Kallikrein-related peptidases: Volume 1 Characterization, regulation, and interactions within the protease web 9783110260373, 9783110260366, 9783110481518

Table of contents :
Preface
List of contributing authors
Table of Contents
Introduction to Volume 1: Kallikrein-related Peptidases. Characterization, Regulation, and Interactions Within the Protease Web
Bibliography
1 Genomic Structure of the KLK Locus
1.1 Introduction
1.2 Kallikreins in rodents
1.2.1 The mouse kallikrein gene family
1.2.2 The rat kallikrein gene family
1.3 Characterization and sequence analysis of the human KLK gene locus
1.3.1 Locus overview
1.3.2 Repeat elements and pleomorphism
1.4 Structural features of the human KLK genes and proteins
1.4.1 Common structural features
1.5 Sequence variations of human KLK genes
1.6 Regulation of KLK activity
1.6.1 At the mRNA level
1.6.2 Locus control of KLK expression
1.6.3 Epigenetic regulation of KLK gene expression
1.7 Isoforms and splice variants of human KLKs
1.8 Evolution of KLKs
Bibliography
2 Single Nucleotide Polymorphisms in the Human KLK Locus and Their Implication in Various Diseases
2.1 Introduction
2.2 KLKSNPs - data-mining from SNPdb and 1000 Genomes
2.3 Functional annotations using web-based prediction tools
2.4 Experimentally validated functional KLK SNPs
2.5 KLKSNP haplotypes and tagging
2.6 Malignant and non-malignant diseases and association with KLK SNPs
2.6.1 Association studies on high-risk variants in KLK genes
2.6.2 Association studies on low-risk variants in KLK genes
2.7 Conclusions
Bibliography
3 Evolution of Kallikrein-related Peptidases
3.1 Introduction
3.2 Basic elements of phylogenetic analysis
3.3 Evolutionary trends at the KLK locus
3.4 Evolution of the KLK1-KLK4 sublocus
3.4.1 KLK2 and KLK3 originate from a duplicated segment containing both KLK1 and KLK15
3.4.2 A large number of KLK1 tandem repeats in the house mouse
3.4.3 The rat KLK1 sublocus consists of 10 large repeats
3.4.4 Four duplications of KLK1 and KLK15 in the dog
3.4.5 A large repeat containing KLK4 in the horse
3.5 KLK genes in non-mammalian species
3.6 General conclusions and remarks on the evolution of KLK genes
Bibliography
4 Structural Aspects of Kallikrein-related Peptidases
4.1 Introduction
4.2 Individual KLK structures
4.2.1 Tissue kallikrein (KLK1)
4.2.2 Prostate specific antigen (PSA/KLK3)
4.2.3 Prostase (KLK4)
4.2.4 Stratum corneum tryptic enzyme (SCTE/KLK5)
4.2.5 Myelencephalon-specific protease or neurosin (MSP/KLK6)
4.2.6 Stratum corneum chymotryptic enzyme (SCCE/KLK7)
4.2.7 Neuropsin (KLK8)
4.2.8 Other mammalian KLK structures
Bibliography
5 Molecular Recognition Properties of Kallikrein-related Peptidases on Synthetic and Endogenous Substrates
5.1 Introduction
5.2 Substrate specificities of individual kallikrein-related peptidases
5.2.1 The classical kallikreins (KLK1, KLK2, KLK3)
5.2.2 KLK4/KLK5/KLK7
5.2.3 KLK6/KLK13/KLK14
5.2.4 KLK8/KLK10/KLK12
5.2.5 KLK9/KLK11/KLK15
Bibliography
6 Natural, Engineered and Synthetic Inhibitors of Kallikrein-related Peptidases
6.1 Introduction
6.2 KLK diversity
6.3 The KLK superfamily: Structure and catalytic mechanism
6.4 KLK inhibition: Rationale and mechanisms
6.5 Proteinaceous inhibitors
6.5.1 Kunitz domain inhibitors
6.5.2 Kazal domain inhibitors
6.5.3 Other canonical inhibitors
6.5.4 Serpins
6.6 Naturally occurring small molecule kallikrein inhibitors
6.7 Engineered KLK Inhibitors
6.7.1 Approaches to inhibitor design
6.7.2 Pharmacological challenges for therapeutic inhibitors
6.7.3 Serpins
6.7.4 Ecotin
6.7.5 Sunflower Trypsin Inhibitor (SFTI)
6.7.6 Warhead inhibitors
6.8 Conclusions and outlook
Acknowledgements
Bibliography
7 Kallikrein-related Peptidases as Pharmaceutical Targets
7.1 Introduction
7.2 KLK disease markers as potential therapeutic targets
7.3 KLKs in oncology
7.3.1 Prostate cancer
7.3.2 Ovarian and pancreatic cancer
7.4 KLKs in inflammatory skin diseases
7.4.1 Kallikrein expressions and activities in skin
7.4.2 Netherton Syndrome as most relevant clinical model
7.4.3 Atopic dermatitis, the potential major indication for kallikrein targeting
7.4.4 Psoriasis and relevance of kallikreins
7.4.5 Other potential skin disorders with kallikrein involvement
7.5 KLKs in neurological disorders
7.5.1 Alzheimer’s disease and dementia
7.5.2 Multiple sclerosis (MS)
7.6 Kallikrein inhibitors to treat human diseases
7.6.1 Design of KLK inhibitors and clinical development
7.6.2 KLK inhibitors in oncology
7.6.3 KLK inhibitors in dermatology
7.7 Conclusions and Outlook
Bibliography
8 Expression of Kallikrein-related Peptidases under (Patho-)Physiological Conditions
8.1 Introduction
8.2 KLK expression in tissues and biological fluids under physiological conditions
8.2.1 KLKs in the central and peripheral nervous system
8.2.2 KLKs in the female reproductive system
8.2.3 KLKs in the male reproductive system
8.2.4 Cellular distribution of KLKs in the gastrointestinal system
8.2.5 KLKs in the skin and skin appendages
8.2.6 KLKs in the respiratory system
8.2.7 KLKs in the urinary system
8.2.8 KLKs in lymphatic and endocrine organs (adrenal glands, thyroid gland, parathyroid glands, pituitary gland)
8.2.9 KLKs in the cardiovascular system
8.2.10 KLKs in the skeletomuscular system
8.3 Expression of KLKs in non-malignant diseases
8.3.1 Non-malignant diseases of the CNS
8.3.2 Inflammatory-related conditions
8.4 Expression of KLKs in cancer tissues
8.4.1 Cancers of the brain
8.4.2 Cancers of the female reproductive system
8.4.3 Cancers of the male reproductive system
8.4.4 Cancers of the gastrointestinal system
8.4.5 Cancers of the skin
8.4.6 Lung cancer
8.4.7 Cancers of the urinary system
8.5 Conclusion
Abbreviations
Bibliography
9 Kallikrein-related Peptidases within the Proteolytic Web
9.1 Introduction
9.2 KLKs as actors and targets during the initiation and amplification of extracellular proteolytic activity
9.2.1 The KLK-dependent KLK activome
9.2.2 Cross- and reciprocal activation of KLK and non-KLK proteases
9.2.3 Inactivation of protease inhibitors
9.3 KLKs in the termination of proteolytic activity
9.3.1 Proteolytic inactivation of (non-)KLK proteases
9.3.2 Processing of the uPA receptor
9.3.3 Disarming of the proteinase-activated receptors
9.4 Conclusion
Bibliography
10 Kallikrein-Kinin Cascade: Bioregulation by Human Tissue Kallikrein 1 (hK1, KLK1)
10.1 Discovery of classical (true) tissue kallikrein and kinins
10.2 Cellular localization
10.3 Genomics and molecular structure
10.4 Inhibitors of hK1
10.5 Modulation of membrane receptors
10.6 Epigenetic regulation
10.7 Kinin receptors and signaling
10.7.1 Receptor subtypes
10.7.2 Kinin receptor signaling
10.7.3 Regulation of kinin receptor signaling
10.8 Human disease
10.8.1 Hypertension and renal damage
10.8.2 Cardiac protection
10.8.3 Inflammation and neutrophil function
10.8.4 Cancer
10.8.5 Angiogenesis
10.9 Conclusion
Abbreviations
Bibliography
11 Role of KLK4 in Dental Enamel Formation
11.1 Introduction
11.2 Early studies implicated proteases in dental enamel formation
11.3 Investigations of enamel proteases discovered KLK4
11.4 KLK4 and amelogenesis imperfecta
11.5 Klk4 lacZ/lacZ mice
11.6 Other enamel specific genes
11.7 Role of KLK4 in enamel formation
11.8 Conclusion
Bibliography
12 Kallikrein-related Peptidases and Semen
12.1 Introduction
12.2 Expression pattern and origin of seminal KLKs
12.3 Physiological function of seminal KLKs
12.3.1 Seminal coagulation and fibrinolytic balance
12.3.2 Sperm motility
12.3.3 Reproductive immune interactions
12.4 Proteolytic pathways of seminal KLKs
12.4.1 Role of seminal zinc
12.4.2 Role of seminal KLK inhibitors
12.4.3 Other inhibitory mechanisms of seminal KLKs
12.4.4 Seminal proteolytic activation cascade
12.5 Conclusions and outlook
Abbreviations
Bibliography
13 Kallikrein-related Peptidases and Inhibitors of the Skin
13.1 Introduction
13.2 KLKs in the epidermis
13.3 Desquamation
13.4 Regulation of protease activity
13.4.1 KLK activation
13.4.2 KLK inhibitors
13.5 Skin disorders
13.6 Conclusions and outlook
Bibliography
14 Physiological and Pathophysiological Roles of Kallikrein-related Peptidases in the Central Nervous System
14.1 Introduction
14.2 KLK expression and roles in CNS physiology
14.2.1 KLK expression in the CNS
14.2.2 Physiological roles of KLKs in the CNS
14.2.3 Pathophysiological roles of KLKs in the CNS
14.3 Conclusions and outlook
Acknowledgements
Abbreviation
Bibliography
15 Kallikrein-related Peptidases (KLKs), Proteinase-mediated Signaling and Proteinase-activated receptors (PARs)
15.1 Proteinases: shocktroops ofthe innate immune response
15.2 Multiple mechanisms for proteinase-mediated signaling
15.3 Proteinases and PAR-mediated signaling
15.4 Linking PARs to the KLKs: the prostate connection
15.5 Proteolytic cascades, KLKs and the innate immune response
15.6 KLKs, other serine proteinases, PARs and inflammation
15.7 KLKs, PARs and inflammation of the central nervous system and the skin
15.8 KLKs, PARs and cancer
15.9 KLKs and PARs: Therapeutic targets for inflammatory diseases, cancer and other disorders
15.10 Blocking proteinase-mediated PAR activation: PAR-targeted blocking antibodies versus proteinase inhibitors
15.11 Summary and outlook for the future
Acknowledgements
Bibliography
Index

Citation preview

Kallikrein-related peptidases Characterization, regulation, and interactions within the protease web Magdolen, Sommerhoff, Fritz and Schmitt (Eds.)

Kallikrein-related peptidases Volume 1 Characterization, regulation, and interactions within the protease web Viktor Magdolen, Christian P. Sommerhoff, Hans Fritz, and Manfred Schmitt (Eds.) ISBN 978-3-11-026036-6 e-ISBN 978-3-11-026037-3 De Gruyter, Berlin 2012

Volume 2 Novel cancer-related biomarkers Viktor Magdolen, Christian P. Sommerhoff, Hans Fritz, and Manfred Schmitt (Eds.) ISBN 978-3-11-030358-2 e-ISBN 978-3-11-030366-7 De Gruyter, Berlin 2012

Kallikrein-related peptidases Volume 1 Characterization, regulation, and interactions within the protease web Editors Viktor Magdolen, Christian P. Sommerhoff, Hans Fritz, and Manfred Schmitt

Editors Prof. Dr. Viktor Magdolen Frauenklinik der TU München Klinikum rechts der Isar Ismaninger Str. 22 81675 München [email protected] Prof. Dr. Christian P. Sommerhoff Institut für Laboratoriumsmedizin Klinikum der LMU München Nussbaumstraße 20 80336 München [email protected]

Prof. Dr. Hans Fritz LMU München / Klinikum Innenstadt Abteilung für Klinische Chemie und Klinische Biochemie in der Chirurgischen Klinik und Poliklinik Nussbaumstraße 20 80336 München [email protected] Prof. Dr. Manfred Schmitt Frauenklinik der TU München Klinikum rechts der Isar Ismaninger Straße 22 81675 München [email protected]

Cover image: It shows kallikrein-related peptidase 4 (KLK4) in standard orientation with the inhibitor benzamidine bound to the S1 pocket, using the PDB coordinates of 2BDH (kindly provided by Peter Goettig). This book contains 54 figures and 35 tables. ISBN 978-3-11-026036-6 e-ISBN 978-3-11-026037-3 Library of Congress Cataloging-in-Publication Data A CIP catalog record for this book has been applied for at the Library of Congress. Bibliographic information published by the Deutsche Nationalbibliothek The Deutsche Nationalbibliothek lists this publication in the Deutsche Nationalbibliografie; detailed bibliographic data are available in the internet at http://dnb.dnb.de. © 2012 Walter de Gruyter GmbH, Berlin/Boston The publisher, together with the authors and editors, has taken great pains to ensure that all information presented in this work (programs, applications, amounts, dosages, etc.) reflects the standard of knowledge at the time of publication. Despite careful manuscript preparation and proof correction, errors can nevertheless occur. Authors, editors and publisher disclaim all responsibility and for any errors or omissions or liability for the results obtained from use of the information, or parts thereof, contained in this work. Illustrations: Andreas Hoffmann, Berlin Typesetting: Beltz Bad Langensalza GmbH, Bad Langensalza Printing and binding: Hubert & Co. GmbH & Co. KG, Göttingen Printed on acid-free paper Printed in Germany www.degruyter.com

Preface It was challenging to bring some semblance of order to the increasing body of information on kallikrein-related peptidases (KLKs) in normal physiology and under pathophysiological conditions. We therefore decided to cover contributions of authors, each of them an expert in the field, in two volumes of the book on Kallikrein-related peptidases. Volume 1, containing fifteen review chapters, highlights the genomic and proteomic organization of KLKs, including 3D-structures, substrate and inhibitor specificity of KLKs, interaction and regulation of KLKs within the proteolytic web, and the importance of KLKs for tooth development, the physiological function of seminal KLKs, and for non-malignant diseases such as those of the skin and the central nervous system. Different from Volume 1, the second volume presents a selection of review articles focusing on the clinical utility of KLKs in various types of solid malignant tumors. The ten chapters contained in Volume 2 summarize the clinical importance of diverse KLKs in several major types of cancer, e.g. that of the lung, the gastrointestinal and urogenital tract, the breast, and cancers of the head & neck. Each chapter is organized such that it provides an overview and interpretation of the clinical impact of certain KLKs in these types of malignancies. All chapters of Volume 1 and 2 are comprehensive, with an extensive list of cited literature references and each is designed to stand on itself, so that the reader does not need to refer back to previous reports for background information. We wish you enjoyable reading! Manfred Schmitt, Christian P. Sommerhoff, Hans Fritz, and Viktor Magdolen

List of contributing authors Jyotsna Batra Australian Prostate Cancer Research Centre-Queensland and Institute of Health and Biomedical Innovation Queensland University of Technology Brisbane, Australia and Molecular Cancer Epidemiology Institute of Medical Research Brisbane, Australia e-mail: [email protected] Chapter 2 Jane Bayani Department of Pathology and Laboratory Medicine Mount Sinai Hospital Toronto, Canada e-mail: [email protected] Chapter 8 Nathalie Beaufort Institute for Stroke and Dementia Research Klinikum der Universität München Munich, Germany e-mail: [email protected] Chapter 9 Christoph Becker-Pauly Institute of Biochemistry Unit for Degradomics of the Protease Web Christian-Albrechts-University Kiel Kiel, Germany e-mail: [email protected] Chapter 9 Kanti D. Bhoola Sir Charles Gairdner Hospital Lung Institute of Western Australia Nedlands, Australia e-mail: [email protected] Chapter 10

Wolfram Bode Max Planck Institute of Biochemistry Department of Structural Cell Biology Martinsried, Germany and Gauting, Germany e-mail: [email protected] Chapter 4 Maria Brattsand Department of Dermatology and Venereology Umeå University Umeå, Sweden and Department of Medical Biosciences, Pathology Umeå University Umeå, Sweden e-mail: [email protected] Chapter 13 Judith A. Clements Institute of Health and Biomedical Innovation Queensland University of Technology Kelvin Grove, Australia e-mail: [email protected] Chapter 2 Charles S. Craik Department of Pharmaceutical Chemistry UCSF Genentech Hall San Francisco, CA, USA e-mail: [email protected] Chapter 5 Daniela Cretu Department of Pathology and Laboratory Medicine Mount Sinai Hospital Toronto, Canada e-mail: [email protected] Chapter 1

VIII

List of contributing authors

Dalila Darmoul Institut National de la Santé et de la Recherche Médicale (INSERM-U 773) Centre de Recherche Biomédicale Bichat Beaujon (CRB3) Université Paris 7 Denis Diderot Faculté de Médecine Xavier Bichat Paris, France e-mail: [email protected] Chapter 15 Mekdes Debela Molecular Machines Group Structural Studies MRC-Laboratory of Molecular Biology Cambridge, UK e-mail: [email protected] Chapter 4 David Deperthes Med Discovery SA World Trade Center II Geneva, Switzerland e-mail: [email protected] Chapter 7 Eleftherios P. Diamandis Department of Pathology & Laboratory Medicine Mount Sinai Hospital Toronto, Canada e-mail: [email protected] Chapter 1, 8, 12 Apostolos Dimitromanolakis Department of Pathology and Laboratory Medicine Mount Sinai Hospital Toronto, Canada e-mail: [email protected] Chapter 8 Nashmil Emami Department of Pathology and Laboratory Medicine Mount Sinai Hospital Toronto, Canada e-mail: [email protected] Chapter 12

Alexander Faussner Institute for Cardiovascular Prevention Ludwig-Maximilians-University Munich, Germany e-mail: [email protected] Chapter 10 Carlos D. Figueroa Instituto de Anatomia Universidad Austral de Chile Valdivia, Chile e-mail: [email protected] Chapter 10 Peter Göttig Department of Structural Biology University of Salzburg Salzburg, Austria e-mail: [email protected] Chapter 4 Jonathan M. Harris Institute of Health and Biomedical Innovation Queensland University of Technology Brisbane, Australia e-mail: [email protected] Chapter 6 Morley D. Hollenberg Faculty of Medicine University of Calgary Calgary, Canada e-mail: [email protected] Chapter 15 John D. Hooper Mater Medical Research Institute South Brisbane, Australia e-mail: [email protected] Chapter 15 Yuanyuan Hu Department of Biologic and Materials Sciences University of Michigan School of Dentistry Ann Arbor, MI, USA e-mail: [email protected] Chapter 11

List of contributing authors

Jan C.C. Hu Department of Biologic and Materials Sciences, University of Michigan School of Dentistry Ann Arbor, MI, USA e-mail: [email protected] Chapter 11 Christoph Kündig Med Discovery SA Biopôle Epalinges, Switzerland and Dermadis SAS Technopole d’Archamps Archamps, France e-mail: [email protected] Chapter 7 Aaron M. LeBeau Department of Pharmaceutical Chemistry UCSF Genentech Hall San Francisco, CA, USA e-mail: [email protected] Chapter 5 Felicity Lose Molecular Cancer Epidemiology Queensland Institute of Medical Research Brisbane, Australia e-mail: [email protected] Chapter 2 Åke Lundwall Lund University Department of Laboratory Medicine Skåne University Hospital Malmö, Sweden e-mail: [email protected] Chapter 3 Viktor Magdolen Frauenklinik der Technischen Universität München Klinikum rechts der Isar Munich, Germany e-mail: [email protected] Chapter 4, 9

IX

Valentina Milou Ontario Institute for Cancer Research Toronto, Canada e-mail: [email protected] Chapter 8 Katerina Oikonomopoulou Department of Pathology and Laboratory Medicine Mount Sinai Hospital Toronto, Canada e-mail: [email protected] Chapter 15 Tracy O’Mara Australian Prostate Cancer Research CentreQueensland and Institute of Health and Biomedical Innovation Queensland University of Technology and Molecular Cancer Epidemiology Institute of Medical Research Brisbane, Australia e-mail: [email protected] Chapter 2 Constantina D. Petraki Pathologist Metropolitan Hospital Athens, Greece e-mail: [email protected] Chapter 8 Amelia S. Richardson Department of Biologic and Materials Sciences University of Michigan School of Dentistry Ann Arbor, MI, USA. e-mail: [email protected] Chapter 11 Isobel A. Scarisbrick Department of Physical Medicine and Rehabilitation Neurobiology of Disease Program Mayo Clinic Rochester MN, USA e-mail: [email protected] Chapter 14

X

List of contributing authors

Manfred Schmitt Frauenklinik der Technischen Universität München Klinikum rechts der Isar Munich, Germany e-mail: [email protected] Chapter 8 Andreas Scorilas Department of Biochemistry and Molecular Biology University of Athens Athens, Greece e-mail: [email protected] Chapter 1 James P. Simmer Department of Biologic and Materials Sciences University of Michigan Dental Research Lab Ann Arbor, MI, USA e-mail: [email protected] Chapter 11 Christian P. Sommerhoff Institut für Laboratoriumsmedizin Klinikum der Ludwig-Maximilians-Universität Munich, Germany e-mail: [email protected] Chapter 9

Joakim E. Swedberg Institute for Molecular Biosciences University of Queensland Brisbane, Australia e-mail: [email protected] Chapter 6 Simon J. de Veer Institute of Health and Biomedical Innovation Queensland University of Technology Brisbane, Australia e-mail: [email protected] Chapter 6 George M. Yousef Department of Laboratory Medicine St. Michael’s Hospital Toronto, Canada e-mail: [email protected] Chapter 1

Table of Contents Preface

V

List of contributing authors Table of Contents

VII

XI

Introduction to Volume 1: Kallikrein-related Peptidases. Characterization, Regulation, and Interactions Within the Protease Web 1 Bibliography 3 1 1.1 1.2 1.2.1 1.2.2 1.3 1.3.1 1.3.2 1.4 1.4.1 1.5 1.6 1.6.1 1.6.2 1.6.3 1.7 1.8

2 2.1 2.2 2.3 2.4 2.5 2.6 2.6.1

Genomic Structure of the KLK Locus 5 Introduction 5 Kallikreins in rodents 6 The mouse kallikrein gene family 7 The rat kallikrein gene family 8 Characterization and sequence analysis of the human KLK gene locus 9 Locus overview 9 Repeat elements and pleomorphism 11 Structural features of the human KLK genes and proteins Common structural features 12 Sequence variations of human KLK genes 13 Regulation of KLK activity 14 At the mRNA level 14 Locus control of KLK expression 15 Epigenetic regulation of KLK gene expression 17 Isoforms and splice variants of human KLKs 18 Evolution of KLKs 21 Bibliography 22

12

Single Nucleotide Polymorphisms in the Human KLK Locus and Their Implication in Various Diseases 31 Introduction 31 KLK SNPs – data-mining from SNPdb and 1000 Genomes 32 Functional annotations using web-based prediction tools 34 Experimentally validated functional KLK SNPs 35 KLK SNP haplotypes and tagging 36 Malignant and non-malignant diseases and association with KLK SNPs 38 Association studies on high-risk variants in KLK genes 39

XII

2.6.2 2.7

3 3.1 3.2 3.3 3.4 3.4.1 3.4.2 3.4.3 3.4.4 3.4.5 3.5 3.6

Table of Contents

Association studies on low-risk variants in KLK genes Conclusions 71 Bibliography 71

39

Evolution of Kallikrein-related Peptidases 79 Introduction 79 Basic elements of phylogenetic analysis 80 Evolutionary trends at the KLK locus 80 Evolution of the KLK1–KLK4 sublocus 82 KLK2 and KLK3 originate from a duplicated segment containing both KLK1 and KLK15 82 A large number of KLK1 tandem repeats in the house mouse 85 The rat KLK1 sublocus consists of 10 large repeats 87 Four duplications of KLK1 and KLK15 in the dog 88 A large repeat containing KLK4 in the horse 90 KLK genes in non-mammalian species 92 General conclusions and remarks on the evolution of KLK genes 93 Bibliography 94

4 4.1 4.2 4.2.1 4.2.2 4.2.3 4.2.4 4.2.5 4.2.6 4.2.7 4.2.8

Structural Aspects of Kallikrein-related Peptidases 97 Introduction 97 Individual KLK structures 98 Tissue kallikrein (KLK1) 98 Prostate specific antigen (PSA/KLK3) 100 Prostase (KLK4) 101 Stratum corneum tryptic enzyme (SCTE/KLK5) 104 Myelencephalon-specific protease or neurosin (MSP/KLK6) Stratum corneum chymotryptic enzyme (SCCE/KLK7) 108 Neuropsin (KLK8) 110 Other mammalian KLK structures 111 Bibliography 112

5

Molecular Recognition Properties of Kallikrein-related Peptidases on Synthetic and Endogenous Substrates 117 Introduction 117 Substrate specificities of individual kallikrein-related peptidases 121 The classical kallikreins (KLK1, KLK2, KLK3) 121 KLK4/KLK5/KLK7 125 KLK6/KLK13/KLK14 127 KLK8/KLK10/KLK12 129

5.1 5.2 5.2.1 5.2.2 5.2.3 5.2.4

106

Table of Contents

5.2.5

6 6.1 6.2 6.3 6.4 6.5 6.5.1 6.5.2 6.5.3 6.5.4 6.6 6.7 6.7.1 6.7.2 6.7.3 6.7.4 6.7.5 6.7.6 6.8

7 7.1 7.2 7.3 7.3.1 7.3.2 7.4 7.4.1 7.4.2 7.4.3 7.4.4 7.4.5 7.5 7.5.1 7.5.2

KLK9/KLK11/KLK15 Bibliography 132

130

Natural, Engineered and Synthetic Inhibitors of Kallikrein-related Peptidases 141 Introduction 141 KLK diversity 141 The KLK superfamily: Structure and catalytic mechanism 141 KLK inhibition: Rationale and mechanisms 143 Proteinaceous inhibitors 144 Kunitz domain inhibitors 144 Kazal domain inhibitors 146 Other canonical inhibitors 147 Serpins 147 Naturally occurring small molecule kallikrein inhibitors 148 Engineered KLK Inhibitors 149 Approaches to inhibitor design 150 Pharmacological challenges for therapeutic inhibitors 150 Serpins 150 Ecotin 151 Sunflower Trypsin Inhibitor (SFTI) 152 Warhead inhibitors 153 Conclusions and outlook 154 Acknowledgements 154 Bibliography 154 Kallikrein-related Peptidases as Pharmaceutical Targets 161 Introduction 161 KLK disease markers as potential therapeutic targets 162 KLKs in oncology 165 Prostate cancer 165 Ovarian and pancreatic cancer 167 KLKs in inflammatory skin diseases 169 Kallikrein expressions and activities in skin 169 Netherton Syndrome as most relevant clinical model 170 Atopic dermatitis, the potential major indication for kallikrein targeting 171 Psoriasis and relevance of kallikreins 172 Other potential skin disorders with kallikrein involvement 172 KLKs in neurological disorders 173 Alzheimer’s disease and dementia 173 Multiple sclerosis (MS) 173

XIII

XIV

7.6 7.6.1 7.6.2 7.6.3 7.7

Table of Contents

Kallikrein inhibitors to treat human diseases 174 Design of KLK inhibitors and clinical development 174 KLK inhibitors in oncology 176 KLK inhibitors in dermatology 179 Conclusions and Outlook 180 Bibliography 181

8

Expression of Kallikrein-related Peptidases under (Patho-)Physiological Conditions 187 8.1 Introduction 187 8.2 KLK expression in tissues and biological fluids under physiological conditions 188 8.2.1 KLKs in the central and peripheral nervous system 188 8.2.2 KLKs in the female reproductive system 192 8.2.3 KLKs in the male reproductive system 196 8.2.4 Cellular distribution of KLKs in the gastrointestinal system 198 8.2.5 KLKs in the skin and skin appendages 203 8.2.6 KLKs in the respiratory system 207 8.2.7 KLKs in the urinary system 207 8.2.8 KLKs in lymphatic and endocrine organs (adrenal glands, thyroid gland, parathyroid glands, pituitary gland) 207 8.2.9 KLKs in the cardiovascular system 211 8.2.10 KLKs in the skeletomuscular system 211 8.3 Expression of KLKs in non-malignant diseases 212 8.3.1 Non-malignant diseases of the CNS 212 8.3.2 Inflammatory-related conditions 215 8.4 Expression of KLKs in cancer tissues 217 8.4.1 Cancers of the brain 222 8.4.2 Cancers of the female reproductive system 222 8.4.3 Cancers of the male reproductive system 223 8.4.4 Cancers of the gastrointestinal system 224 8.4.5 Cancers of the skin 225 8.4.6 Lung cancer 226 8.4.7 Cancers of the urinary system 226 8.5 Conclusion 227 Abbreviations 227 Bibliography 228 9 9.1 9.2

Kallikrein-related Peptidases within the Proteolytic Web 251 Introduction 251 KLKs as actors and targets during the initiation and amplification of extracellular proteolytic activity 252

Table of Contents

9.2.1 9.2.2 9.2.3 9.3 9.3.1 9.3.2 9.3.3 9.4

10 10.1 10.2 10.3 10.4 10.5 10.6 10.7 10.7.1 10.7.2 10.7.3 10.8 10.8.1 10.8.2 10.8.3 10.8.4 10.8.5 10.9

11 11.1 11.2 11.3 11.4 11.5 11.6 11.7 11.8

The KLK-dependent KLK activome 252 Cross- and reciprocal activation of KLK and non-KLK proteases Inactivation of protease inhibitors 260 KLKs in the termination of proteolytic activity 260 Proteolytic inactivation of (non-)KLK proteases 260 Processing of the uPA receptor 261 Disarming of the proteinase-activated receptors 262 Conclusion 263 Bibliography 264

XV

256

Kallikrein-Kinin Cascade: Bioregulation by Human Tissue Kallikrein 1 (hK1, KLK1) 271 Discovery of classical (true) tissue kallikrein and kinins 271 Cellular localization 272 Genomics and molecular structure 273 Inhibitors of hK1 276 Modulation of membrane receptors 277 Epigenetic regulation 277 Kinin receptors and signaling 278 Receptor subtypes 278 Kinin receptor signaling 279 Regulation of kinin receptor signaling 280 Human disease 281 Hypertension and renal damage 281 Cardiac protection 283 Inflammation and neutrophil function 283 Cancer 286 Angiogenesis 286 Conclusion 287 Abbreviations 288 Bibliography 289 Role of KLK4 in Dental Enamel Formation 295 Introduction 295 Early studies implicated proteases in dental enamel formation Investigations of enamel proteases discovered KLK4 296 KLK4 and amelogenesis imperfecta 297 Klk4lacZ/lacZ mice 297 Other enamel specific genes 302 Role of KLK4 in enamel formation 304 Conclusion 307 Bibliography 307

295

XVI

Table of Contents

12 Kallikrein-related Peptidases and Semen 311 12.1 Introduction 311 12.2 Expression pattern and origin of seminal KLKs 12.3 Physiological function of seminal KLKs 312 12.3.1 Seminal coagulation and fibrinolytic balance 12.3.2 Sperm motility 314 12.3.3 Reproductive immune interactions 316 12.4 Proteolytic pathways of seminal KLKs 318 12.4.1 Role of seminal zinc 319 12.4.2 Role of seminal KLK inhibitors 319 12.4.3 Other inhibitory mechanisms of seminal KLKs 12.4.4 Seminal proteolytic activation cascade 321 12.5 Conclusions and outlook 322 Abbreviations 323 Bibliography 323

312 312

320

13 Kallikrein-related Peptidases and Inhibitors of the Skin 13.1 Introduction 329 13.2 KLKs in the epidermis 331 13.3 Desquamation 332 13.4 Regulation of protease activity 333 13.4.1 KLK activation 333 13.4.2 KLK inhibitors 334 13.5 Skin disorders 337 13.6 Conclusions and outlook 340 Bibliography 341

329

14

Physiological and Pathophysiological Roles of Kallikrein-related Peptidases in the Central Nervous System 349 14.1 Introduction 349 14.2 KLK expression and roles in CNS physiology 349 14.2.1 KLK expression in the CNS 349 14.2.2 Physiological roles of KLKs in the CNS 353 14.2.3 Pathophysiological roles of KLKs in the CNS 359 14.3 Conclusions and outlook 363 Acknowledgements 364 Abbreviation 364 Bibliography 364 15 15.1

Kallikrein-related Peptidases (KLKs), Proteinase-mediated Signaling and Proteinase-activated receptors (PARs) 373 Proteinases: shock troops of the innate immune response 373

Table of Contents

15.2 15.3 15.4 15.5 15.6 15.7 15.8 15.9 15.10 15.11

XVII

Multiple mechanisms for proteinase-mediated signaling 374 Proteinases and PAR-mediated signaling 376 Linking PARs to the KLKs: the prostate connection 378 Proteolytic cascades, KLKs and the innate immune response 379 KLKs, other serine proteinases, PARs and inflammation 379 KLKs, PARs and inflammation of the central nervous system and the skin 380 KLKs, PARs and cancer 382 KLKs and PARs: Therapeutic targets for inflammatory diseases, cancer and other disorders 383 Blocking proteinase-mediated PAR activation: PAR-targeted blocking antibodies versus proteinase inhibitors 387 Summary and outlook for the future 389 Acknowledgements 389 Bibliography 390 Index

399

Viktor Magdolen, Christian P. Sommerhoff, Hans Fritz, and Manfred Schmitt

Introduction to Volume 1: Kallikrein-related Peptidases. Characterization, Regulation, and Interactions Within the Protease Web Most of the concepts of proteases as biomarkers involved in physiological and pathophysiological processes have been derived from laboratory experiments, especially those on cells and tissues from laboratory animals and human subjects. Yet, it is only recently that molecular and experimental methods, reagents, tools, and instruments have become available that will allow us to locate and quantify the expression of kallikrein-related peptidases (KLKs), a group of 15 closely related, multifaceted proteases, in cells, tissues, and bodily fluids at the gene and protein level. These 15 highly homologous KLK genes are clustered on the long arm of chromosome 19 at 19q13.4. Volume 1 of this book, entitled “Kallikrein-related peptidases. Characterization, regulation, and interactions within the protease web”, encompasses 15 chapters, authored by prominent researchers working in the field of KLKs, focusing on the current knowledge of KLKs acting in normal physiology but also in neuropathophysiological disorders and skin diseases. A number of chapters deal with the evolution of the KLKs, their genomic and protein structure, KLK gene regulation, substrate specificity, their interactions with inhibitors, proteolytic enzymes from other classes and signaling molecules, and their potential as pharmaceutical targets. Other chapters provide an overview on the physiological role of KLKs, e.g. in semen, skin, the central nervous system, and during tooth development, and their pathophysiological effects upon dysregulation of expression. The companion volume 2 of this book will focus in depth on KLKs as novel biomarkers involved in various cancer diseases. The four guest editors of this book on kallikrein-related peptidases represent for a long tradition of KLK research in Munich, Germany. Actually, it was the Munich surgeon Emil-Karl Frey, a scholar of the famous ‘Geheimrat’ Ferdinand Sauerbruch at the Ludwig-Maximilians-University of Munich, and his colleague Heinrich Kraut, who, in 1925, observed a considerable reduction in arterial blood pressure when human urine was injected into dogs (Fritz et al., 2001). Unlike many other contemporary scientists, they did not attribute this effect to a toxic action of urine, but rather to the specific activity of a so-far unknown, hormone-like substance (F-substance) with potential biological functions (Frey, 1926; Frey and Kraut, 1926): “It is a substance that probably originates from several organs, is eliminated by the kidneys, and has a pronounced cardioactive and vasoactive effect: a substance that is assigned

2

Viktor Magdolen, Christian P. Sommerhoff, Hans Fritz, and Manfred Schmitt

the role of a hormone in the organism”. This F-substance was then named kallikrein (in Greek, kalli = sweet; krein = flesh) according to the Greek synonym for pancreas, kallikreas, when the three Munich scientists Frey, Kraut, and Werle found that this gland is a particularly rich source of this endogenous, hypotensive substance (Kraut et al., 1930). Some years later, Werle et al. (1937) identified kallikrein as a proteolytic enzyme, liberating the biologically highly active basic polypeptide “DK”, or kallidin, from a blood plasma protein named “kallidinogen”. Furthermore, Werle and Grunz (1939) observed the irreversible “fermental” degradation of kallidin by “kininases”, and identified them as peptidases. Hence, the fundamental knowledge of the system that we refer to today as the kallikrein-kinin system was provided by the surgeon E.K. Frey, the physiologist H. Kraut, and the chemist E. Werle, whose work was continued by members of the Department of Clinical Chemistry and Clinical Biochemistry at the University of Munich until the turn of the millennium, thus establishing a world-wide kallikrein network. Several colleagues who have been part of this network have contributed to this KLK book as well. Surprisingly, for more than fifty years, i.e. until the mid-1980s, it was common knowledge that only three homologous genes, encoding for three structurally very similar serine proteases, are located within the so-called kallikrein locus on chromosome 19q13.4, namely tissue kallikrein hK1 (KLK1), glandular kallikrein hK2 (KLK2), and hK3 (KLK3), commonly known as prostate-specific antigen PSA, an often-employed biomarker in prostate cancer. Yet, progress in molecular biology around the millennium led to the identification of 12 additional protease genes, also located in tandem on chromosome 19q13.4. Based on their chromosomal location and sequence, or structural similarities with the three traditional kallikreins, an ‘extended’ kallikrein family, now consisting of 15 serine protease genes, was thus defined (Borgoño and Diamandis, 2004; Clements et al., 2001; Schmitt and Magdolen, 2009; Yousef and Diamandis, 2001). Present evidence, covered in various chapters of volume 1 of this book, suggests that these 15 KLKs not only differ in substrate specificity but also in their biological and regulatory functions. Therefore, the various KLK proteins and their encoding genes have attracted increased attention among scientists and clinicians worldwide, since they represent very interesting, structurally and functionally distinct biomarkers, especially for neurological disorders and skin diseases and, particularly, in cancer (Borgoño and Diamandis, 2004; Clements et al., 2001; 2004; Debela et al., 2006; Pampalakis and Sotiropoulou, 2007; Schmitt and Magdolen, 2009; Yousef and Diamandis, 2001). This is why a whole new world, the KLK-world, is ready for discovery and exploitation (Fig. 0.1).

Introduction to Volume 1

3

translational studies proteomic studies

regulation

genomic studies

KLK world

structural studies

functional studies

proteolytic cascades therapeutic implication

Fig. 0.1 The 15 different KLKs are in focus of biological and clinical interest, stimulating studies centering on the structure, function, and regulation of these proteases at the gene and protein level. KLKs may also serve as biomarkers to predict clinical outcome of patients or to act as therapeutic targets to be inhibited by targeted drugs.

Bibliography Borgoño, C.A., and Diamandis, E.P. (2004). The emerging roles of human tissue kallikreins in cancer. Nat. Rev. Cancer 4, 876–890. Clements, J., Hooper, J., Dong, Y., and Harvey, T. (2001). The extended human kallikrein (KLK) gene family: genomic organization, tissue-specific expression and potential functions. Biol. Chem. 382, 5–14. Clements, J., Willemsen, N., Myers, S., and Dong, Y. (2004). The tissue kallikrein family of serine proteases: functional roles in human diseases and potential as clinical biomarkers. Crit. Rev. Clin. Lab. Sci. 41, 265–312. Frey, E.K. (1926). Zusammenhänge zwischen Herzarbeit und Nierentätigkeit. Arch. Klin. Chir. 142, 663–669. Frey, E.K., and Kraut, H. (1926). Über einen von der Niere ausgeschiedenen, die Herztätigkeit anregenden Stoff. Hoppe-Seyler’s Z. Physiol. Chem. 157, 32–61. Fritz, H., Jochum, M., and Müller-Esterl, W. (2001). Kinins 1925–2000. Biol. Chem. 382, 3–4. Kraut, H., Frey, E.K., and Werle, E. (1930). Der Nachweis eines Kreislaufhormons in der Pankreasdrüse. Hoppe-Seyler’s Z. Physiol. Chem. 189, 97–106. Pampalakis, G., and Sotiropoulou, G. (2007). Tissue kallikrein proteolytic cascade pathways in normal physiology and cancer. Biochem. Biophys. Acta 1776, 22–31. Schmitt, M., and Magdolen, V. (2009). Using kallikrein-related peptidases (KLK) as novel cancer biomarkers. Thromb. Haemost. 101, 222–224. Werle, E., and Grunz, M. (1939). Zur Kenntnis der darmkontrahierenden und blutdrucksenkenden Substanz DK. Biochem. Z. 301, 429–436. Werle, E., Götze, W., and Keppler, A. (1937). Über die Wirkung des Kallikreins auf den isolierten Darm und über eine neue darmkontrahierende Substanz. Biochem. Z. 289, 217–233. Yousef, G.M., and Diamandis, E.P. (2001). The new human tissue kallikrein gene family: structure, function and association to disease. Endocr. Rev. 22, 184-204.

Daniela Cretu, George M. Yousef, Andreas Scorilas, and Eleftherios P. Diamandis

1 Genomic Structure of the KLK Locus 1.1 Introduction Kallikrein-related peptidases (KLK) are a group of serine proteases that are found in diverse tissues and biological fluids. The term ‘kallikrein’ was introduced in the 1930s by Heinrich Kraut and colleagues, who found a hypotensive substance in urine and in the pancreas (in Greek, kalli = sweet; krein/kreos = flesh) (Yousef et al., 2000; Yousef and Diamandis, 2001; 2003). Today, the substance is known as kallikrein 1 (KLK1) or tissue kallikrein, an enzyme that generates Lys-bradykinin via specific proteolysis of kininogen 1. KLK1 is also termed glandular kallikrein, to differentiate it from the plasma kallikrein (KLKB1), discovered later. Mason et al. (1983) reported that the mouse and rat genomes carry several genes that are closely related to human KLK1 (Yousef et al., 2000; Yousef and Diamandis, 2001; 2003). These homologous genes were assigned to a novel gene family, known as the glandular kallikrein gene family, and the number of genes was estimated at 25 in the mouse, and 10 in the rat. Initially, only three glandular kallikreins were identified in humans: KLK1 (Riegman et al., 1992), KLK2, initially named human glandular kallikrein 1, and KLK3, also known as prostate specific antigen (PSA) (see Chapter 10 and also Chapter 4 of Volume 2). In 2000, three research groups (Gan et al., 2000; Harvey et al., 2000; Yousef et al., 2000) independently discovered that the human KLK locus on the long arm of chromosome 19 carries a number of genes (Grimwood et al., 2004) encoding serine endopeptidases, which are also related to KLK1 (Riegman et al., 1992; Yousef and Diamandis, 2001). These genes were merged with the existing “classical” genes at the KLK locus, to form the extended KLK gene family. To prevent any confusion with regard to the glandular rodent kallikreins, a new, comprehensive nomenclature was defined (Lundwall et al., 2006a). All genes at the human locus, except for KLK1, are denoted kallikrein-related peptidases or KLKs and are numbered in the order of their discovery (Tab. 1.1). The kallikreins are now divided into two major categories: plasma kallikrein and tissue kallikreins (Yousef et al., 2000; Yousef and Diamandis, 2001; 2003). These two categories differ significantly in their molecular weight, substrate specificity, gene structure and type of kinin released. Plasma kallikrein (KLKB1) is encoded by a single gene located on human chromosome 4q35 (Yu et al., 1998). The gene is composed of 15 exons and encodes an enzyme that releases the bioactive peptide bradykinin from high-molecular-weight kininogen produced by the liver. The major function of KLKB1 is its participation in the process of blood clotting and fibrinolysis and, through the release of bradykinin, in the regulation of vascular tone and inflammatory reactions (Bhoola et al., 1992). Plasma kallikrein will not be further discussed here, since the gene encoding this enzyme has no major similarities with the tissue kallikrein genes

6

Daniela Cretu, George M. Yousef, Andreas Scorilas, and Eleftherios P. Diamandis

Tab. 1.1 Official and other gene and protein names for members of the human kallikrein gene familya Official gene name

Aliases

Entrez Gene ID

Unigene cluster

KLK1

pancreatic/renal kallikrein (hPRK), tissue kallikrein human glandular kallikrein-1 (hGK-1), tissue kallikrein-2 prostate-specific antigen (PSA), antigen prostate-specific (APS), gamma-seminoprotein, P-30 antigen, semenogelase KLK-L1, enamel matrix serine protease 1 (EMSP1), prostase serine protease 17 (PRSS17) KLK-L2, stratum corneum tryptic enzyme (SCTE) zyme, protease M, neurosin, serine protease 9 (PRSS9), serine protease 18 (PRSS18) stratum corneum chymotryptic enzyme (SCCE), serine protease 6 (PRSS6) neuropsin (NP), tumor-associated differentially expressed gene 14 protein (TADG14), serine protease 19 (PRSS19), ovasin KLK-L3 normal epithelial cell-specific (NES1), protease serine-like 1 (PRSSL1) trypsin-like serine protease (TLSP), hippostasin, serine protease 20 (PRSS20) KLK-L5 KLK-L4 KLK-L6 ACO, HSRNASPH, prostinogen

3816

Hs. 123107 S01. 160

P06870

3817

Hs. 515560 S01. 161

P20151

354

Hs. 171995 S01. 162

P07288

9622

Hs. 218366 S01. 251

Q9Y5K2

25818

Hs. 50915

S01. 017

Q9Y337

5653

Hs. 79361

S01. 236

Q92876

5650

Hs. 151254 S01. 300

P49862

11202

Hs. 104570 S01. 244

O60259

284366 5655

Hs. 448942 S01. 307 Hs. 275464 S01. 246

Q9UKQ9 O43240

11012

Hs. 57771

S01. 257

Q9UBX7

43849 26085 43847 55554

Hs. 411572 Hs. 165296 Hs. 283925 Hs. 567535

S01. 020 S01. 306 S01. 029 S01. 081

Q9UKR0 Q9UKR3 Q9P0G3 Q9H2R5

KLK2 KLK3

KLK4

KLK5 KLK6

KLK7 KLK8

KLK9 KLK10 KLK11 KLK12 KLK13 KLK14 KLK15

Merops ID UniProt ID

a According to the Human Gene Nomenclature Committee [www.gene.ucl.ac.uk/nomenclature]

and is not a member of this multigene family. The phylogenetics of the tissue kallikrein family is discussed in detail in Chapter 3.

1.2 Kallikreins in rodents Kallikrein genes and proteins have been identified in six different mammalian orders: Primates, Rodentia, Carnivora, Proboscidea, Perissodactyla, and Artiodactyla (Meyer, 2001). The number of kallikrein genes varies among species. In this section, a quick

7

Genomic Structure of the KLK Locus

Kl k1 4

KL K1 3 KL K1 4 Kl k1 3

Kl k Kl 6 k7 Kl k8 Kl k Kl 9 k1 Kl 0 k1 Kl 1 k1 2

Kl k5

KL K5 KL K6 KL K7 KL K KL 8 K9 KL K KL 10 K KL 11 K1 2

KL KP 1 KL K4 Kl k4

Kl k2 -p s

Kl k1 Kl k1 5

rat KLK locus 1q22

KL K2

KL K3

KL K KL 1 K1 5

human KLK locus 19q13.3-13.4

Kl k1 4

Kl k1 3

Kl k7 Kl k8 Kl k Kl 9 k1 Kl 0 k Kl 11 k1 2

Kl k5 Kl k6

Kl k1 5

Kl k1

Kl k2 -p s Kl k4

2 c1 ps k1 2Kl 5c1 ps k1 2Kl 2c1 k 0 s Kl 1c1 0-p k 1 Kl 5c k1 Kl 0-ps c1 k2 Kl 1c4 -ps k 4 Kl 15c k s Kl -p c4 s k2 Klk1c66-p Kl 15c -ps k Kl 2c6 k Kl c2 s k1 -p Kl 5c2 k1 s Kl -p c2 s k2 -p Kl c8 k2 ps Kl 85c k1 Kl 1c8 ps k Kl c9 k2 Kl ps 95c k1 Kl 1c9 s k p Kl c7k2 Kl ps 75c k1 Kl 1c7 ps k Kl 2c3 s k Kl 3-p 5c k1 Kl 3 c k1 Kl

mouse KLK locus 7B4

s -p b7 k1 Kl b8 ps k1 Kl 1b2 k Kl 1b1 k Kl b9 s k1 Kl 10-p b k1 1 s Kl 1b12-p k Kl 1b16 k 2 s Klk1b 8-p Kl 1b1 -ps k 8 Kl 1b2 s p k Kl 19b k1 7 Kl b2 k1 Kl ps 4b1 k1 Kl ps 5b1 k1 1 Kl b2 k1 2 Kl 1b2 ps k 3Kl 2 b k1 Kl 6 b1 k1 Kl

4 b2 k1 Kl 1b3 k Kl 4 b k1 Kl 5 b k1 Kl

Fig. 1.1 KLK locus organization. The orientation and approximate position of the KLK genes are shown for human, mouse, and rat. Arrowheads indicate the approximate location of the genes, and the direction of transcription. Pseudogenes are highlighted in yellow, while the “classical” KLKs are colored in red. Nonclassical KLKs are shaded in blue. Adapted from Emami and Diamandis (2007).

overview of kallikrein families in mice and rats will be provided, with special emphasis on their structural and localization similarities to the human KLKs (Fig. 1.1).

1.2.1 The mouse kallikrein gene family In the mouse, kallikreins are represented by a large multigene family, which includes 26 genes. Among those, at least 14 genes were presumed to encode serine proteases (Evans et al., 1987). Here follows a brief summary of data from the Mouse Genome Project http://www.ncbi.nlm.nih.gov/projects/genome/guide/mouse/) (Olsson and Lundwall, 2002): mouse tissue kallikrein genes reside in a locus that spans approximately 530 kb on chromosome 7. Data from the Human/Mouse Homology maps (http://www.ncbi.nlm.nih.gov/Homology/) show that this region is highly syntenic to the human chromosome 19q13. 4 (Fig. 1.1), which harbors the human KLK genes

8

Daniela Cretu, George M. Yousef, Andreas Scorilas, and Eleftherios P. Diamandis

(up to 75% sequence similarity). Sequence analysis indicated the presence of possible mouse orthologues for the human KLK1 and KLK4-15, but not for the classical kallikreins KLK2 and KLK3. Comparison of the human and mouse kallikrein loci indicated that, while the distance between the human KLK1 and KLK15 genes is only 1.5 kb, the same area in the mouse genome is 290 kb in length and harbors the rest of the mouse kallikreins (Olsson and Lundwall, 2002). All mouse kallikrein genes are transcribed in the same direction and share a high degree of structural homology at both the mRNA and protein levels (70–90%). They also share the same genomic organization, comprised of five coding exons and four introns, with completely conserved exon-intron splice sites. A TATA box variant “TTAAA” and consensus polyadenylation signal sequences were found in all mouse kallikreins (Evans and Richards, 1985; Mason et al., 1983; van Leeuwen et al., 1986). The mouse kallikreins were initially denoted mGK1-mGK25 (Evans et al., 1987), but a new nomenclature has since been defined for all rodent as well as human kallikrein genes (Lundwall et al., 2006a).

1.2.2 The rat kallikrein gene family In the rat, 13 kallikrein genes were initially discovered, linked to 2 gene clusters, spanning 475 kb on chromosome 1 (MacDonald et al., 1996). Three genes were identified as pseudogenes, while 10 coded for KLK proteins. Data from the Rat Genome Database (http://rgd.mcw.edu/) indicated the possibility of the existence of additional kallikreins in the rat genome. Like the mouse and human kallikreins, rat kallikreins are clustered in the same chromosomal region and share a high degree of structural similarity. They consist of a conserved structure of five coding exons and four introns, with most of the similarity in the exonic, rather than intronic regions (Southard-Smith et al., 1994). As is the situation in the human and the mouse, only one rat kallikrein (rKLK1) meets the functional definition of a kallikrein (Ashley and MacDonald, 1985). As demonstrated by Olsson et al., the rat KLK locus actually spans approximately 580 kb on chromosome 1q22. It contains 22 genes and 19 pseudogenes and is devoid of KLK2 and KLK3 orthologs (Olsson et al., 2004). This locus contains 9 duplications of a ~ 30 kb region, harboring the KLK1, KLK15 and pseudogene ΨKLK2 (Klk2-ps), resulting in 9 paralogs of each gene, located between ΨKLK2 and KLK4. However, only the KLK1 paralogs seem to be functional.

Genomic Structure of the KLK Locus

9

1.3 Characterization and sequence analysis of the human KLK gene locus 1.3.1 Locus overview The first comprehensive attempt to characterize the human kallikrein locus was reported by Riegman et al. (1992), who proposed that the locus is formed by only three genes, KLK1, 2, 3. These three genes were clustered in a 60-kb region on chromosome 19q13.4. Their alignment in the genome is Centromere-KLK1-KLK3-KLK2-Telomere. KLK2 and KLK3 are transcribed in the direction from centromere to telomere, KLK1 in the opposite direction (Riegman et al., 1989b; 1992; Yousef et al., 2000). With the discovery of all 15 human KLK genes, the human KLK gene locus has been characterized with high accuracy. Precise mapping of each of the 15 members of the human KLK gene family, determination of the distances between them, and their directions of transcription (Yousef et al., 2000) have been achieved (Tab. 1.2). The human tissue KLK gene locus spans a region of 265,098 bp on chromosome 19q13.313.4 and is formed by 15 KLK genes, where differences in gene lengths are attributed to discrepancies in noncoding regions (Fig. 1.2 and Tab. 1.2). A KLK pseudogene, known as KLKP1, lying between KLK2 and KLK4 has been cloned (Gan et al., 2000). Exons 3 and 4 of KLKP1 are homologous to a segment spanning from Intron 1 to Intron 2 of KLK1-3, and give rise to four different transcripts, including ΨKLK1, KLK31P-short, KLK31P-long, and KRIP1 (Kaushal et al., 2008; Lu et al., 2006). There exists evidence of other KLK pseudogenes which, however, remain to be experimentally identified. The centromeric end of the KLK locus is bordered by several small nucleolar RNAs and C19orf48, a major histocompatibility antigen with no known function (Lawrence et al., 2010). The KLK locus is bordered telomerically by the CD33rSiglec gene family of Ig-like lectin receptors (Yousef et al., 2002). Intergenic spacing between the KLK genes is variable, ranging from approximately 1.5 kb between KLK1 and KLK15 to 32.5 kb between KLK4 and KLK5. Like KLK1, and unlike KLK2 and KLK3, all KLKs are transcribed from telomere to centromere. Detailed information about the locus is presented in Fig. 1.1 and Tab. 1.2. The KLK genomic organization can be disrupted and this event has been studied primarily in tumor cells. For example, in a prostate cancer specimen, fusion between Exon 1 of KLK2 and ETV4, a transcription factor on chromosome 17q21, was identified (Hermans et al., 2008). Also, copy number gains of the KLK locus have also been identified in breast, bladder, and ovarian cancer cell lines and tissues (Bayani et al., 2008; Ni et al., 2004; Shinoda et al., 2007). These alterations are reviewed in detail in Chapter 9 of Volume 2.

10

Daniela Cretu, George M. Yousef, Andreas Scorilas, and Eleftherios P. Diamandis

Tab. 1.2 Coordinates of all genes and pseudogenes contained within the human KLK locus. Numbers are given according to GenBank Contig NT_011109. 16. Name

Strand

Start

End

Length

# of exons

KLK1

–

51322404

51327043

4640

5

KLK15

–

51328545

51334779

6235

5

KLK3

+

51358171

51364020

5850

6

KLK2

+

51376689

51383823

7135

5

KLKP1

–

51385352

51399654

14303

1

KLK4

–

51409608

51413994

4387

6

KLK5

–

51446559

51456344

9786

6

Inter-gene region

1501 23391 12668 1528 9953 32564 5542 KLK6

–

51461887

51472929

11043

7

KLK7

–

51479729

51487294

7566

6

KLK8

–

51499264

51504958

5695

6

KLK9

–

51505769

51512890

7122

5

KLK10

–

51516000

51523431

7432

6

KLK11

–

51525487

51531290

5804

6

KLK12

–

51532348

51538486

6139

6

KLK13

–

51559463

51568367

8905

5

6799 11969 810 3109 2055 1057 20976 12206 KLK14

–

51580574

51587502

6929

8

11

Genomic Structure of the KLK Locus

KLK mRNA transcript 5’ UTR 5’

coding exons 1

I

2

II

3

3’ UTR I

4

0

5

3’

Fig. 1.2 Schematic representation of an mRNA transcript, representing all human KLKs. KLK genes range from 4–14 kb in length and contain 5 coding exons and 4 intervening introns, with a conserved intron phase pattern of I, II, I, 0. Coding exons in blue boxes are similar, if not identical, among KLK genes, while intron lengths vary considerably. With the exception of the “classical” KLKs, most KLK genes also contain one or two noncoding exons (red boxes) in the 5ʹ UTR. The 3ʹ UTR is known to vary in length.

1.3.2 Repeat elements and pleomorphism The KLK locus was also analyzed for the presence of repeat elements (Yousef et al., 2001). The entire sequence has 49.59% GC content, which is comparable to other genomic regions, and approximately 34–52% of the region was found to contain various repetitive elements (on both strands). The most abundant repeats are short interspersed nuclear elements (SINE), such as ALU and mammalian wide interspersed repeats (MIR), followed by the long interspersed nuclear elements (LINE), which represent 22.53% and 13.1% respectively, of the KLK locus. Other repeat elements, including Tigger2, MER8, and MSR1 were also identified in KLK4 introns (Hu et al., 2000). The human kallikrein locus contains a unique minisatellite element (AGTCCAGGCCCCCAGCCCCTCCTCCCTCAGACCCAGG), known as MSR1, which is predominantly (although not exclusively) located within the chromosomal band 19q13.2-13. 4 (Das et al., 1987; Yousef et al., 2001). Ten clusters of this minisatellite are distributed along the kallikrein locus, and are mainly located in the promoters and enhancers of genes, as well as in introns of KLK6, 7, 14 and in the 3ʹ untranslated regions of KLK4 and KLK14 (Hooper et al., 2001; Kaushal et al., 2008; Nelson et al., 1999; Yousef et al., 2001). Data indicates that the distribution of the different alleles of these minisatellites within the KLK4 and KLK14 3ʹ UTR might be associated with malignancy (Yousef et al., 2001). Although their functional significance has not been elucidated, it is believed that they affect the stability of KLK mRNA transcripts. Similarly, KLKP1 contains three “exonized” repetitive elements: an AluY repeat for Exon 1, an MLT2A2 long-terminal repeat for Exon 2, and an ERVL endogenous retrovirus-related repeat for Exon 5 (Lu et al., 2006).

12

Daniela Cretu, George M. Yousef, Andreas Scorilas, and Eleftherios P. Diamandis

1.4 Structural features of the human KLK genes and proteins Apart from their co-localization in the genome, the KLK genes also share structural and functional similarities. Extensive analyses over the past few years have led to the identification of many common structural features of KLKs. Some of these features are shared with other members of the S1 family of serine proteases.

1.4.1 Common structural features The common structural genomic features of KLKs can be summarized as follows (Fig. 1.2) (Diamandis and Yousef, 2001; Yousef and Diamandis, 2001; 2003; Yousef et al., 2002): 1. All genes possess 5 coding exons (except for a KLK4 variant, which has four exons), and most of them have one or two extra 5ʹ untranslated exons. The first coding exon (Exon 1) always contains the 5ʹ UTR, followed by the methionine start codon, located 37–88 bp away from the end of the exon. The last coding exon (Exon 5) contains the stop codon, located 150–189 bp from the beginning of Exon 5, and the 3ʹ UTR. 2. Exon sizes are conserved in size and arrangement (Diamandis and Yousef, 2002). 3. The intron phases of the coding exons (i.e. the position where the intron starts in relation to the last codon of the previous exon) are conserved in all genes. The pattern of the intron phase is always I-II-I-0. Splice site sequences between coding exons are also consistent (Tab. 1.3), with the exception of KLK10, which contains a variant splice site for Intron 4 (Yousef and Diamandis, 2001). 4. Classical or variant polyadenylation signals have been found 10 to 20 bases away from the poly-A tail of all KLK mRNAs (Tab. 1.3). All three classical KLKs have the same variant polyadenylation signal AGTAAA (Evans et al., 1987; Lundwall, 1989; Riegman et al., 1989a and b; Schedlich et al., 1987). 5. Multiple alignments of all KLK proteins have been published previously (Yousef and Diamandis, 2001). In contrast to the coding regions, differences exist between the UTRs, and the size and sequence of introns vary considerably between kallikreins (Gan et al., 2000). Most human KLK genes have one to three additional upstream exons, which have arisen from alternative transcription start sites, but many of the noncoding exons remain to be experimentally validated, as they have only been predicted in silico.

Genomic Structure of the KLK Locus

13

1.5 Sequence variations of human KLK genes Sequence changes, including polymorphisms and mutations, are clinically important, since they can be indicators for susceptibility to and prognosis of different malignancies (Bharaj et al., 2000). In this respect, KLK3 is the most extensively studied kallikrein. Comparison of the published mRNA sequences of KLK3 reveals infrequent and inconsistent sequence variations. Baffa et al. found no evidence of mutations in the KLK3 mRNA sequence in prostate cancer, compared to matching normal tissues from the same patient (Baffa et al., 1996). Similarly, no mutations were found in the coding portion of the KLK3 gene in breast cancer tissues and cell lines, with the exception of a polymorphism in Exon 2 in some breast tumors (Majumdar and Diamandis, 1999). Three distinct forms of KLK1 mRNA, differing in one or two amino acid substitutions, were identified in different tissues (Angermann et al., 1989; Baker and Shine, 1985; Fukushima et al., 1985), but experimental evidence, however, indicates that the protein products of these variants display no difference in their protein activity (Chan et al., 1998). Probably the most polymorphic sequence of KLK4 is the one identified by Hu et al. (2000). In addition to a large insertion in the 3ʹ untranslated region, there are 18 differences between their sequence and those identified by others. These probable polymorphisms will affect the derived amino acid product (Hu et al., 2000). The polymorphic and mutational status of the KLK10 gene was examined in detail (Bharaj et al., 2002), using DNA isolated from normal tissues and from cancers of the breast, ovary, prostate, and testis. The group confirmed that the KLK10 gene does not seem to be a target for somatic mutations in either breast, ovarian, prostate, or testicular cancer, however, a germline single nucleotide variation in Exon 3 of the KLK10 gene has been identified that changes the respective amino acid from alanine to serine. This polymorphism is less prevalent in prostate cancer patients compared to control subjects (Bharaj et al., 2002). Four additional polymorphisms were identified in Exon 4 of the same gene. Within a 5.8 kb promoter/enhancer region of KLK3, 16 different mutational hotspots (appearing more than once in every 9 tumors) were found in breast cancer (Majumdar and Diamandis, 1999). A single nucleotide variation (G → A) was identified at position –158 (deemed –158 G/A polymorphism) within androgen response element 1 (ARE-1), which has been previously associated with an increased serum PSA and increased risk of developing prostate cancer (Cramer et al., 2003). Variations seen in these associations of the −158 G/A polymorphism with serum PSA levels are likely to be due to linkage disequilibrium (the dependence of an allele at one locus on alleles at another locus) of the −158 G/A polymorphism with other polymorphisms in the PSA gene and its promoter (Cramer et al., 2003). Specifically, the A allele of the −158 G/A SNP is linked exclusively to the far upstream haplotype, −5429T/−5412T/−4643A, which is associated with reduced promoter activity in vitro (Cramer et al., 2003). The examination of sequence variations within the 300 kb KLK locus remains high on the agenda, and such recent advances are discussed in detail in Chapter 2.

14

Daniela Cretu, George M. Yousef, Andreas Scorilas, and Eleftherios P. Diamandis

1.6 Regulation of KLK activity KLK regulation is achieved by an assortment of stimulatory and inhibitory factors, which influence many signaling pathways. A more comprehensive understanding of these regulatory mechanisms may provide some much needed insight into the role of KLKs in (patho-)physiological conditions, as described in Chapter 8.

1.6.1 At the mRNA level Promoter analysis and hormonal stimulation experiments have provided insights into the mechanisms that regulate expression of the human KLK genes. TATA box variants are found in the three classical KLKs. KLK1 has the variant, TTTAAA, whereas KLK2 and KLK3 share another variant, TTTATA (Evans et al., 1987; Lundwall, 1989; Riegman et al., 1989a and b; Schedlich et al., 1987). Apart from KLK2-4, 10, no obvious TATA boxes were found in the promoter region of other KLKs. Tab. 1.3 summarizes all functionally tested or predicted promoter elements of the KLKs. For a subset of tissues, it is clear that KLK expression is regulated by hormones including androgens, estrogens, progestins, mineralcorticoids, and glucocorticoids.

Tab. 1.3 TATA, polyadenylation signals; and splice/junctions for the KLK genesa,e Gene

TATA box

Polyadenylation signald

Splice junctions

KLK1 KLK2 KLK3 KLK4 KLK5 KLK6 KLK7 KLK8 KLK9 KLK10 KLK11 KLK12 KLK13 KLK14 KLK15

TTTAAA (–21 bp)b TTTATA (–35 bp) TTTATA (–22 bp) TTATAA (–30 bp) Not found Not found Not found Not found Not found TTAAAA (–35 bp) Not found Not found Not found Not found Not foundc

AGTAAA (–15 bp) AATAAA (–19 bp) AATAAA (–16 bp) AATAAA (–15 bp) AATAAA (–8 to –11 bp) AATAAA (–14 bp) AATAAA (–16 bp) AATAAA (–15 to –18 bp) AGTAAA (–14 bp) ACTAAA (–17 bp) AATAAA (–17 bp) AATAAA (–16 bp) TATAAA (–16 bp) Putative AATAAA ATTAAA (–17 bp)

Fully conserved Fully conserved Fully conserved Fully conserved GC for GT at 5ʹUTR Fully conserved Fully conserved Fully conserved Fully conserved GC for GT at beginning of Intron 4 Fully conserved Fully conserved Fully conserved Fully conserved Fully conserved

a The information was derived from the EntrezGene ID entries shown in Tab. 1.1. b Denotes position of TATA box, taking the first nucleotide of start codon as 1; bp, base pair. c TATA box may be present in some genes for which the 5ʹ-proximal promoter sequences have not as yet been accurately defined. d Position of polyadenylation signal in base pairs before the poly-A tail. e This table was adapted from Yousef and Diamandis (2003).

Genomic Structure of the KLK Locus

15

Regulation by steroid hormones is achieved when a ligand-bound nuclear receptor binds to hormone response elements (HRE) in the promoter of target genes (Scheidereit et al., 1983). These HREs are commonly composed of palindromic repeats of the sequence 5ʹ-TGTTTCT-3ʹ separated by three nucleotides (5ʹ-AGAACAnnnTGTTCT-3ʹ) (Scheidereit et al., 1983). Two androgen response elements (AREI and AREII) have been identified and verified experimentally (Cleutjens et al., 1996). Another ARE was mapped in the far upstream enhancer region of the gene (AREIII) and shown to be functional and tissue-specific (Brookes et al., 1998; Cleutjens et al., 1997). More recently, five additional, low affinity AREs have been identified close to ARE-III (Huang et al., 1999) (AREIIIA, AREIIIB, AREIV, AREV, AREVI), and three distinct regions surrounding ARE-III were found to bind ubiquitous and cell-specific proteins. KLK2 and KLK3 promoters share over 80% sequence identity in the –1 to –196 bp and –1673 to –4165 bp region, starting from the KLK2 transcription start site (TSS). It is therefore not surprising that a functional ARE was also identified within the KLK2 promoter and enhancer (Murtha et al., 1993), which is almost identical in both the location (–160 bp) and sequence of ARE1 of KLK3. Likewise, AREII was identified between –3819 and –3805 bp of the KLK2 promoter (Yu et al., 1999). Interestingly, a negative regulatory element was also found between -468 and -323 bp of KLK2 (Murtha et al., 1993). Apart from the classical KLKs, data has been accumulating, which documents regulation of KLK4-15. A known KLK4 transcript has been shown to be regulated from an alternative TSS in Exon 2 (Korkmaz et al., 2001; Lai et al., 2009). Additionally, several putative AREs have been identified in silico (Stephenson et al., 1999). Numerous Glucocorticoid Response Elements (GRE) half-sites have also been identified in the promoters of KLK5-8, 10, 13 in silico, while Estrogen Response Element half-sites have been identified upstream of KLK5 and KLK7 (Li et al., 2009), but these remain to be experimentally validated. A vitamin D response element (AGTTCAacgAGTTCT) has been identified 489 bp upstream of the KLK6 TSS, and putative sites may also be present upstream of KLK5, 7, 8, 10, 13 (Lu et al., 2005). Furthermore, up-regulation of KLK10 can also be achieved by retinoic acid, which has been shown to bind a retinoic acid response element located 1014 bp upstream of KLK10 (Zeng et al., 2006). Although ample in silico evidence exists, with regard to hormone and nonhormonal regulation of KLKs, these findings must be validated experimentally. Given that KLKs are colocalized in the genome and most often coexpressed in tissues, there is speculation that they are also regulated by shared enhancer elements.

1.6.2 Locus control of KLK expression The parallel differential regulation of groups of KLKs in (patho)physiological conditions, e.g. the up-regulation of a number of KLKs in ovarian cancer (Yousef et al., 2003b) raises the possibility of the existence of a common mechanism that controls

16

Daniela Cretu, George M. Yousef, Andreas Scorilas, and Eleftherios P. Diamandis

expression of groups of KLK genes in a cluster, known as a “locus control region”. Clustering of co-expressed homologous genes could be explained by the evolutionary history of the genomic region. In this case, the probable mechanism would include local duplication and divergence of amplified copies, resulting in an array of paralogues that may retain common regulatory elements (Boutanaev et al., 2002). This is evident from the relatively short distances between adjacent KLKs, which could be as short as the 1.5 kb between KLK1 and KLK15 (Yousef et al., 2002), and the absence of classic promoter sequences, as shown by prediction analysis, in all KLKs except KLK2 and KLK3. A number of studies has shown that two sequence elements are essential for initiating DNA replication of an adjacent group of beta globin genes: the initiation region (IR) and the locus control region (LCR), residing 50 kb upstream of the IR. The beta globin LCR is located 6–20 kb upstream of a cluster of 5 functional globin genes, and consists of five DNAse hypersensitive sites (HS) and numerous binding sites for transcription factors. LCRs are operationally defined by their ability to enhance the expression of linked genes to physiological levels in a tissue-specific and copy-number-dependent manner (Li et al., 1999). Although their composition and locations relative to their cognate genes are different, LCRs have been described in a broad spectrum of mammalian gene systems, suggesting that they play an important role in the control of eukaryotic gene expression. In one particular study (Wei et al., 1998), maximal KLK3 expression in transgenic mice requires both the KLK2 and KLK3 enhancers, suggesting that KLK2 AREII may act as a shared enhancer for KLK2 and KLK3, but further experiments must be conducted to validate this hypothesis. Other intergenic sequences, such as domain boundaries or barriers, and chromatin architecture may also be involved. Acquisition of knowledge about these processes is a key step towards the understanding of the role of KLKs in normal physiology and pathobiology. It might, therefore, be worthwhile to also investigate whether KLK2 and KLK3 enhancers influence the expression of other KLKs, especially KLK4, KLK15, and KLKP1, which are clustered around KLK2 and KLK3 (Lawrence et al., 2010). Another proposed regulatory mechanism would be gene potentiation, which is the process of opening a chromatin domain that will render genes accessible to the various factors required for their expression. The formation of an open chromatin structure is central to the establishment of cell fate and tissue-specific gene expression. Many eukaryotic genes are organized into functional chromatin domains, which facilitates their coordinated regulation during development (Kramer et al., 2000). The ability of individual cells to regulate the genes contained within such chromatin domains is of extreme importance to their differentiation. Perturbations in chromatin structure can act both locally to alter the accessibility of trans-acting factors to cisregulatory elements, and globally to affect the opening and closing of entire chromatin domains (Vermaak and Wolffe, 1998). The potentiated state of a gene can also be influenced by alterations in the local chromatin environment. For example, many

Genomic Structure of the KLK Locus

17

eukaryotic genes are expressed differentially by altering their methylation status. These genes are largely unmethylated in cells where they are transcribed, but fully methylated in all non-expressing cells (Cedar, 1988). Histone acetylation can also act on the local gene to stabilize the more relaxed open structure (Davie and Hendzel, 1994). It has also been postulated that DNA methylation patterns may serve to modulate histone acetylation, thereby maintaining local chromatin states. As such, both DNA demethylation and histone acetylation render increased accessibility of ubiquitous and tissue-specific trans-acting factors to cis-regulatory elements, facilitating transcriptional activation (Eden et al., 1998).

