Lithuanian Baltic Sea Coasts during the Holocene: Sea Level Changes, Environmental Developments and Human Adaptations 9781407359878, 9781407359885

Table of contents :
Front Cover
Title Page
Copyright Page
Cultural Studies In Maritime And Underwater Archaeology
Volumes In The Series
Contents
Preface
1
Flooded Landscapes in the Lithuanian Waters of the Baltic Sea
1.1. Introduction
1.2. Research methods
1.3. Research areas
1.4. Discussion. The survival of relict landscapes
1.5. Conclusion
Acknowledgments
References
2
Changes in Baltic Sea Relict Coasts and the Subsistence Economyin Lithuania in the Late Pleistocene and Early Holocene
2.1. Introduction
2.2. Present features of the Baltic Sea and its
southeastern shores
2.3. The southeast Baltic Sea region during the Late
Pleistocene period (Nemunas 2a–e and 3)
2.4. The Baltic Ice Lake-Yoldia Sea: the natural
environment, the formation of the coasts, and thesubsistence economy
2.5. The shores of the final Yoldia Sea: The initial
Ancylus Lake period
2.6. The natural environment and the subsistence
economy
2.7. The development of the Middle and Late Ancylus
Lake coasts
2.8. The Littorina Sea shores
2.9. The subsistence economy
2.10. Conclusions
References
3
Lateglacial–Middle Holocene Environmental Dynamics in the Coastal Area of the Baltic Sea: A New Insight for the Territory of Lithuania
3.1. Introduction
3.2. Overview of previous studies
3.3. Material, methods and results
3.4. Discussion
3.5. Conclusions
Acknowledgements
References
4
The Search for Holocene Rivers on the Lithuanian Coastland
4.1. Introduction
4.2. Study area and methods
4.3. Sub-bottom survey
4.4. Marine seismic survey
4.5. Results
4.6. Possible reconstruction
4.7. Conclusions
Acknowledgements
References
5 The Final Palaeolithic and Mesolithic in the Coastal Part of Lithuania:
Societies, Technologies and Resource Management
5.1. Introduction
5.2. Research background
5.3. Material
5.4. Methods
5.5. Results
5.6. Discussion
5.7. Conclusions
References
6 Osteological Material and the Natural Environment on the Baltic
Coast: the Middle Pleistocene to the Middle Holocene
6.1. Introduction
6.2. Material and methods
6.3. Baltic coastal fauna and the natural environment
6.4. The fauna of the Final Palaeolithic–Early
Mesolithic
6.5. Coastal fauna in the Mesolithic–Middle Neolithic
6.6. Conclusions
Acknowledgments
References
7 Molecular Studies of 11,000-Year-Old Scots Pine (Pinus sylvestris L.)
Found on the Bed of the BALTIC Sea
7.1. Introduction
7.2. Material and methods
7.3. Results
7.4. Discussion
References
8
Sulphur content and its palaeoecological significance demonstrated in Early Holocene relict trees from the bottom of the Baltic Sea
8.1. Introduction
8.2. Methods and material
8.3. Results and discussion
8.4. Conclusions
References
9
Phosphorus Traces Left by Stone Age People in Aukštumala Highmoor
9.1. Introduction
9.2. The study area
9.3. The research methods
9.4. Results and discussion
9.5. Conclusions
References
Back Cover

Citation preview

C U LT U R A L S T U D I E S IN MARITIME AND U N D E R WA T E R ARCHAEOLOGY VOLUME 3

Lithuanian Baltic Sea Coasts during the Holocene Sea Level Changes, Environmental Developments and Human Adaptations EDITED BY

ALGIRDAS GIRININKAS AND VLADAS ŽULKUS

B A R I N T E R NAT I O NA L S E R I E S 3 0 8 9

2022

C U LT U R A L S T U D I E S IN MARITIME AND U N D E R WA T E R ARCHAEOLOGY VOLUME 3

Lithuanian Baltic Sea Coasts during the Holocene Sea Level Changes, Environmental Developments and Human Adaptations EDITED BY

ALGIRDAS GIRININKAS AND VLADAS ŽULKUS

B A R I N T E R NAT I O NA L S E R I E S 3 0 8 9

2022

Published in 2022 by BAR Publishing, Oxford, UK BAR International Series 3089 Cultural Studies in Maritime and Underwater Archaeology, Volume 3 Lithuanian Baltic Sea Coasts during the Holocene ISBN  978 1 4073 5987 8 paperback ISBN  978 1 4073 5988 5 e-format This book is available electronically on the BAR Digital Platform doi  https://doi.org/10.30861/9781407359878 A catalogue record for this book is available from the British Library © the editors and contributors severally 2022 Cover image  Relict trees on the seabed, in the depth of 25 m. This pine grew about 10,400 years ago. Photography by Vladas Žulkus. The Authors’ moral rights under the 1988 UK Copyright, Designs and Patents Act are hereby expressly asserted. All rights reserved. No part of this work may be copied, reproduced, stored, sold, distributed, scanned, saved in any form of digital format or transmitted in any form digitally, without the written permission of the Publisher. Links to third party websites are provided by BAR Publishing in good faith and for information only. BAR Publishing disclaims any responsibility for the materials contained in any third-party website referenced in this work.

BAR titles are available from: BAR Publishing 122 Banbury Rd, Oxford, ox2 7bp, uk [email protected] www.barpublishing.com

C U LT U R A L S T U D I E S I N M A R I T I M E A N D U N D E RWAT E R A R C H A E O L O G Y series editors: Linda Hulin (Oxford) and Veronica Walker Vadillo (Helsinki)

In the thirty years since Christer Westerdahl called for the study of maritime cultural landscapes, the field of maritime and underwater archaeology has been dominated by economic studies and the exploration of boat building traditions. Yet there has been a quiet sea-change, with more and more graduate studies oriented towards maritime cultural life on land as well as on board ship, and including inland rivers, lakes and waterways in the scope of their inquiry. This series embraces all forms of theory in maritime and underwater archaeology that increases understanding of maritime cultural practices and identities in the past. The geographical scope of the series is global, with contributions from all regions of the world and from all time periods, from the Palaeolithic to the modern world.

editorial advisory board Carlos Ausejo, Peru Ina Berg, UK Aaron Brody, USA Helen Farr, UK Ben Ford, USA Kristin Ilves, Estonia Akifumi Iwabuchi, Japan Roberto Junco Sanchez, Mexico Ligaya S.P. Lacsina, Philippines Emilia Mataix Ferrandiz, Finland Cliff Pereira, Hong Kong Himanshu Prabha Ray, India Wendy van Duivenvoorde, Australia Christer Westerdahl, Denmark Assaf Yasur-Landau, Israel

iii

VOLUMES IN THE SERIES Le patrimoine subaquatique du lac Titicaca, Bolivie Utilisation et perception de l’espace lacustre durant la période Tiwanaku (500–1150 PCN) Christophe Delaere BAR International Series 2966 | 2020

Volume 1

La navegación prehispánica en Mesoamérica Modelo de conectividad entre la costa del Pacífico y el Altiplano Central (1200-1521 d.C.) Mariana Favila-Vázquez BAR International Series 3013 | 2020 

Volume 2

Lithuanian Baltic Sea Coasts during the Holocene Sea Level Changes, Environmental Developments and Human Adaptations Edited by Algirdas Girininkas and Vladas Žulkus BAR International Series 3089 | 2022

Volume 3

iv

Contents Preface Algirdas Girininkas, Vladas Žulkus����������������������������������������������������������������������������������������������������������������������������������� vii 1. Flooded Landscapes in the Lithuanian Waters of the Baltic Sea Vladas Žulkus������������������������������������������������������������������������������������������������������������������������������������������������������������������ 1 2. C  hanges in Baltic Sea Relict Coasts and the Subsistence Economy in Lithuania in the Late Pleistocene and Early Holocene Vladas Žulkus, Algirdas Girininkas������������������������������������������������������������������������������������������������������������������������������ 15 3. L  ateglacial–Middle Holocene Environmental Dynamics in the Coastal Area of the Baltic Sea: A New Insight for the Territory of Lithuania Miglė Stančikaitė, Albertas Bitinas, Aldona Damušytė, Giedrė Vaikutienė, Algirdas Girininkas, Tomas Rimkus Linas Daugnora, Vladas Žulkus������������������������������������������������������������������������������������������������������������������������������������ 41 4. The Search for Holocene Rivers on the Lithuanian Coastland Nikita Dobrotin������������������������������������������������������������������������������������������������������������������������������������������������������������� 61 5. T  he Final Palaeolithic and Mesolithic in the Coastal Part of Lithuania: Societies, Technologies and Resource Management Tomas Rimkus���������������������������������������������������������������������������������������������������������������������������������������������������������������� 69 6. O  steological Material and the Natural Environment on the Baltic Coast: the Middle Pleistocene to the Middle Holocene Linas Daugnora, Algirdas Girininkas��������������������������������������������������������������������������������������������������������������������������� 91 7. M  olecular Studies of 11,000-Year-Old Scots Pine (Pinus sylvestris L.) Found on the Bed of the Baltic Sea Jurata Buchovska, Darius Danusevičius�������������������������������������������������������������������������������������������������������������������� 123 8. S  ulphur content and its palaeoecological significance demonstrated in Early Holocene relict trees from the bottom of the Baltic Sea Jolita Petkuvienė, Sergej Suzdalev, Vladas Žulkus����������������������������������������������������������������������������������������������������� 139 9. Phosphorus Traces Left by Stone Age People in Aukštumala Highmoor Jolita Petkuvienė, Algirdas Girininkas, Tomas Rimkus���������������������������������������������������������������������������������������������� 147

v

Preface Algirdas Girininkas: Institute of Baltic Region History and Archaeology, Klaipėda University Vladas Žulkus: Institute of Baltic Region History and Archaeology, Klaipėda University palaeo-watercourses of three presently existing rivers – Danė, Smeltalė and Dreverna. Knowing that the Stone Age settlements were founded close to the river estuaries, the results of the palaeo-river watercourse surveys showed promising sites for exploratory underwater archaeological research.

In this collective monograph„ Lithuanian Baltic Sea Coasts during the Holocene: Sea Level Changes, Environmental Developments and Human Adaptations“ summarizes the results of the research conducted during the scientific project Mesolithic-Neolithic people and the Baltic Sea: relict shores and settlements underwater and on the shore. ReCoasts&People executed by the Klaipėda University Institute of Baltic Region History and Archaeology in 2018-2021. The project is funded by the European Social Fund according to the activity ‘Improvement of Researchers’ Qualification by Implementing WorldClass R&D Projects’ of Measure No. 09.3.3-LMT-K-712 by a grant (No. 09.3.3-LMT-K-712-01-0171) from the Research Council of Lithuania.

The methodology of underwater research and the results of the explorations searching for the remains of the relict coasts and surveying underwater sites RF-I, RF-II, RF-III in the Baltic Sea was investigated in detail. Eight sites were explored in Lithuanian territorial waters. The elements of the relict underwater landscape were detected in five of the sites: rooted stumps, tree trunks and peat deposits formed in the coastal lakes. It was determined that the remained relict landscape elements are present in the northern part of the underwater Curonian plateau and in the basin to the north of it. The remained relict landscapes were not found to the north from Klaipėda, where the seabed consists of washed moraine ridges and stony areas, except the RF-II.

The aim of the ‘ReCoasts&People’ project was to survey inhabited sites on current and flooded coasts of the Baltic Sea during the Final Palaeolithic/Early Mesolithic– Neolithic periods, and the natural-cultural landscapes of the Early and Middle Holocene. This monograph sums up interdisciplinary research covering the Final Pleistocene– Middle Holocene period.

The determination of Baltic Sea relict coasts, fluctuations in the sea level and features of coastal settlements are objects of research in the whole Baltic Sea region. The research in the project ‘ReCoasts&People’ is important not only for estimating changes in the climate and how the Baltic Sea developed, or for our understanding of prehistoric coastal culture, but also for attempting to preserve cultural and historical landscapes, and planning economic activity by people living by the sea, possibilities for the use of land, and the possible environmental impact. Therefore, the research data provided in the pages of this publication are integrated with similar research into the development of the Baltic Sea carried out in northern and Western Europe.

The Baltic Sea seabed survey was executed using remote survey technologies: the side-scan sonar, multi-beam echo sounder and seismic survey devices in four supporting research grounds in the Baltic Sea at Juodkrantė, Klaipėda, Palanga and Šventoji at the depths of 10-40 m in order to find the possibly remaining elements of the relict coasts and flooded landscapes: relict trees, peat deposits in the sites of the former freshwater water bodies, the former watercourses of rivers. After the survey of the sites with the relict landscapes on the Baltic Sea bottom, it was possible to specify the sea water fluctuations during the Yoldia – Littorina period and the climatic changes during the Holocene period. During the survey, diversarchaeologists explored separate sites RF-I, RF-II, RFIII presently underwater at the depths of 10–30 metres. During the survey, samples of wood from the presently remained palaeo-trees and peat samples for the 14C dating as well as samples for geochemical, palaeobotanical, palaeo-zoological, tree DNA analyses were taken.

In all chapters of the monograph use the periodization and chronology of the Stone Age accepted in Lithuanian archaeology1, and the development of the Holocene and the Baltic Sea are presented according to the classification and chronology by Rosentau et al. 2017 and Bailey and Jöns 20202 (Tab. 1).

In this study were provides the results of the search of palaeo-rivers watercourses (Šventoji, Rąžė, Danė, Smeltalė and Dreverna) that flowed into the Baltic Sea in Lithuanian territory during the Yoldia-Littorina period in the sea bottom. The search for palaeo-valley incisions of those rivers under the sediments of the sea bottom was carried out using the methods of seismic survey. Six palaeo-incisions were identified which are related to the

Girininkas , A., 2009. Lietuvos archeologija I. Akmens amžius. Vilnius: Versus Aureus. 2  Rosentau, A., Bennike, O., Uscinowicz, S. and Miotk-Szpiganowicz, G., 2017. The Baltic Sea Basin. In: N.C. Flemming, J., Harff, D., Moura, A., Burgess, and G.N. Bailey, eds. Submerged Landscapes of the European Continental Shelf: Quaternary Paleoenvironments, 103–134. Chichester: John Wiley & Sons; Bailey, G. and Jöns, H., 2020. The Baltic and Scandinavia: Introduction. In: G. Bailey, N. Galanidou, H. Peeters, H. Jöns and M. Mennenga, eds. The Archaeology of Europe‘s Drowned Landscapes. Springer Open, 27–38. 1 

vii

Algirdas Girininkas and Vladas Žulkus Tab. 1. Chronology of the Baltic Sea Basin and the Lithuanian Stone Age (according to Rosentau et al. 2017; Bailey and Jöns 2020, and Girininkas 2009). Dates were calibrated by OxCal v4.4 (Bronk Ramsey 2009) and the IntCal20 atmospheric curve (Reimer et al. 2013) Climatic periods

Baltic Basin

BP

Archaeological

chronology

cal BC

cal BP

BØ DR2

Baltic Ice Lake

16000–11700

FINAL PALAEOLITHIC

12600–9600

15118/14939–1110/10786

PB

Yoldia Sea

11700–10700

MESOLITHIC

Early

9600–8200

1110/10786–9270/9028

BO

Ancylus Lake

10700–9800

Middle

8200–6500

9270/9028–7430/7335

AT1

Initial Littorina Sea

9800–8500

Late

6500–5300

7430/7335–6180/6000

AT2

Littorina Sea

8500–4500

Early

5300–4200

6180/6000–4834/4655

Middle

4200–2900

4834/4655–3073/2966

Post-Littorina

Since 4500

Late

2900–2000

3073/2966–1990/1890

AL DR3

NEOLITHIC

SB1 SB2

During the underwater research eight sites in the Baltic Sea in Lithuanian territorial waters were explored. The remains of relict coasts are surveying in the underwater sites RF-I, RF-II and RF-III. Elements of relict underwater landscapes were detected in five of the sites: rooted stumps, tree trunks and peat deposits that formed in coastal lakes. It was determined that surviving elements of relict landscapes are present in the northern part of the underwater Curonian plateau and in the basin to the north of it. Relict landscapes were not found to the north of Klaipėda, where the seabed consists of washed moraine ridges and stony areas, except for RF-II.

The geological, geomorphological, chronological and palaeo-biological situation from the regression of the Baltic Ice Lake until the Middle Holocene period, were discussed analyzed too. The evaluations and conclusions are based on the newest data obtained while surveying the Baltic Sea coasts and relict landscapes underwater. The data provided by the authors define the major chronological and spatial limits of the Late Glaciation and Holocene in Lithuanian coastal region. New geomorphological, isotopic (14C) and palaeo-botanic data show that during the Early Holocene period, marine terraces, that extended from 11 to 30-32 m. b.s.l. or even deeper were forming. Until 10.200-10.100 cal BP the present Lithuanian coastal waters were land, where shallow sediment basins formed and the swamping of huge areas started in the area of the present Nemunas estuary. The data of that period archaeological research show that the people who lived there during the Final Palaeolithic period belonged to the groups of classical Swiderian culture. The marine terraces of the Littorina transgressions that remained in the levels from 8 to 1–2 m a.s.l. were determined.

Recent exploration of the underwater landscape in Lithuanian waters, in the eastern part of the Baltic Sea, allowed identification of trees stumps in growth position, peat sediments, and traces of people that were living in the now flooded landscape in the Final Pleistocene–Early Holocene periods. The results of the research enabled to determine and specify the Baltic Sea coast transformations related to the sea water level fluctuations during the Yoldia, Ancylus Lake, Littorina Sea transgressions and regressions and the coastal areas inhabitants subsistence of those times. The results from the radiocarbon analysis of wood, peat and trees found in the Baltic Sea bottom and swampy lakes sites as well as osteological and archaeological material detected in the former Aukštumala (Šilutė district), Venckai (Klaipėda district), Smeltalė (Klaipėda city), Palanga, Šventoji settlement sites not only specify the dynamics of the Baltic Sea water level fluctuations, but also shows that the inhabitants of the Final Palaeolithic-Middle Neolithic periods adapted to the changing climatic conditions and water level fluctuations in Lithuanian coastal area and lived there continuously, using only the resources present in the coastal area. Due to the profitable hunter-gatherer economy (fishing, seal hunting) and the exchange of raw amber material and its articles, those people developed the production economy slower than in the communities that lived in the continental territories.

In this monograph the archaeological material found on the Lithuanian coastline related to people’s subsistence during the Final Pleistocene–Early Holocene period is discussed too. During the execution of the project ReCoasts&People new archaeological material covering the Final Palaeolithic and Mesolithic periods considerably replenished. It is especially significant that the traces of the Final Palaeolithic inhabitants were found in Lithuanian coastal area for the first time. Artifacts from the Aukštumala settlements and Pūzraviečiai (both in Šilutė district) prove that the Swiderian culture communities lived next to the Baltic Ice Lake during the Late Dryas period. After the performed archaeological research in the Aukštumala settlements it was determined that the Final Palaeolithic period finds can be related to the technology of the Late Swiderian culture. The tanged point found in Pūzraviečiai would show that Lithuanian coastal area was viii

Preface inhabited during the Swiderian culture period, too. The newest data of osteological material and archaeological material from Smeltalė, Melnragė II (Klaipėda city), Šilmeižiai (Šilutė district), Venckai (Klaipėdos district) show, that Lithuanian coastal area was inhabited during the Mesolithic period.

with data gained after similar research in other regions of the Baltic Sea and in the North Sea. One of the aims of the search for flooded relict landscapes from the Holocene period was to detect traces of Stone Age sites inhabited by people. The information we have about Final Palaeolithic to Late Neolithic settlements in the current Lithuanian coastal area shows that settlements at that time were rare. Therefore, the chances of detecting traces of them on the current sea bed are very small. Despite this, six sites of various sizes have already been discovered where relict trees and peat deposits have survived at depths of ten to 30 metres. However, no signs of human activity have yet been found there. This is a reason to continue underwater research and the search for new sites with elements of relict landscapes and possible traces of human activity. The relict river watercourse incisions identified during seismic surveys are around currently known sites with relict landscapes that have survived under water. These areas offer prospects for future research. Of course, the situation indicators for yet-undiscovered underwater settlements are newly detected Stone Age settlements in the coastal area on land and Stone Age finds on the seashore. The results of the project are ambiguous. Interpretations of the fluctuations in the level of the Baltic Sea by geologists who have studied the coastline do not always coincide with the results of research obtained from the analysis of relict landscapes found on the seabed and archaeological settlements on the coast.

The results of detailed osteological material, were found during excavations of the archaeological sites on the Baltic coast is analyzed along with changes in the natural environment. The peculiarities of the MIS-3, the Final Pleistocene – the Early and Middle Holocene fauna are analyzed after the chronology of the finds has been estimated (according to 14C analysis data) and species composition has been studied as well as Energy-dispersive X-ray spectroscopy (EDS) and Histological section has been performed. The changes to the fauna identified using the newest data of the osteological material found on the Baltic coast is related to the alterations of both the Baltic Sea coastline and natural environment. The species of mammals that existed there during the MIS-3 period and dominating hunted fauna during the separate Early Holocene periods has been determined. According to the data of the osteological material research, the economy of those times people related to the hunting of reindeer, seals, red deer, elks, fishing freshwater and marine fish, bird hunting is analyzed. The analysis of chemical indicators on the land in Final Pleistocene-Early Holocene Aukštumala I-III settlements showed the traces of various intensity human activities.

The results were achieved by research in the Lithuanian coastal area and the sea bed of the Baltic Sea in the ‘ReCoasts&People’ project, and the experience gained shows that there could be relict coasts in neighbouring regions, in the Kaliningrad Oblast (district) of the Russian Federation, and in Latvian waters.

Meanwhile during the studies the features of the chemical composition of relict wood samples dated from the Early Holocene period found during underwater landscape surveys carried out in the Baltic Sea a high level of chemical degradation was identified due to the staying underwater that lasted for millenniums. The research conducted during the project enables us to explain the peculiarities of wood survival in the Early Holocene period. The data from the research were compared to the amount of sulphur and iron found in present-day trees in Lithuania and samples of trees flooded by the sea in Sweden. Despite this, the wood of the Scots pine (Pinus sylvestris L.) that survived on the sea bottom appeared suitable for genetic study. The research tried to detect the origins of pine trees which were common on the east Baltic shore in those times. The origin of the pine trees that grew there 11,000 years ago was estimated to be from refugia in Southern Europe. The tests revealed relatively strong genetic associations between relicts of Scots pine found under water in the Baltic Sea and the present-day south Lithuanian population of Scots pine. It is possible that these innovative results of relict pine wood study will encourage analogous research in other Baltic Sea regions. The research carried out for ‘ReCoasts&People’ includes only the Lithuanian zone of the shore of the Baltic Sea and its coastal waters, but the results obtained correlate ix

1 Flooded Landscapes in the Lithuanian Waters of the Baltic Sea Vladas Žulkus: Institute of Baltic Region History and Archaeology, Klaipėda University Abstract: In Lithuanian waters, six sites with preserved relict landscapes of the Yoldia–Early Littorina periods have been found. In finding and identifying submerged palaeo-landscapes, and possible traces of prehistoric human activity, traditional methods for such research were used: acoustic surveys and diving surveys. Samples from sites with preserved relict trees were required for palaeobotanical and geochemical research for phosphorus concentration testing. Samples of rooted pine tree stumps were used to perform this original research in order to extract DNA from Scots pine, circa 11,000 years old, that were found at the bottom of the Baltic Sea, and test the genetic links with the present-day gene pool of Scots pine in Lithuania. The samples of relict trees and peat were taken from depths of 10 to 30 metres and were dated to around 11,200 to about 7,800 cal BP. They have provided more possibilities to become acquainted with features of nature in the Holocene period, changes to the climate, and fluctuations of the sea level during the Yoldia, Ancylus Lake and Littorina stages. The term ‘underwater natural heritage’ is not as familiar as it should be in Lithuania, and it is understandable that sites of relict landscapes, like natural maritime heritage, are not reliably protected at the national level. Areas with preserved relict underwater landscapes will be incorporated into the action plan for the implementation of the Maritime Spatial Planning procedure. Prehistoric settlements known in the coastal areas, and finds washed up by the sea, encourage the continuation of the search for Palaeolithic and Mesolithic settlements at the bottom of the sea. Keywords: Baltic Sea, Lithuanian waters, Flooded landscapes, Sea level fluctuations, Tree sampling, Peat sampling, Remote sensing, Diving surveys 1.1. Introduction In all cultures across the world, prehistoric coastal areas which included marine resources, coastal forest fauna, coastal migratory birds and animal migration paths, were a favourable place for human settlement. For these reasons, people moved from the coast of the former Baltic Ice Lake to the newly formed Yoldia Sea coastline, where the abundant fauna enabled humans to survive. The Yoldia coast of the Baltic Sea is now flooded and at the bottom of the sea. The location of the coastline during the Yoldia Sea and Ancylus Lake stages is not yet exactly clear. It is assumed that relicts of these coasts could have survived on the bed of the Baltic Sea at depths of 37 to 39 metres (Žulkus and Girininkas 2020, p. 6, Fig. 3).

taken from depths of 10 to 30 metres in different parts of Lithuanian territorial waters (Fig. 1.1). Besides the available samples, additional ones were taken that were necessary to corroborate the dates and to continue previous research. Samples from all the sites with preserved relict trees were required for geochemical research, which had not been done earlier, and for phosphorus concentration testing, as an indicator of possible prehistoric human activity. Samples of rooted pine tree stumps that were preserved on the seabed were used to perform this original research in order to extract DNA and amplify PCR fragments from nine Scots pine circa 11,000 years old that were found at the bottom of the Baltic Sea, and test the genetic links with the present-day gene pool of Scots pine in Lithuania.

One of the objectives of the ReCoasts&People project was to explore the seabed in order to find relict landscape elements under water, define the limits of their spread, and search for traces of prehistoric human activity in currently submerged coastal areas. In order to determine sea level fluctuations during the Yoldia, Ancylus Lake and Littorina stages, as well as the changes in natural conditions during the Holocene period, samples of relict trees and peat that were dated to around 11,200 to about 7,800 cal BP were

Preserved relict forest trees and peat outcrops in areas near Juodkrantė and Klaipėda, and in the area of the Nemunas palaeo-estuary beside Nida, were explored by remote sensing technology and diving, and relicts of old coastlines and possible traces of human activity were searched for around Palanga and Šventoji. Based on the available research data, sites for new investigations were chosen based on the sounding of the seabed structure using sub-bottom profiling acoustic systems.

1

Vladas Žulkus

Figure 1.1. Map showing the locations of underwater relict forests in Lithuanian waters and the sites of the survey: 1. Lithuanian waters; 2. sites of submerged relict forests; 3. points of the diving investigation (drawing by Vladas Žulkus).

1.2. Research methods

Before planning any additional seabed observations by scuba divers and using side-scan sonar, data from previous research were used, and the research material and results of previous seabed explorations performed for scientific purposes and for the extraction of marine resources were collected and analysed. The results of multinational mine clearance operations (MCOPLIT) and Open Spirit (an international mine clearance exercise) in 1997, 1998 and

In finding and identifying submerged palaeo-landscapes, palaeo-coastlines, and possible traces of prehistoric human activity, typical methods for research were used: acoustic survey, seismic remote sensing (sub-bottom profiling), diving surveys, underwater photography, and video filming. 2

 Flooded Landscapes in the Lithuanian Waters of the Baltic Sea 1999, underwater acoustic surveys, remote sensing and diving surveys were used. The bed of the Baltic Sea was explored during an international demining operation held in Lithuania’s territorial waters and its exclusive economic zone. During these operations, some objects found at depths of 20 to 60 metres were identified as tree trunks and stumps, possibly the remains of ancient trees. According to signals recorded by side-scan sonar, the sites of surviving peat outcrops can be estimated. The possibility of making a mistake is always present when interpreting the results of explorations of the seabed using side-scan sonar if objects are not checked by a diving survey.

needs further comparison with direct observations by divers and underwater video cameras (Tauber 2007, p. 75). In addition, the interpretation of the data obtained by sidescan sonar is hindered by shipwrecks and other technogenic objects present in the exploration area, the identification of which is possible only during scuba diving. While carrying out the ReCoasts&People project, the seabed areas were also investigated using side-scan sonar. Objects that could be related to natural and cultural submerged relict landscapes according to data from sonar scanning were explored by divers. In achieving the objectives of the research, explorations were conducted at sea in seven zones in the area between Nida and Palanga between 2018 and 2021. In total, 200 diving sessions in pairs were performed. Mostly vessels from Klaipėda University were used for the diving work: the S/V Brabander, the yacht Odisėja, and motorboats for work in the offing. The total number of samples taken was 24. Summarising the results of the explored sites, the identified areas with preserved relict landscapes with rooted pine stumps below the water were mapped, and the limits of these areas were identified. The samples obtained from the bed of the Baltic Sea were studied using palaeobotanical (pollen, diatom, plant macrofossil) survey, isotopic (14C) measurements, estimation of phosphate concentration, and an original DNA study of a pine found at the bottom of the sea (Fig. 1.2).

In looking for possible preserved relict trees, a selection might have to be made from dozens, or even hundreds, of objects registered by side-scan sonar. The small size of the tree stumps (most have a diameter in a range of 15 to 30 cm) prevented their detection on side-scan sonar records. The acoustic backscatter is similar to that of stones or small ridges from a moraine. A difference is shown by the short distance (5 to 6 m) of sonar ‘fish’ over the seabed. This method was successfully applied in 2010 and 2011 when exploring the RF-I site (Žulkus and Girininkas 2012, pp. 14, 51). Of course, this possibility is available only to sites with quite an even seabed. The correct recognition and interpretation of sediments and other seabed features on side-scan images in all cases

Figure 1.2. Map of relict trees and peat sampling points: 1. samples taken for 14C dating; 2. samples taken for 14C dating and geochemical study; 3. samples taken for 14C dating, geochemical and tree DNA study; 4. samples taken for 14C dating and tree DNA study (drawing by Vladas Žulkus).

3

Vladas Žulkus Some unplanned problems arose during the research. Frequent poor underwater visibility hindered the investigations conducted by divers; this did not allow for high-quality underwater photography or video camera filming, and consequently the creation of 3D photos. Difficulties were encountered in trying to take large undisturbed samples from relict peat deposits lying at depths of 29 or 30 metres. The water pressure of the sea at a depth of 30 metres is four atmospheres. While rising to the surface, the pressure drops rapidly; therefore, even quite dense soil (in our case it was peat) is washed away. Simple equipment was constructed to take soil samples from great depths, by means of which samples of up to 30 centimetres in length were taken with their structure undestroyed. When performing exploratory archaeological research at the RF-III-B site, at a depth of 11 metres, airlift equipment was used. The compressed air for the airlift was supplied from the air tanks of the Klaipėda State Seaport Authority vessel Naras.

the verification of the sonar results was obtained by scuba examination. After the initial side-scan sonar research, 477 targets were identified on the seabed. After a review of the RF-I site, out of the 477 selected targets, 109 objects were identified as likely to be trees. However, scuba examination showed that some horizontal trunks, especially smaller ones, were partially or almost completely covered over by sediment, and therefore invisible to the side-scan sonar. So, we can claim that in this 30 square kilometre area there may be twice as many relict forest rooted tree stumps and trunks preserved (Žulkus and Girininkas 2012, pp. 16, 51). According to the exploration’s results, the largest submerged accumulations of objects were in the northeast and central parts of the area. In 2011 and 2012, six relict tree groups were identified and surveyed by diving. The central part of the area was investigated for four tree groups. Groups of rooted relict trees were found at depths of 24 to 29 metres. At 29 and 30 metres, peat from the RFI-P group was found in situ. Currently, 22 trees and peat samples from the seabed have been dated in the RF-I area.

In order to identify a landscape feature such as a palaeo-river channel or traces of possible archaeological settlements, the seabed was explored using sub-bottom profiling acoustic systems, which allow for the identification and measurement of various marine sediment layers that exist below the sediment surface (Chapter 4 of this book). This research was carried out in three parts.

At the very western edge of the surveyed area, 15 to 15.5 kilometres from the coast, an ancient coastal structure was discovered. At a depth of 37 to 39 metres, the sonar showed very unusual underwater terrain. This was probably the remains of the ancient, washed-away coast. At a depth of 39 metres, the degraded traces of terraces were detected; and further west, further into the sea, at a depth of 43 metres, a low continuous underwater terrace extending in a north–south direction was detected as well. At depths of 44 and 47 metres, underwater ridges parallel to the coast, small terraces and presumed disrupted coastal structures were observed (Žulkus and Girininkas 2020, p. 7, Fig. 3).

Three marine seismic reflection cross-sections were collected for mapping shallow sedimentary quaternary layers and to locate buried valleys of palaeo-rivers. High resolution seismic data allows us to distinguish relatively small geological structures, and provide valuable information for future underwater archaeological surveys. A marine seismic survey gave promising results. During seismic data processing and interpretation, six palaeoincisions were found. The discovered palaeo-incisions can be linked to the current rivers.

In 2011 and 2012, seven test samples of pine (Pinus sylvestris) trunks lying underwater were extracted for dendrochronological testing. Five test pieces were suitable for tree-ring measurement. When synchronised with each other, the wood samples showed that they did not stop growing at the same time: the distribution of the withering trees covers a 32-year interval. It was not possible to date the trees using the dendrochronological method, because a dendrochronological scale of the Holocene period with absolute dates for the Baltic region does not exist (Žulkus and Girininkas 2012, pp. 35, 53).

1.3. Research areas RF-I The area of the relict forest explored on the seabed near Juodkrantė (RF-I) represents a part of the landscape that developed on the Curonian Plateau (an underwater peninsula) during the Yoldia, Ancylus Lake and Early Littorina stages. Studies from 2010 to 2012 revealed the northern part of the Curonian Plateau seabed formations and coastlines. At depths of 15 to 25 metres (21o 04’ E to 21o 02’ E longitude), the bed of the Baltic Sea is relatively flat and sandy, with an inclination to the west. There are multiple two to three-metre-high mounds with deeper hollows between them (up to 30 metres below the surface) and further out to sea (up to 20° 57’ E longitude) throughout the whole explored area. The mounds and hollows run in a northeast–southwest direction. In RF-I, the investigation work consisted of two phases: exploration by side-scan sonar, and by multi-beam technology. Later,

In recent years, considerable seabed research has been carried out for different purposes at the RF-I site and its area (Fig. 1.3). In 2017, measurements were conducted using a multi-beam echo sounder in neighbouring sites, partly covering the areas previously investigated. Last year, using a multi-beam echo sounder and side-scan sonar, around 150 square kilometres of the seabed southwest of the RF-I exploration site on the northern edge of the underwater Curonian Plateau was investigated. The scanning was conducted for research purposes and in order to evaluate the possibility of dredging sand to replenish beaches. The seabed 4

 Flooded Landscapes in the Lithuanian Waters of the Baltic Sea

Figure 1.3. Seabed research was carried out for different purposes at the RF-I site and its surroundings using multi-beam and side-scan sonar (drawing by Vladas Žulkus).

in this area contains relict coast formations similar to the ones discovered at the RF-I site. The underwater northern slope of the plateau is steep, plunging from 20 metres to almost 50 metres in depth (Zakarauskas 2017). This area may be suitable for searching for ancient relicts of the Baltic Sea.

obtained by scuba diving examination. Objects recorded by side-scan sonar were inspected during diving sessions from 2018 to 2021, while the ReCoasts&People and BalticRIM projects were being conducted (Figs. 1.1, 1.2). Between 2018 and 2021, diving was performed at the RF-I site in order to identify objects on the seabed and parts of relict landscapes (Fig. 1.4; Fig. 1.5), and to take

During explorations performed by different institutions, the identification of objects registered on the seabed was not

Figure 1.4. A 3D model of the RF-I-B-1 tree trunk dated to about 10,400 cal BP on the seabed at a depth of 25 metres (by Janusz Różycki, National Maritime Museum in Gdansk, Poland).

5

Vladas Žulkus

Figure 1.5. The remains of the RF-I-P-2(2) tree and peat layer, dated to about 11,850 cal BP on the seabed at a depth of 30 metres (photograph by Vladas Žulkus).

samples of relict trees and peat. A total of 18 sites were explored underwater, and 17 samples of relict trees and peat were taken for 14C dating, geochemical and tree DNA analysis (Chapter 2, Table 2.1 of this book). Summarising the available research data at the RF-I site, the total area of relict trees and peat spread was identified.

sites, a boulder that was unusually big for Lithuanian coastal waters was detected during earlier explorations on the stony bed of the washed moraine, at a depth of 25 metres (Žulkus 2016). This boulder, of quite a regular form, was cleaned, measured and filmed. The boulder stands out not only by its size (4.4 by 3.65 m, it rises up to 2.6 m above the seabed), but also by the quite regular cutoff sides, and the even upper surface with strange hollows and splits (Fig. 1.9). Investigations were conducted in order to find possible traces of human activity; however, they were not found.

During the course of the project, a search was conducted in other locations south of the RF-I site, and also near Nida, around the former Nemunas palaeo-estuary (Gelumbauskaitė 2010). According to data from earlier sonar research, parts of palaeo-landscapes and rooted relict trees were likely there. During diving sessions, the seabed was explored at seven sites at depths of 14 to 33 metres (Fig. 1.6). In some places, formations of regular shapes similar to traces possibly left by human activity were detected (Fig. 1.7). Undamaged formations of relict coasts, rooted relict trees, and sediment deposits were not found.

No other objects that could be related to relict natural or cultural landscapes, except the rooted stump RF-II, were found at this site. The seabed there consists of a washed moraine. An additional search was carried out around this relict tree, but no other similar finds or artefacts related to the activities of prehistoric people were found. Another exploration site was the RF-III-1 (RF-III-A) area south of Klaipėda. A rooted stump of a relict pine was found there at a depth of 11 metres, and it was dated (Fig. 2.2). Pursuing further research in the vicinity of this find, seven still unseen rooted relict trees were found on the sandy seabed. Three samples were taken for laboratory tests (RF-III-A-2, RF-III-A-3, RF-III-A-4). This site is one of the most promising for further exploration.

RF-II and RF-III There were two more explored sites to the north of the RF-I site, near Klaipėda port. A relict rooted stump RFII was found earlier at a depth of 14.5 metres at the site at Melnragė II beach (to the north of Klaipėda port). In addition, a T-shaped red deer antler axe was found on the shore in that location (Rimkus 2019, pp. 8–9). The date of the axe (7163–6958 cal BP; 5214–5009 cal BC) is close to the date of the rooted stump RF-II (8008–7571 cal BP; 6059–5622 cal BC) (Chapter 2, Table 2.1 of this book).

The relict landscape sites RF-III-B and RF-III-C, submerged by the sea, were found in 2016 (Žulkus 2017). During non-invasive investigations using sidescan sonar, an indistinct object was detected at a depth of 11 metres to the southwest of the southern leg of the breakwater of Klaipėda port. During the diving session, the remains of six rooted relict trees, and, as was thought, poles left by people, 13 or 14 centimetres high, and five

The seabed in the area of these finds was also explored using side-scan sonar. Later, the search was continued by diving at six sites where relic landscapes or traces of human activity were expected (Fig. 1.8). At one of the

6

 Flooded Landscapes in the Lithuanian Waters of the Baltic Sea

Figure 1.6. The locations of the acoustic survey (RF-I) and diver inspection sites (A) around the former Nemunas palaeoestuary: 1. old shore dunes ridge; 2. the old Nemunas delta (bathymetry and morphogenetic forms after Gelumbauskaitė 2010, p. 110, Fig. 1, drawing by Vladas Žulkus).

or six centimetres in diameter, were found at the site, in an area of about 16 by 11 metres (Fig. 1.10). Ten metres to the north of the supposed group of poles, one more separate pole with supposedly a regular cut was found. Two samples were dated using 14C, and their dates were determined to be around an average of 7,530 cal BC. It is presumed that the poles were possibly left by people beside the Danė palaeo-estuary, or they are possibly the remains of fish weirs (Žulkus and Girininkas 2020).

possible fish weir (Rimkus 2021). A test pit was made at the site using a prefabricated metal caisson. It was necessary to prevent the collapse of the test pit walls and the fall of sediment. The caisson was constructed so that it allowed the deepening from the present surface of the seabed by to up to one metre. The research was carried out by pumping seabed silt by means of an airlift, which is normally used in underwater research at depths greater than 10 metres.

In 2020, the seabed was further investigated by divers in order to detect unknown objects. Underwater archaeological research was carried out at the site of the

Underwater explorations on the seabed to the southwest of the southern leg of the Klaipėda port breakwater showed that at the RF-III-B site, around the presumed relict River

7

Vladas Žulkus when a depth of 60 centimetres from the present seabed was reached during the excavation. Unlike the trees that were found 6.5 to 12 metres from the exploration site with washed-up roots, this group of trees seems to have grown in a small lower area, and their roots were covered by sand. Only small trunks of trees were seen on the surface of the present seabed, which created an impression of hammered poles. No signs of a cultural layer were noticed at the site, no finds with traces of human activity, and no human or animal bones were found. Samples of preserved rooted tree stumps were taken from around the test pit for further research (14C dating, tree DNA determination, geochemical analysis, and phosphate concentration testing). About 15 metres to the south of the RF-III-B-1 group of trees, one up-rooted tree stump was found of about 30 centimetres in diameter and one metre high, which was not detected earlier. This find shows that at the RFIII-B exploration site, the relict preserved landscape has survived in a larger area than was thought before. At about 70 metres to the east of the RF-III-B exploration site, at a depth of 12 metres, yet another fragment of relict forest, marked RF-III-C (Fig. 2.10, C), was found. It consists of groups of small trees and large up-rooted tree stumps, and a peat outcrop. Three tree samples (RFIII-C-1, RF-III-C-2 and RF-III-C-3) and a peat sample (RF-III-C-P1) were dated using the 14C method. These relicts belong to a similar period as the ones found at the RF-III-B site (Chapter 2, Table 2.1 of this book).

Figure 1.7. The structure of the area of the former Nemunas palaeo-estuary at a depth of 36 metres, discovered using side-scan sonar.

RF-III-D

Danė estuary, at a depth of 11 metres, a group of four poles, RF-III-B-1, presumably left by people, and a supposed pole, RF-III-B-8, are of natural origin. The roots of these trees were discovered under layers of sand and gravel

The relict submerged landscape at site RF-III-D (Fig. 1.1) with tree stumps with roots embedded in the sandy seabed

Figure 1.8. Map of the seabed north of Klaipėda, scanned using side-scan sonar: 1. the points of the diving investigation; 2. a rooted pine stump dated to about 7,800 cal BP; 3. a boulder of regular shape (drawing by Vladas Žulkus).

8

 Flooded Landscapes in the Lithuanian Waters of the Baltic Sea

Figure 1.9. The boulder with supposedly regular, cut-off sides and a hollow on its upper surface (photographs by Vladas Žulkus).

Figure 1.10. Trees (A, B) dated to about 9,400 cal BP and peat formation (C, D) dated to about 9,200 cal BP found at a depth of 11 or 12 metres at the RF-III-B and RF-III-C sites around the relict estuary of the River Dangė (photographs by Vladas Žulkus).

9

Vladas Žulkus was found in 2020 at a depth of 10 metres (information from the Lithuanian Navy Divers Team). Underwater explorations on the seabed at this site have not been conducted.

The sites selected in this area were explored by divers (Fig. 1.12). Traces of possible surviving natural and cultural landscapes, and signs of human activity, were searched for. In the explored area, the sandy seabed with small mounds, rock formations with sandy patches, and moraine ridges alternated with rock formations, fine silty sand, and gritty sand. There are occasional boulders two to three metres in size. In none of the 26 explored sites were traces of surviving prehistoric landscapes detected. The oldest coasts are transformed by processes of erosion during later transgressions and regressions.

The Palanga area The reason for the explorations of the seabed around Palanga was the fact that prehistoric settlements were found on the present coastal area. A Late Mesolithic period settlement was situated on the edge of a moraine next to the River Rąžė. Finds from the Late Neolithic and the Early Bronze Age were also discovered in the vicinity (Girininkas 2011, pp. 50–56).

1.4. Discussion. The survival of relict landscapes

Research conducted by the Lithuanian Transport Safety Administration was used in the research project. In 2014, at a distance of six to 12 kilometres from the coast, an area of seabed was sounded by means of side-scan sonar. The formations on the seabed enabled an assumption to be made about possible traces of the River Rąžė palaeo-valley on the present seabed. In order to extend the research to already-explored ground, one more area was scanned in 2018, in which 27 objects on the seabed were distinguished as potential relicts of prehistoric landscapes. The total area sounded by side-scan sonar around Palanga comprised more than 40 square kilometres (Fig. 1.11). The depths in the area are from 12 to 30 metres.

Six sites are currently known in Lithuanian territorial waters in the Baltic Sea where fragments of relict landscapes submerged by the sea have been detected. The oldest peat outcrop and rooted trees are from the Yoldia Sea stage. We cannot yet explain how they have survived, or what the possibilities are to find other sites with undamaged or barely damaged formations of relict coasts. We can only make assumptions. The fact that at the RF-I site near Juodkrantė so many relict forest trees have survived in situ, and so few residues of washed shores are present at depths of 24 to 30 metres, would indicate that the rise in sea level was very fast.

Figure 1.11. The seabed areas near Palanga scanned using side-scan sonar: 1. the points of the diving investigation (drawing by Vladas Žulkus).

10

 Flooded Landscapes in the Lithuanian Waters of the Baltic Sea

Figure 1.12. Diving from the SV Brabander (photograph by Ieva Želvytė).

A well-preserved relict ‘forest’ RF-I near Juodkrantė suggests that after its remains were flooded, a layer of sediment must have settled there which preserved the remains of trees and peat deposits, and protected them during the Ancylus transgression and regression, and the Early Littorina transgression, until the area was flooded again in around 7500 cal BP. The formation of sediments could have been infuenced by the previously adjacent river silt. During the Littorina transgression, the rising water and waves eroded the coasts of that time unevenly in different places, and the remaining relicts of the Yoldia Sea were preserved until today.

In Haväng and western Blekinge (Sweden), stumps and tree trunks from the Ancylus Lake stage have been preserved, but no stumps or tree trunks from the Initial Littorina Sea stage have been found. The rate of transgression will determine how long the trees are exposed to terrestrial decay processes, which in turn will determine if the trees can withstand erosive forces under water. Consequently, the comparably slow transgression rate during the Initial Littorina Sea stage most likely meant that the trees were more or less totally decomposed before the water level reached their positions (Hansson 2018, pp. 33–35).

Similar phenomena can be observed in other regions of the Baltic Sea. The reason for the survival of so many submerged sites and the preservation of rich assemblages of organic material are similar in different locations. Burial and preservation are dependent on interaction between environmental factors, the coastal configuration and geodynamics, biological interactions, and geochemical processes (Hansson 2018, p. 33).

Otherwise, the pine forest of stumps, trunks and branches (Fig. 1.13) would have been destroyed or covered by subsequent layers. It is not known how many pieces of this landscape have been preserved at the RF-I site. It is also unclear whether elements of the relict landscape have been preserved at depths shallower than 16 or 15 metres. Of course, relicts of old landscapes could be found in other places under a thicker layer of silt, but they are not seen in investigations with side-scan sonar or scuba divers.

Burial in sediments, followed by permanent submergence under water, provides anaerobic conditions that protect organic material from destruction by bacteria. As always, when considering issues of underwater preservation, there is a delicate balance between sediment accumulation which is sufficiently rapid to provide protection for land surfaces and archaeological material, but not so rapid as to bury them deeply beyond reach of easy observation (Bailey and Jöns 2020, p. 35).

Traces of prehistoric settlements were not found at the exploration sites. We can offer two reasons for this. Firstly, during the Baltic Ice Lake, Yoldia and Ancylus Lake stages (the Late Palaeolithic and Mesolithic periods), the number of settlements was not high, despite the favourable conditions for survival (Girininkas and Daugnora 2015, p. 38). The second reason is that during the erosion of the coast, the cultural layers of such settlements were destroyed quite rapidly.

11

Vladas Žulkus

Figure 1.13. Branches preserved at a depth of 25 metres at the RF-I-C site, near a rooted pine stump dated to about 10,500 cal BP (photograph by Vladas Žulkus).

The survival of a relict landscape is influenced by constantly recurring factors: hurricanes, activation or changes in sediment flows, and, recently, the impact of human activity in exploiting marine resources. This was encountered during our research. At the RF-III-A site, it was discovered that the seabed here was different in 2020 compared to previous years. Part of the site with about 0.5 metre high stumps was covered in sand. In another part, seven stumps were uprooted and had not been found previously by divers as they had been under the silt.

2019, stumps were not found in that site. In the summer of 2020, one stump rising about 70 centimetres above the seabed was detected at a depth of 24.5 metres. It is obvious that, under the influence of currents and silt, relict trees are covered with sand and uncovered again, depending on the directions of the currents that form on the seabed, their strength, and the amount of silt carried. In Lithuanian waters, the sources of sediments in shallow waters are moraine plateau relicts affected by abrasion, flows of terigenic sediment material from the Curonian Lagoon, and silt carried by currents on the seabed. A longitudinal front of silt moves from the Sambian Peninsula in a south–north direction (Gelumbauskaitė 2014; Žaromskis 2020, p. 29, Fig. 2.7). Around Klaipėda port, the geodynamic balance can be damaged by port dredging operations (Gelumbauskaitė 2014).

In order to inspect the earlier detected peat deposit in situ and take samples, in 2020 diving was performed at the RF-III-C site. It is adjacent to the relict forest RF-III-B site, and about 250 metres south of the southern leg of the Klaipėda port breakwater. In 2016, fragments of a relict landscape, groups of small trees with uprooted roots, and a peat deposit, were found there at depths of 11.5 or 12 metres. Three samples of trees (RF-III-C-1, RF-III-C-2 and RF-III-C-3) and a peat sample (RF-III-C-P1) were dated using 14C (Chapter 2, Table 2.1 of this book). In 2020, the objective was to take samples for 14C dating, tree DNA determination, and analysis of phosphates. It was found that the seabed at the site had changed a lot. The rooted tree stumps and peat deposit were totally covered with sand. The depth there was only about ten metres. At about 20 metres south of the earlier explored site, one small, rooted tree stump was eventually detected, samples of which (RF-III-C-3) were taken for further study. It is obvious that the seabed at this site was covered with a layer of sand 1.5 metres or even two metres thick.

The significant increase in the sand sediment layer on the seabed in the RF-I and RF-III sites of relict forests could be related to two factors. An area of excavated sand is located very close to the RF-I site, where submerged landscapes have been preserved across quite a large area (Fig. 2.3). In 2020, dredging was carried out there to enlarge Palanga beach. The sand was taken from the sea bed with special equipment, and deposited on the beach. The volume of imported sand was >180,000 cubic metres.1 The sand moved during the excavations is transported during storms by waves and currents in a northerly direction. This was the reason for the layer of sand sediment at the RF-I, and probable RF-III-A sites.

In the eastern part of RF-I, at a depth of 25 metres, five rooted stumps of trees were found in 2011 (Žulkus and Girininkas 2012, p. 27). During diving in the summer of

https://welovelithuania.com/palangos-papludimiai-bus-papildytismeliu/ 1 

12

 Flooded Landscapes in the Lithuanian Waters of the Baltic Sea A 1.5 to two-metre-thick layer of sand that covered the areas of relict forest and peat bog at the RF-III-C site could have formed after currents brought dredged material which formed small hills on the bed around the fairwater of Klaipėda port. The dredged material was dumped at sea. The main offshore dumping site that is used for dumping all lithological types of sediments is located 20 kilometres southwest of the entrance to Klaipėda port, at a depth of about 43 to 48 metres (Dembska et  al. 2014, p. 4). Operations to increase the depth of ports are carried out constantly, and they were especially intensive in the spring of 2021. In both cases, the changes to the seabed in the investigated areas are related to human activity. It changed the surroundings of the relict landscapes considerably, but it was not invasive in nature. Relict coasts flooded by the sea were not destroyed, only covered with soil. Direct human activity, intensifying the commercial and industrial exploitation of the seabed areas, where natural and cultural landscapes have survived, would destroy them.

Parts of relict coasts and landscapes found as a result of our research have raised a new issue: the management of underwater natural heritage. Offshore waters are an area of economic activity. The term ‘underwater natural heritage’ is not as familiar as it should be in Lithuania, and it is understandable that sites of relict landscapes, like natural maritime heritage, are not reliably protected at the national level. Discussions that take place at an international level promote efforts at the national level. Maritime cultural heritage authorities in the Baltic Sea region have begun to pay attention to the underwater landscape. The concept of ‘underwater landscape’ should be implemented in Maritime Spatial Planning (MSP) documents. Areas with preserved relict underwater landscapes will be introduced into the action plan for the implementation of the MSP. An MSP with potential maritime cultural heritage sites was approved in Lithuania in 2014. The latest edition of the plan is currently in the final stages of its development, and should envisage the preservation of underwater landscapes when exploiting marine resources (Lehtimäki et al. 2020, pp. 40, 55, 59).

1.5. Conclusion

Acknowledgments

In a small basin in Lithuanian territorial waters, six sites were detected where relicts of the Yoldia, Ancylus Lake and Early Littorina stages with comparatively large numbers of well-preserved rooted trees, and in some places peat outcrops, were investigated. The mapping of the identified areas with surviving relict landscapes under water showed that these sites are in an area smaller than 30 kilometres, in the southern part of the territorial waters, from around Klaipėda to Juodkrantė. This is the northern edge of the underwater Curonian Plateau (an underwater peninsula) and the basin to the north of it. At these sites, the bed of the Baltic Sea is relatively flat and sandy (Gelumbauskaitė 2010). To the north of Klaipėda, where the seabed is formed of moraine ridges and rock formations, no surviving sites of relict landscapes were found, except one, the RF-II site. The old coasts are more eroded in this part of the sea, and the possibility of survival for relict trees or sediment formations is lower. Sites where sub-bottom profiling acoustic systems suggest there is a palaeo-river channel are more promising for further research.

The article uses data obtained during the project “BalticRIM–Baltic Sea Region Integrated Maritime Cultural Heritage Management” (2017–2020), partfinanced by the European Union (European Regional Development Fund). I would like to thank Valerijus Krisikaitis, a diving instructor at the Underwater Research Center of the Institute of History and Archeology of the Baltic Region of Klaipėda University, who is a co-author of all underwater discoveries. I would also like to thank: the Klaipėda State Seaport Authority, the Lithuanian Transport Safety Administration, the Lithuanian Navy, the Explosive Ordnance Disposal Divers Team, and the National Maritime Museum in Gdansk (Poland).

Palaeobotanical and chemical surveys of sediments from the seabed, and DNA studies of the trees, have provided more possibilities to get acquainted with the features of nature in the Holocene period, changes to the climate, and the circumstances of the emergence of pines in the southeast Baltic coastal areas during the Yoldia stage.

Dembska, G., Suzdalev, S., Topchaya, V., Zegarowski, Ł., Flasińska, A., Sapota, G., Blažauskas, N. and Aftanas, B., 2014. Report of quantity, types and characteristics of the sediments from existing dumping sites in SE Baltic. “Application of ecosystem principles for the location and management of offshore dumping sites in SE Baltic Region (ECODUMP)”.

References Bailey, G. and Jöns, H., 2020. The Baltic and Scandinavia: Introduction. In: G. Bailey, N. Galanidou, H. Peeters, H. Jöns and M. Mennenga, eds. The Archaeology of Europe’s Drowned Landscapes. SpringerOpen, 27–38.

The coast was a favourable place for human settlement, despite the fact that there are no data about any economic activity or any other traces of human behaviour in the research locations investigated so far. Prehistoric settlements known in the coastal areas, and finds washed up by the sea, encourage the continuation of the search for Palaeolithic and Mesolithic settlements on the bottom of the sea.

Gelumbauskaitė, L. Ž., 2010. Palaeo-Nemunas delta history during the Holocene time. In: BALTICA, 23(2), 109–116. Gelumbauskaitė, L. Ž., 2014. Kranto zonos geomorfologija ir geodinamika. In: Studija Baltijos jūros krantų erozijos problemų analizė ir sprendimo būdai II. Klaipėda, 27–40. 13

Vladas Žulkus Girininkas, A., 2011. New Data on Palanga Stone Age Settlement. In: Archaeologia Baltica, 16, 48–57. Girininkas, A. and Daugnora, L., 2015. Ūkis ir visuomenė Lietuvos priešistorėje. T. I. Klaipėda. Hansson, A., 2018. Submerged Landscapes in the Hanö Bay: Early Holocene shoreline displacement and human environments in the southern Baltic Basin. Thesis. Lund University. https://lup.lub.lu.se/record/bc9381d0-08a6-4720-914a2eecdafea096 Lehtimäki, M., Tikkanen, S., Tevali, R., eds. 2020. Integrating cultural heritage into maritime spatial planning in the BSR. Final publication of the Baltic Sea Region Integrated Maritime Cultural Heritage Management Project (BalticRIM) 2017–2020. Rimkus, T., 2019. In search of Lithuanian coastal Mesolithic. Review of current data and the aims of an ongoing research project. In: Fornvännen, 1, 1–11. Rimkus, T., 2021. RF-III-B, priešistorės žmonių veiklos pėdsakų paieškų Baltijos jūros užlieto reliktinio kraštovaizdžio vietoje, Klaipėdos valstybinio jūrų uosto pietinio bangolaužio aplinkoje, archeologinių povandeninių žvalgomųjų tyrimų 2020 m. ataskaita. Klaipėdos universitetas, Klaipėda. Tauber, F., 2007. Seafloor exploration with sidescan sonar for geo-archaeological investigations. In: J. Harf and F. Lüth (eds). SINCOS I – Sinking Coasts. Geosphere, Ecosphere and Anthroposphere of the Holocene Southern Baltic Sea. Bericht der RGK 88, 67–79. Zakarauskas, M. 2017. Komandiruotės 2017 m. rugsėjo 21 d. Nr. K-93 ataskaita. Lietuvos saugios laivybos administracijos Hidrografijos ir navigacinių įrenginių skyrius. Žaromskis, R., 2020. Abipus kranto linijos. Klaipėda. Žulkus, V., 2016. AVEC plotų jūroje archeologinių objektų inventorizacija ties Nemirseta ir Palanga. Ataskaita. VĮ „Pajūrio tyrimų ir planavimo institutas“, Klaipėda. Žulkus, V. 2017. Objektų paieškos šoninės apžvalgos sonaru ir neinvazinių povandeninių žvalgomųjų archeologinių tyrimų Klaipėdos valstybinio jūrų uosto šiaurinio ir pietinio bangolaužių rekonstravimo (statybos) ir dalies Kuršių nerijos šlaito tvirtinimo akvatorijose ataskaita. Užsakovas „Sweco Lietuva“ (sut. Nr. 1614112251). Klaipėda. Žulkus, V. and Girininkas, A., 2012. Baltijos jūros krantai prieš 10 000 metų „YOLDIA“. Klaipėda University. Žulkus, V. and Girininkas, A., 2020. The eastern shores of the Baltic Sea in the Early Holocene according to natural and cultural relict data. In: Geo: Geography and Environment. 2020;e00087. https://doi.org/10.1002/ geo2.87

14

2 Changes in Baltic Sea Relict Coasts and the Subsistence Economy in Lithuania in the Late Pleistocene and Early Holocene Vladas Žulkus: Institute of Baltic Region History and Archaeology, Klaipėda University Algirdas Girininkas: Institute of Baltic Region History and Archaeology, Klaipėda University Abstract: Data on flooded relict coasts that have survived in the eastern Baltic, elements of their landscape, and archaeological research of GS-1 to the Early Holocene, are presented in this article. On the basis of this research, the changes to the coastline of those times related to the fluctuations in the water level and the subsistence economy of people who settled near the coast are detailed. Based on the dates of relict trees and peat deposits, as well as the chronology of archaeological layers and archaeological finds, the research conducted in the Baltic Sea and on its shores has enabled the estimation not only of relative, but also eustatic sea level changes. During the research, the location of the final-stage Yoldia Sea and the initial-stage Ancylus Lake shores were specified, their landscapes were determined, and the development of the Ancylus Lake and the first to the third Littorina transgressions and regressions were specified. The latest research data obtained from the waters of the Baltic Sea provided in this publication are related to analogous research into the shores and changes in the water level conducted in the south and southwest parts of the Baltic Sea. Keywords: Baltic Sea, Sea level fluctuation, Flooded coasts, Underwater relict forests, Prehistoric coastal settlements, Mesolithic, Neolithic, Lithuania 2.1. Introduction

the few Stone Age settlements also ended up under water; however, no traces of them were found on the seabed. Finds of animal bones and archaeological artefacts washed ashore indicate that in prehistoric times people lived in places now flooded by the sea.

In implementing the Klaipėda University project ‘Man and the Baltic Sea in the Meso-Neolithic: Relict Coasts and Settlements below and above the Present Sea Level. ReCoasts&People’, research was carried out on the present shores of the Baltic Sea and in the territorial waters of Lithuania. Cultural layers and finds from Stone Age coastal settlements (Fig. 2.1) and the natural palaeoenvironment were investigated. In the sea, research into flooded coast relicts was developed further, specifying and supplementing the results of earlier research.

In Early Mesolithic settlements (such as Aukštumala 1–3 in the Nemunas estuary raised bog, Smeltalė in the southern part of Klaipėda, Šventoji, Palanga, and others) which were located next to small coastal lakes and bogs and small rivers flowing into the sea, the subsistence economy depended greatly not only on changes to the climate, but also on fluctuations in the sea level and changes in fresh and saline sea water. Newly dated and re-dated artefacts and cultural layers of prehistoric settlements show close interrelations between Stone Age settlements and changes in the coast. Newly received and interpreted dates of relict trees and peat from the coastline flooded by the sea frequently correlate with research data from seashore settlements that are currently on the coast, and reliably supplement research into the development of the Baltic Sea shore and the changes in the natural environment in the Holocene period.

This article presents the latest research results, which add to our knowledge of the subsistence economy of prehistoric peoples on the coast in those times. The landscape relicts investigated under water flooded by the sea, together with finds of prehistoric settlements that were located on the coast in those times, allow us to review, newly interpret and specify data about the fluctuations in sea level and the changes to the coastline on the eastern shore during the Yoldia and Littorina Sea periods. The shallow Lithuanian coastal waters of the Baltic Sea hide well-preserved submerged relict coasts and landscape elements. The coastline has washed-up peat layers, at depths of 10 to 30 metres, and well-preserved tree stumps. Their 14C dates place them at more than 10,000 years old, and they enable us to understand fluctuations in the water level in the southeast part of the Baltic Sea during the Yoldia and Littorina periods. After a rise in the sea level,

Changes to the coastline related to fluctuations in sea level are constantly being updated on the basis of new research data; however, a consensus is often not reached. The latest data received from investigations of prehistoric submerged landscapes in the Lithuanian waters of the Baltic Sea, as well as new and corrected archaeological research into Stone Age settlements on the coast, enable us to reconstruct 15

Vladas Žulkus and Algirdas Girininkas

Figure 2.1. Stone Age settlements on the shores of the Baltic Sea discussed in this paper, and sites of relict shores flooded by the Baltic Sea: 1. Aukštumala 1, 2 settlements; 2. Šnaukštai, Klaipėda district; 3. Klaipėda city; 4. Palanga; 5. Šventoji. RF – flooded relict shores (compiled by A. Girininkas and V. Žulkus).

the fluctuations in sea level in the eastern part of the Baltic from the period of the Yoldia Sea to the present in some cases. The reconstruction of the fluctuations in sea level is also based on earlier research, both in Lithuania and in other countries of the Baltic region.

Littorina period are discussed in this paper based on the stratigraphy and dates of the cultural layers of coastal prehistoric settlements. In this way, conclusions drawn so far about changes to the coastline on the Lithuanian coast and in neighbouring regions during this period are corrected in this paper. Reliable knowledge on the transformations of the coastline in the period 7,000–3,000 cal BP is very important in the search for

The sizes and periods of relatively small sea water transgressions and regressions that took place in the 16

Changes in Baltic Sea Relict Coasts in the Late Pleistocene and Early Holocene prehistoric settlements in coastal waters and in this area of the coast.

and Finland, the coastal hollow-type crystalline rocks are from the Pre-Cambrian period; however, sand and gravel from the Holocene period can be found on the beaches. The Baltic coasts of Sweden and Finland are very irregular; there are plenty of small islands off them. Coastal erosion takes place in most southern and eastern Baltic Sea coastal areas (Leppäranta and Myrbeg 2009).

The authors of this article see the transformations of the coastline in the Littorina period as a controversial one. Our data allow for the critical evaluation of the results of the available research, but we cannot give comprehensive and final answers in all cases about the complex processes related to the changes in the palaeo-environment of the Baltic Sea and people’s subsistence economy on the coast. The arguments presented by us correct the opinions of previous researchers; however, the conclusions drawn are not final, but they will be updated when new research data emerge.

The Baltic coast of Lithuania is 90.6 kilometres long. The Curonian Spit takes up about 51 kilometres, and the continental coastline is about 39 kilometres long. All of the Lithuanian coasts are made of loose sediments: multigrain sand, gravel and shingle, and in separate locations moraine pre-clay. Cliffs of moraine pre-clay appear in the continental landscape to the north of Klaipėda (the section of coastline from Olando Kepurė to the village of Šaipiai). There are more moraine pre-clay sediments in the coastal area further north at Palanga. To the north of the pier at Palanga, moraine formations prevail on an underwater coastal slope. The moraine formations are at depths of one to 1.5 metres in Lithuanian coastal waters, and in other places they are five to eight metres deep. Peat from the Littorina period appears on the coast in the area between Palanga pier and Vanagupė, and to the north of Šventoji, after heavy storms (Fig. 2.2). Peat from the Littorina Sea period lies at a depth of one to 1.5 metres under the sand of the beach (Žaromskis and Gulbinskas 2018, pp. 120, 152–159, 163–169, 173). Relicts of moraine coasts have been found on the seabed to the north of Palanga, at depths of 14 to 20 metres (Fig. 2.3).

2.2. Present features of the Baltic Sea and its southeastern shores The Baltic Sea is semi-enclosed, surrounded by the lows of Scandinavia and Central and Eastern Europe. The total area of the Baltic Sea is 392,978 square kilometres (Leppäranta and Myrbeg 2009). The sea is shallow: approximately 54 metres deep. It is connected to the North Sea and the Atlantic Ocean through the Strait of Denmark. The Baltic is one of the largest saline internal waters in the world. There is a plentiful flow of fresh water from the land to the sea, and a limited flow of water from the open ocean; therefore, a strong and almost constant horizontal gradient of salinity is formed (Andrén et  al. 2011). The basin of the Baltic Sea is almost 4.3 times larger than the sea itself. The largest flow of water from the land is on the east and southeast shores. A total of 518 cubic kilometres of water has to flow out of the Baltic Sea for the level to remain constant (Mažeika 2001, pp. 27–29). The location of the edge of the present Baltic Sea is related to the retreat of the last Scandinavian ice sheet. In the southwestern part of the present Baltic Sea, the ice sheet melted and the nascent Baltic Ice Lake (BIL) formed about 16,000 years ago (Andrén et al. 2011). The climate is currently very different in the environment of the Baltic Sea. The western and southern parts are strongly influenced by the Atlantic Ocean; therefore, both marine and normal climate types prevail. The eastern and northern parts have a more continental climate and colder winters. This is reflected by the distribution of sea ice: during a typical winter, the northeastern parts are covered with ice. The shores of the Baltic Sea are very different. Sand spits and cliffs prevail on the southern and eastern shores. The cliffs contain Quarternary ice deposits. Cliffs from the Cretacoeus period, Palaeogene and Neogene are found less frequently. There are sand and other sediment deposits from the Miocene on the shores of the western part of the Bay of Gdansk, and Eocene and Oligocene sand and clay deposits in the cliffs of the Sambian Peninsula (on the eastern shores of the Bay of Gdansk). There are chalk deposit outcrops on the coasts of the islands of Rügen and Møn. The cliffs on the Latvian coast are formed from Devonian-period rocks, and the cliffs in Estonia contain Cambrian-Ordovician-Silurian-Devonian rocks. In Sweden

Figure 2.2. Litorina Sea period peat layer outcrops on the coast at Šventoji, December 2013 (photograph by G. Venckus).

