Mechanism of plant hormone signaling under stress 9781118888766, 1118888766, 9781118888964, 1118888960, 9781118889022, 1118889029

Table of contents :
Content: Volume 1 --
Part I. Auxin as a mediator of abiotic stress responses --
Volume 2 --
Part II. Interaction of other components with phytohormones --
Volume 2 --
Part III. Transcription regulators of phytohormones --
Volume 2 --
Part IV. Involvement of multiple phytohormones in stress responses. Cover
volume 1
Title Page
Copyright
Contents
About the Editor
List of Contributors
Preface
Part I Action of Phytohormones in Stress
Chapter 1 Auxin as a Mediator of Abiotic Stress Responses
1.1 Introduction 1.2 Auxin: A Short Overview of Appearance, Metabolism, Transport, and Analytics 1.2.1 De Novo Synthesis
1.2.2 Reversible and Irreversible Conjugation Pathways
1.2.3 IBA to IAA Conversion
1.2.4 Degradation Pathways
1.2.5 Polar Auxin Transport 1.2.6 Analytical Methods in Auxin Identification and Quantification 1.3 How Auxin Homeostasis Shifts with Diverse Abiotic Stresses
1.3.1 How the Auxin Pool is Affected by Abiotic Stress?
1.3.2 Transcription of Auxin Metabolic Genes under Abiotic Stress 1.3.3 What Can We Learn from Functional Analysis Research? 1.4 How Does Auxin Signaling Respond to Abiotic Stress?
1.4.1 Brief Overview of Auxin Perception and Signaling 1.4.2 Auxin Signaling Attenuation under Stress Conditions: The Importance of miRNA Driven Post-Transcriptional Regulation 1.5 Auxin and Redox State During Abiotic Stress
1.6 Auxin-Stress Hormones Crosstalk in Stress Conditions
1.6.1 Auxin-ABA Crosstalk
1.6.2 Auxin-JA Crosstalk

Citation preview

k

Mechanism of Plant Hormone Signaling under Stress

k

k

k

k

ii

Cover Image Description The image presents a holistic view of the functional role of phytohormones. Different classes of plant hormones perform a myriad of functions starting from germination, vegetative, to reproductive phase transition; abiotic and biotic stress responses, defense against pathogens, and senescence. Plant hormones are known to regulate and interact with other hormones and more than one hormone is frequently involved in different signaling pathways, suggesting a mechanistic interplay among them in regulating plant growth, development, and physiological responses.

k

k

k

k

Mechanism of Plant Hormone Signaling under Stress Edited by Girdhar K. Pandey Department of Plant Molecular Biology, University of Delhi South Campus, New Delhi, India

k

k

Volume I

k

k

Copyright © 2017 by John Wiley & Sons, Inc. All rights reserved Published by John Wiley & Sons, Inc., Hoboken, New Jersey Published simultaneously in Canada No part of this publication may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying, recording, scanning, or otherwise, except as permitted under Section 107 or 108 of the 1976 United States Copyright Act, without either the prior written permission of the Publisher, or authorization through payment of the appropriate per-copy fee to the Copyright Clearance Center, Inc., 222 Rosewood Drive, Danvers, MA 01923, (978) 750-8400, fax (978) 750-4470, or on the web at www.copyright.com. Requests to the Publisher for permission should be addressed to the Permissions Department, John Wiley & Sons, Inc., 111 River Street, Hoboken, NJ 07030, (201) 748-6011, fax (201) 748-6008, or online at http://www.wiley.com/go/permission. Limit of Liability/Disclaimer of Warranty: While the publisher and author have used their best efforts in preparing this book, they make no representations or warranties with respect to the accuracy or completeness of the contents of this book and specifically disclaim any implied warranties of merchantability or fitness for a particular purpose. No warranty may be created or extended by sales representatives or written sales materials. The advice and strategies contained herein may not be suitable for your situation. You should consult with a professional where appropriate. Neither the publisher nor author shall be liable for any loss of profit or any other commercial damages, including but not limited to special, incidental, consequential, or other damages.

k

For general information on our other products and services or for technical support, please contact our Customer Care Department within the United States at (800) 762-2974, outside the United States at (317) 572-3993 or fax (317) 572-4002. Wiley also publishes its books in a variety of electronic formats. Some content that appears in print may not be available in electronic formats. For more information about Wiley products, visit our web site at www.wiley.com. Library of Congress Cataloging-in-Publication Data: Names: Pandey, Girdhar K., editor. Title: Mechanism of plant hormone signaling under stress / edited by Girdhar K. Pandey. Description: Hoboken, New Jersey : John Wiley & Sons, Inc., 2017. | Includes bibliographical references and index. Identifiers: LCCN 2016047893 (print) | LCCN 2016059906 (ebook) | ISBN 9781118888926 (cloth : alk. paper) | ISBN 9781118888964 (Adobe PDF) | ISBN 9781118888766 (ePub) Subjects: LCSH: Plants–Effect of stress on. | Botanical chemistry. | Plant hormones. | Auxin. | Gibberellins. Classification: LCC QK754 .M36 2017 (print) | LCC QK754 (ebook) | DDC 581.7–dc23 LC record available at https://lccn.loc.gov/2016047893 Set in 10/12pt WarnockPro by SPi Global, Chennai, India Cover image: Mie Igarashi / EyeEm/Gettyimages Cover designer: Wiley

10 9 8 7 6 5 4 3 2 1

k

k

k

v

Contents About the Editor xv List of Contributors xvii Preface xxiii

Part I

k

Action of Phytohormones in Stress 1

1

Auxin as a Mediator of Abiotic Stress Responses 3 Branka Salopek-Sondi, Iva Pavlovi´c, Ana Smolko, and Dunja Šamec

1.1 1.2

Introduction 3 Auxin: A Short Overview of Appearance, Metabolism, Transport, and Analytics 4 De Novo Synthesis 4 Reversible and Irreversible Conjugation Pathways 5 IBA to IAA Conversion 6 Degradation Pathways 6 Polar Auxin Transport 7 Analytical Methods in Auxin Identification and Quantification 7 How Auxin Homeostasis Shifts with Diverse Abiotic Stresses 9 How the Auxin Pool is Affected by Abiotic Stress? 9 Transcription of Auxin Metabolic Genes under Abiotic Stress 10 What Can We Learn from Functional Analysis Research? 11 How Does Auxin Signaling Respond to Abiotic Stress? 13 Brief Overview of Auxin Perception and Signaling 13 Auxin Signaling Attenuation under Stress Conditions: The Importance of miRNA Driven Post-Transcriptional Regulation 14 Auxin and Redox State During Abiotic Stress 15 Auxin-Stress Hormones Crosstalk in Stress Conditions 18 Auxin-ABA Crosstalk 18 Auxin-JA Crosstalk 19 Auxin-Ethylene Crosstalk 20 Auxin-SA Crosstalk 20 Promiscuous Protein Players of Plant Adaptation: Biochemical and Structural Views 21

1.2.1 1.2.2 1.2.3 1.2.4 1.2.5 1.2.6 1.3 1.3.1 1.3.2 1.3.3 1.4 1.4.1 1.4.2 1.5 1.6 1.6.1 1.6.2 1.6.3 1.6.4 1.7

k

k

k

vi

Contents

1.7.1 1.7.2 1.8

IAR3 Auxin Amidohydrolase 21 GH3 Auxin Conjugate Synthetases 23 Conclusion 24 Acknowledgment 24 References 25

2

Mechanism of Auxin Mediated Stress Signaling in Plants 37 Lekshmy S, Krishna G.K., Jha S.K., and Sairam R.K.

2.1 2.2 2.3 2.4

Introduction 37 Auxin Biosynthesis, Homeostasis, and Signaling 37 Auxin Mediated Stress Responses in Model and Crop Plants 40 Regulation of Root System Architecture under Drought and Nutrient Stresses 41 Conclusions and Future Perspectives 45 References 46

2.5

k

3

Integrating the Knowledge of Auxin Homeostasis with Stress Tolerance in Plants 53 Shivani Saini, Isha Sharma, and Pratap Kumar Pati

3.1 3.2 3.3 3.4 3.5 3.6

Introduction 53 Auxin Biosynthesis and its Role in Plant Stress 53 Auxin Transport and its Role in Plant Stress 57 Auxin Signaling and its Role in Plant Stress 60 Auxin Conjugation and Degradation and its Role in Plant Stress 61 Conclusions 63 References 63

4

Cytokinin Signaling in Plant Response to Abiotic Stresses 71 Nguyen Binh Anh Thu, Xuan Lan Thi Hoang, Mai Thuy Truc, Saad Sulieman, Nguyen Phuong Thao, and Lam-Son Phan Tran

4.1 4.2 4.2.1 4.2.2 4.2.2.1 4.2.2.2 4.3 4.3.1 4.3.2 4.3.3 4.4 4.5

Introduction 71 CK Metabolism 72 CK Components and Regulatory Functions 72 CK Metabolism, Perception, and Signal Transduction 75 CK Metabolism 75 CK Perception and Signal Transduction 77 The Components of the CK Signaling Pathway 77 The CK Receptor Histidine Kinases 77 Histidine Phosphotransfer Proteins 79 Response Regulators 80 CK Signaling in Plant Responses to the Abiotic Stresses 81 Genetic Engineering of CK Content for Improvement of Plant Tolerance to Abiotic Stresses 82 Conclusions 88 Acknowledgments 88 References 88

4.6

k

k

k

Contents

5

Crosstalk Between Gibberellins and Abiotic Stress Tolerance Machinery in Plants 101 Ashutosh Sharan, Jeremy Dkhar, Sneh Lata Singla-Pareek, and Ashwani Pareek

5.1 5.2 5.3 5.3.1 5.3.2 5.3.3 5.4

Introduction 101 Gibberellins: Biosynthesis, Transport, and Signaling 102 GA Metabolism and Signaling During Abiotic Stress 106 Salinity Stress Induces GA2ox and GA20ox Gene Expression 106 Reduced GA Confers Tolerance to Drought Stress 111 Role of GA in Cold and Heat Stresses 112 Crosstalk between GA and Other Plant Hormones in Response to Abiotic Stresses 114 Crosstalk between GAs and Ethylene During Abiotic Stress 114 Crosstalk Between GAs and Abscisic Acid During Abiotic Stress 115 Crosstalk Between GAs and SA During Abiotic Stress 116 Crosstalk Between GAs and Jasmonic Acid During Abiotic Stress 116 Applications in Crop Improvement 117 Flower Development 117 Fruit Development 118 Brewing Industry 118 Conclusion 118 Acknowledgment 119 References 119

5.4.1 5.4.2 5.4.3 5.4.4 5.5 5.5.1 5.5.2 5.5.3 5.6

k

6

The Crosstalk of GA and JA: A Fine-Tuning of the Balance of Plant Growth, Development, and Defense 127 Yuge Li and Xingliang Hou

6.1 6.2 6.3 6.4 6.5 6.6 6.7

Introduction 127 GA Pathway in Plants 128 JA Pathway in Plants 129 GA Antagonizes JA-Mediated Defense 131 JA Inhibits GA-Mediated Growth 133 GA and JA Synergistically Mediate Plant Development 134 Conclusions 136 Acknowledgments 136 References 136

7

Jasmonate Signaling and Stress Management in Plants 143 Sirhindi Geetika, Mushtaq Ruqia, Sharma Poonam, Kaur Harpreet, and Ahmad Mir Mudaser

7.1 7.2 7.3 7.4 7.4.1 7.4.2 7.4.3 7.4.4

Introduction 143 JA Biosynthesis and Metabolic Fate 144 JA Signaling Network 146 Physiological Role of JAs 151 JA in Seed Germination 151 JA in Root Growth 151 JA in Tuber Formation 152 JA in Trichome Development 152

k

vii

k

k

viii

Contents

7.4.5 7.4.6 7.4.7 7.4.8 7.5 7.5.1 7.5.2 7.5.3 7.6

k

JA in Flower and Seed Development 153 JA in Abscission and Senescence 153 JA in Photosynthesis Regulation 154 JA in Secondary Metabolism 155 JA Regulated Stress Responses 156 JA in Antioxidant Management and Reactive Oxygen Species Homeostasis 156 JA in Biotic Stress 157 JA in Abiotic Stresses 157 Conclusion 159 References 159

8

Mechanism of ABA Signaling in Response to Abiotic Stress in Plants 173 Ankush Ashok Saddhe, Kundan Kumar, and Padmanabh Dwivedi

8.1 8.2 8.3 8.4 8.5 8.5.1 8.5.2 8.5.3 8.5.4 8.5.5 8.5.6 8.5.7 8.6

Introduction 173 Signal Perception and ABA Receptors 175 Negative Regulators of ABA Signaling: Protein Phosphatase 2C (PP2C) Positive Regulators of ABA Signaling: SnRK2 179 ABA Signaling Regulating Transcription Factor 181 Basic-Domain Leucine Zipper (bZIP) TF 181 AP2/ERF TF 182 NAC TF 183 WRKY TF 183 C2 H2 ZF TF 184 MYB TF 185 bHLH TF 185 Crosstalk Between Various ABA Responsive Pathways in Abiotic Stress 186 Summary and Future Prospects 187 Acknowledgments 188 Abbreviations 188 References 188

8.7

9

Abscisic Acid Signaling and Involvement of Mitogen Activated Protein Kinases and Calcium-Dependent Protein Kinases During Plant Abiotic Stress 197 Aryadeep Roychoudhury and Aditya Banerjee

9.1 9.2 9.2.1 9.2.2 9.2.3 9.2.4 9.2.4.1 9.2.4.2 9.2.4.3

Introduction 197 ABA Signaling in Plants 198 ABA as a Phytohormone 198 ABA Metabolism 199 ABA Transport 199 ABA Perception and Signal Transduction 201 ABA Receptors in Signal Transduction 202 PP2Cs as Negative Regulators of ABA Signaling 203 SnRK2 Acting as a Global Positive Regulator of ABA Signaling

k

205

178

k

k

Contents

9.3 9.4 9.5 9.6 9.7

k

9.7.1 9.7.2 9.7.2.1 9.7.2.2 9.7.3 9.7.3.1 9.7.3.2 9.7.3.3 9.7.3.4 9.7.3.5 9.7.3.6 9.7.3.7 9.8 9.8.1 9.8.1.1 9.8.1.2 9.8.2 9.8.3 9.9 9.10

The Signalosome and Signaling Responses Mediated by ABA: Structural Alterations in ABA by PYR/PYL/RCAR 207 Structural Alterations During PP2C Inhibition by ABA 208 The abi1-1 Mutation Mystery Solved 208 Basic Leucine Zipper (bZIP) TFs in ABA Signaling 209 Mitogen-Activated Protein Kinase (MAPK) Cascades and Regulation of Downstream Signaling 210 Relevance and Crosstalk of MAPKs in Plant Abiotic Stresses 212 The MAPK Families of Arabidopsis and Rice 212 Arabidopsis 212 Rice 213 MAPK Cascades Regulating Abiotic Stress Signaling 215 Salt Stress 215 Drought Stress 215 Oxidative Stress 215 Ozone Stress 216 Heavy Metal Stress 216 Temperature Stress 216 ABA-Induced Activation of MAPKs 216 Calcium Dependent Protein Kinases (CDPKs) 219 CDPK Activities 221 Regulation of CDPK Activity 221 CDPK in ABA Signaling 221 Relevance and Crosstalk of CDPKs in Plant Abiotic Stresses 223 CDPKs as Potent Signaling Hubs 224 MAPK-CDPK Crosstalk 225 Conclusion and Future Perspectives 226 Acknowledgments 227 References 227

10

Abscisic Acid Activates Pathogenesis-Related Defense Gene Signaling in Lentils 243 Rebecca Ford, David Tan, Niloofar Vaghefi, and Barkat Mustafa

10.1 10.1.1 10.1.2 10.1.3 10.1.4 10.1.5 10.2 10.3 10.3.1 10.3.2 10.3.3 10.3.4 10.3.5 10.4

Plant Host Defense Mechanisms 243 Host versus Non-Host Resistance 243 Preformed and Induced Defense Responses 244 Reactive Oxygen Species (ROS) During an Oxidative Burst 245 Hypersensitive Response (HR) 245 Systemic Acquired Resistance (SAR) 246 Phytoalexins and Pathogenesis-Related (PR) Proteins 247 The Role of Plant Hormones in Pathogen Defense 247 Salicylic Acid 247 Jasmonic Acid 248 Ethylene 249 Abscisic Acid 249 Conservation and Crosstalk Within Signaling Pathways 250 The Lentil Ascochyta lentis Pathosystem 251

k

ix

k

k

x

Contents

10.5 10.6 10.6.1 10.6.2 10.6.3 10.6.4 10.7

k

Key Defense-Related Genes Involved in Ascochyta lentis Defense 252 The Effect of Exogenous Hormone Treatment on PR4 and PR10 Transcription in Lentils 253 Bioassays and cDNA Production 255 PR Gene Amplification and Expression Profiling 255 Effects of ABA, ACC, MeJA, and SA on Lentil PR4 Gene Expression 256 Effects of ABA,ACC,MeJA, and SA on Lentil PR10 Gene Expression 256 Conclusions 259 References 261

11

Signaling and Modulation of Non-Coding RNAs in plants by Abscisic Acid (ABA) 271 Raj Kumar Joshi, Swati Megha, Urmila Basu, and Nat N.V. Kav

11.1 11.2 11.3 11.3.1 11.3.2 11.4 11.4.1 11.4.2 11.4.3

Introduction 271 Biogenesis of Non-Coding RNAs in Plants 273 Mode of Action of ncRNAs in Plants 274 Mechanism of Action in Small RNAs 274 Mechanism of Action of lncRNAs 275 ABA Signaling in Plants 276 ABA Biosynthesis, Transport, and Catabolism 276 ABA Signal Transduction 278 Cis-Acting Elements and Transcription Factors in ABA-Mediated Gene Expression 278 ABA-Mediated Stomatal Closure During Pathogen Attack 280 Non-Coding RNAs and ABA Response 280 MiRNAs in ABA Signaling 280 Other ncRNAs in ABA Signaling 283 Conclusion and Future Prospects 285 References 286

11.4.4 11.5 11.5.1 11.5.2 11.6

12

Ethylene and Stress Mediated Signaling in Plants: A Molecular Perspective 295 Priyanka Agarwal, Gitanjali Jiwani, Ashima Khurana, Pankaj Gupta, and Rahul Kumar

12.1 12.2 12.2.1 12.2.1.1 12.2.1.2 12.2.2 12.2.2.1 12.2.2.2 12.3 12.3.1 12.3.1.1 12.3.1.2 12.3.2 12.3.2.1

Introduction 295 Types of Stress 295 Temperature Stress 296 Cold Stress 296 Heat Stress 296 Water Stress 297 Drought Stress 297 Salinity stress 298 Overview of Stress Signaling 298 Perception of Stress 298 Perception at Plasma Membrane 298 Perception by Changed Ca2+ Concentration 299 Action of Different Secondary Messengers 299 Reactive Oxygen Species (ROS) 299

k

k

k

Contents

12.3.2.2 12.3.3 12.3.4 12.3.5 12.3.5.1 12.3.5.2 12.3.5.3 12.3.5.4 12.3.6 12.3.6.1 12.3.6.2 12.3.6.3 12.3.6.4 12.3.6.5 12.3.7 12.3.7.1 12.3.7.2 12.3.7.3 12.3.7.4

k

12.3.8 12.3.9 12.4

Lipid Messengers 300 Ca2+ as an Intermediate Signal Molecule 301 Role of MAPK in Stress Signaling 302 Role of Ethylene During Stress 302 Ethylene 302 Ethylene Biosynthesis 302 Ethylene Perception 303 Role of Ethylene in Fruit Ripening 303 Role of Ethylene in Abiotic Stress 304 Cold Stress 304 Heat Stress 306 Salinity Stress 307 Ethylene and Drought Stress 310 Ethylene and Flooding Tolerance 310 Role of Ethylene in Biotic Stress 310 Ethylene Signal Perception in Response to Biotic Stress in Plants 310 Mechanism of Action of Ethylene in Plant Pathogen Interaction 311 Crosstalk of Hormones in Plant Defense 312 Crosstalk of Ethylene with Other Hormones in Response to Biotic Stress 313 Role of ABA in Stress 315 Role of Other Phytohormones in Stress 316 Conclusion 316 Acknowledgment 316 References 317

13

Regulatory Function of Ethylene in Plant Responses to Drought, Cold, and Salt Stresses 327 Haixia Pei, Honglin Wang, Lijuan Wang, Fangfang Zheng, and Chun-Hai Dong

13.1 13.2 13.3 13.4

Functional Roles of Ethylene in Plant Drought Tolerance Ethylene Signaling in Plant Cold Tolerance 330 Ethylene Signaling and Response to Salt Stress 333 Conclusion 336 References 337

14

Plant Nitric Oxide Signaling Under Environmental Stresses 345 Ione Salgado, Halley Caixeta Oliveira, and Marília Gaspar

14.1 14.2 14.3 14.3.1 14.3.2 14.3.3

Introduction 345 Mechanisms of NO Action in Plants 346 The Control of NO Homeostasis in Plants 348 NO Synthesis in Plants 349 NO Degradation in Plants 350 Regulation of NO Homeostasis by S-Nitrosothiols Through the Nitrogen Assimilation Pathway 350 NO and the Response to Abiotic Stresses 351 Drought 351 Hypoxia Stress 352

14.4 14.4.1 14.4.2

k

328

xi

k

k

xii

Contents

14.4.3 14.4.4 14.4.5 14.5

Salt Stress 354 Heavy Metals 355 Low Temperature Stress 356 Conclusions and Future Prospects 358 References 360

15

Cell Mechanisms of Nitric Oxide Signaling in Plants Under Abiotic Stress Conditions 371 Yuliya A. Krasylenko, Alla I. Yemets, and Yaroslav B. Blume

15.1 15.2

Introduction 371 Duality of RNS: Key Secondary Messengers in Plant Cells versus Nitrosative Stress Agents 373 Tyrosine Nitration as a Hallmark of Nitrosative Stress and Regulatory Post-Translational Modification 376 NO and Environmental Abiotic Challenges 380 Mechanical Wounding and Programmed Cell Death Progression 380 Chilling, Cold/Heat Stress, and Acclimation 380 Light Overexposure and UV Irradiation 382 Air (Ozone) and Soil Pollution (Heavy Metals, Herbicides) 384 Osmotic Stresses: High Salinity, Drought, and Flooding 386 Conclusions and Future Perspectives 388 Acknowledgments 389 References 389

15.3 15.4 15.4.1 15.4.2 15.4.3 15.4.4 15.4.5 15.5 k 16

S-Nitrosylation in Abiotic Stress in Plants and Nitric Oxide Interaction with Plant Hormones 399 Ankita Sehrawat and Renu Deswal

16.1 16.2 16.2.1 16.2.2 16.2.3 16.2.4 16.2.5 16.3 16.4

Introduction 399 S-Nitrosylation in Abiotic Stress 400 Salinity Stress 401 Cold Stress 406 Desiccation Stress 406 High Light Stress 406 Cadmium and 2,4-Dichlorophenoxy Acetic Acid (2,4-D) Stress 406 Nitric Oxide and Plant Hormone Interaction 407 Conclusions and Future Areas of Research 409 References 409

17

Salicylic Acid Signaling and its Role in Responses to Stresses in Plants 413 Pingzhi Zhao, Gui-Hua Lu, and Yong-Hua Yang

17.1 17.2 17.2.1 17.2.2 17.3 17.3.1

Introduction 413 Salicylic Acid Biosynthesis and Metabolism in Plants 414 SA Biosynthesis 414 SA Metabolism 416 Salicylic Acid: A Central Molecule in Plant Responses to Stress SA-Mediated Plant Resistance to Disease 417

k

417

k

k

Contents

17.3.2 17.3.2.1 17.3.2.2 17.3.2.3 17.3.2.4 17.3.2.5 17.3.3 17.4 17.5

k

xiii

SA-Mediated Abiotic Stress Tolerance 419 Drought Stress 419 Cold and Heat Stress 421 Salinity Stress 423 Heavy Metal Stress 424 Ozone Stress and UV Radiation 425 Relationship Between Biotic and Abiotic Stress Factors 426 Salicylic Acid in Relation to Other Phytohormones in Response to Plant Stress Status 427 Conclusion 429 References 429

18

Glucose and Brassinosteroid Signaling Network in Controlling Plant Growth and Development Under Different Environmental Conditions 443 Manjul Singh, Aditi Gupta, and Ashverya Laxmi

18.1 18.2 18.3 18.4 18.5 18.6 18.7

Introduction 443 Glucose Homeostasis and Signaling in Plants 444 Brassinosteroid Biosynthesis and Signaling 447 Role of Glc in Plant Adaptation to Changing Environmental Conditions 452 Role of BR in Plant Adaptation to Changing Environmental Conditions 454 Glc-BR Crosstalk and its Adaptive Significance in Plant Development 458 Conclusion and Future Perspective 459 References 459 Index 471

k

k

k

k

k

k

k

xv

About the Editor

k

Girdhar K. Pandey received his B.Sc. (Hon.) in Biochemistry from Delhi University in 1992 and M.Sc. in Biotechnology in year 1994 from Banaras Hindu University (BHU). Subsequently, he joined the School of Life Sciences for his Ph.D., Jawaharlal Nehru University (JNU), and worked in the field of calcium signal transduction under abiotic stresses in plants. He was awarded the Ph.D. degree in 1999 and then pursued a post-doctoral career at the Department of Plant and Microbial Biology, University of California, Berkeley in 2000. There, he extended his work in the field of calcium-mediated signaling in Arabidopsis by studying CBL-CIPKs, phosphatases, channels/transporters, and transcription factors involved in abiotic stresses. Currently, he is working as Professor in the Department of Plant Molecular Biology, Delhi University South Campus. Pandey’s research interests involve detail mechanistic interplay of signal transduction networks in plant under mineral nutrient deficiency (mostly potassium, calcium, and nitrate) and abiotic stresses such as drought, salinity, and oxidative stresses induced by heavy metals. His laboratory is working on the coding and decoding of mineral nutrient deficiency and abiotic stress signals by studying several signaling components such as phospholipases (PLA, PLC, and PLD), calcium sensors such as calcineurin B-like (CBL) and CBL-interacting protein kinases (CIPK), phosphatases (mainly PP2C and DSP), transcription factors (AP2-domain containing or ERF, WRKY), transporters and channels proteins (potassium and calcium channels/transporters), small GTPases, and Armadillo domain containing proteins in both Arabidopsis and rice. The long-term goal of his research group is to establish the mechanistic interplay and crosstalk of mineral nutrient deficient conditions and different abiotic stress signaling cascades in Arabidopsis and rice model systems by using the advance tools of bio-informatics, genetics, cell biology, biochemistry, and physiology with greater emphasis on functional genomics approaches. See Pandey’s web page for further information about his lab and research work: https://sites.google.com/site/gkplab/home; www.dpmb.ac.in/index.php?page=girdharpandey

k

k

k

k

k

k

k

xvii

List of Contributors Priyanka Agarwal

Jeremy Dkhar

Department of Plant Molecular Biology, University of Delhi New Delhi, India

Stress Physiology and Molecular Biology Laboratory, School of Life Sciences, Jawaharlal Nehru University New Delhi, India

Aditya Banerjee

Post Graduate Department of Biotechnology, St. Xavier’s College Kolkata, West Bengal, India

Chun-Hai Dong

Qingdao Agricultural University Qingdao, Shandong, China

k

Padmanabh Dwivedi

Urmila Basu

Department of Plant Physiology, Institute of Agricultural Sciences, Banaras Hindu University Varanasi, India

Department of Agricultural Food and Nutritional Science, University of Alberta, Edmonton, Alberta, Canada

Rebecca Ford Yaroslav B. Blume

Department of Genomics and Molecular Biotechnology, Institute of Food Biotechnology and Genomics, National Academy of Sciences of Ukraine Kyiv, Ukraine

School of Natural Sciences, Griffith University Queensland, Australia Krishna GK

Division of Plant Physiology, Indian Agricultural Research Institute New Delhi, India

Renu Deswal

Molecular Plant Physiology and Proteomics Laboratory, Department of Botany, University of Delhi Delhi, India

Marília Gaspar

Núcleo de PesquisaemFisiologia e Bioquímica, Instituto de Botânica de São Paulo São Paulo, Brazil

k

k

k

xviii

List of Contributors

Sirhindi Geetika

Raj Kumar Joshi

Department of Botany, Punjabi University Patiala, India

Department of Agricultural Food and Nutritional Science, University of Alberta, Edmonton, Alberta, Canada and Centre of Biotechnology, Siksha O Anusandhan University Bhubaneswar, India

Aditi Gupta

National Institute of Plant Genome Research Aruna Asaf Ali Marg, New Delhi, India Interdisciplinary Centre for Plant Genomics, University of Delhi South Campus New Delhi, India

Nat N.V. Kav

Department of Agricultural Food and Nutritional Science, University of Alberta, Edmonton, Alberta, Canada Ashima Khurana

Pankaj Gupta

Central Research Institute for Homeopathy Noida, UP India Kaur Harpreet

k

Department of Botany, Punjabi University Patiala, India Xuan LanThi Hoang

School of Biotechnology, International University, Vietnam National University HCMC Ho Chi Minh City, Vietnam

Zakir Husain College, University of Delhi New Delhi, India Yuliya A. Krasylenko

Department of Genomics and Molecular Biotechnology, Institute of Food Biotechnology and Genomics, National Academy of Sciences of Ukraine Kyiv, Ukraine Rahul Kumar

RTGR, Department of Plant Sciences, University of Hyderabad Hyderabad, India

Xingliang Hou

Key Laboratory of South China Agricultural Plant Molecular Analysis and Genetic Improvement, South China Botanical Garden, Chinese Academy of Sciences, Guangzhou, China

Kundan Kumar

Department of Biological Sciences, Birla Institute of Technology & Science Pilani Goa, India Ashverya Laxmi

Gitanjali Jiwani

Department of Plant Molecular Biology, University of Delhi New Delhi, India

National Institute of Plant Genome Research Aruna Asaf Ali Marg, New Delhi, India

k

k

k

List of Contributors

Yuge Li

Pratap Kumar Pati

Key Laboratory of South China Agricultural Plant Molecular Analysis and Genetic Improvement, South China Botanical Garden, Chinese Academy of Sciences, Guangzhou, China

Department of Biotechnology, Guru Nanak Dev University Amritsar, Punjab, India Iva Pavlovi´c

Department for Molecular Biology, Rud-erBoškovi´c Institute Zagreb, Croatia

Gui-Hua Lu

NJU–NJFU Joint Institute for Plant Molecular Biology, State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing, China

Lekshmy S

Division of Plant Physiology, Indian Agricultural Research Institute New Delihi, India Haixia Pei

Swati Megha

Qingdao Agricultural University Qingdao, Shandong, China

Department of Agricultural Food and Nutritional Science, University of Alberta, Edmonton, Alberta, Canada k

xix

Sharma Poonam

Department of Botany, Punjabi University Patiala, India

Ahmad Mir Mudaser

Department of Botany, Punjabi University Patiala, India

Sairam RK

Barkat Mustafa

Department of Environment and Primary Industries, Victorian AgriBiosciences Centre, La Trobe University Victoria, Australia Halley Caixeta Oliveira

Departamento de Biologia Animal e Vegetal, Centro de CiênciasBiológicas, UniversidadeEstadual de Londrina(UEL), Londrina, Brazil Ashwani Pareek

Stress Physiology and Molecular Biology Laboratory, School of Life Sciences, Jawaharlal Nehru University New Delhi, India

Division of Plant Physiology, Indian Agricultural Research Institute New Delhi, India Aryadeep Roychoudhury

Post Graduate Department of Biotechnology, St. Xavier’s College Kolkata, West Bengal, India Mushtaq Ruqia

Department of Botany, Punjabi University Patiala, India Jha SK

Division of Genetics, Indian Agricultural Research Institute New Delhi, India

k

k

k

xx

List of Contributors

Ankush Ashok Saddhe

Manjul Singh

Department of Biological Sciences, Birla Institute of Technology & Science Pilani Goa, India

National Institute of Plant Genome Research Aruna Asaf Ali Marg, New Delhi, India

Shivani Saini

Department of Biotechnology, Guru Nanak Dev University Amritsar, Punjab, India

Interdisciplinary Centre for Plant Genomics, University of Delhi South Campus New Delhi, India Sneh Lata Singla-Pareek

Ione Salgado

Departamento de Biologia Vegetal, Instituto de Biologia, UniversidadeEstadual de Campinas (UNICAMP), Campinas, Brazil Branka Salopek-Sondi

Department for Molecular Biology, Rud-erBoškovi´c Institute Zagreb, Croatia k

Dunja Šamec

Department for Molecular Biology, Rud-erBoškovi´c Institute Zagreb, Croatia Ankita Sehrawat

Molecular Plant Physiology and Proteomics Laboratory, Department of Botany, University of Delhi Delhi, India Ashutosh Sharan

Stress Physiology and Molecular Biology Laboratory, School of Life Sciences, Jawaharlal Nehru University New Delhi, India

Plant Molecular Biology, International Centre for Genetic Engineering and Biotechnology, New Delhi, India Ana Smolko

Department for Molecular Biology, Rud-erBoškovi´c Institute Zagreb, Croatia Saad Sulieman

Signaling Pathway Research Unit, RIKEN Center for Sustainable Resource Science, Yokohama, Japan and Department of Agronomy, Faculty of Agriculture, University of Khartoum Khartoum North, Sudan David Tan

Faculty of Veterinary and Agricultural Sciences, The University of Melbourne Victoria, Australia Nguyen Phuong Thao

School of Biotechnology, International University, Vietnam National University HCMC Ho Chi Minh City, Vietnam Nguyen Binh Anh Thu

Isha Sharma

Department of Biotechnology, Guru Nanak Dev University Amritsar, Punjab, India

School of Biotechnology, International University, Vietnam National University HCMC Ho Chi Minh City, Vietnam

k

k

k

List of Contributors

Lam-Son Phan Tran

Yong-Hua Yang

Signaling Pathway Research Unit, RIKEN Center for Sustainable Resource Science Yokohama, Japan

NJU–NJFU Joint Institute for Plant Molecular Biology, State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing, China

Mai Thuy Truc

School of Biotechnology, International University, Vietnam National University HCMC, Ho Chi Minh City, Vietnam and John Carroll University, University Heights, OH, USA

Alla I. Yemets

Department of Genomics and Molecular Biotechnology, Institute of Food Biotechnology and Genomics, National Academy of Sciences of Ukraine Kyiv, Ukraine

Niloofar Vaghefi

Cornell University, Plant Pathology & Plant-Microbe Biology Section Geneva, NY, USA Honglin Wang

k

xxi

Qingdao Agricultural University Qingdao, Shandong, China

Pingzhi Zhao

NJU–NJFU Joint Institute for Plant Molecular Biology, State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing, China

Lijuan Wang

Fangfang Zheng

Qingdao Agricultural University Qingdao, Shandong, China

Qingdao Agricultural University Qingdao, Shandong, China

k

k

k

k

k

k

k

xxiii

Preface

k

One of the basic biological differences between plants and animals is in their habit of growth and development. During the processes of evolution, unlike animals, plants adopted sessile and relatively immobile growth habits to complete their lifecycle. However, common key chemical communicators called “hormones” regulate growth and development in a similar fashion in plants and animals. Plant hormones are known as “phytohormones,” which act locally and systemically to regulate their growth and development. The importance of phytohormones in a plant’s biological activities can be perceived well typically in a tissue culture system, where a slight alteration in the level of various hormones lead to development of undifferentiated mass of cells called the callus. The Phytohormones act at a very low concentration, usually in nano- to micro molar amounts within a plant cell. Owing to this, initial attempts to understand the biochemical and functional role of phytohormones remained inconclusive. However, with the help of chemical synthesis, large-scale purification, and through mutant based genetic approaches, valuable information to understand the underlying mechanism has been unearthed for the role of phytohormones over the past few decades. The detailed biosynthetic and signal transduction pathways have been identified for most of the classical phytohormones like auxin, abscisic acid, gibberllin, cytokinin, and ethylene along with the newly discovered brassinosteroids, salicylic acid, jasmonic acid, nitric oxide, and others. Using the tools of genetics, biochemistry, and molecular biology, plant biologists are now able to develop a concrete roadmap starting from the biosynthesis to perception and action of many of these phytohormones in regulating physiological and developmental responses. Mounting evidence suggest that, besides regulating the growth of plants, phytohormones are the critical factors that also play a role in fine-tuning the metabolism and physiology of the plants under varying environmental cues. In the natural growth environment, plants perceive a large number of favorable (nutrient, water, light) and unfavorable stimuli (abiotic and biotic stresses), which influence their growth and development. To counteract these adverse conditions, plants have developed an intricate web of complex machineries to translate perceived stress signal into effective response by modulating the gene expression or directly affecting the physiology of the cell. Phytohormones or plant growth regulators are the key chemical molecules that are involved in broad spectrum of signaling pathways in response to a particular abiotic or biotic stress mounting an effective defense response.

k

k

k

xxiv

k

Preface

Similar to other signaling molecules, phytohormones act coordinately to generate synergistic, antagonistic, and additive or subtractive responses. The direct indication of this cross talk is considered to be based on molecular interactions between factors regulating phytohormone signal action pathways. Thus, to elucidate the molecular mechanism of possible integration of phytohormone signaling pathways with the intermediates of other signaling cascades under a given condition requires the major attention of plant biologists. More than ever, in the current state where aggressive climate change, rapidly growing population, and diminishing fertile land due to increased exploitation of natural resources imposes serious threat to crop production worldwide. And so, the major focus of plant biologists across the world is to improve crop productivity and yield. With the development of gene cloning, genetic engineering, and genome editing, modification of a food crop’s genetic makeup to accustom it toward changing conditions paves way for the possibility of development and enhancement of tolerance against these stresses. In the field conditions, crops are constantly exposed to multitude of stresses and efforts are being focused towards generating new crop varieties that can tolerate these multiple stresses without yield loss. Detail molecular understanding of the cross talk and interaction of different phytohormones would certainly open new directions to design strategies to generate stress tolerant high yielding crop varieties. In the post-genomic era, one of the major challenges is the functional analysis and understanding of plant hormone associated multiple genes and gene families regulating a particular physiological and developmental aspect of plant lifecycles. One of the important physiological processes is stress response regulation, which leads to adaptation in response to adverse stimuli. With the holistic understanding of the molecular mechanism of plant hormones associated signaling involving more than one gene family, plant biologist can lay the foundation for designing and generating future crops, which can withstand adverse environmental conditions without compromising on yield and productivity. This book on Mechanism of Plant Hormone Signaling under Stress comprises of two volumes (Volume I and Volume II with 18 chapters in each). Several plant biologists throughout the world have contributed in the field of ‘mechanisms of plant hormone action’ in plants with a special emphasis on ‘stress signaling in plants’. This book describes the timely and state-of-art contribution to knowledge in the field of ‘phytohormone mediated signaling under stress’ to develop a better and holistic understanding of hormone stress perception, transduction followed by the generation of response. Despite of availability of large number of publications in the field of action of phytohormones during stress conditions, the in-depth analysis of this aspect has not been covered in previous books and volumes. Above all, the topics include a greater emphasis on genomics and functional genomics aspects in order to understand the global and whole genome level changes under particular stress conditions through a functional genomics perspective. With functional genomics tools, the mechanisms of phytohormone signaling and their target genes can be defined in a more systematic manner. The integrated analysis of phytohormone signaling under single or multiple stress conditions may prove exceptional to design stress tolerant crop plants in field conditions. Toward achieving

k

k

k

Preface

k

this goal, the book is divided into four sections. Volume I comprises the first part where 18 chapters on Action of Phytohormones in Stress discusses the mechanistic action of the most common phytohormones, and their roles in stress signaling in plants. These chapters will aware the readers primarily on the detailed signaling pathways and their roles in various stress conditions in plants. The first three chapters (Chapter 1–3) are dealing with the various aspects of biosynthesis, signaling, and action of classical phytohormone, auxin in multiple stress conditions. The Chapter 4 describes the metabolism, homeostasis, and signaling pathways of another classical phytohormone, cytokinin, known to regulate growth and differentiation in plants, also involved in various stress conditions. GA also belongs to the category of classical phytohormone regulating plant growth by cell division and elongation. Chapter 5 and 6 discuss the various roles of GA, its metabolism, signal transduction pathways, and also its interaction with JA in stress conditions in plants. In continuation with Chapter 6, where interaction of GA with JA is discussed, their elaborate role, metabolism, and signaling pathway is discussed in detail in Chapter 7 with a special emphasis of JA in stress management. The another typical phytohormone, ABA, long known to regulate stress related responses in plants is extensively discussed in Chapters 8–11, where different contributors have discussed its in-depth signal transduction and mechanism of action in regulating both abiotic and biotic stresses. Ethylene is also a conventional gaseous hormone known to regulate fruit ripening and senescence in plants. Chapters 12 and 13 discusses the elaborate aspects of ethylene signal transduction and responses under both abiotic and biotic stresses and cross talk with other phytohormones. Chapters 14 to 16 emphasizes the signal transduction and detail role of another gaseous hormone, nitric oxide or NO and the process of S-nitrosylation in several abiotic stress conditions in plants. Salicylic acid (SA) is mostly appreciated as an important phytohormone regulating biotic stress. SA is also well elaborated upon in multiple abiotic stresses in Chapter 17. The last chapter of the Part I (Chapter 18) describes the complex interplay of brassinosteroid (BR) and glucose in growth and development, and also during environmental stress conditions. Volume II of this book contains three parts (Parts II–IV) consisting of 18 chapters in total. Part II of this book describes the role of several different factors that are intangibly linked with phytohormone signaling under biotic and abiotic stresses. Chapters 1 and 2 elaborate the role of reactive oxygen species (ROS) in regulating both abiotic and biotic stress responses. ROS are key signaling molecules, which are also interacting and participating in multiple phytohormone-mediated signaling and response pathways during various stress conditions in plants. Calcium (Ca2+ ) is a metal ion involved in regulating a plethora of biological processes including stress signal transduction pathways in plants. Ca2+ acts as second messenger and is involved in signaling pathways of several phytohormones. The most studied phytohormone where Ca2+ is a pivotal signaling molecule is abscisic acid (ABA) regulating several abiotic stress responses. Chapter 3 focuses on the role of Ca2+ signaling components and their complex interplay with multiple phytohormones in plants. Chapter 4 reports the role of phospholipids in regulating various signaling pathways during biotic and abiotic stresses and their interaction with phytohormones. Emerging evidences showing effects of biotic and abiotic stresses on cytoskeletal protein network mediated through different phytohormone is highlighted in Chapter 5. In the Chapter 6, the role of several proteins involved in metabolism, transport, and signal transduction of different phytohormones is discussed. Further, increased use of man-made chemicals such as organic compounds mainly used as

k

xxv

k

k

xxvi

k

Preface

pesticides, herbicides, and fungicides has resulted in the accumulation of these xenobiotic compounds in the environment that leads to interference with plant hormone signaling and metabolism. Chapter 7 articulates important aspects of interaction of xenobiotic compounds with phytohormone signaling and metabolism, and opens up new possibilities to investigate these aspects at molecular levels. In Chapter 8, the role of phytohormone mediated signaling in several metal stresses and how plants changes their growth and development in response to toxic metal ions is well documented. Part III (in Volume II) of this book comprised of three chapters, which mainly discusses the role of transcription factors, transcription activators, and microRNA in the regulation of phytohormones related gene expression under stress and developmental conditions. In Chapter 9, the development of stomata by several transcription factors and their regulation by multiple phytohormones is described. Since stomata is the gate-keeper that controls the passage of gases like CO2 , O2 , and are responsible for the transpirational pull of water and nutrients from the soil, their opening and closure is thoroughly fine-tuned by several phytohormones, majorly by ABA. This chapter details the interplay of phytohormones in the development of stomata and their regulation under abiotic stresses mediated by multiple phytohormones. Chapter 10 describes the role of the phytohormone regulated mediator complex. This is a large multimeric transcriptional activator complex, involved in regulating the transcription of multiple stress inducible genes. In Chapter 11, the complex regulatory roles of micro-RNA in modulating the gene expression in phytohormones and abiotic stress conditions are extensively elucidated. The last part of this book (in Volume II), Part IV is comprised of seven chapters, mainly discussing the roles of multiple phytohormones in diverse stress adaptive responses. The first chapter in this section, i.e., Chapter 12 confers on the role of multiple phytohormones and microbial elicitors in regulating the signaling pathway in guard cell during stomatal closure. Chapter 13 elaborates on how phytohormones are involved in regulating pathogen infection and plant defense and immune response during biotic stress. In Chapter 14, the role of multiple phytohormones is described in regulating both seed development and stress responses. The important role and interaction of multiple phytohormones is once more discussed in abiotic and biotic stress responses in Chapter 15 with special emphasis on SA and its interaction with other phytohormones. With the identification of multiple phytohormones signaling pathways, it is well appreciated that many of these phytohormone shows the complex interaction because of convergence and overlap of signal transduction components such as kinases, phosphatases, transcription factors, and other signaling molecules. Chapters 16 and 17 highlight the complex interplay of several phytohormones in abiotic and biotic stress regulation and crosstalk. The last chapter of this section, Chapter 18, emphasizes on the transgenic approaches to manipulate crop productivity by altering the levels of several phytohormones. With an in-depth understanding of several signal transduction components mediated by phytohormones, the ultimate goal is to translate this mechanistic knowledge into useful tools to generate crop varieties with either genetic alteration of these signaling components, or to utilize this knowledge for molecular-marker assisted breeding, which ultimately augment stress tolerance in crop plants without compromising their productivity. Despite my rigorous attempts, not all aspects of phytohormone signaling and components could be discussed here because of space constraints. Nevertheless, I strongly

k

k

k

Preface

xxvii

believe that this book, covering different characteristics of phytohormone signal transduction machinery with a special emphasis on the mechanistic action under stress conditions will prove extremely useful to students, teachers, and research scientists. I am grateful to all the contributors of this work, which could not be possibly compiled without their significant contributions. At last, I would like to express my sincere thanks to Dr. M.C. Tyagi, Dr. Amita Pandey, and Ms. Manisha Sharma for critical reading and constructive suggestions related to this book. Ms. Manisha Sharma is also acknowledged for designing the cover page of this book. I am also thankful to Delhi University, University Grant Commission, Department of Biotechnology, Department of Science and Technology, and Council of Scientific and Industrial Research, India for supporting research in my laboratory. Girdhar K. Pandey (Editor)

k

k

k

k

Mechanism of Plant Hormone Signaling under Stress

k

k

k

k

ii

Cover Image Description The image presents a holistic view of the functional role of phytohormones. Different classes of plant hormones perform a myriad of functions starting from germination, vegetative, to reproductive phase transition; abiotic and biotic stress responses, defense against pathogens, and senescence. Plant hormones are known to regulate and interact with other hormones and more than one hormone is frequently involved in different signaling pathways, suggesting a mechanistic interplay among them in regulating plant growth, development, and physiological responses.

k

k

k

k

Mechanism of Plant Hormone Signaling under Stress Edited by Girdhar K. Pandey Department of Plant Molecular Biology, University of Delhi South Campus, New Delhi, India

k

k

Volume II

k

k

Copyright © 2017 by John Wiley & Sons, Inc. All rights reserved Published by John Wiley & Sons, Inc., Hoboken, New Jersey Published simultaneously in Canada No part of this publication may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying, recording, scanning, or otherwise, except as permitted under Section 107 or 108 of the 1976 United States Copyright Act, without either the prior written permission of the Publisher, or authorization through payment of the appropriate per-copy fee to the Copyright Clearance Center, Inc., 222 Rosewood Drive, Danvers, MA 01923, (978) 750-8400, fax (978) 750-4470, or on the web at www.copyright.com. Requests to the Publisher for permission should be addressed to the Permissions Department, John Wiley & Sons, Inc., 111 River Street, Hoboken, NJ 07030, (201) 748-6011, fax (201) 748-6008, or online at http://www.wiley.com/go/permission. Limit of Liability/Disclaimer of Warranty: While the publisher and author have used their best efforts in preparing this book, they make no representations or warranties with respect to the accuracy or completeness of the contents of this book and specifically disclaim any implied warranties of merchantability or fitness for a particular purpose. No warranty may be created or extended by sales representatives or written sales materials. The advice and strategies contained herein may not be suitable for your situation. You should consult with a professional where appropriate. Neither the publisher nor author shall be liable for any loss of profit or any other commercial damages, including but not limited to special, incidental, consequential, or other damages.

k

For general information on our other products and services or for technical support, please contact our Customer Care Department within the United States at (800) 762-2974, outside the United States at (317) 572-3993 or fax (317) 572-4002. Wiley also publishes its books in a variety of electronic formats. Some content that appears in print may not be available in electronic formats. For more information about Wiley products, visit our web site at www.wiley.com. Library of Congress Cataloging-in-Publication Data: Names: Pandey, Girdhar K., editor. Title: Mechanism of plant hormone signaling under stress / edited by Girdhar K. Pandey. Description: Hoboken, New Jersey : John Wiley & Sons, Inc., 2017. | Includes bibliographical references and index. Identifiers: LCCN 2016047893 (print) | LCCN 2016059906 (ebook) | ISBN 9781118888926 (cloth : alk. paper) | ISBN 9781118888964 (Adobe PDF) | ISBN 9781118888766 (ePub) Subjects: LCSH: Plants–Effect of stress on. | Botanical chemistry. | Plant hormones. | Auxin. | Gibberellins. Classification: LCC QK754 .M36 2017 (print) | LCC QK754 (ebook) | DDC 581.7–dc23 LC record available at https://lccn.loc.gov/2016047893 Set in 10/12pt WarnockPro by SPi Global, Chennai, India Cover Image: Mie Igarashi / EyeEm/Gettyimages Cover designer: Wiley

10 9 8 7 6 5 4 3 2 1

k

k

k

v

Contents About the Editor xv List of Contributors xvii Preface xxiii

Part II

k

Interaction of Other Components with Phytohormones 1

1

Interaction between Hormone and Redox Signaling in Plants: Divergent Pathways and Convergent Roles 3 Srivastava AK, Redij T, Sharma B, and Suprasanna P

1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9

Introduction 3 Redox-Hormone Crosstalk in Plants 4 Auxin 4 Abscisic Acid 9 Ethylene 11 Jasmonic Acid 11 Salicylic Acid 12 Brassinosteroids 14 Conclusion and Future Perspectives 15 References 15

2

Redox Regulatory Networks in Response to Biotic Stress in Plants: A New Insight Through Chickpea-Fusarium Interplay 23 Anirban Bhar, Sumanti Gupta, Moniya Chatterjee, and Sampa Das

2.1 2.2 2.2.1 2.2.2 2.3 2.4 2.4.1 2.4.2 2.4.3 2.4.4

Introduction 23 Production and Scavenging of ROS: The Balance versus Perturbations 24 NADPH Oxidase, the Biological ROS Factory 24 Detoxification of ROS 25 Role of ROS in Plants: Ease and Disease 28 Reactive Oxygen Species Networks in Plants 28 Oxidative Sensors: Decoding of ROS Language 28 The Role of ROS in Cell Wall Fortification 29 The MAP Kinase Signaling Cascade: Relation to the Cellular Redox State 32 ROS, an Inducer in Plant Systemic Responses 33

k

k

k

vi

Contents

2.5 2.6

ROS Signaling in Chickpea-Fusarium Interplay 34 Concluding Remarks 36 Acknowledgments 37 References 37

3

Ca2+ , The Miracle Molecule in Plant Hormone Signaling During Abiotic Stress 45 Swatismita Dhar Ray

3.1 3.2 3.3 3.3.1 3.3.2

Introduction 45 Intricacies of Hormonal Signaling in Abiotic Stress 46 Ca2+ Regulated Hormonal Signaling 50 Calcium-Dependent Protein Kinase (CDPK/CPK) 50 Calcineurin B-Like Protein (CBL)-CBL-Interacting Protein Kinase (CIPK) 62 Ca2+ Binding Protein Calmodulin (CAM), CAM-Like Protein (CML) and CAM-Binding Transcription Activator (CAMTA) 64 Ca2+ /Calmodulin-Dependent Protein Kinase (CCaMK) 65 Ca2+ /H+ Antiporter (CAX) 66 Ca2+ ATPase (ACA) 66 Calreticulin (CRT) 67 Conclusion 67 Acknowledgment 68 Abbreviations 68 References 69

3.3.3 3.3.4 3.3.5 3.3.6 3.4 3.5 k 4

Phosphoglycerolipid Signaling in Response to Hormones Under Stress 91 Igor Pokotylo, Martin Janda, Tetiana Kalachova, Alain Zachowski, and Eric Ruelland

4.1 4.1.1 4.1.2 4.1.2.1 4.1.2.2 4.1.2.3 4.1.2.4 4.1.2.5 4.2 4.2.1

Main Players in Phosphoglycerolipid Signaling Machinery 91 Phosphoglycerolipid Signaling Pathways 91 Which Molecules Act as Mediators? 93 Targets of Phosphatidic Acid 93 Phosphoinositides 94 Diacylglycerol 96 Phosphorylated Inositols 96 Lysophosphoglycerolipids and Free Fatty Acids 96 Lipid Signaling, An Important Component of Plant Stress Responses 97 The Effect of Abiotic or Biotic Stresses on the Expression of Genes Encoding Enzymes of Lipid Signaling Machinery 97 The Effects of Abiotic Stresses on the Components of Lipid Signaling Machinery 99 Salt and Osmotic Stresses 99 Drought stress 100 Temperature Stress 101 Nutrient Deficiency and Toxic Metals 102 Effects of Biotic Stresses on Components of Lipid Signaling Machinery 102 Involvement of Phosphoglycerolipids in Phytohormone Signaling 104 Abscisic Acid 104

4.2.2 4.2.2.1 4.2.2.2 4.2.2.3 4.2.2.4 4.2.3 4.3 4.3.1

k

k

k

Contents

4.3.2 4.3.3 4.3.4 4.3.5 4.3.6 4.4 4.5

5

vii

Salicylic Acid 107 Jasmonates 108 Ethylene 109 Auxins 109 Brassinosteroids 110 Stresses Can Affect Responses to Hormones by Altering Phosphoglycerolipid Machinery 111 Conclusion 113 Acknowledgments 113 References 113 The Role of the Plant Cytoskeleton in Phytohormone Signaling under Abiotic and Biotic Stresses 127 Yaroslav B. Blume, Yuliya A. Krasylenko, and Alla I. Yemets

5.1 5.2

k

Introduction 127 Phytohormone-Mediated Perception of Abiotic Factors via the Cytoskeleton 131 5.2.1 Osmotic Stress and its Main Signaling Molecules Abscisic Acid and Ethylene: Interplay with the Cytoskeleton 131 5.2.1.1 Osmotic Stress 131 5.2.1.2 Osmotic Stress and Cytoskeleton 132 5.2.1.3 ABA and MTs 136 5.2.1.4 ABA and AFs 138 5.2.1.5 Ethylene and MTs 139 5.2.1.6 Ethylene and AFs 141 5.2.2 Microgravity and Mechanical Alterations Signal Transduction via Auxin and Brassinosteroids 142 5.2.2.1 Gravity 142 5.2.2.2 Mechanosensing 142 5.2.2.3 MTs as a Moving Force of Gravity Response 143 5.2.2.4 AFs and Gravity Response 143 5.2.2.5 Auxins as a Gravity Signal 144 5.2.2.6 Auxins and NO Interplay 144 5.2.2.7 Auxins and cGMP 145 5.2.2.8 Auxins and MTs 145 5.2.2.9 Auxins and AFs 147 5.2.2.10 Auxin and Brassinosteroid Interplay 150 5.2.2.11 Brassinosteroids and Cytoskeleton 150 5.2.3 Light Causes Cytoskeleton Rearrangement Mediated by Gibberellins 152 5.2.4 Cytoskeleton and Phytohormones as the Players of Common Signaling Cascades Under Extreme Temperatures 154 5.2.4.1 Cold and Phytohormones 155 5.2.4.2 Cold, MTs, and ABA 156 5.2.4.3 Cold, ABA, and AFs 158 5.2.4.4 Heat Shock Stress 158 5.2.4.5 Heat Shock-Induced Phytohormonal Imbalance 159 5.2.4.6 Hydrogen Peroxide (H2 O2 ) and Nitric Oxide (NO) 160

k

k

k

viii

Contents

5.2.4.7 5.2.4.8 5.3 5.3.1 5.3.2 5.3.3 5.4

6

Proteins in Phytohormone Signaling Pathways for Abiotic Stress in Plants 187 Sasikiran Reddy Sangireddy, Zhujia Ye, Sarabjit Bhatti, Xiao Bo Pei, Muhammad Younas Khan Barozai, Theodore Thannhauser, and Suping Zhou

6.1 6.2

Introduction 187 Metabolic Pathways of Phytohormones and Stress-Induced Protein Expression Affecting their Biosynthesis Process 187 Proteins for Intra- and Inter-Cellular Transport of Phytohormones 190 Hormone Signaling Systems, Hormone Crosstalk, and Stress Responses 191 The Application of Proteomics in the Identification of Hormone Signaling Pathways 193 Conclusion and Prospective 194 References 194

6.3 6.4 k

ROS 160 Heat and the Cytoskeleton 161 Cytoskeleton Regulation in Plant Interactions with Pathogens/Symbionts: Jasmonic and Salicylic Acids, and Strigolactones 162 Jasmonic Acid 164 Salicylic Acid 166 Strigolactones 167 Conclusions and Future Perspectives 169 Acknowledgments 169 Abbreviations 169 References 170

6.5 6.6

7

Perturbation and Disruption of Plant Hormone Signaling by Organic Xenobiotic Pollution 199 Anne-Antonella Serra, Diana Alberto, Fanny Ramel, Gwenola Gouesbet, Cécile Sulmon, and Ivan Couée

7.1 7.2

Introduction 199 Plant-Hormone-Interfering Naturally-Occurring Organic Compounds Play Important Roles in the Chemical Ecology of Plants 204 Transcriptome Profiling Reveals the Wide-Ranging Molecular Effects of Plant-Organic Xenobiotic Interactions 205 The Wide-Ranging Molecular Effects of Plant-Organic Xenobiotic Interactions Emphasize the Involvement of Regulatory Processes 206 Specifically Designed Organic Xenobiotics Directly Interact with Plant Hormone Systems 209 Organic Xenobiotics Can Cause Biological Effects that Interfere with Plant Hormone Dynamics and Signaling 210 The Diversity of Organic Xenobiotic Occurrences in Environmental Pollutions Can Induce Plant Hormone Perturbations in Non-Target Plant Communities 212 Conclusions and Perspectives 214 Acknowledgments 214

7.3 7.4 7.5 7.6 7.7

7.8

k

k

k

Contents

ix

Abbreviations 214 References 214 8

Plant Hormone Signaling Mediates Plant Growth Plasticity in Response to Metal Stress 223 Xiangpei Kong, Huiyu Tian, and Zhaojun Ding

8.1 8.2 8.3 8.4

Introduction 223 Cadmium (Cd) 224 Aluminum (Al) 226 Other Metals 228 Acknowledgments 229 References 229

Part III

k

Transcriptional Regulators of Phytohormones 237

9

Transcription Factors and Hormone-Mediated Mechanisms Regulate Stomata Development and Responses Under Abiotic Stresses: An Overview 239 Marco Landi, Alice Basile, Marco Fambrini, and Claudio Pugliesi

9.1 9.2 9.2.1 9.2.2

Introduction 239 Stomata Development 240 The Transition from a Non-Differentiated Cell to GC Pair 240 The Positive Regulators from the Transition of a Non-Differentiated Cell to a GC Pair 241 Genetic Control of Stomatal Patterning 245 Additional Genes Involved in Stomatal Differentiation and Function 248 Regulation of Stomata Differentiation and Patterning via Phytohormones 250 Regulation of Stomata Differentiation and Patterning via Environmental Cues 252 Stomatal Response to Drought/Salinity and Waterlogging/Anoxia Constraints 253 Root-to-Shoot Communication 253 The Harsh Conditions Experienced by Plants in Mediterranean Environment: The Stomatal Responses to Drought and Salinity 253 Transcription Factors and Hormones Mediate Stomatal Response in Drought and Salinity Stresses 254 Waterlogging and Oxygen Shortage 258 Conclusions and Perspectives 262 Acknowledgments 264 References 264

9.2.3 9.2.4 9.2.5 9.2.6 9.3 9.3.1 9.3.2 9.3.2.1 9.3.3 9.4

10

Convergence of Stress-Induced Hormone Signaling Pathways on a Transcriptional Co-Factor 285 Nidhi Dwivedi, Vinay Kumar, and Jitendra K. Thakur

10.1

Introduction 285

k

k

k

x

Contents

10.2 10.3 10.4 10.5 10.6 10.7

k

10.7.1 10.7.2 10.7.3 10.7.4 10.7.5 10.7.6 10.7.7 10.7.8 10.7.9 10.7.10 10.7.11 10.7.12 10.7.13 10.8 10.9

Mediator Complex 286 Role of Mediator in Transcription 289 Flexibility of Mediator 290 Phytohormone Signaling Under Stress 291 Effect of Hormone and Stress on the Expression of Mediator Subunit Genes 293 Involvement of Specific Mediator Subunits in Hormone Signaling and Stress Response 295 MED5 295 MED8 296 MED14 and MED2 297 MED15 297 MED16 298 MED17, MED18, and MED20 298 MED18 299 MED19 299 MED21 300 MED25 301 MED34 302 MED37 302 CDK8 302 Convergence of Signaling Pathways on the Mediator Complex 303 Conclusion 304 Acknowledgment 305 References 305

11

Micro-Regulators of Hormones and Stress 319 Neha Sharma, Deepti Mittal, and Neeti-Sanan Mishra

11.1 11.2 11.2.1 11.2.2 11.2.3 11.2.4 11.3 11.3.1 11.3.2 11.3.3 11.3.4 11.3.5 11.4 11.4.1 11.4.2 11.4.3 11.4.4 11.5

Introduction 319 Plant microRNAs 320 Road to Discovery 320 miR Biogenesis 321 Genomic Organization of Plant miRs 323 Mode of Action and Target Recognition 324 Role of miRs in Hormone Signaling 325 Auxins 325 Gibberellins 328 Cytokinins 329 Ethylene 330 Abscisic Acid (ABA) 331 miR Mediated Regulation of Abiotic Stress 332 Water Stress 332 Temperature 333 Nutrient Deprivation 334 Salt Stress 334 Conclusions and Perspectives 335 References 336

k

k

k

Contents

xi

Part IV Involvement of Multiple Phytohormones in Stress Responses 353

k

12

Signal Transduction Components in Guard Cells During Stomatal Closure by Plant Hormones and Microbial Elicitors 355 Srinivas Agurla, Gunja Gayatri, and Agepati S. Raghavendra

12.1 12.2 12.2.1 12.2.1.1 12.2.1.2 12.2.1.3 12.2.1.4 12.2.1.5 12.2.1.6 12.3 12.4 12.5 12.5.1 12.5.2 12.5.3 12.5.4 12.6 12.6.1 12.6.2 12.6.3 12.6.4 12.6.5 12.6.6 12.6.7 12.6.8 12.6.9 12.7 12.8

Introduction 355 Compounds or Signals that Regulate Stomatal Function 356 Plant Hormones 356 Abscisic Acid 357 Auxins 357 Cytokinins 357 Ethylene 357 Brassinosteroids 358 Salicylic Acid and Acetyl Salicylic Acid 358 Guard Cell Turgor and Stomatal Closure: Ion Fluxes as the Basis 360 Experimental Approaches to Studying Signaling Components 360 Sensing Systems in Guard Cells 361 ABA receptors 361 MJ Receptors 362 Calcium Receptors 362 Others 362 Signaling Components in Guard Cells 363 Reactive Oxygen Species (ROS) 363 Nitric Oxide (NO) 363 Calcium 368 Cytosolic pH 370 Protein Kinases and Protein Phosphatases 370 G-Proteins 370 Phospholipids and Sphingolipids 371 Cation and Anion Channels 371 Cytoskeleton Elements 371 Validation with Arabidopsis Mutants 372 Concluding Remarks 374 Acknowledgments 375 References 375

13

Plants’ Defense and Survival Strategies versus Pathogens’ Anti-Defense and Infection Capabilities: The Hormone-Based Mechanisms 389 Pranav Pankaj Sahu, Namisha Sharma, and Manoj Prasad

13.1 13.2

Introduction 389 Modulation of Hormone Signaling Networks by Pathogens for Virulence 390 Alteration of Hormone Signaling and Associated Components by Bacteria 390

13.2.1

k

k

k

xii

Contents

13.2.2 13.2.3 13.3 13.3.1 13.3.2 13.3.3 13.3.4 13.4

k

Alteration of Hormone Signaling and Associated Components During Plant-Virus Interaction 395 Alteration of Hormone Signaling and Associated Components During Fungal Infection 398 Alteration of the Hormone Signaling Network by Plants for Disease Resistance 400 Salicylic Acid: A Key Regulatory Hormone in the Resistance Signaling Network 400 The Emerging Role of Auxin as a Defense Hormone 402 Changing Trends of ABA Signaling: A Positive Regulator of Defense Response During Pathogen Attack 402 JA/ET Pathway Plays Both Synergistically and Antagonistically with the Other Phytohormones 403 Conclusions and Future Perspectives 405 Acknowledgment 405 References 405

14

Exploring Crossroads Between Seed Development and Stress Response 415 Sushma Naithani, Hiro Nonogaki, and Pankaj Jaiswal

14.1 14.1.1 14.1.1.1 14.1.1.2 14.1.1.3 14.1.2 14.2 14.2.1 14.2.2 14.2.3 14.2.3.1 14.2.3.2 14.2.3.3 14.3 14.4 14.4.1 14.4.2 14.4.3 14.4.4 14.5

Introduction 415 Seed Development 415 Embryo and Endosperm Morphogenesis 415 Reserve Accumulation in Seeds 417 Seed Maturation and Dormancy 418 Seed Germination 419 Genes, Proteins, and Pathways Involved in Seed Development 419 Transcription Activators, Repressors, Others, and Regulatory Proteins 419 microRNAs (miRNA) 422 Metabolic Pathways and Associated Genes 422 Hormone Metabolism 422 Carbohydrate Metabolism and Starch Deposition 423 Proteins and Enzymes 423 Genes at the Intersection of Seed Development and Stress Response 424 Exploring Bioinformatics Resources 425 Visualization of Synteny Across Plant Species 432 Gene Phylogeny 435 Genetic Marker Resource 437 Gene Expression Data Analysis 437 Insights and Future Prospects 441 Acknowledgments 444 References 444

15

Role of Multiple Phytohormones in Regulating Stress Responses in Plants 455 Diwaker Tripathi, Bal Krishna Chand Thakuri, and Dhirendra Kumar

15.1

Introduction 455

k

k

k

Contents

k

15.2 15.2.1 15.2.2 15.2.3 15.2.4 15.2.5 15.3 15.3.1 15.3.2 15.3.3 15.3.4 15.3.5 15.3.6 15.4 15.5 15.6

Biotic Stress 456 SA Biosynthesis and Modifications 456 SA and MAP Kinases in Biotic Stress Signaling 457 SA Signaling through Transcription Factors 458 SA Mediated Signaling through SA-Binding Proteins 458 Hormones Affecting Stomatal Aperture During Biotic Stress Response 461 Role of Hormones in Abiotic Stress 461 Role of Salicylic Acid in Abiotic Stress 461 Role of Abscisic Acid in Abiotic Stress 463 Role of Jasmonic Acid in Abiotic Stress 464 Role of Ethylene (ET) in Abiotic Stress 465 Role of Auxin in Abiotic Stress 465 Role of Gibberellins in Abiotic Stress 465 Interaction of SA with other Stress Hormones 466 SA/ABA Antagonism 467 Future Perspective and Challenges 467 Acknowledgments 468 References 468

16

Phytohormones and Drought Stress: Plant Responses to Transcriptional Regulation 477 Neha Pandey, Zahra Iqbal, Bhoopendra K. Pandey, and Samir V. Sawant

16.1 16.2 16.2.1 16.2.2 16.2.3

Introduction 477 Phytohormones: Role in Plant Growth and Development 479 Plant Growth and Hormone Signaling 479 Role of Phytohormones in Plant Development Under Stress Conditions 479 Crosstalk and Combinatorial Effect of Phytohormones in Various Stresses 480 Plant Hormonal Response to Stress Conditions 481 Hormone Biosynthesis by Abiotic Stress 481 Hormonal Regulation of Stress Responsive Genes 481 ABA-Responsive Gene Expression 482 Interaction Between ABA and Other Stress Hormones in Abiotic Stress Responses 485 Auxin Responsive Gene Expression and Stress Response 485 Cytokinin and its Role in Stress Response 486 An Insight into the Role of GA and SA in Abiotic Stress 486 Interplay of Phytohormones on Plants under Stress Conditions 487 Hormonal Mediated Transcriptional Response to Stress Conditions 488 Hormonal Conjugation in Regulation of Gene Expression in Abiotic Stress 488 Regulation of Stress Responsive Transcription Factors by Phytohormones 488 The Role of ABA in Regulating Stress Induced Transcription Factors 489 Phytohormone Mediated Signaling Response Under Stress Conditions 490 Signal Transduction of Phytohormones Under Abiotic Stress 490

16.3 16.3.1 16.3.2 16.3.3 16.3.4 16.3.5 16.3.6 16.3.7 16.3.8 16.4 16.4.1 16.4.2 16.4.3 16.5 16.5.1

k

xiii

k

k

xiv

Contents

16.5.2 16.5.3 16.5.4 16.6 16.7

Interaction Between Hormone Biosynthetic Pathways and Signal Transduction Pathways 490 Regulation of Kinases and Phosphatase by Hormones 491 Role of Secondary Messengers in Hormone Signaling 491 Significance of Phytohormones in Plant Genetic Engineering 493 Conclusion 493 References 493

17

Mechanisms of Hormone Signaling in Plants Under Abiotic and Biotic Stresses 505 Jogeswar Panigrahi, and Gyana Ranjan Rout

17.1 17.2 17.3

Introduction 505 Role of Hormones in Plant Growth and Development 506 Common Tenets in Hormone Signaling in Plants Under Abiotic and Biotic Stress 507 Role of ROS in Hormone Signaling Pathways 509 Role of MAPK in Hormone Signaling Pathways 511 Role of Jasmonic Acid and Cytokinin on Hormone Signaling Pathways 515 Role of Brassinosteroids on Hormone Signaling Pathways 516 The Crosstalk of Hormones and Hormone-Like Substances in Plants under Abiotic and Biotic Stress Responses 518 Conclusion 520 References 521

17.4 17.5 17.6 17.7 17.8 17.9 k 18

Transgenic Approaches to Improve Crop Productivity via Phytohormonal Research: A Focus on the Mechanisms of Phytohormone Action 533 Brijesh Gupta, Rohit Joshi, Ashwani Pareek, and Sneh L. Singla-Pareek

18.1 18.2

Introduction 533 Phytohormones and Crop Yield: Approaches and Vision for Genetic Improvement 535 Cytokinins: Roles, Biosynthesis, and Signaling 535 Gibberellins: Roles, Biosynthesis, and Signaling 537 Brassinosteroids: Roles, Biosynthesis, and Signaling 539 Auxins: Roles, Biosynthesis, and Signaling 540 Manipulation of Phytohormone Levels in Transgenic Plants to Improve Crop Productivity 541 Cytokinins and Crop Yield 541 Gibberellins and Crop Yield 545 Brassinosteroids and Crop Yield 547 Auxins and Crop Yield 549 Phytohormonal Crosstalks to Enhance Crop Productivity 550 Conclusion and Future Directions 552 Acknowledgments 553 References 554

18.2.1 18.2.2 18.2.3 18.2.4 18.3 18.3.1 18.3.2 18.3.3 18.3.4 18.4 18.5

Index 569

k

k

k

xv

About the Editor Girdhar K. Pandey received his B.Sc. (Hon.) in Biochemistry

k

from Delhi University in 1992 and M.Sc. in Biotechnology in year 1994 from Banaras Hindu University (BHU). Subsequently, he joined the School of Life Sciences for his Ph.D., Jawaharlal Nehru University (JNU), and worked in the field of calcium signal transduction under abiotic stresses in plants. He was awarded the Ph.D. degree in 1999 and then pursued a post-doctoral career at the Department of Plant and Microbial Biology, University of California, Berkeley in 2000. There, he extended his work in the field of calcium-mediated signaling in Arabidopsis by studying CBL-CIPKs, phosphatases, channels/transporters, and transcription factors involved in abiotic stresses. Currently, he is working as Professor in the Department of Plant Molecular Biology, Delhi University South Campus. Pandey’s research interests involve detail mechanistic interplay of signal transduction networks in plant under mineral nutrient deficiency (mostly potassium, calcium, and nitrate) and abiotic stresses such as drought, salinity, and oxidative stresses induced by heavy metals. His laboratory is working on the coding and decoding of mineral nutrient deficiency and abiotic stress signals by studying several signaling components such as phospholipases (PLA, PLC, and PLD), calcium sensors such as calcineurin B-like (CBL) and CBL-interacting protein kinases (CIPK), phosphatases (mainly PP2C and DSP), transcription factors (AP2-domain containing or ERF, WRKY), transporters and channels proteins (potassium and calcium channels/transporters), small GTPases, and Armadillo domain containing proteins in both Arabidopsis and rice. The long-term goal of his research group is to establish the mechanistic interplay and crosstalk of mineral nutrient deficient conditions and different abiotic stress signaling cascades in Arabidopsis and rice model systems by using the advance tools of bio-informatics, genetics, cell biology, biochemistry, and physiology with greater emphasis on functional genomics approaches. See Pandey’s web page for further information about his lab and research work: https://sites.google.com/site/gkplab/home; www.dpmb.ac.in/index.php?page=girdharpandey

k

k

k

xvii

List of Contributors Srinivas Agurla

Anirban Bhar

Department of Plant Sciences, School of Life Sciences University of Hyderabad Hyderabad, India

Division of Plant Biology, Bose Institute and Post Graduate Department of Botany, Ramakrishna Mission Vivekananda Centenary College, West Bengal, India

Srivastava AK

k

Nuclear Agriculture and Biotechnology Division, Bhabha Atomic Research Centre Trombay, Mumbai, India

Sarabjit Bhatti

Department of Agricultural and Environmental Sciences, College of Agriculture, Human and Natural Sciences, Tennessee State University Nashville, TN, USA

Diana Alberto

Université de Rennes, Centre National de la Recherche Scientifique Rennes, France

Yaroslav B. Blume

Nuclear Agriculture and Biotechnology Division, Bhabha Atomic Research Centre Trombay, Mumbai, India

Department of Genomics and Molecular Biotechnology, Institute of Food Biotechnology and Genomics, National Academy of Sciences of Ukraine Kyiv, Ukraine

Muhammad Younas Khan Barozai

Moniya Chatterjee

Department of Botany, University of Balochistan Quetta, Pakistan

Division of Plant Biology, Bose Institute West Bengal, India

Alice Basile

Ivan Couée

Institute of Biology, RWTH Aachen University Aachen, Germany

Université de Rennes, Centre National de la Recherche Scientifique Rennes, France

Sharma B

k

k

k

xviii

List of Contributors

Sampa Das

Zahra Iqbal

Division of Plant Biology, Bose Institute West Bengal, India

Council of Scientific and Industrial Research, National Botanical Research Institute Lucknow, India

Zhaojun Ding

The Key Laboratory of Plant Cell Engineering and Germplasm Innovation, Ministry of Education, College of Life Sciences, Shandong University Jinan, People’s Republic of China

Pankaj Jaiswal

Nidhi Dwivedi

Martin Janda

National Institute of Plant Genome Research, New Delhi, India Marco Fambrini

Dipartimento di Scienze Agrarie, Ambientali e Agro-alimentari, Università degli Studi di Pisa Pisa, Italy k

Gunja Gayatri

Department of Plant Sciences, School of Life Sciences University of Hyderabad Hyderabad, India Gwenola Gouesbet

Université de Rennes, Centre National de la Recherche Scientifique Rennes, France Brijesh Gupta

Plant Stress Biology, International Centre for Genetic Engineering and Biotechnology New Delhi, India Sumanti Gupta

Division of Plant Biology, Bose Institute and Department of Botany, Rabindra Mahavidyalaya, Champadanga, West Bengal, India

Department of Botany and Plant Pathology, Oregon State University Corvallis, OR, USA

Department of Biochemistry and Microbiology, University of Chemistry and Technology Prague, and Laboratory of Pathological Plant Physiology, Institute of Experimental Botany AS CR Prague, Czech Republic Rohit Joshi

Plant Stress Biology, International Centre for Genetic Engineering and Biotechnology New Delhi, India Tetiana Kalachova

Institute of Bioorganic Chemistry and Petrochemistry, National Academy of Sciences of Ukraine, Kiev, Ukraine; and CNRS and Institut d’Ecologie et des Sciences de l’Environnement de Paris, Université Paris-Est, Créteil, France Xiangpei Kong

The Key Laboratory of Plant Cell Engineering and Germplasm Innovation, Ministry of Education, College of Life Sciences, Shandong University Jinan, People’s Republic of China

k

k

k

List of Contributors

Yuliya A. Krasylenko

Suprasanna P

Department of Genomics and Molecular Biotechnology, Institute of Food Biotechnology and Genomics, National Academy of Sciences of Ukraine Kyiv, Ukraine

Department of Biological Sciences, University of the Sciences in Philadelphia Philadelphia, PA, USA

Vinay Kumar

National Institute of Plant Genome Research, New Delhi, India

xix

Bhoopendra K. Pandey

Council of Scientific and Industrial Research, National Botanical Research Institute Lucknow, India, and Academy of Scientific and Innovative Research New Delhi, India

Dhirendra Kumar

Department of Biological Sciences, East Tennessee State University Johnson City, TN, USA

Neha Pandey

Council of Scientific and Industrial Research, National Botanical Research Institute Lucknow, India

Marco Landi

k

Dipartimento di Scienze Agrarie, Ambientali e Agro-alimentari, Università degli Studi di Pisa Pisa, Italy

Jogeswar Panigrahi

School of Life Sciences, Sambalpur University Sambalpur, Odisha, India

Neeti-Sanan Mishra

Plant RNAi Biology Group, International Centre for Genetic Engineering and Biotechnology New Delhi, India

Ashwani Pareek

Stress Physiology and Molecular Biology Laboratory, School of Life Sciences, Jawaharlal Nehru University, New Delhi, India

Deepti Mittal

Plant RNAi Biology Group, International Centre for Genetic Engineering and Biotechnology New Delhi, India

Sneh L. Singla-Pareek

Plant Stress Biology, International Centre for Genetic Engineering and Biotechnology New Delhi, India

Sushma Naithani

Department of Botany and Plant Pathology, Oregon State University Corvallis, OR, USA

Xiao Bo Pei

Department of Agricultural and Environmental Sciences, College of Agriculture, Human and Natural Sciences, Tennessee State University Nashville, TN, USA

Hiro Nonogaki

Department of Horticulture, Oregon State University Corvallis, OR, USA

k

k

k

xx

List of Contributors

Igor Pokotylo

Pranav Pankaj Sahu

Institute of Bioorganic Chemistry and Petrochemistry, National Academy of Sciences of Ukraine Kiev, Ukraine

National Institute of Plant Genome Research, New Delhi, India Sasikiran Reddy Sangireddy

Manoj Prasad

National Institute of Plant Genome Research, New Delhi, India Claudio Pugliesi

Dipartimento di Scienze Agrarie, Ambientali e Agro-alimentari, Università degli Studi di Pisa Pisa, Italy Agepati S. Raghavendra

Department of Plant Sciences, School of Life Sciences University of Hyderabad Hyderabad, India k

Department of Agricultural and Environmental Sciences, College of Agriculture, Human and Natural Sciences, Tennessee State University Nashville, TN, USA Samir V. Sawant

Council of Scientific and Industrial Research, National Botanical Research Institute Lucknow, India, and Academy of Scientific and Innovative Research New Delhi, India Anne-Antonella Serra

Fanny Ramel

Université de Rennes, Centre National de la Recherche Scientifique Rennes, France

Université de Rennes, Centre National de la Recherche Scientifique Rennes, France Namisha Sharma

Swatismita Dhar Ray

Biotechnology and Bioresources Management Division, The Energy and Resources Institute New Delhi, India Gyana Ranjan Rout

School of Life Sciences, Sambalpur University Sambalpur, Odisha, India

National Institute of Plant Genome Research, New Delhi, India Neha Sharma

Plant RNAi Biology Group, International Centre for Genetic Engineering and Biotechnology New Delhi, India Cécile Sulmon

Eric Ruelland

CNRS and Institut d’Ecologie et des Sciences de l’Environnement de Paris, Université Paris-Est, Créteil, France

Université de Rennes, Centre National de la Recherche Scientifique Rennes, France

k

k

k

List of Contributors

Redij T

Zhujia Ye

Department of Biological Sciences, University of the Sciences in Philadelphia Philadelphia, PA, USA

Department of Agricultural and Environmental Sciences, College of Agriculture, Human and Natural Sciences, Tennessee State University Nashville, TN, USA

Jitendra K. Thakur

National Institute of Plant Genome Research, New Delhi, India

Alla I. Yemets

Department of Genomics and Molecular Biotechnology, Institute of Food Biotechnology and Genomics, National Academy of Sciences of Ukraine Kyiv, Ukraine

Bal Krishna Chand Thakuri

Department of Biological Sciences, East Tennessee State University Johnson City, TN, USA Theodore Thannhauser

Plant, Soil and Nutrition Research Unit, USDA-ARS Ithaca, NY, USA

Alain Zachowski

CNRS and Institut d’Ecologie et des Sciences de l’Environnement de Paris, Université Paris-Est, Créteil, France

Huiyu Tian

k

xxi

The Key Laboratory of Plant Cell Engineering and Germplasm Innovation, Ministry of Education, College of Life Sciences, Shandong University Jinan, People’s Republic of China

Suping Zhou

Department of Agricultural and Environmental Sciences, College of Agriculture, Human and Natural Sciences, Tennessee State University Nashville, TN, USA

Diwaker Tripathi

Department of Plant Pathology, Washington State University Pullman, WA, USA

k

k

k

xxiii

Preface

k

One of the basic biological differences between plants and animals is in their habit of growth and development. During the processes of evolution, unlike animals, plants adopted sessile and relatively immobile growth habits to complete their lifecycle. However, common key chemical communicators called “hormones” regulate growth and development in a similar fashion in plants and animals. Plant hormones are known as “phytohormones,” which act locally and systemically to regulate their growth and development. The importance of phytohormones in a plant’s biological activities can be perceived well typically in a tissue culture system, where a slight alteration in the level of various hormones lead to development of undifferentiated mass of cells called the callus. The Phytohormones act at a very low concentration, usually in nano- to micro molar amounts within a plant cell. Owing to this, initial attempts to understand the biochemical and functional role of phytohormones remained inconclusive. However, with the help of chemical synthesis, large-scale purification, and through mutant based genetic approaches, valuable information to understand the underlying mechanism has been unearthed for the role of phytohormones over the past few decades. The detailed biosynthetic and signal transduction pathways have been identified for most of the classical phytohormones like auxin, abscisic acid, gibberllin, cytokinin, and ethylene along with the newly discovered brassinosteroids, salicylic acid, jasmonic acid, nitric oxide, and others. Using the tools of genetics, biochemistry, and molecular biology, plant biologists are now able to develop a concrete roadmap starting from the biosynthesis to perception and action of many of these phytohormones in regulating physiological and developmental responses. Mounting evidence suggest that, besides regulating the growth of plants, phytohormones are the critical factors that also play a role in fine-tuning the metabolism and physiology of the plants under varying environmental cues. In the natural growth environment, plants perceive a large number of favorable (nutrient, water, light) and unfavorable stimuli (abiotic and biotic stresses), which influence their growth and development. To counteract these adverse conditions, plants have developed an intricate web of complex machineries to translate perceived stress signal into effective response by modulating the gene expression or directly affecting the physiology of the cell. Phytohormones or plant growth regulators are the key chemical molecules that are involved in broad spectrum of signaling pathways in response to a particular abiotic or biotic stress mounting an effective defense response.

k

k

k

xxiv

k

Preface

Similar to other signaling molecules, phytohormones act coordinately to generate synergistic, antagonistic, and additive or subtractive responses. The direct indication of this cross talk is considered to be based on molecular interactions between factors regulating phytohormone signal action pathways. Thus, to elucidate the molecular mechanism of possible integration of phytohormone signaling pathways with the intermediates of other signaling cascades under a given condition requires the major attention of plant biologists. More than ever, in the current state where aggressive climate change, rapidly growing population, and diminishing fertile land due to increased exploitation of natural resources imposes serious threat to crop production worldwide. And so, the major focus of plant biologists across the world is to improve crop productivity and yield. With the development of gene cloning, genetic engineering, and genome editing, modification of a food crop’s genetic makeup to accustom it toward changing conditions paves way for the possibility of development and enhancement of tolerance against these stresses. In the field conditions, crops are constantly exposed to multitude of stresses and efforts are being focused towards generating new crop varieties that can tolerate these multiple stresses without yield loss. Detail molecular understanding of the cross talk and interaction of different phytohormones would certainly open new directions to design strategies to generate stress tolerant high yielding crop varieties. In the post-genomic era, one of the major challenges is the functional analysis and understanding of plant hormone associated multiple genes and gene families regulating a particular physiological and developmental aspect of plant lifecycles. One of the important physiological processes is stress response regulation, which leads to adaptation in response to adverse stimuli. With the holistic understanding of the molecular mechanism of plant hormones associated signaling involving more than one gene family, plant biologist can lay the foundation for designing and generating future crops, which can withstand adverse environmental conditions without compromising on yield and productivity. This book on Mechanism of Plant Hormone Signaling under Stress comprises of two volumes (Volume I and Volume II with 18 chapters in each). Several plant biologists throughout the world have contributed in the field of ‘mechanisms of plant hormone action’ in plants with a special emphasis on ‘stress signaling in plants’. This book describes the timely and state-of-art contribution to knowledge in the field of ‘phytohormone mediated signaling under stress’ to develop a better and holistic understanding of hormone stress perception, transduction followed by the generation of response. Despite of availability of large number of publications in the field of action of phytohormones during stress conditions, the in-depth analysis of this aspect has not been covered in previous books and volumes. Above all, the topics include a greater emphasis on genomics and functional genomics aspects in order to understand the global and whole genome level changes under particular stress conditions through a functional genomics perspective. With functional genomics tools, the mechanisms of phytohormone signaling and their target genes can be defined in a more systematic manner. The integrated analysis of phytohormone signaling under single or multiple stress conditions may prove exceptional to design stress tolerant crop plants in field conditions. Toward achieving

k

k

k

Preface

k

this goal, the book is divided into four sections. Volume I comprises the first part where 18 chapters on Action of Phytohormones in Stress discusses the mechanistic action of the most common phytohormones, and their roles in stress signaling in plants. These chapters will aware the readers primarily on the detailed signaling pathways and their roles in various stress conditions in plants. The first three chapters (Chapter 1– 3) are dealing with the various aspects of biosynthesis, signaling, and action of classical phytohormone, auxin in multiple stress conditions. The Chapter 4 describes the metabolism, homeostasis, and signaling pathways of another classical phytohormone, cytokinin, known to regulate growth and differentiation in plants, also involved in various stress conditions. GA also belongs to the category of classical phytohormone regulating plant growth by cell division and elongation. Chapter 5 and 6 discuss the various roles of GA, its metabolism, signal transduction pathways, and also its interaction with JA in stress conditions in plants. In continuation with Chapter 6, where interaction of GA with JA is discussed, their elaborate role, metabolism, and signaling pathway is discussed in detail in Chapter 7 with a special emphasis of JA in stress management. The another typical phytohormone, ABA, long known to regulate stress related responses in plants is extensively discussed in Chapters 8–11, where different contributors have discussed its in-depth signal transduction and mechanism of action in regulating both abiotic and biotic stresses. Ethylene is also a conventional gaseous hormone known to regulate fruit ripening and senescence in plants. Chapters 12 and 13 discusses the elaborate aspects of ethylene signal transduction and responses under both abiotic and biotic stresses and cross talk with other phytohormones. Chapters 14 to 16 emphasizes the signal transduction and detail role of another gaseous hormone, nitric oxide or NO and the process of S-nitrosylation in several abiotic stress conditions in plants. Salicylic acid (SA) is mostly appreciated as an important phytohormone regulating biotic stress. SA is also well elaborated upon in multiple abiotic stresses in Chapter 17. The last chapter of the Part I (Chapter 18) describes the complex interplay of brassinosteroid (BR) and glucose in growth and development, and also during environmental stress conditions. Volume II of this book contains three parts (Parts II–IV) consisting of 18 chapters in total. Part II of this book describes the role of several different factors that are intangibly linked with phytohormone signaling under biotic and abiotic stresses. Chapters 1 and 2 elaborate the role of reactive oxygen species (ROS) in regulating both abiotic and biotic stress responses. ROS are key signaling molecules, which are also interacting and participating in multiple phytohormone-mediated signaling and response pathways during various stress conditions in plants. Calcium (Ca2+ ) is a metal ion involved in regulating a plethora of biological processes including stress signal transduction pathways in plants. Ca2+ acts as second messenger and is involved in signaling pathways of several phytohormones. The most studied phytohormone where Ca2+ is a pivotal signaling molecule is abscisic acid (ABA) regulating several abiotic stress responses. Chapter 3 focuses on the role of Ca2+ signaling components and their complex interplay with multiple phytohormones in plants. Chapter 4 reports the role of phospholipids in regulating various signaling pathways during biotic and abiotic stresses and their interaction with phytohormones. Emerging evidences showing effects of biotic and abiotic stresses on cytoskeletal protein network mediated through different phytohormone is highlighted in Chapter 5. In the Chapter 6, the role of several proteins involved in metabolism, transport, and signal transduction of different phytohormones is discussed. Further, increased use of man-made chemicals such as organic compounds mainly used

k

xxv

k

k

xxvi

k

Preface

as pesticides, herbicides, and fungicides has resulted in the accumulation of these xenobiotic compounds in the environment that leads to interference with plant hormone signaling and metabolism. Chapter 7 articulates important aspects of interaction of xenobiotic compounds with phytohormone signaling and metabolism, and opens up new possibilities to investigate these aspects at molecular levels. In Chapter 8, the role of phytohormone mediated signaling in several metal stresses and how plants changes their growth and development in response to toxic metal ions is well documented. Part III (in Volume II) of this book comprised of three chapters, which mainly discusses the role of transcription factors, transcription activators, and microRNA in the regulation of phytohormones related gene expression under stress and developmental conditions. In Chapter 9, the development of stomata by several transcription factors and their regulation by multiple phytohormones is described. Since stomata is the gate-keeper that controls the passage of gases like CO2 , O2 , and are responsible for the transpirational pull of water and nutrients from the soil, their opening and closure is thoroughly fine-tuned by several phytohormones, majorly by ABA. This chapter details the interplay of phytohormones in the development of stomata and their regulation under abiotic stresses mediated by multiple phytohormones. Chapter 10 describes the role of the phytohormone regulated mediator complex. This is a large multimeric transcriptional activator complex, involved in regulating the transcription of multiple stress inducible genes. In Chapter 11, the complex regulatory roles of micro-RNA in modulating the gene expression in phytohormones and abiotic stress conditions are extensively elucidated. The last part of this book (in Volume II), Part IV is comprised of seven chapters, mainly discussing the roles of multiple phytohormones in diverse stress adaptive responses. The first chapter in this section, i.e., Chapter 12 confers on the role of multiple phytohormones and microbial elicitors in regulating the signaling pathway in guard cell during stomatal closure. Chapter 13 elaborates on how phytohormones are involved in regulating pathogen infection and plant defense and immune response during biotic stress. In Chapter 14, the role of multiple phytohormones is described in regulating both seed development and stress responses. The important role and interaction of multiple phytohormones is once more discussed in abiotic and biotic stress responses in Chapter 15 with special emphasis on SA and its interaction with other phytohormones. With the identification of multiple phytohormones signaling pathways, it is well appreciated that many of these phytohormone shows the complex interaction because of convergence and overlap of signal transduction components such as kinases, phosphatases, transcription factors, and other signaling molecules. Chapters 16 and 17 highlight the complex interplay of several phytohormones in abiotic and biotic stress regulation and crosstalk. The last chapter of this section, Chapter 18, emphasizes on the transgenic approaches to manipulate crop productivity by altering the levels of several phytohormones. With an in-depth understanding of several signal transduction components mediated by phytohormones, the ultimate goal is to translate this mechanistic knowledge into useful tools to generate crop varieties with either genetic alteration of these signaling components, or to utilize this knowledge for molecular-marker assisted breeding, which ultimately augment stress tolerance in crop plants without compromising their productivity. Despite my rigorous attempts, not all aspects of phytohormone signaling and components could be discussed here because of space constraints. Nevertheless, I strongly

k

k

k

Preface

xxvii

believe that this book, covering different characteristics of phytohormone signal transduction machinery with a special emphasis on the mechanistic action under stress conditions will prove extremely useful to students, teachers, and research scientists. I am grateful to all the contributors of this work, which could not be possibly compiled without their significant contributions. At last, I would like to express my sincere thanks to Dr. M.C. Tyagi, Dr. Amita Pandey, and Ms. Manisha Sharma for critical reading and constructive suggestions related to this book. Ms. Manisha Sharma is also acknowledged for designing the cover page of this book. I am also thankful to Delhi University, University Grant Commission, Department of Biotechnology, Department of Science and Technology, and Council of Scientific and Industrial Research, India for supporting research in my laboratory. Girdhar K. Pandey (Editor)

k

k

k

k

1

Part I Action of Phytohormones in Stress

k

k

k

k

3

1 Auxin as a Mediator of Abiotic Stress Responses Branka Salopek-Sondi, Iva Pavlovi´c, Ana Smolko, and Dunja Šamec Department for Molecular Biology, Rud-er Boškovi´c Institute, Zagreb, Croatia

1.1 Introduction

k

Being sessile organisms, plants must respond to various unfavorable environmental conditions (abiotic stress). This has been particularly important in recent decades in the context of current climate variability, as well as predicted continued warming and decreased precipitation. The effect of environmental changes has significantly influenced global agricultural production [1–3]. It is estimated that considerable losses in crop productivity (more than 50%) are caused by abiotic stresses such as drought, increased salinity, and extreme temperature [4]; hence they threaten worldwide food security. Over 6% of global land area is estimated to be affected by salinity, 64% by drought, 13% by flooding, and about 57% by extreme temperatures [5–7]. In the period 2000–2009, reported as the warmest decade, the net primary production (plant biomass) decreased as a result of large-scale droughts in the Southern Hemisphere [3]. Due to urgent need to increase abiotic stress tolerance in plants, many scientists in the fields of plant biology, agronomy, ecology, and biotechnology have been challenged to investigate and understand mechanisms underlying plant abiotic stress responses and tolerance. As a result of that trend, Cramer et al. [6] reported in their review a continuous increase in publications related to systems biology and abiotic stress. This type of research is becoming increasingly important in the context of food security and energy production. Plants have developed complex mechanisms for perceiving external signals and respond accordingly by altering the expression of numerous defense-signaling molecules [8]. The most common responses of plants to stresses are growth retardation and reduced metabolism to maximize survival under adverse environmental conditions. These compromise a wide range of processes such as modification of photosynthesis, increased antioxidant activities, secondary metabolites accumulation, changes in gene expression, and so on. [9]. Phytohormones or plant growth regulators are crucial for the ability of plants to adapt to unfavorable environmental changes (abiotic stress) by mediating a wide range of adaptive responses, such as growth, development, nutrient allocation, and source/sink transitions [10–12]. All of the processes mentioned previously, which are involved in growth and developmental plasticity that impact on crop performance and yield, Mechanism of Plant Hormone Signaling under Stress, First Edition, Volume 1. Edited by Girdhar Pandey. © 2017 John Wiley & Sons, Inc. Published 2017 by John Wiley & Sons, Inc.

k

k

k

4

Mechanism of Plant Hormone Signaling under Stress

are controlled by plant hormone balance and complex crosstalk [13]. In recent years emerging evidence suggests that the phytohormone auxin acts as a frequent player in the majority of hormonal interactions in stress conditions [13–15]. Auxin signaling has been proposed to participate in the adaptive response against oxidative stress and salinity by interacting with the redox metabolism in Arabidopsis [16]. Moreover, ROS, auxin, and antioxidants, such as ascorbate, GSH, and related proteins, have been proposed as forming a redox signaling module that links plant development with environmental cues [17, 18]. Other plant hormones, such as cytokinins, brassinosteroids, ethylene, abscisic acid, gibberellins, jasmonic acid, and strigolactones interact either synergistically or antagonistically with auxin to trigger cascades of events leading to stress responses. Here, we summarize the recent findings on the auxin as a part of a complex signaling network mediating stress responses of plants to environmental changes.

1.2 Auxin: A Short Overview of Appearance, Metabolism, Transport, and Analytics

k

Around 1880, Charles Darwin and Ciesielski independently postulated that a “transmitted influence” present in the tip of plant shoots was responsible for gravitropism. More than 100 years after Darwin’s research, development of precise quantitative methods, good model systems for in vivo analysis, and mutants allowed substantial progress in the understanding of auxin (mostly indole-3-acetic acid, IAA) metabolism and mode of action. New scientific articles appeared periodically with updated information on plant hormone auxin, its appearance in plant kingdom, physiological role, as well as regulation of its activity. IAA has long been recognized as the key hormone that, alone or in combination with other hormones, is responsible for regulating different aspects of plant growth and development [19, 20]. IAA is the most abundant auxin in plant kingdom and the most studied one, although some other endogenous auxins have been reported, such as indole-3-butyric acid (IBA), 4-chloroindole-3-acetic acid (4-Cl-IAA), and phenylacetic acid (PAA) [21, 22]. In the plant, the auxin pool consists of a mixture of free auxin, auxin conjugates, the inactive auxin precursors, and the inactive methyl ester form of IAA, MeIAA [21, 23]. Plant development is regulated by precisely controlled processes such as auxin biosynthesis, reversible and irreversible conjugation, transport, accumulation, and degradation. The fine-tuning of auxin concentrations with local auxin maxima, directional cell-to-cell transport and auxin gradients, together with the differential distribution of the auxin signaling pathways allow the correct setting of developmental cues and directional growth in response to highly changing environment. A short overview of IAA metabolism and the involved enzymes identified up to now can be seen in Fig. 1.1. 1.2.1 De Novo Synthesis

Two major pathways in IAA biosynthesis are tryptophan (Trp)-dependent and (Trp)-independent pathways [24]. In Trp-dependent pathways, four interconnected

k

k

k

1 Auxin as a Mediator of Abiotic Stress Responses

De novo synthesis

Conjugation pathways

Ester linked IAA

B1 T84 UG D1 T74 UG

...

AMI1

UC YU C s,. ..A IPD s Q C, AO

GH3

2/3 9B P7 CY

TDC

TAA/TARs

IPyA TAM Y IAOx

Amide linked IAA ILR1 ILL2 IAR3

Trp-dependent

IAM

IAMT1

H2

C ,E Rs

DAO1

Trp-independent

IBA

IBA to IAA conversion

UG T74 D UG T74 1 E2

MeIAA

Amide linked OxIAA

IB

k

5

OxIAA-Glc OxIAA IBA-Glc

4D1 GT7

U

Degradation pathways

Figure 1.1 Brief overview of auxin homeostasis. Genes encoding IAA biosynthetic and metabolic enzymes identified are shown in black. The red fonts indicate the proposed reaction steps catalyzed by in vitro characterized enzymes. Arrows at steps for which enzymes have been identified are solid and arrows in pathways that have not been identified are dashed and may be single or multiple steps. Abbreviations: aldehyde oxidase (AO), amidase1 (AMI1), cytochrome P450 79B2 and P450 79B3 (CYP7952/3), dioxygenase for auxin oxidation 1 (DAO1), enoyl-CoA hydratase 2 (ECH2), IAA-carboxymethyltransferase 1(IATM1), indole-3-acetamide (IAM), indole-3-acetaldoxime (IAox), indole-3-pyruvate decarboxylase (IPDC), indole-3-pyruvic acid (IPyA), nitrilases (NITs), oxindole-3-acetic acid (oxIAA), peroxisomal enzymes including indole-3-butyric acid response1/3/10 (IBRs), tryptamine (TAM), tryptophan aminotransferase1 (TAA1), tryptophan aminotransferase related 1–4 (TARs), tryptophan decarboxylase (TDC), UDP-glycosyltransferases (UGTs), flavin monooxygenases (YUCs). This scheme has been created based on recent updates on the auxin metabolism [23, 25, 26, 36–38].

pathways have been postulated [25]: (i) the indole-3-acetamide (IAM) pathway; (ii) the indole-3-pyruvic acid (IPyA) pathway; (iii) the tryptamine (TAM) pathway; and (iv) the indole-3-acetaldoxime (IAOx) pathway. Recently, historical overviews of auxins biosynthesis and future guidelines have been summarized in review articles by Tivendale et al. [25] and Ljung [26]. 1.2.2 Reversible and Irreversible Conjugation Pathways

Depending on the tissue and the plant species studied, abundance of the IAA free form in plants is up to 25%, while the rest are conjugates. Major forms of auxin conjugates in higher plants include ester-linked simple and complex carbohydrate

k

k

k

6

Mechanism of Plant Hormone Signaling under Stress

conjugates, amide-linked amino acid conjugates, and amide linked peptide and protein conjugates [23, 27]. IAA conjugates are regarded as reversible, storage compounds, or irreversible conjugates that are subjected to degradation. Previous studies reported that conjugates serve many functions involved in the regulation of the levels of the active hormone but their function during plant growth and development is still under investigation. 1.2.3 IBA to IAA Conversion

k

IBA was discovered as a synthetic compound that induced root initiation. Later, endogenous IBA has been identified by gas chromatography–mass spectrometry (GC-MS) in a variety of plants, including pea, cypress, maize, carrot, tobacco, and Arabidopsis [28]. IBA and IAA show many similarities, such as the ability to form conjugates, and the structure of the molecule; the side chain of IBA is two carbons longer than the IAA side chain [29]. Therefore, it has been shown that IAA could be converted to IBA by reaction of acetylation in dark grown maize seedlings. Conversely, IBA can be shortened to IAA by peroxisomal β-oxidation in oil-seed plants like Arabidopsis, and provides IBA-derived IAA, which is included in certain developmental processes [30, 31]. So far, numerous studies support the fact that IBA is an endogenous precursor of IAA [22, 27, 32, 33]. However, a report from Novák et al. [34] showed no existence of IBA in several plants, although they performed systematic analytical research of auxins by using cutting edge methodology. In this report, IBA has not been identified in Arabidopsis, nor in other plant species such as Populus and wheat. It was not identified either in the triple Arabidopsis mutant ibr1-2 ibr3-1 ibr10-1, which should accumulate IBA due to a blockade in the conversion of IBA to IAA via β-oxidation. Possible reasons that authors speculated with are: (i) IBA level was below the detection limit in the investigated samples, or (ii) IBA simply was not synthesized in the investigated plant species under growing conditions applied in experiments. Consequently, authors doubt that IBA is an endogenous compound in Arabidopsis, at least under applied growth conditions, and it is therefore unlikely that IBA functions as a significant endogenous precursor for IAA biosynthesis. It was suggested that the reason for determination of IBA in previous studies is the use of GC-MS selected ion monitoring (SIM), methods that are much less selective than GC and LC tandem mass spectrometry (MS/MS) analysis. Authors speculated that co-eluting peaks from the plant matrix or interference from unlabeled IBA present in the internal standard may give a false positive signal for IBA on GC-MS in SIM mode. This example shows that auxins role in plant growth and development is still not fully understood and needs to be explained in the future. 1.2.4 Degradation Pathways

Certain auxin storage forms can be converted back to the active auxin IAA, while some storage forms appear to comprise an IAA inactivation pathway and cannot be converted back to active IAA [23]. Some auxin conjugates, such as IAA–sugar conjugates or IAA–Asp and IAA–Glu, have roles in IAA inactivation [35]. Additionally, 2-oxindole-3-acetic acid (oxIAA), which is the first precursor in the pathway responsible for catabolism of IAA, and conjugates of oxIAA play an

k

k

k

1 Auxin as a Mediator of Abiotic Stress Responses

7

important role in the degradation process [36]. Experiments using Arabidopsis IAA-overproducing mutants showed that OxIAA has little biological activity and is formed in plants rapidly and irreversibly in response to increases in auxin levels [39]. Therefore, authors conclude that oxidation of IAA to oxIAA is an important regulator of IAA homeostasis, capable of modulating developmentally important auxin gradients and auxin level in plants. Recently published papers describe function of the A. thaliana gen AtDAO1 which encodes IAA oxidase, cytosolic enzyme, which represents the major regulator of auxin degradation to oxIAA [37, 38]. 1.2.5 Polar Auxin Transport

k

Additional process participating in auxin homeostasis is polar auxin transport. Plants have evolved complex machineries mediating intra- and inter-cellular polar auxin transport that enables the establishment of hormonal concentration and hence activity gradients, thus shaping plant growth and development. During plant growth, the shoot will bend up against the gravity vector (negative gravitropism), whereas the root will bend down with the gravity vector (positive gravitropism). In both cases, the growth response is the result of asymmetric auxin distribution, with elevated concentrations at the lower side of the tissue and reduced concentrations at the upper side. By using the model plant Arabidopsis, a number of auxin transport proteins have been identified, which essentially belong to three classes: (i) AUX/LAX family of intrinsic membrane proteins with resemblance to tryptophan permeases implicated in cellular uptake of the auxin; (ii) ABCB group of ATP-binding cassette membrane proteins involved in cellular efflux and uptake of auxin; and (iii) PIN families, a plant-specific class of membrane proteins involved in auxin cellular efflux as well as in intracellular compartmentalization [40–43]. An additional class of auxin transport proteins, PILS (PIN-LIKES), has recently been reported to participate in modulation of intracellular auxin homeostasis [44]. 1.2.6 Analytical Methods in Auxin Identification and Quantification

A major limitation in auxin research has been measuring the level of endogenous auxins in plants. Since auxins, including IAA, are present in very low abundance, their identification and quantification require more sensitive detection methods than those used for the study of a major metabolic pathway. Auxins are usually present at low concentrations in plant tissues, generally pg/g fresh weight, while substances that interfere with their analysis are present in far greater concentrations [45]. For example, IAA is easily lost by binding to plant constituents or even by binding to glassware and during the assay is subject to oxidative destruction. Thus, the development of modern methods which reduce its loss during preparation and the use of high-resolution devices for their extraction, purification, identification, and quantification have been essential for their accurate and precise determination. Consequently, important milestone in auxin research is the synthesis of stable internal standards [46] that could be added to the plant extract, and then losses of IAA could be corrected by means of mass spectrometry. Early assays for auxin analysis required as much as 4 kg of plant material per assay [47], while today, less than 20 mg of fresh plant tissue is enough for auxin analysis by using modern approaches [48]. Because of low auxin level in plant their target analysis

k

k

k

8

k

Mechanism of Plant Hormone Signaling under Stress

from crude plant extracts may be hindered by signal suppression due to strong matrix effects. These can be mitigated by a time consuming process including solid-phase extraction (SPE), HPLC purification and multiple concentration steps using a rotary evaporator [49]. Recently, some new faster methods have been introduced, such as the high-throughput method that allows the analysis of up to 96 samples per day [50] or the miniature system for purifying IAA and its biosynthetic precursors using SPE tips [51]. For a many years GC-MS was the most commonly employed method for quantifying IAA or IAA precursors in plant tissues [45]. Often, gas chromatography (GC) coupled with selected ion monitoring (SIM) on a single quadrupole (MS) was used [50, 52], or recently, triple-quadrupole MS (MS/MS) [51] mass spectrometer with previous solid phase extraction (SPE). The advantages of GC-MS are predictability and reproducibility of fragmentation patterns, but the drawback of this method is the fact that IAA is not volatile; so time-consuming analyte derivatization procedures are required. On the other hand, frequently used GC-MS methods using selected ion monitoring (GC-SIM-MS) on either ion trap or single quadrupole mass spectrometers are much less selective than GC and LC tandem mass spectrometry (MS/MS) analysis. For example, IBA which was detected in variety of plants [28] as an endogenous compound using GC-SIM-MS, was not detected in Arabidopsis (neither wild type, nor the triple mutant ibr1-2 ibr3-1 ibr10-1) and other plants using LC-MRM-MS or GC-MRM-MS [34]. A possible reason is that co-eluting peaks from the plant matrix or interference from unlabeled IBA present in the internal standard may give a false positive signal for IBA determination by GC-SIM-MS. This example demonstrates the importance of selecting appropriate analytical methods for auxin analysis which will give the most credible results. In recent years, for auxin analysis more sensitive and selective liquid chromatography-multiple reaction monitoring-mass spectrometry (LC-MRM-MS) analysis has been used [34, 39, 48, 53, 54]. This is the best currently available analytical technology that is capable of determining, besides free IAA, its auxin precursors, conjugates (reversible/irreversible), and IAA catabolites. As we mentioned before, only a small amount of IAA is in the free form, so determination of auxins conjugates is a critical step in understanding their functions and roles in plants growth and development. Identification of IAA-conjugates requires a much more intricate procedure than the measurements of IAA alone, mainly because levels of IAA conjugates in plant extracts are significantly lower. Historically, conjugate analysis has been mostly based on total conjugates determined after hydrolysis. A commonly employed technique for estimating the amount of IAA conjugates is sodium hydroxide (NaOH) treatment of the sample in which IAA conjugates hydrolyze to release free IAA. It was found that 1 M sodium hydroxide (NaOH) treatment of the sample for 1 h at room temperature is adequate to hydrolyze IAA-ester conjugates without affecting IAA-amide conjugates [55] while 7 M NaOH treatment at 100∘ C for 3 h completely hydrolyzes all conjugated forms of IAA and this total hydrolysable IAA was termed “total IAA” [49]. This method has been used for years for the determination of total auxins in numerous studies, but a recently published paper by Yu et al. [56] clearly demonstrated the limits associated with the base hydrolysis in determining IAA conjugates, particularly in plants from Brassicaceae family. The authors showed that significant portion of the IAA found after base treatment could be attributed to chemical conversions other than conjugate hydrolysis, which can lead to false positive results. For

k

k

k

1 Auxin as a Mediator of Abiotic Stress Responses

9

determining IAA conjugates more direct approaches such as mass spectrometry based strategies for unambiguous characterizations, should be used. Synthesis of labeled auxin conjugates [53, 57], which could be used as internal standards, enabled investigation and identification of a broader range of IAA conjugated to amino acids. Recently modern analytical approaches for unambiguous conjugate identification and quantification have been developed. Usually they include the use of an internal standard, immunoaffinity extraction [53, 54], and the use of modern analytical technology based on liquid chromatography-tandem mass spectrometry (LC–MS/MS), which is capable of determining both IAA and its amino acid conjugates [45].

1.3 How Auxin Homeostasis Shifts with Diverse Abiotic Stresses 1.3.1 How the Auxin Pool is Affected by Abiotic Stress?

k

Auxin homeostasis, and subsequently plant growth, is modulated by various developmental and environmental stimuli acting on the regulation of the auxin level and distribution. Research on a variety of plant species demonstrated that auxin homeostasis directly links growth regulation with stress adaptation responses [27, 58, 59]. Generally, free auxin content appears decreased in many plant species under abiotic stress conditions, suggesting that a diminished auxin content may be a factor that adapts plant growth (generally reduces) during adverse environmental conditions. One example of growth inhibition of Brassica rapa seedlings under salt stress can be seen in Fig. 1.2. Root elongation has been reduced from 60% to 100% with NaCl in concentration range 50–200 mM. Severe stresses, including drought and salinity stress, decrease the overall root growth of seedlings. However, recent studies have shown that, in lower concentrations of salt or mild drought, specific adjustments of root architecture can be observed, involving branching and changes in the growth direction [60]. Salt stress is reported to cause a great reduction in IAA in rice leaves [61], tomato leaf [62], wheat roots [63], and Chinese cabbage roots (own unpublished data). In poplar trees, the free auxin content was also found to decline during salinity [64] and drought conditions [65], while auxin conjugates were increased. Decreased level of free auxin was also noted in apple during salt and cold stress [66]. Tognetti et al. [67] furthermore reported significant increase of IBA and IBA-Glc conjugates in Arabidopsis under PEG induced stress (osmotic stress) while IAA level was decreased. This was in agreement with the previously reported data of Ludwig-Müller and Hilgenberg [68] in maize, where both free and conjugated IBA were increased in maize under water-limiting conditions. For the study of auxin homeostasis under abiotic stress, Arabidopsis transgene line DR5::GUS has been a particularly useful tool for monitoring the changes in auxin accumulation and distribution. DR5::GUS line is a widely used auxin-related marker line under the control of the auxin-responsive DR5 promoter. Experiments using Arabidopsis transgene line DR5::GUS confirmed significant suppression of the auxin response under drought [69] as well as salt and cold treatments [66].

k

k

k

10

Mechanism of Plant Hormone Signaling under Stress

Root growth inhibition (%)

0 mM NaCl

k

50 mM NaCl

100 mM NaCl

200 mM NaCl

100 80 60 40 20 0

0

50

100 NaCl (mM)

150

200

Figure 1.2 Root growth inhibition of Brassica rapa seedlings under salinity stress. One day old seedlings with root lengths of 1 cm were transferred to agar plates containing NaCl in concentrations: 50, 100, and 200 mM. Treated seedlings were compared with non-treated control after 24 h. According the USDA Salinity Laboratory, the saline soil has an electrical conductivity (EC) of 4 dS/m or more. EC value of 1 dS/m corresponds approximately to 10 mM NaCl while 9.8 dS/m corresponds to 100 mM NaCl (reported in the Handbook of Physics and Chemistry, CRC Press, 55th edn, 1975). The actual salinity of a rain-fed field could be 8–12 dS/m that may severely limit the yield of most crops.

Although in the most of the stress conditions IAA level declines as a response to unpleasant environment, the opposite situation was obtained in rice under cold and heat stresses, where a significant increase in IAA level was measured [70, 71], suggesting that different kinds of abiotic stress can cause different auxin response in certain plant species. 1.3.2 Transcription of Auxin Metabolic Genes under Abiotic Stress

In plants, the stress conditions trigger off a cascade of signals which regulate the endogenous IAA level by influencing gene expression and the activity of enzymes involved in auxin homeostasis. Many auxin biosynthesis-related genes, including anthranilate synthase (AS), a gene encoding key enzyme in the synthesis of tryptophan (Trp), and IAA; then YUCCA gene family (flavin monooxigenases that convert IPyA to IAA) were significantly suppressed under drought stress while slightly induced by cold and heat stresses in rice [71]. Except biosynthesis-related genes, abiotic stresses have been reported to mediate the auxin homeostasis by influencing gene expression and activity of enzymes responsible for reversible auxin conjugation, such as auxin conjugate synthetases (GH3), UDP-glucosyltransferases (UGT), and auxin amidohydrolases (IAR and ILL). Various environmental stresses are able to induce members of the GH3 gene family, responsible for IAA amidoconjugate synthesis [72], in Arabidopsis [58], poplar [73], Sorghum bicolor [74], rice [71], and apple [66],

k

k

k

1 Auxin as a Mediator of Abiotic Stress Responses

11

consequently causing an increased amount of conjugated IAA. Tognetti et al. [67] showed that an UDP-glucosyltransferase (UGT74E2), which preferentially glycosylates IBA as a substrate, was strongly upregulated during drought and salt stress. Considering auxin amidohydrolases, proteome analysis of soybean roots at an early vegetative stage identified an auxin-amidohydrolase newly induced upon waterlogging stress [75] and suggested the release of free auxin to be the inducing factor for the adventitious root formation as an adaptation to the flooded conditions. It was recently shown that the level of IAR3 transcript was increased in Arabidopsis due to high osmotic stress [76] while transcription of other amidohydrolases, such as ILL5 was not affected. 1.3.3 What Can We Learn from Functional Analysis Research?

k

A better understanding of the role of auxin in abiotic stress comes from the experiments performed by using mutant and overexpressing lines for the genes encoding the key enzymes in auxin metabolism. Thus, AtYUCCA7 overexpressing Arabidopsis plants and AtYUCCA6 overexpressing potato plants with elevated endogenous IAA level exhibited auxin-related developmental phenotypes together with enhanced drought tolerance [77–79]. Interestingly, transgenic potato showed lower accumulation of ROS compared to the wild-type plants, which was proposed, in part, at the basis of the drought tolerance [78]. Furthermore, Shi et al. [69] showed that the iaaM-OX transgenic line, which was constitutively expressing Agrobacterium tumefaciens tryptophan monooxygenase, and exhibited up to four-fold higher IAA levels than the wild type, and had 20–30% increased survival under drought conditions. The same rate of improved tolerance to drought was obtained by IAA pretreatment of the wild type Arabidopsis plants. On the other hand, the same authors showed that the yuc1yuc2yuc6 triple mutant, which is deficient in three flavin monooxygenase genes (YUCCA1, YUCCA2, and YUCCA6), had inhibited growth and suffered from about 30% decreased survival rate in comparison to the wild types. These results suggest that high levels of auxin are required for drought tolerance in Arabidopsis, and indicated the critical role of the Trp-dependent auxin biosynthesis pathway in the upregulation of auxin contents under water stress. The increase of free IAA may furthermore be obtained by IAA mobilization from storage conjugates through the activity of auxin amidohydrolase enzymes. Indeed, Junghans et al. [64] found that Arabidopsis plants transformed with the auxin-amidohydrolase gene ILL3 from poplar were more resistant to salt stress than the wild-type plants. Expression of IAR3 auxin amidohydrolase was furthermore demonstrated to be important for development of lateral roots and drought tolerance in Arabidopsis [76]. The iar3 mutants accumulated reduced IAA levels and did not display an increased number of lateral roots. On the contrary, transgenic plants, accumulating high levels of non-cleavable IAR3 mRNA, showed increased lateral root development compared to transgenic plants expressing mRNA susceptible to cleavage by miRNA. The mechanism of this particular action has been explained at the post-transcriptional (miRNA) level [76]. As already mentioned, particular members of the GH3 enzyme family, involved in conjugation are reported as important mediators of abiotic stress tolerance. For example, WES1 (GH3-5) overproducing line was tolerant to drought, freezing, salt, and high temperatures while knock-out mutant showed reduced stress tolerance

k

k

k

12

k

Mechanism of Plant Hormone Signaling under Stress

[80]. Overexpressing rice line OsGH3–2 showed significantly reduced IAA level, and consequently, showed an auxin-deficient phenotype. It was hypersensitive to drought while tolerant to cold stress [70]. Improved cold tolerance in the overexpressing OsGH3-2 rice lines was explained by reduced free auxin content, together affecting the enhanced ROS scavenging and decreasing membrane permeability [70, 81]. Furthermore, Arabidopsis transgenic lines overexpressing UGT74E2 glucosyltransferase that preferentially uses IBA as a substrate producing IBA-Glc conjugates, showed significantly improved survival during drought and salt stress treatments [67]. Not only the IBA-Glc conjugate, but the free forms of IBA and IAA were also increased in the mentioned overexpressing lines. By comparing salt tolerant maize hybrid with the sensitive one, Zörb et al. [82] showed clear differences in auxin (IAA, IBA) and ABA concentrations in expanding leaves and roots in control conditions. In response to salinity, the salt-tolerant maize significantly increased IBA concentrations in growing leaves and maintained IAA concentration in roots, while both auxins were decreased in the root and leaf tissue in the sensitive hybrid. Decrease of active IAA may be realized through an irreversible degradation process resulting in increased level of a catabolic product 2-oxindole-3-acetic acid (oxIAA). It has little biological activity and was formed in response to localized auxin accumulation as well as exogenous auxin treatments [83]. Thus oxIAA was highly abundant in Arabidopsis IAA overproducing mutants, YUCCA1 (35S:YUC1), sur1-3 and sur2-1 [39]. The YUC1 gene has been reported to be directly involved in Trp-dependent IAA biosynthesis pathway. The sur1-3 and sur2-1 mutations block the biosynthesis of indole glucosinolates, thereby redirecting Trp precursor into IAA biosynthesis, and resulting in IAA overproduction [26]. Peer et al. [83] showed that localized IAA accumulation caused generation of ROS, and thereby contributed to oxIAA formation. Authors furthermore confirmed that the oxIAA levels were higher in mutants that lack ROS-scavenging flavonoids (tt4 mutant), and, on the other hand, were lower in overexpressing lines that accumulate excess flavonols (tt3). So far, there has not been clear evidence about the role of oxIAA in stress conditions. Since increased level of ROS is usually connected to stress conditions, one may suggest that the process of IAA degradation and oxIAA accumulation may participate in auxin homeostasis upon unfavorable environmental conditions. Finally, auxin cellular transport mediated by proteins belonging to the AUX/LAX, ABCB, and PIN families is also an important process controlling auxin availability [40, 41, 43]. During gravitropic responses, asymmetrical localization of auxin to one side of the cell through the action of auxin transport proteins, in particular PINs, redirects the root growth towards the center of gravity [84]. Consistently, disruption of auxin transport blocks primary root growth and branching [85], as well as gravitropic responses [86]. Auxin transport has also been reported to be affected by certain stress conditions and contributes to plant adaptive responses. In Arabidopsis mild salt stress promotes auxin accumulation in developing lateral root primordia, causing morphogenic response characteristic of several other abiotic stresses: the proliferation of lateral roots with a concomitant reduction in lateral and primary root lengths. Moreover, in the auxin transporter mutant aux1-7

k

k

k

1 Auxin as a Mediator of Abiotic Stress Responses

13

the lateral root proliferation was completely inhibited under salt stress treatment [87]. In sorghum, certain genes, such as SbPIN1–3, -6, -7, and -10 were strongly inhibited by drought and salinity stress while the expression of SbPIN4, -5, -8, -9, and -11 was highly increased in the same conditions [88]. The trafficking of the auxin efflux carrier PIN2, which acts in basipetal auxin transport, as well as the lateral relocalization of PIN3, which has been suggested to mediate the early phase of root gravity response, were dramatically inhibited by cold stress [15, 89]. Salt stress has also been observed to inhibit gravitropic growth of the primary root in Arabidopsis, tomato, and sorghum. A new study shows that, if plant roots sense high doses of salt coming up from below, they dump gravity responses and grow away from the salt contamination. It was shown that the intracellular relocalization of PIN2 allows for auxin redistribution and for the directional bending of the root away from the higher salt concentration. This novel tropism that allows plant seedlings to reduce their exposure to salinity by circumventing a saline environment is called halotropism [60, 90, 91]. Salt stress, in addition to altering PIN2 cellular localization, inhibits PIN2 expression [92].

1.4 How Does Auxin Signaling Respond to Abiotic Stress? k

1.4.1 Brief Overview of Auxin Perception and Signaling

In the last 10 years, studies of Arabidopsis and other plant species have identified a major auxin-signaling pathway. A few systematic overviews of auxin perception and signaling have been published recently [43, 59, 93]. In brief, three proteins TIR1/AFBs (Transport Inhibitor Response 1/Auxin Signaling F-Box Proteins), ABP1(Auxin Binding Protein1) and SKP2A (S-Phase Kinase-Associated Protein 2A) have been recognized so far as auxin receptors and each of them mediates auxin signaling cascades that play a diverse regulatory role in plant growth and development. The TIR1 is the first widely accepted auxin receptor. It exists as part of a protein complex, the TIR1/AFB proteins which are subunits of the SKP1–Cul1–F-box (SCF)-type E3 ligase called SCFTIR1/AFB . Under circumstances where auxin levels are low or they are even absent, Aux/IAA protein repressors bind to ARFs (Auxin-Responsive Factors), and repress their transcriptional activity. When available, auxin acts as a “molecular glue” to promote interaction between the auxin co-receptor, TIR1/AFB and repressor Aux/IAA, resulting in the latter’s degradation, and thereby activating ARF transcription factors and the downstream signaling components. The tir1 mutants showed a variety of growth defects including hypocotyl elongation and lateral root formation, indicating that TIR1 is required for normal response to auxin [93]. More drastic effects in auxin responses were detected in higher-order mutants such as tir1afb2afb3. The interaction between the ARF transcription factors and the Aux/IAA co-repressors is a key event of auxin regulation. Furthermore, ARFs directly bind to auxin-response elements (AuxREs) in the promoters of auxin responsive genes through their DBD (DNA-binding domain). ABP1 was first identified as an auxin binding protein in maize more than 40 years ago and it has been reported to control different aspects of plant growth and development.

k

k

k

14

Mechanism of Plant Hormone Signaling under Stress

Recent research showed that ABP1 is involved in the ROP-GTPase-mediated cascade and regulates clathrin-mediated endocytosis of PIN (PIN-FORMED) auxin efflux carrier on the plasma membrane in pavement cells, guard cells, and root cells [94–96]. It is widely acknowledged that ABP1 mediates non-transcriptional auxin signaling that quickly modulates auxin response during growth and development, although ABP1 auxin signaling at the transcriptional level cannot be excluded [97]. SKP2A has been identified as the third auxin receptor due to its ability to directly bind auxin at the auxin binding site as predicted by comparative computational structure analysis [98, 99]. Also, skp2a mutant showed auxin-tolerant phenotypes. Arabidopsis SCFSKP2A complex positively regulates the cell cycle and functions almost in the same way as to SCFTIR1/AFB although future research would shed light on the mechanism. 1.4.2 Auxin Signaling Attenuation under Stress Conditions: The Importance of miRNA Driven Post-Transcriptional Regulation

k

It is conceivable that the auxin signaling pathway also plays critical roles in plant responses to abiotic stress. To date, very little is known about how the auxin signaling is turned off in various auxin-mediated processes. Growth reduction during unpleasant environmental conditions is mostly the result of attenuated auxin signaling. Attenuation can occur at several levels, including auxin homeostatic processes that result with less available active auxin, deactivation of receptors, and the signaling components at transcriptional or post-transcriptional levels. One component included in post-transcriptional regulation are miRNAs (microRNAs). The miRNAs are small regulatory RNAs, which play critical roles during plant growth and development by negatively regulating gene expression at post-transcriptional level. These non- coding small RNAs (miRNAs) inhibit gene expression post-transcriptionally by targeting cognate mRNAs for either degradation or translational repression. Over the years, a number of miRNAs that target plant genes have been reported. Many of miRNAs are reported to respond to environmental stress signals [100–103] and some of them clearly regulate auxin signaling components [104]. In particular, miR393, miR397b, and miR402, whose predicted targets are mRNAs encoding auxin receptor TIR1, LACCASE, and DEMETER-LIKE PROTEIN3, respectively, were up-regulated in response to cold, dehydration, salt, and ABA in Arabidopsis, rice (Oryza sativa), maize and Phaseolus vulgaris [105–111]. There is a hypothesis that the suppression of auxin signaling might be one of the plant strategies to enhance their tolerance to stresses. As already known, a mild salt stress results in a drastic reduction of lateral root elongation and an increase in lateral root numbers, while higher salt levels completely inhibit root elongation. Due to salt stress, lateral root numbers were reduced in auxin signaling mutants axr1, axr4, and tir1 [112] confirming the important role of this signaling elements in stress response. Salt and osmotic stresses lead to a repression of TIR1 and AFB2 receptors [113]. The tir1afb2 Arabidopsis mutant showed increased tolerance to salt stress in comparison to wild type [16]. Interestingly, that mutant contained less H2 O2 and superoxide anion and increased antioxidant enzyme activities, exhibiting increased tolerance to oxidative stress. Thus, the auxin receptor mediates plant adaptive growth under salt stress. In addition, Iglesias et al. [114] showed that downregulation of TIR1/AFB2-mediated auxin signaling was regulated post-transcriptionally by miR393 which was upregulated upon increased salinity. In

k

k

k

1 Auxin as a Mediator of Abiotic Stress Responses

k

contrast, the mir393ab mutant exhibited increased levels of reactive oxygen species (ROS) due to reduced ascorbate peroxidase (APX) enzymatic activity. Based on those findings, authors proposed a hypothetical model to explain how salt stress might suppress auxin signaling by integrating stress signals, redox state and physiological growth responses during acclimation to salinity in Arabidopsis. Arabidopsis plants overexpressing miR393 (that down regulates the expression of the AFB3 auxin receptor), resemble afb3 mutant plants, which show compromised primary root and lateral root growth in response to nutritional stress [115]. Furthermore, additional miRNA, called miRNA167a has been identified in Arabidopsis as an important regulator of root architecture changes in osmotic stress and drought tolerance. IAR3 mRNA has been identified as a new target of miR167a. As already mentioned, IAR3 is auxin amidohydrolase which hydrolyzes an inactive form of auxin (IAA-Ala) by releasing bioactive IAA. Sequence comparison revealed that the miR167-IAR3 interaction appears to be evolutionarily conserved in higher dicot and monocot plant species [76]. The same authors identified that miR167a levels decreased, whereas IAR3 mRNA levels increased under stress conditions. In contrast with the wild type, iar3 mutants accumulated reduced IAA levels and did not display high osmotic stress–induced root architecture changes. Transgenic plants expressing a cleavage-resistant form of IAR3 mRNA accumulated high levels of IAR3 transcript and showed increased lateral root development compared with transgenic plants expressing wild-type IAR3. Expression of an inducible non-coding RNA to sequester miR167a by target mimicry led to an increase in IAR3 mRNA levels, further confirming the inverse relationship between the two partners. In addition to IAR3 mRNA, ARF6/8 mRNAs are also targets of miR167 [116]. It was determined that an increase in barley miR160a during heat stress considerably downregulates the expression level of the auxin response transcription factors ARF17 and ARF13. ARF8 mRNA is also strongly downregulated under heat stress and it is predicted as a target of miR167h [117]. In addition, a combinatorial approach of high-throughput sequencing in wheat validated ARF10 as target sequence of miRNA160 [103]. Auxin responsive factors ARF8, ARF13 and ARF17 are among others responsible for regulation of shoot morphology and root architecture.