1.6.3 Epigenetic regulation of KLK gene expression Numerous mechanisms may contribute to a downregulation of gene expression, including homozygous deletions, allelic loss in combination with mutations, abnormal splicing, and CpG island methylation (Stallmach et al., 2003). DNA-methylation contributes to inactivation of numerous genes, including the cell cycle regulator p16 (Herman et al., 1995), the growth suppressor ER (estrogen receptor) (Issa et al., 1994), the epithelial adhesion molecule E-cadherin (Nakayama et al., 2001), and the DNA repair gene MGMT (methylguanine-DNA methyltransferase) (Esteller et al., 1999). Likewise, KLK10 has been shown to be inactivated by CpG island hypermethylation in both breast cancer (Li et al., 2001) and acute lymphoblastic leukemia (Roman-Gomez et al., 2004). Although the physiological function of KLK10 is still unclear, recent data suggests that KLK10 may be a tumor suppressor, based on its down-regulation in breast and prostate cancer cell lines and the finding that overexpression of KLK10 in nude mice can suppress tumor formation (Goyal et al., 1998; Liu et al., 1996). This putative tumor suppressor activity has prompted speculation that this gene may be a target for either somatic mutations or hypermethylation, in analogy to other tumor suppressor genes that are inactivated by mutations or methylation. Li et al. demonstrated an important role for CpG island methylation in the loss of KLK10 gene expression in breast cancer (Li et al., 2001). This data suggests that one major mechanism of KLK10 inactivation may be at the epigenetic level. The frequent loss of KLK10 expression suggests that inactivating the function of KLK10 may be a critical step towards carcinogenesis, and a strong correlation between KLK10 Exon 3 hypermethylation, and loss of KLK10 mRNA expression was noted (Li et al., 2001). A similar regulatory mechanism has been reported for the KLK6 gene (Pampalakis et al., 2006). Conversely, recent data suggests that KLK13 is activated in malignant cells via demethylation of its upstream region (Chang et al., 2011). For the remaining human KLK genes, DNA-methylation has not been identified as a potential mechanism for (in)activation, although it is possible that some of the genes are epigenetically suppressed or activated through CpG island (de)methyla-

18

Daniela Cretu, George M. Yousef, Andreas Scorilas, and Eleftherios P. Diamandis

tion. Clearly, there is a need to characterize the CpG islands within these genes and to better understand the mechanism and role that epigenetic regulation plays within the human KLK locus.

1.7 Isoforms and splice variants of human KLKs The mechanism of a single gene giving rise to more than one mRNA transcript is referred to as differential splicing. This system is often tightly regulated in a cell-type or in a developmental stage-specific manner and thus increases genome complexity by generating different proteins from the same mRNA. The presence of more than one mRNA form for the same gene is common among kallikreins. These variant mRNAs may result from alternative splicing, a retained intronic segment, or utilization of an alternative transcription initiation site. To date, there are over 80 documented splice variants of the 15 kallikrein genes, many of which may hold significant clinical value. With the exception of KLK14, all kallikreins have at least one alternative transcript (Tab. 1.4), where KLK3, followed by KLK4 and KLK13, has the highest number of alternative transcripts. Splicing is seen mostly in the protein coding regions, and to a much lesser extent in the 5ʹ UTR and, although certain KLKs have confirmed alternative poly-A tails, no splicing events have been detected in this region (Kurlender et al., 2005). Exon skipping is the most common event in the KLK locus, since 35% of splicing events result in a skipped exon, where exon 2 and Exon 4 are most commonly skipped (Kurlender et al., 2005; Michael et al., 2005). As an example, Pampalakis et al. (2004) have identified two splice variants of the KLK6 gene, lacking either Exon 1 or 2, while KLK8 splice variants were found with missing Exon 2 or Exon 3. On the other hand, intron retention almost always results in retention of Intron 3 between Exons 3 and 4, with the exception of a KLK3 variant (GenBank #AF335478), where Intron 1 is retained instead. 5ʹ exon truncation has been detected in Exons 3, 4, and 5, while 3ʹ exon truncation occurs almost exclusively in Exon 3 (except with a KLK3 variant (Tanaka et al., 2000), where Exon 4 is truncated). It has been shown that 3ʹ and 5ʹ exon extension also occurs, where 5ʹ exon extension occurs less often, and has not been observed in Exon 5. Alternative promoter regions have also been confirmed in splice variants of KLK4 and KLK6 (Kurlender et al., 2005). A KLK5 transcript with a short 5ʹ-untranslated region, and a novel KLK7 transcript with a long 3ʹ-untranslated region were highly expressed in the ovarian cancer cell lines OVCAR-3 and PEO1, respectively, but were expressed at very low levels in normal ovarian epithelial cells. Both Western blot and immunohistochemical analyses have shown that these two enzymes are secreted from ovarian carcinoma cells. Therefore, the short KLK5 and long KLK7 transcripts may be useful as tumor markers for epithelial-derived serous carcinomas (Dong et al., 2003). Evolutionarily conserved sequences ensure that the 3ʹ and 5ʹ splice sites are cleaved correctly and the two ends are properly joined. These consensus sequences

Genomic Structure of the KLK Locus

19

Tab. 1.4 Reported splice variants of the human KLK genes and their respective association with cancer types. Gene

Number of KLK

Variant GenBank

Variants reported

Accession number

Type of cancer

References

KLK1

4

NM_002257 AY429508

renal cell carinoma

NM_005551 AY429509 AY429510 AF188747 AF188746 AF188745 NM_001648 AJ459783 AJ310938 AJ031937 AJ459782 AJ512346 AF335477 AF335478 AF228497 AF259969 AY923170 AF148532 AF259964 AF259971 AF259970

prostate cancer

Angermann et al., 1989 Baker and Shine, 1985 Chen et al., 1994 Fukushima et al., 1985 Michael et al., 2005 Rae et al., 1999 Liu et al., 1999 Michael et al., 2005 Riegman et al., 1991 Sauter et al., 2002

KLK2

7

KLK3

11

KLK4

9

KLK5

6

KLK6

8

NM_012427 AY461805 AY279381 AY279380 AF435980 AF435981 NM_002774 AY279383 AY318867 BC015525 AY318869 AY318870 AY318868 AY457039

prostate cancer

David et al., 2002 Heuze-Vourc’h et al., 2003 Michael et al., 2005 Tanaka et al., 2000

breast cancer, prostate cancer

Dong et al., 2005 Korkmaz et al., 2001 Lai et al., 2009 Michael et al., 2005 Nelson et al., 1999 Obiezu and Diamandis, 2000 Yousef et al., 1999 Dong et al., 2003 Kurlender et al., 2004 Michael et al., 2005 Yousef and Diamandis, 1999 Yousef et al., 2004a Anisowicz et al., 1996 Little et al., 1997 Pampalakis et al., 2004 Strausberg et al., 2002 Yamashiro et al., 1997

ovarian cancer, prostate cancer, breast and ovarian cancer

breast cancer

20

Daniela Cretu, George M. Yousef, Andreas Scorilas, and Eleftherios P. Diamandis

Tab. 1.4 (continued) Gene

Number of KLK

Variant GenBank

Variants reported

Accession number

KLK7

3

KLK8

5

KLK9

3

KLK10 2

KLK11 4

KLK12 4

KLK13 9

KLK14 1 KLK15 6

Type of cancer

References

AF411214 AF411215 NM_139227 BC040887 NM_007196 NM_144505 NM_144506 NM_144507 NM_012315 AF135026 AY551001 NM_002776 NM_145888

ovarian cancer

Dong, et al., 2003 Yousef et al., 2000

ovarian cancer lung cancer

Magklara et al., 2001 Mitsui et al., 1999 Planque et al., 2010 Strausberg et al., 2002 Yoshida et al., 1998 Yousef and Diamandis, 2000

NM_006853 AB078786 AF164623 NM_144947 NM_145894 NM_019598 NM_145895 AY358524 NM_015596 AY923171 AY923172 AY923173 AB108823 AB108824 AY923174 AY923175 AL050220 NM_022046

prostate cancer

NM_017509 NM_023006 NM_138464 NM_138563 AY373373 AY373374

prostate cancer

Liu et al., 1996 Luo et al., 1998 Strausberg et al., 2002 Clark et al., 2003 Yousef et al., 2000

Clark et al., 2003 Yousef et al., 2000

testicular cancer

Chang et al., 2001 Komatsu et al., 2003 Yousef et al., 2000

Hooper et al., 2001 Yousef et al., 2001 Batra et al., 2011 Mavridis et al., 2010 Michael et al., 2005 Yousef et al., 2001

Genomic Structure of the KLK Locus

21

contain invariant dinucleotides at each end, GT (donor site) and AG (acceptor site), and are associated with a more flexible sequence AG:GT(A/G)AGT….CAG:G. However, exceptions to the tightly regulated splice sites can arise. An alternative GT-GC intron may exist but, unlike a possible AT-AC intron boundary, it will still be processed by the same splicing machinery as the conventional GT-AG introns. The GT-GC boundary is present in some KLK splice variants, including the 5ʹ untranslated region of KLK5 splice variant 2 (GenBank accession #AY279381) and Intron 3 for KLK10 transcript variant 2 (GenBank accession NM_145888). The functional and diagnostic relevance of most KLKs is still under investigation but preliminary evidence indicates that some are expressed in pathological conditions, therefore implicating KLKs as potential therapeutic and diagnostic targets.

1.8 Evolution of KLKs Some studies have investigated the phylogenetic relationship between different serine proteases, but no definitive conclusions regarding the so-called glandular kallikreins could be drawn at that time (Krem et al., 2000; Yousef et al., 2003a; 2004b). Inspection of the KLK protein sequences suggested that KLKs have virtually identical splicing patterns, as discussed previously, with slight deviations, and many of the serine protease encoding genes share the same splice sites. This suggests that the serine proteases have evolved from an ancestral trypsin-like protein (see Chapter 3). Only plasminogen-encoding genes demonstrated different splice patterns, indicating that the split between the proteases took place around that time (Forsgren et al., 1987). Accumulation of genomic sequences has allowed for the study of the KLK gene family in different species. Phylogenetic and comparative analyses of the KLK locus have revealed a significant level of locus similarity among mammals, suggesting (a) conserved function(s) of the encoded proteins (Elliott et al., 2006; Lundwall et al., 2006b). Experimental and in silico identification of mammalian KLKs in human, rat, mouse, pig, dog, chimpanzee, and opossum, as well as comparative studies of the horse and cow genomes, have revealed a polyphyletic nature of the gene family (Elliott et al., 2006; Fernando et al., 2007; Lundwall et al., 2006b). Further phylogenetic studies have suggested five main subfamilies, with shared recent ancestry, namely KLK4, 5, 14; KLK9, 11, 15; KLK10, 12; KLK6, 13; and KLK1-3, 8. (Elliott et al., 2006). No KLK was found in the nonmammalian species examined thus far (Elliott et al., 2006). Bayesian phylogenetic analyses of the KLK locus of the genome of human, chimpanzee, mouse, rat, dog, pig, and opossum indicate that these species carry at least one copy of KLK4-15 (Elliott et al., 2006). Interestingly, “classic” KLKs exhibit the largest amount of variability in the number of gene copies, with the highest number of duplications in rodents (Elliott et al., 2006). Given that in marsupial species the number of gene copies is similar, the majority of duplication events probably date

22

Daniela Cretu, George M. Yousef, Andreas Scorilas, and Eleftherios P. Diamandis

back to 125–175 million years ago, prior to the marsupial-placental divergence (Elliott et al., 2006). A thorough discussion regarding the evolution of the KLK locus can be found in Chapter 3.

Bibliography Anisowicz, A., Sotiropoulou, G., Stenman, G., Mok, S. C., and Sager, R. (1996). A novel protease homolog differentially expressed in breast and ovarian cancer. Mol. Med. 2, 624–636. Angermann, A., Bergmann, C., and Appelhans, H. (1989). Cloning and expression of human salivarygland kallikrein in Escherichia coli. Biochem. J. 262, 787–793. Ashley, P.L., and MacDonald, R.J. (1985). Tissue-specific expression of kallikrein-related genes in the rat. Biochemistry 24, 4520–4527. Baffa, R., Moreno, J.G., Monne, M., Veronese, M.L., and Gomella, L.G. (1996). A comparative analysis of prostate-specific antigen gene sequence in benign and malignant prostate tissue. Urology 47, 795–800. Baker, A.R., and Shine, J. (1985). Human kidney kallikrein: cDNA cloning and sequence analysis. DNA 4, 445–450. Batra J., Lose F., O’Mara T., Marquart L., Stephens C., Alexander K., Srinivasan S., Eeles R.A., Easton D.F., Al Olama A.A., Kote-Jarai Z., Guy M., Muir K., Lophatananon A., Rahman A.A., Neal D.E., Hamdy F.C., Donovan J.L., Chambers S., Gardiner R.A., Aitken J., Yaxley J., Kedda M.A., Clements J.A., and Spurdle A.B. (2011). Association between prostinogen (KLK15) genetic variants and prostate cancer risk and aggressiveness in Australia and a meta-analysis of GWAS data. PLoS One 6, e26527. Bayani, J., Paliouras, M., Planque, C., Shan, S.J., Graham, C., Squire, J.A., and Diamandis, E.P. (2008). Impact of cytogenetic and genomic aberrations of the kallikrein locus in ovarian cancer. Mol. Oncol. 2, 250–260. Bharaj, B., Scorilas, A., Giai, M., and Diamandis, E.P. (2000). TA repeat polymorphism of the 5α-reductase gene and breast cancer. Cancer Epidemiol. Biomarkers Prev. 9, 387–393. Bharaj, B.B., Luo, L.Y., Jung, K., Stephan, C., and Diamandis, E.P. (2002). Identification of single nucleotide polymorphisms in the human kallikrein 10 (KLK10) gene and their association with prostate, breast, testicular, and ovarian cancers. Prostate 51, 35–41. Bhoola, K.D., Figueroa, C.D., and Worthy, K. (1992). Bioregulation of kinins: kallikreins, kininogens, and kininases. Pharmacol. Rev. 44, 1–80. Boutanaev, A.M., Kalmykova, A.I., Shevelyov, Y.Y., and Nurminsky, D.I. (2002). Large clusters of co-expressed genes in the Drosophila genome. Nature 420, 666–669. Brookes, D.E., Zandvliet, D., Watt, F., Russell, P.J., and Molloy, P.L. (1998). Relative activity and specificity of promoters from prostate-expressed genes. Prostate 35, 18–26. Cedar, H. (1988). DNA methylation and gene activity. Cell 53, 3–4. Chan, H., Springman, E.B., and Clark, J.M. (1998). Expression and characterization of human tissue kallikrein variants. Protein Expr. Purif. 12, 361–370. Chang, A., Yousef, G.M., Jung, K., Rajpert-De Meyts, E., and Diamandis, E.P. (2001). Identification and molecular characterization of five novel kallikrein gene 13 (KLK13; KLK-L4) splice variants: differential expression in the human testis and testicular cancer. Anticancer Res. 21, 3147–3152. Chen, L.M., Murray, S.R., Chai, K.X., Chao, L., and Chao, J. (1994). Molecular cloning and characterization of a novel kallikrein transcript in colon and its distribution in human tissues. Braz. J. Med. Biol. Res. 27, 1829–1838.

Genomic Structure of the KLK Locus

23

Clark, H.F., Gurney, A.L., Abaya, E., Baker, K., Baldwin, D., Brush, J., Chen, J., Chow, B., Chui, C., Crowley, C., Currell, B., Deuel, B., Dowd, P., Eaton, D., et al., and Gray, A. (2003). The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment. Genome Res. 13, 2265–2270. Cleutjens, K.B., van Eekelen, C.C., van der Korput, H.A., Brinkmann, A.O., and Trapman, J. (1996). Two androgen response regions cooperate in steroid hormone regulated activity of the prostate-specific antigen promoter. J. Biol. Chem. 271, 6379–6388. Cleutjens, K.B., van der Korput, H.A., van Eekelen, C.C., van Rooij, H.C., Faber, P.W., and Trapman, J. (1997). An androgen response element in a far upstream enhancer region is essential for high, androgen-regulated activity of the prostate-specific antigen promoter. Mol. Endocrinol. 11, 148–161. Cramer S.D., Chang B.L., Rao A., Hawkins G.A., Zheng S.L., Wade W.N., Cooke R.T., Thomas L.N., Bleecker E.R., Catalona W.J., Sterling D.A., Meyers D.A., Ohar J., and Xu J. (2003). Association between genetic polymorphisms in the prostate-specific antigen gene promoter and serum prostate-specific antigen levels. J. Natl. Cancer Inst. 95, 1044–1053. Das, H.K., Jackson, C.L., Miller, D.A., Leff, T., and Breslow, J.L. (1987). The human apolipoprotein C-II gene sequence contains a novel chromosome 19-specific minisatellite in its third intron. J. Biol. Chem. 262, 4787–4793. David, A., Mabjeesh, N., Azar, I., Biton, S., Engel, S., Bernstein, J., Romano, J., Avidor, Y., Waks, T., Eshhar, Z., Langer, S.Z., Lifschitz-Mercer, B., Matzkin, H., Rotman, G., Toporik, A., Savitsky, K., and Mintz, L. (2002). Unusual alternative splicing within the human kallikrein genes KLK2 and KLK3 gives rise to novel prostate-specific proteins. J. Biol. Chem. 277, 18084–19090. Davie, J.R., and Hendzel, M.J. (1994). Multiple functions of dynamic histone acetylation. J. Cell. Biochem. 55, 98–105. Diamandis, E.P., and Yousef, G.M. (2001). Human tissue kallikrein gene family: a rich source of novel disease biomarkers. Expert Rev. Mol. Diagn. 1, 182–190. Diamandis, E.P., and Yousef, G.M. (2002). Human tissue kallikreins: a family of new cancer biomarkers. Clin. Chem. 48, 1198–1205. Dong, Y., Kaushal, A., Brattsand, M., Nicklin, J., and Clements, J.A. (2003). Differential splicing of KLK5 and KLK7 in epithelial ovarian cancer produces novel variants with potential as cancer biomarkers. Clin. Cancer Res. 9, 1710–1720. Dong, Y., Bui, L.T., Odorico, D.M., Tan, O.L., Myers, S.A., Samaratunga, H., Gardiner, R.A., and Clements, J.A. (2005). Compartmentalized expression of kallikrein 4 (KLK4/hK4) isoforms in prostate cancer: nuclear, cytoplasmic and secreted forms. Endocr. Relat. Cancer 12, 875–889. Eden, S., Hashimshony, T., Keshet, I., Cedar, H., and Thorne, A.W. (1998). DNA methylation models histone acetylation. Nature 394, 842. Elliott, M.B., Irwin, D.M., and Diamandis, E.P. (2006). In silico identification and Bayesian phylogenetic analysis of multiple new mammalian kallikrein gene families. Genomics 88, 591–599. Emami, N., and Diamandis, E.P. (2007). New insights into the functional mechanisms and clinical applications of the kallikrein-related peptidase family. Mol. Oncol. 1, 269–287. Esteller, M., Hamilton, S.R., Burger, P.C., Baylin, S.B., and Herman, J.G. (1999). Inactivation of the DNA repair gene O6-methylguanine-DNA methyltransferase by promoter hypermethylation is a common event in primary human neoplasia. Cancer Res. 59, 793–797. Evans, B.A., and Richards, R.I. (1985). Genes for the alpha and gamma subunits of mouse nerve growth factor are contiguous. EMBO J. 4, 133–138. Evans, B.A., Drinkwater, C.C., and Richards, R.I. (1987). Mouse glandular kallikrein genes. Structure and partial sequence analysis of the kallikrein gene locus. J. Biol. Chem. 262, 8027–8034.

24

Daniela Cretu, George M. Yousef, Andreas Scorilas, and Eleftherios P. Diamandis

Fernando, S.C., Najar, F.Z., Guo, X., Zhou, L., Fu, Y., Geisert, R.D., Roe, B.A., and DeSilva, U. (2007). Porcine kallikrein gene family: genomic structure, mapping, and differential expression analysis. Genomics 89, 429–438. Forsgren, M., Raden, B., Israelsson, M., Larsson, K., and Heden, L.O. (1987). Molecular cloning and characterization of a full-length cDNA clone for human plasminogen. FEBS Lett. 213, 254–260. Fukushima, D., Kitamura, N., and Nakanishi, S. (1985). Nucleotide sequence of cloned cDNA for human pancreatic kallikrein. Biochemistry 24, 8037–8043. Gan, L., Lee, I., Smith, R., Argonza-Barrett, R., Lei, H., McCuaig, J., Moss, P., Paeper, B., and Wang, K. (2000). Sequencing and expression analysis of the serine protease gene cluster located in chromosome 19q13 region. Gene 257, 119–130. Goyal, J., Smith, K.M., Cowan, J.M., Wazer, D.E., Lee, S.W., and Band, V. (1998). The role for NES1 serine protease as a novel tumor suppressor. Cancer Res. 58, 4782–4786. Grimwood, J., Gordon, L.A., Olsen, A., Terry, A., Schmutz, J., Lamerdin, J., Hellsten, U., Goodstein, D., Couronne, O., Tran-Gyamfi, M., et al., and Lucas, S.M. (2004). The DNA sequence and biology of human chromosome 19. Nature 428, 529–535. Harvey, T.J., Hooper, J.D., Myers, S.A., Stephenson, S.A., Ashworth, L.K., and Clements, J.A. (2000). Tissue-specific expression patterns and fine mapping of the human kallikrein (KLK) locus on proximal 19q13.4. J. Biol. Chem. 48, 37397–37406. Heuze-Vourc’h, N., Leblond, V., and Courty, Y. (2003). Complex alternative splicing of the hKLK3 gene coding for the tumor marker PSA (prostate-specific-antigen). Eur. J. Biochem. 270, 706–714. Herman, J.G., Merlo, A., Mao, L., Lapidus, R.G., Issa, J.P., Davidson, N.E., Sidransky, D., and Baylin, S.B. (1995). Inactivation of the CDKN2/p16/MTS1 gene is frequently associated with aberrant DNA methylation in all common human cancers. Cancer Res. 55, 4525–4530. Hermans, K.G., Bressers, A.A., van der Korput, H.A., Dits, N.F., Jenster, G., and Trapman, J. (2008). Two unique novel prostate-specific and androgen-regulated fusion partners of ETV4 in prostate cancer. Cancer Res. 68, 3094–3098. Hooper, J.D., Bui, L.T., Rae, F.K., Harvey, T.J., Myers, S.A., Ashworth, L.K., and Clements, J.A. (2001). Identification and characterization of KLK14, a novel kallikrein serine protease gene located on human chromosome 19q13.4 and expressed in prostate and skeletal muscle. Genomics 73, 117–122. Hu, J.C., Zhang, C., Sun, X., Yang, Y., Cao, X., Ryu, O., and Simmer, J.P. (2000). Characterization of the mouse and human PRSS17 genes, their relationship to other serine proteases, and the expression of PRSS17 in developing mouse incisors. Gene 251, 1–8. Huang, W., Shostak, Y., Tarr, P., Sawyers, C., and Carey, M. (1999). Cooperative assembly of androgen receptor into a nucleoprotein complex that regulates the prostate-specific antigen enhancer. J. Biol. Chem. 274, 25756–25768. Issa, J.P., Ottaviano, Y.L., Celano, P., Hamilton, S.R., Davidson, N.E., and Baylin, S.B. (1994). Methylation of the oestrogen receptor CpG island links ageing and neoplasia in human colon. Nat. Genet. 7, 536–540. Kaushal, A., Myers, S.A., Dong, Y., Lai, J., Tan, O.L., Bui, L.T., Hunt, M.L., Digby, M.R., Samaratunga, H., Gardiner, R.A., Clements, J.A., and Hooper, J.D. (2008). A novel transcript from the KLKP1 gene is androgen regulated, down-regulated during prostate cancer progression and encodes the first non-serine protease identified from the human kallikrein gene locus. Prostate 68, 381–399. Komatsu, N., Takata, M., Otsuki, N., Toyama, T., Ohka, R., Takehara, K., and Saijoh, K. (2003). Expression and localization of tissue kallikrein mRNAs in human epidermis and appendages. J. Invest. Dermatol. 121, 542–549.

Genomic Structure of the KLK Locus

25

Korkmaz, K.S., Korkmaz, C.G., Pretlow, T.G., and Saatcioglu, F. (2001). Distinctly different gene structure of KLK4/KLK-L1/prostase/ARM1 compared with other members of the kallikrein family: intracellular localization, alternative cDNA forms, and regulation by multiple hormones. DNA Cell Biol. 20, 435–445. Kramer, J.A., McCarrey, J.R., Djakiew, D., and Krawetz, S.A. (2000). Human spermatogenesis as a model to examine gene potentiation. Mol. Reprod. Dev. 56, 254–258. Krem, M.M., Rose, T., and Di Cera, E. (2000). Sequence determinants of function and evolution in serine proteases. Trends Cardiovasc. Med. 10, 171–176. Kurlender, L., Yousef, G.M., Memari, N., Robb, J.D., Michael, I.P., Borgoño, C., Katsaros, D., Stephan, C., Jung, K., and Diamandis, E.P. (2004). Differential expression of a human kallikrein 5 (KLK5) splice variant in ovarian and prostate cancer. Tumour Biol. 25, 149–156. Kurlender, L., Borgoño, C., Michael, I.P., Obiezu, C., Elliott, M.B., Yousef, G.M., and Diamandis, E.P. (2005). A survey of alternative transcripts of human tissue kallikrein genes. Biochim. Biophys. Acta 1755, 1–14. Lai, J., Myers, S.A., Lawrence, M.G., Odorico, D.M., and Clements, J.A. (2009). Direct progesterone receptor and indirect androgen receptor interactions with the kallikrein-related peptidase 4 gene promoter in breast and prostate cancer. Mol. Cancer Res. 7, 129–141. Lawrence, M.G., Lai, J., and Clements, J.A. (2010) Kallikreins on steroids: structure, function, and hormonal regulation of prostate-specific antigen and the extended kallikrein locus. Endocr. Rev. 31, 407–446. Li, B., Goyal, J., Dhar, S., Dimri, G., Evron, E., Sukumar, S., Wazer, D.E., and Band, V. (2001). CpG methylation as a basis for breast tumor-specific loss of NES1/kallikrein 10 expression. Cancer Res. 61, 8014–8021. Li, Q., Harju, S., and Peterson, K.R. (1999). Locus control regions: coming of age at a decade plus. Trends Genet. 15, 403–408. Li, X., Liu, J., Wang, Y., Zhang, L., Ning, L., and Feng, Y. (2009). Parallel underexpression of kallikrein 5 and kallikrein 7 mRNA in breast malignancies. Cancer Sci. 100, 601–607. Little, S.P., Dixon, E.P., Norris, F., Buckley, W., Becker, G.W., Johnson, M., Dobbins, J. R., Wyrick, T., Miller, J.R., MacKellar, W., Hepburn, D., Corvalan, J., McClure, D., Liu, X., Stephenson, D., Clemens, J., and Johnstone, E.M. (1997). Zyme, a novel and potentially amyloidogenic enzyme cDNA isolated from Alzheimer’s disease brain. J. Biol. Chem. 272, 25135–25142. Liu, X.F., Essand, M., Vasmatzis, G., Lee, B., and Pastan, I. (1999). Identification of three new alternate human kallikrein 2 transcripts: evidence of long transcript and alternative splicing. Biochem. Biophys. Res. Commun. 264, 833–839. Liu, X.L., Wazer, D.E., Watanabe, K., and Band, V. (1996). Identification of a novel serine proteaselike gene, the expression of which is down-regulated during breast cancer progression. Cancer Res. 56, 3371–3379. Lu, J., Goldstein, K.M., Chen, P., Huang, S., Gelbert, L.M., and Nagpal, S. (2005). Transcriptional profiling of keratinocytes reveals a vitamin D-regulated epidermal differentiation network. J. Invest. Dermatol. 124, 778–785. Lu, W., Zhou, D., Glusman, G., Utleg, A.G., White, J.T., Nelson, P.S., Vasicek, T.J., Hood, L., and Lin, B. (2006). KLK31P is a novel androgen regulated and transcribed pseudogene of kallikreins that is expressed at lower levels in prostate cancer cells than in normal prostate cells. Prostate 66, 936–944. Luo, L., Herbrick, J.A., Scherer, S.W., Beatty, B., Squire, J., and Diamandis, E.P. (1998). Structural characterization and mapping of the normal epithelial cell-specific 1 gene. Biochem. Biophys. Res. Commun. 247, 580–586. Lundwall, A. (1989). Characterization of the gene for prostate-specific antigen, a human glandular kallikrein. Biochem. Biophys. Res. Commun. 161, 1151–1159.

26

Daniela Cretu, George M. Yousef, Andreas Scorilas, and Eleftherios P. Diamandis

Lundwall, A., Band, V., Blaber, M., Clements, J.A., Courty, Y., Diamandis, E.P., Fritz, H., Lilja, H., Malm, J., Maltais, L.J., Olsson, A.Y., Petraki, C., Scorilas, A., Sotiropoulou, G., Stenman, U.H., Stephan, C., Talieri, M., and Yousef, G.M. (2006a). A comprehensive nomenclature for serine proteases with homology to tissue kallikreins. Biol. Chem. 387, 637–641. Lundwall, A., Clauss, A., and Olsson, A.Y. (2006b). Evolution of kallikrein-related peptidases in mammals and identification of a genetic locus encoding potential regulatory inhibitors. Biol. Chem. 387, 243–249. MacDonald, R.J., Southard-Smith, E.M., and Kroon, E. (1996). Disparate tissue-specific expression of members of the tissue kallikrein multigene family of the rat. J. Biol. Chem. 271, 13684–13690. Majumdar, S., and Diamandis, E.P. (1999). The promoter and the enhancer region of the KLK 3 (prostate specific antigen) gene is frequently mutated in breast tumours and in breast carcinoma cell lines. Br. J. Cancer 79, 1594–1602. Magklara, A., Scorilas, A., Katsaros, D., Massobrio, M., Yousef, G.M., Fracchioli, S., Danese, S., and Diamandis, E.P. (2001). The human KLK8 (neuropsin/ovasin) gene: identification of two novel splice variants and its prognostic value in ovarian cancer. Clin. Cancer Res. 7, 806–811. Mason, A.J., Evans, B.A., Cox, D.R., Shine, J., and Richards, R.I. (1983). Structure of mouse kallikrein gene family suggests a role in specific processing of biologically active peptides. Nature 303, 300–307. Mavridis, K., Avgeris, M., Koutalellis, G., Stravodimos, K., and Scorilas, A. (2010). Expression analysis and study of the KLK15 mRNA splice variants in prostate cancer and benign prostatic hyperplasia. Cancer Sci. 101, 693–699. Meyer, W. (2001). Distribution of tissue kallikrein in the integumental blood vessel system of wild mammals. Cell. Mol. Biol. (Noisy-le-grand) 47 Online Pub, OL125–130. Michael, I.P., Kurlender, L., Memari, N., Yousef, G.M., Du, D., Grass, L., Stephan, C., Jung, K., and Diamandis, E.P. (2005). Intron retention: a common splicing event within the human kallikrein gene family. Clin. Chem. 51, 506–515. Mitsui, S., Tsuruoka, N., Yamashiro, K., Nakazato, H., and Yamaguchi, N. (1999). A novel form of human neuropsin, a brain-related serine protease, is generated by alternative splicing and is expressed preferentially in human adult brain. Eur. J. Biochem. 260, 627–634. Murtha, P., Tindall, D.J., and Young, C.Y. (1993). Androgen induction of a human prostate-specific kallikrein, hKLK2: characterization of an androgen response element in the 5ʹ promoter region of the gene. Biochemistry 32, 6459–6464. Nakayama, S., Sasaki, A., Mese, H., Alcalde, R.E., Tsuji, T., and Matsumura, T. (2001). The E-cadherin gene is silenced by CpG methylation in human oral squamous cell carcinomas. Int. J. Cancer 93, 667–673. Nelson, P.S., Gan, L., Ferguson, C., Moss, P., Gelinas, R., Hood, L., and Wang, K. (1999). Molecular cloning and characterization of prostase, an androgen-regulated serine protease with prostaterestricted expression. Proc. Natl. Acad. Sci. USA 96, 3114–3119. Ni, X., Zhang, W., Huang, K.C., Wang, Y., Ng, S.K., Mok, S.C., Berkowitz, R.S., and Ng, S.W. (2004). Characterisation of human kallikrein 6/protease M expression in ovarian cancer. Br. J. Cancer 91, 725–731. Obiezu C.V., and Diamandis E.P. (2000). An alternatively spliced variant of KLK4 expressed in prostatic tissue. Clin. Biochem. 33, 599–600. Olsson, A. Y., and Lundwall, A. (2002). Organization and evolution of the glandular kallikrein locus in Mus musculus. Biochem. Biophys. Res. Commun. 299, 305–311. Olsson, A.Y., Valtonen-Andre, C., Lilja, H., and Lundwall, A. (2004). The evolution of the glandular kallikrein locus: identification of orthologs and pseudogenes in the cotton-top tamarin. Gene 343, 347–355.

Genomic Structure of the KLK Locus

27

Pampalakis, G., Kurlender, L., Diamandis, E.P., and Sotiropoulou, G. (2004). Cloning and characterization of novel isoforms of the human kallikrein 6 gene. Biochem. Biophys. Res. Commun. 320, 54–61. Pampalakis, G., Diamandis, E.P., and Sotiropoulou, G. (2006). The epigenetic basis for the aberrant expression of kallikreins in human cancers. Biol. Chem. 387, 795–799. Planque, C., Choi, Y.H., Guyetant, S., Heuzé-Vourc’h, N., Briollais, L., and Courty, Y. (2010). Alternative splicing variant of kallikrein-related peptidase 8 as an independent predictor of unfavorable prognosis in lung cancer. Clin. Chem. 56, 987–997. Rae, F., Bulmer, B., Nicol, D., and Clements, J. (1999). The human tissue kallikreins (KLKs 1–3) and a novel KLK1 mRNA transcript are expressed in a renal cell carcinoma cDNA library. Immunopharmacology 45, 83–88. Riegman, P.H., Vlietstra, R.J., Klaassen, P., van der Korput, J.A., Geurts van Kessel, A., Romijn, J.C., and Trapman, J. (1989a). The prostate-specific antigen gene and the human glandular kallikrein-1 gene are tandemly located on chromosome 19. FEBS Lett. 247, 123–126. Riegman, P.H., Vlietstra, R.J., van der Korput, J.A., Romijn, J.C., and Trapman, J. (1989b). Characterization of the prostate-specific antigen gene: a novel human kallikrein-like gene. Biochem. Biophys. Res. Commun. 159, 95–9102. Riegman, P.H., Vlietstra, R.J., van der Korput, H.A., Romijn, J.C., and Trapman, J. (1991). Identification and androgen-regulated expression of two major human glandular kallikrein-1 (hGK-1) mRNA species. Mol. Cell. Endocrinol. 76, 181–190. Riegman, P.H., Vlietstra, R.J., Suurmeijer, L., Cleutjens, C.B., and Trapman, J. (1992). Characterization of the human kallikrein locus. Genomics 14, 6–11. Roman-Gomez, J., Jimenez-Velasco, A., Agirre, X., Castillejo, J.A., Barrios, M., Andreu, E.J., Prosper, F., Heiniger, A., and Torres, A. (2004). The normal epithelial cell-specific 1 (NES1) gene, a candidate tumor suppressor gene on chromosome 19q13.3-4, is downregulated by hypermethylation in acute lymphoblastic leukemia. Leukemia 18, 362–365. Sauter, E.R., Welch, T., Magklara, A., Klein, G., and Diamandis, E.P. (2002). Ethnic variation in kallikrein expression in nipple aspirate fluid. Int. J. Cancer 100, 678–682. Schedlich, L.J., Bennetts, B.H., and Morris, B.J. (1987). Primary structure of a human glandular kallikrein gene. DNA 6, 429–437. Scheidereit, C., Geisse, S., Westphal, H.M., and Beato, M. (1983). The glucocorticoid receptor binds to defined nucleotide sequences near the promoter of mouse mammary tumour virus. Nature 304, 749–752. Shinoda, Y., Kozaki, K., Imoto, I., Obara, W., Tsuda, H., Mizutani, Y., Shuin, T., Fujioka, T., Miki, T., and Inazawa, J. (2007). Association of KLK5 overexpression with invasiveness of urinary bladder carcinoma cells. Cancer Sci. 98, 1078–1086. Southard-Smith, M., Pierce, J.C., and MacDonald, R.J. (1994). Physical mapping of the rat tissue kallikrein family in two gene clusters by analysis of P1 bacteriophage clones. Genomics 22, 404–417. Stallmach, A., Wittig, B.M., Kremp, K., Goebel, R., Santourlidis, S., Zeitz, M., Menges, M., Raedle, J., Zeuzem, S., and Schulz, W.A. (2003). Downregulation of CD44v6 in colorectal carcinomas is associated with hypermethylation of the CD44 promoter region. Exp. Mol. Pathol. 74, 262–266. Stephenson, S.A., Verity, K., Ashworth, L.K., and Clements, J.A. (1999). Localization of a new prostate-specific antigen-related serine protease gene, KLK4, is evidence for an expanded human kallikrein gene family cluster on chromosome 19q13.3-13.4. J. Biol. Chem. 274, 23210–23214. Strausberg, R.L., Feingold, E.A., Grouse, L.H., Derge, J.G., Klausner, R.D., Collins, F. S., Wagner, L., Shenmen, C.M., Schuler, G.D., Altschul, S.F., Zeeberg, B., Buetow, K. H., Schaefer, C.F.,

28

Daniela Cretu, George M. Yousef, Andreas Scorilas, and Eleftherios P. Diamandis

Bhat, N.K., et al., and Marra, M.A. (2002). Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc. Natl. Acad. Sci. U.S.A. 99, 16899–16903. Tanaka, T., Isono, T., Yoshiki, T., Yuasa, T., and Okada, Y. (2000). A novel form of prostate-specific antigen transcript produced by alternative splicing. Cancer Res. 60, 56–59. van Leeuwen, B.H., Evans, B.A., Tregear, G.W., and Richards, R.I. (1986). Mouse glandular kallikrein genes. Identification, structure, and expression of the renal kallikrein gene. J. Biol. Chem. 261, 5529–5535. Vermaak, D., and Wolffe, A.P. (1998). Chromatin and chromosomal controls in development. Dev. Genet. 22, 1–6. Wei, C., Callahan, B.P., Turner, M.J., Willis, R.A., Lord, E.M., Barth, R.K., and Frelinger, J.G. (1998). Regulation of human prostate-specific antigen gene expression in transgenic mice: evidence for an enhancer between the PSA and human glandular kallikrein-1 genes. Int. J. Mol. Med. 2, 487–496. Yamashiro, K., Tsuruoka, N., Kodama, S., Tsujimoto, M., Yamamura, Y., Tanaka, T., Nakazato, H., and Yamaguchi, N. (1997). Molecular cloning of a novel trypsin-like serine protease (neurosin) preferentially expressed in brain. Biochim. Biophys. Acta 1350, 11–14. Yoshida, S., Taniguchi, M., Hirata, A., and Shiosaka, S. (1998). Sequence analysis and expression of human neuropsin cDNA and gene. Gene 213, 9–16. Yousef, G.M., and Diamandis, E.P. (1999). The new kallikrein-like gene, KLK-L2. Molecular characterization, mapping, tissue expression, and hormonal regulation. J. Biol. Chem. 274, 37511–375116. Yousef, G.M., Obiezu, C.V., Luo, L.Y., Black, M.H., and Diamandis, E.P. (1999). Prostase/KLK-L1 is a new member of the human kallikrein gene family, is expressed in prostate and breast tissues, and is hormonally regulated. Cancer Res. 59, 4252–4256. Yousef, G.M., Chang, A., Scorilas, A., and Diamandis, E.P. (2000). Genomic organization of the human kallikrein gene family on chromosome 19q13.3-q13.4. Biochem. Biophys. Res. Commun. 276, 125–133. Yousef, G.M., and Diamandis, E.P. (2001). The new human tissue kallikrein gene family: structure, function, and association to disease. Endocr. Rev. 22, 184–204. Yousef, G.M., Bharaj, B.S., Yu, H., Poulopoulos, J., and Diamandis, E.P. (2001). Sequence analysis of the human kallikrein gene locus identifies a unique polymorphic minisatellite element. Biochem. Biophys. Res. Commun. 285, 1321–1329. Yousef, G.M., Ordon, M.H., Foussias, G., and Diamandis, E.P. (2002). Genomic organization of the siglec gene locus on chromosome 19q13.4 and cloning of two new siglec pseudogenes. Gene 286, 259–270. Yousef, G.M., and Diamandis, E.P. (2003). An overview of the kallikrein gene families in humans and other species: emerging candidate tumour markers. Clin. Biochem. 36, 443–452. Yousef, G.M., Kopolovic, A.D., Elliott, M.B., and Diamandis, E.P. (2003a). Genomic overview of serine proteases. Biochem. Biophys. Res. Commun. 305, 28–36. Yousef, G.M., Polymeris, M.E., Yacoub, G.M., Scorilas, A., Soosaipillai, A., Popalis, C., Fracchioli, S., Katsaros, D., and Diamandis, E.P. (2003b). Parallel overexpression of seven kallikrein genes in ovarian cancer. Cancer Res. 63, 2223–2227. Yousef, G.M., White, N.M., Kurlender, L., Michael, I., Memari, N., Robb, J.D., Katsaros, D., Stephan, C., Jung, K., and Diamandis, E.P. (2004a). The kallikrein gene 5 splice variant 2 is a new biomarker for breast and ovarian cancer. Tumour Biol. 25, 221–227. Yousef, G.M., Elliott, M.B., Kopolovic, A.D., Serry, E., and Diamandis, E.P. (2004b). Sequence and evolutionary analysis of the human trypsin subfamily of serine peptidases. Biochim. Biophys. Acta 1698, 77–86.

Genomic Structure of the KLK Locus

29

Yu, D.C., Sakamoto, G.T., and Henderson, D.R. (1999). Identification of the transcriptional regulatory sequences of human kallikrein 2 and their use in the construction of calydon virus 764, an attenuated replication competent adenovirus for prostate cancer therapy. Cancer Res. 59, 1498–1504. Yu, H., Bowden, D.W., Spray, B.J., Rich, S.S., and Freedman, B.I. (1998). Identification of human plasma kallikrein gene polymorphisms and evaluation of their role in end-stage renal disease. Hypertension 31, 906–911. Zeng, M., Zhang, Y., Bhat, I., Wazer, D.E., Band, H., and Band, V. (2006). The human kallikrein 10 promoter contains a functional retinoid response element. Biol. Chem. 387, 741–747.

Jyotsna Batra, Tracy O’Mara, Felicity Lose, and Judith A. Clements

2 Single Nucleotide Polymorphisms in the Human KLK Locus and Their Implication in Various Diseases 2.1 Introduction Human genomic DNA consists of 3 billion deoxyribonucleotide bases (A, C, G or T) distributed between 23 pairs of chromosomes, which shows inter-individual differences at certain locations – these variations are called polymorphisms. Current estimates indicate that up to 0.1% of the human genome may differ between any two unrelated individuals, or approximately 3 million DNA positions. The most common type of variation in the human genome is the single nucleotide polymorphism (SNP), representing approximately 90% of all sequence variations (Collins et al., 1998). SNPs are conventionally defined as common variations at a single nucleotide position in the genome such that the least common allele is present in at least 1% of a given population. However, some researchers distinguish between these ‘polymorphic SNPs’ and ‘common SNPs’ with a minor allele frequency of at least 5% in the population (Brookes, 1999; Kruglyak and Nickerson, 2001; Ladiges et al., 2004). For over 30 years, the field of genetics has been dominated by Sanger-based DNA sequencing methods. However, the emergence of commercial instruments for non-Sanger-based sequencing methods over the last five years (“next generation” sequencing platforms) has revolutionized the ability to investigate whole genome variation. Next generation sequencing technologies have sharply reduced the cost of sequencing and allowed for large investigations into common genetic variation in the human population (Davey et al., 2011; Mardis, 2008a; Mardis, 2008b; Metzker, 2010; Schuster, 2008). The 1000 Genomes Project (Pennisi, 2010; Siva, 2008) is an international collaboration to sequence the genomes of a substantial number of people, in order to provide a comprehensive resource on human genetic variation and their haplotype contexts. This project has identified up to 50% more novel genetic variants compared to the existing most comprehensive SNP database, HapMap (Olivier, 2003), with an estimate of more than 5.9 million variant nucleotide positions in the human genome. For example, a total of 68,300 non-synonymous SNPs were identified through the 1000 Genomes pilot project (http://www.1000genomes.org), 34,161 of which were found to be novel. A fraction of these variations has been associated with various diseases and assigned a biological role, while others have been proposed to be silent variations with no effect (Pennisi, 2010). Some of these have also been indicated for possible use in clinical practice. For example, a particular 7 SNP risk profile may aid in management of BRCA2 mutation carriers in breast cancer (Antoniou et al., 2010), and a combination of several validated “low-risk” SNP markers may

32

Jyotsna Batra, Tracy O’Mara, Felicity Lose, and Judith A. Clements

be useful in breast cancer and prostate cancer risk prediction (Pharoah et al., 2008; Zheng et al., 2008). In the current chapter, we have summarized the available data on SNPs present within and around the human Kallikrein (KLK) gene locus, which is a region of approximately 300 kilobases (kb) on chromosome 19q13.4, containing 15 genes clustered in a tandem array (as detailed in Chapter 1), and reviewed their association with various malignant and non-malignant diseases.

2.2 KLK SNPs – data-mining from SNPdb and 1000 Genomes All SNPs within +/–10 kb of the KLK locus mapped to Genome Build GRCh37/hg19 (chr19:51312404..51587502) were downloaded from the most popular public SNP database, the National Center for Biotechnology Information’s (NCBI) dbSNP (Sherry et al., 2001) build 132, using the UCSC web-browser (http://genome.ucsc.edu/). A total of 4,331 SNPs were identified, which is almost twice the number of SNPs reported in an existing database “ParSNPs” (built in 2007), which catalogues the common polymorphisms identified within the KLK locus (Goard et al., 2007). Further analysis of these polymorphisms in the KLK locus indicated that 3,420 (73.4%) of them were SNPs and 911 (26.6%) were insertion/deletion polymorphisms (indels) and/or mixed type. A total of 2,627 out of the 4,331 polymorphisms were found to be validated either by frequency, two-hit, submitter, cluster, or by HapMap (as defined in Tab. 2.1), which includes 2,535 SNPs and 92 indels. Five hundred and seventy four SNPs out of 2,627 have been recently discovered from the 1000 Genomes database (Pennisi, 2010; Siva, 2008). A total of 2,150 SNPs were shown to have a minor allele frequency (MAF) of more than 1% in the European population. Our further analysis was restricted to validated polymorphisms only, in an attempt to avoid analysis of false positive records in the dbSNP database, which may have arisen due to sequencing artifacts. These SNPs observed in the KLK locus may be classified according to the nature of their alleles. SNPs start out as single base substitutions in an individual that are subsequently established in the population over time. They may therefore be classified as transitions (C → T or G → A) or as transversions (C → A or G → T, C → G, T → A). Of the

Tab. 2.1 Validation methods for the SNPs identified through dbSNP database. – By Frequency – at least one submitted SNP in cluster has frequency data submitted – By Cluster – cluster has at least 2 submissions, with at least one submission assayed with a noncomputational method – By Submitter – at least one submitter SNP in cluster was validated by independent assay – By 2 Hit/2 Allele – all alleles have been observed in at least 2 chromosomes – By HapMap – submitted by HapMap project (human only) – By 1000Genomes – submitted by 1000 Genomes project (human only)

Single Nucleotide Polymorphisms in the Human KLK Locus

33

Tab. 2.2 Position annotation of the SNPs as described in dbSNP database. SNP category

Description

locus-region coding

variation in region of gene, but not in transcript variation in coding region of gene, assigned if the allele-specific class is unknown no change in peptide for allele with respect to contig sequence change in peptide with respect to contig sequence variation in transcript, but not in coding region interval variation in intron, but not in first 2 or last 2 bases of intron variation in first 2 or last 2 bases of intron

coding-synon coding-nonsynon mrna-utr Intron splice-site

2,535 validated SNPs in the KLK locus, 1,678 (66.2%) were C → T transitions (or G → A on the opposite strand). Of the transversion SNPs, 464 (18.3%) were C → A (G → T on the opposite strand), while 234 (9.2%) and 148 (5.8%) were C → G and T → A transversions, respectively. For 11 SNPs, more than two alleles were reported, so these records were not classified in the groups above. We also looked at the functional effects of the SNPs, based on its position with respect to the nearest gene, and as defined by the UCSC browser (Tab. 2.2). The most prevalent class annotations were those corresponding to the noncoding intronic class (678/2,535; 26.7%), untranslated region (UTR) (113, 4.5%) and gene locus region polymorphisms (241, 9.5%, present near the 3ʹ or 5ʹ of the gene). A smaller proportion of polymorphisms was associated with coding regions in the KLK locus (97/2,535; 3.8%), with 35% synonymous, 62% missense and 3% nonsense changes. The remaining polymorphism records, for which no particular position class was specified by dbSNP (1406/2,535; 55.4%), may refer to either intergenic or unannotated polymorphisms (Fig. 2.1).

27% 3% non-coding intronic coding UTR near gene unclassified

55%

35%

4% 4% 10%

62%

synonymous missense nonsense

Fig. 2.1 Position-based class annotations associated with validated KLK polymorphisms in dbSNP, as downloaded from the UCSC browser. Note: since multiple transcript variants are known for each KLK gene, the functional class annotations may vary based on the transcript under consideration. In the current annotation, SNPs have been labeled on a preferential basis, e.g. coding region preferred over UTR, followed by intronic and near gene locations.

34

Jyotsna Batra, Tracy O’Mara, Felicity Lose, and Judith A. Clements

2.3 Functional annotations using web-based prediction tools Further in silico analysis to predict the potential functional roles of the 2,535 validated KLK SNPs can be conducted with the use of various web-based tools as shown in Fig. 2.2. We ran these SNPs through ‘FuncPred’ from the SNPinfo webserver (http:// manticore.niehs.nih.gov/snpfunc.htm), which assesses multiple functional prediction programs, as well as calculating the regulatory potential score and conservation scores of SNPs (i.e. protein stability, splicing regulation, transcriptional regulation and post-translational modification). Data for 1,404 out of 2,535 SNPs was retrieved from the ‘FuncPred’ program. As FuncPred may not include SNPs recently identified through the 1000 Genomes project, additional analyses, using individual web-based tools specific to the SNP of interest, are also recommended. Only a small fraction of KLK SNPs were found to have a positive prediction for a functional role. For example, 14 SNPs (rs11670728, rs12974899, rs12978483, rs2569522, rs2659056, rs28384475, rs3212811, rs3212840, rs3212846, rs3760739, rs58876874, rs7252452, rs3212850, rs3745541) were predicted to alter the binding site of a transcription factor and 9 SNPs (rs1624358, rs16988799, rs2736433, rs28384475, rs35192866, rs61752567, rs7259651, rs10403407, rs2659094) were predicted to be involved in splicing regulation through alterations of exonic splicing enhancer (ESE) sites, 6 of which may abolish the splicing domain. ‘FuncPred’ also uses the PolyPhen tool (Adzhubei et al., 2010) (http:// coot.embl.de/PolyPhen/) to estimate the structural and functional impact of an amino acid substitution, and predicted 5 SNPs to be probably deleterious (rs1048328, rs198977, rs5515, rs10422897, rs183854).

transcription factor binding sites

splicing signals

miRNA binding sites

TRANSFAC, JASPAR

ESEfinder, Ace view

miRanda, miRBase, miRDB

5’

3’ intron

exon

UTR long-range enhancers EEL

UTR amino acid substitutions

polyadenylation PolyApred, Polyadq, Erpin

HS F E C V CAC P HC F E R V CAC P DS F E R I CAS P NS F E R V C G C P RAF E R I SVSP HSV E R V CAC P

sequence analysis

structure analysis

SIFT, Pmut, PANTHER, MutDB

PolyPhen, SNPs3D, LS_MUT

Fig. 2.2 An overview of some of the web based tools used, represented relative to the SNP location in a gene (Figure adapted from (Lee et al., 2009b). Each SNP should be further examined for its functional effect with respect to each category (i.e. protein coding, splicing regulation, transcriptional regulation and post-translation), using a series of algorithms.

Single Nucleotide Polymorphisms in the Human KLK Locus

35

We performed additional analyses, using the SNPs3D software (http://www. snps3d.org), which employs two methods for determining whether an SNP will be deleterious to protein function (Yue et al., 2006). The first method makes predictions based on the estimated impact of a non-synonymous SNP on protein stability, while the second considers conservation of the given amino acid within a protein family. A total of 11 SNPs were predicted to result in a deleterious substitution, as calculated by at least one method (rs17632542, rs5515, rs198977, rs6072, 3733402, rs3733402, rs4253325, rs4253379, rs2569527, rs1048328, rs183854). Twenty-four SNPs were found to have a high conservation score of >0.4 with three SNPs (rs7245858, rs2691209, rs16989073) having a score of 1. Another interesting class of SNPs present within the KLK genes are the miRSNPs. miRSNPs are defined as polymorphisms present at or near microRNA binding sites of functional genes that can affect gene expression by interfering with miRNA function (Bertino et al., 2007). Four SNPs (rs10426, rs2691258, rs58682039, rs61269009) were predicted to alter miRNA binding sites, as predicted by Miranda (http://www. microrna.org/microrna/home.do), while the Sanger prediction method (http://www. mirbase.org/) predicted 9 miRSNPs (rs2411334, rs2569735, rs2659092, rs268883, rs4846, rs9524, rs12151211, rs1654555, rs2232539).

2.4 Experimentally validated functional KLK SNPs Naturally occurring polymorphisms in several of the human KLK genes have been investigated experimentally for functionality, including those in KLK1, KLK2, KLK3, KLK7 and KLK12. The KLK1 exon 3 non-synonymous polymorphism Arg77His (dbSNP ID rs5515) was assessed for an association with urinary KLK1 activity in hypertensive human subjects, due to the fact that KLK1 activity has previously been reported to be reduced in essential hypertension and due to being partly inherited (Slim et al., 2002). Sixty-six patients were analyzed, 5 of which were heterozygous for the Arg77His polymorphism, with urinary KLK1 activity shown to be statistically significantly decreased in heterozygotes. In vitro functional analysis of the activity of the wild-type or polymorphic KLK1 protein confirmed this decreased activity in the presence of the histidine residue, and modeling using crystallographic data suggested that this residue may alter substrate binding. Another KLK1 coding SNP, Gln145Glu (rs5516), did not affect urinary KLK1 activity in this study. The same laboratory performed a follow-up study of this finding in normotensive subjects and confirmed the reduced activity in carriers of the histidine allele (Azizi et al., 2005). They further investigated the possible physiological effects this SNP might have on cardiovascular traits and showed that subjects heterozygous for Arg77His showed inappropriate remodeling of the brachial artery, which possibly may have implications for cardiovascular diseases. It is interesting to note that the in silico analyses of rs5515 detailed above (section 2.3) also predicted the amino acid substitution to be possibly deleterious. One other functional

36

Jyotsna Batra, Tracy O’Mara, Felicity Lose, and Judith A. Clements

analysis of KLK1 has shown that SNPs in the promoter region of KLK1 can decrease KLK1 gene expression (Song et al., 1997). KLK2 displays a common coding region polymorphism, which substitutes Arg250 for a tryptophan residue (rs198977) and experimental analysis, using recombinant KLK2 produced in insect cells, revealed a lack of trypsin-like activity by the polymorphic KLK2 protein (Herrala et al., 1997). An association of rs198977 with significantly decreased levels of serum KLK2 has also been shown, in two large studies (Klein et al., 2010; Nam et al., 2003), and our bioinformatic analyses indicated a possibly damaging/deleterious effect (section 2.3). This SNP has been the subject of much investigation in relation to prostate cancer risk and will be discussed later in this chapter. The most interesting functional SNP is rs266882, which resides within one of the androgen response elements (ARE) of KLK3, ARE1 (Rao and Cramer, 1999). Studies have reported this SNP to be associated with increased serum PSA levels (Medeiros et al., 2002; Rao et al., 2003; Schatzl et al., 2005; Xu et al., 2002; Xue et al., 2001) and functional studies have shown rs266882 to alter KLK3 expression by augmenting the ability of the androgen receptor to bind to the ARE1 region (Lai et al., 2007). A single study by Vasilopoulos et al. (2011) investigated the KLK7 3ʹ untranslated region AACC insertion polymorphism for an effect on KLK7 expression in vitro, and revealed increased expression in the presence of the insertion, although to date this polymorphism has not been convincingly associated with any disease. KLK12 intronic c.457 + 2T > C polymorphism has been shown to be associated with a splicing abnormality. The authors claimed that the expression of the human KLK12 classical mRNA and the protein (KLK12) was absent in individuals with a c.457 + 2C/C genotype but not in individuals with the T/T or T/C genotypes (Shinmura et al., 2004). This analysis was conducted on a small number (N = 22) of samples and needs to be replicated with a larger dataset, in order to be conclusive. Indeed, additional experimental studies are required to demonstrate the functional role of the SNPs shortlisted in section 2.3.

2.5 KLK SNP haplotypes and tagging Alleles of SNPs in close physical proximity to each other are often correlated, and can be represented as haplotypes. Linkage Disequilibrium (LD) is the more or less frequent occurrence of some combinations of alleles in a population than would be expected from a random formation of haplotypes from alleles (Devlin and Risch, 1995). LD is represented by an r2 or a Dʹ value, which is calculated based on the difference between observed and expected allelic frequencies (assuming random distributions). Geneticists commonly use the threshold of r2 greater than 0.8 to measure which SNPs are in LD with other SNPs. To draw the LD map of KLK locus, we used the HapMap Public Release 27, Build 36 (http://hapmap.ncbi.nlm.nih.gov/cgi-perl/ gbrowse/hapmap27_B36/#search). All database SNPs within the CEPH population

Single Nucleotide Polymorphisms in the Human KLK Locus

Fig. 2.3 LD map of the KLK locus, plotted using Haploview v4.2. Data from the HapMap database European population was used.

37

38

Jyotsna Batra, Tracy O’Mara, Felicity Lose, and Judith A. Clements

(Utah residents with ancestry from northern and western Europe) were plotted using the Haploview 4.2 software (http://www.broad.mit.edu/mpg/haploview/) (Barrett et al., 2005). A total of 262 SNPs were genotyped in HapMap for a total of 205 individuals; 19 SNPs had frequency 5%) (Pestell, 2008).

Risk-associated KLK SNPs using candidate gene association studies Prior to 2007, the candidate gene approach was the predominant method for exploring inherited low risk genetic variants. This approach is based on previous knowledge of the gene(s) of interest in the pathogenesis of the phenotype and involves the examination of a relatively small number of genetic variants (between 1–100 SNPs) (Savage, 2008). This approach has led to the identification of a number of alleles that may influence the risk of hormone-related cancers, particularly prostate cancer (Tab. 2.3). Before 2007, the KLK SNP studied most frequently was rs266882 (G-158A). A significant association with prostate cancer risk was originally reported for this SNP by Xue et al. (2000). However, numerous subsequent studies have revealed conflicting results. Some reported an association with the same allele as the original study (Cicek et al., 2005; Gsur et al., 2002; Lai et al., 2007; Medeiros et al., 2002), while others reported either a significant association in the opposite direction (Binnie et al., 2005; Chiang et al., 2004) or no association for this SNP (Cunningham et al., 2007; Mononen et al., 2006; Pal et al., 2007; Penney et al., 2011; Salinas et al., 2005; Severi et al., 2006; Wang

rs198977

KLK2

rs2664155 G/A

rs1506684 C/T

rs2569744 C/T rs2664156 C/T

KLK2

KLK2 KLK2

C/T

PrCa PrCa

PrCa

PrCa

TFBS TFBS

TFBS 596 645

596

645

117

BrCa TFBS

645 596 135

PrCa PrCa PrCa

PrCa PrCa

miRNA 617 binding non-syn, damaging by polyphen 996 254

Cases

PrCa

Alleles Disease Putative functional role*

KLK2

C792T

SNP

Gene

567 606

567

606

194

606 567 142

1092 168, men with BPH

671

Controls

No No

Yes

Yes

Yes

Yes No Yes

Yes, with localized cancer

Yes Yes

Yes

Association

Tab. 2.3 Summary of KLK candidate gene association studies performed in hormone-related cancers.

Not significant with Gleason score, stage or tumor volume TT/CT: OR 1.3 (1.1–1.6); P = 0.05 Not significant CC: OR 2.78 (1.09–7.06); p = 0.031 T allele: OR 0.56 (0.34–0.83); p = 0.0059 AG/AA: OR 1.4 (1.2–1.8); P = 0.002 T allele: 47.2% (controls) vs. 42.4% (cases); p = 0.041 Not significant Not significant

TT: OR 1.49 (1.0–2.2); p = 0.04 C allele: cases 82.1%, controls 74.7%; p = 0.010 C allele: localized 87.5%, nonlocalized 74.4%; p = 0.026

TT: OR 2.13 (1.3–3.5); p = 0.004

Risk estimates (95% CI)

Pal et al., 2007 Nam et al., 2006

Pal et al., 2007

Nam et al., 2006

Lee et al., 2009a

Nam et al., 2006 Pal et al., 2007 Mittal et al., 2007

Nam et al., 2005 Chiang et al., 2005

Nam et al., 2003

Reference

40 Jyotsna Batra, Tracy O’Mara, Felicity Lose, and Judith A. Clements

KLK3

G-158A

rs266882

G/A

557

PrCa

PrCa

101 300 PrCa cases, 216 BPH cases 122

BrCa PrCa

523

84, BPH patients

266

149

100, advan- 100 ced cases 151 127

132

TFBS

PrCa

PrCa

PrCa

G allele: 87.3% vs. 77.4%; p = 0.008 GG: OR 2.27; p = 0.008 GG: larger tumor volume (p = 0.013)

Not significant No significant association with BPH or PrCa risk

AG + GG: OR 0.63 (0.39–0.99); p = 0.048 GG: OR 2.29 (1.06–4.94); p = 0.034

AA: increased circulating tumor cells (p = 0.018)

A allele: 63.3% vs. 48.8%; P = 0.009, AA: OR 2.92 (1.10–7.86) p = 0.013

GG: OR 2.90 (1.24–6.78)

Yes Yes, with larger tumor volume Yes, with GG: increased extracapsular increased extension (p = 0.036) extracapsular extension No Not significant

Yes

Yes, with increased Gleason score No No

Yes, with early onset PrCa Yes, with circulating tumor cells Yes

Yes

Yes

Salinas et al., 2005

Chiang et al., 2004

Yang et al., 2002 Wang et al., 2003

Gsur et al., 2002

Medeiros et al., 2002

Xue et al., 2000

Single Nucleotide Polymorphisms in the Human KLK Locus

41

BrCa

PrCa

rs11084033 C/A

rs11575894 A/AA

–205 A/AA

KLK3

OvCa

TFBS –

–

–

438, with 493 family history 499, sporadic 493 cases

101

304

299

OvCa

PrCa

596 567 438, with 493 family history 499, sporadic 493 cases 135 142

PrCa PrCa

923 734 223

968 821 209

PrCa PrCa PrCa

479 67

Controls

439 100

Cases

PrCa PrCa

KLK3

Alleles Disease Putative functional role*

SNP

Gene

Tab. 2.3 (continued)

No significant association with survival AA: HR 2.12(1.08–4.15); p = 0.04

No

Not significant

Yes, with survival Yes, with less Less aggressive cancer aggressive cancer No Not significant

No Yes, with Gleason score No

Not significant for risk GG: OR 6.23 (2.29–16.98); p < 0.01

Not significant

No

No No

No No Yes

GG: OR 2.71 (1.06–6.94); p = 0.04 GG: 30% cancer vs. 16% controls (p = 0.025) Not significant Not significant AA/AG: OR 2.61 (1.37–4.96) p = 0.004 Not significant Not significant

Risk estimates (95% CI)

Yes Yes

Association

Cunningham et al., 2007

Yang et al., 2002

O‘Mara et al., 2011

O‘Mara et al., 2011

Pal et al., 2007 Cunningham et al., 2007 Mittal et al., 2007

Mononen et al., 2006 Severi et al., 2006 Lai et al., 2007

Cicek et al., 2005 Binnie et al., 2005

Reference

42 Jyotsna Batra, Tracy O’Mara, Felicity Lose, and Judith A. Clements

rs266849

rs1058205 T/C

rs266870

rs266868 rs266866 rs3760722 rs2292186 rs2659122

rs6998

rs806019

KLK3

KLK3

KLK3

KLK3 KLK3 KLK3 KLK3 KLK3

KLK3

KLK4

BrCa

PrCa

OvCa OvCa

KLK10 rs3745535 G/T

KLK10 rs7259451 C/A

PrCa

PrCa PrCa PrCa PrCa PrCa

PrCa

PrCa

PrCa

PrCa PrCa

PrCa PrCa

C/G

A/G

G/A G/C C/T G/A A/G

C/T

A/G

rs2739448 T/C Rs4802754 G/A

KLK3 KLK3

G/A

rs925013 G-4643A

KLK3

117

596

596 596 596 596 596

Splicing 49 (ESE or ESS), Non-Syn 319 319

TFBS TFBS TFBS miRNA binding site miRNA binding site

479 734

– –

52

194

567

567 567 567 567 567

567

567

439 479 438, with 493 family history 499, sporadic 493 cases 596 567

439 821

miRNA 596 binding site 596

TFBS

TFBS

No No

Yes

Yes

No

No No No No Yes

Yes

Yes

Yes

No No

No Yes

Not significant Not significant

GG: cases 26% v controls 50%; p = 0.027

G allele: OR 0.53 (0.33–0.85); p = 0.0068

G allele: 20.7% (controls) vs. 15.7% (cases); p = 0.006 C allele: 20.2% (controls) vs. 14.2% (cases); p = 0.001 T-allele: 52.3% (controls) vs. 45.4% (cases), p = 0.004 Not significant Not significant Not significant Not significant G allele: 28.1% (controls) vs. 23.9% (cases); p = 0.041 Not significant

Not significant

Not significant G allele: OR 1.4 (1.1–1.7); p = 0.001 Not significant Not significant

Batra et al., 2010 Batra et al., 2010

Bharaj et al., 2002

Lee et al., 2009a

Pal et al., 2007

Pal et al., 2007 Pal et al., 2007 Pal et al., 2007 Pal et al., 2007 Pal et al., 2007

Pal et al., 2007

Pal et al., 2007

Pal et al., 2007

Cicek et al., 2005 Cunningham et al., 2007

Cicek et al., 2005 Severi et al., 2006

Single Nucleotide Polymorphisms in the Human KLK Locus

43

OvCa OvCa OvCa OvCa OvCa

Splicing 319 (ESE or ESS) TFBS 319, Australian cases 3556, Cases from UK GWAS & TCGA TFBS 319 TFBS, miRNA 319 binding site TFBS 319 TFBS 319 TFBS 319 319 319

319

Cases

– – – – –

– –

–

–

–

–

Controls

No No No No No

No No

No

Yes

No

No

Association

Not significant Not significant Not significant Not significant Not significant

Not significant Not significant

Not significant

CT/TT: OR 1.42 (1.02–1.96); p = 0.01

Not significant

Not significant

Risk estimates (95% CI)

Batra et al., 2011b Batra et al., 2011b Batra et al., 2011b Batra et al., 2011b Batra et al., 2011b

Batra et al., 2011b Batra et al., 2011b

Batra et al., 2011b

Batra et al., 2011b

Batra et al., 2010

Reference

* As predicted by ‘FuncPred’ from the SNPinfo web-server (http://manticore.niehs.nih.gov/snpfunc.htm) Abbreviations: OR – odds ratio; CI – confidence interval, GWAS – genome-wide association study, TCGA – the Cancer Genome Atlas, PrCa – prostate cancer, BrCa – breast cancer, OvCa – ovarian cancer, TFBS-transcription factor binding site

A/G C/T A/G C/T A/T

KLK15 KLK15 KLK15 KLK15 KLK15

rs2659055 rs190552 rs2739442 rs2659053 rs2569746

OvCa OvCa

KLK15 rs2659058 A/G KLK15 rs3212810 A/G

KLK15

OvCa

KLK15 rs266851

C/T

OvCa

KLK15 rs3745522 G/T

Alleles Disease Putative functional role*

OvCa

SNP

KLK10 rs2075695 C/T

Gene

Tab. 2.3 (continued)

44 Jyotsna Batra, Tracy O’Mara, Felicity Lose, and Judith A. Clements

Mutation: g.2142 G > A (Trp153Stop)

Polymorphism: 3ʹ untranslated region AACC insertion g.5784 Polymorphism: 3ʹ untranslated region AACC insertion g.5784 Polymorphism: „TaqI polymorphism”

KLK4

KLK7

KLK7

KLK1

Atopic dermatitis

Blood pressure

KLK4

Polymorphism: rs78093423 (–130 Gn) Mutation: g.2142 G > A (Trp153Stop)

Mutation: g.2142 G > A (Trp153Stop)

KLK1

Alzheimer‘s disease, vascular dementia

Methylation

KLK4

KLK1

Acute kidney injury

Polymorphism/ Mutation

Amelogenesis Imperfecta- hypomaturation type IIA1 Amelogenesis Imperfecta- hypomaturation type IIA1 Amelogenesis Imperfecta- hypomaturation type IIA1 Atopic dermatitis

Gene

Outcome

Cases

Caucasian

Caucasian

Norwegian

Increased Caucasian mRNA expression

99

103

71 families

54 families

Not reported 1 family

1057

102

261

N/A

N/A

N/A

Causal

Causal

Causal

N/A

None

None

N/A

N/A

AACC inser- Increased risk: tion 2.31 (1.42–3.76), P = 0.0007

A allele

A allele

A allele

None

Methylation Increased: P = 0.011

Controls Association Risk estimates OR (95%CI)

Caucasian/ 14 32 African American Taiwanese 151 Alzheimer‘s, 161 54 Dementia

Ethnicity

Increased Caucasian mRNA expression

Truncated protein

Truncated protein

Truncated protein

Alters expression

May alter expression

Functional effect

Tab. 2.4 KLK genetic associations performed in non-malignant diseases.

Berge and Berg, 1993

Hubiche et al., 2007

Vasilopoulos et al., 2004

Wright et al., 2011

Wright et al., 2009

Hart et al., 2004

Wang et al., 2006

Kang et al., 2011

Reference

Single Nucleotide Polymorphisms in the Human KLK Locus

45

Gene

KLK1

KLK1

KLK7

KLK1

KLK1

KLK1

KLK1

Outcome

Blood pressure, myocardial infarction

Cerebral hemorrhage

Eczema

Hypertension

Hypertension

Hypertension

Hypertension

Tab. 2.4 (continued) Functional effect

Polymorphisms: rs78093423 (–130 Gn), rs5515 (Arg77His), rs5517 (Lys186Glu), rs5519 Polymorphisms: Non-synonyrs5516 (Gln145Glu), mous SNPs, rs5517 (Lys186Glu) may also alter isoform expression Polymorphism: 3ʹ untranslated region AACC insertion Polymorphism: „TaqI polymorphism” Polymorphism: „ACn polymorphism” Polymorphisms: rs78093423 (-130 Gn), rs36217621, rs5515 (Arg77His), rs1054713, rs5516 (Gln145Glu) Polymorphisms: rs5517 (Lys186Glu), rs5519

Polymorphism/ Mutation 233

Cases

Japanese

Caucasian

Caucasian

Caucasian

Caucasian

>750

314

88

85

1191

Chinese Han 273

Norwegian

Ethnicity

>1100

255

92

100

4544

140

374

None

None

None

None

None

rs5517

None

N/A

N/A

N/A

N/A

N/A

Increased risk: P < 0.05

N/A

Controls Association Risk estimates OR (95%CI)

Iwai et al., 2004

Friend et al., 1996 Slim et al., 2002

Zee et al., 1994

Weidinger et al., 2008

Zeng et al., 2010

Berge et al., 1997

Reference

46 Jyotsna Batra, Tracy O’Mara, Felicity Lose, and Judith A. Clements

KLK1

Hypertension

Hypertension

KLK8

Polymorphisms: rs1722561, rs1701946

Polymorphisms: Non-synonyrs5516 (Gln145Glu), mous SNPs, rs5517 (Lys186Glu) may also alter isoform expression Response to irbesartan KLK1 Polymorphisms: Non-synonyin hypertension rs5516 (Gln145Glu), mous SNPs, rs5517 (Lys186Glu) may also alter isoform expression Hypertension-associ- KLK1 Polymorphism: Alters expresated end-stage renal rs78093423 sion disease (–130 Gn) Intracranial aneurysm 19q13 Microsatellite markers (Linkage) Intracranial aneurysm KLK Polymorphisms: 18 region tagSNPs

KLK15 Polymorphisms: rs3745523, rs3745522 KLK1 Polymorphism: rs3212816, rs78093423 (–130 Gn)

1061

368

Finnish

524

368

Finnish

Finnish/ Russian (stage 2)

444

Finnish

African Ame- 76 rican

Chinese

Chinese Han 2411

578

392

392

85

2348

200

Chinese Han 200

>1100

200

>750

Chinese Han 200

Japanese

N/A

Increased risk: P = 0.003

N/A

Increased risk: P < 0.05 Increased risk: 1.25 (1.16–1.46), P = 0.007

Linkage to LOD score 3.50, region P = 0.00006 rs1722561 Increased risk: P = 0.003 rs1701946 Increased risk: P = 0.002 rs1722561 Increased risk: 1.35 (1.14–1.60), P = 0.0005

-130 G12

None

rs5517

-130 G8

rs3212816 Increased risk: P < 0.05

None

van der Voet et al., 2004 Weinsheimer et al., 2007

Yu et al., 2002

Jiang et al., 2011

Zhao et al., 2007

Hua et al., 2005

Single Nucleotide Polymorphisms in the Human KLK Locus

47

KLK1

KLK1

KLK1

Abdominal aortic aneurysm

Lupus nephritis

Lupus nephritis

KLK7

KLK6

KLK5

Gene

Outcome

Tab. 2.4 (continued)

Polymorphisms: rs2740502, rs5516 (Gln145Glu), rs5517 (Lys186Glu) Polymorphisms: rs2740502, rs1054713, rs5516 (Gln145Glu), rs5517 (Lys186Glu) Polymorphisms: rs1897604, rs268908, rs2569522 Polymorphism: rs1654537 Polymorphism: rs1701924

Polymorphism: rs5516 C > G (Gln145Glu)

Polymorphism/ Mutation

Non-synonymous SNP, may also alter isoform expression

Functional effect 524

Finnish/ Russian (stage 2) Caucasian

Caucasian

Caucasian

Caucasian

Caucasian

35

35

35

>900

Chinese Han 306

755 small AAA, 79 large AAA

Cases

Ethnicity

361

361

361

>4500

338

795

578

None

None

None

None

None

N/A

N/A

N/A

N/A

N/A

rs1701946 Increased risk: 1.32 (1.12–1.57), P = 0.0011 G allele Borderline increased risk: 2.40 (0.98–5.88), P = 0.056

Controls Association Risk estimates OR (95%CI)

Liu et al., 2009

Zhou et al., 2010

Biros et al., 2011

Reference

48 Jyotsna Batra, Tracy O’Mara, Felicity Lose, and Judith A. Clements

N/A

28 (with progres- 170 sion), 120 (no progression)

Caucasian/ 6 families Indian Not reported 1 family

Alters expres- Taiwanese sion

Abbreviations: OR – odds ratio, CI – confidence interval

Polymorphism: rs78093423 (–130 Gn)

19q13 Microsatellite markers (Linkage) KLK10 Mutation screening

Vesicoureteric reflux KLK1 with renal progression in children

Peutz-Jeghers syndrome Peutz-Jeghers syndrome -130 G12

Linkage to region None

Increased risk: P = 0.008

N/A

LOD score 3.80

Mehenni et al., 1997 BuchetPoyau et al., 2002 Lee-Chen et al., 2004

Single Nucleotide Polymorphisms in the Human KLK Locus

49

50

Jyotsna Batra, Tracy O’Mara, Felicity Lose, and Judith A. Clements

et al., 2003). A meta-analysis of all studies published until 2008 reported no evidence of association with overall prostate cancer risk (Jesser et al., 2008). Significant associations with breast cancer, ovarian cancer survival and prostate cancer have also been reported for SNPs located within KLK2, KLK3, KLK4, KLK10 and KLK15, as detailed in Tab. 2.3. Regarding the potential role of polymorphisms in non-cancerous diseases, KLK1 has been the most intensively studied KLK gene, perhaps because it was the first KLK to be discovered. Of the thirteen different non-malignant diseases and traits investigated in KLKs (Tab. 2.4), the role of KLK1 in cardiovascular and kidney-related diseases has been the focus of the majority of studies. A candidate gene association study for the functional SNP rs5515 (as detailed in section 2.4), with risk of cardiovascular traits/disease has not found any association in the only two small candidate SNP studies performed (Tab. 2.4) to date. Perhaps the most compelling finding arose from research into hypertension in the Chinese Han population, with several KLK1 polymorphisms, indicating an increased risk (Hua et al., 2005; Zhao et al., 2007). However, unless performed in a very large sample size of well characterized populations, the candidate-gene approach is prone to spurious results. This is evidenced by the number of follow-up studies, which attempted to validate positive reports of KLK polymorphism disease associations, but failed to confirm the original results (Tab. 2.3 and 2.4).