17

Vladas Žulkus and Algirdas Girininkas The oldest stage is the pre-Baltic Ice Lake one, which corresponds to an Arctic climate period that existed for 1,200 years. The pre-Ice Lake period of the south Baltic was first located in the south and southwest part of the Baltic trough, as the glacier still covered the northern part (Rosentau et  al. 2017, pp. 115–117). Later, it expanded to the north, and spanned the Bay of Riga and the land next to it. This basin is considered to have existed for 1,000 years (Kvasov et al. 1970, pp. 65–92). Multiple and significant fluctuations in the water level were peculiar to the south Baltic pre-Ice Lake period. These processes were determined by both eustatic and glacioisostasis factors (Gudelis 1976, 95–116; Šečkus 2009). It is thought that the oldest Baltic Ice Lake (BIL) coastlines in Estonia, Latvia and Lithuania belong to the formations of the south Baltic Ice Lake. Figure 2.3. Relicts of the moraine shores on the seabed off the coast at Palanga at a depth of 14 metres (photograph by V. Žulkus).

At the beginning of the creation of the southern Baltic Ice Lake, the frontal and later its aerial degradation dominated (Rinterknecht et  al. 2006, pp. 1449–1452; Bitinas 2011, p. 125), and while expanding gradually, it became a large freshwater BIL of the oligotrophic type. Its beginning is considered to be around 16,000 BP, and it corresponds to the GS-2a period (Rosentau et  al. 2017, p. 115). The BIL coastal formations already existed in the GI-1a, b, c, d (Allerød) and GS-1 (Late Dryas) periods in Lithuania. In the coastal area, its sediments have been found on the bed of the Curonian Lagoon, under the Curonian Spit, and under the peat of the Svencelė bog (Kabailienė 2006, p. 103). During the maximum transgression of the BIL, the water level in the Baltic Sea was higher than the present one, and the coastline moved significantly to the east from the present coast. The BIL sediments at Šventoji and Butingė (sand, gravel and shingle) reach approximately five kilometres to the east from the present coast and extend from north to south as a narrow one to two-kilometre strip. BIL sediments are found in the terrace that is higher than the present sea level by 10 to 15 metres (Kabailienė 2006, p. 102). This terrace narrows in a southwest direction: at the state border with Latvia, the width of the BIL terrace is 2.5 to three kilometres, at Palanga it is undetectable, and at Karklė it stands out again. According to data from pollen research, the BIL terrace formed and the sediments were deposited during the GI-1a, b, c, d and GS-1 periods. The coastal formations of the BIL, the age of which was determined according to data from geomorphological and lithological research, extended to the east in almost all the coastal waters of the Baltic Sea.

2.3. The southeast Baltic Sea region during the Late Pleistocene period (Nemunas 2a–e and 3) There were several warmer and colder periods in Europe during the Final Palaeolithic period. The natural environment, the climate and the Baltic Sea changed more than once during this period in the Baltic Sea region, and also in Lithuania. Research from recent years shows that the natural environment and the climate of the Final Palaeolithic period (60000–25000 BC – MIS 3) were very unstable (Satkūnas and Grigienė 2012, pp. 35–51; Satkūnas et al. forthcoming). Did the Baltic region experience glaciation at that time? In many cases, the opinions of geologists differ. Some believe that it did occur (Liivrand 1991; Houmark-Nielsen, 2004; 2011; Marks, 2004; 2012), while others refute this (Helmens and Engels 2010; Kalm et  al. 2011; Lasberg, 2014; Lamsters et  al. 2017). The latest research on Final Palaeolithic period megafauna shows that large mammals lived in Lithuania throughout the MIS-3 period, so there could not have been a total glaciation (Satkūnas et al. forthcoming). 2.4. The Baltic Ice Lake-Yoldia Sea: the natural environment, the formation of the coasts, and the subsistence economy Two climatic periods (GI-2, GS-2a-c and GS-1, GI-1a-e) can be distinguished in the area of the Baltic basin during the last glaciation of Scandinavia (MIS-2), according to research into the Greenland glacier1 (Lowe et  al. 2008, pp. 9–10). They are the last glaciation of Scandinavia and the glacier melting period. Our research into the Baltic Sea starts in the periods of the GS-1 (the Younger Dryas, 12,896–11,703 BP) and Early Holocene (the beginning of the Pre-Boreal period). 1 

The development of the BIL shores has interested many Lithuanian geologists. The fluctuations in the water level of the Baltic Sea were detailed by V. Gudelis and L. Lukoševičius (Gudelis 1965, pp. 53–56; 1976, pp. 95–116; 1979, pp. 159–173; Lukoševičius and Gudelis 1974, pp. 113–118), M. Kabailienė (Kabailienė 2006, p. 432), and later A. Bitinas and A. Damušytė (Bitinas and Damušytė 2004, pp. 37–46), L.Ž. Gelumbauskaitė and J. Šečkus (Gelumbauskaitė and Šečkus 2005, pp. 34–45; 2015 Gelumbauskaitė 2009), and A. Damušytė (Damušytė

GS - Greenland Stadials; GI - Greenland Interstadials.

18

Changes in Baltic Sea Relict Coasts in the Late Pleistocene and Early Holocene 2011, p. 48) (Fig. 2.4). In the opinion of many geologists researching the Lithuanian and south Baltic regions (Lampe 2002, pp. 13–19; Uścinowicz 2004, p. 11; 2006, pp. 86–105; Lampe et al. 2011, pp. 233–251; Uścinowicz et  al. 2011, pp. 219–231; Bennike and Jensen 2013, pp. 17–20; Musielak et al. 2017, pp. 69–85), the water in the BIL basin fell to 40 to 50 metres b.s.l. during the regression in the GI-1a, b, c, d and GS-1 periods. Researchers of fluctuations in the water level of the south Baltic Sea point out that there were two regressions of the BIL in the final periods of GI-1a, b, c, d (Allerød) and GS-1 (Moros et  al. 2002, pp. 151–162; Rößler 2006, p. 32; Andrén et al. 2011, pp. 75–97). In varve year 10,740 BP, the Baltic Ice Lake drained, and the Baltic became level with the Atlantic. As the ice retreated, a strait opened across southern Sweden, known as the Närke Strait. The strait remained blocked by pack ice and icebergs, however, and the conditions in the Baltic remained lacustrine. In the autumn of varve year 10,430 BP, the situation changed completely, and the Baltic became brackish-marine in a single year. The reason for this could have been a very large earthquake of a magnitude well above M8 in the Stockholm region (Mörner and Dawson 2011, p. 350). There are different interpretations of what the water level was during the first BIL regression. According to data from research into the southeast part of the Baltic Sea, some maintain that during a rapid regression, the Baltic Ice Lake drained to 60 to 50 metres b.s.l. (Björck et  al. 1995). According to other data, during the first regression, the water level was ~25 metres b.s.l., and during the second one it was up to ~40 to 50 metres b.s.l. (Bennike and Jensen 2013, pp. 17–20). It has been established that during the second regression, the water level in the region of the Bay of Gdansk fell to 50 to 52 metres b.s.l. or even lower (Uścinowicz 2006). The lowest water level on the south and east Baltic shores could have been 50 to 60 metres b.s.l. (Gelumbauskaitė 2009, p. 33). According to the data from our research, the level of the Baltic Sea around the period 11,850–11,390 cal BP (9,700–9,400 cal BC) was lower than 32 metres b.s.l. During investigations of coastal formations at this depth, relicts were found of pre-coastal lakes that formed (Žulkus et al. 2015) which had already been filled with peat in the final period of the Yoldia Sea (Fig. 2.5). During underwater research, two samples of peat taken in the area of RF-I from the same deposit, from depths of approximately 29 and 30 metres, show a period of the formation of peat. A peat sample from a depth of 30 metres, from the bottom of the peat deposit RF-I-P-2(2), is dated (Vs-2913) to approximately 12,635–11,070 cal BP (11,392–8,015 cal BC). The date of another sample from the same place, from a depth of 29 metres (RF-I-P-2) (Vs2634), is within the interval between 12,191–10,579 cal BP (ca. 9,400 cal BC). The process of the formation of peat could have finished around 11,400 cal BP, or 9,400 cal BC

Figure 2.4. The Baltic Ice Lake in the period GI-1a, b, c, d and GS-1: 2, 13–15, 18. Sites of discoveries of reindeer skeletons; the Aukštumala 1 and 2 settlements (the shoreline of the Baltic, Ice Lake is based on Bitinas and Damušytė 2021, and modified by A. Girininkas).

19

Vladas Žulkus and Algirdas Girininkas

Figure 2.5. Flooded relict shores in the research area RF-I: 1. the sandy shores of the Yoldia Sea period overgrown with pine trees; 2. the Yoldia Sea period peat bog; 3. the remains of the peat bog at the beginning of the Littorina Sea transgression; 4. remnants of the coasts formed during the Ancylus and Littorina Sea transgressions (drawing by V. Žulkus).

2.5. The shores of the final Yoldia Sea: The initial Ancylus Lake period

(Table 2.1), according to the peat sample from its upper part, already in the final period of the Yoldia Sea. Thus, the period of the formation of the peat layer could have lasted 460 to 470 years. The dates of trees and peat RF-I-E-1 (Vs-2257) and RF-I-P-2 (Vs-2634), currently underwater at depths of 25 to 30 metres (Table 2.1), clearly show that at about 11,300 cal BP the water level in the east Baltic was below 30 metres b.s.l.

At the end of the GS-1 and at the beginning of the PreBoreal, when the BIL waters were connected to the Atlantic Ocean and saline water was penetrating into the former freshwater ice lake, a basin of unequal salinity formed in the Baltic, or the Yoldia Sea. The Yoldia Sea stage is seen in the Baltic Sea in the period ca. 11,700–10,700 cal BP, or at 11,100 cal BP, a brackish water basin in the first part of this stage, and a freshwater basin during the second (Andrén et al. 2002, pp. 226–238; Andrén et al. 2011, p. 84; Borzenkova et al. 2015, p. 26; Rosentau et al. 2017, pp. 115–118). According to the data of other researchers, the Yoldia Sea lowstand is considered to have existed in the period between around 11,500 and 10,800 cal BP (Hansson et al. 2019).

The research we conducted does not allow a justified guess at the minimum water level during the Yoldia Sea regression. The terraces which are present at depths greater than 40 metres in the latitude around 55o31’550 N at about 13 kilometres from the coast (Žulkus and Girininkas 2020, Fig. 3) could be relicts of the oldest coasts and locations for further research into the coastal landscapes flooded by the Yoldia Sea. There are data that the water level of the Baltic Sea was around 40 metres b.s.l. at about 10,300 BP (Lampe 2002), and this would correspond approximately with what we assume was the water level of that time.

The water level of the Yoldia Sea was low, and the shoreline, compared to the shore of the present Baltic Sea, was much further to the west. This is confirmed by our underwater research (Žulkus et al. 2015; Žulkus and Girininkas 2020) and research by J. Šečkus (Šečkus 2009, p. 22, Fig. 5). The shores of the lowest water level of the Yoldia Sea are found in the Baltic Sea at between 50 and 55 metres b.s.l. (Gelumbauskaitė 2009, p. 33, Fig. 9). A similar level of the Baltic Sea has been determined in south Baltic coastal areas (Uścinowicz 2003, pp. 1–79; Andrén et al. 2011, pp. 75–79).

Sediments from the Late MIS-2 period could hide under peat which was found under water in the area RF-I a little lower than 30 to 32 metres b.s.l. The coastal formations had to form twice: at the end of the GS-1 when the Baltic Sea contained fresh water, and in the middle of the Pre-Boreal, during the middle stage of the Ancylus Lake, when the water level rose and the formation of peat ended. These data are confirmed by research on diatom assemblages found in samples taken from the Baltic Sea at depths of 35 metres. Diatoms that prefer saline water were not found in the Yoldia Sea layers of sediments (Kabailienė 1999, pp. 15–29).

Our research data (Fig. 2.6) are related to the final period of the existence of the Yoldia Sea, to which belonged the 20

Changes in Baltic Sea Relict Coasts in the Late Pleistocene and Early Holocene Table 2.1. The dates of relict trees and peat deposits underwater (see Fig. 2.1). Dates were calibrated by OxCal v4.4 (Bronk Ramsey 2009) and the IntCal20 atmospheric curve (Reimer et al. 2013) No

Area

Material dated

Depth (m b.s.l.)

Lab ID

C age

14

Cal BP (95.4%) (1 sigma)

Cal BC (95.4%)

Phosphates

Trees DNA

1.

RF-I-A

Pine

27

Vs-1372

9,160 ± 60

10,499–10,225

8550–8276

2.

RF‐I‐B-1

Pine

25

Vs‐2018

9,170 ± 100

10,647–10,178

8698–8229

+

+

3.

RF‐I‐B‐2

Pine

25

Vs‐2272

9,685 ± 65

11,236–10780

9287–8831

+

+

4.

RF-I-B-2

Pine?

25

KIA-53773

9,455±45

11066–10568

9117–8619

5.

RF-I-B-2

Pine

25

KIA-53774

9,485±45

11070–10580

9121–8631

6.

RF‐I‐B‐4

Pine

25

Vs‐2273

9,410 ± 95

11078–10302

9129–8353

7.

RF‐I‐B‐5

Pine

25

Vs‐2254

9,555 ± 100

11185–10585

9236–8636

8.

RF‐I‐C‐1

Pine

24/25

Vs‐2019

9,180 ± 110

10679–10170

8730–8221

9.

RF-I-C-2

Pine

25

KIA-53775

9,470±45

11068–10574

9119–8625

10. RF‐I‐C‐3

Pine

24/25

Vs‐2255

9,300 ± 90

10706–10247

8757–8298

11. RF‐I‐E‐1

Pine

29/30

Vs‐2257

9,770 ± 95

11597–10768

12. RF-I-E-2

Pine

29/30

FTMC-HEO5-2 9694±44

13. RF-I-P-2(3)

Pine

30

14. RF‐II‐1

Pine

15. RF‐III‐1 16. RF-III-A-2

+

+

+

9648–8819

+

+

+

+

11226–10808

9277–8859

FTMC-TD34-1

7149±31

8020–7931

6071–5982

14,5

Vs‐1388

6,930 ± 130

8008–7571

6059–5622

Pine

11

Vs‐1765

8,560 ± 80

9757–9330

7808–7381

Pine

11

FTMC-HEO5-3 7843±44

8972–8486

7023–6537

+

+

17. RF-III-A-3

Pine

11

FTMC-HEO5-4 8027±45

9023–8652

7074–6703

+

+

18. RF-III-A-4

Pine

11

FTMC-HEO5-5 7842±45

8,972–8,477

7023–6528

+

+

19. RF‐III‐B‐1

Pine

11

Vs‐2746

8,450 ± 40

9,536–9,332

7587–7383

+

20. RF‐III‐B‐2

Pine

11

Vs‐2747

8,505 ± 60

9,554–9,327

7605–7378

21. RF‐III‐C‐1

Pine in peat

12

Vs‐2760

8,580 ± 40

9,662–9,482

7713–7533

22. RF‐III‐C‐2

Pine

12

Vs‐2759

8,435 ± 40

9,534–9,323

7585–7374

23. RF-III-C-3

Pine

10

FTMC-CG62-2

8006±32 36.91±0.15 (pMC)

9006–8724

7057–6775

24

RF-I-P-2

Spruce

30

FTMC-HEO5–1 9246±45

10561–10256

8567–8307

25

RF-I-P-2(1)

Pine

KIA-53776

9555±45

11103–10704

9154–8755

26

RF-I-I(2)

Oak, inner part

25

Vs-2749

8035±50

9028–8717

7079–6768

27

RF-I-I(2)

Oak, outer part

25

Vs-2750

7995±55

9009–8688

7060–6739

28

RF-I-I(2)

Oak

25

KIA-53772

7906±40

8810–8596

6861–6647

30,5

+

+

+

PEAT 1

RF-I-P-2(2)

Peat

30

Vs-2913

10090±640

12635–11070

11392–8015

2

RF-I-P-2

Peat

29

Vs-2634

9860±250

12191–10579

10242–8630

3

RF-III-C-P1 Peat

12

Vs-2761

8205±40

9290–9020

7341–7071

4

RF-III-C-P1 Peat

12

Vs-2762

8240±40

9321–9083

7372–7134

5

RF-I-B

Peat

25

Vs-2020

7480±100

8430–8032

6481–6083

6.

RF-I-P-1(3)

Peat

29

FTMC-HG89-1

9651±34

11190–10795

9241–8846

peat deposits found at 29 or 30 metres b.s.l. in the former coastal lakes and pine forests that grew next to them. These elements of the landscape formed after the Yoldia Sea lowered to possibly 50 to 55 metres b.s.l.

locations of pine trees RF-I-E-1; RF-I-E-2, RF-I-P-2(1), RF-I-P-2 was found in the period 11,597–10,256 cal BP (Table 2.1), where the water level must have been lower than 32 metres b.s.l. Groups of pines grew further to the east in the coastal areas; parts of them have survived at depths of 25 to 27 metres. The chronology of the trees consists of three groups, the dates of which are in intervals between 11,185 and 8,724 cal BP (Table 2.1). It is clear that the sea level at the time of the growth

It was determined during underwater research that in the period of the formation of the peat layers RFI-P-2(2), RF-I-P-2 was found at depths of 29 to 30.5 metres b.s.l. – 12,635–10,579 cal BP and in the find 21

Vladas Žulkus and Algirdas Girininkas

22 Figure 2.6. The relative change of curve in the water level in the eastern part of the Baltic Sea on Lithuanian shores during the Early Holocene (drawing by A. Girininkas and V. Žulkus).

Changes in Baltic Sea Relict Coasts in the Late Pleistocene and Early Holocene of the trees could not have been higher than around 30 metres b.s.l.

Sea coastal area, at Aukštumala 1 and Aukštumala 2, and pilot research was carried out at the Aukštumala 3 settlement (Rimkus and Girininkas 2019, pp. 44–49; 2020, pp. 35–38). During the research, flint, quartz, granite, sandstone and mica tools, and crushed stone show that the chronologies of all the settlements belong to the period of the Late Swiderian culture (see Rimkus, Chapter 5 in this volume). The Aukštumala settlements from the Final Palaeolithic and Early Mesolithic were detected in the Aukštumala raised bog (Šilutė district) on an island originating on a moraine with a fluvio-glacial deposit. The Aukštumala raised bog formed during the Holocene period due to natural changes: the marked changes in the climate, fluctuations in the level of the Baltic Sea, and even the rising or sinking of land which was repeated a few times. After the glacier melted, the Baltic Ice Lake lay in the area of the present Aukštumala bog (Fig. 2.2). The first research into the Aukštumala bog was conducted by the German botanist Carl Albert Weber. He established that the lake had disappeared due to the greater rise of the Earth’s surface, and the newly opened wetland was gradually overgrown with groves of black alder. When the Earth’s surface started sinking, the black alder groves were flooded by water from the lake, the shores of which were covered by wide strips of reeds and sedge quagmires. Later, when the land’s surface started rising again, the boggy lake disappeared, and mires formed in the risen peaty bed of the former lake. A raised bog gradually replaced the mires, and survived a second sinking of the Earth’s surface, which was not so strong and so lasted until the present (Weber 2016, pp. 214–216).

Summarising the chronology of the formation of peat and the growth of trees in the area RF-I, it can be stated that the water level must still have been lower than 32 metres b.s.l., and the shore of the Baltic Sea further than ten kilometres to the west of the present coast of the Curonian Spit during the period at the end of GS-1 and the beginning of the Pre-Boreal. The further development of the Baltic Sea was related to the Ancylus Lake period. 2.6. The natural environment and the subsistence economy If birch, with small insertions of pine forests, grew in the coastal area at the end of GS-1, then the pine forests spread in the coastal area from the middle of the Pre-Boreal period (Kabailienė 2006, p. 400). This fact is confirmed by the finds of a relict forest: pine stumps with roots in the research area RF-I. According to the data from these underwater explorations, pine trees had already been the dominant taxon since the beginning of the Ancylus period. Herbaceous vegetation which later formed the peat layers that have survived till modern times flourished next to enclosed water bodies in the region of the Ancylus Lake. Sporadic tools found from the GS-1 period (the find location is called Pūzraviečiai, Šilutė district, about 35 kilometres to the east of the western coast of the Curonian Spit) (see Rimkus, Chapter 5 in this volume) show that the higher places in former BIL coastal areas were settled by people of Early Swiderian culture who engaged in hunting migratory reindeer.

The Aukštumala raised bog started forming during the complex BIL period. Due to the changes in the water level, floods and the conditions of the rising or sinking of the Earth’s crust, the origin of the bed of the bog is quite variable: BIL sedimentation areas extend in the western part of the raised bog, while the eastern part is dominated by an area of moraine hills with fluvio-glacial and aqueoglacial deposits modified by marine terraces and the later formation of peat (Weber 2016, pp. 177–178; Kunskas 2005a).

Diatom assemblages that prefer saline water and the mollusc Yoldia (Portlandia) arctica have been found in the area of the former strait in present-day central Sweden and show the intrusion of water from the Atlantic Ocean into the trough of the Baltic at the beginning of the Yoldia Sea (Björck 1995, pp. 26–27). In Lithuania, similar research on diatoms was conducted with samples from the seabed at a depth of 35 metres, but sediments of the Yoldia Sea and saline-loving diatoms were not detected (Kabailienė 1999, pp. 15–29). It was determined during later research that due to the short period of the existence of the Yoldia Sea (about 1,000 years) and the low sea level, the water’s salinity increased more significantly only in the western and central parts of the Baltic Sea, and there was not enough time for saline water to spread in the southwest part of the sea. This could be witnessed by the finds of freshwater diatom types found in Lithuanian territorial waters that show the existence of a freshwater, or very low-salinity water, basin in this part of the Baltic during those times (Vaikutienė 2004, pp. 58–69).

The bed of the Aukštumala bog currently lies under an up to nine-metre-thick layer of peat (of an average thickness of 6.1 metres). In some locations, the bed is up to 3.5 metres below the present sea level. The height of the surface of the raised bog ranges from 1.5 metres on the margins of the bog to six metres above sea level in the middle of the bog (Liužinas et al. 1995; Kunskas 1974, pp. 45–55). An analysis of peat samples taken from the Aukštumala 1 settlement conducted by C.A. Weber revealed that during the period of the formation of the bog, mire peat (formed from wood, wood-sedge, reeds, and later Rannoch-rush and sphagnum) dominated; when raised bog vegetation gained dominance, layers of cotton-grass, Scots pineand cotton-grass and Rannoch-rush were deposited, and only during the latest period did sphagnum peat start to form. C.A. Weber’s palaeobotanical survey performed in the excavated profile (at a depth of 5.35 to 5.95 metres) next to

In the transitional period from GS-1 to the Early Holocene (Pre-Boreal), three settlements were studied in the Baltic 23

Vladas Žulkus and Algirdas Girininkas the first Aukštumala settlement showed that cotton-grass and sphagnum peat dominated in the earliest peat layers, a significant part contained plants from the sedge family (Cyperaceae), and most of the pollen was from Scots pine trees (Pinus Silvestris) and white birch (Betula pubescens). The upper layer of black alder peat was dominated by Scots pine, Norway spruce, black alder, birch and cotton-grass (Eriophorum vaginatum L.). There were stray occurrences of oak (Quercus), hazelnut (Corylus avellana) and lime tree (Tilia) pollen (Weber 2016, pp. 168–169).

of the sedge (Cyperaceae) and Poaceae families of plants, which spread most frequently on boggy shores, dominated the sample. The pollen of absinthium (Artemisia) and juniper (Juniperus) show that there were open sandy areas next to the lake, and willow (Salix) grew on the shores of the lagoon. Also, a large proportion of the pollen consisted of the Polypodiaceae family of plants. The coolness of the climate in those times is suggested by Selaginela selaginoides (L.). The domination of these plants both in the first Aukštumala settlement and the settlement in the RF-I Baltic Sea area at a depth of 30 metres found in the location of a boggy lake shows them to be from the same period. An analysis of RF-I-B-2(2) and RF-I-P-2 samples according to 14C research data indicates that the peat formation process started at the turn of the Late Dryas and the Pre-Boreal, when the water level in the Baltic Sea (the Yoldia Sea stage) could have dropped to about 50 metres b.s.l. (Žulkus and Girininkas 2012; 2014; 2020; Žulkus et  al. 2015). The process of peat formation could have finished by the final stage of the Yoldia Sea, judging by the upper part of the peat sample RF-I-P-2 (Table 2.1). Later, the water level started to rise. The formation of the peat found in the RF-I area finished with this transgression, and the development of the Ancylus Lake started.

If the data is compared to the samples taken from Baltic Sea area RF-I at a depth of 30 metres, the locations RFI-P-2(2) and RF-I-P-2 from the peat layer of the former lake, of which the lower part is dated to 12,635–11,070 cal BP (Vs-2913) by the 14C method, and the upper part to 12,191–10,579 cal BP (Vs-2634) (Table 2.1), it can be seen that the composition of the peat that formed in the Aukštumala-1 settlement next to the peat and pollen forming in the water basin, and in the lake located in the area RF-I in the Baltic Sea (Fig. 2.7), is almost identical. It can be seen in the pollen diagram that the currently flooded coasts of the peat-forming lake were covered mostly with pine tree forests in sandy locations, and birch spread in more humid locations. The occurrence of pine tree forests found under water is related genetically to the spread of pine trees of A mtDNR type from southern Europe. The latest genetic research on pine trees shows that the mtDNR of pine trees in the RF-I research area is closest to the group of pine trees growing on the islands in the Cepkeliai bog (in southern Lithuania) (Danusevičius et  al. 2021; Chapter 7 in this volume). The amount of herbaceous plant pollen in the spectrum is not large. Pollen

The natural conditions were very similar at the turn of the Late Dryas and the Pre-Boreal, both at the beginning of the formation of the Aukštumala bog and in the former lake currently flooded in the Baltic Sea area RF-I. The composition of the fauna was also identical. The people of Late Swiderian culture who lived in the Lithuanian coastal area in those times engaged in hunting, fishing and gathering. The main livelihood was hunting reindeer

Figure 2.7. Palynological data in the period of the Yoldia Sea and the Ancylus Lake on the shores of the Baltic Sea; PB Pre-Boreal, B Boreal (drawing by A. Girininkas, based on data from Kabailienė 2006 and Balakauskas 2012).

24

Changes in Baltic Sea Relict Coasts in the Late Pleistocene and Early Holocene especially large (Struckmann 1880; Engel 1935; Groß 1939b; 1940; Kulikauskas 1959). Other reindeer antlers on the Curonian Spit that were found in the humus layer under the sand may be from the early stage of the Yoldia Sea, when the water level in the Baltic Sea dropped sharply. At that time, a population of reindeer existed in Lithuania (Table 2.2). Four locations of reindeer antler finds are currently known on the Baltic coast (together with the Curonian Spit), and reindeer antlers have been found in 17 locations all over Lithuania (Table 2.2; Fig. 2.8). There are 23 and eight such locations in Latvia and in Estonia respectively (Paaver 1965; Ukkonen et al. 2006; Zagorska 2012). Only forms of antler specific to reindeer inhabiting tundra were found in all of Lithuania from the GS-1 and early Pre-Boreal periods. This shows that tundra vegetation with thin forests dominated in the coastal zone of Lithuania until the very beginning of the Pre-Boreal. The antlers of reindeer that breed in forests have not been found either in Lithuania or in the rest of the east Baltic region.

(Rangifer tarandus). Parts of reindeer skeletons have been found on the Curonian Spit and in the city of Klaipėda (Fig. 2.2) (during the Yoldia Sea period, this area was also land) in the Lithuanian coastal area of the Baltic Sea. Some reindeer skeletons, dated using 14C, certainly correspond to the period of the Yoldia Sea (Table 2.2). Bows and arrows were used for hunting reindeer. During the GS-1 and the Early Holocene period (the beginning of the Pre-Boreal), flint arrow tips, which were found in the Aukštumala settlements, were used for hunting (Rimkus and Girininkas 2019, p. 46, Fig. 2; 2020, p. 38, Fig. 3). Antlers of reindeer from the GI-1a, b, c, d to GS-1 periods were found adjacent to the present shores of the Baltic, where there are former BIL coasts nearby. The circumstances of reindeer finds in Klaipėda can be explained by this (Groß 1939). The antlers of reindeer found on the Curonian Spit are of two origins. Some could have been carried by the currents in the Baltic Sea, starting from the first stage of the Littorina Sea or during its later stages, when the Curonian Spit started to form (Bitinas et al. 2017, p. 139). Currents in the Baltic Sea bring reindeer antlers ashore nowadays as well. They can be carried from the Sambian Peninsula (in the Kaliningrad region of Russia), where the populations of reindeer were

Nets were used for fishing during this period. Stone weights were used for the net draft. One was found in

Table 2.2. AMS 14C dates of the reindeer (Rangifer tarandus) skeletons in Lithuania (see Fig. 2.7). Dates were calibrated by OxCal v4.4 (Bronk Ramsey 2009) and the IntCal20 atmospheric curve (Reimer et al. 2013) Reindeer (Rangifer tarandus) before Last Glacial maximum Site and county

Sample

Lab. No.

14

C age

cal BC

cal BP

δ13C

1. Kalnėnai, Jurbarkas

Antler, probably Lyngby type tool

Tua-7686

28.685±365

3.632– 33.695

34.016–31.916

–17.4

2. Šnaukštai, Klaipėda

Antler, probably Lyngby type tool

Beta-407751 GrA-65623

41.460±560 37.690±280

43.840– 41.985 43.656– 43.322

45.239–43.234 42.392–41.906

–18.9 –1.92

cal BP

δ13C

Reindeer (Rangifer tarandus) after Last Glacial maximum Site and county

Sample

Lab. No.

C age

cal BC

14

3. Batakiai, Tauragė

Antler

Beta-470333

10.220±30

10.026–9.864

11.975–11.813

–19.2

4. Debeikiai, Anykščiai

Antler

Hela-599

12.085±100

12.350–11.807

14.299–13.756

–18.9

5. Ežerėlis, Kaunas

Antler

Hela-601

10.975±85

11.127–10.809

13.076–12.758

–19.8

6. Ežerėlis, Kaunas

Antler

Tua-7689

10.665±50

10.791–10.665

12.740–12.614

–19.6

7. Karkliškiai, Telšiai

Antler

Tua-7688

9.875±50

9.454–9.246

11.403–11.195

–19.6

8. Parupė, Biržai

Lyngby type axe, Beta-403383 antler

11.170±40

11.221–11.048

13.170–12.997

–19.4

9. Rausvė, Vilkaviškis

Antler

Tua-7690

10.145±50

9.995–9.654

11.944–11.603

–19.0

10. Rudamina, Lazdijai

Antler

Hela-600

10.435±95

10.76–10.017

12.625–11.966

–20.0

11. Upėtai, Telšiai

Antler and a fragment of skull

Tua-7687

5.305±35

4.249–4.042

6.198–5.991

–20.7

Other parts of reindeer skeletons Site and county

Part of the skeleton

References

12. Kretuonas 1 , Švenčionys

Antler

Daugnora, Girininkas, 1996; Girininkas, Daugnora 2015

13. Klaipėda, port

Bone (tibia) with cut mark

Gross 1939

14. Klaipėda town

Antler part

Gross 1939

15. Nida, in humus under a layer of sand

Antler

Gross 1939

16. Kaunas town

Antler

Paaver 1965

17. Kirsna river

Antler

Paaver 1965

25

Vladas Žulkus and Algirdas Girininkas

Figure 2.8. Locations of reindeer skeletons in Lithuania and the Kaliningrad region (Russia) and their 14C dating: 1. Kalnėnai, Jurbarkas district; 2. Šnaukštai, Klaipėda district; 3. Batakiai, Tauragė district; 4. Debeikiai, Anykščiai district; 5, 6. Ežerėlis, Kaunas district; 7. Karkliškiai, Telšiai district; 8. Parupė, Biržai district; 9. the River Rausvė, Vilkaviškis district; 10. Rudamina, Lazdijai district; 11. Upėtai, Telšiai district; 12. Kretuonas 1 settlement, Švenčionys district; 13. Klaipėda port; 14. Klaipėda; 15. Nida; 16. Kaunas; 17. the River Kirsna, Marijampolė district; A – undated reindeer skeletons, B – dated reindeer skeletons. The inset indicates the antlers of reindeer living on the tundra (compiled by A. Girininkas and L. Daugnora).

the Aukštumala II settlement (Rimkus and Girininkas 2019, pp. 46–48). People of that period used tools made of flint, quartz, granite and sandstone: scrapers, burins, hammerstones, etc., in their households (see Rimkus, Chapter 5 in this volume).

the Baltic Sea (Kliewe 2004, pp. 251–264). A consensus about the duration of the Ancylus transgression has not been reached. The end of this transgression on the Polish part of the Baltic coast is indicated to have been about the year 9,200 BP (Uścinowicz 2003, pp. 15, 17, 40, Figs. 6, 8, 35; 2004, p. 11), by which, also around 9,200 cal BP, regression had already started (Lampe 2002, pp. 13–19; Lemke et al. 2001; Bennike and Jensen 2013, pp. 17–20). The Ancylus Lake transgression maximum period established in southern Scandinavia is 10,300–9,800 cal BP (Hansson et al. 2019, p. 14). The peak period of the Ancylus Lake transgression has not been estimated precisely for the Lithuanian coastal area (cf. Gelumbauskaitė 2009, p. 33).

2.7. The development of the Middle and Late Ancylus Lake coasts The connection between the Atlantic Ocean and the Yoldia Sea that lasted for about 800 years was disrupted by isostatic processes and the Ancylus Lake (named after the mollusc Ancylus fluviatilis), which formed in the place of the present Baltic Sea. The beginning of the Ancylus Lake is related to transgression. Rapid Ancylus Lake transgression has been registered during the period from around 8,800 to 6,700 cal BC (Schmölcke et  al. 2006, 425), or ca. 10,700–9,500 cal BP (Borzenkova et al. 2015, p. 26), 10,700–9,800 BP (Andrén et al. 2011, p. 86; Rosentau et  al. 2017, pp. 115–118) and 10,800– 10,300 cal BP (Hansson et  al. 2019, p. 12). At the very south of the Baltic, the transgression is evident from the submerged pine trees and peat deposits dated to between 11,000 and 10,500 cal BP (Andrén et  al. 2011, p. 86). During the period of 7,9007,300 cal BC, the water level rose significantly in the southwest and western parts of

There is not a consensus on the water level during the early Ancylus transgression. The maximum level of the Ancylus Lake was above the present water level in southern Scandinavia (Björck et  al. 2008; Hansson et  al. 2019, p. 14). The water level during the Ancylus maximum transgression is thought to have been lower in the southern part of the Baltic, around 25 or 26 metres b.s.l. (Uścinowicz 2003, pp. 15, 17, 40, Figs. 6, 8, 35; 2004, p. 11), or 18 to 20 metres b.s.l. (Lampe 2002, pp. 13–19; Lemke et al. 2001; Benike and Jensen 2013, pp. 17–20). 26

Changes in Baltic Sea Relict Coasts in the Late Pleistocene and Early Holocene Lithuanian geologists point to different water levels during the early Ancylus transgression. Some think that the highest water level of the Ancylus Lake was around eight metres b.s.l. (Kabailienė 2006, p. 428), or around 12 metres b.s.l. (Damušytė 2011). Other sources indicate that it rose even up to five metres b.s.l. (Gelumbauskaitė and Šečkus 2015, Fig. 4).

RF-III-C-1, found at 12 metres b.s.l. (Table 2.1). There is about an 800-year difference between the oldest pine tree date, 27 metres b.s.l., and the latest pine tree date, 12 metres b.s.l., which would show the duration of the early Ancylus Lake transgression from around 28 to possibly around 13 metres b.s.l. (Fig. 2.6). A similar time for the early Ancylus Lake transgression (up to 850 or 900 years) is seen in the southern part of the Baltic region as well (Andrén et al. 2011, p. 86; Rosentau et al. 2017, pp. 115–118). However, the time of the early Ancylus Lake transgression could have been shorter, if the water maximum was at a lower level. The duration of this transgression is seen as slightly shorter, up to 500 years (Hansson et al. 2019, p. 7).

Research into landscapes surviving in Lithuanian waters that were flooded by the sea shows that during the Ancylus Lake transgression the highest water level was in 9,500 cal BP. It clearly did not exceed 12 metres b.s.l. and it could have been around 20 to 18 metres b.s.l., like in the southern part of the Baltic. Pine trees that have survived at a depth of 12 metres in the sandy seabed and peat deposits (RFIII-C-1, RF-III-C-2) are dated to 9,662–9,482 and 9,534– 9,323 cal BP (Table 1).2 The dates of six pine tree stumps with roots found on the seabed in Klaipėda port at a depth of 11 metres (RF‐III‐1, RF-III-A-2, RF-III-A-3, RF-III-A-4, RF‐III‐B‐1, RF‐III‐B‐2) are between, on average, 9,544 and 8,729 BP. A pine tree found at a depth of ten metres from RF-III-C-3 is dated to 9,006–8,724 cal BP. On the basis of these data, it is maintained that during the periods 9,757–9,330 and 8,972–8,477 cal BP (respectively 7,808– 7,381 and 7,023–6,528 cal BC), the water level must have been lower than 12 metres b.s.l. and it could have been the maximum transgression of the Ancylus Lake. The RF-I-P, RF-I-I-(2) and RF-III-1 depths and dates would contradict the view that the Ancylus Lake transgression peak was about 8,700–8,500 cal BP, when the water could have risen to four metres b.s.l. (Gelumbauskaitė 2009, p. 33). Research into underwater relict landscapes in Lithuanian waters details this transgression period. It took place earlier, around 9,400–9,200 cal BP. This transgression can be best illustrated by 14C dated peat layers and dates of trees with roots in the research areas RF-I and RF-III, 25 to 30 metres b.s.l. and at depths of 10 to 12 metres b.s.l. According to the data from our research, with regard to the dates of peat layers and the latest dates for tree growth in the RF-I area, and the earliest dates of peat as well as the tree growth period in the RF-III research area, the Ancylus Lake transgression could have finished around 9,200 cal BP (Table 2.1). Referring to the same radiocarbon dating of trees found under water in the Baltic Sea, other researchers provide a similar time and water level for the Ancylus Lake transgression (Damušytė 2011; Bitinas et  al. 2017, pp. 137–171; Bitinas and Damušytė, forthcoming).

When discussing the tendencies in changes to the sea level during certain periods, we encounter the problem of imprecise 14C dating for various reasons. Inconsistent organic sediment, mollusc shell and fishbone radiocarbon dates can be impacted by the reservoir effect that shows very clearly in coastal waters, and especially in the lagoons of the southeast Baltic (Bitinas et al. 2013, p. 85). When the Ancylus Lake filled with water again, the surplus went into the ocean through the River Dana, which had formed a course through the Darss Sill rapids and the Store Belt straits and flowed in the same way for about 1,000 years, until the banks of the Dana eroded, the Eresund Strait lowered, and the Ancylus Lake connected with the ocean through it and the Store Belt straits (Björck 1995, pp. 30–32). Sea water started flowing into the Baltic basin again: the Ancylus Lake stage was over. An indicator of this Ancylus Lake transgression may be the trunk of an oak (Quercus) found in the RF-I research area at a depth of 25 metres b.s.l. (sample RF-I-I-2). Its age (250 to 300 years) was established according to the rings from the core to the bark. The 14C dates obtained from it were in the range of 9,028–8,596 cal BP. This is the Boreal 2 (Bo 2) period, when single oaks and lime trees grew in the Lithuanian Baltic coastal area (Fig. 2.6), although the dominant taxons of trees were still pine, birch, alder and elm. The wide spread of the latter trees has been noted by other researchers as well (Balakauskas 2012, p. 224). The final date for the existence of the Ancylus Lake is seen differently. There are opinions that the lowest water level remained for about 1,300 years, during the period 9,800– 8,500 cal BP, called the Initial Littorina Sea Minimum, and that it is related to the data that sea water came into the Baltic Sea basin at around 9,800 cal BP (Andrén et al. 2011, p. 88; Rosentau et al. 2017, pp. 115–118; Hansson et al. 2019).

Based on the available data, the Ancylus transgression period can be specified more precisely, but the sea level reached during this transgression is still unknown. A relict pine tree from the research area RF-I-A has the earliest 14C date of trees located at a depth of 30 to 25 metres b.s.l. dated to 10,499–10,225 cal BP (8,550–8,276 cal BC) (Vs-1372), and the latest date, 9,662–9,482 cal BP (7,713–7,533 cal BC) (Vs-2760), belongs to the pine tree

The water level of the Baltic Sea on the east Baltic coast during the Ancylus regression (A2 period) is not clear. According to seismic-geological research data, the sea level could have dropped down to 46 metres b.s.l. (Gelumbauskaitė and Šečkus 2015, Fig. 4). In fact, seismic-geological research data are not identical in all

Dates were calibrated by OxCal v4.4 (Bronk Ramsey 2009) and the IntCal20 atmospheric curve (Reimer et al. 2013). 2 

27

Vladas Žulkus and Algirdas Girininkas locations on the coast. The data provided were obtained by researching the coast at Klaipėda, but research has not yet been carried out further to the south in the RF-I area. According to J. Šečkus, the impact of glacioisostasis was more important for the determination of the development of the southeast Baltic Sea shores during the Pre-Boreal and Atlantic period, as it was quite intense in those times (Šečkus 2009, p. 20). The data from our research suggest that the water level during the Ancylus regression must have been lower than 30 metres b.s.l., but a more precise minimum water level cannot be established.

and Šečkus 2015, Fig. 4), which would correspond to the Early Littorina Sea stage (Borzenkova et al. 2015, p. 36). From around 9,000 cal BP a great warming of the climate started, which lasted until the Holocene terminal maximum around 8,000–4,500 cal BP (Borzenkova et al. 2015, p. 37). This warming could have caused an almost even rise in the sea level. Despite the tendency towards a rising sea level, during the transgression of the Littorina Sea, unequal fluctuations in the sea level were registered. The water level is seen as rising evenly during the Littorina Sea and postLittorina Sea periods until the present one in the regions of Denmark, northern Germany and northern Poland (Rosentau et  al. 2017, p. 119, Fig. 5.13). Starting from southwest Sweden (in Bleking), in the north and northeast parts of the Baltic, coasts of the Littorina Sea are found, and the former sea level is fixed higher than the present sea level. It is thought that the eustatic and relative water levels in the southwest region of the Baltic Sea, where the modern glacioisostatic rise was almost insignificant, the water level rose from 20 metres b.s.l. to five metres b.s.l. between 8,000–6,000 BP. A rapid rise in the water level is registered in that region (the Bay of Kiel, Kattegate and Store Belt) in the period 7,900–7,300 BP (Kliewe 2004, pp. 251–264), or from 7,500 to 7,000 cal BP (Lampe 2002, p. 16).

There are few traces of the subsistence economy of Boreal I and Boreal II people. According to data from the latest research, bone arrow tips found in 1865 in the former Bachmann manor (now in Klaipėda) are attributed to the Boreal period (Groß 1939a, pp. 65–67). They have been dated to the Final Palaeolithic period, but more precisely specified geological data, the find circumstances of these artefacts and their typology, as well as their manufacture technique, compared to analogous artefacts in other countries (Neumayer 2009, p. 27; Zhilin et  al. 2014, pp. 165–187; 2018, pp. 42–48), show that the finds may belong to the Boreal period. These finds have not yet been precisely dated.3 2.8. The Littorina Sea shores

The later period of the Littorina Sea is related to comparatively short-term, larger or smaller fluctuations in the water level. Some authors point out that there were from two to six transgression stages in the Baltic Sea during the existence of the Littorina Sea (Yu 2003).

Large changes in the Baltic Sea ecosystem are related to the transformation of the fresh water Ancylus Lake into a brackish, and later sea water, basin. The beginning of the process has been fixed at around 9,800 cal BP on the southeast coast of Sweden. The period from around 9,800 cal BP to 8,500 cal BP is also called the Early Littorina Sea period (Borzenkova et al. 2015, p. 36). At about 8,500 cal BP, when the Baltic Sea became a brackish water basin, the Littorina Sea period began (Rosentau et al. 2017, pp. 117–118, Fig. 5.13; Hansson et al. 2019).

This period of existence of the sea is divided differently into sub-periods. Some authors distinguish an early stage of the Littorina Sea (Littorina Sea-1). This period is called the Mastogloia Sea in Sweden and Finland (Krog 1979; Bennike et al. 2021, p. 2), i.e., when the Baltic Sea became saline. The periods of this stage are different, because the Baltic Sea did not become brackish-marine in all places or all at once. The early stage of the Littorina Sea is considered to be the period from the first signs of the appearance of sea water until the Baltic Sea became completely saline (Hyvärinen 1988, pp. 7–11).

The process of the increase in salinity continued gradually and at different periods in different regions of the Baltic Sea. According to the specified data, marine molluscs appeared in the central Great Belt at ca. 8,200 cal BP, in the Mecklenburg Bay at ca. 8,100 cal BP, and in the Arkona Basin at ca. 7,600 cal BP (Bennike et al. 2021, p. 14). In the southwest Baltic area, the beginning of the Littorina transgression was registered at around 8,200 cal BP (around 6,700 BC) or some time later, around 7,500 cal BP (Lemke et al. 2001; Schmölcke et al. 2006, p. 428; Virtasalo 2006, p. 26, Fig. 6; Rößler et al. 2007, p. 59). In the southwest region of the Baltic (in the Bay of Kiel, Kattegate and Store Belt) the first Littorina littorea mollusc shells are dated to around 7,700 BP (Kliewe 2004, pp. 251–264).

The onset of the Littorina Sea transgression in southern Sweden has been dated to approximately 8,500 cal BP. The water level continued to rise until about 6,000 cal BP, when the level of the world’s oceans stabilised (Hansson et  al. 2019). In the southwest Baltic area, the beginning of the Littorina transgression is considered to be around 8,200 cal BP (Schmölcke et al. 2006, p. 428). The period of Littorina transgressions in the Baltic Sea has continued to the present day (Andrén et  al. 2011, p. 89; Rosentau et al. 2017, pp. 115–119, Fig. 5.13).

According to Lithuanian geologists, the beginning of the Littorina period is considered to be around 8,000 14C year BP, or 8,800 cal BP (Kabailienė 1999; Gelumbauskaitė

It is not clear what the initial water level was from which water started rising at the beginning of the Littorina transgression. The results of our research correlate with the opinion that the Littorina transgression could have started with a rise in the water level from around 47 to

This is one of five publicised artefacts (Groß 1939, p. 64, photograph a) currently preserved in the St Petersburg State Hermitage Museum (inv. ПА 1786), but its 14C date has not yet been established. 3 

28

Changes in Baltic Sea Relict Coasts in the Late Pleistocene and Early Holocene 45 metres b.s.l. (Virtasalo 2006, p. 26, Fig. 6). Lithuanian geologists also point out that the water level dropped to 46 metres b.s.l. (Gelumbauskaitė and Šečkus 2015, Fig. 4). The water level is considered not to have been lower than 28 metres b.s.l. in the west Baltic region at the beginning of the Littorina transgression (Uścinowicz 2008, p. 61). The date of peat deposits found in Lithuanian waters at RF-I-P1(3) indicate clearly that the water level dropped below 30 metres b.s.l.

and dated to around the period of 8,350–8,150 cal year BP (Borzenkova et al. 2015, pp. 36–37). Our research also confirms a short halt in the gradual rise in the water level (Fig. 2.6). A pine tree RF-I-P2(3) at a depth of 30 metres is dated to 8,020–7,931 cal BP (6,071–5,982 cal BC), and an aurochs horn (KIA-54525) from a depth of 27 metres (Zelenogradsk, Russia) is dated to around 7,871–7,735 cal BP (5,922–5,786 cal BC) (Table 2.3). The quite rapid sea transgression could have stopped for a while at around 33 or 32 metres b.s.l. This short halt in the rising water level (Fig. 2.6) correlates with the opinion that the Littorina transgression could have started later, at only around 7,500 cal BP (Virtasalo 2006, p. 26, Fig. 6). It is related to data that the water level rose quite rapidly in the period between 7,500 and 7,000 cal BP; later, the rise was slower (Lampe 2002, p. 16).

Fluctuations in the Littorina period water level of the Baltic Sea, as always, depended on changes in the ocean levels, influenced by changes in the climate. At around 6,200 BC the level of all oceans increased rapidly, and large areas of southern Scandinavia were flooded. At around 5,800 BC the climate optimum started in Europe. Later, after the so-called Small Ice Age, at around 5,000 BC, a rise in the sea level was noticed again (Fagan 2013, pp. 112, 114, 122, 137).

Later, the water level in the Baltic rose quite quickly and evenly. Opinions on its dynamics are various. It is pointed out that the water level had already risen around five metres b.s.l. in the Polish southern Baltic Sea at around 7,610 cal BP (Michaelis and Joosten 2007, pp. 104–105). The water level in the west Baltic could have been significantly lower, and might have reached only about 15 metres b.s.l. by 7,500 cal BP (Uścinowicz 2008, p. 61).

The period between 7,500 and 5,500 cal BP was the warmest for the entire Baltic Sea basin area, and the highest temperatures have been determined at around 6,500 cal BP (Borzenkova et al. 2015, pp. 37, 39, 42–43, Fig. 2.8). The even increase in the water level, influenced by the warming climate and the rising temperature of the oceans, could have stopped around the ‘8,200 year old cold event’, during which low temperatures were registered throughout all of Western Europe and regions close to the north Atlantic Ocean. This period could have lasted from 150 to 300 years. The ‘cold period’ has been identified in pollen diagrams in the sediments of lakes in eastern Latvia

At around 7,800 cal BP the water level on the Lithuanian coast could have been around 16 or 17 metres b.s.l. This can be shown by a pine tree with roots found next to Klaipėda, in the research area RF-II, at a depth of 14.5 metres, dated

Table 2.3. AMS 14C dates of the osteological material from coastal settlements and the seabed (see Fig. 2.7). After Linas Daugnora, Tomas Rimkus, Algirdas Girininkas (Chapters 5, 6 of this book) and Gytis Piličiauskas (Piličiauskas et al. 2015). Dates were calibrated by OxCal v4.4 (Bronk Ramsey 2009) and the IntCal20 atmospheric curve (Reimer et al. 2013) No

Area

Material dated

Depth (m b.s.l./a,s.l.)

Lab ID

C age

14

Cal BP (95.4%) (1 sigma)

Cal BC (95.4%)

1.

Duch cap Cape T-shaped red deer (Cervus elaphus) Olando antler axe

0–1 a.s.l.

KIA-53036

6170±35

7163–6958 5214–5009

2.

Palanga site

T-shaped red deer (Cervus elaphus) antler axe

0–1 a.s.l.

Poz-66588

5240±40

6031–5916 4082–3967

3.

Palanga site

Red deer (Cervus elaphus) antler axe

0–1 a.s.l.

Poz-64684

5515±30

6395–6277 4446–4328

4.

Palanga site

Adze, red deer (Cervus elaphus) bone

0–1 a.s.l.

KIA-54281

5310±45

6195–5995 4246–4046

5.

Palanga site

Adze, red deer (Cervus elaphus) bone

0–1 a.s.l.

KIA-54282

5060±29

5903–5735 3955–3783

6.

Palanga site

Red deer (Cervus elaphus) bone

0–1 a.s.l.

KIA-54285

5355±30

6214–6107 4265–4158

7.

Smeltalė site

Red deer (Cervus elaphus) antler

1 a.s.l.

KIA-54286

3069±29

3365–3208 1416–1259

8.

Smeltalė site

Red deer (Cervus elaphus) antler

3–2 b.s.l.

KIA-54288

6205±35

7170–6993 5221–5044

9.

Smeltalė site

Red deer (Cervus elaphus) antler

1 a.s.l.

KIA-54289

3850±28

4405–4220 2456–2271

10. Smeltalė site

Red deer (Cervus elaphus) bone

4–2 b.s.l.

KIA-54290 5970± 35 6899–6720 4950–4771

11. Smeltalė site

Red deer (Cervus elaphus) antler axe

5–4 b.s.l.

KIA‐54291

6380±35

7361–7253 5412–5304

12. Smeltalė site

Red deer (Cervus elaphus) hoe

8–5 b.s.l.

KIA-54292

7085±40

7980–7833 6031–5884

13. Smeltalė site

Red deer (Cervus elaphus) antler sleeve

6–5 b.s.l.

Poz-61594

6920±40

7843–7670 5894–5721

14. Smeltalė site

Elk (Alces alces) antler sleeve

4–3 b.s.l.

Poz-66589

6130±40

7159–6901 5210–4952

15. Zelenogradsk (Russia)

Aurochs (Bos primigenius) horn

27

KIA-54525

6988±26

7871–7735 5922–5786

29

Vladas Žulkus and Algirdas Girininkas to 8,008–7,571 cal BP (6,059–5,622 cal BC) (Vs-1388) (Table 2.1). Later, at around 7,500 cal BP, the water level on the Lithuanian coast is seen to have been around ten metres b.s.l. (Damušytė 2011.). This water level could be related to the end of the first Littorina transgression.

Sediments and formations from the last 5,000 years provide evidence of possible small variations in the sea level, or they may have resulted from short-term extreme events, such as catastrophic storms breaking barriers, saltwater intrusions into lagoons, and the formation of appropriate sediments and shore formations (Uścinowicz 2006). Due to these phenomena, the determination of the water level of the Littorina Sea later than 5,000 BP is less reliable (Lampe 2002, p. 17). At the beginning of the Late Holocene (ca. 5,000 BP), the sea level and coastlines in the south Baltic basin slowly approached their present position. As well, besides the systematic rise in the water level, there was a series of low-speed transgressions, and even short-term regressive fluctuations (Musielak et  al. 2017, pp. 74–75).

We have finds (bones of cattle, antlers, horns, and tools made from them) from Smeltalė (in the south of Klaipėda) from the end of the Littorina I period. Some dated (Table 2.3) adzes and axes made of bone and antler are currently preserved in the History Museum of Lithuania Minor, but the locations of the finds are unknown. Artefacts have been found in bogs on the former left bank of the River Smeltalė and in the Smeltalė estuary (Elertienė 1994). The land surface was around 2.4 metres a.s.l. (above sea level) or lower in the location of bogs before construction work. The horizon of the finds was about one to 1.5 metres a.s.l. Finds with the inventory numbers KKM 9141, 9142, 9146, 9150, 9151, 9153 have been dated. The oldest of them belong to two periods: approximately av. 7,906– 7,756 cal BP (5,958–5,808 cal BC) and 7,307–6,810 cal BP (5,358–4,860 cal BC). Among the finds from the older period, there was an antler adze dated to around 7,906 cal BP or av. 5,958 cal BC (KIA-54292), and a case (around 7,756 cal BP or av. 5,808 cal BC (Poz-61594), intended for an adze or an axe. These tools were next to the River Smeltalė, but further from the present estuary of the river, which was in the area flooded during the first Littorina transgression. The remaining tools are from a later period (Smeltalė 8, 10, 11, 14; Table 2.3), and are related to the second Littorina transgression. Therefore, the water level during that period, that is, during the second Littorina transgression, could not have been higher than the horizon of the finds. No cultural layers have been found or researched on the River Smeltalė, but the chronology of the finds would not deny a possible maximum of the Littorina 2 transgression of around five metres a.s.l. at about 6,700 cal BP (Gelumbauskaitė and Šečkus 2015, Fig. 4).

Short-term, possible fluctuations in the water level of a local nature have been registered on the coast of Lithuania by means of geological and archaeological data. Lithuanian geologists point out that there were three Littorina Sea transgressions (Bitinas and Damušytė 2004, pp. 37–45; Damušytė 2011, p. 48; Bitinas et  al. 2013, p. 85; Gelumbauskaitė and Šečkus 2015, Fig. 4; Bitinas and Damušytė 2021, forthcoming), but great differences exist in evaluating the development of the Littorina transgressions. Some see a large regression after the first Littorina transgression (Bitinas and Damušytė 2004, Fig. 4; Damušytė 2011, p. 48); others point to an insignificant slowing of the transgression (Gelumbauskaitė and Šečkus 2015, Fig. 4). The first Littorina transgression almost coincides with the Early Neolithic period at 5,500/5,300– 4,400/4,200 cal BC (Girininkas and Daugnora 2015, p. 8). The time and the water level during further Littorina transgressions are still to be specified. According to recent data, it was determined that at about 6,700 cal BP the Littorina 2 maximum could have reached a level of about five metres a.s.l., while during the Littorina 3 and post-Littorina (IV transgression),4 which could have been at about 5,400 and 4,400–3,600 cal BP, the water level could have risen up to two metres a.s.l. During the periods between these transgressions, the water level dropped to about 1.5 metres or one metre b.s.l. (Gelumbauskaitė and Šečkus 2015, Fig. 4). According to other data, the coastline was from 3.5 to eight metres a.s.l. at around 7,000 cal BP. Later, when the regression had already started, around 6,700 cal BP, the coastline was determined to be around three metres a.s.l. in the northern parts, around one metre a.s.l. in the centre, and around four metres b.s.l. in the southern parts of Lithuania (Damušytė 2011, p. 48, Fig. 10).

Discussions are still continuing on the water level that was reached during the Littorina transgressions and regressions. The changes in the water level are especially clear during the later stages of the Littorina Sea. In our opinion, the changes to the coastline on the Lithuanian coast are most similar to those determined for the southeast and southern parts of the Baltic. Fluctuations in the sea level at the end of the Atlantic and in the Sub-Boreal period for the southern Baltic area were ascertained based on a set of 315 radiocarbon dates for different terrestrial and marine sediments, collected at 164 sites. According to the data from this research, the water level was about eight metres b.s.l. at around 7,000 cal BP. Then it gradually rose and reached a level of about three metres b.s.l. at around 5,000 cal BP, and by about 2,000 cal BP it had already risen to about 1.5 metres b.s.l., until it was equal to the present level (Uścinowicz 2006). Similar tendencies in the rising water level during the period of the Littorina Sea were registered in the southern Arkona basin and the Mecklenburg Bay (Rößler et al. 2007, pp. 56–57, Fig. 5; Rosentau et al. 2017, p. 117, Fig. 5.12).

The Littorina 2 transgression is seen differently on the southern shores of the Baltic. There, a significant slowing This stage of the Littorina Sea, related to colonisation by freshwater molluscs, is sometimes called the Limnea Sea. It has been dated 4400 cal BP (Borzenkova et al. 2015, p. 26). 4 

30

Changes in Baltic Sea Relict Coasts in the Late Pleistocene and Early Holocene in the rise in the water level has been established during the period between 4,500 and 4,100 BC (around 6,450– 6,050 cal BP) (Schmölcke et al. 2006, p. 433, Fig. 3). It is maintained that during the period of the second Littorina transgression, the water level did not exceed the present water level of the Baltic Sea in the southern part of the Baltic (Uscinowicz 2004; 2006; Michaelis and Joosten 2007, pp. 101–134).

‘around 4,500 years ago’ is considered to be the reason for the disappearance of the fisher and hunter settlements of the Šventoji Narva culture. People are thought to have returned to these locations only after 200 or 300 years, during the regression (Kunskas 2005b, pp. 30–31). A seal (Phocidae) bone from the Palanga settlement dated av. about 5,000 cal BP is from the period of the same regression.

The situation and chronology of the Palanga Stone Age find location (Girininkas 2011) and more precisely established dates of archaeological artefacts (Table 2.3) would confirm the hypothesis of a small regression that followed the Littorina 2 maximum. It is thought that the water level could have fallen from about one or 1.5 metres b.s.l. (Gelumbauskaitė and Šečkus 2015) to five metres b.s.l. (Kabailienė 2006, p. 430). At that time, a Neolithic period settlement already existed in Palanga, by the Rąžė rivulet (Girininkas 2011). The settlement was at a level of about one metre b.s.l., and the ages of bone and antler tools found in it are between 6,395 and 5,735 cal BP (4,446–3,783 cal BC). Thus, the water level must have been no higher than two or three metres b.s.l. at around 6,400 cal BP.

Thus, the time for the Littorina 3 transgression estimated by geologists to be around 4,500–4,000 cal BP, or even earlier, around 5,400 cal BP (Gelumbauskaitė and Šečkus, 2015, Fig. 4), or around 5,220–4,788 cal BP (3,271–2,838 cal BC), when the water level could have been about three metres a.s.l. (Damušytė 2011, p. 48, Fig. 10; Gelumbauskaitė and Šečkus 2015) would not be contradicted by the archaeological data, but would specify the period of the transgression. It could have happened between around 5,500–5,200 cal BP (3,500–3,300 cal BC). Later, there was a period of regression, after which one more rise in the water level was registered: the postLittorina (Limnean) transgression. The archaeological data would confirm that there was a period of regression during the period between the Littorina 3 and post-Littorina (Limnean) transgressions. This regression could have been influenced by the warming of the climate in the Baltic Sea basin, which started from 4,500 cal BP (Borzenkova et al. 2015, p. 42). At that time, people seem to have settled by the Smeltalė rivulet, the banks of which rose to about two metres a.s.l. A red deer antler (KKM 9145) found in the area is dated to 4,405–4,220 cal BP (2,456–2,271 cal BC). The horizon of the finds was about one to 1.5 metres a.s.l.

During the period of the third transgression (around av. 6,095–4,482 cal BP or around av. 4,146–2,532 cal BC), the Lithuanian coastline is defined quite differently: from about one to 2.5 metres a.s.l. in the northern part to about three metres b.s.l. in the southern part (Bitinas and Damušytė 2004, Fig. 4; Damušytė 2011, p. 48, Fig. 10). According to other data, the Littorina 3 transgression could have taken place at around 5,220–4788 cal BP or 3,271–2,838 cal BC,5 when the water level was two to four metres a.s.l. (Gelumbauskaitė 2009, p. 34).

During the post-Littorina (Limnean) transgression, the water rose above the present sea level (Gelumbauskaitė 2009, p. 34; Gelumbauskaitė and Šečkus 2015). Two finds next to the Smeltalė rivulet (KKM 9145, 6596) are dated to around 4312 and 3286 cal BP (2,364–1,338 cal BC). The horizon of these finds was at about one to 1.5 metres a.s.l. The chronology of the finds next to the Smeltalė rivulet would allow us to conclude that the post-Littorina transgression, during which (at around 4,400–3,600 cal BP)6 the water level could have risen to two metres a.s.l. (Gelumbauskaitė and Šečkus 2015), is likely. Also, the hypothesis that around 4,000 cal BP the regression during which the water level in the Lithuanian coastal area could have dropped to 1.5 metres b.s.l. was already taking place, is confirmed (Damušytė 2011, p. 48, Fig. 10).

The layers of Neolithic find locations in Šventoji were at a depth of just 0.4 to 0.8 metres, only about 0.6 to 0.2 metres higher than the present sea level (cf. Rimantienė 2005, p. 272). The newly calibrated dates of the finds show that this settlement existed during two periods. The oldest cultural layer formed at around 5,720–5,520 cal BP, before the Littorina 3 transgression, while the later one formed after the transgression, at around 5,140–4,610 cal BP (cf. Table 2.4; Šv. Nos 1–3, 6, 9 and 12–14, 18, 19, 21–23, 25–27, 31–33, 35). The interval between the layers of the settlement is almost 400 years. It is obvious that the people who settled in this location had migrated, and a settlement appeared in the same location later, when presumably the water level had dropped (Rimantienė 2005, pp. 271, 273, 286, 288). It can be attributed to the comparatively short-term Littorina 3 transgression. It seems that a sudden rise in the sea level happened, and as a result some Šventoji settlements that had existed were abandoned, and people returned to their former locations after a few centuries. The transgression which happened

People were living in the Palanga settlement next to the Rąžė rivulet during the transition period from the Late Neolithic to the Bronze Age, and the peat formation process might have started in this area during the regression of the Limnean Sea. The available geological data indicates that the settlement existed during the period of the former regression of the Limnean Sea, at around

Here and further (Gelumbauskaitė 2009) dates are recalculated referring to OxCal v4.4 (Bronk Ramsey 2009) and the IntCal20 atmospheric curve (Reimer et al. 2013). 5 

Other researchers point out that the Littorina transgression was at around 3,915–3,608 cal BP, or 1,874–1,660 cal BP (Bitinas and Damušytė 2004). 6 

31

Vladas Žulkus and Algirdas Girininkas Table 2.4. AMS 14C dates of the earliest settlements at Šventoji. Dates were calibrated by OxCal v4.4 (Bronk Ramsey 2009) and the IntCal20 atmospheric curve (Reimer et al. 2013) No

Site / Lab ID

Depth from the current ground surface

BP

Cal. BC

Cal BP

1

Šv.2/4, Vs-811

40–60 cm

5110±110

4072–3651

6021–5600

2

Šv.2/4,Vs-633

40–60 cm

4910±110

3960–3509

5909–5458

3

Šv.2/4,Tua-2076

40–60 cm

4875±65

3800–3518

5749–5467

4

Šv.26,Hela-2463

40–80 cm

4835±34

3654–3527

5603–5476

5

Šv.3,Hela-2461

40–80 cm

4827±33

3651–3527

5600–5476

6

Šv.4,Hela-2464

40–60 cm

4805±33

3645–3527

5592–5476

7

Šv.3,Hela-2465

40–80 cm

4783±32

3642–3516

5591–5465

8

Šv.3,Hela-2462

40–80 cm

4756±32

3636–3507

5585–5456

9

Šv.2/4,LJ-2523

40–60 cm

4730±50

3634–3491

5583–5440

10

Šv.1,LJ-2528

60–80 cm

4640±60

3536–3328

5485–5277

11

Šv.1,Hela-2476

60–80 cm

4625±32

3516–3422

5465–5371

12

Šv.2/4,Tua-2075

40–60 cm

4530±65

3378–3014

5327–4963

13

Šv.2,Hela-2477

60–80 cm

4507±32

3356–3097

5305–5046

14

Šv.2/4,Ta-2637

40–60 cm

4480±80

3366–2925

5315–4874

15

Šv.1, IGAI-12

60–80 cm

4470±40

3349–3017

5298–4966

16

Šv.3,Vib-9

40–80 cm

4410±70

3193–2906

5142–4855

17

Šv.1,Ta-247

60–80 cm

4400±90

3347–2892

5296–4841

18

Šv.2/4,Vs-23

40–60 cm

4400±55

3131–2903

5080–4852

19

Šv.2/4,Bln4385

40–60 cm

4385±50

3110–2897

5059–4846

20

Šv.6,Ki-9462

50–70 cm

4370±70

3132–2885

5081–4834

21

Šv.2/4,Ta-2636

40–60 cm

4315±70

3109–2848

5058–4797

22

Šv.2/4, Vs-956

40–60 cm

4300±180

3378–2466

5327–4415

23

Šv.2/4, Vs-812

40–60 cm

4290±110

3134–2617

5083–4566

24

Šv.42, Vs-1956

200 cm?