1.5 Auxin and Redox State During Abiotic Stress Various abiotic stresses lead to the overproduction of reactive oxygen species (ROS) in plants. The ROS comprises free radicals (O2•- , superoxide radicals; OH• , hydroxyl radical; HO2• , perhydroxy radical, and RO• , alkoxy radicals) as well as non-radical, molecular forms (H2 O2 , hydrogen peroxide and 1O2 , singlet oxygen). They are highly reactive and toxic causing damage to proteins, lipids, carbohydrates, and DNA, which ultimately results in oxidative stress [118, 119]. At the same time, ROS have additional signaling roles in plant adaptation to the stress [120]. During abiotic stresses plants produce ROS either in excess, leading to cell damage; or ROS is attenuated to a moderate level causing activation of signals leading to plant adaptation to stress. It is still quite mysterious how the two contrasting functional roles of ROS, between oxidative damage to the cell, and signaling for

k

15

k

k

16

k

Mechanism of Plant Hormone Signaling under Stress

stress protection are balanced [121, 122]. Research suggested that the auxin may be the connecting link regulating the level of ROS and directing its role in oxidative damage or signaling in plants under stress [123–126]. ROS-auxin crosstalk leads to morphological changes, by which plants avoid detrimental effects of environmental cues that are known as the stress-induced morphogenic response (SIMR) [67, 125]. Plants have developed the antioxidant defense machinery for protection against oxidative stress damages by scavenging of ROS. It comprises very efficient enzymatic (superoxide dismutase, SOD; catalase, CAT; ascorbate peroxidase, APX; glutathione reductase, GR; monodehydroascorbate reductase, MDHAR; dehydroascorbate reductase, DHAR; glutathione peroxidase, GPX; guaicol peroxidase, GOPX, and glutathione-S- transferase, GST) and non-enzymatic (ascorbic acid, ASH; glutathione, GSH; phenolic compounds, alkaloids, non-protein amino acids, and α-tocopherols) antioxidant defense systems which work in concert to control the cascades of unpleasant oxidation [120, 121, 127]. The redox state of the cell is generally altered in response to different abiotic stimuli. ROS, having effects on auxin biosynthesis, transport, metabolism and signaling under stress conditions, has been suggested to form a redox signaling module with both auxin and antioxidants, like ascorbate, GSH and related proteins, by which it links plant development with environmental cues [17, 18]. Recently, ROS has been indicated also as an attenuator of auxin signaling. For example, SAUR and TIR1 genes have been downregulated after treatment with ozone, as revealed by transcriptome analysis in Arabidopsis [128]. Oxidative attenuation of auxin signaling has also been evidenced through the catabolism of IAA to oxIAA [83]. Therein, flavonoid-deficient mutant tt4 exhibited higher levels of oxIAA, whereas tt3 mutant accumulating excess flavonols, had a lower content of oxIAA. Flavonoids, which are potent ROS scavengers, have been shown to moderate export of cellular auxin. It was postulated that flavonoids buffer both, the ROS formation at the sites of local IAA increase, as well as IAA oxidation [83]. Ongoing research is dedicated to studying various aspects of ROS-auxin crosstalk, including signaling, metabolism and transport. The interplay between H2 O2 and auxin signaling was clearly demonstrated via the action of an IBA UDP-glucosyltransferase (UGT74E2) as a component of the ROS signaling pathway, which alters auxin responsiveness during adaptation to stress conditions [67]. Auxin transport and auxin levels were perturbed in Arabidopsis triple mutant ntra ntrb cad2, missing the critical components of the thioredoxin and glutaredoxin signaling that are generally included in redox regulation [129]. It was clearly shown that the disruption of NTR-glutathione pathways/thioredoxin and glutathione systems leads to inhibition of auxin transport, further supporting a convergence point between auxin homeostasis and thiol reduction pathways in Arabidopsis [129, 130]. Interestingly, overexpression of rice CC-type glutaredoxin gene OsGRX8 in Arabidopsis rendered the transgenic plants less sensitive to treatment with exogenous auxin and ABA, and in addition, enhanced their tolerance to various abiotic stresses (salinity, oxidative, and osmotic stress) [131]. Furthermore, Gao et al. [132] showed that accumulation of high levels of H2 O2 in a mutant with reduced catalase activity, cat2-1 leads to decrease in auxin content and that process is regulated through change in GHS redox status. The transcripts of several glutathione peroxidases (GPX) genes have been increased upon auxin treatment in Arabidopsis. The gpx, T-DNA insertional mutants, particularly gpx1,

k

k

k

1 Auxin as a Mediator of Abiotic Stress Responses

k

gpx4, and gpx7 showed an altered root phenotype, which was further enhanced by exogenous auxin treatment [133]. Their results indicated that the redox control mediated by AtGPXs is important in the development of root architecture and pointed to a control of lateral root development mediated through hormonal crosstalk with distinct GPXs. Various mutants involved in auxin homeostasis and signaling have exhibited altered levels of ROS and antioxidant machinery. Transgenic potato with constitutive overexpression of an Arabidopsis gene AtYUCCA6 showed lower accumulation of ROS compared to wild-type plants, which was proposed, in part at the basis of the drought tolerance [78, 79]. Similarly, improved cold tolerance in the overexpressing OsGH3-2 rice lines and the two carotenoid deficient lines (phs3-1 mutant and PDS-RNAi transgenic rice) was explained by reduced free auxin content that together affects the enhanced ROS scavenging and decreases membrane permeability [70, 81]. The work of Du et al. [81] also suggested a mutual interplay of auxin and carotenoid (and ABA as well) at the biosynthesis level in rice stress responses. The effect of both endogenous and exogenous auxins on ROS accumulation and antioxidant enzyme activities under drought stress was examined by Shi et al. [69]. In their work, when exposed to drought stress condition, both the wild-type plants pretreated with exogenous IAA and the iaaM-OX transgenic plants constitutively expressing the tryptophan-2-monooxygenase from Agrobacterium tumefaciens contained a higher content of endogenous IAA in comparison to the non-treated control plants. The same plants exhibited decreased levels of H2 O2 and O2•- and increased activities of antioxidant enzymes (SOD, CAT, POD, and GR) compared to the wild type non-treated plants. These exogenous IAA pre-treated plants and the iaaM-OX transgenic plants also exhibited increased drought resistance. On the contrary, yuc1yuc2yuc6 triple mutants, the T-DNA insertional mutants of the YUC flavin monooxygenase gene family [134], showed quite the opposite effects, connected to the lower levels of endogenous auxin. They were more sensitive to drought conditions producing higher levels of H2 O2 and O2•- , and decreased levels of the previously mentioned antioxidant enzymes. These results indicated both endogenous and exogenous auxin as a positive modulator of the ROS detoxifying machinery, as well as of the improved tolerance to drought stress [69]. During cadmium stress, increased ROS (H2 O2 ) changed the expression of crucial components of the auxin signaling [135]. In particular, expression of OsYUCCA, OsPIN, OsARF, and OsIAA was changed in Cd-treated plants, suggesting H2 O2 acts upstream of the auxin signaling pathway, thereby connecting the effect of H2 O2 on root system growth with the modification of auxin signal [135]. Auxin signaling was proposed to participate in the adaptive response against oxidative stress and salinity by interacting with the redox metabolism in Arabidopsis [16]. In detail, the tir1 afb2 mutant, the double mutant for TIR1 AFB2 auxin receptors, showed increased oxidative stress tolerance, and was also more tolerant to salt stress than the wild–type plants. Upon salt stress, tir1 afb2 mutant accumulated less H2 O2 and had decreased level of superoxide anion O2- upon oxidative stress, while it exhibited a higher activity of antioxidant enzymes CAT and APX. Adaptation to salinity was proposed to be mediated, at least in part, by an auxin/redox interaction, and the attenuation of auxin signaling to contribute to the stress tolerance by the reduction of ROS accumulation [16]. More recently, the suppression of auxin signaling upon salt stress, leading to a repression

k

17

k

k

18

Mechanism of Plant Hormone Signaling under Stress

of TIR1 and AFB2 receptors, was shown to be mediated through the miR393 expression [114]. The miR393 was shown to trigger changes of redox related components upon salt stress. In particular, mir393ab mutant showed elevated levels of ROS in roots which were explained by a repression of antioxidant metabolism, particularly the reduction in APX enzymatic activity, together with altered root architecture. On the other hand, in the wild-type plants, which exhibit a downregulated auxin signaling upon salinity, the development of lateral roots was inhibited and it coincided with a reduced level of ROS. A regulatory module was proposed in which plant development during SIMR is directed towards an adaptation to salt stress through post-transcriptional miR393 downregulation of auxin signaling pathway, which consequently modulates ROS homeostasis [114]. The substantial amount of data produced over recent years on the topic of interaction of auxin with ROS and ROS scavenging system has indicated it as a still evolving field. Further investigations are required to examine the link between ROS and auxin homeostasis and how they can be altered to improve the crop tolerance to stress by engineering of any of the previously mentioned signaling cascades.

1.6 Auxin-Stress Hormones Crosstalk in Stress Conditions k

The ability of plants to respond to a changing environment is highly flexible and controlled by plant hormone balance and a complex crosstalk [13]. In the recent years, one of the major topics in the field of plant physiology has been plant hormonal profile/status upon environmental stress conditions. Even though numerous scientific studies gained knowledge of the physiological role of plant hormones in stress response, the complex network of interactions, also known as hormone crosstalk, still presents an intriguing and unsolved paradigm of plant defense system. Certainly, in the diverse plant kingdom there is no unique way of hormonal crosstalk. Research tools and multiple approach techniques are able to highlight some patterns of hormone interactions in the presence of stress causing agents. The role of auxin as a main mediator of plant growth and development leads at the crossroad with the so-called stress hormones induced signals such as abscisic acid (ABA), jasmonic acid (JA), salicylic acid (SA), and ethylene. 1.6.1 Auxin-ABA Crosstalk

In terms of abiotic stress tolerance, abscisic acid has a central role in the regulation of stress response in different developmental stages and environmental cues [136–139]. The common growth coordination of ABA and auxins presents an important step in plants adaption to a rapidly changing environment where increased ABA levels can have inhibitory growth effect. A recent report on Brassica rapa seedlings showed that exogenous ABA treatment caused root growth inhibition, but without significant influence on auxin level [140]. Furthermore, growth retardation at an early developmental stage of Arabidopsis seedlings was ABA stimulated and it occurred ivia potentiating auxin signaling through AXR2/IAA7 [141]. Under normal environmental conditions expression of AXR2/IAA7 gene is localized to embryonic

k

k

k

1 Auxin as a Mediator of Abiotic Stress Responses

19

axis elongation zone, it is auxin inducible and it is downregulated by ABA treatment [141, 142]. Mutation in axr2 gene contributes to insensitivity of Arabidopsis seedlings to auxin, ethylene, and ABA treatments and results in the absence of root growth inhibition [143]. Thus, it is evident that ABA induced repression of AXR2/IAA7 during post-germination growth presents a link between ABA and auxin-dependent growth response. Involvement of ABA stimuli in auxin response can be demonstrated by using genome-wide analysis of Arabidopsis transcripts. Altered expression levels of auxin responsive genes upon short and sustained ABA treatment place ABA-auxin crosstalk on a way of maintaining or even promoting growth in stressful conditions [144]. It has been reported that increased salinity and water deficiency decrease soil moisture as a result, and plants may promote root growth to enhance moisture uptake in unpleasant conditions [145–149]. Under moderate water stress, accumulated endogenous ABA in root tips of Arabidopsis and rice stimulates transport of auxin into the root apex. Then, translocated auxins target the H+ ATPase of the plasma membrane of root cells [150]. Consequently, the enhanced activity of H+ ATPase yields more protons into the cell-wall compartment resulting in lower pH of cell-wall, activation of enzymes, cell-wall loosening, and root growth induction [151]. Increase in transcript levels of AUX1 (an auxin influx transporter) and PIN2 (an auxin efflux transporter) in the root tips of Arabidopsis under ABA stimuli also occurs suggesting auxin and ABA interactions during stress induced root growth [150]. k

k

1.6.2 Auxin-JA Crosstalk

Except ABA, interactions of auxins with jasmonic acid also affect plant growth during stress. The role of JA in coordinating stress response was demonstrated by Wu et al. [152] where treatment with MeJA enhanced tolerance of Brassica oleracea seedlings to drought stress. Furthermore, the influence of cold and heat stress on accumulation of IAA in the stressed rice was accomplished by the upregulation of OsYUCCA and OsASA genes coding for the enzymes in IAA biosynthetic pathway, respectively, and downregulation of GH3 genes coding for conjugate synthetases. Expression profiles of the mentioned genes and endogenous levels of IAA showed opposite patterns under drought conditions. While JA level and induction of JA responsible genes were increased upon cold and drought, the same were suppressed upon heat treatment, implying different regulation of biosynthesis and signaling of JA and IAA upon diverse abiotic stresses [71, 81]. Impact of abiotic stress on the auxin homeostasis by promoting or suppressing the enzymes involved in the reversible conjugation of IAA/hydrolysis of conjugates provides a possible target for auxin–stress hormones crosstalk. It has been shown that upregulation of the IAR3, enzyme required for cleavage of conjugated auxins to active free IAA, together with accumulation of IAA occurs when Brassica rapa seedlings were exposed to JA [140]. High osmotic conditions are able to cause overproduction of Arabidopsis IAR3 mRNA by suppressing silencing mechanism through degradation of mIAR3 by miR167a, so lateral root architecture develops as an adaptation event mediated by JA signal [76]. JA promoted LR formation is an auxin-dependent mechanism involving: (i) functional auxin signaling pathway [153]; (ii) induction of the auxin biosynthesis gene anthranilate synthase1 (ASA1) [154]; and (iii) JA modulation of PIN2 endocytosis and its abundance on the plasma membrane [92].

k

k

20

Mechanism of Plant Hormone Signaling under Stress

Besides lateral roots, a development of adventitious roots (AR) is also an important mode in the acclimatization of plants to environmental conditions. Auxin-JA crosstalk and the influence on JA homeostasis can be observed in the AR induction and development. Formation of ARs is a consequence of inhibition of JA-Ile/COI1 signaling pathway, which negatively regulates AR development in Arabidopsis hypocotyls. According to the model, auxin stimulated AFR8/9 are positive regulators and AFR17 is the negative regulator of GH3.3, GH3.5, and GH3.6 genes, which are involved in conjugation of JA with amino acids. Production of conjugates reduces levels of JA available for GH3.11 JA-Ile synthesis and JA-Ile/COI1 signaling pathway so plants are capable to initiate adventitious roots formation [155]. 1.6.3 Auxin-Ethylene Crosstalk

k

Development of the root architecture can also be coordinated by ethylene. Ethylene stimulates auxin biosynthesis and basipetal auxin transport towards the elongation zone. Auxins in combination with ethylene regulate root development and architecture, an important attribute relevant to drought, salinity, flooding, or nutrient stress tolerance [156]. Accumulated auxins exhibit local inhibitory effect resulting in the root growth retardation [157]. On the contrary, ethylene can stimulate the adventitious roots formation to escape from hypoxia during flooding. Flooded tomato plants treated with the ethylene biosynthesis inhibitor aminoethoxyvinylglycine (AVG) and the auxin transport inhibitor 1-naphthylphthalamic acid (NPA) were unable to form adventitious roots. Crosstalk upon waterlogging results in the auxin accumulation in stem of stressed plants where it triggers de novo ethylene synthesis. Ethylene stimulates the transport of auxins towards the flooded parts of the plant and induces the new root system development to increase plant survival rate [158]. Another way to escape from decreased oxygen levels under temporary submergence is rapid growth of the petiole due to ethylene stimulated enhanced sensitivity to auxins [159]. In summary, modifications of the root system architecture through JA/ethylene-auxin crosstalk, where levels of these hormones are altered upon unfavorable environment, presents significant adaptive mechanism in the plant growth reorganization. 1.6.4 Auxin-SA Crosstalk

Investigation of the salicylic acid historically has been focused on its role in the plant immunity against pathogens, but searching for the mechanisms of the stress tolerance revealed that SA imparts in promoting abiotic stress response. Exogenous treatments of the plants with low concentrations of SA alleviate their tolerance to stress conditions via activation of the antioxidant machinery and sustaining the growth under drought, salinity, temperature stress or heavy metal toxicity [160]. Indeed, SA treatments of pea and Brassica seedlings showed a more reduced state of the seedlings with elevated GSH and reduced GSSG, along with the decreased content of protein carbonyls [140, 161]. We have already elaborated the importance of the intracellular redox status, with glutathione as a key regulator, as a critical parameter involved in auxin homeostasis and determination of plant development in response to biotic and abiotic stresses. Although root growth inhibition of Brassica seedlings

k

k

k

1 Auxin as a Mediator of Abiotic Stress Responses

21

upon SA treatment was not connected directly with changes in IAA level, it was hypothesized that SA acts through mediating auxin signaling pathways [140]. Results obtained on tir1afb2 Arabidopsis mutants with the disrupted auxin receptors TIR1 and AFB2 have improved salinity tolerance and their treatment with SA enhances expression of pathogenesis related (PR) marker PR-1 compared to WT plants. Given results implies on the mutual antagonism between SA-induced PR1 response and auxin signaling [16, 162]. Interactions of SA and auxins can be monitored in the WES1 overexpressing mutant with enhanced GH3 activity and resistance to abiotic and biotic stress where SA stimulates WES1 mediated IAA conjugation and stress response [58]. The bi-functional role of GH3.5 interactions with SA and IAA was shown during pathogen infection of Arabidopsis [163], but since expression levels of legume CaGH3.5 were elevated under desiccation, salt, and cold stresses in shoots and roots, the role of GH3.5 in mediating response during multiple abiotic stresses and coordinating auxin-SA crosstalk can be proposed as well [164]. Due to the positive role of SA in improving plant tolerance, the auxin-SA interactions present a possible niche for modulating the fitness and plant productivity under abiotic stress.

1.7 Promiscuous Protein Players of Plant Adaptation: Biochemical and Structural Views k

We have emphasized that auxin homeostasis and auxin-stress hormone crosstalks are crucial for plant stress response and plant adaptation to unfavorable environmental changes. There are two crucial enzymes involved in both processes: IAR3 auxin amidohydrolase and GH3 auxin conjugate synthetases. Both of them are promiscuous and coquet with auxins but also certain stress hormones as substrate candidates. While IAR3 (JIH1) considers auxin and JA conjugates as substrates, GH3 (3.1, 3.11, and 3.12), in addition to auxin, likes also JA and benzoate (familiar to SA). Knowledge about biochemistry, structure, and possible regulation of these important enzyme players of plant adaptation are crucial for understanding their function in plant stress response. 1.7.1 IAR3 Auxin Amidohydrolase

Although IAR3 was grouped in the IAA amidohydrolase family based on its initially examined in vitro activity against IAA conjugates [165], obviously it has a dual role participating also in JA homeostasis [166, 167]. It may be suggested as one of the major players of auxin–jasmonate crosstalk in plant stress responses. Auxin amidohydrolase IAR3, like other auxin amidohydrolases, belongs to the M20D metallopeptidase subfamily, related to the amidohydrolase superfamily (M20) of enzymes, which hydrolyze a number of different substrates, including amino acids, sugars, nucleic acids, and organophosphate esters [168]. They specifically hydrolyze the amide bond of amino acid conjugated auxins, releasing free active compounds. They were originally characterized in Arabidopsis thaliana [169–171], then A. suecica [172, 173]. The amidohydrolases from the two Arabidopsis species are shown to be specific for IAA–amino acid conjugates, with overlapping substrate specificities (ILR1

k

k

k

22

k

Mechanism of Plant Hormone Signaling under Stress

cleaves IAA-Leu and IAA-Phe preferentially; ILL1, ILL2, and IAR3 prefer IAA-Ala; sILR1 shows specificity for IAA-Gly and IAA-Ala). Homologous amidohydrolases from Triticum aestivum, Medicago truncatula, and Brassica rapa were more active towards aminoacid conjugates of long-chained auxins: indole-3-butyric acid (IBA-Ala) and indole-3-propionic acid (IPA-Ala) in comparison to IAA-Ala [174–176]. A close homolog of IAR3 from Nicotiana attenuata, identified as jasmonoyl-L-isoleucine hydrolase 1 (JIH1) hydrolyzes both JA-Ile and IAA-Ala in vitro [166]. In contrast to auxin conjugation that results in lowering the active auxin pool, the conjugation of JA to isoleucine (JA-Ile) is known to enhance the activity of JA. It seems that IAR3/JIH1 acts antagonistically in auxin-jasmonate crosstalk; it contributes to increase the pull of active forms of auxins in plants, while at the same time attenuates the JA-Ile burst. All auxin-amidohydrolases examined so far need a reducing agent, such as dithiothreitol (DTT) for their activity in vitro, as well as Mn2+ as a metal co-factor. Although these proteins have been known for quite some time, their structure/function relationship is still not clear. The first x-ray structure of a plant enzyme (ILL2, from Arabidopsis thaliana) has been reported as an apoenzyme [177], still missing details about the substrate binding site and the amino acid residues important for substrate specificity. Based on modeling, a potential substrate binding cleft has been proposed for the Arabidopsis enzyme (AtILL2) [177], as well as for the Brassica rapa enzyme (BrILL2), in which several substrate binding modes for the preferred long-chained auxin conjugates were additionally predicted [176]. Structurally, auxin amidohydrolases are characterized by two perpendicular domains with the larger catalytic domain bearing a binuclear metal center, and the smaller “satellite” domain, usually functioning as a polymerization site. Figure 1.3A (Plate 1) presents a structural model of AtIAR3 auxin amidohydrolase. Using molecular dynamic simulations, a study of the dynamics of the BrILL2 enzyme as one member of auxin amidohydrolases has been conducted in accordance with available experimental data and the dynamic

C-terminus C-terminus

inhibitor

JA-Ile

N-terminus (A)

N-terminus (B)

(C)

Figure 1.3 (Plate 1) Overview of the structures of enzymes involved in auxin conjugation and hydrolysis. (A) A proposed model of AtIAR3 made by Phyre [196] using AtILL2 crystal structure (Protein Data Bank code: 2Q43) as a template (59% homology); (B) X-ray structure of AtGH3.11/JAR1 (Protein Data Bank code: 4EPL) with jasmonil-isoleucine as a substrate; and (C) Structure of VvGH3.1 (Protein Data Bank code: 4B2G), in complex with the inhibitor adenosine 5-[2-(1H-indol-3-yl) ethyl]phosphate. All models are visualized by Pymol. (See insert for color representation of this figure.)

k

k

k

1 Auxin as a Mediator of Abiotic Stress Responses

23

properties of the protein in solution and the molecular details of ligand binding [178]. Based on sequence homology, auxin-amidohydrolases, including IAR3 contain two highly conserved cysteine residues. It has been proposed that one of the two conserved Cys residues is part of the active site and coordinates the metal co-factor [176]. Authors proposed that the oxidation/reduction state of highly conserved Cys residues, which strongly depends on the redox status of cellular environment, may be an important factor for regulation of enzyme activity. 1.7.2 GH3 Auxin Conjugate Synthetases

k

The Gretchen Hagen3 (GH3) protein family are products of early auxin-responsive genes GH3s, that share a common motif in their promoter regions in form of auxin responsive elements (AuxREs) with other early auxin-responsive gene groups (SAURs and Aux/IAAs) [26, 27, 35, 179]. The GH3 enzymes decide the faith of plant hormones, more precisely their potency, whether they are to be activated, such is the case of GH3.11/JAR1 [180], or sequestered for storage by forming conjugates with leucine or alanine which can then be readily hydrolyzed, or marked for degradation by forming conjugates with aspartate or glutamate [26, 35, 165, 171]. Therefore, the GH3 protein family directly affects the active pool and the potency of major classes of phytohormones (SA, JA, and IAA). As we have already pointed out, the GH3 protein family has been implied in the stress response and stress tolerance in Arabidopsis [58], poplar [73], sorghum [74], rice [70], and apple [66]. The expression of Arabidopsis GH3-5 (WES1) gene is enhanced under various stress conditions, including cold, drought, salinity, SA and ABA, and also the activated GH3–5 (wes1-D) mutant shows reduced level of IAA and 7.2 times higher IAA-Asp content then in wild type plants and resistance to abiotic stress [58]. By this, Park et al. [58] clearly demonstrated that auxin homeostasis directly links growth regulation with stress adaptation responses in Arabidopsis through the interaction with two stress hormones SA, and ABA. The overexpression (activation, gain-of-function) mutants of several other GH3 enzymes, AtGH3.2/ydk1-D [181], AtGH3.5/wes1-D [58, 163], AtGH3.10/dfl1-D [182], OsGH3.13/ tld1-D [183], OsGH3.8 [184], OsGH3.1 [185], OsGH3.2 [70, 186] have shown typical phenotypical changes (dwarfism, reduced metabolism, shortened hypocotyls, aberrations in the primary and lateral root development) associated with the altered auxin homeostasis, and also their phenotype is similar to the phenotype of the wild type plants which develops upon exposure to environmental stress, the so called SIMR [125]. Also, in the roots of the DR5::GUS transgenic Arabidopsis seedlings, the level of endogenous IAA can be suppressed by ABA, SA, salt, and cold treatments, seen through the decreased GUS activity, as well as inhibited auxin-mediated expression of the DR5::GUS reporter [66]. An extensive review of the GH3 protein family has been given elsewhere [187], so here, a brief overview of current biochemical and structural views will be described. New insights into the GH3 protein family have been given after revealing the crystal structure of two Arabidopsis enzymes (GH3.11/JAR3 and GH3.12/PBS3) [188] and one grapevine (Vitis vinifera) GH3 enzyme (VvGH3.1) [189]. The GH3.11/JAR3 protein (Fig. 1.3B/Plate 1) catalyzes the formation of jasmonyl-isoleucine (JA-Ile), thereby producing the active plant hormone, whereas the function of the benzoates

k

k

k

24

k

Mechanism of Plant Hormone Signaling under Stress

conjugating GH3.12/PBS3 is not clear, due to the lack of information on its physiological substrate, even though Arabidopsis mutants in GH3.12 exhibit SA-related phenotypes [190]. The VvGH3.1 from grapevine (Fig. 1.3C) has shown activity towards IAA, by conjugating it to aspartate [189, 191] and it has been crystallized through the use of an inhibitor adenosine 5-[2-(1H-indol-3-yl)ethyl]phosphate [192]. The overall fold of these enzymes is similar to each other and to the large family of adenylating firefly luciferase (ANL) superfamily of enzymes in general [193]. The crystallography and biochemical studies have enabled the definition of their acyl acid binding site, pointing to residues critical for recognition of amino acids and explaining the plasticity (promiscuity) of the active site towards different substrates [188, 189]. Based also on the sequence comparison of the structures of acyl acid binding site of known GH3 proteins across plant kingdom, it has been concluded that the GH3 family can be divided into eight subgroups according to the conserved structural motifs in the α5, α6, β8, and β9 secondary elements. This could broaden the search for orthologues across plant kingdom. Three of these groups correspond to the already established classification of known GH3 enzymes [194] (group I, II, and III), characterized based on their sequence homology and substrate specificity, which act specifically and distinctly towards either benzoates, JA, SA, or IAA. The evolution of the metabolic versatility of the GH3 family has started with only a few promiscuous GH3 proteins, as found in moss P. patens [195], towards a plethora of GH3s with specialization distinctly towards either benzoates, JA, SA or IAA, possibly even other substrates [189]. The GH3 enzyme family presents a vast exploration material for the future, which would help elucidate its diverse roles in modulation of plant hormone responses.

1.8 Conclusion Due to the urgent need to understand and potentially increase abiotic stress tolerance in plants, it is highly challenging to investigate the mechanisms underlying plant abiotic stress responses and tolerance. One important view is based on the role of auxin in abiotic stress responses. However, the reality is more complicated than single player and single level story. The critical components are the complex network of crosstalk between signaling pathways of auxin and the number of plant hormones. Another node of crosstalk is at the level of biosynthesis, metabolism, or transport involved in the auxin signaling. Thus, auxin homeostasis control is particularly important for growth and reproductive success under constantly changing environments. Additional research performed in future would be of crucial importance to shed more light on these complex processes.

Acknowledgment This work has been supported by Croatian Science Foundation under the project no. IP-2014- 09-4359.

k

k

k

1 Auxin as a Mediator of Abiotic Stress Responses

25

References 1 Varshney, R.K., Bansal, K.C., Aggarwal, P.K., Datta, S.K., Craufurd. P.Q. (2011)

2 3 4

5 6

7 8 9

k 10 11 12

13

14 15 16

17

Agricultural biotechnology for crop improvement in a variable climate: hope or hype? Trends Plant Sci., 16, 363–371. Mba, C., Guimaraes, E.P., Ghosh, K. (2012) Re-orienting crop improvement for the changing climatic conditions of the 21st century. Agr. Food Secur., 1, 1–17. Khedun, C.P. and Singh, V.P. (2014) Climate change, water, and health: A review of regional challenges. Water Qual. Expo. Health, 6, 7–17. Qin, F., Shinozaki, K., Yamaguchi-Shinozaki, K. (2011) Achievements and challenges in understanding plant abiotic stress responses and tolerance. Plant Cell Physiol., 52, 1569–1582. Munns, R. and Tester, M. (2008) Mechanisms of salinity tolerance. Annu. Rev. Plant Biol., 59, 651–681. Cramer, G.R., Urano, K., Delrot, S., Pezzotti, M., Shinozak, K. (2011) Effects of abiotic stress on plants: a systems biology perspective. BMC Plant Biol., 11, 163. Ismail, A., Takeda, S., Nick, P. (2014) Life and death under salt stress: same players, different timing? J. Exp. Bot., 65, 2963–2979. Derksen, H., Rampitsch, C., Daayf, F. (2013) Signaling cross-talk in plant disease resistance. Plant Sci., 207, 79–87. Krasensky, J. and Jonak, C. (2012) Drought, salt, and temperature stress-induced metabolic rearrangements and regulatory networks. J. Exp. Bot., 63, 1593–1608. Peleg, Z. and Blumwald, E. (2011) Hormone balance and abiotic stress tolerance in crop plants. Curr. Opin. Plant Biol., 14, 290–295. Khan, N.A., Nazar, R., Iqbal, N., Anjum, N.A. (eds) (2012) Phytohormones and abiotic stress tolerance in plants. Springer Verlag, Berlin Heidelberg. Wilkinson, S., Kudoyarova, G.R., Veselov, D.S., Arkhipova, T.N., Davies, W.J. (2012) Plant hormone interactions: innovative targets for crop breeding and management. J. Exp. Bot., 63, 3499–3509. Kohli, A., Sreenivasulu, N., Lakshmanan, P., Kumar, P.P. (2013) The phytohormone crosstalk paradigm takes center stage in understanding how plants respond to abiotic stresses. Plant Cell Rep., 32, 945–957. Chandler, J.W. (2009) Auxin as compère in plant hormone crosstalk. Planta, 231, 1–12. Rahman, A. (2013) Auxin: a regulator of cold stress response. Physiol. Plantarum, 147, 28–35. Iglesias, M.J., Terrile, M.C., Bartoli, C.G., D’Ippólito, S., Casalongué, C.A. (2010) Auxin signaling participates in the adaptative response against oxidative stress and salinity by interacting with redox metabolism in Arabidopsis. Plant Mol. Biol., 74, 215–222. De Tullio, M.C., Jiang, K., Feldman, L.J. (2010) Redox regulation of root apical meristem organization: connecting root development to its environment. Plant Physiol. Biochem., 48, 328–336.

k

k

k

26

Mechanism of Plant Hormone Signaling under Stress

18 Tognetti, V.B., Mühlenbock, P., van Breusegem, F. (2012) Stress homeostasis – the

redox and auxin perspective. Plant Cell Env., 35, 321–333. 19 Cooke, T.J., Poli, D.B., Sztein, A.E., Cohen, J.D. (2002) Evolutionary patterns in

auxin action. Plant Mol. Biol., 49, 319–338. 20 Brumos, J., Alonso, J.M., Stepanova, A.N. (2014) Genetic aspects of auxin biosyn-

thesis and its regulation. Physiol. Plantarum, 151, 3–12. 21 Bajguz, A. and Piotrowska, A. (2009) Conjugates of auxin and cytokinin.

Phytochem., 20, 957–969. 22 Simon, S. and Petrášek, J. (2011) Why plants need more than one type of auxin.

Plant Sci., 180, 454–460. 23 Korasick, D.A., Enders, T.A., Strader, L.C. (2013) Auxin biosynthesis and storage

forms. J. Exp. Bot., 64, 2541–2555. 24 Mano, Y. and Nemoto, K. (2012) The pathway of auxin biosynthesis in plants.

J. Exp. Bot., 63, 2853–2872. 25 Tivendale, N.D., Ross, J.J., Cohen, J.D. (2014) The shifting paradigms of auxin

biosynthesis. Trends Plant Sci., 19, 44–51. 26 Ljung, K. (2013) Auxin metabolism and homeostasis during plant development.

Development, 140, 943–950. 27 Ludwig-Müller, J. (2011) Auxin conjugates: their role for plant development and in

the evolution of land plants. J. Exp. Bot., 62, 1757−1773. 28 Ludwig-Müller, J. (2000) Indole-3-butyric acid in plant growth and development.

Plant Growth Regul., 32, 219–230.

k

29 Ludwig-Müller, J. and Epstein, E. (1991) Occurrence and in vivo biosynthesis of 30

31

32 33

34

35 36

37

indole-3-butyric acid in corn (Zea mays L.). Plant Physiol., 97, 765–770. Strader, L.C., Culler, A.H., Cohen, J.D., Bartel, B. (2010) Conversion of endogenous indole-3-butyric acid to indole-3-acetic acid drives cell expansion in Arabidopsis seedlings. Plant Physiol., 153, 1577–1586. Strader. L.C., Wheeler, D.L., Christensen, S.E., Berens, J.C., Cohen, J.D., Rampey, R.A., Bartel, B. (2011) Multiple facets of Arabidopsis seedling development require indole-3-butyric acid–derived auxin. Plant Cell, 23, 984–999. Strader, L.C. and Bartel, B. (2011) Transport and metabolism of the endogenous auxin precursor indole-3-butyric acid. Molec. Plant, 4, 477–486. Schlicht, M., Ludwig-Müller, J., Burbach, C., Volkmann, D., Baluska, F. (2013) Indole-3-butyric acid induces lateral root formation via peroxisome-derived indole-3-acetic acid and nitric oxide. New Phytol., 200, 473–482. Novák, O., Hényková, E., Sairanen, I., Kowalczyk, M., Pospíšil, T., Ljung, K. (2012) Tissue-specific profiling of the Arabidopsis thaliana auxin metabolome. Plant J., 72, 523–536. Woodward, A.W. and Bartel, B. (2005) Auxin: regulation, action, and interaction. Annal. Bot., 95, 707–735. Tanaka, K., Hayashi, K., Natsume, M., Kamiya, Y., Sakakibara, H., Kawaide, H., Kasahara, H. (2014) UGT74D1 catalyzes the glucosylation of 2-oxindole-3-acetic acid in the auxin metabolic pathway in Arabidopsis. Plant Cell Physiol., 55, 218–228. Porco, S., Rasheda, A., Voß, U., Casanova-Sáezb, R., Bishopp, A., Golebiowska, et al. (2016) Dioxygenase- encoding AtDAO1 gene controls IAA oxidation and homeostasis in Arabidopsis. Proc. Natl. Acad. Sci USA, doi/10.1073/pnas.1604375113.

k

k

k

1 Auxin as a Mediator of Abiotic Stress Responses

27

38 Zhang, J., Lin, J.E., Harris, C., Pereira, F.C.M., Wu, F., Blakeslee, J.J., Peer, W. A.

39

40 41

42

43

44

k

45 46

47 48

49

50

51

52

53

(2016) DAO1 catalyzes temporal and tissue-specific oxidative inactivation of auxin in Arabidopsis thaliana. Proc. Natl. Acad. Sci USA, doi/10.1073/pnas.1604769113. Pˇenˇcík, A., Simonovik, B., Petersson, S.V., Henyková, E., Simon, S., Greenham, K., et al. (2013) Regulation of auxin homeostasis and gradients in Arabidopsis roots through the formation of the indole-3-acetic acid catabolite 2-oxindole-3-acetic acid. Plant Cell, 25, 3858–3870. Grunewald, W. and Friml, J. (2010) The march of the PINs: developmental plasticity by dynamic polar targeting in plant cells. EMBO J., 29, 2700–2714. Péret, B., Swarup, K., Ferguson, A., Seth, M., Yang, Y., et al. (2012) AUX/LAX genes encode a family of auxin influx transporters that perform distinct functions during Arabidopsis development. Plant Cell, 24, 2874–2885. Habets, M.E.J. and Offringa, R. (2014) PIN-driven polar auxin transport in plant developmental plasticity: a key target for environmental and endogenous signals. New Phytol., 203, 362–377. Retzer, K., Butt, H., Korbei, B., Luschnig, C. (2014) The far side of auxin signaling: fundamental cellular activities and their contribution to a defined growth response in plants. Protoplasma, 251, 731–746. Barbez, E., Kubes, M., Rolˇcík, J., Beziat, C., Pˇenˇcík, A., Wang, B., et al. (2012) A novel putative auxin carrier family regulates intracellular auxin homeostasis in plants. Nature, 485, 119–122. Tarkowská, D., Novák, O., Floková, K., Tarkowski, P., Turecková, V., Grúz, J., Rolˇcík, J., Strnad, M. (2014) Quo vadis plant hormone analysis? Planta, 240, 55–76. Magnus, V., Bandurski, R.S., Schulze, A. (1980) Synthesis of 4,5,6,7 and 2,4,5,6,7 deuterium-labeled indole-3-acetic acid for use in mass spectrometric assays. Plant Physiol., 66, 75–78. Bandurski, R.S., Schulze, A., Cohen, J.D. (1977) Photo-regulation of the ratio of ester to free indole-3-acetic acid. Biochem. Biophys. Res. Com., 79, 1219–1223. Floková, K., Tarkowská, D., Miersch, O., Strnad, M., Wasternack, C., Novák, O. (2014) UHPLC–MS/MS based target profiling of stress-induced phytohormones. Phytochem., 105, 147–157. Chen, K.H., Miller, A.N., Patterson, G.W., Cohen, J.D. (1988) A rapid and simple procedure for purification of indole-3-acetic acid prior to GC-SIM-MS analysis. Plant Physiol., 86, 822–825. Barkawi, L.S., Tam, Y.Y., Tillman, J.A., Normanly, J., Cohen, J.D. (2010) A high-throughput method for the quantitative analysis of auxins. Nat. Protocols, 5, 1609–1618. Liu, X., Hegeman, A.D., Gardner, G., Cohen, J.D. (2012) Protocol: High-throughput and quantitative assays of auxin and auxin precursors from minute tissue samples. Plant Meth., 8, 31. Barkawi, L.S., Tam, Y.Y., Tillman, J.A., Pederson, B., Calio, J., Al-Amier, H., et al. (2008) A high-throughput method for the quantitative analysis of indole-3-acetic acid and other auxins from plant tissue. Anal. Biochem., 372, 177–188. Pˇenˇcík, A., Rolˇcík, J., Novák, O., Magnus, V., Barták, P., Buchtík, R., et al. (2009) Isolation of novel indole-3-acetic acid conjugates by immunoaffinity extraction. Talanta, 80, 651–655.

k

k

k

28

Mechanism of Plant Hormone Signaling under Stress

54 Brcko, A., Pˇenˇcík, A., Magnus, V., Prebeg, T., Mlinari´c, S., Antunovi´c, J., et al.

55 56 57

58

59

60 61

k

62

63

64

65

66 67

68

69

(2012) Endogenous auxin profile in the Christmas Rose (Helleborus niger) L. flower and fruit: free and amide conjugated IAA. J. Plant Growth Regul., 31, 63–78. Bandurski, R.S. and Schulze, A. (1977) Concentration of indole-3-acetic acid and its derivatives in plants. Plant Physiol., 60, 211–213. Yu, P., Lor, P., Ludwig-Müller, J., Hegeman, A.D., Cohen, J.D. (2015) Quantitative evaluation of IAA conjugate pools in Arabidopsis thaliana. Planta, 241, 539–548. Ili´c, N., Magnus, V., Ostin, A., Sandberg, G. (1997) Stable-isotope labeled metabolites of the phytohormone, indole-3-acetic acid. J. Labelled Compd. Rad., 39, 433–440. Park, J.-E., Park, J.-Y., Kim, Y.-S., Staswick, P.E., Jeon, J., Yun, J., et al. (2007) GH3-mediated auxin homeostasis links growth regulation with stress adaptation response in Arabidopsis. J. Biol. Chem., 282, 10036–10046. Liu, L., Guo, G., Wang, Z., Ji, H., Mu, F., Li, X. (2014) Auxin in plant growth and stress responses. In: PhanTran, L.-S., Pal, S. (eds) Phytohormones: a window to metabolism, signaling and biotechnological applications. Springer Verlag, Berlin Heidelberg, pp. 1–35. Pierik, R. and Testerink, C. (2014) The art of being flexible: how to escape from shade, salt, and drought. Plant Physiol., 166, 5–22. Prakash, L. and Prathapasenan, G. (1990) NaCl-and gibberellic acid-induced changes in the content of auxin and the activities of cellulase and pectin lyase during leaf growth in rice (Oryza sativa). Ann. Bot., 65, 251–257. Albacete, A., Ghanem, M.E., Martinez-Andujar, C., Acosta, M., Sanchez-Bravo, J., Martinez, V., et al. (2008) Hormonal changes in relation to biomass partitioning and shoot growth impairment in salinized tomato (Solanum lycopersicum L.) plants. J. Exp. Bot., 59, 4119–4131. Shakirova, F.M., Sakhabutdinova, A.R., Bezrukova, M.V., Fatkhutdinova, R.A., Fatkhutdinova, D.R. (2003) Changes in the hormonal status of wheat seedlings induced by salicylic acid and salinity. Plant Sci., 164, 317–322. Junghans, U., Polle, A., Düchting, P., Weiler, E., Kuhlmann, B., Gruber, F., Teichmann, T. (2006) Adaptation to high salinity in poplar involves changes in xylem anatomy and auxin physiology. Plant Cell Environ., 29, 1519–1531. Popko, J., Hänsch, R., Mendel, R.R., Polle, A., Teichmann, T. (2010) The role of abscisic acid and auxin in the response of poplar to abiotic stress. Plant Biol., 12, 242–258. Yuan, H., Zhao, K., Lei, H., Shen, X., Liu, Y., Liao, X., Li, T. (2013) Genome-wide analysis of the GH3 family in apple (Malus × domestica). BMC Genomics, 14, 297. Tognetti, V.B., Van Aken, O., Morreel, K., Vandenbroucke, K., van de Cotte, B., De Clercq, I., et al. (2010) Perturbation of indole-3-butyric acid homeostasis by the UDP-Glucosyltransferase UGT74E2 modulates Arabidopsis architecture and water stress tolerance. Plant Cell, 22, 2660–2679. Ludwig-Müller, J. and Hilgenberg, W. (1995) Characterization and partial purification of indole-3-butyric acid synthetase from maize (Zea mays). Physiol. Plant., 94, 651–660. Shi, H., Chen, L., Ye, T., Liu, X., Ding, K., Chan, Z. (2014) Modulation of auxin content in Arabidopsis confers improved drought stress resistance. Plant Physiol. Biochem., 82, 209–217.

k

k

k

1 Auxin as a Mediator of Abiotic Stress Responses

29

70 Du, H., Wu, N., Fu, J., Wang, S., Li, X., Xiao, J., Xiong, L. (2012) A GH3 family

71 72

73

74

75

76

k

77

78

79

80 81

82

83 84 85

member, OsGH3–2, modulates auxin and abscisic acid levels and differentially affects drought and cold tolerance in rice. J. Exp. Bot., 63, 6467–6480. Du, H., Liu, H., Xiong, L. (2013) Endogenous auxin and jasmonic acid levels are differentially modulated by abiotic stresses in rice. Front. Plant Sci., 4, 397. Staswick, P.E., Serban, B., Rowe, M., Tiryaki, I., Maldonado, M.T., Maldonado, M.C., Suza, W. (2005) Characterization of an Arabidopsis enzyme family that conjugates amino acids to indole-3-acetic acid. Plant Cell, 17, 616–627. Teichmann, T., Bolu-Arianto, W.H., Olbrich, A., Langenfeld-Heyser, R., Göbel, C., Grzeganek, P., et al. (2008) GH3::GUS reflects cell-specific developmental patterns and stress-induced changes in wood anatomy in the poplar stem. Tree Physiol., 28, 1305–1315. Wang, S., Bai, Y., Shen, C., Wu, Y., Zhang, S., Jiang, D., et al. (2010) Auxin-related gene families in abiotic stress response in Sorghum bicolor. Functional & Integrative Genomics, 10, 533–546. Alam, I., Lee, D.G., Kim, K.H., Park, C.H., Sharmin, S.A., Lee, H., et al. (2010) Proteome analysis of soybean roots under waterlogging stress at an early vegetative stage. J. Biosci., 35, 49–62. Kinoshita, N., Wang, H., Kasahara, H., Liu, J., MacPherson, C., Machida, Y., et al. (2012) IAA-Ala resistant3, an evolutionarily conserved target of miR167, mediates Arabidopsis root architecture changes during high osmotic stress. Plant Cell, 24, 3590–3602. Lee, M., Jung, J.H., Han, D.Y., Seo, P.J., Park, W.J., Park, C.M. (2012) Activation of a flavin monooxygenase gene YUCCA7 enhances drought resistance in Arabidopsis. Planta, 235, 923–938. Kim, J.I., Baek, D., Park, H.C., Chun, H.J., Oh, D.-H., Lee, M.K., Cha, J.-Y., Kim, W.-Y., Kim, M.C., Chung, W.S. (2013) Overexpression of Arabidopsis YUCCA6 in potato results in high-auxin developmental phenotypes and enhanced resistance to water deficit. Mol. Plant, 6, 337–349. Park, H.-C., Cha, J.-Y., Yun, D.-J. (2013) Roles of YUCCAs in auxin biosynthesis and drought stress responses in plants. Plant Signal. Behav., 8:6, e24495, DOI: 10.4161/psb.24495. Park, C.-M. (2007) Auxin homeostasis in plant stress adaptation response. Plant Sign. Behav., 24, 306–307. Du, H., Wu, N., Chang, Y., Li, X., Xiao, J., Xiong, L. (2013) Carotenoid deficiency impairs ABA and IAA biosynthesis and differentially affects drought and cold tolerance in rice. Plant Mol. Biol., 83, 475–488. Zörb, C., Geilfus, C.-M., Mühling, K.H., Ludwig-Müller, J. (2013) The influence of stress on ABA and auxin concentrations in two maize cultivars differing in salt resistance. J. Plant. Physiol., 170, 220–224. Peer, W.A., Cheng, Y., Murphy, A.S. (2013) Evidence of oxidative attenuation of auxin signalling. J. Exp. Bot., 64, 2629–2639. Friml, J. (2010) Subcellular trafficking of PIN auxin efflux carriers in auxin transport. Eur. J. Cell. Biol., 89, 231–235. Lavenus, J., Goh, T., Roberts, I., Guyomarc’h, S., Lucas, M., De Smet, I., et al. (2013) Lateral root development in Arabidopsis: fifty shades of auxin. Trends Plant Sci., 18, 450–458.

k

k

k

30

Mechanism of Plant Hormone Signaling under Stress

86 Baldwin, K.L., Strohm, A.K., Masson, P.H. (2013) Gravity sensing and signal

transduction in vascular plant primary roots. Am. J. Bot., 100, 126–142. 87 Zolla, G., Heimer, Y.M., Barak, S. (2010) Mild salinity stimulates a stress-induced

morphogenic response in Arabidopsis thaliana roots. J. Exp. Bot., 61, 211– 224. 88 Shen, C.J., Bai, Y.H., Wang, S.K., Zhang, S.N., Wu, Y.R., Chen, M., et al. (2010)

89

90

91 92

93 94

k

95

96 97

98

99 100

101

102

103

Expression profile of PIN, AUX/LAX and PGP auxin transporter gene families in Sorghum bicolor under phytohormone and abiotic stress. FEBS J., 277, 2954–2969. Shibasaki, K., Uemura, M., Tsurumi, S., Rahman, A. (2009) Auxin response in Arabidopsis under cold stress: underlying molecular mechanisms. Plant Cell, 21, 3823–3838. Galvan-Ampudia, C.S., Julkowska, M.M., Darwish, E., Gandullo, J., Korver, R.A., Brunoud, G., et al. (2013) Halotropism is a response of plant roots to avoid a saline environment. Curr. Biol., 23, 2044–2050. Rosquete, M.R. and Kleine-Vehn, J. (2013) Halotropism: turning down the salty date. Curr. Biol., 23, R927–R929. Sun, J., Chen, Q., Qi, L., Jiang, H., Li, S., Xu, Y., et al. (2011) Jasmonate modulates endocytosis and plasma membrane accumulation of the Arabidopsis PIN2 protein. New Phytol., 19, 360–375. Wang, R. and Estelle, M. (2014) Diversity and specificity: auxin perception and signaling through the TIR1/AFB pathway. Curr. Opin. Plant Biol., 21, 51–58. Lin, D., Nagawa, S., Chen, J., Cao, L., Chen, X., Xu, T., et al. (2012) A ROP GTPase-dependent auxin signaling pathway regulates the subcellular distribution of PIN2 in Arabidopsis roots. Curr. Biol., 22, 1319–1325. Xu, T., Dai, N., Chen, J., Nagawa, S., Cao, M., Li, H., et al. (2014) Cell surface ABP1-TMK auxin-sensing complex activates ROP GTPase signaling. Science, 343, 1025–1028. Miyawaki, K.N. and Yang, Z. (2014) Extracellular signals and receptor-like kinases regulating ROP GTPases in plants. Fron. Plant Sci., 5, 449. Tromas, A., Paque, S., Stierlé, V., Quettier, A.-L., Muller, P., Lechner, E., et al. (2013) Auxin-binding protein 1 is a negative regulator of the SCFTIR1/AFB pathway. Nat. Commun., 4, 1–9. Jurado, S., Abraham, Z., Manzano, C., Lopez-Torrejon, G., Pacios, L.F., Del Pozo, J.C. (2010) The Arabidopsis cell cycle F-box protein SKP2A binds to auxin. Plant Cell, 22, 3891–3904. Mach, J. (2010) Auxin binding by SKP2A activates proteolysis of downstream cell cycle regulators and promotes cell division. Plant Cell, 22, 3877–3877. Sunkar, R., Chinnusamy, V., Zhu, J., Zhu, J.K. (2007) Small RNAs as big players in plant abiotic stress responses and nutrient deprivation. Trends Plant Sci., 12, 301–309. Guleria, P., Mahajan, M., Bhardwaj, J., Yadav, S.K. (2011) Plant small RNAs: biogenesis, mode of action and their Roles in abiotic stresses. Genomics Proteomics Bioinformatics, 9, 183–199. Contreras-Cubas, C., Palomar, M., Arteaga-Vázquez, M., Reyes, J.L., Covarrubias, A.A. (2012) Non-coding RNAs in the plant response to abiotic stress. Planta, 236, 943–958. Pandey, R., Joshi, G., Bhardwaj, A.R., Agarwal, M., Katiyar-Agarwal, S. (2014) A comprehensive genome-wide study on tissue-specific and abiotic

k

k

k

1 Auxin as a Mediator of Abiotic Stress Responses

104 105 106 107 108

109 110

111

k

112

113 114

115

116

117

118 119

120

stress-specific miRNAs in Triticum aestivum. PLoS ONE, 9 (4): e95800, doi:10.1371/journal.pone.0095800. Sanan-Mishra, N., Varanasi, S.P.R.M., Mukherjee, S.K. (2013) Micro-regulators of auxin action. Plant Cell Rep., 32, 733–740. Dharmasiri, S. and Estelle, M. (2002) The role of regulated protein degradation in auxin response. Plant Mol. Biol., 49, 401–409. Sunkar, R. and Zhu, J.K. (2004) Novel and stress-regulated micro-RNAs and other small RNAs from Arabidopsis. Plant Cell, 16, 2001–2019. Dharmasiri, N., Dharmasiri, S., Estelle, M. (2005) The F-box protein TIR1 is an auxin receptor. Nature, 435, 441–445. Zhao, B., Liang, R., Ge, L., Li, W., Xiao, H., Lin, H., Ruan, K., Jin, Y. (2007) Identification of drought-induced micro RNAs in rice. Biochem. Biophys. Res. Commun., 354, 585–590. Liu, H.H., Tian, X., Li, Y.J., Wu, C.A., Zheng, C.C. (2008) Microarray-based analysis of stress-regulated micro RNAs in Arabidopsis thaliana. RNA, 14, 836–843. Zhang, Z., Wei, L., Zou, X., Tao, Y., Liu, Z., Zheng, Y. (2008) Submergence-responsive microRNAs are potentially involved in the regulation of morphological and metabolic adaptations in maize root cells. Ann. Bot., 102, 509–519. Arenas-Huertero, C., Pérez, B., Rabanal, F., Blanco-Melo, D., Dela Rosa, C., Estrada-Navarrete, G., et al. (2009) Conserved and novel miRNAs in the legume Phaseolus vulgaris in response to stress. Plant Mol. Biol., 70, 385–401. Wang, Y., Li, K., Li, X. (2009) Auxin redistribution modulates plastic development of root system architecture under salt stress in Arabidopsis thaliana. J. Plant Physiol., 166, 1637– 1645. Chen, H., Li, Z., Xiong, L. (2012) A plant microRNA regulates the adaptation of roots to drought stress. FEBS Lett., 586, 1742–1747. Iglesias, M.J., Terrile, M.C., Windels, D., Lombardo, M.C., Bartoli, C.G., Vazquez, F., et al. (2014) MiR393 Regulation of auxin signaling and redox-related components during acclimation to salinity in Arabidopsis. PLoS ONE, 9 (9): e107678. doi:10.1371/journal.pone.0107678. Vidal, E.A., Araus, V., Lu, C., Parry, G., Green, P.J., Coruzzi, G.M., Gutierrez, R.A. (2010) Nitrate-responsive miR393/AFB3 regulatory module controls root system architecture in Arabidopsis thaliana. PNAS, USA, 107, 4477–4482. Wu, M.F., Tian, Q., Reed, J.W. (2006) Arabidopsis micro RNA167 controls patterns of ARF6 and ARF8 expression, and regulates both female and male reproduction. Development, 133, 4211–4218. Kruszka, K., Pacak, A., Swida-Barteczk, A., Nuc, P., Alaba, S., Wroblewska, Z., et al. (2014) Transcriptionally and post-transcriptionally regulated microRNAs in heat stress response in barley. J. Exp. Bot., 65, 6123–6135. Gill, S.S. and Tuteja, N. (2010) Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem., 48, 909–930. Sharma, P., Jha, A.B., Dubey, R.S., Pessarakli, M. (2012) Reactive oxygen species, oxidative damage, and antioxidative defense mechanism in plants under stressful conditions. J. Bot., 2012, Article ID 217037, 26 pages. Considine, M.J. and Foyer, C.H. (2014) Redox regulation of plant development. Antioxid. Redox Signal., 21, 1305–1326.

k

31

k

k

32

Mechanism of Plant Hormone Signaling under Stress

121 Mittler, R., Vanderauwera, S., Suzuki, N., Miller, G., Tognetti, V.B., Vandepoele, K.,

et al. (2011) ROS signaling: the new wave? Trends Plant Sci., 16, 300–309. 122 Krishnamurthy, A., Rathinasabapathi, B. (2013) Oxidative stress tolerance in plants.

Plant Sign. Behav., 8(10), e25761, DOI: 10.4161/psb.25761. 123 Pasternak, T., Potters, G., Caubergs, R., Jansen, M.A.K. (2005) Complementary

124

125

126

127

128

k 129

130

131

132

133

134

135

interactions between oxidative stress and auxins control plant growth responses at plant, organ, and cellular level. J. Exp. Bot., 56, 1991–2001. Potters, G., Pasternak, T.P., Guisez, Y., Palme, K.J., Jansen, M.K. (2007) Stress-induced morphogenic responses: growing out of trouble? Trends Plant Sci., 12, 98–105. Potters, G., Pasternak, T.P., Guisez, Y., Jansen, M.K. (2009) Different stresses, similar morphogenic responses: integrating a plethora of pathways. Plant Cell Environ., 32, 158–69. Bartoli, C.G., Casalongué, C.A., Simontacchi, M., Marquez-Garcia, B., Foyer, C.H. (2013) Interactions between hormone and redox signalling pathways in the control of growth and cross tolerance to stress. Env. Exp. Bot., 94, 73–88. Miller, G., Suzuki, N., Ciftci-Yilmaz, S., Mittler, R. (2010) Reactive oxygen species homeostasis and signalling during drought and salinity stresses. Plant Cell Environ., 33, 453–467. Blomster, T., Salojarvi, J., Sipari, N., Brosche, M., Ahlfors, R., et al. (2011) Apoplastic reactive oxygen species transiently decrease auxin signaling and cause stress induced morphogenic response in Arabidopsis. Plant Physiol., 157, 1866–1883. Bashandy, T., Guilleminot, J., Vernoux, T., Caparros-Ruiz, D., Ljung, K., Meyer, Y., Reichheld, J.P. (2010) Interplay between the NADP-linked thioredoxin and glutathione systems in Arabidopsis auxin signaling. Plant Cell, 22, 376–391. Koprivova, A., Mugford, S.T., Kopriva, S. (2010) Arabidopsis root growth dependence on glutathione is linked to auxin transport. Plant Cell Rep., 29, 1157–1167. Sharma, R., Priya, P., Jain, M. (2013) Modified expression of an auxin-responsive rice CC-type glutaredoxin gene affects multiple abiotic stress responses. Planta, 238, 871–884. Gao, X., Yuan, H.-M., Hu, Y.-Q., Li, J., Lu, Y.-T. (2014) Mutation of Arabidopsis CATALASE2 results in hyponastic leaves by changes of auxin levels. Plant Cell Env., 37, 175–188. Passaia, G., Queval, G., Bai, J., Margis-Pinheiro, M., Foyer, C.H. (2014) The effects of redox controls mediated by glutathione peroxidases on root architecture in Arabidopsis thaliana. J. Exp. Bot., 65, 1403–1413. Cheng, Y., Dai, X., Zhao, Y. (2006) Auxin biosynthesis by the YUCCA flavin monooxygenases controls the formation of floral organs and vascular tissues in Arabidopsis. Genes Dev., 20, 1790–1799. Zhao, F.-Y., Han, M.-M., Zhang, S.-Y., Wang, K., Zhang, C.-R., Liu, T., Liu, W. (2012) Hydrogen peroxide-mediated growth of the root system occurs via auxin signaling modification and variations in the expression of cell-cycle genes in rice seedlings exposed to cadmium stress. J. Integ. Plant. Biol., 54, 991–1006.

k

k

k

1 Auxin as a Mediator of Abiotic Stress Responses

33

136 Saab, I.N., Sharp, R.E., Pritchard, J., Voetberg, G.S. (1990) Increased endogenous

137 138 139

140

141

142 143

k

144

145

146

147

148

149 150

151

abscisic acid maintains primary root growth and inhibits shoot growth of maize seedlings at low water potentials. Plant Physiol., 93, 1329–1336. Sharp, R.E. and Lenoble, M.E. (2002) ABA, ethylene and the control of shoot and root growth under water stress. J. Exp. Bot., 53, 33–37. Zhang, J., Jia, W., Yang, J., Ismail, A.M. (2006) Role of ABA in integrating plant responses to drought and salt stresses. Field Crops Res., 97, 111–119. Planes, M.D., Niñoles, R., Rubio, L., Bissoli, G., Bueso, E., García-Sánchez, M.J., et al. (2014) A mechanism of growth inhibition by abscisic acid in germinating seeds of Arabidopsis thaliana based on inhibition of plasma membrane H+-ATPase and decreased cytosolic pH, K+, and anions. J. Exp. Bot., 66, 813–825. Salopek-Sondi, B., Šamec, D., Mihaljevi´c, S., Smolko, A., Pavlovi´c, I., Jankovi´c, I., Ludwig-Müller, J. (2013) Influence of stress hormones on auxin homeostasis in Brassica rapa seedlings. Plant Cell. Rep., 32, 1031–1042. Belin, C., Megies, C., Hauserová, E., Lopez-Molina, L. (2009) Abscisic acid represses growth of the Arabidopsis embryonic axis after germination by enhancing auxin signaling. Plant Cell, 21, 2253–2268. Abel, S., Nguyen, M.D., Theologis, A. (1995) The PS-IAA4 / 5 -like Family of Early Auxin-inducible mRNAs in Arabidopsis thaliana. J. Mol. Biol., 251, 533–549. Wilson, A.K., Pickett, F.B., Turner, J.C., Estelle, M. (1990) A dominant mutation in Arabidopsis confers resistance to auxin, ethylene and abscisic acid. Mol. Gen. Genet., 222, 377–383. Yang, C., Liu, J., Dong, X., Cai, Z., Tian, W., Wang, X. (2014) Short-term and continuing stresses differentially interplay with multiple hormones to regulate plant survival and growth. Molecular Plant, 7, 841–855. Spollen, W.G., Sharp, R.E., Saab, I.N., Wu, Y. (1993) Regulation of cell expansion in roots and shoots at low water potentials. In: Smith, J.A.C. and Griffiths, H. (eds.) Water deficits: plant responses from cell to community, 1st edn. BIOS Scientific Publishers, Oxford, pp. 37–52. van der Weele, C.M., Spollen, W.G., Sharp, R.E., Baskin, T.I. (2000) Growth of Arabidopsis thaliana seedlings under water deficit studied by control of water potential in nutrient-agar media. J. Exp. Bot., 51, 1555–1562. Sharp, R.E., Poroyko, V., Hejlek, L.G., Spollen, W.G., Springer, G.K., Bohnert, H.J., Nguyen, H.T. (2004) Root growth maintenance during water deficits: physiology to functional genomics. J. Exp. Bot., 55, 2343–2351. Yamaguchi, M., Sharp, R.E. (2010) Complexity and coordination of root growth at low water potentials: recent advances from transcriptomic and proteomic analyses. Plant Cell Environ., 33, 590–603. Kazan, K. (2013) Auxin and the integration of environmental signals into plant root development. Ann. Bot., 112, 1655–1665. Xu, W., Jia, L., Shi, W., Liang, J., Zhou, F., Li, Q., Zhang, J. (2013) Abscisic acid accumulation modulates auxin transport in the root tip to enhance proton secretion for maintaining root growth under moderate water stress. New Phytol., 197, 139–150. Hager, A. (2003) Role of the plasma membrane H + -ATPase in auxin-induced elongation growth: historical and new aspects. J. Plant Res., 116, 483–505.

k

k

k

34

Mechanism of Plant Hormone Signaling under Stress

152 Wu, H., Wu, X., Li, Z., Duan, L., Zhang, M. (2012) Physiological evaluation of

153

154

155

156 157

158 159

k

160 161 162

163

164

165

166

167

168

drought stress tolerance and recovery in cauliflower (Brassica oleracea L.) seedlings treated with methyl jasmonate and coronatine. J. Plant Growth Regul., 31, 113–123. Raya-González, J., Pelagio-Flores, R., López-Bucio, J. (2012) The jasmonate receptor COI1 plays a role in jasmonate-induced lateral root formation and lateral root positioning in Arabidopsis thaliana. J. Plant Physiol., 169, 1348–1358. Sun, J., Xu, Y., Ye, S., Jiang, H., Chen, Q., Liu, F., et al. (2009) Arabidopsis ASA1 is important for jasmonate-mediated regulation of auxin biosynthesis and transport during lateral root formation. Plant Cell, 21, 1495–1511. Gutierrez, L., Mongelard, G., Floková, K., Pacurar, D.I., Novák, O., Staswick, P., Bellini, C. (2012) Auxin controls Arabidopsis adventitious root initiation by regulating jasmonic acid homeostasis. Plant Cell, 24, 2515–2527. Benkova, E. and Hejatko, J. (2009) Hormone interactions at the root apical meristem. Plant Mol. Biol., 69, 383–396. Ružiˇ ̊ cka, K., Ljung, K., Vanneste, S., Podhorská, R., Beeckman, T., Friml, J., Benková, E. (2007) Ethylene regulates root growth through effects on auxin biosynthesis and transport-dependent auxin distribution. Plant Cell, 19, 2197–2212. Vidoz, M.L., Loreti, E., Mensuali, A., Alpi, A., Perata, P. (2010) Hormonal interplay during adventitious root formation in flooded tomato plants. Plant J., 63, 551–562. Park, W.J., Hertel, R., Kang, B.G. (2011) Enhancement of auxin sensitivity in Ranunculus sceleratus by ethylene: A mechanism to escape from hypoxia under temporary submergence. Env. Exp. Bot., 72, 266–271. Hayat, Q., Hayat, S., Irfan, M., Ahmad, A. (2010) Effect of exogenous salicylic acid under changing environment: A review. Env. Exp. Bot., 68, 14–25. Srivastava, M.K. and Dwivedi, U.N. (1998) Salicylic acid modulates glutathione metabolism in pea seedlings. J. Plant Physiol., 153,409–414. Iglesias, M.J., Terrile, M.C., Casalongué, C.A. (2011) Auxin and salicylic acid signalings counteract the regulation of adaptive responses to stress. Plant Sign. Behav., 6, 452–454. Zhang, Z., Li, Q., Li, Z., Staswick, P.E., Wang, M., Zhu, Y., He, Z. (2007) Dual regulation role of GH3.5 in salicylic acid and auxin signaling during Arabidopsis-Pseudomonas syringae interaction. Plant Physiol., 145, 450–464. Singh, V.K., Jain, M., Garg, R. (2015) Genome-wide analysis and expression profiling suggest diverse roles of GH3 genes during development and abiotic stress responses in legumes. Front Plant Sci., 5: 789. doi: 10.3389/fpls.2014.00789. Rampey, R.A., LeClere, S., Kowalczyk, M., Ljung, K., Sandberg, G., Bartel, B. (2004) A family of auxin-conjugate hydrolases that contribute to free indole-3-acetic acid levels during Arabidopsis germination. Plant Physiol., 135, 978–988. Woldemariam, M.G., Onkokesung, N., Baldwin, I.T., Galis, I. (2012) Jasmonoyl-L-isoleucine hydrolase 1 (JIH1) regulates jasmonoyl-L-isoleucine levels and attenuates plant defenses against herbivores. Plant J., 72, 758–767. Widemann, E., Miesch, L., Lugan, R., Holder, E., Heinrich, C., Aubert, Y., et al. (2013) The amidohydrolases IAR3 and ILL6 contribute to jasmonoyl-isoleucine hormone turnover and generate 12-hydroxyjasmonic acid upon wounding in Arabidopsis leaves. J. Biol. Chem., 288, 31701–31714. Seibert, C.M. and Raushel, F.M. (2005) Structural and catalytic diversity within the amidohydrolase superfamily. Biochem., 44, 6383–6391.

k

k

k

1 Auxin as a Mediator of Abiotic Stress Responses

35

169 Bartel, B. and Fink, G.R. (1995) ILR1, an amidohydrolase that releases active

indole-3-acetic acid from conjugates. Science, 268, 1745–1748. 170 LeClere, S., Tellez, R., Rampey, R.A., Seiichi, P.T., Matsuda, S.P.T., Bartel, B.

171

172 173

174

175

176

k 177

178 179 180

181

182

183

184

(2002) Characterization of a family of IAA-amino acid conjugate hydrolases from Arabidopsis. J. Biol. Chem., 277, 20446–20452. Campanella, J.J., Bakllamaja, V., Restieri, T., Vomacka, M., Herron, J., Petterson, M., Shahtaheri, S. (2003) Isolation of an ILR1 auxin conjugate hydrolase homolog from Arabidopsis suecica. Plant Growth Regul., 39, 175–181. Davies, R.T., Goetz, D.H., Lasswell, J., Anderson, M.N., Bartel, B. (1999) IAR3 encodes an auxin conjugate hydrolase from Arabidopsis. Plant Cell, 11, 365–367. Campanella, J.J., Ludwig-Müller, J., Bakllamaja, V., Sharma, V., Cartier, A. (2003) ILR1 and sILR1 IAA amidohydrolase homologs differ in expression pattern and substrate specificity. Plant Growth Regul., 41, 215–223. Campanella, J.J., Olajide, A.F., Magnus, V., Ludwig-Müller, J. (2004) A novel conjugate hydrolase from wheat with substrate specificity for longer side-chain auxin amide conjugates. Plant Physiol., 135, 2230–2240. Campanella, J.J., Smith, S.M., Leibu, D., Wexler, S., Ludwig-Müller, J. (2008) The auxin conjugate hydrolase family of Medicago truncatula and their expression during the interaction with two symbionts. J. Plant Growth Regul., 27, 26–38. Savi´c, B., Tomi´c, S., Magnus, V., Gruden, K., Barle, K., Grenkovi´c, R., et al. (2009) Auxin amidohydrolases from Brassica rapa cleave the alanine conjugate of indolepropionic acid as a preferable substrate: a biochemical and modeling approach. Plant Cell Physiol., 50, 1587–1599. Bitto, E., Bingman, C.A., Bittova, L., Houston, N.L., Boston, R.S., Fox, B.G., et al. (2009) X-ray structure of ILL2, an auxin-conjugate amidohydrolase from Arabidopsis thaliana. Proteins, 74, 61–71. Šimunovi´c, M., Žagrovi´c, B., Tomi´c, S. (2011) Mechanism and thermodynamics of ligand binding to auxin amidohydrolase. J. Mol. Recognit., 24, 854–861. Hagen, G. and Guilfoyle, T.J. (2002) Auxin-responsive gene expression: genes, promoters and regulatory factors. Plant Mol. Biol., 49, 373–385. Staswick, P.E., Tiryaki, I., Rowe, M.L. (2002) Jasmonate response locus JAR1and several related Arabidopsis genes encode enzymes of the firefly luciferase superfamily that show activity on jasmonic, salicylic, and indole-3-acetic acids in an assay for adenylation. Plant Cell, 14, 1405–1415. Takase, T., Nakazawa, M., Ishikawa, A., Kawashima, M., Ichikawa, T., Takahashi, N., et al. (2004) Ydk1-D, an auxin- responsive GH3 mutant that is involved in hypocotyl and root elongation. Plant J., 37, 471–483. Nakazawa, M., Yabe, N., Ichikawa, T., Yamamoto, Y.Y., Yoshizumi, T., Hasunuma, K., Matsui, M. (2001) DFL1, an auxinresponsive GH3 gene homologue, negatively regulates shoot cell elongation and lateral root formation, and positively regulates the light response of hypocotyl length. Plant J., 25, 213–221. Zhang, S.-W., Li, C.-H., Cao, J., Zhang, Y.-C., Zhang, S.-Q., et al. (2009) Altered architecture and enhanced drought tolerance in rice via the down-regulation of indole-3-acetic acid by TLD1/OsGH3.13 activation. Plant Physiol., 151, 1889–1901. Ding, X., Cao, Y., Huang, L., Zhao, J., Xu, C., Li, X.,Wang, S. (2008) Activation of the indole-3-acetic acid-amido synthetase GH3–8 suppresses expansin expression

k

k

k

36

Mechanism of Plant Hormone Signaling under Stress

185

186

187 188

189

190

191

k

192

193

194

195

196

and promotes salicylateand jasmonate-independent basal immunity in rice. Plant Cell, 20, 228–240. Domingo, C., Andrés, F., Tharreau, D., Iglesias, D.J., Talón, M. (2009) Constitutive expression of OsGH3.1 reduces auxin content and enhances defense response and resistance to a fungal pathogen in rice. Mol. Plant Microbe Interact., 22, 201–210. Fu, J., Liu, H., Li, Y., Yu, H., Li, X., Xiao, J., Wang, S. (2011) Manipulating broad-spectrum disease resistance by suppressing pathogen-induced auxin accumulation in rice. Plant Physiol., 155, 589–602. Westfall, C.S., Muehler, A.M., Jez, J.M. (2013) Enzyme action in the regulation of plant hormone responses. J. Biol. Chem., 288, 19304–19311. Westfall, C.S., Zubieta, C., Herrmann, J., Kapp, U., Nanao, M.H., Jez, J.M. (2012) Structural basis for prereceptor modulation of plant hormones by GH3 proteins. Science, 336, 1708–1711. Peat, T.S., Böttcher, C., Newman, J., Lucent, D., Cowieson, N., Davies, C. (2012) Crystal structure of an indole-3-acetic acid amido synthetase from grapevine involved in auxin homeostasis. Plant Cell, 24, 4525–4538. Okrent, R.A., Brooks, M.D., Wildermuth, M.C. (2009) Arabidopsis GH3.12 (PBS3) conjugates amino acids to 4-substituted benzoates and is inhibited by salicylate. J. Biol. Chem., 284, 9742–9754. Böttcher, C., Keyzers, R.A., Boss, P.K., Davies, C. (2010) Sequestration of auxin by the indole-3-acetic acid-amido synthetase GH3–1 in grape berry (Vitis vinifera L.) and the proposed role of auxin conjugation during ripening. J. Exp. Bot., 61, 3615–3625. Böttcher, C., Dennis, E.G., Booker, G.W., Polyak, S.W., Boss, P.K., Davies, C. (2012) A novel tool for studying auxin-metabolism: the inhibition of grapevine indole-3-acetic acid-amido synthetases by a reaction intermediate analogue. PLoS ONE, 7: e37632. Gulick, A.M. (2009) Conformational dynamics in the Acyl-CoA synthetases, adenylation domains of non-ribosomal peptide synthetases, and firefly luciferase. ACS Chem. Biol., 4, 811–827. Westfall, C.S., Herrmann, J., Chen, Q., Wang, S., Jez, J.M. (2010) Modulating plant hormones by enzyme action: The GH3 family of acyl acid amido synthetases. Plant Sign. Behav., 5, 1607–1612. Ludwig-Müller, J., Jülke, S., Bierfreund, N.M., Decker, E.L., Reski, R. (2009) Moss (Physcomitrella patens) GH3 proteins act in auxin homeostasis. New Phytol., 181, 323–338. Kelley, L.A. and Sternberg, M.J.E. (2009) Protein structure prediction on the web: a case study using the Phyre server. Nature Protocols, 4, 363–371.

k

k

k

37

2 Mechanism of Auxin Mediated Stress Signaling in Plants Lekshmy S 1 , Krishna G.K. 1 , Jha S.K. 2 , and Sairam R.K. 1 1

Division of Plant Physiology, Indian Agricultural Research Institute, New Delhi, India

2 Division of Genetics, Indian Agricultural Research Institute, New Delhi, India

2.1 Introduction

k

Auxin is one of the most ubiquitous and versatile plant hormone playing a role in nearly every aspect of plant growth and development. Auxin is present in all plant species and is even found in green, red, and brown algae. The presence of auxin biosynthesis and signaling mechanism in single celled green algae points out that auxin might have played a key role during evolutionary adaptation of plants to varied environments (De Smet et al. 2010). In higher plants, auxin is indispensable for the differentiation and development of root and shoot apical meristem, initiation of lateral roots and leaves and the configuration of patterns (Williams 2013). Knowledge about auxin’s role in abiotic and biotic stress signaling is limited. In this chapter, besides a concise description about auxin homeostasis, transport, and signaling, the role of auxin as a regulator of plant stress responses is described.

2.2 Auxin Biosynthesis, Homeostasis, and Signaling De novo auxin biosynthesis and the release from auxin conjugates are the two major contributing factors regulating auxin concentration in plants (Tivendale et al. 2014). Tryptophan (Trp) has long been known as precursor for auxin biosynthesis as demonstrated by feeding of 14 C-labeled Trp leading to production of labeled IAA (Wright et al. 1991). However, later on, it was revealed that IAA could also be synthesized in a Trp-independent fashion (Normanly et al. 1995). Recently, the first complete auxin biosynthesis pathway that converts Trp to IAA in plants has been established. Auxin biosynthesis is mediated by multiple pathways involving flavin containing monooxygenases (YUCCA proteins), tryptophan aminotransferases (TAA), and decarboxylases, aldehyde oxidases, nitrilases, and so on (Mano and Nemoto 2012). Trp is first converted to indole-3-pyruvate (IPA) by the TAA family of amino transferases and subsequently IAA is produced from IPA by the YUC family of flavin monooxygenases. Arabidopsis, from the YUCCA gene family consists of 11 YUC genes showing diverse cell type-specific expression patterns (Stepanova et al. 2011). Regulation of auxin Mechanism of Plant Hormone Signaling under Stress, First Edition, Volume 1. Edited by Girdhar Pandey. © 2017 John Wiley & Sons, Inc. Published 2017 by John Wiley & Sons, Inc.

k

k

k

38

Mechanism of Plant Hormone Signaling under Stress

Stress signals ABIOTIC STRESS Salt, drought, submergence, heat, cold, nutrient

BIOTIC STRESS Insects, biotrophic and necrotrophic pathogen

DEVELOPMENTAL TRIGGERS Germination to senescence

IAA homeostasis Biosynthesis IPA pathway (YUCCA, TAA), minor pathways

Conjugation/ degradation GH3, Peroxidase etc

Transport PINs, ABCB, PILs, Aux1, LAX

Bioactive pool of IAA

Auxin signaling TIR1, ABP1, AFB

k

ARFs, Expansins, H+ATPase, stress signaling (Ca, TFs, MAPK)

Hormones (Ethylene, SA, JA, Ck),

Stress response/ growth alteration Figure 2.1 Developmental and stress (biotic and abiotic) signals influence IAA homeostasis and thus the abundance of bioactive pool of IAA. The downstream IAA signaling impart stress tolerance and developmental changes by affecting either auxin responsive genes/transcription factors or by modulating responses to other plant hormones.

biosynthetic enzymes forms a major converging point in plant response to light, temperature, and nutrients (Fig. 2.1). The biologically active pool of IAA is regulated by reversible and irreversible modifications. Conjugation of IAA with amino acids (such as Ala, Asp, Phe), sugars (glucose, inositol) or proteins is a major mode of IAA homeostasis (Normanly 2010, Ludwig-Muller 2011). The auxin inducible genes GRETCHEN HAGEN3 (GH3) encodes IAA-amido conjugases are consequently a component of negative feedback regulation of auxin activity (Hagen and Guilfoyle 1985). Oxidative degradation of IAA by H2 O2 -dependent peroxidases (Gazarian et al. 1998) is another less understood pathway that assuages excess auxin levels. The metabolites, 3 methylene oxindole, 2-oxoindole3-acetic acid (oxIAA), and oxIAA-glucose (oxIAA-Glc), are the major degradation products of IAA (Novák et al. 2012).

k

k

k

2 Mechanism of Auxin Mediated Stress Signaling

k

Auxin is transported by two routes, namely, a faster non-directional long distance transport through phloem and a slower, directional short distance transport through influx and efflux carriers on plasma membrane, termed polar auxin transport (PAT). Polar transport is unique to auxin and is absent for other phytohormones (Prasad and Dhonukshe 2013). In phloem channels, auxin transport rates reach 7 cm/h (Tsurumi and Wada 1980; Baker 2000) while PAT reaches only 10 mm/h. Polar distribution of auxin is mediated through the influx carriers, namely, the AUXIN RESISTANT 1/LIKE AUX 1 (AUX1/LAX) family of transmembrane proteins (Kleine-Vehn et al. 2006; Swarup et al. 2008) and the efflux carriers, namely, the PIN family proteins (Mravec et al. 2008), ATP-binding cassette subfamily B (ABCB)-type transporters of the multidrug resistance/phosphoglycoprotein (ABCB/MDR/PGP) protein family (Noh et al., 2001), and the Major Facilitator Superfamily (MFS) transporter, the ZINC-INDUCED FACILITATOR-LIKE 1 (ZIFL1) (Remy et al. 2013). There are eight PIN gene family members characterized in Arabidopsis, namely, PIN1 to PIN8. Among the eight PIN proteins, PIN1, PIN2, PIN4, and PIN7 are involved in polar auxin transport and are distributed in the plasma membrane (Friml et al. 2002). PIN5, PIN6, and PIN8 are atypical members of the PIN Family, regulating intracellular auxin distribution and were shown to localize to the endoplasmic reticulum and were suggested to play a key role in the intracellular distribution of auxin and the regulation of cellular auxin homeostasis. PIN transport activity and cellular orientation is a target of regulation by developmental, tropical or environmental signals. Feraru et al. (2012) recently described another auxin transporter family denoted as PIN-LIKES (PILS) proteins. PILS proteins show an analogous protein topology to the PIN proteins, and similar to PIN 5, PIN6, and PIN8, where it localizes to ER and regulates intracellular auxin distribution. Auxin regulates its own polar distribution by regulating PIN transcription (Vieten et al. 2005), protein abundance and its activity at plasma membrane (Paciorek et al. 2005; Kleine-Vehn and Friml 2008), and this process is mediated through its receptor ABP1 (Robert et al. 2010). Another classical study by Sauer et al. (2006) showed that auxin acts as a cue for PIN polarity in the plasma membrane and involves AUX/IAA-AUXIN RESPONSE FACTOR (ARF) signaling pathway. This auxin mediated PIN lateral relocation in roots regulates lateral redistribution of auxin and governs the organogenesis of lateral root (LR) primordium and LR emergence (Fig. 2.1). Auxin renders its cellular functions through inducing a family of transcription factors denoted as Auxin Response Factors (ARF). Auxin promotes the degradation of a group of transcriptional repressor proteins called Auxin/Indole-3-acetic acid (Aux/IAA). Aux/IAA proteins have complimentarity to ARFs and thus inhibit the gene regulatory function of ARFs by forming heterodimers (Leyser 2006). The auxin receptor transport inhibitor response 1 (TIR1) interacts with Aux/IAA proteins (Kepinski and Leyser 2005). TIR1 is an F-box protein that forms an Aux/IAA-SCF TIR1 (SKP1, Cullin, and F-box proteins) complex, which targets Aux/IAA proteins for degradation through ubiquitin/26S proteasome pathway (Quint and Gray 2006; Guilfoyle 2007). Auxin induces transcription of three families of genes Aux/IAA, GH3, and the small auxin-up RNA (SAUR) family (Woodward and Bartel 2005).

k

39

k

k

40

Mechanism of Plant Hormone Signaling under Stress

2.3 Auxin Mediated Stress Responses in Model and Crop Plants

k

There are increasing evidences suggesting a probable link between auxin and stress responses in plants. For example, many of the auxin responsive transcripts were also induced by drought and cold stress (Jain and Khurana 2009). Cold stress negatively regulates the intracellular membrane trafficking of PIN proteins and abolishes basipetal auxin transport in Arabidopsis (Shibasaki et al. 2009). Enhancing the endogenous auxin levels by activation of the YUC7 gene, resulted in elevated endogenous auxin levels and improved drought tolerance of Arabidopsis (Lee and Luan 2012). Manipulation of GH3 genes is an alternate way of maintaining IAA homeostasis. OsGH3-8 and OsGH3-1 are known to regulate plant development and resistance to fungi (Domingo et al. 2009). Activation of OsGH3-13 expression resulted in enhanced drought tolerance and overexpression of OsGH3-2 led to disease resistance of rice (Wang and Fu 2011). Expression of OsPIN3 gene involved in polar auxin transport was induced by osmotic stress and overexpression of OsPIN3 improved drought tolerance (Zhang et al. 2012). Higher than optimum temperature induces IAA production in hypocotyls, cotyledons, and root of Arabidopsis (Yamada et al., 2009). However, Sakata et al. (2010) observed that under high temperature treatment, endogenous auxin concentration decreased due to reduction of YUC gene expression in anthers and thus resulted in male sterility of Arabidopsis and barley. Exogenous application of IAA could rescue the pollen viability in barley plants grown under high temperature. Auxin plays both a direct and indirect role in pathogen defense mechanism of plants. Auxin mediated modification of cell wall, root morphology and stomatal anatomy plays an indirect role (Kazan and Manners 2009). Small RNAs (sRNA) are short, 18–25 nucleotide sequences involved in diverse plant processes like developmental patterning and RNA silencing of plant viruses. Recent evidence unequivocally associates micro RNAs (miRNAs) with biotic and abiotic stress responses of plants (Sunkar et al. 2007). miR393 is an ABA induced miRNA and highly induced under dehydration, cold, and salinity stresses. During pathogen attack, plants initiate defense responses after perceiving pathogen-associated molecular patterns (PAMPs), flagellin derived 22–amino acid small peptide, flg22. flg22 induces miR393, which negatively regulates mRNAs of auxin receptor TIR1 and other F-box auxin receptors (Navarro et al. 2006). Abolishment of auxin signaling via flg22 overexpression leads to augmented resistance to Pseudomonas syringae pv. tomato as well as Hyaloperonospora arabidopsidis (Navarro et al. 2006). Induction of salicylic acid biosynthesis forms the basis of flg22-mediated resistance to biotrophic pathogens. Apart from pathogen defense, restriction of auxin signaling mechanism by miR393 mediates reduction in lateral root initiation and elongation during salinity stress (Iglesias et al. 2014). Plant hormones like ABA and salicylic acid, and stresses, namely, biotic and abiotic factors suppress the auxin signaling by inducing GH3 homologue WES1 to target free auxin for conjugation (Park et al. 2007). The susceptibility of plants to Pseudomonas syringae, Xanthomonas oryzae, Magnaporthe oryzae, and gall-producing bacteria were found to be promoted by auxin (Kazan and Lyons 2014). However, auxin can induce resistance to necrotrophs like Botrytis cinerea and Alternaria brassicicola (Llorente et al. 2008). The pathogen effector AvrRpt2 activates auxin signaling by destabilizing AUX/IAA proteins (Cui et al. 2013). TMV infection also destabilizes AUX/IAA proteins and thus strengthens auxin signaling.

k

k

k

2 Mechanism of Auxin Mediated Stress Signaling

41

Knocking down of IAA26 gene was found to mimic the phenotype of TMV infection in Arabidopsis (Padmanabhan et al. 2005, 2008). Plant pathogen also modulate auxin biosynthesis and homeostasis apart from altering auxin signaling. For example, Xanthomonas sp. and Ralstonia solanacearum induce plant auxin biosynthesis, thereby increasing the susceptibility of host plants (Wang and Fu 2011). Pathogens induced auxin production/availability, leads to induction of lateral root production and thus facilitate better colonization and infection of pathogen. The pathogen effector HopM1 of Pseudomonas syringae enhances targeted proteolysis of Arabidopsis MIN7 (HopM INTERACTOR 7) protein, a regulator of membrane vesicle trafficking in plants. Membrane vesicle trafficking is the key to PIN protein localization and function. Targeted proteolysis of MIN7 mediated by HopM1 induces auxin accumulation and thus create suitable environment for infection. Another pathogen-derived molecule (effector) that affects auxin efflux is PSE1 (PENETRATION SPECIFIC EFFECTOR1) of P. parasitica. In Arabidopsis, plants constitutively expressing PSE1, the accumulation of PIN4 and PIN7 at the root apex were altered and the susceptibility to P. parasitica was enhanced (Evangelisti et al. 2013) (Fig. 2.1).

2.4 Regulation of Root System Architecture under Drought and Nutrient Stresses k

Auxin is the central phytohormone that links developmental programs and environmental cues in root growth and development, and hence came to be known as “root forming hormones” (Overvoorde et al. 2010). Interestingly, auxin can inhibit or promote root growth in a dose dependent manner. In Arabidopsis, the optimum concentration of externally applied IAA for promoting root growth is 1 nM, and for shoot it is 10 μM, the level beyond, which it becomes inhibitory (Tanimoto 2005). Auxin dependent signaling is involved in development of primary, lateral and adventitious roots in the dicot Arabidopsis (Lucas et al. 2011) and in seminal, crown (CR), and lateral root (LR) development in the monocot rice (Yin et al. 2011; Wang et al. 2011; Ni et al. 2014). Drought avoidance by improved root system architecture (RSA) is a fundamental adaptation to drought stress (Gowda et al. 2011). Studies of Arabidopsis seedlings grown under a range of osmotic stress treatments showed that root growth is increased at low to moderate stress and inhibition is seen at higher levels (van der Weele et al. 2000; Xu et al. 2013). This is consistent with earlier findings in indica and japonica rice varieties, where root length was higher in upland (rainfed) than lowland (irrigated) genotypes (Price et al. 1997). In maize, the drought tolerant line CML444 was having more axile roots than lateral roots as compared to susceptible line SC-Malawi. Further, the QTL mapped for number of axile roots in maize chromosome 1 was found in the vicinity of RTCS locus involved in the activation of auxin responsive genes for root initiation (Trachsel et al. 2009). Plant roots can distinguish between wet and dry surfaces and lead to change in pattern of root growth, root hairs, and aerenchyma formation, a phenomenon known as hydro-patterning. It is sensed at the initial stage of lateral root founder cell specificity and auxin is the major player in this process (Bao et al. 2014). For maintenance of the root apical meristem and initiation of lateral root primordia, a gradient in auxin distribution is essential. The concentration gradient is maintained lower to higher from

k

k

k

42

k

Mechanism of Plant Hormone Signaling under Stress

the proximal side to the distal end, that is, the root tip. Further, within the root tip, it is highest in the quiescent center, followed by a lower concentration in root cap (Petersson et al. 2009). The lateral root primordium (LRP) development in Arabidopsis is dependent on a similar gradient peak at the LRP tip (Benková et al. 2003). The maintenance of auxin gradient for root morphogenesis is dependent upon biosynthesis in root tips (Ljung et al. 2005), transport from the shoot (Grieneisen et al. 2007; Hayashi et al. 2014), conjugation (Quint et al. 2009), intracellular compartmentation (Barbez et al. 2012), and signaling. The TAA1 protein is involved in IPA pathway, which generates indole-3-pyruvic acid (IPA) the substrate for YUC6 enzyme for IAA biosynthesis under drought stress (Park et al., 2013). Mutation in the gene encoding YUC8 resulted in cow1 mutant of rice having a constitutively wilted phenotype. The mutant lines had higher tryptamine and lower IAA content in roots in comparison with wild types. In cow1 mutant, the shoot development was 90% of normal, while root development reduced by 50% due to thinner and smaller lateral and crown roots as compared to wild type. This change in shoot-root ratio led to an imbalance in transpiratory loss and water uptake (Woo et al. 2007). In another study, activation tagged mutant for YUC7 gene of Arabidopsis (yuc7–1D) had a 40% increase in IAA level compared to wild-type and showed enhanced apical dominance and promotion of lateral root growth. The transcript expression of YUC7 gene in wild type plants is induced under drought, again showing the requirement of auxin in stress tolerance and improving RSA (Lee et al. 2012). Loss-of-function mutants of TAA1 alleles (also known as CKRC1, CYTOKININ INDUCED ROOT CURLING 1; SAV3, SHADE AVOIDANCE 3; WEI8, WEAK ETHYLENE INSENSITIVE 8; TIR2, TRANSPORT INHIBITOR RESPONSE 2) from Arabidopsis, namely wei8-1 and sav3-1 showed a dramatic reduction in hydropatterning in Arabidopsis due to reduction in IAA biosynthesis (Bao et al. 2014). Exogenous applications of IAA as well as TAA1 overexpressing lines were able to rescue hydropatterning phenotype, providing light into the role of IAA biosynthesis in regulating RSA under water deficit stress. The LOW OSMOTIC STRESS 5 (LOS5)/ABA DEFICIENT 3 (ABA3) is a molybdenum containing cofactor (MoCo) sulfurase, which is required to activate ABA aldehyde oxidase and indole-3-acetaldehyde oxidase, the enzymes involved in ABA and IAA biosynthesis, respectively. LOS5 gene expression is induced under drought, osmotic, and salt stresses (Xiong et al., 2001). Transgenic maize expressing AtLOS5 gene exhibited better root and shoot biomass after withholding water for 5 days, followed by re-watering compared to non-transgenic lines. They also maintained better relative water content during stress due to better root-shoot ratio and also reduced transpiration by increased ABA synthesis (Lu et al., 2013). Overexpression of LOS5/ABA3 in rice (Xiao et al., 2009) and soybean (Li et al., 2013) resulted in a better yield performance under drought stress as compared with non-transgenics, even though data on root phenotypes were not provided (Fig. 2.2). Several researchers have correlated longer primary root with reduced lateral branching as a drought avoidance trait (Seo et al., 2009; Chen et al., 2012). This is in contradiction with the effectiveness of auxin in lateral root emergence to avoid drought/osmotic stress. Studies on the activation tagged Arabidopsis mutant designated as enhanced drought tolerance 1 (edt1) showed more lateral roots with a deeper rooting habit, and enhanced drought tolerance compared to the wild type (Yu et al., 2008). Screening of Arabidopsis lines by activation tagging using CaMV35S enhancer tetramer produced

k

k

k

2 Mechanism of Auxin Mediated Stress Signaling IAA Biosynthesis

IAA Conjugation/

TAA1 (CRC1, SAV3, WEI8, TIR2),YUC6, YUC7, YUC8, LOS5/ABA3

degradation GH3, Peroxidase etc

IAA Transport PINs, ABCB, PILs, Aux1, LAX

43

Iron Deficiency

Aluminium toxicity

Potassium Deficiency Drought stress Nitrate signal

Bioactive pool of IAA

TRH1

Auxin signaling NRT1.1

mir393

mir164

k

TIR1

ABP1

AFB2

AFB1

AFB3

Phosphorus Deficiency

SIZ1

NAC transcription factors (AtNAC1/AtNAC2/AtAtNAC4/AtRD6/ OsNAC5,OsNAC9/OsNAC10/ZmNAC1)

Altered root system architecture Figure 2.2 Nutrient limitation and drought stress modulates auxin biosynthesis, transport, and signaling. The alterations in auxin signaling result in modification of the root system architecture and thereby stress adaptation in plants.

hrd-D mutants overexpressing the HARDY (HRD) gene, a member of AP2/ERF-like transcription factor family. They showed profuse lateral branching phenotype in hrd-D mutants along with increase in cortical cell layers and compact stele. These mutants showed enhanced survival under salt and drought stresses. Overexpression of this gene into rice led to improved water-use-efficiency under salt and drought conditions (Karaba et al. 2007). Even though the role of branching phenotype in drought and osmotic stress tolerance in both monocots and dicots was proved; these two studies did not cover the regulatory role of auxin in the root branching phenotype. A classical study by Kaneyasu et al. (2007) using auxin response inhibitor (PCIB, p-chlorophenoxyisobutylacetic acid) unequivocally proved the role of auxin signaling in root hydrotropism, where PCIB inhibited the hydrotropic response in Arabidopsis. The sensing of the external moisture deficit or osmotic gradient signal in roots for hydrotropism is performed by MIZU-KUSSEI 1 (MIZ1) protein in Arabidopsis (Kobayashi 2007). In wild-type plants MIZ1is expressed in root tips where auxin concentration is highest. Overexpression of MIZ1 positively regulated root hydrotropism, but led to a slight reduction in IAA content, which reduced primary root elongation and suppressed lateral root development (Miyazawa et al., 2012). This inhibition of lateral root growth formation by MIZ1 overexpression was rescued by exogenous auxin application, which suggests that MIZ1 modulates auxin levels and controls lateral root formation (Moriwaki et al., 2013).

k

k

k

44

k

Mechanism of Plant Hormone Signaling under Stress

Overexpression of rice micro RNA OsmiR393, which targets TIR1 and AFB2 receptors, led to a reduction in the number and length of roots and was susceptible to drought and salt stress. Application of NAA at 10–4 ppm was found to be inhibitory to wild-type while it improved the root length in mutant lines. When 10–3 ppm NAA was applied, there was a higher root number, which rescued the inhibitory effects of OsmiR393 overexpression on root traits (Xia et al. 2012). Overexpression of a miR393 degradation resistant form of TIR1 (mTIR1) gene led to enhanced auxin sensitivity, resulting in reduced primary root growth and more lateral roots (Chen et al. 2011). The signals downstream of auxin signaling are mediated by the NAC (NAM, ATAF1, 2, and CUC2) family of transcription factors, which play diverse roles in plant development (Olsen et al. 2005). NAC transcription factors regulate plant development under optimum as well as abiotic and biotic stresses like wounding, infection, salt, osmotic, and drought stresses (Nakashima et al. 2012). In fact, the RESPONSIVE TO DESICCATION 26 (RD26) gene of Arabidopsis reported by Yamaguchi-Shinozaki et al. (1992) was also an NAC family gene. The auxin signal transduction downstream of TIR1 for lateral root development under abiotic stress was found to be mediated by AtNAC1 (Xie et al. 2000) and AtNAC2 (He et al. 2005) genes in Arabidopsis. The GFP gene fusion downstream of SNAC1 (STRESS-RESPONSIVE NAC 1) promoter in rice showed an induction of the gene under drought stress in roots and leaf stomata. Also, the lines overexpressing rice SNAC1 gene showed tolerance to salt and drought stresses in rice (Hu et al. 2006). Similar results were observed by overexpression of this gene in cotton, where it induced the total root length and root dry weight under both stresses, thereby providing tolerance (Liu et al., 2014). Other RSA traits are also regulated by NAC family of homeotic proteins, especially under stress conditions. Rice plants overexpressing OsNAC10 and OsNAC5 showed an increase in cell number and size of cortex, stele, and epidermis, which led to an increase in root diameter. These lines also showed a significant increase in grain yield as compared to non-transgenic ones under field drought conditions (Jeong et al., 2010; 2013). Similar results were obtained by OsNAC9 overexpressing transgenic lines having enlarged stele and aerenchyma in rice (Redillas et al., 2012). The overexpression of GmNAC20 in soybean resulted in better lateral root branching, which helped in coping salt stress (Hao et al., 2011). The downregulation of auxin signals by microRNAs act not only at the level of TIR1, but also by post-transcriptional regulation of NAC genes. The cleavage of NAC1 mRNA is mediated by miR164. Transgenic Arabidopsis expressing wild type NAC1 (Myc-NAC1) gene and miR164 cleavage resistant (Myc-NAC1m) gene resulted in contrasting root phenotypes, where the Myc-NAC1m lines showed profuse root branching as compared to Myc-NAC1 lines with no significant difference in shoot phenotype (Guo et al., 2005). A classical study on the role of miRNA on regulation of auxin signaling was done by Li et al. (2012). They used two contrasting maize recombinant inbred lines, namely Zong3, having a higher lateral root density as compared to 87–1. Transcript expression analysis showed that Zong3 had a higher expression of ZmNAC1 than the line 87-1. Interestingly the expression level of precursor and mature miR164 was higher in 87-1, which led to a reduction in 87-1 and thereby leading to reduced lateral root density. Overexpression of ZmNAC1 in Arabidopsis also led to increased lateral branching, which confirms the function of the gene. Plant roots have the capability to adapt to the availability of macro and micro-nutrients and recent evidences suggest auxin as a major player in plant root adaptation to nutrient availability. The most important macro mineral element nitrogen is taken up as

k

k

k

2 Mechanism of Auxin Mediated Stress Signaling

k

nitrate by majority of land plants. Apart from being a nutrient, nitrates act as a signal and it is well known that plant roots tend to grow towards nitrogen rich patches of soil (Zhang and Forde 2000). Recently the nitrogen sensing and signaling mechanism is partially unraveled in Arabidopsis plant. The Arabidopsis NRT1.1 (NITRATE TRANSPORTER1.1, CHL1) protein functions as a dual affinity transporter and also as a nitrate sensor (Ho et al. 2009). The chl1/nrt1.1 mutants were defective in nitrate-induced proliferation of lateral roots, signifying the nitrate-sensing role of NRT1.1 (Remans et al. 2006). Interestingly, NRT1.1 acts as an auxin transporter under low nitrate availability and thus promotes basipetal auxin transport and inhibits lateral root production at high nitrate availability, NRT1.1 reliant basipetal auxin transport is abolished resulting in auxin maxima in lateral root initials and thus promotes lateral root growth (Krouk et al. 2010; Gojon et al. 2011). Transcript abundance of miR393 was upregulated by availability of nitrate and downregulated by reduced N metabolites. The miR393/AFB3 act as a unique N-responsive module and regulate both primary and lateral root growth responses (Vidal et al. 2010). Similar to nitrate transporters, the Arabidopsis TRH1 (TINY ROOT HAIR 1) encoding potassium transporter, belonging to KT/KUP/HAK family, acts as a putative auxin transporter. Arabidopsis plants mutated in trh1 gene displayed altered root hair development and gravitropism along with decreased K+ uptake (Rigas et al. 2001). Application of exogenous auxin could restore the developmental defects of trh1 plants. Recent evidence suggests that TRH1s act as a regulator of auxin efflux protein PIN1, having an established role in gravity perception of roots (Rigas et al. 2013). Low phosphate (Pi) availability induces suppression of primary root growth and promotes of lateral root growth to facilitate search for rhizospheric nutrient sources. However, there was no significant modification of auxin concentration or auxin transport in the roots of Pi-deficient seedlings (Pérez-Torres et al. 2008). The pericycle cells of the primary roots of Pi-deficient seedlings were hypersensitive to auxin as suggested by expression of DR5-GUS reporter in these cells (Pérez-Torres et al. 2008). The low Pi induced sensitivity of lateral root primordia were abolished in tir1afb2afb3 triple auxin receptor mutant. Low Pi conditions also leads to rapid turnover of AXR3/IAA7 (Pérez-Torres et al. 2008). Hence, it can be concluded that, root responses to low Pi is dependent on functional auxin signaling. Mutation in SIZ1, encoding a SUMO E3 ligase, rendered Arabidopsis extremely sensitive to Pi deficiency with profuse development of lateral roots. Under low Pi conditions, SIZ1 inhibits auxin transport and thereby inhibits lateral root development (Miura et al. 2011). Al3+ induced root growth inhibition is less pronounced in aux1 and pin2 mutants compared to wild-type plants (Sun et al. 2010). Fe deficiency induced root elongation is exerted through AUX1 mediated auxin transport (Giehl et al. 2012). Auxin plays a prominent role in regulating root responses to availability of water and nutrients in plants.

2.5 Conclusions and Future Perspectives Most often plants are challenged by co-occurrence of both biotic and abiotic stresses under field conditions however; the molecular mechanism of multiple stress adaptation is poorly understood. Recent evidences unequivocally associates auxin signaling with biotic and abiotic stress responses of plants. However, the knowledge at present is

k

45

k

k

46

Mechanism of Plant Hormone Signaling under Stress

fragmented and a future challenge will be to dissect the discovery of a comprehensive signaling network. Several of the signaling components identified are involved in multiple responses. miR393 is a stress induced miRNA, targeting mRNAs of auxin receptor TIR1 and other F-box auxin receptors. Overexpression of a miR393 degradation resistant form of TIR1 (mTIR1) gene led to enhance auxin sensitivity, resulted in reduced primary root growth and more lateral roots. Similarly, miR164/NAC interactome plays diverse roles in plant development. The auxin signal transduction downstream of TIR1 for lateral root development under abiotic stress was found to be mediated by AtNAC1 in Arabidopsis. Targeting auxin signaling and biosynthesis may serve more than one target (abiotic/biotic stress tolerance) at a time, however, the negative effects on agronomic traits cannot be warranted. The knowledge gained from model species has to be validated in major crop species like rice and maize with the ultimate goal of improving crop response to stressful environments.

References

k

Baker D. Vascular transport of auxins and cytokinins in Ricinus. 2000 Plant Growth Regulation 32(2–3): 157–160. Bao Y, Aggarwal P, Robbins NE, Sturrock CJ, Thompson MC, Tan HQ, Dinneny JR. Plant roots use a patterning mechanism to position lateral root branches toward available water. Proceedings of the National Academy of Sciences 2014; 111(25): 9319–9324. Barbez E, Kubeš M, Rolˇcík J, Béziat C, Pˇenˇcík A, Wang B, Kleine-Vehn, J. A novel putative auxin carrier family regulates intracellular auxin homeostasis in plants. Nature 2012; 485(7396): 119–122. Benková E, Michniewicz M, Sauer M, Teichmann T, Seifertová D, Jürgens G, Friml J. Local, efflux-dependent auxin gradients as a common module for plant organ formation. Cell 2003; 115(5): 591–602. Chen H, Li Z, Xiong L. A plant microRNA regulates the adaptation of roots to drought stress. FEBS Letters 2012; 586(12): 1742–1747. Chen ZH, Bao ML, Sun YZ, Yang YJ, Xu XH, Wang JH, Zhu MY. Regulation of auxin response by miR393-targeted transport inhibitor response protein 1 is involved in normal development in Arabidopsis. Plant Molecular Biology 2011; 77(6): 619–629. Cui F, Wu S, Sun W, Coaker G, Kunkel B, He P, Shan L. The Pseudomonas syringae type III effector AvrRpt2 promotes pathogen virulence via stimulating Arabidopsis auxin/indole acetic acid protein turnover. Plant Physiol 2013; 162: 1018–1029. De Smet I, Lau S, Voß U, Vanneste S, Benjamins R, Rademacher EH, et al. Bimodular auxin response controls organogenesis in Arabidopsis. Proceedings of the National Academy of Sciences 2010; 107(6): 2705–2710. Domingo C, Andrés F, Tharreau D, Iglesias DJ, Talón M. Constitutive expression of OsGH3. 1 reduces auxin content and enhances defense response and resistance to a fungal pathogen in rice. Molecular Plant-Microbe Interactions 2009; 22(2), 201–210. Du H, Liu H, Xiong L. Endogenous auxin and jasmonic acid levels are differentially modulated by abiotic stresses in rice. Front. Plant Sci. 2013a; 9: 397. Du H, Wu N, Chang Y, Li X, Xiao J, Xiong L. Carotenoid deficiency impairs ABA and IAA biosynthesis and differentially affects drought and cold tolerance in rice. Plant Mol. Biol. 2013b; 83: 475–488.

k

k

k

2 Mechanism of Auxin Mediated Stress Signaling

k

Evangelisti E, Govetto B, Minet-Kebdani N, Kuhn ML, Attard A, Ponchet M, et al. The Phytophthora parasitica RXLR effector penetration-specific effector 1 favours Arabidopsis thaliana infection by interfering with auxin physiology. New Phytologist 2013; 199(2): 476–489. Feraru E, Vosolsobe, S, Feraru MI, Petrasek J, Kleine-Vehn J. Evolution and structural diversification of PILS putative auxin carriers in plants. Front Plant Sci. 2012; 227: 10.3389/fpls.2012.00227. Friml J, Wi´sniewska J, Benková E, Mendgen K, Palme K. Lateral relocation of auxin efflux regulator PIN3 mediates tropism in Arabidopsis. Nature 2002; 415(6873): 806–809. Gazarian G, Lagrimini LM, Mellon FA, Naldrett MJ, Ashby GA, Thorneley RN. Identification of skatolyl hydroperoxide and its role in the peroxidase-catalysed oxidation of indol-3-yl acetic acid. Biochemical Journal 1998; 333: 223–232. Giehl RF, Lima JE, von Wirén N. Localized iron supply triggers lateral root elongation in Arabidopsis by altering the AUX1-mediated auxin distribution. The Plant Cell 2012; 24(1): 33–49. Gowda VR, Henry A, Yamauchi A, Shashidhar HE, Serraj R. Root biology and genetic improvement for drought avoidance in rice. Field Crops Research 2011; 122(1): 1–13. Grieneisen VA, Xu J, Marée AF, Hogeweg P, Scheres B. Auxin transport is sufficient to generate a maximum and gradient guiding root growth. Nature 2007; 449(7165): 1008–1013. Guilfoyle T. Plant biology: sticking with auxin. Nature 2007; 446(7136): 621–622. Guo HS, Xie Q, Fei JF, Chua NH. MicroRNA directs mRNA cleavage of the transcription factor NAC1 to downregulate auxin signals for Arabidopsis lateral root development. The Plant Cell Online 2005; 17(5): 1376–1386. Hagen G, Guilfoyle TJ. Rapid induction of selective transcription by auxins. Molecular Cell Biology 1985; 5:1197–1203. Hao YJ, Wei W, Song QX, Chen HW, Zhang YQ, Wang F, Chen SY. Soybean NAC transcription factors promote abiotic stress tolerance and lateral root formation in transgenic plants. The Plant Journal 2011; 68(2): 302–313. Hayashi KI, Nakamura S, Fukunaga S, Nishimura T, Jenness MK, Murphy AS, Aoyama T. Auxin transport sites are visualized in planta using fluorescent auxin analogs. Proceedings of the National Academy of Sciences 2014; 111(31): 11557–11562. He XJ, Mu RL, Cao WH, Zhang ZG, Zhang JS, Chen SY. AtNAC2, a transcription factor downstream of ethylene and auxin signaling pathways, is involved in salt stress response and lateral root development. The Plant Journal 2005; 44(6): 903–916. Ho CH, Lin SH, Hu HC, Tsay YF. CHL1 functions as a nitrate sensor in plants. Cell 2009; 138(6): 1184–1194. Hu H, Dai M, Yao J, Xiao B, Li X, Zhang Q, Xiong L. Overexpressing a NAM, ATAF, and CUC (NAC) transcription factor enhances drought resistance and salt tolerance in rice. Proceedings of the National Academy of Sciences 2006; 103(35): 12987–12992. Iglesias M, José M, Cecilia T, David W, María CL, Carlos GB, et al. MiR393 Regulation of auxin signaling and redox-related components during acclimation to salinity in Arabidopsis. PloS One 2014: e107678. Jain M, Khurana JP. Transcript profiling reveals diverse roles of auxin-responsive genes during reproductive development and abiotic stress in rice. Febs Journal 2009; 276(11): 3148–3162.

k

47

k

k

48

k

Mechanism of Plant Hormone Signaling under Stress

Jeong JS, Kim YS, Baek KH, Jung H, Ha SH, Do Choi Y, Kim, JK. Root-specific expression of OsNAC10 improves drought tolerance and grain yield in rice under field drought conditions. Plant Physiology 2010; 153(1): 185–197. Jeong JS, Kim YS, Redillas MC, Jang G, Jung H, Bang SW, Kim JK. OsNAC5 overexpression enlarges root diameter in rice plants leading to enhanced drought tolerance and increased grain yield in the field. Plant Biotechnology Journal 2013; 11(1): 101–114. Kaneyasu T, Kobayashi A, Nakayama M, Fujii N, Takahashi H, Miyazawa Y. Auxin response, but not its polar transport, plays a role in hydrotropism of Arabidopsis roots. Journal of Experimental Botany 2007; 58(5): 1143–1150. Karaba A, Dixit S, Greco R, Aharoni A, Trijatmiko KR, Marsch-Martinez N, Pereira A. Improvement of water use efficiency in rice by expression of HARDY, an Arabidopsis drought and salt tolerance gene. Proceedings of the National Academy of Sciences 2007; 104(39): 15270–15275. Kazan K, Lyons R. Intervention of phytohormone pathways by pathogen effectors. The Plant Cell Online 2014: 2285–2309. Kazan K, Manners JM. Linking development to defense: auxin in plant–pathogen interactions. Trends in Plant Science 2009; 14(7): 373–382. Kepinski S, Leyser O. The Arabidopsis F-box protein TIR1 is an auxin receptor. Nature 2005; 435(7041): 446–451. Kleine-Vehn J, Dhonukshe P, Swarup R, Bennett M, Friml J. Subcellular trafficking of the Arabidopsis auxin influx carrier AUX1 uses a novel pathway distinct from PIN1. The Plant Cell Online 2006; 18(11): 3171–3181. Kleine-Vehn J, Friml J. Polar targeting and endocytic recycling in auxin-dependent plant development. Annual Review of Cell and Developmental Biology 2008; 24, 447–473. Kobayashi A, Takahashi A, Kakimoto Y, Miyazawa Y, Fujii N, Higashitani A, Takahashi H. A gene essential for hydrotropism in roots. Proceedings of the National Academy of Sciences 2007; 104(11): 4724–4729. Krouk G, Lacombe B, Bielach A, Perrine-Walker F, Malinska K, Mounier E, et al. Nitrate-regulated auxin transport by NRT1. 1 defines a mechanism for nutrient sensing in plants. Developmental Cell 2010; 18(6): 927–937. Lee M, Jung JH, Han DY, Seo PJ, Park WJ, Park CM. Activation of a flavin monooxygenase gene YUCCA7 enhances drought resistance in Arabidopsis. Planta 2012; 235(5): 923–938. Lee SC, Luan S. ABA signal transduction at the crossroad of biotic and abiotic stress responses The Plant Cell Environment 2012; 35: 53–60. Leyser O. Dynamic integration of auxin transport and signalling. Current Biology 2006; 16(11): 424–433. Li Y, Zhang J, Zhang J, Hao L, Hua J, Duan L, Li Z. Expression of an Arabidopsis molybdenum cofactor sulphurase gene in soybean enhances drought tolerance and increases yield under field conditions. Plant Biotechnology Journal 2013; 11(6): 747–758. Liu G, Li X, Jin S, Liu X, Zhu L, Nie Y, Zhang X. Overexpression of rice NAC gene SNAC1 improves drought and salt tolerance by enhancing root development and reducing transpiration rate in transgenic cotton. PloS One 2014; 9(1): e86895. Ljung K, Hull AK, Celenza J, Yamada M, Estelle M, Normanly J, Sandberg G. Sites and regulation of auxin biosynthesis in Arabidopsis roots. The Plant Cell Online 2005; 17(4): 1090–1104.

k

k

k

2 Mechanism of Auxin Mediated Stress Signaling

k

Llorente F, Muskett P, Sánchez-Vallet A, López G, Ramos B, Sánchez-Rodríguez C, et al. Repression of the auxin response pathway increases Arabidopsis susceptibility to necrotrophic fungi. Molecular Plant 2008; 1(3): 496–509. Lu Y, Li Y, Zhang J, Xiao Y, Yue Y, Duan L, Li Z. Overexpression of Arabidopsis molybdenum cofactor sulfurase gene confers drought tolerance in maize (Zea mays L.). PloS One 2013; 8(1): e52126. Lucas M, Swarup R, Paponov IA, Swarup K, Casimiro I, Lake D, Bennett MJ. Short-root regulates primary, lateral, and adventitious root development in Arabidopsis. Plant Physiology 2011; 155(1): 384–398. Ludwig-Müller J. Auxin conjugates: their role for plant development and in the evolution of land plants. Journal of Experimental Botany 2011; 62:1757–1773. Mano Y, Nemoto K. The pathway of auxin biosynthesis in plants. Journal of experimental Botany 2012; 63(8): 2853–2872. Miura K, Lee J, Gong Q, Ma S, Jin JB, Yoo CY, et al. SIZ1 regulation of phosphate starvation-induced root architecture remodeling involves the control of auxin accumulation. Plant Physiology 2011; 155(2): 1000–1012. Miyazawa Y, Moriwaki T, Uchida M, Kobayashi A, Fujii N, Takahashi H. Overexpression of MIZU-KUSSEI1 enhances the root hydrotropic response by retaining cell viability under hydrostimulated conditions in Arabidopsis thaliana. Plant and Cell Physiology 2012; 53(11): 1926–1933. Moriwaki T, Miyazawa Y, Kobayashi A, Takahashi H. Molecular mechanisms of hydrotropism in seedling roots of Arabidopsis thaliana (Brassicaceae). American Journal of Botany 2013; 100(1): 25–34. Mravec J, Kubeš M, Bielach A, Gaykova V, Petrášek J, Skupa ̊ P, Friml J. Interaction of PIN and PGP transport mechanisms in auxin distribution-dependent development. Development 2008; 135(20): 3345–3354. Nakashima K, Takasaki H, Mizoi J, Shinozaki K, Yamaguchi-Shinozaki K. NAC transcription factors in plant abiotic stress responses. Biochimica et Biophysica Acta (BBA)-Gene Regulatory Mechanisms 2012; 1819(2): 97–103. Navarro L, Dunoyer P, Jay F, Arnold B, Dharmasiri N, et al. A plant miRNA contributes to antibacterial resistance by repressing auxin signaling. Science 2006; 312: 436–439. Ni J, Shen YX, Zhang YY, Liu Y. Histological characterization of the lateral root primordium development in rice. Botanical Studies 2014; 55(1): 42. Noh B, Murphy AS, Spalding EP. Multidrug resistance-like genes of Arabidopsis required for auxin transport and auxin-mediated development. The Plant Cell Online 2001; 13(11): 2441–2454. Normanly J, Slovin JP, Cohen JD. Rethinking auxin biosynthesis and metabolism. Plant Physiology 1995; 107(2): 323. Normanly J. Approaching cellular and molecular resolution of auxin biosynthesis and metabolism. Cold Spring Harbor Perspectives in Biology 2010; 2(1): p.a001594. Novák O, Hényková E, Sairanen I, Kowalczyk M, Pospíšil T, Ljung K. Tissue-specific profiling of the Arabidopsis thaliana auxin metabolome. Plant Journal 2012; 72: 523–536. Olsen AN, Ernst HA, Leggio LL, Skriver K. NAC transcription factors: structurally distinct, functionally diverse. Trends in Plant Science 2005; 10(2): 79–87. Overvoorde P, Fukaki H, Beeckman T. Auxin control of root development. Cold Spring Harbor Perspectives in Biology 2010; 2(6): a001537.

k

49

k

k

50

k

Mechanism of Plant Hormone Signaling under Stress

Paciorek T, Zažímalová E, Ruthardt N, Petrášek J, Stierhof YD, Kleine-Vehn J, Niko Geldner JR. Auxin inhibits endocytosis and promotes its own efflux from cells. Nature 2005; 435(7046): 1251–1256. Padmanabhan MS, Goregaoker SP, Golem S, Shiferaw H, Culver JN. Interaction of the tobacco mosaic virus replicase protein with the Aux/IAA protein PAP1/IAA26 is associated with disease development. J. Virol. 2005; 79: 2549–2558. Padmanabhan MS, Kramer SR, Wang X, Culver JN. Tobacco mosaic virus replicase-auxin/indole acetic acid protein interactions: reprogramming the auxin response pathway to enhance virus infection. J. Virol. 2008; 82: 2477–2485. Park HC, Cha JY, Yun DJ. Roles of YUCCAs in auxin biosynthesis and drought stress responses in plants. Plant Signaling & Behavior 2013; 8(6): e24495. Park JE, Park JY, Kim YS, Staswick PE, Jeon J, et al. GH3-mediated auxin homeostasis links growth regulation with stress adaptation response in Arabidopsis. J. Biol. Chem. 2007; 282:10036–10046. Pérez-Torres CA, López-Bucio J, Cruz-Ramírez A, Ibarra-Laclette E, Dharmasiri S, Estelle M, Herrera-Estrella L. Phosphate availability alters lateral root development in Arabidopsis by modulating auxin sensitivity via a mechanism involving the TIR1 auxin receptor. The Plant Cell 2008; 20(12): 3258–3272. Petersson SV, Johansson AI, Kowalczyk M, Makoveychuk A, Wang JY, Moritz T, Ljung K. An auxin gradient and maximum in the Arabidopsis root apex shown by high-resolution cell-specific analysis of IAA distribution and synthesis. The Plant Cell Online 2009; 21(6): 1659–1668. Prasad K, Dhonukshe P. Polar auxin transport: Cell polarity to patterning. In Polar Auxin Transport 2013 (pp. 25–44). Springer Berlin, Heidelberg. Price AH, Tomos AD, Virk DS. Genetic dissection of root growth in rice (Oryza sativa L.) I: a hydrophonic screen. Theoretical and Applied Genetics 1997; 95(1–2): 132–142. Quint M, Barkawi LS, Fan KT, Cohen JD, Gray WM. Arabidopsis IAR4 modulates auxin response by regulating auxin homeostasis. Plant Physiology 2009; 150(2): 748–758. Quint M, Gray WM. Auxin signaling. Current Opinion in Plant Biology 2006; 9(5): 448–453. Redillas MC, Jeong JS, Kim YS, Jung H, Bang SW, Choi YD, Kim JK. The overexpression of OsNAC9 alters the root architecture of rice plants enhancing drought resistance and grain yield under field conditions. Plant Biotechnology Journal 2012; 10(7): 792–805. Remans T, Nacry P, Pervent M, Filleur S, Diatloff E, Mounier E, et al. The Arabidopsis NRT1. 1 transporter participates in the signaling pathway triggering root colonization of nitrate-rich patches. Proceedings of the National Academy of Sciences 2006; 103(50): 19206–19211. Remy E, Cabrito TR, Baster P, Batista RA, Teixeira MC, Friml J, et al. A major facilitator superfamily transporter plays a dual role in polar auxin transport and drought stress tolerance in Arabidopsis. The Plant Cell 2013; 25(3): 901–926. Rigas S, Debrosses G, Haralampidis K, Vicente-Agullo F, Feldmann KA, Grabov A, et al. TRH1 encodes a potassium transporter required for tip growth in Arabidopsis root hairs. The Plant Cell 2001; 13(1): 139–151. Robert S, Kleine-Vehn J, Barbez E, Sauer M, Paciorek T, Baster P, Friml J. ABP1 mediates auxin inhibition of clathrin-dependent endocytosis in Arabidopsis. Cell 2010; 143: 111–121.

k

k

k

2 Mechanism of Auxin Mediated Stress Signaling

k

Sakata T, Takeshi O, Shinya M, Mari T, Yuta T, Nahoko H, et al. Auxins reverse plant male sterility caused by high temperatures. Proceedings of the National Academy of Sciences 2010; 8569–8574. Sauer M, Balla J, Luschnig C, Wi´sniewska J, Reinöhl V, Friml J, Benková E. Canalization of auxin flow by Aux/IAA-ARF-dependent feedback regulation of PIN polarity. Genes & Development 2006; 20(20): 2902–2911. Seo PJ, Xiang F, Qiao M, Park JY, Lee YN, Kim SG, Park CM. The MYB96 transcription factor mediates abscisic acid signaling during drought stress response in Arabidopsis. Plant Physiology 2009; 151(1): 275–289. Shibasaki K, Uemura M, Tsurumi S, Rahman A. Auxin response in Arabidopsis under cold stress: underlying molecular mechanisms. The Plant Cell 2009; 21(12): 3823–3838. Stepanova AN, Yun J, Robles LM, Novak O, He W, Guo H, et al. The Arabidopsis YUCCA1 flavin monooxygenase functions in the indole-3-pyruvic acid branch of auxin biosynthesis. Plant Cell 2011; 23: 3961–3973. Sun P, Tian QY, Chen J, Zhang WH. Aluminium-induced inhibition of root elongation in Arabidopsis is mediated by ethylene and auxin. Journal of Experimental Botany 2010; 61(2): 347–356. Sunkar R, Chinnusamy V, Zhu J, Zhu JK. Small RNAs as big players in plant abiotic stress responses and nutrient deprivation. Trends Plant Sci. 2007; 12: 301–309. Swarup K, Benková E, Swarup R, Casimiro I, Péret B, Yang Y, Bennett MJ. The auxin influx carrier LAX3 promotes lateral root emergence. Nature Cell Biology 2008; 10(8): 946–954. Tanimoto E. Regulation of root growth by plant hormones – roles for auxin and gibberellin. Critical Reviews in Plant Sciences 2005; 24(4): 249–265. Tivendale ND, Ross JJ, Cohen JD. The shifting paradigms of auxin biosynthesis. Trends in Plant Science, 2014; 19(1): 44–51. Trachsel S, Messmer R, Stamp P, Hund A. Mapping of QTLs for lateral and axile root growth of tropical maize. Theor Appl Genet. 2009; 119(8): 1413–1424. Tsurumi S, Wada S. Transport of shoot-and cotyledon-applied indole-3-acetic acid to Vicia faba root. Plant and Cell Physiology 1980; 21(5): 803–816. van der Weele CM, Spollen WG, Sharp RE, Baskin TI. Growth of Arabidopsis thaliana seedlings under water deficit studied by control of water potential in nutrient-agar media. Journal of Experimental Botany 2000; 51(350): 1555–1562. Vidal EA, Araus V, Lu C, Parry G, Green PJ, Coruzzi GM, Gutiérrez RA. Nitrate-responsive miR393/AFB3 regulatory module controls root system architecture in Arabidopsis thaliana. Proc Natl Acad Sci U S A. 2010; 107: 4477–82. doi: 10.1073/pnas.0909571107. Vieten A, Vanneste S, Wi´sniewska J, Benková E, Benjamins R, Beeckman T, Friml J. Functional redundancy of PIN proteins is accompanied by auxin-dependent cross-regulation of PIN expression. Development 2005; 132(20): 4521–4531. Wang S, Fu J. Insights into auxin signaling in plant–pathogen interactions. Frontiers in Plant Science 2011; 2: 74. Wang XF, He FF, Ma XX, Mao CZ, Hodgman C, Lu CG, Wu P. OsCAND1 is required for crown root emergence in rice. Molecular Plant 2011; 4(2): 289–299. Williams ME. The story of auxin. Teaching tools in plant biology: lecture notes. The Plant Cell 2013; doi/10.1105/tpc.110.0410. Woo YM, Park HJ, Su’udi M, Yang JI, Park JJ, Back K, An G. Constitutively wilted 1, a member of the rice YUCCA gene family, is required for maintaining water homeostasis and an appropriate root to shoot ratio. Plant Molecular Biology 2007; 65(1–2): 125–136.

k

51

k

k

52

k

Mechanism of Plant Hormone Signaling under Stress

Woodward AW, Bartel B. Auxin: regulation, action, and interaction. Annals of Botany 2005; 95(5): 707–735. Wright AD, Sampson MB, Neuffer MG, Michalczuk L, Slovin JP, Cohen JD. Indole-3-acetic acid biosynthesis in the mutant maize orange pericarp, a tryptophan auxotroph. Science 1991; 254(5034): 998–1000. Xia K, Wang R, Ou X, Fang Z, Tian C, Duan J, et al. OsTIR1 and OsAFB2 downregulation via OsmiR393 overexpression leads to more tillers, early flowering and less tolerance to salt and drought in rice. PLoS One 2012; 7(1): e30039. Xiao BZ, Chen X, Xiang CB, Tang N, Zhang QF, Xiong LZ. Evaluation of seven function-known candidate genes for their effects on improving drought resistance of transgenic rice under field conditions. Molecular Plant 2009; 2(1): 73–83. Xie Q, Frugis G, Colgan D, Chua NH. Arabidopsis NAC1 transduces auxin signal downstream of TIR1 to promote lateral root development. Genes & Development 2000; 14(23): 3024–3036. Xiong L, Ishitani M, Lee H, Zhu JK. The Arabidopsis LOS5/ABA3 locus encodes a molybdenum cofactor sulfurase and modulates cold stress–and osmotic stress–responsive gene expression. The Plant Cell Online 2001; 13(9): 2063–2083. Xu W, Jia L, Shi W, Liang J, Zhou F, Li Q, Zhang J. Abscisic acid accumulation modulates auxin transport in the root tip to enhance proton secretion for maintaining root growth under moderate water stress. New Phytologist 2013; 197(1): 139–150. Yamada M, Greenham K, Prigge MJ, Jensen PJ, Estelle M. The TRANSPORT INHIBITOR RESPONSE2 gene is required for auxin synthesis and diverse aspects of plant development. Plant Physiol 2009; 151: 168–179. Yamaguchi-Shinozaki K, Koizumi M, Urao S, Shinozaki K. Molecular cloning and characterization of 9 cDNAs for genes that are responsive to desiccation in Arabidopsis thaliana: Sequence analysis of one cDNA clone that encodes a putative transmembrane channel protein. Plant and Cell Physiology 1992; 33(3): 217–224. Yin C, Wu Q, Zeng H, Xia K, Xu J, Li R. Endogenous auxin is required but supraoptimal for rapid growth of rice (Oryza sativa L.) seminal roots, and auxin inhibition of rice seminal root growth is not caused by ethylene. Journal of Plant Growth Regulation 2011; 30(1),: 20–29. Yu H, Chen X, Hong YY, Wang Y, Xu P, Ke SD, Xiang CB. Activated expression of an Arabidopsis HD-START protein confers drought tolerance with improved root system and reduced stomatal density. The Plant Cell Online 2008; 20(4): 1134–1151. Zhang H, Forde BG. Regulation of Arabidopsis root development by nitrate availability. Journal of Experimental Botany 2000; 51(342): 51–59. Zhang Q, Li J, Zhang W, Yan S, Wang R, Zhao J, et al. 2012. The putative auxin efflux carrier OsPIN3t is involved in the drought stress response and drought tolerance. The Plant Journal 2012; 72(5): 805–816.

k

k

k

53

3 Integrating the Knowledge of Auxin Homeostasis with Stress Tolerance in Plants Shivani Saini, Isha Sharma, and Pratap Kumar Pati Department of Biotechnology, Guru Nanak Dev University, Amritsar, Punjab, India

3.1 Introduction

k

Biotic and abiotic stress affects plant growth and development, as well as productivity, by interacting at various levels (Cramer et al. 2011). In response to stress, the changes that are observed at cellular, physiological, biochemical, and molecular levels suggest the interplay of several factors such as activation of hormone signaling pathways, induction of specific set of genes and transcription factors, kinase cascades, heat shock factors, and reactive oxygen species (Atkinson et al. 2012). Phytohormones are very critical components that mediate essential interactions between environmental stimulus and plants (Du et al. 2013; Rahman et al. 2013; Shi et al. 2014; Colebrook et al. 2014). In recent years, modern experimental tools and availability of biological resources and ingenious experiments have increased our knowledge in the area. Phytohormones such as auxin, cytokinins, gibberellins, ethylene, brassinosteroids, abscisic acid, jasmonic acid, and salicylic acid (SA) have been implicated as playing a critical role in stress responsiveness of plants (Fraire-Velázquez et al. 2011; Kohli et al. 2013). It has also been observed that a variable degree of interplay exists between these phytohormones in response to stress signals (Kohli et al. 2013). Among various phytohormones, the emerging role of auxin as a master growth regulator is gradually becoming evident (Saini et al. 2013; Rahman et al. 2013). Up to now, auxins have been implicated in various aspects of plant growth and development such as cell division, elongation, cell differentiation, tropism, and tissue patterning (Quint and Gray 2006; Davies 2010). However, in recent years, there has been a growing interest in exploring the role of auxin in biotic and abiotic stress as well (Du et al. 2013; Shi et al. 2014; Zörb et al. 2013). In this chapter, we discuss various aspects of auxin homeostasis involving auxin biosynthesis, transport, conjugation, degradation, as well as signaling, and link these processes to biotic and abiotic stress.