Risk associated KLK SNPs using genome-wide association studies Since around 2007, genetic epidemiology has been transformed by the availability of high throughput genotyping methods, designed to provide an unbiased survey of the effects of common genetic variants, called genome-wide association studies (GWAS). GWAS are studies wherein research subjects are typed for a large number of genetic variants, typically between 300,000 and 1,000,000 polymorphisms, and the allele or genotype frequencies are evaluated for differences between groups (e.g. disease versus non-disease groups). The advantage of GWAS is that they allow for a wide search of genetic variants associated with disease, without having to specify a particular gene of interest (Wellcome Trust Case Control Consortium, 2007). However, due to the massive number of joint statistical tests that have been performed, there is a higher level of type-1 error (false positives). Therefore, statistical corrections for multiple hypotheses testing are essential and a P < 10–7 has been proposed as an appropriate level of significance for evidence of a genome-wide association (Thomas et al., 2005). Because of this, large sample sizes are required for GWAS, in order to ensure adequate statistical power to detect an association with small P-values. Since the advent of GWAS technology, highly statistically significant and robust associations with SNPs have been successfully identified in over 230 diseases and traits (Hindorff et al., 2011). The National Human Genome Research Institute maintains a catalogue of published GWAS, which can be accessed at http://www.genome.gov/gwastudies/.

rs198977

KLK2

rs1506684 rs2569739

rs12984214 rs198972 C/T

KLK2 KLK2

KLK2 KLK2

C/T G/A

rs2664155

G/A

C/T

Allele

KLK2

C792T

SNP

Gene

TFBS

TFBS TFBS

TFBS

miRNA binding non-syn, damaging by polyphen

Putative functional role*

Stage

–

–

1637 1615

182

798 Ashkenazi Jewish 2686 1389

1172 1172

1157 1157

5185 1157 1327

–

703

5192 1172 1030

1615

1157

No No

No No Yes

Yes Yes

Yes, with biochemical recurrence Yes, with decreased Gleason score No

Yes

No

Controls Association

1389

1172

Cases

Not significant with biochemical recurrence, metastasis or PrCa specific death OR 1.08 (0.97–1.19); p = 0.029 AG/AA: OR 1.24 (1.1–1.4); p = 0.001 Not significant Not significant With decreased risk; p-trend = 0.03 Not significant Not significant

p = 0.04

TT/CT: OR 1.16 (1.0–1.3); p = 0.05 T allele: OR 1.58 (1.15–2.18); p < 0.01

Not significant

Risk estimates (95% CI)

Tab. 2.5 Summary of KLK SNP association studies performed in prostate cancer post genome-wide association studies (2008 onwards).

Ahn et al., 2008 Ahn et al., 2008 Penney et al., 2011 Ahn et al., 2008 Ahn et al., 2008

Klein et al., 2010 Nam et al., 2009

Gallagher et al., 2010

Kohli et al., 2010

Morote et al., 2011

Nam et al., 2009

Ahn et al., 2008

Reference

Single Nucleotide Polymorphisms in the Human KLK Locus

51

rs3760728

rs266882

KLK2

KLK3

KLK3

KLK3

rs198978

KLK2

rs266849

G-4643A

rs925013

G-158A

SNP

Gene

Tab. 2.5 (continued)

A/G

G/A

G/A

C/G

G/T

Allele

TFBS

TFBS

TFBS

miRNA binding site

Putative functional role*

1854 3268 5192

Stage 2

1030

3366 5185

1894

1327

–

1327

1030

1224

–

676

–

–

1224

500

798 Ashkenazi Jewish

798 Ashkenazi Jewish

–

798 Ashkenazi Jewish

No No

Yes

Yes, with Gleason score No

Yes, lymph node invasion No

No

No

No

No

Controls Association

Cases

Stage 1

Stage

G allele: increased lymph node invasion; p = 0.02 Not significant with risk, clinical stage, mortality or incidence of lethal disease G allele: increased % 4 or 5 Gleason Score; p = 0.03 Not significant with risk, clinical stage, mortality or incidence of lethal disease Per allele OR 0.62 (0.55–0.69); p = 1 × 10–16 Not validated in stage 2 Not significant

Not significant

Not significant for biochemical recurrence, metastasis or PrCa specific death Not significant for biochemical recurrence, metastasis or PrCa specific death Not significant for biochemical recurrence, metastasis or PrCa specific death

Risk estimates (95% CI)

Ahn et al., 2008

Eeles et al., 2008

Cramer et al., 2008 Penney et al., 2011

Jesser et al., 2008 Cramer et al., 2008 Penney et al., 2011

Gallagher et al., 2010

Gallagher et al., 2010

Gallagher et al., 2010

Reference

52 Jyotsna Batra, Tracy O’Mara, Felicity Lose, and Judith A. Clements

KLK3

rs2735839

A/G

Stage 2

3366 5185 –

805

1615 –

5192 1563

169

1389 5895

5742

7370 3268

1894

3940 4847

1894

10348

1854

3650 4901

Stage 2 Stage 3 Stage 1

1854

Stage 1

10015

798, Ashkenazi – Jewish

Not significant for biochemical recurrence, metastasis or PrCa specific death Yes Per allele OR 0.93 (0.89–0.98); P = 0.0085 Yes Per allele OR 0.62(0.55–0.69); p = 1.7 × 10–16 No Not validated in stage 2 Yes Per allele OR 0.81(0.74–0.87); overall combined P = 1.4 × 10–14 Yes Per allele OR 0.56(0.50–0.64); p = 2.4 × 10–20 Yes Per allele OR 0.89 (0.83–0.95); p = 0.0007 Yes Per allele OR 0.83(0.75–0.91); combined p = 1.5 × 10–18 No Not significant Yes, with with less aggressive cases; aggressiveness p = 0.03, not significant after multiple testing correction Yes, with stage with lower stage; p = 0.03 not significant for age at diagnosis No Not significant for risk, aggressiveness or early onset Yes AG/AA: OR 1.24 (1.1–1.4); P = 0.001 Yes, with with less aggressive disease OR aggressiveness 1.69 (1.22–2.36); p = 0.002 Yes with lower Gleason grade: p-trend = 3.7 × 10–7

No

Kader et al., 2009

Nam et al., 2009

Camp et al., 2009

Ahn et al., 2008 Xu et al., 2008

Kote-Jarai et al., 2008

Eeles et al., 2008

Lindstrom et al., 2011 Kote-Jarai et al., 2011

Gallagher et al., 2010

Single Nucleotide Polymorphisms in the Human KLK Locus

53

Gene

SNP

Tab. 2.5 (continued)

Allele

Putative functional role*

1267

Yes

No

Yes

Controls Association

1854 3650

Stage 2

3522

3940

1894

3338

Yes

Yes

Yes, with Gleason grade No

301, Yes AfricanAmerican 798, Ashkenazi – No Jewish Yes, with prostate-cancer specific death 2686 1637 No 9862 10366 Yes

454, AfricanAmerican

1308

Cases

Stage 1

Stage

Fitzgerald et al., 2009 Hooker et al., 2010

Reference

Not significant Per allele OR: 0.87 (0.82–0.92); p = 3.05 × 10–6 p = 0.0001, not significant for stage Per allele OR 0.93 (0.83–1.04); p = 0.19 Per allele OR 0.56(0.50–0.64); p = 8.2 × 10–20 Per allele OR 0.84(0.77–0.93); combined p = 2.3 × 10–17

Parikh et al., 2011 Kote-Jarai et al., 2011

Klein et al., 2010 Lindstrom et al., 2011

Not significant for biochemical Gallagher et al., recurrence or metastasis 2010 Per A allele: HR 1.65 (1.18–2.30); p = 0.003

with lower stage; p-trend = 1.9 × 10–4 Not significant for age at diagnosis Per allele OR 0.84 (0.72–0.99); p = 0.04 Per allele OR 0.78 (0.60–1.00); p = 0.04

Risk estimates (95% CI)

54 Jyotsna Batra, Tracy O’Mara, Felicity Lose, and Judith A. Clements

Ile179Thr

rs17632542 T/C

KLK3

T/C

rs1058205

KLK3

Splicing (ESE or ESS), nsSNP

miRNA binding site

3338 1327

3522 1030

1854 3650

Stage 1 Stage 2

3522

5325

4847

4901

Stage 3

3940

1894

3338

41417

3940

3650

Stage 2

1894

1854

5185

2359

2768 5192

4847

4901

Stage 1

Stage 3

Parikh et al., 2011 Penney et al., 2011

Kote-Jarai et al., 2011

Waters et al., 2009 Ahn et al., 2008

Parikh et al., 2011 Kote-Jarai et al., 2011

With decreased risk; p-trend = 0.03 Not significant with clinical stage, mortality or incidence of lethal disease T allele: p = 0.016 Gudmundsson et al., 2010

per allele OR 0.59(0.52–0.66); p = 4.7 × 10–20 per allele OR 0.85(0.78–0.93); combined P = 1.6 × 10–17 per allele OR 0.81(0.75–0.88); overall combined P = 2.8 × 10–28 Not significant

Not significant

Per allele OR 0.80(0.73–0.88); overall combined P = 1.1 × 10–22 Not significant

Yes, with T allele: OR 0.78; p = 0.0099 aggressiveness Yes Per allele OR 0.77(0.67–0.89), p-trend = 0.000341 Yes Per allele 0.35(0.30–0.42); p = 2.9 × 10–29 Yes Per allele 0.78(0.68–0.90); combined p = 1.6 × 10–24

Yes, with age at diagnosis

Yes

No

Yes

Yes

Yes

No

No

Yes

Single Nucleotide Polymorphisms in the Human KLK Locus

55

rs62113214 T/G

rs266870 rs266868 rs3760722

rs2292186

rs2659122

rs6998

rs2569729

KLK3

KLK3 KLK3 KLK3

KLK3

KLK3

KLK3

KLK3

A/G

A/G

A/G

G/A

C/T G/A C/T

rs62113212 C/T

KLK3

Allele

SNP

Gene

Tab. 2.5 (continued)

miRNA binding site

miRNA binding site

TFBS

TFBS

Putative functional role* 4901

Stage 3

5185

1327

1030

5192

–

1327

1030

798 Ashkenazi Jewish

3338

1327

5185 5185 5185 1327

3338

3338

4847

No

No

No

No

No

No

No No No No

Yes

Yes

Yes

Controls Association

3522

1030

5192 5192 5192 1030

3522

3522

Cases

Stage

Not significant for risk, clinical stage, mortality or incidence of lethal disease Not significant for biochemical recurrence, metastasis or PrCa specific death Not significant for risk, clinical stage, mortality or incidence of lethal disease not significant

Per Allele OR 0.65(0.57–0.74), overall combined P = 3.9 × 10–22 per allele OR 0.79 (0.69–0.91); p = 0.00117 per allele OR 0.77 (0.67–0.89); p = 0.000357 Not significant Not significant Not significant Not significant for risk, clinical stage, mortality or incidence of lethal disease Not significant for risk, clinical stage, mortality or incidence of lethal disease Not significant

Risk estimates (95% CI)

Ahn et al., 2008

Penney et al., 2011

Gallagher et al., 2010

Parikh et al., 2011 Penney et al., 2011

Penney et al., 2011

Parikh et al., 2011 Parikh et al., 2011 Ahn et al., 2008 Ahn et al., 2008 Ahn et al., 2008 Penney et al., 2011

Reference

56 Jyotsna Batra, Tracy O’Mara, Felicity Lose, and Judith A. Clements

rs61752561 G/A

rs56397626 T/C

rs11665698 C/A

rs2659124

rs266878

rs174776

KLK3

KLK3

KLK3

KLK3

KLK3

KLK3

C/T

C/G

T/A

A/G

rs2271094

KLK3

A/G C/T A/G A/G G/A

rs1061476 rs8104556 rs8112276 rs10401509 rs17526278

KLK3 KLK3 KLK3 KLK3 KLK3

miRNA binding site

TFBS

TFBS

TFBS

TFBS

3338 1327

1030

1327

1030

3522

3338

3338

3338

3338

–

–

5185 1157 5185 5185 –

3522

3522

3522

3522

798 Ashkenazi Jewish

798 Ashkenazi Jewish

5192 1172 5192 5192 798 Ashkenazi Jewish

not significant not significant not significant not significant Not significance for biochemical recurrence, metastasis or PrCa specific death No Not significance for biochemical recurrence, metastasis or PrCa specific death Yes, with PrCa Per A allele HR 3.1(1.84–5.20); specific death p < 0.0005 Yes, with meta- Per A allele HR 2.16 (1.20–3.90); stasis p = 0.011 Yes Per allele OR 0.80(0.71–0.92); p = 0.000495 Yes Per allele OR 0.88(0.82–0.95); p = 0.00144 No not significant after correction for multiple testing No not significant after correction for multiple testing Yes With decreased risk; p-trend = 0.02 Not significant with clinical stage, mortality or incidence of lethal disease No not significant after correction for multiple testing Yes With decreased risk; p-trend = 0.045

No No No No No

Parikh et al., 2011 Penney et al., 2011

Parikh et al., 2011 Parikh et al., 2011 Parikh et al., 2011 Parikh et al., 2011 Penney et al., 2011

Gallagher et al., 2010

Gallagher et al., 2010

Ahn et al., 2008 Ahn et al., 2008 Ahn et al., 2008 Ahn et al., 2008 Gallagher et al., 2010

Single Nucleotide Polymorphisms in the Human KLK Locus

57

rs266875

rs34750956 C/T

rs11084034 C/T

rs1058274

rs55799315 C/G

rs4802755

rs2569735

KLK3

KLK3

KLK3

KLK3

KLK3

KLK3

KLK3

G/A

C/T

T/C

A/G

T/C

rs266876

KLK3

Allele

SNP

Gene

Tab. 2.5 (continued)

miRNA binding site

Putative functional role*

Stage

3338 1327

1030

3338

3522

3522

3338

1327

1030

3522

3338

3338

3338

3522

3522

3522

3338

1327

1030

3522

3338

Yes

No

No

No

No

No

No

No

No

No

No

Controls Association

3522

Cases

With decreased risk; p-trend = 0.04 Not significant with clinical stage, mortality or incidence of lethal disease

not significant

not significant

Not significant with risk, clinical stage, mortality or incidence of lethal disease not significant

not significant

not significant

not significant

Not significant with risk, clinical stage, mortality or incidence of lethal disease not significant

not significant

Risk estimates (95% CI)

Parikh et al., 2011 Parikh et al., 2011 Parikh et al., 2011 Penney et al., 2011

Parikh et al., 2011 Parikh et al., 2011 Parikh et al., 2011 Parikh et al., 2011 Penney et al., 2011

Parikh et al., 2011 Penney et al., 2011

Reference

58 Jyotsna Batra, Tracy O’Mara, Felicity Lose, and Judith A. Clements

rs62113226 T/C

rs266864

rs266861

rs3760721

rs266880

rs1053972

rs266879

rs2292185

rs2271093

rs1061477

KLK3

KLK3

KLK3

KLK3

KLK3

KLK3

KLK3

KLK3

KLK3

KLK3

T/C

T/C

G/A

C/G

C/T

C/G

C/T

T/C

G/A

rs62113216 T/A

KLK3

TFBS

TFBS

TFBS

TFBS

TFBS

TFBS

TFBS

1030

1030

1030

1030

1030

1030

1030

1030

1030

3522

3522

1327

1327

1327

1327

1327

1327

1327

1327

1327

3338

3338

No

No

No

No

No

No

No

No

No

No

No

Not significant with risk, clinical stage, mortality or incidence of lethal disease Not significant with risk, clinical stage, mortality or incidence of lethal disease Not significant with risk, clinical stage, mortality or incidence of lethal disease Not significant with risk, clinical stage, mortality or incidence of lethal disease Not significant with risk, clinical stage, mortality or incidence of lethal disease Not significant with risk, clinical stage, mortality or incidence of lethal disease Not significant with risk, clinical stage, mortality or incidence of lethal disease Not significant with risk, clinical stage, mortality or incidence of lethal disease Not significant with risk, clinical stage, mortality or incidence of lethal disease

not significant

not significant

Penney et al., 2011

Penney et al., 2011

Penney et al., 2011

Penney et al., 2011

Penney et al., 2011

Penney et al., 2011

Penney et al., 2011

Penney et al., 2011

Parikh et al., 2011 Parikh et al., 2011 Penney et al., 2011

Single Nucleotide Polymorphisms in the Human KLK Locus

59

rs1654553

rs2569522

rs10415743 G/T

rs268905

rs10409107 C/T

rs10409028 G/A

rs11666803 G/A

rs1897604

rs268908

KLK4

KLK5

KLK5

KLK5

KLK5

KLK5

KLK5

KLK5

KLK5

T/G

A/G

G/A

A/G

G/A

G/A

rs266877

KLK3

Allele

SNP

Gene

Tab. 2.5 (continued)

TFBS

Putative functional role*

Stage

1011

1011

1011

1011

1011

1011

1011

1011

798 Ashkenazi Jewish

1030

Cases

1338

1338

1338

1338

1338

1338

1338

1338

–

1327

No

No

No

No

No

No

No

No

No

Yes

Controls Association

Reference

Not significant for risk or aggressiveness Not significant for risk or aggressiveness Not significant for risk or aggressiveness Not significant for risk or aggressiveness Not significant for risk or aggressiveness Not significant for risk or aggressiveness Not significant for risk or aggressiveness Not significant for risk or aggressiveness

Not significant for biochemical recurrence, metastasis or PrCa specific death

Lose et al., 2011

Lose et al., 2011

Lose et al., 2011

Lose et al., 2011

Lose et al., 2011

Lose et al., 2011

Lose et al., 2011

Lose et al., 2011

Gallagher et al., 2010

With decreased risk; Penney et al., p-trend = 0.02 2011 Not significant with clinical stage, mortality or incidence of lethal disease

Risk estimates (95% CI)

60 Jyotsna Batra, Tracy O’Mara, Felicity Lose, and Judith A. Clements

G/T

C/T

C/T

KLK12 rs3865443

KLK12 rs3745540

KLK13 rs2736433

C/T

G/C

C/T

T/C

T/A

KLK13 rs1404319

KLK13 rs4575635

KLK13 rs2569475

KLK13 KLK13 rs2569474

KLK13 KLK13 rs8111207

1011

1011

1011

1011

1011

1011

G/A

KLK13 rs1080669

1011

Combined Aust 3153 & UK sample sets 1011

1011

1011

Splicing (ESE or ESS)

TFBS

TFBS

Splicing (ESE or ESS)

1011

KLK13 rs10426620 C/T

KLK13

G/C

rs1701950

KLK6

T/C

rs1654537

KLK6

1338

1338

1338

1338

1338

1338

1338

1338

1338

3199

1338

1338

decreased risk; p = 0.032

Not significant for risk or aggressiveness

TT: OR 1.28 (1.04–1.57); p = 0.018

Not significant for risk or aggressiveness Not significant for risk or aggressiveness

aggressive disease TT: 1.57 (1.00–2.48); p = 0.051 No Not significant for risk or aggressiveness No Not significant for risk or aggressiveness No Not significant for risk or aggressiveness No Not significant for risk or aggressiveness Yes, with Per allele 0.75 (0.59–0.95); aggressiveness p-trend = 0.0018, not replicated in UK dataset No Not significant for risk Yes, with Per allele 0.718 (0.57–0.91); aggressiveness p-trend = 0.005, not replicated in UK dataset No Not significant for risk Yes, with AA: OR 1.77 (1.07–2.91); aggressiveness p = 0.025, not replicated in UK dataset

Yes

No

Yes

No

No

Lose et al., 2011

Lose et al., 2011

Lose et al., 2011

Lose et al., 2011

Lose et al., 2011

Lose et al., 2011

Lose et al., 2011

Lose et al., 2011

Lose et al., 2011

Lose et al., 2011

Lose et al., 2011

Lose et al., 2011

Single Nucleotide Polymorphisms in the Human KLK Locus

61

A/G

C/T C/T C/T G/T

A/G

KLK13 KLK13 rs1880413

rs266858 rs2560935 rs266114 rs3745522

KLK15 KLK15 KLK15 KLK15

KLK15 rs2659056

KLK15 KLK15 KLK15

Allele

SNP

Gene

Tab. 2.5 (continued)

TFBS

Splicing (ESE or ESS)

TFBS

Putative functional role*

301, No AfricanAmerican 6645 No

454, AfricanAmerican

No No No

3366 1157 –

Yes

No

No No No No

No

3268 1172 798 Ashkenazi Jewish

Combined Aus- 6676 tralian, UK and USA study sets

Stage 2

1894

6665

Combined Aus- 6687 tralian, UK and USA study sets Stage 1 1854

1338

Controls Association

5185 1157 1157 1157

1011

Cases

5192 1172 1172 1172

Stage

Not significant

Per allele OR 1.33(1.20–1.49); p = 1.2 × 10–7 Not validated by Stage 2 No significant difference Not significant for biochemical recurrence, metastasis or PrCa specific death Not significant

Not significant for risk or aggressiveness

not significant No significant difference No significant difference No significant difference

Not significant for risk Not significant for risk or aggressiveness

Risk estimates (95% CI)

Batra et al., 2011a

Hooker et al., 2010

Ahn et al., 2008 Gallagher et al., 2010

Eeles et al., 2008

Batra et al., 2011a

Ahn et al., 2008 Ahn et al., 2008 Ahn et al., 2008 Ahn et al., 2008

Lose et al., 2011

Reference

62 Jyotsna Batra, Tracy O’Mara, Felicity Lose, and Judith A. Clements

C/T T/C

C/T

T/C

T/C

C/T

G/A

G/A

A/T

KLK15 rs2163861 KLK15 rs2659058

KLK15 rs3212810

KLK15 rs2659055

KLK15 rs190552

KLK15 rs266855

KLK15 rs2739442

KLK15 rs2659053

KLK15 rs2569746

TFBS

1008

996

995

997

1384

1374

1371

1373

1383

6647

6632

6645

1157 6639

1157 1157 6657

–

No

No

No

No

No

No

No

No

No No

No No No

Not significant for risk or aggressiveness Not significant for risk or aggressiveness Not significant for risk or aggressiveness Not significant for risk or aggressiveness Not significant for risk or aggressiveness

Not significant for risk or aggressiveness

Not significant for risk or aggressiveness

Not significant for risk or aggressiveness

Not significant Not significant for risk or aggressiveness

Not significant Not significant Not significant for risk or aggressiveness

Yes, with OR 0.85 (0.77–0.93); aggressiveness p = 2.7 × 10–4

* As predicted by ‘FuncPred’ from the SNPinfo web-server (http://manticore.niehs.nih.gov/snpfunc.htm) Abbreviations: OR – odds ratio, CI – confidence interval, TFBS – transcription factor binding site

KLK15 rs35711205 C/G

A/G C/T

KLK15 rs266850 KLK15 rs266851

Combined 5074 Australian, UK and USA study set cases TFBS 1172 TFBS 1172 Combined Aus- 6686 tralian, UK and USA study sets TFBS 1172 TFBS Combined Aus- 6677 tralian, UK and USA study sets miRNA Combined Aus- 6674 binding site tralian, UK and USA study sets TFBS Combined Aus- 6665 tralian, UK and USA study sets TFBS Combined Aus- 6677 tralian, UK and USA study sets TFBS 1002 Batra et al., 2011a Batra et al., 2011a Batra et al., 2011a Batra et al., 2011a Batra et al., 2011a

Batra et al., 2011a

Batra et al., 2011a

Batra et al., 2011a

Ahn et al., 2008 Batra et al., 2011a

Ahn et al., 2008 Ahn et al., 2008 Batra et al., 2011a

Batra et al., 2011a

Single Nucleotide Polymorphisms in the Human KLK Locus

63

254 135

PSA

PSA

rs3760728 PSA

rs11084039 PSA

rs11670728 PSA

rs1506684 PSA

rs2569739 PSA

KLK2

KLK2

KLK2

KLK2

KLK2

KLK2

rs198978

KLK2

TFBS

TFBS

TFBS

TFBS

1267

Stage 2 TFBS

1419

1419

Stage 1

Stage 1

1267

Stage 2

1157

1157

901

736

736

901

736

901

1267 1419

736

901

1419

Stage 1

miRNA Stage 1 binding site Stage 2

1267

736

Stage 2

1157 1419

KLK2

Stage 1

PSA

rs198972

KLK2

901

736

1419 1267

KLK2 Stage 2

1157 Stage 1

Yes

No

No

Yes

Yes

Yes

Yes

Yes

Yes

Yes

No

Yes

Yes

No

168, men No with BPH 142 Yes

671

PSA

617

C792T

miRNA binding non-syn, damaging by polyphen

KLK2

Cases Controls Association

rs198977

Stage

KLK2

Protein Putative assessed functional role*

SNP

Gene

Tab. 2.6 Summary of KLK SNP association studies performed for PSA and hK2 serum levels.

Not significant

Not significant

p = 0.024, combined stage 1 & 2 p < 0.0001

p = 0.0001

P < 0.0001

p = 0.17, combined stage 1 & 2 p < 0.0001

p = 0.0002

Combined Stage 1&2 p < 0.0001

p < 0.0001

Combined Stage 1&2 p < 0.0001

p < 0.0001

Not significant

Combined Stage 1&2 p < 0.0001

p < 0.0001

Not significant

Not significant

Not significant

p = 0.0001

p-value

Ahn et al., 2008

Ahn et al., 2008

Klein et al., 2010

Klein et al., 2010

Klein et al., 2010

Klein et al., 2010

Klein et al., 2010

Ahn et al., 2008

Klein et al., 2010

Ahn et al., 2008

Mittal et al., 2007

Chiang et al., 2005

Nam et al., 2003

Reference

64 Jyotsna Batra, Tracy O’Mara, Felicity Lose, and Judith A. Clements

rs2735839 PSA

KLK3

PSA

KLK3

rs6998

rs3760722 PSA

KLK3

TFBS

PSA

PSA

miRNA Stage 1 binding site

1419

1030

5192 736

1327

5185

5185

5192

PSA

5185

461

41417

1327

409

5192

702

5325

1157

461

PSA

rs266868

KLK3

PSA

rs266870

PSA

rs17632542 PSA

1030

702

PSA

Splicing (ESE or ESS), nsSNP

5325

PSA

rs1058205 PSA

5895

PSA 41417

482

3366

1894

1157

3366

1894

5185

3268

Stage 2

1327 1157

5192

1854

3268

Stage 2 Stage 1

1854

Stage 1

1030

PSA

miRNA binding site

TFBS

PSA

PSA

KLK3

KLK3

KLK3

rs266849

KLK3

PSA

rs12984214 PSA

KLK2

Yes

Yes

Yes

No

Yes

No

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

Yes

No

No

Decreased level at diagnosis; p = 0.01

Penney et al., 2011

p = 0.0003

Increased levels in controls; p = 0.006

Not significant

p = 0.04

Not significant

p = 0.0001

Decreased levels in controls; p = 0.00015

Klein et al., 2010

Penney et al., 2011

Ahn et al., 2008

Ahn et al., 2008

Cramer et al., 2003

Ahn et al., 2008

Parikh et al., 2011

Penney et al., 2011 Gudmundsson et al., 2010

p = 9.7 × 10–9

p = 3.05 × 10–46

Ahn et al., 2008

Decreased levels in controls; p = 0.001

Decreased levels in controls; p = 0.05

Kader et al., 2009 Gudmundsson et al., 2010 Parikh et al., 2011

p = 6.26 × 10–47

Ahn et al., 2008

Increased levels at diagnosis; p = 0.031

p = 0.0041

Xu et al., 2008

Eeles et al., 2008

p = 0.003

Ahn et al., 2008

p-trend = 6.1 × 10–8

Eeles et al., 2008

Ahn et al., 2008

p = 0.02

Not significant

Not significant

Single Nucleotide Polymorphisms in the Human KLK Locus

65

rs266858

rs2569729 PSA

rs1061476 PSA

rs8104556 PSA

rs8112276 PSA

rs10401509 PSA

rs17526278 hK2

rs2271094 PSA

rs61752561 PSA

rs266864

rs266861

rs3760721 PSA

rs266880

rs1053972 PSA

rs266879

KLK3

KLK3

KLK3

KLK3

KLK3

KLK3

KLK3

KLK3

KLK3

KLK3

KLK3

KLK3

KLK3

KLK3

PSA

PSA

PSA

PSA

PSA

PSA

KLK3

TFBS

TFBS

TFBS

TFBS

TFBS

TFBS

1030

1030

1030

1030

1030

1030

1327

1327

1327

1327

1327

1327

901

1267

901 736

1267

Stage 2

736

901

736

5185

5185

1157

5185

5185

5185

1419

1419

1267

Stage 2 Stage 1

1419

Stage 1

5192

5192

1172

5192

5192

5192

1327

901

No

Yes

No

Yes

No

No

Yes

Yes

Yes

Yes

No

Yes

No

Yes

No

No

1267

Stage 2 1030

Cases Controls Association

Stage

Splicing Stage 1 (ESE or ESS), nsSNP Stage 2

TFBS

Protein Putative assessed functional role*

SNP

Gene

Tab. 2.6 (continued)

Not significant

Increased levels in controls; p = 0.01

Not significant

Increased levels in controls; p = 0.03

Not significant

p = 0.0001, Stage 1 & 2 combined p < 0.0001 Not significant

p = 0.0002

p = 0.002, Stage 1 & 2 combined p < 0.0001

P < 0.0001

Did not replicate in stage 2

p = 0.0005

p = 0.03

not significant

p = 0.03

not significant

p = 0.002

not significant

Not significant

p = 0.4, combined stage 1 & 2 p < 0.0001

p-value

Penney et al., 2011

Penney et al., 2011

Penney et al., 2011

Penney et al., 2011

Penney et al., 2011

Penney et al., 2011

Klein et al., 2010

Klein et al., 2010

Klein et al., 2010

Ahn et al., 2008

Ahn et al., 2008

Ahn et al., 2008

Ahn et al., 2008

Ahn et al., 2008

Ahn et al., 2008

Penney et al., 2011

Reference

66 Jyotsna Batra, Tracy O’Mara, Felicity Lose, and Judith A. Clements

rs1061477 PSA

rs2569735 PSA

rs1058274 PSA

rs174776

rs266878

rs2292186 PSA

PSA

rs266876

rs2659122 PSA

PSA

rs266877

rs925013

A-4643G

KLK3

KLK3

KLK3

KLK3

KLK3

KLK3

KLK3

KLK3

KLK3

KLK3

1030

rs266867

rs2739448 PSA

KLK3

PSA

rs62113214 PSA

KLK3

PSA

KLK3

135 1030

PSA

702

702

134

PSA

rs62113212 PSA

151

PSA

G-158A

1030

1030

1030

1030

1030

1030

1030

1030

1030

1030

1030

1030

1030

PSA

TFBS

TFBS

miRNA binding site TFBS

TFBS

miRNA binding site

miRNA binding site

TFBS

rs266882

PSA

PSA

PSA

PSA

PSA

KLK3

KLK3

rs2271093 PSA

KLK3

PSA

rs2292185 PSA

KLK3

1327

409

409

461

461

1327

142

127

409

1327

409

1327

1327

1327

1327

1327

1327

1327

1327

1327

1327

1327

1327

Yes

Yes

No

Yes

Yes

No

Yes

Yes

Yes

No

Yes

Yes

Yes

No

Yes

Yes

Yes

Yes

No

No

Yes

No

No

Yes

Increased levels in controls; p = 0.0004

Penney et al., 2011

Cramer et al., 2003

Penney et al., 2011

Cramer et al., 2003

Penney et al., 2011

Penney et al., 2011

Penney et al., 2011

Penney et al., 2011

Penney et al., 2011

Penney et al., 2011

Penney et al., 2011

Penney et al., 2011

Penney et al., 2011

Penney et al., 2011

Penney et al., 2011

Penney et al., 2011

Penney et al., 2011

Mittal et al., 2007

p = 0.0015

Not significant

Decreased levels in controls; p = 0.00024

Cramer et al., 2003

Cramer et al., 2003

Parikh et al., 2011

Decreased levels in controls; p = 9.70 × 10–5 Parikh et al., 2011

Not significant

p = 0.053

AA: increased PSA serum levels (p = 0.027) Medeiros et al., 2002 p = 0.013 Schatzl et al., 2005

Not significant

Increased level in controls; p = 0.02

p = 0.21

Increased levels in control; p = 0.05

Not significant

Decreased level at diagnosis; p = 0.05

Decreased levels in controls; p = 0.0003

Decreased level at diagnosis; p = 0.01

Decreased level in controls; p = 0.0001

Not significant

Not significant

Decreased levels in controls; p = 0.005

Not significant

Not significant

Increased levels in controls; p = 0.001

Single Nucleotide Polymorphisms in the Human KLK Locus

67

rs1654553 KLK2

KLK4

3366

1894

1157

TFBS

TFBS

PSA

PSA

KLK15 rs266850

KLK15 rs266851

KLK15 rs2163861 PSA

No

No

No

No

No

No

Yes

Yes

Yes

Yes

Not significant

Not significant

Not significant

Not significant

Not significant

Not significant

p = 0.0009

p-trend = 0.0003

p < 0.0001; Stage 1 & 2 combined p < 0.0001

p < 0.0001

p = 0.021

p-value

* As predicted by ‘FuncPred’ from the SNPinfo web-server (http://manticore.niehs.nih.gov/snpfunc.htm) All cases were PrCa patients unless otherwise noted Abbreviations: PSA – prostate specific antigen, KLK2 – kallikrein 2 protein, TFBS – transcription factor binding site

1157

1157

1157

1157

Splicing (ESE or ESS) TFBS

PSA

KLK15 rs3745522 PSA

KLK15 rs266114

1157

3268

Stage 2 1157

TFBS

1854

Stage 1

736 901

PSA

TFBS

1419 1267

Stage 1

409

Cases Controls Association

Stage 2

Stage

KLK15 rs2560935 PSA

KLK15 rs2659056 PSA

rs2569733 PSA

KLK3

Protein Putative assessed functional role*

SNP

Gene

Tab. 2.6 (continued)

Ahn et al., 2008

Ahn et al., 2008

Ahn et al., 2008

Ahn et al., 2008

Ahn et al., 2008

Ahn et al., 2008

Ahn et al., 2008

Eeles et al., 2008

Klein et al., 2010

Cramer et al., 2003

Reference

68 Jyotsna Batra, Tracy O’Mara, Felicity Lose, and Judith A. Clements

Single Nucleotide Polymorphisms in the Human KLK Locus

69

A GWAS performed with 3,268 cases and 3,366 controls identified a prostate cancer susceptibility locus between KLK2 and KLK3. The minor allele of the rs2735839 SNP in this region was reported to confer a 1.2-fold decreased risk of prostate cancer (per allele OR 0.83, 95% CI 0.75–0.91; p = 1.5 × 10–18) (Eeles et al., 2008). Following this discovery, there have been a large number of studies pursuing association studies of SNPs in the KLK region, examining both prostate cancer risk and prognostic features, as summarized in Tab. 2.5. The GWAS-identified SNP, rs2735839, also displayed a strong association with PSA levels (Eeles et al., 2008). However, there has been some debate as to whether the SNP is truly associated with prostate cancer, or simply relates to PSA expression levels, since male controls used for the Stage 1 analysis were limited to those with clinically low PSA levels ( Lys

Tyr > Gln > Arg

Arg > Lys

Arg > Lys

Arg > > Lys

Phe > Arg > Tyr

Arg > Lys

Unknown Arg Arg Lys = Arg

KLK

KLK1

KLK2

KLK3

KLK4

KLK5

KLK6

KLK7

KLK8

KLK9 KLK10 KLK11 KLK12

TDVR↓AAVY (fibronectin) PQFR↓IKGG (tPA) – – – ATPK↓IFNG (pro-KLK12) MATR↓VSNQ (CCN5)

EERR↓LHYG (semenogelin I) TEKR↓LWVH (semenogelin II) ILSR↓IVGG (pro-KLK3) SSIY↓SQTE (semenogelin I) SKLQ↓TSLH (semenogelin II) RRFF↓LHHL (PThRP) NMIR↓HPSL (amelogenin) PNPR↓GFGG (enamelin) VYIR↓STDV (PAP) LRVR↓VLDI (desmoglein-1) QGDK↓IIDG (pro-KLK7) TNPR↓KLYD (plasminogen) AEFR↓HDSG (amyloid β A4 ) LDPR↓SFLL (PAR1) VTGK↓GVTV (PAR2) RHLY↓GPRP (MMP-9)

SPFR↓SSRI (kininogen-1) ISLM↓KRPP (kininogen-1)

Cleavage motifs (P4–P4′)

– Z-LR-AMC, Z-FR-AMC Z-FR-AMC, PFR-AMC, VPR-AMC Boc-VPR-AMC, Boc-QAR-AMC

Boc-QAR-AMC, Boc-FSR-AMC, Boc-VPR-AMC, Abz-AFR↓FSQ-EDDnp suc-RPY-pNA, suc-AAPF-AMC, Abz-KLY↓SSKQ-EDDnp Boc-VPR-AMC, PFR-AMC

Bz-PFR-pNA, Boc-FSR-AMC, Abz-KLR↓SSKQ-EDDnp

Suc-AAPF-AMC, Abz-SSIY↓SQTEEQ-EDDnp, mu-SSKLQ-AMC (selective) Z-FVR-pNA, VPR-AMC, FVQR-pNA (selective)

Bz-PFR-pNA, BzPFR-AMC, VLR-pNA, VLR-AMC, Abz-MISLM↓KRP-EDDNp D-PFR-pNA, ARR-AMC, GKAFRR-AMC (semi-selective)

Synthetic substrates

kallistatin19, elafin23, A1A19, ACT19, LEKTI (D5,D6, D8–11)20, PCI19, AAP19, C1-inh19 PCI19, AAP19, aprotinin24, chymostatin25, leupeptein24, SBTI26 – – – C1-inh19, PCI19, AAP19

SPINK615, SPINK918, PCI19, PAI-119, AAP19, C1-inh19, LEKTI (D5, D6, D8–11, D9–15)20, peruvoside21, digitoxin21 SPINK615, SBTI22, peruvoside21, digitoxin21, ouabain21

ACT9, A2M9, PCI9, A1A10, ATIII7, leupeptin11, LY312340 (synthetic)12, Z-SSKL(boro)L (synthetic)13 ACT14, ATIII14, SPINK615, A2M16, SFTI-FCQR (synthetic)17

PCI5, A2M6, PAI-16, ATIII7, ACT5, AAP6, KLK2b peptide (synthetic)8

Kallistatin1, A1A2, PCI2, HAI-23, FE9990244 (synthetic)

Inhibitors of proteolysis

Tab. 5.1 Substrate specificity summary of the KLKs. Depicted are the substrate specificities of the fifteen KLKs based on potential physiologic substrates, according to the MEROPS database. Synthetic substrates (fluorogenic and chromogenic) and inhibitors (macromolecular and synthetic) are detailed.

Molecular Recognition Properties of Kallikrein-related Peptidases

119

Arg > Lys

Arg > Lys > Tyr

Lys > Arg ?

KLK13

KLK14

KLK15

PRAR↓ITGY (fibronectin) VRLR↓FLRT (laminin) SQVY↓SSGP (desmoglein-1) FLLR↓NPND (PAR1) VTGK↓GVTV (PAR2) ILSR↓IVGG (pro-KLK3)

Cleavage motifs (P4–P4′) Tos-GPR-AMC, VPR-AMC, Abz-KLR↓SSKQ-EDDnp Tos-GPR-pNA, Boc-QAR-AMC, Ac-YAAR-AMC, Ac-YAAK-AMC, CFP-TVDY↓A-YFP Bz-IEGR-pNA, D-PFR-pNA

Synthetic substrates

-

SPINK615, A1A19, ATII19, ACT19, AAP19, LEKTI (D5, D8–11, D9–15)20

AAP19, PAI-119, PCI19

Inhibitors of proteolysis

References for the protease inhibitors: 1, (Chao et al., 1990); 2, (Espana et al., 1995); 3, (Delaria et al., 1997); 4, (Wolf et al., 2001); 5, (Lövgren et al., 1999); 6, (Mikolajczyk et al., 1999); 7, (Cao et al., 2002); 8, (Pakkala et al., 2007); 9, (Williams et al., 2007); 10, (Zhang et al., 1999); 11, (Watt et al., 1986), 12, (Gygi et al., 2002); 13, (LeBeau et al., 2008); 14, (Obiezu et al., 2006); 15, (Kantyka et al., 2011); 16, (Matsumura et al., 2005); 17, (Swedberg et al., 2009); 18, (Brattsand et al., 2009); 19, (Luo and Jiang, 2006); 20, (Deraison et al., 2007); 21, (Prassas et al., 2008); 22, (Magklara et al., 2003); 23, (Franzke et al., 1996); 24, (Eissa et al., 2011; Kishi et al., 2006); 25, (Kishi et al., 2006); 26, (Goettig et al., 2010)

Abbreviations: A1A, α1-antitrypsin; A2M, α2-macroglobulin; AAP, α2-antiplasmin; ACT, α1-antichymotrypsin; ATIII, antithrombin III; HAI-2, hepatocyte growth factor activator inhibitor type 2; PCI, protein C inhibitor.

P1 Specificity

KLK

Tab. 5.1 (continued)

120 Aaron M. LeBeau, and Charles S. Craik

Molecular Recognition Properties of Kallikrein-related Peptidases

121

Tab. 5.2 Positional scanning synthetic combinatorial peptide library (PSSCL) data for nine of the KLKs surveyed using this method. Amino Acid Position

KLK3 KLK4

KLK5

KLK6 KLK7 KLK10 KLK11 KLK13 KLK14

P4

P3

No charged residues IVYFW (large hydrophobic) VI (hydrophobic)

YAVILM (hydrophobic) LAQMY (hydrophobic) No basic residues QVLTP (medium polar, hydrophobic) QSAR (polar, hydroQL (polar, hydrophobic) phobic) QSVA (polar, hydroQLVTPF (medium phobic) polar hydrophobic) MFY (hydrophobic, SNTA (polar, hydroaromatic) phobic) RK (basic) NSFAM (polar, hydrophobic) non-specific RK (basic) non-specific YLnTMF (hydrophobic) EDMYFS (acidic, DEKR (charged) hydrophobic) non-specific KRD (charged) R (basic) LFM (aromatic, hydrophobic) RKSAM (basic, aroHNSPA (polar) matic)

hydrophobic, aromatic GYVP (hydrophobic, aromatic) YFWGPV (hydrophobic, aromatic) non-specific non-specific non-specific non-specific VY (hydrophobic, aromatic) YW (aromatic)

P2

P1 M > n = A > Y1 R > > K1 R2 R > > K3 R1 R2 R > K1 Y > > A = M > n1 R > K = M = n1 M > n > R = K = A > L1 R2 R2

From: 1, (Debela et al., 2006); 2, (Borgoño et al., 2007a); 3, (Matsumura et al., 2005)

5.2 Substrate specificities of individual kallikrein-related peptidases 5.2.1 The classical kallikreins (KLK1, KLK2, KLK3) KLK1 (tissue kallikrein) – KLK1, found at high levels in the human pancreas and urine, was the first member of the kallikrein family to be discovered (Lundwall and Brattsand, 2008). KLK1 is known to play a hypotensive role by cleaving low molecular weight kininogen-1 to release lysyl-bradykinin (kallidin). In addition to its kininogenase activity, KLK1 can cleave pro-insulin, somatostatin, kallistatin, low density lipoprotein, prorenin, vasoactive intestinal peptide, procollagenase, and angiotensin (Clements et al., 2001; Lima et al., 2008). KLK1 displays trypsin- and chymotrypsin-like specificity with both endogenous and synthetic substrates. The processing of kininogen-1 to kallidin requires the cleavage of the Met379↓Lys380 and Arg389↓Ser390 bonds by KLK1 (Li et al., 2008). To understand the requirements behind the hydrolysis of kininogen-1 by KLK1, Del Nery et al. synthesized a number of internally quenched fluoro-

122

Aaron M. LeBeau, and Charles S. Craik

genic substrates, based on the kininogen-1 residues 370–399 (Del Nery et al., 1995; Pimenta et al., 1999). Several important interactions were documented that explained the dual specificity of KLK1 for its endogenous substrate. The chymotrypsin-like activity observed in the hydrolysis of peptide substrates containing Met379↓Lys380 by KLK1 was attributed to favorable interactions of a Leu residue in the P2 position and the basic residues Lys and Arg at P1′ and P2′. When the Phe was substituted for Met in the scissile bond of the substrate Abz – MISLM↓KRP-EDDnp, the kcat/Km changed from 4.71 × 105 M–1 s–1 to 5.25 × 106 M–1 s–1. Cleavage analysis of the Arg389↓Ser390 bond in fluorogenic substrates documented important amino acid preferences in the P1′–P3′ positions that resulted in trypsin-like activity. Recently, the substrate specificity of KLK1 was determined from octapeptide sequences isolated using phage display (Li et al., 2008). From sixteen isolated clones, twelve phage clones were found to encode chymotrypsin-like substrate sequences with large hydrophobic amino acids in the P1 position. For this class of substrates Tyr, not Phe, is the preferred P1 amino acid. The remaining four clones encoded trypsin-like substrates containing Arg in the P1 position. The phage display study complements previous data on the cleavage sites of endogenous substrates. When KLK1 behaves chymotrypsin-like, there is a requirement for either Phe or Tyr in P1 and a hydrophilic or basic residue is required in P1′. Mimicking cleavage in kininogen-1, phage display found that when KLK1 acts trypsinlike there is a strict preference for Ser in P1′. KLK2 (hK2, human glandular kallikrein) – The expression of KLK2 is very high in the prostatic epithelium and its transcripts are also found in the testis, thyroid and breast (Lundwall and Brattsand, 2008; Shaw and Diamandis, 2007). It is widely believed that KLK2 may play a role in the pathobiology of prostate cancer. However, its a direct role in prostate cancer has not yet been determined. KLK2 is only produced in high levels by normal and malignant prostate cancer cells (Williams et al., 2010). In castration-resistant prostate cancer, poorly differentiated and metastatic prostate tumors continue to secrete enzymatically active KLK2 into the peritumoral environment (Darson et al., 1999). In healthy men, KLK2 is found in the ejaculate, where it is believed to cleave semenogelin I&II (Sg I & II) and fibronectin, leading to the liquefaction of the ejaculate (Deperthes et al., 1996). Post-ejaculation, active KLK2 rapidly forms a complex with the serpin protein C inhibitor (PCI) within ten minutes, leading to a large population of inactive protease (Lovgren et al., 1999). Unlike KLK1 and KLK3, the P1 substrate specificity is purely trypsin-like, preferring Arg over Lys in assays on endogenous substrates and synthetic peptide substrates. KLK2 has been mentioned as a potential activator of pro-KLK3 in vivo based on its ability to cleave the pro-domain of pro-KLK3 (APLILSR↓IVGG) in vitro, leading to enzymatically active KLK3 (Takayama et al., 1997). In vitro experiments have also suggested that KLK2 has plasmin-like activity due to its ability to cleave and activate single chain urokinase (Frenette et al., 1997). KLK2 functions as a weak kininogenase, leading to the release of bradykinin. Studies have shown that KLK2 cleaves high molecular weight kinino-

Molecular Recognition Properties of Kallikrein-related Peptidases

123

gen at three places (Arg427, Arg437 and Arg457), but its activity is 500-fold less than that of KLK1 (Charlesworth et al., 1999). Initial substrate specificity studies for KLK2 used digested fragments of its proposed in vivo substrates, Sg I & II and fibronectin (Deperthes et al., 1996; Lovgren et al., 1999). The cleavage maps of Sg I & II showed a pronounced preference for Arg in the P1 position. No cleavage sites were found to occur on the C-terminus of lysine residues. Of the 11 cleavage sites, five were found to be dibasic, with the P2 amino acid being either Arg, Lys, or His. In Sg I, two of the dibasic sites contain the same P2, P1 and P1′ residues (Arg273Arg274Leu275 and Arg333Arg334Leu335). This cleavage sequence is found once in the SgII map at Arg454. For the cleavage sites that were not dibasic, at the P2 position large aliphatic or aromatic amino acid were tolerated. Aliphatic and aromatic amino acids were also present at the P1′ position in eight of the cleavage sites. The fibronectin cleavage map supported the Sg findings, with dibasic cleavage sites present in the fibronectin peptides. From these studies, several fluorogenic substrates were developed, including the intramolecularly quenched substrate Abz-KKR↓SARQ-EDDnp (Km = 1.2 μM, kcat/Km = 2.75 × 107 M–1 s–1) and Pro-Phe-Arg-AMC (Km = 40 μM, kcat/Km = 8.25 × 107 M–1 s–1) (Lovgren et al., 1999). A pentapeptide random phage display library was screened against KLK2 to further elucidate the substrate specificity (Cloutier et al., 2002). This study showed that KLK2 has a strict preference for Arg in the P1 position, which was further enhanced by the Ser in the P1′. Almost a third of all clones were cleaved at the Arg-Ser bond, despite wide variation at the P1′ position. To harness KLK2’s substrate specificity for pro-drug therapy, Janssen et al. used SPOT analysis and a combinatorial library of fluorescence-quenched peptides to find substrates that are selective for KLK2 and are stable in human plasma (Janssen et al., 2004). From their screening, they found a P1–P2 dibasic peptide, GKAFRR (Km = 2.6 μM, kcat/Km = 4.11 × 104 M–1 s–1) which was an excellent substrate for KLK2, but also for plasmin. When coupled to thapsigargan, the KLK2-activated prodrug was stable in plasma, easily hydrolysable by KLK2 and not activated by cathepsin B, cathepsin D or KLK3. KLK3 (prostate-specific antigen, semenogelase) – KLK3 is the best-known and most widely studied kallikrein, because of its role as a prostate cancer biomarker, where serum KLK3 levels of 4 ng/ml and higher are suggestive of prostate cancer. Expressed in prostate epithelial cells, KLK3 is secreted into the lumen of the prostate. Enzymatically active KLK3 is found in high levels in the seminal fluid (0.3–5 mg/ml), where it is one of the main protein components of the ejaculate (Lilja, 1985; Watt et al., 1986). The role KLK3 plays in prostate cancer has been explored, but the precise effect of its enzymatic activity on prostate cancer tumorigenesis and metastasis is unknown. As prostate cancer progresses, the architecture of the gland becomes compromised and KLK3 leaks into the bloodstream, where its detection forms the basis of the PSA test. Once in the bloodstream, KLK3 is rapidly inactivated by the protease inhibitors α1-antichymotrypsin and α2-macroglobulin (Chen et al., 1996; Lin et al., 2005). In con-

124

Aaron M. LeBeau, and Charles S. Craik

trast to the inactive KLK3 in the blood, high levels of active KLK3 (micromolar levels) have been detected in the peritumoral fluid surrounding primary and metastatic prostate cancers (Williams et al., 2007). Under healthy circumstances, the main physiological function of KLK3 is to degrade Sg I & II and fibronectin leading to the liquefaction of the ejaculate (Malm et al., 2000). In vitro, numerous other substrates for KLK3 have been identified, however, the in vivo veracity has not been proved. These substrates include IGFBP 3, latent TGF-β, PThRP (Phe23↓Leu24 of the peptide), plasminogen, laminin, uPA and secretory leukocyte protease inhibitor (Williams et al., 2007). KLK3 is also known to react with α1-antichymotrypsin by cleaving Leu358-Ser359 of the suicide inhibitor (Zhang et al., 1997). KLK3 is about 80% identical to KLK2 in primary structure, but the two have markedly different enzymatic properties (Janssen et al., 2004). As described previously, KLK2 is a trypsin-like kallikrein, whereas KLK3 displays chymotrypsin-like substrate specificity. Examination of the S1 pocket of KLK3 reveals the presence of a Ser189 and a hydrophobic surface (LeBeau et al., 2009). The earliest reports on the substrate specificity of KLK3 focused on the Sg I & II cleavage maps, digested with KLK3 purified from seminal plasma. Digestion of Sg I & II with KLK3 yielded 33 cleavage sites in the two structural proteins (Malm et al., 2000). Out of these 33 sites, an overwhelming majority occurred after Gln or Tyr residues. While a number of bacterial and viral proteases can cleave after Gln, KLK3 is one of the few known mammalian serine proteases that can cleave after Gln residues present in a known physiologic substrate. In the SgI cleavage map, Tyr was the preferred P1 residue, followed by Gln, Leu, Ser, Asn and, surprisingly, Asp. Gln was the preferred P1 residue for SgII with nearly twice as many peptides generated than Tyr. At the P2 position, a greater diversity of amino acids was tolerated, but a slight preference for hydrophobic residues was observed. In the P1′ position, Ser was observed most often, but a general trend was not obvious. In successive studies, Denmeade et al. (1997) synthesized aminomethylcoumarin (AMC) peptide substrates for assaying KLK3, using peptides based on the Sg cleavage maps. The substrate HSSKLQ-AMC (Km = 470 μM, kcat/Km = 23.6 M–1 s–1) was found to be specific for KLK3 when compared to a panel of eleven other proteases. This peptide sequence was later used to make a series of KLK3-activated prodrugs coupled to thapsigargin (Denmeade et al., 2003). An additional aspect of this study that was found to be important is that, in order for KLK3 to hydrolyze the P1-AMC bond, the peptide has to be at least four residues long; the longer the substrate, the more efficient the hydrolysis by KLK3. This relationship was also observed when numerous peptide-based inhibitors were created off the HSSKLQ substrate sequence (LeBeau et al., 2008). The molecular interactions important for binding have been analyzed in great detail (LeBeau et al., 2010). Phage display and iterative optimization of the Sg cleavage sites were used by Coombs to discover KLK3 substrates (Coombs et al., 1998). Phage display has yielded a number of clones with hydrophobic residues in the P1 position, with Tyr as the preferred residue over Leu and Phe. No selected clones contained Gln in the P1 posi-

Molecular Recognition Properties of Kallikrein-related Peptidases

125

tion. This strategy yielded the converged consensus sequence of SS(Y/F)Y↓S(G/S) for KLK3. Substrates based on this sequence had catalytic efficiencies that were much higher than the peptides discovered by Denmeade (2200–3000 M–1 s–1 versus 2–46 M–1 s–1). Despite being highly active toward KLK3, these substrates were also excellent chymotrypsin substrates, with chymo/KLK3 (kcat/Km) ratios ranging from 24–4300. Subsequent studies using synthetic approaches, including the design of hexapeptide substrate mini-libraries, found no KLK3-specific substrates but demonstrated preferences for Ser in the P1′ position and Phe in the P2 position (Yang et al., 1999). Recombinant KLK3 has been screened against a PSSCL library and, much like in the previous studies, Gln was not preferred in the P1 position (Debela et al., 2006). In the P1, KLK3 was found to slightly prefer Met over Nle and Ala, but Leu, Tyr, Phe and the basic residues Arg and Lys, were tolerated. The S2 pocket of KLK3 slightly preferred Leu over Ala, Gln, Met and Tyr. Medium-sized hydrophobic residues were favored in the P3 position, while medium hydrophobic, polar and uncharged residues were tolerated at P4. The PSSCL study documented that KLK3 was bi-specific and could cleave after basic residues Lys and Arg. This data correlates with other data showing that KLK3 could be inhibited by bovine pancreatic trypsin inhibitor and leupeptin. More recently, a paper by Manning et al. showed that commercial sources of purified KLK3 had contaminating, trypsin-like proteases, which could be inhibited by aprotinin while maintaining the ability to cleave the KLK3-chymotrypsin substrate Mu-SRKSQQY-AMC (Km = 90 μM, kcat/Km = 260 M–1 s–1) (Manning et al., 2011).

5.2.2 KLK4/KLK5/KLK7 KLK4 (Prostase, KLK-like 1, enamel matrix serine protease-1 EMSP1, PRSS17) – Originally cloned from human prostate tissue and thought to have prostate-specific expression, KLK4 is found in a diverse array of normal and malignant human tissues (Obiezu et al., 2006). A trypsin-like protease, KLK4 expression is under androgen regulation and restricted to the luminal and basal epithelium of the prostate gland (Nelson et al., 1999). KLK4 is highly expressed in primary and metastatic prostate cancers (Klokk et al., 2007). Addition of KLK4 in vitro can induce the epithelial-tomesenchymal transition (EMT) in prostate cancer cell lines (Gao et al., 2007). KLK4 over-expression is found in other neoplasms, such as breast, colon and ovarian cancer, where its expression is indicative of poor disease-free survival (Dong et al., 2001; Gratio et al., 2010). In tooth remodeling and development, KLK4 aka EMSP1, is responsible for degrading the extracellular matrix surrounding enamel crystallites, allowing for the enamel layer to completely mineralize (Lu et al., 2008). Some known substrates for KLK4 in enamel are amelogenin, enamelin and ameloblastin (Nagano et al., 2009). The cleavage of enamelin by KLK4 results in six cleavage peptides and the sequences have been thoroughly studied (Yamakoshi et al., 2006). It is thought that, in seminal fluid, KLK4 may play a functional role in the dissolution of

126

Aaron M. LeBeau, and Charles S. Craik

the seminal clot by degrading prostatic acid phosphatase (VYIR↓) and activating proKLK3 (ILSR↓) (Takayama et al., 2001). Potential prostate cancer-promoting substrates for KLK4 have been identified in vitro, including PTHRP, IGFBP 3–6, single chain uPA, uPAR and PAR-1 & PAR-2 (Beaufort et al., 2006; Matsumura et al., 2005; Obiezu et al., 2006). KLK4 mediated PAR-1 signaling has also been documented in colon cancer cell lines (Gratio et al., 2010). The KLK4 specificity for the P1 residue was initially determined using a P1 diverse PSSCL library (Matsumura et al., 2005). KLK4 demonstrated a specific preference for Arg and Lys in the P1 position, complementing the Asp189 at the bottom of the S1 pocket. As a result of the marked preference for Arg in the P1 position, the P2–P4 specificities were determined using a library with Arg fixed at the P1 position. For P2, the residue preference was Gln > Leu, Val > Thr, Pro > Phe. Again, KLK4 favored Gln in the P3 position with Gln > Ser, Val > Ala. The P4 specificity was broad, with aliphatic and aromatic side chains over polar and charged residues. Later on, a complete diverse PSSCL was tested for KLK4 and the data were similar to the previous results, with the preference for Gln > Val > Leu at P2 and Gln > Val > Met at P3. Ile, Val, Try, Phe, Trp were all accepted at P4 (Debela et al., 2006). In the development of a sunflower trypsin inhibitor specific for KLK4, Swedberg et al. developed a sparse matrix peptide library of 125 chromogenic tetratpeptide substrates, based on previous findings (Swedberg et al., 2009). Using this method, FVQR-pNA (Km = 679.9 μM, kcat/Km = 23.90 × 103 M–1 s–1) was found to be selective for KLK4 and resulted in an efficient arginine aldehyde inhibitor of KLK4 (IC50 = 10.8 μM). KLK5 (KLK-like 2, human stratum corneum tryptic enzyme, HSCTE) – KLK5 is expressed in a diverse number of human tissues from the skin to the breast and prostate (Shaw and Diamandis, 2007). As suggested by its alternate name, HSCTE, KLK5 in the skin is involved in desquamation through the possible cleavage of the endogenous substrates desmoglein-1, corneodesmosin and desmocollin-1 (Caubet et al., 2004; Simon et al., 2001). KLK5 plays a role in skin-related diseases such as Netherton syndrome, atopic dermatitis and oral squamous cell carcinoma (Briot et al., 2009). KLK5 activates another kallikrein-related peptidase important to skin desquamation, KLK7 (QGDK↓II), at a low rate in vitro (Egelrud et al., 2005). In adenocarcinomas, KLK5 holds promise as a potential biomarker. Increased serum and ascitic fluid KLK5 levels have been associated with poor clinical outcome in patients with ovarian cancer (Kim et al., 2001). It is believed that KLK5 might play a role in ejaculate liquefaction, because of its ability to cleave SgI & II in vitro (Michael et al., 2006). Synthetic heptapeptides of different KLK pro-domains revealed that KLK5 can cleave the prodomains of KLK1 (IQSR↓IVG), KLK2 (IQSR↓IVG) and KLK3 (ILSR↓IVG) with high efficiency. KLK5 is known to auto activate, cleaving itself at SSSR↓II, and can deactivate KLK3 and KLK2 through internal cleavage (Michael et al., 2006). Several proteins important for tumorigenesis and metastasis were found in vitro to be potential substrates for KLK5, including fibronectin, uPA, IGFBP 1–5, and hepatocyte growth factor activator

Molecular Recognition Properties of Kallikrein-related Peptidases

127

zymogen. Out of all of the kallikreins surveyed using synthetic libraries, KLK5 exhibited the strongest preference for Arg over Lys in the P1 position. A PSSCL library screen with KLK5 documented this high specificity for Arg. Thr, Asn, Gln and Ile were also tolerated in the P1 position, while aromatic residues were not (Debela et al., 2006). In the P2 position, Ser was found to be favored over Asn, Thr, and Ala, while Arg and Try were not. This data correlates with the heptapeptide pro-domain cleavage data for the P1 and P2 positions. Most amino acid residues were tolerated in the P3 position, with Met, Phe and Tyr preferred. The acidic residue Asp was not tolerated at all, while Glu was slightly tolerated. Gly was preferred in the P4 position. KLK7 (PRSS6, human stratum corneum chymotryptic enzyme HSCCE) – Much like KLK5, KLK7 is thought to be involved in skin desquamation by degrading corneodesmosomes in the stratum corneum (Egelrud et al., 2005). In addition to skin disorders, KLK7 has been implicated in a number of cancers. Over-expression of KLK7 induced the EMT in prostate cancer cell lines and in colon cancer. Its continued expression is indicative of shorter disease-free survival (Mo et al., 2010; Talieri et al., 2009). KLK7 can cleave MMP-9, a gelatinase important to cancer progression, in addition to E-cadherin (Ramani et al., 2011). KLK7 is one of the few chymotrypsin-like KLKs. Instead of having an Asp189 in the S1 pocket, an Asn residue resides at the bottom of the pocket, and the surrounding non-polar amino acids help to create a hydrophobic environment (Debela et al., 2008). PSSCL data confirmed the chymotrypsin-like activity of this KLK showing that in the P1 position Tyr is favored over Ala, Met and Nle (Debela et al., 2006). Noticeably absent was Phe. Trp was not accepted, due to unfavorable steric interactions with the bottom of the pocket. At the P2 position, the favored residue again was Tyr, followed by Leu, Nle, Thr, Met and Phe. At position P3 and P4, most residues are well tolerated with a preference for hydrophobic residues. This preference for cleaving hydrophobic substrates can be seen in the cleavage products of oxidized insulin B chain, where KLK7 cleaves as follows: FFY↓TP, ALY↓LV and GFF↓YT (Debela et al., 2006). Few synthetic substrates for KLK7, with favorable kinetics, are known to exist. KLK7 is inactive against the chymotrypsin substrate suc-APF-pNA. However, suc-RPY-pNA has been identified as an efficient KLK7 substrate (Schechter et al., 2005). Single P1 amino acid AMC conjugates were found to be slow fluorogenic substrates, e.g. F-AMC (Km = 44.3 μM, kcat/Km = 0.36 M–1 s–1) and Y-AMC (Km = 40.2 μM, kcat/Km = 0.82 M–1 s–1) (Debela et al., 2007). A selective, fluorescence-quenched substrate has been described in the literature, Abz-KLYSSKQ-EDDnp (Km = 1.9 μM, kcat/Km = 1684 M–1 s–1) (Teixeira et al., 2011).

5.2.3 KLK6/KLK13/KLK14 KLK6 (Zyme, Protease M, Neurosin, PRSS9) – KLK6 is abundantly expressed in the central nervous system and is thought to play a role in neurodegenerative diseases,

128

Aaron M. LeBeau, and Charles S. Craik

in addition to certain cancers (Yousef and Diamandis, 2003). KLK6 was found to be a myelencephalon-specific protease, which can play an important role in regulating myelin turnover (Angelo et al., 2006). KLK6-mediated proteolysis has been associated with Alzheimer’s disease, multiple sclerosis, and Parkinson’s disease. KLK6 is over-expressed in ovarian cancer and primary breast cancer, but not in metastatic breast cancer. KLK6 cleaves numerous proteins in vitro: fibrinogen, collagen I & IV, myelin basic protein, Aβ amyloid peptide, plasminogen, myelin, laminin and α-synuclein. Early on, KLK6 was found to be trypsin-like. It has an Asp189 in the S1 pocket and is able to hydrolyze the synthetic substrates FSR-AMC (Km = 410 μM, kcat/ Km = 5.61 × 106 M–1 s–1) and VPR-AMC (Km = 271 μM, kcat/Km = 5.06 × 106 M–1 s–1) (Magklara et al., 2003). A better fluorescence-quenched substrate created later is Abz-AFRFSQEDDnp (Km = 0.9 μM, kcat/Km = 3.87 × 107 M–1 s–1) (Angelo et al., 2006). KLK6 was also able to hydrolyze β-amyloid peptide at several trypsin-like cleavage sites, EVK↓M, EFR↓H and HQK↓L (Magklara et al., 2003). KLK6 has demonstrated its potential as a signaling molecule by being able to cleave PAR1 (DPR↓S), PAR2 (KGR↓S), PAR4 (APR↓G) (Oikonomopoulou et al., 2006). In a PSSCL screen, KLK6 strongly favored Arg over Lys in the P1 in addition to Ala, Met, and Nle (Debela et al., 2006). Contrary to the previous studies on possible endogenous substrates, KLK6 overwhelmingly preferred Arg in the P2 position, according the PSSCL data. In the P3 and P4 positions, however, KLK6 was not selective. More recently, an octapeptide phage display library has been employed to elucidate the substrate specificity of KLK6 (Li et al., 2008). All of the cleavage sequences had a P1 Arg and most had either a Phe or Val residue in the P2. In agreement with other data, Ser was the preferred P1′ residue. The two best KLK6 substrates using this method were WYMTR↓SAMG (Km = 69 μM, kcat/Km = 1.9 × 104 M–1 s–1) and WEAVR↓SAMW (Km = 92 μM, kcat/Km = 5.06 × 106 M–1 s–1). KLK13 (KLK-like 4) – Little is known about KLK13, and its physiologic role is not known at all. KLK13 is expressed in the tonsils, esophagus, testis, salivary glands and cervix (Petraki et al., 2003). It has been associated with malignancies from psoriasis to ovarian and testicular cancer (Chang et al., 2002; Scorilas et al., 2004). A P1 PSSCL profile displayed a preference for basic residues, Arg/Lys, in the P1 position, but Ala and Asn were also tolerated. KLK13 was shown to prefer hydrophobic residues in P2, with a strong preference for Leu or Phe (Borgoño et al., 2007a). In the P3 position, Arg/ Lys were preferred, while little selectivity was observed in P4. A common target motif from this screen was VR(L/F)R↓S. The FRET substrate Abz-KLR↓SSKQ-EDDnp was cleaved efficiently by KLK13 under normal conditions and under conditions of high heparin and salt. KLK13 was also found to efficiently cleave a synthetic version of the salivary peptide histatin (RGYR↓S) (Andrade et al., 2011). KLK14 (KLK-like 6) – KLK14 is believed to play a role in activating proteolytic cascades important to skin desquamation (Emami and Diamandis, 2008). KLK14 is found in high levels in the skin (250 ng/g total protein) followed by the breast and prostate

Molecular Recognition Properties of Kallikrein-related Peptidases

129

(Borgoño et al., 2007b). Enzymatically active KLK14 has been found in the stratum corneum, where it is known to cleave corneodesmosin and desmoglein 1. In addition to its role in skin desquamation, the KLK14 gene is overexpressed in cancerous prostate and breast tissue (Borgoño et al., 2003; Yousef et al., 2003c). Additional evidence exists that documents a possible role for KLK14 in seminal clot liquefaction (Emami et al., 2008). Sequence analysis suggests that KLK14 would possess trypsin-like substrate specificity. Yet, in an early study, it also showed chymotryptic activity. KLK14 was seen to cleave the trypsin substrate IPR-pNA (Km = 300 μM, kcat/Km = 1.0 × 104 M–1 s–1) and chymotrypsin substrate suc-RPY-pNA (Km = 92 μM, kcat/Km = 5.06 × 106 M–1 s–1). A phage display pentapeptide library screen further documented the bi-specific nature of KLK14 (Felber et al., 2005). From the cleaved peptides, 69% had a basic residue in the P1 position and 31% had a Tyr in P1. FRET substrates were made from the peptides and the most efficient substrates were found to be trypsin-like, VGSLR↓ (kcat/Km = 4.81 × 105 M–1 s–1), R↓QTND (kcat/Km = 4.15 × 105 M–1 s–1) and NQR↓AI (kcat/ Km = 3.88 × 105 M–1 s–1). Using the most specific substrates for KLK14, the SwissProt database was searched for possible biological targets (Borgoño et al., 2007a). Several potential physiological substrates were identified, including laminin, matrillin-4 precursor, endothelin-2 precursor, VEGFR3 precursor, and collagen. In a separate study, KLKL14 cleaved PAR1 (DPR↓S, LLR↓N), PAR2 (TNR↓S, KGR↓S) and PAR4 (APR↓G) (Oikonomopoulou et al., 2006). A PSSCL study was performed on KLK14 and, although phage display ascribed a dual trypsin- and chymotrypsin-like specificity to KLK14, only trypsin-like activity was observed in the P1 position (Borgoño et al., 2007a). In the P2 position, small and polar residues were preferred (His, Asn, Ser, Pro, Ala). In the P3 position , KLK14 displays a strong preference for basic residues Arg or Lys, but Ala and Ser are also acceptable. Hydrophobic residues were shown to be most efficiently accepted at the P4 position. To validate the PSSCL results, several AMC substrates were synthesized, with the best KLK14 substrate being Ac-YAAR-AMC (Km = 124 μM, kcat/Km = 2.74 × 108 M–1 s–1). Exchanging the P1 Arg for a Lys delivered the following results: Ac-YAAK-AMC (Km = 256 μM, kcat/Km = 1.05 × 108 M–1 s–1). Recently, several new in vitro KLK14 substrates have been identified, such as vitronectin, plasminogen, kininogen and IGFBP 2 & 3 (Borgoño et al., 2007a).