4280±40

3016–2866

4965–4815

25

Šv.2/4,Ki-9458

40–60 cm

4250±80

3031–2580

4980–4529

26

Šv.2/4, Vs-968

40–60 cm

4230±90

3032–2571

4981–4520

27

Šv.2/4, Vs-957

40–60 cm

4200±100

3025–2555

4974–4504

28

Šv.23,Vib-1

80–100 cm

4190±80

2926–2567

4875–4516

29

Šv.6,Ki-9463

50–70 cm

4180±70

2907–2575

4856–4524

30

Šv.6, Vs-499

50–70 cm

4160±110

3016–2464

4965–4413

31

Šv.2/4,Ki-9460

40–60 cm

4160±80

2907–2566

4856–4515

32

Šv.2/4,Ki-9461

40–60 cm

4160±80

2907–2566

4856–4515

33

Šv.2/4,T-11004

40–60 cm

4145±80

2901–2562

4850–4511

34

Šv.1,Ta-246

70–90 cm

4120±80

2888–2556

4837–4505

35

Šv.2/4, Vs-967

40–60 cm

4120±110

2924–2402

4873–4351

36

Šv.3,Ki-9457

40–80 cm

4120±70

2886–2561

4835–4510

37

Šv.1, Vs-22

70–100 cm

4100±100

2908–2452

4857–4401

38

Šv.42, Vs-1981

200 cm?

4090±50

2781–2557

4730–4506

39

Šv.6, Vs-500

50–70 cm

4070±110

2897–2341

4846–4290

40

Šv.41A,Vs-1828

100 cm?

4020±60

2702–2401

4651–4350

41

Šv.1,Le-865

60–80 cm

3880±80

2574–2136

4523–4085

42

Šv.9,Vib-8

100–130

3860±90

2503–2121

4452–4070

43

Šv.1,Le-835

60–80 cm

3860±50

2467–2199

4416–4148

44

Šv.23,Ki-9458

80–100 cm

3790±80

2465–2023

4414–3972

45

Šv.6,Ta-2638

50–70 cm

3780±100

2474–1933

4423–3882

32

Changes in Baltic Sea Relict Coasts in the Late Pleistocene and Early Holocene 4,200–4,000 BP, or slightly later, at the beginning of the second transgression of the Limnean Sea (Girininkas 2011, pp. 49–50, 56, Fig. 1).

corresponds to the Late Mesolithic. At that time, people chose to settle in higher locations. One such settlement in that period could have been the Late Mesolithic location of finds detected at Venckai (Klaipėda district), on one of the former terraces to the northeast of the Svencelė bog. Patinated flakes and one blade were found there (Rimkus and Girininkas 2020, pp. 404–405) (see Rimkus, Chapter 5 in this volume).

So far, the reason for sudden, and possibly short-term, transgressions is not clear. Hurricanes in the Baltic are quite a frequent occurrence, but even the most powerful hurricanes known up to now caused waves in the Baltic Sea not exceeding a height of eight metres (Kelpšaitė 2008). There are data about high seismic activity during the Scandinavian post-glacial period: 17 traces of earthquakes have been registered. These earthquakes caused tidal waves of up to 20 metres in height. The dates of the determined earthquakes are: 11,600, 11,200, 10,430 10,400, 9,663, 9,428, and 9,291 BP. According to some authors, the tidal waves of some earthquakes on the Swedish coast could have reached the coastal areas of the Gulf of Bothnia and the Gulf of Finland (Mörner 2008, pp. 71–76; Mörner and Dawson 2011, pp. 375–376). This aspect of eastern and southeast coastal areas has not been investigated so far; therefore, we cannot claim this event had an impact on the sudden short-term fluctuations in the sea level during the Littorina Sea stages. In addition, the rise of the sea level, however high, was temporary, and it could not have impacted transgressions that lasted a few centuries.

An osteological find, the horn of an aurochs (Bos primigenius), found at a depth of 27 metres b.s.l. in the Baltic Sea at Zelenogradsk (Kaliningrad region), and dated to 7,871–7,735 cal BP (5,922–5,786 cal BC) (Table 2.3), can also be attributed to the period of the first Littorina transgression. Aurochs bones dated to the Middle Holocene period have been found in the continental part of Lithuania (Padovinys, Marijampolė district, Ariogala, Raseiniai district) (see Daugnora and Girininkas, Chapter 6 in this volume). At the end of the existence of the Ancylus Lake and at the beginning of the Early Littorina Sea, there were favourable conditions for these animals to breed: with thin forests and meadows in woods, their food could be supplemented by acorns and the branches of trees and bushes, both in the coastal area by the Baltic Sea and in the continental part of Lithuania. During the second Littorina transgression, before the coastline in the Lithuanian coastal area was lower than the present one, the people of the Late Mesolithic made many artefacts from the bones and horns of red deer (Cervus elaphus) and elk (Alces alces). Such tools have been found in the lower reaches of the River Smeltalė (Nos 8, 10, 11, 14, Table 2.3). Tools from the second Littorina transgression found in the peat that formed in the estuary of the River Smeltalė were also made of the bones and horns of red deer and elk.

The patterns in sea level changes during the Baltic Sea Littorina period were totally different in Scandinavian, northeast Estonian and northwest Russian coastal areas, due to crustal uplift. Compared to Scandinavia, the interpolated surface of present-day crustal uplift rates (in mm/year) in Lithuanian coastal areas is very insignificant. At Nida and in the Nemunas delta, it is about 0.0 millimetres per year; in the environs of Palanga-Šventoji, it is about +1 millimetres per year (Rosentau et al. 2017, p. 120, Figs. 5.13, 5.14). According to Lithuanian marine and coastal area research data, the reconstructed tendencies of fluctuations in the sea level can be compared to the fluctuations in the water level in southern Baltic coastal areas, and more reliably in the Bay of Gdańsk in Poland (Uścinowicz 2006).

During the maximum period of the Baltic Sea Littorina transgression, the population of red deer and elk was dominant. These animals were widely hunted due to their nutritional value and their skeletal structure. Similar features of the spread of the red deer population are noticeable in the whole region of the south Baltic (Kozlowski 1989; Makowiecki et  al. 2018). People used them not only for food, but also to make tools from their bones and horns. The population of red deer spread especially during the Boreal and Early Atlantic periods, as they fed on the vegetation of that time: the leaves of aspen, hawthorn, ash, oak, willow and alder, and pine shoots. They peeled the bark of ash, aspen and fir trees. This vegetation flourished in the former forests of the Baltic Sea coastal areas. The favourite foods of deer included heather, blueberries, cowberries and other herbaceous plants that flourished in the Early Atlantic period (Kabailienė 2006; Balakauskas 2012). The animals were hunted in the winter, when their young, which were born in May or June, had grown up. Red deer could have comprised up to 25% of all hunted fauna in the diet of Late Mesolithic people (see Daugnora and Girininkas, Chapter 6 in this volume).

Processes contributing to relative sea level (RSL) changes in the region are neither great nor significant; therefore, relative sea level (RSL) fluctuations are very close to the eustatic sea level (ESL) fluctuations (Rovere et al. 2016). The research carried out by us, which is based on the dates of tree roots found in the sea at depths of ten to 30 metres, and those of peat deposits, as well as the specified dates of archaeological finds, should provide a sufficient amount of data not only on the relative sea level changes in Lithuanian coastal areas, but also to determine the eustatic sea level fluctuations in the Baltic Sea. 2.9. The subsistence economy The rise in the water level during the first Littorina transgression could be attributed to the more humid climate in the present area of the Lithuanian coast. This period 33

Vladas Žulkus and Algirdas Girininkas Elk live in forests with varied vegetation, and were widespread in the Baltic coastal area by the BO 2 and A1 periods during different seasons: during the warm season, they lived in mixed and deciduous forests, and in winter in coniferous forests, especially pine forests (Balakauskas 2012). The meat from elk could have comprised up to 8% of the Late Mesolithic diet (see Daugnora and Girininkas, Chapter 6 in this volume).

could be the beginning of the transgression. The Palanga settlement was further from the Baltic coast, and was established on the Rąžė, a rivulet that flowed into the former lagoon which had already started forming peat (Girininkas 2011, pp. 48–57). The latest 14C date of finds from the Palanga settlement allow us to specify the settlement’s chronology and advance the dating of archaeological artefacts (Piličiauskas et al. 2015, pp. 3–28).

Water and food resources were important when choosing locations for settling in the Mesolithic period. Mesolithic communities usually settled by large lakes, or at the source, estuary or confluence of rivers, where there was more fish. No fishing tools or ichthyological material have been found at Late Mesolithic settlements in the Lithuanian coastal area, but Latvian and Estonian palaeo-ichthyological research data show that both sea and freshwater fish were caught (Sloka 1985; Lõugas 1997; 2006, pp. 75–89). Research into east Baltic Mesolithic settlements show that fish migrating from the sea to fresh water were also caught. Middle and Late Mesolithic communities caught European hake (Merluccius merluccius), blue ling (Molva molva), Atlantic cod (Gadus morhua), and other fish (Daugnora and Girininkas, Chapter 6 in this volume).

The earliest settlements at Šventoji are about 300 years later than those at Palanga (Table 4). The settlements at Šventoji began emerging at the beginning of SB1, in the Middle Neolithic. For a long time, it has been considered that the Šventoji bogs, next to which many settlements were found, existed adjacent to a lagoontype lake that had been cut off from the sea in the middle of the Littorina Sea period (Rimantienė et  al. 1971, pp. 131–139; Kabailienė and Rimantienė 1996, pp. 185– 196; Kunskas 2005, p. 24). According to archaeologists, the largest concentration of Neolithic monuments was on the northwest coast of the lagoon-type lake (Rimantienė 2005, p. 214). Only in 2006, after research next to the Šventoji 2/4 settlements, was it discovered that they were established not beside the lagoon, but on the right bank of the former River Šventoji (Brazaitis 2007, pp. 35–42). If, according to the previous assumption, the settlements were washed away by the third Littorina transgression (Kabailienė and Rimantienė 1996, pp. 185–196), the finds would have been spread across a larger area, and not only around the former riverbed. The river burst its banks in the spring and autumn floods, flooding large stretches of land; therefore, it is probable that most of the Šventoji settlements researched were settlements with structures on poles (Girininkas 2005, pp. 33–45). The inventory of settlements washed away during the seasonal floods was deposited in the old riverbed of the River Šventoji. The research conducted (Juodagalvis 2002; Brazaitis 2007, pp. 35–42) shows clearly that the Šventoji Middle Neolithic settlements and the locations of finds were on the banks of the River Šventoji which flowed 1.5 to two metres above the water level of the Baltic Sea at that time in the Middle and Late Neolithic.

After the second Littorina transgression, the regression followed, which could have left a terrace of about four kilometres (Kabailienė 2006, p. 430; Gudelis 1965). The water level fell to five metres b.s.l. During the regression, shallows formed in the drained coasts, and eolian processes started which bridged bays in the sea. The regression is associated by Lithuanian archaeologists with the end of the Early Neolithic period (Girininkas and Daugnora 2015, p. 8). People in those times moved closer to the drained sea at the estuaries of rivers that had formed, and lagoons that had flows going through. There are no known settlements from this period in coastal areas of Lithuania, southern Latvia and the Kaliningrad region, but the Baltic Sea sometimes washes up single tools from the destroyed cultural layers of settlements from that time. In the Early Neolithic, T-shaped axes made only from the horns of red deer appeared. One of the earliest tools of that type in the east Baltic region, attributed to the Early Neolithic period, is a T-shaped axe found on the coast next to Melnragė 2 (north of Klaipėda), dated to 7,163–6,958 cal BP (Table 2.3). They have been found in the coastal region of the eastern Baltic (Palanga in Lithuania; Sārnate and Sise in Latvia) and in settlements in the continental part of the country (Bērziņš et  al. 2016, pp. 1319–1325; Timofeev 1981, pp. 115–119; Cherniavski 1992, pp. 116–120; Rimkus 2019, pp. 1–11).

Seals (Phocidae) and harbour porpoises (Phocoena phocoena), which lived in coastal areas of the Baltic Sea and were hunted by Middle and Late Neolithic communities, contributed greatly to their economy. The bones of these animals were found in almost all settlements in east and southeast Baltic Sea coastal areas, and those that were established next to rivers that flowed into the sea. They were found in the Palanga (Paaver 1958, pp. 1–3) and Šventoji 2/4 settlements (see Daugnora and Girininkas, Chapter 6 in this volume, Table 4). The osteological material from the Palanga and Šventoji settlements shows that four types of hunted seal were detected: grey (Halichoerus grypus), harbour (Phoca vitulina), harp (Pagophylus groenlandicus) and ringed (Pusa hispida) seals, as in all areas of the Baltic at that time (Schmölcke, 2008, pp. 231–246). The population of harp seals could have been more numerous in the Middle

The vast majority of tools from the Palanga settlement made of bone and horn have been dated to the beginning of the Middle Neolithic (Girininkas 2009; 2021 forthcoming) or the very end of the Atlantic A2 period and Sub-Boreal SB1. They are dated to the 6,336–5,820 cal BP period (Table 2.3). This period is between the Littorina second regression and the third Littorina transgression, and 34

Changes in Baltic Sea Relict Coasts in the Late Pleistocene and Early Holocene and Late Neolithic, due to the increase in the salinity of the Baltic Sea (Bennike et al. 2008, pp. 263–272; Emeis at al. 2003, pp. 411–421). Settlements where the bones of domestic animals were scarce were rich in finds of bones of seals and harbour porpoises. A lot of bones of seals and few bones of domestic animals were found in the Šventoji 6 and 26 settlements from the Late Neolithic (Girininkas and Daugnora 2015). It is thought that hunting seals delayed the development of animal husbandry and crop production by coastal area communities. Seals were possibly easily hunted in these areas, and the products obtained from them fully met the needs of local people. Not only the hides and fat of seals, but also skeletons are found in east Baltic continental Late Neolithic settlements, even 300 kilometres from the coast (Lоzе 1979, p. 128). This shows that products from seals were in great demand in the continental zone of the east Baltic. Due to the tradition of using seal and eel fat for providing light, the elongated clay lamps known in all areas of Ertebølle and Narva cultures (the coastal region of the south and east Baltic) were already widespread in the period of the Early Neolithic (see Daugnora and Girininkas, Chapter 6 in this volume).

The water level in the Baltic Sea in eastern Baltic coastal areas during the Ancylus regression is not clear. The 14C data of pine trees with roots RF-I-I(2) and peat layers RFI-P deposited in the research areas show that the water level in the Baltic Sea must have been lower than 30 metres b.s.l. at the end of the Ancylus period during the regression, but a more precise water level was not established. The results of our research correlate with the opinion that the rapid Littorina transgression at around 8,800 cal BP could have started when the water level rose from about 45 metres b.s.l. or lower. The quite rapid sea transgression at around 8,000 cal BP could have stopped briefly for about 200 years when the water level was around 32 or 33 metres b.s.l. (see RF-I-P2(3) pine tree and aurochs horn finds (Fig. 2.6). The slowing down of the rise in the water level or its short stabilisation at lower than 14.5 metres b.s.l. and the subsequent gradual rise in the water level might be related to the end of the first Littorina transgression in the period around av. 7,800 cal BP. This can be confirmed by the dates of a pine tree found in the research area RF-II-I, and of a T-shaped axe found in the coastal area near Klaipėda (Vs-1388; KIA-53036) (Table 2.1; 2.3).

2.10. Conclusions The latest research conducted in Lithuanian coastal waters on the development of the coast and its settlement during the Final Pleistocene and Early Holocene period, based on flooded relict coasts, elements of the landscape and archaeological research data, has made possible the determination and specification of the transformation of the coast related to fluctuations in the water level and the subsistence economy of people who settled in the coastal area in those times.

According to the dating and localisation of tools from the osteological material found beside the River Smeltalė (all the tools were found at 1.5 to one metre a.s.l.), they can be divided into four chronological groups, the first of which (7,980–7,833/7,843–7,670 cal BP) is related to the Littorina I transgression, the second (7,361–7,253/6,899– 6,720 cal BP) to the Littorina II transgression, the third (4,405–4,220 cal BP) to the post-Littorina transgression, and the fourth (3,365–3,208 cal BP) to the post-Littorina regression. There are longer or shorter periods between these chronological groups that correlate with the periods of possible short transgressions determined by geologists. The chronology of the Smeltalė finds would not deny the possible maximum of the Littorina 2 transgression above the present sea level at around 6,700 cal BP.

In around 11,300 cal BP the water level in the east Baltic was certainly lower than 32 metres b.s.l. It was still lower than 32 metres b.s.l. later, during the final stage of the Yoldia Sea and the initial stage of the Ancylus Lake in the period around 10,090–9,860 BP. The Baltic coast was more than ten kilometres to the west of the present coast of the Curonian Spit. This is confirmed by 14C dating of relict trees found in the research area RF-I at 25 to 30 metres b.s.l. and the peat layers deposited after the BIL regression in the water basins at a depth of 29 or 30 metres b.s.l. (Table 2.1; Fig. 2.6).

The tools from the Palanga settlement belong to the regression period that followed the Littorina 2 transgression (6,395–6,277/5,903–5,735cal BP), and are older than the Šventoji 2/4 settlement, which is related to the end of the Littorina 2 regression and the beginning of the Littorina 3 transgression.

According to data of relict pine trees from the dating of the Ancylus Lake early transgression (Vs-1372, Vs-2760 – Table 2.1), the sea could have risen from 28 to around 13 metres b.s.l. over 800 years. According to our research data, the highest water level reached during the Ancylus Lake transgression 9,500 cal BP ago certainly did not reach 12 metres b.s.l. According to the dates of peat layers and the latest dates of tree growth in the RF-I area, as well as the earliest dates of peat and the period of tree growth in the RF-III area, the Ancylus Lake transgression could have finished around 9,200 cal BP (Fig. 2.6). The sea level reached during this transgression is still unknown.

The layers of the Šventoji 2/4 Neolithic settlements are from the later period (around av. 5,140–4,610 cal BP) that formed during the period of the Littorina 3 regression. These archaeological data specify the time of the Littorina 3 transgression: it could have occurred at around 5,500– 5,200 cal BP (3,500–3,200 cal BC). During the period between the Littorina 3 and the post-Littorina, (Limnean) people settled again by the Smiltalė rivulet, of which the banks rose to around two metres a.s.l. The chronology of the finds next to the Smeltalė rivulet and in the settlement of Palanga confirms that the post-Littorina transgression 35

Vladas Žulkus and Algirdas Girininkas could have taken place and the regression could have started at around 4,200 cal BP.

Denmark, Southern Scandinavia, during the Holocene. Boreas, 37, 263–272. Bennike, O. & Jensen, J. B. 2013. A Baltic Ice Lake lowstand of latest Allerød age in the Arkona Basin, southern Baltic Sea. Geological Survey of Denmark and Greenland Bulletin 28,17–20.

Our research conducted in the sea and on the coast, based on the dates of relict trees and peat deposits, as well as on the specified chronology of archaeological layers and finds, provides sufficiently reliable data that allow us to specify not only relative but also eustatic changes to the water level of the Baltic Sea.

Bennike, O., Jensen, J. B. Nørgaard-Pedersen, N., Andresen, K. J., Seidenkrantz, M.-S., Moros, M. & Wagner, B., 2021. When were the straits between the Baltic Sea and the Kattegat inundated by the sea during the Holocene? Boreas. https://doi.org/10.1111/ bor.12525

The latest archaeological research has enabled us to specify the cultural dependence of Final Pleistocene and Early Holocene people, and features of the subsistence economy in Baltic Sea coastal areas. Traces of GS-1 period Early Swiderian culture people were found at the Pūzraviečiai find location (Šilutė district). It was estimated for the first time that communities of Late Swiderian culture, which hunted reindeer and other fauna of that time and engaged in fishing, lived in the Lithuanian coastal area during the Early Pre-Boreal. This is confirmed by research into the first, second and third Aukštumala (Šilutė district) settlements.

Bērziņš,V., Lübke, H., Berga, L., Ceriņa, A., Kalniņa, L., Meadows, J., Muižniece, S., Paegle, S., Rudzīte, M. & Zagorska, I., 2016. Recurrent Mesolithic–Neolithic occupation at Sise (western Latvia) and shoreline displacement in the Baltic Sea basin. The Holocene, 26 (8), 1319–1325. Bitinas, A., 2011. Paskutinis ledynmetis Rytinės Baltijos regione. Klaipėda: Klaipėdos universiteto leidykla. Bitinas, A. & Damušytė, A., 2004. The Litorina Sea at the Lithuanian Maritime region. Polish Geological Institute Special Papers, 11, 37–46.

Traces of Late Mesolithic hunters and fishers from the period of the first Littorina transgression found in the find location at Venckai (Klaipėda district) show an increase in the humidity of the climate, which forced people to settle in higher places.

Bitinas, A. & Damušytė, A., 2021. Southeastern Baltic Sea during the Late Glacial and Holocene: from relative sea level curves to eustatic sea level changes. In press.

The research material from the Smeltalė, Palanga and Šventoji 2/4 settlements relating to the period of the Littorina 2, Littorina 3 and Post-Littorina transgressions shows that people in the Late Mesolithic and Middle Neolithic adapted to the changing natural conditions in the Baltic Sea coastal area. Due to the efficient appropriative economy (fishing, hunting seals) and the exchange of amber and its products, these people developed industrial farming much more slowly than communities that lived in the continental zone at that time.

Bitinas, A., Damušytė, A., Vaičiulytė, S. & Jurkin, V., 2013. Reconstruction of sea level changes in the southeastern Baltic during the Late Glacial and Holocene: methodological approach. In: SPLASHCOS - Under the Sea: Archeology and Palaeolandscapes Final Conference, 23–27 September, Szczecin, Poland, 85. Bitinas, A., Mažeika, J., Buynevich, I.V., Damušytė, A., Molodkov, A. & Grigienė A., 2017. Constraints of Radiocarbon Dating in Southeastern Baltic Lagoons: Assessing the Vital Effects. In: Harff, J., Furmańczyk, K., and von Storch, H. (eds.) Coastline Changes of the Baltic Sea from South to East. Past and Future Projection. Coastal Research Library, 19, 137–171. DOI 10.1007/978-3-319-49894-2_8.

References Andrén, T., Björck, S., Andrén, E., Conley, D., Zillén, L. & Anjar, J., 2011. The Development of the Baltic Sea Basin During the Last 130 ka. In: Harff, J., Bjorck, S. & Hoth, P. (eds.). The Baltic Sea Basin, 75–97. BerlinHeidelberg: Springer-Verlag.

Björck, S., 1995. Late Weichselian to Early Holocene Development of the Baltic Sea – with Implications for Coastal Settlements in the Southern Baltic region. Man and Sea, Oxford, 23–34.

Andrén, T., Lindeberg, G. & Andrén, E., 2002. Evidence of the final drainage of the Baltic Ice Lake and the brackish phase of the Yoldia Sea in glacial varves from the Baltic Sea. Boreas, 31, 226–238.

Björck, S., Andren, T. & Jensen, J. B., 2008. An attempt to resolve the partly conflicting data and ideas on the Ancylus-Littorina transition. Polish Geological Institute Special Papers 23, 21–26.

Balakauskas, L., 2012. Vėlyvojo ledynmečio ir holoceno miškų augalijos raida Lietuvoje LRA (kraštovaizdžio atkūrimo algoritmo) modeliavimo duomenimis. Daktaro disertacija Fiziniai mokslai, geologija (05 P), Vilniaus universitetas.

Borzenkova, I., Zorita, E., Borisova, O., Kalniņa, L., Kisielienė, D., Koff, T., Kuznetsov, D., Lemdahl, G., Sapelko, T., Stančikaitė, M. & Subetto, D., 2015. Climate Change During the Holocene (Past 12,000 Years). The BACC II Author Team, Second Assessment of Climate Change for the Baltic Sea Basin, Regional

Bennike, O., Rasmussen, P. & Aaris-Sørensen, K., 2008. The harp seal (Phoca groenlandica Erxleben) in

36

Changes in Baltic Sea Relict Coasts in the Late Pleistocene and Early Holocene Groß, H., 1939b. Die subfossilen Renntierfunde Ostpreußens. Schriften der Physikalisch-ökonomischen Gesellschaft zu Königsberg, 21, 79–126.

Climate Studies, 25–49. DOI 10.1007/978-3-31916006-1_2. Brazaitis, D., 2007. Šventosios 1-osios, 4-osios, 36-osios radimviečių ir jų aplinkos tyrinėjimai. ATL 2006 metais, Vilnius, 35–42.

Groß, H., 1940. Das Renntier in der Ostpreusischen Vorgeschichte. Alt-Preusen. Vierteljahresschrift fur Vorgeschichte und Volkskunde, 1, 1–4.

Bronk Ramsey, C., 2009. Bayesian analysis of radiocarbon dates.  Radiocarbon, 51(1), 337–360.  https://doi. org/10.1017/S0033822200033865

Gudelis, V. K., 1965. Drevneberegovye obrozovania i osobenosti razvitia Baltiskogo moria na territorii Vostochnoi Pribaltiki. Poslednii Evropeiskii lednikovyi pokrov. Moskva, 53–56.

Cherniavskii, M. M., 1992. Drevneishie rogovye orudia iz pod Smorgoni. Lietuvos archeologija, 9, 116–120.

Gudelis, V. K., 1970. Obshchie cherty geologii i geomorfologii dna tsentral‘nogo sektora Baltiiskogo moria. Baltica, 4, 103–113.

Damušytė, A., 2011. Post‐Glacial geological history of the Lithuanian coastal area. Summary of doctoral dissertation, Physical sciences, geology (05P), Vilnius: Vilnius University Press, Lithuania.

Gudelis, V. K., 1976. Istoria razvitia Baltiiskogo moria. Geologia Baltiiskogo moria. Vilnius, 95–116.

Danusevičius, D., Buchovska, J., Žulkus, V., Daugnora, L. & Girininkas, A., 2021. DNA Markers Reveal Genetic Associations among 11,000-Year-Old Scots Pine (Pinus sylvestris L.) Found in the Baltic Sea with the Present-Day Gene pools in Lithuania. Forests, 12(3), 317. https://doi.org/10.3390/f12030317  (accessed 09 March, 2021).

Hansson, A., Boethius, A., Hammarlund, D., Lagerås, P., Magnell, O. Nilsson, B., Brunlid, A.N. & Rundgren, M., 2019. Shoreline Displacement, Coastal Environments and Human Subsistence in the Hanö Bay Region during the Mesolithic. Quaternary, 2, 14. DOI 10.3390/ quat2010014 www.mdpi.com/journal/quaternary Helmens, K. F. & Engels, S., 2010. Ice-free conditions in eastern Fennoscandia during early Marine Isotope Stage 3: lacustrine records. Boreas, 39(2), 399–409.

Elertienė, B. 1994. Manuscript. The History Museum of Lithuania Minor, Inv. Nr.3982. Klaipėda. Emeis, K.-C., Struck, U., Blanz, T., Kohly, A. & Voß, M., 2003. Salinity changes in the central Baltic Sea (NW Europe) over the last 10 000 years. The Holocene, 13(April), 411–421.

Houmark-Nielsen, M., 2004. The Pleistocene of Denmark: A review of stratigraphy and glaciation history. In: Ehlers, J., Gibbard, P. L. (eds.). Quaternary Glaciations – Extent and Chronology. Part I: Europe. Amsterdam: Elsevier B. V., 35–46.

Engel, C., 1935.Vorgeschichte der altpreußischen Stämme. Königsberg.

Houmark-Nielsen, M., 2011. Pleistocene glaciations in Denmark: A closer look at chronology, ice dynamics and landforms. In: Ehlers, J., Gibbard, P. L., Hughes, P. D. (eds.). Quaternary Glaciations – Extent and Chronology: A Closer Look. Amsterdam: Elsevier, 47–58.

Fagan, B., 2013. Ilgoji vasara. Vilnius: Eugrimas. Gelumbauskaitė, L. Ž., 2009. Character of sea level changes in the subsiding south-eastern Baltic Sea during Late Quaternary. Baltica, 22(1), 23–36.

Hyvärinen, H., 1988. Definitions of the Baltic stages. In: J. Donner & A. Raukas (eds.). Problems of the Baltic Sea History. Annales Academiae Scientarium Fennicae Seri. A. III. Geologica-Geographica, 148, 7–11.

Gelumbauskaite, L. Z. & Šečkus, J., 2005. Late Quaternary shore formations of the Baltic basins in the Lithuanian sector. Geologija, 52, 34–45. Gelumbauskaitė, L. Ž. & Šečkus, J., 2015. Sea level changes and coastal evolution in the south-eastern Baltic Sea. https://www.researchgate.net/publication/ 267966721

Juodagalvis, V., 2002. Šventosios archeologinio komplekso 2002 metų tyrinėjimų ataskaita. Vilnius, 2002, Kultūros paveldo centro Fondų poskyris, f. 39, ap. 1, nr. 1146. Kabailienė, M., 1999. Water Level Changes in SE Baltic Cased on Diatom Stratigraphy of Late Glacial and Holocene, Geologija, 29, 15–29.

Girininkas, A., 2005. Ar buvo polinių gyvenviečių akmens amžiuje Lietuvoje? Lituanistica, 2/62, 33–45. Girininkas, A., 2011. New data on Palanga Stone Age Settlement. Archaeologia Baltica, 16, 48–57.

Kabailienė, M. 2006. Gamtinės aplinkos raida Lietuvoje per 14000 metų. Vilnius: Vilniaus universiteto leidykla.

Girininkas, A., Daugnora, L., 2015. Ūkis ir visuomenė Lietuvos priešistorėje, T. I, Klaipėda: Klaipėdos universiteto leidykla.

Kabailienė, M. & Rimantienė, R., 1996. Holocene Changes in the Palaeoecological Conditions of the Lithuanian Coast around the Šventoji Setllement. Pact 50, 185–196.

Groß, H., 1939a. Die Bedeutung des Renntierjägerfundes von Bachmann, Kreis Memel, Alt-Preußen. Vierteljahresschrift für Vorgeschichte und Volkskunde, 4/3, 65–66.

Kalm, V., Raukas, A., Rattas, M. & Lasberg, K., 2011. Pleistocene glaciations in Estonia. In: J. Ehlers, P. L.

37

Vladas Žulkus and Algirdas Girininkas Gibbard, P. D. Hughes (eds.) Quaternary Glaciations – Extent and Chronology: A Closer Look. Amsterdam: Elsevier, 95–104.

geology and the Dana River concept. Marine Geology, 176, 191–201. https://doi.org/10.1016/S0025-3227(01) 00152-9

Kelpšaitė, L., 2008. Bangų veikimo zonos gylio nustatymas ties Lietuvos priekrante. Jūros ir krantų tyrimai–2008. Konferencijos medžiaga. Klaipėda, 60–61.

Leppäranta, M. & Myrberg, K., 2009. Physical oceanography of the Baltic Sea. Heidelberg: SpringerPraxis Germany.

Kliewe, H., 2004. Holozän im Küstenraum. In: von G. Katzung. Hrsg. Geologie von MecklenburgVorpommern. Stuttgart: E. Schweizerbart´sche Verlagsbuchhandlung, 1. Auflage, 251–264.

Liivrand, E., 1991. Biostratigraphy of the Pleistocene Deposits in Estonia and Correlations in the Baltic Region. Doctoral Thesis. Department of Quaternary Research, Stockholm University: Report, 19, 114.

Kozłowski, S. K., 1989. Mesolithic in Poland. A new Approach. Warszawa.

Liužinas, R., Grigaravičienė, L., Janukonis, A., Kunskas, R., Rajeckas R. & Urbonienė, J., 1995. Lietuvos durpynų kadastras, I, Vilnius.

Krog, H., 1979. The Quaternary history of the Baltic, Denmark. In: Gudelis, V., Königsson, L. K. (eds.). The Quaternary history of the Baltic. Uppsala University, 207–217.

Lõugas, L., 1997. Post-Glacial development of vertebrate fauna in Estonian water bodies. A palaeozoological study. Dissertationes Biologicae Universitatis Tartuensis, 32, Tartu.

Kulikauskas, P., 1959. Seniausieji Kuršių Neringos gyventojai. Iš lietuvių kultūros istorijos, II, Vilnius, 72–85.

Lõugas, L., 2006. Animals as subsistence and bones as raw material for settlers of prehistoric Zvejnieki. In: L. Larsson., I. Zagorska, eds. Back to the origin, Stokholm, 75–89.

Kunskas, R., 1974. Šiaurinio Nemuno deltos pelkyno sandaros ir raidos bruožai. Geografijos metraštis, 13, 45–55.

Lowe, J. J., Rasmussen, S.O., Björck, S., Hoek, W. Z., Steffensen, J. P., Walker, M. J. C. & Yu, Z. C., 2008. Synchronisation of palaeoenvironmental events in the North Atlantic region during the Last Termination: a revised protocol recommended by the INTIMATE group. Quaternary Science Reviews, 27, 6–17.

Kunskas, R., 2005a. Ežerų ir pelkių ekosistemų raida. Mažasis paleogeografijos paleosinekologijos atlasas. Vilnius: Ciklonas. Kunskas, R., 2005b. Šventosios ir Palangos lagūninio ežero ekosistema neolito laikotarpiu. In: Akmens amžiaus žvejai prie Pajūrio lagūnos: Šventosios ir Būtingės tyrinėjimai, Vilnius: Lietuvos nacionalinis muziejus, 20–34.

Loze, I., 1979. Pozdnii neolit i panniaia bronza Lubanskoi ravniny. Rīga: Zinātne. Lukoševicius L., Gudelis V., 1974. The subaqueous Late– and Post–Glacial shorelines in the South–Eastern area of the Baltic Sea (The paleo–Holocene shorelines). Baltica 5, 113-118.

Kvasov, D. D., Bakanova, I. P., Davydova, N. N., 1970. Osnovnye voprosy pozdnelednikovoi istorii Vostochnoi Baltiki. Baltica, 5, 65–92.

Marks, L., 2004. Pleistocene glacial limit in Poland. In: Ehlers, J., Gibbard, P. L. (eds.). Quaternary Glaciations – Extent and Chronology. Part I: Europe. Amsterdam: Elsevier. 296–300.

Lampe, R., 2002. Post-glacial water-level variability along the south Baltic coast – a short overview. Greifswalder Geographische Arbeiten, 27. A2, 13–19. Greifswald. Lampe, R., Naumann, M., Meyer, H., Janke, W. & Ziekur, R., 2011. Holocene Evolution of the Southern Baltic Sea Coast and Interplay of Sea-Level Variation, Isostasy, Accommodation and Sediment Supply. In: Harff, J., Bjorck, S. & Hoth, P. (eds.). The Baltic Sea Basin, 233–251. Berlin-Heidelberg: Springer-Verlag.

Marks, L., 2012. Timing of the Late Vistulian (Weichselian) glacial phases in Poland. Quaternary Science Reviews 44, 81–88. Makowiecki, D., Wiejacka, M., Wiejacki, J., 2018. Gospodarka zwierzętami na podstawie źródel archeozoologicznych. In: D. Król, ed. Zespól osadniczy z epoki kamienia – Rzucewo, Gmina Puck, stanowisko 1 = Settlement complex from Stone Age – Rzucewo, community Puck, site 1. Gdańsk: Muzeum Archeologiczne, 218–238.

Lamsters, K., Kalinska-Nartiša, E., Zeles, V. & Alexanderson, H., 2017. New luminescence ages reveal Early to Middle Weichselian deposits in central Latvia. Geological Quarterly, 61 (2), 480–490. Lasberg, K., 2014. Chronology of the Weichselian Glaciation in the southeastern sector of the Scandinavian Ice Sheet. Dissertationes Geologicae Universitatis Tartuensis. 37. University of Tartu Press.

Mažeika, P. A., 2001. Baltijos jūros hidrodinamika. Klaipėda: Klaipėdos universiteto leidykla. Michaelis, D., Joosten, H., 2007. Mire development, relative sea-level change, and tectonic movement along the Northeast-German Baltic Sea coast. In: Harff, J., Lüth, F. (eds.) SINCOS-Sinking Coasts. Geosphere,

Lemke, W., Jensen, J. B., Bennike, O., Endler, R., Witkowski, A., & Kuijpers, A., 2001. Hydrographic thresholds in the western Baltic Sea: Late Quaternary 38

Changes in Baltic Sea Relict Coasts in the Late Pleistocene and Early Holocene Ecosphere and Anthroposphere of the Holocene Southern Baltic Sea. Sonderdruck aus Bericht der Römisch-Germanischen Kommission, 88, 101–134.

Rimkus, T., 2019. In search of Lithuania coastal Mesolithic. Review of current data and the aims of an ongoing research project. Fornvännen, 114 (1), 1–11.

Mörner, N.-A., 2008. Tsunami events within the Baltic. Polish Geological Institute Special Papers, 23, 71–76.

Rimkus, T. & Girininkas, A., 2019. Tyrimai Aukštumalos akmens amžiaus gyvenvietėse bei jų aplinkoje. ATL 2018 metais. Vilnius, 44–49.

Mörner, N.-A. and Dawson, S., 2011. Traces of Tsunami Events in Off- and On-Shore Environments. Case Studies in the Maldives Scotland and Sweden. In: Mörner, N.-A. (ed). The Tsunami Threat: Research and Technology, London: IntechOpen, 371–388. https://doi.org/10.5772/13686

Rimkus, T. & Girininkas, A., 2020a.Tyrimai Aukštumalos akmens amžiaus gyvenvietėse. ATL 2019 metais. Vilnius, 35–38. Rimkus, T. & Girininkas, A., 2020b. Žvalgymai Klaipėdos ir Šilutės rajonuose. ATL 2019 metais. Vilnius, 404–405.

Musielak, S., Furmańczyk, K., Bugajny, N., 2017. Factors and Processes Forming the Polish Southern Baltic Sea Coasts on Various Temporal and Spatial Scales. In: Harff, J., Furmańczyk, K., von Storch, H. (eds.). Coastline Changes of the Baltic Sea from South to East. Past and Future Projection. Springer, 69–85.

Rinterknecht, V. R., Clark, P. U., Raisbeck, G. M., Yiou, F., Brook, E. J., Bitinas, A., Marks, L., Zelcs, V., Lunkka, J. P., Pavlovskaya, I. E., Piotrowski, J. A. & Raukas, A., 2006. The Last Deglaciation of the Southeastern Sector of the Scandinavian Ice Sheet. Science , 311, 1449–1452.

Neumayer, H., 2009. Lithuanian finds in the museum for Pre- and Early History in Berlin. Archaeologia Lituana, 10, 22–35.

Rosentau, A., Bennike, O., Uscinowicz, S. and MiotkSzpiganowicz, G., 2017. The Baltic Sea Basin. In: Flemming, N. C., Harff, J., Moura, D., Burgess, A., Bailey, G.N. (eds.). Submerged Landscapes of the European Continental Shelf: Quaternary Paleoenvironments, 103–134. Chichester: John Wiley & Sons.

Neumayer, H., 2018. Finds from the Memel region in the museum of prehistory and early history in Berlin. In: Bliujienė, A. (ed). The Klaipėda (Memel) region: from origins to the 17th century. Klaipėda, 42–48.

Rovere, A., Stocchi, P. & Vacchi, M., 2016. Eustatic and Relative Sea Level Changes. Curr Clim Change Rep, 2, 221–231. https://doi.org/10.1007/s40641-016-0045-7

Paaver, K., 1958. Rezultaty opredelenii kostnykh ostatkov, naidenykh pri uglublenii reki u gor. Palanga. In: Kuncienė, O. 1958. Palangos akmens amžiaus stovyklos tyrinėjimų dienoraštis 1958 m. rugpjūčio mėn. 19-31 d. Lietuvos istorijos instituto rankraštynas B.77, Vilnius. Paaver, K., 1965. Formirovanie teriofauny i izmenchivost’ mlekopitaiushchikh Pribaltiki v golotsene. Tartu: Akademia Nayk Estonskoi SSR

Rößler, D., Lemke, W. & Moros, M., 2007. Reconstruction of the Littorina Transgression in the Western Baltic Sea. In: Harff, J., Lüth, F. (eds.). SINCOS I – Sinking Coasts. Geosphere, Ecosphere and Antroposphere of the Holocene Southern Baltic Sea. Sonderdruck aus Bericht der Römisch-Germanischen Kommission, 88, 47–65.

Piličiauskas, G., Luik, H. & Piličiauskienė, G., 2015. Reconsidered Late Mesolithic and Early Neolithic of the Lithuanian coast: the Smeltalė and Palanga sites. Estonian Journal of Archaeology, 19, 1, 3–28.

Satkūnas, J. & Grigienė, A., 2012. Eemian-Weichselian palaeoenvironmental record from the Mickūnai glacial depression (Eastern Lithuania). Geologija, 54, 2(78), 35–51.

Reimer, P. J., Bard, E., Bayliss, A., Beck, J. W., Blackwell, P. G., Bronk Ramsey, C., Grootes, P. M., Guilderson, T. P., Haflidason, H., Hajdas, I., Hatte, C., Heaton, T. J., Hoffmann, D. L., Hogg, A. G., Hughen, K. A., Kaiser, K. F., Kromer, B., Manning, S. W., Niu, M., Reimer, R. W., Richards, D. A., Scott, E. M., Southon, J. R., Staff, R. A., Turney, C. S. M. & van der Plicht, J. 2013. IntCal13 and Marine13 radiocarbon age calibration curves 0-50,000 years cal BP. Radiocarbon, 55(4), 1869–1887. https:// doi.org/10.2458/azu_js_rc.55.16947

Satkūnas, J., Girininkas, A., Rimkus, T., Daugnora, L., Grigiene, A., Skuratovič, Ž., Uogintas, D., Žulkus, V. 2022. New 14C data of megafaunal remains from the SE Baltic - implications for the palaeoenvironmental interpretation of the Middle Weichselian. Palaeogeography, Palaeoclimatology, Palaeoecology, in press. Schmölcke, U., Endtmann, E., Klooss, S., Meyer, M., Michaelis, D., Rickert, B.-H. & Rößler, D., 2006. Changes of sea level, landscape and culture: A review of the south-western Baltic area between 8800 and 4000BC. Palaeogeography, Palaeoclimatology, Palaeoecology, 240, 423–438. DOI 10.1016/j. palaeo.2006.02.009

Rimantienė, R., 2005. Akmens amžiaus žvejai prie Pajūrio lagūnos: Šventosios ir Būtingės tyrinėjimai, Vilnius: Lietuvos nacionalinis muziejus. Rimantienė, R., Dvareckas, V. & Kudaba, Č. 1971. Apie pajūrio pelkės archeologinių radinių slūgsojimo sąlygas. Lietuvos TSR aukštųjų mokyklų mokslo darbai, Geografija ir geologija, 8, 131–139.

Schmölcke, U., 2008. Holocene environmental changes and the seal (Phocidae) fauna of the Baltic Sea: coming, going and staying. Mamal Review, 38, 231–246. 39

Vladas Žulkus and Algirdas Girininkas Sloka, J., 1985. Akmens laikmetā zvejotās zivis Zvejnieku II apmetnē (8.-6 g. t. p. m. ē.). Latvijas PSR Zinātn̦u akadēmijas vēstis, 7, 110–116.

Weber, C. A., 2016. Apie Aukštumalos aukštapelkės Nemuno deltoje augaliją ir vystymąsi lyginant su kitomis Žemės aukštapelkėmis. Biologinė, istorinė ir geologinė studija. Vilnius: Lietuvos gamtos fondas.

Struckmann, C., 1880. Über die Verbreitung des Renthiers in der Gegenwart und in älterer Zeit nach Maassgabe seiner fossilen Reste unter besonderer Berücksichtigung der Deutschen Fundorte. Zeitschrift der Deutschen Geologischen Gesellschaft, XXXII, 728–773.

Zagorska, I., 2012. Senie ziemeļbriežu mednieki Latvijā. Rīga: Zinātne. Žaromskis, R., Gulbinskas, S., 2018. Krantodara ir krantotvarka. Klaipėda.

Šečkus, J., 2009. Pietryčių Baltijos jūros raidos analizė taikant geologinio modeliavimo metodus. Daktaro disertacijos santrauka. Fiziniai mokslai, geologija (05 P). Vilniaus universitetas.

Zhilin, M. G., Savchenko, S. N., Nikulina, E. A., Schmölcke, U., Hartz, S. & Terberger, T., 2014. Eleven bone arrowheads and a dog coprolite – the Mesolithic site of Beregovaya 2, Urals region (Russia). Quartär, 61, 165–187.

Timofeev, I. I., 1981. Izdelia iz kosti i roga neoliticheskoi stoianki Cedmar (Serovo) D. Kratkie soobshchenia instituta archeologii, vyp. 165, 115–119.

Žulkus, V. & Girininkas, A. 2012. The coasts of the Baltic Sea 10 000 years ago. “Yoldia”. Klaipėda, Lithuania: Klaipėda University Press.

Ukkonen, P., Lõugas, L., Zagorska, I., Lukševica, L., Lukševics, E., Daugnora, L. and Jungner, H., 2006. History of the reindeer (Rangifer tarandus) in the eastern Baltic region and its implications for the origin and immigration routes of the recent northern European wild reindeer populations. Boreas, 35, 222–230.

Žulkus, V. & Girininkas, A. 2014. Drowned Early Mesolithic landscapes on the Baltic Sea bed in the Lithuanian waters. Journal of Environmental Science and Engineering B, 3, N. 5, 274–289. David Publishing Company. https://doi.org/10.17265/2162-5263

Uścinowicz, S., 2003. The southern Baltic relative sea level changes, glacio-isostatic rebound and shoreline displacement. Polish Geological Institute Special Papers, 10.

Žulkus, V. & Girininkas, A. 2020. The eastern shores of the Baltic Sea in the Early Holocene according to natural and cultural relict data. Geo: Geography and Environment, 2020;e00087. https://doi.org/10.1002/ geo2.87

Uścinowicz, S., 2004. Rapid Sea Level changes in the Southern Baltic During Late Glacial and Early Holocene. Polish Geological Institute Special Papers, 11, 9–18.

Žulkus, V., Girininkas, A., Stančikaitė, M., Gryguc, G., Šeirienė, V. & Mažeika, J. 2015. In shores of the Yoldia Sea and Ancylus Lake. Maritime landscapes in the Lithuanian waters: Multidisciplinary study. In: Felczak, O. (ed). The Baltic Sea – A Mediterranean of North Europe. In the light of archaeological, historical and natural science resaerch from ancient to early medieval times Gdańsk, 9–18. Poland: Scientific Association of Polish Archaeologists, Gdańsk Division.

Uścinowicz, S., 2006. A relative sea-level curve for the Polish Southern Baltic Sea. Quaternary International,145–146. https://doi.org/10.1016/j. quaint.2005.07.007 Uścinowicz, S., 2008. Late Glacial and Holocene of the Southern Baltic shoreline displacement. Quartenary of the Gulf of Gdańsk and Lower Vistula Regions in Northern Poland: Sedimentary Environments, Stratigraphy and Palaeogeography. International Field Symposium of the INQUA Peribaltic Group Frombork, September 14–19, 2008. Warszawa, 60–62.

Yu, S. Y., 2003. The Littorina transgression in the southeastern Sweden and its relation to mid-Holocene climate variability. Lundqua thesis, 51, 82.

Uścinowicz, S., Miotk-Szpiganowicz, G., Krapiec, M. Witak, M., Harff, J., Lübke, H. & Tauber, F., 2011. Drowned forests in the Gulf of Gdansk (southern Baltic) as an indicator of the Holocene shoreline changes. In: Harff, J., Bjorck, S. & Hoth, P. (eds.). The Baltic Sea Basin, 219–231. Berlin-Heidelberg: Springer-Verlag. Vaikutienė, G., 2004. The western and south‐eastern part of the Baltic Sea in the Late Glacial and Holocene sediment diatom species composition comparison. Geologija, 48, 58–69. Virtasalo, J., 2006. Late-Weichselian – Flandrian Depositional History of the Archipelago Sea, northern Baltic Sea. Annales Universitatis Turkuensis. Ser. Aii Osa. Biologica - Geographica – Geologica, 196. Turku. 40

3 Lateglacial–Middle Holocene Environmental Dynamics in the Coastal Area of the Baltic Sea: A New Insight for the Territory of Lithuania Miglė Stančikaitė: Institute of Baltic Region History and Archaeology, Klaipėda University Albertas Bitinas: Nature Research Centre, Institute of Geology and Geography, Vilnius Aldona Damušytė: Lithuania Geological Survey, Vilnius Giedrė Vaikutienė: Department of Geology and Mineralogy, Vilnius University Algirdas Girininkas: Institute of Baltic Region History and Archaeology, Klaipėda University Tomas Rimkus: Institute of Baltic Region History and Archaeology, Klaipėda University Linas Daugnora: Institute of Baltic Region History and Archaeology, Klaipėda University Vladas Žulkus: Institute of Baltic Region History and Archaeology, Klaipėda University Abstract: To take a new look at the Lateglacial–Middle Holocene environmental history in the maritime region of the territory of Lithuania, we have synthesized geological-geomorphological, geochronological, sedimentological and palaeobiological data representing the Lithuanian maritime region. The published information was coupled with new data obtained within the framework of the project “Man and Baltic Sea in the Meso-Neolithic: Relict Coasts and Settlements Below and Above Present Sea Level. ReCoasts&People”, which included the archaeological record as well. Based on the collected data we propose refined reconstruction of the paleoenvironmental history in this part of the Baltic, including dynamics of the Baltic Sea coast. The development of the proglacial lakes that existed during the initial intervals of the Lateglacial, forming erosional terraces discovered at about 40 m a.s.l. in the southern part of the maritime region, was succeeded by a period of low water estuaries or freshwater lagoons that occurred after 13.8 cal kyr BP (11.7 cal kyr BC) in this part of the region. While in the northern sector of the maritime region, pronounced ridge stretching at about 12–16 m a.s.l. was formed by the Baltic Ice Lake according to geomorphological and sedimentological data. New evidence, particularly isotopic and palaeobiological data, demonstrate that remarkable transformations of the coastal zone started at the Lateglacial–Holocene transition when the seacoast of the Yoldia Sea was situated further westwards and the terraces of this water body were detected laying 11 to 24–29 m b.s.l. even. At that time, the terrestrial sedimentation had predominated all along the Lithuanian maritime region. Numerous imprints of biogenic origin (submerged pine trees and peat enriched sediments) discovered at about 30–32 m b.s.l. point to transgression of the basin at about 10.1–10.2 cal kyr BP (~8.2 cal kyr BC) marking the time of the maximum transgression of the Ancylus Lake, the next stage in the history of the Baltic Sea. Nevertheless, the tendency of a negative water level predominated in the coastal region throughout the final part of the Ancylus stage and the Initial Litorina Sea stage, i.e. until 8.5 cal kyr BP (6.4 cal kyr BC). Only during the second Littorina transgression (7.7–7.6 cal kyr BP/5.8–5.7 cal kyr BC) were certain areas in the northern and central parts of the maritime region submerged. The marine terraces, then varying between 2–8 m a.s.l., were formed due to the subsequent glacioisostatic rebound of the maritime region. Even at that time terrestrial sedimentation predominated in the southern part of the region where formation of the extended peatbogs had started since the Early Holocene onward. Keywords: Lithology, Pollen, Diatoms, Molluscs, 14C, 10Be, OSL, Geology, Geomorphology, Lithuanian maritime region 3.1. Introduction

water, the rate of land uplift and numerous other questions have been discussed surrounding the Baltic region (Björck 1995; Houmark-Nielsen and Kjær 2003; Andrén et  al. 1999; 2000; 2002; 2007; 2011; Berglund et  al. 2005; Muschitiello et al. 2016; Yu et al. 2003). The timing and extent of these events in the eastern and southeastern parts of the basin (Uścinowicz 2006; Saarse et  al. 2009 a; b;

Being the largest inland sea in the northern part of the European continent, the Baltic Sea has attracted the attention of the scientific community since long ago. The palaeogeography of the coastal territories, history and shoreline displacement, the presence of fresh/brackish 41

Stančikaitė, Bitinas, Damušytė, Vaikutienė, Girininkas, Rimkus, Daugnora and Žulkus Miotk-Szpiganowicz et  al. 2010; 2016; Uścinowicz et  al. 2011; Vassiljev and Saarse 2013; Vassiljev et  al. 2015; Napreenko-Dorokhova 2015; Rosentau et  al. 2009; 2013; 2017; 2021), including the Lithuanian coast (Gudelis 1959; Červinskas and Kunskas 1982; Gudelis and Klimavičienė 1990; Gudelis et  al. 1993; Stančikaitė and Kabailienė 1998; Žaromskis 1999; Vaikutienė 2003; Gelumbauskaitė 2000; 2002; 2003; Gelumbauskaitė and Šečkus 2005; Kabailienė 1999; 2006; Kabailienė et  al. 2009; Bitinas et  al. 2000; 2001; 2002; 2003), have been intensely discussed during the last decades providing the community with novel insight into the palaeogeography and palaeoecology of the basin’s history. Based on this, new fresh means for the interpretation of former ideas, including a revision of the history of the Baltic Sea in this

area have been provided as well. Alongside with this, an increasing importance of underwater landscape studies including submerged archaeological investigations have been demonstrated (Veski et al. 2005; Žulkus et al. 2015; Girininkas and Žulkus 2017; Žulkus and Girininkas 2012; 2020; Berzins et  al. 2016; Muru et  al. 2017; Hansson et  al. 2018; Nirgi et  al. 2020; Rosentau et  al. 2013; 2020). Here, we discuss geological, geomorphological, chronological, and palaeobiological information, derived from both onshore and offshore data sets, to provide novel insights into the Lateglacial–Holocene dynamics of the palaeogeography and shoreline displacement in the Lithuanian maritime region (Fig. 3.1).

Figure 3.1. The Lithuanian maritime region.

42

Lateglacial–Middle Holocene Environmental Dynamics in the Coastal Area of the Baltic Sea... 3.2. Overview of previous studies

of the sediments comprising the coastal ridge of the BIL have been conducted. Furthermore, the presence of BIL sediments in the region was confirmed by the numerous paleontologically investigated sections collected from both offshore and coastal areas, the Curonian Spit and the bottom of the Curonian Lagoon. Dated back to the Lateglacial, these beds were deposited in a large, fresh oligotrophic water basin according to diatom data (Kabailienė 1959a, b; 1995; 1997; 1998). The beginning of the Holocene warming is coincident with the onset of the Yoldia Sea stage, characterised by a dramatic decrease of the water level in the Baltic basin. No shorelines or marine sediments of that age were found in Lithuanian territory (Kabailienė 1998). Negative water level tendencies have been emphasised discussing the history of the Ancylus Lake, the next stage of the Baltic Sea history, i.e. in the coastal area of Lithuania the water table of this basin was lower than 8−9 m b.s.l. (Kabailienė 1997).

In the territory of modern Lithuania, scientific investigations of the coastal area of the Baltic Sea and Curonian Lagoon (Kuršių Marios)began more than one hundred years ago. The earliest geological and palaeogeographical investigations conducted by Schumann (1859), Berendt (1869), Tornquist (1910), and von Wichdorff (1919) were accompanied by a survey of the litho- and morphodynamic and aeolian processes emphasised by Prussian scientists (Berendt 1869). It should be emphasised that the first scientific description of a peat bog was conducted in Aukštumala, one of the highmoors stretching across the southern part of the coastal region of Lithuania (Weber 1902). Investigations of the geological structure and palaeogeographical history of the Baltic Sea coast and offshore as well as the Curonian Lagoon are of particular importance when discussing both fundamental issues and practical questions related to the Lithuanian maritime region. Therefore, investigations dealing with the different aspects of the above indicated questions, including the geological history of the Baltic Sea, have intensified after the middle of the 20th century onward (Gudelis 1959; 1979; 1998; Kabailienė 1959a, b; 1960; 1995; 1997; 1998; 1999). For example, lithological, structural and mineralogical investigations have been realised, giving information concerning the structure and formation of the sediment beds in this region. Detailed investigations of the surface geomorphology have been conducted at the same time (Gudelis and Klimavičienė 1990; 1993). Both offshore and beach morphological and lithological dynamics have been studied discussing structural and textural features of offshore and beach sediments. Simultaneously, especially rich and interesting data describing the development of the vegetation cover has been published. Investigations of numerous biogenic and limnic sediment sequencies have allowed scientists to evaluate peculiarities of the vegetation dynamics and provide the biostratigraphical background for the stratigraphical subdivision of the sediment sequencies (Kabailienė 1959a, b; 2006). Later, the palaeogeographical features of the region were widely discussed based on that background. Alongside this, an increasing involvement of palaeogeographical interpretations into archaeological investigations must be noted (Kabailienė and Rimantienė 1995; Stančikaitė et al. 2009; Piličiauskas et al. 2012).

The intensity of the above-described investigations has remarkably increased after the restoration of Lithuanian independence in 1991 when the large-scale integrated geological mapping of the coastal area began. Discussed in the context of the regional or global records, the first detailed stratigraphic investigations of Middle and Late Pleistocene and Holocene sequences of the Baltic Sea coast were carried out during the last decade of the 20th century (Bitinas et  al. 2000; 2001; 2002; 2003). The pattern of the vegetation dynamics (Stančikaitė and Kabailienė 1998; Kabailienė et  al. 2009; Stančikaitė et  al. 2008) and the hydrological and sedimentological system of the Nemunas River Delta (Žaromskis 1999) have been intensely investigated in the territory as well. Thanks to constant efforts of the archaeological team from Klaipėda University, several projects dedicated to offshore archaeological and environmental investigations have been conducted over the last decades. A great number of submerged geological, geomorphological and biological features have been discovered and investigated providing a new background for the reconstruction of Baltic Sea history (Bitinas et  al. 2003; 2017; 2021 in press; Žulkus et  al. 2015; Girininkas and Žulkus 2017; Žulkus and Girininkas 2012; 2020; Damušytė et al. 2021). 3.3. Material, methods and results Geomorphological pattern. For the geomorphological analysis of the surface structure, an interpretation via blackwhite stereoscopic aerial photos (scale 1:17,000; 1952) has been applied. The results of the aerial photo interpretation were checked in the field, and geomorphological maps have been compiled identifying the main structural components of the landscape, estimating the origin of particular forms and complexes and describing the lithological composition of the surface sediments. Analysing the geomorphological pattern of the surface, we begin with a description of the key indicative landforms on which the reconstruction of the environmental dynamics of the area is primarily based. These include marginal ridges, origin of terraces

Throughout these decades numerous attempts to reconstruct the dynamics of the Baltic Sea basin have been accomplished. Based on topography, reconstruction of the coastal lines of proglacial lakes was carried out in the southern part of the coastal region nearly sixty years ago. For the first time the sediments of the Baltic Ice Lake (BIL) were described by Gudelis (1955) northwards from Palanga. Later, the extent of the BIL was reconstructed in the southern part of the coastal region as well (Gudelis and Klimavičienė 1990; 1993). Numerous lithological, structural and mineralogical investigations 43

Stančikaitė, Bitinas, Damušytė, Vaikutienė, Girininkas, Rimkus, Daugnora and Žulkus of erosion or accumulation, glaciofluvial and glaciolimnic forms of relief, river valleys and both limnic and biogenic landforms. The forms of the surface relief of marine origin were of particular importance in analysing the dynamics

of the Baltic Sea. Based on the abovementioned analysis an original geological-geomorphological map covering the Lithuanian maritime region has been compiled (Fig. 3.2).

Figure 3.2. Geological-geomorphological map of the Lithuanian maritime region. Compiled (2000) and modified (2021) by A. Damušytė. Age and genesis of the sediments. Holocene: 1 – delluvium (various clayey sand with gravel). Biogenic sediments: 2 – lowmoor bog peat; 3 – high-moor bog peat. 4 – lacustrine sediments (fine-grained sand, silty and clayey sand, silt, clay, sand with peat and gyttja, gyttja); 5 – flood plain alluvium (various sand, fine- and very fine-grained sand, sand with peat); 6 – deltaic alluvium (fine- and grained sand, very fine-grained sand, silty sand, sand with gyttja); 7 – aeolian sediments (fine-grained sand). Marine sediments (various sand and fine-grained sand, sand with gravel): 8 – the current Baltic Sea; 9 – post-Litorina Sea; 10 – Litorina Sea. Lateglacial: 11 – Baltic Ice Lake sediments (fine-grained sand, silt, clay); 12 – alluvium (very finegrained sand, peaty sand). Upper Nemunas Formation: 13 – sediments of glaciolimnic plains (fine- and very fine-grained sand, silty and clayey sand, silt, clay); 14 – sediments of glaciofluvial plains (various sand, clayey sand, sand with gravel) 15 – basal moraine (till = sandy and clayey loam); 16 – glaciofluvial sediments on the end moraine (various sand, clayey sand, sand with gravel); 17 – glaciolimnic sediments (plateau) on the end moraine (fine- and very fine-grained sand, silty and clayey sand, silt, clay); 18 – end moraine (till = sandy and clayey loam, glaciodislocations). Other signs: Shorelines: 19 – post-Litorina Sea; 20 – Litorina Sea; 21 – Baltic Ice Lake. 22 – sites of geological cross-sections: a – Ošupis (see Fig. 3.3), b – Nemirseta (Fig. 3.4), c – Plaziai Lake, and d – Olando Kepurė (Fig. 3.2); e – Giruliai (Fig. 3.5), f – Smiltynė (Fig. 3.6). 23 – state border.

44

Lateglacial–Middle Holocene Environmental Dynamics in the Coastal Area of the Baltic Sea... Geological structure. Characteristic of the lithological composition and structure of the earth is described, discussing the geological structure and palaeogeographical features of the territory. An extensive number of the cores have been drilled throughout the second half of the 20th and beginning of the 21st centuries for the coastal region of Lithuania. In the maritime region, including the Nemunas River Delta and the Curonian Lagoon, more than 514 boreholes have been drilled during the geological mapping and the special research projects. Description of the sediment strata was based on a visual inspection emphasising thickness of the bed, character of the boundaries, colour, etc. Alongside this, a great number of samples has been collected for later analysis. Finally, based on a compilation of various data sources, several

original geological cross-sections have been compiled (Figs. 3.3–3.7) describing the structure and composition of the sediments, the age of the identified lithological units and the postglacial history of the territory emphasising the history of the Baltic Sea, inter alia. Determining age. 1. 10Be dating. Being directly influenced by the last (Weichselian) Glaciation, the Lithuanian maritime region requires a chronological background for the reconstruction of its deglaciation pattern. During the last decades, the cosmogenic dating (10Be) of glacial landforms and sediments has become a key tool for defining chronologies of ice sheet dynamics, i.e. both

Figure 3.3. Geological structure of the highest Lithuanian continental shore cliffs: at the Plaziai Lake (A) and at the Olando Kepurė (Dutchman’s Cap) Cliff (B). 1 – aeolian sediments (sand, mainly fine-grained in some places – various and coarse-grained), 2 – bog sediments (peat), 3 – Baltic Sea marine sediments (various sand, sand with gravel in some places – gravel and shingle), 4 – post-Litorina Sea marine and lagoon sediments (mainly – various or fine-grained sand with fine-dispersive admixture of organic substance in some places – sand with gravel, gravel, interlayers of gyttja), 5 – Litorina Sea marine and lagoon sediments (prevailed fine-grained sand in many sections – with fine-dispersive admixture of organic substance in some places – with detritus of mollusk shells, interlayers of gyttja), 6 – Baltic Ice Lake sediments (various and fine-grained sand). Sediments of the of Late Pleistocene Glaciation (Upper Nemunas Formation): 7 – glaciolimnic (clay, silt), 8 – glacial 9 – glacial sediments of the Middle Pleistocene (Medininkai Formation) Glaciation (till = morainic clayey and sandy loam), 10 – not identified in detail glacial sediments of the Middle and Late Pleistocene, 11 – inclusion (rafts, interlayers) of sandy sediments inside the till, 12 – phenomena of glaciotectonics (folds, trust-faults, etc.), 13 – Middle Pleistocene lacustrine sediments (very fine-grained sand enriched by fine-dispersive organic substance, silty sand, sandy silt, silt), 14 – boulders, 15 – borehole.

45

Stančikaitė, Bitinas, Damušytė, Vaikutienė, Girininkas, Rimkus, Daugnora and Žulkus

Figure 3.4. Geological structure of the continental shore at Ošupis. Legend – in Fig. 3.2.

Figure 3.5. Geological structure of the continental shore at Nemirseta. Legend – in Fig. 3.2.

46

Lateglacial–Middle Holocene Environmental Dynamics in the Coastal Area of the Baltic Sea...

Figure 3.6. Geological structure of the continental shore close to Giruliai. Legend – in Fig. 3.2.

Figure 3.7. Geological structure of the Curonian Spit shore at Smiltynė. Legend – in Fig. 3.2.

47

Stančikaitė, Bitinas, Damušytė, Vaikutienė, Girininkas, Rimkus, Daugnora and Žulkus glacial advances and the retreat of ice cover. As a certain number of cosmogenic dates (Rinterknecht et al. 2006; 2008) derived from sampled glacial boulders are available from the region, these have been included for the discussion of the deglaciation chronology of the area. According to the results of 10Be data, an age of the ice retreat is about 13.3 ± 0.7 kyr BP (~11.4 cal kyr BC) in the coastal region of Lithuania (Rinterknecht et  al. 2006; 2008), whereas after the modern re-calibration of cosmogenic data the time of the ice melting has been revised, suggesting that the area became ice-free before 14.9 ± 0.8–14.5 ± 0.8 kyr BP (~12.9 cal kyr BC) (Marks et al., in press).

3. 14C dating. Results of the 14C dates play a leading role in constructing the chronological background of the environmental history. While the number of the available radioisotope measurements in the coastal area of the Lithuanian territory is not very high in the case of the pro-glacial sedimentary archives, an increasing representation of reliable dates representing the later stages of the postglacial provides a reliable background for the subsequent modelling of the chronological scales (Fig. 3.8). All published 14C ages of relevance for the palaeoenvironmental history of the coastal zone of the Baltic Sea have been taken into account in analysing the timing of the identified fluctuations (Bitinas et  al. 2002; Stančikaitė et al. 2009; Piličiauskas et al. 2012; Damušytė et al. 2021). It should be pointed out that a certain number of AMS dates have also been involved in this analysis.

2. Optically-stimulated luminescence (OSL) dating. To date the sediment layers consisting of non-organic material, sand particles in most cases, OSL dating has been used (Bitinas et al. 2002; 2017; 2018). Being capable of providing a direct dating of sediment deposition can potentially demonstrate accurate minimum ages of deglaciation of sediments. This is especially important when discussing the chronological framework of the Lateglacial interval when the appearance of organic matter, necessary for 14C dating, is rather limited. However, in practice numerous OSL dates appear to be older than the expected age, most probably due to incomplete bleaching of the analysed sediments. For this reason, discussing the chronology of the result of Baltic Sea dynamics’ OSL dates are taken with some caution, as these are “insufficient for a detailed shore displacement reconstruction” (Linden et  al. 2006). In general, the obtained OSL data suggest a Lateglacial-Holocene age of the sediments investigated (Bitinas et al. 2000; 2001; 2002; 2017; 2018).

The oldest reliable 14C data refer to the Alleröd age of the analysed formations (13.8–13.2 cal kyr BP, 12.0–11.2 cal kyr BC; Rinterknecht et  al. 2008; Damušytė et  al. 2021). Dates from the Early Holocene age are rather few in the onshore sequences apart from the extended peat bogs, which started to develop since the Early Holocene onward (Kabailienė and Stančikaitė 1998; NapreenkoDorokhova 2015; Damušytė et  al. 2021). However, recent investigations conducted in the offshore area has provided numerous 14C measurements of the biogenic material, establishing the Early Holocene age of the material analysed (Bitinas et al. 2003; Žulkus et al. 2015; Girininkas and Žulkus 2017). Further development of the chronological framework points to the increasing intensity of the biogenic-limnic sedimentation during the Middle–Late Holocene (Kabailienė and Stančikaitė 1998; Kabailienė et  al. 2009). It should be pointed out

Figure 3.8. Age-depth model of the Svencele core, Nemunas Delta area, southern part of the maritime region.