3.2 Auxin Biosynthesis and its Role in Plant Stress The recent advances in stable isotope labeling techniques, IAA isolation at microscale level and analyzing plant mutants disrupted in biogenesis of IAA, have proved markedly invaluable in determining the potential precursors and intermediates involved in IAA Mechanism of Plant Hormone Signaling under Stress, First Edition, Volume 1. Edited by Girdhar Pandey. © 2017 John Wiley & Sons, Inc. Published 2017 by John Wiley & Sons, Inc.

k

k

k

54

Mechanism of Plant Hormone Signaling under Stress

biosynthesis. In plants, the tryptophan (Trp)-independent and (Trp)-dependent pathways are the two major possible routes for IAA biosynthesis reported to now (Woodward and Bartel 2005; Chandler 2009; Normanly 2010; Mano and Nemoto 2012). The evidence for existence of these pathways involves the presence of the intermediates, their precursors, and partial purification of the enzymes involved in their interconversions. In plants, the Trp-dependent biosynthesis of IAA is suggested as the main route of IAA biosynthesis (Fig. 3.1/Plate 2) under which the indole-3-acetamide (IAM) pathway; the indole-3-pyruvic acid (IPA) pathway; the tryptamine (TAM) pathway and the indole-3-acetaldoxime (IAOx) pathway have been reported (Woodward and Bartel 2005; Mano and Nemoto 2012; Ljung 2013). Firstly, in the Trp dependent IPA pathway, synthesis of IAA occurs in two steps; in the first step, tryptophan (Trp) is converted to IPA by aminotransferases, TAA1, which belongs to the TAA family, and its close homologues TAR1 and TAR2 (Stepanova et al. 2008; Tao et al. 2008; Yamada et al. 2009; Zhou et al. 2011), however, in the second step (also known as the rate limiting step), conversion of IPA to IAA is mediated by the YUCCA family of flavin monooxygenase genes catalyzing the NADPH-dependent hydroxylation (Mashiguchi et al. 2011; Stepanova et al. 2011; Cheng et al. 2006; 2007; Chen et al. 2014). Furthermore, various genetic and biochemical evidences strongly suggest that the IPA pathway is the main route for IAA biosynthesis in different plants (Zhao 2012). In case of Tryptamine (TAM) pathway, Trp is decarboxylated to TAM by tryptophan decarboxylases. Further, TAM is converted into k

k Auxin biosynthesis

Biotic and Abiotic stresses

Indole

IGP

Trp

IAM

IAOx

Auxin conjugation and degradation

TAM

GH3

PIN

IPA

IAA

GH3

Amide Ester

PIN

Auxin transport AUX/LAX

Auxin signaling: In the presence of auxin

ABP1

TIR1/AFB

AUX/IAA

ARF

Auxin signaling: In the absence of auxin

Activation of auxin responsive genes involved in plant growth and development

26S proteasome mediated degradation of AUX/IAA

Inactivation of 26S proteasome

ABP1

TIR1/AFB

TPL

ARF

AUX/IAA

Inactivation of auxin responsive genes involved in plant growth and development

Figure 3.1 (Plate 2) Model showing the interaction between auxin homeostasis and environmental constraints such as biotic and abiotic stresses. (See insert for color representation of this figure.)

k

k

3 Integrating Auxin Homeostasis with Stress Tolerance

k

N-hydroxyl-tryptamine through YUCCA and dehydrogenated and hydrolyzed to indole-3-acetaldehyde that is further converted into IAA (Mano and Nemoto 2012). In IAM pathway, Trp is converted to IAM by Trp monooxygenases and IAM is further converted to IAA by IAM hydrolases (Patten and Glick 1996; Woodward and Bartel 2005). IAM is present in Arabidopsis, maize, rice, and tobacco whereas IAM hydrolases, which convert IAM to IAA have been only isolated in Arabidopsis and tobacco so far. This suggests the important role of IAM pathway in IAA biosynthesis in these plants (Sugawara et al. 2009; Novák et al. 2012; Pollmann et al. 2006; Nemoto et al. 2009). In IAOx pathway, Trp is oxidized to IAOx through the combined action of two Arabidopsis P450 monooxygenases, CYP79B2 and CYP79B3. IAOx is then further converted either to IAA or indolic glucosinolate secondary metabolites (Hull et al. 2000; Mikkelsen et al. 2000; Woodward and Bartel 2005). Although, most of the IAA is considered to be formed by Trp-dependent biosynthesis pathway in plants, however, it is known that plants also use tryptophan-independent pathways in the biosynthesis of IAA. The Trp-independent route of IAA biosynthesis was first identified in the maize mutant orange pericarp (Wright et al. 1991). Further, decreased Trp levels were observed in Trp-auxotroph Zea mays mutant having defective Trp synthase B activity, however, these plants accumulated 50-fold higher IAA levels as compared to wild-type plants, indicating the existence of Trp-independent IAA biosynthesis pathway (Wright et al. 1991). Although little is known about the Trp-independent IAA biosynthesis in plants, but indole-3-glycerol phosphate (IGP) and indole (the last intermediate of Trp biosynthetic pathway) (Fig. 3.1) have been suggested as the main precursors of this pathway (Ouyang et al. 2000; Zhang et al. 2008; Östin et al. 1998). It has been demonstrated that during somatic embryogenesis, the Trp-independent pathway is considered as the main route of IAA biosynthesis in carrot, however, in undifferentiated suspension cultures, Trp-dependent IAA biosynthesis predominates (Michalczuk et al. 1992) indicating that a relationship persists between the route of IAA biosynthesis and developmental stages of carrot somatic embryogenesis. Although, these studies clearly demonstrate the existence of Trp-independent biosynthesis pathway in plants, however, additional experimental evidences and molecular characterization are required to identify the enzymes and intermediates of this pathway (Mano and Nemoto 2012; Ljung 2013). Auxin is regarded as a master regulator governing root architecture (Saini et al. 2013). It plays important role in primary root elongation, lateral root initiation, root hair development and root gravitropism (Saini et al. 2013; Benjamins and Scheres 2008, Petricka et al. 2012). The fact that root architecture is affected by drought, salinity, flooding, or nutrient stress (Benková and Hejátko 2009), hints towards existence of a strong link between auxin and abiotic stress tolerance. It is generally believed that the requirement of auxin for root development is met through its biosynthesis in shoots (particularly the developing true leaves are the main source of auxin biosynthesis in plants) and then it is transported into the roots (Bhalerao et al. 2002). However, recently it has been demonstrated that roots are also the site of local auxin biosynthesis (Ljung et al. 2005, Stepanova et al. 2008; Chen et al. 2014) and used for its patterning and ameliorating abiotic stresses. A study indicates that in Arabidopsis, five YUCCA genes YUCCA3, YUCCA5, YUCCA7, YUCCA8, and YUCCA9 play a key role in the root development (Chen et al. 2014). These genes also encode the rate limiting enzyme for auxin biosynthesis in roots. Further, very short and agravitropic primary roots are formed upon simultaneous inactivation of

k

55

k

k

56

k

Mechanism of Plant Hormone Signaling under Stress

these five YUCCA genes also known as YUCCA Q mutants (Chen et al. 2014) indicating the important role of local biosynthesis of IAA in roots. Recent studies clearly demonstrate the important role of IAA in ameliorating abiotic stresses (Du et al. 2013; Zörb et al. 2013; Shi et al. 2014). Experimental evidence suggests that IAA content decreases after drought stress but in contrast increases significantly under cold and heat stresses (Du et al. 2013), indicating that the endogenous level of IAA is differentially regulated by abiotic stress and thus implying the critical role of IAA in abiotic stress responses. Evidence also highlights the significant increase of auxin concentration, particularly IBA in growing leaves and IAA in the roots of salt-tolerant maize cultivar SR03 in response to salt stress (Zörb et al. 2013). Further, these tolerant maize varieties favor the development of growth-promoting agents, such as expansins under salt stress. It indicates the possible relationship between auxin concentration and wall extensibility allowing wall growth. Moreover, in tolerant maize leaves, ABA concentrations also increased significantly under salt stress, which aids in acidification of the apoplast, a prerequisite for plant growth under salt stress (Zörb et al. 2013), indicating the role of hormonal adaptations in regulating plant growth and development under abiotic stresses. Recently, the transcript levels of auxin biosynthesis genes in Trp-dependent IAA biosynthesis pathway have also been shown to be regulated by various biotic and abiotic stresses (Du et al. 2013; Tzin and Galili, 2010) suggesting the important role of these genes under environmental constraints. In rice genome, seven OsYUCCA genes have been reported (Yamamoto et al. 2007) and in recent experiments, it is suggested that except for OsYUCCA4 all other OsYUCCA genes exhibited down-regulation under drought stress (Du et al. 2013). However, under cold stress, OsYUCCA2, OsYUCCA3, OsYUCCA6 and OsYUCCA7 were strongly up-regulated. Similarly, heat stress also induced the expression levels of OsYUCCA3, OsYUCCA6, and OsYUCCA7 genes (Du et al. 2013). Therefore, this study indicates that IAA biosynthesis is activated by cold and heat stress but suppressed by drought stress. Furthermore, the overexpression of AtYUCCA6 in transgenic potato (Solanum tuberosum cv. Jowon) has been correlated with enhanced drought tolerance indicating the critical role of auxin biosynthesis in abiotic stress tolerance (Kim et al. 2013). It has been observed that the transgenic potato, which constitutively overexpresses Arabidopsis AtYUCCA6, exhibited high-auxin phenotypes such as narrow downward-curled leaves, increased height/erect stature, and longevity while displayed reduced accumulation of reactive oxygen species (ROS). Moreover, the transgenic plants showed enhanced tolerance against drought stress based on reduced water loss. These results clearly suggest that in potato, YUCCA pathway of auxin biosynthesis is used to alter plant responses to the environment (Kim et al. 2013). In Arabidopsis, a recent microarray analysis of flower buds of RNA-dependent RNA polymerase 6 (RDR6) mutants and wild-type plants grown under drought stress and non-stressed conditions showed that drought stress affects the expression of floral development and auxin response-related genes (Matsui et al. 2014). The information available from microarray data has been further confirmed using qRT-PCR, indicating that the expression of YUCCA1 and YUCCA4. which express in flowers, were downregulated in response to drought stress (Matsui et al. 2014).

k

k

k

3 Integrating Auxin Homeostasis with Stress Tolerance

57

3.3 Auxin Transport and its Role in Plant Stress

k

In the last decade, the discovery of various genes involved in auxin transport has tremendously strengthened our knowledge of auxin-mediated processes in plants. The transport of auxin from the site of synthesis (source) to the site of requirement (sink) is mediated by the combination of two pathways: long distance transport and short distance transport. The long distance transport is fast and involves non-directional transport of auxin through the vascular system mainly phloem. Experimental studies proved the existence of phloem transport by using radioactively labelled auxin (Morris and Thomas, 1978). However, short distance transport is slower and directional transport of auxin, called polar auxin transport (PAT). PAT is specific for active free auxins and occurs in a cell-to-cell manner and has a strictly unidirectional character. Furthermore, polar cell-to-cell auxin transport occur with the help of the class of AUXIN-RESISTANT 1/LIKE AUX1 (AUX1/LAX) influx carriers, the ATP BINDING CASSETTE superfamily of B-type transporters (ABCB/ p-glycoproteins [PGP]/MULTIDRUG RESISTANCE [MDR]), which act both as influx and efflux carriers, and PIN proteins (Fig. 3.1) that serves as only auxin efflux carriers. (Zazímalová et al. 2010). Among auxin influx carrier, AUX1, which is also marked as the first PAT protein to be identified that regulates root gravitropic curvatures, however, aux1 mutations generally exhibits reduced root gravitropism and decreased IAA transport. (Bennett et al. 1996; Marchant et al. 1999; Swarup et al. 2001). In Arabidopsis, there are mainly four auxin influx carriers, AUX1, LAX1 (like AUX1), LAX2, and LAX3 (Yang et al. 2006; Swarup et al. 2008). Furthermore, the members of MDR/PGP/ABCB have emerged as auxin transporters and genetic manipulation of ABCB proteins leads to various developmental defects consistent with the alteration of auxin distribution such as dwarfed plants with shortened inflorescences, reduced axillary and secondary inflorescences, and lesser numbers of rosette and cauline leaves (Noh et al. 2001; Geisler et al. 2005; Terasaka et al. 2005; Blakeslee et al. 2007). The analysis of the pin-formed1 mutant led to identification of PIN proteins involved in auxin efflux (Okada et al. 1991; Gälweiler et al. 1998). PIN proteins are integral membrane proteins with 10 transmembrane spanning domains providing directionality to the auxin transport (Gälweiler et al. 1998; Muller et al. 1998; Friml and Palme 2002; Mravec et al. 2011). All PIN proteins have similar structure with amino and carboxy-terminal hydrophobic membrane and a central hydrophilic loop (Kˇreˇcek et al. 2009). Further, the PIN proteins have been divided into short PINs and long PINs depending upon the length of a hydrophilic loop in the center. The long PINs 1, 2, 4, and 7 possess a long central hydrophilic loop, however, in short PINs, the central hydrophilic loop is partly or significantly reduced in PIN5, PIN6, and PIN8 (Kˇreˇcek et al. 2009; Mravec et al. 2009). In Arabidopsis, eight PIN genes are present that display a unique tissue-specific expression pattern and their functions are studied using loss- and gain-of-function mutants (Paponov et al. 2005; Kˇreˇcek et al. 2009). Since, pin1 mutants exhibit pinformed inflorescences, reduced basipetal auxin transport in inflorescence axes, reduced root length, and root meristem size, and defective development of the vascular tissues due to hindrance of auxin transport (Gälweiler et al. 1998; Okada et al. 1991; Bennett et al. 1995). Further, PIN1 resides primarily at the vascular ends, and is essential for basipetal IAA transport in shoot tissues and for acropetal transport in root tissues (Blilou et al. 2005; Gälweiler et al. 1998), whereas PIN2 is localized apically in root cortical cells, lateral root cap cells, and epidermal cells and is involved in maintaining root gravitropism through

k

k

k

58

k

Mechanism of Plant Hormone Signaling under Stress

redistribution of auxin (Ottenschlager et al. 2003; Chen et al. 1998; Muller et al. 1998; Friml et al. 2004; Shin et al. 2005). Further, in pin2 mutants, agravitropic root-growth phenotypes, reduced basipetal auxin transport in roots leading to slight shortened root length and root meristem size has been observed (Ottenschlager et al. 2003; Chen et al. 1998; Muller et al. 1998; Shin et al. 2005). PIN3 is mainly localized in the cells of the shoot endodermis, in root columella cells, in basal side of vascular cells and also to the lateral side of the pericycle cells (Friml et al. 2002b). PIN3 is involved in phototropic and gravitropic mediated growth responses and also functions in the lateral redistribution of auxin. Further, pin3 mutants displayed reduced growth, diminished phototropic and gravitropic responses, and decreased apical hook formation in etiolated seedlings (Friml et al. 2002b). PIN4 is localized in the provascular cells and in the quiescent center and it functions to establish an auxin sink below the quiescent center of the root apical meristem (Friml et al. 2002a). PIN5 localizes in the endoplasmic reticulum and mediates auxin flow from the cytosol to the endoplasmic reticulum lumen and maintains subcellular auxin homeostasis (Mravec et al. 2009). Further, pin5 mutants exhibit pronounced defects in lateral root initiation as well as in root and hypocotyls growth. PIN6 is also localized in endoplasmic reticulum and is strongly expressed in vasculature of primary roots, lateral roots, cotyledons, cauline leaves, floral stem, and reproductive organs. Further, pin6 mutants exhibits abnormal floral and nectary phenotypes and reduction in root length and lateral roots (Cazzonelli et al. 2013; Nisar et al. 2014). PIN7 localizes in the provascular cells, columella cells, in meristematic and elongation zones. This transporter plays an important function in root acropetal auxin transport. PN7 is also critical in forming and maintaining apical-basal auxin gradients required for establishing embryonic polarity (Blilou et al. 2005; Friml et al. 2003). Further, pin4 and pin7 single mutants exhibit defects in the cell division in the quiescent center and columella root cap (Blilou et al. 2005). PIN8 represents another endoplasmic reticulum localized auxin efflux carrier that expresses specifically in male gametophyte. It is involved in the intracellular auxin transport in the pollen and pin8 mutation results in aborted and misshaped pollen grains (Ding et al. 2012). The physicochemical properties of auxin molecule aid in understanding the transport of auxin across the plasma membrane. Auxins are weak organic acid and they exist in proton dissociated (IAA– + H+ ) and undissociated (IAA-H) form and their ability to penetrate through the plasma membrane depends on pH. The carboxyl group is protonated at low pH making the molecule less polar. The pH of the apoplastic fluid is approximately 5.5, thus most of the auxin molecules exist as undissociated form. In this form, it can diffuse across cell membrane easily, whereas the molecule in its unprotonated form (IAA– ) is too polar to diffuse and requires energy driven influx carriers for transportation. Inside the cytosol, the pH is approximately 7.0 and the auxin molecules dissociates into anionic dissociated form (IAA– + H+ ⇔ IAA-H). The anionic auxins are thus entrapped inside the cytosol and cannot diffuse across the plasma membrane unless auxin efflux carriers, that is, PIN transporters ameliorate this effect (Zažímalová et al. 2010; Rosquete et al. 2012). Recently, a new group of transport proteins, the PIN-LIKES (or PILS proteins) have been identified, which play a critical role in IAA transport between the cytosol and the endoplasmic reticulum function (Barbez et al. 2012). The localization of auxin influx and efflux carriers at the plasma membrane mediates IAA transport in and out of the cell facilitating PAT and manifesting an exclusive way of transporting this important phytohormone between

k

k

k

3 Integrating Auxin Homeostasis with Stress Tolerance

k

different cells and tissues. Further, various evidences suggest the importance of polar transport of auxin in maintaining auxin gradients in specific cell types, and establishment of auxin gradients that provide developmental cues during embryogenesis and root development (Friml et al. 2003; Blilou et al. 2005; Benková et al. 2009). Further, the maintenance of auxin gradients and cell polarity required for optimum auxin action depends upon the apical-basal trafficking of the PIN proteins on the plasma membrane (Grunewald and Friml 2010; Kleine-Vehn and Friml 2008). It has been observed that at the subcellular level, the rapid targeting of PINs between endosomes and the plasma membrane is mediated by vesicle-cycling machinery and GNOM. GNOM encodes ADP-ribosylation factor and are activated by guanine nucleotide exchange factor (ARF-GEF), which helps to maintain cell polarity. Furthermore, the PIN polar targeting also depends upon the reversible protein phosphorylation mechanism involving pinoid kinase (PID) and protein phosphatase 2A (PP2A). PID/PP2A function is critical for apical-basal targeting of PINs (Kleine-Vehn et al. 2009), however, GNOM specifically mediates PIN basal polar targeting. Further, studies also indicate that PID/PP2A both partially colocalize with PIN proteins and act negatively on its phosphorylation thus mediating PIN polar distribution (Michniewicz et al. 2007). It is also proposed that PID/PP2A- and GNOM- mediated polar PIN targeting is critical for tissue patterning and various plant growth and development related processes (Robert and Offringa 2008). Abiotic stresses may also affect PAT, which is supported by various studies. It has been demonstrated that the expression of PIN genes is altered under environmental perturbations (Blakeslee et al. 2005) due to accumulation of phenolic compounds in response to stress exposure (Potters et al. 2009). Recent study indicates that in rice, out of 12 OsPIN genes, the transcript levels of OsPIN2 and OsPIN5b were enhanced by drought, heat and cold stresses. While, the expression of other members of OsPINs were significantly down-regulated by abiotic stress in rice (Du et al. 2013). It has been observed that two PID -like genes in rice, which control auxin distribution through subcellular localization of PIN were suppressed by drought, heat, and cold stresses, indicating that auxin distribution is also affected by abiotic stress (Rashotte et al. 2000). Interestingly, it has been observed that in Arabidopsis, cold stress at 4∘ C reduces shootward and rootward transport of auxin. It also abolishes the root’s capacity to form auxin gradients by hindering the functionality of PINs, thus inhibiting gravitropic responses (Rashotte et al. 2000; Fukaki et al. 1996; Wyatt et al. 2002; Nadella et al. 2006), however, the wild-type phenotype is regained when returned back to room temperature (Wyatt et al. 2002). These results indicate that gravity perception is not affected but gravity response is inhibited due to hindrance of plant’s auxin efflux capability under cold stress (Wyatt et al. 2002; Nadella et al. 2006). Further, mutant studies have been conducted to potentially link auxin response in regulating plant growth and development under cold stress (Wyatt et al. 2002; Nadella et al. 2006). It has been observed that due to the effect of cold stress on gravitropism, recessive mutations have been identified at three loci. The gravity persistence signal (gps) mutant1-1 does not bend when returned to room temperature, gps2-1 bends in opposite direction and gps3-1 over-responds and bends greater than the predicted angle (Wyatt et al. 2002; Nadella et al. 2006). The gps mutants not only manifests altered gravity responses and modified polar and lateral auxin transport but they also fail to maintain auxin gradient indicating a strong link between auxin transporters and cold stress. Furthermore, to study the effect of cold stress on auxin

k

59

k

k

60

k

Mechanism of Plant Hormone Signaling under Stress

transporters, series of elegant experiments have been conducted in Arabidopsis suggesting that intarcellular trafficking of auxin efflux carriers is mediated by cold stress (Shibasaki et al. 2009). Microscopic studies have revealed that under cold stress the intracellular trafficking of PIN2 reduced dramatically due to the reduction in the membrane fluidity (Shibasaki et al. 2009). It resulted in diminished basipetal transport of auxin and lead to reduction in the root’s capability to form auxin gradient required for normal root growth and patterning (Shibasaki et al. 2009). Further, to investigate whether protein trafficking is linked to membrane fluidity, an artificial membrane rigidifier, DMSO has been applied, which mimics the effect of cold stress. It has been observed that DMSO did not affect PIN2 cycling or gravity responses (Shibasaki et al. 2009) indicating that protein trafficking is not linked with membrane rigidification. These results directly demonstrate that the downregulation of PIN2 during cold stress is a selective process resulting in hindrance of PIN2 trafficking and its transport activity. Furthermore, cold stress also inhibits the intracellular-cycling mediated asymmetric redistribution of PIN3, which is overexpressed in gravity sensing tissues (Friml et al. 2002; Shibasaki et al. 2009). Recently, the effect of salt stress on intracellular PIN2 relocalization has been studied (Galvan-Ampudia et al. 2013). It has been found that salt-induced phospholipase D activity stimulates clathrin mediated endocytosis of membrane bound PIN2 facilitating its intracellular relocalization resulting in auxin redistribution, which guided the cells to grow away from the salt gradient as a plant adaptive response to salt stress (Galvan-Ampudia et al. 2013). Also the expression of PIN2 was observed to be suppressed under salt stress at both transcriptional and post-transcriptional levels (Sun et al. 2008) indicating that high salinity affects auxin redistribution and subsequent growth and developmental processes in plants. Apart from abiotic stress, biotic stress also alters auxin transport machinery (Splivallo et al. 2009; Kazan 2013). Since, infection by mycorrhizal fungi, Laccaria bicolor greatly reduces the induction of lateral roots in pin2 mutants or in NPA treated plants through inhibition of polar auxin transport (Splivallo et al. 2009). Moreover, it has also been demonstrated that the expression level of PtaPIN9 was upregulated during interaction between L. bicolor and poplar indicating the role of auxin transporters in biotic stress (Ng et al. 2015).

3.4 Auxin Signaling and its Role in Plant Stress Auxin signaling depends upon the differential concentration of auxin, which is formed by the combined activity of two processes, that is auxin metabolism and its transport. The recent advancement in molecular and genetic approaches, have helped significantly to unravel the intricacies involved in understanding of auxin signaling pathway (Overvoorde et al. 2010). The known mechanisms in auxin signaling leading to plant growth and development is mediated through proteasome-dependent and proteasome-independent pathway. The intake of the auxin inside the cell is mediated by its passive diffusion and via the auxin import carrier, AUX1. Once auxin enters the cell, transport inhibitor response 1 (TIR1)/AFB family of auxin receptors binds to the auxins and elicit auxin mediated signaling cascade (Dharmasiri et al. 2005; Kepinski and Leyser 2005). In proteasome dependent auxin signaling, there are two related families of protein, auxin/indole-3-acetic acid (AUX/IAA), the repressors of the transcription and auxin response factors (ARF); which act either as activators or

k

k

k

3 Integrating Auxin Homeostasis with Stress Tolerance

k

repressors of transcription depending on the type of ARF involved. The proteins such as ARF 5, 7, 8, and 19 having Q-rich middle region are transcriptional activators, whereas those ARF proteins that do not possess Q-rich middle region, such as ARF1 and 2 act as transcriptional repressors (Liscum and Reed 2002). These transcription factors regulate to a great extent auxin responsive gene expression involved in plant growth and development (Guilfoyle et al. 1998a,1998b; Walker and Estelle 1998; Guilfoyle and Hagen 2007). At low auxin levels, a co-repressor, topless (TPL) mediates the binding of AUX/IAA proteins to ARF (Fig. 3.1) leading to the repression of auxin-regulated processes in plants (Szemenyei et al. 2008). AUX/IAA proteins are short lived and are degraded by ubiquitin–proteasome pathway in the presence of auxins (Gray et al. 2001; Mockaitis and Estelle 2008; Santner and Estelle 2009; Ramos et al. 2001; Zenser et al. 2001; Tiwari et al. 2001; Tian et al. 2003; Lau et al. 2009). At high IAA level, the formation of the (TIR1/AFB)-IAA-(Aux/IAA) co-receptor complex targets the Aux/IAA proteins (Fig. 3.1) and facilitate its degradation via the 26S proteasome (Calderón-Villalobos et al. 2010; Hayashi 2012). This process makes the ARFs free, which in turn bind to genes containing auxin response elements (TGTCTC) of the promoters to activate auxin regulated genes involved in plant growth and development. Auxin binding protein 1 (ABP1) is another auxin receptor which functions in proteasome independent auxin signaling pathway (Ljung 2013). This receptor is primarily located at endoplasmic reticulum and cell wall. ABP1 plays a critical role in cell division and cell elongation related developmental processes of plants (Chen et al. 2001; Ljung et al. 2013; Scherer 2011). Experimental evidences suggest that in rice, auxin signaling genes, OsIAA and OsARF respond differentially to drought, heat and cold stresses (Du et al. 2013), indicating an interaction between auxin signaling genes and abiotic stress. Moreover, auxin receptors OsAFB2, OsTIR1, and OsCUL1 were also found to be regulated by drought, cold, and heat stresses (Xia et al. 2012). It has been observed that the transcript level of OsAFB2 was reduced under cold stress. However, the gene expression of OsTIR1 was enhanced under drought and heat stresses, while, it decreased under cold stress (Du et al. 2013) suggesting that the processes upstream of auxin signaling may also be regulated by various environmental cues. Further, the role of auxin signaling genes has also been shown to be regulated under biotic stress conditions, as AUX/IAA and ARF genes express differentially in response to M. grisea and S. hermonthica infection (Ghanashyam and Jain 2009). It has also been reported that flagellin22-responsive microRNA393 inhibits auxin receptors TIR1, AFB2, and AFB3 implicating auxin in disease susceptibility. Furthermore, inhibition of these auxin receptors leads to the stabilization of IAA/AUX genes resulting in repression of auxin-responsive genes restricting Pseudomonas syringae growth providing resistance against this pathogen (Gomez-Gomez et al. 1999; Navarro et al. 2006).

3.5 Auxin Conjugation and Degradation and its Role in Plant Stress Attenuation of auxin by conjugation (mainly to amino acids and sugars moieties) and its degradation is important for maintaining appropriate auxin levels required for plant growth and development process (Normanly 2010; Rosquete et al. 2012).

k

61

k

k

62

k

Mechanism of Plant Hormone Signaling under Stress

Upon conjugation, IAA remains in stored form and these have also been reported to be involved in specific developmental process in plants (Woodward and Bartel 2005; Ludwig-Müller 2011). Gretchen Hagen 3 (GH3) family of amido synthetases and amido hydrolases catalyzes the synthesis of ATP-dependent IAA conjugation and degradation process (reviewed by Woodward and Bartel 2005; Ludwig-Müller 2011). In Arabidopsis, 19 GH3 genes from GH3–1 to GH3–19 are found to play an important role in conjugation of auxin with glucose, or protein/peptide (Fig. 3.1) (Okrent and Wildermuth 2011). IAA conjugates are further categorized as either reversible or irreversible storage compounds. Auxin reversibly conjugates to alanine (Ala) and leucine (Leu), however, binds irreversibly to aspartate (Asp) and glutamine (Glu) amino acids leading to its degradation (Staswick et al. 2005). Further, depending upon the concentration of IAA, catabolic conjugate system may be upregulated or downregulated and IAA conjugate hydrolysis occur with the help IAA amidohydrolase, which is destined for the endoplasmic reticulum (Bartel and Fink 1995; Davies et al. 1999). The degradation products of IAA mainly involve 2-oxoindole-3-acetic acid (oxIAA) and oxIAAglucose (oxIAA-Glc) metabolites (Östin et al. 1998; Kai et al. 2007; Novák et al. 2012). The genes involved in IAA conjugation and degradation have not been well identified and characterized, and the functions of IAA conjugates are still illusive and need investigation. Auxin conjugation and degradation, which are important processes for auxin homeostasis, have also been linked to abiotic stress. It has been demonstrated that the overexpression of TLD/OsGH3-13 resulted in reduction of free IAA level, and lead to enhanced drought tolerance and changed architecture of the plant (Zhang et al. 2009). In tld1-D mutants, activation of some drought inducible genes such as late embryogenesis abundant (LEA) was observed, which results in detoxification and mitigation of cellular damage caused during dehydration. Moreover, plant architectural changes such as enlarged leaf angles, thickened leaf blades, increased number of tillers and dwarfism were also observed in these mutants as a modification to adapt under drought stress (Zhang et al. 2009). Another auxin conjugation and degradation gene OsGH3-2, differentially affects drought and cold tolerance in rice, and also modulates both endogenous free IAA and ABA homeostasis (Du et al. 2012). In OsGH3-2 overexpressing lines in rice, reduced IAA and ABA content was observed. These lines also exhibited significant morphological aberrations consistent with IAA deficiency such as dwarfism, smaller leaves, and fewer crown roots and root hairs. Moreover, enhanced cold tolerance but hypersensitivity to drought stress was observed in these lines in rice indicating an important role of OsGH3.2 in regulating cold and drought stress (Du et al. 2012). In another experiment on rice, it has been indicated that among the OsGH3 family genes, OsGH3.1, OsGH3.2, OsGH3.8, OsGH3.12 and OsGH3.13 were induced by drought stress (Du et al. 2013). On the contrary, cold stress reduced the transcript levels of OsGH3.1, OsGH3.2, OsGH3.5, OsGH3.6, and OsGH3.11. Similarly, OsGH3.2, OsGH3.5, OsGH3.6, OsGH3.7, OsGH3.9, OsGH3.11 and OsGH3.13 genes were also down-regulated by heat stress (Du et al. 2013). These results suggest that the regulation of OsGH3 conjugation and degradation genes are very critical to maintain the endogenous level of IAA and hence play a pivotal role in abiotic stresses such as cold, heat and drought. Further, the expression of GH3 genes has also been linked with biotic stress. Since, differential expression of GH3 genes has been observed in response to M. grisea and S. Hermonthica indicating their role in biotic stress

k

k

k

3 Integrating Auxin Homeostasis with Stress Tolerance

63

(Ghanashyam and Jain 2009). Moreover, the GH3-overexpressing mutant wes1-D exhibits enhanced resistance to biotic stress, since, pathogenesis-related (PR) genes and C-repeat/dehydration responsive element binding factor (CBF) genes are upregulated in this mutant, indicating the key role of these genes in regulating auxin actions that regulates stress adaptation responses in Arabidopsis (Park et al. 2007).

3.6 Conclusions

k

Biotic and abiotic stress has significant adverse effects on plant growth and development, and its productivity. To date, the role of intrinsic and extrinsic factors regulating these environmental constraints has not been comprehended to a great extent. To address some of these challenges, fundamental studies to connect auxin research with biotic and abiotic stresses are being pursued in various laboratories. The output from these studies and our recent understanding of auxin metabolism, transport and signaling clearly unravel the newer roles of auxin in plants. It is increasingly realized that the dynamics of auxin homeostasis is critical in understanding of abiotic stress tolerance in plants. Adopting comprehensive experimental approaches involving physiological, genomics, proteomics, metabolomics, system biology, and the use of available biological resources will facilitate researchers to gain deeper insights into the role of auxin in biotic and abiotic stress tolerance in plants. Furthermore, modulation of endogenous auxin homeostasis and understanding its implications in stress response will open new doors in the accommodative status of plants to adapt to adverse environmental cues.

References Atkinson NJ, Urwin PE (2012) The interaction of plant biotic and abiotic stresses: from genes to the field. J Exp Bot 63:3523–3543. Barbez E, Kubeš M, Rolˇcík J, Béziat C, Pˇenˇcík A, Wang B, et al. (2012) A novel putative auxin carrier family regulates intracellular auxin homeostasis in plants. Nature 485:119–122. Bartel B, Fink GR (1995) ILR1, an amidohydrolase that releases active indole-3-acetic acid from conjugates. Science 268:1745–1748. Benjamins R, Scheres B (2008) Auxin: the looping star in plant development. Annu Rev Plant Biol 59:443–465. Benková E, Hejátko J (2009) Hormone interactions at the root apical meristem Plant Mol Biol 69:383–396. Benková E, Ivanchenko MG, Friml J, Shishkova S, Dubrovsky JG (2009) A morphogenetic trigger: is there an emerging concept in plant developmental biology? Trends Plant Sci 14:189–193. Bennett MJ, Marchant A, Green HG, May ST, Ward SP, Millner PA, et al. (1996) Arabidopsis AUX1 gene: a permease-like regulator of root gravitropism. Science 273:948–950. Bennett SRM, Alvarez J, Bossinger G, Smyth DR (1995) Morphogenesis in pinoid mutants of Arabidopsis thaliana. Plant J 8:505–520.

k

k

k

64

k

Mechanism of Plant Hormone Signaling under Stress

Bhalerao RP, Eklöf J, Ljung K, Marchant A, Bennett M, Sandberg G (2002) Shoot-derived auxin is essential for early lateral root emergence in Arabidopsis seedlings. Plant J. 29:325–332. Blakeslee JJ, Bandyopadhyay A, Lee OR, Mravec J, Titapiwatanakun B, Sauer M, et al. (2007) Interactions among PIN-FORMED and P-Glycoprotein auxin transporters in Arabidopsis. Plant Cell 19:131–147. Blakeslee JJ, Peer WA, Murphy AS (2005) Auxin transport. Current Opinion in Plant Biology 8:494–500. Blilou I, Xu J, Wildwater M, Willemsen V, Paponov I, Friml J, et al. (2005) The PIN auxin efflux facilitator network controls growth and patterning in Arabidopsis roots. Nature 433:39–44. Calderon-Villalobos LI, Tan X, Zheng N, Estelle M (2010) Auxin perception – structural insights. Cold Spring Harb Perspect Biol 2:a005546. Cazzonelli CI, Vanstraelen M, Simon S, Yin K, Carron-Arthur A, Nisar N, et al. (2013) Role of the Arabidopsis PIN6 auxin transporter in auxin homeostasis and auxin-mediated development. PLoS One. 2013; 8(7):e70069. Chandler JW (2009) Local auxin production: a small contribution to a big field. Bioessays 31:60–70. Chen Q, Dai X, De-Paoli H, Cheng Y, Takebayashi Y, Kasahara H, et al. (2014) Auxin overproduction in shoots cannot rescue auxin deficiencies in Arabidopsis roots. Plant Cell Physiol 55:1072–1079. Chen R, Hilson P, Sedbrook J, Rosen E, Caspar T, Masson PH (1998) The Arabidopsis thaliana AGRAVITROPIC 1 gene encodes a component of the polar-auxin-transport efflux carrier. Proc Natl Acad Sci USA 95:15112–15117. Cheng Y, Dai X, Zhao Y (2007) Auxin synthesized by the YUCCA flavin monooxygenases is essential for embryogenesis and leaf formation in Arabidopsis. Plant Cell 19:2430–2439. Cheng Y, Dai X, Zhao Y. (2006) Auxin biosynthesis by the YUCCA flavin monooxygenases controls the formation of floral organs and vascular tissues in Arabidopsis. Genes Dev 20:1790–1799. Colebrook EH, Thomas SG, Phillips AL, Hedden P (2014) The role of gibberellin signalling in plant responses to abiotic stress. The Journal of Experimental Biology 217:67–75. Cramer GR, Urano K, Delrot S, Pezzotti M, Shinozaki K (2011) Effects of abiotic stress on plants: a systems biology perspective. BMC Plant Biol. 11:163. Davies PJ (2010) Plant hormones: their nature, occurrence, and functions. In PJ Davies (ed.) Plant Hormones. Springer, Netherlands, pp. 1–15. Davies RT, Goetz DH, Lasswell J, Anderson MN, Bartel B (1999) IAR3 encodes an auxin conjugate hydrolase from Arabidopsis. Plant Cell 11:365–376. Dharmasiri N, Dharmasiri S, Estelle M (2005) The F-box protein TIR1 is an auxin receptor. Nature 435:441–445. Ding Z, Wang B, Moreno I, Dupláková N, Simon S, Carraro N, et al. (2012) ER-localized auxin transporter PIN8 regulates auxin homeostasis and male gametophyte development in Arabidopsis. Nat Commun 3:941. Du H, Liu H, Xiong L (2013) Endogenous auxin and jasmonic acid levels are differentially modulated by abiotic stresses in rice. Front Plant Sci 4:397. Du H, Wu N, Fu J, Wang S, Li X, Xiao J, Xiong L (2012) A GH3 family member, OsGH3-2, modulates auxin and abscisic acid levels and differentially affects drought and cold tolerance in rice. J Exp Bot 63:6467–6480.

k

k

k

3 Integrating Auxin Homeostasis with Stress Tolerance

k

Fraire-Velázquez S, Raúl Rodríguez-Guerra R, Lenin Sánchez-Calderón L (2011) Abiotic and biotic stress response crosstalk in plants. In Physiological, Biochemical and Genetic Perspectives, A. Shanker and B. Venkateswarlu (eds), InTech. DOI: 10.5772/23217. Friml J, Benkova E, Blilou I, Wisniewska J, Hamann T, Ljung K, et al. (2002a) AtPIN4 mediates sink-driven auxin gradients and root patterning in Arabidopsis. Cell 108:661–673. Friml J, Vieten A, Sauer M, Weijers D, Schwarz H, Hamann T, et al. (2003) Efflux-dependent auxin gradients establish the apical–basal axis of Arabidopsis. Nature 426:147–153. Friml J, Wisniewska J, Benkova E, Mendgen K, Palme K (2002b) Lateral relocation of auxin efflux regulator PIN3 mediates tropism in Arabidopsis. Nature 415:806–809. Friml J, Yang X, Michniewicz M, Weijers D, Quint A, Tietz O, et al. (2004) A PINOID dependent binary switch in apical–basal PIN polar targeting directs auxin efflux. Science 306:862–865. Friml J, Palme K (2002) Polar auxin transport – old questions and new concepts? Plant Mol Biol 49:273–284. Fukaki H, Fujisawa H, Tasaka M (1996) Gravitropic response of lnflorescence stems in Arabidopsis thaliana. Plant Physiol 110:933–943. Galvan-Ampudia CS, Julkowska MM, Darwish E, Gandullo J, Korver RA, Brunoud G, et al. (2013) Halotropism is a response of plant roots to avoid a saline environment. Curr Biol 23:2044–2050. Gälweiler L, Guan C, Müller A, Wisman E, Mendgen K, Yephremov A, Palme K (1998) Regulation of polar auxin transport by AtPIN1 in Arabidopsis vascular tissue. Science 282:2226–2230. Geisler M, Blakeslee JJ, Bouchard R, Lee OR, Vincenzetti V, Bandyopadhyay A, et al. (2005) Cellular efflux of auxin catalyzed by the Arabidopsis MDR/PGP transporter AtPGP1. Plant J. 44:179–194. Ghanashyam C, Jain M (2009) Role of auxin-responsive genes in biotic stress responses. Plant Signal Behav 4:846–848. Gomez-Gomez L, Felix G, Boller T (1999) A single locus determines sensitivity to bacterial flagellin in Arabidopsis thaliana. Plant J 18:277–284. Gray WM, Kepinski S, Rouse D, Leyser O, Estelle M (2001) Auxin regulates SCFTIR1 -dependent degradation of AUX/IAA proteins. Nature 414:271–276. Grunewald W, Friml J (2010) The march of the PINs: developmental plasticity by dynamic polar targeting in plant cells. EMBO J 29: 2700–2714. Guilfoyle T, Hagen G, Ulmasov T, Murfett J (1998a) How does auxin turn on genes? Plant Physiol 118:341–347. Guilfoyle TJ, Ulmasov T, Hagen G (1998b) The ARF family of transcription factors and their role in plant hormone-responsive transcription. Cell Mol Life Sci 54:619–627. Guilfoyle TJ, Hagen G (2007) Auxin response factors. Curr Opin Plant Biol. 10:453–460. Hayashi K (2012) The interaction and integration of auxin signaling components. Plant Cell Physiol 53:965–975. Hull AK, Vij R, Celenza JL (2000) Arabidopsis cytochrome P450s that catalyze the first step of tryptophan-dependent indole-3-acetic acid biosynthesis. Proc Natl Acad Sci U S A 97:2379–2384. Kai K, Horita J, Wakasa K, Miyagawa H (2007) Three oxidative metabolites of indole-3-acetic acid from Arabidopsis thaliana. Phytochemistry 68:1651–1663.

k

65

k

k

66

k

Mechanism of Plant Hormone Signaling under Stress

Kazan K (2013) Auxin and the integration of environmental signals into plant root development. Ann Bot. doi:10.1093/aob/mct229. Kepinski S, Leyser O (2005) The Arabidopsis F-box protein TIR1 is an auxin receptor. Nature 435:446–451. Kim JI, Baek D, Park HC, Chun HJ, Oh DH, Lee MK, et al. (2013) Overexpression of Arabidopsis YUCCA6 in potato results in high-auxin developmental phenotypes and enhanced resistance to water deficit. Mol Plant. 6:337–349. Kleine-Vehn J, Friml J (2008) Polar targeting and endocytic recycling in auxin-dependent plant development. Annu Rev Cell Bio 24:447–473. Kleine-Vehn J, Huang F, Naramoto S, Zhang J, Michniewicz M, Offringa R, Friml J (2009) PIN auxin efflux carrier polarity is regulated by PINOID kinase-mediated recruitment into GNOM-independent trafficking in Arabidopsis. Plant Cell 21:3839–3849. Kohli A, Sreenivasulu N, Lakshmanan P, Kumar PP (2013) The phytohormone crosstalk paradigm takes center stage in understanding how plants respond to abiotic stresses. Plant Cell Rep 32:945–957. Kˇreˇcek P, Skupa ̊ P, Libus J, Naramoto S, Tejos R, Friml J, Zažímalová E (2009) The PIN-FORMED (PIN) protein family of auxin transporters. Genome Biol 10:249. Lau S, Shao N, Bock R, Jürgens G, De Smet I (2009) Auxin signaling in algal lineages: fact or myth? Trends Plant Sci 14:182–188. Liscum E, Reed JW (2002) Genetics of Aux/IAA and ARF action in plant growth and development. Plant Mol Biol 49:387–400. Ljung K (2013) Auxin metabolism and homeostasis during plant development. Development 140:943–950. Ljung K, Hull AK, Celenza J, Yamada M, Estelle M, Normanly J, Sandberg G (2005) Sites and regulation of auxin biosynthesis in Arabidopsis roots. Plant Cell 17:1090–1104. Ludwig-Müller J (2011) Auxin conjugates: their role for plant development and in the evolution of land plants. J Exp Bot 62:1757–1773. Mano Y, Nemoto K (2012) The pathway of auxin biosynthesis in plants. J Exp Bot. 63:2853–2872. Marchant A, Kargul J, May ST, Muller P, Delbarre A, Perrot-Rechenmann C, Bennett MJ (1999) AUX1 regulates root gravitropism in Arabidopsis by facilitating auxin uptake within root apical tissues. EMBO J. 18:2066–2073. Mashiguchi K, Tanaka K, Sakai T, Sugawara S, Kawaide H, et al. (2011) The main auxin biosynthesis pathway in Arabidopsis. Proc Natl Acad Sci U S A 108:18512–18517. Matsui A, Mizunashi K, Tanaka M, Kaminuma E, Nguyen AH, Nakajima M, et al. (2014) tasiRNA-ARF pathway moderates floral architecture in Arabidopsis plants subjected to drought stress. http://dx.doi.org/10.1155/2014/303451. Michalczuk L, Ribnicky DM, Cooke TJ, Cohen JD (1992) Regulation of indole-3-acetic acid biosynthetic pathways in carrot cell cultures. Plant Physiol 100:1346–1353. Michniewicz M, Zago MK, Abas L, Weijers D, Schweighofer A, Meskiene I, et al. (2007) Antagonistic regulation of PIN phosphorylation by PP2A and PINOID directs auxin flux. Cell 130:1044–1056. Mikkelsen MD, Hansen CH, Wittstock U, Halkier BA (2000) Cytochrome P450 CYP79B2 from Arabidopsis catalyzes the conversion of tryptophan to indole-3-acetaldoxime, a precursor of indole glucosinolates and indole-3-acetic acid. J Biol Chem 275:33712–33717.

k

k

k

3 Integrating Auxin Homeostasis with Stress Tolerance

k

Mockaitis K, Estelle M ( 2008) Auxin receptors and plant development: a new signaling paradigm. Annu Rev Cell Dev Biol 24:55–80. Morris DA, Thomas AG (1978) A microautoradiographic study of auxin transport in the stem of intact pea seedlings (Pisum sativum L.). J Exp Bot 29:147–157. Mravec J, Petrasek J, Li N, Boeren S, Karlova R, Kitakura S, et al. (2011) Cell plate restricted association of DRP1A and PIN proteins is required for cell polarity establishment in Arabidopsis. Curr Biol 21:1055–1060. Mravec J, Skupa ̊ P, Bailly A, Hoyerová K, Krecek P, Bielach A, et al. (2009) Subcellular homeostasis of phytohormone auxin is mediated by the ER-localized PIN5 transporter. Nature 459:1136–1140. Muller A, Guan CH, Galweiler L, Tanzler P, Huijser P, Marchant A, et al. (1998) AtPIN2 defines a locus of Arabidopsis for root gravitropism control. EMBO J 17:6903–6911. Nadella V, Shipp MJ, Muday GK, Wyatt SE (2006) Evidence for altered polar and lateral auxin transport in the gravity persistent signal (gps) mutants of Arabidopsis. Plant Cell Environ 29:682–690. Navarro L, Dunoyer P, Jay F, et al. (2006) A plant miRNA contributes to antibacterial resistance by repressing auxin signaling. Science 312:436–439. Nemoto K, Hara M, Suzuki M, Seki H, Muranaka T, Mano Y (2009) The NtAMI1 gene functions in cell division of tobacco BY-2 cells in the presence of indole-3-acetamide. FEBS Lett 583:487–492. Ng JLP, Perrine-Walker F, Wasson AP, Mathesius U (2015) The control of auxin transport in parasitic and symbiotic root–microbe interactions. Plants 4:606–643. Nisar N, Cuttriss AJ, Pogson BJ, Cazzonelli CI (2014) The promoter of the Arabidopsis PIN6 auxin transporter enabled strong expression in the vasculature of roots, leaves, floral stems and reproductive organs. Plant Signal Behav 9: e27898. Noh B, Murphy AS, Spalding EP (2001) Multidrug resistance-like genes of Arabidopsis required for auxin transport and auxin-mediated development. Plant Cell 13:2441–2454. Normanly J (2010) Approaching cellular and molecular resolution of auxin biosynthesis and metabolism. Cold Spring Harb Perspect Biol 2 a001594. Novák O, Hényková E, Sairanen I, Kowalczyk M, Pospíšil T, Ljung K (2012) Tissue-specific profiling of the Arabidopsis thaliana auxin metabolome. Plant J 72:523–536. Okada K, Ueda J, Komaki MK, Bell CJ, Shimura Y (1991) Requirement of the auxin polar transport system in early stages of Arabidopsis floral bud formation. Plant Cell 37:677–684. Okrent RA, Wildermuth MC (2011) Evolutionary history of the GH3 family of acyl adenylases in rosids. Plant Mol Biol 76:489–505. Östin A, Kowalyczk M, Bhalerao RP, Sandberg G (1998) Metabolism of indole-3-acetic acid in Arabidopsis. Plant Physiol 118:285–296. Ottenschlager I, Wolff P, Wolverton C, Bhalerao RP, Sandberg G, Ishikawa H, et al. (2003) Gravity-regulated differential auxin transport from columella to lateral root cap cells. Proc Natl Acad Sci USA 100:2987–2991. Ouyang J, Shao X, Li J (2000) Indole-3-glycerol phosphate, a branchpoint of indole-3-acetic acid biosynthesis from the tryptophan biosynthetic pathway in Arabidopsis thaliana. Plant J 24:327–333. Overvoorde P, Fukaki H, Beeckman T (2010) Auxin control of root development. Cold Spring Harb Perspect Biol 2:a001537.

k

67

k

k

68

k

Mechanism of Plant Hormone Signaling under Stress

Paponov IA, Teale WD, Trebar M, Blilou I, Palme K (2005) The PIN auxin efflux facilitators: evolutionary and functional perspectives. Trends Plant Sci 10:170–177. Park JE, Park JY, Kim YS, Staswick PE, Jeon J, Yun J, et al. (2007) GH3-mediated auxin homeostasis links growth regulation with stress adaptation response in Arabidopsis. J Biol Chem 282:10036–10046. Patten CL, Glick BR (1996) Bacterial biosynthesis of indole-3-acetic acid. Can J Microbiol 42:207–220. Petricka JJ, Winter CM, Benfey PN (2012) Control of Arabidopsis root development. Annu Rev Plant Biol 63:563–590. Pollmann S, Müller A, Weiler EW (2006) Many roads lead to “auxin”: of nitrilases, synthases, and amidases. Plant Biol 8:326–333. Potters G, Pasternak TP, Guisez Y, Jansen MA (2009) Different stresses, similar morphogenic responses: integrating a plethora of pathways. Plant Cell Environ 32:158–169. Quint M, Gray WM (2006) Auxin signaling. Curr Opin Plant Biol 9:448–453. Rahman A (2013) Auxin: a regulator of cold stress response. Physiol Plant 147:28–35 7:e1002172 Ramos JA, Zenser N, Leyser O, Callis J (2001) Rapid degradation of auxin/indoleacetic acid proteins requires conserved amino acids of domain II and is proteasome dependent. Plant Cell 13:2349–2360. Rashotte AM, Brady SR, Reed RC, Ante SJ, Muday GK (2000) Basipetal auxin transport is required for gravitropism in roots of Arabidopsis. Plant Physiol 122:481–490. Robert HS, Offringa R (2008) Regulation of auxin transport polarity by AGC kinases. Curr Opin Plant Biol 11:495–502. Rosquete MR, Barbez E, Kleine-Vehn J (2012) Cellular auxin homeostasis: gatekeeping is housekeeping. Mol Plant. 5:772–786. Saini S, Sharma I, Kaur N, Pati PK (2013) Auxin: a master regulator in plant root development. Plant Cell Rep 32:741–757. Santner A, Estelle M (2009) Recent advances and emerging trends in plant hormone signaling. Nature 459:1071–1078. Sauer M, Kleine-Vehn (2011) AUXIN BINDING PROTEIN1: The Outsider. J Plant Cell 23:2033–2043. Scherer GF (2011) AUXIN-BINDING-PROTEIN1, the second auxin receptor: what is the significance of a two-receptor concept in plant signal transduction? J Exp Bot 62:3339–3357. Shi H, Chen L, Ye T, Liu X, Ding K, Chan Z (2014) Modulation of auxin content in Arabidopsis confers improved drought stress resistance. Plant Physiol Biochem 82:209–217. Shibasaki K, Uemura M, Tsurumi S, Rahman A (2009) Auxin response in Arabidopsis under cold stress: Underlying molecular mechanisms. Plant Cell 21:3823–3838. Shin H, Shin HS, Guo Z, Blancaflor EB, Masson PH, Chen R (2005) Complex regulation of Arabidopsis AGR1/PIN2-mediated root gravitropic response and basipetal auxin transport by cantharidin-sensitive protein phosphatases. Plant J 42:188–200. Splivallo R, Fischer U, Gobel C, Feussner I, Karlovsky P (2009) Truffles regulate plant root morphogenesis via the production of auxin and ethylene. Plant Physiology 150:2018–2029.

k

k

k

3 Integrating Auxin Homeostasis with Stress Tolerance

k

Staswick PE, Serban B, Rowe M, Tiryaki I, Maldonado MT, Maldonado MC, Suza W (2005) Characterization of an Arabidopsis enzyme family that conjugates amino acids to indole-3-acetic acid. Plant Cell 2005 17:616–627. Stepanova AN, Robertson-Hoyt J, Yun J, Benavente LM, Xie DY, Dolezal K, et al. (2008) TAA1-mediated auxin biosynthesis is essential for hormone crosstalk and plant development. Cell 133:177–191. Stepanova AN, Yun J, Robles LM, Novak O, He W, Guo H,et al. (2011) The Arabidopsis YUCCA1 flavin monooxygenase functions in the indole-3-pyruvic acid branch of auxin biosynthesis. Plant Cell 23:3961–3973. Sugawara S, Hishiyama S, Jikumaru Y, Hanada A, Nishimura T, Koshiba T, et al. (2009) Biochemical analyses of indole-3-acetaldoxime-dependent auxin biosynthesis in Arabidopsis. Proc Natl Acad Sci USA 106:5430–5435. Sun F, Zhang W, Hu H, Li B, Wang Y, Zhao Y, Li K, et al. (2008) Salt modulates gravity signaling pathway to regulate growth direction of primary roots in Arabidopsis. Plant Physiol 146:178–188. Swarup K, Benková E, Swarup R, Casimiro I, Péret B, et al. (2008) The auxin influx carrier LAX3 promotes lateral root emergence. Nat Cell Biol 10:946–954. Swarup R, Friml J, Marchant A, Ljung K, Sandberg G, Palme K, Bennett M (2001) Localization of the auxin permease AUX1 suggests two functionally distinct hormone transport pathways operate in the Arabidopsis root apex. Genes Dev 15: 2648–2653. Szemenyei H, Hannon M, Long JA (2008) TOPLESS mediates auxin-dependent transcriptional repression during Arabidopsis embryogenesis. Science. 319:1384–1386. Tao Y, Ferrer JL, Ljung K, Pojer F, Hong F, Long JA, et al. (2008) Rapid synthesis of auxin via a new tryptophan-dependent pathway is required for shade avoidance in plants. Cell 133:164–176. Terasaka K, Blakeslee JJ, Titapiwatanakun B, Peer WA, Bandyopadhyay A, Makam SN, et al. (2005) PGP4, an ATP binding cassette P-glycoprotein, catalyzes auxin transport in Arabidopsis thaliana roots. Plant Cell 17:2922–2939. Tian Q, Nagpal P, Reed JW (2003) Regulation of Arabidopsis SHY2/IAA3 protein turnover. Plant J 36:643–651. Tiwari SB, Wang XJ, Hagen G, Guilfoyle TJ (2001) AUX/IAA proteins are active repressors, and their stability and activity are modulated by auxin. Plant Cell 13:2809–2822. Tzin V, Galili G (2010) The biosynthetic pathways for shikimate and aromatic amino acids in Arabidopsis thaliana. The Arabidopsis Book 8:e0132. Walker L, Estelle M (1998) Molecular mechanisms of auxin action. Curr Opin Plant Biol. 1:434–439. Woodward AW, Bartel B (2005) Auxin: regulation, action, and interaction. Ann Bot 95:707–735. Wright AD, Sampson MB, Neuffer MG, Michalczuk L, Slovin JP, Cohen JD (1991) Indole-3-acetic acid biosynthesis in the mutant maize orange pericarp, a tryptophan auxotroph. Science 254:998–1000. Wyatt SE, Rashotte AM, Shipp MJ, Robertson D, Muday GK (2002) Mutations in the gravity persistence signal loci in Arabidopsis disrupt the perception and/or signal transduction of gravitropic stimuli. Plant Physiol 130:1426–1435. Xia K, Wang R, Ou X, Fang Z, Tian C, Duan J, et al. (2012) OsTIR1 and OsAFB2 downregulation via OsmiR393 overexpression leads to more tillers, early flowering and less tolerance to salt and drought in rice. PLoS One 7:e30039.

k

69

k

k

70

k

Mechanism of Plant Hormone Signaling under Stress

Yamada M, Greenham K, Prigge MJ, Jensen PJ, Estelle M (2009) The TRANSPORT INHIBITOR RESPONSE2 gene is required for auxin synthesis and diverse aspects of plant development. Plant Physiol 151:168–179. Yamamoto Y, Kamiya N, Morinaka Y, Matsuoka M, Sazuka T (2007) Auxin biosynthesis by the YUCCA genes in rice. Plant Physiol 143:1362–1371. Yang Y, Hammes UZ, Taylor CG, Schachtman DP, Nielsen E (2006) High-affinity auxin transport by the AUX1 influx carrier protein. Curr Biol 16:1123–1127. Zazímalová E, Murphy AS, Yang H, Hoyerová K, Hosek P (2010) Auxin transporters: why so many? Cold Spring Harb Perspect Biol 2:a001552. Zenser N, Ellsmore A, Leasure C, Callis J (2001) Auxin modulates the degradation rate of Aux/IAA proteins. Proc Natl Acad Sci U S A 98:11795–11800. Zhang R, Wang B, Ouyang J, Li J, Wang Y (2008) Arabidopsis indole synthase, a homolog of tryptophan synthase alpha, is an enzyme involved in the Trp-independent indole-containing metabolite biosynthesis. J Integr Plant Biol 50:1070–1077. Zhang SW, Li CH, Cao J, Zhang YC, Zhang SQ, Xia YF, Sun DY, Sun Y (2009) Altered architecture and enhanced drought tolerance in rice via the down-regulation of indole-3-acetic acid by TLD1/OsGH3.13 activation. Plant Physiol 151:1889–1901. Zhao Y (2012) Auxin biosynthesis: a simple two-step pathway converts tryptophan to indole-3-acetic acid in plants. Mol Plant 5:334–338. Zhou R, Benavente LM, Stepanova AN, Alonso JM (2011) A recombineering-based gene tagging system for Arabidopsis. Plant J 66:712–723. Zörb C, Geilfus CM, Mühling KH, Ludwig-Müller J (2013) The influence of salt stress on ABA and auxin concentrations in two maize cultivars differing in salt resistance. J Plant Physiol 170:220–224.

k

k

k

71

4 Cytokinin Signaling in Plant Response to Abiotic Stresses Nguyen Binh Anh Thu 1 , Xuan Lan Thi Hoang 1 , Mai Thuy Truc 1,2 , Saad Sulieman 3,4 , Nguyen Phuong Thao 1 , and Lam-Son Phan Tran 3 1

School of Biotechnology, International University, Vietnam National University HCMC, Ho Chi Minh City, Vietnam John Carroll University, OH, USA 3 Signaling Pathway Research Unit, RIKEN Center for Sustainable Resource Science, Yokohama, Japan 4 Department of Agronomy, Faculty of Agriculture, University of Khartoum, Khartoum North, Sudan 2

4.1 Introduction

k

Along with auxin, CKs are hormones that were discovered in plants almost 60 years ago (Miller et al., 1956). CKs were first known to be involved in stimulating cell division (the name of cytokinin derives from “cytokinesis”) and differentiation of the shoot meristem (Miller et al., 1955, 1956; Skoog and Miller, 1957; Su et al., 2011). Subsequent studies revealed that CKs participate in regulating other important processes of plant development such as apical dominance, lateral bud growth, root growth inhibition, shoot meristem formation and maintenance, nitrogen (N) signaling, phyllotaxis, leaf expansion, and leaf senescence (Miyawaki et al., 2004; Noodén et al., 1990; Brandstatter and Kieber, 1998; Frébort et al., 2011; Takei et al., 2002; Giulini et al., 2004). More recently, extended functions of CKs in inducing plant immunity against biotic (Choi et al., 2010; Grobkinsky et al., 2011) and abiotic stresses (Ha et al., 2012; O’Brien and Benkova, 2013) have also been reported. Under a general view of chemical structure, CKs are derivatives of the purine adenine with substitution at position N6 . They can be present in the forms of free nitrogenous bases, nucleosides, nucleotides, or glycosides, which appear to have different CK-biological activities (Mok and Mok, 2001, Sakakibara, 2006). Endogenous CK homeostasis in plants is maintained by various enzymes responsible for either biosynthesis of different pools of CK members, inter-conversion between CK types or CK degradation. In intact plants, CKs are found mostly in meristematic regions, young leaves, and immature seeds (Letham, 1994). CKs indirectly regulate expression of specific genes via intermediate message carriers belonging to two-component system (TCS), in which the phosphotransfer between His and Asp residues of the TCS members is employed to transduce the signal. Alteration in expression of target genes enables plants to provide relevant responses to a stimulus (Huang et al., 2012). In addition to the wide use of CKs in plant tissue culture as a “balanced phytohormone” with auxin, engagement of CKs in increasing plant tolerance to abiotic stresses by regulating expression of genes involved in CK metabolism pathway has been Mechanism of Plant Hormone Signaling under Stress, First Edition, Volume 1. Edited by Girdhar Pandey. © 2017 John Wiley & Sons, Inc. Published 2017 by John Wiley & Sons, Inc.

k

k

k

72

Mechanism of Plant Hormone Signaling under Stress

reported in many studies (Nishiyama et al., 2011, O’Brien and Benkova, 2013, Rivero et al., 2007). From literature, a number of genes controlling CK synthesis, transport, catabolism, and perception have been identified with more than 50 and 100 members in Arabidopsis and soybean, respectively (Le et al., 2012b, Mochida et al., 2010, Zalabák et al., 2013). The applications of the CK-related genes in genetic engineering have shown great potentials for increasing crop yield and stress tolerance, leading to sustainable agriculture. In this chapter, we provide an overview of CK biology, including CK structure, CK metabolism and CK signaling. Additionally, the roles of CKs in plant responses to abiotic stresses and how we could translate our knowledge of CK biology to improve plant stress tolerance will also be discussed.

4.2 CK Metabolism 4.2.1 CK Components and Regulatory Functions

k

A specific feature of all the CK forms is that they possess the nitrogenous base of adenine. However, what makes them differ from the purine adenine and among themselves is the replacement of one hydrogen atom connecting with N6 in the adenine by various chemical groups. This modification determines biological activity, long-distance mobilization, and final allocation in the cell or tissue of each CK-type (Mok and Mok, 2001, Hirose et al., 2008, Letham, 1994). Physiological forms of CKs may exist with adenine attaching to (i) isoprenoid side chain, such as iP (isopentenyladenine), zeatin including tZ (trans-zeatin) and cZ (cis-zeatin), DHZ (dihydrozeatin); or (ii) an aromatic group, like pT (para-topolin), oT (ortho-topolin), mT (meta-topolin), and benzyladenine (BA) (Mok and Mok, 2001, Holub et al., 1998) (Figure 4.1/Plate 3). In Arabidopsis, tZ and iP are the most active forms and present in higher concentrations than other CKs (Kiba et al., 2013). How these two principal CK forms differ in functions in this model plant has not been clearly stated. However, the root/shoot grafting experiments suggested that tZ-type is acropetally directed, while iP-type moves basipetally during long-distance transport (Matsumoto-Kitano et al., 2008) and that different CK receptors in the CK signaling pathway have biased binding affinities to different types of CKs in Arabidopsis (Kieber, 2002, Romanov et al., 2006, Stolz et al., 2011, Yonekura-Sakakibara et al., 2004). Recently, Kiba et al. (2013) proved that root-borne tZ had a potential in promoting shoot growth in Arabidopsis. Moreover, the application of exogenous tZ but not iP helped recover the dramatic retardation of shoot growth triggered by cyp735a1cyp735a2 double mutants that displayed tZ-type CK deficiency (Kiba et al., 2013). The other less active isoform of tZ is cZ that might be classically considered insignificant, but recent evidence has emerged to support its biological roles (Gajdošová et al., 2011). This zeatin isomer was found to be not only active but also exist in substantial status in some monocots and dicots (Frébort et al., 2011). More recent research in tobacco revealed that tZ and cZ had differential expression depending on the growth stage, whereby up-regulation of cZ closely associated with limited growth conditions, such as stresses and seed dormancy, or complete growth, such as leaf senescence (Gajdošová et al., 2011). Lupinic acid is another derivative of tZ but no functionality has been reported for this compound. For DHZ, another CK-type with isoprenoid side chain, a study in Phaseolus vulgaris revealed that it could be made

k

k

k

4 Cytokinin Signaling in Response to Abiotic Stresses

73

(A) N

N N

N

N N

N

N

N

N

O

N

N

N

O

N

O

N

N N

O

N N

O

O N

O

tZR – trans-zeatin riboside

IPR – Isopentenyladenine riboside (B)

N

N

O O

N

N

O

O

O

N

N

O S N

N

N

N

N N

N

N

N N

N O

BA – N6-Benzylaminopurine O N

N

DHZ – Dihydrozeatin IPA – Isopentenyladenine

tZ – trans-zeatin N

N

N

N

N

cZ – cis-zeatin

N

N

k

N

N

N

N

N

N

Kinetin

TDZ – Thidiazuron

N

N

N

N

N

N O

oT – ortho-Topolin mT – meta-Topolin

O

N

pT – para-Topolin

Figure 4.1 (Plate 3) Three-dimensional structure of (A) N6 -isoprenoid side chain, and (B) aromatic-type cytokinins. Cyan and white atoms indicate carbon and hydro residues, respectively. (See insert for color representation of this figure.)

from tZ by the action of zeatin reductase (Martin et al., 1989). Previously, DHZ was indicated to have function in storage organs of plants since its presence was found in seeds and apical buds (Frébort et al., 2011, Martin et al., 1989, Mok et al., 1990). It has also been thought to have biological functions in plant development and in response to drought stress in soybean plants (Le et al., 2012b). On the other hand, aromatic CKs are less studied by scientists (Strnad, 1997). These CK-types are found in only a handful of species including Populus (Strnad et al., 1997, Strnad et al., 1994), tomato (Nandi et al., 1989), Arabidopsis (Tarkowská et al., 2003) and pea (Gaudinová et al., 2005). To date, it has been noted that only mT can appear in various forms, not only in free-base form, but also nucleosides, nucleotides, and glucosides, suggesting a similar metabolic mechanism as its isoprenoid-CK counterparts (Sakakibara, 2010). Although scarce than other CK types in overall, it has also been found in abundant amount in several types of tissues in oil palm (Jones et al., 1996). Elevation of BA concentration was seen during exposure period to drought stress in maize while other studies indicated that aromatic CKs could inhibit drought-induced leaf senescence and increase level of proline as an osmo-protectant against osmotic stress condition (Alvarez et al., 2008). In addition to naturally occurring CKs, synthetic CKs known as phenylureas are also available, some of which are highly active (Takahashi et al., 1978, Mok et al., 1982).

k

k

k

74

k

Mechanism of Plant Hormone Signaling under Stress

CKs also exist in inactive forms. De novo synthesis can be employed to manufacture inactive forms of (i) nucleotides with one, two or three groups of phosphate (iPRMP (iP riboside 5’-monophosphate), iPRDP (iP riboside 5’-diphosphate), iPRTP (iP riboside 5’-triphosphate); tZRMP (tZ riboside 5’-monophosphate), tZRDP (tZ riboside 5’-diphosphate), tZRTP (tZ riboside 5’-triphosphate); cZRMP (cZ riboside 5’-monophosphate); DZRMP (DHZ riboside 5’-monophosphate); BARMP (BA riboside 5′ -monophosphate)), (ii) nucleosides (iPR (iP riboside); tZR (tZ riboside); cZR (cZ riboside); DZR (DHZ riboside); BAR (BA riboside)); or topolin-riboside isomers that require subsequent phosphoribohydrolase activity by LOG (Lonely Guy) enzyme to become active free-base CKs (Frébort et al., 2011, Sakakibara, 2010). Such co-existing forms of active and inactive CKs can be interconverted by adenosine kinase that had been already implied in several studies (Kwade et al., 2005, Allen et al., 2002, Lecomte and Le Floc’h, 1999) and was later proven (Schoor et al., 2011). To control the bioactivity of CKs, plant cells regulate N- and O-glucosyltransferases to perform glucosylation on these molecules, generating N- or O-glucosylated CK pools. Glucosylated CKs include N7 - or N9 -glucosylated (at the purine ring) tZ, and O-glucosylated or xylosylated (at oxygen side chain) tZ or DHZ (Kieber, 2002, Frébort et al., 2011). O-glucosylated cZ and its riboside have also been found in maize (Veach et al., 2003). A classical view stated that CK was synthesized in roots and transported shootward, but increasing evidence has pointed out CK synthesis can also be locally carried out by different tissues (Chen et al., 1985, Hirose et al., 2008, Singh et al., 1988). Different types of CKs are abundant in different tissues and in different species, suggesting that each has distinct biological roles. Generally, while tZ-type CKs, such as tZR, are present in the largest amount in xylem sap, a predominant amount of iP and cZ exists in phloem sap (Hirose et al., 2008). In oil palm seeds, iP-type CKs predominate (Huntley et al., 2002), while in soybean seeds, DHZ- and Z-type CKs are more abundant (Singh et al., 1988). These CKs are also found restricted to actively dividing cells such as shoot apical meristem, leaf primordial and provascular tissues (Corbesier et al., 2003). Spatial and temporal studies of CKs within organs proved the more complex distribution and functions of this phytohormone (Rijavec et al., 2011, Bielach et al., 2012, Stirk et al., 2008, Vanková et al., 1999, Singh et al., 1988). What makes things more complicated is that their concentrations are subjected to changes in coordination with intrinsic or extrinsic factors. Intrinsic factors are often specific requirements of critical developmental stages; for example, flowering (Corbesier et al., 2003, Dewitte et al., 1999), fruit setting (Pilkington et al., 2013, Stephen, 2010, Emery et al., 2000), seed formation (Emery et al., 2000, Morris et al., 1993, Powell et al., 2013), and leaf senescence (Wilhelmová et al., 2004, Letham, 1994). Extrinsic factors could be biotic attacks (Schäfer et al., 2014) and abiotic stresses like nutritive stress (Miyawaki et al., 2004, Hirose et al., 2008, Kamada-Nobusada et al., 2013, Schwartzenberg and Hahn, 2005), excessive heavy metal (Hashem, 2013) or drought (Le et al., 2012b). Each species will have distinct CK manifestation to cope with such adverse conditions. For instance, in Arabidopsis, drought stress could lead to a decrease of tZ-type CK contents whereas levels of iP and cZ were maintained constant (Nishiyama et al., 2011). In Arabidopsis subjected to salt stress, decreases in both tZ- and iP-type CKs were observed (Nishiyama et al., 2011). A decrease in endogenous CK levels caused more susceptibility of Arabidopsis plants to light stress in an AHK2 (Arabidopsis histidine kinase2)-, AHK3-, ARR1 (Arabidopsis response regulator1)- and ARR12-dependent manner (Cortleven et al., 2014). In

k

k

k

4 Cytokinin Signaling in Response to Abiotic Stresses

75

soybean, DHZ content displayed a downfall in concentration under water deficiency (Le et al., 2012b). Under drought, BA content increased while tZ and its derivatives decreased in maize (Alvarez et al., 2008). Interestingly, enhanced CK types of Z and ZR resulted from exposure to water stress or a limited water regime could facilitate earlier grain-filling (Yang et al., 2001) and delay post-harvest yellowing (Zaicovski et al., 2008). 4.2.2 CK Metabolism, Perception, and Signal Transduction 4.2.2.1 CK Metabolism

k

The life cycle of CKs generally involves three important stages: synthesis performed by IPT (isopentenyltransferase) enzyme family, activation by LOG enzymes, and degradation by catabolic enzymes such as CKXs (CK dehydrogenases). CKs that are targeted for storage also undergo deactivation and reactivation. The metabolic pathway of CKs has been meticulously detailed elsewhere (Kieber, 2002, Frébort et al., 2011, Sakakibara, 2010). In Arabidopsis, the AtIPT (Arabidopsis IPT) gene family composed of nine members is responsible for synthesizing ATP/ADP- and tRNA-IPTs (Miyawaki et al., 2004). In loss-of-function studies, AtIPT mutants defected in AtIPT1, AtIPT3, AtIPT5, and AtIPT7 displayed phenotypes similar to mutants that lack all 7-gene components (AtIPT1, 3–8). In addition, mutants of other AtIPTs did not show any significant phenotypic changes as long as AtIPT3, AtIPT5, or AtIPT7 has been maintained (Miyawaki et al., 2006). In general, to create iP, IPT uses DMAPP (dimethylallyl pyrophosphate) produced from MEP (methylerythritol phosphate) and MVA (mevalonate) pathway as side chain donor, and AMP (adenosine monophosphate), ATP or ADP as isoprenoid acceptors for isopentenylation (Sakakibara, 2006). AtIPT1, AtIPT3, AtIPT5, and AtIPT7 encode for enzymes that catalyze the biosynthesis pathway for iP- and tZ-type CKs (Miyawaki et al., 2006). iP synthesis starts from its nucleotide and nucleoside precursors. tZ synthesis can occur either in a direct manner using iP (iPRMP-independent), or indirect manner via conversion from the iP immediate precursor (iPRMP-dependent). The existence of an additional iPRMP-independent synthesis of tZ has been proven, wherein the hormone is directly produced from IPT using a hydroxylated terpenoid side chain donor (Sakakibara, 2010). Hydroxylated DMAPP derivatives, HMBDP ((E)-4-hydroxy-3-methyl-but-2-enyl diphosphate) from MEP pathway, is a potential donor (Sakakibara, 2010). Meanwhile, tRNA-IPTs are required for the biosynthesis of cZ-type CKs. The tRNA-IPTs are produced from AtIPT2 and AtIPT9, catalyzing the isopentenylation of tRNA instead of ATP or ADP (Miyawaki et al., 2006). cZ could be originated from degradation of isopentenylated tRNAs, but not from such source alone, because tRNAs have a very long half-life (Klämbt, 1992). Direct transition from trans- to cis-form of zeatin was previously disregarded, and the origin of cZ was believed to be solely from degradation of tRNAs, but an isomerase capable of such conversion has been found in beans (Bassil et al., 1993). Nevertheless, such reaction might not occur without the help of a catalyst, as reported by Gajdošová et al. (2011). In the meantime, DHZ-type CKs are converted from zeatin via activity of zeatin reductase (Gaudinová et al., 2005). Furthermore, β-(9-cytokinin)-alanine synthase (lupinic acid synthase) can transform tZ into lupinic acid; and cZ, iP, DHZ or other N6 derivatives of adenine to lupinic acid derivatives (Sakakibara, 2010). However, the physiological function of alanylation performed by this enzyme is still unknown. To date, the enzyme was exclusively isolated from lupin seeds. As for aromatic CKs,

k

k

k

76

k

Mechanism of Plant Hormone Signaling under Stress

although more understanding has been gained, there still seem to be a lack of in-depth studies. The metabolism of this ring-CK family remains shrouded in mystery. LOG is an essential enzyme for the activation of iPRMP and tZRMP. The enzyme performs phosphoribohydrolase activity, specifically on CK nucleotide 5′ -monophosphates, and is inefficient on di- or tri-phosphate derivatives, nucleosides, or AMP (Frébort et al., 2011, Kurakawa et al., 2007). Activation may occur via LOG-dependent or two-step LOG-independent pathway, but the former was shown to be dominant (Tokunaga et al., 2012). There are seven LOG genes in Arabidopsis and among these, LOG7 exhibited prominent roles. Other LOGs of this family are redundant, as revealed by loss-of-function analyses (Tokunaga et al., 2012). Orthologs and homologs of AtLOGs in other species have been characterized by intensive comparative analyses in wood plants such as Populus trichocarpa and Prunus persica (Immanen et al., 2013). Regarding the two-step pathway, fewer studies have been conducted. Isolation of UHR1 (uridineribohydrolase 1) in Arabidopsis has reaffirmed previous thoughts (Jung et al., 2009). URH1 has pivotal role in pyrimidine degradation, and has affinity for CK ribosides. Another important class of enzyme for CK interconversion includes two P450 cytochrome monooxygenases/trans-hydroxylases CYP735A1 and CYP735A2. These enzymes create tZ from iP-type CKs through iPRMP-dependent pathway, with the highest affinity for mono- and diphosphate ribosides of iP (Takei et al., 2004). Degradation or deactivation of CKs is occured by irreversible dehydrogenation or by conjugation of CKs with a sugar moiety in a glycosyltransfer reaction (Zalabák et al., 2013). In the past, CKX was actually assumed to have exclusive oxidase activity and contain copper but it was later shown to have more dehydrogenase activity in vitro with covalently-bound cofactor FAD (flavin adenine dinucleotide) (Bilyeu et al., 2001, Frébort et al., 2011, Galuszka et al., 2001). Natural catabolism of CKs is required to maintain the homeostasis for normal development. This process is undertaken by a small family of CKXs. CKX members are varied in according to species. For instance, there are seven different CKXs in Arabidopsis (AtCKX1–7) (Bilyeu et al., 2001, Schmülling et al., 2003). N6 side chains of zeatin isoforms (tZ and cZ) and iP are susceptible to CKXs, and aromatic BA is degraded with lower reaction rates as well; whereas DHZ is considered to be resistant to the cleavage activity of these enzymes (Frébort et al., 2011, Galuszka et al., 2007). Plants overexpressing AtCKX revealed substrate specificity (Galuszka et al., 2007). AtCKX2 and AtCKX4 are more active towards iP and its ribosides than other isoforms (Galuszka et al., 2007). Gajdošová et al. (2011) demonstrated that cZ was preferably digested by AtCKX7, efficiently digested by AtCKX1, and almost resistant to deactivation by AtCKX2, 3 and 4. Expression of CKXs has also been observed in response to certain developmental stages of plants. Rapid accumulation of CKXs before kernel maturation, synthesis and degradation of CKs by IPTs and CKXs, respectively, are either autoregulated (Werner et al., 2006) or controlled by a number of factors that will be discussed later. In addition to irreversible degradation by dehydrogenation, deactivation via glucosylation is another measure to maintain CK homeostasis. Glucosylation might be reversible, resulting in O-glucosylated (by O-glucosyltransferases) or O-xylosylated (by O-xylosyltransferases) CKs, or irreversible, resulting in N7 -glucosylated or N9 -glucosylated (by N-glucosyltransferases) CKs. N-conjugated CKs are resistant to hydrolysis by β-glucosidases and thus cannot be converted back to its free-base form. In maize, two genes encoding O-glucosyltransferases that act on cZ are cisZOG1 (cZ

k

k

k

4 Cytokinin Signaling in Response to Abiotic Stresses

77

O-glucosyltransferases1) and cisZOG2 (Veach et al., 2003), and the gene coding for O-xylosyltransferase is cisZOX1 (Martin et al., 1999a, Mok and Mok, 2001). 4.2.2.2 CK Perception and Signal Transduction

k

It is emphasized that for any modifications of CKs to be meaningful, the downstream signaling pathway must be fully functional. The signaling pathway of CKs is a multistep-phosphorelay pathway involving members of (i) HK protein family acting as receptors, (ii) HP protein family playing the role of messengers, and (iii) RR protein family regulating expression of target gene. Signaling cascade starts with the transfer of phosphoryl group from His residue upon CK reception on CHASE (cyclases/histidine kinases associated sensory extracellular) domain of HKs to the Asp residue of the same molecule. The phosphoryl group is then transferred on the His residue of HPs, and lastly on Asp residue of type-A or type-B RR to facilitate transcription of CK-responsive genes (Figure 4.2/Plate 4). In Arabidopsis, only type-A ARRs are rapidly upregulated in response to CK, as reviewed by Gupta and Rashotte (2012). ARR responses to drought might be induced by CK receptor or CK-independent receptor (Kang et al., 2012). The exceptional cases that inhibit the phosphotransfer in this model plant are AHP6 and type-C ARR22 and ARR24 (Hwang et al., 2012). It has been demonstrated that different AHKs (HKs in Arabidopsis) prefer different CK side chains, thus responses to CKs are HK-dependent. The elaborately characterized process and recent findings on working models of TCS have been described in several reviews (Mizuno, 2005, Hwang et al., 2012). In the scope of this chapter, we are more interested in genes related to the downstream signaling protein cascade, which provides a feedback loop on CK concentrations. Root growth has been known to require CKs as signals for cell differentiation. In Arabidopsis, PHB (phabulosa) and PHV (phavoluta), two transcription factors belonging to the HD-ZIP III (homeodomain-leucine zipper III) family, were shown to control root length and root meristem size, as well as CK content via positive regulation of IPT7 (Dello Ioio et al., 2012). A positive feedback loop occurs when CKs induce expression of ARR1 and suppress the processing of PHB inhibitor-micro RNA165/166 (Dello Ioio et al., 2012). When CKs exceed a defined threshold, ARR1 either acts directly on PHB or indirectly on SHY2/IAA3 (short hypocotyl 2/indole-3-acetic acid inducible 3) transcription to repress IPT5 expression, which downregulates CK level (Dello Ioio et al., 2012, Ioio et al., 2008). On the basis of transcriptional analyses, several genes have also been proposed to upregulate CK content. Riefler et al. (2006) reported several-fold increase of tZ, iP and their derivatives following mutations in AHKs, whereby the most dramatic changes were observed in tZ and its modifications. In rice, overexpression of OsRR6 seemed to increase the production of CK O-glucosyltransferase and thus O-glucoside production (Hirose et al., 2007). However, a straightforward mechanism has not yet been elucidated.

4.3 The Components of the CK Signaling Pathway 4.3.1 The CK Receptor Histidine Kinases

CK molecule is perceived by a sensor of HK receptor, which has a complex multidomain structure. They consists of a CHASE domain located at the N-terminus, two or more

k

k

k

78

Mechanism of Plant Hormone Signaling under Stress

CK molecules Plasma membrane Cytosol p H H

p

ER

HKs

N

TM

CHASE

TM

C

D D

H Hp DD

p

p HPs

H

p Nucleus

k

B-RRs

H p D

p

k

D

A-RRs Transcription of CK responsive genes

Figure 4.2 (Plate 4) Schematic model of CK (cytokinin) signal transduction in Arabidopsis plants. The cascade includes HK (histidine kinase) proteins (AHK2, AHK3, and AHK4), HP (histidine phosphotransfer) proteins (AHP1-AHP5), and type-A and type-B RRs (response regulators). The components of HK, which locates on plasma membrane or ER (endoplasmic reticulum) membrane, include a CHASE (cyclases/histidine kinases associated sensory extracellular) domain, two TM (transmembrane) domains, a catalytic domain, and a receiver domain. CK perception by CHASE domain of HKs initiates signal transduction via autophosphorylation of the conserved H (histidine) residue of the HK, which subsequently results in the transfer of the phosphoryl group to the D (aspartate) residue present on the same HK. Through the multistep phosphorelay, the phosphoryl group (P) is then transferred to the D residue of RR proteins to activate the transcription of CK-responsive genes through the mediation of HP proteins that translocate between cytosol and nucleus as shown by the dashed arrow. (See insert for color representation of this figure.)

transmitter domains at the two sides of this sensor domain, and two receiver domains having histidine kinase activity (Anantharaman and Aravind, 2001, Lomin et al., 2012). Hormone binding activity is undertaken by CHASE domain, which results in the conformational change of the sensor that then triggers the autophosphorylation of its transmembrane domain and finally of its receiver domain. The details of structure and function of CK receptors reviewed recently by Lomin et al. (2012) and Steklov et al. (2013). The first study by Kakimoto (1996) implied involvement of CKI1 (cytokinin independent 1) in regulating CK signaling activity. Although the precise function of

k

k

4 Cytokinin Signaling in Response to Abiotic Stresses

k

CKI1 is currently unknown, it has been indicated to be a nonreceptor-type HK since the protein could not bind directly to CK (Yamada et al., 2001). Other investigations revealed that CKI1 may act independent of CK-receptor HKs yet also is able to transduce the signal to HP proteins downstream in the CK signaling pathway (Urao et al., 2000, Deng et al., 2010). In 2000, Mähönen et al. identified a gene encoding CK-receptor HK known as WOL (wooden leg), whose product is a novel two-component hybrid signal transducer and is required for asymmetric cell division of phloem and procambium through study of vascular morphogenesis of the Arabidopsis roots. By using cre1 (cytokinin response 1) mutant, Inoue et al. (2001) revealed the participation of CRE1 in CK signaling since the mutant phenotype displayed a reduction of CK response. This study showed direct evidence about the function of CRE1 as another CK receptor via the expression of CRE1 in a yeast mutant model, which lacked the endogenous HK (namely SLN1), and thus conferring a CK-dependent growth phenotype. Meanwhile, another research group demonstrated that AHK4, a form being identical to WOL or CRE1, is able to bind to a variety of natural and synthetic CKs, such as IPA (isopentenyladenosine), tZ, BAP and TDZ (thidiazuron) (Yamada et al., 2001), as well as could act as a CK sensor in E. coli (Suzuki et al., 2001). Two homologues of AHK4, AHK2 and AHK3, were also predicted as receptor kinases that played a role in CK signal transduction across the membrane in Arabidopsis (Yamada et al., 2001, Ueguchi et al., 2001). Afterwards, these two homologues were actually identified as CK receptors in study of Hwang and Sheen (2001). The Arabidopsis transgenic plants carrying triple mutants (ahk2, ahk3, and ahk4) did not show CK responses such as inhibition of root elongation and formation, cell proliferation of calli, and induction of primary CK-responsive genes while they displayed limited and infertile growth (Higuchi et al., 2004, Nishimura et al., 2004, Riefler et al., 2006). Higuchi et al. (2004) also analyzed the distinct expression patterns of these three receptors by using expression detection of the GUS reporter gene directed by regulatory sequences for AHK2, AHK3, and AHK4. Particularly, differential expression patterns were noticed that the AHK2 was highly expressed in leaf veins, petioles, inflorescence stems, siliques, and to a lesser extent in roots, whereas the AHK3 was expressed in prominent amounts in root and shoot tissues such as leaves, inflorescence stems, and flowers. On the other hand, the expression of AHK4 was highly expressed in roots, moderate in the inflorescence stems, pedicel and low in the leaves. It was assumed that both AHK2 and AHK3 play an important role in shoot growth and development; in contrast, the AHK4 receptor was implicated for normal growth and development of the root. In addition, these receptors showed differential binding affinity to different CK forms due to their specific functional properties in the signaling pathway (Romanov et al., 2006). Recent research using florescent protein fusion method in order to identify the ER- (endoplasmic reticulum) membrane localization of CK receptors has found that the majority of CK receptors are present on the ER membrane, suggesting a considerable role of this compartment in the CK signal transduction (Caesar et al., 2011, Wulfetange et al., 2011). An overview of current understanding of CK receptors was reviewed recently by Heyl et al. (2012). 4.3.2 Histidine Phosphotransfer Proteins

Histidine phosphotransfer proteins (HPs) or phosphotransmitters are small proteins with 17 kDa in weight (Shi and Rashotte, 2012). As a downstream component of HK

k

79

k

k

80

Mechanism of Plant Hormone Signaling under Stress

receptors, HP proteins participate in the transduction of the CK signal cascade. They have an intermediate role to shuttle the phosphate group from the HK receptor to RR proteins. Suzuki et al. (1998) identified five Arabidopsis HPs (AHP1-AHP5) that have shown phosphorelay activity in vitro (Tanaka et al., 2004, Suzuki et al., 2002, Imamura et al., 2001). These studies also demonstrated that AHP proteins are located mainly in the cytoplasmic space. The sixth HP protein, AHP6 counteracts as an inhibitor of CK signaling and allows protoxylem formation (Mähönen et al., 2006). In the protoplast CK response study, Hwang and Sheen (2001) reported that AHP1 and AHP2 showed the translocation into the nucleus after CK treatment but not in case of AHP5. More recent work by Punwani et al. (2010) has suggested that the translocation of AHPs is independent to CK signaling. Despite of non-response to CK treatment, the translocation of the AHP proteins between nucleus and cytosol was maintained by an active nuclear import and export mechanism. The quintuple AHP mutant created by Hutchison et al. (2006) displayed a reduced-CK phenotype, which was not as severe as the triple HK-receptor mutant. However, a quintuple AHP mutant containing an ahp2-2 null mutant allele showed severe effects in mega-gametogenesis and led to seedling lethality (Deng et al., 2010).

4.3.3 Response Regulators

k

In Arabidopsis, according to the phylogenic analysis of all receiver domain containing proteins, there are 23 functional RRs that could be classified into four different groups: type-A, type-B, type-C, and pseudo RRs (Sakai et al., 1998, 2000, 2001, Mizuno and Nakamichi, 2005). However, based on protein sequence and domain structure, type-A and type-B ARRs are considered the only two main groups involving in the CK signaling pathway, which differ in their structural features, receiving the phosphoryl group from the AHKs mediated by the AHPs (El-Showk et al., 2013). The goal of phosphorylation of the type-A ARRs is to stabilize them, whereas phosphorylation of the type B ARRs enables them to bind to DNA and to regulate the expression of the primary CK-responsive genes, including the type-A ARRs (To et al., 2007). D’Agostino et al. (2000) showed that CK upregulated the expression of the type-A ARRs. Type-A ARRs have only a receiver domain and in turn, in general, they act as negative feedback regulators of the primary signaling pathway (To et al., 2004). However, ARR4 has been shown positive interaction with phytochrome B (Sweere et al., 2001). Type-B ARRs have both a receiver domain and an output domain, which carry a glutamine-rich domain and the most important DNA-binding GARP domain (GOLDEN2 in maize, the ARRs, and the Psr1 protein from Chlamydomonas) being able to initiate the transcription of CK-regulated genes (Sakai et al., 1998, 2000, 2001, Lomin et al., 2012). The structure of the type-B RRs determines their ability to function as transcription factors, which are playing a positive role in the CK signaling cascade. In contrast to type-A ARRs, the expression of type-B ARRs is not regulated by CKs. Another interesting piece of information is that, some of the type-B target genes are under regulation of the type-A ARRs. It means that CK signaling is “auto-regulated” in the negative feedback loop manner (Heyl and Schmülling, 2003, Gupta and Rashotte, 2012).

k

k

k

4 Cytokinin Signaling in Response to Abiotic Stresses

81

4.4 CK Signaling in Plant Responses to the Abiotic Stresses

k

Crop yield and development are strongly affected by various biotic and abiotic environmental factors. During the last decade, modern agriculture received great benefits from genetic engineering. The introduction of stress-suppressing proteins has improved considerably crop resistance to many pathogens and environmental stresses. In plants, CKs are found to be involved in plant responses to various stresses but the molecular mechanism is still not clearly elucidated (Zalabák et al., 2013). Since CKs are recognized by CK receptors from both plants and microorganisms, they can activate plant defense responses and increase pathogens symptoms at the same time (Choi et al., 2010, Pertry et al., 2009, Laffont et al., 2015). This contradictory effect is complicated (Igari et al., 2008), because CKs take part in different processes through their common downstream components (Choi et al., 2010, Ishida et al., 2008, Kim et al., 2006). In general, the participation of CKs in plant abiotic stress tolerance is mainly due to their role in cell division promotion, maintenance of meristematic cell identity, and their high cellular redox potentials during drought and regulation of nutrient disposition (Gupta and Rashotte, 2012, Rivero et al., 2007, Werner et al., 2010). CK involvement in plant environmental stress responses is believed to be related to their role in the maintenance of overall hormonal balance and their interaction with other hormones, such as ABA (abscisic acid), ethylene, salicylic acid, and jasmonic acid, which are found to be directly involved in various environmental stresses (Hare et al., 1997). In cold stress, the regulation and crosstalk of different phytohormones have been summarized by Patel and Franklin (2009). During drought and salt stress conditions, CKs have been found to play a negative role in plant responses to these stressors (Tran et al., 2007). Plants exposed to drought display different regulations of different CK forms due to a decrease of isoprenoid CK (Bano et al., 1994, Shashidhar et al., 1996) and an increase of BA levels in xylem sap (Alvarez et al., 2008). The expression of CK-receptor-encoding genes was found to be strongly affected in plants by osmotic and salt stresses (De La Peña et al., 2008, Argueso et al., 2009). In Arabidopsis, the expression of CK-receptor-encoding genes, AHK2, AHK3, and CRE1/AHK4 is induced by dehydration stress. In addition, AHK2 transcripts were found to be influenced by salt and ABA treatment. The induction of AHK3 was also recorded under high salinity and cold stress conditions (Tran et al., 2007). The application of gain- and loss-of-function studies revealed that AHK2, AHK3, and AHK4 were involved in negative regulation of ABA and stress signals (Tran et al., 2007, 2010). Osmotic stress affected strongly not only the expression of CK receptor-encoding genes but also the accumulation of downstream components, such as genes encoding HPs and RRs in TCS. The expression of ARR genes (ARR5, ARR7, ARR15, and ARR22) in Arabidopsis was significantly induced under dehydration stress, particularly that of ARR7 was upregulated by redundant control of AHK2 and AHK3 receptors (Kang et al., 2012). The negative regulation roles of AHK2 and AHK3 were also confirmed in this study by a drought tolerance assay of wild-type, single, and double mutant plants. In addition, AHK2, AHK3, and AHK4, as well as several cold-inducible type-A ARRs, such as ARR7, were reported to play negative regulatory roles in plant adaptation to cold stress (Jeon et al., 2010). EIN3, involved in ethylene signaling, was demonstrated as a negative regulator in regulation

k

k

k

82

k

Mechanism of Plant Hormone Signaling under Stress

of the expression of CBFs (C-repeat binding factors) and type-A ARRs (ARR5, ARR7, and ARR15) and shown to bind to specific elements in their promoters. Overexpression of these three ARR genes resulted in enhanced freezing tolerance of Arabidopsis plants (Shi et al., 2012). Together with other reports, these findings suggested that there are crosstalks among ABA, ethylene, CK and stress signaling pathways (Nishiyama et al., 2011, Ha et al., 2012). Under salt stress, sodium accumulation in Arabidopsis shoots was regulated by the type-B ARR1 and ARR12, at least via mediating the expression of AtHKT1;1 (Arabidopsis high-affinity K+ transporter 1;1) in roots (Mason et al., 2010). This study also suggested negative role of ARR1 and ARR12 in salt tolerance in Arabidopsis. Interestingly, ARR1, and several AHPs (AHP2, AHP3, and AHP5) as well, were shown to positively regulate plant responses to cold stress (Jeon and Kim, 2013). On the other hand, in another independent study, AHP2, AHP3, and AHP5 were reported to redundantly function as negative regulators of drought responses in Arabidopsis (Nishiyama et al., 2013). ARR22, a type-C ARR acting as an inhibitor of CK signaling (Horák et al., 2008), was induced by cold and dehydration (Kang et al., 2013). Overexpression of ARR22 increased tolerance of Arabidopsis plants to dehydration, drought and cold stresses (Kang et al., 2013). Using qRT-PCR (quantitative real-time PCR) analyses, the abiotic stress-responsive expression patterns of many genes of the CK signaling pathway were found to be different, depending on plant species, varieties, types of tissues, and treatment duration of stress (Le et al., 2011, 2012a, Thu et al., 2014, Zhang et al., 2011, Nishiyama et al., 2012). Several CRFs (CK-responsive factors) belonging to the AP2 (Apetala2)-encoding transcription factor family, which showed overlapping function with type-B ARRs targets in mediating the CK response (Rashotte et al., 2006), were also found to be downregulated in response to salt stress (Argueso et al., 2009).

4.5 Genetic Engineering of CK Content for Improvement of Plant Tolerance to Abiotic Stresses Abiotic stresses like extreme temperatures, unfavorable water levels, and hostile metal concentrations all pose challenges to plant survival and productivity. CK-mediated stress responses in plants depend largely on the concentrations of CKs (O’Brien and Benkova, 2013). Constitutive reduction and overproduction of CKs both result in changes that acclimatize plants to stresses. Thus, wise manipulation has been taken to adjust its concentrations to induce preferable changes (Werner et al., 2010, Nishiyama et al., 2011, Rivero et al., 2007, Ha et al., 2012). So far, most intensive research on CK-mediated stress responses has been performed in the model plant Arabidopsis (Ha et al., 2012). Modulating CK levels by altering expression of IPT or CKX genes is considered the most popular choice. Overexpressing CKX genes or disrupting IPT genes, will lead to a decrease in CK content. Inhibited shoot growth, reduced apical dominance, and bushy root growth are typical symptoms observed in plants with CK deficiency. Using gainand loss-of-function approaches, Nishiyama et al. (2011) revealed that the Arabidopsis ipt1 3 5 7 quadruple mutant and CKX-overexpressing plants (35S:CKX1–35S:CKX4) possessed increased salt and drought tolerance in comparison with the wild-type plants. Analyses from root growth assay and the measurement of intracellular electrolyte leakage indicated that CK-deficient plants were more tolerant to salt stress due

k

k

k

4 Cytokinin Signaling in Response to Abiotic Stresses

k

to the enhanced growth of primary roots and more tolerant to drought probably due to the increased cell membrane integrity (Nishiyama et al., 2011). In addition, the decrease of CK level observed in AtCKX-overexpressing Arabidopsis transgenic plants critically altered the growth and development of many tissues, such as roots and shoots, as well as affected the reproduction, flowering, and vascular development (Werner et al., 2003). Root-specific expression of CKX using W6:CKX1 construct (expression of CKX1 driven by a WRKY6 promoter) in tobacco and P10:CKX3 construct (expression of CKX3 driven by a PYK10 promoter) in Arabidopsis plants showed enlargement of root system in the transgenic lines, which was similar to the root feature of plants grafted between 35S:CKX1 or 35S:CKX3 rootstocks and wild-type scions under growing conditions with restricted water supply (Werner et al., 2010). Moreover, a higher accumulation of minerals, including phosphate, calcium, molybdenum and magnesium, was observed in the transgenic plants compared with the wild-type (Werner et al., 2010). Based on these findings, the authors provided supporting evidence of root growth enhancement that might help plants cope with not only water deficit but also limited soil nutrients. With regard to the role of CKs in regulating biological activities like cell division, organogenesis, meristematic activities, and gametophyte development, constitutive overproduction of CKs may cause severe anomalies (Kieber, 2002). Therefore, organ-specific and stress-inducible production of CK is considered more preferable. For example, gain-of-function experiments demonstrated that using stress-inducible instead of constitutive promoters could help prevent the growth abnormalities, including dwarf and limited root growth phenotypes, which were associated with the overexpression of endogenous CK contents, due to the improved control of CK synthesis (Xing et al., 2009, Peleg and Blumwald, 2011). Promoters like PSAG12 (senescence-associated genes12), PSARK (senescence-associated receptor-like kinase), rd29A (response to dehydration 29A), or HSP (heat shock protein) have been efficiently exploited to drive conditional expression of Agrobacterium tumefaciens IPT gene to increase tolerance to different stresses, including drought and flooding in Arabidopsis (Zhang et al., 2000), creeping bentgrass (Agrostis stolonifera) (Merewitz et al., 2010, 2011a, 2011b, 2011c), petunia (Petunia × hybrida) (Clark et al., 2004), cassava (Manihot esculenta) (Zhang et al., 2010a), rice (Oryza sativa) (Peleg et al., 2011), cotton (Gossypium hirsutum) (Kuppu et al., 2013), peanut (Arachis hypogaea) (Qin et al., 2011), and tobacco (Nicotiana tabaccum) (Rivero et al., 2007, 2010). According to their findings, the transgenic plants displayed various adaptive responses to the stressors, such as increase in CK contents, improvement of photosynthesis capacity, better maintenance of intracellular water content and transpiration rate, as well as postponed leaf senescence, which are promising for economic purposes. Unfortunately, although activating the expression of PSAG12:IPT at the onset of senescence could lead to delayed leaf senescence, unexpected changes in N mobilization, source-sink relations, plant reproduction and yield in response to water stress were observed (Jordi et al., 2000). An alternative promoter, PSARK, therefore, has been widely used to overcome such problem as this promoter can switch on the expression of IPT before the onset of senescence (Rivero et al., 2007, Reguera et al., 2013). In a similar manner, using the Arabidopsis stress-induced rd29A to overexpress the IPT gene from A. tumefaciens in tobacco conferred salt stress tolerance to transgenic plants (Qiu et al., 2012). The Ghcysp (G. hirsutum cystein proteinase) promoter, from the same cysteine endopeptidase gene family as SAG12, was used to overexpress A. tumefaciens IPT gene to improve salt

k

83

k

k

84

k

Mechanism of Plant Hormone Signaling under Stress

tolerance in transgenic cotton (Liu et al., 2012). PSAG39:IPT expression in rice led to early flowering and advanced heading date (Liu et al., 2010), which was suggested to help plants against mild water deficit and improve grain yield during drought (Zou et al., 2007). Furthermore, under water-logging and submerging conditions, increasing IPT expression aided the plant survival capacity during stress exposure as well as recovery stage (Huynh et al., 2005). As for heavy metal stress, surmounting zinc concentration adversely affects plant metabolic activities (Gill, 2014). PSAG12:IPT transgenic tobacco showed better defense against excessive zinc contamination by lowering the declines in net photosynthetic and transpiration rates, as well as maintaining the production of the free amino acids compared with the wild-type, which is indicative of pertaining N metabolism (Pavlíková et al., 2014). Additionally, nutrition deficiency, especially deficiency in essential nutrients like N, can trigger tremendous self-destructive processes within plant cells. PSARK:IPT construct introduced into tobacco could help inhibit ROS (reactive oxygen species) production and deter harmful effects on plants caused by decrease in N concentration (Rubio-Wilhelmi et al., 2011). Another study using PSAG12:IPT construct to generate transgenic bentgrass could also enhance the survival of transgenic plants against N or P (phosphate) deficiency (Zhang et al., 2010b). Overexpression of IPT to increase endogenous CK level as a counter measure against hostile temperature has also been practiced in several species, like generating cold-resistant tall fescue (Festuca arundinacea) and low temperature-tolerant sugarcane (Saccharum spp.) with overexpression of A. tumefaciens IPT using the maize ubiquitin promoter (Hu et al., 2005) and Arabidopsis COR15a (cold-regulated gene15a) promoter (Belintani et al., 2012), respectively. Towards heat stress, an attempt has been conducted on creeping bentgrass using PSAG12 and HSP promoters to overexpress IPT gene from A. tumefaciens (Xu et al., 2009, Xing et al., 2009). Concomitantly, Xing et al. (2009) have also demonstrated that during dark and heat treatment, SAG12-ipt- and HSP18-ipt-bearing transgenic creeping bentgrass had prolonged leaf life-span compared with the wild-type. Another promoter in SAG family of A. thaliana, SAG13, can drive IPT expression in all mature leaves prior to senescence, which is somewhat similar to the expression pattern of PSARK, but it caused more severely altered source-sink relationship (Swartzberg et al., 2006). A modified method of using root-specific CK overproduction under the control of constitutive promoter could also assist tomato plants to elevate plant growth and yield under salt stress (Ghanem et al., 2011). Noticeably, root-to-shoot CK transport was increased in salt-treated tomato plants, whose phenotype presented the improved vegetative growth and ion homeostasis, delayed leaf senescence (in plants with root-specific HSP70:IPT expression), and increased fruit yield (in 35S:IPT-bearing-rootstocks grafted with wild-type shoot) (Ghanem et al., 2011). Therefore, this study suggested a novel effective strategy to attenuate the salt-induced limitations on crop productivity. Another strategy used in genetic engineering is to transiently increase the CK content through the critical distance between the gene and its promoter. By using constitutive 35S promoter, A. tumefaciens IPT gene was fused to the downstream of other genes such as AOC (Bruguiera sexangula allene oxide cyclase) or AtGolS2 (Arabidopsis galactinol synthase), which functioned in salt and cold stress tolerance, respectively (Guo et al., 2010). As a result, Arabidopsis transgenic plants with pVKH35S-AtGolS2-ipt and pVKH35S-AOC-ipt could obtain the slight increase of CK level, and thus showing enhanced plant growth, prolonged flowering, and increased chlorophyll synthesis

k

k

k

Source of isolation

Host plant

k

Arabidopsis Arabidopsis Arabidopsis

Arabidopsis

Arabidopsis

Arabidopsis

Arabidopsis

Arabidopsis

ARR5

ARR6

ARR7

ARR22

Arabidopsis

Arabidopsis Nicotiana tabacum Arabidopsis

Arabidopsis

Arabidopsis

Arabidopsis

Arabidopsis

CKX1, CKX2, CKX3, CKX4

CKX3

CKX1

IPT1 3 5 7

CK degradation

Arabidopsis Arabidopsis

Arabidopsis

Arabidopsis

Arabidopsis

Arabidopsis

AHK4*

AHP2 3 5

Arabidopsis

Arabidopsis

AHK3

ARR1 12

Arabidopsis

Arabidopsis

AHK2

The components in CK signaling pathway

Gene

(Kang et al., 2013)

(Nishiyama et al., 2011)

(Werner et al., 2010) (Werner et al., 2010) (Nishiyama et al., 2011)

↑Drought, ↑cold tolerance

↑Drought, ↑salt tolerance

↑Primary root growth ↑Primary root growth, ↑Drought tolerance ↑Drought, ↑salt

Knockout mutant

Root-specific overexpression

Root-specific overexpression

Constitutive overexpression

Constitutive overexpression

(Continued)

(Jeon et al., 2010) (Jeon et al., 2010)

↑Cold tolerance ↑Cold tolerance

(Nishiyama et al., 2013)

↑Drought tolerance

Knockout; Constitutive overexpression upon CK preincubation

Knockout

Knockout Knockout

(Tran et al., 2007); (Jeon et al., 2010)

↑Cold, ↑salt tolerance

(Mason et al., 2010)

(Tran et al., 2007); (Jeon et al., 2010); (Kang et al., 2012)

↑Drought, ↑cold, ↑salt tolerance

(Jeon et al., 2010)

(Tran et al., 2007); (Jeon et al., 2010); (Kang et al., 2012)

↑Drought, ↑cold, ↑salt tolerance

↑Cold tolerance

References

Typical responses

↑Salt tolerance

Knockout

Knockout

Knockout

Knockout

Genetic engineering approach

Table 4.1 Potential genes of CK signaling and CK metabolism for development of abiotic stress-tolerant plants.

k

k

Source of isolation

Arabidopsis Arabidopsis Agrostis stolonifera Agrostis stolonifera Arachis hypogaea Festuca arundinacea Gossypium hirsutum Gossypium hirsutum Manihot esculenta Nicotiana tabacum

Agrobacterium tumefaciens

Agrobacterium tumefaciens

Agrobacterium tumefaciens

Agrobacterium tumefaciens

Agrobacterium tumefaciens

Agrobacterium tumefaciens

Agrobacterium tumefaciens

Agrobacterium tumefaciens

Agrobacterium tumefaciens

Agrobacterium tumefaciens

IPT

IPT

IPT

IPT

IPT

IPT

IPT

IPT

IPT

Host plant

k Senescence-inducible overexpression

Senescence-inducible overexpression

Senescence-inducible overexpression

Senescence-inducible overexpression

Stress-inducible overexpression

Senescence-inducible overexpression

Stress-inducible overexpression

Senescence-inducible overexpression

Senescence-inducible overexpression

Senescence-inducible overexpression

Genetic engineering approach

k

IPT

CK production in autoregulation

Gene

Table 4.1 (Continued)

References

(Zhang et al., 2000) (Huynh et al., 2005) (Xu et al., 2009) (Xing et al., 2009) (Qin et al., 2011) (Hu et al., 2005) (Liu et al., 2012) (Kuppu et al., 2013) (Zhang et al., 2010a) (Rivero et al., 2010); (Rivero et al., 2007)

Typical responses

↑Flooding tolerance, ↓leaf senescence ↑Water-logging tolerance, ↓leaf senescence ↑Heat tolerance, ↓leaf senescence ↑Heat tolerance, ↓leaf senescence ↑Drought tolerance, ↑crop yield ↑Cold tolerance, ↓leaf senescence ↑Salt tolerance, ↓leaf senescence ↑Drought tolerance, ↓leaf senescence ↑Drought tolerance, ↓leaf senescence ↑Drought tolerance, ↓leaf senescence, ↓yield loss

k

k

(Qiu et al., 2012) (Pavlíková et al., 2014) (Clark et al., 2004) (Peleg et al., 2011) (Belintani et al., 2012) (Ghanem et al., 2011)

(Guo et al., 2010) (Marie et al., 2008)

↑Zinc tolerance, ↓leaf senescence ↑Drought tolerance, ↓leaf senescence ↑Drought tolerance, ↓leaf senescence ↑Cold tolerance, ↓leaf senescence ↑Salt tolerance, ↑fruit yield, ↓leaf senescence

↑Plant growth, ↑cholorophyll ↑Recovery rate under drought stress

Stress-inducible overexpression Root-specific-stress-inducible overexpression; Root-specific constitutive overexpression

Senescence-inducible overexpression

Petunia xhybrida Oryza sativa Saccharum spp. Solanum lycopersicum

Agrobacterium tumefaciens

Agrobacterium tumefaciens

Agrobacterium tumefaciens

Agrobacterium tumefaciens

IPT

IPT

IPT

IPT

k Nicotiana tabacum

Phaseolus lunatus

ZOG1

Senescence-inducible overexpression

*in the presence of cytokinin Abbreviations: AHK (Arabidopsis histidine kinase); ARR (Arabidopsis response regulator); CKX (CK dehydrogenase); IPT (isopentenyltransferase); ZOG1 (Zeatin O-glucosyltransferase1).

Arabidopsis

Agrobacterium tumefaciens

IPT

Moderate expression

Senescence-inducible overexpression

Nicotiana tabacum

Agrobacterium tumefaciens

IPT

CK production with moderate content

Senescence-inducible overexpression

Nicotiana tabacum

Agrobacterium tumefaciens

Stress-inducible overexpression

↑Salt tolerance, ↓leaf senescence

k

IPT

k

k

k

88

Mechanism of Plant Hormone Signaling under Stress

(Guo et al., 2010). Another approach to transiently increase the CK activities is via gentle modification of O-glycosyltransferase expression. Following the successful isolation of ZOG1 gene from Phaseolus lunatus, which codes for ZOG (Martin et al., 1999b), transgenic tobacco plants harboring 35S:ZOG1 and SAG12:ZOG1 were constructed (Marie et al., 2008). As a result, stress-induced increase in CK level helped SAG12:ZOG1-transformed plants initiate growth relatively faster in comparison with the wild-type plants at post-drought recovery stage. Meanwhile, transgenic plants carrying construct 35S:ZOG1 displayed a slower recovery rate, implicating that elevated CK content before stress initiation may have a negative effect under prolonged and severe drought period (Marie et al., 2008). A number of CK-related genes that have been and could be used for development of improved stress-tolerant crops by genetic engineering are summarized in Table 4.1.

4.6 Conclusions

k

From the literature, we can appreciate the vital and multiple roles of CKs in plant growth and development, especially when plants are exposed to abiotic stress conditions. Thanks to the hard efforts of research community, a relatively clear picture about diversity in CK structure, homeostasis, signaling, and CK-based regulation has been drawn. However, more investigations are still needed to answer the remained questions. Future efforts should prioritize an understanding of detailed mechanisms by which CK signaling can trigger multiple, diverse biological outputs, and interact with other hormones to control plant responses to environmental stimuli. We could also see the promising aspect of CK biology in applied research. Control the expression of a specific gene belonging to CK metabolism has shown promising results in increasing tolerance of various plant species to various abiotic stresses. Genetic engineering of candidate genes of CK signaling pathway may also be explored for development of improved stress-tolerant crop plants.

Acknowledgments This study was funded by Vietnam National University, HCM city under grant numbers C2014–28–07 and B2017-28-02 to Nguyen Phuong Thao.