5.2.4 KLK8/KLK10/KLK12 KLK8 (Ovasin, TADG-14, PRSS19, HNP) – KLK8 was first cloned from a human skin cDNA library as a homologue of mouse neuropsin (Shimizu et al., 1998). The DNA sequence of KLK8 was predicted to have 72% amino acid identity with mouse neuropsin (Eissa et al., 2011). Initially thought to be expressed predominantly in the brain, KLK8 protein was detected at low levels in brain tissue, but is primarily found in the upper dermis (Shaw and Diamandis, 2007). In addition, KLK8 is believed to be a potential biomarker of ovarian cancer, as low expression levels have been cor-

130

Aaron M. LeBeau, and Charles S. Craik

related with a positive clinical outcome (Shigemasa et al., 2004). In vitro KLK8 can cleave collagen IV, fibronectin, tissue-type plasminogen activator, pro-KLK11, proKLK1 and LL-37 (Eissa et al., 2011). The trypsin-like substrate specificity of KLK8 has been investigated, using AMC peptide substrates. Boc-VPR-AMC (Km = 24 μM, kcat/Km = 1.02 × 109 M–1 s–1) and PFR-AMC (Km = 70 μM, kcat/Km = 1.56 × 108 M–1 s–1) were cleaved, while P1 Lys substrates and chymotrypsin-like substrates were less efficient or not hydrolyzed at all. A FRET-based, rapid endopeptidase library was screened in order to determine the P2-P2′ specificity of KLK8 (Eissa et al., 2011). From this screen, KLK8 displayed a strong preference for Ile/Leu, Phe/Tyr at P2, Arg/Lys at P1, Ser/Thr, Phe/Tyr at P1′ and Ala/Val, Arg/Lys and Phe/Tyr at P2′. KLK10 (Normal epithelial cell-specific 1) – KLK10 is a potential biomarker for ovarian cancer, where its over-expression is a predictor of poor outcome in women with late-stage disease (Luo et al., 2003). Its expression has also been documented in a number of other cancers, but relatively little is known regarding this member of the KLK family (Yousef et al., 2005). KLK10 has trypsin-like specificity, as predicted by an assumed Asp189 at the bottom of the S1 pocket. In a PSSCL screen, KLK10 was found to prefer Arg at the P1 position over Lys, Met, and Nle (Debela et al., 2006). For the P2 position, Asp is favored over Glu, Arg, and Lys. KLK10 displays a preference for acidic residues (Glu and Asp) at the P3 position, but is also tolerant of hydrophobic or polar residues like Met, Tyr, Phe and Ser. Basic residues, such as Lys and Arg, are not tolerated in P3. The P4 position is non-specific, accepting a variety of residues at that position. Potential physiological cleavage sites for KLK10 are unknown. KLK12 (KLK-like 5) – The presence of KLK12 has been documented in bone, bone marrow, colon, lung, trachea, prostate, salivary glands, and stomach using ELISA and RT-PCR based approaches (Clements et al., 2001). Its trypsin-like specificity, predicted by the amino acid sequence, was established, using fluorogenic peptide substrates. KLK12 can cleave Boc-QAR-AMC (Km = 68.6 μM, kcat/Km = 9.0 × 108 M–1 s–1) and Boc-VPRAMC (Km = 200 μM, kcat/Km = 4.62 × 108 M–1 s–1) efficiently (Memari et al., 2007). Secreted as an inactive zymogen, KLK12 autoactivates cleaving the pro-domain sequence ATPK↓IFNG and can quickly autodegrade (Memari et al., 2007). Other potential substrates for KLK12 have been identified, using a degradomics approach with MDAMB-231 breast cancer cells (Guillon-Munos et al., 2011). KLK12 was found to cleave the six members of the CCN family (CCN1–6). Some of the cleaved sequences include ALK↓GIC, SLKR↓LP, EPR↓ILY, KTK↓KSP, SFK↓NVM and ATR↓VSN.

5.2.5 KLK9/KLK11/KLK15 KLK9 (KLK-like 3) – KLK9 gene expression and protein have been documented in the cerebellum, spinal cord, testis, prostate, ovary, cervix, vagina, esophagus and heart

Molecular Recognition Properties of Kallikrein-related Peptidases

131

(Clements et al., 2001; Shaw and Diamandis, 2007; Yousef et al., 2001a). Its presence in breast and ovarian cancer is viewed as a favorable predictor of disease-free survival (Yousef et al., 2001a; Yousef et al., 2003b). Little is known about this KLK and its substrate specificity has not been well-documented in any published reports. Unlike the majority of KLKs, KLK9 does not contain an Asp residue at the 189 position in the S1 pocket, but has a Gly residue. It can be assumed that KLK9 probably does not have trypsin-like specificity. In a KLK activome experiment, KLK9 was unable to hydrolyze pro-KLK sequences containing basic residues in the P1 position (Yoon et al., 2009). KLK11 (TLSP, Hippostasin, PRSS20) – KLK11 was originally isolated from the human hippocampus and is believed to be a predictive biomarker for breast, ovarian, and prostate cancer (McIntosh et al., 2007; Mitsui et al., 2000; Stavropoulou et al., 2005). KLK11 is found in the seminal plasma at concentrations ranging from 2 to 36 μg/ml. Only 40% of the protease is enzymatically active in the seminal plasma, the rest of the enzyme is inactivated by internal cleavage after Arg156 by a trypsin-like protease (Luo et al., 2006b). KLK11 appears to be a very specific protease, cleaving a relatively small number of substrates. The physiological role of KLK11 remains unclear. Although it is found at high levels in the seminal plasma, it does not cleave the semenogelins and fibronectin such as KLK3 and KLK2 (Luo et al., 2006b). To assign potential physiological cleavage substrates to KLK11, purified KLK11 was incubated with KLK3, KLK5, plasminogen, kininogen and collagen I–IV. However, no cleavage products were observed with these substrates (Luo et al., 2006b). KLK11 can release IGF-1 through the degradation of IGFBP-3 in breast cancer cell lines (Sano et al., 2007). The cleavage sites located on IGFBP-3 have not been identified. KLK11 can cleave fluorogenic trypsin substrates such as PFR-AMC (Km = 530 μM, kcat/Km = 2.11 × 105 M–1 s–1) and VPR-AMC (Km = 280 μM, kcat/Km = 9.60 × 104 M–1 s–1), but KLK11 is not known to cleave substrates with P1 Lys residues (Luo et al., 2006b). The substrate specificity of KLK11 was investigated, using a PSSCL approach (Debela et al., 2006). Despite having an Asp189 in the S1 pocket, the P1 position favors Met and Nle over the trypsin-preferred residues Arg ad Lys. In the P2 substrate position, Arg was clearly favored over Lys and Asp, followed by Glu and all other amino acids except Gln. In the P3 and P4 positions, Met and acidic residues were accepted, while basic amino acid residues were preferred to a much lesser extent. KLK15 (prostinogen, prostin) – KLK15 mRNA is found in numerous tissues such as prostate, colon, ovarian and thyroid, as well as in breast milk and seminal plasma (Yousef et al., 2001b). The use of KLK15 as a prognostic biomarker in breast, prostate and ovarian cancer has been documented (Batra et al., 2011; Rabien et al., 2010; Yousef et al., 2003a). In prostate cancer, KLK can be used to distinguish between aggressive and indolent cancer. KLK15 has 41% sequence identity with KLK3 and can cleave pro-KLK3, resulting in the active protease. KLK15 is unique in that it has a Glu residue at position 189 in the S1 pocket (Yousef et al., 2001b). It has been reported

132

Aaron M. LeBeau, and Charles S. Craik

that Arg-Lys selectivity in trypsin can be shifted 35-fold in favor of Lys by an Asp to Glu mutation (Evnin et al., 1990). It is possible that KLK15 might prefer a Lys residue in the P1 position over Arg. This was seen in KLK activome analysis, where KLK15 was found to efficiently cleave prodomains containing P1 Lys residues (Yoon et al., 2009).

Bibliography Andrade, D., Assis, D.M., Santos, J.A., Alves, F.M., Hirata, I.Y., Araujo, M.S., Blaber, S.I., Blaber, M., Juliano, M.A., and Juliano, L. (2011). Substrate specificity of kallikrein-related peptidase 13 activated by salts or glycosaminoglycans and a search for natural substrate candidates. Biochimie 93, 1701–1709. Angelo, P.F., Lima, A.R., Alves, F.M., Blaber, S.I., Scarisbrick, I.A., Blaber, M., Juliano, L., and Juliano, M.A. (2006). Substrate specificity of human kallikrein 6: salt and glycosaminoglycan activation effects. J. Biol. Chem. 281, 3116–3126. Batra, J., Nagle, C.M., O’Mara, T., Higgins, M., Dong, Y., Tan, O.L., Lose, F., Skeie, L.M., Srinivasan, S., Bolton, K.L., Song, H., Ramus, S.J., Gayther, S.A., Pharoah, P.D., Kedda, M.A., Spurdle, A.B., and Clements, J.A. (2011). A kallikrein 15 (KLK15) single nucleotide polymorphism located close to a novel exon shows evidence of association with poor ovarian cancer survival. BMC Cancer 11, 119. Beaufort, N., Debela, M., Creutzburg, S., Kellermann, J., Bode, W., Schmitt, M., Pidard, D., and Magdolen, V. (2006). Interplay of human tissue kallikrein 4 (hK4) with the plasminogen activation system: hK4 regulates the structure and functions of the urokinase-type plasminogen activator receptor (uPAR). Biol. Chem. 387, 217–222. Borgoño, C.A., Grass, L., Soosaipillai, A., Yousef, G.M., Petraki, C.D., Howarth, D.H., Fracchioli, S., Katsaros, D., and Diamandis, E.P. (2003). Human kallikrein 14: a new potential biomarker for ovarian and breast cancer. Cancer Res. 63, 9032–9041. Borgoño, C.A., Gavigan, J.A., Alves, J., Bowles, B., Harris, J.L., Sotiropoulou, G., and Diamandis, E.P. (2007a). Defining the extended substrate specificity of kallikrein 1-related peptidases. Biol. Chem. 388, 1215–1225. Borgoño, C.A., Michael, I.P., Komatsu, N., Jayakumar, A., Kapadia, R., Clayman, G.L., Sotiropoulou, G., and Diamandis, E.P. (2007b). A potential role for multiple tissue kallikrein serine proteases in epidermal desquamation. J. Biol. Chem. 282, 3640–3652. Brattsand, M., Stefansson, K., Hubiche, T., Nilsson, S.K., and Egelrud, T. (2009). SPINK9: a selective, skin-specific Kazal-type serine protease inhibitor. J. Invest. Dermatol. 129, 1656–1665. Briot, A., Deraison, C., Lacroix, M., Bonnart, C., Robin, A., Besson, C., Dubus, P., and Hovnanian, A. (2009). Kallikrein 5 induces atopic dermatitis-like lesions through PAR2-mediated thymic stromal lymphopoietin expression in Netherton syndrome. J. Exp. Med. 206, 1135–1147. Cao, Y., Lundwall, A., Gadaleanu, V., Lilja, H., and Bjartell, A. (2002). Anti-thrombin is expressed in the benign prostatic epithelium and in prostate cancer and is capable of forming complexes with prostate-specific antigen and human glandular kallikrein 2. Am. J. Pathol. 161, 2053–2063. Caubet, C., Jonca, N., Brattsand, M., Guerrin, M., Bernard, D., Schmidt, R., Egelrud, T., Simon, M., and Serre, G. (2004). Degradation of corneodesmosome proteins by two serine proteases of the kallikrein family, SCTE/KLK5/hK5 and SCCE/KLK7/hK7. J. Invest. Dermatol. 122, 1235–1244. Chang, A., Yousef, G.M., Scorilas, A., Grass, L., Sismondi, P., Ponzone, R., and Diamandis, E.P. (2002). Human kallikrein gene 13 (KLK13) expression by quantitative RT-PCR: an independent indicator of favourable prognosis in breast cancer. Br. J. Cancer 86, 1457–1464.

Molecular Recognition Properties of Kallikrein-related Peptidases

133

Chao, J., Chai, K.X., Chen, L.M., Xiong, W., Chao, S., Woodley-Miller, C., Wang, L.X., Lu, H.S., and Chao, L. (1990). Tissue kallikrein-binding protein is a serpin. I. Purification, characterization, and distribution in normotensive and spontaneously hypertensive rats. J. Biol. Chem. 265, 16394–16401. Charlesworth, M.C., Young, C.Y., Miller, V.M., and Tindall, D.J. (1999). Kininogenase activity of prostate-derived human glandular kallikrein (hK2) purified from seminal fluid. J. Androl. 20, 220–229. Chen, Z., Komatsu, K., Prestigiacomo, A., and Stamey, T.A. (1996). Addition of purified prostate specific antigen to serum from female subjects: studies on the relative inhibition by alpha 2-macroglobulin and alpha 1-antichymotrypsin. J. Urol. 156, 1357–1363. Clements, J., Hooper, J., Dong, Y., and Harvey, T. (2001). The expanded human kallikrein (KLK) gene family: genomic organisation, tissue-specific expression and potential functions. Biol. Chem. 382, 5–14. Cloutier, S.M., Chagas, J.R., Mach, J.P., Gygi, C.M., Leisinger, H.J., and Deperthes, D. (2002). Substrate specificity of human kallikrein 2 (hK2) as determined by phage display technology. Eur. J. Biochem. 269, 2747–2754. Coombs, G.S., Bergstrom, R.C., Pellequer, J.L., Baker, S.I., Navre, M., Smith, M.M., Tainer, J.A., Madison, E.L., and Corey, D.R. (1998). Substrate specificity of prostate-specific antigen (PSA). Chem. Biol. 5, 475–488. Darson, M.F., Pacelli, A., Roche, P., Rittenhouse, H.G., Wolfert, R.L., Saeid, M.S., Young, C.Y., Klee, G.G., Tindall, D.J., and Bostwick, D.G. (1999). Human glandular kallikrein 2 expression in prostate adenocarcinoma and lymph node metastases. Urology 53, 939–944. Debela, M., Magdolen, V., Schechter, N., Valachova, M., Lottspeich, F., Craik, C.S., Choe, Y., Bode, W., and Goettig, P. (2006). Specificity profiling of seven human tissue kallikreins reveals individual subsite preferences. J. Biol. Chem. 281, 25678–25688. Debela, M., Hess, P., Magdolen, V., Schechter, N.M., Steiner, T., Huber, R., Bode, W., and Goettig, P. (2007). Chymotryptic specificity determinants in the 1.0 Å structure of the zinc-inhibited human tissue kallikrein 7. Proc. Natl. Acad. Sci. USA 104, 16086–16091. Debela, M., Beaufort, N., Magdolen, V., Schechter, N.M., Craik, C.S., Schmitt, M., Bode, W., and Goettig, P. (2008). Structures and specificity of the human kallikrein-related peptidases KLK 4, 5, 6, and 7. Biol. Chem. 389, 623–632. Del Nery, E., Chagas, J.R., Juliano, M.A., Prado, E.S., and Juliano, L. (1995). Evaluation of the extent of the binding site in human tissue kallikrein by synthetic substrates with sequences of human kininogen fragments. Biochem. J. 312, 233–238. Delaria, K.A., Muller, D.K., Marlor, C.W., Brown, J.E., Das, R.C., Roczniak, S.O., and Tamburini, P.P. (1997). Characterization of placental bikunin, a novel human serine protease inhibitor. J. Biol. Chem. 272, 12209–12214. Denmeade, S.R., Lou, W., Lövgren, J., Malm, J., Lilja, H., and Isaacs, J.T. (1997). Specific and efficient peptide substrates for assaying the proteolytic activity of prostate-specific antigen. Cancer Res. 57, 4924–4930. Denmeade, S.R., Jakobsen, C.M., Janssen, S., Khan, S.R., Garrett, E.S., Lilja, H., Christensen, S.B., and Isaacs, J.T. (2003). Prostate-specific antigen-activated thapsigargin prodrug as targeted therapy for prostate cancer. J. Natl. Cancer Inst. 95, 990–1000. Deperthes, D., Frenette, G., Brillard-Bourdet, M., Bourgeois, L., Gauthier, F., Tremblay, R.R., and Dube, J.Y. (1996). Potential involvement of kallikrein hK2 in the hydrolysis of the human seminal vesicle proteins after ejaculation. J. Androl. 17, 659–665. Deraison, C., Bonnart, C., Lopez, F., Besson, C., Robinson, R., Jayakumar, A., Wagberg, F., Brattsand, M., Hachem, J.P., Leonardsson, G., and Hovnanian A. (2007). LEKTI fragments specifically

134

Aaron M. LeBeau, and Charles S. Craik

inhibit KLK5, KLK7, and KLK14 and control desquamation through a pH-dependent interaction. Mol. Biol. Cell 18, 3607–3619. Dong, Y., Kaushal, A., Bui, L., Chu, S., Fuller, P.J., Nicklin, J., Samaratunga, H., and Clements, J.A. (2001). Human kallikrein 4 (KLK4) is highly expressed in serous ovarian carcinomas. Clin. Cancer Res. 7, 2363–2371. Egelrud, T., Brattsand, M., Kreutzmann, P., Walden, M., Vitzithum, K., Marx, U.C., Forssmann, W.G., and Magert, H.J. (2005). hK5 and hK7, two serine proteinases abundant in human skin, are inhibited by LEKTI domain 6. Br. J. Dermatol. 153, 1200–1203. Eissa, A., Amodeo, V., Smith, C.R., and Diamandis, E.P. (2011). Kallikrein-related peptidase-8 (KLK8) is an active serine protease in human epidermis and sweat and is involved in a skin barrier proteolytic cascade. J. Biol. Chem. 286, 687–706. Emami, N., Deperthes, D., Malm, J., and Diamandis, E.P. (2008). Major role of human KLK14 in seminal clot liquefaction. J. Biol. Chem. 283, 19561–19569. Emami, N., and Diamandis, E.P. (2008). Human kallikrein-related peptidase 14 (KLK14) is a new activator component of the KLK proteolytic cascade. Possible function in seminal plasma and skin. J. Biol. Chem. 283, 3031–3041. España, F., Fink, E., Sanchez-Cuenca, J., Gilabert, J., Estelles, A., and Witzgall, K. (1995). Complexes of tissue kallikrein with protein C inhibitor in human semen and urine. Eur. J. Biochem. 234, 641–649. Evnin, L.B., Vasquez, J.R., and Craik, C.S. (1990). Substrate specificity of trypsin investigated by using a genetic selection. Proc. Natl. Acad. Sci. USA 87, 6659–6663. Felber, L.M., Borgoño, C.A., Cloutier, S.M., Kündig, C., Kishi, T., Ribeiro Chagas, J., Jichlinski, P., Gygi, C.M., Leisinger, H.J., Diamandis, E.P., and Deperthes D. (2005). Enzymatic profiling of human kallikrein 14 using phage-display substrate technology. Biol. Chem. 386, 291–298. Franzke, C.W., Baici, A., Bartels, J., Christophers, E., and Wiedow, O. (1996). Antileukoprotease inhibits stratum corneum chymotryptic enzyme. Evidence for a regulative function in desquamation. J. Biol. Chem. 271, 21886–21890. Frenette, G., Tremblay, R.R., Lazure, C., and Dube, J.Y. (1997). Prostatic kallikrein hK2, but not prostate-specific antigen (hK3), activates single-chain urokinase-type plasminogen activator. Int. J. Cancer 71, 897–899. Gao, J., Collard, R.L., Bui, L., Herington, A.C., Nicol, D.L., and Clements, J.A. (2007). Kallikrein 4 is a potential mediator of cellular interactions between cancer cells and osteoblasts in metastatic prostate cancer. Prostate 67, 348–360. Goettig, P., Magdolen, V., and Brandstetter, H. (2010). Natural and synthetic inhibitors of kallikreinrelated peptidases (KLKs). Biochimie 92, 1546–1567. Gratio, V., Beaufort, N., Seiz, L., Maier, J., Virca, G.D., Debela, M., Grebenchtchikov, N., Magdolen, V., and Darmoul, D. (2010). Kallikrein-related peptidase 4: a new activator of the aberrantly expressed protease-activated receptor 1 in colon cancer cells. Am. J. Pathol. 176, 1452–1461. Guillon-Munos, A., Oikonomopoulou, K., Michel, N., Smith, C.R., Petit-Courty, A., Canepa, S., Reverdiau, P., Heuze-Vourc’h, N., Diamandis, E.P., and Courty, Y. (2011). Kallikrein-related peptidase 12 hydrolyzes matricellular proteins of the CCN family and modifies interactions of CCN1 and CCN5 with growth factors. J. Biol. Chem. 286, 25505–25518. Gygi, C.M., Leibovitch, I.Y., Adlington, R., Baldwin, J.E., Chen, B., McCoull, W., Pritchard, G.J., Becker, G.W., Dixon, E.P., Little, S.P., Sutkowski, D.M., Teater, C., and Neubauer, B.L. (2002). Prostatespecific antigen (PSA)-mediated proliferation, androgenic regulation and inhibitory effects of LY312340 in HOS-TE85 (TE85) human osteosarcoma cells. Anticancer Res. 22, 2725–2732. Harris, J.L., Backes, B.J., Leonetti, F., Mahrus, S., Ellman, J.A., and Craik, C.S. (2000). Rapid and general profiling of protease specificity by using combinatorial fluorogenic substrate libraries. Proc. Natl. Acad. Sci. USA 97, 7754–7759.

Molecular Recognition Properties of Kallikrein-related Peptidases

135

Hsu, H.J., Sun, Y.K., Chang, H.J., Huang, Y.J., Yu, H.M., Lin, C.H., Mao, S.S., and Yang, A.S. (2008). Factor Xa active site substrate specificity with substrate phage display and computational molecular modeling. J. Biol. Chem. 283, 12343–12353. Janssen, S., Jakobsen, C.M., Rosen, D.M., Ricklis, R.M., Reineke, U., Christensen, S.B., Lilja, H., and Denmeade, S.R. (2004). Screening a combinatorial peptide library to develop a human glandular kallikrein 2-activated prodrug as targeted therapy for prostate cancer. Mol. Cancer Ther. 3, 1439–1450. Kantyka, T., Fischer, J., Wu, Z., Declercq, W., Reiss, K., Schröder, J.M., and Meyer-Hoffert, U. (2011). Inhibition of kallikrein-related peptidases by the serine protease inhibitor of Kazal-type 6. Peptides 32, 1187–1192. Kim, H., Scorilas, A., Katsaros, D., Yousef, G.M., Massobrio, M., Fracchioli, S., Piccinno, R., Gordini, G., and Diamandis, E.P. (2001). Human kallikrein gene 5 (KLK5) expression is an indicator of poor prognosis in ovarian cancer. Br. J. Cancer 84, 643–650. Kishi, T., Cloutier, S.M., Kundig, C., Deperthes, D., and Diamandis, E.P. (2006). Activation and enzymatic characterization of recombinant human kallikrein 8. Biol. Chem. 387, 723–731. Klokk, T.I., Kilander, A., Xi, Z., Waehre, H., Risberg, B., Danielsen, H.E., and Saatcioglu, F. (2007). Kallikrein 4 is a proliferative factor that is overexpressed in prostate cancer. Cancer Res. 67, 5221–5230. LeBeau, A.M., Singh, P., Isaacs, J.T., and Denmeade, S.R. (2008). Potent and selective peptidyl boronic acid inhibitors of the serine protease prostate-specific antigen. Chem. Biol. 15, 665–674. LeBeau, A.M., Singh, P., Isaacs, J.T., and Denmeade, S.R. (2009). Prostate-specific antigen is a „chymotrypsin-like“ serine protease with unique P1 substrate specificity. Biochemistry 48, 3490–3496. LeBeau, A.M., Kostova, M., Craik, C.S., and Denmeade, S.R. (2010). Prostate-specific antigen: an overlooked candidate for the targeted treatment and selective imaging of prostate cancer. Biol. Chem. 391, 333–343. Li, H.X., Hwang, B.Y., Laxmikanthan, G., Blaber, S.I., Blaber, M., Golubkov, P.A., Ren, P., Iverson, B.L., and Georgiou, G. (2008). Substrate specificity of human kallikreins 1 and 6 determined by phage display. Protein Sci. 17, 664–672. Lilja, H. (1985). A kallikrein-like serine protease in prostatic fluid cleaves the predominant seminal vesicle protein. J. Clin. Invest. 76, 1899–1903. Lima, A.R., Alves, F.M., Angelo, P.F., Andrade, D., Blaber, S.I., Blaber, M., Juliano, L., and Juliano, M.A. (2008). S(1)′ and S(2)′ subsite specificities of human plasma kallikrein and tissue kallikrein 1 for the hydrolysis of peptides derived from the bradykinin domain of human kininogen. Biol. Chem. 389, 1487–1494. Lin, V.K., Wang, S.Y., Boetticher, N.C., Vazquez, D.V., Saboorian, H., McConnell, J.D., and Roehrborn, C.G. (2005). Alpha2 macroglobulin, a PSA binding protein, is expressed in human prostate stroma. Prostate 63, 299–308. Lovgren, J., Airas, K., and Lilja, H. (1999). Enzymatic action of human glandular kallikrein 2 (hK2). Substrate specificity and regulation by Zn2+ and extracellular protease inhibitors. Eur. J. Biochem. 262, 781–789. Lu, Y., Papagerakis, P., Yamakoshi, Y., Hu, J.C., Bartlett, J.D., and Simmer, J.P. (2008). Functions of KLK4 and MMP-20 in dental enamel formation. Biol. Chem. 389, 695–700. Lundwall, A., and Brattsand, M. (2008). Kallikrein-related peptidases. Cell. Mol. Life Sci. 65, 2019–2038. Luo, L.Y., Katsaros, D., Scorilas, A., Fracchioli, S., Bellino, R., van Gramberen, M., de Bruijn, H., Henrik, A., Stenman, U.H., Massobrio, M., van der Zee, A.G., Vergote, I., and Diamandis, E.P.

136

Aaron M. LeBeau, and Charles S. Craik

(2003). The serum concentration of human kallikrein 10 represents a novel biomarker for ovarian cancer diagnosis and prognosis. Cancer Res. 63, 807–811. Luo, L.Y., and Jiang, W. (2006a). Inhibition profiles of human tissue kallikreins by serine protease inhibitors. Biol. Chem. 387, 813–816. Luo, L.Y., Shan, S.J., Elliott, M.B., Soosaipillai, A., and Diamandis, E.P. (2006b). Purification and characterization of human kallikrein 11, a candidate prostate and ovarian cancer biomarker, from seminal plasma. Clin. Cancer Res. 12, 742–750. Magklara, A., Mellati, A.A., Wasney, G.A., Little, S.P., Sotiropoulou, G., Becker, G.W., and Diamandis, E.P. (2003). Characterization of the enzymatic activity of human kallikrein 6: Autoactivation, substrate specificity, and regulation by inhibitors. Biochem. Biophys. Res. Commun. 307, 948–955. Mahrus, S., Trinidad, J.C., Barkan, D.T., Sali, A., Burlingame, A.L., and Wells, J.A. (2008). Global sequencing of proteolytic cleavage sites in apoptosis by specific labeling of protein N termini. Cell 134, 866–876. Malm, J., Hellman, J., Hogg, P., and Lilja, H. (2000). Enzymatic action of prostate-specific antigen (PSA or hK3): substrate specificity and regulation by Zn2+, a tight-binding inhibitor. Prostate 45, 132–139. Manning, M.L., Kostova, M., Williams, S.A., and Denmeade, S.R. (2011). Trypsin-like proteolytic contamination of commercially available PSA purified from human seminal fluid. Prostate 72, 1233–1238. Matsumura, M., Bhatt, A.S., Andress, D., Clegg, N., Takayama, T.K., Craik, C.S., and Nelson, P.S. (2005). Substrates of the prostate-specific serine protease prostase/KLK4 defined by positional-scanning peptide libraries. Prostate 62, 1–13. Matthews, D.J., and Wells, J.A. (1993). Substrate phage: selection of protease substrates by monovalent phage display. Science 260, 1113–1117. McIntosh, M.W., Liu, Y., Drescher, C., Urban, N., and Diamandis, E.P. (2007). Validation and characterization of human kallikrein 11 as a serum marker for diagnosis of ovarian carcinoma. Clin. Cancer Res. 13, 4422–4428. Memari, N., Jiang, W., Diamandis, E.P., and Luo, L.Y. (2007). Enzymatic properties of human kallikrein-related peptidase 12 (KLK12). Biol. Chem. 388, 427–435. Michael, I.P., Pampalakis, G., Mikolajczyk, S.D., Malm, J., Sotiropoulou, G., and Diamandis, E.P. (2006). Human tissue kallikrein 5 is a member of a proteolytic cascade pathway involved in seminal clot liquefaction and potentially in prostate cancer progression. J. Biol. Chem. 281, 12743–12750. Mikolajczyk, S.D., Millar, L.S., Kumar, A., and Saedi, M.S. (1999). Prostatic human kallikrein 2 inactivates and complexes with plasminogen activator inhibitor-1. Int. J. Cancer 81, 438–442. Mitsui, S., Yamada, T., Okui, A., Kominami, K., Uemura, H., and Yamaguchi, N. (2000). A novel isoform of a kallikrein-like protease, TLSP/hippostasin, (PRSS20), is expressed in the human brain and prostate. Biochem. Biophys. Res. Commun. 272, 205–211. Mo, L., Zhang, J., Shi, J., Xuan, Q., Yang, X., Qin, M., Lee, C., Klocker, H., Li, Q.Q., and Mo, Z. (2010). Human kallikrein 7 induces epithelial-mesenchymal transition-like changes in prostate carcinoma cells: a role in prostate cancer invasion and progression. Anticancer Res. 30, 3413–3420. Nagano, T., Kakegawa, A., Yamakoshi, Y., Tsuchiya, S., Hu, J.C., Gomi, K., Arai, T., Bartlett, J.D., and Simmer, J.P. (2009). Mmp-20 and Klk4 cleavage site preferences for amelogenin sequences. J. Dent. Res. 88, 823–828. Nelson, P.S., Gan, L., Ferguson, C., Moss, P., Gelinas, R., Hood, L., and Wang, K. (1999). Molecular cloning and characterization of prostase, an androgen-regulated serine protease with prostaterestricted expression. Proc. Natl. Acad. Sci. USA 96, 3114–3119.

Molecular Recognition Properties of Kallikrein-related Peptidases

137

Obiezu, C.V., Michael, I.P., Levesque, M.A., and Diamandis, E.P. (2006). Human kallikrein 4: enzymatic activity, inhibition, and degradation of extracellular matrix proteins. Biol. Chem. 387, 749–759. Oikonomopoulou, K., Hansen, K.K., Saifeddine, M., Tea, I., Blaber, M., Blaber, S.I., Scarisbrick, I., Andrade-Gordon, P., Cottrell, G.S., Bunnett, N.W., Diamandis, E.P., and Hollenberg, M.D. (2006). Proteinase-activated receptors, targets for kallikrein signaling. J. Biol. Chem. 281, 32095–32112. Pakkala, M., Hekim, C., Soininen, P., Leinonen, J., Koistinen, H., Weisell, J., Stenman, U.H., Vepsalainen, J., and Narvanen, A. (2007). Activity and stability of human kallikrein-2-specific linear and cyclic peptide inhibitors. J. Pept. Sci. 13, 348–353. Petraki, C.D., Karavana, V.N., and Diamandis, E.P. (2003). Human kallikrein 13 expression in normal tissues: an immunohistochemical study. J. Histochem. Cytochem. 51, 493–501. Pimenta, D.C., Chao, J., Chao, L., Juliano, M.A., and Juliano, L. (1999). Specificity of human tissue kallikrein towards substrates containing Phe-Phe pair of amino acids. Biochem. J. 339, 473–479. Prassas, I., Paliouras, M., Datti, A., and Diamandis, E.P. (2008). High-throughput screening identifies cardiac glycosides as potent inhibitors of human tissue kallikrein expression: implications for cancer therapies. Clin. Cancer Res. 14, 5778–5784. Rabien, A., Fritzsche, F.R., Jung, M., Tolle, A., Diamandis, E.P., Miller, K., Jung, K., Kristiansen, G., and Stephan, C. (2010). KLK15 is a prognostic marker for progression-free survival in patients with radical prostatectomy. Int. J. Cancer 127, 2386–2394. Ramani, V.C., Kaushal, G.P., and Haun, R.S. (2011). Proteolytic action of kallikrein-related peptidase 7 produces unique active matrix metalloproteinase-9 lacking the C-terminal hemopexin domains. Biochim. Biophys. Acta 1813, 1525–1531. Sano, A., Sangai, T., Maeda, H., Nakamura, M., Hasebe, T., and Ochiai, A. (2007). Kallikrein 11 expressed in human breast cancer cells releases insulin-like growth factor through degradation of IGFBP-3. Int. J. Oncol. 30, 1493–1498. Schechter, N.M., Choi, E.J., Wang, Z.M., Hanakawa, Y., Stanley, J.R., Kang, Y., Clayman, G.L., and Jayakumar, A. (2005). Inhibition of human kallikreins 5 and 7 by the serine protease inhibitor lympho-epithelial Kazal-type inhibitor (LEKTI). Biol. Chem. 386, 1173–1184. Schilling, O., Huesgen, P.F., Barre, O., Auf dem Keller, U., and Overall, C.M. (2011). Characterization of the prime and non-prime active site specificities of proteases by proteome-derived peptide libraries and tandem mass spectrometry. Nat. Protoc. 6, 111–120. Scorilas, A., Borgoño, C.A., Harbeck, N., Dorn, J., Schmalfeldt, B., Schmitt, M., and Diamandis, E.P. (2004). Human kallikrein 13 protein in ovarian cancer cytosols: a new favorable prognostic marker. J. Clin. Oncol. 22, 678–685. Shaw, J.L., and Diamandis, E.P. (2007). Distribution of 15 human kallikreins in tissues and biological fluids. Clin. Chem. 53, 1423–1432. Shigemasa, K., Tian, X., Gu, L., Tanimoto, H., Underwood, L.J., O’Brien, T.J., and Ohama, K. (2004). Human kallikrein 8 (hK8/TADG-14) expression is associated with an early clinical stage and favorable prognosis in ovarian cancer. Oncol. Rep. 11, 1153–1159. Shimizu, C., Yoshida, S., Shibata, M., Kato, K., Momota, Y., Matsumoto, K., Shiosaka, T., Midorikawa, R., Kamachi, T., Kawabe, A., and Shiosaka, S. (1998). Characterization of recombinant and brain neuropsin, a plasticity-related serine protease. J. Biol. Chem. 273, 11189–11196. Simon, M., Jonca, N., Guerrin, M., Haftek, M., Bernard, D., Caubet, C., Egelrud, T., Schmidt, R., and Serre, G. (2001). Refined characterization of corneodesmosin proteolysis during terminal differentiation of human epidermis and its relationship to desquamation. J. Biol. Chem. 276, 20292–20299.

138

Aaron M. LeBeau, and Charles S. Craik

Stavropoulou, P., Gregorakis, A.K., Plebani, M., and Scorilas, A. (2005). Expression analysis and prognostic significance of human kallikrein 11 in prostate cancer. Clin. Chim. Acta 357, 190–195. Swedberg, J.E., Nigon, L.V., Reid, J.C., de Veer, S.J., Walpole, C.M., Stephens, C.R., Walsh, T.P., Takayama, T.K., Hooper, J.D., Clements, J.A., Buckle, A.M., and Harris, J.M. (2009). Substrateguided design of a potent and selective kallikrein-related peptidase inhibitor for kallikrein 4. Chem. Biol. 16, 633–643. Takayama, T.K., Fujikawa, K., and Davie, E.W. (1997). Characterization of the precursor of prostatespecific antigen. Activation by trypsin and by human glandular kallikrein. J. Biol. Chem. 272, 21582–21588. Takayama, T.K., McMullen, B.A., Nelson, P.S., Matsumura, M., and Fujikawa, K. (2001). Characterization of hK4 (prostase), a prostate-specific serine protease: activation of the precursor of prostate specific antigen (pro-PSA) and single-chain urokinase-type plasminogen activator and degradation of prostatic acid phosphatase. Biochemistry 40, 15341–15348. Talieri, M., Mathioudaki, K., Prezas, P., Alexopoulou, D.K., Diamandis, E.P., Xynopoulos, D., Ardavanis, A., Arnogiannaki, N., and Scorilas, A. (2009). Clinical significance of kallikreinrelated peptidase 7 (KLK7) in colorectal cancer. Thromb. Haemost. 101, 741–747. Teixeira, T.S., Freitas, R.F., Abrahao, O. Jr., Devienne, K.F., de Souza, L.R., Blaber, S.I., Blaber, M., Kondo, M.Y., Juliano, M.A., Juliano, L., and Puzer, L. (2011). Biological evaluation and docking studies of natural isocoumarins as inhibitors for human kallikrein 5 and 7. Bioorg. Med. Chem. Lett. 21, 6112–6115. Watt, K.W., Lee, P.J., M’Timkulu, T., Chan, W.P., and Loor, R. (1986). Human prostate-specific antigen: structural and functional similarity with serine proteases. Proc. Natl. Acad. Sci. USA 83, 3166–3170. Williams, S.A., Singh, P., Isaacs, J.T., and Denmeade, S.R. (2007). Does PSA play a role as a promoting agent during the initiation and/or progression of prostate cancer? Prostate 67, 312–329. Williams, S.A., Xu, Y., De Marzo, A.M., Isaacs, J.T., and Denmeade, S.R. (2010). Prostate-specific antigen (PSA) is activated by KLK2 in prostate cancer ex vivo models and in prostate-targeted PSA/KLK2 double transgenic mice. Prostate 70, 788–796. Wolf, W.C., Evans, D.M., Chao, L., and Chao, J. (2001). A synthetic tissue kallikrein inhibitor suppresses cancer cell invasiveness. Am. J. Pathol. 159, 1797–1805. Yamakoshi, Y., Hu, J.C., Fukae, M., Yamakoshi, F., and Simmer, J.P. (2006). How do enamelysin and kallikrein 4 process the 32-kDa enamelin? Eur. J. Oral. Sci. 114 Suppl 1, 45–51; discussion 93–45, 379–380. Yang, C.F., Porter, E.S., Boths, J., Kanyi, D., Hsieh, M., and Cooperman, B.S. (1999). Design of synthetic hexapeptide substrates for prostate-specific antigen using single-position minilibraries. J. Pept. Res. 54, 444–448. Yoon, H., Blaber, S.I., Debela, M., Goettig, P., Scarisbrick, I.A., and Blaber, M. (2009). A completed KLK activome profile: investigation of activation profiles of KLK9, 10, and 15. Biol. Chem. 390, 373–377. Yousef, G.M., Kyriakopoulou, L.G., Scorilas, A., Fracchioli, S., Ghiringhello, B., Zarghooni, M., Chang, A., Diamandis, M., Giardina, G., Hartwick, W.J., Richiardi, G., Massobrio, M., Diamandis, E.P., and Katsaros, D. (2001a). Quantitative expression of the human kallikrein gene 9 (KLK9) in ovarian cancer: a new independent and favorable prognostic marker. Cancer Res. 61, 7811–7818. Yousef, G.M., Scorilas, A., Jung, K., Ashworth, L.K., and Diamandis, E.P. (2001b). Molecular cloning of the human kallikrein 15 gene (KLK15). Up-regulation in prostate cancer. J. Biol. Chem. 276, 53–61.

Molecular Recognition Properties of Kallikrein-related Peptidases

139

Yousef, G.M., and Diamandis, E.P. (2003). An overview of the kallikrein gene families in humans and other species: emerging candidate tumour markers. Clin. Biochem. 36, 443–452. Yousef, G.M., Scorilas, A., Katsaros, D., Fracchioli, S., Iskander, L., Borgoño, C., Rigault de la Longrais, I.A., Puopolo, M., Massobrio, M., and Diamandis, E.P. (2003a). Prognostic value of the human kallikrein gene 15 expression in ovarian cancer. J. Clin. Oncol. 21, 3119–3126. Yousef, G.M., Scorilas, A., Nakamura, T., Ellatif, M.A., Ponzone, R., Biglia, N., Maggiorotto, F., Roagna, R., Sismondi, P., and Diamandis, E.P. (2003b). The prognostic value of the human kallikrein gene 9 (KLK9) in breast cancer. Breast Cancer Res. Treat. 78, 149–158. Yousef, G.M., Stephan, C., Scorilas, A., Ellatif, M.A., Jung, K., Kristiansen, G., Jung, M., Polymeris, M.E., and Diamandis, E.P. (2003c). Differential expression of the human kallikrein gene 14 (KLK14) in normal and cancerous prostatic tissues. Prostate 56, 287–292. Yousef, G.M., White, N.M., Michael, I.P., Cho, J.C., Robb, J.D., Kurlender, L., Khan, S., and Diamandis, E.P. (2005). Identification of new splice variants and differential expression of the human kallikrein 10 gene, a candidate cancer biomarker. Tumour Biol. 26, 227–235. Zhang, W.M., Leinonen, J., Kalkkinen, N., and Stenman, U.H. (1997). Prostate-specific antigen forms a complex with and cleaves α1-protease inhibitor in vitro. Prostate 33, 87–96. Zhang, W.M., Finne, P., Leinonen, J., Vesalainen, S., Nordling, S., and Stenman, U.H. (1999). Measurement of the complex between prostate-specific antigen and α1-protease inhibitor in serum. Clin. Chem. 45, 814–821.

Joakim E. Swedberg, Simon J. de Veer, and Jonathan M. Harris

6 Natural, Engineered and Synthetic Inhibitors of Kallikrein-related Peptidases 6.1 Introduction There is a rapidly growing appreciation of the important physiological roles played by kallikreins and kallikrein-related peptidases (KLKs). Recent studies have revealed that these enzymes control key events in processes as diverse as inflammation and skin desquamation. Accordingly, there is considerable interest in developing tools to further dissect kallikrein activity, and a burgeoning effort aimed at producing lead inhibitors for therapeutic development. Indeed, several candidate inhibitors are already in clinical trials. This chapter surveys the naturally occurring kallikrein inhibitors, together with strategies for employing these molecules as bioscaffolds, as well as current progress in the development of small-molecule kallikrein inhibitors.

6.2 KLK diversity Since the elucidation of the role of cascading proteases in coagulation (Macfarlane, 1964), it has become apparent that proteolytic activity is important as more than just a route for breaking down dietary proteins and peptides into easily absorbed components. The plethora of proteases in the human genome (a total of about 500, 170 of which are serine proteases (Rawlings et al., 2008)) can readily be understood when the advantages of almost instant and irreversible control are considered. Proteolytic activity is a unidirectional pathway for the target substrate. The thermodynamics of proteolytic activity mean that, once cleaved, a substrate will only be re-ligated under the most exceptional of circumstances. Thus, a protease acts as both a circuit breaker and as a commitment step in any pathway it appears in. The KLK superfamily (see Chapter 1 for genomic organization), with its extended substrate selectivity and growing list of physiological relevant substrates, is rapidly gaining attention as a major regulator of a spectrum of pathways ranging from semen liquefaction and skin desquamation to neural development and inflammation. Constituting nearly 10% of the total serine protease complement, KLKs merit our attention on the basis of their number alone.

6.3 The KLK superfamily: Structure and catalytic mechanism In humans, the extended KLK superfamily comprises 15 members (KLK1–15) localized on chromosome 19q13 (Harvey et al., 2000; Yousef and Diamandis, 2000) with rela-

142

Joakim E. Swedberg, Simon J. de Veer, and Jonathan M. Harris

tively low sequence homology (minimum 25%). Members of the family show tryptic, chymotryptic, or mixed activity, together with a startling array of cleavage preferences (Borgoño et al., 2007a; Debela et al., 2006b). This diversity is somewhat surprising, given the high degree of similarity between the structures determined so far for the KLKs and the archetypal chymotryptic and tryptic folds (Debela et al., 2008). Indeed, all KLK structures determined to date show a classic (chymo)trypsin fold, comprised mainly of β-sheets forming two β-barrels with two solvent exposed α-helices (SCOP ID 50493 trypsin-like serine proteases). In line with their structural properties, the KLKs share a common catalytic mechanism based on a catalytic triad of His57, Asp102 and Ser195 (chymotrypsinogen numbering), which lie in an active-site cleft that follows the junction of the β-barrels (note: a more detailed description of KLK structure is given in Chapter 4). Much of the substrate selectivity displayed by members of the superfamily results from interactions within this cleft at small, highly defined pockets termed “S” subsites, which additionally align the substrate with respect to the catalytic triad (Schechter and Berger, 1967). Subsites are arranged linearly along the active site cleft and usually interact with a substrate by forming an extended β-sheet (Tyndall et al., 2005). In turn, substrate residues are termed P sites and numbered according to their position from the point of cleavage. Thus, peptide substrates are cleaved between P1 and P1ʹ, and matching S-subsites are given the corresponding S1 and S1ʹ designation (see Fig. 6.1). Interestingly, many of the naturally occurring kallikrein inhibitors bind to these very same determinants in a substrate-like manner.

S2´

S3 S1 S4

S2

S1´ S3 S4

S2´ S1 S2 S1´

Fig. 6.1 Structural arrangement of the kallikrein active-site cleft. The KLK protease is illustrated by molecular surface (blue), with a bound peptide substrate shown as stick model and colored by element (grey: carbon, red: oxygen, blue: nitrogen). Binding sites from S4 (left) to S2ʹ (right) are labeled sequentially outwards from the scissile bond (between the P1 and P1ʹ residues), according to Schechter and Berger nomenclature. A magnified view of the active site cleft is also shown (see insert).

143

Natural, Engineered and Synthetic Inhibitors of Kallikrein-related Peptidases

6.4 KLK inhibition: Rationale and mechanisms

KLK12

KLK13

KLK14

SPINK6

Aprotinin LEKTI D5 LEKTI D8-11 LEKTI D9-15 SPINK6 Leupeptin STI

KLK8

SPINK6

KLK7

KLK6

KLK5

(a)

KLK4

KLK1

KLK2

Given that proteolytic cleavage in the context of substrate hydrolysis is essentially irreversible, there is considerable evolutionary pressure to prevent unrestricted proteolytic activity. In view of the spectrum of biological pathways mediated by proteases and by KLKs in particular, it can easily be appreciated that rigorous spatial and temporal regulation of proteolytic activity must be exercised. This is achieved partially by transcriptional control, with much of the KLK locus being coordinated by hormoneresponsive transcriptional elements. Additionally, it is now becoming increasingly clear that there is significant influence exerted post-transcriptionally by microRNA (see Yousef (2008)) and Chapter 8 of Volume 2). However, transcriptional control is

0

log10 K i

–3 –6

Antipain Leupeptin

KLK14

KLK13

Antileukoprotease Aprotinin Eglin C LEKTI D5 LEKTI D6 LEKTI D6-9’ LEKTI D8-11 LEKTI D9-12

SPINK6

KLK12

KLK8

Aprotinin LEKTI D5 LEKTI D6 LEKTI D6-9’ LEKTI D8-11 LEKTI D9-12 LEKTI D9-15 SPINK6 SPINK9 Leupeptin STI

KLK7

Antipain Aprotinin SLPI

SFTI-1 SFTI-FCQR SPINK6

KLK5

KLK2 Protein C Inhibitor rACT-6.7

KLK3

KLK1

(b)

Kallistatin Protein C Inhibitor

–12

APP KPI APPH KPI Aprotinin Bikunin Hirustasin

–9

8

log10 Ka

6 4

Antithrombin III Chymostatin Kallistatin Protein C Inhibitor

Protein C Inhibitor

a1-antichymotrypsin a1-antitrypsin a 2-antiplasmin

C1 Inhibitor

a 2-antiplasmin

a 2-antiplasmin

Protein C Inhibitor Serpin B6

a 2-antiplasmin

Kallistatin PAI-1 Protein C Inhibitor

a1-antichymotrypsin a1-antitrypsin a 2-antiplasmin

a 2-antiplasmin Protein C Inhibitor

a1-antichymotrypsin a 2-macroglobulin

0

Protein C Inhibitor

2

Fig. 6.2 (a) Representative log Ki values for naturally occurring and engineered proteinaceous KLK inhibitors. (b) Representative log Ka values for naturally occurring and engineered KLK inhibitors.

144

Joakim E. Swedberg, Simon J. de Veer, and Jonathan M. Harris

a blunt instrument that is unable to achieve acute regulation of proteolytic activity. Therefore, further layers of post-translational regulation are imposed to limit proteolysis, first of all in the form of the KLK pro-region, which effectively prevents a given protease from achieving an active conformation after translation. Previous studies suggest that the pro-region has important roles for folding and maintains nascent protease in an inactive conformation until removed by cleavage. Post-cleavage, the new N-terminal amino acid hydrogen-bonds with Asp194 (chymotrypsin numbering), reordering the protease fold into its active form (Wang et al., 1985; Wroblowski et al., 1997). In addition to the pro-region, an armada of proteinaceous and peptide inhibitors imposes a second layer of regulation by blocking access to the protease active site. The importance of these naturally occurring kallikrein inhibitors is testified by the consequences of their dysfunction through mutation, as exemplified by Netherton Syndrome (Chavanas et al., 2000; Descargues et al., 2006). Key examples of naturally occurring kallikrein inhibitors are discussed below. For convenience, the inhibitory potency of natural and engineered inhibitors is summarized in Fig. 6.2.

6.5 Proteinaceous inhibitors The majority of proteinaceous inhibitors block proteolytic activity either by direct competition with the substrate at the enzyme active site or through disorganization of catalytic residues within the active site. The canonical or standard-mechanism inhibitors represent the best-characterized group of protease inhibitors. This broad class of protease modulators effect inhibition by inserting a specialized loop, known as the canonical loop, into the protease active site (Laskowski and Kato, 1980), as shown in Fig. 6.3a and b. This results in the formation of a tight-binding reversible complex that is very similar to the interaction of substrate molecules, in that an extended β-sheet dominates the interface between protease and inhibitor (Hubbard et al., 1991) and interacts with the protease via the P → S subsite scheme described above (Schechter and Berger, 1967). However, cleavage of the P1-P1ʹ peptide bond is restricted, making a poor leaving group and blocking the acquisition of fresh substrate (Laskowski and Kato, 1980). Whilst the structure of the canonical loop is highly conserved across these inhibitors, the polypeptides supporting it show considerable structural diversity, as shown in Fig. 6.3c–e.

6.5.1 Kunitz domain inhibitors The Kunitz serine protease inhibitors include some of the most-studied proteinaceous modulators of proteolysis. Aprotinin, also known as Trasylol®, bovine pancreatic trypsin inhibitor (BPTI), or kallikrein inhibitor, is the Kunitz domain inhibitor most closely associated with the kallikrein field, through the work of Hans Fritz (Fritz and

Natural, Engineered and Synthetic Inhibitors of Kallikrein-related Peptidases

145

(b)

(a)

Ser195

Asp102 His57

(c)

(d)

(e)

Fig. 6.3 (a) Kallikrein KLK4 from PDBid file 2BDH (cyan) overlaid with SFTI (magenta) from PDBid 1SFI. (b) Magnified view showing disposition of catalytic triad (side chains depicted as gold sticks) relative to canonical loop. (c) KLK4 overlaid with porcine pancreatic secretory inhibitor from 1TGS. (d) Soybean trypsin inhibitor from 1AVX and (e) ecotin from 1EZU. Models (c–e) show protease rendered with a grey solvent-accessible surface together with inhibitors in cartoon form.

Wunderer, 1983). Initially discovered as a potent inhibitor of bovine trypsin, it was also found to inhibit plasma kallikrein (KLKB1), KLK1 (Hofmann and Geiger, 1983) and KLK2. Its association with the pancreas, coupled with its very high inhibitory potency, led to intense efforts for over nearly 50 years, in order to discern a therapeutic role in the treatment of acute pancreatitis. Unfortunately, its promise has yet to be realized (Smith et al., 2009). More recently, it has been used as a reagent to help elucidate the role of the kallikreins in human physiology. For example, aprotinin was recently used to demonstrate that KLK1 can protect cortical neurons against ischemia-acidosis/ reperfusion-induced injury (Su et al., 2011). In addition to KLK1–3, KLK4 (Mize et al., 2008), KLK5 (Brattsand et al., 2005), KLK7 (Lundstrom and Egelrud, 1988), and KLK14 (Brattsand et al., 2005) are inhibited by aprotinin. The Kunitz domain itself comprises some 50–60 residues folded around an anti-parallel β-sheet core forming a β-trefoil (Hynes et al., 1990; Perona et al., 1993), stabilized by a network of disulphide bonds.

146

Joakim E. Swedberg, Simon J. de Veer, and Jonathan M. Harris

This structure is extremely robust imparting strong thermal stability, having a denaturation temperature above 100 °C (Makhatadze et al., 1993) and good resistance to proteolytic degradation. Surprisingly, there is no aprotinin homolog in the human genome. Instead, Kunitz domains occur as part of larger proteins such as Amyloid Precursor Protein (APP), which is associated with Alzheimer’s disease. When expressed separately in yeast, the APP Kunitz domain was shown to be a potent inhibitor of both plasma and glandular kallikreins (Petersen et al., 1994). A further multi-domain Kunitz inhibitor has been isolated from human placenta, Serine Peptidase Inhibitor Kunitz Type 2 (SPINT2) or bikunin, which inhibits both plasma and tissue kallikrein at picomolar levels (Delaria et al., 1997). Potent kallikrein inhibitors are also found in the plant kingdom. The soybean trypsin inhibitor (SBTI) is a well-established broad-spectrum inhibitor of serine proteases and shows potent inhibition of the skin-expressed KLKs, KLK5, 7 and 14 (Brattsand et al., 2005; Lundstrom and Egelrud, 1988).

6.5.2 Kazal domain inhibitors The canonical Kazal domain consists of two short α-helices held together by conserved disulphide links and a short two-stranded antiparallel β-sheet. The domain interacts with its target via a loop inserted into the target protease’s active site, in a way similar to the Kunitz domain. Additionally, like the Kunitz inhibitors, the Kazal domain modulators occur in multi-domain proteins. Inhibitors bearing this domain are particularly important in the skin, where they have been shown to co-ordinate the activity of KLK5, 7 and 14. Skin-expressed Kazal-type inhibitors are derived from three distinct genes termed Serine Protease Inhibitor Kazal (Spink) or Spink5 (Magert et al., 1999), Spink6 (Meyer-Hoffert et al., 2010), and Spink9 (Brattsand et al., 2009; Meyer-Hoffert et al., 2009). Spink5 produces a multi-domain protein that is processed into smaller Kazal-domain-bearing subunits with differing affinities for selected kallikreins. The product from Spink5 was the first of the trio to be described and its protein product was termed LEKTI for Lympho-epithelial Kazal-type-related inhibitor (Magert et al., 1999), which rose to prominence after mutations causing its truncation were linked to the severe skin condition called the Netherton Syndrome (Chavanas et al., 2000; Descargues et al., 2005). Indeed, pedigree analysis has shown that, in extreme cases, this mutation can actually be fatal (Capri et al., 2011; Fartasch et al., 1999). LEKTI fragments display varying abilities for inhibiting KLK5, 7 and 14 (Deraison et al., 2007; Egelrud et al., 2005; Schechter et al., 2005). Most recently, production and activity of these fragments has been exquisitely mapped in the skin, through a combination of antibody mapping and N-terminal sequencing (Fortugno et al., 2011). Like the Spink5 gene, Spink6 and Spink9, produce Kazal domain inhibitors. However, rather than a multi-domain protein, only a single Kazal unit is present. Spink9 shows KLK5-specific inhibition, but is restricted to palmar and plantar skin (Brattsand et al.,

Natural, Engineered and Synthetic Inhibitors of Kallikrein-related Peptidases

147

2009; Meyer-Hoffert et al., 2009). In contrast, Spink6 is broadly inhibitory (Kantyka et al., 2011; Meyer-Hoffert et al., 2010). Interestingly, none of the Spink gene products potently inhibit KLK8, which is postulated to play a role in KLK proteolytic cascades in the skin (Eissa et al., 2011).

6.5.3 Other canonical inhibitors Aside from the classical Kunitz- and Kazal-type inhibitors, a number of other canonical inhibitors with activity against KLKs have been identified. Interest in the Netherton Syndrome and in desquamation in general has prompted detailed investigations of KLK inhibitors from stratum corneum extracts, resulting in the identification of the elafin-like protease inhibitor antileukoprotease, which blocks the activity of KLK7 (Franzke et al., 1996). Additionally, this kallikrein is inhibited by the potato type-1 inhibitor, eglin C. Ecotin (E. coli Trypsin Inhibitor), which is a broad range inhibitor from the periplasmic space of E. coli (Chung et al., 1983) with activity against KLKB1 (Ulmer et al., 1995). The medical leech Hirudo medicinalis has a long-standing connection with protease inhibition in the coagulation cascade and produces hirustasin, a potent inhibitor of KLK1 but not KLKB1 (Söllner et al., 1994). As with the Kunitz inhibitors, plants have proven to be a rich source of other canonical inhibitors including Cucurbita maxima trypsin inhibitor (CMTI) -I and -II (Grzesiak et al., 2000) and the much less selective sunflower trypsin inhibitor (SFTI) (Swedberg et al., 2009).

6.5.4 Serpins In contrast to the modulators of proteolytic activity described above, serpins are large, irreversible inhibitors of KLKs and many other proteases. Irreversible inhibition implies that the activity of the serpins is more directed at the elimination of proteolytic activity, as opposed to regulation such as with the Kunitz- and Kazal-type inhibitors above. Inhibition is effected by inserting a substrate-like loop (the reactive loop) into the target protease’s active site, which is then cleaved. However, the acylenzyme intermediate remains intact. Before the catalytic cycle can be completed, the serpin undergoes a global conformation rearrangement, terminally disordering the target protease’s active site residues (Loebermann et al., 1984). In particular, Ser195 shows considerable displacement and there is disruption of the hydrogen bond network formed after pro-region cleavage and production of active protease (Huntington et al., 2000). Serpins are abundant in human serum and a number of endogenous serpintype kallikrein inhibitors have been described. Antithrombin III, α1-antitrypsin, α2-antiplasmin, and Protein C inhibitor have been shown to block activity of KLKB1 (Gallimore et al., 1979), KLK2 (Deperthes et al., 1995; Frenette et al., 1997), and KLK3

148

Joakim E. Swedberg, Simon J. de Veer, and Jonathan M. Harris

(Christensson et al., 1990). KLK5, 7, 8, 11, 12, 13 and 14 have also been shown to be inhibited by these serpins in vitro (Luo and Jiang, 2006). Interestingly, serpinB6 inhibits KLK8 (Scott et al., 2007), which is not blocked by LEKTI or Spink6 (Meyer-Hoffert et al., 2010) and is only weakly inhibited by LEKTI2 (Brattsand et al., 2009).

6.6 Naturally occurring small molecule kallikrein inhibitors Several low-molecular-weight peptides inhibiting serine proteases have been isolated from actinomycetes (Hozumi et al., 1972). One of these, leupeptin (N-acetyl(Npropionyl)-l-leucyl-l-leucyl-dl-argininal), was shown to be a potent inhibitor of kallikrein (Fritz et al., 1973) and, more recently, has been extensively used as a model inhibitor in the structural investigations undertaken by Debela and Goettig (Debela et al., 2006a; 2007a). As with the canonical inhibitors, these molecules take part in the protease catalytic cycle, but their inhibition is founded on mimicking a substrate’s transition state, forming a hemiacetal with the protease’s catalytic serine (Wolfenden, 1976), rather than cycling through substrate cleavage. The small size of these inhibitors means that they have many more degrees of freedom than the larger and more structured proteinaceous inhibitors. Accordingly, binding to a target protease induces a degree of order and a corresponding entropic debt, which is in turn reflected in a relatively slow kon rate (Schultz et al., 1989). A departure from the transition-state inhibition mechanism of leupeptin is presented by the depsipeptide protease inhibitors (Rubio et al., 2010). Instead of using a transition-state analogue to block protease activity, these compounds have an ester bond linking P1 and P1ʹ, which is resistant to enzymatic hydrolysis. Recently, cyclic depsipeptides from the cyanobacteria Chondromyces were found to be potent inhibitors of KLK7 (US Patent Application 20090156472 – Cyclic Depsipeptides). Currently, these compounds are being investigated commercially (Novartis International AG) and only limited information is available for them. However, the inhibitor’s cyclic constraint is likely to overcome the entropic drawbacks of leupeptin and other linear peptide inhibitors, and the patent application indicates a micromolar potency for the best performing inhibitors. In addition to these peptidic inhibitors, non-peptide isocoumarins extracted from the Brazilian plant Paepalanthus bromelioides have recently been found to inhibit KLK5 and 7 with micromolar potency (Teixeira et al., 2011). Three isocoumarins were selected for detailed study, with the most potent compounds, vioxanthin and 8,8ʹ-paepalantine, competitively inhibiting KLK5 (Ki = 22.9 μM) and KLK7 (Ki = 12.2 μM). Docking studies with the program GLIDE suggest that these polyaromatic lactones insert into the S1 protease pocket and hydrogen bond with the catalytic serine (KLK5) or His57 (KLK7). Interactions with S3 and S4 are also predicted but currently there is no data available on the selectivity of these interesting compounds.

Natural, Engineered and Synthetic Inhibitors of Kallikrein-related Peptidases

149

Whilst not normally considered a protease inhibitor, physiologically relevant concentrations of zinc ions have been shown to block the activity of the prostatic KLK2 and KLK3 (Lovgren et al., 1999; Malm et al., 2000). KLK3 is also inhibited by copper, mercury, cobalt and cadmium ions in vitro, although the extent of inhibition is considerably weaker (Malm et al., 2000). This observation has now been extended to KLK4 (Debela et al., 2006b), KLK5 (Debela et al., 2006a; Michael et al., 2006), KLK7 (Debela et al., 2007b), KLK8 (Kishi et al., 2006) and KLK14 (Borgoño et al., 2007b). Given the increasing number of roles that KLKs are thought to play in pathophysiology, there is considerable interest in bringing about therapeutic inhibition of KLK activity. Although naturally occurring inhibitors discussed above have excellent potency they suffer from poor selectivity, which is a major obstacle for any therapeutic inhibitor. Poor selectivity of inhibition is countered in normal physiology, since protease inhibitor expression is spatially and temporally restricted, allowing for precise coordination with a target protease. However, this co-ordination is rendered ineffective if inhibitors are delivered systemically, as a therapeutic agent. To overcome these drawbacks, a number of researchers and commercial entities have undertaken rational engineering programs, in order to redirect the activity of naturally occurring KLK inhibitors.

6.7 Engineered KLK Inhibitors Currently the dominant strategy in inhibitor engineering is the use of bioscaffolds, where natural template structures are engineered to improve potency and selectivity. This streamlines the design process by simply requiring enhancement of existing properties. Hence, in order to function effectively as a bioscaffold, the starting structure must have sufficient flexibility to allow multiple substitutions without losing structural integrity and should have inherent protease inhibitor activity. A further advantage of this approach derives from the ability to manufacture the variant inhibitors in industrial quantities, using established recombinant protein production techniques. Four bioscaffolds have been successfully used to design KLK inhibitors: the serpins, Kunitz-domain, ecotin and SFTI. Each of these templates uses a canonicalstyle loop to contact its target protease (see Fig. 6.3), forming an extension of the protease’s β-sheet structure (Madala et al., 2010; Tyndall et al., 2005). However, the scaffolding presenting the reactive loop shows considerable structural diversity and plays varying roles in stabilizing the protease-inhibitor complex.

150

Joakim E. Swedberg, Simon J. de Veer, and Jonathan M. Harris

6.7.1 Approaches to inhibitor design Currently, the major focus of inhibitor design is on optimizing the interface between an inhibitor and its target protease. Whilst this approach is effective, recent work by Swedberg et al. (2011) shows that it is also important to consider the structure of the bioscaffold itself, and that re-optimization of the bioscaffold structure after engineering the protease interface can bring about startling increases in potency (see below). The most frequent approach to optimizing inhibitor/protease interfaces is to probe the target’s active site with a library of substrate molecules and identify the best-performing substrate. The rationale behind this is that those substrates which fit well into the active site will also make efficient inhibitors if displayed on a suitable bioscaffold. Three types of libraries have been used in this process, i.e. positional scanning combinatorial libraries (Debela et al., 2006b), sparse matrix libraries (Swedberg et al., 2009; 2011; Swedberg and Harris, 2011) and phage display libraries (Cloutier et al., 2002; Felber et al., 2006). An approach to optimizing the interaction of inhibitor with protease used less frequently is to use direct selection by phage display. Each of these schemes is discussed below, with reference to the major bioscaffolds being used to inhibit KLKs.

6.7.2 Pharmacological challenges for therapeutic inhibitors Leaving aside their use as detection reagents, a major goal for KLK inhibitor design is the production of lead compounds for therapeutic development. For an inhibitor to perform effectively as a therapeutic, it needs to possess five key qualities, namely, potency and selectivity towards its target, a lack of appreciable toxicity or immunogenicity, and good ADME (absorption, distribution, metabolism and excretion) characteristics. The central philosophy behind bioscaffolds requires the use of entities with intrinsic inhibitory activity and, being derived from living systems, they rarely exhibit potent toxicity. The major remaining challenges thus are to ensure selectivity of inhibition (limiting off-target effects), to prevent immunogenicity and to ensure good ADME qualities.

6.7.3 Serpins Three serpins have been extensively targeted for engineering, i.e. C1-inhibitor protein of the complement system (Kase and Pospisil, 1983), human α1-antitrypsin (AAT) (Sun and Yang, 2004), and human α1-antichymotrypsin (ACT) (Potter et al., 2001). Although exosites play an important role for determining target selectivity for the serpins, the reactive loop described in section 6.5.4 is amenable to substitution, resulting in a palette of inhibitors with varying potency and selectivity. C1-inhibitor (Sulikowski

Natural, Engineered and Synthetic Inhibitors of Kallikrein-related Peptidases

151

et al., 2002) was the first serpin to be engineered with a view to improving its selectivity by using plasma kallikrein’s substrate selectivity to guide substitution at the serpin’s reactive loop. This approach produced a recombinant serpin with enhanced selectivity for plasma kallikrein and maintenance of potency (Ka of 382,180 M–1 s–1), and was followed by successful engineering of ACT to produce a potent KLK2 inhibitor with a Ka of 6261 M–1 s–1 (Cloutier et al., 2002; Cloutier et al., 2004). Both ACT and AAT have been targeted for further refinement, using phage display to probe the active site of KLK14 (Felber et al., 2006). Med Discovery, a Swiss Biotech company, is developing the ACT-based inhibitor for treatment of prostate cancer and skin disease. At the time of writing this inhibitor is undergoing toxicity trials.

6.7.4 Ecotin The proteinaceous inhibitor ecotin first came to attention as a broad-spectrum serine protease inhibitor with an unusual dimeric, bidentate binding mode (Chung et al., 1983). It is completely distinct from the Kunitz- and Kazal-type inhibitors described above and contacts target proteases through an extended interaction surface that produces a very extensive buried surface area of 2,850 Å2, when complexed with a target protease (Fig. 6.3e). Two ecotin molecules bind to two protease molecules, making a tetrameric complex (for clarity only a single protease is shown). The two ecotin monomers form a pincer that grips the protease with one arm occupying the conventional canonical loop space, and the other arm contacts the other side of the protease. Since this area is not directly involved in catalytic activity or substrate binding amongst the larger serine protease clade, it offers an excellent opportunity for engineering selectivity. Its periplasmic localization in E. coli facilitates both its expression (it is already codon optimized and natively expressed within this biotechnology workhorse) and extraction/purification through osmotic shock (McGrath et al., 1991). These features make ecotin a natural choice as a bioscaffold for engineering protease inhibitors. However, engineering of ecotin is complicated by strong cooperativity between loops making up the protease interaction surface (Stoop et al., 2010). Thus, mutation of one loop can have an opposing action in a neighboring loop. As a result of this, multiple loops within ecotin have to be targeted, in order to generate potent and selective inhibitors, thus making conventional phage display impracticable. Instead, Stoop et al. used a PCR-driven exon shuffling approach to generate diversity in ecotin’s binding loops. At the same time, they ensured the integrity of ecotin’s backbone by carrying out an alignment of all available prokaryotic ecotin sequences, in order to highlight areas where sequence variation could be tolerated (Gillmor et al., 2000). Selectivity is very difficult to achieve, given the very large buried surface area of ecotin’s protease interface. Accordingly, Stoop et al. employed a subtractive phage display approach and pre-bound soluble off-target proteases to their exon shuffling library before screening it with immobilised target proteases (Stoop et al., 2010). This

152

Joakim E. Swedberg, Simon J. de Veer, and Jonathan M. Harris

scheme was highly successful, yielding a potent inhibitor of plasma kallikrein with a Ki of 11 pM and a minimum of 10,000-fold selectivity against off-target proteases of the coagulation cascade (Factor Xa, Factor XIa, urokinase-type plasminogen activator, thrombin and matriptase). Ecotin was additionally engineered by simple substitution of the P1 analogous residue. In a parallel study, Wang et al. were able to redirect the inhibitory activity of ecotin by substituting the P4 analogous residue (M84R) to produce a variant with 10,000-fold enhanced thrombin inhibition, compared to wildtype ecotin (Wang et al., 2001).

6.7.5 Sunflower Trypsin Inhibitor (SFTI) SFTI is the smallest of the bioscaffold templates, being comprised of just 14 amino acids arranged in a “head to tail”, covalently closed macrocycle, which is bisected by a disulphide bond (Luckett et al., 1999). Its small size means that it occupies the middle ground between the large proteinaceous molecules described above and the small molecules discussed at the end of this chapter. It also means that it inherits some of the best aspects of both classes of inhibitor. Like Kunitz- and Kazal-based bioscaffolds, it can be engineered to provide high levels of potency and selectivity (Swedberg et al., 2011), whilst its smaller size means that it is bioavailable (Swedberg et al., 2011), and it has recently been shown to penetrate cells (Cascales et al., 2011). Furthermore, its closed backbone and structure mean that it does not trigger either cellular or humoral immune responses. With just 14 amino acids determining its structure, it is an ideal candidate for synthetic production, and generation of large numbers of variants can be achieved very efficiently (Korsinczky et al., 2004; Zablotna et al., 2007). Additionally, recent efforts directed at the production of SFTI molecules in E. coli and through phage display, have enabled library production suitable for biological screening (Austin et al., 2009). SFTI inhibits its targets by inserting a canonical loop into the target’s active site in the same manner as the large proteinaceous inhibitors described above. However, unlike the other canonical inhibitors, it uses a dense internal hydrogen bond network to maintain the structural rigidity required to prevent irreversible cleavage, rather than a larger protein scaffold. This affords the advantages above, but also means that optimizing the protease interface tends to compromise internal hydrogen bonding with concomitant destabilization of the acylenzyme intermediate. Recently, Swedberg et al. (2009) used a sparse matrix library to probe the substrate specificity of KLK4 and substituted the optimal tetrapeptide sequence into the SFTI bioscaffold. This produced a potent and selective KLK4 inhibitor, but molecular modelling suggested that the substitution compromised the inhibitor’s internal hydrogen bond network. Subsequently, computational methods were used to predict substitutions that would re-optimise internal hydrogen bonding, and the optimal SFTI variant had enhanced potency of inhibition by a factor of 125 from a Ki of 3.6 nM to 0.039 nM

Natural, Engineered and Synthetic Inhibitors of Kallikrein-related Peptidases

153

(Swedberg et al., 2011). This illustrates another advantage of working with the SFTI system, namely that its very high level of constraint and its small size enable very accurate simulations.

6.7.6 Warhead inhibitors Moving to a smaller scale, short peptides have been converted to selective and potent KLK inhibitors by the addition of functional groups that are generic protease inhibitors. This so called warhead strategy makes use of reversible and irreversible serine protease-specific, tetrahedral transition-state analogues. These functional groups include boronic acid, peptide aldehydes, and halogenated methyl ketones, which form tetrahedral structures with the catalytic serine. KLKB1 has been targeted, using this approach, both with peptide aldehyde-based inhibitors and boronic acid warheads. In both schemes, the short peptidic sequence, targeting the generic inhibitor, was designed using known KLKB1 cleavage sites. The aldehyde-based inhibitor performed relatively poorly with micromolar potency and little selectivity (Fareed et al., 1981), whilst the boronic acid derivatives showed potent inhibition (Ki = 150 pM) and greater selectivity (Dela Cadena et al., 1995). A similar strategy was used to design KLKB1 inhibitors using benzylamine in place of the transition state mimic. The benzylamine moiety is an analogue of an arginine side chain and thus is a good fit in the KLKB1 S1 site. However, when benzylamine is directly incorporated into a peptide, it produces a P1-P1ʹ bond that cannot be enzymatically hydrolyzed (cf. the depsipeptides described in section 6.6). This strategy resulted in a sub-micromolar inhibitor (Wanaka et al., 1990), which was later refined to provide an inhibitor with a Ki of 130 nM (Teno et al., 1993) with limited selectivity. Irreversible reactive functional groups have also been used in inhibitor design. Ferring Pharmaceuticals has used a fluoroalkyloxymethyl ketone warhead, targeted at KLKB1, with peptides containing non-natural amino acids that mimick KLKB1 cleavage sites in kininogen. This strategy yielded potent (nanomolar) inhibitors, which show good selectivity (Evans et al., 1996a and b). Beta-lactam mechanismbased inhibitors have also been directed at the KLKs. A KLK3 inhibitor, based on a 2-azetidinone warhead directed by a substrate-like peptide, achieved inhibition in the nanomolar range (Adlington et al., 2001), although selectivity was not reported. In terms of ADME properties, the small size of the warhead inhibitors means that they are unlikely to provoke an immune response. However, as a consequence, it is also possible for them to become rapidly lost through kidney filtration. Whilst increasing the lipophilicity of the compounds can ameliorate this, these manipulations can affect both potency and selectivity. Additionally, the reactivity of the warheads they carry tends to make them subject to rapid biotransformation by phase 1 and phase 2 detoxification systems (Jakoby and Ziegler, 1990).

154

Joakim E. Swedberg, Simon J. de Veer, and Jonathan M. Harris

Although not strictly a warhead approach, phage display has also been adapted to the small-molecule side of inhibitor design. Peptide inhibitors of KLK2 were directly selected from a peptide (as opposed to protein domain) library, using immobilised KLK2. This approach yielded peptides with inhibition constants in the lower micromolar range. Although this level of inhibition is modest, the molecules were selective against a number of tryptic serine proteases, including KLKB1 (Hekim et al., 2006). Low stability and low potency, related to the high degree of freedom of the peptides, was ameliorated by head-to-tail cyclisation (Pakkala et al., 2007). Being aware of the problems associated with peptide inhibitors, these investigators also pursued a nonpeptidic approach and selected small molecule inhibitors from a non-peptide library (Koistinen et al., 2008a and b), showing the synergistic effects of bioscaffolding and conventional drug-design approaches.

6.8 Conclusions and outlook Clinical translation of KLK inhibitors may soon become a reality, with Med Discovery’s inhibitors progressing through clinical trials. Similarly, Deraison’s exquisite dissection of LEKTI’s interaction with the skin KLKs (Deraison et al., 2007) demonstrates the utility of selective KLK inhibitors in the elucidation of the physiological roles of this enigmatic superfamily. With the promising therapeutic candidates and additional reagents that are in preparation, this area of the KLK field looks set for further expansion in the coming years.

