in response to warm condition Upward movement of floral organs Dropping of leaf Movement of anther ozoids towards archegonia Movement of chalmydomonas

C 1 4 1 4

D 4 5 2 2

E 3 1 3 3

106. Match Column-I with Column–II and select the correct answer: A. B. C. D. E.

Column–I Human urine Gibberella fujikuroi Herring fish DNA Ripening fruits Aged leaves of plants

A. B. C. D. E.

Column–I Auxin Cytokinin Gibberellin Ethylene Abscisic acid

1. 2. 3. 4. 5.

Column–II Cytokinin Auxin Ethylene Abscisic acid Gibberellins

Codes: A B C D E (a) 3 2 1 5 4 (b) 5 4 3 2 1 (c) 1 5 2 4 3 (d) 2 5 1 3 4 107. Match Column-I with Column–II and select the correct answer:

Codes: A B (a) 4 1 (b) 3 1 (c) 2 1 (d) 3 1

1. 2. 3. 4. 5.

C 5 5 5 5

Column–II Heering sperm DNA Inhibitor of growth Apical dominator Epinasty Induces amylase synthesis

D 3 2 3 4

E 2 4 4 2

108. Match Column-I with Column–II and select the correct answer: A. B. C. D.

Column–I Zeatin Florigen IBA NAA

Codes: A B C (a) 1 2 3 (c) 3 4 1

1. 2. 3. 4.

Column–II Flowering Synthetic Cytokinin Natural

D 4 2

A B (b) 2 1 (d) 4 3

C 4 1

D 3 2

Assertion and Reason Type Questions

In each of the following questions, there are two statements, one is Assertion (A) while the other is Reason (R). Examine the statements carefully and mark the correct answer according to the instructions given:

Ans. 102. (d) 103. (b) 104. (d) 105. (d) 106. (d) 107. (d) 108. (d)

System Physiology: Plant

Answer codes: (a) If both (A) and (R) are correct and (R) is correct explanation of (A). (b) If both (A) and (R) are correct and (R) is not correct explanation of (A). (c) If (A) is correct and (R) is wrong. (d) If both (A) and (R) are wrong. 1. Assertion (A): Photosynthetic bacteria do not evolve oxygen during photosynthesis. Reason (R): Photosynthetic bacteria are always obligate anaerobic. 2. Assertion (A) : Photorespiration is a harmful process. Reason (R) : ATPs are not produced in phototrespiration. 3. Assertion (A): Isolated chloroplasts can form sugars in the absence of light if both ATP and NADPH2 are supplied with enzymes and CO2. Reason (R): ATP and NADPH 2 are used in dark reactions. 4. Assertion (A): The absorption spectrum of chlorophyll a shows close relationship with its action of spectrum. Reason (R) : Chlorophyll a is present in pigments systems I and II. 5. Assertion (A): In C3 plants photosynthesis more than C4 plants. Reason (R): C 4 plants have a shorter CO2 fixation cycle. 6. Assertion (A): Those substances which reduce the rate of transpiration are called transpirants. Reason (R) : Imbibition causes osmotic pressure. 7. Assertion (A): Chlorosis means destruction or the loss of chlorophyll pigment. Reason (R): Necrosis is the formation of dead tissue by killing of parenchyma cells. 8. Assertion (A): Water potential of distilled water is zero. Reason (R): C 2 –cycle id also called Calvin cycle. Ans.

1. (c) 12. (a)

2. (a) 13. (c)

3. (a) 14. (a)

4. (b) 15. (a)

5. (d) 16. (d)

469

9. Assertion (A): ‘Transpiration Pull Theory’ was proposed by Dixon and Jolley. Reason (R): Loss of water droplets from hydathodes is called guttation. 10. Assertion (A): When the roots are deprived of oxygen, the active absorption of minerals is decreased. Reason (R): For active absorption of minerals, metabolic the energy of respiration in form of ATP is available. 11. Assertion (A): Ash analysis of a plant provides clear picture of essential elements for the plants. Reason (R): Roots take those elements selectively which are essential to them. 12. Assertion (A): In plants growing in nitrogen deficient soils, the older leaves become chlorotic. Reason (R): In case of the deficiency, nitrogen moves from old leaves to young leaves. 13. Assertion (A): K + , transport in dependent upon respiration. Reason (R): Respiratory inhibitors stimulate K+ uptake. 14. Assertion (A): Nitrogen is a unique inorganic plant nutrient. Reason (R): Nitrogen is derived from both mineral and non-mineral sources. 15. Assertion (A): Odut of 36 ATP molecules, 34 are gained inside and two outside mitochondria. Reason (R): The gain of 4 ATP molecules inside mitochondria is due to transfer of 2NADH + H + molecules from cytosol to mitochondria. 16. Assertion (A): Respiration is an anabolic process. Reason (R): ATP produced in mitochondria is due to photophosphorylation. 17. Assertion (A) : In an electron transport system, energy carried by electron is released in small amounts at each transfer. 6. (d)

7. (b)

8. (c)

9. (b)

10. (a)

11. (d)

470

Plant Physiology: Question Bank

Reason (R) : Each molecule in the series (ETS) holds electron with higher free energy than the preceding molecules. 18. Assertion (A): Had anaerobic respiration ended with pyruvic acid, glycolysis would have been turned off. Reason (R) : In the last steps of anaerobic respiration, NAD+ is feed for use again in glycolysis. 19. Assertion (A): Cyanide resistant respiration is found in some plants. Reason (R): The electrons are transferred from Cyt a3 to O2. 20. Assertion (A): Sunflower plant has long internodes with leaves far apart. Reason (R): Sunflower produces sufficient amounts of gibberellins during its growing period. 21. Assertion (A): Senescence is delayed by the application of cytokines in plants. Reason (R): Cytokinin prevents the breakdown of chlorophyll. 22. Assertion (A): Ethylene triggers ripening in many fruits. Reason (R): During fruit ripening relatively large quantities of ethylene are formed and released to the surroundings. 23. Assertion (A): The endogenous level of plant hormones is estimated by bioassay method. Reason (R) : The concentration of hormone in plants is to low that it is not possible to chemically measure the level. 24. Assertion (A): A farmer does not prefer to grow tobacco plant under short-day condition. Reason (R): Tobacco is a long-day plant. 25. Assertion (A): Cyclic pathway of photosynthesis first appeared in some eubacterial species. Reason (R): Oxygen started accumulating in the atmosphere after noncyclic pathway of photosynthesis evolved. Ans.

17. (c)

18. (a)

19. (b)

20. (a)

21. (a)

True and False Statements

State whether the following statements are True (T) or False (F): 1. The amount of guttated water is more than the transpired water. Ans: F 2. Starch–Sugar hypothesis was proposed by Levitt. Ans: F 3. The abscisic acid (ABA) is called “Stress Hormone”. Ans: T 4. Dumb–Bell shaped guard cells are found in cereals and grasses. Ans: T 5. Water movement in root cortex from cell to cell is under the gradient of suction pressure. Ans: T 6. The osmotic potential of the soil is positive due to the presence of some salts dissolved in it. Ans: F 7. The water movement occurs from lower water potential to a higher water potential. Ans: F 8. The rate of diffusion is directly proportional to its density. Ans: T 9. The water potential of any aqueous solution is always negative. Ans: T 10. A membrane through which a solvent can pass across is called differentially permeable. Ans: F 11. Photophosphorylation was discovered by Mitchell. Ans: F 12. Carotenoids are the composed of carotene and xanthophylls. Ans: T 13. The conversion of RuMP to RuBP occurs with the help of RuBisco. Ans: F 22. (b)

23. (c)

24. (d)

25. (d)

System Physiology: Plant

14. The fixation of CO2 takes place in light reaction. Ans: F 15. The reaction centre in bacterial photosynthesis is P390. Ans: F 16. At the low temperature, the photosynthetic rate decreases due to inactivation enzymes. Ans: T 17. The phenomenon of red drop was known after the discovery of Emerson’s Effect. Ans: T 18. Two important products are formed in light reaction such as ATP and glucose. Ans: F 19. Chemical like DCMU is a strong inhibitor of PS–II. Ans: T 20. The C 4 plants do not show photorespiration. Ans: T 21. The activator required by the enzyme nitrite reductase is boron: Ans: F 22. The apices die if there is the deficiency of calcium. Ans: T 23. Due to the deficiency of potassium molting and chlorosis first appears in younger leaves. Ans: F 24. Water core in turnip is caused due to the deficiency of Mn. Ans: F 25. Reclamation disease of cereals is caused due to the deficiency of copper. Ans: T 26. The elements needed of photolysis of water are Cu and Cl. Ans: F 27. The soils usually have a deficiency of N, P and K. Ans: T

471

28. In addition to C, H, O and N chlorophyll also contains Mg. Ans: T 29. The activator needed by enzyme actinoase is calcium. Ans: F 30. In alkaline soils, the main cation is Ca2+. Ans: T 31. Hormone florigen is involved in vernalization and that is produced during low temperature treatment. Ans: F 32. If a long-day plant is exposed to continuous darkness and provided sucrose, it produces flowers. Ans: F 33. The Pr form changes to Pfr in light. Ans: T 34. Seed germination is inhibited by red wavelength (660 nm) and promoted by far red (730 nm). Ans: F 35. No flowering occurs if the plant is exposed to green light. Ans: T 36. All seed plants are known to produce ethylene. Ans: T 37. Conditions of mechanical stress and wounding decrease the production of ethylene. Ans: F 38. For substituting cold treatment, the gas are applied endogenously. Ans: F 39. In roots, auxin transport is polar and acropetal. Ans: T 40. Auxins like IAA, NAA and 2, 4-D can induce partheocarpy. Ans: T 41. Human genetic at metaphase may be karyotyped. Ans: T 42. Haploid plants are usually fertilize. Ans: F

472

Plant Physiology: Question Bank

43. PTC tasting and tongue rolling genes are present on same chromosome. Ans: F 44. Morgan et al. were able to construct chromosome maps showing the relative location of many genes. Ans: T 45. In Ophioglossum somatic chromosome number is 1262. Ans: T 46. Chromosomes are best seen in telophase of cell division. Ans: F 47. Mendel showed that units of heredity, the factors or genes are stable and particulate. Ans: T 48. Geotropism is turgor movement induced by gravity and is shown by stem and root. Ans: F 49. Leaf fall reduces transpiration loss. Ans: T 50. Growth movements are due to differential (unequal) growth. Ans: T 51. Gibberellins cause parthenocarpy in some types of fruits. Ans: T 52. Ethylene retards abscission of leaves, flowers and fruits. Ans: F 53. Growth is rapid in lag phase. Ans: F 54. As the cells cease to divide, they increase in size. Ans: T 55. NAA and 2,4–D, inhibits flowering in litchi and pineapple. Ans: T 56. By this time, > 100 different gibberellins have been identified. Ans: T 57. The stomata open when guard cell take up Ca++ from the surrounding cells. Ans: F

58. The guard cells walls surrounding the aperture are thicker than outer wall. Ans: T 59. In plant cell, the elastic wall exerts a counter pressure to imbibitinal pressure called wall pressure. Ans: F 60. Two factors which affect water potential are the amount of solutes and external pressure. Ans: T 61. The direction in which water will flow from one part of the plant to another depends on water potential in two regions. Ans: T 62. The dihydroxyacetone phosphate is enzymatically hydrolyzed to glycerol. Ans: T 63. The enzymes of Kreb‘s cycle are found in the perimitochondiral space. Ans: F 64. The enzymes succinic dehydrogenase catalyzes the synthesis of succinic acid to fumaric acid. Ans: T 65. Kreb‘s cycle starts from pyruvic acid. Ans: F 66. Some intermediates of glycolysis may take part in formation of sugars through some other pathway. Ans: T 67. The fats are most preferred substrate for respiration. Ans: F 68. There are six hydrogen donors in the Kreb‘s cycle. Ans: F 69. According to chemiosmotic theory proposed by Mitchell for ATP synthesis, hydrogen ions are pushed out into outer chamber of mitochondria. Ans: T 70. No ATP formation occurs during photorespiration. Ans: T

System Physiology: Plant

71. An ATP molecule is generated when electron is transported from cytochrome b to C1. Ans: T Fill in the Blanks

1. ATP and NADPH 2 formed in light reaction are utilized in dark reaction for the synthesis of ...... Ans. Phosphoglyceraldehyde 2. The process of photophosphorylation occurs in ...... Ans. Grana of Chloroplast 3. In succulents, CO2 fixation takes place by ...... pathway. Ans. Cam 4. ...... is the first stable product during C4 photosynthesis. Ans. Oxaloacetic acid 5. ...... refers to the intensity of light at which rate of respiration is equal to that of photosynthesis. Ans. Compensation point 6. Number of quanta required for releasing one molecule of O 2 during light reaction is called ...... Ans. Quantum Requirement 7. Photophosphorylation was discovered by ...... Ans. Arnon 8. Two pigment systems were known after the discovery of ...... Ans. Emerson Effect 9. ...... turns of Calvin cycle are required to produce one molecule of glucose. Ans. Six 10. ...... proved that excess O2 has inhibitory role in photosynthesis: Ans. Warburg 11. Two types of active and passive water absorption were proposed by ...... Ans. Kramer 12. Bacteria are ...... in salted medium due to the plasmolysis. Ans. Killed

473

13. Exudation of sap from the cut end of a steam is called ...... Ans. Bleeding 14. The phenomenon of ...... is involved in transpiration of water vapors from plants: Ans. Diffusion 15. Stomata are not functional and may be absent in ...... hydrophytes: Ans. Submerged 16. Relay pump theory was proposed by ...... Ans. Godlewski 17. In a flaccid cell, osmotic pressure is equal to its ...... Ans. Diffusion Pressure Deficit 18. Imbibition involves capillarity and ...... Ans. Diffusion 19. When plasmolyzed cell immersed in water, the cell shows ...... Ans. Deplasmolysis 20. The net pressure responsible for the entry of water into the cell is called ...... Ans. Suction Pressure 21. Grey speck of oats is caused due to the deficiency of ...... Ans. Manganese 22. Wilting in plants is caused due to the deficiency of ...... Ans. Chlorine 23. The micronutrients required for the synthesis of IAA is ...... Ans. Zinc 24. Culturing of plants in nutrient water medium is known as ...... Ans. Hydroponics 25. Silica is an essential element required by grasses and ...... Ans. Diatoms 26. Ion accumulation in a cell in concentration greater than that of surrounding medium is due to ...... absorption. Ans. Active 27. Symptoms of deficiency of mobile elements first appear in ...... Ans. Old Leaves

474

Plant Physiology: Question Bank

28. H+ ions of the root are exchanged with ...... of the soil: Ans. Cation 29. Middle lamella requires ...... for its synthesis: Ans. Calcium 30. Absorption of minerals along the concentration gradient without using metabolic energy is ...... absorption: Ans. Passive 31. First dicarboxylic acid formed during Krebs’ cycle is ...... Ans. -ketoglutaric 32. Acetyl CoA is formed from ...... and coenzyme A. Ans. Pyruvic acid 33. ...... is a connecting link between glycolysis and Krebs’ cycle: Ans. Acetyl CoA 34. Cut surface of peach turns black due to the activity of enzyme. Ans. Polyphenoloxidase 35. Complete oxidation of 90 g of glucose results is net gain of ...... ATP molecules: Ans. 18 36. The number of ATP released when two molecules of glucose are converted into alcohl and CO2 is ...... Ans. 4 37. If O 2 is present, the end products of respiration include ...... Ans. CO2 + H2O 38. ...... ATP molecules are produced in hexose monophosphate shunt. Ans. 36 39. Actimycin-A inhibits synthesis of ...... Ans. ATP 40. Complete oxidation of a molecules of pyruvic acid yields ...... ATP molecules. Ans. 15 41. Metabolic energy of the cell is utilized in ...... absorption of water. Ans. Active 42. ...... is the exudation of water drops from the tip or margins of lamina at the vein ends? Ans. Guttation

43. During passive absorption, water is absorbed as a result of tension created by ...... Ans. Transpiration pull 44. Guttation occurs through the pores called ...... Ans. Hydathodes 45. Transpiration is ...... proportional to humidity. Ans. Inversely 46. More is the leaf area, ...... is the rate of transpiration. Ans. Higher 47. ...... is the number of stomata per square mm of leaf surface. Ans. Stomatal frequency 48. The ...... pressure of guard cells is responsible for the opening of stomata. Ans. Turgor 49. The hydrostatic pressure developed in the roots is called ...... pressure. Ans. Root 50. The most acceptable theory of ascent of sap is ...... Ans. Cohesion-tension theory 51. The value of water potential of pure water at normal temperature and pressure is ...... Ans. Zero (bar) 52. DPD in thermodynamic terminology is known as ...... Ans. Water potential 53. A membrane allowing certain molecules to enter and preventing the others is called a ...... membrane. Ans. Semipermeable 54. The form and structure of growing cell are maintained because of ...... Ans. Turgor pressure 55. When a cell is placed in hypotonic solution, water moves into the cell, this flow is called ...... Ans. Endosmosis 56. In the thermodynamic terminology the osmotic pressure is equivalent to ...... potential concept but opposite in sign of its value. Ans. Osmotic

System Physiology: Plant

57. The pressure exerted by cell wall to balance turgor pressure is called ...... Ans. Wall pressure 58. The water potential of pure water is ...... Ans. Cuticular transpiration 59. Plants lose water by the processes of ...... and ...... Ans. Transpiration, guttation 60. When plant absorbs the water from the soil, the water potential of root cell is ...... than the soil. Ans. More 61. The water potential of pure water is ...... Ans. Zero bar 62. Excessive nitrogen supply to the plants reduces the ...... system. Ans. Root 63. The trace elements constituent of the enzyme nitrate reductase is ...... Ans. Manganese 64. The deficiency of potassium produced ...... growth in plants. Ans. Rosette 65. The common symptom of nitrogen deficiency is ...... in plants. Ans. Anthocyanin formation 66. Oxygen is absorbed in the molecular form from the ...... by the plants. Ans. Water 67. Elements which are required in large quantities by the plants are called ...... Ans. Macronutrients 68. Carbon is absorbed by the plant as ...... from the air. Ans. Carbon dioxide 69. Elements which are required by the plants in minute quantities are called ...... Ans. Micronutrients 70. Sundew is an ...... plant. Ans. Insectivorous 71. Absorption of mineral ions is a selective process and takes place ...... concentration. Ans. Against 72. The conversion of ammonia to nitrates is called ...... Ans. Nitrification

475

73. Abbreviation NPK means ...... Ans. (Nitrogen, Phosphorus and Potassium) 74. The technique of culturing plants in nutrient solutions is known as……. Ans. Hydroponics 75. Drought spot apples is caused by the deficiency of…………. Ans. Boron 76. The deficiency of copper in citrus results in disease is known as ...... Ans. Exanthema 77. The deficiency of ...... causes the death of the stem and root apices. Ans. Calcium 78. ...... helps in the conversion of oxalic acid into calcium oxalate in plant cells. Ans. Calcium 79. The deficiency of magnesium results in ...... chlorosis in the plants. Ans. Interveinal 80. Photosynthesis is processed by which green plant trap ...... energy and convert it into ...... the energy of carbohydrates. Ans. Solar, Chemical 81. RuBP carboxylase, in the presence of high concentration of ...... acts as oxygenase. Ans. Oxygen 82. In C4 pathway pyruvic acids generated in the cells and is transferred back to ...... Ans. Mesophyll 83. All the pigments are located in ...... membranes of chloroplast. Ans. Thylakoid 84. The radioactive spots on chromatogram can be located by ...... Ans. Radioautography 85. Biochemical mechanism for photorespiration is also called ...... metabolism. Ans. Glycolate 86. Cell division and ...... are important aspects of growth and development. Ans. Differentiation

476

Plant Physiology: Question Bank

87. Term ...... is applied to indole acetic acid (IAA). Ans. Auxin 88. ...... of leaves and fruits lead to leaf fall and fruit fall. Ans. Abscission 89. IBA is stands for ...... Ans. Indole Butyric Acid 90. Gibberellins stimulate stem elongation and leaf ...... Ans. Expansion 91. In the conjunction with auxins, ...... stimulate cell division even in non– meristematic tissues. Ans. Cytokinins 92. Ethylene is associated with the process of ...... of plant organs. Ans. Aging 93. The dormant seeds germinate when ...... is overcome by gibberellins. Ans. ABA 94. ABA is also acts as ...... hormone. Ans. Stress 95. Gibberellins induce stem elongation in ...... plants. Ans. Rosette 96. The movements in Mimosa pudica is an example of ...... change. Ans. Turgor 97. ...... is the phenomenon by which the synthesis of a set of enzymes leading to a product is shut down, when the product is provided from outside. Ans. Repression 98. In bacteria, regulation of gene expression is usually effected through ...... Ans. Operons 99. ...... are arranged in linear order on chromosomes. Ans. Genes 100. The protein coat of virus is called ...... Ans. Capsid 101. Phages infect the ...... cells. Ans. Bacterial

102. The genes and polypeptide codes are for collinear was proved by ...... Ans. Charles Yanofsky 103. Viruses are ...... obligate parasites. Ans. Intracellular 104. One gene one enzyme hypothesis has been changed to ...... Ans. One gene one polypeptide chain principle 105. Gene mutations alter the information conveyed by a ...... Ans. 1933 106. Extra nuclear genes are usually present in mitochondria and ...... Ans. Gene 107. A pair of genes may be identified as a linked if their recombination frequency is lower than expected value of ...... percent. Ans. Plastids 108. When a particular chromosome is present in three copies, the cell is a ...... Ans. Fifty 109. When a fragment of chromosome rejoins in reverse orientation, mutation is called ...... Ans. Trisomic 110. Morgan received the nobel prize in ...... for his pioneering work in genetics. Ans. Inversion 111. Transmission of a trait from father to daughter then to grandson is called ...... Ans. Criss-Cross inheritance 112. Mutant Drosophila with white eyes was found by ...... Ans. Morgan 113. Human females are homogametic and males are ...... Ans. Heterogametic 114. Crossing over occurs at ...... stranded stage. Ans. Four 115. When there are more than two sets of genomes in a cell, the cells is said to be ...... Ans. Polyploid

System Physiology: Plant

116. The inborn errors of metabolism are gene controlled and are inherited in Mendelian fashion was pointed by ...... Ans. Sir Archibold Garrod 117. Three examples of chemical mutagens are ......, ...... and ...... Ans. Acridine dyes, mustard gas and base analogues 118. More the ...... between two genes, more are the chances of ...... Ans. Distance, Crossing over 119. Linkage and crossing over are ...... related. Ans. Inversely 120. Jacob and Wollman named hereditary particles as ...... which can exist in the cell as exists chromosomal elements. Ans. Plasmids 121. A chromosome having more than two chromatids is called ...... Ans. Polytene 122. Crossing over occurs in ...... of prophase-I in meiosis. Ans. Pachytene 123. Genes that shuffle from one location to another are called ...... Ans. Jumping genes 124. The formation of a peptide bond is catalyzed by the enzyme ...... Ans. Peptidyl Transferease 125. ...... has the shape of clover leaf. Ans. tRNA 126. ...... in RNA replaces thymine in DNA. Ans. Uracil 127. One gene one enzyme concept is now more accurately refered to as one ...... one ...... concept. Ans. Gene, Polypeptide

477

128. ...... is a segment of DNA strand on which a new strand is produced. Ans. Template 129. A sequence of three nitrogen bases that code for an amino acid is a ...... Ans. Codon 130. ......, ...... is the process in which information is carried from RNA to DNA in some viruses. Ans. Reverse Transcription 131. The unidirectional flow of genetic information from DNARNA protein is referred to as the ...... in molecular biology. Ans. Central Dogma 132. New strands of DNA are formed only the ...... direction. Ans. 5’–3’ 133. ...... are enzymes that unwind DNA helicase while ...... break and reseal the strands. Ans. Helicase, Topoisomerases 134. The experiments on DNA using 15 N isotope proved that the replication is ...... Ans. Semiconservative 135. A nucleotide consists of a ......, a ...... and a nitrogen base. Ans. Sugar, Phosphate 136. The DNA molecule takes a complete turn after every ...... base pairs. Ans. Ten 137. ...... is the technique by which the 3–dimensional structures of macromolecules can be studied. Ans. X-ray analysis

478

Plant Physiology: Question Bank

Model Test Papers (c) Deckar effect (d) Hexose monophosphate shunt

MODEL PAPER 1

1. Growth is measured by: (a) Osmometer (b) Auxanometer (c) Potometer (d) Clinostat

7. Photorespiration: (a) Occurs because oxygen rather than carbon dioxide links to the RuBisCo enzyme in the Calvin cycle (b) Occurs more in C4 than in C3 plants under identical conditions (c) Describes the uptake of carbon dioxide and the release of oxygen in chloroplasts (d) All of the above 8. In photorespiration, glycolate and glyoxylate are produced sequentially in the following organelles. (a) Chloroplast and mitochondria (b) Chloroplast and peroxisome (c) Peroxisome and mitochondria (d) Peroxisome and chloroplast 9. When RuBisCo acts as an oxygenase? (a) Phosphoglycerate and phosphoglycolate are produced (b) Phosphoenolpyruvate is oxidized (c) Net carbon fixation is enhanced (d) It must mean that the plant is deprived of CO2 10. Which of the following statements best supports the fact that photorespiration, commonly occurs in C3 plants? (a) C 3 plants do not possess kranz anatomy

2. In plants, growth is: (a) Irreversible (b) Increase in weight (c) Change in volume (d) All of these 3. An example of growth showing increase in volume without increase in weight is: (a) Pollen germination (b) Fruiting (c) Drooping (d) Defoliation 4. It is possible to produce larger fruits by: (a) Increasing nutrient supply (b) Increasing water supply (c) Hormone application (d) Defoliation 5. Hormones differ from vitamins in: (a) Decreasing maturity (b) Increasing maturity (c) Showing movements (d) Increasing temperature 6. Inhibition of photosynthesis in the presence of O2 in C3 plants is called: (a) Pasteur affect (b) Warburg effect Ans.

1. (b)

2. (d)

3. (a)

4. (c)

5. (c)

6. (b) 478

7. (a)

8. (b)

9. (a)

Model Test Papers

(b) C 3 plants have usually high CO 2 compensation species (c) C 3 plants are less efficient in photosynthesis (d) C3 plants are characterized by RuBP oxygenase activity under high oxygen supply 11. Chlorophyll in the membrane of the thylakoid is: (a) All directly active in photosystem I and II (b) Embedded in the lipid via hydrophobic side chain (c) Not associated with membrane protein (d) Present entirely as Chl a 12. The pigment molecules responsible for photosynthesis bare located in the: (a) Cytoplasm of the cell (b) Stroma of the chloroplast (c) Thylakoid membrane of the chloroplast (d) All of the above 13. Antenna pigments: (a) Are bound specifically in pigment – protein complexes (b) Absorb light energy and transfer it efficiently to the reaction center (c) Often include carotenoids and/or xanthophylls (d) All of the above 14. Consider the following pigments. The characteristic photosynthetic pigments present in chlorophyceae would include: (a) Chl b (b) Carotene (c) Chl a (d) All 15. A carotenoid-less mutant plant was grown under normal sunlight, it will experience: (a) Increased photosynthetic rate (b) Increased chlorophyll biosynthesis (c) Reduced photorespiration (d) Increased chlorophyll oxidation and necrosis Ans.

10. (d)

11. (b)

12. (c)

13. (d)

14. (d)

479

16. Essential elements are: (a) Not required for normal reproduction (b) Not replaceable by other elements (c) Not directly involved with metabolism (d) Required only in those metabolic processes leading to increased growth 17. Choose the mismatch. Mineral Function nutrient (a) B Cell elongation (b) Mo N2 fixation (c) Na C3 pathway (d) Cl Photolysis of water 18. Choose the incorrect pair: Mineral Deficiency symptom nutrient (a) Nitrogen Chlorosis nutrient (b) Zinc Reduction in intermodal growth (c) Nickel Accumulation of urea (d) Sodium Whiptail disease 19. Which of the following is an incorrect match of essential and function? (a) Manganese—structural component of chlorophyll (b) Calcium—component of the middle lamella (c) Zinc—enzyme activator (d) Iron—component of ferredoxin 20. Legume root nodules contain leghemoglobin. Its function is to regulate: (a) Expression of nif genes (b) Dinitrogenase activity (c) Oxygen supply (d) Nodule growth 21. Which of the following statements is correct about diffusion? (a) It is very rapid over long distances (b) It requires an expenditure of energy by the cell 15. (d)

16. (b)

17. (c)

18. (d)

19. (a)

20. (c)

480

Plant Physiology: Question Bank

(c) It is a passive process (d) It occurs when molecules move from a region of lower concentration to one of higher concentration 22. Osmosis is a form of diffusion in which: (a) The solute moves freely from a region of higher concentration to one of higher concentration through a semipermeable membrane (b) The solvent moves through a semipermeable membrane from region, where a solute is in higher concentration to region of lower concentration (c) The solvent moves through a semipermeable membrane from higher solvent concentration to lower solvent concentration (d) Solute as well as solvent moves freely from a region of higher concentration to one of higher concentration through a semipermeable membrane 23. I place a cell in a solution. Over a period of time, I notice that the cell shrinks, as if it is losing water which of the following seems likely? (a) The solution is a strong buffer (b) The solution is an acid (c) The solution has more dissolved solutes than the cell does (d) The solution has more dissolved solutes than the cell does 24. Water potential: (a) Of a solution is always greater than for pure water (b) Is the potential energy of water in a system (c) Is a measure of the level of the active movement of water a system (d) Is never zero 25. If a plant cell is placed in deionized water the potential of that cell becomes: Ans.

21. (c)

22. (c)

23. (c)

24. (b)

25. (d)

(a) More positive because the pressure potential becomes more positive (b) More positive because the osmotic potential becomes more negative (c) More positive because the pressure potential becomes more negative (d) Less negative because the pressure potential becomes more positive 26. Which of the following statement(s) is/ are correct? (a) Water lost by transpiration is pure water (b) The cause of guttation is mainly root pressure (c) Rate of transpiration is dependent upon vapor pressure deficit (d) All the above statement are correct 27. Which statement concerning stomatal function is false? (a) To close stoma, potassium ions diffuse passively out of the guard cells (b) When stomata are about to open, potassium ions are actively transported into the guard cells from the surrounding cells of the epidermis (c) Stomata are open when the turgor pressure of the guard cells decreases (d) Low levels of carbon dioxide stimulate the opening of stomata 28. Below are given some statements related to transpiration in plants. Which of the following statement is correct? (a) The major function of stomata in plants is transpiration (b) The movement of water during transpiration is due to adhesion of water to the xylem walls (c) Maximum stomatal transpiration occurs of green light (d) All of the above 29. Stomatal pores open when: (a) H+ ions are pumped into the guard cells 26. (d)

27. (c)

28. (d)

Model Test Papers

(b) K+ ions are pumped out the guard cells (c) Water moves into guard cells in response to a decrease in water potential in the guard cells (d) Water moves out guard cells in response to a decrease in water potential in the guard cells 30. Which of the following statement is incorrect? (a) A root concentrates minerals by active transport (b) To develop root pressure, energy is used to actively transport minerals into root cells (c) Excretion of minerals is not a function of transpiration (d) High carbon dioxide concentrations cause stomata to open 31. A source of extrinsic information is: (a) DNA (b) RNA (c) Vitamin (d) Hormones 32. Growth continuously takes place in: (a) Meristem (b) Shoot tip (c) Cambium (d) Flowers 33. The growth is maximum during: (a) Exponential phase (b) Log phase (c) Lag phase (d) Stationary phase 34. A standard growth curve of plant is: (a) Eclipse (b) Straight (c) Pyramidal (d) Sigmoidal 35. What emerges first during seed germination? (a) Plumule (b) Rachis (c) Radical (d) Hypocotyls 36. C4 plants are able to minimize photorespiration because C4 plants (a) Do not carry-out the Calvin cycle (b) Use a more efficient enzyme to initially fix CO2 (c) Exclude Calvin cycle (d) None Ans.

29. (c) 40. (b)

30. (d) 41. (a)

31. (d) 42. (b)

32. (a) 43. (a)

33. (a)

481

37. Pyruvate to form oxaloacetic acid in: (a) Pea (b) Sugarcane (c) Pinus (d) Apple 38. PEP carboxylase is: (a) Involved in at least some CO 2 fixation in both C3 and C4 plants (b) Catalyzes the reaction fixing CO2 into pyruvic avid in bundle sheath cells (c) Capable of fixing CO 2 more efficiently at lower atmospheric CO2 concentrations than RuBP carboxylase (d) The most adundant enzyme in the world 39. In C4 pathway, the site for oxidative decarboxylation is: (a) Cytoplasm of bundle sheath (b) Chloroplast of mesophyll cell (c) Chloroplast of bundle sheath (d) Cytoplasm of mesophyll cell 40. Conversion of pyruvate into PEP by use of ATP in C4 pathway occurs in: (a) Mesophyll cell’s cytoplasm (b) Mesophyll cell’s chloroplast (c) Bundle sheath cell’s cytoplasm (d) Bundle sheath cell’s chloroplast 41. Photo-oxidation of chlorophyll is prevented by: (a) Carotenoid (b) Anthocyanin (c) Phycobilin (d) Funcoxanthin 42. Antenna pigments transfer light energy to a reaction center: (a) By means of a process known as fluorescence (b) By means of a process known as inductive resonance (direct transfer of energy) (c) By the conduction of heat (d) All of the above 43. Which pigment will have higher absorbance in red region? (a) Chl a (b) Chl b (c) Both (a) and (b) have same absorbance (d) Carotene 34. (d)

35. (c)

36. (b)

37. (b)

38. (c)

39. (c)

482

Plant Physiology: Question Bank

44. Some bacteria contain extensive internal membranes that are involved in specific function. One example of such membranes is chromatophores, which are: (a) Photosynthetic membranes where light is convert to chemical energy in the form of ATP (b) Convolution of the inner membrane that extend into the interior of the mitochondrion (c) Internal membranes where inorganic nitrogen containing compounds oxidize to generate ATP (d) Internal compartment of chloroplast where fixation of CO2 occurs 45. Colors of light most useful in photosynthesis are: (a) Green, yellow and orange (b) Red, violet and blue (c) Infrared, red and yellow (d) Red, white and blue 46. Total energy requirement for fixing one CO2 by combined C4 and C3 cycle is: (a) 5 ATP + 4 NADPH (b) 3 ATP + 4 NADPH (c) 5 ATP + 2 NADPH (d) 8 ATP + 2 NADPH 47. How many ATP are required for the conversion of one N2 to 2NH+4 during nitrogen fixation? (a) 8 ATP (b) 10 ATP (c) 12 ATP (d) 16 ATP 48. Conversion of NO–3 to NO–2 occurs in plant cell. Which of the following is correct? (a) Occur in the cytosol (b) Catalyzed by nitrate reductase (c) Requires Mo and FAD as cofactor (d) All of the above 49. Carnivorous adaptations of plants mainly compensate for soil that has a relatively low content of: Ans.

44. (a)

45. (b)

46. (c)

47. (d)

48. (d)

(a) Potassium (c) Phosphate

(b) Nitrogen (d) Calcium

50. A mineral deficiency is likely to affect older leaves more than younger leaves if: (a) The mineral is a micronutrient (b) The mineral is very mobile within the plant (c) The mineral is required for chlorophyll synthesis (d) The deficiency persists for a longtime 51. Which of the following would be likely to develop deficiency symptoms? (a) A plant growing in a tropical rainforest with associated mycorrhizae (b) Cacti growing in the desert (c) A plant growing naturally on calcareous soil (d) A crop plant growing in a field that has been cultivated for many years 52. Which of the following is correct about nitrate reductase? (a) FAD, Mo and heme act as prosthetic groups (b) Catalyzes conversion of NO 3– to NH4+ (c) FADH2 acts as electron donor (d) Very sensitive to O2 53. The sap of a plant cell has an osmotic potential of –10 bars and there is a wall pressure of 2 bars. When this cell is placed in a solution with an osmotic potential of –3 bars the force causing water to enter the cell is: (a) –8 bar (b) –7 bar (c) –5 bar (d) –3 bar 54. A root cortex cell has a solute potential of –0.5 MPa. The water potential of the soil is –0.3 MPa. At what turgor pressure would the root cortex cell no longer take up water? 49. (b)

50. (b)

51. (c)

52. (a)

53. (c)

Model Test Papers

(a) 0 MPa (c) +0.15 MPa

(b) –0.15 MPa (d) +0.2 MPa

iii. Instrument used to measure the atmospheric pressure iv. Amount of osmosis per unit time (a) i. Potometer ii. Monometer iii. Porometer iv. Osmometer (b) i. Potometer ii. Monometer iii. Porometer iv. Osmometer (c) i. Manometer ii. Potometer iii. Porometer iv. Osmometer (d) i. Potometer ii. Porometer iii. Manometer iv. Osmometer

55. A limp lettuce leaf has an osmotic potential = –4 MPa. The lettuce leaf is placed into a beaker of pure water. When the cells of the lettuce leaf are fully turgid the water potential of the leaf cells will be: (a) +4 MPa (b) +8 MPa (c) –4 MPa (d) 0.0 MPa 56. Space between cell wall and plasma membrane in a plasmolyzed cell is occupied by: (a) Pure water (b) Air (c) Cell sap (d) Plasmolyzing solution 57. In a flaccid cell: (a) DPD = OP (b) DPD = TP (c) DPD = OP – TP (d) None 58. Most of the water taken up by the plant is: (a) Split during photosynthesis as a source of electrons and hydrogen (b) Lost by transpiration through stomata (c) Absorbed by cells during their elongation (d) Incorporated directly into organic material 59. Which of the following statement(s) is/ are incorrect? (a) Classical theory of opening and closing of stomata by sayre and scarth is based on change in pH (b) Pigments which absorbs blue light in guard cell is zeaxanthin (c) Radial micellation on guard cell is made up of cellulose microfibril (d) None 60. The correct match is: i. Instrument used to measure transpiration pull ii. Instrument used to measure the size red of stomata Ans.

54. (d) 65. (b)

55. (d)

56. (d)

57. (a)

58. (b)

483

61. If you put a cell into pure water form a wilted plant, which of the following will happen? (a) More water molecules will move out of the cell than moves in (b) There will be no change in the concentration of water inside or outside of the cells (c) More water will move into the cell than moves out (d) The cell will plasmolyze 62. Auxin B was first isolated by: (a) Miller and Skoog (b) Kogl, Erxlaben and Haagen-Smit (c) Kogl and Sumuki (d) None of these 63. The principal and naturally occurring auxin in higher plant is: (a) IBA (b) IAA (c) NAA (d) MH 64. Bouncy nature of plant is maintained by drastic pruning which causes the deficiency of: (a) Auxin (b) Gibberellins (c) Vitamin (d) Cytokinin 65. Biological activity of IAA tested by: (a) Glycin max callus test (b) Avena curvature test (c) Xanthium leaf disc test (d) All of these 66. When GA induced tall plant is crossed with pure tall plant, the phenotypic ratio of F2 generation is likely to be: 59. (d)

60. (d)

61. (c)

62. (b)

63. (b)

64. (a)

484

Plant Physiology: Question Bank

(a) 25% tall and 75% dwarf (b) 75% tall and 25% dwarf (c) 50% tall and 50% dwarf (d) None of these 67. Consider the following compounds: (a) Phosphoenol pyruvate (b) Malic acid (c) Pyruvic acid (d) Oxaloacetic acid 68. Total energy requirement for fixing one CO2 by combined C4 and C3 cycle is: (a) 5 ATP + 4 NADPH (b) 3 ATP + 4 NADPH (c) 5 ATP + 2 NADPH (d) 8 ATP + 4 NADPH 69. In which of the following cells of a C3 leaf would you find the highest concentration of enzyme 3 RuBisCo? (a) Epidermal cell (b) Mesophyll cell (c) Bundle sheath cell (d) Both (b) and (c) 70. Which of the following are true of C4 photosynthesis? (a) It seems to be advantageous in cooler climates (b) It has high compensation point for CO2 (c) Similar to the CAM photosynthesis pathway (d) All of the above 71. By decreasing photorespiration and efficiently carrying out photosynthesis, C4 plants can: (a) Reduce stomatal opening and thus reduce leaf temperature (b) Reduce stomatal opening and thus increase water loss (c) Increase stomatal opening and thus increase water loss (d) Increase stomatal opening and thus increase transpiration rates Ans.

66. (b)

67. (d)

68. (d)

69. (b)

70. (c)

72. A cell at incipient plasmolysis, with a solute potential of –2000 KPa, is placed in a solution of water potential –1200 KPa. The direction of flow of water will be: (a) From cell to solution (b) From solution to cell (c) Data incomplete (d) No flow of water 73. If both leaf water potential and leaf osmotic potential in mid afternoon on a hot summer day equals – 15 bars: (a) The leaf is probably wilted (b) The whole plant is at the permanent point (c) Leaf cells have highest wall pressure (d) The soil is at the plant’s permanent wilted point 74. Which of the following plays no role in the movement of water through the xylem of plants? (a) Capillarity (b) Root pressure + (c) H /ATPase pump at the xylem element membrane (d) Transpirational pull 75. Water cohesion: (a) Creates the pulling force which pulls water upward in the xylem (b) Causes water to move from the xylem into the phloem in response to differences in water concentration (c) Is an energy requiring process (d) Is responsible for making the column of water 76. The class of water in the soil, that provides most of the water of plants and is thus the most important, is: (a) Gravitational (b) Field capacity (c) Capillary (d) Hygroscopic 77. In passive absorption water is absorbed due to: (a) Exosmosis (b) Osmosis 71. (b)

72. (b)

73. (a)

74. (c)

75. (d)

Model Test Papers

(c) Transpiration pull (d) None of these 78. Most widely accepted explanation for ascent of sap in plant is: (a) Role of atmospheric pressure (b) Capillary theory (c) Transpiration cohesion theory (d) Imbibition theory 79. The ultimate cause of water movement against the gravity is: (a) Diffusion (b) Osmosis (c) Transpiration (d) Imbibitions 80. Passive absorption of water by the root of a plant is affected by: (a) OP of root hairs (b) TP of root hairs (c) Transpiration tension (d) Anatomy of root 81. Which of the following contributes most to transport of water from the ground to the leaves of a tree? (a) Shoot pressure (b) Root pressure (c) Transpiration pull (d) Capillary water 82. Dwarfness of the plant can be controlled by treating it with: (a) IAA (b) IBA (d) GA (c) C2H2 83. Charles Darwin discovered auxin while working on: (a) Pisum sativum (b) Canary grass (c) Carrot grass (d) Oat 84. Which one of the following is an antiauxin substance? (a) NTA (b) DCA (c) TIBA (d) All of the above 85. Actinomycin D inhibits: (a) Transcription (b) Translation (c) Replication (d) Translocation 86. Puromycin, chloramphenicol and cycloheximide inhibit: (a) Translation (b) Transcription (c) Translocation (d) None of these Ans.

76. (c) 87. (d)

77. (c) 88. (b)

78. (c) 89. (b)

79. (c) 90. (c)

80. (c) 91. (b)

485

87. C4 plants are abundant in: (a) Temperate region with more humid conditions (b) Temperate region with more dry conditions (c) Tropical region with more humid conditions (d) Tropical region with more dry condition 88. A C3 mustard plant, was grown at 300 ppm of CO 2 14 hr light/10 hr dark cycles, it was transferred to 1000 ppm CO2. This will lead to (other environmental parameters remaining identical): (a) Increase in photosynthetic rate (b) Decrease in photosynthetic rate (c) Increase in respiration rate (d) No change 89. CAM plants have an adapted photosynthetic process that primarily allows them to: (a) Survive more efficiently in humid conditions (b) Survive arid conditions (c) Fix carbon dioxide during the day and night (d) Prevent the enzyme RuBisCo from being denatured 90. Which of the following plant shows diurnal change in malic acid content in vacuoles and popularly known as dark fixer? (b) C3 plants (a) C4 plants (c) CAM plants (d) Plant showing hexose monophosphate shunt 91. In CAM plants, CO 2 acceptor in the night is: (a) RUBP (b) PEP (c) OAA (d) PGA 92 Thomas Engelmann illuminated a filament of algae with light that passed a prism, thus exposing different segment of the algal filament to 81. (c)

82. (d)

83. (b)

84. (d)

85. (a)

86. (a)

486

Plant Physiology: Question Bank

different wavelengths of light. He add aerobic bacteria and found that these bacteria congregated in the areas illuminated by red and blue light. If you run the same experiment without passing light through a prism, would you predict? (a) There would be no difference in results (b) The number of bacteria would decrease along the entire length of the filament (c) The bacteria would be relatively evenly distributed along the length of the filament (d) The number of bacteria would increase along the length of the filament 93. Photosynthetic yield will be more in: (a) Continuous red light (b) Continuous blue light (c) Intermittent white light (d) Green 94. When DCPIP (Hill reagent) accepts electron from H2O, its color change to: (a) Blue (b) Red (c) Colorless (d) None 95. The experiment material used by van Neil, to prove that O2 comes out from water was: (a) Chlorella pyrenoidosa (b) Scendesmus (c) Blue green algae (d) Chromatium vinosum 96. Halophytes such as mangroves meet high osmotic pressures in the soil. They overcome the problem of water uptake by: (a) Increase in the root to shoot ratio (b) Reduction in the number of stomata to reduce transpiration (c) Accumulation of electrolytes in the vacuoles (d) Growth at relatively high humidity to reduce transpiration Ans.

92. (c) 3. (a)

93. (c)

94. (a)

95. (d)

96. (c)

97. Root pressure is a/an: (a) Nonosmotic phenomenon (b) Osmotic phenomenon (c) Positive hydrostatic pressure (d) More than one correct 98. Which of the following statement is correct? (a) Members of gymnosperm show high root pressure (b) Actively transpiring plants show high root pressure (c) Root pressure is mainly responsible for ascent of sap (d) None 99. Transpiration pull depends on: (a) Adhesion of water molecules to the walls of phloem cells (b) Capillarity (c) The very negative water potential of the atmosphere (d) Cohesion of water molecules to each other 100. The source of energy driving the transport of water through the xylem is: (a) ATP produced by photosynthesis (b) ATP generated by respiration (c) The sun (d) Transpiration MODEL PAPER 2

1. Classical growth experiments were earlier performed by: (a) Lamarck and Darwin (b) Darwin and Paal (c) Darwin and Fleming (d) All of these 2. The classical Avena curvature test was performed by (a) F Skoog (b) FW Went (c) S Miller (d) None of these 3. The natural plant hormones were first isolated from: (a) Human urine and corn germ oil 97. (d)

98. (d)

99. (c) 100. (c)

1. (b)

2. (b)

Model Test Papers

(b) Human urine and wheat plant (c) Human urine and rice plant (d) None of these 4. The most common plant hormone indole, 3-acetic acid was first isolated from: (a) Corn germ oil (b) Almond oil (c) Human urine (d) Castor oil 5. Which one of the following elements plays important role in the biosynthesis of auxin? (a) Fe (b) Zn (c) B (d) Ca 6. Amino acid tryptophan is used as precursor for the synthesis of: (a) ABA (b) GA (c) IAA (d) C2H2 7. A plant hormone showing polar translation is: (a) Auxin (b) C2H2 (c) GA (d) None of these 8. Flowering in ananas and nephelium is increased by: (a) IAA and IBA (b) GA and IAA (c) Zeatin and kinetin (d) NAA and 2-4 D 9. Sprouting of potatoes is prevented by: (a) Auxin (b) Methylester of NAA (c) Kinetin (d) Zeatin 10. The main site of auxin production in plant is: (a) Root apex (b) Shoot apex (c) Root meristem (d) None of these 11. In crassulacean acid metabolism (CAM) plants: (a) Phosphoenolpyruvate carboxylase reduces CO2 to make malic acid (b) Vascular tissue is surrounded by a bundle sheath (c) Vascular tissue is surrounded by a bundle sheath (d) RuBisCo is activated only at night Ans.