References Allen, M., Qin, W., Moreau, F. and Moffatt, B. 2002. Adenine phosphoribosyltransferase isoforms of Arabidopsis and their potential contributions to adenine and cytokinin metabolism. Physiol. Plantarum, 115, 56–68. Alvarez, S., Marsh, E. L., Schroeder, S. G. and Schachtman, D. P. 2008. Metabolomic and proteomic changes in the xylem sap of maize under drought. Plant Cell Environ., 31, 325–340. Anantharaman, V. and Aravind, L. 2001. The CHASE domain: a predicted ligand-binding module in plant cytokinin receptors and other eukaryotic and bacterial receptors. Trends Biochem. Sci., 26, 579–582.

k

k

k

4 Cytokinin Signaling in Response to Abiotic Stresses

k

Argueso, C. T., Ferreira, F. J. and Kieber, J. J. 2009. Environmental perception avenues: the interaction of cytokinin and environmental response pathways. Plant Cell Environ., 32, 1147–1160. Bano, A., Hansen, H., Dörffling, K. and Hahn, H. 1994. Changes in the contents of free and conjugated abscisic acid, phaseic acid and cytokinins in xylem sap of drought stressed sunflower plants. Phytochemistry, 37, 345–347. Bassil, N. V., Mok, D. W. and Mok, M. C. 1993. Partial purification of a cis-trans-isomerase of zeatin from immature seed of Phaseolus vulgaris L. Plant Physiol., 102, 867–872. Belintani, N., Guerzoni, J., Moreira, R. and Vieira, L. 2012. Improving low-temperature tolerance in sugarcane by expressing the ipt gene under a cold inducible promoter. Biol. Plantarum, 56, 71–77. Bielach, A., Podlešáková, K., Marhavý, P., Duclercq, J., Cuesta, C., Müller, B., Grunewald, W., Tarkowski, P. and Benková, E. 2012. Spatiotemporal regulation of lateral root organogenesis in Arabidopsis by cytokinin. Plant Cell, 24, 3967–3981. Bilyeu, K. D., Cole, J. L., Laskey, J. G., Riekhof, W. R., Esparza, T. J., Kramer, M. D. and Morris, R. O. 2001. Molecular and biochemical characterization of a cytokinin oxidase from maize. Plant Physiol., 125, 378–386. Brandstatter, I. and Kieber, J. J. 1998. Two genes with similarity to bacterial response regulators are rapidly and specifically induced by cytokinin in Arabidopsis. Plant Cell., 10, 1009–1019. Caesar, K., Thamm, A. M., Witthöft, J., Elgass, K., Huppenberger, P., Grefen, C., Horak, J. and Harter, K. 2011. Evidence for the localization of the Arabidopsis cytokinin receptors AHK3 and AHK4 in the endoplasmic reticulum. J. Exp. Bot., 62, 5571–5580. Chen, C.-M., Ertl, J. R., Leisner, S. M. and Chang, C.-C. 1985. Localization of cytokinin biosynthetic sites in pea plants and carrot roots. Plant Physiol., 78, 510–513. Choi, J., Huh, S. U., Kojima, M., Sakakibara, H., Paek, K.-H. and Hwang, I. 2010. The cytokinin-activated transcription factor ARR2 promotes plant immunity via TGA3/NPR1-dependent salicylic acid signaling in Arabidopsis. Dev. Cell, 19, 284–295. Clark, D. G., Dervinis, C., Barrett, J. E., Klee, H. and Jones, M. 2004. Drought-induced leaf senescence and horticultural performance of transgenic PSAG12-ipt petunias. J. Am. Soc. Horti. Sci., 129, 93–99. Corbesier, L., Prinsen, E., Jacqmard, A., Lejeune, P., Van Onckelen, H., Périlleux, C. and Bernier, G. 2003. Cytokinin levels in leaves, leaf exudate and shoot apical meristem of Arabidopsis thaliana during floral transition. J. Exp. Bot., 54, 2511–2517. Cortleven, A., Nitschke, S., Klaumünzer, M., Abdelgawad, H., Asard, H., Grimm, B., et al. 2014. A novel protective function for cytokinin in the light stress response is mediated by the ARABIDOPSIS HISTIDINE KINASE2 and ARABIDOPSIS HISTIDINE KINASE3 receptors. Plant Physiol., 164, 1470–1483. D’agostino, I. B., Deruère, J. and Kieber, J. J. 2000. Characterization of the response of the Arabidopsis response regulator gene family to cytokinin. Plant Physiol., 124, 1706–1717. De La Peña, T. C., Cárcamo, C. B., Almonacid, L., Zaballos, A., Lucas, M. M., Balomenos, D. and Pueyo, J. J. 2008. A salt stress-responsive cytokinin receptor homologue isolated from Medicago sativa nodules. Planta, 227, 769–779. Dello Ioio, R., Galinha, C., Fletcher, A. G., Grigg, S. P., Molnar, A., Willemsen, V., et al. 2012. A PHABULOSA/Cytokinin feedback loop controls root growth in Arabidopsis. Curr. Biol., 22, 1699–1704. Deng, Y., Dong, H., Mu, J., Ren, B., Zheng, B., Ji, Z., Yang, W.-C., Liang, Y. and Zuo, J. 2010. Arabidopsis histidine kinase CKI1 acts upstream of histidine phosphotransfer proteins

k

89

k

k

90

k

Mechanism of Plant Hormone Signaling under Stress

to regulate female gametophyte development and vegetative growth. Plant Cell, 22, 1232–1248. Dewitte, W., Chiappetta, A., Azmi, A., Witters, E., Strnad, M., Rembur, J., et al. 1999. Dynamics of cytokinins in apical shoot meristems of a day-neutral tobacco during floral transition and flower formation. Plant Physiol., 119, 111–122. El-Showk, S., Ruonala, R. and Helariutta, Y. 2013. Crossing paths: cytokinin signalling and crosstalk. Development, 140, 1373–1383. Emery, R. N., Ma, Q. and Atkins, C. A. 2000. The forms and sources of cytokinins in developing white lupine seeds and fruits. Plant Physiol., 123, 1593–1604. Frébort, I., Kowalska, M., Hluska, T., Frébortová, J. and Galuszka, P. 2011. Evolution of cytokinin biosynthesis and degradation. J. Exp. Bot., 62, 2431–2452. Gajdošová, S., Spíchal, L., Kamínek, M., Hoyerová, K., Novák, O., Dobrev, P. I., et al. 2011. Distribution, biological activities, metabolism, and the conceivable function of cis-zeatin-type cytokinins in plants. J. Exp. Bot., 62, 2827–2840. Galuszka, P., Frebort, I., Šebela, M., Sauer, P., Jacobsen, S. and Peˇc, P. 2001. Cytokinin oxidase or dehydrogenase? European J. Biochem., 268, 450–461. Galuszka, P., Popelková, H., Werner, T., Frébortová, J., Pospíšilová, H., Mik, V., et al. 2007. Biochemical characterization of cytokinin oxidases/dehydrogenases from Arabidopsis thaliana expressed in Nicotiana tabacum L. J. Plant Growth Regul., 26, 255–267. Gaudinová, A., Dobrev, P. I., Šolcová, B., Novák, O., Strnad, M., Friedecký, D. and Motyka, V. 2005. The involvement of cytokinin oxidase/dehydrogenase and zeatin reductase in regulation of cytokinin levels in pea (Pisum sativum L.) leaves. J. Plant Growth Regul., 24, 188–200. Ghanem, M. E., Albacete, A., Smigocki, A. C., Frébort, I., Pospíšilová, H., Martínez-Andújar, C., et al. 2011. Root-synthesized cytokinins improve shoot growth and fruit yield in salinized tomato (Solanum lycopersicum L.) plants. J. Exp. Bot., 62, 125–140. Gill, M. 2014. Heavy metal stress in plants: a review. Inter J., 2, 1043–1055. Giulini, A., Wang, J. and Jackson, D. 2004. Control of phyllotaxy by the cytokinin-inducible response regulator homologue ABPHYL1. Nature, 430, 1031–1034. Grobkinsky, D. K., Naseem, M., Abdelmohsen, U. R., Plickert, N., Engelke, T., Griebel, T., et al. 2011. Cytokinins mediate resistance against Pseudomonas syringae in tobacco through increased antimicrobial phytoalexin synthesis independent of salicylic acid signaling. Plant Physiol., 157, 815–830. Guo, J.-C., Duan, R.-J., Hu, X.-W., Li, K.-M. and Fu, S.-P. 2010. Isopentenyl transferase gene (ipt) downstream transcriptionally fused with gene expression improves the growth of transgenic plants. Transgenic Res., 19, 197–209. Gupta, S. and Rashotte, A. M. 2012. Down-stream components of cytokinin signaling and the role of cytokinin throughout the plant. Plant Cell Rep., 31, 801–812. Ha, S., Vankova, R., Yamaguchi-Shinozaki, K., Shinozaki, K. and Tran, L.-S. P. 2012. Cytokinins: metabolism and function in plant adaptation to environmental stresses. Trends Plant Sci., 17, 172–179. Hare, P., Cress, W. and Van Staden, J. 1997. The involvement of cytokinins in plant responses to environmental stress. Plant Growth Regul., 23, 79–103. Hashem, H. A. 2013. Cadmium toxicity induces lipid peroxidation and alters cytokinin content and antioxidant enzyme activities in soybean. Botany, 92, 1–7.

k

k

k

4 Cytokinin Signaling in Response to Abiotic Stresses

k

Heyl, A., Riefler, M., Romanov, G. A. and Schmülling, T. 2012. Properties, functions and evolution of cytokinin receptors. European J. Cell Biol., 91, 246–256. Heyl, A. and Schmülling, T. 2003. Cytokinin signal perception and transduction. Curr. Opin. Plant Biol., 6, 480–488. Higuchi, M., Pischke, M. S., Mähönen, A. P., Miyawaki, K., Hashimoto, Y., Seki, M., et al. 2004. In planta functions of the Arabidopsis cytokinin receptor family. Proc. Natl. Acad. Sci. USA, 101, 8821–8826. Hirose, N., Makita, N., Kojima, M., Kamada-Nobusada, T. and Sakakibara, H. 2007. Overexpression of a type-A response regulator alters rice morphology and cytokinin metabolism. Plant Cell Physiol., 48, 523–539. Hirose, N., Takei, K., Kuroha, T., Kamada-Nobusada, T., Hayashi, H. and Sakakibara, H. 2008. Regulation of cytokinin biosynthesis, compartmentalization and translocation. J. Exp. Bot., 59, 75–83. Holub, J., Hanuš, J., Hanke, D. E. and Strnad, M. 1998. Biological activity of cytokinins derived from ortho-and meta-hydroxybenzyladenine. Plant Growth Regul., 26, 109–115. Horák, J., Grefen, C., Berendzen, K. W., Hahn, A., Stierhof, Y.-D., Stadelhofer, B., et al. 2008. The Arabidopsis thaliana response regulator ARR22 is a putative AHP phospho-histidine phosphatase expressed in the chalaza of developing seeds. BMC Plant Biol., 8, 77. Hu, Y., Jia, W., Wang, J., Zhang, Y., Yang, L. and Lin, Z. 2005. Transgenic tall fescue containing the Agrobacterium tumefaciens ipt gene shows enhanced cold tolerance. Plant Cell Rep., 23, 705–709. Huang, G.-T., Ma, S.-L., Bai, L.-P., Zhang, L., Ma, H., et al. 2012. Signal transduction during cold, salt, and drought stresses in plants. Mol. Biol. Rep., 39, 969–987. Huntley, R. P., Jones, L. H. and Hanke, D. E. 2002. Cytokinins and gibberellins in sap exudate of the oil palm. Phytochemistry, 60, 117–127. Hutchison, C. E., Li, J., Argueso, C., Gonzalez, M., Lee, E., Lewis, M. W., et al. 2006. The Arabidopsis histidine phosphotransfer proteins are redundant positive regulators of cytokinin signaling. Plant Cell, 18, 3073–3087. Huynh, L. N., Vantoai, T., Streeter, J. and Banowetz, G. 2005. Regulation of flooding tolerance of SAG12: ipt Arabidopsis plants by cytokinin. J. Exp. Bot., 56, 1397–1407. Hwang, I. and Sheen, J. 2001. Two-component circuitry in Arabidopsis cytokinin signal transduction. Nature, 413, 383–389. Hwang, I., Sheen, J. and Müller, B. 2012. Cytokinin signaling networks. Annu. Rev. Plant Biol., 63, 353–380. Igari, K., Endo, S., Hibara, K. I., Aida, M., Sakakibara, H., Kawasaki, T. and Tasaka, M. 2008. Constitutive activation of a CC-NB-LRR protein alters morphogenesis through the cytokinin pathway in Arabidopsis. Plant J., 55, 14–27. Imamura, A., Yoshino, Y. and Mizuno, T. 2001. Cellular localization of the signaling components of Arabidopsis His-to-Asp phosphorelay. Biosci. Biotechnol. Biochem., 65, 2113–2117. Immanen, J., Nieminen, K., Duchens Silva, H., Rodriguez Rojas, F., Meisel, L., Silva, H., et al. 2013. Characterization of cytokinin signaling and homeostasis gene families in two hardwood tree species: Populus trichocarpa and Prunus persica. BMC Genomics, 14, 885. Inoue, T., Higuchi, M., Hashimoto, Y., Seki, M., Kobayashi, M., Kato, T., et al. 2001. Identification of CRE1 as a cytokinin receptor from Arabidopsis. Nature, 409, 1060–1063.

k

91

k

k

92

k

Mechanism of Plant Hormone Signaling under Stress

Ioio, R. D., Nakamura, K., Moubayidin, L., Perilli, S., Taniguchi, M., Morita, M. T., et al. 2008. A genetic framework for the control of cell division and differentiation in the root meristem. Science, 322, 1380–1384. Ishida, K., Yamashino, T., Yokoyama, A. and Mizuno, T. 2008. Three type-B response regulators, ARR1, ARR10 and ARR12, play essential but redundant roles in cytokinin signal transduction throughout the life cycle of Arabidopsis thaliana. Plant Cell Physiol., 49, 47–57. Jeon, J. and Kim, J. 2013. Arabidopsis response regulator1 and Arabidopsis histidine phosphotransfer protein2 (AHP2), AHP3, and AHP5 function in cold signaling. Plant Physiol., 161, 408–424. Jeon, J., Kim, N. Y., Kim, S., Kang, N. Y., Novák, O., Ku, S.-J., et al. 2010. A subset of cytokinin two-component signaling system plays a role in cold temperature stress response in Arabidopsis. J. Biol. Chem., 285, 23371–23386. Jones, L., Martinková, H., Strnad, M. and Hanke, D. 1996. Occurrence of aromatic cytokinins in oil palm (Elaeis guineensis Jacq.). J. Plant Growth Regul., 15, 39–49. Jordi, W., Schapendonk, A., Davelaar, E., Stoopen, G., Pot, C., De Visser, R., et al. 2000. Increased cytokinin levels in transgenic PSAG12–IPT tobacco plants have large direct and indirect effects on leaf senescence, photosynthesis and N partitioning. Plant Cell Environ., 23, 279–289. Jung, B., Flörchinger, M., Kunz, H.-H., Traub, M., Wartenberg, R., Jeblick, W., et al. 2009. Uridine-ribohydrolase is a key regulator in the uridine degradation pathway of Arabidopsis. Plant Cell, 21, 876–891. Kakimoto, T. 1996. CKI1, a histidine kinase homolog implicated in cytokinin signal transduction. Science, 274, 982–985. Kamada-Nobusada, T., Makita, N., Kojima, M. and Sakakibara, H. 2013. Nitrogen-dependent regulation of de novo cytokinin biosynthesis in rice: the role of glutamine metabolism as an additional signal. Plant Cell Physiol., pct127. Kang, N. Y., Cho, C. and Kim, J. 2013. Inducible expression of Arabidopsis response regulator 22 (ARR22), a Type-C ARR, in transgenic Arabidopsis enhances drought and freezing tolerance. PLoS One, 8, e79248. Kang, N. Y., Cho, C., Kim, N. Y. and Kim, J. 2012. Cytokinin receptor-dependent and receptor-independent pathways in the dehydration response of Arabidopsis thaliana. J. Plant Physiol., 169, 1382–1391. Kiba, T., Takei, K., Kojima, M. and Sakakibara, H. 2013. Side-chain modification of cytokinins controls shoot growth in Arabidopsis. Dev. cell, 27, 452–461. Kieber, J. J. 2002. Cytokinins. Arabidopsis Book, 1, e0063. Kim, H. J., Ryu, H., Hong, S. H., Woo, H. R., Lim, P. O., Lee, I. C., et al. 2006. Cytokinin-mediated control of leaf longevity by AHK3 through phosphorylation of ARR2 in Arabidopsis. Proc. Natl. Acad. Sci. USA, 103, 814–819. Klämbt, D. 1992. The biogenesis of cytokinins in higher plants: our present knowledge. In: Kaminek, M., Mok, D. W. S. and Zazimalova, E. (eds.) Physiology and Biochemistry of Cytokinins in Plants. Netherlands: SPB Academic Publishing. Kuppu, S., Mishra, N., Hu, R., Sun, L., Zhu, X., Shen, G., et al. 2013. Water-deficit inducible expression of a cytokinin biosynthetic gene IPT improves drought tolerance in cotton. PLoS One, 8, e64190.

k

k

k

4 Cytokinin Signaling in Response to Abiotic Stresses

k

Kurakawa, T., Ueda, N., Maekawa, M., Kobayashi, K., Kojima, M., Nagato, Y., et al. 2007. Direct control of shoot meristem activity by a cytokinin-activating enzyme. Nature, 445, 652–655. ´ ˛tek, A., Azmi, A., Goossens, A., Inzé, D., Van Onckelen, H. and Roef, L. Kwade, Z., Swiaa 2005. Identification of four adenosine kinase isoforms in tobacco BY-2 cells and their putative role in the cell cycle-regulated cytokinin metabolism. J. Biol. Chem., 280, 17512–17519. Laffont, C., Rey, T., André, O., Novero, M., Kazmierczak, T., Debellé, F., et al. 2015. The CRE1 cytokinin pathway is differentially recruited depending on Medicago truncatula root environments and negatively regulates resistance to a pathogen. PLoS One, 10, e0116819. Le, D. T., Nishiyama, R., Watanabe, Y., Mochida, K., Yamaguchi-Shinozaki, K., Shinozaki, K. and Tran, L.-S. P. 2011. Genome-wide expression profiling of soybean two-component system genes in soybean root and shoot tissues under dehydration stress. DNA Res., 18, 17–29. Le, D. T., Nishiyama, R., Watanabe, Y., Tanaka, M., Seki, M., Yamaguchi-Shinozaki, K., et al. 2012a. Differential gene expression in soybean leaf tissues at late developmental stages under drought stress revealed by genome-wide transcriptome analysis. PLoS One, 7, e49522. Le, D. T., Nishiyama, R., Watanabe, Y., Vankova, R., Tanaka, M., Seki, M., et al. 2012b. Identification and expression analysis of cytokinin metabolic genes in soybean under normal and drought conditions in relation to cytokinin levels. PLoS One, 7, e42411. Lecomte, I. and Le Floc’h, F. 1999. Adenine phosphoribosyltransferase of peach tree leaves: purification and properties. J. Plant Physiol., 154, 289–295. Letham, D. S. 1994. Cytokinins as phytohormones: sites of biosynthesis, translocation, and function of translocated cytokinin. In: Mok, D. and Mok, M. (eds.) Cytokinins: Chemistry, Activity, and Function. Florida, USA: CRC Press, Boca Raton. Liu, L., Zhou, Y., Szczerba, M. W., Li, X. and Lin, Y. 2010. Identification and application of a rice senescence-associated promoter. Plant Physiol., 153, 1239–1249. Liu, Y., Yin, Z., Yu, J., Li, J., Wei, H., Han, X. and Shen, F. 2012. Improved salt tolerance and delayed leaf senescence in transgenic cotton expressing the Agrobacterium IPT gene. Biol. Plantarum, 56, 237–246. Lomin, S., Krivosheev, D., Steklov, M. Y., Osolodkin, D. and Romanov, G. 2012. Receptor properties and features of cytokinin signaling. Acta naturae, 4, 31. Mähönen, A. P., Bishopp, A., Higuchi, M., Nieminen, K. M., Kinoshita, K., Törmäkangas, K., et al. 2006. Cytokinin signaling and its inhibitor AHP6 regulate cell fate during vascular development. Science, 311, 94–98. Mähönen, A. P., Bonke, M., Kauppinen, L., Riikonen, M., Benfey, P. N. and Helariutta, Y. 2000. A novel two-component hybrid molecule regulates vascular morphogenesis of the Arabidopsis root. Genes Dev., 14, 2938–2943. Marie, H., Dobrev, P. I., Motyka, V., Štorchvá, H., Libus, J., Jana, D., et al. 2008. The role of cytokinins in responses to water deficit in tobacco plants over-expressing trans-zeatin O-glucosyltransferase gene under 35S or SAG12 promoters. Plant Cell Environ., 31, 341–353. Martin, R. C., Mok, M. C. and Mok, D. W. 1999a. A gene encoding the cytokinin enzyme zeatin O-xylosyltransferase of Phaseolus vulgaris. Plant Physiol., 120, 553–558.

k

93

k

k

94

k

Mechanism of Plant Hormone Signaling under Stress

Martin, R. C., Mok, M. C. and Mok, D. W. 1999b. Isolation of a cytokinin gene, ZOG1, encoding zeatin O-glucosyltransferase from Phaseolus lunatus. Proc. Natl. Acad. Sci. USA, 96, 284–289. Martin, R. C., Mok, M. C., Shaw, G. and Mok, D. W. 1989. An enzyme mediating the conversion of zeatin to dihydrozeatin in Phaseolus embryos. Plant Physiol., 90, 1630–1635. Mason, M. G., Jha, D., Salt, D. E., Tester, M., Hill, K., Kieber, J. J. and Eric Schaller, G. 2010. Type-B response regulators ARR1 and ARR12 regulate expression of AtHKT1; 1 and accumulation of sodium in Arabidopsis shoots. Plant J., 64, 753–763. Matsumoto-Kitano, M., Kusumoto, T., Tarkowski, P., Kinoshita-Tsujimura, K., Václavíková, K., Miyawaki, K. and Kakimoto, T. 2008. Cytokinins are central regulators of cambial activity. Proc. Natl. Acad. Sci. USA, 105, 20027–20031. Merewitz, E. B., Du, H., Yu, W., Liu, Y., Gianfagna, T. and Huang, B. 2011a. Elevated cytokinin content in ipt transgenic creeping bentgrass promotes drought tolerance through regulating metabolite accumulation. J. Exp. Bot., 63, 1315–1328. Merewitz, E. B., Gianfagna, T. and Huang, B. 2010. Effects of SAG12-ipt and HSP18. 2-ipt expression on cytokinin production, root growth, and leaf senescence in creeping bentgrass exposed to drought stress. J. Am. Soc. Hortic. Sci., 135, 230–239. Merewitz, E. B., Gianfagna, T. and Huang, B. 2011b. Photosynthesis, water use, and root viability under water stress as affected by expression of SAG12-ipt controlling cytokinin synthesis in Agrostis stolonifera. J. Exp. Bot., 62, 383–395. Merewitz, E. B., Gianfagna, T. and Huang, B. 2011c. Protein accumulation in leaves and roots associated with improved drought tolerance in creeping bentgrass expressing an ipt gene for cytokinin synthesis. J. Exp. Bot., 62, 5311–5333. Miller, C. O., Skoog, F., Okumura, F., Von Saltza, M. and Strong, F. 1956. Isolation, structure and synthesis of kinetin, a substance promoting cell division. J. Am. Chem. Soc., 78, 1375–1380. Miller, C. O., Skoog, F., Von Saltza, M. H. and Strong, F. 1955. Kinetin, a cell division factor from deoxyribonucleic acid1. J. Am. Chem. Soc., 77, 1392–1392. Miyawaki, K., Matsumoto-Kitano, M. and Kakimoto, T. 2004. Expression of cytokinin biosynthetic isopentenyltransferase genes in Arabidopsis: tissue specificity and regulation by auxin, cytokinin, and nitrate. Plant J., 37, 128–138. Miyawaki, K., Tarkowski, P., Matsumoto-Kitano, M., Kato, T., Sato, S., Tarkowska, D., et al. 2006. Roles of Arabidopsis ATP/ADP isopentenyltransferases and tRNA isopentenyltransferases in cytokinin biosynthesis. Proc. Natl. Acad. Sci. USA, 103, 16598–16603. Mizuno, T. 2005. Two-component phosphorelay signal transduction systems in plants: from hormone responses to circadian rhythms. Biosci. Biotechnol. Biochem., 69, 2263–2276. Mizuno, T. and Nakamichi, N. 2005. Pseudo-response regulators (PRRs) or true oscillator components (TOCs). Plant Cell Physiol., 46, 677–685. Mochida, K., Yoshida, T., Sakurai, T., Yamaguchi-Shinozaki, K., Shinozaki, K. and Tran, L.-S. P. 2010. Genome-wide analysis of two-component systems and prediction of stress-responsive two-component system members in soybean. DNA Res., 17, 303–324. Mok, D., Mok, M., Shaw, G., Dixon, S. and Martin, R. 1990. Genetic differences in the enzymatic regulation of zeatin metabolism in Phaseolus embryos. Plant Growth Substances. Springer.

k

k

k

4 Cytokinin Signaling in Response to Abiotic Stresses

k

Mok, D. W. and Mok, M. C. 2001. Cytokinin metabolism and action. Annu. Rev. Plant Biol., 52, 89–118. Mok, M., Mok, D., Armstrong, D., Shudo, K., Isogai, Y. and Okamoto, T. 1982. Cytokinin activity of N-phenyl-N′ -1, 2, 3-thiadiazol-5-ylurea (thidiazuron). Phytochemistry, 21, 1509–1511. Morris, R., Blevins, D., Dietrich, J., Durley, R., Gelvin, S., Gray, J., et al. 1993. Cytokinins in plant pathogenic bacteria and developing cereal grains. Funct. Plant Biol., 20, 621–637. Nandi, S., Palni, L., Letham, D. and Wong, O. 1989. Identification of cytokinins in primary crown gall tumours of tomato. Plant Cell Environ., 12, 273–283. Nishimura, C., Ohashi, Y., Sato, S., Kato, T., Tabata, S. and Ueguchi, C. 2004. Histidine kinase homologs that act as cytokinin receptors possess overlapping functions in the regulation of shoot and root growth in Arabidopsis. Plant Cell, 16, 1365–1377. Nishiyama, R., Le, D. T., Watanabe, Y., Matsui, A., Tanaka, M., Seki, M., et al. 2012. Transcriptome analyses of a salt-tolerant cytokinin-deficient mutant reveal differential regulation of salt stress response by cytokinin deficiency. PLoS One, 7, e32124. Nishiyama, R., Watanabe, Y., Fujita, Y., Le, D. T., Kojima, M., Werner, T., et al. 2011. Analysis of cytokinin mutants and regulation of cytokinin metabolic genes reveals important regulatory roles of cytokinins in drought, salt and abscisic acid responses, and abscisic acid biosynthesis. Plant Cell, 23, 2169–2183. Nishiyama, R., Watanabe, Y., Leyva-Gonzalez, M. A., Van Ha, C., Fujita, Y., Tanaka, M., et al. 2013. Arabidopsis AHP2, AHP3, and AHP5 histidine phosphotransfer proteins function as redundant negative regulators of drought stress response. Proc. Natl. Acad. Sci. USA, 110, 4840–4845. Noodén, L. D., Singh, S. and Letham, D. S. 1990. Correlation of xylem sap cytokinin levels with monocarpic senescence in soybean. Plant Physiol., 93, 33–39. O’brien, J. A. and Benkova, E. 2013. Cytokinin cross-talking during biotic and abiotic stress responses. Front. Plant Sci., 4. Patel, D. and Franklin, K. A. 2009. Temperature-regulation of plant architecture. Plant Signal. Behav., 4, 577–579. Pavlíková, D., Pavlík, M., Procházková, D., Zemanová, V., Hniliˇcka, F. and Wilhelmová, N. 2014. Nitrogen metabolism and gas exchange parameters associated with zinc stress in tobacco expressing an ipt gene for cytokinin synthesis. J. Plant Physiol., 171, 559–564. Peleg, Z. and Blumwald, E. 2011. Hormone balance and abiotic stress tolerance in crop plants. Curr. Opin. Plant Biol., 14, 290–295. Peleg, Z., Reguera, M., Tumimbang, E., Walia, H. and Blumwald, E. 2011. Cytokinin-mediated source/sink modifications improve drought tolerance and increase grain yield in rice under water-stress. Plant Biotechnol. J., 9, 747–758. Pertry, I., Václavíková, K., Depuydt, S., Galuszka, P., Spíchal, L., Temmerman, W., et al. 2009. Identification of Rhodococcus fascians cytokinins and their modus operandi to reshape the plant. Proc. Natl. Acad. Sci. USA, 106, 929–934. Pilkington, S. M., Montefiori, M., Galer, A. L., Emery, R. N., Allan, A. C. and Jameson, P. E. 2013. Endogenous cytokinin in developing kiwifruit is implicated in maintaining fruit flesh chlorophyll levels. Annu. Bot., 112, 57–68. Powell, A. F., Paleczny, A. R., Olechowski, H. and Emery, R. 2013. Changes in cytokinin form and concentration in developing kernels correspond with variation in yield among field-grown barley cultivars. Plant Physiol. Biochem., 64, 33–40.

k

95

k

k

96

k

Mechanism of Plant Hormone Signaling under Stress

Punwani, J. A., Hutchison, C. E., Schaller, G. E. and Kieber, J. J. 2010. The subcellular distribution of the Arabidopsis histidine phosphotransfer proteins is independent of cytokinin signaling. Plant J., 62, 473–482. Qin, H., Gu, Q., Zhang, J., Sun, L., Kuppu, S., Zhang, Y., et al. 2011. Regulated expression of an isopentenyl transferase gene (IPT) in peanut significantly improves drought tolerance and increases yield under field conditions. Plant Cell Physiol., 52, 1904–1914. Qiu, W., Liu, M., Qiao, G., Jiang, J., Xie, L. and Zhuo, R. 2012. An isopentyl transferase gene driven by the stress-inducible rd29A promoter improves salinity stress tolerance in transgenic tobacco. Plant Mol. Biol. Rep., 30, 519–528. Rashotte, A. M., Mason, M. G., Hutchison, C. E., Ferreira, F. J., Schaller, G. E. and Kieber, J. J. 2006. A subset of Arabidopsis AP2 transcription factors mediates cytokinin responses in concert with a two-component pathway. Proc. Natl. Acad. Sci., 103, 11081–11085. Reguera, M., Peleg, Z., Abdel-Tawab, Y. M., Tumimbang, E. B., Delatorre, C. A. and Blumwald, E. 2013. Stress-induced cytokinin synthesis increases drought tolerance through the coordinated regulation of carbon and nitrogen assimilation in rice. Plant Physiol., 163, 1609–1622. Riefler, M., Novak, O., Strnad, M. and Schmülling, T. 2006. Arabidopsis cytokinin receptor mutants reveal functions in shoot growth, leaf senescence, seed size, germination, root development, and cytokinin metabolism. Plant Cell, 18, 40–54. Rijavec, T., Jain, M., Dermastia, M. and Chourey, P. S. 2011. Spatial and temporal profiles of cytokinin biosynthesis and accumulation in developing caryopses of maize. Annu. Bot., 107, 1235–1245. Rivero, R. M., Gimeno, J., Van Deynze, A., Walia, H. and Blumwald, E. 2010. Enhanced cytokinin synthesis in tobacco plants expressing PSARK:: IPT prevents the degradation of photosynthetic protein complexes during drought. Plant Cell Physiol., 51, 1929–1941. Rivero, R. M., Kojima, M., Gepstein, A., Sakakibara, H., Mittler, R., Gepstein, S. and Blumwald, E. 2007. Delayed leaf senescence induces extreme drought tolerance in a flowering plant. Proc. Natl. Acad Sci. USA, 104, 19631–19636. Romanov, G. A., Lomin, S. N. and Schmülling, T. 2006. Biochemical characteristics and ligand-binding properties of Arabidopsis cytokinin receptor AHK3 compared to CRE1/AHK4 as revealed by a direct binding assay. J. Exp. Bot., 57, 4051–4058. Rubio-Wilhelmi, M., Sanchez-Rodriguez, E., Rosales, M., Begona, B., Rios, J., Romero, L., et al. 2011. Effect of cytokinins on oxidative stress in tobacco plants under nitrogen deficiency. Environ. Exp. Bot., 72, 167–173. Sakai, H., Aoyama, T., Bono, H. and Oka, A. 1998. Two-component response regulators from Arabidopsis thaliana contain a putative DNA-binding motif. Plant Cell Physiol., 39, 1232–1239. Sakai, H., Aoyama, T. and Oka, A. 2000. Arabidopsis ARR1 and ARR2 response regulators operate as transcriptional activators. Plant J., 24, 703–711. Sakai, H., Honma, T., Aoyama, T., Sato, S., Kato, T., Tabata, S. and Oka, A. 2001. ARR1, a transcription factor for genes immediately responsive to cytokinins. Science, 294, 1519–1521. Sakakibara, H. 2006. Cytokinins: activity, biosynthesis, and translocation. Annu. Rev. Plant Biol., 57, 431–449. Sakakibara, H. 2010. Cytokinin biosynthesis and metabolism. In: DAVIES, P. (ed.) Plant Hormones. Springer Netherlands.

k

k

k

4 Cytokinin Signaling in Response to Abiotic Stresses

k

Schäfer, M., Meza-Canales, I. D., Navarro-Quezada, A., Brütting, C., Vanková, R., Baldwin, I. T. and Meldau, S. 2014. Cytokinin levels and signaling respond to wounding and the perception of herbivore elicitors in Nicotiana attenuata. J. Integr. Plant Biol., 57, 198–212. Schmülling, T., Werner, T., Riefler, M., Krupková, E. and Y Manns, I. B. 2003. Structure and function of cytokinin oxidase/dehydrogenase genes of maize, rice, Arabidopsis and other species. J. Plant Res., 116, 241–252. Schoor, S., Farrow, S., Blaschke, H., Lee, S., Perry, G., Von Schwartzenberg, K., et al. 2011. Adenosine kinase contributes to cytokinin interconversion in Arabidopsis. Plant Physiol., 157, 659–672. Schwartzenberg, K. V. and Hahn, H. 2005. Nutritive stress and cytokinin status in Norway spruce seedlings (Picea abies L. Karst.). Annu. For. Sci., 62, 449–453. Shashidhar, V., Prasad, T. and Sudharshan, L. 1996. Hormone signals from roots to shoots of sunflower (Helianthus annuus L.). Moderate soil drying increases delivery of abscisic acid and depresses delivery of cytokinins in xylem sap. Annu. Bot., 78, 151–155. Shi, X. and Rashotte, A. M. 2012. Advances in upstream players of cytokinin phosphorelay: receptors and histidine phosphotransfer proteins. Plant Cell Rep., 31, 789–799. Shi, Y., Tian, S., Hou, L., Huang, X., Zhang, X., Guo, H. and Yang, S. 2012. Ethylene signaling negatively regulates freezing tolerance by repressing expression of CBF and type-A ARR genes in Arabidopsis. Plant Cell, 24, 2578–2595. Singh, S., Letham, D. S., Jameson, P. E., Zhang, R., Parker, C. W., Bandenoch-Jones, J. and Noodén, L. D. 1988. Cytokinin biochemistry in relation to leaf senescence IV. Cytokinin metabolism in soybean explants. Plant Physiol., 88, 788–794. Skoog, F. and Miller, C. 1957. Chemical regulation of growth and organ formation in plant fissue cultured. In vitro. Symp. Soc. Exp. Biol., 11, 118–131. Steklov, M. Y., Lomin, S. N., Osolodkin, D. I. and Romanov, G. A. 2013. Structural basis for cytokinin receptor signaling: an evolutionary approach. Plant Cell Rep., 32, 781–793. Stephen, J. T. 2010. Endogenous cytokinin levels during early fruit development of Macadamia. African J. Agric. Res., 5, 3402–3407. Stirk, W., Novák, O., Václavíková, K., Tarkowski, P., Strnad, M. and Van Staden, J. 2008. Spatial and temporal changes in endogenous cytokinins in developing pea roots. Planta, 227, 1279–1289. Stolz, A., Riefler, M., Lomin, S. N., Achazi, K., Romanov, G. A. and Schmülling, T. 2011. The specificity of cytokinin signalling in Arabidopsis thaliana is mediated by differing ligand affinities and expression profiles of the receptors. Plant J., 67, 157–168. Strnad, M. 1997. The aromatic cytokinins. Physiol. Plantarum, 101, 674–688. Strnad, M., Hanuš, J., Vanˇek, T., Kamínek, M., Ballantine, J. A., Fussell, B. and Hanke, D. E. 1997. Meta-topolin, a highly active aromatic cytokinin from poplar leaves (Populus × canadensis Moench., cv. Robusta). Phytochemistry, 45, 213–218. Strnad, M., Peters, W., Hanuš, J. and Beck, E. 1994. Ortho-topolin-9-glucoside, an aromatic cytokinin from Populus x canadensis cv Robusta leaves. Phytochemistry, 37, 1059–1062. Su, Y.-H., Liu, Y.-B. and Zhang, X.-S. 2011. Auxin–cytokinin interaction regulates meristem development. Mol. Plant, 4, 616–625. Suzuki, T., Imamura, A., Ueguchi, C. and Mizuno, T. 1998. Histidine-containing phosphotransfer (HPt) signal transducers implicated in His-to-Asp phosphorelay in Arabidopsis. Plant Cell Physiol., 39, 1258–1268.

k

97

k

k

98

k

Mechanism of Plant Hormone Signaling under Stress

Suzuki, T., Ishikawa, K., Yamashino, T. and Mizuno, T. 2002. An Arabidopsis histidine-containing phosphotransfer (HPt) factor implicated in phosphorelay signal transduction: overexpression of AHP2 in plants results in hypersensitiveness to cytokinin. Plant Cell Physiol., 43, 123–129. Suzuki, T., Miwa, K., Ishikawa, K., Yamada, H., Aiba, H. and Mizuno, T. 2001. The Arabidopsis sensor His-kinase, AHK4, can respond to cytokinins. Plant Cell Physiol., 42, 107–113. Swartzberg, D., Dai, N., Gan, S., Amasino, R. and Granot, D. 2006. Effects of cytokinin production under two SAG promoters on senescence and development of tomato plants. Plant Biol., 8, 579–586. Sweere, U., Eichenberg, K., Lohrmann, J., Mira-Rodado, V., Bäurle, I., Kudla, J., et al. 2001. Interaction of the response regulator ARR4 with phytochrome B in modulating red light signaling. Science, 294, 1108–1111. Takahashi, S., Shudo, K., Okamoto, T., Yamada, K. and Isogai, Y. 1978. Cytokinin activity of N-phenyl-N′ -(4-pyridyl) urea derivatives. Phytochemistry, 17, 1201–1207. Takei, K., Takahashi, T., Sugiyama, T., Yamaya, T. and Sakakibara, H. 2002. Multiple routes communicating nitrogen availability from roots to shoots: a signal transduction pathway mediated by cytokinin. J. Exp. Bot., 53, 971–977. Takei, K., Yamaya, T. and Sakakibara, H. 2004. Arabidopsis CYP735A1 and CYP735A2 encode cytokinin hydroxylases that catalyze the biosynthesis of trans-zeatin. J. Biol. Chem., 279, 41866–41872. Tanaka, Y., Suzuki, T., Yamashino, T. and Mizuno, T. 2004. Comparative studies of the AHP histidine-containing phosphotransmitters implicated in His-to-Asp phosphorelay in Arabidopsis thaliana. Biosci. Biotechnol. Biochem., 68, 462–465. Tarkowská, D., Doležal, K., Tarkowski, P., Åstot, C., Holub, J., Fuksová, K., et al. 2003. Identification of new aromatic cytokinins in Arabidopsis thaliana and Populus × canadensis leaves by LC-(+) ESI-MS and capillary liquid chromatography/frit–fast atom bombardment mass spectrometry. Physiol. Plantarum, 117, 579–590. Thu, N. B. A., Hoang, X. L. T., Nguyen, T.-D. H., Thao, N. P. and Tran, L.-S. P. 2014. Differential expression of two-component system–related drought-responsive genes in two contrasting drought-tolerant soybean cultivars DT51 and MTD720 under well-watered and drought conditions. Plant Mol. Biol. Rep., 1–12. To, J. P., Deruère, J., Maxwell, B. B., Morris, V. F., Hutchison, C. E., Ferreira, F. J., et al. 2007. Cytokinin regulates type-A Arabidopsis response regulator activity and protein stability via two-component phosphorelay. Plant Cell, 19, 3901–3914. To, J. P., Haberer, G., Ferreira, F. J., Deruère, J., Mason, M. G., Schaller, G. E., et al. 2004. Type-A Arabidopsis response regulators are partially redundant negative regulators of cytokinin signaling. Plant Cell, 16, 658–671. Tokunaga, H., Kojima, M., Kuroha, T., Ishida, T., Sugimoto, K., Kiba, T. and Sakakibara, H. 2012. Arabidopsis lonely guy (LOG) multiple mutants reveal a central role of the LOG-dependent pathway in cytokinin activation. Plant J., 69, 355–365. Tran, L.-S. P., Shinozaki, K. and Yamaguchi-Shinozaki, K. 2010. Role of cytokinin responsive two-component system in ABA and osmotic stress signalings. Plant Signal. Behav., 5, 148–150. Tran, L.-S. P., Urao, T., Qin, F., Maruyama, K., Kakimoto, T., Shinozaki, K. and Yamaguchi-Shinozaki, K. 2007. Functional analysis of AHK1/ATHK1 and cytokinin

k

k

k

4 Cytokinin Signaling in Response to Abiotic Stresses

k

receptor histidine kinases in response to abscisic acid, drought, and salt stress in Arabidopsis. Proc. Natl. Acad. Sci. USA, 104, 20623–20628. Ueguchi, C., Koizumi, H., Suzuki, T. and Mizuno, T. 2001. Novel family of sensor histidine kinase genes in Arabidopsis thaliana. Plant Cell Physiol., 42, 231–235. Urao, T., Miyata, S., Yamaguchi-Shinozaki, K. and Shinozaki, K. 2000. Possible His to Asp phosphorelay signaling in an Arabidopsis two-component system. FEBS Letters, 478, 227–232. Vanková, R., Strnad, M., Peˇc, P. and Beck, E. 1999. Cytokinin glycoconjugates-distribution, metabolism and function. Adv. Regul. Plant Growth Dev., 67–78. Veach, Y. K., Martin, R. C., Mok, D. W., Malbeck, J., Vankova, R. and Mok, M. C. 2003. O-glucosylation of cis-zeatin in maize. Characterization of genes, enzymes, and endogenous cytokinins. Plant Physiol., 131, 1374–1380. Werner, T., Köllmer, I., Bartrina, I., Holst, K. and Schmülling, T. 2006. New insights into the biology of cytokinin degradation. Plant Biol., 8, 371–381. Werner, T., Motyka, V., Laucou, V., Smets, R., Van Onckelen, H. and Schmülling, T. 2003. Cytokinin-deficient transgenic Arabidopsis plants show multiple developmental alterations indicating opposite functions of cytokinins in the regulation of shoot and root meristem activity. Plant Cell, 15, 2532–2550. Werner, T., Nehnevajova, E., Köllmer, I., Novák, O., Strnad, M., Krämer, U. and Schmülling, T. 2010. Root-specific reduction of cytokinin causes enhanced root growth, drought tolerance, and leaf mineral enrichment in Arabidopsis and tobacco. Plant Cell, 22, 3905–3920. Wilhelmová, N., Procházková, D., Macháˇcková, I., Vágner, M., Srbová, M. and Wilhelm, J. 2004. The role of cytokinins and ethylene in bean cotyledon senescence. The effect of free radicals. Biol. Plantarum, 48, 523–529. Wulfetange, K., Lomin, S. N., Romanov, G. A., Stolz, A., Heyl, A. and Schmülling, T. 2011. The cytokinin receptors of Arabidopsis are located mainly to the endoplasmic reticulum. Plant Physiol., 156, 1808–1818. Xing, J., Xu, Y., Tian, J., Gianfagna, T. and Huang, B. 2009. Suppression of shade-or heat-induced leaf senescence in creeping bentgrass through transformation with the ipt gene for cytokinin synthesis. J. Am. Soc. Hortic. Sci., 134, 602–609. Xu, Y., Tian, J., Gianfagna, T. and Huang, B. 2009. Effects of SAG12-ipt expression on cytokinin production, growth and senescence of creeping bentgrass (Agrostis stolonifera L.) under heat stress. Plant Growth Regul., 57, 281–291. Yamada, H., Suzuki, T., Terada, K., Takei, K., Ishikawa, K., Miwa, K., et al. 2001. The Arabidopsis AHK4 histidine kinase is a cytokinin-binding receptor that transduces cytokinin signals across the membrane. Plant Cell Physiol., 42, 1017–1023. Yang, J., Zhang, J., Wang, Z., Zhu, Q. and Wang, W. 2001. Hormonal changes in the grains of rice subjected to water stress during grain filling. Plant Physiol., 127, 315–323. Yonekura-Sakakibara, K., Kojima, M., Yamaya, T. and Sakakibara, H. 2004. Molecular characterization of cytokinin-responsive histidine kinases in maize. Differential ligand preferences and response to cis-zeatin. Plant Physiol., 134, 1654–1661. Zaicovski, C. B., Zimmerman, T., Nora, L., Nora, F. R., Silva, J. A. and Rombaldi, C. V. 2008. Water stress increases cytokinin biosynthesis and delays postharvest yellowing of broccoli florets. Postharvest Biol. Technol., 49, 436–439.

k

99

k

k

100

Mechanism of Plant Hormone Signaling under Stress

Zalabák, D., Pospíšilová, H., Šmehilová, M., Mrízová, K., Frébort, I. and Galuszka, P. 2013. Genetic engineering of cytokinin metabolism: prospective way to improve agricultural traits of crop plants. Biotechnol. Adv., 31, 97–117. Zhang, J., Van Toai, T., Huynh, L. and Preiszner, J. 2000. Development of flooding-tolerant Arabidopsis thaliana by autoregulated cytokinin production. Mol. Breeding, 6, 135–144. Zhang, P., Wang, W. Q., Zhang, G. L., Kaminek, M., Dobrev, P., Xu, J. and Gruissem, W. 2010a. Senescence-inducible expression of isopentenyl transferase extends leaf life, increases drought stress resistance and alters cytokinin metabolism in cassava. J. Integr. Plant Biol., 52, 653–669. Zhang, X., Zhen, J., Li, Z., Kang, D., Yang, Y., Kong, J. and Hua, J. 2011. Expression profile of early responsive genes under salt stress in upland cotton (Gossypium hirsutum L.). Plant Mol. Biol. Rep., 29, 626–637. Zhang, Y., Liang, C., Xu, Y., Gianfagna, T. and Huang, B. 2010b. Effects of ipt gene expression on leaf senescence induced by nitrogen or phosphorus deficiency in creeping bentgrass. J. Am. Soc. Hortic. Sci., 135, 108–115. Zou, G. H., Liu, H. Y., Mei, H. W., Liu, G. L., Yu, X. Q., Li, M. S., et al. 2007. Screening for drought resistance of rice recombinant inbred populations in the field. J. Integr. Plant Biol., 49, 1508–1516.

k

k

k

k

101

5 Crosstalk Between Gibberellins and Abiotic Stress Tolerance Machinery in Plants Ashutosh Sharan 1,* , Jeremy Dkhar 1,* , Sneh Lata Singla-Pareek 2 , and Ashwani Pareek 1 1 Stress Physiology and Molecular Biology Laboratory, School of Life Sciences, Jawaharlal Nehru University, New Delhi, India 2 Plant Stress Biology, International Centre for Genetic Engineering and Biotechnology, New Delhi, India

5.1 Introduction

k

Plants encounter a wide array of biotic and abiotic factors in their natural environments that can impose strong physical interactions, beneficial to their growth and development. Microorganisms such as fungi, oomycetes, bacteria, and nematodes constitute biotic factors whereas light, temperature, water, and others comprise abiotic components. When the abiotic conditions are continually sub-optimal or when pathogenic microorganisms enforce an attack to cause disease, plants become stressed (Bohnert and Sheveleva 1998). In response to such a scenario, plants sense, perceive, and transduce stress signals to activate stress-responsive mechanisms via the regulation of certain transcription factors, thereby enabling stress tolerance or resistivity. Failure to do so results in irreversible changes that affect cellular homeostasis and loss of functional and structural proteins and membranes, leading to cell death (Wang et al. 2003). This response is highly complex, involving genes that induce signaling cascades, confer osmoprotection, facilitate water and ion uptake, and transport, and regulate expression of transcription factors and molecular chaperones that stabilize proteins and membranes (Wang et al. 2003). Nevertheless, research in this area has progressed tremendously and the ultimate goal has always been to identify and manipulate these genes for better tolerance in crop plants. An important component of the stress-response machineries against biotic and abiotic factors are the plant growth regulators (PGRs). PGRs are small bioactive molecules produced through various biosynthetic pathways that act locally at their site of synthesis or distantly, following translocation to regulate and mediate overall plant growth and development and stress responses, respectively. Known PGRs include cytokinin (CK), auxin, gibberellin (GA), abscisic acid (ABA), ethylene, jasmonate (JA), brassinosteroids, salicylic acid (SA), nitric oxide, and strigolactone. Studies on hormonal biosynthesis, metabolism, and signaling have seen remarkable progress in recent years and contributed to the understanding of the underlying mechanism that governs these processes. Furthermore, evidences have emerged that * These Authors contributed equally to this work Mechanism of Plant Hormone Signaling under Stress, First Edition, Volume 1. Edited by Girdhar Pandey. © 2017 John Wiley & Sons, Inc. Published 2017 by John Wiley & Sons, Inc.

k

k

k

102

Mechanism of Plant Hormone Signaling under Stress

suggest their role in plant responses to changing environmental conditions or in defenses against pathogenic attack (Bari and Jones 2008; Peleg and Blumwald 2011). Well-studied hormones affecting abiotic and biotic stress responses in plants include ABA (Cutler et al. 2010; Peleg and Blumwald 2011) and SA (Garcion and Métraux 2006; Vlot et al. 2009), respectively. GA is another well-studied growth-promoting hormone that has recently emerged as a crucial player in abiotic stress tolerance. Its primary role in plant growth and development includes seed germination and vegetative growth and is also known to promote flowering as well as flower, fruit, and seed development (Sun 2010). Evidence that highlighted their role in abiotic stress responses became apparent from preliminary experiments in which plants treated with growth-retarding chemicals showed enhanced tolerance against drought (Halevy and Kessler 1963). The treated-plants displayed reduced levels of GA, caused as a result of the inhibition of GA biosynthesis by growth retardants (Rademacher 2000). Numerous reports followed that indicated similar responses (Magome et al. 2004; Alonso-Ramírez et al. 2009), implying that modulation of GA levels in plants confers tolerance to several abiotic stresses. In turn, levels of other plant hormones were found affected, thereby hinting at the existence of a crosstalk between GA and other plant signaling molecules such as JA (Navarro et al. 2008; Cheng et al. 2009; Hou et al. 2010; Yang et al. 2012) and SA (Alonso-Ramírez et al. 2009). Here, we present and discuss these processes and highlight recent advances in understanding of GA metabolism and signaling and their implication in plant responses to abiotic stress. k

k

5.2 Gibberellins: Biosynthesis, Transport, and Signaling Research that led to the discovery of gibberellin began in Japan in the early 1900s when plant pathologists investigating fungal-infected rice plants that were lacking seed setting but showed increased shoot height found that an unknown chemical causing the disease is secreted by the fungus Gibberella fujikoroi, and hence they named it gibberellin (Kurosawa 1926; Ito and Kimura 1936). Gibberellin A3 (GA3 ) was the first GA to be isolated from G. fujikoroi followed by GA1 from Phaseolus multiflorus (Macmillan 1958); since then, more than 100 GAs have been isolated and identified from both fungal and plant sources (MacMillan 2002). However, only a few become active hormones while the remaining exist as precursors or deactivated metabolites (MacMillan 2002; Yamaguchi 2008). GAs are synthesized from a key isoprenoid, geranylgeranyl diphosphate (GGDP), through a series of conversion steps that initially result in the formation of GA12 , and culminating with the production of bioactive gibberellins such as GA1 , GA3 , GA4 , and GA7 . GGDP is produced through an enzymatic condensation reaction involving isopentenyl diphosphate (IPP) and farnesyl diphosphate as substrates and is present in all organisms including humans (Mende et al. 1997; Kainou et al. 1999). Conversion of GGDP to GA12 is achieved in eight steps and requires four enzymes (Fig. 5.1). Two of them, ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS), belong to the terpene cyclases class of enzymes and catalyzes the conversion of GGDP to ent-kaurene via ent-copalyl diphosphate (CDP) (Sun and Kamiya 1997 and references

k

k

Plastid

5 Gibberellins and Abiotic Stress Tolerance

GGDP

CPS

ent-Copalyl diphosphate

KS

ent-Kaurene KO

ent-Kaurenol

Endoplasmic reticulum

GA12-Aldehyde

KAO

ent-7α-Hydroxy kaurenoic acid

ent-Kaurenoic acid

KAO

GA12

KAO

GA110

GA biosynthesis

ent-Kaurenal

KO

KO

GA2ox

GA12

GA20ox

GA15

GA13ox

GA53

20

GA97

GA2ox

11

1 2 3

GA20ox

HO C 2 19

GA44

10 9 4

5

6 H

18

8

GA53 12

OH

H 13 14 16

15 7 CO H 2

H 17 HO C 2

H

GA4

O

GA20ox

H

Cytosol

GA20ox

GA19 GA20ox

HO

GA29

OC

H

HO

H

CO H 2

GA2ox

GA3ox

GA2ox

GA4

GA3ox

GA1

GA5

GA3ox

GA8 GA2ox

GA3ox

OH

O

GA6

H OC HO

GA3ox

H

CO H 2

GA3

k

GA

GID1 +

Nucleus

GA perception and signaling

GA34

GA20

CO H 2

GA3

GA2ox

GA9

OH H

OC

GA24

CO H 2

GA1

O

GA20ox

GA51

k

103

–

A G

SCFGID2/SLY1

DELLA degradation

DELLA

A G Transcription factors

GA responses (plant growth)

GID1 DELLA Transcription factors

DELLA responses (growth restraint)

Figure 5.1 GA metabolism and signaling in plants. GGDP is converted into bioactive GAs through a series of conversion steps. GGDP gets converted into ent-kaurene in the plastid, which is then transported into the endoplasmic reticulum for GA12 biosynthesis. GA12 is then converted into bioactive GAs and occurs in the cytosol. In the presence of bioactive GAs, the GA receptor GID1 binds DELLA and allows plant growth. But in the absence of bioactive GAs, DELLA is free to regulate transcription of GA responsive genes and restraint plant growth. The square box provides structures of some of the GA intermediates as well as the bioactive GAs. GGDP: geranylgeranyl diphosphate (GGDP), CPS: ent-copalyl diphosphate synthase, KS: ent-kaurene synthase, KO: ent-kaurene oxidase, KAO: ent-kaurenoic acid oxidase, GA2ox: GA 2-oxidase, GA13ox: GA 13-oxidase, 20ox: GA 20-oxidase, GA3ox, GA 3-oxidase, GID1: Gibberellin insensitive dwarf1.

k

k

104

k

Mechanism of Plant Hormone Signaling under Stress

therein). Ent-kaurene synthesis is a crucial step in the GA biosynthetic pathway as it determines the level of endogenous GAs (Moore and Coolbaugh, 1991). Ent-kaurene is then converted to GA12 through six oxidation reaction steps at the C-19 position; the initial three steps require the enzyme ent-kaurene oxidase (KO) to generate ent-kaurenoic acid, which is subsequently converted into GA12 via an additional three oxidation steps catalyzed by ent-kaurenoic acid oxidase (KAO) (Nelson et al. 2004) (Fig. 5.1). The synthesis of ent-kaurene from GGDP occurs in the plastid and requires transportation to the plastid’s outer membrane for conversion to ent-kaurenoic acid, while the endoplasmic reticulum represents the site of GA12 biosynthesis (Helliwell et al. 2001). How these intermediates are translocated from one site to another is yet to be determined. Their proposed site of synthesis, however, is based on evidence from GFP-fused protein localization and 35 S-labelled protein import studies of enzymes involved in the early stages of the GA biosynthetic pathway (Helliwell et al. 2001). The production of GA12 sets the stage for the final phases of bioactive GAs synthesis, catalyzed by 2-oxoglutarate-dependent dioxygenases (2ODDS) and takes place in the cytosol (Itoh et al. 2001; Appleford et al. 2006). GA12 is sequentially oxidized at C-20 to produce GA9 , which is then hydroxylated at C-3 to generate the bioactive GA4 ; both reactions are made possible by the action of the soluble GA 20-oxidase (GA20ox) and GA 3-oxidase (GA3ox), respectively (Fig. 5.1). GA1 production, however, requires the action of GA 13-oxidase to hydroxylate GA12 at C-13 and convert it to GA53 followed by the sequential oxidation and hydroxylation steps at C-20 and C-3 involving GA20ox and GA3ox, respectively (Itoh et al. 2001; Appleford et al. 2006) (Fig. 5.1). The immediate precursor of GA1 is GA20 . Further catalytic activity of GA3ox converts GA9 and GA20 into bioactive GA7 and GA3 , respectively (Fig. 5.1). Characteristic features that separate bioactive from inactive GAs are the hydroxyl group on C3 and the carboxyl group on C6 that enable biological activity and, more importantly, reinforce their receptor binding affinities (Harberd et al. 2009). Besides biosynthesis, GA metabolism encompasses another important metabolic deactivation process, a means by which plants control bioactive GA levels (Yamaguchi et al. 2008). It occurs at critical steps of the GA biosynthetic pathway and involves GA 2-oxidases (GA2ox), which utilizes both C-19 and C-20 GAs as substrates (Fig. 5.1). Likely substrates include GA12 , GA53 , GA9 , GA20 , and the bioactive GAs. Although GA biosynthesis is common among organisms, certain deviations exist, for example in the fungus G. fujikoroi (now renamed Fusarium fujikoroi), the cyclization steps that convert GGDP to ent-kaurene is catalyzed by a single CPP synthase enzyme (Kawaide et al. 1997; Tudzynski et al. 1998). Furthermore, unlike GA12 in plants, GA14 acts as the primary intermediate for bioactive GAs production in G. fujikoroi, formed through 3β-hydroxylation of GA12-aldehyde to produce GA14-aldehyde followed by C-7 oxidation (Urrutia et al 2001). In addition, GA1 is present predominantly in all plant species whereas GA3 is the major fungal product (Hedden et al. 2001). These differences and many more (reviewed in Bömke and Tudzynski 2009) suggest an independent evolution of GA biosynthetic pathway in plant, fungal, and bacterial lineages (Bömke and Tudzynski 2009). It is generally believed that active GA biosynthesis occur at their site(s) of action. Based on the expression patterns of KO and GA3ox genes, bioactive GA synthesis during seed germination in Arabidopsis was predicted to occur in the rapidly expanding cortical cells of the embryo, thereby promoting embryo growth and

k

k

k

5 Gibberellins and Abiotic Stress Tolerance

k

facilitating radicle protrusion (Yamaguchi et al. 2001). Interestingly, expression of genes encoding CPS occurs in cell types distinct from those that show KO and GA3ox expression (Yamaguchi et al. 2001), indicating that GA biosynthesis requires intercellular translocation of intermediates, presumably ent-kaurene (Yamaguchi 2008). Once the seeds have germinated, bioactive GAs then induces hypocotyl and stem elongation, leaf expansion, root growth, and flower development. In GA-deficient mutants, the ability to undergo normal growth and development is affected. In severe cases, these mutants completely lack seed germination (Koornneef and van der Veen, 1980; Mitchum et al. 2006). In rare cases where germination occurs, mutant plants become dwarf (Koornneef and van der Veen, 1980; Silverstone et al. 1997; Mitchum et al. 2006). Similar phenotypes were also observed in GA receptor mutants (Griffiths et al. 2006). However, there are several reports that indicate gibberellin activities beyond site of synthesis and these mostly occur at later stages of plant development. For example, transport of bioactive GA (GA4 ) from leaves to the shoot apex was shown to promote flower initiation in Arabidopsis (Eriksson et al. 2006). Furthermore, petal growth in Arabidopsis requires the transport of bioactive GAs from stamens or flower receptacles (Hu et al. 2008). These studies highlight the importance of GA transport in facilitating plant growth and development. But the underlying molecular mechanism is yet to be ascertained. In relevance to the subject of hormone transport, research has shown that leaf initiation occurs at sites of auxin accumulation (Reinhardt et al. 2003), facilitated by the auxin efflux carrier protein PINFORMED1 (PIN1). Whether similar mechanisms involving transmembrane proteins assisted GA transport is one direction that can be looked at, as GA biosynthesis and signaling is thought to affect polar auxin transport (Willige et al. 2011). Unlike GA biosynthesis, which is well characterized, little was known until recently about the underlying molecular mechanism of GA perception and signaling. Based on the hydrophobic properties of GA, it was thought that plants have membrane-bound and soluble receptors for GA binding (Hooley et al. 1992). The search for these elusive receptors began quite recently, about a decade ago, when the first soluble GA receptor GIBBERELLIN INSENSITIVE DWARF1 (GID1) was identified in rice (Ueguchi-Tanaka et al. 2005). GID1 encodes a protein, which shares homology to the hormone-sensitive lipase (HSL) family of proteins. Based on their findings, Ueguchi-Tanaka et al. (2005) suggest that the binding of GID1 to bioactive GA permits interaction with GA response inhibitors, thereby promoting GA signaling (Fig. 5.1). Prior to the identification of GID1, a suppressor of GA signaling called DELLA proteins was already known (Peng et al. 1997; Silverstone et al. 1997). DELLA belongs to a subfamily of the GRAS regulatory protein family common throughout the plant kingdom and acts to restrict plant growth by negatively regulating GA signaling. DELLA is encoded by the slender rice1 (slr1) in rice (Ikeda et al. 2001), GIBBERELLIN INSENSITIVE 1 (GAI1), REPRESSOR OF GA1 (RGA), and RGA-like 1-3 (RGL1-3) in Arabidopsis (Peng et al. 1997; Silverstone et al. 1998; Lee et al. 2002), reduced height (rht) in wheat (Gale et al. 1975), DWARF8 (D8) in maize (Harberd and Freeling 1989; Winkler and Freeling 1994), and slender 1 (SLN) in barley (Gubler et al. 2002). When GA-GID1 complex binds DELLA proteins to form the GA-GID1-DELLA complex, DELLA’s transcriptional regulatory activity is lost. Subsequently, degradation of DELLAs via the ubiquitin-proteasome pathway is directed, which involves a specific ubiquitin E3

k

105

k

k

106

Mechanism of Plant Hormone Signaling under Stress

ligase complex (SCFSLY1/GID2) for polyubiquitination and the 26S proteasome for subsequent degradation (Fig. 5.1). The GA-GID1-DELLA complex formation probably induces a conformational change at the carboxy terminal region of DELLA proteins that enhances its recognition by the F-box protein of the ubiquitin E3 ligase SCF complex (Murase et al. 2008), which otherwise remains undetected when unbound (Fig. 5.1). Based on the crystal structure of GA3 -GID1A-DELLA complex, it was shown that bioactive GA binds to the carboxy terminal domain of GID1 while the amino terminal domain represents the site for DELLA binding (Murase et al. 2008). Upon GA binding, the N-terminal domain of GID1 undergo conformational switch with one surface covering the GA-binding site while the other becomes the site for DELLA binding (Murase et al. 2008; Sun 2010). Following DELLA degradation, transcriptional reprogramming of GA responsive genes occurs (Zentella et al. 2007). These putative downstream targets include genes encoding GA biosynthetic enzymes (GA3ox1 and GA20ox2), GA receptors (GID1a, GID1b), and transcription factors (MYB, bHLH137, bHLH154, WRKY27), which also show early responses to DELLA proteins (Zentella et al. 2007).

5.3 GA Metabolism and Signaling During Abiotic Stress

k

It is now well established that under normal conditions, GA stimulates growth and development via the GID1-induced DELLA degradation pathway. So what role does GA play during plant exposure to adverse environmental conditions? In a preliminary study, Achard et al. (2006a) found that quadruple DELLA Arabidopsis mutants showed better tolerance when exposed to high salt as compared to wild-type seedlings. The wild-type seedlings displayed retarded growth and accumulated reduced bioactive GA levels suggesting that Arabidopsis response to high salt is mediated via the DELLA-dependent pathway (Achard et al. 2006a). With GA levels decreasing, it is expected that DELLA accumulation should also increase. When pRGA:GFP-RGA transgenic lines expressing a GFP-RGA fusion protein were treated with high salt, GFP-RGA signal increased as compared to control, indicating an increased accumulation of DELLA (Achard et al. 2006a). The authors proposed that salt stress and other kinds of stresses inhibit growth by ways of decreasing and increasing GA and DELLA levels, respectively. In other words, plants modulate GA and DELLA levels to enhance survival in unfavorable conditions, but at the cost of growth and development. This DELLA-induced growth restraint is, however, beneficial and is adopted by most plants in their fight for survival. DELLA promotes growth restrain by increasing the expression of cell cycle inhibitor proteins Kip-related protein 2 (KRP2) and SIAMESE (SIM) (Achard et al. 2009). Table 5.1 shows a list of genes conferring tolerance to plants in response to several abiotic stresses as mediated via GA. 5.3.1 Salinity Stress Induces GA2ox and GA20ox Gene Expression

One of the earliest known salt-stress responsive genes DWARF AND DELAYEDFLOWERING 1 (DDF1) identified in Arabidopsis confers stress tolerance via repression of GA biosynthesis (Magome et al. 2004). Upon treatment with 250 μM sodium

k

k

k

k

AP2/ERF Overexpression type-transcription factors

Arabidopsis thaliana DEHYDRATIONRESPONSIVE ELEMENTBINDING PROTEIN 1A (AtDREB1A)

Drought Arabidopsis GA METHYL TRANSFERASE 1 (AtGAMT1)

Overexpression

methyltransferase Overexpression gene family

GA-STIMULATED 97-112 residues IN ARABIDOPSIS peptide 14 (GASA14)

subunit of the Overexpression RNA-induced silencing complex (RISC)

Overexpression

2β-hydroxylation enzyme

GA 2-oxidase 5

TUDOR STAPHYLOCOCCAL NUCLEASE (Tudor-SN)

Overexpression

Description

Manipulation Conferring Tolerance

AP2-type transcription factor

Salinity DWARF AND DELAYEDFLOWERING 1 (DDF1)

Type of Abiotic Stresses Gene

–

–

Increased Faster expression of germination, GA20ox3 increased leaf size and stem length and early flowering Reduced reactive oxygen species (ROS) accumulation Significant reduction in GAST1 expression

Increased plant growth

Dwarf, small dark-greened leaflets

–

–

–

Increased expression of NtGA2ox, NtGA3ox and NtLEA

–

–

–

High

–

Significant increase in GA3ox1 expression

Dwarfism, dark-green leaves, delayed flowering Dwarfism

High

Low

Increased expression of GA2ox7

DELLA Levels

Dwarfism and delayed flowering

Bioactive GA Levels

Downstream Effect

Phenotype of Transgenic Plants

Table 5.1 List of genes conferring tolerance in response to several abiotic stresses as mediated via GA.

Magome et al. (2004, 2008)

References

Sun et al. (2013)

Yan et al. (2014)

Cong et al. (2008)

(Continued)

Solanum Nir et al. lycopersicum (2014)

Arabidopsis thaliana

Arabidopsis thaliana

Nicotiana tobacum

Oryza sativa Shan et al. (2014)

Arabidopsis thaliana

Species

k

k

Cold

O-linked Nacetylglucosamine transferase

SPINDLY (SPY)

k

Gossypium hirsutum DREB1

AP2/ERF type-transcription factors

Low Overexpression Retarded growth Elevated free and delayed proline flowering concentrations; enhanced expression of NtERD10B and NtERD10C

–

– Enhanced expression of RGL1, RGL2, GA2ox, DREB1E/DDF1

–

–

High

Low in over- – expressing lines; high in RNAi lines

Overexpressed lines displayed reduced expression of GA20ox2 and GA3ox1; no significant difference in GA2ox expression

DELLA Levels

Bioactive GA Levels

Downstream Effect

Populus euphratica GRAS/SCL Overexpression Overexpressed Elevated SCARECROW-LIKE transcription factor lines showed no α-amylase and PROTEIN 7 (SCL7) apparent SOD activity phenotype

Loss-of-function Elongated stem, mutation pale leaves, slender seedlings, and male sterility

zinc finger Overexpression Overexpressed transcription factor lines displayed normal growth; RNAi lines displayed early flowering

Phenotype of Transgenic Plants

B-BOX ZINC FINGER 24 (BBX24)

Description

Manipulation Conferring Tolerance

k

Type of Abiotic Stresses Gene

Table 5.1 (Continued)

References

Nicotiana tobacum

Arabidopsis thaliana

Arabidopsis thaliana

Shan et al. (2007)

Ma et al. (2010)

Qin et al. (2011)

Chrysanthemum Yang et al. morifolium (2014)

Species

k

k

GASA5

Overexpression

97–112 residues Loss-of-function peptide mutation

GA-stimulated gene

Overexpression

GA-stimulated gene

Glycine soja GASA1

Heat GASA4

Gain-of-function mutation

AP2-type transcription factor

FTL1/DDF1

Constitutive expression

Longer hypocotyl

No apparent phenotype

Shorter roots

Dark-green leaves, dwarfism, and late flowering

Dwarfism, small and darker leaves, late flowering

– Heat shock proteins are up-regulated in gasa5; no change in overexpressed plants

–

Increased expression of Binding protein (BiP) High (GAI) in GASA5 overexpressing lines

–

High (RGL2 & RGL3)

–

–

High

High (RGL3); Low (GAI, RGL1, RGL2)

Low

Increased – expression of stress-responsive genes

Reduced levels of GA20ox and GA3ox; increased expression of GA2ox

k

CBF1/DREB1b AP2/ERF typetranscription factors

Arabidopsis thaliana

Arabidopsis thaliana

Arabidopsis thaliana

Arabidopsis thaliana

Arabidopsis thaliana

Zhang and Wang (2011)

Ko et al. (2007)

Li et al. (2011)

Kang et al. (2011)

Achard et al. (2008)

k

k k

k

110

k

Mechanism of Plant Hormone Signaling under Stress

chloride, an increased level of DDF1 mRNA (956-fold at 5h) was observed in wild-type Arabidopsis seedlings. To confirm its role in salt stress response, DDF1 transgenic plants under the control of the 35S promoter were produced; these plants showed higher rate of survival as compared to wild-type. Interestingly, exogenous application of GA reduced the plants tolerance to salt stress. DDF1 encodes a putative AP2 transcription factor, the overexpression of which is responsible for the ddf1 phenotype (Magome et al. 2004). The ddf1 mutants were smaller in size and showed dark green leaves with delayed flowering similar to GA-deficient and GA-insensitive mutants (Koornneef and van der Veen, 1980; Koornneef et al. 1985). Since ddf1 was identified as a GA-deficient mutant, high salt treatment was extended to the GA biosynthetic mutant ga1-3. As expected, the ga1-3 mutant showed higher tolerance thereby confirming the involvement of GA in salt-stress tolerance (Magome et al. 2004). In fact, reduction in GA levels in DDF1-overexpressing transgenic plants is due to an increased expression of GA 2-oxidase 7 gene (GA2ox7), which encodes a C20-GA deactivation enzyme (Magome et al. 2008). Mutation in the GA2ox7 gene, that renders it non-functional, suppressed the ddf1 phenotype. Further support on the role of GA in salinity stress response via the GA 2-oxidase pathway had come from rice plants overexpressing GA2ox5. The GA2ox5-overexpressed plants were able to withstand high salt conditions (Shan et al. 2014). These findings show that adaptation to salinity stress is promoted by reduced GA levels caused by the induction of GA 2-oxidase genes. In another similar study, overexpression of a member of the ERF family of transcription factors in Arabidopsis, AtDREB1A, confers salt stress tolerance in transgenic tobacco plants. These plants showed increased expression of NtGA2ox and NtGA3ox, implying that AtDREB1A might directly or indirectly regulate the expression of genes encoding GA dioxygenases and thereby influence GA metabolism (Cong et al. 2008). Another mechanism of salt stress responses in Arabidopsis involves the ubiquitous protein Tudor-SN (TSN). Besides its role in spliceosome assembly, RNA-induced silencing, and nuclease and transcriptional activity, TSN is also involved in stress adaptation; but until recently, its stress-response mechanism remained largely unknown. Yan et al. (2014) showed that TSN modulates GA20ox3 mRNA levels to regulate plant growth under salt stress. GA20ox3 is a key GA biosynthetic enzyme that catalyzes the conversion of C-20 intermediates (GA12 ) to C-19 intermediates (GA9 ), a precursor for the bioactive GA4 . In TSN1/TSN2 RNAi lines and TSN overexpressing lines, GA20ox3 mRNA levels decreased and increased, respectively, suggesting that TSN regulates the mRNA levels of GA20ox3. Both TSN1/TSN2 RNAi lines and ga20ox3 mutants displayed growth impairment when grown under high salt conditions, while TSN1 overexpressing lines showed stress tolerance. Exogenous application of GA3 partially restored the defective phenotypes of the RNAi lines and ga20ox3 mutants, implying that reduced GA level and increased DELLA accumulation are responsible for the growth constraint. The TSN1 overexpressing plants displayed GA overproduction phenotypes, which suggests that a DELLA-independent mechanism might have conferred stress tolerance to these plants. Moreover, wild type seeds accumulated higher levels of GA20ox3 when imbibed in 150 mM NaCl solution. This finding suggests that GA20ox3 induction is required for plant growth under stress. Yan et al. (2014) found that TSN directly binds to GA20ox3; this binding may be required for recruitment into stress granules and subsequent stability of the GA20ox3 mRNA. In

k

k

k

5 Gibberellins and Abiotic Stress Tolerance

111

another interesting finding, overexpression of GASA14, a member of GA-stimulated in Arabidopsis (GASA) gene family improved salt and ABA tolerance in Arabidopsis transgenic plants (Sun et al. 2013). Loss-of-function gasa14 mutants lack tolerance and as a result, displayed severe growth defects in comparison to wild type plants. Moreover, Sun et al. (2013) showed that GASA14 overexpression (OE) lines accumulated less H2 02 while gasa14 mutants accumulated more H2 O2 as compared to wild type, implying that GASA14 modulates ROS accumulation to regulate stress tolerance in plants. 5.3.2 Reduced GA Confers Tolerance to Drought Stress

k

Plants of brassicaceae and related families adopt a strategy called “drought rhizogenesis” in response to progressive drought stress. In such a scenario, plants develop short, tuberized, hairless roots that are able to withstand prolonged period of drought. Since GA deficiency is associated with above-ground phenotypic modification (dwarfism), it is expected that GA may also play a role in drought-induced root morphogenesis. In a preliminary investigation, GA-deficient mutants (ga5) showed enhanced drought rhizogenesis. It was suggested that other GA intermediates that accumulate in ga5 mutants promoted adapted responses to drought stress (Vartanian et al. 1994). Such proposal is fascinating and a revisit on the role of GA intermediates may be envisaged. Nevertheless, the findings by Vartanian et al. (1994) indicate that reduced bioactive GA definitely plays a role in drought stress responses. In a recent study, Nir et al. (2014) produced transgenic tomato plants with reduced bioactive GA levels by overexpressing Arabidopsis thaliana GA METHYL TRANSFERASE 1 (AtGAMT1) gene. GAMT1 encodes an enzyme that catalyzes the methylation of active GAs to generate inactive GA methyl esters. The transgenic plants were able to tolerate drought stress and their phenotypes resembled GA-deficient mutants having smaller stomata with reduced pore size. This morphological characteristic enabled the transgenic plants to retain water in the leaves under drought conditions (Nir et al. 2014). Earlier, Huang et al. (2008) performed oligonucleotide microarray experiments to identify drought-responsive genes in Arabidopsis. Among the approximately 2000 identified drought-related genes, GASA1 expression was downregulated. GASA1 expression is induced by GA. This finding suggests that endogenous level of GA decreases in response to drought, subsequently leading to reduced GASA1 expression. In fact, maize plants showed drastic reduction in GA3 levels when subjected to drought stress (Wang et al. 2008). In a recent study, Yang et al. 2014 identified a zinc finger transcriptional activator BBX24 as a regulator of GA biosynthesis. They found that transgenic Chrysanthemum morifolium plants overexpressing BBX24 gene confers resistance to freezing and drought tolerance whereas RNAi lines showed sensitivity to abiotic stresses. Global expression analysis revealed upregulation of GA20ox and GA3ox in Cm-BBX24-RNAi transgenic lines, which are significantly downregulated in Cm-BBX24-OX lines. However, both transgenic lines showed no difference in expression of GA2ox. The results indicate that BBX24 regulates bioactive GA levels in C. morifolium by controlling GA biosynthesis (Yang et al. 2014). SPINDLY (SPY) is a known negative regulator of GA signaling that encodes an O-linked N-acetylglucosamine transferase and is induced in response to drought stress.

k

k

k

112

k

Mechanism of Plant Hormone Signaling under Stress

Mutations in SPY gene confer high salt and drought tolerance whereas overexpressing SPY renders the plants drought sensitive (Qin et al. 2011). This indicates that SPY plays a negative role in plant abiotic stress. Many GA-responsive genes were upregulated in spy mutants thereby producing mutants resembling GA treated plants. In addition, many stress-inducible genes such as DREB were also upregulated in spy mutants but downregulated in SPY -overexpressing plants. Increased expression of these stress-related genes may have contributed to stress tolerance (Qin et al. 2011). Furthermore, spy mutants accumulated higher levels of DELLA proteins, which must have contributed to stress adaptation. Accumulation of DELLA is achieved through loss of SPY protein function, as SPY has been proposed to alter DELLA protein activity or stability via O-GlcNac modification (Qin et al. 2011). Therefore, in response to abiotic stresses, plants adopt a mechanism by which SPY is rendered ineffective thereby allowing commencement of DELLA-dependent mechanism of stress response. It is now clear that manipulating the endogenous levels of bioactive GA can impart tolerance to stress-sensitive plants. It is of utmost importance then to evaluate plants that have the natural ability to tolerate abiotic stresses. Populus euphratica is a desert plant that can withstand high salt and drought conditions and therefore represents an important source for gene mining. Upon high salt and dehydration treatments, poplar seedlings accumulated high transcript levels of PeSCL7, a plant-specific GRAS/SCL transcription factors known for their roles in development and stress responses. Interestingly, PeSCL7 transcripts gradually decrease in presence of GA. This suggests that GA represses PeSCL7 expression. This finding indicates that adaptation to abiotic stresses in poplar plants is achieved by suppressing GA biosynthesis via a GRAS/SCL-induced pathway. When PeSCL7 gene was overexpressed in Arabidopsis, plants showed tolerance to high salt and drought stresses (Ma et al. 2010). Gene expression profiling of two moderately drought-resistant potato clones, SA2563 and Sullu (Solanum tuberosum L. subsp, andigena), revealed differential expression of genes involved in GA biosynthesis and degradation. Of particular interest, GA2 oxidase gene is up-regulated in Sullu clone. Under drought stress, Sullu clone displayed reduced shoot and leaf growth caused as a result of reduced GA levels (Schafleitner et al. 2007). 5.3.3 Role of GA in Cold and Heat Stresses

Rise in temperature as a result of global warming will have huge impact on plant growth and development. One of the crucial players of temperature response belong to the C-repeat/drought-responsive element binding factor (CBF1/DREB1b) gene family. Overexpression of the Gossypium hirsutum DREB1 gene in tobacco improves tolerance to low temperature. Shan et al. (2007) found that bioactive GA content in transgenic plants is half the amount present in wild-type plants. But upon exogenous application of GA3 , GhDREB1 expression is repressed. This suggests that DREB1 and GA signaling are interconnected via an unknown mechanism (Shan et al. 2007). In a more convincing study, Achard et al. (2008a) showed that the constitutive expression of the C-repeat/drought-responsive element binding factor (CBF1/DREB1b) gene in Arabidopsis improves tolerance to cold stress. These transgenic plants exhibit growth inhibition. The reduced growth phenotype is due to an increased

k

k

k

5 Gibberellins and Abiotic Stress Tolerance

k

RGA (DELLA) accumulation caused as a result of CBF1 overexpression. This is achieved through GA inactivation as CBF1 overexpressed lines exhibited increased expression of the GA 2-oxidase gene. Although role of DELLAs in salt stress is well established (Achard et al. 2006a), its role in cold stress is relatively unknown. The gai-t6 rga mutant exhibit reduced cold tolerance as compared to wild-type plants. This finding shows that DELLA contributes, in part, towards plant responses to CBF1-induced cold stress (Achard et al. 2008a). Overexpression of another member of the CBF1/DREB1 gene family confers tolerance to cold stress (Kang et al. 2011). Although designated as FREEZING TOLERANCE 1-1D (FTL1-1D), sequence comparison, however, identified it as DDF1. In fact, ftl1-1d phenotype resembles ddf1 in several aspects such as dwarfism, dark green leaves and delayed flowering. This suggests that freezing tolerance of ftl1-1d phenotype is caused by overexpression of ddf1 (Kang et al. 2011). Overexpression of the FTL1/DDF1 gene induces expression of stress-response genes, namely COLD-REGULATED 15A (COR15A), RESPONSIVE TO DESSICATION 29A (RD29A), RESPONSIVE TO ABA 18 (RAB18), KIN1, and COLD-REGULATED 15B (COR15B), and a heat shock transcription factor, HSF3. In addition, RGL3, one of the DELLA genes, showed upregulated expression. These findings indicate that increased tolerance to abiotic stresses is associated with induction of stress responsive genes and accumulation of DELLA protein. Upon treatment with exogenous GA, FTL1/DDF1 overexpressing plants displayed reduced tolerance to cold stress and restored impaired phenotypes, implying that reduction in GA level is crucial for plants responses to abiotic stresses (Kang et al. 2011). Low growth inhibition in response to cold stress involves another member of the GASA gene family, GASA1 of Glycine soja (Li et al. 2011). Chronic cold treatment inhibited root growth in GsGASA1 overexpressing Arabidopsis transgenic lines compared to wild-type plants. These transgenic lines also displayed increased accumulation of RGL2 and RGL3, two Arabidopsis DELLA proteins. Since GASA functions downstream of DELLA (Zhang et al. 2009), it seems obvious that GASA1 mediates root growth inhibition under long exposure to cold stress via DELLA proteins. High temperature is a limiting factor for plant growth and development. And understanding how plants respond in such a scenario is of great significance considering the ever increasing global temperature. Zhang and Wang (2011) provided evidence for the involvement of a member of the GASA family, GASA5 in heat stress. In comparison to wild type, loss-of-function mutants displayed enhanced tolerance to heat stress whereas GASA5-overexpressing lines exhibited sensitivity. The transgenic plants overexpressing GASA5 showed reduced expression of genes encoding heat-shock proteins, increased accumulation of H2 O2 and the DELLA protein GAI. This may have contributed to faster cotyledon-yellowing rate and slower hypocotyl elongation phenotypes of the GASA5-overexpressing plants. Exogenous application of GA could rescue the expression of HSP genes. Although the relationship between GA and HSP is not well-established, Zhang and Wang (2011) suggested that GA regulates the expression of HSP genes via the GASA5-mediated SA signaling, a known hormone for HSP induction. Earlier, overexpression of another member of the GASA gene family, GASA4, resulted in increased tolerance to heat stress (Ko et al. 2007). In fact, heat induces the expression of GASA4. This increased expression of GASA4 is also correlated with an increased

k

113

k

k

114

Mechanism of Plant Hormone Signaling under Stress

expression of Binding protein (BiP), a known target of heat shock proteins (Oka et al. 1997; Ko et al. 2007). This finding suggests a direct or indirect interaction between GASA4 and HSP. These findings imply that plants mediate growth under heat stress by controlling HSP expression via GA responsive genes such as the GASAs.

5.4 Crosstalk between GA and Other Plant Hormones in Response to Abiotic Stresses Plants need to correlate external and internal signals to cope with environmental and endogenous cues by means of complex networks of transduction pathways by producing correct response. Identification of various components involved in different signal transduction pathways using hormone biosynthesis or signaling mutants and transgenic plants has increased our knowledge of these signaling cascades. These include complex crosstalk among various hormones during various developmental processes and in response to different biotic and abiotic stresses (Weiss and Ori 2007). Here, we present the crosstalk of GA with other phytohormones in response to abiotic stresses. 5.4.1 Crosstalk between GAs and Ethylene During Abiotic Stress

k

Ethylene, a gaseous hormone, is produced in most of the plant tissues and affects a variety of processes like seed germination, growth, organ senescence, apical hook formation, fruit ripening, abscission, and response to various stresses (Abeles et al. 1992). 1-aminocyclopropane-1-carboxylate synthase (ACS) and ACC oxidase are the two main enzymes involved in the biosynthesis of ethylene via the Yang pathway (Yang and Hoffmann 1984). ETR1, ETR2, ERS1, ERS2, and EIN4 are five ethylene receptors found in Arabidopsis and act as redundant negative regulators suppressing the ethylene responses (Hua and Meyerowitz 1998; Hall et al. 2000). Wild-type plants become tolerant to high salt environment when treated with ACC (Achard et al. 2006a). Ethylene absence enhance EIN3 degradation by SCFEBF1/EBF2 (Kepinski and Leyser, 2003; Potuschak et al. 2003; Gagne et al. 2004). EIN3 accumulation exhibits constitutive ethylene response in ctr1-1 and ebf1-1, ebf2-1 mutants making them more tolerant to salt stress, whereas ein3-1 mutants are less tolerant to salt stress, but a lack of EIN3 in ein3-1, ebf1-1, ebf2-1 triple mutant results in a loss of tolerance level (Achard et al. 2006a). Salt tolerance of the ctr1-1, gai-t6, rga-24 triple mutant is substantially suppressed compared with that exhibited by ctr1-1, demonstrating that EIN3 enhances salt tolerance by promoting DELLA function (Achard et al. 2006a). Ethylene accumulation in case of submergence, results in upregulation of SNORKEL1 and SNORKEL2 (ethylene response factor domain proteins) (Hattori et al. 2009), which in turn leads to increased levels of bioactive GA causing rapid internode elongation to avoid submergence. Rice plants with the Sub1A gene do not follow an escape response to submergence (Fukao and Bailey-Serres, 2008a). They restrict shoot elongation and conserve carbohydrate resources to be utilized for recovery once the flood recedes (Fukao et al. 2006; Xu et al. 2006). This restricted growth is due to increase in levels of DELLA protein SLENDER LIKE-1 and a negative

k

k

k

5 Gibberellins and Abiotic Stress Tolerance

Submergence

115

Salt and Drought

Ethylene

JA

ABA

DELLA

XERICO

SNORKEL

GASA

GA

ICS1 & NPR1

GA target genes

SA

GA induced growth

JAZ

DELLA target genes

DELLA induced growth JA target genes

Stress tolerance JA induced growth

k

Figure 5.2 GA mediated abiotic stress responses in plants. Ethylene accumulation in case of submergence results in upregulation of SNORKEL1 and SNORKEL2, which in turn leads to increased levels of bioactive GAs causing rapid internode elongation to avoid submergence. ABA levels increase in plants in response to salt stress that reduces GA levels and results in growth inhibition. XERICO (RING-H2 zinc finger factor), being a transcriptional downstream target of DELLA proteins, regulates ABA biosynthesis and drought tolerance and functions as a node of abiotic stress responses in plants and links GA and ABA signaling pathways. Application of GA3 exogenously or overexpression of GASA reverts the inhibitory effects of abiotic stresses by modulating SA biosynthesis through GASA gene as a putative intermediate between GA and SA. High salinity and drought increases JA levels in plants. JA rapidly induces DELLA protein (RGL3), which interacts with JAZ proteins there by repressing its activity and in turn enhances the expression of JA-responsive genes to overcome stress.

regulator of GA SLR1-LIKE 1 (SLRL1), which decline in varieties without Sub1A (Fukao and Bailey-Serres 2008b). Enhanced ethylene levels, in response to adverse environmental conditions, cause delayed flowering in Arabidopsis, which is partly rescued by “loss-of-function” mutations in DELLAs encoding genes. Elevated ethylene enhances accumulation of DELLA due to reduced bioactive GA levels, which cause the repression of LEAFY (LFY), the floral meristem-identity genes and SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (SOC1) (Achard et al. 2006b) resulting in delayed flowering (Fig. 5.2). 5.4.2 Crosstalk Between GAs and Abscisic Acid During Abiotic Stress

Abscisic acid (ABA) play a key role in cellular adaptation to abiotic stresses such as drought and salinity as well as functions as a growth inhibitor (Cutler et al. 2010; Raghavendra et al. 2010; Weiner et al. 2010). Different cellular receptors perceive ABA signals and activate specific responses in distinct cellular compartments. The nucleo-cytoplasmic receptors PYL (PYRABACTRIN RESISTANCE LIKE)/RCARs (REGULATORY COMPONENT OF ABA RECEPTORs)/PYR (PYRABACTRIN RESISTANCE) bind ABA and inhibits PP2Cs (type 2 C-protein phosphatases), like ABI1 and ABI2 (Ma et al., 2009; Park et al., 2009). Active SnRK2 (SNF1-RELATED

k

k

k

116

Mechanism of Plant Hormone Signaling under Stress

PROTEIN KINASES) accumulates after inhibition of PP2Cs (Umezawa et al. 2009; Vlad et al. 2009) and regulates various transcription factors responsive to ABA. These transcription factors activate various ABA-responsive genes, which in-turn control different physiological processes in response to ABA (Fig. 5.2). Levels of ABA increases in plants in response to salt stress due to activation of ABA signaling (Zhu et al. 2002), causes ROS production (Achard et al. 2008b), and hence results in growth inhibition (Leung et al. 1997). The quadruple DELLA mutant (rga, gai, rgl1, and rgl2) is tolerant to growth inhibition caused by ABA (Achard et al. 2006a) suggesting a role of DELLA protein in ABA-mediated abiotic stress response. XERICO (RING-H2 zinc finger factor) regulates ABA biosynthesis and drought tolerance in Arabidopsis (Ko et al. 2006). XERICO, being a transcriptional downstream target of DELLA proteins, functions as a node of abiotic stress response in plants, and links GA and ABA signaling pathways (Zentella et al. 2007; Ariizumi et al. 2013). 5.4.3 Crosstalk Between GAs and SA During Abiotic Stress

k

SA induces tolerance against abiotic stresses in plants (Horvath et al. 2007). SA imparts thermotolerance in several plant species, like mustard (B. nigra; Dat et al. 1998), Arabidopsis (A. thaliana; Clarke et al. 2004; Larkindale and Vierling 2008), and pea (P. sativum; Pan et al. 2006). During oxidative stress, SA increases antioxidant capacity and thus reduces the extent of lipid peroxidation (Strobel and Kuc 1995; Ananieva et al. 2002). SA biosynthesis deficient rice mutant NahG is highly sensitive to paraquat (Yang et al., 2004; Kusumi et al., 2006). Proteomic study has shown SA induces higher levels of two superoxide dismutases, improving seed germination in salt stress conditions and also enhances the antioxidant capacity of Arabidopsis seedlings (Rajjou et al., 2006). Early evidence suggesting the role of GAs in thermotolerance emerged by treating Kentucky bluegrass plants with a GA inhibitor (Heckman et al., 2002), making them more susceptible to heat than untreated plants. GASA genes, family of GA-induced genes, are involved in plant responses to abiotic stresses (Wigoda et al. 2006; Ko et al. 2007). Arabidopsis FsGASA4 transgenic lines are more tolerant to salt, oxidative, and heat stresses in seed germination (Alonso-Ramírez et al. 2009). FsGASA4 transgenic seeds show increased concentration of SA as compared to wild-type seeds. FsGASA4 seedlings, when grown in a GA3 supplemented medium, shows enhanced expression of ics1 and npr1 involved in SA biosynthesis and action, respectively (Alonso-Ramírez et al. 2009). It suggests that GAs have an active role in SA biosynthesis and action. Application of GA3 exogenously or overexpression of GASA reverts the inhibitory effects of abiotic stresses in Arabidopsis seedlings by modulating SA biosynthesis, may be through GASA gene as a putative intermediate between GA and SA (Fig. 5.2). 5.4.4 Crosstalk Between GAs and Jasmonic Acid During Abiotic Stress

Jasmonic acid (JA) responds to abiotic stress and modulates plant growth and development (Turner et al. 2002; Pauwels et al. 2009). JA is derived from α-linolenic acid of chloroplast membranes (Wasternack 2007). JA levels increase in salt and drought stresses (Creelman and Mullet 1995; Wang et al. 2001). High salinity and drought increases JA levels in rice (leaves and roots) by inducing JA biosynthesis genes (Moons et al. 1997; Tani et al. 2008). In rice, orthologues of JA biosynthesis

k

k

k

5 Gibberellins and Abiotic Stress Tolerance

117

genes like OsDAD1, OsLOX2, and so on, show upregulation in response to drought stress and genes with putative functions in JA signaling like OsJAR1, OsbHLH148, and OsCOI1a show differential regulation in various abiotic stresses (Du et al. 2013). Yeast two-hybrid assays show OsCOIs interacts with members of the OsJAZ (jasmonic acid ZIM-domain proteins) family (Lee et al. 2013). Overexpression of OsJAZ6 in rice improves salt and mannitol stress tolerance (Ye et al. 2009). DELLA protein (RGL3) is required to enhance JA mediated responses (Wild et al. 2012). JA rapidly induces RGL3, which interacts with JAZ proteins and represses its activity and in turn enhances the expression of JA-responsive genes (Fig. 5.2). These recent findings suggest function of DELLAs as an interface of GA and jasmonic acid signaling. Auxin, cytokinin, and brassinosteroids also play critical role in abiotic stress responses but their direct correlation with GA, in case of abiotic stress, is not much reported and needs further evaluation.

5.5 Applications in Crop Improvement

k

GAs are commercially used to enhance growth of a number of fruit crops, sugar yield in sugarcane, to stimulate malting in barley in beer-brewing industry, increase internodal length, induce and promote flowering in several plants, modify sex expression of flowers in some plants, larger blooms, flower stalk elongation, stimulate early flowering, and seed germination (Table 5.2). 5.5.1 Flower Development

Spraying GA on geranium flowers, at first color appearance; increased the flower size by 25–50%. Single spray of GA can accelerate the flowering of cyclamens by 4–5 weeks, if sprayed 60–75 days prior to the estimated flowering date. GA is used to replace the requirement of long night treatment or cold treatment to induce or force flowering in plants such as azaleas and hydrangeas. GA is also used to stimulate rapid growth and delayed flowering in some plants like fuchsia and geraniums. Table 5.2 Applications of GA in crop improvement. Plant

Condition for GA Application

Effect

Grapes

7–10 days after bloom

Loosening of cluster, increased berry size

Sour cherries

20–40 days after bloom

Reduces the effects of cherry yellow virus

Lemons

In November or December

Control fruit maturity, increase storage life

Oranges

In October or December

Reduction in rind stain, retardation of rind aging

Barley

During germination

Increase in enzyme content in malt

Cherries

While fruits are still green

Larger fruit and better color

Cucumber

1–3 leaf stage

Production of staminate flowers on gynoecious lines

Sugarcane

4 months prior to harvest

Increased sugar content

Apple

At the time of pollination

Fruit russet suppression, increased size

Apple tree

Application to nursery stock

Development of lateral branches in tree

k

k

k

118

Mechanism of Plant Hormone Signaling under Stress

GAs application in monoecious cucumbers increase the number of staminate flowers on gynoecious cucumbers, which have otherwise produced only pistillate flowers. 5.5.2 Fruit Development

Most of the seedless grapes are treated with GA3 causing increase in rachis length and fruit size. Rachis length increment reduces the compactness of the cluster reducing the chance of growth of fungus inside the cluster. GA3 helps in increasing import of carbohydrate into developing fruit and hence the overall size of berry. Application of GA3 , 4–6 weeks prior to harvest, increases fruit size in bing cherries. GA3 application increases fruit set in the tart cherry. Spraying GA3 delay or prevent rind-ageing in oranges and tangerines. It synchronizes ripening and enhances fruit size in lemons and limes. Sugarcane is sensitive to low temperatures, which cause reduced internode elongation and thus sucrose yield. Application of GA3 can counteract the adverse effects of low temperatures and hence increases the sucrose yield. GA4 promotes fruit setting in apple and pear trees. Some apple cultivars undergo biennial bearing, a phenomenon in which fruiting inhibits the flower bud production in subsequent season decreasing fruit yield, which can be overcome by GA4 application. Use of GA4/7 prevents russetting in Golden Delicious apples, which is caused due to abnormal cell division in epidermis. k

5.5.3 Brewing Industry

In germinating seeds, GA-induce α-amylase synthesis by the aleurone layer cells of cereal grains, which hydrolyses starch in endosperm. In the brewing industry, the extent of hydrolytic breakdown of starch by α-amylase to yield fermentable sugars (mainly maltose) determines the yield of end product (ethanol) after fermentation of maltose by yeast. Exogenous application of GA during starch breakdown fastens hydrolysis by supplementing the action of endogenous GA to increase the yield.

5.6 Conclusion To fight for their survival under unfavorable conditions, it is imperative for plants to adopt different mechanisms of stress responses. As noted previously, these can be numerous but the ultimate goal is targeted towards controlling endogenous GA levels. This is achieved via GA deactivation enzymes such as GA 2-oxidases. Stress induces expression of GA2ox genes either through DDF1 or DREB1, which then control GA levels. A reduction in GA results in a concurrent increase in DELLA proteins. This physiological pattern is indeed responsible for the plants endurance in adverse environmental conditions. But a DELLA-independent mechanism of stress tolerance also exists in plants, probably mediated by the TSN protein via GA20ox gene. This holds promise as it allows normal growth, unlike DELLA-dependent pathway, which is associated with growth restraint. In-depth research in this direction should be targeted in the future. It is becoming clear that GA signaling is interconnected with other signaling pathways and there exist a crosstalk between them and in most cases, DELLAs are involved as mediators of the hormonal crosstalk. It has also become

k

k

k

5 Gibberellins and Abiotic Stress Tolerance

119

evident that DELLA proteins mediate crosstalk between GA and other hormones during abiotic stresses. This, in turn, allows the plant to trigger additional mechanism of stress responses, thereby strengthening the plants’ struggle for survival. The way in which these mechanisms are integrated requires further research. The purpose of pursuing research in abiotic stress has and always been the identification of candidate genes for crop improvement via genetic manipulation. We now understand that under abiotic stress, plants modulate the expression of certain genes that render them tolerability. Based on extensive research that spanned the last decade, we have listed in Table 5.1 some of the candidate genes that are involved in crosstalk in GA pathway and known to confer tolerance in response to several abiotic stresses. These genes have the potential for crop improvement in the future.

Acknowledgment

k

Authors would like to acknowledge Department of Biotechnology (DBT), Government of India and Department of Science and Technology (DST), Government of India for their continuous financial support to Stress Physiology and Molecular Biology Laboratory, School of Life Sciences, Jawaharlal Nehru University. AS is grateful to University Grant Commission, Government of India for the award of Senior Research Fellowship. JD is supported by DST, Government of India under the DST INSPIRE Faculty Scheme.

References Abeles FB, Morgan PW, Saltveit ME Jr. Ethylene in Plant Biology, 2nd edn. Academic Press, San Diego. 1992. Achard P, Cheng H, De Grauwe L, Decat J, Schoutteten H, Moritz T, Van Der Straeten D, et al. Integration of plant responses to environmentally activated phytohormonal signals. Science 2006a; 311:91–94. Achard P, Gong F, Cheminant S, Alioua M, Hedden P, Genschik P. The cold-inducible CBF1 factor-dependent signaling pathway modulates the accumulation of the growth-repressing DELLA proteins via its effect on gibberellin metabolism. Plant Cell 2008a; 20:2117–2129. Achard P, Gusti A, Cheminant S, Alioua M, Dhondt S, Coppens F, et al. Gibberellin signaling controls cell proliferation rate in Arabidopsis. Curr Biol 2009; 19:1188–1193. Achard P, Renou JP, Berthomé R, Harberd NP, Genschik P. Plant DELLAs restrain growth and promote survival of adversity by reducing the levels of reactive oxygen species. Curr Biol 2008b; 18:656–660. Achard P, Baghour M, Chapple A, Hedden P, Van Der Straeten D, Genschik P, et al. The plant stress hormone ethylene controls floral transition via DELLA-dependent regulation of floral meristem-identity genes. Proc Natl Acad Sci USA 2006b; 104:6484–6489. Alonso-Ramírez A, Rodríguez D, Reyes D, Jiménez JA, Nicolás G, López-Climent M, et al. Evidence for a role of gibberellins in salicylic acid-modulated early plant responses to abiotic stress in Arabidopsis seeds. Plant Physiology 2009; 150:1335–1344.

k

k

k

120

k

Mechanism of Plant Hormone Signaling under Stress

Ananieva EA, Alexieva VS, Popova LP. Treatment with salicylic acid decreases the effects of paraquat on photosynthesis. J Plant Physiol 2002; 159:685–693. Appleford NE, Evans DJ, Lenton JR, Gaskin P, Croker SJ, et al. Function and transcript analysis of gibberellin-biosynthetic enzymes in wheat. Planta 2006; 223:568–582. Ariizumi T, Hauvermale AL, Nelson SK, Hanada A, Yamaguchi S, Steber CM. Lifting DELLA repression of Arabidopsis seed germination by nonproteolytic gibberellins signaling. Plant Physiol 2013; 162:2125–2139. Bari R, Jones JDG. Role of plant hormones in plant defence responses. Plant Mol Biol 2008; 69:473–488. Bohnert HJ, Sheveleva E. Plant stress adaptations – making metabolism move. Curr Opin Plant Biol 1998; 1:267–274. Bömke C, Tudzynski B. Diversity, regulation, and evolution of the gibberellin biosynthetic pathway in fungi compared to plants and bacteria. Phytochemistry 2009; 70:1876–1893. Cheng H, Song S, Xiao L, Soo HM, Cheng Z, Xie D, Peng J. Gibberellin acts through jasmonate to control the expression of MYB21, MYB24, and MYB57 to promote stamen filament growth in Arabidopsis. PLoS Genet 2009; 5:e1000440. Clarke SM, Mur LAJ, Wood JE, Scott IM. Salicylic acid dependent signaling promotes basal thermotolerance but is not essential for acquired thermotolerance in Arabidopsis thaliana. Plant J 2004; 38:432–447. Cong L, Zheng HC, Zhangb YX, Chaia TY. Arabidopsis DREB1A confers high salinity tolerance and regulates the expression of GA dioxygenases in tobacco. Plant Sci 2008; 174:156–164. Creelman RA, Mullet JE. Jasmonic acid distribution and action in plants: regulation during development and response to biotic and abiotic stress. Proc Natl Acad Sci USA 1995; 92:4114–4119. Cutler SR, Rodriguez PL, Finkelstein RR, Abrams SR. Abscisic acid: emergence of a core signaling network. Annu Rev Plant Biol 2010; 61:651–679. Dat JF, Lopez-Delgado H, Foyer CH, Scott IM. Parallel changes in H2 O2 and catalase during thermotolerance induced by salicylic acid or heat acclimation in mustard seedlings. Plant Physiol 1998; 116:1351–1357. Du H, Liu H, Xiong L. Endogenous auxin and jasmonic acid levels are differentially modulated by abiotic stresses in rice. Front Plant Sci 2013; 4:397. Eriksson S, Bohlenius H, Moritz T, Nilsson O. GA4 is the active gibberellin in the regulation of LEAFY transcription and Arabidopsis floral initiation. Plant Cell 2006; 18:2172–2181. Fukao T, Bailey-Serres J. Ethylene – a key regulator of submergence responses in rice. Plant Sci 2008a; 175:43–51. Fukao T, Bailey-Serres J. Submergence tolerance conferred by Sub1A is mediated by SLR1 and SLRL1 restriction of gibberellin responses in rice. Proc Natl Acad Sci USA 2008b; 105:16814–16819. Fukao T, Xu K, Ronald PC, Bailey-Serres J. A variable cluster of ethylene response factor-like genes regulates metabolic and developmental acclimation responses to submergence in rice. Plant Cell 2006; 18:2021–2034. Gagne JM, Smalle J, Gingerich DJ, Walker JM, Yoo SD, Yanagisawa S, Vierstra RD. Arabidopsis EIN3-binding F-box 1 and 2 form ubiquitin-protein ligases that repress ethylene action and promote growth by directing EIN3 degradation. Proc Natl Acad Sci USA 2004; 101:6803–6808.

k

k

k

5 Gibberellins and Abiotic Stress Tolerance

k

Gale MD, Law CN, Marshall GA, Worland AJ. The genetic control of gibberellic acid insensitivity and coleoptile length in a “dwarf” wheat. Heredity 1975; 34:393–399. Garcion C, Métraux JP. Salicylic acid. In P. Hedden, S.G. Thomas (Eds), Plant Hormone Signaling. Annual Plant Reviews, 2006; 24:229–257. Griffiths J, Murase K, Rieu I, Zentella R, Zhang ZL, Powers SJ, et al. Genetic characterization and functional analysis of the GID1 gibberellin receptors in Arabidopsis. Plant Cell 2006; 186:3399–3414. Gubler F, Chandler PM, White RG, Llewellyn DJ, Jacobsen JV. Gibberellin signalling in barley aleurone cells. Control of SLR1 and GAMYB expression. Plant Physiol 2002; 129:191–200. Halevy AH, Kessler B. Increased tolerance of bean plants to soil drought by means of growth-retarding substances. Nature 1963; 197:310–311. Hall AE, Findell JL, Schaller GE, Sisler EC, Bleecker AB. Ethylene perception by the ERS1 protein in Arabidopsis. Plant Physiology 2000; 123:1449–1458. Harberd NP, Belfield E, Yasumura Y. The angiosperm gibberellin-GID1-DELLA growth regulatory mechanism: how an “inhibitor of an inhibitor” enables flexible response to fluctuating environments. Plant Cell 2009; 21:1328–1339. Harberd NP, Freeling M. Genetics of dominant gibberellin-insensitive dwarfism in maize. Genetics 1989; 121:827–838. Hattori Y, Nagai K, Furukawa S, Song X-J, Kawano R et al. The ethylene response factors SNORKEL1 and SNORKEL2 allow rice to adapt to deep water. Nature 2009; 460:1026–1030. Heckman NL, Horst GL, Gaussoin RE, Tavener BT. Trinexapacethyl influence on cell membrane thermostability of Kentucky bluegrass leaf tissue. Sci Hortic 2002; 92:183–186. Hedden P, Phillips AL, Rojas MC, Carrera E, Tudzynski B. Gibberellin biosynthesis in plants and fungi: A case of convergent evolution? J Plant Growth Regul 2001; 20:319–331. Helliwell CA, Sullivan JA, Mould RM, Gray JC, Peacock WJ, Dennis ES. A plastid envelope location of Arabidopsis ent-kaurene oxidase links the plastid and endoplasmic reticulum steps of the gibberellin biosynthesis pathway. Plant J 2001; 28:201–208. Hooley R, Beale MH, Smith SJ, Walker RP, Rushton PJ, Whitford PN, Lazarus CM. Gibberellin perception and the Avena fatua aleurone: do our molecular keys fit the correct locks? Biochem Soc Trans 1992; 20:85–89. Horvath E, Szalai G, Janda T. Induction of abiotic stress tolerance by salicylic acid signaling. J Plant Growth Regul 2007; 26:290–300. Hou X, Lee LYC, Xia K, Yan Y, Yu H. DELLAs modulate jasmonate signaling via competitive binding to JAZs. Dev Cell 2010; 19:884–894. Hu J, Mitchum MG, Barnaby N, Ayele BT, Ogawa M, Nam E, et al. Potential sites of bioactive gibberellin production during reproductive growth in Arabidopsis. Plant Cell 2008; 20:320–336. Hua J, Meyerowitz E. Ethylene responses are negatively regulated by a receptor gene family in Arabidopsis thaliana. Cell 1998; 94:261–271. Huang D1, Wu W, Abrams SR, Cutler AJ. The relationship of drought-related gene expression in Arabidopsis thaliana to hormonal and environmental factors. J Exp Bot 2008; 59:2991–3007. Ikeda A, Ueguchi-Tanaka M, Sonoda Y, Kitano H, Koshioka M, Futsuhara Y, et al. slender rice, a constitutive gibberellin response mutant, is caused by a null mutation of the SLR1

k

121

k

k

122

k

Mechanism of Plant Hormone Signaling under Stress

gene, an ortholog of the height-regulating gene GAI/RGA/RHT/D8. Plant Cell 2001; 13:999–1010. Ito S, Kimura J. Studies on the “bakanae” disease of the rice plant. Rep. Hokkaido Nat. Agric. Exp. Stn. 1936; 27:1–99. Itoh H, Ueguchi-Tanaka M, Sentoku N, Kitano H, Matsuoka M, Kobayashi M. Cloning and functional analysis of two gibberellin 3 β-hydroxylase genes that are differently expressed during the growth of rice. Proc. Natl. Acad. Sci. USA 2001; 98:8909–8914. Kainou T, Kawamura K, Tanaka K, Matsuda H, Kawamukai M. Identification of the GGPS1 genes encoding geranylgeranyl diphosphate synthases from mouse and human. Biochim Biophys Acta 1999; 1437:333–340. Kang HG, Kim J, Kim B, Jeong H, Choi SH, Kim EK, et al. Overexpression of FTL1/DDF1, an AP2 transcription factor, enhances tolerance to cold, drought, and heat stresses in Arabidopsis thaliana. Plant Sci 2011; 180:634–641. Kawaide H, Imai R, Sassa T, Kamiya Y. ent-Kaurene synthase from the fungus Phaeosphaeria sp. L487 – cDNA isolation, characterization, and bacterial expression of a bifunctional diterpene cyclase in fungal gibberellin biosynthesis. J Biol Chem 1997; 272:21706–21712. Kepinski S, Leyser O. SCF-mediated proteolysis and negative regulation in ethylene signaling. Cell 2003; 115:647–648. Ko CB, Woo YM, Lee DJ, Lee MC, Kim CS. Enhanced tolerance to heat stress in transgenic plants expressing the GASA4 gene. Plant Physiol Biochem 2007; 45:722–728. Ko JH, Yang SH, Han KH. Upregulation of an Arabidopsis RING-H2 gene, XERICO, confers drought tolerance through increased abscisic acid biosynthesis. Plant J 2006; 47:343–355. Koornneef M, Elgersma A, Hanhart CJ, Van Loenen-Martinet EP, Van Rign L, Zeevaart JAD. A gibberellin insensitive mutant of Arabidopsis thaliana. Physiol Plant 1985; 65:33–39. Koornneef M, van der Veen JH. Induction and analysis of gibberellin-sensitive mutants in Arabidopsis thaliana (L.) Heynh. Theor Appl Genet 1980; 1586:257–263. Kurosawa E. Experimental studies on the nature of the substance secreted by the “bakanae fungus”. Nat Hist Soc Formosa 1926; 16:213–227. Kusumi K, Yaeno T, Kojo K, Hirayama M, Hirokawa D, Yara A, Iba K. The role of salicylic acid in the glutathione-mediated protection against photooxidative stress in rice. Physiol Plant 2006; 128:651–661. Larkindale J, Vierling E. Core genome responses involved in acclimation to high temperature. Plant Physiol 2008; 146:748–761. Lee S, Cheng H, King KE, Wang W, He Y, Hussain A, et al. Gibberellin regulates Arabidopsis seed germination via RGL2, a GAI/RGA-like gene whose expression is up-regulated following imbibition. Genes Dev 2002; 16:646–658. Lee HY, Seo JS, Cho JH, Jung H, Kim JK, Lee JS et al. Oryza sativa COI homologues restore jasmonate signal transduction in Arabidopsis coi1–1 mutants. PLoS ONE 2013; 8:e52802. doi:10.1371/journal.pone.0052802. Leung J, Merlot S, Giraudat J. The Arabidopsis ABSCISIC ACID-INSENSlTIVE2 (AB12) and ABIf genes encode homologous protein phosphatases 2C involved in abscisic acid signal transduction. Plant Cell 1997; 9:759–771.

k

k

k

5 Gibberellins and Abiotic Stress Tolerance

k

Li KL, Bai X, Li Y, Cai H, Ji W, Tang LL, et al. GsGASA1 mediated root growth inhibition in response to chronic cold stress is marked by the accumulation of DELLAs. J Plant Physiol. 2011; 168:2153–2160. Ma HS, Liang D, Shuai P, Xia XL, Yin WL. The salt- and drought-inducible poplar GRAS protein SCL7 confers salt and drought tolerance in Arabidopsis thaliana. J Exp Bot 2010; 61:4011–4019. Ma, Y, Szostkiewicz, I, Korte, A, Moes, D, Yang, Y, Christmann, A et al. Regulators of PP2C phosphatase activity function as abscisic acid sensors. Science 2009; 324:1064–1068. MacMillan J. Occurrence of gibberellins in vascular plants, fungi, and bacteria. J Plant Growth Regul 2002; 20:387–442. MacMillan J, Suter PJ. The occurrence of gibberellin A1 in higher plants: Isolation from the seed of runner bean (Phaseolus multiflorus). Naturwissenschaften 1958;45:46. Magome H, Yamaguchi S, Hanada A, Kamiya Y, Oda K. dwarf and delayed-flowering 1, a novel Arabidopsis mutant deficient in gibberellin biosynthesis because of overexpression of a putative AP2 transcription factor. Plant J 2004; 37:720–729. Magome H, Yamaguchi S, Hanada A, Kamiya Y, Oda K. The DDF1 transcriptional activator upregulates expression of a gibberellin-deactivating gene, GA2ox7, under high-salinity stress in Arabidopsis. Plant J 2008; 56:613–626. Mende K, Homann V, Tudzynski B. The geranylgeranyl diphosphate synthase gene of Gibberella fujikuroi: isolation and expression. Mol Gen Genet 1997; 255:96–105. Mitchum MG, Yamaguchi S, Hanada A, Kuwahara A, Yoshioka Y, Kato T, et al. Distinct and overlapping roles of two gibberellin 3-oxidases in Arabidopsis development. Plant J 2006; 456:804–818. Moons A, Prinsen E, Bauw G, Van Montagu M. Antagonistic effects of abscisic acid and jasmonates on salt stress-inducible transcripts in rice roots. Plant Cell 1997; 9:2243–2259. Moore TC, Coolbaugh RC (1991) Correlation between apparent rates of ent-kaurene biosynthesis and parameters of growth and development in Pisum sativum. In N. Takahashi, BO Phinney, and J Macmillan (Eds), Gibberellins (pp. 188–198). Springer-Verlag, New York, NY. Murase K, Hirano Y, Sun TP, Hakoshima T. Gibberellin-induced DELLA recognition by the gibberellin receptor GID1. Nature 2008; 456:459–463. Navarro L, Bari R, Achard P, Lisón P, Nemri A, Harberd NP, Jones JDG. DELLAs control plant immune responses by modulating the balance of jasmonic acid and salicylic acid signaling. Curr Biol 2008; 18:650–655. Nelson DR, Schuler MA, Paquette SM, Werck-Reichhart D, Bak S. Comparative genomics of rice and Arabidopsis. Analysis of 727 cytochrome P450 genes and pseudogenes from a monocot and a dicot. Plant Physiol. 2004; 135:756–772. Nir I, Moshelion M, Weiss D. The Arabidopsis GIBBERELLIN METHYL TRANSFERASE 1 suppresses gibberellin activity, reduces whole-plant transpiration and promotes drought tolerance in transgenic tomato. Plant Cell Environ 2014; 37:113–123. Oka M, Kimata Y, Mori K, Kohno K. HSP70/Ssalp through a heat shock element-mediated pathway. J. Biochem. 1997; 121:578–584. Pan QH, Zhan JC, Liu HT, Zhang JH, Chen JY, Wen PF, Huang WD. Salicylic acid synthesized by benzoic acid 2-hydroxylase participates in the development of thermotolerance in pea plants. Plant Sci 2006; 171:226–233.

k

123

k

k

124

k

Mechanism of Plant Hormone Signaling under Stress

Park SY, Fung P, Nishimura N, Jensen DR, Fujii H, Zhao Y, et al. Abscisic acid inhibits type2 C-protein phosphatases via the PYR/PYL family of START proteins. Science 2009; 324:1068–1071. Pauwels L, Inze D, Goossens A. Jasmonate-inducible gene: what does it mean? Trends Plant Sci. 2009; 14:87–91. Peleg Z, Blumwald E. Hormone balance and abiotic stress tolerance in crop plants. Curr Opin Plant Biol 2011; 14:290–295. Peng J, Carol P, Richards DE, King KE, Cowling RJ, Murphy GP, Harberd NP. The Arabidopsis GAI gene defines a signaling pathway that negatively regulates gibberellin responses. Genes Dev 1997; 11:3194–3205. Potuschak T, Lechner E, Parmentier Y, Yanagisawa S, Grava S, Koncz C, Genschik P. EIN3-dependent regulation of plant ethylene hormone signaling by two Arabidopsis F box proteins: EBF1 and EBF2. Cell 2003; 115:679–689. Qin F, Kodaira KS, Maruyama K, Mizoi J, Tran LS, Fujita Y, et al. SPINDLY, a negative regulator of gibberellic acid signaling, is involved in the plant abiotic stress response. Plant Physiol 2011; 157:1900–1913. Rademacher W. Growth retardants: Effects on gibberellin biosynthesis and other metabolic pathways. Annu Rev Plant Physiol Plant Mol Biol 2000; 51:501–531. Raghavendra AS, Gonugunta VK, Christmann A, Grill E. ABA perception and signalling. Trends Plant Sci 2010; 15:395–401. Rajjou L, Belghazi M, Huguet R, Robin C, Moreau A, Job C, Job D. Proteomic investigation of the effect of salicylic acid on Arabidopsis seed germination and establishment of early defense mechanisms. Plant Physiol 2006; 141:910–923. Reinhardt D, Pesce ER, Stieger P, Mandel T, Baltensperger K, Bennett M, et al. Regulation of phyllotaxis by polar auxin transport. Nature 2003; 426:255–260. Schafleitner R, Gutierrez Rosales RO, Gaudin A, Alvarado Aliaga CA, Martinez GN, Tincopa Marca LR, et al. Capturing candidate drought tolerance traits in two native Andean potato clones by transcription profiling of field grown plants under water stress. Plant Physiol Biochem 2007; 45:673–690. Shan C, Mei Z, Duan J, Chen H, Feng H, Cai W. OsGA2ox5, a gibberellin metabolism enzyme, is involved in plant growth, the root gravity response and salt stress. Plos One 2014; 9(1): e87110. doi:10.1371/journal.pone.0087110 Shan DP, Huang JG, Yang YT, Guo YH, Wu CA, Yang GD, et al. Cotton GhDREB1 increases plant tolerance to low temperature and is negatively regulated by gibberellic acid. New Phytol 2007; 176:70–81. Silverstone AL, Ciampaglio CN, Sun TP. The Arabidopsis RGA gene encodes a transcriptional regulator repressing the gibberellin signal transduction pathway. Plant Cell 1998; 2:155–169. Silverstone AL, Mak PYA, Casamitjana Martínez E, Sun TP. The new RGA locus encodes a negative regulator of gibberellin response in Arabidopsis thaliana. Genetics 1997; 1466:1087–1099. Strobel NE, Kuc A. Chemical and biological inducers of systemic resistance to pathogens protect cucumber and tobacco plants from damage caused by paraquat and cupric chloride. Phytopathology 1995; 85:1306–1310. Sun S, Wang H, Yu H, Zhong C, Zhang X, Peng J, Wang X. GASA14 regulates leaf expansion and abiotic stress resistance by modulating reactive oxygen species accumulation. J Exp Bot 2013; 64:1637–47.

k

k

k

5 Gibberellins and Abiotic Stress Tolerance

k

Sun TP. Gibberellin-GID1-DELLA: A pivotal regulatory module for plant growth and development. Plant Physiol 2010; 154:567–570. Sun TP, Kamiya Y. Regulation and cellular localization of ent-kaurene synthesis. Physiol Plant 1997; 101:701–708. Tani T, Sobajima H, Okada K, Chujo T, Arimura S, Tsutsumi N, et al. Identification of the OsOPR7 gene encoding 12-oxophytodienoate reductase involved in the biosynthesis of jasmonic acid in rice. Planta 2008; 227:517–526. Tudzynski B, Kawaide H, Kamiya Y. Gibberellin biosynthesis in Gibberella fujikuroi: cloning and characterization of the copalyl diphosphate synthase gene. Curr Genet 1998; 34:234–240. Turner JG, Ellis C, Devoto A. The jasmonate signal pathway. Plant Cell 2002; 14:S153–S164. Ueguchi-Tanaka M, Ashikari M, Nakajima M, Itoh H, Katoh E, Kobayashi M, et al. GIBBERELLIN INSENSITIVE DWARF1 encodes a soluble receptor for gibberellin. Nature 2005; 4376:693–698. Umezawa T, Sugiyama N, Mizoguchi M, Hayash S, Myouga F, Yamaguchi-Shinozaki K, et al. Type2 C-protein phosphatases directly regulate abscisic acid activated protein kinases in Arabidopsis. Proc Natl Acad Sci USA 2009; 106:17588–17593. Urrutia O, Hedden P, Rojas MC. Monooxygenases involved in GA12 and GA14 synthesis in Gibberella fujikuroi. Phytochemistry 2001; 56:505–511. Vartanian N, Marcotte L, Ciraudat J. Drought rhizogenesis in Arabidopsis thaliana. Differential responses of hormonal mutants. Plant Physiol 1994; 104:761–767. Vlad F, Rubio S, Rodrigues A, Sirichandra C, Belin C, Robert N, et al. Protein phosphatases 2C regulate the activation of the Snf1-related kinase OST1 by abscisic acid in Arabidopsis. Plant Cell 2009; 2:3170–3184. Vlot AC, Dempsey DMA, Klessig DF. Salicylic acid, a multifaceted hormone to combat disease. Annual Review of Phytopathology 2009; 47:177–206. Wang C, Yang A, Yin H, Zhang J. influence of water stress on endogenous hormone contents and cell damage of maize seedlings. J Integr. Plant Biol. 2008; 50:427–434. Wang W, Vinocur B, Altman A. Plant responses to drought, salinity and extreme temperatures: towards genetic engineering for stress tolerance. Planta 2003; 218:1–14. Wang Y, Mopper S, Hasenstein KH. Effects of salinity on endogenous ABA, IAA, JA, AND SA in Iris hexagona. J Chem Ecol 2001; 27:327–342. Wasternack C. Jasmonates: an update on biosynthesis, signal transduction and action in plant stress response, growth and development. Ann Bot 2007; 100:681–697. Weiner JJ, Peterson FC, Volkman BF, Cutler SR. Structural and functional in sights in to core ABA signaling. Curr Opin Plant Biol 2010; 13:495–502. Weiss D, Ori N. Mechanisms of cross talk between gibberellin and other hormones. Plant Physiol 2007; 144:1240–1246. Wigoda N, Ben-Nissan G, Granot D, Schwartz A, Weiss D. The gibberellin-induced, cysteine-rich protein GIP2 from Petunia hybrid exhibits in planta antioxidant activity. Plant J 2006; 48:796–805. Wild M, Davière JM, Cheminant S, Regnault T, Baumberger N, Heintz D, et al. The Arabidopsis DELLA RGA-LIKE3 is a direct target of MYC2 and modulates jasmonate signaling responses. Plant Cell 2012; 24:3307–3319. Willige BC, Isono E, Richter R, Zourelidou M, Schwechheimer C. Gibberellin regulates PIN-FORMED abundance and is required for auxin transport-dependent growth and development in Arabidopsis thaliana. Plant Cell 2011; 23:2184–2195.

k

125

k

k

126

k

Mechanism of Plant Hormone Signaling under Stress

Winkler RG, Freeling M. Physiological genetics of the dominant gibberellin-nonresponsive maize dwarfs, Dwarf8 and Dwarf9. Planta 1994; 193:341–348. Xu K, Xu X, Fukao T, Canlas P, Maghirang-Rodriguez R, et al. Sub1A is an ethyleneresponse-factor-like gene that confers submergence tolerance to rice. Nature 2006; 442:705–708. Yamaguchi S. Gibberellin metabolism and its regulation. Annu Rev Plant Biol 2008; 59:225–251. Yamaguchi S, Kamiya Y, Sun TP. Distinct cell-specific expression patterns of early and late gibberellin biosynthetic genes during Arabidopsis seed germination. Plant J. 2001; 28:443–453. Yan C, Yan Z, Wang Y, Yan X, Han Y. Tudor-SN, a component of stress granules, regulates growth under salt stress by modulating GA20ox3 mRNA levels in Arabidopsis. J Exp Bot 2014; 65:5933–5944. Yang DL, Yao J, Mei CS, Tong XH, Zeng LJ, Li Q, et al. Plant hormone jasmonate prioritizes defense over growth by interfering with gibberellin signaling cascade. Proc Natl Acad Sci USA 2012; 109:E1192–E1200. Yang SF, Hoffmann NE. Ethylene biosynthesis and its regulation in higher plants. Annu Rev Plant Physiol 1984; 35:155–189. Yang Y, Ma C, Xu Y, Wei Q, Imtiaz M, Lan H, et al. A zinc finger protein regulates flowering time and abiotic stress tolerance in chrysanthemum by modulating gibberellin biosynthesis. Plant Cell 2014; 26:2038–2054. Yang YN, Qi M, Mei CS. Endogenous salicylic acid protects rice plants from oxidative damage caused by aging as well as biotic and abiotic stress. Plant J 2004; 40:909–919. Ye H, Du H, Tang N, Li X, Xiong L. Identification and expression profiling analysis of TIFY family genes involved in stress and phytohormone responses in rice. Plant Mol Biol 2009; 71:291–305. Zentella R1, Zhang ZL, Park M, Thomas SG, Endo A, Murase K, et al. Global analysis of DELLA direct targets in early gibberellin signaling in Arabidopsis. Plant Cell 2007; 19:3037–3057. Zhang S, Wang X. Overexpression of GASA5 increases the sensitivity of Arabidopsis to heat stress. J Plant Physiol 2011; 168:2093–2101. Zhang S, Yang C, Peng J, Sun S, Wang X. GASA5 a regulator of flowering time and stem growth in Arabidopsis thaliana. Plant Mol Biol 2009; 69:745–759. Zhu JK. Salt and drought stress signal transduction in plants. Annu Rev Plant Biol 2002; 53:247.

k

k

k

127

6 The Crosstalk of GA and JA: A Fine-Tuning of the Balance of Plant Growth, Development, and Defense Yuge Li and Xingliang Hou Key Laboratory of South China Agricultural Plant Molecular Analysis and Genetic Improvement, South China Botanical Garden, Chinese Academy of Sciences, Guangzhou, China

6.1

k

Introduction

As sessile organisms, plants rely on a series of developmental adaptive mechanisms to respond to environmental challenges. Plant defense against pathogens and other biotic/abiotic stresses usually occurs at the expense of growth since input on resistance responses inevitably reduces resources needed for plant growth (Huot et al., 2014; Peleg and Blumwald, 2011). It is well-known that phytohormones play a fundamental role in the regulation of growth and defense during the whole life cycle of plants (Gimenez-Ibanez and Solano, 2013; Huot et al., 2014; Leone et al., 2014; Vanstraelen and Benkova, 2012). Although each of phytohormones regulates a different cellular process, the same biological processes are controlled by different phytohormones, suggesting cooperation and crosstalk among their signaling pathways (Vanstraelen and Benkova, 2012). By these sophisticated mutual interactions, phytohormone signaling not only orchestrates intrinsic developmental programs but also conveys environmental cues ensuring the survival when plants face adversity. Gibberellins (GAs) and jasmonates (JAs) are two major phytohormones that have various effects on a wide range of growth, development and defense processes in plants. GAs were first isolated from culture filtrates of the rice pathogen Gibberella fujikuroi (Kurosawa, 1926). The role of GA is crucial in all phases of the development cycle of angiosperms, from seed germination, vegetative growth, and flowering to seed set. JAs are naturally occurring regulators of higher plant development in response to external stimuli. JAs were first isolated from cultures of the fungus Lasiodiplodia theobromae (Demole et al., 1962). Numerous studies documented that JA plays a broader role in regulating the balance between growth- and defense-related processes, thereby optimizing plant fitness in rapidly changing environments. Here, we briefly review the recent progresses in growth and defense signaling pathways mediated by GA and JA, respectively, and their antagonistic and synergistic crosstalk in addressing the plant dilemma between “to grow” and “to defend” in response to various stimuli.

Mechanism of Plant Hormone Signaling under Stress, First Edition, Volume 1. Edited by Girdhar Pandey. © 2017 John Wiley & Sons, Inc. Published 2017 by John Wiley & Sons, Inc.

k

k

k

128

Mechanism of Plant Hormone Signaling under Stress

6.2

k

GA Pathway in Plants

GAs are a family of tetracyclic diterpenoid plant hormones that are involved in regulating the growth rate and differentiation of plant tissues or organs through affecting cell proliferation and expansion, which makes them one of the most important phytohormones in plants (Feng et al., 2008; Gallego-Bartolome et al., 2011; Lee et al., 2012; Tanimoto, 2012; Ubeda-Tomas et al., 2009; Yang et al., 1996). Previous studies have shown that GA promotes various transition processes during plant development, including seed germination, the juvenile-to-adult phase transition, and flowering control (Sun and Gubler, 2004). In addition, GA also plays central roles in regulating the response of plants to environmental stresses including salt, flooding, light, temperature, and pathogen attack (Achard et al., 2006, 2008; de Lucas et al., 2008; Djakovic-Petrovic et al., 2007; Feng et al., 2008; Fukao and Bailey-Serres, 2008; Stavang et al., 2009; Wild et al., 2012). Thus, the GA signaling pathway exerts pivotal functions in plants for development and adaptation through coordinating the events occurred during growth and defense responses. GA biosynthesis enzyme mutants show defects in growth and development that are rescued by GA application. For instance, the GA-deficient mutant ga1-3, which contains a deletion in GA1, an enzyme that catalyzes an early step in the synthesis of gibberellic acid, germinates only under exogenous GA application and exhibits retarded growth of shoots and roots, reduced apical dominance, and defects in flowering and floral organ development (Koornneef and van der Veen, 1980; Silverstone et al., 1997). Similar to ga1-3, the null mutants of GA3ox and GA20ox, encoding the enzymes functioning later in the GA biosynthesis pathway, exhibit dwarfism, infertility, and failure to mobilize stored reserves during seed germination through α-amylase induction (Hedden and Phillips, 2000; Plackett et al., 2012). Changes in GA3ox and GA20ox expression in response to environmental or developmental stimuli directly regulate GA accumulation (Gallego-Giraldo et al., 2008; Mitchum et al., 2006; Sakamoto et al., 2004). Notably, the endogenous bioactive GA level is determined not only by the synthesis but also the deactivation regulation involving in GA metabolism. For example, 2β-hydroxylation, a deactivation reaction of GA, is catalyzed by GA2ox, which is a class of 2-oxoglutarate–dependent dioxygenases (2ODDs). Loss-of-function in GA2ox gene presents extreme elongation and defects in pistil and fruit development (Schomburg et al., 2003). In contrast, overexpression of GA2ox increases GA turnover, leading to reduced grain germination and α-amylase induction in wheat (Appleford et al., 2007) and failures in seed development and pollen tube growth in Arabidopsis (Singh et al., 2002). In addition to the oxidation regulation pathway, methylation of GAs by GUANIDINOACETATE METHYLTRANSFERASE 1 (GAMT1) and GUANIDINOACETATE METHYLTRANSFERASE 2 (GAMT2) is another deactivation pathway found in Arabidopsis (Varbanova et al., 2007). Thus, GA biosynthesis and deactivation are tightly controlled in concert to fine-tune GA levels in different development stages. Three key GA signaling components in Arabidopsis have been identified: the GA receptors, GA INSENSITIVE DWARF1 (GID1); a group of repressors, DELLA proteins; and an F-box protein involved in protein degradation, SLEEPY1 (SLY1) (Dill et al., 2001; Griffiths et al., 2006; McGinnis et al., 2003; Murase et al., 2008). Among these three components, DELLAs act as the central repressors of GA pathway, while GA-GID1 complex promotes the interaction between DELLAs and SLY1, and triggers the

k

k

k

6 Crosstalk of GA and JA

k

degradation of DELLAs through the ubiquitin/26S proteasome-dependent proteolytic pathway (Dill et al., 2001; Griffiths et al., 2006; Murase et al., 2008; Shimada et al., 2008), thus promoting GA-responsive growth and development in plants. Because of the central role in GA signaling pathway, the molecular function of DELLA proteins has been well-characterized in numerous previous studies. There are five DELLA proteins, RGA, GAI, RGL1, RGL2, and RGL3, identified in Arabidopsis. These DELLA proteins play overlapping and distinct roles in regulating GA-mediated growth and adaptation to changing environments (Cheng et al., 2004; Dill and Sun, 2001; Fu and Harberd, 2003; Lee et al., 2002; Wen and Chang, 2002; Wild et al., 2012; Yu et al., 2004). GAI and RGA are negative regulators of GA responses in the control of stem elongation, flowering time, and root growth (Dill and Sun, 2001; Fu and Harberd, 2003), while RGL2 is major repressor of seed germination mediated by GA signaling (Lee et al., 2002). RGA and RGL2 play a dominant role in suppressing normal development of floral organs (Cheng et al., 2004; Hou et al., 2008; Yu et al., 2004), and RGL3 positively regulates JA-mediate resistance (Wild et al., 2012). Previous studies have demonstrated that DELLAs interact specifically with other protein partners to regulate the expression of GA-responsive genes in various developmental processes. For example, DELLAs interact with two bHLH-type transcriptional factors (TFs), PHYTOCHROME-INTERACTING FACTOR 3 and 4 (PIF3 and PIF4), thus preventing them from binding to the promoters of their target genes that are involved in light control of hypocotyl elongation (de Lucas et al., 2008; Feng et al., 2008). Another characterized protein–protein interaction includes the DELLA–JASMONATE-ZIM-DOMAIN PROTEIN (JAZ) interaction whereby DELLAs attenuate the inhibition of JAZs to JA positive regulator MYC2, and conversely JAZs attenuate the inhibition of DELLAs to PIFs (Hou et al., 2010; Yang et al., 2012). In addition, DELLAs have also been shown to interact with ALCATRAZ (ALC), another bHLH TF involved in fruit patterning, to define the separation layer of siliques, thus, impairing seed dispersal (Arnaud et al., 2010). Nevertheless, although large-scale studies have revealed a lot of genes that function downstream of DELLAs in the GA-signaling pathway, so far the information on how DELLAs regulate them is rather limited yet. As DELLAs do not contain a DNA-binding domain, further investigation in DELLA-interacting TFs is important for understanding the underlying mechanism of GA signaling pathway in various developmental processes.

6.3

JA Pathway in Plants

JAs are lipid-derived molecules that play a central role in regulating plant defense against necrotrophic pathogens and arthropod herbivores as well as plant responses to abiotic stresses, such as ozone and UV light (Balbi and Devoto, 2008; Browse, 2005; Browse and Howe, 2008; Kazan and Manners, 2008; Liechti et al., 2006; Staswick, 2008; Wasternack and Hause, 2013). A lot of studies have demonstrated that both induction of endogenous JA locally in response to pathogen infection or tissue damage and exogenous application of JA promote the expression of defense-related genes and thus enhancing the resistance of plants to stresses (Lorenzo and Solano, 2005; Wasternack and Hause, 2013). In addition, JA is also involved in diverse developmental processes including root growth inhibition (Sasaki-Sekimoto et al., 2013; Song et al., 2013), trichome formation

k

129

k

k

130

k

Mechanism of Plant Hormone Signaling under Stress

(Nakata et al., 2013), stamen development (Thines et al., 2013), chlorophyll loss (Fonseca et al., 2014), flowering control (Song et al., 2013), and anthocyanin accumulation (Li et al., 2014; Peng et al., 2011). JA biosynthesis is initiated with α-linolenic acid (α-LeA) as the substrate in chloroplast membranes (Gfeller et al., 2010; Hamberg and Gardner, 1992). Conversion of α-LeA into (+)-7-iso-JA is catalyzed consecutively by several enzymes, including lipoxygenase (LOX), allene oxide synthase (AOS), allene oxide cyclase (AOC), and 12-oxo-phytodienoic acid reductase (OPR), followed by three rounds of β-oxidation in the chloroplast and peroxisome (Wasternack and Hause, 2013). (+)-7-iso-JA is rapidly epimerized into the more stable epimer (−)-JA that can be further converted into a variety of derivatives in plants. Among these derivatives, jasmonoyl L-isoleucine (JA-Ile) conjugate has been suggested as the endogenous bioactive JA that promotes the physical interaction between CORONATINE INSENSITIVE 1 (COI1) and JASMONATE ZIM-domain 1 (JAZ1), two key regulatory proteins in the JA-signaling pathway (Fonseca et al., 2009; Katsir et al., 2008; Thines et al., 2007). The perception of JA is mediated by the JA co-receptor complex consisting of COI1, JAZ1, and their interacting co-factor, inositol pentakisphosphate (Sheard et al., 2010). COI1, a substrate-recruiting F-box protein, is the key regulator of the JA signaling pathway (Xie et al., 1998). Together with JAZ transcriptional repressors, COI1 functions as a JA-Ile receptor in the E3 ubiquitin-ligase Skip-Cullin-F-box complex SCFCOI1 (Sheard et al., 2010; Yan et al., 2009). Binding of JA-Ile to COI1 triggers the degradation of JAZs through the ubiquitin/26S proteasome (Chini et al., 2007; Katsir et al., 2008; Pauwels and Goossens, 2011; Thines et al., 2007; Yan et al., 2009). Recent studies show that JAZ proteins act as transcriptional repressors of JA signaling by interacting with positive transcriptional regulators, such as MYC2 (Chini et al., 2007; Fernandez-Calvo et al., 2011; Niu et al., 2011). In absence of bioactive JA, JAZs recruit general co-repressors TOPLESS (TPL) and TOPLESS-related (TRR) proteins through an EAR domain adaptor protein, Novel Interactor of JAZ (NINJA), thus, repressing MYC2 activation of JA-responsive gene expression (Pauwels et al., 2010). MYC2, and its closest homologs, MYC3 and MYC4, interact with most JAZ proteins with either overlapping or distinct function in regulating various JA-mediated responses, such as resistance to herbivores and inhibition of root growth (Cheng et al., 2011; Chini et al., 2007; Fernandez-Calvo et al., 2011; Niu et al., 2011). However, since loss-of-function mutants of these MYC genes do not show a complete loss of JA responses, there should be other TFs that also regulate JA responses downstream of JAZs. Indeed, JAZs have been reported to interact with other bHLH and MYB TFs, thus, mediating some JA-induced processes, such as anthocyanin accumulation, trichome initiation, and stamen development (Li et al., 2014; Qi et al., 2011, 2014; Song et al., 2011). In addition, JAZs also directly interact with other hormone signaling pathway TFs (Pauwels and Goossens, 2011). It has been reported that JAZs interact with ETHYLENE INSENSITIVE3 (EIN3)/EIN3-Like1 (EIL1), two primary TFs in the ethylene-signaling pathway, and recruit HISTONE DEACETYLASE 6 (HDAC6) as a co-repressor to repress the TF activity of EIN3 and EIL1 (Zhu et al., 2011). Notably, EIN3 and EIL1 also repress SALICYLIC ACID INDUCTION DEFICIENT 2 (SID2), a gene encoding an isochorismate synthase required for salicylic acid (SA) biosynthesis (Chen et al., 2009). These observations suggest a potential role of JAZ repressors in mediating the crosstalk among several different phytohormones that regulate plant responses to pathogens.

k

k

k

6 Crosstalk of GA and JA

131

Thus, with an increasing number of TFs and other proteins identified as binding targets of JAZs, JAZ repressors turn out to be main hubs for coordinating not only various JA downstream responses, but also the crosstalk between JA and other phytohormones.

6.4

k

GA Antagonizes JA-Mediated Defense

Crosstalk among plant hormones is a complicated and delicate regulatory system that facilitates the flexibility of plants for fine-tuning of genes expression regulation in response to developmental cues and environmental challenges. There are antagonistic roles between GA and JA depending on several processes in which these two plant hormones are involved. Consistent with the suggested role of DELLAs in integrating plant responses to various hormonal and environmental signals (Achard et al., 2003, 2006, 2008; Bai et al., 2012; Bolle, 2004; de Lucas et al., 2008; Feng et al., 2008; Fu and Harberd, 2003), some recent findings have revealed that GA signaling, which is negatively regulated by DELLAs, orchestrates growth and defense against biotic stresses through intensive interaction with the JA pathway (Cheng et al., 2009; Hou et al., 2010; Navarro et al., 2008; Wild et al., 2012; Yang et al., 2012). For example, in response to biotic stress, there are evidences to support a role of GA in compromising JA-mediated defense against necrotrophic pathogens. It has been shown that DELLAs contribute to JA perception and/or signaling and confer increased resistance to necrotrophs in infected Arabidopsis plants, whereas they attenuate SA signaling to make plants more vulnerable to biotrophs. The role of DELLAs in resistance to necrotrophs and susceptibility to biotrophs suggests that GA may mediate the balance of SA/JA responses via degradation of DELLAs (Navarro et al., 2008). Another piece of evidence also shows a similar GA-mediated SA-JA tradeoff in caterpillar herbivory resistance (Lan et al., 2014). Thus, DELLAs play a role in modulating the relative strength of JA and SA signaling in response to biotic stress. A “relief of repression” model has been proposed to describe how DELLAs affect JA signaling via competitive binding to JAZs (Hou et al., 2010) (Fig. 6.1/Plate 5). JA triggers destabilization of JAZs that physically interact with MYC2 and inhibit the activity of MYC2 as a transcriptional activator of JA signaling. Degradation of JAZ proteins releases MYC2 and activates the expression of JA-responsive genes (Fig. 6.1a). In the absence of GA, stabilized DELLAs compete with MYC2 for binding to JAZs, which in turn releases MYC2 to activate the expression of JA-responsive genes through MYC2 binding to G-box motifs. Increased GA levels trigger degradation of DELLAs and liberate JAZs to bind to MYC2, thus repressing MYC2 activity and attenuating JA signaling (Fig. 6.1b). Interestingly, the C-termini of JAZs containing the JA-associated (Jas) domain are indispensable for both the interactions between JAZs and DELLAs and between JAZs and MYC2 (Chini et al., 2007; Hou et al., 2010). In addition, the C-termini of JAZs are also necessary and sufficient for interaction of JAZs with COI1 and binding of virulence factor coronatine to the complexes (Katsir et al., 2008). These observations imply that the C-termini of JAZs may determine the interactions between JAZs and various partners under different biological contexts. Recent study has suggested that a DELLA protein, RGL3, positively regulates JA-mediated resistance to the necrotroph Botrytis cinerea and susceptibility to the hemibiotroph Pseudomonas syringae (Wild et al., 2012). Unlike other DELLAs, RGL3

k

k

k

132

Mechanism of Plant Hormone Signaling under Stress

(A)

–

JA

+

MYC2

26S proteasome

JAZ MYC2

JA JAZ

JA-responsive genes

JA-responsive genes

G-box

(B)

G-box

–

GA

+

JAZ

JAZ

26S proteasome

DELLA

JAZ

MYC2

GA DELLA

MYC2

JA-responsive genes

JA-responsive genes

k

G-box

G-box

Figure 6.1 (Plate 5) A dynamic “relief of repression” model illustrating the antagonistic effect between GA and JA on expression of JA-responsive genes via the DELLA-JAZ interaction (cited in Hou et al., 2013). (A) JA mediates the degradation of JAZ proteins that are key repressors of JA-induced gene expression. JAZs inhibit the activity of MYC2 as a transcriptional activator of JA signaling via direct interaction with MYC2 in the absence of JA. Elevated JA levels trigger destabilization of JAZs, thus releasing MYC2 to activate the expression of JA-responsive genes through its binding to G-box motifs. (B) GA fine-tunes plant response to JA through the interaction between DELLAs and JAZs in the presence of JA signals. Without GA, stabilized DELLAs bind to JAZs, which in turn release MYC2 to activate JA responsive genes. Elevated GA levels trigger degradation of DELLAs and liberate JAZs to interact with MYC2, thus repressing MYC2 activity. (See insert for color representation of this figure.)

mRNA expression is induced by JA in a MYC2-dependent manner, while the RGL3 protein interacts with JAZs. Thus, JA induces the accumulation of RGL3, which in turn interacts with JAZs and releases MYC2 to further enhance the expression of JA-responsive genes. This study establishes RGL3 as a unique GA repressor that enables plants to develop adaptive resistance to pathogens through regulating JA signaling. Therefore, DELLA proteins could contribute to JA responses not only through interacting with JAZs, but also through acting directly as JA-responsive regulators. This allows DELLAs to more effectively module JA signaling in response to both GA and JA signals. Although so far MYC2 is the only known effector acting immediately downstream of DELLA–JAZ interaction in the JA pathway, other transcription factors that are physically associated with JAZs, such as EIN3/EIL1 and other bHLH TFs, could

k

k

k

6 Crosstalk of GA and JA

JA

26S

JAZ

EIN3/ EIL1

k

GA

DELLA

MYB

MYC

WDrepeat complex

PIF

Biotic stress

Development

Growth

• • •

• •

• •

caterpillar herbivory necrotroph sesquiterpene production

133

trichome initiation stamen development

hypocotyl elongation root growth

Figure 6.2 (Plate 6) Interaction among DELLAs, JAZs, and TFs mediates the crosstalk between GA and JA signaling to balance plant growth, development and defense. DELLAs repress GA-mediated growth and development through direct interaction with TFs, such as PIFs or the WD-repeat complex. Similarly, JAZs suppress JA-mediated intrinsic or defense response through direct interactions with other TFs, such as MYBs, MYCs, or EIN3/EIL1. The DELLAs and JAZs inhibition of their mutual TF targets (e.g., MYC and WD-repeat complex) expression through direct protein binding confers the synergistic effect of GA and JA signaling on sesquiterpene biosynthesis and trichome initiation. Physical association and functional interaction among DELLAs, JAZs, and TFs tip the balance of growth, development, and defense in response to signals perceived by GA and JA pathways. (See insert for color representation of this figure.)

be similarly affected by DELLAs. Further investigation of the outcome of DELLA–JAZ interaction would shed more light on the impact of GA on JA signaling. It is noteworthy that GA treatment itself does not significantly affect the expression of JA-responsive genes (Hou et al., 2010; Navarro et al., 2008). Instead, the antagonistic effect of GA on JA signaling is only evident in a JA-dependent manner, implying that GA and DELLAs fine-tune JA sensitivity only when external cues trigger JA defense responses (Fig. 6.2/Plate 6). This prevents plants from wasting resource on stress responses under favorable growth conditions. On the other hand, when facing adverse conditions, the crosstalk between DELLAs and JAZs permits plants to quickly participate in adjusting stress responses in a manner that fits their growth status reflected by GA levels.

