Periodontal Pathogens: Methods and Protocols [1 ed.] 1071609386, 9781071609385

Table of contents :
Preface
Contents
Contributors
Part I: Methods for Bacterial Genetic Manipulation
Chapter 1: Site-Directed and Random Mutagenesis in Porphyromonas gingivalis: Construction of Fimbriae-Related-Gene Mutant
1 Introduction
2 Materials
2.1 Site-Directed Mutagenesis
2.1.1 Culture Media and Antibiotics for Escherichia coli and P. gingivalis
2.1.2 Preparation of DNA Constructs
2.1.3 Preparation of P. gingivalis Competent Cells
2.1.4 Electroporation of P. gingivalis Cells
2.2 Random Mutagenesis
2.2.1 Transposon Mutagenesis of P. gingivalis by Conjugation
2.2.2 Colony Immunoblotting
3 Methods
3.1 Site-Directed Mutagenesis
3.1.1 Culture Conditions for P. gingivalis and E. coli
3.1.2 Preparation of DNA Constructs
3.1.3 Competent Cell Preparation of P. gingivalis
3.1.4 Electroporation of P. gingivalis
3.2 Random Mutagenesis
3.2.1 Transposon Mutagenesis of P. gingivalis by Conjugation
3.2.2 Screening of Mutants (e.g., Lacking Outer Membrane Proteins): Colony Immunoblotting
4 Notes
References
Chapter 2: Genetic Manipulations of Oral Spirochete Treponema denticola
1 Introduction
2 Materials
3 Methods
3.1 Designing Constructs for Gene Deletion by Allelic Exchange
3.2 Designing Construct for Gene Deletion by Counterselectable Maker
3.3 Preparing Electrocompetent Cells
3.4 Electrotransformation
3.5 Preparing Chemically Induced Competent Cells
3.6 Heat Shock Transformation
3.7 Selection of Transformants by Plating
3.8 Cis-Complementation via Genetic Reconstitution
3.9 Trans-Complementation Using a Shuttle Vector (See Note 9)
4 Notes
References
Chapter 3: Construction of a Gene-Deletion Mutant in Tannerella forsythia
1 Introduction
2 Materials
2.1 Bacterial Culture
2.2 Inactivation of the Target Gene
3 Methods
3.1 Blood Agar Medium with NAM
3.2 Preparation of Electrocompetent Cells of T. forsythia
3.3 Preparation of DNA Construct for Allelic Exchange Mutagenesis
3.4 Transformation
4 Notes
References
Chapter 4: Construction of a Mutant in Prevotella melaninogenica Using the Conjugation Transfer Method with Escherichia coli
1 Introduction
2 Materials
2.1 A porK-Deletion Mutant of P. melaninogenica
2.2 Hemagglutination Test
3 Methods
3.1 Construction of a porK-Deletion Mutant of P. melaninogenica
3.1.1 Construction of Suicide Vector Plasmid
3.1.2 Introduce the Suicide Vector Plasmid into E. coli
3.1.3 Conjugative Transfer
3.1.4 Confirm that the Target Gene Has Been Replaced with ermF
3.2 Hemagglutination Test
4 Notes
References
Chapter 5: Genetic Transformation of Fusobacterium nucleatum
1 Introduction
2 Materials
2.1 Plasmid DNA Construct for Transformation
2.2 Transformation of F. nucleatum
2.2.1 Bacterial Preparation
2.2.2 Sonoporation
3 Methods
3.1 Construction of a fadA-Deletion Mutant in F. nucleatum
3.1.1 DNA Construct
3.1.2 Transformation Using Sonoporation
3.2 Construction of a fadA-Complemented Mutant in F. nucleatum
3.2.1 DNA Construct
3.2.2 Transformation Using Sonoporation
4 Notes
References
Part II: Experimental Methods to Examine Virulence Factors
Chapter 6: Genotyping of Porphyromonas gingivalis in Relationship to Virulence
1 Introduction
2 Materials
2.1 Samples and P. gingivalis Culture
2.2 PCR
2.3 Electrophoresis
3 Methods
3.1 Clinical Sample Collection
3.2 DNA Extraction
3.3 Confirm Existence of Bacterial DNA Using PCR
3.4 Confirm Existence of P. gingivalis DNA Using PCR
3.5 Determine fimA Genotypes of P. gingivalis-Positive Specimens Using PCR
3.6 Second PCR for fimA Type-Unidentified Specimens Obtained in First PCR Assay (Nested PCR)
4 Note
References
Chapter 7: Transport and Polymerization of Porphyromonas gingivalis Type V Pili
1 Introduction
2 Materials
2.1 Bacterial Culture
2.2 Sodium Dodecyl Sulfate (SDS)-Polyacrylamide Gel
2.3 Immunoblotting
2.4 Globomycin Treatment
2.5 Palmitic Acid Labeling Experiment
2.6 Dot Blot Analysis
2.7 Cys-Cys Cross-Linking Analysis
2.8 Electron Micrography
2.9 Preparation of Fim Fimbriae
3 Methods
3.1 Globomycin Treatment
3.2 Palmitic Acid Labeling Experiment
3.3 Dot Blot Analysis
3.4 Cys-Cys Cross-Linking Analysis
3.5 Electron Microscopy
4 Notes
References
Chapter 8: Purification of Native Mfa1 Fimbriae from Porphyromonas gingivalis
1 Introduction
2 Materials
2.1 Cultivation of P. gingivalis
2.2 Preparation and Isolation of Fimbriae
2.2.1 Preparation of the Soluble Fraction from P. gingivalis Cells
2.2.2 Isolation and Purification of Fimbriae
2.3 SDS-PAGE
2.4 Immunoblotting
2.5 Electron Microscopy
3 Methods
3.1 Preparation and Isolation of Fimbriae
3.1.1 Culturing of P. gingivalis
3.1.2 Preparation of the Soluble Fraction
3.1.3 Isolation and Purification of Fimbriae
3.2 Assays for the Purity of Fimbriae
3.2.1 SDS-PAGE
3.2.2 Immunoblotting
3.2.3 Electron Microscopy
4 Notes
References
Chapter 9: Crystallization of Recombinant Fimbrial Proteins of Porphyromonas gingivalis
1 Introduction
2 Materials
2.1 Initial Screening
2.2 Optimization
2.3 Cryo Crystallography
3 Methods
3.1 Protein Crystallization
3.2 Optimization
3.3 Cryoprotection of Crystals
4 Notes
References
Chapter 10: Enzymatic Characteristics and Activities of Gingipains from Porphyromonas gingivalis
1 Introduction
2 Materials
2.1 Gingipain Sample Preparation
2.2 Substrates for Rgp
2.3 Substrates for Kgp
2.4 Protein Substrates
2.5 Measurement of Gingipain Activity Using MCA Substrates
2.6 Measurement of Gingipain Activity Using p-Nitroanilide Substrates
2.7 Measurement of Hemoglobin-Hydrolyzing Activity
2.8 Measurement of Caseinolytic Activity
2.9 Gelatin Zymography
2.10 Luminol-Dependent Chemiluminescence (CL) Response of Neutrophils
2.11 Measurement of Vascular Permeability In Vivo
3 Methods
3.1 Gingipain Sample Preparation
3.2 Measurement of Gingipain Activity Using MCA Substrates
3.2.1 Gingipain Activity in Sample
3.2.2 Standard Curve
3.3 Measurement of Gingipain Activity Using p-Nitroanilide Substrates
3.4 Measurement of Hemoglobin-Hydrolyzing Activity
3.4.1 Gingipain Activity in Sample
3.4.2 Standard Curve
3.5 Measurement of Caseinolytic Activity
3.5.1 Gingipain Activity in Sample
3.5.2 Standard Curve
3.6 Gelatin Zymography
3.7 Luminol-Dependent Chemiluminescence (CL) Response of Neutrophils
3.7.1 Neutrophil Preparation
3.7.2 Opsonization of Zymozan A
3.7.3 Chemiluminescence Assay
3.8 Measurement of Vascular Permeability In Vivo
4 Notes
References
Chapter 11: Structural Characterization of the Type IX Secretion System in Porphyromonas gingivalis
1 Introduction
2 Materials
2.1 PorK/N Complex Purification
2.2 Electron Microscopy
2.3 Cross-Linking
3 Methods
3.1 Isolation of PorK/N Protein Complex
3.2 Electron Microscopy
3.2.1 Negative Staining
3.2.2 Cryo-Electron Microscopy
3.3 Cross-Linking Mass Spectrometry
4 Notes
References
Chapter 12: Methods for Functional Characterization of the Type IX Secretion System of Porphyromonas gingivalis
1 Introduction
2 Materials
2.1 A T9SS-Deficient Mutant of P. gingivalis
2.2 T9SS Complemented Strains of P. gingivalis
2.3 Colony Pigmentation
2.4 Analysis of Progingipains
2.5 Hemagglutination Test
2.6 Subcellular Fractionation
2.7 Analysis of the Supernatant Protein
3 Methods
3.1 Construction of a T9SS Deficient Mutant of P. gingivalis
3.1.1 Construction of Targeting Vector Plasmid
3.1.2 Construction of a P. gingivalis Drug Resistant Mutant Strain
3.1.3 Construction of a P. gingivalis Multidrug-Resistant Mutant Strain
3.2 Construction of a T9SS Complemented Strain of P. gingivalis
3.2.1 Construction of Targeting Vector Plasmid
3.2.2 Introduction of the Targeting Vector Plasmid into E. coli
3.2.3 Conjugative Transfer
3.3 Colony Pigmentation
3.4 Analysis of Progingipains
3.5 Hemagglutination Test
3.6 Subcellular Fractionation
3.7 Analysis of the Supernatant Protein
4 Notes
References
Chapter 13: Purification of Tannerella forsythia Surface-Layer (S-Layer) Proteins
1 Introduction
2 Materials
2.1 T. forsythia Culturing
2.2 Extraction and Partial Purification of T. forsythia Surface Layer
2.3 Size Exclusion Chromatography
3 Methods
3.1 T. forsythia Culturing
3.2 Extraction and Partial Purification of T. forsythia Surface Layer
3.3 Size Exclusion Chromatography
4 Notes
References
Chapter 14: Separation of Glycosylated OmpA-Like Proteins from Porphyromonas gingivalis and Tannerella forsythia
1 Introduction
2 Materials
2.1 Growth of Bacterial Cells
2.2 Preparation of Bacterial Whole-Cell Lysates
2.3 Solubilization of Bacterial Whole-Cell Lysates
2.4 Lectin Affinity Chromatography
2.5 SDS-PAGE
2.6 Detection of Proteins
2.7 Detection of Glycosylated Proteins Using Glycoprotein Stain
2.8 Western Blotting
2.8.1 Confirmation of OmpA-Like Proteins Using Specific Antibody (SeeNote 9)
2.8.2 Detection of O-GlcNAc Modification Using Anti-O-GlcNAc Antibody
2.8.3 Confirmation of WGA Reactivity by Lectin Blotting
3 Methods
3.1 Growth of Anaerobic Bacterial Cells
3.2 Preparation of Bacterial Whole-Cell Lysates
3.3 Solubilization of Bacterial Whole-Cell Lysates
3.4 Lectin Affinity Chromatography (SeeNote 12)
3.5 SDS-PAGE
3.6 Detection of Proteins
3.7 Detection of Glycosylated Proteins (SeeNote 15)
3.8 Western Blotting
3.8.1 Detection of OmpA-Like Proteins
3.8.2 Detection of O-GlcNAc Modification (SeeNote 16)
3.8.3 Lectin Blotting
4 Notes
References
Chapter 15: Intranasal Vaccine Study Using Porphyromonas gingivalis Membrane Vesicles: Isolation Method and Application to a M...
1 Introduction
2 Materials
2.1 Cultivation of P. gingivalis for MV Preparation
2.2 MV Preparation
2.3 Purification of MVs by Density Gradient Centrifugation (See Note 3)
2.4 Quantification of Lipids Contained in MVs (See Note 4)
2.5 Intranasal Immunization of MVs to Mice
3 Methods
3.1 MV Preparation and Quantification
3.1.1 MV Preparation
3.1.2 Quantification of Lipids Contained in MVs
3.2 Intranasal Immunization of MVs to Mice
3.2.1 Immunization
3.2.2 Collection of Mouse Specimens and Antibody Detection
4 Notes
References
Chapter 16: Analysis of the Butyrate-Producing Pathway in Porphyromonas gingivalis
1 Introduction
2 Materials
2.1 Colorimetric Assay for Butyryl-CoA:Acetate CoA Transferase Activity
2.2 GC-MS Assay for Detection of SCFAs
3 Methods
3.1 Colorimetric Assay for Butyryl-CoA:Acetate CoA Transferase
3.2 GC-MS Analysis
4 Notes
References
Chapter 17: Characterization of the Treponema denticola Virulence Factor Dentilisin
1 Introduction
2 Materials
2.1 Purification of Dentilisin
2.2 Measurement of Dentilisin Activity
2.3 Evaluation of Pathogenicity of T. denticola
2.4 Construction of T. denticola Dentilisin Mutant (Electroporation Protocol)
2.5 Construction of T. denticola Dentilisin Mutant (Heat Shock Protocol)
2.6 Coaggregation Assay
2.7 Measurement of the Invasion Potential of T. denticola (Antibiotic Protection Assay)
3 Methods
3.1 Purification of Dentilisin
3.2 Measurement of Dentilisin Activity
3.3 Evaluation of Pathogenicity of T. denticola
3.4 Construction of T. denticola Dentilisin Mutant (Electroporation Protocol)
3.4.1 Construction of DNA Construct
3.4.2 Preparation of Competent Cells
3.4.3 Transformation of T. denticola
3.5 Construction of T. denticola Mutant (Heat Shock Protocol)
3.5.1 Preparation of Competent Cells
3.5.2 Transformation of T. denticola
3.6 Coaggregation Assay
3.7 Measurement of the Invasion Potential of T. denticola (Antibiotic Protection Assay)
4 Notes
References
Chapter 18: Evaluation of the Virulence of Aggregatibacter actinomycetemcomitans Through the Analysis of Leukotoxin
1 Introduction
2 Materials
2.1 Determination of Leukotoxin Promoter Type
2.1.1 Dental Plaque Preparation
2.1.2 Polymerase Chain Reaction (PCR)
2.2 Apoptosis Assay
2.2.1 Infection of Leukocytes with A. actinomycetemcomitans
2.2.2 DNA Laddering
2.2.3 Annexin V Apoptosis Detection Assay
2.2.4 Determination of LDH Release
3 Methods
3.1 Determination of Leukotoxin Promoter Type
3.1.1 Dental Plaque Preparation
3.1.2 PCR
3.2 Apoptosis Assay
3.2.1 Infection of THP-1 with A. actinomycetemcomitans
3.2.2 DNA Laddering Assay
3.2.3 Annexin V Assay
3.2.4 LDH Release Assay
4 Notes
References
Chapter 19: Lipoprotein Extraction from Microbial Membrane and Lipoprotein/Lipopeptide Transfection into Mammalian Cells
1 Introduction
2 Materials
2.1 M. salivarium and T. forsythia Cultures
2.2 Lipoprotein Extraction
2.3 Lipopeptide Transfection into Macrophages
3 Methods
3.1 Bacterial Cultures
3.1.1 M. salivarium Culture
3.1.2 T. forsythia Culture
3.2 Lipoprotein Extraction by TX-114 Phase Separation Method (SeeNote 8)
3.3 Transfection of the Lipopeptide FSL-1 into the Macrophages
4 Notes
References
Part III: Interactions with Other Pathogenic Microorganism and Host Cells
Chapter 20: Analysis of the Interaction Between HIV and Periodontopathic Bacteria That Reactivates HIV Replication in Latently...
1 Introduction
2 Materials
2.1 Preparation of Culture Supernatant and Bacterial Cells
2.2 Cell Culture (See Note 1)
2.3 Stimulation Experiments
2.4 Immunoblotting Analysis of HIV Antigens
2.5 Polymerase Chain Reaction (PCR) Analysis of HIV RNA Expression
2.6 Enzyme-linked Immunosorbent Assay (ELISA) for Detection of the HIV Core Protein p24
2.7 Analysis of HIV Transcription Activity by Luciferase Assay
3 Methods
3.1 Preparation of Culture Supernatant and Bacterial Cells from Periodontal Pathogens
3.2 Stimulation Experiments (Fig. 1)
3.3 Viral Replication Assay
3.3.1 Immunoblotting Analysis of HIV Antigens
3.3.2 PCR Analysis of HIV RNA Expression
3.3.3 ELISA for Detection of the HIV Core Protein p24
3.3.4 Analysis of HIV Transcription Activity by Luciferase Assay
4 Notes
References
Chapter 21: Invasion of Gingival Epithelial Cells by Porphyromonas gingivalis
1 Introduction
2 Materials
2.1 P. gingivalis
2.2 Gingival Epithelial Cells
2.3 Confocal Microscopy
2.4 Cell Staining
3 Methods
3.1 Culturing of P. gingivalis
3.2 Culturing of IHGE Cells
3.3 Infection of Cells with P. gingivalis
3.4 Analysis Using Confocal Microscopy
4 Notes
References
Chapter 22: Analysis of Interaction Between Porphyromonas gingivalis and Endothelial Cells In Vitro
1 Introduction
2 Materials
2.1 Bacterial Strains and Growth Conditions
2.2 Cells and Culture Conditions
2.3 P. gingivalis Adherence to Endothelial Cells
2.4 P. gingivalis Invasion into Endothelial Cells
2.5 P. gingivalis-Induced NO Production
2.6 P. gingivalis-Induced vWF Release
3 Methods
3.1 Bacterial Cell Culture
3.2 Endothelial Cell Culture
3.3 Analysis of P. gingivalis Adhesion to Endothelial Cells
3.4 P. gingivalis Invasion into Endothelial Cells
3.5 P. gingivalis-Induced NO Production
3.6 P. gingivalis-Induced vWF Release
4 Notes
References
Part IV: Animal Model of Periodontitis
Chapter 23: Analysis of Experimental Ligature-Induced Periodontitis Model in Mice
1 Introduction
2 Materials
2.1 Animals
2.2 Ligation
2.3 Microinjection
2.4 Bone Analysis
2.5 Tissue Analysis
2.6 Molecular Analysis
2.7 Bacteria Analysis
3 Methods
3.1 Breeding
3.2 Ligation
3.3 Microinjection
3.4 Bone Analysis
3.5 Tissue Analysis
3.6 Molecular Analysis
3.7 Bacteria Analysis
4 Notes
References
Index

Citation preview

Methods in Molecular Biology 2210

Keiji Nagano Yoshiaki Hasegawa Editors

Periodontal Pathogens Methods and Protocols

METHODS

IN

MOLECULAR BIOLOGY

Series Editor John M. Walker School of Life and Medical Sciences University of Hertfordshire Hatfield, Hertfordshire, UK

For further volumes: http://www.springer.com/series/7651

For over 35 years, biological scientists have come to rely on the research protocols and methodologies in the critically acclaimed Methods in Molecular Biology series. The series was the first to introduce the step-by-step protocols approach that has become the standard in all biomedical protocol publishing. Each protocol is provided in readily-reproducible step-by step fashion, opening with an introductory overview, a list of the materials and reagents needed to complete the experiment, and followed by a detailed procedure that is supported with a helpful notes section offering tips and tricks of the trade as well as troubleshooting advice. These hallmark features were introduced by series editor Dr. John Walker and constitute the key ingredient in each and every volume of the Methods in Molecular Biology series. Tested and trusted, comprehensive and reliable, all protocols from the series are indexed in PubMed.

Periodontal Pathogens Methods and Protocols

Edited by

Keiji Nagano Division of Microbiology, Department of Oral Biology, School of Dentistry, Health Sciences University of Hokkaido, Ishikari-Tobetsu, Hokkaido, Japan

Yoshiaki Hasegawa Department of Microbiology, School of Dentistry, Aichi Gakuin University, Nisshin, Aichi, Japan

Editors Keiji Nagano Division of Microbiology Department of Oral Biology School of Dentistry Health Sciences University of Hokkaido Ishikari-Tobetsu, Hokkaido, Japan

Yoshiaki Hasegawa Department of Microbiology School of Dentistry Aichi Gakuin University Nisshin, Aichi, Japan

ISSN 1064-3745 ISSN 1940-6029 (electronic) Methods in Molecular Biology ISBN 978-1-0716-0938-5 ISBN 978-1-0716-0939-2 (eBook) https://doi.org/10.1007/978-1-0716-0939-2 © Springer Science+Business Media, LLC, part of Springer Nature 2021 This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer Nature. The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.

Preface Periodontal disease is characterized by chronic inflammation of periodontal tissue, often leading to tooth loss. The disease is prevalent among humans, affecting approximately 50% of all adults in most countries. In addition, periodontal disease adversely affects various systemic diseases including diabetes, arteriosclerosis, and rheumatoid arthritis. Periodontal disease is caused by multispecies bacterial biofilms in periodontal tissue. Several reports have listed bacteria that act as periodontal pathogens, but the specific causal bacteria of periodontal disease have not been definitively elucidated. This book addresses the major periodontal pathogens implicated as causal agents including Porphyromonas gingivalis, Tannerella forsythia, Treponema denticola, Fusobacterium nucleatum, Aggregatibacter actinomycetemcomitans, and Prevotella spp. The authors of this book first focus on a method for bacterial genetic manipulation, which is of great importance because of the difficulty in generating mutant periodontal pathogens with gene deletions. Next, the authors cover experimental methods for studying type-V fimbriae, the type-IX secretion system, and the surface layer of gram-negative bacteria (relatively new research areas developed by studying periodontal pathogens). Additionally, the authors describe experimental methods for examining periodontal pathogen-virulence factors (such as gingipain, dentilisin, leukotoxin, OmpA-like proteins, butyric acid, lipoproteins, and membrane vesicles) and their interactions with other pathogenic microorganisms (i.e., human immunodeficiency virus activation) and host cells (i.e., gingival epithelial cells and vascular endothelial cells). Finally, a mouse model of periodontitis is detailed. This book will serve as an extensive and useful reference for researchers studying periodontal pathogens and will help elucidate the causes of periodontal disease and the systemic diseases related with it. Hokkaido, Japan Aichi, Japan

Keiji Nagano Yoshiaki Hasegawa

v

Contents Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

PART I

METHODS FOR BACTERIAL GENETIC MANIPULATION

1 Site-Directed and Random Mutagenesis in Porphyromonas gingivalis: Construction of Fimbriae-Related-Gene Mutant . . . . . . . . . . . . . . . . . . . . . . . . . . . . So-ichiro Nishiyama, Yoshiaki Hasegawa, and Keiji Nagano 2 Genetic Manipulations of Oral Spirochete Treponema denticola . . . . . . . . . . . . . . . Kurni Kurniyati and Chunhao Li 3 Construction of a Gene-Deletion Mutant in Tannerella forsythia . . . . . . . . . . . . . Keiji Nagano and Yoshiaki Hasegawa 4 Construction of a Mutant in Prevotella melaninogenica Using the Conjugation Transfer Method with Escherichia coli . . . . . . . . . . . . . . . . Yoshio Kondo 5 Genetic Transformation of Fusobacterium nucleatum . . . . . . . . . . . . . . . . . . . . . . . . Akihiro Yoshida and Akihiko Ikegami

PART II

v ix

3 15 25

33 43

EXPERIMENTAL METHODS TO EXAMINE VIRULENCE FACTORS

6 Genotyping of Porphyromonas gingivalis in Relationship to Virulence . . . . . . . . . 53 Atsuo Amano, Youn-Hee Choi, and Hiroki Takeuchi 7 Transport and Polymerization of Porphyromonas gingivalis Type V Pili . . . . . . . . 61 Mikio Shoji, Satoshi Shibata, Mariko Naito, and Koji Nakayama 8 Purification of Native Mfa1 Fimbriae from Porphyromonas gingivalis . . . . . . . . . . 75 Yoshiaki Hasegawa, Keiji Nagano, Yukitaka Murakami, and Richard J. Lamont 9 Crystallization of Recombinant Fimbrial Proteins of Porphyromonas gingivalis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 87 Thomas Heidler and Karina Persson 10 Enzymatic Characteristics and Activities of Gingipains from Porphyromonas gingivalis. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 97 Tomoko Kadowaki 11 Structural Characterization of the Type IX Secretion System in Porphyromonas gingivalis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 113 Dhana G. Gorasia, Eric Hanssen, Paul D. Veith, and Eric C. Reynolds

vii

viii

12

13

14

15

16 17 18

19

Contents

Methods for Functional Characterization of the Type IX Secretion System of Porphyromonas gingivalis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Keiko Sato Purification of Tannerella forsythia Surface-Layer (S-Layer) Proteins . . . . . . . . . . Sreedevi Chinthamani, Prasad R. Settem, Kiyonobu Honma, Takuma Nakajima, and Ashu Sharma Separation of Glycosylated OmpA-Like Proteins from Porphyromonas gingivalis and Tannerella forsythia. . . . . . . . . . . . . . . . . . . . . . . . . . . Yukitaka Murakami, Keiji Nagano, and Yoshiaki Hasegawa Intranasal Vaccine Study Using Porphyromonas gingivalis Membrane Vesicles: Isolation Method and Application to a Mouse Model . . . . . . . . . . . . . . . Satoru Hirayama and Ryoma Nakao Analysis of the Butyrate-Producing Pathway in Porphyromonas gingivalis . . . . . . Yasuo Yoshida Characterization of the Treponema denticola Virulence Factor Dentilisin. . . . . . . Yuichiro Kikuchi and Kazuyuki Ishihara Evaluation of the Virulence of Aggregatibacter actinomycetemcomitans Through the Analysis of Leukotoxin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Toshiyuki Nagasawa, Satsuki Kato, and Yasushi Furuichi Lipoprotein Extraction from Microbial Membrane and Lipoprotein/Lipopeptide Transfection into Mammalian Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Akira Hasebe, Ayumi Saeki, and Ken-ichiro Shibata

PART III 20

21 22

123 135

143

157 167 173

185

195

INTERACTIONS WITH OTHER PATHOGENIC MICROORGANISM AND HOST CELLS

Analysis of the Interaction Between HIV and Periodontopathic Bacteria That Reactivates HIV Replication in Latently Infected Cells . . . . . . . . . . 207 Kenichi Imai Invasion of Gingival Epithelial Cells by Porphyromonas gingivalis . . . . . . . . . . . . . 215 Hiroki Takeuchi and Atsuo Amano Analysis of Interaction Between Porphyromonas gingivalis and Endothelial Cells In Vitro . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 225 Kenji Matsushita

PART IV ANIMAL MODEL OF PERIODONTITIS 23

Analysis of Experimental Ligature-Induced Periodontitis Model in Mice. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 237 Hikaru Tamura, Tomoki Maekawa, Takumi Hiyoshi, and Yutaka Terao

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

251

Contributors ATSUO AMANO • Department of Preventive Dentistry, Graduate School of Dentistry, Osaka University, Suita, Osaka, Japan SREEDEVI CHINTHAMANI • Department of Oral Biology, School of Dental Medicine, University at Buffalo, State University of New York, Buffalo, NY, USA YOUN-HEE CHOI • Department of Preventive Dentistry, School of Dentistry, Kyungpook National University, Daegu, South Korea YASUSHI FURUICHI • Division of Periodontology and Endodontology, Department of Oral Rehabilitation, School of Dentistry, Health Sciences University of Hokkaido, Ishikari-gun, Hokkaido, Japan DHANA G. GORASIA • Oral Health Cooperative Centre, Melbourne Dental School, Bio21 Institute, The University of Melbourne, Parkville, VIC, Australia ERIC HANSSEN • Department of Biochemistry and Molecular Biology, Bio21 Molecular Science and Biotechnology Institute, University of Melbourne, Parkville, VIC, Australia; Advanced Microscopy Facility, Bio21 Molecular Science and Biotechnology Institute, University of Melbourne, Parkville, VIC, Australia AKIRA HASEBE • Department of Oral Molecular Microbiology, Faculty of Dental Medicine and Graduate School of Dental Medicine, Hokkaido University, Sapporo, Japan YOSHIAKI HASEGAWA • Department of Microbiology, School of Dentistry, Aichi Gakuin University, Nisshin, Aichi, Japan THOMAS HEIDLER • Department of Chemistry, Umea˚ University, Umea˚, Sweden SATORU HIRAYAMA • Niigata University Graduate School of Medical and Dental Sciences, Niigata, Japan; Department of Bacteriology I, National Institute of Infectious Diseases, Tokyo, Japan TAKUMI HIYOSHI • Division of Microbiology and Infectious Diseases, Graduate School of Medical and Dental Sciences, Niigata University, Niigata, Japan; Division of Periodontology, Graduate School of Medical and Dental Sciences, Niigata University, Niigata, Japan KIYONOBU HONMA • Department of Oral Biology, School of Dental Medicine, University at Buffalo, State University of New York, Buffalo, NY, USA AKIHIKO IKEGAMI • Department of Environmental and Preventive Medicine, Jichi Medical University, Shimotsuke, Tochigi, Japan KENICHI IMAI • Department of Microbiology, Nihon University School of Dentistry, Tokyo, Japan; Division of Immunology and Pathobiology, Dental Research Center, Nihon University School of Dentistry, Tokyo, Japan KAZUYUKI ISHIHARA • Department of Microbiology, Tokyo Dental College, Tokyo, Japan; Oral Health Science Center, Tokyo Dental College, Tokyo, Japan TOMOKO KADOWAKI • Department of Frontier Life Science, Graduate School of Biomedical Sciences, Nagasaki University, Nagasaki, Japan SATSUKI KATO • Division of Periodontology and Endodontology, Department of Oral Rehabilitation, School of Dentistry, Health Sciences University of Hokkaido, Ishikari-gun, Hokkaido, Japan YUICHIRO KIKUCHI • Department of Microbiology, Tokyo Dental College, Tokyo, Japan; Oral Health Science Center, Tokyo Dental College, Tokyo, Japan

ix

x

Contributors

YOSHIO KONDO • Department of Pediatric Dentistry, Nagasaki University Graduate School of Biomedical Sciences, Nagasaki, Japan KURNI KURNIYATI • Department of Oral and Craniofacial Molecular Biology, Philips Institute for Oral Health Research, Virginia Commonwealth University, Richmond, VA, USA RICHARD J. LAMONT • Department of Oral Immunology and Infectious Diseases, University of Louisville School of Dentistry, Louisville, KY, USA CHUNHAO LI • Department of Oral and Craniofacial Molecular Biology, Philips Institute for Oral Health Research, Virginia Commonwealth University, Richmond, VA, USA TOMOKI MAEKAWA • Division of Microbiology and Infectious Diseases, Graduate School of Medical and Dental Sciences, Niigata University, Niigata, Japan; Research Center for Advanced Oral Science, Graduate School of Medical and Dental Sciences, Niigata University, Niigata, Japan KENJI MATSUSHITA • Department of Oral Disease Research, National Center for Geriatrics and Gerontology, Obu, Aichi, Japan YUKITAKA MURAKAMI • Department of Dental Basic Education (Biology), Asahi University School of Dentistry, Mizuho, Gifu, Japan KEIJI NAGANO • Division of Microbiology, Department of Oral Biology, School of Dentistry, Health Sciences University of Hokkaido, Ishikari-Tobetsu, Hokkaido, Japan TOSHIYUKI NAGASAWA • Division of Advanced Clinical Education, Department of Integrated Dental Education, School of Dentistry, Health Sciences University of Hokkaido, Ishikarihgun, Hokkaido, Japan MARIKO NAITO • Department of Microbiology and Oral Infection, Graduate School of Biomedical Sciences, Nagasaki University, Nagasaki, Japan TAKUMA NAKAJIMA • Center for Medical Education, Faculty of Health Sciences, Ryotokuji University, Chiba, Japan RYOMA NAKAO • Department of Bacteriology I, National Institute of Infectious Diseases, Tokyo, Japan KOJI NAKAYAMA • Department of Microbiology and Oral Infection, Graduate School of Biomedical Sciences, Nagasaki University, Nagasaki, Japan SO-ICHIRO NISHIYAMA • Faculty of Applied Life Sciences, Niigata University of Pharmacy and Applied Life Sciences, Niigata, Japan KARINA PERSSON • Department of Chemistry, Umea˚ University, Umea˚, Sweden ERIC C. REYNOLDS • Oral Health Cooperative Centre, Melbourne Dental School, Bio21 Institute, The University of Melbourne, Parkville, VIC, Australia AYUMI SAEKI • Department of Oral Molecular Microbiology, Faculty of Dental Medicine and Graduate School of Dental Medicine, Hokkaido University, Sapporo, Japan KEIKO SATO • Department of Pediatric Dentistry, Nagasaki University Graduate School of Biomedical Sciences, Nagasaki, Japan PRASAD R. SETTEM • Department of Oral Biology, School of Dental Medicine, University at Buffalo, State University of New York, Buffalo, NY, USA ASHU SHARMA • Department of Oral Biology, School of Dental Medicine, University at Buffalo, State University of New York, Buffalo, NY, USA KEN-ICHIRO SHIBATA • Department of Oral Molecular Microbiology, Faculty of Dental Medicine and Graduate School of Dental Medicine, Hokkaido University, Sapporo, Japan SATOSHI SHIBATA • Molecular Cryo-Electron Microscopy Unit, Okinawa Institute of Science and Technology Graduate University, Onna, Okinawa, Japan

Contributors

xi

MIKIO SHOJI • Department of Microbiology and Oral Infection, Graduate School of Biomedical Sciences, Nagasaki University, Nagasaki, Japan HIROKI TAKEUCHI • Department of Preventive Dentistry, Graduate School of Dentistry, Osaka University, Suita, Osaka, Japan HIKARU TAMURA • Division of Microbiology and Infectious Diseases, Graduate School of Medical and Dental Sciences, Niigata University, Niigata, Japan; Research Center for Advanced Oral Science, Graduate School of Medical and Dental Sciences, Niigata University, Niigata, Japan; Division of Periodontology, Graduate School of Medical and Dental Sciences, Niigata University, Niigata, Japan YUTAKA TERAO • Division of Microbiology and Infectious Diseases, Graduate School of Medical and Dental Sciences, Niigata University, Niigata, Japan; Research Center for Advanced Oral Science, Graduate School of Medical and Dental Sciences, Niigata University, Niigata, Japan PAUL D. VEITH • Oral Health Cooperative Centre, Melbourne Dental School, Bio21 Institute, The University of Melbourne, Parkville, VIC, Australia AKIHIRO YOSHIDA • Department of Oral Microbiology, Matsumoto Dental University, Shiojiri, Nagano, Japan YASUO YOSHIDA • Department of Microbiology, School of Dentistry, Aichi Gakuin University, Nagoya, Japan

Part I Methods for Bacterial Genetic Manipulation

Chapter 1 Site-Directed and Random Mutagenesis in Porphyromonas gingivalis: Construction of Fimbriae-Related-Gene Mutant So-ichiro Nishiyama, Yoshiaki Hasegawa, and Keiji Nagano Abstract Porphyromonas gingivalis, an etiological agent of chronic periodontitis, is an asaccharolytic anaerobic gram-negative coccobacillus. Genetic approaches greatly facilitate research on organisms at the molecular level. Although with some challenges, the use of genetic techniques (such as constructing knockout mutants) in P. gingivalis are feasible. In this chapter, we describe detailed methods for site-directed and random mutagenesis through the construction of fimbriae-related gene mutants of P. gingivalis. Key words Porphyromonas gingivalis, Gene replacement, Site-directed mutagenesis, Homologous recombination, Transposon mutagenesis

1

Introduction Porphyromonas gingivalis, a gram-negative anaerobe, is a causative agent of adult chronic periodontitis, which expresses a variety of virulence factors, such as fimbriae/pili, lipopolysaccharide (LPS), and gingipains [1, 2]. Large amounts of information on virulence factors in this organism have accumulated through studies at the physiological and molecular level. One example concerns type V fimbriae and type IX secretion system for the secretion of gingipains [3, 4]. P. gingivalis possesses two types of fimbriae, FimA and Mfa1 fimbriae, which are involved in host–bacterial adhesion, autoaggregation, coaggregation with other bacteria, and biofilm formation [5, 6]. The gene fimA, which encodes the major component of FimA fimbriae, forms an operon with downstream elements fimB-fimE (Fig. 1). The products of the downstream genes, FimCFimE, appear to be accessory proteins of FimA fimbriae [6, 7].

Keiji Nagano and Yoshiaki Hasegawa (eds.), Periodontal Pathogens: Methods and Protocols, Methods in Molecular Biology, vol. 2210, https://doi.org/10.1007/978-1-0716-0939-2_1, © Springer Science+Business Media, LLC, part of Springer Nature 2021

3

4

So-ichiro Nishiyama et al.

fimA

mfa1

fimB

fimC

mfa2

fimD

mfa3

mfa4

fimE

mfa5

Fig. 1 Schematic diagram of fimA and mfa1 gene clusters in the P. gingivalis ATCC 33277 strain. The cross in fimB indicates the point of a nonsense mutation (TAA) in the strain. In some other strains, such as HW24D1, fimB is intact and functions properly [8]

FimB (encoded by fimB, located immediately downstream of fimA) plays a major role in regulating the number, length, and biogenesis of FimA fimbriae [8], although the protein functions unproperly in some type strains, including ATCC 33277 or 381, due to a nonsense mutation (Fig. 1). FimC and FimD may play roles in the adhesive function of FimA fimbriae as a lack of these components results in the loss of autoaggregation and binding to extracellular matrices [7]. The fimbriae devoid of these minor components (DAP fimbriae) showed a weakened virulence and potentiated immune responses of host cells [9–11]. Our previous studies also suggested that FimE may function as an adaptor protein connecting FimC and FimD [7, 10]. Similar to the gene architectures and functions of FimA fimbriae, the mfa1–5 (PGN_0287-0291 [12]) genes also form a gene cluster (Fig. 1). The Mfa1 protein is the major component of Mfa1 fimbriae. Mfa2 functions as a fimbrial anchor and length regulator [13]. Mfa3, Mfa4, and Mfa5 are integrated into the fimbriae as minor accessory proteins [14–16]. These studies have been performed using genetic and biochemical techniques, including the construction of mutants that lack specific genes of interest. In the case of FimA fimbriae, transposon mutagenesis and screening for fimbriae mutants resulted in the identification of a two-component system (FimS/R) that plays a role in the expression of the fimbriae [17, 18]. For P. gingivalis, it is possible to replace the targeted gene(s) (“reverse genetics”) with an erythromycin (Em)-resistance cassette, ermF-ermAM (Fig. 2) [7, 19, 20]. For finding genes involved in the function of interest, random mutagenesis by transposon insertion (“forward genetics”) is also possible [17, 18]. A screening method for the mutants has also been established. These methods will be described in this chapter (see Note 1).

P. gingivalis Mutagenesis a

b

c

target gene

5

d P. gingivalis chromosomal DNA

PCR with primers a-b e

A

ermM-ermAF PCR with primers c-d

a 2.1 kbp

PCR with primers a-e d

B

C

a

PCR with primers a-d

D Cloned into a plasmid vector

digestion Linearization of the plasmid using a restriction enzyme

Electroporation

ermM-ermAF

target gene P. gingivalis chromosomal DNA

Gene replacement by homologous recombination

ermM-ermAF P. gingivalis chromosomal DNA

Fig. 2 Gene replacement in P. gingivalis by homologous recombination. The detailed procedures are described in the text

6

2

So-ichiro Nishiyama et al.

Materials

2.1 Site-Directed Mutagenesis

1. Strains: E. coli (DH5α, HB101, or BW19851) and P. gingivalis (ATCC 33277; see Note 1).

2.1.1 Culture Media and Antibiotics for Escherichia coli and P. gingivalis

2. LB liquid medium or agar plate (for E. coli): 1% tryptone, 0.5% yeast extract, and 0.5% NaCl. Add 1.5% agar when necessary. Antibiotics: add kanamycin (Km; 50 μg/mL), erythromycin (Em; 20 μg/mL), chloramphenicol (Cm; 20 μg/mL), or tetracycline (Tc; 10 μg/mL) to LB medium when necessary. 3. sTSB liquid medium (for P. gingivalis): trypticase soy broth supplemented with 0.25% (w/v) yeast extract, 2.5 μg/mL hemin, 5.0 μg/mL menadione, and 0.01% (w/v) dithiothreitol (see Note 2). sBHI liquid medium: 3.7% (w/v) Brain Heart Infusion supplemented with 2.5 μg/mL hemin, 5.0 μg/mL menadione, and 0.01% (w/v) dithiothreitol (see Note 2). 4. LRBB plates (for P. gingivalis): Brucella HK agar (Kyokuto) supplemented with 5% (w/v) laked rabbit blood, 2.5 μg/mL hemin, 5.0 μg/mL menadione, and 0.01% (w/v) DTT. Antibiotics: add gentamicin (Gm; 200 μg/mL, see Note 3) or erythromycin (Em; 20 μg/mL) to sTSB or LRBB plates when necessary. 5. Anaerobic culture instruments (for P. gingivalis): gas ratio at 10% CO2, 10% H2, and 80% N2.

2.1.2 Preparation of DNA Constructs

1. Chromosomal DNA of P. gingivalis (see Note 4). 2. pVA2198 carrying the ermF-ermAM cassette [19]. 3. Primers used for PCR reactions. 4. Thermal cycler for PCR reactions. 5. An apparatus for agarose gel electrophoresis.

2.1.3 Preparation of P. gingivalis Competent Cells

1. sBHI medium (see Subheading 2.1.1). 2. EP buffer: 10% (w/v) glycerol and 1 mM MgCl2. Sterilize this buffer by filtration (e.g., by Millipore 0.2 μm syringe filter). 3. Refrigerated centrifuge.

2.1.4 Electroporation of P. gingivalis Cells

1. sTSB medium (see Subheading 2.1.1). 2. LRBB plate with Em (see Subheading 2.1.1). 3. Glass test tubes. 4. Electroporator (e.g., Bio-Rad MicroPulser or Gene Pulser).

P. gingivalis Mutagenesis

2.2 Random Mutagenesis 2.2.1 Transposon Mutagenesis of P. gingivalis by Conjugation

7

1. E. coli (HB101/R751::*Ω4 [18, 21] or BW19851/pEP4351 [22]). 2. P. gingivalis (ATCC 33277). 3. sTSB medium (see Subheading 2.1.1). 4. LB medium (see Subheading 2.1.1). 5. LRBB plates with Em (see Subheading 2.1.1). 6. 1.5 mL microtubes. 7. Spectrophotometer. 8. Microcentrifuge.

2.2.2 Colony Immunoblotting

1. sTSB medium (see Subheading 2.1.1). 2. LRBB plates (see Subheading 2.1.1). 3. TBS buffer: 20 mM Tris–HCl, pH 7.4, 0.5 M NaCl. 4. TBS with 0.05% (w/v) Tween 20. 5. TBS with 1% bovine serum albumin (BSA). 6. Primary antibody against the target protein. 7. Enzyme-linked secondary antibody: for example, HRP (horseradish peroxidase)-labeled anti-rabbit goat antibody. 8. Visualization solution: For HRP-labeled secondary antibody, 25 mL TBS with 5 μL of 4-chloro-1-naphthol solution (15 μg/ mL, dissolved in methanol), and 15 μL of H2O2. 9. Circular nitrocellulose membranes fitting the diameter of the petri dish. 10. Paintbrushes with soft bristles.

3

Methods

3.1 Site-Directed Mutagenesis 3.1.1 Culture Conditions for P. gingivalis and E. coli

3.1.2 Preparation of DNA Constructs

1. Inoculate P. gingivalis cells with a toothpick from a single colony on a plate and culture in sTSB or sBHI anaerobically at 37
C for 2 days (up to 48 h). Add gentamicin (see Subheading 2.1.1) if required (see Note 5). 2. Inoculate E. coli cells with a toothpick from a single colony on a plate and culture overnight in LB with vigorous shaking at 37
C. Add antibiotics (see Subheading 2.1.1) if required. Any nonessential genes of P. gingivalis can be deleted by replacement with an ermF-ermAM cassette [19] via primer-extension and homologous recombination [7, 20] (see Note 6). Site-directed mutagenesis or restoration of a gene is also possible [8]. The steps for gene replacement are schematically illustrated in Fig. 2. Briefly, the upstream and downstream regions of the targeted gene are PCR-amplified and merged with the ermF-ermAM cassette using

8

So-ichiro Nishiyama et al.

multistep PCR. The “hybrid” DNA fragment is then cloned into a vector plasmid. The resultant plasmid is then digested using a restriction enzyme for linearization and used for electroporation. Occasionally, the linearized DNA fragment is incorporated into the P. gingivalis chromosomal DNA by double-crossover recombination. 1. Design primers as shown in Fig. 2a–e. The sequences of primer a and reverse primer d should completely match the chromosomal sequence of P. gingivalis. The sequence of reverse primer e should match the 30 end of the ermF-ermAM cassette. The overlapping primers b and c have hybrid sequences of matching P. gingivalis chromosomal DNA and the ermF-ermAM cassette. Overlapping sequences should be approximately 20 bases in length. For efficient recombination, the length of homologous sequences (i.e., the lengths between primers a–b and c–d in Fig. 2) should be at least 500 base pairs in length (see Note 7). 2. Amplify the DNA fragments with primers a and b using P. gingivalis chromosomal DNA as a template for PCR (the amplified fragment is designated as fragment “A” in Fig. 2). 3. Amplify the DNA fragments with primers a and e using fragment A and the ermF-ermAM cassette as templates for PCR (the amplified fragment is designated as fragment “B” in Fig. 2). 4. Amplify the DNA fragments with primers c and d using P. gingivalis chromosomal DNA as a template for PCR (the amplified fragment is designated as fragment “C” in Fig. 2). 5. Amplify the DNA fragments with primers a and d using fragments B and C as templates for PCR (the amplified fragment is designated as fragment “D” in Fig. 2). 6. Clone the amplified DNA fragment D to a vector plasmid (see Note 8). 7. Linearize the plasmid DNA by treatment with a restriction enzyme to make a single cut at a unique site (see Note 9). 8. Desalinize the linearized DNA (up to 10 μg) using ethanol precipitation or desalting spin columns. 3.1.3 Competent Cell Preparation of P. gingivalis

1. Inoculate a single colony of P. gingivalis into 3 mL of sBHI and incubate anaerobically at 37
C overnight (see Notes 10 and 11). 2. Inoculate the overnight culture (1.0 mL) into 10 mL of sBHI and incubate anaerobically at 37
C overnight (see Note 11). 3. Inoculate the culture (1.0 mL) into 90 mL of sBHI and incubate anaerobically at 37
C for approximately 10–11 h (see Note 11). The optical density at 600 nm (OD600) of the culture should be approximately 0.35.

P. gingivalis Mutagenesis

9

4. Harvest cells by centrifugation (2600  g) at 4
C for 10 min. 5. Resuspend the cells in 60 mL of EP buffer by gentle pipetting. 6. Collect the cells by centrifugation (2600  g) at 4
C for 10 min. 7. Resuspend the cells in 1 mL of EP buffer by gentle pipetting. 8. Distribute the samples into aliquots (100 μL each) and freeze immediately (see Note 12). 9. Store the samples at 80
C (see Note 13). 3.1.4 Electroporation of P. gingivalis

1. Gently thaw the competent cells (100 μL) on ice. 2. Add desalinized DNA solution (up to 10 μg). 3. Perform electroporation out at 2.5 kV (see Note 14). 4. Add TSB (1.0 mL) and transfer the samples into a glass test tube. 5. Incubate the samples anaerobically at 37
C overnight. 6. Collect the cells by centrifugation. 7. Spread the cells onto LRBB plates containing Gm (200 μg/ mL) and Em (20 μg/mL). Incubate the plates anaerobically at 37
C for 7–10 days (see Note 15).

3.2 Random Mutagenesis 3.2.1 Transposon Mutagenesis of P. gingivalis by Conjugation

1. Inoculate a single colony of P. gingivalis into 3 mL of sTSB and incubate anaerobically at 37
C overnight. 2. Inoculate the culture (0.1 mL) into 5 mL of sTSB and incubate anaerobically at 37
C overnight. On the same day, add a single colony of E. coli HB101/R751::*Ω4 or BW19851/pEP4351 (see Note 16) to 5 mL of LB containing Cm (20 μg/mL) and Tc (10 μg/mL) and cultivate aerobically at 37
C overnight with vigorous shaking. 3. Inoculate 30 μL of E. coli culture into 3 mL of LB and cultivate aerobically at 37
C for approximately 2 h with vigorous shaking (see Note 17). 4. Transfer 0.2 mL of E. coli culture to a microtube. Collect the cells by centrifugation and remove the supernatant. Resuspend the pellet in 0.5 mL of LB. 5. Add 1.0 mL of P. gingivalis culture (seestep 2 in Subheading 3.2.1) to the tube. Collect the cells by centrifugation and remove the supernatant completely. 6. Resuspend the pellet in 50 μL of sTSB. 7. Spot the suspension on an LRBB plate without antibiotics (see Note 18). 8. Incubate the LRBB plate anaerobically at 37
C for 15 to 20 h.

10

So-ichiro Nishiyama et al.

9. Scrape the cells from the spot using an inoculating loop and suspend in 1 mL of sTSB. 10. Spread the cell suspension (0.2 mL) onto an LRBB plate containing Gm (200 μg/mL) and Em (20 μg/mL) (see Note 19). 11. Incubate the LRBB plates anaerobically at 37
C for about 7–10 days to form conjugant colonies. 3.2.2 Screening of Mutants (e.g., Lacking Outer Membrane Proteins): Colony Immunoblotting

The method described below was primarily developed for the screening of FimA fimbriae mutants of P. gingivalis (Fig. 3) [18], and allows for the identification of a two-component system (FimS/R) involved in fimbriae synthesis [17]. We believe it can also be used to screen for mutants lacking other outer membrane proteins, with minor modifications. 1. Use toothpicks to create patches of conjugants on the LRBB plates containing Em (20 μg/mL). Create up to 50 patches per plate (Fig. 3) (see Note 20). 2. Incubate the plates anaerobically at 37
C for two nights.

Fig. 3 Screening for fimbriae-deficient mutants by colony immunoblotting. The arrowhead at the top indicates positive (a fimbriate conjugant, patched as “plus”) and a negative (a fimbriae-deficient mutant, patched as “minus”) reactions of the control strains. The arrowhead in the middle indicates a candidate for fimbriae-deficient conjugant. (Taken from Watanabe-Kato et al. [18] with permission from Elsevier)

P. gingivalis Mutagenesis

11

3. Transfer the cells to nitrocellulose membranes (one membrane per plate). 4. After transferring, store the plates anaerobically at room temperature until further use. 5. Wash each membrane with TBS at room temperature for 30 min. 6. Remove cells and any debris using a paintbrush (see Note 21). 7. Wash each membrane with TBS at room temperature for 5 min. 8. Wash each membrane with TBS with 0.05% (w/v) Tween 20 at room temperature for 5 min. 9. Place each membrane on an empty petri dish. 10. Add TBS (20 mL) supplemented with 1% BSA and 10 μL of primary antiserum to each dish (see Note 22). 11. Shake the dishes gently at room temperature for 2 h (see Note 23). 12. Wash the membranes twice with TBS containing 0.05% (w/v) Tween 20 at room temperature for 5 min. 13. Wash the membranes twice with TBS at room temperature for 5 min. 14. Add TBS (20 mL) supplemented with 1% BSA and 10 μL of enzyme-linked secondary antiserum (see Note 24). 15. Wash the membranes twice with TBS containing 0.05% (w/v) Tween 20 at room temperature for 5 min. 16. Wash the membranes twice with TBS at room temperature for 5 min. 17. While washing, prepare the visualizing solution (see Subheading 2.2.2). 18. Rinse the membranes with distilled water (discard the water immediately). 19. Add the visualizing solution under shaking at room temperature and allow to react for 5 min. 20. To stop the reaction, wash the membranes with tap water for 30 min, then dry. 21. Select the positive conjugants and identify the insertion regions using pulse-field gel electrophoresis [22] or direct sequencing.

12

4

So-ichiro Nishiyama et al.

Notes 1. All of the methods described in this section were developed for the ATCC 33277 strain and its derivatives. Therefore, we cannot confirm that our methods can be successfully applied to other P. gingivalis strains. For example, we have recognized that it is difficult to construct gene-disrupted mutants of a strain HW24D1 using the methods described in this chapter (Nishiyama, unpublished data). The optimization of conditions may be necessary to extend these methods to P. gingivalis strains other than ATCC 33277. 2. It is very important to preincubate aliquots of liquid medium anaerobically before inoculation (typically from 8 h to overnight). This preincubation facilitates oxygen purging to ensure the growth of P. gingivalis, which is an obligate anaerobe. 3. P. gingivalis is naturally resistant to gentamicin. 4. The chromosomal DNA of P. gingivalis can be acquired using a purification kit for gram-negative bacteria (e.g., MasterPure Complete DNA and RNA Purification Kit, Lucigen), according to the manufacturer’s instructions. 5. To avoid contamination, gentamicin can be added to the medium (see Note 3). If the P. gingivalis strain already carries antibiotic-resistance gene(s) via primary mutagenesis, add the corresponding antibiotics to the medium. 6. To create a double mutant, a chloramphenicol-resistance cassette (cat) can be used as the secondary selection marker [20]. However, it will be more difficult to construct it because the minimum inhibitory concentration (MIC) of chloramphenicol for P. gingivalis is relatively low. Moreover, the MIC can be influenced by the promoter activity of the target gene. 7. Typical examples of such primers have been described in the literature [7, 20]. 8. The cloning vector is arbitrary (e.g., zero-blunt TOPO, Thermo Fisher Scientific) but must possess at least one unique restriction site for linearization. 9. The complete digestion of the plasmid DNA will need to be confirmed (typically by agarose gel electrophoresis of a sample). Residual circular plasmid DNA may result in the incorporation of an intact plasmid into the P. gingivalis chromosome by a single crossover. 10. sTSB can be used instead of sBHI. However, in this case, the growth rate is altered, such that culture dilution and incubation time need to be adjusted.

P. gingivalis Mutagenesis

13

11. sBHI (or sTSB) should be preincubated at 37
C in anaerobic conditions for at least 8 h or longer to purge oxygen to allow for the proper growth of P. gingivalis. 12. The use of dry ice is recommended for quick freezing. 13. Competent cells can remain stable for at least 3 months if stored at 80
C. 14. In the case of the Bio-Rad MicroPulser, a 0.2 cm wide electrocuvette can be used with the program “Ec2” for electroporation. 15. Typically, it takes about 7–10 days for the colonies to become visible. 16. Plasmid R751::*Ω4 or pEP4351 is a suicide vector carrying Tn4351 [18, 22]. 17. For efficient conjugation, the growth stage of the E. coli donor is very important. The optimum culture OD600 should be limited from 0.2 to 0.3. Multiple independent cultures enhance success. On the other hand, the growth stage for the donor P. gingivalis is less critical (OD600 ¼ 0.5–1.0). 18. The cell suspension should be spotted at two or three places on each LRBB plate. 19. Both antibiotics are needed to kill E. coli and unconjugated P. gingivalis. 20. Alternatively, modified GAM agar plates (Nissui Pharmaceutical) can be used to reduce background signals, since the black pigmentation of P. gingivalis does not occur on GAM plates. However, the post-incubation of the plates at 37
C for several days is necessary for additional growth after the transfer procedure, since most of the cells adhere to the membranes. 21. This operation is very important for reducing noise. 22. The dilution rates of the primary antibody can vary depending on the one you apply. Here, we describe the anti-FimA (polymer) antibody as an example. 23. After this procedure, the membranes can be kept at 4
C overnight optionally. 24. The dilution rates of the secondary antibody can vary depending on the antibody used. Here, we described the HRP-labeled anti-rabbit goat antibody (Merck Millipore) as an example.

Acknowledgments We would like to thank Professor John S. Parkinson (University of Utah) for his critical reading of the manuscript.

14

So-ichiro Nishiyama et al.

References 1. Lamont RJ, Jenkinson HF (1998) Life below the gum line: pathogenic mechanisms of Porphyromonas gingivalis. Microbiol Mol Biol Rev 62(4):1244–1263 2. How KY, Song KP, Chan KG (2016) Porphyromonas gingivalis: an overview of periodontopathic pathogen below the gum line. Front Microbiol 7:53 3. Hospenthal MK, Costa TRD, Waksman G (2017) A comprehensive guide to pilus biogenesis in Gram-negative bacteria. Nat Rev Microbiol 15(6):365–379 4. Lasica AM, Ksiazek M, Madej M et al (2017) The Type IX secretion system (T9SS): highlights and recent insights into its structure and function. Front Cell Infect Microbiol 7:215 5. Enersen M, Nakano K, Amano A (2013) Porphyromonas gingivalis fimbriae. J Oral Microbiol 5:1–10 6. Yoshimura F, Murakami Y, Nishikawa K et al (2009) Surface components of Porphyromonas gingivalis. J Periodontal Res 44(1):1–12 7. Nishiyama S, Murakami Y, Nagata H et al (2007) Involvement of minor components associated with the FimA fimbriae of Porphyromonas gingivalis in adhesive functions. Microbiology 153(Pt 6):1916–1925 8. Nagano K, Hasegawa Y, Murakami Y et al (2010) FimB regulates FimA fimbriation in Porphyromonas gingivalis. J Dent Res 89 (9):903–908 9. Hajishengallis G, McIntosh ML, Nishiyama S et al (2013) Mechanism and implications of CXCR4-mediated integrin activation by Porphyromonas gingivalis. Mol Oral Microbiol 28 (4):239–249 10. Pierce DL, Nishiyama S, Liang S et al (2009) Host adhesive activities and virulence of novel fimbrial proteins of Porphyromonas gingivalis. Infect Immun 77(8):3294–3301 11. Wang M, Shakhatreh MA, James D et al (2007) Fimbrial proteins of Porphyromonas gingivalis mediate in vivo virulence and exploit TLR2 and complement receptor 3 to persist in macrophages. J Immunol 179(4):2349–2358 12. Naito M, Hirakawa H, Yamashita A et al (2008) Determination of the genome sequence of Porphyromonas gingivalis strain ATCC 33277 and genomic comparison with strain

W83 revealed extensive genome rearrangements in P. gingivalis. DNA Res 15 (4):215–225 13. Hasegawa Y, Iwami J, Sato K et al (2009) Anchoring and length regulation of Porphyromonas gingivalis Mfa1 fimbriae by the downstream gene product Mfa2. Microbiology 155 (Pt 10):3333–3347 14. Hasegawa Y, Iijima Y, Persson K et al (2016) Role of Mfa5 in expression of Mfa1 fimbriae in Porphyromonas gingivalis. J Dent Res 95 (11):1291–1297 15. Hasegawa Y, Nagano K, Ikai R et al (2013) Localization and function of the accessory protein Mfa3 in Porphyromonas gingivalis Mfa1 fimbriae. Mol Oral Microbiol 28(6):467–480 16. Ikai R, Hasegawa Y, Izumigawa M et al (2015) Mfa4, an accessory protein of Mfa1 fimbriae, modulates fimbrial biogenesis, cell autoaggregation, and biofilm formation in Porphyromonas gingivalis. PLoS One 10(10): e0139454 17. Hayashi J, Nishikawa K, Hirano R et al (2000) Identification of a two-component signal transduction system involved in fimbriation of Porphyromonas gingivalis. Microbiol Immunol 44 (4):279–282 18. Watanabe-Kato T, Hayashi JI, Terazawa Y et al (1998) Isolation and characterization of transposon-induced mutants of Porphyromonas gingivalis deficient in fimbriation. Microb Pathog 24(1):25–35 19. Fletcher HM, Schenkein HA, Morgan RM et al (1995) Virulence of a Porphyromonas gingivalis W83 mutant defective in the prtH gene. Infect Immun 63(4):1521–1528 20. Nagano K, Read EK, Murakami Y et al (2005) Trimeric structure of major outer membrane proteins homologous to OmpA in Porphyromonas gingivalis. J Bacteriol 187(3):902–911 21. Shoemaker NB, Getty C, Gardner JF et al (1986) Tn4351 transposes in Bacteroides spp. and mediates the integration of plasmid R751 into the Bacteroides chromosome. J Bacteriol 165(3):929–936 22. Alvarez B, Secades P, McBride MJ et al (2004) Development of genetic techniques for the psychrotrophic fish pathogen Flavobacterium psychrophilum. Appl Environ Microbiol 70 (1):581–587

Chapter 2 Genetic Manipulations of Oral Spirochete Treponema denticola Kurni Kurniyati and Chunhao Li Abstract There have been more than 60 different oral Treponema species identified in the oral cavity; however, only few species can be cultivated in vitro reliably. Among those cultivable species, due to its medical importance and genetic tractability, Treponema denticola, one of the keystone pathogens associated with human periodontitis, has emerged as a paradigm model organism to understanding the genetics, etiology, and pathophysiology of oral Treponema species. During the last two decades, several genetic tools have been developed, which have played an instrumental role in the study of T. denticola. This chapter describes the experimental design and procedure of genetic manipulations of T. denticola. Key words Periodontal disease, Spirochete, Treponema denticola, Genetic manipulation

1

Introduction Treponema denticola is an obligate anaerobic and highly motile bacterium that is associated with human periodontitis (for a review, see refs. 1–3). It is understudied mainly due to its fastidious growth requirements and recalcitrance to genetic manipulations (for a review, see refs. 4, 5). The first genetic transformation of T. denticola was published in 1996 [6, 7]. Since then, several new genetic tools have been developed, including transposon mutagenesis (Fig. 1a), antibiotics resistance markers, shuttle vectors, and a counterselectable marker (Fig. 1b) [7–15]. The commonly used genetic transformation method in T. denticola is electroporation (electrotransformation), which is based on a high-voltage electric pulse causing the cellular membrane to be transiently permeabilized, subsequently allowing DNA to enter the cells [6, 7]. The other method is chemically induced transformation, which is based on the treatment of bacterial cells with divalent cations including CaCl2, MgCl2, or RuCl2 and followed by heat shock [14, 16]. The heat shock step depolarizes the cell membrane, facilitating DNA entry into the cells. Compared to the electro-transformation, to

Keiji Nagano and Yoshiaki Hasegawa (eds.), Periodontal Pathogens: Methods and Protocols, Methods in Molecular Biology, vol. 2210, https://doi.org/10.1007/978-1-0716-0939-2_2, © Springer Science+Business Media, LLC, part of Springer Nature 2021

15

16

Kurni Kurniyati and Chunhao Li

Fig. 1 Diagrams illustrating strategies for gene deletion and complementation in T. denticola. (a) A modified Himar1 vector for transposon mutagenesis of T. denticola. (b) A pyrF-based counterselectable knockout system using the pPOPin vector to construct marker free deletion mutants. (c) Targeted gene deletion by two-step PCR. (d) Cis-complementation of a gene by replacing the antibiotic cassette with a gene of interest and a different antibiotic resistance cassette. Both constructs are generated by PCR. The arrows represent the relative positions and orientations of the PCR primers. ORF open reading frame of a gene of interest, US‘ upstream region of a gene of interest, DS‘ downstream of a gene of interest

our experience, the chemically induced transformation method is more efficient. This method has been regularly used in our laboratory for DNA transformation in T. denticola. By using this method, numerous mutants have been successfully generated. To our experience, the key factor that affects the transformation success and efficacy in T. denticola includes: (1) growth phase of cell cultures for competent cell preparations, (2) growth media, and (3) exposure time of the cells to oxygen. In this chapter, we describe the detail methodologies in genetic manipulations, which will help other laboratories to construct T. denticola mutants.

Genetic manipulation and Treponema denticola

2

17

Materials 1. T. denticola ATCC 35405 and ATCC 33520 are two commonly used lab strains, which are available from ATCC (http://www.atcc.org) (see Note 1). 2. Escherichia coli strain DH5α (New England BioLabs) is used for DNA cloning and plasmid amplifications. 3. T. denticola is cultured at 37  C in an anaerobic chamber (Anaerobe Systems) in the presence of 85% nitrogen, 10% carbon dioxide, and 5% hydrogen. E. coli is cultured in incubators and shakers at 37  C. 4. Tryptone-yeast extract-gelatin-volatile fatty acids-serum (TYGVS) medium [17]: three solutions are separately prepared. To prepare the first solution (800 mL), dissolve the following items in ~600 mL of distilled H2O (dH2O), including 10 g of tryptone, 5 g of brain heart infusion broth, 10 g of yeast extract, 10 g of gelatin, 0.5 g of (NH4)2SO4, 0.1 g of MgSO4∙7H2O, 1.13 g of K2HPO4, 0.9 g of KH2PO4, and 1 g of NaCl. Stir until dissolve, adjust pH to 7.2 with 4 M KOH, adjust the volume to 800 mL with dH2O, autoclave the medium, and allow it to cool to room temperature. To prepare the second solution (100 mL), dissolve the following items in ~50 mL of dH2O, including 1 g of glucose, 1 g of cysteine hydrochloride, 0.0125 g of thiamine pyrophosphate, 0.25 g of sodium pyruvate, 0.27 mL of acetic acid, 0.1 mL of propionic acid, 0.064 mL of n-butyric acid, 0.016 mL of n-valeric acid, 0.016 mL of isobutyric acid, 0.016 mL of isovaleric acid, and 0.016 mL of DL-methylbutyric acid. Stir until dissolve, adjust pH to 7.2 with 4 M KOH, adjust the volume to 100 mL with dH2O, and sterilize by filtration (0.22 μm). To prepare the third solution, 100 mL rabbit serum will be heat-inactivated by in 55  C water bath for 30 min and allow it to cool to room temperature. Mix all the three solutions and store at 4  C (see Note 2). 5. Electroporation solution (EPS): 15% (v/v) glycerol solution, sterilized by autoclave, and stored at 4  C. 6. Chemically induced transformation solution (CTS): 15% (v/v) glycerol and 50 mM CaCl2 solution, sterilized by autoclave, and stored at 4  C. 7. Low melting temperature agarose [SeaPlaque agarose]. 8. Antibiotic stock solutions (for selection of transformants): 100 mg/mL ampicillin; 20 mg/mL gentamicin; 25 mg/mL kanamycin (all dissolved in dH2O and filter-sterilized— 0.22 μm); 50 mg/mL erythromycin; 50 mg/mL

18

Kurni Kurniyati and Chunhao Li

chloramphenicol (all dissolved in ethanol and filter-sterilized— 0.22 μm); and 10 mg/mL coumermycin A1 (dissolved in dimethyl sulfoxide and filter-sterilized—0.22 μm) (see Note 3).

3

Methods

3.1 Designing Constructs for Gene Deletion by Allelic Exchange

1. We typically use two-step PCR to create a construct for targeted gene deletion. Design six primers to amplify two flanking regions of a targeted gene and an antibiotic resistance cassette (Fig. 1c) (see Note 4). PCR-amplify the upstream flanking region and an antibiotic resistance cassette using primer pairs P1–P2 and P3–P4, respectively, and then fuse two fragments using primers P1 and P4, generating fragment 1. PCR-amplify the downstream flanking region using primers P5 and P6, and then fuse it to the fragment 1 by PCR using primers P1 and P6. 2. Clone the obtained PCR product into a cloning vector, generating the deletion construct. Confirm the construct by DNA sequencing. 3. Prepare plasmid DNA from E. coli and suspend the plasmid DNA pellet in dH2O (see Note 5). Measure plasmid DNA concentrations and proceed to either electrotransformation or heat shock transformation.

3.2 Designing Construct for Gene Deletion by Counterselectable Maker

1. Design four primers to amplify two regions flanking the sequence to be deleted (Fig. 1b) (see Note 4). PCR-amplify the upstream and downstream flanking regions using primer pairs P1–P2 and P3–P4, respectively, and then fuse two fragments using primers P1 and P4. 2. Clone the obtained PCR product into pCounter [14], generating pPOPin construct. Confirm the construct by DNA sequencing. 3. Prepare plasmid DNA from E. coli and dissolve the plasmid DNA pellet in dH2O (see Note 5). Measure plasmid DNA concentrations and proceed to either electrotransformation or heat shock transformation.

3.3 Preparing Electrocompetent Cells

1. Inoculate 50 mL of TYGVS medium in a 250-mL flask with 50 μL of a late-log-phase T. denticola culture (see Note 2). Incubate at 37  C in anaerobic chamber (without agitation) until the culture reaches mid-log phase (5  108 cells/mL). 2. Transfer the culture to a sterile 50-mL screw-top centrifuge tube. Centrifuge at 4800  g for 10 min at 4  C. 3. Decant the supernatant and resuspend the cell pellet in 25 mL of cold EPS. Centrifuge at 4800  g for 10 min at 4  C. 4. Repeat step 3 for three more times (a total wash is four times).

Genetic manipulation and Treponema denticola

19

5. Decant the supernatant and resuspend the cell pellet in 500 μL of cold EPS. 6. Aliquot 100 μL of the cell suspension into sterile 1.5-mL Eppendorf tubes prechilled on ice (see Note 6). 7. Proceed to Subheading 3.4 or quickly freeze the cells in liquid nitrogen and store at 80  C. 3.4 Electrotransformation

1. Cool electroporation cuvettes (0.2 cm electrode gap) to 4  C (see Note 7). 2. Transfer 10 μL of DNA (approximately 5 μg of DNA) (see Note 5) to the competent cell, mix gently, and incubate on ice for 5 min. 3. Transfer the cell–DNA mixture to a chilled electroporation cuvette. Cap the cuvette and gently tap the cell–DNA mixture to the bottom of the cuvette. Avoid introducing bubbles. Incubate the cuvette on ice for 5 min. 4. Place the cuvette in the pulse generator and deliver a single pulse of 2.5 kV, 25 μF, and 200 Ω producing a time constant of 5–5.8 ms. 5. Immediately (within 1 min) add 1 mL of TYGVS medium (prewarmed to 37  C in anaerobic chamber overnight) without antibiotics. 6. Transfer the mixture to a sterile 15-mL snap cap tube that contains an additional 9 mL of TYGVS medium (prewarmed to 37  C in anaerobic chamber overnight) and incubate (without agitation) at 37  C in anaerobic chamber for 48 h.