4. (c) 15. (a)

5. (b) 16. (d)

6. (c) 17. (c)

7. (a)

8. (d)

487

12. Which of the following incorporate CO 2 into organic acids, and then release it for use in the Calvin cycle? (b) C4 plants (a) C3 plants (c) C3 and CAM plants (d) C4 and CAM plants 13. Which of the following plant species have highest photosynthetic yield? (a) Species possessing CAM pathway (b) Species possessing C3 pathway (c) Species possessing C4 pathway (d) Same for all 14. At low CO2 concentration, photosynthesis is limited by: (a) The carboxylation capacity of RuBisCo (b) Ability of calvin cycle enzyme to regenerate RuBP (c) ATP + NADPH (d) All of the above 15. When photosynthesis rate is plotted as a function of temperature, the graph will be: (a) Bell shape (b) Sigmoid (c) Straight line (d) None of these 16. According to British plant physiologist FF Blckman’s law of limiting factor, at any given time. Photosynthesis can be limited by: (a) Light (b) CO2 concentration (c) Both (a) and (b) (d) Either by light or by CO2 17. Which of the following statements about the Calvin cycle are true? (a) It regenerates the ribulose 1,5bisphosphate consumed by the RuBisCo reaction (b) It forms glyceraldehyde 3-phosphate, which can be converted to fructose 6-phosphate (c) It requires ATP and NADPH (d) It consists of enzymes, which can be activated through reduced thioredoxin 9. (b)

10. (b)

11. (a)

12. (d)

13. (c)

14. (a)

488

Plant Physiology: Question Bank

18. The total requirement of ATP and NADPH for each molecule Of CO 2 fixed and reduced in photosynthesis in the Calvin cycle is: (a) 2 ATP and 2 NADPH (b) 2 ATP and 3 NADPH (c) 3 ATP and 2 NADPH (d) 4 ATP and 3 NADPH 19. Chloroplasts are disrupted and the stroma separated from the lamellae. The isolated stroma will fix CO if is supplied with: (a) Oxygen (b) Carotenoid (c) Light (d) ATP+NADPH 20. In Calvin cycle, RuBisCo incorporates CO 2 into ribulose 1,5 bisphosphate which rapidly splits into: (a) Glyceraldehydes-3-phosphate (b) 2,3-phosphoglyceric acid (c) 3-phosphoglycerate (d) 1,3-diphosphoglycerate 21. The Orbanche plant is: (a) Partial parasite (b) Total root parasite (c) Symbiont (d) Total stem parasite 22. Epiphytes are the plants which are dependent on other plants: (a) Only for water (b) For water and food (c) Only for food (d) Only for shelter (support) 23. An example of a parasitic plant that is also strictly epiphytic is: (a) Cuscuta (Dodder) (b) Viscum (Mistletoe) (c) Rafflesia (d) Orbanche 24. Which of the following is an example of insectivorous plants? (a) Brassica (b) Cuscuta (c) Mucor (d) Nepenthes 25. Which of the following is an insectivorous plant? Ans.

18. (c) 29. (c)

19. (d) 30. (c)

20. (c) 31. (c)

21. (b)

22. (d)

(a) Cuscuta (b) Orbanche (c) Drosera (d) Rafflesia 26. Plant such as ‘sundew’ and ‘pitcher plant’ are termed: (a) Carnivorous (b) Parasitic (c) Symbiotic (d) Autotrophic 27. Insectivorous plants: (a) Are heterotrophic (b) Cannot manufacture their own protein (c) Only get supplementary protein food (d) Cannot manufacture their food other than carbohydrates 28. Which of the following is obtained by insectivorous plants from animal bodies? (a) O2 (b) CO2 (c) N2 (d) SO2 29. The insects captured by the insectivorous plants partially fulfil their requirement of: (a) Enzymes (b) Oxygen (c) Nitrogen (d) Water 30. Insectivorous plants grow in soil which are deficient in: (a) Calcium (b) Water (c) Nitrogen (d) Magnesium 31. The water within xylem vessels moves toward the top of a tree (long distances) as a result of: (a) Atmospheric pressure on roots (b) Active transport of ions into the vascular bundle (c) Evaporation of water through stoma (d) The force of root pressure 32. Which combination of characteristic of a vessel element is most important for water movement in the xylem? (a) Rigid cell wall, cell death at maturity, end walls absent (b) Rigid cell wall, reduction in size of plastids and mitochondria, end walls present 23. (b)

24. (d)

25. (c)

26. (a)

27. (c)

28. (c)

Model Test Papers

(c) Rigid cell wall, living cell membrane, and walls absent (d) Flexible cell wall, nucleus anchored to the cell membrane, end walls present 33. Which of the following properties of water is most directly related to its ability to rise in the capillary spaces of plants? (a) Neutral pH (b) High density (c) Low compressibility (d) High surface tension 34. Which of the following observations shows that ion uptake in plants is energy dependent? (a) Ion uptake shows saturation kinetics (b) Ion uptake rates are different for different ions (c) Some ions accumulate against a concentration gradient (d) Some ions enter the symplast before reaching the endodermis 35. How does a plant accumulate ions from the soil, which has a lower concentration than that in the plant? (a) Applies pressure to push ions into the cell (b) Applies tension to pull the ions into the cell (c) Expends energy to transport ions against concentration gradient (d) Roots grow around soil particles trapping the ions in a cell 36. Which statement about the function of the casparian strip is correct? (a) It prevents excess transpiration from leaves (b) It regulates ions movement into root vascular cylinder (c) It prevent disease causing organisms from invading the plant (d) It is the pathway for nutrient transfer from xylem to phloem Ans.

32. (c)

33. (d)

34. (c)

35. (c)

36. (b)

489

37. Mark the correct statements: (a) Resistance to water flow in root cortex will be higher for symplastic pathway (b) Major pathway followed by ions from the epidermis to tracheary element of root is symplastic (c) The casparian strip prohibits H2O from passing through the apoplast (d) Absorption of ions in plants is controlled by carriers and pumps (e) All of the above 38. Ion absorption by plant roots: (a) Can be explained by the nutrient – carrier hypothesis (b) Is basically ions passively soaking in root cells along with soil water (c) Explains the movement of ions from a dilute soil solution into a more concertrated solution (d) More than one correct 39. When a cell membrane moves substances from a region of lower concentration to a region of higher concentration, and expends energy in the process, this type of movement is called: (a) Osmosis (b) Diffusion (c) Active transport (d) Facilitate diffusion 40. Ion absorption by symplast occurs: (a) Passively by facilitated diffusion (b) Actively by primary and secondary active transport (c) Passively by free diffusion (d) Both a and b 41. The most common type of transpiration found in plant is: (a) Stomatal (b) Cuticular (c) Lenticular (d) None of these 42. Plants wilt because of excessive: (a) Respiration (b) Photosynthesis (c) Transpiration (d) Absorption 37. (e)

38. (d)

39. (c)

40. (d)

41. (a)

42. (c)

490

Plant Physiology: Question Bank

43. Initial transpiration rate increases with increase in temperature and wind velocity but it slows down later because: (a) Of mechanical disturbances (b) Of chemical disturbance (c) Of closure os stomata (d) Water is not made available 44. Application of phenylmercuric acetate acts as a/an? (a) Hormones (b) Vitamins (c) Antitranspirant (d) Weedicide 45. In xerophytes the presence of thick cuticle scales and a few sunken stomata on the leaf is to: (a) Reduce transpiration (b) Increase transpiration (c) Protect from light (d) None of these 46. Temporary wilting in plants occurs when the rate of absorption is: (a) Equal to transpiration (b) Equal to respiration (c) Less than transpiration (d) Less than respiration

(a) Auxin (c) C2H2

(b) GA (d) None of these

51. The growth in subapical meristem is regulated by: (a) GA (b) IAA (c) IBA (d) Ethylene 52. Auxin is characterized by: (a) Apical dominance (b) Delay of abscission (c) Polar translocation (d) All of the above 53. It is possible to obtain good amount of tea leaves from a single plant by: (a) Removing the apical buds (b) Supplying auxin to the root and shoot apices (c) Feeding auxin by the roots of the plant (d) None of these 54. Apical dominance found in the plants is due to: (a) IBA in the shoot tip (b) IAA in the shoot tip (c) GA in the lateral buds (d) Kinetin in the leaf tip

47. Temporary wilting in plants occurs when the rate of absorption is: (a) Equal to transpiration (b) Equal to respiration (c) Less than transpiration (d) Less than respiration

55. Excurrent nature of trees like conifers including pinus is due to: (a) Presence of cambium (b) Presence of apical dominance (c) High concentration of GA (d) High concentration of IAA

48. Transpiration increases by: (a) High humidity (b) Low wind velocity (c) High light intensity (d) High temperature

56. Which of the following is related to apical bud dominance: (a) IAA (b) IBA (c) GA (d) Florigen

49. The amount of water usually lost in total transpiration is: (a) 55% (b) 66% (c) 75% (d) 98% 50. A substance which is synthesized at the tip of stem and regulates growth elsewhere is: Ans.

43. (c) 54. (b)

44. (c) 55. (b)

45. (a) 56. (a)

46. (c) 57. (b)

47. (c)

57. Pruning induces dense growth of hedges because: (a) Root sprouts additional branches (b) Apical dominance is removed (c) Injury induces dense growth (d) None of these 58. The famous Avena curvature test conducted by FW went proves that: 48. (b)

49. (d)

50. (a)

51. (a)

52. (d)

53. (a)

Model Test Papers

(a) ABA is a growth inhibitor (b) Auxin exercise apical bud dominance (c) Shoot apex is the site for the synthesis of growth regulation substance (d) All of the above 59. Light regulates distribution of auxin was experimentally demonstrated by: (a) Darwin (b) Skoog (c) Miller (d) Went and Thimann 60. Which of the following is the most adundant protein in leaves? (a) Chlorophyll a/b binding protein (b) ATP synthase (c) Ribulose-1,5 bisphosphate carboxylase (d) Globulins 61. If radioactive carbon dioxide (14CO2) is used in Calvin cycle then which carbon atom of 3-phosphoglycerate will appear radioactive? (a) Carbon 3 (b) Carbon 1 (c) Carbon 2 (d) None 62. The first carboxylation product of a C plant is: (a) Phosphoglyceric acid (b) Oxaloacetic acid (c) Malic acid (d) Phosphoglyceraldehyde 63. Which of the following statement is correct? RuBisCo: (a) Catalyzes the fixation of CO2 (b) Can function as an oxygenase (c) Is the most adundant protein on earth (d) All of the above 64. RuBisCo: (a) Catalyzes the carboxlation of CO2 to ribulose 1,5-bisphosphate (b) Initiates photorespiration when the CO2 /O2 ration is low (c) Catalyzes the reduction of two molecules of PGAL to form glucose (d) (a), (b) but not (c) Ans.

58. (c) 69. (c)

59. (d) 70. (d)

60. (c)

61. (b)

62. (a)

491

65. If asked to pinpoint precisely the site of synthesis of 3-phosphoglyceraldehyde in plants, you would have to say that it takes place within the: (a) Mesophyll (b) Grana (c) Stroma (d) Chloroplast 66. Which one of the following statement regarding photosynthesis is correct? (a) Light is absorbed by chlorophyll during Calvin cycle (b) Cyclic phosphorylation produces neither oxygen nor NADPH (c) The site of light reaction is the stroma of the chloroplast (d) NADPH and ATP are generated during the light independent phase to power Calvin cycle 67. During photosynthesis, the final product of the Calvin cycle is (a) Ribulose bisphosphate (b) Phosphoglycerate (c) Pyruvate (d) Glyceraldehyde-3-phosphate 68. Three molecules of RuBP in Calvin cycle are regenerated from: (a) 4 molecules of glyceraldehydes-3phosphate (b) 5 molecule of 3-phosphoglyceric acid (c) 5 molecule of glyceraldehydes-3phosphate (d) 6 molecules of glyceraldehyde-3phosphate 69. The final product of the Calvin cycle is: (a) RuBP (b) Phosphoglyceric acid (c) Phosphoglyceraldehyde (d) Glucose 70. Insectivorous plants are usually adapted to: (a) Water rich soils (b) Soil deficient in sugars (c) Soils rich in trace elements (d) Soils deficient in nitrogenous compounds 63. (d)

64. (d)

65. (c)

66. (b)

67. (d)

68. (c)

492

Plant Physiology: Question Bank

71. In some insectivorous plants, there is secretion of acidic enzymes by which trapped insects are killed and digested, this enzyme is: (a) Erepsin (b) Trypsin (c) Strypsin (d) Amylopsin 72. The small rootless aquatic herb in which a portion of the leaf forms a tiny sac or bladder which trap water insects is: (a) Dionaea (b) Utricularia (c) Sarracenia (d) Drosera 73. Insectivorous plant are called so because: (a) All insects eat these plants (b) They catch insects for food (c) They are herbivorous (d) Insects like such plants 74. Dionaea muscipula is commonly known as: (a) Butterwort (b) Venus fly trap (c) Water fly trap (d) Bladderwort 75. In Drosera, an insectivorous plant, the insect catching mechanism is: (a) Valvular arrangement in the bladder (b) Secretion of glandular hairs on the leaves (c) Pitcher covered with lid (d) Secretion of glandular hairs in the pitcher 76. The insectivorous plant having glandular structures on its leaf secretes sticky fluid is: (a) Venus fly trap (b) Sundew plant (c) Aldrovanda (d) Bladderwort 77. In ‘sundew’ (Drosera), the part of plant which attracts the insects is: (a) Leaf blade (b) Leaf apex (c) Leaf base (d) Leaf petiole 78. Which one is an organic nutrient? (a) Protein (b) Calcium (c) Cellulose (d) Vitamin Ans.

71. (b) 82. (e)

72. (b) 83. (e)

73. (b) 84. (a)

74. (b)

75. (b)

79. In Nepenthes, the pitcher is modified: (a) Leaf apex (b) Leaf base (c) Leaf petiole (d) Leaf blade 80. In plant roots, the casparian strip is correctly described by which of the following? (a) It is located in the walls between endodermal cells and cortex cells (b) It provides energy for the active transport of minerals into the vascular bundle from the cortex (c) It ensures that all minerals are absorbed from the soil in equal amounts (d) It ensures that all water and dissolved substances must pass through a cell before entering the vascular bundle 81. Ion transport in root occurs (a) Passively through channels (b) Actively through channels (c) Actively through carriers (d) Through both symplast and apoplast (e) all 82. Ion channels (a) Always require ATP in order to function (b) Are always open (c) Are integral membrane proteins (d) Are responsible for the selective permeability of a membrane (e) Both (c) and (d) 83. The casparian strip: (a) Limits the pathway available to water and solutes, forcing them to enter the symplast (b) Surrounds the root vascular tissue (c) Allows water to move down a water potential gradient (d) Is made of suberin (e) All of the above 84. Water potential of soil at field capacity is: (a) – 0.3 bars (b) –4 bars (c) – 6 bars (d) – 8 bars 76. (b)

77. (a)

78. (b)

79. (d)

80. (d)

81. (e)

Model Test Papers

85. Maximum density of water is exist as: (a) 0°C (b) 4°C (c) 40°C (d) 100°C 86. Water potential of chemically pure water is: (a) – 0.1 MPa (b) – 0.5 MPa (c) – 1 MPa (d) Zero 87. Purple cabbage leaves do not lose their color in cold water but do so in boiling water because: (a) The plasma membrane gets killed in boiling water (b) The cell is killed in boiling water (c) The pigment is not soluble in cold water (d) The cell is killed in cold water 88. Osmosis involves: (a) Cell to cell movement of water (b) Movement of water through cortical cells (c) Active absorption of water through (d) All of these 89. In osmosis, solvent flows from: (a) Its lower concentration to its higher concentration (b) Its higher concentration to its lower concentration (c) Its higher concentration to its higher concentration (d) None of these 90. Osmotic pressure is highest in: (a) Hydorphyte (b) Halophytes (c) Xerophytes (d) Mesophyte 91. The real force leading to the entry of water into a cell from other cell is: (a) Diffusion pressure deficit (b) Turgor pressure (c) Wall pressure (d) Osmotic pressure 92. The value of DPD of a cell is: (a) OP × TP (b) OP + TP (c) OP – TP (d) None of these 93. When all cell is fully turgid, which of the following is zero? Ans.

85. (b) 96. (c)

86. (d) 97. (d)

87. (a) 98. (a)

88. (d) 99. (c)

89. (b)

493

(a) Osmotic pressure (b) Turgor pressure (c) Diffusion pressure deficit (d) None of these 94. Two important functions of leaves are: (a) Photosynthesis and respiration (b) Transpiration and phototropism (c) Photosynthesis and transpiration (d) Photosynthesis and guttation 95. Which of the following factors affect temperature and rainfall condition? (a) Transformation (b) Transpiration (c) Photosynthesis (d) Translocation 96. Which one of the following helps in holding the leaves in position and soft stems to stay erect? (a) Stomatal cells (b) Rigidity of the cell wall (c) Turgidity of cells (d) Transpiration 97. Which one is not related to transpiration? (a) Regulation of plant body temperature (b) Absorption and distribution of mineral stalk (c) Circulation of water (d) Bleeding 98. Water potential in the leaf cells is positive during: (a) Excessive transpiration (b) Low transpiration (c) Excessive absorption (d) Guttation 99. Transpiration pull depends on: (a) Adhesion of water molecules to the walls of phloem cells (b) Capillarity (c) The very negative water potential of the atmosphere (d) Cohesion of water molecules to each other 100. Guttation can be easily observed in colocasia growing in: 90. (b)

91. (d)

92. (c)

93. (c)

94. (c)

95. (b)

494

Plant Physiology: Question Bank

(a) Asom (c) Rajasthan

(b) Uttar Pradesh (d) Uttarakhand

(a) Induction of cell division (b) Promotion of cell elongation (c) Promotion of leaf fall (d) Inhibition of cell elongation

MODEL PAPER 3

1. Auxin is commercially used to induce: (a) Shooting of woody part (b) Rooting of woody part (c) Callus formation (d) Stem curvature 2. A higher concentration of auxin: (a) Induces fruiting (b) Kills the plant (c) Induce intermodal elongation (d) Promotes flowering 3. A higher concentration of synthetic auxins are used for: (a) Induces intermodal elongation (b) Preventing growth of lateral buds (c) Weed control (d) Inducing flowering 4. Which one of the following is a natural auxin? (a) IAA (b) IBA (c) GA (d) GA3 5. Which one of the following hormones if concerned with the root initiation? (a) IAA (b) IBA (c) NAA (d) GA 6. Removal of apical bud during flowering results in: (a) Promotion of apical branching (b) Promotion of lateral branching (c) Death of plant shoot (d) Elongation of mainstem 7. Which one of the following techniques is used for the separation and identification of phytohormones? (a) Autoradiography (b) Cell fractionation (c) Gas chromatography (d) None of these 8. One of the following is not a character of auxin: Ans. 100. (a) 11. (c)

1. (b) 12. (d)

2. (b) 13. (a)

3. (c) 14. (c)

4. (a)

9. Gibberellins was first extracted from: (a) Triticum (b) Gigartina (c) Gelidium (d) Fusarium 10. Elongation of genetically dwarf plants is possible by: (a) IAA (b) IBA (c) GA (d) C2H2 11. Production of one molecule of 3phosphor-glyceraldehyde requires how many turns of the Calvin cycle? (a) 1 (b) 2 (c) 3 (d) 6 12. Calvin cycle represents which of the following phenomenon? (a) Oxidative carboxylation (b) Substrate level phosphorylation (c) Dark respiration (d) Reductive carboxylation 13. Which of the following is not a regulatory factor of carbon fixation? (a) The level of acetyl-CoA in the chloroplast stroma (b) The levels of ATP and NADPH in the stroma (c) pH of the stroma (d) Magnesium level in the stroma 14. Which of these statements about thioredoxin is correct? (a) It contains a heme that cycles between two oxidation states (b) Its oxidized form predominates while light absorption is taking place (c) It activates some biosynthetic enzymes by reducing disulfide bridges (d) It activates some biosynthetic enzymes by reducing disulfide bridges 5. (c)

6. (b)

7. (c)

8. (c)

9. (d)

10. (c)

Model Test Papers

15. Synthesis of sucrose during photosynthesis occurs in: (a) Chloroplast (b) Cytosol (c) Vacuoles (d) Amyloplast 16. Which of the following statement is correct with respect to the synthesis of starch and sucrose in plants? (a) Starch is synthesized in the mitochondria and sucrose in the cytosol (b) Starch is synthesized in the cytosol and sucrose in the chloroplast (c) Starch is synthesized in the chloroplast and sucrose in the mitochondria (d) Starch is synthesized in the chloroplast and sucrose in the cytosol 17. In C4 plants, the C4 cycle begins with the PEP and CO 2 reaction in the presence of: (a) PEP carboxylase (b) Pyruvic acid (c) RuBP (d) Oxidation phosphorylase 18. C 4 plants differ from C3 plants with respect to: (a) Number of ATP used (b) Substrate which accepts the CO 2 molecule (c) The final product (d) None of these 19. Photorespiration takes place only in: (a) Green parts of the plant (b) All the living cells of the plant (c) Mitochondria (d) Roof 20. In C4 plants, initial CO2 fixation takes place in the chloroplasts of: (a) Guard cells (b) Spongy mesophyll (c) Palisade tissue (d) Bundle sheath 21. Choose the incorrect statement: (a) CO 2 fixation in C 3 plants reaches saturation at much lower light intensities then C4 plants Ans.

15. (b)

16. (d)

17. (a)

18. (b)

19. (a)

495

(b) Optimum temperature for C 4 photosynthesis is higher as compared to C3 photosynthesis (c) C3 plants are able to use water move efficiently than C4 plants (d) Under ideal conditions, the rate of photosynthesis in C4 plants is 2–3 times that of C3 plants 22. Peroxisomes are present: (a) Abundantly in mesophyll cells of C3 and C4 plants (b) Abundantly in bundle sheath cells of C3 and C4 plant (c) Mostly in mesophyll cells of C 3 plants and bundle sheath cells in C4 plants (d) Mostly in bundle sheath cells of C3 plants and mesophyll cells of C 4 plants 23. Most C4 plants are native to: (a) Aquatic habitats (b) Mesic habitats (c) Xeric habitats (d) Nothing can be said definitely 24. Warburg effect is due to: (a) Competition of CO 2 and O 2 for enzyme RuBP carboxylase (b) Competition of CO 2 and O 2 for enzyme PEP carboxylase (c) Competition of CO2 and N2 for PEP carboxylase (d) Competition of CO2 and O2 for both RuBP carboxylase and PEP carboxylase 25. Which of these is not a characteristic feature of C4 plants as compared to C3 plants: (a) They are more efficient in utilizing low levels of CO 2 in the external environment (b) They have greater ability to use water efficiently (c) They have greater rates of net photosynthesis at high temperatures (d) None of these 20. (b)

21. (c)

22. (c)

23. (c)

24. (a)

25. (c)

496

Plant Physiology: Question Bank

26. In which portion of the chloroplast, pH is lowest when sunlight is on the chloroplast: (a) Stroma (b) Cytosol (c) Space enclosed by inner and outer membranes (d) Space enclosed by thylakoid membranes 27. Phosphorylation in chloroplasts most similar to which of the undermentioned mitochondrial reactions: (a) Oxidative phosphorylation (b) Substrate level phosphorylation (c) Oxidative decarboxylation (d) Hydrolysis 28. Light waves slightly shorter than violet (380 nm) are ineffective for photosynthesis because: (a) Break weak bonds (b) Cause all atoms in the cell to lose electrons (c) Do not pack enough energy to raise an electron to a higher orbital (d) All the above 29. Light waves shorter than 200 nm are not useful for photosynthesis because these: (a) Break weak bonds (b) Cause all atoms in the cell to lose electrons (c) Do not pack enough energy to raise an electron to a higher orbital (d) All the above 30. Chlorophyll a is abundant pigment in: (a) Photosystem I (b) Photosystem II (c) Both photosystem I and II (d) Neither photosystem I nor II

(b) Organic matter of the plant (c) Both the mineral salts and organic matter (d) None of the above 33. Which group of elements is not essential for a normal plant: (a) Potassium, calcium, magnesium (b) Iron, zinc, manganese, boron (c) Lead, nickel, iodine, sodium (d) Magnesium, iron, molybdenum 34. Which one of the following is not an essential element for plants? (a) Iron (b) Zinc (c) Potassium (d) Iodine 35. An essential element is one which: (a) Is available in soil (b) Improves plant growth (c) Is indispensable and irreplaceable for growth (d) In present in plant ash 36. Most abundant elements in a living cell are: (a) C, O, H, N (b) C, O, S, P (c) C, O, N, S (d) C, O, H, P 37. Micronutrients: (a) Are as important as macronutrients (b) Are less important than macronutrients (c) Are called ‘micro’ as they play only a minor role in plant nutrition (d) May be omitted from culture media without any detrimental effects on the plants 38. An independent role in energy metabolism is: (a) Li (b) Ca (c) P (d) Na

31. Chlorophyll b is more abundant than chlorophyll a in: (a) Photosystem I (b) Photosystem II (c) Both photosystem I and II (d) Neither photosystem I nor II

39. Which of the following elements is responsible for maintaining turgor: (a) Na (b) K (c) Ca (d) Mg

32. The plant ash is an indication of: (a) Mineral salts absorbed by the plant

40. Premature leaf fall is caused due to the deficiency of:

Ans.

26. (d) 37. (a)

27. (a) 38. (c)

28. (a) 39. (d)

29. (b)

30. (a)

31. (b)

32. (a)

33. (c)

34. (d)

35. (c)

36. (a)

Model Test Papers

(a) Potassium (c) Nitrogen

(b) Calcium (d) Phosphorus

41. The element which is required in largest quantities by plant is: (a) Nitrogen (b) Calcium (c) Sulfur (d) Phosphorus 42. Osmotic pressure is highest in: (a) Hydorphyte (b) Halophytes (c) Xerophytes (d) Mesophyte 43. The value of DPD of a cell is: (a) OP × TP (b) OP + TP (c) OP – TP (d) None of these 44. When all cell is fully turgid, which of the following is zero? (a) Osmotic pressure (b) Turgor pressure (c) Diffusion pressure deficit (d) None of these 45. The maximum value of DPD is equal to: (a) TP (b) WP (c) OP (d) All of these 46. In a plasmolyzed cell, the DPD is: (a) Equal to OP (b) Zero (c) Less than WP (d) Equal to WP 47. If a cell with OP = 5 and TP = 4 is surrounded by cell with OP = 3 and TP = 1, what will be the direction of water movement? (a) From cell A to other cells (b) From other cells to cell A (c) Water will move up (d) Water will not move up 48. Which of the following is correct? (a) DPE = OP × WP (b) WP = OP – DPD (c) OP = WP – DPP (d) DPD = WP – OP 49. Osmotic pressure depends upon: (a) Concentration of solute (b) Ionization of solute (c) Temperature (d) Both a and b (e) all Ans.

40. (c) 51. (c)

41. (a) 52. (b)

42. (b) 53. (a)

43. (c) 54. (b)

44. (c) 55. (c)

497

50. Water pontential can be obtained by: (a) TP – OP (b) OP = WP (c) OP – TP (d) OP – DPD 51. The effective adaptation for better gaseous exchange in plants is: (a) Waxy cuticle (b) Large number of hairs of lower surface (c) Presence of stomata on lower surface of leaf (d) All of the obove 52. Increase in CO2 concentration around the leaf results in stomatal: (a) Opening (b) Partial closure (c) Complete closure (d) No effect 53. Conversion of starch into organic acid is essential for: (a) Stomatal opening (b) Stomatal closure (c) Stomatal growth (d) Stomatal initiation 54. Phenylmercuric acetate: (a) Increase transpiration rate (b) Decrease transpiration rate (c) Reduce respiration rate (d) Reduce photosynthesis 55. Guttation is caused due to: (a) Osmosis (b) Transpiration (c) Root pressure (d) Shoot pressure 56. In which of the following plants would metabolism be hindered if the leaves are coated with wax on their upper surface? (a) Dydrilla (b) Spirullina (c) Nelumbo (d) Pistia 57. The primary osmolite which causes an opening and closing of stomata is: (a) Sugar (b) Carbohydrate (c) K-malate (d) Lipid 58. If ABA is sprayed on leaves, the stomata will: (a) Close (b) Open (c) Burst (d) No response 45. (c) 56. (c)

46. (a) 57. (c)

47. (a) 58. (a)

48. (b)

49. (e)

50. (a)

498

Plant Physiology: Question Bank

59. A change in guard cells responsible for opening of stomata is the: (a) Decrease in OP and TP (b) Increase in TP and WP (c) Increase in OP and TP (d) None of these 60. Stomata open at night and close during daytime in: (a) Halophyte (b) Hydrophyte (c) Xerophytes (d) Succulents 61. Elongation of subapical meristem is induced by: (a) IAA (b) NAA (c) Kinetin (d) GA 62. Induction of male flowers on genetically female plant is possible by application of GA in: (a) Carica (b) Coccinia (c) Cannabis (d) None of these 63. In which of the following monoecious plants GA promotes formation of male flowers? (a) Cuscuta (b) Cucurbita (c) Cannabis (d) All of these 64. Habit of cabbage can be drastically changed by application of: (a) IAA (b) GA (c) ABA (d) All of these 65. Stomatal closure in response to leaf stress is mediated by: (a) IAA (b) IBA (c) ABA (d) None of these 66. Gibberellins are characterized by: (a) Increasing amylase activity (b) Removal of genetic dwarfism (c) Decrease amylase activity (d) Induction of genetic dwarfism (e) Both (a) and (b) 67. Which hormone is responsible to cause bakane disease of rice? (a) GA (b) IAA (c) IBA (d) Ethylene Ans.

59. (c) 70. (a)

60. (d) 71. (b)

61. (d) 72. (d)

62. (c) 73. (c)

63. (b) 74. (b)

68. Who discovered that foolish seedling disease of rice is caused by a fungus? (a) Skoog (b) Miller (c) Yabuta (d) Kurosawa 69. The major role sites of GA production in higher plants are: (a) Roots (b) Embryos (c) Leaves (d) All of these 70. The mutant dwarf varieties of pea and corn can be made to elongate by the application of: (a) GA (b) IAA (c) IBA (d) Ethylene 71. Which element is essential for photolysis of water: (a) Nitrogen (b) Chlorine (c) Carbon (d) Oxygen 72. NADPH is generated through: (a) Anaerobic respiration (b) Glycolysis (c) Photosystem I (d) Photosystem II 73. Chlorophyll a molecule has as its carbon atom 3 of the pyrrole ring II: (a) Magnesium (b) Aldehyde group (c) Methyl group (d) Carboxylic group 74. The core metal of chlorophyll molecule is: (a) Nickel (b) Magnesium (c) Iron (d) Copper 75. An aquatic plant was placed in a test tube containing distilled water and the tube was stoppered. The tube was left outdoors for 24 hours and the pH value of the water was measured at a regular intervals. What results must have been observed? (a) The pH value was lowest just before sunrise (b) The pH value was highest just before sunrise (c) The pH value was lowest at noon 64. (b) 75. (a)

65. (c)

66. (e)

67. (a)

68. (d)

69. (d)

Model Test Papers

(c) Green algae (d) Slime moulds

(d) The pH value was lowest just before sunset 76. Most plants are green in color because: (a) Green light is the most effective wavelength region of the visible spectrum for photosynthesis (b) The atmosphere filters off all the colors of the visible light spectrum except green (c) Chlorophyll is least effective in absorbing green light (d) Green light allows maximum photosynthesis 77. According to Munch hypothesis, osmotic pressure remains high in the mesophyll cells due to: (a) Accumulation of salts brought by xylem (b) Accumulation of food brought by phloem (c) Synthesis of soluble carbohydrates due to photosynthesis (d) Conversion of starch into sugar 78. Assimilatory powers produced during photosynthesis are: (a) H2O and O2 (b) RuBP and RuMP (c) C6H12O6 and PGAL (d) ATP and NADPH2 79. Which of the followings events the photo-oxidation and destruction of pigments: (a) Phycocyanin (b) Carotenoids (c) Phycoerythrin (d) Phytochrome 88. What happens in photosystem II: (a) CO2 fixation (b) CO2 reduction (c) Photolysis of HO2 (d) All of these 81. Which of these uses basically cyclic photophosphorylation for synthesizing sugar: (a) All photoautotrophs (b) Photosynthetic bacteria Ans.

76. (c)

77. (c)

78. (d)

79. (b)

80. (c)

499

82. Plants do not store carbohydrates in the form of glucose because: (a) Glucose dissolves in water thereby altering the osmotic balance (b) Glucose attracts insects herbivores (c) Glucose in an unstable molecule (d) Glucose would replace ribose in DNA synthesis 83. The layer of cytoplasm lining the vertical walls of sieve elements: (a) Provides a differentially permeable membrane across which a difference in sugar concentration is maintained (b) Is the site of active transport of sugar molecules during loading and unloading (c) Permits the osmosis of water to take place across it (d) All the above are true 84. Photosynthesis is process by which the plants prepare food materials in the way: (a) Carbohydrates are formed using CO 2 and H 2O in the presence of sunlight with the help of chlorophyll (b) Carbohydrates are formed using CO 2 and H 2 O with the help of chlorophyll (c) Carbohydrates are formed by the use of CO2 and H2O (d) Carbohydrates are formed using CO2 in the presence of sunlight 85. Photosynthesis is process in which: (a) CO2 is reduced to carbohydrate (b) NADH is reduced to NAD (c) ATP is generated (d) Oxidative phosphorylation occurs 86. Nine tenth of all the photosynthesis is the world is carried out by: (a) Chlorophyll containing ferns of the forests 81. (b)

82. (a)

83. (d)

84. (a)

85. (a)

500

Plant Physiology: Question Bank

(b) Scientists in the laboratories (c) Algae of the oceans (d) Large trees with millions of branches and leaves 87. Photosynthesis is mainly responsible for the existence of: (a) Animals on this earth (b) Plants on the earth (c) Both (a) and (b) (d) None of the above 88. Total amount of the dry weight of Photosynthates produced by all types of plants per annum is: (a) 1.7 million tones (b) 17 million tones (c) 170 million tones (d) 1700 million tones 89. Which of the following is a macronutrient? (a) Mn (b) Mg (c) Zn (d) Cu 90. The framework elements of plants are: (a) Magnesium, copper and iron (b) Copper, carbon and oxygen (c) Manganese, calcium and nitrogen (d) Carbon, hydrogen and oxygen 91. Which of the following is a macronutrient? (a) Ca (b) Mo (c) Zn (d) Mn 92. Mg++ and Fe ++ are needed by plants for: (a) Energy transfer (b) Chlorophyll synthesis (c) Carbohydrate translocation (d) Stomatal opening 93. Which of the following is a micronutrient? (a) Calcium (b) Phosphorus (c) Copper (d) Magnesium Ans.

86. (c) 97. (a)

87. (c) 98. (b)

88. (d) 99. (c)

89. (b) 1. (c)

90. (d)

94. A microessential element is one which: (a) Is less important than the major essential elements (b) Is more important than the major essential elements (c) Is present small quantities in the soil (d) Is needed in very small amounts but is as important as major essential element 95. Which one of the following nutrient serve as microelements for plant growth: (a) Manganese, copper, calcium (b) Sodium, potassium, boron (c) Sodium, nickel, chlorine (d) Copper, molybdenum, zinc 96. When chlorophyll is burnt, which one is obtained? (a) Fe (b) Mg (c) Both (a) and (b) (d) Ca and Mn 97. A plant material is dried and burnt in a crucible, the residue would contain: (a) Oxides and carbonates of about ten elements (b) Carbon and phosphorus (c) Nitrates and sulfates only (d) Oxides and carbonates of Ca and Mg only 98. Which of the following elements has not been proved to be essential for plants? (a) Potassium (b) Sodium (c) Zinc (d) Iron 99. Elongation of genetically dwarf plants is possible by: (a) IAA (b) IBA (c) GA (d) C2H2 MODEL PAPER 4

1. The property of GA for inducing seed germination is counteracted by: (a) IAA (b) IBA (c) ABA (d) Ethylene 91. (a)

92. (b)

93. (c)

94. (d)

95. (d)

96. (b)

Model Test Papers

2. For successful production of bonsai plants, a heavy pruning of root system is regularly carried out. The underlying principle is to induce: (a) Deficiency of ethylene (b) Deficiency of cytokinin (c) Deficiency of mineral nutrients (d) None of these 3. When tendril of a climbing plant touches an object, it twins around it. It shows: (a) Geotropism (b) Phototropism (c) Thigmotropism (d) Chemotropism 4. The movement of insect catching hairs found in Drosera is: (a) Geotropism (b) Thigmonastic (c) Thermostatic (d) Epinastic 5. The movement observed in a telegraph plant is an example of: (a) Thigmotropism (b) Phototropism (c) Movement of variation (d) None of these 6. Maple and elm are example of: (a) Shoot senescence (b) Leaf senescence (c) Sequential senescence (d) Synchronous senescence 7. Wounding of plant organs results in: (a) Increased respiration (b) Increased photosynthesis (c) Decrease respiration (d) No effect on respiration 8. Mark the correct statement: (a) Albinism is genetical while etiolation is physiological (b) Etiolation is genetical (c) Etiolation is irreversible (d) All of the above 9. Growth of pollen tube towards ovule is an example of: (a) Chemotropism (b) Phototropism (c) Geotropism (d) Thigmotropism Ans.

2. (b) 13. (d)

3. (c) 14. (b)

4. (b) 15. (c)

5. (c) 16. (c)

6. (d) 17. (d)

501

10. Which one of the following is not a short-day plant? (a) Soybean (b) Tomato (c) Potato (d) Radish 11. Phenomenon of photoperiodism was discovered by: (a) Garner and Allard (b) Skoog and Miller (c) Blackman and Hill (d) Warburg 12. Permentation and anaerobic respiration differ in: (a) Fermentation is entracellulae (b) Fermentation occurs in microbes (c) Both (a) and (b) (d) Fermentation occurs in virus 13. RQ is maximum when substrate is: (a) Glucose (b) Protein (c) Fats (d) Maleic acid 14. When oxygen is utilized in other metabolic process, then the value of RQ will be: (a) Less than one (b) More than one (c) Unity (d) Zero 15. The rate of respiration, on placing the leaves in a sugar solution: (a) Increases steadily (b) Increases rapidly (c) Remain constant (d) Decreases rapidly 16. Kerb’s cycle is connected with the: (a) Formation of lactic acid from glucose (b) Formation of ATP from ADP (c) Changes in pyruvic acid to release energy (d) Formation of pyruvic acid from glucose 17. What is the importance of respiration in plants? (a) It liberates energy (ATP) (b) It provides oxygen to plants (c) It librates carbon dioxide (d) All the above 7. (a)

8. (a)

9. (a)

10. (d)

11. (a)

12. (c)

502

Plant Physiology: Question Bank

18. ATP  ADP conversion release: (a) 2000 calories (b) 12000 calories (c) 1000 calories (d) 800 calories

(b) Chlorophyll a and b are found in equal proportion in leaves of most plants (c) Chlorophyll a is found less than chlorophyll b in leaves of most plants (d) Chlorophyll b is found tenfold more than chlorophyll a in leaves of most plants

19. Enzymes responsible for fermentation is: (a) Ligase (b) Lipase (c) Zymase (d) Renase 20. Respiratory quotient (RQ) is: (a) Ratio between NH3 and O2 (b) Ratio between CO2 and O2 (c) Ratio between CO2 and H2O (d) Ratio between H2O and NH3

27. Chlorophyll b is present in: (a) Prokaryotes (b) Eukaryotes (c) Both (a) and (b) (d) Bacteria

21. RQ indicates: (a) Duration of respiration (b) Nature of substrate (c) Nature of environment (d) All of these 22. Photorespiration occurs only: (a) In rain (b) In dark (c) In light (d) In cloudy days 23. The chemical formula for chlorophyll a is: (a) C55H72O6N4Mg (b) C55H70O5N4Mg (c) C55H72O5N4Mg (d) C55H70O5Mg 24. The correct molecular formula for chlorophyll b is: (a) C55H72O4N3Mg (b) C55H70O6N4Mg (c) C55H70O5N4Mg (d) C55H77O6N4Mg 25. The main difference between chlorophyll a and b is: (a) Chlorophyll a is a linear chain compound and b is branched chain (b) Chlorophyll a has no Mg + ion in center of molecule (c) In chlorophyll a there is –CH 3 group whereas in b, it is –CHO group (d) All of the above 26. Which one of the following statements is correct for chlorophyll a: (a) Chlorophyll a is found more than chlorophyll b in leaves of most plant Ans.

18. (b) 29. (b)

19. (c) 30. (c)

20. (b) 31. (c)

21. (b) 32. (b)

22. (c) 33. (a)

28. For chlorophyll formation in plants, elements needed are: (a) Sodium and copper (b) Calcium and potassium (c) Iron and magnesium (d) Iron and calcium 29. Which one is the precursor of chlorophyll? (a) Tryptophan (b) Protochlorophyll or chlorophyllides (c) Bacteriochlorophyll (d) Bacterioviridin 30. Chlorophyll absorbs: (a) Red light only (b) Blue light only (c) Blue as well as red light (d) Green light 31. Which color of light gives maximum absorption peak by chlorophyll a: (a) Yellow (b) Red (c) Blue (d) Green 32. The wavelength of green light is: (a) 400–450 nm (b) 500–580 nm (c) 660–720 nm (d) 720–800 nm 33. Etiolated plants are formed due to lack of: (a) Light (b) Hg (c) Fe (d) Mg 34. The role of molybdenum is: (a) Chromosome contraction 23. (c)

24. (b)

25. (c)

26. (a)

27. (b)

28. (c)

Model Test Papers

(b) Carbon assimilation (c) Nitrogen fixation (d) Flowering induction 35. The mineral element essential for N2-fixation and N2-metabolism is: (a) Zn (b) Mo (c) Mn (d) B 36. Deficiency of Mo causes: (a) Yellowing of leaves (b) Mottling and necrosis of leaves (c) Poor development of vasculature (d) Bending of leaf tip 37. Technique of growing plants without soils, in nutrient solutions is called: (a) Parthenogenesis (b) Hydroponics (c) Aquaculture (d) Tissue culture 38. Hydroponics are cultures of plant in: (a) Soil (b) Soil-less condition (c) Light (d) Nutrients 39. EDTA is much used in tissue cultures, it is a: (a) Hormone (b) Vitamin (c) Buffer (d) Nutrient 40. Fertilizers have formulae consisting of three figures as 8, 10, 10. These figures stand for percentages of: (a) Magnesium, iron, potassium (b) Calcium, iron , boron (c) Nitrogen, phosphorus, potassium (d) Magnesium, manganese, sulfur 41. Which of the following elements is not absorbed by plants from soil? (a) Carbon (b) Nitrogen (c) Hydrogen (d) Boron 42. Which one following is not required by plants for their normal healthy growth? (a) Cobalt (b) Calcium (c) Lead (d) Iron 43. Presence of phosphorus in a plant: (a) Retards protein formation (b) Promotes fruit ripening Ans.

34. (c) 45. (d)

35. (b) 46. (b)

36. (b) 47. (d)

37. (b) 48. (b)

38. (b) 49. (a)

503

(c) Brings about healthy root growth (d) None of these 44. Die back disease of citrus is caused by: (a) Fungus (b) Bacteria (c) Virus (d) Cu-deficiency 45. Rapid deterioration of root and shoot tips occurs due to the deficiency of: (a) Phosphorus (b) Nitrogen (c) Cobalt (d) Calcium 46. On the basis of symptoms of chlorosis in leaves a student inferred that this was due to deficiency of nitrogen. This inference could be correct only if yellowing appeared first in: (a) Old leaves followed by young leaves (b) Young leaves (c) Old leaves (d) None of these 47. Cytochrome oxidase contains: (a) Co (b) Na (c) Mg (d) Fe 48. Plastocyanin is a protein containing: (a) Ca (b) Cu (c) Mg (d) Fe 49. Absence of Mg +2 ions from plant tissue result in: (a) Chlorosis (b) Plasmolysis (c) Necrosis (d) Hydrolysis 50. Sickle leaf disease occurs due to deficiency of: (a) P (b) K (c) Fe (d) Mg 51. Sulfur is the constituent of: (a) Valine (b) Lucine (c) Proline (d) Methionine 52. Khaira disease of rice is the consequence of: (a) Boron deficiency (b) Mo deficiency (c) Zn deficiency (d) Calcium deficiency 53. Yellowing and premature fall of the leaves is due to the deficiency of: 39. (c) 50. (a)

40. (c) 51. (c)

41. (a) 52. (c)

42. (c)

43. (a)

44. (d)

504

Plant Physiology: Question Bank

(a) Ca (c) P or K

(b) S or Mg (d) N

54. On the basis of symptoms of chlorosis in leaves a student inferred that this was due to the deficiency of nitrogen. This inference could be correct only, if yellowing of leaves appeared first in: (a) Young leaves (b) Old leaves (c) Young leaves followed by old leaves (d) Old leaves followed by young leaves 55. Which of the following essential elements do terrestrial plants take exclusively from the air? (a) Nitrogen (b) Phosphorus (c) Potassium (d) Carbon 56. Guttation is commonly found in: (a) Xerophytes (b) Halophytes (c) Hydrophytes (d) Mesophytes 57. From epithem hydathode, the water oozes out by: (a) Imbibitions pressure (b) Root pressure (c) Osmotic pressure (d) All of these 58. Stomata are more widely open in: (a) Far red light (b) Green light (c) Blue light (d) Orange light 59. Temporary wilting in plants occurs when the rate of absorption is: (a) Equal to transpiration (b) Equal to respiration (c) Less than transpiration (d) Less than respiration 60. The closure of stomata is affected by: (a) Auxin (b) ABA (c) IBA (d) GA 61. The main cause of permanent wilting is: (a) Rapid transpiration (b) Rapid translocation (c) Rapid photosynthesis (d) Poor availability of soil water Ans.

53. (d) 64. (c)

54. (d) 65. (c)

55. (d) 66. (b)

56. (d) 67. (b)

57. (b) 68. (b)

62. Stomatal movement is a kind of (a) Chemotactic movement (b) Nastic movement (c) Geotropic movement (d) Phototropic movement 63. Percentage of water left in the soil when a plant wilts is known as: (a) Field capacity (b) Respiration capacity (c) Wilting coefficient (d) Storage capacity 64. Guttation takes place through: (a) Stomata (b) Lenticles (c) Hydathodes (d) Wounds 65. The process which frequently takes place when temperature is low and root pressure is high is: (a) Respiration (b) Transpiration (c) Guttation (d) Evaporation 66. Henbane flowers when phytochrome is in: (b) P fr from (a) Px (c) Either of the two (d) None of these 67. Induction of flowering by low temperature is called: (a) Photoperiodism (b) Vernalization (c) Cryobiology (d) Photomorphogenesis 68. Flowering in long-day plants in favored by: (a) IAA (b) GA (c) IBA (d) ABA 69. Photoperiodism in plants is related to the formation of: (a) GA (b) ABA (c) Ethylene (d) Florigen 70. Phytochrome is associated with: (a) Absorption of far red light with wavelength 730 nm (b) Absorption of 660 nm and 730 nm in reversible manner 58. (c) 69. (d)

59. (c) 70. (b)

60. (b)

61. (d)

62. (b)

63. (c)

Model Test Papers

(c) Absorption of blue light with wavelength 630 nm (d) None of these

(vitamin C) solution browning does not occurs. This is because ascorbic acid: (a) Inhibit activity of polyphenal oxidase (PPO) (b) Overcomes cell injury caused by cutting (c) Prevento drying of cut surface (d) Prevents release of polyphenol from damaged cells

71. Flowering in short-day plant is induced by: (a) Short-night (b) Long-night (c) Short-photoperiod and interrupted long-night (d) All of the above 72. Pigment involved in photoperception in flowering is: (a) Carotene (b) Xanthophylls (c) Cytochrome (d) Phytochrome 73. Phytochrome is most frequently located in: (a) Old leaves (b) Young leaves (c) Flower (d) Only stem

505

80. Krebs cycle takes place in: (a) Vesicles of ER (b) Mitochondrial matrix (c) Dictyosomes (d) Lysosomes 81. The net gain of energy from one gram mole glucose during aerobic respiration is: (a) 2 ATP (b) 4 ATP (c) 38 ATP (d) 40 ATP

74. A plant which requires not less than ten hours of light to flower is a: (a) Long-day plant (b) Short-day plant (c) Day neutral plants (d) None of these

82. The universal hydrogen acceptor is: (a) NAD (b) ATP (c) COA (d) FMN

75. The pigment that absorbs both red and far red light is: (a) Carotene (b) Xanthophylls (c) Phytochrome (d) Chlorophyll

83. Different steps in respiration are controlled by: (a) Auxins (b) Sugars (c) Enzymes (d) Kinina

76. Phytochrome plays important role in: (a) Respiration (b) Transpiration (c) Flowering only (d) Both (b) and (c)

84. The ‘‘energy currency’’ of plants and animals is: (a) AMP or NADP (b) ATP (c) Chlorophyll or DNA (d) Caloric or RNA

77. Respiratory quotient (RQ) of germinating fat rich seed is: (a) Unity (b) More than unity (c) Less than unity (d) Zero 78. In plants energy is produced during the process of: (a) Phtosynthesis (b) Transpiration (c) Respiration (d) Water absorption 79. The cut surface of an apple fruit turns brown when in contact with air. If the cut apple is dipped in ascorbic acid Ans.