6.5 JA Inhibits GA-Mediated Growth The interaction between JAZs and DELLAs implies a possibility that degradation of JAZs by JA may also have an impact on the activity of DELLAs, thus affecting GA response in plants. To answer this question, several pieces of evidences have verified

k

k

k

134

k

Mechanism of Plant Hormone Signaling under Stress

that JA affects GA-mediated growth and developmental processes via binding to DELLAs (Fig. 6.2). A typical developmental process regulated by this interaction is light control of hypocotyl elongation. JA has been suggested to regulate photomorphogenesis through degradation of the JAZ1 protein (Robson et al., 2010; Zhai et al., 2007). Interestingly, the inhibitory effect of JA on hypocotyl elongation is partially impaired in DELLA quadruple mutants (gai-t6 rga-t2 rgl1-1 rgl2-1) and pif4 mutants (Hou et al., 2010), and completely lost in DELLA quintuple mutants (gai-t6 rga-t2 rgl1-1 rgl2-1 rgl3-1) (Yang et al., 2012). Together with the previous findings that DELLAs interact with PIF3 and PIF4 and block their transcriptional activity in activating cell elongation genes to suppress hypocotyl growth and reversely, GA triggers degradation of DELLAs, thus releasing PIFs to promote hypocotyl growth (de Lucas et al., 2008; Feng et al., 2008), these observations indicate that the interaction between JAZs and DELLAs may affect DELLA’s ability in modulating the activity of PIFs, thus conferring an antagonistic effect on photomorphogenesis by JA and GA signals. Further evidence shows that, similar to the DELLA’s role in impeding the JAZ–MYC interaction, JAZs also interfere in the DELLA–PIF interaction, thus mediating the inhibitory effect of JA on GA-mediated growth (Yang et al., 2012). In the presence of JA, JAZs are degraded to release DELLAs, which in turn interact with PIF3 and suppress GA-mediated plant growth. As a consequence, overexpression of PIF3 is able to partially overcome JA inhibition of hypocotyl growth. In addition to the expected outcome of JAZ–DELLA interaction, JA also negatively regulates GA response through modulating the levels of DELLA proteins in both Arabidopsis and rice (Yang et al., 2012). Thus, activation of JA signaling may inhibit GA-mediated growth through multiple mechanisms. Moreover, JA inhibits key enzymes in GA metabolic pathway to antagonize GA responses (Heinrich et al., 2013). In tobacco, silencing CDPK4 and CDPK5 function dramatically elevates JA levels and exhibits stunted stem elongation. In contrast, supplementation of GA obviously restores normal stem growth in CDPK4/5 silenced plants. Further findings support that JA antagonizes GA biosynthesis in stem through repressing the transcript accumulation of GA20ox and GA13ox, the key genes involved in GA production in tobacco (Heinrich et al., 2013). A recent study showed that light in low red: far red ratio induces DELLAs’ degradation and enhances the JAZs’ stability by inactivation of the photoreceptor phyB, the repressor of PIFs, resulting in shade-avoidance response of plants under deficient light condition (Leone et al., 2014). This finding indicates that the key roles of DELLAs and JAZs in growth regulation in response to various environment challenges, where plants fine-tune the dynamic balance of growth and defense for survival through the reconfiguration of their resource allocation strategy.

6.6

GA and JA Synergistically Mediate Plant Development

In contrast to their antagonistic roles in balancing plant growth and defense, GA and JA also exhibit synergistic effects on several development processes. For instance, both ga1-3 and opr3, which are GA- and JA-deficient mutants, respectively, display the male-sterile phenotype due to impaired filament elongation, reduced pollen viability,

k

k

k

6 Crosstalk of GA and JA

k

and defective anther dehiscence (Koornneef and van der Veen, 1980; Stintzi and Browse, 2000). This suggests that both GA and JA promote male organ development. A hierarchical relationship between GA and JA has been established in that GA modulates JA biosynthesis, thus influencing the expression and activity of JAZs’ interacting partners, MYB TFs, involved in normal stamen development in Arabidopsis (Cheng et al., 2009; Mandaokar et al., 2006; Song et al., 2011). GA suppresses DELLAs to upregulate the expression of two JA biosynthesis genes, DEFECTIVE IN ANTHER DEHISCENCE 1 (DAD1) and LIPOXYNENASE 1 (LOX1), which in turn promote JA biosynthesis and upregulate the expression of MYB21, MYB24, and MYB57 (Cheng et al., 2009). Among these three MYB TFs, MYB21 and MYB24 are verified to act as direct targets of JAZs to regulate JA-mediated stamen development. Their mRNA expression is induced by JA, while their protein activity is inhibited by direct interaction with JAZs (Mandaokar et al., 2006; Song et al., 2011). GA and JA pathways are also integrated to play a synergistic role in regulating the production of volatile terpenes, such as sesquiterpenes, which may function in plant–insect interactions, in Arabidopsis flowers (Hong et al., 2012). Both JAZs and DELLAs interact with MYC2 and prevent its binding to the promoters of two sesquiterpene synthase genes, TPS21 and TPS11, whereas JA and GA destabilize JAZs and DELLAs, respectively, thus, releasing MYC2 that in turn activates the expression of TPS21 and TPS11 involved in the production of sesquiterpenes (Hong et al., 2012). Since volatile terpenes play multiple roles in plants, such as attracting insects for pollination or defense against herbivores (Baldwin, 2010), the synergistic role of GA and JA in sesquiterpene production provides a unique perspective on the interaction between DELLAs and JAZs in coordinating development and defense response. This is different from the conventional view on their antagonistic effects on growth and defense. Furthermore, there is increasing evidence that GA and JA signaling synergistically controls trichome formation. Trichomes are the finely differentiated structures from epidermal cells in the aerial part of a plant and are particularly important for protecting plants from biotic attack, such as insects and herbivores, or abiotic damage, such as UV irradiation and excessive transpiration (Ishida et al., 2008; Wagner et al., 2004). Both GA- and JA-deficient mutants are almost glabrous, and exogenous application of GA and JA restores their trichome initiation (Perazza et al., 1998; Traw and Bergelson, 2003). A WD-repeat protein TRANSPARENT TESTA GLABRA1 (TTG1) and a bHLH TF GLABRA3 (GL3) act in concert with an R2R3-MYB TF GLABRA1 (GL1) to promote trichome initiation in response to JA in a dosage-dependent manner (Qi et al., 2011; Walker et al., 1999; Yoshida et al., 2009). The expression of GL1 and GL3 is regulated by a C2H2 zinc finger protein, ZFP5, in the GA signaling pathway (Zhou et al., 2011), indicating that GL1 and GL3 are convergent points that integrate GA and JA pathways in the control of trichome initiation. Correspondently, a recent study revealed that both DELLAs and JAZs interact with the WD-repeat/bHLH/MYB complex to mediate synergism between GA and JA signaling in regulating trichome development. JA and GA trigger the degradation of JAZs and DELLAs, thus releasing the WD-repeat/bHLH/MYB complex to initiate trichome formation (Qi et al., 2014).

k

135

k

k

136

Mechanism of Plant Hormone Signaling under Stress

6.7 Conclusions In past decades, it has been well-established that the phytohormones GA and JA play essential roles in whole life of plants. Recent studies revealed that there is a crosstalk between GA and JA in mediating the balance among plant growth, development, and defense through interaction between DELLAs and JAZs, the key repressors in both signaling pathways, respectively. The antagonistic or synergetic effect conferred by DELLAs and JAZs is mostly dependent on how they interact with each other to modulate the activity of their binding TFs, which in turn control other downstream effectors of GA and JA signaling (Fig. 6.2). Because DELLAs and JAZs serve as the regulatory hubs that mediate the processes involved in the signaling pathways of GA, JA, and other phytohormones, and GA or JA can rapidly release repression of DELLAs or JAZs to downstream genes expression by triggering these proteins degradation, it facilitates plants to flexibly reallocate their resources for growth, development or defense in response to various internal and external conditions. Crosstalk among phytohormones has been demonstrated to widely exist in plants, the sophisticated mechanisms of which still remain elusive. Further elucidation of molecular interactions among known key players and identification of novel components in phytohormone networks will extend our understanding on the mechanisms underlying the balance of growth, development, and defense in plants.

k

Acknowledgments

k

This work was supported by grants from the National Natural Science Foundation of China (No.31300239), and the “Hundred Talents” program of the Chinese Academy of Sciences. We apologize to all those colleagues whose excellent work could not be cited due to space limitations.

References Achard, P., Cheng, H., De Grauwe, L., Decat, J., Schoutteten, H., Moritz, T., et al. (2006) Integration of plant responses to environmentally activated phytohormonal signals. Science 311, 91–94. Achard, P., Gong, F., Cheminant, S., Alioua, M., Hedden, P. and Genschik, P. (2008) The cold-inducible CBF1 factor-dependent signaling pathway modulates the accumulation of the growth-repressing DELLA proteins via its effect on gibberellin metabolism. Plant Cell 20, 2117–2129. Achard, P., Vriezen, W.H., Van Der Straeten, D. and Harberd, N.P. (2003) Ethylene regulates Arabidopsis development via the modulation of DELLA protein growth repressor function. Plant Cell 15, 2816–2825. Appleford, N.E., Wilkinson, M.D., Ma, Q., Evans, D.J., Stone, M.C., Pearce, S.P., et al. (2007) Decreased shoot stature and grain alpha-amylase activity following ectopic expression of a gibberellin 2-oxidase gene in transgenic wheat. J Exp Bot 58, 3213–3226. Arnaud, N., Girin, T., Sorefan, K., Fuentes, S., Wood, T.A., Lawrenson, T., et al. (2010) Gibberellins control fruit patterning in Arabidopsis thaliana. Genes Dev 24, 2127–2132.

k

k

6 Crosstalk of GA and JA

k

Bai, M.Y., Shang, J.X., Oh, E., Fan, M., Bai, Y., Zentella, R., Sun, T.P. and Wang, Z.Y. (2012) Brassinosteroid, gibberellin and phytochrome impinge on a common transcription module in Arabidopsis. Nat Cell Biol 14, 810–817. Balbi, V. and Devoto, A. (2008) Jasmonate signalling network in Arabidopsis thaliana: crucial regulatory nodes and new physiological scenarios. New Phytol 177, 301–318. Baldwin, I.T. (2010) Plant volatiles. Curr Biol 20, R392–397. Bolle, C. (2004) The role of GRAS proteins in plant signal transduction and development. Planta 218, 683–692. Browse, J. (2005) Jasmonate: an oxylipin signal with many roles in plants. Vitam Horm 72, 431–456. Browse, J. and Howe, G.A. (2008) New weapons and a rapid response against insect attack. Plant Physiol 146, 832–838. Chen, H., Xue, L., Chintamanani, S., Germain, H., Lin, H., Cui, H., et al. (2009) ETHYLENE INSENSITIVE3 and ETHYLENE INSENSITIVE3-LIKE1 repress SALICYLIC ACID INDUCTION DEFICIENT2 expression to negatively regulate plant innate immunity in Arabidopsis. Plant Cell 21, 2527–2540. Cheng, H., Qin, L., Lee, S., Fu, X., Richards, D.E., Cao, D., et al. (2004) Gibberellin regulates Arabidopsis floral development via suppression of DELLA protein function. Development 131, 1055–1064. Cheng, H., Song, S., Xiao, L., Soo, H.M., Cheng, Z., Xie, D. and Peng, J. (2009) Gibberellin acts through jasmonate to control the expression of MYB21, MYB24, and MYB57 to promote stamen filament growth in Arabidopsis. PLoS Genet 5, e1000440. Cheng, Z., Sun, L., Qi, T., Zhang, B., Peng, W., Liu, Y. and Xie, D. (2011) The bHLH transcription factor MYC3 interacts with the Jasmonate ZIM-domain proteins to mediate jasmonate response in Arabidopsis. Mol Plant 4, 279–288. Chini, A., Fonseca, S., Fernandez, G., Adie, B., Chico, J.M., Lorenzo, O., et al. (2007) The JAZ family of repressors is the missing link in jasmonate signalling. Nature 448, 666–671. de Lucas, M., Daviere, J.M., Rodriguez-Falcon, M., Pontin, M., Iglesias-Pedraz, J.M., Lorrain, S., et al. (2008) A molecular framework for light and gibberellin control of cell elongation. Nature 451, 480–484. Demole, E., Lederer, E., and Mercier, D. (1962) Isolement et détermination de la structure du jasmonate de méthyle, constituant odorant caractéristique de l’essence de jasmin. Helvetica Chimica Acta, 45, 675–685. Dill, A., Jung, H.S. and Sun, T.P. (2001) The DELLA motif is essential for gibberellin-induced degradation of RGA. Proc Natl Acad Sci U S A 98, 14162–14167. Dill, A. and Sun, T. (2001) Synergistic derepression of gibberellin signaling by removing RGA and GAI function in Arabidopsis thaliana. Genetics 159, 777–785. Djakovic-Petrovic, T., de Wit, M., Voesenek, L.A. and Pierik, R. (2007) DELLA protein function in growth responses to canopy signals. Plant J 51, 117–126. Feng, S., Martinez, C., Gusmaroli, G., Wang, Y., Zhou, J., Wang, F., et al. (2008) Coordinated regulation of Arabidopsis thaliana development by light and gibberellins. Nature 451, 475–479. Fernandez-Calvo, P., Chini, A., Fernandez-Barbero, G., Chico, J.M., Gimenez-Ibanez, S., Geerinck, J., et al. (2011) The Arabidopsis bHLH transcription factors MYC3 and MYC4 are targets of JAZ repressors and act additively with MYC2 in the activation of jasmonate responses. Plant Cell 23, 701–715.

k

137

k

k

138

k

Mechanism of Plant Hormone Signaling under Stress

Fonseca, S., Chini, A., Hamberg, M., Adie, B., Porzel, A., Kramell, R., et al. (2009) (+)-7-iso-Jasmonoyl-L-isoleucine is the endogenous bioactive jasmonate. Nat Chem Biol 5, 344–350. Fonseca, S., Fernandez-Calvo, P., Fernandez, G.M., Diez-Diaz, M., Gimenez-Ibanez, S., Lopez-Vidriero, I., et al. (2014) bHLH003, bHLH013 and bHLH017 are new targets of JAZ repressors negatively regulating JA responses. PLoS One 9, e86182. Fu, X. and Harberd, N.P. (2003) Auxin promotes Arabidopsis root growth by modulating gibberellin response. Nature 421, 740–743. Fukao, T. and Bailey-Serres, J. (2008) Submergence tolerance conferred by Sub1A is mediated by SLR1 and SLRL1 restriction of gibberellin responses in rice. Proc Natl Acad Sci U S A 105, 16814–16819. Gallego-Bartolome, J., Arana, M.V., Vandenbussche, F., Zadnikova, P., Minguet, E.G., et al. (2011) Hierarchy of hormone action controlling apical hook development in Arabidopsis. Plant J 67, 622–634. Gallego-Giraldo, L., Ubeda-Tomas, S., Gisbert, C., Garcia-Martinez, J.L., Moritz, T. and Lopez-Diaz, I. (2008) Gibberellin homeostasis in tobacco is regulated by gibberellin metabolism genes with different gibberellin sensitivity. Plant Cell Physiol 49, 679–690. Gfeller, A., Dubugnon, L., Liechti, R. and Farmer, E.E. (2010) Jasmonate biochemical pathway. Sci Signal 3, cm3. Gimenez-Ibanez, S. and Solano, R. (2013) Nuclear jasmonate and salicylate signaling and crosstalk in defense against pathogens. Front Plant Sci 4, 72. Griffiths, J., Murase, K., Rieu, I., Zentella, R., Zhang, Z.L., Powers, S.J., et al. (2006) Genetic characterization and functional analysis of the GID1 gibberellin receptors in Arabidopsis. Plant Cell 18, 3399–3414. Hamberg, M. and Gardner, H.W. (1992) Oxylipin pathway to jasmonates: biochemistry and biological significance. Biochim Biophys Acta 1165, 1–18. Hedden, P. and Phillips, A.L. (2000) Gibberellin metabolism: new insights revealed by the genes. Trends Plant Sci 5, 523–530. Heinrich, M., Hettenhausen, C., Lange, T., Wunsche, H., Fang, J., Baldwin, I.T. and Wu, J. (2013) High levels of jasmonic acid antagonize the biosynthesis of gibberellins and inhibit the growth of Nicotiana attenuata stems. Plant J 73, 591–606. Hong, G.J., Xue, X.Y., Mao, Y.B., Wang, L.J. and Chen, X.Y. (2012) Arabidopsis MYC2 interacts with DELLA proteins in regulating sesquiterpene synthase gene expression. Plant Cell 24, 2635–2648. Hou, X., Ding, L. and Yu, H. (2013) Crosstalk between GA and JA signaling mediates plant growth and defense. Plant Cell Rep 32, 1067–1074. Hou, X., Hu, W.W., Shen, L., Lee, L.Y., Tao, Z., Han, J.H. and Yu, H. (2008) Global identification of DELLA target genes during Arabidopsis flower development. Plant Physiol 147, 1126–1142. Hou, X., Lee, L.Y., Xia, K., Yan, Y. and Yu, H. (2010) DELLAs modulate jasmonate signaling via competitive binding to JAZs. Dev Cell 19, 884–894. Huot, B., Yao, J., Montgomery, B.L. and He, S.Y. (2014) Growth-defense tradeoffs in plants: a balancing act to optimize fitness. Mol Plant 7, 1267–1287. Ishida, T., Kurata, T., Okada, K. and Wada, T. (2008) A genetic regulatory network in the development of trichomes and root hairs. Annu Rev Plant Biol 59, 365–386.

k

k

k

6 Crosstalk of GA and JA

k

Katsir, L., Schilmiller, A.L., Staswick, P.E., He, S.Y. and Howe, G.A. (2008) COI1 is a critical component of a receptor for jasmonate and the bacterial virulence factor coronatine. Proc Natl Acad Sci U S A 105, 7100–7105. Kazan, K. and Manners, J.M. (2008) Jasmonate signaling: toward an integrated view. Plant Physiol 146, 1459–1468. Koornneef, M. and van der Veen, J.H. (1980) Induction and analysis of gibberellin sensitive mutants in Arabidopsis thaliana (L.) Heynh. Theor Appl Genet 58, 257–263. Kurosawa, E. (1926) Experimental studies on the nature of the substance excreted by the “bakanae” fungus, in Japanse. Trans Nat Hist Soc Formosa 16, 213–227. Lan, Z., Krosse, S., Achard, P., van Dam, N.M. and Bede, J.C. (2014) DELLA proteins modulate Arabidopsis defences induced in response to caterpillar herbivory. J Exp Bot 65, 571–583. Lee, L.Y., Hou, X., Fang, L., Fan, S., Kumar, P.P. and Yu, H. (2012) STUNTED mediates the control of cell proliferation by GA in Arabidopsis. Development 139, 1568–1576. Lee, S., Cheng, H., King, K.E., Wang, W., He, Y., Hussain, A., Lo, J., Harberd, N.P. and Peng, J. (2002) Gibberellin regulates Arabidopsis seed germination via RGL2, a GAI/RGA-like gene whose expression is up-regulated following imbibition. Genes Dev 16, 646–658. Leone, M., Keller, M.M., Cerrudo, I. and Ballare, C.L. (2014) To grow or defend? Low red: far-red ratios reduce jasmonate sensitivity in Arabidopsis seedlings by promoting DELLA degradation and increasing JAZ10 stability. New Phytol 204, 355–367. Li, T., Jia, K.P., Lian, H.L., Yang, X., Li, L. and Yang, H.Q. (2014) Jasmonic acid enhancement of anthocyanin accumulation is dependent on phytochrome A signaling pathway under far-red light in Arabidopsis. Biochem Biophys Res Commun 454, 78–83. Liechti, R., Gfeller, A. and Farmer, E.E. (2006) Jasmonate signaling pathway. Sci STKE 2006, cm2. Lorenzo, O. and Solano, R. (2005) Molecular players regulating the jasmonate signalling network. Curr Opin Plant Biol 8, 532–540. Mandaokar, A., Thines, B., Shin, B., Lange, B.M., Choi, G., Koo, Y.J., et al. (2006) Transcriptional regulators of stamen development in Arabidopsis identified by transcriptional profiling. Plant J 46, 984–1008. McGinnis, K.M., Thomas, S.G., Soule, J.D., Strader, L.C., Zale, J.M., Sun, T.P. and Steber, C.M. (2003) The Arabidopsis SLEEPY1 gene encodes a putative F-box subunit of an SCF E3 ubiquitin ligase. Plant Cell 15, 1120–1130. Mitchum, M.G., Yamaguchi, S., Hanada, A., Kuwahara, A., Yoshioka, Y., Kato, T., et al. (2006) Distinct and overlapping roles of two gibberellin 3-oxidases in Arabidopsis development. Plant J 45, 804–818. Murase, K., Hirano, Y., Sun, T.P. and Hakoshima, T. (2008) Gibberellin-induced DELLA recognition by the gibberellin receptor GID1. Nature 456, 459–463. Nakata, M., Mitsuda, N., Herde, M., Koo, A.J., Moreno, J.E., Suzuki, K., et al. (2013) A bHLH-type transcription factor, ABA-INDUCIBLE BHLH-TYPE TRANSCRIPTION FACTOR/JA-ASSOCIATED MYC2-LIKE1, acts as a repressor to negatively regulate jasmonate signaling in Arabidopsis. Plant Cell 25, 1641–1656. Navarro, L., Bari, R., Achard, P., Lison, P., Nemri, A., Harberd, N.P. and Jones, J.D. (2008) DELLAs control plant immune responses by modulating the balance of jasmonic acid and salicylic acid signaling. Curr Biol 18, 650–655.

k

139

k

k

140

k

Mechanism of Plant Hormone Signaling under Stress

Niu, Y., Figueroa, P. and Browse, J. (2011) Characterization of JAZ-interacting bHLH transcription factors that regulate jasmonate responses in Arabidopsis. J Exp Bot 62, 2143–2154. Pauwels, L., Barbero, G.F., Geerinck, J., Tilleman, S., Grunewald, W., Perez, A.C., et al. (2010) NINJA connects the co-repressor TOPLESS to jasmonate signalling. Nature 464, 788–791. Pauwels, L. and Goossens, A. (2011) The JAZ proteins: a crucial interface in the jasmonate signaling cascade. Plant Cell 23, 3089–3100. Peleg, Z. and Blumwald, E. (2011) Hormone balance and abiotic stress tolerance in crop plants. Curr Opin Plant Biol 14, 290–295. Peng, Z., Han, C., Yuan, L., Zhang, K., Huang, H. and Ren, C. (2011) Brassinosteroid enhances jasmonate-induced anthocyanin accumulation in Arabidopsis seedlings. J Integr Plant Biol 53, 632–640. Perazza, D., Vachon, G. and Herzog, M. (1998) Gibberellins promote trichome formation by up-regulating GLABROUS1 in Arabidopsis. Plant Physiol 117, 375–383. Plackett, A.R., Powers, S.J., Fernandez-Garcia, N., Urbanova, T., Takebayashi, Y., Seo, M., et al. (2012) Analysis of the developmental roles of the Arabidopsis gibberellin 20-oxidases demonstrates that GA20ox1, -2, and -3 are the dominant paralogs. Plant Cell 24, 941–960. Qi, T., Huang, H., Wu, D., Yan, J., Qi, Y., Song, S. and Xie, D. (2014) Arabidopsis DELLA and JAZ proteins bind the WD-repeat/bHLH/MYB complex to modulate gibberellin and jasmonate signaling synergy. Plant Cell 26, 1118–1133. Qi, T., Song, S., Ren, Q., Wu, D., Huang, H., Chen, Y., et al. (2011) The Jasmonate-ZIM-domain proteins interact with the WD-Repeat/bHLH/MYB complexes to regulate Jasmonate-mediated anthocyanin accumulation and trichome initiation in Arabidopsis thaliana. Plant Cell 23, 1795–1814. Robson, F., Okamoto, H., Patrick, E., Harris, S.R., Wasternack, C., Brearley, C. and Turner, J.G. (2010) Jasmonate and phytochrome A signaling in Arabidopsis wound and shade responses are integrated through JAZ1 stability. Plant Cell 22, 1143–1160. Sakamoto, T., Miura, K., Itoh, H., Tatsumi, T., Ueguchi-Tanaka, M., Ishiyama, K., et al. (2004) An overview of gibberellin metabolism enzyme genes and their related mutants in rice. Plant Physiol 134, 1642–1653. Sasaki-Sekimoto, Y., Jikumaru, Y., Obayashi, T., Saito, H., Masuda, S., Kamiya, Y., et al. (2013) Basic helix-loop-helix transcription factors JASMONATE-ASSOCIATED MYC2-LIKE1 (JAM1), JAM2, and JAM3 are negative regulators of jasmonate responses in Arabidopsis. Plant Physiol 163, 291–304. Schomburg, F.M., Bizzell, C.M., Lee, D.J., Zeevaart, J.A. and Amasino, R.M. (2003) Overexpression of a novel class of gibberellin 2-oxidases decreases gibberellin levels and creates dwarf plants. Plant Cell 15, 151–163. Sheard, L.B., Tan, X., Mao, H., Withers, J., Ben-Nissan, G., Hinds, T.R., et al. (2010) Jasmonate perception by inositol-phosphate-potentiated COI1-JAZ co-receptor. Nature 468, 400–405. Shimada, A., Ueguchi-Tanaka, M., Nakatsu, T., Nakajima, M., Naoe, Y., Ohmiya, H., et al. (2008) Structural basis for gibberellin recognition by its receptor GID1. Nature 456, 520–523.

k

k

k

6 Crosstalk of GA and JA

k

Silverstone, A.L., Mak, P.Y., Martinez, E.C. and Sun, T.P. (1997) The new RGA locus encodes a negative regulator of gibberellin response in Arabidopsis thaliana. Genetics 146, 1087–1099. Singh, D.P., Jermakow, A.M. and Swain, S.M. (2002) Gibberellins are required for seed development and pollen tube growth in Arabidopsis. Plant Cell 14, 3133–3147. Song, S., Qi, T., Fan, M., Zhang, X., Gao, H., Huang, H., et al. (2013) The bHLH subgroup IIId factors negatively regulate jasmonate-mediated plant defense and development. PLoS Genet 9, e1003653. Song, S., Qi, T., Huang, H., Ren, Q., Wu, D., Chang, C., et al. (2011) The Jasmonate-ZIM domain proteins interact with the R2R3-MYB transcription factors MYB21 and MYB24 to affect Jasmonate-regulated stamen development in Arabidopsis. Plant Cell 23, 1000–1013. Staswick, P.E. (2008) JAZing up jasmonate signaling. Trends Plant Sci 13, 66–71. Stavang, J.A., Gallego-Bartolome, J., Gomez, M.D., Yoshida, S., Asami, T., Olsen, J.E., et al. (2009) Hormonal regulation of temperature-induced growth in Arabidopsis. Plant J 60, 589–601. Stintzi, A. and Browse, J. (2000) The Arabidopsis male-sterile mutant, opr3, lacks the 12-oxophytodienoic acid reductase required for jasmonate synthesis. Proc Natl Acad Sci U S A 97, 10625–10630. Sun, T.P. and Gubler, F. (2004) Molecular mechanism of gibberellin signaling in plants. Annu Rev Plant Biol 55, 197–223. Tanimoto, E. (2012) Tall or short? Slender or thick? A plant strategy for regulating elongation growth of roots by low concentrations of gibberellin. Ann Bot 110, 373–381. Thines, B., Katsir, L., Melotto, M., Niu, Y., Mandaokar, A., Liu, G., et al. (2007) JAZ repressor proteins are targets of the SCF(COI1) complex during jasmonate signalling. Nature 448, 661–665. Thines, B., Mandaokar, A. and Browse, J. (2013) Characterizing jasmonate regulation of male fertility in Arabidopsis. Methods Mol Biol 1011, 13–23. Traw, M.B. and Bergelson, J. (2003) Interactive effects of jasmonic acid, salicylic acid, and gibberellin on induction of trichomes in Arabidopsis. Plant Physiol 133, 1367–1375. Ubeda-Tomas, S., Federici, F., Casimiro, I., Beemster, G.T., Bhalerao, R., Swarup, R., et al. (2009) Gibberellin signaling in the endodermis controls Arabidopsis root meristem size. Curr Biol 19, 1194–1199. Vanstraelen, M. and Benkova, E. (2012) Hormonal interactions in the regulation of plant development. Annu Rev Cell Dev Biol 28, 463–487. Varbanova, M., Yamaguchi, S., Yang, Y., McKelvey, K., Hanada, A., Borochov, R., et al. (2007) Methylation of gibberellins by Arabidopsis GAMT1 and GAMT2. Plant Cell 19, 32–45. Wagner, G.J., Wang, E. and Shepherd, R.W. (2004) New approaches for studying and exploiting an old protuberance, the plant trichome. Ann Bot 93, 3–11. Walker, A.R., Davison, P.A., Bolognesi-Winfield, A.C., James, C.M., Srinivasan, N., Blundell, T.L., et al. (1999) The TRANSPARENT TESTA GLABRA1 locus, which regulates trichome differentiation and anthocyanin biosynthesis in Arabidopsis, encodes a WD40 repeat protein. Plant Cell 11, 1337–1350. Wasternack, C. and Hause, B. (2013) Jasmonates: biosynthesis, perception, signal transduction and action in plant stress response, growth and development. An update to the 2007 review in Annals of Botany. Ann Bot 111, 1021–1058.

k

141

k

k

142

k

Mechanism of Plant Hormone Signaling under Stress

Wen, C.K. and Chang, C. (2002) Arabidopsis RGL1 encodes a negative regulator of gibberellin responses. Plant Cell 14, 87–100. Wild, M., Daviere, J.M., Cheminant, S., Regnault, T., Baumberger, N., Heintz, D., et al. (2012) The Arabidopsis DELLA RGA-LIKE3 is a direct target of MYC2 and modulates jasmonate signaling responses. Plant Cell 24, 3307–3319. Xie, D.X., Feys, B.F., James, S., Nieto-Rostro, M. and Turner, J.G. (1998) COI1: An Arabidopsis gene required for jasmonate-regulated defense and fertility. Science 280, 1091–1094. Yan, J., Zhang, C., Gu, M., Bai, Z., Zhang, W., Qi, T., Cheng, Z., Peng, W., Luo, H., Nan, F., Wang, Z. and Xie, D. (2009) The Arabidopsis CORONATINE INSENSITIVE1 protein is a jasmonate receptor. Plant Cell 21, 2220–2236. Yang, D.L., Yao, J., Mei, C.S., Tong, X.H., Zeng, L.J., Li, Q., et al. (2012) Plant hormone jasmonate prioritizes defense over growth by interfering with gibberellin signaling cascade. Proc Natl Acad Sci U S A 109, E1192–1200. Yang, T., Davies, P.J. and Reid, J.B. (1996) Genetic dissection of the relative roles of auxin and gibberellin in the regulation of stem elongation in intact light-grown peas. Plant Physiol 110, 1029–1034. Yoshida, Y., Sano, R., Wada, T., Takabayashi, J. and Okada, K. (2009) Jasmonic acid control of GLABRA3 links inducible defense and trichome patterning in Arabidopsis. Development 136, 1039–1048. Yu, H., Ito, T., Zhao, Y., Peng, J., Kumar, P. and Meyerowitz, E.M. (2004) Floral homeotic genes are targets of gibberellin signaling in flower development. Proc Natl Acad Sci U S A 101, 7827–7832. Zhai, Q., Li, C.B., Zheng, W., Wu, X., Zhao, J., Zhou, G., et al. (2007) Phytochrome chromophore deficiency leads to overproduction of jasmonic acid and elevated expression of jasmonate-responsive genes in Arabidopsis. Plant Cell Physiol 48, 1061–1071. Zhou, Z., An, L., Sun, L., Zhu, S., Xi, W., Broun, P., Yu, H. and Gan, Y. (2011) Zinc finger protein5 is required for the control of trichome initiation by acting upstream of zinc finger protein8 in Arabidopsis. Plant Physiol 157, 673–682. Zhu, Z., An, F., Feng, Y., Li, P., Xue, L.A.M., Jiang, Z., et al. (2011) Derepression of ethylene-stabilized transcription factors (EIN3/EIL1) mediates jasmonate and ethylene signaling synergy in Arabidopsis. Proc Natl Acad Sci U S A 108, 12539–12544.

k

k

k

143

7 Jasmonate Signaling and Stress Management in Plants Sirhindi Geetika, Mushtaq Ruqia, Sharma Poonam, Kaur Harpreet, and Ahmad Mir Mudaser Department of Botany, Punjabi University, Patiala, India

7.1 Introduction

k

Jasmonates are group of highly diverse substances, which are formed from one of the off-shoots of the oxidation process of polyunsaturated fatty acids (PUFA). These include free jasmonic acid (JA), a methyl ester of JA (MeJA), an amino acid derivative of JA named jasmonyl isoleucine (JA-Ile), cis-jasmone, jasmonyl ACC (JA-ACC), and so on. Initially PUFA undergoes oxidation mainly by two process: (i) the α-DOXs (α-Dioxygenases) pathway and (ii) the LOX (Lipoxygenase) pathway. All these, the JA and its derivatives are naturally occurring plant growth regulators, which modulate growth and development of higher plants in response to external stimuli by regulating the cellular metabolic responses and nuclear gene expression regulation (Creelman and Mullet, 1995). Other than the previously mentioned derivatives of JA, some hydroxylated forms of JA have also found in plants such as tuberonic acid and cucurbic acid. JA and its derivatives are responsible for inducing genes of vegetative storage proteins (Vsp), phosphatases; Lipoxygenase; ethylene forming enzymes; large subunit of ribulose bis-phosphate carboxylase; proteinase inhibitor II; thionin – an antifungal protein; osmotin antifungal protein; chalcone synthase; phenylalanine ammonia lyase, and hydroxymethyl glutaryl CoA reductase. However, the role of most of the derivatives of JA found in plants is still unclear, but it has been proposed that tuberonic acid, which is a hydroxylated form of JA, is responsible for regulating tuber formation in many plants including the potato (Koda, 1992). The level of JA found in intact plants varies in different organs but the highest levels are reported in meristematic tissues, flowers, and reproductive tissues and the lowest levels have been reported in roots and mature leaves. Though the level of JA in various plant tissues varies depending on the function of tissue type, development stage and external signals also modulate the level of JA in tissues. In general, a concentration of JA estimated from different tissues of plants is less than 10 μM. Farmer and Ryan (1990) reported that nanomolar to micromolar concentrations of JA and/or MeJA induced changes in plant gene expressions. On other hand Reinbothe et al. (1993) stated that at concentrations of more than 50 μM, jasmonates induced senescence in plant cell cultures and excised leaves included loss Mechanism of Plant Hormone Signaling under Stress, First Edition, Volume 1. Edited by Girdhar Pandey. © 2017 John Wiley & Sons, Inc. Published 2017 by John Wiley & Sons, Inc.

k

k

k

144

Mechanism of Plant Hormone Signaling under Stress

of chlorophyll, degradation of chloroplast proteins such as ribulose bisphosphate carboxylase, and accumulation of new proteins.

7.2 JA Biosynthesis and Metabolic Fate

k

The pathway for jasmonate biosynthesis was first time described in Vicia faba by Vick and Zimmerman (1983). Hamberg and Gardner (1992) illustrated the structure of jasmonates, which is similar to mammalian eicosanoids, which are also derived from lipids through the action of lipoxygenase. The fatty acid substrate of JA biosynthesis is a-linolenic acid (18:3) (α-LeA) released by galactolipids of chloroplast membranes (Wasternack and Hause, 2013). It is generally accepted that a phospholipase1 (PLA1) releasing α-LeA from the sn1 position of galactolipids is responsible for generation of the JA substrate, whereas the large family of PLA2s are not involved in JA biosynthesis (Scherer et al., 2010). It was, however, a matter of debate as to which of the PLA1s are involved in JA biosynthesis. Upon oxygenation by a 13-lipoxygenase (13-LOX), the 13(S)-hydroperoxy octadecatrienoic acid (13(S)-HPOT) is converted to an epoxide by a 13-allene oxide synthase (AOS) and cyclized to the cyclopentenone (cis)-12-oxophytodienoic acid (OPDA) by an allene oxide cyclase (AOC) (Wasternack, 2007; Wasternack and Kombrink, 2010). In this step, the enantiomeric structure of the naturally occurring (+)-7-iso-JA [(3R, 7S)-JA] is established. All the enzymes involved in these steps of biosynthesis of JA as galactolipase, 13-LOX, AOS, and AOC are located in plastids. The subsequent reduction of the cyclopentenone ring by an OPDA reductase (OPR3) and three cycles of β-oxidation of the carboxylic acid side chain by fatty acid β-oxidation enzymes take place in peroxisomes. The final product (+)-7-iso-JA may equilibrate to the more stable (–)-JA [(3R, 7R)-JA]. Further conversion of JA includes variety of derivatives, such as methyl jasmonate (MeJA) and jasmonoyl-L-isoleucine (JAIle) (Browse, 2009; Wasternack and Hause, 2013: Fig. 7.1). Many of these derivatives, including MeJA and JA-Ile, have been shown to be biologically active (Wasternack, 2007). Mechanistic insights into catalysis of JA biosynthesis enzymes were found after crystallization of 13-LOX, 13-AOS, AOC, OPR3, and ACX1 (Wasternack and Kombrink, 2010). Mutants in JA biosynthesis and signaling have contributed, notably in elucidating jasmonate-dependent processes (Browse, 2009; Wasternack, 2006). Biosynthesis of JA is regulated by a positive feedback loop, substrate availability, and tissue specificity (Browse, 2009; Landgraf et al., 2012; Stenzel et al., 2003; Wasternack, 2007). Conversely, different branches of the LOX pathway through their concurrent action provide additional regulation to JA biosynthesis. Among the seven different branches known in the LOX pathway (Feussner and Wasternack, 2002), the AOS and HYDROPEROXIDE LYASE (HPL) reactions were reported to be concurrent on the same substrate, which was the product of a 13-LOX. The HPL branch of biosynthesis leads to the formation of volatile and non-volatile oxylipins, for example leaf aldehydes and leaf alcohols (Andreou et al., 2009: Fig. 7.2). Tong et al. (2012) affirmed that one of the three HPLs found in rice plants positively regulated the formation of green leafy volatiles (GLVs) but negatively regulated JA biosynthesis by substrate competition. Numerous studies have shown that JA formation took place very rapidly within some minutes after an external stimulus sensed by plants such as wounding (Glauser et al., 2008; Mielke et al., 2011). All biosynthetic enzymes analyzed so far involved in JA

k

k

k

HO OH

O O

O H

HO O

O

PLA1

CH2OH

13 COOH

dad1 α-LOA

O Galactolipids

13-LOX

OOH 13

O

COOH 13-HPOT

aos AOS

O

AOC

k

O

O 1** 1̍ O O O OH 6 ̍ O 1 ̍ O 3 1 O 1** HO OH O

COOH cts-(+)-OPDA

O

Arabidopsides

Plastid O

Peroxisome

OPR3 O

COOH

opr3 COOH

OPC-8

O

β-oxidation O

11 COOH

11

acx1 12

JAR1

jar1

NH O HO2C

12

coi1 myc2 Gene expression jai1

(+)–7-lso-JA-Be

(+)–7-lso-JA

Figure 7.1 Synthesis of jasmonic acid (JA)/JA-Ile from a-linolenic acid generated from galactolipids (Wasternack and Hause, 2013).

k

k

146

Mechanism of Plant Hormone Signaling under Stress

Figure 7.2 Overview of the oxylipin biosynthesis pathways in plants (Andreou et al., 2009).

PUFA (18:3 or 18:2)

α-DOX

LOX 2-hyroperoxy FA aldehydes

9- or 13-hydroperoxides reductase

AOS

DES

EAS Jasmonates (JAs)

LOX

epoxy-hydroxyFA keto-FA

hydroxy-FA

POX HPL

divinylether FA epoxy-hydroxy-FA leaf aldehydes leaf alcohols traumatin

k

biosynthesis as LOX, AOS, and AOC were found constitutively and abundantly in leaves after an external stimulus. Laudert et al. (2000) and Stenzel et al. (2003) affirmed that transgenic lines, which were consistently over-expressing AOS or AOC, did not show increase in JA levels in absence of any external stimuli, which clearly indicated that substrate availability is a regulatory factor of JA biosynthesis (Wasternack, 2007). A presumptive enzyme activity regulation in JA biosynthesis, however, is poorly understood. Another factor of regulation of JA biosynthesis was given by cell and tissue specific occurrence of JA biosynthetic enzymes (Hause et al., 2000), there by attributing to localized generation of JA, for example, during wounding (Koo et al., 2009). (+)-7-iso-JA (3R, 7S-JA) is the final product of JA biosynthetic pathway, the substrate of which is linolenic acid (Sembdner and Parthier, 1993). This final product is unstable and readily isomerizes to different stereoisomeric forms, which are thermodynamically favored products under normal conditions. JA also undergoes a series of modifications in its molecular structure leading to formation of a variety of metabolites in plants (Gfeller et al., 2010: Fig. 7.3). Through this series of conversions taking place in plants, JA can be converted into more than 30 distinct jasmonates, which are found ubiquitously in large numbers of plant species of Angiosperms, Gymnosperms, Pteridophytes, Algae (such Euglena, Spirulina, and Chiarella), and in red algae Gelidium. However, free JA, cis-jasmone, MeJA, and JA-Ile are the most effective bioactive forms of JA in plants (Fonseca et al., 2009).

7.3 JA Signaling Network The transition pathway involving transition of chemical signal of JA-Ile to biological signal was elucidated in recent years. The signaling process of JA responses initiates after the formation of ternary complex of SCFCOF1 -JA-Ile-JAZ in response to external stimuli (JAZ: jasmonate ZIM-domain protein; Sheard et al., 2010: Fig. 7.4/Plate 7). The repressors of JAZ then ubiquitously degraded to release various transcription factors, for example MYC2, responsible for different biological responses through downstream transcription activation of defense or developmental related processes (Chini et al., 2007; Thines et al., 2007).

k

k

k

O

O COOH

O

O

OPDA

OH

COOH

O

COOH GS

O

COOH OPDA-GSH 9,10-dJA

O

NH

O

HOOC

O NH

O

HOOC

OH

NH COOH

O

HOOC

8

11

12-HOJA

6

JA-IIe

12-HOJA-IIe

5

k

7 4 3

COOH 1

2

O OSO3H

JA COOH

O

12-SJA O

O

NH

JA-ACC

O

JA-Trp

k

12-HOOCJA-IIe

O

O

HOOC NH

HOOC

NH

O

OH

O

COO-β-gIc

COOMe

MeJA

OH

COOH

cJA

Figure 7.3 The metabolites produced from JA in plants (Gfeller et al., 2010).

k

OH 6-HOJA

COOH

11-HOJA

1-β-gIc-JA

k

148

Mechanism of Plant Hormone Signaling under Stress

Pathogen signals

Phytochrome signals COI 1 JAZ

UU

U

Mediator Complex

26S Proteasome

8

?

PFT1

MYC2/ activators

MED

RNA Pol II

enhancers

Flowering Genes (e.g. FT)

Fs

GT

gene

JA Genes (e.g. JAZ9, MYC2, JMT, PDF1.2 and THI)

Figure 7.4 (Plate 7) JA signaling regulation in response to external stimuli. (See insert for color representation of this figure.)

k

To date, only one receptor involved in JA signaling process has been identified, named the COI1 protein, and that too using only JA-Ile as a ligand of the SCFCOI1 E3 ubiquitin ligase complex (Katsir et al., 2008; Yan et al., 2009). JA as a signaling molecule interact with number of processes involved in regulating expression of various genes involved in growth and development and stress responses of plants. The ubiquitin-proteasome system is the central regulator for JA signaling, which consists of Skp1/Cullin/F-box (SCF) complex that functions as an E3 ubiquitin ligase, where the F-box protein recognizes a target protein, which is ubiquitinated and subsequently subjected to proteasomal degradation (Wasternack and Hause, 2013; Yan et al., 2013; Linkes and Leubner-Metzger, 2012: Fig. 7.5/Plate 8). In the last couple of years, several breakthroughs in this regard have improved our knowledge of JA signaling. Jasmonate-ZIM-domain (JAZ) proteins were discovered and Promoter JA-RE

ORF TS X

MYC2 JAZ

JAZ

SCFCOI1

Promoter JA-RE MYC2

RBX CUL1 COI1 ASK

active transcription

JA-lle

UQ UQ JAZ

ORF TS

JA JAZ

Proteasome

Figure 7.5 (Plate 8) JAZ repressor’s ubiquitinization and subsequent degradation to release transcription factor MYC2 (Linkis and Leubner-Metzger, 2011). (See insert for color representation of this figure.)

k

k

k

7 Jasmonate Signaling and Stress Management

JAZ12 JAZ11

149

JAZ1 JAZ2

JAZ10

JAZ3

JAZ9

Plant disease and immunity

JAZ4

JAZ8 JAZ5

JAZ7 JAZ6

Figure 7.6 Structure JAZ receptor protein involved in JA perception.

k

identified as repressors of JA-induced gene expression and, to date, about 12 JAZ proteins have been identified in Arabidopsis thaliana (Chini et al., 2007; Chung and Howe, 2009; Chung et al., 2009; Pauwels and Goossens, 2011; Thines et al., 2007; Yan et al., 2007; Wager and Browse, 2012: Fig. 7.6). COI1 (CORONATINE INSENSITIVE1 Protein) in Arabidopsis was identified as constituent of the Jasmonate co-receptor complex (Browse 2009; Xie et al., 1998; Yan et al., 2009), which belongs to the F-box protein family and acts as a JA receptor to initiate JA signaling (Katsir et al., 2008; Thines et al., 2007). Sheard et al. (2010) identified the COI1-JAZ co-receptor complex in crystallized form and was shown to be potentiated in jasmonate perception by inositol 5-phosphate. An adaptor protein “Novel Interactor of JAZ” (NINJA) was shown to connect the co-repressor TOPLESS (TPL) to JAZ proteins (Pauwels et al., 2010). Furthermore, while searching the JAZ targets, numerous new TFs (transcription factors) and JAZ interactors were discovered (Pauwels and Goossens, 2011; Wager and Browse, 2012). In Arabidopsis JA signaling, a model has been established by Browse and Howe (2008; Fig. 7.7/Plate 9). JA-Ile is the most bioactive jasmonate compound (Fonseca et al., 2009). Numerous other JA metabolites have been identified being formed by decarboxylation, glucosylation, or hydroxylation of the pentenyl side chain or by sulfation of the hydroxylated derivatives (Wasternack, 2007). Miersch et al. (2008) identified some of these compounds such as 12-OH-JA to be inactive, suggesting a switch off in JA signaling by metabolic conversion. However, the biological activity of these metabolites has been found in distinct developmental processes such as tuber formation and leaf movement (Nakamura et al., 2011; Wasternack and Hause, 2002). Laluk and Mengiste (2010) deliberated that JA signaling was effective against necrotrophic pathogens while McConn et al. (1997) and Puthoff and Smigocki (2007) affirmed that JA signaling pathway was involved in the induction of below-ground plant defenses. Activation of JA signaling by exogenous supply of methyl jasmonate-MeJA has also been shown to increase the release of signaling compounds, such as flavonoids and indoles from plant roots (Badri

k

k

k

150

Mechanism of Plant Hormone Signaling under Stress

A (Low level of JA signal)

B (High level of JA signal)

k

k

Figure 7.7 (Plate 9) Model of JA signaling in Arabidopsis (Browse and Howe, 2008). (See insert for color representation of this figure.)

et al., 2008; Buer et al., 2010; Bulgarelli et al., 2012; Faure et al., 2009; Hassan and Mathesius, 2012). Carvalhais et al. (2013) investigated the influence of the JA defense signaling pathway activation in Arabidopsis thaliana on the structure of associated rhizosphere bacterial communities using 16S rRNA gene amplicon pyrosequencing and the results suggested that JA signaling may mediate plant-bacteria interactions in the soil upon necrotrophic pathogen and herbivorous insect attacks. The evidence from molecular biology experiments demonstrated that JA is indispensable in plant defense responses and in many other aspects of plant growth and development (Shan et al., 2009; Scalschi et al., 2013) JA has become a major focus for plant hormone research in recent years (Thines et al., 2007; Chini et al., 2007; Spartz and Gray, 2008). Lee et al. (2013) concluded that the three OsCOIs in the genome of Oryza sativa are orthologues of the COI1 genome of Arabidopsis, which play key roles in JA signaling.

k

k

7 Jasmonate Signaling and Stress Management

151

7.4 Physiological Role of JAs 7.4.1 JA in Seed Germination

k

Germination has been defined as the emergence of the radicle beyond the seed coat (Bewley and Black, 1994; Bewley, 1997). Being a very sophisticated process, the control of seed germination requires the concerted action and interaction between diverse phytohormones (Kucera et al., 2005). The involvement of JA and its methyl ester-MeJA in seed germination is one of the long recognized effects of jasmonates. The inhibitory role of MeJA in germination and plant growth has been extensively reviewed in a number of plant species (Linkes and Leubner-Metzger, 2012). MeJA inhibited seed germination to significant levels in Amaranthus caudatus as compared to control seeds (Bialecka and Kepczynski, 2003; Kepczynski and Bialecka, 1994), cocklebur (Nojavan and Ishizawa, 1998), sunflower (Corbineau et al., 1988), tobacco (Preston et al., 2002), rapeseed, and flax (Wilen et al., 1994). Recent work with Arabidopsis thaliana mutants suggested the regulatory role of jasmonates during seed germination (Dave et al., 2011; Preston et al., 2009). Free JA, or its methyl ester MeJA, inhibited seed germination of Solanum lycopersicum (Miersch et al., 2008), Brassica napus (Oh et al., 2009), Linum usitatissimum (Wilen et al., 1991), and Lupinus luteus (Zalewski et al., 2010). Norastehnia et al. (2007) concluded that decreased α-amylase activity and/or concentration as well as reduced ethylene production played significant roles in the physiological and biochemical processes underlying the inhibited seed germination and root elongation in maize under conditions of increased MeJA concentrations. Methyl jasmonate (MeJA) inhibited germination of seeds of cocklebur, lettuce, sunflower, Amaranthus, Nicotiana attenuata, oat, wheat, rapeseed, and flax (Daletskaya and Sembdner, 1989; Krock et al., 2002; Preston et al., 2009), but it enhanced germination of a number of dormant seeds as in apple, pear, two species of Acer, and Douglas fir (Pseudotsuga menziesii) (Berestetsky et al., 1991; Daletskaya and Sembdner, 1989; Jarvis et al., 1997; Ranjan and Lewak 1992; Yildiz et al., 2007, 2008). Differences in results remain largely unexplained although use of very high amounts of jasmonate may be involved in inhibition of germination (Sembdner and Parthier, 1993). Dave et al. (2011) evidenced on the basis of genetic and biochemical studies that it was OPDA that is the inhibitory compound acting together with ABA in a COI1-independent manner. 7.4.2 JA in Root Growth

Role of free JA in root growth inhibition, lateral root, and adventitious root formation has been illustrated by number of workers and described that inhibition of root growth and promotion of senescence related mechanism were the first two physiological responses, which were regulated by free JA (Dathe et al., 1981; Ueda and Kato, 1980). Root growth inhibition was reported in Arabidopsis thaliana, Oryza sativa, Allium cepa, and Phaseolus coccineus by exogenous application of free JA or methylated form of JA (Maksymiec and Krupa, 2007; Staswick et al., 1992; Wang et al., 2002). The antagonistic role of JA on root growth in response to wounding has been reported; JA did not mediate systemic root growth responses to wounding in A. thaliana (Schmidt et al., 2010), but it has been found to participate in this response in Nicotiana attenuata (Hummel et al., 2007, 2009). Monzon et al. (2012) investigated the effect of JA on root architecture of Helianthus annuus seedlings and illustrated the interactive role of JA and auxins to

k

k

k

152

Mechanism of Plant Hormone Signaling under Stress

modulate root growth of the primary as well as lateral roots. Swiatek et al. (2003) indicated that exogenously applied JA acts as an inhibitor of cell elongation and cell division in tobacco cells and Arabidopsis roots, responsible for inhibition of root growth. These results demonstrated that JA is a potent hormone, apart from auxins, involved in the regulation of primary and lateral root growth and their distribution in sunflower. Similarly, in Arabidopsis and rice plants, number of lateral roots increased when treated with jasmonates (Sun et al., 2009; Wang et al., 2002), although variable responses were observed on lateral root development in rice plants depending on the root region analyzed. But the promotion of lateral root by JA might not be a general behavior and could depend on the hormonal balance characteristic of each plant species. Gutierrez et al. (2012) on the basis of signaling studies suggested that there is auxin-JA cross talk responsible for adventitious root formation which is negatively regulated by JA/JA-Ile. 7.4.3 JA in Tuber Formation

k

Tuber formation is a multifactorial controlled process, which is strictly controlled by photoperiod in potato as well as hormonal control (Sarkar, 2008). Wasternack and Hause (2002) reviewed jasmonate regulated tuber-induced activities in plants. Kolomiets et al. (2001) advocated involvement of StLOX-1 in tuber yield and tuber formation. Nam et al. (2008) demonstrated accumulation of LOX-derived metabolites such as JA, 12-OH-JA (TA) and its glucoside (TAG) at low temperature, which favored tuber formation. Occurrence of 12-OH-JA, 12-HSO4 -JA, and 12-O-Glc-JA in different non-tuber-bearing plant species argued against specific role of jasmonates in tuber formation. Tuber inducing factors might be controlled indirectly by expansion of cells in stolons, which is associated with changes in microtubule orientations and this is correlated with JA as biosynthesis of JA may occur in developing stolons (Abe et al., 1990; Cenzano et al., 2007; Takahashi et al., 1994). Jasmonates have been found to control the formation of bulb and tuber by stimulation of cell division and promotion of cell expansion (Castro et al., 1999; Koda 1997; Takahashi et al., 1995). JA and tuberonic acid were found to be the inducers of tuber formation in vitro (Koda et al., 1991; Pelacho and Mingo-Castel, 1991; Yoshihara et al., 1989), and JA induced swelling of tuber cells and a concomitant increase in sucrose content resembling the in vivo situation in developing tubers (Takahashi et al., 1995). Jackson and Willmitzer (1994) demonstrated that exogenous application of JA to the leaves of non-induced plants did not lead to tuber formation, which suggested that tuberization could be controlled at any of the steps in the putative conversion of JA to tuberonic acid. 7.4.4 JA in Trichome Development

Plants have epidermal appendages, known as trichomes, on their surfaces. Trichomes are defined as unicellular or multicellular protuberances extending from epidermal cells and have been divided into two types: glandular and nonglandular. They develop outward on the surface of plant organs and vary in size, shape, and location among plant species. The roles played by trichomes are diverse such as reflecting radiation, reducing leaf wetness, secreting substances, and protecting the plant from herbivores and pathogens (Levin, 1973; Wagner et al., 2004). Recent studies have indicated that exogenous jasmonates increase the trichome density in tomato and Arabidopsis (Traw and

k

k

k

7 Jasmonate Signaling and Stress Management

153

Bergelson, 2003; Boughton et al., 2005) and that endogenous jasmonates regulate trichome development in these species (Li et al., 2004; Yoshida et al., 2009). 7.4.5 JA in Flower and Seed Development

k

Free JA and its various conjugated forms were identified in flower and seed tissues as first JA and its methyl ester MeJA was identified as odorant constituents of flowers of Jasminum grandiflorum (Demole et al., 1962). Miersch, et al. (2008) observed 1.50–2.10 pmol g-1 FW of different jasmonate derivatives as OPDA, JA, 12-OH-JA, the sulfated derivative 12-HSO4 -JA and the glucoside 12-O-Glc-JA in green and white caryopses of Hordeum vulgare but was found to be 1.700–94.500 pmol g−1 FW in tassels, silks, and pollen in Zea mays. The pericarp of Glycine max and Vicia faba was also found to contain high levels, whereas in the pericarp of Cucumis sativus only residual amounts of these compounds were found. Goetz et al. (2012) revealed that it was occurrence of OPDA, compared to JA, which dominated during flower and seed development in tomato flowers and seeds. Oh et al. (2013) studied the regulatory role of Jasmonate ZIM domain protein NaJAZd in floral development of Nicotiana attenuata plants, which counteract with flower abscission. In this study they concluded that increased flower abscission in NaJAZd-silenced plants points to a novel function of JAZ proteins in plants. The absence of NaJAZd negatively affected the fitness of plants, which suggested that NaJAZd is required for a proper accumulation and/or maintenance of NaMYB305 (flower development gene) transcript levels in developing flowers, revealing a new function and requirement of NaMYB305 in flower retention during later stages of flowering that can optimize fitness and seed production in plants. Ochiai et al. (2013) noticed that MeJA treatment promoted flower opening of cut flower Eustoma by inducing proteins responsible for cell wall loosening in petals by accelerated expression of expansin and xyloglucan endotransglycosylase/hydrolase (XTH). 7.4.6 JA in Abscission and Senescence

Several researchers have reported that exogenous application of MeJA hastened abscission in crops such as citrus and tomato (Curtis 1984; Hartmond et al., 2000; Beno-Moualem et al., 2004; Agustı et al., 2008; Rohwer and Erwin, 2008). JA revealed the regulatory role in floral organ abscission in Arabidopsis thaliana (Kim et al., 2013) and many of these studies addressed the role of JA in combination with other compounds including silver nitrate, ethylene, and 1-MCP. Characterization of coi1-1 and a novel allele (coi1-37) has also revealed an essential role of JA in apical dominance and floral meristem arrest and provided genetic evidence, which indicated that the delayed abscission 4 (dab4-1) mutant is allelic to coi1-1 and that meristem arrest and apical dominance are evolutionarily divergent functions for COI1 that are governed in an ecotype-dependent manner. This study opens the door revealing new roles for JA and its interaction with other hormones during plant development. Leaf senescence is a complex developmental program that depends on light/dark conditions, nutrients, biotic and abiotic stresses, and several hormones including JA. Over the last few years, several reviews on leaf senescence in relation to JA have been published (Guo and Gan, 2012; Reinbothe et al., 2009; Zhang and Zhou, 2013). It has been reported that exogenous application of jasmonates induce senescence-like phenotypes such as yellowing of leaves and induction of senescence associated genes.

k

k

k

154

Mechanism of Plant Hormone Signaling under Stress

Jasmonates accumulate during natural and dark induced senescence but the increase in these compounds is not essential for the initiation or progression of these senescence processes. In a study on transgenic Arabidopsis LOX2RNAi lines, which did not accumulate JA and 12-oxo-phytodienoic acid (OPDA) during natural senescence or upon dark/sorbitol-induced senescence processes, it has been suggested that the rise in endogenous jasmonate levels was not necessary for the initiation or progression of leaf yellowing during aging or upon dark-induced senescence-like processes (Seltmann et al., 2010). Besseau et al. (2012) illustrated that the JA-linked TFs, namely WRKY53, WRKY54, and WRKY70, might have participated in regulatory network that integrated internal and environmental cues to modulate the onset and progression of leaf senescence, possibly through an interaction with WRKY30. Degradation of chlorophyll is the key mechanism operating during leaf senescence, which is controlled by the chlorophyllase enzyme, and it was demonstrated in Arabidopsis thaliana that the gene encoding CHLOROPHYLLASE1 was strongly induced by JA (Tsuchiya et al., 1999). 7.4.7 JA in Photosynthesis Regulation

k

Popova et al. (2003) studied changes in some photosynthetic and photorespiratory properties in barley leaves after treatment with JA. In this study the plants treated with JA showed a decrease in the rate of photosynthetic CO2 fixation and the activity of RuBP carboxylase. The negative role of JA on photosynthesis became obvious more than 20 years ago, when down-regulation of Rubisco activity by JA was identified (Weidhase et al., 1987). Rubisco activase was described as target of the COI1-dependent JA-induced reprogramming of gene expression (Shan et al., 2011; Walia et al., 2007). The inhibition of carboxylase activity of RuBISCO leads to decreased ratio of the carboxylase/oxygenase, which in turn decreases the photosynthetic efficiency of plants. Golovatskaya and Karnachuk (2008) studied the effect of JA on morphogenesis and photosynthetic pigment level in two types of Arabidopsis (Ler, the wild type, and hy4, a mutant) seedlings grown under green light intensity (8.1 and 18.1 W/m2 ) with or without 1 μM JA treatment. Treatment with JA in green light intensity caused retardation of hypocotyl and cotyledon growth of plants; however, stimulated the growth in hy4 plants. JA reduced the chlorophyll a and total carotenoid levels in cotyledons of Arabidopsis plants grown under green light. Sorial et al. (2010) studied the effect of exogenous application of JA on sweet basil in relation to different water supplies and concluded that JA caused increment in chlorophyll in basil plants. They found that JA treatment caused enhancement in the active cytokine (CK) that ultimately increased the chlorophyll pigments. Ataei et al. (2013) studied the growth and photosynthetic pigments of marigold (Calendula officinalis L.) under stress induced by JA and found that different concentrations of JA (0.75, 150 and 225 μM) effect flower diameter, number of flowers, dry flower weight, plant height, 1000-seed weight, and photosynthetic pigments. They found that with increase in concentration of JA, chlorophyll a increased and maximum chlorophyll a was obtained at 150 μM while chlorophyll b at 225 μM JA. Sharma et al. (2013) studied the effect of jasmonic acid on photosynthetic pigments and stress markers in Cajanus cajan (L.) Millsp. seedling under copper stress and suggested that priming of pigeon pea seeds with different concentrations of JA resulted in higher accumulation of total protein along with enhancement of light capturing capacity by more accumulation of total chlorophyll and carotenoids under normal environment as well as in presence of 5 mM

k

k

k

7 Jasmonate Signaling and Stress Management

155

Cu2+ solution and thus found that JA helped in neutralizing the diminishing effects of Cu2+ on seedlings. 7.4.8 JA in Secondary Metabolism

k

Jasmonates have been responsible for induction of gums in various species of stone fruit trees such as plum, peach, cherry, and apricot, as well as in tulips (Saniewski and Puchalski, 1988, Saniewski et al., 1998a, 2000, 2003; Ueda et al., 2003) and presence of ethylene along with MeJA intensified MeJA action in gummosis, and that both of them were implicated in the promotion of senescence (Saniewski et al., 1998b). However, the mechanism of JA-Me in the induction of gummosis, and its interaction with ethylene is still unknown. Skrzypek et al. (2005) also observed that gum formation in tulips affected by MeJA required changes in sugar metabolism, which strongly suggests that gum formation induced by the application of jasmonates in tulip shoots is connected with sugar metabolism. Guo et al. (2013) studied that Jasmonic acid and glucose synergistically modulated the accumulation of glucosinolates in Arabidopsis thaliana and concluded that, Glu-induced glucosinolate biosynthesis was enhanced by the addition of JA by enhancing the expression of genes involved in glucosinolate metabolism. These results indicated crosstalk between JA and Glu signaling in the regulation of glucosinolate biosynthesis. Originally, JAs were labelled as secondary metabolites present in the scent of jasmine flowers (Jasminum grandiflorum). Now it has become clear that they themselves act as elicitors of the production of secondary metabolites across the plant kingdom, from angiosperms to gymnosperms (Wasternack, 2007; Pauwels et al., 2009; Browse, 2009; Zhao et al., 2005) suggesting that the signaling machinery underlying JA-mediated secondary metabolite elicitation is conserved and that it was installed early in the higher plant lineage, which seems to be supported by the existence of a conserved module for JA perception and subsequent “primary” signal transduction (Browse, 2009; Pauwels and Goossens, 2011; Chini et al., 2009; Memelink, 2009). For several plant systems, exogenous application of MeJA ameliorated secondary metabolite production in vitro either alone or in combination with other elicitors (Curtin et al., 2003; Plata et al., 2003; Rudell and Mattheis 2008; Shimizu et al., 2010). Moreover, production of secondary metabolites can be enhanced in undifferentiated cells with elicitor treatment; for example, MeJA, SA, and chitosan (Namdeo, 2007). Broadly, three major classes of plant secondary metabolites can be defined: the terpenoids, alkaloids, and phenylpropanoids. JAs can induce the synthesis of molecules in all these classes (Pauwels, et al., 2009; Zhao, 2005). In addition, JAs can modulate particular primary metabolic pathways to supply connected secondary metabolite pathways with the necessary substrates (Pauwels et al., 2009; Spitzer-Rimo et al., 2010). Van der Fits and Memelink (2000) and Memelink et al. (2001) identified the first TFs involved in JA-dependent terpenoid indole alkaloid (TIA) synthesis in Catharanthus roseus and named them as OCTADECANOID DERIVATIVE RESPONSIVE CATHARANTHUS AP2-DOMAIN 2 and 3 (ORCA2 and ORCA3). The involvement of SCFCOI1 complex along with JAZ proteins and MYC2 is a common aspect underlying JA-mediated transcriptional control of secondary metabolite biosynthesis together with additional components, such as WRKYs, ORCAs, ERFs, MYBs, PAP1, and ZCTs, all of them being active in distinct pathways. Shoji et al. (2008) reported the transcriptional

k

k

k

156

Mechanism of Plant Hormone Signaling under Stress

regulatory role of JA on genes encoding enzymes for nicotine biosynthesis and these genes depend on functional COI1–JAZ co-receptor. Similarly, Todd et al. (2010) and Shoji and Hashimoto (2011), on the basis of genomic screening, identified bHLH TFs, such as MYC2, as playing a regulatory role in nicotine biosynthesis. Yu et al. (2012) concluded that two JA-responsive ERFs, namely ERF1 and ERF2, positively controlled the biosynthesis of antimalarial sesquiterpene lactone artemisinin, which act in a concerted manner with MYC2. Sønderby et al. (2010) suggested the inducible role of JA in glucosinolate metabolites. The main components of the JA/JA-Ile signaling pathway leading to glucosinolates and camalexin synthesis have been identified and for camalexin biosynthesis SCFCOI1 –JAZMYC2 has been identified and JA modulated camalexin formation by inducing expression of ANAC042 (De Geyter et al., 2012). Saga et al. (2012) observed that expression of ANAC042 was induced by flagellin, which depended on ethylene signaling but was repressed by the exogenous application of MeJA. Recent biochemical and genetical studies on anthocyanin synthesis and accumulation indicated that TFs involved in anthocyanin synthesis have been targeted by JAZs, thereby providing a mechanistic framework for JA-induced anthocyanin formation (Qi et al., 2011). Ram et al. (2013) investigated the effects of salicylic acid (SA) and methyl jasmonate (MeJA) on anthocyanin induction, accumulation of biomass, pigment content and pigment production in callus cultures of Rosa hybrida cv. Pusa Ajay and found positive effect of these treatments on both biomass and anthocyanin accumulation. k

7.5 JA Regulated Stress Responses 7.5.1 JA in Antioxidant Management and Reactive Oxygen Species Homeostasis

Pathogen attack or wounding or other abiotic factors that cross their permissible limits in plants growth environment lead to the generation of reactive oxygen species (ROS), including hydrogen peroxide (H2 O2 ), superoxide anions (O2− ), and hydroxyl free radicals (•OH) and these are also responsible for the induction of JA synthesis, which regulates a variety of plant developmental processes (Parra-Lobato et al., 2009). Plants possess antioxidant defense systems, consisting of enzymatic and non-enzymatic components, responsible for homeostasis of ROS within the cell. Non-enzymatic antioxidants include low molecular weight ascorbate and glutathione (GSH) and enzymatic antioxidants of SOD, CAT, POD, and APOX to scavenge different types of ROS (Jubany-Mari et al., 2010; Mittler, 2002; Menezes-Benavente et al., 2004). Popova et al. (2003) reported the accumulation of different isoforms of SOD, CAT and POX in barley plants after exogenous application of MeJA. Similar results were observed by Ayala-Zavala et al. (2005) in berries where MeJA treated berries showed highest antioxidant capacity as compared to untreated berries during postharvest period, which enable in ameliorating the shelf life of fruit. Kumari et al. (2006) reported Jasmonic acid induces changes in protein pattern, antioxidative enzyme activities and peroxidase isozymes in peanut seedlings and concluded that these seedlings when exposed to JA resulted in induction of pathogen related (PR) proteins along with increase in ammonia content, GS activity, and lipid peroxidation. Soares et al. (2010) studied the effect of methyl jasmonate on antioxidative enzyme activities and contents of ROS and H2 O2 in Ricinus communis leaves and

k

k

k

7 Jasmonate Signaling and Stress Management

157

found that CAT (catalase) and GPX (guaiacol peroxidise) acted transiently while SOD (superoxide dismutase) activity decreased and APX (ascorbate peroxidase) increased after treatment with MeJA. Manar et al. (2013) reported the enhancement in activity of antioxidative enzyme (SOD, CAT, and APX) under salt stress in plants treated with JA as compared to control untreated plants. 7.5.2 JA in Biotic Stress

k

Jasmonic acid (JA) is by far the most well studied phytohormone involved in herbivore-induced responses in plants (Balbi and Devoto, 2008; Ballare, 2011; Wasternack and Kombrink, 2010). The genes coding for enzymes involved in JA biosynthesis such as LOX2, AOS, OPLC1 were known to be upregulated when plants confronted wounding, herbivores, or necrotrophic pathogens (Ballare, 2011; Chini et al., 2007; De Vos et al., 2005; Glauser et al., 2008; Pauwels et al., 2009). The involvement of JA in reallocation of primary metabolites between roots and shoots was the signature of metabolic reprogramming needed to enhance plant tolerance to herbivory (Gomez et al., 2010; Henkes et al., 2008; Schwachtje et al., 2006). Erb et al. (2009) and Rasmann and Agrawal (2008) elaborated on the role of JA signaling pathway in local and systemic responses in roots against wounding. Tytgat et al. (2013) observed similar type of results in roots and shoots attacked by herbivores in Brassica oleracea and reported that root and shoot respond differently. They further added that application of JA mimicked herbivore attack in roots or shoots of Brassica oleracea on the basis of molecular and chemical studies. The role of JA in response to biotic stress caused by necrotrophic pathogens and herbivores has been reviewed by Pieterse et al. (2012) and Wasternack and Hause (2013). Li et al. (2004) demonstrated that JA signaling is must for defense in Solanum lycopersicum against Tetranychus urticae. 7.5.3 JA in Abiotic Stresses

Plant productivity and growth has been declined due to deterioration in number of environmental factors both on extreme low and/or high side, which have posed abiotic stress on plants. For example, heavy metal polluted soil induced lipid peroxidation, causing disintegration of plasma membrane and ultimately death of the plant. All abiotic factors such as light, temperature, UV-radiations, heavy metals, drought, flooding, and salinity when exceed some threshold value in the plant habitat lead to oxidative stress. Plants confronted with oxidative stress have shown imbalance in the cell homeostasis due to more production of reactive oxygen species than their mitigation. Numbers of research findings are available in literature showing the positive role of various plant growth regulators in making the plant more efficient in mitigating the detrimental effect of oxidative stress on growth, development and productivity. Jasmonates have been suggested to be involved in responses to abiotic stresses in Arabidopsis (Wang et al., 2001). The anti-stressor potential of free jasmonic acid and its different conjugates in salinity stress (Tsonev et al., 1998), UV irradiation (Mackerness et al., 1999), and low temperatures (Wilen et al., 1994) have been reported in plants, which led to the suggestion that jasmonate could mediate the defense response to various environmental stresses. However, the role of JA in heavy metal stress in plants is controversial as Maksymiec and Krupa (2007) who reported that methyl jasmonate

k

k

k

158

k

Mechanism of Plant Hormone Signaling under Stress

(MeJA) inhibited root growth in Phaseolus coccineus but in Allium cepa this inhibitory effect was not clear. Tao et al. (2011) have shown that JA treatment to Cu stressed plants induced expression of CaELIP (an early light-inducible protein gene), which regulated the level of ROS. Maksymiec et al. (2005) indicated in their study on Arabidopsis thaliana and Phaseolus coccineus plants grown in Cu and Cd heavy metal stress conditions, that JA is connected with the mechanism of toxic action of heavy metals in plant, which was not similar to the exogenous application of JA to plants under heavy metal stress. Exogenous application of different concentrations JA (10–6 , 10–9 , and 10–12 M) induced copper tolerance in Cajanus cajan seedlings by enhancing antioxidant enzyme activity and stress markers along with more accumulation of photosynthetic pigments thus made the plants more tolerant to Cu stress (Sharma et al., 2013). Increase in salinity of the soil is consequence of multifactorial phenomenons and increased drought condition is one such factor. It has been reported that in rice, both drought and high salinity stresses increased jasmonate levels in the leaves and roots and also increased the induction of genes responsible for JA biosynthesis (Moons et al., 1997; Tani et al., 2008). Ismail et al. (2012) suggested in their study on grape vines the involvement of jasmonate signaling pathway for modulating salt stress responses but in differential manner. Salt stress induced the transient upregulation of gene expression involved in JA biosynthesis in citrus plants, which reached to its maximum level after 6 h of stress (Mahouachi et al., 2007; Arbona and Gomez-Cadenas, 2008; Arbona et al., 2010). Shan and Liang (2010) also observed the induction of JA responsive genes in water stressed plants of Agropyron cristatum that lead to the regulation of ascorbate and glutathione metabolism and has an important role for acquisition of water stress tolerance in plants. Tsonev et al. (1998) demonstrated the adaptive role of JA in barley seedlings to salinity stress through improved growth and photosynthetic performance of the plants. Sheteawi (2007) also observed similar results of JA on growth, yield and metabolism of soybean (Glycine max L. cv. Giza 111) and concluded that application of JA to salinity stressed plants improved salt tolerance of soybean by enhancing the accumulation of nontoxic metabolites such as sugars, free proline, and proteins as well as accumulation of some micronutrients like N, P, and K as a protective adaptation. Rezai et al. (2013) observed that exogenous application of MeJA helped in mitigating the toxic effect of salt stress in pepper cv. “Green Hashemi.” Yoon et al. (2010) affirmed that there was no significant change in plant height of soybean grown under salinity stress by application of MeJA as compared to plants without MeJA treatment under salt stress. Salt stress induced generation of excessive reactive oxygen species (ROS) lead to cell toxicity, membrane dysfunction and cell death (Chookhampaeng, 2011). Plants have developed enzymatic and non-enzymatic mechanisms to scavenge ROS (Asada, 1999; Yasar et al., 2006). Among the active oxygen species, superoxide is converted by the SOD (superoxide dismutase) enzyme into H2 O2, which is further scavenged by CAT and APX. Manar et al. (2013) studied the effects of JA treatment on growth and some enzyme activities in eggplant embryos in vitro under salt stress conditions and avowed that JA primed embryos with 10 μM JA showed relatively better development under saline toxicity compared to those that had no prior treatment of JA. Kumari et al. (2006) reported that high level of salinity decreased the amount of chlorophyll pigments in pea plants to significant levels and application of MeJA increased content of chlorophyll a and b under salt stress. Wasternack and Hause (2002) demonstrated that application of MeJA in plants upregulated the expression

k

k

k

7 Jasmonate Signaling and Stress Management

159

of genes involved in chlorophyll synthesis. Jamalomidi et al. (2013) illustrated the enhanced photosynthetic pigments and protein contents in Cocker 347a cultivar of tobacco (Nicotine tabacum L.) under salinity stress after treatment of MeJA. However, interaction of salinity and MeJA reduced proline content but total carotenoids increased significantly thus adjusting the plants under salinity stress conditions.

7.6 Conclusion

k

Our understanding of the signaling pathways and factors involved in signaling of various derivatives of jasmonates to manage growth and developmental responses and the stress management during various stresses, plants exposed to, has increased substantially in last few years. Currently, only JA-Ile derivative of JA has been conclusively shown ligand like activity with JAZ receptor proteins. Many aspects of JA signaling were found to mimic with auxin signal transduction pathway. The various transcription factors like MYC2, MYC3, and MYC4 are the positive regulators of JA responses. In its higher level of concentration, JA promotes binding of JAZ receptor to SCFCOI1 protein to form reception complex triggering the subsequent ubiquitous degradation of JAZ repressors resulting in regulation of gene expressions involved in various plant activities. Recent studies exploring various aspects of JA regulated processes found a wide spectrum of JA responses in plants, including physiological and biochemical regulation of plant growth, and development and regulation of defense related responses through modulation of an antioxidant defense system during the biotic and abiotic stresses plants are exposed to by managing the ROS homeostasis of cell.

References Abe, M., Shibaoka, H., Yamane, Y. and Takahashi, N. (1990). Cell cycle-dependent disruption of microtubules by methyl jasmonate in tobacco Y-2 cells. Protoplasma, 156: 1–8. Agustı, J., Merelo, P., Cercos, M., Tadeo, R.F. and Talon, M. (2008). Ethylene-induced differential gene expression during abscission of citrus leaves. J. Exp. Bot., 59(10): 2717–2733. Andreou, A., Brodhun, F. and Feussner, I. (2009). Biosynthesis of oxylipins in nonmammals. Prog Lipid Res. 48(3–4): 148–170. Arbona, V. and Gomez-Cadenas, A. (2008). Hormonal modulation of Citrus responses to flooding. J. Plant Growth Regul., 27: 241–250. Arbona, V., Argamasilla, R. and Gomez-Cadenas, A. (2010). Common and divergent physiological, hormonal and metabolic responses of Arabidopsis thaliana and Thellungiella halophila to water and salt stress. J. Plant Physiol., 167: 1342–1350. Asada, K. (1999). The water-water cycle in chloroplasts: scavenging of active oxygens and dissipation of excess photons. Annual Review Plant Physiology & Plant Molecular Biology. 50: 601–639 Ataei, N., Moradi, H. and Akbarpour, V. (2013). Growth parameters and photosynthetic pigments of marigold under stress induced by jasmonic acid. Not. Sci. Biol., 5(4): 513–513.

k

k

k

160

k

Mechanism of Plant Hormone Signaling under Stress

Ayala-Zavala, J.F., Wang, S.Y., Wang, C.Y. and Gonzalez-Aguilar, G.A. (2005). Methyl jasmonate in conjunction with ethanol treatment increases antioxidant capacity, volatile compounds and postharvest life of strawberry fruit. Eur. Food Res. Technol., 221: 731–738. Badri, D.V., Loyola-Vargas, V.M., Du, J., Stermitz, F.R., Broeckling, C.D., Iglesias-Andreu, L. and Vivanco, J.M. (2008). Transcriptome analysis of Arabidopsis roots treated with signalling compounds: a focus on signal transduction, metabolic regulation and secretion. New Phytol., 179: 209–223. Balbi, V. and Devoto, A. (2008). Jasmonate signalling network in Arabidopsis thaliana: crucial regulatory nodes and new physiological scenarios. New Phytol., 177: 301–318. Ballare, C.L. (2011). Jasmonate-induced defenses: a tale of intelligence, collaborators and rascals. Trends Plant Sci., 16: 249–257. Beno-Moualem, D., Gusev, I., Dvir, O., Pesis, E., Mier, S. and Lichter, A. (2004). The effects of ethylene, methyl jasmonate and 1-MCP on abscission of cherry tomatoes from the bunch and expression of endo-1,4-β–glucanases. Plant Sci., 167: 499–507. Berestetsky, V., Dathe, W., Daletskaya, T., Musatenko, L., and Sembdner, G. (1991). Jasmonic acid in seed dormancy of Acer tataricum. Biochem. Physiol. Pflanzen., 187: 13–19. Besseau, S., Li, J. and Palva, E.T. (2012). WRKY54 and WRKY70 co-operate as negative regulators of leaf senescence in Arabidopsis thaliana. J. Exp. Bot., 63(7): 2667–2679. Bewley, D. (1997). Seed germination and dormancy. Plant Cell, 9: 1055–1066. Bewley, J.D. and Black, M. (1994). Seeds: Physiology of Development and Germination. New York, Plenum Press, pp. 445. Bialecka, B. and Kepczynski, J. (2003). Endogenous ethylene and reversing methyl jasmonate inhibition of Amaranthus caudatus seed germination by benzyladenine or gibberellin. Plant Growth Regul., 41: 7–12. Boughton, A.J., Hoover, K. and Felton, G.W. (2005). Methyl jasmonate application induces increased densities of glandular trichomes on tomato, Lycopersicon esculentum. J. Chem. Ecol., 31: 2211–2216. Browse, J. (2009). Jasmonate passes muster: a receptor and targets for the defense hormone. Annu. Rev. Plant Biol., 60: 183–205. Browse, J. and Howe, G.A. (2008). New weapons and a rapid response against insect attack. Plant Physiol., 146: 832–838. Buer, C.S., Imin, N. and Djordjevic, M.A. (2010). Flavonoids: New roles for old molecules. J. Integr. Plant Biol., 52: 98–111. Bulgarelli, D., Rott, M., Schlaeppi, K., Ver Loren van Themaat, E., Ahmadinejad, N., Assenza, F., et al. (2012). Revealing structure and assembly cues for Arabidopsis root-inhabiting bacterial microbiota. Natr., 488 (7409): 91–95. Carvalhais, L.C., Dennis, P.G., Badri, D.V., Tyson, G.W., Vivanco, J.M. and Schenk, P.M. (2013). Activation of the jasmonic acid plant defence pathway alters the composition of rhizosphere bacterial communities. PLoS One. 8: 1–5 Castro, G., Kraus, T. and Abdala, G. (1999). Endogenous jasmonic acid and radial cell expansion in buds of potato tubers. Journal of Plant Physiology 155: 706–710. Cenzano, A., Abdala, G. and Hause, B. (2007). Cytochemical immuno-localization of allene oxide cyclase, a jasmonic acid biosynthetic enzyme, in developing potato stolons. Journal of Plant Physiology 164: 1449–1456

k

k

k

7 Jasmonate Signaling and Stress Management

k

Chini, A., Boter, M. and Solano, R. (2009). Plant oxylipins: COI1/JAZs/MYC2 as the core jasmonic acid-signalling module. FEBS J., 276: 4682–4692. Chini, A., Fonseca, S., Fernandez, G., Adie, B., Chico, J.M., Lorenzo, O., et al. (2007). The JAZ family of repressors is the missing link in jasmonate signalling. Natur., 448: 666–671. Chookhampaeng, S. (2011). The effect of salt stress on growth, chlorophyll content proline content and antioxidative enzymes of pepper (Capsicum annuum L.) seedling. Eur. J. Sci. Res., 49: 103–109. Chung, H.S. and Howe, G.A. (2009). A critical role for the TIFY motif in repression of jasmonate signalling by a stabilized splice variant of the JASMONATE ZIM-domain protein JAZ10 in Arabidopsis. Plant Cell, 21: 131–145. Chung, H.S., Niu, Y., Browse, J. and Howe, G.A. (2009). Top hits in contemporary JAZ: an update on jasmonate signalling. Phytochemistry, 70: 1547–1559. Corbineau, F., Rudnicki, R.M. and Come, D. (1988). The effects of methyl jasmonate on sunflower (Helianthus annuus L.) seed germination and seedling development. Plant Growth Regul., 7: 157–169. Creelman, R.A. and Mullet, J.E. (1995). Jasmonic acid distribution and action in plants: regulation during development and response to biotic and abiotic stress. Proc. of the Natl. Acad. Sci., USA, 92: 4114–4119. Curtin, C., Zhang, W. and Franco, C. (2003). Manipulating anthocyanin composition in Vitis vinifera suspension cultures by elicitation with jasmonic acid and light irradiation. Biotechnol. Lett., 25: 1131–1135. Curtis, R.W. (1984). Abscission-inducing properties of methyl jasmonate, ABA, and ABA-methyl ester and their interactions with ethephon, AgNO3 , and malformin. J. Plant Growth Regul., 3: 157–168. Daletskaya, T. and Sembdner, G. (1989). Effect of jasmonic acid on germination of nondormant and dormant seeds (in Russian). Fiziol. Rast., 36: 1118–1123. Dathe, W., Ronsch, H., Preiss, A., Schade, W., Sembdner, G. and Schreiber, K. (1981). Endogenous plant hormones of the broad bean, Vicia faba L. (-) - jasmonic acid, a plant growth inhibitor in pericarp. Planta, 153: 530–535. Dave, A., Hernandez, M.L., He, Z., Andriotis V.M.E., Vaistij, F.E., Larson, T.R. and Graham, I.A. (2011). 12-oxo-phytodienoic acid accumulation during seed development represses seed germination in Arabidopsis. Plant Cell, 23(2): 583–599. De Geyter, N., Gholami, A., Goormachtig, S. and Goossens A. (2012). Transcriptional machineries in jasmonate-elicited plant secondary metabolism. Trends Plant Sci., 17: 349–359. De Vos, M., Van Oosten, V.R., Van Poecke. R.M.P., Van Pelt, J.A., Pozo, M.J., Mueller, M.J, et al. (2005). Signal signature and transcriptome changes of Arabidopsis during pathogen and insect attack. Mol. Plant Microbe. Interact., 18: 923–937. Demole, E., Lederer, E. and Mercier, D. (1962). Isolement et determination de la structure du jasmonate de methyle, constituent odorant caracteristique de l′ essence de jasmin. Helv. Chim. Acta., 45: 675–695. Erb, M., Lenk, C., Degenhardt, J. and Turlings, T.C.J. (2009). The under estimated role of roots in defense against leaf attackers. Trends Plant Sci., 14: 653–659. Farmer, E. E. and Ryan, C. A. (1990). Interplant communication: airborne methyl jasmonate induces synthesis of proteinase inhibitors in plant leaves. Proc. Natl. Acad. Sci., USA, 87: 7713–7716.

k

161

k

k

162

k

Mechanism of Plant Hormone Signaling under Stress

Faure, D., Vereecke, D. and Leveau, J.H.J. (2009). Molecular communication in the rhizosphere. Plant Soil, 321: 279–303. Feussner, I. and Wasternack, C. (2002). The lipoxygenase pathway. Annual Review in Plant Bio., 53: 275–297 Fonseca, S., Chini, A., Hamberg, M., Adie, B., Porzel, A., Kramell, R., et al. (2009). (+)-7iso-Jasmonoyl-L-isoleucine is the endogenous bioactive jasmonate. Nat. Chem. Biol., 5: 344–350. Gfeller, A., Liechti, R. and Farmer, E.E. (2010). Arabidopsis jasmonate signalling pathway. Science Signalling. 3(109): cm4. Glauser, G., Grata, E., Dubugnon, L., Rudaz, S., Farmer, E.E. and Wolfender, J.L. (2008). Spatial and temporal dynamics of jasmonate synthesis and accumulation in Arabidopsis in response to wounding. J. Biol. Chem., 283: 16400–16407. Goetz, S., Hellwege, A., Stenzel, I., Kutter, C., Hauptmann, V., Forner, S., et al. (2012). Role of cis-12-oxo phytodienoic acid in tomato embryo development, Plant Physiol., 158(4): 1715–1727. Golovatskaya, I.F. and Karnachuk, R.A. (2008). Effect of jasmonic acid on morphogenesis and photosynthetic pigment level in Arabidopsis Seedlings grown under green light 7. Russian J. Plant Physiol., 55(2): 220–224. Gomez, S., Ferrieri, R.A., Schueller, M. and Orians, C.M. (2010). Methyl jasmonate elicits rapid changes in carbon and nitrogen dynamics in tomato. New Phytol., 188: 835–844. Guo, R., Shen, W., Qian, H., Zhang, M., Liu, L. and Wang, Q. (2013). Jasmonic acid and glucose synergistically modulate the accumulation of glucosinolates in Arabidopsis thaliana. J. Exp. Bot., 22: 1–13. Guo, Y. and Gan, S.S. (2012). Convergence and divergence in gene expression profiles induced by leaf senescence and 27 senescence-promoting hormonal, pathological and environmental stress treatments. Plant Cell Environ., 35: 644–655. Gutierrez, L., Mongelard, G., Flokova, K., Pacurar, D.I., Novak, O., Staswick et al (2012). Auxin controls Arabidopsis adventitious root initiation by regulating jasmonic acid homeostasis. The Plant Cell. 24(6): 2515–2527. Hamberg, M. and Gardner, H.W. (1992). Oxylipin pathway to jasmonates: Biochemistry and biological significance. Biochim. Biophys. Acta., 1165: 1–18. Hartmond, U., Yuan, R., Burns, J.K., Grant, A. and Kender, W.J. (2000). Citrus fruit abscission induced by methyl-jasmonate. Journal of the American Society for Horticultural Science. 125: 547–552 Hassan, S. and Mathesius, U. (2012). The role of plant flavonoids in root-rhizosphere signalling: opportunities and challenges for improving plant-microbe interactions. J. Exp. Bot., 63: 3429–3444. Hause, B., Stenzel, I., Miersch, O., Maucher, H., Kramell, R., Ziegler, J. and Wasternack, C. (2000). Tissue-specific oxylipin signature of tomato flowers – allene oxide cyclise is highly expressed in distinct flower organs and vascular bundles. Plant J., 24: 113–126. Henkes, G.J., Thorpe, M.R., Minchin, P.E.H., Schur, U. and Rose, U.S.R. (2008). Jasmonic acid treatment to part of the root system is consistent with stimulated leaf herbivory diverting recently assimilated carbon towards untreated roots within an hour. Plant Cell & Environment 31: 1229–1236. Hummel, G.M., Naumann, M., Schurr, U. and Walter, A. (2007). Root growth dynamics of Nicotiana attenuata seedlings are affected by simulated herbivore attack. Plant Cell & Environment. 30: 1326–1336.

k

k

k

7 Jasmonate Signaling and Stress Management

k

Hummel, G.M., Schurr, U., Baldwin, I.T. and Walter, A. (2009). Herbivore-induced jasmonic acid bursts in leaves of Nicotiana attenuata mediate short-term reductions in root growth. Plant Cell Environment. 32: 134–143. Ismail, A., Riemann, M. and Nick, P. (2012). The jasmonate pathway mediates salt tolerance in grapevines. J. Exp. Bot., 63: 2127–2139. Jackson, S.D. and Willmitzer, L. (1994). Jasmonic acid spraying does not induce tuberization in short-day- requiring potato species kept in non- inducing condition. Planta, 194: 155–159. Jamalomidi, F., Sarmad, J. and Jamalomidi, M. (2013). Changes caused by methyl jasmonate in Cocker 347a cultivar of tobacco (Nicotine tabacum L.) under salinity stress International Res. J. App. Basic Sci., 4(5): 1139–1145. Jarvis, S.B., Taylor, M.A., MacLeod, M.R. and Davies, H.V. (1996). Cloning and characterisation of the cDNA clones of three genes that are differentially expressed during dormancy-breakage in the seeds of Douglas fir (Pseudotsuga menziesii). Journal of Plant Physiology. 147(5): 559–566. Jubany-Mari, T., Prinsen, E., Munne-Bosch, S. and Alegre, L. (2010). The timing of methyl jasmonate, hydrogen peroxide and ascorbate accumulation during water deficit and subsequent recovery in the Mediterranean shrub Cistus albidus L. Environ. Exp. Bot., 69: 47–55. Katsir, L., Schilmiller, A.L., Staswick, P.E., He, S.Y. and Howe, G.A. (2008). COI1 is a critical component of a receptor for jasmonate and the bacterial virulence factor coronatine. Proceedings of the National Academy of Sciences of the USA. 105: 7100–7105. Kepczynski, J. and Bialecka, B. (1994). Stimulatory effect of ethephon, ACC, gibberellin A-3 and A-4+7 on germination of methyl jasmonates inhibited Amaranthus caudatus L. seeds. Plant Growth Regul., 14(3): 211–216. Kim, Y., Park, S., Gilmour, S.J., and Thomashow, M.F. (2013). Roles of CAMTA transcription factors and salicylic acid in configuring the low temperature transcriptome and freezing tolerance of Arabidopsis. The Plant Journal. 75: 364–376. Koda, Y. (1992). The role of jasmonic acids and related compounds in the regulation of plant development. Int. Rev. Cytol., 135: 155–199. Koda, Y. (1997). Possible involvement of jasmonates in various morphogenic events. Physiol. Plant, 100: 639–646. Koda, Y., Kikuta, Y., Tazaki, H., Tsujino, Y., Sakamura, S., and Yoshihara, T. (1991). Potato tuber-inducing activities of jasmonic acid and related compounds. Phytochemistry, 30: 1435–1438. Kolomiets, M., Hannapel, D., Chen, H., Tymeson, M. and Gladon, R. (2001). Lipoxygenase is involved in the control of potato tuber development. Plant Cell, 13: 613–626. Koo, A.J.K., Gao, X., Jones, A.D. and Howe, G.A. (2009). A rapid wound signal activates the systemic synthesis of bioactive jasmonates in Arabidopsis. Plant J., 59: 974–986. Krock, B., Schmidt, B., Hertweck, C. and Baldwin, I. (2002). Vegetation derived abscisic acid and four terpenes enforce dormancy in seed of the post-fire annual Nicotiana attenuata. Seed Sci. Res., 12: 239–252. Kucera, B., Cohn, M.A. and Leubner-Metzger, G. (2005). Plant hormone interactions during seed dormancy release and germination. Seed Sci. Res., 15(04): 281–307. Kumari, G.J., Reddy, A.M., Naik, S.T., Kumar, S.G., Prasanthi, J., Sriranganayakulu, G., et al. (2006). Jasmonic acid induced changes in protein pattern, antioxidative enzyme activities and peroxidase isozymes in peanut seedlings. Biol. Plantarum, 50(2): 219–226.

k

163

k

k

164

k

Mechanism of Plant Hormone Signaling under Stress

Laluk, K. and Mengiste, T. (2010). Necrotroph attacks on plants: wanton destruction or covert extortion? Arabidopsis Book, 8: e0136. Landgraf, R., Schaarschmidt, S. and Hause, B. (2012). Repeated leaf wounding alters the colonization of Medicago truncatula roots by beneficial and pathogenic microorganisms. Plant, Cell & Environment. 35: 1344–1357. Laudert, D., Schaller, F. and Weiler, E. (2000). Transgenic Nicotiana tabacum and Arabidopsis thaliana plants overexpressing allene oxide synthase. Planta, 211: 163–165. Lee, H.Y., Seo, J.S., Cho, J.H., Jung, H., Kim, J.K., Lee, J.S., et al. (2013). Oryza sativa COI homologues restore jasmonate signal transduction in Arabidopsis coi1-1 mutants. Plos One, 8(1): e52802. Levin, D.A. (1973). The role of trichomes in plant defense. Q Rev. Biol., 48: 3–15. Li, L., Zhao, Y., McCaig, B.C., Wingerd, B.A., Wang, J., Whalon, M.E., et al. (2004). The tomato homolog of CORONATINE-INSENSITIVE 1 is required for the maternal control of seed maturation, jasmonate-signaled defense responses, and glandular trichome development. Plant Cell, 16: 126–143. Linkes, A. and Leubner-Metzger, G. (2012). Beyond gibberellins and abscisic acid: how ethylene and jasmonates control seed germination. Plant Cell Rep., 31: 253–270. Mackerness, S.A.H., Surplus, S.L., Blake, P., John, C.F., Buchanan-Wollastan, V., Jordan, B.R. and Thomas, B. (1999). Ultraviolet-B-induced stress and changes in gene expression in Arabidopsis thaliana: role of signalling pathways controlled by jasmonic acid, ethylene and reactive oxygen species. Plant Cell Environ., 22: 1413–1423. Mahouachi, J., Arbona, V. and Gomez-Cadenas, A. (2007). Hormonal changes in papaya seedlings subjected to progressive water stress and re-watering. Plant Growth Regul., 53: 43–51. Maksymiec, W. and Krupa, Z. (2007). Effects of methyl jasmonate and excess copper on root and leaf growth. Biol. Plantarum, 51:322–326. Maksymiec, W., Wianowska, D., Andrzej, L., Radkiewicz, D.S., Mardarowicz, M. and Krupa, Z. (2005). The level of jasmonic acid in Arabidopsis thaliana and Phaseolus coccineus plants under heavy metal stress. J. Plant Physiol., 162: 1338–1346. Manar, T., Banu, G., Fikret, Y., S¸ ebnem, K., Özlem, U. and S¸ ebnem, E. (2013). The effects of JA treatment on the growth and some enzyme activities of egg plant embryos grown in vitro under salt stress conditions. Res. J. Biotech., 8(12): 102. McConn, M., Creelman, R.A., Bell, E., Mullet, J.E. and Browse, J. (1997). Jasmonate is essential for insect defense in Arabidopsis. U.S.A, P. Natl. Acad. Sci., 94: 5473–5477. Memelink, J. (2009) Regulation of gene expression by jasmonate hormones. Phytochemistry, 70: 1560–1570. Memelink, J., Verpoorte, R. and Kijne, J.W. (2001). ORCAnization of jasmonate-responsive gene expression in alkaloid metabolism. Trends in Plant Sciences. 6: 212–219. Menezes-Benavente, L., Teixeira, F.K., Kamei, C.L.V. and Pinheiro, M.M. (2004). Salt stress induces altered expression of genes encoding antioxidant enzymes in seedlings of Brazilian indica rice (Oryza sativa L.). Plant Sci., 166: 323–331. Mielke, K., Forner, S., Kramell, R., Conrad, U. and Hause, B. (2011). Cell-specific visualization of jasmonates in wounded tomato and Arabidopsis leaves using jasmonate specific antibodies. Phytol., 190: 1069–1080. Miersch, O., Neumerkel, J., Dippe, M., Stenzel, I. and Wasternack, C. (2008). Hydroxylated jasmonates are commonly occurring metabolites of jasmonic acid and contribute to a partial switch-off in jasmonate signalling. New Phytol., 177: 114–127.

k

k

k

7 Jasmonate Signaling and Stress Management

k

Mittler, R. (2002). Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci., 7: 405–410. Monzón, G.C., Pinedo, M., Lamattina,L. and Canal, L.D. (2012). Sunflower root growth regulation: the role of jasmonic acid and its relation with auxins. Plant Growth Regul., 66: 129–136. Moons, A., Prinsen, E., Bauw, G. and Van Montagu, M. (1997). Antagonistic effects of abscisic acid and jasmonates on salt stress inducible transcripts in rice roots. Plant Cell, 9: 2243–2259. Nakamura, Y., Mithofer, A., Kombrink, E., Boland, W., Hamamoto, S., Uozumi, N., et al. (2011). 12-Hydroxyjasmonic acid glucoside is a COI1-JAZ-independent activator of leaf-closing movement in Samanea saman. Plant Physiol., 155: 1226–1236. Nam, K.H., Kong, F., Matsuura, H., Takahashi, K., Nabeta, K. and Yoshihara, T. (2008). Temperature regulates tuber-inducing lipoxygenase-derived metabolites in potato (Solanum tuberosum). J. Plant Physiol., 165: 233–238. Namdeo, A.G. (2007). Plant cell elicitation for production of secondary metabolites: a review. Pharmacogn Rev., 1: 69–79. Nojavan-Asghari, M. and Ishizava, K. (1998). Inhibitory effects of methyl jasmonate on the germination and ethylene production in cocklebur seeds. J. Plant Growth Regul., 17: 13–18. Norastehnia, A., Sajedi, R.H. and Nojavan-Asghari, M. (2007). Inhibitory effects of methyl jasmonate on seed germination in maize (Zea mays): effect on α-amylase activity and ethylene production. Gen. Appl. Plant Physiol., 33(1–2): 13–23. Ochiai, M., Matsumoto, S. and Yamada, K. (2013). Methyl jasmonate treatment promotes flower opening of cut Eustoma by inducing cell wall loosening proteins in petals. Postharvest boil. Technol., 82: 1–5. Oh, E., Kang, H., Yamaguchi, S., Park, J., Lee, D., Kamiya, Y. and Choi, G. (2009). Genome-wide analysis of genes targeted by PHYTOCHROME INTERACTING FACTOR 3-LIKE5 during seed germination in Arabidopsis. Plant Cell, 21(2): 403–419. Oh, Y., Baldwin, I.T. and Galis, I. (2013). A jasmonate ZIM-Domain Protein NaJAZd regulates floral jasmonic acid levels and counteracts flower abscission in Nicotiana attenuata plants. PLoS ONE, 8(2): e57868. doi:10.1371. Parra-Lobatoa, M.C., Fernandez-Garciab, N., Olmosb, E., Alvarez-Tinauta, M.C. and Gómez-Jiméneza, M.C. (2009). Methyl jasmonate-induced antioxidant defence in root apoplast from sunflower seedlings. Environ. Exp. Bot., 66: 9–17. Pauwels, L. and Goossens, A. (2011). The JAZ proteins: A crucial interface in the jasmonate signalling cascade. Plant Cell, 23: 3089–3100. Pauwels, L., Barbero, G.F., Geerinck, J., Tilleman, S., Grunewald, W., Perez, A.C., et al. (2010). NINJA connects the co-repressor TOPLESS to jasmonate signalling. Natur., 464: 788–791. Pauwels, L., Inze, D. and Goossens, A. (2009). Jasmonate-inducible gene: what does it mean? Trends Plant Sci., 14: 87–91. Pelacho, A.M. and Mingo-Castel, A.M. (1991). Jasmonic acid induces tuberization of potato stolons cultured in vitro. Plant Physiol., 97: 1253–1255. Pieterse, C.M.J., van der Does, D., Zamioudis, C., Leon-Reyes, A. and van Wees, S.C.M. (2012). Hormonal modulation of plant immunity. Ann. Rev. Cell Dev. Biol., 28: 489–521.

k

165

k

k

166

k

Mechanism of Plant Hormone Signaling under Stress

Plata, N., Konczak-Islam, I., Jayram, S., McCelland, K., Woolford, T. and Franks, P. (2003). Effect of methyl jasmonate and p-coumaric acid on anthocyanin composition in a sweet potato cell suspension culture. Biochem. Eng. J., 14: 171–177. Popova, L., Ananieva, E., Hristova, V., Christov, K., Georgieva, K., Alexieva, V. and Stoinova, Z.H. (2003). Salicylic acid and methyl jasmonate-induced protection on photosynthesis to paraquat oxidative stress. Bulg. J. Plant Physiol., pp. 133–152. Preston, C.A., Betts, H. and Baldwin, I.T. (2002). Methyl jasmonate as an allelopathic agent: sagebrush inhibits germination of a neighboring tobacco, Nicotiana attenuata. J. Chem. Ecol., 28: 2343–2369. Preston, J., Tatematsu, K., Kanno, Y., Hobo, T., Kimura, M., Jikumaru, Y., et al. (2009). Temporal expression patterns of hormone metabolism genes during imbibition of Arabidopsis thaliana seeds: a comparative study on dormant and non-dormant accessions. Plant Cell Physiol., 50: 1786–1800. Puthoff, D.P. and Smigocki, A.C. (2007). Insect feeding-induced differential expression of Beta vulgaris root genes and their regulation by defense-associated signals. Plant Cell Rep., 26: 71–84. Qi, T., Song, S., Ren, Q., Yu, D., Huang, H., Chen, Y., et al. (2011). The jasmonate-ZIM-domain proteins interact with the WD- Repeat/bHLH/MYB complexes to regulate jasmonate mediated anthocyanin accumulation and trichome initiation in Arabidopsis thaliana. Plant Cell, 23: 1795–1814. Ram, M., Prasad, K.V., Singh, S.K., Hada, B.S. and Kumar, S. (2013). Influence of salicylic acid and methyl jasmonate elicitation on anthocyanin production in callus cultures of Rosa hybrida L. Plant Cell Tiss. Organ. Cult., 113: 459–467. Ranjan, R. and Lewak, S. (1992). Jasmonic acid promotes germination and lipase activity in non-stratified apple embryos. Physiol. Plant, 86: 335–339. Rasmann, S. and Agrawal, A.A. (2008). In defense of roots: A research agenda for studying plant resistance to below ground herbivory. Plant Physiol., 146: 875–880. Reinbothe, C., Springer, A., Samol, I. and Reinbothe, S. (2009). Plant oxylipins: role of jasmonic acid during programmed cell death, defence and leaf senescence. FEBS. J., 276: 4666–4681. Reinbothe, S., Reinbothe, C., Heintzen, C., Seidenbecher, C. and Parthier, B. (1993). A methyl jasmonate induced shift in the length of 5′ untranslated region impaires translation of the plastid rbcL transcript in barley. EMBO J., 12: 1505–1512. Rezai, S., Orojloo, M., Bidabadi, S.S. and Soleimanzadeh, M. (2013). Possible role of methyl jasmonate in protection to NaCl–induced salt stress in pepper cv. “Green Hashemi. Intl. J. Agri. Crop Sci., 6(17): 1235–1238. Rohwer, C. and Erwin, J.E. (2008). Horticultural applications of jasmonates: J. Horticultural Sci. Biotechnol., 83 (3): 283–304. Rudell, D.R. and Mattheis, J.P. (2008). Synergism exists between ethylene and methyl jasmonate in artificial light-induced pigment enhancement of “Fuji” apple fruit peel. Postharvest Biol. Technol., 47: 136–140. Saga, H., Ogawa, T, Kai, K., Suzuki, H., Ogata, Y., Sakurai, N., et al. (2012). Identification and characterization of ANAC042, a transcription factor family gene involved in the regulation of camalexin biosynthesis in Arabidopsis. Mol. Plant–Microbe Interact., 25(5): 684–696. Saniewski, M. and Puchatski, J. (1988). The induction of gum formation in the leaf, stem and bulb by methyl jasmonate in tulips. Bull. Pol. Acad. Sci. Biol. Sci., 36: 35–38.

k

k

k

7 Jasmonate Signaling and Stress Management

k

Saniewski, M., Horbowicz, M., Puchalski, J. and Ueda J. (2003). Methyl jasmonate stimulates the formation and the accumulation of anthocyanin in Kalanchoe blossfeldiana. Acta Physiol. Plant., 25: 143–149. Saniewski, M., Miszczak, A., Kawa-Miszczak, L., Wegrzynowicz-Lesiak, E., Miyamoto, K. and Ueda, J. (1998b). Effect of methyl jasmonate on anthocyanin accumulation, ethylene production, and CO2 evolution in cooled and uncooled tulip bulbs. J. Plant Growth Regul., 17: 33–37. Saniewski, M., Miyamoto, K. and Ueda, J. (1998a). Methyl jasmonate induces gums and stimulates anthocyanin accumulation in peach shoot. J. Plant Growth Regul., 17: 121–124. Saniewski, M., Ueda, J. and Miyamoto, K. (2000). Gum induction by methyl jasmonate in tulip stem: relevance to its chemical composition. Acta. Hort., 515: 39–48. Sarkar, D. (2008). The signal transduction pathways controlling in planta tuberization in potato: an emerging synthesis. Plant Cell Reports, 27: 1–8. Scalschi, L., Vicedo, B., Camañes, G., Fernandez-Crespo, E., Lapeña, L., González-Bosch, C. and García-Aqustín, P. (2013). Hexanoic acid is a resistance inducer that protects tomato plants against Pseudomonas syringae by priming the jasmonic acid and salicylic acid pathways. Mol. Plant Pathol., 14: 342–355. Scherer, G.F.E., Ryu, S.B., Wang, X., Matos, A.R. and Heitz, T. (2010). Patatin-related phospholipase A: nomenclature, subfamilies and functions in plants. Trends Plant Sci., 15: 693–700. Schmidt, L., Hummel, G.M., Schöttner, M., Schurr, U. and Walter, A. (2010). Jasmonic acid does not mediate root growth responses to wounding in Arabidopsis thaliana. Plant Cell Environ., 33: 104–116. Schwachtje, J., Minchin, P.E.H., Jahnke, S., van Dongen, J.T., Schittko, U. and Baldwin, I.T. (2006). SNF1-related kinases allow plants to tolerate herbivory by allocating carbon to roots. Proc. Natl. Acad. Sci. USA, 103: 12935–12940. Seltmann, M.A., Sting, I.N.E., Lautenschlaeger, J.K., Krischke, M., Mueller, M.J. and Berger, S. (2010). Differential impact of lipoxygenase 2 and jasmonates on natural and stress-induced senescence in Arabidopsis. Plant Physiol., 152: 1940–1950. Sembdner, G. and Parthier, B. (1993). The biochemistry and the physiology and molecular actions of jasmonates. Annu. Rev. Plant Physiol. Mol. Biol., 44: 569–589. Shan, C. and Liang, Z. (2010). Jasmonic acid regulates ascorbate and glutathione metabolism in Agropyron cristatum leaves under water stress. Plant Sci., 178: 130–139. Shan, X., Wang, J., Chua, L., Jiang, D., Peng, W. and Xie, D. (2011). The role of Arabidopsis rubisco activase in jasmonate-induced leaf senescence. Plant Physiol., 155: 751–764. Shan, X., Zhang, Y., Peng, W., Wang, Z. and Xie, D. (2009). Molecular mechanism for jasmonate-induction of anthocyanin accumulation in Arabidopsis. J. Exp. Bot. 60: 3849–3860. Sharma, P., Kaur, H. and Sirhindi, G. (2013). Effect of jasmonic acid on photosynthetic pigments and stress markers in Cajanus cajan (L.) Millsp. seedlings under copper stress. Am. J. Plant Sci., 4: 817–823. Sheard, L.B., Tan, X., Mao, H., Withers, J., Ben-Nissan, G., Hinds, T.R., et al. (2010). Jasmonate perception by inositol-phosphate-potentiated COI1-JAZ co-receptor. Natur., 468: 400–405. Sheteawi, S.A. (2007). Improving growth and yield of salt-stressed soybean by exogenous application of jasmonic acid and ascobin. Intl. J. Agri. Bio., 3: 473–478.

k

167

k

k

168

k

Mechanism of Plant Hormone Signaling under Stress

Shimizu, Y., Maeda, K., Kato, M. and Shimomura, K. (2010). Methyl jasmonate induces anthocyanin accumulation in Gynura bicolour cultured roots. Vitro Cell Dev. Biol. Plant, 46: 460–465. Shoji, T. and Hashimoto, T. (2011). Tobacco MYC2 regulates jasmonate-inducible nicotine biosynthesis genes directly and by way of the NIC2-locus ERF genes. Plant Cell Physiol., 52: 1117–1130. Shoji, T., Ogawa, T. and Hashimoto, T. (2008). Jasmonate-induced nicotine formation in tobacco is mediated by tobacco COI1 and JAZ genes. Plant Cell Physiol., 49: 1003–1012. Skrzypek, E., Miyamoto, K., Saniewski, M. and Ueda, J. (2005). Jasmonates are essential factors inducing gummosis in tulips: mode of action of jasmonates focusing on sugar metabolism. J. Plant Physiol., 162: 495–505. Soares, A.M.S., De souza, T.F., Jacinto, T. and Machado, O.L.T. (2010). Effect of methyl jasmonate on antioxidative enzyme activities and on the contents of ROS and H2 O2 in Ricinus communis leaves. Braz. J. Plant Physiol., 22(3): 151–158. Sønderby, I.E., Geu-Flores, F. and Halkier, B.A. (2010). Biosynthesis of glucosinolates– gene discovery and beyond. Trends Plant Sci., 15: 283–290. Sorial, M.E., EI-Gamal, S.M. and Gendy, A.A. (2010). Response of sweet basil to jasmonic acid application in relation to different water supplies. Bio. Res., 7(1): 39–47. Spartz, A.K. and Gray, W.M. (2008). Plant hormone receptors: new perceptions. Genes Dev., 22: 2139–2148. Spitzer-Rimon, B., Marhevka, E., Barkai, O., Marton, I., Edelbaum, O., Masci, T., et al. (2010) EOBII, a gene encoding a flower-specific regulator of phenylpropanoid volatiles’ biosynthesis in petunia. Plant Cell, 22: 1961–1976. Staswick, P.E., Su, W. and Howell, S.H. (1992). Methyl jasmonate inhibition of root growth and induction of a leaf protein are decreased in an Arabidopsis thaliana mutant. U.S.A. Proc. Natl. Acad. Sci., 89: 6837–6840. Stenzel, I., Hause, B., Miersch, O., Kurz, T., Maucher, H., Weichert, H., et al. (2003). Jasmonate biosynthesis and the allene oxide cyclise family of Arabidopsis thaliana. Plant Mol. Biol., 51: 895–911. Sun, J., Xu, Y., Ye, S., Jiang, H., Chew, Q., Liu, F., et al. (2009). Arabidopsis ASA1 is important for jasmonate-mediated regulation of auxin biosynthesis and transport during lateral root formation. Plant Cell, 21: 1495–1511. Swiatek, A., Azmi, A., Witters, E. and Van Onckelen, H. (2003). Stress messengers jasmonic acid and abscisic acid negatively regulate plant cell cycle. Bulg. J. Plant Physiol., 29: 172–178. Takahashi, K., Fujino, K., Kikuta, Y. and Koda, Y. (1994). Expansion of potato cells in response to jasmonic acid. Plant Sci., 100: 3–8. Takahashi, K., Fujino, K., Kikuta, Y. and Koda, Y. (1995). Involvement of the accumulation of sucrose and the synthesis of cell wall polysaccharides in the expansion of potato cells in response to jasmonic acid. Plant Sci., 111: 11–18. Tani, T., Sobajima, H., Okada, K., Chujo, T., Arimura, S., Tsutsumi, N., et al. (2008). Identification of the OsOPR7 gene encoding 12-oxophytodienoate reductase involved in the biosynthesis of jasmonic acid in rice. Planta, 227: 517–526. Tao, L., Zeba, N., Ashrafuzzaman, M. and Hong, C.B. (2011). Heavy metal stress-inducible early light-inducible gene CaELIP from hot pepper (Capsicum annuum) shows broad expression patterns under various abiotic stresses and circadian rhythmicity. Environ. Exp. Bot., 72: 297–303.

k

k

k

7 Jasmonate Signaling and Stress Management

k

Thines, B., Katsir, L., Melotto, M., Niu, Y., Mandaokar, A., Liu, G., et al. (2007). JAZ repressor proteins are targets of the SCF COI1 complex during jasmonate signalling. Natur., 448: 661–665. Todd, A.T., Liu, E., Polvi, S.L, Pammett, R.T. and Page, J.E. (2010). A functional genomics screen identifies diverse transcription factors that regulate alkaloid biosynthesis in Nicotiana benthamiana. Plant J., 62: 589–600. Tong, X., Qi, J., Zhu, X., Mao, B., Zeng, L., Wang, B., et al. (2012). The rice hydro peroxide lyase OsHPL3 functions in defense responses by modulating the oxylipin pathway. The Plant J., 71: 763–775. Traw, M.B. and Bergelson, J. (2003). Interactive effects of jasmonic acid, salicylic acid, and gibberellin on induction of trichomes in Arabidopsis. Plant Physiol., 133: 1367–1375. Tsonev, T.D., Lazova, G.N., Stoinova, Z.G. and Popova, L.P. (1998). A possible role for jasmonic acid in adaptation of barley seedlings to salinity stress. J. Plant Growth Regul., 17: 153–159. Tsuchiya, T., Ohta, H., Okawa, K., Iwamatsu, A., Shimada, H., Masuda, T. and Takamiya, K. (1999). Cloning of chlorophyllase, the key enzyme in chlorophyll degradation: finding of a lipase motif and the induction by methyl jasmonate. Proc. Natl. Acad. Sci. USA., 96: 15362–15367. Tytgat, T.O.G., Verhoeven, K.J.F., Jansen, J.J., Raaijmakers, C.E., Bakx-Schotman, T., Lauren, M., et al. (2013). Plants know where it hurts: root and shoot jasmonic acid induction elicit differential responses in Brassica oleracea. PLoS ONE 8(6): e65502. Ueda, J. and Kato, J. (1980). Identification of a senescence-promoting substance from wormwood (Artemisia absinthum L.) Plant Physiol., 66: 246–249. Ueda, J., Miyamoto, K. and Saniewski, M. (2003). Gum formation and leaf abscission in ornamental Japanese cherry (Prunus yedoensis): a possible role of ethylene and jasmonates in these processes. In: M. Vendrell, H. Klee, J.C. Pech and F. Romojaro (Eds). Bio. Biotechnol. Plant Hormone Ethylene III., IOS Press. pp. 303–304. Van der Fits, L. and Memelink, J. (2000). ORCA3, a jasmonate-responsive transcriptional regulator of plant primary and secondary metabolism. Sci., 289: 295–297. Vick, B.A. and Zimmerman, D.C. (1983). The biosynthesis of jasmonic acid: a physiological role for plant lipoxygenase. Biochem. Biophys. Res. Commun., 111(2): 470–477. Wager, A. and Browse, J. (2012). Social Network: JAZ protein interactions expand our knowledge of jasmonate signaling. Frontiers Plant Sci., 3: 41. Wagner, G.J., Wang, E. and Shepherd, R.W. (2004). New approaches for studying and exploiting an old protuberance, Plant trichome. Ann. Bot., 93: 3–11. Walia, H., Wilson, C., Condamine, P., Liu, X., Ismail, A.M. and Close, T.J. (2007). Large-scale expression profiling and physiological characterization of jasmonic acid-mediated adaptation of barley to salinity stress. Plant Cell Envir., 30: 410–421. Wang, S., Ichii, M., Taketa, S., Xu, L., Kai, X. and Xie, Z. (2002). Lateral root formation in rice (Oryza sativa): promotion effect of jasmonic acid. J. Plant Physiol., 159: 827–832. Wang, Y., Mopper, S. and Hasenstein, K.H. (2001). Effects of salinity on endogenous ABA, IAA, JA, AND SA in Iris hexagona. J. Chem. Ecol., 27: 327–342. Wasternack, C. (2006). Oxylipins: biosynthesis, signal transduction and action, In: P. Hedden, S. Thomas (Eds). Plant Hormone Signaling. Harpenden: Blackwell Publishing, pp. 185–228. Wasternack, C. (2007). Jasmonates: an update on biosynthesis, signal transduction and action in plant stress response, growth and development. Ann. Bot. 100: 681–697.

k

169

k

k

170

k

Mechanism of Plant Hormone Signaling under Stress

Wasternack, C. and Hause, B. (2002). Jasmonates and octadecanoids – signals in plant stress response and development, In: K. Moldave (Ed.). Progress in Nucleic Acid Research and Molecular Biology. New York: Academic Press, pp. 165–221. Wasternack, C. and Hause, B. (2013). Jasmonates: biosynthesis, perception, signal transduction and action in plant stress response, growth and development. Ann. Bot., 111: 1021–1058. Wasternack, C. and Kombrink, E. (2010). Jasmonates: Structural requirements for lipid-derived signals active in plant stress responses and development. ACS. Chemical Bio., 5: 63–77. Weidhase, R.A., Lehmann, J., Kramell, H., Sembdner, G. and Partier, B. (1987). Degradation of ribulose-1,5-biphosphate carboxylase and chlorophyll in senescing barley leaf segments triggered by jasmonic acid methylester, and counteraction by cytokinin. Physiologia Plantarum, 69(1): 161–166. Wilen, R.W, van Rooijen G.J.H., Pearce, D.W., Pharis, R.P., Holbrook, L.A. and Moloney, M.M. (1991). Effects of jasmonic acid on embryo specific processes in Brassica and Linum oilseeds. Plant Physiol, 95(2): 399–405. Wilen, R.W., Bruce, E.E. and Gusta, L.V. (1994). Interaction of abscisic acid and jasmonic acid on the inhibition of seed germination and the induction of freezing tolerance. Can. J. Bot., 72: 1009–1017. Xie, D.X., Feys, B., James, S., Nieto-Rostro, M. and Turner, J. (1998). COI1: an Arabidopsis gene required for jasmonate-regulated defense and fertility. Sci., 280: 1091–1094. Yan, J., Zhang, C., Gu, M., Bai, Z., Zhang, W., et al. (2009). The Arabidopsis CORONATINE INSENSITIVE1 protein is a jasmonate receptor. Plant Cell, 21: 2220–2236. Yan, Y., Borrego, E. and Kolomiets, M.V. (2013). Jasmonate biosynthesis, perception and function in plant development and stress responses. In: Baez, R.D. (Ed.) Lipid Metabolism. InTech, pp. 393–442, http://dx.doi.org/10.5772/52675. Yan, Y., Stolz, S., Chetelat, A., Reymond, P., Pagni, M., Dubugnon, L. and Farmer, E.E. (2007). A downstream mediator in the growth repression limb of the jasmonate pathway. Plant Cell, 19: 2470–2483. Yasar, F., Kusvuran, S. and Ellialtıoglu, S. (2006). Determination of anti-oxidant activities in some melon (Cucumis melo L.) varieties and cultivars under salt stress. J. Horticultural Sci. Biotechnol.,81(4): 627–630. Yildiz, K., Muradoglu, F. and Yilmaz, H. (2008). The effect of jasmonic acid on germination of dormant and non-dormant pear (Pyrus communis) seeds. Seed Sci. Technol., 36: 569–574. Yildiz, K., Yazici, C. and Muradoglu, F. (2007). Effect of jasmonic acid on germination of dormant and non-dormant apple seeds. Asian J. Chem., 19: 1098–1102. Yoon, J.Y., Hamayun, M., Lee, S.K. and Lee, I.J. (2010). Methyl jasmonate alleviated salinity stress in soyabean. J. Crop Sci. Biotechnol., 12(2): 63- 68. Yoshida, Y., Sano, R., Wada, T., Takabayashi, J. and Okada, K. (2009). Jasmonic acid control of GLABRA3 links inducible defense and trichome patterning in Arabidopsis. Development, 136: 1039–1048. Yoshihara, T., Omer, E-SA, Koshino, H., Sakamura, S., Kikuta, Y. and Koda, Y. (1989) Structure of a tuber-inducing stimulus from potato leaves (Solanum tuberosum L.). Agricultural and Biological Chemistry. 53: 2835–2837.

k

k

k

7 Jasmonate Signaling and Stress Management

171

Yu, Z.X., Li, J.X., Yang, C.Q., Hu, W.L., Wang, L.J. and Chen, X.Y. (2012). The jasmonate-responsive AP2/ERF transcription factors AaERF1 and AaERF2 positively regulate artemisinin biosynthesis in Artemisia annua L. Mol. Plant, 5: 353–365. Zalewski, K., Nitkiewicz, B., Lahuta, L.B., Glowacka, K., Socha, A. and Amarowicz, R. (2010). Effect of jasmonic acid-methyl ester on the composition of carbohydrates and germination of yellow lupine (Lupinus luteus L.) seeds. J Plant Physiol., 167(12): 967–973. Zhang, H. and Zhou, C. (2013) Signal transduction in leaf senescence. Plant Molecular Biology. 82: 539. Zhao, J., Davis, L.C. and Verpoorte, R. (2005). Elicitor signal transduction leading to production of plant secondary metabolites. Biotechnol. Adv., 23, 283–333.

k

k

k

k

173

8 Mechanism of ABA Signaling in Response to Abiotic Stress in Plants Ankush Ashok Saddhe 1 , Kundan Kumar 1 , and Padmanabh Dwivedi 2 1

Department of Biological Sciences, Birla Institute of Technology & Science Pilani, K. K. Birla Goa Campus, Goa, India

2 Department of Plant Physiology, Institute of Agricultural Sciences, Banaras Hindu University, Varanasi, India

8.1 Introduction

k

The interaction between living organisms and various environmental factors is essential for continuous life process. Abiotic stresses, including drought, salinity, heat, cold, chilling, freezing, nutrient, high light intensity, ozone (O3 ), and anaerobic stress affecting plants and crops in the field, have been extensively studied (Cavanagh et al., 2008; Munns and Tester, 2008; Chinnusamy and Zhu, 2009; Mittler and Blumwald, 2010). Predictions from current climate models demonstrate that average surface temperature will rise by 3–5∘ C in the next 50–100 years, which in turn will drastically affect global agricultural systems leading to an increased frequency of drought, flood, and heat waves (IPCC, 2007, 2008; Mittler and Blumwald, 2010). Plant molecular responses towards abiotic stresses involve interactions and crosstalks between numerous metabolic and signaling pathways. The pathways involved in various plants include transcription factors, photosynthesis, antioxidant mechanisms, pathogen responses, hormone signaling, and osmolyte synthesis (Atkinson et al., 2013; Iyer et al., 2013; Prasch and Sonnewald, 2013; Rasmussen et al., 2013). Earlier recognized plant hormones abscisic acid (ABA) and ethylene are important regulators of plant responses to abiotic stresses (Goda et al., 2008). ABA synthesis is induced by environmental stresses including drought, salinity cold, and, therefore, considered to be a plant stress hormone (Chinnusamy et al., 2008; Hubbard et al., 2010; Kim et al., 2010). ABA is an ubiquitous plant hormone and signaling molecule that plays a crucial role in several physiological processes such as stomatal closure, embryo morphogenesis, seed development, synthesis of storage proteins and lipids, germination, leaf senescence, and pathogen defense mechanisms (Finkelstein, 2013). High salinity, drought, and low-temperature conditions are considered to be major causative factors for hyperosmotic stress characterized by a decreased turgor pressure and water loss. Stress responsive gene expression in various plants is mainly regulated by ABA dependent and independent pathways (Yamaguchi-Shinozaki and Shinozaki, 2006). There are four major components of ABA signaling cascade under stress condition: ABA receptor (PYR1, pyrabactin resistance 1; PYL, PYR1-like; RCAR1, regulatory components of ABA receptor 1; hereafter referred to as PYLs), type 2C protein phosphatase Mechanism of Plant Hormone Signaling under Stress, First Edition, Volume 1. Edited by Girdhar Pandey. © 2017 John Wiley & Sons, Inc. Published 2017 by John Wiley & Sons, Inc.

k

k

k

174

Mechanism of Plant Hormone Signaling under Stress

(PP2C; a negative regulator), sucrose non-fermenting 1-related protein kinase 2 (SnRK2; a positive regulator), and ABA – responsive transcription factors (AREB) (Cutler et al., 2010; Raghavendra et al., 2010; Zhang et al., 2015). The pathway interfaces with ion channels, transcription factors, and other targets, thus providing a mechanistic connection between phytohormone and ABA-induced responses. The cis-acting element, the ABA-responsive element (ABRE), and a group of transcription factors, ABRE-binding protein/ABRE-binding factors (AREB/ABFs) have important roles in ABA-dependent gene expression. AREB is mainly induced by dehydration, high salinity, and ABA treatment in vegetative tissues, and thus plants overexpressing these factors show enhanced drought stress tolerance (Kim et al., 2004, Fujita et al., 2005). Under abiotic stress, ABA binds to intracellular PYL receptors and protein phosphatase 2C (PP2C) and forms a ternary complex (ABA-PYL-PP2C). Involvement of PP2C in the ternary complex is responsible for autophosphorylation of SnRK2 members and they are the major abiotic stress regulators. Activated SnRK2 further phosphorylates downstream transcription factors (ABREB/ARF) and in turn induces ABA responsive genes, which further leads to adaptation of plants under various abiotic stresses (Fig. 8.1/Plate 10). In the absence of abiotic stress, ABA level is a negligible and Abiotic stresses

Cell Membrane

k

GTG1/2 GDP ?

ABA accumulation

Expression of ABA responsive genes

Group A PP2C

PYR/PYL/ RCAR

Subclass III SnRK2 (2.2/2.3/2.6)

p (AREB1/2) (ABF2/3/4)

CHLH/ABAR Plastid WRKY 18, 40,60

p No Gene Expression

p

ABRE ABA Responsive gene expression Stress Tolerance

Figure 8.1 (Plate 10) Diagrammatic representation of ABA signaling mechanism in the presence of abiotic stress. The positive regulation of ABA signaling under abiotic stress: ABA accumulates and binds to intracellular PYR/PYL/RCAR receptor and protein phosphatase 2C (PP2C), which in turn forms a ternary complex (ABA-PYL-PP2C). Deactivation of PP2C in the ternary complex is responsible for autophosphorylation of SnRK2 members, which are major abiotic stress regulators. Activated SnRK2 further phosphorylates the transcription factor and activates various ABA responsive genes, which in turn leads to abiotic stress tolerance in plants. GDP-bound form of GTG binds ABA and regulates the expression of ABA-responsive genes via an unknown mechanism. ABA-bound ABAR/ChlH sequesters WRKYs to the cytosol, thus allowing the expression of ABA-signaling transcription factors that, through binding to different cis-elements such as CE1, MYB, DRE, and ABRE, activate the expression of ABA-responsive genes. (See insert for color representation of this figure.)

k

k

k

8 Mechanism of ABA Signaling in Abiotic Stress

175

No abiotic stresses Cell Membrane

GTG1/2 GTP ?

No ABA accumulation PYR/PYL /RCAR Subclass III SnRK 2

No ABA responsive gene expression

CHLH/ABAR Plastid

Group A PP2C Dephosphorylation

WRKY 18, 40, 60

p p AREB/ABF

w box

Gene Expression

ABRE No ABA Responsive gene expression

k

Figure 8.2 (Plate 11) Diagrammatic representation of the ABA signaling mechanism in the absence of abiotic stress. The negative regulation of ABA signaling under normal conditions: In the absence of abiotic stress, ABA level is negligible and intracellular PYR/PYL/RCAR receptors as well as PP2Cs are independent. It leads to activation of PP2C and hence dephosphorylation of SnRK2. Inactivated SnRK2 will not be able to phosphorylate downstream transcription factor and ABA responsive genes in turn off state. GTG is present as GTP-bound, an inactive form. ABAR/ChlH cannot sequester WRKYs, therefore, WRKYs bind to the W-box of many key ABA-signaling transcription factors such as ABI4, ABI5, ABF4, DREB1A, DREB2A, MYB2, and RAB18, which further inhibit their expression. (See insert for color representation of this figure.)

intracellular PYL receptor, PP2Cs are independent, which leads to activation of PP2C and dephosphorylation of SnRK2. Inactivated SnRKs are unable to phosphorylate the downstream transcription factor and thus ABA responsive genes are present in an uninduced state (Fig. 8.2/Plate 11). In the current review, we try to deal with various ABA receptors involved in signal perception, protein phosphatase PP2C acting as a negative regulator in the cascade, SnRK2 as a positive regulator in ABA signaling, and lastly transcription factors involved in regulating ABA responsive genes leading to adaptation under various abiotic stresses in plants.