48

Lateglacial–Middle Holocene Environmental Dynamics in the Coastal Area of the Baltic Sea... that numerous 14C dates referring to the Middle–Late Holocene age of the sediments have been obtained from the archaeological context representing the northern part of the maritime region in particular (Juodagalvis and Simpson 2000; Rimantienė 2005; Stančikaitė et al. 2009; Piličiauskas et al. 2012). However, it is necessary to note that 14C dates in the maritime region have some limitations. The recent detailed analysis of 14C data of the freshwater organic and carboniferous deposits obtained from lagoons (including so-called “lagoon marl” and mollusc shells) show that particular types of deposits cannot be used for detailed chronological reconstructions due to the influence of a so-called “reservoir effect” which prevails in the southeastern Baltic, i.e. in the Curonian and Vistula lagoons in particular (Bitinas et al. 2017).

the formation of sparse forests along the coastal regions even during the Younger Dryas. The ongoing formation of biogenic beds in the extended peat bogs had started since the Early Holocene, ca. 9.6–9.0 cal kyr BP (7.7–7.2 cal kyr BC), from the southern sector of the maritime region (Kabailienė and Stančikaitė 1998; Napreenko-Dorokhova 2015; Damušytė et  al. 2021), when gradual immigration of the deciduous taxa points to the re-organization of the vegetation pattern. One more important stage of the vegetation’s history coincides with the introduction of agricultural activity (Stančikaitė et al. 2009), when pollen data proves continuous cereal cultivation after 3.25 cal kyr BC in coastal Lithuania (Piličiauskas et al. 2012). 2. Diatoms. Reconstructing the dynamics of the sedimentary basin’s, diatom data is of particular importance. Reconstruction of the basin depth changes, salinity as well as its trophic status, inflow and outflow system, etc. is usually based on diatom records. Based on analyses of onshore and offshore sediment cores, these data have played a leading role in analysing the different freshwater and marine stages of the Baltic Sea in Lithuania (Kabailienė 1959; 1995; 1999; Kabailienė et  al. 2009). Alongside the reconstruction of the dynamics of the basin, this information has been used to discuss the dynamics of the palaeoclimatic changes and palaeogeographical features of the coastal region as well (Kabailienė, 2006).

Palaeobiological approach 1. Pollen investigations. Numerous palynological investigations conducted in the different parts of the region have provided the scientific community with extended information describing the palaeoecological and palaeogeographical situation including an analysis of human-induced environmental fluctuations during the Lateglacial and Holocene in the territory. The history of the vegetation dynamics, development of the sedimentary basins, palaeoclimatic issues, habitation of the territory and dynamics of the agriculture activity – all these questions have been discussed applying the pollen data. Preparing the manuscript, all the formerly published pollen data has been analysed in accordance with the regional or continent scale records and modern biostratigraphical and chronostratigraphical subdivision of the Lateglacial and Holocene.

Available diatom records from deep boreholes in the territory of the Curonian Lagoon and Curonian Spit (Fig. 3.10) show deposition in the freshwater oligotrophic sedimentary basin of the Baltic Ice Lake during the Lateglacial in the Lithuanian coastal area (Kabailienė 1999; Kabailienė et al. 2009). Most common freshwater benthic species are Ellerbeckia arenaria (Moore) Crawford, Achnanthes lanceolata (Brébisson) Grunow, Opephora martyi Héribaud, Cocconeis disculus (Schumann) Cleve, and Campylodiscus noricus var. hibernicus (Ehrenberg) Grunow and suggest sedimentation in the shallow littoral zone of the Baltic Ice Lake. The regression of the abovementioned water body happened shortly before 11.7 cal kyr BP (9.7 cal kyr BC) (Björck 1995; Houmark-Nielsen and Kjær 2003; Andrén et al. 2011). Discovered scattered

Collected data suggest deposition of the investigated sequences since the Lateglacial in the region (Fig. 3.9). Alongside this, an increasing participation of biogenic constituents already shows the development of the vegetation cover with participation of pine-birch woods during the Alleröd (Rinterknecht et  al. 2008; Stančikaitė et al. 2008). The vegetation pattern points to the predominance of a milder climatic system triggering

Figure 3.9. Percentage pollen diagram of selected taxa, core 8a, Nemunas Delta area, southern part of the maritime region.

49

Stančikaitė, Bitinas, Damušytė, Vaikutienė, Girininkas, Rimkus, Daugnora and Žulkus

Figure 3.10. Percentage diatom diagram, core 25, Nemunas Delta area, southern part of the maritime region.

diatoms indicate the existence of a very shallow freshwater basin at the age interval of 11.6−8.2 cal kyr BP (9.7−6.3 cal kyr BC) in the central part of the present Curonian Lagoon (Damušytė et  al. 2021), while investigations conducted in the offshore zone of the present Baltic Sea infer the existence of a shallow transparent water body with a rather high water temperature, intense water turbidity and higher nutrient supply (Žulkus et al. 2015). Besides this, sediments of Early Holocene age deposited in fresh, shallow mesoeutrophic water basins with high participation of benthic and some planktonic diatoms (Aulacoseira islandica (O. Müller) Simonsen, Aulacoseira granulata (Ehrenberg) Simonsen, Amphora ovalis var. pediculus (Kützing) Van Heurck, Opephora martyi Héribaud, Navicula scutelloides W. Smith, Fragilaria brevistriata Grunow, Cocconeis disculus (Schumann) Cleve, Epithemia sp.) have been discovered in the sediment sequences distributed all along the territory of the Curonian Spit and the northern part of the Curonian Lagoon (Kabailienė 1999; Bitinas et al. 2000; 2002; Kabailienė et al. 2009; Kaminskas et al. 2019).

particular (Kabailienė 1995, 1999; Bitinas et  al. 2002; Kabailienė et  al. 2009) suggesting the formation of the littoral zone of the Litorina Sea. However, the content of planktonic freshwater diatoms was still high, especially in the territory of the Curonian Lagoon and spit as the area was largely influenced by the freshwater outflow from the continent. In the sediments of the Late Holocene age, formed after the regression of the Litorina Sea (Andrén et  al. 2000), freshwater benthic diatoms predominate indicating the existence of an almost fresh littoral basin in the southern part of the region (Kabailienė, 1999; Kabailienė et al., 2009). 3. Plant macro remains. During recent years, surveys of the plant macroremains have been conducted analysing the material obtained from the offshore zone of the Baltic Sea. Both plant macro remains extracted from the sediment sequences (Žulkus et al. 2015) and in situ remains of trees (Chapter 1, Figs. 1.10, 1.13 of this book), discovered at the sea bottom, have been analysed (Bitinas et al. 2003). Collected data let us consider the flourishing of a dry Pinus-predominating forest and the formation of biogenic deposits in small local basins situated at about 24−29 m b.s.l. The final degradation of the pine forest was dated to about 10.1–10.2 cal kyr BP (~8.2 cal kyr BC) (Girininkas and Žulkus, 2017) which generally marks the maximum transgression of the Ancylus Lake (Andrén et  al. 2011), whereas the plant macrofossil record of biogenic sediments establishes the existence of a shallow water basin surrounded by a rich rim of water plants during the Early Holocene.

Obviously, existence of these basins chronologically was coincident with the Yoldia Sea (Björck 1995) and Ancylus Lake (Björck 1995; Andrén et  al. 2011) stages in the history of the Baltic Sea, when coastlines of both mentioned basins were situated significantly westward. The situation has changed when the Initial Litorina Sea stage (9.8–8.5 cal kyr BP, 7.6–6.4 cal kyr BC, according to Andrén et al. 2000) ended and increasing number (up to 30%) of discovered benthic brackish diatom complexes (Diploneis didyma (Ehrenberg) Ehrenberg, Diploneis smithii f. rhombica Mereschkowsky, Grammatophora marina (Lyngbye) Kützing, Campylodiscus clypeus Ehrenberg, Campylodiscus echeneis Ehrenberg, Rhabdonema arcuatum (Lyngbye) Kützing, Nitzschia tryblionella Hantzsch, Navicula forcipata Greville) indicates the onset of brackish water inflow in the region and the area of the present Curonian Spit and lagoon in

4. Molluscs. Subfossil molluscs have been discovered in the sediment sequences representing different parts of the maritime region (Damušytė 2009; 2011; Buynevich et al. 2011). In the northern part of the region, including the northern part of the Curonian Spit, fossil mollusc shells typical for the shallow littoral zone of the basin have 50

Lateglacial–Middle Holocene Environmental Dynamics in the Coastal Area of the Baltic Sea... predominated in the sediment sequences representing the mainland coast of the present Baltic Sea. Dating back to the Early–Middle Holocene (~7.2–6.2 cal kyr BP, 5.3–4.3 cal kyr BC), they flourished in basins with a sandy and silty bottom (Macoma baltica) as well as in areas with a high abundance of boulders, gravel, or pebbles (Mytilus edulis, Littorina littorea). The latter has also indicated the limited inflow of brackish water to the area while water salinity hardly reached 8–10%. While in the rest of the territory presently attributed to the Curonian Spit, deposition in shallow freshwater pools of water or slowly flowing basins predominated throughout the Middle-Late Holocene according to mollusc data (Damušytė 2009; 2011). Shells of Bithynia tentaculate, Valvata naticina, Lymnaea ovata, Pisidium amnicum, Pisidium pulshellum etc. have been discovered in the sediments. Moreover, the age of the molluscs’ bearing sediments varied from the onset of the Middle Holocene (~8.0 cal kyr BP, ~6.0 cal kyr BC) to the Common Era. A similar pattern of the mollusc records indicating the existence of small freshwater basins with slowly flowing streams has been indicated when analysing the fossils discovered in the territory of the Nemunas River Delta (Damušytė 2009; 2011). Here Amnicola steini, Acroloxus lacustre, Sphaerium solidum and Pisidium, amnicum as well as P. henslowanum have been discovered. Interestingly, the oldest mollusc bearing sediments, i.e. ones deposited at around 13.5 cal kyr BP (~11.6 cal kyr BC), have been discovered in this region, suggesting deposition in the littoral zone of a small enclosed freshwater basin that existed at that time here (Damušytė 2009; 2011).

can be emphasised between the continental part of the coast and those indicated along the Curonian Spit and the territory of the Nemunas River delta (Bitinas et al. 2005; Damušytė 2011; Damušytė et al. 2021). The glaciogenic formations (morainic clayey and sandy loam) of the Upper Pleistocene prevail in the continental part of the maritime region, and are found in outcrops in the geological cross-sections of the seashore cliffs stretching northwards from Klaipėda (Fig. 3.3). The glacial sediments of the Middle Pleistocene, in some areas merged and shown in the geological cross-sections as a single complex together with the layers of the Upper Pleistocene glacial, are found in outcrops on the underwater slope in the continental part of the maritime region (Figs. 3.4, 3.5). Intermorainic sediments of Middle Pleistocene age reaching up to 10–12 m and consisting of greenish-grey sandy silt, as well as fine- and very finegrained, often silty, limnic sand containing admixtures of a fine, dispersive organic substance have also been found in the coastal zone of the continental shore (Figs. 3.3, 3.6; Bitinas et al. in press). Prominent layers of sandy sediments overlie the abovedescribed glacial deposits of the Upper Pleistocene. This part of the Quaternary strata was formed during the Lateglacial and Holocene. All along the territory of the maritime region an accumulation started in the proglacial meltwater lakes during the initial intervals of the Lateglacial (Late Weichselian) (Fig. 3.2). Fine and very fine-grained sand with a high proportion of silt and clay particles was deposited. Later these sediments were overlain by the sand of the Baltic Ice Lake (BIL), reaching up to 10 m in depth in the northern sector of the maritime region (Bitinas et  al. 2001). While limnic and biogenic sediments were deposited in the local freshwater basins stretching to the southern part of the maritime region, as the coastline of the BIL was situated further westward from the present coast in this part of the Baltic basin (Damušytė 2011). Contemporaneous presence of the organic enriched gyttja pointing to the existence of a small, shallow oligotrophic basin and sandy formations, typical of deeper basins, points to the formation of a broken landscape of low water estuaries or freshwater lagoons at about 12.8–12.7 cal kyr BP (10.8–10.7 cal kyr BC) here (Damušytė et al. 2021).

3.4. Discussion Geological-geomorphological structure of the Lithuanian maritime region In the Lithuanian coastal zone of the Baltic Sea, Quaternary sediments predominate both onshore and offshore. Furthermore, deposited on the undulating sub-Quaternary surface, these beds are highly intersected by prominent paleoincisions. Lower Triassic, Middle Jurassic, Lower and Upper Cretaceous sediments (clay, silt, sand and sandstone) underlie deposits of Quaternary age whereas Permian limestone is found deposited in the bottom of the deepest paleoincisions. The thickness of the Quaternary sediments is mainly determined by the nature of the subQuaternary relief, i.e. on the continental part of the shore it ranges from 50–60 to 130–140 m, while in the southern part of the region it reaches about 60–70 m. Formed by several advances of the continental ice glaciogenic sediments of Pleistocene age, morainic clayey and sandy loam (till) prevail in the geological cross-section of the coastal zone while the uppermost part of the sediments consists of Holocene layers. The latter include marine, aeolian, alluvial, and bog formations.

The onset of the Holocene is concomitant with the establishment of the vast boggy areas in the southern part of the maritime region (Kabailienė and Stančikaitė, 1998; Napreenko-Dorokhova 2015, Stančikaitė pers. comm.). Beside that, decreasing representation of finegrained terrigenous material is typical for sediments dating back to the Early Holocene here (Damušytė et al. 2021). Simultaneously, an interbedding of terrigenous and organic layers was noted, suggesting periodic inundation of the area.

Discussing the peculiarities of the geological structure of the of the uppermost part of the Quaternary thickness of the Lithuanian maritime region, remarkable differences

Deposition in the nearshore of the Litorina Sea took place during the later stages of the Holocene in the northern part of the Lithuanian coastal region and along 51

Stančikaitė, Bitinas, Damušytė, Vaikutienė, Girininkas, Rimkus, Daugnora and Žulkus the Curonian Spit. Interlayers of an organogenic origin, i.e. massive compressed peat, is characteristic for these formations testifying to the fact that about 7.5 and 3.7– 4.3 cal kyr BP (5.6 and 2.4–1.8 cal kyr BC) there were marine sedimentation breaks (Damušytė 2011). On the Lithuanian-Latvian border, the Litorina Sea beds reach a maximum of 6–7 m thick. Beside that, marine and lagoon deposits interchange in the geological cross-section testifying to a change in sedimentation conditions. The marine sediments are mainly composed of fine-grained sand, whereas lagoon formations consist of brown or black-grey massive compressed gyttja reaching up to 0.5– 0.7 m, as well as of very fine-grained sand that abounds in an admixture of a fine, dispersive organic substance, detritus of mollusc shells and pieces of amber, while in the territory of the present Nemunas River Delta, ongoing deposition of biogenic material in the extended peat bogs (Kabailienė and Stančikaitė 1998; Napreenko-Dorokhova 2015; Damušytė et  al. 2021) are noted since the Early Holocene onward, suggesting limited impact of the Litorina basin into the area.

5 m a.s.l. to 15 m a.s.l. in the territory of the Nemunas River Delta (Damušytė et al. 2021), while in the northern part of the maritime region these formations have been remarkably influenced by the melting ice water and are represented by NE orientated ridges (35 m a.s.l.) of 500–800 m long and 150–200 m width stretching to the slightly undulating plain of glacial origin. The marginal formations noted in the central part of the maritime region (30–35 m a.s.l.) have been remarkably influenced by the aquaglacial and marine processes and small hills are seen in here today. Discussing the surface structure of the maritime region, the relief forms of the proglacial lakes should be emphasised as the territory was occupied by these basins during the earliest stages of the postglacial. In general, the terraces of these basins have been identified stretching all along the coastal zone (Fig. 3.2). In the northern part of the region a flat terrace laying at about 37 m a.s.l. was formed and later reworked by aeolian processes. Meanwhile, in the central part of the investigated region, an extended ice-marginal plateau was formed in between the blocks of the dead-ice and later abraded by the Baltic Sea basins later. It should be pointed out that the shorelines of these basins might have been remarkably uplifted by glacioisostasy (Šliaupa et al. 2005) in the northern part of the Lithuanian coastal zone in particular. Regarding the southern part of the area, the altitude of these basins was rather high as well, as the top-most glaciolacustrine terraces are lying at about 40 m a.s.l. here (Damušytė et  al. 2021) and few more lower levels of this origin have been identified at 16–20 m a.s.l. and 6–8 m a.s.l. (Damušytė 2011). Going westwards, the glaciolimnic sediments of the proglacial basins have been discovered laying at about 19–20 m b.s.l. in the territory of the Curonian Lagoon and Curonian Spit and at about 7–9 m b.s.l. in the territory of Rusnė Island.

Meanwhile in the Curonian Spit, sandy deposits of open basins predominate in the upper part of the Quaternary formations with organogenic (lagoon and bog) beds occurring in some areas (e.g. Bitinas et  al. 2001; 2017; Kaminskas et al. 2019). Glacial deposits (morainic clayey and sandy loam) were noted laying at about 30 m b.s.l. here, while in the northern part of the spit the top of these deposits was fixed at about 13–14 m b.s.l. (Fig. 3.7). The basis of the Curonian Spit is composed of the Litorina and post-Litorina Sea’s marine deposits – mainly fine-grained sands (Fig. 3.7). Lagoon deposits (sandy silt enriched by organic substance, or a so-called “lagoon marl”), as well as bog deposits (peat) are inserted here. Modern marine deposits that are noted for a rather profound change in granuliometric composition along the entire shore are prevalent throughout the whole shore zone of the Curonian Spit. Course-grained sand dominates on the seashore in the southern part of the spit, in the environs of Nida, whereas sand with gravel (in some cases shingle) is common in the central part of the spit, between Preila and Juodkrantė. The protective beach dune ridge which was given rise to by humans more than two hundred years ago, runs along the entire shore of the Curonian Spit (Bučas 2001). The entire Curonian Spit territory is covered by aeolian sediments what have been deposited starting from the Middle Holocene (Gaigalas and Pazdur 2008; Gudelis 1998; Gudelis et  al. 1993) – in some areas the aeolian massifs are still not covered by vegetation and present active, moving dunes (Buynevich et al. 2007a, b; Dobrotin et al. 2013; Česnulevičius at al. 2017; Bitinas et al. 2018).

The relief forms of the BIL are widely distributed in the northern part of the Lithuanian coastal zone, while these are very episodic within the southern part of the region – only the small fragment of the glaciolacustrine terrace (5 m a.s.l.) has been identified here (Fig. 3.2). Meanwhile a largely undulating plain with a flat and wide ridge (up to 300 m wide) reaching up to 16 m a.s.l. stretches northwards Palanga. Later, the surface of the terraces were reworked by aeolian processes, intersected by the river valleys, eroded and abraded in some places. Going southwards the terrace gradually declines to about 7 m a.s.l. and is submerged below the present sea level (an altitude varies from 2 to 13 m b.s.l.) on the rest of the coast. This new interpretation suggests minimum water level elevations in this part of the BIL, i.e. the water table was varying around zero points before 13.3 cal kyr BP, and significantly lowered even before the final drainage of the BIL (Damušytė et al. 2021) at about 11.7 kyr BP (~9.6 cal kyr BC) (Björck 1995; Houmark-Nielsen and Kjær 2003; Andrén et al. 2011).

Geomorphological pattern of the maritime region Analysing the postglacial relief of the Lithuanian maritime region, the ice-marginal ridges formed during the last (Weichselian) Glaciation are of particular importance. NE–SW stretching relief forms are covered by a thin layer of glaciolacustrine sediments with a surface varying from

After the regression of the BIL, the terrestrial system established in the coastal region of Lithuania according 52

Lateglacial–Middle Holocene Environmental Dynamics in the Coastal Area of the Baltic Sea... to former reconstructions of regression resulted in about 30–33 m shallower water (Gudelis 1979; Kabailienė 1999) or even the 55.5–57.6 m b.s.l. range (Gelumbauskaitė 2009) in this part of the Baltic basin. According to newly obtained evidence from the offshore zone of the Baltic Sea the remains of the terraces reaching up to 500 m wide were detected at 37–39 m b.s.l., and 44–47 m b.s.l. westwards from the Curonian Spit (Žulkus et al. 2015; Girininkas and Žulkus 2017; Žulkus and Girininkas 2020). Presumably, these could be interpreted as having been formed by the Yoldia Sea (Žulkus et al. 2015; Damušytė et al. 2021). No direct traces of coastal formations attributed to the next stage of the Baltic Sea, Ancylus Lake, have been found in the territory of the Lithuanian coast so far (Damušytė 2011).

Hoth 2011). The first marine basin was developed during the Holsteinian Interglacial, about 410–390 kyr before present (BP), when the southern part of the present Baltic was filled with sea water (Uścinowicz 2011). During the next phase, the Eemian Interglacial (about 126–115 kyr BP), the aforementioned depression became a similar size and shape as the present Baltic Sea, and also filled with marine water – the Eemian Sea was formed (Uscinowicz, 2011). Since the Last Glacial Maximum (LGM, 26.5–20 cal kyr BP, 29.0–22.0 cal kyr BC; Clark et  al. 2009), the area of the Baltic Sea basin as well as surrounding territories have undergone numerous transformations. The ice retreat that started at about 16.5 cal kyr BP (14.5 cal kyr BC) was coincident with the formation of the ice-marginal and subglacial landforms considered as key-factors in describing the earliest stages of the deglaciation. An age of the final ice retreat is about 14.9 ± 0.8–14.5 ± 0.8 ka BP (~12.9 cal kyr BC) in the maritime region of Lithuania according to 10Be data (Rinterknecht et  al. 2006; 2008; Marks et  al. 2021, in press) and marginal formations stretching along the coast of the Baltic Sea and Curonian Lagoon mark this time-interval (Fig. 3.2). In response to the ice melting, large, cold freshwater proglacial basins were impounded between the ice sheet and the higher terrain (Stroeven et al. 2016). Shorelines of these basins, both of erosional or depositional origin, are noted along the highest terraces of the Lithuanian maritime region stretching to an elevation of 40 m a.s.l. (Bitinas et al. 2002; Damušytė 2011; Damušytė et al. 2021).

The situation discussing the geomorphological imprints of the Litorina Stage in the terrestrial part of the Lithuanian maritime region is totally different. Despite the negligible impact of the first Litorina transgression (8.3–8.0 cal kyr BP/6.3–6.0 cal kyr BC), the influence of the second Litorina transgression, dating to 7.7–7.6 cal kyr BP (5.8– 5.7 cal kyr BC) resulted in the submergence of large areas of the current onshore area (Damušytė 2011). The terraces of 3.5 km width were formed in the northern part of the region (near Šventoji, up to 8 m a.s.l.) while in the central part it reached up to 0.2 km width (up to 5 m a.s.l.) in parts of the maritime region (Damušytė 2011) when the coastline retreated westward due to an intense glacioisostatic rebound of the maritime region – the uplift trends northward (Šliaupa et  al. 2005; Rozentau et  al. 2012). It should be pointed out that no remnants of this basin have been found in the Nemunas Delta region, suggesting limited impact of the Littorina Sea here. In this area an extended bogging processes (Kabailienė and Stančikaitė 1998; NapreenkoDorokhova 2015; Stančikaitė pers. comm.) and formation of the river valleys started implying predominance of terrestrial sedimentation and re-organisation of the surface by intense fluvial-erosion processes. Simultaneously, formation of especially pronounced geomorphological features started – missives of the old parabolic aeolian dunes in the Curonian Spit (Gaigalas and Pazdur 2008; Gudelis 1998; Dobrotin at al. 2013).

The further development of the Lithuanian maritime region was directly related to the history of the BIL, the freshwater basin that lasted to about 11.7 cal kyr BP (~9.7 cal kyr BC) (Andrén et al. 2011). In the northern part of the maritime region coastal formations of the BIL stretch to about 12–16 m a.s.l., while gradually declining to 7 m a.s.l. going southward (Gudelis 1979; Damušytė 2011). In the territory of the Nemunas Delta, these formations are situated below the present sea level suggesting the variations of the water table are about 0 m altitude here (Damušytė et al. 2021), which is in a positive correlation to the regional reconstructions (Uścinowicz 2006; Rosentau et al. 2009; Vassiljev and Saarse 2013). Nevertheless, an intense sedimentation processes took place as small-scale isolated basins have existed according to diatom, pollen, mollusc and 14C data at that time here (Rinterknecht et  al. 2008; Damušytė et  al. 2021). Besides this, deeper basins influenced by water streams and flows existed in the territory of the present Curonian Lagoon and beneath the present Curonian Spit (Sergeev et al. 2015; Kaminskas et  al. 2019). The described palaeogeographical system might have been established at about 12.8–12.7 cal kyr BP (10.8–10.7 cal kyr BC), simultaneously with the first drainage of the Baltic Ice Lake (Muschitiello et al. 2016). Moreover, new data collected from offshore of the Baltic Sea proves the formation of the peat sediments at about 12.1–10.5 cal kyr BP (Lab. code Vs-2634; 9860 ± 250 14 C years BP; 10.2–8.5 cal kyr BC) (Žulkus et  al. 2015;

The post-Litorina Sea interval in the history of the Baltic Sea is characterised by the rather stable hydrological system all along the territory of the Lithuanian maritime region (Damušytė 2011). For example, biogenic-limnic sedimentation with the formation of appropriate forms of relief continued in the territory of the Nemunas River Delta. History of the Baltic Sea in the Lithuanian maritime region At the beginning of the Quaternary there was no evidence of the existence of the marine basin in the outline of the present Baltic Sea – the recent Baltic Sea depression is a Middle Pleistocene phenomenon of both tectonic and glacial erosion origin (e.g. Schwab et al. 1997; Šliaupa and 53

Stančikaitė, Bitinas, Damušytė, Vaikutienė, Girininkas, Rimkus, Daugnora and Žulkus Girininkas and Žulkus 2017) at -29 m b.s.l. proving early regression of the BIL in this part of the Baltic basin.

peat bogs and lakes predominated here as formation of biogenic sediments had started at about 9.6–9.3 cal kyr BP (7.7–7.3 cal kyr BC), in the Kozje peat bog, the Russian part of the Nemunas River Delta (Napreenko-Dorokhova 2015) for example. Taking into account the results of the new 14C dates of tree trunks collected from the Lithuanian offshore sector of the Baltic Sea (Žulkus et al. 2012; 2015; Žulkus and Girininkas 2020), it is possible to maintain that the second, maximal, Litorina Sea transgression manifested about 7.7–7.6 cal kyr BP (5.8–5.7 cal kyr BC). As a result, the sea level raised about 20 m and stabilized approximately at its most recent position. After these significant changes in the Baltic basin, the final stage of the Curonian Spit formation began. An accumulation of the “lagoon marl”, i.e. limnic sediments, in the Lithuanian part of the Curonian Lagoon started about 6.0 cal kyr BP (4.1 cal kyr BC); they have been discovered laying below the territory of the present Curonian Spit as well (Bitinas et  al. 2017; Kaminskas et  al. 2019). According to the fossil mollusc data these basins might be characterised as shallow freshwater basins (Damušytė 2009) and judging on the basis of the diatom data this area was a part of the littoral zone of the freshwater basin (Kabailienė 1997).

After the final regression of the BIL, which lasted to about 11.7 cal BP (~9.7 cal kyr BC) (Björck 1995; HoumarkNielsen and Kjær 2003; Andrén et  al. 2011), the water table lowered 30–33 m (Gudelis 1979; Kabailienė 1999) to possibly even 55.5–57.6 m b.s.l. (Gelumbauskaitė 2009) along the Lithuanian coast. Obviously, the water retreat resulted in the remarkable lowering of the water table and the coast of the Yoldia Sea that existed at that time (Björck 1995) was situated further westwards. According to new information obtained 15.0–15.5 km offshore from the Curonian Spit, the remains of a 500 m wide terrace were detected laying at 37–39 m b.s.l., and 44–47 m b.s.l. (Žulkus and Girininkas 2020). Furthermore, trunks of a pine tree, dating back to about 11.4–10.1 cal kyr BP (9.5– 8.2 cal kyr BC), have been discovered at about 24–29 m b.s.l. (Bitinas et al. 2003; Žulkus et al. 2015) implying the existence of a terrestrial environment here during the Early Holocene. In general, no sediments of the Yoldia basin have been found above 15 m b.s.l. all along the territory of the southern Baltic coast (Björck 1995; Berglund et al. 2005; Uścinowicz 2006). Small sedimentary basins, which existed in the territory of the present Curonian Lagoon or Nemunas River Delta (Damušytė et al. 2021; Chapter 5 in this volume), attracted humans as groups of the Final Palaeolithic population, representing the classic Swiderian culture settled in areas at that time (Rimkus and Girininkas 2021). Hence, the palaeogeographical situation was shaped by local factors in this part of the Baltic basin at that time and similar circumstances lasted until about 10.2 cal kyr BP (8.2 cal kyr BC) when the abovementioned pine forest was flooded (Žulkus et al. 2015). Indicated data marks the maximum transgression of the Ancylus Lake, one more stage of the Baltic Sea (Andrén et al. 2011). It should be pointed out that the exact outlet of the basin is still a matter of debate in Lithuania, as no direct traces of coastal formations have been found so far (Damušytė 2011; Damušytė et al. 2021). The former reconstructions indicate the water table varied about 4 m b.s.l. in this part of the southeastern Baltic basin during the maximum transgression of the Ancylus Lake (Gelumbauskaitė 2000; 2002; 2003; Bitinas et  al. 2002). Nevertheless, a remarkable lowering of the water table during the final part of the Ancylus Lake stage was noted all along the southern and eastern parts of the Baltic as well (Berglund et  al. 2005; Uścinowicz 2006; Rosentau et  al. 2013; Hansson et  al. 2018). According to the new data collected from the Lithuanian offshore sector of the Baltic Sea, the water table lowered about 30–32 m b.s.l. (Bitinas et  al. 2003; Žulkus et al. 2015; Žulkus and Girininkas 2020) or even lower (Žulkus and Girininkas in press) during the final part of the Ancylus stage.

The terraces of the post-Litorina Sea, formed after 3.7 cal kyr BP (1.7 cal kyr BC) (Damušytė 2011), exceeded the present coastline by 1 or 2 m in the central and northern parts of the maritime region while an extended freshwater basin with numerous embayments and lagoons existed in the southern part of the region where no sediments of these basins have been found above 0 m a.s.l. 3.5. Conclusions Presented data outlining the major chronological and spatial limits of the Lateglacial and Holocene in the Lithuanian maritime region reveals formation of the extended proglacial lakes reaching up to 40 m a.s.l. during the earliest stages of the deglaciation. While following the regression of the abovementioned basins, the terrestrial landscape of low water estuaries or freshwater lagoons have occurred since about 13.8 cal kyr BP (~11.7 cal kyr BC) in the southern part of the region. Meanwhile, the extended basin of the Baltic Ice Lake occupied the northern part of the maritime region. After the final recession of the BIL at about 11.7 cal kyr BP (9.7 cal kyr BC), a low water table persisted in this part of the south Baltic basins as both the Yoldia Sea and Ancylus Lake were situated further westwards. New geomorphological, isotopic (14C) and palaeobotanical data obtained from the offshore of the Baltic Sea evidences the formation of the extended marine terraces of Early Holocene age laying between 11 to 30–32 m b.s.l., or even lower. Until 10.2–10.1 cal kyr BP (~8.2 cal kyr BC), a terrestrial system predominated in the coastal territory of the present Baltic Sea where shallow sedimentary basins developed and bogging of the vast areas in the territory of the present Nemunas River Delta started. At the same time, archaeological records imply the presence of Final Palaeolithic populations represented by elements of classic Swiderian culture here. The negative

The Initial Litorina Sea stage (9.8–8.5 cal kyr BP (7.6–6.4 cal kyr BC) according to Andrén et  al. 2000) is characterised by a low water table in the territory of the present coast of Lithuania (Damušytė 2011). The terrestrial conditions that supported deposition in the 54

Lateglacial–Middle Holocene Environmental Dynamics in the Coastal Area of the Baltic Sea... water level tendencies lasted until 8.5 cal kyr BP (6.4 cal kyr BC) in the maritime region. The northern part of region was submerged by the maximal transgression of Litorina Sea at about 7.7–7.6 cal kyr BP (5.8–5.7 cal kyr BC). As a result of later glacioisostatic rebound of the territory, the current position of these marine terraces varies between 8 m a.s.l. in the northern part of the region and 2–4 m a.s.l. in the central one. The terraces formed after 3.7 cal kyr BP (1.7 cal kyr BC), during the time of the post-Litorina Sea, reached altitudes of 1–2 m a.s.l. in the central and northern parts of the maritime region.

Vaikmäe, R., 2000. Stratigraphic correlation of Late Weichselian and Holocene deposits in the Lithuanian Coastal Region. Proceedings of the Estonian Academy of Sciences, Geology, 49, 200–216. DOI:10.3176/ geol.2000.3.03. Bitinas, A., Damušytė, A., Hutt, G., Jaek, I., Kabailienė, M., 2001. Application of the OSL dating for stratigraphic correlation of Late Weichselian and Holocene sediments in the Lithuanian Maritime Region. Quaternary Science Reviews, 20, 767–772. Bitinas, A., Damušytė., A., Stančkaitė M., Aleksa, P., 2002. Geological development of the Nemunas River Delta and adjacent areas, West Lithuania. Geological Quarterly, 46 (4), 375–389.

Acknowledgements Investigations were partly financed by the grant (No. 09.3.3-LMT-K-712-01-0171) from the Research Council of Lithuania.

Bitinas, A., Žulkus, V., Mažeika, J., Petrošius, R., Kisielienė, D. 2003. Medžių liekanos Baltijos jūros dugne: pirmieji tyrimų rezultatai. Gelogija, 43, 43–46.

References

Bitinas, A., Mažeika, J., Buynevich, V. I., Damušytė, A., Molodkov, A., Grigienė, A., 2017. Constraints of radiocarbon dating in southeastern Baltic lagoons: assessing the vital effects. In: Harff, J. (d). Coastline Changes of the Baltic Sea from South to East, Coastal Research Library, vol. 19.

Andrén, E., Shimmield, G., Barnd, T., 1999. Changes in the environment during the last centuries on the basisi of siliceous microfossil records from the southwestern Baltic Sea. The Holocene, 9, 25–38. Andrén, E., Andrén, E., Sohlenius, G., 2000. The Holocene history of the south–western Baltic Sea as relected in a sediment core from the Bornholm Basin. Boreas, 29, 233–250.

Bitinas, A., Dobrotin, N., Buynevich, I. V., Molodkov, A., Damušytė, A., Pupienis, D., 2018. Coastal dune dynamics along the northern Curonian Spit, Lithuania: toward an integrated database. Geological Quarterly, 62 (3), 553–562.

Andrén, T., Lindeberg, G., Andrén, E., 2002. Evidence of the final drainage of the Baltic Ice Lake and the brackish phase of the Yoldia Sea in glacial varves from the Baltic Sea. Boreas, 31, 226–238.

Bitinas, A., Molodkov, A., Damušytė, A., Grigienė, A., Satkūnas, J., Šeirienė, V., Šlauteris, A., 2021. Reconstruction of the geological history of the Lithuanian Maritime Region from MIS 6 to MIS 3. Quaternary International (in press).

Andrén, T., Andrén, E., Berglund, B.E., Yu, S.-H., 2007. New insights on the Yoldia Sea low stand in the Blekinge archipelago, southern Baltic Sea. GFF, 129, 277–285.

Björck, S., 1995. A review of the history of the Baltic Sea, 13.0–8.0 ka BP. Quaternary International, 27, 19–40.

Andrén, T., Björck, S., Andrén, E., Conley, D., Zillén, L., Anjar, J., 2011. The development of the Baltic Sea basin during the last 130 ka. In: Harff, J., Bjorck, S., Hoth, P. (eds.). In: The Baltic Sea Basin. Springer, Heidelberg Dordrecht Berlin New York, 75–97.

Bučas, J., 2001. Kuršių nerijos nacionalinis parkas (Curonian Spit National Park). Vilnius, Savastis. Buynevich, I. V., Bitinas, A., Pupienis, D., 2007a. Lithological anomalies in a relict coastal dune: geophysical and paleoenvironmental markers. Geophysical Research Letters, 34, L09707.

Berendt, G., 1869. Geologie der Kurischen Haffes und seinen Umgebung. Königsberg. Berglund, B.E., Sandgren, P., Barnekow, L., Hannon, G., Jiang, H., Skog, G., Yu, S.-Y., 2005. Early Holocene history of the Baltic Sea, as reflected in coastal sediments in Blekinge, southeastern Sweden. Quaternary International, 130 (1), 111–139.

Buynevich, I. V., Bitinas, A., Pupienis, D., 2007b. Reactivation of coastal dunes documented by subsurface imaging of the Great Dune Ridge, Lithuania. Journal of Coastal Research, SI50, 226–230.

Berzins, V., Lübke, H., Berga, L., Cerina, A., L, K., Meadows, J., Muižniece, S., Paegle, S., Rudzīte, M., Zagorska, I., 2016. Recurrent Mesolithic-Neolithic occupation at Sise (western Latvia) and shoreline displacement in the Baltic Sea basin. Holocene, 26, 1319–1325.

Buynevich, I. V., Damušytė, A., Bitinas, A., Olenin, S., Mažeika, J., and Petrošius, R., 2011. PonticBaltic pathways for invasive aquatic species: Geoarchaeological implications. In: Buynevich, I. V., Yanko-Hombach, V., Gilbert, A., and Martin, R. E. (eds). Geology and Geoarchaeology of the Black Sea Region: Beyond the Flood Hypothesis: Geological Society of America Special Paper 473, 189–196.

Bitinas, A., Brodski, L., Damušytė, A., Hütt, G., Martma, T., Ruplėnaitė, G., Stančikaitė, M., Ūsaitytė, D., 55

Stančikaitė, Bitinas, Damušytė, Vaikutienė, Girininkas, Rimkus, Daugnora and Žulkus Clark, P. U., Dyke, A. S., Shakun, J. D., Carlson, A. E., Clark, J., Wohlfarth, B., Mitrovica, J. X., Hostetler, S. W., McCabe, A. M., 2009. The last glacial maximum. Science, 325, 710–714.

krantų tyrimai 2017”. Klaipėdos universiteto leidykla, 69–72. Gudelis, V., 1959. Geologicheskie i fiziko– geograficheskie uslovija zaliva Kurshiu mares i teritrorii okaimliajushchej zaliv. In: Jankevichius, K. (ed). Kurshiu marеs. Itogi kompleksnogo issledovania. Vilnius, 7–46.

Červinskas, E., Kunskas, R., 1982. Kuršių Marių lagūninės avandeltinės sedimentacijos palyginimas (Comparison of the sedimentological features of the avandelta of the Curonian Spit). Geografijos metraštis, XX, 123–139.

Gudelis, V., 1979. The Quaternary history of the Baltic. Lithuania area. In: Gudelis, V., Königsson, L.-K. (eds). The Quaternary history of the Baltic. Acta Univ. Upsallensis Anum Quingentesimu Celebratis 1, 159– 173.

Česnulevičius, A., Morkūnaitė, R., Bautrėnas, A., Bevainis, L., Ovodas, D., 2017. Intensity of geodynamic processes in the Lithuanian part of the Curonian Spit. Earth Dynamic System, 8, 419–428. Damušytė, A., 2009. Late Glacial and Holocene subfossil mollusc shells on the Lithuanian Baltic Sea coast. Baltica, 22 (2), 111–122.

Gudelis, V., 1998. Lietuvos įjūris ir pajūris. Vilnius. Gudelis, V., Klimavičienė, V., 1990. Lietuvos Pajūrio lygumos pietinės dalies geomorfologiniai bruožai. Baltijos jūros krantų dinamikos ir paleogeografijos klausimai, 1 (II), Vilnius, 94–118.

Damušytė, A., 2011. Post-glacial geological history of the Lithuanian coastal area. Summary of doctoral dissertation. Vilnius University. Vilnius, 84.

Gudelis, V., Klimavičienė, V., 1993. Nemuno detos geomorfologijos ir paleogeografijos bruožai. Geografija, 29, 7–12.

Damušytė, A., Stančikaitė, M., Girininkas, A., Rimkus, T., Daugnora, L., Skuratovič, Ž., Uogintas, D., Valūnas, D., Vaikutienė, G., Žulkus V., 2021. New insight into the palaeoenvironmental dynamics as a background of the human history in the Nemunas River delta region, W Lithuania, throughout the Lateglacial and Early Holocene. Baltica, 34 (2), 216–245. https://doi. org/10.5200/baltica.2021.2.7

Gudelis V, Klimavičienė V, Savukynienė N., 1993. Kuršių Nerijos kopų senieji dirvožemiai ir jų palinologinė charakteristika. In: V. Gudelis, ed. Baltijos jūros krantų dinamikos ir paleogeografijos klausimai, 2. Academia, Vilnius, pp. 64–93. Hansson, A., Nilsson, B., Sjöström, A., Björck, S., Holmgren, S., Linderson, H., Magnell, O., Rundgren, M., Hammarlund, D., 2018. A submerged Mesolithic lagoonal landscape in the Baltic Sea, south-eastern Sweden–Early Holocene environmental reconstruction and shore-level displacement based on a multiproxy approach. Quaternary International, 463 (A), 110–123.

Dobrotin, N., Bitinas, A., Michelevičius, D., Damušytė, A., Mažeika, J., 2013. Reconstruction of the Dead (Grey) Dune evolution along the Curonian Spit, Southeastern Baltic. Bulletin of the Geological Society of Finland, 85, 53–64. Gaigalas, A., Pazdur, A., 2008. Chronology of buried soils, forest fires and extreme migration of dunes on the Kuršių nerija spit (Lithuanian coast). Landform Analysis, 9, 187–191.

Houmark-Nielsen, M., Kjær, K. H., 2003. Southwest Scandinavia, 40–15 kyr BP: palaeogeography and environmental change. Journal of Quaternary Science, 18(8), 769–786.

Gelumbauskaitė, L. Ž., 2000. Late– and Postglacial palaeogeomorphology on the Klaipėda submarine slope, southeastern Baltic Sea. Baltica, 13, 36–43.

Juodagalvis, V., Simpson, D. N., 2000. Šventoji revisited -the joint Lithuanian-Norwegian project. Lietuvos Archeologija, 19, 139–51.

Gelumbauskaitė, L. Ž., 2002. Holocene history on the northern part of the Kuršių Marios (Curonian) Lagoon. Baltica, 15, 3–12.

Kabailienė, M., 1959a. Lietuvos ir pietinės Latvijos Baltijos pajūrio raida vėlyvajame ledynmetyje ir poledynmetyje diatomėjų floros tyrimo duomenimis. Geologija ir Geografija, X (2), 175–215.

Gelumbauskaitė, L. Ž., 2003. On the morphogenesis and morphodynamics of the shallow zone of the Kuršių Nerija (Curonian Spit). Baltica, 16, 37–42.

Kabailienė, M., 1959b. Augalijos raida vėlyvajame ledynmetyje ir poledynmetyje Lietuvos ir pietinės Latvijos pajūrio zonoje. Geografijos metraštis, 2, 477– 506.

Gelumbauskaitė, L. Ž., 2009. Character of sea level changes in the subsiding southeastern Baltic Sea during Late Quaternary. Baltica, 22 (1), 77–82. Gelumbauskaitė, L. Ž., Šečkus, J., 2005. Late Quaternary shore formations of the Baltic basins in the Lithuanian sector. Geologija, 52, 34–45.

Kabailienė, M., 1960, About the displacement of the shore - line on the Lithuanian and Latvian sea - coast in Late - and Post - Glacial period and the possibilities of comparison with adjacent areas. In: Gudelis, V. (ed.) Collected papers for the XIX international Geographical Congress, 315–322.

Girininkas, A., Žulkus, V., 2017. Baltijos jūros krantai ir žmonės ankstyvajame holocene. In: 10-oji Nacionalinė jūros mokslų ir technologijų konferencija „Jūros ir 56

Lateglacial–Middle Holocene Environmental Dynamics in the Coastal Area of the Baltic Sea... Kabailienė, M., 1995. The Baltic Ice Lake and Yoldia sea stages, based on data from diatom analysis in the central, south-eastern and eastern Baltic. Quaternary International, 27, 69–72.

Sea Marine Geology. Abstract Volume & Field Trip Guidebook. Polish Geological Institute, Warsaw, 125– 129. Muru, M., Rosentau, A., Kriiska, A., Lougas, L., Kadakas, U., Vassiljev, J., Aunap, R., Küttim, L., Puusepp, L., Kihno, K., 2017. Sea level changes and Neolithic hunter-fisher-gatherers in the centre of Tallinn, southern coast of the Gulf of Finland, Baltic Sea. Holocene, 27, 917–928.

Kabailienė, M., 1997. Shore line displacement, palaeoecological conditions and human impact on the southeastern coast of Baltic Sea. In: Grigelis, A. (ed.) The Fifth marine geological conference “The Baltic’. Abstracts and excursion guide. October 6–11, Vilnius, Lithuania. 145–147.

Muschitiello, F., Lea, J. M., Greenwood, S. L., Nick, F. M., Brunnberg, L., MacLeod, A., Wohlfarth, B., 2016. Timing of the first drainage of the Baltic Ice Lake synchronous with the onset of Greenland Stadial 1. Boreas, 45, 322–334.

Kabailienė, M., 1998. Vegetation history and climate changes in Lithuania during the Late Glacial and Holocene according to pollen and diatom data. In: Kabailienė, M., Miller, U., Moe, D., Hackens, T. (eds). Environmental History and Quaternary Stratigraphy of Lithuania, PACT, 54, 13–31.

Napreenko-Dorokhova, T. V., 2015. Paleoecological reconstruction of the vegetation cover of the southeastern part of the Baltic region in the Holocene. Ph.D. thesis, Kaliningrad University.

Kabailienė, M., 1999. Water level changes in SE Baltic based on diatom stratigraphy of the Late Glacial and Holocene. Geologija, 29, 15–29.

Nirgi, T., Rosentau, A., Habicht, H.-L., Hang, T., Jonuks, T., Jõeleht, A., Kihno, K., Kriiska, A., Mustasaar, M., Risberg, J., Suuroja, S., Talviste, P., Tõnisson, H., 2020. Holocene relative shore-level changes and Stone Age palaeogeography of the Párnu Bay area, eastern Baltic Sea. Holocene, 30, 37–52.

Kabailienė, M., 2006. Gamtinės aplinkos raida Lietuvoje per 14000 metų (Development of natural environment in Lithuania during 14000 years). Vilnius University, Vilnius, 471. Kabailienė, M., Rimantienė, R., 1995. Holocene changes in the palaeoecological conditions of the Lithuania coast around the Šventoji settlement. PACT, 50, 185– 196.

Piličiauskas, G., Mažeika, J., Gaidamavičius, A., Vaikutienė, G., Bitinas, A., Skuratovič, Ž., Stančikaitė, M., 2012. New archaeological, paleoenvironmental, and 14C data from the Šventoji neolithic sites, NW Lithuania. Radiocarbon, 54(3-4), 1017–1031.

Kabailienė, M., Vaikutienė, G., Damušytė, A., Rudnickaitė, E., 2009. Post-Glacial stratigraphy and palaeoenvironment of the northern part of the Curonian Spit, Western Lithuania. Quaternary International 207, 69–79, DOI:10.1016/j.quaint.2008.12.007.

Rimantienė R., 2005. Die Steinzeitfischer an der Ostseelagune in Litauen. Vilnius. Rimkus, T., Girininkas, A., 2021. The Final Palaeolithic in the Coastal Part of Lithuania with the Technological Emphasis on Aukštumala Stone Age Sites. Archaeologia Baltica, 28, 102–117. Klaipėda.

Kaminskas, D., Rudnickaitė, E., Vaikutienė, G., Bitinas, A., Grigienė, A., Buynevich, I., Damušytė, A., Pupienis, D., Šinkūnas, P., 2019. Middle and Late Holocene paleoenvironmental development of the Curonian Lagoon, Lithuania. Quaternary International, 501, 240–249.

Rinterknecht, V. R., Clark, P. U., Raisbeck, G. M., Yiou, F., Bitinas, A., Brook, E. J., Marks, L., Zelcs, V., Lunkka, J. P., Pavlovskaya, I. E., Piotrowski, J. A., Raukas, A., 2006. The last deglaciation of the southeastern sector of the Scandinavian ice sheet. Science, 311, 1449–1452.

Linden, M., Moller, P., Björck, S., Sandgren, P., 2006. Holocene shore displacement and deglaciation chronology in Norrbotten, Sweden. Boreas, 35, 1–22.

Rinterknecht, V. R., Bitinas, A., Clark, P. U., Raisbeck, G. M., Yiou, F., Brook, E. J., 2008. Timing of the last deglaciation in Lithuania. Boreas, 37, 426–433.

Marks, L., Bitinas, A., Błaszkiewicz, M., Börner, A., Guobytė, R., Rinterknecht, V., Tylmann, K., 2021. Northern Central Europe: glacial landforms during deglaciation (18.9-14.9 ka). In: Palacios, D., Hughes, P. García-Ruiz, J. M., Andrés, N. (eds). European Glacial Landscapes, Vol. I (in press).

Rosentau, A., Vassiljev, J., Hang, T., Saarse, L., Kalm, V., 2009. Development of the Baltic Ice Lake in the eastern Baltic. Quaternary International, 206, 16–23. Rosentau, A., Muru, M., Kriiska, A., Subetto, D. A., Vassiljev, J., Hang, T., Gerasimov, D., Nordqvist, K., Ludikova, A., Lougas, L., Raig, H., Kihno, K., Aunap, R., Letyka, N., 2013. Stone age settlement and Holocene shore displacement in the Narva-Luga Klint Bay area, eastern Gulf of Finland. Boreas, 42 (4), 912–931.

Miotk-Szpiganowicz, G., Uścinowicz, S., Przezdziecki, P., 2010. Relicts of terrestrial deposits on the southern Baltic Sea bed. The Baltic Sea geology 10, Abstract volume, 80–82. Miotk-Szpiganowicz, G., 2016. Stop 4 - coast of the Vistula lagoon (Przebrno). peatbogs and fossil soils of the Vistula Spit. In: The 13th Colloquium on Baltic

Rosentau, A., Bennike, O., U_scinowicz, S., MiotkSzpiganowicz, G., 2017. The Baltic Sea basin. In: 57

Stančikaitė, Bitinas, Damušytė, Vaikutienė, Girininkas, Rimkus, Daugnora and Žulkus Flemming, N.C., Harff, J., Moura, D., Burgess, A., Bailey, G.N. (eds). Submerged Landscapes of the European Continental Shelf: Quaternary Paleoenvironments. Springer, Dordrecht, 103–134.

Stroeven, A.P., Hattestrand, C., Kleman, J., Heyman, J., Fabel, D., Fredin, O., Goodfellow, B.W., Harbor, J.M., Jansen, J.D., Olsen, L., Caffee, M.W., Fink, D., Lundqvist, J., Rosqvist, G.C., Stromberg, B., Jansson, K.N. 2016. Deglaciation of Fennoscandia. Quaternary Science Reviews 147, 91–121, http:// dx.doi.org/10.1016/j.quascirev.2015.09.016

Rosentau, A., Nirgi, T., Muru, M., Bjursäter, S., Hang, T., Preusser, F., Risberg, J., Sohar, K., Tõnisson, H., Kriiska, A., 2020. Holocene relative shore level changes and stone age hunter-gatherers in Hiiumaa island, eastern Baltic Sea. Boreas, 49 (4), 783–798.

Šliaupa, S., Hoth, P., 2011. Geological Evolution and Resources of the Baltic Sea Area from the Precambrian to the Quaternary. In: Harff, J., Björck, S., Hoth, P. (eds). The Baltic Sea Basin. Springer-Verlag, 133–146.

Rosentau, A., Klemann, V., Bennike, O., Steffen, H., Wehr, J., Latinovic, M., Bagge, M., Ojala, A., Berglund, M., Becher, G.P., Schoning, K., Hansson, A., Nielsen, L., Clemmensen, L.B., Hede, M.-U., Kroon, A., Pejrup, M., Sander, L., Stattegger, K., Schwarzer, K., Lampe, R., Lampe, M., Uscinowicz, S., Bitinas, A., Grudzinska, I., Vassiljev, J., Nirgi, T., Kublitskiy, Y., Subetto, D., 2021. A Holocene relative sea-level database for the Baltic Sea. Quaternary Science Reviews, 266, 107071.

Šliaupa, S., Bitinas, A., Zakarevičius, A., 2005. Predictive model of the vertical movements of the Earth’s surface: implications for the land use of the Lithuanian coastal area. Social Strategies, 40, 221–235. Tornquist, A., 1910. Geologie von Ostpreussen. Berlin. Uścinowicz, S., 2006. A relative sea-level curve for the Polish Southern Baltic Sea. Quaternary International, 145/146, 85–105.

Saarse, L., Heinsalu, A., Veski, S., 2009a. Litorina Sea sediments of ancient Vääna lagoon, northwestern Estonia. Estonian Journal of Earth Sciences, 58 (1), 85−93.

Uścinowicz, S., 2011. Geochemistry of the Baltic Sea surface sediments. Polish Geological Institute – National Research Institute, Warsaw.

Saarse, L., Niinemets, E., Amon, L., Heinsalu, A., Veski, S., Soha, K., 2009b. Development of the late glacial Baltic basin and the succession of vegetation cover as revealed at Palaeolake Haljala, northern Estonia. Estonian Journal of Earth Sciences, 58(4), 317−333.

Uścinowicz, S., Miotk-Szpiganowicz, G., Krapiec, M., Witak, M., Harff, J., Lübke, H., Tauber, F., 2011. Drowned forests in the Gulf of Gdańsk (southern Baltic) as an indicator of the Holocene shoreline changes. In: Harff, J., Björck, S., Hoth, P. (eds). The Baltic Sea Basin. Springer-Verlag, 221–234.

Schumann, J., 1859. Geologische Wanderungen durch Ostpreussen. Königsberg.

Vaikutienė, G., 2003. Changes of palaeogeographical conditions in the central part of the Baltic Sea during the Late Glacial and Holocene according to diatom data. Abstract of doctoral thesis, Institute of Geology and Geography, Vilnius, 23.

Schwab, G., Karabanov, A., Aizberg, R., Garbar, D., Kockel, F., Ludwig, A. O., Lukke-Andersen, H., Ostaficzuk, S., Palienko, V., Sim, L, Sliaupa. A., Sokolowski, I., Stackebrandt, W., 1997. The neogeodynamics of Central and Western regions of Europe. Geological Journal (Kiev, Ukraine), 3–4, 32–41.

Vassiljev, J., Saarse, J., 2013. Timing of the Baltic Ice Lake in the eastern Baltic. Bulletin of the Geological Society of Finland, 85, 9–18.

Sergeev, A., Sivkov, V., Zhamoida, V., Ryabchuk D., Bitinas A., Mažeika J., 2015. Holocene organic-rich sediments within the Curonian Spit coast, the southeastern Baltic Sea. Baltica, 28 (1), 41–50.

Vassiljev, J., Saarse, L., Grudzinska, I., Heinsalu, A., 2015. Relative sea level changes and development of the Hiiumaa Island, Estonia, during the Holocene. Geological Quarterly, 59, 517–530.

Stančikaitė, M., Kabailienė, M., 1998. Development of the Šventelė-typical hihgmoor in Nemunas Delta Region. In: Satkūnas, J., Kabailienė, M. (eds). Environmental perspectives of sensitive south-eastern Baltic coastal areas through the time, Excursion Guidebook of the NorFA Course, Vilnius, 30–35.

Veski, S., Heinsalu, A., Klassen, V., 2005. Early Holocene coastal settlements and palaeoenvironment on the shore of the Baltic Sea at Pärnu, southwestern Estonia. Quaternary International, 130, 75–85.

Stančikaitė, M., Šinkūnas, P., Šeirienė, V., Kisielienė, D., 2008. Patterns and chronology of the Lateglacial environmental development at Pamerkiai and Kašučiai, Lithuania. Quaternary Science Reviews, 27, 127–147.

Weber, C.A., 1902. Über die Vegetation und Enstehnung des Hochmoors von Augstumal im Memeldelta mit vergleichenden Ausblicken auf andere Hochmoore der Erde. Berlin. Wichdorff von Hess H., 1919. Die Geologie der Kurischen Nehrung und des Samlands. Preussische Geologische Landesanstalt NFH P 77.

Stančikaitė, M., Daugnora, L., Hjelle, K., & Hufthammer, A. K., 2009. The environment of the Neolithic archaeological sites in Šventoji, Western Lithuania. Quaternary International, 207(1-2), 117–129.

Yu, S.-Y., Andren, E., Barnelov, L., Berglund, B., Sandgren, P., 2003. Holocene palaeo-ecology and 58

Lateglacial–Middle Holocene Environmental Dynamics in the Coastal Area of the Baltic Sea... shoreline displacement on the Biskopsmala peninsula, south-eastern Sweden. Boreas, 32, 578–589. Žaromskis, R., 1999. Nemuno delta kaip geografinių tyrimų objektas. Geografija, 35 (2), 5–13. Žulkus, V., Girininkas, A., 2012. Baltijos jūros krantai prieš 10 000 metų (“Yoldia“). Klaipėda, Žulkus, V., Girininkas, A., Stančikaitė, M., Gryguc, G., Šeirienė, V., Mažeika, J., 2015. In shores of the Yoldia Sea and Ancylus Lake. Maritime landscapes in the Lithuanian waters: multidisciplinary study. In: Felscak, O. (ed). The Baltic Sea – a Mediterranean of North Europe. In the light of archaeological, historical and natural science research from ancient to Early Medieval Times. Gdansk, 9–18. Žulkus, V., Girininkas, A. 2020. The eastern shores of the Baltic Sea in the Early Holocene according to natural and cultural relict data. GEO: Geography and Environment, 7 (1), 1–16.

59

4 The Search for Holocene Rivers on the Lithuanian Coastland Nikita Dobrotin: Vilnius University, Faculty of Chemistry and Geosciences, Institute of Geosciences Abstract: The search for settlements of Final Palaeolithic-Mesolithic people on the seashore is directly related to the search for relics of the shores from the Early Holocene and the locations of rivers. Seismic surveys have allowed us to identify nine possible palaeo-valleys associated with the rivers Šventoji, Ražė, Danė, Smeltalė and Dreverna. The identified palaeo-incisions are compared to elevation cross-sections of the river valleys visible in the current relief. The results obtained could lead to a detailed survey to study the riverbeds of the palaeo-rivers in detail, allowing for underwater archaeological excavations. Keywords: Baltic Sea, Lithuania, Flooded landscapes, Palaeo-incisions, Marine seismic survey, Underwater research 4.1. Introduction

by locating past shorelines and river mouths (Hansson 2018, p. 40).

During the Holocene, in the Yoldia period of the Baltic Sea (12,800–11,500 cal BP), the Lithuanian landscape was covered by forest tundra. Palaeolithic settlements are known on the coast only on the former shores of the Baltic Ice Lake (BIL), near the River Danė (Bachmann Manor, now Klaipėda) and near the River Minija (Venckai). Palaeolithic settlements are mostly found in eastern Lithuania, including near the Nemunas and Neris rivers (Girininkas and Daugnora 2015, pp. 32–35, 41, 79–81; Rimkus 2020, p. 194).

Geophysical surveys to identify possible palaeo-riverbeds during the Yoldia–Early Littorina period were carried out as part of the ‘ReCoasts’ project. The aim was to link river sites with archaeological sites on the coast, and to identify traces of relict riverbeds on the now-flooded shores on the basis of data obtained during seabed investigations. Surviving fragments of the relict landscapes from the Yoldia–Littorina period and the localised palaeo-riverbeds would allow for a more reliable search for possible prehistoric settlements on the current seabed.

Early Mesolithic settlements in the area are found 50 to 80 kilometres from the recent coast of the Baltic Sea (Girininkas 2009). The available data might give the impression that the Mesolithic, Yoldia–Early Littorina period people did not yet live on seashores at that time, though the Neolithic Lithuanian coast was densely populated (Girininkas and Daugnora 2015, pp. 69, 166, Fig. 143, Fig. XXII 80). Due to the transgression of the sea, the shores of the Yoldia–Early Littorina period have now been flooded by the Baltic Sea. Coastal remains in Lithuanian waters have been found on the seabed, at a depth of 14.5 to 30 metres, dozens of kilometres west of the current seashore (Žulkus and Girininkas 2020).

4.2. Study area and methods A set of geophysical surveys was conducted to detect the palaeo-valleys of the rivers. Three sections of the Lithuanian coastline were selected for detailed investigation by marine seismic surveys and sub-bottom surveys. The survey lines were chosen according to previous studies of the Baltic Sea’s transgressions and regressions (Damušytė 2011; Bitinas and Damušytė 2017), new finds of tree trunks at the bottom of the sea (Žulkus and Girininkas 2020), and the network of existing rivers (the Šventoji, Ražė, Danė, Smeltė, Minija and Dreverna). The coordinates of survey lines performed (seismic lines and sub-bottom lines), and elevation cross-sections of river valleys visible in relief, are presented in Table 1. The study area is presented in Figure 1. The borehole Pervalka-18 on the Curonian Spit (21° 02’ 55.4962” E, 55° 23’ 53.0466” N) was used for general information about the geological strata.

This search for early Holocene river palaeo-valleys is closely related to the search for prehistoric archaeological sites on the Lithuanian coast. According to geological surveys of palaeo-riverbeds, several locations on land have been reliably identified (Damušytė 2011), but the locations of their furrows and estuaries on the seabed are often only speculated on (Bitinas and Damušytė 2004; Damušytė 2011; Bitinas and Damušytė 2017). Reconstructions of the landscape and river network can greatly aid predictive modelling for the discovery of further submerged sites

4.3. Sub-bottom survey At first a sub-bottom survey was performed along the Lithuanian coast using Innomar SES-2000 light 61

Nikita Dobrotin equipement. The survey depth was set to 20 metres (Fig. 4.1). Unfortunately, the study of the sub-bottom profiler did not yield the expected results. The Innomar SES-2000 light sends out a very weak signal that dissipates quickly. In some places, more pronounced reflections, up to two or three metres deep, are visible, most likely showing the thickness of the sludge.

velocity analysis, normal move-out (NMO) correction and common mid-point (CMP) stacking, deconvolution to remove reverberation, migration, F-X deconvolution and band pass filter. Strong multiple reflections caused by the shallow and hard sea bed were the main problem in this data set. All attempts to attenuate multiple reflections were unsuccessful, due to the small offset range for move-out discrimination methods, while predictive deconvolution gave bad results by removing primary reflections.

4.4. Marine seismic survey

4.5. Results

Seimic data were collected using a GeoEel streamer and a Sig Mille boomer. Acquisition geometry consisted of one source and one 50-metre-long streamer with 16 channels (3.33 m between receivers and a minimum offset of 26 m) – Fig. 4.1. Data processing was performed using GLOBE Claritas TM. The processing workflow consisted of geometry creation and assignment (the bin size is 5 m along the sailing direction), amplitude recovery (t1), stacking

The marine seismic survey yielded promising results. A number of seismic reflections resembling palaeo-incisions left by rivers was found in all three seismic cross-sections. Seismic cross-section III–III’ was collected in shallow waters (Fig. 4.1; Table 4.1); therefore, the seismic data have many multiples and are difficult to interpret. According

Figure 4.1. The area studied.

62

 The Search for Holocene Rivers on the Lithuanian Coastland Table 4.1. The coordinates of the seismic surveys, sub-bottom survey, and elevation cross-sections Seismic line

Start

End

Length (km)

Easting

Northing

Easting

Northing

I – I’

20° 59’ 13.9607” E

55° 30’ 53.1540” N

20° 59’ 14.2074” E

55° 35’ 14.6813” N

8.09

II – II’

20° 59’ 14.4650” E

55° 35’ 20.1033” N

21° 01’ 28.8321” E

55° 43’ 01.1289” N

14.45

III – III’

20° 57’ 33.2606” E

55° 56’ 34.1505” N

20° 57’ 31.8276” E

56° 01’ 45.4208” N

9.63

Start

End

Sub-bottom line

Easting

Northing

Easting

Northing

SB-1

20° 57’ 31.1910” E

55° 55’ 02.4144” N

20° 57’ 31.1427” E

56° 01’ 47.3669” N

12.52

SB-2

21° 03’ 35.3412” E

55° 37’ 55.9500” N

21° 02’ 35.2948” E

55° 43’ 31.9077” N

10.44

SB-3

20° 59’ 14.1126” E

55° 27’ 27.7345” N

20° 59’ 14.0929” E

55° 35’ 16.5978” N

14.50

Start

 

End

 

Easting

Northing

Easting

Northing

A

21° 18’ 19.2427” E

55° 33’ 01.4536” N

21° 19’ 44.8873” E

55° 30’ 27.2475” N

5

B

21° 11’ 24.0703” E

55° 39’ 43.5627” N

21° 12’ 03.6560” E

55° 39’ 00.5332” N

1.5

C

21° 08’ 47.1793” E

55° 43’ 16.5472” N

21° 09’ 44.7672” E

55° 42’ 40.5530” N

1.5

D

21° 04’ 11.5171” E

55° 55’ 09.5573” N

21° 03’ 58.8369” E

55° 54’ 38.0179” N

1

E

21° 06’ 28.5990” E

56° 02’ 25.3204” N

21° 06’ 31.1959” E

56° 01’ 36.8432” N

1.5

Lidar section

to the Pervalka-18 borehole, the quaternary geology consists mostly of sand, silty sand and sandy moraine, while the upper cretaceous part consists of sandstone, thus creating a strong seismic horizon visible in two seismic cross-sections (I-I’ and II-II’). The seismic line I–I’ with a borehole and geological interpretation is presented in Fig. 4.2. A few types of reflections were identified: a reflection created from water and the sea bottom boundary, a reflection created from the boundary between quaternary and cretaceous sediments (white bold line), and reflections created from possible palaeo-incisions (I-1, I-2 and I-3) are presented by a black bold dashed line. Incision I-1 is approximately 2,107 metres wide and 52 metres deep at its maximum: the incision has a deep valley with a shallow terrace on one side. Incision I-2 is only 771 metres wide and 29 metres deep. Incision I-3 is approximately 1,350 metres wide and more than 80 metres deep. All these palaeo-incisions are close to each other, and could be the result of changes in one riverbed.

Length (km)

Length (km)

Seismic cross-section III–III’ was the most challenging to interpret, due to the strong multiple reflections (Fig. 4.4). The boundary between quaternary and cretaceous sediments is obscured by strong multiples. Unfortunately, only half of palaeo-incision III-1 was recorded, so it is not possible to determine the depth and width of the valley, but a reflection reminiscent of a slope is clearly visible. Likewise, the bottom of palaeo-incision III-2 is also not visible, due to strong multiples. The incision width is 1,200 metres. Palaeo-incision III-3 is approximately 2,000 metres wide, and 50 metres deep; the palaeo-incision has a valley and a small terrace in the southern part. All the coordinates and widths of the identified palaeoincisions are presented in Table 4.2. 4.6. Possible reconstruction The analysis of the seismic data showed nine palaeoincisions in the coastal section with five active rivers (Šventoji, Rąžė, Danė, Smeltalė and Dreverna). The identified palaeo-incisions were linked to the nearest rivers, and as a result, a map of the reconstruction of possible palaeo-valleys was created (Fig. 4.5). In order to verify the data, the elevation cross-sections of river valleys visible in relief were examined (Fig. 4.6). Seismic line I–I’ has three palaeo-incisions (I-1, I-2 and I-3); all three incisions could be the result of changes in one riverbed

Seismic line II–II’ (Fig. 4.3) also has a strong visible boundary between quaternary and cretaceous sediments, and three distinct palaeo-incisions. Incision II-1 is very wide, 3,696 metres, and consists of three characteristic valleys; the deepest valley is 32 metres deep. Incisions II2 and II-3 are vey narrow and shallow, 801 metres wide and 27 metres deep (II-2), and approximately 471 metres and 26.7 metres deep (II-3). 63

Nikita Dobrotin

Figure 4.2. Seismic cross-section I–I’ with borehole: A) geological interpretation; B) seismic cross-section. Black bold dashed lines: reflections of palaeo-incisions. Bold white line: the boundary between quaternary and cretaceous sediments. Thin dashed white line: multiple bottom reflections, Q: quaternary sedimentary strata. K: cretaceous sandstone.