71. (b) 82. (a)

72. (d) 83. (c)

73. (a) 84. (b)

74. (a) 85. (a)

75. (b) 86. (c)

85. Substrate for photorespiration is: (a) Glycolate (b) Serine (c) Malaic acid (d) IAA 86. The incomplete breakdown of sugars in anaerobic respiration results in formation of: (a) Fructose and water (b) Glucose and carbon dioxide (c) Alcohol and carbon dioxide (d) Water and carbon dioxide 87. Synthesis of ATP in mitochondria requires: 76. (d)

77. (c)

78. (c)

79. (a)

80. (b)

81. (c)

506

Plant Physiology: Question Bank

(a) Oxygen (c) FMN

(b) NADP (d) Pyruvic acid

88. During ATP synthesis electrons pass through: (a) Water (b) Cytochromes (d) O2 (c) CO2 89. In Himalayan forest, nitrogen fixing bacteria is: (a) Azotobacter (b) Anabaena (c) Frankia (d) Nostoc 90. Existence of nitrogen fixing bacteria in soil was discovered by: (a) Robert Koch (b) Louis Pasteur (c) J Lister (d) SN Winogradsky 91. The enzyme responsible for the reduction of molecular nitrogen to the level of ammonia in leguminous root nodule is: (a) Nitrogenase (b) Nitrate reductase (c) Nitrite reductase (d) All of the above 92. The enzyme responsible for atmospheric nitrogen fixation is: (a) Nitrogenase (b) Hydrogenase (c) Oxygenase (d) Carboxylase 93. The microbial conversion of ammonia to nitrate is called: (a) Ammonification (b) Nitrification (c) Denitrification (d) Nitrogen fixation 94. Most plants obtain their nitrogen from the soil in the form of: (b) Nitrate (a) NO2 (c) Free nitrogen gas (d) Nitrogen oxide 95. Mineral salts which are absorbed by the roots from the soil are in the form of: (a) Dilute solution (b) Very concentrated solution Ans.

87. (a) 98. (d)

88. (b) 89. (c) 99. (c) 100. (d)

90. (d) 1. (d)

91. (a) 2. (c)

(c) Concentrated solution (d) Very dilute solution 96. An example of photosynthetic anaerobic nonsymbiotic nitrogen fixing bacterium is: (a) Azotobacter (b) Bacillus (c) Rhizobium (d) Rhodospirillum 97. Nonsymbiotic nitrogen fixers are: (a) Azotobacter (b) Blue-green algae (c) Soil fungi (d) Pseudomonas 98. Which one of the following bacteria has potential for nitrogen fixation: (a) Nitrosomonas (b) Nitrobacter (c) Nitrosococcus (d) Rhizobium 99. The biological process carried on by the rhizobium is called: (a) Nitrification (b) Ammonification (c) Nitrogen fixation (d) Fermentation 100. Which element has to be taken exclusively from extermal atmosphere by the terrestrial plant? (a) N (b) P (c) Mg (d) C MODEL PAPER 5

1. Dormancy in seeds is induced by: (a) IAA (b) IBA (c) GA (d) ABA 2. Positive photoblastic seeds can be made to germinate by the use of: (a) GA and IAA (b) GA and ABA (c) GA and cytokinin (d) None of these 3. Legume seeds exhibit dormancy because of: (a) Soft seed coat (b) Hard seed coat (c) Presence of GA (d) All of these 92. (a) 3. (b)

93. (b)

94. (b)

95. (d)

96. (d)

97. (a)

Model Test Papers

4. The factor that has less influence on seed germination of: (a) Light (b) Water (c) Temperature (d) CO2 5. The meaningful lights affecting phototropism are: (a) Orange and red (b) Red and blue (c) Red and far red (d) None of these 6. Opening and closing of flower is a kind of: (a) Tropic movement (b) Nastic movement (c) Tactic movement (d) None of these 7. Siesmonasty is the best shown by: (a) Oryza (b) Albizzia (c) Drosera (d) Biophytum 8. The respiratory enzymes are located in: (a) Mitochondrial matrix (b) Perimitochondrial space (c) Cristae (d) Outer membrane 9. Fermentation is: (a) Anaerobic respiration (b) Incomplete oxidation of carbohydrates (c) Complete oxidation of carbohydrates (d) None of the above 10. Respiration is: (a) Endothermic process (b) Exothermic process (c) Anabolic process (d) Endergonic process 11. RQ for fatly substance/fat is: (a) Unity (b) Less than one (c) Greater than one (d) Zero 12. RQ for glucose/carbohydrate is: (a) l (b) 0.5 (c) 2 (d) 0.05. 13. An indispensable role in energy metabolism is played by: Ans.

4. (a) 15. (d)

5. (b) 16. (a)

6. (b) 17. (c)

7. (d) 18. (c)

8. (a) 19. (a)

(a) Sodium (c) Calcium

507

(b) Phosphorus (d) Lithium

14. The amount of energy given by one mole of ATP is: (a) 7.3 kcal (b) 721 kcal (c) 7600 kcal (d) 1000 kcal 15. Krebs cycle starts with the formation of six carbon compound by reaction between: (a) Malic acid and acetyl CoA (b) Succinic acid and pyruvic acid (c) Fumaric acid and pyruvic acid (d) Oxaloacetic acid and acetyl CoA 16. Instantaneous source of energy is: (a) Glucose (b) Fats (c) Proteins (d) Amino acid 17. Chloroplasts fix: (a) O2 (c) CO2

(b) H (d) N2

18. Chloroplasts contain maximum quantity of: (a) Pyruvic carboxylase (b) Hexokinase (c) RUDP (RuBP) carboxylase (d) None of the above 19. Chlorophyll a is found in: (a) All O 2 releasing photosynthetic forms (b) All plants except fungi (c) All higher plants that photosynthesize (d) All photosynthetic prokaryotes and eukaryotes 20. In angiosperms, synthesis of chlorophyll occurs in the presence of : (a) Phytochrome (b) Light (c) Cytochrome (d) None of these 21. Leaves appear green because they: (a) Reflect green light (b) Absorb green light (c) Both (a) and (b) (d) None of the above 9. (a) 20. (b)

10. (b) 21. (a)

11. (b)

12. (a)

13. (b)

14. (a)

508

Plant Physiology: Question Bank

22. Which wavelength of light carries out photosynthesis in bacteria: (a) Red (b) Infrared (c) Ultraviolet (d) Blue 23. Photosynthetically active radiation is represented by the range of wavelength of: (a) 640–650 nm (b) 600–950 nm (c) 400–700 nm (d) 340–450 nm 24. The chlorophyll absorb visible light in region of the following wavelengths: (a) 400–500 nm only (b) 600–800 nm only (c) 400–500 nm and 600–700 nm (d) 300–400 nm only 25. Two pigment system theory of photosynthesis was proposed by: (a) Hill (b) Emerson (c) Balckmann (d) Hatch and Slack 26. Process in which green plants synthesize food is called: (a) Photorespiration (b) Photosynthesis (c) Respiration (d) Transpiration 27. Food in photosynthesis is made in the form of: (a) Proteins (b) Fats (c) Carbohydrates (d) Gils 28. Deficiency symptoms of elements in plants may vary from: (a) Individual to individual (b) Species to species (c) Genus to genus (d) Family to family 29. Essentiality of nitrogen for plant growth was first shown by: (a) Sachs (b) Knop (c) Arnon (d) Hoagland 30. In Arnon and Hoagland’s solution, iron was supplied as ferrous sulphate. Quite often it precipitated out. This Ans.

22. (b) 33. (c)

23. (c) 34. (b)

24. (c) 35. (b)

25. (b) 36. (a)

26. (b)

problem is solved by using which salt of EDTA: (a) Monosodium (b) Disodium (c) Trisodium (d) Polysodium 31. Macroelements are those which are present in plant tissues in concentration of at least: (a) 1 gm per gm dry matter (b) 0.1 gm per gm dry matter (c) 0.01 gm per gm dry matter (d) 0.001 gm per gm dry matter 32. A number of mineral elements serve as cofactors for enzymes. The most effective among these is: (a) Manganese (b) Chlorine (c) Sodium (d) Potassium 33. The bond in molecular nitrogen is difficult to break because: (a) It is twisted configuration (b) It is quadruple hydrogen bond (c) It is triple covalent bond (d) It is triple ionic bond 34. Nitrogen fixation by organisms require: (a) Highly alkaline conditions (b) Anaerobic conditions (c) Abundant sunlight (d) Water free conditions 35. The root nodules of legumes where N2 fixing bacteria live, are formed from cells of the: (a) Epidermis (b) Cortex (c) Endodermis (d) Vascular cylinder 36. Nitrogen is required by plants in all the regions but particularly in: (a) Meristematic tissues (b) Differentiating tissues (c) Roots (d) Organs undergoing senescence 37. Excessive amount of essential elements: (a) Increase the growth of plants (b) Do not increase the growth of plants 27. (c)

28. (b)

29. (a)

30. (b)

31. (d)

32. (d)

Model Test Papers

(c) Are wasted by plants (d) Are harmful for plants 38. An element required for pollen germination is: (a) Ca (b) Co (c) B (d) K 39. Which one of the following is essential for the evolution of oxygen in photosynthesis? (a) Ca (b) Mg (c) Cl (d) Fe 40. Which element is the constituent of cytochrome and ferredoxin, activates catalase and required for the synthesis of chlorophyll? (a) Fe (b) Ca (c) Mg (d) Co 41. Indian soil has mainly a deficiency of: (a) Zn (b) Mg (c) Ca (d) N 42. Leghemoglobin protects the activity of: (a) Amylase (b) Nitogenase (c) Catalase (d) Nitrate reductase 43. A nitrogen fixing cyanobacteria found in coralloid root of cycas is: (a) Spirulina (b) Anabaena (c) Aulosira (d) None of these 44. Nostoc is found developing symbiotic relationship with: (a) Virus (b) Bacteria (c) Fungi (d) Anthoceros 45. Nitosomonas converts: (a) NO3 into NO2 (b) HNO3 into NO3 (c) NH3 into NO2 (d) None of these 46. Ammonia is converted into nitrite in the soil by: (a) Nitrosococcus (b) Nitosomonas (c) Nitrococcus (d) None of these 47. Which bacteria oxidize nitrite in the soil by: (a) Nitosomonas (b) Nitrosococcus (c) Nitrococcus (d) Nitrobacter Ans.

37. (d) 48. (c)

38. (c) 49. (d)

39. (c) 50. (b)

40. (a) 51. (a)

41. (d) 52. (c)

509

48. A change in guard cells responsible for opening of stomata is the (a) Decrease in OP and TP (b) Increase in TP and WP (c) Increase in OP and TP (d) None of these 49. Stomata open at night and close during daytime in: (a) Halophyte (b) Hydrophyte (c) Xerophytes (d) Succulents 50. The guard cells differ from other epidermal cells in having: (a) Mitochondria (b) Chloroplast (c) Ribosome (d) Nucleolus 51. An important factor in the mechanism of opening and closing of stomata is the: (a) Shape of the guard cell (b) Starch content of the cell (c) Protein content of the cell (d) Chlorophyll content of the guard cell 52. Plants wilt because of excessive: (a) Respiration (b) Photosynthesis (c) Transpiration (d) Absorption 53. An element which plays an important role in stomatal movement is: (a) Na (b) K (c) Cl (d) Mg 54. Accumulation of ions which takes place in the guard cells at the time of stomatal opening is: (a) Cl – (b) K+ (c) Mg (d) None of these 55. Decapitated seedling fails to show curvature is response to light, because it hamper: (a) Respiration (b) Photosynthesis (c) Transpiration (d) Perception of light stimulus 56. Opening and closing of flower is a kind of: (a) Tropic movement 42. (d) 53. (b)

43. (b) 54. (b)

44. (d) 55. (d)

45. (c)

46. (a)

47. (d)

510

Plant Physiology: Question Bank

(b) Nastic movement (c) Autonomic movement (d) Nutation 57. The leaves of Mimosa pudica drop down when touched due to: (a) Nyctinasty (b) Seismonasty (c) Chemonasty (d) None of these 58. Thigmonasty is observed in: (a) Drosera (b) Utricularia (c) Mimosa (d) Cuscuta 59. What type of movement is shown by the antherozoids of Riccia and Funaria? (a) Geotropic (b) Thigmotactic (c) Chemotactic (d) Phototactic 60. Cholodny-Went theory successfully explanins: (a) Phototropism (b) Photorespiration (c) Phototranspiratioin (d) Photoperiodism 61. Hormone involved in phototropism is: (a) GA (b) IAA (c) Auxin (d) Cytokinin 62. Which side will contain more auxin in young seedling exposed to unilateral light? (a) Illuminated side (b) Shaded side (c) Neither side (d) Both (a) and (b) 63. Clinostate is used to: (a) Neutralize gravity (b) Record movement (c) Record growth (d) Demonstrate growth

56. (b) 67. (b)

57. (b) 68. (b)

58. (c) 69. (d)

66. Respiration differs from combustion in (a) Liberating more energy as compared to combustion (b) Liberating of all the energy at once in contrast to combustion (c) Liberation of energy gradually in steps in contrast to combustion (d) Carbohydrates take part as the combustion substance 67. In mitochondria, ATP synthesis occurs: (a) At the outer membrane (b) At the cristae (c) In the matrix (d) In the intracristal space 68. Final electron acceptor in respiration is: (a) Hydrogen (b) Oxygen (c) Cytochromes (d) Dehydrogenases 69. Hexose monophosphate shunt is: (a) Transformation of glucose to pyruvic acid (b) Formation of new products (c) Sum total of metabolic reactions (d) Pentose phosphate pathway 70. Oxidative phosphorylation is found in: (a) Chloroplasts (b) Leucoplasts (c) Peroxisomes (d) Mitochondria

64. The curvature of oat coleoptile occurs towards the source of light. It is due to: (a) Enlargement of cell on both sides (b) Enlargement of cell on illuminated side (c) Enlargement of cell on shaded side (d) No enlargement Ans.

65. Bending of plant organ towards the light is: (a) Negative phototropism (b) Positive phototropism (c) Phototactism (d) Photosynthesis

59. (c) 70. (d)

60. (a) 71. (c)

71. In Opunita and other succulents, night-time RQ is: (a) One (b) More than one (c) Zero (d) Less than one 72. RQ is less than one when the respiratory substrate is: (a) Sucrose (b) Fat (c) Glucose (d) Organic acid 61. (c) 72. (b)

62. (b)

63. (a)

64. (c)

65. (b)

66. (c)

Model Test Papers

73. Cut surfaces of fruits often becomes dark due to: (a) Dirty knife (b) Oxidation of iron containing chemicals (c) Dissolution of iron of the knife (d) Oxidation of tannic acid assisted by traces of iron from knife 74. Cut apple turns brown but does not do so if dipped in ascorbic acid solution due to: (a) Nonrelease of polyphenol (b) Inactivation of polyphenol oxidase (c) Keeping the cut surface moist (d) In situ preservation of cells 75. Link between glycolysis, Krebs cycle and  -oxidation of fatty acid or carbohydrate and fat metabolism is: (a) Oxaloacetic acid (b) Succinic acid (c) Citric acid (d) Acetyl CoA 76. Citric acid cycle is the alternate name of: (a) HMP shunt (b) Glycolysis (c) TCA cycle (d) Calvin cycle 77. The plant grown in magnesium deficient but urea sprayed soil would show: (a) Early flowering (b) Yellowing of leaves (c) Loss of pigments in petals (d) Deep green foliage 78. Zinc as a nutrient is available to plants in the form of: (a) ZnSO4 (b) ZnO (c) Zn (d) Zn++ 79. Insectivorous plants grow in: (a) Nitrogen rich soil (b) Protein deficient soil (c) Nitrogen deficient soil (d) Protein rich soil 80. Which of the following is used to measure the salinity of soil? Ans.

73. (d) 84. (b)

74. (b) 85. (b)

75. (d) 86. (d)

76. (c) 87. (c)

77. (b) 88. (b)

511

(a) Potometer (b) Porometer (c) Conductivity meter (d) Sphygnomanometer 81. Nitrogen is fixed in some nonleguminous crops by: (a) Rhizobium (b) Nostoc (c) Frankia (d) Thiobacillus 82. Minerals are absorbed by plants: (a) In colloidal form (b) In ionic form (c) In precipitated form (d) In solid form 83. Nitrogen is absorbed in the form of: (b) NO (a) N2 (d) NO3 (c) NO2 84. Microelements (tracer elements) are used: (a) In great quantities (b) In small quantities (c) In tracing plant activity (d) Microorganism 85. Trace elements are used for: (a) Tracing in drawing (b) Tracing plant physiology (c) Tracing growth hormones (d) All of these 86. Chlorophyll is formed in presence of: (a) Copper (b) Chlorine (c) Chloride (d) Iron and magnesium 87. RQ is: (a) C/N (c) CO2/O2

(b) N/C (d) O2/CO2

88. EMP can produce a total of: (a) 6 ATP (b) 8 ATP (c) 24 ATP (d) 38 ATP 89. Energy is released during: (a) Citric acid  Isocitric acid (b) Isocitric acid  cis-Acotinic acid (c) Glucose 1–P  Glucose 6-P (d) Pyruvate  Acetyl CoA 78. (d) 89. (d)

79. (c)

80. (c)

81. (c)

82. (b)

83. (d)

512

Plant Physiology: Question Bank

90. Succinate is oxidized to fumarate in Krebs cycle by (a) Removal of hydrogen (b) Loss of electrons (c) Addition of oxygen (d) Removal of oxygen 91. Gibberellin was first extracted from: (a) Gibberella fusikural (b) Gelidium (c) Gracelaria (d) Aspergillus 92. A plant bend towards the source of light when exposed to the light on only one side: (a) The apices of their stems are attracted by light (b) Some auxins accumulates on the shaded side to induce greater cell elongation on that side (c) They need light for photosynthesis (d) Light stimulates cell on the illuminated side to increase in length 93. A decapitated plant does not bend towards light: (a) Because the root send message to the upper portion of plant to do so (b) Because of the accumulation of growth promoting substances at the bend (c) Because of secretion of a growth promoting substance by the tip (d) As result of food material translocated from leaves 94. Phototropism in shoot is attributed to: (a) Gibberellins (b) Auxins (c) Abcisic acid (d) Cytokinins 95. Who gave term auxin? (a) Paal (b) Jenson (c) FW Went (d) Stark 96. Yellowing of leaves or chlorosis is the first deficiency symptom of which element? (a) Calcium (b) Nitrogen (c) Phosphorus (d) Chlorine Ans.

90. (a) 1. (b)

91. (a) 2. (a)

92. (b) 3. (b)

93. (c) 4. (c)

94. (b) 5. (a)

97. Best fertilizer for paddy fields is: (a) Azolla pinnata (b) Rhizobium melilotii (c) Bacillus megatherium (d) Bacillus polymyxa 98. Active uptake of minerals requires: (a) Respiration (b) Expenditure of energy (c) Root metabolism (d) Fhotophosphorylation 99. Ammonium sulfate is: (a) Insecticide (b) Weedicide (c) Fertilizer (d) Toxic chemical 100. Which element is needed in large amount? (a) Nitrogen (b) Sulfur (c) Phosphorus (d) Calcium MODEL PAPER 6

1. Protein % in chloroplast are: (a) 20–25% (b) 40–50% (c) 60–65% (d) None of these 2. Glycolysis takes place in the: (a) Cytoplasm (b) Mitochondria (c) Both (a) and (b) (d) None of these 3. Krebs cycles takes places in: (a) Cytoplasm (b) Mitochondria (c) Ribosomes (d) Lysosomes 4. RNA content in ribosome is: (a) 20% (b) 30% (c) 40% (d) 60% 5. The function of ribosomes is: (a) Protein synthesis (b) Release energy (c) Formation of nuclear membrane (d) All of the above 6. Matrix contains: (a) Amino acids (b) Soluble RNA (c) Enzyme (d) All of the above 7. Which types of carbohydrates occur in protoplasm? (a) Glucose (b) Fructose (c) Sucrose (d) All of the above 95. (c) 6. (d)

96. (b) 7. (d)

97. (a)

98. (b)

99. (c) 100. (a)

Model Test Papers

8. Ho is the father of plant physiology: (a) WW Gardner (b) von Helment (c) HA Allard (d) Kraus 9. Theory of photoperiodism given by: (a) WW Gardner and von Helment (b) WW Gardner and HA Allard (c) Kraus and Kraybill (d) None of the above 10. Which are short-day plant? (a) Tobacco, radish and beet (b) Tobacco, soybean and strawberry (c) Tomato, potato and soybean (d) All of the above 11. Performance of flowering are better in which type of light? (a) Blue light (b) Red light (c) Yellow light (d) White light 12. Which is causes of dormancy? (a) Hard seed coat (b) Seed coat impermeable to O2 (c) Seed coat impermeable to water (d) All of the above 13. Which condition is favorable for germination of seed? (a) Water (b) Oxygen (c) Temperature (d) All of the above 14. In mustard plant which type of stomata are found? (a) Potato type (b) Oat type (c) Alfalfa type (d) Potamogeton type 15. Porphyrin and phytol are parts of: (a) Chlorophyll molecules (b) Chromoplast (c) Protoplast (d) Both (b) and (c) 16. Middle lamila of cell contain: (a) Pectate of calcium and magnesium (b) Pectate of calcium of sulfur (c) Sulfate of calcium and magnesium (d) None of these 17. Thickness of plasma membrane is: (a) 0–20Å (b) 40–50 Å (c) 75–100 Å (d) None of these Ans.

8. (b) 19. (b)

9. (b) 20. (c)

10. (b) 21. (b)

11. (b) 22. (c)

12. (d) 23. (d)

513

18. Size of nucleus varies with: (a) 5–7 µ (b) 15–25 µ (c) 40–50 µ (d) 75–125 µ 19. Khaira disease was discovered by: (a) Dr BR Mehta (b) Dr YL Nane (c) Dr YL Sahni (d) None of these 20. Diameter of ribosome is: (a) 50–100Å (b) 100–150 Å (c) 150–200 Å (d) 250–300 Å 21. Deficiency symptoms of nitrogen firstly appear on: (a) New leaves (b) Older leaves (c) Flower buds (d) All of the above 22. Which of the following is esterase enzyme? (a) Lipase (b) Phosphotase (c) Both (d) None of these 23. Which is germination inhibitor? (a) Coumarin (b) Ammonia (c) Perulic acid (d) All of the above 24. Which is the biennials plants? (a) Sugar beet (b) Broccoli (c) Cabbage (d) All of the above 25. Requirement of temperature during vernalization: (a) 0°C (b) 0–2°C (c) 1–4°C (d) 1–7°C 26. In most plant vernalization site is: (a) Old branch (b) Old leaves (c) Apical tip (d) All of the above 27. Shading of plant affect the following phenomenon: (a) Produced abundant auxin (b) Growtaller (c) Root system becomes weak (d) All of the above 28. Which is growth retardant? (a) CCC (chloro choline chloride) (b) Alar (N-dimethyl amino succinic Acid) (c) Cycoceal (d) All of the above 13. (d) 24. (d)

14. (c) 25. (d)

15. (a) 26. (c)

16. (a) 27. (d)

17. (c) 28. (d)

18. (a)

514

Plant Physiology: Question Bank

29. Oxygen is required for: (a) Photosynthesis (b) Transpiration (c) Respiration (d) Guttation 30. Nigrogen is essential for: (a) Protein (b) Amino acid (c) Chlorophyll (d) None of these 31. Plant nutrients absorbed by plants from soil are carried upward through: (a) Xylem (b) Phloem (c) Epidermis (d) All of the above 32. Which of the following major nutrients is maintained in usable from throughout the plant in uniform concentration: (a) Nitrogen (b) Phosphorus (c) Potash (d) All of the above 33. Mineral elements circulate in the plant along with sap: (a) Downward through phloem (b) Upward through xylem (c) Outward through leaves (d) All of the above 34. Transpiration associated ion uptake is: (a) Passive uptake (b) Active uptake (c) Both (a) and (b) (d) None of these 35. Absorption of nutrients by plant roots from soil solution is a: (a) Active process (b) Passive process (c) Both (a) and (b) (d) None of these 36. Khaira disease of rice can be controlled by spraying the crop with: (b) ZnSO4 + urea (a) ZnSO4 + lime (c) Both (a) and (b) (d) None of these

39. Rice seed can germinate under the absence of: (a) Light (b) Water (c) Oxygen (d) None of these 40. Nonviable seed of rice had: (a) Lower level of auxin (b) Higher level of auxin (c) Lower level of kinetin (d) Higher level of kinetin 41. In paddy plant brown spots on the lamina and drying of tips are the sign of deficiency of: (a) Copper (b) Boron (c) Manganese (d) Sulfur 42. Optimum temperature for tuber formation is about: (a) 8–10°C (b) 15–18°C (c) 20–29°C (d) 29–32°C 43. Potato plant will greatly freeze the potato plants at the temperature: (a) –1°C (b) –4°C (c) 4°C (d) 6°C 44. Optimal temperature for highest content of starch and sugar in potato tuber is: (a) 15°C (b) 18°C (c) 20°C (d) 29°C 45. Respiratory rate of leaf blade is highest in: (a) Potato (b) Sweet potato (c) Wheat (d) Mustard 46. Formula of potato periodic index is: (a)

37. Wilting and withering of leaves without chlorosis and sheding in a leguminous plant show deficiency of: (a) Mn (b) Fe (c) S (d) Cu 38. Which of the following chemical retard rate of translocation in plant? (a) Cyanide (b) Fluorides (c) 2,4-dinitrophenol (d) All of the above Ans.

29. (c) 40. (b)

30. (d) 41. (b)

31. (b) 42. (b)

32. (b) 43. (b)

33. (d) 44. (c)

(b) (c) (d)

Yield under short-day condition  100 Yield under natural day condition Yield under short-day condition  100 Yield under long-day condition Yield under long-day condition  100 Yield under short-day condition Yield under short-day condition  100 Yield under natural day condition

47. In wheat the plant height is governed by a set of dwarfing genes: (a) Recessive Norin genes (b) Dominant Norin genes (c) Normal genes (d) All of the above 34. (a) 45. (b)

35. (c) 46. (b)

36. (c) 47. (a)

37. (d)

38. (d)

39. (c)

Model Test Papers

48. In most fruits the rate of respiration will undergo a sharp rise and fall near the end of development this phenomenon is: (a) Climacteric rise (b) Nonclimacteric rise (c) Apical rise (d) None of these 49. Which substance used for fruit ripening? (a) Auxin (b) Kinetins (c) Gibberellins (d) Ethylene 50. Which compound used for breaking dormancy? (a) Ethylene chlorohydrins (b) Thiourea (c) Gibberellins (d) All of the above 51. Choose correct pair. (a) Ethylene ClCH3CH2OH chlorohydrins (b) Thiourea NH2CSNH2 (c) Dicalcium CaHPO4 phosphate (d) None of the above 52. Which compound used for supply the magnesium? (a) Olivine (b) Dolomite (c) Magnesite (d) All of these 53. Potometer is used for: (a) Measuring the evaporation rate (b) Measuring the movement of plant (c) Measuring the transpiration rate (d) Measuring the Guttation rate 54. Which is the antitranspirant? (a) Phenyl mercuric acetate (b) Abscisic acid (c) Both (a) and (b) (d) None of these 55. On an average, the ordinary garden soil has mineral matter: (a) 10% (b) 20% (c) 30% (d) 40% 56. Which soil horizon contain finer rock? (a) A-Horizon (b) B-Horizon (c) C-Horizon (d) All of these Ans.

48. (a) 59. (c)

49. (d) 60. (d)

50. (d) 61. (c)

51. (b) 62. (a)

52. (d) 63. (a)

515

57. The ammonium ions are said to have been exchanged for potassium and the phenomenon is called: (a) An ion exchange (b) Cation exchange (c) Both (a) and (b) (d) None of these 58. Which sentences is correct? (a) Humus is dark in color (b) Humus is light in color (c) Humus is essential constituent of soil (d) All of the above 59. The amount of water which the soil retains after the excess has been removed by gravitation is called: (a) Field capacity (b) Water holding capacity (c) Both (a) and (b) (d) None of these 60. A small amount of water is bound to the molecules of some soil minerals by strong chemical bonds and is also not available to the root. This is called: (a) Chemical water (b) Bond water (c) Hygroscopic water (d) Chemically combined water 61. The amount of moisture left in the soil expressed as a percentage of the dry weight of soil, after a plant has permanently wilted is called: (a) Wilting coefficient (b) Permanent wilting point (c) Both (a) and (b) (d) None of these 62. The osmotic pressure of soil solution varies from: (a) 0.1–0.2 atm (b) 0.5–1.0 atm (c) 1.0–1.5 atm (d) 2.0–5.0 atm 63. Osmotic pressure of soil solution at permanent wilting point is: (a) 5.0 atm (b) 10.0 atm (c) 15.0 atm (d) 50.0 atm 64. Which of the following is the deep rooted plants? (a) Oak (b) Apple (c) Tomato (d) All of these 53. (c) 64. (d)

54. (c)

55. (d)

56. (a)

57. (b)

58. (d)

516

Plant Physiology: Question Bank

65. Which of the following is the shallow rooted plant? (a) Maize (b) Grasses (c) Cabbage (d) All of these

74. Fe, Mn, B, Cu, Zn, Mo and Cl are categorized as a: (a) Micronutrient (b) Trace element (c) Minor element (d) All of these

66. Length of root hair zone varies: (a) 1.0–4.0 cm (b) 5.0–8.0 cm (c) 10.0–12.0 cm (d) 15.0–20.0 cm

75. Clay contains: (a) Aluminium oxides (b) Silicon oxides (c) Both (a) and (b) (d) None of these

67. Length of root hairs varies from: (a) 0.1–0.5 mm (b) 0.5–1.0 mm (c) 0.7–1.0 mm (d) 1.0–2.0 mm 68. An average diameter of root hair is: (a) 2.0 µ (b) 5.0 µ (c) 10.0 µ (d) 20.0 µ 69. Root hair are: (a) Short-lived structure (b) Medium-lived structure (c) Long-lived structure (d) Very long-lived structure 70. To determined the mineral composition of the plant the material is dried in an over at the temperature: (a) 50–60°C (b) 70–80°C (c) 90–100°C (d) 100–110°C 71. Which is criteria for considering essential element for plant? (a) Element should not be replaced by any other element (b) Element should be directly involved in function within plant (c) Element should be required for growth and reproduction of plant (d) All of these 72. By applying the criteria of essential element to plant how many elements are essential for plant? (a) 14 (b) 16 (c) 17 (d) 18 73. C, H, O, N, S, P, Ca, K and Mg are: (a) Natural elements (b) Microelements (c) Beneficial elements (d) Macroelements Ans.

65. (d) 76. (b)

66. (a) 77. (b)

67. (c) 78. (a)

68. (c) 79. (b)

69. (a) 80. (d)

76. Which of the following elements is part of chlorophyll? (a) Calcium (b) Magnesium (c) Iron (d) Copper 77. Which of the elements is a component of nucleic acid? (a) Nitrogen (b) Phosphorus (c) Potassium (d) Magnesium 78. Copper is constituent of: (a) Ascorbic acid (b) Nucleic acid (c) Amino acid (d) None of these 79. Which element is constituent of oxidase? (a) Phosphorus (b) Copper (c) Molybdenum (d) Zinc 80. Which element is required for functioning of the nitrate reductase enzyme? (a) Cobalt (b) Copper (c) Magnesium (d) Molybdenum 81. Which amino acid contain sulfur? (a) Methionine (b) Cystine (c) Cysteine (d) All of these 82. Leaf chlorosis, leaf sheding, poor flowering and fruiting are the symptoms of: (a) Sulfur (b) Phosphorus (c) Nitrogen (d) Potassium 83. Calcium is necessary for: (a) Sulphur (b) Phosphorus (c) Nitrogen (d) Potassium 84. Leaf chlorosis, leaf curling, death of root and shoot tips are the symptoms of: (a) Phosphorus (b) Calcium (c) Potassium (d) Magnesium 70. (b) 81. (d)

71. (d) 82. (c)

72. (b) 83. (c)

73. (d) 84. (b)

74. (d)

75. (c)

Model Test Papers

85. Iron is constituent of: (a) Ferredosin (b) Cytochrome (c) Catalase (d) All of these 86. Which element is responsible for pollen germination? (a) Copper (b) Boron (c) Manganese (d) Magnesium 87. Leaf margin and tip chlorosis, leaf mottling and necrosis, stunted growth failure of seed setting are deficiency of: (a) Molybdenum (b) Zinc (c) Chlorine (d) Copper 88. Nitrogen starvation in the plant caused: (a) Increase respiration rate (b) Decrease the respiration rate (c) No effect (d) None of these 89. Sulfur is component of: (a) Biotin (b) Thiamine (c) Coenzyme (d) All of these 90. Phosphorus is constituent of: (a) ADP (b) ATP (c) NADP (d) All of these 91. Calcium is essential for: (a) Binding of nucleic acid (b) Cell division (c) Development of root hairs (d) All of these 92. Die back of young shoots internode retarded and dominance of apical bud are symptoms of: (a) Deficiency of phosphorus (b) Deficiency of potassium (c) Deficiency of calcium (d) Deficiency of molybdenum 93. Maximum % of iron in the: (a) Choloroplast (b) Root hair (c) Root tip (d) None of these 94. Tomato and carrot require boron nearly: (a) 1.0 ppm (b) 5.0 ppm (c) 10.0 ppm (d) 20.0 ppm Ans.

85. (d) 96. (d)

86. (b) 97. (b)

87. (b) 98. (b)

88. (b) 89. (d) 99. (d) 100. (b)

517

95. Boron play an important role in: (a) Carbohydrate metabolism (b) Fat metabolism (c) Translocation of carbohydrate (d) All of these 96. Boron deficiency cause: (a) Leaf roll of potato (b) Heart root of sugar beet (c) Brown heart of turnip (d) All of these 97. Internal browing and cork formation in apple appear due to deficiency of: (a) Copper (b) Boron (c) Calcium (d) Magnesium 98. Which element used for algal growth from fish ponds? (a) Boron (b) Copper (c) Zinc (d) Chlorine 99. Which element is essential for photosynthetic production of oxygen? (a) Mo (b) B (c) Zn (d) Cu 100. Dead brown spots, yellow tip of young leaves in oats and die back of citrus appear due to deficiency of: (a) Mo (b) Cu (c) B (d) None of these MODEL PAPER 7

1. Which element is essential for normal growth of fungus ‘Aspergillus niger’? (a) Cu (b) Mo (c) Zn (d) B 2. Browning of cauliflower appear due to the deficiency of: (a) Mg (b) Co (c) B (d) None of these 3. Zn is component of: (a) Carboxypeptidase enzyme (b) Carbonic anhydrase enzyme (c) Both (a) and (b) (d) None of the above 90. (d) 1. (c)

91. (d) 2. (c)

92. (b) 3. (c)

93. (a)

94. (d)

95. (d)

518

Plant Physiology: Question Bank

4. Match the following: I. Brown heart A. Citrus II. Die back B. Sugar beet III. Kharia C. Potato IV. Hollow heart D. Paddy Codes I II III IV I II III IV (a) A B C D (b) B A D C (c) A C B D (d) C A D B 5. Which element is required for functioning of the enzyme nitrate reductase? (a) Mo (b) Cu (c) B (d) None of these 6. The technique of growing plants in the nutrient solution is called: (a) Hydroponics (b) Soil less growth (c) Tank farming (d) All of these 7. Which is the chelating agent? (a) NAA (b) NAD (c) EDTA (d) None of these 8. Solution in which the toxic effect of different ions are mutually neutralized is called: (a) Neutral solution (b) Balanced solution (c) Normal solution (d) None of these 9. The sum total of all the chemical reaction going on in living organism is described as: (a) Exergonic (b) Endergonic (c) Metabolism (d) None of these 10. Certain orgainc substances which speed up or catalize the metabolic reaction called: (a) Hormone (b) Vitamins (c) Enzymes (d) Growth regulator

4. (b) 15. (d)

5. (a) 16. (c)

6. (d) 17. (c)

7. (c) 18. (c)

13. Enzymes are destroyed at the temperature of: (a) 50–60°C (b) 100–110°C (c) 70–100°C (d) 140–160°C 14. Match the following: 1. Enzyme I. Invertase 2. Sucrase II. Substrate 3. Red pigment III. Blue pigment 4. Phycocyanin IV. Phycoerythrin Codes 1 2 3 4 1 2 3 4 (a) I II III IV (b) II I IV III (c) III I II IV (d) IV I II III 15. Which sentense are correct? (a) Enzynmes are sensitive to heat (b) Enzyme are sensitive acids (c) Enzyme are alkalies and salt (d) All of these 16. Enzyme catalase shows optimum activity in a: (a) Acidic medium (b) Alkali medium (c) Neutral medium (d) None of these 17. Enzyme amylase acts best in: (a) Neutral medium (b) Slightly acidic medium (c) Both (a) and (b) (d) None of these 18. Which of the following is inhibitor? (a) Fluorocitric acid (b) Malonic acid (c) Both (a) and (b) (d) None of these 19. Which is the noncompetitive inhibitors: (a) Cu++ (b) Zn++ (c) Hg++ (d) All of these 20. Raw materials for photosynthesis is: (a) Water (b) CO2 (c) Both (d) None of these

11. Turnover number of sucrose is: (b) 104 (a) 102 5 (c) 10 (d) 108 Ans.

12. Turnover number of catalase is: (a) 105 (b) 102 6 (c) 10 (d) 1012

8. (b) 19. (d)

9. (c) 20. (c)

10. (c)

11. (c)

12. (c)

13. (c)

14. (b)

Model Test Papers

21. The rate of photosynthesis is measured by the following method: (a) The volume of CO2 consumed (b) Volume of oxygen liberated (c) Amount of carbohydrate accumulated (d) All of these 22. Formula of chlorophyll is: (a) C55H70O5N4Mg (b) C55H72O5N4Mg (c) C55H72O2N4Mg (d) None of these 23. Formula of chlorophyll b is: (a) C55H70O6N4Mg (b) C55H72O5N4Mg (c) C55H70O5N4Mg (d) C55H72O6N4Mg 24. The biosynthesis of chlorophyll starts with the condensation of: (a) Succinyl Coenzyme A (b) Glycerol (c) Both (a) and (b) (d) None of these 25. Which is fat soluble yellow pigments? (a) Carotenes (b) Xanthophylls (c) Both (a) and (b) (d) None of these 26. Highest rate of photosynthesis occur in the: (a) Green rays (b) Yellow rays (c) Red rays (d) Blue rays 27. Photosynthesis rate increase under: (a) Low CO2 concentration (b) High CO2 concentration (c) Very high CO2 concentration (d) None of these 28. Which statement is correct? (a) Water is not a raw material for photosynthesis (b) Choropyll is essential for photosynthesis (c) Desert plants can carry on phothosynthesis at 75°C (d) Etiolated plant show photosynthesis 29. Optimal temperature for photosynthesis in C3 plant is: (a) 10–25°C (b) 25–35°C (c) 45–50°C (d) All of the above Ans.

21. (d) 32. (d)

22. (b) 33. (b)

23. (a) 34. (b)

24. (c) 35. (b)

25. (c) 36. (b)

519

30. Optional temperature for photosynthesis in C4 plant is: (a) 10–15°C (b) 20–25°C (c) 30–45°C (d) 45–55°C 31. Which statement is correct? (a) Water use efficiency of C4 plants is higher than that of C3 ones (b) Water use efficiency of C3 plants is higher than that of C4 plants (c) Photorespiration are absent in C3 plants (d) Photorespiration are present in C4 plants 32. Which is aromatic amino acids? (a) Phenylalanine (b) Tyrosine (c) Tryptophane (d) All of these 33. The enzyme responsible for nitrogen reduction is: (a) Amylase (b) Nitrogenase (c) Baciriolase (d) Invertase 34. Pink color of root nodules is due to: (a) Hemoglobin (b) Leghemoglobin (c) Nitrogenase (d) Heterocysts 35. Plant, which muisty depend for their nutrition upon ready-made organic food, are called: (a) Autophytes (b) Heterophytes (c) Parasites (d) Sasprophytes 36. When 0.5 gram of a substance is dissolved in water and the volume is made up to 1000 ml it result in: (a) 50 ppm (b) 500 ppm (c) 5 ppm (d) 5000 ppm 37. Molecular weight of glucose is: (a) 100 (b) 460.2 (c) 140.0 (d) 240.6 38. To prepare one molar solution which weight of substance is dissolved in water? (a) Gram weight (b) Gram molecular weight (c) Molecular weight (d) None of these 26. (c) 37. (c)

27. (b) 38. (b)

28. (b)

29. (b)

30. (c)

31. (a)

520

Plant Physiology: Question Bank

39. When one gram molecular weight of a substances is dissolved in exactly 1000 ml of water called: (a) Molar solution (b) Molal solution (c) Normal solution (d) Buffer solution 40. When gram molecular weight of a substances is dissolved in a small quantity of water called: (a) Molar solution (b) Molal solution (c) Normal solution (d) None of these 41. A solution of a weak acid and its salt constitutes a: (a) Normal solution (b) Acidic solution (c) Buffer solution (d) None of these 42. The change of a solution to gel is called gelation and that of a gel to solution is called: (a) True solution (b) Solidification (c) Solution (d) All of the above 43. One part of agar can imbibe: (a) 50 part of water (b) 60 part of water (c) 70 part of water (d) 99 part of water 44. Resin are: (a) Hydrophobic (c) Thermophilic

(b) Hydrophilic (d) All of the above

45. Nature of colloidal particles are: (a) Hydrophobic (b) Hydrophilic (c) Both (a) and (b) (d) None of these 46. Colloidal particle migrate as a whole to one pole or the other depending on the charge and do not separate into negative and positive ions. This migration is called: (a) Ionization (b) Nonionization (c) Cataphoresis (d) Noncataphoresis 47. The movement continues until the gas molecules are evenly distributed throughout the available space termed: Ans.

39. (b) 50. (d)

40. (a) 51. (a)

41. (c) 52. (c)

42. (c) 53. (d)

43. (d) 54. (d)

(a) Distribution (c) Movement

(b) Diffusion (d) Suspension

48. The osmosis takes place when the value of DPD is: (a) Zero (b) Less than zero (c) More than zero (d) None of these 49. Which is correct? (a) DPD = OP + TP (b) DPD = OP/TP (c) DPD = OP – TP (d) DPD = TP/OP 50. Which is correct sentence? (a) The cell sap exerts high osmotic pressure (b) TP is exerted by the cell sap in the outward direction (c) OP is the invard direction of the cell (d) All of these 51. The outward movement of water from a cell when it is placed in a hypertonic solution is: (a) Exosmosis (b) Endosmosis (c) Filtration (d) Diffusion 52. The phenomenon of reversal of plasmolysis is called: (a) Nonplasmolysis (b) Unplasmolysis (c) Deplasmolysis (d) All of the above 53. In a plasmolysed cell: (a) Valve of Tp being zero (b) Suction pressure = osmotic pressure (c) DPD = OP (d) All of the above 54. Osmotic pressure of the cell sap is calculated by the following formula: 22.4  depression of freezing point 1.00 22.4 (b) OP   depression of freezing point 1.86 10.4 (c) OP   depression of freezing point 1.00

(a) OP 

(d) None of the above

55. Which type of light is most effective in causing stomatal opening? (a) Blue light (b) Yellow light (c) Red light (d) All of the above 44. (b) 55. (c)

45. (c)

46. (c)

47. (b)

48. (c)

49. (c)

Model Test Papers

56. Most favorable temperature for photosynthesis is much higher: (a) 20–25°C (b) 30–35°C (c) 10–15°C (d) 35–40°C 57. Concentratiion of CO2 in atmosphere is: (a) 0.3% (b) 0.03% (c) 0.003% (d) 0.35% 58. Exudation of liquid water and sap with the dissolved substances from injured parts of the plants called: (a) Guttation (b) Bleeding (c) Both (a) and (b) (d) None of these 59. Guttation take place from more or less specialized structure called: (a) Epithem (b) Epidermis (c) Chlorenchyma (d) Hydathodes 60. In maize which type of protein are found? (a) Globulins (b) Glutelin (c) Glutenin (d) Albumin 61. In wheat which protein are found? (a) Globulin (b) Hordein (c) Glutenin (d) Tuperin 62. Match the following: 1. Enzyme I. Invertase 2. Sucrase II. Substrate 3. Red pigment III. Blue pigment 4. Phycocyanin IV. Phycoerythrin Codes 1 2 3 4 1 2 3 4 (a) I II III IV (b) II III I IV (c) II I IV III (d) II I III IV 63. Enzyme nitrogenase requires products of respiration namely: (a) ATP (b) NADH (c) Both (a) and (b) (d) None of these 64. The best example of itcher plant is: (a) Hydrilla (b) Neottia (c) Nepenthes (d) Monotropa 65. One gram molecule of glucose on complete oxidation yield: (a) 124 calories (b) 440 calories (c) 673 calories (d) 692 cakirues Ans.