3.5 Preparing Chemically Induced Competent Cells

1. Inoculate 50 mL of TYGVS medium in a 250-mL flask with 50 μL of a late-log-phase culture. Incubate at 37  C in anaerobic chamber (without agitation) until the culture reaches mid-log phase (5  108 cells/mL). 2. Transfer the culture to a sterile 50-mL screw-top centrifuge tube. Centrifuge at 4800  g for 10 min at 4  C. 3. Decant the supernatant fraction and resuspend the cell pellet in 25 mL of cold CTS. Centrifuge at 4800  g for 10 min at 4  C. 4. Repeat step 3 for three more times (a total wash is four times). 5. Decant the supernatant and resuspend the cell pellet in 500 μL of cold CTS. 6. Aliquot 100 μL of the cell suspension into sterile 1.5-mL tubes prechilled on ice (see Note 6). 7. Proceed to Subheading 3.6 or quickly freeze the cells in liquid nitrogen and store at 80  C.

20

Kurni Kurniyati and Chunhao Li

3.6 Heat Shock Transformation

1. Transfer 10 μL of DNA (approximately 5 μg) (see Note 5) to the cell suspension, mix gently, and incubate on ice for 10 min. 2. Incubate at 50  C for 1 min and then incubate on ice for 5 min. 3. Add 1 mL of TYGVS medium (prewarmed to 37  C in anaerobic chamber overnight) without antibiotics. 4. Transfer the mixture to a sterile 15-mL snap cap tube that contains an additional 9 mL of TYGVS medium (prewarmed to 37  C in anaerobic chamber overnight) and incubate (without agitation) at 37  C in anaerobic chamber for 48 h.

3.7 Selection of Transformants by Plating

1. Autoclave 3% SeaPlaque low melting temperature agarose and equilibrate at 50  C in water bath. 2. Transfer 22.5 mL of TYGVS medium to a sterile 50-mL screwtop centrifuge tube, equilibrate the medium at 50  C in water bath, and combine with 7.5 mL of 3% low melting temperature agarose and an appropriate antibiotic (see Note 3). 3. Transfer the mixture to two 100-mm petri dishes and allow them to solidify at room temperature. 4. Meanwhile, transfer 12.5 mL of TYGVS medium to a sterile 50-mL screw-top centrifuge tube. Relocate the medium and the dishes into anaerobic chamber to equilibrate overnight. 5. The following day, autoclave 3% SeaPlaque low melting temperature agarose and equilibrate at 50  C in water bath. 6. Equilibrate the transferred medium at 37  C incubator, and combine with 7.5 mL of 3% SeaPlaque low melting temperature agarose, 10 mL of either the electroporated cells or the heat shocked cells, and an appropriate antibiotic. 7. Transfer the mixture to two 100-mm petri dishes from the previous day and allow them to solidify at room temperature. 8. Incubate the plates at 37  C in anaerobic chamber. Colonies will appear in 5–10 days. 9. Pick up antibiotic resistant colonies using sterile micropipettes. Transfer colonies into 1.5 mL of TYGVS medium in the presence of an appropriate antibiotic. Incubate the cultures at 37  C in anaerobic chamber until the culture reaching latelog phase. 10. Transfer 200 μL of the culture into 1.5 mL of TYGVS medium in the presence of an appropriate antibiotic. Incubate the cultures at 37  C in anaerobic chamber until the culture reaching late-log phase. 11. Screen colonies for the targeted deletion by PCR (see Note 8).

Genetic manipulation and Treponema denticola

3.8 Cis-Complementation via Genetic Reconstitution

21

1. Design six primers to amplify two regions flanking the sequence to be complemented (one of which includes the gene to be complemented) and an antibiotic resistance cassette (Fig. 1d). PCR-amplified the downstream flanking region including the gene to be complemented and an antibiotic resistance cassette using primer pairs P1–P2 and P3–P4, respectively, and then fuse the fragments using primers P1 and P4, generating fragment 1. PCR-amplify the downstream flanking region using primers P5 and P6, and then fuse the resulting fragments to fragment 1 by PCR using primers P1 and P6. 2. Clone the obtained PCR product into a cloning vector, generating the complementing construct. Confirm the construct by DNA sequencing. 3. Prepare plasmid DNA from E. coli and resuspend the plasmid pellet in dH2O (see Note 5). Measure the plasmid concentration and proceed to either electrotransformation or heat shock transformation.

3.9 TransComplementation Using a Shuttle Vector ( See Note 9)

1. Search the DNA sequence of a gene to be complemented and the shuttle vector for appropriate restriction enzyme cut sites. 2. Choose a shuttle vector containing a selectable marker different from what was used to generate the deletion mutant. 3. Design two primers to amplify the complementing gene with an appropriate restriction sites at both ends. 4. Clone the complementing gene into a shuttle vector. Confirm the complementing construct by DNA sequencing. 5. Prepare plasmid DNA from E. coli and suspend the plasmid pellet in dH2O (see Note 5). Measure the plasmid concentration and proceed to either electrotransformation or heat shock transformation.

4

Notes 1. T. denticola ATCC 35405 and ATCC33520 are two most commonly used lab strains. The genome of ATCC 35405 was sequenced [18]. 2. Other media are also available; however, TYGVS medium is relatively easy to be prepared and promotes better growth [17, 19]. T. denticola is anaerobic and unable to withstand exposure of oxygen for a long period of time. While working with T. denticola outside anaerobic chamber, we suggest to work as fast as possible to limit oxygen exposure and aseptically. All the media and plates have to be equilibrated in an anaerobic chamber for at least 24 h to remove oxygen in the medium and agar plates.

22

Kurni Kurniyati and Chunhao Li

3. The original antibiotic for genetic manipulation is erythromycin cassette, which contains both ermF and ermAM (ermB) [6, 10]. This cassette has been widely in T. denticola and other oral pathogens as well. Other selection markers include gentamicin, kanamycin, chloramphenicol, and coumermycin A1 [9, 11, 13, 15]. Chloramphenicol and coumermycin are the least used due to higher rate of spontaneous mutations. The final concentrations of antibiotics used in T. denticola is as follow: 50 μg/mL erythromycin, 20 μg/mL gentamicin, 25 μg/mL kanamycin, 10 μg/mL chloramphenicol, and 10 μg/mL coumermycin A1. 4. We typically make deletion or complementation constructs by using two-step PCR [20]. Our approach of generating mutant is to replace the entire open reading frame (ORF) with an antibiotic resistance cassette to avoid truncated gene products to be expressed and potential polar effect on the downstream genes [14]. 5. DNA is resuspended in dH2O to reduce the interference of salt contaminants in the electroporation process. High salt concentration in DNA solution might cause electrical discharge, which will kill bacterial cells. We are able to obtain transformants with circular DNA, linearized DNA, and PCR products. However, the transformation efficiency using different types of DNA has yet to be assessed. 6. Competent cells can be stored at 80  C for a long time. Freezing cells only slightly decreases transformation efficiency. Frozen competent cells can be thaw on ice for 10 min and proceed with either electroporation or heat shock step. 7. The originally used protocol for T. denticola transformation is to use 0.1 cm electrode gap cuvette with a pulse generator set to 1.8 kV, 25 μF, and 200 Ω [7]. We discovered that using 0.2 cm electrode gap increases transformation efficiency (Unpublished data). 8. Characterizations of transformants by PCR. We typically use six primers including two primers outside the flanking regions, two primers for targeted gene, and two primers for the antibiotic resistance cassette. PCR analysis is performed with the combination of primers outside the flanking regions and either gene of interest or the antibiotic resistance cassette. Characterization of transformants for counterselectable knockout mutants is performed according to the previous publication [14]. 9. Several shuttle vectors have been successfully transformed into ATCC 33520 including pKT210 (confers chloramphenicol resistance and highly unstable), pKMR4PE (confers erythromycin resistance), pKMCou (confers chloramphenicol

Genetic manipulation and Treponema denticola

23

resistance), and pBFC (confers chloramphenicol resistance) [7, 11, 12, 15, 21]. Compared to ATCC 33520, T. denticola ATCC 35405 is less amenable to those vectors, most likely due to its unique DNA modification systems [21, 22]. References 1. Ellen RP, Galimanas VB (2005) Spirochetes at the forefront of periodontal infections. Periodontol 2000 38:13–32 2. Holt SC, Ebersole JL (2005) Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia: the “red complex”, a prototype polybacterial pathogenic consortium in periodontitis. Periodontol 2000 38:72–122 3. Darveau RP (2010) Periodontitis: a polymicrobial disruption of host homeostasis. Nat Rev Microbiol 8:481–490 4. Dashper SG, Seers CA, Tan KH et al (2011) Virulence factors of the oral spirochete Treponema denticola. J Dent Res 90:691–703 5. Fenno JC, McBride BC (1998) Virulence factors of oral treponemes. Anaerobe 4:1–17 6. Li H, Ruby J, Charon N et al (1996) Gene inactivation in the oral spirochete Treponema denticola: construction of an flgE mutant. J Bacteriol 178:3664–3667 7. Li H, Kuramitsu HK (1996) Development of a gene transfer system in Treponema denticola by electroporation. Oral Microbiol Immunol 11:161–165 8. Yang Y, Stewart PE, Shi X et al (2008) Development of a transposon mutagenesis system in the oral spirochete Treponema denticola. Appl Environ Microbiol 74:6461–6464 9. Li Y, Ruby J, Wu H (2015) Kanamycin resistance cassette for the genetic manipulation of Treponema denticola. Appl Environ Microbiol 13:4329–4338 10. Goetting-Minesky MP, Fenno JC (2010) A simplified erythromycin resistance cassette for Treponema denticola mutagenesis. J Microbiol Methods 83:66–68 11. Chi B, Limberger RJ, Kuramitsu HK (2002) Complementation of a Treponema denticola flgE mutant with a novel coumermycin A1-resistant T. denticola shuttle vector system. Infect Immun 70:2233–2237 12. Chi B, Chauhan S, Kuramitsu H (1999) Development of a system for expressing heterologous genes in the oral spirochete Treponema denticola and its use in expression of the Treponema pallidum flaA gene. Infect Immun 67:3653–3656

13. Bian J, Fenno JC, Li C (2012) Development of a modified gentamicin resistance cassette for genetic manipulation of the oral spirochete Treponema denticola. Appl Environ Microbiol 78:2059–2062 14. Kurniyati K, Li C (2016) pyrF as a counterselectable marker for unmarked genetic manipulations in Treponema denticola. Appl Environ Microbiol 82:1346–1352 15. Slivienski-Gebhardt LL, Izard J, Samsonoff WA et al (2004) Development of a novel chloramphenicol resistance expression plasmid used for genetic complementation of a fliG deletion mutant in Treponema denticola. Infect Immun 72:5493–5497 16. Asif A, Mohsin H, Tanvir R et al (2017) Revisiting the mechanisms involved in calcium chloride induced bacterial transformation. Front Microbiol 8:2169 17. Ohta K, Makinen KK, Loesche WJ (1986) Purification and characterization of an enzyme produced by Treponema denticola capable of hydrolyzing synthetic trypsin substrates. Infect Immun 53:213–220 18. Seshadri R, Myers GS, Tettelin H et al (2004) Comparison of the genome of the oral pathogen Treponema denticola with other spirochete genomes. Proc Natl Acad Sci U S A 101:5646–5651 19. Orth R, O’Brien-Simpson N, Dashper S et al (2010) An efficient method for enumerating oral spirochetes using flow cytometry. J Microbiol Methods 80:123–128 20. Cha-Aim K, Hoshida H, Fukunaga T et al (2012) Fusion PCR via novel overlap sequences. Methods Mol Biol 852:97–110 21. Godovikova V, Goetting-Minesky MP, Shin JM et al (2015) A modified shuttle plasmid facilitates expression of a flavin mononucleotide-based fluorescent protein in Treponema denticola ATCC 35405. Appl Environ Microbiol 81:6496–6504 22. Bian J, Li C (2011) Disruption of a type II endonuclease (TDE0911) enables Treponema denticola ATCC 35405 to accept an unmethylated shuttle vector. Appl Environ Microbiol 77:4573–4578

Chapter 3 Construction of a Gene-Deletion Mutant in Tannerella forsythia Keiji Nagano and Yoshiaki Hasegawa Abstract Tannerella forsythia, a gram-negative anaerobic bacterium, is one of the most important pathogens in periodontal disease. However, it has been difficult to construct a gene-deletion mutant in this organism, which may serve as a useful tool in microbiological research. We reported a highly efficient method to construct a gene-deletion mutant of T. forsythia in 2007, and it was accomplished by preparing competent cells from a colony grown on an agar medium instead of a broth culture. Here, we describe the same method with some improvements. Key words Tannerella forsythia, Mutant, Electroporation, Colony, Agar medium

1

Introduction In 1979, Tanner et al. reported the presence of slow-growing, fusiform-shaped, gram-negative, anaerobic bacteria of the genus Bacteroides, which were predominantly isolated from subgingival plaque in periodontitis sites [1]. They designated the organism as Bacteroides forsythus in 1986 [2]; however, it is now called Tannerella forsythia [3], which is a member of the red complex bacteria in periodontal pathogens [4]. Although this bacterium shows slow growth even in a rich medium supplemented with animal blood, it has been observed that the addition of N-acetylmuramic acid (NAM), a component of the bacterial cell wall, improves their growth rates [5]. A gene-deletion mutant is a useful tool in microbiological research. However, it has been difficult to construct such a mutant in T. forsythia. In 2001, Honma et al. was the first to report the construction of a mutant in T. forsythia through the triparental mating procedure with a suicide vector [6]. However, to the best of our knowledge, no further studies have reported the use of this method. In 2007, Honma et al. again published a research paper describing the construction of a mutant in T. forsythia through

Keiji Nagano and Yoshiaki Hasegawa (eds.), Periodontal Pathogens: Methods and Protocols, Methods in Molecular Biology, vol. 2210, https://doi.org/10.1007/978-1-0716-0939-2_3, © Springer Science+Business Media, LLC, part of Springer Nature 2021

25

26

Keiji Nagano and Yoshiaki Hasegawa

allelic gene recombination by electroporation method [7]. Furthermore, the authors published additional studies by constructing a mutant with the same method [8, 9]. Notably, they prepared the competent cells from a broth culture at an early logarithmic phase. At around the same time in 2007, we also reported a method for the construction of a gene-deletion mutant in T. forsythia [10]. A mutant with high efficiency was successfully produced by preparing competent cells from a colony grown on an agarsolidified medium. However, we could not obtain any mutants by using competent cells from a broth culture in our previous study. In addition, other research groups suggested that the construction efficiency for preparing competent cells from a broth culture was very low, although a couple of transformants could be obtained (personal communication). Therefore, we believe that the colony cells have a higher competence potential for transformation through allelic gene recombination. Here, we describe our previously published method with some improvements [10].

2 2.1

Materials Bacterial Culture

1. Bacterial strain: T. forsythia ATCC 43037, a type strain in American Type Culture Collection. 2. Brucella HK Agar (Kyokuto Pharmaceutical Industrial Co., Ltd.): (formula per liter of water) 10.0 g of peptic digest of animal tissue, 10.0 g of pancreatic digest of casein, 5.0 g of yeast extract, 1.0 g of glucose, 0.1 g of sodium bisulfite, 5.0 g of sodium chloride, 0.01 g of hemin, 0.01 g of vitamin K, 1.0 g of sodium pyruvate, 1.0 g of arginine, 0.3 g of cysteine hydrochloride, 15.0 g of agar, pH 7.0  0.2 (see Note 1). 3. Blood (sheep or rabbit), defibrinated, sterile: Transfer an aliquot aseptically into a sterile tube. Store at 20  C. 4. Stock solution of NAM: Dissolve 100 mg of NAM in 10 mL of distilled water (10 mg/mL) and sterilize it by filtration. Store the aliquots at 20  C. 5. Stock solution of erythromycin and chloramphenicol: Dissolve 100 mg of each antibiotic in 10 mL of ethanol. Store at 20  C. 6. Anaerobic incubator: A general anaerobic incubator is used. Periodically inject a mixture of gases comprising 80% N2, 10% H2, and 10% CO2 into a hermetically sealed incubator. In addition, place a catalyst that consumes residual O2 by reacting with H2 in the incubator (see Note 2).

Mutant Construction in T. forsythia

2.2 Inactivation of the Target Gene

27

1. Wash buffer—glycerol (10% (w/v)): Dissolve 10 g of glycerol in 80 mL of distilled water. Make up the volume to 100 mL with distilled water. Sterilize it by autoclaving. Store at 4  C. 2. pVA2198 plasmid: It harbors an erythromycin-resistance gene (ermF), which contains a promoter functioning in genus Bacteroides [11]. 3. pACYC184 plasmid: a popular plasmid for cloning that carries chloramphenicol-resistance gene (cat). 4. Polymerase chain reaction (PCR) reagent: A high-fidelity DNA polymerase, available for long amplicons (see Note 3). 5. Electroporation (see Note 4).

3

Methods

3.1 Blood Agar Medium with NAM

1. Add the prescribed amount of Brucella HK Agar powder to distilled water in a bottle. 2. Autoclave it at 115  C (see Note 5). 3. Thaw and warm the blood at 37  C when the medium is being autoclaved. 4. After autoclaving, mix the medium gently to dispense the components in the bottle uniformly. 5. Cool the medium and warm in a water bath at 52  C. 6. After incubating the medium in the water bath, add one-thousandth part of 10 mg/mL of NAM to the medium (10 μg/mL of NAM as final concentration). 7. Add antibiotics to the medium when needed (see below for details). 8. Add blood to the medium (5% blood as final concentration), and immediately mix well but gently. 9. Pour the medium into petri dish plates. 10. Solidify the medium by leaving the plate at room temperature and let the surface dry for a while. 11. The agar plates are sealed in a plastic bag and stored (see Note 6).

3.2 Preparation of Electrocompetent Cells of T. forsythia

1. Streak T. forsythia cells (parental strain, usually wild type) on the NAM-containing blood agar (without antibiotics). 2. Cultivate at 37  C under anaerobic conditions for a week (subculture). 3. Select a single colony and spread it on another NAM-containing blood agar (without antibiotics) using a sterile swab (see Note 7).

28

Keiji Nagano and Yoshiaki Hasegawa

4. Cultivate at 37  C under anaerobic conditions for 5 days. 5. Collect and suspend the bacterial cells in 30 mL of 10% chilled glycerol in a 50-mL sterile tube using a sterile swab. 6. Centrifuge at 4000  g for 20 min at 4  C. 7. Discard the supernatant. 8. Spin down the cells at 4000  g for 2 min at 4  C. 9. Remove the residual supernatant with a pipette. 10. Add 20 mL of 10% chilled glycerol (do not suspend). 11. Centrifuge at 4000  g for 10 min at 4  C. 12. Discard the supernatant. 13. Spin down the cells at 4000  g for 2 min at 4  C. 14. Remove the residual supernatant with a pipette. 15. Gently suspend in 0.1–1 mL of 10% chilled glycerol (see Note 8). 16. Measure the turbidity of the bacterial suspension at a wavelength of 600 nm (OD600) with a spectrophotometer. 17. Adjust the bacterial concentration to 10 at OD600. 18. Store aliquots (100 μL/tube) at 3.3 Preparation of DNA Construct for Allelic Exchange Mutagenesis

80  C (see Note 9).

We have only briefly described a preparation method of the DNA construct for allelic exchange mutagenesis because various methods are already known. 1. The most commonly used selectable marker conferring antibiotic resistance in T. forsythia is the ermF gene [11]. The gene contains a promoter functioning in the genus Bacteroides. We have also used the cat gene [10]. However, the cat gene does not contain a promoter functioning in T. forsythia; hence, this gene has to be appended with any functional promoter in T. forsythia (see Note 10). 2. The antibiotic-resistant genes are inserted inside the target gene to inactivate the target gene (Fig. 1). We usually prepare the DNA construct such that the antibiotic-resistant gene is flanked by 500 to 1000 bp of DNA fragments that are immediately upstream and downstream of the target gene using the overlap PCR method to delete the target gene completely [12]. 3. It is possible to construct a gene-deletion mutant by directly introducing the PCR product of the DNA construct into T. forsythia. However, we usually clone the DNA construct into a plasmid vector and Escherichia coli strain. After cloning in E. coli, we sequence the DNA construct to confirm that there are no errors introduced during PCR amplification. Next, the

Mutant Construction in T. forsythia

29

T. forsythia cell Chromosome

Primer

Target gene

Primer Upper region (> 500 bp)

Antibiotic-resistance gene

Lower region (> 500 bp)

DNA construct

Fig. 1 Schematic diagram of the construction of a gene-deletion mutant in T. forsythia. The target gene is to be replaced with an antibiotic-resistance gene by allelic exchange mutagenesis. The antibiotic-resistance gene is flanked by DNA fragments homologous to the upstream and downstream regions of the target gene. More than 500-bp DNA fragments should be cloned for efficient recombination. A primer set, annealing outside the DNA construct and inside the antibiotic-resistant gene, is used for confirmation of the gene replacement. White, shaded, and two small arrows indicate the target gene in T. forsythia chromosome, antibiotic-resistance gene, and primers for confirmation of transformation, respectively

plasmid is linearized by digestion with restriction enzymes that do not cleave within the DNA construct, and introduced into the electro-competent cells of T. forsythia (see Note 11). 3.4

Transformation

1. Thaw 100 μL of electrocompetent cells of T. forsythia and 50 μL of DNA construct (1 μg) on ice. 2. Add both to an electroporation cuvette with 0.2-cm gap width. 3. Mix once quickly by inverting the cuvette. 4. Pulse once at 2.5 kV (see Note 12). 5. Transfer the pulsed sample onto NAM-containing blood agar plate (without antibiotics). 6. Incubate the plate at 37  C under anaerobic conditions for 1–3 days (see Note 13). 7. Collect the bacterial cells with a sterile swab and spread them on the NAM-containing blood agar plate supplemented with different concentrations of antibiotics (see Note 14). 8. Cultivate the plates at 37  C under anaerobic conditions for 5–7 days. 9. Restreak single colonies on the NAM-containing blood agar plates supplemented with antibiotics (see Note 15).

30

Keiji Nagano and Yoshiaki Hasegawa

10. Confirm the gene replacement by PCR with a primer set that anneals outside the DNA construct (e.g., further upstream of the DNA construct) and inside the antibiotic-resistance gene (Fig. 1).

4

Notes 1. Brucella agar medium is used as a general medium for anaerobic bacteria [13]. Brucella HK Agar is based on the brucella medium and presupplemented with hemin and vitamin K. 2. In addition to an anaerobic incubator, Anoxomat (Advanced Instruments, Norwood, MA, USA) and AnaeroPack (Mitsubishi Gas Chemical Company, Inc.) are also used for anaerobic culture in our laboratory. 3. We usually use the PrimeSTAR DNA polymerase kit series of Takara or the KOD kit series of Toyobo Co., Ltd. as they are high-fidelity polymerases. 4. We use the electroporation apparatus and cuvette (0.2-cm gap width) provided by Bio-Rad Laboratories. 5. We autoclave 200 mL of medium for 20 min. 6. The agar plates in a plastic bag can be stored at 4  C for a month. 7. We would recommend preincubating this plate under anaerobic conditions for a couple of days. 8. Maintain the bacterial suspension at 4  C or place it on ice. 9. The efficiency of transformation is likely to be higher when the competent cells are immediately used without freezing. This may be attempted if there is a difficultly in creating the mutant. 10. When designing the DNA construct that expresses the cat gene, depending on the promoter of the target gene, there seems to be no polar effect on the downstream genes of the cat gene after it replaces the target gene [14, 15]. 11. The linearization of plasmid circumvents the rest of the target genes after the DNA construct is integrated into the bacterial chromosomal DNA. 12. We use the program name “Ec2” of MicroPulser Electroporator (Bio-Rad). 13. We incubate the plate only till a slight bacterial growth is observed on the plate. During this incubation, the selectable marker gene is integrated into the chromosome, and the enzyme that inactivates the antibiotics is induced.

Mutant Construction in T. forsythia

31

14. Since it is not possible to determine the likelihood of an increase in the antibiotic resistance of the transformants, it is recommended to prepare some agar plates containing various concentrations of antibiotics. For example, we prepare the NAM-containing blood agar medium by supplementing with 0 (as a control), 2, 4, 8, and 10 μg/mL of erythromycin or chloramphenicol. 15. This procedure is performed to exclude the contamination of nontransformants.

Acknowledgments We would like to thank Editage (www.editage.com) for English language editing. References 1. Tanner ACR, Haffer C, Bratthall GT et al (1979) A study of the bacteria associated with advancing periodontitis in man. J Clin Periodontol 6(5):278–307 2. Tanner ACR, Listgarten MA, Ebersole JL et al (1986) Bacteroides forsythus sp. nov. , a slowgrowing, fusiform Bacteroides sp. from the human oral cavity. Int J Syst Evol Microbiol 36(2):213–221 3. Maiden MF, Cohee P, Tanner AC (2003) Proposal to conserve the adjectival form of the specific epithet in the reclassification of Bacteroides forsythus Tanner et al. 1986 to the genus Tannerella Sakamoto et al. 2002 as Tannerella forsythia corrig., gen. nov., comb. nov. Request for an opinion. Int J Syst Evol Microbiol 53 (Pt 6):2111–2112 4. Socransky SS, Haffajee AD (2005) Periodontal microbial ecology. Periodontol 2000 38:135–187 5. Wyss C (1989) Dependence of proliferation of Bacteroides forsythus on exogenous N-acetylmuramic acid. Infect Immun 57 (6):1757–1759 6. Honma K, Kuramitsu HK, Genco RJ et al (2001) Development of a gene inactivation system for Bacteroides forsythus: construction and characterization of a BspA mutant. Infect Immun 69(7):4686–4690 7. Honma K, Inagaki S, Okuda K et al (2007) Role of a Tannerella forsythia exopolysaccharide synthesis operon in biofilm development. Microb Pathog 42(4):156–166

8. Honma K, Mishima E, Inagaki S et al (2009) The OxyR homologue in Tannerella forsythia regulates expression of oxidative stress responses and biofilm formation. Microbiology 155(Pt 6):1912–1922 9. Honma K, Mishima E, Sharma A (2011) Role of Tannerella forsythia NanH sialidase in epithelial cell attachment. Infect Immun 79 (1):393–401 10. Sakakibara J, Nagano K, Murakami Y et al (2007) Loss of adherence ability to human gingival epithelial cells in S-layer protein-deficient mutants of Tannerella forsythensis. Microbiology 153(Pt 3):866–876 11. Fletcher HM, Schenkein HA, Morgan RM et al (1995) Virulence of a Porphyromonas gingivalis W83 mutant defective in the prtH gene. Infect Immun 63(4):1521–1528 12. Horton RM, Ho SN, Pullen JK et al (1993) Gene splicing by overlap extension. Methods Enzymol 217:270–279 13. Murray PR, Baron EJ, American Society for Microbiology (2003) Manual of clinical microbiology, 8th edn. ASM Press, Washington, DC 14. Nagano K, Read EK, Murakami Y et al (2005) Trimeric structure of major outer membrane proteins homologous to OmpA in Porphyromonas gingivalis. J Bacteriol 187(3):902–911 15. Komatsu T, Nagano K, Sugiura S et al (2012) E-selectin mediates Porphyromonas gingivalis adherence to human endothelial cells. Infect Immun 80(7):2570–2576

Chapter 4 Construction of a Mutant in Prevotella melaninogenica Using the Conjugation Transfer Method with Escherichia coli Yoshio Kondo Abstract Prevotella melaninogenica is a bacterium that is resident in the oral cavity and upper respiratory tract and is associated with periodontal disease and aspiration pneumonia. Prevotella mutants are difficult to produce and only few reports have been reported. We examined several methods and many strains and succeeded in producing mutants in Prevotella melaninogenica GAI 07411. In this chapter, we will describe how to create a mutation of a target gene by carrying out conjugation transfer using Escherichia coli S17-1 as a donor and introducing a plasmid into P. melaninogenica. Key words Prevotella melaninogenica, Gene mutation, Transconjugation, Escherichia coli, Bacteroidetes phylum

1

Introduction It has recently been recognized that oral biofilms cause not only caries and periodontal disease but also systemic diseases such as aspiration pneumonia [1, 2]. Prevotella bacteria are commonly detected in patients with aspiration pneumonia and are often refractory because they are resistant to antibacterial agents as a result of lactamase productivity and biofilm formation [3–5]. Prevotella melaninogenica is a black-pigment–producing anaerobic gramnegative bacillus of the Bacteroidetes phylum. P. melaninogenica is a member of normal human oral flora and can be grown from the tongue, gingival crevices, saliva and plaque of healthy individuals [6–9]. It is considered a potential pathogen [10–13] because it is commonly cultured as the sole infectious agent in extraoral abscesses that occur in spondylitis, osteomyelitis, and pyomyositis, and in peritoneal abscesses and vaginal mesh infections [14– 17]. P. melaninogenica is also frequently cultured in the context of polymicrobial diseases including brain abscesses,

Keiji Nagano and Yoshiaki Hasegawa (eds.), Periodontal Pathogens: Methods and Protocols, Methods in Molecular Biology, vol. 2210, https://doi.org/10.1007/978-1-0716-0939-2_4, © Springer Science+Business Media, LLC, part of Springer Nature 2021

33

34

Yoshio Kondo

pleuropulmonary infections, endocarditis, illicit drug injection sites, intra-abdominal infections, wound infections, necrotizing fasciitis, pyogenic infections, decubitus and diabetic ulcers [17– 22]. Stimulation of total cell lysates from P. melaninogenica reportedly stimulates weak cytokine responses (IL-1α, IL-6, and TNF-α in human monocytes and human gingival fibroblasts) via the TLR2 signaling pathway, but not via the TLR4 pathway [23, 24]. Therefore, P. melaninogenica may have TLR2 agonist properties. Another study reported that P. melaninogenica supernatants impaired phagocytosis by polymorphonuclear leukocytes [25]. Despite being associated with a wide variety of infectious diseases and cellular responses, little is known about the contribution of P. melaninogenica to disease progression, perhaps because molecular genetic methods such as mutation of the target gene have not been developed. Genetic and molecular biological analysis of many pathogenic bacteria has played a major role in identifying their virulence factors. The role of various pathogenic factors in the periodontopathic bacterium Porphyromonas gingivalis has been clarified by genetic and molecular biological techniques [26]. The author and coworkers attempted to create a mutant of P. melaninogenica, and succeeded in creating a mutant with one clinical isolate using the conjugation transfer method [27]. Further, the genome sequence of the strain was decoded and registered (DDBJ/EMBL/GenBank database accession numbers; AP018049-51). Bacterial conjugation is a horizontal gene transfer process from donor cells with one or more conjugating plasmids to recipient cells. Most bacterial conjugation plasmids are transferred to distant or even unrelated microorganisms. Transfer of the conjugated plasmid requires close physical contact between the conjugated cells and is usually mediated by a plasmid-encoded protein that provides a transfer (tra) function [28]. Conjugation involves a special type of replication in which plasmid DNA molecules replicate during conjugation, with one copy remaining in the donor cell and another copy transferred to the recipient. In most cases, replication is initiated by creating a single-stranded nick at the transcription origin (oriT) of the plasmid. A single strand of nickless DNA is replicated in the donor cell, and the 50 ends of the nicked DNA are actively transported linearly to the recipient cell through the donor and recipient cell envelopes into the recipient cell. Here, it is replicated and the double-stranded DNA is circularized. The entire process requires many proteins encoded by plasmid genes, including those needed to form mating pairs between donor and recipient [28–32]. In constructing a mutant strain, double recombination occurs between the plasmid introduced into the recipient cell and the chromosome of the recipient cell, resulting in mutation of the target gene. In this chapter, we will describe how to construct a

Gene Mutation of Prevotella melaninogenica

35

mutant strain of P. melaninogenica using E. coli S17-1 as a donor host. Here, we introduce a protocol we used to construct a porK mutant in P. melaninogenica GAI 07411 [27].

2

Materials

2.1 A porK-Deletion Mutant of P. melaninogenica

1. Freeze Throw Buffer (FTB): Dissolve 0.6 g of PIPES (final concentration 10 mM), 0.44 g of CaCl2∙2H2O (final concentration 15 mM), 3.72 g of KCl (final concentration 250 mM) in 190 mL of water. Adjust pH between 6.7 and 6.8 using KOH. After adding 2.18 g of MnCl2∙4H2O (final concentration 55 mM), make up to 200 mL with water. Sterilize by the filter (0.22 μm). 2. Competent cells of E. coli S17-1: Culture E. coli S17-1 (ΔrecA, endA1, hsdR17, supE44, thi-1, tra +) [33] in LB broth. Collect the E. coli S17-1 cells by centrifugation at 1000  g for 10 min at 4  C. Suspend the bacterial pellet in FTB and cenrifuge again. Suspend the cells in FTB, and store aliquots at 80  C. 3. Recipient strain: P. melaninogenica GAI07411 [27] (see Note 1). 4. LB medium: For the selection of ampicillin-resistant E. coli strains, add ampicillin to the molten agar at the concentration of 100 μg/mL. 5. Tryptic soy broth supplemented with 5 mg/mL hemin (TSH): Add about 10 mL of 0.1 M NaOH to a glass bottle. Weigh 50 mg of hemin and transfer to the bottle. Completely dissolve hemin, and make up to 100 mL with water (0.5 mg/mL hemin at final concentration). Sterilize by autoclaving. Dissolve 3.7 g of tryptic soy broth in 100 mL of water and sterilize by autoclaving. After cooling to room temperature, add 1 mL of 0.5 mg/mL hemin to the broth. Store it anaerobically. 6. TSH agar plate: Dissolve 4.0 g of tryptic soy broth agar in 100 mL of water and sterilize by autoclaving. After cooling to 45–50  C, add 1 mL of 0.5 mg/mL hemin to the molten agar. For the selection and maintenance of erythromycin-resistant P. melaninogenica strain, add erythromycin to the molten agar at a concentration of 5 μg/mL. After the solidity of the medium, store it anaerobically. 7. Blood agar plate: Dissolve 4.0 g of tryptic soy broth agar in 100 mL of water and sterilize by autoclaving. After cooling to 45–50  C, add 1 mL of 0.5 mg/mL hemin and 5 mL of rabbit blood to the molten agar. For the selection of P. melaninogenica from the mixture of E. coli and P. melaninogenica, add gentamicin to the molten agar at a concentration of 100 μg/mL. For the selection and

36

Yoshio Kondo

maintenance of erythromycin-resistant P. melaninogenica strain, add erythromycin to the molten agar at a concentration of 5 μg/mL. After the solidity of the medium, store it anaerobically. 8. Anaerobic incubator: consists of 10% CO2, 10% H2, and 80% N 2. 9. Advantage-HF 2 PCR kit (Takara Bio): A high-fidelity PCR kit. 10. pGEM-T Easy (Promega): a cloning plasmid vector which linearized with a single 30 -terminal thymidine at both ends. 11. pBluescript II SK(): a cloning plasmid vector. 12. Restriction enzymes: XhoI, BamHI, and NotI. 13. pTCB: Bacteroides–E. coli shuttle vector, carrying antibiotic resistance gene [34]. 14. MasterPure Complete DNA and RNA Purification Kit (Epicentre): A Genomic DNA purification kit. 2.2 Hemagglutination Test

1. Phosphate-buffered saline (PBS), pH 7.4. 2. Rabbit erythrocyte. 3. Round bottom microtiter plate.

3

Methods

3.1 Construction of a porK-Deletion Mutant of P. melaninogenica 3.1.1 Construction of Suicide Vector Plasmid

1. A 1.0 kb upstream region of porK was amplified by PCR from the chromosomal DNA of P. melaninogenica using AdvantageHF 2 PCR kit. The amplified DNA was then cloned into pGEM-T Easy and digested with XhoI and BamHI. The resulting DNA fragment was then inserted into the XhoI and BamHI sites of pBluescript II SK() to generate pML001 (see Note 2). 2. A 1.0-kb downstream region of porK was amplified from the chromosomal DNA of P. melaninogenica. The amplified DNA was cloned into pGEM-T Easy and digested with BamHI and NotI. The resulting fragment was then inserted into the BamHI and NotI sites of pML001 to generate pML002. 3. The 1.1 kb BamHI ermF DNA cassette was inserted into the BamHI site of pML002, resulting in pML003. 4. pML003 was digested with XhoI and NotI and inserted into the XhoI–NotI site of pTCB plasmid, resulting in pML004 (Fig. 1).

3.1.2 Introduce the Suicide Vector Plasmid into E. coli

1. Mix 1–5 μl of pML004 (usually 10 pg–100 ng) into 20–50 μL of competent E. coli S17-1 in a tube. 2. Incubate the mixture of competent E. coli S17-1 and the plasmid on ice for 20–30 min.

Gene Mutation of Prevotella melaninogenica

(a)

37

Prevotella melaninogenica GAI 07411 chromosomal DNA

porK

upstream of porK (1.0 kb)

downstream of porK (1.0 kb)

(b) Ampr

XhoI

pML004

BamHI BamHI

NotI

tetQ

upstream of porK (1.0 kb) ermF downstream of porK (1.0 kb)

Fig. 1 Construction of suicide plasmid vector. (a) The upstream and downstream 1.0 kb of the porK gene is amplified by PCR, and each is inserted into a T-vector, respectively. (b) The DNA fragment of 1.0 kb upstream of porK-erythromycin resistance cassette-1.0 kb downstream of porK is inserted into the Bacteroides-E. coli shuttle vector

3. Heat shock the mixture by placing the bottom half to two-thirds of the tube into a 42  C water bath for 30–60 s. 4. Put the tubes back on ice for 2 min. 5. Add 250–1000 μL of LB medium (without antibiotic) to the bacteria and grow in 37  C shaking incubator for 45 min. 6. Plate some or all of the culture onto an LB agar plate containing 100 μg/mL ampicillin. 7. Incubate plates at 37  C overnight. 3.1.3 Conjugative Transfer

1. Culture E. coli S17-1 retaining the plasmid in 3 mL of LB medium containing 100 μg/mL ampicillin for 12 h. Culture 200 μL of this solution in 20 mL of fresh LB medium without antibiotics for 3 h. 2. Culture P. melaninogenica GAI07411 in 2 mL of TSH broth for 12 h in anaerobic incubator, then add 10 mL of fresh TSH broth to the culture, and culture anaerobically for 3 h. 3. Mix the cultures of plasmid-retained E. coli S17-1 and the P. melaninogenica. 4. Centrifuge the mixture at 1000  g for 10 min.

38

Yoshio Kondo

hypothetical

porK

porL

porM

porN

wild type Primer set A (partial porK)

ΔporK

ermF Primer set B (ermF) Primer set C (hypothetical-ermF)

Fig. 2 Chromosomal structure at the porK locus of the porK deletion mutant. The deletion of the porK gene was occurred by the replacement of the porK gene with erythromycin (ermF) cassette. The regions amplified to confirm the deletion of porK are shown

5. Spot the concentrated mixture on TSH agar plate, culture at 37  C for 15 min under aerobic conditions, and then coculture for 12 h under anaerobic conditions (see Note 3). 6. Suspend the bacteria in the TSH medium, and seed on blood agar medium containing 100 μg/mL gentamicin and 5 μg/mL erythromycin. 7. Culture for 5–8 days under anaerobic conditions to form bacterial colonies. 3.1.4 Confirm that the Target Gene Has Been Replaced with ermF

1. Subculture the colonies grown onto TSH agar plates containing 5 μg/mL erythromycin and culture them anaerobically for 5–8 days. 2. Purified the genome from the bacterial isolates using MasterPure Complete DNA and RNA Purification Kit. 3. Perform the PCR using the purified genome as a template to confirm the mutation. See the Fig. 2 for primer design.

3.2 Hemagglutination Test

The porK mutant forms white colonies on blood agar. Therefore, a hemagglutination test was performed. The method is introduced below. 1. Culture P. melaninogenica in TSH medium anaerobically overnight. 2. Centrifuge the P. melaninogenica cells at 1000  g for 10 min, wash them with PBS, and resuspend them to OD550 of 0.4 with PBS. 3. Dilute the bacterial suspensions in a twofold series with PBS. 4. Mix a 100-μl aliquot of each suspension with an equal volume of rabbit erythrocyte suspension (1.0–2.0% in PBS) (see Note 4). 5. Incubate in a round bottom microtiter plate at room temperature for 3 h (Fig. 3).

Gene Mutation of Prevotella melaninogenica

Dilution rate of bacterial solution

20

21

22

23

24

25

26

39

27

ΔporK

WT

Fig. 3 Hemagglutination test. P. melaninogenica cells were grown in TSH broth, washed with PBS, and resuspended in PBS at an OD550 of 0.4. The suspension and its dilutions in a twofold series were applied to the wells of a microtiter plate and mixed with 2.0% rabbit erythrocyte suspension. When hemagglutination occurred, red blood cells did not settle and spread throughout the wells, whereas when hemagglutination did not occur, sedimented red blood cells became small spots

4

Notes 1. We acquired P. melaninogenica ATCC 25845 and clinical isolates from the Division of Anaerobic Research, Life Science Research Center, Gifu University (GAI 96524, GAI 00278, GAI 00319, GAI 07400, GAI 07402, GAI 07404, GAI 07406, GAI 07408, and GAI 07410). We used these to try to make a gene mutant in the same way, but this was unsuccessful. The gene mutant could only be obtained with GAI 07411. We believe that the exogenous DNA-exclusion mechanism of the recipient strain affected the mutant construction. The basis for this is that GAI 07411 does not have many genes related to restriction modification systems. Additionally, GAI07411 has a foreign plasmid. This indicates that GAI 07411 is tolerant to foreign DNA [27]. 2. Homologous recombination requires the insertion of 1000 bp of upstream and downstream regions of the target gene into the target plasmid. 3. Transfer of plasmids between bacteria by conjugative transfer requires cell contact and DNA metabolism between donor and recipient cells. When E. coli and P. melaninogenica are cocultured on an agar plate, the bacterial pellet forms a spot in one place instead of seeding. 4. Rabbit blood was used to confirm black pigment production on blood agar. There are other strains that do not produce a black pigment in animal blood. We also recommend using rabbit blood for the hemagglutination test.

40

Yoshio Kondo

References 1. Haffajee AD, Socransky SS, Patel MR et al (2008) Microbial complexes in supragingival plaque. Oral Microbiol Immunol 23:196–205 2. Kuriyama T, Karasawa T, Nakagawa K et al (2000) Bacteriologic features and antimicrobial susceptibility in isolates from orofacial odontogenic infections. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 90:600–608 3. Behra-Miellet J, Calvet L, Mory F et al (2003) Antibiotic resistance among anaerobic Gramnegative bacilli: lessons from a French multicentric survey. Anaerobe 9:105–111 4. Hecht DW (2006) Anaerobes: antibiotic resistance, clinical significance, and the role of susceptibility testing. Anaerobe 12:115–121 5. Wybo I, Pie´rard D, Verschraegen I et al (2007) Third Belgian multicentre survey of antibiotic susceptibility of anaerobic bacteria. J Antimicrob Chemother 59:132–139 6. Duerden BI (1980) The isolation and identification of Bacteroides spp. from the normal human gingival flora. J Med Microbiol 13:89–101 7. Bik EM, Long CD, Armitage GC et al (2010) Bacterial diversity in the oral cavity of 10 healthy individuals. ISME J 4:962–974 8. Papaioannou W, Gizani S, Haffajee AD et al (2009) The microbiota on different oral surfaces in healthy children. Oral Microbiol Immunol 24:183–189 9. Ko¨no¨nen E (1993) Pigmented Prevotella species in the periodontally healthy oral cavity. FEMS Immunol Med Microbiol 6:201–205 10. Ogrendik M, Kokino S, Ozdemir F et al (2005) Serum antibodies to oral anaerobic bacteria in patients with rheumatoid arthritis. MedGenMed 7:2 11. Rogers GB, Carroll MP, Serisier DJ et al (2004) Characterization of bacterial community diversity in cystic fibrosis lung infections by use of 16s ribosomal DNA terminal restriction fragment length polymorphism profiling. J Clin Microbiol 42:5176–5183 12. Robert R, Grollier G, Frat JP et al (2003) Colonization of lower respiratory tract with anaerobic bacteria in mechanically ventilated patients. Intensive Care Med 29:1062–1068 13. Falagas ME, Siakavellas E (2000) Bacteroides, Prevotella, and Porphyromonas species: a review of antibiotic resistance and therapeutic options. Int J Antimicrob Agents 15:1–9 14. Mukhopadhyay S, Rose F, Frechette V (2005) Vertebral osteomyelitis caused by Prevotella (Bacteroides) melaninogenicus. South Med J 98:226–228

15. Bowler PG, Duerden BI, Armstrong DG (2001) Wound microbiology and associated approaches to wound management. Clin Microbiol Rev 14:244–269 16. Odeh M, Oliven A, Potasman I et al (2000) Pyomyositis of the thigh due to Prevotella melaninogenica. Infection 28:49–50 17. Jousimies-Somer H, Savolainen S, M€akitie A et al (1993) Bacteriologic findings in peritonsillar abscesses in young adults. Clin Infect Dis 16(Suppl 4):S292–S298 18. Hsiao WW, Li KL, Liu Z et al (2012) Microbial transformation from normal oral microbiota to acute endodontic infections. BMC Genomics 13:345 19. Talan DA, Abrahamian FM, Moran GJ et al (2003) Clinical presentation and bacteriologic analysis of infected human bites in patients presenting to emergency departments. Clin Infect Dis 37:1481–1489 20. De A, Varaiya A, Mathur M (2002) Anaerobes in pleuropulmonary infections. Indian J Med Microbiol 20:150–152 21. Brook I (1995) Prevotella and Porphyromonas infections in children. J Med Microbiol 42:340–347 22. Sibley CD, Grinwis ME, Field TR et al (2011) Culture enriched molecular profiling of the cystic fibrosis airway microbiome. PLoS One 6:e22702 23. Rossano F, Rizzo A, Sanges MR et al (1993) Human monocytes and gingival fibroblasts release tumor necrosis factor-alpha, interleukin-1 alpha and interleukin-6 in response to particulate and soluble fractions of Prevotella melaninogenica and Fusobacterium nucleatum. Int J Clin Lab Res 23:165–168 24. Ahmed N, Hayashi T, Hasegawa A et al (2010) Suppression of human immunodeficiency virus type 1 replication in macrophages by commensal bacteria preferentially stimulating Toll-like receptor 4. J Gen Virol 91:2804–2813 25. Jones GR, Gemmell CG (1982) Impairment by Bacteroides species of opsonisation and phagocytosis of enterobacteria. J Med Microbiol 15:351–361 26. Be´langer M, Rodrigues P, Progulske-Fox A (2007) Genetic manipulation of Porphyromonas gingivalis. Curr Protoc Microbiol. Chapter 13:Unit13C.2 27. Kondo Y, Sato K, Nagano K et al (2018) Involvement of PorK, a component of the type IX secretion system, in Prevotella melaninogenica pathogenicity. Microbiol Immunol 62:554–566

Gene Mutation of Prevotella melaninogenica 28. Errington J, Bath J, Wu LJ (2001) DNA transport in bacteria. Nat Rev Mol Cell Biol 2:538–545 29. Llosa M, de la Cruz F (2005) Bacterial conjugation: a potential tool for genomic engineering. Res Microbiol 156:1–6 30. Sprague GF (1991) Genetic exchange between kingdoms. Curr Opin Genet Dev 1:530–533 31. Grohmann E, Muth G, Espinosa M (2003) Conjugative plasmid transfer in gram-positive bacteria. Microbiol Mol Biol Rev 67:277–301, table of contents 32. Possoz C, Ribard C, Gagnat J et al (2001) The integrative element pSAM2 from

41

Streptomyces: kinetics and mode of conjugal transfer. Mol Microbiol 42:159–166 33. Simon R, Priefer UB, Pu¨hler A (1983) A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram negative bacteria. Bio/Technology 1:784–791 34. Nagano K, Murakami Y, Nishikawa K et al (2007) Characterization of RagA and RagB in Porphyromonas gingivalis: study using genedeletion mutants. J Med Microbiol 56:1536–1548

Chapter 5 Genetic Transformation of Fusobacterium nucleatum Akihiro Yoshida and Akihiko Ikegami Abstract Fusobacterium nucleatum is a human periodontal pathogen that causes opportunistic infections. It has been implicated in preterm birth and has as a pathogen of colorectal cancer. However, it is a common member of the oral microbiota and can have a symbiotic relationship with its hosts. To date, studies of F. nucleatum have been hindered by a lack of effective genetic tools, and the transformation of F. nucleatum has not been investigated. In this chapter, protocols for the transformation of F. nucleatum strain 12230 using sonoporation are presented. We also include a genetic complementation protocol for a F. nucleatum knockout mutant. Key words Fusobacterium nucleatum, Transformation, Sonoporation

1

Introduction Fusobacterium nucleatum is a gram-negative anaerobic oral and gastrointestinal commensal. It is a periodontal pathogen that has been associated with a wide spectrum of human diseases [1–3], and it is implicated in various forms of periodontitis and opportunistic infections. F. nucleatum is highly prevalent in intrauterine infections associated with preterm birth and other adverse pregnancy outcomes [4–7]. Recently, F. nucleatum has been implicated as a cancer-associated microorganism known to influence cancer development and progression, most notably in colorectal cancer [7– 14]. Genomic analysis revealed F. nucleatum enrichment in human colon cancers and adenomas relative to noncancerous colon tissues [15]. These observations have been reported in multiple colorectal cancer cohorts [16]. Thus, this organism is associated with various infectious diseases and colon cancer; however, it is also a common member of the oral microflora. A lack of effective genetic tools has hindered studies of F. nucleatum. Genetic manipulation is difficult, presumably due in part to its diversified restriction endonuclease systems, which differ between strains and cleave DNA irrespective of the extent of

Keiji Nagano and Yoshiaki Hasegawa (eds.), Periodontal Pathogens: Methods and Protocols, Methods in Molecular Biology, vol. 2210, https://doi.org/10.1007/978-1-0716-0939-2_5, © Springer Science+Business Media, LLC, part of Springer Nature 2021

43

44

Akihiro Yoshida and Akihiko Ikegami

methylation [17]. Several mobile genetic elements have been identified, and several shuttle plasmids have been constructed [18–22], but these shuttle plasmids have only produced two strains, F. nucleatum ATCC 10953 and ATCC 23726 [20, 21]. This chapter describes transformation protocols for F. nucleatum. Previous studies failed to employ electroporation and conjugation to F. nucleatum. Han et al. successfully employed sonoporation techniques and constructed a FadA adhesin-null mutant (ΔfadA::ermF–ermAM) using ultrasound (US) [23]. This was the first allelic exchange mutant in F. nucleatum 12230. US is a type of mechanical energy generated in a medium as oscillating pressure in space and time at frequencies above 20 kHz, beyond the audible range. US exposure generates bioeffects resulting in tissue heating, shear stress, and cavitation. Cavitation has been used for the intracellular delivery of drugs and genes. Cavitation can cause drastic local physical and chemical changes, and the generation of free radicals [24, 25]. Cell membranes can be damaged or disrupted locally, allowing for the entry of extracellular agents into the cytoplasm. This process is termed sonoporation. Sonoporation can be classified into two categories: (1) reparable sonoporation, in which temporary pores are induced in the cell membrane and then resealed, leading to cell survival; and (2) irreversible sonoporation, in which the cell membrane is irreversibly damaged or the cell is lysed, leading to cell death. Reparable sonoporation is an emerging technology for intracellular delivery of genes or other agents and has been used in mammalian cells. The use of sonoporation to construct the F. nucleatum mutant was its first application in bacteria [23]. All transformants obtained by sonoporation were double-crossover allelic exchange mutants using an intact suicide plasmid [26]. This was the first study to use double-crossover allelic exchange with an intact suicide plasmid in gram-negative bacteria [26]. In this chapter, we describe the construction of a F. nucleatum fadA double-crossover mutant and complementation of this strain, as one sample of knockout mutant and genetic complementation of this bacteria.

2

Materials Prepare all solutions using distilled water and analytical grade reagents. Prepare and store all reagents at room temperature (unless indicated otherwise).

2.1 Plasmid DNA Construct for Transformation

Oligonucleotide primers are listed in Table 1. Plasmids and bacterial strain used in this study are listed in Table 2. 1. pCR2.1: (Invitrogen) for the cloning vector. 2. pVA2198: containing the ermF–ermAM cassette [27].

Transformation of Fusobacterium nucleatum

45

Table 1 Primers used in this study Primer

Sequencea (50 ! 30 )

Gene targeted

fadA1f

AGGTCAAGAAGCAAAAGG

upfadA

fadA1r

TTTTTGGTACCCTTGCTGCATCAGTTGC

upfadA

fadA2f

TTTTTGGATCCTCAAGCTTTAAGAGCTGG

downfadA

fadA2r

AGGGTTACTTGATTCAGG

downfadA

fadASDF TTTGGATCCTAAATAAATAATTTGGGAGG TAACAAAAATG

The fadA gene with a Shine–Dalgarno sequence

fadASDR TTTGTCGACTTAGTTACCAGCTCTTAAAGC

The fadA gene with a Shine–Dalgarno sequence

fadAfor

TTAGCTGTTTCTGCTTCAGC

fadA

fadArev

TTACCAGCTCTTAAAGCTTG

fadA

erm1F

TGCATACCTTTGTTCCTCGG

ermF-ermAM cassette

erm1R

TTTTTTGGATCCGAAGGACAATGGAACC TCCC

ermF-ermAM cassette

erm2F

TTTTTTGTCGACAAATTGGAACAGG TAAAGGGC

ermF-ermAM cassette

erm2R

CTCATAGAATTATTTCCTCCCG

ermF-ermAM cassette

a

Endonuclease restriction sites are underlined

3. pJIR418: carrying catP, confers thiamphenicol resistance [28]. 4. pYH1378: pCR2.1 carrying ΔfadA::ermF–ermAM and flanking regions of fadA; 7.1 kb [23]. 5. pYH1426: pYH1378 containing sacB; 9.2 kb [23]. 6. pYH1479: carrying the ermF–fadA–ermAM fragment with the SalI site between fadA and ermAM [29]. 7. pYH1480: catP from pJIR418 cloned into the SalI site in pYH1479, carrying thiamphenicol-resistance gene, used for sonoporation to generate a fadA-complementing clone [29]. 8. Restriction enzymes: KpnI, BamHI, SalI, and EcoRV. 9. Ligation kit: Ligase, Ligation buffer. 10. Escherichia coli TOP10: A cloning host strain for plasmid construction. Maintain E. coli TOP10 strain in Luria–Bertani (LB) broth 25 g/L or on LB agar (add 15 g/L agar to LB broth) and incubate at 37
C.

46

Akihiro Yoshida and Akihiko Ikegami

Table 2 Bacterial strains and plasmids used in this study Strains or plasmid

Description

Source or reference

Fusobacterium nucleatum 12230

Oral commensal

[26]

Fusobacterium nucleatum US1

fadA deletion mutant (12230 ΔfadA::ermF–ermAM)

[23]

Fusobacterium nucleatum USF81

fadA complementing strain (12230 US1 ermF–ermAM::fadA-catP)

[29]

Escherichia coli TOP10

Cloning host

Invitrogen

pCR2.1

Cloning vector

Invitrogen

pVA2198

Source of ermF–ermAM cassette

[27]

pJIR418

Carrying catP, confers thiamphenicol resistance

[28]

pYH1378

pCR2.1 carrying ΔfadA::ermF–ermAM and flanking regions of fadA

[23]

pYH1426

pYH1378 containing sacB

[23]

pYH1479

Carrying the ermF–fadA–ermAM fragment with the SalI site between fadA and ermAM

[29]

pYH1480

catP from pJIR418 cloned into the SalI site in pYH1479

[29]

Strains

Plasmids

2.2 Transformation of F. nucleatum 2.2.1 Bacterial Preparation

Bacterial strains used in this study are listed in Table 2. 1. F. nucleatum 12230 (see Note 1). 2. Clindamycin: 0.4 mg/mL stock solution in water. 3. Thiamphenicol: 5 mg/mL stock solution in ethanol. 4. Columbia blood agar: Autoclaved 39 g/L of Columbia blood agar base. Add 5 μg/mL hemin, 1 μg/mL menadione (vitamin K1), and 5% defibrinated sheep blood once it cools to below 60
C. For selective plates, add the appropriate antibiotics (clindamycin or thiamphenicol) (see Note 2). 5. Tryptic soy (TS) broth or brain heart infusion (BHI) broth/ agar plates supplemented with hemin and menadione. 6. Anaerobic chamber: Maintain at 37
C with 5% CO2, 10% H2, and 85% N2. 7. 0.1 M CaCl2: Dissolve 1.47 g of CaCl2∙2H2O in water and make up to 100 mL with water. Store at room temperature.

Transformation of Fusobacterium nucleatum

47

8. 0.1 M MgCl2: Dissolve 2.03 g of MgCl2∙6H2O in water and make up to 100 mL with water. Store at room temperature. 9. 20 stock of phosphate-buffered saline (PBS) pH 7.3: Dissolve 320 g of NaCl, 8 g of KH2PO4, 46 g of Na2HPO4, and 8 g of KCl in distilled H2O. Adjust the pH at pH 7.3 with HCl (or NaOH) and make up to 2 L with distilled H2O (or water). Store at room temperature. 10. Sonoporation buffer: Add 0.1 mL of 0.1 M CaCl2, 0.1 mL of 0.1 M MgCl2, and 5 mL of 20 PBS in 20 mL of water. After mixing, make up to 100 mL. Sterilize by autoclaving. Store at room temperature. 2.2.2 Sonoporation

1. Definity contrast agent: Ultrasound contrast agent consisting of octafluoropropane gas bubbles encapsulated in a lipid and dispersed solution. 2. Nunc eight-well immunomodule (0.4-ml wells). 3. US transducer: a regular planar piezoelectric lead–zirconate– titanate US transducer with a circular aperture 5.1 cm in diameter (center frequency of 0.96 MHz). 4. Use a signal generator (33250A; Agilent Technologies). 5. 75 W power amplifier (75A250; Amplifier Research). 6. Calibrated hydrophone Acoustics).

system

(HPM04/1;

Precision

7. US power meter (UPM-DT-10; Ohmic Instrument Co). 8. Perflutren lipid microsphere (Bristol-Myers Squibb).

3

Methods

3.1 Construction of a fadA-Deletion Mutant in F. nucleatum 3.1.1 DNA Construct

1. To construct plasmids pYH1378 and pYH1426, amplify a 526-bp fragment, “upfadA,” and a 510-bp fragment, “downfadA,” corresponding to the upstream and downstream regions flanking the fadA gene, respectively, using the following primer sets: fadA1f–fadA1r and fadA2f–fadA2r (Table 2). This generates a KpnI site in “upfadA” and a BamHI site in “downfadA” at the ends adjacent to fadA [23]. 2. Ligate the KpnI–BamHI fragment containing the ermF– ermAM cassette from pVA2198 with the “upfadA” and the “downfadA” fragments, and then clone the fragment into pCR2.1. The resulting plasmid is designated as pYH1378. 3. Transform E. coli TOP10 with pYH1378. 4. Purify and digest pYH1378 with EcoRV to linearize [23].

48

Akihiro Yoshida and Akihiko Ikegami

3.1.2 Transformation Using Sonoporation

1. Culture F. nucleatum 12230 overnight at 37
C under anaerobic conditions in BHI broth supplemented with hemin and menadione. 2. Harvest the log-phase F. nucleatum 12230 culture and then wash and resuspend the culture in PBS supplemented with 0.1 mM CaCl2 and 0.1 mM MgCl2. 3. Mix 100 μL (approximately 1  109 CFU) of the bacterial suspension with 50 μg of plasmid and 50 μL of Definity (contrast agent) in the Nunc eight-well immunomodule. 4. Direct a regular planar piezoelectric lead–zirconate–titanate US transducer with a circular aperture 5.1 cm in diameter (center frequency of 0.96 MHz) upward to irradiate the bacteria in the 96-well plate. 5. Use a signal generator to control the duty cycle and initial amplitude of the input signal, and amplify the signal using a 75 W power amplifier. Connect the amplified signal to the US transducer to generate the desired US field. Use pulsed US exposures at a duty cycle of 50% and a pulse repetition frequency of 1 Hz for a total duration of 90 s. Measure the US beam profile using a calibrated hydrophone system, and calibrate the effective US output powers using a US power meter. The acoustic pressure of US exposure should be 0.5 MPa (corresponding to an initial input signal at 130 mV). 6. Plate the suspension onto Columbia blood agar plates and incubate the suspension under anaerobic conditions at 37
C for 24 h. Subculture the bacteria on Columbia blood agar plates containing 0.4 μg/μL clindamycin and incubate for 3 additional days. Purify the clindamycin-resistant colonies on plates before inoculating them in Columbia broth containing 0.4 μg/μL clindamycin. Verify the genetic composition of the mutants by PCR using fadAfor and fadArev primers (Table 1) to obtain the resulting fadA deletion mutant, F. nucleatum 12230 US1.

3.2 Construction of a fadA-Complemented Mutant in F. nucleatum

1. Amplify the fadA gene with a Shine–Dalgarno sequence using fadASDF and fadASDR primers to create a 436-bp fragment with a BamHI site at the 50 end and a SalI site at the 30 end.

3.2.1 DNA Construct

2. Amplify the ermF gene using erm1F and erm1R primers to create a 622-bp fragment with a BamHI site at the 30 end [29]. 3. Amplify the ermAM gene using erm2F and erm2R primers to create a 643-bp fragment with a SalI site at the 50 end [29]. 4. Following digestion with BamHI and/or SalI, ligate these three fragments. Amplify the ermF–fadA–ermAM fragment using erm1F and erm2R primers and clone the fragment into

Transformation of Fusobacterium nucleatum

49

pCR2.1. Digest the resulting plasmid, pYH1479, with SalI, and then insert the catP gene from plasmid pJIR418 [28] into this site to generate pYH1480 [29]. 3.2.2 Transformation Using Sonoporation

1. Culture, wash and resuspend F. nucleatum US1 cells in PBS supplemented with 0.1 mM CaCl2 and 0.1 mM MgCl2 (see steps 1 and 2 in Subheading 3.1.2). 2. Mix the bacterial suspension (approximately 1  109 cells) with 50 μg of plasmid pYH1480 and 50 μL of Definity in 0.4-mL wells of an eight-well flat-bottomed immunomodule with a frame. 3. Treat the mixture by sonoporation as previously described (see steps 4 and 5 in Subheading 3.1.2). Plate the sonoporated suspension onto Columbia blood agar plates and incubate without selection for 24 h at 37
C under anaerobic conditions, followed by replication on Columbia blood agar plates containing 5 μg/mL thiamphenicol. 4. Incubate the plates for 3–5 days at 37
C. Isolate the thiamphenicol-resistant colonies and inoculate the bacteria in Columbia broth containing 5 μg/mL thiamphenicol.

4

Notes 1. F. nucleatum 12230: also referred to F. nucleatum subsp. polymorphum, strain F0401 (Oral Clone BS019) was isolated from a transtracheal biofilm from a healthy patient. Strain F0401 (HMP ID 9369) is a reference genome for The Human Microbiome Project (HMP). 2. Alternatively, TS broth 30 g/L or BHI 37 g/L, supplemented with 5 μg/mL hemin and 1 μg/mL menadione, is available for inoculation of F. nucleatum. Add 15 g/L agar to the medium and autoclave at 121
C for 15 min. Gifu Anaerobic Broth medium 59 g/L (Nissui Pharmaceutical Co., Ltd., Tokyo, Japan) supplemented with hemin and menadione is also available.

References 1. Jenkins HC, Baker HA (1951) Fermentative process of the fusiform bacteria. J Bacteriol 61:101–114 2. Moore WF, Moore LV (1994) The bacteria of periodontal diseases. Periodontol 2000 5:66–77 3. Brennan CA, Garrett WS (2019) Fusobacterium nucleatum-symbiont, opportunist and oncobacterium. Nat Rev Microbiol 17:156–166

4. Han YW, Shen T, Chung P et al (2009) Uncultivated bacteria as etiologic agents of intraamniotic inflammation leading to preterm birth. J Clin Microbiol 47:38–47 5. Hill GB (1998) Preterm birth: associations with genital and possibly oral microflora. Ann Periodontol 3:222–232 6. Coppenhagen-Glazer S, Sol A, Abed J et al (2015) Fap2 of Fusobacterium nucleatum is a galactose-inhibitable adhesin involved in

50

Akihiro Yoshida and Akihiko Ikegami

coaggregation, cell adhesion, and preterm birth. Infect Immun 83:1104–1113 7. Han YW (2015) Fusobacterium nucleatum: a commensal-turned pathogen. Curr Opin Microbiol 23:141–147 8. Wong SH, Yu J (2019) Gut microbiota in colorectal cancer: mechanisms of action and clinical applications. Nat Rev Gastroenterol Hepatol 16:690–704 9. Rubinstein MR, Baik JE, Lagana SM et al (2019) Fusobacterium nucleatum promotes colorectal cancer by inducing Wnt/β-catenin modulator Annexin A1. EMBO Rep 20: e47638 10. Komiya Y, Shimomura Y, Higurashi T et al (2019) Patients with colorectal cancer have identical strains of Fusobacterium nucleatum in their colorectal cancer and oral cavity. Gut 68:1335–1337 11. Bullman S, Pedamallu CS, Sicinska E et al (2017) Analysis of Fusobacterium persistence and antibiotic response in colorectal cancer. Science 358:1443–1448 12. Yu T, Guo F, Yu Y et al (2017) Fusobacterium nucleatum promotes chemoresistance to colorectal cancer by modulating autophagy. Cell 170:548–563 13. Ramos A, Hemann MT (2017) Drugs, bugs, and cancer: Fusobacterium nucleatum promotes chemoresistance in colorectal cancer. Cell 170:411–413 14. Rubinstein MR, Wang X, Liu W et al (2013) Fusobacterium nucleatum promotes colorectal carcinogenesis by modulating E-cadherin/β-catenin signaling via its FadA adhesin. Cell Host Microbe 14:195–206 15. Castellarin M, Warren RL, Freeman JD et al (2012) Fusobacterium nucleatum infection is prevalent in human colorectal carcinoma. Genome Res 22:299–306 16. Mima K, Nishihara R, Qian ZR et al (2016) Fusobacterium nucleatum in colorectal carcinoma tissue and patient prognosis. Gut 65:1973–1980 17. Lui AC, McBride BC, Vovis GF et al (1979) Site specific endonuclease from Fusobacterium nucleatum. Nucleic Acids Res 6:1–15 18. McKay TL, Ko J, Bilalis Y et al (1995) Mobile genetic elements of Fusobacterium nucleatum. Plasmid 33:15–25

19. Claypool BM, Yoder SC, Citron DM et al (2010) Mobilization and prevalence of a Fusobacterial plasmid. Plasmid 63:11–19 20. Bachrach G, Haake SK, Glick A et al (2004) Characterization of the novel Fusobacterium nucleatum plasmid pKH9 and evidence of an addiction system. Appl Environ Microbiol 70:6957–6962 21. Haake SK, Yoder SC, Attarian G et al (2000) Native plasmids of Fusobacterium nucleatum: characterization and use in development of genetic systems. J Bacteriol 182:1176–1180 22. Kinder Haake S, Yoder S, Gerardo SH (2006) Efficient gene transfer and targeted mutagenesis in Fusobacterium nucleatum. Plasmid 55:27–38 23. Han YW, Ikegami A, Rajanna C et al (2005) Identification and characterization of a novel adhesin unique to oral fusobacteria. J Bacteriol 187:5330–5340 24. Ward M, Wu J, Chiu JF (2000) Experimental study of the effects of Optison concentration on sonoporation in vitro. Ultrasound Med Biol 26:1169–1175 25. Miller DL, Pislaru SV, Greenleaf JE (2002) Sonoporation: mechanical DNA delivery by ultrasonic cavitation. Somat Cell Mol Genet 27:115–134 26. Han YW, Ikegami A, Chung P et al (2007) Sonoporation is an efficient tool for intracellular fluorescent dextran delivery and one-step double-crossover mutant construction in Fusobacterium nucleatum. Appl Environ Microbiol 73:3677–3683 27. Fletcher HM, Schenkein HA, Morgan RM et al (1995) Virulence of a Porphyromonas gingivalis W83 mutant defective in the prtH gene. Infect Immun 63:1521–1528 28. Sloan J, Warner TA, Scott PT et al (1992) Construction of a sequenced Clostridium perfringens-Escherichia coli shuttle plasmid. Plasmid 27:207–219 29. Ikegami A, Chung P, Han YW (2009) Complementation of the fadA mutation in Fusobacterium nucleatum demonstrates that the surfaceexposed adhesin promotes cellular invasion and placental colonization. Infect Immun 77:3075–3079

Part II Experimental Methods to Examine Virulence Factors

Chapter 6 Genotyping of Porphyromonas gingivalis in Relationship to Virulence Atsuo Amano, Youn-Hee Choi, and Hiroki Takeuchi Abstract Porphyromonas gingivalis, a significant periodontal pathogen, is known to possess genetic variations in relation to its virulence. Furthermore, fimbriae encoded by the fimA gene are involved in bacterial adherence to and invasion of host cells, and a known virulence factor of the bacterium. The fimA gene is classified into six variants (types I–V and Ib) and has been shown to be related to microbial virulence. Polymerase chain reaction (PCR) assay results are helpful to differentiate the genotypes, with fimA typespecific primer sets used for that have been developed by several researchers. Although room for improvement remains, fimA genotyping is expected to become a useful technique for periodontal examinations and diagnosis. In this chapter, currently available PCR methods to classify fimA genotypic variations of P. gingivalis are described. Key words Periodontitis, Periodontal bacteria, fimA, Genotyping, Porphyromonas gingivalis, Fimbriae, Polymerase chain reaction, PCR

1

Introduction Porphyromonas gingivalis, associated with various forms of marginal periodontitis, resides in periodontal pockets undergoing destruction as well as healthy gingival margins. Research findings have strongly suggested clonal heterogeneity among harbored organisms, thus specific clones of P. gingivalis have been investigated to determine their relationship to bacterial virulence [1–4]. Genetic variations of P. gingivalis can be distinguished by a variety of methods, including polymerase chain reaction (PCR) assays, heteroduplex analysis, microarray-based comparative genomic hybridization, multiple locus sequence typing, multiple-loci variable number of tandem repeats analysis, pattern-based technologies, and comparative whole-genome analysis. Among those, PCR results are useful to classify genotypes of P. gingivalis in relationship to microbial virulence [1–4].