Figure 4.3. Seismic cross-section II–II’: A) geological interpretation; B) seismic cross-section. Black bold dashed lines: reflections of palaeo-incisions. Bold white line: the boundary between quaternary and cretaceous sediments. Thin dashed white line: multiples of bottom reflection.

64

 The Search for Holocene Rivers on the Lithuanian Coastland

Figure 4.4. Seismic cross-section III–III’: A) geological interpretation; B) seismic cross-section. Black bold dashed lines: reflections of palaeo-incisions. Thin dashed white line: multiples of bottom reflection.

Table 4.2. Coordinates of identified palaeo-incisions Seismic line

Start

End

Width (km)

Easting

Northing

Easting

Northing

I-1

20° 59’ 15.3264” E

55° 32’ 03.9029” N

20° 59’15.4025” E

55° 33’ 12.0467” N

2.107

I-2

20° 59’ 15.4416” E

55° 33’ 47.0764” N

20° 59’ 15.4695” E

55° 34’ 12.0304” N

0.771

I-3

20° 59’ 15.4862” E

55° 34’ 26.9048” N

20° 59’ 15.5350” E

55° 35’ 10.5756” N

1.35

II-1

20° 59’ 35.7770” E

55° 36’ 33.9534” N

21° 00’ 10.1197” E

55° 38’ 31.8841” N

3.696

II-2

21° 00’ 39.2821” E

55° 40’ 12.1769” N

21° 00’ 46.7338” E

55° 40’ 37.7025” N

0.801

II-3

21° 01’ 09.1107” E

55° 41’ 53.9899” N

21° 01’ 13.5035” E

55° 42’ 09.0161” N

0.471

III-1

20° 57’ 33.2606” E

55° 56’ 34.1505” N

20° 57’ 33.1760” E

55° 56’ 52.5212” N

–

III-2

20° 57’ 32.9137” E

55° 58’ 18.3423” N

20° 57’ 32.7351” E

55° 58’ 57.1418” N

1.2

III-3

20° 57’ 31.7259” E

56° 00’ 38.8157” N

20° 57’ 31.4283” E

56° 01’ 43.4811” N

2

of the River Dreverna. The elevation cross-section of the valley of the Dreverna presented in Fig. 4.6, A shows that the Dreverna had a wide valley, approximately 3,000 to 3,500 metres wide, and there are also a few riverbeds visible in the valley, so it is possible that the Dreverna could have eroded three incisions.

Closest to palaeo-incision II-1 is the River Smeltalė. Palaeo-incision II-1 is wide, and consists of three narrower incisions, possibly caused by a fluctuating watercourse. The Smeltalė river valley also consists of a few narrow valleys (Fig. 4.6, B). Palaeo-incisions II-2 and II-3 are narrow and shallow, and also relatively close to each other. 65

Nikita Dobrotin

Figure 4.5. A map of a possible reconstruction of palaeo-valleys.

These palaeo-incisions were probably eroded by the changing watercourse of the River Danė. The present valley of the River Danė (Fig. 4.5, C) is proportionate to palaeo-incisions II-2 and II-3. The Danė river valley reconstruction should possibly include the shallow trenches found in the sub-bottom survey.

valley (Fig. 4.6, E); both consist of a valley and a terrace. 4.7. Conclusions The search for places of habitation and activity of Final Palaeolithic-Mesolithic people on relict shores of the Lithuanian coast is directly related to the relics of the shores and the landscapes of the Early Holocene, which, due to many transgressions and regressions, are now under water. The shores have changed, as sea levels have changed, and people settled on shores that are now flooded.

Seismic cross-section III–III’ covers the northernmost part of the survey area, which includes two rivers (the Rąžė and the Šventoji). The elevation cross-section D represents the River Ražė: the valley is narrow, and consists of two trenches and a shallow terrace. Incisions III-1 and III-2 are nearest to the River Danė. Finally, incision III-3 was linked to the River Šventoji. The incision is wider and deeper than the current Šventoji

According to the data from the underwater research, the fluctuations in the Yoldia–Littorina period, and the sea

66

 The Search for Holocene Rivers on the Lithuanian Coastland

Figure 4.6. Elevation cross-sections of river valleys visible in relief.

level and the locations of the shores in Lithuanian waters, have been specified. In order to elucidate the possible locations of flooded prehistoric settlements, investigations of palaeo-riverbeds were carried out. Seismic reflections associated with the palaeo-valleys of the Šventoji, Ražė, Danė, Smeltalė and Dreverna have been recorded as a result of seismic surveys.

RF-III-C (about 9,500–8,800 cal BP), can be associated with the presumed relict estuary of the Danė. Palaeoincisions II-2 and II-3, detected during seismic surveys, are associated with the changing watercourse of the River Danė. The Dreverna changed course during the Yoldia–Ancylus period. Seismic surveys have identified three sites of former furrows (palaeo-incisions I-1, I-2, I-3) south of the RF-I site, where fragments of a palaeo-landscape with former pine forests, swampy lakes and lagoons have survived.

During the Ancylus regression, when the water level fell from about 18 metres to about 40 metres below the current sea level, in the period of about 9,200–8,500 cal BP, rivers flowing into the sea were able to change their course, depending on the relief of the newly exposed coasts. Two sites at a depth of 10 to 12 metres, with surviving fragments of the relict landscapes RF-III-B and

Knowing that Stone Age settlements developed near rivers, this research has helped narrow down the scope of

67

Nikita Dobrotin future research. The discovery of river palaeo-valleys has opened up opportunities for further detailed study. Acknowledgements I would like to thank Dr Milda Grendaitė for processing the seismic data. References Bitinas A., Damušytė A., 2004. The Littorina Sea at the Lithuanian Maritime Region. In: Polish Geological Institute Special Papers, 11(2004), 37–46. Bitinas A., Damušytė A., 2017. Pietyčių Baltijos regiono hidrografinio tinklo raida poledynmečiu. In: Jūros ir krantų tyrimai 2017. 10-oji nacionalinė jūros mokslų ir technologijų konferencija. Konferencijos medžiaga. Klaipėda, 37. Damušytė A., 2011. Post-glacial geological history of the Lithuanian coastal area. Summary of doctoral dissertation. Physical sciences, geology (05P). Vilnius University. Girininkas A., 2009. Akmens amžius. Lietuvos archeologija I. Klaipėda. Girininkas A., Daugnora L., 2015. Ūkis ir visuomenė Lietuvos priešistorėje. T. I. Hansson, A., 2018. Submerged landscapes in the Hanö Bay. Early Holocene shoreline displacement and human environments in the southern Baltic Basin. Lund: Lund University. Rimkus, T., 2020. Pirmieji gyventojai prie Baltijos ledyninio ežero ir Joldijos jūros krantų: Aukštumalos akmens amžiaus gyvenvietės ir jų vieta Lietuvos kranto zonos pirminio apgyvendinimo kontekste. In: Jūros ir krantų tyrimai 2020. 13-oji nacionalinė jūros mokslų ir technologijų konferencija. Konferencijos medžiaga. Klaipėda, 192–195. Žulkus, V., Girininkas A., 2020. The eastern shores of the Baltic Sea in the Early Holocene according to natural and cultural relict data. Geo: Geography and Environment. 2020;e00087. https://doi.org/10.1002/ geo2.87

68

5 The Final Palaeolithic and Mesolithic in the Coastal Part of Lithuania: Societies, Technologies and Resource Management Tomas Rimkus: Institute of Baltic Region History and Archaeology, Klaipėda University. Abstract: This paper discusses the first summarised data on the Final Palaeolithic and Mesolithic in coastal Lithuania, based on the research conducted during the 2017–2021 research project ‘Man and the Baltic Sea in the Meso-Neolithic: Relict Coasts and Settlements below and above Present Sea Level. ReCoasts&People’. The earliest evidence of prehistoric societies comes from the Final Palaeolithic Swiderian culture sites in the Aukštumala upland bog, and one single find from the village of Pūzraviečiai. Lithics and their chronology are studied based on technological studies, emphasising their similarities and differences. Mesolithic lithic technology is scarce at the moment; however, the latest data on osseous finds from the Lithuanian coast have revealed more Late Mesolithic finds and their technological similarities with the adjacent areas in the Baltic region. Resources for the manufacture of lithic implements were an important economic aspect of Final Palaeolithic societies at Aukštumala, whereas Mesolithic data display hunted animal species and the importance of large ungulates for the production of osseous tools. Keywords: Final Palaeolithic, Mesolithic, Lithic and osseous technologies, Mobile art, AMS 14C dating, Coastal Lithuania 5.1. Introduction

scarce. This situation is determined by several factors, which are mainly related to the shifts in the Baltic Sea water level, and to the dynamics of coastal rivers and lakes. At the end of the Late Pleistocene and the beginning of the Early Holocene, the eastern shores of the Baltic Sea were much lower or above the present sea level. This is related to separate stages of variations in the level of the Baltic Sea in the Late Pleistocene and Early Holocene,2 during which the sea basin became an open saline or closed freshwater basin (Rosentau et al. 2017). The fluctuations in the level of the Baltic Sea and changes to its shoreline were most frequent before approximately the 5th millennium cal BC, when, during the Littorina Sea stage, the coastline settled in Lithuanian territory and it became most similar to the present day. In the Final Palaeolithic and Mesolithic, changes to the coastal areas affected people’s choice of places to settle, and features of their subsistence strategies. Therefore, human settlements during the Yoldia Sea, Ancylus Lake and the early stages of the Littorina Sea periods must have been flooded by the rising water level, and their study is now possible only by underwater investigations. Despite the fact that underwater investigations in the eastern Baltic waters have been performed during the past two decades, and coasts from separate Baltic Sea stages and the remains of tree trunks dated to the Early Holocene have been found

The human subsistence economy in the Late Pleistocene and Early Holocene in Lithuania is best studied based on the excavated settlements in the inland part of the country. Their abundance has provided knowledge about various tool technologies made of flint and other metamorphic rocks, the use of animal bones and antlers, tool types, subsistence strategies, burial traditions and taxonomic variability, which has been discussed in many synthetic works and theses (e.g. Rimantienė 1971; 1996; Girininkas 2009; Girininkas and Daugnora 2015; Butrimas 2016; Šatavičius 2016; Gudaitienė 2018; Slah 2018; Rimkus 2019b). However, a different research situation can be observed in the coastal part of Lithuania. There is a lack of research into Final Palaeolithic and Mesolithic archaeological material, which does not allow for wider conclusions regarding human behavior in the Late Pleistocene and Early Holocene environmental setting. In the second half of the 20th century and in the 21st century, the main focus was on research into the economy of Neolithic and Bronze Age societies, continuing archaeological excavations in known and newly discovered settlements in coastal Lithuania, and using modern research methods in the analysis of archaeological finds (e.g. Rimantienė 2005; Piličiauskas 2016; Minkevičius et  al. 2020; Osipowicz et  al. 2020; Piličiauskas et  al. 2021). The Final Palaeolithic and Mesolithic1 data from the Lithuanian coastal area are

dated to the Younger Dryas and the beginning of the Preboreal. The Mesolithic chronology in this paper is based on the classic periodisation, with its beginning at the end of the Preboreal, and lasting until the end of the 6th millennium cal BC with the introduction of pottery. 2  For further details regarding this subject, see the chapter 3 of this book.

In this paper, the Final Palaeolithic is considered to be the period characteristic for tanged point complexes (Ahrensburgian and Swiderian) 1 

69

Tomas Rimkus (Žulkus and Girininkas 2020), submerged settlements left by past human societies have not yet been located.

Archaeological field investigations and laboratory studies of previous archaeological material were conducted between 2017 and 2021 while carrying out the research project ‘Man and the Baltic Sea in the Meso-Neolithic: Relict Coasts and Settlements below and above Present Sea Level. ReCoasts&People’ in order to provide assembled data on the Final Palaeolithic and Mesolithic communities in the present Lithuanian coastal area. The main aims were to study flint and other metamorphic rocks, and osseous technologies used for hunting and domestic activities, and also investigate the availability and use of various resources in the Lithuanian coastal area during the Final Palaeolithic and Mesolithic. This research was performed using classic research methods, such as typology, microscopic analysis, and AMS 14C dating methods. Data were collected from 13 sites, where the finds belonged to the Final Palaeolithic and the later part of the Mesolithic (Fig. 5.1). It is important to note that the research into the Final Palaeolithic and Mesolithic archaeological material was based on existing data for the present Lithuanian coast. During separate stages of the Early Holocene, the coast was much further to the west, but there are currently no confirmed data about submerged Mesolithic settlements in Lithuanian waters.

Other factors are related to the dynamics of coastal rivers and lakes, and their estuaries in the Lithuanian coastal area. Geological research shows that the formation of the biggest river estuaries in this region (the Danė, Minija and Nemunas) was quite complicated and unique, compared to the continental part of the country, due to the changes in the Baltic Sea water level (e.g. Gelumbauskaitė 2010; Damušytė 2011). Coastal lakes, as research into submerged prehistoric landscapes suggest (Žulkus et  al. 2015), existed during the different Baltic Sea stages, but they were flooded by the rising water level. The landscape was also altered significantly by another factor – intense human economic activity during historical times and the development of urbanization. As a consequence, the first Final Palaeolithic and Mesolithic archaeological finds were detected during construction rather than in the course of archaeological fieldwork, as will be discussed further in this article. These factors, and the relatively small number of archaeological research fieldwork cases, mean that only a small number of sites or single finds from these periods are currently known.

Figure 5.1. Western Lithuania and the Final Palaeolithic and Mesolithic coastal sites discussed in this paper: 1. Aukštumala 1–3; 2. Šilmeižiai; 3. Naujapieviai; 4. Pūzraviečiai; 5. Venckai; 6. Kvietiniai; 7. Smeltalė; 8. Kalniškiai (the former Bachmann manor); 9. Melnragė II; 10. Šventoji 40; 11. Būtingė 1. (Esri, HERE, Garmin, © OpenStreetMap contributors, and the GIS user community © UAB HNIT-BALTIC)

70

The Final Palaeolithic and Mesolithic in the Coastal Part of Lithuania 5.2. Research background

so-called hillfort was referred several times in 20th century works by Lithuanian and German researchers (Crome 1938; Tarasenka 1928; Tautavičius 1975, p. 33), and even in the latest atlas of Lithuanian hillforts (Baubonis et al. 2017, pp. 16–17). Peat extraction intensified in the eastern part of the Aukštumala Highmoor in the middle of the 20th century, the sandy hill was excavated, and its soil was used for road construction. The fluvioglacial hill was not completely destroyed, and during field surveys carried out in the surroundings of the supposed hillfort at the end of the 20th century, separate flint finds on the surface were discovered. The first detailed archaeological investigations in the vicinity of the fluvioglacial hill were conducted in 2004 in order to find out if there were any possible archaeological remains on the entire sandy hill related to the supposed hillfort. After the excavations, two locations with flint finds were located, and they were named the Aukštumala I and II settlements (Dakanis 2006). Based on the archaeological material, the finds from both sites were attributed to the Final Palaeolithic and Mesolithic. In 2013, the lithic finds were investigated again, and their technological and cultural aspects were evaluated, which confirmed the earlier chronology, but this time they were ascribed to the Ahrensburg and Nemunas cultures (Grigaliūnas 2013; Slah 2013). However, many technical aspects of this archaeological material were not assessed, and the established chronology and taxonomy raised questions. Therefore, in 2018 and 2019, new archaeological field investigations were carried out at the Aukštumala sites, during which one more site, named number 3, was detected (Fig. 5.2). The research results from the archaeological material found at these sites are provided in the following chapters of this paper.

As already mentioned, the extensively studied sites in the Lithuanian coastal area are located in the northern part of the coast, and dated to the Neolithic (multiple sites at Šventoji), and on the Curonian Spit (the sites of Nida and Alksnynė). In the second half of the 19th and the beginning of the 20th centuries, the southern coastal part (from Nemirseta to the Nemunas River delta and the Curonian Spit) were investigated by German archaeologists, who provided the first data about Neolithic settlements in the area (Rimantienė 1999, pp. 11–15). We can also find the first information related to the finds ascribed to the Final Palaeolithic and Mesolithic described by them (Groß 1940). After assembling the data, it was determined that 13 sites could be distinguished where the archaeological material is entirely or partly related to the Final Palaeolithic and the Mesolithic. Some of these sites have long research histories; therefore, only a brief research history is provided further as this has already been discussed elsewhere (e.g. Rimantienė 2005; Piličiauskas et  al. 2015; Rimkus and Girininkas 2021). Currently, only two places in the Lithuanian coastal area provide data on the Final Palaeolithic: the Aukštumala Highmoor and the village of Pūzraviečiai. The Aukštumala Highmoor was first investigated by the German scientist C. A. Weber in the second half of the 19th century, who described its natural development and plant species (Weber 1902). The eastern part of the Aukštumala Highmoor started being transformed into peat extraction fields at the end of the 19th century. During the 20th century, peat extraction there was stepped up, and the entire eastern part is currently devoted to commercial peat extraction. However, the western part has been designated for preserving its unique and natural bog flora and fauna. We can learn about the archaeological research at Aukštumala from the famous eastern Prussian archaeologists A. Bezzenberger (Tamulynas 1998), who in 1891 excavated a sandy hill in the eastern part of the bog, where, according to the locals, a hillfort was situated. Bezzenberger carried out excavations on the sandy hill with the assistance of a local amateur archaeologist, but according to him only wood charcoal and boulders were found, and no archaeological finds were unearthed (Bezzenberger 1892). The site was also explored at the end of the 19th century by the aforementioned C. A. Weber, who tried to determine the origin of the sandy hill. He investigated a 1.4-metre-deep test-pit at the center of the hill, and concluded that it was a fluvioglacial hill formed by the last glacial. Its upper layers were covered with peat which had formed during the development of the highmoor (Weber 1902). He also pointed out that the hill was six metres above the level of the Curonian Lagoon, and did not mention any data about archaeological finds during his work.3 Despite this, the

Besides finds from the Final Palaeolithic at Aukštumala, there is one more find in the recently discovered findspot in the village of Pūzraviečiai, located 20 kilometres northwest of the Aukštumala sites. It is located close to the left bank of the River Ašva. In 2021, a single tanged point from this location that was found by the landowner was sent to the Department of Cultural Heritage. Unfortunately, no other finds related to the Final Palaeolithic have been found there. Lithic finds typical to the Mesolithic are scarce in the Lithuanian coastal area. Most of them are single finds, and are difficult to ascribe to a particular Stone Age chronology. Therefore, only the finds that have shape, technology or AMS 14C dating context which would suggest they belong to the Mesolithic will be discussed further in this article. It is important to mention that the flint hunting tool technologies that dominated at the end of the Mesolithic remained similar in the Early Neolithic (Rimkus 2019b); therefore, in many cases, it is difficult to evaluate the possible chronology of a find based only on its typological features.

C. A. Weber was familiar with Stone Age archaeology, as he cooperated with German archaeologist J. Mestorf and conducted palaeobotanical 3 

studies from Neolithic sites in Kiel fjord (Weber and Mestorf 1904).

71

Tomas Rimkus

Figure 5.2. The location of the Final Palaeolithic sites in the Aukštumala Highmoor. (Esri, HERE, Garmin, © OpenStreetMap contributors, and the GIS user community © UAB HNIT-BALTIC)

Two sites on the northern part of the Lithuanian coast are associated with the Late Mesolithic: Būtingė 1 and Šventoji 40. The Būtingė 1 site, located on the right bank of the River Šventoji, contain flint finds, including some typical to the Mesolithic: fragments of lanceolates, a trapeze, and regular blades found in a ploughed field (Rimantienė 2005, p. 484). The trapeze point allowed the site to be attributed to the Late Mesolithic, because this technology in particular is related to the end of this period (Žulkus and Girininkas 2012, pp. 40–41), although such finds can also be attributed to the Neolithic. There were flint tools, ground stone axes and amber ornaments among the finds that should be attributed to the later periods of the Neolithic (Rimantienė 2005, pp. 482–486).

regular blades, specific to the Mesolithic, were discovered (Rimantienė 2005, pp. 479–482). The field investigation was renewed in 2013 and 2016. Besides finds specific to the Neolithic, microlithic implements and regular blades were found, and also a feature considered to be a former building was investigated. Within the feature, pieces of charcoal and charred hazelnut shells were dated by AMS 14 C. The feature was dated to ca. 6,000 cal BC, and is ascribed to the Late Mesolithic (Piličiauskas 2018, pp. 106–108). There have been more lithic finds ascribed to the Mesolithic in the Lithuanian coastal area. The Kvietiniai site is situated on the right bank of the River Minija, and was investigated in 2014, 2015 and 2017. Cremation burials from the Early Metal Age were also found (Vengalis et al. 2020). There were finds specific to the Late Neolithic and the Bronze Age, but in one area flint finds characteristic of the Mesolithic were located. These were microlithic implements, regular blades and cores (Vengalis et  al. 2020, Fig. 12). Cores and two regular blades characteristic of the Mesolithic were also discovered at the village of

The Šventoji 40 site is located west of the Būtingė 1 site, on the left bank of the River Šventoji. Stone Age finds and even finds from historical times were found on the surface of a ploughed field. Therefore, in 1967, one excavation trench was investigated there. Neolithic ground stone axes and ceramics with impressed cord decoration were found, and among them the flint tools, lanceolates and 72

The Final Palaeolithic and Mesolithic in the Coastal Part of Lithuania Naujapieviai in the southernmost coastal area of Lithuania. At this location, close to the Nemunas River delta, a subconical core and two blades were found in 2020 on a small, barely noticeable terrace standing between floodplains. They were found by local people, and were handed in to the Department of the Cultural Heritage. But no other finds were discovered there. The find spot was in areas affected by the spring floods, and the lithics themselves are not covered by a patina typical to wetlands or dry land. Therefore, due to the lack of data regarding the actual find place, and the find circumstances, these finds will not be included in the general analysis devoted to the Mesolithic, and the find location is provided only in Figure 5.1 and Table 5.1.

lithics. An identical situation is observed at Šilmeižiai. It is located on a sandy terrace on the right bank of the River Topalis, close to its confluence to the Šyša River. In 2002, flint flakes and blades were found in a former sand quarry, which were attributed to the Late Mesolithic (Žulkus and Girininkas 2012, p. 40). However, the finds are not diagnostic and require wider research, same as the case at Venckai village. Unfortunately, the site has been significantly damaged by the quarry, and the cultural layer there may already be destroyed. Although most osseous implements from the Lithuanian coastal area are from the Neolithic, there are examples characteristic to the Mesolithic, dated using AMS 14C. Two sites with radiocarbon dated bone and antler tools are currently known, whereas another site lacks dating. The most abundant collection of osseous tools was found at the Smeltalė site, in the southern part of Klaipėda, next to the Curonian Lagoon. This part of Klaipėda port was widened between 1970 and 1973, and the adjacent wetland was excavated. During the works, 13 bone and antler finds and eight amber ornaments were found and transferred to the Klaipėda museum. Only in 2015 was the first AMS 14 C dating performed on them, which showed that two artefacts are from the 6th millennium cal BC, and another

The last two sites yielding lithic finds are the villages of Venckai and Šilmeižiai. Only a few finds were detected in each location, which are tentatively attributed to the Mesolithic, judging only by very slight external features. At Venckai, located on the eastern sandy terrace of the Svencelė wetland, two flint flakes and one blade were found in a ploughed field (Rimkus and Girininkas 2020b, p. 404). Both were covered in a light bluish patina. However, more detailed research at the site is necessary before we can speak in detail about the chronology of these

Table 5.1. Stone Age sites located in the coastal part of Lithuania and ascribed to the Late Glacial and Early Holocene Site

Coordinates

Chronology

Material

Aukštumala 1

55°38’93’N 21°41’49’E

Final Palaeolithic

Lithics

Contains diagnostic finds

Grigaliūnas 2013

Aukštumala 2

55°39’24’N 21°41’61’E

Final Palaeolithic

Lithics

Contains diagnostic finds

Grigaliūnas 2013

Aukštumala 3

55°39’07’N 21°41’56’E

Final Palaeolithic

Lithics

Contains diagnostic finds

Rimkus and Girininkas 2021

Būtingė 1

56°03’60’N 21°11’49’E

Late Mesolithic (?)

Lithics

Stray finds

Rimantienė 2005

Kalniškiai (Bachmann manor)

55°72’31’N 21°16’77’E

Mesolithic (?)

Osseous finds

Stray finds; no AMS data

Groß 1939

Kvietiniai

55°73’61’N 21°42’50’E

Late Mesolithic

Lithics

Contains diagnostic finds

Vengalis et al. 2020

Melnragė II

55°74’79’N 21°08’39’E

Late Mesolithic

Osseous find

Stray find; reliable AMS data

Rimkus 2019a

Naujapieviai

55°20’22’N 21°71’86’E

Mesolithic

Lithics

Stray finds

This study

Pūzraviečiai

55°47’68’N 21°68’07’E

Final Palaeolithic

Lithic

Stray find

Rimkus and Girininkas 2021

Smeltalė

55°64’91’N 21°17’73’E

Late Mesolithic/ Early–Late Neolithic

Osseous finds

Reliable AMS data

Rimkus and Daugnora 2021

Šilmeižiai

55°35’53’N 21°56’35’E

Mesolithic (?)

Lithics

Stray finds; lacks diagnostic finds

Girininkas and Zabiela 2005

Šventoji 40

56°03’31’N 21°10’73’E

Late Mesolithic

Lithics

Two AMS dates point to the Late Mesolithic

Piličiauskas 2016

Venckai

55°50’72’N 21°31’73’E

Mesolithic (?)

Lithics

Stray finds; lacks diagnostic finds

Rimkus and Girininkas 2020b

73

Notes

Reference

Tomas Rimkus 5.3. Material

is from modern times (Piličiauskas et al. 2015, Table 2). Later, more artefacts from this collection were dated, which shows that the archaeological material belongs to the 6th, 5th and 3rd millennia cal BC (Rimkus and Daugnora 2021). It is believed that the site was completely destroyed by development work at the port, and therefore there are no possibilities to perform any additional field investigations to collect more information about the former Stone Age sites at Smeltalė.

For this paper, lithic and osseous implements dated to the Final Palaeolithic and Mesolithic from different sites were selected for the analysis. Only material from Aukštumala 1–3 sites, the villages of Pūzraviečiai and Venckai, the Smeltalė site and Melnragė II beach will be discussed, as these places were the main focus of the ReCoast&People research project, while other sites mentioned previously will be used for comparison.

One more dated osseous artefact was found in 2015, washed up north of Klaipėda on Melnragė II beach. It is a T-shaped antler axe. Its AMS 14C date places it at the end of the 6th millennium cal BC, and it is one of the earliest tools of this particular type in the eastern Baltic region (Rimkus 2019a, pp. 8–9). It is important to mention that the remains of relict pine trees at the bottom of the sea near the Melnragė II beach (RF-II site) have also been dated to the Late Mesolithic (Žulkus and Girininkas 2020, Table 1).

Final Palaeolithic lithic technology is described based on the excavated materials from the Aukštumala 1–3 sites and one single find from the village of Pūzraviečiai. Only these two locations currently shed light on Final Palaeolithic technology in the coastal part of Lithuania. However, no osseous finds dating to the period in question are known from the area. On the other hand, Mesolithic lithic technology in the Lithuanian coastal zone will be discussed based on a series of stray finds from the village of Venckai, and on microliths from the Šventoji 40 and Būtingė sites, whereas the osseous industry will be studied with materials from the Smeltalė site and Melnragė II beach. Archaeological material of osseous tools found at the Palanga Stone Age site has been attributed in previous studies to the Mesolithic, Neolithic, and even the Bronze Age (Kulikauskas 1959; Girininkas 2011); therefore, it is not included in this paper. After the recent dating of osseous finds from Palanga Stone Age site (Piličiauskas et al. 2015, Table 2; Rimkus and Daugnora 2021), it was concluded that they all belong to the period between 4400–3800 cal BC, which marks the end of the Early Neolithic; therefore, this material does not fit the chronological frame of this chapter.4

The last data on osseous finds from the Lithuanian coastal region related to the Mesolithic are from the 19th century. Five osseous points were found during marl extraction at Kalniškiai, formerly known as the Bachmann manor, close to Klaipėda, in 1865, and were sent to the museum of prehistory in Berlin. Although the exact location is not known, the find place must have been close to the left bank of the River Danė. It was thought that the finds were made from reindeer (Rangifer tarandus) antlers and bones, and therefore they must be dated to the Final Palaeolithic (Groß 1939). These hypotheses were later maintained in the eastern Baltic Stone Age material culture studies, which also considered them to be osseous implements made from reindeer skeletal remains, and attributed them to the Final Palaeolithic Swiderian culture (Rimantienė 1971, p. 35; Daugnora and Girininkas 2005, p. 120; Girininkas and Daugnora 2015, p. 35). However, a recent reinvestigation of their find circumstances and their shapes makes us reconsider the assumption that these tools were made from reindeer skeletal parts, and their chronology is also questioned, as a similar type of tool is known from the Middle Mesolithic (Neumayer 2009, p. 27; Šatavičius 2016, p. 23; Rimkus 2018, pp. 154–155).

5.4. Methods Archaeological excavations Archaeological excavations were carried out at the Stone Age sites at Aukštumala Highmoor. An area of 84 m2 was excavated on the fluvioglacial hill during 2018 and 2019 (Rimkus and Girininkas 2019; 2020a). Excavation trenches of 40 and 10 m2 were dug at the previously mentioned sites 1 and 2 respectively. The rest of the test pits were concentrated in an area where it seemed the most opportune location to discover new sites. This gave results, and a new site (site 3) was identified between sites 1 and 2. All the sites are located on the edges of the sandy hill, only a few metres away from the peat extraction fields. During the excavations, soil samples for archaeobotanical and phosphate studies were taken from all three sites, from the peat areas and layers, and sandy layers where lithic finds were found.5 No features were discovered during

All the currently available data on the Final Palaeolithic and Mesolithic in the coastal part of Lithuania is summarised in Table 5.1. However, there have been many more attempts in the past to locate new Stone Age sites in the coastal part of Lithuania. The banks of major coastal rivers and wetlands were selected for investigation, in addition to rescue excavations. However, no diagnostic finds were found during the research which would point to the Final Palaeolithic or Mesolithic (Šatavičius et al. 2008; Peseckas 2018; Piličiauskas and Peseckas 2018; Rimkus and Girininkas 2020b). Some lithic finds were also found during later period excavations, for example at the Užpelkiai Iron Age burial site (Bliujienė and Bračiulienė 2018). However, the find complex also lacks diagnostic tools to attribute the lithic concentrations to a particular chronology.

For further studies on bone and antler material from the Palanga Stone Age site, see the Chapter 6 of this book. 5  The results of archaeobotanical and soil phosphate studies are presented in Chapter 6 of this book . 4 

74

The Final Palaeolithic and Mesolithic in the Coastal Part of Lithuania the excavations. All three sites are sandy-type open-air Stone Age sites. These types of prehistoric settlement often contain several occupation episodes which could each be further studied if separate features are revealed (e.g. Sobkowiak-Tabaka and Diachenko 2021). Although no features were discovered, as will be discussed in the following chapters, no technological admixture in lithic technology was noticed at any of the three sites; therefore, we argue that the Aukštumala sites offer only Final Palaeolithic occupation.

Their analysis is also included in this study, as it shows the selection and local availability of lithic raw material that was used by Final Palaeolithic societies. Finds of non-flint rocks at the Aukštumala sites consisted of knapping waste, blades and various tools that were found only during the 2018–2019 fieldwork. No such tools or knapping waste were documented during the 2004 excavations. For this paper, osseous implements from the Smeltalė site and the Melnragė II findspot are selected and described. Their technological attributes, bone and antler taxa were characterised in a previous study by Piličiauskas et  al. (2015); therefore, this paper will focus on their dating, and evidence of decoration on their surface.

Besides the excavations at the Aukštumala Stone Age sites, field surveys were conducted in 2018 and 2019 along the main coastal rivers (Minija, Šventoji, Šyša and Tenžė) and wetlands (the Nemunas River delta), in order to gather data about possible locations of new Stone Age sites (Rimkus and Girininkas 2020b). Unfortunately, no diagnostic finds were obtained that would resemble Final Palaeolithic or Mesolithic technologies.

AMS 14C dating AMS (Accelerated Mass Spectrometry) 14C dating was applied to organic samples found at the Aukštumala 1 and 3 sites, and to the osseous tools found at the Smeltalė site and Melnragė II beach. The Aukštumala Stone Age sites are sandy-type open-air sites, located on the edge of a fluvioglacial hill. There is always a possibility of obtaining mixed materials at such sites. Besides lithic finds, three charred hazelnut shells and one piece of wood charcoal was found at sites 1 and 3 and dated by AMS. Five osseous implements from the Smeltalė site and one tool from Melnragė II beach were also dated. Samples were taken from damaged parts, or inner antler parts where spongy tissue was exposed. All the organic samples were dated at the Leibniz Laboratory for Radiometric Dating and Stable Isotope Research at Kiel University. The dates were calibrated by OxCal v4.4 (Bronk Ramsey 2017) and the IntCal20 atmospheric curve (Reimer et al. 2020).

Lithic and osseous implement studies In this paper, lithic finds are discussed by using classic typology and technical features. A total of 311 lithic finds were found at the Aukštumala 1–3 sites in 2018 and 2019, whereas in 2004, 45 worked lithics were obtained. The material from the 2004 excavations has been discussed by Grigaliūnas (2013); however, some of the published technological remarks, taxonomy and chronology in particular lacked conclusions. Nonetheless, the lithic material from the 2004 excavations is important for this study, as it contains typologically discerned implements, such as fragments of arrowheads, dihedral burins and scrapers; therefore, it is included in this paper.

5.5. Results

One of the most important technological features is the manufacture technique of arrowheads, cores and blades. Unfortunately, only one completely exhausted bidirectional platform core was found at the Aukštumala 1 site; therefore, there is not much data about techniques of core preparation and exploitation at the site. There is different data regarding blades, however. Over 50 blades were discovered during the 2018–2019 and 2004 excavations at all three sites. Most are poorly preserved, fractured or burnt. Therefore, only completely or partly preserved blades that contain morphological features such as bulbs, curvature, platforms and scars are analysed in this paper. In addition, blade size attributes are given in a table that supplements the technological tendencies of blade production. Recent studies have shown that a technological analysis of blades could contribute a significant part of the data regarding the Final Palaeolithic lithic technologies (e.g. Berg-Hansen et al. 2019; Grużdź 2018; Winkler 2019).

Final Palaeolithic The Aukštumala Stone Age sites contained a stratigraphy that is characteristic to sandy-type open-air Stone Age settlements. A very similar stratigraphy was observed at all three sites. The upper parts of the stratigraphy consisted of various kinds of peat specific to the natural development of the highmoor (Weber 1902). Layers of eight to ten-centimetre-thick greyish sand, and 18 to 25-centimetre-thick yellowish sand that contained all the lithic and organic finds (charred hazelnut shells and wood charcoal) followed. Plough marks were uncovered in all the excavation trenches and test pits, probably revealing intense modern human activity related to the development of the peat extraction fields. This factor must have caused the archaeological finds to be moved from their initial positions. As a consequence, organic residues from a much later period may have occurred in the layers.

High-quality flint raw material is absent in the Nemunas River delta region. Therefore, a considerable part of the lithic inventory in the archaeological excavations at the Aukštumala 1–3 sites consisted of various worked metamorphic rocks, such as granite, sandstone, quartz, etc.

The majority of the flint finds at the Aukštumala 1–3 sites were affected by heavy patination and heat. Most of the flints were discovered at site 1, followed by sites 2 and 3 (Fig. 5.3). Flakes constituted most of the find inventory, 75

Tomas Rimkus

Figure 5.3. The total number of flint finds discovered at the Final Palaeolithic Aukštumala 1–3 sites, including data from the 2004 and 2018–2019 excavations (compiled by T. Rimkus).

whereas blades and tools were less numerous. The tools consisted of scrapers, arrowheads, backed pieces, burins, perforators, a core axe and one bidirectional platform core (Fig. 5.4). The tools were made from light grey Baltic

erratic flint, of which there are outcrops in the middle and upper reaches of the Nemunas in Lithuania (Baltrūnas et al. 2006; 2007). However, sporadic concentrations and individual flint rocks of various sizes are found in the

Figure 5.4. The total number of flint implements discovered at the Final Palaeolithic Aukštumala 1–3 sites, including data from the 2004 and 2018–2019 excavations (compiled by T. Rimkus).

76

The Final Palaeolithic and Mesolithic in the Coastal Part of Lithuania western Lithuanian morainic landscape (Baltrūnas et  al. 2004), and in the lower Nemunas region, where, according to the discoverer of the Swiderian tanged point at the village of Pūzraviečiai, local farmers sometimes observe and collect sporadic light grey, various-sized flint rocks in their arable fields.

(Rimantienė 1996, pp. 23–34; Girininkas 2009, pp. 57–62; Zagorska 2012; Šatavičius 2016, pp. 21–30). The domestic tools consist of dihedral and angled burins, scrapers, perforators, a core axe, and a backed piece (Fig. 5.6). The dihedral and angled burins, which are made from large blades and flakes, represent Final Palaeolithic technology, and are known in other Swiderian culture sites in the eastern Baltic region (e.g. Ostrauskas 1999; Šatavičius 2005; Zagorska 2012; Gudaitienė 2020). The perforators and scrapers are made from larger flakes, whereas one axe was manufactured from an exhausted core.

A total of 14 finds were ascribed to the category of tool. One fragment of an arrow point’s proximal part was identified during the 2004 excavations (Fig. 5.5. 2). At first, it was identified as a fragment of an Ahrensburgian tanged point (Grigaliūnas 2013, p. 185); however, after a second inspection, it became clear that the fragment had a flat retouch on its ventral surface; therefore, it was assumed that the point should be ascribed to Swiderian technology. The 2018 and 2019 field investigations confirmed this, as four more Swiderian points, some of them almost fully preserved, were discovered (Fig.5.5. 1, 3–5). All points are made of regular blades. The first point is made from a small blade, and has a side retouch close to its proximal part on the ventral surface (Fig. 5.5: 1). At first, it does not seem to match the technology of Swiderian points; however, if it is compared with the larger point found at site 1 (Fig. 5.5. 3), similarities can be observed in the shape of the retouch and the tang. The slight technical differences regarding this arrowhead can probably be explained by the small size of the blade, for it was not required to fully retouch the ventral surface in the proximal part. All the Swiderian points were attributed to the willow leaf-shaped point technology that is common in the eastern Baltic

One completely exhausted bidirectional platform core lacked information on the core preparation and blade production techniques used at the Aukštumala sites. Instead, fully or partially preserved blades gave more data about the blade technique. They vary in size and other features that are described in Table 5.2. The largest blades are 71 mm in length, whereas the width and thickness vary between 10 and 20 mm, and three and seven mm respectively (Fig. 5.7). The remains of the core platform and characteristic bulbs indicate that the blades were probably produced by direct percussion, with a hard or soft hammer. The scars on the blades have features of a single or bidirectional platform core, which would indicate that both core types could have been used at the sites. Some of the blades are much smaller in size and are more regular regarding the scars. This is similar to the

Figure 5.5. Swiderian willow leaf-shaped points found at the Aukštumala 1 and 3 sites (Nos. 1–5), and the single tanged point from the Pūzraviečiai village (No. 6) (photograph by T. Rimkus).

77

Tomas Rimkus

Figure 5.6. Domestic flint tools found at the Aukštumala 1–3 sites: 1. backed piece; 2. perforator; 3. scraper; 4–6. burins; 7. core axe (photograph by T. Rimkus).

Table 5.2. Flint blade size attributes and technological features visible in the lithic materials from the Aukštumala 1–3 Stone Age sites Status

Bulb

Core platform

Colour

Length mm

Width mm

Thickness mm

Cortex

Other features

No proximal part

No

No

Dark grey

31

11

3

No

Triangular cross-section

Lacks small fragment of distal part

Yes

Yes

Dark grey

38

17

4

No

Trapezoidal crosssection

No distal part

Barely visible

No

Light grey; burnt

19

10

5

No

Triangular cross-section; curved

Fully preserved

Barely visible

No

Light grey

71

15

7

No

Triangular cross-section; curved

No distal part

Yes

Yes

Dark grey

14

20

4

No

Triangular cross-section

No distal part

No

No

Dark grey; burnt

17

8

3

No

Triangular cross-section

Fully preserved

No

No

Light grey; burnt

35

15

6

No

Curved in the distal part

No proximal part

–

–

Light grey

42

18

5

No

Trapezoidal crosssection; straight

Fully preserved

Yes

Yes

Dark grey

70

20

9

White

Curved in the proximal part

Only proximal part

Barely visible

No

Dark grey; burnt

35

12

6

White

Curved in the distal part

Fully preserved

No

Yes

Dark grey

66

20

6

No

Slightly curved in the distal part

78

The Final Palaeolithic and Mesolithic in the Coastal Part of Lithuania

Figure 5.7. Flint blades (1–9) and an exhausted bidirectional platform core (10) from the Final Palaeolithic Aukštumala 1–3 sites (photograph by T. Rimkus).

regular blades that are often truncated into many pieces, and resemble Pulli technology in Lithuania (Ostrauskas 1996). However, a direct comparison of lithic technology between Swiderian and Pulli cultures in the east Baltic is still lacking, and needs further research. Most likely the blades found at Aukštumala sites were manufactured using indirect percussion, as such regularity could be obtained much easier using this method. However, most of the blades are fragmented and lack diagnostic features for further identification.

The 2004 and 2018–2019 excavations at Aukštumala revealed three Final Palaeolithic sites that technologically resemble Swiderian culture. All three sites are dated only by the technological features of lithic finds and their dated parallels from other Swiderian sites in the adjacent regions (Schild 2014; Winkler 2019; Płonka et al. 2020). Although the sites at Aukštumala are a sandy type, no finds from a later chronology were observed. The lithic tools and their manufacturing features, blades and cores indicate that the flint and non-flint rock finds should be associated with the Final Palaeolithic Swiderian culture (see the discussion for more on the chronology of the sites). However, four samples were dated by AMS 14C in order to supplement the information about the chronology of the sites. Three samples of charred hazelnut shell and wood charcoal from site 1, and one sample of wood charcoal from site 3, were found in the same sandy layers as the lithic finds. However, their absolute age does not correspond with the relative Swiderian culture chronology, and should be regarded as false (Table 5.3). We assume that the dated samples ended up in the layers due to heavy ploughing, or by other natural post-depositional factors (e.g. forest fires, animal activities, etc.).

During the 2018–2019 excavations, 150 worked metamorphic rock finds associated with Final Palaeolithic human occupation were found. Most of them consist only of knapping waste and one blade, but specific tools can also be identified. Tools such as an arrowhead made of a granite flake, a blade fragment with possible use-wear traces on its edges, hammerstones and cores were found (Fig. 5.8). Besides these finds, more flakes with traces of retouch, breakage and possible use-wear traces were found. However, their functional interpretation should be further examined according to the microwear, in order to attribute them to a specific tool type. Granite was the main raw material used for the production of non-flint tools. Other raw materials, such as sandstone, quartzite, quartz, mica and opoka were also used for manufacturing tools, but in smaller numbers. These rocks are mostly available locally in the lower Nemunas area and in the entire Lithuanian coastal zone.

Mesolithic Diagnostic Mesolithic lithic implements are scarce in the coastal part of Lithuania. Only a few sites and stray finds confirm some technological aspects. Most of the 79

Tomas Rimkus

Figure 5.8. Lithic tools made from non-siliceous rocks: 1. granite arrowhead; 2. granite blade with use-wear marks; 3. granite hammerstone; 4–5. granite cores (photograph by T. Rimkus).

Table 5.3. AMS 14C data obtained from the Aukštumala 1 and 3 sites. The dates were calibrated by OxCal v4.4 (Bronk Ramsey 2017) and the IntCal20 atmospheric curve (Reimer et al. 2020) Site

Dated material

Lab. No.

C BP

14

cal BP (95.4%)

cal BC/AD (95.4%)

Reference

Site 1

Hazelnut shell

KIA-53320

4144±24

4823-4575

2874–2626 BC

Rimkus and Girininkas 2021

Site 1

Hazelnut shell

KIA-53323

4036±26

4574-4421

2625–2472 BC

Rimkus and Girininkas 2021

Site 1

Charcoal

KIA-53321

1744±21

1706-1571

245–380 AD

Rimkus and Girininkas 2021

Site 3

Charcoal

KIA-53322

1178±22

1179-1001

772–949 AD

Rimkus and Girininkas 2021

sites, however, lack radiocarbon data. Only at the Šventoji 40 site radiocarbon data pointing to the Late Mesolithic is available, and diagnostic lithic finds, such as inserts, lanceolates and regular blades support this data (Rimantienė 2005, Fig. 380; Piličiauskas 2018, Fig. 64). Microlithic implements, regular blades and cores are present at the Būtingė 1 and Kvietiniai sites as well (Rimantienė 2005, Fig. 383; Vengalis et al. 2020, Fig. 12). The lithic finds at these sites could be related to the Late Mesolithic; but on the other hand, Mesolithic hunting and blade technology was maintained at the beginning of the Early Neolithic, i.e. the beginning of the 5th millennium cal BC, and most likely more dramatic changes in lithic technology began to emerge at the end of the Early Neolithic. This hypothesis must still be supported by firm data, however. The same

circumstances could be applied to the flint blade finds from the Šilmeižiai and Venckai findspots that are also regarded as a possible attribution to the Mesolithic (Žulkus and Girininkas 2012, p. 40; Rimkus and Girininkas 2020b). The studies of stray bone and antler implements are also a good way to analyse Stone Age osseous technologies. They could be dated by radiocarbon and their typological systems could be improved (Hartz et  al. 2019). The Mesolithic period in the coastal part of Lithuania is currently best known via osseous technologies and especially with the finds collection from the Smeltalė site and Melnragė II beach. Thirteen osseous implements made from red deer (Cervus elaphus), elk (Alces alces) and auroch/bison (Bos primigenius/Bison bonasus) (Piličiauskas et al. 2015, 80

The Final Palaeolithic and Mesolithic in the Coastal Part of Lithuania pp. 17–19) antlers and bones were found at the Smeltalė site. Tools with perforations for wooden handles prevail among the finds (axes, adzes and sockets), while red deer antler tines, probably used for processing lithics, and one bone awl are also available (Fig. 5.9). Previous dating attempts indicated that two antler tools belong to the Late Mesolithic, whereas one cattle skull was dated to modern times (Piličiauskas et al. 2015, Table 2). This demonstrates that some of the finds could be from the technogenic layer; nonetheless, more dating of the rest of the osseous finds was conducted, in order to better comprehend the chronology of the tools and the former site. Five more dates from the Smeltalė osseous finds revealed that most of the finds belong to the Late Mesolithic, whereas one is attributed to the beginning of the 5th millennium cal BC, and one red deer antler tine is dated to the Late Neolithic (Table 5.4). The exact find location and layers of these finds are not known; therefore, the dating of the finds would show that they are collected from different parts of the wetland, or from a multi-layered settlement. A wider chronology of the Smeltalė site is also indicated by the amber ornaments in the collection (Pilčiauskas et al. 2015, Fig. 10). Amber raw material occurs abundantly in the

eastern Baltic coastal area in around the 5th millennium cal BC with the transgression of the Littorina Sea (Katinas 1983). As a consequence, amber was used frequently during the Neolithic for the production of different kind of ornaments (Rimantienė 2001; Bliujienė 2007). Therefore, the types of amber finds discovered at the Smeltalė site could even reach back to the Late Neolithic. There are two osseous artefacts from the Smeltalė site that have a geometric and stylised decoration on their surface, which are attributed to hunter-gatherer portable art (e.g. Płonka 2003). The first (No. 9153) is an axe/adze made of red deer antler by cutting its main beam and forming working blades. A perforation for fixing a wooden handle was made next to the antler burr. The burr itself and an adjacent small rectangular area, about three centimetres in size are polished, and contain 13 parallel incisions on the rectangular area (Fig. 5.10). In the Late Mesolithic context of the Baltic region, this type of decoration is simple and does not contain complex geometric compositions, compared to the ornamentation of other osseous finds (Terberger 2003; Sørensen 2017, pp. 135–143; Zagorska et al. 2021, Fig. 10).

Figure 5.9. Osseous tools from the Smeltalė site: 1. bone awl; 2. bone adze; 3. antler adze; 4. antler socket; 5. antler axe/adze; 6. antler adze; 7. antler socket; 8–10. antler tines; 11–12. antler axes (photograph by T. Rimkus).

81

Tomas Rimkus Table 5.4. AMS 14C data obtained from osseous implements from the Smeltalė site and a stray T-shaped antler axe from Melnragė II beach. The dates were calibrated by OxCal v4.4 (Bronk Ramsey 2017) and the IntCal20 atmospheric curve (Reimer et al. 2020) Find No.

Lab. No.

cal BP (95.4 %)

cal BC (95.4 %)

Smeltalė 9142

KIA-54288

6206±32

C BP

7247-6995

5298–5046

Rimkus and Daugnora 2021

Smeltalė 9145

KIA-54289

3850±28

4405-4153

2456–2204

Rimkus and Daugnora 2021

Smeltalė 9146

KIA-54290

5970±34

6898-6676

4949–4727

Rimkus and Daugnora 2021

Smeltalė 9151

KIA-54291

6378±32

7421-7174

5472–5225

Rimkus and Daugnora 2021

Smeltalė 9153

KIA-54292

7085±40

8008-7798

6059–5849

Rimkus and Daugnora 2021

Smeltalė 9144

Poz-61593

225±30

314-25

1636–1925 AD

Piličiauskas et al. 2015

Smeltalė 9141

Poz-61594

6920±40

7843-7670

5894–5721

Piličiauskas et al. 2015

Smeltalė 9150

Poz-66589

6130±40

7159-6901

5210–4952

Piličiauskas et al. 2015

Melnragė II

KIA-53036

6170±35

7163-6958

5214–5009

Rimkus 2019a

14

Reference

Figure 5.10. An antler axe/adze from the Smeltalė site, with geometric decoration (photograph by T. Rimkus).

82

The Final Palaeolithic and Mesolithic in the Coastal Part of Lithuania

Figure 5.11. The ornamented antler adze from the Smeltalė site (photograph by T. Rimkus).

Another tool attributed to the category of portable art is an adze from the Smeltalė site, and is made from a red deer antler (No. 9141) (Fig. 5.11). As in the previously mentioned case, its main beam was cut diagonally, and the working blade of the tool was formed. There is a perforation for fixing a wooden handle above. There are no geometric motifs on the surface of the tool, but the antler’s cortex is removed from both sides at the front and back. The cortex is removed partially, not entirely, and in some parts, it is left untouched. When a fresh antler cortex is removed, the antler’s colour becomes lighter and acquires a whitish colour, whereas the natural colour of an antler cortex is dark brown. Therefore, it is likely that Late Mesolithic societies shaped this find to highlight different colours on its surface. Based on the studies of other Stone Age artefacts, as well as the data on burials, it can be concluded that Stone Age communities paid considerable attention to the contrast of colours and their brightness, which possibly had a certain symbolic meaning (e.g. Grünberg 2015; Butrimas et al. 2018).

axes are made by cutting off a red deer antler’s bez tine, trez tine, brow tine and crown, and then the main beam is cut at both ends, and a perforation is formed through the part where the trez tine grew (Kabaciński et al. 2014). This is the second T-shaped antler axe found in the coastal area of Lithuania. The first was discovered at the Palanga Stone Age site; however, it was dated to 4440–3980 cal BC (Piličiauskas et al. 2015, Table 2). Such tools are very common in the eastern Baltic region, as more examples are known from coastal Latvia, inland Lithuania, the Kaliningrad region, and northwestern Belarus (Bērziņš et al. 2016; Butrimas 2019, p. 177; Vashanau et al. 2020). Most of them are not yet dated; however, the dated ones fall between the 6th and the 5th millennia cal BC. 5.6. Discussion The earliest evidence of human habitation on the current Lithuanian coast comes from the Aukštumala 1–3 sites, where Swiderian culture lithic technology has been discovered. The main objects that prove this are the arrowheads that resemble willow leaf-shaped points. This is evident from two fully preserved points that are associated with this particular type, whereas other points are only tang fragments; however, their shape suggests that they should also be attributed to the willow leafshaped point technology. Only one Swiderian tanged point is known from the coastal zone of Lithuania. An almost

The osseous find collection from the Smeltalė site is currently the largest collection of the Late Mesolithic osseous finds in the Lithuanian coastal zone. One single osseous tool was found at Melnragė II beach, north of Klaipėda. The find was identified as an enigmatic T-shaped antler axe, made from a red deer antler, and dated to 5214–5009 cal BC (Table 5.4; Fig. 5.12). Classic T-shape 83

Tomas Rimkus

Figure 5.12. The T-shaped antler axe from Melnragė II beach (photograph by T. Rimkus).

fully preserved tanged point, it comes from the village of Pūzraviečiai. Comparing this particular specimen with the arrowheads from Aukštumala, significant differences in tang and blank production can be observed. The tanged point from Pūzraviečiai is much larger and has a pointed shape compared to the points from the Aukštumala sites, where smaller blades were produced for making points. The Pūzraviečiai tanged point is 86 mm length, 21 mm width and 9 mm thick, whereas the largest arrowhead from the Aukštumala Stone Age sites (No. 5 in Fig. 5) is 29 mm length, 8 mm width and only 2 mm thickness. According to the Swiderian culture periodisation (e.g. Rimantienė 1996; Schild 2014), tanged points were used during the Younger Dryas, whereas willow leaf-shaped points were produced in the Preboreal. This chronological arrangement is still in use today. However, this periodisation in the eastern Baltic Final Palaeolithic raises further questions: for how long did these two technologies coexist, and when did one replace the other? Both types of Swiderian points are often found at Lithuanian Stone Age sites, and there is a possibility that the two types of arrowheads were used simultaneously. Further research on homogenous materials and their radiocarbon dating is required in order to study these problems.

This layer contained tanged and willow leaf-shaped points, and bidirectional platform cores. Apart from this data, there is a lack of reliable radiocarbon data on the Final Palaeolithic Swiderian sites in the eastern Baltic. The dating of bone and antler harpoons from Latvia and one bone dagger from Lithuania, however, point to the Younger Dryas and the Preboreal, i.e. the timing of Swiderian chronology (Zagorska et al. 2019; Rimkus et al. 2019), but their association with Swiderian technology is still questionable, as these implements were discovered by chance. However, dated animal bones, osseous implements, wood charcoal and pollen data from Swiderian sites in Poland confirm the technocomplex’s continuity from the Younger Dryas to the Preboreal (e.g. Serwatka 2018, Fig. 4; Winkler 2019, Abb. 3). The radiocarbon data from the Aukštumala sites do not fall into the chronological frames of the Swiderian culture. However, studies of changes in the Baltic Sea water level on the Lithuanian coast as well as geological sampling in the Nemunas River delta area suggest that the Aukštumala upland bog was not formed during the Younger Dryas (Damušytė 2011). Most likely the favorable conditions for human habitation at the fluvioglacial hill in the eastern part of the Aukštumala upland bog became available in the Preboreal with the onset of the Yoldia Sea water level regression. Before that, with the Baltic Ice Lake’s existence in the Younger Dryas, the area in question could have been affected by the short-term glacial water bodies that covered the small fluvioglacial hills in the area, disabling access

Few radiocarbon data from Swiderians material is known in Lithuania. So far, only the lower layer C at the Kabeliai 2 Stone Age site is dated to the end of the Younger Dryas and the first half of the Preboreal (Ostrauskas 2002, Table 14).

84

The Final Palaeolithic and Mesolithic in the Coastal Part of Lithuania to them. Also, the dynamics of the Baltic Ice Lake’s water level must also be taken into account as it could have made temporal shifts in shoreline displacement, whereas changes in the Nemunas riverbed is also observed at the onset of the Holocene (Vassiljev and Saarse 2013; Bitinas et  al. 2017). These factors would support the theory on the absence of older archaeological material in the area of question as the environmental setting would favor the suitable conditions for humans already settling in today’s Nemunas River delta area in the Lateglacial (Bitinas et al. 2002; Damušytė et al. 2021). However, sediment studies from the Aukštumala upland bog indicate that the former water basin here formed much later in the Holocene;6 therefore, the landscape and the environment during the Preboreal were completely different without the former coastal lake.

Groß (1940) published finds of reindeer skeletal remains from the latter region and the Kaliningrad region that were later referred to by other authors (Daugnora and Girininkas 2005, Fig. 2). However, the material is scarce and is not dated; therefore, it is unclear whether the reindeer skeletal remains from the Lithuanian coast are contemporaneous with the relative Swiderian chronology at the Aukštumala sites. The Mesolithic case is different, however. The subsistence strategies of Early Holocene societies can be partly described by the osseous tools from the Smeltalė site and Melnragė II beach. Most of the tools are made from red deer antlers; however, elk and aurochs/bison remains also occur. Unfortunately, no other hunted species or consumed resources from the freshwater basins and the sea in the Mesolithic are known at the moment. The current data show that information regarding coastal resources probably lies submerged, and only further underwater studies will supplement the exploitation of sea resources during the Mesolithic (Žulkus and Girininkas 2020).

The available radiocarbon data from the Aukštumala 1 and 3 sites point to the Late Neolithic, the Roman Iron Age, and the late Migration period–Viking Age (Table 5.3). No evidence of Late Neolithic material was found during the 2004 or 2018–2019 fieldwork. Therefore, we assume that the two dates from charred hazelnut shells ended naturally in the sandy layers, or were mixed during modern peat extraction. The same could be said of the two charcoal samples dating from the Iron Age. No indications of former fortification or remains of a settlement were found during the excavations; therefore, we do not relate these dates to the hillfort mentioned in the previously reviewed literature.

Resources for the production of lithic tools were also an important part of the Final Palaeolithic economy. A total of 150 worked metamorphic rock finds were discovered at the Aukštumala 1–3 sites during the excavations in 2018 and 2019. Compared to the flint material, the non-flint lithic finds comprise 49% of all the finds, leaving flint at 51%. Most of the non-siliceous finds (79) were found at site 3, where cores, hammerstones and knapping waste were concentrated. It is most likely that this area was used for processing non-flint rocks. Various types of metamorphic rock raw material are available locally in the Nemunas River delta region and adjacent areas; therefore, it was much easier for Final Palaeolithic societies to obtain these raw materials than to travel long distances to the main flint outcrops in the upper reaches of the Nemunas. The extensive use of non-flint raw material at Swiderian sites is also evident from an inland Lithuanian site. The best example is currently regarded to be the Pasieniai 1 site in eastern Lithuania, where a variety of types of worked metamorphic rocks was identified (Šatavičius 2012).

While the Mesolithic lithic data is scarce in the Lithuanian coastal area, osseous implements from the Smeltalė site and Melnragė II point to the Late Mesolithic. The finds from these two locations consist of various tools; however, axes and adzes are the main ones. Similar bone and antler material was obtained at the Sise site, in the former mouth of the River Užava, in the coastal part of Latvia. A T-shaped antler axe, adzes and axes, antler sockets and tines, and also evidence of portable art, were found at this site, and the available radiocarbon dates attribute the material to between the Middle Mesolithic and the Early Neolithic (Bērziņš et al. 2016; Bērziņš 2020; Zagorska et al. 2021). Although dating is required to further study the osseous material from Kalniškiai (the former Bachmann manor) in coastal Lithuania, the previously raised hypothesis that they are made of reindeer skeletal remains and should be attributed to the Final Palaeolithic should be questioned (Rimantienė 1971; Daugnora and Girininkas 2004, p. 24; 2005, p. 120; Girininkas and Daugnora 2015, p. 35). On the contrary, their shapes resemble Mesolithic ones, and exact dated parallels can be found at the Beregovoya 2 site in Russia (Zhilin et al. 2014).

This also raises discussion on what shape the flint raw material was brought to the Aukštumala? The large number of flakes at site 1 most likely indicate that flint was worked there; this is also supplemented by one exhausted bidirectional platform core and core axe. The latter still has a large part of the cortex remaining on its outer surface. The remaining cortex is also visible on some flint blades and flakes; therefore, perhaps it indicates that flint was brought here in nodules. However, core preparation flakes are missing, while larger flakes are only few. Smaller flakes probably originated from flint tool production. Therefore, it is highly likely that flint raw material at site 1 was brought already partially worked, and further processing of cores and blanks took place here.

Little data can be found on Final Palaeolithic subsistence strategies on the Lithuanian coast. In the last century, H.

6 

The situation regarding site 2 is different as only several larger blades were found there. However, the site requires further excavation in order to speculate about the use of

See Chapter 3 of this book for a further discussion on this subject.

85

Tomas Rimkus References

flint raw material here. Site 3, however, is currently seen as a non-flint raw material processing area.

Baltrūnas, V., Karmaza, B., Kulbickas, D. and Pukelytė, V., 2004. Mineralinės žaliavos, jų paplitimas Virvytės, Minijos ir Varduvos aukštupiuose. Acta Academiae Artium Vilnensis, 34, 33–44.

It is unclear how these three sites are related, if at all. The only subject that relates them for now is the same Swiderian lithic technology; however, how these sites functioned during different seasons or regarding their chronological aspect remains to be studied.

Baltrūnas, V., Karmaza, B., Kulbickas, D. and Ostrauskas, T., 2006. Distribution of raw material for prehistoric flint artefacts in South Lithuania. Geografija, 42 (2), 41–47.

5.7. Conclusions

Baltrūnas, V., Karmaza, B., Kulbickas, D. and Ostrauskas, T., 2007. Egzotinė titnago bei titnago pakaitalų žaliava Lietuvos akmens ir žalvario amžiaus gyvenvietėse. Lietuvos archeologija, 31, 109–122.

Research on the Final Palaeolithic and Mesolithic communities in the Lithuanian coastal area has been updated with new archaeological data. So far, data on the Final Palaeolithic communities that lived here have been scarce, but after archaeological research conducted at the Aukštumala Stone Age sites, it was assumed that this period can be related to the technology of the Swiderian culture. Willow leaf-shaped points, flint blades and other domestic tools were found at three sites. A tanged point characteristic to Swiderian technology was discovered at the village of Pūzraviečiai, of which the size and its pointed tang are different to the ones found at Aukštumala. According to the parallels, these tools should be dated to the Younger Dryas or the Preboreal, yet the radiocarbon data from the Aukštumala settlements do not currently reveal a true chronology of the finds. The latest dating research on the Smeltalė site and Melnragė II osseous implements show that most of them belong to the Late Mesolithic; however, some of the finds from the Smeltalė site are also dated to the Early Neolithic, and one of them even to the Late Neolithic. Two artefacts have distinct decoration on their surface, which according to the analogies belong to the category of the hunter-gatherer geometric and stylised art. Regarding the osseous finds from Kalniškiai (the former Bachmann manor), discovered in the middle of the 19th century, it is necessary to reevaluate them, as their shapes could represent artefacts typical to the Mesolithic, but additional research is necessary in order to evaluate them in greater detail.

Baubonis, Z., Stončius, D., Šatavičius, E. and Zabiela, G., 2017. Lietuvos piliakalniai. Atlasas, T. 4. Vilnius: Lietuvos archeologijos draugija. Berg-Hansen, I.M., Damlien, H. and Zagorska, I., 2019. The northern fringe of the Swiderian technological tradition: Salaspils Laukskola revisited. Archaeologia Baltica, 26, 12–31. https://doi.org/10.15181/ ab.v26i0.2020 Bērziņš, V., 2020. Transformations of coast and culture. A view from the Latvian shore of the Baltic. In: A. Schülke, ed. Coastal landscapes of the Mesolithic. Human engagement with the coast from the Atlantic to the Baltic Sea. London and New York: Routledge, 99–118. https://doi.org/10.4324/9780203730942 Bērziņš, V., Lübke, H., Berga, L., Ceriņa, A., Kalniņa, L., Meadows, J., Muižniece, S., Paegle, S., Rudzīte, M. and Zagorska, I., 2016. Recurrent Mesolithic– Neolithic occupation at Sise (western Latvia) and shoreline displacement in the Baltic Sea basin. The Holocene, 26 (8), 1319–1325. https://doi.org/10.1177 %2F0959683616638434 Bezzenberger, A., 1892. Der Schlossberg im Augstumaller Moor. Sitzungsberichte der Altertumsgesellschaft Prussia, 17, 40–43.

Although new data have been collected on the Final Palaeolithic and Mesolithic material culture in the Lithuanian coastal area, there is still a great lack of data about the subsistence strategies of these societies. Only lithic tools were found at the Aukštumala sites, but no animal remains or other organics dated to the Final Palaeolithic, therefore it is difficult to discuss the subsistence economy of these communities. Final Palaeolithic societies paid attention to the choice of local non-flint rock raw material. The studies conducted show that the flint material at all Aukštumala sites comprises 51% of all finds, and nonflint, 49%. This indicates the specialised choice of rocks for the manufacture of tools, and there was possibly an area for processing tools, located at the Aukštumala 3 site. Osseous finds from the Smeltalė site and Melnragė II beach indicate that the Late Mesolithic societies hunted large ungulates (red deer, elk, aurochs/bison); however, no data is available at the moment on the management of freshwater and sea resources.

Bitinas, A., Damušytė, A., Stančikaitė, M. and Aleksa, P., 2002. Geological development of the Nemunas River delta and adjacent areas, West Lithuania. Geological Quarterly, 46 (4), 375–389. Bitinas, A., Druzhinina, O., Damušytė, A., NapreenkoDorokhova, T., Guobytė, R. and Mažeika, J., 2017. The lower reaches of the Nemunas River at the end of the Lats (Weichselian) Glacial and beginning of the Holocene. Geological Quarterly, 61 (1), 156–165. http://dx.doi.org/10.7306/gq.1337 Bliujienė, A., 2007. Lietuvos priešistorės gintaras. Vilnius: Versus Aureus. Bliujienė, A. and Bračiulienė, R., 2018. Užpelkių kapinynas Lietuvos pajūrio ir Baltijos jūros regiono kultūriniame kontekste. Vilnius: Vilniaus dailės akademijos leidykla.

86

The Final Palaeolithic and Mesolithic in the Coastal Part of Lithuania Bronk Ramsey, C., 2017. Methods for summarizing radiocarbon datasets. Radiocarbon, 59 (6), 1809–1833. https://doi.org/10.1017/RDC.2017.108

Grigaliūnas, M., 2013. The first Palaeolithic and Mesolithic settlements in Aukštumala, Šilutė district, the Nemunas River delta. Archaeologia Baltica, 20, 174–189. https:// doi.org/10.15181/ab.v20i0.815

Butrimas, A., 2016. Biržulis lake islands Donkalnis and Spiginas Mesolithic cemeteries (West Lithuania). In: J.M. Grünberg, B. Gramsch, L. Larsson, J. Orschiedt and H. Meller, eds. Mesolithic burials – rites, symbols and social organisation of early postglacial communities. Tagungen des Landesmuseums für vorgeschichte Halle, band 13/I. Halle (Saale): Landesmuseum für vorgeschichte, 193–217.