56. (a) 67. (b)

57. (b) 68. (b)

58. (b) 69. (b)

59. (d) 70. (d)

60. (b) 71. (b)

521

66. One gram fat yielding: (a) 6.1 calories (b) 8.1 calories (c) 6.7 calories (d) 9.1 calories 67. One gram protein yielding: (a) 4.2 calories (b) 6.7 calories (c) 9.1 calories (d) 8.2 calories 68. Which statement is correct? (a) Respiration is a anabolic process (b) Respiration is a catabolic process (c) In respiration food is accumulated (d) End product of respiration are CO2 and hexose sugar 69. Yeast cells are killed by ethyl alcohol when its concentration reaches: (a) 5–10% (b) 10–15% (c) 15–20% (d) 20–25% 70. Which of the following is the oxido reductases enzyme? (a) Oxidases (b) Peroxidases (c) Oxygenae (d) All of these 71. A good which can support optimum plant growth should have at field capacity about: (a) 10–15 % (b) 20–30% (c) 40–60% (d) 70–80% 72. Plant can grow in the presence of high concentration of salts as much as 20% in soil called: (a) Autophytes (b) Glycophytes (c) Halophytes (d) None of these 73. Plants cannot grow even when cncentration of salts reaches 1–2% in the soil solution called: (a) Glycophytes (b) Halophytes (c) Heterophytes (d) Autophytes 74. Soil salinity affect the following function in the plant: (a) Metabolism (b) Synthesis of protein inhibited (c) Inhibit the growth of root and shoot (d) All of these 61. (c) 72. (c)

62. (b) 73. (a)

63. (c) 74. (d)

64. (c)

65. (c)

66. (d)

522

Plant Physiology: Question Bank

75. Which of the following plant is highly sensitive to salinity? (a) Beans (b) Radish (c) Pulses (d) All of these

84. Which practice opt for removing seed dormancy? (a) Scarification (b) Stratification (c) Both (a) and (b) (d) None of these

76. Which of the following plant is highly tolerant to salinity of soil: (a) Beet root (b) Rice (c) Barley (d) All of these

85. Which is inhibitory hormone for seed? (a) Gibberellic acid (b) Kinetin (c) Ethylene (d) 2,4-D

77. Which of the following is synthetic auxin? (a) IBA (b) NAA (c) 2,4-D (d) All of these 78. Which is true natural auxin? (a) IAA (b) Indole pyruvic acid (c) Indole acetonitrile (d) None of these

87. Storage of food in radish and carrot promote under: (a) Long-day condition (b) Short-day condition (c) Day neutral condition (d) All of these

79. Which is the antiauxin? (a) 2,4-dichloranizole (b) Indole acetic acid (c) Indole acetaldehyde (d) None of these

88. Male flower formation in cucumber inhibited by: (a) Short-days (b) Long-days (c) Both (a) and (b) (d) None of these

80. Which synthetic auxin is more effective for inducing rooting in vegetative propagation? (a) IAA (b) IBA (c) NAA (d) None of these 81. Gibberellin was discovered by: (a) Yabuta (1938) (b) Kurosava (1928) (c) Curtis (1954) (d) Cross (1954) 82. Match the following: 1. Retinol I Vitamin B2 2. Thiamin II. Vitamin B6 3. Riboflavin III. Vitamin B1 4. Pyridoxine IV. Vitamin A Codes 1 2 3 4 1 2 3 4 (a) I II III IV (b) IV III I II (c) I I IV II (d) I III IV II 83. Pantothenic acid is component of: (a) Coenzyme A (b) Coenzyme B (c) Coenzyme C (d) Coenzyme D Ans.

75. (d) 86. (b)

76. (d) 87. (b)

77. (d) 88. (a)

86. Which substance promotes the germination of seed which have chilling requirement? (a) Gibberellic acid (b) Kinetin (c) Ethylene (d) 2,4-D

78. (d) 89. (b)

79. (a) 90. (b)

89. Match the following. 1. Tomato I. Short-day plant 2. Night jasmine II. Long-day plant 3. Lilium III. Day neutral plant 4. Soybean IV. Long short-day plant Codes 1 2 3 4 1 2 3 4 (a) II I III IV (b) III IV II I (c) I III II IV (d) I II III IV 90. Pr form of phytochrome absorb maximum light in: (a) Green light (b) Red light (c) Yellow light (d) Blue light 91. Pfr form of phytochrome absorb peak in far red region at: (a) 660 mµ (b) 730 mµ (c) 740 mµ (d) 930 mµ 92. Photoconversion of phytochrome is complete within: 80. (b) 91. (b)

81. (b)

82. (b)

83. (a)

84. (c)

85. (a)

Model Test Papers

(a) 1–2 minutes (c) 5–10 minutes

(b) 1–4 minutes (d) 10–15 minutes

93. Florigen was proposed by: (a) Chailakhyan (b) Krishnamoorthy (c) Klebs (d) Tournois

95. Quantitative vernalization requirement is: (a) Rye (b) Pea (c) Gram (d) All of these 96. Temperature ranges are effective for devernalization of seed and plants: (a) 20–30°C (b) 30–35°C (c) 40–50°C (d) 50–60°C 97. Period of deley after the initiation of the stimulus is called the: (a) Transmission time (b) Reaction time (c) Conduction time (d) None of these 98. Plant movement depend upon the imbibitions or loss of water by the cells called: (a) Tractic movement (b) Tropic movement (c) Hygroscopic movement (d) All of these 99. Match the following: Gravity stimulai Light stimulai Contact stimulai Water stimulai Chemical stimulai

Codes 1 (a) I (b) III (c) III (d) II Ans.

2 II I V III

92. (b) 3. (d)

3 III II I IV

4 IV V I V

93. (a) 4. (d)

I. II. III. IV. V.

Thigmotropism Hydrotropism Geotropism Chemotropism Photoperiodism

5 V IV IV I 94. (c) 5. (a)

100. Protein % in chloroplast are: (a) 20–25% (b) 40–50% (c) 60–65% (d) None of these MODEL TEST PAPER 8

94. Cabbage and brussel sprout plant need to be exposed to temperature at: (a) 0–7°C (b) 7–12°C (c) 12–17°C (d) 17–25°C

1. 2. 3. 4. 5.

523

1. Among the following, who was not recipient of Nobel Prize of 1974 in Physiology or Medicine category, was awarded in recognition for their contribution to structural and functional organism of the cell? (a) Christian de Duve (b) Albert Claude (c) George E Palade (d) None of the above 2. Polyribosomes or polysomes are group of ribosome’s which: (a) Are attached to ER (b) Lie freely in cytoplasm (c) Are attached to single mRNA molecule during protein synthesis (d) None of the above 3. Double stranded circular DNA molecules are found in: (a) Prokaryotes (b) Mitochondria (c) Chloroplasts (d) All of these 4. Find the Nobel Laureate, among the following: (a) Ernst Ruska (b) The (Theodor Svedberg) (c) Camilla Golgi (d) None of the above 5. The term was first given by: (A) C Benda (b) W Fleming (c) Altman (d) None of these 6. The method of separating a colloid from a crystalloid by filtration through a membrane is called: (a) Coagulation (b) Dialysis (c) Cataphoresis (d) None of these 7. Protoplasm is a: (a) Complex colloidal system of many phases

95. (d) 6. (b)

96. (b) 7. (a)

97. (b)

98. (c)

99. (c) 100. (b)

1. (d)

2. (c)

524

Plant Physiology: Question Bank

(b) Colloidal solution (c) Suspension (d) True solution 8. The colloidal solutions not show the properties of: (a) Flocculation (b) Tyndall effect (c) Brownian movements (d) None of the above 9. The unstable system among the following: (a) Colloidal system (b) True solution (c) Suspension (d) All of these 10. In colloidal solution of a mixture of fine clay with water, the clay particles from the: (a) Continuous phase (b) Dispersed phase (c) Dispersion medium (d) All of the above 11. Which of the following is the most correct equation for water potential? (a) w = s + p (b) w = s – p (c) w = s – p + s (d) w = s + p + g

15. Movement of water in osmotic or other systems takes place: (a) In the presence of semipermeable membrane only (b) From a region of less negative water potential to more negative water potential (c) From a region of more negative water potential to less negative water potential (d) None of the above 16. Aquaporins are formed in cell membranes by: (a) Phospholipids (b) Integral membrane proteins (c) Peripheral membrane proteins (d) None of the above 17. Water absorbing tissue called velamen is characteristic of some: (a) Pitcher plants (b) Orchids (c) Aquatic plants (d) All of these 18. Casparian strips are found in roots in: (a) Endodermal cells (b) Pericycle (c) Cortical cells (d) Epidermal cells

12. Total sum of all osmotic potentials caused by different solutes dissolved in cell sap is called: (a) Combined osmotic potential (b) Osmolarity (c) Osmolality (d) None of these w) of an imbibant 13. Water potential ( which is not confined is equal to: (a) Matric potential minus pressure potential (b) Matric potential (m) plus pressure potential (p) (c) Matric potential (d) None of these

19. Water holding capacity of the soil is much greater in: (a) Loam soil (b) Sandy soil (c) Clayey soil (d) None of these

14. Dry seeds when placed on moist filter paper absorb water and swell up due to: (a) Imbibition (b) Diffusion (c) Osmotic diffusion (d) None

21. Which one of the following plants does not show phenomenon of guttation? (a) Colocasia (b) Garden nasturtium (c) Tropaeolum (d) None of these

Ans.

8. (d) 19. (a)

9. (c) 20. (c)

10. (b) 21. (d)

11. (d)

12. (c)

20. The percentage of soil water left after the plant growing in that soil is permanently wilted, is called: (a) Permanent field capacity (b) Water holding capacity of the soil or field capacity (c) Wilting coefficient or permanent wilting percentage (d) None of the above

13. (c)

14. (a)

15. (b)

16. (b)

17. (b)

18. (a)

Model Test Papers

22. Guttation occurs through: (a) Stomata (b) Hydathodes (c) None of these (d) Both (a) and (b) 23. In some angiosperms, watery drops zone out from uninjured margins of leaves. This phenomenon is called: (a) Guttation (b) Transpiration (c) Root pressure (d) None of these 24. In plants, the rate of respiration is usually maximum in: (a) Evening (b) Afternoon (c) Little before noon (d) Morning 25. Which of the following substances are not antitranspirants? (a) Phenylmercuric acetate and very high conc. of CO2 (b) Color plastics and silicon oils (c) Low viscositis waxes and ABA (d) None of the above 26. Which of the following does not occur in vascular plants? (a) Pathogen-induced embolism (b) Water stress-induced embolism (c) Embolism formation by winter freezing (d) None of the above 27. Repair of embolism by root pressure or positive xylem pressure has been observed on a nightly basis in: (a) Trees (b) Herbs (c) Shrubs (d) All of the above 28. Blocking of a xylem vessel or tracheid by an air bubble is called: (a) Embolism (b) Hydraulic discontinuity (c) Cavitation (d) None of these 29. Main force for ascent of sap in higher plants is: (a) Capillary force (b) Atmospheric pressure (c) Transpiration pull (d) Root pressure Ans.

22. (b) 33. (d)

23. (a) 34. (c)

24. (c) 35. (d)

25. (d) 36. (b)

26. (d)

525

30. The root pressure can be measured by: (a) Mercury manometer (b) Ganong’s potometer (c) Psychometer (d) All of the above 31. The phenomenon wherein an ion species present in excess in the nutrient medium may depress the uptake of another ion species has been called: (a) Ion-antagoniam (b) Ion-inhibition (c) Ion-suppression (d) None of these 32. Main function of arbuscles in VAM is: (a) To provide the strength to host cells (b) To increase surface area between fungus and the host cell (c) To decrease the volume of host cells (d) None of the above 33. Mycorrhizal formation tends to be suppressed in soil that is: (a) Very rich in nutrient supply (b) Flooded (c) Very poor in nutrient supply (d) All of the above 34. Which of the following mineral elements is less soluble and comparatively immobile in soil? (a) N (b) K (c) P (d) None of these 35. Choose the wrong statement among the following: (a) Mycorrhizae reduce the rhizosphere and nutrient depletion zone in the soil (b) VAM forms thick mantle around root surface (c) The arbuscles formed by VAM penetrate protoplasts of cortical cell of host root (d) All of the above 36. Nickel deficiency in plants results in: (a) Chlorosis of leaves (b) Necrosis of leaves (c) Both (a) and (b) (d) None of these 27. (b)

28. (a)

29. (c)

30. (a)

31. (a)

32. (b)

526

Plant Physiology: Question Bank

37. A trace element which is cofactor of enzyme urease is: (a) Cl (b) Mo (c) Ni (d) None of these 38. Bronzing of the leaves is typically used by the deficiency of: (a) Cl (b) Mo (c) Fe (d) None of these 39. Chloride ions play an important role in: (a) Nitrogen fixation (b) Photolysis of water and O2 evolution in photosynthesis (c) Glycolysis (d) None of these 40. Whiptail disease of cauliflower plants is caused by the deficiency of: (a) Ni (b) Fe (c) B (d) Mo 41. In a polypeptide, the peptide C–N bond has: (a) A hydrogen bond nature (b) A partial double bond nature (c) A partial triple bond nature (d) None of the above 42. In eukaryotes, the process of splicing: (a) Removes introns and joints exons (b) Removes exons and joins introns (c) Both (a) and (b) (d) None of these 43. The direction of transcription on DNA template strand is form: (a) 3’-end to 5’-end (b) 5’-end to 3’-end (c) Both (a) and (b) (d) None of these ) factor is involved in: 44. Rho ( (a) The termination of transcription (b) Initiation of synthesis of polypeptide chain (c) Termination of synthesis of polypeptide chain (d) None of the above 45. In eukaryotes how many different types of RNA polymerases are involved in the synthesis of different types of RNAs? Ans.

37. (c) 48. (d)

38. (a) 49. (a)

39. (b) 50. (a)

40. (d) 51. (c)

41. (b) 52. (d)

(a) Four (c) Two

(b) Three (d) One

46. Nonprotein chemical substances which are required for enzymic reaction but one not tightly bound to the enzyme (by covalent linkages) are called: (a) Coenzymes (b) General activators (c) Cofactors (d) Prosthetic groups 47. Which of the following hydrolyzing enzymes do not hydrolyze ester bonds? (a) Peptidases (b) Lipases (c) Phosphatidases (d) Phosphatases 48. EC number of the enzyme alcohol dehydrogenase is: (a) 4.1.1.1 (b) 3.1.1.1 (c) 2.1.1.1 (d) 1.1.1.1 49. The specific enzyme code number (EC number) consists of: (a) Four digits (b) Three digits (c) Two digits (d) One digit 50. According to the new system of classification the enzymes are grouped into: (a) Six major classes (b) Five major classes (c) Four major classes (d) None of the above 51. Chromatophores constitute the photosynthetic apparatus in: (a) Heliobacteria (b) Green bacteria (c) Purple bacteria (d) All of the above 52. With regard to bacterial photosynthesis, which of the following statements is correct? (a) Instead of NADPH, NAD + is reduced to NADH (b) There is only one pigment system which is analogous to pigment system I of algae and higher plants (c) O2 is not involved (d) All of the above 42. (a)

43. (b)

44. (a)

45. (b)

46. (c)

47. (a)

Model Test Papers

53. Which of the following organisms use H2S to reduce CO2 in photosynthesis? (a) Cyanobacteria (b) Photosynthetic bacteria (c) Chemosynthetic bacteria (d) None of the above 54. By far, the most abundant protein on the earth is: (a) Ribulose bisphosphate oxygenase (b) RuBisCo (c) Fd–NADP-reductase (d) None of the above 55. Most correct and stable structure of D-glucose is provided by: (a) Haworth’s formula (b) Chair conformational form (c) Fischer’s projection formula (d) None of the above 56. Alginic acid is found in: (a) Brown algae (b) Green algae (c) Red algae (d) All of the above 57. Callose is found in: (a) Phloem parenchyma (b) Phloem sieve tubes (c) Companion cells (d) None of the above 58. Which of the following are not epimers? (a) D-glucose and D-mannose (b) D-ribullose and D-xylulose (c) D-rlucose and D-galactose (d) None of the above 59. Which of the following lack cellulose degrading enzymes? (a) Termites (b) Ruminants (c) Plants and humans (d) None of these 60. Amylose and amylopectin, the two components of starch contain respectively: (a)  (1  4) +  (1  6) and  (1  4) glycosidic bonds (b)  (1  4) and  (1  6) +  (1  4) glycosidic bonds Ans.

53. (b) 64. (b)

54. (b) 65. (a)

55. (b) 66. (c)

56. (a) 67. (b)

57. (b) 68. (b)

527

(c)  (1  6) and  (1  4) glycosidic bonds (d)  (1  4) and  (1  6) glycosidic bonds 61. Which of the following has  (1  4) glycosidic linkage in its molecule? (a) Sucrose (b) Maltose (c) Cellobiose (d) All of the above 62. Which of the following polysaccharides is probably the most abundant organic substance on the earth? (a) Inulin (b) Starch (c) Cellulose (d) Chitin 63. Which of the following is a mucopolysaccharides? (a) Pectin (b) Chitin (c) Hemicellulose (d) Cellulose 64. Corresponding D and L sugars are the mirror image of each other that form: (a) Optically active pair (b) Enantiomeric pair (c) Anomeric pair (d) None of the above 65. -oxidation of fatty acids in plants: (a) Two steps process (b) Three steps process (c) One step process (d) None of the above 66. In eukaryotic plants, complete aerobic oxidation of one molecule of glycerol results in net gain of: (a) 15 ATPs (b) 5 ATPs (c) 20 ATPs (d) None of these 67. In cells, fats are stored in: (a) Lysosomes (b) Spherosomes (Olesomes) (c) Cytosol (d) All of the above 68. Fats are found in abundance in plants especially in: (a) Vegetative tissues (b) Reproductive tissues (c) Meristematic tissues (d) All of the above 58. (d)

59. (c)

60. (b)

61. (b)

62. (c)

63. (b)

528

Plant Physiology: Question Bank

69. Which of the following is not an unusual plant fatty acid? (a) Licanic acid (b) Stearic acid (c) Vernolic acid (d) Chaulmoogric acid

76. The cytochromes in electron transport chain from: (a) One electron redox system (b) Two electron redox system (c) Both (a) and (b) (d) None of these

70. In symplastic loading the transport sugars are mainly: (a) Oligosaccharides other than sucrose (b) Sucrose (c) Sucrose + other oligosaccharides (d) None of the above

77. Prosthetic group of cytochrome oxidase (cyt a3) contains: (a) Mn (b) Cu (c) Ni (d) All of the above

71. Transfer of photosynthates from sieve tube elements to receiver cells of sink is called: (a) Translocation of photosynthesis (b) Phloem loading (c) Phloem unloading (d) All of the above 72. The transfer of sugars from mesophyll cells to sieve tube elements in the leaf is called: (a) Phloem unloading (b) Phloem loading (c) Both (a) and (b) (d) None of the above 73. Which of the following is not related to translocation of organic solutes in higher plants? (a) Activated diffusion hypothesis and electro-osmotic theory (b) Protoplasmic streaming theory (c) Interfacial flow hypothesis (d) None of the above 74. Munch’s hypothesis accounts for translocation of organic solutes only in: (a) Downward direction (b) Upward direction (c) Both (a) and (b) (d) None of these 75. Which will die first in a girdled plant? (a) Root (b) Fruits (c) Shoot (d) All of these Ans.

69. (b) 80. (c)

70. (c) 81. (a)

71. (c) 82. (b)

72. (b) 83. (d)

73. (d)

78. Cytochromes are: (a) Fe-porphyrin proteins (b) Mg-porphyrin proteins (c) Both (a) and (b) (d) None of these 79. Which of the following is not a component of mitochondrial electron transport system? (a) Cytochromes a and a3 (b) Cytochrome C (c) Cytochrome b (d) Ubiquinone 80. How many sites of phosphorylation (ATP synthesis) are there in mitochondrial electron transport system? (a) One (b) Two (c) Three (d) None of these 81. Most of the ATP molecules in aerobic oxidation of glucose are synthesized by: (a) Terminal oxidation of reduced coenzymes produced in TCA cycle (b) Terminal oxidation of reduced coenzymes produced in glycolysis (c) Substrate level phosphorylation in TCA cycle (d) Substrate level phosphorylation in glycolysis 82. A protein inhibitor of ethylene action is: (a) Manganese ions (b) Silver ions (c) Cobalt ions (d) None of these 83. Which one of the following is not an inhibitor of ethylene biosynthesis? (a) Co2+ (b) AVG (c) AOA (d) None of these 74. (a)

75. (a)

76. (a)

77. (b)

78. (a)

79. (c)

Model Test Papers

84. Immediate precursor of ethylene biosynthesis in plants is: (a) 1-aminocyclopropane-1-carboxylic acid (ACC) (b) Methionine (c) S-adenosyl methionine (d) None of these 85. Nowadays, which of the following technique is not used for detection and estimation of ethylene? (a) Laser driven photoacoustic detector (b) Triple response bioassay method (c) Gas chromatographic technique (d) None of the above 86. Well known absorbent of ethylene is: (a) Potassium hydroxide (b) Potassium permanganate (c) Formalin (d) All of the above 87. The energy of hydrogen bond (which is represented by dotted line) is: (a) Lesser than ionic or covalent bonds (b) Greater than ionic or covalent bonds (c) Lower than van der Waals forces (d) None of the above 88. Unique physical properties of water due to the presence of: (a) Hydrogen bonds between water molecules (b) Covalent bonds between water molecules (c) Both (a) and (b) (d) None of these 89. The water molecules are polar in nature and are: (a) Positively charged (b) Neutral (c) Negatively charged (d) None of the above 90. In water molecule, the two hydrogen atoms are joined to oxygen atom by covalent bonds forming an angle of: (a) 115° (b) 110° (c) 105° (d) 100° 91. Which is the most important factor in regulation of transpiration? Ans.

84. (a) 95. (a)

85. (b) 96. (a)

86. (a) 97. (c)

87. (a) 98. (c)

(a) Wind (c) Temperature

529

(b) Humidity (d) Light

92. Cut flowers are dipped basally in dilute sodium chloride solution to: (a) Increase solute inside the flowers (b) Induce endosmosis (c) Reduced the transpiration (d) Reduced the bacterial growth 93. Plasmolysis is due to: (a) Adsorption (b) Osmosis (c) Endomosis (d) Exosmosis 94. With the rise in turgidity, wall pressure will: (a) Remain unchanged (b) Fluctuate (c) Increase (d) Decrease 95. In the seeds germination the first to occur is: (a) Imbibition (b) Diffusion (c) Osmosis (d) All of these 96. Endosmosis of water occurs when the water potential of the cell sap is: (a) Lower (b) Higher (c) Equal (d) None of these 97. The movement of free atoms from higher concentration to lower concentration is called: (a) Exosmosis (b) Endosmosis (c) Diffusion (d) Osmosis 98. The water potential of a solution is depicted by: (a)  (b) s (c) S (d) P 99. 01 M solution of solute (nonelectrolyte) will have a water potential of: (a) 22.4 bars (b) 2.3 bares (c) –2.3 bars (d) Zero 100. The term of water potential was termed by: (a) Slatyer and Taylor (b) Lloyd (b) von Mohl (d) Sayre

88. (b) 89. (c) 99. (c) 100. (a)

90. (a)

91. (a)

92. (c)

93. (d)

94. (c)

530

Plant Physiology: Question Bank

(a) Hydrogen bonds between water molecules (b) Covalent bonds between water molecules (c) Both (a) and (b) (d) None of the above

MODEL TEST PAPER 9

1. Paroxysms are associated with: (a) Oxidative phosphorylation (b) Photorespiration (c) Respiration (d) All of the above 2. Conversion of fats into sugars in plant occurs in: (a) Lisosome (b) Glyoxisome (c) Peroxisomes (d) Golgi bodies 3. Spherosomes are rich in: (a) Carbohydrates (b) Fats (c) Proteins (d) None of these 4. Ribosomes are associated with: (a) Photorespiration (b) Respiration (c) Protein synthesis (d) Photosynthesis 5. Thylakoids are found in: (a) Glyoxysome (b) Lysosome (c) Chloroplast (d) Mitochondrion 6. One angstrom unit is equal to: (b) 10–8 cm (a) 10–9 cm –7 (d) 10–6 cm (c) 10 cm 7. Specific heat for 1 gm of pure water is: (a) Two calories (8.368 J) (b) Three calories (12.552 J) (c) One calorie (4.184 J) (d) None of the above 8. In ice, water molecules form a: (a) Tetrahydral structure (b) Quadrangular structure (c) Triangular structure (d) None of the above 9. The energy of hydrogen bond (which is represented by dotted line) is: (a) Lesser than ionic or covalent bonds (b) Greater than ionic or covalent bonds (c) Lower than van der Waals forces (d) None of the above 10. Unique physical properties of water due to the presence of: Ans.

1. (b) 12. (a)

2. (b) 13. (b)

3. (b) 14. (c)

4. (c) 15. (c)

5. (b) 16. (b)

11. The water molecules are polar in nature and are: (a) Positively charged (b) Neutral (c) Negatively charged (d) None of the above 12. In water molecule, the two hydrogen atoms are joined to oxygen atom by covalent bonds forming an angle of: (a) 115° (b) 110° (c) 105° (d) 100° 13. Incipient plasmolysis is: (a) Initial stage of plasmolysis (b) Last stage of plasmolysis (c) Middle stage of plasmolysis (d) None of the above 14. Turgor pressure of a plant cell increases due to: (a) Wall pressure (b) End-osmosis (c) Ex-osmosis (d) All of the above 15. Osmotic pressure is higher in: (a) Hypotonic solution (b) Isotonic solution (c) Hypertonic solution (d) None of the above 16. Osmotic pressure in a solution which is separated from its solvent by semipermeable membrane, results due to: (a) Solvent molecules in it (b) Dissolved solutes in it (c) Insoluble solutes in it (d) None of the above 17. Demonstration of the process of osmosis can be done by potato osmoscope by using: (a) Boiled and unskinned potato tuber (b) Boiled and skinned potato tuber 6. (c)

7. (a)

8. (a)

9. (a)

10. (b)

11. (c)

Model Test Papers

(c) Unskinned potato tuber (d) Skinned potato tuber 18. The diffusion of solvent molecules into the solution through semipermeable membrane is called: (a) Osmosis (b) Imbibition (c) Diffusion (d) All of these 19. Which one of the following forms of soil water is commonly absorbed by plants? (a) Combined water (b) Gravitational water (c) Capillary water (d) Hygroscopic water 20. First step in absorption of water by root hairs is: (a) Osmotic diffusion (b) Imbibition (c) Simple diffusion (d) None of the above 21. During absorption of water by roots, the flow of water from epidermis to endodermis takes place by: (a) Transmembrane pathway (b) Apoplastic pathway (c) Symplastic pathway (d) All of the above 22. Root pressure is developed in: (a) Pericycle (b) Cortex (c) Xylem (d) Phloem 23. Main force behind passive absorption of water by roots, is: (a) Transpiration pull (b) Root pressure (c) Osmotic pressure (d) None of the above 24. Which of the following parts of root is involved in absorption of water in higher plants? (a) Root hair zone (b) Root cap and meristematic region (c) Zone of elongation (d) All of the above Ans.

17. (c) 28. (b)

18. (a) 29. (d)

19. (c) 30. (d)

20. (b) 31. (b)

21. (c) 32. (c)

531

25. Which is the most important factor in regulation of transpiration? (a) Wind (b) Humidity (c) Temperature (d) Light 26. Closure of stomata of normal plants can be induced by: (b) IAA (a) GA3 (c) ABA (d) All of the above 27. Which of the following forms of CO2 has controlling influence on stomatal movements? (a) Atmospheric (b) Intercellular (c) Intracellular (d) None of these 28. Which one of the following colors of light is effective in the stomatal opening? (a) Green (b) Blue (c) Far red (d) Red 29. Which one of the following processes is sometimes called necessary evil? (a) Evaporation (b) Transpiration (c) Guttation (d) All of these 30. In plants, transpiration plays an important role in: (a) Translocation of mineral salts (b) Regulation of temperature (c) Ascent of sap (d) All of the above 31. The stomata open when guard cells become: (a) Plasmolysed (b) Turgid (c) Flaccid (d) None of these 32. The stomata open at night in: (b) C3 plants (a) C4 plants (c) CAM plants (d) None of these 33. Cohesive force of water is due to the presence of: (a) Hydrogen bonds between water and components of xylem walls (b) Hydrogen bonds between water molecules (c) Covalent bonds between water molecules (d) None of the above 22. (a) 33. (b)

23. (a)

24. (a)

25. (c)

26. (b)

27. (b)

532

Plant Physiology: Question Bank

34. Which one of the following plants is tallest angiosperm? (a) Ficus bengalensis (b) Sequoia sempervirens (c) Australian eucalyptus (d) None of the above 35. Transpiration pull and cohesion of water theory of ascent of sap was first proposed by: (a) Sachs (b) Dixon and Joly (c) Joly (c) Dixon 36. The scientists whose gave vital theories of ascent of sap in plants? (a) Bose (b) Godlewski (c) Strasburger (d) All of the above 37. Ascent of sap in higher plant takes place through: (a) Parenchyma (b) Xylem (c) Phloem (d) None of these 38. Which of the following most important in the transport of ionisable solutes across the membrane? (a) Electric potential gradient (b) Electrochemical potential gradient (c) Chemical potential gradient (d) Concentration of solutes 39. Facilitated diffusion of solutes through transporter proteins across the membrane is: (a) Secondary active transport process (b) Passive transport process (c) Active transport process (d) Both (b) and (c) 40. The mineral salts after being absorbed by epidermal cells of roots are transported to xylem by: (a) Symplastic pathway (b) Transmembrane pathway (c) Apoplastic pathway (d) All of the above 41. If a cell contain fixed cations in it and is placed in a salt solution containing cations and anions, then Donnan’s equilibrium will result in: (a) Equal numbers of cations and anions inside the cell Ans.

34. (c) 45. (a)

35. (b) 46. (b)

36. (d) 47. (a)

37. (b)

38. (b)

(b) Accumulation of anions inside the cell (c) Accumulation of cations inside the cell (d) None of the above 42. Which of the following enzymes has no role in Bennet–Clark’s protein– lecithin theory? (a) Choline esterase(b) Lecithinase (c) Choline acetylase (d) None of the above 43. Protein–lecithin theory of absorption of mineral salts was first proposed by: (a) Donnan (b) Lundegardh and Burstrom (c) Bennet-Clark (d) None of the above 44. Leguminous plants are able to fix atmospheric nitrogen through the process of symbiotic nitrogen fixation. Which one of the following statements is not correct during this process of nitrogen fixation? (a) Nitrogenase is insensitive to oxygen (b) The enzyme nitrogenase catalyses the conversion of atmospheric N2 to NH3 (c) Nodules act as sites for nitrogen fixation (d) Leghemoglobin scavenges oxygen and is pinkish in color 45. The common nitrogen-fixer in paddy fields is: (a) Oscillatoria (b) Azospirillum (c) Rhizobium (d) Frankia 46. One of the free-living anaerobic nitrogen-fixer is: (a) Rhizobium (b) Rhodospirillum (c) Beijernickia (d) Azotobacter 47. Which of the following statements is correct? (a) Extensive use of chemical fertilizers may lead to eutrophication of nearby water bodies 39. (b)

40. (d)

41. (b)

42. (d)

43. (c)

44. (a)

Model Test Papers

(b) At present, it is not possible to grow maize without chemical fertilizers (c) Cynobacteria such as anabaena and nostoc are important mobilizers of phosphates and for plant nutrition in soil (d) Both azotobacter and rhizobium fix atmospheric nitrogen in root nodules of plants 48. Which of the following is a flowering plant with nodules containing filamentous nitrogen-fixing microorganism? (a) Casuarina equisetifolia (b) Cicer arietinum (b) Cycas revolute (d) Crotalaria juncea 49. If by radiation all nitrogenase enzymes are inactivated, then there will be no: (a) Conversion from ammonium to nitrate in soil (b) Conversion from nitrate to nitrite in legumes (c) Fixation of atmospheric nitrogen (d) Fixation of nitrogen in legumes 50. Which of the following is an early product of sulfur assimilation in plants? (a) Cysteine (b) Coenzyme A (c) Methionine (d) None of these 51. Sulfur assimilation in higher plants occurs chiefly in the form of: (a) Immature seeds (b) Fruits (c) Roots (d) Leaves 52. Higher plants absorbs sulfur from the environment chiefly in the form of: (a) Sulfide (b) Sulfite (c) Sulfate (d) Sulfur dioxide 53. Which of the following compounds do not contain sulfur? (a) Biotin and lipoic acid (b) Coenzyme A and gulthathione Ans.

47. (a) 58. (d)

48. (a) 59. (c)

49. (d) 60. (a)

50. (a)

51. (d)

533

(c) Cysteine and thiamine (d) None of the above 54. Sulfur containing amino acids which constitute proteins are: (a) Methionine and histidine (b) Cysteine and serine (c) Cysteine and methionine (d) Histidine and tryosine 55. Which one of the following bacteria brings about denitrification of nitrates and nitrites to molecular nitrogen? (a) B vulgaris (b) Bacillus mycoides (c) B ramosus (d) None of these 56. The scientist among the following scientists (All Nobel Laureates), who not recipient of Nobel Prize of 1946 in Chemistry which was jointly awarded to three of them for their contribution in the preparation of enzymes and viruses in pure crystalline form? (a) WM Stanley (b) Sir Robert Robinson (c) Jhon H Northorp (d) James B Sumner 57. The first enzyme to be isolated in pure crystalline form was: (a) Diastase (b) Invertase (c) Urease (d) Zymase 58. Choose the incorrect statement: (a) Enzymes are biological catalysts (b) Enzymes are simple or combined proteins acting as specific catalysts (c) Enzymes are organic catalysts (d) None of the above 59. Expect for small group of catalytic RNA molecules, all enzymes are: (a) Lipids (b) Lipids and protein (c) Proteins (d) None of these 60. The word enzyme was coined by: (a) Willstatter (b) Traube (c) Louis pasture (d) FW Kuhne 52. (c)

53. (d)

54. (c)

55. (d)

56. (b)

57. (c)

534

Plant Physiology: Question Bank

61. Violet blue and red parts of spectrum of radiant energy are respectively in between: (a) 200–400 and 550–650 mm (b) 390–500 and 650–700 mm (c) 500–600 and 700–1000 mm (d) None of the above 62. Characteristic absorption peaks shown by chlorophyll a and chlorophyll b in vitro are respectively at: (a) 480, 650 and 435, 670 mm (b) 452, 642 and 410, 660 mm (c) 410, 660 and 452, 642 mm (d) None of the above 63. Which of the following pigments have open conjugated system of four pyrrole rings in their molecule? (a) Carotenoids (b) Chlorophylls (c) Phycobillins (d) All of the above 64. In chloroplasts, photodynamic damage is preserved by: (a) Carotenoids (b) Chlorophyll b (c) Phycobillins (d) None of these 65. Photosynthesis is: (a) Anabolic process (b) Amphibolic process (c) Catabolic process (d) None of the above

(a) Sucrose (d) Ribose

(b) Glucose (d) Starch

70. Carbohydrates in plant: (a) Are important constituents of nucleic acid (b) Act as energy reservoirs (c) Serve architectural functions (d) All of the above 71. The primary source of synthesis of carbohydrates in plant is: (a) CO2 of atmosphere through photosynthesis (b) Fat (c) Protein (d) None of these 72. Which of the following statements is most correct? (a) Carbohydrates correspond to general formula (CH2O)n (b) Carbohydrates are polyhydroxyaldehydes or polyhydroketones and their derivatives (c) Carbohydrates are hydrates of carbon (d) None of the above

68. Which of the following is not an oligosaccharide? (a) Raffinose (b) Sucrose (c) Maltose (d) Inulin

73. Fats are found in abundance in plants especially in: (a) Vegetative tissues (b) Reproductive tissues (c) Meristematic tissues (d) All of the above 74. Which of the following is not an unusual plant fatty acid? (a) Licanic acid (b) Stearic acid (c) Vernolic acid (d) Chaulmoogric acid 75. Common 18–C unsaturated fatty acid, oleic acid contains: (a) Two double bonds (b) One triple bond (c) One double bond (d) None of the above

69. Which of the following is not called sugar?

76. In fatty acids, numbering of carbon atoms (1, 2, 3. …….) is usually done

66. Molecular formulae of chlorophyll a and respectively are: (a) C40H56O2 and C40H56 (b) C40H56 and C40H56O2 (c) C55H72O5N6Mg and C55H70O6N4Mg (d) C55H70O6N4Mg and C55H72O5N6Mg 67. In aldose sugars, aldehyde group or the reducing center always lies at: (a) C–3 (b) C–1 (c) C–2 (d) None of these

Ans.

61. (b) 72. (b)

62. (c) 73. (b)

63. (c) 74. (b)

64. (a) 75. (c)

65. (a)

66. (c)

67. (b)

68. (d)

69. (d)

70. (d)

71. (a)

Model Test Papers

from carboxylic carbon side. Which of the following carbon atoms are also designated as  and  -carbon atoms respectively in the fatty acid? (a) Carbon atoms 2 and 3 (b) Carbon atoms 3 and 4 (c) Carbon atoms 1 and 2 (d) None of the above 77. Which will die first in a girdled plant? (a) Root (b) Fruits (c) Shoot (d) All of the above 78. Mass flow or pressure flow hypothesis was first put forward by: (a) de Vries (b) Craft (c) Munch (d) None of these 79. Which of the following constitute sources of photoassimilates in the plants? (a) Flowers (b) Leaves (c) Seeds (d) Fruits 80. Sink tissues or organs in higher plants are mainly: (a) Fruits and seeds (b) Young leaves (c) Stems and roots (d) All of these 81. Photosynthates are translocated from sources to sink organs mainly in the form of: (a) Starch (b) Sucrose (c) Fructose (d) Glucose 82. In which of the following do the two names refer to one and same thing? (a) Tricarboxylic acid cycle and urea cycle (b) Citric acid cycle and calvin cycle (c) Tricarboxylic acid cycle and citric acid cycle (d) Krebs cycle and calvin cycle 83. In mitochondria, protons accumulate in the: (a) Inner membrane (b) Outer membrane (c) Intermembrane space (d) Matrix Ans.

76. (a) 87. (c)

77. (a) 88. (c)

78. (c)

79. (b)

80. (d)

535

84. Which of the following is the key intermediate compound linking glycolysis to the Krebs cycle? (a) ATP (b) NADH (c) Acetyl CoA (d) Malic acid 85. In Krebs cycle, the FAD precipitates as electron acceptor during the conversion of: (a) -ketoglutarate to succinic CoA (b) Succinyl CoA to succinic acid (c) Succinic acid to fumaric acid (d) Fumaric acid to malic acid 86. Read the following four statements (A–D): A: Both photophosphorylation and oxidative phosphorylation involve uphill transport of protons across the membrane B: In dicots stems, a new cambium originates from cells of pericycle at the time of secondary growth C: Stamens in flowers of Gloriosa and petunia are polyandrous D: Symbiotic nitrogen-fixers occur in free-living state also in the soil How many of the above statements are right? (a) A (b) B (c) C (d) D 87. Dough kept overnight in warm weather becomes soft and spongy because of: (a) Osmosis (b) Cohesion (c) Fermentation (d) Absorption of carbon dioxide from atmosphere 88. In higher plants, which of the following is true for physiological effect of auxin, except: (a) Auxin high conc. initiates more lateral branch roots (b) Auxin stimulates to cell elongation in the plants (c) Auxin prevents to senescence in plants 81. (b)

82. (c)

83. (c)

84. (c)

85. (c)

86. (b)

536

Plant Physiology: Question Bank

(d) Auxin enhance to the apical dominance 89. Which of the following amino acids is precursor of auxin in plants? (a) Tyrosine (b) Tryptophan (c) Proline (d) Both (a) and (b) 90. Which one of the following is the true statement about auxins in the plants, expect? (a) Conjugated or bound auxins complexes with proteins or amino acids (b) Conjugated or bound auxins complexes with lipids (c) Conjugated or bound auxins complexes with inositol (d) Conjugated or bound auxins complexes with carbohydrates 91. Can be regulate plant cell organelle functions, e.g. ATP synthesis in chloroplasts and mitochondria. Which one of the following is PGRs play the specific role? (a) Plant peptide hormones (b) Polyamines (c) Nitric oxide (d) None of these 92. Which of the following phytohormone promoting to the fruit ripening? (a) Gibberellin (b) Abscisic acid (c) Ethylene (d) Both (b) and (c) 93. “Transpiration is a necessary evil” was said by: (a) Curtis (b) Anderson (c) Steward (d) Bose 94. Wooden doors swell up and get stuck during rainy season due to: (a) Exosmosis (b) Capillary (c) Imbibition (d) Endomosis 95. When half the leaves are removed randomly, transpiration will show: (a) Both magnitude and flux decrease (b) Both magnitude and flux increase (c) Lower magnitude and higher flux (d) Higher magnitude but lower flux or rate per unit Ans.

89. (b) 100. (a)

90. (b) 1. (a)

91. (c) 2. (b)

92. (d) 3. (b)

93. (a)

96. Shrinking of protoplasm from cell wall under influence of hypertonic solution is: (a) Flaccidity (b) Plasmosis (c) Turgidity (d) Apoptosis 97. Latest explanation for closure of stomata is: (a) ABA theory (b) Starch glucose theory (c) Active K+ ions theory (d) None of the above 98. A cell shrinks on being kept in a solution. The solution is: (a) Hypertonic (b) Isotonic (c) Hypotonic (d) None of these 99. Nonfunctional stomata can be seen in: (a) Lotus (b) Hydrilla (c) Pea leaves (d) Mango leaf 100. Maximum transpiration occurs in: (a) Mesophytic plants (b) Hydrophytic plants (c) Xerophytic plants (c) Algal cells MODEL TEST PAPER 10

1. Seeds soaked in water imbibe the same because of: (a) Adsorption (b) Higher OP (c) Lower OP (d) Pressure of vacuoles 2. Largest cell of the human body is: (a) Voluntary muscle fibre cell (b) Nerve cell (c) Striated muscle fibre cell (d) Cardiac muscle fibre cell 3. An enzyme can be synthesized by chemically bonding together the molecules of: (a) Carbohydrates (b) Amino acids (c) Lipase (d) CO2 4. Basic feature of Kranz anatomy of C4 plants is: (a) Presence of chloroplasts in bundle sheath cells 94. (c)

95. (c)

96. (b)

97. (a)

98. (a)

99. (b)

Model Test Papers

(b) Presence of chloroplasts in mesophyll and epidermal cells (c) Presence of typical granal chloroplasts in bundle sheath cells and rudimentary chloroplasts in mesophyll cells (d) Presence of rudimentary chloroplasts in bundle sheath cells and typical granal chloroplasts in mesophyll cells 5. A nucleated differentiated cell that has lost the power to dedifferentiate is: (a) Nerve cell (b) Kidney cell (c) Liver cell (d) All of the above 6. Biological activity of IAA tested by: (a) Glycin max callus test (b) Avena curvature test (c) Xanthium leaf disc test (d) All of these 7. Which of the following is correct about nitrate reductase? (a) FAD, Mo and heme act as prosthetic groups (b) Catalyzes conversion of NO –3 to NH4+ (c) FADH2 acts as electron donor (d) Very sensitive to O2 8. By decreasing photorespiration and efficiently carrying out photosynthesis, C4 plants can: (a) Reduce stomatal opening and thus reduce leaf temperature (b) Reduce stomatal opening and thus increase water loss (c) Increase stomatal opening and thus increase water loss (d) Increase stomatal opening and thus increase transpiration rates 9. A carotenoid-less mutant plant was grown under normal sunlight, it will experience: (a) Increased photosynthetic rate (b) Increased chlorophyll biosynthesis (c) Reduced photorespiration Ans.

4. (c) 15. (d)

5. (a) 16. (a)

6. (b)

7. (a)

8. (b)

537

(d) Increased chlorophyll oxidation and necrosis 10. Conversion of starch into organic acid is essential for: (a) Stomatal opening (b) Stomatal closure (c) Stomatal growth (d) Stomatal initiation 11. The dodder (Cuscuta) is a: (a) Total stem parasite (b) Total root parasite (c) Partial stem parasite (d) Partial root parasite 12. Which of the following is iron porphyrin coenzyme or cofactor? (a) Coenzyme A (b) Cytochrome (c) NAD (d) FAD 13. Nonsymbiotic nitrogen fixing prokaryote is: (a) Rhizobium (b) Nostoc (c) Frankia (d) Azotobacter 14. First successful culture was obtained by: (a) Haberlandt (b) White (c) Skoog and Miller (d) Steward et al 15. Which one of the following is an antiauxin substance? (a) NTA (b) DCA (c) TIBA (d) All of the above 16. In crassulacean acid metabolism (CAM) plants: (a) Phosphoenol pyruvate carboxylase reduces CO2 to make malic acid (b) Vascular tissue is surrounded by a bundle sheath (c) Vascular tissue is surrounded by a bundle sheath (d) RuBisCo is activated only at night 17. Light waves shorter than 200 nm are not useful for photosynthesis because these: (a) Break weak bonds 9. (d)

10. (a)

11. (a)

12. (b)

13. (d)

14. (b)

538

Plant Physiology: Question Bank

(b) Cause all atoms in the cell to lose electrons (c) Do not pack enough energy to raise an electron to a higher orbital (d) All the above 18. The selectively permeable membrane of the cell is: (a) Plasmalemma (b) Cytoplasm (c) Cell wall (d) None of these 19. Cell theory was put forward by: (a) Schleiden and Schwann (b) Sutton and Boveri (c) Watson and Crick (d) Darwin and Wallace 20. In xerophytes the presence of thick cuticle scales and an few sunken stomata on the leaf is to: (a) Reduce transpiration (b) Increase transpiration (c) Protect from light (d) None of these 21. Which of the following statements is incorrect? (a) At optimum pH, the activity of enzyme is maximum (b) Enzymes are not affected by hydrogen ion concentration (c) The optimum pH for pepsin is 2.0 (d) The optimum pH for trypsin is 8.8 22. Die-back disease of citrus is caused by: (a) Virus (b) Fungus (c) Bacterium (d) Cu-deficiency 23. Pruning induces dense growth of hedges because: (a) Root sprouts additional branches (b) Apical dominance is removed (c) Injury induces dense growth (d) None of these 24. Which of the following is the most adundant protein in leaves? (a) Chlorophyll a/b binding protein (b) ATP synthase Ans.

17. (b) 28. (d)

18. (a) 29. (b)

19. (a) 30. (b)

20. (a)

21. (b)

(c) Ribulose-1,5 bisphosphate carboxylase (d) Globulins 25. Who among the following gave chemical composition of chlorophyll, carotenes and xanthophylls: (a) Fleming and Waksman (b) Willstatter and Stoll (c) Park and Biggins (d) Meyer and Calvin 26. The experiment material used by van Neil, to prove that O2 comes out from water was: (a) Chlorella pyrenoidosa (b) Scendesmus (c) Blue green algae (d) Chromatium vinosum 27. The activator of carbonic anhydrase which is fastest enzyme RBC in of our body is: (a) Cobalt (b) Zn (c) Fe++ (d) Cl– 28. Insectivorous plants are usually adapted to: (a) Water rich soils (b) Soil deficient in sugars (c) Soils rich in trace elements (d) Soils deficient in nitrogenous compounds 29. Wilting of plants occurs when: (a) Phloem is blocked (b) Xylem is blocked (c) Both (a) and (b) (d) A few roots are removed 30. Letter S in the structural unit of ribosome denotes: (a) Concentration unit (b) Svedberg unit (c) Polymerization unit (d) Stability unit 31. When leaves are floated on dilute glycolate solution, the stomata: (a) Closes completely 22. (d)

23. (b)

24. (c)

25. (b)

26. (d)

27. (b)

Model Test Papers

(a) Emerson (c) Arnon

(b) Open completely (c) Closes partially (d) Open partially 32. The transfer of a group from a donor molecule to an acceptor molecule is catalyzed by: (a) Transferase (b) Isomerase (c) Protease (d) Hydrolytic enzymes 33. Rapid deterioration of root and shoot tip occurs due to the deficiency of: (a) Calcium (b) Phosphorus (c) Nitrogen (d) Carbon 34. Which hormone is responsible to cause bakane disease of rice? (a) GA (b) IAA (c) IBA (d) Ethylene 35. A decrease in photosynthetic rate with increased availability of oxygen is called: (a) Warbing effect (b) Richmond–Lang effect (c) Blackman’s law of limiting factors (d) Emerson’s enhancement effect 36. The mass flow hypothesis was first described by: (a) Kurosawa (b) Swanson (c) Munch (d) Buchanan

539

(b) Hill (d) Blackman

40. Which organism does not evolve oxygen in photosynthesis? (a) Anabaena (b) Funaria (c) Higher plants (d) Rhodospirillum 41. Which of the following is a micronutrient? (a) Calcium (b) Phosphorus (c) Copper (d) Magnesium 42. Temporary wilting in plants occurs when the rate of absorption is: (a) Equal to transpiration (b) Equal to respiration (c) Less than transpiration (d) Less than respiration 43. Root pressure is absent in: (a) Dicots (b) Monocots (c) Mango (d) Gymnosperms 44. Turnover number of enzyme depends upon: (a) Molecular weight of enzyme (b) Size of enzyme molecule (c) Active sites of enzyme molecule (d) Concentration of substrate molecule

37. Competitive inhibitors are those which: (a) Act as coenzyme for reaction (b) Alter the structure of enzyme molecule (c) Compete for same active site of enzyme (d) Both (a) and (c) 38. Mineral requirement is studied through hydroponics which is related to growing plants in: (a) Soil (b) Air (c) Solution (d) Ponds

45. Auxin and cAMP promote: (a) Partial opening of stomata (b) Complete opening of stomata (c) Partial closing of stomata (d) None of these 46. Which hormone was discovered from pith cells of tobacco plant? (a) Cytokinin (b) GA (c) IBA (d) ABA

39. Evidence for the existence of two photochemical systems in photosynthesis was provided by:

48. The porphyrin ring of chlorophyll molecule is a complex ring structure of:

Ans.