Keiji Nagano and Yoshiaki Hasegawa (eds.), Periodontal Pathogens: Methods and Protocols, Methods in Molecular Biology, vol. 2210, https://doi.org/10.1007/978-1-0716-0939-2_6, © Springer Science+Business Media, LLC, part of Springer Nature 2021

53

54

Atsuo Amano et al.

Fimbriae are thin, filamentous, proteinaceous surface appendages (hairlike organelles) on bacterial surfaces, and a critical factor for colonization of P. gingivalis in subgingival regions, as they promote both bacterial adhesion to and invasion of targeted sites. The fimA gene is monocistronic and exists as a single copy in the chromosome of P. gingivalis, and has been classified into six variants (types I–V and Ib) on the basis of the nucleotide sequence [1, 2, 4]. Previous studies have strongly suggested that type II is the most virulent fimA genotype, followed by types Ib and IV. The odds ratio for the association of each fimA type with periodontitis has been reported to be 0.198 for type I, 6.51 for type Ib, 77.8 for type II, 2.51 for type III, 7.54 for type IV, or 1.05 for type V [4]. fimA type-specific primer sets used for differentiation analysis have been developed and improved by researchers [5, 6]. However, untypable fimA genes other than the 6 known genotypes have also been observed [2, 6, 7]. The methods for fimA genotyping will require further development; however, they are expected to be useful for periodontal examinations and diagnosis. This chapter describes currently available PCR methods to classify fimA genotypic variations of P. gingivalis.

2

Materials All polypropylene tubes and water should be nuclease and pyrogen free. All solutions and reaction mixtures should be prepared on ice, unless indicated otherwise.

2.1 Samples and P. gingivalis Culture

1. Subgingival plaque. 2. Sterile Gracy curette. 3. Dulbecco’s phosphate buffered saline (PBS: NaCl; 8 g/L, KCl; 0.2 g/L; Na2HPO4; 1.15 g/L, KH2PO4; 0.2 g/L), pH 7.4, sterilized. 4. 1.5 mL sample tubes. 5. 15 mL centrifuge tubes. 6. Standard reference strains: P. gingivalis ATCC 33277, TDC60, 6/26, W50, HNA-99, and HG1691. 7. Anaerobe blood agar plates (BD). 8. Trypticase soy broth (TSB) medium: 30 mg/mL TSB in water supplemented with 1 mg/mL yeast extract, 5 μg/mL hemin, 1 μg/mL menadione, and 1 mg/mL L-cysteine hydrochloride. Autoclave TSB medium in a glass bottle 121
C for 15 min, cool down to room temperature, and set TSB in anaerobic jar until use. 9. Anaerobic jar.

Genotyping of Porphyromonas gingivalis in Relationship to Virulence

55

10. Gas generators for anaerobic culture (Mitsubishi Gas Chemical). 11. Spectrophotometer. 12. UV-transparent cuvettes. 13. Incubator for incubation at 37
C. 14. Centrifuge. 2.2

PCR

1. Genomic DNA purification kit (Promega). 2. 0.2 μL PCR tubes. 3. PCR master mix. 4. Thermal cycler. 5. Spectrophotometer.

2.3

Electrophoresis

1. Tris–acetate–EDTA (TAE) buffer, pH 8.3. 2. Agarose. 3. Gel casting set. 4. Molecular size standard. 5. Nucleic acid staining solution. 6. Agarose electrophoresis unit (Mupid-exU). 7. Gel and PCR Clean-Up System (Promega). 8. UV illumination.

3

Methods

3.1 Clinical Sample Collection

1. Remove supragingival plaque and collect plaque samples from subgingival sites with a sterile Gracy curette (see Note 1). 2. Place each sample into sterile 1.5-mL tube containing 1 mL of sterile PBS (pH 7.4) and place on ice.

3.2

DNA Extraction

1. Gently vortex the sample tube for 10 s, then centrifuge at 3300  g for 5 min. Carefully discard the supernatant. 2. For a positive control, streak P. gingivalis from frozen glycerol stocks onto blood agar plates and grow for 3 days at 37
C in anaerobic conditions. Pipet 5 mL of TSB medium into 15 mL tube and steak out P. gingivalis on blood agar plates into TSB medium. Incubate bacteria in culture medium at 37
C in anaerobic conditions for 24–48 h until bacteria reach peak infectivity (final OD600 ¼ 2.0). Centrifuge sample tubes containing 1 mL of bacterial culture and carefully discard the supernatant.

56

Atsuo Amano et al.

3. Purify genomic DNA from the clinical sample and positive control with a genomic DNA purification kit. 4. Determine DNA amount with a spectrophotometer and adjust to 10 ng/μL. Store immediately at 80
C. 3.3 Confirm Existence of Bacterial DNA Using PCR

1. Prepare 1 ng of sample DNA and 16S rRNA primer set in PCR tube (Table 1). 2. Perform an amplification reaction using PCR Master Mix. The thermal cycle is as follows: after initial denaturation at 95
C for 15 min, perform 30 cycles consisting of 95
C for 15 s, 55
C for 15 s, and 72
C for 40 s, and a final extension at 72
C for 7 min (Table 1). 3. Include positive and negative controls in each PCR set, as well as when processing all samples. 4. Confirm PCR products with electrophoresis in 2% agarose gel with TAE buffer. Use a 100-bp DNA ladder as the molecular size standard. 5. Stain the gel with nucleic acid staining solution and obtain photographs under UV illumination (Fig. 1).

3.4 Confirm Existence of P. gingivalis DNA Using PCR

1. Prepare 1 ng of sample DNA and P. gingivalis 16S rRNA primer set in PCR tubes (Table 1). 2. Perform amplification reaction with PCR Master Mix. The thermal cycle is as follows: following initial denaturation at 95
C for 15 min, perform 30 cycles consisting of 95
C for 15 s, 58
C for 15 s, and 72
C for 15 s, and a final extension at 72
C for 7 min (Table 1). 3. Confirm the PCR products (seesteps 4 and 5 in Subheading 3.3) (Fig. 1).

3.5 Determine fimA Genotypes of P. gingivalisPositive Specimens Using PCR

1. Prepare 1 ng of sample DNA and fimA type primer set in PCR tubes (Table 1). 2. Perform amplification reaction with PCR Master Mix. The thermal cycle is as follows: following initial denaturation at 95
C for 15 min, perform 35 cycles consisting of 95
C for 15 s, then 60
C (type V) or 58
C (other types) for 15 s, and 72
C for 15 s, and a final extension at 72
C for 7 min (Table 1). 3. Confirm the PCR products (seesteps 4 and 5 in Subheading 3.3) (Fig. 1).

Genotyping of Porphyromonas gingivalis in Relationship to Virulence

57

Table 1 fimA type- and 16S rRNA-specific primers

Primer Set Sequence (50 –30 )

Length Ta Elongation (bp) (
C) period (s)

Reference

16S rRNA GGATTAGAGTTTGATCCTGGCTACC TTGTTACGACTT

728

55

40

Lyons et al. [8]

Pg 16S rRNA

198

58

15

Amano et al. [1]

fimA AAGTTTTTCTTGTTGGGAC 1219 universal TTGCAACCCCGCTCCCTGTATTCCGA

58

45

Shimoyama et al. [6]

fimA type I CTGTGTGTTTATGGCAAACCTTCTTA TTCTTAGGCGTATAATTGC

173

58

15

Shimoyama et al. [6]

fimA type Ib

CTGTGTGTTTATGGCAAACTTCTTATTC TTAGGCGTATAACCAT

173

58

15

Shimoyama et al. [6]

fimA type II

GCATGATGGTACTCCTTTGAC TGACCAACGAGAACCCACT

292

58

15

Moon et al. [5]

fimA type III

ATTACACCTACACAGG TGAGGCAACCCCGCTCCCTGTA TTCCGA

253

58

15

Amano et al. [1]

fimA type IV

CTATTCAGGTGCTA TTACCCAAAACCCCGCTCCCTGTA TTCCGA

249

58

15

Amano et al. [1]

fimA type V

TGGAACGAATACGCC TGAAGGAAACCCCGCTCCCTGTA TTCCGA

166

60

15

Shimoyama et al. [6]

TGTAGATGACTGATGGTGAAAACCACG TCATCCCCACCTTCCTC

3.6 Second PCR for fimA Type-Unidentified Specimens Obtained in First PCR Assay (Nested PCR)

When an fimA genotype is not identified by the first PCR assay despite positive findings for the P. gingivalis 16S rRNA gene, nested PCR is applied, as previously described [6]. 1. Amplify DNA fragment with a set of fimA universal primers designed for common sequences among the 6 fimA genes (Table 1). The thermal cycle is as follows: following initial denaturation at 95
C for 15 min, perform 30 cycles consisting of 95
C for 15 s, 58
C for 15 s, and 72
C for 45 s, and a final extension at 72
C for 7 min (Table 1). 2. Purify the PCR products using a Gel and PCR Clean-Up System. 3. Perform fimA-specific purified DNA.

PCR

with

aliquot

(1

μL)

of

4. Confirm the PCR products (seesteps 4 and 5 in Subheading 3.3) (Fig. 1).

58

Atsuo Amano et al.

Fig. 1 PCR assay for detection of fimA types of P. gingivalis. The assay is performed with DNA purified from cultures of P. gingivalis with the six different fimA types (type I: ATCC 33277, type II: TDC60, type III: 6/26, type IV: W50, type V: HNA-99, type Ib: HG1691) or no template. PCR is performed with a set of fimA type-specific primers, P. gingivalis 16S rRNA, or 16S rRNA, as shown in Table 1

4

Note 1. The amount of the samples should be more than half of the curette blade area. When the sample amount is not enough, collect from other periodontal pockets.

References 1. Amano A, Nakagawa I, Kataoka K et al (1999) Distribution of Porphyromonas gingivalis strains with fimA genotypes in periodontal patients. J Clin Microbiol 37(5):1426–1430 2. Amano A, Kuboniwa M, Nakagawa I et al (2000) Prevalence of specific genotypes of Porphyromonas gingivalis fimA and periodontal health status. J Dent Res 79(9):1664–1668 3. Nakagawa I, Amano A, Kimura RK et al (2000) Distribution and molecular characterization of

Porphyromonas gingivalis carrying a new type of fimA gene. J Clin Microbiol 38(5):1909–1914 4. Nakagawa I, Amano A, Ohara-Nemoto Y et al (2002) Identification of a new variant of fimA gene of Porphyromonas gingivalis and its distribution in adults and disabled populations with periodontitis. J Periodontal Res 37(6):425–432 5. Moon JH, Shin SI, Chung JH et al (2012) Development and evaluation of new primers for PCR-based identification of type II fimA of

Genotyping of Porphyromonas gingivalis in Relationship to Virulence Porphyromonas gingivalis. FEMS Immunol Med Microbiol 64(3):425–428 6. Shimoyama Y, Ohara-Nemoto Y, Kimura M et al (2017) Dominant prevalence of Porphyromonas gingivalis fimA types I and IV in healthy Japanese children. J Dent Sci 12(3):213–219 7. Enersen M, Olsen I, Kvalheim Ø et al (2008) fimA genotypes and multilocus sequence types

59

of Porphyromonas gingivalis from patients with periodontitis. J Clin Microbiol 46(1):31–42 8. Lyons SR, Griffen AL, Leys EJ (2000) Quantitative real-time PCR for Porphyromonas gingivalis and total bacteria. J Clin Microbiol 38 (6):2362–2365

Chapter 7 Transport and Polymerization of Porphyromonas gingivalis Type V Pili Mikio Shoji, Satoshi Shibata, Mariko Naito, and Koji Nakayama Abstract Adhesive pili (or fimbriae) in bacteria are classified into five types, among which type V pili have been most recently described. Type V pili differ from other pili types with respect to transport mechanism, structure, and pilin synthesis. Genes of type V pili are restricted to the phylum Bacteroidetes. Protein subunits that compose type V pili are transported to the cell surface as lipoprotein precursors and then polymerized into a pilus through a strand-exchange mechanism, which is demonstrated by several experiments, including palmitic acid labeling and Cys-Cys cross-linking analysis. Here, we describe the use of these methods to analyze type V pili. Key words Type V pili, Fimbriae, Immunoblot, Globomycin treatment, Palmitic acid labeling, Dot blot, Cys-Cys cross-linking, Electron microscopy

1

Introduction Periodontal diseases including chronic periodontitis are caused by bacterial infection. Chronic periodontitis has been reported to have many epidemiological associations with metabolic syndrome disease states such as diabetes, coronary heart disease, hypertension, and dyslipidemia [1]. Therefore, chronic periodontitis is considered to be of particular importance among periodontal diseases. The bacterium, Porphyromonas gingivalis, is known to be one of the primary causative agents of chronic periodontitis. Its pathogenicity and the inflammatory responses it induces in its host have been well studied [2]. P. gingivalis is a gram-negative anaerobic bacterium that produces highly active proteases called gingipains to promote its survival in the periodontal pocket [3]. Gingipains are divided into two groups: arginine-specific gingipains (RgpA and RgpB) and a lysinespecific gingipain (Kgp). Gingipains are transported via the type IX secretion system, a recently described system that is restricted to the phylum Bacteroidetes [4, 5]. Much attention is focused on

Keiji Nagano and Yoshiaki Hasegawa (eds.), Periodontal Pathogens: Methods and Protocols, Methods in Molecular Biology, vol. 2210, https://doi.org/10.1007/978-1-0716-0939-2_7, © Springer Science+Business Media, LLC, part of Springer Nature 2021

61

62

Mikio Shoji et al.

gingipains, not only due to their virulent activities against the host but also their contribution to the maturation of extracellular proteins of P. gingivalis. P. gingivalis produces pili (or fimbriae) that allow it to adhere to host cells or other bacterial cells. P. gingivalis expresses Fim and Mfa fimbriae, both of which are type V pili [6, 7]. Fim and Mfa fimbriae–encoding genes each occur in clusters that are located distantly in the P. gingivalis genome. The protein subunits of these fimbriae (except for Mfa5) are transported as lipoprotein precursors; N-terminal prosequences of the protein subunits are then processed by arginine-specific gingipains on the cell surface [8–12]. The processed protein subunits such as FimA and Mfa1 polymerize to form the shaft of the fimbriae on the cell surface. Crystal structure analysis of the type V pili-related proteins suggests that the C-terminal portion of shaft proteins act as linkers necessary for the polymerization [13]. Compared to other types of pili studied, such as chaperone-usher pili, type IV pili, and curli in gram-negative bacteria, and sortase-dependent pili in gram-positive bacteria, the type V pili have unique characteristics concerning transport, structures and mechanism of polymerization [14]. Genes of the type V pili are only found in the phylum Bacteroidetes. As P. gingivalis fimbriae are the most studied of the type V pili, we describe experimental protocols using this species. Bacterial lipoproteins contain an N-terminal signal sequence, the lipobox, that enables them to pass through the Sec apparatus; the lipobox is located approximately 20 amino acid residues from the first methionine residue of the lipoprotein [15]. A cysteine residue of the lipobox is lipidated by a diacylglycerol transferase (Lgt) in the inner membrane [16]. Fim or Mfa fimbriae-related proteins contain such lipoboxes, thus we carried out lipoprotein detection experiments including treatment with the signal peptidase II inhibitor globomycin and palmitic acid-labeling experiments [10, 17]. Next, we describe a dot blot analysis to determine whether fimbriae-related proteins are present on the cell surface and then perform Cys-Cys cross-linking analysis to determine whether the C-terminal portion of shaft proteins acts as a donor strand for subunit polymerization. Furthermore, we describe electron microscopy using the negative staining method to observe fimbriae on the cell surface or purified fimbriae.

2

Materials Deionized water (DIW) should be used to prepare growth media. Use ultrapure water (prepared by purifying DIW to attain a sensitivity of 18 MΩ cm at 25
C) and analytical grade reagents should be used to prepare all other solutions. All reagents are to be prepared and stored at room temperature unless indicated

Experimental Protocol for Analyzing Type V Pili

63

otherwise. Follow waste disposable regulations strictly when disposing of waste materials. Strains of P. gingivalis ATCC 33277, its mutants, complemented strains, and W83 are used in this protocol. 2.1

Bacterial Culture

1. Brain–heart infusion (BHI) liquid medium for P. gingivalis growth: Weigh 3.7 g BHI, 0.5 g yeast extract, and 0.1 g Lcysteine into a 100 mL glass bottle. Add DIW to a final volume of 100 mL. Mix well and autoclave. Store at room temperature for up to 1 day, otherwise, store at 4
C, or at 37
C in an anaerobic box. Prior to inoculation with P. gingivalis cells, supplement the autoclaved liquid medium with 5 μg/mL hemin and 1 μg/mL menadione. Grow P. gingivalis cells under anaerobic conditions (80% N2, 10% CO2, 10% H2). 2. Hemin stock solution (0.5 mg/mL): Thoroughly dissolve hemin (50 mg) in 1 mL of 1 N NaOH and add to 99 mL of ultrapure water in a glass bottle. Autoclave and store at 4
C. When preparing 100 mL BHI liquid medium, 1 mL of hemin stock solution should be added. 3. Menadione (Vitamin K) stock solution (5 mg/mL): Dissolve 25 mg of vitamin K thoroughly in 5 mL of pure ethanol. Stored at 4
C. When preparing 100 mL BHI liquid medium, 20 μL of menadione stock solution should be added. 4. Tryptic soy (TS) agar solid medium for P. gingivalis growth: Weigh 4 g TS agar, 0.5 g BHI, and 0.05 g L-cysteine into a 100 mL glass bottle. Add DIW to a final volume of 100 mL. Mix well and autoclave. Prior to pouring into plates, supplement the autoclaved solid medium with 5 μg/mL hemin and 0. 5 μg/mL menadione. When preparing100 mL TS agar plate, 1 mL of hemin stock solution and 10 μL of menadione stock solution should be added. Pour into plates and store at 4
C. Grow P. gingivalis cells on TS agar plates under anaerobic conditions (see Note 1). Passage the cells to fresh TS agar plates approximately every 7 days. 5. Skim milk stock solution for P. gingivalis strains: Weigh 10 g skim milk into a 100 mL glass bottle. Add DIW to a final volume of 100 mL. Mix well and autoclave. Pour into the Cryotube with 1.6 mL. Scrape P. gingivalis cells from colonies on TS agar plates using a sterile plastic inoculation loop and transfer the cells into the skim milk solution. Stored at 80 or 20
C.

2.2 Sodium Dodecyl Sulfate (SDS)– Polyacrylamide Gel

1. Separating gel buffer: 1.5 M Tris–HCl, pH 8.8. Weigh 181.7 g Tris–HCl into a 1 L glass beaker. Add ultrapure water to a volume of 0.9 L. Mix well and adjust the pH with HCl. Add ultrapure water to a final volume of 1 L. Store at 4
C.

64

Mikio Shoji et al.

2. Stacking gel buffer: 0.5 M Tris–HCl, pH 6.8. Weigh 60.6 g Tris–HCl into a 1 L glass beaker. Add ultrapure water to a volume of 0.9 L. Mix well and adjust the pH with HCl. Add ultrapure water to a final volume of 1 L. Store at 4
C. 3. 30% acrylamide–bisacrylamide solution (acrylamide–bisacrylamide 29.2:0.8): Weigh 29.2 g of acrylamide monomer and 0.8 g bisacrylamide (cross-linker) into a 100 mL glass beaker. Add ultrapure water to a final volume of 100 mL. Transfer to an amber bottle. Store at 4
C. 4. 10% ammonium persulfate solution in sterile ultrapure water prior to use. 5. N,N,N,N0 -Tetramethyl ethylenediamine: Store at 4
C. 6. Sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) running buffer: 0.025 M Tris, 0.2 M glycine, 0.1% SDS. 7. SDS lysis buffer stock solution (4): 0.25 M Tris–HCl, pH 6.8, 8% SDS, 40% glycerol. Mix well and heat to 100
C to dissolve thoroughly. Store 1 mL aliquots of the solution at 20
C (see Note 2). 8. PBS stock solution (10): 1.37 M NaCl, 0.027 M KCl, 0.081 M Na2HPO4, 0.015 M KH2PO4, pH 7.4. Autoclave and store at room temperature. 9. Proteinase inhibitors: Tosyl-L-lysyl-chloromethane hydrochloride (TLCK) and leupeptin. 10. Phosphate buffered saline (PBS) with proteinase inhibitors: Add 0.1 mM TLCK and 0.1 mM leupeptin to PBS (pH 7.4), to avoid autoproteolysis (see Note 3). 2.3

Immunoblotting

1. Glass plates, clips, and a comb for a mini-slab gel. 2. Plastic container. 3. Polyvinylidene difluoride (PVDF) membranes. 4. Mini-gel wet-transfer module. 5. Whatman filter paper. 6. Western blot transfer buffer: 0.02 M Tris, 0.15 M glycine, 0.02% SDS, 20% methanol. Weigh 7.3 g Tris, 33.8 g glycine, and 0.6 g SDS into a 5 L plastic beaker. Add 2.4 L of DIW and 0.6 L of methanol to the beaker and mixed well. Stored at room temperature. 7. Washing solution: PBS containing 0.05% Tween 20 (PBST). 8. Blocking solution: 3% skim milk in PBST (see Note 4). 9. Diluent solution: 3% skim milk in PBST.

Experimental Protocol for Analyzing Type V Pili

65

10. Antibodies: Antiserum raised against recombinant (r) FimA, rMfa1, and rMfa2 proteins, obtained from strain P. gingivalis ATCC 33277, and rFimB protein, obtained from strain W83, is used as a source of primary antibodies. 11. Horseradish antibodies.

peroxidase

(HRP)-conjugated

secondary

12. Enhanced chemiluminescence prime detection reagent. Mix equal volumes of solution A and solution B. 13. Autoradiography film. 14. Developing, stop, and fixing solutions. 2.4 Globomycin Treatment

1. Globomycin: a signal peptidase II inhibitor (kindly provided from Sankyo Co., Ltd.).

2.5 Palmitic Acid Labeling Experiment

1. Palmitic acid, [1-14C]-, 2.5 μCi (14C-palmitic acid henceforth, for the sake of brevity). 2. BugBuster® protein extraction reagent. 3. Antibodies: Antiserum raised against rFimB protein, obtained from strain W83, and rMfa2 protein, obtained from strain ATCC 33277, is used for immunoprecipitation. 4. Protein G agarose beads. 5. Plastic container. 6. Whatman filter paper. 7. Wrap. 8. Gel dryer. 9. Cassette used for autoradiography. 10. Imaging plate. 11. Fluorescent-image analyzer, FLA-5100.

2.6

Dot Blot Analysis

1. Multimode microplate reader. 2. Nylon membranes. 3. Immunoblotting system as described (see Subheading 2.3).

2.7 Cys-Cys CrossLinking Analysis

1. Hydrogen peroxide. 2. Cross-linkers: bismaleimidoethane (BMOE) or bismaleimidohexane (BMH). 3. Immunoblotting system as described (see Subheading 2.3).

2.8 Electron Micrography

1. 1% (w/v) ammonium acetate prepared in ultrapure water. 2. Carbon-coated cupper 200 mesh electron microscopy (EM) grid. 3. 1% (w/v) uranyl acetate solution prepared in ultrapure water.

66

Mikio Shoji et al.

4. Whatman filter paper. 5. Glow discharge equipment: HDT-400 (JEOL, Japan). 6. JEM-1200EX transmission electron microscope (JEOL, Japan). 7. ImageJ: Image processing program (see http://rsb.info.nih. gov/ij) [18]. 2.9 Preparation of Fim Fimbriae

3

1. Fim fimbriae: Prepared from the Mfa1-deficient mutant. Fim fimbriae from KDP225 cells (mfa1::cepA) [13] are prepared using the method of vesicle-depleted supernatant fraction, as described [19]. Briefly, colonies from TS agar plates are suspended in 1 mL of PBS, vortexed vigorously, and then centrifuged at 6000  g for 15 min at 4
C. The supernatant fraction, which contains soluble extracellular proteins and outer membrane vesicles, is transferred to centrifuge tube for use in a Beckman Coulter TLA100.3 fixed-angle rotor. The vesicledepleted supernatant fraction is obtained by a further centrifugation of the wash supernatant at 100,000  g for 1 h at 4
C. The supernatant fraction containing Fim fimbriae is used for electron microscopy with negative staining.

Methods

3.1 Globomycin Treatment

1. Inoculate P. gingivalis cells in 2 mL of BHI liquid medium and incubate overnight. 2. Inoculate 0.2 mL of the overnight culture to 1.8 mL of fresh BHI medium. Incubate for 3 h in an anaerobic box. 3. Add the signal peptidase II inhibitor, globomycin, to the culture to obtain a final concentration of 50 μg/mL or 100 μg/ mL, as desired. Incubate samples in an anaerobic box. 4. After 1 or 3 h, harvest the cells from 0.1 mL globomycintreated culture by centrifugation at 20,400  g for 1 min. 5. Dissolve the resulting precipitates in 60 μL of PBS with inhibitors and then mix with 20 μL of SDS lysis buffer (4). 6. Heat-denature samples at 100
C for 10 min. 7. Apply 10 μL of each sample per well, for separation by SDS-PAGE. 8. After electrophoresis, transfer proteins from the gel to a PVDF membrane using western blot transfer buffer (see Note 5). 9. After the transfer, rinse the blotted membrane first with 100% methanol and then ultrapure water. 10. Block the membrane with blocking buffer for 1 h.

Experimental Protocol for Analyzing Type V Pili A Globomycin (μg/ml)

67

B 0

100

Globomycin (μg/ml)

0

50

Prepro-form Pro-form

Prepro-form Pro-form Matured-form

Matured-form

Anti-FimA

100

Anti-Mfa1

Fig. 1 Globomycin treatment of P. gingivalis. P. gingivalis was grown in BHI liquid medium with or without globomycin for 3 h. Cell lysates were subjected to SDS-PAGE, followed by immunoblot analysis with (a) α-FimA or (b) α-Mfa1 antiserum. Notably, preproteins (Prepro-form) of FimA or Mfa1 were only detected in samples treated with globomycin

11. After blocking, gently agitate the membrane with PBST including primary antiserum of the target protein at room temperature for 1 h or at 4
C overnight. Next, wash the membrane with washing buffer for 10 min. Repeat this wash step twice more, replacing the buffer each time, for a total wash time of 30 min. 12. Then, gently agitate the membrane with PBST including HRP conjugated secondary antibody at room temperature for 1 h. Next, wash the membrane with washing buffer for 10 min. Repeat this wash step twice more, replacing the buffer each time, for a total wash time of 30 min. 13. Perform chemiluminescent immunodetection using the enhanced chemiluminescence prime detection reagent. 14. Cover the membrane with an autoradiography film for an appropriate amount of time. Then, immerse the film in the order of developing solution, stopping solution, and fixing solution (Fig. 1). 3.2 Palmitic Acid Labeling Experiment

1. Inoculate P. gingivalis cells in 2 mL of BHI liquid medium and incubate overnight. 2. Inoculate 0.5 mL of the overnight culture to 4.5 mL of fresh BHI medium. Incubate for 3 h in an anaerobic jar. 3. Add 14C-palmitic acid to the culture to obtain a final concentration of 2.5 μCi/mL. Incubate the culture in an anaerobic jar for 24 h. 4. Harvest cells from 1 mL of the culture by centrifugation at 20,400  g for 1 min. 5. To eliminate unincorporated 14C-palmitic acid, wash the cells with PBS buffer and centrifuge at 20,400  g for 5 min. Repeat this wash step/centrifugation twice more, replacing the buffer each time, for a total wash time/centrifugation of 15 min. 6. Dissolve the washed cells in 1 mL of BugBuster® protein extraction reagent with 0.1 mM TLCK and 0.1 mM leupeptin.

68

Mikio Shoji et al.

7. Immunoprecipitate the target protein using protein G agarose beads and the appropriate antiserum (see Note 6). 8. Dissolve the resulting precipitates in 60 μL of PBS with inhibitors and then mix with 20 μL of SDS lysis buffer (4). 9. Heat-denature samples at 100
C for 10 min. 10. Load 10 μL of each sample per well for separation by SDS-PAGE. 11. After the electrophoresis, wash the SDS-PAGE gel with ultrapure water for 5 min. Repeat this wash step twice more, replacing the ultrapure water each time, for a total wash time of 15 min. 12. Subsequently, place the gels on the Whatman filter paper and dry with a gel dryer. 13. Wrap the dried gels and place them in a cassette with an imaging plate on top. After securely closing the cassette, store it in appropriate box for a minimum of 4 days. 14. Perform detection using a fluorescent-image analyzer, FLA-5100 (Fig. 2).

A

33277 33277 /pFimB WT

Heat temperature (°C)

33277 /pFimB C23A

B kDa

- 60 100 - 60 100 - 60 100

140 100

55 47 37

70 55

27

47 37

16

*

27 19 IP: α-FimB

16 IP: α-Mfa2

Fig. 2 Palmitic acid labeling analysis. 14C-palmitic acid-labeled cells of P. gingivalis strains were lysed and then immunoprecipitated with α-FimB or α-Mfa2 antiserum. The immunoprecipitated samples were subjected to SDS-PAGE, followed by autoradiography. (a) The immunoprecipitated samples were heat-denatured at the temperatures indicated for 10 min. Red arrows indicate palmitic acid-labeled FimB proteins. (b) The immunoprecipitated samples were heat-denatured at 100
C for 10 min. Red arrows indicate palmitic acidlabeled Mfa2 proteins. An asterisk indicates a nonspecific band. (Reproduced from Xu et al. [13] with permission from Elsevier Inc.)

Experimental Protocol for Analyzing Type V Pili

3.3

Dot Blot Analysis

69

1. Wash P. gingivalis cells, grown in BHI liquid medium, once with PBS buffer and then resuspend them in PBS. 2. Adjust the cell suspension to an optical density (OD) of 0.5 or 1.0 at 595 nm. 3. Blot 3 μL of the suspension directly onto a nylon membrane and allow to air-dry. 4. Perform immunodetection using the appropriate antiserum (see Note 7).

3.4 Cys-Cys CrossLinking Analysis

1. To detect the Cys-Cys disulfide bridges of the mutated FimA protein in which three endogenous cysteine residues are mutated to alanine residues and two residues to be checked for their proximity are mutated to cysteine residues (see Note 8), collect cells from 0.1 mL of overnight cell cultures by centrifugation at 20,400  g for 1 min. 2. Resuspend the samples gently in one of the following: 0.1 mL of ultrapure water, 0.1 mL of 0.5 mM hydrogen peroxide in ultrapure water, or 0.1 mL of 2 mM hydrogen peroxide in in ultrapure water and incubate them at room temperature for 1 h. A disulfide bridge can form between two cysteine residues less than 5 A˚ apart (see Note 9). 3. Collect cells by centrifugation and then suspend them in 60 μL of PBS with inhibitors. Mix the suspension with 20 μL of SDS lysis buffer (4) alone or SDS lysis buffer (4) with bME. Heat-denature all samples at 100
C for 10 min. If there are disulfide bridges in FimA, FimA ladder bands will appear in samples treated with anti-FimA antiserum. As a positive control, monomer FimA protein is observed in samples treated with anti-FimA antiserum and treated with bME (Fig. 3).

3.5 Electron Microscopy

1. Grow P. gingivalis cells in BHI liquid medium. Collect cells from overnight cultures and wash them once with 1% (w/v) ammonium acetate. 2. Resuspend the cells in 1% ammonium acetate. Alternatively, prepare a Fim fimbriae sample. 3. Glow discharge the carbon-coated copper size 200 mesh EM grid. 4. Apply a 1–5 μL sample to the glow discharged EM grid and retain it on the grid for 10 s. 5. Remove approximately 80% of the liquid with filter paper by blotting from the edge of grid. 6. Apply 5–10 μL of 0.5% uranyl acetate solution (1% uranyl acetate for FimA fimbriae samples) to the grid and retain for 1 min. 7. Repeat steps 5 and 6.

70

Mikio Shoji et al.

Fig. 3 Cys-Cys cross-linking analysis. (a) Formation of disulfide bonds between cysteine pairs are predicted on the A10 strand with D1 or G1 beta strands. The A10 strand is an invading FimA C-terminal beta-strand. D1 and G1 beta strands are in the N-terminal domain of the preceding FimA protein in the polymer. (b) P. gingivalis cells expressing two mutated cysteines of FimA protein in the fimA mfa1 null mutant were grown in BHI liquid medium. Cell pellets were either untreated (0) or treated with the indicated concentration of hydrogen peroxide (0.5 or 2 mM H2O2). The lysed SDS samples with (+) or without () bME, were heat-denatured at 100
C for 10 min and then subjected to SDS-PAGE, followed by immunoblot analyses with α-FimA antiserum. Cys-Cys cross-linked FimA ladder is visible in samples untreated with bME suggesting that C-terminal beta strands of FimA are required linkers for polymerization. (Reproduced from Xu et al. [13] with permission from Elsevier Inc.)

8. Remove liquid completely with filter paper by blotting from the edge of grid and allow the grid to air-dry. 9. Observe the stained samples with a JEM-1200EX transmission electron microscope at 80 kV. 10. Process micrographs with the image processing program ImageJ (Fig. 4). 11. Measure filament lengths using the “Measure” function in ImageJ.

4

Notes 1. Although P. gingivalis can be grown in an anaerobic jar, anaerobic pouch, or anaerobic box, it is optimal, when performing palmitic acid labeling, to inoculate P. gingivalis in a 15 mL plastic tube and then incubate the culture in an anaerobic box. An anaerobic jar and anaerobic pouch are cheaper than anaerobic box and easy to use for scientists not accustomed to anaerobic culture. However, when constructing gene-deficient mutants, an anaerobic pouch is preferable for growth.

Experimental Protocol for Analyzing Type V Pili

71

Fig. 4 Electron microscopy. (a) Electron micrograph of P. gingivalis ATCC 33277 with negative staining. P. gingivalis ATCC 33277 has a nonsense mutation in the fimB gene, resulting in many long Fim fimbriae. Scale bar ¼ 0.5 μm. (b) Electron micrograph of vesicle-depleted culture supernatants from the P. gingivalis mfa1 mutant with negative staining. Fim fimbriae are clearly observed in the vesicle-depleted fraction. Scale bar ¼ 0.2 μm

2. In preparation for lysing samples, leave one aliquot of SDS lysis buffer (4) at room temperature and warm to dissolve SDS thoroughly. Add 4% β-mercaptoethanol (bME), 0.1% bromophenol blue prior to use. 3. PBS with proteinase inhibitors should be prepared fresh for immediate use. 4. Blocking solution should be prepared fresh for immediate use. 5. Prior to transfer, PVDF membranes should be activated in methanol for a minimum of 2 min. And then, PVDF membranes and Whatman filter paper are soaked in transfer buffer. 6. Immunoprecipitation is performed as follows. IgG agarose beads are washed three times with PBS. Then, the IgG agarose beads ae dissolved with PBS and appropriate amount of antiserum and then rotated at room temperature for 1 h. After that, the IgG agarose beads are collected by centrifugation and washed three times with PBS. Washed IgG agarose beads are kept on ice. Cell pellet is collected from 1 mL of fully grown culture and washed once with PBS. The washed cell pellet is solubilized in 1 mL of BugBuster® protein extraction reagent with 0.1 mM TLCK and 0.1 mM leupeptin by pipetting and stored at room temperature for 10 min. The solubilized fraction is collected by centrifugation and then poured into the washed IgG agarose beads as mentioned above and then

72

Mikio Shoji et al.

rotated at room temperature for 1 h. After that, the IgG agarose beads which include antibody and target protein are collected by centrifugation and washed three times with PBS. Washed IgG agarose beads which include antibody and target protein are solubilized by PBS with inhibitors and SDS lysis buffer (4). 7. When performing a dot blot analysis, PBS is normally used as the washing solution. Detergent should not be used because it may destroy the bacterial cell membranes. 8. In this analysis, the three endogenous cysteine residues are changed to alanine residues to prevent internal or unexpected disulfide bridges. Site-directed mutagenesis is performed to convert all cysteine residues encoded by the fimA gene to alanine residues. To create fimA genes with the desired sequence alterations, PCR primers are designed to incorporate a 15 bp overlap at each end of the amplified fragment. DNA fragments are amplified from pTCB-fimA+ with the FimA-Fw/ mutant-R and mutant-L/FimA-Rv, as described [13]. Amplified fragments are fused with SalI-XbaI–linearized pTCB-fimA+ (Tetr) using the In-Fusion® HD Cloning Kit. Each mutated fimA gene in the pTCB vector is introduced into Escherichia coli S17-1 [20]; each E. coli transformant is then conjugated with the fimA::ermF (Emr) mfa1::cepA (Apr) mutant. 9. When the distance between cysteine residues is greater than ˚ , it is preferable to use a cross-linker, such as BMOE or 5 A BMH, instead of hydrogen peroxide. If this is the case, resuspend the cells in 0.1 mL of PBS, 0.1 mL of 0.5 mM BMOE (or BMH) in PBS, or 0.1 mL of 2 mM BMOE (or BMH) in PBS.

Acknowledgments We thank Editage (www.editage.com) and Matthews MM (Okinawa Institute of Science and Technology Graduate University) for English language editing. References 1. Bourgeois D, Inquimbert C, Ottolenghi L et al (2019) Periodontal pathogens as risk factors of cardiovascular diseases, diabetes, rheumatoid arthritis, cancer, and chronic obstructive pulmonary disease-is there cause for consideration? Microorganisms 7(10). pii: E424 2. Jia L, Han N, Du J et al (2019) Pathogenesis of important virulence factors of Porphyromonas gingivalis via Toll-like receptors. Front Cell Infect Microbiol 9:262

3. Imamura T (2003) The role of gingipains in the pathogenesis of periodontal disease. J Periodontol 74(1):111–118 4. Sato K, Naito M, Yukitake H et al (2010) A protein secretion system linked to bacteroidete gliding motility and pathogenesis. Proc Natl Acad Sci U S A 107(1):276–281 5. Nakayama K (2015) Porphyromonas gingivalis and related bacteria: from colonial

Experimental Protocol for Analyzing Type V Pili pigmentation to the type IX secretion system and gliding motility. J Periodontal Res 50 (1):1–8 6. Yoshimura F, Takahashi K, Nodasaka Y et al (1984) Purification and characterization of a novel type of fimbriae from the oral anaerobe Bacteroides gingivalis. J Bacteriol 160 (3):949–957 7. Hamada N, Sojar HT, Cho MI et al (1996) Isolation and characterization of a minor fimbria from Porphyromonas gingivalis. Infect Immun 64(11):4788–4794 8. Nakayama K, Yoshimura F, Kadowaki T et al (1996) Involvement of arginine-specific cysteine proteinase (Arg-gingipain) in fimbriation of Porphyromonas gingivalis. J Bacteriol 178 (10):2818–2824 9. Kadowaki T, Nakayama K, Yoshimura F et al (1998) Arg-gingipain acts as a major processing enzyme for various cell surface proteins in Porphyromonas gingivalis. J Biol Chem 273 (44):29072–29076 10. Shoji M, Naito M, Yukitake H et al (2004) The major structural components of two cell surface filaments of Porphyromonas gingivalis are matured through lipoprotein precursors. Mol Microbiol 52(5):1513–1525 11. Shoji M, Yoshimura A, Yoshioka H et al (2010) Recombinant Porphyromonas gingivalis FimA preproprotein expressed in Escherichia coli is lipidated and the mature or processed recombinant FimA protein forms a short filament in vitro. Can J Microbiol 56(11):959–967 12. Hasegawa Y, Iijima Y, Persson K et al (2016) Role of Mfa5 in expression of Mfa1 fimbriae in

73

Porphyromonas gingivalis. J Dent Res 95 (11):1291–1297 13. Xu Q, Shoji M, Shibata S et al (2016) A distinct type of pilus from the human microbiome. Cell 165(3):690–703 14. Hospenthal MK, Costa TRD, Waksman G (2017) A comprehensive guide to pilus biogenesis in Gram-negative bacteria. Nat Rev Microbiol 15(6):365–379 15. Okuda S, Tokuda H (2011) Lipoprotein sorting in bacteria. Annu Rev Microbiol 65:239–259 16. Narita SI, Tokuda H (2017) Bacterial lipoproteins; biogenesis, sorting and quality control. Biochim Biophys Acta Mol Cell Biol Lipids 1862(11):1414–1423 17. Inukai M, Ghrayeb J, Nakamura K et al (1984) Apolipoprotein, an intermediate in the processing of the major lipoprotein of the Escherichia coli outer membrane. J Biol Chem 259 (2):757–760 18. Schneider CA, Rasband WS, Eliceiri KW (2012) NIH image to ImageJ: 25 years of image analysis. Nat Methods 9(7):671–675 19. Chen T, Nakayama K, Belliveau L et al (2001) Porphyromonas gingivalis gingipains and adhesion to epithelial cells. Infect Immun 69 (5):3048–3056 20. Simon R, Priefer U, Puhler A (1983) A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram negative bacteria. Biotechnology (NY) 1:784–791

Chapter 8 Purification of Native Mfa1 Fimbriae from Porphyromonas gingivalis Yoshiaki Hasegawa, Keiji Nagano, Yukitaka Murakami, and Richard J. Lamont Abstract Fimbriae of the periodontal pathogen Porphyromonas gingivalis mediate its colonization through associations with other bacteria and host tissues. P. gingivalis generally expresses two distinct fimbrial types, FimA and Mfa1. In P. gingivalis ATCC 33277, FimA fimbriae are present as long filaments easily detached from cells, whereas Mfa1 fimbriae are short filaments compactly bound to the cell surface. Because of this unique characteristic, FimA fimbriae have been selectively and easily isolated from the bacterial cell surface through mechanical shearing such as by pipetting and stirring. However, P. gingivalis ATCC 33277 harbors a mutation in the gene encode the fimbrial length regulator, FimB, and thus produces unusually long FimA fimbriae length. Hence, mechanical shearing to remove FimA is potentially applicable only for this type strain. Here we present protocols to purify intact Mfa1 fimbriae from a fimA-deficient mutant strain. Mfa1 fimbriae are purified from cell lysates, using a French pressure cell and through ion-exchange chromatography. The purity of Mfa1 fimbriae can be confirmed through sodium dodecyl sulfate–polyacrylamide gel electrophoresis, immunoblotting, and electron microscopy. Key words Periodontal pathogen, Porphyromonas gingivalis, Mfa1 fimbriae, Ion-exchange chromatography

1

Introduction Porphyromonas gingivalis, a gram-negative anaerobe, is a primary pathogen in periodontal diseases [1]. Colonization by P. gingivalis can induce microbiota dysbiosis, and result in a non-resolving and destructive inflammatory response [2, 3]. Fimbriae are effectors of colonization and prominent virulence factors in P. gingivalis. They are effective organelles of attachment through their association with other bacteria and with host tissues. P. gingivalis expresses at least two types of fimbriae known as FimA and Mfa1. While they are both type V fimbriae [4, 5], they are genetically distinct from each other and are encoded at different chromosomal locations [6]. FimA fimbriae are primarily composed

Keiji Nagano and Yoshiaki Hasegawa (eds.), Periodontal Pathogens: Methods and Protocols, Methods in Molecular Biology, vol. 2210, https://doi.org/10.1007/978-1-0716-0939-2_8, © Springer Science+Business Media, LLC, part of Springer Nature 2021

75

76

Yoshiaki Hasegawa et al.

of polymers of FimA, encoded by fimA [7, 8], whereas Mfa1 fimbriae are predominantly composed of Mfa1, encoded by mfa1 [9]. Along with structural proteins FimA and Mfa1, several minor accessory components including FimC-E and Mfa3–5 are present in the respective fimbriae [10–15]. In P. gingivalis type ATCC 33277, FimA fimbriae are long filaments (more than 1 μm in length) that are easily detached from the cells [8], whereas Mfa1 fimbriae are short filaments (ranging 60–500 nm in length) [9, 16] and are more tightly bound to the cell surface. We previously reported that Mfa1 fimbriae are elongated and easily detached from the cell surface when mfa2, located immediately downstream of mfa1 and in the same operon, is deficient [10]. Mfa2 thus functions as an anchor and an assembly and elongation terminator. This finding prompted us to analyze the fim cluster, since we hypothesized that FimA fimbriae of ATCC 33277, having long filaments that are easily detached from cells, may contain nonsense mutations in a short ORF sequence (of 357 bp), “orf1” immediately downstream of fimA [17]. We restored the potential nonsense mutation in orf1, called fimB, via site-directed mutagenesis. Restoration of fimB resulted in the production of shortened fimbriae of approximately 150 nm. Together, our previous findings indicate that ATCC 33277 harbors a fimB mutation that leads to the production of unusual FimA fimbriae, at least with regard to length and cell anchoring ability. Because of this unique characteristic, FimA fimbriae of ATCC 33277 and its derivatives have been selectively and easily isolated from the bacterial cell surface through mechanical shearing such as pipetting and stirring without disrupting the bacterial cells [8, 18]. However, this method is applicable only for this type strain. Here we present modified protocols for purifying intact Mfa1 fimbriae. Mfa1 fimbriae can be purified via ion-exchange chromatography from cells lysed using a French pressure cell [10–13, 15, 16]. This may help purify Mfa1 fimbriae from most P. gingivalis strains. The purity of Mfa1 fimbriae can be confirmed through sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE), immunoblotting, and electron microscopy.

2

Materials Prepare all solutions using ultrapure water and analytical-grade reagents. Prepare all reagents at ambient temperature, unless indicated otherwise. Before preparing any materials, carefully read the safety guidelines for chemical material and wear appropriate safety equipment. Diligently follow all waste disposal regulations when disposing of waste materials.

Purification of Mfa1 Fimbriae from P. gingivlis

2.1 Cultivation of P. gingivalis

77

1. P. gingivalis JI-1 (see Note 1) [10]. 2. Blood agar plate: Dissolve 9.4 g of Brucella HK Agar powder (Kyokuto) in 200 mL of distilled water, and sterilize at 115  C in an autoclave. Place the medium in a water bath at 52  C and add 10 mL of laked rabbit blood, 5 μg/mL hemin, 1 μg/mL menadione, and 5 μg/mL chloramphenicol. Pour the medium into petri dishes. Seal the agar plates in a plastic bag and store (see Note 2). 3. Trypticase soy broth (TSB) medium: Dissolve 60 g of TSB powder and 5 g of yeast extract in 2 L of distilled water. Dispense the solution in 1-L glass bottles. Autoclave at 121  C. Add 5 μg/mL hemin, 1 μg/mL menadione, and chloramphenicol to the liquid medium prior to inoculation with P. gingivalis (see Note 3). 4. Anaerobic incubator: Periodically inject a mixture of gases comprising 80% N2, 10% H2, and 10% CO2 into a hermetically sealed incubator. 5. Phosphate-buffered saline (PBS): Mix 137 mM NaCl, 2.68 mM KCl, 10 mM Na2HPO4, and 2 mM KH2PO4 at pH 7.4.

2.2 Preparation and Isolation of Fimbriae 2.2.1 Preparation of the Soluble Fraction from P. gingivalis Cells

1. P. gingivalis cells (see Subheading 3.1.1). 2. Centrifuge. 3. French pressure cell (Ohtake Works) (see Note 4). 4. 10 mM HEPES-NaOH (pH 7.4). 5. Nα-p-tosyl-L-lysine chloromethyl ketone (TLCK): 10 mM stock solution in ethanol. Store at 20  C. 6. Phenylmethyl sulfonyl fluoride (PMSF): 20 mM stock solution in ethanol. Store at 20  C. 7. Leupeptin: 10 mM stock solution in water. Store at

20  C.

8. 10 mM HEPES–NaOH (pH 7.4) containing protease inhibitors: 10 mM HEPES–NaOH (pH 7.4) containing protease inhibitors (0.1 mM TLCK, 0.2 mM PMSF and 0.1 mM leupeptin). 9. Ammonium sulfate. 10. 20 mM Tris–HCl (pH 8.0). 11. Ultracentrifuge. 12. Ultracentrifuge rotor. 13. Teflon homogenizer. 14. Dialysis tubing.

78

Yoshiaki Hasegawa et al.

2.2.2 Isolation and Purification of Fimbriae

1. The soluble fraction of P. gingivalis cells (see Subheading 3.1.2). 2. Diethylaminoethyl (DEAE) Sepharose Fast Flow anion exchange chromatography resin (GE Healthcare). 3. Chromatography column (2  20 cm). 4. Ring stand. 5. Peristaltic pump. 6. Spectrophotometer. 7. 20 mM Tris–HCl (pH 8.0). 8. 0.3 M NaCl in 20 mM Tris–HCl (pH 8.0). 9. Ammonium sulfate. 10. Dialysis tubing (molecular weight cutoff of 12–14 kDa). 11. Centrifuge. 12. Bradford protein assay kit (Pierce BCA Protein Assay Kit, Thermo Fisher Scientific).

2.3

SDS-PAGE

1. Purified Mfa1 fimbriae (see Subheading 3.1.3). 2. SDS-PAGE sample loading buffer with 2-mercaptoethanol (2-ME). 3. Electrophoresis buffer: 25 mM Tris–192 mM glycine–0.1% SDS (pH 8.3). 4. 12% polyacrylamide gels. 5. SDS-PAGE apparatus. 6. Heat block. 7. Molecular markers. 8. Coomassie brilliant blue (CBB) R-250.

2.4

Immunoblotting

1. Purified Mfa1 fimbriae (see Subheading 3.1.3). 2. SDS-PAGE sample loading buffer with 2-ME. 3. Electrophoresis buffer: 25 mM Tris–192 mM glycine–0.1% SDS (pH 8.3). 4. 12% polyacrylamide gels. 5. SDS-PAGE apparatus. 6. Transfer buffer: 20 mM Tris, 150 mM glycine, 0.02% SDS, and 20% methanol. 7. Polyvinylidene difluoride (PVDF) membrane. 8. Blotting apparatus: Wet system. 9. Tris-buffered sodium chloride solution (TBS): 20 mM Tris– HCl (pH 7.5) containing 0.5 M NaCl. 10. TBS-T: TBS containing 0.05% Tween 20.

Purification of Mfa1 Fimbriae from P. gingivlis

79

11. 1% skim milk in TBS-T: TBS containing 1% skim milk. 12. Anti-Mfa1 fimbriae antibody [12, 13]. 13. HRP-conjugated goat anti-rabbit IgG. 14. ECL Prime western (GE Healthcare). 2.5 Electron Microscopy

blotting

detection

system

1. Purified Mfa1 fimbriae (see Subheading 3.1.3). 2. Nickel grid with formvar carbon support or grid coated with formvar carbon (see Note 5). 3. 1% ammonium molybdate, pH 7.0. 4. Transmission electron microscope (TEM, Hitachi H-600).

3

Methods

3.1 Preparation and Isolation of Fimbriae 3.1.1 Culturing of P. gingivalis

1. Culture P. gingivalis for 1 week on a blood agar plate in an anaerobic chamber at 37  C. 2. Pick a few colonies from the agar plate and inoculate them in 5 mL of fresh TSB medium. Incubate the culture in an anaerobic chamber at 37  C for 1 day. 3. Inoculate the 5-mL P. gingivalis culture into 100 mL of fresh TSB medium. Incubate in an anaerobic chamber at 37  C for 2 days. 4. Inoculate the 100-mL P. gingivalis culture into 2 L of fresh TSB medium. Incubate in an anaerobic chamber at 37  C for 2 days (see Note 6). 5. Centrifuge the bacterial culture at 5000  g for 15 min at 4  C. Discard the supernatant. Suspend the bacterial cells with 500 mL of PBS. 6. Centrifuge bacterial suspension at 5000  g for 15 min at 4  C. Discard the supernatant. Suspend the bacterial cells with 200 mL of PBS. 7. Centrifuge bacterial suspension at 5000  g for 15 min at 4  C. Discard the supernatant (see Note 7).

3.1.2 Preparation of the Soluble Fraction

1. Resuspend the pellet in 30 mL of 10 mM HEPES-NaOH (pH 7.4) containing protease inhibitors. Disrupt bacterial cells in a French pressure cell through three passes at 100 MPa at 4  C. 2. Centrifuge at 1000  g for 15 min at 4  C to eliminate residual intact bacterial cells. 3. Harvest the supernatant containing bacterial lysates.

80

Yoshiaki Hasegawa et al.

4. Ultracentrifuge the bacterial lysates at 100,000  g for 1 h at 4  C to eliminate the insoluble (membrane) fraction (see Note 8). 5. Harvest the supernatant as the soluble fraction. 6. Wash the insoluble (membrane) fraction with 10 mL of 10 mM HEPES-NaOH (pH 7.4) containing protease inhibitors, using a Teflon homogenizer (see Note 9). 7. Ultracentrifuge the suspension at 100,000  g for 1 h at 4  C to eliminate the insoluble fraction. 8. Harvest the supernatant and mix it with the soluble fraction. 9. Precipitate proteins by addition of ammonium sulfate to 50% saturation into the soluble fraction. Stir for 3 h at 4  C (see Note 10). 10. Centrifuge the mixture at 14,000  g for 30 min at 4  C. Eliminate the supernatant and dissolve the pellet in 5 mL of 20 mM Tris–HCl (pH 8.0). 11. Dialyze the mixture, using dialysis tubing, against 2 L of 20 mM Tris–HCl (pH 8.0) for 24 h at 4  C. 3.1.3 Isolation and Purification of Fimbriae

1. Clamp the chromatography column onto a ring stand to ensure that it is upright. 2. Pour the slurry for the DEAE Fast Flow anion exchange chromatography resin into the chromatography column and wait for 1 h to allow resin to settle. 3. Equilibrate the affinity chromatography column with 10-bed volume of 20 mM Tris–HCl (pH 8.0). Set the flow rate of peristaltic pump at approximately 0.5 mL/min. 4. Carefully load the protein sample onto the top of the chromatography column. 5. Wash the column with 10-bed volume of 20 mM Tris–HCl (pH 8.0). 6. Elute the proteins through a linear salt gradient from 0 to 0.3 M NaCl in 20 mM Tris–HCl (pH 8.0) with a total volume of 400 mL. Monitor the absorbance at 280 nm (A280) using a spectrophotometer (Fig. 1). 7. Subject peak fractions and its margins at A280 to SDS-PAGE analysis (see Notes 11 and 12). 8. Collect fractions showing a band of Mfa1 monomer protein (at ~70 kDa). 9. Precipitate proteins by addition of ammonium sulfate to 50% saturation into the soluble fraction. Stir for 3 h at 4  C (see Note 10).

C

0.2

Fraction #

0.1

NaCl (M)㸦…㸧

0.3

A280㸦

A 㸧

Purification of Mfa1 Fimbriae from P. gingivlis

0

81

50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 kDa 150 100 75

Fraction #

㸧

0.2

0.1

37 NaCl (M)㸦…㸧

0.3

A280 㸦

50

B

25 20 10

0 Fraction #

Fig. 1 Isolation of Mfa1 fimbriae. (a) Elution profile of the first ion-exchange chromatography (see steps 4–8 in Subheading 3.1.3). Each fraction was collected at a flow rate of approximately 0.5 mL/min (5 mL/tube). (b) Elution profile of the second ion-exchange chromatography (see step 12 in Subheading 3.1.3). Each fraction was collected at a flow rate of approximately 0.5 mL/min (5 mL/tube). (c) Sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and Coomassie Brilliant Blue (CBB) staining of the fraction containing Mfa1 fimbriae. Fractions 50–65 (10 μL each) from the second elution corresponding to the peak were subjected to SDS-PAGE, followed by CBB staining

10. Centrifuge the mixture at 14,000  g for 30 min at 4  C. Eliminate the supernatant and dissolve the pellet in 10 mL of 20 mM Tris–HCl (pH 8.0). 11. Dialyze using dialysis tubing against 2 L of 20 mM Tris–HCl (pH 8.0) for 24 h at 4  C. 12. Repeat steps 4–9. 13. Centrifuge the mixture at 14,000  g for 30 min at 4  C. Harvest the pellet and dissolve it in 2 mL of 20 mM Tris– HCl (pH 8.0). 14. Dialyze using dialysis tubing against 2 L of 20 mM Tris–HCl (pH 8.0) for 24 h at 4  C. 15. Determine the protein concentration of the sample, using a Bradford protein assay kit in accordance with the manufacturer’s instructions. 3.2 Assays for the Purity of Fimbriae

Check the purity of the sample via SDS-PAGE, immunoblotting, and electron microscopy.

82

Yoshiaki Hasegawa et al.

kDa 150 100

Mfa5

75 50

Mfa1

37

Mfa3

25 20

Mfa4

10

Fig. 2 Sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and Coomassie brilliant blue (CBB) staining of the purified Mfa1 fimbriae (5 μg/ lane). The Mfa1 band indicated with a bold arrow was clearly detected. Mfa3, Mfa4, and Mfa5 are indicated with thin arrows as the accessory proteins of Mfa1 fimbriae [10–13, 15] 3.2.1 SDS-PAGE

1. Mix a sample of the purified Mfa1 fimbriae (5 μg/lane) with SDS-PAGE sample loading buffer containing 2-ME. 2. Denature the samples at 100  C for 5 min. 3. Apply the sample and perform SDS-PAGE under constant voltage at 100 V. 4. Visualize the proteins by CBB staining (Fig. 2).

3.2.2 Immunoblotting

1. Mix a sample of the purified Mfa1 fimbriae (1 μg/lane) with SDS-PAGE sample loading buffer containing 2-ME. 2. Denature the samples through heating (see Note 13). 3. Apply the sample and perform SDS-PAGE under constant voltage at 100 V. 4. Transfer proteins from gels onto PVDF membranes with transfer buffer at 100 V for 1 h (see Note 14). 5. Wash the membranes with TBS-T for 15 min. 6. Block the membranes with 1% skim milk in TBS-T for 30 min. 7. Incubate the membranes with primary antibody (anti-Mfa1 fimbriae, 1:4000) in 1% skim milk in TBS-T for 5 h. 8. Wash the membranes thrice with TBS-T for 15 min each.

Purification of Mfa1 Fimbriae from P. gingivlis

1

2

3

4

83

5

kDa 220 120 100 80 60 50 40 30 20 Fig. 3 Immunoblotting with anti-Mfa1 antibody. Mfa1 fimbriae (1 μg/lane) in SDS-containing buffer was heated at 100  C for 5 min (1), 100  C for 1 min (2), 80  C for 15 min (3), 80  C for 10 min (4), or 80  C for 5 min (5), and subjected to SDS-PAGE. Thereafter, immunoblotting was performed using anti-Mfa1 antibody. Mfa1 fimbriae were denatured by heating at 80  C for 5 min, which resulted in a ladderlike pattern, whereas denaturation via heating at 100  C for 5 min resulted in a single band at the sizes corresponding to the monomer [12, 19, 20]

9. Incubate the membranes with the secondary antibody (HRP-conjugated goat anti-rabbit IgG, 1:4000) in 1% skim milk in TBS-T for 5 h. 10. Wash the membranes twice with TBS-T for 15 min each time, then once with TBS for 15 min. 11. Develop the membrane with ECL Prime western blotting detection system in accordance with the manufacturer’s instructions (Fig. 3). 3.2.3 Electron Microscopy

1. Apply 10 μL of the purified fimbriae onto the nickel grid with formvar carbon support and hold for 30 s (see Note 15). 2. Absorb the excess sample using filter paper from the edge of the grid (see Note 16).

84

Yoshiaki Hasegawa et al.

Fig. 4 Electron micrograph of the purified Mfa1 fimbriae. Mfa1 fimbriae were negatively stained with 1% ammonium molybdate. Scale bar, 100 nm. Most fibers of Mfa1 fimbriae are approximately 100 nm long

3. Apply 10 μL of 1% ammonium molybdate on the grid and hold for 1 min. 4. Repeat steps 2 and 3. 5. Completely absorb the excess, using filter paper from the edge of the grid. Then, air-dry the grid for 10 min before viewing it using a TEM (Fig. 4).

4

Notes 1. In our laboratory, this procedure is used to obtain native Mfa1 fimbriae from the fimA-deficient strain named JI-1 [10], which is derived from P. gingivalis ATCC 33277, to prevent contamination with FimA fimbriae. 2. The agar plates in a plastic bag can be stored at 4  C for a month. 3. Place the aliquots of TSB medium in anaerobic conditions 3 days before use to eliminate oxygen. 4. To prevent damage to fimbriae, bacterial cells should be disrupted using a French pressure cell. Sonication should be avoided during the isolation process to minimize shearing of the fimbrial structures.

Purification of Mfa1 Fimbriae from P. gingivlis

85

5. We usually use a commercially available hydrophilized TEM grid (Okenshoji). 6. Monitor bacterial growth using a spectrophotometer to measure optical density (OD) at 600 nm (OD600). The OD600 usually exceeds 2.0 in 2 days. 7. Proceed with preparation of the soluble fraction or otherwise store it at 20  C until further use. 8. A brown, jellylike pellet precipitate should be obtained at the bottom of the tube. 9. Transfer the entire brown, jellylike pellet to a Teflon homogenizer, using a spatula. This step can increase the recovery of solubilized Mfa1 fimbriae from the pellet. 10. Ammonium sulfate should be added gradually over 1 h with gentle stirring. 11. Mfa1 fimbriae are usually eluted between 0.17 and 0.22 M NaCl (Fig. 1). 12. We recommend confirming the fraction corresponding to the peak via SDS-PAGE. Briefly, mix up to three volumes of the samples from ion-exchange chromatography with one volume of SDS-PAGE sample loading buffer containing 2-ME. Denature the samples at 100  C for 5 min. Thereafter, perform SDS-PAGE and CBB staining (see Subheading 3.2.1). 13. Denaturation of Mfa1 fimbriae by heating at 80  C results in a ladderlike pattern owing to partial dissociation of the Mfa1 polymers during SDS-PAGE, whereas denaturation by heating at 100  C results in a single band at the size corresponding to the monomer [12, 19, 20]. 14. It is necessary to treat the PVDF membrane in methanol before immunoblotting. 15. It is necessary to dilute the sample of the purified Mfa1 fimbriae approximately tenfold with 20 mM Tris–HCl (pH 8.0). 16. Avoid completely drying the grid in order to avoid artifacts.

Acknowledgments This study was supported, in part, by JSPS KAKENHI Grant Numbers 16K11466 (Y.H.) and Furukawa funding, Aichi Gakuin University (Y.H.). We thank Fuminobu Yoshimura for helpful advice and technical assistance at the initial stage of this study. We would like to thank Editage (www.editage.com) for English language editing.

86

Yoshiaki Hasegawa et al.

References 1. Lamont RJ, Jenkinson HF (1998) Life below the gum line: pathogenic mechanisms of Porphyromonas gingivalis. Microbiol Mol Biol Rev 62:1244–1263 2. Hajishengallis G, Lamont RJ (2016) Dancing with the stars: how choreographed bacterial interactions dictate nososymbiocity and give rise to keystone pathogens, accessory pathogens, and pathobionts. Trends Microbiol 24:477–489 3. Hajishengallis G, Lamont RJ (2012) Beyond the red complex and into more complexity: the polymicrobial synergy and dysbiosis (PSD) model of periodontal disease etiology. Mol Oral Microbiol 27:409–419 4. Xu Q, Shoji M, Shibata S et al (2016) Distinct type of pilus from the human microbiome. Cell 165:690–703 5. Hospenthal MK, Costa TRD, Waksman G (2017) A comprehensive guide to pilus biogenesis in Gram-negative bacteria. Nat Rev Microbiol 15(6):365–379 6. Yoshimura F, Murakami Y, Nishikawa K et al (2009) Surface components of Porphyromonas gingivalis. J Periodontal Res 44:1–12 7. Dickinson DP, Kubiniec MA, Yoshimura F et al (1988) Molecular cloning and sequencing of the gene encoding the fimbrial subunit protein of Bacteroides gingivalis. J Bacteriol 170 (4):1658–1665 8. Yoshimura F, Takahashi K, Nodasaka Y et al (1984) Purification and characterization of a novel type of fimbriae from the oral anaerobe Bacteroides gingivalis. J Bacteriol 160:949–957 9. Hamada N, Sojar HT, Cho MI et al (1996) Isolation and characterization of a minor fimbria from Porphyromonas gingivalis. Infect Immun 64:4788–4794 10. Hasegawa Y, Iwami J, Sato K et al (2009) Anchoring and length regulation of Porphyromonas gingivalis Mfa1 fimbriae by the downstream gene product Mfa2. Microbiology 155:3333–3347

11. Hasegawa Y, Nagano K, Ikai R et al (2013) Localization and function of the accessory protein Mfa3 in Porphyromonas gingivalis Mfa1 fimbriae. Mol Oral Microbiol 28:467–480 12. Ikai R, Hasegawa Y, Izumigawa M et al (2015) Mfa4, an accessory protein of Mfa1 fimbriae, modulates fimbrial biogenesis, cell autoaggregation, and biofilm formation in Porphyromonas gingivalis. PLoS One 10(10): e0139454 13. Hasegawa Y, Iijima Y, Persson K et al (2016) Role of Mfa5 in expression of Mfa1 fimbriae in Porphyromonas gingivalis. J Dent Res 95:1291–1297 14. Nishiyama SI, Murakami Y, Nagata H et al (2007) Involvement of minor components associated with the FimA fimbriae of Porphyromonas gingivalis in adhesive functions. Microbiology 153:1916–1925 15. Kloppsteck P, Hall M, Hasegawa Y et al (2016) Structure of the fimbrial protein Mfa4 from Porphyromonas gingivalis in its precursor form: implications for a donor-strand complementation mechanism. Sci Rep 6:22945 16. Park Y, Simionato MR, Sekiya K et al (2005) Short fimbriae of Porphyromonas gingivalis and their role in coadhesion with Streptococcus gordonii. Infect Immun 73:3983–3989 17. Nagano K, Hasegawa Y, Murakami Y et al (2010) FimB regulates FimA fimbriation in Porphyromonas gingivalis. J Dent Res 89:903–908 18. Shoji M, Shibata S, Naito M et al (2020) Transport and polymerization of Porphyromonas gingivalis type V pili. Methods Mol Biol 2210: 61–75 19. Hall M, Hasegawa Y, Yoshimura F et al (2018) Structural and functional characterization of shaft, anchor, and tip proteins of the Mfa1 fimbria from the periodontal pathogen Porphyromonas gingivalis. Sci Rep 8(1):1793 20. Nagano K, Hasegawa Y, Yoshida Y et al (2017) Novel fimbrilin PGN_1808 in Porphyromonas gingivalis. PLoS One 12(3):e0173541

Chapter 9 Crystallization of Recombinant Fimbrial Proteins of Porphyromonas gingivalis Thomas Heidler and Karina Persson Abstract Porphyromonas gingivalis fimbriae play a critical role in colonization. Elucidation of the fimbrial structure in atomic detail is important for understanding the colonization mechanism and to provide means to combat periodontitis. X-ray crystallography is a technique that is used to obtain detailed information of proteins along with bound ligands and ions. Crystallization of the protein of interest is the first step toward structure determination. Unfortunately it is not possible to predict the crystallization condition of a certain protein or even if the protein can be crystallized. Protein crystallization is, on the contrary, a matter of trial and error. However, the best strategy for success is to focus on the protein purification step to obtain a sample that is pure, stable, homogeneous and of high concentration. This chapter addresses general methods for crystallization of fimbrial proteins. Key words Protein purification, Crystallization, Optimization, Fimbriae

1

Introduction Fimbriae are extracellular proteins or protein polymers that bacteria use for attachment to other bacteria, surfaces, or host cells. Porphyromonas gingivalis is periodontal pathogen that causes chronic inflammation and tooth loss [1] but is also associated with other systemic diseases [2, 3]. The presence of its two fimbriae, FimA and Mfa1, is essential for its adhesive function and virulence. Consequently, both P. gingivalis fimbriae constitute promising targets for the development of antiadhesive substances in order to combat periodontal disease. Fimbrial proteins are in general a very diverse group of proteins, and their structure and polymerization mechanism depend firstly on if they are expressed by gram-positive or gram-negative bacteria. Many of the gram-positive bacteria use intermolecular isopeptide bonds (amide bonds between the side chain of a lysine to the side chain of an aspartic acid or an asparagine) to attach fimbrial proteins to each other during polymerization [4]. These

Keiji Nagano and Yoshiaki Hasegawa (eds.), Periodontal Pathogens: Methods and Protocols, Methods in Molecular Biology, vol. 2210, https://doi.org/10.1007/978-1-0716-0939-2_9, © Springer Science+Business Media, LLC, part of Springer Nature 2021

87

88

Thomas Heidler and Karina Persson

fimbrial proteins may be further stabilized by intramolecular isopeptide bonds, and in some organisms such as Actinomyces and Corynebacteria, but not streptococci, also by several disulfide bonds [5–7]. The presence of intramolecular isopeptide bonds makes the proteins stable and can therefore have a positive effect on crystallization, whereas a large number of cysteines can be detrimental for crystallization due to incorrect disulfide pairing. Gram-positive fimbrial proteins are often built up from several domains and the motion between these domains may be unfavorable for crystal formation [8]. Therefore, it can be fruitful to clone and express the individual domains separately. Some of the fimbriae expressed by gram-negative bacteria may depend on a donor-strand exchange mechanism during polymerization, for instance for the assembly of type-I fimbria [9]. This means that the fimbrial proteins fold with an incomplete β-sheet where one strand is missing. This void in the β-sheet is to be filled by the N-terminal strand from another subunit during polymerization, but before that, the empty position in the sheet is filled by a β-strand from a chaperone. These fimbrial proteins cannot be expressed in soluble forms, unless they are coexpressed with their chaperone or in an engineered form where an extra strand has been introduced to fill the gap [10]. Both fimbriae expressed by the gram-negative P. gingivalis are fimbriae of type-V and form polymers comprised of five different proteins, FimA–E and Mfa1–5, respectively. Type-V fimbriae are also likely to use a donor-strand exchange mechanism for polymerization; however, instead of a chaperone donor strand, the protein is expressed with a complete β-sheet from which the first strand is cleaved off and replaced with a strand from a neighboring subunit during polymerization. The assembly mechanism of type-V fimbriae is still poorly understood [11, 12]. In order to study the structure of fimbriae in their native polymerized forms cryo-electron microscopy techniques are recommended. However, for characterization of fimbrial proteins in atomic detail it is advisable to express the individual proteins in recombinant form, and study them using X-ray crystallography methods. For that, high-quality protein crystals are needed. Preparation of a protein sample suitable for structure determination starts with a careful bioinformatics examination of the protein sequence in order to design the optimal construct for expression. An ideal expression construct lays ground for high protein expression and a stable product. In short, purity, stability, and homogeneity of the protein sample are parameters that are crucial for the start of a successful crystallization project.