Groß, H., 1939. Die Bedeutung des Renntierjägerfundes von Bachmann, Kreis Memel. Altpreußen, 4 (3), 65–67. Groß, H., 1940. Das Renntier in der Ostpreußischen Vorgeschichte. Altpreußen, 1, 1–4. Grużdź, W., 2018. An examination of theories on lithic reduction methods in Swiderian technology. In: K. Knutsson, H. Knutsson, J. Apel and H. Glørstad, eds. Technology of early settlement in northern Europe. Transmission of knowledge and culture. The early settlement of northern Europe vol. 2. Sheffield/Bristol: Equinox publishing, 47–61. http://dx.doi.org/10.1558/ equinox.30725

Butrimas, A., 2019. Biržulis. Medžiotojai, žvejai ir senieji žemdirbiai X–II tūkstantmetyje pr. Kr. T. I. Paminklų tyrinėjimai. Vilnius: Vilniaus dailės akademijos leidykla. Butrimas, A., Ulozaitė, R. and Iršėnas, M., 2018. Aber discs with cross decoration. Archaeologia Baltica, 25, 140–160. https://doi.org/10.15181/ab.v25i0.1835

Grünberg, J.M., 2015. Red colour in Mesolithic burial rites. In: N. Bicho, C. Detry, T. Douglas Price and E. Cunha, eds. Muge 150th: The 150th anniversary of the discovery of Mesolithic shellmiddens – Volume 2. Cambridge: Cambridge Scholars publishing, 253–265.

Crome, H., 1938. Verzeichnis der Wehranlagen Ostpreussens. Zeitschrift für Heimatkunde, Königsberg. Dakanis, B., 2006. Lapalių (Aukštumalos) gyvenvietės. ATL 2004 metais, 11–13.

Gudaitienė, G., 2018. The first inhabitants in the western part of the Neris River basin in Lithuania. Thesis (PhD). Vilnius University.

Damušytė, A., 2011. Post-glacial geological history of the Lithuanian coastal area. Summary of doctoral dissertation. Vilnius University.

Gudaitienė, G., 2020. Eiguliai, one of Rimutė Rimantienė‘s first excavations – a revised interpretation. Lietuvos archeologija, 46, 33–63. https://doi. org/10.33918/25386514-046001

Damušytė, A., Stančikaitė, M., Girininkas, A., Rimkus, T., Daugnora, L., Skuratovič, Ž., Uogintas, D., Valūnas, D., Vaikutienė, G. and Žulkus, V., 2021. New insight into the environmental dynamics and human history in the Nemunas Delta region, W Lithuania, throughout the Lateglacial and Early Holocene. Baltica, 34 (2), in press.

Hartz, S., Lübke, H. and Groß, D., 2019. Early Mesolithic bone points from Schleswig-Holstein. In: D. Groß, H. Lübke, J. Meadows and D. Jantzen, eds. Working at the sharp end: from bone and antler to Early Mesolithic life in northern Europe. Untersuchungen und Materialien zur Steinzeit in Schleswig-Holstein und im Ostseeraum, Bd. 10. Kiel/Hamburg: Wachholtz, 203–238.

Daugnora, L. and Girininkas, A., 2004. Rytų Pabaltijo bendruomenių gyvensena XI–II tūkst. pr. Kr. Kaunas: Lietuvos veterinarijos akademija. Daugnora, L. and Girininkas, A., 2005. Šiaurės elnių keliai ir jų paplitimas Lietuvoje vėlyvajame paleolite. Lietuvos archeologija, 29, 119–132.

Kabaciński, J., Sobkowiak-Tabaka, I., David, E., Osypińska, M., Terberger, Th. and WiniarskaKabacińska, M., 2014. The chronology of T-shaped axes in the Polish lowland. Sprawozdania archeologiczne, 66, 29–56.

Gelumbauskaitė, L.Ž., 2010. Palaeo-Nemunas delta history during the Holocene time. Baltica, 23 (2), 109–116. Girininkas, A., 2009. Akmens amžius archeologija T. 1). Vilnius: Versus Aureus.

(Lietuvos

Katinas, V., 1983. Baltijos gintaras. Vilnius: Mokslas. Kulikauskas, P., 1959. Naujai aptikta akmens-žalvario amžių gyvenvietė Palangoje. MAD‘A, 2 (7), 33–41.

Girininkas, A., 2011. New data on Palanga Stone Age settlement. Archaeologia Baltica, 16, 48–57. https:// doi.org/10.15181/ab.v16i0.33

Minkevičius, K., Podėnas, V., Urbonaitė-Ubė, M., Ubis, E. and Kisielienė, D., 2020. New evidence on the southeast Baltic Late Bronze Age agrarian intensification and the earliest AMS dates of Lens culinaris and Vicia faba. Vegetation History and Archaeobotany, 29, 327–338. https://doi.org/10.1007/s00334-019-00745-2

Girininkas, A. and Daugnora, L., 2015. Ūkis ir visuomenė Lietuvos priešistorėje, T. 1. Klaipėda: Klaipėdos universiteto leidykla. Girininkas, A. and Zabiela, G., 2005. Žvalgomieji tyrinėjimai Žemaičių Naumiesčio apylinkėse. Archeologiniai tyrinėjimai Lietuvoje 2002 metais, 302–307.

Neumayer, H., 2009. Lithuanian finds in the museum for pre- and early history in Berlin. Archaeologia Lituana, 10, 22–35.

87

Tomas Rimkus Osipowicz, G., Orłowska, J., Piličiauskas, G., Piličiauskienė, G. and Bosiak, M., 2020. Osseous points and harpoon heads from Šventoji subneolithic sites, coastal Lithuania. First traceological insight into the way they were produced and used. Lietuvos archeologija, 46, 147–169. https://doi.org/10.33918/25386514-046005

Talamo, S., 2020. The IntCal20 northern hemisphere radiocarbon age calibration curve (0–55 cal kBP). Radiocarbon, 62 (4), 725–757. https://doi.org/10.1017/ RDC.2020.41 Rimantienė, R., 1971. Paleolit i mezolit Litvy. Vilnius: Mintis.

Ostrauskas, T. 1996. Vakarų Lietuvos mezolitas. Lietuvos archeologija, 14, 192–212.

Rimantienė, R., 1996. Akmens amžius Lietuvoje (2-as papildytas leidimas). Vilnius: Žiburio leidykla.

Ostrauskas, T., 1999. Vėlyvasis paleolitas ir mezolitas Pietų Lietuvoje. Lietuvos archeologija, 16, 7–17.

Rimantienė, R., 1999. Kuršių nerija archeologo žvilgsniu. Vilnius: Vilniaus dailės akademijos leidykla.

Ostrauskas, T., 2002. Kabeliai 2 Stone Age site. Archaeologia Baltica, 5, 51–82.

Rimantienė, R., 2001. Die Bernsteinerzeugnisse von Šventoji. Acta Academiae Artium Vilnensis, 22, 87–98.

Peseckas, K., 2018. Tenžės upės slėnio ties Kretinga žvalgomieji tyrimai 2016 m. ATL 2017 metais, 539– 541.

Rimantienė, R., 2005. Akmens amžiaus žvejai prie Pajūrio lagūnos. Šventosios ir Būtingės tyrinėjimai. Vilnius: Lietuvos nacionalinis muziejus.

Piličiauskas, G., 2016. Lietuvos pajūris subneolite ir neolite. Žemės ūkio pradžia. Lietuvos archeologija, 42, 25–103.

Rimkus, T., 2018. Weaponry in the daily life of a hunterfisherman-gatherer. In: A. Bliujienė, ed. The Klaipėda (Memel) region: from origins to the 17th century. Klaipėda: History Museum of Lithuania minor, 151– 158.

Piličiauskas, G., 2018. Virvelinės keramikos kultūra Lietuvoje 2800–2400 cal BC. Vilnius: Lietuvos istorijos institutas.

Rimkus, T., 2019a. In search of Lithuanian coastal Mesolithic. Review of current data and the aims of an ongoing research project. Fornvännen, 1, 1–11.

Piličiauskas, G. and Peseckas, K., 2018. Žvalgomieji tyrimai pajūryje. Archeologiniai tyrinėjimai Lietuvoje 2017 metais, 43–47.

Rimkus, T., 2019b. Mikrolitizacijos proceso įtaka ūkio raidai Rytų Baltijos regione mezolito laikotarpiu. Technologijų ir funkcijos tyrimai. Thesis (PhD). Klaipėda University.

Piličiauskas, G., Luik, H. and Piličiauskienė, G., 2015. Reconsidered Late Mesolithic and Early Neolithic of the Lithuanian coast: the Smeltalė and Palanga sites. Estonian journal of archaeology, 19 (1), 3–28. https:// doi.org/10.3176/arch.2015.1.01

Rimkus, T., Iršėnas, M., Butrimas, A. and Meadows, J., 2019. The decorated spindle-shaped bone dagger from Šarnelė: the earliest example of hunter-gatherer mobile art in Lithuania. Archaeologia Baltica, 26, 50–62. https://doi.org/10.15181/ab.v26i0.2022

Piličiauskas, G., Vengalis, R., Minkevičius, K., Kisielienė, D., Ežerinskis, Ž., Šapolaitė, J., Skipitytė, R. and Robson, H.K., 2021. The earliest evidence for crop cultivation during the Early Bronze Age in the southeastern Baltic Journal of Archaeological Science: Reports, 36, 102881. https://doi.org/10.1016/j. jasrep.2021.102881 Płonka, T., 2003. The portable art of Mesolithic Europe. Wrocław: Wydawnictwo Uniwersytetu Wrocławskiego.

Rimkus, T. and Daugnora, L., 2021. Akmens amžiaus kaulo ir rago dirbinių technologija Lietuvos pajūrio regione. Papildant Palangos ir Smeltalės kolekcijų duomenis. In: E. Rimkienė, ed. Kretingos rajono archeologiniai tyrimai ir perspektyvos. Vilnius: Vilniaus dailės akademijos leidykla, in press.

Płonka, T., Bobak, D. and Szuta, M., 2020. The dawn of the Mesolithic on the plains of Poland. Journal of world prehistory, 33, 325–383. https://doi.org/10.1007/ s10963-020-09146-0

Rimkus, T. and Girininkas, A., 2019. Tyrimai Aukštumalos akmens amžiaus gyvenvietėse bei jų aplinkoje. Archeologiniai tyrinėjimai Lietuvoje 2018 metais, 44– 49.

Reimer, P.J., Austin, W.E.N., Bard, E., Bayliss, A., Blackwell, P.G., Bronk Ramsey, C., Butzin, M., Cheng, H., Edwards, R.L., Friedrich, M., Grootes, P.M., Guilderson, T.P., Hajdas, I., Heaton, T.J., Hogg, A.G., Hughen, K.A., Kromer, B., Manning, S.W., Muscheler, R., Palmer, J.G., Pearson, Ch., van der Plicht, J., Reimer, R.W., Richards, D.A., Scott, E.M., Southon, J.R., Turney, C.S.M., Wacker, L., Adolphi, F., Büntgen, U., Capano, M., Fahrni, S.M., FogtmannSchulz, A., Friedrich, R., Köhler, P., Kudsk, S., Miyake, F., Olsen, J., Reinig, F., Sakamoto, M., Sookdeo, A. and

Rimkus, T. and Girininkas, A., 2020a. Tyrimai Aukštumalos akmens amžiaus gyvenvietėse. Archeologiniai tyrinėjimai Lietuvoje 2019 metais, 35–38. Rimkus, T. and Girininkas, A., 2020b. Žvalgymai Klaipėdos ir Šilutės rajonuose. Archeologiniai tyrinėjimai Lietuvoje 2019 metais, 404–406. Rimkus, T. and Girininkas, A., 2021. The Final Palaeolithic in the coastal part of Lithuania with the technological emphasis on Aukštumala Stone Age sites. Archaeologia Baltica, 28, in press.

88

The Final Palaeolithic and Mesolithic in the Coastal Part of Lithuania Rosentau, A., Bennike, O., Uścinowicz, S. and MiotkSzpiganowicz, G., 2017. The Baltic Sea basin. In: N.C. Flemming, J. Harf, D. Moura, A. Burges and G.N. Bailey, eds. Submerged landscape of the European Continental shelf: Quaternary paleoenvironments. Chichester: Willey-Blackwell, 103–133. https://doi. org/10.1002/9781118927823.ch5

Tarasenka, P., 1928. Lietuvos archeologijos medžiaga. Kaunas. Tautavičius, A. (sud.), 1975. Lietuvos TSR archeologijos atlasas II. Piliakalniai. Vilnius. Terberger, T., 2003. Decorated objects of the older Mesolithic from the northern lowlands. In: L. Larsson, H. Kindgren, K. Knutsson, D. Loeffler and A. Åkerlund, eds. Mesolithic on the move. Papers presented at the Sisth International conference on the Mesolithic in Europe, Stockholm 2000. Oxford: Oxbow, 547–557.

Schild, R., 2014. Geomorphology, stratigraphy, paleoecology and radiochronology. In: R. Schild, ed. Całowanie. A Final Paleolithic and Early Mesolithic site on an island in the ancient Vistula channel. Warsaw: Polish Academy of Sciences, 17–57.

Vashanau, A., Malyutina, A., Tkachova, M., Chernyavskiy, M. and Tkach, E., 2020. Early and Middle Holocene antler tools with holes from the gravel pits of the Smarhon area, north-western Belarus. Swiatowit, LIX, 89–110. https://doi.org/10.31338/0082-044X. swiatowit.59.1

Serwatka, K., 2018. What’s your point? Flexible projectile weapon system in the Central European Final Palaeolithic. The case of Swiderian points. Journal of archaeological science: reports, 17, 263–278. https:// doi.org/10.1016/j.jasrep.2017.10.048

Vassiljev, J. and Saarse, L., 2013. Timing of the Baltic Ice Lake in the eastern Baltic. Bulletin of the Geological Society of Finland, 85, 9–18.

Slah, G., 2013. Flint artefact manufacture techniques at the Palaeolithic and Mesolithic settlements at Aukštumala in Lithuania, and traceological studies of them. Archaeologia Baltica, 20, 190–199. https://doi. org/10.15181/ab.v20i0.816

Vengalis, R., Piličiauskas, G., Pilkauskas, M., Kozakaitė, J. and Juškaitis, V., 2020. The large-scale rescue excavation of a multi-period site at Kvietiniai sheds light on the so far little explored Bronze Age in western Lithuania. Archaeologia Baltica, 27, 17–50. https://doi. org/10.15181/ab.v27i0.2176

Slah, G., 2018. Ankstyvojo holoceno technologinės ūkio raidos pagal Rytų Pabaltijo archeologinės medžiagos eksperimentinius-trasologinius tyrimus nustatymas. Thesis (PhD). Klaipėda University.

Weber, C.A., 1902. Vegetation und Entstehung des Hochmoors von Augstumal im Memeldelta. Berlin: Paul Parey.

Sobkowiak-Tabaka, I. and Diachenko, A., 2021. How to find a fireplace in a burnt forest? Approaching the structure of Late Palaeolithic camps. Journal of Archaeological Science: Reports, 35, 102748. https:// doi.org/10.1016/j.jasrep.2020.102748

Weber, C.A. and Mestorf, J., 1904. Wohnstätten de älteren Neolitischen Periode in der Kieler Förde. Berichte des Schleswig-Holsteinisch-Lauenburgischen Museums vaterlädischer Alterthümer, 43, 9–30.

Sørensen, S.A., 2017. The Kongemose culture. Copenhagen: The Royal society of northern antiquaries and University press of southern Denmark.

Winkler, K., 2019. Ahrensburgien und Swiderian im mittleren Oderraum. Technologische und typologische Untersuchungen an Silexartefakten der Jüngeren Dryaszeit. Untersuchungen und Materialien zur Steinzeit in Schleswig-Holstein und im Ostseeraum, Bd. 11. Kiel/Hamburg: Wachholtz.

Šatavičius, E., 2005. Svidrų kultūra Lietuvoje. Lietuvos archeologija, 29, 133–170. Šatavičius, E., 2012. Pasieniai 1 settlement. In: G. Zabiela, Z. Baubonis and E. Marcinkevičiūtė, eds. Archaeological investigations in independent Lithuania 1990–2010. Vilnius: Society of the Lithuanian archaeology, 21–26.

Zagorska, I., 2012. Senie ziemeļbriežu mednieki Latvijā. Riga: Zinātne. Zagorska, I., Eriksen, B.V., Meadows, J. and Zelčs, V., 2019. Late Palaeolithic ettlement of Latvia confirmed by radiocarbon dating of bone and antler artefacts. In: B.V. Eriksen, E. Rensink and S. Harris, eds. The Final Palaeolithic of northern Eurasia. Proceedings of the Amersfoort, Schleswig and Buegos UISPP commission meetings. Schriften des museums für archäologie Schloss Gottorf band 13. Schleswig: Ludwig, 343–362.

Šatavičius, E., 2016. The first Palaeolithic inhabitants and the Mesolithic in Lithuanian territory. In: G. Zabiela, Z. Baubonis and E. Marcinkevičiūtė, eds. A hundred years of archaeological discoveries in Lithuania. Vilnius: Society of the Lithuanian archaeology, 8–39. Šatavičius, E., Baubonis, Z., Marcinkevičiūtė, E. and Zabiela, G., 2008. Projektuojamo dujotiekio Tauragė– Klaipėda trasos žvalgymai. Archeologiniai tyrinėjimai Lietuvoje 2007 metais, 498–500.

Zagorska, I., Lõugas, L., Lübke, H., Meadows, J., Pettit, P., Macāne, A. and Bērziņš, V., 2021. East meets west in the 6th millennium: Mesolithic osseous tools and art from Sise on the Latvian seaboard. Praehistorische Zeitschrift, 96 (1), 1–18. https://doi.org/10.1515/pz-2021-0003

Tamulynas, A., 1998. Bezzenbergerio archeologiniai tyrinėjimai Klaipėdos krašte. Lietuvos archeologija, 15, 247–285.

89

Tomas Rimkus Zhilin, M.G., Savchenko, S.N., Nikulina, E.A., Schmölcke, U., Hartz, S. and Terberger, Th., 2014. Eleven bone arrowheads and a dog coprolite – the Mesolithic site of Beregovaya 2, Urals region (Russia). Quartär, 61, 165–187. http://dx.doi.org/10.7485/QU61-10 Žulkus, V. and Girininkas, A., 2012. Baltijos jūros krantai prieš 10 000 metų „Yoldia“. Klaipėda: Klaipėdos universiteto leidykla. Žulkus, V. and Girininkas, A., 2020. The eastern shores of the Baltic Sea in the Early Holocene according to natural and cultural relict data. GEO: Geography and Environment, 7 (1), 1–16. https://doi.org/10.1002/ geo2.87 Žulkus, V., Girininkas, A., Stančikaitė, M., Gryguc, G., Šeirienė, V. and Mažeika, J., 2015. In shores of the Yoldia Sea and Ancylus Lake. Maritime landscapes in the Lithuanian waters: multidisciplinary study. In: O. Felczak, ed. The Baltic Sea – a Mediterranean of North Europe: in the light of archaeological, historical and natural science research from Ancient to Early Medieval times. Gdańsk: Scientific Association of Polish Archaeologists, Gdańsk Division, 9–18.

90

6 Osteological Material and the Natural Environment on the Baltic Coast: the Middle Pleistocene to the Middle Holocene Linas Daugnora: Institute of Baltic Region History and Archaeology, Klaipėda University Algirdas Girininkas: Institute of Baltic Region History and Archaeology, Klaipėda University Abstract: The search for relict coasts from the Early–Middle Holocene, and their determination according to the remains of vegetation (pine and oak forests), as well as according to peat deposits in the lagoons of the Early Holocene coastal areas that existed in the Lithuanian coastal area, has been ongoing in Lithuanian territorial waters for 20 years. In this article, the plentiful osteological and osteo-archaeological material is analysed, some of which is from currently flooded areas, and from now-discovered settlements in the Baltic coastal area. This article is devoted to the study of the change in fauna in MIS-3, the Final Pleistocene to the Early and Middle Holocene, establishing its chronology and the composition of species. With the use of energy-dispersive X-ray spectroscopy (EDS) and a histological section, the change in fauna is recorded while both the coastline and the natural environment are altered. People’s activities from these times are analysed based on data from osteological material. Keywords: Faunal remains, Osteoarchaeology, Baltic Sea coast, Pleistocene–Holocene, Subsistence economy, Lithuania 6.1. Introduction

P. Ukkonen (Ukkonen et  al. 2006; 2014), and others. The main material for this research is from settlements currently being investigated in coastal areas. However, the osteological material detected in Lithuanian coastal areas is frequently from former settlements on the Late Palaeolithic to the Early Neolithic–Late Dryas/Late Atlantis Baltic coast. These flooded, eroded coasts are currently located in the Baltic Sea, the coastal areas of which contain the remains of forests that grew in the aforementioned period (Žulkus and Girininkas 2012; 2014; 2020; Girininkas and Žulkus 2017). They were settled by people of the Late Palaeolithic–Early Neolithic. This is confirmed by 14C dated zooarchaeological material, which is frequently washed up from these flooded eroded coasts from the Early Holocene or found in the investigated settlements.

A lot of osteological material has been found in the Lithuanian coastal area which includes the period from the middle glacial to the end of the Atlantis. This material cannot be analysed in isolation without linking it to other osteological material from the same period found in eastern and southern Baltic coastal areas. Therefore, this article has a discursive format, where the material detected in the Lithuanian coastal area is compared to the fauna of the south and southwest Baltic coastal areas belonging to the same period, the spread and the composition of species of which frequently differs. The dependence can be observed, of the composition of species of fauna and the distribution of its population on the entirety of regionally formed local natural peculiarities, water salinity and geological processes, which significantly influenced the composition of species of fauna and the possibilities for the adaptation of the fauna to the environment.

6.2. Material and methods The investigation of the osteological material from MIS3, the Final Pleistocene and Early–Middle Holocene periods found in the Lithuanian coastal area, is based on the collection of seals, fish and birds in the Osteology Department of the Bergen Museum in Norway, the animal, fish and bird skeleton and bone collection of the Anatomy and Histology Department of the Lithuanian Veterinary Academy (LVA), the personal fish collection of J. Sloka, and the sets of hunted fauna and bird bones in the T. Ivanauskas Museum of Zoology. A comparative morphology method was used to research finds from the coastal area. Most osseous and antler tools found in the Lithuanian coastal area were dated using the radiocarbon method as part of the project ‘ReCoasts&People.’

Research on osteological material started in the first half of the 20th century in Lithuania and neighbouring countries. This research is related to the works of H. Gross (Gross 1939, 1940), E. Lubicz-Niezabitowski (Lubicz-Niezabitowski 1928; 1929), K. Paaver (Paaver 1965) and J. Sloka (Sloka 1985). Later, the osteological material from eastern Baltic coastal areas was investigated by V. P. Danilchenko (Rimantienė 2005), L. Daugnora and A. Girininkas (Daugnora and Girininkas 1996; 2004; Girininkas and Daugnora 2015), L. Lõugas (L. Lõugas 1997), D. Makowiecki (Makowiecki 2003; Makowiecki and Król 1997; Makowiecki et  al. 2018), A. Lasota-Moskalewska (Lasota-Moskalewska 1997), 91

Linas Daugnora and Algirdas Girininkas All fishbones and scales were picked out with the use of tweezers and analysed in the Osteology Department of the Bergen Museum. All excavated fishbone sediments from the Šventoji 2/4 site were washed through one-millimetre, two-millimetre and four-millimetre screens. In addition to the found in the excavated plot, three column samples were taken at Šventoji 2/4 for osteological fish analysis. Each sample of each column was 10 by 25 centimetres large and four centimetres thick, constituted about 1,000 cubic centimetres, and was taken every eight centimetres. Where a larger concentration of bones was observed, samples were taken every eight centimetres. The total number from Šventoji 2/4 was 93:62 (62 litres) systematically taken samples, and 31 aditional samples.

2009), K. Mannermaa (Mannermaa 2002), Wood and De Petri (Wood and De Petri 2015), M. Kellner (Kellner 1968), and A. Morales Muniz (Morales Muniz 1993) were used. 6.3. Baltic coastal fauna and the natural environment Late Palaeolithic (MIS-3) fauna in the Baltic coastal area The palaeofauna found in the eastern Baltic coastal area during the Middle Weichselian (MIS-3) period can be divided into two periods: the cold Nemunas 2c (44–38 cal. kyr BP), and the transient period from the colder to the warmer Mickūnai 4 (28–26 cal kyr BP) (Table 6.1).

In addition, the fish research methodology in the studies by J. Lepiksaar (1983), A. Morales and K. Rosenlund (1979), A. Wheeler and A. K. G. Jones (1989) and W. Harder (1976) was referred to in this research. When analysing fishbones found in the Šventoji 2/4 settlement, not only the aforementioned collections of skeletons were used, but also S. Tercerie’s published virtual (Tercerie et al. 2015) library of fishbones.

The first period is related to climate cooling. According to data from spores and pollen analysis, the development of the vegetation from forest tundra to arctic tundra, and back again to forest tundra, can be noticed. This stage of development of vegetation corresponds to the coldest MIS-3 period, and reflects a regular sequence in the development of vegetation, starting from southern tundra to arctic tundra, and finishing with southern tundra again. During the coldest period, communities similar to ones which exist in the present arctic tundra dominated.

Not only morphological but also osteometric (von den Driesch, 1976) and radiological methods were used to research the osteological material from the Lithuanian coastal area. The collagen fingerprinting technique (ZooMS; zooarchaeology by mass spectrometry) methodology in the article by V. L. Harvey et al. (Harvey et al. 2018) was used to determine the species of fish in the Šventoji 2/4 settlement.

The composition of spectrums is dominated by spores represented by Bryales (50%–90%) and Selaginella selaginoides (15%–41%). The amount of pollen of tree species fluctuates in the range of 10% to 20%, and less frequently it reaches 30%. The pollen of Betula nana and Pinus sylvestris was found, and sometimes single pieces of pollen from Picea sect. Eupicea, Alnus, Alnaster, Betula sect. Albae, B. sect. Fruticosae were detected. The majority of herbaceous pollens comprised Poaceae, absynthium and goosefoot. Dryas and Menianthes pollen were also registered (Table 6.1).

The micro-elemental analysis express method using energy dispersive spectroscopy was used for the reindeer (Rangifer tarandus) antlers found in Lithuania. The samples of reindeer antlers were analysed with a Hitachi S-3400N scanning electronic microscope (SEM), and energy dispersive spectroscopy was carried out to establish the chemical composition of the samples and the distribution of the detected chemical elements in the volume of the samples. Energy-dispersive X-ray spectroscopy (EDS or EDX) was used together with a scanning electronic microscope. This apparatus can determine the chemical composition of a sample and the density of the distribution of elements on the surface area. The analysis is based on the idea that each element has its own specific atomic structure; therefore, characteristic X-ray photon energies are different for all chemical elements. EDS does not register atoms lighter than boron (H, He and Li; see the analysis of reindeer antlers found in the environs of Šnaukštai and Debeikiai in Fig. 11). It creates the possibility to determine the results of migration and the analysis of some microelements and compare them to the populations of reindeer living in the wider region.

This complex of spores and pollen shows that the communities of tundra vegetation which are now observed in the northwest European arctic tundra grew in this location. It is thought that green moss and selaginelas dominated. There was little grass. This was typical for arctic and alpine arctic zones. The varieties of Betula nana and Pinus sylvestris clinging to the land as an admixture were rare. Northern pondweed (Potamogeton alpinus) was widespread. Botrychium boreale, Lycopodium pungens and L. appressum also grew. This spectrum of spores and pollen should reflect the transition to a northern tundra. Similar plant communities now grow in the zone of northern tundra (Satkūnas et al., forthcoming). During the second period of MIS-3, the stage of vegetation development shows that during the period of the Upper Pleistocene Nemunas glaciation Rokai megastage, periglacial tundra woodland prevailed, which was gradually replaced by moss and bush tundra. At the

While performing research on bird bones, the methodologies suggested by D. Serjeanson (Serjeantson

92

 Osteological Material and the Natural Environment on the Baltic Coast: the Middle Pleistocene to the Middle Holocene Table 6.1. Periodization of the Middle Weichselian (MIS-3) chronozones in Lithuania (Satkūnas et al., forthcoming) Thermomer/ Cryomer

Time kyr BP

Type locality, section

Pollen data

Mickūnai 4

26–28

Mickūnai 184 P Rokantai

Participation of Betula nana increased considerably (up to 18%). NAP consists of Cyperaceae, Poaceae and Artemisia, predominantly. An open landscape with sparse birch

Nemunas 2e

28–31

Mickūnai 184 P Rokantai

The pollen frequency is very low throughout the interval. Though Betula and Alnus predominate among AP (50% of the total pollen sum), Asteraceae, Artemisia and Chenopodiaceae are the best represented among NAP. Tundra landscape

Mickūnai 3 (Denekamp Interstadial)

31–35

Purviai Medininkai 117P Mickūnai 184 P Rokantai Popierinė Gaidūnai

Betula plays the leading role among AP and the value of NAP (19%) is considerably low throughout the interval. A sparse birch forest

Nemunas 2d

35–36

Purviai Medininkai 117P Mickūnai 184 P Rokantai Popierinė Gaidūnai

The pollen record is very scarce suggesting the NAP (53%) taxa as predominating. Poaceae is prevailing and Cyperaceae together with Artemisia presented in large numbers. Cold steppe landscape

Mickūnai 2

36–38

Medininkai 117P Mickūnai 184 P Rokantai Popierinė Gaidūnai

The number of AP (66%) slightly increases with Pinus as the predominating taxa while NAP is dominated by Cyperaceae. An open landscape with sparse mixed pine - birch forest

Nemunas 2c

38–44

Medininkai 117P Mickūnai 184 P Rokantai Popierinė Gaidūnai

Pollen records prove the flourishing of NAP taxa constituting up to 70%. Cyperaceae clearly predominates and percentage values of Artemisia, Ranunculaceae, Chenopodiaceae and Helianthemum increase indicating the opening of the landscape

Mickūnai 1

44–47

Mickūnai 184 P Rokantai Popierinė Gaidūnai

Alnus plays a leading role in the beginning of the interstadial while Pinus varies between 30 and 60% and the number of Betula is low. Cyperaceae varies between 30 and 60% and the number of Betula is low. Cyperaceae and Artemisia are dominant among NAP (46%). North-boreal mesophytes are represent by Selaginella selaginoides and Botrychium boreale. A sparse northern boreal forest

Nemunas 2b

47–49

Jonionys Gaidūnai

The tree pollen lowered to 60% and Pinus together with Alnus and Betula predominate. NAP group is represented by Cyperaceae and Poaceae predominantly. The light-demanding plants, e.g. Caryophyllaceae, Artemisia, Armeria, Plantaginaceae and Botrychium spores were noted. An open, tree-less landscape

Jonionys 3 (Oerel Interstadial

49–60

Gaidūnai Rokantai Svirkančiai

High representation of AP pollen (up to 90%) with Betula and Alnus as predominating taxa is typical for the interstadial, while NAP pollen are represented by Cyperaceae, Poaceae, Artemisia and Chenopodiaceae mainly. Sparce boreal forest

Nemunas 2a

60–74

Jonionys Medininkai 117P Mickūnai 184 P Gaidūnai

The number of AP varies around 60% and Betula together with Pinus play the leading role. Cyperaceae flourishes among NAP. An open birch forest

Jonionys 2 (Odderade)

74–85

Gaidūnai Jonionys Medininkai 117P

The value of AP pollen reaches up to 95% and Pinus predominates. Also, Alnus is represented by high frequencies. The pollen of larch (Larix) and Calluna as well as spores of Selaginella selaginoides are noted. Boreal forest with pine, birch and an admixture of spruce

93

Linas Daugnora and Algirdas Girininkas beginning, a sparse pine forest grew; there was also a small amount of Picea sect. Eupicea, Betula sect. Albae, B. sect. Fruticosae, and Alnus. In the wetlands, there was moss, dwarf birch and bushy alder. Grass flourished: different species of Poaceae, goosefoot and varieties of complex flowering families. Drier areas were occupied by cold-resistant absinthium. The sparse forest was gradually replaced by open swampy areas where bushy birch trees and green moss grew.

was found in Lithuania for the first time (Table 6.2). This metatarsal bone III (ossa metatarsalia III) of a wild horse (Equus sp.) is from the bottom of the Olando kepurė hill (Klaipėda district). The morphological investigation of this metatarsal bone, when traditional measurements were done (von den Driesh 1976), showed that it was a large adult horse. The length of this individual metatarsal bone was 29.8 centimetres (Table 6.3). After the initial measurements and their comparison to the measurements of horse species (Fig. 6.1), we assume that the metatarsal bone found in the environs of the Olando kepurė hill belongs to a member of the equine family (Equus sp.) from the MIS-3 period. The metatarsal bone is heavy and mineralised (possibly petrified); therefore, it is possible to speak about certain peculiarities/errors in the

In the natural environment of these two periods (Satkūnas et al. forthcoming), reindeer, mammoths, woolly rhinoceros, wild horses and other micro and macro fauna, which had favourable conditions in the natural environment of that time, could prosper. A bone from the foot of a wild horse dated to 39,400±1300/1100 BP

Table 6.2. Dating of fauna from the MIS-3 and GS-2b periods found in the Lithuanian coastal and central area. Dates were calibrated by OxCal v4.4 (Bronk Ramsey 2009) and the IntCal20 atmospheric curve (Reimer et al. 2013) No

Locality

Dated object

Lab. No.

1

On the Baltic Sea coast, Dutch cap, Klaipėda district

Equus sp. metatarsal bone

KIA-55582

2

Šnaukštai quarry Klaipėda district

3

C14 BP

cal BP

Cal BC

δ13C

References

39,400±1300/ 45,453– 41,833 1100

43,504– 39,884

Rangifer tarandus GrA-65623 Linnaeus, 1758 Antler

37,690±280

42,392– 41,906

40,443– 39,957

–18.92

Girininkas et al. 2016, 2017

Šnaukštai quarry Klaipėda district

Rangifer tarandus BETA-407751 Linnaeus, 1758 Antler

41,460±560

45,239– 43,234

43,290– 41,285

–18.9

Girininkas and Daugnora 2015; Girininkas et al. 2016, 2017

4

On the Baltic Sea coast, Dutch cap, Klaipėda district

Mammuthus primigenius Blum. Molar

Hela-3320

27,490±250

31,891– 31,111

29,942– 29,162

–

Girininkas and Daugnora 2015

5

On the Baltic Sea coast, Dutch cap, Klaipėda district

Mammuthus primigenius Blum. Molar

LuS 7918

>43,000

46,359– 44,622

44,410– 42,673

–

Ukkonen et al. 2011; Girininkas and Daugnora 2015

6

On the Baltic Sea coast, Dutch cap, Klaipėda district

Mammuthus primigenius Blum. Molar

Vs-1799

17,430±800

23,074– 19,224

21,125– 17,275

–

This study

7

Ariogala, Raseiniai district

Mammuthus primigenius Blum. Incisivi

FTMCFR-48-2

28,633±95

33,326– 32,225

31,377– 30,276

–

Satkūnas et al. in press

8

Ariogala, Raseiniai district

Mammuthus primigenius Blum. Incisivi

FTMCFR-48-1

25,159±86

29,788– 29,169

27,839– 27,220

–

Satkūnas et al. in press

9

Žagarė, Joniškis district

Mammuthus primigenius Blum. Incisivi

KIA-55701

27,960± 230

32,876– 31,369

30,927– 29,420

10

Naravai, Prienai District

OxA-12017 Coelodonta antiquitatis Blumenbach 1799 Cranium

44,950±650

48708– 45964

46759– 44015

94

–20.6±0.3% This study

–19.0±0.2% This study –

Girininkas and Daugnora 2015

 Osteological Material and the Natural Environment on the Baltic Coast: the Middle Pleistocene to the Middle Holocene Table 6.3. The measurements of the wild horse metatarsal bone found near Olando kepurė (in the Klaipėda district). The measurements were taken by L. Daugnora No

Third metatarsal bone measurement

Measurement / mm

1.

Maximal length

298 mm

2.

Minimal breadth (near the middle of the bone)

41 mm

3.

Depth of the diaphysis at level of 3

38.4 mm

4.

Distal supra-articular breadth (transverse diameter)

58.2 mm

5.

Greatest proximal depth (DAP)

46.3 mm

6.

Diameter of the articular facet for the os tarsale III

50.2 mm

7.

Diameter of the articular facet for the os tarsale quartum IV

8.

Greatest proximal breadth (DT)

9.

Breadth of the distal articulation of the metatarsal bone

10.

Depth of the sagittal crest

42.9 mm

11.

Least depth of the medial condyle

33.9 mm

12.

Greatest depth of the medial condyle

34.9 mm

9 mm 55.5 mm 57 mm

Figure 6.1. The third metatarsal bone (right) of a wild horse dated to 39,400±1300/1100 BP found in Lithuania. Equid measurements of the metatarsal bone in Tab. 6.3 (drawing by Algirdas Girininkas).

radiocarbon measurement method: the radiocarbon date is KIA-55582 39,400±1300/1100 BP. The measurements have shown that the large metatarsal bone is close to the caballoid (‘true’ horse) species, Equus ferus mosbachensis, the first, largest and biggest ecomorph of the Equine family that spread in Europe. This group of horses was widespread during the whole MIS-3 period (Fig. 6.2). In

comparison of the third metatarsal maximal length (mm) of several horse samples, the metrical variation and the mean (cross) are given for each sample (Athanassiou 2001, p. 460). The length of the metatarsal bone found near Klaipėda coincides with the length of Equus ferus mosbachensis 95

Linas Daugnora and Algirdas Girininkas

Figure 6.3. The oldest reindeer antler (Rangifer tarandus, Linnaeus 1758) measurements. West Lithuania, Šnaukštai quarry (photograph by Girininkas, measurements by L. Daugnora) Figure 6.2. Comparison of the third metatarsal maximal length of several bone samples. The metrical variation and the mean (cross) are given for each sample (according to Athanassiou, 2001, and L. Daugnora)

of the working blade is 190 centimetres, and the diameter of the handle is 2.53 centimetres (Fig. 6.3). The tool was made from the antler of a young reindeer (possibly a doe). It was dated using 14C in two laboratories (cf. Chapter 2 of this book). The dates of this reindeer tool fall in the cold Nemunas 2c period (Table 6.1), and it shows that at that time there was no glaciation in the Lithuanian coastal area, as is confirmed by many geologists (Helmens and Engels 2010; Kalm et  al. 2011; Lasberg 2011; Lamsters et al. 2017; Satkūnas and Grigienė 2012, pp. 35–51).

metatarsal bones. The size of its distal part (Bd) is closer to the largest member of the equine family, Equus bressanus,1 Equus suessenbornensis or Equus ferus mosbachensis. However, the proximal sizes (the measurements of the upper part, Bp and Dp) show that the sizes are closer to Equus altidens (stenanoids, ‘zebra’ species). It is worth noting that the proximal part is quite damaged; therefore, the measurements of this part may be imprecise.

Two teeth belonging to mammoths (Mammuthus primigenius, Blum. Molar) from the MIS-3 period, and one tooth from the end of the Nemunas 3 period (Table 6.1), were found in the Lithuanian coastal area, at Olando kepurė (Klaipėda district). In total, 17 mammoth 14C dated skeletons were found in Lithuania (Girininkas and Daugnora 2015, p. 17; Table 2). One of the dated mammoth teeth is 22.5 centimetres long, and 17 centimetres high (Fig. 6.4). The radiocarbon data show that mammoths did not live in Lithuania after the last Nemunas glaciation.

Based on the measurements, the slenderness index, the smallest breadth of the diaphysis (SD) and the greatest length (GL) × 100. (40/301) × 100 = 13.29, were estimated. With no collection of a larger horse skeleton (it requires a skull with teeth), and analysing just a single bone, we cannot define the species or other parameters. As was mentioned earlier, it is the first metatarsal bone of a wild horse dated to before the LGM found in Lithuania. No analogues to this horse from the period were found in neighbouring countries in the eastern Baltic. The oldest part of a reindeer from the last glaciation period, which is the oldest not only in Lithuania but also in northern Europe, was found in the Lithuanian coastal area, used for making a Lyngby socketed axe (Girininkas et al. 2016; 2017). This artefact was found lying at the bottom of a gravel pit on the left bank of the River Agluona, in the village of Šnaukštai in the Klaipėda district, western Lithuania (55° 38’ 58.57”, 21° 24’ 51.43”) (WGS) (Fig. 6.3), and was discovered at a depth of 4.5 to 5.5 metres. The reindeer antler is 30.8 centimetres long, the diameter

Figure 6.4. The mammoth molar tooth (Mammuthus primigenius Blumenbach 1799) from western Lithuania on the Baltic seaside near the Olandas cap (Klaipėda district) (photograph by J. Mažeika)

Equus bressanus is also called Equus major. It is considered to be slightly larger than its descendants Equus suessenbornensis, which lived during the MIS-3 period. 1 

96

 Osteological Material and the Natural Environment on the Baltic Coast: the Middle Pleistocene to the Middle Holocene After the analysis of the enamel of the isotopic carbon composition of mammoth teeth found in Estonia, Latvia, Denmark and Poland, it was found that the d13C values fluctuate from 12.7 to 10.7. For example, during the analysis of mammoth tooth enamel found in Latvia, the lowest value of the isotopic carbon composition obtained was 12.4±0.3 ‰. Samples of mammoth teeth found in Poland, Lithuania and Estonia showed average values of –11.3±0.4 ‰, –11.5±0.3 ‰ and –11.6±0.4 ‰ (Girininkas and Daugnora 2015). When performing research into the development of the nature and landscape of the Baltic coastal area, biological research methods were also applied. Research into the oxygen δ18Ow contained in the mammoths’ teeth was carried out to enable us to determine the average palaeotemperature during the period of their lives (Arppe et  al. 2011, pp. 285–290). Having performed the oxygen isotope analysis of mammoth tooth enamel from Estonia, Latvia, Poland and Denmark, temperature data were obtained, revealing the climatic and palaeotemperature conditions of the Nemunas glaciation (before and after the maximum spread of the glacier) in Lithuania and northern Europe. Analysing the δ18Ow average values of mammoth tooth enamel, significant fluctuations can be observed until the maximum extent of the glacier. For example, comparing the δ18Ow values from France and Great Britain (–7…–9 ‰) with Lithuania and Sweden, as well as with northwest Russia (–14…–16 ‰), the differences are quite large (Arppe and Karhu 2010, pp. 1263–1275). In many authors’ opinions, these differences are closely related to the fluctuations in climate temperature that occurred in different locations in northern Europe. We can see from the results of woolly mammoth tooth enamel research that after the maximum spread of the glacier, and during its melting (17th to 11th millennium BC), the temperature fluctuated between 6°C and 12°C in the Baltic States and southwest Russia, and it was 5°C to 7°C lower at those times compared to the present. These fluctuations in temperature show that the annual average temperature in Latvia was from 6°C to –4°C, in Lithuania from –1°C to 0°C, and in southwest Russia it was 0°C to 2°C. This temperature data enable us to maintain that during the final stage of the last glaciation the air temperature was higher than was appropriate for mammoths. Therefore, they were forced to migrate further to the north of Eurasia, where they finished their existence as a species in the Holocene period.

Figure 6.5. First cervical vertebrae (atlas) of wooly rhinoceros (Coelodonta antiquitatis Bronn, 1831) from western Lithuania, Agluonėnai quarry (Klaipėda district). Photograph by V. Daugnorienė

An upper jaw molar of the second rhinoceros was found near Karklė, next to the eroded slope of the Olandų kepurė hill, in 2012. The length of this tooth is 6.72 centimetres, the width is 5.19 centimetres, the length of the root is 5.43 centimetres, the length of the pit is 2.44 centimetres, and the width is 1.03 centimetres. These data show that it was young when it died. The palaeostological material that has survived in Lithuania from the MIS-3 period shows that climatic and temperature conditions were favourable not only for these animals, but also for people. Of course, without direct evidence (anthropological data), we cannot state that people inhabited Lithuania, and that mammoths, rhinoceroses and reindeer were hunted. But the values of oxygen δ18Ow and carbon d13C surviving in the mammoth tooth enamel show that it was possible for humans to live, hunt and gather food. Undoubtedly, the last glaciation destroyed everything. But single finds such as a tool found in Šnaukštai (in the Klaipėda district), possibly made from a reindeer antler, could have been made by a human (Girininkas et al. 2016). Therefore, the development of the MI-3 period’s fauna and flora, and the research into one find, possibly a tool, do not mean that people who lived in western Lithuania during this period lived only from hunting and gathering. 6.4. The fauna of the Final Palaeolithic–Early Mesolithic The research into Final Palaeolithic and Early Mesolithic osteological material found on the shores of the Baltic Sea starts from the GS-1 and the Early Holocene period (the beginning of the Pre-Boreal). The second regression of the Baltic Ice Lake (BIL) ended the development of the Baltic Sea Final Palaeolithic. This event coincides with the end of GS-1 cooling and the beginning of the Holocene and a warmer period. The Baltic Sea connected to the ocean once again in the southern lowland area of central Sweden. This stage of the Baltic Sea is called the Yoldia Sea. The Eresund was already not a strait between the BIL and the ocean. At that time, land rose between southern Sweden, Denmark and the continent of Europe. The glacier melted rapidly,

During the MIS-3 period, large woolly rhinoceroses weighing up to three tonnes (Coelodonta antiquitatis, Blumenbach 1799) inhabited the Lithuanian coast. The bones and teeth of two woolly rhinoceroses have been found in the Klaipėda district. The first neck vertebra (atlas) of one rhinoceros was found at Agluonėnai quarry in 2012 (Fig. 6.5), of which the BFcr (greatest) breadth of the Facies articularis cranialis (cranial articular surface) was 19.5 centimetres, and the height (measured in a measuring box by laying the atlas with its cranial side on the bottom of the box and closing the blocks over the dorsal and ventral arches) was 13.7 centimetres. 97

Linas Daugnora and Algirdas Girininkas and the Bay of Bothnia in the present Baltic Sea remained covered in ice. Large areas of land rose out of water on the present east Baltic Sea shore, in territory which people of the Final Palaeolithic settled (Rimkus and Girininkas 2021; Zagorska et al. 2019, pp. 343–362). At Juodkrantė, formations of the Yoldia sea coastline have been detected at depths of 25 to 30 metres, at which the remains of relict forests are found (Žulkus and Girininkas 2012, pp. 28– 35; 2014, pp. 274–289; 2020; cf. Chapter 2 of this book). When analysing the development of the Baltic Sea shore, a very important question arises: the possibility for people to live next to the Baltic Ice Lake, and later the Yoldia Sea, the Ancylus Lake and the Littorina Sea. Were the natural and climatic conditions good enough? Could people find a sufficient amount of food on the Baltic coast at that time? These questions are partly answered by the research data into osteological material from those times, closely related to the changes in the natural environment, the needs of human nutrition, and the subsistence economy.

Lake (Fig. 6.6). This possibly explains the circumstances of reindeer antler appearing in Klaipėda (Groß 1939, pp. 65–67; 1940, pp. 1–4). But reindeer antlers found on the Curonian Spit may have two different origins. These antlers could have been washed up by currents in the sea from the eroded Sambian peninsula during the first Littorina Sea or its later stages when the Curonian Spit started forming.

Reindeer (Rangifer tarandus) and their importance to people in the Final Palaeolithic–Early Mesolithic The osteological material from the Lithuanian coastal area is quite varied. On the Lithuanian segment of the Baltic Sea coastline, the osteological material is from the Final Palaeolithic–Middle Neolithic period. At the end of GS-1 and the beginning of the Pre-Boreal, when the BIL waters connected with the ocean and saline water penetrated the formerly freshwater ice lake, a basin of varying salinity, the Yoldia Sea, formed. The Yoldia Sea existed in the period of 11,700–10,700 cal BP (Andrén et  al. 2011, p. 84; Borzenkova et al. 2015, p. 26; Rosentau et al. 2017, pp. 115–118). The water level of the Yoldia Sea was low, and the coastline, compared with the present Baltic coast, was much further to the west in Lithuanian territorial waters. This is confirmed by the latest underwater research into the Baltic coast (Žulkus et al. 2015; Žulkus and Girininkas 2020). If at the end of GS-1 and the beginning of the PreBoreal, birch trees with small areas of pine forests grew on the coast, from the middle of the Pre-Boreal, thin pine forests spread in the coastal area (Kabailienė 2006, p. 400). This fact is also confirmed by the detection of relict rooted pine stumps on the bed of the Baltic Sea at the RF-I site (cf. Chapter 2 of this book). At the end of the GS-1 period, there were numerous herds of reindeer in the Lithuanian coastal area and in the continental part of Lithuania, but with the gradual change in the climate (during the transient period from GS-1 to the Pre-Boreal), new animals appeared: aurochs (Bos primigenius), bison (Bison bonasus), red foxes (Vulpes vulpes), red deer (Cervus elaphus), roe deer (Capreolus capreolus) and other animals (Girininkas and Daugnora 2015). However, the dominant species during the transient period was reindeer.

Figure 6.6. Baltic Glacial Lake in the period of GI-1a, b, c, d and GS-1: 2, 13–15, 18 sites (see- table 4) of reindeer skeleton discovery; Aukštumala 1, 2 settlements. Baltic Glacial Lake shorelines are marked according to Bitinas and Damušytė 2021. Modified by A. Girininkas

Reindeer antlers from the Allerod–Younger Dryas period are found on the shores of the present Baltic Sea, which did not differ significantly from the shores of the Baltic Ice 98

 Osteological Material and the Natural Environment on the Baltic Coast: the Middle Pleistocene to the Middle Holocene found in 23 and eight sites respectively (Paaver 1965; Ukkonen et al. 2006; Zagorska 2012). In all of Lithuania, only tundra forms of reindeer antlers from the Late Dryas and Early Pre-Boreal periods have been found (cf. Chapter 2 of this book). This shows that climatic conditions were still quite extreme for human habitation in those times. BIL coastal areas were a very favourable route for reindeer to migrate in south–north directions. During migration, reindeer had to cross rivers flowing into the BIL. One such river could have been the River Danė. It is possible that reindeer antlers detected around Klaipėda port and city (cf. Chapter 2 of this book) could have belonged to reindeer that were killed by hunters while they were crossing the river. Reindeer hunting, as a summary of the sites of Final Palaeolithic settlements and parts of a single reindeer skeleton allows us to state, frequently occurred adjacent to river shoals during the spring and autumn reindeer migration (Girininkas and Daugnora 2015, pp. 39–41) (Fig. 6.8).

Figure 6.7. Reindeer (Rangifer tarandus Linnaeus, 1758) antler discovered on the Curonian Spit south of Nida (Kaliningrad region). Photograph by N.V. Martynovich

Even now, reindeer antlers are washed ashore by currents in the Baltic Sea, possibly from the Sambian peninsula, as the number of reindeer antlers is especially high in former Prussia, including the Sambian territory (the Kaliningrad region) (Struckmann 1880; Engel 1935; Gross 1939; 1940; Kulikauskas 1959, Girininkas and Daugnora 2015, pp. 35–43). One such antler was found on the coast south of Nida, in the Kaliningrad region (Fig. 6.7). Other reindeer antlers, found on the Curonian Spit under sand in the dark humus layer, may be from an early stage of the Yoldia Sea, when the water level in the Baltic Sea started decreasing rapidly and the Yoldia Sea was forming. At that time, a population of reindeer still existed in Lithuania. In the Baltic coastal area (together with the Curonian Spit), four sites with reindeer finds are known, and reindeer antlers have been found in 17 sites all over Lithuania (cf. Chapter 2 of this book), while in Latvia and Estonia they have been

Histological research of reindeer antlers shows that the reindeer antler microstructure and the amount of osteons in reindeer did not change from the beginning of the last glaciation to its end (Fig. 6.9); only the first ones are less bright due to their age. The spectroscopic X-ray analysis of reindeer antlers found both in Lithuanian coastal areas and in continental parts shows that the organic fractions detected and the smaller amount/loss of exogenous

Figure 6.8. Possible reindeer migration routes (7), locations of reindeer skeletons (6), and Late Pleistocene settlements: Hamburgian (1). Federmesser (2), Brommean (3), Ahrensburgian (4) and Swidrian (5) in the Lithuanian territory. Drawing by A. Girininkas

99

Linas Daugnora and Algirdas Girininkas

Figure 6.9. Reindeer (Rangifer tarandus, Linnaeus 1758) micro-structural antler histological section (43,840–41,985 BC). Preparation and microphoto by Prof. T. Bromage

amounts of Na, Zn and C. These features can be explained by the fact that the antlers were in different layers of sediment where the chemical elements transferred gradually into the environment. However, the study of the Karkliškiai reindeer skull fragment (Fig. 6.10) shows that

microelements are typical of reindeer antlers from the Late Palaeolithic and Early Holocene. These measurements show that Ca and P distribution is homogenous. Elements such as Ba, Si, Al and S are usually distributed unevenly. The profiles of Fe, Mn and F decline, as well as the

Figure 6.10. A fragment of the Karkliškė (western Lithuania) reindeer cranium. Samples were analyzed by scanning electron microscopy (SEM) and energy dispersion spectroscopy (EDS). Analysis was performed to determine the chemical composition of the samples and the distribution of the found chemical elements in the sample bulk. Photograph by G. Slah

100

 Osteological Material and the Natural Environment on the Baltic Coast: the Middle Pleistocene to the Middle Holocene

Figure 6.11. A fragment of the Karkliškiai reindeer cranium. Samples were analyzed by scanning electron microscopy (SEM) and energy dispersijon spectroscopy (EDS). Analysis was performed to determine the concentration of different elements (Ca, P, Mg, Ba, K, S, Zn, Mn and Sr). Drawing by S. Tučkutė

the estimated relative amount of strontium (Sr) reached 0.07at. ‰ (Fig. 6.11). A study of present-day reindeer antlers (from Norway) carried out at the same time also shows traces of Sr present in the antler. The amount of Sr found in the current limestone-clay and sandstone soils of western Lithuania (Kadūnas et  al. 1999) shows that animals that absorb Sr through plants have been in this land from the beginning of the Holocene. The amount of Sr did not change significantly during the whole Holocene period. These preliminary data do not allow us to make premature conclusions on the migration of reindeer and its direction from areas where Sr is present in the soil; but having compared this data to the Sr data of presentday soil, the assumption can be made that reindeer in the Late Pleistocene and Early Holocene periods fed on local vegetation in the coastal areas of the former Baltic Ice Lake and the Yoldia Sea that was forming in the Lithuanian coastal area. What vegetation was it? Palynological data show that the main source of nutrition for reindeer was reindeer moss (Cladonia rangiferina) (1) and birch trees (Betula nana), which contained Sr aggregates (Fig. 6.12).

to the former BIL (cf. Chapter 5 of this book). They were intended for hunting larger animals: reindeer and fur-bearing animals. The sustainable economy of Late Palaeolithic reindeer hunters, reindeer hunting and their keeping were studied by A. Rust (Rust 1937; 1958), D. A. Sturdy (Sturdy 1975, pp. 55–98), L. Zaliznjak (Zaliznjak 1995), B. Bratlund, and M.-J. Weber, M. F. Mortensen, J. Olsen, J. Holm, C. Christensen (Bratlund 1999, pp. 47–59; Weber 2013, pp. 75–90; Mortensen et al. 2014), and other researchers. Data from reindeer antlers found in Lithuania show that the first reindeer were already present here at the end of the GI-1e period. During this period, reindeer also appeared in southern Scandinavia (Aaris-Sørensen et al. 2007, pp. 916–917). The latest period of the presence of reindeer includes the beginning of the Pre-Boreal. Reindeer were hunted at the same time in Denmark (8400 cal BC) (Aaris-Sørensen et al. 2007, p. 915). Carbon isotope values of reindeer found in Lithuania range from from -18.9 to -20.0 (cf. Chapter 2 of this book). Reindeer antler δ13C isotope research shows that reindeer fed on similar food as they did in the eastern Baltic (Ukkonen et al. 2006, p. 227, Table 2).

Almost all researchers studying the Late Palaeolithic period agree that the main source of food at that time in the north European lowland for southern Scandinavian communities was reindeer hunting. The provision of nutrition was the main driving force behind flint and osseous technologies. During all of the Late Palaeolithic, tanged points were used that were recently found adjacent

During the Late Palaeolithic, wide rivers and long lakes were a major obstacle for reindeer to migrate. It is thought that they tried to overcome these obstacles in the most suitable places, at shoals and wades (Simchenko 1976, pp. 75–76; Zalizniak 1989, p. 123; Rust 1943). It is said 101

Linas Daugnora and Algirdas Girininkas

Figure 6.12. Vegetation of the territory of western Lithuania in the late Pleistocene. The main food for reindeer was reindeer moss (Cladonia rangiferina) (1) and, birch trees (Betula nana) (2) according to A. Weber 2016; M. Kabailienė 2006.

that in the Late Palaeolithic period, the people of those times, reindeer hunters, settled next to these shoals and wades through which reindeer crossed the bodies of water from both sides (Weber 2016, pp. 77–82). Referring to data from archaeological research, suitable sites for reindeer hunting in Lithuania were by the rivers Nemunas, Nemunėlis, Aukštumala and Danė (Šilutė district) (Girininkas, Daugnora, 2015, p. 39; Girininkas et al. 2017, p. 9; Rimkus, and Girininkas 2020, pp. 35–38), and other bodies of water of that time adjacent to which arrowheads typical of Hamburg, Lyngby-Brome, Ahrensburg and Swiderian cultures, and other tools, are found (cf. Chapter 5 of this book).

The coolness in those times is shown by the detection of Selaginela selaginoides (L.) (see Chapter 3). This natural environment, mostly reflecting the Pre-Boreal period, shows that during this period, reindeer gradually retreated from the eastern Baltic region. As was mentioned above, sub-species of reindeer inhabiting woodland tundra were detected neither in the Baltic coastal area nor in continental Lithuania. This indicates that the fauna changed together with the development of forests and the retreat of the reindeer. 6.5. Coastal fauna in the Mesolithic–Middle Neolithic The main branch of human economic activity in the Mesolithic–Middle Neolithic was hunting. The economic contribution of hunting was very significant to a person’s life at that time. This contribution was not limited to food, i.e. meat. A human procured all necessary means for living from hunting, including fur, leather, bones and antlers (the main raw material for tools and weapons), tendons (for sewing, tools and bows), grease, and more. Finds of animal bones which comprise single parts of a skeleton, or tools made from them, have not so far been numerous, either in the Lithuanian coastal area or in continental Mesolithic settlements (Girininkas and Daugnora 2015, p. 68). The amount of osseous and corneous tools increases in Late Mesolithic and Neolithic settlements in Palanga, Smeltalė (Klaipėda city) and Šventoji (Palanga municipality) (Table 6.4).

Archaeological data show that there was a similar situation on the shores of the Baltic Ice Lake during the GS-1 and Early Pre-Boreal periods. This is confirmed by research into the Aukštumala I–III settlements (Rimkus and Girininkas 2019, pp. 44–49; 2020, pp. 35–38). According to data from palynological research, there were numerous lakes in the coastal areas during the regression of the BIL and the formation of the Yoldia Sea, and most of the vegetation on the sandy shores of the lakes consisted of pine forests, and in wetlands, birch trees. Herbal vegetation was dominated by the sedge family (Cyperaceae) and Poaceae plants, which usually spread in swampy areas. Absinthium (Artemisia) and juniper (Juniperus) grew in open sandy locations. Quite a large amount of pollen consisted of Polypodiaceae plants. 102

 Osteological Material and the Natural Environment on the Baltic Coast: the Middle Pleistocene to the Middle Holocene Table 6.4. Radiocarbon dating of Holocene-period osteological material found in the Lithuanian coastal area. Dates were calibrated by OxCal v4.4 (Bronk Ramsey 2009) and the IntCal20 atmospheric curve (Reimer et al. 2013) No

Area

Material Dated

Photo of the dating artefacts

Lab ID

14

C age BP

Cal BP (95.4%) (1 sigma)

Cal BC (95.4%)

δ13C %

1.

Melnragė II

T-shaped red deer (Cervus elaphus) antler axe

KIA-53036

6170±35

7163–6958

5214–5009

–

2.

Palanga site

T-shaped red deer (Cervus elaphus) antler axe

Poz-66588

5240±40

6179–5916

4230–3967

–

3.

Palanga site

Red deer (Cervus elaphus) antler axe

Poz-64684

5515±30

6395–6223

4446–4274

–

4.

Palanga site

Adze, red deer (Cervus elaphus) bone

KIA-54281

5310±45

6266–5943

4317–3994 –21.0

(Continued) 103

Linas Daugnora and Algirdas Girininkas Table 6.4. Continued No

Area

Material Dated

Photo of the dating artefacts

Lab ID

C age BP

Cal BP (95.4%) (1 sigma)

14

Cal BC (95.4%)

δ13C %

5.

Palanga site

Adze, red deer (Cervus elaphus) bone

KIA-54282

5060±29

5903–5735

3954–3786 –22.7

6.

Palanga site

Red deer (Cervus elaphus) bone

KIA-54285

5355±30

6275–6003

4326–4054 –22.6

7.

Smeltalė site

Red deer (Cervus elaphus) antler

KIA-54288

6205±35

7247–6993

5298–5044 –22.1

8.

Smeltalė site

Red deer (Cervus elaphus) antler

KIA-54289

3850±28

4405–4153

2456–2204 –20.2

9.

Smeltalė site

Red deer (Cervus elaphus) bone

KIA-54290

5970±35

6899–6676

4950–4727 –23.0

Red deer (Cervus elaphus) antler axe

KIA‐54291

6380±35

7421–7175

5472–5226 –21.4

10. Smeltalė site

(Continued) 104

 Osteological Material and the Natural Environment on the Baltic Coast: the Middle Pleistocene to the Middle Holocene

No

Area

Material Dated

Photo of the dating artefacts

Lab ID

14

C age BP

Cal BP (95.4%) (1 sigma)

Cal BC (95.4%)

δ13C %

11. Smeltalė site

Red deer (Cervus elaphus) hoe

KIA-54292

7085±40

8008–7798

6059–5849 –21.5

12. Smeltalė site

Red deer (Cervus elaphus) antler sleeve

Poz-61594

6920±40

7843–7670

5894–5721

–

13. Smeltalė site

Elk (Alces alces) antler sleeve

Poz-66589

6130±40

7159–6901

5210–4952

–

14. Zelenogradsk (Russia, Kaliningrad region)

Aurochs (Bos primigenius) horn

KIA-54525

6988±26

7929–7735

5980–5786 –22.0

15. Palanga site

Seal (Phoca groenlandicus)

Vs-2648

4370±220

5576–4422

3627–2473

–

16. Curonian spit (Russia) near border with Lithuania

Reindeer (Rangifer tarandus)

–

–

–

–

–

17

Šventoji 6

Seal Phocidae

Ki-9463

4180±70

4856–4524

2907–2575

–

18

Šventoji 6

Alces alces

Ki-9462

4370±70

5281–4834

3332–2885

–

(Continued) 105

Linas Daugnora and Algirdas Girininkas Table 6.4. Continued No

Area

Material Dated

Photo of the dating artefacts

Lab ID

C age BP

Cal BP (95.4%) (1 sigma)

Cal BC (95.4%)

δ13C %

14

19

Šventoji 23

Seal Phocidae

Ki-9459

3730±70

4350–3880

2401–1931

–

20

Šventoji 23

Bos primigenius

Ki-9458

3790±80

4414–3972

2465–1983

–

21

Šventoji 2/4

Bos primigenius

ETH-70755

4149±37

4828–4534

2879–2585

–

22

Šventoji 2/4

Canis familiaris

Tua-2075

4530±65

5445–4963

3496–3014

–

23

Šventoji 2/4

accumulation of fish bones

Tua-2076

4875±65

5846–5467

3897–3518

–

24

Šventoji 2/4

Harp seal (Phoca groenlandicus) femur

Ua-50227

4549±43

5436–5048

3487–3099 –16.9

25

Šventoji2/ 4

seal scapula

LuS-7693

4420±50

5281–4864

3332–2915 –17.0

26

Šventoji 23

Sealpiramis otica

LuS-7692

4550±50

5443–4990

3494–3041 –17.7

27

Šventoji 1

Seal vertebra

LuS-7694

4470±50

5305–4885

3356–2936 –17.0

(Continued) 106

 Osteological Material and the Natural Environment on the Baltic Coast: the Middle Pleistocene to the Middle Holocene C age BP

Cal BP (95.4%) (1 sigma)

LuS-7696

4605±50

5472–5053

3523–3104 –17.3

Humerus, seal

LuS-7695

4370±50

5265–4840

3316–2891 –17.7

Aurochs (Bos primigenius), Bojanus 1827

Ki-9460

4168±80

4860–4445

2911–2496

Material Dated

No

Area

28

Šventoji 3

Mandibula, seal

29

Šventoji 6

30

Šventoji 2/4

Photo of the dating artefacts

During this period, the natural conditions were good enough for people to live in the Lithuanian coastal area. According to the latest data from underwater coastal landscape research, pines were the dominant taxon from the beginning of the Ancylus Lake and during all the Boreal period. Elms, hazelnuts, lime trees and oaks grew next to them. In the region of the Ancylus Lake coastal area (its coasts are all underwater now, cf. Chapter 2 of this book), herbal vegetation flourished adjacent to closed bodies of water, and formed layers of peat that have survived till today. The coastal area was especially favourable for hunters, fishers and gatherers to live. Several different zones of vegetation formed in the coastal areas of those times. In the coastal forests of the Ancylus Lake itself, thin pine forests with undergrowth were favoured more by red deer, and a little further from the coast, denser forests were preferred by aurochs, elk, bears, and wild boar. In small lakes in the coastal area that were located during underwater research (cf. Chapter 2 of this book), freshwater fish and birds bred, as did seals on the shores of the former Ancylus Lake and the Littorina Sea. The range of several different zones of coastal vegetation, which had differences in fauna, was especially favourable to the hunter-fisher communities that lived there in those times.