Acknowledgements The corresponding author’s laboratory was supported by grants from the Prostate Cancer Foundation of Australia (Grant #PR09) and the Institute of Health and Biomedical Innovation mid-career Researcher scheme (awarded to JMH). SJD receives funding from the Smart Futures Fund (Queensland Government, Australia).

Bibliography Adlington, R.M., Baldwin, J.E., Becker, G.W., Chen, B., Cheng, L., Cooper, S.L., Hermann, R.B., Howe, T.J., McCoull, W., McNulty, A.M., Neubauer, B.L., and Pritchard, G.J. (2001). Design, synthesis and proposed active site binding analysis of monocyclic 2-azetidinone inhibitors of prostatespecific antigen. J. Med. Chem. 44, 1491–1508. Austin, J., Kimura, R.H., Woo, Y.H., and Camarero, J.A. (2009). In vivo biosynthesis of an Ala-scan library based on the cyclic peptide SFTI-1. Amino Acids 38, 1313–1322.

Natural, Engineered and Synthetic Inhibitors of Kallikrein-related Peptidases

155

Borgoño, C.A., Gavigan, J.A., Alves, J., Bowles, B., Harris, J.L., Sotiropoulou, G., and Diamandis, E.P. (2007a). Defining the extended substrate specificity of kallikrein 1-related peptidases. Biol. Chem. 388, 1215–1225. Borgoño, C.A., Michael, I.P., Shaw, J.L.V., Luo, L.-Y., Ghosh, M.C., Soosaipillai, A., Grass, L., Katsaros, D., and Diamandis, E.P. (2007b). Expression and functional characterization of the cancerrelated serine protease, human tissue kallikrein 14. J. Biol. Chem. 282, 2405–2422. Brattsand, M., Stefansson, K., Lundh, C., Haasum, Y., and Egelrud, T. (2005). A proteolytic cascade of kallikreins in the stratum corneum. J. Invest. Dermatol. 124, 198–203. Brattsand, M., Stefansson, K., Hubiche, T., Nilsson, S.K., and Egelrud, T. (2009). SPINK9: a selective, skin-specific Kazal-type serine protease inhibitor. J. Invest. Dermatol. 129, 1656–1665. Capri, Y., Vanlieferinghen, P., Boeuf, B., Dechelotte, P., Hovnanian, A., and Lecomte, B. (2011). A lethal variant of Netherton syndrome in a large inbred family. Arch. Pediatr. 18, 294–298. Cascales, L., Henriques, S.T., Kerr, M.C., Huang, Y.H., Sweet, M.J., Daly, N.L., and Craik, D.J. (2011). Identification and characterization of a new family of cell penetrating peptides: Cyclic cell penetrating peptides. J. Biol. Chem. 286, 36932–36943. Chavanas, S., Bodemer, C., Rochat, A., Hamel-Teillac, D., Ali, M., Irvine, A.D., Bonafe, J.L., Wilkinson, J., Taieb, A., Barrandon, Y., Harper, J.I., de Prost, Y., and Hovnanian, A. (2000). Mutations in SPINK5, encoding a serine protease inhibitor, cause Netherton syndrome. Nat. Genet. 25, 141–142. Christensson, A., Laurell, C.B., and Lilja, H. (1990). Enzymatic activity of prostate-specific antigen and its reactions with extracellular serine proteinase inhibitors. Eur. J. Biochem. 194, 755–763. Chung, C.H., Ives, H.E., Almeda, S., and Goldberg, A.L. (1983). Purification from Escherichia coli of a periplasmic protein that is a potent inhibitor of pancreatic proteases. J. Biol. Chem. 258, 11032–11038. Cloutier, S.M., Chagas, J.R., Mach, J.P., Gygi, C.M., Leisinger, H.J., and Deperthes, D. (2002). Substrate specificity of human kallikrein 2 (hK2) as determined by phage display technology. Eur. J. Biochem. 269, 2747–2754. Cloutier, S.M., Kundig, C., Felber, L.M., Fattah, O.M., Chagas, J.R., Gygi, C.M., Jichlinski, P., Leisinger, H.J., and Deperthes, D. (2004). Development of recombinant inhibitors specific to human kallikrein 2 using phage-display selected substrates. Eur. J. Biochem. 271, 607–613. Debela, M., Magdolen, V., Grimminger, V., Sommerhoff, C., Messerschmidt, A., Huber, R., Friedrich, R., Bode, W., and Goettig, P. (2006a). Crystal structures of human tissue kallikrein 4: activity modulation by a specific zinc binding site. J. Mol. Biol. 362, 1094–1107. Debela, M., Magdolen, V., Schechter, N., Valachova, M., Lottspeich, F., Craik, C.S., Choe, Y., Bode, W., and Goettig, P. (2006b). Specificity profiling of seven human tissue kallikreins reveals individual subsite preferences. J. Biol. Chem. 281, 25678–25688. Debela, M., Goettig, P., Magdolen, V., Huber, R., Schechter, N.M., and Bode, W. (2007a). Structural basis of the zinc inhibition of human tissue kallikrein 5. J. Mol. Biol. 373, 1017–1031. Debela, M., Hess, P., Magdolen, V., Schechter, N.M., Steiner, T., Huber, R., Bode, W., and Goettig, P. (2007b). Chymotryptic specificity determinants in the 1.0 Å structure of the zinc-inhibited human tissue kallikrein 7. Proc. Natl. Acad. Sci. USA 104, 16086–16091. Debela, M., Beaufort, N., Magdolen, V., Schechter, N.M., Craik, C.S., Schmitt, M., Bode, W., and Goettig, P. (2008). Structures and specificity of the human kallikrein-related peptidases KLK 4, 5, 6, and 7. Biol. Chem. 389, 623–632. Dela Cadena, R.A., Stadnicki, A., Uknis, A.B., Sartor, R.B., Kettner, C.A., Adam, A., and Colman, R.W. (1995). Inhibition of plasma kallikrein prevents peptidoglycan-induced arthritis in the Lewis rat. FASEB J. 9, 446–452.

156

Joakim E. Swedberg, Simon J. de Veer, and Jonathan M. Harris

Delaria, K.A., Muller, D.K., Marlor, C.W., Brown, J.E., Das, R.C., Roczniak, S.O., and Tamburini, P.P. (1997). Characterization of placental bikunin, a novel human serine protease inhibitor. J. Biol Chem. 272, 12209–12214. Deperthes, D., Chapdelaine, P., Tremblay, R.R., Brunet, C., Berton, J., Hebert, J., Lazure, C., and Dube, J.Y. (1995). Isolation of prostatic kallikrein hK2, also known as hGK-1, in human seminal plasma. Biochim. Biophys. Acta 1245, 311–316. Deraison, C., Bonnart, C., Lopez, F., Besson, C., Robinson, R., Jayakumar, A., Wagberg, F., Brattsand, M., Hachem, J.P., Leonardsson, G., and Hovnanian, A. (2007). LEKTI fragments specifically inhibit KLK5, KLK7, and KLK14 and control desquamation through a pH-dependent interaction. Mol. Biol. Cell 18, 3607–3619. Descargues, P., Deraison, C., Bonnart, C., Kreft, M., Kishibe, M., Ishida-Yamamoto, A., Elias, P., Barrandon, Y., Zambruno, G., Sonnenberg, A., and Hovnanian, A. (2005). Spink5-deficient mice mimic Netherton syndrome through degradation of desmoglein 1 by epidermal protease hyperactivity. Nat. Genet. 37, 56–65. Descargues, P., Deraison, C., Prost, C., Fraitag, S., Mazereeuw-Hautier, J., D’Alessio, M., IshidaYamamoto, A., Bodemer, C., Zambruno, G., and Hovnanian, A. (2006). Corneodesmosomal cadherins are preferential targets of stratum corneum trypsin- and chymotrypsin-like hyperactivity in Netherton syndrome. J. Invest. Dermatol. 126, 1622–1632. Egelrud, T., Brattsand, M., Kreutzmann, P., Walden, M., Vitzithum, K., Marx, U.C., Forssmann, W.G., and Magert, H.J. (2005). hK5 and hK7, two serine proteinases abundant in human skin, are inhibited by LEKTI domain 6. Br. J. Dermatol. 153, 1200–1203. Eissa, A., Amodeo, V., Smith, C.R., and Diamandis, E.P. (2011). Kallikrein-related peptidase-8 (KLK8) is an active serine protease in human epidermis and sweat and is involved in a skin barrier proteolytic cascade. J. Biol. Chem. 286, 687–706. Evans, D.M., Jones, D.M., Pitt, G.R., Ashworth, D., De Clerck, F., Verheyen, F., and Szelke, M. (1996a). Synthetic inhibitors of human tissue kallikrein. Immunopharmacology 32, 117–118. Evans, D.M., Jones, D.M., Pitt, G.R., Sueiras-Diaz, J., Horton, J., Ashworth, D., Olsson, H., and Szelke, M. (1996b). Selective inhibitors of plasma kallikrein. Immunopharmacology 32, 115–116. Fareed, J., Messmore, H.L., Kindel, G., and Balis, J.U. (1981). Inhibition of serine proteases by low molecular weight peptides and their derivatives. Ann. NY Acad. Sci. 370, 765–784. Fartasch, M., Williams, M.L., and Elias, P.M. (1999). Altered lamellar body secretion and stratum corneum membrane structure in Netherton syndrome: differentiation from other infantile erythrodermas and pathogenic implications. Arch. Dermatol. 135, 823–832. Felber, L.M., Kundig, C., Borgoño, C.A., Chagas, J.R., Tasinato, A., Jichlinski, P., Gygi, C.M., Leisinger, H.J., Diamandis, E.P., Deperthes, D., and Cloutier, S.M. (2006). Mutant recombinant serpins as highly specific inhibitors of human kallikrein 14. FEBS J. 273, 2505–2514. Fortugno, P., Bresciani, A., Paolini, C., Pazzagli, C., El Hachem, M., D’Alessio, M., and Zambruno, G. (2011). Proteolytic activation cascade of the Netherton syndrome-defective protein, LEKTI, in the epidermis: implications for skin homeostasis. J. Invest. Dermatol. 131, 2223–2232. Franzke, C.W., Baici, A., Bartels, J., Christophers, E., and Wiedow, O. (1996). Antileukoprotease inhibits stratum corneum chymotryptic enzyme. Evidence for a regulative function in desquamation. J. Biol. Chem. 271, 21886–21890. Frenette, G., Deperthes, D., Tremblay, R.R., Lazure, C., and Dube, J.Y. (1997). Purification of enzymatically active kallikrein hK2 from human seminal plasma. Biochim. Biophys. Acta 1334, 109–115. Fritz, H., Forg-Brey, B., and Umezawa, H. (1973). Leupeptin and antipain. Strong competitive inhibitors of sperm acrosomal proteinase (boar acrosin) and kallikreins from porcine organs (pancreas, submand. glands, urine). Hoppe Seylers Z Physiol. Chem. 354, 1304–1306. Fritz, H., and Wunderer, G. (1983). Biochemistry and applications of aprotinin, the kallikrein inhibitor from bovine organs. Arzneimittelforschung 33, 479–494.

Natural, Engineered and Synthetic Inhibitors of Kallikrein-related Peptidases

157

Gallimore, M.J., Amundsen, E., Larsbraaten, M., Lyngaas, K., and Fareid, E. (1979). Studies on plasma inhibitors of plasma kallikrein using chromogenic peptide substrate assays. Thromb. Res. 16, 695–703. Gillmor, S.A., Takeuchi, T., Yang, S.Q., Craik, C.S., and Fletterick, R.J. (2000). Compromise and accommodation in ecotin, a dimeric macromolecular inhibitor of serine proteases. J. Mol. Biol. 299, 993–1003. Grzesiak, A., Buczek, O., Petry, I., Szewczuk, Z., and Otlewski, J. (2000). Inhibition of serine proteinases from human blood clotting system by squash inhibitor mutants. Biochim. Biophys. Acta 1478, 318–324. Harvey, T.J., Hooper, J.D., Myers, S.A., Stephenson, S.A., Ashworth, L.K., and Clements, J.A. (2000). Tissue-specific expression patterns and fine mapping of the human kallikrein (KLK) locus on proximal 19q13.4. J. Biol. Chem. 275, 37397–37406. Hekim, C., Leinonen, J., Narvanen, A., Koistinen, H., Zhu, L., Koivunen, E., Vaisanen, V., and Stenman, U.H. (2006). Novel peptide inhibitors of human kallikrein 2. J. Biol. Chem. 281, 12555–12560. Hofmann, W., and Geiger, R. (1983). Human tissue kallikrein. I. Isolation and characterization of human pancreatic kallikrein from duodenal juice. Hoppe Seylers Z Physiol. Chem. 364, 413–423. Hozumi, M., Ogawa, M., Sugimura, T., Takeuchi, T., and Umezawa, H. (1972). Inhibition of tumorigenesis in mouse skin by leupeptin, a protease inhibitor from Actinomycetes. Cancer Res. 32, 1725–1728. Hubbard, S.J., Campbell, S.F., and Thornton, J.M. (1991). Molecular recognition. Conformational analysis of limited proteolytic sites and serine proteinase protein inhibitors. J. Mol. Biol. 220, 507–530. Huntington, J.A., Read, R.J., and Carrell, R.W. (2000). Structure of a serpin-protease complex shows inhibition by deformation. Nature 407, 923–926. Hynes, T.R., Randal, M., Kennedy, L.A., Eigenbrot, C., and Kossiakoff, A.A. (1990). X-ray crystal structure of the protease inhibitor domain of Alzheimer’s amyloid beta-protein precursor. Biochemistry 29, 10018–10022. Jakoby, W.B., and Ziegler, D.M. (1990). The enzymes of detoxication. J. Biol. Chem. 265, 20715–20718. Kantyka, T., Fischer, J., Wu, Z., Declercq, W., Reiss, K., Schröder, J.M., and Meyer-Hoffert, U. (2011). Inhibition of kallikrein-related peptidases by the serine protease inhibitor of Kazal-type 6. Peptides 32, 1187–1192. Kase, F., and Pospísil, J. (1983) Physiologic inhibitors of blood coagulation. 2. Alpha 2-macroglobulin, alpha-antitrypsin and the C1 inhibitor of complement. Folia Haematol. Int. Mag. Klin. Morphol. Blutforsch. 110, 634–650. Kishi, T., Cloutier, S.M., Kundig, C., Deperthes, D., and Diamandis, E.P. (2006). Activation and enzymatic characterization of recombinant human kallikrein 8. Biol. Chem. 387, 723–731. Koistinen, H., Narvanen, A., Pakkala, M., Hekim, C., Mattsson, J.M., Zhu, L., Laakkonen, P., and Stenman, U.H. (2008a). Development of peptides specifically modulating the activity of KLK2 and KLK3. Biol. Chem. 389, 633–642. Koistinen, H., Wohlfahrt, G., Mattsson, J.M., Wu, P., Lahdenpera, J., and Stenman, U.H. (2008b). Novel small molecule inhibitors for prostate-specific antigen. Prostate 68, 1143–1151. Korsinczky, M.L., Schirra, H.J., and Craik, D.J. (2004). Sunflower trypsin inhibitor-1. Curr. Protein Pept. Sci. 5, 351–364. Laskowski, M. Jr., and Kato, I. (1980). Protein inhibitors of proteinases. Annu. Rev. Biochem. 49, 593–626.

158

Joakim E. Swedberg, Simon J. de Veer, and Jonathan M. Harris

Loebermann, H., Tokuoka, R., Deisenhofer, J., and Huber, R. (1984). Human alpha 1-proteinase inhibitor. Crystal structure analysis of two crystal modifications, molecular model and preliminary analysis of the implications for function. J. Mol. Biol. 177, 531–557. Lövgren, J., Airas, K., and Lilja, H. (1999). Enzymatic action of human glandular kallikrein 2 (hK2). Substrate specificity and regulation by Zn2+ and extracellular protease inhibitors. Eur. J. Biochem. 262, 781–789. Luckett, S., Garcia, R.S., Barker, J.J., Konarev, A.V., Shewry, P.R., Clarke, A.R., and Brady, R.L. (1999). High-resolution structure of a potent, cyclic proteinase inhibitor from sunflower seeds. J. Mol. Biol. 290, 525–533. Lundström, A., and Egelrud, T. (1988). Cell shedding from human plantar skin in vitro: evidence of its dependence on endogenous proteolysis. J. Invest. Dermatol. 91, 340–343. Luo, L.-Y., and Jiang, W. (2006). Inhibition profiles of human tissue kallikreins by serine protease inhibitors. Biol. Chem. 387, 813–816. Macfarlane, R.G. (1964). An enzyme cascade in the blood clotting mechanism, and its function as a biochemical amplifier. Nature 202, 498–499. Madala, P.K., Tyndall, J.D., Nall, T., and Fairlie, D.P. (2010). Update 1 of: Proteases universally recognize beta strands in their active sites. Chem. Rev. 110, PR1–31. Magert, H.J., Standker, L., Kreutzmann, P., Zucht, H.D., Reinecke, M., Sommerhoff, C.P., Fritz, H., and Forssmann, W.G. (1999). LEKTI, a novel 15-domain type of human serine proteinase inhibitor. J. Biol. Chem. 274, 21499–21502. Makhatadze, G.I., Kim, K.S., Woodward, C., and Privalov, P.L. (1993). Thermodynamics of BPTI folding. Protein Sci. 2, 2028–2036. Malm, J., Hellman, J., Hogg, P., and Lilja, H. (2000). Enzymatic action of prostate-specific antigen (PSA or hK3): substrate specificity and regulation by Zn2+, a tight-binding inhibitor. Prostate 45, 132–139. McGrath, M.E., Hines, W.M., Sakanari, J.A., Fletterick, R.J., and Craik, C.S. (1991). The sequence and reactive site of ecotin. A general inhibitor of pancreatic serine proteases from Escherichia coli. J. Biol. Chem. 266, 6620–6625. Meyer-Hoffert, U., Wu, Z., and Schröder, J.M. (2009). Identification of lympho-epithelial Kazal-type inhibitor 2 in human skin as a kallikrein-related peptidase 5-specific protease inhibitor. PLoS One 4, e4372. Meyer-Hoffert, U., Wu, Z., Kantyka, T., Fischer, J., Latendorf, T., Hansmann, B., Bartels, J., He, Y., Glaser, R., and Schröder, J.M. (2010). Isolation of SPINK6 in human skin: selective inhibitor of kallikrein-related peptidases. J. Biol. Chem. 285, 32174–32181. Michael, I.P., Pampalakis, G., Mikolajczyk, S.D., Malm, J., Sotiropoulou, G., and Diamandis, E.P. (2006). Human tissue kallikrein 5 is a member of a proteolytic cascade pathway involved in seminal clot liquefaction and potentially in prostate cancer progression. J. Biol. Chem. 281, 12743–12750. Mize, G.J., Wang, W., and Takayama, T.K. (2008). Prostate-specific kallikreins-2 and -4 enhance the proliferation of DU-145 prostate cancer cells through protease-activated receptors-1 and -2. Mol. Cancer Res. 6, 1043–1051. Pakkala, M., Hekim, C., Soininen, P., Leinonen, J., Koistinen, H., Weisell, J., Stenman, U.H., Vepsalainen, J., and Narvanen, A. (2007). Activity and stability of human kallikrein-2-specific linear and cyclic peptide inhibitors. J. Pept. Sci. 13, 348–353. Perona, J.J., Tsu, C.A., Craik, C.S., and Fletterick, R.J. (1993). Crystal structures of rat anionic trypsin complexed with the protein inhibitors APPI and BPTI. J. Mol. Biol. 230, 919–933. Petersen, L.C., Bjørn, S.E., Norris, F., Norris, K., Sprecher, C., and Foster, D.C. (1994). Expression, purification and characterization of a Kunitz-type protease inhibitor domain from human amyloid precursor protein homolog. FEBS Lett. 338, 53–57.

Natural, Engineered and Synthetic Inhibitors of Kallikrein-related Peptidases

159

Potter, H., Wefes, I.M., and Nilsson, L.N. (2001) The inflammation-induced pathological chaperones ACT and apo-E are necessary catalysts of Alzheimer amyloid formation. Neurobiol. Aging 22, 923–930. Rawlings, N.D., Morton, F.R., Kok, C.Y., Kong, J., and Barrett, A.J. (2008). MEROPS: the peptidase database. Nucleic Acids Res. 36, D320–325. Rubio, B.K., Parrish, S.M., Yoshida, W., Schupp, P.J., Schils, T., and Williams, P.G. (2010). Depsipeptides from a guamanian marine cyanobacterium, Lyngbya bouillonii, with selective inhibition of serine proteases. Tetrahedron Lett. 51, 6718–6721. Schechter, I., and Berger, A. (1967). On the size of the active site in proteases. I. Papain. Biochem. Biophys. Res. Commun. 27, 157–162. Schechter, N.M., Choi, E.J., Wang, Z.M., Hanakawa, Y., Stanley, J.R., Kang, Y., Clayman, G.L., and Jayakumar, A. (2005). Inhibition of human kallikreins 5 and 7 by the serine protease inhibitor lympho-epithelial Kazal-type inhibitor (LEKTI). Biol. Chem. 386, 1173–1184. Schultz, R.M., Varma-Nelson, P., Ortiz, R., Kozlowski, K.A., Orawski, A.T., Pagast, P., and Frankfater, A. (1989). Active and inactive forms of the transition-state analog protease inhibitor leupeptin: explanation of the observed slow binding of leupeptin to cathepsin B and papain. J. Biol. Chem. 264, 1497–1507. Scott, F.L., Sun, J., Whisstock, J.C., Kato, K., and Bird, P.I. (2007). SerpinB6 is an inhibitor of kallikrein-8 in keratinocytes. J. Biochem. 142, 435–442. Smith, M., Kocher, H.M., and Hunt, B.J. (2009). Aprotinin in severe acute pancreatitis. Int. J. Clin. Pract. 64, 84–92. Söllner, C., Mentele, R., Eckerskorn, C., Fritz, H., and Sommerhoff, C.P. (1994). Isolation and characterization of hirustasin, an antistasin-type serine-proteinase inhibitor from the medical leech Hirudo medicinalis. Eur. J. Biochem. 219, 937–943. Stoop, A.A., Joshi, R.V., Eggers, C.T., and Craik, C.S. (2010). Analysis of an engineered plasma kallikrein inhibitor and its effect on contact activation. Biol. Chem. 391, 425–433. Su, J., Tang, Y., Liu, L., Zhou, H., and Dong, Q. (2011). Regulation of acid-sensing ion channel 1a function by tissue kallikrein may be through channel cleavage. Neurosci. Lett. 490, 46–51. Sun, Z., and Yang, P. (2004) Role of imbalance between neutrophil elastase and alpha 1-antitrypsin in cancer development and progression. Lancet Oncol. 5, 182–190. Sulikowski, T., Bauer, B.A., and Patston, P.A. (2002). α1-Proteinase inhibitor mutants with specificity for plasma kallikrein and C1s but not C1. Protein Sci. 11, 2230–2236. Swedberg, J.E., de Veer, S.J., Sit, K.C., Reboul, C.F., Buckle, A.M., and Harris, J.M. (2011). Mastering the canonical loop of serine protease inhibitors: enhancing potency by optimising the internal hydrogen bond network. PLoS One 6, e19302. Swedberg, J.E., Nigon, L.V., Reid, J.C., de Veer, S.J., Walpole, C.M., Stephens, C.R., Walsh, T.P., Takayama, T.K., Hooper, J.D., Clements, J.A., Buckle, A.M., and Harris, J.M. (2009). Substrateguided design of a potent and selective kallikrein-related peptidase inhibitor for kallikrein 4. Chem. Biol. 16, 633–643. Swedberg, J.E., and Harris, J.M. (2011). Plasmin substrate binding site cooperativity guides the design of potent peptide aldehyde inhibitors. Biochemistry 50, 8454–8462. Teixeira, T.S., Freitas, R.F., Abrahao, O. Jr., Devienne, K.F., de Souza, L.R., Blaber, S.I., Blaber, M., Kondo, M.Y., Juliano, M.A., Juliano, L., and Puzer, L. (2011). Biological evaluation and docking studies of natural isocoumarins as inhibitors for human kallikrein 5 and 7. Bioorg. Med. Chem. Lett. 21, 6112–6115. Teno, N., Wanaka, K., Okada, Y., Taguchi, H., Okamoto, U., Hijikata-Okunomiya, A., and Okamoto, S. (1993). Development of active center-directed plasmin and plasma kallikrein inhibitors and studies on the structure-inhibitory activity relationship. Chem. Pharm. Bull. (Tokyo) 41, 1079–1090.

160

Joakim E. Swedberg, Simon J. de Veer, and Jonathan M. Harris

Tyndall, J.D., Nall, T., and Fairlie, D.P. (2005). Proteases universally recognize beta strands in their active sites. Chem. Rev. 105, 973–999. Ulmer, J.S., Lindquist, R.N., Dennis, M.S., and Lazarus, R.A. (1995). Ecotin is a potent inhibitor of the contact system proteases factor XIIa and plasma kallikrein. FEBS Lett. 365, 159–163. Wanaka, K., Okamoto, S., Bohgaki, M., Hijikata-Okunomiya, A., Naito, T., and Okada, Y. (1990). Effect of a highly selective plasma-kallikrein synthetic inhibitor on contact activation relating to kinin generation, coagulation and fibrinolysis. Thromb. Res. 57, 889–895. Wang, D., Bode, W., and Huber, R. (1985). Bovine chymotrypsinogen A X-ray crystal structure analysis and refinement of a new crystal form at 1.8 Å resolution. J. Mol. Biol. 185, 595–624. Wang, S.X., Esmon, C.T., and Fletterick, R.J. (2001). Crystal structure of thrombin-ecotin reveals conformational changes and extended interactions. Biochemistry 40, 10038–10046. Wolfenden, R. (1976). Transition state analog inhibitors and enzyme catalysis. Annu. Rev. Biophys. Bioeng. 5, 271–306. Wroblowski, B., Diaz, J.F., Schlitter, J., and Engelborghs, Y. (1997). Modelling pathways of alphachymotrypsin activation and deactivation. Protein Eng. 10, 1163–1174. Yousef, G.M., and Diamandis, E.P. (2000). The expanded human kallikrein gene family: locus characterization and molecular cloning of a new member, KLK-L3 (KLK9). Genomics 65, 184–194. Yousef, G.M. (2008). microRNAs: a new frontier in kallikrein research. Biol. Chem. 389, 689–694. Zablotna, E., Jaskiewicz, A., Legowska, A., Miecznikowska, H., Lesner, A., and Rolka, K. (2007). Design of serine proteinase inhibitors by combinatorial chemistry using trypsin inhibitor SFTI-1 as a starting structure. J. Pept. Sci. 13, 749–755.

David Deperthes, and Christoph Kündig

7 Kallikrein-related Peptidases as Pharmaceutical Targets 7.1 Introduction Proteases are enzymes that catalyze the breakdown of proteins by hydrolysis of peptide bonds. Analysis of the human genome has revealed the presence of over 500 proteases (2% of the genome). Whereas their primary role was long considered to be protein degradation relevant to food digestion, and intracellular protein turnover, it is now clear that proteases are at the center of numerous essential biological pathways. They are involved in processes such as cell-cycle progression, cell proliferation and cell death, DNA replication, tissue remodeling, hemostasis (coagulation), wound healing and the immune response.

Tab. 7.1 Selection of extracellular proteases targets with their corresponding potential therapeutic indication. Class

Protease

Serine proteases

Neutrophil elastase

Disease indication

chronic obstructive pulmonary disease (COPD), cystic fibrosis, emphysema Plasma Kallikrein Hereditary angiodema, chronic inflammation, asthma Hepsin Cancer progression; growth invasion and angiogenesis Matriptase Cancer progression; growth invasion and angiogenesis Cathepsin G Breast cancer metastasis Urokinase (uPA) Cancer progression; metastasis Metallo-proteases Angiotensin Converting Enzyme Hypertension, myocardial infarction (ACE) MMP-2, MMP-9, MMP-14 Cancer progression; growth invasion and angiogenesis Tumour necrosis factor alpha Cancer growth and development activating enzyme (TACE) Cysteine proteases Cathepsin B, Cathepsin L Cancer invasion; growth and angiogenesis, COPD and emphysema Cathepsin S Cancer invasion, growth and angiogenesis, auto-immune disorders and atherosclerosis Cathepsin K Tumor bone metastases, osteoporosis Aspartic proteases Viral proteases (including HIV) Viral infections Threonine proteases Proteasome Cancer growth and progression

162

David Deperthes, and Christoph Kündig

Protease activities during these processes are tightly controlled, and dysregulated proteolysis, or imbalance between proteases and anti-proteases, is recognized as a key factor in many pathologies. Inappropriate proteolysis has been linked to cancer as well as to cardiovascular, inflammatory, neurodegenerative, and infectious diseases. Because excessive proteolysis can be prevented by blocking the appropriate proteases, this area is under intense investigation by biotech and pharmaceutical companies (for examples see Tab. 7.1). Human kallikrein-related peptidases (KLKs) are involved in the regulation of multiple essential physiological processes. Dysregulation of these tightly-regulated proteolytic pathways leads to both neoplastic and non-neoplastic pathological conditions. In the case of different forms of cancer, multiple KLKs were found to be overexpressed and were linked to malignancy through tumor microenvironment modulating processes. KLK proteolytic activity in the skin plays an important role in desquamation, antimicrobial defense, and permeability. Dysregulation of these pathways causes serious skin inflammatory disorders including Netherton Syndrome, atopic dermatitis, or psoriasis.

7.2 KLK disease markers as potential therapeutic targets KLKs are expressed throughout the body, with several kallikreins usually being expressed in the same tissue, allowing their organization in enzymatic cascades (see Fig. 7.1). Whereas many serine proteases such as thrombin or plasma kallikrein are centrally produced and systemically active, tissue kallikreins are locally produced, i.e. tissue or even cell-type specific, and believed to be mostly locally active. The KLK protease family is associated with a broad range of physiological functions. Typical kallikrein substrates fall into a few categories, including growth factors and signaling molecules, extracellular matrix proteins, cell adhesion proteins, and cell surface receptors. Via precise cleavage of their protein substrates KLKs control key biological events, including apoptosis, cell proliferation and differentiation, extracellular matrix remodeling, and inflammation. The best-studied physiological roles of KLK cascades are in prostate biology and semen liquefaction, skin homeostasis and desquamation, and in the central nervous system. Only KLK1 plays a major systemic role in regulating blood pressure and platelet aggregation (see also Chapter 10, which is dedicated to KLK1). Like prostate or breast tissue, KLK gene expression is extraordinarily responsive to steroids and hormones. There is a clear, well documented association between KLK levels and processes associated with inflammation and cancer growth. The long list of biomarker applications (Tab. 7.2) demonstrates that dysregulation of KLKs is common in neoplastic diseases. Generally, more than one KLK is over-expressed, sug-

163

KLK1 KLK15 KLK3 KLK2 KLK4 KLK5 KLK6 KLK7 KLK8 KLK9 KLK10 KLK11 KLK12 KLK13 KLK14

Kallikrein-related Peptidases as Pharmaceutical Targets

adipocyte adrenal gland adrenal cortex appendix blood bone marrow brain brain – thalamus brain – hypothalamus colorectal carcinoma heart kidney liver lung brochial epithelium lymph node ovary pancreas pancreatic islets pituitary placenta prostate salivary gland skin smooth muscle spinal cord testis thymus thyroid tonsil trachea tonsil tongue uterus uterus corpus log intensity

1

2

3

4

Fig. 7.1 Specific gene expression (microarrays) of the 15 members of the tissue kallikrein family in 35 different healthy tissues (see Lawrence et al., 2010 for details). Expressions may vary in case of cancers.

Tab. 7.2 KLKs 2-15 over-expression in various types of cancer. Tissue kallikrein

Cancer

KLK2 KLK3 (PSA) KLK4 KLK5 KLK6 KLK7 KLK8 KLK9 KLK10 KLK11 KLK12 KLK13 KLK14 KLK15

Prostate Prostate Prostate, Ovarian, Lung Breast, Ovarian, Prostate, Testicular Renal, Ovarian, Colorectal, Gastric Renal, Breast, Intracranial, Pancreatic Ovarian, Lung Not known Breast, Ovarian, Colorectal, Head & Neck, Leukemia Lung, Ovarian, Prostate, Renal Lung Breast, Ovarian, Lung Prostate, Ovarian, Breast, Lung Breast, Ovarian, Prostate

164

David Deperthes, and Christoph Kündig

neurology (KLK6)

skin disease (KLK5, 7, 14)

KLKs prostate cancer (KLK2, 4, 14)

ovarian cancer (KLK6...)

pancreatic cancer (KLK7)

Fig. 7.2 Major KLKs involved in ovarian, pancreatic and prostate cancer, in skin diseases, and in neurological disorders.

gesting transcriptional regulatory mechanisms of groups of genes through common promoter regions. As reviewed by Oikonomopoulou et al. (2010), many KLKs have themselves direct hormonal properties, by signaling via proteinase-activated receptors (PARs), a family of G-protein-coupled receptors. Signals by PAR1, PAR2, and PAR4 regulate calcium release or mitogen-activated protein kinase activation, and lead to platelet aggregation, vascular relaxation, cell proliferation, cytokine release, and inflammation. Tumors and inflamed tissues can release increased amounts of active KLKs, which under non-pathological conditions are tightly regulated. Disruption of this delicate activation/inhibition balance contributes to the development and/or aggravation of cancer disorders. Inhibition of proteolytic activity is of particular therapeutic interest for drug developers active in the fields of prostate cancer (KLK2, KLK4, and KLK14) and ovarian cancer (mainly KLK5, KLK6, KLK8, and KLK10) or skin diseases (principally KLK5 and KLK7). The major therapeutic indications that could be tested with efficient KLK inhibitors are presented in Fig. 7.2.

Kallikrein-related Peptidases as Pharmaceutical Targets

165

7.3 KLKs in oncology 7.3.1 Prostate cancer The roles of KLKs in prostate cancer are described in detail in Chapter 4 of Volume 2 of this book. The two highly homologous genes KLK2 and KLK3 (PSA) are specifically expressed in the prostate under androgen control. The concentration of PSA in prostate tissue, seminal plasma and blood is about 100 times higher than KLK2 concentration (Deperthes et al., 1996; Lintula et al., 2005; Magklara et al., 1999). The amount of KLK2 transcripts, however, is between 10–50% of that of PSA transcripts (Ylikosky et al., 2001). This indicates that the two proteases differ in translation rates or protein stability and can be considered as independent potential biomarkers. KLK3 and KLK2 have been studied extensively as candidate biomarkers for benign and malignant prostatic diseases (Jansen et al., 2009; Ulmert et al., 2009). Early work on KLK2 as a potential prostate cancer marker was performed on tissue samples (Darson et al., 1999; Tremblay et al., 1997). These studies demonstrated increased KLK2-specific expression in lymphatic metastases and in high-grade tumors compared with well-differentiated tumors and benign tissue. PSA expression on the other hand was shown to be negatively correlated with tumor progression. These findings were confirmed by Herrala et al. (2001) showing that KLK2 was expressed at higher concentrations in prostate cancer samples than in benign prostate tissue, contrary to the PSA expression. With KLK2 but not KLK3 being amplified in prostate cancer tissue samples, they also offered an explanation for relative changes in their protein expression. Very similar data was published (Lintula et al., 2005) where the ratio of KLK2:PSA mRNA was shown to be significantly increased in cancer and especially in high-grade cancer samples. These findings on prostate samples suggest that increased expression of KLK2 and changes in relative expression of KLK2 vs. PSA are associated with carcinogenesis and progression. A recent study by Helo et al. (2009) measured circulating tumor cells (CTCs) in prostate cancer patients and showed that KLK2/3-expressing CTCs are common in men with castration-refractory prostate cancer and bone metastases, but are rare in patients with localized cancer. Whereas tumor expression of the serum marker PSA is not linked to disease progression, other KLKs including KLK2, 4 and 14 are considered promising drug targets, playing crucial roles in tumor microenvironment remodeling through activation of growth factors and membrane receptors, degradation of adhesion and extracellular matrix proteins of the surrounding prostatic stroma, and regulation of tumor associated inflammatory processes. KLK2 is a highly efficient enzyme that releases Insulin-like growth factor-1 (IGF-1), a major growth factor in cancer development, by hydrolysis of its regulatory IGF binding proteins (Réhault 2001). IGFs promote growth and survival of many types of tumor cells and epidemiological studies have implicated carcinogenesis, with high levels of IGFs in circulation or in tissues. The levels of IGF binding proteins (IGFBPs)

166

David Deperthes, and Christoph Kündig

have been associated with reduced risk for prostate and other cancers. Experimental studies have implicated high levels of IGF-1 directly, and IGFBP-3 inversely in prostate cancer growth, survival, and progression. Also, KLK2 can activate another growth factor pathway, the epidermal growth factor (EGF) receptor, by cross-activation of the B2 receptor via bradykinins (Barki-Harrington et al., 2001; Daaka, 2004; Deperthes et al., 1997). Besides direct activation, EGFR can cross-talk with either heterologous receptors activated by neurotransmitters, lymphokines, and stress inducers, or G-protein-coupled receptors. Bradykinin, agonist of B2 receptor, can be released from kininogen by KLK2 and exerts its effect on ERK activation via a protein kinase C and EGFR dependent pathway. KLK2 can enhance tumor invasion by degrading the extracellular matrix (ECM) basement membrane, in order to facilitate the penetration of surrounding connective tissues and blood vessels by tumor cells. Direct ECM protein cleavage (Deperthes et al., 1996), as well as activation of alternative proteases involved in ECM degradation, were suggested (Frenette et al., 1997; Mikolajczyk et al., 1999). Several studies showed activation of PSA by KLK2 in cell-free biochemical studies (Lövgren et al., 1997; Takayama et al., 1997). Williams et al. (2010) confirmed this hypothesis, using relevant cell-based in vitro, xenograft, and transgenic animal models. Of special interest might be the urokinase plasminogen activator (uPA) system. This process stimulates activation of extracellular proteases, including plasmin and metalloproteases, and promotes the release of various growth factors that are otherwise sequestrated by intact ECM. Also, uPAR interacts with cell adhesion and signal transduction through vitronectin and integrins. But KLK2 is not only capable of uPA activation, but was also shown to degrade the covalent uPA inhibitor protein PAI-1. All these processes confer growth and survival advantages to the tumor cells. Finally, KLK2 can activate PARs which promote tumor growth, invasion, and metastasis. It has been shown that PARs are overexpressed in prostate cancer samples and may serve as potential predictors of recurrence (Black et al., 2007; Kaushal et al., 2006; Tantivejkul et al., 2005). The potential role of PARs in autocrine and paracrine mechanisms of prostate cancer is supported by multiple in vitro studies, performed on prostate cancer cell lines. These experiments suggest PAR involvement in increased invasiveness (Black et al., 2007), survival, induction of IL-6, IL-8 and VEGF expression (Liu et al., 2006; Tantivejkul et al., 2005), or amplification of MMP-2 and MMP-9 production (Wilson et al., 2004). Interestingly, multiple reports indicate a clear link between prostatic inflammation reactions and the initiation and progression of prostate cancer. KLK4, analogous to KLK2, is expressed and hormonally regulated in the prostate and exhibits a higher expression level in prostate carcinomas, both at the mRNA and protein level (Klokk et al., 2007). KLK4 is suggested to have extracellular matrix remodeling properties, potentially facilitating local invasion and/or metastatic progression of carcinomas. Similar to KLK2, KLK4 can activate pro-PSA and single-chain urokinase-type plasminogen activator (Takayama et al., 2001), and recombinant

Kallikrein-related Peptidases as Pharmaceutical Targets

167

KLK4 was shown to degrade prostatic acid phosphatase (Takayama et al., 2001) and members of the insulin-like growth factor binding protein family (Matsumura et al., 2005). Interestingly, immunohistochemical data indicates a similar osteoblastic expression of the KLK4 protein in prostate cancer-mediated bone metastasis, suggesting a potential role of KLK4 in tumor progression (Gao et al., 2007). Furthermore, co-culture studies of the sarcoma osteogenic (SaOs)2 cell line with the prostatic LNCaP and PC3 cells suggest an association between KLK4 expression and the metastatic bone environment, thus reinforcing the proposed function of the protein. KLK4 is believed to function as a modulator of EMT (endothelial-mesenchymal transition) during prostate cancer progression, possibly through loss of E-cadherin and dysregulation of a number of cell cycle regulatory genes, including the positive regulators PCNA and Ki67, as well as the cell cycle inhibitors p15, p16, and p21 (Klokk et al., 2007; Veveris-Lowe et al., 2005). Recent evidence suggests an additional function of KLK4 in prostate cancer through activation of the protease-activated receptors (PARs) 1 and 2 and their downstream ERK signaling pathway (Ramsay et al., 2008). Accumulating evidence indicates a key role of KLK14 as an activator of KLK proteolytic cascades in the skin and seminal plasma (Brattsand et al., 2005; Emami et al., 2008; Yoon et al., 2007). Given the prostatic origin of the seminal KLK members of the cascade, aberrant activation of these KLKs as a result of overexpression and increased activity of the activator KLK14 may be instrumental in tumor initiation and/or progression in prostate cancer. KLK14 is also overexpressed in prostate cancer, although it is not detected at high levels in the prostatic tissue. As the protease acts upstream of KLK2, KLK3, and KLK4 in the proteolytic cascade, exaggerated activation of KLK14 may be instrumental in tumor initiation and/or progression in prostate cancer. In summary, it should be therapeutically interesting to inhibit the KLKs involved in prostate cancer progression. Rather than using a highly selective inhibitor against a single KLK protein, it might be necessary to block several key KLK proteins within the proteolytic cascade to achieve the required effect.

7.3.2 Ovarian and pancreatic cancer KLKs are expected to be linked to the pathobiology of several other cancers. Two of these potential indications for KLK inhibitors, namely ovarian and pancreatic cancer, are briefly introduced here, whereas other potential indications are discussed in more detail in other chapters of this book. KLK6 has been significantly correlated with a strong unfavorable outcome of ovarian cancer. Higher KLK6 tissue and serum concentrations are associated with aggressive phenotypes of the disease and significantly shorter disease-free survival and overall survival (reviewed in Borgoño and Diamandis, 2004). A unique N-gly-

168

David Deperthes, and Christoph Kündig

cosylation pattern of ovarian-derived KLK6 in ascites fluids was found to correlate significantly with ovarian cancer patient status and prognosis (Kuzmanov et al., 2009). The role of several other KLKs involved in ovarian cancer was described by Dorn et al. (2010). Primary tumor levels of serine proteases and KLKs, as well as of urokinase-type plasminogen activator (uPA) and its inhibitor PAI-1 impact disease course in ovarian cancer. The change in levels of these factors was associated with metastastic processes. Protein levels of seven tissue KLKs (KLK5-8, 10, 11, 13), uPA, and PAI-1 were determined in extracts of primary tumor tissue and corresponding omentum metastasis of 54 ovarian cancer patients. Higher levels of KLK5-8, 10–11, and uPA were associated with residual tumor >10 mm. Residual tumor and larger levels of KLK5-7, 10, and uPA were associated with disease progression in the whole cohort. Remarkably, higher level of KLK5-8 and 10–11 strongly impacted disease progression even in patients with residual tumor mass ≤10 mm; hence, the observed impact of increased KLK5-7 and 10 on disease progression was not simply attributable to their association with surgical success. Although detailed mechanistic knowledge on how the different KLKs influence ovarian cancer progression is still being investigated, tumor microenvironment interactions similar to those described for prostate cancer are suspected. Ovarian cancer currently has a poor prognosis, and treatments are essentially limited to surgery and chemotherapy. The data given above clearly suggests that there is room for the development of inhibitors that are able to block a series of KLKs involved in ovarian cancer. The prognostic potential of KLK6 and KLK10 expression was evaluated for pancreatic ductal adenocarcinoma patients (Paliouras et al., 2007). Co-expression of these two family members was found to correlate with shorter overall survival periods, thus underlining the unfavorable prognostic nature of elevated KLK6 and KLK10 for the majority of gastrointestinal malignancies. Johnson et al. (2007) reported that KLK7 enhances pancreatic cancer cell invasion by shedding E-cadherin. The authors demonstrated that KLK7 was overexpressed in pancreatic adenocarcinomas. In 70% of tumors examined (16/23), KLK7 was observed in neoplastic cells with moderate-to-intense staining. In contrast, only 15% of nonmalignant tissue specimens (2/13) displayed moderate KLK7 staining. Using in vitro assays, KLK7 was shown to cleave E-cadherin, and the soluble E-cadherin fragment produced significantly enhanced Panc-1 cell invasion through ECM proteins, with a corresponding reduction in Panc-1 cell aggregation. These results, combined with the strong KLK7 staining of the pancreatic tissue sections during the progression of the pre-malignant ductal lesions to invasive adenocarcinomas, clearly supports the prognostic value of KLK7 for pancreatic cancer, as well as the need for further clinical analysis (Ramani and Haun, 2008). There is an unmet need for therapies to treat pancreatic cancer, which currently is difficult to treat and has a very high mortality. The strong evidence of the prognostic

Kallikrein-related Peptidases as Pharmaceutical Targets

169

value of KLK6, 7, and 10 suggests the potential for a novel therapeutic approach in pancreatic cancer by inhibition of these proteases.

7.4 KLKs in inflammatory skin diseases 7.4.1 Kallikrein expressions and activities in skin The epidermis is composed of four layers: the stratum basale, the stratum spinosum, the stratum granulosum, and the stratum corneum. The primary function of the skin epidermis is to protect the organism from external insults and to prevent desiccation. To maintain this protective barrier, old corneocytes are continuously desquamated from the stratum corneum, which involves proteolysis of various structural and connective proteins. Human tissue kallikreins are secreted, with diverse expression patterns in the skin suggesting a functional involvement in different physiological and pathophysiological processes. KLK7, named stratum corneum chymotryptic enzyme (SCCE), and KLK5, the stratum corneum tryptic enzyme (SCTE), were isolated as the main serine proteases expressed in skin due to their involvement in corneocyte shedding (Brattsand and Egelrud, 1999; Egelrud and Lundstrom, 1991; Lundstrom and Egelrud, 1988; Lundstrom and Egelrud, 1991). KLK5 and KLK7 are expressed by keratinocytes, localized in lamellar granules and released to the extracellular space at the interface stratum granulosum / stratum corneum where they degrade corneodesmosomes, desmocollin 1 and desmoglein 1 (Borgoño et al., 2007; Descargues et al., 2006; IshidaYamamoto et al., 2005; Suzuki et al., 1996). Corneodesmosomes are intercellular junctions implicated in the cohesion of the stratum corneum. A model of the regulation of desquamation has been proposed, in which KLK5 activates KLK7 and triggers the enzymatic degradation of corneodesmosomes concomitant with skin desquamation. Caubet et al. (2004) analyzed the KLK7 and KLK5 “mode of action” and concluded that KLK7 directly cleaves the structural junctions corneodesmosin and desmocollin 1 and needs KLK5 to cleave desmoglein 1. Beside KLK5 and KLK7, multiple kallikreins are expressed in skin, KLK8 and KLK11 being the most abundant in adult and fetal skin (Komatsu et al., 2005; Komatsu et al., 2006a; Shaw and Diamandis, 2007). Activity profiling of epidermal kallikreins, using casein zymography analysis and chromogenic peptide substrates, has identified KLK5, KLK7, and KLK14 as major active KLKs (Brattsand et al., 2005; Stefansson et al., 2006). This indicates that less abundant KLKs in the SC may be catalytically more active. As activators of PARs, skin kallikreins potentially are also involved in the inflammation and pruritus aspects of skin disorders. KLK5 activates PAR-2 and induces the upregulation of molecules such as ICAM-1, TNF-a, TSLP and IL-8 expression which are important mediators of inflammation (Briot et al., 2009). This evidence suggests

170

David Deperthes, and Christoph Kündig

the implication of Lympho-epithelial Kazal-type-related inhibitor (LEKTI) deficiency in inflammation and activation of innate immunity through the KLK5 - PAR-2 activation signaling cascade, producing pro-inflammatory mediators (Briot et al., 2009). A recent study examined the effect of UVB irradiation on the expression of KLK5, KLK7, and LEKTI in human epidermal keratinocytes. UVB irradiation significantly reduced expression of SPINK5 encoding LEKTI and increased the expression of KLK5 and KLK7, which may contribute to desquamation of the stratum corneum and inflammation (Nin et al., 2009). It is known that hyperkeratosis and acanthosis occur in inflamed skin. Keratinocyte proliferation and differentiation play a crucial role in skin homeostasis and barrier function. KLK8 was proposed to be involved in such processes (Kishibe et al., 2007) and, more recently, it was shown that KLK8 secretion increased significantly upon calcium induction of terminal keratinocyte differentiation, suggesting an active role for this protease in upper epidermis (Eissa et al., 2011). This elevation takes place in the stratum spinosum during skin inflammation (Shingaki et al., 2010) and it would lead to an inhibition of transcription factor activator protein-2α (AP-2α) expression in the cells of the stratum basale and stratum spinosum. Then, it induces an increase of keratin 10 expression, cell proliferation in the stratum basale, and cell differentiation in the stratum spinosum. Another implication of KLK8 was identified in the proliferation and migration of keratinocytes through the upregulation and activation of KLK6 (Kishibe et al., 2012). The involvement of KLK8 overexpression in desquamatory and inflammatory skin disease conditions remains not completely clear, but it becomes more and more obvious that KLK8 must be considered as an important KLK and, consequently, a target of high interest like KLK5 and 7. Implication of kallikreins in skin desquamation disorders and the inflammation process supports the therapeutic targeting of skin kallikreins by the development of specific inhibitors.

7.4.2 Netherton Syndrome as most relevant clinical model In terms of current data, the most immediate indication for inhibitors of KLKs in dermatology is in the Netherton Syndrome (NS), a very rare autosomal recessive disease. The Netherton Syndrome is characterized by a broad skin phenotype, including severe ichthyosis, specific hair shafts (“bamboo hair”) and atopic skin manifestations with high levels of IgE. This syndrome is associated with high postnatal mortality. Adult patients present atopic-dermatitis symptoms with scaling and erythroderma. Severity of the phenotypes is correlated to serine protease hyperactivity and is inversely correlated with LEKTI residual activity (Komatsu et al., 2008). The genetic origin of the Netherton Syndrome lies in mutations of LEKTI, leading to a truncated, non-functional inhibitor (Chavanas et al., 2000; Komatsu et al., 2008). Significant high levels of KLKs were found in the stratum corneum and serum of

Kallikrein-related Peptidases as Pharmaceutical Targets

171

NS patients (Komatsu et al., 2008). Descargues et al. (2005) demonstrated the link between unregulated activity of skin proteases such as KLK5 and KLK7, uncontrolled desquamation, and NS phenotype in a knock-out mouse model of SPINK5. Recently, it has been shown that LEKTI is a potent inhibitor of KLK5, KLK7, and KLK14 through a pH-dependent interaction and that it regulates skin desquamation (Deraison et al., 2007). In the deep stratum corneum, the neutral pH favors the interaction between LEKTI and kallikreins, whereas the acidic pH in the stratum corneum will reduce this interaction, allowing the controlled activation of skin kallikreins. Active skin kallikreins will then degrade corneodesmosomes and trigger desquamation. In NS patients, PAR-2 has been shown to be activated by KLK5 and KLK14, but not by other highly expressed KLKs such as KLK7 and KLK8 (Stefansson et al., 2008). Recently, a direct in vivo link of KLK5-mediated inflammation through PAR-2 has been described in human NS xenotransplantation onto nude mice. This xenograft presented a skin atopic dermatitis phenotype and the deficiency in LEKTI led to KLK5 hyperactivity. Finally, involvement of kallikreins in NS was recently linked to another class of protease called matriptase. A matriptase-pro-kallikrein pathway could take place in the pathogenic process, as was shown in a LEKTI-deficient mouse model with a premature activation of a pro-kallikrein cascade (Sales et al., 2010).

7.4.3 Atopic dermatitis, the potential major indication for kallikrein targeting Deregulated skin KLK expression has also been shown in patients suffering from atopic dermatitis. This chronic inflammatory disease is associated with changes in stratum corneum function and structure. Like NS, atopic dermatitis presents skin features such as scales, ichthyosis, and erythroderma. High IgE levels are also found in atopic dermatitis patients. Atopic dermatitis might also involve LEKTI, as SPINK5 single nucleotide polymorphisms have been described as associated with the disease (Kato et al., 2003; Walley et al., 2001). Moreover, increased expression of skin kallikreins in the stratum corneum and serum has been found in patients with atopic dermatitis (Komatsu et al., 2007a). Immunostaining and expression studies on normal skin and atopic skin indicated the co-expression of KLK7 and LEKTI within the stratum corneum and at the stratum corneum / stratum granulosum junction only in normal skin sections (Roelandt et al., 2009). Atopic skin presented elevated expression of KLK7 in the stratum corneum and LEKTI localization deeper in the stratum corneum with no co-localization. suggesting an imbalance that could lead to the unregulated desquamation seen in such a disease (Roelandt et al., 2009; Voegeli et al., 2009). Finally, PAR-2 is upregulated in keratinocytes of patients with atopic dermatitis and is co-localized with human tissue kallikreins. These data suggest common mechanisms in atopic dermatitis and NS, and emphasizes the role of controlled serine protease activity in maintenance of skin barrier integrity.

172

David Deperthes, and Christoph Kündig

7.4.4 Psoriasis and relevance of kallikreins Psoriasis is a chronic autoimmune disease. Five forms of psoriasis are described, the most common being psoriasis vulgaris. Psoriasis vulgaris is characterized by red patches and scales. At the cellular level, psoriasis is characterized by epidermal inflammation, hyperplasia, abnormal keratinocyte differentiation, and chronic neutrophil and T-cell infiltrates. Aberrant levels of skin kallikreins were found in the stratum corneum and serum of patients with psoriasis (Komatsu et al., 2005 and 2007b), suggesting that kallikreins might be involved in this disease. Aberrant kallikrein expression was shown to be dependent on phenotype, severity, and applied therapy of psoriasis. KLK6, KLK10, and KLK13 levels were significantly elevated even in the non-lesional stratum corneum, whereas KLK7 serum levels did not differ between normal volunteers and patients with psoriasis. Serum KLK6, KLK8, KLK10, and KLK13 levels in patients with untreated psoriasis significantly correlates with the clinical Psoriasis Area and Severity Index score. After therapy, serum KLK5 and KLK11 levels decreased in patients with psoriasis.

7.4.5 Other potential skin disorders with kallikrein involvement In addition to the best-understood kallikrein skin disease NS and the two major skin disorders atopic dermatitis and psoriasis, KLKs were linked to another skin disease, called peeling skin syndrome type B (PSS-type B, MIN 270300). This syndrome is a congenital skin disease associated with continual skin peeling and ichthyotic erythroderma. In the stratum corneum of these patients, all KLK concentrations studied by ELISA were dramatically higher than those in the normal samples. In the serum of the patients, concentrations of KLK6, 7, 8, 10, and 13 were significantly elevated (Komatsu et al., 2006b). Recently, Oji et al. (2010) used three-dimensional human skin models to study generalized peeling skin disease and showed that KLK5 was elevated in patient models and that its expression was broadened in the epidermis. They demonstrated that lack of corneodesmosin causes an epidermal barrier defect that is supposed to account for the predisposition to atopic diseases, and they confirmed the role of corneodesmosin as a decisive epidermal adhesion molecule (Oji et al., 2010). More common, rosacea is a skin disease that also exhibits unique inflammatory responses to normal environmental stimuli. The high level of KLK5 in rosacea was shown to be related to Toll-like receptor 2 (TLR2) overexpression (Yamasaki et al., 2011). Cathelicidin, which acts as an innate antibiotic and as an immunomodulator in the skin, is activated by KLK5 and KLK7. The cathelicidin LL-37 and its proteolytic peptide fragments, having an inflammatory activity as host-defense peptide, seem to be generated by KLK5 activity (Meyer-Hoffert et al., 2011; Morizane et al., 2010). Thus, the two main skin kallikreins, KLK5 and KLK7, are suggested to have a negative impact in rosacea.

Kallikrein-related Peptidases as Pharmaceutical Targets

173

There is no doubt that kallikreins play an important role in the pathology process of many skin disorders. If KLK5 by its upstream involvement seems to be essential, KLK7 and probably KLK8, 11, and 14 must be considered of high interest to the understanding of skin pathophysiology.

7.5 KLKs in neurological disorders 7.5.1 Alzheimer’s disease and dementia As reported by Ashby et al. (2010), KLK6 is highly expressed in the central nervous system. Although the physiological roles of KLK6 are largely unknown, in vitro substrates include amyloid precursor protein and components of the extracellular matrix, which are altered in neurological disease, particularly Alzheimer’s disease. These authors compared KLK6 expression in post-mortem brain tissue in patients with Alzheimer’s disease, vascular dementia, and control groups. For Alzheimer’s disease they found KLK6 protein and mRNA levels to be significantly decreased in the frontal, but not the temporal cortex. In vascular dementia, KLK6 protein level was significantly increased in the frontal cortex. Their findings thus suggest that an altered KLK6 expression may contribute to vascular abnormalities in Alzheimer’s disease and vascular dementia. These results are confirmed by reports reviewed by Goettig et al. (2010). KLK6 and KLK8 (also termed neurosin and neuropsin, respectively) are highly expressed in the brain. KLK6 accumulates at cerebral lesions in humans, and investigations in mice suggest that excessive KLK6 activity causes inflammation of the central nervous system and promotes multiple sclerosis through demyelinating activity. The physiological role of KLK6 seems to be both de- and re-myelination of glial cells, thus contributing to neurite and axon growth after injuries. In contrast, KLK8, which is mostly expressed in adults in the hippocampus, is involved in long term potentiating and memory acquisition through restructuring synapses, as shown by Yoshida (2010) in mouse models. Furthermore, in human brains with Alzheimer’s disease, a more than 10-fold increased expression of KLK8 was observed, and single nucleotide polymorphisms in the human KLK8 gene are associated with manic-depressive disorder and cognitive impairment.

7.5.2 Multiple sclerosis (MS) In MS patients, serum levels of KLK1 and KLK6 are elevated, with the highest levels associated with secondary progressive disease (Scarisbrick et al., 2008). Elevated KLK1 correlates with higher disease scores at the time of serum draw and KLK6 with future disease, worsening in relapsing, remitting patients. Supporting the concept

174

David Deperthes, and Christoph Kündig

that KLK1 and KLK6 promote degenerative events associated with progressive MS, exposure of murine cortical neurons to either kallikrein promoted rapid neurite retraction and neuron loss. These findings suggest that KLK1 and KLK6 may serve as serological markers of progressive MS and contribute directly to the development of neurological disability by promoting axonal injury and neuron cell death. This data suggests that KLK inhibitors could be of potential therapeutic use both for Alzheimer’s disease and for multiple sclerosis. A KLK6 inhibitor that is designed to pass the blood brain barrier would be of particular interest for both indications.

7.6 Kallikrein inhibitors to treat human diseases A series of natural endogenous inhibitors that target distinct KLKs have been identified (see Goettig et al., 2010 for review). Among them are Zn2+ ions, active site-directed proteinaceous inhibitors, such as serpins and the Kazal-type inhibitors, or the large, non-specific compartment-forming α2 macroglobulin. Failure of these systems can lead to various pathological conditions. Molecular, cellular, and in vivo analyses have linked excessive kallikrein activity to various tumor and inflammation-related pathways stimulating disease progression. Down-regulation of excessive KLK activity, principally in cancer and in skin diseases, represents an attractive therapeutic approach.

7.6.1 Design of KLK inhibitors and clinical development The development of kallikrein inhibitors can be achieved with different objectives. For instance, research requires inhibitory molecules to aid understanding of target roles, and their selectivity will be the first driver of its development strategy. Often, such developments do not consider two other essential properties of a therapeutic compound, which are the potential toxicity and the industrialization of the compound. Recent progress in bio-informatics and in 3-D protein structure analysis has opened new horizons to the design of novel specific chemical inhibitors. If toxicity rarely is a bottleneck for in vitro experiments, it becomes a crucial concern as soon as experimentation moves to animal or human. Indeed, this modern approach often leads to active chemical molecules, but with high toxicity and/or limited efficacy in patients. This has resulted in a high number of failures, notably with MMP inhibitors, in clinical trials or after the approval of the product (Dorman et al., 2010). Almost all natural inhibitors of endogenous proteases that operate as essential regulators of a wide variety of biological processes are proteins or fragment of proteins. Thus it appears at least rational that the use of such natural modulators, which mimic a protease’s physiological inhibition, must represent a non-negligible part of drug development approaches.

Kallikrein-related Peptidases as Pharmaceutical Targets

175

Biological protease inhibitors such as serpins or cysteine protease inhibitors often show better safety profiles, more efficacy and a longer half-life than chemical inhibitors. On the other hand, their manufacture can become an unsolvable challenge, due to the low yield of production or the higher cost to get large quantity in comparison to chemical compounds. We can nevertheless observe a drastic decrease in the cost of production upscaling, and the cost of goods will be less and less of a limitation (Basu et al., 2011; Shukla et al., 2010). Another critical issue lies in the stability of recombinant molecules, since such inhibitors usually possess complex and sophisticated structures, with specific folding and disulfide bridges that trigger their inhibitory activity. Therefore, the system of production shall encompass all industrialization requirements, which will define the cost of goods and the potential future in a competitive market. Another crucial concern for biologics arises from their potential immunogenicity (Chirmule et al., 2012). The early appraisal of the immunogenicity risks of a recombinant therapeutic protein is of key importance to its successful development. It includes the choice of the recombinant system that will trigger the post-translational modifications, the bioprocess to get the active form (e.g. refolding, activation step), and the production yield. For peptidic inhibitors, industrialization is less of an issue if the length of the peptide is short or if non-natural or modified amino acids are not predominant in the sequence. They can be produced synthetically in large quantities, at low cost. Moreover, the GLP production (good laboratory practice, i.e. quality requirements for preclinical trials) can be made within few weeks, whereas several years can be mandatory for getting GMP (good manufacturing practice) batches of therapeutic proteins. Another important advantage of peptides resides in their simple structure and small size, which help them to elude the immune system and prevent a reaction of the organism after repeated treatment. Various problems encountered with peptidic drugs, such as their short half-life, which makes it difficult for them to reach their target, have hampered their clinical success. The development of new delivery systems is expected to open new opportunities in the near future (McGonicle et al., 2012; Svensen et al., 2012). For dermatology disorders treatments will probably be performed with a topical application of peptides, thus overcoming delivery problems. Development of KLK inhibitors must be inspired by successful clinical and commercial experiences. For example, the angiotensin-converting enzyme (ACE) inhibitors, which have been on the market for more than 20 years, are widely used for the treatment of cardiovascular conditions, including hypertension, heart failure, and heart attack. Inhibitors of the HIV protease are another well-known example, proving how proteases can be successfully exploited as drug targets.

176

David Deperthes, and Christoph Kündig

7.6.2 KLK inhibitors in oncology Besides dermatology, oncology indications, mainly prostate cancer, which has been extensively described in thousands of articles during the last 30 years, appear very attractive for application of the kallikrein targeting concept. Recently, first human clinical trials were initiated by Med Discovery, using a biologic inhibitor developed against KLK2, with strong cross-reactivity towards KLK4 and KLK14. Med Discovery has developed the engineered serpin-type inhibitor MDPK67b by replacing the reactive center loop of human α1-anti-chymotrypsin (ACT) with a KLK2 cleavage site (Cloutier et al., 2004). Among natural protease inhibitors, serpins act through a unqiue mechanism. These protease inhibitors present a peptidic sequence as bait on an easily accessible loop (RCL, reactive center loop), which serves as substrate for a specific protease or class of proteases. Once the protease cleaves within the RCL, a covalent serpin-protease complex is formed. This serpin cleavage induces irreversible inactivation of both serpin and protease. The inhibitory specificity of serpins is mostly attributed to the nature of the RCL loop, i.e. the residues flanking the cleavage site. Modifications of the RCL of ACT have been performed in order to change the specificity and potency of this inhibitor. ACT, an acute phase serum glycoprotein, is the main inhibitor of cathepsin G and chymases and of KLK2 in the blood circulation. Peptide sequences, selected by phage display technology as substrates for the enzyme KLK2, have been used to replace amino acid residues of the RCL to create a panel of KLK2 inhibitors. The lead candidate MDPK67b shows strong in vitro inhibition selectivity towards KLK2 (Tab. 7.3), 4 and 14 when compared to other unrelated serum proteases (Tab. 7.4 and 7.5). Using a cell based assay, MDPK67b was able to block PAR2 activation in a dose-dependent manner. To investigate in vivo effects of KLK2 levels and its blockage of prostate cancer tumor growth, MDPK67b was tested in a mouse xenograft model. DU145 human prostate tumor cells were stably transfected to express KLK2. KLK2 level in this model was shown to be comparable to the reported serum level in patients with prostate cancer (Black et al., 1999; Väisänen et al., 2004), supporting the validity of the in vivo model. The model provides some biologically relevant evidence of the involveTab. 7.3 Kinetic KLK2 inhibition parameters of ACT, PCI and MDPK67b. Stoichiometry of inhibition (SI values) describes the number of inhibitor molecules that are needed to inactivate one protease molecule, k′ constant values quantify the reaction velocity as a second order rate constant. Inhibitor

S.I. value

K′ constant (M–1 s–1)

Alpha-1-Antichymotrypsin Protein C Inhibitor – PCI MDPK67b

N.D. 2.9 1.9

N.D. 80000 97000

N.D.: Not Determinable

Kallikrein-related Peptidases as Pharmaceutical Targets

177

Tab. 7.4 Inhibition profile of MDPK67b against various proteases. Those KLKs marked in bold are likely to be involved in cancer progression and completely inhibited by MDPK67b. The SI values (stoichiometry of inhibition) were determined only when complete inhibition (100%) was achieved (see table below). Enzyme

% inhibition

KLK1 KLK2 KLK3 KLK4 KLK5 KLK6 KLK7 KLK8 KLK13 KLK14 Human Neutrophil Elastase Plasma Kallikrein Thrombin Plasmin Urokinase Factor Xa Factor XIa

0 100 50 100 100 68 81 82 37 100 3 38 0 95 0 0 10

ment of KLK2 overexpression in prostate cancer progression, since KLK2 expression was found to encourage implantation of a higher proportion of grafted tumor cells (Fig. 7.3) and more rapid tumor growth, compared to non-KLK2-expressing control cells. The same DU145-KLK2 mouse model was also used for proof-of-principle studies on the effectiveness of MDPK67b in the treatment of prostate cancer. Various doses of MDPK67b, wild type ACT, and vehicle buffer were injected subcutaneously in animals with palpable tumors. Tumor growth was found to be significantly reduced in a dosedependent manner by up to 90% at the end of treatment, when comparing individuals treated with the highest dose of MDPK67b (5mg/kg) to the control group (Fig. 7.4). During preclinical and non-clinical testing, MDPK67b showed a very favorable toxicity profile. The safety profile of the drug candidate was tested in rodent and primate animal models. Final, pivotal toxicity studies were carried out exclusively in Tab. 7.5 Stoichiometry of inhibition (SI value) for proteases completely inhibited by MDPK67b. Protease

SI value

KLK2 KLK4 KLK5 KLK14

2.1 1.7 5.1 1

David Deperthes, and Christoph Kündig

100

50

size of tumor (mm3)

% of mice with tumor

178

~ 80 %

~ 30 %

0 DU145 WT

300 200 100 0

DU145-hK2

DU145 WT

DU145-hK2

Fig. 7.3 Effect of KLK2 expression on tumor growth (DU145 transfected with active KLK2) in xenograft nude mice model.

tumor size (mm3)

control ACT wt 5 mg/Kg

2000

MDPK67 0.2 mg/Kg MDPK67 2 mg/Kg MDPK67 5 mg/Kg

1500

prostate tumor

1000 500 28

32

34

40

42

46

48

day post tumor inoculation

Fig. 7.4 Inhibitory growth effect of MDPK67 recombinant inhibitor (subcutaneous injection every 2 days for 30 days) on human prostate tumor growth (DU145-KLK2) in a xenograft nude mice model.

KLK2 ng/g (TP) KLK3 ng/g (TP)

1.0E+08 1.0E+07 1.0E+06 1.0E+05 1.0E+04 1.0E+03 1.0E+02 1.0E+01 1.0E+00 rhesus prostate extract

cynomolgus prostate extract

human prostate extract

Fig. 7.5 Comparison of KLK2 and KLK3 expression in primate and human prostate tissues.

Kallikrein-related Peptidases as Pharmaceutical Targets

179

cynomolgus monkeys, as expression of kallikreins is very species-specific, and nonprimate models are considered appropriate only to test non-specific, off-target effects of the molecule (Fig. 7.5). The study was completed and no signs of treatment-related effects were observed in standard pharmacology, hematology, blood biochemistry, urinalysis and pathology examinations. Also, no immunogenicity of the drug was observed during the repeat dose treatment period. Furthermore, no interference was observed of MDPK67b with proteases involved in blood coagulation, when its effect on the extrinsic, intrinsic and common pathways was analyzed in clinical human blood samples. Doses of up to 1 mg/ml in human blood did not influence prothrombin time, activated partial thromboplastin time and thrombin time. First-in-man trials were initiated by Med Discovery in healthy volunteers to evaluate its safety in humans and gain deeper insight into the pharmacokinetic and pharmacodynamic parameters of the drug candidate. These studies will open the door to clinical proof-of-concept studies, which are in planning for asymptomatic hormoneresistant prostate cancer treatments with rising PSA.

7.6.3 KLK inhibitors in dermatology The development of inhibitors for kallikreins in the field of dermatology was largely based on natural inhibitors of skin kallikreins, i.e. serine protease inhibitors of the Kazal-type (SPINK) family. The main challenge with this type of protein inhibitors is inherent in its very complex structures. A typical Kazal domain requires three intramolecular disulfide bonds for correct folding and activity. LEKTI possesses 15 of these Kazal domains, which makes it very complicated to produce it in a recombinant system. Different domains (6 and 13) or fragment of domains (fragments of domains 6–8 and 9–12) of SPINK5 (LEKTI) have already been produced recombinantly at the laboratory scale (Schechter et al., 2005; Vitzithum et al., 2008) and exhibit different inhibitory profiles. A recombination of those domains will remain a challenge in industrial manufacturing, and a significant immunogenicity risk cannot be avoided, due to the non-human junctions between domains which are usually highly immunogenic. On the other hand, a cocktail of these recombinant domains would have a very low chance to reach the market, because multiple clinical trials (for a combination of different new compounds) will be required and the cost of development will be not affordable. Unlike LEKTI, SPINK6 has only one typical Kazal domain and was recently produced in a yeast recombinant system (Jayakumar et al., 2004; Lu et al., 2012). It could represent an alternative to LEKTI and its 15 domains for therapeutic development, even if its inhibitory spectrum is limited to KLK5, 7, and 14, while it cannot inhibit KLK8 (Meyer-Hoffer et al., 2010). Other strategies of KLK inhibition were recently described by using doxycycline, which can prevent activation of kallikreins potentially through

180

David Deperthes, and Christoph Kündig

MMPs inhibition (Kanada et al., 2012) or isocoumarin compounds inhibiting KLK5 and KLK7 (Teixeira et al., 2011). The development of inhibitors for kallikreins for the field of dermatology has recently taken a new step, with two compounds currently in clinical development for NS and atopic dermatitis. Novartis has developed a cyclic depsipeptide to inhibit KLK7 (Goettig et al., 2010) for targeting only one kallikrein, while Dermadis has used a serpin backbone to build a multi-specific inhibitor to create a kallikrein cascade blocker. This inhibitor is a biological product, also known as DM107, which displays antitrypsin-like and also antichymotrypsin-like activities. It can inhibit KLK5, 7, 8, and 14 and it was postulated that this engineered protein could counterbalance LEKTI deficiency. Topical formulations are seen as the best approach to dermatologic applications, as it favors direct delivery of the drug at its site of action in the skin. Such a formulation needs to be designed for sustained release of active drug and for delivery that crosses the epidermal skin barrier. Stratum corneum barrier function in healthy skin means that only low molecular weight lipophilic molecules ( A; c.458G > A; p.W153X), have been characterized (Hart et al., 2004; Wright et al., 2011). The dental enamel was hypomineralized and pigmented, with no phenotype besides the enamel. Mutation analyses were performed on KLK4, because it was known to be expressed and secreted during the maturation stage of amelogenesis (enamel formation). The matrix metalloproteinase 20 gene (MMP-20; 11q22.2) encodes another secreted protease, expressed during tooth development. Mutations in both alleles of MMP-20 cause amelogenesis imperfecta, hypomaturation-type IIA2 (AI2A2; OMIM # 612529), a recessive condition similar to that caused by KLK4, also with no disease phenotype outside of the dentition (Kim et al., 2005; Lee et al., 2010; Ozdemir et al., 2005; Papagerakis et al., 2008; Wright et al., 2011). Klk4 (Simmer et al., 2009) and MMP-20 (Caterina et al., 2002) null mice both show significant enamel malformations in the absence of systemic conditions. Because humans and mice that lack KLK4 and MMP-20 genes only show an enamel phenotype, it is evident that their gene products are functionally specific for dental enamel formation, although the expression of both genes can be detected in other tissues. The tissue specificity of Klk4 expression has recently been explored using Klk4 knockout/lacZ knockin mice (Simmer et al., 2011b).