Crystallization

2

89

Materials Use commercial crystallization kits for initial screening. For optimization use analytical grade chemicals. Filter all solutions (0.22 μm) to avoid uncontrolled nucleation due to dust particles or aggregates. Filtration also hinders microbial contamination. Use fresh ultrapure water for crystallization setups.

2.1

Initial Screening

1. Premade crystallization kits (see Note 1). 2. 96-well sitting-drop crystallization plates (see Note 2). 3. An eight-channel pipette. 4. Automatic pipette, or a crystallization robot. 5. Optically clear tape (Hampton Research or Molecular Dimensions). 6. A stereomicroscope with zoom. 7. A tabletop centrifuge.

2.2

Optimization

1. A set of buffers with a wide range of pH values (see Note 3). 2. Stock solutions of polymeric or organic precipitants: polyethylene glycols (PEG), ethylene glycol, 2-methyl-2,4-pentanediol. Store at 4  C in the dark. 3. Stock solutions of salt precipitants: ammonium sulfate, ammonium chloride, sodium formate, and other salts. 4. Chemicals that can be used as additives (see Note 4). 5. 48-well or 24-well crystallization plates (see Note 2). 6. Optically clear tape (Hampton Research or Molecular Dimensions). 7. Siliconized glass cover slides or plastic cover slides (Hampton Research, Molecular Dimensions or Jena Bioscience). 8. Seeding tools (Hampton Research, Molecular Dimensions or Jena Bioscience) or actual cat whiskers. 9. α-chymotrypsin: 1 mg/mL stock solution in water (Sigma). Store at 80  C. 10. SYPRO Orange (Invitrogen Molecular Probes): Stock solution (200) in water or buffer. Diluted samples are not stable for longer periods. 11. Chemicals for lysine methylation: Dimethylamine-borane complex (Fluka), formaldehyde. Alternatively, a Methylation kit (Jena Biosciences).

2.3 Cryo Crystallography

1. A set of cryo loops with diameters ranging from 0.025 to 1.0 mm (Molecular Dimensions, Hampton Research or Jena Bioscience).

90

Thomas Heidler and Karina Persson

2. Cryoprotecting solutions: glycerol, PEG 400, ethylene glycol, or oils like Perfluoropolyether Cryo Oil or Parabar 10312 (Hampton Research). 3. Liquid nitrogen. 4. Cryo container (see Note 5).

3

Methods Carry out all procedures at room temperature, unless other temperatures are specified.

3.1 Protein Crystallization

1. Make sure that the protein sample is pure and monodisperse (see Notes 6 and 7). 2. Start with a protein concentration of 10 mg/mL in a low concentration buffer (see Note 8). 3. Spin the protein at high speed for 2 min in a tabletop centrifuge to avoid uncontrolled nucleation due to aggregated protein. 4. Transfer approximately 80 μL of premade crystallization solution from the deep well block to each of the 96 wells of the crystallization plate using the multichannel pipette. 5. Mix equal volumes of crystallization solution and protein. This can be performed manually or by using a crystallization robot (see Note 9). 6. Seal the plate with optically clear tape. 7. Store the plates at room temperature, alternatively at 4  C, in a room without vibrations or temperature fluctuations. 8. Inspect the crystallization plates regularly using a stereomicroscope (make notes if crystals or precipitate appear) (Fig. 1).

3.2

Optimization

1. If only precipitate, low quality crystals, intergrown or very small crystals are obtained, larger and better crystals may be obtained by varying the concentrations of the chemicals of the initial condition (see Note 10). 2. Crystal growth may also be obtained by seeding clear drops with microseeds obtained from initial crystals. This can be done manually or by dispensing seeds using the crystallization robot (see Note 11). 3. The probability of obtaining crystals is higher if the protein is in a buffer that keeps the protein stable. Protein stability is correlated to its melting temperature, which is a parameter that can be measured (see Note 12). The optimal buffer and sometimes the appropriate additive (see Note 4) can be identified by measuring the melting temperature of the protein.

Crystallization

91

Fig. 1 Crystallization drops of a fimbrial protein from Porphyromonas gingvalis. (a) A clear drop (without nucleation sites), (b) a drop with brown precipitate (not a promising condition) and (c) a drop with thin needles (optimization is needed). (d) A drop with single thin crystals in precipitate (optimization is needed). (e) A cluster of crystals where optimization is needed to obtain single crystals, (f) a single well diffracting crystal obtained after α-chymotrypsin treatment

4. Flexible parts of the protein, such as N- and C-termini or loops may hinder crystal packing. In order to facilitate crystal growth, the proteins may be treated with small amounts of proteases in situ to trim off these parts (see Note 13 and Fig. 1). 5. The motion of side chains on the protein surface may also hinder crystal growth. One of these amino acids, lysine, has a long and positively charged side chain that can interfere with crystal growth. In order to lower the entropy of the protein surface and facilitate crystal growth it has been proven useful to methylate the lysines [13] which makes them more rigid and prone to participate in crystal packing (see Note 14).

92

Thomas Heidler and Karina Persson

3.3 Cryoprotection of Crystals

X-ray diffraction data is generally collected at synchrotrons using high energy X-ray radiation. Due to the high intensity of the X-rays the crystals are quickly destroyed by radiation damage. In order to preserve the crystal during data collection the crystals are kept at 100 K in a stream of liquid nitrogen. The crystal should be frozen in a vitreous amorphous glasslike state and not in crystalline ice, since ice crystals will destroy the well-ordered crystal lattice. In order to obtain the glasslike structure it is generally necessary to replace the water content in and around the crystal with a cryoprotectant solution 1. Prepare a cryoprotectant solution (see Note 15). 2. Quickly transfer the crystal to the cryoprotectant solution using a cryo loop. 3. Pick up the cryoprotected crystal using the same loop. 4. Quickly transfer the loop with the crystal to a liquid nitrogen bath. 5. Store the crystal, and the loop, in a cryogenic container until the crystals can be shipped to a synchrotron for data collection.

4

Notes 1. Premade crystallization screens are available from several companies. For example Hampton Research, Molecular Dimensions, Jena Bioscience, Triana Sci&Tech, Emerald BioSystems, and Qiagen. The solutions can be dispensed into deep-well blocks or purchased in predispensed deep-well blocks. The crystallization solutions are generally mixtures of buffers, precipitants, and other additives. Since many different combinations of solutions may need to be screened it is advantageous to use a commercial kit. Initial screening usually starts by using a sparse-matrix screen that covers a large number of different conditions. If enough protein is available, the screening can be extended to cover grid screens where pH and the concentration of a fixed precipitant are systematically varied (e.g., ammonium sulfate or polyethylene glycol). When using a robot, protein and precipitant volumes of 50–200 nL per drop are generally used. 2. Crystallization plates for screening and optimization can be obtained in several forms but 96, 48, or 24-well plates are most common. In addition both sitting-drop and hangingdrop plates are available. Importantly these plates can be used both manually or by pipetting robots.

Crystallization

93

3. The pH of the crystallization solution but also the buffer composition is important for obtaining crystals. For the initial optimization, prepare stock solutions (1 M) of sodium acetate pH 4.6, trisodium citrate pH 5.6, MES pH 6.5, sodium HEPES pH 7.5, Tris–HCl pH 8.5, and bicine pH 9.0. Keep in mind that other buffers or pH values may be optimal for your particular protein. 4. Additives are small molecules that can be added to the crystallization solution to improve the chances of crystal formation. The functions of these molecules are to stabilize the protein or to introduce contacts between the macromolecules. The additives could be purchased from companies supplying crystallization reagents, for instance Additive or Silver bullet screens (Hampton Research). It is also possible to try any chemical available in your lab. 5. Cryo containers are used for storage and transport of cryoprotected crystals. Cryogenic Dewar flasks are produced by Taylor and Worthington Industries and can be ordered from Molecular Dimensions. 6. Protein purity is one of the most important parameters for obtaining crystals; thus, care has to be taken during purification. However, if starting with an overexpressed protein the chance of obtaining pure protein in sufficient amounts is large. Pure protein should preferably be flash-frozen in small aliquots (20–50 μL) and stored at 80  C. Avoid repeated freeze–thaw cycles. 7. Dispersity is a measure of if the protein exists in one or several polymeric forms (e.g., monomeric, dimeric, oligomeric, or a mixture of different forms). It is recommended to use gel filtration as the final step of purification; it functions both as a purification step and as an analytical step making it possible to judge if the protein is homogeneous. A homogeneous protein elutes as a single peak from the gel filtration column; however, if the elution profile shows several peaks, a protein solution with different oligomeric forms should be considered. If the protein elutes in the void it is a sign that the protein forms very large complexes or aggregates, then the chances of obtaining crystals are small. The order of dispersity can be analyzed more exactly with a dynamic light scattering instrument. 8. If possible, change to a low concentration storage buffer (such as 20 mM Tris–HCl or HEPES) with no or only low salt concentration after the final gel filtration step. It is important to avoid phosphate buffers since phosphate ions often form inorganic crystals when mixed with the crystallization solution. It is not possible to predict at what protein concentration to start crystallization screening. Depending on the protein,

94

Thomas Heidler and Karina Persson

crystallization can occur from 0.5 mg/mL to several hundred mg/mL. It is recommended to aim for a protein concentration of 10 mg/mL for the initial sparse matrix screen. If only clear drops are obtained the concentration should be increased, and if dark heavy precipitate is observed in a majority of the drops the protein concentration should be lowered. If light precipitate is found in approximately 30–60% of the drops the protein concentration is in a suitable range for crystal growth. 9. Crystal growth can be obtained by preparing a drop of equal volumes of protein and crystallization solution. The drop is allowed to equilibrate, by vapor diffusion, against a larger volume of the same crystallization solution in a sealed system. During equilibration the concentration of protein and precipitant slowly increase which can induce nucleation if the conditions are favorable. If nucleation occurs, growth of crystals can follow. If enough material is available it is advisable to also screen other protein–precipitant ratios in order to vary the speed of equilibration. 10. When crystals, or a promising precipitate (Fig. 1) are found in the initial screens the conditions may be optimized by changing parameters that influence nucleation and crystal growth; protein concentration, pH, precipitant concentration, temperature, and the presence of additives. For optimization crystallization plates holding larger volumes, such as 48- or 24-well plates can be used. Then it is also possible to use larger protein/precipitant volumes, 0.5–5 μL. 11. There are numerous forms of seeding, for instance streak seeding and micro seeding. Seeding should be performed on clear drops where protein and crystallization solutions are mixed and equilibrated. Use protein concentration lower than in the original drop to avoid spontaneous nucleation. In streak seeding a crystal is touched with a probe, for instance a cat whisker. Seeds are attached to the whisker and transferred to the empty drop as the whisker is drawn across the surface of the drop. In micro seeding, a seed stock is prepared by manually crushing a crystal, for example, with a pipette tip or a needle, and resuspending it in crystallization solution (100–500 μL). The solution is briefly vortexed and spun. Next, the cat whisker is dipped into the seed solution followed by streaking the surface of the new drop. A seed stock can also be obtained with seed beads from companies that provide crystallization reagents. 12. It is advisable to explore the effect that different buffers or additives have on the protein. A useful method is to perform a thermal shift assay. The melting curve of the protein is measured in different conditions, and the more stabilizing effect the buffer or additive has on the protein, the higher the

Crystallization

95

melting temperature gets. Protein melting curves can be monitored by adding a dye, SYPRO Orange, and measuring the change in fluorescence using a Real Time PCR instrument [14]. This method is more reliable for soluble proteins than for membrane proteins. 13. The protein solution is prepared as described above. Immediately before mixing with the crystallization solution a small amount of α-chymotrypsin, trypsin, or another protease of choice is added [11, 15, 16]. The final amount of protease can be 1% (w/w). 14. For lysine methylation two chemicals are needed, dimethylamine-borane complex and formaldehyde. A detailed protocol can be obtained from Protein Production UK [17]. Alternatively, the chemicals can be purchased as a readyto-use kit. 15. Cryoprotection of crystals is obtained by transferring the crystal to crystallization solution supplemented with appropriate concentration of cryoprotective solution, such as 20% PEG 400 or ethylene glycol. The preferred cryoprotective solution is unique for each crystal system. The preferred transfer of crystals to the cryoprotective solution may also be unique. Some crystals can be transferred immediately from the original drop to a drop of cryoprotective solution and then flash-cooled in liquid nitrogen. Other crystals are more sensitive and the cryoprotective need to be added stepwise. References 1. Bostanci N, Belibasakis GN (2012) Porphyromonas gingivalis: an invasive and evasive opportunistic oral pathogen. FEMS Microbiol Lett 333(1):1–9 2. Michaud DS, Izard J, Wilhelm-Benartzi CS et al (2013) Plasma antibodies to oral bacteria and risk of pancreatic cancer in a large European prospective cohort study. Gut 62 (12):1764–1770 3. Leech MT, Bartold PM (2015) The association between rheumatoid arthritis and periodontitis. Best Pract Res Clin Rheumatol 29 (2):189–201 4. Baker EN, Squire CJ, Young PG (2015) Selfgenerated covalent cross-links in the cellsurface adhesins of Gram-positive bacteria. Biochem Soc Trans 43(5):787–794 5. Persson K, Esberg A, Claesson R et al (2012) The pilin protein FimP from Actinomyces oris: crystal structure and sequence analyses. PLoS One 7(10):e48364

6. Kang HJ, Paterson NG, Gaspar AH et al (2009) The Corynebacterium diphtheriae shaft pilin SpaA is built of tandem Ig-like modules with stabilizing isopeptide and disulfide bonds. Proc Natl Acad Sci U S A 106 (40):16967–16971 7. Daniels R, Mellroth P, Bernsel A et al (2010) Disulfide bond formation and cysteine exclusion in gram-positive bacteria. J Biol Chem 285 (5):3300–3309 8. Mishra A, Devarajan B, Reardon ME et al (2011) Two autonomous structural modules in the fimbrial shaft adhesin FimA mediate Actinomyces interactions with streptococci and host cells during oral biofilm development. Mol Microbiol 81(5):1205–1220 9. Hospenthal MK, Costa TRD, Waksman G (2017) A comprehensive guide to pilus biogenesis in Gram-negative bacteria. Nat Rev Microbiol 15(6):365–379

96

Thomas Heidler and Karina Persson

10. Roy SP, Rahman MM, Yu XD et al (2012) Crystal structure of enterotoxigenic Escherichia coli colonization factor CS6 reveals a novel type of functional assembly. Mol Microbiol 86 (5):1100–1115 11. Hall M, Hasegawa Y, Yoshimura F et al (2018) Structural and functional characterization of shaft, anchor, and tip proteins of the Mfa1 fimbria from the periodontal pathogen Porphyromonas gingivalis. Sci Rep 8(1):1793 12. Xu Q, Shoji M, Shibata S et al (2016) A distinct type of pilus from the human microbiome. Cell 165(3):690–703 13. Forsgren N, Lamont RJ, Persson K (2009) Crystal structure of the variable domain of the Streptococcus gordonii surface protein SspB. Protein Sci 18(9):1896–1905

14. Ericsson UB, Hallberg BM, Detitta GT et al (2006) Thermofluor-based high-throughput stability optimization of proteins for structural studies. Anal Biochem 357(2):289–298 15. Dong A, Xu X, Edwards AM et al (2007) In situ proteolysis for protein crystallization and structure determination. Nat Methods 4 (12):1019–1021 16. Kloppsteck P, Hall M, Hasegawa Y et al (2016) Structure of the fimbrial protein Mfa4 from Porphyromonas gingivalis in its precursor form: implications for a donor-strand complementation mechanism. Sci Rep 6:22945 17. Walter TS, Meier C, Assenberg R et al (2006) Lysine methylation as a routine rescue strategy for protein crystallization. Structure (Camb) 14(11):1617–1622

Chapter 10 Enzymatic Characteristics and Activities of Gingipains from Porphyromonas gingivalis Tomoko Kadowaki Abstract Porphyromonas gingivalis is a gram-negative, rod-shaped, nonmotile bacterium belonging to the phylum Bacteroidetes. It produces abundant amounts of proteases in both cell-associated and secretory forms, including a group of cysteine proteases referred to as gingipains, which have attracted much attention due to their high proteolytic activity associated with pathogenicity. Gingipains are grouped into arginine (R)specific (RgpA and RgpB) and lysine (K)-specific (Kgp) types. Both Rgp (collective term for RgpA and RgpB) and Kgp gingipains play crucial roles in the virulence of P. gingivalis, including the degradation of host periodontal tissues, disruption of host defense mechanisms, and loss of viability in host cells, such as fibroblasts and endothelial cells. In addition to their function in virulence, gingipains are also essential for the growth and survival of P. gingivalis in periodontal pockets through the acquisition of amino acids and heme groups. Furthermore, Rgp and Kgp gingipains are critical in processing fimbriae and several bacterial proteins that contribute to hemagglutination, coaggregation, and hemoglobin binding. This chapter describes the methods used to analyze gingipains. Key words Gingipain, Rgp, Kgp, Protease inhibitors, Virulence, Vascular permeability

1

Introduction Periodontal diseases are chronic inflammatory diseases occurring in approximately 60% of adult humans [1]. Typically found in the oral cavity, Porphyromonas gingivalis is a gram-negative bacterium that is implicated in adult chronic periodontitis. P. gingivalis produces several virulence factors, including proteases, lipopolysaccharide, hemagglutinins, and fimbriae [2, 3]. Among these virulence factors, a unique class of cysteine proteinases, referred to as gingipains, is responsible for a wide range of pathophysiological processes of P. gingivalis [4]. Gingipains are grouped into arginine-specific (Rgp) and lysine-specific (Kgp) subtypes. There are two types of Rgp, namely RgpA, which contains proteolytic and adhesin domains at its C-terminus, and RgpB, which only contains a proteolytic domain [5, 6]. However, there is only one type of Kgp, and

Keiji Nagano and Yoshiaki Hasegawa (eds.), Periodontal Pathogens: Methods and Protocols, Methods in Molecular Biology, vol. 2210, https://doi.org/10.1007/978-1-0716-0939-2_10, © Springer Science+Business Media, LLC, part of Springer Nature 2021

97

98

Tomoko Kadowaki

it contains both proteolytic and adhesin domains [7]. It is worth mentioning that there are similarities between the adhesin domain sequences of Kgp and RgpA. Our previous studies using gingipaindeficient mutants [8–11] and proteinase inhibitors specific for Rgp (KYT-1) and Kgp (KYT-36) [12–14] revealed several functions of gingipains, for example, destruction of periodontal tissues, disruption of host defense mechanisms, processing of bacterial cellsurface and secretory proteins, and acquisition of heme groups and amino acids. Rgp degrades immunoglobulin G (IgG) [15], collagen types I and IV [15, 16], cytokines, and adhesion molecules on gingival fibroblasts [17] and Kgp degrades IgG [18, 19]. In terms of proteolytic processing of bacterial proteins necessary for maturation, Rgp processes fimbrilin (FimA), a vital component of fimbriae [10]. Furthermore, hemagglutinins and hemoglobinbinding proteins encoded by internal regions of rgpA and kgp genes are converted to functional molecules by autoproteolytic processing by Rgp and Kgp [8, 20, 21]. Recent studies have reported the association of gingipains with various systemic diseases, such as cardiovascular diseases [9, 22], rheumatoid arthritis [23], preterm birth and low birth weight [11], and Alzheimer’s disease [24, 25]. Consequently, gingipains have received considerable attention, not only due to their high degree of virulence against the host, but also because of their contribution to the survival, virulence, and maturation of extracellular proteins of P. gingivalis. Here, the methods for measuring the activities of gingipains, analyzing their cytotoxicity, and enhancing their vascular permeability are described.

2

Materials In this protocol, the use of ultrapure water (prepared by purifying deionized water to attain a sensitivity of 18 MΩ cm at 25
C) and analytical grade reagents is vital for preparing all solutions. Additionally, all reagents should be stored at 25
C unless indicated otherwise.

2.1 Gingipain Sample Preparation

1. 0.5 mg/mL hemin stock solution: Dissolve 50 mg of hemin in 1 mL of 1 N NaOH, and add this solution to 99 mL of water in a glass bottle. Autoclave and store at 4
C. 2. 5 mg/mL menadione (vitamin K) stock solution: Dissolve 25 mg of vitamin K in 5 mL of pure ethanol. Stored at 4
C. 3. Brain-heart infusion (BHI) liquid medium: Weigh 3.7 g of BHI, 0.5 g of yeast extract, and 0.1 g of L-cysteine into a 100 mL glass bottle. Add water to adjust the final volume of the solution to 100 mL. Mix well and autoclave. Before inoculation with P. gingivalis, supplement the autoclaved liquid medium with 5 μg/mL hemin and 1 μg/mL menadione.

Experimental Protocol for Analyzing Gingipain Characteristics and Activities

99

4. Phosphate-buffered saline (PBS): Prepare a stock solution (10) as follows. 1.37 M NaCl, 0.027 M KCl, 0.081 M Na2HPO4, and 0.015 M KH2PO4; pH 7.4. Dilute ten times with water and sterilize by autoclaving. Store at room temperature. 5. Lysis buffer for measurement of proteolytic activities: PBS containing 0.1% Triton X100. 6. Lysis buffer for sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE): Add 1 μL of each of the 10 mM stock solutions of the protease inhibitors TLCK (DMSO solution), TPCK (DMSO solution), and leupeptin (ultrapure water solution) to 100 μL of PBS containing 0.1% Triton X-100. 7. Anaerobic incubator. 8. Centrifuge. 9. Ultrasonic disruptor or French pressure cell press. 2.2 Substrates for Rgp

1. Carbobenzoxy-L-phenylalanyl-L-arginine-4-methylcoumaryl7-amide (Z-Phe-Arg-MCA): Prepare a 1 mM stock solution in dimethyl sulfoxide (DMSO) and store in the dark at 20
C. Just before use, dilute the stock solution with cold water to make a 20 μM working solution. Keep the working solution in the dark at 4
C. 2. t-Butyloxycarbonyl-L-phenylalanyl-L-seryl-L-arginine-4methylcoumaryl-7-amide (Boc-Phe-Ser-Arg-MCA): Prepare a 1 mM stock solution in DMSO, and store it in the dark at 20
C. Just before use, dilute the stock solution with cold water to make a 20 μM working solution. Keep the working solution in the dark at 4
C. 3. Nα-Benzoyl-DL-arginine 4-nitroanilide (BApNA): Prepare a 100 mM stock solution with DMSO and store it in the dark at 20
C. Just before use, dilute the stock solution with cold water to make a 4 mM working solution. Keep the working solution in the dark at 4
C.

2.3 Substrates for Kgp

1. t-Butyloxycarbonyl-L-valyl-L-leucyl-L-lysine-4-methylcoumaryl-7-amide (Boc-Val-Leu-Lys-MCA): Prepare a 1 mM stock solution in DMSO, and store it in the dark at 20
C. Just before use, dilute the stock solution with cold water to make a 20 μM working solution. Keep the working solution in the dark at 4
C. 2. Carbobenzoxy-L-histidyl-L-glutamyl-L-lysine-4-methylcoumaryl-7-amide (Z-His-Glu-Lys-MCA): Prepare a 1 mM stock solution in DMSO, and store it in the dark at 20
C. Just before use, dilute the stock solution with cold water to make a 20 μM working solution. Keep the working solution in the dark at 4
C.

100

Tomoko Kadowaki

3. L-Lysine-p-nitroanilide dihydrobromide: Prepare a 100 mM stock solution with DMSO, and store it in the dark at 20
C. Just before use, dilute the stock solution with cold water to make a 4 mM working solution. Keep the working solution in the dark at 4
C. 2.4 Protein Substrates

1. 5% hemoglobin solution: Dissolve 5 g of bovine hemoglobin in water, and adjust the final volume to 100 mL. Remove undissolved residue by filtration using a qualitative filter paper. 2. 2% casein solution: Dissolve 2 g casein in approximately 90 mL of water; adjust the pH to 10 using NaOH. Completely dissolve casein and then adjust the pH to 7.5 using HCl. Adjust the final volume to 100 mL. Remove undissolved residue by filtration using a qualitative filter paper. 3. 10% trichloroacetic acid (TCA): Dissolve 10 g TCA in 100 mL water.

2.5 Measurement of Gingipain Activity Using MCA Substrates

1. Gingipain sample (see Subheading 3.1). 2. Phosphate buffer: 0.2 M sodium phosphate buffer, pH 7.5. Dissolve 27.8 g of NaH2PO4 in 1 L of water (solution A). Dissolve 71.7 g of Na2HPO4·12H2O in 1 mL of water (solution B). Mix solutions A and B at volume ratio of 1:5.25. Adjust the pH to 7.5 by adding the appropriate amount of solution A (acidic solution) or solution B (basic solution). 3. L-cysteine: 50 mM solution. Dissolve 60.6 mg L-cysteine in 10 mL water. 4. MCA substrate solution: 20 μM MCA working solutions for Z-Phe-Arg-MCA, Boc-Phe-Ser-Arg-MCA, Boc-Val-Leu-LysMCA, and Z-His-Glu-Lys-MCA. 5. 7-Amino-4-methylcoumarin (AMC) standard solution: Prepare a 1 mM stock solution in DMSO, and store it in the dark at 20
C. Just before use, dilute the stock solution with water at 4
C, to make a 0.1–5.0 μM solutions. 6. 0.1 M sodium acetate buffer, pH 5.0: Prepare a 1 M stock solution. Dilute 11.55 mL of acetic acid with water to obtain a volume of 200 mL (solution A). Dissolve 41.0 g of CH3COONa·3H2O in 500 mL water (solution B). Mix solutions A and B at an volume ratio of 1:2.4. Adjust the pH to 5.0 by adding the appropriate amount of solution A (acidic solution) or solution B (basic solution). Dilute the 1 M stock solution with water to make a 0.1 M solution. 7. Iodoacetic acid: 10 mM iodoacetic acid in 0.1 M sodium acetate buffer, pH 5.0. Dissolve 186 mg of iodoacetic acid in 100 mL of 0.1 M sodium acetate buffer, pH 5.0. 8. Test tube: 13  100 mm glass test tube.

Experimental Protocol for Analyzing Gingipain Characteristics and Activities

101

9. Vortex. 10. Water bath with gentle shaking. 11. Fluorescence spectrophotometer (Hitachi F-2500). 2.6 Measurement of Gingipain Activity Using p-Nitroanilide Substrates

1. Gingipain sample (see Subheading 3.1). 2. 1 M Tris–HCl buffer, pH 7.5: Make a 1 M stock solution. Dissolve 121.1 g of Tris (hydroxymethyl) aminomethane in 900 mL of water. Adjust the pH to 7.5 using HCl. Finally, adjust the volume to 1 L. 3. 1 M CaCl2: Dissolve 1.47 g of CaCl2·2H2O in 10 mL water. 4. 50 mM L-cysteine (see item 3 in Subheading 2.5). 5. Assay buffer for BApNA (2): Mix 100 μL of 1 M Tris–HCl, pH 7.5, 4 μL of 1 M CaCl2, 200 μL of 50 mM cysteine, and 696 μL water. 6. Substrate solution: 4 mM BApNA (see item 3 in Subheading 2.2). 7. 50% acetic acid: Mix equal volumes of acetic acid and water. 8. 96-well plate: Transparent bottom microplates. 9. Incubator. 10. Microplate reader: For absorbance measurement.

2.7 Measurement of HemoglobinHydrolyzing Activity

1. Gingipain sample (see Subheading 3.1). 2. Phosphate buffer (see item 2 in Subheading 2.5). 3. 50 mM L-cysteine (see item 3 in Subheading 2.5). 4. 5% hemoglobin solution (see item 1 in Subheading 2.4). 5. Tyrosine standard solution: 10–100 μg/mL tyrosine solution. Dissolve 1 mg of tyrosine in water to make a 1 mg/mL stock solution. Dilute the stock solution with water to make 10, 20, 40, 60, 80, and 100 μg/mL tyrosine standard solutions. 6. 10% TCA (see item 3 in Subheading 2.4). 7. Lowry–Folin Mixture: Add 1 mL of 1% CuSO4·5H2O in water, 1 mL of 2% sodium or potassium tartrate to 100 mL of 2% Na2CO3 in 0.1 N NaOH (see Note 1). 8. Folin and Ciocalteu’s phenol reagent (see Note 2). 9. Test tube (see item 8 in Subheading 2.5). 10. Vortex mixer. 11. Centrifuge. 12. Incubator or Water bath with shaking. 13. Spectrophotometer.

102

Tomoko Kadowaki

2.8 Measurement of Caseinolytic Activity

1. Gingipain sample (see Subheading 3.1). 2. Phosphate buffer (see item 2 in Subheading 2.5). 3. 50 mM L-cysteine (see item 3 in Subheading 2.5). 4. 2% Casein solution: Dissolve 2 g of casein in approximately 90 mL of water; adjust the pH to 10 using NaOH. Completely dissolve casein and then adjust the pH to 7.5 using HCl. Adjust the final volume to 100 mL. Remove undissolved residue by filtration using a qualitative filter paper. 5. Tyrosine standard solution: 10–100 μg/mL tyrosine solution (see item 5 in Subheading 2.7). 6. 10% TCA (see item 3 in Subheading 2.4). 7. Lowry–Folin mixture (see item 7 in Subheading 2.7). 8. Folin and Ciocalteu’s phenol reagent (see item 8 in Subheading 2.7). 9. Test tube (see item 8 in Subheading 2.5). 10. 1.5-mL tube. 11. Vortex mixer. 12. Centrifuge. 13. Incubator or water bath with shaking. 14. Spectrophotometer.

2.9 Gelatin Zymography

1. Fairbanks solubilizing buffer (5): 50% sucrose, 5 mM ethylenediaminetetraacetic acid (EDTA), 50 mM Tris–HCl, pH 8.0, 10% sodium dodecyl sulfate (SDS), and 20% β-mercaptoethanol. 2. 0.1% bromophenol blue (BPB): Dissolve 0.1 g of BPB in 100 mL of water. Store at room temperature. 3. Separating gel buffer: 1.5 M Tris–HCl, pH 8.8: Dissolve 181.7 g Tris–HCl into 0.9 L water. Mix well and adjust the pH with HCl to 8.8. Add water to a final volume of 1 L. Store at 4
C. 4. Stacking gel buffer: 0.5 M Tris–HCl, pH 6.8: Dissolve 60.6 g Tris–HCl in 0.9 L water. Mix well and adjust the pH with HCl to 6.8. Add water to adjust the final volume to 1 L. Store at 4
C. 5. 30% acrylamide–bisacrylamide solution (acrylamide–bisacrylamide 29.2:0.8): Dissolve 29.2 g of acrylamide monomer and 0.8 g bisacrylamide (cross-linker) in water, and adjust the final volume to 100 mL. Store at 4
C in the dark. 6. 10% ammonium persulfate: Prepare in water before use. 7. 4 mg/mL gelatin: Dissolve 40 mg of gelatin (from porcine skin) in 10 mL of water.

Experimental Protocol for Analyzing Gingipain Characteristics and Activities

103

8. N,N,N,N0 -Tetramethyl ethylenediamine: Store at 4
C. 9. SDS-PAGE running buffer: 0.025 M Tris, 0.2 M glycine, 0.1% SDS. 10. Separating gel: 10% SDS-PAGE gel. Mix 3.75 mL of separating gel buffer, 5 mL of 30% acrylamide–bisacrylamide solution, 0.75 mL of 4 mg/mL gelatin (200 μg/mL at final concentration), and 4.83 mL of water in a 50 mL conical flask. Add 0.31 mL of 10% SDS, 0.36 mL of 10% ammonium persulfate, and 10 μL of TEMED, and cast gel within a gel cassette. Allow space for stacking gel and gently overlay with isobutanol or water. 11. Stacking gel: Prepare the stacking gel by mixing 1.25 mL of stacking gel buffer, 1.0 mL of 30% acrylamide–bisacrylamide solution, and 2.45 mL of water in a 50 mL conical flask. Add 200 μL of SDS, 200 μL of 10% ammonium persulfate, and 5 μL of TEMED. Insert a 10-well gel comb immediately without introducing air bubbles. 12. Staining solution: 0.1% Coomassie Brilliant Blue (R-250) in a solution consisting of 30% methanol and 7% acetic acid in water. 13. De-staining solution I: 40% methanol and 10% acetic acid in water. 14. De-staining solution II: 25% ethanol and 8% acetic acid in water. 15. 2% Triton X-100: Mix 10 mL of 0.2 M phosphate buffer, pH 7.5 (see item 4 in Subheading 2.1), 2 mL of Triton X-100, and 88 mL of water. 16. 20 mM phosphate buffer: Dilute 0.2 M phosphate buffer, pH 7.5, ten times with water. 17. 10 mM dithiothreitol (DTT): Dissolve 15.4 mg DTT in 20 mM phosphate buffer. 18. Incubator. 19. Electrophoresis apparatus. 2.10 LuminolDependent Chemiluminescence (CL) Response of Neutrophils

1. 0.9% NaCl: Dissolve 0.9 g of NaCl in 100 mL of water. 2. Oyster glycogen: 0.2% solution in 0.9% NaCl. Sterilize by autoclaving. 3. Hanks’ Balanced Salt Solution (HBSS): 140 mg/mL CaCl2, 100 mg/mL MgCl2·6H2O, 100 mg/mL MgSO4·7H2O, 400 mg/mL KCl, 60 mg/L KH2PO4, 350 mM NaHCO3, 8000 mg/mL NaCl, 48 mg/mL Na2HPO4, and 1000 mg/ mL D-glucose (see Note 2).

104

Tomoko Kadowaki

4. Guinea pig neutrophils (see Note 3): Intraperitoneally inject 20 mL of oyster glycogen into a female Hartley guinea pig (bodyweight approximately 400 g). Collect the peritoneal exudates at 14 h after injection. Wash the cells with HBSS twice (see Note 4). 5. Zymosan A: 20 mg/mL suspension in 0.9% NaCl. Weigh 20 mg of zymosan A, and suspend it in 1 mL of 0.9% NaCl. 6. Guinea pig serum: Blood sample is obtained from a guinea pig by cardiac puncture and left for about 20 min to form a clot. The sample is centrifuged at 2000  g for 15 min, and the supernatant is collected and used as serum. 7. Luminol: Prepare a 10 mM stock solution by dissolving 1.77 mg of luminol in 1 mL ice-cold ultrapure water, and store it in the dark at 20
C. Just before use, dilute the stock solution with water at 4
C to make a 0.2 mM solution. 8. Hemocytometer. 9. Luminometer: Berthold Microlumat LB 96V. 10. Centrifuge. 11. Incubator. 12. 96-well white plate. 2.11 Measurement of Vascular Permeability In Vivo

3

1. Guinea pig: Female Hartley guinea pig with a bodyweight of approximately 300–400 g. 2. 5% Evans Blue Dye (EBD): Dissolve 50 mg of EBD in 1 mL of PBS (see item 2 in Subheading 2.1).

Methods

3.1 Gingipain Sample Preparation

1. Inoculate a colony of P. gingivalis in 10 mL of BHI liquid medium, and allow the bacterium to grow anaerobically until the medium gets cloudy. 2. Make a tenfold dilution of the P. gingivalis culture in fresh BHI liquid medium and grow the bacteria overnight (see Note 5). 3. Collect the bacterial cells by centrifugation at 6000  g for 15 min at 4
C, and wash twice with ice-cold PBS. 4. Resuspend the bacterial cells in an ice-cold lysis buffer. 5. Lyse the bacterial cells by ultrasonic disruptor or French pressure cell press on ice. 6. Centrifuge the lysate at 25,000  g for 10 min to remove insoluble materials. 7. Collect the resultant supernatant as a cell extract.

Experimental Protocol for Analyzing Gingipain Characteristics and Activities

Rgp

100 % Maximum activity

105

Kgp

80 60 40 20 0 2

3

4

5

6

7

8

9

10

11

12

13

pH

Fig. 1 Optimal pH of Rgp and Kgp. Degradative activities of gingipains toward synthetic substrate (Z-Phe-Arg-MCA for Rgp and Boc-Val-Leu-Lys-MCA for Kgp) were measured at different pH values. Both Rgp and Kgp showed enzymatic activity between pH 5 and 10. Their optimal pH was approximately 7.5 [15, 26] 3.2 Measurement of Gingipain Activity Using MCA Substrates 3.2.1 Gingipain Activity in Sample

1. Add 100 μL of phosphate buffer, 100 μL of L-cysteine, gingipain sample (x μL), and water (300  x μL) to the test tube (see Note 6). 2. Add 500 μL of MCA substrate solution (20 μM) into the tube. 3. Mix well by vortexing and incubate at 40
C for 10 min in a water bath, with gentle shaking. 4. Add 1 mL of iodoacetic acid and mix well by vortexing to stop the reaction (see Note 7). 5. Measure the fluorescence of AMC at an excitation wavelength of 380 nm and an emission wavelength of 460 nm (Fig. 1). 6. Calculate the concentration of released AMC using the AMC standard curve. 7. Determine the enzymatic activity as the amount of AMC released under the conditions.

3.2.2 Standard Curve

1. Add 500 μL of 0.1–5.0 μM AMC standard solutions, 100 μL of sodium phosphate buffer (pH 7.5), 100 μL of L-cysteine, 1 mL of 10 mM iodoacetic acid, and 300 μL of water to a test tube. 2. Measure the fluorescence at an excitation wavelength of 380 nm and an emission wavelength of 460 nm, and make the AMC standard curve.

3.3 Measurement of Gingipain Activity Using p-Nitroanilide Substrates

1. Load 100 μL of the 2 assay buffer for BApNA and 90 μL of the gingipain sample into a well of a 96-well plate (see Note 6). 2. Add 10 μL of the substrate solution (4 mM) to each well. 3. Incubate the plate at 37
C for 10–30 min.

106

Tomoko Kadowaki

4. Stop the reaction by adding 50 μL of 50% acetic acid to each well. 5. Measure absorbance at a 410 nm wavelength. 6. Determine the enzyme activity as the amount of pNA (OD value at 410 nm) released under the conditions. 3.4 Measurement of HemoglobinHydrolyzing Activity 3.4.1 Gingipain Activity in Sample

1. Add 50 μL of phosphate buffer, 50 μL of L-cysteine, 125 μL of hemoglobin solution, appropriate amount of gingipain sample (x μL), and (275  x) μL of water into the test tube (see Note 6). 2. Mix well by vortex and incubate at 40
C for 40 min. 3. Stop the reaction by adding 0.5 mL of ice-cold 10% TCA. 4. Incubate on ice for 10 min (see Note 8). 5. Centrifuge at 2000  g for 10 min at 4
C. 6. Transfer 200 μL of the supernatant to another new test tube. 7. Add 1 mL of Lowry–Folin mixture to the tube and mix well by vortex. 8. Incubate the mixture at 25
C for 10 min. 9. Add 100 μL of Folin and Ciocalteu’s phenol reagent, immediately mix well, and incubate at 25
C for 30 min. 10. Measure absorbance at 660 nm wavelength. 11. Calculate the concentration of released amino acids from the standard curve.

3.4.2 Standard Curve

1. Mix the following reagents in test tube: 200 μL of 10–100 μg/ mL tyrosine standard solution, 1 mL of Lowry–Folin mixture, and 100 μL of Folin and Ciocalteu’s phenol reagent. 2. Incubate the mixture at 25
C for 30 min, measure absorbance at 660 nm wavelength, and make the tyrosine standard curve.

3.5 Measurement of Caseinolytic Activity 3.5.1 Gingipain Activity in Sample

1. Add 50 μL of phosphate buffer, 50 μL of L-cysteine, 250 μL of casein solution, an appropriate amount (up to 150 μL) of the gingipain sample, and water to obtain a total volume of 0.5 mL in test tube. 2. Mix well and incubate at 40
C for 40 min. 3. Stop the reaction by adding 0.5 mL of ice-cold 10% TCA. 4. Incubate on ice for 10 min (see Note 8). 5. Centrifuge at 2000  g for 10 min at 4
C. 6. Collect the supernatant in a fresh tube. 7. Transfer 200 μL of supernatant to another new tube. 8. Add 1 mL of Lowry–Folin mixture to the tube and mix well by vortexing.

Experimental Protocol for Analyzing Gingipain Characteristics and Activities

107

9. Incubate the mixture at 25
C for 10 min. 10. Add 100 μL of Folin and Ciocalteu’s phenol reagent, immediately mix well, and incubate at 25
C for 30 min. 11. Measure absorbance at a 660 nm wavelength. 3.5.2 Standard Curve

1. Mix the following reagents in a tube: 200 μL of 10–100 μg/ mL tyrosine standard solution, 1 mL of Lowry–Folin mixture, and 100 μL of Folin and Ciocalteu’s phenol reagent. 2. Incubate the mixture at 25
C for 30 min, measure absorbance at 660 nm wavelength, and make the tyrosine standard curve. 3. Calculate the concentration of amino acids released using the standard curve.

3.6 Gelatin Zymography

1. Mix 30 μL of the gingipain samples with 7.5 μL of 5 Fairbanks solubilizing buffer and incubate at 37
C for 30 min. 2. Add 2 μL of 0.1% BPB to the mixture. 3. Load the samples into the gel and perform electrophoresis (see Note 9). 4. After electrophoresis, wash the gel three times with 2% Triton X-100 and twice with 20 mM phosphate buffer. 5. Soak the gel in 10 mM DTT, and incubate at 37
C for 2 h. 6. Wash the gel with distilled water, stain with staining solution for an hour or more, and then wash with destaining solutions I and II for several hours until the proteolytic band appears white (Fig. 2).

Fig. 2 Gelatin zymography of gingipain. Partially purified Rgp from the P. gingivalis culture supernatant was subjected to gelatin zymography. The band corresponding to Rgp appears white due to degradation

108

Tomoko Kadowaki

3.7 LuminolDependent Chemiluminescence (CL) Response of Neutrophils

1. Incubate guinea pig neutrophils (107 cells/mL) with the gingipain sample at 37
C for 60 min. 2. Centrifuge at 300  g for 5 min and remove the supernatant. 3. Wash the cells with HBSS twice by repeating the centrifugation and suspending.

3.7.1 Neutrophil Preparation

4. Resuspend the washed cells in some HBSS, and adjust the cell density to 107 cells/mL using hemocytometer.

3.7.2 Opsonization of Zymozan A

1. Boil zymosan A for 5 min. 2. Centrifuge the suspension at 300  g for 5 min, and remove the supernatant. 3. Suspend the sedimentary zymosan A in the same volume of guinea pig serum. 4. Incubate the suspension at 37
C for 30 min to opsonize the zymosan A. 5. Centrifuge at 300  g for 5 min, and remove the supernatant. 6. Suspend the sedimentary zymosan A in a 0.9% NaCl (about 20 mg/mL zymosan A solution).

3.7.3 Chemiluminescence Assay

1. Mix 100 μL of neutrophils, 100 μL of opsonized zymosan, and 100 μL of luminol in a well of 96-well plate. 2. Measure luminol-dependent CL continuously for 30 min using a luminometer (Fig. 3).

3.8 Measurement of Vascular Permeability In Vivo

1. Remove the hair on dorsal trunk of anesthetized guinea pigs by clippers. 2. Inject the gingipain samples (50 μL each) intradermally into back skin of a guinea pig. 3. Inject EBD intravenously into the lateral saphenous vein 30 min after the gingipain injection. 4. Sacrifice the guinea pig and remove the skin in one lump of epidermis and dermis with scissors in the subcutaneous layer. 5. Observe the skin from dermis and measure the area of intradermally extravasated dye (Fig. 4, see Note 10).

4

Notes 1. The product should be strictly used within a day. 2. A commercial product is used. 3. Neutrophils from other animals, such as humans and mice, can be used. In this case, use serum for the opsonization of zymosan obtained from the same type of animal as the neutrophils.

Experimental Protocol for Analyzing Gingipain Characteristics and Activities

A

109

Zymosan C3bR neutrophil rophil

FcR NADPH oxidase O2 O2HO䞉䞉 H2O2 myeloperoxidase HOCl

CL luminol

B

Fig. 3 Inhibition of the chemiluminescence (CL) response of neutrophils by gingipains. (a) Schematic representation of Luminol-dependent CL response. (b) Effects of P. gingivalis culture supernatant and gingipain inhibitors on CL response. Treatment with selective inhibitors KYT-1 (107 M, for Rgp) and KYT-36 (107 M, for Kgp) recovered the suppressive activity of the P. gingivalis culture supernatant on the neutrophil CL response [12] (see Note 11)

4. More than 90% of cells obtained by this method are neutrophils. 5. For the preparation of P. gingivalis cell extract samples, a long incubation period of bacteria in BHI liquid medium should be avoided in order to prevent cell lysis. 6. Since gingipain activity is substantially high, the reaction mixture should be kept cold (i.e., on ice) before and after incubation to avoid autoproteolysis. 7. The inhibitor added to the stop solution can be substituted with leupeptin (100 μM), TLCK (1 mM), TPCK (1 mM), or iodoacetamide (10 mM) (Table 1).

110

Tomoko Kadowaki

A

1

4

2

5 6

3

B 1

2

3

4

5

6

Fig. 4 Enhanced vascular permeability by Gingipains. (a) Schematic representation of intradermal injection of gingipain samples into a guinea pig. (b) Dye leakage is observed in vascular hyperpermeability sites. (1) phosphatebuffered saline (PBS). (2) P. gingivalis culture supernatant. (3) KYT-1 alone. (4) P. gingivalis culture supernatant supplemented with KYT-1 (106 M). (5) P. gingivalis culture supernatant supplemented with KYT-36 (106 M). (6) P. gingivalis culture supernatant supplemented with KYT-1 and 36 (106 M each). Inhibitors of Rgp and Kgp apparently inhibited their vascular permeabilityenhancement activity

8. Acid-soluble amino acids/peptides formed by degradation can be extracted at this step. 9. The voltage should be kept reasonably low (e.g., 50 V) in order to avoid autoproteolysis during electrophoresis. 10. Quantification of the extent of permeability can be performed by measuring the diameter of the region colored with dye or the absorbance of the dye extracted from the colored region.

Experimental Protocol for Analyzing Gingipain Characteristics and Activities

111

Table 1 Inhibition of gingipain activity by compounds Remaining activity (%) Inhibitor

Concentration

None

Rgpa

Kgpb

100

100

Leupeptin

100 μM

0

17

E-64

140 μM

10

88

Iodoacetic acid

1 mM

33

24

Iodoacetamide

10 mM

0

0

TLCK

1 mM

20

4

TPCK

1 mM

5

1

PMSF

1 mM

76

94

EDTA

1 mM

18

110

CaCl2

1 mM

133

98

a

Data from [15] b Data from [26]

11. KYT-1 and KYT-36 are selective synthetic inhibitors of Rgp and Kgp, respectively, based on the cleavage sites of histatins by the enzyme. The two inhibitors are currently not commercially available. References 1. Albandar JM, Rams TE (2002) Global epidemiology of periodontal diseases: an overview. Periodontol 2000 29:7–10 2. Mysak J, Podzimek S, Sommerova P et al (2014) Porphyromonas gingivalis: major periodontopathic pathogen overview. J Immunol Res 2014:476068 3. Bostanci N, Belibasakis GN (2012) Porphyromonas gingivalis: an invasive and evasive opportunistic oral pathogen. FEMS Microbiol Lett 333(1):1–9 4. Kadowaki T, Takii R, Yamatake K et al (2007) A role for gingipains in cellular responses and bacterial survival in Porphyromonas gingivalisinfected cells. Front Biosci 12:4800–4809 5. Nakayama K, Kadowaki T, Okamoto K et al (1995) Construction and characterization of arginine-specific cysteine proteinase (Arg-gingipain)-deficient mutants of Porphyromonas gingivalis. Evidence for significant

contribution of Arg-gingipain to virulence. J Biol Chem 270(40):23619–23626 6. Nakayama K (1997) Domain-specific rearrangement between the two Arg-gingipainencoding genes in Porphyromonas gingivalis: possible involvement of nonreciprocal recombination. Microbiol Immunol 41(3):185–196 7. Okamoto K, Kadowaki T, Nakayama K et al (1996) Cloning and sequencing of the gene encoding a novel lysine-specific cysteine proteinase (Lys-gingipain) in Porphyromonas gingivalis: structural relationship with the arginine-specific cysteine proteinase (Arg-gingipain). J Biochem 120(2):398–406 8. Shi Y, Ratnayake DB, Okamoto K et al (1999) Genetic analyses of proteolysis, hemoglobin binding, and hemagglutination of Porphyromonas gingivalis. Construction of mutants with a combination of rgpA, rgpB, kgp, and hagA. J Biol Chem 274(25):17955–17960

112

Tomoko Kadowaki

9. Hashimoto M, Kadowaki T, Tsukuba T et al (2006) Selective proteolysis of apolipoprotein B-100 by Arg-gingipain mediates atherosclerosis progression accelerated by bacterial exposure. J Biochem 140(5):713–723 10. Kadowaki T, Nakayama K, Yoshimura F et al (1998) Arg-gingipain acts as a major processing enzyme for various cell surface proteins in Porphyromonas gingivalis. J Biol Chem 273 (44):29072–29076 11. Takii R, Kadowaki T, Tsukuba T et al (2018) Inhibition of gingipains prevents Porphyromonas gingivalis-induced preterm birth and fetal death in pregnant mice. Eur J Pharmacol 824:48–56 12. Kadowaki T, Baba A, Abe N et al (2004) Suppression of pathogenicity of Porphyromonas gingivalis by newly developed gingipain inhibitors. Mol Pharmacol 66(6):1599–1606 13. Kadowaki T, Kitano S, Baba A et al (2003) Isolation and characterization of a novel and potent inhibitor of Arg-gingipain from Streptomyces sp. strain FA-70. Biol Chem 384 (6):911–920 14. Kadowaki T, Yamamoto K (2003) Suppression of virulence of Porphyromonas gingivalis by potent inhibitors specific for gingipains. Curr Protein Pept Sci 4(6):451–458 15. Kadowaki T, Yoneda M, Okamoto K et al (1994) Purification and characterization of a novel arginine-specific cysteine proteinase (argingipain) involved in the pathogenesis of periodontal disease from the culture supernatant of Porphyromonas gingivalis. J Biol Chem 269(33):21371–21378 16. Houle MA, Grenier D, Plamondon P et al (2003) The collagenase activity of Porphyromonas gingivalis is due to Arg-gingipain. FEMS Microbiol Lett 221(2):181–185 17. Baba A, Abe N, Kadowaki T et al (2001) Arg-gingipain is responsible for the degradation of cell adhesion molecules of human gingival fibroblasts and their death induced by Porphyromonas gingivalis. Biol Chem 382 (5):817–824 18. Vincents B, Guentsch A, Kostolowska D et al (2011) Cleavage of IgG1 and IgG3 by

gingipain K from Porphyromonas gingivalis may compromise host defense in progressive periodontitis. FASEB J 25(10):3741–3750 19. Guentsch A, Hirsch C, Pfister W et al (2013) Cleavage of IgG1 in gingival crevicular fluid is associated with the presence of Porphyromonas gingivalis. J Periodontal Res 48(4):458–465 20. Nakayama K, Ratnayake DB, Tsukuba T et al (1998) Haemoglobin receptor protein is intragenically encoded by the cysteine proteinaseencoding genes and the haemagglutininencoding gene of Porphyromonas gingivalis. Mol Microbiol 27(1):51–61 21. Sakai E, Naito M, Sato K et al (2007) Construction of recombinant hemagglutinin derived from the gingipain-encoding gene of Porphyromonas gingivalis, identification of its target protein on erythrocytes, and inhibition of hemagglutination by an interdomain regional peptide. J Bacteriol 189 (11):3977–3986 22. Naito M, Sakai E, Shi Y et al (2006) Porphyromonas gingivalis-induced platelet aggregation in plasma depends on Hgp44 adhesin but not Rgp proteinase. Mol Microbiol 59 (1):152–167 23. Kharlamova N, Jiang X, Sherina N et al (2016) Antibodies to Porphyromonas gingivalis indicate interaction between oral infection, smoking, and risk genes in rheumatoid arthritis etiology. Arthritis Rheumatol 68(3):604–613 24. Dominy SS, Lynch C, Ermini F et al (2019) Porphyromonas gingivalis in Alzheimer’s disease brains: evidence for disease causation and treatment with small-molecule inhibitors. Sci Adv 5(1):eaau3333 25. Nie R, Wu Z, Ni J et al (2019) Porphyromonas gingivalis infection induces amyloid-beta accumulation in monocytes/macrophages. J Alzheimers Dis 72(2):479–494 26. Abe N, Kadowaki T, Okamoto K et al (1998) Biochemical and functional properties of lysine-specific cysteine proteinase (Lys-gingipain) as a virulence factor of Porphyromonas gingivalis in periodontal disease. J Biochem 123(2):305–312

Chapter 11 Structural Characterization of the Type IX Secretion System in Porphyromonas gingivalis Dhana G. Gorasia, Eric Hanssen, Paul D. Veith, and Eric C. Reynolds Abstract The type IX secretion system (T9SS) is the most recently discovered secretion system in the gram-negative bacteria and is specific to the Bacteroidetes phylum. It is comprised of at least 19 proteins, which together allows for the secretion and cell surface attachment of a specific group of proteins (T9SS substrates), that harbor a signal sequence at the C-terminus. Here we describe the structural characterization of the PorK, PorN and PorG components of the Porphyromonas gingivalis T9SS using electron microscopy and crosslinking mass spectrometry. Key words Type IX secretion system (T9SS), Porphyromonas gingivalis, Electron microscopy, PorK, PorN, PorG, Cross-linking, Mass spectrometry, Protein complexes, Gradient centrifugation

1

Introduction Many pathogens use dedicated protein secretion systems to transport virulence factors across the cell envelope. Porphyromonas gingivalis uses the type IX secretion system (T9SS) to transport its virulence factors (gingipains) across the outer membrane and attach them onto the cell surface [1–3]. Proteins secreted by the T9SS have an N-terminal signal peptide that facilitates export across the inner membrane by the Sec system and have a conserved C-terminal domain referred to as the CTD signal, that enables them to pass through the outer membrane via the T9SS [4– 6]. Once on the surface, the CTD signals are removed by the sortase PorU and replaced with anionic-LPS, anchoring the proteins to the cell surface [7, 8]. The T9SS is composed of at least 19 proteins, namely, PorK, PorL, PorM, PorN, PorP, PorG, Sov, PorQ, PorV, PorU, PorZ, PorT, PorE, PorW, Plug, PorF, and the three transcription regulators, PorX, PorY, and SigP [1, 9– 14]. Sato et al. showed that PorK, PorL, PorM, and PorN form a complex greater than 1.2 MDa [1]. Previously, the Type III secretion system was isolated using CsCl density centrifugation [15] and

Keiji Nagano and Yoshiaki Hasegawa (eds.), Periodontal Pathogens: Methods and Protocols, Methods in Molecular Biology, vol. 2210, https://doi.org/10.1007/978-1-0716-0939-2_11, © Springer Science+Business Media, LLC, part of Springer Nature 2021

113

114

Dhana G. Gorasia et al.

therefore we adapted and modified their protocol in an attempt to isolate the T9SS. With this protocol we successfully purified a complex containing the PorK, PorN, and PorG components of the T9SS. Using electron microscopy, we showed that PorK and PorN form large ring-shaped structures that measured 50 nm in diameter [16]. Cross-linking mass spectrometry revealed that PorG is also associated with PorK and PorN in the ring structure [16]. Here, we provide a detailed protocol for the purification of the PorK/N/G complex and cross-linking of the purified complex.

2

Materials Prepare all solutions using ultrapure water (prepared by purifying deionized water to attain a sensitivity of 18 MΩ cm at 25
C).

2.1 PorK/N Complex Purification

1. Phosphate-buffered saline (PBS): Dissolve 8 g of NaCl, 0.2 g of KCl, 1.44 g of anhydrous Na2HPO4, and 0.24 g of anhydrous KH2PO4 in 800 mL of water. Adjust the pH to 7.4 with HCl and make up to 1 L with water. Filter PBS with 0.2 μm filter or autoclave it. 2. 1 M Tris–HCl: For 50 mL, Dissolve 6.05 g of Tris–HCl in 30 mL of water, adjust pH to 7.5 with HCl. Make up to 50 mL with water. 3. 1.5 M sucrose: Dissolve 51.34 g of sucrose in water and make up to 100 mL with water. 4. 2.5 M NaCl: Dissolve 7.3 g of NaCl in water and make up to 50 mL with water. 5. 1 M MgCl2: Dissolve 4.8 g of anhydrous MgCl2 in water and make up to 50 mL with water. 6. 10% n-dodecyl β-D-maltoside (DDM): Dissolve 1 g of DDM in water and make up to 10 mL with water. 7. 0.5 M EDTA: Dissolve 18.6 g of EDTA sodium salt in 80 mL of water. Adjust the pH to 8.0 with NaOH and make up to 100 mL with water. 8. Tosyl-L-lysine chloromethyl ketone hydrochloride (TLCK): Make 50 mM stock in water. Needs to be fresh, prepare just before use. 9. 250 U/μL benzonase. 10. Protease inhibitor cocktail (PIC) (Roche): Dissolve one tablet in 2 mL of water to make 25 stock solution. 11. Lysozyme: 10 mg/mL stock solution. Dissolve 10 mg of lysozyme in 1 mL of water.

Isolation and Characterisation of the PorK/N Complex

115

12. Lysis buffer: 50 mM Tris (pH 7.5), 150 mM NaCl, 0.5 M sucrose, 5 mM MgCl2, 1% DDM, 250 U of benzonase, 1 PIC, 5 mM TLCK. 13. Resuspension buffer A: 50 mM Tris pH 7.5, 500 mM NaCl, 1% DDM, 5 mM EDTA, 0.5 mg/mL lysozyme, and 1 PIC. 14. Resuspension buffer B: 10 mM Tris pH 7.5, 500 mM NaCl, 1% DDM, 5 mM EDTA. 15. Diluting buffer: 10 mM Tris pH 7.5, 500 mM NaCl, 0.5% DDM, 5 mM EDTA. 16. Resuspension buffer C: 10 mM Tris pH 7.5, 500 mM NaCl, 0.5% DDM. 17. Hemin: 5 mg/mL stock solution. Dissolve 625 mg of hemin in 4 mL of 1 N NaOH then add 96 mL of water. Autoclave at 121
C for 20 min. Store at 4
C. 18. Cysteine: 0.5 mg/mL stock solution. Dissolve 12.5 g of Lcysteine hydrochloride monohydrate in 25 mL of water and filter-sterilize. Store in 2 mL aliquots at 20
C. 19. Menadione: 5 mg/mL stock solution. Dissolve 125 mg of menadione in 25 mL of 100% ethanol and filter-sterilize. 20. P. gingivalis growth media: Dissolve 25 g of Trypticase Soy Broth and 30 g of Brain heart infusion in 1 L of water. Autoclave for 25 min at 121
C. Prior to bacterial inoculation add 1 mL of hemin, cysteine, and menadione. 21. Ultracentrifuge. 22. Beckman Coulter ultracentrifuge tubes: Ultra Clear centrifuge tube, 2.2 mL; thick wall polycarbonate tube, 1 mL; thick wall polycarbonate tube, 30 mL (seeNote 1). 23. TLS-55 rotor (Beckman Coulter, Inc.): a swinging-bucket rotor of centrifuge. 24. MLA-130 rotor (Beckman Coulter, Inc.): a fixed angle rotor of centrifuge. 2.2 Electron Microscopy

1. 400 mesh carbon-coated copper grids (ProScitech). 2. QUANTIFOIL R2/2 copper grids (ProScitech). 3. 1% Uranyl acetate: Dissolve 1 g of uranyl acetate in 100 mL of water (seeNote 2). 4. Ethane gas. 5. Liquid nitrogen. 6. Glow discharge unit (Pelco EasyGlow). 7. Transmission electron microscope (TEM Tecnai F30, FEI). Operates at 300 kV accelerating voltage and is equipped with field emission gun, BioTWIN objective lens (Cs 3.0), highangle annular dark field detector, and Gatan imaging energy filter.

116

2.3

Dhana G. Gorasia et al.

Cross-Linking

1. PBS containing 0.5% DDM. 2. Bis(sulfosuccinimidyl)suberate (BS3) (Thermo Fisher Scientific): 1 M solution in water. 3. 50 mM Ammonium bicarbonate: Dissolve 3.96 g of ammonium bicarbonate in 1 L of water. Aliquot in 50 mL tubes and store it at 20
C. 4. Iodoacetamide. 5. 1 M Dithiothreitol (DTT): Dissolve 154.5 mg of DTT in 1 mL of water. Aliquot and store at 20
C. 6. Sequencing grade trypsin. 7. Urea. 8. C18 Zip-tips (Millipore). 9. 10% trifluoroacetic acid (TFA). 10. SpeedVac (Thermo Fisher Scientific): vacuum concentrator. 11. Mass spectrometer.

3

Methods

3.1 Isolation of PorK/ N Protein Complex

1. Cultivate P. gingivalis anaerobically in P. gingivalis growth media. 2. Centrifuge 50 mL of P. gingivalis culture (OD650nm 0.8–1.2) at 10,000  g for 10 min at 4
C. 3. Remove the supernatant (seeNote 3) and wash the cell pellet with ice cold PBS (seeNote 4) and centrifuge again as in step 1 (seeNote 5). 4. Prepare the lysis buffer (seeNotes 6 and 7). 5. Resuspend the cell pellet in 5 mL of lysis buffer and incubate in ice for 45 min (seeNote 8). 6. Centrifuge at 10,000  g for 25 min at 4
C to remove any cellular debris. 7. Transfer the supernatant into the thick wall polycarbonate tube, 30 mL centrifuge and centrifuge at 142,000  g for 40 min at 12
C in an ultracentrifuge. 8. Remove the supernatant (seeNote 9) and resuspend the pellet in 5 mL of Resuspension buffer A. 9. Incubate the sample at 37
C for 15 min (seeNote 10) and centrifuge again at 142,000  g for 40 min at 12
C. 10. Remove supernatant and resuspend the pellet in 500 μL of Resuspension buffer B.

Isolation and Characterisation of the PorK/N Complex

117

11. Centrifuge at 10,000  g for 10 min to remove insoluble material and load the supernatant on 1.5 mL of 30% w/v CsCl in Ultra Clear centrifuge tube, 2.2 mL (seeNote 11). 12. Centrifuge at 214,200  g for 17 h in a TLS-55 rotor at 20
C (seeNote 12). 13. Collect eight fractions of 250 μL each using a needle syringe (seeNote 13). 14. Add 1.25 mL of diluting buffer to each fraction mix and transfer in thick wall polycarbonate tube, 1 mL and centrifuge at 543,200  g for 30 min in MLA-130 rotor (seeNote 14). 15. Remove the supernatant and resuspend the pellet containing PorK/N complex in resuspension buffer C. The PorK/N complex pellet is observed in fraction 6. The sample can be stored at 4
C. 16. Check the purity of sample by SDS-PAGE analysis (seeNote 15) (Fig. 1a).

Fig. 1 SDS-PAGE and electron micrographs of negatively stained PorK/N complex. (a) Fraction 6 from CsCl density gradient was resolved by SDS-PAGE and visualized by Coomassie Brilliant Blue stain. (b) Complexes were stained with uranyl acetate and observed under TEM. Homogenous ring-shaped structures of PorK/N complex were observed. Reproduced from Gorasia et al. (2016) with permission from PLOS Pathogens [16]

118

Dhana G. Gorasia et al.

3.2 Electron Microscopy 3.2.1 Negative Staining

1. Using forceps place an EM grid (Fomvar-carbon films supported on 200 mesh copper grids) in a glow discharge unit for 15 s at 25 mA. 2. Prepare a piece of parafilm with a 5 μL drop of sample, a 30 μL drop of water and a 10 μL drop of 1% uranyl acetate. 3. Place the grid on the drop of sample for 30 s. The carbon side of the grid needs to be in contact with the sample (seeNote 16). 4. Remove the grid from the sample and blot the excess on a piece of filter paper (seeNote 17). 5. Touch the grid on the drop of water for 1 s and blot the excess water on the filter paper. 6. Place the grid on top of the 1% uranyl acetate drop and incubate for 30 s. 7. Pick up the grid, touch the filter paper and let air dry for 10 min before viewing it with Tecnai F30 electron microscope (TEM) (Fig. 1b).

3.2.2 Cryo-Electron Microscopy

1. Glow discharge the QUANTIFOIL grid for 15 s at 25 mA. 2. Prepare the liquid ethane bath. 3. Load a grid on the Vitrobot (80% humidity, 20
C). 4. Apply 3 μL of sample to the grid and wait for 5 s. 5. Blot for 2 s with a filter paper. 6. Plunge in liquid ethane and store in liquid nitrogen until imaging session.

3.3 Cross-Linking Mass Spectrometry

1. Prepare the PorK/N sample as detailed in Subheading 3.1 until step 12. 2. Add 1.25 mL of PBS to each fraction and centrifuge as in step 13, Subheading 3.1. 3. Resuspend the pellet containing PorK/N with ~30 μL PBS containing 0.5% DDM. 4. Estimate the protein concentration using NanoDrop (seeNote 18). 5. Take ~12 μg of sample and to that add 1 mM (final concentration) of BS3 cross-linker (seeNote 19). 6. Incubate at room temperature for 15 min with rotation. 7. Stop the reaction by adding 1 M Tris–HCl pH 7.5 to a final concentration of 20 mM and let it stand for 10 min. 8. Make the total volume to 50 μL with 20 mM Tris–HCl if it is not 50 μL already. 9. Add solid urea (~24 mg) to the sample to obtain a final concentration of 8 M.

Isolation and Characterisation of the PorK/N Complex

119

10. Add 1 M DTT to a final concentration of 10 mM and incubate at 37
C for 1 h. 11. Add Iodoacetamide to a final concentration of 25 mM and incubate for 30 min at room temperature in dark (seeNote 20). 12. Dilute the sample with 25 mM NH4HCO3 to a final urea concentration of 1 M (~400 μL). 13. Add sequencing grade modified trypsin to a final concentration of 10 ng/μL to the sample and incubate overnight at 37
C. 14. Add 10% TFA to a final concentration of 0.1%. Use C18 Zip-Tips according to the manufacturer’s instructions to desalt and concentrate the samples in SpeedVac (seeNote 21) before analysis with Orbitrap mass spectrometer. 15. Set the mass spectrometer to exclude 2+ charged ions and include 3+ and 4+ charged ions. Choose higher energy collision dissociation type of fragmentation with longer gradient. See ref. 16 for more details on the mass spectrometry conditions. 16. Generate mgf file using raw converter (fields.scripps.edu/rawconv/). Analyze the mgf file generated by the mass spectrometer using P-Link software (download from http://pfind.ict.ac. cn/software/pLink). 17. Use the following settings after uploading the file: Enzyme ¼ Trypsin, missed cleavage ¼ 3, MS tolerance ¼ 5 ppm, cross-linker ¼ BS3, spectra format ¼ mgf, fixed modification ¼ carbamidomethyl_C, variable modification ¼ oxidation_M, spectra type ¼ HCD. 18. The result file will contain an Excel sheet with the identified cross-linked peptides between PorK, PorN, and PorG. Another result file will contain mass spectra showing the identified cross-linked peptides.

4

Notes 1. Ensure the rotor is balanced by weighing the tubes containing the sample and balance tubes. The difference in weight needs to be within 0.1 g. 2. Uranyl acetate is very toxic in powder form. Prepare 1% uranyl acetate in the fume hood. 3. Be careful when tipping out the supernatant as the pellet may be loose. 4. We usually prepare the day before and store it in the fridge. 5. The cell pellet can be frozen at this stage or proceed with the purification protocol.

120

Dhana G. Gorasia et al.

6. TLCK is only required if wild-type or gingipain-expressing P. gingivalis cells are used. 7. Prepare the stock solution of each reagent in advance and add the reagents together to make the lysis buffer on the day. 8. After 45 min, check whether all bacteria have lysed by looking at the turbidity of the lysate. If it is not clear, then add more lysis buffer and incubate for further 10 min. 9. The pellet will look glassy. Remove the supernatant with a pipette rather than tipping out as the pellet comes off easily. 10. We usually incubate in a water bath. 11. The total volume needs to be 2 mL if using TLS-55 rotor: 1.5 mL of 30% CsCl and 0.5 mL of the sample on the top. 12. Do not centrifuge at 4
C as it can cause CsCl to precipitate and therefore cause rotor balance issue. Also, if using balance tube, then make it with CsCl and not just water. 13. Wash the syringe with buffer containing Tris and 0.2% DDM between fractions. 14. We use thick walled tubes and we add 750 μL of sample in each tube. 15. Pellets from all fractions can be analyzed on SDS-PAGE. 16. Carbon side is darker and shinier. 17. Complete drying of grids before staining will cause staining artifacts. 18. Use the same buffer for blanking the NanoDrop. 19. Always prepare BS3 immediately before usage. Since BS3 cross-linker links amines, no amine containing chemicals should be included in the solution (e.g., no Tris). 20. Make highly concentrated iodoacetamide stock solution (~1 M) so that only small volume needs to be added to the sample. 21. When using Zip-Tip ensure no bubbles are created in the resin, and the resin is not dried up during the procedure.

Acknowledgments This work was supported by the Australian Government Department of Industry, Innovation and Science Grant ID 20080108, the National Health and Medical Research Council Grant ID 1123866.