8.2 Signal Perception and ABA Receptors The perception and response to the environmental cues are crucial steps towards adaptive response. With recent advances in genomics, paradigm-shifting discoveries have changed our fundamental understanding of plant ABA signaling and its core components such as receptor, downstream kinases and transcription factors. Many studies suggested that ABA binding and perception sites are localized on intracellular and/or extracellular regions of plant cell. Receptor studies using microinjection and ABA analogs suggested that ABA may have both intracellular and extracellular sites of perception. Several proteins with the properties of either plasma membrane or intracellular ABA receptors have been described. Prior to the identification of ABA

k

k

k

176

k

Mechanism of Plant Hormone Signaling under Stress

receptors, several studies provided indirect evidence for multiple receptors such as FCA (RNA-binding protein involved in flowering), H subunit of the chloroplast Mg2+ -chelatase and G-protein-coupled receptors (Shen et al., 2006; Liu et al., 2007; Cutler et al., 2010). The first ABA binding protein was identified in barley aleurone, which is a homologue of Arabidopsis FCA, but later was rejected as an ABA receptor. The plastid-localized H subunit of the Mg2+ -chelatase is considered another class of ABA binding receptor in Arabidopsis but not validated experimentally in barley. The C-terminus of Mg2+ -chelatase can interact with soluble proteins in the cytosol such as WRKY (WRKY 40/18/60) transcription factors in the presence of ABA. This association prevents WRKY transcription factor movement to the nucleus, where they can repress several ABA-responsive genes including some ABI transcription factors (Shang et al., 2010; Liu et al., 2012). The Mg2+ -chelatase complex subunit I (CHLI) contributes to ABA sensitivity without binding to ABA (Du et al., 2012), the CHLH/CHLI heterodimers function in ABA signaling, while Mg2+ -chelatase activity requires two additional subunits: CHLD and GENOMES UNCOUPLED4 (GUN4). In silico, biochemical and genetic studies lead to identification of novel class of ABA receptors: G-protein-coupled receptor (GPCR) like proteins in Arabidopsis named GPCR-type G proteins 1 and 2 (GTG1 and GTG2) (Pandey et al., 2009). The characteristic features of the identified GTGs are that they have both nucleotide-binding and GTPase-activating domains. The GTG interacts with GPA1(Arabidopsis Gα subunit) and demonstrating that GPA1 inhibits the intrinsic GTPase activity of the GTGs without affecting ABA-binding properties of GTGs. Arabidopsis double mutants gtg1/gtg2 showed reduced ABA sensitivity in seed germination, root growth, stomatal response, and gene expression in ABA-response assays (Pandey et al., 2009). These studies suggested that GPA1 is not involved in signal transduction downstream of the GTG receptors. An interesting avenue of future investigation will be to identify ABA dependent downstream targets of the GTGs signaling cascade. The major breakthrough of ABA signaling was discovery of novel, soluble ABA binding protein by four independent groups as pyrabactin resistance 1 (PYR1) and regulatory component of ABA receptor 1 (RCAR1) (Ma et al., 2009; Park et al., 2009; Santiago et al., 2009; Nishimura et al. 2010). The pyrabactin is a selective agonist of ABA in seed germination and stomatal closure, which leads to the connection between PYR1 and ABA signaling components. Genetic screening showed that PYR1 is crucial for pyrabactin action in vivo (Park et al., 2009). The PYR1 interacts with group A protein phosphatase 2C (PP2C) namely ABA-insensitive (ABI1, ABI2) and homology to ABI1 (HAB1) in response to ABA and pyrabactin. However, ABA insensitive 1-interacting protein was identified in two yeast hybrid screenings and referred as the REGULATORY COMPONENT OF ABA RECEPTOR1 (RCAR1), which corresponds to PYL9 (Ma et al., 2009). Other members, PYL5, PYL6, and PYL8, were identified through its constitutive interaction with HAB1 (Santiago et al., 2009). Nishimura et al. (2010) used an in vivo strategy of ABI1 complex purification from Arabidopsis plants that led to the identification of nine of the 14 PYR/RCARs. PYL8 receptors are non-redundant in their function and help in the regulation of root ABA sensitivity and promoting lateral root growth by enhancing the MYB77-dependent transcription of auxin-responsive genes (Antoni et al., 2013; Zhao et al., 2013). ABA receptor family PYL has been endowed with 14 members named PYR1 and PYL1–13 in Arabidopsis exhibiting functional redundancy.

k

k

k

8 Mechanism of ABA Signaling in Abiotic Stress

k

ABA receptors are small soluble molecules commonly found in the cytoplasm and nucleus of plant cells and, in the absence of ABA, these receptors form dimers. The PYL receptor members belong to START/Bet v I superfamily and form a helix-grip fold structural motif. The receptor members are known to interact with group A protein phosphatase 2C (PP2C) in an ABA-dependent manner, and, in turn, inhibits PP2C activity as shown in Fig. 8.1 (Ma et al., 2009: Park et al., 2009). The natural (+)-stereoisomer of ABA shows preferable strong binding affinity towards the RCAR1/PYL5 receptor. In contrast, PYL2, PYL3, and PYL4 interact with HAB1 in presence of either 10 μM (S)-(–)-ABA or (R)-(+)-ABA. The preferential selectivity of receptors for pyrabactin and (–)-ABA in comparison to (+)-ABA suggests that the ligand binding pockets of PYR/PYL/RCAR proteins probably have non-conserved residues that can be utilized for selective receptor activation (Cutler et al., 2010). The certainty about PYR/RCAR and PP2C functioning together as a receptor remains obscured. The elucidation of PYR1, PYL1, and PYL2 crystal structures in the presence of ABA has established ABA binding to PYR/PYLs (Melcher et al., 2009; Miyazono et al., 2009; Nishimura et al., 2009; Santiago et al., 2009; Yin et al., 2009). The protein structure of all PYLs shares a highly similar helix-grip structure that is characterized by a seven-stranded β-sheet, which is flanked by two α-helices. The crucial sites for ABA binding are the L2 loop between the α3 helix and β2 strand, the L4 loop (also called CL2 or the “gate” loop) between the β3 and β4 strands, the L5 loop (also called CL3 or “latch” loop) between the β5 and β6 strands, and the C-terminal helix α4 encompasses the entrance of the ligand-binding pocket (Melcher et al., 2009; Yin et al., 2009). The interaction between ABA receptor and phosphatase residues serves to immobilize the gate of the receptor and this mechanism is known as “gate-latch-lock” (Melcher et al., 2010; Joshi-Saha et al., 2011). The PYR/RCAR proteins have a ligand-binding site within a large internal cavity. Most of PYR/RCAR proteins interact with the ABA molecule through non-polar interaction, while hydrogen bonds allow receptor proteins in proper orientation with the ring carbonyl, central hydroxyl, and carboxylic acid groups of ABA (Melcher et al., 2009; Miyazono et al., 2009; Nishimura et al., 2009; Santiago et al., 2009). Members of the PYL family in Arabidopsis (except PYL13) are capable of activating ABA signaling using protoplast transfection assays (Fujii and Zhu, 2009). Recently, it has been confirmed that PYL13 is not an ABA receptor but modulates the ABA pathway by inhibiting both the PYL receptors and the PP2C co-receptors (Zhao et al., 2013). The functions of PYL in ABA signaling were confirmed by mutant studies. The triple pyr1/pyl1/pyl4, quadruple pyr1/pyl1/pyl2/pyl4 and sextuple pyr1/pyl1/pyl2/pyl4/pyl5/pyl8 mutants exhibited hyposensitivity in germination and root growth in responses to ABA (Park et al., 2009; Gonzalez-Guzman et al., 2012). Overexpression of a few ABA receptor members such as PYL5, PYL8, and PYL9 increased ABA responses and conferred drought resistance (Ma et al., 2009; Santiago et al., 2009; Saavedra et al., 2010). It has been demonstrated that PYL8 interacted with five PP2Cs such as HAB1, HAB2, ABI1, ABI2, and PP2CA/AHG3 (Antoni et al., 2012). Overexpression studies of PYL1, PYL5, and PYL8 provide greater tolerance towards drought stress in Arabidopsis. All these studies showed that the PYL receptor family members are main regulator of ABA signaling cascade and PP2C phosphatase considered as a co-receptor. Collectively all evidences indicate that PYLs function as bonafide ABA receptors, converging all aspects of ABA signaling. PYLs-mediated ABA

k

177

k

k

178

Mechanism of Plant Hormone Signaling under Stress

signaling might play a crucial role in favoring stress adaptive growth and development in plants.

8.3 Negative Regulators of ABA Signaling: Protein Phosphatase 2C (PP2C)

k

The plants have common signaling components such as receptors, protein kinases, and phosphatases to sense and transduce a wide range of environmental cues. Protein kinases and phosphatases are the main key players that maintain phosphoregulation in normal and modulate under stress conditions. The protein phosphatases have been classified based on substrate specificity into two major categories namely serine/threonine (ser/thr) and tyrosine (tyr) phosphatases. Further ser/thr phosphatases can be divided into two major families: phosphoprotein phosphatases (PPP) and phosphoprotein metallophosphatase (PPM). The PPP family includes PP1, PP2A, PP2B phosphatases, and distantly related phosphatases (PP4, PP5, PP6, and PP7). Similarly, the PPM group includes PP2C phosphatases and Mg2+ dependent phosphatases (Singh and Pandey, 2012). Protein tyrosine phosphatases (PTPs) have a unique signature motif of CX5 R composed of two groups, namely tyrosine specific phosphatases (PTP) and dual specificity phosphatases (DSPs), which can dephosphorylate tyrosine and serine/threonine residues (Singh and Pandey, 2012). Genetic evidence revealed that both PP2A and PP2C are involved in ABA signaling (Cutler et al., 2010). Protein phosphatase type 2C (PP2C) is a monomer, cation dependent (Mg2+ ∕Mn2+ ) unique class of enzymes. They are evolutionary highly conserved from prokaryotes to higher eukaryotes and play an important role in stress signaling. In the Arabidopsis genomes 80 PP2Cs members have been reported, which further clustered into 12 (A-K) clades (Fuchs et al., 2013). Similarly, in rice, PP2Cs are the major class of protein phosphatase and includes 90 members that again are further subdivided into 11 subfamilies (Singh and Pandey, 2012). The PP2C phosphatase was identified by genetic screening of ABA mutants of Arabidopsis and other plants that are either unable to respond or to synthesize ABA. The Arabidopsis ABSCISIC ACID-INSENSITIVE (ABI1 and ABI2) genes encode homologous protein serine/threonine phosphatase 2C (PP2C), involved in ABA signaling pathway (Fuchs et al., 2013). The clade A PP2C, comprised of nine members, namely ABI1, ABI2, PP2CA∕AHG3 (ABA Hypersensitive Germination 3), HAB1 (Homology to ABI1 1), HAB2 (Homology to ABI1 2), HAI1 (Highly ABA-Induced PP2C 1), HAI2 (Highly ABA-Induced PP2C 2), HAI3 (Highly ABA-Induced PP2C 3), and AHG1 (ABA Hypersensitive Germination 1) (Fig. 8.3a) (Fuchs et al., 2013). The mutant abi1-1 (G180D) and abi2-1 (G168D) showed loss of interaction with PYR/RCARs and exhibited dominant ABA insensitivity (Ma et al., 2009; Park et al., 2009). The disruption of clade A PP2C genes from Physcomitrella patens showed that it helped survive under full desiccation conditions, without ABA treatment, though its growth was severely hindered indicating the importance of group A PP2C under abiotic stress (Komatsu et al., 2013). Expression of several members of the rice PP2C clade A was highly induced by ABA, salt, mannitol and cold treatment (Xue et al., 2008; Singh et al., 2010). In Arabidopsis, the expression of nine members of PP2C group mediates abiotic stresses and demonstrated to be induced by ABA treatment (Xue et al., 2008). Five members of Arabidopsis PP2C

k

k

k

8 Mechanism of ABA Signaling in Abiotic Stress

Phosphatase PP2C 12 Clades A to K Clade A ABI1 ABI2 AHG3 HAB1 HAB2 HAI1 HAI2 AHG1

(A)

SnRK2 Subfamily

Transcription Factor

Subclass 1

Subclass 2

Subclass 3

SnRK2.1 SnRK2.4 SnRK2.5 SnRK2.9 SnRK2.10

SnRK2.7 SnRK2.8

SnRK2.2 SnRK2.3 SnRK2.6

Activated by osmotic stress

179

Activated by ABA and osmotic stress

(B)

bZIP, MYB, WRKY, AP2/EREBP, NAC, ARF, ABI3/VP1, bHLH, HSF

bZIP

NAC

AREB1/ABF2, AREB2/ABF4, ABF1, ABF3

(C)

Figure 8.3 Members of signaling intermediates in ABA signaling (A) Protein phosphatase 2C, 80 members of PP2C categorized into 12 different clades from A to K. Among these, only clade A has been implicated into ABA dependent pathways under abiotic stress. (B) SnRK 2 ser/thr protein kinase subfamily members. SnRK2 subfamily has been divided into three subclasses, subclass I, II, and III comprising 5, 2, and 3 members, respectively. Subclass III is considered a major ABA dependent abiotic stress regulator. (C) Abiotic stress responsive transcription factor family. Basic leucine zipper family members play crucial roles during ABA dependent abiotic stresses. Transcription factors AREB1/ABF2, AREB2/ABF4, ABF1, and ABF3 are major regulators of abiotic stress and bind ABA responsive elements (ABRE).

k

group (ABI, ABI2, HAB1, HAB2, and PP2CA) have been well studied and characterized as the negative regulators of ABA mediated signaling. The ABI1/ABI2 proteins interacted with SALT OVERLAY SENSITIVE 2 (SOS2)/ CIPK24 through a protein kinase interaction motif (PKI) within the catalytic phosphatase region (Schweighofer and Meskiene, 2008). The mutated PKI motif in abi2-1 may disrupt interaction and hence showed improved salt tolerance in plants (Ohta et al., 2003). ABA and osmotic stress activated protein kinase SnRK2.6/OST1 that, in turn, interacts with ABI1 but mutant abi1-1 showed reduced interaction (Mustilli et al., 2002; Yoshida et al., 2006a,b). The novel function of PP2C is that it may act as co-receptor of PYL in the presence of ABA and forms ternary complex that negatively regulates ABA signaling.

8.4 Positive Regulators of ABA Signaling: SnRK2 ABA signals under abiotic stress are recognized and transmitted to various downstream components in which protein kinases and phosphatases are key components. Plant specific abiotic stress specific kinases are calcium-dependent protein kinases (CDPKs) and most of SNF1-related kinases (SnRK). The members of SnRK1 have been identified and characterized from several plant species, which are the closest relatives of SNF1 to yeast and that of AMP-activated protein kinase (AMPK) from animals. They are involved in the regulation of global metabolism and energy status of the plant such as in response to low glucose/high sucrose level, dark period, hypoxia, salinity, pathogen, or herbivore attack (Halford and Hey, 2009; Kulik et al., 2011).

k

k

k

180

k

Mechanism of Plant Hormone Signaling under Stress

Plant SnRK belongs to the SnRK-CDPK superfamily and can be further classified into three subfamilies such as SnRK1, SnRK2, and SnRK3. The Arabidopsis genome encodes 38 SnRK members, out of which SnRK1, SnRK2, and SnRK3 subfamily have 3, 10, and 25 members each, respectively. SnRK1 is reported to be involved in signaling pathways which modulates nitrogen, sucrose and lipid metabolism as well as involved in organogenesis and senescence. SnRK2 subfamily has 10 members in Arabidopsis and is categorized into three subclasses (Hrabak et al., 2003). Subclass I members of SnRK2 comprise SnRK2.1, SnRK2.4, SnRK2.5, SnRK2.9, SnRK2.10, and they get instantly activated by osmotic stress. SnRK2 kinases are considered as downstream regulators of ABA signaling pathways, besides, they are involved in responses to abiotic stresses (Hrabak et al., 2003). However, SnRK2.7 and SnRK2.8 belong to subclass II while subclass III SnRK2 includes SnRK2.2, SnRK2.3, and SnRK2.6. They are activated by both ABA and osmotic stress, but subclass II is weakly activated by ABA (Boudsocq et al., 2004) (Fig. 8.3A). Two research groups have obtained independently a triple snrk2.2/3/6 mutant, which allowed them to establish the role of ABA dependent SnRK2s in plant response to water deficit, seed maturation, and germination (Fujii and Zhu, 2009; Fujita et al., 2009; Nakashima et al., 2009). The triple knockout mutant SnRK2 subclass III (snrk2.2/snrk2.3/snrk2.6) is extremely insensitive to ABA and exhibits greatly reduced tolerance to drought, not only by the disruption of stomatal closing but also as a result of downregulation of ABA and water stress induced genes (Wang et al., 2013). However, the phenotype of the triple mutant clearly indicated that SnRK2 is important for ABA responses, both in terms of water stress response and developmental processes (Fujii and Zhu, 2009; Fujita et al., 2009; Nakashima et al., 2009). All SnRK2 members (except SnRK2.9) are instantly activated by treatment with different osmolytes such as sucrose, mannitol, sorbitol, NaCl, and some of them by ABA (Boudsocq et al., 2004, 2005). The mutant study of snrk2.3 blocked stomatal ABA response and weaken drought response as well (Mustilli et al., 2002; Yoshida et al., 2002). ABA-induced kinase activity is significantly dropped in quadruple pry1/pyl1/pyl2/pyl4 and dominant PP2C mutants, while PP2C loss-of-function or knockout mutants exhibited higher kinase activities (Umezawa et al., 2009; Vlad et al., 2009). Subclass III kinases such as SnRK2.2, SnRK2.3, and SnRK2.6 exhibit rapid activation by ABA and thus are considered major regulators of ABA signaling (Fig. 8.3B). The SnRK2 substrates include the bZIP transcription factors AREBs (ABA-Responsive Element Binding factors), the ion channels SLAC1 (Slow Anion Channel-Associated 1), and KAT1 (K+ channel in Arabidopsis thaliana 1) that are critical for ABA regulation of stomatal movement, and RBOHF (Respiratory Burst Oxidase Homolog F) that functions in reactive oxygen species (ROS) generation in response to ABA (Wang et al., 2013). Three SnRK2s along with 9 of the 14 members of PYL were co-immunoprecipitated with ABI1 in Arabidopsis. These results suggested that ABI1, three SnRK2s, and nine receptor proteins might constitute a core ABA signaling complex (Fujii and Zhu, 2009; Nishimura et al., 2010; Joshi-Saha et al., 2011). The 3D structure of the SnRK2-PP2C protein complex revealed SnRK2 activation is orchestrated with ABA binding and PP2C inactivation. In the absence of ABA, SnRK2 promotes dephosphorylation at serine residue in the kinase activation loop (Ser175 in SnRK2.6/OST1) through PP2C activity (Yoshida et al., 2006a,b; Ma et al., 2009; Park et al., 2009; Umezawa et al., 2009; Vlad et al., 2009; Yin et al., 2009; Soon et al., 2012). Various studies revealed that SnRK2.6 is involved in ABA-induced stomata closure in

k

k

k

8 Mechanism of ABA Signaling in Abiotic Stress

181

response to drought. SnRK2.2 and SnRK2.3, as shown in Fig. 8.3(B), are predominantly responsible for the inhibition of seed germination and seedling growth in response to ABA.

8.5 ABA Signaling Regulating Transcription Factor The transcription factors (TF) and their cis-elements control the expression of stress inducible genes. The transcription factor families, such as AP2/EREBP, ABI3/VP1, ARF, bHLH, bZIP, HSF, MYB, NAC, and WRKY have been involved in the regulation of various abiotic stress responses (Fig. 8.3C). 8.5.1 Basic-Domain Leucine Zipper (bZIP) TF

k

ABA responsive transcription factors are downstream elements of ABA dependent signaling complex. Promoters analysis of ABA inducible genes showed that ABA responsive gene expression requires multiple cis-elements, designated as ABA-responsive elements (ABREs; PyACGTGG/ TC), or the combination of an ABRE with a coupling element such as CE1, CE3, and DRE/CRT (Zhang et al., 2005a,b; Gomez-Porras et al., 2007). To date, coupling elements CE1, CE3, motif III, and DRE/CRT have been identified that belong to the G-box (CACGTG) family and are implicated in a broad range of gene expression mechanisms. The Arabidopsis genome encodes approximately 75 members of the bZIP family, which have been classified into more than 10 groups (Lindemose et al., 2013). The Arabidopsis genome encodes 13 AREB/ABF transcription factors belonging to groups A, having a basic-domain leucine zipper (bZIP) and four conserved domains containing ser/thr kinase phosphorylation sites (Jakoby et al., 2002). Based on phylogenetic relationships, bZIP family members can be divided into two groups (Yoshida et al. 2010). The five members of ABI5/AtDPBF family ABI5, enhanced Em levels (EEL), Dc3 promoter-binding factor 2 (DPBF2/AtbZIP67), DPBF4, and AREB3 are mainly expressed in seeds and plays important role in seed maturation and development. However, the members of AREB/ABF family namely AREB1/ABF2, AREB2/ABF4, ABF1, and ABF3 are predominantly expressed in vegetative tissues under abiotic stress conditions (Fujita et al., 2011). Transcript analysis using abi3 and abi5 mutants showed that ABI3 and ABI5 play an important role in the expression of RD29B in seeds (Nakashima et al., 2006). Based on yeast one-hybrid approach four AREB/ABF proteins were identified as ABRE-binding proteins (AREB) or ABRE-binding factors (ABF) (Uno et al. 2000). The ABF1 is cold responsive and the remaining three (AREB1/ABF2, AREB2/ABF4, and ABF3) can be significantly induced by dehydration, high-salt and exogenous ABA treatments (Fujita et al. 2005). The transcription factors AREB/ABF are considered key players and cooperatively regulate AREB-dependent gene expression during drought stress. AREB/ABF has been activated in an ABA dependent cascade through SNF1-related kinase 2 (SnRK2), which phosphorylates on multiple sites of their conserved domains (Nakashima et al., 2014). Similarly, another class of bZIP transcription factors encoded by ABI4 and ABI5 loci, regulate germination in response to ABA and do not appear to affect dormancy significantly (Finkelstein and Lynch, 2000; Cutler et al., 2010). An overexpression study of these factors results in ABA hypersensitivity in germination and

k

k

k

182

Mechanism of Plant Hormone Signaling under Stress

seedling growth and increased drought stress tolerance (Kim et al., 2004; Fujita et al., 2005). Triple mutants of areb1/areb2/abf3 exhibit greater resistance to ABA, in comparison with single and double mutants, with respect to primary root growth and reduced drought tolerance (Yoshida et al., 2010). In contrast to triple mutant areb1/areb2/abf3 the quadruple mutant areb1/areb2/abf3/abf1 displayed increased drought sensitivity, decreased ABA sensitivity in primary root growth, and impaired expression of ABA as well as osmotic stress responsive genes. Transcriptome analysis of quadruple mutant (areb1/areb2/abf3/abf1) revealed downregulation of subclass III SnRK2 dependent genes. SnRK2 namely SnRK2.2, SnRK2.3, and SnRK2.6 are co-localized to plant cell nuclei and interact with AREB/ABF. The mutant study of snrk2.2/2.3/2.6 showed the impairment of downstream genes expression of AREB1/ABF2, AREB2/ABF4, ABF3, and lack of ABA-dependent phosphorylation of AREB/ABFs (Fujii and Zhu, 2009). The phosphoproteome analysis underpinned that AREB/ABFs are master transcription factors functioning downstream of the three subclass III SnRK2s during ABA signaling in response to osmotic stress. Besides these three transcription factors, ABF1 is a transcription factor that functions downstream of SnRK2. It is concluded from these results that SnRK2s regulate ABA-responsive gene expression under osmotic stress primarily through four AREB/ABF transcription factors. 8.5.2 AP2/ERF TF

k

The plant specific APETALA-2/ETHYLENE RESPONSIVE FACTOR (AP2/ERF) TF family has approximately 145 members in Arabidopsis. Furthermore, it was categorized into four major subfamilies namely AP2, RELATED TO ABI3/VP1 (RAV), ERF, and dehydration-responsive element-binding protein (DREB). The DREB subfamily members play an important role in abiotic stress tolerance by modulating gene expression via the cis-acting dehydration-responsive element/C-repeat (DRE/CRT) element. The DREB1 sub-group composed of six members, DREB1A/CBF3, DREB1B/CBF1, DREB1C/CBF2, DREB1D/CBF4, DREB1F/DDF1, and DREB1E/DDF2. The DREB1A/CBF3, DREB1B/CBF1, and DREB1C/CBF2 showed transcriptional activation by cold stress, but the expression pattern of DREB1C/CBF2 differed compared to other TFs. The DREB2 (A-2) subgroup comprised of eight members in Arabidopsis with DREB2A as a well-characterized transcriptional regulator. The DREB2A gene was upregulated by ABA and both DREB2A and DREB2B were strongly activated by drought, salt, and temperature stress. A constitutively expressed DREB2A transgenic lines without negative regulatory domain (NRD), displayed improved tolerance to drought, high salinity and heat shock. Arabidopsis Growth-Regulating Factor 7 (GRF7) functions as a transcriptional repressor of ABA and osmotic stress-responsive genes including DREB2A. The GRF7 miRNA-silenced lines and T-DNA insertion line were demonstrated to have higher transcription level of DREB2A compared to the wild type (Kim et al., 2012). The other classes of DREB family genes, namely DREB2A and DREB2B, are strongly induced by osmotic and high-temperature stresses, while DREB2A is slightly upregulated by ABA (Nakashima et al., 2000; Sakuma et al., 2009). A detailed analysis of an RD29A promoter that is responsive to multiple abiotic stresses has indicated that DRE/CRT can function as a cis-acting element in promoters of ABA regulated genes (Nakashima et al., 2006). It has been reported that DREB1A/CBF3, DREB2A, and DREB2C proteins physically interact with AREB/ABF proteins

k

k

k

8 Mechanism of ABA Signaling in Abiotic Stress

183

(Lee et al. 2010). These evidences support the view that DREB/CBFs and AREB/ABFs might interact to control ABA mediated gene expression. 8.5.3 NAC TF

k

The NAC (NAM, ATAF1/2, and CUC2) is one of the largest plant-specific TF families, with approximately 110 members in Arabidopsis and 150 members in rice (Lindemose et al., 2013). NAC proteins have conserved NAC domain at the N-terminus, which consists of approximately 160 amino acid residues that are categorized into five subdomains (A–E). NAC TFs have diverse cellular functions in cellular morphogenesis, signal transduction and environmental stress responses (Hu et al., 2010). Some members of NAC sub group III are associated with abiotic stress, also referred to as ATAF or SNAC (Stress-responsive NAC) sub-group. Arabidopsis AtNAC019, AtNAC055, and RD26 (AtNAC072) were activated by drought, salt stress, ABA, and JA hormone and these can bind to the CATGTG motif promoter of EARLY RESPONSIVE TO DEHYDRATION STRESS 1 (ERD1). Transgenic lines with ectopic expressed RD26/AtNAC072 and AtNAC019 showed enhance sensitivity to ABA, while repressed lines of RD26/AtNAC072 are insensitive to ABA. Transcriptome analyses of both lines have revealed that RD26/ AtNAC072 mediated genes are involved in the detoxification of ROS, defense, and senescence in an ABA dependent manner (Fujita et al. 2004). The ATAF1 was overexpressed and affected plant tolerance to drought, but reports were contradictory, suggesting both positive and/or negative regulatory effects (Lu et al., 2007; Wu et al., 2009). 8.5.4 WRKY TF

The WRKY TF family comprised of 74 and 109 members in Arabidopsis and rice, respectively (Eulgem et al., 2000; Ross et al., 2007). The characteristic of WRKY protein is the presence of conserved sequence WRKYGQK and a zinc finger motif (CX4–7 CX22–23 HXH/C). The WRKY family is categorized into three groups based on the number of WRKY domains and zinc finger-like motifs (Eulgem et al., 2000). The WRKY proteins have been regulating plant responses to pathogens, plant innate immunity such as microbe/pathogen-associated molecular pattern-triggered immunity (MTI∕PTI) and effector-triggered immunity (ETI) (Rushton et al., 2012). Recently several groups reported that WRKY TFs are also involved in the ABA mediated signaling networks (reviews in Rushton et al., 2012). Further, genetic analysis underscored involvement of WRKY TF in abiotic stresses such as cold and high temperature, water stress, high CO2 levels, high ozone concentrations, and salt stress (Rushton et al., 2012). Arabidopsis group IIa WRKY TFs, AtWRKY18, AtWRKY40, and AtWRKY60 interact with the chloroplast/plastid-localized ABA receptor, ABAR (Shang et al., 2010). Initial reports on ABA receptor (ABAR) cytosolic C-terminus interacts with a group of WRKY TFs (AtWRKY40, AtWRKY18, and AtWRKY60) that function as a negative regulator of ABA signaling. Knockout studies of AtWRKY18, AtWRKY40, and AtWRKY60 observed ABA-hypersensitive phenotypes in ABA-induced post germination growth arrest and inhibition of seed germination suggesting that they negatively regulate ABA signaling. The knockout lines of Arabidopsis wrky40/wrky18 showed altered ABA responsive gene expression including ABF4, ABI1, ABI2, ABI4, ABI5, DREB1A, DREB2A, MYB2, PYL2∕RCAR13, PYL2∕RCAR11, RAB18, PYL2∕RCAR9, PYL2∕RCAR7, SnRK2.2, and

k

k

k

184

k

Mechanism of Plant Hormone Signaling under Stress

SnRK2.3 (Shang et al., 2010). Group III subfamily member AtWRKY63 is another WRKY TF involved in the ABA mediated response. T-DNA insertion in AtWRKY63, referred to as a ABA-hypersensitive abo3 mutant, showed impairment in seedling establishment and seedling growth. WRKY63/ABO3 is bound to the W-box in the promoter of AREB1/ABF2 in accordance with repressed expression of the AREB1/ABF2 gene in abo3 mutant plants, and the ABA-dependent induction of WRKY63/ABO3 was impaired in the abi1, abi2, and abi5 mutants (Ren et al., 2010). Together, these data showed that WRKY63 is one of the central components of the ABA-dependent gene regulatory network that also involves group A, ABRE-dependent bZIP TFs. The AtWRKY40 appears to act upstream of the bZIP transcription factor ABI5, whereas AtWRKY63 acts downstream during seed germination and post germination growth (Ren et al., 2010; Shang et al., 2010). Overexpression studies of WRKY25 or WRKY33 enhanced salt tolerance and ABA sensitivity (Jiang et al., 2009). Ectopic expression of WRKY25, WRKY26, and WRKY33 affects resistance to heat stress and the triple mutant wrky25/wrky26/wrky33 was more sensitive to heat stress than wild-type plants (Li et al., 2011). Recently, genetic analysis showed that WRKY57 improved drought tolerance in Arabidopsis by increasing the ABA level and upregulating stress-responsive genes. The ChIP assays proved that WRKY57 is bound to the RD29A promoter and the ABA biosynthesis gene 9-cis-epoxycarotenoid dioxygenase3 (NCED3) (Jiang et al., 2012). Group I member WRKY2 affects seed germination and post germination growth in Arabidopsis. The mutant wrky2 analyses observed downregulation of ABI5 and ABI3 and upregulation of the LEA, Em1, and Em6 (Jiang and Yu, 2009). In rice, heat-inducible HSP101 promoter driven expression of OsWRKY11 showed enhanced drought and heat tolerance (Wu et al., 2009). These studies improved the understanding of WRKY TF factors in ABA mediated abiotic stress modulation. To date, very few reports are available on WRKY TF, which is involved in abiotic stresses. The connection between WRKY TF, ABA signaling, and abiotic stress is one of the main areas for further exploration. 8.5.5 C2 H2 ZF TF

C2 H2 -type zinc finger proteins contain DNA-binding motifs with conserved two cysteine and two histidine residues bound to one zinc ion tetrahedrally, and represented as CX2–4 CX3 FX5 LX2 HX3–5 H. The Arabidopsis genome encodes approximately 176 C2 H2 -type zinc finger (Ciftci-Yilmaza and Mittler, 2008). C2 H2 zinc figure proteins have an ERF-associated amphiphilic repression (EAR) domain that acts as transcriptional repressors and regulate responses to abiotic stresses. Based on zinc finger position and sequence, all A. thaliana C2 H2 -type zinc finger proteins are divided into three different groups (A, B, and C), and are further divided into different subgroups (C1, C2, and C3), which in turn are again divided into different families and subclasses (Englbrecht et al., 2004). C2 H2 -type zinc finger TFs plays important role in metabolic pathways, stress response and defense induction in plants. Some important members of this group include the stress-response proteins Zat12 and Zat10/STZ. Gain- and loss-of-function mutations in Zat10 enhance the tolerance of plants to abiotic stress (Mittler et al., 2006). Subclass C1 members of Arabidopsis AtZF1 and AZF2 were induced by osmotic stress and ABA, and overexpression study affects plant growth

k

k

k

8 Mechanism of ABA Signaling in Abiotic Stress

185

and viability. A set of genes were down regulated by osmotic stress, ABA treatment and many auxin (IAA)-responsive genes, which are repressed by AZF1 and AZF2. The data suggested that AZF1 and AZF2 work as transcriptional repressors to inhibit plant growth by inhibiting auxin-mediated plant growth under abiotic stress conditions (Kodaira et al., 2011). Arabidopsis SUPERMAN, SUP-family gene, designated the SA- and ABA-downregulated zinc finger gene (SAZ), negatively regulates a subset of ABA-responsive genes, including RD29B and RAB18 in Arabidopsis under normal conditions (Jiang et al., 2008). 8.5.6 MYB TF

k

In plants, MYB/bHLH complexes regulate various cellular processes such as cell wall synthesis, cell death, circadian clock, responses to abiotic and biotic stress, hormone signaling, and biosynthesis of specialized metabolites (Lindemose et al., 2013; Pireyre and Burow, 2015). The Arabidopsis genome encodes 339 MYB TFs, characterized by sequence repeats R1- R3 of the MYB domain. The R2R3-MYB sub-family is highly diverse in plants and most of the genes are involved in ABA-mediated abiotic stress responses. Most of bHLHs physically interact with various MYBs to perform function. Along with bHLH and MYB interaction, another partner cytosolic WD40 repeat proteins participated through formation of highly dynamic MYB/bHLH/WD40 (MBW) complexes (Pireyre and Burow, 2015). AtMYB60 is a R2R3-MYB gene of Arabidopsis, the first transcription factor involved in the regulation of stomatal movement. AtMYB60 is expressed in guard cells and its expression is negatively regulated by drought stress. A null mutation of Arabidopsis myb60 showed constitutive reduction of stomatal opening and decreased wilting under water stress conditions (Cominelli et al., 2005). The MYB44/MYBR1 was regulated via ABA-dependent stomatal closure in response to abiotic stress. Genetic analysis of MYB96 in Arabidopsis helped to establish a molecular connection that mediates ABA-auxin crosstalk in drought stress response and lateral root growth, providing an adaptive strategy under drought stress conditions (Seo et al., 2009). AtMYC2 and AtMYB2 proteins function as transcriptional activators in ABA-inducible gene expression under drought stress in plants. R2R3 type MYB transcription factor MYB15 is involved in cold regulation and binds to the promoter of DREB1B/CBF1, DREB1C/CBF2, and DREB1A/CBF3 for acquired freezing tolerance (Agarwal et al., 2006). Ding at al. (2009) reported MYB15 overexpressed Arabidopsis lines showed improved drought and salt tolerance, and resulted in ABA-hypersensitivity. 8.5.7 bHLH TF

The basic/helix-loop-helix (bHLH) TFs have DNA binding and dimerization abilities. They are involved in several different functions in essential physiological and developmental process in plants. The bHLH domain contains approximately 60 amino acids with two functionally distinct regions, the basic region and the HLH regions (Wang et al., 2015). The bHLH family consists of 162 members in Arabidopsis genome, and a few of these play a role in ABA-signaling and abiotic stress responses. Two most important bHLH TFs, MYC2 and AtAIB, have been reported to be involved in ABA-dependent gene expression in Arabidopsis. MYC2 has multiple synonymous factors, such as RD22BP1, RAP-1, AtbHLH006, and ZBF1 (Lindemose et al., 2013).

k

k

k

186

Mechanism of Plant Hormone Signaling under Stress

The TF MYC2/RD22BP1 was characterized as a positive regulator of ABA-inducible genes under osmotic stress conditions. MYC2 function cooperatively with MYB2 TFs in transactivation of the RD22 gene. MYC2 has been considered as the master regulator of crosstalk between the signaling pathways of JA and ABA, SA, GA, and auxin (IAA) (Kazan and Manners, 2012). The ABA-inducible AIB positively regulated ABA responses in Arabidopsis and overexpressing AIB lines showed increased drought tolerance (Li et al., 2007). The bHLH92 was activated by NaCl, dehydration, mannitol, and cold treatments, and overexpression of bHLH92 resulted in a slightly increased tolerance against NaCl and osmotic stresses (Jiang et al., 2009). The well-characterized bHLH TF inducer of CBF expression 1 (ICE1) is a regulator of CBF genes during cold conditions. The ice1 mutant abrogated the expression of DREB1A/CBF3 and decreased the expression of many genes downstream of CBFs, which resulted in a significant reduction in plant tolerance to cold and freezing (Chinnusamy et al., 2003). ICE1 interacted with MYB15 and together control the DREB1A/CBF3 promoter to regulate cold stress tolerance (Agarwal et al., 2006).

8.6 Crosstalk Between Various ABA Responsive Pathways in Abiotic Stress

k

Molecular crosstalk is referred as an interaction between two or more signaling pathways and their components. Signal cascades can branch in both convergent and divergent manners and regulate either positively or negatively. Several abiotic stresses such as drought, salt, and cold imposed both general and specific effects on plant growth and development. The common consequences are associated with osmotic and oxidative stress due to exposure of drought, salinity, and cold stresses (Huang et al., 2012; Roychoudhury et al., 2013; Kohli et al., 2013). The published reports suggest that preliminary effect of salt and drought stresses are osmotic stress, which is further conveyed through two pathways: ABA-dependent and ABA independent. However, cold stress signaling cascades mostly regulated through an ABA-independent pathway (Roychoudhury et al., 2013). The demarcation between ABA-dependent and independent pathways is completely blurred. The node is a central potential component of crosstalk, which is commonly shared by various abiotic stress elements (Knight and Knight, 2001). ABA dependent pathways are regulated by unique class of cis-acting element referred as ABA responsive element (ABRE) present in ABA responsive promoter. The interactions between several transcription factors provide a crosstalk between different abiotic stress signaling pathways. The CBF/DREB1 TF family members are mainly induced by cold stress, but the CBF4 gene is induced by drought stress and functions as crosstalk between DREB2 and CBF/DREB1 regulatory systems. The CBF4 follows ABA-dependent pathways suggesting that CBF4 function may depend on the accumulation of ABA and responds slowly to drought stress. RD29A (dehydration induced gene) promoter has both cis-acting elements; DRE/C-repeat and ABRE are excellent examples of ABA dependent and ABA-independent gene regulation. The DRE/DRE-core motif might be core element of ABRE, and DRE as well as ABRE are interdependent in stress responsive expression of the RD29A gene (Narusaka et al., 2003). The activation of RD29A transcription depends upon the coordination between the DRE and ABRE elements. DREB1A and DREB2A, are bound to the DRE or DRE

k

k

k

8 Mechanism of ABA Signaling in Abiotic Stress

187

core, and two AREB proteins, AREB1 and AREB2, are bound to the ABRE of RD29A (Narusaka et al., 2003). However, the RD29A promoter with GUS fusion gene was cumulatively transactivated by DREB and AREB proteins. The OsDREB1F responded to exogenous ABA treatment and was induced by drought or salt stresses in rice, suggesting that OsDREB1F was involved in both the stress-responsive and ABA signaling pathways (Wang et al., 2008). Overexpression studies with OsDREB1F have also shown increased expression of both ABA-independent (cor15a, rd29A) and ABA-dependent (Rab18, rd29b) genes. The expression of CBF/DREB1 family members such as CBF4/ DREB1D is induced by osmotic stress and the DDF1/DREB1F and DDF2/DREB1E are activated by high-salinity stress, suggesting the existence of crosstalk between the CBF/DREB1 and the DREB2 pathways. The fiery1 (fry1) mutant impaired a bifunctional enzyme and evidenced that phosphoinositides (IP3) function as second messenger in stress and ABA signaling. An analysis of double mutants between fry1 and aba1 or abi1 indicated that the cold or osmotic stress hypersensitivity in the mutant is not dependent on ABA. FRY1 encodes an inositol polyphosphate 1-phosphatase that is required for IP3. The studies suggest that ABA signaling cascades act as points of convergence in various forms of abiotic stresses in plants.

8.7 Summary and Future Prospects k

ABA is considered as universal abiotic stress phytohormone. The perception of environmental cues leads to accumulation of ABA level, which further activates ABA dependent responses. ABA binds to intracellular soluble receptor such as PYL family members. When ABA binds to intracellular receptors, it forms a ternary complex (ABA-PYL-ABI2) with protein phosphatase 2C members, which blocks PP2C phosphatase activity. As soon as PP2C gets blocked, members of SnRK kinase are activated via phosphorylation at ser/thr domain. Members of SnRK such as SnRK2.2, SnRK2.3, and SnRK2.6 are master regulators of various abiotic stresses. All these SnRK2 further convey signal towards downstream elements through AREB/ABF transcription factor phosphorylation. Four transcription factors such as AREB1, AREB2, ABF3, and ABF1 play crucial roles in abiotic stress. AREB transcription factor thus induces ABA responsive genes, which further leads to adaptation under various abiotic stresses. Several families of ABA receptors have been identified, but most of their modes of action remain poorly understood. Therefore, identifying the signaling components and molecular events from ABA perception to their physiological function is essential. Further investigation is required to identify ABA dependent downstream targets in GTGs signaling cascade. More than 200 possible combinations exist between PYL/RCAR-PP2C-SnRK2 complexes. Each combination may regulate various downstream targets resulting in large complexity in fine-tuning of the regulation. Several transcription factor families are involved in the ABA signaling process, this is another important avenue for future research. Recently, very few members have been reported from various TF families that are actually involved in the ABA mediated regulation. The crosstalk between various TF is another important thrust area that needs further investigation. In conclusion, the relevance of ABA signaling mechanism has provided insights into molecular events and requires further translation in agriculture to create new avenues for crop improvement under various abiotic stresses.

k

k

k

188

Mechanism of Plant Hormone Signaling under Stress

Acknowledgments Junior research fellowship to AAS from University Grant Commission (UGC), India is gratefully acknowledged. The work in KK lab is supported by financial assistance from the Science and Engineering Research Board (SB/FT/LS-312/2012), Department of Science & Technology, India.

Abbreviations ABI1: ABA insensitive 1, ABI2: ABA insensitive 2, AHG3: ABA Hypersensitive Germination 3, HAB1: Homology to ABI1 1, HAB2: Homology to ABI1 2, HAI1: Highly ABA-Induced PP2C 1, HAI2: Highly ABA-Induced PP2C 2, HAI3: Highly ABA-Induced PP2C 3, AHG1: ABA Hypersensitive Germination 1. SnRK: SNF1-related kinases, AREB1: ABA responsive element binding protein 1, ABF2: ABA Binding factor 2, AREB2: ABA responsive element binding protein 2, ABF4: ABA binding factor 4, ABF1: ABA binding factor 1: ABF3: ABA binding factor 3.

References

k

Agarwal M, Hao Y, Kapoor A, Dong CH, Fujii H, Zheng X, Zhu JK (2006). A R2R3 type MYB transcription factor is involved in the cold regulation of CBF genes and in acquired freezing tolerance. Journal of Biological Chemistry 281:37636–37645. Antoni R, Gonzalez-Guzman M, Rodriguez L, Rodrigues A, Pizzio GA, Rodriguez PL (2012). Selective inhibition of clade A phosphatases type 2C by PYR/PYL/RCAR abscisic acid receptors. Plant Physiology 158:970–980. Atkinson NJ, Lilley CJ, Urwin PE (2013). Identification of genes involved in the response of Arabiidopsis to simultaneous biotic and abiotic stresses. Plant Physiology 162: 2028–2041. Boudsocq M, Barbier-Brygoo H, Lauriere C (2004). Identification of nine sucrose nonfermenting 1-related protein kinases 2 activated by hyperosmotic and saline stresses in Arabidopsis thaliana. Journal of Biological Chemistry 279:41758–41766. Boudsocq M, Lauriere C (2005). Osmotic signaling in plants. Multiple pathways mediated by emerging kinase families. Plant Physiology 138:1185–1194. Cavanagh C, Morell M, Mackay I, Powell W (2008). From mutations to MAGIC: resources for gene discovery, validation and delivery in crop plants. Current Opinion in Plant Biology 11:215–221. Chinnusamy V, Gong Z, Zhu JK (2008). Abscisic acid-mediated epigenetic processes in plant development and stress responses. Journal of Integrative Plant Biology 50:1187–1195. Chinnusamy V, Ohta M, Kanrar S, Lee BH, Hong X, Agarwal M, Zhu JK (2003). ICE1: A regulator of cold-induced transcriptome and freezing tolerance in Arabidopsis. Genes and Development 17:1043–1054. Chinnusamy V, Zhu JK (2009). Epigenetic regulation of stress responses in plants. Current Opinion in Plant Biology 12:133–139. Ciftci-Yilmaz S, Mittler R (2008). The zinc finger network of plants. Cellular and Molecular Life Sciences 65:1150–1160.

k

k

k

8 Mechanism of ABA Signaling in Abiotic Stress

k

Cominelli E, Galbiati M, Vavasseur A, Conti L, Sala T, Vuylsteke M, et al. (2005). Guard-cell-specific MYB transcription factor regulates stomatal movements and plant drought tolerance. Current Biology 15:1196–1200. Cutler SR, Rodriguez PL, Finkelstein RR, and Abrams SR (2010). Abscisic acid: Emergence of a core signaling network. Annual Review of Plant Biology 61:651–667. Ding Z, Li S, An X, Liu X, Qin H, Wang D (2009). Transgenic expression of MYB15 confers enhanced sensitivity to abscisic acid and improved drought tolerance in Arabidopsis thaliana. Journal of Genetics and Genomics 36:17–29. Du SY, Zhang XF, Lu Z, Xin Q, Wu Z, Jiang T, et al. (2012). Roles of the different components of magnesium chelatase in abscisic acid signal transduction. Plant Molecular Biology 80:519–537. Englbrecht CC, Schoof H, Böhm S (2004). Conservation, diversification and expansion of C2H2 zinc finger proteins in the Arabidopsis thaliana genome. BMC Genomics 5:1. Eulgem T, Rushton PJ, Robatzek S, Somssich IE (2000). The WRKY superfamily of plant transcription factors. Trends Plant Science 5:199–206. Finkelstein R (2013). Abscisic acid synthesis and response. The Arabidopsis Book e0166: doi: 10.1199/tab.0166. Finkelstein RR, Lynch TJ (2000). The Arabidopsis abscisic acid response gene ABI5 encodes a basic leucine zipper transcription factor. Plant Cell 12:599–610. Fuchs S, Grill E, Meskiene I, Schweighofer A (2013). Type 2C protein phosphatases in plants. FEBS Journal 280:681–693. Fujii H, and Zhu JK (2009). Arabidopsis mutant deficient in 3 abscisic acid-activated protein kinases reveals critical roles in growth, reproduction, and stress. Proceedings of the National Academy of Sciences USA 106:8380–8385. Fujita Y, Fujita M, Satoh R, Maruyama K, Parvez MM, Seki M, et al. (2005). AREB1 is a transcription activator of novel ABRE-dependent ABA signaling that enhances drought stress tolerance in Arabidopsis. Plant Cell 17:3470–3488. Fujita Y, Fujita M, Shinozaki K, Yamaguchi-Shinozaki K (2011). ABA-mediated transcriptional regulation in response to osmotic stress in plants. Journal of Plant Research 124:509–525. Fujita Y, Nakashima K, Yoshida T, Katagiri T, Kidokoro S, Kanamori N, et al. (2009). Three SnRK2 protein kinases are the main positive regulators of abscisic acid signaling in response to water stress in Arabidopsis. Plant Cell Physiology 50:2123–2132. Goda H, Sasaki E, Akiyama K, Maruyama-Nakashita A, Nakabayashi K, Li W, et al. (2008). The At GenExpress hormone and chemical treatment data set: experimental design, data evaluation, model data analysis and data access. Plant Journal 55:526–542. Gomez-Porras J, Riano-Pachon D, Dreyer I, Mayer J, Mueller-Roeber B (2007). Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice. BMC Genomics 8:260. Gonzalez-Guzman M, Pizzio GA, Antoni R, Vera-Sirera F, Merilo E, Bassel GW, et al. (2012). Arabidopsis PYR/PYL/RCAR receptors play a major role in quantitative regulation of stomatal aperture and transcriptional response to abscisic acid. Plant Cell 24:2483–2496. Halford NG, Hey SJ (2009). Snf1-related protein kinases (SnRK) act within an intricate network that links metabolic and stress signaling in plants. Biochemistry Journal 419:247–259.

k

189

k

k

190

k

Mechanism of Plant Hormone Signaling under Stress

Hrabak EM, Chan CWM, Gribskov M, Harper JF, Choi JH, Halford N, et al. (2003). The Arabidopsis CDPK-SnRK superfamily of protein kinases. Plant Physiology 132:666–680. Hu R, Qi G, Kong Y, Kong D, Gao Q, Zhou G (2010). Comprehensive analysis of NAC domain transcription factor gene family in Populus trichocarpa. BMC Plant Biology 10: 145. Huang GT, Ma SL, Bai LP, Zhang L, Ma H, Jia P, Guo ZF, et al. (2012). Signal transduction during cold, salt, and drought stresses in plants. Molecular Biology Reports 39:969–987. Hubbard KE, Nishimura N, Hitomi K, Getzoff ED, Schroeder JI (2010). Early abscisic acid signal transduction mechanisms: newly discovered components and newly emerging questions. Genes and Development 24:1695–1708. IPCC 2007. Climate change 2007: The physical science basis. In: Solomon S, Qin D, Manning M, Chen Z, Marquis M, Averyt KB, Tignor M, Miller HL (eds) Contribution of Working Group I to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change. Geneva: IPCC Secretariat. IPCC 2008. Climate change and water. In: Bates BC, Kundzewicz ZW, Palutikof J, Wu S (eds). Technical Paper of the Intergovernmental Panel on Climate Change. Geneva: IPCC Secretariat, 210. Iyer NJ, Tang Y, Mahalingam R (2013). Physiological, biochemical and molecular responses to a combination of drought and ozone in Medicago truncatula. Plant, Cell & Environment 36: 706–720. Jakoby M, Weisshaar B, Dröge-Laser W, Vicente-Carbajosa J, Tiedemann J, Kroj T, et al (2002). bZIP transcription factors in Arabidopsis. Trends in Plant Sciences 7:106–111. Jiang CJ, Aono M, Tamaoki M, Maeda S, Sugano S, Mori M, Takatsuji H (2008). SAZ, a new SUPERMAN-like protein, negatively regulates a subset of ABA-responsive genes in Arabidopsis. Molecular Genetics and Genomics 279:183–192. Jiang W, Yu D (2009). Arabidopsis WRKY2 transcription factor mediates seed germination and post germination arrest of development by abscisic acid. BMC Plant Biology 9:96. Jiang Y, Liang G, Yu D (2012). Activated expression of WRKY57 confers drought tolerance in Arabidopsis. Molecular Plant 5:1375–1388. Jiang Y, Yang B, Deyholos MK (2009). Functional characterization of the Arabidopsis bHLH92 transcription factor in abiotic stress. Molecular Genetics and Genomics 282:503–516. Joshi-Saha A, Valon C, Leung JA (2011). Brand new START: abscisic acid perception and transduction in the guard cell. Science Signaling 4:201. Kazan K, Manners JM (2012). MYC2: The Master in Action. Molecular Plant doi:10.1093/mp/sss128. Kim JS, Mizoi J, Kidokoro S, Maruyama K, Nakajima J, Nakashima K, et al. (2012). Arabidopsis growth-regulating factor7 functions as a transcriptional repressor of abscisic acid- and osmotic stress-responsive genes, including DREB2A. Plant Cell 24:3393–3405. Kim S, Kang JY, Cho DI, Park JH, Kim SY (2004). ABF2, an ABRE-binding bZIP factor, is an essential component of glucose signaling and its overexpression affects multiple stress tolerance. Plant Journal 40:75–87. Kim TH, Bohmer M, Hu H, Nishimura N, Schroeder JI (2010). Guard cell signal transduction network: advances in understanding abscisic acid, CO2 , and Ca2+ signaling. Annual Review of Plant Biology 61:561–591. Knight H, Knight MR (2001). Abiotic stress signalling pathways: specificity and cross-talk. Trends in Plant Science 6:262–267.

k

k

k

8 Mechanism of ABA Signaling in Abiotic Stress

k

Kodaira KS, Qin F, Tran LS, Maruyama K, Kidokoro S, Fujita Y, et al. (2011). Arabidopsis Cys2/His2 zinc-finger proteins AZF1 and AZF2 negatively regulate abscisic acid-repressive and auxin-inducible genes under abiotic stress conditions. Plant Physiology 157:742–756. Kohli A, Sreenivasulu N, Lakshmanan P, Kumar PP (2013). The phytohormone crosstalk paradigm takes center stage in understanding how plants respond to abiotic stresses. Plant Cell Reports 32:945–957. Komatsu K, Suzuki N, Kuwamura M, Nishikawa Y, Nakatani M, Ohtawa M, et al. (2013). Group A PP2Cs evolved in land plants as key regulators of intrinsic desiccation tolerance. Nature Communications 4:1–9. Kulik A, Wawer I, Krzywinska E, Bucholc M, Dobrowolska G (2011). SnRK2 protein kinases-key regulators of plant response to abiotic stresses. OMICS A Journal of Integrative Biology 15:859–872. Lee SJ, Kang JY, Park HJ, Kim MD, Bae MS, Choi HI, Kim SY (2010). DREB2C interacts with ABF2, a bZIP protein regulating abscisic acid-responsive gene expression, and its overexpression affects abscisic acid sensitivity. Plant Physiology 153:716–727. Li H, Sun J, Xu Y, Jiang H, Wu X, Li C (2007). The bHLH-type transcription factor AtAIB positively regulates ABA response in Arabidopsis. Plant Molecular Biology 65:655–665. Li S, Fu Q, Chen L, Huang W, Yu D (2011). Arabidopsis thaliana WRKY25, WRKY26, and WRKY33 coordinate induction of plant thermo tolerance. Planta 233:1237–1252. Lindemose S, O’Shea C, Jensen MK, Skriver K (2013). Structure, function and networks of transcription factors involved in abiotic stress responses. International Journal of Molecular Sciences 14:5842–5878. Liu X, Yue Y, Li B, Nie Y, Li W, Wu W, et al. (2007). A G protein coupled receptor is a plasma membrane receptor for the plant hormone abscisic acid. Science 315:1712–1716. Liu ZQ, Yan L, Wu Z, Mei C, Lu K, Yu YT, et al. (2012). Cooperation of three WRKY-domain transcription factors WRKY18, WRKY40, and WRKY60 in repressing two ABA-responsive genes ABI4 and ABI5 in Arabidopsis. Journal of Experimental Botany 63:6371–6392. Lu PL, Chen NZ, An R, Su Z, Qi BS, et al. (2007). A novel drought-inducible gene, ATAF1, encodes a NAC family protein that negatively regulates the expression of stress-responsive genes in Arabidopsis. Plant Molecular Biology 63:289–305. Ma Y, Szostkiewicz I, Korte A, Moes D, Yang Y, Christmann A, et al. (2009). Regulators of PP2C phosphatase activity function as abscisic acid sensors. Science 324:1064–1068. Melcher K, Ng LM, Zhou XE, Soon FF, Xu Y, Suino-Powell KM, Xu HE (2009). A gate–latch–lock mechanism for hormone signalling by abscisic acid receptors. Nature, 462:602–608. Melcher K, Zhou XE, Xu HE (2010). Thirsty plants and beyond: structural mechanisms of abscisic acid perception and signaling. Current Opinion Structural Biology 20:722–729. Mittler R, Blumwald E (2010). Genetic engineering for modern agriculture: challenges and perspectives. Annual Review of Plant Biology 61: 443–462. Mittler R, Kim Y, Song L, Coutu J, Coutu A, Ciftci-Yilmaz S, et al. (2006). Gain- and loss-of-function mutations in Zat10 enhance the tolerance of plants to abiotic stress. FEBS Letter 580:6537–6542. Miyazono KI, Miyakawa T, Sawano Y, Kubota K, Kang HJ, Asano A, et al., (2009). Structural basis of abscisic acid signalling. Nature 462:609–614.

k

191

k

k

192

k

Mechanism of Plant Hormone Signaling under Stress

Munns R, Tester M (2008). Mechanisms of salinity tolerance. Annual Review of Plant Biology 59: 651–681. Mustilli A, Merlot S, Vavasseur A, Fenzi F, Giraudat J (2002). Arabidopsis OST1 protein kinase mediates the regulation of stomatal aperture by abscisic acid and acts upstream of reactive oxygen species production. Plant Cell 14:3089–3099. Nakashima K, Fujita Y, Kanamori N, Katagiri T, Umezawa T, Kidokoro S, et al. (2009). Three Arabidopsis SnRK2 protein kinases, SRK2D/SnRK2.2, SRK2E/SnRK2.6/OST1 and SRK2I/SnRK2.3, involved in ABA signaling are essential for the control of seed development and dormancy. Plant and Cell Physiology 50:1345–1363. Nakashima K, Fujita Y, Katsura K, Maruyama K, Narusaka Y, Seki M, et al. (2006). Transcriptional regulation of of ABI3-and ABA-responsive genes including RD29B and RD29A in seeds, germinating embryos, and seedlings of Arabidopsis. Plant Molecular Biology 60:51–68. Nakashima K, Shinwari ZK, Sakuma Y, Seki M, Miura S, Shinozaki K, Yamaguchi-Shinozaki K (2000). Organization and expression of two Arabidopsis DREB2 genes encoding DRE-binding proteins involved in dehydration- and high-salinity-responsive gene expression. Plant Molecular Biology 42:657–665. Nakashima K, Yamaguchi-Shinozaki K, Shinozaki K (2014). The transcriptional regulatory network in the drought response and its crosstalk in abiotic stress responses including drought, cold, and heat. Frontiers in Plant Science 5:170. Narusaka Y, Nakashima K, Shinwari ZK, Sakuma Y, Furihata T. et al. (2003). Interaction between two cis-acting elements, ABRE and DRE, in ABA-dependent expression of Arabidopsis rd29A gene in response to dehydration and high salinity stresses. The Plant Journal 34:137–148. Nishimura N, Hitom K, Arvai AS, Rambo RP, Hitomi C, Cutler SR, et al. (2009). Structural mechanism of abscisic acid binding and signaling by dimeric PYR1. Science 326:1373–1379. Nishimura N, Sarkeshik A, Nito K, Park S, Wang A, Carvalho PC, et al. (2010). PYR/PYL/RCAR family members are major in-vivo ABI1 protein phosphatase 2C-interacting proteins in Arabidopsis. Plant Journal 61:290–299. Ohta M, Guo Y, Halfter U, Zhu JK (2003). A novel domain in the protein kinase SOS2 mediates interaction with the protein phosphatase 2C ABI2. Proceedings of the National Academy of Sciences USA 100:11771–11776. Pandey S, Nelson DC, Assmann SM (2009). Two novel GPCR type G proteins are abscisic acid receptors in Arabidopsis. Cell 136:136–148. Park S, Fung P, Nishimura N, Jensen DR, Fujii H, Zhao Y, et al. (2009). Abscisic acid inhibits type 2C protein phosphatases via the PYR/PYL family of START proteins. Science 324:106–1071. Pireyre M, Burow M (2015). Regulation of MYB and bHLH transcription factors–a glance at the protein level. Molecular Plant 8:378–388. Prasch CM, Sonnewald U (2013). Simultaneous application of heat, drought, and virus to Arabidopsis plants reveals significant shifts in signaling networks. Plant Physiology 162: 1849–1866. Raghavendra AS, Gonugunta VK, Christmann A, Grill E (2010). ABA perception and signaling. Trends in Plant Science 15:395–401.

k

k

k

8 Mechanism of ABA Signaling in Abiotic Stress

k

Rasmussen S, Barah P, Suarez-Rodriguez MC, Bressendorff S, Friis P, Costantino P, et al. (2013). Transcriptome responses to combinations of stresses in Arabidopsis. Plant Physiology 161: 1783–1794. Ren X, Chen Z, Liu Y, Zhang H, Zhang M, Liu Q, et al. (2010). ABO3, a WRKY transcription factor, mediates plant responses to abscisic acid and drought tolerance in Arabidopsis. The Plant Journal 63:417–429. Ross CA, Liu Y, Shen QJ (2007). The WRKY gene family in rice (Oryza sativa). Journal of Integrative Plant Biology 49:827–842. Roychoudhury A, Paul S, Basu S (2013). Cross-talk between abscisic acid-dependent and abscisic acid-independent pathways during abiotic stress. Plant Cell Reports 32:985–1006. Rushton DL, Tripathi P, Rabara RC, Lin J, Ringler P, Boken AK, et al. (2012). WRKY transcription factors: key components in abscisic acid signalling. Plant Biotechnology Journal 10:2–11. Saavedra X, Modrego A, Rodriguez D, Gonzalez-Garcia MP, Sanz L, Nicolas G, et al. (2010). The nuclear interactor PYL8/RCAR3 of Fagus sylvatica FsPP2C1 is a positive regulator of abscisic acid signaling in seeds and stress. Plant Physiology152:133–150. Sakuma Y, Maruyama K, Osakabe Y, Qin F, Seki M, Shinozaki K, et al. (2009). The abscisic acid receptor PYR1 in complex with abscisic acid. Nature 462:665–668. Santiago J, Rodrigues A, Saez A, Rubio S, Antoni R, et al. (2009). Modulation of drought resistance by the abscisic acid-receptor PYL5 through inhibition of clade A PP2Cs. The Plant Journal 16:16. Schweighofer A, Meskiene I (2008). Protein phosphatases in plant growth signaling pathways. In: Boegre L (ed.) Plant Growth Signaling. Heidelberg: Springer-Verlag, 277–297. Seo PJ, Xiang F, Qiao M, Park JY, Lee YN, Kim SG, et al. (2009). The MYB96 transcription factor mediates abscisic acid signaling during drought stress response in Arabidopsis. Plant Physiology 151:275–289. Shang Y, Yan L, Liu ZQ, Cao Z, Mei C, Xin Q, et al. (2010). The Mg-Chelatase H subunit of Arabidopsis antagonizes a group of WRKY transcription repressors to relieve ABA responsive genes of inhibition. Plant Cell 22: 1909–1935. Shen Y, Wang X, Wu F, Du S, Cao Z, Shang Y, et al. (2006). The Mg-chelatase H subunit is an abscisic acid receptor. Nature 443:823–826. Singh A, Giri J, Kapoor S, Tyagi AK, Pandey GK (2010). Protein phosphatase complement in rice: genome-wide identification and transcriptional analysis under abiotic stress conditions and reproductive development. BMC Genomics 11:435. Singh, A., and Pandey, G. K. (2012). Protein phosphatases: a genomic outlook to understand their function in plants. Journal of Plant Biochemistry and Biotechnology, 21:100–107. Soon FF, Ng LM, Zhou XE, West GM, Kovach A, Eileen Tan MH, et al. (2012) Molecular mimicry regulates ABA signaling by SnRK2 kinases and PP2C phosphatases. Science 335:85–88. Umezawa T, Sugiyama N, Mizoguchi M, Hayashi S, Myouga F, Yamaguchi-Shinozaki K. et al. (2009). Type 2C protein phosphatases directly regulate abscisic acid-activated protein kinases in Arabidopsis. Proceedings of the National Academy of Sciences USA 106:17588–17593. Uno Y, Furihata T, Abe H, Yoshida R, Shinozaki K, Yamaguchi-Shinozaki K (2000). Arabidopsis basic leucine zipper transcription factors involved in an abscisic

k

193

k

k

194

k

Mechanism of Plant Hormone Signaling under Stress

acid-dependent signal transduction pathway under drought and high-salinity conditions. Proceedings of the National Academy of Sciences USA 97:11632–11637. Vlad F, Rubio S, Rodrigues A, Sirichandra C, Belin C, Robert N, et al. (2009). Protein phosphatases 2C regulate the activation of the Snf1-related kinase OST1 by abscisic acid in Arabidopsis. Plant Cell 21:3170–3184. Wang J, Hu Z, Zhao T, Yang Y, Chen T, Yang M, et al., (2015). Genome-wide analysis of bHLH transcription factor and involvement in the infection by yellow leaf curl virus in tomato (Solanum lycopersicum). BMC Genomics 16:39. Wang P, Xue L, Batelli G, Lee S, Hou YJ, Van Oosten MJ et al. (2013). Quantitative phosphoproteomics identifies SnRK2 protein kinase substrates and reveals the effectors of abscisic acid action. Proceedings of the National Academy of Sciences USA 110:11205–11210. Wang Q, Guan Y, Wu Y, Chen H, Chen F, et al (2008). Overexpression of a rice OsDREB1F gene increases salt, drought, and low temperature tolerance in both Arabidopsis and rice. Plant Molecular Biology 67:589–602. Wu FQ, Xin Q, Cao Z, Liu Z-Q, Du S-Y, et al. (2009). The magnesium-chelataseH subunit binds abscisic acid and functions in abscisic acid signaling: new evidence in Arabidopsis. Plant Physiology 150:1940–1954. Xue T, Wang D, Zhang S, Ehlting J, Ni F, Jakab S, Zheng C, Zhong Y (2008). Genome-wide and expression analysis of protein phosphatase 2C in rice and Arabidopsis. BMC Genomics 9:550. Yamaguchi-Shinozaki K, Shinozaki K (2006). Transcriptional regulatory networks in cellular responses and tolerance to dehydration and cold stresses. Annual Review of Plant Biology 57:781–803. Yin P, Fan H, Hao Q, Yuan X, Wu D, Pang Y, et al. (2009). Structural insights into the mechanism of abscisic acid signaling by PYL proteins. Nature Structural Molecular Biology 16:1230–1236. Yoshida R, Hobo T, Ichimura K, Mizoguchi T, Takahashi F, Aronso J, et al. (2002). ABA-activated SnRK2 protein kinase is required for dehydration stress signaling in Arabidopsis. Plant and Cell Physiology 43:1473–1483. Yoshida R, Umezawa T, Mizoguchi T, Takahashi S, Takahashi F, Shinozaki K (2006a). The regulatory domain of SRK2E/OST1/SnRK2.6 interacts with ABI1 and integrates abscisic acid (ABA) and osmotic stress signals controlling stomatal closure in Arabidopsis. Journal of Biological Chemistry 281:5310–5318. Yoshida T, Fujita Y, Maruyama K, Mogami J, Todaka D, Shinozaki K, et al. (2010). AREB1, AREB2, and ABF3 are master transcription factors that cooperatively regulate ABRE-dependent ABA signaling involved in drought stress tolerance and require ABA for full activation. Plant Journal 61:672–685. Yoshida T, Nishimura N, Kitahata N, Kuromori T, Ito T, Asami T, et al. (2006b). ABA-hypersensitive germination3 encodes a protein phosphatase 2C (AtPP2CA) that strongly regulates abscisic acid signaling during germination among Arabidopsis protein phosphatase 2Cs. Plant Physiology 140:115–126. Zhang W, Ruan J, Ho TD, You Y, Yu T, Quatrano RS (2005a). Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana. Bioinformatics 21: 3074–3081.

k

k

k

8 Mechanism of ABA Signaling in Abiotic Stress

195

Zhang X, Garreton V, Chua NH (2005b). The AIP2 E3 ligase acts as a novel negative regulator of ABA signaling by promoting ABI3 degradation. Genes and Development 19: 1532–43 Zhang XL, Jiang L, Xin Q, Liu Y, Tan JX, Chen ZZ (2015). Structural basis and functions of abscisic acid receptors PYLs. Frontiers in Plant Science 6:88. Zhao Y, Chan Z, Xing L, Liu X, Hou YJ, Chinnusamy V, et al. (2013). The unique mode of action of a divergent member of the ABA-receptor protein family in ABA and stress signaling. Cell Research 23:1380–1395.

k

k

k

k

197

9 Abscisic Acid Signaling and Involvement of Mitogen Activated Protein Kinases and Calcium-Dependent Protein Kinases During Plant Abiotic Stress Aryadeep Roychoudhury and Aditya Banerjee Post Graduate Department of Biotechnology, St. Xavier’s College (Autonomous), Kolkata, West Bengal, India

9.1 Introduction

k

Plants are sedentary, sessile organisms. They inevitably require well-developed mechanisms to tackle adverse environmental conditions. Plants have highly evolved signaling networks to withstand such abiotic stresses. Stress may be caused by high saline contents of the soil, high or low temperature, oxidative stresses, limited nutrient availability, and heavy metal toxicity, all of which lead to the retardation of normal growth of the traditional glycophytes. The stress-inducible genes that produce gene products to help the plants combat against such adverse situations can be grouped under three major categories: (i) genes involved in signal transduction pathways (STPs) and transcriptional control; (ii) genes with membrane and endogenous protein protective functions; and (iii) genes assisting with water and ion uptake and their transport (Vierling 1991; Ingram and Bartels 1996; Smirnoff 1998; Shinozaki and Yamaguchi-Shinozaki 2000). Abscisic acid (ABA) is one of the most intensely studied stress phytohormones that mediate diverse stress responses. The accumulating evidences also point towards ABA, playing pivotal roles in plant defense. ABA is reckoned as the “universal stress hormone” regulating other plant developmental processes including seed dormancy, germination, growth, and stomatal movements. A series of morphological, physiological, biochemical, and molecular changes are enhanced in plants due to abiotic stresses that deteriorate cell growth in tissues and adversely affect plant growth and productivity (Wang et al. 2001). Similar cellular damages may occur due to interconnections of drought, salinity, extreme temperatures and oxidative stresses, for example, salinity and/or drought causes osmotic stress in plants leading to imbalanced metabolic homeostasis and ion distribution in the cell (Serrano et al. 1999; Zhu 2001). Consequently, the synergistic effects of such environmental stresses stimulate activation of similar cell signaling pathways (Knight 2000; Shinozaki and Yamaguchi-Shinozaki 2000; Zhu 2002) to enhance the activation or transcription of various stress-regulated proteins, upregulation of antioxidants, and accumulation of compatible solutes (Vierling and Kimpel 1992; Zhu et al. 1997; Cushman and Bonhert 2000; Wang et al. 2003). Such response cascades aid in the production of stress proteins, often induced by ABA-dependent STPs. The osmotic stress promotes the synthesis of ABA, which then triggers a major change in gene expression and adaptive Mechanism of Plant Hormone Signaling under Stress, First Edition, Volume 1. Edited by Girdhar Pandey. © 2017 John Wiley & Sons, Inc. Published 2017 by John Wiley & Sons, Inc.

k

k

k

198

Mechanism of Plant Hormone Signaling under Stress

physiological responses (Seki et al. 2002; Shinozaki and Yamaguchi-Shinozaki 2007; Yamaguchi-Shinozaki and Shinozaki 2006). Experimental evidences now have deciphered the core signaling complexes that perceive ABA and transmit cues to downstream events (Fuji et al. 2009; Ma et al. 2009; Park et al. 2009). Such upcoming observations have inspired researchers to unfold the link between the core ABA complex and other known regulatory pathways of stress signaling in plants, like the Mitogen Activated Protein Kinase (MAPK) and Calcium Dependent Protein Kinase (CDPK) pathways. This chapter concentrates on providing a vivid study on how the ABA is perceived by the membrane receptors, followed by the activation of messenger molecules to start off MAPK or CDPK (with obvious spurt in cytosolic calcium concentrations during stress) cascades, leading to the activation of transcription factors (TFs) binding to the cis elements (response elements) of the downstream target genes. This promotes an up regulation in the transcription of the stress-responsive genes. Translation of these accumulated transcripts increases the level of the stress proteins in the total protein pool. These stress proteins via varying mechanisms confer stress tolerance to the plant system by re-establishing the cellular homeostasis. Thus, the importance of ABA in initiating, transducing signals and finally relaying and amplifying the responses to resist against abiotic stresses encompasses a major field of research in developing stress-resistant crops.

k

9.2 ABA Signaling in Plants

k

9.2.1 ABA as a Phytohormone

ABA belongs to the class of isoprenoids often termed as terpenoids (Nambara and Marion-Poll 2005). It is a sesquiterpenoid with one asymmetric, optically active carbon atom at C-1. The naturally occurring form reckons with S-(+) ABA; the side chain of ABA by definition being 2-cis, 4-trans. Trans, trans ABA is inactive biologically, but a possible racemized product R-(-)-ABA via the ABA-trans-diol catabolite is biologically active (Vaughan and Milborrow 1988; Toorop et al. 1999). Except in Archea, ABA has been reported in all kingdoms of life (Hauser et al. 2011). This phytohormone is a common mediator in plants in response to any form of abiotic stress as has been mentioned before. In salt stress-induced water deficit of the plant, ABA controls transpiration by regulation of stomatal closure through guard cell depolarization and varying guard cell turgor and volume, driven by a well accommodated cation-anion efflux. The endogenous ABA concentrations in the leaves during water deficit can be 10–15-fold higher within hours of the onset of the stress. At the molecular level, ABA is a common regulator of the stress STPs, controlling either the ion channels or changes in the expression of myriad stress-inducible genes, translating into an altered proteome, ready to tackle the stress situations (Roychoudhury and Paul 2012). The salt-tolerant varieties of crops show a higher ability for ABA synthesis than the sensitive ones. The salt-tolerant indica rice varieties like Nonabokra and Pokkali showed 30-fold and six-fold higher peak ABA concentration, respectively, than the salt-sensitive variety, Taichung Native-1 when exposed to an osmotic shock (150 mM NaCl). It was shown earlier that the accumulation of ABA initiates a downstream signaling, which promotes synthesis of elevated amounts of several osmolytes and antioxidative systems, all of

k

k

9 ABA, MAPK, and Calcium-Dependent Protein Kinases

199

which in conjunction play role in plant stress tolerance (Roychoudhury et al. 2009). Among the other diverse functions of ABA, its high concentrations at the cellular level lead to the synthesis of storage proteins in seeds, promote seed desiccation tolerance and dormancy (Finkelstein et al. 2002, 2008), and inhibit seed germination. Lateral root formation and seedling growth are also controlled by ABA (Xiong et al. 2006). 9.2.2 ABA Metabolism

ABA biosynthesis occurs mainly via the de novo and the plastidic methyl erythritol-4phosphate (MEP) pathway. In the MEP pathway, xanthoxin formed after a chain of reactions, ultimately migrates from the plastids to the cytosol and is converted to ABA, a sesquiterpenoid compound (Milborrow 2001; Hartung et al. 2002; Nambara and Marion-Poll 2005). ABA levels are generally lowered by two pathways: (i) hydroxylation of ABA at the 8’ position by a P450 type monoxygenase, and (ii) ABA conjugation, where esterification of ABA results in ABA-glucosyl ester (ABA-GE) (Lee et al. 2006; Xu et al. 2012) (Fig. 9.1). 9.2.3 ABA Transport

k

The overall physiological responses in a plant are mediated by the translocation of ABA between cells and tissues (Schachtman and Goodger 2008; Wilkinson and Davies 2010). Most of the genes and factors with respect to ABA signaling play a significant involvement in ABA intracellular regulation (Hirayama and Shinozaki 2007, 2010). There are systemic and dynamic alterations in gene expression related to ABA or stress responses (Christmann et al. 2007; Umezawa et al. 2010). Two plasma membrane bound ATP-binding cassette (ABC) transporters have been shown to regulate cell to cell ABA transport (Kang et al. 2010; Kuromori et al. 2010) along with a family of low affinity nitrate transporters (Kanno et al. 2012). Most of the ABC transporters are integral membrane proteins and act as ATP-driven transporters for a very wide range of substrates, including lipids, drugs, heavy metals, and auxin (Rea 2007; Danquah et al. 2014). One of the ABC transporter genes, AtABCG25 (also referred as AtWBC26) encodes a half size transporter protein responsible for ABA transport and responses in Arabidopsis (Kuromori et al. 2010). The genetic screening for ABA sensitivity during the greening of cotyledons allowed the isolation of the atabcg25 mutant. The wild type protein AtABCG25 is a membrane protein showing predominant expression in the vascular tissues. The membrane vesicles derived from Sf9 insect cells expressing AtABCG25 was used to study ABA efflux. Furthermore, the AtABCG25 overexpression in plants resulted in higher leaf temperature, suggesting the influence of ABA transport on stomatal regulation (Kuromori et al. 2010; Umezawa et al. 2010; Danquah et al. 2014). Another full size ABC transporter encoded by the AtABCG40 (also referred to as AtPDR12) was found to be functional as an ABA importer in plant cells (Kang et al. 2010). The selection of the atabcg40 mutants was performed via screening for seed germination and stomatal movement in 13 of 15 Arabidopsis ABC transporter gene knockout mutants (atabcg29-atabcg41). The localization of AtABCG40 in the plasmalemma was supported by genetic fusion technology via ABCG40::sGFP expression, driven by the native promoter in Arabidopsis guard cells. The membrane protein AtABCG40 expression was detected in the leaves of young plantlets and in primary

k

k

k

200

Mechanism of Plant Hormone Signaling under Stress

CHLOROPLAST

STRESSES

Glyceraldehyde -3-phosphate

Pyruvate

Isopentyl Pyrophosphate

Neoxanthin

Beta-Carotene

(cis isomer) Violaxanthin Zeaxanthin

(cis isomer)

(first xanthophyll) Xanthoxin

Abscisic alcohol

k VACUOLE

Beta glucosidase

Abscisic aldehyde

ABA-GE ABA-GE

(inactive)

Xanthoxin Xanthoxic acid ABA (active) 8’-hydroxy ABA

APOPLAST

ABA

ABA-GE

Figure 9.1 ABA biosynthesis, catabolism and transport: Chloroplasts of plant parts, especially wilting leaves, facing stressful conditions promote the production of isopentyl pyrophosphate from pyruvate and glyceraldehyde-3-phosphate. The isopentyl pyrophosphate synthesized is transformed via a number of steps into beta-carotene, violaxanthin (cis isomer), and neoxanthin (cis isomer). Beta-carotene forms zeaxanthin that is the first xanthophyll synthesized. Both the cis isomers of violaxanthin and neoxanthin produce xanthoxin. Xanthoxin passes out of the chloroplast and forms active ABA via three pathways: abscisic aldehyde, xanthoxic acid, and abscisic alcohol pathways. Active ABA gets hydroxylated by cytochrome P450 monoxygenase to form 8’-hydroxy ABA. This ultimately gets converted to phaseic acid and subsequently to dihydrophaseic acid. Active ABA is also acted upon by beta-glucosidase to form the inactive ABA-GE (ABA-Glucosyl Ester), which remains stored in the vacuoles for future requirements. ABA-GE may get transported out of the cell to the apoplast and affect functioning of the guard cells. ABA also gets transported out of the cell in its active form through the ABC transporters.

k

k

k

9 ABA, MAPK, and Calcium-Dependent Protein Kinases

k

or lateral roots. The guard cells showed the highest expression in the leaves. Reduced drought tolerance was reported in the atabcg40 mutants due to slower closing of the stomata in response to stimuli by ABA accumulation. A consistent decrease in the rate of ABA transport in the protoplasts of atabcg40 plants was observed when compared to the control, whereas temporal increment in ABA uptake was inferred in AtABCG40 expressing yeast and BY2 cells. That proper functioning of the wild-type AtABCG40 is necessary for relaying signals to regulate ABA response in a timely fashion was hypothesized by the fact that several ABA-inducible genes experienced delayed expression due to slow or late ABA transport in atabcg40 mutant. In both cases, i.e., for the transporters AtABCG25 and AtABCG40, experimental usage of stereoisomers of ABA proved the stereospecificity for transport. Little variation was observed in the Michaelis–Menten constant (KM ) saturation kinetics of ATP-dependent ABA transport (260 nM and 1 μM for AtABCG25 and AtABCG40, respectively), although different systems were utilized to assay the activity (Kang et al. 2010; Kuromori et al. 2010; Umezawa et al. 2010). Such findings support the active transport of ABA through the previously mentioned ABC transporters. A lucid model was proposed where ABA, after synthesis in the related cells gets imported to the apoplast, from where it is passed into the guard cells. The model also promotes the potentiality of an ABA transporter, delivering ABA with regulated periodicity to give an impetus to rapid, agile, and controlled responses to various abiotic stress stimuli (Kang et al. 2010). The protein-protein interaction assay technique or the directed yeast two hybrid screening assay was adopted and modified to isolate ABA-IMPORTING TRANSPORTER 1 (AIT1) (also referred to as low affinity nitrate transporter; NRT1.2) (Kanno et al. 2012). In the modified assay system, the capability of inducing interactions between the ABA receptor PYR/PYL/RCAR and PP2C protein phosphatase at low ABA concentration were observed in the positive clones. The localization of AIT1 was found in the plasmalemma of plant cells and its prevalent expression occurred in the vascular tissues of the cotyledons, true leaves, hypocotyls, roots, and inflorescence stems. Though increased transport and uptake of exogenous ABA occurred in yeast and insect cells expressing AIT1, the same cells showed hindrance to the import of Gibberellic Acid (GA3 ), Indole Acetic Acid (IAA), or Jasmonic Acid (JA). The screened ait1 mutants pointed towards their reduced sensitivity to ABA during germination and post-germination growth. Thus, due to delayed and impaired transport of ABA, the stomata closed much slowly in response to abiotic stress stimulus resulting in excess moisture loss, which terminally led to a lower surface temperature in the inflorescence of ait1 mutants, in comparison to the wild type plants. The ABA hypersensitivity was reported in the instance of AIT1 overexpression (Kanno et al. 2012; Danquah et al. 2014). 9.2.4 ABA Perception and Signal Transduction

A central signaling module plays an important role in ABA signal transduction with the aid of three classes of proteins: Pyrabactin Resistance/Pyrabactin resistance-like/Regulatory Component of ABA Receptor (PYR/PYL/RCARs) acting as ABA receptors, Protein Phosphatase 2Cs (PP2Cs) that act as negative regulators, and SNF1-related protein kinases (SnRK2s) that are the positive regulators of ABA signaling. The response from environmental or developmental cues coordinates ABA

k

201

k

k

202

Mechanism of Plant Hormone Signaling under Stress

to promote the interaction of PYR/PYL/RCAR and PP2C, inferring in PP2C inhibition and SnRK2 activation. This signaling complex exists both in the nucleus as well as in the cytosol, as it has been seen that the kinase domain of SnRK2 can phosphorylate basic leucine zipper (bZIP) TFs or even membrane proteins and ion channels (Mustilli et al. 2002; Park et al. 2009; Schweighofer et al. 2004; Umezawa et al. 2009, 2010; Yoshida et al. 2006a; Fujii et al. 2009; Ma et al. 2009; Santiago et al. 2009a; Sheard and Zheng 2009; Soon et al. 2012). 9.2.4.1 ABA Receptors in Signal Transduction

k

The central role in ABA perception and then relaying the signal downstream was seen to be played by the novel soluble PYR/PYL/RCAR family of receptors via molecular and structural studies (Ma et al. 2009; Melcher et al. 2010; Miyazono et al. 2009; Nishimura et al. 2009, 2010; Park et al. 2009; Santiago et al. 2009a; Yin et al. 2009). Most ABA binding proteins have been characterized to be G-protein coupled receptors (GPCRs) with one Mg-chelatase H subunit (Liu et al. 2007; Shen et al. 2006). However, Pandey et al. (2009) discovered a GPCR-Type G-Protein (GTG) that did not act as Mg-chelatase. Such GPCR type G proteins (GTG1 and GTG2) can be potent enough to act as ABA receptors. The cell membrane proteins, GTG1 and GTG2 share partial homology with the mammalian Golgi pH regulator membrane protein through an identical stretch of sequence. These GPCRs mediate abiotic stress-induced ABA accumulation through the G-protein α subunit (GPA1) (Pandey et al. 2009; Liu et al. 2007). The importance of GPA1 was found in the gpa1 mutants exhibiting almost absolute decline in ABA sensitivity in the guard cells (Pandey et al. 2009; Chen et al. 2006). Partial reduction in ABA sensitivity was featured in germinating seeds, growing roots, and constriction of stomata in the gtg1/gtg2 double mutants. This partial reduction is an essential indication of the presence of more independent ABA receptors involved in ABA transport (Danquah et al. 2014). Another group of proteins interacting with ABA is a chloroplast protein, namely, the ABA binding protein (ABAR)/Mg-chelatase H subunit (CHLH)/ Genomes uncoupled 5 (GUN5), recognized via a homologous stretch as an ABA-specific binding protein from the faba beans (Mochizuki et al. 2001; Zhang et al. 2002). The ABAR/CHLH/GUN5 functions as a positive regulator of ABA-induced signaling in germinating seeds, and post germination developments (Shen et al. 2006). The abar/chlh/gun5 mutants failed to show interaction with ABA, but the mechanism of action of this protein in wild type genotype as a functional ABA receptor is unknown (Klingler et al. 2010). The PYR/PYL/RCAR family members were isolated in a genetic approach by the screening for mutants, which possessed the ability to germinate in the presence of pyrabactin (Park et al. 2009). Pyrabactin is a naphthalene sulfonamide mimicking ABA and is a hypocotyl cell expansion inhibitor. It is the first of its type, since pyrabactin, though an ABA agonist is not an ABA analogue. The genetic screening was performed independently through a directed yeast two hybrid assay with the PP2C ABI2 as bait (Ma et al. 2009). The START-domain/Bet V allergen superfamily proteins are both encoded by PYR1 and RCAR1. These have shown the presence of ligand binding pocket that is typically hydrophobic (Umezawa et al. 2010). Fourteen PYR/PYL/RCAR proteins with highly conserved amino acid sequences have been identified in the Arabidopsis genome. The members of this soluble receptor family in Arabidopsis each encode small proteins with a range between 159 and 211 amino acid residues (Santiago et al. 2009a). Several of them, including PYR1, PYL1, and PYL2 were biochemically shown to directly bind ABA (Danquah et al. 2014; Miyazono et al. 2009; Nishimura et al. 2009; Santiago et al. 2009b; Yin et al. 2009).

k

k

k

9 ABA, MAPK, and Calcium-Dependent Protein Kinases

203

The dissociation constant (Kd ) for each PYR/PYL/RCAR protein binding to (+)-S-ABA or (-)-R-ABA varies and some members recognize the chirality of ABA (Ma et al. 2009; Park et al. 2009; Santiago et al. 2009b; Szostkiewicz et al. 2010). The interaction of an interface of an ABA bound form of PYR/PYL/RCAR with the group A PP2C inhibits the protein phosphatase activity of the latter (Umezawa et al. 2010). Triple pyr1/pyl1/pyl4 or quadruple pyr1/pyl1/pyl2/pyl4 (and more recently the sextuple pyr1/pyl1/pyl2/pyl4/pyl5/pyl8) mutants expressing hyposensitivity in germination and root growth responses to ABA have provided the genetic evidence to introduce abiotic stress researches to the role of PYR/PYL/RCAR receptors in ABA signaling (Gonzalez-Guzman et al. 2012; Park et al. 2009). The proposal of high level of functional genetic redundancy in this gene family arose when the single mutants were found to display normal ABA responses. Impaired stomatal closure, hypoactive SnRKs, and an ABA-insensitive transcriptome profile were exhibited in the quadruple mutants (Gonzalez-Guzman et al. 2012; Nishimura et al. 2010; Park et al. 2009; Danquah et al. 2014). Enhanced drought resistance and more efficient ABA responses were portrayed by the Arabidopsis plants overexpressing PYL5, PYL8, or PYL9 (Ma et al. 2009; Saavedra et al. 2010; Santiago et al. 2009a). The capability to stimulate responses in the ABA signaling pathway rests within the entire PYR/PYL/RCAR family in Arabidopsis, except PYL13. It can thus be inferred that almost all members of this family can function as ABA receptors that coordinate downstream signaling cascades. 9.2.4.2 PP2Cs as Negative Regulators of ABA Signaling

k

ABA binds to the START domain of the soluble PYR/PYL/RCAR receptors and induces a conformational change. As a result, PP2Cs are sequestered by the ABA-bound receptors after which the phosphatase activity of PP2C proteins is inhibited (Ma et al. 2009; Park et al. 2009; Gonzalez-Guzman et al. 2012; Cutler et al. 2010) (Fig. 9.2). The ABA-INSENSITIVE1 (ABI1) and the successive ABI2, both encoding PP2Cs, were identified through a genetic screening for ABA-insensitive Arabidopsis mutants (Leung et al. 1994, 1997; Meyer et al. 1994; Rodriguez et al. 1998). The ABA insensitivity was characterized in abi-1 or abi-2 mutants in target tissues and in various developmental phases. PP2Cs have been portrayed as general negative regulators of ABA-induced stress signaling in yeasts and mammals (Lammers and Lavi 2007; Vlad et al. 2009; Danquah et al. 2014). The 76 PP2Cs encoded by the Arabidopsis genome have been clustered into 10 groups and ABI1 and ABI2 belong to group A, which consist of nine members (Schweighofer et al. 2004). The isolation of ABA signaling regulators like HOMOLOGY TO ABI1 (HAB1) and HAB2 were performed based on the sequence similarity to ABI1 (Saez et al. 2004). Through successful implementation of cloning from genetic screens of Arabidopsis and via yeast complementation test, other members of clade A PP2Cs like ABA HYPERSENSITIVE GERMINATION 1 (AHG1) and AHG3/PP2CA were isolated (Antoni et al. 2012; Kuhn et al. 2006; Kuromori and Yamamoto 1994; Nishimura et al. 2007; Yoshida et al. 2006b). ABA hypersensitivity was significantly exhibited by all loss-of-function type mutants of group A PP2Cs (Hirayama and Shinozaki 2007). The PP2C functions are well conserved in several other plant species like Oryza sativa, Selaginella moellendorfii, Physcomitrella patens, Ostreococcus tauri, and Chlamydomonas reinhardtii (Umezawa et al. 2010; Gonzalez-Garcia et al. 2003; Komatsu et al. 2009; Tougane et al. 2010). ABA hypersensitivity in double or triple PP2C knockout mutants also gave the same information regarding conservation of PP2C (Nishimura et al. 2007; Rubio et al. 2009). Molecular functional redundancy of the group A PP2Cs does not

k

k

k

204

Mechanism of Plant Hormone Signaling under Stress

No ABA

ABA present

ABA present

PYR/PYL/RCAR

PYR/PYL/RCAR

ABA

PYR/PYL/RCAR

PP2C P

PP2C SnRK2

k

abi1-1 Sn RK2

Sn RK2

TFs

TFs

TFs

Stress genes remain inactive

Stress genes active

Stress genes remain inactive

(A)

(B)

(C)

Figure 9.2 The regulatory transducing pathway in ABA signaling and the effect of abi1-1 mutation: (A) In the absence of ABA, the PP2C inhibit SnRK2 to activate major TFs. Hence, the genes required to combat stress are not transcribed; (B) Chloroplasts start synthesizing ABA as the plant faces stress and endogenous ABA concentration in the cell rises. ABA binds to the START domain of PYR/PYL/RCAR. The latter undergoes conformational changes to inhibit PP2C. Thus, in the absence of the phosphatase activity, SnRK2 remain phosphorylated. The required TFs now get activated and transcribe downstream genes to cope up with stresses; (C) Plants with abi1-1 mutation fail to combat stress, even in the presence of high concentration of ABA. The PYR/PYL/RCAR, along with ABA cannot inhibit the phosphatase activity of the mutated abi1-1. Thus, SnRK2 does not remain phosphorylated and the stress genes are not transcribed.

affect the tissue-specific roles of these proteins. This can be exemplified by citing the instance that seeds and guard cells express ABI1. The mutant phenotype of AHG1 and AHG3/AtPP2CA were maximally expressed in the seeds (Yoshida et al. 2006a; Nishimura et al. 2007; Umezawa et al. 2009). It was suggested that ABI1 localizes in the cytosol and nucleus, whereas AHG1 and AHG3 accumulates predominantly in the nucleus due to tissue-specific subcellular localization patterns (Umezawa et al. 2009). Previous experimental evidences also support such localization patterns, suggesting that ABI1 is a general regulator, widely controlling ABA responses from seed tissues to guard cells. AHG1 and AHG3 possess a rather restrictive operation in the seed tissues in regulating nuclear gene expression (Leung et al. 1994; Meyer et al. 1994; Yoshida et al. 2006a; Nishimura et al. 2007). The dynamic transcriptional changes during seed development, dormancy and germination usher such occurrences of tissue-specific subcellular localization patterns of the proteins of concern (Nakabayashi et al. 2005). Among PP2Cs, surprisingly ABI3 acts a positive regulator in ABA signaling. ABI3 binds through its B3 domain to the RY cis-motif in DNA (Finkelstein and Somerville 1990; Giraudat et al. 1994; Nambara et al. 1992). Along with two other B3 domain proteins (FUS3 and LEC2) and the CCAAT-binding protein subunit HAP3 (LEC1),

k

k

k

9 ABA, MAPK, and Calcium-Dependent Protein Kinases

k

ABI3 is essential for seed maturation and development during seed dormancy (Giraudat et al. 1994; Luerssen et al. 1998; Stone et al. 2001). Seed dormancy gets skipped by a loss of function abi3 mutant in Arabidopsis, while the counterpart mutation in maize (viviparous) signals uncontrolled germination, even on the ear (McCarty 1992). Recently, identification of a new dormancy mutant designated honsu (hon) was achieved through the screening of germination mutants from a set of T-DNA insertion lines. HON is one of the major PP2Cs involved in negative regulation of seed dormancy by inhibiting ABA signaling and on the contrary enhancing the gibberellic acid signaling. This was proved by analyzing double loss-of-function mutants among PP2Cs (Kim et al. 2013). Comparing with the hon mutant seeds, almost all HON-OX (HON OVEREXPRESSING) seeds germinated at even 5 μM ABA. The ABA sensitivity difference became more prominent when the seeds were grown under polychromatic white light in the presence and absence of ABA. In the hon mutant, varying growth arrests were observed in the media with a low concentration of ABA. In the wild type seeds, such growth arrests were not observed due to slow germination kinetics, as all the seeds germinated by exhibiting coinciding kinetic values (Kim et al. 2013). Group A PP2Cs negatively regulate ABA-mediated downstream signaling in Arabidopsis. Reduced seed dormancy, ABA-resistant seed germination and seedling growth, uncontrolled stomatal regulations and abnormalities in abiotic stress responses were exhibited in plants with the dominant mutations abi1–1 (abi1G180D ) or abi2–1 (abi2G168D ) and in HAB1G246D mutants (Finkelstein and Somerville 1990; Hoth et al. 2002; Koornneef et al. 1984; Leung et al. 1994, 1997; Meyer et al. 1994; Robert et al. 2006; Rodriguez et al. 1998; Danquah et al. 2014; Umezawa et al. 2010). The abi1-1 and abi2-1 mutations occur at a highly conserved glycine residue that eventually gets converted to an aspartate in the catalytic domain of PP2C. In spite of the diverse applications of abi1-1 and abi1-2 mutants as tools to study the ABA signaling pathway, it was a mystery how this single amino acid mutation could bring about ABA insensitivity to specific tissue cells in the plant system. This mystery is unfolded later in this chapter. 9.2.4.3 SnRK2 Acting as a Global Positive Regulator of ABA Signaling

The CDPK-SnRK superfamily consists of seven types of Ser/Thr protein kinases that have been cited as CDPK, CDPK-related kinase (CRK), phosphoenolpyruvate kinase (PPCK), PEP carboxylase kinase (PEPCK), calmodulin dependent kinase (CaMK), calcium, calmodulin dependent protein kinase (CCaMK), and finally the SnRK. Individual isoforms and subfamilies existing under this superfamily of kinases have well sorted regulatory domains, subcellular targeting information, and specificity towards substrate molecules. About 38 SnRKs have been isolated in the Arabidopsis genome (Hrabak et al. 2003). The classical Sucrose Non-Fermenting 1 (SNF1) of yeasts has also been found to be located in plant cells. However, the interesting deviation lies in the fact that the majority of the protein kinases related to SNF1 in Arabidopsis have a varying primary structure in comparison to their yeast homologs. Thus, the name SNF1-related kinase (SnRK) was suggested for this group, under which three subgroups were identified: SnRK1, SnRK2, and SnRK3, based on sequence similarity and domain structure (Halford and Hardie 1998; Hrabak et al. 2003). Detailed study and investigations provided knowledge on the pivotal role played by the protein phosphorylation events in the ABA signaling pathway. Evidences from the fava

k

205

k

k

206

k

Mechanism of Plant Hormone Signaling under Stress

bean (Vicia faba) and wheat (PKABA1) ABA-Activated Protein Kinase (AAPK) highlighted the SnRK2 family as a group of ABA-activated protein kinase. These kinases are important in the downstream signaling cascades in presence of high and low concentrations of ABA in the cell (Hirayama and Shinozaki 2007, 2010; Gomez-Cadenas et al. 1999; Li et al. 2000). Ten members fall under the SnRK2 family in Arabidopsis, which again have been grouped under three subclasses (Hrabak et al. 2003; Yoshida et al. 2002). The rapid activation of the members of subclass I occurs by stimuli from osmotic stresses within a minute. Subclasses II and III members achieve their activation both by osmotic stress stimuli and ABA. It was also experimentally proved that the subclass II members were rather weakly activated by ABA (Boudsocq et al. 2004). The SnRK2.3/OPEN STOMATA 1 (OST1), a putative orthologue of AAPK in Arabidopsis was isolated by targeting the major regulatory elements in osmotic stress adaptation (Boudsocq et al. 2004; Merlot et al. 2002; Mustilli et al. 2002; Wasilewska et al. 2008; Xie et al. 2006; Yoshida et al. 2002; Danquah et al. 2014). The responses and actions of the stomata stimulated by ABA accumulation and mild drought conditions were blocked in the snrk2.3 mutants (Mustilli et al. 2002; Yoshida et al. 2002). Yeast two-hybrid assays directed the interaction of SnRK2.3/OST1 with ABI1 through a conserved domain II motif in the C-terminus, acting as the ABI1 binding site (Yoshida et al. 2006a). The Group A PP2Cs dephosphorylate the SnRK2s (Umezawa et al. 2009; Vlad et al. 2009). A relatively diverse C-terminal domain and a conserved catalytic kinase domain are present in SnRK2s (Yoshida et al. 2002; Hrabak et al. 2003). The C-terminal domain of the SnRK2 family of kinases has further diverged into two parts: domain I and domain II (Yoshida et al. 2006a). The domain I has been found to be comparatively more similar among SnRK2 subgroups than the domain II which in the “acidic patch region” varies distinctly among the same subgroups. Thus, the C-terminal region might stand out to be the sought after regulatory domain of SnRK2 (Boudsocq et al. 2004; Kobayashi et al. 2004; Umezawa et al. 2010). The domain II plays an important regulatory role, as its impairment or deletion mutation results in an abnormal ABA-dependent activation due to the absence of the acid patch (Yoshida et al. 2006b). Experiments were also performed in economically important crops like rice. The C-terminal fragments of rice SAPK1 and SAPK2 were swapped only to draw the inference that these regions accurately defined activation schemes and patterns of the SnRK2s (Kobayashi et al. 2004). The aspartate residues predominate in the acid patch of subclasses II and III, but glutamate is found in majority of the subclass I members. The subclass III kinases, SnRK2.2, SnRK2.3, and SnRK2.6 are the most potential regulators of ABA signaling, as they are most strongly activated by ABA induction (Boudsocq et al. 2004). Isolation of a subclass III triplet knockout mutant, snrk2.2/snrk2.3/snrk2.6 in Arabidopsis, through exhaustive genetic screenings has relayed the importance of kinases belonging to this subclass. The triple mutant exhibited extreme sensitivity and high resilience to low humidity and ABA respectively, which were recorded in all the elementary phenotypic responses (Fujita et al. 2009; Nakashima et al. 2009; Danquah et al. 2014). Co-immunoprecipitation experiments in protein extracts from Arabidopsis showed that these three SnRK2s interacted with nine of the 14 members of PYR/PYL/RCARs, along with ABI1. The composition of the co-purified proteins was ABA-independent. In spite of this fact, accumulated data suggested that at least ABI1, the three SnRK2s and at least nine of the 14 receptor

k

k

k

9 ABA, MAPK, and Calcium-Dependent Protein Kinases

k

proteins should constitute or partly constitute the core ABA signalosome (Fujii and Zhu 2009; Joshi-Saha et al. 2011; Nishimura et al. 2010; Danquah et al. 2014). The next invariant question spurting in the inquisitive minds was that how SnRK2 activation is putatively synchronized with PP2C inhibition by ABA. Such basic queries were removed by the recently reported three-dimensional structure of the SnRK2-PP2C complex (Soon et al. 2012). The PP2Cs by virtue of their phosphatase activity dephosphorylate SnRK2 at a Ser residue in the kinase activation loop (Ser175 in SnRK2.6/OST1). The kinase activity is switched on when this specific Ser175 residue gets phosphorylated (Ma et al. 2009; Park et al. 2009; Soon et al. 2012; Umezawa et al. 2009; Vlad et al. 2009; Yin et al. 2009; Yoshida et al. 2006a). The kinase activation loop of SnRK2s docks into the active site of PP2Cs, while the conserved ABA-sensing tryptophan of PP2Cs inserts into the kinase catalytic cleft. This SnRK2–PP2C complex structure also mimics a receptor–PP2C interaction (Soon et al. 2012; Danquah et al. 2014). The PYR/PYL/RCAR receptors bind to the active site of PP2Cs due to ABA binding to the soluble receptors and inhibit the phosphatase activity possessed by the PP2Cs (Santiago et al. 2009b; Melcher et al. 2010; Miyazono et al. 2009; Nishimura et al. 2009). The accumulation of ABA in the tissues instigates an ABA-induced PP2C inhibition (Fig. 9.2). If PP2C gets prohibited from expressing its phosphatase activity, the phosphorylations on the specific residues important for the SnRK2 kinase activity occur by activation loop autophosphorylation. The simultaneous activation of the kinase takes place as well (Hubbard et al. 2010; Cutler et al. 2010; Danquah et al. 2014). Probably, the participation of more emerging factors is likely in the autophosphorylation of SnRK2 activation loop in plants. Such emerging players can even be some unidentified upstream kinases (Boudsocq et al. 2007; Burza et al. 2006; Danquah et al. 2014).

9.3 The Signalosome and Signaling Responses Mediated by ABA: Structural Alterations in ABA by PYR/PYL/RCAR In the previous Section 9.2, with regards to PYR/PYL/RCAR, we presented a short discussion on the functions of PYR/PYL/RCAR as a group of soluble receptors controlling ABA perception. In this section, we shall emphasize on the recent findings on the structural characteristics of the receptor in accommodating ABA molecules. An ABA molecule gets trapped with its carboxyl group oriented towards the centre of the receptor molecule; and the PYR/PYL/RCAR consists of a well defined, internal water cavity, where the ABA molecule accommodates itself (Umezawa et al. 2010). An ion pair association links the carboxyl group of ABA with a lysine residue side chain. The carboxyl group also forms hydrogen bonds with the side chains of five polar residues, with water as the bonding solvent. This complex structural network mediates interaction of the ABA carboxyl group with a hydroxyl group of the chiral carbon. This showed the position of the pentadienoic acid moiety (Umezawa et al. 2010). Higher affinity for the biologically active (+) stereoisomer of ABA is exhibited by PYR/PYL/RCAR. The flipped dimethyl group in the (−) stereoisomer of ABA causes steric hindrance inhibition between the said dimethyl group and the small pocket, where the monomethyl group gets inserted (Melcher et al. 2009; Umezawa et al. 2010). The formation of the homodimer of PYL2 is governed by the gate loop (one of the two conserved loops connecting the third beta strand of the receptor protein with the

k

207

k

k

208

Mechanism of Plant Hormone Signaling under Stress

fourth beta strand). Dimerization is also regulated by ABA, acting as an allosteric effector. The performance of X-ray crystallography, small angle X-ray scattering (SAXS), and subsequently, size exclusion chromatography confirmed the dimerization of the receptors (Nishimura et al. 2009; Yin et al. 2009; Umezawa et al. 2010). Such contact mediated by dimerization promotes stabilization of the gate loop with conformational plasticity in the open or closed state and also orients the gate loop in the dimer interface. This mechanism blocks the access of PP2Cs to the loop using the induced fit mechanism (Yin et al. 2009; Umezawa et al. 2010).

9.4 Structural Alterations During PP2C Inhibition by ABA

k

The PYR/PYL/RCAR in presence of ABA actually inhibits PP2C in dephosphorylating SnRK2. These subsequently activate the required response cascades (Danquah et al. 2014). The Ser112 of PYL1 and the Ser89 of PYL2, upon ABA interaction, form crucial hydrogen bonds between its side chain and another highly conserved residue of PP2C (ABI1 E142 and HAB1 E203). The PP2C activity gets suppressed by insertion of the gate loop of the receptor (Umezawa et al. 2010). An additional antiparallel beta sheet in PP2C induces its interaction with the receptor bound to ABA (Yin et al. 2009). The receptor in the ABA bound state attains a conformation with two closed loops between which the indole rings of the conserved tryptophan residues (ABI1 W300 and HAB1 W385) get inserted. Water stimulated hydrogen bonds are formed by the imino group of the indole ring with the closed loop of the receptor and ABA carbonyl group (Umezawa et al. 2010). Structural studies have also provided evidences of the receptor gate loop attaining stability. This is mainly due to the presence of a conserved arginine residue (ABI1 R304 and HAB1 R389) intervening between the guanidinium group and a conserved proline residue (PYL1 P115 and PYL2 P92) on the loop of the receptor (Umezawa et al. 2010). Thus, the affinity of the PP2Cs to ABA-bound PYR/PYL/RCAR receptors has been structurally proved by this “gate-latch-lock” mechanism (Ma et al. 2009).

9.5 The abi1-1 Mutation Mystery Solved We have earlier discussed that the reason behind the dominant insensitivity of the abi1-1 mutation to ABA had remained an unsolved mystery for a long time. This was solved after the entire picture of the ABA signalosome (the PYR/PYL/RCAR-PP2C-SnRK2 signaling complex) became clear. It was observed that though the abi1-1 proteins do not associate with the PYR/PYL/RCAR receptor proteins, an interaction is maintained between the abi1-1 mutated protein product and the subclass III SnRK2s. This has pointed to the independent functioning of abi1-1 with respect to the regulation of PYR/PYL/RCARs (Umezawa et al. 2009). Inactivation of SnRK2s via dephosphorylation by abi1-1 protein phosphatase was reported using in vitro reconstitution assays, evading all doubts on the phosphatase activity of the mutant protein (Umezawa et al. 2009, 2010) (Fig. 9.2). Even the presence of the PYR/PYL/RCAR receptors along with ABA could not inhibit the abi1-1 mutant protein from undergoing its enzymatic activity by dephosphorylating SnRK2s. Hence, chalking out of such a strategy by the abi1-1 protein helps in maintaining the mutant phenotype dominantly by ushering the plant signaling towards almost absolute insensitivity to ABA (Umezawa et al. 2010).

k

k

k

9 ABA, MAPK, and Calcium-Dependent Protein Kinases

209

9.6 Basic Leucine Zipper (bZIP) TFs in ABA Signaling

k

The ABA-inducible genes have multiple cis-elements like ABREs (PyACGTGG/TC) or coupling elements such as CE1 and CE3 (Gómez-Porras et al. 2007; Umezawa et al. 2010). Isolation of the ABRE-binding factors (ABFs) was done by using the ABRE sequences as baits in the directed yeast one hybrid assay (Choi et al. 2000). The AREB/ABFs actually represent group A subfamily of bZIP factors. Arabidopsis has 13 members of bZIP factors (Corrêa et al. 2008; Yamaguchi-Shinozaki and Shinozaki 2006; Danquah et al. 2014). The AREB1/ABF2, AREB2/ABF4, and ABF3 are induced during dehydration and salinity stresses and after exogenously applying ABA in vegetative tissues (Fujita et al. 2005). The hypersensitivity to ABA in germination and seedling growth was seen in the transgenic varieties overexpressing these TFs (Abdeen et al. 2010; Umezawa et al. 2010). Transcriptome analyses in the generated triple mutant, areb1 areb2 abf3 made it clear that the stress-mediated gene response, stimulated by ABA, fails to get activated (Yoshida et al. 2010). The Late Embryogenesis Abundant (LEA) proteins have a hydrophilic, random coil structure serving as a water binding domain, which acts as hydration buffer in order to regulate water status. LEA proteins also interact with macromoleculer surfaces as a water matrix to inhibit protein denaturation under stressful conditions (Roychoudhury et al. 2007; Ganguly et al. 2012; Banerjee and Roychoudhury 2016). Genetic screening of seeds exposed to gamma-radiation helped in the identification of one group A bZIP factor named ABI5 for low sensitivity towards ABA during the germination phase (Danquah et al. 2014). The areb1 areb2 abf3 triple mutant showed enhanced resistance to ABA than the single or double mutants. The triple mutants also expressed less drought tolerance, clearly pointing to the fact that the wild type AREB1, AREB2, and ABF3 are master TFs regulating the expression of various ABA-dependent downstream signaling genes (Umezawa et al. 2010). The AREB3 and EEL (a bZIP protein) play pivotal roles in seed development through their expression in the nuclei (Bensmihen et al. 2005). Post translational modification (generally phosphorylation) is compulsory at the multiple conserved RxxS/T regions for activation of the bZIP factors (Uno et al. 2000; Kagaya et al. 2002; Furihata et al. 2006). Constitutive activation was achieved by mutating the five Ser/Thr residues in the phosphorylation site into aspartic acid residues. This resulted in AREB1/ABF2-stimulated ABA-responsive gene expression under normal conditions in plants that constitutively expressed the dominant active form of AREB1/ABF2 (Furihata et al. 2006). The potentiality to phosphorylate AREB/ABF in vitro was found in certain SnRK2s like SnRK2.2, SnRK2.3, and OST1/SnRK2.6. These kinases also exhibited co-localization and interaction with the AREB/ABFs in the plant cell nuclei via bimolecular fluorescence (BiFC) (Furihata et al. 2006; Fujita et al. 2009; Yoshida et al. 2010; Danquah et al. 2014). A comparison was made between the wild type plants after ABA application and the snrk2.2/snrk2.3/snrk2.6 triple mutants. It was found that the ABA-responsiveness occurred in 75% of the AREB/ABF target genes. These genes had low expressivity in the triple mutants showing the linkage between the AREB/ABF and SnRK2.2/SnRK2.3/SnRK2.6 target genes (Umezawa et al. 2010). The snrk2.2/snrk2.3/snrk2.6 mutants also presented the deletion of the ABA-regulated kinase activities. This inferred about the possible control of AREB/ABFs by the SnRK2.2/SnRK2.3/SnRK2.6 in ABA signaling induced by drought stress (Umezawa et al. 2009; Fuji and Zhu 2009). About 48% of the downregulated genes in abi5 mutant

k

k

k

210

k

Mechanism of Plant Hormone Signaling under Stress

also showed inhibited expression in the triple mutants. This throws light on the fact that SnRK2.2/SnRK2.3/SnRK2.6 regulates genes, which is also partially dependent on ABI5 phosphorylation during seed germination (Nakashima et al. 2009). Instances of PKABA1 (an orthologue of wheat SnRK) phosphorylating the TaABF (an orthologue of wheat AREB1) or SAPK8, SAPK9 and SAPK10 (SnRK2 orthologues in rice) phosphorylating TRAB-1 (AREB1 orthologue in rice) in vitro showed the regulation of bZIP factors by SnRK2s (Johnson et al. 2002; Kobayashi et al. 2005; Umezawa et al. 2010). Another bZIP factor (lip) that is inducible under cold stress was reported in different cereal plants like rice. The transactivation study of lip gene created a positive regulation on five wheat LEA genes (WDHN13, WRab17, WRab18, WRab19) (Roychoudhury et al. 2013). The constitutive expression of the stress-induced genes was achieved by overexpressing the low temperature and ABA-inducible SCOF1, the C2H2-type zinc finger protein of Glycine max in Arabidopsis. This resulted in enhanced cold tolerance by constitutive expression of the stress-induced genes. SCOF1 being itself unable to bind to the ABRE motifs, promotes the DNA binding activity of the bZIP factor, SGBF1 to the ABRE of osmotic stress-responsive genes. In this way, the SCOF1-SGBF1 complex regulates gene expression during cold stress through an ABA-mediated signaling, via ABRE recognition (Roychoudhury et al. 2013) (Fig. 9.3). The ABA Responsive Element-Binding Factor 2 (VvABF2) in Vitis vinifera is a bZIP factor which aids in the berry ripening processes (Nicolas et al. 2014). The DREB, WRKY, and MYB families of factors, regulated by ABA, achieve higher levels of activation when VvABF2 is overexpressed. Thus, VvABF2 plays a role in mediating ABA-transducing pathways (Nicolas et al. 2014; Euglem et al. 2000). Exogenous ABA treatment of the grape cells showed the regulation of genes involved in osmotic stress, dehydration (raffinose synthase and LEA), abiotic stress tolerance proteins (AP2-DREB, bZIP like VvABF2 and NAC (No Apical Meristem [NAM], Arabidopsis Transcription Activation Factor [ATAH], Cup Shaped Cotyledon [CUC]), PP2Cs, calmodulin and calmodulin stimulated protein kinase (Nicolas et al. 2014).

9.7 Mitogen-Activated Protein Kinase (MAPK) Cascades and Regulation of Downstream Signaling MAPKs function as phosphorylating enzymes showing a diverse variety of substrates, thus turning them into hotspots for research linked to signaling. The MAPK cascades in signal transduction pathways have been found to be conserved in all eukaryotes throughout evolution and have been identified in plants, yeast, fungi, insects, nematodes, and mammals (Hamel et al. 2012; Danquah et al. 2014). The cascade including MAPK activities, procures the involvement of MAP kinase kinase kinases (MAP3Ks/MAPKKKs/MEKKs), MAP kinase kinases (MAP2Ks/MAPKKs/MEKs) and MAP kinases (MAPKs/MPKs) (Mishra et al. 2006). Adaptor kinases like MAP4Ks may also come into play to link the stress response with the main MAPK cascade. The Ser/Thr kinases, namely MAP3Ks, phosphorylate two amino acid residues in the S/T-X3–5 -S/T motif, existing on the activation loop of the MAP2K and the latter in turn catalyzes the phosphorylation of Thr and Tyr residues at a conserved T-X-Y motif (Sinha et al. 2011; Hamel et al. 2012). The activated MAPK in the MAPK cascade can exhibit its kinase activity upon a diverse range of substrates. This can lead to

k

k

k

9 ABA, MAPK, and Calcium-Dependent Protein Kinases

211

Cold stress

ABA

SCOF1 (C2H2-type Znfinger)

SGBF1 (bZIP

k

k

ABRE

TATA

Cis element

Promoter

Figure 9.3 Genetic modification of TFs in Arabidopsis to combat cold stress: ABA- inducible C2H2-type Zn finger protein, SCOF1 isolated from Glycine max during cold stresses. Overexpression of this protein in Arabidopsis leading to enhanced cold tolerance. SCOF1 does not have an ABRE-binding domain; it rather activates the bZIP protein SGBF1. SCOF1-SGBF1 together activates Osmotic stress Responsive (OR) genes.

the regulation of the activity of TFs, phospholipases, cytoskeletal proteins as well as microtubule-associated proteins (Danquah et al. 2014; Taj et al. 2010). Several scaffold proteins, shared docking domains and adaptor or anchoring proteins often participate in a successful MAPK cascade (Sinha et al. 2011). Termination of the MAPK signaling is also as important as its induction. Prolonged unwanted activation invariably harms the cell and such temporal-mediated termination is catalyzed by the dephosphorylation activity of the MKPs (MAPK phosphatases) (Ulm et al. 2002). The growing interest in MAPKs plays on the fact that these signal cascades have provided enough evidences to regulate transducing signals during biotic stresses like pathogen invasion and also in different abiotic stresses in plants (Danquah et al. 2014).

k

k

212

Mechanism of Plant Hormone Signaling under Stress

9.7.1 Relevance and Crosstalk of MAPKs in Plant Abiotic Stresses

MAPKs control several signal transduction events during abiotic stress responses and the intermediates or components of such pathways often converge to produce a common output. Almost 20 MAPKs of the Arabidopsis genome show a tendency towards crosstalk as these are stimulated by more than one kind of stress. The AtMPK6 exhibits its enzymatic kinase activity in the ozone, hydrogen peroxide, ethylene, ABA and JA signaling pathways and even in developmental processes during seed germination, like epidermal patterning, embryo development, and nourishment. The MPK6 has been found to interact with several MAP2Ks like MKK2, MKK3, MKK4, MKK5, and MKK9, proposing a crosstalk in the signaling cascades (Sinha et al. 2011; Teige et al. 2004; Takahashi et al. 2007; Asai et al. 2002; Yoo et al. 2008). 9.7.2 The MAPK Families of Arabidopsis and Rice 9.7.2.1 Arabidopsis

k

Adequate genome screening has identified 20 MAPKs, 10 MAPKKs, and 80 MAPKKKs in Arabidopsis, depending on the sequence structures and functionalities of these enzymes (Sinha et al. 2011). The number of the upstream MAPKs (MAP3K) is much greater than that of the downstream MAPKs. This presents a clear possibility of more than one upstream MAPK converging to a downstream MAPK, thus presenting crosstalk. The Arabidopsis MAPKs are diverged into four groups (A to D) based on structural motifs and sequence homology. The groups A, B, and C get phosphorylated in the T-E-Y motif, while the MAPKs belonging to the D group are activated in the T-D-Y phosphorylation motif (Ichimura et al. 2002). Arabidopsis MAPKs are involved in regulating processes like the innate immunity, cytoskeletal and microtubule arrangements, epidermal patterning, ovule development, and also in abiotic stress responses. Major MAPKs with such functions are MPK3, MPK4, and MPK6 (Danquah et al. 2014; Sinha et al. 2011). Research has shown that AtMPK3 stimulates the pathway for developing tolerance in plants against thigmotrophic movement, low temperature, and salt stresses (Mizoguchi et al. 1996). AtMPK6 and AtMPK3 both enhance phytotolerance against hypoosmolarity and ozone (Ahlfors et al. 2004; Droillard et al. 2002). The AtMPK1, AtMPK4, and AtMPK6 all regulate the pathway that guards up the plant system against salinity stress, cold, dehydration, thigmotrophic movement, wounding, and hyperosmotic stresses (Ichimura et al. 2000). The MAPKKs that act upstream of MAPKs, by phosphorylating the latter, can also be divided into four groups (A–D) with five amino acids usually flanking between the Ser/Thr residues, consisting of a characteristic consensus of S/TxxxxxS/T. This sequence differs in the activation loop of the mammalian MAPKKs where three amino acid residues exist between the phosphorylation target residues of Ser/Thr, attaining a sequence of S/TxxxS/T (Ichimura et al. 2002). The MAPKKs acting upstream of MAPKs, MPK4, and MPK6 are the group A members, MKK1 and MKK2. Group C, MKK4 and MKK5, catalyze their kinase activities on the downstream MPK4 and MPK6, MAPKs during Pathogen Activated Molecular Patterns (PAMPs), act on stimulation from biotic stress (Danquah et al. 2014). The MKK3, apart from being the sole member of group B, has a Nuclear Transfer Factor (NTF2) encoded in the unusually extended C-terminal domain. MKK3 also regulates signaling modules related to the developmental processes under the stimulation of JA, defense mechanisms against

k

k

k

9 ABA, MAPK, and Calcium-Dependent Protein Kinases

k

pathogen invasions and ROS homeostasis, especially in Arabidopsis (Hamel et al. 2006; Ichimura et al. 2002; Takahashi et al. 2007, 2011). The MKK6, MKK7, and MKK9 are the other important MAP kinase kinases that have been reported (Beck et al. 2010, 2011; Takahashi et al. 2007, 2010, 2011; Yoo et al. 2008; Zhang et al. 2007). The Arabidopsis genome encodes MAP3Ks which can be classified into three groups: MEKK-like, Raf-like, and ZIK-like. To date, proof of Raf-like or ZIK-like kinase encoding functional MAP3Ks is lacking (Danquah et al. 2014; Colcombet and Hirt 2008). Constitutive Triple Response 1 (CTR1) and Enhanced Disease Resistance 1 (EDR1) are the best suited examples of Raf-like kinases. They regulate ethylene-mediated signaling and plant innate immunity in hypersensitivity responses against biotic stresses like pathogen attack. However, no confirmation of the activity of CTR1 and EDR1 in the defined MAPK cascade has been attained (Rodriguez et al. 2010). The 20 MAP3Ks encoded by the Arabidopsis genome are classified into six subgroups (A1–A6) and the functional analyses and impacts of subgroups A1–A4 have been recorded. The MEKK1–MEKK4 falls under subgroup A1, of which MEKK1 functions in the MAPK cascade. MEKK1 regulates the signaling related to plant tolerance against thigmotrophism, cold, and salt stresses (Ichimura et al. 2002; Asai et al. 2002; Gao et al. 2008; Rodriguez et al. 2010). The functional significance of MEKK2 stands on the activation of the R-protein, SUMM2 (suppressor of mkk1 mkk2) – stimulated immune responses. Such activity of MEKK2 is, on the contrary, negatively regulated by a near homologue, MEKK1 (Kong et al. 2012). The regulation of the MEKK2 transcript level is maintained by the stringent activity of the MPK4. Available evidences reveal that deletion mutations of the MEKK2 and MEKK3 together reverts the phenotype of the MPK4 signaling pathway mutants, as the MEKK1, MEKK2, and the MEKK3 are arranged as a tandemly arranged gene locus (Su et al. 2013; Danquah et al. 2014). Hence, the distinguishing signal between growth, proliferation, and apoptosis events in a cell is perceived and deciphered through the MPK4 signaling module. The MAP3Kα, MAP3Kγ, and YODA constitute the subgroup A2, among which YODA carries out its activity upstream to the MKK4/MKK5-MPK3/MPK6 cascade. YODA aids in the moderation of the cell functions in the embryo and stomatal patterning (Danquah et al. 2014; Wang et al. 2007). The MAP3Kε1 and MAP3Kε2 belong to subgroup A4. They function in regulating the cell cycle events and the sustainable development of the pollen grains. The subgroup A3 members aid in cytokinesis (Jouannic et al. 2001; Chaiwongsar et al. 2012; Krysan et al. 2002). 9.7.2.2 Rice

The Institute for Genomic Research (TIGR) annotation program in 2007 has put up a nomenclatural system of the classification of MAPKs in rice (OsMPKs). About 17 MAPKs have been reported to be encoded in the rice genome. All of them contain a protein kinase enzymatic domain, consisting of 11 highly conserved sub domains and the T-loops (attaining either TEY or TDY motif ) (Rohila and Yang 2007). The entire MAPK family in rice can be classified under six groups A–F, all belonging to the CMGC family (cyclin-dependent kinase, MAPK, glycogen synthase kinase, and the casein kinase II families) (Rohila and Yang 2007). In line with the full length peptide sequences of the 17 OsMPKs, an un-rooted radial tree was created using the MEGA3 bioinformatic software (Kumar et al. 2008). There lies a vital difference in the protein sequences of TEY (OsMPKs 1-6) and TDY (OsMPKs 7-17) subgroups, which was found in the activation

k

213

k

k

214

k

Mechanism of Plant Hormone Signaling under Stress

loop providing a protein-binding scaffold for the substrate (Rohila and Yang 2007). The TDY subgroups contained MAPKs flanked by three to four extra amino acids near the activation loop in comparison to the MAPKs belonging to TEY subgroups. The insertion of these extra amino acids in the activation loop does specify the substrate specificity of the enzymes, though the specific activation by the upstream signaling remains constant (Jiang et al. 1997). The C-terminal common docking domain is the site in the TEY subgroup MAPKs where the upstream MAP2K associates, while this domain is found to be lacking in the TDY subgroup MAPKs (Rohila and Yang 2007). The most studied MAPKs in group A are the OsMPK1 and OsMPK5. OsMPK5 is an orthologue of AtMPK3 and NtWIPK, and produces two spliced isoform transcripts (OsMAPK5a and OsMAPK5b). In spite of possessing, an AIK motif in the subdomain II and TEY motif in the activation loop, OsMAPK5b does not express any kinase activity (Xiong and Yang 2003). The OsMPK5 have different functional names like OsMAPK2, OsMSRMK2, OsMAPK1, and OsBIMK1. The OsMPK5 (OsMAPK2) upregulates plant tolerance against cold and heavy metal (copper) toxicity. OsMPK5 (OsMSRMK2) induction occurs in leaf detachment processes via wounding, JA, salicylic acid (SA), ABA, drought, ozone, UV-C radiations, heavy metal toxicity, and high temperature stress. The OsMPK5 (OsMAPK1) was activated in anthers, shoots, and roots in response to ABA induction, drought, and salt stresses. The OsMPK5 (OsBIMK1) gene transcription was induced by wounding, pathogen infection and systemic acquired resistance (SAR) inducers like benzothiadiazole (BTH), dichloroisonicotinic acid (INA), and so on (Rohila and Yang 2007). The Group B OsMPKs are not well elucidated and include OsMPK2 and OsMPK6. OsMPK2 was found to be activated during an attack by the avirulent strain of Magnaporthe grisea (Reyna and Yang 2006). The involvement of the important member of group C, OsMPK4 in biotic and abiotic stress response was suggested. This is due to the fact that the basal mRNA level of this protein was downregulated during drought, high temperature, cold stress and UV-C irradiation. The induction of the same kinase occurred by exogenous application of JA and M. grisea infection (Reyna and Yang 2006). The most studied MPKs in group D are the OsMPK7, OsMPK8, OsMPK9, and OsMPK10, among which the first two have been found to be associated with biotic and abiotic stresses. Full length sequencing of the OsMPK7 cDNA showed the presence of 599 amino acids in the protein of molecular weight 65 kDa. A transmembrane domain at the N-terminus was also found with potent functions. The OsMPK7 is involved in JA-mediated signaling and defense responses (Reyna 2004). The OsMPK7 (OsMAPK44) is responsive to salinity and drought stresses. The basal mRNA transcript level of this gene was up regulated by exogenous application of ABA and hydrogen peroxide (Jeong et al. 2006). The group E is the largest in rice, consisting of six MAPKs (OsMPK12, OsMPK13, OsMPK15, and OsMPK17), all with the TDY motif. The activity of the OsMPK12 was enhanced by M. grisea attack and general defense molecules like JA, ABA, SA, and ethylene (Rohila and Yang 2007). The OsMPK13 is induced by treatment with ethylene and is associated with host cell death to prevent the spread of the unwanted infection via a pathogen attack in the plant (Reyna and Yang 2006). The only member of the group F containing the TDY motif is OsMPK11, but the clarity in its role in stress response and control is yet to be clearly deciphered (Rohila and Yang 2007). The upstream MAP2Ks in rice like the MAPKK4 and MAPKK6 are induced during cold and salt stresses. The MAPKK1 functions during salt and drought stresses

k

k

k

9 ABA, MAPK, and Calcium-Dependent Protein Kinases

215

and the MAPKK10–2 regulate plant tolerance against cold stress (Kumar et al. 2008). Thus, the rice MAPK family plays a significant role in enhancing plant tolerance against certain biotic and abiotic stresses. 9.7.3 MAPK Cascades Regulating Abiotic Stress Signaling 9.7.3.1 Salt Stress

One of the major factors of abiotic stress is the high salt content of the soil. Salinity tolerance is recognized as a multigenic trait, with quantitative trait loci (QTL) identified in barley, wheat, soybean, citrus, tomato, and rice (Flowers and Flowers 2005; Jenks et al. 2007). Exogenous treatment of ABA to the seedlings of the salt-sensitive indica rice cultivar can promote resistance to salinity stress (Roychoudhury and Chakraborty 2013). Studies on the MAPK cascade in the Arabidopsis genome exemplified the increased transcription of the MEKK1 mRNA in response to high salinity. The directed yeast two hybrid analyses showed interaction between MEKK1 and MEK1, between MEK1 and MPK4 and a feedback interaction between MPK4 and MEKK1 (Ichimura et al. 1998). Another MAPK cascade involved during salt stress is via the MPK6 and p44MAPK (Ichimura et al. 2000). Salt stress in alfalfa induced a 46 kDa SIMK (salt stress-induced MAPK). The presence of an upstream SIMKK was also found to relay its downstream phosphorylation on SIMK. Salt stress-induced MAPKs like ZmMPK3, ZmMPK5, and ZmSIMK1 have been reported in maize (Sinha et al. 2011). k

9.7.3.2 Drought Stress

Physically dry soils due to low moisture content generally create a constraint for optimum plant growth and crop development. Increased dehydration tolerance was achieved by overexpressing DSM1 (drought hypersensitive mutant 1). The DSM1 is an OsMAP3K gene found in Oryza sativa (Ning et al. 2010). The kinase activity of p44MKK4 in alfalfa was shown to be enhanced via in-gel kinase assays preceding immunoprecipitation with antibodies against different MAPKs of alfalfa (Sinha et al. 2011). The drought tolerance in Malus was also found to be mediated via expression patterns of MaMAPK cascades. Likewise, significant activity of ZmMPK3 was reported in maize in response to low water content in the soil (Peng et al. 2006). 9.7.3.3 Oxidative Stress

This kind of stress is manifested by the overproduction of the harmful Reactive Oxygen Species (ROS) like free radicals (hydroxyl, superoxide) or the non-radicals (hydrogen peroxide, lipid peroxide). They cause oxidative damages by halting normal functions of several cellular machineries. Exogenous application of antioxidants like vitamins A, C, E, biflavonoids, and carotenoids, along with catalytic enzymes like catalase (CAT), peroxidase and superoxide dismutase aid the plant system in tolerating and even overcoming such oxidative stresses (Sinha et al. 2011). The CAT1 gene in Arabidopsis which encodes the CAT enzyme to decompose scavenging hydrogen peroxide molecules has been found to be stimulated by ABA. The MAPKK inhibitor PD98059 blocked the ABA-induced CAT1 expression (Xing et al. 2007). The MEKK1 and MPK4 were operational during oxidative stress defense. SA accumulation has been found to regulate the expression of another CAT-encoding gene, CAT2 (Pitzschke and Hirt 2009). The MEKK1-MPK4 cascade is therefore an important mediator of ROS metabolism (Nakagami et al. 2006) and maintains ROS homeostasis in the

k

k

k

216

Mechanism of Plant Hormone Signaling under Stress

cell. The cellular redox status is the guiding factor for the cell to experience growth, differentiation, and development (Pitzschke and Hirt 2009). In alfalfa, the MAP3K, OMTK1 (oxidative stress-activated MAP triple kinase 1) activated the downstream MAPK, namely, MMK3 (Nakagami et al. 2004). 9.7.3.4 Ozone Stress

Strong oxidative agents like ozone often stimulate the production of ROS, like hydrogen peroxide, superoxide anions, and hydroxyl radicals. They disrupt the phospholipid-rich cell membrane via lipid peroxidation, causing cellular damage and even cell or organelle lysis (Samuel and Ellis 2002). Induction of the OsMSRMK2 gene occurrs in rice in response to oxidative stress (Agrawal et al. 2002). Ozone hypersensitiveness was reported in Arabidopsis plants lacking MPK3 and MPK6, pointing to their possible implications. Transgenic tobacco with the NtMPK4 gene silenced showed the same ozone hypersensitivity (Sinha et al. 2011). Possible regulation of MKP2 over ozone-induced MPK3 and MPK6 was found when the MPK2 RNAi plants exhibited hypersensitivity to ozone under oxidative stress conditions (Lee and Ellis 2007). 9.7.3.5 Heavy Metal Stress

k

A high concentration of heavy metals in the soil is detrimental for several cellular processes of the plant system. Presence of high levels of copper, cadmium, and mercury in their cationic forms induce the activation of the OsMSRMK2 in japonica-type rice (Sinha et al. 2011). SIMK, MMK2, MMK3, and SAMK (stress activated MAPK) stimulation was reported in Medicago seedlings exposed to toxic concentrations of copper or cadmium ions in the soil. Still, the phosphorylation by a SIMKK only on SIMK and SAMK and not on MKK2 and MKK3 in the protoplast is quite bizarre (Jonak et al. 2004). The importance of the MAPK signaling cascade in response to As (III) hyperaccumulation in the plant rhizosphere has been characterized by the activation of the OsMPK3, OsMPK4, and OsMKK4 in rice seedlings (Gupta et al. 2009; Sinha et al. 2011). 9.7.3.6 Temperature Stress

The transcription levels of AtMEKK1 and AtMPK3 was elevated along with the induction of AtMPK4 and AtMPK6 during low temperature stress (Mizoguchi et al. 1996; Ichimura et al. 2000). The activation of ZmMAPK5 was reported during cold stress (Ding et al. 2009). Several roles of MAPK cascades were reported in plants like Chorispora bungeana, Gossypium hirsutum (GhMAPK), and Salicornia brachita (SbMAPKK) (Sinha et al. 2011). Heat stress-regulated MAPKs have also been reported. With context to issues like global warming and increasing temperature, such MAPKs have turned out to be the major targets for abiotic stress-associated research. The first plant heat shock protein was identified in alfalfa and was named HAMK (heat shock-activated MAPK) (Sangwan et al. 2002). Partially purified HAMK from tomato photoautotrophic cell cultures phosphorylated the TF, HsFA3 (Link et al. 2002). Heat treatment in potato induced the transcription of StMPK1 (Blanco et al. 2006). The rapid induction of the OsMSRMK2 mRNA in rice at 37∘ C portrayed its ability to sense high temperature (Sinha et al. 2011). 9.7.3.7 ABA-Induced Activation of MAPKs

ABA is one of the prime players in mediating stress-associated responses in plant systems. ABA has been found to activate certain MAPKs during abiotic stresses. Such

k

k

k

9 ABA, MAPK, and Calcium-Dependent Protein Kinases

k

activated MAPKs can regulate the downstream signal via activation of specific TFs, such as c-Myc, c-Jun, and STE12, along with other kinases involved in gene regulation (Knetsch et al. 1996). In vivo studies showed that both the MAPK activity and the Rab16 gene expression were upregulated by treatment with sub micromolar concentrations of ABA. The connection between the ABA-induced Rab16 gene expression and the ABA-regulated MAPK signaling was extrapolated by using protein tyrosine phosphatase inhibitor, phenylarsine oxide (PAO), indicating the linkage between MAPK signaling and tyrosine phosphatase stimulation (Knetsch et al. 1996). Accumulation of ABA in the cell controls the transcriptional regulation of MPK3, MPK5, MPK7, MPK18, MPK20, MKK9, MAP3K1 (ANP1), MAP3K10 (MEKK3), MAP3K14, MAP3K15, MAP3K16, MAP3K17, MAP3K18, MAP3K19, Raf6, Raf12, and Raf35 in Arabidopsis (Wang et al. 2011). Transcriptional upregulation of OsMAPK5 (OsMAP1), OsMAPK2, OsMSRMK2, OsMSRMK3, OsBIMK1, DMS1, OsEDR1, OsMAPK44, OsSIPK, OsWJUMK1, and OsMKK1 by ABA induction have been reported in rice (Danquah et al. 2014; Agrawal et al. 2002, 2003; Jeong et al. 2006; Lee et al. 2008). In several other plants, ABA has been shown to transcriptionally activate the genes like CbMAPK3, CsNMAPK, AhMPK3, BnOIPK , BnMPK3, RaMPK1, RaMPK2, RsMPK2, and StMPK1 (Blanco et al. 2006; Liu et al. 2010; Yin et al. 2010; Zhang et al. 2006; Danquah et al. 2014). The treatment of the barley aleurone protoplasts with ABA promoted temporal activation of a myeline basic protein (MBP) kinase activity. The kinase was immunoprecipitated by incubation with anti-ERK1 polyclonal antibodies. Other sets of antibodies against the phosphotyrosine residues yielded the same results. Further immunoblot analyses implicated the presence of three possible MAPK isoforms ranging between 40–43 kDa in the barley aleurone (Knetsch et al. 1996). An ABA-induced MAPK, the p38MAPK was identified in moss (D’Souza and Johri 2002). The guard cell signaling via ABA induction requires a change in ion fluxes, which was found to be mediated by the ABA-induced p45MAPK in pea (Schroeder et al. 2001). Oxidative stress leads to ROS generation in cells, which upregulates ABA-mediated MAPK signaling (Desikan et al. 2004; Jammes et al. 2009). The dehydrin gene expression and ABA-induced stomatal regulations were negatively hampered by the action of MAP2K inhibitor, PD98059 in the epidermal peels of pea. The use of SB203580, inhibiting the p38 MAPK (in the mammalian system) hindered ABAand hydrogen peroxide-regulated stomatal closure and the potassium ion flux across the plasmalemma in the Vicia faba plant (Jiang et al. 2008). Transgenic plants with low activity of MPK3 showed reduced control of ABA over stomatal opening and hydrogen peroxide-induced stomatal closure. The ABA-induced stomatal closure in such plants however remained unaffected. Similarly, the mkk1 and the mpk6 mutants showed abnormality in the synthesis of hydrogen peroxide by accumulated ABA in the apoplast of guard cells (Xing et al. 2008). The creation of double mutants of mpk9/mpk12 showed high amounts of moisture loss via transpiration through the open stomata during abiotic stresses like drought or salinity. The interesting part of the finding was that neither of the single mutants, mpk9 or mpk12 showed such abnormality. This enhanced the fact that both MPK9 and MPK12 together are positive regulators of ABA- and hydrogen peroxide-mediated guard cell signaling and stomatal closure (Jammes et al. 2009). Recently, it was observed that while MPK9/MPK12 operates the ABA-mediated response in the guard cells, the pathogen-induced biotic stress response in the guard cells is mediated by MPK3/MPK6 (Montillet et al. 2013).

k

217

k

k

218

k

Mechanism of Plant Hormone Signaling under Stress

The NADPH oxidase, RBOHF has been found to regulate ABA-mediated signals in guard cells (Mersmann et al. 2010). Another instance of a MAPK cascade functioning in ABA signal transduction is the MdMPK1 and MdMKK1 in apple (Wang et al. 2010). MdMPK1 was found to encode an active MAPK, and modified immunoprecipitation enhanced the association among MdMPK1 and MdMKK1 forming a cascade. However, the autophosphorylation of MdMPK1 can be enough to mask the phosphorylation effect of the upstream kinase. Hence, to discriminate between the two, a kinase-negative form of MdMPK1 was produced by site-directed mutagenesis of lysine residues (90K and 91K) within the ATP binding domain into methionine residues. Genetic engineering helped in the expression of the MdMPK1KM fused to a 6X His tag and the MdMKK1 fused with the glutathione S-transferase (GST) protein via vectors transfected into E. coli. Purification via affinity chromatography indicated that the mutated MdMPK1KM showed no autophosphorylation. Further assumption of strong phosphorylation of MdMPK1KM by the upstream MdMKK1 was also proved by using gamma [32 P]-radiolabeled ATPs. The labeled terminal phosphate was loaded onto the phosphorylation site on MdMPK1KM from the supplied radiolabeled ATPs (Wang et al. 2010). ABA rapidly activated the enzymatic activity of MdMPK1. This was proved by the application of anti-MdMPK1c serum and immunoprecipitation-coupled in-gel kinase assay. This increment in enzymatic activity reached its peak within 15 minutes of incubation and returned to the basal level after longer spans of incubation. Immunoblotting assays showed that ABA interaction did not distinctly alter the steady-state levels of the MdMPK1 protein. Hence, it is possible that the post translational activation of MdMPK1 is mediated by ABA (Wang et al. 2010). The MdMPK1 and MdMKK1 expressing seeds, when grown in media supplemented with increasing concentrations of ABA (0.5, 1, and 3 μM), showed more rapid growth than the wild type seeds. This supported the fact that MdMKK1- and MdMPK1-expressing seeds were hypersensitive to ABA during germination (Wang et al. 2010). The ABA-mediated MdMPK1 phosphorylates ABI5 at the conserved Ser314 residue. ABI5 also possesses the potential to often act as a target of the ABA-regulated MAPK signaling pathways. The aforesaid MdMPK1-MdMKK1 coupled cascade was shown to affect the downstream transduction through the expression and phosphorylation of either ABI5 or ABI5-like TFs or even other such crucial components of the signaling pathway (Wang et al. 2010). So far, our discussion on MAPKs has highlighted the importance of phosphorylation in MAPK cascades. It should be emphasized that the corresponding phosphatases, about which little is known, also plays pivotal roles in the transduction modules. The dephosphorylation of only the specific residue in the highly conserved TXY motif at which the protein is phosphorylated is enough to herald the termination of the subsequent activities. The Medicago sativa (alfalfa) MP2C is the first PP2C shown to negatively regulate MAPK signaling by directing its activity over the salt-inducible SIMK at the Thr residue in the pTEpY motif (Meskiene et al. 1998, 2003). In the same process, the AP2C1 of Arabidopsis, a close homologue of the alfalfa MP2C showed phosphatase activity over MPK4 and MPK6, terminating their activities (Schweighofer et al. 2007). The PP2Cs (Ptc1 and Ptc3) negatively regulate the MAPK Hog1 (high osmolarity glycerol) by direct dephosphorylation (Nguyen and Shinozaki 1999). In ABA signaling, AP2C1, a member of the clade B of PP2C superfamily acts as a MAPK phosphatase (Schweighofer et al. 2007). Four out of the six members of clade B contains a typical

k

k

k

9 ABA, MAPK, and Calcium-Dependent Protein Kinases

k

KIM (MAPK interaction motif ) (Schweighofer et al. 2007). The co-localization of the nuclear protein phosphatase PP2C5 (genetically fused to CFP or Cyan Fluorescent Protein) along with other fluorescent protein fused-MAPKs (MPK3, MPK4, MPK6) in the Arabidopsis protoplast system were studied. It was seen that PP2C5 could dephosphorylate activated MAPKs. The physical interaction between PP2C5 and MPK3, MPK4, MPK6 was verified using the yeast two-hybrid assay (Brock et al. 2010). Apart from the PP2C5, a Dual Specificity Phosphatase (DsPTP) named IBR5 (conferring reduced root sensitivity towards auxin and ABA in Arabidopsis) also interacts with MPK12 (Lee et al. 2009). The ABA-induced MAPK signaling in the guard cells promote stomatal movements (Danquah et al. 2014). In the mutants, pp2c5 and ap2c1 (AP2C1 is a close homologue of PP2C5) T-DNA insertion lines showed a significantly increased stomatal aperture under normal conditions. No increase in the stomatal aperture was recorded in the pp2c5 line complemented with a PP2C5 gene. Increased stomatal aperture along with reduced responses of the ABA-inducible genes like ABI1, ABI2, and Erd10 were also recorded in the pp2c5/ap2c1 double mutants. In spite of the increased stomatal aperture, none among the double or the single mutants, however showed any sign of extra moisture loss, when exposed to abiotic stresses like drought and salinity (Brock et al. 2010). Thus, it is probable that the changed concentration levels of PP2C5 affected the MAPK functions in the guard cells in response to transduction mediated by ABA. Knockdown of the PP2C5 gene in Arabidopsis ensured prolonged activation of ABA-inducible MPK3 and MPK6. In Nicotiana benthamiana, the same experiment showed that even after ABA treatment, the SA-induced MAPKs and wound-induced MAPK (WIPK) remained benign (Brock et al. 2010). The pathogen response gene, Azelaic Acid Induced 1 (AZI1), encoding protein for lipid transfer was downregulated under combined dehydration and nematode stresses. The negative influence on ABA biosynthesis and functionality of ABA-responsive genes was observed by the induction of the Systemic Acquired Resistance (SAR) gene product (Atkinson et al. 2013). The AZI1 expression was found to be higher in the ABA-insensitive abi2 mutant, showing the negative regulation of ABA on AZI1 governed systemic immunity and drought susceptibility. Plant pathogens like parasitic nematodes have developed mechanisms to cause minimum damage to the plant cells during their spreading and also to bypass the normal plant defense responses. When such biotic and abiotic stresses occur together, the plant attaches its priority to the more hazardous abiotic stress. Such responses are most often regulated by ABA, via MAPK signaling cascades, in spite of the fact that the biotic and the abiotic stress responses act antagonistic to each other (Atkinson et al. 2013).