31. (b) 42. (c)

32. (a) 43. (d)

33. (a) 44. (c)

34. (a) 45. (b)

35. (c) 46. (a)

47. Chlorophyll ‘b’ is present in: (a) Prokaryotes (b) Eukaryotes (c) Both (a) and (b) (d) Bacteria

36. (c) 47. (b)

37. (c)

38. (c)

39. (a)

40. (a)

41. (c)

540

Plant Physiology: Question Bank

(a) Double bonds (b) Triple bonds (c) Alternating double and single bond (d) Alternating double and triple bonds 49. Cellular totipotency is demonstrated by: (a) Only gymnosperm cells (b) All plant cells (c) All eukaryotic cells (d) Only bacterial cells 50. Deficiency of potassium in plant causes: (a) Increased apical dominance (b) Decreased apical dominance (c) Increased monopodial growth (d) Increased secondary growth 51. Most widely accepted explanation for ascent of sap in plant is: (a) Role of atm. pressure (b) Capillary theory (c) Transpiration cohesion theory (d) Imbibition theory 52. For the enzyme action: (a) Value of Km is low (b) Value of Ki is low (c) Value of Km is high (d) Value of Ki is high 53. Stomata are more widely open in: (a) Far red light (b) Green light (c) Blue light (d) Orange light 54. Temporary wilting in plants occurs when the rate of absorption is: (a) Equal to transpiration (b) Equal to respiration (c) Less than transpiration (d) Less than respiration 55. The movement observed in a telegraph plant is an example of: (a) Thigmotropism (b) Phototropism (c) Movement of variation (d) None of these 56. Microelement required for synthesis of IAA is also a cofactor for enzyme: Ans.

48. (a) 59. (c)

49. (b) 60. (a)

50. (b) 61. (d)

51. (c) 62. (c)

52. (b) 63. (b)

(a) Nitrogenase (b) Catalse (c) PEP carboxylase (d) Carbonic anhydrase 57. Triplet fibrils of a centriole are tilted at an angle of: (a) 40° (b) 30° (c) 20° (d) 10° 58. Respiration is: (a) Aerobic (b) Anaerobic (c) Both (a) and (b) (d) Fermentation 59. Photosynthetically active radiation is represented by the range of wavelength of: (a) 640–650 nm (b) 600–950 nm (c) 400–700 nm (d) 340–450 nm 60. Warburg effect is due to: (a) Competition of CO 2 and O 2 for enzyme RuBP carboxylase (b) Competition of CO 2 and O 2 for enzyme PEP carboxylase (c) Competition of CO2 and N2 for PEP carboxylase (d) Competition of CO2 and O2 for both RuBP carboxylase and PEP carboxylase 61. What is the action spectra of transpiration? (a) Green and ultraviolet (b) Orange and red (c) Blue and far red (d) Blue and red 62. Photorespiration in C 3 plants starts from: (a) Phosphoglycerate (b) Phosphoglycolate (c) Glycerate (d) Glycine 63. ‘Micrographia’ was written by: (a) Grew (b) Hooke (c) Brown (d) Lamarck 64. Which is best evidence for Lock and Key theory (template theory)? (a) Non-competitive inhibition (b) Allosteric inhibition 53. (c) 64. (a)

54. (c)

55. (c)

56. (d)

57. (a)

58. (c)

Model Test Papers

(c) Competitive inhibition (d) Feedback inhibition 65. Which microtubule or subfibre of the triplet disappears while passing through basal plate? (a) C (b) A (c) B (d) None of these 66. Commonest ion in the cell is of: (a) Phosphorus (b) Potassium (c) Iron (d) Sulfur 67. Stomatal pores open when: (a) H+ ions are pumped into the guard cells (b) K+ ions are pumped out the guard cells (c) Water moves into guard cells in response to a decrease in water potential in the guard cells (d) Water moves out guard cells in response to a decrease in water potential in the guard cells 68. The activity of an enzyme declines: (a) Above the optimum temperature (b) Below the optimum temperature (c) Both above and below the optimum temperature (d) Below the minimum and above the maximum temperature 69. If the seeds are too deep in soil seedling could not come out because: (a) Starch (b) Abscisic acid (c) Lack of oxygen (d) The seedlings cannot come up to soil surface 70. Auxin and cAMP promote: (a) Partial opening of stomata (b) Complete opening of stomata (c) Patial closing of stomata (d) None of these 71. An essential micronutrient of certain plants and used in cancer therapy is: (a) Calcium (b) Potasium (c) Iron (d) Cobalt Ans.

65. (a) 76. (a)

66. (b) 77. (b)

67. (c) 78. (a)

68. (c) 79. (c)

69. (c)

541

72. Hill reaction occurs in: (a) High altitude plants (b) Total darkness (c) Absence of water (d) Presence of ferricyanide 73. It is possible to induce flowering in long-day plants under short-day condition by use of: (a) GA (b) IAA (c) 2,4-D (d) Zeatin 74. Both respiration and photosynthesis require: (a) Sunlight (b) Chlorophyll (c) Glucose (d) Cytochromes 75. The percentage of light energy utilized for photosynthesis by higher plants is: (a) 100 (b) 50 (c) 10 (d) 1–2 76. Enzymes with same function property and different molecular structure are called: (a) Isoenzyme (b) Coenzymes (c) Isomerases (d) Zymases 77. Light waves shorter than 200 nm are not useful for photosynthesis because these: (a) Break weak bonds (b) Cause all atoms in the cell to lose electrons (c) Do not pack enough energy to raise an electron to a higher orbital (d) All the above 78. Cutting of seed coat to facilitate the entry of water and oxygen is known as: (a) Scarification (b) Dormancy (c) Senescence (d) Culture 79. In photosynthesis: (a) No ATP is formed (b) ATP is formed in initial stages (c) Water is not involved (d) Oxygen comes from carbon dioxide 80. An essential micronutrient of certain plants and used in cancer therapy is: 70. (b)

71. (d)

72. (c)

73. (a)

74. (d)

75. (d)

542

Plant Physiology: Question Bank

(a) Calcium (c) Iron

(b) Potasium (d) Cobalt

81. It is believed that florigen comprises: (a) GA and anthesin (b) Auxin and GA (c) GA and cytokinin (d) None of these 82. Presence of which of the following in a seed is associated with dormancy? (a) Starch (b) Abscisic acid (c) Ethylene (d) Gibberellic acid 83. Hormone involved in phototropism is: (a) IAA (b) Gibberellin (c) Kinetin (d) 2,4-D 84. Isoenzymes are structural variants of same enzyme. LDH (lactic dehydrogenase) has 5 isomers in liver. -amylase in wheat endosperm has how many isoenzymes? (a) 4 (b) 5 (c) 16 (d) None of these 85. Number of dynein arms: (a) Four attached to subfibre B (b) Two attached to subfibre B (c) Two attached to subfibre A (d) Four attached to subfibre A 86. Cilium or flagellum is structurally bilateral due to presence of: (a) Central sheath (b) Singlet fibrils (c) Double bridge (d) Both b and c 87. A cilium beats: (a) Asymmetrically by sweeping action (b) Symmetrically by sweeping action (c) Symmetrically by undulatory action (d) Asymmetrically by undulatory action 88. Supply of excess fertilizer and watering of a grass lawn causes browning of grass leaves due to: (a) Decreased photosynthesis (b) Water-logging of soil Ans.

80. (d) 91. (a)

81. (a) 92. (d)

82. (b) 93. (a)

83. (a) 94. (b)

84. (c) 95. (c)

(c) Leaching of fertilizer to lower soil strata (d) Osmosis and death of root 89. Instrument used for measuring ‘stomatal pressure’ is: (a) Porometer (b) Callipers (c) Photometer (d) Micronare 90. Match the columns and find the correct combination: (a) N (i) Coppery texture of leaf (b) Mg (ii) Premature leaf fall (c) Bo (iii) Interveinal chlorosis (d) P (iv) Mottled chlorosis and necrosis (A) (a)–iv, (b)–i, (c)–ii, (d)–iii (B) (a)–i, (b)–ii, (c)–iii, (d)–iv (C) (a)–iv, (b)–iii, (c)–i, (d)–ii (D) (a)–iv, (b)–ii, (c)–i, (d)–iii 91. During absorption of water by roots, the water potential of cell sap is lower than that of: (a) Pure water and soil solution (b) Neither pure water nor soil solution (c) Pure water but higher than that of soil solution (d) Soil solution but higher than that of pure water 92. Plant cells kept in hypertonic solution will get: (a) Lysed (b) Turgid (c) Deplasmolysed (d) Plasmolysed 93. 0.01 M solution of solute (nonelectrolyte) will have a water potential of: (a) –2.3 bars (b) Zero (c) 2.3 bars (d) 22.4 bars 94. The movement of free atoms from higher concentration to lower concentration is called: (a) Osmosis (b) Diffusion (c) Endosmosis (d) Exosmosis 95. An element useful in seed germination is: (a) Iron (b) Magnesium (c) Boron (d) Zinc 85. (c)

86. (d)

87. (a)

88. (d)

89. (a)

90. (c)

Model Test Papers

96. Which of the following factors affect temperature and rainfall condition? (a) Transformation (b) Transpiration (c) Photosynthesis (d) Translocation 97. Conversion of starch into organic acid is essential for: (a) Stomatal closure (b) Stomatal completely (c) Opening of stomata (d) Stomatal ontogeny 98. Which ones are primarily absorbed by carotenoids? (a) Blue and green (b) Green and red (c) Red and violet (d) Violet and blue

Ans.

96. (b)

97. (c)

98. (c)

99. (d) 100. (d)

543

99. Which of the following statement(s) is/are correct? (a) Water lost by transpiration is pure water (b) The cause of guttation is mainly root pressure (c) Rate of transpiration is dependent upon vapor pressure deficit (d) All the above statement are correct 100. In plants, enzymes are present: (a) Only in leaves (b) Only in storage organs (c) Only in flowers (d) In all the living cells of the plant body

544

Plant Physiology: Question Bank

Study Questions point the functions of the different cell organelles. 12. Give the function of: (i) Endoplasmic reticulum, (ii) Lysosomes, (iii) Ribosomes, (iv) Mitochondria, (v) Golgi bodies. 13. With the aid of a sketch, describe the living contents of typical plant cell and state their functions. 14. Describe the structure of a typical mitochondrion. 15. Enumerate the cell organelles. Mention briefly the physiological role of anyone of them. 16. By the help of labeled sketches only show the structure of chloroplast and mitochondria. 17. What are the cell organelles? Describe the structure and function of the following: (a) Mitochondria (b) Endoplasmic reticulum (c) Golgi bodies 18. Differentiate between (a) Ribosomes and lysosomes (b) Apoplast and symplast. 19. Explain the structure and function of ribosomes. 20. Describe the structure and function of plasma membrane. 21. Define cell and illustrate briefly that the cell is the structural and functional unit. 22. Justify the statements “The use of electron microscope has helped in a

1. Plant Cell

1. Give an illustrated account of ultrastructure of a plant cell. How does a plant cells differ from an animal cell? 2. Why is mitochondria called “power house of the cell”? 3. Why chloroplast is called “The Kitchen of the cell”? 4. Describe the structure of chromosome in the light of recent researches. 5. What are the cell organelles? Describe the structure and function of the following: (i) Mitochondria (ii) Chloroplast (iii) Ribosomes (iv) Liposomes 6. Give a brief account of the structure and function of the plasma membrane. 7. Write briefly the structure and function of cell wall. Describe its biogenesis. 8. The vacuoles are no more considered to be inert storage bags. Comment upon this statement. 9. Write briefly the morphology and chemical combination of chromosomes. 10. Give a brief account of the structure and function of following cell organelles: (i) Ribosomes (ii) Peroxisomes (iii) Lysosomes (iv) Golgi complex. 11. Give an illustrated account of the fine structure of a typical plant cell and 544

Study Questions

better understanding of the structures of the cell”. 23. Describe the nature and composition of plastids. 24. Justify the statement “cell is the chemical and biochemical basis of life”. 25. Describe briefly: (i) Distribution of enzymes in mitochondria. (ii) Light harvesting complex of the chloroplast. (iii) GERL (iv) Difference between 70 S and 80 S types of ribosomes. (v) Microsomes (vi) Microtubules (vii) Ultrastructure of flagellum (viii) Endoplasmic reticulum (ix) Glyoxysomes and spherosomes (x) Origin of chloroplast and mitochondria (xi) Functions of mitochondria. (xii) Molecular organization of thylakoids (xiii) Protoplasm (xiv) Chemical changes in plant cell wall. 26. Give the function of (i) Ribosomes (ii) Nucleolus (iii) Mitochondria 27. Explain briefly ultrastructure of chloroplast. 28. Write note on structure of chloroplast. 29. Write short notes on: (i) Structure of mitochondria (ii) Chloroplast (iii) Polyribosome (iv) Thylakoid (v) Plasmalemma (vi) Colloidal nature of protoplasm (vii) Polysomes (viii) Unit membrane (ix) Peroxisome (x) Apoplast 30. Write notes on: (i) Ribosomes (ii) Chloroplasts (iii) ATP

545

2. Water, Solutions, Suspensions and Colloidal Systems

1. What do you understand by solutions, suspensions and colloidal system? Give important properties of colloidal solutions. 2. How will you differentiate a true solution from a colloidal solution? 3. Describe some important functions of water in plants. 4. Describe the structure of water molecule. 5. Discuss how the physical constants of water contribute to the versatility of the molecules? 6. Define pH. Describe how various buffers maintain pH of the cell sap. 7. Describe the water potential, pressure potential and osmotic potential and their interrelationship in a plant cell. 8. Describe how osmosis can help in the movement of the water in plant. 9. Describe various ways of measuring water potential of a plant tissue. 10. Describe the following: (i) Hydrophilic and hydrophobic colloids (ii) Particulate nature of the colloids (iii) Lewis concept of acids and bases (iv) Ammonium ion as an acid. 11. How will you differentiate a true solution and a colloidal solution? 12. What are the basic differences between a true solution an, a suspension and a colloidal solution? Which of the 3 system occurs in living protoplasm? 13. Why water is so important for plant life? 14. Mention the biological importance of the water. 15. What factor(s) is/are responsible for the polar nature of water molecules? 16. Give some important properties of colloidal solutions in brief. 17. Write short notes on: (i) Adsorption (ii) Hydrophilic and hydrophobic colloids

546

Plant Physiology: Question Bank

(iii) Electrophoresis (iv) Importance of water for plant (v) Physical properties of water (vi) Colloidal systems 3. Diffusion, Osmosis and Imbibition

1. Discuss the relationship between osmotic pressure, turgor pressure and diffusion pressure deficit of a vacuolated plant cell. 2. Discuss the relation between the various osmotic, quantities in a plant cell under normal and stress conditions. 3. What do you understand by water potential? Establish the relationship between solute potential, matrix potential, pressure potential and water potential. 4. Describe membrane permeability in relation to plant cell. Which of the theory explains best the permeability of membrane? 5. Distinguish between the following: (i) Diffusion and activated diffusion (ii) Diffusion and osmosis (iii) Imbibitions and permeability (iv) Endosmosis and exosmosis (v) Osmosis and imbibitions (vi) Osmotic pressure and diffusion pressure (vii) Water potential and diffusion pressure deficit (viii) Incipient and evident plasmolysis 6. Describe imbibitions, with respect to osmotic effect and its quantitative aspects. 7. Explain the various phenomena found in plants (diffusion, osmosis, plasmolysis and imbibition) and their relationships. 8. Discuss briefly ‘Protoplasm is a complex colloidal system’. 9. Explain the phenomenon of plasmolysis. How can you make use of it in determining the osmotic pressure of cell sap. 10. Grape fruits usually burst when they kept in the ordinary water.

11. You are provided with a Tradescantria leaf epidermis and 3 test tubes having sugar solutions of different concentrations. How you prove which solution is of highest and which one of the lowest– concentration? 12. Differentiate between osmotic pressure, turgor pressure. 13. Explain the relation between osmotic pressure, turgor pressure and suction pressure (DPD). 14. Define diffusion pressure deficit (DPD). 15. Explain the term turgor pressure. 16. Discuss the relation between the various osmotic quantities in a plant cell under normal and stress conditions. 17. Discuss the water relations of a plant cell. 18. Explain osmosis and osmotic pressure. Describe how these are related to the life of a plant. 19. Differentiate between pressure potential and osmotic potential of a cell. 20. What is the reason that the cell sap of roots of the halophytic plants has normally higher osmotic pressure than that of the cell sap of mesophytic plants? 21. Distinguish between osmotic pressure and diffusion pressure deficit. 22. What do you understand by diffusion, imbibitions and osmosis? How do these processes help plants to absorb water? 23. Differentiate exosmosis and endosmosis. 24. Distinguish between: (i) Osmotic pressure and turgor pressure (ii) Diffusion pressure deficit and water potential 25. Define OP, TP, WP and DPD. Indicate their relationship if any, in a plant cell. 26. Explain plasmolysis. What are its advantages? How would you determine OP of the cell sap by plasmolytic method?

Study Questions

27. Differentiate between: (i) Osmotic pressure and suction pressure (ii) Osmosis and diffusion 28. What is water potential? Write its significance in plant life. 29. What is osmotic pressure? Differentiate between osmotic pressure (OP) and diffusion pressure deficit (DPD). 30. Characterize water potential of a cell. What are its components? How are they interrelated, (a) under isotonic conditions; (b) at maximum turgidity of a cell? 31. What is water potential? How it used to explain osmotic relations of the cells? 32. Write a short note on plasmolysis. 33. Write note on incipient plasmolysis. 34. Write short notes on: (i) Diffusion pressure deficit (ii) Osmotic relations of plant cell (iii) Structure of plasmolyzed cell (iv) Gaseous diffusion (v) Turgor pressure (vi) Practical applications of plasmolysis (vii) Diffusion (viii) Osmotic pressure 35. Write the short notes on: (a) Plasmolysis (b) Diffusion pressure deficit (c) Water potential (d) Imbibition (e) Plant cell as osmotic system (f) Osmosis (g) Permeability (h) Hypotonic solution 4. Absorption of Water

1. Explain the water absorption. In higher plants. What are the various external factors that after absorption of water? 2. Discuss osmotic and nonosmotic theories of active water absorption. How will you explain the difference between active and passive absorption? 3. What do you mean by “Ascent of sap”? Describe various theories involved in

547

the discussion of the phenomenon in higher plants. 4. Discuss the factors which regulate water movement in plants. 5. Which theory, i.e. physical or physiological, best explains the mechanism of water upliftment in higher plants? 6. Differentiate between the following: (i) Active and passive absorption (ii) Osmotic theory and nonosmotic theory of water absorption (iii) Physical and physiological dryness. (iv) Temporary wilting and permanent wilting (v) Field capacity and readily available water (vi) Chesard and echard 7. Describe some important function of water in plants. 8. Discuss the structure of water molecule. 9. Discuss how the physical constants of water contribute to the versatility of the molecule. 10. Describe water potential, pressure potential and osmotic potential and their interrelationship in a plant cell. 11. Discuss how osmosis can help in the movement of water in the plant. 12. Describe various ways of measuring water potential of a plant tissue. 13. Describe imbibitions, with respect to osmotic effects and its quantitative aspects. 14. Discuss water related values of soil which determine the availability of water to the plants growing in it. 15. Describe the process of active absorption of water by roots. How does root pressure contribute to the process? 16. Give a brief account of factors affecting water absorption. 17. Discuss water related values of soil which determine the availability of water to the plants growing in it. 18. Describe the process of active absorption of water by the roots. How does root pressure contribute to the process?

548

Plant Physiology: Question Bank

19. Give a brief account of the factors affecting water absorption. 20. Write an essay on absorption and translocation of water. 21. How will you differentiate active and passive absorption? 22. How will you prove the root pressure? 23. Give an account of osmotic uptake of the water. 24. Explain what is meant by active and passive absorption of water in plants? Indicate briefly the probable processes concerned on active absorption. 25. Differentiate between (i) Gravitational, capillary and hygroscopic waters (ii) Field capacity and permanent wilting percentage 26. Comment briefly on the relative importance of active and passive absorption of water. 27. Explain the mechanism of entry of water in plants. 28. Distinguish between passive absorption of water and active absorption of water. 29. Describe the mechanism of active and passive absorption of water by roots. 30. Describe the mechanism of water absorption of water by roots of higher plants. 31. Explain the mechanism of water absorption in land plants. 32. Describe any two hypotheses of the active absorption of water. 33. Describe the mechanism of water absorption in plants. 34. Explain the process of water absorption and the factors affecting in the rate of absorption. 35. Explain the mechanism of absorption by land plants. 36. How is water absorbed by the land plants? Describe the various external conditions affecting the rate of absorption. 37. How is water absorbed by the land plants? Describe the various external

conditions affecting absorption of water by roots. 38. Explain the process of absorption of water in plants using energy. 39. Write the factors affecting water absorption. 40. Write note on wilting coefficient, physiological dryness. 41. Write a note on wilting. 42. Write short notes on: (i) Water holding capacity. (ii) Root pressure. 43. Temporary and permanent wilting. 44. Gravitational water. 45. Passive absorption of water. 46. Soil water. 47. Active absorption of water. 48. Physiological dryness. 49. Role of root hairs in plant life. 50. Mechanism of osmotic absorption of water by roots. 51. Apoplastic and symplastic movement of water. 5. Transrespiration and Guttation

1. What is transpiration? How does it differ from guttation and exudation? Give the mechanism of stomatal transpiration. 2. Explain the role of light and CO2 in the mechanism of stomatal movement. 3. What are the different modes of water loss from plants? Explain the factors affecting transpiration. 4. Give the current concept of stomatal movement. 5. Define transpiration. Discuss briefly the useful purposes, it serves in the plant. 6. Discuss briefly the mechanism of opening and closing of stomata. Describe the classical theory of its mechanism. 7. Describe proton secretion theory of stomatal opening and closing. OR Discuss the involvement of K+ and H+ in stomatal opening and closing.

Study Questions

8. Give a brief account of factors affecting the rate of transpiration. 9. Describe few methods of measuring the rate of transpiration. 10. Describe the role of following factors in stomatal opening and closing: (i) Light, (ii) CO2. 11. What is transpiration? Discuss its significance in plant life. 12. Write an essay on ‘The stomata and their role in transpiration’. 13. Explain the role of light and CO2 in the mechanism of opening and closing of stomata. 14. Explain how humidity, temperature and light affect transpiration. 15. Leaves which have wilted in the afternoon usually recover at night, Why? 16. Comment briefly mechanism of stomatal movement. 17. Transpiration is less during rainy season. Comment. 18. Differentiate between transpiration and guttation. 19. Describe the mechanism of opening and closing of stomata. 20. Describe the structure of stomata. Discuss the mechanism of stomatal movement and factors influencing it. Throw light on their functions. 21. What are the different ways of loss water from plant? Explain the factors affecting transpiration. 22. Describe the mechanism of transpiration in plants. Point out the beneficial and harmful effects of the process. 23. Distinguish between stomatal transpiration and lenticular respiration. 24. Explain exist of water from leaves. 25. Explain the structure, function, their different positions and the working of stomata. Discuss its role in different physiological processes. 26. Give a brief account of the mechanism of stomatal movement.

549

27. Write an essay on transpiration and its advantages to the plant. 28. Transpiration is often described as a necessary evil. How far do you agree with this statement? 29. Discuss the mechanism of transpiration in plants and state the factors affecting it? 30. What is transpiration? Mention various factors that affect the rate of transpiration. 31. Distinguish between transpiration and guttation. 32. Evaporation and transpiration. 33. “Transpiration is a necessary evil”. Justify the statement. How plants control the excessive loss of water? 34. What is transpiration? Describe the mechanism of stomatal transpiration. 35. Give the brief account of the process of the transpiration in plants. Mention the various factors that influence the rate of transpiration. 36. Comment briefly on the factors affecting transpiration. 37. Write an account of various theories which explain mechanisms of opening and closing of stomata. 38. Describe the ATP-driven proton– potassium exchange mechanism in guard cells. 39. Explain the potassium pump theory on stomatal movement. 40. Discuss the involvement of K+ and H+ in stomatal opening and closing. 41. Draw VS of hydathode and label its part. 42. Write explanatory note on stomatal regulation of transpiration. 43. Write notes: (i) Stomatal movements. (ii) Active potassium transport mechanism. (iii) Transpiration is a necessary evil. (iv) Role of stomata in transpiration. (v) K+-malate hypothesis for stomatal transpiration.

550

Plant Physiology: Question Bank

6. Translocation of Organic Solutes

1. Explain in detail the transpiration pull and cohesion of water theory of ascent of sap. 2. How will you prove the fact of transpiration pull? 3. Can the ascent of sap occur in trees by root pressure only? Explain. How do you account for the ascent of sap in plants? 4. How do plants transport water to far off regions? 5. With which physiological process the name “Dixon” is associated and how? 6. Describe Dixon’s theory of ascent of sap in plants. 7. Comment on the role of transpiration pull and water cohesion in ascent of sap. 8. Give an account of the various theories proposed for the ascent of sap. 9. Describe the relationship between ascent of sap and transpiration in plants. 10. Explain the mechanism of ascent of sap in plants. 11. Explain cohesion theory of ascent of sap in plants. 12. What is cell sap? Describe the mechanism of ascent of sap. 13. How would you differentiate root pressure and transpiration pull. 14. Discuss various theories put forth to explain the mechanism of ascent of sap in the land plants. 15. Give an account of the various forces concerned in the ascent of sap in plants. 16. Justify Dixon and Joly’s theory of ascent of sap in trees. 17. Discuss in detail the various theories that have been put forward to explain mechanism of ascent of sap in higher plants. 18. Explain briefly cohesion-tension theory. 19. Describe how transpiration pull causes ascent of sap in tall trees.

20. Write an account of ascent of sap in plants. 21. How does water enter the body of plant and what is the path taken in moving from root to leaves? Give experimental proof in the support of your answer. 22. Trace the path of a molecule of water from the time it enters the root hair until it escapes as water vapors from the leaf. 23. Write short notes on: (i) Transpiration pull (ii) Cohesion theory of water (iii) Ascent of sap (iv) Dixon’s theory of ascent of sap (v) Vital theories of ascent of sap 7. Absorption of Mineral Salts

1. Give a brief account of essentiality of zinc and molybdenum in plant nutrition. 2. What are the plant nutrients? Discuss critically, the importance of plant nutrients in increasing agricultural productivity. 3. Describe the role of magnesium and manganese in plant metabolism. 4. What are the trace elements? How they differ from tracer elements? Give role of any three trace elements in the plants. 5. What are the essential elements in plant nutrition? Explain the role of any three of them. 6. Differentiate between the following: (i) Chlorosis and etiolation (ii) Macroelements and microelements (iii) Sand culture and water culture (iv) Chlorosis and necrosis 7. How does active and passive absorption of salt differs? Give mechanism of salt absorption in plants. 8. Give the modern concept of active salt absorption in plants. 9. Distinguish between the following: (i) Absorption and adsorption (ii) Active salt absorption and passive salt absorption

Study Questions

10. Give an account of the mechanism of passive uptake of ions. 11. What is an active uptake? Write an account of the carrier mediated uptake. What are the evidences in favor of such a mechanism? 12. Describe active uptake of ions in relation to following hypothesis only: (i) Anion respiration hypothesis. (ii) Electrochemical gradient hypothesis. (iii) Phospholipid hypothesis. 13. What is essential element? Describe the role of calcium and magnesium in the plant life. 14. Describe briefly the hydroponic method of studying mineral requirements of a plant. 15. Describe the role of sulfur and phosphorus in plant life. 16. What are the micronutrients? Describe the role of any three micronutrients in plant life. 17. Discuss how nitrogen and iron are important for plant. What are deficiency symptoms of these two elements? 18. Give concise account of the mechanism of ion uptake in plants. 19. Describe active absorption of minerals with special reference to the role of Carriers. 20. Describe the mechanism of mineral salt absorption by the plants. 21. Distinguish between active and passive absorption of salts. 22. Describe the mechanism of salt uptake by the plants. 23. Give active and passive mechanism of absorption of mineral salts by the higher plants. 24. Discuss the modern concept regarding the active transport of solutes. 25. Describe principles involved in the mechanism of absorption of mineral salts by the plants. 26. Describe the mechanism of absorption of mineral salts by plants.

551

27. Give a concise account of the mechanism of absorption of mineral salts by plants. 28. Describe the mechanism of absorption of mineral salts by plants. How does it differ from the absorption of water? 29. What do you understand by active salt absorption? Explain the mechanism of active absorption of the salts by plants. 30. Describe the mechanism of active salt absorption. 31. Explain the mechanism of absorption of mineral salts from the soil by plants. What is Donnan’s equilibrium? 32. How do the plants absorb mineral salts from the soil? 33. What are the various elements necessary for the healthy growth of green plants? From what sources are these obtained? 34. Explain the mechanism of absorption of salts and discuss the effect of deficiency of potassium, calcium and iron and growth of plant. 35. Comment on the role of trace elements in plants. 36. Distinguish between the role of magnesium and hat of iron in plant physiology. 37. How would you determine the mineral requirements of a plant species? Write the physiological role of nitrogen, phosphorus and potassium in crop plants. 38. Comment briefly on the role of elements essential in plant nutrition. 39. Describe the mechanism of absorption of salts from the soil by land plants. 40. Describe the mechanism of absorption of mineral salts. 41. Explain the reason for salt accumulation against the osmotic gradient in plants. 42. How would you account for the higher concentration of ions inside the cell than outside? How do ions move against an electrochemical potential gradient? 43. Describe the role of respiratory energy in the absorption of ions by the plant cells.

552

Plant Physiology: Question Bank

44. Give the mechanism of absorption of mineral salts by the roots of the higher plants. 45. Differentiate between electrogenic and electroneutral pumped. Give an example of each. 46. Write a note on the essential mineral elements for plants and how would you establish their essentiality. 47. Write explanatory note on: (i) Ion uptake in plants (ii) Ion exchange (iii) Factors affecting salt uptake (iv) Membrane transport proteins 48. Write note on active uptake of ions. 49. Write note on Donnan’s equilibrium. 50. Write short notes on: (i) Carrier hypothesis of salt uptake. (ii) Active absorption of mineral salts by roots. (iii) Ion exchange mechanism of salt uptake. 8. Mineral Nutrition of Plants

1. Give an account of mode of nutrition in insectivorous plants. 2. What are heterotrophs? Give an account of special modes of nutrition in heterotrophs. 3. What are the essential elements which are necessary for the normal development of green plants? Give experimental demonstration to show their essentiality. 4. What are the essential elements in plant nutrition? Explain the role of any three of them and show how their deficiency affects the plant growth. 5. Is it possible to determine the amount of minerals present in the soil from an analysis of the minerals of plant grown in the fertile soil? 6. Give an example of the following and discuss their importance: (i) Micronutrients (ii) Deficiency disease

7. What criteria would you apply for proving the essentiality of mineral element for plant? 8. Differentiate between micronutrients and macronutrients. 9. What are essential minerals required by the plants? Explain the role of potassium and phosphorus in the plant nutrition? 10. Give a brief account of the various mineral elements necessary for the healthy growth of the plants? 11. Evaluate the importance of phosphorus in the plant nutrition. 12. Write an essay on the role of essential elements in plant nutrition. 13. Enumerate major and minor elements in plant nutrition and briefly explain their role in plants. 14. Name the mineral elements essential for growth of the higher plants. 15. List the elements essential for plants. Mention the physiological role of nitrogen and iron. 16. Describe the role of mineral nutrient elements in plants. 17. Write an essay on mineral deficiency in plants. 18. Explain the deficiency symptoms of any five macroelements. 19. Distinguish between: (i) Macroelements and trace elements. (ii) Trace element and tracer elements. (iii) Macroelement and microelement. 20. What elements are important in plant nutrition? What is the difference between trace and tracer elements? Explain the role and deficiency symptoms of any five trace elements. 21. What do you mean by macro- and micro-nutrients? Describe the role of nitrogen, potassium and iron in plant nutrition. 22. Mention the deficiency symptoms of the following: Iron, manganese, chlorine, boron and copper. 23. What are the macroelements? Add note on the role of NPKS in plant growth and metabolism.

Study Questions

24. What are the trace elements? Explain their role in plant nutrition. 25. What elements can be called nutrients? Describe briefly the physiological role of any two of the micronutrients in the plant life. 26. Write short note on soilless culture and its significance. 27. Write short note on mineral deficiency in plants. 28. Write short notes on: (i) Symptoms of Zn and Mn deficiency (ii) Symptoms of N, P and K deficiency (iii) Deficiency disease (iv) Trace elements (v) The role of K in plants (vi) Hydroponics. 29. Write note on: (i) Technique of water culture (ii) Chlorosis 30. Write short note on trace elements. 31. Write short notes on: (i) Chelating agents. (ii) Aeroponics. 9. Nitrogen and Sulfur Metabolism

1. How atmospheric nitrogen is converted to ammonia by living organism? 2. What is nitrogen fixation? Give an account of symbiotic nitrogen fixation in plants. 3. Differentiate between the following: (i) Nitrification and denitrification. (ii) Asymbiotic and biotic nitrogen fixation (iii) Rhizobia and frankia. 4. What are amino acids? How are they produced in plants? 5. Give an account of structure and properties of amino acids. What are essential amino acids? 6. Give a brief mechanism of protein synthesis in prokaryotes, how does it differ eukaryotes? 7. Give detail transcription in eukaryotes. How does transcription differ from replication?

553

8. Give an account of protein synthesis in eukaryotes starting from activation of amino acids. 9. Give an account of regulatory mechanism of protein synthesis in prokaryotes. 10. Give a brief account of the metabolic pathway of conversion of fat into carbohydrates in plants. 11. Give a concise account of the beta oxidation of fatty acids. 12. Write a brief account of the synthesis of fatty acids. 13. Describe briefly changes in protein content during seed germination and seedling growth. 14. Give an account of molecular mechanism of protein synthesis, starting from the activation of amino acids. 15. Describe the following: (i) Classification of proteins (ii) Protein changes during senescence (iii) Role of ribosomes in protein synthesis. 16. Give a concise account of structure and function of lectins. 17. Describe briefly the salient features and functions of calmodulin and phytochelatins in plants. 18. Give a general account of nitrogen cycle. What are the important nitrogen containing sources (living and nonliving) in oceans? 19. What do you understand by the term ‘symbiotic nitrogen fixation’? Give a brief account of nodule formation in the roots of leguminous plants infected by Rhizobium. 20. Give a brief account of general properties, mechanism of catalytic action and regulation of nitrogenase. 21. Give an account of the reduction of nitrate to ammonia. 22. Describe briefly the pathway of glutamic acid biosynthesis of ammonia. 23. Give general account of the reduction of sulfide in plants. What is the fate of sulfides in plants?

554

Plant Physiology: Question Bank

24. Write a detailed account of nitrogen cycle found in nature. 25. Discuss briefly the mechanism of biological nitrogen fixation. 26. Discuss the various aspects of nitrogen in the soil. 27. Explain the mechanism of biological nitrogen fixation. 28. How will you differentiate nitrification and denitrification? 29. Describe briefly the process of protein synthesis in plants. 30. How do plants synthesize proteins? What is the function of proteins in plants? 31. Give an example and importance of nucleic acid. 32. Mention the specific role of: (i) Ribonucleic acids (ii) Triplet of bases 33. Give an account of nitrogen cycle. 34. Write an essay on protein synthesis. 35. How DNA does differ form RNA? 36. How are nitrites converted to ammonia? 37. Enumerate the whole series of events that involve nitrogen in relation to plant life. 38. Explain the role of ribosomes in protein synthesis. 39. How do the plants take up nitrogen? 40. Distinguish between nitrogen fixation and nitrification. 41. Explain the structure of DNA with near labeled diagrams. 42. Differentiate between DNA and RNA. 43. Describe the process of protein synthesis in plants. 44. Describe the mechanism of protein synthesis in a prokaryote cell and point out the role of different RNAs in this process. 45. Describe the mechanism of nitrogen fixation in nodules of leguminous plants. 46. Describe briefly the role of DNA in protein synthesis.

47. How is atmospheric nitrogen fixed by symbiotic systems? 48. Describe the structure of the –helix of DNA molecule, mentioning hoe this structure is helpful in correct transfer the genome to the next generation. 49. What do you understand by amino acid activation with reference to protein synthesis? How is the activated amino acid attached to its proper position in the protein molecule? 50. Describe in brief how proteins synthesized from amino acids? 51. Explain the role of RNA in protein synthesis. 52. Briefly describe how nitrogen taken up by the plants is converted into proteins? 53. Comment on the role of RNA in protein synthesis in short. 54. Distinguish between DNA and RNA. 55. Give an account of the role of nucleic acids in protein synthesis. 56. What are the main features of: (i) Transamination (ii) Simple proteins (iii) Translation (iv) tRNA 57. Describe the nitrogen cycle in nature and throw light on the importance of nitrogen in plants? 58. How do the enzymes nitrate reductase and nitrite reductase help in nutrition in the plants. 59. Explain any of the two: (i) Reduction of nitrates in plant tissues. (ii) Biochemical explanation of nitrogen fixation. (iii) Nitrogen cycle. 60. What are the proteins? Explain their structural levels. Discuss the biological importance of the proteins. 61. Describe the mechanism of biological nitrogen fixation in root nodules of leguminous plants, what are the different amino acids that constitute proteins in plants.

Study Questions

62. Describe the protein synthesis with reference to DNA and RNA. 63. Differentiate between: (i) Nucleotide and nucleoside (ii) Dipeptide and polypeptide (iii) Acidic amino acid and basic amino acid. 64. Describe semiconservative replication. 65. Describe the double helix model of DNA along with suitable labeled diagrams. 66. Give an account of biological nitrogen fixation and its significance. 67. Describe the synthesis of the protein. 68. Describe the biosynthesis of amino acids. 69. Explain the structure of protein. 70. Give a detailed account and mechanism of biological nitrogen fixation. 71. Explain the nitrogen fixation in plants. 72. Summarize the interactions between photosynthesis respiration and nitrogen fixation in bacterioids, how is fixed nitrogen exported from nodules to the leaves of plant? Illustrate your answer. 73. Describe the salient features of -helix structure of proteins. 74. Describe the forces stabilizing tertiary structure of proteins. 75. Describe secondary, tertiary and quaternary structure of proteins. 76. Write short notes on: (i) Transcription (ii) Ribonucleic acid (iii) Codon 77. Write short notes on: (i) Transamination (ii) Nitrogen cycle in nature (iii) Biological nitrogen fixation (iv) Ammonification 78. Name the following: (i) Codon initiating the synthesis of polypeptide chain. (ii) Combination compound of a base (purine or pyrimidine) with a pentose sugar.

555

(iii) The three terminating codons. (iv) The amino acid by which initiation of the polypeptide chain takes place in bacteria. (v) The bond which is formed between tRNA and amino acid. 79. Write a note on genetic code. 80. Write short notes on: (i) rRNA (ii) Root nodules of leguminous plants. (iii) mRNA (iv) Symbiotic nitrogen fixation. 81. Write short notes on: (i) Biological nitrogen fixation. (ii) Structure of DNA molecule. (iii) Synthesis of polypeptide chain. (iv) Transcription. (v) Nitrogen fixation. (vi) Role of nodules in agriculture. (vii) Nitrogenase. (viii) Nitrate assimilation. (ix) Rhizobium. 82. Write a critical note on nitrogen cycle. 83. Write short notes on: (i) Nitrate reductase. (ii) Amination and transamination. (iii) Watson and Crick model of DNA. (iv) Amphoteric compound. (v) Zwitter ion. (vi) Ammonia assimilation. (vii) Tertiary structure of proteins. (viii) Isoenzymes. (ix) Significance of sulfur metabolism. 84. Write a short note on nitrogen fixation. 85. Explain: (i) Differences in mRNA, rRNA and tRNA (ii) Jacob Monod hypothesis. (iii) Role of Leghemoglobibn in plants. (iv) Role of nitrogenase in plants. 86. Write a note on mRNA. 87. Write a note on nitrogen cycle.

556

Plant Physiology: Question Bank

10. Enzymes

1. What are enzymes? How do they differ from inorganic catalysts and coenzyme? Give mechanism of enzyme action. 2. Enumerate the properties of enzymes. Give the classification of enzymes. 3. Describe physicochemical nature of enzymes. 4. What is Michaelis–Constant? How does it differ from line weaver Burk-plot? 5. Differentiate between the following: (i) Multienzyme and isoenzyme. (ii) Coenzyme and prosthetic group. (iii) Competitive inhibition and noncompetitive inhibition. (iv) Enzymes and hormones. (v) Holoenzyme and simple enzyme. (vi) Coenzymes and vitamins. (vii) Oxidoreductase enzyme and isomerases. (viii) Feedback inhibition and allosteric inhibition. 6. Give a brief account of classification of enzymes up to classes only. Describe how an enzyme is assigned an enzyme commission number. 7. Describe briefly the physicochemical nature of enzymes. 8. Give a concise account of the mechanism of the action of enzymes. 9. What is Michaelis Constant. Describe various types of plots for determining it. 10. Describe factors affecting enzyme activity. 11. Describe how the enzyme synthesis is regulated in eukaryotes. Discuss various procedure to ascertain that the increase in enzyme activity in the presence of a given positive modulators is due to increased enzyme synthesis. 12. Write an essay on isoenzymes. 13. What do you know about the nomenclature and specificity of enzymes? 14. What are the enzymes? How are they classified? Give an example of oxidoreductase and describe its mode of action.

15. Give an example and importance of coenzyme. 16. Boiled yeast cannot ferment sugar. Comment. 17. What are the enzymes? Describe their properties and mechanism of enzyme action. 18. What are the enzymes? Classify them and explain their role in the vital activities of plants. 19. Write an essay on plant enzymes. 20. What are the enzymes? Write an account of the factors controlling the enzymatic reactions. 21. What is an enzyme? How does it work? Give an account of enzymes which are involved in the oxidation and reduction processes of respiration. 22. What are the enzymes? Give an account of the general properties and nomenclature of enzymes. 23. Enzymes are “biological middle men”. Justify with the help of a brief description. 24. What are the enzymes? Discuss their mechanism of action. 25. What are the enzymes? Discuss their properties and mode of action. 26. Describe the chemical nature, mechanism of action and properties of the enzymes. 27. Where are the following enzymes located in the plant cell? In what process do they participate? 28. Aldolase, fumarase, ribulose bisphosphate carboxylase and RNA polymerase. 29. Describe the structure and the mechanism of the enzyme action. 30. Explain differences in the following: Coenzyme, prosthetic group and cofactor. 31. Explain the following: Frozen and boiled leaf extract hardly exhibit any enzyme activity but when brought to room temperature, the former shows enzyme activity and the latter fails to do so.

Study Questions

32. What are the enzymes? Write about their mode of action: (i) Role in plant metabolism. (ii) Classification. 33. What are the enzymes? Discuss mechanism of the enzyme action. 34. What are the enzymes? Describe their structure and mechanism of action. 35. Describe chemical nature and characteristics of enzymes. 36. What is Michaelis–Menten Constant? What is its significance? 37. What are the enzymes? Describe the various factors affecting the enzyme activity. 38. What are the enzymes? Describe their properties. 39. Write an essay on the enzyme action. 40. What are the coenzymes? Illustrate your answer with two examples. 41. Describe the enzyme classification by IUB system. 42. Describe factors that affect enzyme action in biochemical reaction. 43. Give an account of classification and mechanism of the action of enzymes. 44. Describe the IUB system of classification of enzymes, giving examples from each class. Also give EC number of any two enzymes. 45. Differentiate between: (i) Competitive and noncompetitive inhibitors. (ii) Coenzymes and cofactors. (iii) NAD+ and NADP+. (iv) Endoenzyme and exoenzyme (v) Coenzyme and cofactor (vi) Allosteric enzyme 46. Give a short account of the mechanism of the action of enzymes. 47. Write an essay on coenzyme. 48. Write note on coenzyme. 49. Write short notes on: (i) Coenzyme and isoenzyme. (ii) Induced fit mechanism. (iii) Feedback inhibition (allosteric inhibition).

557

(iv) Apoenzyme and coenzyme. (v) Enzyme kinetics. 50. Write short note on prosthetic group. 51. Write short note on enzymes. 52. Write short note on the mechanism of enzyme action. 11. Photosynthesis

1. What do you mean by pigment system? Describe “Z” scheme of electron transfer from water to NADP+. 2. Give the mechanism of light reaction. 3. What is phosphorylation? How oxidative phosphorylation differs from photophosphorylation? 4. Give the kinds of phosphorylation? How phosphorylation takes place in chloroplasts and mitochondria? Give mechanism. 5. Distinguish between: (i) Fluorescence and phosphorescence. (ii) Pigment system I and pigment system II. (iii) Photorespiration and dark respiration. (iv) Cyclic and noncyclic electron transport. (v) Absorption spectra and action spectra. (vi) Cholorespiration and photorespiration. (vii) C3 and C4 plants 6. Describe the chloro respiratory pathway. What roles does it play in photosynthesis? 7. What is photoinhibition? Distinguish between photoprotection and photodamage. 8. How are plants protected against the potential effects of these ROS (reactive oxygen species)? 9. How PSII reaction center is protected against photoinhibition? Explain PSII reaction center repair mechanism with labeled diagrams. 10. What do you mean by photosynthetic and nonphotosynthetic pigments? What photosynthetic pigments are

558

Plant Physiology: Question Bank

found in higher plants? How chlorophyll differs from cytochrome and phytochrome? 11. Distinguish between C3 and C4 plants with reference to structure, biochemical reactions and efficiency. 12. Give an account of carbon fixation mechanism in C4 plants. 13. Trace the path of carbon in C3 plants. How does it differ from C4 plants? 14. What is photorespiration? How does it differ from dark respiration? Give the mechanism of photorespiration in C3 and CAM plants. 15. What are CAM plants? How do they differ from C4 plants and which of the two is more efficient. Give mechanism of carbon fixation in CAM plants. 16. Give an account of bacterial photosynthesis. How does it differ from chemosynthesis and green plant photosynthesis? 17. Give a brief account of the structure of chloroplasts. What are principal photosynthetic pigments in higher plants and algae? 18. Describe various events in the absorption of light, leading to the excitation of chlorophyll molecules. Describe inductive resonance theory of transfer of energy from one chlorophyll molecule to other. 19. Discuss ‘Z’ scheme of light reactions of photosynthesis. Or discuss how the two photosystems cooperate in producing NADPH and ATP in light reaction of photosynthesis. 20. “Primary process in photosynthesis leads to the conversion of light energy into chemical energy”. Discuss this statement. 21. Discuss the statement “C3 species, C4 species and CAM species represent three different groups of photosynthetic plants with their three different photosynthetic options”. Do you see any phylogenetic relationship among these species?