Lab ID

14

Cal BC (95.4%)

δ13C %

–

Early Holocene period (Paaver 1965, p. 308: Lõugas 2006, pp. 75–89; Kabaciński 2009, pp. 119–130; Orłowska and Osipowicz 2021, pp. 143–154). Climate change, and especially the formation of the Boreal forests, had an impact on the spread of aurochs populations. Therefore, the greatest number of aurochs existed in the Mesolithic to the Middle Neolithic period (Girininkas and Daugnora 2015, pp. 70, 105), during the climate optimum of the Holocene. They were found in the Šventoji 2/4 and Šventoji 23 settlements. In the Sub-Boreal period, their population decreased (Girininkas and Daugnora 2015, p. 154; Rimantienė 2005, p. 351), due to the changeing natural conditions. During the period of the greatest spread of aurochs, the horn of an aurochs (Bos primigenius, Bojanus 1827), dated 6988±26 BP, was found near Zelionogradsk (the Kaliningrad region of Russia), in the eastern Baltic Sea at a depth of 27 metres (Fig. 6.13; Table 6.4). It can be associated with the period of the formation of the Littorina Sea, as

Aurochs (Bos primigenius) The aurochs is an extinct animal from the Bovidae order of mammals, the Bovinae family. It was a very important animal for humans during the Early and Middle Holocene. Hunters were not only interested in their meat and fur, but also the domestication of aurochs during the Middle Holocene, which determined the development of presentday animal husbandry. Aurochs have been detected in eastern and southern parts of the Baltic region from the

Figure 6.13., Aurochs (Bos primigenius, Bojanus 1827) cranium aboral part with horns found in the Baltic Sea near Zelinogradsk (Kaliningrad region, Russia) at a depth of 27–24 m b.s.l. Photograph by V. E. Sukhov

107

Linas Daugnora and Algirdas Girininkas a lagoon from a similar time was found near Juodkrantė, where peat formed in the investigated site RF-I-P (Žulkus and Girininkas 2020). This period coincides with the Baltic Sea shores that were 28 to 30 metres below sea level, on which aurochs lived. Aurochs horns and skeletal material from later periods are also found in the Lithuanian coastal area (Šventoji 23, Šventoji 2/4 settlements) from 4168±80 BP (Ki-9460), and some from earlier periods are detected in the continental part (Ariogala, Raseinių district, 7192±30 BP, ETH-85691; Skapiškis, Kupiškio district, 3860±100 BP; Padovinys, Marijampolė district, 7709±27 BP, ETH-66327) (Girininkas and Daugnora 2015, pp. 116, 154, 205; Hofman‐Kamińska et al. 2915–2930). Aurochs bones from the earlier Ancylus Lake period in 9330±65 BP were found along parts of the Hanö Bay coast in southeast Sweden (Hansson et al. 2017).

were forests dominated by pine, birch and other species of trees that were favoured by elk (Alces alces) around the Šventoji settlements and the Biržulis lakeshore in those times (Girininkas and Daugnora 2015, p. 58). Many microand macro-elements present in teeth (Kendall MacKenzie et al. 2011, p. 5488) are included in the structure of dental enamel and dentine complex hydroxyapatite crystals, of which the formation occurs during the growth of a tooth (Simmelink 1994, p. 239). A lack of these micro- and macro- elements, especially copper, zinc and tin, causes cracks and ruptures of the crowns of teeth (Kendall MacKenzie et al. 2011, p. 5483). Such conditions possibly formed in the Šventoji micro-region in this period. Red deer (Cervus elaphus) Red deer could not inhabit the Lithuanian coastal area during the last glaciation and early Pre-Boreal period, due to the natural conditions, which were too harsh for them. Their spread there can be related to the development of the Boreal forests, both in Lithuania’s coastal zone and the continental part. In the Middle Holocene, and especially during the Atlantis period, most hunted fauna on the shores of the former eastern Baltic Sea consisted of red deer (Girininkas and Daugnora 2015, p. 105; Bērziņš 2008, pp. 470–473; Lõugas et  al. 1996, pp. 399–420). After seal, red deer stand out by their abundance among the earliest specific osteological material found in the Šventoji 2/4 settlement (Girininkas and Daugnora 2015, p. 105). According to the available data, the population of red deer was widely hunted in the Lithuanian coastal area, and their bones and antlers were used for making tools. Through the chronological and osteological analysis of tools made from red deer skeletal material (Table 6.4), we can see that during the Baltic Sea Littorina maximum transgression period, the population of this animal was dominant: it comprised 17% to 18% of all hunted animals. Although the red deer population in the Lithuanian coastal area at that time was quite large, it was significantly larger in the continental part. Red deer comprised as much as 32% of hunted animals in settlements in eastern Lithuania at that time (Daugnora and Girininkas 2004, p. 91; Girininkas and Daugnora 2015, p. 105). Similar features in the spread of the red deer population are observed all over the eastern region of the Baltic Sea (Kozlowski 1989; Makowiecki et  al. 2018). Deer antlers were used mostly for manufacturing T-shaped axes, both in the continental part (Kabaciński et  al. 2014, pp. 29–56; Vashanau et  al. 2020, pp. 89–110), and in the Baltic coastal area, in the settlement at Palanga and by Melnragė II (Table 6.4; cf. Chapter 5 of this book). These tools are from the same period as the pine tree habitat found on the former eroded Baltic coast (at a depth of 14 m in the investigated site RF-II) (Žulkus and Girininkas 2020), dated 5500–5000 BP. Therefore, it can be assumed that these tools are from the AT2 and SB1 periods (6000–4300 BP), when Late Mesolithic to Early Neolithic people lived on the currently eroded coast lying at a depth of 14 metres (see Chapter 3). Nowadays, these tools are washed up by the Baltic Sea in stormy weather.

Elk (Alces alces) Elk inhabited east Baltic territory and its coastal areas just after the melting of the last glacier (Paaver 1965, pp. 252– 253). They appeared in the southwest and southern parts of the Baltic region simultaneously (Krause 1937, pp. 48– 61; Krause and Kollau 1943, pp. 49–59; Bratlund 1999, pp. 47–59). In the Lithuanian coastal area, elk skeletal material and antlers have been found in the Šventoji 2/4, 1B 2B and 6 settlements (Girininkas and Daugnora, 2015, p. 105) (Table 4), and other settlements from the Neolithic period in the Baltic coastal area (Bērziņš 2008, pp. 470–473; Eriksson et al. 2003; Lõugas et al. 1996, pp. 399–420). One hammer adze made from an elk antler was detected in the Smeltalė settlement, dated to the turn of the Late Mesolithic and Early Neolithic periods, i.e. 6130±40 BP (Table 4). What were the conditions for elk to survive? This is shown partly by the analysis of elk teeth. After a review of elk teeth found at the 23rd Šventoji settlement, it was noticed that part of the tooth crowns had crumbled (Rimantienė 2005, p. 440). Such crumbling of elk teeth was also found in the Donkalnis burials from the Mesolithic period (Daugnora 2019, pp. 365–369). This can be related to mechanical damage to the teeth while manufacturing pendants or amulets, or their long-term lying in the ground. Some damage could have occurred while the animal was alive. Anterior teeth with cracks or crumbling are found more frequently in areas where animals receive an insufficient amount of minerals with their food. Scientific research carried out for years in North America and Europe showed the significance of micro- and macroelements contained in animals’ food for their metabolism (Underwood 1971; 1977; Underwood, Suttle 1999). While analysing macro- and micro-elements, it was determined that their concentration depends on natural meadows, the composition of the food, the level of abrasion of the tooth surface, and the geochemical composition of the soil. Such conditions could have existed in the Šventoji coastal area and the Biržulis lakeshore in the Mesolithic– Late Neolithic period. It has been established that there 108

 Osteological Material and the Natural Environment on the Baltic Coast: the Middle Pleistocene to the Middle Holocene Seals (Phocidae)

Having studied the seal bones found in the Lithuanian coastal area, and in the Šventoji and Palanga Neolithic settlements, many types of seals and harbour porpoises have been identified: harbour seals (Phoca vitulina), ringed seals (Phoca hispida), grey seals (Halychoerus grypus), harp seals (Pagophylus groenlandicus) and harbour porpoises (Phocoena phocoena) were hunted by Late Neolithic communities in the Lithuanian coastal area and used for economic needs and jewellery (Girininkas 2011b; Girininkas and Daugnora, 2015, p. 106) (Table 6.4, 6.5; Fig. 6.15).

Seals (Phocidae) and harbour porpoises (Phocoena phocoena) hunted on the east Baltic coast played an important role during the Middle Neolithic period. The bones of these mammals have been found in almost all coastal settlements of the east and southeast Baltic, and in settlements adjacent to rivers flowing into the sea since the Mesolithic period (Sommer and Benecke 2003, pp. 16–28; Lasota-Moskalewska 1997, pp. 162–167; Lõugas 1997; 2006; Bērziņš 2008, pp. 353–358, 408; Ukkonen et al. 2014, p. 1697, Ahlgren et al. 2022). The appearance of the seal (Phocidae) population in the Baltic Sea, and its subsistence during the Holocene period, was influenced by natural and geological changes. They included the changes in fresh and saline water, and the temporary, limited possibilities (during the Baltic Ice Lake and Ancylus Lake periods) for marine species of animals to migrate from the Atlantic Ocean to the basin of the Baltic Sea. Ringed seals (Phosa hispida) migrated to the Baltic Sea during the Yoldia Sea period when the water became brackish in some places (Schmölcke 2008; 2013). Later, their migration developed at the end of the Littorina Sea maximum 1 period, when in around 6200 cal. BC, a severe cooling of the weather occurred (Wiersma et al. 2006, pp 831–849). When the salinity of the Baltic Sea increased in the Middle Holocene, the population of harp seals (Phoca groenlandica) grew as well (Glykou 2013, pp. 101–111; Glykou et al. 2021; Emeis et al. 2003, pp. 411–421). This type of seal was also found during the final period of the existence of the Palanga settlement (Paaver 1958, p. 2, Tab. 1, in Kuncienė 1958) (Table 6.5, Fig. 6.14). Harp seals have been detected in Mesolithic and Neolithic settlements on the shores of the east Baltic Sea in Estonia (Lõugas 1997; Storå and Lõugas 2005; Luik 2013), and in Mesolithic and Neolithic settlements in Gotland (Lindqvist and Possnert 1997; 1999).

The populations of seals appeared in the Baltic Sea at the end of the existence of the Yoldia Sea. These were ringed seals (Phoca hispida), and slightly later, at the turn of the Ancylus Lake and Littorina Sea periods, grey seals (Halichoerus gryphus). Harp seals (Phoca groenlandica) appeared when the Baltic Sea became saline, at the beginning of the Littorina Sea. Harbour seals (Phoca vitulina) as well as harp seals, spread during the Littorina Sea period. Harp seals were recorded in the Palanga and Šventoji 1B, 3B and 2/4 B settlements (Fig. 6.16), and dated ones are only from the Palanga and Šventoji 2/4 B settlements in the Lithuanian coastal area. These dates are 4370±220 BP (3535–3559 cal BC) (Vs2648) (Palanga) – 4549±43 (3487–3099) (Ua 50227) (Šventoji 2/4) in the Middle Neolithic period, i.e. the first period with the appearance of harp seals in the Baltic Sea (Fig. 6.17). The importance of seals in the economic activities and the spiritual life of east Baltic coastal area communities is illustrated by the pendants found in the Šventoji 2/4 B, 6 settlements made from the teeth of seals (Rimantienė 2005, pp. 305, 38), and the figure of a seal made from pine bark found in the Silinupė settlement (Latvia) (Zagorska 2000, p. 282).

Table 6.5 Species and numbers of seals found in the Šventoji and Palanga settlements. Material analysed by L. Daugnora Species/Site

Šv. 4/2 site

Šv. 1B site

Šv. 3B site

Šv.26

Palanga

Common seal (Phoca vitulina)

5

1/1

2

–

–

Ringed seal (Phoca hispida)

2

2

4

–

–

Grey seal (Halichoerus grypus)

3

1/1

3

6

–

Harp seal Phoca groenlandica)

12

1/1

12

–

4/2*

Harbour porpoise (Phocoena phocoena)

1/1

–

3

–

–

Unspec.

22

22

53

11

–

Total

45

27

77

17

4

* The composition of species of seal bones found in the Palanga settlement was identified by K. Paaver in 1958. One of three bones in the Kretinga museum was dated by the authors of the article in 2015 (Vs-2648) (Table 4).

Figure 6.14. The time interval in which the T-shaped axes were spread in East Baltic region, according to the authors.

109

Linas Daugnora and Algirdas Girininkas

Figure 6.15. The bone artefacts made of parts of the seal’s skeleton in the Šventoji 2/4 and Šventoji 6 sites: 1–5 – fur scrapers, 6–15 – pendants from seal teeth, according to R. Rimantienė (2005).

and another was stabbed through the shoulder twice. The first stab on the shoulder was unsuccessful: the animal survived and escaped with an injury. Osseous tissue covered the site of the stab. It is likely that the other time the stab with a harpoon or arrowhead was closer to the heart, and the hunter killed the seal (Fig. 6.18). These investigations of bone enabled some features of seal hunting to be determined. Broken parts of harpoons were frequently found with the bones of seals. Parts were found in the Šventoji 2/4 B and Šventoji 3 settlements, and bone harpoons that had separated from the handle were found in the Šventoji 3 settlement (Fig. 6.19). Different tools were made from the bones of seals (Rimantienė 2005, p. 305; Osipowicz 2020, pp. 27–40). Seals could have been hunted by other means, not necessarily with harpoons. It is known from ethnological data that the Inuit people

Figure 6.16. A harp seal (Phoca groenlandica Erxleben, 1777) baculum (os penis) from the settlement of Šventoji 2/4. Photograph by L. Daugnora

Traces of seal hunting in Lithuanian coastal settlements Traces of stabs made with harpoons stayed in animals: one skull of a seal from the Šventoji 2/4 B settlement was pierced through the eyes (Rimantienė 2005, p. 61),

Figure 6.17. The appearance of seals in the Baltic Sea. Harp seals at Lithuanian coastal settlements. Drawing by A. Girininkas

110

 Osteological Material and the Natural Environment on the Baltic Coast: the Middle Pleistocene to the Middle Holocene

Figure 6.18. The regeneration process after a stab in the seal’s shoulder. Traces of the stab made with a spear. 1. The seal bone regeneration after injury. 2. The bone tissue regeneration. 3. The puncture hole. Photograph by T. Rimkus

(of North America) use bows and arrows for seal hunting (Henshaw 2000). Seal meat, and especially fat (which comprises 40% to 50% of the weight of a live seal) and blood, which contains a high amount of albumen, is useful and necessary for humans in winter. Grey seal pups weaned from their mother weigh 47 kilograms, 34 kilograms of which consist of skin and fat. Seal skin was widely used for footwear, their fur was used for clothing, roofing and tent coverings, their fat was used for lighting, etc. Ringed and grey seals were hunted at the end of the winter and in the spring, when they migrated south from their winter habitat to give birth. Harp seals were hunted in the late autumn and at the beginning of winter (Art 1988, p. 13; Kriiska and Lõugas 1999, pp. 157–172). Parts of seal skeletons have also been found in eastern Baltic continental settlements: Zvejnieki, Abora I, Sārnate (Latvia) and Valma (Estonia) (Zagorska 2000, pp. 279–283; Kriiska 2000, p. 157; Loze 1979, p. 128; Bērziņš 2008, p. 472). In the whole Baltic Sea region, seal bones comprise up to a third of all detected bones among the osteological material from the coastal settlements from the end of the Atlantis and the beginning of the Pre-Boreal periods (Glykou 2013, p. 104, Fig. 2; Luik 2013, p. 75), and in the Middle Neolithic Šventoji settlements they even comprise more than half (Girininkas and Daugnora 2015, p. 105). Traces of the slaughter of seals on their skeletons in all of the Middle Neolithic coast settlements of Lithuania are found (Fig. 6.20; 6.21). As previously mentioned, seals were in great demand both by local people and for exchange with communities that lived in continental areas. Therefore, seal hunting in Lithuanian coastal settlements had a great impact on their slower development of animal husbandry, because fishing and seal hunting met the nutritional needs of the local

Figure 6.19. Harpoons which are intended for seal hunting: 1–2 – Šventoji 3 site; 3 – Neustadt, according to Rimantienė (2005) and Glykou (2013)

111

Linas Daugnora and Algirdas Girininkas

Figure 6.20. Phoca vitulina cranium part of the pars basilaris ossis ocipitalis (1) with cut marks (2). Photograph by L. Daugnora

Dog (Canis familiaris) Dogs assisted hunters in Neolithic Baltic coastal settlements. The bones of dogs, and pendants made from their bones, have been found in small quantities, but in almost all settlements from the Middle Neolithic period (Rimantienė 2005, p. 440). The number of dog bones reaches 5.3% in some settlements (Table 6.6). A similar amount of dog bones, especially teeth, was detected in material from a similar period in neighbouring countries, such as the Zvejnieki burial site in western Latvia (Lõugas 2006, p. 86, Fig. 8), and the Dudka settlement (northeast Poland) (Gumiński 2011). Table 6.6. The number of dogs (Canis familiaris) found in Middle and Late Neolithic settlements in the Lithuanian coastal area (14C data in Table 6.4). Material analysed by L. Daugnora

Figure 6.21. Seal cranium after slaughter, the cribriform plate. Part of the ethmoid bone, which has a low density and is spongy, visible deep grooves supporting the olfactory bulb. Photograph by G. Slah

communities, and the profitable foraging economy did not encourage the development of stockbreeding and farming. Residents received the first domestic animals in exchange for seal fat, amber and other products (Girininkas and Daugnora 2015, p. 254).

112

No

Sites

Number of fragments (Canis familiaris) /MNI

1

Šventoji 2/4 B

5/2

4.0

2

Šventoji 26

1/1

1.78

3

Šventoji 6

19/3

5.3

4

Šventoji 23

13/5

4.05

5

Šventoji 1B

8/3

8.7

% of all bone fragments

 Osteological Material and the Natural Environment on the Baltic Coast: the Middle Pleistocene to the Middle Holocene Fish (Pisces) The people of the Neolithic period caught not only freshwater fish but also marine fish in the Lithuanian coastal area. The composition of species in the Middle Neolithic period is best revealed by ichthyological fauna research in the Šventoji 2/4B settlement (Table 6.7), which shows that most fish caught were from bodies of freshwater. The fish are quite large. This means that bigger, already mature fish were caught for food. Absolute lengths of fish in the Middle Neolithic period are quite similar, mainly from between 40 and 50 to between 70 and 80 centimetres (about 85% of the fish) (Fig. 6.22; 6.23). However, the length of the fish differs according to their absolute length when comparing different fish families (Cyprinidae and Percidae). In the Middle Neolithic, most fish were from

Figure 6.22. The average growth rate of pike (Esox lucius) per year at the Šventoji 2/4 site. Drawing by L. Daugnora

Table 6.7. The species analysis of fishbones excavated at the Šventoji 2/4 settlement (according to Daugnora and Hufthammer 1999; Daugnora and Girininkas 2004, 95–96; and the material analysed by L. Daugnora and D. Norkus). The Šventoji 2/4 settlement fishbones are dated (Tua-2076) 4875±65 BP), and the top layer of top, where the collection of fishbones was dated to (Tua-13523a) 4545±80 BP (5466– 4961 cal BP; 3517–3012 cal BC) (Table 4), the bottom layer of bottom was date to (Tua-13523) 4930±55 (5885–5582 cal BP; 3936–3633 cal BC) Fish species Šventoji 2/4B site

%

Fresh water Northern Pike (Esox lucius) Minnows (Cyprinidae) Rudd (Scardinius erythrophthalmus) Tench (Tinca tinca) 71

Bream (Abramis brama) Burbot (Lota lota) Perch (Perca fluviatilis) Wels (Silurus glanis)

Figure 6.23. The average growth rate of the perch family (Percidae) in different periods. Drawing by L. Daugnora

Pike-perch (Stizostedion lucioperca) Migrating Eel (Anguilla anguilla)

the Cyprinidae/carp family. Most (about 88%) were 20 to 40 centimetres. At that time, the number of fish from the pike family longer than 100 centimetres was about 22% of the total number. The largest fish of the pike family, a pike, was 152 centimetres in length, according to the measurements of the fishbones.

12

Salmonids (Salmo sp.) Eršketas  (Acipenser) Marine Brill (Scophthalmus rhrombus) Atlantic cod (Gadus morhua) Flounder family (Pleuronectidae)

The most frequently caught fish were pike, pike-perch, perch, carp, and less frequently large sturgeon; the head plates of the latter were used to make zoomorphic and anthropomorphic figures by Middle Palaeolithic people from Zvejnieki (Latvia) (Zagorskis 2004, p. 143, Fig. XXVIII: 1, 2, 4), which were found at a burial site from the Middle Neolithic period (5090±55 BP, Ua-19809). Based

17

Plaice (Pleuronectes platessa) Whitefish (Coregonus lavaretus lavaretus) Saithe (Pollachius virens)

113

Linas Daugnora and Algirdas Girininkas on data from Middle Neolithic ichthyofauna research at Šventoji, it can be said that the communities residing there obviously went to sea to fish. Fish caught at sea comprised around 17% of the communities’ nutrition ratio (Table 6.7). The lengths of Scophthalmidae family fish ranging from 30 to 40 centimetres confirms that fishing was conducted at sea. These were already mature fish, which could have been caught near the coast during spawning at a depth of four to 30 metres, in May or June (Stankus 2001, pp. 36–42). This confirms the fact that they cannot have been caught from the ice when the edges of the sea froze, because fish of the Scophthalmidae family were not present in coastal waters at that time. Therefore, the depths that this fish inhabited could have been reached only by seagoing boats or dugout canoes that were suitable for fishing at such a depth. Thus, the communities that lived in the Šventoji micro-region had this means of transport. It is also shown by Late Mesolithic to Early Neolithic water transport, a dugout canoe of up to 12 metres carved out of a log, which could be used for coastal sailing at sea in south Baltic coastal areas (Klooss and Lübke 2009, pp. 97–105). In addition, some dugout canoes and a piece of one were found in the Šventoji 2B settlement (Rimantienė 2005, p. 79), and dugout canoes of up to eight metres in length were found at the Sarnate K settlement and around Lake Semba (Vankina 1970, pp. 90, 92, Fig.44; Bērziņš 2000, p. 31; 2008, pp. 352–353). Propulsive and pushoff oars were found together with the dugout canoes (Rimantienė 2005, pp. 83, 3, Fig. 9: 1–6). The Latvian archaeologist V. Bērziņš believes that the Baltic Sea was not yet crossed in the summer, but when the edges of the sea froze in winter during the Sub-Boreal period, it was possible to reach Gotland (Bērziņš, 2008, p. 353). The Gadidae fish family and Coregonus lavaretus, which were caught at sea, have also been detected in Swedish Middle Neolithic western Baltic coastal settlements (Olson 2008, p. 9). This shows that different communities living around the Baltic Sea during the Middle Neolithic period already went to fish at sea, using carved dugout canoes with wings. In the opinion of D. Makowiecki, in the Middle and Late Neolithic periods, fishing in marine coastal areas was more important than to settlements next to rivers and lakes in the continental part (Makowiecki, 2003). Research on fishing in those times in Poland shows that fishing changed depending on the environmental conditions, the type of settlement (permanent or temporary), and the fish fauna in local bodies of water.

herring, were caught in coastal settlements in eastern Sweden (Olson 2008, p. 25, Table 4), and several bones of were detected at the Šventoji 23 settlement. Large fish from the cod and flounder families show that they could have been caught further from the coast, and the smaller ones show that they could have been caught in shallow waters. However, during spawning, fish tend to stay closer to the shore (Stankus 2001; Hart and Reynolds 2002; Olson 2008). People already knew the spawning times of certain fish in the Middle and Late Neolithic periods. Therefore, the fishing period frequently coincided with the spawning period (Daugnora and Girininkas 2004). The factor of the size of the fish was very important for the nutrition of communities living on the Baltic coast. Fish growth is not limited, as they grow all their life. The pace of growth is influenced by many factors, both biotic and abiotic (Smith et al. 2007). Biotic factors include the size of a nutritional object, its quality and availability, the condition of the fish itself (stress, the period of spawning), and competition with others. Abiotic factors are the quality of the water, the water temperature and its salinity, and also tides, their duration and scope. The greatest speed of fish growth,2 due to osmoregulation and energy necessary to maintain that regulation, occurs in brackish water. Research also shows that the optimal temperature for fish growth increases with the increase in the length of their body (Katzenmeyer 2010). In analysing the absolute lengths of fish of the Percidae family, it can be seen that their length is from between 40 and 50 centimetres to between 70 and 80 centimetres, and in the total collection they amount to 85% to 91% (Table 6.8). According to the ichthyological data collected, the largest fish belonging to the Percidae fish family was a pike-perch (its length was about 111 cm) in the Middle Neolithic period. The largest minnow family fish caught in the Middle Neolithic period was 64 centimetres in length, and the largest length of fish of the pike family (Esocidae) was 152 centimetres (the results of fishbone measurements). However, the amount of other fish families (Percidae and Carp, Cyprinidae) is very different according to their absolute lengths. In Middle Neolithic period settlements, fish of the pike (Esocidae) family larger than 100 centimetres comprised only 9% of the total amount of fish. Fish of the Siluridae family measured at the Šventoji 2/4 settlement were longer than 100 centimetres, the largest amount of marine fish were from the Scophthalmidae family, the absolute length of which was between 30 and 40 centimetres (Table 6.8). The absolute lengths of fish of the Percidae family range in similar intervals from between 40 and 50 centimetres to between 70 and 80 centimetres, and they comprised about 19% of the total amount of the fish measured.

Fishing customs changed slightly in the Late Neolithic period. Comparing fish in terms of quantity and species in the Middle and Late Neolithic periods, it is noticeable that the amount of fish caught at sea, as well as the number of pike, wels and bream caught in freshwater bodies that were bigger and longer (and heavier) compared to the Middle Neolithic period, increased slightly (Fig. 6.23). This is obvious from palaeoichthyological material from the Šventoji 6 settlement (Duoba and Daugnora 1994, pp. 24–28). The amount of Atlantic cod and brill also increased. This is possibly related to more frequent fishing at sea. In this period, more marine fish, especially Atlantic

Osmosis occurs in water when the pressure difference is present, and the regulation of osmosis in fish is related to the internal liquids of the fish. 2 

114

 Osteological Material and the Natural Environment on the Baltic Coast: the Middle Pleistocene to the Middle Holocene habitats, and more specific requirements. However, small fishbones are rare, despite the fact that soil washing is used during archaeological research, since the survival of bones depends on their size. In addition, as a consequence, the number of vertebrae, as well as the process of ossification and taphonomic survival possibility, is very different for different species (Lam and Pearson, 2005). For example, the bones of Salmonidae fish, eels, are weakly osseous, since they are fattier; therefore, they disintegrate faster compared to the osseous formations of other fish groups before sedimentation occurs. In addition, establishing the composition of species, and the possibilities for their survival in settlements of the Šventoji micro-region, is complicated, due to the peculiarities of the fish dissection process, their boiling, the peculiarities of chemical and biological disintegration, and the fact that dogs were fed with fish remains, as in continental settlements adjacent to larger bodies of water (Erikson et al. 2003, pp. 1–25).

Table 6.8. Absolute lengths of different fish families found in the Šventoji 2/4 settlement according to the measurements of fishbones (D. Norkus, unpublished data) Lengths

Siluridae

Gadidae

Scophthalmidae

20–30

0

0

9

30–40

0

1

19

40–50

0

2

9

50–60

0

1

3

60–70

0

2

0

70–80

0

1

0

80–90

0

1

0

90–100

0

0

0

>100

24

0

0

The measurements of fishbones are partly relative, as it is difficult to find out whether the remains of fish at the Šventoji 2/4 settlement are from the environment of those times, or whether they are foreign, brought in from other sources. Several problems are encountered here. Firstly, the number of species found at the Šventoji 2/4 settlement does not reflect the structure of the fish population of those times. Also, an important factor in analysing the composition of fish species is human selectivity for specific fish species. Another significant aspect of palaeoichthyology is that species important for this type of research are those that are adapted to live in certain biotic and abiotic environmental conditions (Lam and Pearson 2005; Schmölcke and Richie 2010). As a rule of thumb, small species of fish are important indicators, as they have a smaller range of

It is worth quoting several rare examples in the fish collections of the Šventoji 2/4 settlement. A cut was detected in the middle part of a pike dental bone at the Šventoji 2/4 settlement (Fig. 6.24). Such dissected fish were found in other regions and archaeological fish collections (Willis and Boehm 2014; Willis et  al. 2008; Rimkus 2019). In the collections of fish from this settlement, separate deformed vertebrae were detected, which are similar to the ones detected in coyote scat (the coyote scat of Harney Lake) and fish vertebrae coprolite specimens found in human faeces from the Hidden Cave (HC-44914, western Nevada) (Butler and Schroder 1998, Fig. 4). Research into this material is closely related to the impact of acids of the digestive tract (the stomach and bowels) on fish vertebrae, and shows the asymmetry that occurs

Figure 6.24. A cut mark in the middle part of the dental bone of the pike (Esox lucius) found at the settlement of Šventoji 2/4. Photograph by G. Slah

115

Linas Daugnora and Algirdas Girininkas

Figure 6.25. Coalescence/fusion of two neighbouring fish caudal vertebrae of pleuronectiformes. Photograph by G. Slah

after the impact of acids. A rare  fusion of neighbouring vertebrae of two percidae fish vertebrae was found at the Šventoji 2/4 settlement: it is an unusual and rare case in ichthyological/archaeological fish collections (Fig. 6.25). Such a fusion of neighbouring vertebrae is also found in modern fish bone studies (Jawad et  al. 2015, Golubtsov et al. 2021).

Very informative and abundant material on bird bones was collected in the research on the coastal Middle Neolithic Šventoji 2/4 settlement (Daugnora et  al. 2002, pp. 233– 238). In this Middle Neolithic settlement, the variety of the Anas platyrhynchos L., Anas clypeata and Aythya fuligula populations stands out. Bones belong to as many as 16 species of birds. A variety of species of bird similar to the Šventoji 2/4 settlement has been observed in the Baltic coastal Middle Neolithic settlements of Sarnate (Latvia), Dudka (northeast Poland) where the Eurasian jay (Garrulus glandarius L.) was extensively hunted (Bērziņš 2008, p. 366; Gumiński 2005, pp. 111–147; Mannermaa 2013, pp.189–205).

Birds (Aves) Hunting large amounts of birds had a great influence on the subsistence economy of people in the Baltic coastal area. The coastal area was an exceptional natural and economic micro-region in the Middle and Late Palaeolithic periods. The composition of species of birds in the Baltic coastal area was more varied than in the continental area, as it had the main migration route of birds in the spring and autumn. The population of migrating and wintering birds in the southeast part of the Baltic and other places includes a very wide variety of groups and ecotypes. It is thought that wintering aquatic birds are especially vulnerable to different changes in winter conditions, not only during the period discussed, but also nowadays.

6.6. Conclusions The Lithuanian coastal area osteological material presented here is from two different climatic periods: the Middle and Late Pleistocene, and the Early and Middle Holocene. The latest radiocarbon research on fauna detected belonging to the period from 50,000 to 25,000/24,000 (MIS-3) shows that conditions were favourable for people to live in the steppe tundra environment on the Lithuanian coast. Having carried out the radiocarbon analysis of woolly rhinoceros, mammoth, wild horse and reindeer skeletal material found in Lithuania in recent years (Table 6.2; cf. Chapter 2 of this book), it was established that

One of the main chains of nutrition in the Baltic Sea was water birds feeding on bivalve molluscs. More than 80% of Baltic Sea water birds fed on bivalve molluscs (Durinck et al. 1994). 116

 Osteological Material and the Natural Environment on the Baltic Coast: the Middle Pleistocene to the Middle Holocene the aforementioned fauna lived in Lithuania more than 25,000 years ago, before the last glaciation. The natural conditions, although harsh (Table 6.1), enabled humans to live and subsist. This is confirmed by a Lyngby-type tool made of reindeer antler, found in the Klaipėda district, belonging to the period (Girininkas et al. 2017, pp. 4–23) with trasological traces (albeit slight) of its use for work.

(Rutilus rutilus), tench (Tinca tinca), and other species, were caught in the freshwater bodies of the coastal area, especially during spawning. Communities living in the Baltic coastal areas caught the following species of migratory fish: eel (Anguilla anguilla), salmon (Salmo sp., S. trutta, S. salar), and twait shad (Alosa fallax. Marine species of fish were caught from the Middle Neolithic period. They comprised around 17% of all detected fishbones. The communities that lived in the Middle and Late Neolithic periods caught Atlantic cod (Gadus morhua), flounder (Pleuronectidae), brill (Scophthalmus rhrombus), saithe (Pollachius virens), and Atlantic herring (Clupea harengus) (Table 6.7). According to fishbone measurements (Table 6.8), mature fish of longer lengths were caught most for food.

During the Late Palaeolithic period (GI-1a, b, c, d, e and GS-1), having arrived in areas of land freed from the glacier, people had to adapt to the environmental conditions flexibly, and to seize the opportunities to survive provided by nature. It was determined by radiocarbon testing that by then mammoths did not live next to the Baltic Ice Lake. The main source of nutrition for communities was hunting reindeer. This is confirmed by the osteological material from that time (cf. Chapter 2 of this book).

Different types of bird bones were found in Middle Holocene Lithuanian coastal settlements. Most bones belonged to water birds: mallards (Anas platyrhynchos), great crested grebes (Podiceps cristatus), and redthroated divers (Gavia stellata). The bones of white storks (Ciconia ciconia), cranes (Grus grus) and strigiformes were also detected. Very informative and abundant bird bone material was collected in the analysis of the coastal Šventoji 2/4 settlements (Daugnora et al. 2002, pp. 233– 238). The bones belonged to birds of 16 species. The variety of the Anatidae bird population stands out. An important source of Late Neolithic period human nutrition was birds, which were hunted at the end of the summer and the beginning of the autumn. It is thought that most birds (Anatidae, Gruidae, Ciconiidae and Gaviidae) during the Late Neolithic period were hunted for food, and owls and birds of prey were hunted for rituals.

In the Early to Middle Holocene, changes to the Baltic Sea coast occurred due to fluctuations in the water level, and the natural environment and fauna inhabiting the Lithuanian coastal area changed. Red deer, elk and aurochs bred in the pine forests of the coastal area. The Boreal forests of the Lithuanian coastal area were favoured by red deer, which were hunted the most. Their antlers and bones were used for making tools. This is reflected in the manufacture of osseous and corneous tools found in the Palanga and Smeltalė settlements (Table 6.4). The latest osteological research shows that all species of seal known in the Holocene period lived and bred in the Baltic Sea during the Middle Mesolithic period in the Lithuanian coastal zone: harbour seals (Phoca vitulina), ringed seals (Phoca hispida), grey seals (Halychorerus grypus), harp seals (Pagophylus groenlandicus) and harbour porpoises (Phocoena phocoena). The seal population increased significantly during the formation of the Littorina Sea, when the salinity of the water increased. During that period, at 3500–3100 cal BC, and especially during the Middle Neolithic, the number of harp seals rose. These species of seal were detected in research of the Šventoji and Palanga settlements. Seal bones comprised 30% to 40% of the total number of bones found in these settlements respectively. The research data shows that seal skin, fat and meat were also in high demand among communities that lived further from the sea. Seal hunting had an impact on the slower development of animal husbandry in Lithuanian coastal settlements, because fishing and seal hunting fully met the nutritional needs of the communities, and the profitable appropriation economy and amber raw material from the shores of the Baltic Sea did not encourage the development of a production economy.

Acknowledgments We would like to thank anthropologists Prof. Timothy Bromage, Prof. Anne Karin Hufthammer, archaeologist Dr. Gvidas Slah, biologists Deividas Norkus, Tomas Pocius, Dr. Simona Tučkutė, N. V. Martynovich, and V. E. Sukhov for fruitful cooperation. References Aaris-Sørensen, K., Mühldorff, R., Petersen, E. B., 2007. The Scandinavian reindeer (Rangifer tarandus L.) after the last glacial maximum: time seasonality and human exploitation. Journal of Archaeological Science, 34, 914–923. Ahlgren, H., Bro-Jørgensen, M. H., Glykou, A., Schmölcke, U. Angerbjörn, A., Olsen, M. T. and Lidén, K. 2022. The Baltic grey seal: A 9000-year history of presence and absence. The Holocene, 1–9. DOI: 10.1177/09596836221080764.

During the whole Neolithic period, fishing was a significant branch of the economy, and a source of nutrition for communities in the Baltic coastal area. Climate change in the Middle Holocene did not have an impact on the composition of fish species. Various species of fish, northern pike (Esox lucius), wels (Silurus glanis), perch (Perca fluviatilis), minnow or carp (Ciprinidae), roach

Andrén, T., Björck, S., Andrén, E., Conley, D., Zillén, L., Anjar, J., 2011. The Development of the Baltic Sea Basin During the Last 130 ka. In: J. Harff, S. Bjorck, P. Hoth, eds. The Baltic Sea Basin, 75–97. BerlinHeidelberg: Springer-Verlag. 117

Linas Daugnora and Algirdas Girininkas Arppe, L., Aaris-Sørensen, K., Daugnora, L., Lõugas, L., Wojtal, P., Zupins, I., 2011. The palaeoenvironmental δ13C record in European woolly mammoth tooth enamel. Quaternary International, 245, 285–290.

Durinck, J., Skov, H., Jensen, F. P., Pihl, S., 1994. Important Marine Areas for Wintering Birds in the Baltic Sea. EU DG XI research contract no. 2242/90-09-01. Harvard: Ornis Consult report.

Arppe, L., Karhu, J. A., 2010. Oxygen isotope values of precipitation and the thermal climate in Europe during the middle to late Weichselian ice age. Quaternary Science Reviews, 29, 1263–1275.

Emeis, K.-C., Struck, U., Blanz, T., Kohly, A., Voß, M., 2003. Salinity changes in the central Baltic Sea (NW Europe) over the last 10 000 years. The Holocene, April, 13, 411–421.

Art, E., 1988. Hülged ja hülgepüük. Hülgepüük. Hülgepüügi meenutusi möödunud aegadest, Stockholm, 5–15.

Engel, C., 1935. Vorgeschichte der altpreußischen Stämme. Königsberg.

Athanassiou, A., 2001. New data on the Equus stenonis Cocchi, 1867 from the late Pliocene locality of Sésklo (Thessaly, Greece). Geodiversitas, 23 (3), 439–469.

Emeis, K.-Ch., Struck, U., Blanz, T., Kohly, A., Voß, M., 2003. Salinity changes in the central Baltic Sea (NW Europe) over the last 10 000 years. The Holocene, April, 13, 411–421.

Bērziņš, V., 2000. The conditions for travel and transport in the Stone Age. Muinasaja teadus, 8, 27–48.

Eriksson, G., Lõugas, L., Zagorska, I. 2003. Stone Age hunter-fisher-gatherers at Zvejnieki, northern Latvia: radiocarbon, stable isotope and archaeozoology data. Before Farming, 2003/1, 1–25.

Bērziņš, V., 2008. Sārnate: living by a coastal lake during the East Baltic Neolithic. Faculty of Humanities, General Archaeology, University of Oulu, Oulu: Oulu University Press.

Girininkas, A., 2011a. Baltų kultūros ištakos, II. Klaipėda: Klaipėdos universiteto leidykla.

Borzenkova, I., Zorita, E., Borisova, O., Kalniņa, L., Kisielienė, D., Koff, T., Kuznetsov, D., Lemdahl, G., Sapelko, T., Stančikaitė, M., Subetto, D., 2015. Climate Change During the Holocene (Past 12,000 Years). The BACC II Author Team, Second Assessment of Climate Change for the Baltic Sea Basin, Regional Climate Studies, 25–49. DOI: 10.1007/978-3-319-16006-1_2.

Girininkas, A., 2011b. New data on Palanga Stone Age settlement. Archaeologia Baltica, 16, 48–57. DOI: 10.15181/ab.v16i0.33 Girininkas, A. and Daugnora, L., 2015. Ūkis ir visuomenė Lietuvos priešistorėje, T. 1. Klaipėda: Klaipėdos universiteto leidykla.

Bratlund, B., 1999. A survey of the ahrensburgian faunal assemblage of Stellmoor. Tanged points, Lublin, 47–59.

Girininkas, A., Rimkus, T., Slah, G., Daugnora, L., Stančikaitė, M., Zabiela, G., 2016. Lithuanian’s Lyngby type articles in the context of Nordic Europe Stone Age:  Multidisciplinary Study. Arheoloģija un etnogrāfija, XXIX, 13–30.

Bronk Ramsey, C., 2009. Bayesian analysis of radiocarbon dates.  Radiocarbon, 51(1), 337–360.  https://doi. org/10.1017/S0033822200033865 Daugnora, L., 2019. Donkalnio ir Spigino kapinynuose rastų priekinių žvėrių dantų biotechnologiniai tyrimai. In: A. Butrimas, ed. Biržulis. Medžiotojai, žvejai ir senieji žemdirbiai X-II tūkstantmetyje pr. Kr. 1, Paminlų tyrinėjimai. Vilnius, 363–373.

Girininkas, A., Rimkus, T., Slah, G., Daugnora L., 2017. Liungbiu tipo dirbiniai Lietuvoje, Istorija, 105, 4–23. Girininkas, A., Žulkus, V., 2017. Baltijos jūros krantai ir žmonės ankstyvajame Holocene. Jūros ir krantų tyrimai, Klaipėda: Klaipėdos universitetas, 69–72.

Daugnora, L., 2000. Fish and seal osteological data at Šventoji sites. Lietuvos archeologija, 19, 85–101.

Glykou, A., 2013. Seal hunting at the Baltic Sea coast – A case study from the Late Mesolithic and earliest Neolithic Neustadt in Holstein, Germany. Old traditions and regional developments, continental sources and continental influences, Schriften des Archaologischen Landesmuseums Erganzungsreihe, 7, Neumünster, 101–111.

Daugnora, L., Bilskienė, R., Hufthammer, A., 2002. Bird remains from Neolithic and Bronze Age settlements in Lithuania. Acta zoologica cracoviensia, Ser. A, Vertebrata, 45 (special issue), Kraków, 233–238. Daugnora, L., Girininkas, A., 1996. Osteoarcheologija Lietuvoje: vidurinysis ir vėlyvasis holocenas, Vilnius: Savastis.

Glykou, A., Lõugas, L., Piličiauskienė, G., Schmölcke, U., Eriksson, G., Lidén, K. 2021. Reconstructing the ecological history of the extinct harp seal population of the Baltic Sea. Quaternary Science Reviews 251, 1–15. DOI: 10.1016/j.quascirev.2020.106701.

Daugnora, L., Girininkas, A., 2004. Rytų Pabaltijo bendruomenių gyvensena XI–II tūkst. pr. Kr., Kaunas: Lietuvos veterinarijos akademijos leidykla.

Golubtsov, A.S., Korostelev, N.B., Levin, B.A. 2021. Monsters with a shortened vertebral column: A population phenomenon in radiating fish Labeobarbus (Cyprinidae). Plos one 16(1), 1–27.

Duoba, D., Daugnora, L., 1994. Osteologinės medžiagos, rastos Šventosios 6-oje gyvenvietėje, tyrimų rezultatai. Lietuvos veterinarijos akademijos mokslo darbai, 22, 24–28.

118

 Osteological Material and the Natural Environment on the Baltic Coast: the Middle Pleistocene to the Middle Holocene Groß, H., 1939. Die bedeutung des renntierjägerfun-des von Bachmann, Kreis Memel. Altpreußen, 4 (3), 65–67.

atlasas. Vilnius: Lietuvos Geologijos Institutas.

Groß, H., 1940. Das renntier in der Ostpreußischen vorgeschichte. Altpreußen, 1, 1–4.

Geologijos

Tarnyba,

Kalm, V., Raukas, A., Rattas, M., Lasberg, K., 2011. Pleistocene Glaciations in Estonia. In: Ehlers, J., Gibbard, P. L., Hughes, P. D., eds. Quaternary Glaciations - Extent and Chronology - A Closer Look, 95−104. Amsterdam, The Netherlands: Elsevier.

Gumiński, W., 2005. Bird for Dinner. Stone Age hunters of Dudka and Szczepanki. Mazurian Lakeland, NEPoland. Acta Archaeologica, 76/2, 111–147.

Katzenmeyer, E. D., 2010. Fish growth responses to a changing environment: effects of aquatic nuisance species and environmental conditions in a shallow, eutrophic lake. Iowa State University, Graduate Theses and Dissertations. Paper 11827.

Gumiński, W., 2011. Nowewyjątkowe siedlisko osadnicze paraneolitycznej kultury Zedmar na wschodnim cyplu wyspy Szczepanki (sektor „A”) na Mazurach, Światowit, IX(l)/B, 87–144. Hansson, A., Boethius, A., Hammarlund, D., Lagerås, P., Magnell, O., Nilsson, B., Nilsson, A. B. and Rundgren M., 2019. Shoreline Displacement, Coastal Environments and Human Subsistence in the Hanö Bay Region during the Mesolithic. Quaternary, 2, 14. DOI: 10.3390/quat2010014

Kellner, M., 1968. Vergleichend morphologische Untersuchun an Einzelknochen des postkranialen Skeletts in Europa. Munchen: Vorkimender Ardeidae. Kendall MacKenzie, C. S., Clough, M. J., Broders, H. G., Tubrett, M., 2011. Chemical and structural composition of Atlantic Canadian moose (Alces alces) incisors with patterns of high breakage. Science of the Total Environment, 5483–5492.

Harder, W., 1976. Anatomy of fishes. Stuttgart: E. Schweizerbart’sche Verlagsbuchhandlung (Nägele u. Obermiller).

Klooss, S., Lübke, H., 2009. The Terminal Mesolithic and Early Neolithic Logboats of StralsundMischwasserspeicher. Evidence Of Early Waterborne Transport on the German Southern Baltic Coast. In: R. Bockius, ed. Between the Seas. Evidence of Early Waterborne Transport on the German Southern Baltic Coast. Transfer and Exchange in Nautical Technology Proceedings of the eleventh International Symposium on Boat and Ship Archaeology, Mainz 2006. ISBSA, 11, 97–105.

Hart, J. B., Reynolds, J. D., 2002. Handbook of Fish Biology and Fisheries, Fish Biology, 1: Fish and Fisheries. Malden, Oxford, Carlton: Wiley-Blackwell. Harvey, V. L., Daugnora, L., Buckley, M., 2018. Species identifikation of ancient Lithuanian fish remains using collagen fingerprinting. Journal of archaeological Science, 98, 102–111. Helmens, K. F., Engels, S., 2010. Ice-free conditions in eastern Fennoscandia during early Marine Isotope Stage 3: lacustrine records. Boreas, 39(2), 399–409.

Kozłowski, S. K., 1989. Mesolithic in Poland. A new Approach, Warszawa.

Henshaw, A. S., 2000. Central Inuit household economies: Zooarchaeological, environmental, and historical evidence from outer Frobisher Bay, Baffin Island, Canada. Hofman-British Archaeological Reports, International Series 871. Oxford: BAR Publishing.

Krause, W., 1937. Die eiszeitlichen Knochenfunde von Meiendorf. In: A. Rust, ed. Das altsteinzeitliche Rentierjägerlager Meiendorf, Neumünster: Karl Wachholtz Verlag, 48–61.

Jawad, L. A., AL-Faisal, A.J. and AL-Mukhtar, M. 2015. A case of vertebral coalescence in Luciobarbus xanthopterus (Pisce: Cyprinidae) obtained from the lower reaches of Mesopotamia. Travaux du Museum National d Histoire (Grigore Antipa) 57(2), 127–132.

Krause, W. and Kollau, W., 1943. Die steinzeitlichen Wirbeltierfaunen von Stellmoor in Holstein. In: A. Rust, ed. Die alt- und mittelsteinzeitlichen Funde von Stellmoor, Neumünster: Karl Wachholtz Verlag, 49–59. Kriiska, A., Lõugas, L., 1999. Late Mesolithic and Early Neolithic Seasonal Settlement at Kōpu, Hiiumaa Island, Estonia. Environmental and cultural history, Strasbourg, 157–172.

Kabaciński, J., 2009. Quarrying the antler adzes – a new Mesolithic site of the Boreal period at Krzyz Wielkopolski, western Poland. Quartär, 56, 119–130. Kabaciński, J., Sobkowiak-Tabaka, I., David, E., Osypińska, M., Terberger, T. and Winiarska-Kabacińska, M., 2014. The chronology of T-shaped axes in the Polish lowland. Sprawozdania archeologiczne, 66, 29–56.

Kriiska, A., 2000. Settlements of Coastal Estonia and Maritime Hunter-Gatherer Economy. Lietuvos archeologija, 19, 153–166.

Kabailienė, M., 2006. Gamtinės aplinkos raida Lietuvoje per 14000 metų, Vilnius: Vilniaus universiteto leidykla.

Kulikauskas, P., 1959. Naujai aptikta akmens-žalvario amžių gyvenvietė Palangoje. Lietuvos TSR Mokslų akademijos darbai, 2/7, 33–41.

Kadūnas, V., Budavičius, R., Gregorauskienė, V., Katinas, V., Brännvall, E., Radzevičius, A.,Taraškevičius, R.,Valiukevičius, J., 1999. Lietuvos geocheminis

Kuncienė, O., 1958. Palangos akmens amžiaus stovyklos tyrinėjimų dienoraštis 1958 m. rugpjūčio mėn. 19-31 d. Lietuvos istorijos instituto rankraštynas, Nr. 77.

119

Linas Daugnora and Algirdas Girininkas Lam, Y. M., and Pearson, O. M., 2005. Bone density studies and the interpretation of the faunal record. Evolutionary Anthropology: Issues, News, and Reviews, 14(3), 99–108.

Makowiecki, D., 2003. Historia ryb i rybołówstwa w holocenie na Niżu Polskim w świetle badań archeoichtiologicznych, Poznań. Makowiecki, D., Król, D., 1997. Bone and Antler Artefacts in the Rzucewo Settlement. In: D. Król, ed. The Built Environment of Coast Areas during the Stone Age. The Baltic Sea-Coast Landscapes Seminar. Gdańsk. Session 1, 167–173.

Lamsters, K., Kalinska-Nartiša, E., Zeles, V., Alexanderson, H., 2017. New luminescence ages reveal Early to Middle Weichselian deposits in Central Latvia. Geological Quarterly, 61 (2), 480–490. Lasberg, K., 2011. Pleistocene glaciations in Estonia. In: J. Ehlers, P. L. Gibbard, P. D. Hughes eds. Quaternary Glaciations – Extent and Chronology: A Closer Look. Amsterdam: Elsevier, 95–104.

Makowiecki, D., Wiejacka, M., Wiejacki, J., 2018. Gospodarka zwierzętami na podstawie źródel archeozoologicznych. In: D. Król, ed. Zespól osadniczy z epoki kamienia – Rzucewo, Gmina Puck, stanowisko 1 = Settlement complex from Stone Age – Rzucewo, community Puck, site 1. Gdańsk: Muzeum Archeologiczne, 218–238.

Lasota-Moskalewska, A., 1997. Animal remains from the Neolithic settlement at Rzucewo. In: D. Król, ed. The Built Environment of Coast Areas during the Stone Age. The Baltic Sea-Coast Landscapes Seminar, Session No. 1. Osrodek Dokumentacji Zabytków, Gdańsk, Warszawa, 162–166.

Mannermaa, K., 2002. Bird bones from Jettbole I, a site in the Neolithic Aland archipelago in the norther Baltic. Acta zoologica cracoviensia, 45 (special issue), 85–98.

Lepiksaar, J., 1983. Animal remains from the Mesolithic Bog Site at Agerod V in Central Scania. Acta archaeologica Lundensia, 12, 159–166.

Mannermaa, K., 2013. Powerful birds. The Eurasian jay (Garrulus glandarius) and the osprey (Pandion haliaetus) in hunter-gatherer burials at Zvejnieki, northern Latvia and Yuzhniy Oleniy Ostrov, northwestern Russia. Anthropozoologica, 48 (2), 189– 205.

Lindqvist, C. and Possnert, G., 1997. The subsistence economy and diet at Jakobs/Ajvide, Eksta Parish and other prehistoric dwelling and burial sites on Gotland in long-term perspective. In: Remote Sensing, vol. I. In: G. Burenhult, ed. Theses and Papers in North-European Archaeology 13:a, 29–90. Stockholm University.

Morales, A., Rosenlund, K., 1979. Fish bone measurements. An attempt to standartize the measuring of fish bones from archaeological sites. Copehagen: Strenstrupia.

Lindqvist, C. and Possnert, G., 1999. The First Seal Hunter Families on Gotland. On the Mesolithic Occupation in the Stora Förvar Cave. Current Swedish Archaeology, 7, 65–88.

Morales Muniz, A., 1993. Ornithoarchaeology: the variuos of the classification of bird remains from archaeological Archaeofauna. Archaeornithology: Birds and The Archaeotap cal Record. Proceedings of the First meeting of the ICAZ Working Group. Madrid, 2, 1–13.

Lubicz-Niezabitowski, E., 1928. Szczątki foki grenlandzkiej neolitycznej (Phoca [Phagophoca] groenlandica neolithica n.s.sp.) z polskiego wybrzeża Bałtyku, Rocznik Muzeum Wielkopolskiego, 4 (za 1926 r.), 44–99.

Mortensen, M. F., Olsen, J., Holm, J., Christensen, C., 2014. Right time, right place – dating the Havelte phase in Slotseng, Denmark. In: F. Riede, M. Tallaavaara, eds. Lateglacial and postglacial pioneers in northern Europe. BAR Publishing S2599. Oxford, 11–22.

Lubicz-Niezabitowski, E., 1929. Szczątki zwierzęce z osady neolitycznej w Rzucewie na polskim wybrzeżu Bałtyku. Przegląd Archeologiczny, 4, 64–81.

Olson, C., 2008. Neolithic Fisheries. Osteoarchaeology of Fish Remains in the Baltic Sea Region. Theses and Papers in Osteoarchaeology, No. 5, Osteoarchaeological Research Laboratory. Stockholm University.

Luik, H., 2013. Seals, Seal Hunting and Worked Seal Bones in the Estonian Coastal Region in the Neolithic and Bronze Age. In: A. Choyke, S. O’Connor, eds. From these Bare Bones. Raw materials and the study of worked osseons objects, 73–87.

Lõugas, L., 1997. Post-Glacial development of vertebrate fauna in Estonian water bodies. A palaeozoological study. Dissertationes Biologicae Universitatis Tartuensis, 32, Tartu.

Orłowska, J., and Osipowicz, G., 2021. Mesolithic bone adzes and mattock heads from Poland. Some suggestions on their technology and function. In: S. Beyries, C. Hamon and Y. Maigrot, eds. Beyond UseWear Traces: Going from tools to people by means of archaeological wear and residue analyses. Leiden: Sidestone Press, 143–154.

Lõugas, L., 2006. Animals as subsistence and bones as raw material for settlers of prehistoric Zvejnieki. In: L. Larsson., I. Zagorska, eds. Back to the origin, Stokholm, 75–89.

Osipowicz, G., 2020. Toward an Understanding the Role of Seals in the Subneolithic Communities of the SouthEast Coast of the Baltic Sea. The Bacula from Šventoji 3 Site. Archaeologia Lituana, 21, 27–40.

Loze, I., 1979. Pozdnii neolit i panniaia bronza Lubanskoi ravniny. Rīga: Zinātne.

120

 Osteological Material and the Natural Environment on the Baltic Coast: the Middle Pleistocene to the Middle Holocene Paaver, K., 1965. Formirovanie teriofauny i izmenchivost’ mlekopitaiushchikh Pribaltiki v golotsene. Tartu: Akademia Nayk Estonskoi SSR.

Schmölcke, U., 2008. Holocene environmental changes and the seal (Phocidae) fauna of the Baltic Sea: coming, going and staying. Mammal Review, 38, 231–246.

Reimer, P. J., Bard, E., Bayliss, A., Beck, J. W., Blackwell, P. G., Bronk Ramsey, C., Grootes, P. M., Guilderson, T. P., Haflidason, H., Hajdas, I., Hatte, C., Heaton, T. J., Hoffmann, D. L., Hogg, A. G., Hughen, K. A., Kaiser, K. F., Kromer, B., Manning, S. W., Niu, M., Reimer, R. W., Richards, D. A., Scott, E. M., Southon, J. R., Staff, R. A., Turney, C. S. M., van der Plicht, J., 2013. IntCal13 and Marine13 radiocarbon age calibration curves 0–50,000 years cal BP.  Radiocarbon, 55(4), 1869– 1887. https://doi.org/10.2458/azu_js_rc.55.16947

Schmölcke, U., 2013. A short history of seals and seal populations in Northern European waters. In: O. Grimm, U. Schmölcke, eds. Hunting in Northern Europe until 1500 AD. Old traditions and regional developments, continental sources and continental influences. Neumünster, 91–99. Schmölcke, U., and Ritchie, K., 2010. A new method in palaeoecology: fish community structure indicates environmental changes. International Journal of Earth Sciences, 99(8), 1763–1772.

Rimantienė, R., 2005. Akmens amžiaus žvejai prie Pajūrio lagūnos: Šventosios ir Būtingės tyrinėjimai. Vilnius: Lietuvos nacionalinis muziejus.

Serjeantson, D., 2009. Birds. Cambridge: Cambridge University Press, Cambridge Manuals in Archaeology. Simchenko, I. B., 1976. Kul‘tura okhotnikov na olenei Severnoi Evrazii. Моskva.

Rimkus, T., 2019. The Influence of the Microlithisation on the Economic Development in the Eastern Baltic Region Mesolithic. Technological and Functional Research. Summary of doctoral dissertation Humanities, History and Archaeology (H 005), Klaipėda.

Simmelink, J. W., 1994. Histology of enamel. In: Avery, J. K., ed. Oral Development and Histology. New York, 228–241.

Rimkus, T. and Girininkas, A., 2019. Tyrimai Aukštumalos akmens amžiaus gyvenvietėse bei jų aplinkoje. Archeologiniai tyrinėjimai Lietuvoje 2018 metais, 44–49.

Sloka, J., 1985. Akmens laikmeta zvejotās zivis Zvejnieku II apmetnē (8.-6 g. t. p. m. ē.), Latvijas Zinātņu Akadēmijas Vēstis, 7, 110–116.

Rimkus, T. and Girininkas, A., 2020. Tyrimai Aukštumalos akmens amžiaus gyvenvietėse. Archeologiniai tyrinėjimai Lietuvoje 2019 metais, 35–38.

Smith, M. A., Pegg, M. A., Iron, K. S., 2007. Analysis of Fish Age Structure and Growth in the Illinois River (No. TR-2007-T002). Illinois State water survey Peoria Center for water shed science, 1–55.

Rimkus, T. and Girininkas, A., 2021. The Final Palaeolithic in the coastal part of Lithuania with the technological emphasis on Aukštumala Stone Age sites. Archaeologia Baltica, 28, 102–117.

Sommer, R., Benecke, N., 2003. Post-Glacial history of the European seal fauna on the basis of sub-fossil records. Beiträge zur Archäologie und prähistorischen Anthropologie, 4, 16–28.

Rosentau, A., Bennike, O., Uscinowicz, S., MiotkSzpiganowicz, G., 2017. The Baltic Sea Basin. In: N.C. Flemming, J. Harff, D. Moura, A. Burgess, G. N. Bailey, eds. Submerged Landscapes of the European Continental Shelf: Quaternary Paleoenvironments, 103–134. Chichester: John Wiley & Sons.

Stankus, S., 2001. Uotų (Psetta maxima (L.)) reprodukcijos tyrimai Baltijos jūros Lietuvos ekonominėje zonoje. Ekologijos institutas, 1, 36–42. Storå, J., and Lõugas, L., 2005. Human Exploitation and History of Seals in the Baltic during Late Holocene. In: Monk, G., ed.. The Exploitation and Cultural Importance of Sea Mammals, 95–106.

Rust, A., 1937. Das altsteinzeitliche Rentierjägerlager Meiendorf. Neumünster. Rust, A., 1943. Die alt- und mittelsteinzeitlichen Funde von Stellmoor, Neumünster.

Struckmann, C., 1880. Ueber die Verbreitung des Renthiers in der gegenwart und in älterer Zeit nach Maassgabe seiner fossilen Reste unter besonderer Berücksichtigung der deutschen Fundorte. Zeitschrift der deutschen geologischen Gesellschaft, XXXII, 728– 773.

Rust, A., 1958. Die jungpaliiolithischen Zeltanlagen von. Ahrensburg. Neumünster: Offa- Bikher. Satkūnas, J., Grigienė, A., 2012. Eemian-Weichselian palaeoenvironmental record from the Mickūnai glacial depression (Eastern Lithuania). Geologija, 54, 2(78), 35–51.

Sturdy, D. A., 1975. Some Reindeer Economies in Prehistoric Europe. In: E. Sidney Higgs, ed. Palaeoeconomy: being the second volume of Papers in economic prehistory by members and associates of the British Academy Major Research Project in the Early History of Agriculture, Cambridge, 55–95.

Satkūnas, J., Girininkas, A., Rimkus, T., Daugnora, L., Grigiene, A., Skuratovič, Ž., Uogintas, D., Žulkus, V. 2022. New 14C data of megafaunal remains from the SE Baltic - implications for the palaeoenvironmental interpretation of the Middle Weichselian. Palaeogeography, Palaeoclimatology, Palaeoecology, in press.

Tercerie, S., Bearez, P., Pruvost, P., Bailly, N., VignesLebbe, R., Bled, L., Grosjean, S., Valderrama, I., Buenaventes, E. and Jacquez, K., 2015. Osteobase. 121

Linas Daugnora and Algirdas Girininkas Willis, L. M., Boehm, A. R., 2014. Fish bones, cut marks, and burial: implications for taphonomy and faunal analysis. Journal of Archaeological Science, 45, 20–25.

World Wide Web electronic publication. Accessed 2021.04.15: http://osteobase.mnhn.fr/ Ukkonen, P., Lõugas, L., Zagorska, I., Lukševica, L., Lukševics, E., Daugnora, L., Jungner, H., 2006. History of the reindeer (Rangifer tarandus) in the eastern Baltic region and its implications for the origin and immigration routes of the recent northern European wild reindeer populations. Boreas, 35, 222–230.

Wood, J. R., and De Petri, V. L., 2015. Next-generation paleornithology: Technological and methodological advances allow new insights into the evolutionary and ecological histories of living birds. The Auk, 132(2), 486–506. Zagorska, I., 2000. Sea mammal hunting strategy in the Eastern Baltic. Lietuvos archeologija, 19, 275–286.

Ukkonen, P., Aaris-Sørensen, K., Arppe, L., Daugnora, L., Halkka, A., Lõugas, L., Oinonen, M. J., Pilot, M., Storå, J., 2014. An Arctic seal in temperate waters: History of the ringed seal (Pusa hispida) in the Baltic Sea and its adaptation to the changing environment. The Holocene, 24(12), 1694–1706.

Zagorska, I., 2012. Senie ziemeļbriežu mednieki Latvijā. Rīga: Zinātne.

Underwood, E. J., 1977. Trace Elements in Animal and Human Nutrition. New York: Academic Press Incorporated USA.

Zagorska, I., Eriksen, B.V., Meadows, J., and Zelčs, V., 2019. Late Palaeolithic settlement of Latvia confirmed by radiocarbon dating of bone and antler artefacts. In: B. V. Eriksen, E. Rensink, and S. Harris eds. The Final Palaeolithic of northern Eurasia. Proceedings of the Amersfoort, Schleswig and Buegos UISPP commission meetings. Schriften des museums für archäologie Schloss Gottorf band 13. Schleswig: Ludwig, 343–362.

Underwood, E. J., Suttle, N. F., 1999. The Mineral Nutrition of Livestock. New York: CABI Publishing USA.

Zagorskis, F., 2004. Zvejnieki (Northern Latvia) Stone Age Cemetery. BAR International series, 1292, Oxford: BAR Publishing.

von den Driesch, A., 1976. A quide to the measurement of animal from archaeological sites. Harvard University Bull. 1.

Zalizniak, L. L., 1989. Okhotniki na severnogo olenia Ukrainskogo Poles‘ia epokhi final‘nogo paleolita. Kiev: Naukova Dumka.

Vankina, L. V., 1970. Torfianikovaia stoianka Sārnate. Rīga: Zinātne.

Zaliznjak, L., 1995. The Swidrian Reindeer-Hunters of Eastern Europe. Ser. Beiträge zur Ur- und Frühgeschichte Mitteleuropas, 5, Wilkau-Hasslau.

Underwood, E. J., 1971. Trace Elements in Animal and Human Nutrition. New York: Academic Press Incorporated USA.

Vashanau, A., Malyutina, A., Tkachova, M., Chernyavskiy, M., and Tkach, E., 2020. Early and Middle Holocene antler tools with holes from the gravel pits of the Smarhon area, north-western Belarus. Swiatowit, LIX, 89–110. DOI: 10.31338/0082-044X.swiatowit.59.1

Žulkus, V., Girininkas, A., 2012. Baltijos jūros krantai prieš 10  000 metų „Yoldia“. Klaipėda: Klaipėdos universiteto leidykla. Žulkus, V., Girininkas, A., 2014. Drowned Early Mesolithic landscapes on the Baltic Sea bed in the Lithuanian waters. Journal of Environmental Science and Engineering B, 3, N. 5, 274–289. David Publishing Company. DOI: 10.17265/2162-5263

Weber, C. A., 2016. Apie Aukštumalos aukštapelkės Nemuno deltoje augaliją ir vystymąsi lyginant su kitomis Žemės aukštapelkėmis. Vilnius: Lietuvos gamtos fondas.

Žulkus, V., Girininkas, A., 2020. The eastern shores of the Baltic Sea in the Early Holocene according to natural and cultural relict data. GEO: Geography and Environment, 7(1), 1–16. DOI: 10.1002/geo2.87

Weber, M.-J., 2013. Late Upper and Late Palaeolithic reindeer hunting in the Ahrensburg tunnelvalley – Differences between Hamburgian and Ahrensburgian hunting tactics. In: Grimm, O., Schmölcke, U., eds. Hunting in Northern Europe until 1500 AD. Old traditions and regional developments, continental sources and continental influences. Neumünster, 75–90. Wheeler, A., Jones, A. K. G., 1989. Fishes. Cambridge: Cambridge University Press. Wiersma, A. P., Renssen, H., Goosse, H., Fichefet, T., 2006. Evaluation of different freshwater forcing scenarios for the 8.2 ka BP event in a coupled climate model. Climate Dynamics, 27 (7), 831–849 DOI: 10.1007/s00382-0060166-0 Willis, L. M., Eren, M. I., Rick, T. C., 2008. Does butchering fish leave cut marks. Journal of Archaeological Science, 35, 1438–1444. 122

7 Molecular Studies of 11,000-Year-Old Scots Pine (Pinus sylvestris L.) Found on the Bed of the BALTIC Sea Jurata Buchovska: Institute of Forestry, Lithuanian Research Centre for Agriculture and Forestry, Kaunas. Darius Danusevičius: Faculty of Forest Science and Ecology, Agricultural Academy, Vytautas Magnus University. Abstract: We studied nine samples of fossil wood from tree stumps found on the seabed of the Baltic Sea at a depth of 15 to 30 metres, ca. 14 kilometres offshore. The age of the samples was ca. 11,000 years. The genetic associations between the marine wood and the present-day Scots pine populations were estimated based on DNA markers. A strict pollution avoidance protocol was followed in the laboratory. The wood taken from the seabed was kept in a sterile environment to prevent contamination. ATMAB was used as a DNA extraction protocol. A void control sample was used for contamination control with the nDNA locus (11 items) and mtDNA locus. DNA cleanliness and concentration were sufficient for the research at 18–41 ng/ml. PCR amplification provided reliable DNA fragments; only one dimension standard showing little possibility of contamination was present in the electrophoresis profiles. The research shows that saline sea water preserves ancient DNA in wood well. Keywords: Holocene, DNA, SSR, STS, Postglacial migration, Pine 7.1. Introduction

around 14,000 years BC, and has continued rising ever since, and thus the Holocene period started (Kvist 2000). Radiocarbon research into fossil pollen in Europe shows that during this period, from 14,000 to 12,000 BP, trees grew relatively fast in the north (Kvist 2000). Scots pine, a pioneering species, spread rapidly at a rate of about 150 kilometres to the north over a century, forming mostly forests of birch and pine (Huntley and Birks 1983; Huntley 1990). Scots pine was found on the east Baltic Sea coast around 13,000 years BC (Balakauskas 2013). It was most widespread in Europe at around 9,500 to 7,000 years BP; later the amount decreased in the south, and started spreading to the north, to the most northern Fenoscandia, at around 8,500 years BP (Huntley 1990; Birks 1989). Since 4,500 years BP, possibly due to a large climate deviation (drift) to higher humidity, the spread of pine decreased significantly, especially in the northwest of Europe, and less so in Finland (Eronen and Huttunen 1987; Gear and Huntley 1991) and Lithuania (Balakauskas 2013).