11.5 Klk4lacZ/lacZ mice In Klk4 knockout mice, the Klk4 coding region was replaced with an NLS-lacZ reporter. NLS-lacZ encodes bacterial β-galactosidase with a mouse nuclear localization signal (NLS). Klk4 was knocked out and NLS-lacZ was knocked in. The Klk4 5ʹ promoter region was not disturbed up to the translation initiation codon in exon 2,

298

James P. Simmer, Yuanyuan Hu, Amelia S. Richardson, and Jan C.C. Hu

and remained in place in its context on chromosome 7 (Simmer et al., 2009). In these mice, β-galactosidase (β-gal) is expressed from the Klk4 promoter in place of KLK4 and localizes within the nucleus. Nuclear-localized β-galactosidase activity serves as a sensitive and specific marker for normal KLK4 gene expression. Tissues that express the NLS-lacZ reporter are detected on cryosections incubated at pH 8 with β-gal substrate (X-gal), which is converted into an indigo product that stains the nucleus blue. Mammals also express β-galactosidase, but the endogenous enzyme localizes within lysosomes and has a lower pH optimum than the bacterial enzyme. Endogenous expression is readily distinguished from Klk4-driven NLS-lacZ expression by checking for the presence of blue staining in negative controls (wild-type mice) and for nuclear/non-nuclear localization of the blue stain. The expression of Klk4 in developing mouse teeth was extensively characterized by in situ hybridization (Hu et al., 2000a and b; Hu et al., 2002; Simmer et al., 2004), which demonstrated that Klk4 is specifically expressed by ameloblasts (enamel forming cells) in the later (maturation) stage of amelogenesis, but not in the earlier

KLK4 lacZ/lacZ

wild type

day 5

day 5 KLK4 lacZ/lacZ

wild type

day 7

day 7 KLK4 lacZ/lacZ

wild type

day 14

day 14

Fig. 11.1 Klk4 expression in day 5, 7, and 14 maxillary first molars (mouse). Wild-type sections from maxillary first molars in the secretory stage (day 5), in the secretory stage cervically and maturation stage near the cusp tips (day 7), and maturation stage (day 14) are shown in the left column. Comparable sections from Klk4 null mice (Klk4lacZlacZ) are shown in the right column. No blue staining was observed in the wild-type sections, demonstrating an absence of background staining in these sections. Klk4-driven β-gal expression was observed near the cusp tips of day 7 maxillary first molars. By day 14 Klk4 expression extended throughout the ameloblast layer. Red counterstaining of enamel proteins was absent in day 14 wild-type enamel (the enamel proteins were degraded and removed in the presence of Klk4), but persisted in the day 14 Klk4 null mice shortly before eruption into the oral cavity. Key: Am, ameloblasts; E, enamel; D, dentin; Od, odontoblasts; P, pulp. Bars = 100 μm. This figure is adaped from Fig. 1 of Simmer et al. (2011b).

Role of KLK4 in Dental Enamel Formation

299

(secretory) stage. Klk4 expression, detected by X-gal histochemistry in Klk4lacZ/lacZ mice, showed the same ameloblast specificity as by in situ hybridization (Simmer et al., 2011b) (Fig. 11.1). The specificity of X-gal histostaining resolved a question as to whether or not odontoblasts (dentin forming cells) expressed Klk4 (they did not)

a

b

c

Fig. 11.2 Klk4 driven β-gal expression in developing molars, prostate, and salivary gland in Klk4lacZ/lacZ null mice. Cryosections of a day 14 maxillary first molar (a), and 1-year prostate (b) and 1-year submandibular gland (c) were incubated with X-gal at pH 8 for 5 h. Age-matched sections of comparable wild-type tissue did not show endogenous β-gal staining (data not shown). (a) The maxillary molar section, which is in the late maturation stage, shows strong and specific staining in the maturation stage ameloblasts lining the enamel extracellular space. Enamel proteins, normally reabsorbed by this point, counterstained red and are retained in the enamel, due to the absence of Klk4 activity in the knockout. (b) Most of the prostate tissue was negative for Klk4 expression, but a small patch (arrow) of prostate epithelia displayed weakly positive nuclei, indicative of trace Klk4 expression (boxed area is shown at higher magnification on the right). (c) In the submandibular salivary gland the intralobular (striated) ducts showed positive nuclei, indicating low but detectable Klk4 expression (boxed area is shown at higher magnification on the right). Scale bars: a, b (left) and c (left) = 200 μm; b (right) and c (right) = 50 μm. This figure is adaped from Fig. 3 of Simmer et al. (2011b).

300

James P. Simmer, Yuanyuan Hu, Amelia S. Richardson, and Jan C.C. Hu

and secreted it through their long processes into the inner enamel near the dentino enamel junction (Fukae et al., 2002; Simmer et al., 2011a). Klk4lacZ/lacZ mice were used to assay Klk4 expression in developing teeth, adult prostate, liver, kidneys, submandibular salivary glands, ovaries, testis, vas deferens, and epididymis (Simmer et al., 2011b). The non-dental tissues were examined in 1-year-old mice. No Klk4 expression was observed in the adult liver, kidneys, testis, vas deferens, and epididymis. Maturation ameloblasts showed strong expression of Klk4 (Fig. 11.2a). Weak expression was observed in the striated ducts of the submandibular salivary gland (Fig. 11.2c) and only trace expression was detected in the prostate (Fig. 11.2b). Except for developing teeth, which showed retention of enamel proteins and hypomineralized enamel, no pathology or developmental abnormalities were observed in any of the examined tissues.

Tab. 11.1 Human EST profiles listed in the UniGene database at the National Center for Biotechnology Information (NCBI), by body site, for KLK1 (Hs.123107), KLK2 (Hs.515560), KLK3 (Hs.171995), KLK4 (Hs.218366), KLK5 (Hs.50915), and glyceraldehyde-3-phosphate dehydrogenase GAPDH (Hs.544577). The numbers in the ESTs column show the total number of ESTs submitted for each tissue. The EST levels of KLKs vary significantly, but are all much lower than GAPDH, except for KLK2 and KLK3 EST levels found in the prostate. KLK4 has only 30 transcripts listed, with prostate accounting for all but six. Total numbers of ESTs for KLKs totals not listed in the table are KLK6 (Hs.79361) = 211; KLK7 (Hs.151254) = 78, KLK8 (Hs.104570) = 28; KLK9 (Hs.448942) = 2; KLK10 (Hs.275464) = 129; KLK11 (Hs.57771) = 75; KLK12 (Hs.411572) = 2; KLK13 (Hs.165296) = 20; KLK14 (Hs.283925) = 2; KLK15 (Hs.567535) = 3. Tissue

KLK1

KLK2

Adipose tissue Adrenal gland Ascites Bladder Blood Bone Bone marrow Brain Cervix Connective tissue Ear Embryonic tissue Esophagus Eye Heart Intestine Kidney Larynx Liver Lung

0 0 1 3 0 2 0 0 0 1 0 0 0 0 2 4 21 0 0 0

0 0 0 0 0 15 1 0 0 0 0 0 0 0 0 0 0 0 0 1

KLK3 0 1 0 0 0 21 12 6 0 0 0 0 0 0 0 1 0 0 0 0

KLK4

KLK5

GAPDH

0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0

0 0 0 0 0 0 0 0 1 0 0 0 0 0 4 0 4 0 0 1

5 71 73 59 336 122 36 1638 284 69 1 1033 22 686 119 517 419 119 428 1321

ESTs 13106 33188 40008 29752 123497 71655 48795 1101041 48157 149266 16211 215684 20203 211048 89594 234425 211788 24138 207692 336992

301

Role of KLK4 in Dental Enamel Formation

Tab. 11.1 (continued) Tissue

KLK1

KLK2

KLK3

KLK4

KLK5

GAPDH

ESTs

Lymph Lymph node Mammary gland Mouth Muscle Nerve Ovary Pancreas Parathyroid Pharynx Pituitary gland Placenta Prostate Salivary gland Skin Spleen Stomach Testis Thymus Thyroid Tonsil Trachea Umbilical cord Uterus Vascular

0 0 0 0 0 0 1 29 0 0 0 0 0 4 1 0 0 0 0 2 2 0 0 0 0

0 0 0 0 3 21 0 0 0 1 0 0 584 0 0 0 0 4 0 0 0 0 0 0 0

0 0 227 0 10 27 0 0 0 0 0 0 1095 2 0 0 0 0 0 0 0 0 0 0 0

0 0 0 0 0 0 0 0 0 0 0 0 24 0 0 0 0 0 0 0 0 0 0 4 0

0 14 1 2 0 0 13 0 0 0 0 0 0 0 3 0 4 1 0 0 0 0 0 2 0

449 179 429 41 263 55 577 477 15 16 26 642 332 135 1574 15 230 413 14 20 185 0 24 677 22

44259 91581 153295 67047 107709 15760 102045 214796 20535 41375 16585 280776 189408 20155 210552 53961 96591 330371 81126 47450 16996 52408 13677 232829 51774

Totals

73

630

1402

30

50

14168

5779301

The fact that only low or trace levels of Klk4-driven β-galactosidase expression are found in Klk4 null mice is largely consistent with earlier studies that detected KLK4 expression using other techniques. Human multiple tissue Northern blot analyses detected KLK4 mRNA from prostate only (Nelson et al., 1999). KLK4 mRNA was absent from 19 other tissues, but developing teeth and salivary glands were not included in the analysis (Nelson et al., 1999). A highly sensitive immunofluorometric assay detected only trace concentrations of KLK4 protein in prostatic tissue, although this very low level was higher than that of other tissues (Obiezu et al., 2002). The concentration of prostate specific antigen (KLK3) was 10,000 times higher than the concentration of KLK4 in prostatic tissues and 1,000,000 times higher than the concentration of KLK4 in seminal plasma (Obiezu et al., 2002). KLK4 transcripts are relatively rare in the human expressed sequence tag (EST) database, which does not include developing teeth (Tab. 11.1). Only six KLK4 EST (expressed sequence tag) entries are located outside of the prostate.

302

James P. Simmer, Yuanyuan Hu, Amelia S. Richardson, and Jan C.C. Hu

Current human genetic data and characterization of knockout mice support the conclusion that KLK4 is functionally specific for dental enamel formation, while β-gal histochemistry, multiple-tissue Northern blots, immunofluorometric assays and EST analyses support the conclusion that KLK4 expression outside of developing teeth is relatively very low. For practical reasons the characterization of Klk4 expression and function falls far short of covering all tissues, at all ages, and under all conditions, so a role for KLK4 in other processes besides dental enamel formation is possible, but seems unlikely given that no phenotype outside of enamel has been observed in persons and mice that do not express KLK4 or Klk4, respectively. To facilitate further studies, the Klk4lacZ/lacZ mice have been made available at The Jackson Laboratory under the strain name C57BL/6-Klk4tm1.1Jpsi/J (stock number 010684).

11.6 Other enamel specific genes Dental enamel is the product of epithelial cells and is therefore fundamentally different from other mineralized tissues in the body, such as bone, cartilage, and dentin. Its formation depends upon a specialized toolbox of genes and proteins. Defects in genes that are functionally specific for dental enamel formation are manifested as isolated enamel malformations (tooth defects without malformations in other parts of the body), and are grouped under the designation of amelogenesis imperfecta (AI) (Witkop, 1988). So far, six genes have been implicated in the etiology of non-syndromic forms of AI. Four of them express gene products that are secreted into the enamel matrix of developing teeth (AMELX, ENAM, MMP-20, and KLK4), while the other two express intracellular proteins (FAM83H and WDR72). Defects in these six genes account for less than half of all non-syndromic AI cases (Chan et al., 2011; Wright et al., 2011) and hence it appears that more enamel-specific genes await discovery. Tab. 11.2 Human EST (expressed sequence tag) profiles listed in the UniGene database at the National Center for Biotechnology Information (NCBI) listed by body site for amelogenin (AMELX; Hs.654436), enamelin (ENAM; Hs.667018), ameloblastin (AMBN; Hs.272396), matrix-metalloprotease 20 (MMP-20; Hs.591946), family with sequence similarity 83, member H (FAM83H; Hs.67776), and WD repeat domain 72 (WDR72; Hs.122125). The numbers in the ESTs column show the total number of ESTs submitted for each tissue. Tissue

AMELX

Adipose tissue Adrenal gland Ascites Bladder Blood Bone Bone marrow

0 0 0 0 0 0 0

ENAM

AMBN

0 0 0 0 1 0 0

0 0 0 0 0 0 0

MMP20 0 0 0 0 0 0 0

FAM83H 0 0 1 3 0 0 0

WDR72 0 0 0 4 0 0 0

ESTs 13106 33188 40008 29752 123497 71655 48795

303

Role of KLK4 in Dental Enamel Formation

Tab. 11.2 (continued). Tissue

AMELX

Brain Cervix Connective tissue Ear Embryonic tissue Esophagus Eye Heart Intestine Kidney Larynx Liver Lung Lymph Lymph node Mammary gland Mouth Muscle Nerve Ovary Pancreas Parathyroid Pharynx Pituitary gland Placenta Prostate Salivary gland Skin Spleen Stomach Testis Thymus Thyroid Tonsil Trachea Umbilical cord Uterus Vascular

0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Totals

1

ENAM

AMBN

MMP20

0 0 1 0 0 0 2 0 0 2 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 2 0 0 0 0 0 0 0

2 0 14 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0

10

17

4

FAM83H

WDR72

ESTs

2 5 0 0 8 0 7 0 4 3 3 0 11 0 2 6 0 0 1 8 9 1 0 0 7 14 0 4 0 6 5 0 1 0 0 0 5 0

0 0 0 0 1 1 2 0 6 29 0 4 5 0 0 0 5 1 0 0 1 0 0 0 0 1 0 0 0 3 15 1 1 0 0 0 6 0

1101041 48157 149266 16211 215684 20203 211048 89594 234425 211788 24138 207692 336992 44259 91581 153295 67047 107709 15760 102045 214796 20535 41375 16585 280776 189408 20155 210552 53961 96591 330371 81126 47450 16996 52408 13677 232829 51774

116

86

5779301

304

James P. Simmer, Yuanyuan Hu, Amelia S. Richardson, and Jan C.C. Hu

Evolutionary evidence supports the conclusion that genes associated with non-syndromic forms of amelogenesis imperfecta are functionally specific to teeth. Several enamel-specific genes have recently been shown to be deleted in vertebrates that have lost the ability to make teeth or dental enamel. Birds lack an amelogenin gene, although their ancestors had teeth and expressed amelogenin (Sire et al., 2008). Genes encoding enamelin, amelogenin, ameloblastin and MMP-20 have degenerated into pseudogenes in whales and/or other mammals that lack teeth or dental enamel (Meredith et al., 2009; 2011). The absence of selection to preserve enamel-associated genes when teeth do not form suggests that these genes are only necessary for tooth formation. The EST records for ameloblastin, and five genes implicated in the etiology of non-syndromic AI, are listed in Tab. 11.2. Although associated with non-syndromic AI, the EST listings for FAM83H and WDR72 indicate that these genes are expressed at low levels in many tissues. FAM83H may even serve a necessary function in tissues other than ameloblasts. The autosomal, dominant FAM83H mutations which cause non-syndromic AI are all nonsense mutations or frameshifts within a discrete segment of the last FAM83H coding exon, and cause premature translation termination (Lee et al., 2008; 2011). It appears that these truncations cause a gain of function or dominant negative effects in ameloblasts, and it is possible that such effects would not occur in other cell types where FAM83H plays a necessary role. Proper functioning of the unmutated FAM83H allele may be sufficient to maintain a normal phenotype in these other tissues. Perhaps, when mutations are found in both FAM83H alleles, a phenotype will be observed in non-dental tissues. In summary, KLK4 is highly expressed by maturation-stage ameloblasts, relative to all other tissues. It is critical for dental enamel formation, and is not known to be necessary for any other processes. To understand the function of KLK4, we turn to its role in amelogenesis.

11.7 Role of KLK4 in enamel formation There are a number of in-depth reviews on the roles of proteases in dental enamel formation (Bartlett and Simmer, 1999; Simmer and Hu, 2002; Simmer, 2004; 2011b; Smith, 1998). There is also a concise review for persons outside of the enamel field (Lu et al., 2008). Below, we provide a summary of the literature on KLK4 in enamel formation and highlight advances made since the most recent review. During the early stage of enamel formation, hydroxyapatite ribbons are extended from the dentin surface to what becomes the final enamel surface. These mineral ribbons form within an extracellular space rich in the extracellular matrix proteins amelogenin, ameloblastin, and enamelin (Fincham et al., 1999). These enamel-specific, proline/glutamine-rich phosphoproteins are members of the secretory calciumbinding phosphoprotein (SCPP) family of genes and proteins (Kawasaki and Weiss, 2003). These novel secreted proteins are processed by MMP-20 into a series of cleavage

Role of KLK4 in Dental Enamel Formation

a

305

b

c

d

e

f

Fig. 11.3 Scanning electron micrographs (SEM) of 7-week-old wild-type and Klk4 null mouse teeth. (a) Cross section of wild-type mandibular incisor at the level of the alveolar crest. (b) Comparable section from Klk4 null mouse. Note that the enamel thickness and internal rod structure, which are established in the secretory stage before KLK4 is expressed, are similar. (c) Buccal view of wild-type mandibular molars. (d) Buccal view of Klk4 null molars. Note the areas of enamel fracture (arrowheads). (e) Occlusal view of wild-type mandibular molars. (f) Occlusal view of Klk4 null molars. Scale bars: (a, b) 10 μm; (c–f) 1 mm.

products, some of which are reabsorbed into ameloblasts, while the rest accumulates in the extracellular matrix between the long thin crystal ribbons (Chun et al., 2010; Iwata et al., 2007; Nagano et al., 2009). At the end of the secretory stage, the enamel matrix is still about 30% protein by weight. During the subsequent maturation stage, KLK4 digests the accumulated extracellular matrix proteins, which facilitates their removal from the extracellular space and allows the individual enamel crystals to grow together and interlock (Simmer et al., 1998; 2009). When MMP-20 is absent, KLK4 is not as effective in removing the uncleaved enamel proteins expressed during the secretory stage (Yamakoshi et al., 2011a). The natural KLK4 substrates in vivo are mainly amelogenin, ameloblastin, and enamelin cleavage products. However, KLK4 is able to degrade uncleaved enamel proteins, such as amelogenin, in vitro (Ryu et al., 2002).

306

James P. Simmer, Yuanyuan Hu, Amelia S. Richardson, and Jan C.C. Hu

a wild type

b KLK4 null

Fig. 11.4 Backscatter electron micrographs (bSEM) of 7-week-old wild-type and Klk4 null mouse teeth. (a) Cross-sections of wild-type mandibular incisor at the level of the alveolar crest. (b) Comparable section from Klk4 null mouse. Whiter areas are more highly mineralized. Note that the entire thickness of the wild-type enamel is highly mineralized, whereas in the Klk4 null mice the enamel is only highly mineralized near the surface. Scale bars = 100 μm.

When KLK4 is absent from developing teeth, enamel proteins are not efficiently removed, and there is a progressive failure to mineralize the enamel layer with depth (Smith et al., 2011; Hu et al., 2011) (Fig. 11.3 and Fig. 11.4). It is not clear how the surface enamel achieves its high degree of mineralization in the absence of KLK4. It appears that ameloblasts can reabsorb proteins near the enamel surface, but cleavage of the accumulated proteins in the deeper enamel is necessary for them to efficiently work their way up to the surface for reabsorption. The role of KLK4 in dental enamel formation seems to be fairly well understood, but some questions remain. N-linked glycosylations on KLK4 appear to be necessary for functional stability. However, the extent of glycosylation varies among species. Porcine KLK4 has three potential N-glycosylation sites, mouse Klk4 has two, and human KLK4 has only one. Porcine KLK4 is more highly glycosylated than murine Klk4, although the structures of the glycosylations are very similar (Yamakoshi et al., 2011b). It is not clear whether human KLK4 is glycosylated, as the enzyme has not been isolated from in vivo sources. However, the commercially available recombinant human KLK4 zymogen (R&D Systems; Minneapolis, MN, USA) does not appear to be glycosylated and seems to be less stable than the porcine and murine glycosylated forms of the enzyme. The role of KLK4 in dental enamel formation may also turn out to be more complex than currently appreciated. What are the functionally important consequences of KLK4 cleavages on the properties of enamel proteins? Do these cleavages remove enamel proteins from the crystals, increase their solubility, disaggregate them, and/or improve their diffusibility? KLK4 can activate Protease Activated Receptors (PARs), suggesting that KLK4 may play an unexpected role in the regulation of

Role of KLK4 in Dental Enamel Formation

307

maturation-stage ameloblasts (Gratio et al., 2010; Mize et al., 2008; Ramsay et al., 2008).

11.8 Conclusion KLK4 is a glycosylated serine protease that is functionally specific for dental enamel formation. It is expressed at relatively high levels in maturation-stage ameloblasts, and in low or trace levels in the submandibular gland and prostate. In humans, mutations in KLK4 cause a non-syndromic hypomaturation form of Amelogenesis Imperfecta, and Klk4 knockout mice produce defective enamel, which undergoes rapid attrition. The main role of KLK4 in enamel formation is to cleave accumulated enamel proteins, so that they can be efficiently reabsorbed by maturation stage ameloblasts and the enamel layer can achieve its high degree of mineralization.

Bibliography Bartlett, J.D., and Simmer, J.P. (1999). Proteinases in developing dental enamel. Crit. Rev. Oral Biol. Med. 10, 425–441. Carter, J., Smillie, A.C., and Shepherd, M.G. (1984). Proteolytic enzyme in developing porcine enamel. In: Tooth Enamel IV, R.W. Fearnhead, and S. Suga, eds. (Amsterdam, Elsevier Science), pp. 229–233. Carter, J., Smillie, A.C., and Shepherd, M.G. (1989). Purification and properties of a protease from developing porcine dental enamel. Arch. Oral Biol. 34, 195–202. Caterina, J.J., Skobe, Z., Shi, J., Ding, Y., Simmer, J.P., Birkedal-Hansen, H., and Bartlett, J.D. (2002). Enamelysin (matrix metalloproteinase 20)-deficient mice display an amelogenesis imperfecta phenotype. J. Biol. Chem. 277, 49598–49604. Chan, H.-C., Estrella, N.M., Milkovich, R.N., Kim, J.-W., Simmer, J.P., and Hu, J.C.-C. (2011). Target gene analyses of 39 amelogenesis imperfecta kindreds. Eur. J. Oral Sci. 119 (Suppl. 1), 311–323. Chun, Y.H., Yamakoshi, Y., Yamakoshi, F., Fukae, M., Hu, J.C., Bartlett, J.D., and Simmer, J.P. (2010). Cleavage site specificity of MMP-20 for secretory-stage ameloblastin. J. Dent. Res. 89, 785–790. Crenshaw, M.A., and Bawden, J.W. (1984). Proteolytic activity in embryonic bovine secretory enamel. In Tooth Enamel IV, R.W. Fearnhead, and S. Suga, eds. (Amsterdam, Elsevier Science), pp. 109–113. Deakins, M., and Volker, J.F. (1941). Amount of organic matter in enamel from several types of human teeth. J. Dent. Res. 20, 117–121. Fincham, A.G., Moradian-Oldak, J., and Simmer, J.P. (1999). The structural biology of the developing dental enamel matrix. J. Struct. Biol. 126, 270–299. Fukae, M., and Shimizu, M. (1974). Studies on the proteins of developing bovine enamel. Arch. Oral Biol. 19, 381–386. Fukae, M., Tanabe, T., and Shimizu, M. (1977). Proteolytic enzyme activity in porcine immature enamel. Tsurumi U. Dent. J. 3, 15–17.

308

James P. Simmer, Yuanyuan Hu, Amelia S. Richardson, and Jan C.C. Hu

Fukae, M., Tanabe, T., Nagano, T., Ando, H., Yamakoshi, Y., Yamada, M., Simmer, J.P., and Oida, S. (2002). Odontoblasts enhance the maturation of enamel crystals by secreting EMSP1 at the enamel-dentin junction. J. Dent. Res. 81, 668–672. Gratio, V., Beaufort, N., Seiz, L., Maier, J., Virca, G.D., Debela, M., Grebenchtchikov, N., Magdolen, V., and Darmoul, D. (2010). Kallikrein-related peptidase 4: a new activator of the aberrantly expressed protease-activated receptor 1 in colon cancer cells. Am. J. Pathol. 176, 1452–1461. Hart, P.S., Hart, T.C., Michalec, M.D., Ryu, O.H., Simmons, D., Hong, S., and Wright, J.T. (2004). Mutation in kallikrein 4 causes autosomal recessive hypomaturation amelogenesis imperfecta. J. Med. Genet. 41, 545–549. Hu, J.C., Ryu, O.H., Chen, J.J., Uchida, T., Wakida, K., Murakami, C., Jiang, H., Qian, Q., Zhang, C., Ottmers, V., Bartlett, J.D., and Simmer, J.P. (2000a). Localization of EMSP1 expression during tooth formation and cloning of mouse cDNA. J. Dent. Res. 79, 70–76. Hu, J.C., Zhang, C., Sun, X., Yang, Y., Cao, X., Ryu, O., and Simmer, J.P. (2000b). Characterization of the mouse and human PRSS17 genes, their relationship to other serine proteases, and the expression of PRSS17 in developing mouse incisors. Gene 251, 1–8. Hu, J.C., Sun, X., Zhang, C., Liu, S., Bartlett, J.D., and Simmer, J.P. (2002). Enamelysin and kallikrein-4 mRNA expression in developing mouse molars. Eur. J. Oral Sci. 110, 307–315. Hu, Y., Hu, J.C.-C., Smith, C., Bartlett, J., and Simmer, J. (2011). Kallikrein-related peptidase 4, matrix metalloproteinase 20, and the maturation of murine and porcine enamel. Eur. J. Oral Sci. 119 (Suppl. 1), 329–337. Iwata, T., Yamakoshi, Y., Hu, J.C., Ishikawa, I., Bartlett, J.D., Krebsbach, P.H., and Simmer, J.P. (2007). Processing of ameloblastin by MMP-20. J. Dent. Res. 86, 153–157. Kawasaki, K., and Weiss, K.M. (2003). Mineralized tissue and vertebrate evolution: the secretory calcium-binding phosphoprotein gene cluster. Proc. Natl. Acad. Sci. USA 100, 4060–4065. Kim, J.W., Simmer, J.P., Hart, T.C., Hart, P.S., Ramaswami, M.D., Bartlett, J.D., and Hu, J.C. (2005). MMP-20 mutation in autosomal recessive pigmented hypomaturation amelogenesis imperfecta. J. Med. Genet. 42, 271–275. Lee, S.K., Hu, J.C.-C., Bartlett, J.D., Lee, K.E., Lin, B.P.-J., Simmer, J.P., and Kim, J.W. (2008). Mutational spectrum of FAM83H: The C-terminal portion is required for tooth enamel calcification. Hum. Mutat. 29, E95-E99. Lee, S.K., Seymen, F., Kang, H.Y., Lee, K.E., Gencay, K., Tuna, B., and Kim, J.W. (2010). MMP20 hemopexin domain mutation in amelogenesis imperfecta. J. Dent. Res. 89, 46–50. Lee, S.K., Lee, K.E., Jeong, T.S., Hwang, Y.H., Kim, S., Hu, J.C., Simmer, J.P., and Kim, J.W. (2011). FAM83H mutations cause ADHCAI and alter intracellular protein localization. J. Dent. Res. 89, 1378–1382. Lu, Y., Papagerakis, P., Yamakoshi, Y., Hu, J.C., Bartlett, J.D., and Simmer, J.P. (2008). Functions of KLK4 and MMP-20 in dental enamel formation. Biol. Chem. 389, 695–700. Menanteau, J., Mitre, D., and Raher, S. (1986). An in-vitro study of enamel protein degradation in developing bovine enamel. Archs. Oral Biol. 31, 807–810. Meredith, R.W., Gatesy, J., Murphy, W.J., Ryder, O.A., and Springer, M.S. (2009). Molecular decay of the tooth gene Enamelin (ENAM) mirrors the loss of enamel in the fossil record of placental mammals. PLoS Genet. 5, e1000634. Meredith, R.W., Gatesy, J., Cheng, J., and Springer, M.S. (2011). Pseudogenization of the tooth gene enamelysin (MMP20) in the common ancestor of extant baleen whales. Proc. Biol. Sci. 278, 993–1002. Mize, G.J., Wang, W., and Takayama, T.K. (2008). Prostate-specific kallikreins-2 and -4 enhance the proliferation of DU-145 prostate cancer cells through protease-activated receptors-1 and -2. Mol. Cancer Res. 6, 1043–1051.

Role of KLK4 in Dental Enamel Formation

309

Nagano, T., Kakegawa, A., Yamakoshi, Y., Tsuchiya, S., Hu, J.C., Gomi, K., Arai, T., Bartlett, J.D., and Simmer, J.P. (2009). Mmp-20 and Klk4 cleavage site preferences for amelogenin sequences. J. Dent. Res. 88, 823–828. Nelson, P.S., Gan, L., Ferguson, C., Moss, P., Gelinas, R., Hood, L., and Wang, K. (1999). Molecular cloning and characterization of prostase, an androgen-regulated serine protease with prostaterestricted expression. Proc. Natl. Acad. Sci. USA 96, 3114–3119. Obiezu, C.V., Soosaipillai, A., Jung, K., Stephan, C., Scorilas, A., Howarth, D.H., and Diamandis, E.P. (2002). Detection of human kallikrein 4 in healthy and cancerous prostatic tissues by immunofluorometry and immunohistochemistry. Clin. Chem. 48, 1232–1240. Overall, C.M., and Limeback, H. (1988). Identification and characterization of enamel proteinases isolated from developing enamel. Amelogeninolytic serine proteinases are associated with enamel maturation in pig. Biochem. J. 256, 965–972. Ozdemir, D., Hart, P.S., Ryu, O.H., Choi, S.J., Ozdemir-Karatas, M., Firatli, E., Piesco, N., and Hart, T.C. (2005). MMP20 active-site mutation in hypomaturation amelogenesis imperfecta. J. Dent. Res. 84, 1031–1035. Papagerakis, P., Lin, H.K., Lee, K.Y., Hu, Y., Simmer, J.P., Bartlett, J.D., and Hu, J.C. (2008). Premature stop codon in MMP20 causing amelogenesis imperfecta. J. Dent. Res. 87, 56–59. Ramsay, A.J., Dong, Y., Hunt, M.L., Linn, M., Samaratunga, H., Clements, J.A., and Hooper, J.D. (2008). Kallikrein-related peptidase 4 (KLK4) initiates intracellular signaling via proteaseactivated receptors (PARs). KLK4 and PAR-2 are co-expressed during prostate cancer progression. J. Biol. Chem. 283, 12293–12304. Ryu, O., Hu, J.C., Yamakoshi, Y., Villemain, J.L., Cao, X., Zhang, C., Bartlett, J.D., and Simmer, J.P. (2002). Porcine kallikrein-4 activation, glycosylation, activity, and expression in prokaryotic and eukaryotic hosts. Eur. J. Oral Sci. 110, 358–365. Shimizu, M., Tanabe, T., and Fukae, M. (1979). Proteolytic enzyme in porcine immature enamel. J. Dent. Res. 58, 782–789. Simmer, J.P., Fukae, M., Tanabe, T., Yamakoshi, Y., Uchida, T., Xue, J., Margolis, H.C., Shimizu, M., DeHart, B.C., Hu, C.C., and Bartlett, J.D. (1998). Purification, characterization, and cloning of enamel matrix serine proteinase 1. J. Dent. Res. 77, 377–386. Simmer, J.P., and Hu, J.C. (2002). Expression, structure, and function of enamel proteinases. Connect Tissue Res. 43, 441–449. Simmer, J.P. (2004). Prostase. In Handbook of Proteolytic Enzymes, A. Barrett, N. Rawlings, and J. Woessner, eds. (Amsterdam, Academic Press), pp. 1612–1613. Simmer, J.P., Sun, X., Yamada, Y., Zhang, C.H., Bartlett, J.D., and Hu, J.C.-C. (2004). Enamelysin and kallikrein-4 expression in the mouse incisor. In: Biomineralization: formation, diversity, evolution and application. Proceedings of the 8th International Symposium on Biomineralization, Niigata, Jpn, Sept 25–28, 2001, I. Kobayashi, and H. Ozawa, eds. (Hadano, Jpn, Tokai University Press), pp. 348–352. Simmer, J.P., Hu, Y., Lertlam, R., Yamakoshi, Y., and Hu, J.C. (2009). Hypomaturation enamel defects in Klk4 knockout/LacZ knockin mice. J. Biol. Chem. 284, 19110–19121. Simmer, J., Hu, Y., Richardson, A., Bartlett, J., and Hu, J.C.-C. (2011a). Why does enamel in Klk4 null mice break above the dentino-enamel junction? Cells Tissues Organs 194, 211–215. Simmer, J., Richardson, A., Smith, C., Hu, Y., and Hu, J.-C. (2011b). Expression of kallikrein 4 (Klk4) in dental and non-dental tissues. Eur. J. Oral Sci. 119 (Suppl. 1), 226–233. Simmer, J.P. (in press). KLK4. In Handbook of Proteolytic Enzymes, A. Barrett, N. Rawlings, and J. Woessner, eds. (Amsterdam, Academic Press). Sire, J.Y., Delgado, S.C., and Girondot, M. (2008). Hen’s teeth with enamel cap: from dream to impossibility. BMC Evol. Biol. 8, 246.

310

James P. Simmer, Yuanyuan Hu, Amelia S. Richardson, and Jan C.C. Hu

Smith, C.E. (1998). Cellular and chemical events during enamel maturation. Crit. Rev. Oral Biol. Med. 9, 128–161. Smith, C.E., Richardson, A.S., Hu, Y., Bartlett, J.D., Hu, J.C., and Simmer, J.P. (2011). Effect of kallikrein 4 Loss on enamel mineralization: Comparison with mice lacking matrix metalloprotease 20. J. Biol. Chem. 286, 18149–18160. Stephenson, S.A., Verity, K., Ashworth, L.K., and Clements, J.A. (1999). Localization of a new prostate-specific antigen-related serine protease gene, KLK4, is evidence for an expanded human kallikrein gene family cluster on chromosome 19q13.3–13.4. J. Biol. Chem. 274, 23210–23214. Tanabe, T. (1984). Purification and characterization of proteolytic enzymes in porcine immature enamel. Tsurumi U. Dent. J. 10, 443–452. Weinmann, J.P., Wessinger, G.D., and Reed, G. (1942). Correlation of chemical and histological investigation of developing enamel. J. Dent. Res. 21, 171–182. Witkop, C.J. Jr. (1988). Amelogenesis imperfecta, dentinogenesis imperfecta and dentin dysplasia revisited: problems in classification. J. Oral Pathol. 17, 547–553. Wright, J.T., Torain, M., Long, K., Seow, K., Crawford, P., Aldred, M.J., Hart, P.S., and Hart, T.C. (2011). Amelogenesis imperfecta: genotype-phenotype studies in 71 families. Cells Tissues Organs 194, 279–283 Yamakoshi, Y., Richardson, A.S., Nunez, S.M., Yamakoshi, F., Milkovich, R.N., Hu, J.C.-C., Bartlett, J.D., and Simmer, J.P. (2011a). Enamel proteins and proteases in Mmp20 and Klk4 null and double null mice. Eur. J. Oral Sci. 119 (Suppl. 1), 206–216. Yamakoshi, Y., Yamakoshi, F., Hu, J.C.-C., and Simmer, J.P. (2011b). Characterization of kallikrein 4 glycosylations. Eur. J. Oral Sci. 119 (Suppl. 1), 234–240. Yousef, G.M., Obiezu, C.V., Luo, L.Y., Black, M.H., and Diamandis, E.P. (1999). Prostase/KLK-L1 is a new member of the human kallikrein gene family, is expressed in prostate and breast tissues, and is hormonally regulated. Cancer Res. 59, 4252–4256.

Nashmil Emami, and Eleftherios P. Diamandis

12 Kallikrein-related Peptidases and Semen 12.1 Introduction Human semen primarily consists of secretions of several accessory glands of the male genital tract, including the seminal vesicles, bulbourethral and urethral glands, and the prostate (Jequier, 2000). During ejaculation, secretions from each source are mixed in an orderly fashion. The first portion consists of about 5% of the total ejaculate and contains secretions from the bulbourethral (Cowper) and Littre glands. This is followed by sequential secretions from the prostate, epididymis, and the seminal vesicles (Owen and Katz, 2005). Secretions of the seminal vesicles and the prostate are the two main constituents of seminal plasma, affecting the function of the sperms and the physiology of the seminal plasma. The seminal vesicles contribute to the majority of the ejaculate and are particularly important, since they provide an energy source for the spermatozoa (Nun et al., 1972). The prostate is the second contributor to the semen, accounting for 13–33% of its total volume (Owen and Katz, 2005). Prostatic fluid is secreted directly into the urethra through multiple ducts surrounding the verumontanum in the prostatic urethra (Jequier, 2000). Secretions from the prostate in part contribute to the biochemistry of the semen as the main source of acid phosphatase, inositol, ions such as citrate, calcium, zinc, magnesium and seminal protein content. The semen was long seen as merely a vehicle for the survival and transport of sperms to the female reproductive tract. Emerging evidence, however, points to the importance of the semen in mediating key biochemical and physiological functions, to allow successful gamete fusion (Robertson, 2005). For instance, semen’s exceptionally high buffering capacity is believed to be pivotal in neutralizing the hostile acidic cervical mucus, making it more receptive to sperm penetration and survival (Owen and Katz, 2005). To further support successful fertilization of the ovum, semen functionally orchestrates the subsequent processes of sperm motility, capacitation, hyperactivity, and oocyte penetration (Ikawa et al., 2010). Semen sequentially augments sperm motility first by modulating liquefaction and release of motile sperm. This is followed by capacitation and hyperactivation of sperms, which is inhibited in the early stages of sperm migration to avoid premature acrosome reaction (de Lamirande, 2007; Giojalas et al., 2004). Various components of the semen, consisting mainly of proteases and their inhibitors, have been shown to be essential in fine tuning the timing of these intricate processes. This chapter focuses on the seminal tissue kallikrein-related peptidases (KLK) as one of the key families of proteases in seminal plasma. The functional role of seminal KLKs in sperm motility and survival will be discussed at length. The complex

312

Nashmil Emami, and Eleftherios P. Diamandis

interplay between the proteolytic and inhibitory regulatory components of seminal KLKs will also be reviewed.

12.2 Expression pattern and origin of seminal KLKs All members of the KLK family are present in human semen, with the exception of KLK6 and KLK8 (Shaw and Diamandis, 2007). The expression level of these KLKs spans a wide range, from highly abundant (KLK2 and KLK3) to scarce (KLK4 and KLK13). KLK3 (also known as PSA or prostate specific antigen) is the most abundant chymotrypsin-like serine protease in the semen, with an average protein level of 1–2 mg/ml in healthy men (Lovgren et al., 1999b; Matsumura et al., 2005). These seminal KLKs have been shown to be expressed by the glandular epithelial cells of the prostate (Borgoño and Diamandis, 2004). The prostatic origin of seminal KLKs is supported by the observation that their protein and mRNA expression levels in the prostate are consistent with their presence in seminal plasma (Shaw and Diamandis, 2007). The only exception to this is the expression pattern of KLK6 and KLK8, which seem to be absent in semen, despite their expression at the mRNA level in the prostate (Shaw and Diamandis, 2007). The observed discrepancy could be due to mRNA instability or a rapid degradation of their representative proteins.

12.3 Physiological function of seminal KLKs Seminal KLKs have been implicated in various physiological processes associated with sperm motility, metabolism, and fertilization. In particular, accumulating evidence on the substrate specificity, inhibition profiles, and the putative signaling pathways of seminal KLKs, provide compelling evidence with regard to the complex roles these KLKs play in semen coagulation and the fibrinolytic hemostatic system, stimulation of sperm motility and metabolism, cervical mucus penetration, intrauterine sperm migration, and regulation of immune response (Emami and Diamandis, 2010; Lwaleed et al., 2007; Miska and Schill, 1990; Schill and Miska, 1992).

12.3.1 Seminal coagulation and fibrinolytic balance The semen microenvironment is known to function as a mechanical means for maximizing fertilization, by creating a sperm deposit in the rear vaginal cavity in the form of a coagulate (Tauber and Zaneveld, 1981). Despite lack of consensus on the nature of seminal coagualatory factors, semen has long been known for its potent clotting capacity. For instance, when added to normal blood plasma, seminal plasma, diluted up to 10,000 times, can drastically impede blood fibrinolysis time (Huggins and Neal,

Kallikrein-related Peptidases and Semen

313

1942). Subsequent liquefaction of the coagulum within minutes (ranging from 5 to 20 minutes after ejaculation) allows for a progressive release of motile sperms (Tauber and Zaneveld, 1981). The matrix backbone of semen coagulate consists of a semi-solid gelatinous structure, which is primarily composed of the semenogelin proteins and fibronectin. The trio is often referred to as the high-molecular-weight seminal vesicle proteins, as they are exclusively secreted by the seminal vesicles (Lilja et al., 1989). Certain conventional blood coagulation factors also appear to be present in the semen. These include the blood clotting tissue factor (also known as factor III), factor VII, the prothrombin fragments 1 and 2 and thrombin-antithrombin complexes, as well as analogs of thrombin and platelet-activating factor (Lwaleed et al., 2004, 2005). Even though physiological roles of these blood factors are not yet fully understood, accumulating evidence points to their functional significance in the process of semen coagulation. For example, functional importance of factor VII was demonstrated by successfully abrogating semen clot formation, using a neutralizing antibody against factor VII (Fernandez et al., 1997). Likewise, the coagulatory property of semen was shown to be in part mediated by active tissue factor located on the surface of prostasome vesicles (Fernandez et al., 1997). The subsequent fibrinolysis, or liquefaction, of the semen coagulate is achieved through proteolytic cleavage of the fibrin-like matrix to its constituent soluble proteins, which eventually are fragmented into soluble peptides (Lilja, 1985; Lilja and Laurell, 1985; Polak and Daunter, 1989). These newly formed peptides are then degraded further into even smaller amino acid residues. The seminal KLK family is considered one of the key fibrinolytic factors in semen (Emami et al., 2008; Lilja, 1985; Michael et al., 2006). The regulatory function of KLKs in modulating semen liquefaction is believed to be mediated through a complex proteolytic cascade, containing KLK3 as the main executor and several KLKs as initiators or progressors (Pampalakis and Sotiropoulou, 2007). The nature of this regulatory cascade will be discussed at length hereafter. The function of seminal KLKs in semen liquefaction has been demonstrated in various in vitro and ex vivo studies. For example, addition of purified, natural seminal KLK3 was shown to induce liquefaction of the coagulated semen by rapid cleaving of the high-molecular-weight seminal vesicle proteins (Christensson et al., 1990). The time course and fragmentation patterns were reportedly consistent with those of naturally liquefied semen. As expected from the substrate specificity of KLK3, the cleavage sites were mapped to the carboxyl termini characteristic to chymotrypsin-like specific proteases. Similarly, KLK2 was shown to cleave semenogelin I and II, in vitro (Lovgren et al., 1999a). The great majority of the cleavage sites was characterized to be those of a trypsin-like specific substrate, by cleavage of arginine at P1 position within internal repeat regions (Lovgren et al., 1999a). KLK5 and KLK14 were also shown to directly cleave semenogelin proteins in vitro (Emami et al., 2008; Michael et al., 2006). The physiological relevance of trypsin-like KLKs in the processing of semenogelins in semen remains elusive, as no major trypsin-like cleavage sites have yet been iden-

314

Nashmil Emami, and Eleftherios P. Diamandis

tified in naturally fragmented semenogelin peptides (Malm et al., 2000). Fibronectin has also been shown to be a putative substrate for both the chymotrypsin-, and trypsin-like KLKs, including KLK2, 3, 5, 7, 14 (Emami and Diamandis, 2007). Moreover, regulatory factors common to the blood fibrinolytic pathway have recently been proposed to function in balancing seminal homeostasis. These factors, as mentioned above include tissue-type plasminogen activator (tPA), urokinase-type plasminogen activator (uPA), trypsinogen, and plasmin, as well as traces of fibrinogen, plasminogen, plasminogen activator inhibitor type-1 (PAI-1), factor VIII coagulant activity, and fibrin (Lwaleed et al., 2004; Paju et al., 2000). Despite the uncertainty surrounding their functions, several indirect causal relationships have been established. For example, a potent and specific plasmin inhibitor, 6-amidino-2-naphthyl-6-guanidinobenzoate dihydrochloride (Fusan), has been shown to significantly impair semen liquefaction (Matsuda et al., 1994). In addition, correlative studies suggest that tPA may play a role in semen liquefaction, as it was found at a lower level in individuals with delayed liquefaction (Arnaud et al., 1994). A similar correlative pattern was observed between KLK2, 3, 13, 14 and liquefaction state (Emami et al., 2009). KLKs have also been suggested to putatively mediate activation of several of the abovementioned fibrinolytic factors. For example, KLK2 and KLK4 may be involved in activation of uPA, as was shown in in vitro experiments (Mikolajczyk et al., 1999; Takayama et al., 2001).

12.3.2 Sperm motility Sperm motility is a key determinant of successful fertilization. Following ejaculation, sperms undergo a series of step-wise physiological changes, enabling them to migrate through the female reproductive tract to reach and penetrate the oocyte. The first change in the process of maturation is known as “capacitation”, through which motile sperms acquire fertilization capability (Ikawa et al., 2010). Premature capacitation is prevented physiologically, as it may adversely affect sperm physiology and fertility. Semenogelin-derived peptides are believed to play a critical role in blocking sperm capacitation (de Lamirande et al., 2001; Robert and Gagnon, 1996). These semenogelin peptides have been shown to be generated during the process of liquefaction, through processing of the semenogelin proteins by seminal KLK3 (de Lamirande, 2007). Thus, seminal KLKs may play a role in the temporal regulation of sperm capacitation through the processing of semenogelin proteins. Capacitation is primarily achieved through removal of the glycoprotein layer of the sperm acrosomal head, in order to allow a greater binding between sperm and the oocyte (Ikawa et al., 2010). Such changes in the acrosomal head create a more accessible membrane, which in turn results in an influx of calcium ions and increased intracellular cAMP concentration (Lishko et al., 2011). This phenomenon is known as “hyperactivation” and is characterized by an asymmetrical beating pattern of sperm

Kallikrein-related Peptidases and Semen

315

flagella, to facilitate sperm penetration to the zona pellucida (Lishko et al., 2011). The mechanism of calcium influx during sperm hyperactivation is not fully understood. Recent evidence suggests a potential route of calcium entry through the voltagesensitive Ca2+-mediated channels CatSpers (Qi et al., 2007). CatSper activation was shown to be triggered by elevation of intracellular pH and extracellular progesterone secreted by cumulus cells surrounding the egg (Lishko et al., 2011). Similarly, calcium influx may be mediated through a G-protein-coupled receptor, protease activated receptor (PAR). Active PARs have been shown to induce a transient calcium influx in certain cell types (Oikonomopoulou et al., 2006) (see Chapter 15). It is not clear whether calcium influx in human spermatozoa is in part regulated by a similar mechanism. Recent immunoelectron microscopy experiments have revealed that PAR2 is expressed on the membrane of the acrosomal region and midpiece of human spermatozoa (Weidinger et al., 2003). These receptors were shown to be activated by exposure of human spermatozoa to the recombinant serine protease tryptase. Thus, sperm PAR2 is expected to be functional and may play a role similar to CatSpers in mediating calcium influx. In support of this, treatment with tryptase of motile spermatozoa of healthy men was shown to significantly reduce sperm motility in a dose- and time-dependent manner (Zitta et al., 2007). Interestingly, this effect was successfully reversed by pretreatment with tryptase antibodies or PAR2 antiserum (Zitta et al., 2007). Similar to tryptase, various members of the KLK family have been shown to regulate PAR2 activity. It should be noted that, despite the convincing data on KLK signaling through PARs, it is not yet apparent whether these pathways apply to the reproductive system and, if so, whether PAR2 activation contributes to calcium influx during hyperactivation. KLKs may play an additional role in regulating sperm motility through kinin signaling pathways. This has been suggested, given the presence of key components of the kallikrein-kinin system in semen and the demonstrated importance of kinin in sperm motility (Schill and Miska, 1992; Siems et al., 2003). The nonapeptide bradykinin was shown to significantly promote sperm motility at subnanomolar concentrations (Siems et al., 2003). This effect was noticeably augmented upon suppression of hydrolysis of bradykinin in the semen, and was shown to be mediated through noncanonical downstream pathways, independent of the bradykinin receptors (Siems et al., 2003). Kinin activation by KLKs is primarily attributed to KLK1 (Tang et al., 2011), even though traces of kininogenase activity have been suggested for another seminal KLK, KLK2 (Charlesworth et al., 1999). Functional significance of seminal KLK2 in processing kininogen and generation of active kinin molecule is still under debate. Incubation of high-molecular-weight kininogen with KLK2 purified from seminal plasma was shown to result in the generation of active bradykinin (Charlesworth et al., 1999). Interestingly, the electrophoretic mobility pattern of the fragmented heavy (56 kDa) and light (42 kDa) chains of high-molecular-weight kininogen was similar between KLK1 and KLK2 (Charlesworth et al., 1999). In addition to KLK2, in vitro studies suggest

316

Nashmil Emami, and Eleftherios P. Diamandis

that KLK5 is able to process the low-molecular-weight kininogen (Michael et al., 2005). However, based on the identified putative cleavage sites, KLK5 most likely lacks kininogenase activity. Rather, cleavage of low-molecular-weight kininogen by KLK5 may have functional significance in the release of a cystatin-like domain 3 fragment and inhibition of cysteine proteases such as calpain (Michael et al., 2005). Given the importance of the calpain-calmodulin system in membrane fusion during the process of capacitation (Ozaki et al., 2001), KLK5 may therefore play an indirect role in regulating sperm motility.

12.3.3 Reproductive immune interactions Insemination is known to elicit an array of immune-mediated changes in the female reproductive system (Robertson, 2005). Seminal KLKs are involved in these immune responses by regulating various immune moieties in the female reproductive system (Emami and Diamandis, 2010; Shaw et al., 2008; Sorensen et al., 2003). Immediately after insemination, seminal plasma induces a rapid and transient influx of inflammatory cells to the site of semen deposition (Robertson, 2005). The nature of such post-mating inflammatory responses has been well-characterized as being a group of pro-inflammatory cytokines, including granulocyte-macrophage colony-stimulating factor, interleukin 6 and various chemokines (Robertson, 2005). These pro-inflammatory factors induce an array of cellular changes that lead to the recruitment of macrophages, dendritic cells, and granulocytes into the endometrial mucosa. Such inflammatory responses are transient and fully disappear by the time the fertilized egg has implanted. Post-mating inflammation is believed to serve as a means to raise the chance of successful fertilization and implantation. This is achieved through four main processes: 1) clearing defective sperms and microorganisms that might have been introduced in the uterus during intercourse, 2) tissue remodeling, in order to enhance endometrial receptivity, 3) activation of cytokines and growth factors required for embryo development prior to implementation, and 4) inducing an immune response against semen antigens and other parental transplantation proteins (Robertson, 2005). The growth factor TGF-β (transforming growth factor β) is the key player in the inflammatory events following semen deposition, regulating both the extent and duration of the pro-inflammatory responses (Robertson et al., 2002). In a normal physiologic state, TGF-β expression is approximately five times higher in semen than in blood (Robertson et al., 2002). The majority of seminal TGF-β is synthesized in the male accessory glands, in particular in the prostate (Robertson et al., 2002). Human semen is known to contain two subtypes of TGF-β, namely TGF-β1 and TGF-β2 (Nocera and Chu, 1995), with TGF-β1 being expressed at about 10 times higher levels. The biologically active forms of these TGF-β proteins are found as homodimers with a molecular weight of approximately 25 kDa (Chu et al., 1996). Activation is initiated by cleavage

Kallikrein-related Peptidases and Semen

317

of the latency-associated peptide at the cleavage site of arginine 278 at the N-terminus (Gentry et al., 1988). Further processing of this peptide leads to a complete exposure of the receptor-binding motif and activation of TGF-β. The physiological activation of TGF-β proteins is not well-characterized. Several proteases, including KLKs, have been implicated in TGF-β activation through proteolysis (Emami and Diamandis, 2010; Crawford et al., 1998; Lyons et al., 1990). Given the presence of some of these proteases, such as calpain, plasmin, and surely seminal KLKs in seminal plasma, the possibility that seminal TGF-β is activated through a similar mechanism is highly plausible. Lack of orthologs of a number of potential key activators of TGF-β (in particular KLKs) in lower animals, has hampered progress towards understanding the intricate regulatory pathways of TGF-β. Despite this critical impediment, recent evidence on the co-spatial expression of seminal TGF-β and its potential proteolytic activators and accumulating in vitro and ex vivo findings have begun to provide insight into the activation processes of this key immune regulatory component of the semen. It has been postulated that activation of seminal TGF-β is in part induced simultaneous with the release of motile spermatozoa following semen liquefaction (Emami and Diamandis, 2010). Thus, these two processes may to some extent be orchestrated simultaneously by seminal KLKs. KLK14 was shown to activate latent TGF-β1, in vitro (Emami and Diamandis, 2010). In addition, both the latency-associated peptide and the latent TGF-β binding protein 1 were shown to be processed by KLK14 in a doseand time-dependent manner. Furthermore, even though KLK1, 2, and 5 were unable to directly activate TGF-β1, they may play a supplementary role in inducing the conformational changes necessary for improving the accessibility of the latency-associated peptide for further processing (Emami and Diamandis, 2010). In addition, KLKs may mediate post-mating inflammatory responses through an alternative route of kallikrein-kinin signaling. There is increasing evidence that an active kallikrein-kinin system exists in the female reproductive tract (Schill and Miska, 1992). This signaling system has been implicated in the inflammatory processes of endometrial proliferation during the menstrual cycle and ovulation (Clements et al., 1997). It is not yet clear whether such a kallikrein-kinin signaling pathway, particularly through KLK1, plays a role in post-mating inflammation. As stated above, post-mating inflammatory responses are transient and are followed by opposing immunosuppressive reactions, in order to attenuate the immune attack triggered by sperm entry. Such immunosuppressive effects of the reproductive system are essential for survival of the sperm cells in the immunologically hostile environment of their recipient. Several seminal components are known to influence the immunosuppressive events that occur in the female reproductive tract following sperm entry. For instance, seminal clusterin is known to inhibit the complement system of innate immunity in the female reproductive system (Harris et al., 2006). Similarly, TGF-β1 was shown to present strong immunosuppressive capacity in the semen. This was particularly evident from the ability of semen-purified TGF-β1 to

318

Nashmil Emami, and Eleftherios P. Diamandis

diminish the activity of interleukin 2-stimulated lymphocytes (Nocera and Chu, 1993). Thus, the function of seminal TGF-β1 in reproduction seems to be paradoxical in nature, as it involves both modulating and skewing immune reactions to the allogeneic sperm. Consequently, the roles of seminal KLKs as activators of TGF-β1 are expected to be dual and opposing. Given the complex function of seminal TGF-β1 in regulating the immune response in the female reproductive system, the timing and extent of activation is expected to be tightly regulated. This has been well-demonstrated in mice, as nearly 70% of TGF-β was found to be active in the uterine fluid, while only 30% of the TGF-β recovered from seminal vesicles was found active (Robertson et al., 2002). This may suggest that activation of seminal TGF-β mostly occurs following ejaculation and deposition of sperm cells in the female tract. Given the prominence of active immune defense in the female reproductive system, it is rational to believe that the semen-induced immunosuppression spans only a short period of time when sperms are released following liquefaction. As a result, it has been postulated that the two processes of semen liquefaction and immune tolerance are regulated through an overlapping pathway, with certain seminal KLKs playing a dual role of mediating liquefaction and activation of seminal TGF-β1. Alternatively, KLK3 may contribute to the immunosuppressive property of seminal plasma through the processing of the “sperm-coating” antigen MHS-5. MHS-5 antigen is exclusively synthesized by the seminal vesicles and degraded upon incubation with prostatic fluid or purified seminal KLK3 (Flickinger et al., 1990). To support this, MHS-5 antibody was produced in mice immunized with human sperm.

12.4 Proteolytic pathways of seminal KLKs The diversity of processes that are mediated by seminal KLKs points to a complex scheme of their regulation in the reproductive tissues. This is in part achieved through a stepwise entry of various constituents of the ejaculate into the posterior urethra. As mentioned at the beginning of the chapter, the first fraction of the ejaculate consists mainly of spermatozoa, accompanied by epididymal fluid (Jequier, 2000). This is followed by sequential secretion of the prostate and the seminal vesicles. Such stepped ejaculation prevents complete mixing of the ejaculate before liquefaction of the semen coagulate. This helps to avoid potential deleterious proteolytic degradation, such as unwanted proteolysis prior to release of sperms and excessive degradation of sperm surface proteins that can potentially damage the integrity of the sperm. The complex interplay between seminal KLKs and their regulatory components will be discussed in the following sections.

Kallikrein-related Peptidases and Semen

319

12.4.1 Role of seminal zinc Zinc is a strong inhibitor of seminal KLKs (see Chapter 4). Prostatic fluid contains an exceptionally high level of zinc ions, sufficient to keep the seminal KLKs in an inactive form prior to ejaculation. Upon ejaculation, the high-molecular-weight seminal vesicle proteins are chelated with the free zinc ions. This induces a series of structural modifications in these proteins, which in turn modulate formation of the aggregate complex of the coagulate (Yoshida et al., 2008). Depletion of free zinc ions due to chelation to the coagulate matrix proteins renders seminal KLKs active. As mentioned previously, active seminal KLKs are able to directly or indirectly degrade the highmolecular-weight seminal vesicle proteins. Fragmentation of the coagulate matrix results in a gradual release of free zinc ions. The increased level of zinc in turn serves as a negative feedback, in order to prevent excessive proteolysis of the seminal KLKs (Robert and Gagnon, 1999). The zinc binding sites have been identified and were shown to vary between different seminal KLKs. Zinc-ion-mediated inhibition of KLK2 and KLK3 seems to be competitive through direct blocking of the active site, whereas a potential non-competitive or mixed-type inhibition has been proposed for KLK4 (Debela et al., 2006). The physiological choice by KLK4 between the two potential inhibitory mechanisms is not yet clear. As the zinc ion binding site is separate from the proteolytic site, a non-competitive inhibition is likely. Yet, the possibility of conformational changes in the active site upon zinc ion binding, and hence a mixed-type inhibition cannot be precluded.

12.4.2 Role of seminal KLK inhibitors Protein C inhibitor (PCI) of the serpin family is known as one of the most important physiological inhibitors of seminal KLKs. PCI is secreted from seminal vesicles and is present in the semen at a concentration of 2.2 to 3.7 μM , which is nearly 30 times higher than its blood concentration (Espana et al., 2007). The newly secreted PCI remains fully active until after ejaculation and mixing with its several protease targets with prostatic origin (Espana et al., 2007). As a result of this complexing, PCI activity gradually drops, until it eventually becomes fully inactive approximately 2 hours after ejaculation. PCI was shown to be important in several steps of human reproduction, notably in the fertilization process, through inhibition of sperm both binding to and penetrating into oocytes (Espana et al., 2007). Several physiological targets of PCI have been identified in the semen. These include several seminal KLKs (KLK1-3) and tPA and uPA. Notably, PCI is able to almost completely inhibit KLK2 in the semen (Heeb and Espana, 1998). This was shown by a nearly complete removal of KLK2 complexes in the semen by an antibody directed to PCI (Heeb and Espana, 1998). However, further in vitro inhibition profiling indicated a fourfold increase in the association constant of PCI and KLK2, in the pres-

320

Nashmil Emami, and Eleftherios P. Diamandis

ence of heparin (Lovgren et al., 1999a), pointing to a potential cross-talk between the seminal KLK network and other fibrinolytic components of the semen. A similar complex structure was identified for KLK3. Inhibition of KLK3 by PCI is regulated in part through a ternary complex formation between PCI, KLK3 and the semenogelin component of semen coagula (Kise et al., 1996). Formation of this complex and therefore inhibition of seminal KLK3 is modulated by a number of seminal factors, including heparin, zinc, semen pH, and overall ionic strength (Kise et al., 1996). In addition, given its chymotrypsin-like substrate selectivity, KLK3 inhibition by seminal chymotrypsin inhibitors has been the subject of many studies. Surprisingly, contrary to the inhibition of KLK3 by α1-antichymotrypsin inhibitor in blood, this inhibitory route was not found in semen (Qian et al., 1997), despite the high concentration of α1-antichymotrypsin in seminal plasma. This may suggest a potential interference of zinc ions in the complexing of seminal KLK3 with this inhibitor (Qian et al., 1997). Similarly, the protease inhibitor α2-macroglobulin was shown to inhibit seminal KLK2 and KLK3 (Birkenmeier et al., 1998; Heeb and Espana, 1998). Interestingly, this inhibition may be target-specific, as no in vitro inhibition was observed for KLK 4, 5, 6, 12, and 13 (Goettig et al., 2010). Given the low concentration of α2-macroglobulin in seminal plasma, the physiological inhibitory contribution of this inhibitor is expected to be minimal (Kramer et al., 1992). Instead, seminal α2-macroglobulin may play a functional role upon complex formation with its target in seminal plasma. In support of this hypothesis, seminal α2-macroglobulin was shown to be clinically correlated with sperm motility and overall quality of the sperm (Glander et al., 1996). These processes are speculated to be mediated in part through the processing of α2-macroglobulin by its target proteases, which in turn leads to conformational changes of the inhibitor and exposure of its receptor binding site (Birkenmeier et al., 1998). Subsequent binding of α2-macroglobulin complex to its receptor on the surface of spermatozoa may model the aforementioned functions.

12.4.3 Other inhibitory mechanisms of seminal KLKs Alternatively, seminal KLKs may catalyze their own inhibition by self-cleavage, or become cleaved by other proteases. Such inhibitory mechanisms have been suggested for KLK2, 5, 11, 13, and 14 (Borgoño et al., 2007; Charlesworth et al., 1999; Emami and Diamandis, 2007; Luo et al., 2006; Michael et al., 2005; Sotiropoulou et al., 2003). Autolytic inhibition is believed to play a key role as a negative feedback loop in the seminal KLK activation cascade. Likewise, internal cleavages mediated by other proteases may represent potential cross-talks between seminal KLKs and other seminal proteases. Such potential regulatory interplay between seminal proteases has been proposed as the principal inhibitory mechanism in certain seminal KLKs, more notably in KLK11. KLK11 was shown to be cleaved by the thrombostasis axis protease plasmin

Kallikrein-related Peptidases and Semen

321

(Luo et al., 2006). In vitro evidence suggests a highly specific and controlled cleavage at a single site and generation of two 20 kDa peptides, homologous to the observed cleaved native KLK11. However, full inhibition was reportedly not achieved in vitro, which may indicate a more complex regulatory web that might exist in the semen microenvironment. Lack of plasmin cofactors or negative feedback loops through cleaved KLK11 have been proposed as a possible explanation for the observed, partial, in vitro inhibition of KLK11 by plasmin (Luo et al., 2006). Lastly, inhibition through compartmentalization has been suggested for some KLKs, particularly for KLK4. The in-solution KLK4 oligomer, with a molecular weight of 700 kDa, reportedly shows almost no activity against its chromogenic and fluorogenic substrates (Debela et al., 2006). However, the refolded KLK4, in the presence of 2 mM calcium ions, was shown to be highly active and have a significantly smaller size (25 kDa) (Goettig et al., 2010).

12.4.4 Seminal proteolytic activation cascade Seminal KLKs are synthesized in the prostate as zymogens and are activated extracellularly by cleavage of their propetides at the N-terminus (Borgoño and Diamandis, 2004). The activation processes of seminal KLKs are mediated through a highly orchestrated cascade and include a step-wise activation of the initiator, progressor, and executor proteases. At each level of the cascade, proteolytic activation may include auto-activation and activation by other seminal KLKs or proteases. Such potential cross-activation processes, particularly through the thrombostasis axis proteases such as plasmin, plasma kallikrein, and factor Xa, and through other proteases such as uPA and matrix metalloproteinases (MMP) have been suggested (Beaufort et al., 2006; Luo et al., 2006; Ramani et al., 2011). According to the accumulating in vitro and ex vivo experiments, KLK5 and KLK14 can be autoactivated and in turn activate the key executor seminal KLK, pro-KLK3 (Borgoño et al., 2007; Emami et al., 2008; Michael et al., 2006). To avoid deleterious effects due to excessive activity at the execution level, activated KLK3 is consequently inhibited in part by its activator KLKs through internal fragmentation (Malm and Lilja, 1995). Even though still debatable, active KLK2 may also activate pro-KLK3 in a similar manner. KLK14 may also activate additional seminal KLKs, namely KLK1 and 11 (Emami et al., 2008). Similar to classical proteolytic cascades such as the blood coagulation cascade, a number of positive and negative feedback loops may exist in the seminal KLK cascade. As discussed above, negative feedback loops are often mediated by internal catalysis or autolysis. Such feedback loops have been well demonstrated in a number of seminal KLKs, including KLK2, 3, 5, 11, 14 (Pampalakis and Sotiropoulou, 2007). Similarly, positive feedback loops through other proteases or auto-activation have been postulated (Paju et al., 2000; Pampalakis and Sotiropoulou, 2007). These feedback loops are instrumental in a rapid and physiologically safe amplification of active seminal KLKs.

322

Nashmil Emami, and Eleftherios P. Diamandis

12.5 Conclusions and outlook KLKs, and more particularly KLK3, are one of the most extensively characterized prostatic biomarkers. Despite this, we are only at the beginning of our understanding of the complex nature of their activation, downstream targets, regulatory and signaling pathways, and cross-talks with other proteases in seminal plasma. This chapter has provided an insight into the functional significance and regulatory mechanisms of the seminal KLK family. Recent studies have significantly advanced our understanding of the function of seminal KLKs in the key processes of homeostasis balance, sperm motility, and reproductive immunity, yet many questions remain to be answered. Based on the available information, potential pathological roles of seminal KLKs in male sub-fertility are presented in Fig. 12.1. It is hoped that our increasing knowledge about the biological mechanisms and the pathological role of seminal KLKs will lead to an improved understanding of the etiology of male sub-fertility and the design of highly specific therapeutic compounds against those seminal KLKs involved in the pathogenesis of the complex reproductive defects. In the meantime, some KLKs, especially PSA (KLK3), will continue to be used as premier biomarkers of prostatic adenocarcinoma.

abnormal expression of activators of the seminal KLK cascade

abnormal expression of the inhibitory components of the seminal KLK cascade

structural defects that cause abnormal catalysis

defective feedback loops dysregulated activation of the downstream targets

aberrant activation of seminal KLKs

dysregulated immune response following sperm entry

semen homeostasis imbalance

abnormal sperm motility

reduced male fertility

Fig. 12.1 Hypothetical mechanisms of impaired fertility through aberrant expression or regulation of seminal KLKs.

Kallikrein-related Peptidases and Semen

323

Abbreviations KLK PAR PCI TGF

Kallikrein-related peptidase Protease activated receptor Protein C inhibitor Transforming growth factor

Bibliography Arnaud, A., Schved, J.F., Gris, J.C., Costa, P., Navratil, H., and Humeau, C. (1994). Tissue-type plasminogen activator level is decreased in human seminal plasma with abnormal liquefaction. Fertil. Steril. 61, 741–745. Beaufort, N., Debela, M., Creutzburg, S., Kellermann, J., Bode, W., Schmitt, M., Pidard, D., and Magdolen, V. (2006). Interplay of human tissue kallikrein 4 (hK4) with the plasminogen activation system: hK4 regulates the structure and functions of the urokinase-type plasminogen activator receptor (uPAR). Biol. Chem. 387, 217–222. Birkenmeier, G., Usbeck, E., Schäfer, A., Otto, A., and Glander, H.J. (1998). Prostate-specific antigen triggers transformation of seminal α2-macroglobulin (α2-M) and its binding to α2-macroglobulin receptor/low-density lipoprotein receptor-related protein (α2-M-R/LRP) on human spermatozoa. Prostate 36, 219–225. Borgoño, C.A., and Diamandis, E.P. (2004). The emerging roles of human tissue kallikreins in cancer. Nat. Rev. Cancer 4, 876–890. Borgoño, C.A., Michael, I.P., Shaw, J.L., Luo, L.Y., Ghosh, M.C., Soosaipillai, A., Grass, L., Katsaros, D., and Diamandis, E.P. (2007). Expression and functional characterization of the cancer-related serine protease, human tissue kallikrein 14. J. Biol. Chem. 282, 2405–2422. Charlesworth, M.C., Young, C.Y., Miller, V.M., and Tindall, D.J. (1999). Kininogenase activity of prostate-derived human glandular kallikrein (hK2) purified from seminal fluid. J. Androl. 20, 220–229. Christensson, A., Laurell, C.B., and Lilja, H. (1990). Enzymatic activity of prostate-specific antigen and its reactions with extracellular serine proteinase inhibitors. Eur. J. Biochem. 194, 755–763. Chu, T.M., Nocera, M.A., Flanders, K.C., and Kawinski, E. (1996). Localization of seminal plasma transforming growth factor-beta1 on human spermatozoa: an immunocytochemical study. Fertil. Steril. 66, 327–330. Clements, J., Mukhtar, A., Yan, S., and Holland, A. (1997). Kallikreins and kinins in inflammatory-like events in the reproductive tract. Pharmacol. Res. 35, 537–540. Crawford, S.E., Stellmach, V., Murphy-Ullrich, J.E., Ribeiro, S.M., Lawler, J., Hynes, R.O., Boivin, G.P., and Bouck, N. (1998). Thrombospondin-1 is a major activator of TGF-beta1 in vivo. Cell 93, 1159–1170. de Lamirande, E., Yoshida, K., Yoshiike, T.M., Iwamoto, T., and Gagnon, C. (2001). Semenogelin, the main protein of semen coagulum, inhibits human sperm capacitation by interfering with the superoxide anion generated during this process. J. Androl. 22, 672–679. de Lamirande, E. (2007). Semenogelin, the main protein of the human semen coagulum, regulates sperm function. Semin. Thromb. Hemost. 33, 60–68. Debela, M., Magdolen, V., Grimminger, V., Sommerhoff, C., Messerschmidt, A., Huber, R., Friedrich, R., Bode, W., and Goettig, P. (2006). Crystal structures of human tissue kallikrein 4: activity modulation by a specific zinc binding site. J. Mol. Biol. 362, 1094–1107.

324

Nashmil Emami, and Eleftherios P. Diamandis

Emami, N., and Diamandis, E.P. (2007). New insights into the functional mechanisms and clinical applications of the kallikrein- related peptidase family. Mol. Oncol. 1, 269–287. Emami, N., Deperthes, D., Malm, J., and Diamandis, E.P. (2008). Major role of human KLK14 in seminal clot liquefaction. J. Biol. Chem. 283, 19561–19569. Emami, N., Scorilas, A., Soosaipillai, A., Earle, T., Mullen, B., and Diamandis, E.P. (2009). Association between kallikrein-related peptidases (KLKs) and macroscopic indicators of semen analysis: their relation to sperm motility. Biol. Chem. 390, 921–929. Emami, N., and Diamandis, E.P. (2010). Potential role of multiple members of the kallikrein-related peptidase family of serine proteases in activating latent TGF beta 1 in semen. Biol. Chem. 391, 85–95. España, F., Navarro, S., Medina, P., Zorio, E., and Estelles, A. (2007). The role of protein C inhibitor in human reproduction. Semin. Thromb. Hemost. 33, 41–45. Fernandez, J.A., Heeb, M.J., Radtke, K.P., and Griffin, J.H. (1997). Potent blood coagulant activity of human semen due to prostasome-bound tissue factor. Biol. Reprod. 56, 757–763. Flickinger, C.J., Herr, J.C., McGee, R.S., Sigman, M., Evans, R.J., Sutherland, W.M., Summers, T.A., Spell, D.R., and Conklin, D.J. (1990). Dynamics of a human seminal vesicle specific protein. Andrologia 22 (Suppl 1), 142–154. Gentry, L.E., Lioubin, M.N., Purchio, A.F., and Marquardt, H. (1988). Molecular events in the processing of recombinant type 1 pre-pro-transforming growth factor beta to the mature polypeptide. Mol. Cell Biol. 8, 4162–4168. Giojalas, L.C., Rovasio, R.A., Fabro, G., Gakamsky, A., and Eisenbach, M. (2004). Timing of sperm capacitation appears to be programmed according to egg availability in the female genital tract. Fertil. Steril. 82, 247–249. Glander, H.J., Kratzsch, J., Weisbrich, C., and Birkenmeier, G. (1996). Insulin-like growth factor-I and α2-macroglobulin in seminal plasma correlate with semen quality. Hum. Reprod. 11, 2454–2460. Goettig, P., Magdolen, V., and Brandstetter, H. (2010). Natural and synthetic inhibitors of kallikreinrelated peptidases (KLKs). Biochimie 92, 1546–1567. Harris, C.L., Mizuno, M., and Morgan, B.P. (2006). Complement and complement regulators in the male reproductive system. Mol. Immunol. 43, 57–67. Heeb, M.J., and España, F. (1998). α2-macroglobulin and C1-inactivator are plasma inhibitors of human glandular kallikrein. Blood Cells Mol. Dis. 24, 412–419. Huggins, C., and Neal, W. (1942). Coagulatin and liquefaction of semen: proteolytic enzymes and citrate in prostatic fluid. J. Exp. Med. 76, 527–541. Ikawa, M., Inoue, N., Benham, A.M., and Okabe, M. (2010). Fertilization: a sperm’s journey to and interaction with the oocyte. J. Clin. Invest. 120, 984–994. Jequier, A.M. (2000). The anatomy and physiology of the male genital tract. In Male Infertility: A guide for the Clinician (Malden: Blackwell Science, Inc), pp. 8–26. Kise, H., Nishioka, J., Kawamura, J., and Suzuki, K. (1996). Characterization of semenogelin II and its molecular interaction with prostate-specific antigen and protein C inhibitor. Eur. J. Biochem. 238, 88–96. Kramer, M.D., Simon, M.M., Tilgen, W., Naher, H., Justus, C.W., and Petzoldt, D. (1992). Alpha 2-macroglobulin and alpha 2-macroglobulin/proteinase complexes in human seminal fluid. Fertil. Steril. 57, 417–421. Lilja, H. (1985). A kallikrein-like serine protease in prostatic fluid cleaves the predominant seminal vesicle protein. J. Clin. Invest. 76, 1899–1903. Lilja, H., Abrahamsson, P.A., and Lundwall, A. (1989). Semenogelin, the predominant protein in human semen. Primary structure and identification of closely related proteins in the male accessory sex glands and on the spermatozoa. J. Biol. Chem. 264, 1894–1900.