Isolation and Characterisation of the PorK/N Complex

121

References 1. Sato K, Naito M, Yukitake H et al (2010) A protein secretion system linked to bacteroidete gliding motility and pathogenesis. Proc Natl Acad Sci U S A 107(1):276–281 2. Lasica AM, Ksiazek M, Madej M et al (2017) The type IX secretion system (T9SS): highlights and recent insights into its structure and function. Front Cell Infect Microbiol 7:215 3. Veith PD, Glew MD, Gorasia DG et al (2017) Type IX secretion: the generation of bacterial cell surface coatings involved in virulence, gliding motility and the degradation of complex biopolymers. Mol Microbiol 106(1):35–53 4. Seers CA, Slakeski N, Veith PD et al (2006) The RgpB C-terminal domain has a role in attachment of RgpB to the outer membrane and belongs to a novel C-terminal-domain family found in Porphyromonas gingivalis. J Bacteriol 188(17):6376–6386 5. Veith PD, Nor Muhammad NA, Dashper SG et al (2013) Protein substrates of a novel secretion system are numerous in the Bacteroidetes phylum and have in common a cleavable C-terminal secretion signal, extensive posttranslational modification, and cell-surface attachment. J Proteome Res 12 (10):4449–4461 6. Shoji M, Sato K, Yukitake H et al (2011) Por secretion system-dependent secretion and glycosylation of Porphyromonas gingivalis heminbinding protein 35. PLoS One 6(6):e21372 7. Glew MD, Veith PD, Peng B et al (2012) PG0026 is the C-terminal signal peptidase of a novel secretion system of Porphyromonas gingivalis. J Biol Chem 287(29):24605–24617 8. Gorasia DG, Veith PD, Chen D et al (2015) Porphyromonas gingivalis type IX secretion substrates are cleaved and modified by a sortase-like mechanism. PLoS Pathog 11(9): e1005152

9. Lasica AM, Goulas T, Mizgalska D et al (2016) Structural and functional probing of PorZ, an essential bacterial surface component of the type-IX secretion system of human oralmicrobiomic Porphyromonas gingivalis. Sci Rep 6:37708 10. Heath JE, Seers CA, Veith PD et al (2016) PG1058 is a novel multidomain protein component of the bacterial type IX secretion system. PLoS One 11(10):e0164313 11. Saiki K, Konishi K (2010) Identification of a novel Porphyromonas gingivalis outer membrane protein, PG534, required for the production of active gingipains. FEMS Microbiol Lett 310(2):168–174 12. Naito M, Tominaga T, Shoji M et al (2019) PGN_0297 is an essential component of the type IX secretion system (T9SS) in Porphyromonas gingivalis: Tn-seq analysis for exhaustive identification of T9SS-related genes. Microbiol Immunol 63(1):11–20 13. Kadowaki T, Yukitake H, Naito M et al (2016) A two-component system regulates gene expression of the type IX secretion component proteins via an ECF sigma factor. Sci Rep 6:23288 14. Lauber F, Deme JC, Lea SM et al (2018) Type 9 secretion system structures reveal a new protein transport mechanism. Nature 564 (7734):77–82 15. Marlovits TC, Kubori T, Sukhan A et al (2004) Structural insights into the assembly of the type III secretion needle complex. Science 306 (5698):1040–1042 16. Gorasia DG, Veith PD, Hanssen EG et al (2016) Structural insights into the PorK and PorN components of the Porphyromonas gingivalis type IX secretion system. PLoS Pathog 12 (8):e1005820

Chapter 12 Methods for Functional Characterization of the Type IX Secretion System of Porphyromonas gingivalis Keiko Sato Abstract The type IX secretion system (T9SS) is a protein secretion system for gingipain proteases and is found on the cell surface of Porphyromonas gingivalis. Proteins secreted by T9SS contain a signal peptide, functional domains, an immunoglobulin (Ig)-like domain, and a C-terminal domain (CTD). Thirty genes on the P. gingivalis chromosome encode proteins that possess the CTD, which is important for T9SS-mediated translocation to the cell surface across the outer membrane. In T9SS mutant strains, proteins accumulate as precursors in the cell and therefore exhibit a phenotype similar to that of secreted protein-deficient mutants. Black pigment productivity and hemagglutination are phenotypic features of P. gingivalis associated with the activity of gingipains. In P. gingivalis T9SS mutants, unprocessed gingipains with high molecular weights accumulate in the cell, and colony pigmentation and hemagglutination are not observed in the same phenotype as a gingipain null mutant. Key words Type IX secretion system (T9SS), Protein secretion, Virulence factors, Gingipain, Bacteroidetes phylum

1

Introduction Porphyromonas gingivalis is a major pathogen that causes periodontal disease and possesses a number of virulence factors, including hemagglutinins, lipopolysaccharides and proteases called gingipains. The type IX secretion system (T9SS) is a protein secretion system for gingipains. In P. gingivalis, cell surface proteins of the C-terminal domain (CTD) family, which includes gingipains, metallocarboxypeptidase CPG70, TapA, HBP35, PepK, and bacterial peptidylarginine deaminase, are secreted by the T9SS [1– 6]. Tannerella forsythia, Prevotella intermedia, and Prevotella melaninogenica are human pathogens that also use the T9SS to secrete virulence factors to these cell surface [7, 8]. The 30, 30, 54, and 30 genes encoding CTD-containing proteins are found on the chromosome of P. gingivalis, T. forsythia, P. intermedia, and P. melaninogenica, respectively. The T9SS is also a part of the

Keiji Nagano and Yoshiaki Hasegawa (eds.), Periodontal Pathogens: Methods and Protocols, Methods in Molecular Biology, vol. 2210, https://doi.org/10.1007/978-1-0716-0939-2_12, © Springer Science+Business Media, LLC, part of Springer Nature 2021

123

124

Keiko Sato

motility machinery found in many gliding bacteria of the Bacteroidetes phylum [9, 10]. The T9SS includes the PorK, PorL, PorM, PorN, PorP, PorQ, PorT, PorU, PorV, PorW, PorZ, Sov, PGN_0297, PGN_1296, and PGN_1437 proteins with regulatory proteins PorX, PorY, and SigP [11–16]. T9SS-deficient P. gingivalis mutants accumulate unprocessed, high molecular weight gingipains in the periplasmic space and have significantly reduced gingipain proteolytic activity. Three separate genes on the chromosome encode for gingipains. The rgpA and rgpB genes encode the Arg-specific cysteine proteases RgpA and RgpB, respectively, while kgp encodes the Lys-specific cysteine protease Kgp. Wild-type P. gingivalis strains form black-pigmented colonies, which is caused by the accumulation of oxidized heme on the cell surface [17, 18]. Because gingipains function in processing the release of heme from hemoglobin and the synthesis of the oxidized form of heme, Kgp-null mutants exhibit reduced pigmentation and Kgp/Rgp-null mutants show no pigmentation [19, 20]. The hemagglutinin/adhesin (HA) regions of gingipains are proteolytically processed into three or four putative HA domains (Kgp is processed to Kgp39, Kgp15, and Kgp44, and RgpA is processed to Rgp44, Rgp15, Rgp17, and Rgp27) in the outer membrane. Rgp44 and Kgp39 possess hemagglutinating activity. In this chapter, we provide a detailed protocol for functional characterization of the Type IX secretion system focused on function and localization of gingipains of Porphyromonas gingivalis.

2

Materials

2.1 A T9SS-Deficient Mutant of P. gingivalis

1. P. gingivalis ATCC 33277. 2. Ap-LB agar: For the selection of ampicillin-resistant Escherichia coli strains, add ampicillin to the molten agar at the concentration of 100 μg/mL. 3. Tryptic soy broth supplemented with 5 mg/mL hemin (TSH): Add about 10 mL of 0.1 M NaOH to a glass bottle. Weigh 50 mg of hemin and transfer to the bottle. Completely dissolve hemin, and make up to 100 mL with water (0.5 mg/mL hemin at final concentration). Sterilize by autoclaving. Dissolve 3.7 g of tryptic soy broth in 100 mL of water and sterilize by autoclaving. After cooling to room temperature, add 1 mL of 0.5 mg/mL hemin to the broth. Store it anaerobically. 4. TSH agar plate: Dissolve 4.0 g of tryptic soy agar in 100 mL of water and sterilize by autoclaving. After cooling to 45–50
C, add 1 mL of 0.5 mg/mL hemin to the molten agar.

Functional Characterization of T9SS of P. gingivalis

125

5. Blood agar plate: Dissolve 4.0 g of tryptic soy agar in 100 mL of water and sterilize by autoclaving. After cooling to 45–50
C, add 1 mL of 0.5 mg/mL hemin and 5 mL of rabbit blood to the molten agar. For the selection and maintenance of erythromycin-resistant P. gingivalis strain, add erythromycin to the molten agar at a concentration of 10 μg/mL. Store it anaerobically. 6. Anaerobic incubator: Consist of 10% CO2, 10% H2, and 80% N 2. 7. 0.3 M sucrose solution: Dissolve 10.3 g of sucrose (3 M at final concentration) in 100 mL of water. Sterilize by the a filter (0.22 μm). 8. Advantage-HF 2 PCR kit (Takara Bio): A high-fidelity PCR kit. 9. pGEM-T Easy (Promega): A cloning plasmid vector which linearized with a single 30 -terminal thymidine at both ends. 10. pBlueScript II SK(): A cloning plasmid vector. 11. Chloramphenicol-resistant pACYC184 [19].

cassette

(cat):

Cloned

from

12. β-Lactam-resistant cassette (cepA): Cloned from pSC22 [21]. 13. Tetracycline-resistant pT-COW [22]. 14. Erythromycin-resistant pVA2198 [23].

cassette cassette

(tetQ):

Cloned

from

(ermF):

Cloned

from

15. Restriction enzymes: KpnI, BamHI, and NotI. 16. Electroporator. 17. Cuvette. 2.2 T9SS Complemented Strains of P. gingivalis

1. Porphyromonas gulae VPB3492. 2. Freeze Throw Buffer (FTB): 10 mM PIPES, 15 mM CaCl2, 250 mM KCl, 55 mM MnCl2. Dissolve 0.6 g of PIPES, 0.44 g of CaCl2∙2H2O, 3.72 g of KCl in 190 mL of water. Adjust pH between 6.7 and 6.8 using KOH. After adding 2.18 g of MnCl2.4H2O, make up to 200 mL with water. Sterilize by the filter (0.22 μm). 3. Competent cells of E. coli S17-1: Culture E. coli S17-1 (ΔrecA, endA1, hsdR17, supE44, thi-1, tra +) [24] in LB broth. Collect the E. coli S17-1 cells by centrifugation at 1000  g for 10 min at 4
C. Suspend the bacterial pellet in FTB and cenrifuge again. Suspend the cells in FTB, and store aliquots at 80
C. 4. Recipient strain: P. gingivalis ATCC 33277. 5. LB broth. 6. Ap-LB broth. 7. TSH (see item 3 in Subheading 2.1).

126

Keiko Sato

8. TSH agar plate: For maintenance of tetracycline-resistant P. gingivalis strain, add tetracycline to the molten agar at a concentration of 1 μg/mL (see item 4 in Subheading 2.1). 9. Blood agar plate: For the selection of P. gingivalis from the mixture of E. coli and P. gingivalis, add gentamicin to the molten agar at a concentration of 100 μg/mL. For the selection and maintenance of tetracycline-resistant P. gingivalis strain, add tetracycline to the molten agar at a concentration of 1 μg/mL (see item 5 in Subheading 2.1). 10. Anaerobic incubator (see item 6 in Subheading 2.1). 11. Advantage-HF 2 PCR kit (see item 8 in Subheading 2.1). 12. pGEM-T Easy (see item 9 in Subheading 2.1). 13. pBluesript II SK() (see item 10 in Subheading 2.1). 14. Restriction enzymes: KpnI, BamHI, BglII, and NotI. 15. pTCB: Bacteroides–E. coli shuttle vector. 2.3 Colony Pigmentation

1. Blood agar plate: Blood agar plate (see item 5 in Subheading 2.1) without antibiotics.

2.4 Analysis of Progingipains

1. Phosphate-buffered saline (PBS), pH 7.4 containing 0.1 mM Na-p-tosyl-L-lysine chloromethyl ketone (TLCK) and 0.1 mM leupeptin, 0.5 mM EDTA, pH 8.0, 25 μg/mL DNase I, and 25 μg/mL RNase A. 2. Sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE): 25 mM Tris base, 192 mM glycine, 0.1% SDS. 3. Western blot transfer buffer: 0.02 M Tris–HCl, 0.15 M glycine, 20% methanol. 4. Polyvinylidene fluoride (PVDF) membrane. 5. XCell II™ Blot Module (Thermo Fisher Scientific): A wet transfer device. 6. Tris-buffered saline (TBS): 0.15 M NaCl, 20 mM Tris–HCl, pH 7.4. 7. TBS containing 0.5% Tween 20 and 5% skim milk. 8. TBS containing 0.5% Tween 20 and 1% skim milk. 9. Polyclonal antisera against RgpB and Kgp (see Note 1). 10. Swine anti-rabbit immunoglobulins/HRP (DAKO). 11. Goat anti-mouse immunoglobulins immunoglobulins/HRP (DAKO). 12. Western blotting detection kit.

2.5 Hemagglutination Test

1. P. gingivalis strains. 2. TSH (see item 3 in Subheading 2.1).

Functional Characterization of T9SS of P. gingivalis

127

3. PBS, pH 7.4. 4. Defibrinated sheep blood. 5. Round bottom microtiter 96-well plate. 6. Spectrophotometer. 2.6 Subcellular Fractionation

1. P. gingivalis strains. 2. TSH (see item 3 in Subheading 2.1). 3. PBS, pH 7.4 containing 0.1 mM TLCK, 0.1 mM leupeptin, 0.5 mM EDTA, 25 μg/mL DNase I and 25 μg/mL RNase A. 4. French pressure cell. 5. Centrifugation. 6. Ultracentrifugation. 7. 1% Triton X-100 in PBS containing 20 mM MgCl2. 8. Two-dimensional (2D) gel electrophoresis: first dimensional isoelectric focusing, IEF) and second dimension (SDS-PAGE) electrophoreses. Buffers, IEF strips and SDS-PAGE gels, and devises (see Note 2). 9. Coomassie Brilliant Blue R250 (CBB).

2.7 Analysis of the Supernatant Protein

1. P. gingivalis strains. 2. TSH (see item 3 in Subheading 2.1). 3. Ultracentrifugation. 4. PBS, pH 7.4 containing 0.1 mM TLCK, 0.1 mM leupeptin, 0.5 mM EDTA pH 8.0, 25 μg/mL DNase I and 25 μg/mL RNase A. 5. 10% Trichloroacetic acid (TCA). 10% (w/v) aqueous solution. 6. Diethyl ether, chilled. 7. Cell lysis solution: 7 M urea, 2 M thiourea, 4% CHAPS, 1 mM EDTA pH 8.0 and 5 mM tributyl phosphine. 8. 2D gel electrophoresis (see item 8 in Subheading 2.6). 9. CBB.

3

Methods

3.1 Construction of a T9SS Deficient Mutant of P. gingivalis 3.1.1 Construction of Targeting Vector Plasmid

1. PCR-amplify DNA regions upstream and downstream of a gene from the chromosomal DNA of P. gingivalis ATCC 33277 using primer pairs (PGN gene number-U-F-KpnI plus PGN gene number-U-R and PGN gene number-D-F plus PGN gene number-D-R-NotI), where “U” indicates upstream, “F” indicates forward, “D” indicates downstream, and “R” indicates reverse (see Note 3).

128

Keiko Sato

2. Double-digest the amplified DNA fragments upstream of each gene with KpnI plus a corresponding restriction enzyme (BamHI or BglII). Digest the DNA fragments downstream of each gene with NotI plus a corresponding restriction enzyme (BamHI or BglII). Ligate both digested products into a pBluescript II SK() vector that has been digested with NotI and KpnI to yield pMG01. 3. Insert the antibiotic resistance DNA fragment into the BamHI or BglII site of pMG01 to yield pMG02 for mutagenesis. 4. Digest the plasmids with NotI (or KpnI) to linearize (see Note 4). 3.1.2 Construction of a P. gingivalis Drug Resistant Mutant Strain

1. Culture P. gingivalis ATCC 33277 in 2 mL of TSH broth for 12 h in anaerobic incubator, then add 10 mL of fresh TSH broth to the culture, and culture anaerobically for 3 h. 2. Centrifuge the mixture at 1000  g for 20 min. 3. Suspend the bacteria in the 10 mL of the 0.3 M sucrose solution. 4. Centrifuge the mixture at 1000  g for 20 min. 5. Resuspend the bacteria in the 1 mL of the 0.3 M sucrose solution. 6. Mix pMG02 into 400 μL of washed P. gingivalis in a cuvette. 7. Store for 5 min on ice. 8. Electroporation (Pulse once at 2.5 kV). 9. Culture the bacteria in 3 mL of TSH broth overnight. 10. Seed on blood agar medium containing antibiotics. 11. Culture for 5–8 days under anaerobic conditions to form nonpigmented colonies.

3.1.3 Construction of a P. gingivalis MultidrugResistant Mutant Strain

1. For the construction of quadruple mutants, multiple mutants can be easily obtained by adding drug resistance mutations in the order of the chloramphenicol-resistant cassette (cat), betalactam-resistant cassette (cepA), tetracycline-resistant cassette (tetQ), and erythromycin-resistant cassette (ermF).

3.2 Construction of a T9SS Complemented Strain of P. gingivalis

1. PCR-amplify the promoter region of the P. gulae catalase gene (accession number AB083039) from P. gulae VPB3492 chromosomal DNA using primer pairs (Pgu- F-KpnI and Pgu-RBamHI) (see Note 5).

3.2.1 Construction of Targeting Vector Plasmid

2. Digest the amplified DNA with KpnI plus BamHI and insert into the corresponding restriction enzyme region of a pTCB to yield pCG001. 3. PCR-amplify the entire T9SS gene region from the chromosomal DNA.

Functional Characterization of T9SS of P. gingivalis

129

4. Digest the amplified DNA with BamHI plus NotI and insert into the corresponding restriction enzyme region of pCG001 to yield pCG02. 3.2.2 Introduction of the Targeting Vector Plasmid into E. coli

1. Mix pCG02 (usually 100 ng) into 100 μL of competent E. coli S17-1 in a tube. 2. Incubate the mixture on ice for 10 min. 3. Heat shock the mixture at 42
C for 60 s. 4. Put the tubes back on ice for 2 min. 5. Plate all of the culture onto Ap-LB agar. 6. Incubate plates at 37
C overnight.

3.2.3 Conjugative Transfer

1. Culture E. coli S17-1 retaining the plasmid in 3 mL of Ap-LB broth for 12 h. Culture 400 μL of this solution in 20 mL of fresh LB broth without antibiotics for 3 h. 2. Culture P. gingivalis T9SS deficient mutant in 2 mL of TSH broth for 12 h in anaerobic incubator, then add 10 mL of fresh TSH broth to the culture, and culture anaerobically for 3 h. 3. Mix the cultures of 20 mL of plasmid-retained E. coli S17-1 and 10 mL of the P. gingivalis mutant. 4. Centrifuge the mixture at 1000  g for 20 min. 5. Spot the concentrated mixture on TSH agar plate, culture at 37
C for 30 min under aerobic conditions, and then coculture for 12 h under anaerobic conditions (see Note 6). 6. Suspend the bacteria in the TSH broth, and seed on blood agar medium containing 100 μg/mL gentamicin and 5 μg/mL tetracycline. 7. Culture for 5–8 days under anaerobic conditions to form blackpigmented colonies.

3.3 Colony Pigmentation

Wild-type P. gingivalis strains form black-pigmented colonies, whereas the T9SS mutants exhibit no pigmentation on blood agar plates. 1. Streak the bacteria on blood agar medium. 2. Culture for 5–7 days under anaerobic conditions. 3. Determine the colony pigmentation; black or white colony.

3.4 Analysis of Progingipains

T9SS-deficient P. gingivalis mutants accumulate unprocessed, high molecular weight gingipains and have significantly reduced gingipain proteolytic activity. 1. Culture P. gingivalis in TSH medium anaerobically overnight, and harvest by centrifugation.

130

Keiko Sato

2. Resuspend the cells in PBS containing 0.1 mM TLCK, 0.1 mM leupeptin, 0.5 mM EDTA, pH 8.0, 25 μg/mL DNase I, and 25 μg/mL RNase A. 3. Separate proteins by SDS-PAGE analysis. 4. Transfer proteins onto PVDF membranes in the western blot transfer buffer using XCell II™ Blot Module. 5. Block the membrane in TBS containing 0.5% Tween 20 and 5% skim milk for 1 h at room temperature. 6. Incubate the membrane with polyclonal antisera against RgpB or Kgp as primary antibodies in TBS containing 0.5% Tween 20 and 5% skim milk. 7. Wash the membrane three times with TBS containing 0.5% Tween 20 and 1% skim milk, 5 min each. 8. Incubate the membrane with the swine anti-rabbit or goat antimouse immunoglobulins/HRP in TBS containing 0.5% Tween 20 and 5% skim milk. 9. Wash the membrane three times with TBS containing 0.5% Tween 20 and 1% skim milk, 5 min each. 10. Develop the membrane with a Western blotting detection kit according to the manufacturer’s instructions. 3.5 Hemagglutination Test

Wild-type P. gingivalis strains aggregate with erythrocytes, whereas the T9SS mutants exhibit no hemagglutination. 1. Culture P. gingivalis in TSH medium anaerobically overnight. 2. Harvest the bacteria by centrifugation at 1500  g for 20 min at 20
C, and discard the supernatant. 3. Wash the bacterial cells with PBS and resuspend them to optical density (OD) at 550 nm wave length of 0.4 with PBS. 4. Harvest defibrinated sheep blood by centrifugation at 400  g for 5 min, and discard the supernatant. 5. Add the sheep erythrocyte to PBS, centrifuge at 400  g for 5 min, and discard the supernatant. This step is repeated 2–3 times. 6. Add PBS to give a 2% (v/v) solution of erythrocytes. 7. Prepare twofold dilution series with the bacterial cells in a round bottom 96-well plate (100 μL/well). 8. Add 100 μL of the 2% erythrocyte solution to each well. 9. Incubate the plate at room temperature for 3 h. 10. Determine the lowest concentration of bacteria that show visible hemagglutination.

Functional Characterization of T9SS of P. gingivalis

3.6 Subcellular Fractionation

131

Separation of the inner and outer membrane proteins of P. gingivalis. Subcellular fractionation of P. gingivalis cells is performed, as described previously [25]. 1. Harvest P. gingivalis cells from a 200-mL culture by centrifugation at 10,000  g for 30 min at 4
C. 2. Resuspend the cells in 100 mL of PBS containing 0.1 mM TLCK, 0.1 mM leupeptin, 0.5 mM EDTA, 25 μg/mL DNase I, and 25 μg/mL RNase A. 3. Disrupt cells using a French pressure cell with two passes at 100 MPa. 4. To remove the remaining intact bacterial cells, centrifuge at 2400  g for 10 min at 4
C. 5. Ultracentrifuge the supernatant at 100,000  g for 60 min. 6. Treat the pellets with 1% Triton X-100 in PBS containing 20 mM MgCl2 for 30 min at 20
C to solubilize the cytoplasmic membrane. 7. Recover the outer membrane fraction as a precipitate by ultracentrifugation at 100,000  g for 60 min at 4
C. The supernatant containing the cytoplasmic membrane fraction is retained. 8. Apply to 2D electrophoresis analysis. 9. Detect all major proteins by CBB and specific proteins by Western blotting.

3.7 Analysis of the Supernatant Protein

Most of the secreted proteins are anchored to the cell surface, but some are released into the culture supernatant. Because gingipains are responsible for the processing/maturation of P. gingivalis secreted proteins, including hemagglutinins and pili, it is preferable to use a mutant strain based on a gingipain null mutant. Particlefree culture supernatant and vesicle fractions are obtained, as described previously [26]. 1. Centrifuge P. gingivalis cell cultures at 6000  g for 30 min and 4
C, and harvest the culture supernatant. 2. To remove vesicles, ultracentrifuge the culture supernatant at 100,000  g for 60 min at 4
C, and harvest the particle-free culture supernatant. 3. Precipitate the proteins in this fraction with 10% TCA at 4
C, and harvest the precipitated proteins by centrifugation at 4
C for 20 min. 4. Wash the pellet three times with cold diethyl ether. 5. Suspend the pellet in cell lysis solution. 6. Apply to 2D electrophoresis analysis (see step 8 in Subheading 3.6).

132

Keiko Sato

7. Stain the gel with CBB. 8. Protein identification fingerprinting.

4

of

proteins

by

peptide-mass

Notes 1. Polyclonal antisera against RgpB and Kgp were prepared by immunizing rabbits with peptides derived from the amino acid sequences E361RNITTEDKWLGQAL375 and W705DAPSAKKAEASRE718, respectively [27]. 2. 2D gel electrophoresis is performed by a general protocol [1]. 3. Homologous recombination requires the insertion of 300–500 bp of upstream and downstream regions of the target gene into the target plasmid. 4. Double recombination resulted in deletion of the target gene and acquisition of antibiotic-resistance. 5. The promoter region of the P. gulae catalase gene works in E. coli and P. gingivalis. 6. Transfer of plasmids between bacteria by conjugative transfer requires cell contact and DNA metabolism between donor and recipient cells. When E. coli and P. gingivalis are cocultured on an agar plate, the bacterial pellet forms a spot in one place instead of seeding.

References 1. Sato K, Yukitake H, Narita Y et al (2013) Identification of Porphyromonas gingivalis proteins secreted by the Por secretion system. FEMS Microbiol Lett 338:68–76 2. Kondo Y, Ohara N, Sato K et al (2010) Tetratricopeptide repeat protein-associated proteins contribute to the virulence of Porphyromonas gingivalis. Infect Immun 78:2846–2856 3. Shoji M, Sato K, Yukitake H et al (2011) Por secretion system-dependent secretion and glycosylation of Porphyromonas gingivalis heminbinding protein 35. PLoS One 6:e21372 4. Nonaka M, Shoji M, Kadowaki T et al (2014) Analysis of a Lys-specific serine endopeptidase secreted via the type IX secretion system in Porphyromonas gingivalis. FEMS Microbiol Lett 354:60–68 5. Veith PD, Nor Muhammad NA, Dashper SG et al (2013) Protein substrates of a novel secretion system are numerous in the Bacteroidetes phylum and have in common a cleavable C-terminal secretion signal, extensive post-

translational modification, and cell-surface attachment. J Proteome Res 12:4449–4461 6. Seers CA, Slakeski N, Veith PD et al (2006) The RgpB C-terminal domain has a role in attachment of RgpB to the outer membrane and belongs to a novel C-terminal-domain family found in Porphyromonas gingivalis. J Bacteriol 188:6376–6386 7. Narita Y, Sato K, Yukitake H et al (2014) Lack of a surface layer in Tannerella forsythia mutants deficient in the type IX secretion system. Microbiology 160:2295–2303 8. Kondo Y, Sato K, Nagano K et al (2018) Involvement of PorK, a component of the type IX secretion system, in Prevotella melaninogenica pathogenicity. Microbiol Immunol 62:554–566 9. McBride MJ, Zhu Y (2013) Gliding motility and Por secretion system genes are widespread among members of the phylum Bacteroidetes. J Bacteriol 195:270–278

Functional Characterization of T9SS of P. gingivalis 10. Nakane D, Sato K, Wada H et al (2013) Helical flow of surface protein required for bacterial gliding motility. Proc Natl Acad Sci U S A 110:11145–11150 11. Sato K, Sakai E, Veith PD et al (2005) Identification of a new membrane-associated protein that influences transport/maturation of gingipains and adhesins of Porphyromonas gingivalis. J Biol Chem 280:8668–8677 12. Sato K, Naito M, Yukitake H et al (2010) A protein secretion system linked to bacteroidete gliding motility and pathogenesis. Proc Natl Acad Sci U S A 107:276–281 13. Saiki K, Konishi K (2007) Identification of a Porphyromonas gingivalis novel protein sov required for the secretion of gingipains. Microbiol Immunol 51:483–491 14. Lasica AM, Ksiazek M, Madej M et al (2017) The type IX secretion system (T9SS): highlights and recent insights into its structure and function. Front Cell Infect Microbiol 7:215 15. Veith PD, Glew MD, Gorasia DG et al (2017) Type IX secretion: the generation of bacterial cell surface coatings involved in virulence, gliding motility and the degradation of complex biopolymers. Mol Microbiol 106:35–53 16. Kadowaki T, Yukitake H, Naito M et al (2016) A two-component system regulates gene expression of the type IX secretion component proteins via an ECF sigma factor. Sci Rep 6:23288 17. Shah HN, Gharbia SE (1989) Lysis of erythrocytes by the secreted cysteine proteinase of Porphyromonas gingivalis W83. FEMS Microbiol Lett 52:213–217 18. Smalley JW, Silver J, Marsh PJ et al (1998) The periodontopathogen Porphyromonas gingivalis binds iron protoporphyrin IX in the mu-oxo dimeric form: an oxidative buffer and possible pathogenic mechanism. Biochem J 331 (Pt 3):681–685 19. Shi Y, Ratnayake DB, Okamoto K et al (1999) Genetic analyses of proteolysis, hemoglobin binding, and hemagglutination of Porphyromonas gingivalis. Construction of mutants with a

133

combination of rgpA, rgpB, kgp, and hagA. J Biol Chem 274:17955–17960 20. Okamoto K, Nakayama K, Kadowaki T et al (1998) Involvement of a lysine-specific cysteine proteinase in hemoglobin adsorption and heme accumulation by Porphyromonas gingivalis. J Biol Chem 273:21225–21231 21. Haruyama K, Yoshimura A, Naito M et al (2009) Identification of a gingipain-sensitive surface ligand of Porphyromonas gingivalis that induces Toll-like receptor 2- and 4-independent NF-κB activation in CHO cells. Infect Immun 77:4414–4420 22. Gardner RG, Russell JB, Wilson DB et al (1996) Use of a modified BacteroidesPrevotella shuttle vector to transfer a reconstructed beta-1,4-D-endoglucanase gene into Bacteroides uniformis and Prevotella ruminicola B(1)4. Appl Environ Microbiol 62:196–202 23. Fletcher HM, Schenkein HA, Morgan RM et al (1995) Virulence of a Porphyromonas gingivalis W83 mutant defective in the prtH gene. Infect Immun 63:1521–1528 24. Simon R, Priefer U, Puhler A (1983) A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria. Biotechnology 1:784–791 25. Murakami Y, Imai M, Nakamura H et al (2002) Separation of the outer membrane and identification of major outer membrane proteins from Porphyromonas gingivalis. Eur J Oral Sci 110:157–162 26. Potempa J, Pike R, Travis J (1995) The multiple forms of trypsin-like activity present in various strains of Porphyromonas gingivalis are due to the presence of either Arg-gingipain or Lys-gingipain. Infect Immun 63:1176–1182 27. Sato K, Kakuda S, Yukitake H et al (2018) Immunoglobulin-like domains of the cargo proteins are essential for protein stability during secretion by the type IX secretion system. Mol Microbiol 110:64–81

Chapter 13 Purification of Tannerella forsythia Surface-Layer (S-Layer) Proteins Sreedevi Chinthamani, Prasad R. Settem, Kiyonobu Honma, Takuma Nakajima, and Ashu Sharma Abstract The objective of this chapter is to provide a detailed purification protocol for the surface-layer (S-layer) glycoproteins of the periodontal pathogen Tannerella forsythia. The procedure involves detergent based solubilization of the bacterial S-layer followed by cesium chloride gradient centrifugation and gel permeation chromatography. The protocol is suitable for the isolation of S-layer glycoproteins from T. forsythia strains with diverse O-glycan structures, and aid in understanding the biochemical basis and the role of protein O-glycosylation in bacterial pathogenesis. Key words Tannerella forsythia, Surface-layer, Bacterial glycoproteins, O-glycosylation, Periodontitis

1

Introduction Tannerella forsythia is a gram-negative periodontal pathogen implicated in the development of periodontitis, an inflammatory disease of the tooth supporting tissues that often leads to tooth loss [1]. T. forsythia possesses a number of virulence factors, among them the bacterium’s surface-layer proteins play critical roles in pathogenesis [2]. Many bacterial species are covered with a crystalline protein lattice known as the surface layer (S-layer). S-layers are formed naturally on the surfaces of these bacteria via the self-assembly of proteins (glycoproteins) into symmetrical lattices, typically with center-to-center spacings of ~10–25 nm [3]. It is generally thought that S-layers provide bacteria selective advantages in their natural habitat with different functions such as serving as protective coats against host or environmental factors and acting as molecular traps for biomolecules with adhesion and immunological functions [4]. Under experimental conditions the isolated S-layer proteins can self-assemble into porous supramolecular materials in suspension or as nanoarrays on biomaterials. This

Keiji Nagano and Yoshiaki Hasegawa (eds.), Periodontal Pathogens: Methods and Protocols, Methods in Molecular Biology, vol. 2210, https://doi.org/10.1007/978-1-0716-0939-2_13, © Springer Science+Business Media, LLC, part of Springer Nature 2021

135

136

Sreedevi Chinthamani et al.

property has been exploited for nanobiotechnology research and applications, such as for the delivery of drug and vaccine [5–8]. The S-layer-of T. forsythia is quite unique—to the best of our knowledge it is the only glycosylated S-layer found in gramnegative bacteria, and moreover it is formed by the self-assembly of two glycosylated proteins rather than one as is usually the case in other bacteria [9, 10]. The T. forsythia S-layer plays roles in bacterial adhesion [11], biofilm formation [12], serum resistance [13], and immunomodulation [14–16]. The T. forsythia S-layer is comprised of two high molecular mass proteins, TfsA (134.5 kDa) and TfsB (152.4 kDa), which on SDS-PAGE gels migrate at apparent masses of ~230 and 250 kDa, respectively, due to glycosylation. TfsA and TfsB proteins are linked via Ser/Thr residues within the D (S/T)(A/I/L/M/T/V) motif to an O-linked decasaccharide complex [17] with a terminal nonulosonic acid (sialic acid-like) residue. Depending on the strain, the nonulosonic acid can either be a pseudaminic acid residue (as in ATCC 43037-type strain) or a legionaminic acid residue (as in UB4 strain) [18]. The terminal pseudaminic acid containing trisaccharide branch of the O-linked glycan complex is thought to be responsible for S-layer’s immunosuppressive role via blocking Th17 response [15, 16]. Besides the nonulosonic acid residues, other unique S-layer glycan sugars present in the T. forsythia O-glycan are fucose, digitoxose, xylose, N-acetyl mannosaminuronic acid, and N-acetyl mannosaminuronamide. The T. forsythia ATCC 43037 S-layer can bind macrophage-inducible C-type lectin (MINCLE, a pathogen recognition receptor with suggested mannose/fucose/N-acetyl glucosamine/glucose specificity [19]), and induce pro- as well as anti-inflammatory cytokine expression in macrophages [20].

2

Materials Prepare all solutions using ultrapure water (prepared by purifying deionized water, to attain a sensitivity of 18 MΩ cm at 25
C) and analytical grade reagents. Prepare and store all reagents at 4
C (unless indicated otherwise). Tannerella forsythia ATCC 43037 strain used in this protocol can be obtained from American Type Culture Collection (ATCC.org) or the author A. Sharma on request. Follow all waste disposal regulations diligently when disposing of waste materials and perform bacterial manipulation under Biosafety Level-2 regulation.

2.1 T. forsythia Culturing

1. Hemin: Dissolve 50 mg of hemin into 1 mL of 1 N sodium hydroxide and then add 99 mL of water. Store at 4
C. 2. Vitamin K1: Dissolve 50 mg of vitamin K1 into 10 mL of 95% ethanol. Store at 4
C protected from light.

T. forsythia Surface-layer Glycoprotein Isolation

137

3. N-Acetylmuramic acid (NAM): Dissolve 100 mg of NAM (Sigma Chemicals) in 100 mL of water, filter (0.2 μm)-sterilize, and store in small aliquots at 80
C. 4. Broth and agar plates: In 470 mL of water in a 2-L Erlenmeyer flask add and dissolve 15 g of brain heart infusion broth (along with 7.5 g of agar if preparing agar plates), 0.5 g of yeast extract, 0.5 g of L-cysteine, 5 mL of hemin stock, and 0.1 mL of vitamin K1 stock. Adjust pH to 7.2 and autoclave at 121
C for 15 min. Transfer autoclaved flask to a 45
C water bath and leave the flask in the water bath for 2–3 h to cool (see Note 1). Then, inside a biological hood sterilely add 30 mL of room temperature equilibrated sheep or horse blood (Gibco-BRL) and 5 mL of NAM stock solution into the medium. Shake the contents gently and pour the agar medium into petri dishes (approx. 30 mL in 10 cm plates) and after the agar hardens, turn the plates upside down and leave plates at room temperature to dry and next day wrap plates and store at 4
C. Broth can be aliquoted into smaller fractions in appropriate sterile containers and stored at 4
C. Plates or broth can be used within 1 month after storage. 5. Anaerobic chamber: Set at 37
C, equilibrated with an atmosphere of 85% N2, 10% H2, 5% CO2. 6. Spectrophotometer. 7. 1 mL glass cuvettes. 8. 250 mL polypropylene centrifuge bottles. 9. Centrifuge rotor for 250 mL bottles (e.g., Sorvall GSA rotor). 10. Centrifuge (e.g., Sorvall RC5). 2.2 Extraction and Partial Purification of T. forsythia Surface Layer

1. 50 mM Tris–HCl, pH 7. 4: Dissolve 6.06 g of Tris–HCl in 800 mL of water and adjust pH to 7.4 with HCl. Make up to 1 L with water. 2. 2% sodium deoxycholate (NaDoc): Dissolve 2 g of NaDoc in 100 mL of 50 mM Tris–HCl, pH 7.4. 3. High-speed refrigerated centrifuge (e.g., Sorvall RC5). 4. Centrifuge rotor (e.g., Sorvall SS-34). 5. Centrifuge tubes: Polypropylene 50 mL, 29  103 mm. 6. 50% Cesium chloride (CsCl): 50% solution in 50 mM Tris– HCl, pH 7.4. 7. Ultracentrifuge bottles and tubes: Beckman polycarbonate 355618 (26.3 mL, 25  89 mm) bottles with cap assembly and Beckman-Coulter Quick-Seal 342413 (16  76 mm) tubes with metal spacers. 8. Ultracentrifuge tube sealer: Beckman-Coulter 342420 Tube Sealer.

138

Sreedevi Chinthamani et al.

9. Ultracentrifuge rotors: Beckman 70Ti and Beckman 75Ti. 10. Ultracentrifuge (e.g., Beckman-Coulter Optima XE-90). 11. Syringe needles: 13, 22, and 26 G. 12. 3-mL insulin syringe. 2.3 Size Exclusion Chromatography

1. 0.5 M ethylenediaminetetraacetic acid (EDTA): Add 18.6 g of disodium ethylenediaminetetraacetate dihydrate into 80 mL of water and bring the pH to 8.0 by adding NaOH pellets (appx. 2 g). Once the solution becomes clear, bring the volume to 100 mL and autoclave the solution at liquid cycle. 2. 1 M DL-dithiothreitol (DTT): Dissolve 1.5 g of DTT in 8 mL of deionized or distilled H2O. Adjust volume to 10 mL, dispense into 1-mL aliquots, and store in the dark at 20
C. 3. Chromatography buffer (CB): 50 mM ethanolamine, 8 M urea, 0.15 M NaCl, 2 mM EDTA, and 5 mM DTT. Add 3.1 mL of ethanolamine into 750 mL of water followed by addition of 480.48 g of urea and 8.77 g of NaCl. Once the urea and NaCl are completely dissolved, add 4 mL of 0.5 M EDTA and 5 mL of 1 M DTT, adjust the pH to 9.6 with HCl and bring the final volume to 1 L with water. 4. Chromatography column: size: 50  1.0 cm I.D., Vt ¼ 39 mL. 5. Resin: Sephacryl S-200 HR (GE Health Sciences). 6. Reducing sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE). 7. Coomassie Brilliant Blue R-250 stain. 8. Glycoprotein specific stain (Pierce GelCode Glycoprotein Staining Kit; Thermo Fisher Scientific). 9. Dialysis tubing: molecular weight cutoff (MWCO) 10,000 Da. 10. 20 mM ammonium bicarbonate buffer: Dissolve 1.58 g of NH4HCO3 in 1 L of water. The pH should be between 8.2 and 8.5.

3

Methods

3.1 T. forsythia Culturing

1. Inoculation, growth and bacteria harvesting. Streak an agar plate with a glycerol stock of T. forsythia cells and incubate the plate at 37
C in the anaerobic chamber (see Note 2). It may take 4–5 days for colonies to appear. With the help of a sterile bacterial loop transfer a loopful of colonies from the plate into a culture medium (10 mL) dispensed in a screwcap glass tube; rub the loop on the walls of the tube to dislodge and suspend the colonies into the medium (see Note 3). Incubate the tube at 37
C in the anaerobic chamber. When the culture

T. forsythia Surface-layer Glycoprotein Isolation

139

reaches an absorbance at 600 nm of 0.6 (it may take 2–3 days) (see Note 4), transfer the bacterial suspension into 500 mL of fresh broth and incubate for 5 days in the anaerobic chamber at 37
C as above. At the end of the incubation the bacterial suspension should reach at least an absorbance of 1.0. Pellet bacterial suspension by centrifugation at 8000  g for 10 min at 4
C. 3.2 Extraction and Partial Purification of T. forsythia Surface Layer

1. Wash the T. forsythia cell pellet three times with 50 mM Tris– HCl, pH 7. 4. Pellet cells each time by centrifugation at 8000  g for 10 min at 4
C. 2. Resuspend the cell pellet in 30 mL of 2% NaDoc and stir for 3 h at 4
C. 3. Centrifuge the bacterial suspension at 12,000  g for 15 min at 4
C and save the supernatant (extract) in an appropriate container. 4. Resuspend the cell debris in 15 mL of ice-cold 50 mM Tris– HCl, pH 7. 4 and stir for 10 min in the cold room (6–8
C). Centrifuge the suspension at 12,000  g for 10 min at 4
C, collect the supernatant (cell debris wash) and pool it with the extract saved above. 5. Centrifuge the pooled solution (extract + cell debris wash) at 80,000  g for 1 h at 4
C and resuspend the pellet in 20 mL of 50% CsCl. 6. Transfer the CsCl suspension into the Quick-Seal tubes using a syringe with a 13-G or smaller needle. A small air bubble no larger than 3 mm can be left in the tube neck. Leaving a larger air space can cause deformation or collapsing of tube during centrifugation. Heat seal tubes using the Beckman-Coulter tube sealer as per the instructions provided in the manual. Prior to sealing, make sure that the tube neck is dry. After sealing, place tubes in the ultracentrifuge rotor and place metal spacers over each tube. 7. Centrifuge the tubes at 100,000  g for 18 h with breaks set to the OFF setting to prevent dispersion of protein bands during stoppage of the run. 8. After centrifugation, carefully remove each tube and look for two translucent white protein bands. The second band from the top contains the S-layer fraction (Fig. 1). 9. To remove the S-layer protein band, first insert a 26-G needle into the top of the tube and then insert a 22-G needle attached to a 3-mL insulin syringe just below the band of the S-layer fraction, and carefully aspirate the protein band. 10. Transfer the contents into a fresh ultracentrifuge tube, and centrifuge at 80,000  g for 1 h at 4
C.

140

Sreedevi Chinthamani et al.

Fig. 1 Protein banding after CsCl ultracentrifugation. The second band from the top (indicated with an arrow) contains the S-layer protein faction

11. Wash the S-layer protein pellet twice in 30 mL of 50 mM Tris– HCl, pH 7.4 by repeated resuspension and centrifugation as above. Finally, resuspend pellet in 5 mL of 50 mM Tris–HCl, pH 7.4 (see Note 5). 12. Centrifuge the S-layer fraction as above and store the protein pellet at 80
C until further purification by size exclusion chromatography. 3.3 Size Exclusion Chromatography

1. Resuspend the S-layer protein pellet in 4 mL of CB. Let the pellet incubate and shake in the buffer for 1–2 h at 8–10
C. 2. Centrifuge the S-layer solution at 15,000  g for 15 min at 8
C to remove any insoluble material and collect the clear supernatant. 3. Apply up to 1 mL of the clear supernatant on a chromatography column packed with the Sephacryl S-200 HR resin and equilibrated with CB in a cold room. 4. Elute the proteins from the column at a flow rate of 12–15 mL/h. Monitor the absorbance at 280 nm and collect 1 mL of fractions. 5. Analyze the protein fractions by reducing SDS-PAGE. Visualize proteins by staining with Coomassie Brilliant Blue R-250 stain or glycoprotein specific stain (see Note 6).

T. forsythia Surface-layer Glycoprotein Isolation

141

6. Pool fractions containing S-layer proteins and dialyze extensively against 20 mM ammonium bicarbonate buffer, lyophilize, and store at 20
C.

4

Notes 1. For preparing broth or agar plates, bring the temperature of the medium to 45
C before adding blood to avoid lysis. 2. T. forsythia is a fastidious organism and a strict anaerobe. The quality of the horse serum and the correct composition of anaerobic gas mix is very important to obtain optimal growth. Prior to inoculation, broth should be well equilibrated to the anaerobic environment. 3. Bacterial cells should be harvested from broth cultures inoculated with freshly streaked plates inoculated from lower passaged frozen stocks. 4. To monitor the bacterial growth, take 1 mL of culture, pellet bacteria by centrifugation, wash cells once with water by suspending and pelleting cells by centrifugation. Finally, resuspend cells in 1 mL of water, transfer cell suspension into a glass cuvette and read absorbance at 600 nm. 5. The CsCl purified S-layer fraction after washing is generally milky in appearance but this should not cause any alarm. 6. A typical separation profile of S-layer proteins on a SephacrylS200 and the analysis of purified proteins by SDS-PAGE are shown in Fig. 2.

Absorbance (280 nm)

A.

B.

Vt = 40 ml Flow rate :15 ml/h Fraction volume = 1 ml

0.4

kDa 245

S-layer Proteins

0.3

1 2 3 4

180 100

0.2

40

0.1 0.0

0

5

10

15

20

25

30

35

40

Coom Glyc

Fraction

Fig. 2 (a) Sephacryl S-200 chromatographic profile of S-layer fraction from cesium chloride ultracentrifugation. (b) SDS-PAGE analysis of purified S-layer fraction purified by Sephacryl S-200 chromatography. Gels were either stained with Coomassie (Coom) or Glycostain (Gly); lanes 1 and 3 each contain 5 μg and lanes 2 and 4 each contain 10 μg of total protein

142

Sreedevi Chinthamani et al.

References 1. Tanner AC, Izard J (2006) Tannerella forsythia, a periodontal pathogen entering the genomic era. Periodontol 2000(42):88–113 2. Sharma A (2010) Virulence mechanisms of Tannerella forsythia. Periodontol 2000 54 (1):106–116 3. Sleytr UB, Beveridge TJ (1999) Bacterial S-layers. Trends Microbiol 7(6):253–260 4. Sleytr UB, Schuster B, Egelseer EM et al (2014) S-layers: principles and applications. FEMS Microbiol Rev 38(5):823–864 5. Sara M, Pum D, Schuster B et al (2005) S-layers as patterning elements for application in nanobiotechnology. J Nanosci Nanotechnol 5(12):1939–1953 6. Ucisik MH, Sleytr UB, Schuster B (2015) Emulsomes meet S-layer proteins: an emerging targeted drug delivery system. Curr Pharm Biotechnol 16(4):392–405 7. Sara M, Sleytr UB (2000) S-layer proteins. J Bacteriol 182(4):859–868 8. Sleytr UB, Schuster B, Egelseer EM et al (2011) Nanobiotechnology with S-layer proteins as building blocks. Prog Mol Biol Transl Sci 103:277–352 9. Kerosuo E (1988) Ultrastructure of the cell envelope of Bacteroides forsythus strain ATCC 430377T. Oral Microbiol Immunol 3 (3):134–137 10. Sabet M, Lee SW, Nauman RK et al (2003) The surface (S-) layer is a virulence factor of Bacteroides forsythus. Microbiology 149 (Pt 12):3617–3627 11. Sakakibara J, Nagano K, Murakami Y et al (2007) Loss of adherence ability to human gingival epithelial cells in S-layer protein-deficient mutants of Tannerella forsythensis. Microbiology 153(Pt 3):866–876 12. Bloch S, Thurnheer T, Murakami Y et al (2017) Behavior of two Tannerella forsythia strains and

their cell surface mutants in multispecies oral biofilms. Mol Oral Microbiol 32(5):404–418 13. Shimotahira N, Oogai Y, Kawada-Matsuo M et al (2013) The S-layer of Tannerella forsythia contributes to serum resistance and oral bacterial co-aggregation. Infect Immun 81 (4):1198–1206 14. Sekot G, Posch G, Messner P et al (2011) Potential of the Tannerella forsythia S-layer to delay the immune response. J Dent Res 90 (1):109–114 15. Settem RP, Honma K, Sharma A (2014) Neutrophil mobilization by surface-glycan altered th17-skewing bacteria mitigates periodontal pathogen persistence and associated alveolar bone loss. PLoS One 9(9):e108030 16. Settem RP, Honma K, Nakajima T et al (2012) A bacterial glycan core linked to surface (S)layer proteins modulates host immunity through Th17 suppression. Mucosal Immunol 6:415–426 17. Posch G, Pabst M, Brecker L et al (2011) Characterization and scope of S-layer protein O-glycosylation in Tannerella forsythia. J Biol Chem 286:38714–38724 18. Friedrich V, Janesch B, Windwarder M et al (2017) Tannerella forsythia strains display different cell-surface nonulosonic acids: biosynthetic pathway characterization and first insight into biological implications. Glycobiology 27(4):342–357 19. Richardson MB, Williams SJ (2014) MCL and Mincle: C-type lectin receptors that sense damaged self and pathogen-associated molecular patterns. Front Immunol 5:288 20. Chinthamani S, Settem RP, Honma K et al (2017) Macrophage inducible C-type lectin (Mincle) recognizes glycosylated surface (S)layer of the periodontal pathogen Tannerella forsythia. PLoS One 12(3):e0173394

Chapter 14 Separation of Glycosylated OmpA-Like Proteins from Porphyromonas gingivalis and Tannerella forsythia Yukitaka Murakami, Keiji Nagano, and Yoshiaki Hasegawa Abstract OmpA-like proteins located in the outer bacterial membrane are potential virulence factors from the major periodontal pathogens Porphyromonas gingivalis and Tannerella forsythia. Our previous studies have shown that OmpA-like proteins are glycosylated by O-linked N-acetylglucosamine (O-GlcNAc) and are strongly reactive to wheat germ agglutinin (WGA) lectin, which shows sugar specificity to GlcNAc. Utilizing this property, we have developed a separation method for OmpA-like proteins by affinity chromatography using WGA lectin-agarose. The purity of enriched native OmpA-like proteins were confirmed by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and Coomassie Brilliant Blue (CBB) staining. More importantly, the purified OmpA-like proteins formed a unique trimeric structure keeping their bioactivity intact. In this chapter, we describe a detailed procedure to separate OmpA-like proteins, which may be used to further progress the biological studies of OmpA-like proteins. Key words Glycoproteins, OmpA-like proteins, Porphyromonas gingivalis, Tannerella forsythia, Wheat germ agglutinin lectin, Affinity chromatography, O-linked N-acetylglucosamine

1

Introduction A majority of people suffer from periodontal disease [1–3], which is currently thought to be associated with several systemic diseases, such as cardiovascular disease, diabetes, and rheumatoid arthritis [4, 5]. The gram-negative bacteria Porphyromonas gingivalis, Tannerella forsythia, and Treponema denticola are the major periodontal pathogens, well-known as “red complex” [6]. Among them, P. gingivalis is a keystone pathogen which leads the periodontal community to the dysbiotic microbiota [7–9]. Virulence factors from P. gingivalis and T. forsythia have been extensively studied thus far. Major virulence factors reported in P. gingivalis include the fimbriae, gingipain proteases, and lipopolysaccharide, while those in T. forsythia include the S-layer and BspA protein [6, 10– 12]. In addition, outer membrane proteins, which locate in the bacterial cell wall, possess potential virulence factors. Therefore, we

Keiji Nagano and Yoshiaki Hasegawa (eds.), Periodontal Pathogens: Methods and Protocols, Methods in Molecular Biology, vol. 2210, https://doi.org/10.1007/978-1-0716-0939-2_14, © Springer Science+Business Media, LLC, part of Springer Nature 2021

143

144

Yukitaka Murakami et al.

have focused on outer membrane proteins from P. gingivalis and T. forsythia (Table 1), especially OmpA-like proteins [13–18], which are homologous to the OmpA protein in Escherichia coli [19–21]. The separation of virulence factors is usually a prerequisite procedure to characterize their virulence-related properties. We have tried to purify the native OmpA-like proteins while keeping their bioactivity intact by using conventional gel filtration and ion exchange chromatography after the fractionation of the P. gingivalis and T. forsythia outer membrane. However, this attempt was unsuccessful. We could only purify the denatured OmpA-like proteins from the excised protein bands after staining of sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) gel with Coomassie brilliant blue (CBB) by electroelution. However, the bioactivity of OmpA-like proteins purified through this method was questionable, because outer membrane protein materials were boiled prior to loading into the SDS-PAGE gel. The difficulty in obtaining purified proteins has hindered the detailed analysis of the OmpA-like proteins, such as the analyses of their structure and their functions as porin. Therefore, we examined the biological properties of OmpA-like proteins by using mutant strains [14, 16, 18]. Protein glycosylation is recently known to exist in both eukaryotes and prokaryotes [22, 23]. Several glycoproteins in periodontal pathogens, such as P. gingivalis and T. forsythia, have been studied until now. Gingipains, Mfa1 fimbriae and other proteins were reported as glycoproteins in P. gingivalis [24–28], whereas S-layer proteins, BspA and others were reported in T. forsythia [29, 30]. To search for novel glycoproteins from P. gingivalis, we performed a glycoproteomic study by combining glycoprotein staining with two-dimensional gel electrophoresis and mass spectrometry. As a result, we have shown that OmpA-like proteins are glycosylated [31]. In addition, OmpA-like proteins are shown to have a high affinity to several lectins by lectin blot analysis, especially to wheat germ agglutinin (WGA) lectin. Furthermore, OmpA-like proteins have an O-linked N-acetylglucosamine (O-GlcNAc) modification, suggested being derived from the sugar specificity of WGA lectin, shown in western blot analysis by using an anti-O-GlcNAc antibody [32]. Next, we tried to purify OmpA-like proteins solubilized with 1% dodecyl maltoside (DDM) from the periodontal pathogen P. gingivalis by affinity chromatography using WGA lectin-agarose. We successfully separated OmpA-like proteins by using a one-step chromatography procedure with preserved binding abilities to the extracellular matrix proteins, such as fibronectin, laminin, and collagen type I [32]. This separation method is also effective for OmpA-like protein from another periodontal pathogen, that is, T. forsythia [33]. OmpA-like proteins purified from P. gingivalis

Isolation of Glycosylated OmpA-Like Proteins from Periodontal Pathogens

145

Table 1 OmpA-like proteins from representative strains of P. gingivalis and T. forsythia

Locus tag

Apparent molecular mass (kDa)

PGN_0728

40

PGN_0729

41

HMPREF1322_0632

41

HMPREF1322_0633

40

ATCC 43037

Tanf_10935

40

92A2

BFO_0311

40

Strain P. gingivalisa

ATCC 33277

W50

T. forsythia

b

a

OmpA-like proteins from P. gingivalis consist of heterotrimeric structure of 40- and 41-kDa proteins [13, 14]. Identities between PGN_0728 and HMPREF1322_0633, and those between PGN_0729 and HMPREF1322_0632 are both 99% b OmpA-like protein from T. forsythia consists of homodimeric or homotrimeric structure of 40-kDa protein [18, 29]. Identities between Tanf_10935 and BFO_0311 are 100%

and T. forsythia by WGA lectin-agarose show apparent molecular masses of about 40 kDa and 120 kDa under reducing and nonreducing conditions, respectively, by SDS-PAGE (Table 1). Thus, the trimeric form of native OmpA-like proteins is obtained by using the WGA column [32, 33]. Since WGA lectin is popular and costeffective, this separation method may be applicable to OmpA-like proteins from other gram-negative bacteria. Here, we present a detailed method for the separation of glycosylated OmpA-like proteins from representative periodontal pathogens P. gingivalis and T. forsythia by WGA lectinaffinity chromatography. We think this method may be highly useful to further study OmpA-like proteins and their biological activity.

2

Materials Prepare all solutions using ultrapure water and analytical grade reagents. Prepare and store all reagents at room temperature, unless indicated otherwise. Diligently follow all waste disposal regulations when disposing of waste materials.

2.1 Growth of Bacterial Cells

1. Bacterial strains: Porphyromonas gingivalis ATCC 33277, W50; Tannerella forsythia ATCC 43037, 92A2. 2. Growth medium for P. gingivalis: Dissolve 6 g of trypticase soy broth and 0.5 g of yeast extract in 197 mL of water. Autoclave for 20 min at 121
C. Prior to bacterial inoculation add 1 mL of hemin, 0.2 mL of menadione, and 2 mL of dithiothreitol. 3. Growth medium for T. forsythia: Dissolve 6 g of trypticase soy broth and 0.5 g of yeast extract in 187 mL of water. Autoclave for 20 min at 121
C. Prior to bacterial inoculation add 1 mL of

146

Yukitaka Murakami et al.

hemin, 0.2 mL of menadione, 2 mL of dithiothreitol, 0.2 mL of N-acetyl muramic acid, and 10 mL of Fildes extract or 10 mL of fetal bovine serum. 4. Hemin stock (0.5 mg/mL): Dissolve 50 mg of hemin in 1 mL of 1 N NaOH and add 99 mL of water. Autoclave at 121
C for 20 min. Store at 4
C. 5. Menadione stock (5 mg/mL): Dissolve 50 mg of menadione in 10 mL of 100% ethanol and filter sterilize. Store at 4
C. 6. Dithiothreitol stock (10 mg/mL): Dissolve 100 mg of dithiothreitol in 10 mL of water and sterilize by filtration. Store at 4
C. 7. N-Acetyl muramic acid stock (10 mg/mL): Dissolve 100 mg of N-acetyl muramic acid in 10 mL of water and sterilize by filtration. Store at 4
C. 8. Fildes extract (Thermo Fisher Scientific). 9. Fetal bovine serum. 10. Anaerobic chamber (seeNote 1): 10% (v/v) CO2, 10% (v/v) H2, 80% (v/v) N2 atmosphere. Anaerobox (Hirasawa Works). 11. Spectrophotometer (Shimadzu UV1240). 2.2 Preparation of Bacterial Whole-Cell Lysates

1. Centrifuge and appropriate rotor (Kubota 7000 and A-6512C). 2. HEPES buffer (seeNote 2): 10 mM HEPES–NaOH (pH 7.4) containing 0.15 M NaCl. 3. Nα-p-tosyl-L-lysine chloromethyl ketone (TLCK): 10 mM stock solution in ethanol. Store at 20
C. 4. Phenylmethyl sulfonyl fluoride (PMSF): 20 mM stock solution in ethanol. Store at 20
C. 5. Leupeptin: 10 mM stock solution in water. Store at 20
C. 6. HEPES buffer containing protease inhibitors: 10 mM HEPES–NaOH (pH 7.4) containing protease inhibitors (0.1 mM TLCK, 0.2 mM PMSF, and 0.1 mM leupeptin). 7. French pressure cell press (Ohtake Works) or sonicator (Bioruptor UCD-300, Cosmo Bio) (seeNote 3).

2.3 Solubilization of Bacterial Whole-Cell Lysates

1. DDM solution: 20% stock solution in water. 2. 1% DDM: Add 1 mL of DDM solution to 19 mL of 10 mM Tris–HCl (pH 7.4) containing protease inhibitors (0.1 mM TLCK, 0.2 mM PMSF, and 0.1 mM leupeptin). 3. Tabletop ultracentrifuge (Optima TLX, Beckman). 4. Ultracentrifuge rotor (TLA-100.2, Beckman). 5. Ultracentrifugation tube (1.5 mL). 6. Shaker or rocker.

Isolation of Glycosylated OmpA-Like Proteins from Periodontal Pathogens

2.4 Lectin Affinity Chromatography

147

1. Tris buffer: 10 mM Tris–HCl (pH 7.4). 2. Tris buffer containing protease inhibitors: 10 mM Tris–HCl (pH 7.4) with protease inhibitors (0.1 mM TLCK, 0.2 mM PMSF, and 0.1 mM leupeptin). 3. WGA agarose (J-Chemicals). 4. Empty column: Poly-prep column (Bio-Rad) or Muromac mini-column (Muromachi Chemicals). 5. Inhibitory sugar: GlcNAc. 6. Cellulose dialysis tubing: Molecular weight cut-off (MWCO) 12–14 kDa. 7. Ficoll PM400 (GE Healthcare) (seeNote 4). 8. Centrifuge filter unit (10 kDa MWCO): Amicon ultra (Millipore). 9. Wash buffer: 20 mM Tris–HCl (pH 7.4) containing 0.15 M NaCl and 0.03% DDM and protease inhibitors (1 μM TLCK, 2 μM PMSF, and 1 μM leupeptin). 10. Elution buffer: 20 mM Tris–HCl (pH 7.4) containing 0.15 M NaCl, 0.03% DDM, protease inhibitors (1 μM TLCK, 2 μM PMSF, and 1 μM leupeptin), and 0.2 M GlcNAc. 11. Spectrophotometer (Shimadzu UV1240).

2.5

SDS-PAGE

1. SDS-PAGE apparatus: Mini-PROTEAN Tetra Cell (Bio-Rad). 2. Polyacrylamide gels (seeNote 5): 12% polyacrylamide gel, 0.75mm thick [34, 35]. 3. Electrophoresis buffer: 25 mM Tris, 192 mM glycine, 0.1% SDS (pH 8.3). 4. SDS-buffer: Mix 2.5 mL of 0.5 M Tris–HCl (pH 6.8), 4.0 mL of 10% SDS, 2.0 mL of glycerol, and an appropriate amount of bromophenol blue (BPB). When needed, add 1.0 mL of 2-mercaptoethanol (2-ME) just before use. 5. Heat block. 6. Tabletop mini centrifuge. 7. Molecular marker: Precision Plus Protein Standards (Bio-Rad). 8. Molecular marker for glycoprotein (seeNote 6): CandyCane glycoprotein molecular weight standards (Thermo Fisher Scientific).

2.6 Detection of Proteins

1. CBB R-250. 2. SYPRO Ruby protein gel stain (Thermo Fisher). 3. UV illuminator or gel imaging device (e.g., FluoroPhoreStar 3000 image capture system, Anatech). 4. Filters imaging for SYPRO Ruby protein gel stain: Excitation/ Emission (nm) are 280 and 450/610, respectively.

148

Yukitaka Murakami et al.

2.7 Detection of Glycosylated Proteins Using Glycoprotein Stain

1. Pro-Q Emerald 300 Glycoprotein Gel and Blot Stain Kit (Thermo Fisher Scientific; seeNote 7). 2. Pro-Q Emerald 300 solution: Prepare according to the manufacturer’s instructions. 3. Fix solution: 50% methanol and 5% acetic acid in water. 4. Wash solution: 3% glacial acetic acid in water. 5. Oxidizing solution: Prepare according to the manufacturer’s instructions of Pro-Q Emerald 300. 6. UV illuminator or gel imaging device (e.g., FluoroPhoreStar 3000 image capture system, Anatech). 7. Filters for imaging Pro-Q Emerald 300 glycoprotein stain: Excitation/Emission (nm) are 280/530, respectively.

2.8

Western Blotting

1. Blotting apparatus (Mini Trans-Blot Cell, Bio-Rad): Wet (tank) system. 2. Membranes: Polyvinylidene nitrocellulose.

difluoride

(PVDF)

or

3. Methanol. 4. Transfer buffer (seeNote 8): Tris–Glycine transfer buffer (25 mM Tris, 192 mM Glycine, pH 8.3, 20% methanol; [34]). 5. Filter paper. 2.8.1 Confirmation of OmpA-Like Proteins Using Specific Antibody (SeeNote 9)

1. TBS: 20 mM Tris–HCl (pH 7.5) containing 0.5 M NaCl. 2. 1% bovine serum albumin (BSA)–TBS: TBS containing 1% BSA. 3. TBS-T: TBS containing 0.05% Tween 20. 4. Anti-Pgm6/7 antibody (seeNote 10): Rabbit polyclonal antiserum specific for the Pgm6/7 proteins (OmpA-like proteins) from P. gingivalis ATCC 33277 [14, 15]. 5. Secondary antibody: Horseradish peroxidase (HRP)conjugated goat anti-rabbit IgG (MP Bio Medicals). 6. 0.05% 4-chloro-1-naphtol in TBS. 7. 30% hydrogen peroxide.

2.8.2 Detection of O-GlcNAc Modification Using Anti-O-GlcNAc Antibody

1. BSA-TBS (seeitem 2 in Subheading 2.8.1). 2. TBS-T (seeitem 3 in Subheading 2.8.1). 3. Mouse monoclonal anti-O-GlcNAc (CTD110.6; Cell Signaling Technology). 4. Secondary antibody: HRP conjugated goat anti-mouse IgM (Dako). 5. ECL Prime western blotting detection system (GE Healthcare Life Sciences): A chemiluminescence detection reagent. 6. Digital imager (Light-Capture II system, Atto).

Isolation of Glycosylated OmpA-Like Proteins from Periodontal Pathogens 2.8.3 Confirmation of WGA Reactivity by Lectin Blotting

149

1. Tris buffer: 10 mM Tris–HCl (pH 7.4) containing 0.15 M NaCl. 2. Buffer-T: 10 mM Tris–HCl (pH 7.4) containing 0.15 M NaCl and 0.05% Tween 20. 3. HRP-conjugated WGA lectin (Vector Laboratories or EY Laboratories; seeNote 11): Dilute 200 times with Buffer-T. 4. Rinsing buffer: 10 mM Tris–HCl (pH 7.4) containing 0.15 M NaCl. 5. 0.05% 3,30 -diamino benzidine (DAB) in TBS. 6. 30% hydrogen peroxide.

3

Methods

3.1 Growth of Anaerobic Bacterial Cells

1. Grow P. gingivalis in growth media under anaerobic conditions at 37
C for 48 h. 2. Grow T. forsythia in growth media under anaerobic conditions at 37
C for 120 h. 3. Monitor bacterial growth using a spectrophotometer by measuring optical density (OD) at a wavelength of 600 nm (OD600).

3.2 Preparation of Bacterial Whole-Cell Lysates

All procedures should be done at 4
C. 1. Harvest bacterial cells from 200 mL of culture by centrifuging at 10,000  g for 20 min. 2. Wash bacterial cells twice with 10 mM HEPES–NaOH (pH 7.4) containing 0.15 M NaCl. 3. Resuspend with 20 mL of 10 mM HEPES–NaOH (pH 7.4) containing protease inhibitors. 4. Disrupt cells in a French pressure cell press by three passes at 100 MPa, or in a sonicator repeating 30 s bursts and 30 s intervals for 15 min. 5. Remove the remaining undisrupted bacterial cells and large debris by centrifugation at 1000  g for 10 min. 6. Collect the supernatant as the bacterial whole-cell lysates.

3.3 Solubilization of Bacterial Whole-Cell Lysates

All procedures should be done at 4
C. 1. Solubilize the whole-cell lysates with 1% DDM for 2 h by using rotator or rocker. 2. Remove the insoluble materials by ultracentrifugation at 100,000  g for 1 h. 3. Collect the supernatant as the solubilized material.

150

Yukitaka Murakami et al.

3.4 Lectin Affinity Chromatography (SeeNote 12)

All procedures should be done at 4
C. 1. Suspend 1 mL of settled WGA-agarose in 10 mM Tris–HCl (pH 7.4) to make a slurry. 2. Pour the slurry into the column. 3. Pack 1 mL of WGA–agarose slurry to an empty mini-column until the desired level is reached (seeNote 13). 4. Equilibrate the column with ten bed volumes of wash buffer. 5. Apply solubilized materials (about 5 mg of protein) to a WGA-agarose column. Leave column overnight to increase binding of glycoproteins. 6. Wash with ten bed volumes of the wash buffer. 7. Elute the bound proteins with five bed volumes of the elution buffer (seeNote 14). 8. Transfer the eluted samples to the cellulose dialysis tubing. 9. Dialyze the eluted samples extensively against 10 mM Tris– HCl (pH 7.4). 10. Concentrate the sample in the dialysis tubing by Ficoll PM400. 11. Recover materials from the dialysis tubing by rinsing out the tubing with a small volume of 10 mM Tris–HCl (pH 7.4) containing inhibitors. 12. Concentrate again using a centrifuge filter unit when needed. 13. Determine the concentration of protein samples using a spectrophotometer by measuring the OD at 280 nm.

3.5

SDS-PAGE

1. Mix up to three volumes of the samples from lectin affinity chromatography (approximately 30 μg) and one volume of SDS-buffer with 2-ME. 2. Denature the samples at 100
C for 5 min. 3. Perform SDS-PAGE under constant voltage at 100 V. Usually run SDS-PAGE until the BPB dye front reaches the bottom.

3.6 Detection of Proteins

1. Perform SDS-PAGE (see Subheading 3.5).

3.7 Detection of Glycosylated Proteins (SeeNote 15)

1. Perform SDS-PAGE (see Subheading 3.5).

2. For protein detection, stain gels with CBB R-250 (Fig. 1) or SYPRO Ruby protein gel stain according to the manufacturer’s instructions. When SYPRO Ruby protein gel is used, acquire images by UV illuminator or gel imaging device.

2. Fix the gel with the fix solution at room temperature (RT) for 30 min. Wash the gel with the wash solution twice at RT for 10–20 min. 3. Oxidize the carbohydrates with the oxidizing solution at RT for 30 min.