A widespread coniferous species such as Scots pine (Pinus sylvestris L.) can help us to understand the distribution of genetic variation in time and space and reveal the evolution of a species (Gugerli et al. 2005; Gutaker et al. 2017). The first postglacial waves of migration, such as pines dating from 11,000 BP to now, are especially interesting from this perspective (Žulkus and Girininkas 2014; Balakauskas 2013). During the Pleistocene geological period, which started about two million years ago, the Earth experienced repeated periods of glaciation, which lasted for about 100,000 years, with a warming period of about 10,000 years between the periods. The last Pleistocene glaciation in Europe started and finished around 110,000 to 12,500 years BC. During the last glaciation maximum (LGM), at around 20,000 years BC, the southern edge of the polar ice cap reached northern Poland, Germany and the Baltic countries (Hewitt 1999). The area of tundra where the permafrost prevented any significant groupings of woody vegetation extended to the south of France, northern Italy and the Caspian Sea (Hewitt 1999). The abundance of fossil pollen in soil research, studies of the abundance of fossil pollen in soil sedimental horizons, and DNA polymorphism show that the remaining wooden vegetation spread to the north from three main southern refugia, in the Pyrenees, the Italian peninsula and the Balkans, and also in a smaller eastern refugium in present-day eastern Ukraine (Huntley and Birks 1983; Tollefsrud et al. 2009; Naydenov et  al. 2007). The rise in temperature started

The first postglacial migrants such as pines in the study dating back to 9000 BC are especially interesting. In Scots pine, the mitochondrial DNA (mtDNA) genome is maternally inherited (Neatle and Sederoff 1989; Jaramillo-Correa et  al. 2003). Therefore, it is free from paternal effects, and is likely to represent distinct genetic lineages of postglacial migration (Sperisen et  al. 2001). The mitochondrial DNA marker coded here as Nad7-1 (Naydenov et  al. 2007) revealed two distinct glacial refugia for Scots pine in the temperate and boreal zones of Eurasia: (a) multiple refugia south of the ice cover stretching longitudinally over all of Eurasia from Scotland 123

Jurata Buchovska and Darius Danusevičius to southwest Siberia (Chernova et al. 1991; Cheddadi et al. 2006), referred to here as universal type A mitochondrial DNA haplotype; and (b) northern refugia, much smaller in geographical area, found mainly in the Baltic, Karelian (northwest Russia) and Finnish populations, the northern type B haplotype. Our earlier study on the geographical variation of the mitochondrial DNA Nad7.1 locus among 54 populations of Scots pine from the eastern European range revealed type A with the 300 bp allele and type B with 295 bp allele mtDNA variants. Based on Naydenov et  al. (2007), the 295 bp type B variant was identified as representing the northerly glacial refugium. The geographical distribution of the Nad7-1 northern B variant was not random, indicating that its glacial refugium centred at about 300 kilometres southeast of Moscow at the intersection of latitude 50º–55º N and longitude 35º–45º E. The main postglacial migration route from this northern refugium is located northwestwards, towards Karelia and northern Finland (Buchovska et al. 2013). The objective of the genetic study was to investigate the most likely postglacial refugium of the Scots pine trees found at the bottom of the Baltic Sea dating back to 11,000 BC, by identifying the maternally inherited mitochondrial DNA haplotypes and nuclear DNA haplotypes.

specimens, the ages of which were from 80 to 250 years. These were 27 autochthonous stands of Scots pine populations of normal moisture, growing in Lithuania (Table 7.1, Fig. 7.1). We also compared three swamps in different locations of Lithuania where Scots pine grow (Fig. 7.1). Marshy locations are raised bogs from which samples for research were taken: KAMA area, 2,435 hectares; BARG, 3,645 hectares; CIAP, 6,847 hectares (the largest marsh in Lithuania). 7.2.2. DNA extraction

7.2. Material and methods

DNA was extracted from the wood of Scots pine (approximately 100 mg) using the modified ATMAB protocol (Dumolin et  al. 1995). The DNA preparation and extraction stages were carried out in a separate laboratory room where analyses are not performed. Before the process of DNA extraction, all the laboratory tools were disinfected in a UV chamber for 30 minutes (the disinfection of the laboratory was repeated for each new DNA sample). Wood chips were made by drilling into the wood one to two centimetres with an electric drill (bit diameter 3 mm). The wood chips were shredded with a Retsch MM400 mill. The Eppendorf test tubes had three stainless steel balls inserted. About 80 milligrams of wood powder was used for the analysis.

7.2.1. Material

DNA extraction protocol:

The ancient wood consisted of mostly tree trunks with branches and stumps found on the bed of the Baltic Sea at a depth of about 15 to 30 metres, at three to 14 kilometres from the shore at Juodkrantė (abbreviated as JUOD) (RFI), Melnragė (RF-II) and Klaipėda/Smiltynė (RF-III-1), as well as Klaipėda (RF-III-B, RF-III-C) (Žulkus and Girininkas 2020). The wood samples were taken by diving and cutting off a piece of the wood for research. The tree stumps and trunks were located at a distance of two kilometres from each other. The samples recovered from the water were kept in sterile plastic containers, tightly sealed with sea water, in a cool and dark environment at 5ºC for a few days before they reached the laboratory. The samples taken to the laboratory were transferred into sterile plastic bags, closed tightly, and kept at -20ºC until the DNA analysis. The samples were analysed in the laboratory; the following DNA analyses were carried out: Scots pine: RF-I-B-1; RF-I-B-2; RF-I-C-2; TO 185(3); RF-I-E-1, RF-I-P-2, RF-I-E-2; RF-III-A-3; RF-III-A-2. 

1. We removed the metal beads and added 1 mL DNA extraction buffer (warm, 55ºC temperature), 50 µL DTT (1M) and 2 µL RNAse and mixed the solution and stored the tubes in a water bath for 12 hours at 55ºC. 2. Afterwards, we let them cool for 10 minutes and added 400 µL of dichloromethane, vortexed and opened the lid to remove the air from the tubes (the work is done under a fume hood). The tubes were centrifuged for 10 minutes, and the upper layer was pipetted into other 1.5 mL Eppendorf tubes (amount ~600–800 µL); if the upper phase was not clear, the dichloromethane precipitation step was repeated (for some samples 3–5 times). 3. Afterwards, 400 µL cold isopropanol was added to each cup and shaken gently until DNA was precipitated (and visible). The 1.5 mL Eppendorf tubes were kept at –20ºC overnight (12 hours at least). 4. The tubes were centrifuged for 10 minutes. Then all the liquid was discharged, and we let the remaining DNA-pellet dry for 5 minutes. After drying, 1 mL cold ethanol (76%) was added, and the DNA pellet (e.g. by vortexing) was released. Cups were centrifuged for 10 minutes (13,000 rpm, at 40ºC) again, and then all the liquid was removed, and the remaining DNA pellet dried for an hour. 5. After drying, 30 µL 1X TE buffer was added to force the DNA pellet to float; then the DNA pellet was resuspended overnight (in the fridge or at room temperature). The DNA was stored in a freezer at –20ºC.

The microscopical analysis of the wood samples showed that these were species of conifer, probably pine. We confirmed they were Scots pine, and tried PCR with 11 nucleus microsatellite loci, which were tested in research studies with more than 1,000 samples of Scots pine (Danusevičius et al. 2016). In other research, wood samples were dated using 14C (Žulkus and Girininkas 2014). The marine wood was compared to Scots pines currently growing in Lithuania. We genotyped 25 to 60 mature 124

 Molecular Studies of 11,000-Year-Old Scots Pine (Pinus sylvestris L.) Found on the Bed of the BALTIC Sea Table 7.1. The list of studied populations and the size of samples, shortened in Fig. 7.1, the probability of the GENECLASS association of seven Scots pine sample individuals to these reference populations, based on markers of nucleus microsatellites. N obs is the number of trees. Possibilities of association vary between 0 and 1, where values closer to 1 show strong genetic associations. Mean4 is the average association probability of four pine samples (B_1, C_2, T_3, P_2) which gave significant, higher than zero associations with Lithuanian populations (high values are highlighted in yellow). Note that ancient pine samples B_2, E_1 and E_2 are approximately 300 years older than the other ancient pines (Table 7.2) Population

Long

Lat

N obs

B_1

C_2

DARB

21.42073

56.01161

17

0.42

0.13

KAMA

T_3

P_2

Mean4

B_2

E_1

E_2

0.14

0.28

0.24

0

0.01

0.04

Northwest Lithuania 22.58897

56.27021

50

0.12

0.13

0.25

0.44

0.24

0

0.04

0.09

KAMA_BOG2 22.58888

56.27031

50

0.81

0.47

0.27

0.19

0.44

0.02

0.01

0.04

KURT

23.01582

55.84321

22

0.03

0.08

0.34

0.54

0.25

0

0.01

0.01

PLUN

21.67079

56.01509

20

0.62

0.15

0.65

0.37

0.45

0.05

0.09

0.07

TRYS

22.60041

55.99533

19

0.28

0.05

0.05

0.06

0.11

0

0.01

0.02

VARN

22.49134

55.71269

21

0.39

0.25

0.43

0.19

0.31

0.08

0.02

0.14

Central Lithuania BARG

23.45353

55.49002

47

0.09

0.04

0.07

0.15

0.09

0

0

0.13

BARG_BOG2

23.45362

55.49013

50

0.31

0.61

0.50

0.50

0.49

0.02

0.02

0.14

GRAZ

26.06653

55.65148

20

0.23

0.38

0.41

0.35

0.34

0.01

0

0

VAIS

24.10089

54.82318

20

0.12

0.28

0.21

0.14

0.19

0.01

0.01

0.03

AZVI

26.03584

55.46754

20

0.2

0.18

0.17

0

0.01

0

Eastern Lithuania 0.08

0.2

GEGU

24.51172

55.80243

20

0.55

0.23

0.35

0.24

0.34

0.07

0.01

0.05

LABA

25.85967

55.19655

21

0.19

0.14

0.18

0.15

0.16

0.01

0

0.01

MIKE

25.18647

55.67154

20

0.35

0.08

0.06

0.57

0.27

0

0.03

0.01

SALA

26.21100

55.82984

20

0.25

0.21

0.34

0.5

0.33

0.01

0

0.02

TRAK

24.83398

54.55192

19

0.16

0.2

0.16

0.05

0.14

0.01

0.01

0.01

ROKI

25.63185

55.97338

20

0.05

0.28

0.29

0.37

0.25

0

0.01

0.01

Southern Lithuania ANCI

23.66721

54.08405

19

0.53

0.56

0.5

0.61

0.55

0.07

0.04

0.05

BRAZ

23.43601

54.76620

20

0.25

0.2

0.71

0.46

0.41

0.01

0.05

0.02

CIAP

24.45519

54.02410

50

0.81

0.19

0.33

0.59

0.48

0.05

0.02

0.06

CIAP_BOG2

24.45528

54.02415

50

0.01

0.25

0.27

0.14

0.16

0.00

0.00

0.01

PUNI

24.07702

54.53224

19

0.13

0.32

0.63

0.59

0.42

0.02

0.02

0.01

VEIS

23.84428

54.07806

20

0.24

0.07

0.41

0.75

0.37

0.04

0.03

0.06

Southwest Lithuania

1

MOCI

22.23994

55.10132

4

0.06

0.02

0.02

0.03

0.03

0.01

0

0.01

NORK

21.53281

55.44790

3

0

0

0

0

0

0

0

0

VIES

22.41296

55.08369

3

0.07

0.09

0.02

0

0.04

0.01

0

0.01

PAGE

21.90091

55.14596

20

0.52

0.49

0.58

0.39

0.50

0.02

0.02

0.14

SVEK

21.44141

55.51897

20

0.09

0.39

0.42

0.21

0.28

0.02

0

0.01

JUOD1

21.11488

55.52645

19

0.42

0.15

0.58

0.17

0.33

0.01

0

0.05

Marine pines

0

0

7

–

–

–

–

–

–

–

–

Total

 

 

730

 

 

 

 

 

 

 

 

JUOD is located on the Curonian Spit, about a kilometre from the seashore; 2 marsh populations.

6. The DNA concentration was measured with a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA).

in the laboratory analyses described by (Naydenov et al. 2007). We used the GeneBank deposited sequences of the (Naydenov et  al. 2007) mtDNA Nad7-1 haplotypes (DQ665913 to DQ665915) to design the primers flanking the 5 bp deletion, so that the PCR products would result in the following two segments (Naydenov et  al. 2007): 300 bp for the universal A haplotype and 295 bp for the northern B haplotype, to be resolved on a DNA

7.2.3. Mitochondrial DNA markers To detect the polymorphism at the mtDNA Nad7-1 locus, we optimised the procedure to avoid the restriction step 125

Jurata Buchovska and Darius Danusevičius

Figure 7.1. The location of the Scots pine reference populations (filled circles) and ancient underwater stumps of Scots pine. It is 12 kilometres offshore in the Baltic Sea (a cross). Three marshy populations of Scots pine are marked with a triangle, located near populations of KAMA (in the north), BARG (near the centre) and CIAP populations (in the south).

cycles: 25 cycler 94ºC for 30 seconds, 55ºC for 45 seconds, 72ºC for 1 minute and a final elongation step at 72ºC for 10 minutes. To test against contamination during the PCR, along with the PCR wells with the PCR mix, buffer, the primers, the size standard and the DNA of ancient pine samples, we included a DNA-free control with the same chemical compounds as other DNAcontaining wells (6 samples with DNA and 3 DNA-free samples). The controls were placed in the PCR plate immediately after each sample with the aDNA. The plate with the post-PCR products was wrapped in folium and kept for 10–20 minutes in an empty freezer at -20º until the electrophoresis with the ABI PRISM®310 Genetic Analyze (Applied Biosystems, Waltham, MA, USA) by using the GeneScan 500 LIZ ladder standard. Allele sizing was performed on a binset by using the program GeneMapper (Applied Biosystems version 4.0, Foster City, CA, USA).

Table 7.2. Primer sequences and characteristics of the selected polymorphic microsatellite markers in P. sylvestris Number Locus 1.

Nad 7.1

Primers sequence 5’ –3’ For: ATACCGTCTGGCGAAAACGCCG Rew: GGCCTCTCCATTTCCAATGACCCG

sequencer. The primer sequences for the Nad7-1 locus designed with the BLAST primer designing tool were as follows (Table 7.2). The PCR was run in a separate room, where no DNA manipulation is carried out. The PCR procedure was run as described in Buchovska et al. (2013). We carried out the PCR with a total volume of 11 µL PCR mix, containing 5 µL Platinum Multiplex PCR Master Mix (ThermoFisher Scientific), 4 µL RNAse-free water, 0.5 µL primer F, 0.5 µL primer R and 1 µL of sample DNA (about 10 ng). A thermal cycler GeneAmp PCR System9700 was used for PCR reaction, with the following settings: initial denaturation at 95ºC for 12 minutes, followed by 10 cycles of 94ºC for 30 seconds, 60(-0.5)ºC for 45 seconds, and 72ºC for 1 minute. Two

7.2.4. Nuclear DNA markers We used 11 nuclear microsatellite loci (Table 7.3) with two to three nucleotide repeats that were used earlier by us on a set of Lithuanian Scots pine populations:  126

 Molecular Studies of 11,000-Year-Old Scots Pine (Pinus sylvestris L.) Found on the Bed of the BALTIC Sea Table 7.3. Primer sequences and characteristics of the 11 selected polymorphic nuclear microsatellite markers in P. sylvestris Locus

Primers sequence 5’ –3’

Repeated motif

Allele size range (bp)

GenBank accession no.

References

Psyl57

F: CCCCACATCTCTACAGTCCAA R: TGCTCTTGGATTTGTTGCTG

(ACC)7

187–202

HQ113944

Sebastiani et al. (2012)

Psyl2

F: TTGCTTTTGCAGAACATTCG R: GTCCTGCAGGCAATCAAAAT

(GCT)5

199–211

HQ113935

Sebastiani et al. (2012)

Psyl18

F: ACTACCTGGCATTCGTCCTG R: GGATCTGGTCCATTTCGTGT

(GCA)7

297–306

HQ113938

Sebastiani et al. (2012)

Psyl42

F: CAACTTCAGCCTTGCAACAA R: CGACTTCATTTGGAACACCA

(TC)9

171–179

HQ113942

Sebastiani et al. (2012)

Psyl25

F: CAGCACGCGTTCTTTGTATC R: ACCGTTGCTCGTTGTCTTCT

(GCA)5

214–244

HQ113940

Sebastiani et al. (2012)

Psyl16

F: GCTCTGCCCATGCTATCACT R: TGATGCTACCCAATGAGGTG

(AT)7

202–210

HQ113936

Sebastiani et al. (2012)

SPAC 7,14

F: TTCGTAGGACTAAAAATGTGTG R: CAAAGTGGATTTTGACCG

(TG)17 (AG)21

175–259

AJ223771.1

Soranzo et al. (1998)

SPAC 12,5

F: CTTCTTCACTAGTTTCCTTTGG R: TTGGTTATAGGCATAGATTGC

(GT)20– (GA)10

121–195

AJ223772.1

Soranzo et al. (1998)

SPAC 11,4

F: TCACAAAACACGTGATTCACA R: GAAAATAGCCCTGTGTGAGACA

(AT)5 (GT)19

129–169

AJ223766.1

Soranzo et al. (1998)

PtTX4011

F: GGTAACATTGGGAAAACACTCA R: TTAACCATCTATGCCAATCACTT

(GT)20

195–283

AF286621.1

Auckland et al. (2002)

PtTX4001

F: CTATTTGAGTTAAGAAGGGAGTC R: CTGTGGGTAGCATCATC

(GT)15

201–237

AF286619.2

Auckland et al. (2002)

Psyl57, Psyl2, Psyl18, Psyl42, Psyl25, Psyl16 (EST-SSRs [Sebastiani et  al. 2012]), Spac7.14, Spac12.5, Spac11.4 (genomic SSRs developed for Pinus sylvestris [Soranzo et  al. 1998]) and PtTX4011, PtTX4001 (genomic SSRs developed for Pinus taeda) (Elsik et  al. 2000; Auckland et al. 2002). We combined the loci into three multiplexes for the PCR and the two multiplexes for the capillary electrophoresis. We carried out the PCR with the same cycling settings for all three multiplexes in a total volume of 11 µL PCR mix, containing 5 µL Platinum Multiplex PCR Master Mix (ThermoFisher Scientific), 4 µL RNAsefree water, 0.5 µL primer F, 0.5 µL primer R and 1 µL of sample DNA (about 10 ng). A thermal cycler GeneAmp PCR System9700 was used for the PCR reaction, with the following settings: initial denaturation at 95ºC for 15 minutes, followed by 30 cycles of 94ºC for 30 seconds, 57ºC for 1:30 minutes, 72ºC for 30 seconds and a final elongation step at 60ºC for 30 minutes. We ran the capillary electrophoresis on the ABI PRISM®310 Genetic Analyze (Applied Biosystems, Waltham, MA, USA) by using the GeneScan 500 LIZ ladder standard and scored the alleles with the GeneMapper®software (Version 4.0, Applied Biosystems, Waltham, MA, USA).

et  al. 2006) for the absence of null alleles and false imprints. The frequency of null alleles was small, less than 0.5 for all loci. In trying to detect genetic connections between ancient underwater Scots pine specimens and the current Scots pine genetic pools in Lithuania, we used the Bayesian association method, installed in the software GENECLASS2 (Piry et al. 2004). We chose the (Rannala et al. 1997) method of individual association, calculating the individual multifaceted genotype association possibilities of each individual ancient pine sample to the reference populations, using a Monte Carlo repeated sampling method from 10,000 simulated individuals (Paetkau et  al. 2004). Personal association possibilities were calculated for each present population. 7.3. Results 7.3.1. Mitochondrial DNA analysis For all the tested samples, our DNA extraction method yielded sufficient DNA concentration for the PCR amplification (with a range from 20 to 40 ng/μl). The PCR in all four DNA-free control samples amplified no DNA fragments above 10 relative fluorescence units (RFU), whereas the size standard in the DNA-free samples was of high quality above 2500 RFU. This result indicates a low likelihood of contamination of the DNA samples from the underwater Scots pine stumps.

7.2.5. Statistical analysis The data set for the reference population was checked using the software MICRO-CHECKER (Van Oosterhout 127

Jurata Buchovska and Darius Danusevičius For the Scots pine, we found two mitotypes (A and B) at the only known polymorphic mitochondrial DNA locus in Scots pine. The universal dominant A mitotype, originating from the southern Europe refugium, and the mitotype B (the northern one), originating from the areas in what is presently eastern Ukraine in the southeast Europe refugium, were detected. The spread of these two mitotypes is not coincidental; a higher concentration of the northern mitotype B was detected in the pine forests of the northeast and southern refugium. We consider that this spread of mitotypes is a result of evolutionary origin, i.e. the migration routes after the last glaciation.

quality was high, well above 3000 relative fluorescence units (RFU), near the upper margin for fragment detection by the ABI310 Genetic Analyzer (Table 7.5). Based on Naydenov et  al. (2007), and Buchovska et  al. (2013), the 300 bp Nad-7 allele belongs to Scots pine from the southern glacial refugium (Fig. 7.1). Based on pollen fossils, P. sylvestris reached the northernmost part of Scandinavia in circa 7,800 years BP (Huntley and Birks 1983; Willis et al. 1998). Therefore, our samples dated to 12,000 BC are very likely to represent the first postglacial migration waves of Scots pine. Our findings indicate that the postglacial migration of Scots pine from the southern European refugium may have occurred earlier than from the northeast refugium located in the southern part of European Russia (Fig. 7.1). It is likely that the cold receded later in the northeast refugium, allowing for later migration from these areas northwards.

We found no type B mitochondrial DNA (mtDNA) haplotype in the underwater stumps of Scots pine dating back to 9000 BC, indicating that the Scots pine from the south European refugium reached the Baltic region earlier than Scots pine from the more northern refugium represented by the type B haplotype (Figure 7.2).

7.3.2. Nuclear DNA analysis Replicating the research twice, 11 microsatellite loci amplified successfully in seven out of nine ancient pines (Table 7.5). The repeated trials provided an acceptable amplification in six out of 11 loci for the remaining two

All six replications of the three underwater stumps of Scots pine contained the 300 bp allele at the mitochondrial DNA Nad7-1 locus (Table 7.4). The PCR amplification

Figure 7.2. The sources of postglacial migration of pines are outlined by red diagonal lines (based on: Naydenov et al. 2007, Buchovska et al. 2013).

128

 Molecular Studies of 11,000-Year-Old Scots Pine (Pinus sylvestris L.) Found on the Bed of the BALTIC Sea Table 7.4. Detection of alleles at the Nad7.1 locus for four individual Scots pine trees found in the sea (identified as RF followed by a code). The controls are DNA free samples containing the same chemical reagents and subjected to the same PCR and capillary electrophoresis procedure as the RF samples. NA – no amplification of DNA of any kind over the 0 to 500 bp range. Sample ID refers to two independent samples from a single wood specimen (individual tree) Sample ID

Sample DNA present in the PCR mix

mtDNA haplotype

Size standard quality, RFU1

Nad7–1 allele size, bp

Nad7–1 fragment height in RFU1

RF-I-C-2

1

Yes

A (universal)

2000

300

4871

RF-I-C-2

2

Yes

A (universal)

2000

300

4919

Control_1

–

No

–

2000

NA

NA

RF-I-B-1

1

Yes

A (universal)

6000

300

5316

RF-I-B-1

2

Yes

A (universal)

5500

300

5719

Control_2

–

No

–

5500

NA

NA

RF-I-B-2

1

Yes

A (universal)

4500

300

3977

RF-I-B-2

2

Yes

A (universal)

4500

300

250

Control_3

–

 

–

4500

NA

NA

RF-I-I-2

1

Yes

A (universal)

3500

300

4601

RF-I-I-2

2

Yes

A (universal)

3500

300

4510

Control_4

–

No

–

3500

NA

NA

Individual tree ID

1

Relative fluorescent units (RFU), where we set the MARGIN for ignoring any fragments below RFU of 50.

Table 7.5. The quality characteristics of the PCR scoring of the ancient underwater individuals of Scots pine (details of the PCR quality at the microsatellite loci are given in Table 7.6). ‘PCR attempts’ are the number of independent PCR runs (sampled from the ‘maternal’ extracted DNA sample). ‘Fine’ means PCR fragments above 50 relative fluorescence units (RFU) found in at least two replications (RFU rages from 0 to 6000, where all DNA fragments below 10 RFU is set as noise). NA means no amplification. ‘Not used’ means not used in the analysis. RF codes refer to the sea sampling site according to (Žulkus, Girininkas 2020). Original lab tree ID is given in brackets for reference with other studies Tree ID (lab. ID)

DNA conc. ng/μl

Age, years BP1

mtDNA Nad7.1 PCR quality

mtDNA (PCR attempts)

nDNA loci of acceptable quality

nDNA (PCR attempts)

B_1 (RF-I-B-1)

27.9

10.647–10.178

Fine, 300 bp

3

11

2

B_2 (RF-I-B-2)

13.7

11.236–10.780

Fine, 300 bp

3

11

2

C_2 (RF-I-C-2)

16.1

11.068–10.574

Fine, 300 bp

3

11

2

P_2 (RF-I-P-2)

16.9

10.561–10.256

NA

6

11

2

T_3 (RF-I-P2(1))

10.9

11.103–10.704

NA

6

11

2

E_1 (RF-I-E-1)

12.6

11.597–10.768

NA

6

11

3

E_2 (RF-I-E-2)

16.5

11.226–10.808

NA

6

11

3

A_2 (RF-III-A-2)

41.1

8972–8486

NA

6

6 not used

4

A_3 (RF-III-A-3)

33.1

9023–8652

NA

6

6 not used

4

C radiocarbon dating see Žulkus and Girininkas, Table 2.1 Chapter 2 of this book.

1 14

samples. Therefore, in this research, we analysed only seven samples which amplified in all 11 loci (Table 7.5). The quality of most amplified PCR fragments in the seven samples of Scots pine varied from 100 to 2000 RFU (Table 7.6).

DNA amplified quality fragments of the size standard had amplified DNA fragments below 10 relative fluorescence units, which may be treated as random noise. This indicates a low probability of contamination in samples with ancient DNA.

The PCR on the DNA-free controls that were run with the same constituents as the rest., Except for the sample

The distribution of locus allele frequency and its comparison with ancient 12,000-year-old Scots pines 129

130

Id

DNAC

Psyl18

Psyl42

Psyl57

Psyl2

Psyl25

Psyl44

Psyl16

Spac7.14

Spac12.5

Spac11.4

B_1

21

90

95

1739

455

209

209

923

206

1126 1126

54

54

56

B_2

25

110

120

2493 1343

794

794

1789

226

1450 1450

328

328

C_2

22

115

112

1910 4008

797

797

2188 2188 1896 1896

250

T_3

16

112

112

2296 1574

171

171

1833 1833 2033 2033

56

126

91

40

40

597

479

219

219

241

233

42

42

287

117

189

112

86

86

34

34

38

38

255

66

70

546

546

660

670

33

33

102

110

150

140

116

116

41

41

333

315

117

107

40

40

37

37

E_1

22

432

432

38

38

38

38

100

69

153

153

267

267

87

87

31

40

905

308

67

67

93

93

E_2

23

164

127

82

82

122

122

156

156

77

77

132

132

61

61

33

64

547

547

96

80

56

55

P_2

27

83

83

394

251

140

140

161

63

224

224

49

49

81

81

44

43

30

38

30

30

70

70

1095 1095 57

57

3550 3600 57

56

Pttx4001 Pttx4001 Pttx4011 Pttx4011

Jurata Buchovska and Darius Danusevičius

Table 7.6. The DNA concentration (DNAC in ng/ml) and the size of the amplified PCR fragments for the two alleles per locus in relative fluorescence units (RFU) from the outputs of the AB software GeneMapper

 Molecular Studies of 11,000-Year-Old Scots Pine (Pinus sylvestris L.) Found on the Bed of the BALTIC Sea revealed the tendencies of small-size alleles between ancient pines from the most varying loci of the ‘Spac’ series. This tendency was not observed in the ‘Psyl’ and ‘Pttx’ loci (Fig. 7.3; Fig. 7.4).

T_3), the association probabilities varied between 0 and 0.81, pointing out an especially varied set of association data (Table 7.1). The largest mean association probability of four ancient Scots pines was received in the southern population, and it was slightly smaller in the western Lithuanian population (it fluctuated from 0.36 to 5.43, Fig. 7.4, Table 7.1). When the association possibilities of the four ancient pine specimens are analysed separately, a consistent similarity with the present population of southern Lithuania was obvious according to the

The Bayesian test assignment test showed that three samples of the ancient Scots pine (B-2, E-1 and E-2) had only zero association probability to the reference populations in Lithuania (Table 7.1). For the remaining four specimens of ancient Scots pine (P_2, C_2, B_1 and

Figure 7.3. 12, 000-year-old sea heterozygosity (including all 11 loci, in the bottom right corner) and the frequency of locus alleles (red continuous line, seven trees, abbreviated as ‘sea’) and present Scots pines in Lithuania (dotted line, n = 573) trees. The microsatellite motif (bp) and the number of different alleles are provided in brackets in one place, and the locus title is in the upper part of each area. ‘Psyl’ loci are expressed as SSR loci. ‘Spac’ loci are genomic SSR loci. The most varying genomic loci of the ‘Spac’ series show a consistent tendency of small allele sizes of ancient Scots pine trees. Figure taken from: Danusevicius et al. 2021.

131

Jurata Buchovska and Darius Danusevičius

Figure 7.4. The interpolated contour plots of the GENECLASS assignment probabilities of the four ancient sea pine tree samples (P_2, B_1, C_2, C_3) to each of the 27 autochthonous present-day reference populations of Scots pine plotted on a simplified map of Lithuania. The mean association probability of these four pines is provided in the lowest contour map. Figure taken from: Danusevicius et al. 2021.

association probability, especially with such high values as 0.5 to 0.7 with the southern ANCI, BRAZ and CIAP populations from dry locations (Table 1). In addition, the southern populations and ancient Scots pine specimens P_2 and B_1 showed a similarity with the northeast, while T_3 and B_1 were similar to the populations of western Lithuania, especially with the PLUN one (Table 7.1). The two ancient Scots pine specimens B_1 and T_3 had high assignment probabilities with the seaside

population of JUOD, which is geographically the closest present-day inland population to the ancient pines (0.42–0.58, Table 7.1). However, samples C_2 and P_2 were less similar to the JUOD population. Therefore, their probability of association to JUOD was of average weight (0.33) (Table 7.1). In two out of three locations of marshes, four ancient Scots pine samples (P_2, B_1, C_2 and T_3) showed a 132

 Molecular Studies of 11,000-Year-Old Scots Pine (Pinus sylvestris L.) Found on the Bed of the BALTIC Sea

Figure 7.5. Left: the mean GENECLASS assignment probabilities of the four ancient Scots pine specimens (P_2, B_1, C_2 and T_3) to the pairs of adjacent wetland and dryland populations of Scots pine at three wetland locations in Lithuania (KAMA, the north, BARG, the centre, and CIAP, the south of the country, Fig. 1). Right: the reference population of Scots pine in the wetland of Bargailiai (during sampling in the raised bog, age of Scots pine trees circa 100 years, estimated by sampling the increment cores). The adjacent dry land reference population of BARG is seen at the horizon. Figure taken from: Danusevičius et al. 2021.

much stronger relation to the swamp populations than to the neighbouring populations of Scots pine growing on dry land (Fig. 7.4; Table 7.1). The largest difference of association was in the BARG marsh, located in the middle of Lithuania: the average association probability (p) with the BARG marsh population was 0.49, and it decreased to 0.09 with the adjacent dry land population (see BARG Table 7.1; Fig. 7.5). However, in the southern CIAP marsh, the result was just the opposite: the relations of ancient pines to dry lands (p = 0.42) were stronger than the ones from marsh populations (p = 0.16, Table 7.3).

PCR profiles: we found no more than two fragments in all 11 nDNA loci. We used ATMAB DNA extraction protocol, which is economical, convenient for laboratory use, and easily accessible. The large aDNA yield which was received from underwater pine wood of about 11,000 years old shows that saline sea water is a very effective preservative for ancient wood remains. Therefore, geneticists can cooperate closely with underwater archaeologists so that the fast and suitable taking of underwater wood samples can be ensured in this and other sites (Hansson 2018). The used nuclear DNA would be preserved better than old plant material organ DNA, and their yield was significantly higher (Banerjee et  al. 2002), and this may explain the higher success rate of nDNA amplification, compared to mtDNA in our research (Table 7.2).

7.4. Discussion Being aware of possible contamination of DNA, e.g. with pollen (Lendvay et  al. 2018), we conducted the DNA research in December and January, when the pollen content in the air is smallest (Gugerli et al. 2005). We did not bleach the ancient wood samples, or control them by means of laser radiation. Our strategy was to rely on checking by control test samples without DNA and less degraded DNA kept in saline sea water (Lendvay et  al. 2018). We did not expect contaminants such as pollen to exceed DNA amplification. The majority of PCR fragments in our research were higher than 100 RFU, which significantly exceeds the strength of expected DNA contaminant amplification, e.g. PCR amplicons or pollen (Ping-Hua et  al. 2008). Pollen powder (grain) external walls are especially resistant to chemical detergents, which decrease pollen DNA concentration. Another argument against pollen contamination was that it was expected to have a lot of PCR fragments, contaminated with pollen, as pollen grains, or powder, have different genotypes (Gugerli et al. 2005). But it was not so in our

The regression of the historical Yoldia Sea, the predecessor of the present Baltic Sea, was the largest during 11,000 to 10,700 years BP, and forest vegetation was 33 to 55 metres below the present sea level, which includes the sites of the researched ancient pines in our research (Rosentau et  al. 2017; Gelumbauskaitė and Šečkus 2005). Thus, it is highly expected that our samples from about 11,000 years BP will show signs of the first postglaciation wave of migration to the east Baltic region. Our positive A type mtDNA haplotype results in ancient pine samples show that the postglacial migration of Scots pine from southern Europe could have occurred earlier than that from the northwestern refugium in the southern part of European Russia (Fig. 7.2). This finding supports Scots pine postglacial migration theories reporting a relatively later contribution of the northerly type B local refugium (Naydenov et al. 2007; Sinclair et al. 1999). It 133

Jurata Buchovska and Darius Danusevičius is likely that the frost retreated later in the northeastern refugium, and it allowed migration from these areas to the north later. Analysing the gene pool of the present Scots pine, Kavaliauskas (2016) announced a gradual B type mtDNA haplotype decrease towards the west, which corresponds well with our conclusions. It is worth noting that our assumptions are based on the data of three populations, and it shows indicative but not convincing results.

11,200 years BP, and can include numerous Scots pine migration waves during the post-glaciation period. What could be the reasons for the relatively stronger long-term temporary ancient Scots pine associations namely with current Lithuanian Scots pine populations? It could be random associations, because the stochastics environment of numerous generations can significantly alter the frequencies of alleles. However, in certain cases the variants of neutral genomes can be retained in large populations (Flowers 2008). A specific case could be Scots pine with the neutral part of the genome exceeding several times that of other tree species. Neutral frequencies of alleles in widespread, wind-pollinated species with large populations are likely to ensure that they do not have strong mutation drift and natural selection remains in a Hardy-Weinberg balance generation (Flowers 2008); why not over circa 100 non-overlapping generations, given 100 years of natural ageing in Scots pine growing at its edaphic optimum? We determined that temporary associations were strong with all present populations of southern Lithuania for the genotypes in our research. In cases of random associations, we would have noticed the strong consistent distribution of random association throughout all of Lithuania, but it was not the case in our research. Another interesting observation is that the geographical patterns of long-term temporal genetic associations (Fig. 7.5) correspond well with the Scots pine pollen abundance maps from 13,300 to 500 years BP, based on fossil pollen dating records in Lithuania (Kabailienė 2006, Figs. 3.6.14, 3.6.15). Research by Balakauskas (2013) revealed that the population of Scots pine in Lithuania has remained stable from 13,300 years BP till nowadays, while in other countries the presence of Scots pine was different over time. The Scots pine gene pool in southern Lithuania could have been preserved better due to its dominance in poor sandy soil, which is more suitable for Scots pine than for other species of forest trees.

Considering the time span of circa 11,000 years between the present-day and the ancient Scots pine gene pools in our study, it is interesting to examine the debatable mutation models of the DNA base pair repeat motives at the microsatellite loci. Our results show that, contrary to the conservative EST-SSR, highly variable, likely neutral SSR loci tend to mutate gradually, increasing the size of alleles with new inserts during the last 11,000 years (Fig. 7.2). The relatively lower observed heterozygocity in ancient marine pines can be explained by migration events enriching the variety, and it is expected that the gene pools will increase the heterozygocity of modern generations (Hewitt 1999). Scots pine is widespread; it is a conifer pollinated by wind, standing out from other forest trees by the most powerful flow of genes between populations (Lindgren et  al. 1995). This powerful flow of genes determines the low differentiation between populations, and the large genetic variation in Scots pine populations (Tóth et  al. 2017). The neutral DNA markers mainly reflect zones of shared gene pools of Scots pine populations via phenology synchrony (Tóth et  al. 2017). This phenology is based on the structure, and is indirectly related to adjusting variation, because the phenology is a strong adaptive feature of Scots pine (Eriksson 2008). Our indicative populations comprise the main pine forests in the country, and sampling sizes from 20 to 50 specimens are large enough to depict local gene pools using microsatellite DNA markers (Danusevičius et  al. 2016). Therefore, we consider the data set used for association analysis to be reliable. Despite this, three out of seven ancient pine trees did not have any association with current pine populations in Lithuania (Table 7.1). This could be due to (a) the large population number and ancient Scots pine gene pool variety, or (b) samples of ancient Scots pine depict separate forest generations, originating from different glaciation migration sources. Based on fossil pollen radiocarbon dating, Pinus sylvestris reached the most northern parts of Scandinavian countries around 7,800 years BP (Huntley 1983; Willis et  al. 1998). Fossil pollen research adjacent to the Lithuanian coast of the Baltic Sea shows the dominance of birch forests during the early Preboreal, about 11,500 years BC, after which a significant increase in Scots pine forests was seen around 10,500 years BC (Balakauskas 2013; Kabailienė 1990; Kabailienė 2006). Our genetic material recovered from the bed of the Baltic Sea is dated to about 10,400 to

We expected closer genetic relations between the ancient pines found in the Baltic Sea and old Scots pines growing on the shore, closest to the sampling site in JUOD forest, approximately one kilometre from the coast. Two out of four ancient pine specimens were related to the JUOD population, with a relatively high probability from 0.42 to 0.58 (Table 7.1). A similarity exists, but by taking samples in more populations, especially from the ones closest to the coast, it would be possible to generalise the remains of the old genetic pools in Neringa. There are a few reasons for the large-scale forest destruction in Neringa: sandstorms and wind erosion, as well as human initiatives in afforestation. Thus, we may have multiple founder effects manifesting in the Scots pine gene pool of Neringa. Another coherent discovery is the relatively stronger associations between ancient pines and pine populations growing in marshes in central (BARG) and northern

134

 Molecular Studies of 11,000-Year-Old Scots Pine (Pinus sylvestris L.) Found on the Bed of the BALTIC Sea (KAMA) Lithuanian marshes. Peat layers with remains of Cyperaceae, Menyanthes and Euquisetum, and Polypodiaceae and Sphagnum plant species, were found in the site in the Baltic Sea where the underwater ancient Scots pine samples were taken (Žulkus and Girininkas 2012; Žulkus and Girininkas 2014). In the RF-I sampling site, the radiocarbon dating of peat specimens sampled 29 metres below the present sea level at the bottom of the underwater peat layer returned ages of circa 11,770 years BP. This indicates the contemporary presence of Scots pine and wetlands that formed in the zone of regression/ transgression of the pre-Baltic Sea water pools (Žulkus et  al. 2014). Present marshy areas with Scots pines are about 5,000 hectares, an area that is sufficient to maintain separate gene pools due to phenological differences of pines in wetlands and on dry land (Sirgėdienė 2020). During the hot and dry summer period, the upper layer of dry moss and peat reaches a depth of one to two metres. It is a strong selective force for drought-resistant Scots pine in the age of young plants. In the south of Lithuania, the CIAP marsh population did not provide such associations. A possible reason for this could be the strong associations with the genetic pool of southern Lithuanian Scots pine.

Buchovska, J., Danusevičius, D., Stanys, V., Šikšnianienė, J. B., Kavaliauskas, D., 2013. The location of the northern glacial refugium of Scots pine based on mitochondrial DNA markers. Baltic Forestry, 19 (1), 2–12. Cheddadi, R., Vendramin, G.G., Litt, T., François, L., Kageyama, M., Lorentz, S., Laurent, J.M., de Beaulieu, J.L., Sadori, L., Jost, A., Lunt, D., 2006. Imprints of glacial refugia in the modern genetic diversity of Pinus sylvestris. Global Ecology and Biogeography, 15, 271– 282. Chernova, G.M., Mikhailov, N.N., Denisenko, V.P., Kozyreva, M.G., 1991. Some questions of paleogeography of Holocene of South Eastern Altai. Izv. All-Union Geogr. Soc., 2, 140–146. Danusevičius, D., Buchovska, J., Žulkus, V., Daugnora, L., Girininkas, A., 2021. DNA Markers Reveal Genetic Associations among 11,000-Year-Old Scots Pine (Pinus sylvestris L.) Found in the Baltic Sea with the Present-Day Gene Pools in Lithuania. Forests, 12(3), 317; https://doi.org/10.3390/f12030317. Danusevičius, D., Kavaliauskas, D., Fussi, B., 2016. Optimum Sample Size for SSR-based Estimation of Representative Allele Frequencies and Genetic Diversity in Scots Pine Populations. Baltic Forestry, 22, 194–202.

To conclude, our research has shown that saline sea water effectively preserves ancient DNA in wood, the quality and cleanliness of which are suitable for the genetic research of trees, even dating back 11,000 years in the past. Individual ancient Scots pines were found on the bed of the Baltic Sea in the locus of A type (300 bp) allele mitochondria DNA Nad7.1, indicating their origin from the southern glacial refugium in southern Europe. Bajes task tests based on nuclear DNA microsatellites indicators revealed relatively stronger genetic associations between the ancient Scots pines found under water in the Baltic Sea and the present-day southern Lithuanian Scots pine populations, as well as with pine populations from certain swamps.

Dumolin, S., Demesure, B., Petit, R. J., 1995. Inheritance of chloroplast and mitochondrial genomes in pedunculated oak investigated with an efficient PCR method. Theoretical and Applied Genetic, 91, 1253– 1256. https://doi.org/10.1007/BF00220937. Elsik, G. C., Minihan, V. T., Hall, S. E., Scarpa, A. M., Williams, C. G., 2000. Low-copy microsatellite markers for Pinus taeda L. Genome, 43, 112. Eriksson, G., 2008. Pinus Sylvestris Recent Genetic Research. Swedish University of Agricultural Sciences: Uppsala.

References

Eronen, M., Huttunen, P., 1987. Radiocarbon-dated sub-fossil pines from Finnish Lapland. Geografiska Annaler: Series A, Physical Geography, 69, 297–304.

Auckland, L., Bui, T., Zhou, Y., Shepard, M., Williams, C., 2002. Conifer microsatellite handbook. Raleigh (NC): Corporate Press.

Flowers, J. M., Purugganan, M. D., 2008. The evolution of plant genomes: Scaling up from a population perspective. Current Opinion in Genetics & Development, 18, 565–570.

Balakauskas, L., 2013. Vėlyvojo Ledynmečio ir Holoceno Miškų Augalijos Raida Lietuvoje LRA (Kraštovaizdžio Atkūrimo Algoritmo) Modeliavimo Duomenimis; Forest Vegetation during Late Glaciation Holocene in Lithuania Mased on LRA Modeling. Thesis (PhD). Vilnius University.

Gear, A. J., Huntley, B., 1991. Rapid changes in the range limits of Scots pine 4000 years ago. Science, 251, 544– 547.

Banerjee, M., Brown, T. A., 2002. Preservation of nuclear but not chloroplast DNA in archaeological assemblages of charred wheat grains. Ancient Biomolecules, 4, 59–63.

Gelumbauskaitė, L. Ž., Šečkus, J., 2005. Late quaternary shore formations of the Baltic basins in the Lithuanian sector. Geologija, 52, 34–45.

Birks, H. J. B., 1989. Holocene isochrone maps and patterns of tree-spreading in the British Isles. Journal of Biogeography, 16, 503–540.

Gugerli, F., Parducci, L., Petit, R. J., 2005. Ancient plant DNA: Review and prospects. New Phytologist, 166, 409–418.

135

Jurata Buchovska and Darius Danusevičius Gutaker, R. M., Burbano, H. A., 2017. Reinforcing plant evolutionary genomics using ancient DNA. Current Opinion in Plant Biology, 36, 38–45.

Neatle, D.B., Sederoff, R.R., 1989. Paternal inheritance of chloroplast DNA and maternal inheritance of mitochondrial DNA in loblolly pine. Theoretical and Applied Genetics, 77, 212–216.

Hansson, A., 2018. Submerged landscapes in the Hanö Bay: Early Holocene shoreline displacement and human environments in the southern Baltic Basin. Thesis (PhD). Lund University.

Paetkau, D., Slade, R., Burden, M., Estoup, A., 2004. Genetic assignment methods for the direct, real-time estimation of migration rate using assignment methods: A simulation-based exploration of accuracy and power. Molecular Ecology, 13, 55–65.

Hewitt, G. M., 1999. Postglacial recolonization of European biota. Biological Journal of the Linnean Society, 68, 87–122.

Ping-Hua, C., Yong-Bao, P., Ru-Kai, C., 2008. Highthroughput procedure for single pollen grain collection and polymerase chain reaction in plants. Journal of Integrative Plant Biology, 50, 375–383.

Huntley, B., Birks, H. J. B., 1983. An Atlas of Past and Present Pollen Maps for Europe 0–13,000 Years Ago. Cambridge University Press: Cambridge.

Rannala, B., Mountain, J. L., 1997. Detecting immigration by using multilocus genotypes. Proceedings of the National Academy of Sciences USA, 94, 9197–9221.

Huntley, B., 1990. European post-glacial forests: Compositional changes in response to climatic change. Journal of Vegetation Science, 1, 507–518.

Rosentau, A., Muru, M., Gauk, M., Oja, T., Liibusk, A., Kall, T., Karro, E., Roose, A., Sepp, M., Tammepuu, A., et al. 2017. Sea-Level Change and Flood Risks at Estonian Coastal Zone. Coastline Changes of Baltic Sea from South to East, 19, 363–388.

Jaramillo-Correa, J.P., Bousquet, J., Beaulieu, J., Isabel, N., Perron, M., Bouillé, M., 2003. Cross-species amplification of mitochondrial DNA sequencetagged-site markers in conifers: The nature of polymorphism and variation within and among species in Picea. Theoretical and Applied Genetics, 106, 1353–1367.

Sebastiani, F., Pinzauti, F., Kujala, S.T., GonzálezMartínez, S.C., Vendramin, G.G., 2012. Novel polymorphic nuclear microsatellitemarkers for Pinus sylvestris L. Conservation Genetics Resources, 4, 231– 234.

Kabailienė, M., 1990. Lietuvos Holocenas. Vilnius: Mokslas. Kabailienė, M., 2006. Gamtinės aplinkos raida Lietuvoje per 14,000 metų. Vilnius: Vilnius University Press.

Sinclair, W. T., Morman, J. D., Ennos, R. A., 1999. The postglacial history of Scots pine (Pinus sylvestris L.) in western Europe: Evidence from mitochondrial DNA variation. Molecular Ecology, 8, 83–88.

Kavaliauskas, D., 2016. Genetic Structure and Diversity of Scots Pine (Pinus sylvestris L.) Populations in Lithuania. Thesis (PhD). Kaunas Aleksandras Stulginskis University.

Sirgėdienė, M., 2020. Genetic Differentiation of Scots Pine Mitochondrial DNA Haplotypes and Bog Populations Based on Morphology and DNA Markers. Thesis (PhD). Kaunas Vytautas Magnus University.

Kvist, L., 2000. Phylogeny and Phylogeography of European Parids; Department of Biology, Faculty of Science, University of Oulu: Oulu. ISBN 951-42-55364. http://urn.fi/urn:isbn:9514255364 (accessed on 5 February 2021).

Soranzo, N., Provan, J., Powell, W., 1998. Characterization of microsatellite loci in Pinus sylvestris L. Molecular Ecology, 7, 1260–1261.

Lendvay, B., Hartmann, M., Brodbeck, S., Nievergelt, D., Reinig, F., Zoller, S., Parducci, L., Gugerli, F., Buntgen, U., Sperisen, C., 2018. Improved recovery of ancient DNA from subfossil wood—application to the world’s oldest Late Glacial pine forest. New Phytologist, 217, 1737–1748.

Sperisen, C., Büchler, U., Gugerli, F., Mátyás, G., Geburek, T., Vendramin, G.G., 2001. Tandem repeats in plant mitochondrial genomes: Application to the analysis of population differentiation in the conifer Norway spruce. Molecular Ecology, 10, 257–263. Tollefsrud, M. M., Sønstebø, J. H., Brochmann, C., Johnsen, Ø., Skrøppa, T., Vendramin, G. G., 2009. Combined analysis of nuclear and mitochondrial markers provide new insight into the genetic structure of North European Picea abies. Heredity, 102, 549– 562.

Lindgren, D., Paule, L., Shen, X., Yazdani, R., Segerstrom, U., Vallin, J. E., Lejdebro, M. L., 1995. Can viable pollen carry Scots pine genes over long distances? Grana 34, 64-69. https://doi.org/10.1080/00173139509429035 Naydenov, K., Senneville, S., Beaulieu, J., Tremblay, F., Bousquet, J., 2007. Glacial variance in Eurasia: Mitochondrial DNA evidence from Scots pine for a complex heritage involving genetically distinct refugia at mid-northern latitudes and in Asia Minor. BMC Evolutionary Biology, 7, 233.

Tóth, E. G., Köbölkuti, Z. A., Pedryc, A., Höhn, M., 2017. Evolutionary history and phylogeography of Scots pine (Pinus sylvestris L.) in Europe based on molecular markers. Journal of Forestry Research, 28, 637–651.

136

 Molecular Studies of 11,000-Year-Old Scots Pine (Pinus sylvestris L.) Found on the Bed of the BALTIC Sea Van Oosterhout, C., Weetman, D., Hutchinson, W. F., 2006. Estimation and adjustment of microsatellite null alleles in nonequilibrium populations. Molecular Ecology Notes, 6, 255–256. Willis, K. J., Bennett, K. D., Birks, J. B., 1998. The late Quaternary dynamics of pines in Europe. In: D. M. Richardson, ed. Ecology and Biogeography of Pinus, Cambridge: Cambridge University Press, UK, 107– 121. Žulkus, V., Girininkas, A., 2012. Baltijos jūros krantai prieš 10 000 metų “Yoldia”. Klaipėda: Klaipėda University Press. Žulkus, V., Girininkas, A., 2014. Drowned Early Mesolithic Landscapes on the Baltic Sea bed in the Lithuanian Waters. Journal of Environmental Science and Engineering, 3, 274–289. Žulkus, V., Girininkas, A., 2020. The eastern shores of the Baltic Sea in the Early Holocene according to natural and cultural relict data. GEO: Geography and Environment, 7 (1), 1–16. https://doi.org/10.1002/ geo2.87.

137

8 Sulphur content and its palaeoecological significance demonstrated in Early Holocene relict trees from the bottom of the Baltic Sea Jolita Petkuvienė: Marine Research Institute, Klaipėda University Sergej Suzdalev: Marine Research Institute, Klaipėda University Vladas Žulkus: Institute of Baltic Sea Region History and Archaeology, Klaipeda University. Abstract: The enrichment of sulphur (S) and iron (Fe) elements and their compounds in wood is related to microbial action on wooden organic material. Our results demonstrate that the highest sulphur values were measured in the Ancylus Lake (av. 19.9±11.7 mg/g) and Yoldia Sea (av. 16.4±5.3 mg/g) periods, and the lowest in the Littorina (av. 13.1±3.2 mg/g). The sulphur concentration of modern pine trees which were not waterlogged was 87 times lower (0.11–0.24 mg/g of dry wood). The highest average Fe values were measured in relict trees of the Ancylus Lake period (10.2±13.1 mg/g), while in the Yoldia Sea (2.1±3.1 mg/g) and Littorina (1.6±1.2 mg/g) periods, the Fe concentration of relict wood was distributed similarly. Modern pines accumulated only an average 0.01±0.00 mg/g of iron. The intensity of the distribution of S and Fe concentrations depended not only on the dated period, but also on the sample quality, i.e. the highest concentrations in soft wood were represented by small pieces of wood. Keywords: Early Holocene, Relict trees, Sulphur, Iron, Degradation, Baltic Sea 8.1. Introduction

relict trees have been affected by the physical transport of sediments and peat, changes in the composition of the water (temperature, salinity, redox potential, pH), and the action of microorganisms (Björdal and Nilsson 2008; Björdal 2012; Fors 2015). Relict trees remain on the seabed in good condition, and we can discover many archaeological finds around the Baltic Sea (Fors et  al. 2012, Hansson et al. 2018). This shows that the water of the Baltic Sea is a suitable environment for the preservation of organic matter. The low salinity and temperature of Baltic Sea water and the suboxic-anoxic environment of the seabed prevent the degradation of wood by worms, molluscs and insects (Björdal et al. 1999; Björdal and Nilsson 2008; Fors et al. 2008), and marine bacteria become the most active microorganisms affecting the waterlogged state of the wood (Fors et al. 2008; Blanchette, 2000). The intensity of the degradation is determined by the diversity of bacteria and its required oxidant for processing. The most active and energetically effective degradation occurs under oxic conditions, where oxygen is the main driver (Broda and Hill 2021). When oxygen is consumed, nitrate is used for mineralisation. Under suboxic conditions, manganese and iron oxide/hydroxide are the main oxidants for the reduction of organic matter; while under anoxic conditions, sulphate and methane force degradation. Consequently, the rate and degree of the degradation of wood depend not only on the type of wood and its composition, but also the redox state in the environment influencing the abundance and diversity of bacteria.

The Baltic Sea holds great, preserved natural secrets and history about nature and human changes on the Earth over thousands of years. Under the water, we can find former Baltic Sea shorelines, details of wooden poles made by ancient humans, and pieces of trees from relict forests (Hansson et  al. 2018; Jöns et  al. 2020; Nilsson et  al. 2020). The evolution and water level dynamics of the Baltic Sea on the Lithuanian coast from the Early Holocene period has been extensively investigated by Gudelis (1955), Gelumbauskaitė (2009), and Žulkus and Girininkas (2020). Studies demonstrate that during the Early Holocene, the shoreline of today’s Baltic Sea was at a depth of 39 to 55 metres below present sea level (b.s.l) during the Yoldia Sea period (11,700–10,700 cal BP) (Gudelis 1955; Gelumbauskaitė 2009; Žulkus and Girininkas 2020). Later, during the Ancylus Lake transgression, the water changed from fresh to brackish, the level rose up to 10 metres b.s.l. (Žulkus and Girininkas 2020), and the Ancylus Lake became present from around 9800 until 8500 cal BP. After that, the Littorina Sea period began, with fully brackish sea water (Rosentau et al. 2017; Hansson et  al. 2018). In all periods, former lakes and lagoons were surrounded by forest, settlements and other ancient landscapes, which, with the rise in the water level, were submerged under water. Relict trees have undergone many biological, physical and chemical destructive influences, leading to a deterioration in the structure of the wood (Komorowicz et  al. 2015). Between the Early Holocene and the present day, the Baltic Sea has undergone different stages, and as a result,

Many studies are measuring the composition of the organic compounds, like lignin and cellulose, in relict waterlogged wood which demonstrate the quality of relict wood 139

Jolita Petkuvienė, Sergej Suzdalev and Vladas Žulkus (Salanti et  al. 2010; Eriksen et  al. 2017). Nevertheless, an accumulation of inorganic contaminants in the relict trees may also indicate the condition of wood biomass (Fors 2008; 2015). The enrichment of sulphur (S) and iron (Fe) elements and its compounds in the wood is related to microbial action on wooden organic material. The suboxicanoxic bed of the marine environment has a high redox diversity of the microbial community, offering suitable conditions for sulphurous bacteria (Fors et al. 2012). Under oxic conditions, sulphate slowly oxidises organic matter, forms sulphuric acid in the wood cellulose fibres, and decreases the mechanical stability of the wood (Sandström et al. 2005). In a hypoxic or anoxic environment, sulphate reducing bacteria form H2S (hydrogen sulphide), which reacts with the lignin-rich part of the wood, and creates organic sulphur compounds (Sandström et al. 2005; Fors 2008). H2S may also react with reduced iron, and form FeS. The enhancement of sulphuric, iron and organic acids in the wood may have a long-term destructive effect on the physical integrity of the residual relict wood, and maybe lose valuable archaeological information (Fors et al. 2008). It raises the question of the preservation and protection of the archaeological underwater landscape.

found by the northern edge of the Curonian plateau at Juodkrantė (RF‐I‐E‐I; RF‐I‐B‐2; RF‐I-B‐5; Žulkus and Girininkas 2012, 2020; Žulkus et  al. 2015). These trees were growing during the Yoldia Sea lowstand period (Žulkus and Girininkas 2020), and later during the Ancylus Lake transgression the forest with discovered RF-I lagoons and lakes was submerged. There is evidence that after the transgression the water level dropped, and the shoreline of the Ancylus Lake (until 9800 cal BP) was overgrown with pines and oaks (RF-I-B and RF-I-A). Several wood stumps were found 1.3 kilometres from the shore, near Smiltynė, at a depth of 11 metres (RF‐III‐1), dated 9630–9500 cal BP (Early Littorina period) (Žulkus and Girininkas 2020). The discovered relict ‘forest’ was preserved until today by flooding with fresh and brackish water, and a cover of sediments and peat during the evolution of the Baltic Sea. Wood sample collection, preparation and analysis Relict wood samples were collected by scuba diving, by divers cutting the wood with a handsaw. Expeditions were performed in 2018 and 2019, and eight wood samples were taken. Additionally, samples from previous sampling were used for analysis. For comparison, modern pine samples were taken from the Curonian Spit and northwest Lithuania. In total, we had 14 tree samples for chemical analysis. All the samples were of a different size, part of the wood and wood hardness (Table 8.1).

Within the framework of the ‘Man and the Baltic Sea in the Meso-Neolithic: Relict Coasts and Settlements below and above the Present Sea Level. ReCoasts&People’ project, an analysis of the chemical composition of relict trees was performed, simply in order to evaluate the state of trees affected by a long period of immersion in water. Before preservation action can be taken, waterlogged wood should be assessed according to its physical condition (to know the usability and strength of the wood), morphology (to know about biological infestations and the integrity of its structure) and chemical conditions (the components of the wood at a molecular level) (Lucejko et al. 2020). For the first study, the state of the quality of the wood was performed by using S and Fe elements as an indicator in the wood. Our hypothesis is that long-submerged trees will have a higher concentration of sulphur and iron, which will be a sign of greater degradation from microorganisms. We also believe that sample size and quality are important to assess the biogeochemical processes under water.

Eleven relict pine and one oak sample dating from 11,597 to 8477 cal BP (Table 8.1) were collected from three zones. The RF-I trees are from the relict forest area growing on the shoreline of the Yoldia Sea and the Ancylus Lake, while the RF-III pines and relict oak are from the Early Littorina and the Littorina Sea. Since most of the trees are pines, another two samples of modern pine were collected from the Curonian Spit and from a forest in northwest Lithuania. It is very difficult to collect wood samples under water, so we had different-quality samples for chemical analysis, starting from small pieces of wood to part of a trunk. For this reason, during the preparation of the samples, the type of wood was evaluated by wood hardness, and we had four hardwoods from the relict trees, which were mainly large pieces of trunk, four medium samples, which were several pieces of trunk, and soft samples, and also four which were mainly small pieces of branch or parts of the trunk (near the cortex) (Table 8.1).

8.2. Methods and material Study site The exploration concentrated on the localisation of former Early Holocene coasts. During the evolution of the Baltic Sea from the Yoldia Sea to the Littorina Sea stages, the coast was covered with ancient forest. Three zones/areas of forest have been identified on the Baltic Sea shore, called RF-I, RF-II and RFIII (Fig. 8.1). They have been named based on the nearest town in Lithuania, thus, Juodkrantė (RF‐I), Melnragė (RF‐II), and Klaipėda/Smiltynė (RF‐ III‐1) and Klaipėda (RF‐III‐B, RF‐III‐C).

The wood samples underwent different phases of preparation and processing before the analysis. During the preparation phase, the samples were cleaned of overgrowth and other visible damage to the cortex. The samples were covered with mussels, barnacles and macroalgae. The processing phase included shredding by ceramic knife to avoid heavy metal contamination. Depending on the sample’s quality, all the wood samples were shredded and divided according to quality: 0–3 innermost part, 3–6 middle, and >6 outermost fragments. After the shredding, the samples were dried for 24 hours at 60oC, and later heated for four hours at 240oC in a SNOL

The RF-I forest, dated to be within an interval of 11,410– 11,060 cal BP, with roots anchored in the seabed, was 140

Sulphur content and its palaeoecological significance demonstrated in Early Holocene relict trees...

Figure 8.1. Map of relict tree sampling points. Samples taken for 14C dating and geochemical study (drawing by Vladas Žulkus). Table 8.1. Properties of relict and modern trees from the Baltic Sea region. Code of relict tree

Wood type

Age Cal BP

Baltic Sea stages/find place

Sample type/quality

Wood hardness

RF-I-E-1

Pine

11,597–10,768

Yoldia Sea

Piece of trunk close to cortex

medium

RF-I-B-2

Pine

11,008–10,825

Yoldia Sea

Piece with rings from core to cortex

medium

RF-I-E-2

Pine

11,226–10,808

Yoldia Sea

Piece of trunk close to cortex

medium

RF-I-B-5

Pine

11,185–10,585

Yoldia Sea

Branch

soft

RF-I-B-4

Pine

11,078–10,302

Yoldia Sea

Small branch

soft

RF-I-C-2

Pine

11,068-10,574

Yoldia Sea

Small piece of trunk

hard

RF-I-B

Pine

10,647–10,178

Ancylus Lake

Small pieces

soft

RF-I-A

Pine

10,499–10,225

Ancylus Lake

Several pieces of trunk

medium

RF-III-1

Pine

9757–9330

Ancylus Lake

Trunk from core to cortex

hard

RF-III-C-1

Pine

9662–9482

Ancylus Lake

Branch

hard

RF-III-A-4

Pine

8972–8477

Ancylus Lake –Early Littorina Sea

Piece of branch close to cortex

soft

RF-I-I(2)

Oak

8810–8596

Ancylus Lake –Early Littorina Sea

Trunk from core to cortex

hard

Coast LT

Pine

Modern

Terrestrial

Trunk from core to cortex

hard

Northwest LT

Pine

Modern

Terrestrial

Trunk from core to cortex

hard

141

Jolita Petkuvienė, Sergej Suzdalev and Vladas Žulkus 13/1100 LHM01 oven. Later, the heated samples were ground by a Retsch MM400 mill to 5 µm particle size. The ground wood samples were weighed and mixed with wax to make an analysis tablet. The prepared tablets were analysed with a Rentgen radius fluorescence spectrometer Xemos HE (XRF technique), performing calibration with a PAL system.

Our expectation that the oldest wood samples would have the highest concentrations of S was partly proven, while the highest values were measured in the Ancylus Lake and Yoldia Sea periods, and the lowest in Littorina and modern trees. The S concentration was related more to the size of the wood sample. The average S concentration in the Yoldia Sea period varied from 10.4 to 24.4 mg/g (av. 16.4±5.3 mg/g), and the wood was of medium and soft hardness where pieces or a small part of the trunk were collected. For the Ancylus Lake period, S varied from 11.6 to 28.1 mg/g (av. 19.9±11.7 mg/g), and this period was represented by only two pieces of small wood samples, of very soft and medium hardness. The lowest rates of relict wood were measured in the Littorina Sea wood, where the S concentration varied from 11.1 to 17.8 mg/g (av. 13.1±3.2 mg/g). The wood from this period was mostly hard, good-quality and with a well-preserved trunk. The average concentration of S in the modern wood reached 0.17±0.06 mg/g (171±56 mg/kg), which corresponded to an 87 times lower concentration compared with the

8.3. Results and discussion The sulphur (S) concentration in the relict trees varied from 10.4 to 28.1 mg/g of dry wood (Fig. 8.2). The highest amount was measured in RF-I-B-I from the Ancylus Lake period. The lowest concentration was evaluated in RF-I-C-2 from the Yoldia Sea period, while for modern pine trees which were not waterlogged, the sulphur concentration varied from 0.11 to 0.24 mg/g of dry wood. The increase in the S concentration of the wood indicates active anaerobic bacterial activity by degrading organic matter in the wood (Sandström et al. 2002; Fors 2008).

Figure 8.2. Sulphur and iron concentrations in trees from different periods.

142

Sulphur content and its palaeoecological significance demonstrated in Early Holocene relict trees... relict trees. Our measured sulphur values are in the range of S values presented by Sandström et al. (2005), which studied Vasa shipwreck wood (submerged for more than 300 years), and the S concentrations varied from 0.4 to 4 mass % S (4-40 mg/g) in the timber. An experiment by Fors et al. (2008) demonstrated that the S concentration in pinewood which was submerged for two years in the Baltic Sea close to Stockholm (Sweden) increased by ten times compared with S values in fresh untreated pinewood (52 mg/kg). Our samples lay at the bottom of the Baltic Sea for thousands of years, and the S values are quite similar. It shows that our environment is perhaps not very polluted by organic matter, or the relict trees off the Lithuanian coast are not under anaerobic conditions, which increases the action of sulphur-reducing bacteria. It may cause greater problems for the preservation of wood, while under oxic conditions organic matter degrades much faster compared with anaerobic ones (Hulthe et al. 1998).

two years with seawater and sediments, where Fe values reached 1.9–4.7 mg/g (Fors et  al. 2008). The higher Fe amount in the samples may be from iron rich sediments or corroded metal. The studies by Fors (2008; 2015) and (Björdal and Nilsson 2000) showed that the highest S values were measured on the outer wood surface, and moving deeper into the wood sample the amounts of S and Fe decreased. Results from different parts of underwater ship wood showed that the S concentration in the wood samples was 1.8% to 3.8% in the inner part of the wood, and decreased to 0.4% to 0.5% of mass moving to the core (Fors et  al. 2012). The iron concentration was higher on the surface up to 0.28% of the mass, and there were lower values at the heart of the wood 0.01% of Fe mass (Fors et al. 2012). In the RF-I-B-2 samples, we also measured the same tendencies, where the sulphur in the outer part of the wood was 19.2 (1.9%), and decreased moving towards the inside to 8.3 mg S/g (0.8% of the mass). The bacteria in the water have greater access to and contact with the surface of the organic wood matter, while the deeper parts of the wood must be affected by destructive bacteria (Sandström et al. 2005). The RFIII-1 wood sample had a different distribution of sulphur, where higher S values were measured in the inner and outer layers (Fig. 8.4). This could be due to the position of the tree in the water, while the stump was cracked and the inner part had contact with water and bacteria as well. Modern trees from the Curonian Spit had a higher S concentration in the outer part (0.24 mg/g), and lower in the inner part (0.11). Pines from northwest Lithuania had a similar distribution of S in the trunk (Fig. 4). The iron concentration decreased from the surface to the core for RF-I-B-2 and RF-III-1 pines, from 0.4–1.1 mg/g to 2.5–3.2 mg/g.

The iron (Fe) concentration in relict trees strongly and positively correlated with sulphur (r=0.6, p