9.8 Calcium Dependent Protein Kinases (CDPKs) The CDPKs are an important class of Ser/Thr protein kinases in plants having an N-terminal kinase domain fused to a C-terminal calmodulin (CaM) like domain through a junction region. This maintains the stability and the auto-inhibited state of the kinase. The multigene families of CDPKs are the result of gene duplication (Zhu et al. 2007). The CDPKs are generally activated by calcium and hence provide a possible

k

219

k

k

220

k

Mechanism of Plant Hormone Signaling under Stress

mechanism in decoding calcium-mediated signaling pathways (Harper et al. 1994; Hrabak et al. 1996; Chico et al. 2002). Out of the 34 CDPK genes in Arabidopsis, the expression of three of them could not be shown, via cDNA persistence or expression of sequence tag clones. This proves that these might be either non-expressed pseudogenes or because of the transcription activation under specific stress stimuli, their transcript level in the cell under normal conditions is low or limited to a specific type of cells (Hrabak et al. 2003). Except CDPK25 (CPK25), other CDPKs of Arabidopsis possess four EF hands (helix-loop-helix structural motif for calcium binding) as decoded by Simple Modular Architecture Research Tool (SMART) (Schultz et al. 2000). This is due to the truncation of the C-terminal end in CPK25 that can accommodate only one EF hand. The CDPK N-termini often provide specific sites of myristoylation and a flanking Cys residue is often a target site for palmitoylation (Hrabak et al. 2003). Such CDPK protein kinases have molecular masses ranging between 54–72 kDa. After the establishment of myristoylation in CPK5, the myristoylation reactions occurring even in CPK6 and CPK13 seemed probable. Such myristoylation is an important post-translational modification in CDPKs to enhance their membrane binding capacities in Arabidopsis. This helps them to regulate the signaling modules in an efficient manner (Hrabak et al. 2003). The CDPKs are often considered a type of MAPK, activated by calcium binding, according to some schools of thought. The interaction of such CDPKs with phytohormones like ABA results in the production of functional proteins aiding in abiotic and biotic stress tolerance. Recently, CPKs have been found in all plants ranging from green algae to higher eukaryotic species via a broadly sampled phylogenetic analysis. Such findings exemplify the diversification of CPKs on the basis of specific expression and functions in certain plants and under specific stressed situations. Keeping at par with the divergence of terrestrial plants, CPK sequence diversification has also occurred in parallel. Such variations in CPK have been classified under four major groups. The high levels of conservation in the sequences of CPK have been observed among CPKs in all plant species. Thus, a minimum correlation between the groups formed on the basis of CPK evolution in plants has been chalked out (Valmonte et al. 2014). The polar localization and regulation of the underlying transporters mediate the alterations in ion gradients and fluxes at the tips to enhance the apical growth in pollen tubes (PTs). Recently, a negative gradient of cytosolic anion concentration focused on the tip was reported showing negative correlation with the cytosolic calcium ion concentrations. The possibility of functional CPKs connecting the two events hence increases (Gutermuth et al. 2013). Experiments with SLAH3: YFP [Yellow Fluorescent Protein (YFP) fused to a homologue of the SLOW ANION CHANNEL-ASSOCIATED1 (SLAH3)] showed fluorescence signal, being concentrated in the regions along PTs, whereas the lines with integrated CPK2/CPK20/CPK17/CP34: YFP constructs exhibited fluorescence strictly localized at the cell membrane tip together with the anion efflux (Gutermuth et al. 2013). The Förster-resonance energy transfer fluorescence lifetime microscopy in the protoplasts of the mesophyll cells in Arabidopsis and bimolecular fluorescence complementation (BiFC) in living PTs proved that the protein interactions occured between SLAH3 and CPK2/CPK20 and not with CPK17/CPK34. The CPK2/CPK20 regulation in PT growth was also inferred from the fact that the double mutants of cpk2/cpk20 in PT cells exhibited comparably less extracellular anion fluxes at the tip than the wild type controls (Gutermuth et al. 2013).

k

k

k

9 ABA, MAPK, and Calcium-Dependent Protein Kinases

221

9.8.1 CDPK Activities 9.8.1.1 Regulation of CDPK Activity

k

The CDPK activity is regulated by reversible phosphorylation in presence of calcium flux. Autophosphorylation has been found to be a common observation in both the native and recombinant CDPKs (Cheng et al. 2002). Experiments showed that the in vitro autophosphorylation led to the activation of Arachis hypogea CDPK, while inhibited a CDPK in Psophocarpus tetragonolobus (winged bean). The NtCDPK2 in tobacco required both calcium stimulation and phosphorylation for its activation. Since in vitro phosphorylation could not substitute the effect of in vivo phosphorylation, autophosphorylation was not considered to be a step in the activation of this CDPK (Cheng et al. 2002). Similarly, dephosphorylation plays an important role in mediating CDPK activities. A soluble phospho-Ser phosphatase from the shoots of the winged beans was isolated, which dephosphorylated and inactivated WbCDPK1. Thus, an inhibitory effect of autophosphorylation via a regulatory feedback loop was released (Cheng et al. 2002; Ganguly and Singh 1999). Phospholipids have also found to initiate higher activation levels in CDPK like the Avena sativa (oat) CDPK, AtCPK1 and Daucus carota (carrot) DcCPK1 in exhibiting their kinase activities on the specific substrates (Cheng et al. 2002). Phosphatidylinositol and lyso-phosphatidylcholine promotes the AtCPK1 kinase activity. Phosphatidylinositol also relieves the inhibitory effects of poly-Lys by CDPK autophosphorylation. The phosphatidylinositol binds to the N-terminus of the AtCPK1. Phosphatidylserine activates DcCPK1 which again phosphorylates a target residue on protein kinase C (PKC), possibly having a homologue in plants, thereby activating it (Cheng et al. 2002). Along with calcium binding activation via the EF hand motifs in CDPK, the isoforms of 14-3-3 proteins also aid in stimulating the functions of CDPKs, like AtCPK1 by binding to specific phosphorylated residues. The possible binding site of 14-3-3 proteins on AtCPK1 is the N-terminal domain having a close 14-3-3 binding site sequence of R-S/T-X-S-X-P, where the underlined Ser residue remains phosphorylated (Cheng et al. 2002; Camoni et al. 1998). The AtCPK24 and AtCPK28 also possess similar 14-3-3 binding sites at the N-terminal domain, suggesting the important regulatory functions of the 14-3-3 proteins on CDPK activities (Cheng et al. 2002). 9.8.1.2 CDPK in ABA Signaling

Ca2+ has been shown to act as secondary messengers in the ABA signaling pathway (Finkelstein and Rock 2002). Several functions of the calcium activated CDPKs have been deciphered in the ABA signaling module. ABA-stimulated CDPK, ACPK1 was identified from grape berry (Vitis vinifera) (Yu et al. 2006, 2007). The mRNA transcript levels of CPK4 and CPK11 remained unaffected, but the overall protein concentrations via translation of the aforesaid transcripts greatly increased with ABA treatment. The kinase activities of CPK4 and CPK11 were also enhanced. Due to the exogenous application of ABA, the endogenous concentration of ABA increased, which helped to mimic stress conditions in the cell. However, ABA concentration beyond 1 μM proved to be hazardous to the optimization of the response (Zhu et al. 2007). The single and double mutants of the CPK4 and CPK11 genes caused hypersensitivity towards salt stress during seed germination and seedling growth and the overexpression of CPK4 and CPK11 increased ABA sensitivity during seedling growth. Thus, the closely related CDPKs in

k

k

k

222

k

Mechanism of Plant Hormone Signaling under Stress

Arabidopsis, CPK4 and CPK11 act as pleiotropic positive regulators of CDPK/Ca2+ regulated ABA signaling in germination of seeds, seedling growth, and stomatal movement (Zhu et al. 2007). Genetic approaches to acknowledge biological functions may get hindered by the redundancies in the CDPK genes (Hrabak et al. 2003; Choi et al. 2005). The CPK4 and CPK11 localize in the cytoplasm and the nucleus to phosphorylate the same TFs, ABF1 and ABF4, proposing the possibility of crosstalk between the two kinases. Other factors may also be the targets of the CDPKs, as the double mutants of the aforesaid CDPKs showed more ABA- and some salt-responsive phenotypes than the single mutants. As already mentioned earlier, water deficiency in the plant cell due to abiotic stresses like high salinity and drought is regulated by ABA. This is via the strict maintenance of water balance by stomatal closure guided by signals from the guard cells and promoting osmotic dehydration tolerance by the induction of genes encoding proteins like dehydrin. As the name suggests, dehydrins function in tolerance to stress-induced dehydration (Zhu et al. 2007; Roychoudhury et al. 2007; Ganguly et al. 2012; Danquah et al. 2014). The CPK4 and CPK11 function via the regulation of the guard cells to conserve water when the plant system has suffered moisture loss (Zhu et al. 2007). CDPKs localized in the cytoplasm sense a calcium ion flux and phosphorylate the downstream specific substrates to trigger responses such as guard cell regulation to manipulate stomatal closure. On the other hand, the CDPKs that get localized in the nucleus exhibit their enzymatic kinase activities on nuclear-based factors. These factors ultimately stimulate the transcription of specific genes to regulate a downstream response (Zhu et al. 2007). Several regulators of the ABA signaling module like ABA-inducible, stress-responsive TFs are activated by the CDPKs, via post-translational phosphorylations (Yoshida et al. 2002, 2006b; Furihata et al. 2006; Fujii et al. 2007; Song et al. 2005). The phosphorylation of ABF1 and ABF4 (AREB2) are catalyzed by CPK4 and CPK11 in Arabidopsis, while the ABA-responsive APETALA2 domain factor, ABI4 was not phosphorylated (Choi et al. 2000; Uno et al. 2000; Zhu et al. 2007). This result can draw a conclusion that the two ABFs act downstream to the two CDPKs. The ABF1 is also a target of two SnRK2s, SnRK2.2, and SnRK2.3, which shows that a single factor can be common substrates for several kinases (Fujii et al. 2007). Interaction between CPK11 and a zinc finger protein, AtDi19 (induced during salt and drought stresses) and subsequent phosphorylation of the latter by the former also supports the participation of CPK11 in ABA signaling for stress tolerance (Zhu et al. 2007). The guard cell ion channel regulation is transduced via ABA signals, utilizing the cytosolic calcium ions. The guard cell expressed-CDPKs in Arabidopsis such as CPK3 and CPK6 are important regulators of guard cell signaling. They act as calcium ion sensors, as their mutant forms affected stomatal closure (Mori et al. 2006). In the guard cells of the double mutants, cpk3/cpk6, the ABA-induced, calcium-activated, slow type anion channels in the cell membrane were seen to be impaired, leading to the abnormal and partial closure of the stomata. However, the long lasting calcium ion-programmed stomatal closure remained normal, thus drawing the inference that a different signaling module regulates such long term responses (Mori et al. 2006). AtCPK10 and AtCPK30 are activated by an ABA-inducible promoter during abiotic stresses. The transcriptional enhancement of tobacco NtCDPK1 and AtCPK32 is mediated by ABA, which also regulates grape ACPK1 activation and its subsequent enzymatic functions (Wan et al. 2007; Ding et al. 2013). The rice genome consists of 29 CDPKs which have been identified through genome screenings and construction of complete full length cDNA database. All of the 29

k

k

k

9 ABA, MAPK, and Calcium-Dependent Protein Kinases

k

CDPKs amazingly contained multiple stress responsive cis-elements in the upstream promoter region, constituting 1 Kbp of the genes (Wan et al. 2007). The interaction of specific factors with these cis-elements results in the transcription of the CDPK genes under specific stress responses. Thus, it is the nature of the cis-elements that regulate promoter efficiency and gene expression (Wan et al. 2007). The multiple stress responsive cis-elements, identified in different CDPKs include EBOXBNNAPA, MYBCORE, MYCATRD22, DRECRTCOREATC, LTRECOREAT-COR15, CCAATBOX, IBOXCORE, and WBOXATNPR1. These cis-elements have been found to initiate crucial roles in specific gene expression during ABA response, water deficit, cold stress, heat shock, light stress, and pathogen attack. The EBOXBNNAPA is the most well distributed ABA-responsive cis-element in the CDPKs of rice (Wan et al. 2007). IBOXCORE is a light-regulated cis-element in the promoter region of most rice CDPK genes. MYBCORE and MYCATRD22 are the cis-elements that are bound by the MYB and MYC proteins, regulating a number of stress-inducible genes. The dehydration responsive element/C-repeat (DRE/CRT) actually resides within the DRECRTCORERT cis-element, where the factors like DREBs/CBFs (Dehydration Responsive Element Binding/C-repeat Binding Factors) bind and regulate the transcription of certain stress-inducible genes (Urao et al. 1993; Abe et al. 1997; Busk et al. 1998; Dubouzet et al. 2003; Qin et al. 2004). LTRECOREATCOR15 is a Low Temperature-Responsive Element (LTRE) and is required for transcription of the Cor15a and BN115 genes under cold stress. The CCAATBOX sequence interacts with adjacent Heat Shock Element (HSE) to activate transcription of heat shock proteins (Wan et al. 2007). OsCPK6, OsCPK13, OsCP17, and OsCPK25 were activated when the seedlings were exposed to chilling temperature, water deficiency, and salt stress. The OsCPK7 in the roots, stems, leaves, and panicles was upregulated during salt stress. The OsCPK15 levels in the stems, leaves, and panicles increased when exposed to abiotic stresses like cold and salinity. OsCPK20, OsCPK21, and OsCPK22 showed enhanced rates of transcription during cold, drought, and salt stresses, whereas the OsCPK24 and OsCPK29 were root-specific. The OsCPK24 levels increased in response to cold stress and OsCPK29 levels were high under cold, drought, and salt stresses. Since the ABA responsive cis-element EBOXNNAPA is the most common motif in rice CDPKs, most of the CDPKs we have discussed before are induced by ABA (Wang et al. 2007). 9.8.2 Relevance and Crosstalk of CDPKs in Plant Abiotic Stresses

Different parallel signaling pathways interact and affect each other’s outcomes, either in a positive or negative regulatory manner. Normally to evade away much complications, when a single stress pathway is studied, it is considered to be isolated from other stress pathways. However, this is not the actual situation in sustaining cells where signals converge and diverge to form blueprints of various signaling networks. Silencing or overexpressing certain components in the signaling pathway often show their functions in the particular signaling pathway, However, in the absence of phenotypic side affects caused due to these protein alterations, their functions in accessory or other major pathways stay unnoticed. The CDPK, belonging to the group of MAPK has a tendency to form crosstalk, serving several interests of the plant system under stressful conditions. The NtCDPK2 is stimulated both by hypo-osmotic stress and biotic stresses (Ludwig et al. 2003). The AtCPK21 of Arabidopsis regulates osmotic stress via the ABA-mediated

k

223

k

k

224

k

Mechanism of Plant Hormone Signaling under Stress

signaling pathway. The single mutants with Atcpk21 showed increased stress responses when exposed to osmotic stress, while a reversal mutation converting the mutants to wild type revived the lost wild type phenotype. However, the single mutants of CBL (Calcineurin B-Like) and CIPK (CBL Interacting Protein Kinase) proteins such as cbl1 and cipk1 showed reduced osmotic stress response when exposed to the same environmental conditions. Thus, the fact that the AtCPK21 and the CBL1/CIPK signaling modules act antagonistic to each other depending on the actual calcium ion concentration in the cell is emancipated (Steinhorst and Kudla 2013). Subtle but distinct differences between the two pairs of EF hands suggest that the binding of calcium ions to AtCPK21 may contribute to the CPK21 functional variability (Steinhorst and Kudla 2013). Recently, the ABA-mediated CDPK in Arabidopsis pollen, AtCPK11 was seen to regulate a potassium ion channel (Steinhorst and Kudla 2013; Zhao et al. 2011). The CPK11 and CPK24 negatively regulated the pollen-specific Shaker type K+ channel (SPIK). That the CPK11 and CPK24 act in the same signaling module was found by the generation of single mutants like cpk11 and cpk24 and double mutants like cpk11/cpk24. All of the generated mutants showed the removal of the calcium-dependent inhibition on inward potassium fluxes, thus promoting PT growth (Steinhorst and Kudla 2013). The involvement of AtCPK4 and AtCPK11 with ABA responsiveness has already been discussed before. The quadruple loss-of-function mutants with Atcpk4/Atcpk5/Atcpk6/Atcpk11 had developed less responsiveness to pathogen invasion. They had also lost the ability of ROS production. This indicated the hindrance in the activation of RBOH (Respiratory Burst Homologue), an NADPH oxidase. The ABA-induced AtCPK4 and AtCPK11 that regulate abiotic stress responses also phosphorylate NADPH oxidases in vitro, thus approving them as the major components in ROS production during immune signaling (Steinhorst and Kudla 2013). AtCPK12 acts antagonistically to the positive regulators in ABA signaling like AtCPK4 and AtCPK11. Hence, the activities performed by the close homologues of AtCPK12 become balanced. Such mediation and crosstalk among the CDPKs act as potential calcium ion sensors, aiding in the activation and termination of a particular signal (Zhao et al. 2011). The high level of complexity and crosstalks involved in CDPK signaling has not been completely deciphered. Overexpression of the negative regulator of ABA, AtCPK12 under the CaMV (Cauliflower Mosaic Virus) 35S promoter and the downregulation of the same AtCPK12 under the CPK12-RNAi lines, both resulted in ABA hypersensitivity, which is quite confusing (Zhao et al. 2011). Actually, the negative regulation of CPK12 is carried out by CPK12 itself. CPK12 phosphorylates the two ABA-responsive factors, ABF1 and ABF4, which put an activating phosphate residue on ABI2, a PP2C. The ABI2 exhibits its phosphatase activity on the activated substrates of the CDPKs, which positively regulate ABA-mediated signaling (Zhao et al. 2011). 9.8.3 CDPKs as Potent Signaling Hubs

The CDPKs show a high level of versatility in their modes of action. The obvious proposals of CDPKs acting as signaling hubs in abiotic stress signaling mediated by ABA are now being given. Such explanations are supported by the fact that even a single isoform of the enzyme may stimulate convergence and integration of responses mediated by diverse biological processes. Multiple CDPKs have a tendency to follow the same signal transducing pathway, often to target the common substrate protein

k

k

k

9 ABA, MAPK, and Calcium-Dependent Protein Kinases

225

(Schulz et al. 2013). A particular CDPK can be functional in a single pathway with its concentration mediated by scaffolding proteins or it can be diverse in its activities having substrates whose activations control multiple pathways. Apart from ROS production, the AtCPK6 functions in multiple pathways by mediating ABA-responsive and abiotic stress signals. AtCPK6 directly phosphorylates SLAC1, which is required for plant guard cell S-type anion channel function in stomatal signaling; gets activated by biochemical inductions by flg22 in leaf protoplasts and regulates the transcriptional load in innate immune responses (Munemasa et al. 2011; Gao et al. 2013; Schulz et al. 2013). Another example of a potent signal hub is the CPK11, due to its participation in immune responses, abiotic stresses, and growth in PTs, about which we have exhaustively discussed before. Each CDPK is thought to have unique, stimulus-specific sites of phosphorylation in their specific substrates. Recently, the site-specific differential pattern in RBOHD mediated by AtCPK5 has been decoded by SRM-MS (Selection Reaction Monitoring-Mass Spectrometry) (Schulz et al. 2013). The calcium binding domain in the CDPK isoforms often show varying affinities towards calcium binding, thus leading to variable functions. Deciphering these variations in calcium binding among the various isoforms of the same CDPK still remain as big obstacles in absolutely proving the CDPKs as signaling hubs and playing nodal roles (Schulz et al. 2013).

9.9 MAPK-CDPK Crosstalk k

A close homologue of the AtCPK4 and AtCPK11 is ZmCPK11 of maize that belongs to the group I CDPK family (Boudsocq and Sheen 2012). ZmCPK11 aids in ABA-induced antioxidant defense in maize, by the expression of the antioxidant genes like SOD4 (Superoxide Dismutase 4) and cAPX (chloroplastic Ascorbate Peroxidase) (Ding et al. 2013). In maize, the homologue of AtMPK6 and OsMPK1 regulating the ABA-induced antioxidant defense in reply to oxidative stress is ZmMPK5 (Xing et al. 2008; Zhang et al. 2012). Application of the CDPK inhibitor, N-(6-aminohexyl)-5-chloro-1-naphthalene sulfonamide hydrochloride (W7) prohibited the activation of MAPKs, induced by cold and heat. This suggests the possible activation of MAPKs via CDPKs (Ding et al. 2013). Recent findings, however, oppose the presence of crosstalk between the MAPK and the CDPK pathways in response to biotic stress like pathogen attack and abiotic stress like salt stress (Kobayashi et al. 2012; Ding et al. 2013). According to the latest findings, three instances show the connectivity between ZmCPK11 and ZmMPK5. The parallel downregulation of ZmCPK11 and ZmMPK5 occurred with the application of EGTA (Ethylene Glycol Tetraacetic Acid) in maize leaves. The RNAi silencing of ZmCPK11 hindered the expression of ZmMPK5. It even restricted the ABA-induced activation of ZmMPK5, whereas the RNAi silencing of ZmMPK5 did not affect the expression and activities of ZmCPK11 at all. The maize protoplasts with partial silencing of ZmMPK5 and partial activity of ZmCPK11 negligibly induced the transcription of the antioxidant genes like SOD and cAPX. All these facts clearly prove that ZmCPK11 does crosstalk with ZmMPK5. Also, ZmCPK11 acts upstream to ZmMPK5 in the signaling module (Ding et al. 2013). The RNAi mediated silencing of ZmCPK11 in Zea mays protoplasts hindered the ABA-stimulated increment in the production of hydrogen peroxide. It is now proposed that ZmCPK11 upregulates the production of ABA-mediated hydrogen peroxide, which is also required for the activation of ZmMPK5 in the ABA signaling

k

k

k

226

Mechanism of Plant Hormone Signaling under Stress

EGTA

RNAi

Production of

silencing

proteins to combat oxidative stress

W7 ZmMPK5

ZmCPK11

SOD4 cAPX

Immune

Pollen

Responses

Tube growth

k

Cellular

Hydrogen Peroxide

ROS homeostasis

Redox status

Figure 9.4 CDPK acting as potent signaling hub and CDPK-MAPK crosstalk in Zea mays: EGTA (Ethylene Glycol Tetraacetic Acid), W7 (N-(6-aminohexyl)-5-chloro-1-naphthalene sulphonamide hydrochloride), and RNAi silencing, all inhibit ZmCPK11 activity, which triggers immune responses, PT growth, and other important plant physiological processes. ZmCPK11 inhibition also inhibits hydrogen peroxide production. Such inhibition prohibits the activity of the downstream-acting ZmMPK5. Thus, inhibition of ZmCPK11 inhibits ZmMPK5 and affects ROS (Reactive Oxygen Species) homeostasis and the redox status of the cell. Hindrance in ZmMPK5 activity blocks SOD4 (SuperOxide Dismutase4) and cAPX (chloroplastic Ascorbate Peroxidase) activities.

pathway. This probably explains how the ZmCPK11 acting upstream to the ZmMPK5 activates the same (Ding et al. 2013) (Fig. 9.4).

9.10 Conclusion and Future Perspectives Recent research developments on ABA membrane receptors as well as the soluble receptors in ABA signaling, the positive regulators like SnRK2s, the ABA- transporters, and downstream effectors have been thoroughly discussed in the present chapter, along with the negative regulators like PP2Cs that, importantly, terminate signal transduction. Thus, ABA is the central regulator in mediating abiotic stress responses when the plant is exposed to dehydration, cold, high temperature, oxidative stress, and salt stress. Recent reports have shown that the blueprint signaling network in which the linkage between ABA-MAPK and ABA-CDPK exists is highly complex in nature. Future work with well developed and modified experimental protocols is required to simplify our understanding of the downstream ABA signaling transduction. Another interesting and amazing aspect is the possibility of a crosstalk existing among CDPK-regulated pathways as well as between CDPK and MAPK regulated pathways. CDPKs are also portrayed as potent signaling hubs important in regulating multiple pathways related to ABA-dependent abiotic stress response and even biotic stresses. The next target to be achieved is to gain a detailed knowledge regarding ABA-mediated signaling in order to design transgenic plant varieties and crop cultivars that can be tolerant to a particular abiotic stress. This may be accomplished through overexpression of the ABA-responsive

k

k

k

9 ABA, MAPK, and Calcium-Dependent Protein Kinases

227

genes, positively regulating stress tolerance, or through the knockdown or silencing of genes negatively regulating stress tolerance. Genetic modifications of the TFs which mediate the transcription of their target stress-responsive genes could also be another approach. All these applications require profound knowledge of the signal transduction mechanism operated by ABA under abiotic stress situations. The present review has been a humble effort on our part to portray an updated knowledge in this field.

Acknowledgments Financial support from Science and Engineering Research Board (SERB), Department of Science and Technology (DST), Government of India and from Council of Scientific and Industrial Research (CSIR), Government of India through the research grants SR/FT/LS-65/2010 and 38(1387)/14/EMR-II, respectively, to Dr. Aryadeep Roychoudhury is gratefully acknowledged.

References

k

Abdeen A, Schnell J, Miki B (2010) Transcriptome analysis reveals absence of unintended effects in drought-tolerant transgenic plants overexpressing the transcription factor ABF3. BMC Genomics 11:69. Abe H, Yamaguchi-Shinozaki K, Urao T, Iwasaki T, Hosokawa D, Shinozaki K (1997) Role of Arabidopsis MYC and MYB homologs in drought- and abscisic acid regulated gene expression. Plant Cell 9:1859–1868. Agrawal GK, Rakwal R, Iwahashi H (2002) Isolation of novel rice (Oryza sativa L.) multiple stress responsive MAP kinase gene, OsMSRMK2, whose mRNA accumulates rapidly in response to environmental cues. Biochem Biophys Res Commun 294:1009–1016. Ahlfors R, Macioszek V, Rudd J, Brosche M, Schlichting R, Scheel D, et al. (2004) Stress hormone-independent activation and nuclear translocation of mitogen-activated protein kinases in Arabidopsis thaliana during ozone exposure. Plant J 40:512–522. Antoni R, Gonzalez-Guzman M, Rodriguez I, Rodrigues A, Pizzio GA, Rodriguez PL (2012) Selective inhibition of clade A phosphatases type 2C by PYR/PYL/RCAR abscisic acid receptors. Plant Physiol 158:970–980. Asai T, Tena G, Plotnikova J, Willmann MR, Chiu WL, Gomez-Gomez L, et al. (2002) MAP kinase signaling cascade in Arabidopsis innate immunity. Nature 415:977–983. Atkinson NJ, Lilley CJ, Urwin PE (2013) Identification of genes involved in the response to Arabidopsis to simultaneous biotic and abiotic stresses. Plant Physiol 162:2028–2041. Banerjee A, Roychoudhury A (2016) Group II late embryogenesis abundant (LEA) proteins: structural and functional aspects in plant abiotic stress. Plant Growth Regul 79: 1–17. Beck M, Komis G, Muller J, Menzel D, Samaj J (2010) Arabidopsis homologs of nucleusand phragmoplast-localized kinase 2 and 3 and mitogen-activated protein kinase 4 are essential for microtubule organization. Plant Cell 22:755–771. Beck M, Komis G, Ziemann A, Menzel D, Samaj J (2011) Mitogen-activated protein kinase 4 is involved in the regulation of mitotic and cytokinetic microtubule transitions in Arabidopsis thaliana. New Phytol 189:1069–1083.

k

k

k

228

k

Mechanism of Plant Hormone Signaling under Stress

Bensmihen S, Giraudat J, Parcy F (2005) Characterization of three homologous basic leucine zipper transcription factors (bZIP) of the ABI5 family during Arabidopsis thaliana embryo maturation. J Exp Bot 56:597–603 Blanco FA, Zanetti ME, Casalongue CA, Daleo GR (2006) Molecular characterization of a potato MAP kinase transcriptionally regulated by multiple environmental stresses. Plant Physiol Biochem 44:315–322. Boudsocq M, Barbier-Brygoo H, Lauriere C (2004) Identification of nine sucrose nonfermenting 1-related protein kinases 2 activated by hyperosmotic and saline stresses in Arabidopsis thaliana. J Biol Chem 279:41758–41766. Boudsocq M, Droillard MJ, Barbier-Brygoo H, Lauriere C (2007) Different phosphorylation mechanisms are involved in the activation of sucrose nonfermenting1 related protein kinases2 by osmotic stress and abscisic acid. Plant Mol Biol 63:491–503. Boudsocq M, Sheen J (2012) CDPKs in immune and stress signaling. Trends Plant Sci 18:1360–1385. Brock AK, Willmann R, Kolb D, Grefen L, Lajunen HM, Bethke G, Lee J, et al. (2010) The Arabidopsis mitogen-activated protein kinase phosphatase PP2C5 affects seed germination, stomatal aperture and abscisic acid-inducible gene expression. Plant Physiol 153:1098–1111. Burza AM, Pekala I, Sikora J, Siedlecki P, Malagocki P, Bucholc M, et al. (2006) Nicotiana tabacum osmotic stress-activated kinase is regulated by phosphorylation on Ser-154 and Ser-158 in the kinase activation loop. J Biol Chem 281:34299–34311. Busk PK, Pages M (1998) Regulation of abscisic acid induced transcription. Plant Mol Biol 37:425–435. Camoni L, Harper JF, Palmgren MG (1998) 14-3-3 proteins activate a plant calcium-dependent protein kinase (CDPK). FEBS Lett 430:381–384. Chaiwongsar S, Strohm AK, Su SH, Krysan PJ (2012) Genetic analysis of the Arabidopsis protein kinases MAP3K epsilon1 and MAP3K epsilon2 indicates roles in cell expansion and embryo development. Front Plant Sci 3:228. Chen J-G, Gao Y, Jones AM (2006) Differential roles of Arabidopsis heterotrimeric G-protein subunits in modulating cell division in roots. Plant Physiol 141:887–897. Cheng SH, Willmann MR, Chen HC, Sheen J (2002) Calcium signaling through protein kinases. The Arabidopsis calcium-dependent protein kinase gene family. Plant Physiol 129(2):469–485. Chico JM, Raices M, Tellez-Inon MT, Ulloa RM (2002) A calcium-dependent protein kinase is systemically induced upon wounding in tomato plants. Plant Physiol 128:256–270. Choi H, Hong J, Ha J, Kang J, Kim SY (2000) ABFs, a family of ABA responsive element binding factors. J Biol Chem 275: 1723–1730. Choi H, Park HJ, Park JH, Kim S, Im MY, Seo HH, et al. (2005) Arabidopsis calcium-dependent protein kinase CPK32 interacts with ABF4, a transcriptional regulator of abscisic acid-responsive gene expression, and modulates its activity. Plant Physiol 139:1750–1761. Christmann A, Weiler EW, Steudle E, Grill E (2007) A hydraulic signal in root-to-shoot signaling of water shortage. Plant J 52:162–174. Colcombet J, Hirt H (2008) Arabidopsis MAPKs: a complex signaling network involved in multiple biological processes. Biochem J 413:217–226.

k

k

k

9 ABA, MAPK, and Calcium-Dependent Protein Kinases

k

Corrêa LG, Riaño-Pachón DM, Schrago CG, dos Santos RV, Mueller-Roeber B, Vincentz M (2008) The role of bZIP transcription factors in green plant evolution: adaptive features emerging from four founder genes. PLoS ONE 3: e2944. Cushman JC, Bonhert HJ (2000) Genomic approaches to plant stress tolerance. Curr Opin Plant Biol 3:117–124. Cutler SR, Rodriguez PL, Finkelstein RR, Abrams SR (2010) Abscisic acid: emergence of a core signaling network. Annu Rev Plant Biol 61:651–679. Danquah A, Zelicourt A, Colcombet J, Hirt H (2014) The role of ABA and MAPK signaling pathways in plant abiotic stress responses. Biotechnol Adv 32:40–52. Desikan R, Cheung M, Bright J, Henson D, Hancock J, Neill S (2004) ABA, hydrogen peroxide and nitric oxide signalingg in stomatal guard cells. J Exp Bot 55:205–212. Ding H, Zhang A, Wang J, Lu R, Zhang H, Zhang J, Jiang M (2009) Identity of an ABA -activated 46 kDa mitogen-activated protein kinase from Zea mays leaves: partial purification, identification and characterization. Planta 230:239–251. Ding Y, Cao J, Ni L, Zhu Y, Zhang A, Tan M, Jiang M (2013) ZmCPK11 is involved in abscisic acid-induced antioxidant defence and functions upstream of ZmMPK5 in abscisic acid signaling in maize. J Exp Bot 64:871–884. Droillard M, Boudsocq M, Barbier-Brygoo H, Lauriere C (2002) Different protein kinase families are activated by osmotic stresses in Arabidopsis thaliana cell suspensions. Involvement of the MAP kinases AtMPK3 and AtMPK6. FEBS Lett 527:43–50. D’Souza JS, Johri MM (2002) ABA and NaCl activate myelin basic protein kinase in the chloronema cells of the moss Funaria hygrometrica. Plant Physiol Biochem 40:17–24. Dubouzet JG, Sakuma Y, Ito Y, Kasuga M, Dubouzet EG, Miura S, et al. (2003) OsDREB genes in rice, Oryza sativa L., encode transcription activators that function in drought-, high salt- and cold-responsive gene expression. Plant J 33:751–763. Euglem T, Rushton PJ, Robatzek S, Somssich IE (2000) The WRKY superfamily of plant transcription factors. Trends Plant Sci 5:199–206. Finkelstein R, Gampala SSL, Rock CD (2002) Abscisic acid signaling in seeds and seedlings. The Plant Cell 14:S15–45. Finkelstein R, Reeves W, Ariizumi T, Steber C (2008) Molecular aspects of seed dormancy. Annu Rev Plant Biol 59:387–415. Finkelstein RR, Rock CD (2002) Abscisic acid biosynthesis and response. The Arabidopsis Book, American Society of Plant Biologists 1:e0058. Finkelstein RR, Somerville CR (1990) Three classes of Abscisic Acid (ABA)-insensitive mutations of Arabidopsis define genes that control over lapping subsets of ABA responses. Plant Physiol 94:1172–1179. Flowers TJ, Flowers SA (2005) Why does salinity pose such a difficult problem for plant breeders? Agr Water Manag 78:15–24. Fujii H, Chinnusamy V, Rodrigues A, Rubio S, Antoni R, Park S-Y, et al. (2009) In vitro reconstitution of an abscisic acid signaling pathway. Nature 462:660–664. Fujii H, Verslues PE, Zhu JK (2007) Identification of two protein kinases required for abscisic acid regulation of seed germination, root growth, and gene expression in Arabidopsis. Plant Cell 19:484–494. Fujii H, Zhu J-K (2009) Arabidopsis mutant deficient in 3 abscisic acid-activated protein kinases reveals critical roles in growth, reproduction, and stress. Proc Natl Acad Sci USA 106:8380–8385.

k

229

k

k

230

k

Mechanism of Plant Hormone Signaling under Stress

Fujita Y, Fujita M, Satoh R, Maruyama K, Parvez MM, Seki M, et al. (2005) AREB1 is a transcription activator of novel ABRE dependent ABA signaling that enhances drought stress tolerance in Arabidopsis. Plant Cell 17:3470–3488. Fujita Y, Nakashima K, Yoshida T, Katagiri T, Kidokoro S, Kanamori N, et al. (2009) Three SnRK2 protein kinases are the main positive regulators of abscisic acid signaling in response to water stress in Arabidopsis. Plant Cell Physiol 50:2123–2132. Furihata T, Maruyama K, Fujita Y, Umezawa T, Yoshida R, Shinozaki K, Yamaguchi-Shinozaki K (2006) Abscisic acid-dependent multisite phosphorylation regulates the activity of a transcription activator AREB1. Proc Natl Acad Sci USA 103:1988–1993. Ganguly M, Datta K, Roychoudhury A, Gayen D, Sengupta DN, Datta SK (2012) Overexpression of Rab16A gene in indica rice variety for generating enhanced salt tolerance. Plant Signl Behav 4:502–509. Ganguly S, Singh M (1999) Purification and characterization of a protein phosphatase from winged bean. Phytochem 52:239–246. Gao M, Liu J, Bi D, Zhang Z, Cheng F, Chen S, et al. (2008) MEKK1, MKK1/MKK2 and MPK4 function together in a mitogen-activated protein kinase cascade to regulate innate immunity in plants. Cell Res 18:1190–1198. Gao X, Chen X, Lin W, Chen S, Lu D, Niu Y, et al. (2013) Bifurcation of Arabidopsis NLR immune signaling via Ca2+ -dependent protein kinases. PLoS Pathog 9:e1003127. Giraudat J, Parcy F, Bertauche N, Gosti F, Leung J, et al. (1994) Current advances in abscisic acid action and signaling. Plant Mol Biol 26:1557. Gomez-Cadenas A, Verhey SD, Holappa LD, Shen Q, Ho TH, Walker-Simmons MK (1999) An abscisic acid-induced protein kinase, PKABA1, mediates abscisic acid-suppressed gene expression in barley aleurone layers. Proc Natl Acad Sci USA 96:1767–1772. Gómez-Porras JL, Riaño-Pachón DM, Dreyer I, Mayer JE, Mueller-Roeber B (2007) Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice. BMC Genomics 8: 260–273. Gonzalez-Garcia MP, Rodriguez D, Nicolas C, Rodriguez PL, Nicolas G, Lorenzo O (2003) Negative regulation of abscisic acid signaling by the Fagus sylvatica FsPP2C1 plays a role in seed dormancy regulation and promotion of seed germination. Plant Physiol 133:135–144. Gonzalez-Guzman M, Pizzio GA, Antoni R, Vera-Siera F, Merilo E, et al. (2012) Arabidopsis PYR/PYL/RCAR receptors play a major role in quantitative regulation of stomatal aperture and transcriptional response to abscisic acid. Plant Cell 24:2483–2496. Gupta M, Sharma P, Sarin NB, Sinha AK (2009) Differential response of arsenic stress in two varieties of Brassica juncea L. Chemosphere 74:1201–1208. Gutermuth T, Lassig R, Teresa Portes M, Maierhofer T, Romeis T, et al. (2013) Pollen tube growth regulation by free anions depends on the interaction between the anion channel SLAH3 and calcium dependent protein kinases CPK2 and CPK20. Plant Cell 25:4525–4543. Halford NG, Hardie DG (1998) SNF1-related protein kinases: global regulators of carbon metabolism in plants? Plant Mol Biol 37:735–748. Hamel LP, Nicole MC, Duplessis S, Ellis BE (2012) Mitogen-activated protein kinase signaling in plant-interacting fungi: distinct messages from conserved messengers. Plant Cell 24:1327–1351.

k

k

k

9 ABA, MAPK, and Calcium-Dependent Protein Kinases

k

Harper JF, Huang JF, Lloyd SJ (1994) Genetic identification of an autoinhibitor in CDPK, a protein kinase with a calmodulin-like domain. Biochem 33:7267–7277. Hartung W, Sauter A, Hose E (2002) Abscisic acid in the xylem: where does it come from, where does it go? J Exp Bot 53:27–32. Hauser F, Waadt R, Schroeder JL (2011) Evolution of abscisic acid synthesis and signaling mechanisms. Curr Biol 21:R346–355. Hirayama T, Shinozaki K (2007) Perception and transduction of abscisic acid signals: keys to the function of the versatile plant hormone ABA. Trends Plant Sci 12:343–351. Hirayama T, Shinozaki K (2010) Research on plant abiotic stress responses in the post-genome era: past, present and future. Plant J 61:1041–1052. Hoth S, Morgante M, Sanchez JP, Hanafey MK, Tingey SV, Chua NH (2002) Genome-wide gene expression profiling in Arabidopsis thaliana reveals new targets of abscisic acid and largely impaired gene regulation in the abi1–1 mutant. J Cell Sci 115:4891–4900. Hrabak EM, Chan C, Gribskov M, Harper JF, Choi, JH, et al. (2003) The Arabidopsis CDPK-SnRK superfamily of protein kinases. Plant Physiol 132:666–680. Hrabak EM, Dickmann LJ, Satterlee JS, Sussman MR (1996) Characterization of eight new members of the calmodulin-like domain protein kinase gene family of Arabidopsis thaliana. Plant Mol Biol 31:405–412. Hubbard KE, Nishimura N, Hitomi K, Getzoff ED, Schroeder JI (2010) Early abscisic acid signal transduction mechanisms: newly discovered components and newly emerging questions. Genes Dev 24:1695–1708. Ichimura K, Mizoguchi T, Irie K, Morris P, Giraudat J, Matsumoto K, et al. (1998) Isolation of ATMEKK1 (a MAP Kinase kinase kinase)-interacting proteins and analysis of a MAP kinase cascade in Arabidopsis. Biochem Biophys Res Commun 253:532–543. Ichimura K, Mizoguchi T, Yoshida R, Yuasa T, Shinozaki K (2000) Various abiotic stresses rapidly activate Arabidopsis MAP kinases ATMPK4 and ATMPK6. Plant J 24:655–665. Ichimura K, Shinozaki K, Tena G, Sheen J, Henry Y, Champion A, et al. (2002) Mitogen-activated protein kinase cascades in plants: a new nomenclature. Tends Plant Sci 7:301–308. Ingram J, Bartels D (1996) The molecular basis of dehydration tolerance in plants. Annu Rev Plant Physiol Plant Mol Biol 47:377–403. Jammes F, Song C, Shin D, Munemasa S, Takeda K, Gu D, et al. (2009) MAP kinases MPK9 and MPK12 are preferentially expressed in guard cells and positively regulate ROS-mediated ABA signaling. Proc Natl Acad Sci USA 106:20520–20525. Jenks MA, Hasegawa PM, Mohan Jain S (2007) Advances in Molecular Breeding toward Drought and Salt Tolerant Crops. Springer, Dordrecht, The Netherlands. Jeong MJ, Lee SK, Kim BG, Kwon TR, Cho WS, Park YT, et al. (2006) A rice (Oryza sativa L.) MAP kinase gene, OsMAPK44, is involved in response to abiotic stresses. Plant Cell Tiss Organ Cult 85:151−160. Jiang J, Wang P, An G, Wang P, Song CP (2008) The involvement of a P38-like MAP kinase in ABA-induced and H2 O2 -mediated stomatal closure in Vicia faba L. Plant Cell Rep 27:377–385. Jiang Y, Li Z, Schwarz EM, Lin A, Guan K, Ulevitch RJ, et al. (1997) Structure-function studies of p38 mitogen-activated protein kinase. Loop 12 influences substrate specificity and autophosphorylation, but not upstream kinase selection. J Biol Chem 272:11096−11102.

k

231

k

k

232

k

Mechanism of Plant Hormone Signaling under Stress

Johnson RR, Wagner, RL, Verhey SD, Walker-Simmons MK (2002) The abscisic acid-responsive kinase PKABA1 interacts with a seed-specific abscisic acid response element-binding factor, TaABF, and phosphorylates TaABF peptide sequences. Plant Physiol. 130:837–846. Jonak C, Nakagami H, Hirt H (2004) Heavy metal stress. Activation of distinct mitogen-activated protein kinase pathways by copper and cadmium. Plant Physiol 136:3276–3283. Joshi-Saha A, Valon C, Leung J (2011) A brand new START: abscisic acid perception and transduction in guard cells. Sci Signal 4:re4. Jouannic S, Champion A, Segui-Simarro JM, Salimova E, Picaud A, Tregear J, et al. (2001) The protein kinases AtMAP3Kepsilon1 and BnMAP3Kepsilon1 are functional homologues of S. pombe cdc7p and may be involved in cell division. Plant J 26:637–649. Kagaya Y, Hobo T, Murata M, Ban, Hattori T (2002) Abscisic acid-induced transcription is mediated by phosphorylation of an abscisic acid response element binding factor, TRAB1. Plant Cell 14:3177–3189. Kang J, Hwang J, Lee M, Kim Y, et al. (2010) PDR-type ABC transporter mediates cellular uptake of the phytohormone abscisic acid. Proc Natl Acad Sci USA 107:2355–2360. Kanno Y, Hanada A, Chiba Y, Ichikawa T, Nakazawa M, Matsui M, et al. (2012) Identification of an abscisic acid transporter by functional screening using the receptor complex as a sensor. Proc Natl Acad Sci USA 109:9653–9658. Kim W, Lee Y, Park J, Lee N, Choi G (2013) HONSU, a protein phosphatase2C, regulates seed dormancy by inhibiting ABA signaling in Arabidopsis. Plant Cell Physiol 54:555–572. Klingler JP, Batelli G, Zhu JK (2010) ABA receptors: the START of a new paradigm in phytohormone signalingg. J Exp Bot 61:3199–3210. Knetsch MW, Wang M, Snaar-Jagalska BE, Heimovaara-Dijkstra S (1996) Abscisic acid induces mitogen-activated protein kinase activation in barley aleurone protoplasts. Plant Cell 8:1061–1067. Knight H (2000) Calcium signaling during abiotic stress in plants. Int Rev Cytol 195:269–324. Kobayashi M, Yoshioka M, Asai S, Nomura H, Kuchimura K, Mori H, et al. (2012) StCDPK5 confers resistance to late blight pathogen but increases susceptibility to early blight pathogen in potato via reactive oxygen species burst. New Phytol 196:223–237. Kobayashi Y, Murata M, Minami H, Yamamoto S, Kagaya Y, Hobo T, et al. (2005) Abscisic acid-activated SnRK2 protein kinases function in the gene-regulation pathway of ABA signal transduction by phosphorylating ABA response element-binding factors. Plant J 44:939–949. Kobayashi Y, Yamamoto S, Minami H, Yamamoto S, Kagaya Y et al. (2004) Differential activation of the rice sucrose non-fermenting1-related protein kinase2 family by hyperosmotic stress and abscisic acid. Plant Cell 16:1163–1177. Komatsu K, Nishikawa Y, Ohtsuka T, Taji T, Quatrano R, Tanaka S, et al. (2009) Functional analyses of the ABI1-related protein phosphatase type 2C reveal evolutionary conserved regulation of abscisic acid signaling between Arabidopsis and the moss Physcomitrella patens. Plant Mol Biol 70:341–357. Kong Q, Qu N, Gao M, Zhang Z, Ding X, Yang F, et al. (2012) The MEKK1-MKK1/MKK2-MPK4 kinase cascade negatively regulates immunity mediated

k

k

k

9 ABA, MAPK, and Calcium-Dependent Protein Kinases

k

by a mitogen-activated protein kinase kinase kinase in Arabidopsis. Plant Cell 24:2225–2236. Koornneef M, Reuling G, Karssen CM (1984) The isolation and characterization of abscisic acid-insensitive mutants of Arabidopsis thaliana. Physiol Plant 61:377–383. Krysan PJ, Jester PJ, Gottwald JR, Sussman MR (2002) An Arabidopsis mitogen-activated protein kinase kinase kinase gene family encodes essential positive regulators of cytokinesis. Plant Cell 14:1109–1120. Kuhn JM, Boisson-Demier A, Dizon MB, Maktabi MH, Schroeder JI (2006) The protein phosphatase AtPP2CA negatively regulates abscisic acid signal transduction in Arabidopsis, and effects of abh1 on AtPP2CA mRNA. Plant Physiol 140:127–139. Kumar K, Rao KP, Sharma P, Sinha AK (2008) Differential regulation of rice mitogen activated protein kinase kinase (MKK) by abiotic stress. Plant Physiol Biochem 46:891–897. Kuromori T, Miyaji T, Yabuuchi H, Shimuzu H, et al. (2010) ABC transporter AtABCG25 is involved in abscisic acid transport and responses. Proc Natl Acad Sci USA 107:2361–2366. Kuromori T, Yamamoto M (1994) Cloning of cDNAs from Arabidopsis thaliana that encode putative protein phosphatase 2C and a human DM-like protein by transformation of a fission yeast mutant. Nucleic Acids Res 22:5296–5301. Lammers T, Lavi S (2007) Role of type 2C protein phosphatises in growth regulation and in cellular stress signaling. Crit Rev Biochem Mol Biol 42:437–761. Lee JS, Ellis BE (2007) Arabidopsis MAPK phosphatase 2 (MKP2) positively regulates oxidative stress tolerance and inactivates the MPK3 and MPK6 MAPKs. J Biol Chem 282:25020–25029. Lee JS, Wang S, Sritubtim S, Chen JG, Ellis BE (2009) Arabidopsis mitogen-activated protein kinase MPK12 interacts with the MAPK phosphatase IBR5 and regulates auxin signaling. Plant J 57:975–985. Lee KH, Piao HL, Kim HY, Choi SM, Jiang F, Hartung W, et al. (2006) Activation of glucosidase via stress induced polymerization rapidly increases active pools of abscisic acid. Cell 126:1109–1120. Lee MO, Cho K, Kim SH, Jeong SH, Kim JA, Jung YH, et al. (2008) Novel rice OsSIPK is a multiple stress responsive MAPK family member showing rhythmic expression at mRNA level. Planta 227:981–990. Leung J, Bouvier-Durand M, Morris PC, Guerrier D, Chefdor F, Giradaut J (1994) Arabidopsis ABA response gene ABI1: features of a calcium-modulated protein phosphatise. Science 264:1448–1452. Leung J, Merlot S, Giradaut J (1997) The Arabidopsis ABSCISIC ACID INSENSITIVE2 (ABI2) and ABI1 genes encode homologous protein phosphatises 2C involved in abscisic acid signal transduction. Plant Cell 9:759–771. Li J, Wang XQ, Watson MB, Assmann SM (2000) Regulation of abscisic acid-induced stomatal closure and anion channels by guard cell AAPK kinase. Science 287:300–303. Link V, Sinha AK, Vashista P, Hofmann MG, Proels RK, Ehness R, Roitsch T (2002) A heat-activated MAP kinase in tomato: a possible regulator of the heat stress response. FEBS Lett 531:179–183. Liu X, Yue Y, Li B, Nie Y, Li W, Wu W-H, et al. (2007) A G protein-coupled receptor is a plasma membrane receptor for the plant hormone abscisic acid. Science 315:1712–1716.

k

233

k

k

234

k

Mechanism of Plant Hormone Signaling under Stress

Liu Y, Li X, Tan H, Liu M, Zhao X, Wang J (2010) Molecular characterization of RsMPK2, a C1 subgroup mitogen-activated protein kinase in the desert plant Reaumuria soongorica. Plant Physiol Biochem 48:836–844. Ludwig AA, Romeis T, Jones JDG (2003) CDPK-mediated signaling pathways: specificity and cross-talk. J Exp Bot 55:181–188. Luerssen H, Kirik V, Herrmann P, Misera S (1998) FUSCA3 encodes a protein with a conserved VP1/ABI3-like B3 domain which is of functional importance for the regulation of seed maturation in Arabidopsis thaliana. Plant J 15:755–764. Ma Y, Szostkiewicz I, Korte A, Moes D, Yang Y, Christman A, et al. (2009) Regulators of PP2C phosphatise activity function as abscisic acid sensors. Science 324:1064–1068. McCarty DR (1992) The role of VPI in regulation of seed maturation in maize. Biochem Soc Trans 20:89–92. Melcher K, Ng L, Zhou XE, Soon F, Xu Y, Suino-Powell KM, et al. (2009) A gate-latch–lock mechanism for hormone signalingg by abscisic acid receptors. Nature 462:602–608. Melcher K, Zhou XE, Xu HE (2010) Thirsty plants and beyond: structural mechanisms of abscisic acid perception and signaling. Curr Opin Struc Biol 20:722–729. Merlot S, Mustilli AC, Genty B, Northy H, Lefebvre V, Sotta B, et al. (2002) Use of infrared thermal imaging to isolate Arabidopsis mutants defective in stomatal regulation. Plant J 30:601–609. Mersmann S, Bourdais G, Rietz S, Robatzek S (2010) Ethylene signaling regulates accumulation of the FLS2 receptor and is required for the oxidative burst contributing to plant immunity. Plant Physiol 154:391–400. Meskiene I, Baudouin E, Schweighofer A, Liwosz A, Jonak C, Rodriguez PL, et al. (2003) Stress-induced protein phosphatase 2C is a negative regulator of a mitogen-activated protein kinase. J Biol Chem 278:18945–18952. Meskiene I, Bogre L, Glaser W, Balog J, Brandstotter M, Zwerger K, et al. (1998) MP2C, a plant protein phosphatase 2C, functions as a negative regulator of mitogen-activated protein kinase pathways in yeast and plants. Proc Natl Acad Sci USA 95:1938–1943. Meyer K, Leube MP, Grill E (1994) A protein phosphatase 2C involved in ABA signal transduction in Arabidopsis thaliana. Science 264:1452. Milborrow BV (2001) The pathway of biosynthesis of abscisic acid in vascular plants: a review of the present state of knowledge of ABA biosynthesis. J Exp Bot 52:1145–1164. Mishra NS, Tuteja R, Tuteja N (2006) Signaling through MAP kinase networks in plants. Arch Biochem Biophys 452:55–68. Miyazono K, Miyakawa T, Sawano Y, Kubota K, et al. (2009) Structural basis of abscisic acid signaling. Nature 462:609–614. Mizoguchi T, Irie K, Hirayama T, Hayashida N, Yamaguchi-Shinozaki K, Matsumoto K, et al. (1996) A gene encoding a mitogen-activated protein kinase kinase kinase is induced simultaneously with genes for a mitogen-activated protein kinase and an S6 ribosomal protein kinase by touch, cold, and water stress in Arabidopsis thaliana. Proc Natl Acad Sci USA 93:765–769. Mochizuki N, Brusslan JA, Larkin R, Nagatani A, Chory J (2001) Arabidopsis genomes uncoupled 5 (GUN5) mutant reveals the involvement of Mg-chelatase H subunit in plastid-to-nucleus signal transduction. Proc Natl Acad Sci USA 98:2053–2058. Montillet J-L, Hirt H (2013) New checkpoints in stomatal defense. Trends Plant Sci 6:295–297.

k

k

k

9 ABA, MAPK, and Calcium-Dependent Protein Kinases

k

Mori IC, Maruta Y, Yang Y, Munemasa S, Wang Y, Andreoli S, et al. (2006) CDPKs CPK6 and CPK3 function in ABA regulation of guard cell S-type anion- and Ca2+ - permeable channels and stomatal closure. PLoS Biol 4:e327. Munemasa S, Hossain MA, Nakamura Y, Mori IC, Murata Y (2011) The Arabidopsis calcium-dependent protein kinase, CPK6, functions as a positive regulator of methyl jasmonate signaling in guard cells. Plant Physiol 155:553–561 Mustilli AC, Merlot S, Vavasseur A, Fenzi F, Giradaut J (2002) Arabidopsis OST1 protein kinase mediates the regulation of stomatal aperture by abscisic acid and acts upstream of reactive oxygen species production. Plant Cell 14:3089–3099. Nakabayashi K, Okamoto M, Koshiba T, Kamiya Y, Nambara E (2005) Genome-wide profiling of stored mRNA in Arabidopsis thaliana seed germination: epigenetic and genetic regulation of transcription in seed. Plant J 41:697–709. Nakagami H, Kiegerl S, Hirt H (2004) OMTK1, a novel MAPKKK, channels oxidative stress signalingg through direct MAPK interaction. J Biol Chem 279:26959–26966. Nakagami H, Soukupova H, Schikora A, Zarsky V, Hirt H (2006) A mitogen-activated protein kinase kinase kinase mediates reactive oxygen species homeostasis in Arabidopsis. J Biol Chem 281:38697–38704. Nakashima K, Fujita Y, Kanomori N, Katagiri T, Umezawa T, et al. (2009) Three Arabidopsis SnRK2 protein kinases, SRK2D/SnRK2.2, SRK2E/SnRK2.6/OST1 and SRK2I/SnRK2.3, involved in ABA signaling are essential for the controlof seed development and dormancy. Plant Cell Physiol 50:1345–1363. Nambara E, Marion-Poll A (2005) Abscisic acid biosynthesis and catabolism. Annu Rev Plant Biol 56:165–185. Nambara E, Naito S, McCourt P (1992) A mutant of Arabidopsis which is defective in seed development and storage protein accumulation is a new abi3 allele. Plant J 2:435–441. Nguyen AN, Shiozaki K (1999) Heat-shock-induced activation of stress MAP kinase is regulated by threonine- and tyrosine-specific phosphatases. Genes Dev 13:1653–1663. Nicolas P, Lecourieux D, Kappel C, Cluzet S, Cramer G, et al. (2014) The basic leucine zipper transcription factor ABSCISIC ACID RESPONSE ELEMENT-BINDING FACTOR2 is an important transcriptional regulator of abscisic acid-dependent grape berry ripening processes. Plant Physiol 164:365–383. Ning J, Li X, Hicks LM, Xiong L (2010) A Raf-like MAPKKK gene DSM1 mediates drought resistance through reactive oxygen species scavenging in rice. Plant Physiol 152:876–890. Nishimura N, Hitomi K, Arvai AS, Rambo RP, Hitomi C, Cutler SR, et al. (2009) Structural mechanism of abscisic acid binding and signaling by dimeric PYR1. Science 326:1373–1379. Nishimura N, Sarkeshik A, Nito K, Park SY, Wang A, et al. (2010) PYR/PYL/RCAR family members are major in-vivo ABI1 protein phosphatise 2C-interacting proteins in Arabidopsis. Plant J 61:290–299. Nishimura N, Yoshida T, Kitahata N, Asami T, Shinozaki K, Hirayama T (2007) ABA-Hypersensitive Germination1 encodes a protein phosphatase 2C, an essential component of abscisic acid signaling in Arabidopsis seeds. Plant J 50:935–949. Pandey S, Nelson DC, Assmann SM (2009) Two novel GPCR-type G proteins are abscisic receptors in Arabidopsis. Cell 136:136–148. Park S-Y, Fung P, Nishimura N, Jensen D R, Fuji H, Zhao Y, et al. (2009) Abscisic acid inhibits Type 2C protein phosphatises via the PYR/PYL family of START proteins. Science 324:1068–1071.

k

235

k

k

236

k

Mechanism of Plant Hormone Signaling under Stress

Peng LX, Gu LK, Zheng CC, Li DQ, Shu HR (2006) Expression of MaMAPK gene in seedlings of Malus L. under water stress. Acta Biochim Biophys Sin (Shanghai) 38:281–286. Pitzschke A, Hirt H (2009) Disentangling the complexity of mitogen-activated protein kinases and reactive oxygen species signaling. Plant Physiol 149:606–615. Qin F, Sakuma Y, Li J, Liu Q, Li YQ, Shinozaki K, Yamaguchi-Shinozaki K (2004) Cloning and functional analysis of a novel DREB1/CBF transcription factor involved in cold responsive gene expression in Zea mays L. Plant Cell Physiol 45:1042–1052. Rea PA (2007) Plant ATP-binding cassette transporters. Annu Rev Plant Physiol Plant Mol Biol 58:347–375. Reyna NS (2004) Genome Analysis and Functional Characterization of Mitogen-activated Protein Kinase Genes in Rice. PhD dissertation, University of Arkansas, Fayetteville Reyna NS, Yang Y (2006) Molecular analysis of the rice MAP kinase gene family in relation to Magnaporthe grisea infection. Mol Plant Microbe Interact 19:530−540. Robert N, Merlot S, N’Guyen V, Boisson-Dernier A, Schroeder JI (2006) A hypermorphic mutation in the protein phosphatase 2C HAB1 strongly affects ABA signaling in Arabidopsis. FEBS Lett 580:4691–4696. Rodriguez MCS, Petersen M, Mundy J (2010) Mitogen-activated protein kinase signaling in plants. Annu Rev Plant Biol 61:621–649. Rodriguez PL, Benning G, Grill E (1998) ABI2, a second protein phosphatase 2C involved in abscisic acid signal transduction in Arabidopsis. FEBS Lett 421:185–190. Rohila JS, Yang Y (2007) Rice mitogen-activated protein kinase gene family and its role in biotic and abiotic stress response. J Int Plant Biol 49:751–759. Roychoudhury A, Basu S, Sengupta DN (2009) Effects of exogenous abscisic acid on some physiological rsponses in a popular aromatic indica rice compared with those from two traditional non-aromatic indica rice cultivars. Acta Physiol Plant 31:915–926. Roychoudhury A, Chakraborty M (2013) Biochemical and molecular basis of varietal difference in plant salt tolerance. Annu Rev Res Biol 3:422–454. Roychoudhury A, Paul A (2012) Abscisic acid-inducible genes during salinity and drought stress. In: Advances in Medicine and Biology, L.V. Berhardt (Ed.), vol. 51, pp. 1–78, Nova Science Publishers, New York, USA. Roychoudhury A, Paul S, Basu S (2013) Cross-talk between abscisic acid-dependent and abscisic acid-independent pathways during abiotic stress. Plant Cell Rep 32:985–1006. Roychoudhury A, Roy C, Sengupta DN (2007) Transgenic tobacco plants overexpressing the heterologous lea gene Rab16A from rice during high salt and water deficit display enhanced tolerance to salinity stress. Plant Cell Rep 26:1839–1859. Rubio S, Rodrigues A, Saez A, Dizon MB, Galle A, Kim T, et al. (2009) Triple loss of function of protein phosphatases type 2C leads to partial constitutive response to endogenous abscisic acid. Plant Physiol 150:1345–1355. Saavedra X, Modrego A, Rodriguez D, Gonzalez-Garcia MP, Sanz I, et al. (2010) The nuclear interactor PYL8/RCAR3 of Fagus sylvatica FsPP2C1 is a positive regulator of abscisic acid signaling in seeds and stress. Plant Physiol 152:133–150. Saez A, Apostolova N, Gonzalez-Guzman M, Gozalez-Garcia MP, Nicolas C, et al. (2004) Gain-of-function and loss-of-function phenotypes of the protein phosphatase 2C HAB1 reveal its role as a negative regulator of abscisic acid signaling. Plant J 37:354–369.

k

k

k

9 ABA, MAPK, and Calcium-Dependent Protein Kinases

k

Samuel MA, Ellis BE (2002) Double jeopardy: both overexpression and suppression of a redox-activated plant mitogen-activated protein kinase render tobacco plants ozone sensitive. Plant Cell 14:2059–2069. Sangwan V, Orvar BL, Beyerly J, Hirt H, Dhindsa RS (2002) Opposite changes in membrane fluidity mimic cold and heat stress activation of distinct plant MAP kinase pathways. Plant J 31:629–638. Santiago J, Dupeux F, Round A, Antoni R, Park SY, et al. (2009b) The abscisic acid receptor PYR1 in complex with abscisic acid. Nature 462:665–668. Santiago J, Rodrigues A, Saez A, Rubio S, Antoni R, Dupeux F, et al. (2009a) Modulation of drought resistance by the abscisic acid receptor PYL5 through inhibition of clade A PP2Cs. Plant J 60:575–588. Schachtman DP, Goodger JQ (2008) Chemical root to shoot signaling under drought. Trends Plant Sci 13:281–287. Schroeder JI, Allen GJ, Hugouvieux V, Kwak JM, Waner D (2001) Guard cell signal transduction. Annu Rev Plant Physiol Plant Mol Biol 52:627–658. Schultz J, Copley RR, Doerks T, Ponting CP, Bork P (2000) SMART: a Web-based tool for the study of genetically mobile domains. Nucleic Acids Res 28:231–234. Schulz P, Herde M, Romeis T (2013) Calcium-dependent protein kinases: hubs in plant stress signaling and development. Plant Physiol 163:523–530. Schweighofer A, Hirt H, Meskiene I (2004) Plant PP2C phosphatises: emerging functions in stress signaling. Trends Plant Sci 9:236–243. Schweighofer A, Kazanaviciute V, Scheikl E, Teige M, Doczi R, Hirt H, et al. (2007) The PP2C-type phosphatase AP2C1, which negatively regulates MPK4 and MPK6, modulates innate immunity, jasmonic acid, and ethylene levels in Arabidopsis. Plant Cell 19:2213–2224. Seki M, Ishida J, Narusaka M, Fujita M, Nanjo T, Umezawa T, et al. (2002) Monitoring the expression pattern of around 7000 Arabidopsis genes under ABA treatments using a full-length cDNA microarray. Funct Integr Genomics 2:281–91 Serrano R, Mulet JM, Rios G, Marquez JA, De Larrinoa IF, Leube MP, et al. (1999) A glimpse of the mechanisms of ion homeostasis during salt stress. J Exp Bot 50:1023–1036. Sheard LB, Zheng N (2009) Plant biology: signal advance for abscisic acid. Nature 462:575–576. Shen Y-Y, Wang X-F, Wu F-Q, Du S-Y, Cao Z, Shang Y, et al. (2006) The Mg-chelatase H subunit is an abscisic acid receptor. Nature 443:823–826. Shinozaki K, Yamaguchi-Shinozaki K (2000) Molecular responses to dehydration and low temperature: differences and cross talk between two stress signaling pathways. Curr Opin Plant Biol 3:217–233. Shinozaki K, Yamaguchi-Shinozaki K (2007) Gene networks involved in drought stress response and tolerance. J Exp Bot 58:221–227. Sinha AK, Jaggi M, Raghuram B, Tuteja N (2011) Mitogen-activated protein kinase signalingg in plants under abiotic stress. Plant Sig Behav 6:196–203. Smirnoff N (1998) Plant resistance to environmental stress. Curr Opin Biotechnol 9:214–219. Song CP, Agarwal M, Ohta M, Guo Y, Halfter U, Wang P, Zhu JK (2005) Role of an Arabidopsis AP2/EREBP-type transcriptional repressor in abscisic acid and drought stress responses. Plant Cell 17:2384–2396.

k

237

k

k

238

k

Mechanism of Plant Hormone Signaling under Stress

Song Y, Jing SJ, Yu DQ (2009) Overexpression of the stress induced OsWRKY08 improves the osmotic stress tolerance in Arabidopsis. Chin Sci Bull 54:4671–4678. Soon F-F, Ng L-M, Zhou XE, West GM, Kovach A, Tan MHE, et al. (2012) Molecular mimicry regulates ABA signaling by SnRK2 kinases and PP2C phosphatises. Science 335:85–88. Steinhorst L, Kudla J (2013) Calcium and reactive oxygen species rule the waves of signaling. Plant Physiol 163:471–485. Stone SL, Kwong LW, Yee KM, Pelletier J, Lepiniec L, Fischer RL, et al. (2001) LEAFY COTYLEDON2 encodes a B3 domain transcription factor that induces embryo development. Proc Natl Acad Sci USA 98:11806–18011. Su SH, Bush SM, Zaman N, Stecker K, Sussman MR, Krysan P (2013) Deletion of a tandem gene family in Arabidopsis: increased MEKK2 abundance triggers autoimmunity when the MEKK1-MKK1/2-MPK4 signaling cascade is disrupted. Plant Cell 25:1895–1910. Szostkiewicz I, Richter K, Kepka M, Demmel S, Ma Y, et al. (2010) Closely related receptor complexes differ in their ABA selectivity and sensitivity. Plant J 61:25–35. Taj G, Agarwal P, Grant M, Kumar A (2010) MAPK machinery in plants: Recognition and response to different stresses through multiple signal transduction pathways. Plant Signal Behav 5:1370–1378. Takahashi F, Yoshida R, Ichimura K, Mizoguchi T, Seo S, Yonezawa M, et al. (2007) The mitogen-activated protein kinase cascade MKK3-MPK6 is an important part of the jasmonate signal transduction pathway in Arabidopsis. Plant Cell 19:805–818. Takahashi F, Mizoguchi T, Yoshida R, Ichimura K, Shinozaki K (2011) Calmodulin-dependent activation of MAP kinase for ROS homeostasis in Arabidopsis. Mol Cell 41:649–660. Takahashi Y, Soyano T, Kosetsu K, Sasabe M, Machida Y (2010) HINKEL kinesin, ANP MAPKKKs andMKK6/ANQMAPKK, which phosphorylates and activates MPK4MAPK, constitute a pathway that is required for cytokinesis in Arabidopsis thaliana. Plant Cell Physiol 51:1766–1776. Teige M, Scheikl E, Eulgem T, Doczi R, Ichimura K, Shinozaki K, et al. (2004) The MKK2 pathway mediates cold and salt stress signaling in Arabidopsis. Mol Cell 15:141–152. Toorop PE, Bewley JD, Abrams SR, Hilhorst HWM (1999) Structure-activity studies with ABA analogs on germination and endo b-mannanase activity in tomato and lettuce seeds. J Plant Physiol 154:679–685. Tougane K, Komatsu K, Bhyan SB, Sakata Y, Ishizaki K, Yamato KT, et al. (2010) Evolutionarily conserved regulatory mechanisms of abscisic acid signaling in land plants: characterization of ABSCISIC ACID INSENSITIVE1-like type 2C protein phosphatase in the liverwort Marachantia polymorpha. Plant Physiol 152:1529–1543. Ulm R, Ichimura K, Mizoguchi T, Peck SC, Zhu T, Wang X, et al. (2002) Distinct regulation of salinity and genotoxic stress responses by Arabidopsis MAP kinase phosphatase1. EMBO J 21:6483–6493. Umezawa T, Nakashima K, Miyakawa T, Kuromori T, Tanokura M, Shinozaki K, Yamaguchi-Shinozaki K (2010) Molecular basis of the core regulatory network in ABA responses: sensing, signaling and transport. Plant Cell Physiol 51:1821–1839. Umezawa T, Sugiyama N, Mizoguchi M, Hayashi S, Myouga F, et al. (2009) Type 2C protein phosphatises directly regulate abscisic acid activated protein kinases in Arabidopsis. Proc Natl Acad Sci USA 106:17588–17593.

k

k

k

9 ABA, MAPK, and Calcium-Dependent Protein Kinases

k

Uno Y, Furihata T, Abe H, Yoshida R, Shinozaki K, Yamaguchi-Shinozaki K (2000) Arabidopsis basic leucine zipper transcription factors involved in an abscisic acid-dependent signal transduction pathway under drought and high-salinity conditions. Proc Natl Acad Sci USA 97:11632–11637. Urao T, Yamaguchi-Shinozaki K, Urao S, Shinozaki K (1993) An Arabidopsis myb homolog is induced by dehydration stress and its gene product binds to the conserved MYB recognition sequence. Plant Cell 5:1529–1539. Valmonte GR, Arthur K, Higgins CM, MacDiarmid RM (2014) Calcium dependent protein kinases in plants: evolution, expression and function. Plant Cell Physiol 55:551–569. Vaughan GT, Milborrow BV (1988) The stability of the 1’-4’-diols of abscisic acid. Phytochem 27:339–343. Vierling E (1991) The roles of heat shock proteins in plants. Annu Rev Plant Physiol Plant Mol Biol 42:579–620 Vierling E, Kimpel JA (1992) Plant responses to environmental stress. Curr Opin Biotechnol 3:164–70 Vlad F, Rubio S, Rodrigues A, Sirichandra C, Belin C, Robert N, et al. (2009) Protein phosphatases 2C regulate the activation of the Snf1-related kinase OST1 by abscisic acid in Arabidopsis. The Plant Cell 21:3170–3184. Wan B, Lin Y, Mou T (2007) Expression of rice Ca2+ -dependent protein kinases (CDPKs) genes under different environmental stresses. FEBS Lett 581:1179–1189. Wang H, Ngwenyama N, Liu Y, Walker JC, Zhang S (2007) Stomatal development and patterning are regulated by environmentally responsive mitogen-activated protein kinases in Arabidopsis. Plant Cell 19:63–73. Wang RS, Pandey S, Li S, Gookin TE, Zhao Z, Albert R, et al. (2011) Common and unique elements of the ABA-regulated transcriptome of Arabidopsis guard cells. BMC Genomics 12:216. Wang W, Vinocur B, Altman A (2003) Plant responses to drought, salinity and extreme temperatures: towards genetic engineering for stress tolerance. Planta 218:1–14. Wang WX, Vinocur B, Shoseyov O, Altman A (2001) Biotechnology of plant osmotic stress tolerance; physiological and molecular considerations. Acta Hortic 560:285–292. Wang XJ, Zhu SY, Lu YF, Zhao R, Xin Q, Wang XF, et al. (2010) Two coupled components of the mitogen-activated protein kinase cascade MdMPK1 and MdMKK1 from apple function in ABA signal transduction. Plant Cell Physiol 51:754–766. Wasilewska A, Vlad F, Sirichandra C, Redko Y, Jammes F, et al. (2008) An update on abscisic acid signaling in plants and more. Mol Plant 1:198–217. Wilkinson S, Davies WJ (2010) Drought, ozone, ABA and ethylene new insights from cell to plant to community. Plant Cell Environ 33:510–525. Xie X, Wang Y, Williamson L, Holroyd GH, Tagliavia C, et al. (2006) The identification of genes involved in the stomatal response to reduced atmospheric relative humidity. Curr Biol 16:882–887. Xing Y, Jia W, Zhang J (2007) AtMEK1 mediates stress induced gene expression of CAT1 catalase by triggering H2O2 production in Arabidopsis. J Exp Bot 58:2969–2981. Xing Y, Jia W, Zhang J (2008) AtMKK1 mediates ABA-induced CAT1 expression and H2O2 production via AtMPK6-coupled signaling in Arabidopsis. Plant J 54:440–451. Xiong L, Wang RG, Mao G, Koczan JM (2006) Identification of drought tolerance determinants by genetic analysis of root response to drought stress and abscisic acid. Plant Physiol 142:1065–1074.

k

239

k

k

240

k

Mechanism of Plant Hormone Signaling under Stress

Xiong L, Yang Y (2003) Disease resistance and abiotic stress tolerance in rice are inversely modulated by an abscisic acid-inducible mitogen-activated protein kinase. Plant Cell 15:745−759. Xu ZY, Lee KH, Dong T, Jeong JC, et al. (2012) A vacuolar beta glucosidase homolog that possesses glucose-conjugated abscisic acid hydrolysing activity plays an important role in osmotic stress responses in Arabidopsis. Plant Cell 24:2184–2199. Yamaguchi-Shinozaki K, Shinozaki K (2006) Transcriptional regulatory networks in cellular responses and tolerance to dehydration and cold stresses. Annu Rev Plant Biol 57:781–803. Yin H, Zhao X, Bai X, Du Y (2010) Molecular cloning and characterization of a Brassica napus L. MAP kinase involved in oligochitosan-induced defense signaling. Plant Mol Biol Report 28:292–301. Yin P, Fan H, Hao Q, Yuan X, Wu D, Pang Y, et al. (2009) Structural insights into the mechanism of abscisic acid signaling by PYL proteins. Nat Struct Mol Biol 16:1230–1236. Yoo SD, Cho YH, Tena G, Xiong Y, Sheen J (2008) Dual control of nuclear EIN3 by bifurcate MAPK cascades in C2H4 signaling. Nature 451:789–795. Yoshida R, Hobo T, Ichimura K, Mizoguchi T, Takahashi F, et al. (2002) ABA-activated SnRK2 protein kinase is required for dehydration stress signaling in Arabidopsis. Plant Cell Physiol 43:1473–1483. Yoshida R, Umezawa T, Mizoguchi T, Takahashi S, Takahashi F, Shinozaki K (2006a) The regulatory domain of SRK2E/OST1/SnRK2.6 interacts with ABI1 and integrates abscisic acid (ABA) and osmotic stress signals controlling stomatal closure in Arabidopsis. J Biol Chem 281:5310–5318. Yoshida T, Nishimura N, Kitahata N, Kuromori T, Asami T, et al. (2006b) ABA-Hypersensitive Germination3 encodes a protein phosphatase 2C (AtPP2CA) that strongly regulates abscisic acid signaling during germination among Arabidopsis protein phosphatase 2Cs. Plant Physiol 140:115–126. Yoshida T, Fujita Y, Sayama H, Kidokoro S, Maruyama K, et al. (2010) AREB1, AREB2 and ABF3 are master transcription factors that cooperatively regulate ABRE-dependent ABA signaling involved in drought stress tolerance and require ABA for full activation. Plant J 61:672–685. Yu XC, Li MJ, Gao GF, Feng HZ, Geng XQ, Peng CO, et al. (2006) Abscisic acid stimulates a calcium-dependent protein kinase in grape berry. Plant Physiol 140:558–579. Yu XC, Zhu SY, Gao GF, Wang XJ, Zhao R, Zou KQ, et al. (2007) Expression of a grape calcium-dependent protein kinase ACPK1 in Arabidopsis thaliana promotes plant growth and confers abscisic acid-hypersensitivity in germination, postgermination growth, and stomatal movement. Plant Mol Biol 64:531–538. Zhang D-P, Wu Z-Y, Li X-Y, Zhao Z-X (2002) Purification and identification of a 42-kilodalton abscisic acid-specific-binding protein from epidermis of broad bean leaves. Plant Physiol 128:714–725. Zhang H, Ni L, Liu Y, Wang Y, Zhang A, Tan M, Jiang M (2012) The C2H2-type zinc finger protein ZFP182 is involved in abscisic acid-induced antioxidant defense in rice. Journal of Integrative Plant Biol 54:500–510. Zhang T, Liu Y, Xue L, Xu S, Chen T, Yang T, et al. (2006) Molecular cloning and characterization of a novel MAP kinase gene in Chorispora bungeana. Plant Physiol Biochem 44:78–84.

k

k

k

9 ABA, MAPK, and Calcium-Dependent Protein Kinases

241

Zhang X, Dai Y, Xiong Y, DeFraia C, Li J, Dong X, et al. (2007) Overexpression of Arabidopsis MAP kinase kinase 7 leads to activation of plant basal and systemic acquired resistance. Plant J 52:1066–1079. Zhao R, Wang X-F, Zhang D-P (2011) CPK12: A Ca2+ -dependent protein kinase balancer in abscisic acid signaling. Plant Sig Behav 6:1687–1690. Zhu JK (2001) Cell signaling under salt, water and cold stresses. Curr Opin Plant Biol 4:401–406. Zhu JK (2002) Salt and drought stress signal transduction in plants. Annu Rev Plant Biol 53:247–273. Zhu JK, Hasegawa PM, Bressan RA (1997) Molecular aspects of osmotic stress in plants. Crit Rev Plant Sci 16:253–277. Zhu SY, Yu XC, Wang XJ, Zhao R, Li Y, Fan RC, Shang Y, et al. (2007) Two calcium-dependent protein kinases, CPK4 and CPK11 regulate abscisic acid signal transduction in Arabidopsis. Plant Cell 19:3019–3036.

k

k

k

k

243

10 Abscisic Acid Activates Pathogenesis-Related Defense Gene Signaling in Lentils Rebecca Ford 1 , David Tan 2 , Niloofar Vaghefi 3 , and Barkat Mustafa 4 1

School of Natural Sciences, Griffith University, Queensland, Australia

2 Faculty of Veterinary and Agricultural Sciences, The University of Melbourne, Victoria, Australia 3

Cornell University, Plant Pathology & Plant-Microbe Biology Section, Geneva, NY, USA Department of Environment and Primary Industries, Victorian AgriBiosciences Centre, La Trobe University, Victoria, Australia 4

10.1 Plant Host Defense Mechanisms

k

Plants exhibit complex defense responses against pathogens to either prevent them from entering the plant or obtaining nutrients for growth and reproduction. This first involves the interaction of pathogen elicitors with plant receptors, followed by the subsequent transduction of this interaction into defense response (Thatcher et al., 2005). The defense response may be divided into non-host resistance or host specific resistance. In either case, the defenses may be pre-formed and/or induced. The mechanisms that plants are able to rapidly activate to defend themselves include the production of reactive oxygen species (ROS), polymers to strengthen the cell wall, and the synthesis of anti-microbial compounds such as PR proteins. Defense responses are first triggered upon recognition of elicitors from invading pathogens. Downstream signaling cascades are then activated leading to production of signaling compounds that spread throughout the plant from the initial infection site. This may also increase resistance to secondary infections in tissues distal from the original site of infection, leading to systemic acquired resistance (SAR). The accumulation of PR proteins constitutes one of the critical components of plants inducible defense response to both biotic and abiotic stresses and can therefore serve as important gene markers to study the plant defense mechanism. 10.1.1 Host versus Non-Host Resistance

In a host specific resistance, the plant is resistant to some but not all pathotypes of a pathogen (Heath, 2000). There is specific recognition by a host plant R protein of a corresponding pathogen avirulence protein. This is also known as “gene-for-gene” resistance. Several Ascochyta species, including A. lentis, are host specific (Hernandez-Bello et al., 2006). In non-host specific resistance, a plant is resistant to all pathotypes/races of a

Mechanism of Plant Hormone Signaling under Stress, First Edition, Volume 1. Edited by Girdhar Pandey. © 2017 John Wiley & Sons, Inc. Published 2017 by John Wiley & Sons, Inc.

k

k

k

244

Mechanism of Plant Hormone Signaling under Stress

pathogen, either as the result of constitutive/induced defense responses (Lipka et al., 2008) or due to non-recognition of the pathogen by the plant. It is this phenomenon that is being investigated in depth for novel selective resistance breeding tool development in many crop species (Gill et al., 2015). 10.1.2 Preformed and Induced Defense Responses

k

Plants have developed a complex combination of both pre-formed (passive) and inducible (active) defense mechanisms involving a number of proteins and other organic molecules produced prior to infection or during pathogen attack (Dixon and Harrison, 1990). Pre-formed defense is the first obstacle a pathogen has to overcome when invading a plant and typically includes morphological, structural, and chemical barriers. An example of a morphological barrier is the height of lips of stomatal guard cells. Certain fungal rust pathogens are able to sense the height of stomatal guard cell lips on susceptible plants. When the hyphae locate a lip of the proper height, they will undergo a developmental process to form invasive structures that enter the stomata and colonize the leaf interior (Hoch et al., 1987). The plant cytoskeleton is also an important structural barrier against most invading plant pathogens. Examples of structural components include waxes, cutin, suberin, lignin, cellulose, callose, and cell wall proteins, which are rapidly synthesized during invasion (Ferreira et al., 2007). In addition, plants constitutively produce a broad array of secondary metabolites and antifungal compounds. These include various phenolics, saponins, terpenoids, and steroids. The pre-formed compounds may be directly toxic such as avenacin, a triterpene saponin glycoside produced by oat (Avena sativa) plants (Osbourn et al., 1994). Apart from passive pre-formed defenses, plants also possess inducible defense mechanisms, which are active, energy-consuming systems that typically require specific recognition of the pathogen that leads to the eventual production of proteins or metabolites that are toxic to the pathogen. Recognition of an avirulence (avr) gene product in the pathogen or pathogen associated molecular patterns (PAMP) occurs by a corresponding resistance (R) gene product in the host (Thatcher et al., 2005; Bent and Mackey, 2007). In addition to PAMPs, plant cell wall fragments broken down by fungi (danger-associated molecular patterns: DAMPs, or microbe-induced molecular patterns: MIMPs) may function as endogenous elicitors, resulting in pathogen recognition by the plant (Bent and Mackey 2007; Schwessinger and Zipfel, 2008). This interaction initiates a very rapid defense response in the plant and, in most situations, occurs under high specificity. A “compatible” reaction occurs when the host plant is susceptible to the virulent pathogen while an “incompatible” reaction occurs when the host is resistant to an avirulent pathogen (Agrios, 2004). Resistant (R) gene products are encoded by multigene families, comprising five main classes of proteins with the majority of proteins containing a nucleotide-binding site (NBS) followed by a series of leucine-rich repeats (LRR) at their C-terminus. The NBS-LRR proteins can be classified into those that have N-terminal homology with the Toll and Interleukin-1 receptor (TIR), a leucine-zipper (LZ), or a coiled-coil domain (CC) (Martin et al., 2003). The R proteins are either membrane-bound or cytoplasmic. Examples of R genes with NBS and LRR include RPS2, RPP5, and RPM1 from Arabidopsis; Mi from tomato; and Xa1 from rice (Pan et al., 2000). Resistance

k

k

k

10 ABA Activates Pathogenesis-Related Defense

245

gene analogues (RGAs), which are sequences coding for internal domains conserved in known R genes have been isolated from Lens species (Yaish et al., 2004). The lentil RGAs sequenced belong to the TIR subclass of NBS-LRR proteins. In addition, the predicted amino acid sequences indicated that the lentil RGAs contain all the conserved motifs (P-loop, kinase-2, kinase-3a, GLPL, and MHD) present in the majority of other known plant NBS–LRR resistance genes. Further to the recognition of a pathogen’s avr protein by a host R protein, several signal transduction cascades downstream of R genes are activated in the defense response. They differ in their requirement of downstream regulators, which include lipase-like proteins (EDS1, PAD4) (Feys et al., 2001), membrane-bound proteins (NDR1) of unknown function (Aartz et al., 1998), and regulators of protein-dependent protein degradation (RAR1 and SGT1) (Dodds and Schwechheimer, 2002). Other non-specific pathogen-derived elicitors such as complex carbohydrates from fungal cell walls, microbial enzymes, polypeptides, proteins, and lipids can also trigger plant defense response such as the mitogen activated protein kinase (MAPK) cascades that result in rapid and transient phosphorylation of specific nuclear, cytosolic, and membrane bound proteins (Jonak et al., 2002; Peck, 2003). 10.1.3 Reactive Oxygen Species (ROS) During an Oxidative Burst

k

The R-avr binding leads to alterations in cellular metabolism. The earlier plant defense events include fluxes of calcium and other ions, increase of reactive oxygen species (ROS) during oxidative burst (Lamb and Dixon, 1997), hypersensitive response (HR) (Greenberg, 1997; Garcia-Brugger et al., 2006), and activation of transcription factors and protein kinases (Grant and Mansfield, 1999). The oxidative burst occurs in a biphasic manner. A first oxidative burst occurs in both susceptible and resistant plants within minutes of a pathogen infection while a second sustained burst develops several hours later in resistant plants (Low and Merida, 1996). Being aerobic organisms, plants utilize oxygen (O2 ) as a terminal electron acceptor. ROS is produced as a result of oxygen reduction. ROS such as the superoxide anion and hydrogen peroxide (H2 O2 ) are normal products of metabolism and are produced in all cellular compartments within a variety of processes (Dat et al., 2000). In most biological systems, the superoxide anion is rapidly converted to H2 O2 by the enzyme superoxide dismutase (SOD). In general, ROS are maintained at constant basal levels in healthy cells, but their levels transiently or persistently increase under different stress conditions or in response to developmental signals. Studies using ascochyta-blight-elicited cell suspension cultures and plant tissue of chickpea and lentil reported several rapid defense responses following elicitation that are in line with the inducible defense mechanisms. These responses include an oxidative burst, extracellular alkalization followed by acidification, and a potassium (K+ ) efflux (Barz and Mackenbrock, 1994; Coram and Pang, 2006, 2007; Mustafa et al., 2009). 10.1.4 Hypersensitive Response (HR)

The increase in ROS is also a result of the hypersensitive response (HR), a pathogen-induced response that leads to rapid and localized death of host cells at the point of infection following an incompatible reaction. It is believed to confine biotrophic pathogens to necrotic lesions near the site of infection through the

k

k

k

246

Mechanism of Plant Hormone Signaling under Stress

production of antimicrobial compounds and by limiting nutrient uptake. During the HR, there is influx of Ca2+ and H+ ions and efflux of K+ and Cl- ions through controlled protein phosphorylation and dephosphorylation. These events are suggested to be signals for the generation of ROS and reactive nitrogen species such as nitric oxide (NO) (Low and Merida, 1996). ROS such as H2 O2 are produced by plant cells via the enhanced enzymatic activity of plasma-membrane bound NADPH-oxidases, cell wall–bound peroxidases and amine oxidases in the apoplast (Grant and Loake, 2000). The H2 O2 produced is thought to play multiple roles. Apart from its antimicrobial effect, it also acts as a signaling molecule (Scheler et al., 2013) and will diffuse into cells and activate many plant defenses (Figure 10.1/Plate 12). These include stimulating cell wall lignification and cross-linking to enhance the barrier against the invading pathogen. Lignin, together with callose, forms papillae underneath the site of pathogen infection (Yang et al., 1997). In addition, hydroxyproline-rich cell wall glycoproteins (HPRGs) and extensin levels increase and vascular occlusions such as gels, gums, or tyloses are produced. Programmed cell death may also take place. Together, they help to prevent pathogen spread. On the other hand, necrotrophic fungal pathogens have been shown to produce mycotoxins that cause ROS accumulation and lead to host cell death. They use such a strategy to kill the plant and feed on the dead tissue (Gechev et al., 2004). Likewise, some necrotrophic phytopathogens diffuse reactive nitrogen species such as NO into the plant tissue to induce localized plant cell death and promote pathogenicity (Turrion-Gomez and Benito, 2011). k

k

10.1.5 Systemic Acquired Resistance (SAR)

Diverse R-avr signaling pathways are known to converge and often lead to the expression of common sets of target genes. The pathways are regulated by several key signaling molecules including salicylic acid (SA), jasmonic acid (JA), and ethylene (ET), which activate both local defense responses and systemic responses in non-infected tissues leading to systemic acquired resistance (SAR). SAR results in a long-lasting,

Pathogen Attack O2– R

H2O2

Oxidase

ROS

Figure 10.1 (Plate 12) Roles of ROS under pathogen attack during HR. Plasma membrane or apoplast-localized oxidases are activated. They produce highly toxic superoxide radicals that will kill the invading pathogen. Superoxide radicals are also rapidly dismutated into H2 O2 , which, in contrast to superoxide, can readily cross the plasma membrane. ROS increase to critical levels and induce programmed cell death (PCD) (Apel and Hirt, 2004). (See insert for color representation of this figure.)

ROS scavengers PCD

k

k

10 ABA Activates Pathogenesis-Related Defense

247

non-specific, systemic resistance to subsequent infection by a broad range of pathogens. In contrast to HR, the development of SAR is slow and gradual. SAR is dependent on and is characterized by an increase in SA. This was demonstrated by studies in transgenic plants that were modified so that they were unable to accumulate SA and did not exhibit a SAR response (Delaney et al., 1994; Lawton et al., 1995).

10.2 Phytoalexins and Pathogenesis-Related (PR) Proteins

k

Phytoalexins are low molecular weight, non-protein secondary metabolites and are chemically diverse, possessing both antimicrobial and antifungal activities (Ferreira et al., 2007). They are induced by pathogen infection and elicitors and are synthesized through complex pathways such as the shikimic acid pathway. PR proteins were first described in tobacco infected with tobacco mosaic virus (TMV) (Datta et al., 1999). There are presently 17 classes numbered from PR1 to PR17 (Van Loon et al., 2006), the majority of whose functions are unknown (Ferreira et al., 2007). PR proteins whose functions have been demonstrated include PR1 and PR5 (thaumatin-like proteins and osmotins) that are reported to create transmembrane pores; PR2 (β-1,3-glucanases) and PR3, -4, -8, and -11 (chitinases) that hydrolyze β-1,3-glucans and chitin, respectively, components of the cell walls of higher fungi; and PR12 (defensins; Thomma et al., 2002) that induce K+ efflux, Ca2+ influx, alkalinization of the medium and membrane potential changes.

10.3 The Role of Plant Hormones in Pathogen Defense Transcriptional profiling of defense signal pathways has been achieved using microarrays constructed from unique cDNAs from Arabidopsis (Schenk et al., 2000), sorghum (Salzman et al., 2005), and chickpea (Coram and Pang, 2006, 2007). This has led to analyses of the responses of different genotypes (susceptible to resistance) to treatments with SA, methyl jasmonate (MeJA), and the immediate ethylene precursor aminocyclopropane carboxylic acid (ACC). These have provided valuable insights into pathways of defense-related gene regulation. In addition, abscisic acid (ABA) is also increasingly recognized as a signaling molecule in plant defense responses (Cao et al. 2011). 10.3.1 Salicylic Acid

SA regulates expression of genes involved in the oxidative burst, synthesis of phytoalexins, pathogenesis-related (PR) proteins including PR1, PR2, and PR5, and putative antimicrobial proteins (Schenk et al., 2000; Salzman et al., 2005). Mutants with altered levels of SA or defects in SA sensitivity have been used to understand the SA signaling pathway. SA is known to accumulate during both localized and systemic defense responses. The accumulation of SA appears to involve several upstream signal molecules, EDR1, SID1, and PAD4, which transmit the R-avr signal. edr1 (enhanced disease resistant 1 encodes a MAPK kinase kinase); sid1 (salicylic acid deficient 1 encodes a membrane-spanning transporter protein); pad4 (phytoalexin deficient 4

k

k

k

248

Mechanism of Plant Hormone Signaling under Stress

encodes a protein with predicted similarity to triacyl glycerol lipases similar to EDS1). edr1 mutants that are unable to express PR1, PR2, or PR5; sid1 mutants have reduced PR1 expression; pad4 mutants have defects in phytoalexin, SA accumulation and reduced PR expression (Cao et al., 1994; Glazebrook et al., 1996; Frye and Innes, 1998). Arabidopsis sid1 mutants, which have mutations in genes affecting the phenylalanine ammonia lyase (PAL) pathway or isochorismate synthase pathway, exhibited increased susceptibility to the pathogens Pseudomonas syringae and P. parasitica (Lee et al., 1995; Nawrath and Métraux, 1999; Wildermuth et al., 2001). Further transduction of the SA signal is reported to require npr1 (nonexpressor of PR genes1), which encodes an ankyrin-repeat containing protein, a domain often involved in protein-protein interactions. Npr mutants have reduced ability to express PR proteins (Cao et al., 1994). It is now known that SAR and SA dependent resistance in Arabidopsis is regulated by genes upstream and downstream of SA synthesis, which forms a feedback loop (Jirage et al., 1999; Shah et al., 1999; Feys and Parker, 2000). The level of SA production is in tandem with the damage caused by the pathogen and will eventually lead to induction of defense-related genes and SAR. SA-dependent defense responses are often associated with an HR-like suicide event of infected host cells. This in turn deprives the infecting pathogen of nutrients (Thomma et al., 2001). Arabidopsis mutants with defects in SA synthesis were shown to have enhanced disease susceptibility against biotrophic pathogens such as Erysiphe orontii, Peronospora parasitica, and Pseudomonas syringae, indicating SA’s role in defense responses against this type of pathogen (Thomma et al., 2001; Rojo et al., 2003). k

k 10.3.2 Jasmonic Acid

Jasmonates are produced from linoleic acid, which is a major plant plasma membrane lipid, via the octadecanoid biosynthetic pathway. Jasmonic acid and its methyl ester (MeJA) have been reported to regulate important developmental processes such as embryogenesis, pollen and seed development, and root growth (Creelman and Mullet, 1997). MeJA also caused the expression of defense-related genes such as PR3, PR4, and defensin PDF1.2 (PR12) and Thi2.1 (PR13) in Arabidopsis thaliana and induced expression of dad1, lox2, aos, opr3, and jmt genes, which regulate JA synthesis in A. thaliana (Devoto and Turner, 2003). Jasmonic acid is also involved in responses to wounding and defense against necrotrophic pathogens (Reymond et al., 2000). This was demonstrated with Arabidopsis mutants (coi1) with a defect in JA signaling that had increased susceptibility to the soft rot fungus Botrytis cinerea (Thomma et al., 1999). Mutants have also been used to analyze the jasmonic acid (JA) signaling pathway. Fad, dad1, dde1, and opr3 mutants are unable to produce JA (McConn and Browse, 1996; Sanders et al., 2000). Fad mutants have ineffective fatty acid desaturase enzymes; dad1 (defective anther dehiscence1) encodes a phospholipase that hydrolyses phospholipids; dde1 (delayed dehiscence1) and opr3 (12-oxophytodienoic acid reductase3) have ineffective OPDA (12-oxophytodienoic acid) reductase enzymes. Other mutants such as jar1 have reduced JA-dependent gene expression. Jar1 encodes a protein with similarity to adenylate-forming enzymes, which can metabolize JA (Staswick et al., 2002). Other mutants such as cet (constituitive expressor of thionin) mutants exhibit constitutive JA-dependent gene expression, and elevated levels of JA (Hilpert et al., 2001).

k

k

10 ABA Activates Pathogenesis-Related Defense

249

10.3.3 Ethylene

k

Ethylene (ET) plays a role in the regulation of different plant physiological and metabolic processes including germination, senescence and fruit ripening (Johnsson and Ecker, 1998; Bleecker and Kende, 2000; Wang et al., 2002). In order to biosynthesize ethylene, methionine is enzymatically converted to S-adenosyl-L-methionine, which is then converted by ACC synthase to aminocyclopropane carboxylic acid (ACC). Ethylene is then produced by ACC oxidase (Yang and Hoffman, 1984). The components of the ET signaling pathway include the nuclear-localized transcription factor EIN3, which activates ERF1 (ethylene response factor1). ERF1 is a member of the plant specific ethylene-responsive element binding protein (EREBP) family, which binds to GCC box promoter elements to activate defense genes such as pdf1.2 and chi-b (Solano et al., 1998). The GCC box motif is found in the promoters of many pathogen-responsive genes. As ERF1 was found to regulate the expression of both ET and JA dependent genes, its function is postulated to be at the downstream intersection between the ET and JA signaling pathways (Lorenzo et al., 2003). Similar to JA, ET is also involved in defense response to necrotrophic pathogens such as B. cinerea and Erwinia carotovora (Glazebrook, 2005). ACC induces a wide range of defense-related transcripts in Arabidopsis and chickpea including phytoalexins, PR genes including vacuolar β-1,3-glucanases (PR2), vacuolar basic-chitinases (PR3), acidic hevein-like proteins (PR4) plant defensins (PR12), and ethylene-responsive element binding protein (EREBP) transcription factors (Eyal et al., 1993; Xu et al., 1994; Penninckx et al., 1996; Thomma et al., 1999; Schenk et al., 2000; Chakravarthy et al., 2003; Lorenzo et al., 2003; Van Zhong and Burns, 2003; Salzman et al., 2005). 10.3.4 Abscisic Acid

Abscisic acid (ABA) plays a role in plant development such as stomata closure and it is also well known for its function in abiotic stress responses (Leung and Giraudat, 1998). Over the past decade, much evidence has arisen to indicate that ABA also plays a significant regulatory role in the response to plant pathogens. Interestingly, this is not necessarily towards increased resistance or activation of defense responses. For example, exogenous treatment with ABA has led to increased susceptibility in barley to Erysiphe graminis (Edwards, 1983), in soybean to Phytophthora megasperma (Ward et al., 1989), in Arabidopsis to Fusarium oxysporum (Anderson et al., 2004), in tomato to Botrytis cinerea (Audenaert et al., 2002), and in Arabidopsis to an avirulent isolate of Pseudomonas syringae pv. tomato (Mohr and Cahill, 2003). Likewise, reduction in endogenous concentration of ABA has been associated with higher resistance levels as ABA-deficient Arabidopsis mutant, aba1-1, showed enhanced resistance to virulent isolates of Hyaloperonospora parasitica (Mohr and Cahill, 2003). Conversely, ABA levels were increased upon infection of Arabidopsis with Pseudomonas irregulare and Alternaria brassicicola, and mutants that were ABA-deficient or insensitive were more susceptible to both of these pathogens when compared to the wild type (Adie et al., 2007). Arabidopsis mutants were also shown to require ABA for JA synthesis as well as for induction of a JA-dependent defense pathway after infection with P. irregulare (Leon et al., 2001; Adie et al., 2007). Therefore, ABA seems to be involved in the activation of defense responses against particular pathogens and is perhaps related to the method of infection. This is thought to occur partially through priming

k

k

k

250

Mechanism of Plant Hormone Signaling under Stress

of callose production and deposition (Ton and Mauch-Mani, 2004), reactive oxygen species production, and activation of defense gene expression cascades (Adie et al., 2007). 10.3.5 Conservation and Crosstalk Within Signaling Pathways

k

There is emerging evidence that there is a considerable level of conservation within the basic signaling pathways (SA, JA, and ET) in hormone-induced responses in plants (Santner and Estelle, 2009). The extent of conservation and crosstalk among individual components or sub-pathways involved in pathogen defense, including SAR, is being unraveled (Martínez-Medina et al., 2013). Anderson et al. (2005) summarized the pathogen defense signaling in plants with two general signaling pathways that are believed to be activated depending on the type of pathogen. If the host recognizes the pathogen as biotrophic, an enhanced disease susceptibility protein (EDS1) will be induced, which then results in the upregulation of SA. SA is then involved in the signal transduction to activate protein kinases, such as MAP kinases, which in turn leads to the activation of appropriate transcription factors such as WRKYs, which leads to the upregulation of relevant PR proteins such as PR1 and PR2. This leads to induction of mechanisms such as the breaking down of pathogen cell walls by glucanases. Another pathway is thought to be activated if the invading pathogen is necrotrophic. This involves the up regulation of the global signaling molecules ET and JA, which in turn activate other transcription factors such as EINs and ERFs. This leads to the upregulation of PR proteins such as PR12 and PR13 encoding defense proteins known as defensins (Figure 10.2). Complex interactions exist between the SA-dependent, JA-dependent, and ET-dependent pathways, which are both synergistic and antagonistic. Such crosstalk can be mediated through a number of means including sharing components between pathways such as NPR1, or enhancement of one pathway when the other is not inducible. SA and JA may act antagonistically when SA has an inhibitory effect on JA biosynthesis and JA-responsive gene expression (Gupta et al., 2000; Devoto and Turner, 2003). Conversely, SA and JA may act synergistically as demonstrated by the constitutive expression of PDF1.2 that requires SA as well as JA and ET signaling pathways (Schenk et al., 2000). Both ET and JA pathways are often synergistic. This is evident in a microarray study where most genes induced by ET were also induced by MeJA (Schenk et al., 2000). ABA has been reported to downregulate SA, JA, and ET. This was demonstrated through studies on mutation of Atmyc2/jin, which regulates the ABA signaling pathway and also through exogenous applications of ABA, which suppressed JA/ET induction of defense genes (Anderson et al., 2004). The type of pathogen will also affect the induction of specific pathways where the SA pathway has been observed to be induced in response to biotrophic pathogens while the JA/ET pathway is induced in response to necrotrophic pathogens (Thaler and Bostock, 2004). Meanwhile, the defense-related transcripts in chickpea to Ascochyta rabiei were proposed to be regulated by all three signaling molecules (Coram and Pang, 2007). Therefore, it is oversimplified to classify plants responses based on two independent and antagonistic defense pathways. It is more likely that complex signaling pathways involving SA, JA, ET, and ABA will interact to mount an appropriate defense response against different pathogens and suppress other less effective signaling pathways to conserve physiological resources.

k

k

k

10 ABA Activates Pathogenesis-Related Defense

251

Pathogen CW/PM

Receptors/ R protein(s)

ET Dad1/BrDad1

EDS1 RAR1

ETR1/ERS1

JA

SA

CTR1 MAP kinases (e.g. SIPK, AtMPK3)

Ein2

COI1, JAR1

Ankyrin NPR1 repeat proteins (e.g. AKR2, ANK1)

EIN3

ERFs

TGAs, WRKYs

PR proteins (e.g. PR12, PR13), Resistance

PR proteins (e.g. PR1, PR2), Resistance

k

Figure 10.2 A simplified schematic of pathogen defense signaling in plants. Components in bold text represent those that are found in both monocotyledonous and dicotyledonous plants while those in normal text are found in at least two dicotyledonous species. CTR1, constitutive triple response encoding a protein kinase is involved in ET signaling; CW/PM, the cell wall and plasma membrane; Dad1/BrDad1, defective anther dehiscence1, encodes a phospholipase that is required for JA biosynthesis; EDS1, enhanced disease susceptibility protein, which mediates R protein dependent signaling; EIN2, ET insensitive encodes a membrane protein; EIN3, ET insensitive encodes a transcription factor; ERFs, ethylene response factors such as ERF1, which is a is a member of the plant specific ethylene-responsive element binding protein (EREBP) family; ET, ethylene; ETR1/ERS1, ET receptors; JA, jasmonic acid; JAR1; jasmonate resistant, encodes an adenylate-forming enzyme that is involved in JA metabolism and signaling; NPR1, nonexpressor of PR1 that encodes ankyrin repeat protein involved in SA signaling; RAR1, zinc-binding protein involved in R protein dependent signaling; SA, salicylic acid TGAs, belong to a subclass of basic region/leucine zipper (bZIP) transcription factors that specifically interact with NPR1; WRKYs, a family of transcription factors of 60 amino acids containing conserved sequence WRKYGQK and zinc finger motif, which are produced in response to pathogen infections as well as to signaling molecules including SA and JA (from Anderson et al., 2005).

10.4 The Lentil Ascochyta lentis Pathosystem The Leguminosae family comprises many economically and nutritiously valued food sources including lentil (L. culinaris ssp. culinaris Medikus), one of the earliest domesticated crop species. Lentil is a short semi-erect annual legume with seed-containing pods. It is diploid (2n = 2× = 14 chromosomes) and self-pollinating, with a haploid genome size of 4063 Mbp (Arumuganathan and Earle, 1991) and is cultivated throughout the Indian subcontinent, western Asia, northern Africa, southern Europe, North and South America, and Australia (Erskine, 1996). Total global production in 2013 was near 5.0 million metric tons (FAOSTAT, 2007). High in protein, carbohydrate, and B

k

k

k

252

k

Mechanism of Plant Hormone Signaling under Stress

vitamins and low in sodium, fat, and toxic materials (Savage, 1988), the seed are used for both human food and animal feed. Similar to other grain legumes, lentil fixes atmospheric nitrogen through symbiotic Rhizobia associated with root nodules and is used in crop rotations to maintain soil fertility (Vellasamy et al., 1998). A major biotic constraint to lentil production worldwide is the Ascochyta blight disease caused by the heterothallic and necrotrophic fungal pathogen Ascochyta lentis. Cool, moist growth conditions favor the disease development, and pathogen infection and spread, which can occur through splash and airborne conidia and/or ascospores as well as commercial distribution of plant materials or seeds (Nene et al. 1988). All major photosynthetic parts of lentil including leaves, shoots, stem, and pods can be affected, causing defoliation, leaf blight, stem girdling and pod abortion; and shriveled and discolored seed may be unmarketable (Morrall and Sheppard, 1981; Gossen and Morrall, 1983). Although the disease incidence can be reduced through the use of foliar fungicides, fungal treatment of seeds, disease-free seeds, desiccating crops prior to harvest, crop rotation, and deep ploughing, the most effective, environmentally friendly, and sustainable method of disease control is through the use of resistant cultivars (Erskine et al., 1994; Tivoli et al., 2006). Resistance to A. lentis is available in both wild and cultivated Lens species (Tivoli et al., 2006). In lines exhibiting complete resistance, the disease cycle is disrupted as symptoms and spore production is totally prevented, and pathogen multiplication is halted. Partial resistance detected in many commonly grown cultivars disrupts one or more steps of the disease cycle, causing a reduction in the disease rate and reduced pathogen multiplication. Although genes that confer resistance have been identified (Nguyen et al., 2001), an understanding of gene functions and the pathways of gene induction that elicit defense responses leading to resistance against A. lentis are lacking.

10.5 Key Defense-Related Genes Involved in Ascochyta lentis Defense Although a limited study, several transcripts with potential roles in defense were discovered when the response of ascochyta blight (A. lentis) was studied in two lentil genotypes, ILL7537 (resistant) and ILL6002 (susceptible) (Mustafa, 2008). The study involved assessing differential expression of genes using a cDNA microarray and these were validated by quantitative reverse-transcription polymerase chain reaction (qRT-PCR). The differentially transcribed genes included a pathogenesis-related protein Bet v I family, a pea (pi230) disease resistance response protein 230, a gamma-thionen type defensin/protease inhibitor, superoxide dismutase, and a carbonic anhydrase. The host defense response based on the transcriptional changes can be classified into early response (6–12 hours after inoculation; hai) following recognition of pathogen contact and mid-late response (24–48 hours after inoculation) when the pathogen has penetrated and signaling cascades trigger an oxidative burst, induction of HR and/or synthesis of antifungal proteins (Coram and Pang, 2006). In the differential expression study involving the two lentil genotypes, the expression of superoxide dismutase in the resistant genotype (ILL7537) was found to be an early host response (6 hai) and indicated evidence of an oxidative burst mechanism. An early-mid response (24 hai) was represented by the upregulation of carbonic anhydrase that binds to salicylic acid

k

k

k

10 ABA Activates Pathogenesis-Related Defense

k

for antioxidant activity in ILL7537 and was downregulated in ILL6002. A mid-late response was represented by the upregulation of snakin-2 antimicrobial peptide in ILL7537, which was downregulated in ILL6002 (Mustafa, 2008). These observations are in line with previous studies that the speed at which the host mounts defense response and the efficacy of the response to a particular pathogen is critical in determining whether the host is resistant or susceptible. By following the classical mechanisms of an oxidative burst, HR, PR proteins and the phenylpropanoid pathway, it was proposed that induced expression in the resistant genotype ILL7537 of a serine/threonine protein kinase may have acted as a signal for increased downstream expression of PR proteins and other antimicrobial proteins. The induced PR proteins were a β-1,3-glucasnase (CV793598), a pathogenesis-related protein 4 (DY396388), and three class 10 PR proteins (EB085032, CV793610, DY396377). PR4 proteins have been reported to possess anti-fungal activity by binding to chitin at the fungal hyphal tip and disrupting cell polarity, leading to inhibition of fungal growth by as yet unknown mechanisms (Bormann et al., 1999). Some PR4 proteins have been reported to have RNase and DNase activity (Bertini et al., 2009; Guevara-Morato et al., 2010; Lu et al., 2012). A PR4 gene was previously differentially expressed in chickpea in response to Ascochyta rabiei infection (Coram and Pang, 2006). In addition, hevein-like peptides (PR4 clan) have been reported to interfere with the growth of Alternaria brassiciocola, Ascochyta pisi and Fusarium culmorum (Van et al., 1991). The expression of the lentil gene has been substantially characterised in the response to A. lentis infection (Vaghefi et al., 2013). PR10 proteins play a role in plant defense response against pathogens. Many PR10 proteins have been reported to demonstrate antimicrobial capability through ribonuclease activity such as a birch pollen allergen, Betv1 (Bufe et al., 1996), a white lupin root PR10-like protein, LaPR10 (Bantignies et al., 2000), a Capsicum annuum PR10 protein (CaPR10) against the oomycete pathogen P. capsici (Park et al., 2004), and SsPR10 from Solanum surattense against Pyricularia oryzae (Liu et al., 2006). Although a definitive biological function of PR10 proteins remains unclear, it is believed that the ribonuclease activity of these proteins confer protection to the plants during programmed cell death as a result of pathogen attack or by acting directly on the pathogen (Liu and Ekramoddoullah, 2003). The study of differential expression of candidate defense genes involved in the resistance of lentil to A. lentis, and determining the associated hormone signals, is an essential step towards elucidating the resistance mechanisms. This may be partially achieved via qRT-PCR to analyze differential expression of already identified candidate resistance genes in a resistant lentil genotype using various signaling molecules as potential elicitors.