22. Give a brief account of the Calvin– Benson cycle of photosynthesis. 23. Describe briefly how the bundle sheath cells and mesophyll cells cooperate in photosynthetic CO2 assimilation in C4 plants. 24. Point out the main biochemical differences between C3 and C4 pathway of photosynthetic CO2 assimilation. 25. Give a brief account of the mechanism of bacterial photosynthesis. 26. “Photorespiration is an unavoidable evil of the existence of oxygen in the atmosphere and of active site chemistry of RuBP carboxylase/oxygenase”. Discuss. 27. Describe the effect of temperature on apparent rate of photosynthesis in green plants. 28. Discuss how C3 and C4 plants differ in their photosynthetic response to CO2 concentration and light intensities. 29. Describe the effect of air pollutants on photosynthesis. 30. Write an essay on photosynthetic pigments. 31. Write an essay on chemistry and biosynthesis of chlorophyll or carotenoids. 32. Describe briefly the mechanism of photosynthesis in the light of modern researches. 33. What parts do chlorophyll, carbon dioxide and light play in the synthesis of carbohydrates in green plants? 34. A labeled atom of carbon was originally found as a part of carbon dioxide molecule in the atmosphere over a field of potato plants but is eventually seen as a part of starch molecule in a potato tuber. Trace in a logical sequence the movement of this atom, indicating tissues through which it moves and the kind of chemical substances in which it occur? What are the forces which bring about its movement? 35. Describe the light dependent phase of photosynthesis.

Study Questions

36. What do you understand by the ‘Light’ and ‘Dark’ reactions in photosynthesis? 37. What do you understand by the term limiting factors? How do they affect the rate of photosynthesis? 38. Discuss the effect of various factors on the process of photosynthesis. 39. What is Emerson effect? How has the discovery helped in understanding the mechanism of light reaction in photosynthesis? 40. Write an account of bacterial photosynthesis. 41. Giving suitable illustration, compare the photosynthetic process found in bacteria and higher green plants. 42. What is chemosynthesis? Compare it with photosynthesis. 43. What is photorespiration? Summarize the various steps involved in the process. 44. Discuss the inter-organelle relationships of chloroplast, peroxisome and mitochondria. 45. How does photorespiration differ from dark respiration? Discuss critically. 46. Write an illustrated account of glycolate metabolism found in plants. Describe the following: (i) Photosynthesis of water (ii) Photophosphorylation. 47. Discuss photosynthesis in the terms of: (i) Material used. (ii) Information gained from the work with C14 (iii) Information obtained through the use of O18. Write the overall reaction of photosynthesis. 48. What part do chlorophyll, carbon dioxide and light play in synthesis of simple carbohydrates in green plants? 49. What are radioactive isotopes? How far the use of tracer C has been successful in tracing out various intermediate products of the dark phase of the photosynthesis? 50. How would you prove experimentally the following:

559

(i) Oxygen is evolved in photosynthesis. (ii) Carbohydrate synthesis cannot take place in the absence of chlorophyll. 51. Give an account of the process of photosynthesis. 52. How do the plants utilize carbondioxide? 53. Describe the mechanism of conversion of solar energy into chemical energy in the plants. 54. Explain recent views of the mechanism of photosynthesis in green plants. Discuss at least three evidences to support the view that photosynthesis takes place in two steps. 55. Describe the mechanism of photophosphorylation in higher plants. 56. What are the raw materials of photosynthesis? How are they absorbed and utilized? Explain the information obtained with the use of C14 and O18. 57. Give a detailed account of Calvin cycle. 58. Give an account of the modern views on the mechanism of photosynthesis. 59. Describe cyclic and noncyclic electron transport and photophosphorylation. 60. Give an account of recent work on the mechanism of photosynthesis. 61. Describe briefly the mechanism of photosynthesis in green plants in the light of modern researches. 62. What do you understand by cyclic phosphorylation? 63. What are the limiting factors? Describe in detail their significance in relation to photosynthesis. 64. Give a comparative account of photosynthetic pigments of higher plants. 65. Explain the mechanism of carbon fixation in photosynthesis. 66. Enumerate the requirements of a chemoautotroph. 67. Discuss the importance of protoplasmic factors on photosynthesis. 68. Trace the path of carbon in C3 and C4 cycles.

560

Plant Physiology: Question Bank

69. What do you understand by the terms of light reaction and dark reaction? 70. Give a critical account of the various factors influencing photosynthesis. 71. Discuss the mechanism of light reaction in photosynthesis. 72. Describe the mechanism of respiration in CAM plants and compare it with photorespiration. 73. Describe the biochemical changes which occur during photorespiration in C3 plants. 74. What is phosphorylation? Give an account of cyclic and noncyclic photophosphorylation. 75. What is “Dark Reaction” in photosynthesis? How does it take place in C 3 plants? 76. What is phosphorylation? How does it differ from oxidative phosphorylation? 77. What is Blackman’s law of limiting factors? Explain with the help of proper graphic representation for photosynthesis. 78. Explain the mechanism of photosynthesis with regard to the following points: (i) Source of liberated oxygen. (ii) Role of light. 79. Describe briefly how plants transform carbon dioxide into sugars. 80. Differentiate between: (i) Photosynthesis and chemosynthesis. (ii) Absorption spectrum and action spectrum. 81. Point out the difference between: (i) Photosystem I and photosystem II. (ii) Photosynthetic quotient and respiratory quotient. (iii) Photophosphorylation and oxidative phosphorylation. 82. Trace the path of carbon in C3 plants. 83. Describe the role of chlorophyll in photosynthesis. 84. Explain the mechanism of carbon fixation in CAM plants.

85. Differentiate between respiration and photorespiration. 86. Write short notes on: (i) Quantasomes. (ii) Hill reaction. (iii) Photorespiration. (iv) Structure of chloroplast. (v) Peroxisomes. (vi) Hatch–Slack pathway. (vii) Noncyclic photophosphorylation. 87. How would you differentiate C3 and C4 plants? 88. What is photorespiration? Give the mechanism and significance of this process. 89. Differentiate between photorespiration and anaerobic respiration. 90. How does oxygen affect the photosynthetic productivity of plants? What is its mechanism? 91. Outline Hatch and Slack cycle and point out differences with Calvin cycle. 92. Comment upon “Farming can be called applied photosynthesis”. 93. Describe how CO 2 is converted into sugars by sugarcane plants? 94. What do you understand by phosphorylation? Describe the different kinds of phosphorylations in the plants. 95. Why C 4 plants are considered more efficient in fixing CO2 than C3 plants? Explain. 96. Name (i) A Mg containing tetrapyrrolic molecule involved in photosynthesis (ii) Cell organelle concerned with glycolate pathway. (iii) Primary acceptors of CO2 in C3 and C4 plants. 97. Write a brief account of photosynthesis under the following heads: (i) Role of light (ii) Source of oxygen evolved. (iii) Explain the C4 cycle. 98. Define photosynthesis. Describe the role of light in detail. 99. What is photosynthesis? Give an account of mechanism of CO2 fixation explaining major steps and the end products in the said process.

Study Questions

100. Differentiate between C3 and C4 plants. 101. What is photophosphorylation? How does it occur in higher plants? 102. Describe the light reaction in photosynthesis in detail. 103. Describe the process of dark reaction in photosynthesis. 104. Differentiate between any two of the following: (i) Cyclic and noncyclic photophosphorylation. (ii) C3 and C4 plants. (iii) Photosynthesis in higher green plants and bacteria. 105. Why some plants are called C 3 and others C 4 ? What are their morphological and biological characteristics? 106. Describe the mechanism of CO2 fixation in C 3 and C 4 plants. Also give their structural and physiological differences. 107. Draw a labeled diagram of chloroplast and describe its role in photosynthesis. 108. Explain the Hill’s reaction in photosynthesis. 109. Give brief account of photosynthesis in bacteria. 110. Explain the chemical composition of chloroplast pigments. 111. Describe the path of carbon in C4 plants. 112. What are the C 4 plants? Describe in detail Calvin cycle. 113. Give the importance of cyclic and noncyclic photophosphorylation in plants. 114. Describe C 4 pathway and compare it with CAM. 115. What is photorespiration? How it is differ from that of mitochondrial respiration? 116. What are C4 plants? How do they differ from C3 plants in CO2 fixation? 117. Describe: (i) Cyclic photophosphorylation (ii) CAM cycle. (iii) Acyclic photophosphorylation. (iv) Absorption and action spectra of chlorophylls. 118. Define photosynthesis. Give the details of light reactions of photosynthesis.

561

119. What is photosynthesis? Describe the path of carbon in C3 plants. 120. What is the net effect of the process of photosynthetic electron transport? Illustrate the path of Z–scheme, highlighting the changes in redox potential and the direction of electron flow. 121. Differentiate between: (i) Pigment system I and pigment system II. (ii) Cyclic and noncyclic photophosphorylation. (iii) C3 and C4 plants. (iv) Respiration and photorespiration. (v) Photosynthesis and chemosynthesis. 122. Write short notes on: (i) Photosynthetic unit. (ii) Redox potential. (iii) Red drop in photosynthesis. (iv) Cyt b6f complex. 123. Write short notes on: (i) Warburg effect. (ii) Photorespiration. (iii) Red drop and Emerson’s enhancement effect. (iv) Photochlorophyll. (v) Redox reaction. (vi) Absorption spectrum. (vii) CAM plants. (viii) Chemosynthesis. (ix) Water oxidizing cycle. (x) Distribution of two pigment systems in thylakoid membrane. 124. Write short notes on: (i) Blackman’s law of limiting factors. (ii) Photophosphorylation. (iii) Krantz anatomy. (iv) Water oxidizing clock. (v) Chemosynthesis. 125. Write short notes on: (i) Cyclic and noncyclic photophosphorylation. (ii) Photorespiration. (iii) Quantum requirement of photosynthesis. (iv) Peroxisome.

562

Plant Physiology: Question Bank

(v) Two pigment system. (vi) Z–scheme. (vii) Emerson’s effect and two pigment systems. (viii) CO2 compensation point. (ix) Phosphorescence and RuBisCo. 126. Write the short notes on: (i) Blackman’s law of limiting factors. (ii) Factors affecting photosynthesis. (iii) Photosystem I and II in photosynthesis. 127. Describe the effect of light and CO2 on the rate of photosynthesis and write a note on Blackman’s law of limiting factors. 128. Write notes on the following: (i) Emerson Effect. (ii) Noncyclic photophosphorylation. (iii) Rate of photosynthesis in higher in intermittent light than in continuous light. (iv) Contribution of Ruben. 129. Write short notes on: (i) Emerson’s effect and both of carbon in photosynthesis. (ii) Path of carbon in C3 and C4 plants. (iii) C4 plants. (iv) Carbon dioxide fixation in dark. (v) Thylakoid. (vi) Law of limiting factors. (vii) Important of photosynthesis. (viii) Photophosphorylation. (ix) Role of water in photosynthesis. (x) C3 cycle. (xi) Krantz anatomy. 130. Write critical note on chemosynthesis. 131. Write short note on chemosynthesis. 132. Write a short note on photosynthetic phosphorylation. 133. Explain clearly any one of the following: (i) Photophosphorylation. (ii) Path of carbon in photosynthesis. 134. Write note on the structure of chloroplast and quantasomes. 135. Write note on Blackman’s principle of limiting factors.

12. Special Methods of Nutrition

1. Give an account of special modes of nutrition in plants. 2. Give an account of special modes of nutrition met within angiosperms. 3. Write short note on heterotrophic nutrition. 4. Write short note on modes of nutrition in insectivorous plants. 5. Write short note on physiology of nutrition of insectivorous plants. 13. Carbohydrate Metabolism

1. Give a brief account of the structure of disaccharides found in plants. 2. What are the main types of carbohydrates found in plants? Add a not on their importance in plant metabolism. 3. Classify carbohydrates by giving suitable examples. 4. Describe the mechanism of biosynthesis and degradation of sucrose. 5. Classify carbohydrates. Describe the mechanism of biosynthesis of starch. 6. Give an account of synthesis and breakdown of sucrose and starch in plants. 7. Give structure and properties of the various sugars found in plant cells. 8. Give straight chain, cyclic and ring structure of glucose along with important properties? 9. Describe the different types of carbohydrates and their properties. 10. Mention briefly the structural features of open chain and ring forms of monosaccharides found in plants. 11. Describe the structure and synthesis of starch. 12. In which polysaccharides are -Dglucose and -D-glucose units found and how do these polysaccharides differ from one another in chemistry and in function and location in plant cell? 13. Starch and cellulose are composed of same type of monomers. How do these

Study Questions

differ from each other in the structure and function? 14. Describe the polysaccharides. 15. Give biosynthesis of starch and sucrose. 16. Write a short note on disaccharides. 17. Write short notes on: (i) Synthesis and degradation of sucrose. (ii) Synthesis of sucrose. (iii) Oligosaccharides and polysaccharides. (iv) Asymmetric carbon atom. 14. Lipid (Fat) Metabolism

1. Give an account of synthesis of fat in plants. 2. What is gluconeogenesis? How is fat converted to carbohydrate in plants? 3. Give an account of  and  oxidation of fatty acids. 4. How are fatty acids synthesized in plants? Give the structure of multienzyme involved in the process. 5. Differentiate between the following: (i) Fat and oil (ii) Oxidative rancidity and hydrolytic rancidity (iii) Animal fat and plant fat (iv) Saturated and unsaturated fatty acids 6. What are carbohydrates? How do monosaccharides differ from polysaccharides? Give an account of derived monosaccharides. 7. Give a biological significance of carbohydrates. Classify carbohydrates by giving suitable examples. 8. Give an account of properties of monosaccharides. What are glucosides? 9. What are the fats and how are they synthesized in the plants? 10. Discuss in detail the various steps involved in the conversion of fats into carbohydrates. 11. Wherein the cell does synthesis and breakdown of fats occur? Why does a gram of fat yield more energy than a

563

gram of carbohydrate? Briefly describe how fats synthesis takes place in a cell. 12. Describe the process of fat synthesis in plants. 13. What do you know about -oxidation? 14. Give an account of biosynthesis and oxidation of fats. 15. Give an account of fat synthesis in plants. 16. Elucidate the composition of a plant fat. 17. Enumerate the steps leading to the synthesis of fatty acids. 18. What are the lipids? Explain the degradation of lipids. 19. Describe degradation of fats. What is the fat of end product of their oxidation? Write. 20. What other substances disappear when lipids accumulate in developing fatty seeds? 21. What are the plant lipids? How are they biosynthesized? Discuss mechanism of their biosynthesis. 22. Draw –oxidation pathway. No description is required. 23. How would classify lipids? Give an account of energetics of oxidation of palmitic acid. 24. Explain glyoxydome cycle. 25. Explain the role of the lipids in the plant metabolism. 26. What are the lipids? Explain the distribution and degradation of lipids in plants. 27. Give the structure and mechanism of fat synthesis in plants. 28. Describe the -oxidation pathway of fatty acids. 29. Write short notes on: (i) Phospholipids. (ii) Energetics of -oxidation. (iii) Oxidation of fatty acid. (iv) Beta oxidation of stearic acid, a saturated fatty acid. (v) Alpha oxidation of fatty acids. (vi) Biological importance of lipids. (vii) Simple lipids.

564

Plant Physiology: Question Bank

30. Write short notes on: (i) Lipids (ii) Phospholipids and their occurrence. (iii) Fatty acid degradation. 31. Write a short note on fat metabolism. 15. Translocation of Organic Solutes

1. What is translocation? Give mechanism of translocation of organic solutes produced in leaves. 2. Give detail in various passive theories explaining phloem translocation mechanism. 3. Give an account of various active theories proposed to explain the translocation of photosynthetase. 4. Differentiate between: (i) Radioactive tracers and nonradioactive tracers. (ii) Stable isotopes and radioactive isotopes. (iii) Canny’s view and Thaine’s view of phloem translocation. 5. Describe a few experimental procedures to demonstrate that translocation of sugar takes place through the phloem. 6. Give an account of mass flow hypothesis of the transport of organic solutes. 7. Write a brief account of the following: (i) Apoplastic vs, symplastic transport (ii) Phloem loading and unloading 8. Give an account of translocation of solutes. 9. Why do most trees die if all the tissues external to xylem are removed to a ring around the stem? 10. Describe various theories proposed to explain the mechanism of translocation of solute. 11. What is pressure flow hypothesis and what are its merits and demerits? 12. Which will die first, the root or the shoot in a ringed plant? 13. Describe the process of translocation of solutes in plants.

14. With which physiological process the name ‘Munch’ is associated and how? 15. What is the evidence that phloem is the channel of the transport of organic substances in a plant? 16. Describe the theory which you think best explains the mechanism underlying the translocation of organic solutes through phloem. 17. Explain translocation of solutes with special reference to munch hypothesis. 18. Describe the mass flow hypothesis of translocation of solutes in plants. Give its merits and demerits. 19. Give an account of the process of translocation of organic solutes in higher plants. 20. Discuss the concepts about translocation of photosynthesis in plants. 21. Describe briefly the translocation of food in plants. 22. Describe any three hypotheses on the mechanism of translocation of organic solutes in the phloem. 23. Explain the following: (i) Ringing or girdling experiment. (ii) Transcellular streaming. (iii) Mechanism of sieve tube translocation. 24. What is the path of translocation of organic solutes in higher plants? Explain the mechanism of translocation of solutes. 25. Write explanatory note on loading and unloading in phloem transport. 26. What is the pathway followed by photosynthetic products on their translocation from leaves to storage organs? What is the mechanism of this process? 27. Using suitable illustrations, discuss the structure of sieve elements and the salient features of pressure flow hypothesis of photoassimilates transport. 28. Explain briefly vein loading. 29. What is the tissue involved in sugar translocation in plants? Give evidences. 30. A source of sugar translocation at one time can become sink later on. Comment.

Study Questions

31. Give a comparative account of apoplastic mode of sugar loading in phloem with that of symplastic mode. 32. Write a short note in mass flow hypothesis. 33. Write a short note on phloem transport. 34. Write a short note on hypothesis. 35. Write a short note on translocation. 16. Respiration

1. What is respiration? How aerobic respirations differ from anaerobic respiration? Give mechanism of aerobic respiration in plants. 2. Give an account of pentose phosphate pathway. How does it differ from glycolytic pathway? What is the metabolic significance of pentose phosphate pathway? 3. Give an account of Krebs cycle. How many reduced coenzymes are produced during the cycle? Is Krebs cycle an amphibolic cycle? 4. In what sense photosynthesis and respiration are the reverse of each other and what reversible reactions are shared in common? 5. What is oxidative phosphorylation? Give mechanism of phosphorylation in the light of recent researches. Why mitochondrion is called “Power house” of the cell? 6. Describe the oxidation of glucose up to pyruvic acid formation. 7. Differentiate between the following: (i) Dark respiration and photorespiration. (ii) Normal respiration and cyanide resistant respiration. (iii) Plant respiration and animal respiration. (iv) Combustion and respiration. (v) Respiration and photosynthesis. (vi) Respiratory quotient and photosynthetic quotient. (vii) Cytosolic NADH + H + and Mitochondrial NADH + H+

565

8. Describe briefly the metabolic pathway of anyone of the following. (i) Glycolysis (ii) Tricarboxylic acid cycle (iii) Pentose phosphate pathway. 9. Discuss the electron transport system in the mitochondria. 10. Discuss briefly the mechanism of ATP formation in mitochondria. 11. Write down the complete chemical equation for the following reactions: (i) Decarboxylation of acetyl CoA in TCA cycle (ii) Fermentation of glucose to ethanol (iii) Oxidation of NADH by oxygen. 12. Define respiratory quotient. Discuss how it varies according to the respiratory substrate. 13. Give a concise account of the effect of anyone of the following factors on respiration: (i) Temperature, (ii) CO2 concentration, (iii) Age of the plant tissue. 14. Describe the effect of CO2 concentration of the atmospheres on rate of respiration. 15. Define the term respiratory quotient. Give its normal value and mention the various deviations from it. What is the significance of this ratio? 16. What is the distinction between aerobic and anaerobic respiration, and in what way does latter resemble alcoholic fermentation? 17. Describe the process of respiration in higher plants. How is this process affected by the presence or absences of oxygen? 18. Describe briefly anaerobic and aerobic respiration. Are the two processes interrelated? 19. Give an account of the resent advances in our knowledge of respiration of plants. 20. Give an account of chemical reaction involved in aerobic respiration of plants.

566

Plant Physiology: Question Bank

21. Give examples of more common enzymes which act catalysts in the breaking down of the products of storage in plants. 22. What is respiratory quotient? Explain differences in respiratory quotient as found in wheat and castor oil seeds. 23. Comment briefly on respiratory quotient during the germination of starchy and fatty seeds and in succulent plants. 24. How many atoms of oxygen are consumed when one molecule of pyruvic acid is oxidized in TCA cycle and how many molecules of ATP are generated in the ETS? 25. Describe the mechanism of fermentation. 26. Cite the experiments to show that plants carry on anaerobic respiration. How does it differ from aerobic respiration? 27. What is the respiratory substrate? Show how the values of RQ, are changed with the change in the nature of respiratory substrate. 28. What is the difference between aerobic and anaerobic respiration? 29. Prove that CO2 is evolved during respiration. 30. How do the plants synthesize ATP? 31. What do you understand by the term respiratory quotient? Explain why it varies with the nature of the respiratory substrate? 32. Describe the mechanism of aerobic respiration in plant. How are they reduced acceptors regenerated and how many molecules of ATP are formed from a glucose molecule when completely oxidized? 33. What is the relation between aerobic and anaerobic respiration. 34. Describe the citric acid cycle in plants and explain how ATP is generated in aerobic respiration? 35. Write down what do you know about accumulation of malic acid in succulents.

36. Comment briefly on glycolysis and its significance in the mechanism of respiration. 37. Give an account of the energy releasing process in glucose oxidation. 38. Describe the main steps in the aerobic respiration of plant cells. 39. What is fermentation? How does it differ from aerobic respiration? Describe the changes that occur during fermentation of a glucose molecule. 40. Write a brief account of respiration in plants. 41. Why the mitochondria are called the power houses of the cells? 42. What is respiration? How would you demonstrate that it takes place in green plants? 43. Describe the Krebs cycle reactions and discuss their significance. 44. What are the energy changes that occur during glycolysis? 45. Comment on electron transport. 46. How does the glycolysis of aerobic respiration differ from that of anaerobic respiration? 47. Explain the various steps of TCA cycle. 48. Give concise account of glycolysis. 49. What is meant by Krebs cycle? Explain the significance in plant respiration. 50. Describe the mechanism of anaerobic respiration. How does it differ from aerobic respiration? 51. Outline briefly how a molecule of glucose is used by an anaerobic organism. 52. Give a brief account of the process of glycolysis. Explain the anaerobic breakdown of pyruvic acid. 53. Give a detailed account of EMP pathway. 54. How many atoms of oxygen are used when a molecule of pyruvic acid is oxidized in Krebs’ cycle? Give the mechanism of oxygen utilization and ATP formation. 55. What is RQ? How does it differ in different plants? Give its significance.

Study Questions

56. How is pyruvic acid synthesized in plants? Does this process require the expenditure of energy? Discuss. 57. Comment upon the electron transport system in respiration. 58. What do you understand by oxidative phosphorylation? How does it differ from photophosphorylation. 59. Describe the mechanism of electron transport during oxidative phosphorylation. In which region of cell is the mechanism located? How many ATP molecules would be produced when (i) NADH is oxidized (ii) succinic acid is oxidized. 60. What is terminal oxidation? Describe the process with reference to respiration in plants. 61. Explain the Krebs’ cycle. 62. Describe Krebs’ cycle and explain the function of various enzymes taking part in it. 63. Comment briefly on factors affecting respiration. 64. Explain anaerobic respiration. 65. Give a concise account of Krebs’ cycle. 66. What do you know about the reactions of glycolysis and the enzyme involved in this process? 67. What is respiratory quotient? How its value differs with the nature of different respiratory substrates? What is its significance? 68. Describe the mechanism of anaerobic respiration in plants. How many ATP molecules are produced by each hexose molecule in this process? 69. Describe the mechanism of aerobic oxidation of pyruvic acid in plants. How many ATP molecules are produced by each hexose molecule in this process? 70. Distinguish aerobic and anaerobic respiration. 71. Explain the Krebs cycle. 72. Draw any two of the following pathways/cycle. No description is required. (i) Pentose phosphate pathway.

567

(ii) Embden–Meyerhof–Paranas pathway. (iii) -oxidation pathway. 73. Name (i) a nonheme Fe–enzyme that takes part in TCA cycle (ii) metallic component of cytochrome a–3 oxidase. 74. Give an account of metabolic pathways of aerobic respiration. 75. Explain pentose phosphate pathway. What is its significance? 76. Explain the mechanism of complete oxidation of pyruvic acid in the presence of oxygen. How many ATP molecules are generated in this process? 77. Outline the various steps of hexose monophosphate shunt and discuss its significance. 78. Describe the respiratory process which is common in aerobic and anaerobic respiration. 79. With the help of ultramicroscope sketch the structure of mitochondria. Describe the oxidation of pyruvic acid in higher plants. 80. Explain Krebs’ cycle. Differentiate between aerobic and anaerobic respiration. 81. Describe schematically the pentose phosphate pathway of glucose oxidation. How does it differ from other cellular oxidation process from the point of view of ATP generation? 82. What are factors affecting respiration? 83. What do you understand by RQ? How does it vary on the basis of the food material involved? 84. What are (i) Pasteur effect, (ii) cyanide insensitive respiration? 85. Describe the common process present in aerobic and anaerobic respiration and end product of this process. How will you convert it into ethyl alcohol, CO2 and little energy? 86. Write short notes on: (i) Cyanide resistant respiration. (ii) ATP yield in respiration. (iii) Significance of Krebs’ cycle. 87. Write a shot note on fermentation.

568

Plant Physiology: Question Bank

88. Write short note on compensation point. 89. Write a note on glycolysis. 90. Write short note on oxidative decarboxylation of pyruvic acid. 91. Write short note on respiratory quotient. 92. Write a short note on oxidative phosphorylation. 93. Write note on hexose monophosphate shunt. 94. Write short note on EMP pathway. 95. Write a short note on respiratory quotient. 96. Write a short note on Krebs cycle. 97. Write a note on ATP. 98. Write a note on the role of mitochondria in the respiration. 99. Write a note on Embden–Meyerhof– Paranas pathway. 17. Growth and Growth Hormones

1. How do phytohormones differ from animal hormones and growth regulators? Give an account of the structure, forms and distribution of natural auxins. 2. Give an account of various theories proposed to explain the mechanism of auxin action. 3. Give the mechanism of action and physiological role of a hormone which is fungal in origin. 4. Give an account of gibberellin metabolism in plants. What are the other metabolites derived from the synthetic pathway of gibberellin? 5. Describe the chemical nature and more important physiological effects of kinetin. 6. Give an account of mode of cytokinin action. Describe two bioassay methods of cytokinin. 7. What are polyamines? Give their biological significance and metabolism in plants. 8. Give an account of physiological roles of ethylene along with their commercial applications.

9. Give an account of distribution, bioassay, metabolism and mechanism of the action of ethylene in plants. Is any other hormone derived from intermediates of biosynthetic pathway of ethylene? 10. Give an account of biosynthesis, translocation and mechanism of action of abscisic acid. 11. Differentiate between: (i) Antiauxin and auxin antagonists. (ii) Natural and synthetic auxins. (iii) Gibberellins and gibberellin-like substance. (iv) Physiological activities of auxins and gibberellins. 12. Define senescence. Describe various types of senescence. What is the significance of senescence in the life of a plant? 13. What are the different theories which explain senescence in plants? 14. What are the associated changes observed in leaves during senescence? 15. Distinguish between: (i) Aging and senescence (ii) Senescence and abscission. 16. Give a concise account of physiological and biochemical changes during leaf senescence. Describe the effects of cytokinins on these changes. 17. What is abscission? Describe the anatomical and biochemical changes taking place during abscission of a leaf. 18. Describe the effects of various factors, including hormones on abscission. 19. Give a concise account of physiological effects of abscisic acid. 20. Discuss the mechanism of action of abscisic acid. 21. Describe the following: (i) Role of AbA in drought resistance (ii) Biosynthesis of AbA (iii) Bioassay of AbA. 22. Describe briefly the physiological effects of ethylene. 23. Discuss the mechanism of the action of ethylene.

Study Questions

24. Give a brief account of the biosynthesis of ethylene. Mention environmental factors influencing the process. 25. Discuss briefly the various aspects of growth found in plants. 26. What do you understand by growth hormones? Describe briefly the recent work done in this line. 27. Give a concise account of the recent work on growth hormones in plants. 28. Write an essay on phytohormones. 29. Trace the development of our knowledge about the plant hormones. 30. Give a concise account of the structure of naturally occurring auxins. 31. Describe various types of physiological effects of auxin on higher plants. 32. Discuss the molecular mechanism the action of auxins. 33. What are auxins? Give their mode of action and explain their importance with reference to agriculture in India. 34. Write an essay on plant hormone researchers in India. 35. Give a brief account of bioassay of gibberellins. What are alternate methods of detecting gibberellins in plants? 36. Describe various types of physiological responses in plants to gibberellins. 37. Discuss the role of gibberellins in enzyme induction. 38. Outline the pathway of gibberellin biosynthesis. Name some other plant metabolites which are derived from gibberellin biosynthetic pathway. 39. Give a concise account of the structure of gibberellins and other compounds which show gibberellin type activity. 40. Give a brief account of gibberellins, their structure, distribution, biosynthesis and role of endogenous gibberellins. 41. What is the common name of the compound 6–furfurylaminopurine. Describe some of its physiological effects on plants.

569

42. Write briefly the role of cytokinins in retarding the senescence of leaves. 43. Discuss the molecular mechanism of cytokinin action. 44. Describe some of the techniques used to detect the presence of cytokinins in the plant extracts. 45. What are cytokinins? Discuss their importance to plants. 46. Write an account of the application of growth regulators in horticulture and agriculture. 47. Define photoperiodism. Give a brief account of the division of plants based on photoperiodic responses. 48. Give a concise account of the “florigen concept”. Give reasons for gibberellins not considered as florigen. 49. Give a brief account of the morphological and physiological changes taking place in the shoot apex during the evocation and initiation of flowering. 50. Write an essay on vernalization. 51. Explain the following: (i) Night break phenomenon in flowering (ii) Light quality in photoperiodic responses (iii) Carbon : nitrogen ratio in flowering. 52. Photoperiodism and vernalization 53. Describe apical dominance of growth correlations. 54. Describe the role of auxins in plants. 55. Distinguish between an auxin and a gibberellin. 56. Draw growth curve of an annual plant. 57. Write an essay on auxins giving emphasis on growth regulation. 58. Write short note on vitamins. 59. Discuss growth hormones and their role in the life of plants. 60. Give an account of plant growth regulators and mention their chief functions in the plant cells. 61. Describe briefly indole acetic acid and its role.

570

Plant Physiology: Question Bank

62. What are the phytohormones? Discuss the role any one of them. 63. What are auxins? Give their physiological roles in the higher plants. 64. Discuss the role of: (i) Cytokinins in leaf senescence. (ii) Auxins in apical dominance (iii) Abscisic acid in abscission. 65. What are the physiological roles of gibberellins? 66. What are growth regulating substances? Explain the role of auxins and gibberellins in the growth of the plants. 67. Describe the physiological role of gibberellins in higher plants. 68. What is a phytohormone? How many kinds of them are known to you? Describe at least one number of each class of phytohormones mentioning in structure and functions. 69. What is the reason that when apical bud of the shoot of a young seedling is removed the axillary buds begin to grow out? 70. What are the plant growth substances? Explain the physiological effects of the auxins. 71. What are gibberellins? How are they synthesized in plants? Discuss their role in plants. 72. Briefly explain the role of gibberellins in plants. 73. Name: (i) Plant hormone associated with abscission and dormancy. (ii) Any two cytokinins found in the plants. 74. What are auxins? Describe their practical applications in plants. 75. What are phytohormones? Describe the physiological roles of gibberellins or auxins in higher plants. 76. What are the growth regulators? Explain the biosynthesis and assay of auxins. 77. What is growth? Describe the function of plant hormones regulating growth.

78. Differentiate between: (i) Ethylene and abscisic acid (ii) Cytokinin and kinetin (iii) Hormones and enzymes 79. What is a phytohormone? Give a comparative account of the physiological effects of auxins, gibberellins and cytokinins in plants. 80. Write short notes on: (i) Eater soluble vitamins. (ii) Cytokinins and their role in plants. (iii) Abscisic acid and its role in plants. (iv) Vitamin A and D. (v) Vitamin C and D. (vi) Sigmoid curve. 81. Describe the biosynthesis, mechanism of action and practical applications of cytokinins. 82. Write an essay on vitamins. 83. Define the following abbreviations with their functions: (i) IAA (ii) 2,4-D (iii) ABA 84. Describe the physiological effects of cytokinins. 85. What is the physiological role of auxins? 86. What are the gibberellins? Discuss their physiological role in plants. 87. Explain briefly growth curve. 88. What are the auxins? Describe their mechanism of action and physiological effects in higher plants. 89. Explain, on chopping again and again the hedge plants get dense. 90. Describe physiological effects and practical applications of auxins. 91. Explain briefly applications of auxins and abscission. 92. What are the growth hormones? Discuss their role in growth and the development of the plants. 93. Describe physiological effects of: (i) Auxins. (ii) Cytokinins. 94. What are auxins? Describe their role in growth regulators.

Study Questions

95. Write explanatory notes on: (i) Climacteric rise in the rate of respiration (ii) Kinetics of plant growth. 96. What are the growth regulators? Explain their role in agriculture and horticulture. 97. Discuss the role of auxins in acid growth hypothesis for cell enlargement. Summarize the set of genes whose transcription is stimulated by auxins. 98. Discuss the role of DELLA proteins in plants. Illustrate your answer. Schematically present an account of gibberellin-induced release of enzymes and carbohydrates mobilization during seed germination. 99. Describe molecular mechanism of action of auxin. 100. Write short note on: (i) Senescence. (ii) Cellular totipotency (iii) Morphactins (iv) Fruit ripening 101. Write short note on phases of growth. 102. Write short notes on: (i) Auxins (ii) Grand period of growth (iii) Phytohormones (iv) Ethylene 103. Write short note on abscission layer. 104. Write short note on kinetin. 105. Write a note on practical application of auxins. 106. Write a note on auxin. 107. Write a short note on cytokinins. 108. Write note on abscisic acid. 109. Write short note on grand period of growth. 110. Write note on gibberellins. 18. Photoperiodism

1. Describe the role of light in photoperiodism and phototropism. 2. Describe the role of dark period in the induction of flowering in a short-day plants. What is phytochrome?

571

3. Describe the various theories proposed to explain the flowering mechanism in higher plants. 4. Give a brief account of the discovery, isolation and distribution of phytochrome in the plants. 5. Write an account of the physicochemical nature of phytochrome. 6. Give a brief account of a few phytochrome mediated responses. Describe how these responses are manifested at physiological and biochemical levels. 7. Mention the specific role of florigen. 8. Describe the phenomenon of photoperiodism in higher plants. 9. Describe the role of light in flowering. 10. What is photoperiodism? Discuss the phenomenon with reference to shortday plants. 11. What is phytochrome? How does it mediate the photomorphogenic response? Describe its role in flowering. 12. Explain the following: Interruption of dark period with red light inhibits flowering in short-day plants but stimulates in long-day plants. 13. Give the botanical name of any longday plant. 14. Differentiate between: (i) Short-day plants and long-day plants. (ii) Phytochrome (R) and phytochrome (FR). (iii) Phytochrome and florigens. 15. What is photoperiodism? Describe the mechanism of floral bud induction in plants. 16. Write note on short-day and long-day plants. 17. Give an account of discovery, structure, function and mode of action of phytochromes. 18. Explain the role of light in flowering. 19. What is photoperiodism? Compare photoperiodism with vernalization. 20. What is the effect of day length on the histology of flowering?

572

Plant Physiology: Question Bank

21. Generally, the long-day plants should more appropriate be called short-night plants. 22. Write short notes on: (i) Short-day plants, (ii) bolting. 23. What is photoperiodism? Explain the physiology of photoperiodism in plants. Add a not on its significance in agriculture. 24. Explain photoperiodism with suitable examples. Add a note on phytochrome. 25. Write a critical account on the physiology of flowering. 26. Write note on photoperiodism. 27. Write a note on phytochrome, long-day plants. 28. Write note on critical photoperiod. 29. Write a short note on phytochrome. 19. Vernalization

1. Write an essay on photoperiodism or vernalization. 2. What do you understand by vernalization? Give some practical uses of this phenomenon. 3. Describe the different ways in which light affects the life of plants. 4. Discuss the various theories of flowering in relation to photoperiodism and vernalization. 5. Explain the importance of vernalization in plants. 6. Describe the phenomenon of vernalization in higher plants and its importance in a tropical country like ours. 7. Describe the role of temperature on flowering. 8. What are various theories for the mechanism of vernalization in plants? 9. Write an essay on vernalization. 10. Give an account of vernalization and mention its significance. 11. Write short note on devernalization. 12. Write note on practical application of vernalization. 13. Write a critical account on the physiology of flowering. 14. Write short note on vernalization.

20. Germination and Dormancy of Seeds and Buds

1. What do you mean by primary and secondary dormancy? Explain the mechanism of dormancy and method of breaking seed dormancy. 2. List the biochemical reactions going on in seeds during seed germination. 3. Give a concise account of the chemical composition of seeds. 4. Describe metabolic changes taking place during seed germination. 5. Give an account of the environmental factors affecting germination. 6. Discuss various cases of seed dormancy. Describe a few methods to break dormancy. 7. Describe briefly the role of growth hormones in seed germination. 8. Describe briefly the physiology of seed germination. 9. Define growth. Describe a few parameters of measuring growth. 10. Give a brief account of the growth pattern of an annual plant. What are different phases in a growth curve? 11. Give a brief account of either root or stem growth. What are important differences in the initiation of a lateral root and a branch? 12. Discuss the role of light in plant growth. 13. Discuss the effect of drought and of water logging on plant growth. 14. What is seed dormancy? What are its causes? What methods are used to break it? 15. Give an account of dormancy in seeds and buds together with the methods employed for its removal. 16. Write a note on seed dormancy. 17. What is dormancy of seeds? How is it helpful in the life cycle of certain plants? Describe some methods for breaking dormancy. 18. Stress physiology. 19. Differentiate between scarification and stratification.

Study Questions

20. Describe what you know of the dormancy of buds. 21. What do you understand by growth and development? Discuss the factors which are responsible for the breaking of dormancy of perennating organs. 22. Define dormancy and quiescence. Comment on their significance. 23. Explain the methods to break seed dormancy. 24. Write note on factors affecting seed germination. 25. Write note on scarification. 26. Write short note on bud or seed mechanism of overcoming dormancy in buds. 27. Write note on causes of seed dormancy. 28. Write short note on bud or seed dormancy. 29. Write short note on dormancy of seeds. 30. Write short note on dormancy. 21. Plant Movements

1. Explain the role of auxins in phototropism and nastic movements. 2. Describe nyctinasty. What might be physiological significance of nyctinasty? In what ways is the seismonastic response similar to nyctinasty. In what ways this different? 3. Distinguish between: (i) Tropic and nastic movements (ii) Epinasty and hyponasty (iii) Thigmotropism and geotropism (iv) Nasty and nutational movements 4. Define tropic and nastic growth movements in plants. Give a brief account of geotropism in plants. 5. What is phototropism? Describe its mechanism. 6. Describe the following: (i) Thigmotropism (ii) Hydrotropism (iii) Thermonasty 7. Give a general account of various types of nastic responses in plants. 8. Describe the various types of movements shown by higher and lower plants.

573

9. What are tropic movements? Explain the role of auxin in phototropism and geotropism. 10. What is tropic movement? Describe any such movement, explaining the cause for the same. 11. Discuss the tactic and tropic movements in plants. 12. Distinguish clearly between tactic, tropic and nastic movements of plants giving suitable examples. 13. Give an account of the principal types of growth movements in plants. 14. Give an illustrated account of induced movements in plants. 15. Fruiting. 16. Describe some of the important tropic movements found in plants. 17. Explain why and how pants usually bend towards the source of light. 18. Leaves of Mimosa are sensitive to touch. Explain. 19. How will you prove the fact of geotropism? 20. Write an essay on different types of movements in plants. 21. What are tropic movements? Discuss the role of auxins in phototropic movements. 22. Discuss the basic differences among tactic, tropic and nastic movements in plants. 23. How do you differentiate the following: (i) Autonomic growth movements and induced movements of curvature. (ii) Chemotaxis and phototaxis. 24. Differentiate between: (i) Tactic and tropic movements in plants. (ii) Seismonasty and epinasty. (iii) Thigmonasty and nyctinasty. 25. Differentiate between tropic movement and nastic movement. 26. Distinguish between seismonastic movements and thigmonastic movements. 27. Write an essay on tropic movements in plants.

574

Plant Physiology: Question Bank

28. Write short notes on: (i) A leaf of Mimosa pudica when touched shows the sleeping movements. (ii) Plants exposed to unilateral light bend towards the source of light. (iii) Photonastic movements. (iv) Tropic movements. 29. Write short notes on: (i) Tropic and tactic movements. (ii) Seismonasty. (iii) Nastic movements. (iv) Geotropic movement. (v) Plant movements. 30. Give an account of either ‘Photoropism’ or ‘Geotripism’ in plants and discuss its mechanism. 31. Write short note on nastic movements. 32. Write note on paratonic growth movements. 33. Write note on phototropic movements. 34. Write note on geotropic movements. 22. Circadian Rhythms in Plants

1. Write a brief account of biological clock. 2. What are circadian rhythms? Discuss these with suitable examples. 3. Cite suitable examples, which indicate the presence of circadian rhythms in unicellular organisms. 4. What is biological clock? 5. Write an essay on endogenous rhythms. 23. Stress Physiology

1. Describe the mechanism of drought and cold resistance in plants. 2. How do stress tolerant plants differ from stress enduring plants? Give mechanism of salt stress tolerance in aquatic plants. 3. Why is there photoinhibition of photosynthesis during both water and light stress? 4. What is stress and strain? Explain taking suitable examples of plant habits.

5. “The physiology of drought and cold resistance of plants is essentially similar”. Discuss the statement. 6. What is drought resistance and what are the physiological alterations influenced by the drought? 7. Write an essay on the drought and cold resistance of plants. Can it be induced? 8. What is stress? Give a brief account of water and salt stress in plants. 9. Distinguish clearly between drought tolerance and drought avoidance. Describe various morphophysiological adaptations by plants to combat drought. 10. How do plants respond to water stress? 11. What are the abiotic stresses for cold and heat? Explain the defense mechanism of the plants? 12. Write short notes on: (i) Frost injury in plants. (ii) Salt tolerance of plants. (iii) Frost resistance. (iv) Salinity tolerance and salinity resistance. (v) Water stress. (vi) Facultative CAM plants. (vii) Metal toxicity. (viii) HR and SAR. (ix) Salicylic acid. 24. Secondary Metabolites

1. What are the secondary metabolites? How do they differ from primary metabolites? Give biological significance of secondary metabolites. 2. What are alkaloids? How do true alkaloids differ from proto- and pseudo-alkaloids? Describe diverse properties of alkaloids. 3. What are the secondary metabolites? Name five important secondary plant metabolites and discuss their role. 4. What are secondary plant metabolites? How do they differ from primary metabolites? Discuss their importance in plant life.

Study Questions

5. Give an elementary idea of secondary metabolites. 6. Write a detailed note on the chemistry, distribution and metabolism of phenolic compounds in plants. 7. Write short notes on: (i) Flavonoids. (ii) Phenolics. (iii) Lignin. (iv) Functions of steroids. (v) Importance of secondary metabolites to human. (vi) Secondary metabolites and their significance. 25. Photomorphogenesis

1. What is phytochrome? How does it differ from chlorophyll and cytochrome? Give a brief account of phytochrome mediated process in plants. 2. Give an account of theories proposed for mechanism of phytochrome action in plants. 3. Differentiate between the following: (i) Phytochrome and Cryptochrome. (ii) Pr form and Pfr form of phytochrome. 4. What is photomorphogenesis? Explain it taking suitable examples. 5. Light is a master factor for the plant growth and development. Explain. 6. What is phytochrome? Discuss its role in plants. 7. Discuss briefly about phytochrome in reference to its structure, mode of action and activities. 8. What do you understand by photomorphogenesis? 9. Give a brief account of phytochrome mediated photomorphogenetic responses in plants. 10. What are blue-light responses in plants? Discuss the nature of the photoreceptor involved in such responses. 11. Phytochrome also absorbs blue-light, then how can you distinguish blue-light

575

responses from phytochrome mediated photoresponse in plants? 12. Differentiate between low fluence responses and high irradiance responses. 13. Write about history of the discovery of phytochromes and cryptochrome and their phytochemical and biochemical properties. 14. Write short note on cryptochrome. 26. Bioenergetics

1. What are the bioenergetics and thermodynamics? 2. Explains the laws of thermodynamics especially with relation to biological systems. 3. What are enthalpy, entropy and Gibbs free energy? How are these interrelated? 4. Describe fundamentals of thermodynamics with emphasis on free energy concept. 5. Write short notes on: (i) Standard free energy change. (ii) Exergonic and endergonic reactions. (iii) Thermodynamic systems. (iv) Third law of thermodynamics. (v) Isothermally unavailable energy. (vi) Entrophy. (vii) Second law of thermodynamics. 27. The Nucleic Acids (DNA and RNA)

1. What are nucleic acids? Give their role in plants, how many forms of DNA are found? 2. Give an account of structure of B–DNA. How does it differ from Z–DNA? 3. Give an account of replication of DNA in plants. 4. Differentiate between following: (i) DNA and RNA (ii) Replication in prokaryotes and eukaryotes. (iii) Purine and pyrimidine bases. (iv) Ribonucleotides and deoxyribonucleotides.

576

Plant Physiology: Question Bank

(v) Replication of circular DNA and single stranded DNA. 5. Give a concise account of biosynthesis of either purine or pyrimidine nucleotides. 6. Describe briefly the mechanism of DNA replication. 7. Give a briefly account of the following: (i) Enzymic hydrolysis of nucleic acids to nucleotides. (ii) Catabolism of nucleotides. 8. Write a brief account of the structure of DNA. 9. Discuss briefly the structure of various forms of DNA. 10. Mention the characteristics of double helical modes of DNA. 11. Write a brief account of RNA and elucidate the differences between RNA and DNA. 12. Replication of DNA

28. Tissue Culture

1. Outline the protoplast fusion technique and its application in plant movement. 2. What is tissue culture? How are haploid plants produced from this technique? Enumerate the role of tissue culture in plant improvement. 3. Distinguish between: (i) Somatic hybrids and sexual hybrids. (ii) Somatic embryo and gametic embryo. (iii) Callus and callose. (iv) Cybrids and synkaryon. 4. Write critical notes on: (i) Totipotency of cell. (ii) Aspects of tissue culture. (iii) Protoplast culture. (iv) Acclimatization.

Practice Windows

577

Practice Windows (a) PEP carboxylase (b) Phosphorylase (c) Carbonic anhydrase (d) Lysozyme 7. Inactive precursors of some enzymes that are activated by hydrolysis, are known as: (a) Proenzyme (b) Apoenzyme (c) Zymogen (d) Holoenzyme 8. Which of the farming amino acid is most likely to be present at the active site of an enzyme? (a) Ala (b) Met (c) His (d) Ile 9. Conformational change in the enzyme structure is achieved by: (a) Change of amino acid sequence (b) Change in the amino acids of the active site (c) Rearrangement of amino acids at the active site (d) None of the above 10. In a successful enzyme purification: (a) Enzyme activity decreases and specific activity increases (b) Enzyme activity increases and specific activity decreases (c) Both activity and specific activity increases (d) Activity and specific activity both decreases

Model Test Paper I

1. Enzymes catalyze a chemical reaction by: (a) Increasing the rate of reaction (b) Decreasing the G° to proceed the reaction spontaneously (c) Decreasing the entropy of the reaction (d) Moving the reaction equilibrium 2. Enzymes increase the reaction rate by: (a) Increasing the activation energy (b) Increasing the free energy change of the reaction (c) Changing the equilibrium constant of the reaction (d) Decreasing the activation energy 3. The group of enzymes that catalyze the transfer of electrons are named: (a) Oxidoreductase (b) Hydrolase (c) Transferase (d) Lyase 4. The first enzyme to be isolated in pure crystalline form was: (a) Oxygenase (b) Hexokinase (c) Urease (d) Ribonuclease A 5. Which of the following enzyme is not proteinaceous in nature? (a) Urease (b) Ribozyme (c) Protease (d) Phosphatase 6. Which of the following enzyme has the highest turnover number? Ans.