Isolation of Glycosylated OmpA-Like Proteins from Periodontal Pathogens

P. g ingivalis W50 kDa M 250 150 100 75 50 37 25 20

P

B

P. g ingivalis ATCC 33277 kDa 250 150 100 75 50 37 * 25 20

M

P

B

151

T. forsythia ATCC 43037 kDa 250 150 100 75 50 * 37

M

P

B

*

25 20

M, molecular marker; P, whole- cell lysates prior to loading into the WGA column; B, proteins bound to the WGA column; *, enriched OmpA - like proteins

Fig. 1 Example of the separation of OmpA-like proteins by WGA lectin affinity chromatography. Whole-cell lysates from P. gingivalis W50, P. gingivalis ATCC 33277, and T. forsythia ATCC 43037 were solubilized with 1% DDM and applied to a WGA lectin-agarose column. The bound proteins were eluted with 0.2 M GlcNAc. The obtained fractions were dialyzed, concentrated, and subjected to SDS-PAGE. The gels were stained with CBB R-250. Lane M, molecular marker; Lane P, whole-cell lysates prior to loading into to the WGA column; Lane B, proteins bound to the WGA column; *, enriched OmpA-like proteins

4. Stain the gel with the Pro-Q Emerald 300 solution at RT for 90 min in the dark. 5. Wash the gel with the wash solution twice at RT for 15 min. 6. Visualize stained glycoproteins using a UV illuminator or gel imaging device. 3.8

Western Blotting

3.8.1 Detection of OmpA-Like Proteins

After SDS-PAGE, transfer proteins from gels onto nitrocellulose or PVDF membranes with the transfer buffer at 30 V overnight. PVDF membranes should be used for the ECL detection system. Wet PVDF membranes in methanol before performing blotting. 1. Block the transferred membranes with 1% BSA-TBS at RT for 30 min. 2. Incubate the membranes with primary antibody (anti-Pgm6/7 antibody, 1:3000–1:10,000) in 1% BSA-TBS at RT for 5 h. 3. Wash the membranes with TBS-T three times at RT for 15 min each time. 4. Incubate the membranes with secondary antibody (HRP conjugated goat anti-rabbit IgG, 1:3000) in 1% BSA-TBS at RT for 5 h.

152

Yukitaka Murakami et al.

5. Wash the membranes twice with TBS-T at RT for 15 min each time, then once with TBS at RT for 15 min. 6. Soak the membranes with 30 mL of 0.05% 4-chloro-1-naphthol in TBS and 15 μL of 30% hydrogen peroxide to visualize the OmpA-like proteins. 7. Wash the membranes with water. 3.8.2 Detection of O-GlcNAc Modification (SeeNote 16)

1. Block the transferred PVDF membranes with 1% BSA-TBS at RT for 3 h. 2. Incubate the membranes with primary antibody (anti-OGlcNAc, 1:10,000) in TBS-T at 4
C, overnight. 3. Wash the membranes with TBS-T at RT, twice for 2 min each time, once for 15 min, and then three times for 5 min each time. 4. Incubate the membranes with secondary antibody (HRP conjugated anti-mouse IgM, 1:30,000) in TBS-T at RT for 3 h. 5. Wash the membranes with TBS-T at RT, twice for 2 min each time, once for 15 min, and then three times for 5 min each time. 6. Develop the membrane with ECL Prime western blotting detection system according to the manufacturer’s instructions. 7. Acquire the respective image on an appropriate digital imager.

3.8.3 Lectin Blotting

1. Block the transferred membranes with Buffer-T at 4
C for 1 h. 2. Incubate the membranes with HRP-conjugated WGA lectin (1:200 dilution) in Buffer-T at RT for 3 h. 3. Wash the membranes twice with Buffer-T at RT for 10 min each time. 4. Rinse the membranes once with 10 mM Tris–HCl (pH 7.4) containing 0.15 M NaCl at RT for 10 min. 5. Soak the membranes with 30 mL of 0.05% DAB in TBS and 15 μL of 30% hydrogen peroxide to visualize the binding of the OmpA-like proteins to WGA lectin. 6. Wash the membrane with water.

4

Notes 1. Alternatively, anaerobic cultivation sets (e.g., Anaero Pack (Mitsubishi Gas Chemical)) can be used. 2. Alternatively, 10 mM Tris–HCl (pH 7.4) containing 0.15 M NaCl can be used.

Isolation of Glycosylated OmpA-Like Proteins from Periodontal Pathogens

153

3. The French pressure cell press (French press) must be chilled before use. The French press allows for steady disruption and is suitable for relatively large number of samples. In contrast, the sonicator is used for a small number of samples; however, the temperature tends to become higher and disruption is not stable. 4. The Ficoll PM400 is useful for concentrating solutions by dialysis. Osmotic pressure draws water across the membrane into the solution of Ficoll PM400. 5. We prefer method of Lugtenberg et al. [35] rather than the conventional method of Laemmli [36], because the former shows better separation for bacterial membrane proteins. We usually make handcast gels. 6. When Pro-Q Emerald is used to detect glycoproteins, CandyCane glycoprotein molecular standards must be loaded to the SDS-PAGE gel to distinguish between specifically and nonspecifically stained bands. CandyCane glycoprotein molecular standards consist of mixture of glycoproteins and nonglycosylated proteins. 7. Pro-Q Emerald is more sensitive than the traditional periodic acid-Shiff base method using fuchsin dye. Instead of Pro-Q Emerald 300 stain, Pro-Q Emerald 488 stain for visible light excitation is alternatively used (excitation maximum at 510 nm, emission maximum at 520 nm). 8. Alternatively, a carbonate–bicarbonate transfer buffer (3 mM Na2CO3, 10 mM NaHCO3, pH 9.9, with 20% methanol) can be used. 9. We usually use 4-chloro-1-naphthol for detection of proteins (see Subheading 2.8.1), and DAB for glycosylation detection (see Subheading 2.8.3). Because these chromogenic substrates have somewhat low sensitivity, the chemiluminescence system is required for the detection of O-GlcNAc modification (see Subheading 2.8.2). 10. The anti-Pgm6/7 antibody described previously [14, 15] is reactive to OmpA-like proteins from most P. gingivalis strains tested. In addition, this antibody shows cross-reactivity to OmpA-like protein from T. forsythia [18]. 11. The HRP-conjugated WGA from J-Chemicals (formerly J-Oil Mills) is discontinued. 12. For the separation of OmpA-like proteins by WGA-agarose, the addition of metal ions, such as Ca2+ and Mg2+, for wash and elution buffers is not necessary. 13. As column volume is small, we often use several columns at the same time. Generally, 1 mL of lectin agarose gel should be enough to bind 1–2 mg of glycoproteins.

154

Yukitaka Murakami et al.

14. After using the WGA column, regenerate it by washing it with ten volumes of 10 mM Tris–HCl (pH 7.4) containing 0.5 M NaCl to remove nonspecifically bound particles to the agarose gel. Store at 4
C in 10 mM phosphate-buffered saline (pH 7.2) containing 0.02% (w/v) sodium azide. 15. After glycoprotein staining using Pro-Q Emerald, subsequent protein staining using CBB or SYPRO Ruby is possible. However, sequential staining in the reverse order is not possible. 16. When the O-GlcNAc modification is detected by Western blotting, α-crystallin, which contains O-GlcNAc, should be included as a positive control protein. References 1. Kinane DF, Stathopoulou PG, Papapanou PN (2017) Periodontal disease. Nat Rev Dis Primers 3:17038 2. Michaud DS, Fu Z, Shi J et al (2017) Periodontal disease, tooth loss, and cancer risk. Epidemiol Rev 39:49–58 3. Eke PI, Borgnakke WS, Genco RJ (2020) Recent epidemiologic trends in periodontitis in the USA. Periodontol 2000 82:257–267 4. Kumar PS (2013) Oral microbiota and systemic disease. Anaerobe 24:90–93 5. Maddi A, Scannapieco FA (2013) Oral biofilms, oral and periodontal infections, and systemic disease. Am J Dent 26:249–254 6. Holt SC, Ebersole JL (2005) Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia: the “red complex”, a prototype polybacterial pathogenic consortium in periodontitis. Periodontol 2000 38:72–122 7. Darveau RP, Hajishengallis G, Curtis MA (2012) Porphyromonas gingivalis as a potential community activist for disease. J Dent Res 91:816–820 8. Hagishengallis G, Lamont RJ (2012) Beyond the red complex and into more complexity: the polymicrobial synergy and dysbiosis (PSD) model of periodontal disease etiology. Mol Oral Microbiol 27:409–419 9. Lamont RJ, Hajishengallis G (2015) Polymicrobial synergy and dysbiosis in inflammatory disease. Trends Mol Med 21:172–183 10. Lamont RJ, Jenkinson HF (1998) Life below the gum line: pathogenic mechanisms of Porphyromonas gingivalis. Microbiol Mol Biol Rev 62:1244–1263 11. Pathirana RD, O’Brien-Simpson NM, Reynolds EC (2010) Host immune responses to Porphyromonas gingivalis antigens. Periodontol 2000 52:218–237

12. Sharma A (2010) Virulence mechanisms of Tannerella forsythia. Periodontol 2000 54:106–116 13. Murakami Y, Imai M, Nakamura H et al (2002) Separation of the outer membrane and identification of major outer membrane proteins from Porphyromonas gingivalis. Eur J Oral Sci 110:157–162 14. Nagano K, Read EK, Murakami Y et al (2005) Trimeric structure of major outer membrane proteins homologous to OmpA in Porphyromonas gingivalis. J Bacteriol 187:902–911 15. Imai M, Murakami Y, Nagano K et al (2005) Major outer membrane proteins from Porphyromonas gingivalis: strain variation, distribution, and clinical significance in periradicular lesions. Eur J Oral Sci 113:391–399 16. Iwami J, Murakami Y, Nagano K et al (2007) Further evidence that major outer membrane proteins homologous to OmpA in Porphyromonas gingivalis stabilize bacterial cells. Oral Microbiol Immunol 22:356–360 17. Yoshimura F, Murakami Y, Nishikawa K et al (2009) Surface components of Porphyromonas gingivalis. J Periodontal Res 44:1–12 18. Abe T, Murakami Y, Nagano K et al (2011) OmpA-like protein influences cell shape and adhesive activity of Tannerella forsythia. Mol Oral Microbiol 26:374–387 19. Smith SG, Mahon V, Lambert MA et al (2007) A molecular Swiss army knife: OmpA structure, function and expression. FEMS Microbiol Lett 273:1–11 20. Krishnan S, Parasadarao NV (2012) Outer membrane protein A and OprF – versatile roles in Gram-negative bacterial infections. FEBS J 279:919–931

Isolation of Glycosylated OmpA-Like Proteins from Periodontal Pathogens 21. Confer AW, Ayalew S (2013) The OmpA family of proteins: roles in bacterial pathogenesis and immunity. Vet Microbiol 163:207–222 22. Nothaft H, Szymanski CM (2010) Protein glycosylation in bacteria: sweeter than ever. Nat Rev Microbiol 8:765–778 23. Eichler J, Koomey M (2017) Sweet new roles for protein glycosylation in prokaryotes. Trends Microbiol 25:662–672 24. Curtis MA, Thickett A, Slaney JM et al (1999) Variable carbohydrate modification to the catalytic chains of the RgpA and RgpB proteases of Porphyromonas gingivalis. Infect Immun 67:3816–3823 25. Nakao R, Tashiro Y, Nomura N et al (2008) Glycosylation of the OMP85 homolog of Porphyromonas gingivalis and its involvement in biofilm formation. Biochem Biophys Res Commun 365:784–789 26. Zeituni AE, McCaig W, Scisci E et al (2010) The native 67-kilodalton minor fimbria of Porphyromonas gingivalis is a novel glycoprotein with DC-SIGN-targeting motifs. J Bacteriol 192:4103–4110 27. Shoji M, Sato K, Yukitake H et al (2011) Por secretion system-dependent secretion and glycosylation of Porphyromonas gingivalis heminbinding protein 35. PLoS One 6:e21372 28. Shoji M, Nakayama K (2016) Glycobiology of the oral pathogen Porphyromonas gingivalis and related species. Microb Pathog 94:35–41 29. Veith PD, O’Brien-Simpson NM, Tan Y et al (2009) Outer membrane proteome and

155

antigens of Tannerella forsythia. J Proteome Res 8:4279–4292 30. Posch G, Pabst M, Brecker L et al (2011) Characterization and scope of S-layer protein O-glycosylation in Tannerella forsythia. J Biol Chem 286:38714–38724 31. Kishi M, Hasegawa Y, Nagano K et al (2012) Identification and characterization of novel glycoproteins involved in growth and biofilm formation by Porphyromonas gingivalis. Mol Oral Microbiol 27:458–470 32. Murakami Y, Hasegawa Y, Nagano K et al (2014) Characterization of wheat germ agglutinin lectin-reactive glycosylated OmpA-like proteins derived from Porphyromonas gingivalis. Infect Immun 82:4563–4571 33. Horie T, Inomata M, Into T et al (2016) Identification of OmpA-like protein of Tannerella forsythia as an O-linked glycoprotein and its binding capability to lectins. PLoS One 11: e0163974 34. Towbin H, Staehelin T, Gordon J (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci U S A 76:4350–4354 35. Lugtenberg B, Meijers J, Peters R et al (1975) Electrophoretic resolution of the ‘major outer membrane protein’ of Escherichia coli K12 into four bands. FEBS Lett 58:254–258 36. Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680–685

Chapter 15 Intranasal Vaccine Study Using Porphyromonas gingivalis Membrane Vesicles: Isolation Method and Application to a Mouse Model Satoru Hirayama and Ryoma Nakao Abstract Bacteria release spherical nanobodies, known as membrane vesicles (MVs), during various growth phases. MVs have been gaining recognition as structurally stable vehicles in the last two decades because they deliver a wide range of antigens, virulence factors, and immunomodulators to the host. These functions suggest not only the possible contribution of MVs to pathogenicity but also the potential applicability of low-dose MVs for use as vaccines. Here, we describe a series of methods for isolating MVs of Porphyromonas gingivalis, which is an important species among periodontopathic bacteria. The present chapter also introduces a mouse model of intranasal immunization using MVs from P. gingivalis. Key words Porphyromonas gingivalis, Membrane vesicles (MVs), Ultracentrifugation, Density gradient centrifugation, Lipid quantification, Intranasal immunization

1

Introduction A wide variety of bacteria, regardless of species, produce spherical structures during various phases of growth. These structures, called membrane vesicles (MVs), range in size from tens to hundreds of nanometers in diameter, and contain much of the biological content derived from their parent bacterial cells, such as phospholipids, peptidoglycans, lipopolysaccharides (LPS), proteins, enzymes, toxins, and nucleic acids [1, 2]. MVs therefore have versatile functions in bacteria-host interactions, serving as structurally stable transfer vehicles carrying virulence factors, antigens, immunomodulatory molecules, and signals for communication [3–5]. Porphyromonas gingivalis is a black-pigmented, gram-negative, anaerobic bacterium that resides in periodontal pockets as a component of biofilms. P. gingivalis is thought to contribute to periodontal diseases by turning a benign microbial community into a dysbiotic one, and thus is well-known as one of the “keystone

Keiji Nagano and Yoshiaki Hasegawa (eds.), Periodontal Pathogens: Methods and Protocols, Methods in Molecular Biology, vol. 2210, https://doi.org/10.1007/978-1-0716-0939-2_15, © Springer Science+Business Media, LLC, part of Springer Nature 2021

157

158

Satoru Hirayama and Ryoma Nakao

pathogens” of periodontal diseases [6, 7]. Notably, P. gingivalis MVs contain large amounts of various virulence factors, including gingipains (cysteine proteases consisting of lysine-gingipain Kgp, arginine-gingipain RgpA and RgpB), pili, CPG70, peptidylarginine deiminase, and HBP35 [8, 9], which could be responsible for the initiation and progression of periodontal diseases. On the other hand, attempts have been made to use a low dose of P. gingivalis MVs as a vaccine antigen [9, 10], taking advantage of the fact that MVs can be relatively thermostable vehicles carrying immunodominant antigens and natural adjuvants. In the present chapter, we describe the isolation method of MVs from P. gingivalis culture supernatant. The chapter also introduces a mouse model of intranasal immunization using P. gingivalis MVs. We are convinced that these general methods could be adapted to MV studies in other bacterial species as well by implementing some modifications.

2

Materials

2.1 Cultivation of P. gingivalis for MV Preparation

1. 0.5 mg/mL hemin solution: Weigh and dissolve 50 mg of hemin in 1 mL of 1 N NaOH. Make up to 100 mL with distilled water and autoclave. Store at 4  C. 2. 10 mg/mL menadione solution: Weigh and dissolve 50 mg of menadione in 5 mL of ethanol. After filtration through a 0.22μm filter, store at 4  C. 3. 100HM solution: Mix 0.5 mg/mL hemin solution and 10 mg/mL menadione solution at a ratio of 100:1 (v/v). Store at 4  C. 4. BHI + HM blood agar plate: Brain heart infusion (BHI) broth supplemented with 5 mg/L hemin, 1 mg/L menadione, 5% defibrinated sheep blood, and 1.5% agar. After mixing BHI broth and agar, and autoclaving, add 1/100 volume of 100HM solution and 1/20 volume of defibrinated sheep blood, and pour into petri dishes. Store at 4  C. 5. BHI + HM broth: BHI broth supplemented with 5 mg/L hemin, 1 mg/L menadione. After dissolving BHI broth and autoclaving, add 1/100 volume of 100HM solution. Store at 4  C. 6. Anaerobic chamber: Incubator filled with 80% N2, 10% H2, and 10% CO2 gas at 37  C (see Note 1).

2.2

MV Preparation

1. Centrifuge. 2. Centrifuge tubes. 3. PVDF membrane filters with pore sizes of 0.45 and 0.22 μm.

Intranasal Vaccine Study Using Porphyromonas gingivalis Membrane. . .

159

4. Aspirator. 5. Ultracentrifuge. 6. Ultracentrifuge rotor: Fixed-angle ultracentrifugation rotor that can accommodate six bottles at maximum. 7. Ultracentrifuge bottles: Polycarbonate bottles with each 70-mL capacity. 8. Aluminum caps for the ultracentrifuge bottles. 9. 20 mM Tris–HCl buffer (pH 8.0): Autoclave 1 M Tris–HCl buffer (pH 8.0), and dilute 1/50 with distilled water. Filter with a 0.22-μm PVDF membrane filter (see Note 2). 10. Phosphate-buffered saline (PBS): Dissolve 8 g of NaCl, 200 mg of KCl, 1.44 g of Na2HPO4 and 240 mg of KH2PO4 in 800 mL of distilled water in a suitable container. Confirm pH to be at 7.4 (adjust pH if necessary). Make up to 1 L with distilled water. Filter with a 0.22-μm PVDF membrane filter (see Note 2). 2.3 Purification of MVs by Density Gradient Centrifugation (See Note 3)

1. Iodixanol stock solution: Purchase or prepare 60% (w/v) iodixanol solution dissolved with double distilled water. 2. Iodixanol standard solution: Dilute iodixanol stock solution to different concentrations; 16, 20, 24, 28, 32, 36, and 40% (w/v). Use the solvent in which MV is dissolved (20 mM Tris–HCl, pH 8.0, and PBS, pH 7.4). 3. Ultracentrifuge. 4. Ultracentrifuge rotor. 5. 13.2-mL ultraclear centrifuge tubes. 6. 12.5% (w/v) polyacrylamide gel for sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE). 7. SDS-PAGE equipment. 8. Reagents for silver staining.

2.4 Quantification of Lipids Contained in MVs (See Note 4)

1. Linoleic acid solution: Dissolve linoleic acid (water-soluble) in distilled water to obtain 1 mg/mL solution. Dispense into microtubes and store at 20  C. Just before use, serially dilute 1 mg/mL linoleic acid stock solution with distilled water to make a series of linoleic acid standard solutions (0.5–500 μg/mL). 2. FM4-64 dye solution: Dissolve FM4-64 dye (N-(3-triethylammoniumpropyl)-4-(6-(4-(diethylamino) phenyl) hexatrienyl) pyridinium dibromide) in distilled water to prepare a 0.5 mg/mL solution. Dispense into microtubes and store at 20  C protected from light. Just before use, dilute 0.5 mg/ mL FM4-64 dye solution to 1/100 with distilled water (5 μg/ mL at final concentration).

160

Satoru Hirayama and Ryoma Nakao

3. 96-well black microtiter plate. 4. Fluorescence microplate reader. 2.5 Intranasal Immunization of MVs to Mice

1. 5-week-old female BALB/c mice: Purchase at least 1 week before starting experiments. 2. Cages for breeding animals. 3. Feed and water for mice. 4. 10 mg/mL polyinosinic-polycytidylic acid [poly(I:C)]: Dissolve poly(I:C) sodium salt in endotoxin-free water to obtain 10 mg/mL solution. Dispense into microtubes and store at 20  C (see Note 5). 5. Isoflurane. 6. Inhalation anesthesia device (see Note 6). 7. PBS (see item 10 in Subheading 2.2). 8. Parasympathetic stimulant solution: Mix 0.8 mg/mL isoproterenol in PBS and 0.2 mg/mL pilocarpine in PBS in equal volumes, and filter the solution through a 0.22-μm filter (see Note 7). 9. 1-mL syringe. 10. 26 G needle. 11. 21 G nonbeveled needle (see Note 8). 12. Scissors and tweezers. 13. PBS containing 0.1% bovine serum albumin (BSA): Dissolve BSA at 0.1% concentration (w/v) in PBS. 14. 1.5-mL tube.

3

Methods Carry out all procedures at room temperature, unless specified otherwise.

3.1 MV Preparation and Quantification 3.1.1 MV Preparation

1. Take a cryopreservation of P. gingivalis and streak on a BHI + HM blood agar plate. Incubate in the anaerobic chamber at 37  C for 4–5 days. 2. Pick up a small amount of bacteria from colonies on the agar plate and suspend in 12–15 mL of BHI + HM broth (see Note 9). Incubate in an anaerobic chamber at 37  C for 2 days. 3. Inoculate 1/40 volume of P. gingivalis culture into 450–500 mL of BHI + HM broth. Incubate in the anaerobic chamber at 37  C for 2 days (see Note 9). 4. Centrifuge 450 mL of the bacterial culture at 7,190  g for 30 min at 4  C to obtain the culture supernatant (see Note 10).

Intranasal Vaccine Study Using Porphyromonas gingivalis Membrane. . .

161

5. Filter the culture supernatant with a 0.45-μm filter and then with a 0.22-μm filter using an aspirator to completely remove the remaining bacterial cells (see Note 11). 6. Ultracentrifuge the 420-mL culture supernatant at 103,800  g for 2 h at 4  C to obtain an MV pellet (seeNote 12). 7. Suspend the MV pellet in 20 mM Tris-HCl (pH 8.0) or PBS (see Notes 13–16). 8. Mix iodixanol stock solution and MV suspension to obtain 400 μL of 45% iodixanol solution containing MVs. 9. Pipette 400 μL of 45% iodixanol solution containing MVs into the bottom of 13.2-mL ultraclear centrifuge tube. 10. Carefully layer 1.5 mL of serially diluted iodixanol solutions in the order of concentration from highest (40%) to lowest (16%) (Fig. 1). 11. Ultracentrifuge the tube at 151,000  g for 16 h at 4  C. 12. Carefully collect a 1-mL fraction from the surface of the solution. This process can be repeated for each successive fraction. 13. Subject an aliquot of each fraction to SDS-PAGE and visualize the proteins using silver staining (see Notes 17 and 18) (Fig. 2). 14. Pick up the fractions containing the MVs.

16% 1.5 mL 20% 1.5 mL 24% 1.5 mL 28% 1.5 mL 32% 1.5 mL 36% 1.5 mL 40% 1.5 mL 45% 0.4 mL (including MVs)

Fig. 1 The schematic diagram of the ultracentrifuge tube before density gradient centrifugation. Pipette the MV preparation containing 45% iodixanol into the bottom of the tube, then layer down with decreasing iodixanol density

162

Satoru Hirayama and Ryoma Nakao

Fraction number

Top

1

2

3

4

5

6

7

Bottom

8

9

10

11

㸨

Fraction 5

Purified MV fraction

Fig. 2 (Left) After fractionating the MVs of P. gingivalis ATCC 33277 strain using iodixanol, each fraction was subjected to 12.5% SDS-PAGE and silver-stained. Fractions 4–6 contain the purified MVs. An asterisk indicates MVs before subjecting to density gradient centrifugation. (Right) MVs contained in fraction 5 observed by negative staining with a transmission electron microscope. The scale bar indicates 200 nm

15. The fractions are diluted with the solvent that was used to dissolve MVs at step 7 (20 mM Tris–HCl or PBS) (see Note 19). 16. Ultracentrifuge the diluted samples at 151,000  g for 2–3 h at 4  C. 17. Resuspend the MV pellet with the solvent that was used to dissolve MVs at step 7 (see Note 19). 3.1.2 Quantification of Lipids Contained in MVs

1. Set a series of linoleic acid standard solutions (e.g., 0.5–500 μg/mL). 2. Serially dilute MV samples by two- to tenfold in distilled water. 3. Add 100 μL of 5 μg/mL FM4-64 dye to the standards and samples (5 μL each) in the 96-well black plate (see Note 20). 4. Incubate the plate protected from light for 10 min at room temperature. 5. Detect fluorescence from FM4-64 dye (excitation at 535 nm and emission at 625 nm) with a fluorescence plate reader (see Note 21). 6. Estimate the amount of lipid contained in the MV sample from the calibration curve created by the standard.

Intranasal Vaccine Study Using Porphyromonas gingivalis Membrane. . .

163

Intranasal Immunization 6-week-old female mice (BALB/c)

1st

2nd

0

3

5

(weeks)

Saliva Sera Nasal wash

Fig. 3 Immunization timeline. Immunize mice first at 6 weeks of age and again 2 weeks later. Collect various samples (saliva, sera, and nasal wash) 2 weeks after the last immunization. 3.2 Intranasal Immunization of MVs to Mice 3.2.1 Immunization

Figure 3 shows the immunization schedule. 1. Keep 5-week-old female BALB/c mice for 1 week to acclimate to the environment. 2. Adjust MV and MV + poly(I:C) suspension to desired concentration with PBS (see Note 22). 3. Anesthetize mice with isoflurane by inhalation (see Note 23). 4. At day 0 (6-week-old), inoculate both nostrils with 5 μL each (total 10 μL) of PBS (mock, negative control) or MV, or MV + poly(I:C) suspension using pipette (see Note 24). 5. At 21 days after first immunization (at 9 weeks old), nasal immunization is performed again as in step 4 in this section (see Note 25). 6. At 14 days after the second immunization (at 11 weeks old), collect specimens such as saliva, sera, and nasal washes.

3.2.2 Collection of Mouse Specimens and Antibody Detection

1. Saliva: Inject 200 μL of the parasympathetic stimulant solution into the abdominal cavity. When saliva secretion is induced, collect saliva from the mouth with a pipette. Store at 80  C (seeNote 26). 2. Serum: Collect whole blood samples from anesthetized mice by cardiac puncture through the diaphragm with 1-mL syringe and 26 G needle (seeNotes 27 and 28). Centrifuge blood samples at 300  g for 10 min to precipitate blood cells, collect the supernatant. Store at 20  C. 3. Nasal wash: Remove the head of the deceased mouse after exsanguination, and dissect out the lower jaw. Insert a syringe needle (21 G nonbeveled) into the nasal cavity from the posterior opening, and flush with 1 mL of PBS containing 0.1% BSA. Collect the outflow from the nostrils in 1.5-mL tube. Repeat the flushing step three times (seeNote 29). 4. Proceed to techniques such as enzyme-linked immunosorbent assay (ELISA) to confirm antibody production against the antigen.

164

4

Satoru Hirayama and Ryoma Nakao

Notes 1. Anaerobic jar and gas pack system for anaerobiosis can be used instead. 2. Filtration is recommended to remove contaminants in the buffers. 3. The MV preparations following simply ultracentrifuging the culture supernatant usually contain various impurities such as pili. Further purification by density gradient centrifugation can be a powerful option to improve the purity of MV preparations. 4. The Bradford method [11] and/or the BCA method [12] have also been widely used for protein quantification of MVs. An alternative method for quantifying MVs is to quantify the total lipid amounts of the MVs using the amphiphilic styryl dye FM4-64. The principle of the assay is based on the property of FM4-64, which primarily stains the lipid bilayer of MVs. 5. Prior to intranasally administrating poly(I:C) to mice, poly(I: C) must be denatured at 65  C for 10 min, then slowly chilled at room temperature. The proper annealing step will ensure formation of double-stranded RNA. 6. An anesthesia bottle can be used instead. 7. Prepare and mix the solutions of isoproterenol and pilocarpine just prior to intraperitoneally administrating the mixture to mice. 8. It is also possible to cut the tip of the 21 G beveled needle to make it nonbeveled. 9. It is not enough to pick a single colony of bacteria. Approximately one platinum loop is required. Preliminary experiments should be performed to optimize the culture conditions, as MV production level is depend on the strains used for testing. In P. gingivalis, 2 days of culture at 37  C usually results in the production of MVs at maximum yield. 10. Collect the culture supernatant quickly because the pellet of P. gingivalis cells is easily disintegrated. 11. The proper size or material of the filtration membranes to be used depends on the bacterial species or strain that is used in assay. Suitable filtration conditions must be established in preliminary experiments. 12. Usually, brownish pellets are clearly formed. 13. As a solvent for suspending the MV pellets, distilled water, PBS, or another buffer can be used depending on the purpose of the individual study.

Intranasal Vaccine Study Using Porphyromonas gingivalis Membrane. . .

165

14. Usually, 100–200 μL of buffer is enough to dissolve the MV pellet when a 70-mL culture supernatant is ultracentrifuged. 15. As much as possible, be careful not to create a foam when suspending the MV. Due to the lipophilic characteristics of MVs, it is very easy to generate bubbles. 16. Perform further purification, if purer MVs are needed, such as washing or density gradient centrifugation. 17. Coomassie brilliant blue staining can be performed instead, but silver staining is recommended because of its high sensitivity. Scanning or transmission electron microscopy analysis is a reliable way to confirm both the purity and structural integrity of MVs. 18. Most of pili can be removed from the crude MV preparations by density gradient centrifugation (Fig. 2). 19. To precipitate MVs as a pellet after ultracentrifugation, the collected fractions should be sufficiently diluted with as much the used solvent as possible. 20. We recommend measuring standards and samples in duplicate or triplicate. 21. FM4-64 dye has a maximum excitation of 515 nm and a maximum emission of 640 nm. 22. In the case of P. gingivalis MVs, the MVs alone are not sufficient for immunity induction; it is necessary to use poly(I:C) as a mucosal adjuvant. One microgram of MV (as protein amount) and 10 μg of poly(I:C) per mouse are sufficient. Mucosal adjuvants may not be needed depending on the strain used to prepare the MVs. 23. For isoflurane, a concentration of 2% and a flow rate of 2 L/ min are sufficient. The use of isoflurane is preferable to that of sevoflurane for inhalation anesthesia of mice to reduce the risk of accidental death. Note that induction of and recovery from inhalation anesthesia is much quicker with sevoflurane than isoflurane. 24. Insufficient anesthesia may cause sneezing in mice. It is safer to wait ca. 1 min after inoculating one nasal cavity before inoculating the other so that the first inoculation does not block the airway. The mouse is less likely to sneeze. 25. An additional booster after the second vaccination may further enhance humoral immune responses. 26. Storage at 80  C is recommended to easily handle saliva samples, as it reduces the viscosity of saliva.

166

Satoru Hirayama and Ryoma Nakao

27. Slowly drain the blood to prevent heart collapse. 28. Approximately 1 mL can be collected. 29. Centrifuging the nasal wash is recommended to remove cell debris.

Acknowledgments We would like to thank Michiyo Kataoka and Naomi Nojiri for their technical assistance. This study was supported by JSPS KAKENHI (JP16K11537, JP18K15160, JP19H02920, JP19K22644, JP20K09943,and JP20H03861). References 1. Schooling SR, Beveridge TJ (2006) Membrane vesicles: an overlooked component of the matrices of biofilms. J Bacteriol 188 (16):5945–5957. https://doi.org/10.1128/ JB.00257-06 2. Orench-Rivera N, Kuehn MJ (2016) Environmentally controlled bacterial vesicle-mediated export. Cell Microbiol 18(11):1525–1536. https://doi.org/10.1111/cmi.12676 3. Kaparakis-Liaskos M, Ferrero RL (2015) Immune modulation by bacterial outer membrane vesicles. Nat Rev Immunol 15 (6):375–387. https://doi.org/10.1038/ nri3837 4. Schwechheimer C, Kuehn MJ (2015) Outermembrane vesicles from Gram-negative bacteria: biogenesis and functions. Nat Rev Microbiol 13(10):605–619. https://doi.org/10. 1038/nrmicro3525 5. Toyofuku M, Nomura N, Eberl L (2019) Types and origins of bacterial membrane vesicles. Nat Rev Microbiol 17(1):13–24. https:// doi.org/10.1038/s41579-018-0112-2 6. Lamont RJ, Hajishengallis G, Koo H et al (2019) Oral microbiology and immunology. ASM Press, Washington, DC 7. Hajishengallis G (2015) Periodontitis: from microbial immune subversion to systemic inflammation. Nat Rev Immunol 15 (1):30–44. https://doi.org/10.1038/nri3785

8. Veith PD, Chen YY, Gorasia DG et al (2014) Porphyromonas gingivalis outer membrane vesicles exclusively contain outer membrane and periplasmic proteins and carry a cargo enriched with virulence factors. J Proteome Res 13(5):2420–2432. https://doi.org/10. 1021/pr401227e 9. Bai D, Nakao R, Ito A et al (2015) Immunoreactive antigens recognized in serum samples from mice intranasally immunized with Porphyromonas gingivalis outer membrane vesicles. Pathog Dis 73(3):ftu006. https://doi. org/10.1093/femspd/ftu006 10. Nakao R, Hasegawa H, Dongying B et al (2016) Assessment of outer membrane vesicles of periodontopathic bacterium Porphyromonas gingivalis as possible mucosal immunogen. Vaccine 34(38):4626–4634. https://doi.org/ 10.1016/j.vaccine.2016.06.016 11. Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254. https://doi.org/10.1006/abio. 1976.9999 12. Smith PK, Krohn RI, Hermanson GT et al (1985) Measurement of protein using bicinchoninic acid. Anal Biochem 150(1):76–85. https://doi.org/10.1016/0003-2697(85) 90442-7

Chapter 16 Analysis of the Butyrate-Producing Pathway in Porphyromonas gingivalis Yasuo Yoshida Abstract Butyrate is one of the most harmful metabolic end products found in the oral cavity. Thus, it would be important to characterize the enzymes responsible for production of this metabolite to elucidate the pathogenicity of periodontogenic bacteria. Here, a spectrophotometric assay for butyryl-CoA:acetate CoA transferase activity and gas chromatography–mass spectrometry measurement of butyrate and other short chain fatty acids such as acetate, propionate, isobutyrate, and isovalerate are described. Key words Short chain fatty acid, Butyrate, Porphyromonas gingivalis, Periodontopathogenic bacteria, GC-MS

1

Introduction Porphyromonas gingivalis possesses and produces a variety of virulence factors, including fimbriae, proteases, hemagglutinins, lipopolysaccharides, capsule polysaccharides, major outer membrane proteins, and cytotoxic metabolic end products [1, 2]. One of the most harmful metabolic end products found in the oral cavity is butyrate [3], which induces apoptosis in gingival fibroblasts and immune cells such as T- and B-cells [4–6], and increases production of reactive oxygen species, affecting cell cycle progression, in human gingival fibroblasts [7]. Interestingly, the concentration of butyrate in the periodontal pockets positively correlates with clinical measures of inflammation and disease severity [3, 8]. The metabolic pathway for butyrate production, which occurs in a limited number of bacterial species in the oral cavity, including Porphyromonas gingivalis, Fusobacterium nucleatum, and Tannerella forsythia, has recently been reported [9–12]. In P. gingivalis, three butyryl-CoA:acetate CoA transferases (PGN_0725, PGN_1341, and PGN_1888) transfer the CoA moiety from butyryl-CoA to an exogenous acetate molecule, forming acetylCoA and butyrate in the last step of butyrate production [11].

Keiji Nagano and Yoshiaki Hasegawa (eds.), Periodontal Pathogens: Methods and Protocols, Methods in Molecular Biology, vol. 2210, https://doi.org/10.1007/978-1-0716-0939-2_16, © Springer Science+Business Media, LLC, part of Springer Nature 2021

167

168

Yasuo Yoshida

In this chapter, two approaches for analyzing the enzymatic activity of butyryl-CoA:acetate CoA transferase are discussed, including a colorimetric assay and a gas chromatography–mass spectrometry (GC-MS) assay, the latter of which can be used for analysis of multiple short chain fatty acids (SCFAs) in saliva, including acetate, butyrate, propionate, isobutyrate, and isovalerate.

2

Materials Prepare all solutions using ultrapure water and analytical grade reagents. When used for GC-MS analysis, use MS grade waters and reagents. Prepare and store all reagents at room temperature, unless otherwise indicated. Diligently follow all waste disposal regulations when disposing of waste materials.

2.1 Colorimetric Assay for Butyryl-CoA: Acetate CoA Transferase Activity

1. Reaction mixture: 40 mM potassium phosphate buffer (pH 8.0), 20–250 mM sodium acetate, and 0.5–5 mM butyryl-CoA or propionyl-CoA. 2. Block incubator. 3. 100 μg/mL crude enzyme extracts: Lyse P. gingivalis cells in 40 mM potassium phosphate buffer (pH 8.0) by ultrasonication in the presence of the following protease inhibitors, 0.1 mM Nα-tosyl-L-lysine chloromethyl ketone, 0.2 mM phenylmethylsulfonyl fluoride, and 0.1 mM leupeptin. Protein concentrations are determined using a Pierce BCA Protein Assay Kit. 4. Purified enzyme (500 ng/mL PGN_0725, 50 μg/mL PGN_1341, or 500 ng/mL PGN_1888). The recombinant proteins are obtained using the expression vector pGEX-6P1, as described previously [9]. The coding sequences are PCR-amplified from the genomic DNA of P. gingivalis (ATCC 33277). Protein concentrations are determined as described previously [13], and protein purity is assessed by SDS-PAGE. 5. Trichloroacetic acid: 4.5% (W/V) solution in water. 6. 400 mM potassium phosphate buffer (pH 8.0). The solution pH is adjusted by mixing 400 mM KH2PO4 and 400 mM K2HPO4. 7. Assay mixture: 4 mM oxaloacetate, 4 mM 5,50 -dithiobis-2nitrobenzoic acid, and 36.8 μg/mL citrate synthase. 8. Spectrophotometer. 9. Crystal cuvette. 10. Acetyl-CoA.

Analysis of the Butyrate-Producing Pathway in Porphyromonas gingivalis

2.2 GC-MS Assay for Detection of SCFAs

169

1. Brucella HK agar supplemented with 5% rabbit blood. 2. Modified GAM broth. 3. Anaerobic chamber (80% N2, 10% H2, 10% CO2). 4. Spectrophotometer. 5. Crystal cuvette. 6. Tabletop microcentrifuge. 7. Acetone. 8. Gas chromatograph–mass spectrometer (TQ8040 GC-MS, Shimadzu). 9. InertCap Pure-WAX + T.L. column (length 32 m; diameter 0.25 mm; film thickness 0.25 μm).

3

Methods

3.1 Colorimetric Assay for Butyryl-CoA: Acetate CoA Transferase

The enzymatic activity of butyryl-CoA:acetate CoA transferases in P. gingivalis is determined by measuring the amount of acetyl-CoA, which is produced as a by-product of the reaction. Next, CoA-SH and citrate are produced from acetyl-CoA and oxaloacetate by citrate synthase. CoA-SH reacts with 5,50 -dithiobis-2-nitrobenzoic acid, and can be detected spectrophotometrically. 1. Prewarm a 1.5 mL tube containing 40 μL of reaction mixture (see Note 1) at 37  C for approximately 5 min in a block incubator (see Note 2). 2. After prewarming, add 10 μL of enzyme (crude enzyme extracts, PGN_0725, PGN_1341, or PGN_1888) (see Note 3) to initiate the reactions, and then incubate at 37  C for precisely 5 min. 3. Terminate the reaction trichloroacetic acid.

by

adding

10

μL

of

4.5%

4. Add 25 μL of 400 mM potassium phosphate buffer (pH 8.0) to neutralize the solution. 5. To quantify acetyl-CoA, add 25 μL of assay mixture to the reaction mixture. 6. Incubate the reaction mixture at 37  C for 30 min, and then spectrophotometrically measure the samples at 412 nm. 7. Calculate sample acetyl-CoA concentrations using a standard curve that has been generated in advance. 8. Compute the parameters from the Lineweaver–Burk transformation (V1 versus S1) of the Michaelis–Menten equation. Calculate kcat values from Vmax and protein molecular weights. 9. In addition to the general reaction conditions described above, use varying concentrations of sodium acetate (20–250 mM) and butyryl-CoA (0.5–5.0 mM) to determine the kinetic parameters of each recombinant protein (see Note 4).

170

Yasuo Yoshida

Fig. 1 GC-MS chromatograph of the supernatant from P. gingivalis ATCC33277. Data were obtained using the total ion chromatograph mode 3.2

GC-MS Analysis

The GS-MS analysis used to quantify SCFAs in bacterial culture, including acetate, butyrate, propionate, isobutyrate, and isovalerate is illustrated in Fig. 1 and described below. Instead of laboratory samples, clinical samples, such as human saliva can be also used as specimens. 1. Inoculate a colony of P. gingivalis ATCC 33277 (or its derivative strains) on Brucella HK agar supplemented with 5% rabbit blood into 2 mL of Modified GAM broth, and culture the bacteria anaerobically for 24 h. 2. Add 8 mL of fresh Modified GAM broth, which has been anaerobically prewarmed, to the bacterial culture, and incubate the culture anaerobically for 24 h. 3. Dilute a portion of the bacterial culture with fresh Modified GAM broth and culture to an OD600 of 0.375  0.025, corresponding to approximately 1.5  105 CFU/μL, to normalize the concentration of cultured cells (see Note 5).

Analysis of the Butyrate-Producing Pathway in Porphyromonas gingivalis

171

4. Remove cells from bacterial cultures by centrifugation at approximately 20,000  g for 10 min. 5. Add 500 μL of acetone to 100 μL of the supernatant, incubate samples at 20  C for 2 h, and subsequently centrifuge the mixture at approximately 20,000  g for 10 min to remove proteins (see Notes 6 and 7). 6. Inject 1.0 μL of sample in splitless mode into a GC-MS instrument equipped with an InertCap Pure-WAX + T.L. column. 7. Use helium as the carrier gas, with a linear velocity of 50 cm/ s (see Note 8). 8. Set the injection port temperature to 200  C. 9. Hold the oven temperature at 40  C for 5 min, and then increase the temperature to 240  C at a rate of 10  C/min, and maintain the temperature at 240  C for 5 min. 10. For MS, the ionization source temperature is 200  C. 11. Characterize the components in full-scan mode, and identify them by comparing the mass fragmentation patterns with those of the corresponding reference substances. 12. Obtain ion-monitoring data to quantify the concentrations of SCFAs. 13. Analyze samples at least in triplicate.

4

Notes 1. Propionyl-CoA can be used for the propionyl-CoA:acetate CoA transferase assay. 2. The temperature control accuracy at 37  C should ideally be less than 0.5  C. 3. Determine the optimal enzyme concentration to maintain the initial velocity at 5 min. 4. The double-reciprocal plots to determine whether the reaction catalyzed by the enzyme follows a ternary complex mechanism or a biphasic mechanism. 5. As long as the OD600 value is almost the same between samples, it is not necessary to set the value at 0.375  0.025. The value of the stationary phase depends on the gene inactivated in P. gingivalis. The ordinary value of the wild-type strain incubated overnight is more than 1.0. 6. Removal of unevaporated materials is one of the most important steps for preparation of GC-MS specimens. 7. When clinical samples such as saliva are used, start from this step. 8. The concentration of helium should be greater than 99.995%.

172

Yasuo Yoshida

Acknowledgments This study was supported in part by JSPS KAKENHI Grant Number JP17K11634 from the Ministry of Education, Culture, Sports, Science and Technology of Japan. References 1. Holt SC, Kesavalu L, Walker S et al (1999) Virulence factors of Porphyromonas gingivalis. Periodontol 2000 20:168–238 2. Lamont RJ, Koo H, Hajishengallis G (2018) The oral microbiota: dynamic communities and host interactions. Nat Rev Microbiol 16:745–759 3. Niederman R, Zhang J, Kashket S (1997) Short-chain carboxylic-acid-stimulated, PMN-mediated gingival inflammation. Crit Rev Oral Biol Med 8:269–290 4. Kurita-Ochiai T, Fukushima K, Ochiai K (1995) Volatile fatty acids, metabolic by-products of periodontopathic bacteria, inhibit lymphocyte proliferation and cytokine production. J Dent Res 74:1367–1373 5. Kurita-Ochiai T, Ochiai K, Fukushima K (2000) Butyric-acid-induced apoptosis in murine thymocytes and splenic T- and B-cells occurs in the absence of p53. J Dent Res 79:1948–1954 6. Kurita-Ochiai T, Seto S, Suzuki N et al (2008) Butyric acid induces apoptosis in inflamed fibroblasts. J Dent Res 87:51–55 7. Chang MC, Tsai YL, Chen YW et al (2013) Butyrate induces reactive oxygen species production and affects cell cycle progression in human gingival fibroblasts. J Periodontal Res 48:66–73

8. Qiqiang L, Huanxin M, Xuejun G (2012) Longitudinal study of volatile fatty acids in the gingival crevicular fluid of patients with periodontitis before and after nonsurgical therapy. J Periodontal Res 47:740–749 9. Yoshida Y, Sato M, Nagano K et al (2015) Production of 4-hydroxybutyrate from succinate semialdehyde in butyrate biosynthesis in Porphyromonas gingivalis. Biochim Biophys Acta 1850:2582–2591 10. Yoshida Y, Sato M, Kezuka Y et al (2016) AcylCoA reductase PGN_0723 utilizes succinylCoA to generate succinate semialdehyde in a butyrate-producing pathway of Porphyromonas gingivalis. Arch Biochem Biophys 596:138–148 11. Sato M, Yoshida Y, Nagano K et al (2016) Three CoA transferases involved in the production of short chain fatty acids in Porphyromonas gingivalis. Front Microbiol 7:1146 12. Yoshida Y, Sato M, Nonaka T et al (2019) Characterization of the phosphotransacetylase-acetate kinase pathway for ATP production in Porphyromonas gingivalis. J Oral Microbiol 11:1588086 13. Pace CN, Vajdos F, Fee L et al (1995) How to measure and predict the molar absorption coefficient of a protein. Protein Sci 4:2411–2423

Chapter 17 Characterization of the Treponema denticola Virulence Factor Dentilisin Yuichiro Kikuchi and Kazuyuki Ishihara Abstract Treponema denticola is a potent periodontal pathogen that forms a red complex with Porphyromonas gingivalis and Tannerella forsythia. It has many virulence factors, yet there are only a few reports detailing these factors. Among them, dentilisin is a well-documented surface protease. Dentilisin is reported to be involved in nutrient uptake, bacterial coaggregation, complement activation, evasion of the host immune system, inhibition of the hemostasis system, and cell invasion as a result of its action, in addition to its original proteolysis function. Therefore, characterization of dentilisin, and clarifying the relationship between T. denticola and the onset of periodontal disease will be important to better understanding this disease. In this chapter, we explain the methods for analysis of dentilisin activity and pathogenicity. Key words Treponema denticola, Dentilisin, Prolyl-phenylalanine-specific protease, prtP

1

Introduction Treponema denticola is a gram-negative, motile, anaerobic spirochete frequently isolated, together with Porphyromonas gingivalis and Tannerella forsythia, from human chronic periodontal lesions [1, 2]. This microorganism expresses numerous virulence factors, such an outer membrane-associated prolyl-phenylalanine-specific protease (dentilisin; also called chymotrypsin-like protease) [3, 4], cysteine proteases (IdeS) [5], major surface protein (Msp) [6], adherence to fibronectin and plasminogen (OppA) [7], and adherence to FH and FHL-1 (FhbB) [8, 9]. Dentilisin in particular has been reported to be involved in the degradation of host proteins [3, 4, 10, 11] and coaggregation with other bacteria [12, 13], which is a very important factor in elucidating the pathogenicity of T. denticola. Dentilisin is a proryl-phenylalanine-specific protease located on the surface of T. denticola and coded by three genes (prcB, prcA, and prtP). After transcription, PrcA is cleaved into a 38 kDa protein and a 43 kDa protein and organized into a complex with PrtP

Keiji Nagano and Yoshiaki Hasegawa (eds.), Periodontal Pathogens: Methods and Protocols, Methods in Molecular Biology, vol. 2210, https://doi.org/10.1007/978-1-0716-0939-2_17, © Springer Science+Business Media, LLC, part of Springer Nature 2021

173

174

Yuichiro Kikuchi and Kazuyuki Ishihara

[3, 14, 15]. PrcB plays an important role in complex formation and expression of dentilisin activity [16]. Dentilisin activity is required for the expression of major surface protein, Msp, of T. denticola, which is an adherence factor of this microorganism [14, 17]. Dentilisin degrades host proteins, such as transferrin, gelatin, laminin, fibrinogen, fibronectin, IgG, IgA, alpha1-antitrypsin, type IV collagen, and human complement 3 [3, 4, 11], and is also involved in adherence of the microorganism via coaggregation to T. forsythia and P. gingivalis, as well as adherence to fibrinogen [12, 13, 18]. Dentilisin is also involved in the migration of epithelial cells and invasion of epithelial cells by T. denticola [19]. Abscess forming activity in mice by this microorganism attenuated by inactivation of prtP [17]. These phenomena demonstrate the virulence of dentilisin at the periodontal lesion. This chapter describes the protocols used for the purification, inactivation, and characterization of virulence of dentilisin.

2

Materials

2.1 Purification of Dentilisin

1. T. denticola ATCC 35405 (seeNote 1). 2. Tryptone–yeast extract–gelatin–volatile fatty acids–serum (TYGVS) medium [20]: three solutions are separately prepared. To prepare the first solution (Solution A), dissolve 5 g of heart infusion broth, 10 g of tryptone, 10 g of yeast extract, 10 g of gelatin, 2 g of K2HPO4, 1 g of NaCl, 0.1 g of MgSO4, and 0.5 g of (NH4)2SO4 in 800 mL of deionized water. Sterilize at 121
C for 20 min and store at 4
C. Volatile fatty acid (VFA) solution: Dissolve 1.7 mL of acetic acid, 0.6 mL of propionic acid, 0.4 mL of n-butyric acid, 0.1 mL of n-valeric acid, 0.1 mL of isobutyric acid, 0.1 mL of isovaleric acid, 0.1 mL of DL-methylbutyric acid in 27.9 mL of deionized water. Cocarboxylase solution: Dissolve 0.25 g of cocarboxylase in 100 mL of deionized water. To prepare the second solution (Solution B), dissolve 1 g of L-cysteine hydrochloride, 1 g of glucose, 0.25 g of sodium pyruvate, 5 mL of VFA solution, 5 mL of cocarboxylase solution in 90 mL of deionized water. Mix and adjust pH 7.2–7.4 with KOH and sterilized by filtration. To prepare the third solution (Rabbit serum), inactivate rabbit serum at 56
C for 30 min. Mix the 800 mL of solution A, 100 mL of solution B and 100 mL of inactivated rabbit serum. Store at 4
C. 3. Anaerobic glove box (10% CO2, 10% H2, and 80% N2). 4. Column equilibration buffer: 20 mM Tris–HCl, pH 8.0 containing 1% zwitterionic detergent 3-[(3-cholamidopropyl)-

Characterization of the Treponema denticola Virulence Factor Dentilisin

175

dimethyl-ammonio]-1-propane sulfonate (CHAPS). Weigh 2.42 g of Tris and 10 g of CHAPS and transfer to the cylinder. Add deionized water to a volume of 900 mL. Mix and adjusted pH with HCl. Make up to 1 L with deionized water. Store at 4
C. 5. Sonicator. 6. Ultracentrifuge. 7. Q-Sepharose fast-flow column (2.6 cm diameter, 10 cm high). 8. Sodium chloride: 110, 200 and 300 mM solution in water. 9. Dilution buffer: Distilled water containing 1% CHAPS. 10. Centriprep Centrifugal Filter Unit: 15 mL, 50,000-molecularweight-cutoff membrane. 11. Rotofor cell running buffer: 1 mM Tris–HCl buffer (pH 8.0) containing 10 mM NaCl, 1% (wt/vol) CHAPS, 2% (wt/vol) ampholytes (pH 5–7). 12. Rotofor isoelectric focusing cell: The electrolytes in the anode and cathode chambers are 100 mM H3PO4 and 100 mM NaOH, respectively. 13. G3000SWXL gel filtration column equilibration buffer: Phosphate buffered saline (PBS), pH 7.2, 1% CHAPS. Weigh 8 g NaCl, 0.2 g KCl, 1.44 g Na2HPO4, and 0.24 g KH2PO4 and transfer to a 900 mL water. Mix and adjust pH with HCl. Add 10 mL CHAPS and make up to 1 L with water. 14. G3000SWXL gel filtration column (7.5 mm inner diameter, 30 cm high). 15. Dialysate buffer: 10 mM Tris–HCl, pH 8.5, 0.8% n-octyl-β-Dglucopyranoside (octylglucoside). 16. An anion-exchange column (7.5 mm inner diameter, 7.5 cm high). 17. TSKgel DEAE-5PW. 18. Reverse-phase chromatography phenyl-5PW-RP (4.6 mm inner diameter, 7.5 cm high).

column

19. HPLC solvent A: 0.02% trifluoroacetic acid in water. 20. HPLC solvent B: 0.02% trifluoroacetic acid in acetonitrile. 2.2 Measurement of Dentilisin Activity

1. T. denticola ATCC 35405 (seeNote 1). 2. TYGVS medium (seeitem 2 in Subheading 2.1). 3. Anaerobic glove box (10% CO2, 10% H2, and 80% N2). 4. PBS (pH 7.2). 5. Sonicator. 6. DC Protein Assay Kit.

176

Yuichiro Kikuchi and Kazuyuki Ishihara

7. SAAPNA hydrolyzing activity buffer: 100 mM Tris–HCl, pH 8.0, 1.0 mM N-succinyl-L-alanyl–L-alanyl–L-prolyl–L-phenylalanine p-nitroanilide (SAAPNA). 8. Incubator. 9. Acetic acid: 20% solution in water. 10. 96-well transparent microplate. 11. Microplate reader. 2.3 Evaluation of Pathogenicity of T. denticola

1. T. denticola ATCC 35405 (seeNote 1). 2. TYGVS medium (seeitem 2 in Subheading 2.1). 3. Anaerobic glove box (10% CO2, 10% H2, and 80% N2). 4. PBS (pH 7.2). 5. C-chip: Disposable hemocytometer. 6. Dark-field microscope. 7. BALB/c mice (6–8 weeks old, male or female). 8. Caliper gauge.

2.4 Construction of T. denticola Dentilisin Mutant (Electroporation Protocol)

1. T. denticola ATCC 35405 genome. 2. Synthetic oligonucleotide primers: prtP forward primer, 50 -CGGTCTGACAGACGGAAATTATTTGG-30 , prtP reverse primer, 50 -ACGGATCCCCTGTAAACCGTAACTC-30 ) (Fig. 1a). 3. PCR polymerase kit. 4. pCR II vector. 5. Restriction enzyme: EcoRI, BamHI, KpnI, PstI, and BglII. 6. Ligation kit. 7. pMCL191 [17]. 8. ermF-ermAM cassette [21] from plasmid pVA2198. 9. T. denticola ATCC 35405 (seeNote 1). 10. TYGVS medium (seeitem 2 in Subheading 2.1): If necessary, add 40 μg/mL erythromycin at final concentration. 11. Anaerobic glove box (10% CO2, 10% H2, and 80% N2). 12. Ice. 13. Wash buffer: Ice-cold distilled water. 14. Electroporation buffer: Ice-cold 10% glycerol in distilled water. 15. Electroporator. 16. Capillary pipette. 17. Selection agar medium: TYGVS medium, 0.8% agarose, 40 μg/mL erythromycin. Keep melting at 45
C. 18. Plate: 10-cm petri dish plate, sterile.

Characterization of the Treponema denticola Virulence Factor Dentilisin

177

Fig. 1 Diagrams of plasmid constructs for the prtP mutant. (a) Chromosomal structure around prtP. Arrows show the primer oligonucleotides for PCR fragments of prtP. (b) Construction of pDLCK3 and the ermF-ermAM fragment to pKO3

178

Yuichiro Kikuchi and Kazuyuki Ishihara

2.5 Construction of T. denticola Dentilisin Mutant (Heat Shock Protocol)

1. T. denticola ATCC 35405 (seeNote 1). 2. TYGVS medium (seeitem 2 in Subheading 2.1): If necessary, add 40 μg/mL erythromycin at final concentration. 3. Anaerobic globe box (10% CO2, 10% H2, and 80% N2). 4. Ice. 5. Heat shock buffer: Ice-cold water containing 15% glycerol and 50 mM CaCl2. 6. Incubator. 7. Selection SeaPlaque agarose medium: TYGVS medium containing 0.75% SeaPlaque agarose and the appropriate antibiotics for positive selection. 8. Capillary pipette.

2.6 Coaggregation Assay

1. T. denticola ATCC 35405 (seeNote 1). 2. TYGVS medium (seeitem 2 in Subheading 2.1). 3. Anaerobic glove box (10% CO2, 10% H2, and 80% N2). 4. Coaggregation buffer: Various buffers are used for each experiment, so select the solution that is appropriate for your experimental conditions (seeNote 2). 5. Vortex. 6. Spectrophotometer.

2.7 Measurement of the Invasion Potential of T. denticola (Antibiotic Protection Assay)

1. T. denticola ATCC 35405 (seeNote 1). 2. TYGVS medium (seeitem 2 in Subheading 2.1). 3. Anaerobic glove box (10% CO2, 10% H2, and 80% N2). 4. 10 μCi/ml [3H]uridine. 5. Ca9-22 cell (seeNote 3). 6. Antibiotic free medium: Eagle’s minimal essential medium (MEM) supplemented with 0.6 mg/mL glutamine and heatinactivated 10% fetal calf serum. 7. Antibiotic containing medium: MEM supplemented with 0.6 mg/mL glutamine, heat-inactivated 10% fetal calf serum, 300 μg/mL gentamicin, and 200 μg/mL metronidazole. 8. PBS (pH 7.2). 9. Liquid scintillation counter.

3

Methods

3.1 Purification of Dentilisin [3]

1. Grow T. denticola cells anaerobically (10% CO2, 10% H2, and 80% N2) in 4 L of TYGVS medium at 37
C.

Characterization of the Treponema denticola Virulence Factor Dentilisin

179

2. Harvest T. denticola cells by centrifugation at 8000  g for 20 min at 4
C and wash twice with the column equilibration buffer. 3. Disrupt the cells by sonication at 100 W for 5 min on ice. 4. Ultracentrifuge at 105,000  g for 1 h and transfer the upper aqueous phase to a new tube. 5. Equilibrate the Q-Sepharose fast-flow column with the column equilibration buffer. 6. Absorb the aqueous phase containing the dentilisin to the Q-Sepharose fast-flow column and wash with the column equilibration buffer. 7. Elute the column with a linear concentration gradient of NaCl from 0 to 300 mM and dentilisin may elute fractions with approximately 200 mM NaCl. 8. Pool the enzymatically active fractions (see Subheading 3.2) and dilute with the dilution buffer. 9. Concentrate by ultrafiltration at 1500  g for 30 min through Centriprep Centrifugal Filter Unit. 10. Bring the fraction to 50 mL with Rotofor cell running buffer. 11. Apply this sample to Rotofor isoelectric focusing cell. 12. Do the isoelectric focusing in the Rotofor cell at 12 W of constant power at an initial voltage of 500 V at 4
C for 4 h. 13. Continue the focusing until the voltage had been stabilized (1200 V) for 30 min. Dentilisin activity may detected in the fraction at a pH of about 5. 14. Concentrate the active enzyme fractions and apply to a G3000SWXL gel filtration column equilibrated with G3000SWXL gel filtration column equilibration buffer. 15. Wash the column at a rate of 0.8 mL/min and collect the 0.5 mL of fractions. 16. Dialyzed the fraction with dentilisin activity against the dialysate buffer and concentrate it with Centriprep Centrifugal Filter Unit. 17. Apply this fraction to an anion-exchange column containing TSKgel DEAE-5PW equilibrated with the dialysate buffer and then elute it with 110 mM NaCl. 18. Analyze the enzyme preparation from the gel filtration column by HPLC. 19. Use a reverse-phase chromatography phenyl-5PW-RP column with the following HPLC parameters. The flow rate was 1 mL/ min with a linear gradient of 5–80% acetonitrile (HPLC solvent B) over 40 min. 20. Detect the protein absorbance at 220 nm.

180

Yuichiro Kikuchi and Kazuyuki Ishihara

3.2 Measurement of Dentilisin Activity [3]

1. Grow T. denticola cells anaerobically (10% CO2, 10% H2, and 80% N2) in TYGVS medium at 37
C. 2. Harvest T. denticola cells by centrifugation at 8000  g for 10 min at 4
C, wash and suspend in PBS (pH 7.2). 3. Disrupt the cells by sonication at 100 W for 5 min on ice. 4. Centrifuge at 8000  g for 20 min and transfer the upper aqueous phase to a new tube. 5. Analyze the concentration of the protein solution by Lowry assay. 6. Mix the 5 μL of sonicated solution with 150 μL of SAAPNA hydrolyzing activity buffer in a well of a 96-well transparent microplate. 7. Incubate at 37
C for 15 min. 8. Stop the reaction by adding the 50 μL of 20% acetic acid. 9. Measure its absorbance at 405 nm (seeNote 1).

3.3 Evaluation of Pathogenicity of T. denticola [17]

1. Grow T. denticola cells anaerobically (10% CO2, 10% H2, and 80% N2) in TYGVS medium at 37
C for 72 h. 2. Harvest T. denticola cells and suspend in PBS (pH 7.2). 3. Quantitate the cell number of T. denticola with the C-chip using a dark-field microscope. Adjust the bacterial concentration to 1.5  1010 cells/mL. 4. Challenge subcutaneously on the posterior dorsolateral surface of BALB/c mice with 200 μL (3  109 cells) of T. denticola cell suspension. 5. Measure the size of each lesion with a caliper gauge at 3, 6, 9 and 12 days after subcutaneously challenge.

3.4 Construction of T. denticola Dentilisin Mutant (Electroporation Protocol) [22]

1. Amplify the sequence of matureprtP by PCR with synthetic oligonucleotide primers (prtP forward primer, 50 -CGGTCTGACAGACGGAAATTATTTGG-30 ; prtP reverse primer, 50 -ACGGATCCCCTGTAAACCGTAACTC-30 ) (Fig. 1a).

3.4.1 Construction of DNA Construct

2. Insert the amplified fragment into pCR II vector using a ligation kit. 3. Isolate the EcoRI–BamHI fragment containing the prtP from the resulting plasmid, ligate it to pMCL191 [17] and designate the vector pDLCK3. 4. Isolate an ermF–ermAM cassette [21] from plasmid pVA2198 by digesting with KpnI–PstI and insert the cassette inside the prtP sequence in pDLCK3 (Fig. 1b) (seeNote 4). 5. Name the resulting plasmid pKO3 and linearize it by digesting with EcoRI and BglII (Fig. 1b).

Characterization of the Treponema denticola Virulence Factor Dentilisin 3.4.2 Preparation of Competent Cells

181

1. Grow T. denticola cells anaerobically (10% CO2, 10% H2, and 80% N2) in 100 mL of TYGVS medium at 37
C and incubate for 3 days. 2. Place the cells on ice for 15 min, wash it twice with 100 mL of the wash buffer, and centrifuged at 4000  g for 10 min. Resuspend the cells with 50 mL of the wash buffer, and centrifuged at 4000  g for 10 min. 3. Resuspend the cells in 2 mL of ice-cold distilled water containing 10% glycerol. 4. Centrifugate the cells and suspend them in 500 μL of 10% glycerol.

3.4.3 Transformation of T. denticola

1. Mix 80 μL of competent cells (approximately 5  1010 cells) with 10 μg of linearized pKO3. 2. Electroporate the competent cells in a 1.0-mm gap cuvette with the pulse controller set as 1.8 kV, 25 μF and 200 Ω. 3. Mix it with 2 mL of TYGVS medium. 4. Incubate the cells for 24 h under anaerobic conditions. 5. Mix 1 mL of the culture with 35 mL of the selection agar medium at 45
C and pour in a plate. 6. Incubate the plates for 4–8 days under anaerobic conditions. 7. Isolate the individual colonies with a capillary pipette and reinoculate into TYGVS medium containing 40 μg/mL erythromycin.

3.5 Construction of T. denticola Mutant (Heat Shock Protocol) [23] 3.5.1 Preparation of Competent Cells 3.5.2 Transformation of T. denticola

1. Grow T. denticola cells anaerobically (10% CO2, 10% H2, and 80% N2) in 50 mL of TYGVS medium at 37
C. 2. Harvest T. denticola cells (approximately 108 cells/mL) at the late-logarithmic phase by centrifugation at 8000  g for 10 min at 4
C and wash four times with the heat shock buffer. 3. Resuspend the cells in 0.5 mL of the heat shock buffer. 1. Mix the 80 μL of competent cells with 10 μg of either linearized targeting vector (see Subheading 3.4.1). 2. Incubate on ice for 10 min, at 50
C for 1 min, and on ice again for 5 min. 3. Inoculate the cells immediately into 10 mL of TYGVS medium. 4. Incubate the cells for 2 days, and plate on Selection SeaPlaque agarose medium with the appropriate antibiotics for positive selection. 5. Pick up the bacterial colonies on the plates after 5–7 days of incubation.

182

Yuichiro Kikuchi and Kazuyuki Ishihara

3.6 Coaggregation Assay [13]

Coaggregation assay for T. denticola is performed with a variety of oral bacteria such as T. forsythia [13], P. gingivalis [24], and Fusobacterium nucleatum [25]. Use them as a paired bacterium in this assay. 1. Grow T. denticola cells anaerobically (10% CO2, 10% H2, and 80% N2) in TYGVS medium at 37
C and the paired bacteria in appropriate culture conditions. 2. Harvest cells by centrifugation at 8000  g for 10 min at 4
C, wash and suspend in a coaggregation buffer (seeNote 2). 3. Mix equal volumes of T. denticola and its coaggregation partner suspension and vortex them for 10 s. 4. Evaluate the OD660 with the spectrophotometer at room temperature for 60 min. 5. Calculate the coaggregation percentage using the following equation: coaggregation (%) ¼ [(OD660 at 0 min  OD660 at 60 min)/OD660 at 0 min]  100.

3.7 Measurement of the Invasion Potential of T. denticola (Antibiotic Protection Assay) [19]

1. Label the T. denticola following incubation in TYGVS medium containing 10 μCi/mL [3H]uridine for 5 days. 2. Calculate the multiplicity of infection (MOI) based on the number of cells per well at confluence. 3. Add the labeled bacteria (1  107) to the Ca9-22 monolayers (1  105) grown in the MEM without antibiotics and incubate for 2 h under 5% CO2 at 37
C. 4. Wash the monolayers twice with sterile PBS, and add the fresh medium containing 300 μg/mL gentamicin and 200 μg/mL metronidazole for an additional 1 h to kill extracellular treponemes. 5. Wash the adherent cells with PBS and lyse with sterile water. 6. Count the internalized bacteria using a liquid scintillation counter. 7. Calculate the invasion potential of T. denticola to Ca9-22 as follows: Invasion potential ¼ (intracellular T. denticola at indicated time)/(T. denticola immediately after infection)  100.

4

Notes 1. The dentilisin activity of T. denticola ATCC 35405 and 33520 were high, whereas T. denticola ATCC 35404 and 33521 showed very low activity [26]. Nevertheless, the expression of prtP by qRT-PCR showed that the level of ATCC 33521 was very low, whereas the level of other three strains was almost the same.

Characterization of the Treponema denticola Virulence Factor Dentilisin

183

2. Coaggregation buffers used in past papers are as follows: (a) 1 mM sodium phosphate buffer, pH 8.0. (b) PBS, pH 8.0. (c) 10 mM Tris–HCl, pH 8.0. (d) Coaggregation reactions between T. denticola and T. forsythia have been reported in a previous study [13]: 1 mM sodium phosphate buffer (pH 8.0) containing 0.1 mM CaCl2, 0.1 mM MgCl2, and 150 mM NaCl. (e) Coaggregation reactions between T. denticola and P. gingivalis have been reported in a previous study [24]: PBS (pH 8.0) containing 0.02% NaN3. (g) Coaggregation reactions between T. denticola and F. nucleatum have been reported in a previous study [25]: 10 mM Tris–HCl, pH 8.0, 1 mM CaCl2, 1 mM MgCl2, 150 mM NaCl, and 0.02% NaN3. 3. Ca9-22 cells are the cell line of a human squamous cell carcinoma gingival-derived cell line bearing a mutant p53 [27]. 4. Erythromycin resistance methylase genes ermF-ermAM [21] or ermB (ermAM) [23], kanamycin resistance gene aphA2 [28], and gentamicin resistance gene aacC1 [29] have been reported as drug resistance markers used to create T. denticola mutant or complement strains.