Kallikrein-related Peptidases and Semen

325

Lilja, H. and Laurell, C.B. (1985). The predominant protein in human seminal coagulate. Scand. J. Clin. Lab. Invest. 45, 635–641. Lishko, P.V., Botchkina, I.L., and Kirichok, Y. (2011). Progesterone activates the principal Ca2+ channel of human sperm. Nature 471, 387–391. Lövgren, J., Airas, K., and Lilja, H. (1999a). Enzymatic action of human glandular kallikrein 2 (hK2). Substrate specificity and regulation by Zn2+ and extracellular protease inhibitors. Eur. J. Biochem. 262, 781–789. Lövgren, J., Valtonen-Andre, C., Marsal, K., Lilja, H., and Lundwall, A. (1999b). Measurement of prostate-specific antigen and human glandular kallikrein 2 in different body fluids. J. Androl. 20, 348–355. Luo, L.Y., Shan, S.J., Elliott, M.B., Soosaipillai, A., and Diamandis, E.P. (2006). Purification and characterization of human kallikrein 11, a candidate prostate and ovarian cancer biomarker, from seminal plasma. Clin. Cancer Res. 12, 742–750. Lwaleed, B.A., Greenfield, R., Stewart, A., Birch, B., and Cooper, A.J. (2004). Seminal clotting and fibrinolytic balance: a possible physiological role in the male reproductive system. Thromb. Haemost. 92, 752–766. Lwaleed, B.A., Greenfield, R.S., Birch, B.R., and Cooper, A.J. (2005). Does human semen contain a functional haemostatic system? A possible role for tissue factor pathway inhibitor in fertility through semen liquefaction. Thromb. Haemost. 93, 847–852. Lwaleed, B.A., Goyal, A., Delves, G.H., and Cooper, A.J. (2007). Seminal hemostatic factors: then and now. Semin. Thromb. Haemost. 33, 3–12. Lyons, R.M., Gentry, L.E., Purchio, A.F., and Moses, H.L. (1990). Mechanism of activation of latent recombinant transforming growth factor beta 1 by plasmin. J. Cell Biol. 110, 1361–1367. Malm, J., Hellman, J., Hogg, P., and Lilja, H. (2000). Enzymatic action of prostate-specific antigen (PSA or hK3): substrate specificity and regulation by Zn2+, a tight-binding inhibitor. Prostate 45, 132–139. Malm, J., and Lilja, H. (1995). Biochemistry of prostate specific antigen, PSA. Scand. J. Clin. Lab. Invest. Suppl. 221, 15–22. Matsuda, Y., Oshio, S., Yazaki, T., Umeda, T., and Akihama, S. (1994). The effect of some proteinase inhibitors on liquefaction of human semen. Hum. Reprod. 9, 664–668. Matsumura, M., Bhatt, A.S., Andress, D., Clegg, N., Takayama, T.K., Craik, C.S., and Nelson, P.S. (2005). Substrates of the prostate-specific serine protease prostase/KLK4 defined by positional-scanning peptide libraries. Prostate 62, 1–13. Michael, I.P., Sotiropoulou, G., Pampalakis, G., Magklara, A., Ghosh, M., Wasney, G., and Diamandis, E.P. (2005). Biochemical and enzymatic characterization of human kallikrein 5 (hK5), a novel serine protease potentially involved in cancer progression. J. Biol. Chem. 280, 14628–14635. Michael, I.P., Pampalakis, G., Mikolajczyk, S.D., Malm, J., Sotiropoulou, G., and Diamandis, E.P. (2006). Human tissue kallikrein 5 is a member of a proteolytic cascade pathway involved in seminal clot liquefaction and potentially in prostate cancer progression. J. Biol. Chem. 281, 12743–12750. Mikolajczyk, S.D., Millar, L.S., Kumar, A., and Saedi, M.S. (1999). Prostatic human kallikrein 2 inactivates and complexes with plasminogen activator inhibitor-1. Int. J. Cancer 81, 438–442. Miska, W. and Schill, W.B. (1990). Enhancement of sperm motility by bradykinin and kinin analogs. Arch. Androl. 25, 63–67. Nocera, M. and Chu, T.M. (1993). Transforming growth factor beta as an immunosuppressive protein in human seminal plasma. Am. J. Reprod. Immunol. 30, 1–8. Nocera, M. and Chu, T.M. (1995). Characterization of latent transforming growth factor-beta from human seminal plasma. Am. J. Reprod. Immunol. 33, 282–291.

326

Nashmil Emami, and Eleftherios P. Diamandis

Nun, S., Musacchio, I., and Epstein, J.A. (1972). Variations in seminal plasma constituents from fertile, subfertile, and vasectomized azoospermic men. Fertil. Steril. 23, 357–360. Oikonomopoulou, K., Hansen, K.K., Saifeddine, M., Tea, I., Blaber, M., Blaber, S.I., Scarisbrick, I., Andrade-Gordon, P., Cottrell, G.S., Bunnett, N.W., Diamandis, E.P., and Hollenberg, M.D. (2006). Proteinase-activated receptors, targets for kallikrein signaling. J. Biol. Chem. 281, 32095–32112. Owen, D.H. and Katz, D.F. (2005). A review of the physical and chemical properties of human semen and the formulation of a semen simulant. J. Androl. 26, 459–469. Ozaki, Y., Blomgren, K., Ogasawara, M.S., Aoki, K., Furuno, T., Nakanishi, M., Sasaki, M., and Suzumori, K. (2001). Role of calpain in human sperm activated by progesterone for fertilization. Biol. Chem. 382, 831–838. Paju, A., Bjartell, A., Zhang, W.M., Nordling, S., Borgström, A., Hansson, J., and Stenman, U.H. (2000). Expression and characterization of trypsinogen produced in the human male genital tract. Am. J. Pathol. 157, 2011–2021. Pampalakis, G., and Sotiropoulou, G. (2007). Tissue kallikrein proteolytic cascade pathways in normal physiology and cancer. Biochim. Biophys. Acta 1776, 22–31. Polak, B., and Daunter, B. (1989). Seminal plasma biochemistry. IV: Enzymes involved in the liquefaction of human seminal plasma. Int. J. Androl. 12, 187–194. Qi, H., Moran, M.M., Navarro, B., Chong, J.A., Krapivinsky, G., Krapivinsky, L., Kirichok, Y., Ramsey, I.S., Quill, T.A., and Clapham, D.E. (2007). All four CatSper ion channel proteins are required for male fertility and sperm cell hyperactivated motility. Proc. Natl. Acad. Sci. USA 104, 1219–1223. Qian, Y., Sensibar, J.A., Zelner, D.J., Schaeffer, A.J., Finlay, J.A., Rittenhouse, H.G., and Lee, C. (1997). Two-dimensional gel electrophoresis detects prostate-specific antigen-α1-antichymotrypsin complex in serum but not in prostatic fluid. Clin. Chem. 43, 352–359. Ramani, V.C., Kaushal, G.P., and Haun, R.S. (2011). Proteolytic action of kallikrein-related peptidase 7 produces unique active matrix metalloproteinase-9 lacking the C-terminal hemopexin domains. Biochim. Biophys. Acta 1813, 1525–1531. Robert, M. and Gagnon, C. (1996). Purification and characterization of the active precursor of a human sperm motility inhibitor secreted by the seminal vesicles: identity with semenogelin. Biol. Reprod. 55, 813–821. Robert, M., and Gagnon, C. (1999). Semenogelin I: a coagulum forming, multifunctional seminal vesicle protein. Cell Mol. Life Sci. 55, 944–960. Robertson, S.A., Ingman, W.V., O’Leary, S., Sharkey, D.J., and Tremellen, K.P. (2002). Transforming growth factor beta – a mediator of immune deviation in seminal plasma. J. Reprod. Immunol. 57, 109–128. Robertson, S.A. (2005). Seminal plasma and male factor signalling in the female reproductive tract. Cell Tissue Res. 322, 43–52. Schill, W.B., and Miska, W. (1992). Possible effects of the kallikrein-kinin system on male reproductive functions. Andrologia 24, 69–75. Shaw, J.L., and Diamandis, E.P. (2007). Distribution of 15 human kallikreins in tissues and biological fluids. Clin. Chem. 53, 1423–1432. Shaw, J.L., Petraki, C., Watson, C., Bocking, A., and Diamandis, E.P. (2008). Role of tissue kallikreinrelated peptidases in cervical mucus remodelling and host defense. Biol. Chem. 389, 1513–1522. Siems, W.E., Maul, B., Wiesner, B., Becker, M., Walther, T., Rothe, L., and Winkler, A. (2003). Effects of kinins on mammalian spermatozoa and the impact of peptidolytic enzymes. Andrologia 35, 44–54. Sorensen, O.E., Gram, L., Johnsen, A.H., Andersson, E., Bangsboll, S., Tjabringa, G.S., Hiemstra, P.S., Malm, J., Egesten, A., and Borregaard, N. (2003). Processing of seminal plasma hCAP-18 to

Kallikrein-related Peptidases and Semen

327

ALL-38 by gastricsin: a novel mechanism of generating antimicrobial peptides in vagina. J. Biol. Chem. 278, 28540–28546. Sotiropoulou, G., Rogakos, V., Tsetsenis, T., Pampalakis, G., Zafiropoulos, N., Simillides, G., Yiotakis, A., and Diamandis, E.P. (2003). Emerging interest in the kallikrein gene family for understanding and diagnosing cancer. Oncol. Res. 13, 381–391. Takayama, T.K., McMullen, B.A., Nelson, P.S., Matsumura, M., and Fujikawa, K. (2001). Characterization of hK4 (prostase), a prostate-specific serine protease: activation of the precursor of prostate specific antigen (pro-PSA) and single-chain urokinase-type plasminogen activator and degradation of prostatic acid phosphatase. Biochemistry 40, 15341–15348. Tang, S.C., Leung, J.C., and Lai, K.N. (2011). The kallikrein-kinin system. Contrib. Nephrol. 170, 145–155. Tauber, P.F., and Zaneveld, L.J. (1981). Coagulation and liquefaction of human semen. In Biochemical Andrology, Hafez E.S.E., ed. (St. Louis: Mosby), pp. 153–166. Weidinger, S., Mayerhofer, A., Frungieri, M.B., Meineke, V., Ring, J., and Kohn, F.M. (2003). Mast cell-sperm interaction: evidence for tryptase and proteinase-activated receptors in the regulation of sperm motility. Hum. Reprod. 18, 2519–2524. Yoshida, K., Kawano, N., Yoshiike, M., Yoshida, M., Iwamoto,T., and Morisawa, M. (2008). Physiological roles of semenogelin I and zinc in sperm motility and semen coagulation on ejaculation in humans. Mol. Hum. Reprod. 14, 151–156. Zitta, K., Albrecht, M., Weidinger, S., Mayerhofer, A., and Kohn, F. (2007). Protease activated receptor 2 and epidermal growth factor receptor are involved in the regulation of human sperm motility. Asian J. Androl. 9, 690–696.

Maria Brattsand

13 Kallikrein-related Peptidases and Inhibitors of the Skin 13.1 Introduction The skin is the largest organ of the body, and we cannot survive without it. It protects us from mechanical stress, UV-light, and harmful agents like toxins, bacteria, and viruses, at the same time as it keeps the homeostasis of the organism intact by preventing free diffusion of water molecules and ions through the skin barrier. Our skin also has a very important social function that is often overlooked. Human skin is composed of three main layers, i.e. the underlying subcutis, the dermis and the superficial epidermis (Fig. 13.1). The subcutis is mainly composed of adipose tissue, with fat cells as the dominating cell-type. It serves to protect from trauma and functions as a temperature isolator. The thickness of the subcutis is dependent on heredity, hormone balance, and nutrition. The dermis is a 0.3–3 mm thick layer composed of cells, collagen fibers, and a matrix of glucosaminoglycans and hyaluronic acid. The dermis provides the vascular supply for the avascular epidermis and a base for the skin appendages. Blood vessels and nerves, present in the dermis, are of great importance for body temperature regulation. The most common cell type in the dermis is the fibroblast (Young et al., 2000). The epidermis is the outermost layer of the skin, which confers the barrier function. It is mainly built up from keratinocytes that are formed in a basal cell layer. From this layer, the cells migrate up towards the skin surface at the same time as they undergo a tightly regulated differ-

stratum corneum

epidermis

stratum basale hair shaft root sheath

dermis sebaceous gland

subcutis

hair erector muscle hair follicle sweat gland

blood vessels

Fig. 13.1 Schematic cross-section of the skin. Schematic picture showing the three main layers of human skin, i.e. epidermis, dermis, and subcutis. The stratum basale is shown with its characteristic downward folds. The figure also shows the principle skin appendages, hairs, sebaceous glands, and sweat glands. With courtesy of K. Stefansson.

330

Maria Brattsand

entiation process. When the cells reach the outermost surface, the stratum corneum (SC), they are metabolically dead, flattened and filled with keratin (Candi et al., 2005). The cells normally reside at the skin surface for 1–4 weeks before they are shed by a process named desquamation (Fig. 13.2). To maintain a healthy epidermis, it is very important that there is a balance between the proliferation in the basal cell layer and the shedding of cells from the surface. Imbalance between the two processes causes health problems like psoriasis (too high proliferation rate) or ichtyosis (shedding process too slow) (Egelrud, 2000). From the mid 1960’s on, it was believed that lipids were the main mediators of both cohesion and the barrier function of epidermal permeability, and SC was regarded as a “plastic wrap” that surrounds the body. During the 1970s, the concept changed and the SC was compared to a brick wall, with the corneocytes (the “bricks”) being embedded in and held together by intercellular lipids (the “mortar”). This model was supported by the fact that inherited disorders of lipid metabolism are associated with clinical ichtyosis with abnormal scaling, due to decreased desquamation (Elias, 2004). At the end of the 1980s, the group of Egelrud developed an in vitro model that could be used to show that protease activity is necessary for the desquamation process to occur (Egelrud et al., 1988; Egelrud and Lundstrom, 1991; Lundstrom and Egelrud, 1990). The microenvironment of the outer layers of the epidermis makes special demands on the proteases acting there. First of all, the skin surface is described as an acidic mantle with a pH varying between pH 4.5–6, depending on location and age of the person, while the deeper, living layers of the epidermis are more neutral (Ohman and Vahlquist, 1994). More recent studies, using refined measuring methods, have shown that there is no consistent pH gradient. Instead, acidic micro domains

(a)

(b)

(c) sweat duct

desquamated cell

SC SG

SS desmosome SB

Fig. 13.2 Epidermis. (a) Normal non-palmo-plantar skin from the lower back. (b) Palmar skin. (c) Schematic representation of the epidermis. SB, stratum basale. SS, stratum spinosum. SG, stratum granulosum. SC, stratum corneum. Sections were stained with eosin-hematoxylin. Note the different scales and the spiral-formed sweat duct in b. With courtesy of K. Stefansson.

Kallikrein-related Peptidases and Inhibitors of the Skin

331

(average pH 6) can be found in the extracellular matrix. The intracellular space of the corneocytes in mid-SC approaches neutrality (average pH 7.0). The surface is acidic. The average pH of the SC increases with depth due to a decrease in the ratio of acidic to neutral regions within the SC (Hanson et al., 2002). It has been shown that the KLKs that are thought to be involved in the desquamation process have an optimum pH that is slightly basic, but they also have considerable activity within the pH range of the outer layers of the SC (Borgoño et al., 2007; Brattsand et al., 2005; Caubet et al., 2004; Ekholm et al., 1999). In vitro studies suggest that the activation rate for KLK5 cleaving the pro-peptide of KLK7 is even enhanced at more acidic conditions (Brattsand et al., 2005). In vivo studies have also shown that the pH is crucial for an impaired skin barrier – more basic conditions lead to increased serine protease activity and an increase in water evaporation, which is a measurement of the barrier capacity. Reduced acidity also results in delay of barrier recovery after injury (Hachem et al., 2003). Another restricting factor is the water content of the SC intercellular space. The amount of water influences both the pH and the concentration of agents, and thereby the activity of the different proteases that are present. However, at least KLK7 seems to be well-adapted to function in the water-restricted environment (Watkinson et al., 2001).

13.2 KLKs in the epidermis Various experiments have shown that both chymotryptic and tryptic enzyme activity is necessary for desquamation (Egelrud and Lundstrom, 1991; Suzuki et al., 1993; 1994). The first enzyme to be purified from human stratum corneum in active form was stratum corneum chymotryptic enzyme (SCCE, now named KLK7) (Hansson et al., 1994), followed by stratum corneum tryptic enzyme (SCTE, now named KLK5) (Brattsand and Egelrud, 1999), and KLK14 (Stefansson et al., 2006). Since then, a majority of the KLKs has been detected in the skin, either at the mRNA or protein level, or at both (Ekholm and Egelrud, 1998; Ekholm et al., 1998; 2000; Komatsu et al., 2003; 2005a and b; Sondell et al., 1994; 1996; Stefansson et al., 2006). Published data regarding the expression of KLKs in the epidermis and its appendages are summarized in Tab. 13.1. There are contradictions in the available literature concerning the levels of expression, but it seems that many of the KLKs have a very similar expression pattern. The expression is often localized to keratinizing squamous epithelia and locations where desquamation occurs, like the skin surface and parts of the hair follicle and sebaceous glands. An exception is KLK14, which seems to be primarily expressed in sweat glands and low levels are found in the SC, compared to KLK5 and KLK7 (Stefansson et al., 2006). Recently, the role of KLK8 in human epidermis and sweat was studied. Cell culture experiments showed that only keratinocytes, but neither fibroblasts nor melanocytes,

332

Maria Brattsand

produce KLK8. Induction of terminal differentiation of keratinocytes induces KLK8 protein expression. KLK8 could be immunoprecipitated from extracts of non-palmo plantar epidermis and sweat samples and, in contrast to what has been found for KLK5 and KLK7, the majority of KLK8 was present in its mature, activated form. Interestingly, so far no endogenous inhibitors have been found that inhibit KLK8 activity (Brattsand et al., 2009; Eissa et al., 2011; Ekholm et al., 1999). It has been shown that KLK8, like KLK5 and KLK7, is transported to the apical region of granular keratinocytes by lamellar granules (Ishida-Yamamoto et al., 2004; 2005; Sondell et al., 1995). Animal experiments indicate that KLK8 could be important in the recovery process after induction of inflammation (Kirihara et al., 2003; Kishibe et al., 2007).

13.3 Desquamation Desmosomes are a type of anchoring junctions which mechanically connect cells and their cytoskeleton like a tiny button between the cells (Fig. 13.2). The intracellular part of the desmosome consists of a dense cytoplasmic plaque, composed of plakoglobin and desmoplakin, which are intracellular anchoring proteins. Via plakoglobin and desmoplakin, the cytoskeleton is connected to the transmembrane adhesion proteins desmoglein (DSG) and desmocollin (DSC). Desmosomes found in the SC have been altered during the keratinization process. During the last stages of keratinization, corneodesmosin (CDSN) is synthesized. CDSN is present in the extracellular part of the altered desmosome called corneodesmosome (Brody, 1968; Haftek et al., 1997; Lundstrom et al., 1994; Raknerud, 1975; Serre et al., 1991). Proteolytic degradation of the corneodesmosomes is necessary for the cell shedding seen to occur in the desquamation process (Egelrud et al., 1988). It has been shown that both KLK5 and KLK7 have the ability to degrade epidermally derived CDSN and DSC1 at both pH 7.2 and pH 5.6 (Caubet et al., 2004; Simon et al., 2001). Interestingly, KLK5 does not degrade recombinant CDSN, implying that the degradation seen when using epidermally derived CDSN could be an indirect effect where KLK5 activates another enzyme present in the CDSN lysate. It was also shown that KLK5, but not KLK7, can degrade DSG1,2 at pH 5.6 but not pH 7.2 (Caubet et al., 2004; Simon et al., 2001). This was somewhat contradicted in a later study, where Borgoño et al. (2007) showed degradation by KLK5 of a DSG1-chimeric protein fused to the Fc region of human IgG fusion protein at both pH 5.4 and 7.6. In the latter study, the authors also showed that the DSG1-Fc protein was an excellent substrate for KLK14. KLK6 also showed the ability to cleave the molecule, but did so slightly less efficiently than KLK5. Minimal activity was detected for KLK1 and no DSG1 degrading activity was recognized for KLK13 (Borgoño et al., 2007).

Kallikrein-related Peptidases and Inhibitors of the Skin

333

Tab. 13.1 Expression pattern (protein/mRNA) of KLKs present in human epidermis and appendages. KLK1 KLK4 KLK5 KLK6 KLK7 KLK8 KLK9 KLK10 KLK11 KLK13 KLK14 a

Stratum corneum Stratum granulosum Stratum spinosum Stratum basale Hair inner root sheath Hair outer root sheath Sebaceous gland / duct Sweat gland / duct

nd nd/+

nd nd/+

+ +/nd

+ +/+

+ +/+

+ +/–

nd nd/+

+ nd/+

+ nd/+

+ +/+

+ +/+

nd/+

nd/+

– /nd +/+

– /–

+/–

nd/–

nd/+

nd/+

+/+

+/+

nd/+

nd/+

– /nd +/+

–/–

+/–

nd/–

nd/–

nd/+

+/+

–/+

nd/+

nd/+

+/nd

+/+

+/nd

+/–

nd/+

nd/+

nd/+

+/+

nd/+

nd/+

nd/+

– /nd +/+

+/nd

+/–

nd/–

nd/+

nd/+

+/–

nd/–

nd/+

nd/+

+/nd

+/+

+/nd

+/–

nd/+

nd/+

nd/+

+/+

+/+

nd/+

nd/+

+/nd

+/+

+/nd

+/–

nd/+

nd/+

nd/+

+/+

+/+

a in SC only protein was determined, no mRNA present nd = no data available; + positive signal; – no signal detected

13.4 Regulation of protease activity A tight regulation of protease activity is crucial for a well-functioning epidermis. Several studies show that increased protease activity is correlated with impaired barrier function (Descargues et al., 2005; Hachem et al., 2003; Hachem et al., 2006; Komatsu et al., 2002). Regulation can occur at several different levels, i.e. by gene expression, translation efficiency, posttranslational modifications, by activation of inactive zymogens, and by inhibitors. Also, other factors in the environment can influence the activity, such as pH and water content, as mentioned in the introduction section. It is well known that serine protease activities can be regulated by endogenous cations. The influence of different metal ions and other inhibitors on KLK activity was reviewed by Goettig et al. (2010). Ca2+, Mg2+, Na+ and K+ can stimulate the activity of several KLKs, while Zn2+ is an efficient inhibitor.

13.4.1 KLK activation All KLKs are produced as inactive pro-forms. Some enzymes, like proKLK2, proKLK5, and proKLK12, seem to have the ability to auto-activate themselves, and thereafter activate other members of the KLK family, thereby starting a proteolytic cascade in the epidermis. KLK5 may be a key player in the epidermis, inasfar as it is the only enzyme

334

Maria Brattsand

found that can activate the proform of KLK7 (Brattsand et al., 2005; Caubet et al., 2004; Eissa et al., 2011; Yoon et al., 2007). The processes observed were quite slow, but it is important to keep in mind that quite substantial amounts of, for example, KLK5 and KLK7 are found as pro-enzymes in the outer layers of the SC (Ekholm et al., 1999). KLK6 also has the ability to cleave its own pro-peptide, leading to an active enzyme, but the activation rate is negligible compared to the rate of internal autolytic inactivation. Those kinds of negative feedback loops are probably quite common within the KLK family (Blaber et al., 2007; Yoon et al., 2007). More recent data suggest that members of the KLK family are not only restricted to activate members of its own gene family. KLK4, 5 and 8 were shown to be specific activators of the metalloproteases meprin α and β. In skin, meprin α is exclusively expressed in the basal cell layer and was suggested to be involved in basal keratinocyte proliferation, while meprin β is only found in the SG. In vitro, meprin β induces a dramatic change in cell morphology and a significant reduction of the number of cells (Ohler et al., 2010).

13.4.2 KLK inhibitors Inhibitors can act according to different principles of protease inhibition, e.g. attenuation by reversible binding of inhibitors or knock-out inhibition by irreversible binding to the inhibitory molecule, which often involves the formation of covalent bonds. Serpins are inhibitors that react with active serine proteases and form covalent, irreversible complexes. Serpins circulating in the plasma have been shown to be efficient inhibitors of KLK5, 7, 12, and 14 and may also be found in the epidermis (Luo and Jiang, 2006). KLK7, for example, has been purified from plantar SC in complex with α1-antitrypsin (Egelrud, personal communication). Lympho-epithelial Kazal type-related inhibitor (LEKTI) is a serine protease inhibitor that consists of 15 different domains (Fig. 13.3), all with putative inhibitory capacity. Originally, two different peptides were isolated from human blood filtrate and when the corresponding cDNA was cloned, it appeared that the two peptides originated from a common precursor protein. The two peptides found correspond to domain 1 (D1) and 6 (D6) (Mägert et al., 1999). Initial mRNA expression analysis showed expression in the oral mucosa, tonsils, parathyroid glands, Bartholin’s gland, and vaginal epithelium, which led to the conclusion that LEKTI was probably involved in anti-inflammatory and/or antimicrobial protection of mucous epithelia. Two of the domains, D2 and D15, match the sixcysteine pattern of classical Kazal-type inhibitors, except for the fact that the spacing between the first two cysteines is 13 amino acids in D2, and 12 in D15, compared to 6 in the Kazal template (C-(X)6-C-(X)7-C-(X)10-C-(X)2or3-C-(X)17-C, where X could be any amino acid). Comparison of all 15 domains showed that their cysteine patterns are identical, but the non-Kazal type inhibitors lack cysteines 3 and 6. The combination of the expression pattern and the resemblance with the Kazal motif led to the name LEKTI

335

Kallikrein-related Peptidases and Inhibitors of the Skin

3.7 kb 3 kb

D1

D2

D3

D4

D5

D6

D7

D8

D9

D10

D11

D12

D13

D1

D2

D3

D4

D5

D6

D7

D8

D9

D10

D11

D12

D13

D1

D2

D3

D4

D5

D6

D7

D8

D9

D10

D11

D12

D13

D1

D2

D3

D4

D5

37 kD

D6

D7

D8

D9

37 kD

D10

D11

D12

D13

D14

D6

D8

D7

D15

65 kD

D6

7 kD

D8

D7

D9 30 kD D10

D7

D11

D9

D8 D12

D10

D9 D13

D14

145 kD FL

D15 D14

D15

148 kD L 125 kD Sh

D11

D12

D13

D14

D15 102 kD

23 kD

D10

D11

D12

D13

D14

D15

42 kD

68 kD

7 kD

Fig. 13.3 LEKTI transcripts and fragments found in human epidermis. The three transcripts found in human epidermis (black arrows) encode for three pro-peptides, denoted FL (full length), L (long), and Sh (short). The 15 domains are depicted by numbered black boxes. The different fragments resulting from furin cleavage of the pro-peptides can be seen as grey boxes. All predicted sizes are stated to the right of corresponding peptide (Fortugno et al., 2011; Tartaglia-Polcini et al., 2006).

(Magert et al., 1999). Later studies have shown highest amounts of LEKTI transcripts in skin, esophagus and tongue (Tartaglia-Polcini et al., 2006). In the epidermis, the expression correlates well with epithelial differentiation, as strong expression is seen in granular and uppermost spinous layers of epidermis and in differentiated layers of stratified epithelia (Bitoun et al., 2003). LEKTI is transcribed from the SPINK5 gene (serine protease inhibitor of Kazal type 5) in three different isoforms that all seem to be expressed in all SPINK5 transcriptionally active tissues. Both full-length protein from the different isoforms and shorter spliced fragments have been identified from epidermis and cultured normal human keratinocytes (Fig. 13.3) (Ahmed et al., 2001; Bitoun et al., 2003; Deraison et al., 2007; Fortugno et al., 2011; Raghunath et al., 2004; Tartaglia-Polcini et al., 2006). Furin, a Ca2+ dependent serine protease (Pearton et al., 2001), seems to be involved in processing of the LEKTI full-length protein (Bitoun et al., 2003; Deraison et al., 2007; Jayakumar et al., 2005). Both single LEKTI domains and fragments containing several domains have been shown to be active towards different KLKs and other kinds of proteases, but the efficiency and specificity varies (Egelrud et al., 2005; Fortugno et al., 2011; Kreutzmann et al., 2004; Schechter et al., 2005). In some cases, binding studies showed the interaction between the inhibitor and enzyme to be pH dependent. The D8–11/KLK5 complex showed no dissociation at neutral pH. Reduction of the pH to 4.5 finally

336

Maria Brattsand

resulted in dissociation, making it very tempting to speculate that this could be a regulatory mechanism occurring in vivo (Deraison et al., 2007). LEKTI has been localized in lamellar granules, separate from KLK5 and KLK7, and it was observed that it is secreted earlier than KLK5 and KLK7. LEKTI was located in the upper spinous layer, while KLK5 and KLK7 were detected in the most superficial granular layer (Ishida-Yamamoto et al., 2005). It has also been shown that KLK7 is not only inhibited by LEKTI, but may also degrade LEKTI, at least in vitro, and thereby inactivate the inhibitor (Roelandt et al., 2009). SPINK6 is a 6 kD Kazal-type inhibitor consisting only of a single Kazal-type domain. Using RT-PCR, low levels of mRNA could be detected in all tissues studied, but the expression levels were much higher in cultured keratinocytes, and mRNA expression was induced during keratinocyte differentiation. Immunohistochemical studies showed protein expression in the upper epidermal layer of the skin at different body sites, but this expression was more prominent at palmo-plantar sites. SPINK6 could also be detected in sebaceous glands and in some sweat glands, but not in hair follicles. Interestingly, in atopic dermatitis SPINK6 expression was reduced, and it was also slightly reduced in psoriatic lesions. SPINK6 was shown to be a very efficient inhibitor of KLK5 and KLK14. Slight inhibition could also be observed for KLK7, while no inhibition at all was detected for KLK8. No obvious activity could be determined towards other serine proteases tested, including trypsin, cathepsin G and leukocyte elastase. SPINK6 could inhibit spontaneous desquamation of human plantar skin in an ex vivo model in a concentration-dependent manner (Meyer-Hoffert et al., 2010). SPINK9, also named LEKTI2, is a 7.7 kD protein that consists of a single Kazaltype domain. Interestingly, it has a very restricted expression and inhibitory profile. The only enzyme, found so far, which is inhibited by SPINK9, is KLK5, and the expression is almost completely limited to palmo-plantar stratum granulosum and stratum corneum, making the name LEKTI2 somewhat misleading. Enhanced expression was also observed in plantar clavus, where the skin is thickened due to pressure and frictional forces, leading to hyperkeratosis. Therefore, it is tempting to speculate that KLK5 activity is very important for regulating the thickness of SC (Brattsand et al., 2009; Meyer-Hoffert et al., 2009). So far, no disease has been correlated with SPINK9 expression. In comparison, very low levels of expression can be found in thymus, tonsils, adenoids, bronchial epithelial cells, and non-palmo-plantar epidermis. The peptide has also been suggested to have anti-bacterial properties. The majority of the peptide present in heel SC was found as a 61 amino acid long chain, but both N-terminally extended as well as truncated forms were identified. Among these, the 62 and 63 residue variants, but none of the others, were found to have antibacterial activity (Wu et al., 2008). Whey acidic 4-disulphide core (WFDC) proteins are a family of proteins defined as possessing one or more protein domains containing approximately 40–50 amino acids. Each includes 8 conserved cysteine residues that produce 4 characteristic intramolecular domains. Some WFDC-proteins only contain a single domain, while others

Kallikrein-related Peptidases and Inhibitors of the Skin

337

may contain other kinds of domains in combination with one or more WFDC-domain. At least three different WFDC-proteins, WFDC4, WFDC12, and WFDC14, have been found in the skin. WFDC4, commonly known as secretory leukocyte protease inhibitor (SLPI), antileukoprotease (ALP), or human seminal inhibitor-1 (HUSI-1), is an 11.7 kD inhibitor that efficiently inhibits KLK7 (Franzke et al., 1996). It is primarily expressed in different glandular epithelia, but a weak staining can also be found in the SG of adult normal human epidermis. In lesional psoriatic epidermis and in migrating keratinocytes of healing wounds, a strong cytoplasmic staining is seen in suprabasal keratinocytes (Wingens et al., 1998). In vitro experiments have shown that the peptide is efficient in inhibiting desquamation (Franzke et al., 1996). WFDC4 has also been proposed to have antibacterial (Wiedow et al., 1998) as well as anti-retroviral activity (McNeely et al., 1995). WFDC14 is better known as skin-derived antileukoprotease (SKALP) or elafin. It is composed of 57 amino acids, with a calculated molecular weight of 7 kD and a pI of 9.7. It was primarily isolated from psoriatic scales, and its expression in normal human epidermis is low or absent. The peptide primarily shows an elastase inhibitory activity, but also has a weak effect on KLK7. It can to some extent inhibit desquamation in vitro, although not as efficiently as WFDC4 (Franzke et al., 1996; Schalkwijk et al., 1991; Wiedow et al., 1990). The third WFDC protein that has been identified in the epidermis is WFDC12, which was originally identified under the name whey acidic protein 2 (WAP2). So far, it has not been shown to inhibit any of the KLKs, and its function in the epidermis has not been determined (Lundwall and Clauss, 2002).

13.5 Skin disorders The first in vivo indication that serine proteases could be important for skin physiology was a study that showed topical addition of the serine protease inhibitor α1-antitrypsin as effective in treating patients with severe atopic dermatitis (Wachter and Lezdey, 1992). The indirect proof came when the Netherton syndrome was linked to mutations in the SPINK5 gene (Chavanas et al., 2000). Netherton syndrome (NS), sometimes named Comèl-Netherton syndrome, is a severe autosomal recessive disorder characterized by congenital ichtyosis with defective cornification, a specific hair shaft defect (trichorrexia invaginata or “bamboo hair”), and severe atopic manifestations, including atopic dermatitis and hay fever with high serum IgE levels, and hypereosinophilia. Life-threatening complications during infancy include temperature and electrolyte imbalance, recurrent infections, and poor growth (Burns et al., 2004; Comel, 1949; Netherton, 1958). Different mutations in the SPINK5 gene have been identified, including single nucleotide insertions and deletions leading to premature stops in transcription as well as splice

338

Maria Brattsand

site mutations (Chavanas et al., 2000). Correlation between skin symptoms and the location of the mutations has been established. Mutations leading to an early truncation of LEKTI seem to correlate with a more severe phenotype, and faint staining of LEKTI peptides has been detected in patients suffering from less severe symptoms, indicating that they may have some residual LEKTI activity (Descargues et al., 2006; Komatsu et al., 2008; Komatsu et al., 2002; Sprecher et al., 2001). In vitro studies show that mutations in the N-terminal signal peptide alter the distribution of LEKTI from the endoplasmic reticulum to the cytoplasm, which markedly reduces its stability. It was also obvious that elements present in C-terminal domains may have a role in regulating LEKTI secretion (Jayakumar et al., 2005). Quite early it was suggested that the LEKTI peptides were involved in the regulation of desquamation in epidermis. A marked increase was observed in trypsin-like hydrolytic activity in the SC samples of NS patients (Komatsu et al., 2002). Spink5deficient mice also showed symptoms that closely resemble the features of human NS (Descargues et al., 2005; Yang et al., 2004). The animal models indicated that the increased protease activity led to a premature degradation of desmosomal proteins, and this was later supported by studies of a cohort of NS patients (Descargues et al., 2006). In this study, it could be demonstrated that a majority of patients had a dramatic reduction of DSG1 and DSC1 levels in the uppermost living cell layers, compared to normal controls. This reduction in desmosomal protein content was correlated with an extension of KLK5 and KLK7 expression into lower layers, parallel to an increase in both tryptic and chymotryptic activity, which was implicated to come from KLK5 and KLK7. KLK5 hyperactivity resulting from LEKTI deficiency has also been proposed to trigger atopic manifestations via the PAR2 system (Briot et al., 2009). Psoriasis is a common chronic, disfiguring, inflammatory, and proliferative condition of the skin, in which both genetic and inflammatory influences play a critical role. The most characteristic lesions consist of red, scaly, sharply demarcated, indurated plaques. The disease is highly variable in duration, periodicity of flares, and extent. The prevalence of the disease varies among different ethnical populations (1.5–4.8% in northern Europe and Scandinavia, compared to 0.3% in China). The cardinal features of lesional psoriatic skin are epidermal hyper-proliferation with distorted differentiation, dilatation and proliferation of dermal blood vessels, and accumulation of inflammatory cells, particularly neutrophils and T-lymphocytes (Burns et al., 2004). Different reports have shown aberrant expression of many different molecules in psoriatic lesions. In a large-scale gene expression study (12,000), 177 transcripts were found to have different expression in lesional psoriatic skin versus normal skin. Among those were KLK6, KLK8, and WFDC14 (Bowcock et al., 2001). In an earlier study, it was shown that the expression of KLK7 was increased and the level of activated KLK7 compared to inactive precursor was higher in psoriatic lesions, compared to normal skin. The staining of the thickened, parakeratotic stratum corneum was somewhat patchy, and the number of KLK7-staining layers of high suprabasal

Kallikrein-related Peptidases and Inhibitors of the Skin

339

cells below the stratum corneum was increased. Interestingly, some biopsies taken distant from the lesions in apparently normal skin also showed an increase in KLK7 staining (Ekholm and Egelrud, 1999). The pro-inflammatory cytokine IL-1β is found in active form, in increased amounts, in psoriatic lesions. In vitro studies have shown that KLK7 has the ability to cleave the pro-form of IL-1β into one of the active forms (Lundqvist and Egelrud, 1997; Nylander-Lundqvist and Egelrud, 1997). In another study, significantly higher levels of all KLKs were found in psoriatic lesions. KLK6, 10, and 13 levels were found to be elevated in non-lesional SC as well. Serum levels of KLK6, 8, 10, and 13 were found to be elevated in patients with untreated psoriasis and significantly correlated with the Psoriasis Area and Severity Index score. The overall enzyme activity was found to be increased, but in contrast to the earlier study, chymotryptic activity was not elevated. The serum levels of KLK7 did not differ between psoriasis patients and healthy controls (Komatsu et al., 2005b; 2007b). Atopic dermatitis (AD) is a difficult condition to define, because it lacks a diagnostic test and shows variable clinical features. But most consensus groups seem to agree that atopic dermatitis, synonymous with atopic eczema, is an itchy, chronic or chronically relapsing, inflammatory condition that is often associated with asthma and hay fever. The patients often have an increase in circulating IgE levels (Burns et al., 2004). Epidermal dysfunction has been proposed to be a primary event in the development of AD, and overexpression of KLK7 in mice showed symptoms similar to those seen in human patients, with increased epidermal thickness, hyperkeratosis, dermal inflammation, severe pruritus, and decreased barrier function (Cork et al., 2009; Hansson et al., 2002). Polymorphisms in the SPINK5 gene have been associated with AD (Walley et al., 2001), and one study found that the expression of LEKTI was significantly decreased in AD patients, compared to healthy individuals (Roedl et al., 2009). Studies of a British cohort showed genetic association between an AACC insertion in the 3ʹ UTR of the KLK7 gene and AD (Vasilopoulos et al., 2004), while studies of a French atopic dermatitis cohort could not find any association between SPINK5 or KLK7 polymorphisms and AD (Hubiche et al., 2007). In yet another study, the levels of all KLKs except KLK11 were found to be significantly elevated in the SC of AD patients. In contrast with the results found in psoriasis, the elevation of KLK7 was predominant, compared to the trypsin-like KLKs. In the serum of AD patients, KLK8 was significantly elevated and KLK5 and KLK11 were decreased (Komatsu et al., 2005b; 2007a). KLK5, 6 and 14, but not KLK7 or KLK8, have been shown to activate the PAR2 receptor (see Chapter 15). The presence of active KLK14 in sweat has been suggested as having a role in the itch sensation, which is often recognized to increase when the patient gets warm (Oikonomopoulou et al., 2006; Stefansson et al., 2008). Rosacea is a disease lacking an entirely satisfactory definition. It is a chronic disorder affecting the facial convexities, characterized by frequent flushing, persistent erythema and telangiectasia, interspersed by episodes of inflammation, during which swelling, papules, and pustules are evident (Burns et al., 2004).

340

Maria Brattsand

Cathelicidin antimicrobial peptides (CAP) do not only have the capacity to kill a wide variety of microbes, but can also modify host immune and cell growth responses (Lai and Gallo, 2009). In humans, the only cathelicidin is synthesized as the inactive proform hCAP, which is cleaved into different active peptides. Analysis of normal skin samples showed that multiple cathelicidin peptides were found in the skin, and LL-37 (the hitherto most known peptide fragment) only constituted 13.7% of the peptides found. It was also shown that KLK5 can efficiently cleave hCAP into active peptides. KLK7 can also cleave hCAP into active peptides, but those are rapidly degraded further into inactive, smaller peptides (Yamasaki et al., 2006). Analysis of skin samples from Rosacea patients showed abnormally high levels of cathelicidins in their facial skin, and the proteolytically processed forms were different from those present in healthy individuals. An increase of KLK5 expression and activity could also be seen (Yamasaki et al., 2007). Aberrant KLK expression and activity has been implied also in other skin diseases where the desquamation process is disturbed. In X-linked ichtyosis, both trypsin-like and chymotrypsin-like activity was reduced, which can be explained by increased levels of cholesterol sulfate (Sato et al., 1998; Suzuki et al., 1996). Elevated levels of KLKs have been reported in the SC and serum of peeling skin syndrometype B patients (Komatsu et al., 2006). The newly reported dermatose circumscribed palmo-plantar hypokeratosis also showed a decrease in LEKTI and an increase in KLK5 expression over hypokeratotic areas (Kanitakis et al., 2011).

13.6 Conclusions and outlook The true nature of the role of different KLKs in skin physiology still is to be elucidated, but the finding that Netherton syndrome is linked to mutations in the SPINK5 gene makes it tempting to suggest that at least some of the KLKs may be quite important. The expression pattern and existence of active KLK enzymes in the extracellular space coincides very well with their suggested function in the desquamation process. The ability to generate active antimicrobial peptides opens up a role in innate immunity. An activation of the PAR2 system by KLKs could imply a role in inflammation and proliferation. The significance of the finding that the expression of many KLKs is induced in inflammatory skin disorders has to be further explored – are they involved in the disease process or is it only a spin-off effect of other factors involved in this diseased tissue?

Kallikrein-related Peptidases and Inhibitors of the Skin

341

Bibliography Ahmed, A., Kandola, P., Ziada, G., and Parenteau, N. (2001). Purification and partial amino acid sequence of proteins from human epidermal keratinocyte conditioned medium. J. Protein Chem. 20, 273–278. Bitoun, E., Micheloni, A., Lamant, L., Bonnart, C., Tartaglia-Polcini, A., Cobbold, C., Al Saati, T., Mariotti, F., Mazereeuw-Hautier, J., Boralevi, F., Hohl, D., Harper, J., Bodemer, C., D’Alessio, M., and Hovnanian, A. (2003). LEKTI proteolytic processing in human primary keratinocytes, tissue distribution and defective expression in Netherton syndrome. Hum. Mol. Genet. 12, 2417–2430. Blaber, S.I., Yoon, H., Scarisbrick, I.A., Juliano, M.A., and Blaber, M. (2007). The autolytic regulation of human kallikrein-related peptidase 6. Biochemistry 46, 5209–5217. Borgoño, C.A., Michael, I.P., Komatsu, N., Jayakumar, A., Kapadia, R., Clayman, G.L., Sotiropoulou, G., and Diamandis, E.P. (2007). A potential role for multiple tissue kallikrein serine proteases in epidermal desquamation. J. Biol. Chem. 282, 3640–3652. Bowcock, A.M., Shannon, W., Du, F., Duncan, J., Cao, K., Aftergut, K., Catier, J., Fernandez-Vina, M.A., and Menter, A. (2001). Insights into psoriasis and other inflammatory diseases from large-scale gene expression studies. Hum. Mol. Genet. 10, 1793–1805. Brattsand, M., and Egelrud, T. (1999). Purification, molecular cloning, and expression of a human stratum corneum trypsin-like serine protease with possible function in desquamation. J. Biol. Chem. 274, 30033–30040. Brattsand, M., Stefansson, K., Lundh, C., Haasum, Y., and Egelrud, T. (2005). A proteolytic cascade of kallikreins in the stratum corneum. J. Invest. Dermatol. 124, 198–203. Brattsand, M., Stefansson, K., Hubiche, T., Nilsson, S.K., and Egelrud, T. (2009). SPINK9: a selective, skin-specific Kazal-type serine protease inhibitor. J. Invest. Dermatol. 129, 1656–1665. Briot, A., Deraison, C., Lacroix, M., Bonnart, C., Robin, A., Besson, C., Dubus, P., and Hovnanian, A. (2009). Kallikrein 5 induces atopic dermatitis-like lesions through PAR2-mediated thymic stromal lymphopoietin expression in Netherton syndrome. J. Exp. Med. 206, 1135–1147. Brody, I. (1968). An electron-microscopic study of the junctional and regular desmosomes in normal human epidermia. Acta Derm. Venereol. 48, 290–302. Burns, T., Breathnach, S., Cox, N., and Griffiths, C., eds. (2004). Rook’s Textbook of Dermatology (Blackwell Publishing). Candi, E., Schmidt, R., and Melino, G. (2005). The cornified envelope: a model of cell death in the skin. Nat. Rev. Mol. Cell Biol. 6, 328–340. Caubet, C., Jonca, N., Brattsand, M., Guerrin, M., Bernard, D., Schmidt, R., Egelrud, T., Simon, M., and Serre, G. (2004). Degradation of corneodesmosome proteins by two serine proteases of the kallikrein family, SCTE/KLK5/hK5 and SCCE/KLK7/hK7. J. Invest. Dermatol. 122, 1235–1244. Chavanas, S., Bodemer, C., Rochat, A., Hamel-Teillac, D., Ali, M., Irvine, A., Bonafé, J., Wilkinson, J., Taïeb, A., Barrandon, Y., Harper, J.I., de Prost, Y., and Hovnanian, A. (2000). Mutations in SPINK5, encoding a serine protease inhibitor, cause Netherton syndrome. Nat. Genet. 25, 141–142. Comel, M. (1949). Ichtyosis linearis circumflexa. Dermatologica 98, 133–136. Cork, M.J., Danby, S.G., Vasilopoulos, Y., Hadgraft, J., Lane, M.E., Moustafa, M., Guy, R.H., Macgowan, A.L., Tazi-Ahnini, R., and Ward, S.J. (2009). Epidermal barrier dysfunction in atopic dermatitis. J. Invest. Dermatol. 129, 1892–1908. Deraison, C., Bonnart, C., Lopez, F., Besson, C., Robinson, R., Jayakumar, A., Wagberg, F., Brattsand, M., Hachem, J.P., Leonardsson, G., and Hovnanian, A. (2007). LEKTI fragments specifically inhibit KLK5, KLK7, and KLK14 and control desquamation through a pH-dependent interaction. Mol. Biol. Cell 18, 3607–3619.

342

Maria Brattsand

Descargues, P., Deraison, C., Bonnart, C., Kreft, M., Kishibe, M., Ishida-Yamamoto, A., Elias, P., Barrandon, Y., Zambruno, G., Sonnenberg, A., and Hovnanian, A. (2005). Spink5-deficient mice mimic Netherton syndrome through degradation of desmoglein 1 by epidermal protease hyperactivity. Nat. Genet. 37, 56–65. Descargues, P., Deraison, C., Prost, C., Fraitag, S., Mazereeuw-Hautier, J., D’Alessio, M., IshidaYamamoto, A., Bodemer, C., Zambruno, G., and Hovnanian, A. (2006). Corneodesmosomal cadherins are preferential targets of stratum corneum trypsin- and chymotrypsin-like hyperactivity in Netherton syndrome. J. Invest. Dermatol. 126, 1622–1632. Egelrud, T., Hofer, P.A., and Lundstrom, A. (1988). Proteolytic degradation of desmosomes in plantar stratum corneum leads to cell dissociation in vitro. Acta Derm. Venereol. 68, 93–97. Egelrud, T., and Lundstrom, A. (1991). A chymotrypsin-like proteinase that may be involved in desquamation in plantar stratum corneum. Arch Dermatol. Res. 283, 108–112. Egelrud, T. (2000). Desquamation in the stratum corneum. Acta Derm. Venereol. Suppl. (Stockh) 208, 44–45. Egelrud, T., Brattsand, M., Kreutzmann, P., Walden, M., Vitzithum, K., Marx, U.C., Forssmann, W.G., and Magert, H.J. (2005). hK5 and hK7, two serine proteinases abundant in human skin, are inhibited by LEKTI domain 6. Br. J. Dermatol. 153, 1200–1203. Eissa, A., Amodeo, V., Smith, C.R., and Diamandis, E.P. (2011). Kallikrein-related peptidase-8 (KLK8) is an active serine protease in human epidermis and sweat and is involved in a skin barrier proteolytic cascade. J. Biol. Chem. 286, 687–706. Ekholm, E., and Egelrud, T. (1998). The expression of stratum corneum chymotryptic enzyme in human anagen hair follicles: further evidence for its involvement in desquamation-like processes. Br. J. Dermatol. 139, 585–590. Ekholm, E., Sondell, B., Stranden, P., Brattsand, M., and Egelrud, T. (1998). Expression of stratum corneum chymotryptic enzyme in human sebaceous follicles. Acta Derm. Venereol. 78, 343–347. Ekholm, E., and Egelrud, T. (1999). Stratum corneum chymotryptic enzyme in psoriasis. Arch Dermatol. Res. 291, 195–200. Ekholm, E., Brattsand, M., and Egelrud, T. (1999). Stratum corneum tryptic enzyme – A missing link in desquamation? J. Invest. Dermatol. 113, 454–454. Ekholm, I.E., Brattsand, M., and Egelrud, T. (2000). Stratum corneum tryptic enzyme in normal epidermis: a missing link in the desquamation process? J. Invest. Dermatol. 114, 56–63. Elias, P.M. (2004). The epidermal permeability barrier: from the early days at Harvard to emerging concepts. J. Invest. Dermatol. 122, xxxvi-xxxix. Fortugno, P., Bresciani, A., Paolini, C., Pazzagli, C., El Hachem, M., D’Alessio, M., and Zambruno, G. (2011). Proteolytic activation cascade of the Netherton syndrome-defective protein, LEKTI, in the epidermis: implications for skin homeostasis. J. Invest. Dermatol. 131, 2223–2232. Franzke, C., Baici, A., Bartels, J., Christophers, E., and Wiedow, O. (1996). Antileukoprotease inhibits stratum corneum chymotryptic enzyme. Evidence for a regulative function in desquamation. J. Biol. Chem. 271, 21886–21890. Goettig, P., Magdolen, V., and Brandstetter, H. (2010). Natural and synthetic inhibitors of kallikreinrelated peptidases (KLKs). Biochimie 92, 1546–1567. Hachem, J.P., Crumrine, D., Fluhr, J., Brown, B.E., Feingold, K.R., and Elias, P.M. (2003). pH directly regulates epidermal permeability barrier homeostasis, and stratum corneum integrity/ cohesion. J. Invest. Dermatol. 121, 345–353. Hachem, J.P., Houben, E., Crumrine, D., Man, M.Q., Schurer, N., Roelandt, T., Choi, E.H., Uchida, Y., Brown, B.E., Feingold, K.R., and Elias, P.M. (2006). Serine protease signaling of epidermal permeability barrier homeostasis. J. Invest. Dermatol. 126, 2074–2086.

Kallikrein-related Peptidases and Inhibitors of the Skin

343

Haftek, M., Simon, M., Kanitakis, J., Marechal, S., Claudy, A., Serre, G., and Schmitt, D. (1997). Expression of corneodesmosin in the granular layer and stratum corneum of normal and diseased epidermis. Br. J. Dermatol. 137, 864–873. Hanson, K.M., Behne, M.J., Barry, N.P., Mauro, T.M., Gratton, E., and Clegg, R.M. (2002). Two-photon fluorescence lifetime imaging of the skin stratum corneum pH gradient. Biophys. J. 83, 1682–1690. Hansson, L., Stromqvist, M., Backman, A., Wallbrandt, P., Carlstein, A., and Egelrud, T. (1994). Cloning, expression, and characterization of stratum corneum chymotryptic enzyme. A skin-specific human serine proteinase. J. Biol. Chem. 269, 19420–19426. Hansson, L., Backman, A., Ny, A., Edlund, M., Ekholm, E., Ekstrand Hammarstrom, B., Tornell, J., Wallbrandt, P., Wennbo, H., and Egelrud, T. (2002). Epidermal overexpression of stratum corneum chymotryptic enzyme in mice: a model for chronic itchy dermatitis. J. Invest. Dermatol. 118, 444–449. Hubiche, T., Ged, C., Benard, A., Leaute-Labreze, C., McElreavey, K., de Verneuil, H., Taieb, A., and Boralevi, F. (2007). Analysis of SPINK 5, KLK 7 and FLG genotypes in a French atopic dermatitis cohort. Acta Derm. Venereol. 87, 499–505. Ishida-Yamamoto, A., Simon, M., Kishibe, M., Miyauchi, Y., Takahashi, H., Yoshida, S., O’Brien, T.J., Serre, G., and Iizuka, H. (2004). Epidermal lamellar granules transport different cargoes as distinct aggregates. J. Invest. Dermatol. 122, 1137–1144. Ishida-Yamamoto, A., Deraison, C., Bonnart, C., Bitoun, E., Robinson, R., O’Brien, T.J., Wakamatsu, K., Ohtsubo, S., Takahashi, H., Hashimoto, Y., Dopping-Hepenstal, P.J., McGrath, J.A., Iizuka, H., Richard, G., and Hovnanian, A. (2005). LEKTI is localized in lamellar granules, separated from KLK5 and KLK7, and is secreted in the extracellular spaces of the superficial stratum granulosum. J. Invest. Dermatol. 124, 360–366. Jayakumar, A., Kang, Y., Henderson, Y., Mitsudo, K., Liu, X., Briggs, K., Wang, M., Frederick, M.J., El-Naggar, A.K., Bebök, Z., and Clayman, G.L. (2005). Consequences of C-terminal domains and N-terminal signal peptide deletions on LEKTI secretion, stability, and subcellular distribution. Arch. Biochem. Biophys. 435, 89–102. Kanitakis, J., Lora, V., Chouvet, B., Zambruno, G., Haftek, M., and Faure, M. (2011). Circumscribed palmo-plantar hypokeratosis: a disease of desquamation? Immunohistological study of five cases and literature review. J. Eur. Acad. Dermatol. Venereol. 25, 296–301. Kirihara, T., Matsumoto-Miyai, K., Nakamura, Y., Sadayama, T., Yoshida, S., and Shiosaka, S. (2003). Prolonged recovery of ultraviolet B-irradiated skin in neuropsin (KLK8)-deficient mice. Br. J. Dermatol. 149, 700–706. Kishibe, M., Bando, Y., Terayama, R., Namikawa, K., Takahashi, H., Hashimoto, Y., Ishida-Yamamoto, A., Jiang, Y.P., Mitrovic, B., Perez, D., Iizuka, H., and Yoshida, S. (2007). Kallikrein 8 is involved in skin desquamation in cooperation with other kallikreins. J. Biol. Chem. 282, 5834–5841. Komatsu, N., Takata, M., Otsuki, N., Ohka, R., Amano, O., Takehara, K., and Saijoh, K. (2002). Elevated stratum corneum hydrolytic activity in Netherton syndrome suggests an inhibitory regulation of desquamation by SPINK5-derived peptides. J. Invest. Dermatol. 118, 436–443. Komatsu, N., Takata, M., Otsuki, N., Toyama, T., Ohka, R., Takehara, K., and Saijoh, K. (2003). Expression and localization of tissue kallikrein mRNAs in human epidermis and appendages. J. Invest. Dermatol. 121, 542–549. Komatsu, N., Saijoh, K., Sidiropoulos, M., Tsai, B., Levesque, M., Elliott, M., Takehara, K., and Diamandis, E. (2005a). Quantification of human tissue kallikreins in the stratum corneum: dependence on age and gender. J. Invest. Dermatol. 125, 1182–1189. Komatsu, N., Saijoh, K., Toyama, T., Ohka, R., Otsuki, N., Hussack, G., Takehara, K., and Diamandis, E. (2005b). Multiple tissue kallikrein mRNA and protein expression in normal skin and skin diseases. Br. J. Dermatol. 153, 274–281.

344

Maria Brattsand

Komatsu, N., Suga, Y., Saijoh, K., Liu, A.C., Khan, S., Mizuno, Y., Ikeda, S., Wu, H.K., Jayakumar, A., Clayman, G.L., Shirasaki, F., Takehara, K., and Diamandis, E.P. (2006). Elevated human tissue kallikrein levels in the stratum corneum and serum of peeling skin syndrome-type B patients suggests an over-desquamation of corneocytes. J. Invest. Dermatol. 126, 2338–2342. Komatsu, N., Saijoh, K., Kuk, C., Liu, A.C., Khan, S., Shirasaki, F., Takehara, K., and Diamandis, E.P. (2007a). Human tissue kallikrein expression in the stratum corneum and serum of atopic dermatitis patients. Exp. Dermatol. 16, 513–519. Komatsu, N., Saijoh, K., Kuk, C., Shirasaki, F., Takehara, K., and Diamandis, E.P. (2007b). Aberrant human tissue kallikrein levels in the stratum corneum and serum of patients with psoriasis: dependence on phenotype, severity and therapy. Br. J. Dermatol. 156, 875–883. Komatsu, N., Saijoh, K., Jayakumar, A., Clayman, G.L., Tohyama, M., Suga, Y., Mizuno, Y., Tsukamoto, K., Taniuchi, K., Takehara, K., and Diamandis, E.P. (2008). Correlation between SPINK5 gene mutations and clinical manifestations in Netherton syndrome patients. J. Invest. Dermatol. 128, 1148–1159. Kreutzmann, P., Schulz, A., Standker, L., Forssmann, W.G., and Mägert, H.J. (2004). Recombinant production, purification and biochemical characterization of domain 6 of LEKTI: a temporary Kazal-type-related serine proteinase inhibitor. J. Chromatogr. B Analyt. Technol. Biomed. Life Sci. 803, 75–81. Lai, Y., and Gallo, R.L. (2009). AMPed up immunity: how antimicrobial peptides have multiple roles in immune defense. Trends Immunol. 30, 131–141. Lundqvist, E.N., and Egelrud, T. (1997). Biologically active, alternatively processed interleukin-1 beta in psoriatic scales. Eur. J. Immunol. 27, 2165–2171. Lundstrom, A., and Egelrud, T. (1990). Evidence that cell shedding from plantar stratum corneum in vitro involves endogenous proteolysis of the desmosomal protein desmoglein I. J. Invest. Dermatol. 94, 216–220. Lundstrom, A., Serre, G., Haftek, M., and Egelrud, T. (1994). Evidence for a role of corneodesmosin, a protein which may serve to modify desmosomes during cornification, in stratum corneum cell cohesion and desquamation. Arch Dermatol. Res. 286, 369–375. Lundwall, A., and Clauss, A. (2002). Identification of a novel protease inhibitor gene that is highly expressed in the prostate. Biochem. Biophys. Res. Commun. 290, 452–456. Luo, L.Y., and Jiang, W. (2006). Inhibition profiles of human tissue kallikreins by serine protease inhibitors. Biol. Chem. 387, 813–816. Mägert, H.J., Standker, L., Kreutzmann, P., Zucht, H.D., Reinecke, M., Sommerhoff, C.P., Fritz, H., and Forssmann, W.G. (1999). LEKTI, a novel 15-domain type of human serine proteinase inhibitor. J. Biol. Chem. 274, 21499–21502. McNeely, T.B., Dealy, M., Dripps, D.J., Orenstein, J.M., Eisenberg, S.P., and Wahl, S.M. (1995). Secretory leukocyte protease inhibitor: a human saliva protein exhibiting anti-human immunodeficiency virus 1 activity in vitro. J. Clin. Invest. 96, 456–464. Meyer-Hoffert, U., Wu, Z., and Schröder, J.M. (2009). Identification of lympho-epithelial Kazal-type inhibitor 2 in human skin as a kallikrein-related peptidase 5-specific protease inhibitor. PLoS ONE 4, e4372. Meyer-Hoffert, U., Wu, Z., Kantyka, T., Fischer, J., Latendorf, T., Hansmann, B., Bartels, J., He, Y., Glaser, R., and Schröder, J.M. (2010). Isolation of SPINK6 in human skin: selective inhibitor of kallikrein-related peptidases. J. Biol. Chem. 285, 32174–32181. Netherton, E.W. (1958). A unique case of trichorrhexis nodosa; bamboo hairs. AMA Arch. Derm. 78, 483–487. Nylander-Lundqvist, E., and Egelrud, T. (1997). Formation of active IL-1 beta from pro-IL-1 beta catalyzed by stratum corneum chymotryptic enzyme in vitro. Acta Derm. Venereol. 77, 203–206.

Kallikrein-related Peptidases and Inhibitors of the Skin

345

Ohler, A., Debela, M., Wagner, S., Magdolen, V., and Becker-Pauly, C. (2010). Analyzing the protease web in skin: meprin metalloproteases are activated specifically by KLK4, 5 and 8 vice versa leading to processing of proKLK7 thereby triggering its activation. Biol. Chem. 391, 455–460. Ohman, H., and Vahlquist, A. (1994). In vivo studies concerning a pH gradient in human stratum corneum and upper epidermis. Acta Derm. Venereol. 74, 375–379. Oikonomopoulou, K., Hansen, K.K., Saifeddine, M., Vergnolle, N., Tea, I., Blaber, M., Blaber, S.I., Scarisbrick, I., Diamandis, E.P., and Hollenberg, M.D. (2006). Kallikrein-mediated cell signalling: targeting proteinase-activated receptors (PARs). Biol. Chem. 387, 817–824. Pearton, D.J., Nirunsuksiri, W., Rehemtulla, A., Lewis, S.P., Presland, R.B., and Dale, B.A. (2001). Proprotein convertase expression and localization in epidermis: evidence for multiple roles and substrates. Exp. Dermatol. 10, 193–203. Raghunath, M., Tontsidou, L., Oji, V., Aufenvenne, K., Schurmeyer-Horst, F., Jayakumar, A., Stander, H., Smolle, J., Clayman, G.L., and Traupe, H. (2004). SPINK5 and Netherton syndrome: novel mutations, demonstration of missing LEKTI, and differential expression of transglutaminases. J. Invest. Dermatol. 123, 474–483. Raknerud, N. (1975). The ultrastructure of the interfollicular epidermis of the hairless (hr/hr) mouse. III. Desmosomal transformation during keratinization. J. Ultrastruct. Res. 52, 32–51. Roedl, D., Traidl-Hoffmann, C., Ring, J., Behrendt, H., and Braun-Falco, M. (2009). Serine protease inhibitor lymphoepithelial Kazal type-related inhibitor tends to be decreased in atopic dermatitis. J. Eur. Acad. Dermatol. Venereol. 23, 1263–1266. Roelandt, T., Thys, B., Heughebaert, C., De Vroede, A., De Paepe, K., Roseeuw, D., Rombaut, B., and Hachem, J.P. (2009). LEKTI-1 in sickness and in health. Int. J. Cosmet. Sci. 31, 247–254. Sato, J., Denda, M., Nakanishi, J., Nomura, J., and Koyama, J. (1998). Cholesterol sulfate inhibits proteases that are involved in desquamation of stratum corneum. J. Invest. Dermatol. 111, 189–193. Schalkwijk, J., de Roo, C., and de Jongh, G.J. (1991). Skin-derived antileukoproteinase (SKALP), an elastase inhibitor from human keratinocytes. Purification and biochemical properties. Biochim. Biophys. Acta 1096, 148–154. Schechter, N.M., Choi, E.J., Wang, Z.M., Hanakawa, Y., Stanley, J.R., Kang, Y., Clayman, G.L., and Jayakumar, A. (2005). Inhibition of human kallikreins 5 and 7 by the serine protease inhibitor lympho-epithelial Kazal-type inhibitor (LEKTI). Biol. Chem. 386, 1173–1184. Serre, G., Mils, V., Haftek, M., Vincent, C., Croute, F., Reano, A., Ouhayoun, J.P., Bettinger, S., and Soleilhavoup, J.P. (1991). Identification of late differentiation antigens of human cornified epithelia, expressed in re-organized desmosomes and bound to cross-linked envelope. J. Invest. Dermatol. 97, 1061–1072. Simon, M., Jonca, N., Guerrin, M., Haftek, M., Bernard, D., Caubet, C., Egelrud, T., Schmidt, R., and Serre, G. (2001). Refined characterization of corneodesmosin proteolysis during terminal differentiation of human epidermis and its relationship to desquamation. J. Biol. Chem. 276, 20292–20299. Sondell, B., Thornell, L.E., Stigbrand, T., and Egelrud, T. (1994). Immunolocalization of stratum corneum chymotryptic enzyme in human skin and oral epithelium with monoclonal antibodies: evidence of a proteinase specifically expressed in keratinizing squamous epithelia. J. Histochem. Cytochem. 42, 459–465. Sondell, B., Thornell, L.E., and Egelrud, T. (1995). Evidence that stratum corneum chymotryptic enzyme is transported to the stratum corneum extracellular space via lamellar bodies. J. Invest. Dermatol. 104, 819–823.

346

Maria Brattsand

Sondell, B., Dyberg, P., Anneroth, G.K., Ostman, P.O., and Egelrud, T. (1996). Association between expression of stratum corneum chymotryptic enzyme and pathological keratinization in human oral mucosa. Acta Derm. Venereol. 76, 177–181. Sprecher, E., Chavanas, S., DiGiovanna, J.J., Amin, S., Nielsen, K., Prendiville, J.S., Silverman, R., Esterly, N.B., Spraker, M.K., Guelig, E., de Luna, M.L., Williams, M.L., Buehler, B., Siegfried, E.C., van Maldergem, L., Pfendner, E., Bale, S.J., Uitto, J., Hovnanian, A., and Richard, G. (2001). The spectrum of pathogenic mutations in SPINK5 in 19 families with Netherton syndrome: implications for mutation detection and first case of prenatal diagnosis. J. Invest. Dermatol. 117, 179–187. Stefansson, K., Brattsand, M., Ny, A., Glas, B., and Egelrud, T. (2006). Kallikrein-related peptidase 14 may be a major contributor to trypsin-like proteolytic activity in human stratum corneum. Biol. Chem. 387, 761–768. Stefansson, K., Brattsand, M., Roosterman, D., Kempkes, C., Bocheva, G., Steinhoff, M., and Egelrud, T. (2008). Activation of proteinase-activated receptor-2 by human kallikrein-related peptidases. J. Invest. Dermatol. 128, 18–25. Suzuki, Y., Nomura, J., Hori, J., Koyama, J., Takahashi, M., and Horii, I. (1993). Detection and characterization of endogenous protease associated with desquamation of stratum corneum. Arch Dermatol. Res. 285, 372–377. Suzuki, Y., Nomura, J., Koyama, J., and Horii, I. (1994). The role of proteases in stratum corneum: involvement in stratum corneum desquamation. Arch Dermatol. Res. 286, 249–253. Suzuki, Y., Koyama, J., Moro, O., Horii, I., Kikuchi, K., Tanida, M., and Tagami, H. (1996). The role of two endogenous proteases of the stratum corneum in degradation of desmoglein-1 and their reduced activity in the skin of ichthyotic patients. Br. J. Dermatol. 134, 460–464. Tartaglia-Polcini, A., Bonnart, C., Micheloni, A., Cianfarani, F., Andre, A., Zambruno, G., Hovnanian, A., and D’Alessio, M. (2006). SPINK5, the defective gene in netherton syndrome, encodes multiple LEKTI isoforms derived from alternative pre-mRNA processing. J. Invest. Dermatol. 126, 315–324. Vasilopoulos, Y., Cork, M.J., Murphy, R., Williams, H.C., Robinson, D.A., Duff, G.W., Ward, S.J., and Tazi-Ahnini, R. (2004). Genetic association between an AACC insertion in the 3ʹUTR of the stratum corneum chymotryptic enzyme gene and atopic dermatitis. J. Invest. Dermatol. 123, 62–66. Wachter, A.M., and Lezdey, J. (1992). Treatment of atopic dermatitis with alpha 1-proteinase inhibitor. Ann. Allergy 69, 407–414. Walley, A.J., Chavanas, S., Moffatt, M.F., Esnouf, R.M., Ubhi, B., Lawrence, R., Wong, K., Abecasis, G.R., Jones, E.Y., Harper, J.I., Hovnanian, A., and Cookson, W.O. (2001). Gene polymorphism in Netherton and common atopic disease. Nat. Genet. 29, 175–178. Watkinson, A., Harding, C., Moore, A., and Coan, P. (2001). Water modulation of stratum corneum chymotryptic enzyme activity and desquamation. Arch Dermatol. Res. 293, 470–476. Wiedow, O., Schröder, J.M., Gregory, H., Young, J.A., and Christophers, E. (1990). Elafin: an elastasespecific inhibitor of human skin. Purification, characterization, and complete amino acid sequence. J. Biol. Chem. 265, 14791–14795. Wiedow, O., Harder, J., Bartels, J., Streit, V., and Christophers, E. (1998). Antileukoprotease in human skin: an antibiotic peptide constitutively produced by keratinocytes. Biochem. Biophys. Res. Commun. 248, 904–909. Wingens, M., van Bergen, B.H., Hiemstra, P.S., Meis, J.F., van Vlijmen-Willems, I.M., Zeeuwen, P.L., Mulder, J., Kramps, H.A., van Ruissen, F., and Schalkwijk, J. (1998). Induction of SLPI (ALP/ HUSI-I) in epidermal keratinocytes. J. Invest. Dermatol. 111, 996–1002. Wu, Z., Bartels, J., and Schroder, J.M. (2008). Lympho-Epithelial-Kazal-Type-Inhibitor (LEKTI)-2: a novel epithelial peptide antibiotic. Exp. Dermatol. 17, 260–260.

Kallikrein-related Peptidases and Inhibitors of the Skin

347

Yamasaki, K., Schauber, J., Coda, A., Lin, H., Dorschner, R., Schechter, N., Bonnart, C., Descargues, P., Hovnanian, A., and Gallo, R. (2006). Kallikrein-mediated proteolysis regulates the antimicrobial effects of cathelicidins in skin. FASEB J. 20, 2068–2080. Yamasaki, K., Di Nardo, A., Bardan, A., Murakami, M., Ohtake, T., Coda, A., Dorschner, R.A., Bonnart, C., Descargues, P., Hovnanian, A., Morhenn, V.B., and Gallo, R.L. (2007). Increased serine protease activity and cathelicidin promotes skin inflammation in rosacea. Nat. Med. 13, 975–980. Yang, T., Liang, D., Koch, P.J., Hohl, D., Kheradmand, F., and Overbeek, P.A. (2004). Epidermal detachment, desmosomal dissociation, and destabilization of corneodesmosin in Spink5-/mice. Genes Dev. 18, 2354–2358. Yoon, H., Laxmikanthan, G., Lee, J., Blaber, S.I., Rodriguez, A., Kogot, J.M., Scarisbrick, I.A., and Blaber, M. (2007). Activation profiles and regulatory cascades of the human kallikrein-related peptidases. J. Biol. Chem. 282, 31852–31864. Young, B., Heath, J.W., and Wheater, P.R., eds. (2000). Wheather’s functional histology : a text and colour atlas, 4th edn (Churchill Livingstone: Edinburgh).

Isobel A. Scarisbrick

14 Physiological and Pathophysiological Roles of Kallikrein-related Peptidases in the Central Nervous System 14.1 Introduction There is a long-standing interest in the role of proteases in the central nervous system (CNS), with a rich body of literature pointing to roles in physiological function and disease. With the recognition of 12 new members of the gene family of kallikreinrelated peptidases (KLKs) in the past decade, many of which are expressed in the CNS, there is growing interest in understanding their nervous-system-specific activities. In addition to expected roles in extracellular proteolysis, the ability of select KLKs to directly or indirectly activate G-protein coupled receptors, including the bradykinin receptors (B1 or B2) and protease-activated receptors (PAR) (PAR1 through 4), permits direct effects on intracellular signaling mechanisms, which can profoundly affect neural and glial function. An additional level of complexity in understanding the scope of action of this important gene family in the healthy and injured CNS comes from research demonstrating that KLK activation and inactivation cascades intersect with thrombostasis enzymes as well as matrix metalloproteases, enzyme families which have long been known to contribute to nervous system function and disease. There is no doubt that we are truly on the precipice of a new era, in which KLKs, along with their better-known proteolytic counterparts, will be considered true players in the enzymatic cascades that govern brain function and which, when deregulated, are positioned to mediate disease. To date, KLKs 1, 6 and 8 have been most extensively studied with regard to their likely physiological and pathophysiological roles in the adult CNS and therefore, these will be the focus of this review. In this regard, important roles in the pathogenesis of neurovascular, neurodegenerative, and neuroinflammatory disorders have all been described defining KLKs as important new targets for the development of therapies that may broadly affect the function of the nervous system.