1. (a)

2. (d)

3. (a)

4. (c)

5. (b)

6. (c) 577

7. (c)

8. (c)

9. (c)

10. (a)

578

Plant Physiology: Question Bank

11. The model that explains that active site is flexible and the catalytic group of the enzyme is brought into proper alignment by the substrate is called: (a) Concerted model (b) Induced fit model (c) Transition state model (d) Lock and key model 12. Binding energy of an enzyme is defined by: (a) The energy released by the interaction of an enzyme to its substrate (b) The energy of activation (c) The energy difference between the ground states a substrate and the product (d) None of the above 13. Abzymes are known as: (a) Enzymes that are highly specific like anti (b) Enzymes that hydrolyze antibodies (c) Antibodies with catalytic activity (d) None of the above 14. FAD serves as a coenzyme for: (a) Oxidoreductases (b) Ligases (c) Hydrolases (d) Lyases 15. The enzyme having the EC number 2.7.1.1 belongs to the class: (a) Oxidoreductase (b) Transferase (c) Isomerase (d) Ligase 16. The interaction between a substrate and its enzyme largely involves: (a) Covalent bonding (b) Non-covalent interaction (c) Coordinate bonding (d) All of the above 17. The Km of an enzyme is defined as (a) Half of Vmax (b) A dissociation constant (c) The enzyme-substrate association constant Ans.

11. (b) 22. (b)

12. (a) 23. (c)

13. (c)

14. (a)

15. (b)

(d) The substrate concentration at which half maximum velocity is achieved 18. Which of the following is an example of isoenzyme? (a) Lactate dehydrogenase (b) Cytochrome oxidase (c) Pyruvate kinase (d) None of the above 19. Lower value of Km denotes: (a) The enzyme’s action is inhibited (b) The enzyme has higher affinity for the substrate (c) The enzyme has lower affinity for the substrate (d) Both a and c 20. If the substrate concentration in an enzyme catalyzed reaction is equal to ¼ Km, the initial velocity of the reaction will be: (b) 0.50 Vmax (a) 0.20 Vmax (c) 0.33 Vmax (d) 0.67 Vmax 21. At what substrate concentration (S) is the velocity (V 0) of an enzyme catalyzed reaction is 1/4th of the Vmax: (b) 1/4 km (a) 3/4 km (c) 1/3 km (d) 4 km 22. An enzyme has Arg and Lys at the active site. The pI of Arg is 11 and Lys is 9.5. The enzyme functions when Arg is in protonated form and Lys is deprotonated form. The pH at which the enzyme will show maximum activity is: (a) 11 (b) 10.6 (c) 9.5 (d) 12 23. Carboxypeptidase is an enzyme that removes amino acids from C-terminus of a polypeptide. This enzyme is 307 amino acids long, having Arg145 and Glu 270 in the active site. If carboxypeptidase present in the form of a -helix, how far will be Arg and Glu? (a) 400 (b) 460.5 (c) 187.5 (d) 600 16. (b)

17. (d)

18. (a)

19. (b)

20. (a)

21. (c)

Practice Windows

24. When substrate concentration is much greater than K m and the velocity reaches its maximum, the rate of a enzyme catalyzed reaction is said to: (a) 1st order with respect to substrate (b) 2nd order with respect to substrate (c) zero order with respect to substrate (d) None of the above 25. In a reaction, changing the pH from 7 to 6 increases the activity of an enzyme. From this one can conclude that: (a) The amount of unbound enzyme increases (b) The enzyme’s optimal pH is 6 (c) The temperature must have increased when the pH changed to 6 (d) The enzyme was in a more active conformation at pH 6 26. Match the following cofactors with their corresponding enzymes: Cofactor Enzyme (a) Mo 1. Alcohol dehydrogenase (b) Cu 2. Nitrate reductase (c) Zn 3. Cytochrome oxidase (d) Se 4. Nitrogenase (a) (a)-1, (b)-4, (c)-2, (d)-3 (b) (a)-4, (b)-1, (c)-3, (d)-2 (c) (a)-4, (b)-3, (c)-1, (d)-2 (d) (a)-1, (b)-3, (c)-2, (d)-4 27. What is the (S) for the enzyme catalyzed reaction which has an initial velocity of 14.52 mol/L/min and the maximum velocity of 23.79 mol/L/min and a Km of 3.88 mol/L? (a) 2.51 mol/L (b) 0.90 mol/L (c) 3.79 mol/L (d) 6.07 mol/L 28. Enzyme X can catalyze the conversion of AA’ and the conversion of BB’. Both of these reactions follows MichaelisMenten kinetics and both have the same Vmax. However, the Km for the 1st reaction is double than the 2 nd reaction. What is the relationship between the substrate concentration Ans.

24. (c)

25. (d)

26. (c)

27. (d)

28. (a)

579

[A] and [B], when both the reactions are proceeding at a reaction velocity of ½Vmax? (a) [A] > [B] (b) [A] = [B] (c) [A] < [B] (d) The question is incomplete 29. A chemical reaction that follows Michaelis-Menten equation, what will be the substrate concentration when the reaction velocity reaches 90% of the maximum velocity? (a) 18 km (b) 9 km (c) 5 km (d) 1 km 30. Which of the following are true about competitive inhibitors? 1. They are usually water soluble 2. They are small molecules 3. They resemble transition state intermediates 4. Their inhibition can be reversed if the concentration of the substrate is increased (a) 1, 2 and 3 (b) 1 and 4 (c) 1 and 3 (d) 1, 2, 3 and 4 31. Some enzymes require the presence of a non-protein substance for their activity. Which of the following is a more general term for such a substance? (a) Prosthetic group (b) Coenzyme (c) Cofactor (d) Modulator 32. When a piece of liver is dropped into hydrogen peroxide, the peroxide bubbles vigorously as a result of which reaction? (a) Peroxide being broken into water and oxygen (b) Peroxide is destroying germs in the liver (c) More peroxide is being created by the liver (d) Liver and peroxide are joining together to make new proteins 29. (d)

30. (d)

31. (c)

32. (a)

580

Plant Physiology: Question Bank

33. Allosteric enzymes: (a) Do not behave according to Michaelis-Menten kinetics (b) Bind allosteric modulators at sites not associated with substrate binding (c) Often have separate regulatory and catalytic domains (d) All of the above 34. An inhibitor that bonds only to the E-S complex is referred to as a: (a) Competitive inhibitor (b) Noncompetitive inhibitor (c) Uncompetitive inhibitor (d) Feedback inhibitor 35. Chymotrypsin is an example of: (a) Transferase (b) Hydrolase (c) Oxidoreductase (d) Lyase 36. Which of the following coenzyme is involved in the decarboxylation reaction? (a) Tetrahydrofolate (b) Biotin (c) Thiamine pyrophosphate (d) Pyridoxal phosphate 37. The apparent Km value changes in a: (a) Competitive inhibition (b) Uncompetitive inhibition (c) Noncompetitive inhibition (d) Both (b) and (c) 38. Which of the following amino acid can transfer protons when present in the active site of an enzyme? (a) Glutamate (b) Aspartate (c) Histidine (d) Lysine 39. Under physiological conditions, the substrate concentration is: (a) More than Km (b) Less than Km (c) Equals to Km (d) Does not depend on Km 40. Which of the following best describes steady-state assumption? Ans.

33. (d) 44. (c)

34. (c) 45. (a)

35. (b) 46. (c)

36. (c)

37. (a)

(a) The concentration of [S] is decreasing (b) The concentration of [ES] is constant (c) The total enzyme concentration decreases (d) All of the above 41. When [S] = K m the velocity of an enzyme catalyzed reaction is about: (b) 0.2 Vmax (a) 0.1 Vmax (c) 0.3 Vmax (d) 0.5 Vmax 42. In a double reciprocal plot, the slope indicates: (b) 1/Km (a) 1/V0 (c) Km/Vmax (d) None of these 43. The double reciprocal plot is also called: (a) Lineweaver-Burk equation (b) Steady state equation (c) Eadie-Hofstee equation (d) Rapid equilibrium 44. In Lineweaver-Burk equation, the X-intercept is: (a) Km (b) 1/Km (c) –1/Km (d) 1/Vmax 45. Given an enzyme with a Km= 10 mM and V max = 100 m mol/min. If [S] = 100 mM, which of the following will be true? (a) A 10 fold increase in V max would increase velocity 10 fold (b) A 10 fold decrease in K m would increase velocity 10 fold (c) Both a and b (d) A 10 fold increase in V max would decrease velocity 20 fold 46. The active site of an enzyme remains: (a) At the centre of globular proteins (b) Rigid and does not change shape (c) Complementary to the rest of the molecule (d) None of the above 38. (b)

39. (a)

40. (b)

41. (d)

42. (c)

43. (a)

Practice Windows

47. In a Lineweaver-Burk plot, the effect of a competitive inhibitor can be seen as: (a) It moves the entire curve to right (b) It moves the entire curve to the left (c) It changes the X-intercept (d) It has no effect on the slope 48. Noncompetitive inhibitor of an enzyme catalyzed reaction: (a) Decreases the Vmax (b) Binds to the Michaelis Complex (ES) (c) Both a and b (d) Can actually increase reaction velocity in rare cases 49. A noncompetitive inhibition: (a) Increase Km and reduces Vmax (b) Increase Km and Vmax (c) Reduces Km and increases Vmax (d) None of the above 50. An allosteric inhibitor usually: (a) Participates in feedback regulation (b) Denature the enzyme (c) Is a hydrophobic compound (d) Causes the enzyme to work faster 51. Which of the following is used to determine the cooperativity of an enzyme: (a) Hill plot (b) Michaelis-Menten hyperbola (c) Koshland curve (d) Cannot be determined 52. Which of the following is an example of irreversible inhibitor? (a) Chloramphenicol (b) Oseltamivir (c) Protease inhibitors (d) DIPF 53. The catalytic triad in the active site of chymotrypsin contains which amino acids? (a) Serine, histidine, aspartate (b) Serine, histidine, glutamate (c) Threonine, histidine, aspartate (d) Methionine, histidine, glutamate Ans.

47. (c)

48. (a)

49. (d)

50. (a)

51. (a)

581

54. You have performed a series of experiments determining the Ki values for four competitive inhibitors. The results are given in the table: Inhibitor Ki (M) A. 5 B. 1 C. 0.2 D. 10 (a) A (b) B (c) C (d) D 55. An inhibitor binds to a site other than the active site of an enzyme. Which statement below correlates with the observation? (a) It must be a competitive inhibitor (b) It could be noncompetitive or uncompetitive inhibition (c) The inhibition must be irreversible (d) It could be any of the above 56. 1.5 g of enzyme (MW-30kDa) gives a Vmax of 3  mol of product produced per minute. What is the turnover number for this enzyme? (b) 100 Sec–1 (a) 1000 Sec–1 –1 (c) 10 Sec (d) 333 Sec–1 57. The below graph represents:

(a) Competitive inhibition (b) Uncompetitive inhibition (c) Bi-substrate reaction (d) Noncompetitive inhibition 58. Which of the following statement about suicide inhibitors is not true? (a) They are irreversible inhibitors (b) They are non-reactive till they bind to the active site 52. (d)

53. (a)

54. (c)

55. (b)

56. (a)

57. (c)

582

Plant Physiology: Question Bank

10.0  g of pure carbonic anhydrase catalyzed the hydration of 0.30 g of CO2 in 1 min at 37°C at Vmax, what is the turnover number of carbonic anhydrase? (a) 2*107min–1 (b) 2*108min–1 6 –1 (c) 2*10 min (d) 4*106min–1

(c) After binding, they immediately inhibit the enzyme function (d) They are called mechanism-based inactivators 59. Which of the following reaction is catalyzed by lysozyme? (a) Hydrolysis of peptide bond (b) Addition of phosphate group (c) Cleaves the glycosidic bond between NAG and NAM in bacterial cell wall (d) None of the above 60. The HIV protease is an example of: (a) Serine protease (b) Cysteine protease (c) Aspertyl protease (d) Metalloprotease 61. Cooperative interactions can be reflected by: (a) A sigmoid curve (b) A rectangular hyperbola (c) A linear graph (d) None of the above 62. Which of the following is a covalent modification catalyzed by diphtheria toxin? (a) Phosphorylation (b) Methylation (c) ADP-ribosylation (d) Carboxylation 63. Phosphorylation is a covalent modification catalyzed by protein kinases. The addition of the phosphate group occurs in which amino acid? (a) Ser (b) Asp (c) Ala (d) Pro 64. In order to form mature trypsin, how many amino acids are deleted from trypsiongen? (a) 25 (b) 6 (c) 7 (d) 11 65. Carbonic anhydrase is the enzyme with highest turnover number. If Ans.

58. (c) 69. (a)

59. (c)

60. (c)

61. (a)

62. (c)

66. Allosteric inhibition of an enzyme involves which of the following? (a) Binding of a negative modulator to a site other than the substrate binding site (b) Binding of a negative modulator competitively to the substrate binding site (c) Binding of a negative modulator noncompetitively to the substrate binding site (d) Cooperative binding of a substrate to an enzyme 67. An example of competitive inhibitor is the inhibition of: (a) Carbonic anhydrase by CO2 (b) Hexokinase by glucose-6-phosphate (c) Cytochrome oxidase by cyanide (d) Succinate dehydrogenase by malonate 68. The enzyme glutathione peroxidase contains: (a) Zn (b) Se (c) Mo (d) Fe 69. Which the following statements are correct about coenzymes? P. Tetrahydrofolate transfer –CH 3, –CH2, –CHO and –CHNH group Q. S.adenosylmethionine transfers –CH3 group R. Biotin transfer CO2 group S. TPP transfer acyl group (a) P, Q and R (b) P and R (c) R and S (d) P, Q, R and S 63. (a)

64. (b)

65. (a)

66. (a)

67. (d)

68. (b)

Practice Windows

70. Catalytic antibodies function as enzymes on the principle of: (a) Enzymatic conversion of antibodies (b) Stabilizing transition state analogue of substrates (c) Monoclonal antibodies with chemical capability (d) Antigen-antibody affinity 71. Zymogen is: (a) Immature form of an enzyme that undergoes maturation by cleavage (b) The non-protein part of an enzyme (c) The unfolded form of an enzyme (d) The complex formed between an enzyme and its substrate 72. Isozymes are characterized by: (a) The different chemical reactions that they catalyze (b) The differences in their elution profile from a size-exclusion column (c) The differences in their amino acid sequences (d) All of the above 73. Which of the following effect does pH have on enzyme catalyzed reaction? A. The direction of the reaction may be influenced by concentration of H+ B. The ionization state of dissociating groups on the enzyme may be modified C. The ionization state of the substrate may be modified D. The protein may be denatured at certain pH values (a) A and B (b) A and C (c) A, B and C (d) A, B, C and D 74. Alcohol dehydrogenase converts methanol to formaldehyde. If a person drinks methanol, the best way to detoxify it to: (a) Feed the patient with glucose (b) Make the person drink ethanol Ans.

70. (b)

71. (a)

72. (a)

73. (d)

74. (b)

583

(c) Make the person drink lemon juice (d) Give an intravenous dose of steroids to the patient 75. The steady state hypothesis suggests that: (a) Rate of formation of ES complex is equal to the rate of its breakdown (b) Rate of formation of ES complex is equal to rate of formation of products (c) Enzymes are steadily consumed in the reaction (d) None of the above 76. Which enzyme inhibitors represent the most common used clinical agents? (a) Reversible inhibitors (b) Irreversible inhibitors (c) Suicide substrates (d) Transition state inhibitors 77. Which of the following agents act as irreversible inhibitors? (a) Sulphonamides (b) Penicillin (c) Statins (d) Protease inhibitor 78. Irreversible inhibitors form covalent bonds with: (a) Any amino acid residues at or near the active site (b) Tryptophan or phenylalanine residues at or near the active site (c) Positively charged residues at the active site (d) Ser or Cys residues at or near the active site 79. The effect of a competitive inhibition can be reversed by: (a) Increasing the product concentration (b) Increasing the substrate concentration (c) Changing the pH (d) Changing the temperature 75. (a)

76. (a)

77. (b)

78. (d)

79. (b)

584

Plant Physiology: Question Bank

80. Inhibition of enzyme cytochrome oxidase by carbon monoxide is an example of: (a) Feedback inhibition (b) Competitive inhibition (c) Noncompetitive inhibition (d) None of the above 81. Number of substrate molecule convened into product by one molecule of enzyme active site per unit time is called: (a) Turnover number (b) Reaction number (c) Maximum velocity (d) Substrate number 82. The enzyme that catalyze the formation of peptide bond is a: (a) Protein (b) RNA (c) Carbohydrate (d) None of the above 83. A given substrate may be acted upon by a number of different enzymes, each of which uses the same substrate and produces the same product. The set of enzymes is known as: (a) Group specific enzymes (b) Isoenzymes (c) Substrate specific enzymes (d) Allosteric enzymes 84. The aspartic acid residue (Asp52) at the active site of lysozyme serves which of the following purposes as a part of the catalytic mechanism? (a) General acid catalysis (b) General base catalysis (c) Electrostatic stabilization of a carbonium ion (d) Covalent catalysis 85. Isoenzymes can be identified in an electrophoresis by incorporation of: (a) Urea (b) 2-marcaptoethanol (c) DMSO (d) None of the above Ans.

80. (c)

81. (a)

82. (b)

83. (a)

84. (c)

86. Isoenzymes differ in their: (a) Molecular weight (b) Electrophoretic mobility (c) Km values (d) Both (b) and (c) 87. The purity of an enzyme at various stages of purification is best measured by: (a) Total protein (b) Total enzyme activity (c) Specific activity of the enzyme (d) None of the above 88. The active site differs from antigenantibody binding in that: (a) The active site is complementary to a specific substrate (b) Active site contains amino acids without side chains (c) Catalyzes a chemical reaction (d) Active site contains modified amino acids 89. The transition state of an enzymatic reaction is: (a) Lower in energy than a uncatalyzed reaction (b) Lower in energy than the substrate (c) Bound very weakly to the catalyst (d) A highly populated intermediate in the reaction pathway 90. Which of the following is an example of feedback inhibition? (a) Cytochrome oxidase inhibition by cyanide (b) Inhibition of hexokinase by glucose-6-phosphate (c) Reaction between succinate dehydrogenase and succinate (d) None of the above 91. Which of the following statement is correct regarding enzyme inhibition? (a) Competitive inhibition is seen when a substrate competes with an enzyme for binding to an inhibitor 85. (a)

86. (d)

87. (c)

88. (c)

89. (a)

90. (b)

Practice Windows

585

(b) Noncompetitive inhibition of an enzyme can be overcome by adding large amount of substrate (c) Noncompetitive inhibitors often bind to the enzyme irreversibly (d) Competitive inhibition is seen when the substrate and the inhibitor compete for the active site of an enzyme

Based on the above information, what could be the possible function of malonic acid? (a) It decreases the pH of the system (b) It forms a permanent attachment to the active site of an enzyme (c) It has a similar molecular conformation to that of the succinic acid (d) It acts as a coenzyme

92. Some of the enzymes, involved in the conversion of fats to carbohydrates are present in: (a) Golgi bodies (b) Chloroplasts (c) Glyoxysomes (d) Liposomes

97. Which of the following is an extracellular enzyme? (a) Catalase (b) DNA polymerase (c) Keratin (d) Trypsin

93. Which of the following enzyme deficiency causes albinism? (a) Tyrosinase (b) Phenylalanine hydroxylase (c) Hexosaminidase A (d) Melaninase 94. Which of the following reactions used for the purpose of recycling enzymes in bioprocesses? (a) Isomerization (b) Phosphorylation (c) Immobilization (d) Polymerization 95. De novo synthesis of an enzyme, promoted by the substrate on which it acts, is characterized by the term: (a) Induction (b) Activation (c) Gratuity (d) Derepression 96. Succinate dehydrogenase is the enzyme that catalyzes the oxidation of succinate during TCA cycle. If malonic acid or malonate is added to the system the rate of the reaction is reduced. An increase in the concentration of succinate increases the rate of the reaction again. Ans.

91. (d)

92. (c)

93. (a)

94. (c)

95. (a)

98. Which of the following condition is least likely to denature an enzyme? (a) An extreme temperature (b) A high pH (c) Heavy metal ion (d) A low temperature 99. Which of the below curves represent the result of an experiment in presence of a fixed, low concentration of a reversible competitive inhibitor?

(a) A (c) C

(b) B (d) D

100. Which of the curves represent the presence of an irreversible noncompetitive inhibitor? (a) A (b) B (c) C (d) D 96. (c)

97. (d)

98. (d)

99. (a) 100. (b)

586

Plant Physiology: Question Bank

Model Test Paper II

1. Which of the following pair of amino acids has more than one chiral centres? (a) Alanine, arginine (b) Tyrosine, isoleucine (c) Isoleucine, threonine (d) Methionine, lysine 2. Which of the following amino acid is most likely to be found inside of a protein? (a) Lysine (b) Glutamic acid (c) Tyrosine (d) Leucine 3. Isoelectric point is defined as: (a) The pH at which all groups are protonated (b) The pH at which all groups are deprotonated (c) The pH at which the molecule has no net charge (d) None of the above 4. Which of the following is an essential amino acid? (a) Asparagines (b) Cystine (c) Serine (d) Phenylalanine 5. Nonpolar amino acids are found mostly: (a) In the core of proteins (b) On the outer surface (c) In the active site (d) In nonspecific region 6. Which of the following amino acid is negatively charged at physiological pH (pH 7.0)? (a) His (b) Arg (c) Asp (d) Ala 7. Which of the amino acid is present on the exterior of a protein? (a) Valine (b) Isoleucine (c) Alanine (d) Arginine 8. Which of the following amino acid has the highest and lowest isoelectric points respectively? (a) Arg, Ala (b) Arg, Asp (c) Lys, Glu (d) Glu, Arg Ans.

1. (c) 12. (b)

2. (d) 13. (c)

3. (c) 14. (c)

4. (d) 15. (a)

5. (a) 16. (b)

9. What is the average mass of an amino acid in a polypeptide chain? (a) 155 dalton (b) 110 dalton (c) 180 dalton (d) 118 dalton 10. Consider the molecular mass of an amino acid is 150 dalton. The molecular weight of a pentapeptide generated from it will be: (a) 750 (b) 840 (c) 786 (d) 678 11. A protein with a molecular weight of 95 kDa will have: (a) 9500 residues (b) 950 residues (c) 8600 residues (d) 860 residues 12. The 21st amino acid, Selenocysteine is derived from which of the following amino acid? (a) Cysteine (b) Serine (c) Methionine (d) Aspartate 13. The pK value of alanine changes as it forms di-, tri- or oligopeptide of alanine. Which of the following statement is true? (a) pK 1 decreases as the chain length increases (b) pK 2 increases as the chain length increases (c) pK 2 decreases as the chain length increases (d) both pK1 and pK1 remains same 14. Which of the following amino acid has the least propensity to form an alphahelix? (a) Alanine (b) Valine (c) Proline (d) Glycine 15. Which of the following amino acid has the most propensity to form an alphahelix? (a) Alanine (b) Valine (c) Glycine (d) Proline 16. Which of the following amino acid is unable to rotate light? (a) Valine (b) Glycine (c) Tyrosine (d) Proline 6. (c)

7. (d)

8. (b)

9. (b)

10. (d)

11. (d)

Practice Windows

17. An amino acid with buffering capacity at neutral pH: (a) Histidine (b) Tyrosine (c) Arginine (d) Aspartic acid 18. At a pH, lower than the PI most amino acids behave like: (a) A cation (b) An anion (c) A zwitterions (d) None of these 19. The peptide bond in proteins is: (a) Planar and can rotate freely (b) Nonpolar and fixed in a trans configuration (c) Planar and fixed in a trans configuration (d) Nonpolar and cannot rotate freely 20. The average half-life of a peptide bond is: (a) 15 days (b) 70 years (c) 7 years (d) 7 mins 21. Which of the following peptide will show no or less electrophoretic mobility at neutral pH? (a) Ala-Gly-Ser (b) His-Ala-Tyr (c) Asp-Arg-Glu (d) Asp-Lys-His 22. A polar amino acid in a solution of pH 1.5 is titrated against a basic solution. At which point all the molecules will be negatively charged: (a) At the first equivalent point (b) At the isoelectric point (c) At the second half equivalence point (d) At the second equivalence point 23. In a highly acidic solution, glycine will exist in which of the following forms: (a) HN3+—CH2—COOH (b) HN3–—CH2—COOH (c) HN2—CH2—COOH (d) HN2—CH—COOH 24. Which of the following is an imino acid? (a) Arginine (b) Lysine (c) Proline (d) Histidine Ans.

17. (a) 28. (d)

18. (a) 29. (d)

19. (c) 30. (c)

20. (c)

21. (a)

587

25. A mutation has changed an isoleucine residue of a protein to glutamic acid Which of the following statement best describes its location in a globular protein? (a) On the surface (b) In the core of the protein (c) Anywhere, inside or outside (d) None of the above 26. Absence of which amino acid in collagen causes scurvy? (a) Hydroxy proline (b) Hydroxy lysine (c) Hydroxy serine (d) Hydroxyl glutamate 27. Insertion of which of the following amino acid most likely to distort the structure of collagen? (a) Ala (b) Val (c) Trp (d) Ser 28. Among the following, at which point an amino acid shows maximum buffering capacity? (a) At the first equivalence point (b) At the isoelectric point (c) At the second equivalence point (d) Both (a) and (c) 29. What is the net charge of the following peptide at pH 11? Glu-His-Phe-Thr-Ala-Arg-Leu-ProVal (a) +2 (b) –2 (c) 0 (d) –1 30. The isoelectric point of lactate dehydrogenase is 5.5 it was known that, the protein had 12 positively charged and 10 negatively charged ions. At pH 8.5, it was observed that the protein had undergone 3 deprotonation. The net charge on the enzyme at pH 8.5 would therefore, be: (a) –9 (b) +3 (c) –3 (d) +9 31. The most predominant non-covalent interaction stabilizing the  -helix is the hydrogen bonding. The hydrogen bonds in the helix: 22. (d)

23. (a)

24. (c)

25. (a)

26. (a)

27. (c)

588

Plant Physiology: Question Bank

(a) Occur mainly between the electronegative atoms of the side chain R groups (b) Occur mainly between the electronegative atoms of the backbone (c) Are perpendicular to the helix axis (d) All of the above 32. The side chains of the amino acid residues of -helix: (a) Are parallel to the axis of the helix (b) Are located outside the helix axis (c) Are perpendicular to helix (d) None of the above 33. Which of the following is not an example of super secondary structure? (a) Greek Key (b) -barrel (c) Type I reserve turn (d)  unit 34. Ramachandran’s plot shows: (a) The amino acid residues that have the greatest degree of rotational freedom (b) The sterically limited rotational angles where phi and psi are allowed in the protein backbone (c) The sterically allowed rotational angles between the side chain groups in a peptide and the peptide backbone (d) The angles that are allowed about the bonds connecting the amide nitrogen in a peptide bond 35. The rise per residue of a  -helix is about 1.5 Å. A protein passes 7 times the bilayer membrane having diameter 4 nm through its helical transmembrane domain. What is the number of amino acid residues that constitute the transmembrane protein? (a) 45 (b) 150 (c) 190 (d) 450 36. Which of the following statement about isoelectric point is not true? Ans.

31. (c)

32. (b)

33. (b)

34. (b)

35. (c)

(a) At isoelectric point, proteins have a net charge of zero (b) Proteins have the most electrophoretic mobility at isoelectric point (c) Proteins are less soluble at isoelectric point (d) At isoelectric point amino acids occur as a zwitterions 37. A polypeptide has 60 residues which contain 120 bonds around which it can rotate freely. Assume 3 orientations are possible per bond. Based on this information, how many possible conformations will be possible for the polypeptide? (b) 1203 (a) 3120 600 (c) 3 (d) 60*120*3 38. Which of the following polypeptide will be more soluble at pH 5.0? (a) Ala-Ser-Ile-Asp-Phe-Pro (b) Gly-Tyr-Arg-Leu-Asp-Cys (c) Asp-Ala-Arg-Glu-Lys-Tyr (d) Ala-Val-Ser-Leu-Phe-Trp 39. Which of the following peptide is most suitable to form the transmembrane domain of a protein? (a) Ala-Ile-Val-Met-Gly-Pro-Phe-Ala (b) Asp-Gly-Arg-Leu-Asn-Ser-Tyr-Thr (c) Arg-Leu-Asp-Glu-Pro-Lys-Glu-Tyr (d) Gln-Cys-His-Asp-Asp-Gly-Arg-Tyr 40. Choose the following pair of amino that give protein max of 280 nm. (a) Phe, Cys (b) Ala, Tyr (c) Tyr, Trp (d) Trp, His 41. The oligopeptide M-A-L-M-C-H-M-S was treated with Cyanozen Bromide (CNBr). Which of the following fragment will not be generated from this treatment? (a) A-L-M-C-H-M (b) M-A-L (c) M-A-L-M (d) M-A-L-M-C-H-M 36. (b)

37. (a)

38. (c)

39. (a)

40. (c)

41. (b)

Practice Windows

42. You are successful in generating a mutant protein by site directed mutagenesis which has a higher isoelectric point than the wild type. Which of the following change in the amino acid can bring these changes? (a) Tyr to Lys (b) Asp to Arg (c) Gly to Leu (d) Arg to Asp 43. Following are some of the confirmatory tests that are done for the detection of a specific amino acid. Choose the correct match. Amino acid Name of the test (a) Tyrosine Sacaguchi (b) Arginine Millon (c) Cystine Hopkins cole (d) Histidine Pauly 44. Aspartame, the artificial sweetener has the sequence: (a) Asp-Phe (b) Phe-Arg (c) Asp-Gly (d) Asp-Met 45. 2D gel electrophoresis separators proteins on the basis of: (a) Charge and mass (b) Mass and charge (c) Shape (d) Molecular weight 46. Two proteins have the same molecular weight, charge and substrate specificity, but they have different pI. Which of the following procedure is most suitable to separate two proteins? (a) Ion exchange chromatography (b) Affinity chromatography (c) Isoelectric focusing (d) Gel filtration chromatography 47. Which of the following non-covalent interaction is responsible for the stability of an alpha-helix? (a) Ionic interaction (b) Hydrogen bonding (c) van der Waals interaction (d) Hydrophobic interaction Ans.

42. (b) 53. (a)

43. (d)

44. (a)

45. (a)

46. (c)

589

48. Which of the following amino acid is -helix terminator? (a) Alanine (b) Cystine (c) Glycine (d) Proline 49. Which of the following repeat is known as the Rossamann Fold? (a)  (b)  (c)  (d) None of the above 50. In -helix the bonding is between: (a) Adjacent amino acids (b) Carbonyl oxygen of one amino acid to the NH group of the 4th amino acid (c) NH group of the 1st amino acid to the CO group of the 4th amino acid (d) All of the above 51. An  -helix is made-up of 80 amino acid residues. What will be its length in fully extended conformation and also the axial length of the helix? (a) 288 Å,120 Å (b) 120 Å,120 Å (c) 120 Å,288 Å (d) 288 Å,288 Å 52. The mirror image of right handed -helix with all L-amino acids will be: (a) Right handed -helix with L- amino acids (b) Right handed -helix with D-amino acids (c) Left handed -helix with L-amino acids (d) Left handed -helix with D-amino acids 53. Which of the following polypeptide will form a -strand? (a) Gly-Ala-Gly-Ala-Gly-Ser-Gly-AlaGly-Ser-Gly-Ala (b) Ile-Glu-Asn-Glu-Gln-Asn-Met-AlaHis-Phe-Tyr-Trp (c) Gly-Arg-Pro-His-Ala-Gly-Phe-TyrSer-Met-Pro-Cys (d) None of the above 47. (b)

48. (d)

49. (c)

50. (b)

51. (a)

52. (d)

590

Plant Physiology: Question Bank

54. The three dimension structure of a protein is mainly stabilized by: (a) Covalent interactions (b) Non-covalent interactions (c) Covalent and coordinate bonds (d) All of the above 55. The isoelectric point of Asp is 2.76. If it is dissolved in a buffer of pH 5.0 and subjected to electrophoresis: (a) It will migrate to the anode (b) It will migrate to the cathode (c) It will not migrate (d) It will migrate to either cathode or anode 56. How many molecules of amino acid residues a SDS molecule binds in a protein sequence? (a) 2 (b) 3 (c) 4 (d) 5 57. Which of the following is known as the Sanger’s reagent? (a) 1-fluro-2,5-dinitrobenzene (b) 1-fluro-2,4-dinitrobenzene (c) 6-fluro-1,3-dinitrobenzene (d) 1-fluro-3,5-dinirobenzene 58. What is the sequence of the polypeptide generated through the following treatments: 1. Acid hydrolysis (Ser2, Gly, Ala, Lys2, Leu, Met., Phe, Tyr, Asp) 2. Trypsin digestion (Gly, Ser, Lys), (Leu, Lys), (Met, Phe, Asp, Tyr, Met, Ala, Ser) 3. CNBr digestion (Ser, Gly, Met, Lys2, Leu), (Phe. Tyr, Met, Asp), (Ala, Ser) 4. Chymotrypsin treatment (Ser, Gly, Lcu, Lys2, Phc, Met), (Asp, Tyr), (Ala, Met, Ser) (a) Gly-Leu-Lys-Ser-Lys-Phe-MetAsp-Tyr-Ser-Ala-Met (b) Gly-Ser-Leu-Lys-Met-Lys-AspPhe-Ala-Ser-Met-1W (c) Gly-Ser-Lys-Leu-Lys-Met-PheAsp-Tyr-Met-Ala-Ser Ans.

54. (b)

55. (b)

56. (a)

57. (b)

58. (c)

(d) Met-Phe-Lys-Leu-Lys-Gly-Ser-MetAla-Ser-Tyr-Asp 59. A group of scientists have identified the following peptide having antibacterial property, Glu-Lys-Leu-Phe-AlaTyr-His-Glu-Ala. Further studies have indicated that the deletion of the tripeptide His-Glu-Ala from the above peptide has enhanced the property. Which of the following strategy will be more appropriate to achieve the objective? (a) By chymotrypsin hydrolysis of the protein (b) By nypsin hydrolysis of the protein (c) By acid hydrolysis (d) By using antibody against the tripeptide 60. Cleavage of the following peptide with Pepsin generates: Gly-Lys-Ile-Arg-Met-Tyr-Asn-ProVal-Ser (a) 2 fragments (b) 3 fragments (c) 4 fragments (d) 5 fragments 61. In Sanger method of nucleotide sequencing, the N-terminal of an amino acid is determined by using: (a) Acid hydrolysis (b) 2,4- FDNB (c) Phenylisothiocyanate (d) Hydrazine 62. What does the (W) mean in a sequence of protein? (a) Tryptophan (b) Any amino acid except tryptophan (c) Any amino acid (d) None of the above 63. A peptide with the sequence Lys-AlaGly-Leu-Ile-Asn-Ser-Ala is sequenced by Edman process. If each Edman cycle is 96% efficient, what percent of amino acids liberated in the E cycle will be Leu? (a) 96% (b) 92% (c) 88% (d) 48% 59. (a)

60. (a)

61. (b)

62. (b)

63. (c)

Practice Windows

64. Often it is seen that retrieval of the noncovalent interactions results in the renaturation of protein 3d structure. However we cannot get an intact egg from an omlet. Because: (a) All the three dimensional structure is lost (b) The primary structure is lost (c) High temperature denatures all the bonds (d) All of the above 65. What function does SDS serve in gel electrophoresis? (a) Interferes with the hydrophobic interactions (b) Give uniform charge distribution to the proteins (c) Unwind proteins (d) All of the above 66. A mixture of proteins with pls 3, 5, 8 and 11 are loaded on CM-cellulose column equilibrated with a buffer of pH 7. Which of the four proteins would be expected to be eluted from the column? (a) Proteins with pl 3 and 5 only (b) Protein with pl 11 not the others (c) Protein with pI 8 only, not the others (d) Proteins with pl 8 and I I, but not 5 and 3 67. Native PAGE of a protein gives the molecular weight of about 80,000 daltons. SDS-PAGE of this protein gives a single band of molecular weight 20,000 in presence of ftmarcaptoethanol. N-terminal analysis gave two amino acids Alanine and Leucine in equal proportions. Hence the protein is a: (a) Homotetramer (b) Dimer of two dimmers (c) Protein is contaminated with another protein Ans.

64. (d)

65. (d)

66. (d)

67. (d)

68. (a)

591

(d) Protein contains four polypeptide chains linked with disulfide bonds 68. Which of the following is the most common method for the detection of changes in the secondary structure of a protein? (a) Circular dichroism (b) UV absorption spectroscopy (c) NMR spectroscopy (d) All of the above 69. A researcher has isolated a protein by eluting it between 160 kDa and 90 kDa in gel filtration chromatography. When he run the protein In a SDSPAGE containing p-marcaptoethanol, he observed a single band of 35 kDa. How many subunits are therein the protein? (a) One (b) Two (c) Three (d) Four 70. A protein was purified by size exclusion chromatography, had the molecular weight of 80 kDa. Chromatography in presence of 6 M urea yielded 40 kDa proteins. When chromatography was repeated in presence of 6M urea and 10 mM 11-mercaptoethanol, a single molecular species of 20 kDa was resulted. The protein is a: (a) Homodimer of 40 kDa (b) Homodimer of 20 kDa (c) Homotetramer of 20 kDa (d) Homotetramer of 40 kDa 71. Cation exchangers bind proteins that have: (a) Acidic pI (b) Basic pI (c) No charge (d) Highly hydrophobic 72. A group of students purified an enzyme by using different purification techniques which are listed in the following table. Which of the purification technique is the most effective? 69. (d)

70. (c)

71. (b)

592

Plant Physiology: Question Bank

Procedure Crude extract Salt precipitation Ion exchange chromatography Affinity chromatography Size exclusion chromatography

(a) Step 1 (c) Step 5

Total Protein (mg)

Activity (units)

20,000 5,000 2000 50 30

40,00,000 30,00,000 8,00,000 7,50,000 6,75,000

(b) Step 3 (d) Step 4

73. The isoelectric point 6-phosphogluconate dehydrogenase is 6. A researcher wants to purify it by using DEAE anion exchanger. Which of the following pH range will be suitable for its retention in the column? (a) pH 4 to pH 6 (b) pH 6 (c) pH 6 to pH 9 (d) above pH 9 74. A researcher wanted to elute three proteins; ovalalbumin (pi 4.6), urease (p1–5.0) and myoglobin (pI = 7.0). The protein mixture was loaded to a DEAE column adjusted to pH 6.5. The proteins were first eluted with a buffer (pH 6.5) of low ionic strength and then the same buffer having high concentration of NaCI was used to elute them. In which order the proteins will elute from the column? (a) Ovalalbumin-urcase-myoglobin (b) Urease-ovalalbumin-myoglobin (c) Myoglobin-urease-ovalalbumin (d) Myoglobin-urease-ovalalbumin 75. An enzyme (mol. wt. 25 kDa; p1 5.5) is contaminated with two other proteins, one with a similar molecular mass and pl of 7.0 while the other has a molecular mass of 100 kDa and pl of 5.4. Which of the following techniques will be useful to purify the enzyme? (a) Size exclusion; Ion exchange (b) Affinity chromatography; SDS PAGE (c) Ion exchange; Size exclusion (d) Size exclusion; Isoelectric focusing Ans.

72. (c)

73. (c)

74. (a)

75. (d)

76. (c)

76. A student isolated a protein from a bacterium and run it in SDS-PAGE. Followed by staining, a single band appears. In order to confirm the results, the supervisor asked to run the protein in native PAGE. To his surprise, this time the student got two bands. %Mich of the following can be the most possible reason? (a) The result of the SDS-PAGE was not right (b) The protein was degraded while doing native PAGE (c) Proteins with different pi, which were neutralized in the SDS PAGE giving a single band (d) The proteins in the native PAGE were denatured in the SDS PAGE to give similar mass 77. Which of the following polypeptide can form an a-helix? (a) Gly-Ala-Gly-Ala-Gly-Ser-Gly-AlaGly-Ser-Gly-Ala (b) Ile-Glu-Asn-Glu-Gln-Asn-Met-AlaHis-Phe-Tyr-Trp (c) Gly-Arg-Pro-His-Ala-Gly-Phe-TyrSer-Met-Pro-Cr (d) None of the above 78. Protein A will fold into its native conformation when protein X is present in the solution. However protein X can fold into its native conformation in the absence of protein (A) Protein X can therefore function as a: (a) Ligand (b) Molecular chaperon (c) Supersecondary structure (d) Structural motif 79. Which of the following forces is favorable for folding of a protein? (a) Hydrogen bonding (b) Hydrophobic interaction (c) Ionic interaction (d) van der Waals interaction 77. (b)

78. (b)

79. (b)

Practice Windows

80. Folding of a protein does not depends on: (a) Concentration of salts (b) pH (c) Solvent (d) Solute 81. Which of the following is a function of molecular chaperons? (a) It degrades proteins that have folded properly (b) It provides a template for protein folding (c) It degrades proteins that have not folded properly (d) It provides a microenvironment to the improperly folded proteins and allow them to fold properly 82. Which of the following are chaperons in E. coli? (a) Hsp 70 (b) Hsp 40 (c) DnaA (d) DnaK & Dna1 83. During a successful protein purification, one would expect that: (a) The specific activity increases (b) The specific activity decreases (c) The number of proteins decrease (d) Both (a) and (c) 84. In isoelectric focusing, separation of the proteins is based on: (a) Relative content of positively charged groups (b) Relative content of negatively charged groups (c) pH (d) Both (a) and (b) 85. You find that your protein sample losses its activity during storage. How can you solve this problem? (a) Add an additional purification step (b) Use a protease inhibitor during the purification step (c) Perform each step as quick as possible, in cold conditions (d) All of the above 86. Which of the following technique is often called the ‘polishing step’ in a protein purification strategy? Ans.

80. (d) 91. (b)

81. (d)

82. (d)

83. (d)

84. (d)

593

(a) Size exclusion chromatography (b) Ion exchange chromatography (c) Hydrophobic interaction chromatography (d) Affinity chromatography 87. The void volume of the Gel-filtration column is 30 ml. A monomeric protein with a known molecular weight of 25 kDa elutes at a volume of 45 ml. The protein of your interest elutes at 35 ml. Which of the following explanation is true? (a) The protein is repelled by the column matrix (b) The protein is not monomeric in solution (c) The protein is disrupted during purification (d) None of the above 88. Salting out process involves: (a) Precipitation of proteins using ammonium sulphate (b) Precipitation of proteins using sodium chloride (c) Precipitation of proteins using copper sulfate (d) None of the above 89. In the binding of oxygen to myoglobin, the relationship between concentration of oxygen and the fraction of binding site occupied can best be described as: (a) Sigmoid (b) Hyperbolic (c) Linear with a positive slope (d) Linear with a negative slope 90. The transition from T to R state in haemoglobin is triggered by: (a) Fe2+ binding (b) Heme binding (c) Oxygen binding (d) Subunit association 91. Which of the following changes in amino add sequence is responsible for sickle cell anemia? (a) Arg to Ala (b) Glu to Val (c) Lys to Leu (d) Tyr to Met 85. (d)

86. (a)

87. (b)

88. (a)

89. (b)

90. (c)

594

Plant Physiology: Question Bank

92. Which of the following is not correct about cooperative binding of a ligand to a protein? (a) It is usually a form of allosteric interaction (b) It results in a nonlinear Hill plot (c) It is usually associated with proteins having multiple subunits (d) It rarely occurs in enzymes 93. Which of the following state of hemoglobin has the highest binding affinity for oxygen? (a) Hb (b) Hb(O)2 (c) Hb(O2)2 (d) Hb(O2)4 94. Which of the following reagents would be most useful in determining the N-terminal amino acid of polypeptide? (a) Trypsin (b) Cyanogens bromide (c) HCl (d) Phenylisothiocyanate 95. The highest concentration of cystine can be found in: (a) Keratin (b) Collagen (c) Myosin (d) Melanin

Ans.

92. (d)

93. (c)

94. (d)

95. (a)

96. (a)

96. The best way to determine the location of protein is the purification scheme is to measure: (a) Rate of ATP synthesis (b) Changes in the refractive index (c) Mass spectroscopy of the protein (d) UV absorption 97. The amino acid commonly used in SDS buffers S: (a) Glycine (b) Arginine (c) Glutamic acid (d) Aspartic acid and lysine together 98. Which of the following amino acid is used S ‘Stripping’ of Western Blot? (a) Glycine (b) Glutamic acid (c) Phenylalanine (d) Alanine 99. Glycine and proline are the most abundant amino acids in the structure of: (a) Elastin (b) Collagen (c) Haemoglobin (d) Insulin 100. Which of the following amino acid is a precursor for a mediator of allergies and inflammation? (a) Histidine (b) Tyrosine (c) Phenylalanine (d) Tryptophan

97. (a)

98. (a)

99. (b) 100. (a)

Practice Windows

4. Match the column given below.

Model Test Paper III

1. Native DNA consists of two antiparallel strands. Which is complementary in nature. Below are some statements that describe the characteristics of DNA double helix. Mention the wrong statement. (a) The base pairing of DNA duplex follows mainly Watson-Crick base pair rule (b) The backbone of DNA consists by nitrogenous base, sugar and phosphate molecule (c) Most DNA in Cells are basically right handed double helix in nature (d) Phosphodiester bond holds the backbone structure of DNA in an intact form 2. Mention the correct statement following below: (a) The three dimensional structure of nucleic acids does not depends upon the characteristics of nucleotide bases (b) DNA binding proteins generally binds with the major and minor groove of the duplex DNA (c) The two antiparallel strands of DNA is stabilized mostly by covalent bonds (d) DNA acts as a genetic material and it has a catalytic power 3. Which is true statement about the nucleic acids? (a) In a particular species, the base composition of DNA is changes with the changing environment (b) One turn of DNA double helix proposed by Watson and Crick has 10.5 base pairs and it is 4.6 nm in length (c) X-ray diffraction data of DNA double helix shows that adenine always binds with thymine and guanine with cytosine (d) Chargoff’s rule states that A + T = G+C Ans.