Acknowledgments This research has been supported, in part, by JSPS KAKENHI Grant Numbers 15K11023 (to K.I.). References 1. Holt SC, Ebersole JL (2005) Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia: the “red complex”, a prototype polybacterial pathogenic consortium in periodontitis. Periodontol 2000 38:72–122. https://doi.org/10.1111/j.1600-0757.2005. 00113.x 2. Socransky SS, Haffajee AD, Cugini MA et al (1998) Microbial complexes in subgingival plaque. J Clin Periodontol 25:134–144. https://doi.org/10.1111/j.1600-051x.1998. tb02419.x 3. Ishihara K, Miura T, Kuramitsu HK et al (1996) Characterization of the Treponema denticola prtP gene encoding a prolylphenylalanine-specific protease (dentilisin). Infect Immun 64:5178–5186 4. Uitto VJ, Grenier D, Chan EC et al (1988) Isolation of a chymotrypsinlike enzyme from Treponema denticola. Infect Immun 56:2717–2722

5. Ishihara K, Wawrzonek K, Shaw LN et al (2010) Dentipain, a Streptococcus pyogenes IdeS protease homolog, is a novel virulence factor of Treponema denticola. Biol Chem 391:1047–1055. https://doi.org/10.1515/ BC.2010.113 6. Fenno JC, Muller KH, McBride BC (1996) Sequence analysis, expression, and binding activity of recombinant major outer sheath protein (Msp) of Treponema denticola. J Bacteriol 178:2489–2497 7. Fenno JC, Tamura M, Hannam PM et al (2000) Identification of a Treponema denticola OppA homologue that binds host proteins present in the subgingival environment. Infect Immun 68:1884–1892 8. McDowell JV, Frederick J, Miller DP et al (2011) Identification of the primary mechanism of complement evasion by the periodontal pathogen, Treponema denticola. Mol Oral Microbiol 26:140–149. https://doi.org/10. 1111/j.2041-1014.2010.00598.x

184

Yuichiro Kikuchi and Kazuyuki Ishihara

9. McDowell JV, Lankford J, Stamm L et al (2005) Demonstration of factor H-like protein 1 binding to Treponema denticola, a pathogen associated with periodontal disease in humans. Infect Immun 73:7126–7132. https://doi. org/10.1128/IAI.73.11.7126-7132.2005 10. Miyamoto M, Ishihara K, Okuda K (2006) The Treponema denticola surface protease dentilisin degrades interleukin-1 beta (IL-1 beta), IL-6, and tumor necrosis factor alpha. Infect Immun 74:2462–2467. https://doi.org/10.1128/ IAI.74.4.2462-2467.2006 11. Yamazaki T, Miyamoto M, Yamada S et al (2006) Surface protease of Treponema denticola hydrolyzes C3 and influences function of polymorphonuclear leukocytes. Microbes Infect 8:1758–1763. https://doi.org/10. 1016/j.micinf.2006.02.013 12. Hashimoto M, Ogawa S, Asai Y et al (2003) Binding of Porphyromonas gingivalis fimbriae to Treponema denticola dentilisin. FEMS Microbiol Lett 226:267–271. https://doi. org/10.1016/S0378-1097(03)00615-3 13. Sano Y, Okamoto-Shibayama K, Tanaka K et al (2014) Dentilisin involvement in coaggregation between Treponema denticola and Tannerella forsythia. Anaerobe 30:45–50. https://doi. org/10.1016/j.anaerobe.2014.08.008 14. Bian XL, Wang HT, Ning Y et al (2005) Mutagenesis of a novel gene in the prcA-prtP protease locus affects expression of Treponema denticola membrane complexes. Infect Immun 73:1252–1255 15. Lee SY, Bian XL, Wong GW et al (2002) Cleavage of Treponema denticola PrcA polypeptide to yield protease complex-associated proteins Prca1 and Prca2 is dependent on PrtP. J Bacteriol 184:3864–3870 16. Godovikova V, Wang HT, Goetting-Minesky MP et al (2010) Treponema denticola PrcB is required for expression and activity of the PrcA-PrtP (dentilisin) complex. J Bacteriol 192:3337–3344. https://doi.org/10.1128/ JB.00274-10 17. Ishihara K, Kuramitsu HK, Miura T et al (1998) Dentilisin activity affects the organization of the outer sheath of Treponema denticola. J Bacteriol 180:3837–3844 18. Bamford CV, Fenno JC, Jenkinson HF et al (2007) The chymotrypsin-like protease complex of Treponema denticola ATCC 35405 mediates fibrinogen adherence and degradation. Infect Immun 75:4364–4372. https:// doi.org/10.1128/IAI.00258-07 19. Inagaki S, Kimizuka R, Kokubu E et al (2016) Treponema denticola invasion into human

gingival epithelial cells. Microb Pathog 94:104–111. https://doi.org/10.1016/j. micpath.2016.01.010 20. Ohta K, Makinen KK, Loesche WJ (1986) Purification and characterization of an enzyme produced by Treponema denticola capable of hydrolyzing synthetic trypsin substrates. Infect Immun 53:213–220 21. Fletcher HM, Schenkein HA, Macrina FL (1994) Cloning and characterization of a new protease gene (prtH) from Porphyromonas gingivalis. Infect Immun 62:4279–4286 22. Li H, Ruby J, Charon N et al (1996) Gene inactivation in the oral spirochete Treponema denticola: construction of an flgE mutant. J Bacteriol 178:3664–3667 23. Kurniyati K, Li C (2015) pyrF as a counterselectable marker for unmarked genetic manipulations in Treponema denticola. Appl Environ Microbiol 82:1346–1352. https://doi.org/ 10.1128/AEM.03704-15 24. Grenier D (1992) Demonstration of a bimodal coaggregation reaction between Porphyromonas gingivalis and Treponema denticola. Oral Microbiol Immunol 7:280–284. https://doi. org/10.1111/j.1399-302x.1992.tb00589.x 25. Rosen G, Genzler T, Sela MN (2008) Coaggregation of Treponema denticola with Porphyromonas gingivalis and Fusobacterium nucleatum is mediated by the major outer sheath protein of Treponema denticola. FEMS Microbiol Lett 289:59–66. https://doi.org/ 10.1111/j.1574-6968.2008.01373.x 26. Nagano K, Hasegawa Y, Yoshida Y et al (2017) Comparative analysis of motility and other properties of Treponema denticola strains. Microb Pathog 102:82–88. https://doi.org/ 10.1016/j.micpath.2016.11.021 27. Horikoshi M, Kimura Y, Nagura H et al (1974) A new human cell line derived from human carcinoma of the gingiva. I. Its establishment and morphological studies. Nihon Koku Geka Gakkai Zasshi 20:100–106. https://doi.org/ 10.5794/jjoms.20.100 28. Li Y, Ruby J, Wu H (2015) Kanamycin resistance cassette for genetic manipulation of Treponema denticola. Appl Environ Microbiol 81:4329–4338. https://doi.org/10.1128/ AEM.00478-15 29. Bian J, Fenno JC, Li C (2012) Development of a modified gentamicin resistance cassette for genetic manipulation of the oral spirochete Treponema denticola. Appl Environ Microbiol 78:2059–2062. https://doi.org/10.1128/ AEM.07461-11

Chapter 18 Evaluation of the Virulence of Aggregatibacter actinomycetemcomitans Through the Analysis of Leukotoxin Toshiyuki Nagasawa, Satsuki Kato, and Yasushi Furuichi Abstract Aggregatibacter actinomycetemcomitans is frequently isolated from localized aggressive periodontitis and periodontitis associated with systemic diseases. A. actinomycetemcomitans produces a leukotoxin, which induces apoptosis in human leukocytes. The leukotoxin expression is dependent on the upstream sequence, likely including the promoter, of the gene encoding leukotoxin; strains with the truncated/short upstream sequence express more leukotoxin than strains with the general/long upstream. This chapter addresses the determination of the type of the leukotoxin promoter by PCR analysis, and detection of the apoptosis in the coculture of human monocyte cell line (THP-1) with A. actinomycetemcomitans by the DNA ladder formation, membrane perturbation, and lactate dehydrogenase release. Key words Aggregatibacter actinomycetemcomitans, Leukotoxin, Apoptosis

1

Introduction Aggregatibacter actinomycetemcomitans is frequently isolated from localized aggressive periodontitis or periodontitis associated with systemic diseases [1]. A. actinomycetemcomitans produces a leukotoxin which induces apoptosis in human leukocytes [2]. It is known that the leukotoxin expression is dependent on the upstream sequence, probably including the promoter, of the gene encoding leukotoxin [3]. A. actinomycetemcomitans strain JP2 has a truncation in the upstream sequence (short type), and highly produces leukotoxin compare to the general strains which have the fulllength long upstream sequence (long type). Many reports indicate that high virulent strains are originated from JP2 [4]. Thus, the examination of the type of upstream sequence of the leukotoxin gene can predict the pathogenicity of A. actinomycetemcomitans. In the first part of this chapter, we address the determination of the

Keiji Nagano and Yoshiaki Hasegawa (eds.), Periodontal Pathogens: Methods and Protocols, Methods in Molecular Biology, vol. 2210, https://doi.org/10.1007/978-1-0716-0939-2_18, © Springer Science+Business Media, LLC, part of Springer Nature 2021

185

186

Toshiyuki Nagasawa et al.

type of the upstream sequence of the leukotoxin gene by PCR analysis. For the examination of leukotoxic activity by A. actinomycetemcomitans, human monocyte cell line THP-1 is used for the target cells. Apoptosis induced by A. actinomycetemcomitans is examined by general assays as follows. An internucleosomal DNA fragmentation is detected as a DNA ladder in electrophoresis [5]. Plasma membrane perturbation as known phospholipid flipflop is detected by annexin V and quantification is performed using a flow cytometer [6]. Additionally, we describe quantification of lactate dehydrogenase (LDH) release. Although LDH in culture supernatant is often used for an indicator of necrosis, it may also be useful to detect apoptosis at late stage [7–9].

2

Materials

2.1 Determination of Leukotoxin Promoter Type

1. Paper point, sterile.

2.1.1 Dental Plaque Preparation

4. Vortex mixer.

2. Saline, sterile: Autoclave 0.9% NaCl in water. 3. 1.5-mL Eppendorf Safe-Lock tube. 5. Centrifuge. 6. Water, sterile: Autoclave ultrapure water. 7. Boiling water or heat block.

2.1.2 Polymerase Chain Reaction (PCR)

1. PCR tube. 2. Primer sets for the promoter of A. actinomycetemcomitans leukotoxin [10] (see Note 1). Ltx3: 50 -GCCG ACACCAAAGACAAAGTCT-30 . Ltx4: 50 -GCCCATAA CCAAGCCACATAC-30 . 3. Ready-To-Go PCR Beads (Amersham Biosciences). 4. Thermal Cycler. 5. Agarose gel electrophoresis equipment: Use a Tris–acetate– EDTA (TAE) buffer. 6. 1% agarose gel. 7. Ethidium bromide (EtBr): 0.5 μg/mL solution. 8. UV light.

2.2

Apoptosis Assay

2.2.1 Infection of Leukocytes with A. actinomycetemcomitans

1. A. actinomycetemcomitans: JP2 (ATCC 700685), Y4 and NCTC 9710 strains are obtained from Dr. Donald R. Demuth and Dr. Tatsuji Nishimura, respectively. 2. Todd-Hewitt broth with yeast extract (THY): Dissolve 30 g of Todd-Hewitt broth and 10 g of yeast extract in 1 L of water, and autoclave at 121  C for 15 min. Store at room temperature.

Analysis of Aggregatibacter actinomycetemcomitans Leukotoxin

187

3. THP-1 cell: Obtain from Japanese Collection of Research Bioresources Cell Bank (JCRB 0112.1). Maintain and grow THP-1 cells in RPMI-1640 medium supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 U/mL penicillin G, and 100 μg/mL streptomycin. 4. RPMI-1640 w/o antibiotics: RPMI-1640 medium supplemented with 5% FBS. Store at 4  C. 5. RPMI-1640 w/o antibiotics: RPMI-1640 medium supplemented with 5% FBS, 100 U/mL penicillin G, 100 μg/mL streptomycin, and 200 mg/mL gentamicin. Store at 4  C. 6. CO2 incubator: 5% CO2 in air with humidity. 7. 15-mL centrifuge tube, sterile. 8. Centrifuge. 9. Spectrophotometer. 10. 6-well culture plates. 2.2.2 DNA Laddering

1. 1.5-mL tube. 2. 2.0-mL tube. 3. Centrifuge. 4. Cell lysis buffer: 10 mM Tris–HCl buffer, pH 7.4, 10 mM EDTA, pH 8.0, and 0.5% Triton X-100. Mix 0.1 mL of 1 M Tris–HCl buffer, pH 7.4, 0.2 mL of 0.5 M EDTA, pH 8.0, and 0.5 mL of 10% Triton X-100, and make up to 10 mL with water. 5. RNase: 0.5 mg/mL solution (DNase free). 6. Proteinase K: 10 mg/mL solution. 7. Phenol–chloroform–isoamyl alcohol: phenol–chloroform/isoamyl alcohol (25/24/1 v/v), saturated with 10 mM Tris, pH 8.0, 1 mM EDTA. 8. Chloroform. 9. Vortex mixer. 10. Sodium acetate: 3 M solution, pH 5.2. 11. Pure ethanol: 99.5% ethanol, chilled. 12. 70% ethanol: 70% solution in water, chilled. 13. TE buffer: 10 mM Tris–HCl, pH 8.0, and 1 mM EDTA, pH 8.0. 14. Agarose gel electrophoresis equipment: Use a TAE buffer. 15. 2% agarose gel. 16. EtBr. 17. UV light.

188

Toshiyuki Nagasawa et al.

2.2.3 Annexin V Apoptosis Detection Assay

1. 2.0-mL tube. 2. Centrifuge. 3. BD Annexin V: FITC Apoptosis Detection Kit I (BD Biosciences): FITC-labeled annexin V and propidium iodide (PI) are contained. 4. BD FACSVerse system. 5. BD FACSuite software.

2.2.4 Determination of LDH Release

1. 2.0-mL tube. 2. Centrifuge. 3. 96-well transparent plate. 4. Cytotoxicity Detection kit (LDH) (Roche) (see Note 2). 5. Microplate reader: Measure optical density (OD) at 490 nm wave length (OD490).

3

Methods

3.1 Determination of Leukotoxin Promoter Type

3.1.1 Dental Plaque Preparation

For the determination of the type of leukotoxin promoter of A. actinomycetemcomitans, the PCR method is available for the dental plaque samples as well as clinical isolates [10]. Here we describe the case using dental plaque samples. 1. Place the paper point in the periodontal pocket of a patient with periodontitis. 2. Transfer the paper point in 200 μL of saline in 1.5-mL Eppendorf Safe-Lock tube. 3. Mix vigorously by vortex mixer for a second, and remove the paper point. 4. Centrifuge at 20,000  g at 4  C for 30 min, and discard the supernatant. 5. Suspend the pellet in 100 μL of water. 6. Heat for 5 min in a boiling water bath or heat block at 100  C.

3.1.2 PCR

1. Prepare PCR mixture in a PCR tube: Add 23 μL of template (sample, see Subheading 3.1.2) and 1 μL (10 pmol) of each of two primers (Ltx3 and Ltx4) to the Ready-To-Go PCR Beads. 2. Set PCR program of a thermal cycler as follows: denaturation for 5 min at 94  C, and 30 cycles of 94  C for 1 min, 60  C for 1 min, and 72  C for 2 min, followed by a final extension at 72  C for 8 min.

Analysis of Aggregatibacter actinomycetemcomitans Leukotoxin

189

bp 2,000 1,500 1,000 750 500

JP2

Y4

9710

Fig. 1 PCR amplification of the upstream region of the leukotoxin gene of A. actinomycetemcomitans strains. PCR using primers of Ltx3 and Ltx4 amplifies the short (686 bp, strain JP2) and long (1216 bp, strains Y4 and 9710) type upstream sequences of the leukotoxin gene

3. Load the PCR product on 1% agarose gel, and electrophorese. 4. After staining the gel with EtBr, detect the band by UV light (Fig. 1) (see Note 3). 3.2

Apoptosis Assay

3.2.1 Infection of THP-1 with A. actinomycetemcomitans

1. Grow A. actinomycetemcomitans strains in THY in CO2 incubator at 37  C for 2 days. 2. Harvest A. actinomycetemcomitans, and suspended in RPMI1640 w/o antibiotics. Then, adjust the bacterial concentration to an OD of 0.55 at 550 nm, corresponding to approximately 5  109 bacteria/mL, with RPMI-1640 w/o antibiotics. 3. Harvest THP-1 cells, and suspend in RPMI-1640 w/o antibiotics. Then, adjust the cell concentration to 2  107 cells/ mL. 4. Mix 0.4 mL of 2  107 cells/mL THP-1 cells with 1.6 mL of 5  109 bacteria/mL A. actinomycetemcomitans in 15-mL sterile centrifuge tube (cell-to-bacteria ratio of 1:1000). 5. Centrifuge at 1000  g for 10 min at 4  C. 6. Suspend the cell–bacteria pellet in 2 mL of RPMI-1640 w/o antibiotics. 7. Incubate in CO2 incubator at 37  C for 30 min (see Note 4). 8. Harvest the infected cells by centrifugation at 1000  g for 10 min, and suspend in 2 mL of RPMI-1640 w/o antibiotics to kill noninvaded bacteria.

190

Toshiyuki Nagasawa et al.

9. Transfer the cell suspension to 6-well culture plates (2 mL/ well). 10. Incubate in CO2 incubator at 37  C in for 0–24 h. 3.2.2 DNA Laddering Assay

Use THP-1 cells infected with A. actinomycetemcomitans for 24 h (see step 10 in Subheading 3.2.1) for this assay to detect internucleosomal DNA fragmentation which is induced by apoptosis. 1. Collect the infected THP-1 cells (about 2 mL) in 2.0-mL tube by centrifugation at 1000  g for 10 min. 2. Suspend the cell pellet in 1 mL of the cell lysis buffer. 3. Centrifuge the lysate at 15,000  g for 20 min at 4  C to remove intact nuclei, and transfer the supernatant to 2.0mL tube. 4. Add 10 μL of RNase to the supernatants, and incubate for 1 h at 37  C. 5. Add 10 μL of proteinase K, and incubate for 1 h at 50  C. 6. Add 500 μL phenol–chloroform–isoamyl alcohol, and incubate with shaking for 30 min at room temperature. 7. Centrifuge at 15,000  g for 20 min at room temperature, and transfer 350 μL of the supernatant to a new 1.5-mL tube. 8. Add 450 μL of chloroform to the supernatant, and mix well by vortexing. 9. Centrifuge at 15,000  g for 10 min at room temperature, and transfer 300 μL of the supernatant to a new 1.5-mL tube. 10. Add 30 μL of 3 M sodium acetate and 750 μL of pure ethanol to the supernatant, and incubate for overnight at 20  C. 11. Centrifuge at 15,000  g for 20 min at 4  C, and remove the supernatant. 12. Add 1 mL of 70% ethanol, centrifuge at 15,000  g for 20 min at 4  C, remove the supernatant, and dry. 13. Dissolve in 30 μL of TE buffer. 14. Electrophorese in 2% agarose gel, stain with EtBr, and detect the DNA ladder with UV light (Fig. 2).

3.2.3 Annexin V Assay

Use THP-1 cells infected with A. actinomycetemcomitans for 0 h (for negative control) and 3 h (see step 10 in Subheading 3.2.1) for this assay to detect the cell membrane perturbation which is induced by apoptosis. 1. Collect the infected THP-1 cells (about 2 mL) in 2.0-mL tube by centrifugation at 1000  g for 10 min. 2. Treat the cell pellet with the BD Annexin V: FITC Apoptosis Detection Kit I according to the manufacturer’s instructions.

Analysis of Aggregatibacter actinomycetemcomitans Leukotoxin

191

bp 1230 1107 984 861 738 615 492 369 246 123

Fig. 2 A nucleosome ladder pattern of DNA degradation in THP-1 cells infected with or without A. actinomycetemcomitans Y4

3. Apply the sample to BD FACSVerse system. 4. Analyze the data using BD FACSuite software using the Annexin V FITC assay (see Note 5). 3.2.4 LDH Release Assay

Use THP-1 cells infected with A. actinomycetemcomitans for 0 h (for negative control) to 24 h (see step 10 in Subheading 3.2.1) for this assay to detect the loss of membrane integrity which is induced by apoptosis. 1. Collect the infected THP-1 cells (about 2 mL) in 2.0-mL tube by centrifugation at 1000  g for 10 min. 2. Transfer 100 μL of the supernatant to a 96-well plate. 3. Perform experiment using the LDH release using Cytotoxicity Detection kit according to the manufacturer’s instructions. 4. Measure OD490 by a microplate reader.

192

4

Toshiyuki Nagasawa et al.

Notes 1. The type of A. actinomycetemcomitans leukotoxin promoter region is usually determined by PCR analysis, and several primers specific for the leukotoxin promoter are reported. Although most of the primers are available for the cultured A. actinomycetemcomitans strains, some of the primers are not suited for the plaque samples. The primer pairs reported by Poulsen et al. [10], are designed for the clinical plaque samples. Other than JP2, most of the reported strain has the same length as Y4, but A. actinomycetemcomitans with insertion sequence of the region was reported in Japan, and the clone was also high producer of leukotoxin [11]. 2. Colorimetric assay for the quantification of cell death and cell lysis, based on the measurement of LDH activity released from the cytosol of damaged cells into the supernatant [7]. 3. Sensitivity of the PCR analysis is approximately 1  103 cells/ ml. The Ready-To-Go PCR Beads does not contain buffers in the kit, and 25 μL of deionized water containing template and primers is needed. Accordingly, the protocol at Subheading 3.1, step 3 uses 23 μL of the samples. The amount of the samples can be adjusted according to the number of the bacteria in the samples. In addition, if contaminants in the samples interfere with the PCR reaction, purification of the DNA might improve the reaction. The other PCR kits are also available in this assay, but volume of the sample solution is limited in PCR analysis (usually less than 10 μL), and number of the A. actinomycetemcomitans in the sample solution should be more than 1  103 cells/ml (1 cell/μL). 4. A. actinomycetemcomitans invades into THP-1 cells during this incubation. 5. Flow cytometry can measure the percentages of the apoptotic cells within the A. actinomycetemcomitans-infected leukocytes. The gates are set based on the forward and side scatters. The report generated from the apoptosis assay includes the number of the cells stained with Annexin V and/or PI (Fig. 3). The PI-positive cells are dead cells, and Annexin V-positive cells are apoptotic cells, indicating that the apoptotic cell death is quantitated by the both Annexin V- and PI-positive cells. It should be noted that culture condition might affect the results, and viability of the cells is checked by the PI-positive dead cells in the control staining. Incubation time and number of A. actinomycetemcomitans might affect the results, and reference strains are needed to measure the leukotoxic activity of unknown strains.

Analysis of Aggregatibacter actinomycetemcomitans Leukotoxin

A. actinomycetemcomitans infection

Control 0.23

105

104

104

PI

PI

4.84

5

10

103

102

101

101 88.13

6.80 103 FITC

104

105

Annexin-FITC

0.21

10.97

78.43

10.39

103

102

101 102 Specimen_001_3h0.fcs Count: 9606 FSC-A, SSC-A subset

193

101

102

Specimen_001_3hY.fcs Count: 9560 FSC-A, SSC-A subset

103

104

105

FITC

Annexin-FITC

Fig. 3 Staining pattern of Annexin V-FITC and PI in THP-1 cells infected with or without A. actinomycetemcomitans Y4 for 3 h. Apoptotic and dead cells are stained with Annexin V and PI, respectively. Viable and nonapoptotic cells are Annexin/PI. Early apoptotic cells are Annexin V+/PI, whereas the late apoptotic or dead cells are Annexin V+/PI+ References 1. Nagasawa T, Shimizu S, Kato S et al (2014) Host–microbial co-evolution in periodontitis associated with Aggregatibacter actinomycetemcomitans infection. J Oral Biol 56(1):11–17 2. Taichman NS, Dean RT, Sanderson CJ (1980) Biochemical and morphological characterization of the killing of human monocytes by a leukotoxin derived from Actinobacillus actinomycetemcomitans. Infect Immun 28 (1):258–268 3. Brogan JM, Lally ET, Poulsen K et al (1994) Regulation of Actinobacillus actinomycetemcomitans leukotoxin expression: analysis of the promoter regions of leukotoxic and minimally leukotoxic strains. Infect Immun 62 (2):501–508 4. Haubek D, Ennibi OK, Poulsen K et al (2008) Risk of aggressive periodontitis in adolescent carriers of the JP2 clone of Aggregatibacter (Actinobacillus) actinomycetemcomitans in Morocco: a prospective longitudinal cohort study. Lancet 371(9608):237–242 5. Majtnerova P, Rousar T (2018) An overview of apoptosis assays detecting DNA fragmentation. Mol Biol Rep 45(5):1469–1478 6. van Engeland M, Nieland LJ, Ramaekers FC et al (1998) Annexin V-affinity assay: a review

on an apoptosis detection system based on phosphatidylserine exposure. Cytometry 31 (1):1–9 7. Smith SM, Wunder MB, Norris DA et al (2011) A simple protocol for using a LDH-based cytotoxicity assay to assess the effects of death and growth inhibition at the same time. PLoS One 6(11):e26908 8. Kato S, Muro M, Akifusa S et al (1995) Evidence for apoptosis of murine macrophages by Actinobacillus actinomycetemcomitans infection. Infect Immun 63(10):3914–3919 9. Kato S, Sugimura N, Nakashima K et al (2005) Actinobacillus actinomycetemcomitans induces apoptosis in human monocytic THP-1 cells. J Clin Microbiol 54(Pt 3):293–298 10. Poulsen K, Ennibi OK, Haubek D (2003) Improved PCR for detection of the highly leukotoxic JP2 clone of Actinobacillus actinomycetemcomitans in subgingival plaque samples. J Clin Microbiol 41(10):4829–4832 11. He T, Nishihara T, Demuth DR et al (1999) A novel insertion sequence increases the expression of leukotoxicity in Actinobacillus actinomycetemcomitans clinical isolates. J Periodontol 70(11):1261–1268

Chapter 19 Lipoprotein Extraction from Microbial Membrane and Lipoprotein/Lipopeptide Transfection into Mammalian Cells Akira Hasebe, Ayumi Saeki, and Ken-ichiro Shibata Abstract Microbial lipoproteins/lipopeptides are important virulence factors for periodontal diseases. The membrane lipoproteins from Mycoplasma salivarium or Tannerella forsythia can be easily extracted by exploiting a characteristic feature of Triton X-114: its aqueous nature at low temperatures (0–4  C), which is absent at room temperature (25–37  C). Transfection of these lipopeptides into macrophages was performed using the protein transfection reagent, PULSin. Key words Microbial lipoprotein, Triton X-114, Mycoplasma salivarium, Tannerella forsythia, Interleukin-1β, Lipopeptide transfection

1

Introduction Bacterial surface lipoproteins or mycoplasmal membrane lipoproteins/lipopeptides are important virulence factors for periodontal diseases [1]. Lipoproteins from Tannerella forsythia, a member of the Red Complex [2], have been reported to induce inflammatory cytokine production or apoptosis in immune cells [3]. Many studies reported the biological activities of mycoplasmal lipoproteins, such as host cell adhesion, cytokine induction, and apoptosis induction [4–7]. Not only the gram-negative bacteria but also mycoplasmas may be involved in the pathogenesis of periodontal diseases. Mycoplasma salivarium was isolated from the periodontal pockets of diseased subjects at a significantly higher rate than from the gingival sulci of healthy subjects [8]. Also, the antibody response to Mycoplasma species is significantly higher in diseased subjects than healthy subjects [9]. In this study, we introduce the methods to extract membrane lipoproteins from M. salivarium and T. forsythia using the phase separation technique of Triton X (TX)-114. This technique exploits

Keiji Nagano and Yoshiaki Hasegawa (eds.), Periodontal Pathogens: Methods and Protocols, Methods in Molecular Biology, vol. 2210, https://doi.org/10.1007/978-1-0716-0939-2_19, © Springer Science+Business Media, LLC, part of Springer Nature 2021

195

196

Akira Hasebe et al.

the property of TX-114 to remain in aqueous state at low temperatures (0–4  C) but promote microcondensation of micelles at higher temperatures (25–37  C) [10]. Therefore, lipoproteins extracted using TX-114 at 4  C are separated by the formation of microcondensed micelles at 25–37  C. To examine stimulatory activity of these lipoproteins/lipopeptides, they are then transfected into macrophages using an amphipathic transfection reagent that can transfect proteins and peptides. The reagent contains a cationic amphiphilic molecule that forms noncovalent complexes with proteins, which are then internalized via the anionic celladhesion receptors and released into the cytoplasm, where they disassemble. This method is used to analyze the mechanism of interleukin-1β (IL-1β) induction by lipoproteins and a synthetic mycoplasmal lipopeptide [11] since IL-1β is also known to play a key role in the pathogenesis of periodontal diseases [12].

2

Materials Prepare all the solution using ultrapure water, such as MilliQ water and analytical grade reagents.

2.1 M. salivarium and T. forsythia Cultures

1. M. salivarium ATCC 23064. 2. Heat-inactivated horse serum and fetal bovine serum (FBS): Heat horse serum and FBS for 30 min at 56  C in a water bath to inactivate the complement proteins. 3. PPLO broth with supplements: PPLO broth supplemented with 15% (v/v) heat-inactivated horse serum, 1.5% yeast extract (w/v), 1% (w/v) L-arginine HCl, 0.05% (w/v) thallium acetate, and 1000 U/mL penicillin G. Add 850 mL of water to a glass vial. Weigh 21 g of PPLO broth powder, 15 g of yeast extract, 10 g of L-arginine hydrochloride, and 0.5 g of thallium acetate and then add them to water in a glass vial. Autoclave this base broth. When it has cooled to room temperature, transfer 10 mL of base broth to a vial of 100,000 U injectable penicillin G, and mixed well. Return 10 mL of this penicillin G solution to the base broth and then add 150 mL of heatinactivated horse serum. 4. T. forsythia ATCC 43037. 5. Hemin: 50 mg/mL solution. Add 1 g of hemin to 20 mL of 0.1 N NaOH, mix well and store in the dark at 4  C. 6. Menadione: 10 mg/mL solution. Add 0.1 g of menadione to 10 mL of ethanol, mix well and store in the dark at 4  C. 7. Brain heart infusion (BHI) broth with supplements: BHI containing 0.5% (w/v) yeast extract, 5 μg/mL hemin, 0.5 μg/mL menadione, 0.001% (w/v) N-acetylneuraminic acid, and 0.1%

Lipoprotein Extraction from Microbial Membrane and Lipoprotein/Lipopeptide. . .

197

(w/v) L-cysteine and 5% (v/v) FBS. Add 950 mL of water to a glass vial. Weigh 37 g of BHI broth powder, 5 g of yeast extract, 0.01 g of N-acetylneuraminic acid, and 1 g of L-cysteine, and then add them to 950 mL of water. Add 100 μL of hemin solution and 50 μL of menadione solution. Autoclave this base broth. After cooling down to room temperature, add 50 mL of heat-inactivated FBS (seeNote 1). 8. Sterile 15-mL tube. 9. Autoclavable 250-mL plastic bottle. 10. Temperature-controlled high-speed centrifuge. 11. TS buffer: 154 mM NaCl, 10 mM Tris–HCl, pH 7.4 containing 1 mM phenylmethylsulfonyl fluoride (PMSF). Add about 900 mL of water to a glass beaker. Weigh 1.21 g of Tris (hydroxymethyl)aminomethane and 9 g of sodium chloride, and then add them to 900 mL of water. Add 10 mL of 100 mM PMSF and mix to dissolve them completely. Adjust its pH to 7.4 with HCl. Transfer the solution to a cylinder and make up to 1 L with water. Store at 4  C. 12. Spectrophotometer. 13. Modified Lowry protein assay kit. 14. GasPak and airtight jar. 2.2 Lipoprotein Extraction

1. PMSF stock solution: 100 mM PMSF. Add 0.174 g of PMSF in 10 mL of dimethyl sulfoxide (DMSO) or isopropanol. Dissolve PMSF in DMSO or isopropanol due to its low solubility in water (seeNote 2). 2. Phosphate-buffered saline (PBS): 137 mM NaCl, 2.7 mM KCl, 8.1 mM Na2HPO4, 1.5 mM KH2PO4. Add about 900 mL of water to a glass beaker. Weigh 8 g of NaCl, 0.2 g of KCl, 1.15 g of Na2HPO4, and 0.2 g of KH2PO4, and then add them to 900 mL of water. Transfer the solution to a cylinder and make up to 1 L with water. 3. PBS containing 10 mM n-octyl-β-D-glucopyranoside (OG): Dissolve 1 g of n-octyl-β-D-glucopyranoside in 34.2 mL of PBS to prepare a 100 mM stock solution, and dilute ten times with PBS as needed. Store at 4  C. 4. Microcentrifuge (seeNote 3). 5. 20% TX-114: Add 40 mL of TS buffer and 10 mL of TX-114 in a glass beaker and mix thoroughly with a magnetic stirrer while maintaining the temperature at 0–4  C (seeNote 4). Store at 4  C. 6. Ice-cold methanol. 7. Modified Lowry protein assay kit (seeNote 5). 8. Constant-temperature water bath.

198

Akira Hasebe et al.

9. Ultrasonicator (for T. forsythia). 10. Vortex mixer. 2.3 Lipopeptide Transfection into Macrophages

1. Murinebone marrow-derived macrophages (BMMs). 2. PULSin (Polyplus-Transfection, store at 4  C). 3. 20 mM HEPES buffer (store at 4  C). 4. 10 μM FSL-1 (a synthetic lipopeptide derived from M. salivarium) (InvivoGen, in water, store at 20  C). 5. 100 μg/mL Ultrapure Escherichia coli LPS (InvivoGen, in water, store at 20  C) (seeNote 6). 6. RPMI 1640 medium (Thermo Fisher Scientific). 7. RPMI 1640 medium (Thermo Fisher Scientific) containing 10% (v/v) FBS. 8. 37  C, 5% CO2, cell culture incubator. 9. Cell culture centrifuge with swinging buckets to hold 24-well cell plates. 10. 24-well cell culture plate. 11. 96-well cell culture plate. 12. Pipette with a volume of 1–500 μL. 13. ELISA kit for IL-1β (e.g., BD Biosciences).

3

Methods

3.1 Bacterial Cultures 3.1.1 M. salivarium Culture

1. Transfer 10 mL of PPLO broth to a sterile 15-mL tube. 2. For preculture, inoculate 1 mL of M. salivarium culture stock to the broth under aerobic conditions at 37  C and incubate for 24 h. 3. Add the precultured M. salivarium to 990 mL of PPLO broth. Culture M. salivarium in aerobic condition at 37  C for 48–72 h. 4. Harvest the M. salivarium cells in an autoclavable 250-mL plastic bottle by centrifuging at 8000  g for 30 min at 4  C. 5. After discarding the supernatants, add 40 mL of ice-cold TS buffer to the plastic bottle and suspend the cell pellet with pipetting (seeNote 7). 6. Transfer the suspension to a 50-mL centrifuge tube and harvest the M. salivarium cells by centrifuging at 15,000  g for 15 min at 4  C. 7. Repeat steps 5 and 6 twice to remove any leftover suspended debris from the broth. 8. Suspend the cell pellet in 10 mL of TS buffer and determine the protein concentration by modified Lowry method. The protein

Lipoprotein Extraction from Microbial Membrane and Lipoprotein/Lipopeptide. . .

199

concentration of the cell suspensions should be adjusted to 2 mg/mL with TS buffer. Store the suspension at 80  C until further use. 3.1.2 T. forsythia Culture

1. Transfer 10 mL of the BHI broth with supplements to a sterile 15-mL tube. 2. For preculture, inoculate T. forsythia culture into the broth with a platinum loop for a few times. Immediately start culture under anaerobic conditions using GasPak and an airtight jar at 37  C and incubated for 2 days. 3. Add the precultured T. forsythia to 990 mL of BHI broth with supplements. Immediately start preculture under anaerobic conditions using GasPak and an airtight jar at 37  C for 5–7 days. 4. Harvest the T. forsythia cells in an autoclavable 250-mL plastic bottle by centrifuging at 8000  g for 15 min at 4  C. 5. After discarding the supernatants, add 40 mL of ice-cold TS buffer and suspend the cell pellet with pipetting (seeNote 7). 6. Transfer the suspension to a 50-mL centrifuge tube and harvest the T. forsythia cells by centrifuging at 8000  g for 10 min at 4  C. 7. Repeat step 5 and 6 twice to remove any leftover suspended debris from the broth. 8. Suspend the cell pellet in 10 mL of TS buffer and determine the protein concentration by modified Lowry method. The protein concentration of the cell suspensions should be adjusted to 2 mg/mL with TS buffer. Store the suspension at 80  C until further use.

3.2 Lipoprotein Extraction by TX-114 Phase Separation Method (SeeNote 8)

Lipoprotein extraction by TX-114 phase separation technique exploits the characteristic feature of TX-114 to be present as an aqueous solution at low temperatures (0–4  C), but promote microcondensation of micelles at a higher temperature (25–37  C). Therefore, it is important to control the temperature for the extraction of microbial lipoproteins. The procedure is illustrated in Fig. 1. 1. In a chilled small glass container (e.g., 20-mL container), add 4.5 mL of mycoplasma or T. forsythia suspension of which protein concentration adjusted to 2 mg/mL with TS buffer. For T. forsythia, ultrasonicate the 2 mg/mL suspension by three sets of 30 s sonication cycles. Keep chilling the container and sonicate by placing the tip of the sonicator into the cell suspension. 2. Add 0.5 mL of 20% TX-114 to this container and stir for 2 h with the help of a magnetic stirrer bar. To maintain the

200

Akira Hasebe et al.

Transfer supernatants

Increase temperature

Centrifuge room temperature

Discard AQ Add MeOH

-80 ֯C overnight Centrifuge

Dsicard AQ Add TS buffer

Centrifuge room temperature

WASH

Increase temperature

Fig. 1 Flow diagram of TX-114 phase separation for lipoprotein extraction from M. salivarium or T. forsythia

temperature of the mixture at 0–4  C, put the glass container in a plastic container filled with ice. Keep mixing for 2 h on ice. 3. Dispense 1 mL of this mixture to chilled microtubes. 4. Centrifuge the tubes at 4  C for 10 min at 15,000  g. Transfer the supernatants to fresh tubes to remove the sediments. 5. Incubate the tubes at 37  C for 5 min. During incubation, the clear supernatants turn cloudy, thus indicating the condensation of detergent micelles. 6. Centrifuge the tubes at room temperature for 10 min at 10,000  g. The upper aqueous (AQ) phase and the viscous lower detergent (TX) phase are separated into two distinct

Lipoprotein Extraction from Microbial Membrane and Lipoprotein/Lipopeptide. . .

201

layers in the tubes. Since lipoproteins exist in the TX phase, discard the AQ phase and wash the TX phase as follows. 7. Add 0.8 mL of ice-cold TS buffer to the remaining TX phase in the microtube kept on ice and mix well with a vortex mixer. 8. Chill the microtube on ice for 5 min. Repeat steps 5 and 6 to remove any leftover hydrophilic components. 9. After discarding the upper AQ phase, add 0.9 mL of ice-cold methanol to the TX phase and mix well. 10. Store the microtubes in a deep freezer at 80  C for more than 1 h to precipitate the lipoproteins (seeNote 9). 11. Centrifuge the tubes at 4  C for 10 min at 15,000  g and then discard supernatants. The sediments contain the desired lipoproteins (seeNote 10). 12. Dissolve the sediments with PBS or PBS containing 10 mM OG, and determine the protein concentration using modified Lowry method [13]. 3.3 Transfection of the Lipopeptide FSL-1 into the Macrophages

This protocol describes a method for transfection of M. salivariumderived lipopeptide FSL-1 into BMMs with the protein transfection reagent PULSin to assess the release of IL-1β. 1. Count the cells and adjust them to 8  105 cells/mL in RPMI 1640 containing 10% FBS. 2. Seed 500 μL/well of cell suspension in a 24-well plate and incubate at 37  C for 2 h. 3. Add 5 μL of ultrapure E. coli LPS (1 μg/mL) to each well (final LPS concentration of 10 ng/mL) to prime the cells (seeNote 11). 4. Incubate the plate at 37  C for 4 h. 5. Add 10 μL of FSL-1 (10 μM) to 90 μL of 20 mM HEPES buffer in a microcentrifuge tube, vortex gently and spin down briefly. 6. Add 1 μL of the PULSin reagent to this tube, vortex immediately, spin down briefly and then incubate for 15 min at room temperature (seeNote 12). 7. Wash cells once with RPMI 1640 basal medium (pre-warmed at 37  C) and resuspended in 270 μL of the same medium (seeNote 13). 8. Add 30 μL of FSL-1/PULSin mix to the cells (final FSL-1 concentration of 100 nM) and homogenize by gently swirling the plate and incubate at 37  C (seeNote 14). 9. At the end of the incubation period, centrifuge the plate at 4  C for 10 min at 300  g, and carefully transfer 200 μL of the cell culture supernatant to a fresh 96-well plate (seeNote 15). Store

202

Akira Hasebe et al.

this plate with the cell culture supernatants at until further use.

20 or

70  C

10. Analyze the cell culture supernatants by ELISA for IL-1β according to the manufacturer’s instructions.

4

Notes 1. To keep the broth anaerobic, inoculate T. forsythia immediately after the addition of heat-inactivated FBS, or store the broth in an airtight jar with GasPak until further use. 2. Be sure to wear gloves and mask during the treatment of PMSF due to its harmful nature. 3. Using a microcentrifuge with a swing rotor is recommended during centrifugation process for lipoprotein extraction. In another centrifugation, a microcentrifuge with angle rotor can be used. For centrifugation at 4  C, a temperaturecontrolled microcentrifuge is needed. 4. Prepare a large-pore pipette to measure and gently pipet out TX-114 due to its viscous nature. 5. You can also use any reagents to determine protein concentrations. 6. The standard LPS preparations extracted by classical methods are contaminated by other bacterial components, such as lipoproteins. The ultrapure LPS is extracted by successive enzymatic hydrolysis steps and purified by the phenoltriethylamine-deoxycholate extraction protocol to remove contaminating lipoproteins [14]. 7. Discarded supernatants should be sterilized. 8. This method of membrane lipoprotein extraction is applicable to other mycoplasmas, such as M. pneumoniae and M. fermentans, and other gram-negative bacteria, such as E. coli and Porphyromonas gingivalis also. 9. Overnight storage of the microtubes in a deep freezer is recommended. 10. During the extraction of lipoproteins from gram-negative bacteria, it is difficult to avoid contamination with LPS. We use polymyxin B to decrease the effects of LPS contamination. 11. IL-1β is generally produced extracellularly through two steps. The first step is the transcription of pro-IL-1β triggered by pattern recognition receptors such as toll like receptors, which is referred to as “priming” (e.g., LPS pre-stimulation). The second step is the maturation of pro-IL-1β by caspase-1 to

Lipoprotein Extraction from Microbial Membrane and Lipoprotein/Lipopeptide. . .

203

Fig. 2 Transfection of FSL-1-Fluorescein (FSL-1-FITC, EMC Microcollections) with PULSin into the cytosol of BMMs. BMMs were primed with LPS (10 ng/mL) for 4 h and then transfected with 2 μg/mL of FSL-1-FITC with PULSin. After incubation for 4 h, the cells were fixed and observed using a confocal microscope

be activated by the intracellular multiprotein complex, inflammasome [15]. 12. Vortex PULSin reagent for 5 s and spin down before use. 13. The washing step is critical to remove all traces of serum, which leads to low transfection efficiency. 14. Figure 2 shows the delivery of FITC-labeled FSL-1 with PULSin to the cytosol of LPS primed-BMMs 4 h after transfection. 15. We measure IL-1β at 4–24 h after transfection [11].

Acknowledgments This work was supported by JSPS KAKENHI grant numbers JP19K10066 and JP16H06280. We would like to thank the Nikon Imaging Center at Hokkaido University for technical support. References 1. Kovacs-Simon A, Titball RW, Michell SL (2011) Lipoproteins of bacterial pathogens. Infect Immun 79:548–561. https://doi.org/ 10.1128/IAI.00682-10

2. Roˆc¸as IN, Siqueira JF, Santos KRN, Coelho AMA (2001) “Red complex” (Bacteroides forsythus, Porphyromonas gingivalis, and Treponema denticola) in endodontic infections: a molecular approach. Oral Surg Oral Med Oral

204

Akira Hasebe et al.

Pathol Oral Radiol Endod 91:468–471. https://doi.org/10.1067/moe.2001.114379 3. Hasebe A, Yoshimura A, Into T et al (2004) Biological activities of Bacteroides forsythus lipoproteins and their possible pathological roles in periodontal disease. Infect Immun 72:1318–1325 4. Hasebe A, Pennock ND, Mu HH et al (2006) A microbial TLR2 agonist imparts macrophage-activating ability to apolipoprotein A-1. J Immunol 177:4826–4832. https://doi.org/10.4049/jimmunol.177.7. 4826 5. Hasebe A, Mu HH, Cole BC (2014) A potential pathogenic factor from Mycoplasma hominis is a TLR2-dependent, macrophage-activating, P50-related adhesin. Am J Reprod Immunol 72:285–295. https://doi.org/10.1111/aji. 12279 6. Into T, Nodasaka Y, Hasebe A et al (2002) Mycoplasmal lipoproteins induce toll-like receptor 2- and caspases-mediated cell death in lymphocytes and monocytes. Microbiol Immunol 46:265–276 7. Shibata K, Hasebe A, Into T et al (2000) The N-terminal lipopeptide of a 44-kDa membrane-bound lipoprotein of Mycoplasma salivarium is responsible for the expression of intercellular adhesion molecule-1 on the cell surface of normal human gingival fibroblasts. J Immunol 165:6538–6544 8. Engel L, Kenny G (1970) Mycoplasma salivarium in human gingival sulci. J Periodontal Res 5:163–171 9. Kumagai K, Iwabuchi T, Hinuma Y et al (1971) Incidence, species, and significance of

Mycoplasma species in the mouth. J Infect Dis 123:16–21 10. Wise KS, Kim MF, Watson-McKown R (1995) Variant membrane proteins. In: Razin S, Tully JG (eds) Molecular and diagnostic procedures in mycoplasmology. Elsevier, Amsterdam, pp 227–241 11. Saeki A, Sugiyama M, Hasebe A et al (2018) Activation of NLRP3 inflammasome in macrophages by mycoplasmal lipoproteins and lipopeptides. Mol Oral Microbiol 33. https://doi. org/10.1111/omi.12225 12. Shibata K (2018) Historical aspects of studies on roles of the inflammasome in the pathogenesis of periodontal diseases. Mol Oral Microbiol 33:203–211. https://doi.org/10.1111/ omi.12217 13. Dulley JR, Grieve PA (1975) A simple technique for eliminating interference by detergents in the Lowry method of protein determination. Anal Biochem 64:136–141. https://doi.org/10.1016/0003-2697(75) 90415-7 14. Hirschfeld M, Ma Y, Weis JH et al (2000) Cutting edge: repurification of lipopolysaccharide eliminates signaling through both human and murine Toll-like receptor 2. J Immunol 165:618–622. https://doi.org/10. 4049/jimmunol.165.2.618 15. Mariathasan S, Monack DM (2007) Inflammasome adaptors and sensors: Intracellular regulators of infection and inflammation. Nat Rev Immunol 7:31–40. https://doi.org/10.1038/ nri1997

Part III Interactions with Other Pathogenic Microorganism and Host Cells

Chapter 20 Analysis of the Interaction Between HIV and Periodontopathic Bacteria That Reactivates HIV Replication in Latently Infected Cells Kenichi Imai Abstract The acquired immunodeficiency syndrome (AIDS) pandemic caused by the human immunodeficiency virus (HIV) is a major global health concern affecting 38 million people worldwide. HIV gene expression is the major determinant of the rate of viral replication leading to the progression of AIDS. The persistence of cellular reservoirs of HIV proviruses, despite prolonged treatment with antiretroviral drugs, represents the main obstacle preventing the eradication of HIV. Epigenetic silencing by histone deacetylase (HDAC) contributes to maintaining HIV transcriptional latency. However, the mechanism of the switch from latency to full HIV replication is unknown. HIV infection and antiretroviral treatment or a combination of both contribute to a higher incidence and severity of periodontitis. Periodontopathic bacteria such as Porphyromonas gingivalis and Fusobacterium nucleatum produce high concentrations of butyric acid, which strongly inhibit HDAC, indicating that periodontitis may mediate the reactivation of HIV replication. Here we describe a stepwise protocol for analyzing HIV reactivation by periodontal pathogens. However, the experiments using HIV requires BSL3 containment, making it difficult to handle HIV in dentistry. Therefore, we present an experimental method using cell lines latently infected with HIV. Key words HIV, Latent HIV infection, Reactivation, Periodontopathic bacteria

1

Introduction The cytopathic retrovirus human immunodeficiency virus (HIV) is the primary cause of acquired immunodeficiency syndrome (AIDS) and associated disorders. Despite the discovery of HIV-1 in 1983, we are unable to eliminate the virus from infected patients. The HIV genome, the prototype human lentivirus, has been found to encode the virion proteins Gag (p24, p41, and p55), Env, and Pol. Gag codes for the structural proteins such as capsid, matrix, and nucleocapsid, Env encodes the glycoproteins gp41 and gp120, and Pol encodes reverse transcriptase, integrase, and protease. In addition, HIV has six regulatory genes: tat, rev, nef, vif, vpr, and vpu [1].

Keiji Nagano and Yoshiaki Hasegawa (eds.), Periodontal Pathogens: Methods and Protocols, Methods in Molecular Biology, vol. 2210, https://doi.org/10.1007/978-1-0716-0939-2_20, © Springer Science+Business Media, LLC, part of Springer Nature 2021

207

208

Kenichi Imai

The transcription of the HIV provirus is the major determinant of the viral replication rate leading to disease progression. HIV transcription, which is directed by the promoter located in the 50 -long terminal repeat (LTR) of the integrated provirus, is controlled by cellular factors that bind to the LTR as well as the viral transactivator Tat [1]. Tat protein is a virus-encoded 86–101 amino acid regulatory protein that is essential for the replication and pathogenicity of the virus. HIV-1 gene expression is induced by extracellular factors such as cytokines and inhibitors of histone deacetylase (HDAC), including trichostatin A and butyric acid. In contrast to productively infected cells, transcriptionally silent proviral HIV genomes integrated into heterochromatin persist in infected cells [1]. Although there is no effective HIV vaccine, antiretroviral therapy (ART) greatly lengthens the survival of patients with AIDS. However, despite the potency of ART, resting CD4+ T cells remain latently infected with HIV, allowing the virus to escape the host’s immune responses [1]. Therefore, viral latency prevents eradication of HIV. Thus, identifying the molecular mechanisms that maintain viral latency and reactivation is required to understand the pathophysiology of HIV infection, which will likely lead to novel prevention and treatment strategies. Chronic immune activation associated with coinfection by HIV with other pathogens may represent a critical factor that contributes to the severity and progression of AIDS, which increases the risk of HIV transmission from infected individuals [2]. A positive association between HIV infection and chronic periodontitis has been reported. For example, more periodontopathic bacteria are present in HIV-positive individuals compared with those of healthy controls [3, 4]. There is a significant correlation between the stage of periodontitis and the HIV RNA viral load in plasma and saliva as well as the HIV proviral DNA load in gingival crevicular fluid [5, 6]. Moreover, expression of HIV receptors and coreceptors is increased in association with chronic periodontitis [7]. We have previously demonstrated that Porphyromonas gingivalis and Fusobacterium nucleatum produce butyric acid, which may induce the reactivation of latent HIV through inhibition of HDAC [8– 10]. Interestingly, Das et al. reported that butyric acid in the saliva of patients with chronic periodontitis induces the reactivation of HIV [11]. Further, P. gingivalis upregulates C-C chemokine receptor type 5 (CCR5) expression by oral keratinocytes to facilitate subsequent infection by HIV of permissive cells such as macrophages in a CCR5-dependent manner [12]. Moreover, the interaction between HIV and the outer membrane vesicles (OMVs) of P. gingivalis leads to OMV-dependent entry of HIV into oral epithelial cells [13]. Although additional basic and clinical studies

Reactivation of Latent HIV by Periodontopathic Bacteria

209

of HIV-infected individuals are required, these observations suggest that periodontitis affects HIV activation and the ensuing progression of AIDS. This chapter describes the analysis of HIV reactivation mediated by periodontopathic bacteria.

2

Materials

2.1 Preparation of Culture Supernatant and Bacterial Cells

1. P. gingivalis strains (FDC381, W83, and ATCC 33277): Culture P. gingivalis strains in brain heart infusion (BHI) broth supplemented with 5% fetal bovine serum (FBS), 5 μg/mL hemin, and 0.4 μg/mL menadione in an anaerobic chamber at 37  C for 48 h. 2. F. nucleatum ATCC 25586: Culture F. nucleatum ATCC 25586 in BHI broth supplemented with 5% FBS, 5 μg/mL hemin, and 0.4 μg/mL menadione in an anaerobic chamber at 37  C for 48 h. 3. Anaerobic chamber (5% CO2, 10% H2, and 85% N2). 4. 0.22-μm pore size sterilized membrane filter. 5. Phosphate-buffered saline (PBS), pH 7.4.

2.2 Cell Culture (See Note 1)

1. Human CD4+ T lymphocyte (ACH-2) cell line (National Institute of Allergy and Infectious Diseases, National Institutes of Health): Maintain at 37  C in RPMI 1640 with 10% FBS, 100 units/mL penicillin, 100 mg/mL streptomycin, and 20 μM azidothymidine (AZT) (see Note 2). 2. Macrophage/monocyte cell line OM10.1 harboring replication-competent latent HIV-1 (National Institute of Allergy and Infectious Diseases, National Institutes of Health): Maintain at 37  C in RPMI 1640 with 10% FBS, 100 units/mL penicillin, 100 mg/mL streptomycin, and 20 μM AZT (see Note 2). 3. Human embryonic kidney 293T cell line (American Type Culture Collection) (see Note 3): Maintain at 37  C in Dulbecco’s modified Eagle’s medium (DMEM) with 10% FBS. 4. 12-well plate. 5. 0.22-μm pore size sterilized membrane filter. 6. PBS, pH 7.4.

2.3 Stimulation Experiments

1. ACH-2 cells (see Subheading 3.2). 2. OM10.1 cells (see Subheading 3.2). 3. Culture supernatant (see step 2 in Subheading 3.1). 4. Bacterial cells (see step 4 Subheading 3.1).

210

Kenichi Imai

5. Butyric acid. 6. TNF-α (R&D). 7. Lysis buffer. 2.4 Immunoblotting Analysis of HIV Antigens

1. Cell lysate (see step 3 in Subheading 3.2). 2. 12.5% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel. 3. SDS-PAGE equipment set. 4. Nitrocellulose membrane. 5. Anti-HIV antibody (see Note 4). 6. Blocking buffer. 7. Wash buffer. 8. Secondary antibody. 9. Kit for detection of chemiluminescence.

2.5 Polymerase Chain Reaction (PCR) Analysis of HIV RNA Expression

1. Cell lysate (see step 3 in Subheading 3.2). 2. Kit for extract total RNA. 3. Reverse transcriptase. 4. DNA polymerase. 5. 1.5% agarose gels.

2.6 Enzyme-linked Immunosorbent Assay (ELISA) for Detection of the HIV Core Protein p24

1. Cell lysate (see step 3 in Subheading 3.2).

2.7 Analysis of HIV Transcription Activity by Luciferase Assay

1. Human embryonic kidney 293T cell.

2. HIV p24 ELISA kit (Zepto Metrix).

2. 12-well plate. 3. The luciferase assay system (Promega). 4. HIV LTR reporter plasmid (CD12-Luc containing wild-type HIV-1 LTR). 5. Transfection reagent (see Note 5). 6. Lysis buffer (Promega). 7. Luciferase assay system (Promega).

3

Methods 1. Collect the culture supernatant from culture of P. gingivalis strains or F. nucleatum by centrifugation at 10,000  g for 20 min at 4  C.

Reactivation of Latent HIV by Periodontopathic Bacteria

211

3.1 Preparation of Culture Supernatant and Bacterial Cells from Periodontal Pathogens

2. Filter the culture supernatant through a 0.22-μm pore size sterilized membrane filter (use as the culture supernatant).

3.2 Stimulation Experiments (Fig. 1)

Cell lysates prepared in this section are used for detections of HIV by immunoblotting, PCR and ELISA.

3. Wash the bacterial suspension three times with PBS. 4. Standardize the bacterial suspension to 2  106 CFU/mL in 100 μL of RPMI 1640 (use as the bacterial cells) (see Note 6).

1. Prepare ACH-2 or OM10.1 cells (0.5  106 cells/mL) in 12-well plates (see Note 7). 2. Treat the cells for 48 h with culture supernatant (25–100 μL/ mL of cell culture medium), bacterial cells (0.2  106 CFU), 1–2 mM butyric acid, or 1–2 ng/mL TNF-α for 24 h (see Note 8). 3. Harvest the cells using the lysis buffer. 3.3 Viral Replication Assay 3.3.1 Immunoblotting Analysis of HIV Antigens

1. Centrifuge the lysates at 15,000  g for 20 min at 4  C. 2. Separate the supernatant proteins using SDS-PAGE. 3. Transfer the proteins to a nitrocellulose membrane. 4. Block and wash the membrane according to the usual protocol. 5. Treat the membrane overnight at 4  C with sera from a patient with AIDS. 6. Treat the washed membrane with secondary antibody for 1 h at room temperature. 7. Visualize the immune complexes using enhanced chemiluminescence (Fig. 2).

3.3.2 PCR Analysis of HIV RNA Expression

1. Extract total RNA from the lysate according to the manufacturer’s instructions. 2. Reverse transcribe 1 μg of total RNA using random primers. 3. Amplify gag and env sequences encoded by the cDNA using Taq polymerase and specific primers (see Note 9). 4. Electrophorese the PCR products through 1.5% agarose gels.

3.3.3 ELISA for Detection of the HIV Core Protein p24

The stimulatory effect of periodontopathic bacteria on cells latently infected with HIV are evaluated according to the levels of HIV-1 p 24 produced by ACH-2 and OM10.1 cells. Measure the p24 levels in cell culture supernatants using a commercially available p24 antigen-capture ELISA assay according to the manufacturer’s instructions.

212

Kenichi Imai

Culture supernatant or bacterial cells of periodontopathic bacteria Positive control䠖Butyric acid or TNF-a

Stimulation

HIV-latently infected cells 䠄ACH-2 and OM10.1 ) Cell lysate

䞉Detection of HIV antigen by immunoblot (See 3.3.1) 䞉Analysis of HIV RNA expression by PCR (See 3.3.2)

HIV-LTR transfected 293 T cells

Culture supernatant

䞉 Measurement of

Cell lysate

䞉 Measurement of

HIV p24 by ELISA (See 3.3.3)

transcriptional activity by luciferase assay (See 3.3.4)

Fig. 1 Flowchart of experiments using cells latently infected with HIV-1

p55 p41

p24 C

Fig. 2 P. gingivalis facilitates the reactivation of HIV replications (Immunoblot assay). Latent HIV-1–infected ACH-2 cells was incubated with or without TNF-α (1 ng/mL) or culture supernatants of P. gingivalis (10% v/v) for 48 h. Detection of various viral proteins in the cell lysate was performed by immunoblotting with collected sera of AIDS patients. Control bacterial culture medium was added as a control (“C”). Positions of HIV-1 proteins are indicated from the right. CSP culture supernatant of P. gingivalis

Reactivation of Latent HIV by Periodontopathic Bacteria 3.3.4 Analysis of HIV Transcription Activity by Luciferase Assay

213

1. Prepare 293T cells (2  105 cells/mL) in 12-well plates. 2. Insert 10 ng of HIV LTR reporter plasmid into the cells using a transfection reagent. 3. Treat the cells after 24 h with culture supernatant, bacterial cells, butyric acid, or TNF-α for 24 h. 4. Harvest the cells using the lysis buffer for the luciferase assay. 5. Use a luciferase assay system to measure the transcriptional activity level of the HIV LTR according to the manufacturer’s instructions (see Note 10).

4

Notes 1. The ACH-2T cell line, which is chronically infected with HIV-1, was derived from the parental cell line A3.01 and is defective for activation of the Tat-TAR axis. HIV Tat-mediated activation occurs through cytokine-induced activation of HIV-1 transcription through the host transcription factor nuclear factor-κB [14]. The OM10.1 cell line, which is chronically infected with HIV-1, was derived from the HL-60 myelomonocytic leukemic cell line containing a single integrated copy of HIV-1LAV provirus with an intact Tat-TAR axis [15, 16]. The cell lines express low levels of viral mRNA, presumably because of inhibition of transcriptional initiation. 2. To maintain the latency of HIV-1 in the cells, 20 μM AZT are added in the culture medium but was excluded prior to conducting the experiments. 3. The human embryonic kidney 293T cells used to test the transcriptional activity of the HIV-1 LTR. 4. An antibody specific for acetylated histones or sera from a patient with AIDS are used. 5. FUGENE 6 (Promega) and Lipofectamine 2000 (Thermo Fisher Scientific) are used for transfection of 293T cells. 6. The culture supernatant and bacterial cell samples are stored at 80  C until use. 7. Use a culture medium that does not contain AZT. 8. 1–2 ng/mL TNF-α and 1–2 mM butyric acid are used as indicators of HIV reactivation, which is observed approximately 12 h after stimulation. Butyric acid, which inhibits HDAC activity by competing with the HDAC substrate at the catalytic center [17, 18], stimulates the transcription of certain genes including those of HIV. P. gingivalis and F. nucleatum produce high amounts of butyric acid that inhibit HDACs [8, 9].

214

Kenichi Imai

9. The primer sequences for gag and env were as follows: gag, forward (50 -TTG CCA AAG AGT GAC CTG AGG GAA-30 ) and reverse (50 -GGG GGG ACA TCA AGC AGC CAT GC-30 ); env, forward (50 -CTT GCT CTC CAC CTT CTT CTT C-30 ) and reverse (50 -CCA ATT CCC ATA CAT TAT TGT G-30 ) [8]. 10. The data are presented as the fold-increases in luciferase activities (means  S.D.) relative to the control of three independent transfections. References 1. Pace MJ, Agosto L, Graf EH et al (2011) HIV reservoirs and latency models. Virology 411:344–354 2. Mbopi-Ke´ou FX, Be´lec L, Teo CG et al (2002) Synergism between HIV and other viruses in the mouth. Lancet Infect Dis 2:416–424 3. Chattin BR, Ishihara K, Okuda K et al (1999) Specific microbial colonizations in the periodontal sites of HIV-infected subjects. Microbiol Immunol 43:847–852 4. Scully C, Porter SR, Mutlu S et al (1999) Periodontopathic bacteria in English HIV-seropositive persons. AIDS Patient Care STDs 13:369–374 5. Maticic M, Poljak M, Kramar B et al (2000) Proviral HIV-1 DNA in gingival crevicular fluid of HIV-1-infected patients in various stages of HIV disease. J Dent Res 79:1496–1501 6. Shugars DC, Slade GD, Patton LL et al (2000) Oral and systemic factors associated with increased levels of human immunodeficiency virus type 1 RNA in saliva. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 89:432–440 7. Jotwani R, Muthukuru M, Cutler CW (2004) Increase in HIV receptors/co-receptors/α-defensins in inflamed human gingiva. J Dent Res 83:371–377 8. Imai K, Ochiai K, Okamoto T (2009) Reactivation of latent HIV-1 infection by the periodontopathic bacterium Porphyromonas gingivalis involves histone modification. J Immunol 182:3688–3695 9. Imai K, Yamada K, Tamura M et al (2012) Reactivation of latent HIV-1 by a wide variety of butyric acid-producing bacteria. Cell Mol Life Sci 69:2583–2592

10. Imai K, Okamoto T, Ochiai K (2015) Involvement of Sp1 in butyric acid-induced HIV-1 gene expression. Cell Physiol Biochem 37:853–865 11. Das B, Dobrowolski C, Shahir AM et al (2015) Short chain fatty acids potently induce latent HIV-1 in T-cells by activating P-TEFb and multiple histone modifications. Virology 474:65–81 12. Giacaman RA, Asrani AC, Gebhard KH et al (2008) Porphyromonas gingivalis induces CCR5-dependent transfer of infectious HIV-1 from oral keratinocytes to permissive cells. Retrovirology 5:1–14 13. Dong XH, Ho MH, Liu B et al (2018) Role of Porphyromonas gingivalis outer membrane vesicles in oral mucosal transmission of HIV. Sci Rep 8:8812 14. Folks TM, Powell DM, Lightfoote MM et al (1986) Induction of HTLV-III/LAV from a nonvirus-producing T-cell line: implications for latency. Science 231:600–602 15. Clouse KA, Powell D, Washington I et al (1989) Monokine regulation of human immunodeficiency virus-1 expression in a chronically infected human T cell clone. J Immunol 142:431–438 16. Butera ST, Perez VL, Wu B-Y et al (1991) Oscillation of the human immunodeficiency virus surface receptor is regulated by the state of viral activation in a CD4+ cell model of chronic infection. J Virol 65:46–55 17. Riggs MG, Whittaker RG, Neumann JR et al (1977) n-Butyrate causes histone modification in HeLa and Friend erythroleukaemia cells. Nature 268:462–464 18. Sealy L, Chalkley R (1978) The effect of sodium butyrate on histone modification. Cell 14:115–121

Chapter 21 Invasion of Gingival Epithelial Cells by Porphyromonas gingivalis Hiroki Takeuchi and Atsuo Amano Abstract Porphyromonas gingivalis is a major pathogen responsible for severe and chronic manifestations of periodontal disease, which is one of the most common infectious disorders of humans. Although human gingival epithelium prevents intrusions by periodontal bacteria, P. gingivalis is able to invade gingival epithelial cells. To study the dynamics and the fate of intracellular P. gingivalis, confocal laser scanning microscopy (CLSM) is a method of choice. Information gained with CLSM contains not only the number of P. gingivalis associated with gingival epithelial cells but also the bacterial localization on/inside the host cells, morphological change of host cells, and physical interaction between the bacteria and host organelle. In this chapter, we describe the protocols for microscopy techniques to morphologically study gingival epithelial cells infected by P. gingivalis. Key words Morphology, Confocal microscopy, Porphyromonas gingivalis, Gingival epithelial cell

1

Introduction Porphyromonas gingivalis is a major pathogen responsible for severe and chronic manifestations of periodontal disease, one of the most common infectious disorders occurring in humans. Although human gingival epithelium prevents intrusions by periodontal bacteria, P. gingivalis can invade gingival epithelial cells. To monitor the localization of P. gingivalis inside gingival epithelial cells, we often employ indirect fluorescence stain using fixed gingival epithelial cells infected with the bacteria. Because the size of P. gingivalis is approximately 1 μm in diameter, we generally use confocal microscopy, by which we are able to acquire high-resolution images. We use paraformaldehyde (PFA) to fix three dimensional association of the bacteria with cytoskeletal components and organelle of gingival epithelial cells (Fig. 1). In the case of fixation by organic solvents, morphologic changes such as host cells getting “flat” should be taken into consideration.

Keiji Nagano and Yoshiaki Hasegawa (eds.), Periodontal Pathogens: Methods and Protocols, Methods in Molecular Biology, vol. 2210, https://doi.org/10.1007/978-1-0716-0939-2_21, © Springer Science+Business Media, LLC, part of Springer Nature 2021

215

216

Hiroki Takeuchi and Atsuo Amano

Fig. 1 Confocal microscopic images of PFA-fixed IHGE cells infected with P. gingivalis. (A) IHGE cells stably expressing monomeric Cherry (mCherry)-tagged FYVE (magenta, early endosome marker) were infected with P. gingivalis at an MOI of 100 for 1 h. The cells were then fixed with PFA, stained with DAPI (cyan), and analyzed by confocal microscopy. Higher magnification of the areas indicated by the white boxes in the left panel are shown at right. Scale bar, 10 μm. Arrow, P. gingivalis in early endosome. (B) IHGE cells stably expressing enhanced green fluorescent protein (EGFP)-tagged FYVE (yellow) were infected with P. gingivalis at an MOI of 100 for 1 h. The cells were then fixed with paraformaldehyde, stained with DAPI (cyan), and analyzed by confocal microscopy. Cross-sectional higher magnification of P. gingivalis in early endosomes in the left panel are shown at right

40 ,6-diamidino-2-phenylindole (DAPI) is used to confirm the bacterial localization inside the host cells to stain bacterial DNA [1, 2]. In order to distinguish the DAPI-stained signal intensities by detecting the difference between P. gingivalis and host cytosolic components, the detectors should have high sensitivity and a dynamic range. One hour after infection, P. gingivalis stained with DAPI is confirmed in the cytosolic space of gingival epithelial cells (Fig. 2). Host cell nucleus is also stained with DAPI; however, DAPI-stained bacteria can be distinguished by their size, that is, the diameter of the rod-shaped bacteria is about 1 μm, markedly smaller than cell nucleus. In the case of staining bacteria by antibodies against P. gingivalis, false-positive signals due to nonspecific

Invasion of Gingival Epithelial Cells by Porphyromonas gingivalis

217

Fig. 2 Phalloidin staining of IHGE cells infected with P. gingivalis. IHGE cells were infected with P. gingivalis at an MOI of 100 for 1 h. The cells were then fixed, stained with DAPI (cyan) and Alexa Fluor 568-Phalloidin (magenta), and analyzed by confocal microscopy. Higher magnification of the areas indicated by the white boxes (a, b) in the upper panel are shown in the lower panel. Scale bar, 10 μm. White arrow, invading P. gingivalis. Red arrow, not invading P. gingivalis

interactions of antibodies with host cellular proteins should be taken into consideration. To discriminate intracellular P. gingivalis from the bacteria on cell surface, we basically employ the following three methods to label host cells. Phalloidin, a toxin found in Amanita phalloides, can

218

Hiroki Takeuchi and Atsuo Amano

be used to stain actin, a cytoskeletal component of cells (Fig. 2) [3]. The merit of phalloidin is that we can easily utilize fluorescent dye–conjugated peptides. Second, fluorescent protein–expressing host cells can be used to distinguish cytosol of host cells from extracellular spaces (Fig. 3) [2]. The merit of this method is that

Fig. 3 Confocal microscopic images of EGFP-expressing IHGE cells infected with P. gingivalis. IHGE cells expressing EGFP (yellow) were infected with P. gingivalis at an MOI of 100 for 1 h. The cells were then fixed, stained with DAPI (cyan), and analyzed by confocal microscopy. Higher magnification of the areas indicated by the white boxes (a, b) in the upper panel are shown in the lower panel. Scale bar, 10 μm. White arrow, invading P. gingivalis. Red arrow, not invading P. gingivalis

Invasion of Gingival Epithelial Cells by Porphyromonas gingivalis

219

Fig. 4 Confocal microscopic images of biotin-labeled IHGE cells infected with P. gingivalis. IHGE cells were infected with P. gingivalis for 1 h. The cells were then fixed, labeled with biotin, stained with DAPI (cyan) and fluorescein isothiocyanate (FITC)-streptavidin (green), and analyzed by confocal microscopy. Higher magnification of the area indicated by the white box in the upper panel are shown in the lower panel. Scale bar, 10 μm. White arrow, invading P. gingivalis. Red arrow, not invading P. gingivalis

we do not need to perform further labeling of host cells. To analyze the distribution of intracellular P. gingivalis in these two methods, we manually count the bacteria located on the inside 1 μm distant from the outermost fluorescent signal expressed by host cells. Third, biotin, a water-soluble B vitamin, can be used to label the perimeter of host cells in combination with fluorescent-conjugated streptavidin (Fig. 4) [4, 5]. The merit of this method is to easily detect extracellular bacteria by colocalization of fluorescent signals. In this chapter, we describe the protocols using gingival epithelial cells stably expressing green fluorescent protein (EGFP) to view invading P. gingivalis in host cells.