10.6 The Effect of Exogenous Hormone Treatment on PR4 and PR10 Transcription in Lentils The PR4 gene type member is tobacco R (Van Loon, 1999). Chitin-binding proteins possessing antifungal activity by binding to fungal cell wall chitin, they are typically 13–14.5 kDa and divided into two classes: Class I belong to the superfamily of chitin-binding lectins or agglutinin and contain a chitin-binding N-terminal domain

k

253

k

k

254

k

Mechanism of Plant Hormone Signaling under Stress

while Class II do not have this domain (Selitrennikoff, 2001; Theis and Stahl, 2004). This domain is cysteine rich and hevein-like, corresponding to mature hevein, which is a small antifungal protein isolated from rubber tree (Hevea brasiliensis) latex (Broekaert et al., 1990). Genes encoding PR4 proteins have been studied in rubber plants, potato, tobacco, tomato, Arabidopsis, barley, maize, wheat, Capsicum, and fig (Stanford et al., 1989; Broekaert et al., 1990; Linhorst et al., 1991; Svensson et al., 1992; Potter et al., 1993; Ponstein et al., 1994; Bertini et al., 2009; Guevara-Morato et al., 2010; Lu et al., 2012). It has been reported that a PR4 gene was differentially expressed in chickpea in response to Ascochyta rabiei infection (Coram and Pang, 2006). In addition, hevein-like peptides have been reported to interfere with the growth of Alternaria brassiciocola, Ascochyta pisi, and Fusarium culmorum (Van et al., 1991). In Arabidopsis, PR4 gene induction is dependent on the JA signaling pathway and independent of the SA signaling pathway (Thomma et al., 1998). The full-length cDNA of lentil PR4 from resistant lentil genotype ILL7537 is 636 bp and encodes a 146 amino acid long protein of 15.8 kDa (Vaghefi et al., 2013). Predicted to possess two serine phosphorylation sites and three threonine phosphorylation sites, it encodes a conserved Barwin domain, which is closely related to hevein. In addition, it encodes a signal peptide, indicating that it may be produced as a pre-protein, which has to be cleaved to produce a mature protein. PR10 proteins are believed to be involved in plant defense as well as growth and development. They are generally intracellular, cytoplasmic, acidic, and possess a molecular mass of 16–19 kDa. They do not have signal peptides and are resistant to proteases. Multiple members have been identified in the Leguminosae including pea (Pisum sativum) (Fristensky et al., 1988), bean (Phaseolus vulgaris) (Walter et al., 1990), soybean (Glycine max) (Crowell et al., 1992), peanut (Arachis hypogaea) (Chadha and Das, 2006), and lupin (Lupinus albus) (Bantignies et al., 2000). PR10 protein expression is reported to be triggered by viruses (Xu et al., 2003; Park et al., 2004), bacteria (Breda et al., 1996; Robert et al., 2001), and fungi (Walter et al., 1990; Pinto and Ricardo, 1995; Ekramoddoullah et al., 1998; Jwa et al., 2001; McGee et al., 2001; Liu et al., 2003) as well as wound treatment (Warner et al., 1992, 1993). Expression of PR10 genes due to fungal infection has been reported in bean (Walter et al., 1990), peanut (Chadha and Das, 2006), pea (Tewari et al., 2003), chickpea (Cicer arietinum) (Coram and Pang, 2006), and soybean (Glycine max) (Xu et al., 2014). AhPR10 from peanut has antifungal activity (Chadha and Das, 2006); leaf extracts from transgenic tobacco (Nicotiana tabacum) expressing the maize ZmPR10 contained RNAse as well as anti-fungal activity (Chen et al., 2006). The RNase activity has been proposed to protect plants during programmed cell death around the infection sites or to act directly against the pathogens (Liu and Ekramoddoullah, 2003). Studies using global signaling molecules and plant hormones have found that PR10 gene expression is regulated by JA, ABA, and SA (Wang et al., 1999; McGee et al., 2001; Liu and Ekramoddoullah, 2003). Recently, significant upregulated expression of a Betv-I type class PR10 family member to A. lentis was identified in the lentil genotype ILL7537 at 24 h after inoculation with A. lentis (Mustafa, 2008). The sequence comprises an ORF of 471bp encoding 156 amino acids including a Betv-I domain homologous with that in bean (Walter et al., 1990, 1996) and in abscisic acid-responsive proteins ABR17 and ABR18 of pea (Fristensky et al., 1988; Iturriaga et al., 1994).

k

k

k

10 ABA Activates Pathogenesis-Related Defense

255

10.6.1 Bioassays and cDNA Production

The characterization of expression patterns of the PR4 and PR10 genes upon A. lentis infection or exogenous treatment with hormone compounds provided insight into the signaling of defense responses within the resistance mechanism. For this, seedlings of ILL7537, which is highly resistant to Ascochyta lentis (Nasir and Bretag, 1997a, 1997b), were cultivated in the growth cabinet under controlled environmental conditions of 12/12 h light/dark at 25∘ C. Eight seedlings were grown per pot (15 cm). Two biological replicates consisting of a total of 60 seedlings (12 pots of 5 plants) per replicate were performed. 14-day-old seedlings were sprayed with 100 μM of ABA, ACC, MeJA, or SA until run-off and control plants were sprayed with sterile water only. Plants were then covered and left in the dark for 24 hours, after which cups were removed and pots returned to the growth chamber. Total seedling foliage (leaf and shoot) from five plants was harvested at 0, 6, 24, 48, 72, and 96 hours post treatment (hpt). Tissue samples were snap frozen in liquid nitrogen and stored at −80∘ C until total RNA was extracted using an RNeasy Plant Mini Kit with On-Column DNase digestion (Qiagen, USA). cDNA synthesis was carried out by reverse-transcribing 1.5 μg of each RNA sample using an oligo dT18 primer (Roche, Germany) and the Omniscript RT kit (Qiagen, USA) and diluted with sterile water. 10.6.2 PR Gene Amplification and Expression Profiling

k

PCR amplification of the lentil sequences from genomic DNA with gene-specific primers yielded an expected single 101bp product with PR4Forward (5′ -TACCTGGG ATGCTAACCAGCCTTT-3′ ) and PR4reverse (5′ - ATTTGCCGCAAGAATCTCTGC CTG-3′ ). The PR4 gene may be constitutively expressed in ILL7537 as a product was observed in the cDNA from 0 hpt. Similarly, an expected single 83 bp product was amplified with the PR10Forward (5′ -TGGCACTTCTGCTGTTAGATGGAC-3′ ) and PR10reverse (5′ -GGTAATCCATCCAGCCATTTGGAG-3′ ) and this gene may also be constitutively expressed. The lentil actin gene was also amplified using the PsActinForward (5′ - GTTCCACAA TGTTCCCTGGT-3′ ) and PsActinReverse (5′ -ATTCTGCCTTTGCAATCCAC-3′ ) primers designed from pea actin (Genebank ID: U76190). The dissociation (melt) curve showed single peaks for the genes tested. The optimum primer concentration for both the PR4 and PR10 primers was 0.2 μM and the optimum annealing temperature was 57∘ C. Under these reaction conditions, the housekeeping gene, actin, was also confirmed to show a single peak and a clear exponential amplification curve. Quantitation of the target sequences within the total RNA (cDNA) was calculated using the comparative Ct method (ΔΔCt ) (Livak and Schmittgen, 2001). A prerequisite being that the efficiency of the target amplification and the efficiency of reference amplification (actin) be approximately equal. This was performed by validation of the primer pair by; (i) selecting one random cDNA sample and creating a dilution series five orders of magnitude, (ii) performing separate real-time qPCR on the dilution series with the normalization primer pair (actin) and the target primer pair, and (iii) calculating amplification efficiency across the dilution series. A standard curve (as a semi-log regression line plot of Ct value vs log input of nucleic acid) was generated from the dilution series for each primer pair; the equation y = m× + b was used to determine the slope for the trend line of standard curve for each primer pair where y

k

k

k

256

Mechanism of Plant Hormone Signaling under Stress

is the fold dilution of the sample, m is the slope or gradient of the line, × is Ct value at the corresponding fold dilution, and b is a constant represents the y-intercept of the line. The amplification efficiency of the primer pair was then calculated from the slope of the standard curve using the “QPCR Standard Curve Slope to Efficiency Calculator” (www.stratagene.com/techtoolbox/calc/qpcr_slope_eff.aspx). Each primer pair must show 90–110% amplification efficiency to pass validation. The amplification efficiency of the PR4 primers was 104%, and for the PR10 primers was 92%. Subsequently, triplicate qPCR was performed for cDNA samples derived from two sets of independently grown plants samples at 6, 24, 48, and 96 hpt. All PCR products were subjected to melting curve analysis from 50 to 95∘ C and the ΔΔCt was used to calculate the relative fold changes using (i) the average Ct-value for each sample; (ii) Ct differences between the gene of interest and the normalizer/reference/housekeeping gene (actin) [ΔCt = Ct (target) – Ct (normalizer)]; and (iii) the differences between the control ΔCt-values and the treatment ΔCt-values [ΔΔCt-value]. The ΔΔCt-values were then converted to absolute values using the formula for comparative expression level [2-ΔΔCt ]. 10.6.3 Effects of ABA, ACC, MeJA, and SA on Lentil PR4 Gene Expression

k

At 6 hpt, the relative expression of PR4 to the housekeeping gene, actin, was observed to be the highest in ABA treated plants (2.9-fold) but suppressed (7.0-fold) in MeJA treated plants (Figure 10.3). At 24 hpt, the relative expression of PR4 was observed to increase further in ABA treated plants to 7.5-fold that of actin and decreased in ACC and SA treated plants. At 48 hpt, the relative PR4 expression in ABA treated plants remained high (7.5 fold that of actin) and remained low in ACC, MeJA and SA treated plants. This pattern persisted at 96 hpt, indicating that of the hormones assessed, only ABA consistently induced PR4 expression over the time course of the study in ILL7537 (Figure 10.3). Normalization of PR4 transcription data from hormone treated plants against that from untreated control plants showed that exogenous ABA elicited a strong induction over time, from two-fold at 6 hpt to 16.6-fold at 96 hpt. In contrast, the other three hormones assessed either had no effect or reduced the expression of PR4 (Figure 10.4). ACC suppressed expression two-fold at 6 hpt and at nine-fold by 48 hpt. Similarly, MeJA and SA treatments resulted in general suppression of PR4 expression throughout the times assessed suggest that ACC, MeJA, and SA do not have a substantial direct role in lentil PR4 regulation. 10.6.4 Effects of ABA,ACC,MeJA, and SA on Lentil PR10 Gene Expression

At 6 hpt, the relative expression of PR10 to actin was similar to PR4 expression. ABA-treated plants displayed the most upregulation where the relative expression was 1.3-fold that of actin. At 24 hpt, PR10 expression was induced in untreated controls and all treatments except ACC. The greatest PR10 induction was observed in ABA-treated plants at 4.3-fold, followed by untreated, MeJA and SA-treated plants. At 48 hpt, there was further increase in relative PR10 expression to 5.5-fold while the relative expression of PR10 in untreated plants and plants treated with the other hormones remained

k

k

k

10 ABA Activates Pathogenesis-Related Defense

257

static. At 96 hpt, only the relative expression of PR10 remained high in ABA-treated plants. Similar to PR4, the lentil PR10 gene expression in ILL7537 was stimulated by ABA only of the hormones assessed (Figure 10.5). Relative to control plants, expression of PR10 in ABA-treated plants was induced at 6 hpt and continuously increased with time, reaching a 3.2-fold relative expression at 96 hpt. Again, suggesting that ABA positively regulates PR10 gene expression. In contrast, ACC, MeJA and SA appear to have a suppressive effect on this gene. For ACC-treated plants, the PR10 expression was suppressed by approximately 6 fold at 24 hpt and 48 hpt. The suppression of this gene was delayed until 96 hpt following MeJA treatment (Figure 10.6).

2.9 1.1 1 1.0

1.0 7.0

0.1 Cont

k

ABA

MeJA

SA

7.5 2.8 1.7

1 2.0 6.0

0.1

6 h post treatments

ABA ACC MeJA 24 h post treatments

(A)

(B)

10 Relative PR-4 expression

ACC

Relative PR-4 expression

10

Cont

10

7.5

1.6

1.3

1.0

1

7.0

Relative PR-4 expression

Relative PR-4 expression

10

SA

7.3

1

6.0

6.0 8.0

8.0

0.1

0.1 Cont

ABA

ACC

MeJA

Cont

SA

ABA

ACC

MeJA

48 h post treatments

96 h post treatments

(C)

(D)

SA

Figure 10.3 Fold changes in relative transcript level of PR4 in fourteen-day old lentil genotype ILL7537 seedlings of untreated plants (Cont) and after treatments with ABA, ACC, MeJA, and SA at (A) 6 h, (B) 24 h, (C) 48 h, and (D) 96 h. Total RNA was isolated from plants at each timepoint post treatment, reverse-transcribed to cDNA and used as template for qPCR assays. PR4 transcript levels were normalized to the expression of actin gene measured in the same samples and expressed logarithmically. Columns represent average data with error bars from two independent experiments. The numbers on each bar show the fold increase or decrease in PR4 transcript levels caused by each treatment relative to those in untreated controls: the y-axis differs between treatments.

k

k

k

258

Mechanism of Plant Hormone Signaling under Stress 1

16.6 10

5.8 2.7

2.0 1

Relative PR-4 expression (treated/control ratio)

Relative PR-4 expression (treated/control ratio)

100

2.0 5.0

8.0 0.1

6hABA 24hABA 48hABA 96hABA Hours post treatm ent

9.0 6hACC

24hACC 48hACC 96hACC Hours post treatment

(A)

(B) 10

4.0

6.9

0.1

1.2 1 2.0 5.0 7.0 0.1

6hMeJA 24hMeJA 48hMeJA 96hMeJA Hours post treatment

6hSA

24hSA 48hSA 96hSA Hours post treatment

(D)

(C) 100 Relative PR-4 expression (treated/control ratio)

k

1.9

2.0

Relative PR-4 expression (treated/control ratio)

Relative PR-4 expression (treated/control ratio)

1

10

ABA ACC MeJA

1

0.1

SA

6h

24h

48h

96h

Hours post treatment

(E)

Figure 10.4 Fold changes in relative transcript level of PR4 in 14-day-old lentil genotype ILL7537 seedlings at 6 h, 24 h, 48 h, and 96 h after treatments with (A) ABA, (B) ACC, (C) MeJA, or (D) SA. (E) shows all treatments at all timepoints on a single chart. PR4 transcript levels were normalized to the expression of actin genes measured in the same samples and expressed logarithmically relative to the normalized transcript levels in untreated plants. Columns represent average data with error bars from two independent experiments. The numbers on each bar show the fold increase or decrease in PR4 transcript levels caused by each treatment relative to those in untreated controls: the y-axis differs between treatments.

k

k

k

10 ABA Activates Pathogenesis-Related Defense 10

1.3 1

1.0

1.0

2.0

2.0

Relative PR-10a expression

Relative PR-10a expression

10

4.3 2.3

2.0 1.0

1.2

ABA ACC MeJA 24 h post treatment

SA

1

0.1

0.1 Cont

ABA ACC MeJA 6 h post treatment

Cont

SA

(A)

(B) 10

5.6 2.2

2.0 1.0

1

1.0

Relative PR-10a expression

Relative PR-10a expression

10

3.2

1

1.0 3.0

5.0

5.0

0.1

0.1 Cont

k

259

ABA ACC MeJA 48 h post treatment

Cont

SA

ABA ACC MeJA 96 h post treatment

SA

(D)

(C)

Figure 10.5 Fold changes in relative transcript level of PR10 in 14-day old lentil genotype ILL7537 seedlings of untreated plants (Cont) and after treatments with ABA, ACC, MeJA, or SA at (A) 6 h, (B) 24 h, (C) 48 h, and (D) 96 h. Total RNA was isolated from plants at each time point post treatment, reverse-transcribed to cDNA and used as template for qPCR assays. PR10 transcript levels were normalized to the expression of actin genes measured in the same samples and expressed logarithmically. Columns represent average data with error bars from two independent experiments. The numbers on each bar show the fold increase or decrease in PR10 transcript levels caused by each treatment relative to those in untreated controls: the y-axis differs between treatments.

10.7 Conclusions The global signaling molecules, ACC, JA, and SA, are well established to play a part in modulating defense gene(s) expression to various pathogens in both dicotyledonous and monocotyledonous species. Studies in Arabidopsis, maize, rice, and wheat reported that PR4 gene was upregulated by a JA-dependent pathway but not by a SA-dependent pathway (Thomma et al., 1998; Agrawal et al., 2003; Bravo et al., 2003; Desmond et al., 2006; Seo et al., 2008). In another study in chickpea, the PR4 gene was upregulated by exogenous ACC in a genotype resistant to the fungal pathogen A. rabiei, and upregulated by exogenous SA in another genotype susceptible to A. rabiei (Coram and Pang, 2006). In the relative legume lentil, PR4 expression was suppressed not only by SA but also by ACC and MeJA. In contrast, exogenous ABA induced lentil PR4 expression, complimenting previous reports that the ABA signaling pathway acts antagonistically against ET and JA signaling

k

k

k

260

Mechanism of Plant Hormone Signaling under Stress

10

3.2 2.4 1.9 1.5

1 6hABA

24hABA

48hABA

Relative PR-10a expression (treated/control ratio)

Relative PR-10a expression (treated/control ratio)

10

1.2 1 3.0

0.1

96hABA

6hACC

Hours post treatment

24hACC 48hACC 96hACC Hours post treatment

(B)

(A) 1 1.0

1.2 1 2.0

2.0 5.0

0.1

Relative PR-10a expression (treated/control ratio)

Relative PR-10a expression (treated/control ratio)

10

6hMeJA 24hMeJA 48hMeJA 96hMeJA Hours post treatment

4.0

5.0

5.0

k 0.1

6hSA

24hSA 48hSA 96hSA Hours post treatment

(D)

(C) 10 Relative PR-10a expression (treated/control ratio)

k

6.0

6.0

ABA

1

ACC MeJA SA

0.1

6h

24h

48h

96h

Hours post treatment

(E)

Figure 10.6 Fold changes in relative transcript level of PR10 in 14-day-old lentil genotype ILL7537 seedlings at 6 h, 24 h, 48 h, and 96 h after treatments with (A) ABA, (B) ACC, (C) MeJA, or (D) SA (E) shows all treatments at all time points on a single chart. PR10 transcript levels were normalized to the expression of actin genes measured in the same samples and expressed logarithmically relative to the normalized transcript levels in untreated plants. Columns represent average data with error bars from two independent experiments. The numbers on each bar show the fold increase or decrease in PR10a transcript levels caused by each treatment relative to those in untreated controls: the y-axis differs between treatments.

k

k

10 ABA Activates Pathogenesis-Related Defense

k

pathways involved in defense gene expression in Arabidopsis (Adie et al., 2007). ABA is known to be upstream of JA biosynthesis and can activate its biosynthesis through the octadecanoic pathway to produce high levels of endogenous JA, which in turn activates the expression of various genes upon stresses (Farmer and Ryan, 1992; Pena-Cortes et al., 1995). However, there are JA or MeJA-independent pathways of ABA induction in potato (Dammann et al., 1997) and lily (Wang et al., 1999). Therefore, the induction of PR4 in lentil may similarly be due to an ABA-dependent but MeJA-independent pathway. The observed increase of PR4 expression over time after treatment with ABA may suggest that this hormone instigates a sustained signaling mechanism such as SAR. Following exogenous ABA application, upregulation of PR4 expression occurred from 6 hpt and continued to increase throughout the time course of the experiment, well into the comparative timing of sub-cuticular invasion by a necrotrophic fungal pathogen such as Ascochyta lentis. Previously, PR4 expression was shown to be upregulated at 24 hpt following inoculation with A. lentis in the same lentil genotype (Mustafa, 2008). Meanwhile, PR10 proteins are induced in many plant species in response to microbial attack and by the global signaling molecules SA (Jwa et al., 2001), JA (Moons et al., 1997; Wang et al., 1999; Jwa et al., 2001; Lee et al., 2001; McGee et al., 2001; Rakwal et al., 2001), ABA (Moons et al., 1997; Wang et al., 1999; Lee et al., 2001) as well as by abiotic stresses (Hashimoto et al., 2004) and wounding (Warner et al., 1992; 1993). A transcript profiling study conducted in sorghum found that a PR10 protein was induced to different levels by SA, ACC and JA (Salzman et al., 2005). The effect of JA was most significant as it increased PR10 expression by 156 fold in sorghum root at 27 hpt. In another study conducted in chickpea, a PR10 gene homologous to the lentil PR10 was downregulated in a genotype susceptible to the fungal pathogen A. rabiei (Coram and Pang, 2006). In a separate study in chickpea, a disease resistance response protein DRRG49-C, which is a member of the PR10 family, was upregulated by ACC in the same susceptible genotype. Also, PR10 protein was upregulated by SA in another genotype, which was moderately resistant to A. rabiei (Coram and Pang, 2007). While ABA is known to be upstream of JA biosynthesis and can activate its biosynthesis through the octadecanoic pathway (Farmer and Ryan, 1992; Pena-Cortes et al., 1995), JA or MeJA pathways, independent of ABA induction of PR10 were reported in lily anthers (Wang et al., 1999). Previously, the ABA signaling pathway was found to act antagonistically against ET and JA signaling pathways involved in defense gene expression in Arabidopsis (Adie et al., 2007). Indeed, the PR10 expression in lentil was positively regulated by ABA and negatively regulated by ACC, MeJA, and SA. In summary, we propose that ABA is a major signaling molecule for inducing PR4 and PR10 in lentil and that this mechanism is independent of a SA-dependent signaling pathway (Thomma et al., 1998). Careful examination of ABA mutants in lentil may contribute further to the understanding of defense signaling response and their hormonal control mechanisms in lentils.

References Aartz N, Metz M, Stakawicz BJ, Daniels MJ, Parker JE (1998) Different requirements for EDS1 and NDR1 by disease resistance genes define at least two R gene-mediated signaling pathways in Arabidopsis. Proceedings of the National Academy of Sciences USA 95: 10306–10311.

k

261

k

k

262

k

Mechanism of Plant Hormone Signaling under Stress

Adie BA, Perez-Perez J, Perez-Perez MM, Godoy M, Sanchez-Serrano JJ, Schmelz EA, Solano R (2007) ABA is an essential signal for plant resistance to pathogens affecting JA biosynthesis and the activation of defenses in Arabidopsis. Plant Cell 19: 1665–1681. Agrawal GK, Jwa NS, Han KS, Agrawal VP, Rakwal R (2003) Isolation of a novel rice PR4 type gene whose mRNA expression is modulated by blast pathogen attack and signaling components. Plant Physiology and Biochemistry 41: 81–90. Agrios GN (2004) Plant Pathology, 5th edn. Academic Press. Anderson JP, Badruzsaufari E, Schenk PM, Manners JM, Desmond OJ, Ehlert C, et al. (2004) Antagonistic interactions between abscisic acid and jasmonate-ethylene signalling pathways modulates defense gene expression and disease resistance in Arabidopsis. Plant Cell 16: 3460–3479. Anderson JP, Thatcher LF, Singh KB (2005) Plant defence responses: conservation between models and crops. Functional Plant Biology 32: 21–34. Apel K, Hirt H (2004) Reactive Oxygen Species: metabolism, oxidative stress, and signal transduction. Annual Review of Plant Biology 55: 373–399. Arumuganathan K, Earle E (1991) Nuclear DNA content of some important plant species. Plant Molecular Biology Reporter 9: 208–218. Audenaert K, De Meyer GB, Höfte MM (2002) Abscisic acid determines basal susceptibility of tomato to B. cinerea and suppresses salicylic acid dependent signaling mechanisms. Plant Physiology 128: 491–501. Bantignies B, Seguin J, Muzac I, Dedaldechamp F, Gulick P, Ibrahim R (2000) Direct evidence for ribonucleolytic activity of a PR-10-like protein from white lupin roots. Plant Molecular Biology 42: 871–881. Barz W, Mackenbrock U (1994) Constitutive and elicitation induced metabolism of isoflavones and pterocarpans in chickpea (Cicer arietinum) cell-suspension cultures. Plant Cell, Tissue and Organ Culture 38: 199–211. Bent A, Mackey D (2007) Elicitors, effectors and R genes: The new paradigm and a lifetime supply of questions. Annual Review of Phytopathology 45: 399–436. Bertini L, Caporale C, Testa M, Proietti S, Caruso C (2009) Structural basis of the antifungal activity of wheat PR4 proteins. Federation of European Biochemical Societies Letters 583: 2865–2871. Bleecker AB, Kende H (2000) Ethylene: a gaseous signal molecule in plants. Annual Review of Cell and Developmental Biology 16: 1–18. Bormann C, Baier D, Horr I, Raps C, Berger J, Jung G, Schwarz H (1999) Characterization of a novel, antifungal, chitin-binding protein from Streptomyces tendae Tu901 that interferes with growth polarity. Journal of Bacteriology 181: 7421–7429. Bravo JM, Campo S, Murillo I, Coca M, San Segundo B (2003) Fungus- and wound-induced accumulation of mRNA containing a class II chitinase of the pathogenesis-related protein 4 family of maize. Plant Molecular Biology 52: 745–759. Breda C, Sallaud C, El-Turk J, Buffard D, de Kosak I, Esnault R, Kondorosi A (1996) Defense reaction in Medicago sativa: a gene encoding a class 10 PR protein is expressed in vascular bundles. Molecular Plant-Microbe Interactions 9: 713–719. Broekaert W, Lee H, Kush A, Chua NH, Raikhel NV (1990) Wound-induced accumulation of mRNA containing a hevein sequence in laticifers of rubber tree (Hevea brasiliensis). Proceedings of the National Academy of Sciences USA 87: 7633–7637. Bufe A, Spangfort MD, Kahlert H, Schlaak M, Becker WM (1996) The major birch pollen allergen, Bet V1, shows ribonuclease activity. Planta 199 413–415.

k

k

k

10 ABA Activates Pathogenesis-Related Defense

k

Cao H, Bowling SA, Gordon S, Dong X (1994) Characterization of an Arabidopsis mutant that is nonresponsive to inducers of systemic acquired resistance. Plant Cell 6: 1583–1592. Cao FY, Yoshioka K, Desveaux D (2011) The roles of ABA in plant–pathogen interactions. Journal of Plant Research 124: 489–499. Chadha P, Das R (2006) A pathogenesis related protein, AhPR10 from peanut: an insight of its mode of antifungal activity. Planta 225: 213–222. Chakravarthy S, Tuori RP, D’Ascenzo MD, Fobert PR, Despres C, Martin GD (2003) The tomato transcription factor Pti4 regulates defense related gene expression via GCC-box and non-GCC box cis elements. Plant Cell 15: 3033–3050. Chen ZY, Brown RL, Rajasekaran K, Damann KE, Cleveland TE (2006) Identification of a maize kernel pathogenesis-related protein and evidence for its involvement in resistance to Aspergillus flavus infection and aflatoxin production. Phytopathology 96: 87–95. Coram TE, Pang ECK (2006) Expression profiling of chickpea genes differentially regulated during a resistance response to Ascochyta rabiei. Plant Biotechnology Journal 4: 647–666. Coram TE, Pang ECK (2007) Transcriptional profiling of chickpea genes differentially regulated by salicylic acid, methyl jasmonate and aminocyclopropane carboxylic acid to reveal pathways of defence-related gene regulation. Functional Plant Biology 34: 52–64. Creelman RA, Mullet JE (1997) Biosynthesis and action of jasmonates in plants. Annual Review of Plant Physiology and Plant Molecular Biology 48: 355–381. Crowell D, John ME, Russell D, Amasino RM (1992) Characterization of a stress-induced developmentally regulated gene family from soybean. Plant Molecular Biology 18: 459–466. Dammann C, Rojo E, Sanchez-Serrano JJ (1997) Abscisic acid and jasmonic acid activate wound-inducible genes in potato through separate, organ-specific signal transduction pathways. Plant Journal 11: 773–782. Dat J, Vandenabeele S, Vranova E, Van Montagu M, Inze D (2000) Dual action of the active oxygen species during plant stress responses. Cellular and Molecular Life Sciences 57: 779–795. Datta K, Muthukrishnan S, Datta SK (1999) Expression and function of PR-protein genes in transgenic plants. In SK Datta, S Muthukrishnan (eds), Pathogenesis-Related Proteins in Plants. CRC Press, Boca Raton, FL, pp. 261–277. Delaney TP, Uknes S, Vernooij B, Friedrich L, Weymann K (1994) A central role of salicylic acid in plant disease resistance. Science 266: 1247–1250. Desmond OJ, Edgar CI, Manners JM, Maclean DJ, Schenk P, Kazan K (2006) Methyl jasmonate induced gene expression in wheat delays symptom development by crown rot pathogen Fusarium pseudograminearum. Physiological and Molecular Plant Pathology 67: 171–179. Devoto A, Turner JG (2003) Regulation of jasmonate-mediated plant responses in Arabidopsis. Annals of Botany 92: 329–337. Dixon RA, Harrison MJ (1990) Activation, structure, and organization of genes involved in microbial defense in plants. Advances in Genetics 28: 165–234. Dodds PN, Schwechheimer C (2002) A breakdown in defense signalling. Plant Cell 14: S5–S8. Edwards HH (1983) Effect of kinetin, abscisic acid and cations on host–parasite relation of barley inoculated with Erysiphe graminis f. sp. hordei. Journal of Phytopathology 107: 22–30.

k

263

k

k

264

k

Mechanism of Plant Hormone Signaling under Stress

Ekramoddoullah AKM, Davidson JJ, Taylor D (1998) A protein associated with frost hardiness of western white pine is upregulated by infection in the white pine blister rust pathosystem. Canadian Journal of Forest Research 28: 412–417. Erskine WM (1996) Lessons for breeders from land races of lentil. Euphytica 93: 107–112. Erskine WM, Tufail M, Russell AC, Tyagi MC, Rahman M, Saxena MC (1994) Current and future strategies in breeding lentil for resistance to biotic and abiotic stresses. Euphytica 73: 127–135. Eyal Y, Meller Y, Levy S, Fluhr R (1993) A basic-type PR-1 promoter directs ethylene responsiveness, vascular and abscission zone-specific expression. Plant Journal 4: 225–234. FAOSTAT (2007) Source of statistical data on production. FAOSTAT, http://faostat.fao.org. Farmer EE, Ryan CA (1992) Octadecanois precursors jasmonic acid activates the synthesis of wound-inducible proteinase inhibitors. Plant Cell 4: 129–132. Ferreira RB, Monteiro S, Freitas R, Santos CN, Chen Z, Batista LM, et al. (2007) The role of plant defence proteins in fungal pathogenesis. Molecular Plant Pathology 8: 677–700. Feys BJ, Moisan LJ, Newman MA, Parker JE (2001) Direct interaction between Arabidopsis disease resistance proteins, EDS1 and PAD4. EMBO Journal 19: 5400–5411. Feys BJ, Parker JE (2000) Interplay of signaling pathways in plant disease resistance. Trends in Genetics 16: 449–455. Fristensky B, Horovitz D, Hadwiger LA (1988) cDNA sequences for pea disease response genes. Plant Molecular Biology 11: 713–715. Frye CA, Innes RW (1998) An Arabidopsis mutant with enhanced resistance to powdery mildew. Plant Cell 10: 947–956. Garcia-Brugger A, Lamotte O, Vandelle E, Bourque S, Lecourieux D, Poinssot B, et al. (2006) Early signalling events induced by elicitors of plant defences. Molecular Plant-Microbe Interactions 19: 711–724. Gechev TS, Gadjev IZ, Hille J (2004) An extensive microarray analysis of AAL-toxin-induced cell death in Arabidopsis thaliana brings new insights into the complexity of programmed cell death in plants. Cellular and Molecular Life Sciences 61: 1185–1197. Gill US, Lee S, Mysore KS (2015) Host versus nonhost resistance: Distinct wars with similar arsenals. Phytopathology http://dx.doi.org/10.1094/PHYTO-11–14–0298-RVW. Glazebrook J (2005) Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annual Review of Phytopathology 43: 205–227. Glazebrook J, Rogers EE, Ausubel FM (1996) Isolation of Arabidopsis mutants with enhanced disease susceptibility by direct screening. Genetics 143: 973–982. Gossen BD, Morrall RAA (1983) Effect of Aschochyta blight on seed yield and quality of lentils. Canadian Journal of Plant Pathology 5: 168–173. Grant JJ, Loake GJ (2000) Role of reactive oxygen intermediates and cognate redox signaling in disease resistance. Plant Physiology 124: 21–29. Grant M, Mansfield J (1999) Early events in host-pathogen interactions. Current Opinion in Plant Biology 2: 312–319. Greenberg J (1997) Programmed cell death in plant-pathogen interactions. Annual Review of Plant Physiology and Plant Molecular Biology 48: 525–545. Guevara-Morato MA, de Lacoba MG, Garcia-Luque I, Serra MT (2010) Characterization of a pathogenesis-related protein 4 (PR-4) induced in Capsicum chinense L3 plants with dual RNase and DNase activities. Journal of Experimental Botany 61: 3259–3271.

k

k

k

10 ABA Activates Pathogenesis-Related Defense

k

Gupta V, Willits MG, Glazebrook J (2000) EDS4 contributes to salicylic acid (SA)-dependent expression of defense responses: evidence for inhibition of jasmonic acid signaling by SA. Molecular Plant-Microbe Interactions 13: 503–511. Hashimoto M, Kisseleva L, Sawa S, Furukawa T, Komatsu S, T. K (2004) A novel rive PR10 protein, RSJIOsPR10, specifically induced in roots by biotic and abiotic stresses, possibly via the jasmonic acid signalling pathway. Plant Cell Physiology 45: 550–559. Heath MC (2000) Nonhost resistance and nonspecific plant defenses. Current Opinion in Plant Biology 3: 315–319. Hernandez-Bello MA, Chilvers MI, Akamatsu H, Peever TL (2006) Host specificity of Ascochyta spp. infecting legumes of the Viciae and Cicerae tribes and pathogenicity of an interspecific hybrid. Phytopathology 96: 1148–1156. Hilpert B, Bolmann H, den Camp R, Przybyla D, Miersch O, Buchala A, Apel K (2001) Isolation and characterization of signal transduction mutants of Arabidopsis thaliana that constitutively activate the octadecanoid pathway and form necrotic lesions. Plant Journal 26: 435–446. Hoch H, Staples R, Whitehead B, Comeau J, Wolf E (1987) Signalling for growth orientation and cell differentiation by surface topography in Uromyces. Science 235: 1659–1662. Iturriaga EA, Leech MJ, Paul Barratt DH, Wang TL (1994) Two ABA-responsive proteins from pea (Pisum sativum L.) are closely related to intracellular pathogenesis-related proteins. Plant Molecular Biology 24: 235–240. Jirage D, Tootle TL, Reuber TL, Frost LN, Feys BJ, Parker JE, et al. (1999) Arabidopsis thaliana PAD4 encodes a lipase-like gene that is important for salicylic acid signaling. Proceedings of the National Academy of Sciences USA 96: 13583–13588. Johnsson PR, Ecker JR (1998) The ethylene gas signal transduction pathway: a molecular perspective. Annual Review of Genetics 32: 227–254. Jonak C, Okresz L, Bogre L, Hirt H (2002) Complexity, cross talk and integration of plant MAP kinase signalling. Current Opinion in Plant Biology 5: 414–424. Jwa NS, Agrawal K, Rakwal R, Park CH, Agrawal VP (2001) Molecular cloning and characterization of a novel jasmonate inducible pathogenesis-related class 10 protein gene, JIOsPR10, from rice (Oryza sativa L.) seedling leaves. Biochemical and Biophysical Research Communications 286: 973–983. Lamb C, Dixon RA (1997) The oxidative burst in plant disease response. Annual Review of Plant Physiology and Plant Molecular Biology 48: 251–257. Lawton K, Weymann K, Friedrich L, Vernooij B, Uknes S, Ryals JA (1995) Systemic acquired resistance in Arabidopsis requires salicylic acid but not ethylene. Molecular Plant-Microbe Interactions 8: 863–870. Lee H-I, León J, Raskin I (1995) Biosynthesis and metabolism of salicylic acid. Proceedings of the National Academy of Sciences USA 92: 4076–4079. Lee M-W, Qi M, Yang Y (2001) A novel jasmonic acid-inducible rice myb gene associates with fungal infection and host cell death. Molecular Plant-Microbe Interactions 14: 527–535. Leon J, Rojo E, Sanchez-Serrano JJ (2001) Wound signalling in plants. Journal of Experimental Botany 52: 1–9. Leung J, Giraudat J (1998) Abscisic acid signal transduction. Annual Review of Plant Physiology and Plant Molecular Biology 49: 199–222.

k

265

k

k

266

k

Mechanism of Plant Hormone Signaling under Stress

Linhorst HJM, Danhash N, Brederode FT, Van Kan JAL, De Witt PJGM, Bol JF (1991) Tobacco and tomato PR proteins homologous to win and pro-havein lack the ‘hevein’ domain. Molecular Plant-Microbe Interactions 4: 585–592. Lipka U, Fuchs R, Lipka V (2008) Arabidopsis non-host resistance to powdery mildews. Current Opinion in Plant Biology 11: 404–411. Liu J-J, Ekramoddoullah AKM (2003) Root-specific expression of a western pine PR10 gene is mediated by different promoter regions in transgenic tobacco. Plant Molecular Biology 52: 103–120. Liu JJ, Ekramoddoullah AKM, Yu X (2003) Differential expression of multiple PR10 proteins in western white pine following wounding, fungal infection and cold-hardening. Plant Physiology 119: 544–553. Liu X, Huang B, Lin J, Fei J, Chen Z, Pang Y, Sun X, Tang K (2006) A novel pathogenesis-related protein (SsPR10) from Solanum surattense with ribonucleolytic and antimicrobial activity is stress- and pathogen-inducible. Journal of Plant Physiology 163: 546–556. Livak KJ, Schmittgen, TD (2001) Analysis of relative expression data using real-time quantitative PCR and the 2-▵▵CT method. Methods 25: 402–408. Lorenzo O, Piqueras R, Sanchez-Serrano JJ, Solano R (2003) Ethylene Response Factor1 integrates signals from ethylene and jasmonate pathways in plant defense. Plant Cell 15: 165–178. Low PS, Merida JR (1996) The oxidative burst in plant defense: function and signal transduction. Physiologia Plantarum 96: 533–542. Lu HC, Lin JH, Chua AC, Chung TY, Tsai IC, Tzen JT, Chou WM (2012) Cloning and expression of pathogenesis-related protein 4 from jelly fig (Ficus awkeotsang Makino) achenes associated with ribonuclease, chitinase and anti-fungal activities. Plant Physiology and Biochemistry 56: 1–13. Martin GB, Bogdanove AJ, Sessa G (2003) Understanding the functions of plant disease resistance proteins. Annual Review of Plant Biology 54: 23–61. Martínez-Medina A, Fernández I, Sánchez-Guzmán MJ, Jung SC, Pascual JA, Pozo MJ (2013) Deciphering the hormonal signalling network behind the systemic resistance induced by Trichoderma harzianum in tomato. Frontiers in Plant Science 4: 206. McConn M, Browse J (1996) The critical requirement for linoleic acid is pollen development, not photosynthesis, in an Arabidopsis mutant. Plant Cell 8: 403–416. McGee JD, Hamer JE, Hodges TK (2001) Characterization of a PR-10 pathogenesis-related gene family induced in rice during infection with Magnaporthe grisea. Molecular Plant-Microbe Interactions 14: 877–886. Mohr PG, Cahill DM (2003) Abscisic acid influences the susceptibility of Arabidopsis thaliana to Pseudomonas syringae pv. tomato and Peronospora parasitica. Functional Plant Biology 30: 461–469. Moons A, Prinsen E, Bauw G, Van Montagu M (1997) Antagonistic effects of abscisic acid and jasmonates on salt stress-inducible transcripts in rice roots. Plant Cell 9: 2243–2259. Morrall RAA, Sheppard JW (1981) Ascochyta blight of lentils in western Canada: 1978 to 1980. Canadian Plant Disease Survey 61: 7–13. Mustafa BM (2008) Functional mechanisms of Aschochyta blight resistance in lentil. PhD Thesis. University of Melbourne, Melbourne

k

k

k

10 ABA Activates Pathogenesis-Related Defense

k

Mustafa BM, Coram TE, Pang ECK, Taylor PWJ and Ford R (2009). A cDNA microarray approach to decipher Ascochyta blight resistance in lentil. Australasian Plant Pathology 38: 617–631. Nasir M, Bretag TW (1997a) Prevalence of Ascochyta fabae f. sp. lentis on lentil seed from Victoria, Australia. Australasian Plant Pathology 26: 117–120. Nasir M, Bretag TW (1997b) Pathogenic variability in Australian isolates of Ascochyta lentis. Australasian Plant Pathology 26: 217–220. Nawrath C, Métraux JP (1999) Salicylic acid induction-deficient mutants of Arabidopsis express PR-2 and PR-5 and accumulate high levels of camalexin after pathogen inoculation. Plant Cell 11: 1393–1404. Nene YL, Hanounik SH, Qureshi SH, Sen B (1988) Fungal and bacterial foliar diseases of pea, lentil, faba bean and chickpea. In RJ Summerfield (ed.), World Crops: Cool Season Food Legumes. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 677–589. Nguyen TT, Taylor PWJ, Brouwer JB, Pang ECK, Ford R (2001) A novel source of resistance in lentil (Lens culinaris ssp. culinaris) to ascochyta blight caused by Ascochyta lentis. Australasian Plant Pathology 30: 211–215 Osbourn AE, Clarke BR, Lunness P, Scott PR, Daniels MJ (1994) An oat species lacking avenacin is susceptible to infection by Gaeumannomyces graminis var. tritici. Physiological and Molecular Plant Pathology 45: 457–467. Pan Q, Jonathan W, Fluhr R (2000) Divergent evolution of plant NBS–LRR resistance gene homologues in dicot and cereal genomes. Journal of Molecular Evolution 50: 203–213. Park CJ, Kim KJ, Shin R, Park JM, Shin YC, Paek KH (2004) Pathogenesis-related protein 10 isolated from hot pepper functions as a ribonuclease in an antiviral pathway. Plant Journal 37: 186–198. Peck SC (2003) Early phosphorylation events in biotic stress. Current Opinion in Plant Biology 6: 334–338. Pena-Cortes H, Fisahn J, Willmitzer L (1995) Signals involved in wound-induced proteinase inhibitor II gene expression in tomato and potato plants. Proceedings of the National Academy of Sciences USA 92: 4106–4113. Penninckx IA, Eggermont K, Terras FR, Thomma BP, De Samblanx GW, Buchala A, et al. (1996) Pathogen-induced systemic activation of a plant defensin gene in Arabidopsis follows a salicylic acid-independent pathway. Plant Cell 8: 2309–2323. Pinto MP, Ricardo CP (1995) Lupinus albus L. pathogenesis-related proteins that show similarity to PR-10 proteins. Plant Physiology 109: 1345–1351. Ponstein AS, Bres-Vloemans SA, Sela-Buurlage MB, Van Den Elzen PJM, Melchers LS, Cornelissen BJC (1994) A novel pathogen-and wound-inducible tobacco (Nicotiana tabacum) protein with antifungal activity. Plant Physiology 104: 109–118. Potter S, Uknes S, Lawton K, Winter AM, Chandler D, DiMaio J, et al. (1993) Regulation of a hevein-like gene in Arabidopsis. Molecular Plant-Microbe Interactions 680–685. Rakwal R, Agrawal GK, Yonekura M (2001) Light-dependent induction of OsPR10 in rice (Oryza sativa L.) seedlings by global stress signalling molecule jasmonic acid and protein phosphatase 2A inhibitors. Plant Science 161: 469–479. Reymond P, Weber H, Damond M, Farmer EE (2000) Differential gene expression in response to mechanical wounding and insect feeding in Arabidopsis. Plant Cell 12: 707–720. Robert N, Ferran J, Breda C, Coutos-Thevenot P, Boulay M, Buffard D, Esnault R (2001) Molecular characterization of the incompatible interaction of Vitis vinifera leaves with

k

267

k

k

268

k

Mechanism of Plant Hormone Signaling under Stress

Pseudomonas syringae pv. pisi: expression of genes coding for stilbene synthase and class 10 PR protein. European Journal of Plant Pathology 107: 249–261. Rojo E, Solano R, Sanchez-Serrano JJ (2003) Interactions between signalling compounds involved in plant defense. Journal of Plant Growth Regulation 22: 82–98. Salzman RA, Brady JA, Finlayson SA, Buchanan CD, Summer EJ, Sun F, et al. (2005) Transcriptional profiling of sorghum Induced by methyl jasmonate, salicylic acid, and aminocyclopropane carboxylic acid reveals cooperative regulation and novel gene responses. Plant Physiology 138: 352–368. Sanders PM, Lee PY, Biesgen C, Boone JD, Beals TP, Weiler EW, Goldberg RB (2000) The Arabidopsis Delayed Dehiscence1 gene encodes an enzyme in the jasmonic acid synthesis pathway. Plant Cell 12: 1041–1061. Santner A, Estelle M (2009) Recent advances and emerging trends in plant hormone signalling. Nature 459: 1071–1078. Savage GP (1988) The composition and nutritive value of lentils (Lens culinaris). Nutrition Abstracts and Reviews 58: 319–343. Scheler C, Durner J, Astier J (2013) Nitric oxide and reactive oxygen species in plant biotic interactions. Current Opinion in Plant Biology 16: 534–539. Schenk P, Kazan K, Wilson I, Anderson JP, Richmond T, Somerville S, Manneers J (2000) Coordinated plant defense responses in Arabidopsis revealed in microarray analysis. Proceedings of the National Academy of Sciences USA 97: 11655–11660. Schwessinger B, Zipfel C (2008) News from the frontline: recent insights into PAMP-triggered immunity in plants. Current Opinion in Plant Biology 11: 389–395. Selitrennikoff CP (2001) Antifungal proteins. Applied and Environmental Microbiology 67: 2883–2894. Seo PJ, Lee A-K, Xiang F, Park C-M (2008) Molecular and functional profiling of Arabidopsis pathogenesis-related genes: insights into their roles in salt response of seed germination. Plant Cell Physiology 49: 334–344. Shah J, Kachroo P, Klessig D (1999) The Arabidopsis ssi1 mutation restores PR gene expression in SA-Insenstive (npr1) plants and renders PDF1.2 (Defensin) gene expression SA dependent. Plant Cell 11: 191–206. Solano R, Stepanova A, Chao Q, Ecker JR (1998) Nuclear events in ethylene signalling: a transcriptional cascade mediated by Ethylene-Insensitive3 and Ethylene-Response-Factor1. Genes and Development 12: 3703–3714. Stanford A, Bevan M, Northcote D (1989) Differential expression within a family of novel wound-induced genes in potato. Molecular and General Genetics 215: 200–208. Staswick PE, Tiryaki I, Rowe ML (2002) Jasmonate response locus JAR1 and several related Arabidopsis genes encode enzymes of firefly luciferase superfamily that show activity on jasmonic, salicylic, and indole-3-acetic acids in an assay for adenylation. Plant Cell 14: 1405–1415. Svensson B, Svendsen I, Hojrup P, Roepstorff P, Ludvigsen S, Poulsen FM (1992) Primary structure of Barwin: a barley seed protein closely related to the C-terminal domain of proteins encoded by wound-induced plant genes. Biochemistry 31: 8767–8770. Tewari S, Brown SM, Fristensky B (2003) Plant defense multigene families: I. Divergence of Fusarium solani-induced expression in Pisum and Lathyrus quantitative biology. ArXiv Quantitative Biology, http://arxiv.org/ftp/q-bio/papers/0310/0310003.pdf (accessed September 28, 2016).

k

k

k

10 ABA Activates Pathogenesis-Related Defense

k

Thaler J, Bostock R (2004) Interactions between abscisic-acid-mediated responses and plants resistant to pathogen and insects. Ecology 85: 48058. Thatcher LF, Anderson JP, Singh KB (2005) Plant defence responses: what have we learnt from Arabidopsis? Functional Plant Biology 32: 1–19. Theis T, Stahl U (2004) Antifungal proteins: targets, mechanisms and prospective applications. Cellular and Molecular Life Sciences 61: 437–455. Thomma BP, Eggermont K, Tierens KF, Broekaert WF (1999) Requirement of functional ethylene-insensitive2 gene for efficient resistance of Arabidopsis to infection by Botrytis cinerea. Plant Physiology 121: 1093–1102. Thomma BPHJ, Cammue BPA, Thevissen K (2002) Plant defensins. Planta 216: 193–202. Thomma BPHJ, Eggermont K, Penninckx IAMA, Mauch-Mani B, Vogelsang R, Cammune BP, Broekaert WF (1998) Separate jasmonate-dependent and salicylate-dependent defense-response pathways in Arabidopsis are essential for resistance to distinct microbial pathogens. Proceedings of the National Academy of Sciences USA 95: 15107–151011. Thomma BPHJ, Penninckx IAMA, Cammue BPA, Broekaert WF (2001) The complexity of disease signaling in Arabidopsis. Current Opinion in Immunology 13: 63–68. Tivoli B, Baranger A, Avila C, Banniza S, Barbetti M, Chen W, et al. (2006) Screening techniques and sources of resistance to foliar diseases caused by major necrotrophic fungi in grain legumes. Euphytica 147: 223–253. Ton J, Mauch-Mani B (2004) Beta-amino-butyric acid-induced resistance against necrotrophic pathogens is based on ABA-dependent priming for callose. Plant Journal 38: 119–130. Turrion-Gomez JL, Benito EP (2011) Flux of nitric oxide between the necrotrophic pathogen Botrytis cinerea and the host plant. Molecular Plant Pathology 12: 606–616. Vaghefi, N, Mustafa BM, Dulal N, Selby-Pham J, Taylor PWJ, Ford R (2013) A novel pathogenesis-related protein (LcPR4a) from lentil, and its involvement in defence against Ascochyta lentis. Phytopathologia Mediterranea 52: 192−201. Van Loon LC (1999) Occurrence and properties of plant pathogenesis-related proteins. In SK Datta, MS (eds), Pathogenesis-Related Proteins in Plants. CRC Press, Boca Raton, FL, pp. 1–19. Van Loon LC, Rep M, Pieterse CM (2006) Significance of inducible defense-related proteins in infected plants. Annual Review of Phytopathology 44: 135–162. Van PJ, Broekaert W, Goldstein I, Peumans W (1991) Hevein: an antifungal protein from rubber-tree (Hevea braziliensis) latex. Planta 183: 258–264. Van Zhong G, Burns J (2003) Profiling ethylene-regulated gene expression in Arabidopsis thaliana by microarray analysis. Journal of Plant Molecular Biology 53: 117–131. Vellasamy G, Hill GD, McKenzie BA (1998) The role of grain legumes in maintaining soil fertility in Canterbury, New Zealand. In Proceedings of the 3rd European Conference on Grain Legumes, Valladolid, Spain. Walter MH, Liu J-W, Grand C, Lamb CJ, Hess D (1990) Bean pathogenesis-related (PR) proteins deduced from elicitor-induced transcripts are members of a ubiquitous new class of conserved PR proteins including pollen allergens. Molecular and General Genetics 222: 353–360. Walter MH, Liu J-W, Wunn J, Hess D (1996) Bean ribonuclease-like pathogenesis-related protein genes (Ypr10) display complex patterns of developmental, dark-induced and

k

269

k

k

270

k

Mechanism of Plant Hormone Signaling under Stress

exogenous-stimulus dependent expression. European Journal of Biochemistry 239: 281–293. Wang C-S, Huang J-C, Hu J-H (1999) Characterization of two subclasses of PR-10 transcripts in lily anthers and induction of their genes through separate signal transduction pathways. Plant Molecular Biology 40: 807–814. Wang KLC, Li H, Ecker JR (2002) Ethylene biosynthesis and signaling networks. Plant Cell S131–151. Ward EWB, Cahill DM, Bhattacharyya MK (1989) Abscisic acid suppression of phenylalanine ammonia-lyase activity and mRNA, and resistance of soybeans to Phytophthora megasperma f. sp. glycinea. Plant Physiology 91: 23–27. Warner S, Scott R, Draper J (1993) Isolation of an asparagus intracellular PR gene (AoPR1) wound-responsive promoter by the inverse polymerase chain reaction and its characterization in transgenic tobacco. Plant Journal 3: 191–201. Warner SAJ, Scott R, Draper J (1992) Characterization of a wound-induced transcript from the monocot asparagus that shares similarity with a class of intracellular pathogenesis-related (PR) proteins. Plant Molecular Biology 19: 555–561. Wildermuth MC, Dewdney J, Wu G, Ausubel FM (2001) Isochorismate synthase is required to synthesize salicylic acid for plant defence. Nature 414: 562–565. Xu P, Blancaflor EB, Roossinck MJ (2003) In spite of induced multiple defense responses, tomato plants with cucumber mosaic virus and D satellite RNA succumb to systemic necrosis. Molecular Plant-Microbe Interactions 16: 467–476. Xu Y, Chang P-FL, Liu D, Narasimhan ML, Raghothama KG, Hasegawa PM, Bressan RA (1994) Plant defense genes are synergistically induced by ethylene and methyl jasmonate. Plant Cell 6: 1077–1085. Xu P, Jiang L, Wu J, Li W, Fan S, Zhang S (2014) Isolation and characterization of a pathogenesis-related protein 10 gene (GmPR10) with induced expression in soybean (Glycine max) during infection with Phytophthora sojae. Molecular Biology Reports 41: 4899–4909. Yaish MWF, De Miera LES, De la Vega MP (2004) Isolation of a family of resistance gene analogue sequences of the nucleotide binding site (NBS) type from Lens species. Genome 47: 650–659. Yang S, Hoffman N (1984) Ethylene biosynthesis and its regulation in higher plants. Annual Review of Plant Physiology and Plant Molecular Biology 35: 155–189. Yang Y, Shah J, Klessig DF (1997) Signal perception and transduction on plant defense responses. Genes and Development 11: 1621–1639.

k

k

k

271

11 Signaling and Modulation of Non-Coding RNAs in plants by Abscisic Acid (ABA) Raj Kumar Joshi 1,2 , Swati Megha 1 , Urmila Basu 1 , and Nat N.V. Kav 1 1

Department of Agricultural Food and Nutritional Science, University of Alberta, Edmonton, Alberta, Canada

2 Centre of Biotechnology, Siksha O. Anusandhan University, Bhubaneswar, India

11.1 Introduction

k

Plants are sessile organisms and often get exposed to environmental stresses including drought, salinity, extreme temperatures, and pathogen infections, which significantly impact their yield and productivity. The phytohormone abscisic acid (ABA) is produced by plants as an endogenous messenger and is involved in the regulation of adaptive responses to various stresses (Melcher et al., 2010; Nakashima and Shinozaki, 2013; Figure 11.1/Plate 13). Drought stress often results in elevated ABA levels that, in turn, promotes the closure of stomata and induces the expression of several genes responsible for dehydration tolerance (Wasilewska et al., 2008, Lee et al., 2009; Wilkinson and Davis, 2010). Although ABA mostly regulates water balance and osmotic stress tolerance, it also plays an important role in fine-tuning many growth and developmental processes including leaf size, bud dormancy, seed maturation, size of guard cells, and internodes in concert with various other phytohoromones, including ethylene, brassinosteroids, and auxins (Achard et al., 2006, Raghavendra et al., 2010). The recent discovery of a core signaling complex for ABA perception has been covered in several reviews, which have discussed the physiological and molecular aspects of ABA signal transduction as well as the functions of target genes and transcription factors implicated in ABA signaling (Ben-Ari, 2012; Ye et al., 2012; Ding et al., 2013; Danquah et al., 2013). There is significant amount of information available on the regulation of gene expression at the transcriptional level by ABA (Kim, 2014). However, the importance of post-transcriptional regulation of gene expression has only been relatively recently realized with the identification of large number of transcripts with no apparent coding ability (Bonnet et al., 2006; Sunkar, 2010). These transcripts otherwise referred to as the “dark matter” or “molecular fossils” are ncRNAs with specialized biological roles (Carninci et al., 2005; Kapranov et al., 2007). ncRNAs include the highly abundant and functional RNAs including transfer RNAs (tRNAs), ribosomal RNAs (rRNAs), small nuclear RNAs (snRNAs), small nucleolar RNAs (snoRNAs), piwi-interacting RNAs (piRNAs), extracellular RNAs (exRNAs), short interfering RNAs (siRNAs), microRNA

Mechanism of Plant Hormone Signaling under Stress, First Edition, Volume 1. Edited by Girdhar Pandey. © 2017 John Wiley & Sons, Inc. Published 2017 by John Wiley & Sons, Inc.

k

k

k

Ion channels

Receptor like kinases

Histidine kinases

Generation of secondary messenger: Ca2+, InSP, ROS, ABA

Regulatory Molecules

Membrane Receptors

Activation of singaling cascades

Mechanism of Plant Hormone Signaling under Stress

Perception of extracellular stress signal

272

Second round of signaling

ABA SA JA Ethylene

Stress responsive genes

Gene products

Plant adaptation to strees conditions

Figure 11.1 (Plate 13) Involvement of ABA through many rounds of signaling to induce various stress responsive gene products for plant adaption to environmental stress. ABA, abscisic acid; SA salicylic acid; JA, jasmonic acid; InSP, inositol triphosphate; ROS, reactive oxygen species. (See insert for color representation of this figure.)

k

k (miRNAs), and trans acting siRNAs (tasiRNAs). A majority of these ncRNAs are antisense or are generated from the intergenic or promoters of functional genes (Jacquier, 2009) and are classified into short (20 0nt) ncRNAs (lncRNAs) based on their size. Origin of lncRNAs can be intronic, exonic, intragenic, intergenic, from promoter regions, enhancer sequences or 3’- and 5-UTR regions (Geisler and Coller, 2013). lncRNAs antisense to known protein coding transcripts are referred to as NATs (natural antisense transcripts) and are further classified as cis-NATs, trans-NATs, and pseudogenes (Nie et al., 2012, Liu et al., 2015a). These ncRNAs have been recognized as the new modulators of stress tolerance in plants by controlling the expression of biotic and abiotic stress responsive genes (Covarrubias and Reyes, 2010). Short ncRNAs like miRNAs, siRNAs, and piwiRNAs have been implicated in transcriptional and post-transcriptional regulation of gene expression (Ghildyal and Zamore, 2009; Chitwood and Thimmermans, 2010). Modulation of ncRNAs influences the accumulation of target transcripts and directly contributes to the adaptive responses of plants to stress (Shukla et al., 2008). Other reports have suggested that ncRNAs are integral members of gene regulatory networks mostly targeting transcription factors, in response to phytohoromones like ABA (Reyes and Chua, 2007; Li et al., 2008; Liu et al., 2009). Recently, lncRNAs have also been observed to function as important participants in the regulation of biotic and abiotic stress responses in various plants (Zhu et al., 2014; Shuai et al., 2013; Li et al., 2014). In this article, we review available information on the biogenesis of ncRNAs, ABA signaling networks, and the interplay between ncRNAs and ABA within the context of plant growth and regulation as well as stress responses.

k

k

11 Signaling and Modulation of Non-Coding RNAs by ABA

273

11.2 Biogenesis of Non-Coding RNAs in Plants

k

Although, both small and lncRNAs have been demonstrated to play similar roles in the regulation of gene expression and stress responses, their biogenesis is quite different. miRNAs are small regulatory sequences of 20–22 nucleotides that are processed from single stranded hairpin precursor encoded by endogenous miRNA (MIR) genes (Khraiwesh et al., 2012; Sunkar et al., 2012). During miRNA biogenesis, RNA Polymerase II (RNA Pol II) mediates the synthesis of primary miRNA transcripts (pri-miRNAs) from nuclear encoded MIR genes. The RNA binding protein DAWDLE (DDL) interacts with the ribonuclease Dicer-like 1 (DCL1) and stabilizes the pri-miRNAs in the dicing bodies (D-bodies) of the nucleus (Ha and Kim, 2014). DCL1 together with the RNA binding protein Hyponastic Leaves 1 (HYL1) and zinc-finger protein SERRATE (SE) forms a nuclear cap-binding complex and processes the pri-miRNAs into a hairpin precursor (pre-miRNAs) (Papp et al., 2003). The length of these precursor RNAs range from 60 to 300 nt in plants and exhibit greater variability when compared to their animal counterparts (Bartel and Bartel, 2003). Subsequently, the hairpin precursor is cleaved into a mature miRNA duplex comprising of miRNA and the miRNA* sequences, each of 20–22 nt in length. This is followed by addition of methyl groups to the 3’ nucleotide of the miRNA duplex by Hua Enhancer 1 (HEN1) protein. The methylation of the miRNA duplex provides stability by blocking the uridylation and 3’-exonuclease degradation of miRNAs (Yu et al. 2005). The methylated duplex is then exported into the cytoplasm by a nuclear exportin called HASTY1 (HST1) (Kim et al. 2004b; Park et al. 2005). The two strands of the duplex are separated by an unknown helicase and one of the strand (mature miRNA) binds to the cytoplasmic Argonaute (AGO) protein from the RNA induced silencing complex (RISC). The activated RISC subsequently facilitates the binding of the mature miRNA with the target mRNA transcript through sequence complementarity, thereby leading to cleavage or translational repression of the target genes (Naqvi et al., 2012). siRNAs exhibit similar regulatory functions as that of miRNAs. However, a distinctive variation can be observed in their origin, structure, and the proteins associated with their biogenesis. Long and double stranded siRNA precursors are either generated by the expressed products of the host genome or from external sources triggered through transgene insertion or viruses (Vazquez and Hohn, 2013). Ta-siRNAs are generated from primary transcripts encoded by TAS genes (Peragine et al., 2004). Primary TAS RNAs are uncapped and the 3’polyadenylated end is lost through a miRNA directed cleavage (Vazquez et al., 2004). The single stranded TAS RNA is then duplicated into double stranded siRNA precursors by a RNA-dependent DNA polymerase, RDR6 (Yoshikawa et al., 2005). Subsequently, it is processed by DCL4 in a phased way to generate 21–22 nt-siRNAs that target mRNAs similarly to miRNAs (Chen, 2009). In contrast, repeat associated siRNAs (ra-siRNAs) are usually generated from the transposable and repetitive sequences of the genome (Vazquez 2006). Single stranded RNA precursors for ra-siRNAs are transcribed from these heterochromatic loci by a DNA dependent RNA polymerase (Pol IV) (Vazquez 2006). The ssRNA precursors are processed by RDR2 and DCL3 generating double stranded 24 nt ra-siRNAs that causes DNA and histone methylation through the action of AGO4, methylases, Pol V and chromoproteins (Matzke et al., 2009; Vazquez and Hohn, 2013). In addition to this, the overlapping dsRNA regions formed by natural antisense transcripts (NATs)

k

k

k

274

k

Mechanism of Plant Hormone Signaling under Stress

are sometimes processed by DCL1/DCL3 proteins resulting in the formation of a third group of si-RNAs called nat-siRNAs (Zhang et al. 2012). However, the detailed mechanism of nat-siRNAs biogenesis is still unknown. Although, the repertoire and functional classifications of lncRNAs is still at its infancy in plants, recent reports have revealed critical information related to its biogenesis. Being the by-product of the Polymerase II (Pol II) activity, similar to mRNAs, lncRNAs are also capped at the 5’ end and characterized by a polyadenylated tail at the 3’ end (Liu et al., 2012). Available evidence indicates that the transcription of lncRNA genes also requires transcription and elongation factors as well as complexes for histone modification (Kim et al. 2011; Wang et al., 2014; Di et al., 2014). More than 50% of lncRNAs in plants contain introns, which are longer than the protein coding transcripts (Liu et al., 2015a,2015b). Therefore, splicing is a prerequisite for the production of lncRNA transcripts similar to mRNAs. Liu et al. (2012) reported that the biogenesis of intergenic lncRNAs is regulated by SERRATE protein together with the cap binding proteins, CBP20 and CBP80. The knocking out of any of these proteins resulted in un-spliced lncRNA sequences (Liu et al., 2012). In addition, lncRNA transcription is also monitored by similar surveillance strategies that determine the quality of mRNA transcripts (Liu et al. 2015a,b). For example, the UP-frame shift (UPF) proteins maintain the quality of lncRNA transcripts similar to mRNA through the non-sense-mediated mRNA decay pathway (Kim et al., 2009). Absence of UPF proteins in knock out mutants of Arabidopsis resulted in anomalous noncoding transcripts from the intergenic and antisense regions of the DNA (Kurihara et al., 2009). Additional reports have revealed that other mRNA degradation pathways also monitor the characteristic features of lncRNAs in plants although molecular details are yet to be ascertained (Van Dijk et al., 2011, Flynn et al., 2011). All these reports suggest that the biogenesis of lncRNA follows similar mechanism to that which governs the synthesis of mRNA in plants.

11.3 Mode of Action of ncRNAs in Plants 11.3.1 Mechanism of Action in Small RNAs

ncRNAs are defined riboregulators that mediate the expression of genes at the transcriptional as well as post-transcriptional levels. Of the various types of ncRNAs, the regulation of gene expression by miRNAs has been investigated more thoroughly. miRNAs have been identified as prominent determinants of post-transcriptional gene regulation through target mRNA cleavage or translational inhibition (Sunkar et al., 2012). The import of AGO proteins into the nucleus directs the silencing of the target gene. The PIWI domain of AGO forms an RNAse-H fold with an endonuclease activity that cleaves the complementary mRNA target of the loaded miRNA (Liu et al., 2004). miRNAs can be complementary to any part of the target sequence and are reported to have binding sites in 5’ untranslated region (5’ UTR), open reading frames (ORFs), or 3’ UTRs (Doench and Sharp, 2004). The endonuclease activity of AGO has been demonstrated in several plants including Arabidopsis and Nicotiana (Rogers and Chen, 2013). mRNA degradome and ligation mediated rapid amplification of cDNA ends (RLM-RACE) analysis in many plants has demonstrated that a large number of miRNA targets undergo cleavage (Gregory et al., 2008). Plant miRNAs are

k

k

k

11 Signaling and Modulation of Non-Coding RNAs by ABA

k

highly complementary to their target RNA and this complementarity determines the effectiveness of the endonuclease activity exhibited by the AGO proteins (Mallory et al., 2004). Thus, the dicing of target mRNA is the primary mode of action exhibited by miRNA in plants. The recent identification of Arabidopsis mutants exhibiting miRNA-mediated gene repression at the protein and not mRNA levels together with the insensitivity of this mechanism to AGO directed cleavage suggest that miRNA directed translational repression is as distinctive as target cleavage towards regulation of gene expression (Iwakawa and Tomari, 2013). Results from a recent study indicate that translational repression occurs on the endoplasmic reticulum (ER) (Li et al., 2013). It was reported that, an ALTERED MERISTEM PROGRAM1 (AMP1) protein present on the surface of the ER mediates the disproportionate effect of miRNA towards repression of the target gene. The group demonstrated that AMP1 together with AGO bound miRNA prevents the binding of target mRNA to the membrane bound polysomes, thereby inhibiting the translation of the target gene (Li et al., 2013). Although several other mechanisms of miRNA mediated translational repression including prevention of initiation and ribosome separation has been proposed in animals (Fabian et al., 2010), they are yet to be demonstrated in plants. Besides, additional silencing effectors such as GW (Glycine and Tryptophan)-repeat proteins and the decapping proteins (DCP1 and DCP2) have been presumed to be involved in the possible degradation of some miRNA targets (Motomura et al., 2012; Zekri et al., 2013). Nevertheless, the high density of target transcripts around the polysomes in the Arabidopsis mutant amp1, suggests that miRNAs play a significant role in inhibiting the translational initiation of the target mRNAs (Li et al., 2013). In addition to post-transcriptional silencing, some small RNAs also undergo transcriptional silencing in both plants and animals (Rogers and Chen, 2013). The DCL3 dependent ra-siRNAs causes the methylation of lysine at the ninth position of histone H3 (H3K9) leading to systemic silencing of the target gene (Zilberman et al., 2004). The ra-siRNA/AGO4 RISC directs the DNA methyltransferase 1 (MET1) and H3K9 methyltransferases towards the target gene where they bring about the RNA directed DNA methylation (Law and Jacobsen, 2010). Similarly, a DCL3 dependent miRNA together with AGO4 forms an RISC that activates the methylation at the cytosine position of MIR genes as well as target loci (Wu et al., 2010). All these observations suggest that small RNAs exhibit various mechanisms to regulate the functional expression of genes. 11.3.2 Mechanism of Action of lncRNAs

lncRNAs are pervasive and exhibit a myriad of biological functions. The molecular basis of lncRNA action can be classified into four types. Firstly, lncRNAs serve as molecular signals and exhibit cell specific expression in response to diverse stimuli and developmental cues under significant transcriptional control (Wang and Chang, 2011). For instance, in Arabidopsis, cold stimulus triggers histone methylation leading to epigenetic repression of the floral repressor, FLOWERING LOCUS C (FLC) (Bastow et al., 2004). Swiezewski et al. (2009) identified a lncRNA named COOLAIR that silences the sense FLC transcription. Heo and Sung (2011) identified another lncRNA termed COLD-ASSISTED INTRONIC NON-CODING RNA (COLDAIR) responsible for vernalization mediated epigenetic repression of FLC. Together, they appear to serve as signals of transcriptional activity which initiates vernalization. Secondly, lncRNAs can act

k

275

k

k

276

k

Mechanism of Plant Hormone Signaling under Stress

as decoys and interact with transcription factors and other proteins thereby taking them away from the chromatin region and regulate the transcription either positively or negatively (Kim and Sung, 2012). In Medicago truncatula, the lncRNA Enod40 expressed during early nodulation acts as a molecular cargo for MtRBP1 (Medicago truncatula RNA binding protein) and relocalizes it from the nuclear chromatin regions to the cytoplamic arena during nodulation (Campalans et al., 2004). Thirdly, lncRNAs also serve as guides by directing the localization of specific ribonucleoprotein complexes to their target sites for possible functional expression (reviewed by Hung and Chang, 2010). RepA RNA, a 1.6 kb sequence from the 5’ end of lncRNA Xist guides the polycomb repressive complex 2 (PRC2) to the mammalian X inactivation center (Xic) locus causing H3K27 trimethylation and silencing of one of the two X chromosomes in female mammals (Sun et al. 2006). The lncRNA COLDAIR in Arabidopsis also acts a guide in cis by bringing the PRC2 to the chromatin of FLC which represses its transcription through histone modification during vernalization (Heo and Sung, 2011). Lastly, lncRNAs also act as scaffold like proteins and provide binding sites for multiple molecular components involved in diverse biological signaling processes (Spitale et al., 2011). For instance, HOTAIR, a lncRNA from the homeobox transcription factor cluster (HOXC) locus in humans acts as a platform for different chromatin modifying complexes resulting in the suppression of gene expression through multiple mechanisms at the same time (Tsai et al. 2010). In plants, there is no evidence to support the role of lncRNA acting as scaffold and this mode of action of lncRNA is yet to be confirmed in plants. In addition, several lncRNAs also exhibit a combinatorial mechanism in executing a specific biological function. For example, the COLDAIR and COOLAIR lncRNAs serve both as a signals as well as guide for epigenetic repression of the floral repressor in Arabidopsis. With the advent of new sequencing strategies and growing interest in this area of research, new mechanism of action of lncRNAs may be defined in future towards the regulation of gene expression under different developmental and stress conditions.

11.4 ABA Signaling in Plants 11.4.1 ABA Biosynthesis, Transport, and Catabolism

Stress induced activation of ABA biosynthetic genes are usually regulated through a calcium dependent phosphorylation process (Chinnusamy et al., 2004). ABA being a plastid isoprenoid, is synthesized from an isopentenyl (IPP) precursor that undergoes a sequential cylization and hydroxylation leading to the production of β-carotene. Figure 11.2 (Plate 14) provides a comprehensive overview of ABA biosynthesis. ABA synthesized in the vasculature passes through an integrated cellular transport system and exerts its effects on various tissues including stomatal guard cells (Boursiac et al., 2013). ABA accumulation in the cell negatively affects the activation of ABA biosynthetic genes and stimulates ABA catabolic enzymes leading to the degradation of excessive ABA (Verslues et al., 2006). Cellular ABA concentration is often lowered by either hydroxylation or conjugation with sugar molecules to form inactive compounds (Nambara and Marion-Poll, 2005). The ABA hydroxylation pathway involves the oxidation of methyl groups at the C-7, C-8, or C-9 position of the ring structure, which triggers further inactivation steps (Nambara and Marion-Poll, 2005). The

k

k

k

11 Signaling and Modulation of Non-Coding RNAs by ABA

277

Isopentenyl pyrophosphate (IPP) GGPS

GGDP PSY

Phytoene PDS Z-ISO ZDS CrTISO

β-Carotene B

Y LC

Lycopene CHLO

Zeaxanthin

ROPL

ZEP1

VDE

Antheraxanthin

AST

ZEP1

Neoxanthin

NSY

VDE

Dihydrophaseic acid

Violaxanthin

ISO

ISO

9-cis Neoxanthin

9-cis violaxanthin

Phaseic acid

NCED

8-hydroxy ABA CYTOSOL

Xanthoxin ABA-8’H ABA2

k

Abscisic aldehyde

AAO3

ABA glycosyl esters ABA-GT

ABA

Figure 11.2 (Plate 14) ABA metabolic pathway in higher plants. The isopentenyl diphosphate (IPP) synthesized via the MEP pathway passes through a series of cyclization and hydrozylation resulting in β-carotene. β-carotene leads to the formation of xanthophylls, zeaxanthin, which is the first oxygenated carotenoid. ABA is synthesized through oxidative cleavage of neoxanthin and conversion of xanthoxin to abscisic aldehyde. The ABA synthesized in the cytosol is either hydroxylated into dihydrophaseic acid or conjugated with glucose forming the ABA glucosylesters. The enzymes catalyzing various steps are marked in red. GGDP, geranylgeranyl diphosphate; GGPS, geranylgeranyl diphosphate synthase; PDS, phytoene desaturase; Z-ISO, ζ-carotene isomerase; ZDS, ζ-carotene desaturase; CRTISO, carotene isomerase; LCYB, β-cyclase; ZEP, zeaxanthin epoxidase; VDE, violaxanthin de-epoxidase; NSY, neoxanthin synthase; NCED, 9-cis-epoxycarotenoid dioxygenase; ABA2, short-chain alcohol dehydrogenase; AAO3, abscisic aldehyde oxidase; ABA-8’H, ABA-8’hydroxylase; ABA-GT, ABA-glucosyl transferase. (See insert for color representation of this figure.)

8’hydroxylation is the predominant pathway for ABA catabolism, which is catalyzed by a cytochrome P450 monoxyenase, also known as ABA8’-hydroxylase (ABA-8’H), resulting in the formation of highly unstable 8’hydroxy ABA (Saito et al., 2004). Cellular ABA and hydroxy ABA also bind with glucose at the C-1 hydroxyl group leading to the formation of many inactive conjugates (Dietz et al., 2000). ABA-glucosyl ester (ABA-GE) is the most prominent ABA catabolite, which is formed by the conjugation of ABA with UDP D-glucose in presence of ABA glucosyltransferase (AOG) (Xu et al. 2002). The inactive ABA-GE is accumulated in the vacuole for long-term storage (Jiang and Hartung, 2008). Under dehydration stress, ABA is released from the glucosyl ester by β-Glucosidases (Dietz et al., 2000; Lee et al., 2006; Xu et al., 2012). All these studies clearly indicate that ABA biosynthesis and regulation is a complex mechanism.

k

k

k

278

Mechanism of Plant Hormone Signaling under Stress

11.4.2 ABA Signal Transduction

k

Recent evidence suggests that ABA perception and signal transduction is achieved by specific interaction between three classes of proteins isolated from Arabidopsis (Park et al., 2009, Ma et al., 2009, Umezawa et al., 2009). These includes the (i) Pyrabactin Resistance 1 (PYR1) and/or PYR1-like protein (PYL) and/or Regulatory component of the ABA receptor (RCAR), (ii) Protein phosphatase 2C (PP2C), and (iii) Sucrose non-fermenting-1(SNF1) related protein kinase 2 (SnRK2s). Quadrapule mutants of pyr1/pyl1/pyl2/pyl4 resulted in poor sensitivity to ABA during germination and root growth while overexpression of PYL5 and PYL8 led to improved ABA responses suggesting their direct involvement in ABA signaling (Gonzalez-Guzman et al., 2012; Santiago et al., 2009). Furthermore, the stomatal conductance gradually increased with triple, quadruple, pentuple, and sextuple mutants suggesting a quantitative regulation of stomatal closure by PYR/PYL/RCAR family of proteins. The first two PP2C group A genes namely ABA-Insensitive 1 (ABI1) and ABI2 and two ABI homologues (HAB1 and HABI2) have been identified as negative regulators of ABA-induced stress signaling through regulation of MAP kinase pathways (Danquah et al., 2013). Genetic evidence for the involvement of PP2Cs in ABA signaling came from the fact that the dominant mutants, abi1-1 and abi2-1, exhibited an ABA-insensitive phenotype including reduced dormancy of seeds, abnormal regulation of stomata, and poor response to drought (Meyer et al., 1994; Rodriguez et al., 1998; Hoth et al., 2002; Robert et al., 2006). Structural analyses demonstrated that ABA binds to PYR/PYL/RCARs under osmotic stress leading to conformational changes and exposes the recognition site for suitable binding of PP2Cs (Melcher et al., 2010; Yin et al., 2009; Cutler et al., 2010). Subclasses II and III of the SnRK2 family are positive regulators of ABA and osmotic stress tolerance (Boudsocq et al., 2004). PKABA1 from wheat and AAPK from Vicia faba have been reported to be among the first SnRK2 kinases involved in ABA signaling (Gomez-Cadenas et al., 1999; Li et al., 2000). Triple mutant snrk2.2/snrk2.3/ost1 showed severe ABA-insensitivity with respect to seed germination, root growth and water loss (Fujita et al., 2009; Nakashima et al., 2009a). Yeast two-hybrid assays revealed positive interactions between SnRK2/OST1 and ABI1 related to a conserved domain II motif in the C-terminus of SnRK2s (Yoshida et al., 2010). These data suggest that the two subclasses of SnRK2 act as major constituent of the core ABA signaling complex. Thus, ABA signaling involves a two-way interaction of PP2Cs with PYR/PYL/RCARs and SnRK2s. 11.4.3 Cis-Acting Elements and Transcription Factors in ABA-Mediated Gene Expression

ABA mediates the expression of stress responsive genes through a transcriptional regulatory network of cis-acting elements and transcription factors (TFs). ABA-responsive element (ABRE) is one of the extensively studied cis-acting elements involved in ABA-induced gene expression. These elements belong to the G box family (PyACGTGGC) and contain an ACGT core recognized by basic leucine zipper (bZIP) transcription factors, ABRE binding protein (AREB)/ABRE-binding factor (ABF) (Choi et al., 2000; Uno et al., 2000). Two ABRE motifs have been found to be involved in the regulation of ABA-responsive expression of Arabidopsis stress responsive gene rd29B, which encodes a LEA-like protein (Uno et al., 2000). The AREB/ABF subfamily of bZIP TFs consists of nine members in Arabidopsis each with three N-terminal and one

k

k

k

11 Signaling and Modulation of Non-Coding RNAs by ABA

k

C-terminal conserved ABRE domains (Jakoby et al., 2002; Suzuki et al., 2003; Fujita et al., 2011). Among these, AREB1/ABF2, AREB/ABF4, and ABF3 have been demonstrated to be induced in vegetative tissues in response to dehydration, high salinity, or ABA treatment (Kim et al., 2004a; Fujita et al., 2005). The suppression of the transactivation of a reporter gene by AREB1 and AREB2 in ABA-deficient aba2 and ABA-insensitive abi1 mutants and extreme enhancement in the ABA hypersensitive era1 mutants suggest that ABA is highly essential for their activation (Uno et al., 2000). Improved drought tolerance has been reported in rice and soybean overexpressing AREB1 (Oh et al., 2005, Barbosa et al., 2013). Recent studies have revealed that SNF-related protein kinase 2 protein (SnRK2s) such as SRK2D/SnRK2.2, SRK2E/SnRK2.6 play a crucial role in ABA-dependent signaling network through phosphorylation of AREB/ABFs (Fujita et al., 2009; Nakashima et al., 2009a; Umezawa et al., 2013). For further comprehensive information about the role of ABRE/ABF in ABA signaling, readers can refer to the following reviews (Cutler et al., 2010; Raghavendra et al., 2010; Umezawa et al., 2010; Nakashima and Yamaguchi-Shinozaki, 2013). MYB is another class of TFs, which participates in ABA signaling pathways. These MYB proteins belong to R2R3-type MYB family and share conserved MYB binding domains (Kranz et al., 1998; Stracke et al., 2001). ABA-mediated overexpression of RD22, a drought inducible gene, has been reported under severe water deficit condition (Shinozaki and Yamaguchi-Shinozaki, 2000). MYC/MYB TFs, RD22BP1 (AtMYC2) and AtMYB2, bind to the cis-elements of RD22 promoter resulting in its activation (Abe et al., 1997; 2003). ABA accumulation resulted in increased levels of MYC and MYB proteins indicating that both these TFs play a role in the later stages of stress responses (Abe et al., 2003). Arabidopsis overexpressing MYB and MYC showed hypersensitive response to ABA as well as improved osmotic stress tolerance when compared with wild type plants (Abe et al., 2003). Other MYB TFs also participate in the interaction between ABA and other stress signaling pathways. For instance, MYB102 plays a role in mediating responses to ABA, jasmonic acid (JA), salinity, and wounding stress via conserved promoter elements, for example, ABRE-CE1, W-box, and other interacting factors (Denekamp and Smeekens, 2003). Thus it is clear from reports in the literature that the MYB family of TFs functions as key mediators of ABA responsive genes and may be involved in the interaction between ABA and other signaling pathways. NAC-family consists of NAM (Non apical meristem), ATAF1-2 (Arabidopsis transcription activation factor), and CUC2 (Cup-shaped cotyledon), which contains a similar DNA-binding domain. More than 100 genes have been identified in Arabidopsis and Oryza sativa, which code for NAC TFs (reviewed in Nakashima et al., 2012). Members of this family (ANAC019, ANAC055, ANACO72/RD26, OsNAC6/SNAC2, ONACo45) bind to the NACR (NAC recognition sequence; CACG core) (Nakashima et al., 2009b). The enhanced expression of these genes resulted in increased drought tolerance in Arabidopsis and rice vegetative tissues (Nakashima et al., 2009b). Under stress conditions, ANACO72/RD26 acts as a positive regulator of ABA signaling and its expression is induced by drought, salinity, ABA, and JA (Fujita et al., 2004; Jensen et al., 2010). Overexpression of ANACO72/RD26 caused ABA hypersensitivity in transgenic plants, whereas, transgenic plants with an RD26 dominant repressor were found to be insensitive to ABA (Jensen et al., 2010). Transcriptome analysis of ANACO72/RD26 overexpressing and RD26 repressor lines revealed that many ABA- and stress-related genes were upregulated in overexpressers, while these were repressed in the RD26

k

279

k

k

280

Mechanism of Plant Hormone Signaling under Stress

repressor lines. In addition, typical ABA-inducible genes such as LEA (Late Embryogenesis Abundant protein), RD (Responsive to Dehydration), COR (Cold regulated), and KIN (cold induced) were not found to be regulated by RD26, while many JA-inducible genes were targets of RD26 (Fujita et al., 2004). Thus, RD26 plays a dual role in the regulation of ABA and JA signaling pathways. ABA has also been shown to activate the expression of AtNAP (NAC TF in Arabidopsis) and a senescence-associated gene 113 (SAG113) (localized in Golgi apparatus. These reports suggest that the NAC TFs play a significant role in regulating ABA induced genes in regulating drought and salinity stress response. 11.4.4 ABA-Mediated Stomatal Closure During Pathogen Attack

k

Plants have evolved several mechanisms to prevent and protect them from a variety of pathogens. Bacterial pathogens use natural openings such as stomata, hydathodes, and lenticels to establish themselves in host plant, and stomata have been found to be their major point of entry (Melotto et al., 2008). Stomatal closure for water conservation during drought has been found to be regulated by ABA, as mentioned in an earlier section. The cellular and molecular mechanisms involved in ABA-induced stomatal closure during drought stress has been extensively reviewed (Assmann, 2003; Wasilewska et al., 2008; Cutler et al., 2010; Hubbard et al., 2010; Popko et al., 2010). Melotto and colleagues found that stomata in Arabidopsis close in response to bacteria and pathogen associated molecular pattern (PAMP) (Melotto et al., 2006). However, stomatal closure was not induced by PAMPs in ost1 mutant (which does not respond to ABA) and ABA-deficient aba3-1 mutant, indicating that PAMP induced stomatal closure requires proper functioning of the ABA signal transduction pathway (Melotto et al., 2006). Thus, ABA has been implicated to play a positive role in bacterial resistance through mediating stomatal closure.

11.5 Non-Coding RNAs and ABA Response 11.5.1 MiRNAs in ABA Signaling

As discussed in the previous sections, ABA is a key phytohormone that regulates the expression of several stress-induced genes especially under stress conditions (Wilkinson and Davies, 2002). Many recent reports suggest major involvement of miRNAs and their cognate targets in ABA mediated stress responses (Khraiwesh et al., 2012; Ding et al., 2013) (Table 11.1). Early evidence suggests that loss-of-function mutation in key genes of the miRNA biogenesis pathway leads to the development of ABA hypersensitive mutants (Lu and Fedoroff, 2000). The hyponastic leaves 1 (hyl1), dicer like 1(dcl1), and Hua enhancer 1(hen1) mutants showed high sensitivity to ABA during germination while Serrate (se) and Hasty (hst) mutants were hypersensitive to ABA, sensitive to high salt concentration and exhibited open stomata, even under water deficit conditions in Arabidopsis (Zhang et al., 2008), indicating a clear association between the defective miRNAs in the mutants, and ABA responses in Arabidopsis. MiR417 is one of the earliest known ABA induced miRNAs that plays a role as a negative regulator of seed germination under salt stress (Jung and Kang, 2007). MiR417 expresses both spatially and temporally, and is regulated by salt stress, dehydration, and

k

k

k

11 Signaling and Modulation of Non-Coding RNAs by ABA

281

Table 11.1 Non coding RNAs associated with ABA signaling in plants

k

ncRNAs

Species

Target genes

Reference

miR159

A. thaliana

MYB transcription factor Reyes and Chua 2007

miR169

A. thaliana M. truncatula Glycine max

Nuclear factor YA

Li et al. 2008; Wang et al. 2011; Ni et al. 2013

miR167

A. thaliana Zea mays

Auxin response factor Phospholipase D

Liu et al. 2008; 2009; Wei et al. 2009

miR160

A. thaliana

Auxin response factor

Liu et al. 2007

miR394

G. max

F-box protein

Ni et al. 2012

AtTAS3

A. thaliana

Auxin response factor 4

Ben Amor et al. 2009

TAS1, TAS2, TAS3

A. thaliana

–

Matsui et al. 2014

OsTAS1

Oryza sativa

OsRDR6

Yang et al. 2008

Ptc-LncRNA2752

Populus trichocarpa

Nuclear factor YA

Shuai et al. 2014

ABA. Overexpression of miR417 in Arabidopsis resulted in ABA hyposensitivity and poor seed germination (Jung and Kang, 2007). Target analysis revealed that inhibition of the target mRNA encoding a C2 domain containing protein was caused due to translational repression by miR417. Reyes and Chua (2007) reported that ABA induced miR159 causes the cleavage of MYB33 and MYB101transcripts, during Arabidopsis seed germination. Overexpression of miR159 in the presence of ABA decreased the abundance of MYB33 and MYB101 transcripts, leading to ABA hyposensitivity while transgenic plants with cleavage resistant forms of MYB33 and MYB101 were hypersensitive and drought tolerant (Reyes and Chua, 2007). Consistently, plants inserted with Turnip Mosaic Virus (TuMV) P1-HC pro viral protein, which inhibits miR159 were hypersensitive to ABA, while null mutant of myb33 and myb101 were insensitive to ABA (Reyes and Chua, 2007). These studies have suggested that MYB TFs positively regulate osmotic stress tolerance and that miR159 directly influences the ABA mediated signaling by modifying the abundance of target MYB transcript in Arabidopsis. Liu et al. (2009) reported that three miRNAs: miR167, miR162, and miR413, were differentially regulated by ABA in rice. Gene expression studies showed that both miR167 and miR162 were downregulated while miR413 was upregulated within 4 h of ABA treatment in rice seedlings. Previously, miR167 was also reported as being upregulated under water deficit conditions in Arabidopsis (Liu et al. 2008). Potential targets for miR167 include Phospholipase D (PLD), Nucleotide binding site-leucine rich repeat (NBS-LRR) disease resistance protein, and auxin response factors (Liu et al., 2008; Wei et al., 2009; Shivaprasad et al., 2012). In Zea mays, downregulation of miR167d was associated with overexpression of PLD transcripts under drought stress (Wei et al., 2009). PLD was reported to produce phosphatidic acid (PA), which binds to ABI1 plus PP2C or interacts with GTP-binding protein alpha subunit (GPA1) to mediate ABA induced stomatal closure in guard cells (Zhang et al., 2005; Mishra et al., 2006). Hence, it appears that endogenous levels of PLD transcript are regulated by miR167d further demonstrating a clear role for miRNAs in the mediation of ABA-induced stress responses.

k

k

k

282

k

Mechanism of Plant Hormone Signaling under Stress

There are many other examples of miRNAs modulating the abundance of ABA-responsive transcripts in response to stress. For instance, miR169a regulates the expression of nuclear transcription factor Y alpha 5 (NFYA-5) TF in Arabidopsis during ABA-dependent drought stress responses (Li et al., 2008). NFYA is a ubiquitous TF with specific roles in plant development and stress responses (Ceribelli et al., 2008). MiR169a binds to a target site in NFYA-5 mRNA resulting in repression of its translation. During ABA-dependent drought responses, miR169a expression is inhibited leading to the accumulation of NFYA-5 mRNA. Analysis of nfya-5 mutant lines reported high sensitivity to drought. Similarly, Arabidopsis lines overexpressing miR169a resulted in high water loss due to prolonged stomatal opening (Li et al., 2008). In contrast, plants overexpressing NFYA-5 displayed reduced leaf water loss and were more resistant to drought stress (Li et al. 2008). Microarray analysis revealed that NFYA-5 increases the expression of several drought and oxidative stress responsive genes (Li et al., 2008). Based on the observation that NFYA-5 and miR169 are highly conserved across plant types (Jones-Rhoades and Bartel, 2004), it may be concluded that the post-transcriptional regulation of NFYA-5 by miR169 is a widespread strategy for mediating ABA dependent drought stress responses in plants. Recent genome-wide sequencing studies have revealed that the expression of miR169 along with seven other miRNAs is inhibited under drought stress in M. truncatula (Wang et al., 2011). On the contrary, Zhou et al. (2007) reported significant accumulation of miR169g, especially in the root tissues, under drought stress in rice. Cis-element analysis revealed the presence of two dehydration responsive elements (DREs) in the upstream region of the miR169g suggesting that the Dehydration Responsive Element-Binding factors (DREB) directly regulates the expression of miR169g. In another study, drought stress led to the accumulation of Sly-miR169c in tomato that consequently resulted in the inhibition of the targets, namely three nuclear factor-Y subunits (SlNF-YA1/2/3) and one multidrug resistance-associated protein (SlMRP1) (Zhang et al., 2011). MRP genes have been reported to control stomatal movement under osmotic stress (Klein et al., 2004). Transgenic plants overexpressing Sly-miR169c showed reduced transpiration rate, low water loss, and enhanced drought tolerance suggesting a negative correlation between Sly-miR169c and stomatal movement during drought responses (Zhang et al., 2011). Glycine max nuclear transcription factor alpha 3 (GmNFYA3), a gene encoding NFYA TF has been recently identified to be induced by ABA and abiotic stresses (Ni et al., 2013). Overexpression of GmNFYA3 in Arabidopsis resulted in high sensitivity to exogenous ABA, reduced water loss, and increased expression of ABA biosynthetic and stress responsive genes (Ni et al., 2013). Co-expression and 5’ RACE assay of GmNFYA3 and miR169 in tobacco plants indicated that miR169 is responsible for in vivo cleavage of GmNFYA3 mRNA (Ni et al., 2013). These finding suggest that ABA plays a significant role in the regulation of miR169 in various plant species and, in turn, the modulation of drought stress tolerance. In another example, miR394 isolated from G. max also promoted ABA induced drought tolerance (Ni et al., 2012). Over expression of GmamiR394a in A. thaliana inhibited the accumulation of target gene encoding a putative F-box protein. It has already been demonstrated that miR394a targets At1g27340 in Arabidopsis (Jones-Rhoades and Bartel, 2004). The increased abundance of GmaMIR394a in transgenic Arabidopsis plants rapidly reduced At1g27340 transcript levels (Ni et al., 2012). F-box genes reduce the sensitivity to ABA and abiotic stress tolerance while F-box mutations cause hypersensitive ABA

k

k

k

11 Signaling and Modulation of Non-Coding RNAs by ABA

k

response and stomatal closure (Yan et al., 2011). Based on the aforementioned studies, it can be concluded that ABA-induced GmaMIR394a, downregulates the target F-box gene, which acts as a negative regulator of drought responses. In yet another example, it has been demonstrated that Fry1, an ABA hypersensitive mutant, had increased endogenous levels of miR393 following ABA treatment, suggesting that ABA also regulated the expression of this miRNA (Chen et al., 2012). As a corollary, miR393 expression was observed to be repressed in the ABA-insensitive mutant abi1 (Chen and Xiong, 2010) providing additional evidence that ABA is involved in the regulation of its expression. Thus it is clear that ABA plays a significant role in modulating the expression of miRNAs with implications on ABA-regulated gene expression in response to abiotic stress. MicroRNAs have also been observed to modulate the expression of auxin response factors (ARFs) and to play significant role in auxin-ABA interaction. For instance, miR160 targets ARF10 and ARF16 while miR167 targets ARF6 and ARF8 under drought stress (Teotia et al., 2008). Arabidopsis plants with silent mutations in the miR160 target site, ARF10, exhibited improper germination, developmental chimeras, and ABA hypersensitivity (Liu et al., 2007). Microarray analysis revealed upregulation of several ABA responsive genes in the arf10 mutants during germination (Liu et al., 2007). Furthermore, gene expression analyses demonstrated that miR167 is downregulated by ABA treatment, which led to concomitant increase of ARF6 mRNAs in rice seedlings (Liu et al., 2009), suggesting a close interaction between ABA and auxin signaling. A recent report revealed that miR168 controls Argonaute1 (AGO1) homeostasis, which is crucial for modulation of gene expression during plant development following ABA treatment and abiotic stresses in Arabidopsis (Li et al., 2012). miR168 loss-of-function mutant displayed ABA insensitivity and drought hypersensitivity while transgenic plants overexpressing miR168a and ago1 mutants were both ABA hypersensitive and drought tolerant. miR168a negatively regulated AGO1 transcripts even though the AGO1 promoter showed enhanced activity in the presence of ABA suggesting that a steady state AGO1 transcript level is maintained by enhanced transcription of miR168a (Li et al., 2012). Additionally, miR168a has the ABRE cis-element within the promoter region, which binds to at least four ABRE binding factors to regulate miRNA transcription. All these studies have revealed a complex interaction between various miRNAs and ABA signaling in abiotic stress tolerance (Figure 11.3/Plate14). 11.5.2 Other ncRNAs in ABA Signaling

Endogenous siRNAs, which are generated from long double stranded RNAs also play important roles in abiotic stress responses (Mallory and Vaucheret, 2006) (Figure 11.3). Ta-siRNAs, derived from antisense lncRNAs, are cleaved by miR156 or miR390, and are a specific group of siRNAs involved in the post-transcriptional regulation of stress responses in plants (Cho et al., 2012). As mentioned previously, there is a close relationship between ARFs and ABA signaling (Liu et al., 2007). An earlier report provided evidence that complex regulation between miR390, TAS3-tasiRNA, and Auxin Response Factor 4 (ARF4) is extremely important for lateral root growth in Arabidopsis (Ben-Amor et al., 2009). Similarly, a tasiRNA homologous to rice RNA-dependent RNA polymerase 6 (OsRDR6) was reported as being significantly induced by ABA (Yang et al., 2008). In that study, an in vitro synthesized dsRNA permanently silenced the target isocitrate lyase (ICL) transcripts in the presence of ABA while the silencing was

k

283

k

k

284

Mechanism of Plant Hormone Signaling under Stress CH3

H3C CH3

O

OH CH3 O

OH

ABA

miRNAs miR394

miR169

miR167

LncRNAs

siRNAs miR160

miR159

TAS1, TAS2, TAs3

ptc-lncRNA2752 Target mimicry

miR169 F-box

NFYA

PLD/ARF

ARFs

MYBs

ARFs/ICL NFYA

ABA induced genes

Abiotic stress response and tolerance (Drought/Osmotic stress)

Stress acclimatization/root and leaf growth

k

Figure 11.3 (Plate 15) Interplay between ABA and different non-coding RNAs (miRNAs, tasiRNAs, lncRNAs) in response to stress. NFYA, nuclear transcription factor Y alpha 5; PLD, phospholipase D; ARF, auxin response factors; MYB, myeloblastosis; ICL, isocitratelyase. (See insert for color representation of this figure.)

observed to be transient in the absence of ABA (Yang et al., 2008). Transcriptional regulation studies revealed that ABA not only positively regulates OsRDR6 but also significantly upregulates the expression of OsRDR6 dependent siRNA (Yang et al., 2008). These results suggest that ABA modulates post-transcriptional gene silencing in rice through a tasiRNA mediated transcriptional control of OsRDR6. Recently, three groups of tasiRNAs (TAS1, TAS2, and TAS3) and their precursors were observed to be downregulated in Arabidopsis under drought stress (Matsui et al., 2014). This study also reported irregular stamen growth and poor seed formation in tasiRNA mutants such as rdr6, dcl4, and ago7 in the absence of water (Matsui et al., 2014). Furthermore, the downregulation of ARF3 and ARF4 was significantly less in the ta-siRNA mutant rdr6 (Matsui et al., 2014). Microarray analysis revealed the expression of several abiotic stress responsive genes such as dehydration responsive element binding factor 2C (DREB2C), ascorbate peroxidase, glutathione transferase, as well as ta-siRNA pathway related and ta-siRNA target genes (Matsui et al., 2014). As many of these genes are directly associated with auxin and ABA signaling, it can be concluded that ta-siRNAs are directly involved in the regulation of ABA mediated gene expression under drought stress. Further research on tasiRNA-target genes will provide additional insights into the nature of ABA mediated modulation of ta-siRNA, which results in the fine-tuning of plant adaptive responses to abiotic stresses. As mentioned previously, lncRNAs are >200 nt in size, contain open reading frames of 70–100 amino acids, act as precursors of various miRNAs and siRNAs and directly interact with proteins by forming scaffolds or bind to the RNA polymerase transcription complex to regulate transcription and translation (Prasanth and Spector,

k

k

k

11 Signaling and Modulation of Non-Coding RNAs by ABA

285

2007; Sasidharan and Gerstein, 2008). Recent reports suggest that many lncRNAs are also induced during biotic and abiotic stress responses in plants and animals (Matsui et al., 2013) (Figure 11.3). In wheat, 125 lncRNAs showed spatial expression in different tissues and were differentially expressed under powdery mildew infection and heat stress (Xin et al., 2011). In Arabidopsis, 2708 lncRNAs were identified through genome wide RNA-Seq and among these, 1832 lncRNAs exhibited differential expression in response to diverse abiotic stresses and ABA treatments (Liu et al., 2012). In total, 664 transcripts were identified as differentially expressed lncRNAs under drought stress in maize (Zhang et al., 2014). Similarly, 504 drought-responsive lncRNAs were isolated and validated from Populus trichocarpa and target mimics for 20 miRNAs were identified (Shuai et al., 2014). As mentioned previously, miR169 has been identified as a regulator of NFYA transcription factor in the presence of ABA, which is important for drought stress regulation (Ni et al., 2013). A drought responsive long intergenic non coding RNA (lincRNA) namely ptc-lincRNA2752 was identified as the target mimic of ptc-miR169 and could reduce its expression under drought stress (Shuai et al., 2014). Thus, this study suggests that ptc-lincRNA2752 might be involved in the regulation of drought stress through ABA, miR169 and NFYA. Future experiments on the overexpression and loss-of-function analysis of stress responsive lncRNAs can provide us information to better understand the exact roles of lncRNAs in ABA signaling as well as during plant growth and development.

k

11.6 Conclusion and Future Prospects Besides its role in plant development, ABA has been demonstrated to be involved in sensing and adapting to different abiotic stresses, primarily drought, cold, and salinity. Numerous genetic/molecular/biochemical studies have provided clear information on early events of ABA perception to downstream regulatory pathways, which involve the coordinated action of multiple transcription factors, receptors, transporters, and enzymes (Raghavendra et al., 2010; Danquah et al., 2013, Park et al., 2015). Several loss-of-function studies have established a connection between ncRNA regulated gene expression and hormonal signaling. A plethora of miRNAs, small evolutionarily conserved ncRNAs, including miR159, miR167, miR169, miR162, and miR413 and their target genes have been known to regulate ABA signaling and drought responses in plants. Furthermore, some other studies have identified the differential regulation response of miR393 and miR394 and their target genes in response to ABA and other stimuli; and established the association of miR168 with AGO homeostasis during ABA treatment and abiotic stress. Some recent studies have also clearly demonstrated the interaction of ta-siRNAs with ARF genes, which subsequently modulate drought stress response in Arabidopsis. Availability of whole transcriptome analysis techniques, such as RNA sequencing has begun to facilitate the identification of lncRNAs associated with ABA signaling in abiotic stress as well as those involved in other plant processes. Preliminary studies have indicated that lncRNAs can act as precursors for small RNAs and are able to modulate gene expression at multiple levels via small RNA dependent mechanism. In a recent study on Populus, ptc-lincRNA2572 has emerged as an important player in post-transcriptional gene regulation of drought stress through modulation of ABA, miR169, and NFYA TFs.

k

k

k

286

Mechanism of Plant Hormone Signaling under Stress

Detailed functional studies using expression analysis and targeted knockdown experiments or through chromatin remodeling will provide new perspectives on epigenetic and transcriptional regulation by lncRNAs, and their potential interaction with other classes of ncRNAs. Targeting these key ncRNAs to alter complex regulatory pathways associated with hormone signaling and perception will be a valuable option towards engineering crops, especially in response to abiotic stresses and climatic change. Such studies are currently underway in our laboratory and will form the basis of future publications.

References

k

Abe H, Urao T, Ito T, et al. (2003) Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signaling. The Plant Cell 15: 63–78. Abe H, Yamaguchi-Shinozaki K, Urao T, et al. (1997) Role of Arabidopsis MYC and MYB homologs in drought- and abscisic acid-regulated gene expression. The Plant Cell 9: 1859–1868. Achard P, Cheng H, Grauwe LD et al. (2006) Integration of plant responses to environmentally activated phytohormonal signals. Science 311: 91–94. Assmann SM (2003) Open stomata1 opens the door to ABA signaling in Arabidopsis guard cells. Trends Plant Sci 8: 151–153. Barbosa EGG, Leite JP, Marin SRR, et al. (2013) Overexpression of the ABA-dependent AREB1 transcription factor from Arabidopsis thaliana improves soybean tolerance to water deficit. Plant Mol Biol Rep 31: 719–730. Bartel B, Bartel DP (2003) MicroRNAs: at the root of plant development? Plant Physiol 132: 709–717. Bastow R, Mylne JS, Lister C, et al. (2004) Vernalization requires epigenetic silencing of FLC by histone methylation. Nature 427: 164–167. Ben-Amor B, Wirth S, Merchan F, et al. (2009) Novel long non-protein coding RNAs involved in Arabidopsis differentiation and stress responses. Genome Res 19: 57–69. Ben-Ari G (2012) The ABA signal transduction mechanism in commercial crops: learning from Arabidopsis. Plant Cell Rep 31: 1357–1369. Bonnet E, Van der Peer Y, Rouze P (2006) The small RNA world of plants. New Phytol 171: 451–468. Boudsocq M, Barbier-Brygoo H, Lauriere C (2004) Identification of nine sucrose nonfermenting1-related protein kinases 2 activated by hyperosmotic and saline stresses in Arabidopsis thaliana. J Biol Chem 279: 41758–41766. Boursiac Y, Leran S, Corratge-Faillie C, et al. (2013) ABA transport and transporters. Trends Plant Sci 18: 325–333. Campalans A, Kondorosi A, Crespi M (2004) Enod40, a short open reading frame-containing mRNA, induces cytoplasmic localization of a nuclear RNA binding protein in Medicago truncatula. Plant Cell 16: 1047–1059. Carninci P, Kasukawa T, Katayama S et al (2005) The transcriptional landscape of the mammalian genome. Science 309: 1559–1563. Ceribelli M, Dolfini D, Merico D, et al. (2008) The histone like NF-Y bifunctional transcription factor. Mol Cell Biol 28: 2047–2058.

k

k

k

11 Signaling and Modulation of Non-Coding RNAs by ABA

k

Chen H, Li Z, Xiong L (2012) A plant microRNA regulates the adaptation of roots to drought stress. FEBS Lett 586: 1742–1747. Chen H, Xiong L (2010) The bifunctional abiotic stress signalling regulator and endogenous RNA silencing suppressor FIERY1 is required for lateral root formation. Plant Cell Env 33: 2180–2190. Chen X (2009) Small RNAs and their roles in plant development, Annu Rev Cell Dev Biol 25: 21–44. Chinnusamy V, Schumaker K, Zhu JK (2004) Molecular genetic perspectives on cross-talk and specificity in abiotic stress signaling in plants. J Exp Bot 55: 225–236. Chitwood DH, Thimmermans MCP (2010) Small RNAs are on the move. Nature 467: 415–419. Cho SH, Coruh C, Axtell MJ (2012) miR156 and miR390 regulate tasiRNA accumulation and developmental timing in Physcomitrella patens. The Plant Cell 24: 4837–4849. Choi H, Hong J, Ha J, et al. (2000) ABFs, a family of ABA-responsive element binding factors. J Biol Chem 275: 1723–1730. Covarrubias AA, Reyes JL (2010) Post transcriptional gene regulation of salinity and drought responses by plant microRNAs. Plant Cell Env 33: 481–489. Cutler SR, Rodriguez PL, Finkelstein RR, et al. (2010) Abscisic acid: emergence of a core signaling network. Annu Rev Plant Biol 61: 651–679. Danquah A, Zelicourt AD, Colcombet J, et al. (2013) The role of ABA and MAPK signaling pathways in plant abiotic stress responses. Biotechnol Adv 32:40–52. Denekamp M, Smeekens SC (2003) Integration of wounding and osmotic stress signals determines the expression of the At-MYB102 transcription factor gene. Plant Physiol 132: 1415–1423. Di C, Yuan J, Wu Y et al. (2014) Characterization of stress-responsive lncRNAs in Arabidopsis thaliana by integrating expression, epigenetic and structural features. Plant J 80: 848–861. Dietz KJ, Sauter A, Wichert K, et al. (2000) Extracellular beta-glucosidase activity in barley involved in the hydrolysis of ABA glucose conjugate in leaves. J Expt Bot 51: 937–944. Ding Y, Tao Y, Zhu C (2013) Emerging roles of MicroRNAs in the mediation of drought stress response in plants. J Exp Bot doi: 10.1093/jxb/ert164. Doench JG, Sharp PA (2004) Specificity of microRNA target selection in translational repression. Genes Dev 18: 504–511. Fabian MR, Sonenberg N, Filipowicz W (2010) Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem 79: 351–379. Flynn RA, Almada AE, Zamudio JR (2011) Antisense RNA polymerase II divergent transcripts are P-TEFb dependent and substrates for the RNA exosome. Proc Natl Acad Sci USA 108: 10460–10465. Fujita Y, Fujita M, Shinozaki K, et al. (2011) ABA-mediated transcriptional regulation in response to osmotic stress in plants. J Plant Res 124: 509–525. Fujita Y, Nakashima K, Yoshida T, et al. (2009) Three SnRK2 protein kinases are the main positive regulators of abscisic acid signaling in response to water stress in Arabidopsis. Plant Cell Physiol 50: 2123–2132. Fujita Y, Fujita M, Satoh R, et al. (2005) AREB1 is a transcription activator of novel ABRE-dependent ABA signaling that enhances drought stress tolerance in Arabidopsis. The Plant Cell 17: 3470–3488.

k

287

k

k

288

k

Mechanism of Plant Hormone Signaling under Stress

Geisler S, Coller J (2013) RNA in unexpected places: long non-coding RNA functions in diversecellular contexts. Nat Rev Mol Cell Biol 12: 699–712. Ghildyal M, Zamore PD (2009) Small silencing RNAs: an expanding universe. Nature Rev Genet 10: 94–108. Gomez-Cadenas A, Verhey SD, Holappa LD, et al. (1999) An abscisic acid-induced protein kinase, PKABA1, mediates abscisic acid-suppressed gene expression in barley aleurone layers. Proc Natl Acad Sci USA 96: 1767–1772. Gonzalez-Guzman M, Pizzio GA, Antoni R, et al. (2012) Arabidopsis PYR/PYL/RCAR receptors play a major role in quantitative regulation of stomatal aperture and transcriptional response to abscisic acid. Plant Cell 24: 2483–2496. Gregory BD, O’Malley RC, Lister R et al. (2008) A link between RNA metabolism and silencing affecting Arabidopsis development. Dev Cell 14: 854–866. Ha M, Kim VN (2014) Regulation of microRNA biogenesis. Nat Rev 15: 509–524. Heo JB, Sung S (2011) Vernalization-mediated epigenetic silencing by a long intronic noncoding RNA. Science 331: 76–79. Hoth S, Morgante M, Sanchez JP (2002) Genome-wide gene expression profiling in Arabidopsis thaliana reveals new targets of abscisic acid and largely impaired gene regulation in the abi1-1 mutant. J Cell Sci 115: 4891–4900. Hubbard KE, Nishimura N, Hitomi K, et al. (2010) Early abscisic acid signal transduction mechanisms: newly discovered components and newly emerging questions. Genes Dev 24: 1695–1708. Hung T, Chang HY (2010) Long noncoding RNA in genome regulation: prospects and mechanisms. RNA Biol. 7: 582–585. Iwakawa H, Tomari Y (2013) Molecular insights into microRNA-mediated translational repression in plants. Mol Cell 52: 591–601. Jacquier A (2009) The complex eukaryotic transcriptome: unexpected pervasive transcription and novel small RNAs. Nature Rev Genet 10: 833–844. Jakoby M, Weisshaar B, Droge-Laser W, et al. (2002) bZIP transcription factors in Arabidopsis. Trends Plant Sci 7: 106–111. Jensen MK, Kjaersgaard T, Nielsen MM, et al. (2010) The Arabidopsis thaliana NAC transcription factor family: structure–function relationships and determinants of ANAC019 stress signaling. Biochem J 426: 183–196. Jiang F and Hartung W (2008) Long-distance signalling of abscisic acid (ABA): the factors regulating the intensity of the ABA signal. J. Exp. Bot 59: 37–43. Jones-Rhoades MW, Bartel DP (2004) Computational identification of plant microRNAs and their targets, including a stress induced miRNA. Mol Cell 14: 787–799. Jung HJ, Kang H (2007) Expression and functional analyses of miR417 in Arabidopsis thaliana under stress conditions. Plant Physiol Biochem 45: 805–811. Kapranov P, Cheng J, Dike S, et al. (2007) RNA maps reveal new RNA classes and a possible function for pervasive transcription. Science 316: 1484–1488. Khraiwesh B, Zhu JK, Zhu JH (2012) Role of miRNAs and siRNAs in biotic and abiotic stress responses of plants. Biochim Biophys Acta 1819: 137–148. Kim ED, Sung S (2012) Long noncoding RNA: unveiling hidden layer of gene regulatory networks, Trends Plant Sci 17: 16–21. Kim S, Kang J, Cho D, et al. (2004a) ABF2, an ABRE-binding bZIP factor, is an essential component of glucose signaling and its over-expression affects multiple stress tolerance. Plant J. 40: 75–87.

k

k

k

11 Signaling and Modulation of Non-Coding RNAs by ABA

k

Kim SH, Koroleva OA, Lewandowska D, et al. (2009) Aberrant mRNA transcripts and the nonsense-mediated decay proteins UPF2 and UPF3 are enriched in the Arabidopsis nucleolus. Plant Cell 21: 2045–2057. Kim SY (2014) Transcription factors involved in ABA signaling. In Zhang DP (ed.), Abscisic Acid: Metabolisim, Transport and Signaling. Springer Netherlands, pp. 225–242. Kim VN (2004b) MicroRNA precursors in motion: exportin-5 mediates their nuclear export, Trends Cell Biol 14: 156–159. Kim YJ, Zheng B, Yu Y, et al. (2011) The role of mediator in small and long noncoding RNA production in Arabidopsis thaliana. EMBO J 30: 814–822. Klein M, Geisler M, Suh SJ, et al. (2004) Disruption of AtMRP4, a guard cell plasma membrane ABCC-type ABC transporter, leads to deregulation of stomatal opening and increased drought susceptibility. Plant J 39: 219–236. Kranz HD, Denekamp M, Greco R, et al. (1998) Towards functional characterization of the members of the R2R3-MYB gene family from Arabidopsis thaliana. Plant J 16: 263–276. Kurihara Y, Matsui A, Hanada K, et al. (2009) Genome-wide suppression of aberrant mRNA-like noncoding RNAs by NMD in Arabidopsis. Proc Natl Acad Sci USA 106: 2453–2458. Law JA, Jacobsen SE (2010) Establishing, maintaining and modifying DNA methylation patterns in plants and animals. Nat Rev Genet 11: 204–220. Lee KH, Piao HL, Kim HY, et al. (2006) Activation of glucosidase via stress-induced polymerization rapidly increases active pools of abscisic acid. Cell 126: 1109–1120. Lee SC, Lan W, Buchanan BB et al. (2009) A protein kinase-phosphatase pair interacts with an ion channel to regulate ABA signaling in plant guard cells. Proc Natl Acad Sci USA 106: 21419–21424. Li J, Wang XQ, Watson MB, et al. (2000) Regulation of abscisic acid-induced stomatal closure and anion channels by guard cell AAPK kinase. Science 287: 300–303. Li L, Eichten SR, Shimizu R, et al. (2014) Genome wide discovery and characterization of maize long non-coding RNAs. Genome Biol 15: R40. Li S, Liu L, Zhuang X, et al. (2013) MicroRNAs inhibits the translation of target mRNAs on the endoplasmic reticulum in Arabidopsis. Cell 153: 562–574. Li W, Cui X, Meng Z, et al. (2012) Transcriptional regulation of Arabidopsis miR168a and ARGONAUTE1 homeostasis in abscisic acid and abiotic stress responses. Plant Physiol 158: 1279–1292. Li WX, Oono Y, Zhu J, et al. (2008) The Arabidopsis NFYA5 transcription factor is regulated transcriptionally and post transcriptionally to promote drought resistance. The Plant Cell 20: 2238–2251. Liu H, Tian X, Li Y, et al. (2008) Microarray-based analysis of stress-regulated microRNAs in Arabidopsis thaliana. RNA 14: 836–843. Liu J, Carmell MA, Rivas FV, et al. (2004) Argonaute2 is the catalytic engine of mammalian RNAi. Science 305: 1437–14411 Liu J, Wang H, Chua NH (2015a) Long noncoding RNA transcriptome of plants. Plant Biotechnol J 13: 319–328. Liu PP, Montgomery TA, Fahlgren N, et al. (2007) Repression of AUXIN RESPONSE FACTOR10 by microRNA160 is critical for seed germination and post-germination stages. The Plant J 52: 133–1461

k

289

k

k

290

k

Mechanism of Plant Hormone Signaling under Stress

Liu Q, Zhang YC, Wang CY, et al. (2009) Expression analysis of phytohormone-regulated microRNAs in rice, implying their regulation roles in plant hormone signalling. FEBS Lett 583: 723–7281 Liu J, Jung C, Xu J, et al. (2012) Genome wide analysis uncovers regulation of long intergenic non coding RNAs in Arabidopsis. The Plant Cell 24: 4333–43451 Liu X, Hao L, Li D, et al. (2015b) Long non-coding RNAs and their biological roles in plants. Genomics Proteomics Bioinformatics 13(3): 137–147. Lu C, Fedoroff N (2000) A mutation in the Arabidopsis HYL1 gene encoding a dsRNA binding protein affects responses to abscisic acid, auxin, and cytokinin. The Plant Cell 12: 2351–2366. Ma Y, Szostkiewicz I, Korte A, et al. (2009) Regulators of PP2C phosphatase activity functions as abscisic acid sensors. Science 324: 1064–1068. Mallory AC, Reinhart BJ, Jones-Rhoades MW, et al. (2004) MicroRNA control of PHABULOSA in leaf development: Importance of pairing to the microRNA 59 region. EMBO J 23: 3356–3364. Mallory AC, Vaucheret H (2006) Functions of microRNAs and related small RNAs in plants. Nat Genet 38: S31–S36. Matsui A, Mizunashi K, Tanaka M, et al. (2014) tasiRNA-ARF pathway moderates floral architecture in Arabidopsis plants subjected to drought stress. Biomed Res Int 30345: 1–10. Matsui A, Nguyen AH, Nakaminami K, et al. (2013) Arabidopsis non-coding RNA regulation in Abiotic stress responses. Int J Mol Sci 14: 22642–22654. Matzke M, Kanno T, Daxinger L, et al. (2009) RNA-mediated chromatin-based silencing in plants, Cur Opin Cell Biol 21: 367–376. Melcher K, Zhou XE, Xu HE (2010) Thirsty plants and beyond: structural mechanisms of abscisic acid perception and signalling. Curr Opin Struct Biol 20: 722–729. Melotto M, Underwood W, He SY (2008) Role of stomata in plant innate immunity and foliar bacterial diseases. Annu Rev Phytopath 46: 101–122. Melotto M, Underwood W, Koczan J, et al. (2006) Plant stomata function in innate immunity against bacterial invasion. Cell 126: 969–980. Meyer K, Leube MP, Grill E (1994) A protein phosphatase 2C involved in ABA signal transduction in Arabidopsis thaliana. Science 264: 1452. Mishra G, Zhang W, Deng F, et al. (2006) A bifurcating pathway directs abscisic acid effects on stomatal closure and opening in Arabidopsis. Science 312: 264–266. Motomura K, Le QT, Kumakura N et al. (2012) The role of decapping proteins in the miRNA accumulation in Arabidopsis thaliana. RNA Biol 9: 644–652. Nakashima K, Fujita Y, Kanamori N et al. (2009a) Three Arabidopsis SnRK2 protein kinases, SRK2D/SnRK2.2, SRK2E/SnRK2.6/OST1 and SRK2I/SnRK2.3, involved in ABA signaling are essential for the control of seed development and dormancy. The Plant Cell Physiol 50: 1345–1363. Nakashima K, Ito Y, Yamaguchi-Shinozaki K (2009b) Transcriptional regulatory networks in response to abiotic stresses in Arabidopsis and grasses. Plant Physiol 149: 88–95. Nakashima K, Shinozaki KY (2013) ABA signalling in stress-response and seed development. Plant Cell Rep 32: 959–970. Nakashima K, Takasaki H, Mizoi J, et al. (2012). NAC transcription factors in plant abiotic stress responses. Biochim Biophys Acta 1819: 97–103.

k

k

k

11 Signaling and Modulation of Non-Coding RNAs by ABA

k

Nambara E, Marion-Poll A (2005) Abscisic acid biosynthesis and catabolism. Annu Rev Plant Biol 56: 165–185. Naqvi AR, Sarwat M, Hasan S, Roychodhury N (2012) Biogenesis, functions and fate of plant microRNAs. J Cell Physiol 227: 3163–3168. Ni Z, Hu Z, Jiang Q, et al. (2012) Overexpression of gma-MIR394a confers tolerance to drought in transgenic Arabidopsis thaliana. Biochem Biophy Res Comm 427: 330–335. Ni Z, Hu Z, Jiang Q, et al. (2013) GmNFYA3, a target gene of miR169, is a positive regulator of plant tolerance to drought stress. Plant Mol Biol 82: 113–119. Nie L, Wu HJ, Hsu J-M, et al. (2012) Long non-coding RNAs: versatile master regulators of geneexpression and crucial players in cancer. Am J Transl Res 4: 127–150. Oh SJ, Song SI, Kim YS, et al. (2005) Arabidopsis CBF3/DREB1A and ABF3 in transgenic rice increased tolerance to abiotic stress without stunting growth. Plant Physiol 138: 341–351. Papp I, Mette MF, Aufsatz W, Daxinger L, Schauer SE, Ray A, et al. (2003) Evidence for nuclear processing of plant micro RNA and short interfering RNA precursors. Plant Physiol 132: 1382–1390. Park MY, Wu G, Gonzalez-Sulser A, Vaucheret H, Poethig RS (2005) Nuclear processing and export of microRNAs in Arabidopsis. Proc Natl Acad Sci USA 102: 3691–3696. Park SY, Fung P, Nishimura N, et al. (2009) Abscisic acid inhibits Type 2C protein phosphatases via the PYR/PYL family of START proteins. Science 324:1068–1071. Park SY, Peterson FC, Mosquna A, et al. (2015) Agrochemical control of plant water use using engineered abscisic acid receptors. Nature doi:10.1038/nature14123. Peragine A, Yoshikawa M, Wu G, et al. (2004) SGS3 and SGS2/SDE1/RDR6 are required for juvenile development and the production of trans-acting siRNAs in Arabidopsis. Genes & Dev. 18: 2368–2379. Popko J, Hansch R, Mendel RR, et al. (2010) The role of abscisic acid and auxin in the response of poplar to abiotic stress. Plant Biol 12: 242–258. Prasanth K, Spector DL (2007) Eukaryotic regulatory RNAs: an answer to the genome complexity conundrum. Genes Dev 21: 11–42. Raghavendra AS, Gonugunta VK, Christmann A, et al. (2010) ABA perception and signalling. Trends Plant Sci 15: 395–401. Reyes JL, Chua NH (2007) ABA induction of miR159 controls transcript levels of two MYB factors during Arabidopsis seed germination. The Plant J 49: 592–606. Robert N, Merlot S, N’Guyen V, et al. (2006) A hypermorphic mutation in the protein phosphatase 2C HAB1 strongly affects ABA signaling in Arabidopsis. FEBS Lett 580: 4691–4696. Rodriguez PL, Benning G, Grill E (1998) ABI2, a second protein phosphatase 2C involved in abscisic acid signal transduction in Arabidopsis. FEBS Lett 421: 185–190. Rogers K, Chen X (2013) Biogenesis, turnover, and mode of action of plant microRNAs. The Plant Cell 25: 2383–2399. Saito S, Hirai N, Matsumoto C (2004) Arabidopsis CYP707As encode (+)-abscisic acid 8’-hydroxylase, a key enzyme in the oxidative catabolism of abscisic acid. Plant Physiol 134: 1439–1349. Santiago J, Dupeux F, Round A, et al. (2009) The abscisic acid receptor PYR1 in complex with abscisic acid. Nature 462: 665–668. Sasidharan R, Gerstein M (2008) Protein fossils live on as RNA. Nature 453: 729–731.

k

291

k

k

292

k

Mechanism of Plant Hormone Signaling under Stress

Shinozaki K, Yamaguchi-Shinozaki K (2000) Molecular responses to dehydration and low temperature: differences and cross-talk between two stress signaling pathways. Curr Opin Plant Biol 3: 217–223. Shivaprasad VP, Chen HM, Patel K, et al. (2012) A microRNA superfamily regulates nucleotide binding site-leucine rich repeats and other mRNAs. The Plant Cell 24: 859–874. Shuai P, Liang D, Zhang Z, et al. (2013) Identification of drought-responsive and novel Populus trichocarpa microRNAs by high-throughput sequencing and their targets using degradome analysis. BMC Genomics 14: 233. Shuai P, Liang D, Tang S, Zhang Z, Ye CY, Su Y, et al. (2014) Genome wide identification and functional prediction of novel and drought-responsive lincRNAs in Populus trichocarpa. J Expt Bot doi: 10.1093/jxb/eru256. Shukla LI, Chinnusamy V, Sunkar R (2008) The role of MicroRNAs and other endogenous small RNAs in plant stress responses. Biochim Biophy Acta 1779: 743–748. Spitale RC, Tsai MC, Chang HY (2011) RNA templating the epigenome: long noncoding RNAs as molecular scaffolds. Epigenet 6: 539–543. Stracke R, Werber M, Weisshaar B (2001) The R2R3-MYB gene family in Arabidopsis thaliana. Curr Opin Plant Biol 4: 447–456. Sun BK, Deaton AM, Lee JT (2006) A transient heterochromatic state in Xist preempts X inactivation choice without RNA stabilization. Mol Cell 21: 617–628. Sunkar R (2010) MicroRNAs with macro-effects on plant stress responses. Sem Cell Dev Biol 21: 805–811. Sunkar R, Li YF, Jagadeeswaran G (2012) Functions of microRNAs in plant stress responses. Trends Plant Sci 17: 196–203. Suzuki M, Ketterling M, Li Q, et al. (2003) Viviparous1 alters global gene expression patterns through regulation of abscisic acid signaling. Plant Physiol 132: 1664–1677. Swiezewski S, Liu F, Magusin A, et al. (2009) Cold-induced silencing by long antisense transcripts of an Arabidopsis Polycomb target. Nature 462: 799–780. Teotia PS, Mukherjee SK, Mishra NS (2008) Fine tuning of auxin signaling by miRNAs. Physiol Mol Biol Plants 14: 81–90. Tsai MC, Manor O, Wan Y, et al. (2010) Long non-coding RNA as modular scaffold of histone modification complexes. Science 329: 689–693. Umezawa T, Nakashima K, Miyakawa T, et al. (2010) Molecular basis of the core regulatory network in ABA responses: sensing, signalling and transport. Plant Cell Physiol 51: 1821–1839. Umezawa T, Sugiyama N, Mizoguchi M, et al. (2009) Type 2C protein phosphatases directly regulate abscisic acid-activated protein kinases in Arabidopsis. Proc Natl Acad Sci USA 106: 17588–17593. Umezawa T, Sugiyama N, Takahashi F, et al. (2013) Genetics and phosphoproteomics reveal a protein phosphorylation network in the abscisic acid signaling pathway in Arabidopsis thaliana. Sci Signal 6: rs8. Uno Y, Furihata T, Abe H, et al. (2000) Arabidopsis basic leucine zipper transcription factors involved in an abscisic acid-dependent signal transduction pathway under drought and high-salinity conditions. Proc Natl Acad Sci USA 97: 11632–11637. Van Dijk EL, Chen CL, d’Aubenton-Carafa Y (2011) XUTs are a class of Xrn1-sensitive antisense regulatory non-coding RNA in yeast. Nature 475: 114–117.

k

k

k

11 Signaling and Modulation of Non-Coding RNAs by ABA

k

Vazquez F, Hohn T (2013) Biogenesis and bioactivity of secondary si-RNAs in plants. Scintifica 2013: 783253. Vazquez F, Vaucheret H, Rajagopalan R et al. (2004) Endogenous trans-acting siRNAs regulate the accumulation of Arabidopsis miRNAs. Mol Cell 16: 69–79. Vazquez F (2006) Arabidopsis endogenous small RNAs: highways and by ways. Trends Plant Sci 11: 460–468. Verslues PE, Agarwal M, Katiyar-Agarwal S (2006) Methods and concepts in quantifying resistance to drought, salt and freezing, abiotic stresses that affect plant water status. Plant J 45: 523–539. Wang H, Chung PJ, Liu J et al. (2014) Genome-wide identification of long noncoding natural antisense transcripts and their responses to light in Arabidopsis. Genome Res 24: 444–453. Wang KC, Chang HY (2011) Molecular mechanisms of long noncoding RNAs. Mol Cell 43: 904–914. Wang T, Chen L, Zhao M et al. (2011) Identification of drought-responsive MicroRNAs in Medicago truncatula by genome-wide high-throughput sequencing. BMC Genomics 12:367. Wasilewska A, Vlad F, Sirichandra C, et al. (2008) An update on abscisic acid signaling in plants and more. Molecular Plant 1: 198–217. Wei L, Zhang D, Xiang F (2009) Differentially expressed miRNAs potentially involved in the regulation of defense mechanism to drought stress in maize seedlings. Int J Plant Sci 170: 979–989. Wilkinson S, Davies WJ (2002) ABA-based chemical signaling: the coordination of responses to stress in plants. Plant Cell Env 25: 195–210. Wilkinson S, Davies WJ (2010) Drought, ozone, ABA and ethylene: new insights from cell to plant to community. Plant Cell Env 33: 510–525. Wu L, Zhou H, Zhang Q, et al. (2010) DNA methylation mediated by a microRNA pathway. Mol Cell 38: 465–475. Xin M, Wang Y, Yao Y, et al. (2011) Identification and characterization of wheat long non-protein coding RNAs responsive to powdery mildew infection and heat stress by using microarray analysis and SBS sequencing. BMC Plant Biol 11: 61. Xu ZJ, Nakajima M, Suzuki Y, et al. (2002) Cloning and characterization of the abscisic acid specific glucosyltransferase gene from adzuki bean seedlings. Plant Physiol 129: 1285–1295. Xu ZY, Lee KH, Dong T, et al. (2012) A vacuolar beta-glucosidase homolog that possesses glucose-conjugated abscisic hydrolyzing activity plays an important role in osmotic stress responses in Arabidopsis. Plant Cell 24: 2184–2199. Yan YS, Chen XY, Yang K (2011) Overexpression of an F-box protein gene reduces abiotic stress tolerance and promotes root growth in rice. Mol Plant 4: 190–197. Yang JH, Seo HH, Han SJ, et al. (2008) Phytohormone abscisic acid control RNA-dependent RNA polymerase 6 gene expression and post-transcriptional gene silencing in rice cells. Nucl Acid Res 36: 1220–1226. Ye N, Jia L, Zhang J (2012) ABA signal in rice under stress conditions. Rice. 5:1. Yin P, Fan H, Hao Q, et al (2009) Structural insights into the mechanism of abscisic acid signaling by PYL proteins. Nat Struct Mol Biol 16: 1230–1236. Yoshida T, Fujita Y, Sayama H, et al. (2010) AREB1, AREB2, and ABF3 are master transcription factors that cooperatively regulate ABRE-dependent ABA signaling

k

293

k

k

294

k

Mechanism of Plant Hormone Signaling under Stress

involved in drought stress tolerance and require ABA for full activation. Plant J 61: 672–685. Yoshikawa M, Peragine A, Park MY, et al. (2005) A pathway for the biogenesis of trans-acting siRNAs in Arabidopsis. Genes Dev. 19: 2164–2175. Yu B, Yang Z, Li J, Minakhina S, Yang M, Padgett RW, Steward R, Chen X (2005) Methylation as a crucial step in plant microRNA biogenesis. Science 307: 932–935. Zekri L, Kuzuo˘glu-Öztürk D, Izaurralde E (2013) GW182 proteins cause PABP dissociation from silenced miRNA targets in the absence of deadenylation. EMBO J 32: 1052–1065. Zhang JF, Yuan LJ, Shao Y et al. (2008) The disturbance of small RNA pathways enhanced abscisic acid response and multiple stress responses in Arabidopsis. Plant Cell Env 31: 562–574. Zhang W, Han Z, Guo Q et al. (2014) Identification of maize long non-coding RNAs responsive to drought stress. Plos One 9: e98958. Zhang W, Yu L, Zhang Y (2005) Phospholipase D is the signalling networks of plant response to abscisic acid and reactive oxygen species. Biochim Biophys Acta 1736: 1–9. Zhang X, Xia J, Lii YE et al. (2012) Genome-wide analysis of plant nat-siRNAs reveals insights into their distribution, biogenesis and function. Genome Biol 13: R20. Zhang X, Zou Z, Gong P et al. (2011) Over-expression of microRNA169 confers enhanced drought tolerance to tomato. Biotechnol Lett 33: 403–409. Zhou X, Ruan J, Wang G, Zhang W (2007) Characterization and identification of microRNA core promoters in four model species. PLoS Comput Biol 3: e37. doi: 10.1371/journal.pcbi.0030037. Zhu QH, Stephen S, Taylor J, et al. (2014) Long non coding RNAs responsive to Fusarium oxysporium infection in Arabidopsis thaliana. New Phytol 201: 574–584. Zilberman D, Cao X, Johansen LK, et al. (2004) Role of Arabidopsis ARGONAUTE4 in RNA-directed DNA methylation triggered by inverted repeats. Curr Biol 14: 1214–1220.

k

k

k

295

12 Ethylene and Stress Mediated Signaling in Plants: A Molecular Perspective Priyanka Agarwal 1 , Gitanjali Jiwani 1 , Ashima Khurana 2 , Pankaj Gupta 3 , and Rahul Kumar 4 1

Department of Plant Molecular Biology, University of Delhi, New Delhi, India Zakir Husain College, University of Delhi, New Delhi, India 3 Central Research Institute for Homeopathy, Noida, UP, India 4 RTGR, Department of Plant Sciences, University of Hyderabad, Hyderabad, India 2

12.1 Introduction

k

Plants, being sessile, are constantly exposed to various abiotic and biotic stress conditions, such as low temperature, salt, drought, flooding, oxidative stress, and heavy metal toxicity. Additionally, they are affected by various anthropogenic activities. In contrast to animals that generally opt for a stress avoidance response by moving away from unfavorable conditions, plants cannot escape from such changes and have to undergo “overcome” response by withstanding under the same environment. Altogether, these stress conditions affect both growth and productivity of plants. The ever increasing world population poses a constant challenge before human race for their survival in context of increasing food requirements. Plants are a major source of food to us and if they don’t develop better preventive measures to combat stress, we have to bear the consequences of heavy agronomic losses. The situation becomes worse with global warming induced sudden environmental changes, which adversely affect the final crop yield. However, plants have developed various preventive mechanisms to combat major stress conditions. Phenotypic plasticity remains one of such adaptive measures. At the molecular level, plants regain their resistance against stress majorly by dynamic reprogramming of metabolism and gene expression.

12.2 Types of Stress Due to the diverse nature of unfavorable conditions, stresses are divided into two categories; abiotic and biotic. Abiotic stresses consist of non-living environmental factors that negatively affect the growth and productivity of plants and mainly include cold, heat, drought, and desiccation whereas biotic stresses are caused when plants are attacked by pathogens, fungal infection, or wounding. Water and temperature stress especially affect the agriculture by preventing plants to attain their full genetic potential. Mechanism of Plant Hormone Signaling under Stress, First Edition, Volume 1. Edited by Girdhar Pandey. © 2017 John Wiley & Sons, Inc. Published 2017 by John Wiley & Sons, Inc.

k

k

k

296

Mechanism of Plant Hormone Signaling under Stress

12.2.1 Temperature Stress

Plants require an optimum temperature for proper growth and development. Any extreme increase or decrease in environmental temperature leads to adverse effects on plants physiology and metabolism. Although all plant tissues are prone to stress, reproductive tissues are relatively more sensitive. Temperature changes after perceived by receptors are transduced to nucleus, cause an altered transcriptome and culminate in plant response (Zeller et al., 2009). 12.2.1.1 Cold Stress

k

Cold stress is induced when the fall in temperature leads to either chilling (