1. (b)

2. (c)

3. (c)

595

4. (d)

5. (b)

(a) Rosalind Franklin (b) Watson and Crick (c) Erwin Chargoff (d) Harshey and Chase

1. Purine is present always in equal amounts as pyrimidine 2. X-ray diffraction study of DNA 3. Double helical structure of DNA 4. DNA acts as a genetic material 5. Works on Streptococcus pneumoniae 6. Diffraction of visible light

(a) (a)-4, (b)-3, (c)-2, (d)-4 (b) (a)-4, (b)-3, (c)-1, (d)-5 (c) (a)-4, (b)-3, (c)-1, (d)-5 (d) (a)-2, (b)-3, (c)-1, (d)-4 5. Choose the incorrect statement given below: (a) DNA molecule is relatively fragile in nature (b) The maximum point of temperature at which DNA is denatured is called it’s Tm Value (c) Heteroduplex DNA contains mismatched base pairs (d) Bacteriophage phi 174 contains circular single stranded DNA 6. Which of the following statements are correct? A. Negative supercoiling of DNA is generally found in circular DNAs of mitochondria, viral and bacterial chromosomes B. Positive supercoiling is bound in eukaryotic chromosomes C. Positive supercoiling of eukaryotic DNA prevents the DNA to be compacted in a limited space within nucleus D. VNTRs are helpful for the identification of individuals during DNA fingerprinting process (a) A, B, C (b) A, C, D (c) A, B, D (d) B, C, D 7. Match the following column given below: (a) LINEs and SINEs (b) Linker DNA (c) Uridine

6. (c)

1. Specifically radio labelled for RNA detection 2. Moderately repeating DNA sequences 3. H3 Histone

596

Plant Physiology: Question Bank

(d) Leading strand of DNA 4. 3’-5’ direction 5. H1 Histone 6. 5’-3’ direction

(a) (a)-1, (b)-2, (c)-4, (d)-6 (b) (a)-2, (b)-3, (c)-1, (d)-4 (c) (a)-2, (b)-5, (c)-1, (d)-4 (d) (a)-1, (b)-2, (c)-6, (d)-4 8. Mention the correct statement given below. (a) RNA is very prone to hydrolysis in alkali because of the presence of glycosidic bonds (b) The stability of DNA in alkaline hydrolysis process is due to the absence of 2’-OH group (c) mRNA is synthesized and translated in the cytoplasm of the cell (d) Sugar found in nucleic acids are in pentose form and is planner in nature 9. Choose the incorrect statement given bellow. (a) Nucleotide acts as a precursor of secondary messengers like cAMP, cGMP, etc. (b) Sugar and nitrogenous base combinedly forms nucleotide of DNA molecules (c) In nucleic acid, the sequence of nucleotide residues is written from 5’ to the 3’ orientation (d) The major groove of B-DNA is generally wide and deep 10. The mode of DNA replication is semiconservative. Which is the correct option given below? A. Semi conservative mode of DNA replication is proposed by the scientists Watson and Crick B. Messelson and Stahl experimentally proved that DNA replication is semiconservative C. Messelson and Stahl used p32 radioisotope in their experiment D. Messelson and Stahl used N15 and N14 radioisotope in their experiment

Ans.

7. (c)

8. (b)

9. (b)

10. (c)

11. (d)

Which is the correct option given below? (a) A, C, D (b) B, C, D (c) A, B, D (d) A, B, C 11. During DNA replication, two strands of DNA are separated and new strands are synthesized which are complementary to each strand. Which is the correct statement about DNA replication? A. The orientation of leading strand is 5’-3’ and this strand is joined to its parental strand by covalent interaction B. A single RNA primer is enough to synthesize the leading strand of DNA C. Multiple RNA primers are required to synthesize the lagging strand D. RNA primers of okazaki fragments are finally removed by DNA polymerase I Which option is correct? (a) A, B, D (b) A, C, D (c) A, B, C (d) B, C, D 12. Mention the true statement about the physical and chemical nature of DNA replication. A. Prokaryotic chromosomal DNA is basically monorepliconic in origin B. Eukaryotic chromosomal DNA is basically multi repliconic in origin C. DNA polymerase I and II has the high polymerization rate whereas DNA polymerase III has very low polymerization rate D. DNA polymerase delta synthesizes the lagging strand of DNA and DNA polymerase gamma synthesizes mitochondrial DNA Which option is correct? (a) A, B, D (b) B, C, D (c) A, B, C (d) A, C, D 13. Match the following column given below. A. DNA B B. DNA G C. Gyrase

12. (a)

1. Clamp loader 2. Beta clamp 3. Primase

Practice Windows D. Gamma complex

4. Helicase 5. Topoisomerase 6. Restriction endonuclease

(a) (A)-2, (B)-4, (C)-3, (D)-1 (b) (A)-2, (B)-4, (C)-4, (D)-1 (c) (A)-4, (B)-3, (C)-5, (D)-1 (d) (A)-4, (B)-5, (C)-3, (D)-2 14. Mark the incorrect statement given below: (a) Topoisomerase enzyme remove supercoiling that occurs ahead of the replication fork during DNA replication (b) DNA polymerase III acts as a main replicating enzyme in E. coli bacteria (c) SSB proteins help in maintaining the intact structure of DNA duplex (d) DNA polymerase I removes the RNA primers in the lagging strand 15. DNA polymerase I has one subunit and it shows 5’-3’ polymerase and exonuclease activity and 3’-5’ exonuclease activity. If we treat DNA pol I by protease enzyme (such as subtillisin or trypsin), it cleaves into two fragments. Which is the correct statement given below: (a) N-terminal Klenow fragment retain 5’-3’ exonuclease activity (b) C-terminal retain 5’-3’ exonuclease activity (c) N-terminal Klenow fragment retain 5’-3’ polymerase and 5’-3’ exonuclease activity (d) C-terminal fragment retain 5’-3’ polymerase and 5’-3’ exonuclease activity 16. Write the true statements about the general properties of DNA replication. A. Origin recognition complex (ORC) helps in loading of helicase and other replication protein into the conserve sequences of replicating DNA in yeast B. Initiation of replication in newly synthesized strand of DNA is Ans.

13. (c)

14. (c)

15. (c)

16. (d)

17. (c)

597

temporarily prevented by SEq a protein in E. coli bacteria C. ATP hydrolysis is needed for the loading of helicase enzyme by ORC in yeast D. The size of Okazaki fragment is 100 to 200 nucleotides in bacterial cells (a) A, B, D (b) B, C, D (c) A, C, D (d) A, B, C 17. Chose the correct sequence about DNA replication process. A. DNA A binds to the Ori C Complex B. DNA helicase is loaded C. RNA primer is synthesized by the primase enzyme D. DNA strands are separated (a) A, C, B, D (b) A, B, D, C (c) A, B, C, D (d) A, D, B, C 18. Match the following column given below: A. B. C. D.

FEN1 NAD+ Rnase H DNA ligase

1. 2. 3. 4.

Joining of two strands of DNA Eukaryotic RNA primer degradation AMP donors Degradation of phosphodiester bond between the last nucleotide of RNA primer and the first nucleotide of DNA. 5. Separate two strands 6. Recruitment of DNA B proteins

(a) A-4, B-3, C-2, D-1 (b) A-4, B-6, C-5, D-1 (c) A-2, B-3, C-4, D-1 (d) A-2, B-6, C-5, D-1 19. Which statement is true about DNA replication? (a) During DNA replication, new nucleotides are added to the last nucleotide of the newly synthesizing DNA strand by nucleophilic attack (b) A phosphodiether bond is formed during the nucleotide addition (c) Mn2+ present in DNA polymerase helps its catalytic activity (d) The direction of DNA chain elongation is 3’-5’ orientation 20. Chromosomal ends are protected by telomere binding proteins in the telo18. (c)

19. (a)

598

Plant Physiology: Question Bank

meric region. Which is the incorrect statement about telomeric replication? (a) Telomerase enzyme anneal to the 3’ end of the sDNA region of the telomere thought it’s RNA component (b) POT1 is the inhibitor of telomerase enzyme (c) Telomerase enzyme has the ability to dislodge the RNA template and reanneals again to repeat the replication process (d) Telomeric replication is repetitive and has protein coding ability 21. Mention the true statement regarding the replication process. A. DNA ligase catalyze the formation of phosphodiester bond between-3’ phosphate group of the other nucleotide B. Tus protein helps in termination of bacterial DNA replication C. Error in DNA replication is solved by the 5’-3’ proofreading activity of DNA polymerase enzyme D. Okazaki fragments are joined to one another by the enzyme DNA ligase and the joining is covalent in nature (a) A, B (b) B, D (c) B, C (d) A, C 22. Which is the correct option about the replication process in different systems? (a) The rolling circle model of DNA replication is basically seen in bacteriophage lamda and bacteriophage M13 (b) Displacement replication is generally seen in circular mitochondrial and chloroplast DNA (c) 5’-PO4 group serve as a premier for rolling circle model of DNA replication (d) Replication of mitochondrial DNA initiates in both the strand of duplex DNA at the same time Ans.

20. (d)

21. (b)

22. (a)

23. (c)

24. (c)

(a) a, c (c) a, d

(b) b, d (d) a, b

23. Match the column given below:

A. B. C. D.

Rec B Rec D Rec C Rec G

1. 2. 3. 4. 5. 6.

Brance migration Recognization Chi site 5’-3’ helicase activity 3’-5’ helicase and nuclease activity Exonuclease V Resolve the holiday junction

(a) A-1, B-3, C-5, D-2 (b) A-1, B-4, C-5, D-2 (c) A-4, B-3, C-2, D-1 (d) A-4, B-3, C-5, D-2 24. Which is the correct options about he recombination process of DNA? A. Site specific recombination is required for the integration of bacteriophage lamda into the E. coli bacteria B. Lamdaintegrase, a serine protease helps in site specific recombination process C. Integration Host Factor (IHF) is a sequence independent DNA binding protein D. If the two loxP sites are oriented in the same direction on a chromosome segment, then the intervening sequence between the two loxP sites is excised (a) A, C (b) B, D (c) A, D (d) B, C 25. Match the following coloumn given below:

A. B. C. D.

DNA photolyase O6- methyl guanine Cre-Lox p system ABC exonuclease

1. 2. 3. 4. 5. 6.

Nucleotide excision repair Photoreactivation Binds with thymine Base excision repair Mismatch repair Site specific integration of transgene

(a) A-2, B-4, C-4, D-6 (b) A-2, B-4, C-6, D-5 (c) A-2, B-3, C-5, D-6 (d) A-2, B-3, C-6, D-1 26. Mark the correct options regarding the DNA damage repairing system: A. DNA glycosylase enzyme acts in base excision repair process during DNA damage repairing 25. (d)

Practice Windows

B. Aqurinic or an apyrimidinic site if formed by DNA glycosylase during DNA repair process C. AP endonuclease helps in breaking phosphodiester bond during DNA repair D DNA polymerase III is the main component of AP endonuclease (a) A, C, D (b) B, A, C (c) A, B, C (d) B, A, D 27. Base excision repair is a one type of DNA repairing mechanism that occurs when DNA is exposed to mutagenic agents. Following are the certain statements regarding this repair process. Rearrange the sequence of events: A. AP endonuclease cleaves the phosphodiester bond B. DNA glycosylase removes the chemically modified base C. DNA ligase seals the nic D. Deoxyribose phosphodiesterase removes the deoxyribose phosphate molecules E. DNA pol beta add single nucleotide to the 3’ end of the nicked strand at the gap (a) A, C, B, D, E (b) A, B, C, D, E (c) B, A, D, E, C (d) B, A, E, D, C 28. Mark the incorrect statement given below: (a) Base excision repair process excise a short piece polynucleotide (b) Nucleotide excision repair process acts on relatively larger area than base excision repair process (c) Xerodermapigmentosum is the example of defective base excision repair process (d) SOS repair system is an error prone DNA repair system 29. Which statement is false about nucleotide excision repair system of DNA repairing mechanism? (a) Uvr A recognizes the DNA damage (b) Uvr AB dimer cleaves the phosphodiester bond Ans.

26. (c)

27. (c)

28. (c)

29. (b)

30. (c)

599

(c) Uvr D helps to unwind the DNA and thereby removes the targeted sites between the two cuts (d) DNA polymerase I fills the gap that is generated by Uvr (D) 30. Which is the incorrect statement regarding DNA repair system? (a) Both prokaryotes and eukaryotes show nucleotide excision repair process (b) Direct DNA repairing process involve DNA photolyase enzyme (c) Photolyase enzyme contain NAD and FAD as a cofactor (d) In nucleotide excision repair Uvr A first recognizes DNA damage 31. Mention the correct statement regarding DNA repairing process: (a) In prokaryotes, UV light activates the catalytic activity of DNA photolyase enzyme (b) In E. coli, DNA polymerase III acts in mismatch repair process (c) DNA polymerase gamma acts in base excision repair mechanism (d) Adenine DNA glycosylase is the first discovered glycosylase enzyme 32. Mark the correct statement about the properties and repair process of DNA duplex. (a) Dam and Dam methylation causes mutation in DNA strand (b) Mismatch repair system is initiated and directed by strand specific nicks in eukaryotes (c) When new strand of DNA is synthesized, they are methylated instantly (d) DNA replication starts from undermethylated DNA strands 33. Which is the correct statement in mismatch repair system? (a) Mut H protein recognizes the TAAAT sequence (b) Mut S protein recognizes the mismatch sequence 31. (b)

32. (b)

33. (b)

600

Plant Physiology: Question Bank

(c) The product of the mut genes help in short patch mismatch repair process in E. coli bacteria (d) Mut H protein cleaves the fully methylated strand on the 5' side of the G in the GATC sequence 34. Mention the correct statements regarding DNA damage and repairing mechanism: A. 5-BU, an analog of cytosine acts as a mutagenic agent. B. Rec A and Rec BCD acts in double strand break repair system in E. coli C. Umu C acts in Translesion DNA synthesis type of repair mechanism in E. coli bacteris D. Recombinational repair mechanism acts during double strand break of DNA (a) A, C, D (b) A, B, D (c) B, C, D (d) A, B, C 35. Different types of DNA repairing process acts to rectify the incorrect bases incorporated in DNA during replication. Mark the correct statements regarding DNA repair system: A. Recombinational repair is a post replicative DNA repair mechanism B. In recombinational repair system, a pyrimidine dimer causes a gap in the newly synthesized daughter strand C. The replication of daughter strand is terminated if the damaged DNA site is not bypassed D. When replication is stated in recombinational repair method, ‘reversion of replication fork occurs which restore the process. (a) A, B, D (b) B, C, D (c) A, C, B (d) All of these 36. Double strand DNA break can be repaid by the cellular non-homologous end joining pathway and homology directed pathway. Which is the incorrect statement regarding this? (a) NHEJ does not require homologous template in repairing process Ans.

34. (c)

35. (d)

36. (c)

37. (d)

38. (b)

(b) HDR pathway require homologous template in repairing process (c) NHEJ pathway normally predominates during S and G2 phase of the cell cycle (d) NHEJ pathway starts quickly on instantly during double strand DNA breakage 37. Which is the correct statement about DNA repair process? A. Homology directed repair pathway predominates in S and G2 phase of the cell cycle B. During NHEJ pathway K 70 and Ku 80 heterodimer helps in damage recognition C. DNA-recruit the end processing factors that trim the DNA end making compatible for ligation D. DNA ligase IV along with the scaffold protein XRCC 4 helps in final ligation of double strand break repairing process (a) A, B, D (b) A, B, C (c) B, C, D (d) All of these 38. Mark the correct statements about SOS dependent DNA repair system: A. Lex A and Rec A proteins are the key regulator of SOS response mediated DNA repairing method B. Rec A is a repressor protein C. Rec A causes autocatalytic proteolytic cleavage of LexA repressor D. Rec A mediated proteolytic cleavage of LexA OCCURS AT Gly-Pro peptide bonds (a) A, C, D (b) A, B, C (c) B, C, D (d) All of these 39. Mark the correct statement about Histone mediated gene regulation: (a) ADP ribosylation occurs on the lysine residue in histone proteins (b) Acetylation of lysine and arginine is common in histone proteins (c) H 3 K 9 methylation causes gene silencing (d) H 3 K 4 methylation causes gene silencing 39. (c)

Practice Windows

40. Which options are true about the structure of chromatin? A. Euchromatin is light staining and highly condensed portion of chromatin during the interphase of cell cycle B. Heterochromatin is dark staining and less condensed portion of chromatin during the interphase of cell cycle C. Euchromatin is transcriptionally active region of chromatin during the interphase of cell cycle D. Heterochromatin is generally transcriptionally inactive portion of chromatin during the interphase of cell cycle (a) A, B, C (b) B, C, D (c) Only A and B (d) Only C and D 41. Choose the correct options about the nucleosome model of DNA: A. Chaperones play very important role during the incorporation of histone proteins in nucleosome B. HI and H2A histone proteins are called linker DNA C. Histones octamer is formed by H2A, H2B, H3, and H4 histones D. The length of the DNA in the core histone is approximately 147 bp (a) A, C, D (b) B, A, C (c) A, C, B (d) all of these 42. Which is the correct statement about the histone proteins? A. H1 histone proteins are lysine and arginine rich B. 1-14 histone proteins are lysine rich C. Protamine is present in fish sperm instead of histone proteins D. Chaperones found in nucleosomes are negatively charged proteins (a) B and D (b) A and C (c) A and B (d) C and D Ans.

40. (d)

41. (a)

42. (d)

43. (c)

44. (c)

601

43. Mention the correct statements about the structure of chromosome. A. t-Loop structure of telomere is responsible for the stability of the chromosomal ends in mammals B. Alphoid DNA is found in human centromeric region C. During anaphase acrocentric chromosome looks like dumbell shaped D. Holocentric chromosome is found in C. elegans (a) A and C (b) B and C (c) A, B and D (d) all of these 44. A bacterial population has a plasmid with copy number ‘n’. It was observed that on an average in one out of 2(n – 1) cell divisions, there was spontaneous plasmid curing. It was inferred from the observation that: A. There was no equal probability of plasmid curing during each cell divisions B. Plasmids are randomly distributed to the daughter cells C. There was no particular plasmid segregation mechanism in the two daughter cells D. Each plasmid has an equal chance of being taken by the two daughter cells Which of the following option is true? (a) A and B (b) A and D (c) B, C, and D (d) All of these 45. Mention the correct options about the time and process of DNA replication in the cell: A. During DNA replication, primers for both the strands are synthesized by DNA polymerase alpha, followed by ‘polymerase switching’ with polymerase epsilon and delta B. Leading strand is synthesized by polymerase delta after polymerase switching

602

Plant Physiology: Question Bank

C. During DNA replication, each origin of replication is activated only once D. Pre-replicative complex for DNA replication forms only in 01 phase and initiation of replication occurs during S phase after the separation of pre-replicative complex (a) A, B, C (b) B, C, D (c) A, C, D (d) B, A, D 46. Which is the true statements regarding the regulation and properties of DNA replication? A. FEN-1 is responsible for the degradation of RNA primer during DNA replication by 5‘-3‘ exonuclease activity B. Sigma 32 controls the heat-shock response in bacteria C. Only the lagging strand of DNA duplex needs primer during DNA replication and it is completed by the DNA polymerase alpha till the end D. DNA is compactly attached with the histone octamer through covalent bonding (a) A, B, D (b) B, C, D (c) A, C, D (d) A and B only 47. Mention the correct statement about the general properties of nucleotides of the chromosomes in the cell: A. In a cell rNTPs are present at approximately 10 times higher concentration than dNTPs B. The chance of rNTPs getting incorporated into DNA is 1000 times lower than dNTPs C. DNA polymerase cannot discriminates between rNTPs and dNTPs D. The nucleotide binding pocket of DNA polymerase cannot accommodate a 2-OH group on the incoming nucleotide (a) A (b) B (c) C (d) D Ans.

45. (c)

46. (d)

47. (c)

48. (d)

49. (c)

48. Which is the correct statements about the enzyme topoisomerase? A. Topoisomerase enzyme has tyrosine residue which is nucleophilic in nature B. Type II topoisomerase changes the linking number of DNA by two C. Type IA topoisomerase binds to the 5’phosphate and type IB topoisomerase binds to the 3’-phosphate during DNA hydrolysis D. Type IA topoisomerase changes the linking number by one and type IB topoisomerase changes the linking number by any integer number (a) A, B, D (b) A, C, D (c) B, C, D (d) All of these 49. Match the following column given below: A. Proliferating cell nuclear antigen B. Replication factor C C. iRNA D. DNA polymerase

1. Main replicating enzyme in prokaryotes 2. Primer removal 3. Sliding clamp 4. Lagging strand synthesis 5. Clamp loader 6. Short RNA primer

(a) A-4, B-1, C-2, D-4 (b) A-4, B-5, C-2, D-1 (c) A-3, B-5, C-6, D-2 (d) A-3, B-5, C-2, D-1 50. If your guide ask you to do a polymerase chain reaction (PCR) without Taq DNA polymerase, which strategy you would follow? (a) Not do the experiment until Taq polymerase is available (b) Replace Taq by ordinary DNA polymerase in the experiment (c) Try the PCR without polymerase (d) Use ordinary DNA polymerase but replenish at every cycle 51. DNA fingerprinting refers to: (a) Molecular analysis of profiles of DNA samples 50. (b)

Practice Windows

(b) Analysis of DNA samples using imprinting devices (c) Techniques used for molecular analysis of different specimens of DNA (d) Both (a) and (c) 52. RT-PCR reaction sequentially uses: (a) RNA dependent DNA polymerase and DNA dependent DNA polymerase (b) RNA dependent DNA polymerase and DNA polymerase 1 (c) RNA polymerase and DNA dependent DNA polymerase (d) RNA polymerase and DNA polymerase 1 53. DNA repair is carried out by which of the polymerases in eukaryotes? (a)  (b)  (c)  and  (d)  and  54. Why a DNA duplex melts at a specific temperature (Tm) on heating? (a) Loss of base stacking energy (b) The double helix is intrinsically unstable (c) The single helix is more stable as compared to the double helix (d) The DNA double helix is a cooperative structure stabilized by hydrogen bonds and base pairing 55. A single base pair of DNA weighs 1.1 × 10 –21 grams. How many picomoles of a plasmid vector of length 2750 by are contained in 1 ftg of purified DNA? (a) 0.30 (b) 0.55 (c) 0.25 (d) 0.91 56. When nonsense mutations occur in the reading frame of mRNA, protein synthesis gets terminated at the nonsense mutation to deliver a truncated polypeptide. However, in certain bacterial strains, this does not happen; these bacterial cells are able to synthesize full-length polypeptide. This phenomenon is due to: Ans.

51. (d)

52. (a)

53. (b)

54. (a)

55. (a)

603

(a) Compensatory frame shift mutation that occurs elsewhere in the mRNA (b) Involvement of suppressor RNAs (c) Polypeptide splicing at the broken point (d) Post-transcriptional editing of the nonsense mutation 57. Small RNAs with internally complementary sequences that form hairpinlike structure, synthesized as precursor RNAs and cleaved by endonucleases to form short duplexes are called: (a) snRNA (b) rRNA (c) mRNA (d) miRNA 58. Reverse transcriptase has both ribonulcease and polymerase activities. Ribonuclease activity is required for: (a) The synthesis of new RNA strand (b) The degradation of RNA strand (c) The synthesis of new DNA strand (d) The degradation of DNA strand 59. In gene regulation, open reading frame (ORF) implies: (a) Intervening nucleotide sequence in between two genes (b) A series of triplet codons not interrupted by a stop codon (c) A series of triplet codons that begins with a start codon and ends with a stop codon (d) The exonic sequence of a gene that corresponds to the 5’UTR of the mRNA and thus does not code for the protein 60. While replicating DNA, the rate of mis-incorporation by DNA polymerase is 1 in 105 nucleotides. However, the actual error rate in the replicated DNA is 1 in 109 nucleotides incorporated. This is achieved mainly due to: (a) Spontaneous excision of misincorporated nucleotides 56. (a)

57. (d)

58. (b)

59. (b)

604

Plant Physiology: Question Bank

(b) 35 proofreading activity of DNA polymerase (c) Termination of DNA polymerase at misincorporated sites (d) 53 proofreading activity 61. A nick in a DNA molecule can be detected by which of the following methods? (a) Nested PCR (b) Primer extension (c) RT-PCR (d) All the above 62. The structure of a double-stranded DNA in a palindrornic sequence is: (a) G-quartets (b) Triplex DNA (c) Hairpin DNA (d) Cruciform DNA 63. The enzyme responsible for indefinite growth of human cancer cells is: (a) Telomerase (b) DNA polymerase 1 (c) RNA polymerase (d) Reverse transcriptase 64. Spontaneous deamination in a DNA stored at –20°C will lead to conversion of cytosine into: (a) Thymine (b) Guanine (c) Adenine (d) Uracil 65. Which of the following does not apply to triplex DNA? (a) It is triple-stranded DNA (b) Requires only Hoogsteen hydrogen bonding requires (c) Watson-Crick hydrogen bonding (d) Forms at neutral or acidic pH 66. The replicative polymerase in E. coli is: (a) DNA polymerase I (b) DNA polymerase II (c) DNA polymerase III (d) DNA primase 67. A mixture of 50-mer oligonucleotide and free nucleotides was loaded onto a Sephadex G-50 gel filtration column, which of the following results can be expected? Ans.

60. (b) 71. (b)

61. (d) 72. (b)

62. (c)

63. (a)

64. (d)

(a) The oligonucleotide and the nucleotides would be retained in the column and they both can bind the resin (b) The oligonucleotide would elute fist (c) Nucleotide would elute first (d) Both co-elute on this column 68. In what type of mutation, the number of nucleotides between the wild-type allele and the mutant allele might differ in the DNA level? (a) Missense (b) Nonsense (c) Frameshift (d) None of these 69. A sample of DNA and a sample of RNA (of equal length) are run on nondenaturing gel under DNase and RNase free conditions. Which of the following is true? (a) DNA will run faster than RNA (b) RNA will run faster than DNA (c) They will run at the same speed (d) None of the above 70. Which of the following is not true? (a) Agarose gel is formed by crosslinking polymers (b) DNA migrates negative to positive electrode in agarose gel but the opposite in polyacrylamide (c) Polyacrylamide gels can be melted and reused (d) All of the above 71. You have two tubes one containing DNA and one RNA, the tubes are not labeled; which of following you can use to make out which tube contains what with highest level of certainty? (a) Gel electrophoresis (b) Spectrophotometric measurement (c) pH measurement (d) Densitometric measurement 72. If you are designing a primer against a specific sequence 5’ ggtagtggatcctagtgatt3’ the sequence of the reverse primer would be: (a) 5’ aatcactggatccactccc3’ (b) 5’ ggtagtggatcctagtgatt3’ 65. (d)

66. (a)

67. (d)

68. (c)

69. (c)

70. (b)

Practice Windows

(c) 3’ ggtagtggatcctagtgatt5’ (d) None of the above 73. A messenger RNA is 336 bases long including the initiation and terminator codons. The number of amino acids in the polypeptide translated from this is: (a) 110 (b) 333 (c) 111 (d) 600 74. If a species contains 23% adenine in its DNA, then the percentage of guanine in its DNA would be: (a) 23% (b) 46% (c) 54% (d) 27% 75. A frameshift mutation undergoes revision to wild type. What are the ways in which reversion could occur? (a) Deletion of two bases (b) A missense mutation next to the original mutation (c) An inversion within the mutated gene (d) Insertion of two bases 76. How many different transfer RNA molecules are possible in a hypothetical organism where the ribosome detect a quadruplet instead of a triplet codon including the start and stop codon? (a) 64 (b) 128 (c) 20 (d) 256 77. Which of the following does not contribute to protein diversity (variants of the same protein)? (a) RNA editing (b) RNA splicing (c) RNA interference (d) Alternative initiation of translation 78. Hydrogen bonds are unique among non-covalent interactions because of their: (a) Directional character (b) They are formed from protons (c) The strength of these bonds is equal to that of covalent bonds (d) None of the above 79. The recognition sequence for the restriction endonuclease astWI is Ans.

73. (c) 84. (c)

74. (c)

75. (a)

76. (d)

77. (c)

605

GRCGYC where R is any Purine and Y is any Pyrimidine base. In a truly random DNA sequence what will be the average distance (measured in base pairs) between successive AstWI cut sites? (a) 1024 (b) 52 (c) 4096 (d) 24 80. A single–strand nick in the parental DNA helix just ahead of a replication fork to break. Recovery from this calamity requires: (a) DNA ligase (b) DNA primase (c) Site specific recombination (d) Homologous recombination 81. The Base analog 2-aminopurine pairs with thymine, and can occasionally pair with cytosine. The type of mutation induced by 2-aminopurine is: (a) Transversion (b) Transition (c) Deletion (d) Nonsense 82. The double stranded DNA of a species is 1.2 metre and the DNA replicates at the rate of 20  m/min. How many origins of replication are therein the DNA? (a) 2500 (b) 250 (c) 25 (d) 1 83. A novel type II restriction enzyme was identified and it recognizes 5’ATAANNNTTAT3’ (N = any nucleotide) and cuts after third A in the above sequence. What is the fate of the DNA after digestion? (a) a 3 nucleotide long 5’ overhang (b) a 7 nucleotide long 5’ overhang (c) a 4 nucleotide long 5’ overhang (d) a 3 nucleotide long 3’ overhang 84. In a temperature sensitive mutant bacteria, at non-permissive temperature, there are huge accumulation of Okazaki fragments. The bacteria are mutant for: (a) DNA polymerase I (b) DNA toposiomerase I (c) DNA ligase (d) DNA gyrase 78. (d)

79. (d)

80. (c)

81. (b)

82. (b)

83. (b)

606

Plant Physiology: Question Bank

85. A mutational event inserts bases in the beginning of the coding sequence of a gene. The highest chance of the altered protein being functional when the number of base(s) inserted is: (a) 1 (b) 2 (c) 3 (d) 4 86. Which of the following best explains how mutation in DNA can result in expression of new phenotype? (a) A different polypeptide is produced (b) The polarity of tRNA becomes the opposite of that of DNA (c) Nucleic acids are methylated (d) The gene is now read in 3’-5’ direction 87. A DNA strand 5’CGATTG3’ would be complementary to the sequence: (a) 5’ GCUAAC 3’ (b) 5’ GCTAAC 3’ (c) 5’ CCATCG 3’ (d) 5’ CCUTCG 3’ 88. Which of the following contains DNA sequences required for segregation of chromosome during mitosis and meiosis? (a) Telomerase (b) Centromeres (c) Nucleosomes (d) Spliceosomes 89. Which of the following provides visual evidence of genetic recombination during meiosis? (a) Centromeres (b) Synaptonemal complex (c) Haploid nuclei (d) Chiasmata 90. Chargeoff’ rule is: (a) A + T = G + C (b) A = T = G = C (c) A + G = T + C (d) Both (a) and (c) 91. Left-handed DNA is: (a) A DNA (b) B DNA (c) Z DNA (d) C DNA 92. The total number of nucleotide in a stretch of dsDNA containing 50 thymine and 50 guanine residues are: (a) 220 (b) 200 (c) 250 (d) 290 Ans.

85. (c) 96. (a)

86. (a) 97. (d)

87. (b) 98. (c)

88. (b) 89. (d) 99. (b) 100. (c)

93. The uncommon feature about Z-DNA is: (a) Uracil (b) Left handed (c) Triple helix (d) None of these 94. The length of DNA having 23 base pairs is: (a) 78 A (b) 78.2 A (c) 78.4 A (d) 74.8 A 95. The width of a DNA molecule is: (a) 15 A (b) 3.4 A (c) 20 A (d) 25 A 96. The composition of a nucleoside is: (a) Base and sugar (b) Base and phosphate (c) Base and sugar and phosphate (d) None of these 97. DNA is the genetic material of: (a) Only prokaryotes (b) Only prokaryotes and eukaryotes (c) Both a and b (d) Prokaryotes, eukaryotes and some viruses 98. DNA strands are joined by: (a) Amide bond (b) Phosphodiester bond (c) Hydrogen bond (d) All the above 99. Adjacent nucleotide of a DNA are joined by: (a) Amide bond (b) Phosphodiester bond (c) Hydrogen bond (d) All the above 100. In DNA fingerprinting, even a smallest amount of DNA obtained from samples collected at crime place, can be multiplied into millions of copies by using a technique called: (a) Southern blotting (b) Electrophoresis (c) Polymerase chain reaction (d) Autoradiography 90. (c)

91. (c)

92. (b)

93. (a)

94. (d)

95. (c)

Scientists and Their Contribution

607

Scientists and Their Contribution Scientist Name

Year

Contribution

Addicott FT Alexander Reuss Always Alwine et al Aronon Arnon and Stout Asana RD Atkins and Priestly Ball Baltimore Barbara McClintock Bateson Beadle and Tatum Beijernick WM Belling Benda O Berg

1963 1807 1913

First identified and characterized the hormone ‘ABA Principle of electrophoresis Hygroscopic coefficient Given ‘northern blotting’ technique for RNA separation Discovered photophosphorylation Criteria of essential elements Worked on drought tolerance Osmotic theory of active absorption Raised whole plants of Lupinus by shoot tip culture Isolated Reverse transcriptase from RNA tumor virus Jumping gene, transposons Defined ‘genetics’ One gene-one enzyme hypothesis First to isolate the root nodule bacterium Copy choice theory Coined ‘mitochondria’ Produced first recombinant DNA, combining SV40 virus and ë virus Filtered cell suspension and isolated single cells by plating Coined the term ‘Floating respiration’ Discovered ‘chemical phase in photosynthesis’ Demonstrated ‘dark phase of photosynthesis’ Law of inhibitory factor Sequenced E. coli genome Vital theory for the ‘ascent of sap’ Chescograph Nutrient mobility concept CL essentiality Generic balance theory Moisture equivalent Permanent wilting point Disvovered first the ‘enzymatic activity’ Capillary potential Biological clock

Bergmann Blackman Blackman Blackman FF Blackman RF Blattner et al Bose JC Bose JC Bray et al Brayer Bridge CB Briggs and McLane Briggs and Santz Buchner Buckinghum Bunning

1939

1946 1970 1950 1941

1897 1972 1960

1997 1924 1926

1926 1907 1912 1907

(Contd.) 607

608

Plant Physiology: Question Bank

Scientist Name

Year

Contribution

Calvin Camillo Golgi Carlson

1950 1898 1972

Chailakhyan Charles Darwin and Wallace Chilton et al

1958-75 1858 1977

Christian de Duve Cocking

1955 1960

Calvin cycle Golgi complex Produced first interspecific hybrid of Nicotiana by protoplast fusion Named the ‘florigen’ hormonal theory of flowering Evolution through natural selection Successfully integrated Ti plasmid DNA from Agrobacterium tumefaciens in plants Discovered ‘lysosome’ Was first to isolate protoplast by enzymatic degradation of cell wall Given the ‘transpiration is a necessary evil’ Discovered ‘spherosomes’ Coined the term ‘photorespiration’ Stated ‘ethylene is hightly effective in inducting fruit ripening’ ‘Trasnpiration Pull’ or ‘cohesion tension theory’ of ascent of sap Concept of plant ideotype Kreb cycle Central dogma Proposed ‘lock and key model’ Discovered ‘mesosome’ Sequenced Haemophilus influenzae First antibiotic penecillin Gene for gene hypothesis Suggested that principle nourishment of plants was water RNA is a genetic material Demonstrated ‘cyclic photophosphorylation’ Theory of ‘Token stimuli’ Coined the term ‘auxin’ Given the term ‘vitamin’ Worked on plant water relationship Triplet codon Demonstrated the photoperiod phenomenon White and Nobecourt established endless proliferation of callus cultures ‘Relay pmp theory’ of ascent of sap Phytochrome theory of flowering Produced first haploid plants from pollen grains of Datura Proposed concept of in vitro cell culture Discovered ‘ribosomes’ Cultured embryos from several cruciferous species Moisture holding capacity Worked on isolated chloroplast Z-scheme of electron transport First reported the base sequence of a tRNA molecule Developed transgenic tobacco by transformation with Agrobacterium

Curtis Dangeared Decker Denny

1919 1924

Dixon and Jolly Donald CM Embden and Mehroof FHC Crick Fisher Fitz-james Fleischmann et al Fleming Flor Francis Bacon Frankel C and Singer Fraenkel Fraenkel G Frits Went Funk Galston AW Gammow G Gardner and Allard Gautheret Godlewski Gregory FG Guha and Maheshwari Haberlandt Haguenan Hannig Hilgard Hill Hill and Bendell Holley Horsh et al

1968 1956 1966 1960 1995 1929 1956 1957

1926 1912 1952 1954 1920 1939

1948 1966 1902 1958 1904 1906

1984

(Contd.)

Scientists and Their Contribution Scientist Name

Year

Ingenhouse Ingram Ingo Petricus Isloy Israelson and West Jacob and Monod Johnson Kanta and Maheshwari Kary Mullis Kerry Mullis Khorana Khus GS Klien et al Kogl Kolte Koshland Kostychev Kuhne W Letham Leuwenhoek Levitt

2001 1951 1922 1961 1909 1962 1983

1968 1987

1922 1959 1898 1963 1679

Liebig Maheswari

1862 1982

Mandel Mayer Mc Clintock Mc Collum and Davis Methl and Stheal Micheal Tswett Miller and Skoog

1865

Mitchell P

1967

Mollister

1935

Morgan TH Moore and Mc Alear Muller HJ Muir Müller and Borger Munch

1931 1961 1927 1954 1940

Murashige and Skoog

1962

1950 1915 1958 1906 1955

609

Contribution First to recognize the participation of chlorophyll and light in photosynthesis One-gene-one polypeptide hypothesis Golden rice Concept of seed vigour Field capacity Operon concept Porelne theory, term gene genotype, phenotype Developed test tube fertilization technique Invented polymerase chain reaction (PCR), for amplification of DNA Given ‘PCR technique’ Discovery of ‘genetic code’ Idea of super rice Developed biologistic gene transfer method for plant transformation Isolated for the first time IAA from human urine And Robbins successfully cultured root and stem tips respectively Proposed ‘Induced fit’ hypothesis Discovered ‘anaerobic respiration’ Introduced the term ‘enzyme’ First identified the ‘zeatin’ and ‘cytokinin’ Discovered chloroplast as small green bodies Proposed ‘proton transport concept of photoactive stomatal opening’ Law of minimum Confirmed the ‘intracellular location of phytochrome’ in wheat and maize Law of inheritance Coined the term ‘Diffusion Pressure Deficit’ Transferable element Given first vitamin, i.e. vitamin A Semi-conservative mode of DNA replication Initiated the idea of chromatography Discovery of kinetin from yeast DNA that induce cell division Chemiosmotic hypothesis for ATP biosynthesis in living system Red light promoted and far red light inhibited seed germination in lettuce Sex linkage Discovered lomasomes Induced mutation in Drosophila by X-ray Was first to break callus tissues into single cells Given ‘phytoalexin concept’ Mass flow mechanism, coined the terms ‘apoplast’ and ‘symplast’ Developed MS medium with higher salt concentration (Contd.)

610

Plant Physiology: Question Bank

Scientist Name

Year

Contribution

Nagaheru Nagarajan S Neal O Nene YL Nicholas JD O’Farrel

1931 2005

Given ‘triangle of brassicas’ Idea of super wheat Given permeability classification into total seven classes Reported ‘Khaira’ disease in rice due to deficiency of Zn Functional element Developed high resolution two dimensional gel electrophoresis system Shown first time the oxygenase function of RuBisCo First to add coconut milk for cell division in Datura First time reported the presence of ribosomes in cell The ash content of plants (1563) Explained the ‘Lock and Key’ arrangement Named ‘spherosomes’ Father of hybrid rice Discovered ‘endoplasmic reticulum’ Idea of gas exchange in photosynthesis Human genome sequenced successfully

Ogren and Bowes Overbeek Palade Palissy Paul field and woods Perner Peng YL Porter Priestly Project consortium and Venter et al Purkinje Reinert and Steward Renner O Rhodin Richard and Gardner Rimpu Robert Brown

1961 1963 1975

1941

1952 1955 2005 1840 1840 1959 1915 1954 1936 1827 1831 1665

Robert Hooke Sachs Salisbury Sanger, Maxam-Gilbert Sayre

1977 1926

Scheiden and Schwann Schimper Schloesing and Muntz Skoog and Miller Skoog and Miller

1839 1885 1877 1955 1957

Slantterback Smith and Nathans

1963 1970

Sorenson SPL Southern Stephan Hales Steward

1909 1975 1966

Strasburger

1875

Coined the term ‘protoplasm’ Given that protomplasm consists of nucleus and cytoplasm Regenerated embryos from callus clumps and cell suspension of Daucuscarota Water potential concept Discovered ‘microbodies’ Tensiometer Discovered ‘triticale’ Brownian movement Discovered ‘nucleus’ Discovered ‘cell’ ‘Imbibition theory’ of ascent of sap Coined the term ‘stomatal index’ Gave technologies for DNA sequencing Explained starch to sugar interconversion for stomatal opening and closing Given cell theory Discovered ‘plastids’ Demonstrated ‘ nitrification’ Discovered kinetin as cell division hormone Gave concept of hormonal control (auxin: cytokinin) of organ formation Discovered ‘microtubules’ Discovered first restriction enzyme from Haemophilus influenza (HindIII) pH Given ‘southern blotting’ for DNA separation ‘Root pressure theory’ of ascent of sap Demonstrated totipotency by regenerating carrot plants from single cells of tomato Discovered ‘chromosome’ (Contd.)

Scientists and Their Contribution Scientist Name

Year

Strasburger and Hertwig Strong and Ray Strutvant Summer JB Sutton Sutton and Boveri Swammerdam and Bonnet Talbert et al Taylor et al Thimann KV Thimann and Went Towbin et al Tucker and Nason van den Honest van Helmont JB Vavilov NI von Mohl Wadleigh and Ayres Wahua Waldeyer Walther and Frau Hesse Watson and Crick Wareig Watson and Crick Went White

1913 1926 1903 1903 1968 1934 1934 1979 1955

1846 1945 1983 1888 1881 1953 1955 1926 1934

Wright Yabuta and Hayashi Yoshida Zaenen et al

1791 1930

Zambryski Zelith and Tolbert

1980 1971–73

1974

611

Contribution Characters transmit from generation to generation throught chromosomes Given the term ‘skototropism’ First genetic map in drosophila Isolate the enzyme ‘urease’ as a cattaline protein Given ‘chromosome theory’ Established parallel behavior of chromosomes and genes Performation theory Perioxisomes Ultimate wilting percentage Isolation and characterization of auxins Discovered first time ‘IAA’ Western blotting for protein separation Isolated ‘hydroxylamine reductase’ from neurospora Carrier concept of ion transport Water Given ‘Centre’s of Origin’ Given that protyoplasm is the physical basis of life Total soil moisture stress Nutrient supplementary index Given the term ‘chromosomes’ Gave the use of agar-agar as a solid medium Double helix model of DNA Coined the term ‘Dormin’ Double helical structure of DNA Discovered first plant growth hormone—Indole acetic acid Introduced vitamin B as growth supplement in tissue culture media for tomato root tip First discovered mutation Isolated gibberellins from fungus Ideal plant type in rice Discovered Ti plasmid is tumor inducing principle of agrobacterium Detailed structure of T-DNA and border sequences Established the path of photorespiration

612

Plant Physiology: Question Bank

Nobel Prize Winners Year

Category

Name

Achievement

1902 1933

Chemistry Physiology or Medicine Physiology or Medicine Chemistry

H Emil Fischer Thomas H Morgan

For his work on sugar and purine syntheses For his discoveries concerning the role played by the chromosome in heredity For the discovery of the production of mutations by means of X-ray irradiation For his discovery that enzymes can be crystallized For their preparation of enzymes and virus proteins in a pure form For his research into the nature of the chemical bond and its application to the elucidation of the structure of complex substances For his work on nucleotides and nucleotide coenzymes For their discovery that genes act by regulating definite chemical events For his work on the structure of proteins, especially that of insulin For his discoveries concerning genetic recombinition and the organization of the genetic material of bacteria For their discovery of the mechanisms in the biological synthesis of ribonucleic acid and deoxyribonucleic acid For their studies of the structures of globular proteins

1946

Hermann J Müller

1954

Chemistry

James B Sumner John H Northrop and Wendell M Stanley Linus C Pauling

1957

Chemistry

Alexander R Todd

1958

Chemistry

George W Beadle and Edward L Tatum Frederick Sanger

1958

Physiology or Medicine

Joshua Lederberg

1959

Physiology or Medicine

Severo Ochoa and Arthur Kornberg

1962

Chemistry

Max F Perutz and John C Kendrew Francis HC Crick, James D Watson and Maurice HF Wilkins Dorothy C Hodgkin

Physiology or Medicine 1964

Chemistry

1965

Physiology or Medicine Physiology or Medicine

1966

For their discoveries concerning the molecular structure of nuclear acids and its significance for information transfer in living material For her determinations by X-ray techniques of the structures of important biochemical substances Fran¸cois Jacob, Andre L For their discoveries concerning genetic control of Woff and Jacoues Monod enzyme and virus synthesis Peyton Rous For his discovery of tumor inducing viruses (Contd.) 612

Nobel Prize Winners

613

Year

Category

Name

Achievement

1968

Physiology or Medicine

For their interpretation of the genetic code and its function in protein synthesis

1969

Physiology or Medicine

1972

Chemistry

Robert W Holley, Har Gobind Khorana and Marshall W Nirenberg Max Delbruck, Alfred D Hershey and Salvador E Luria Christian B Anfinsen

Stanford Moore and William H Stein

1975

Physiology or Medicine

1978

Physiology or Medicine

1980

Chemistry

David Baltimore, Renato Dulbecco and Howard M Temin Werner Arber, Daniel Nathans and Hamilton O Smith Paul Berg

1982

Chemistry

Walter Gilbert and Frederick Sanger Aaron Klug

1983

Physiology or Medicine Physiology or Medicine

1984

1985 1987 1989

Physiology or Medicine Physiology or Medicine Chemistry

1993

Physiology or Medicine Chemistry

1995

Physiology or Medicine

1999

Physiology or Medicine

Barbara McClintock Niels K Jerne, Georges JFK Ohler and C´esar Milstein Michael S Brown and Joseph L Goldstein Susumu Tonegawa Sidney Altman and Thomas R Cech Richard J Roberts and Phillip A SharpKary B. Mullis Michael Smith

Edward B Lewis, Christiane NüssleinVolhard and Eric F Wieschaus Günter Blobel

For their discoveries concerning the replication mechanism and the genetic structure of viruses For his work on ribonuclease, especially concerning the connection between the amino acid sequence and the biologically active confirmation For their contribution to the understanding of the connection between chemical structure and catalytic activity of the active center of the ribonuclease molecule For their discoveries concerning the interaction between tumor viruses and the genetic material of the cell For the discovery of restriction enzymes and their application to problems of molecular genetics For his fundamental studies of the biochemistry of nucleic acids, with particular regard to recombinant DNA For their contributions concerning the determination of base sequences in nucleic acids For his development of crystallographic electron microscopy and his structural elucidation of biologically important nuclei acid–protein complexes For her discovery of mobile genetic elements For theories concerning the specificity in development and control of the immune system and the discovery of the principle for production of monoclonal antibodies For their discoveries concerning the regulation of cholesterol metabolism For his discovery of the genetic principle for generation of antibody diversity For their discovery of catalytic properties of RNA For their independent discoveries of split genes for his invention of the polymerase chain reaction (PCR for his fundamental contributions to the establishment of oligonucleotide based, site directed mutagenesis and its development for protein studies) For their discoveries concerning the genetic control of early embryonic development

For the discovery that proteins have intrinsic signals that govern their transport and localization in the cell (Contd.)

614

Plant Physiology: Question Bank

Year

Category

Name

Achievement

2001

–

Leland H Hartwell,

For their discoveries of key regulators of the cell cycle

2002

2006 2008 2010 2011 2013 2015 2019 2020

R Tim Hunt and Paul M Nurse – Sydney Brenner, H. Robert Horvitz and John E Sulston Physiology and Sydney Brenner, Robert Medicine Horvitz and John Sulston Physiology and Fire and Mello Medicine Chemistry Osumu Shimomura, Martin Chalfie and Roger Tsein Physiology and RG Edwards Medicine Physiology and A Beutler, A Hoffman, Medicine M Steinman Physiology and J Rothman, W Schekman, Medicine T Sudof Physiology and EH Blackburn, Medicine CW Greider, JW Szostak Physiology and WG Kaelin, Sir Peter Medicine GL Semenza Chemistry Jennifer Doudra E Charpentier

For their discoveries concerning genetic regulation of organ development and programmed cell death For programme cell death using caenorhabditis elegans For RNAi For green fluorescent protein, GFP In vitro fertilization Innate/Adaptive immunity Cell transport system Telomerase enzyme How cells sense and adopt to or availability Method of genome editing