220

2

Hiroki Takeuchi and Atsuo Amano

Materials Prepare all solutions using deionized and distilled water and analytical grade reagents.

2.1

P. gingivalis

1. Bacterial strain: P. gingivalis ATCC 33277, a type strain in American Type Culture Collection (seeNote 1). 2. Blood agar plates. 3. Trypticase soy broth (TSB) medium: 30 mg/mL TSB in water supplemented with 1 mg/mL yeast extract, 5 μg/mL hemin, 1 μg/mL menadione, and 1 mg/mL L-cysteine hydrochloride. Autoclave TSB medium in a glass bottle 121  C for 15 min, cool down to room temperature, and set TSB in anaerobic jar until just before use. 4. 15 mL centrifuge tubes. 5. 1.5 mL sampling tubes. 6. Anaerobic jar. 7. Gas generators for anaerobic culture (Mitsubishi Gas Chemical). 8. Spectrophotometer. 9. UV-transparent cuvettes. 10. Incubator: Use at 37  C. 11. Centrifuge.

2.2 Gingival Epithelial Cells

1. Immortalized human gingival epithelial (IHGE) cells (epi 4) are kindly provided by Shinya Murakami (Osaka University) [6] (seeNotes 2 and 3). 2. HuMedia-KG2 (Kurabo). 3. 1.5 mL sampling tubes. 4. 15 mL centrifuge tubes. 5. 50 mL centrifuge tubes. 6. 10 cm cell culture dish. 7. 12-well culture plates. 8. Cover glass. 9. Dulbecco’s phosphate buffered saline (PBS), pH 7.4, sterilized. 10. 0.05% (w/v) trypsin–0.53 mM EDTA∙4Na solution. 11. 0.1% gelatin in PBS. 12. pEGFP-C1 (Clontech). 13. FuGENE6 (Promega). 14. Spectrophotometer.

Invasion of Gingival Epithelial Cells by Porphyromonas gingivalis

221

15. Inverted microscope. 16. Cell counting chambers. 17. Constant temperature bath. 18. CO2 incubator. 19. Clean bench. 20. Centrifuge. 2.3 Confocal Microscopy

1. Confocal laser scanning inverted microscope system (TCS SP8; Leica Microsystems). 2. Application Suite X software (Leica Microsystems). 3. Immersion liquid.

2.4

Cell Staining

1. PBS, pH 7.4, sterilized. 2. 0.1% gelatin in PBS. 3. 4% PFA in PBS. 4. 0.1% Triton X-100 in PBS. 5. DAPI. 6. Mounting medium for fluorescence. 7. Micro slide glass. 8. Incubation chamber.

3

Methods

3.1 Culturing of P. gingivalis

1. Streak out P. gingivalis from frozen glycerol stocks onto blood agar plates and grow for 3 days at 37  C under anaerobic conditions. 2. Pipet 5 mL of TSB medium into 15 mL tube and streak out P. gingivalis on blood agar plates into TSB medium. 3. Incubate bacteria in culture medium at 37  C under anaerobic conditions for 24–48 h until bacteria reach their peak infectivity (final OD600 ¼ 2.0).

3.2 Culturing of IHGE Cells

1. Maintain IHGE cells in HuMedia KG-2 in 10 cm cell culture dishes. 2. For preparation of bacterial infection, remove spent medium from a growing culture, wash cells with PBS, and add 1 mL of trypsin. 3. Once the cells appear detached, add 2 mL of HuMedia KG-2 to inactivate trypsin. 4. Transfer the cell suspension to the 15 mL tube and gently centrifuge at 300  g for 5 min.

222

Hiroki Takeuchi and Atsuo Amano

5. After removing the supernatant, gently resuspend the cell pellet in HuMedia KG-2. 6. Set a cover glass in the wells of a 12-well plate and coat the glass with 0.1% gelatin in PBS for 20 min at room temperature. 7. Remove 0.1% gelatin in PBS and seed approximately 8  104 IHGE cells on cover glass. 8. Twenty-four hours after seeding, transfect IHGE cells with pEGFP-C1 plasmid using FuGENE 6 according to the manufacturer’s protocol. 3.3 Infection of Cells with P. gingivalis

1. 48–72 h after transfection, infect IHGE cells with P. gingivalis at a multiplicity of infection (MOI) of 100 in 12-well culture plates for 1 h at 37  C in 5% CO2 (seeNote 4). 2. One hour after infection, wash IHGE cells twice with PBS to remove external nonadherent bacteria.

3.4 Analysis Using Confocal Microscopy

1. Fix IHGE cells with 4% PFA in PBS for 10 min at room temperature, permeabilize cells with 0.1% Triton X-100 in PBS for 5 min at room temperature, and block cells with 0.1% gelatin in PBS for 20 min at room temperature (seeNote 5). 2. Dilute DAPI 1:400 in PBS. Incubate cells with dye for 1 h at room temperature, followed by washes twice in PBS. 3. Mount cells onto glass slides using mounting medium for fluorescence to label the bacterial and cellular DNA. 4. Acquire images with a confocal laser microscope using a 64 oil-immersion object lens with a numerical aperture of 1.4. Analyze images using the Application Suite X software (seeNote 6).

4

Notes 1. We confirmed that KDP133 (P. gingivalis ΔrgpA ΔrgpB [7]) almost lacks the ability to invade IHGE cells (Fig. 5). We also confirmed that KDP129 (P. gingivalis Δkgp [8]) is capable of invading IHGE cells. These results suggest that P. gingivalis ΔrgpA ΔrgpB, but not Δkgp, can be used for negative control for assays of P. gingivalis invasion into gingival epithelial cells. 2. To analyze the effect of your target gene of gingival epithelial cells on bacterial invasion, knockdown and knockout systems are well worth considering. IHGE cells are useful in that we are able to transfect cells with exogenous genes, including protein expressing vector, small interfering RNA, and small hairpin RNA [9]. We confirmed that CRISPER-Cas9 system can also be used with IHGE cells.

Invasion of Gingival Epithelial Cells by Porphyromonas gingivalis

223

Fig. 5 Confocal microscopic images of IHGE cells infected with P. gingivalis WT, Δkgp, or ΔrgpA ΔrgpB mutant. IHGE cells expressing EGFP (yellow) were infected with P. gingivalis WT, Δkgp, or ΔrgpA ΔrgpB mutant at an MOI of 100 for 1 h. The cells were then fixed, stained with DAPI (cyan), and analyzed by confocal microscopy. Scale bar, 10 μm. White arrow, invading P. gingivalis. Red arrow, not invading P. gingivalis

3. The telomerase immortalized human gingival keratinocyte (hTERT TIGKs, CVCL_M095, ATCC) can also be used to analyze the intracellular localization of P. gingivalis [1, 10]. 4. IHGE cells not infected with P. gingivalis should also be prepared to adjust the laser power and to set the condition of the detector. We confirmed that gingival epithelial cells have autofluorescence but much weaker than the fluorescence of DAPI-stained P. gingivalis. A comparison between infection and no infection is needed to acquire appropriate images.

224

Hiroki Takeuchi and Atsuo Amano

5. We confirmed that necessary and sufficient treatment of fixed cells by detergents is needed to eliminate background fluorescent signal in cytosolic space and to acquire a sharp image of DAPI-stained P. gingivalis. 6. To confirm our observations of bacterial invasion, scan a z series with 0.4 μm intervals. To detect intracellular P. gingivalis in, change the contrast of confocal microscopic images as described previously [2]. Briefly, count bacteria located inside of IHGE cells as intracellular P. gingivalis, but do not count bacteria on the marginal region or outside of IHGE cells (Fig. 3).

Acknowledgments We thank the Center for Oral Science, Graduate School of Dentistry, Osaka University for technical support with confocal laser microscopy. This research was supported by Scientific Research (C) Grant Number 19K10085 (to H.T.) and Scientific Research (A), Grant Number 18H04068 (to A.A.) from the Japan Society for the Promotion of Science. References 1. Takeuchi H, Hirano T, Whitmore SE et al (2013) The serine phosphatase SerB of Porphyromonas gingivalis suppresses IL-8 production by dephosphorylation of NF-κB RelA/ p65. PLoS Pathog 9(4):e1003326 2. Nakagawa I, Amano A, Mizushima N et al (2004) Autophagy defends cells against invading group A Streptococcus. Science 306 (5698):1037–1040 3. Furuta N, Takeuchi H, Amano A (2009) Entry of Porphyromonas gingivalis outer membrane vesicles into epithelial cells causes cellular functional impairment. Infect Immun 77 (11):4761–4770 4. Tsuda K, Amano A, Umebayashi K et al (2005) Molecular dissection of internalization of Porphyromonas gingivalis by cells using fluorescent beads coated with bacterial membrane vesicle. Cell Struct Funct 30(2):81–91 5. Furuta N, Tsuda K, Omori H et al (2009) Porphyromonas gingivalis outer membrane vesicles enter human epithelial cells via an endocytic pathway and are sorted to lysosomal compartments. Infect Immun 77 (10):4187–4196 6. Murakami S, Yoshimura N, Koide H et al (2002) Activation of adenosine-receptor-

enhanced iNOS mRNA expression by gingival epithelial cells. J Dent Res 81(4):236–240 7. Nakayama K, Kadowaki T, Okamoto K et al (1995) Construction and characterization of arginine-specific cysteine proteinase (Arg-gingipain)-deficient mutants of Porphyromonas gingivalis. Evidence for significant contribution of Arg-gingipain to virulence. J Biol Chem 270(40):23619–23626 8. Okamoto K, Nakayama K, Kadowaki T et al (1998) Involvement of a lysine-specific cysteine proteinase in hemoglobin adsorption and heme accumulation by Porphyromonas gingivalis. J Biol Chem 273(33):21225–21231 9. Takeuchi H, Sasaki N, Yamaga S et al (2019) Porphyromonas gingivalis induces penetration of lipopolysaccharide and peptidoglycan through the gingival epithelium via degradation of junctional adhesion molecule 1. PLoS Pathog 15(11):e1008124 10. Moffatt-Jauregui CE, Robinson B, de Moya AV et al (2013) Establishment and characterization of a telomerase immortalized human gingival epithelial cell line. J Periodontal Res 48(6):713–721

Chapter 22 Analysis of Interaction Between Porphyromonas gingivalis and Endothelial Cells In Vitro Kenji Matsushita Abstract Chronic periodontitis is the most common periodontitis observed in adults. Recently, its association with systemic diseases such as ischemic heart–brain disease and diabetes has been pointed out. Porphyromonas gingivalis, a major causative bacterium of chronic periodontitis, has properties of adhering to blood vessels and inducing inflammation, and those properties are involved in the induction of vascular inflammation and promotion of atherosclerosis. Therefore, analysis of the interaction of P. gingivalis with vascular endothelial cells will contribute to an understanding of the link between periodontitis and vascular lesions. Key words Periodontitis, Porphyromonas gingivalis, E-Selectin, Exocytosis, Nitric oxide, von Willebrand factor

1

Introduction Pathogenic bacteria exhibit virulence by attaching to and invading and parasitizing host cells. Bacteria that enter cells have resistance to the host’s immune system and antibiotics [1, 2]. They can also use the nutrients in cells and survive there. Thus, bacterial invasion into host cells is an important process for bacterial survival. There are two major processes in the invasion process: attachment to the host cell and subsequent internalization into the host cell. In the process of attachment, it is important that the ligand and its receptor are present on the bacterial side and the host cell side, and the increase or decrease of these molecules greatly affects the adhesion between the bacterium and the host cell. Porphyromonas gingivalis is considered to be a major pathogen of adult periodontitis. It has also been pointed out that it is related to systemic diseases such as ischemic diseases [3, 4]. This bacterium is frequently detected in atherosclerotic plaques of the arterial wall [5, 6]. The bacterium also is frequently detected in a sample of a limb occluded artery in patients with Buerger disease [7]. P. gingivalis specifically binds to E-selectin expressed on the surface of

Keiji Nagano and Yoshiaki Hasegawa (eds.), Periodontal Pathogens: Methods and Protocols, Methods in Molecular Biology, vol. 2210, https://doi.org/10.1007/978-1-0716-0939-2_22, © Springer Science+Business Media, LLC, part of Springer Nature 2021

225

226

Kenji Matsushita

vascular endothelial cells and attaches to vascular endothelial cells [8]. It has been suggested that this leads to the colonization of P. gingivalis on the blood vessel wall and the subsequent induction of an inflammatory response. An in vitro analysis of P. gingivalis and vascular endothelial cells, their attachment and invasion, and the induction of vascular inflammation are outlined in this chapter.

2

Materials

2.1 Bacterial Strains and Growth Conditions

1. Bacteria: P. gingivalis ATCC 33277 and P. gingivalis W83 (ATCC BAA-308) from American Type Culture Collection. 2. Brucella HK agar with blood (BHK-Blood agar): Brucella HK agar (Kyokuto Pharmaceutical Industrial Co., Ltd.) supplemented with 5% laked rabbit blood, degassed (see Note 1). 3. Trypticase soy broth (TSB): Trypticase soy broth (BD) supplemented with 2.5 mg/mL yeast extract, 2.5 μg/ mL hemin, 5 μg/mL menadione, and 0.1 mg/mL dithiothreitol. 4. Anaerobic jar and anaerobic bag (Mitsubishi Gas Chemical). 5. Incubator. 6. 50-mL centrifuge tube. 7. Centrifuge. 8. Phosphate buffered saline (PBS), pH 7.4: Store at 4
C. 9. Phenol red-free Dulbecco’s Modified Eagle’s Medium (DMEM).

2.2 Cells and Culture Conditions

1. Human umbilical (Cambrex).

vein

endothelial

cells

(HUVECs)

2. Human aortic endothelial cells (HAECs) (Cambrex). 3. Endothelial Growth Medium 2 (EGM-2) with a Bullet kit supplements: Provided from Lonza, which is supplemented with a Bullet kit supplement containing growth factors and cytokines (Lonza) and with 2% fetal bovine serum (FBS). Gentamicin and amphotericin-B are also added. 4. Phenol red-free DMEM. 5. Cell dissociation solution: PBS containing 0.25% trypsin and 1 mM ethylenediaminetetraacetic acid (EDTA), pH 7.4. 6. 100-mm tissue culture dish. 7. CO2 incubator. 2.3 P. gingivalis Adherence to Endothelial Cells

1. Tumor necrosis factor-α (TNF-α) stock: recombinant human TNF-α (PeproTech Inc.). Store at 80
C (see Note 2).

Analysis of Interaction Between Porphyromonas gingivalis. . .

227

2. Lab-Tek II chamber slide (Nalge Nunc International). 3. Cell coating buffer: PBS supplemented with 50 μg/mL rat tail collagen (BD). 4. 4% (w/v) paraformaldehyde. 5. Permeabilizing buffer: PBS containing 0.05% Triton X-100. 6. PBS containing 5% (w/v) bovine serum albumin (BSA). 7. Antiserum to P. gingivalis whole cells. 8. Alexa Fluor 488-conjugated (Invitrogen Co.).

goat

anti-rabbit

IgG

9. Alexa Fluor 568-conjugated phalloidin (Invitrogen Co.). 10. ProLong Gold antifade reagent (Invitrogen Co.). 11. Fluorescence microscopy (Keyence Co.). 2.4 P. gingivalis Invasion into Endothelial Cells

1. 12-well flat-bottom culture plate. 2. Phenol red–free DMEM containing 200 mg/mL metronidazole and 300 mg/mL gentamicin (see Note 3). 3. Sterile distilled water. 4. BHK-Blood agar (see item 2 in Subheading 2.1).

2.5 P. gingivalisInduced NO Production

1. 12-well flat-bottom culture plate. 2. 96-well plate. 3. 2,3-diaminonapthalene (DAN) reagent (Sigma Chemical), which is dissolved in 0.62 N HCl at a concentration of 0.05 mg/mL just before conducting the experiment. 4. Sodium nitrite. 5. Luminescence spectrometer.

2.6 P. gingivalisInduced vWF Release

1. 24-well plate. 2. 50 ng/mL TNF-α (see item 1 in Subheading 2.3). 3. von Willebrand factor (VWF) ELISA kit (American Diagnostic Inc.). 4. Spectrophotometer.

3

Methods

3.1 Bacterial Cell Culture

1. Inoculate P. gingivalis on BHK-Blood agar into TSB and grow for 2 days in an anaerobic jar until OD 660 nm reaches 1.0. 2. Transfer the bacterial culture to a 50-mL centrifuge tube and centrifuge at 3000  g for 10 min at 4
C. 3. Aspirate the supernatant. 4. Resuspend gently with cold PBS.

228

Kenji Matsushita

5. Repeat steps 5–7 three times. 6. Resuspend bacterial cells in phenol red-free DMEM. 3.2 Endothelial Cell Culture

1. Culture HUVECs or HAECs in EGM-2 medium with the Bullet kit supplements in 100-mm tissue culture dish in CO2 incubator. 2. Change the growth medium the day after seeding and then every other day. 3. Passage the cells using cell dissociation solution. The cells are used usually between five and ten passages in all experiments. 4. Phenol red-free DMEM (without antibiotics) is added to HUVECs or HAECs before they are treated with P. gingivalis.

3.3 Analysis of P. gingivalis Adhesion to Endothelial Cells

1. Add the cell coating buffer to Lab-Tek II chamber to coat the chamber with a collagen. 2. After discarding the cell coating buffer, seed 100 μL of HUVECs or HAECs (2  106 cells) in the Lab-Tek II chamber. 3. Incubate for 24 h in a CO2 incubator. Confirm that the cells have grown to almost full confluency in each well. 4. Add 25 μL of 50 ng/mL TNF-α to the wells (see Note 4). 5. Incubate for 3 h in a CO2 incubator. 6. Add P. gingivalis cells (108 cells/mL) to the HUVEC monolayer cells at an MOI of 1:100. 7. Incubate the cells for 0.5–3 h in a CO2 incubator. 8. Wash each well with 100 μL of PBS three times by gentle rinsing for 5 min at room temperature. 9. Fix the cells with 50 μL of 4% (w/v) paraformaldehyde at 4
C overnight. 10. Gently wash the cells three times with PBS. 11. Permeabilize the cells with 100 μL of permeabilizing buffer at room temperature for 30 min. 12. Wash the cells once with 100 μL of PBS. 13. Block with 100 μL of PBS containing 5% (w/v) BSA at room temperature for 30 min. 14. Add an antiserum for P. gingivalis whole cells (1:1000 dilution with PBS) in each well for 60 min at room temperature. 15. Wash the cells five times with 100 μL of PBS. 16. Incubate with Alexa Fluor 488–conjugated goat anti-rabbit IgG (1:1000 dilution with PBS) and 1 μg/mL Alexa Fluor 568-conjugated phalloidin for 60 min at room temperature in the dark.

Analysis of Interaction Between Porphyromonas gingivalis. . .

P. gingivalis

TNF-a (-) 0.5 h TNF-a (+) 0.5 h

TNF-a (-) 1h TNF-a (+) 1h

Actin

Overlay

B 6000

Number of P. gingivalis cells

A

5000

*

TNF-a (-) TNF-a (+)

4000

*

3000 2000

*

1000 0

TNF-a (-) 3h

229

30 min 0.5

1h 1

33h

Time after addition (h)

TNF-a (+) 3h

Fig. 1 Adherence of P. gingivalis to HUVECs is enhanced by stimulation with TNF-α. (a) HUVECs were incubated with TNF-α (10 ng/mL) for 0.5–3 h. P. gingivalis ATCC 33277 cells (108 cells/mL in each well) were then added to the culture medium for 0.5–3 h. Cells were then washed, and attachment of P. gingivalis to the cells was observed by fluorescence microscopy. P. gingivalis was stained with Alexa Fluor 488 (green), and actin of endothelial cells was visualized with Alexa Fluor 568 (red). (b) HUVECs were incubated with TNF-α (10 ng/mL) for 0.5–3 h. P. gingivalis ATCC 33277 cells (108 cells/mL in each well) were then added to the culture medium for 0.5–3 h. Cells were then washed, and attachment of P. gingivalis to the cells was observed by fluorescence microscopy. The attachment levels are expressed as numbers of P. gingivalis cells per 60,430 mm2 (means  standard deviations [SD] [n ¼ 3]). *P < 0.01 versus no TNF-α (Modified from Ref. 6)

17. Gently wash ten times with 100 μL of PBS. 18. Mount chamber slides onto a slide containing ProLong Gold antifade reagent. 19. Photograph adherent bacteria (stained with Alexa 488) on the cell surface in three or selected fields of view in each well by fluorescent microscopy. (An example of fluorescent microscopy to detect bacterial adhesion to endothelial cells is shown in Fig. 1.) 3.4 P. gingivalis Invasion into Endothelial Cells

1. Seed HUVECs or HAECs in a 12-well flat-bottom culture plate at a cell density of 2.0  105 cells/well. 2. Incubate overnight. Confirm that the cells have grown to almost full confluency in each well.

230

Kenji Matsushita

3. Add a P. gingivalis suspension (2.0  107 cells/ well) to each well (MOI ¼ 1:100). 4. Incubate at 37
C in a CO2 incubator for 2 h. 5. Wash gently with PBS three times to remove unattached bacteria. 6. Add phenol red-free DMEM containing 200 mg/mL of metronidazole and 300 mg/mL of gentamicin. 7. Incubate in a CO2 incubator for 1 h. 8. Wash gently with PBS twice. 9. Add 1 mL of sterile distilled water per well (see Note 5). 10. Repeat pipetting for 1 min under an aerobic condition. 11. Dilute lysates and plate on BHK-Blood agar and then incubate anaerobically at 37
C for 10 days. 12. Count the number of bacterial colonies on BHK-Blood agar. 13. Express invasion efficiency as the percentage of the initial inoculum recovered after antibiotic treatment and endothelial cell lysis. 3.5 P. gingivalisInduced NO Production

1. Seed HUVECs or HAECs in a 12-well flat-bottom culture plate with 500 μL of phenol red–free DMEM (see Note 5) at a cell density of 3.5  105 cells/well. 2. Incubate overnight. Confirm that the cells have grown to almost full confluency in each well. 3. Add a P. gingivalis suspension to each well (MOI ¼ 1:100). 4. Incubate at 37
C in a CO2 incubator for 30 min. 5. Collect 100 μL of the culture supernatant in each well and apply to a 96-well plate in triplicate. 6. Add 10 μL of DAN reagent to each well. 7. Leave at room temperature for 10 min. 8. Read the plate on a luminescence spectrometer (excitation 360 nm, emission 440 nm) (see Notes 6 and 7). 9. Make standard curves daily with sodium nitrite ranging from 0.04 to 10 μM in phenol red-free DMEM. (An example of using ELISA to measure NO production is shown in Fig. 2.)

3.6 P. gingivalisInduced vWF Release

1. Plate HUVECs or HAECs in a 24-well plate with 250 μL medium per well. 2. Grow overnight. 3. Make sure the cells are confluent the next morning. 4. Change the medium to prewarmed EGM-2 medium without serum and without Bullet kit supplements (see Notes 8 and 9).

Analysis of Interaction Between Porphyromonas gingivalis. . .

25

TNF-a (-)

NO2- (mmol/l)

*

TNF-a (+)

20

231

15 10 5

0 P. gingivalis Anti-E-selectin Abs

-1 -

+2 -

+3 +

-4 +

Fig. 2 P. gingivalis–induced nitric oxide release from activated endothelial cells is mediated by E-selectin. HUVECs were incubated with TNF-α (10 ng/mL) for 3 h. Cells were then washed and incubated with P. gingivalis ATCC 33277 (108 cells/mL in each well) for 30 min in the presence or absence of an antibody for E-selectin. The release of nitric oxide into the medium was measured by a DAN assay. Data are means  standard deviations [SD] [n ¼ 3]. *P < 0.01 versus no TNF-α (Reprinted from Ref. 6)

5. Add 25 μL of 50 ng/mL TNF-α and incubate for 3 h in a CO2 incubator (see Note 4). 6. Add a suspension of P. gingivalis to each well of TNF-α-treated endothelial cells at an MOI of 100. 7. Incubate for 30–60 min. 8. Harvest the supernatant. 9. Add the supernatant to VWF ELISA kit and add cell media standards. Watch the assay carefully; the moment the color of any sample turns blue, stop the entire assay with a stop buffer. 10. Measure the OD at 450 nm in a spectrophotometer. (An example of using ELISA to measure VWF release is shown in Fig. 3.)

4

Notes 1. Degassing: Use a hardened agar medium that has been left for one day in an anaerobic environment such as in an anaerobic jar. 2. TNF-α stocks are defrosted, and then the excess is discarded. The defrosted stocks never refrozen or rethawed. 3. This concentration of the antibiotic was sufficient to completely kill 108 bacteria/mL in 1 h. 4. TNF-α induces E-selectin expression on endothelial cells and increases adherence of P. gingivalis to endothelial cells [8].

232

Kenji Matsushita

4 TNF-a (-)

+TNF-a (+)

vWF (mU/ml)

3

2

1

0

0

0.5

1

Time (h) Fig. 3 Endothelial VWF exocytosis in response to P. gingivalis is augmented by pretreatment with TNF-α. HUVECs were incubated with TNF-α (10 ng/mL) for 3 h. Cells were then washed and incubated with P. gingivalis ATCC 33277 (108 cells/mL in each well) for 0–1 h. The release of VWF into the medium was measured by ELISA. Data are means  SD (n ¼ 3) (Reprinted from Ref. 6)

5. This process is for lysing endothelial cells. 6. The production level of NO varies depending on the cell lot or passage number. Therefore, preliminary experiments need to be performed to determine the conditions that produce a higher level of NO. 7. If you want to measure both NO2 and NO3 concentrations, reduce NO3 in the culture medium to NO2 with nitrate reductase (14 mU) and NADPH (40 μM) at room temperature for 5 min [9]. Collect media and perform the DAN assay as described in text. 8. Media were void of any interfering components such as dithiothreitol, protein, FBS, phenol red, and hemoglobin. 9. Do not shake cells or move plates quickly because sudden movements will cause VWF release. References 1. Finlay BB, Falkow S (1989) Common themes in microbial pathogenicity. Microbiol Rev 53 (2):210–230 2. Isberg RR (1991) Discrimination between intracellular uptake and surface adhesion of bacterial pathogens. Science 252(5008):934–938

3. Garcia RI, Henshaw MM, Krall EA (2001) Relationship between periodontal disease and systemic health. Periodontology 25:21–36 4. Seymour GJ, Ford PJ, Cullinan MP et al (2009) Infection or inflammation: the link between

Analysis of Interaction Between Porphyromonas gingivalis. . . periodontal and cardiovascular diseases. Futur Cardiol 5(1):5–9 5. Kozarov EV, Dorn BR, Shelburne CE et al (2005) Human atherosclerotic plaque contains viable invasive Actinobacillus actinomycetemcomitans and Porphyromonas gingivalis. Arterioscler Thromb Vasc Biol 25(3):e17–e18 6. Mougeot JC, Stevens CB, Paster BJ et al (2017) Porphyromonas gingivalis is the most abundant species detected in coronary and femoral arteries. J Oral Microbiol 9(1):1281562

233

7. Iwai T, Inoue Y, Umeda M et al (2005) Oral bacteria in the occluded arteries of patients with Buerger disease. J Vasc Surg 42(1):107–115. https://doi.org/10.1016/j.jvs.2005.03.016 8. Komatsu T, Nagano K, Sugiura S et al (2012) E-selectin mediates Porphyromonas gingivalis adherence to human endothelial cells. Infect Immun 80(7):2570–2576 9. Kleinhenz DJ, Fan X, Rubin J et al (2003) Detection of endothelial nitric oxide release with the 2,3-diaminonapthalene assay. Free Radic Biol Med 34(7):856–861

Part IV Animal Model of Periodontitis

Chapter 23 Analysis of Experimental Ligature-Induced Periodontitis Model in Mice Hikaru Tamura, Tomoki Maekawa, Takumi Hiyoshi, and Yutaka Terao Abstract Periodontitis is one of the most prevalent chronic inflammatory diseases in humans. However, the disease has been hard to study, majorly because it has been difficult to establish a reproducible animal model. Nonetheless, the ligature-induced periodontitis model in rodent has shown some promise. Here we describe a simplified systematic method to analyze periodontal pathogenesis using quantitative polymerase chain reaction, immunohistochemistry, and bone phenotype in ligature-induced periodontitis murine model. We provide detailed experimental methods and also provide notes that will help to carry out the procedure successfully. Key words Periodontitis, Ligature-induced periodontitis, Inflammation, Animal model, Bone resorption

1

Introduction Periodontitis is the most prevalent chronic inflammatory disease in humans. Although gram-negative anaerobic bacteria have been related to clinical periodontal disease, particularly pocket depth and bleeding on probing [1], it has been difficult to establish a reproducible animal model, largely because these bacteria exert pathogenicity only in humans. Furthermore, the concept of microbial specificity in the etiology of periodontal diseases has been widely suggested, and different forms of periodontal disease have been associated with qualitatively distinct dental plaques [2]. Nonetheless, several animal models for periodontal disease have been used in the study of periodontal pathogenesis and potential therapeutic approaches. Oral inoculation periodontitis model established by Baker et al. [3] was widely used in mice study. However, oral gavage model needs at least 24 weeks to initiate bone loss induced by periodontitis [4]. In this regard, the ligature-induced periodontitis model causes bone loss within a few days. Inoculation of oral bacteria can affect not only local gingiva, but also change the

Keiji Nagano and Yoshiaki Hasegawa (eds.), Periodontal Pathogens: Methods and Protocols, Methods in Molecular Biology, vol. 2210, https://doi.org/10.1007/978-1-0716-0939-2_23, © Springer Science+Business Media, LLC, part of Springer Nature 2021

237

238

Hikaru Tamura et al.

gut microbiota composition, which is associated with impaired gut barrier function [5]. Such oral bacteria have been suggested to become systemic via periodontitis and directly affect other organs [6, 7]. The ligature model also exhibits systemic dissemination of oral bacteria. Bacterial colony formation was found in a culture of liver and spleen cells after persistent ligature placement. Interestingly, the extractions of those infected tooth inhibited systemic dissemination of oral bacteria and local inflammation in oral mucosa [8]. Therefore, it is considered that the ligature-model could mimic human periodontitis as well as oral inoculation model in mouse. In addition, tooth ligation models can also be used to investigate the influence on systemic diseases such as atherosclerosis, diabetes and rheumatoid arthritis. It has been developed in rodent [9] (mice and rat) or nonhuman primate [6, 10]. Here, we show a simplified and systematic method to analyze periodontal pathogenesis using quantitative polymerase chain reaction (qPCR), immunohistochemistry, and bone phenotype in ligature-induced periodontitis model in mice.

2 2.1

Materials Animals

1. BALB/c mice, male or Nihon CLEA.

female, 6- to 12-week-old:

2. C57BL/6NCrl mice male or female, 6- to 12-week-old: Charles river. 2.2

Ligation

1. A 5–0 silk suture. 2. Forceps Perry 13 cm, curved. 3. Micro forceps 11.5 cm, No. 5 angle. 4. Suture-tying forceps. 5. Dumont Mini Forceps. 6. Vannas scissors (spring type) (Fig. 1). 7. Flexible-arm dissection light. 8. Needle (26-G). 9. A 3–0 silk suture. 10. Rubber band. 11. Styrene foam 30 cm
20 cm. 12. Isoflurane. 13. NARCOBIT-E type II (inhalation anesthesia apparatus): Natsume Seisakusho (Fig. 2a). 14. Dedicated inhalation anesthesia basket (Fig. 2b).

Ligature-Induced Periodontitis Mice Model

239

Fig. 1 Tools for ligature model in mice. From left to right, 5–0 Silk suture, forceps (Perry) Curved, micro forceps, Suture-tying forceps, Dumont Mini Forceps, Vannas shears (spring type)

Fig. 2 (a) Inhalation anesthesia device. NARCOBIT-E type II: Natsume Seisakusho (Tokyo, Japan). (b) Dedicated inhalation anesthesia basket for induction of anesthesia 2.3

Microinjection

1. Hamilton micro syringe 701RN (Fig. 3). 2. Forceps (Perry) 13 cm curved: Bioresearch Center (Fig. 3). 3. Flexible-arm dissection light. 4. Isoflurane.

240

Hikaru Tamura et al.

Fig. 3 (a) Tools for microinjection. From left to right, forceps (Perry) Curved, Hamilton micro syringe 701RN. (b) Enlarged view of the needle tip of Hamilton micro syringe 701RN

5. NARCOBIT-E type II (inhalation anesthesia apparatus): Natsume Seisakusho. 6. Dedicated inhalation anesthesia basket. 2.4

Bone Analysis

1. Micro forceps 11.5 cm No. 5 angle. 2. Dumont mini forceps. 3. Scissors. 4. Centrifuge tube. 5. Autoclave. 6. Hydrogen peroxide. 7. Ultrasonic cleaning. 8. Clay (see Note 1). 9. Leica EZ4W (Stereoscopic microscope): Leica Microsystems. 10. Methylene Blue Hydrate. 11. CosmoScan GX (high-resolution micro scanner): Rigaku Corporation (Fig. 4).

2.5

Tissue Analysis

1. 4% paraformaldehyde (PFA, pH 7.4). 2. Decalcifying solution B (EDTA, pH 7.5). 3. Optimal cutting temperature compound.

Ligature-Induced Periodontitis Mice Model

241

Fig. 4 High-resolution micro scanner CosmoScan GX (Rigaku Corporation, Tokyo, Japan)

4. Cryostat. 5. Dumont mini forceps. 6. Microtome blade (C35 type). 7. Liquid nitrogen. 8. Aluminum foil (see Note 2). 2.6 Molecular Analysis

1. 15C scalpel blades. 2. Dish (internal diameter 8.5 cm). 3. All Prep DNA/RNA Mini Kit: Qiagen. 4. SuperScript VILO IV Mastermix: Thermo Fisher scientific, store at 20  C. 5. 1.5 mL tube. 6. Spectrometer.

242

2.7

Hikaru Tamura et al.

Bacteria Analysis

1. Phosphate buffered saline (PBS). 2. 1.5 mL tube. 3. Vortex mixer. 4. Blood agar plate (Sheep). 5. Bacteria spreader. 6. AnaeroPack Kenki: SUGIYAMA-GEN CO., LTD. 7. AnaeroPack square jar: SUGIYAMA-GEN CO., LTD.

3

Methods

3.1

Breeding

C57BL/6NCrl mice or BALB/c mice are maintained in individually ventilated cages and provided sterile food and water ad libitum under specific pathogen-free conditions. It is recommended to use male BALB/c mice because the alveolar bone resorption response is most obvious in it [11–13]. All animal experiments are approved by the Institutional Animal Care and Use Committee of each University.

3.2

Ligation

1. NARCOBIT-E type II is used according to the instructions. In short, add the isoflurane, turn on the machine, and set the flow rate. Place the mouse in a dedicated inhalation anesthesia basket filled with isoflurane for 5 min. 2. After the anesthesia, mount the mouse for ligation. For mounting, place the mouse on the styrene foam on the back and stick a 26-G needle in both ears for fixing. Subsequently, switch the inflow of inhalation anesthetic to the tube, and apply the tube to the mouse’s nose (see Note 3). 3. Hook the maxillary anterior teeth with a rubber band applied to styrene foam. Attach the 3–0 silk suture to the hand of the two needles and hook the suture on the mandibular anterior teeth. One needle is stuck at ~1 cm from the mouse neck, and the other needle is stuck at ~2 cm from tip of the tail, while pulling the mandibular anterior teeth firmly with a silk suture until the mouth is fully opened (Fig. 5). 4. Cut the 5–0 suture in 10 cm and hold at 1 cm from the end using the tip of forceps. Press the tip of the forceps against the interdental region of the third molar and the second molar, and hold and press the suture into the interdental region using the other forceps (see Note 4) (Fig. 6b). 5. Hold the suture with the tip of forceps and press against the interdental region of the second molar and the first molar, and hold and press the suture into the interdental region using the other forceps (see Note 5) (Fig. 6c).

Ligature-Induced Periodontitis Mice Model

243

Fig. 5 Picture of mouse mounted for ligation. Stick a needle in both ears and put a rubber band on the upper front teeth. Pull and fix the mandible front teeth with silk thread with ends tied to the needle

6. Pull the suture firmly and tie the square knot tight (see Note 6). 7. Cut excess suture from the knot with a scissors (Fig. 6d). 3.3

Microinjection

1. After anesthesia, mount the mouse and open its mouth (see steps 1–3 in Subheading 3.2). 2. Microinject into the palatal gingiva with Hamilton micro syringe. The insertion position should be approximately 3 mm from palatal side of the first molar, and the needle tip is advanced to the second molar palatal gingiva as it slides over the palatal bone (see Note 7). 3. Inject slowly so as to penetrate compound into the entire palate gingiva on one side (see Note 8) (see Fig. 7).

3.4

Bone Analysis

1. Mount and open mouth immediately after sacrificing. Remove the suture and cut it approximately 4 mm with a scissors. Put the cut suture into a 1.5 mL tube containing 1 mL PBS (see Subheading 2.7). 2. Cut the neck, and then stick the 26-G needle in both ears and nose for mounting. Start cutting from both angle of the mouth

244

Hikaru Tamura et al.

Fig. 6 (a) The maxillary molars of the mouse. (b) Pass the 5–0 silk suture through interdental area between second molar and third molar with micro forceps (no. 5 angle) and Dumont Mini Forceps. (c) Pass the 5–0 silk suture through interdental area between first molar and second molar with micro forceps (no. 5 angle) and Dumont Mini Forceps. (d) Pull the suture firmly and tie square knot tight with Suture-tying forceps. Cut excess suture from the knot with a scissors

Fig. 7 Trypan blue infusion. Due to the palatine suture, the injected reagent remains on one side

Ligature-Induced Periodontitis Mice Model

245

Fig. 8 (a) The sampling gingival area on the ligature side (red line), and the un-ligated side (blue line). Cut out the gingiva of the part surrounded by a line with 15C scalpel blades and Dumont Mini Forceps. (b) The gingiva can be collected in one set as shown

and advance parallel to the occlusal surface, resulting in complete opening. Remove the mandibula with scissors and stick it with a needle for mounting, such that the maxillary molars can be seen clearly. 3. Cut the palatal gingiva from the third molar to the first molar, which was surrounded by the line as shown in Fig. 8, with 15C blades and collect in a dish containing fluid of the All Prep DNA/RNA Mini Kit (see Note 9) (see Subheading 2.6). 4. Put the head in a beaker of water, cover with aluminum foil and autoclave at 121  C for 8 min. This makes it easy to remove the soft tissue attached to the bone. 5. After autoclaving, get rid of the skin and remove the excess loose soft tissue with fingers. Remove the mandibula and cranial bone with scissors and forceps for separating the maxilla (Fig. 9a). 6. Completely remove the soft tissue attached to the maxillary bone and place the maxillary bone in a test tube containing 2 mL hydrogen peroxide; subject it to ultrasonic cleaning for 15 min. Then, store it at 4  C, overnight in a hydrogen peroxide (Fig. 9b). 7. Wash the hydrogen peroxide solution with distilled water (DW) and dry it. 8. Soak sample in methylene blue in a petri dish for 1 min. Then, wash the sample with sufficient DW until excess stain is cleared (Fig. 9c). 9. Check for remaining soft tissue in teeth and alveolar bone using a microscope; if present, remove gently with a toothbrush and dry at room temperature (Fig. 9d).

246

Hikaru Tamura et al.

Fig. 9 (a) After autoclaving, excess soft tissue was removed from the maxilla. (b) It was then soaked in hydrogen peroxide, rinsed for 15 min with an ultrasonic cleaner, and soaked overnight. (c) Then, it was immersed in 5% trypan blue for 1 min and washed with distilled water. (d) Soft tissue and dirt were carefully removed using a toothbrush. (e) A lump of clay slightly larger than the sample. (f) Fix the sample arcus zygomaticus into the clay

Ligature-Induced Periodontitis Mice Model

247

Untreated

0.5

0.5

0.5

0.5

0.5

0.5

Ligated + PBS

Ligated + REP

Fig. 10 Representative image of a bone specimen. Representative images of 3D reconstructed with micro CT scanning and stereoscopic microscope from indicated groups (scale bar ¼ 0.5 mm). REP: Rice endosperm protein

10. Make a lump of clay with slightly larger than the sample (Fig. 9e). Flatten the bottom of the clay and fix the sample arcus zygomaticus into the clay and adjust the molar alveolar bone surface of the palate and the microscope lens in parallel (Fig. 9f). 11. Measure the distances from the cementoenamel junction to alveolar bone crest (CEJ-ABC) on the palatal side of ligature site using a microscope (see Note 10 and Fig. 10) [14]. 12. In this study, the sample from the maxillae of the tooth ligation mouse model is scanned using a high-resolution micro scanner CosmoScan GX. Micro CT is run with isometric resolution of 20 μm; the X-energy is set at 90 kV and 88 μA with an exposure time of 14 min. The CosmoScan GX software is used to reconstruct the three-dimensional image (Fig. 10) [14]. 3.5

Tissue Analysis

1. Cut the neck and remove the mandibula and cranial bone with scissors. 2. Immerse in 4% PFA overnight. Then, remove excess soft tissue, other than maxillary gingiva, and place it in the case of decalcification mesh.

248

Hikaru Tamura et al.

C

C

C

PDL

PDL

B

Untreated

PDL

B

B

PBS

REP

Fig. 11 Example of a stained maxillary bone section. Representative sections with tartrate-resistant acid phosphatase (TRAP) and hematoxylin stain of maxillae at indicated groups; arrows indicate TRAP+ osteoclasts. REP: Rice endosperm protein. C cementum, PDL periodontal ligament, B alveolar bone

3. Immerse the sample in a beaker containing 500 mL of decalcifying solution B (EDTA) and stir. Maintain adequate water flow and decalcify it for a week at 4  C. 4. Confirm the degree of decalcification of the hard tissue after 1 week (if insufficient, extend the immersion in the decalcification solution). Make a cup of aluminum foil just enough to hold the sample (see Note 11). Put the sample in the cup and fill it with the compound. Freeze from the bottom of the cup with liquid nitrogen (see Note 12) [14]. 5. Set the cryostat to 30  C. Cut samples to 10 μm thickness with a microtome blade and attach a section of approximately four pieces per plate (see Note 13). 6. Store at 80  C until staining of the sections. Examples of TRAP and nuclear stained sections are shown in Fig. 11. 3.6 Molecular Analysis

1. Prepare mRNA using All Prep DNA/RNA Mini Kit RNA. 2. Measure the RNA absorbance (see Note 14). 3. Perform cDNA synthesis with SuperScript VILO IV Mastermix. 4. Perform qPCR using a probe of the gene of your interest.

3.7

Bacteria Analysis

1. Vortex the tube with ligature for 1 min 30 s (see Note 15). 2. Dilute the PBS in the tube after agitation by ten-, 100-, 1000-, and 10,000-fold. 3. Inoculate 100 μL of each dilution per blood agar plate. 4. Culture the cells overnight in aerobic or anaerobic conditions at 37  C. 5. Select the appropriate plate of dilution (1000- or 10,000-fold dilution) suitable for counting colonies (see Note 16).

Ligature-Induced Periodontitis Mice Model

4

249

Notes 1. Clay is convenient for mounting when observing bone with a microscope. 2. Make 1-cm diameter cups of aluminum foil. Cups are easily shaped using the round part of a pen tip. 3. Appropriate airflow and nose pressure should be maintained. If the positive pressure on the mouse is too strong, the anesthetic could flow into the digestive tract, leading to death. 4. Grasp 1 cm from the end of the ligature with forceps. Holding the ligature too long will result in no force being applied to the interdental area, which may subsequently cause buccal mucosa injury. 5. Push the tip of the Dumont mini forceps with a ligature into the interdental area and separate the teeth slightly to make it easier for the ligature to enter. 6. Tying the ligature strongly by suture-tying forceps or hand is important. A weak knot may cause the ligature to get detached. 7. Aim the cut face of the needle to the bone surface. The needle insertion position should be set to the gingiva on the anterior side of the gingiva from which the sample is collected. This reduces the influence of inserting the needle into the gingiva as much as possible. Advance the needle slowly without force so that the gingiva does not come off the teeth. 8. If injected rapidly, the drug solution would leak out. Further, hold the needle for approximately 5 s after injection and then remove the needle to minimize the leakage of the drug solution. 9. The gingiva on the unligated side is firmly attached to the teeth. Therefore, it is important to place the scalpel firmly. 10. Alveolar bone resorption also occurs in the first molar distal and in the third molar mesial. Therefore, the distance measurement of CEJ-ABC should be set to a total of 5–7 places including the first molar distal, the third molar mesial, and the second molar against one section. 11. It is best to use 0.5 mol/L EDTA solution for decalcification, otherwise bone is completely dissolved, which will lead to failure of TRAP/ALP staining. 12. Pour a small amount of compound into the cup and set up such that the sample is erected upon solidifying with liquid nitrogen. Then, fill the cup completely with the compound and freeze again with liquid nitrogen.

250

Hikaru Tamura et al.

13. When pouring the compound into the cup take care that no air bubble enters the cup. Air bubbles might cause the section to break when cutting. 14. A total of 2 μg of RNA can be collected from the plate gingiva on one side. 15. If the vortex time is short, the bacteria will not be diffused, and the colony number will be incorrect. 16. In our experimental results, ~5.0
105 colony count is obtained when collected 1 week after ligation. References 1. Socransky SS, Haffajee AD, Cugini MA, Smith C, Kent RL Jr (1998) Microbial complexes in subgingival plaque. J Clin Periodontol 25(2):134–144 2. Christersson LA, Zambon JJ, Genco RJ (1991) Dental bacterial plaques. Nature and role in periodontal disease. J Clin Periodontol 18 (6):441–446 3. Baker PJ, Evans RT, Roopenian DC (1994) Oral infection with Porphyromonas gingivalis and induced alveolar bone loss in immunocompetent and severe combined immunodeficient mice. Arch Oral Biol 39(12):1035–1040 4. Maekawa T, Takahashi N, Tabeta K, Aoki Y, Miyashita H, Miyauchi S, Miyazawa H, Nakajima T, Yamazaki K (2011) Chronic oral infection with Porphyromonas gingivalis accelerates atheroma formation by shifting the lipid profile. PLoS One 6(5):e20240 5. Arimatsu K, Yamada H, Miyazawa H, Minagawa T, Nakajima M, Ryder MI, Gotoh K, Motooka D, Nakamura S, Iida T, Yamazaki K (2014) Oral pathobiont induces systemic inflammation and metabolic changes associated with alteration of gut microbiota. Sci Rep 4:4828 6. Olsen I (2008) Update on bacteraemia related to dental procedures. Transfus Apher Sci 39 (2):173–178 7. Han YW, Wang X (2013) Mobile microbiome: oral bacteria in extra-oral infections and inflammation. J Dent Res 92(6):485–491 8. Tsukasaki M, Komatsu N, Nagashima K, Nitta T, Pluemsakunthai W, Shukunami C,

Iwakura Y, Nakashima T, Okamoto K, Takayanagi H (2018) Host defense against oral microbiota by bone-damaging T cells. Nat Commun 9(1):701 9. Abe T, Hajishengallis G (2013) Optimization of the ligature-induced periodontitis model in mice. J Immunol Methods 394(1–2):49–54 10. Maekawa T, Abe T, Hajishengallis E, Hosur KB, DeAngelis RA, Ricklin D, Lambris JD, Hajishengallis G (2014) Genetic and intervention studies implicating complement C3 as a major target for the treatment of periodontitis. J Immunol 192(12):6020–6027 11. Shusterman A, Salyma Y, Nashef A, Soller M, Wilensky A, Mott R, Weiss EI, Houri-HaddadY, Iraqi FA (2013) Genotype is an important determinant factor of host susceptibility to periodontitis in the collaborative cross and inbred mouse populations. BMC Genet 14:68 12. Costalonga M, Batas L, Reich BJ (2009) Effects of Toll-like receptor 4 on Porphyromonas gingivalis-induced bone loss in mice. J Periodontal Res 44(4):537–542 13. Valerio MS, Basilakos DS, Kirkpatrick JE, Chavez M, Hathaway-Schrader J, Herbert BA, Kirkwood KL (2017) Sex-based differential regulation of bacterial-induced bone resorption. J Periodontal Res 52(3):377–387 14. Tamura H, Maekawa T, Domon H, Hiyoshi T, Yonezawa D, Nagai K, Ochiai A, Taniguchi M, Tabeta K, Maeda T, Terao Y (2019) Peptides from rice endosperm protein restrain periodontal bone loss in mouse model of periodontitis. Arch Oral Biol 98(2):132–139

INDEX A Acquired immunodeficiency syndrome (AIDS) .......... 207 Affinity chromatography............144, 145, 147, 150, 151 Aggregatibacter actinomycetemcomitans Annexin V-FITC ..................................................... 193 apoptosis .................................................................. 186 Annexin V................................................. 188, 190 DNA laddering......................................... 187, 190 LDH release ............................................. 188, 191 leucocytes.................................................. 186, 187 THP-1 ............................................................... 189 leukotoxin................................................................ 185 dental plague preparation ........................ 186, 188 PCR........................................................... 186, 188 THP-1 ..................................................................... 191 Anti-Pgm6/7 antibody................................................. 153 Antiretroviral therapy (ART)........................................ 208 Apoptosis ....................................................................... 186 Arginine (R)-specific (Rgp) gingipain FimA .......................................................................... 98 proteinase inhibitors ................................................. 98 RgpA .......................................................................... 97 RgpB .......................................................................... 97 substrates BApNA................................................................. 99 Boc-Phe-Ser-Arg-MCA ...................................... 99 KYT-1 and KYT-36........................................... 111 Z-Phe-Arg-MCA................................................. 99 Azidothymidine (AZT) ................................................ 209

B Bacteroidetes phylum...................................................... 33 Biotin ............................................................................. 219 Bone marrow-derived macrophages (BMMs) ............. 198 Bradford method........................................................... 164 Brain heart infusion (BHI) ............................63, 196, 209 Butyrate metabolic pathway .................................................. 167 oral cavity................................................................. 167 periodontal pockets................................................. 167 SCFAs in bacterial culture ...................................... 170 Butyrate-producing pathway, in P. gingivalis materials colorimetric assay .............................................. 168 GC-MS assay ..................................................... 169

methods enzymatic activity, butyryl-CoA:acetate CoA transferases................................................... 169 GS-MS analysis ..........................................170–171

C Carbobenzoxy-L-histidyl-L-glutamyl-L-lysine-4methylcoumaryl-7-amide (Z-His-Glu-LysMCA) ............................................................. 99 Carbobenzoxy-L-phenylalanyl-L-arginine-4methylcoumaryl-7-amide (Z-Phe-Arg-MCA) ........................................ 99 Carbonate–bicarbonate transfer buffer ........................ 153 C-C chemokine receptor type 5 (CCR5) .................... 208 Chemiluminescence (CL) response ........... 103, 108, 109 Chromatography buffer (CB) ...................................... 138 Confocal microscopy .......................... 215–219, 221–223 Coomassie brilliant blue (CBB) ...............................78, 82 Cross-linking mass spectrometry ........................ 114, 118 Cryo containers ............................................................... 93 Cryo-electron microscopy ............................................ 118 Crystallization additives ..................................................................... 93 pH, solution .............................................................. 93 plates .......................................................................... 91 premade screens ........................................................ 91 Crystallization, fimbrial proteins of P. gingivalis commercial crystallization kits ................................. 89 cryo crystallography ............................................89, 90 cryoprotection of crystals ......................................... 91 crystal growth............................................................ 94 crystallization drops .................................................. 91 initial screening ......................................................... 89 optimization .............................................................. 89 protein crystallization ......................................... 90–91 X-ray diffraction data ................................................ 91 C-terminal domain (CTD) ........................................... 123 Cys-Cys cross-linking.................................. 62, 65, 68, 70

D Deionized water (DIW).................................................. 62 Density gradient centrifugation .........161, 162, 164, 165 Dentilisin ....................................................................... 173 Dimethyl sulfoxide (DMSO)........................................ 197 Dispersity ......................................................................... 93

Keiji Nagano and Yoshiaki Hasegawa (eds.), Periodontal Pathogens: Methods and Protocols, Methods in Molecular Biology, vol. 2210, https://doi.org/10.1007/978-1-0716-0939-2, © Springer Science+Business Media, LLC, part of Springer Nature 2021

251

PERIODONTAL PATHOGENS: METHODS

252 Index

AND

PROTOCOLS

Dot blot analysis................................................. 62, 65, 68 Dulbecco’s modified Eagle’s medium (DMEM) ........ 209

E Endothelial Growth Medium 2 (EGM-2)................... 226 Enzyme-linked Immunosorbent Assay (ELISA)......... 210 Ethylenediaminetetraacetic acid (EDTA) .................... 138

F Fetal bovine serum (FBS) .................................... 196, 209 FimA fimbriae.................................................................. 75 fimA type-specific primer sets......................................... 54 Fimbriae extracellular proteins/protein polymers .................. 87 gram-negative bacteria.............................................. 88 Fimbrial proteins characterization ......................................................... 88 gram-positive bacteria ............................................... 87 gram-positive protein................................................ 88 intramolecular isopeptide bonds .............................. 88 polymerization mechanism ....................................... 87 Freeze Throw Buffer (FTB) ........................................... 35 French pressure cell press (French press) .................... 153 Fusobacterium nucleatum bacterial strains/plasmids ......................................... 46 fadA-complemented mutant DNA construct.................................................... 48 sonoporation ....................................................... 49 fadA-deletion mutant DNA construct.................................................... 47 sonoporation ....................................................... 48 genetic tools .............................................................. 43 genomic analysis ........................................................ 43 plasmid DNA............................................................. 44 primers ....................................................................... 45 sonoporation techniques .......................................... 44 transformation ........................................................... 44 bacterial preparation ........................................... 46 sonoporation ....................................................... 47

G Gas chromatography–mass spectrometry (GC-MS) assay ......................................................................... 168 SCFAs detection............................................. 169–171 Gene replacement ......................................................... 5, 7 Gingipain characteristics and activities materials caseinolytic activity............................................ 102 gelatin zymography...................................102–103 hemoglobin-hydrolyzing activity ..................... 101 Kgp, substrates ............................................99–100 MCA substrates .........................................100–101

p-nitroanilide substrates.................................... 101 protein substrates .............................................. 100 Rgp, substrates .................................................... 99 sample preparation ........................................ 98–99 10 luminol-dependent CL........................103–104 ultrapure water .................................................... 98 vascular permeability in vivo............................. 104 methods caseinolytic activity....................................106–107 gelatin zymography........................................... 107 hemoglobin-hydrolyzing activity ..................... 106 luminol-dependent CL response of neutrophils................................................... 108 sample preparation ............................................ 104 using MCA substrates ....................................... 105 using p-nitroanilide substrates .................105–106 vascular permeability in vivo............................. 108 Gingipains.......................................................61, 124, 158 cysteine proteinases ................................................... 97 functions .................................................................... 98 gelatin zymography................................................. 107 inhibition, gingipain activity................................... 111 Kgp............................................................................. 97 proteinase inhibitors ................................................. 98 vascular permeability ................................98, 108, 110 virulence .................................................................... 98 Gingipains Rgp................................................................ 97 Globomycin treatment..............................................65–67 Glycoproteins ................................................................ 144 detection of glycosylated proteins.......................... 148 molecular marker .................................................... 147 in P. gingivalis ......................................................... 144 Pro-Q Emerald........................................................ 153 Glycosylated OmpA-like proteins, separation method Ficoll PM400 .......................................................... 153 materials bacterial whole-cell lysates ................................ 146 detection of proteins ......................................... 147 glycoprotein stain .............................................. 148 growth of bacterial cells ............................145–146 lectin affinity chromatography ......................... 147 SDS-PAGE ........................................................ 147 western blotting ........................................148–149 methods detection of proteins ......................................... 150 detection, glycosylated proteins .............. 150, 151 growth of anaerobic bacterial cells ................... 149 lectin affinity chromatography ......................... 150 preparation, bacterial whole-cell lysates........... 149 SDS-PAGE ........................................................ 150 solubilization, bacterial whole-cell lysates ....... 149 western blotting ........................................151–152 WGA lectin affinity chromatography ..................... 151

PERIODONTAL PATHOGENS: METHODS H Hemagglutination test ....................................... 36, 38, 39 Hemagglutinin/adhesin (HA) ..................................... 124 Histone deacetylase (HDAC)....................................... 208 Homologous recombination ........................................ 5, 7 Human aortic endothelial cells (HAECs).................... 226 Human immunodeficiency virus (HIV) ............. 207–209 Human umbilical vein endothelial cells (HUVECs)................................................... 226

AND

PROTOCOLS Index 253

substrates Boc-Val-Leu-Lys-MCA....................................... 99 KYT-1 and KYT-36........................................... 111 L-Lysine-p-nitroanilide dihydrobromide ........... 99 Z-His-Glu-Lys-MCA.......................................... 99 Lysine methylation.......................................................... 95

M

Immortalized human gingival epithelial (IHGE) ....... 220 Interleukin-1β (IL-1β) .................................................. 196 Intranasal immunization, mouse model ............. 160, 163 Isolation method from P. gingivalis MVs materials cultivation of P. gingivalis ................................ 158 density gradient centrifugation ........................ 159 intranasal immunization ................................... 160 MV preparation ........................................ 158, 159 quantification of lipids ..............................159–160 methods intranasal immunization, MVs to mice............ 163 MV preparation .........................................160–162 quantification of lipids ...................................... 161

Membrane vesicles (MVs) bacteria-host interactions........................................ 157 description ............................................................... 157 isolation method (see Isolation method from P. gingivalis MVs) Mfa1 fimbriae .................................................................. 84 Micro seeding.................................................................. 94 Microbial lipoprotein .................................................... 199 Minimum inhibitory concentration (MIC)................... 12 Molecular weight cutoff (MWCO).............................. 138 Mycoplasma salivarium cultures ........................................................... 196–199 FSL-1-Fluorescein................................................... 203 lipopeptide FSL-1 ................................................... 200 lipopeptide transfection .......................................... 198 lipoprotein extraction .................................... 197, 198 lipoproteins..................................................... 195, 196 TX-114 phase separation technique ............. 199–201

L

N

Lactate dehydrogenase (LDH) .................................... 186 Legionaminic acid residue ............................................ 136 Leukotoxin .................................................................... 185 Ligature-induced periodontitis .................................... 237 animal model ........................................................... 238 bacterial analysis ............................................. 242, 248 bone analysis................................................... 240, 243 breeding................................................................... 242 inhalation anesthesia device .................................... 239 ligation ................................................... 238, 242, 243 ligature model ......................................................... 239 maxillary molars, mouse ......................................... 244 micro CT scanning.................................................. 247 micro scanner .......................................................... 241 microinjection ....................................... 239, 240, 243 molecular analysis........................................... 241, 248 tissue analysis .................................................. 240, 244 Lipid quantification MVs, P. gingivalis .......................................... 159–161 Lipopeptide transfection............................................... 198 Lipopolysaccharide (LPS) ................................................. 3 L-Lysine-p-nitroanilide dihydrobromide ....................... 99 Luria–Bertani (LB) broth ............................................... 45 Lysine (K)-specific (Kgp) gingipain autoproteolytic processing........................................ 98 proteolytic and adhesin domains.............................. 98

N-acetylmuramic acid (NAM) .............................. 25, 137 Nα-Benzoyl-DL-arginine 4-nitroanilide (BApNA) ........ 99

I

O OmpA-like proteins bioactivity ................................................................ 144 extracellular matrix proteins ................................... 144 lectin blot analysis ................................................... 144 O-GlcNAc modification ......................................... 144 separation method (see Glycosylated OmpA-like proteins, separation method) WGA lectin-agarose ................................................ 145 with 1% DDM ......................................................... 144 Open reading frame (ORF)............................................ 22 Optimization crystallization, P. gingivalis fimbrial proteins .... 89–91

P Palmitic acid labeling experiment ..................... 65, 67, 68 Periodontal disease.......................................................... 15 and systemic diseases............................................... 143 Periodontal pathogen ..................................................... 75 Periodontitis .......................... 53, 54, 135, 225, 237, 238 Periodontopathic bacteria.................................... 208, 209 cell culture ............................................................... 209

PERIODONTAL PATHOGENS: METHODS

254 Index

AND

PROTOCOLS

Periodontopathic bacteria (cont.) culture supernatant ................................................. 210 ELISA ...................................................................... 210 HIV antigens ........................................................... 210 HIV replications ...................................................... 212 HIV-1 ...................................................................... 212 luciferase assay ......................................................... 210 PCR.......................................................................... 210 stimulation experiments................................. 209–211 viral replication ELISA ................................................................ 211 HIV RNA expression ........................................ 211 immunoblotting ................................................ 211 luciferase assay ................................................... 213 Periodontopathogenic bacteria .................................... 167 Phalloidin....................................................................... 217 Phalloidin staining ........................................................ 217 Phosphate buffered saline (PBS).......................... 36, 114, 220, 242 Polymerase chain reaction (PCR) .................................. 53 Polyvinylidene difluoride (PVDF).................................. 78 Porphyromonas gingivalis .................................................. 3 adherence................................................................. 229 adherence to endothelial cells ................................ 226 adhesion to endothelial cells.......................... 228, 229 ATCC........................................................................... 4 bacterial DNA ........................................................... 56 BHI ............................................................................ 63 biotin........................................................................ 219 cell culture ...................................................... 226–228 cell staining .............................................................. 221 chronic inflammation and tooth loss ....................... 87 clinical sample collection .......................................... 55 confocal microscopy....................................... 221, 222 cross linking......................................... 65, 68, 70, 116 crystallization, fimbrial proteins (see Crystallization, fimbrial proteins of P. gingivalis) cultivation .................................................................. 77 culture .......................................................79, 220, 221 DNA extraction...................................................55, 56 dot blot ................................................................65, 68 electron microscopy .................................... 65, 66, 68, 71, 79, 115 cross-linking mass spectrometry.............. 118, 119 cryo .................................................................... 118 negative staining................................................ 118 electrophoresis........................................................... 55 E-selectin ........................................................ 225, 231 fimA gene ..................................................... 54, 56, 58 fimbriae ................................................ 3, 4, 54, 75, 76 fimbriae-deficient mutants........................................ 10 genetic variations....................................................... 53 genetics ........................................................................ 4

gingipains.................................................................. 97, (see also Gingipains) gingival epithelial cells ............................................ 215 globomycin treatment ........................................ 65–67 gram-negative bacterium .......................................... 97 growth conditions ................................................... 226 host cells .................................................................. 218 IHGE .............................................................. 216–223 immunoblotting ........................................... 64, 65, 78 infection of cells ...................................................... 222 intranasal immunization, mouse model........ 160, 163 invasion to endothelial cells.................. 227, 229, 230 isolation/purification ................................... 78, 80, 81 Mfa1 fimbriae ............................................... 81, 83, 84 MVs (see Membrane vesicles (MVs)) nested PCR................................................................ 57 NO production .............................................. 227, 230 OmpA-like proteins ................................................ 145 palmitic acid labeling experiment................ 65, 67, 68 PCR......................................................................55, 56 pili .............................................................................. 62 PorK/N complex isolation ............................ 116, 117 PorK/N complex purification ....................... 114, 115 purity of fimbriae electron microscopy ............................................ 83 immunoblotting ............................................82, 83 SDS-PAGE .......................................................... 82 random mutagenesis colony immunoblotting........................... 7, 10, 11 transposon ......................................................... 7, 9 rRNA-specific primers............................................... 57 samples/culture......................................................... 54 SDS ......................................................................63, 64 SDS-PAGE .................................................78, 82, 117 site-directed mutagenesis competent cell ................................................... 6, 8 culture conditions ..................................................7 culture media/antibiotics ......................................6 DNA constructs ................................................ 6–8 electroporation .................................................. 6, 9 soluble fraction............................................. 77, 79, 80 T9SS colony pigmentation ................................ 126, 129 complemented strains .............................. 125, 126 conjugative transfer ........................................... 129 deficient mutant ....................................... 124, 125 drug resistant mutant........................................ 128 gingipains........................................................... 124 HA ..................................................................... 124 hemagglutination test .............................. 126, 130 multidrug-drug resistant mutant ..................... 128 progingipains ....................................126, 129, 130 subcellular fractionation .......................... 127, 131 supernatant protein .................................. 127, 131

PERIODONTAL PATHOGENS: METHODS vector plasmid ...........................................127–129 vector plasmid into E.coli.................................. 129 type-V fimbriae.......................................................... 88 virulence factors .......................................97, 143, 167 vWF release.............................................227, 230–232 Prevotella melaninogenica bacterial conjugation................................................. 34 chromosomal structure ............................................. 38 conjugative transfer .............................................37, 38 E.coli........................................................................... 36 ermF ........................................................................... 38 hemagglutination test .........................................36, 38 mutant ....................................................................... 34 pathogenic factors ..................................................... 34 phagocytosis .............................................................. 34 polymicrobial diseases ............................................... 33 pork-deletion mutant ................................................ 35 suicide plasmid vector ............................................... 37 suicide vector plasmid ............................................... 36 Propionyl-CoA .............................................................. 171 Pro-Q Emerald.............................................................. 153 Protease inhibitor cocktail (PIC) ................................. 114 Protein glycosylation..................................................... 144 Protein melting curves.................................................... 95 Protein purity .................................................................. 93 Pseudaminic acid residue .............................................. 136

Q Quantitative polymerase chain reaction (qPCR)......... 238

S Seeding ............................................................................ 94 Short chain fatty acids (SCFAs) in bacterial culture................................................... 170 GC-MS assay ........................................................... 169 in saliva..................................................................... 168 ion-monitoring data................................................ 171 Sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) ........... 63, 64, 76 Sonoporation techniques................................................ 44 classification ............................................................... 44 use .............................................................................. 44

T Tannerella forsythia ......................................................... 25 allelic exchange mutagenesis ..............................28, 29 bacterial culture ......................................................... 26 blood agar.................................................................. 27 constructing materials............................................. 136 CsCl ultracentrifugation ......................................... 140

AND

PROTOCOLS Index 255

culturing ......................................................... 136–138 electrocompetent cells ........................................27, 28 electroporation .......................................................... 26 isolation, glycosylated OmpA-like proteins (see Glycosylated OmpA-like proteins, separation method) mutant ................................................................25, 29, (see also Mycoplasmasalivarium) outer membrane proteins .............................. 144, 145 partial purification .......................................... 137–139 SDS-PAGE .............................................................. 141 separation of virulence factors ................................ 144 size exclusion chromatography ..................... 138, 140 S-layer ...................................................................... 136 target gene................................................................. 27 transformation ........................................................... 29 virulence factors ...................................................... 143 Tartrate-resistant acid phosphatase (TRAP)................ 248 t-Butyloxycarbonyl-L-phenylalanyl-L-seryl-L-arginine-4methylcoumaryl-7-amide (Boc-Phe-Ser-ArgMCA) ............................................................. 99 t-Butyloxycarbonyl-L-valyl-L-leucyl-L-lysine-4methylcoumaryl-7-amide (Boc-Val-Leu-LysMCA) ............................................................. 99 Tosyl-L-lysyl-chloromethane hydrochloride (TLCK) .......................................................... 64 Transposon mutagenesis...........................................4, 7, 9 Treponema denticola antibiotic protection assay ............................. 177, 182 chemically induced competent cells ......................... 19 cis-complementation ...........................................16, 21 coaggregation assay........................................ 177, 182 competent cells........................................................ 181 constructing materials............................................... 17 dentilisin ......................................................... 173, 174 competent cells.................................................. 181 DNA construct.................................................. 180 measurement ....................................175, 176, 180 mutant (electroporation) .................................. 176 mutant (heat shock).......................................... 177 purification ..............................174, 175, 177, 179 electrocompetent cells .............................................. 18 electrotransformation................................................ 19 gene deletion allelic exchange.................................................... 18 counterselectable maker...................................... 18 genetic transformation........................................15, 16 heat shock transformation ........................................ 20 pathogenecity ................................................. 176, 180 plating selection ........................................................ 20 prtP mutant ............................................................. 177

PERIODONTAL PATHOGENS: METHODS

256 Index

AND

PROTOCOLS

Treponema denticola (cont.) trans-complementation ............................................ 21 transformation ......................................................... 181 virulence factors ...................................................... 173 Tris-buffered sodium chloride solution (TBS).............. 78 Triton X-114 ................................................................. 195 Trypan blue infusion..................................................... 244 Trypticase soy broth (TSB) ................................... 77, 220 Tryptone–yeast extract–gelatin–volatile fatty acids–serum (TYGVS) ...................................................... 174 TX-114 phase separation technique ............................ 199 Type IX secretion system (T9SS) ............... 113, 123, 124 Type V pili ....................................................................... 62

U Ultracentrifugation .............................................. 159, 165

V Vascular permeability by gingipains.............................................98, 108, 110 von Willebrand factor (VWF)....................................... 227

W Wheat germ agglutinin (WGA) lectin144, 145, 149, 151, 152

X X-ray crystallography methods ....................................... 88