14.2 KLK expression and roles in CNS physiology 14.2.1 KLK expression in the CNS The KLKs comprise a family of 15 structurally and functionally related serine proteases, that cluster on human chromosome 19q13.3-4. KLKs are often co-expressed in tissues and their expression patterns in the CNS reflect this general principle. KLK

350

Isobel A. Scarisbrick

expression patterns, based on combined analysis of RNA and protein levels in whole brain and spinal cord samples as well as in the cerebrospinal fluid (CSF), position at least 12 of the 15 KLKs to participate, at some level, in ongoing CNS physiology. Importantly, many KLKs are also strongly regulated by activity, steroid hormones, or injury, and therefore changes in expression seen in pathological conditions may point to new or additional disease-related roles. Moreover, all KLKs are also present in serum, such that any disorders associated with a breakdown of the blood brain barrier (BBB) would permit involvement of multiple KLKs in CNS disease, including those not expressed at significant levels in the otherwise intact healthy adult brain and spinal cord. At the RNA level, real-time polymerase chain reaction (PCR) methods have been applied to provide a comprehensive evaluation of the expression level of all 15 KLKs in the human brain and spinal cord, in addition to other tissues (Scarisbrick et al., 2006a) (Fig. 14.1). Taken with results of other studies that used conventional PCR and Northern blot, it is clear that KLKs are differentially expressed regionally within the CNS. The reader is referred to individual studies for full details (Clements et al., 2001; Harvey et al., 2000; Scarisbrick et al., 1997; 2001; Shaw and Diamandis, 2007). The quantitative data of Scarisbrick et al. (2006a) is presented in Fig. 14.1. As reported at the time of its initial cloning (Little et al., 1997; Scarisbrick et al., 1997; Yamashiro et al., 1997), KLK6 is highly expressed in the CNS, and is now known to be the most abundant of all KLKs within the brain and spinal cord by approximately a factor of 10. In addition, KLK6 is expressed at higher overall levels in the CNS compared to tissue plasminogen activator, a serine protease with better-known functions in the brain, and indeed KLK6 may be the most abundant serine protease in the human nervous system identified to date (Scarisbrick et al., 1991; 2001). In general, considering expression across the brain and spinal cord, KLK5, 6, 7, and 10 transcript levels were detected at an overall high level. KLK1, 8, and 14 showed moderate levels of expression, and KLK2 and KLK13 were detected at, on average, low levels. In the normal brain and spinal cord, KLK3, 4, and 15 were below detection limits, although all KLKs were observed in the prostate (Scarisbrick et al., 2006a). Direct comparison of KLK RNA levels in the brain relative to the spinal cord, indicates that KLK1, 6, and 10 are each expressed at significantly higher levels in the spinal cord relative to the brain, while KLK2, 5, 7, 9, 12, and 14 are more abundant in samples of whole brain (Scarisbrick et al., 2006a). There are also several reports regarding expression of KLK11 in the hippocampus (Mitsui et al., 2000; Yoshida et al., 1998b) and the cerebellum (Yousef et al., 2000). Prior to revision of the KLK nomenclature, some of the KLK names reflected early recognition of their prominent CNS expression. For example, KLK6 was termed neurosin (Yamashiro et al., 1997), or myelencephalon-specific protease, in human and rat (Scarisbrick et al., 1997), and brain serine protease (Matsui et al., 2000), or brain and skin serine protease in mouse (Meier et al., 1999). Other examples include KLK8, which was termed neuropsin (Chen et al., 1995), and KLK11, referred to as hippostatin (Mitsui et al., 2000).

351

Kallikrein-related Peptidases in the Central Nervous System

1

15

2

3

4

5

6

7

8

9

10

11

12

13

14

Br

.24

nd

.38

nd

nd

22

56

13

.24

.16

15

nd

2.1

.02

.57

SC

2.1

nd

.01

nd

nd

9.0

170

5.1

.38

.06

39

nd

1.6

.03

.23

Kd

20

.18

.0006

nd

nd

2.9

31

1.1

.42

.005

.45

nd

.81

.0002

.05

Bst

1.8

nd

.014

nd

nd

104

19

19

8.5

.01

70

.58

1.3

.05

.22

Pr

11

1.4

9760

262

159

1.9

2.1

.20

.06

.01

33

12

2.0

.35

.2

nd

101

10 2

10 3

10 4

10 5

10 6

107

Fig. 14.1 Heat map indicating the relative RNA copy number (104) of KLK1 through KLK15 detected by real-time RT-PCR in 0.5 μg of RNA isolated from the adult human brain (Br), spinal cord (SC), kidney (Kd), breast (Bst), or prostate gland (Pr). Equal loading was verified by amplification of GAPDH in the same tissue samples (not shown). (‘nd’ stands for not detected). Data is summarized from those published by Scarisbrick et al. (2006a).

At the protein level, quantitative, enzyme-linked, immunosorbent assays demonstrate significant levels of 7 of the 15 KLKs in adult brain protein extracts (Shaw and Diamandis, 2007). Confirming the overall enrichment of KLK6 in the CNS, levels of KLK6 protein (median 1.7 μg/g; range 11.4–22.8) were a factor of 100 greater than those of KLK9 or KLK10, and each was detected at 10-fold higher levels than KLK1, 5, 8 or 15. In the spinal cord, several KLKs were detected at a μg/g level, including KLK6, which was most abundant (median 9.9 μg/g; range 6.9–14.4), followed by KLK11 and KLK12. Significant levels of KLK7 and KLK9 were also detected, followed by KLK4, 13 and 15, while the other KLKs were below the detection limit of the assay. The author cautions that lack of detection in a given assay does not necessarily mean lack of expression. In organs as complex as the brain and spinal cord, expression by a subset of neuron or glial populations could go undetected by examination of RNA and protein extracted from whole organ homogenates. Shaw and Diamandis (2007) also present a comprehensive analysis of KLKs in biological fluids, including CSF. In addition to contributing to buoyancy and cushioning in the brain, the CSF helps maintain chemical stability by circulating metabolic waste to the venous system. The composition of the CSF therefore reflects in part that of the interstitial fluids of the CNS parenchyma. Therefore, as expected, based on the high level of KLK6 expression in brain and spinal cord, KLK6 is the most abundant of all KLKs in CSF. In CSF, median KLK6 levels were 599 μg/L (range 428–37,300), and more than 10 times higher than KLK5, 100 times higher than KLK9, 1,000 times higher than KLK10, and 10,000 times higher than KLK13, 14, or 15. The high levels of KLK6 in CSF are reflected in strong protein staining in the epithelium of the choroid plexus (Petraki et al., 2001). While the regional and cellular specific expression patterns of all KLKs within the brain and spinal cord have yet to be fully documented, for the KLKs that have

352

Isobel A. Scarisbrick

been studied in this regard, expression patterns have proven to be highly specific. For example, KLK6 is present in the spinal cord at levels 10 times higher than in the brain at both RNA (Scarisbrick et al., 1997) and protein level (Shaw and Diamandis, 2007). Notably, KLK6 is also elevated in the medulla oblongata, relative to whole brain samples (Scarisbrick et al., 1997; 2001). This enrichment reflects the abundance of white matter in the cord and brain stem and the fact that, in white matter, KLK6 is highly expressed by oligodendroglia (Scarisbrick et al., 1997; 2000; 2002; Terayama et al., 2004; Yamanaka et al., 1999). This observation, along with regulated expression in cases of injury, led to the very early hypothesis that KLK6 likely participates in myelination (Scarisbrick et al., 1997). The robust expression of KLK6 by oligodendroglia was further substantiated by demonstration of RNA and protein expression in the corpus callosum, the optic nerve and subcortical white matter (Scarisbrick et al., 2001). In addition to high levels of expression in the brain and spinal cord white matter oligodendroglia, KLK6 is also expressed at significant levels in other highly clinically significant human brain regions (Scarisbrick et al., 1997; 2001). Of the brain structures examined to date, the next highest levels of expression of KLK6 after the spinal cord occur in the hippocampus, followed by the frontal lobe, subthalamic nucleus, substantia nigra, thalamus, putamen, and caudate nucleus. In each of these regions KLK6 RNA expression is enriched, relative to that seen in whole brain (Scarisbrick et al., 1997). Significant levels of KLK6 RNA are also detected in the amygdala, the temporal and occipital lobes, as well as in the cerebellum, but in these regions, expression levels are at or below those observed in the whole brain. Interestingly, with the exception of the kidney, in which KLK6 RNA expression is only slightly lower than that detected in the spinal cord, expression in most peripheral organs is close to, or below, that detected in the whole brain. In situ hybridization and immunohistochemical localization of KLK6 in human and rodent brain and spinal cord point to significant expression not only in oligodendroglia, but also at varying levels in neurons (Scarisbrick et al., 2001). This includes dense expression by dopamine-containing neurons of the substantia nigra pars compacta, pyramidal neurons of the hippocampus, large multipolar neurons of the corpus striatum, alpha motoneurons of the spinal cord and other cord gray laminae, neurons of the olfactory bulb, including mitral cells, and neurons in all layers of the cerebral cortex. KLK6 immunoreactivity has also been described in the anterior pituitary. KLK5-8 and KLK10–14 have been localized to the pituitary, with KLK6 localized to growth-hormone-producing cells (Komatsu et al., 2007; Petraki et al., 2001; 2002). Despite dense expression by oligodendroglia and neurons of the normal brain and spinal cord, KLK6 is not expressed in resting astrocytes or microglia, but, notably, expression in each of these cell types is increased after injury (Little et al., 1997; Scarisbrick et al., 1997; 2000; 2006b; 2012a). While KLK6 in the peripheral nervous system has not been examined in detail, immunohistochemical studies have shown expression in human peripheral nerve dorsal root ganglion neurons and Schwann cells, as well as olfactory ensheathing cells (Scarisbrick et al., 2001). Immunohistochemical

Kallikrein-related Peptidases in the Central Nervous System

353

studies have revealed the cellular expression of KLK6 to be primarily cytoplasmic, with immunoreactivity also detectable in extracellular spaces (Petraki et al., 2001; 2002; Scarisbrick et al., 2000; 2001). The other KLK that has been described in some detail at a cellular level in the CNS is KLK8. KLK8 was cloned from the human hippocampus (Chen et al., 1995) and shows a highly restricted expression pattern within forebrain regions, particularly the CA1 and CA3 pyramidal neurons of the hippocampus, and early on these observations led to the hypothesis that KLK8 participates in learning and memory formation (Chen et al., 1995). There is now a substantial body of evidence linking KLK8 to synaptic plasticity and long-term potentiation (LTP), although its role in learning and memory remains equivocal (Davies et al., 2001; Tamura et al., 2006). KLK8 is also expressed in the cerebral cortex, lateral nucleus of the amygdala, nucleus basalis of Meynert, septal nuclei, cerebellum, and frontal lobe (Attwood et al., 2011; Chen et al., 1995; 1998; Mitsui et al., 2000; Yoshida et al., 1998a). Given the significant levels of expression of several other KLKs in the CNS (Scarisbrick et al., 2006a; Shaw and Diamandis, 2007), there is a need to further delineate their neuron- and glial-specific expression patterns, as this will continue to shed light on the CNS-specific roles in health and disease of this important gene family. There are several reports of multiple transcripts for certain KLKs, some of which appear to be nervous-system-specific (see also Chapter 1). For example, KLK6 mRNA splice variants that have identical translation initiation sites in exon 3, but differ in their 5ʹ-UTR, were identified by RACE PCR and are likely generated by distinct tissuespecific promoter elements (Christophi et al., 2004). These transcripts, designated transcripts 1 and 2, differ in sequence between mouse and human, but show identical genomic organization and tissue-restricted expression, with transcript 1 detectable only in the CNS and transcript 2 additionally detected in non-neural tissues (Christophi et al., 2004). There are at least 4 splice variants of human KLK8 (Magklara et al., 2001), with type 2 preferentially expressed in adult brain (Mitsui et al., 2000). Since this transcript is only detected in human CNS, but not in other species, a role in human cognitive function is proposed (Li et al., 2004). At least 3 isoforms of KLK11 have been identified, with one isoform expressed only in non-neural tissues, but not in the CNS (Mitsui et al., 2006). The significance of CNS-specific KLK isoforms is intriguing and remains to be elucidated.

14.2.2 Physiological roles of KLKs in the CNS As secreted serine proteases, KLKs are positioned to participate in turnover and modeling of extracellular matrix molecules (ECM) in the CNS and peripheral nervous system (Bernett et al., 2002; Blaber et al., 2002; Borgoño and Diamandis, 2004). In addition, select KLKs have demonstrated roles in the activation of G-protein linked bradykinin receptors and PARs (see Chapter 15), which are not only known to be

354

Isobel A. Scarisbrick

expressed in the nervous system, but are already linked to physiological function and disease (Adams et al., 2011 for review). While much remains to be learned, it is becoming clear that KLKs are poised to profoundly affect the physiological function of the developing and adult nervous system (Tab. 14.1). Tab. 14.1 KLKs in CNS physiology and pathophysiology. System

KLK

Phenotype

Reference

Synaptic plasticity

KLK8

Cleavage of presynaptic L1 Facilitation of Schaffer collateral LTP Neurite outgrowth and fasciculation KLK8–/– mice show reduced early LTP and have abnormal CA1 synapses

Matsumoto-Miyai et al., 2003 Komai et al., 2000 Oka et al., 2002 Davies et al., 2001; Tamura et al., 2006; Ishikawa et al., 2008; Hirata et al., 2001 Attwood et al., 2011

KLK6

Breakdown of BBB ECM

KLK2, 3, 6, 14

Immune cell extravasation Astrogliosis

KLK6

Stroke

Trauma

KLK6

KLK1

KLK6 KLK6

Cleavage of EphB2 to modulate stress related plasticity in the amygdala Regulates neurite outgrowth by cleaving permissive and inhibitory substrates Activation of PAR1 on NSC34 neurons to elicit Ca2+ and MAPK signaling Cleavage of laminin, fibronectin and collagens

KLK6-neutralizing antibodies reduce lymphocyte migration and invasion Promotes astrocyte stellation and IL-6 production Activation of astrocyte PAR1 and PAR2 to elicit Ca2+ and MAPK signaling Increased in stroke Acutely associated with brain edema and increased vascular permeability Delayed KLK1 gene delivery promotes beneficial effects in rat MCAO in a B2-dependent manner Infusion in patients with brain infarction improves outcome Increased in rat MCAO model Increased in human and rodent contusion SCI Increased in spinal cord with excitotoxicity Increased with rodent spinal cord hemisection Toxicity to primary neurons and oligodendrocytes in culture

Scarisbrick et al., 2006b Vandell et al., 2008 Lilja, 1985 Bernett et al., 2002 Blaber et al., 2002 Deperthes et al., 1996 Magklara et al., 2003 Blaber et al., 2004 Scarisbrick et al., 2012a Vandell et al., 2008, Scarisbrick et al., 2012a Chao et al., 2006 Wagner et al., 2002, Chao et al., 2010 Xia et al., 2004; 2006

Ding et al., 2007 Kwok et al., 2011 Uchida et al., 2004 Scarisbrick et al., 2006b, 2012a Scarisbrick et al., 1997 Terayama et al., 2004 Scarisbrick et al., 2002, 2008

Kallikrein-related Peptidases in the Central Nervous System

355

Tab. 14.1 (continued) System

KLK

Phenotype

Reference Scarisbrick et al., 2012a Tomizawa et al., 1999

KLK1 KLK8

Promotes development of astroglial scar Increased with stab and excitotoxic CNS injury KLK8–/– mice show reductions in axon injury and improved motor performance in a crush SCI model Increased in hippocampal sclerosis Increased with kindling

KLK6

KLK8-neutralizing antibodies blocks kindling KLK8–/– mice are more prone to seizure activity Reduced in AD plaques

KLK8

Epilepsy

Alzheimer’s disease

Reduced in AD CSF Reduced in AD serum

Frontotemporal dementia Parkinson’s disease Post-polio syndrome Neuroinflammation

Terayama et al., 2007

Simoes et al., 2011 Chen et al., 1995 Okabe et al., 1996 Kishi et al., 1997, 1999 Momota et al., 1998 Davies et al., 1998, 2001 Little et al., 1997 Diamanids et al., 2000 Ogawa et al., 2000 Zarghooni et al., 2002 Mitsui et al., 2002 Diamandis et al., 2004 Menendez-Gonzalex et al., 2008 Little et al., 1997 Shimizu-Okabe et al., 2001 Diamandis et al., 2004

KLK8 KLK6 KLK7 KLK10 KLK6

Cleaves amyloid Elevated in AD hippocampus Reduced in CSF Reduced in CSF Elevated in CSF Localized to Lewy bodies in PD brain

KLK6

Degrades α-synuclein Elevated in CSF

Tatebe et al., 2010 Gonzalez et al., 2009

KLK1

Elevated in MS patient serum

Scarisbrick et al., 2008

Promotes lymphoproliferation Elevated in MS lesions Elevated in serum of progressive MS patients Elevated in CSF of progressive MS patients Elevated in serum and CNS in viral and autoimmune murine models of MS

Scarisbrick et al., 2011 Scarisbrick et al., 2002 Scarisbrick et al., 2008

KLK6

Hydrolyzes myelin proteins (MBP and MOG)

Iwata et al., 2003

Hebb et al., 2011 Scarisbrick et al., 2002 Blaber et al., 2004 Christophi et al., 2004 Blaber et al., 2002 Bernett et al., 2002 Blaber et al., 2004

356

Isobel A. Scarisbrick

Tab. 14.1 (continued) System

KLK

KLK8

Phenotype

Reference

KLK6 blocks lymphocyte apoptosis by regulating Bcl2 family member signaling KLK6-neutralizing antibodies attenuate Th1 immune responses, CNS inflammation and neurobehavioral deficits in murine autoimmune models of MS KLK8–/– mice display reduced clinical scores and preservation of myelin in murine viral and autoimmune model of MS

Scarisbrick et al., 2011 Blaber et al., 2004; Scarisbrick et al., 2012b

Terayama et al., 2005

Functional roles of KLKs in the modification of the CNS extracellular matrix The parenchyma of the adult brain contains relatively low amounts of fibrous matrix proteins such as collagens, fibronectin, and vitronectin, or basement membrane proteins such as laminin, although many of these are enriched during nervous system development, can increase in states of disease, and form key components of the BBB. In the adult brain, the ECM is primarily comprised of proteoglycans (lecticans), including aggregan, neurocan, vesican, and brevican, as well as the tenascins and hyalurnonic acid ECMs with which these interact (Aspberg et al., 1997). The ECM can directly impact the function of neurons and glia which express ECM-specific receptors, such as integrins. In the CNS, ECM molecules functionally compartmentalize the brain, serving as synaptic and perisynaptic scaffolds that alter localization and clustering of neurotransmitter receptors, and can affect both synaptic maturation and plasticity (Kwok et al., 2011). There is a considerable body of evidence regarding the roles of KLK8 in activitydependent synaptic plasticity within the hippocampus, effects which can be attributed in part to its ability to modify ECM. For example, N-methyl-D-aspartate (NMDA) receptor activation in the mouse hippocampus increases KLK8 enzymatic activity, resulting in cleavage of the presynaptic adhesion molecule L1 that is linked to Schaffer collateral LTP. A neutralizing KLK8 antibody or inhibition of NMDA receptors blocks this effect (Matsumoto-Miyai et al., 2003) and decreases Schaffer collateral LTP (Komai et al., 2000). LTP is induced by brief repetitive stimulation and results in an activity-dependent and long-lasting enhancement of synaptic efficacy, which is believed to play a role in memory formation. Application of KLK8 to hippocampal slices facilitates LTP and KLK8-neutralization diminishes LTP (Komai et al., 2000; Momota et al., 1998). In KLK8-deficient mice, asymmetrical mature synapses are reduced (Hirata et al., 2001). Interestingly, early transient LTP is blocked in KLK8 knockout mice, while the capacity to generate late, long-lasting LTP appears unaffected (Davies et al., 2001; Ishikawa et al., 2008; Tamura et al., 2006). Effects of KLK8

Kallikrein-related Peptidases in the Central Nervous System

357

deletion on learning and memory are still unclear, with significant delays in Morris water maze learning demonstrated by Tamura et al. (2006), but not by Davies et al. (2001). Taken together, this data supports a model in which KLK8 promotes synaptic plasticity, including LTP, and the assumption that this is likely to depend on the processing of L1. Consistent with a role in synaptic rearrangement, KLK8 was also shown to participate in neurite outgrowth and fasciculation in vitro (Oka et al., 2002). While other KLKs have yet to be examined with regard to their activities in synaptic plasticity, additional studies are warranted, given the demonstrated or predicted roles for many in the degradation of ECM (Borgoño and Diamandis, 2004). KLK6 expression is regulated in an activity-dependent fashion (Scarisbrick et al., 1997) and plays a dynamic role in neurite outgrowth (Scarisbrick et al., 2006b). In vitro, KLK6 modifies the growth-facilitatory substrate laminin to decrease neurite outgrowth. By contrast, KLK6 hydrolyzes aggrecan, a chondroitin sulfate proteoglycan known to be inhibitory to nerve regeneration, to promote neurite outgrowth (Scarisbrick et al., 2006b). Taken with the regulated expression of KLK6 seen in CNS injury and disease (Diamandis et al., 2000; Little et al., 1997; Scarisbrick et al., 1997; Terayama et al., 2004; Uchida et al., 2004), these studies indicate that KLK6 is positioned to modulate the balance of permissive and inhibitory cues that regulate axon outgrowth and potentially nerve regeneration (Scarisbrick et al., 2006b). Endothelial and astrocyte cellular elements of the BBB secrete ECM components that are critical to the separation of the CNS milieu from blood components, and this is essential to the maintenance of CNS homeostasis. Disruption of the BBB directly affects the progression of neurological disease. Since KLKs may directly cleave ECM components, or do so indirectly by activation of metalloproteases (Menashi et al., 1994) or fibrinolytic enzymes (Blaber et al., 2010; Yoon et al., 2007; 2008; 2009), KLKs are poised to play key roles in the disruption of the BBB, thereby making it more permeable to blood proteins and infiltrating immune cells. Several KLKs directly degrade key components of the BBB ECM, such as laminin, fibronectin, and collagens, including KLK2, 3, 6, and 14 (Bernett et al., 2002; Blaber et al., 2002; Deperthes et al., 1996; Lilja, 1985; Magklara et al., 2003). The secretion of KLK6 by activated T cells and monocytes is thought to facilitate the migration of immune cells across the BBB, a process referred to as extravasation (Scarisbrick et al., 2002). Supporting this, KLK6-neutralizing antibodies block the migration of activated immune cells across a matrigel barrier in vitro and reduce the development of CNS inflammatory infiltrates in animal models of multiple sclerosis (MS) (Blaber et al., 2004; Scarisbrick et al., 2012b). Also, alterations in ECM can directly alter the organization of ion channels and transporters at contacts between astrocyte processes and blood vessels (Dityatev et al., 2010). Importantly, by virtue of their ability to activate bradykinin receptors and PARs, KLKs may directly alter the functional properties of the endothelial and astrocytic cellular components of the BBB and therefore directly affect its permeability (Scarisbrick et al., 2012a; Vandell et al., 2008).

358

Isobel A. Scarisbrick

Functional roles of KLKs in receptor activation A significant advance in understanding the potential physiological and pathophysiological actions of KLKs in health and disease came with the discovery that at least some KLKs are physiological activators of PARs (Angelo et al., 2006; Oikonomopoulou et al., 2006a and b; Stefansson et al., 2008; Vandell et al., 2008; see also Chapter 15). PARs can serve as sensor proteins of the microenvironment, since they are cell surface receptors, activated by proteolytic cleavage, and capable of translating this signal via G-proteins to intracellular signaling cascades, which can profoundly affect cell behavior. PARs have been widely implicated in disease, including CNS pathology (Noorbakhsh et al., 2006; Rohatgi et al., 2004). All 4 PARs are expressed in the brain and spinal cord with PAR1 being the most abundant (Junge et al., 2004; Vandell et al., 2008), and are already implicated in neural injury (Festoff et al., 2000; Striggow et al., 2000; Turgeon et al., 1998), in NMDA receptor potentiation (Gingrich et al., 2000; Hammill et al., 1999; Han et al., 2011), and in astrogliosis (Boven et al., 2003; Nicole et al., 2005; Sorensen et al., 2003; Wang et al., 2002; Wang et al., 2007). In CNS-derived neuron and astroglial cell lines, KLK6 activates PAR1 and PAR2. Specifically, KLK6 cleaves and thereby activates PAR1 in NSC34 neurons and both PAR1 and PAR2 in Neu7 astrocytes, to elicit Ca2+ flux and differential signaling of MAPK family members and AKT (Vandell et al., 2008). The ability of KLK6, but not KLK1, to activate ERK1/2 was blocked by the synthetic PAR1 inhibitor SCH79797. In both Neu7 and primary astrocytes, KLK6 triggers astrocyte stellation, a key hallmark of astrogliosis, and this occurs in a PAR1-dependent fashion (Scarisbrick et al., 2012a). KLK6 also mediates Bcl2 family member signaling by activation of PAR1 in lymphocytes (Scarisbrick et al., 2011). KLK5, 6, and 14 are each able to mobilize Ca2+ in rat v-Kras-transformed normal rat kidney PAR2 over-expressing cells and to mediate aortic ring relaxation in a PAR2-dependent fashion (Oikonomopoulou et al., 2006a and b). KLK1 activates PAR4 in a rodent paw edema model (Houle et al., 2005). KLK14 activates PAR2 and PAR4 and inactivates (disarms) PAR1 (Oikonomopoulou et al., 2006a). Taken together, these studies indicate that KLK6 is an activator of CNS PAR and, when considered with expression data (Scarisbrick et al., 2006a; Shaw and Diamandis, 2007), point to the likely roles of several other KLKs as physiological activators, or perhaps inactivators, of CNS PAR. The KLK-kinin system is positioned to play an important role in CNS function and disease, since both KLK1 and bradykinin receptors are present and are regulated by injury. KLK1 cleaves low-molecular-weight kininogen to release potent, short-lived vasoactive kinin peptides, lys-bradykinins, that exert biological activity by the activation of heterotrimeric G-protein coupled receptors, B1 and B2 (Bhoola et al., 1992). KLK1 is the only KLK with demonstrated efficient kininogenase activity and is therefore referred to as true “tissue KLK”. KLK1 (Chao et al., 1983; Scarisbrick et al., 2006a; Shaw and Diamandis, 2007) and B2 (Groger et al., 2005; Regoli et al., 1990; Viel et al., 2008) are expressed in the adult CNS. As in other organ systems, B1 is induced in CNS injury (Groger et al., 2005; Raidoo and Bhoola, 1998). The KLK-kinin system may

Kallikrein-related Peptidases in the Central Nervous System

359

therefore participate in both CNS physiology and pathophysiology. Moreover, in addition to the production of kinins, KLK1 was recently shown to directly activate kinin B2 receptors, independent of kinin release (Biyashev et al., 2006; Hecquet et al., 2000). Interestingly, the ability of KLK6 to promote activation of ERK in NSC34 neurons was reduced by either a PAR1 (SCH79797) or a B2 inhibitor (Icatibant) (Vandell et al., 2008). If KLKs other than KLK1 lack the ability to generate kinins, these findings suggest that some KLKs, including KLK6, may intersect the KLK-kinin system by direct activation of the B2 receptor (Vandell et al., 2008). In addition to modulation of the activity of PARs and bradykinin receptors, the trypsin-like activity of several KLKs positions them to intersect with other key receptor systems governing CNS physiology. Recently, KLK8 was shown to cleave the extracellular portion of EphB2, a member of the largest subfamily of receptor tyrosine kinases, to modulate stress-related plasticity in the amygdala (Attwood et al., 2011).

14.2.3 Pathophysiological roles of KLKs in the CNS The response of the CNS to a wide variety of injuries, including ischemia, trauma, seizures, autoimmunity, or infection, includes the release of inflammatory mediators. Among these, reactive oxygen species, nitric oxide, excitatory amino acids, cytokines, matrix metalloproteases, thrombostasis enzymes, and bradykinin contribute to the dilation of cerebral arterioles, disruption of the BBB, edema, gliosis, neuron injury, and cell death. Many of these players are also seen in more slowly-developing pathologies such as Alzheimer’s and Parkinson’s disease as well as in demyelinating disorders, including MS. Of the KLKs, KLK1 has been the most extensively studied with regard to CNS injury and there is growing evidence regarding the potential roles of several other members of the family, including KLK6 and KLK8 (Tab. 14.1). Since KLKs appear to participate in enzymatic cascade interactions with matrix metalloproteases and thrombolytic enzymes (Blaber et al., 2010), there is a great need to better define their participation in CNS pathogenesis, particularly because this may inform new therapeutic approaches.

KLKs in stroke KLK1 is responsible for kinin release and the KLK-kinin system is regarded as an important facet of the inflammatory pathway activated in response to tissue injury. Components of the KLK-kinin system are each regulated by ischemic stroke (Wagner et al., 2002), including induction of KLK1 (Chao et al., 2006). Less is known regarding the role of other KLKs in a stroke, although elevations in KLK6 occur in the rat middle cerebral artery occlusion (MCAO) model (Uchida et al., 2004). There is now a robust body of literature demonstrating that KLK1-mediated activation of B2 can promote beneficial effects in models of vascular disease, including myocardial infarc-

360

Isobel A. Scarisbrick

tion and ischemic stroke, independent of the hypotensive effects of the enzyme (Xia et al., 2006). For example, in a rat model of middle cerebral artery occlusion, intracerebroventricular or intravenous delivery of an adenoviral KLK1 expression construct confers neuroprotection against cerebral ischemic injury with enhanced astrocyte migration and angiogenesis and reduced neuron apoptosis, inflammation and signs of oxidative stress (Xia et al., 2004; Xia et al., 2006). By contrast, B2-specific antagonists, delivered post-ischemic injury (Ding-Zhou et al., 2003; Gonzalez et al., 2009; Relton et al., 1997; Zausinger et al., 2002), or genetic deletion of B2 (Groger et al., 2005) each reduce infarct volume and edema. Also, B2 activation promotes detrimental effects (Liu et al., 2009; Su et al., 2009) and aggravates ischemia/reperfusion injury (Chiang et al., 2006). In fact, application of recombinant KLK1 is toxic to murine cortical neurons in vitro (Scarisbrick et al., 2008). There is a growing consensus that, acutely, B2 activation may be detrimental by increasing brain edema and vascular permeability, while delayed KLK gene delivery or protein infusion provides beneficial effects (see Chao et al. (2010) for discussion). Supporting the therapeutic potential of KLK1, a multicenter, double-blind clinical trial demonstrated efficacy of infusion of KLK1 in patients with acute brain infarction, when treatment was initiated within 48 hours after onset of the stroke (Ding et al., 2007). Also, administration of human KLK1 for 12–14 days after the stroke, increased sensory cortex activation volume (Kwok et al., 2011). Since kinins are well-recognized to promote proinflammatory responses, vascular permeability, and hypotension, their widespread application in CNS injury or disease will require some caution (Couture et al., 2001).

KLKs in CNS trauma Trauma to the brain and spinal cord triggers a cascade of secondary events, which have a tremendous impact on patient outcome. In traumatic brain injury, brain edema results in increased intracranial pressure and is one of the most important factors governing survival and functional outcomes. Edema results from opening of the BBB and can be mediated by several factors, including bradykinin. Bradykinin increases permeability of the BBB and promotes increased intracranial pressure, largely through activation of B2 (Wahl et al., 1996). Inhibition of B2 was shown to reduce intracranial pressure and contusion volume 24 hours after experimental traumatic brain injury (Zweckberger and Plesnila, 2009). While KLK8 is not normally expressed in CNS white matter, KLK8 RNA is significantly increased with CNS injury, including stab injuries and excitotoxic injury induced by injection of kainic acid (Tomizawa et al., 1999). In KLK8 knockout mice, there appears to be a reduction in trauma-induced injury to the spinal cord, including reduced loss of oligodendrocytes, with preservation of myelin, reduced axon injury, and improved motor performance (Terayama et al., 2007). Significant elevations of KLK6 occur in association with oligodendroglia, astrocytes, and monocytes/microglia in cases of human spinal cord injury, with persistent

Kallikrein-related Peptidases in the Central Nervous System

361

high levels of expression even in chronic cases (Scarisbrick et al., 2006b; 2012a). Elevations in spinal cord KLK6 have also been described in rodent models of spinal cord injury, including glutamate receptor-mediated excitotoxicity (Scarisbrick et al., 1997), hemisection (Terayama et al., 2004), and contusion injury (Scarisbrick et al., 2006b). KLK6 is also increased in response to cryogenic cortical lesions (Oka et al., 2005). Since KLK6 activates PAR1 and PAR2 in astrocytes and promotes MAPK activation, stellation and interleukin 6 secretion, which are all hallmarks of astrogliosis, a role in development of the glial scar is suggested (Scarisbrick et al., 2012a). Together with evidence that elevated levels of KLK6 are neurotoxic (Scarisbrick et al., 2008), oligotoxic (Scarisbrick et al., 2002), and can modify ECM to alter axon outgrowth (Scarisbrick et al., 2006b), KLK6 is in a key position to regulate the regeneration environment and remyelination of the adult CNS (Scarisbrick et al., 1997; 2002; 2006b).

KLKs in epilepsy Epilepsy is characterized by seizures, that are signs of excessive or hypersynchronous brain activity. Elevations in KLK1 occur in glial fibrillary acidic protein reactive astrocytes in patients with hippocampal sclerosis, secondary to refractory temporal lobe epilepsy (Simoes et al., 2011). Both B1 and B2 are also elevated in temporal lobe epilepsy (Arganaraz et al., 2008; Perosa et al., 2007). Results from bradykinin receptor knockout mice and the administration of inhibitors suggest B1 promotes epileptogenic events, while B2 plays a neuroprotective role (Arganaraz et al., 2004; Silva et al., 2008). KLK8 has been implicated in a murine model of epilepsy, referred to as kindling (Kishi et al., 1997; 1999; Momota et al., 1998), in which weak electrical stimulation of the hippocampus over time results in synaptic rearrangement, such that the same weak stimulus subsequently triggers convulsions. In this model of epilepsy, cumulative stimulation results in an increase in hippocampal KLK8 RNA (Chen et al., 1995; Okabe et al., 1996) and a KLK8-neutralizing antibody injected into the lateral ventricle delays the progress of kindling (Momota et al., 1998). Interestingly, KLK8deficient mice are more prone to global seizure activity (Davies et al., 2001; Davies et al., 1998) and have abnormalities in synapses and neurons in the CA1 region of the hippocampus (Hirata et al., 2001).

KLKs in neurodegenerative disorders Alzheimer’s disease (AD) is a progressive neurodegenerative disease, characterized by neuron degeneration, the formation of neurofibrillary tangles, and the accumulation of Aβ, leading to impairment of cognitive function. Several KLK family members are linked to AD pathology. Independent lines of research point to reductions in KLK6 RNA and protein levels in AD plaques (Ashby et al., 2011; Diamandis et al., 2000; Little et al., 1997; Ogawa et al., 2000; Zarghooni et al., 2002). KLK6 is also reduced in AD patients’ CSF (Diamandis et al., 2004; Mitsui et al., 2002) and serum (Menendez-

362

Isobel A. Scarisbrick

Gonzalez et al., 2008). Importantly, in terms of a potential role in the pathogenesis of AD, KLK6 cleaves amyloid-generating amyloidogenic fragments (Little et al., 1997). By contrast, KLK8 RNA in AD hippocampus is elevated by a factor of 11.5 compared to controls (Shimizu-Okabe et al., 2001). Of additional interest is the fact that KLK6 and KLK7 are also reduced in CSF in cases of frontotemporal dementia, whereas KLK10 levels are elevated (Diamandis et al., 2004). The KLK-kinin system is also linked to AD, since deficiency in B1 is protective in response to Aβ infusion intracerebroventricular, while neuron loss and memory deficits are exacerbated in B2 deficient mice (Amaral et al., 2011). Similar effects of B1 and B2 on cognitive function were reported in aged mice (Lemos et al., 2011). The ability of several KLKs to cleave components of the ECM and perineuronal net, including fibronectin, fibrinogen, and collagen types I and IV (Bernett et al., 2002; Ghosh et al., 2004; Magklara et al., 2003) may also have relevance to CNS changes involved in neuron dysfunction and memory loss, since these proteins interact directly with amyloid precursor protein (Ashby et al., 2011). There is an as of yet unknown role suggested for KLK6 in the pathogenesis of Parkinson’s disease and other synucleoinopathies. KLK6 has been localized to intracellular Lewy bodies in the brain of Parkinson’s disease patients. However the role here remains equivocal (Iwata et al., 2003; Kasai et al., 2008; Ogawa et al., 2000). Recent studies confirm that KLK6 degrades α-synuclein in the extracellular space (Tatebe et al., 2010).

KLKs in neuroinflammatory disorders A number of common CNS disorders manifest with an acute or chronic inflammatory component, including myelopathies, leukodystrophies, progressive multifocal leukoencephalopathy, acute disseminated encephalomyelitis, and MS. The KLKkinin system plays a key role in inflammation where B2 mediates acute inflammatory responses, including increased vascular permeability, arterial dilatation, and pain. B1 receptors also appear to be proinflammatory by promoting leukocyte trafficking, edema, and pain (McLean et al., 2000). B1 receptors are associated with vascular endothelial cells and perivascular infiltrates in MS lesions, including T-lymphocytes (Prat et al., 1999; 2000). Activation of B1 on T-cells decreases migratory capacity (Prat et al., 1999). Activation of kinin B2 receptors increases permeability of the BBB and therefore promotes brain edema (Su et al., 2009). Interestingly, in the MOG- (myelin oligodendrocyte glycoprotein) 35–55 induced experimental autoimmune encephalomyelitis (EAE) model of MS, B2 deficiency significantly reduces disease parameters (Dos Santos et al., 2008), while B1 deficiency exacerbates disease, including increased inflammatory infiltrates (Schulze-Topphoff et al., 2009). KLK6 is elevated in actively demyelinating MS lesions (Scarisbrick et al., 2002) and in autoimmune and viral animal models of this disease, where it is associated with infiltrating lymphocytes and monocytes, as well as reactive astrocytes and microglia (Blaber et al., 2004; Christophi et al., 2004; Scarisbrick et al., 2002). Along

Kallikrein-related Peptidases in the Central Nervous System

363

with KLK1, KLK6 is significantly elevated in the serum of progressive MS patients, and levels correlate with the extent of disability (Scarisbrick et al., 2008). KLK6 is also elevated in MS patient CSF (Hebb et al., 2011) and in the CSF of patients with post-polio syndrome (Gonzalez et al., 2009). Notably, in vitro studies using recombinant enzyme demonstrate that, in excess, KLK6 contributes to both neuron injury (Scarisbrick et al., 2008) and oligodendrogliopathy (Scarisbrick et al., 2002), each a key feature of the degenerative changes that can occur in MS. Importantly, KLK6 readily hydrolyzes myelin basic protein (MBP) and MOG (Bernett et al., 2002; Blaber et al., 2004; Scarisbrick et al., 2002). Indeed, among 50 substrates tested in one comprehensive study, KLK6 showed highest hydrolytic activity towards MBP (Angelo et al., 2006). KLK6-neutralizing antibodies delay the onset and reduce the severity of both proteolipid protein (PLP)139-151-induced and MOG35-55-induced EAE (Blaber et al., 2004). Further implicating KLK6 in MS, is the fact that its expression is elevated in activated T cells, as well as in those stimulated by glucocorticoids, androgens, or progesterone (Christophi et al., 2004; Scarisbrick et al., 2002; 2006a). Also, KLK6 promotes lymphocyte survival, while KLK1 has lymphoproliferative effects (Scarisbrick et al., 2011). KLK8 knockout mice exhibit delayed onset of MOG-induced EAE, reduced clinical scores, reduced oligodendrocyte apoptosis, and preservation of MBP RNA expression (Terayama et al., 2005). Taken together, this data supports the hypothesis that KLKs, including KLK1, 6, and 8 are likely key players in multiple facets of the “MS degradome” (Scarisbrick, 2008), and may therefore serve as useful therapeutic targets.

14.3 Conclusions and outlook While in many cases the physiological roles have yet to be fully defined, it is clear from what is currently known regarding expression patterns, physiological substrates, and regulation of diseases, that KLKs are positioned to play important roles in the CNS. Further understanding of the in vivo activation cascades among KLKs, and between KLKs and other protease systems, including metalloproteases and thrombostasis enzymes, will be needed, in order to begin to decipher the likely physiological actions of KLKs in the CNS under physiological and pathophysiological conditions. Given the known role of the KLK-kinin system and the emerging role of newly identified KLKs as hormone-like molecules, capable of impacting intracellular signaling cascades, a view of this gene family as regulatory enzymes, positioned to profoundly affect the behavior of neurons and glia, is emerging. If we see as much progress in understanding the actions of this important gene family in the next decade as in the last, novel diagnostics and therapeutic agents for serious CNS pathologies are likely to emerge.

364

Isobel A. Scarisbrick

Acknowledgements This work was supported by National Institutes of Health R01NS052741 and The Christopher and Dana Reeve Paralysis Foundation. Due to limited space we regret that not all relevant studies could be discussed.

Abbreviation AD BBB CNS CSF EAE ECM LTP MBP MCAO MOG MS NMDA PAR PLP

Alzheimer’s disease blood brain barrier central nervous system cerebrospinal fluid experimental autoimmune encephalomyelitis extracellular matrix molecules long-term potentiation myelin basic protein middle cerebral artery occlusion myelin oligodendrocyte glycoprotein multiple sclerosis N-methyl-D-aspartate protease-activated receptors proteolipid protein

Bibliography Adams, M.N., Ramachandran, R., Yau, M.K., Suen, J.Y., Fairlie, D.P., Hollenberg, M.D., and Hooper, J.D. (2011). Structure, function and pathophysiology of protease activated receptors. Pharmacol. Ther. 130, 248–282. Amaral, F.A., Lemos, M.T., Dong, K.E., Bittencourt, M.F., Caetano, A.L., Pesquero, J.B., Viel, T.A., and Buck, H.S. (2011). Participation of kinin receptors on memory impairment after chronic infusion of human amyloid-beta 1–40 peptide in mice. Neuropeptides 44, 93–97. Angelo, P.F., Lima, A.R., Alves, F.M., Blaber, S.I., Scarisbrick, I.A., Blaber, M., Juliano, L., and Juliano, M.A. (2006). Substrate specificity of human kallikrein 6: salt and glycosaminoglycan activation effects. J. Biol. Chem. 281, 3116–3126. Arganaraz, G.A., Silva, J.A. Jr., Perosa, S.R., Pessoa, L.G., Carvalho, F.F., Bascands, J.L., Bader, M., da Silva Trindade, E., Amado, D., Cavalheiro, E.A., Pesquero, J.B., and da Graça NaffahMazzacoratti, M. (2004). The synthesis and distribution of the kinin B1 and B2 receptors are modified in the hippocampus of rats submitted to pilocarpine model of epilepsy. Brain Res. 1006, 114–125. Arganaraz, G.A., Konno, A.C., Perosa, S.R., Santiago, J.F., Boim, M.A., Vidotti, D.B., Varella, P.P., Costa, L.G., Canzian, M., Porcionatto, M.A., Yacubian, E.M., Sakamoto, A.C., Carrete, H. Jr., Centeno, R.S., Amado, D., Cavalheiro, E.A., Junior, J.A., and Mazzacoratti, G. (2008). The renin-

Kallikrein-related Peptidases in the Central Nervous System

365

angiotensin system is upregulated in the cortex and hippocampus of patients with temporal lobe epilepsy related to mesial temporal sclerosis. Epilepsia 49, 1348–1357. Ashby, E.L., Kehoe, P.G., and Love, S. (2011). Kallikrein-related peptidase 6 in Alzheimer’s disease and vascular dementia. Brain Res. 1363, 1–10. Aspberg, A., Miura, R., Bourdoulous, S., Shimonaka, M., Heinegard, D., Schachner, M., Ruoslahti, E., and Yamaguchi, Y. (1997). The C-type lectin domains of lecticans, a family of aggregating chondroitin sulfate proteoglycans, bind tenascin-R by protein-protein interactions independent of carbohydrate moiety. Proc. Natl. Acad. Sci. USA 94, 10116–10121. Attwood, B.K., Bourgognon, J.M., Patel, S., Mucha, M., Schiavon, E., Skrzypiec, A.E., Young, K.W., Shiosaka, S., Korostynski, M., Piechota, M., Przewlocki, R., and Pawlak, R. (2011). Neuropsin cleaves EphB2 in the amygdala to control anxiety. Nature 473, 372–375. Bernett, M.J., Blaber, S.I., Scarisbrick, I.A., Dhanarajan, P., Thompson, S.M., and Blaber, M. (2002). Crystal structure and biochemical characterization of human kallikrein 6 reveals that a trypsin-like kallikrein is expressed in the central nervous system. J. Biol. Chem. 277, 24562–24570. Bhoola, K.D., Figueroa, C.D., and Worthy, K. (1992). Bioregulation of kinins: kallikreins, kininogens, and kininases. Pharmacol. Rev. 44, 1–80. Biyashev, D., Tan, F., Chen, Z., Zhang, K., Deddish, P.A., Erdös, E.G., and Hecquet, C. (2006). Kallikrein activates bradykinin B2 receptors in absence of kininogen. Am. J. Physiol. Heart Circ. Physiol. 290, H1244–1250. Blaber, M., Yoon, H., Juliano, M.A., Scarisbrick, I.A., and Blaber, S.I. (2010). Functional intersection of the kallikrein-related peptidases (KLKs) and thrombostasis axis. Biol. Chem. 391, 311–320. Blaber, S.I., Scarisbrick, I.A., Bernett, M.J., Dhanarajan, P., Seavy, M.A., Jin, Y., Schwartz, M.A., Rodriguez, M., and Blaber, M. (2002). Enzymatic properties of rat myelencephalon-specific protease. Biochemistry 41, 1165–1173. Blaber, S.I., Ciric, B., Christophi, G.P., Bernett, M.J., Blaber, M., Rodriguez, M., and Scarisbrick, I.A. (2004). Targeting kallikrein 6-proteolysis attenuates CNS inflammatory disease. FASEB J. 19, 920–922. Borgoño, C.A., and Diamandis, E.P. (2004). The emerging roles of human tissue kallikreins in cancer. Nat. Rev. Cancer 4, 876–890. Boven, L.A., Vergnolle, N., Henry, S.D., Silva, C., Imai, Y., Holden, J., Warren, K., Hollenberg, M.D., and Power, C. (2003). Up-regulation of proteinase-activated receptor 1 expression in astrocytes during HIV encephalitis. J. Immunol. 170, 2638–2646. Chao, J., Woodley, C., Chao, L., and Margolius, H.S. (1983). Identification of tissue kallikrein in brain and in the cell-free translation product encoded by brain mRNA. J. Biol. Chem. 258, 15173–15178. Chao, J., Bledsoe, G., Yin, H., and Chao, L. (2006). The tissue kallikrein-kinin system protects against cardiovascular and renal diseases and ischemic stroke independently of blood pressure reduction. Biol. Chem. 387, 665–675. Chao, J., Shen, B., Gao, L., Xia, C.F., Bledsoe, G., and Chao, L. (2010). Tissue kallikrein in cardiovascular, cerebrovascular and renal diseases and skin wound healing. Biol. Chem. 391, 345–355. Chen, Z.L., Yoshida, S., Kato, K., Momota, Y., Suzuki, J., Tanaka, T., Ito, J., Nishino, H., Aimoto, S., Kiyama, H., and Shiosaka, S. (1995). Expression and activity-dependent changes of a novel limbic-serine protease gene in the hippocampus. J. Neurosci. 15, 5088–5097. Chen, Z.L., Momota, Y., Kato, K., Taniguchi, M., Inoue, N., Shiosaka, S., and Yoshida, S. (1998). Expression of neuropsin mRNA in the mouse embryo and the pregnant uterus. J. Histochem. Cytochem. 46, 313–320. Chiang, W.C., Chien, C.T., Lin, W.W., Lin, S.L., Chen, Y.M., Lai, C.F., Wu, K.D., Chao, J., and Tsai, T.J. (2006). Early activation of bradykinin B2 receptor aggravates reactive oxygen species

366

Isobel A. Scarisbrick

generation and renal damage in ischemia/reperfusion injury. Free Radic. Biol. Med. 41, 1304–1314. Christophi, G.P., Isackson, P.J., Blaber, S.I., Blaber, M., Rodriguez, M., and Scarisbrick, I.A. (2004). Distinct promoters regulate tissue-specific and differential expression of kallikrein 6 in CNS demyelinating disease. J. Neurochem. 91, 1439–1449. Clements, J., Hooper, J., Dong, Y., and Harvey, T. (2001). The expanded human kallikrein (KLK) gene family: genomic organisation, tissue-specific expression and potential functions. Biol. Chem. 382, 5–14. Couture, R., Harrisson, M., Vianna, R.M., and Cloutier, F. (2001). Kinin receptors in pain and inflammation. Eur. J. Pharmacol. 429, 161–176. Davies, B.J., Pickard, B.S., Steel, M., Morris, R.G., and Lathe, R. (1998). Serine proteases in rodent hippocampus. J. Biol. Chem. 273, 23004–23011. Davies, B.J., Kearns, I.R., Ure, J., Davies, C.H., and Lathe, R. (2001). Loss of hippocampal serine protease BSP1/neuropsin predisposes to global seizure activity. J. Neurosci. 21, 6993–7000. Deperthes, D., Frenette, G., Brillard-Bourdet, M., Bourgeois, L., Gauthier, F., Tremblay, R.R., and Dube, J.Y. (1996). Potential involvement of kallikrein hK2 in the hydrolysis of the human seminal vesicle proteins after ejaculation. J. Androl. 17, 659–665. Diamandis, E.P., Yousef, G.M., Petraki, C., and Soosaipillai, A.R. (2000). Human kallikrein 6 as a biomarker of alzheimer’s disease. Clin. Biochem. 33, 663–667. Diamandis, E.P., Scorilas, A., Kishi, T., Blennow, K., Luo, L.Y., Soosaipillai, A., Rademaker, A.W., and Sjogren, M. (2004). Altered kallikrein 7 and 10 concentrations in cerebrospinal fluid of patients with Alzheimer’s disease and frontotemporal dementia. Clin. Biochem. 37, 230–237. Ding-Zhou, L., Margaill, I., Palmier, B., Pruneau, D., Plotkine, M., and Marchand-Verrecchia, C. (2003). LF 16-0687 Ms, a bradykinin B2 receptor antagonist, reduces ischemic brain injury in a murine model of transient focal cerebral ischemia. Br. J. Pharmacol. 139, 1539–1547. Ding, D., Lu, C., DIng, M., Su, B., and Chen, H. (2007). A multicenter, randomized, double-blinded and placebo-controlled study of acute brain infarction treated by human urinary kallidinogenase. Clin. J. Neurol. 40, 306–310. Dityatev, A., Schachner, M., and Sonderegger, P. (2010). The dual role of the extracellular matrix in synaptic plasticity and homeostasis. Nat. Rev. Neurosci. 11, 735–746. Dos Santos, A.C., Roffe, E., Arantes, R.M., Juliano, L., Pesquero, J.L., Pesquero, J.B., Bader, M., Teixeira, M.M., and Carvalho-Tavares, J. (2008). Kinin B2 receptor regulates chemokines CCL2 and CCL5 expression and modulates leukocyte recruitment and pathology in experimental autoimmune encephalomyelitis (EAE) in mice. J. Neuroinflammation 5, 49. Festoff, B.W., D’Andrea, M.R., Citron, B.A., Salcedo, R.M., Smirnova, I.V., and Andrade-Gordon, P. (2000). Motor neuron cell death in wobbler mutant mice follows overexpression of the G-protein-coupled, protease-activated receptor for thrombin. Mol. Med. 6, 410–429. Ghosh, M.C., Grass, L., Soosaipillai, A., Sotiropoulou, G., and Diamandis, E.P. (2004). Human kallikrein 6 degrades extracellular matrix proteins and may enhance the metastatic potential of tumour cells. Tumour Biol. 25, 193–199. Gingrich, M.B., Junge, C.E., Lyuboslavsky, P., and Traynelis, S.F. (2000). Potentiation of NMDA receptor function by the serine protease thrombin. J. Neurosci. 20, 4582–4595. Gonzalez, H., Ottervald, J., Nilsson, K.C., Sjogren, N., Miliotis, T., Von Bahr, H., Khademi, M., Eriksson, B., Kjellstrom, S., Vegvari, A., Harris, R., Marko-Varga, G., Borg, K., Nilsson, J., Laurell, T., Olsson, T., and Franzén, B. (2009). Identification of novel candidate protein biomarkers for the post-polio syndrome – implications for diagnosis, neurodegeneration and neuroinflammation. J. Proteomics 71, 670–681. Groger, M., Lebesgue, D., Pruneau, D., Relton, J., Kim, S.W., Nussberger, J., and Plesnila, N. (2005). Release of bradykinin and expression of kinin B2 receptors in the brain: role for cell death and

Kallikrein-related Peptidases in the Central Nervous System

367

brain edema formation after focal cerebral ischemia in mice. J. Cereb. Blood Flow Metab. 25, 978–989. Hammill, A.K., Uhr, J.W., and Scheuermann, R.H. (1999). Annexin V staining due to loss of membrane asymmetry can be reversible and precede commitment to apoptotic death. Exp. Cell Res. 251, 16–21. Han, K.S., Mannaioni, G., Hamill, C.E., Lee, J., Junge, C.E., Lee, C.J., and Traynelis, S.F. (2011). Activation of protease activated receptor 1 increases the excitability of the dentate granule neurons of hippocampus. Mol. Brain 4, 32. Harvey, T.J., Hooper, J.D., Myers, S.A., Stephenson, S.A., Ashworth, L.K., and Clements, J.A. (2000). Tissue-specific expression patterns and fine mapping of the human kallikrein (KLK) locus on proximal 19q13.4. J. Biol. Chem. 275, 37397–37406. Hebb, A.L., Bhan, V., Wishart, A.D., Moore, C.S., and Robertson, G.S. (2011). Human kallikrein 6 cerebrospinal levels are elevated in multiple sclerosis. Curr. Drug Discov. Technol. 7, 137–140. Hecquet, C., Tan, F., Marcic, B.M., and Erdös, E.G. (2000). Human bradykinin B(2) receptor is activated by kallikrein and other serine proteases. Mol. Pharmacol. 58, 828–836. Hirata, A., Yoshida, S., Inoue, N., Matsumoto-Miyai, K., Ninomiya, A., Taniguchi, M., Matsuyama, T., Kato, K., Iizasa, H., Kataoka, Y., Yoshida, N., and Shiosaka, S. (2001). Abnormalities of synapses and neurons in the hippocampus of neuropsin-deficient mice. Mol. Cell. Neurosci. 17, 600–610. Houle, S., Papez, M.D., Ferazzini, M., Hollenberg, M.D., and Vergnolle, N. (2005). Neutrophils and the kallikrein-kinin system in proteinase-activated receptor 4-mediated inflammation in rodents. Br. J. Pharmacol. 146, 670–678. Ishikawa, Y., Horii, Y., Tamura, H., and Shiosaka, S. (2008). Neuropsin (KLK8)-dependent and -independent synaptic tagging in the Schaffer-collateral pathway of mouse hippocampus. J. Neurosci. 28, 843–849. Iwata, A., Maruyama, M., Akagi, T., Hashikawa, T., Kanazawa, I., Tsuji, S., and Nukina, N. (2003). Alpha-synuclein degradation by serine protease neurosin: implication for pathogenesis of synucleinopathies. Hum. Mol. Genet. 12, 2625–2635. Junge, C.E., Lee, C.J., Hubbard, K.B., Ahoabin, A., Olson, J.J., Hepler, J.R., Brat, D.J., and Traynelis, S.F. (2004). Protease-activated receptor-1 in human brain: localization and functional expression in astrocytes. Exp. Neurol. 1888, 94–103. Kasai, T., Tokuda, T., Yamaguchi, N., Watanabe, Y., Kametani, F., Nakagawa, M., and Mizuno, T. (2008). Cleavage of normal and pathological forms of alpha-synuclein by neurosin in vitro. Neurosci. Lett. 436, 52–56. Kishi, T., Kato, M., Shimizu, T., Kato, K., Matsumoto, K., Yoshida, S., Shiosaka, S., and Hakoshima, T. (1997). Crystallization and preliminary X-ray analysis of neuropsin, a serine protease expressed in the limbic system of mouse brain. J. Struct. Biol. 118, 248–251. Kishi, T., Kato, M., Shimizu, T., Kato, K., Matsumoto, K., Yoshida, S., Shiosaka, S., and Hakoshima, T. (1999). Crystal structure of neuropsin, a hippocampal protease involved in kindling epileptogenesis. J. Biol. Chem. 274, 4220–4224. Komai, S., Matsuyama, T., Matsumoto, K., Kato, K., Kobayashi, M., Imamura, K., Yoshida, S., Ugawa, S., and Shiosaka, S. (2000). Neuropsin regulates an early phase of schaffer-collateral long-term potentiation in the murine hippocampus. Eur. J. Neurosci. 12, 1479–1486. Komatsu, N., Saijoh, K., Otsuki, N., Kishi, T., Micheal, I.P., Obiezu, C.V., Borgoño, C.A., Takehara, K., Jayakumar, A., Wu, H.K., Clayman, G.L., and Diamandis, E.P. (2007). Proteolytic processing of human growth hormone by multiple tissue kallikreins and regulation by the serine protease inhibitor Kazal-Type 5 (SPINK5) protein. Clin. Chim. Acta 377, 228–236. Kwok, J.C., Dick, G., Wang, D., and Fawcett, J.W. (2011). Extracellular matrix and perineuronal nets in CNS repair. Dev. Neurobiol. 71, 1073–1089.

368

Isobel A. Scarisbrick

Lemos, M.T., Amaral, F.A., Dong, K.E., Bittencourt, M.F., Caetano, A.L., Pesquero, J.B., Viel, T.A., and Buck, H.S. (2011). Role of kinin B1 and B2 receptors in memory consolidation during the aging process of mice. Neuropeptides 44, 163–168. Li, Y., Qian, Y.P., Yu, X.J., Wang, Y.Q., Dong, D.G., Sun, W., Ma, R.M., and Su, B. (2004). Recent origin of a hominoid-specific splice form of neuropsin, a gene involved in learning and memory. Mol. Biol. Evol. 21, 2111–2115. Lilja, H. (1985). A kallikrein-like serine protease in prostatic fluid cleaves the predominant seminal vesicle protein. J. Clin. Invest. 76, 1899–1903. Little, S.P., Dixon, E.P., Norris, F., Buckley, W., Becker, G.W., Johnson, M., Dobbins, J.R., Wyrick, T., Miller, J.R., MacKellar, W., Hepburn, D., Corvalan, J., McClure, D. Liu, X., Stephenson, D., Clemens, J., and Johnstone, E.M. (1997). Zyme, a novel and potentially amyloidogenic enzyme cDNA isolated from Alzheimer’s disease brain. J. Biol. Chem. 272, 25135–25142. Liu, L., Zhang, R., Liu, K., Zhou, H., Yang, X., Liu, X., Tang, M., Su, J., and Dong, Q. (2009). Tissue kallikrein protects cortical neurons against in vitro ischemia-acidosis/reperfusion-induced injury through the ERK1/2 pathway. Exp. Neurol. 219, 453–465. Magklara, A., Scorilas, A., Katsaros, D., Massobrio, M., Yousef, G.M., Fracchioli, S., Danese, S., and Diamandis, E.P. (2001). The human KLK8 (neuropsin/ovasin) gene: identification of two novel splice variants and its prognostic value in ovarian cancer. Clin. Cancer Res. 7, 806–811. Magklara, A., Mellati, A.A., Wasney, G.A., Little, S.P., Sotiropoulou, G., Becker, G.W., and Diamandis, E.P. (2003). Characterization of the enzymatic activity of human kallikrein 6: Autoactivation, substrate specificity, and regulation by inhibitors. Biochem. Biophys. Res. Commun. 307, 948–955. Matsui, H., Kimura, A., Yamashiki, N., Moriyama, A., Kaya, M., Yoshida, I., Takagi, N., and Takahashi, T. (2000). Molecular and biochemical characterization of a serine proteinase predominantly expressed in the medulla oblongata and cerebellar white matter of mouse brain. J. Biol. Chem. 275, 11050–11057. Matsumoto-Miyai, K., Ninomiya, A., Yamasaki, H., Tamura, H., Nakamura, Y., and Shiosaka, S. (2003). NMDA-dependent proteolysis of presynaptic adhesion molecule L1 in the hippocampus by neuropsin. J. Neurosci. 23, 7727–7736. McLean, P.G., Perretti, M., and Ahluwalia, A. (2000). Kinin B(1) receptors and the cardiovascular system: regulation of expression and function. Cardiovasc. Res. 48, 194–210. Meier, N., Dear, T.N., and Boehm, T. (1999). A novel serine protease overexpressed in the hair follicles of nude mice. Biochem. Biophys. Res. Commun. 258, 374–378. Menashi, S., Fridman, R., Desrivieres, S., Lu, H., Legrand, Y., and Soria, C. (1994). Regulation of 92-kDa gelatinase B activity in the extracellular matrix by tissue kallikrein. Ann. NY Acad. Sci. 732, 466–468. Menendez-Gonzalez, M., Castro-Santos, P., Calatayud, M.T., Perez-Pinera, P., Ribacoba, R., MartinezRivera, M., Gutierrez, C., Lopez-Muniz, A., and Suarez, A. (2008). Plasmatic level of neurosin predicts outcome of mild cognitive impairment. Int. Arch. Med. 1, 11. Mitsui, S., Nakamura, T., Okui, A., Kominami, K., Uemura, H., and Yamaguchi, N. (2006). Multiple promoters regulate tissue-specific alternative splicing of the human kallikrein gene, KLK11/ hippostasin. FEBS J. 273, 3678–3686. Mitsui, S., Yamada, T., Okui, A., Kominami, K., Uemura, H., and Yamaguchi, N. (2000). A novel isoform of a kallikrein-like protease, TLSP/hippostasin, (PRSS20), is expressed in the human brain and prostate. Biochem. Biophys. Res. Commun. 272, 205–211. Mitsui, S., Okui, A., Uemura, H., Mizuno, T., Yamada, T., Yamamura, Y., and Yamaguchi, N. (2002). Decreased cerebrospinal fluid levels of neurosin (KLK6), an aging-related protease, as a possible new risk factor for Alzheimer’s disease. Ann. NY Acad. Sci. 977, 216–223.

Kallikrein-related Peptidases in the Central Nervous System

369

Momota, Y., Yoshida, S., Ito, J., Shibata, M., Kato, K., Sakurai, K., Matsumoto, K., and Shiosaka, S. (1998). Blockade of neuropsin, a serine protease, ameliorates kindling epilepsy. Eur. J. Neurosci. 10, 760–764. Nicole, O., Goldshmidt, A., Hamill, C.E., Sorensen, S.D., Sastre, A., Lyuboslavsky, P., Hepler, J.R., McKeon, R.J., and Traynelis, S.F. (2005). Activation of protease-activated receptor-1 triggers astrogliosis after brain injury. J. Neurosci. 25, 4319–4329. Noorbakhsh, F., Tsutsui, S., Vergnolle, N., Boven, L.A., Shariat, N., Vodjgani, M., Warren, K.G., Andrade-Gordon, P., Hollenberg, M.D., and Power, C. (2006). Proteinase-activated receptor 2 modulates neuroinflammation in experimental autoimmune encephalomyelitis and multiple sclerosis. J. Exp. Med. 203, 425–435. Ogawa, K., Yamada, T., Tsujioka, Y., Taguchi, J., Takahashi, M., Tsuboi, Y., Fujino, Y., Nakajima, M., Yamamoto, T., Akatsu, H., Mitsui, S., and Yamaguchi, N. (2000). Localization of a novel type trypsin-like serine protease, neurosin, in brain tissues of Alzheimer’s disease and Parkinson’s disease. Psychiatry Clin. Neurosci. 54, 419–426. Oikonomopoulou, K., Hansen, K.K., Saifeddine, M., Tea, I., Blaber, M., Blaber, S.I., Scarisbrick, I., Andrade-Gordon, P., Cottrell, G.S., Bunnett, N.W., Diamandis, E.P., and Hollenberg, M.D. (2006a). Proteinase-activated receptors, targets for kallikrein signaling. J. Biol. Chem. 281, 32095–32112. Oikonomopoulou, K., Hansen, K.K., Saifeddine, M., Vergnolle, N., Tea, I., Blaber, M., Blaber, S.I., Scarisbrick, I., Diamandis, E.P., and Hollenberg, M.D. (2006b). Kallikrein-mediated cell signalling: targeting proteinase-activated receptors (PARs). Biol. Chem. 387, 817–824. Oikonomopoulou, K., Diamandis, E.P., and Hollenberg, M.D. (2010). Kallikrein-related peptidases: proteolysis and signaling in cancer, the new frontier. Biol. Chem. 391, 299–310. Oka, T., Akisada, M., Okabe, A., Sakurai, K., Shiosaka, S., and Kato, K. (2002). Extracellular serine protease neuropsin (KLK8) modulates neurite outgrowth and fasciculation of mouse hippocampal neurons in culture. Neurosci. Lett. 321, 141–144. Oka, Y., Uchida, A., Aoyama, M., Fujita, M., Hotta, N., Tada, T., Katano, H., Mase, M., Asai, K., and Yamada, K. (2005). Expression of myelencephalon-specific protease after cryogenic lesioning of the rat parietal cortex. J. Neurotrauma 22, 501–510. Okabe, A., Momota, Y., Yoshida, S., Hirata, A., Ito, J., Nishino, H., and Shiosaka, S. (1996). Kindling induces neuropsin mRNA in the mouse brain. Brain Res. 728, 116–120. Perosa, S.R., Arganaraz, G.A., Goto, E.M., Costa, L.G., Konno, A.C., Varella, P.P., Santiago, J.F., Pesquero, J.B., Canzian, M., Amado, D., Yacubian, E.M., Carrete, H. Jr., Centeno, R.S., Cavalheiro, E.A., Silva, J.A. Jr., and Mazzacoratti, G. (2007). Kinin B1 and B2 receptors are overexpressed in the hippocampus of humans with temporal lobe epilepsy. Hippocampus 17, 26–33. Petraki, C.D., Karavana, V.N., Skoufogiannis, P.T., Little, S.P., Howarth, D.J., Yousef, G.M., and Diamandis, E.P. (2001). The spectrum of human kallikrein 6 (zyme/protease M/neurosin) expression in human tissues as assessed by immunohistochemistry. J. Histochem. Cytochem. 49, 1431–1441. Petraki, C.D., Karavana, V.N., Revelos, K.I., Luo, L.Y., and Diamandis, E.P. (2002). Immunohistochemical localization of human kallikreins 6 and 10 in pancreatic islets. Histochem. J. 34, 313–322. Prat, A., Weinrib, L., Becher, B., Poirier, J., Duquette, P., Couture, R., and Antel, J.P. (1999). Bradykinin B1 receptor expression and function on T lymphocytes in active multiple sclerosis. Neurology 53, 2087–2092. Prat, A., Biernacki, K., Pouly, S., Nalbantoglu, J., Couture, R., and Antel, J.P. (2000). Kinin B1 receptor expression and function on human brain endothelial cells. J. Neuropathol. Exp. Neurol. 59, 896–906.

370

Isobel A. Scarisbrick

Raidoo, D.M., and Bhoola, K.D. (1998). Pathophysiology of the kallikrein-kinin system in mammalian nervous tissue. Pharmacol. Ther. 79, 105–127. Regoli, D., Rhaleb, N.E., Drapeau, G., and Dion, S. (1990). Kinin receptor subtypes. J. Cardiovasc. Pharmacol. 15 (Suppl. 6), S30–38. Relton, J.K., Beckey, V.E., Hanson, W.L., and Whalley, E.T. (1997). CP-0597, a selective bradykinin B2 receptor antagonist, inhibits brain injury in a rat model of reversible middle cerebral artery occlusion. Stroke 28, 1430–1436. Rohatgi, T., Henrich-Noack, P., Sedehizade, F., Goertler, M., Wallesch, C.W., Reymann, K.G., and Reiser, G. (2004). Transient focal ischemia in rat brain differentially regulates mRNA expression of protease-activated receptors 1 to 4. J. Neurosci. Res. 75, 273–279. Scarisbrick, I.A., Towner, M.D., and Isackson, P.J. (1997). Nervous system specific expression of a novel serine protease: regulation in the adult rat spinal cord by excitotoxic injury. J. Neurosci. 17, 8156–8168. Scarisbrick, I.A., Asakura, K., Blaber, S., Blaber, M., Isackson, P.J., Beito, T., Rodriguez, M., and Windebank, A.J. (2000). Preferential expression of myelencephalon specific protease by oligodendrocytes of the adult rat spinal cord white matter. Glia 30, 219–230. Scarisbrick, I.A., Isackson, P.J., Ciric, B., Windebank, A.J., and Rodriguez, M. (2001). MSP, a trypsin-like serine protease, is abundantly expressed in the human nervous system. J. Comp. Neurol. 431, 347–361. Scarisbrick, I.A., Blaber, S.I., Lucchinetti, C.F., Genain, C.P., Blaber, M., and Rodriguez, M. (2002). Activity of a newly identified serine protease in CNS demyelination. Brain 125, 1283–1296. Scarisbrick, I.A., Blaber, S.I., Tingling, J.T., Rodriguez, M., Blaber, M., and Christophi, G.P. (2006a). Potential scope of action of tissue kallikreins in CNS immune-mediated disease. J. Neuroimmunology 178, 167–176. Scarisbrick, I.A., Sabharwal, P., Cruz, H., Larsen, N., Vandell, A., Blaber, S.I., Ameenuddin, S., Papke, L.M., Fehlings, M.G., Reeves, R.K., Blaber, M., Windebank, A.J., and Rodriguez, M. (2006b). Dynamic role of kallikrein 6 in traumatic spinal cord injury. Eur. J. Neurosci. 24, 1457–1469. Scarisbrick, I.A. (2008). The multiple sclerosis degradome: enzymatic cascades in development and progression of central nervous system inflammatory disease. Curr. Top. Microbiol. Immunol. 318, 133–175. Scarisbrick, I.A., Linbo, R., Vandell, A.G., Keegan, M., Blaber, S.I., Blaber, M., Sneve, D., Lucchinetti, C.F., Rodriguez, M., and Diamandis, E.P. (2008). Kallikreins are associated with secondary progressive multiple sclerosis and promote neurodegeneration. Biol. Chem. 389, 739–745. Scarisbrick, I.A., Epstein, B., Cloud, B.A., Yoon, H., Wu, J., Renner, D.N., Blaber, S.I., Blaber, M., Vandell, A.G., and Bryson, A.L. (2011). Functional role of kallikrein 6 in regulating immune cell survival. PLoS One 6, e18376; 18371–18311. Scarisbrick, I.A., Radulovic, M., Burda, J., Larson, N., Blaber, S.I., Giannini, C., Blaber, M., and Vandell, A.G. (2012a). Kallikrein 6 is a novel molecular trigger of reactive astrogliosis. Biol. Chem. 393, 355–367. Scarisbrick, I.A., Yoon, H., Panos, M., Larson, N., Blaber, S.I., Blaber, M., and Rodriguez, M. (2012b) Kallikrein 6 regulates early CNS demyelination in a viral model of multiple sclerosis. Brain Pathol. 22, 709–722. Schulze-Topphoff, U., Prat, A., Prozorovski, T., Siffrin, V., Paterka, M., Herz, J., Bendix, I., Ifergan, I., Schadock, I., Mori, M.A., van Horssen, J., Schröter, F., Smorodchenko, A., Han, M.H., Bader, M., Steinman, L., Aktas, O., and Zipp, F. (2009). Activation of kinin receptor B1 limits encephalitogenic T lymphocyte recruitment to the central nervous system. Nat. Med. 15, 788–793. Shaw, J.L., and Diamandis, E.P. (2007). Distribution of 15 human kallikreins in tissues and biological fluids. Clin. Chem. 53, 1423–1432.

Kallikrein-related Peptidases in the Central Nervous System

371

Shimizu-Okabe, C., Yousef, G.M., Diamandis, E.P., Yoshida, S., Shiosaka, S., and Fahnestock, M. (2001). Expression of the kallikrein gene family in normal and Alzheimer’s disease brain. Neuroreport 12, 2747–2751. Silva, J.A. Jr., Goto, E.M., Perosa, S.R., Arganaraz, G.A., Cavalheiro, E.A., Naffah-Mazzacoratti, M.G., and Pesquero, J.B. (2008). Kinin B1 receptors facilitate the development of temporal lobe epilepsy in mice. Int. Immunopharmacol. 8, 197–199. Simoes, P.S., Perosa, S.R., Arganaraz, G.A., Yacubian, E.M., Carrete, H. Jr., Centeno, R.S., Varella, P.P., Santiago, J.F., Canzian, M., Silva, J.A. Jr., Mortara, R.A., Amado, D., Cavalheiro, E.A., and Mazzacoratti, G. (2011). Kallikrein 1 is overexpressed by astrocytes in the hippocampus of patients with refractory temporal lobe epilepsy, associated with hippocampal sclerosis. Neurochem. Int. 58, 477–482. Sorensen, S.D., Nicole, O., Peavy, R.D., Montoya, L.M., Lee, C.J., Murphy, T.J., Traynelis, S.F., and Hepler, J.R. (2003). Common signaling pathways link activation of murine PAR-1, LPA, and S1P receptors to proliferation of astrocytes. Mol. Pharmacol. 64, 1199–1209. Stefansson, K., Brattsand, M., Roosterman, D., Kempkes, C., Bocheva, G., Steinhoff, M., and Egelrud, T. (2008). Activation of proteinase-activated receptor-2 by human kallikrein-related peptidases. J. Invest. Dermatol. 128, 18–25. Striggow, F., Riek, M., Breder, J., Henrich-Noack, P., Reymann, K.G., and Reiser, G. (2000). The protease thrombin is an endogenous mediator of hippocampal neuroprotection against ischemia at low concentrations but causes degeneration at high concentrations. Proc. Natl. Acad. Sci. USA 97, 2264–2269. Su, J., Cui, M., Tang, Y., Zhou, H., Liu, L., and Dong, Q. (2009). Blockade of bradykinin B2 receptor more effectively reduces postischemic blood-brain barrier disruption and cytokines release than B1 receptor inhibition. Biochem. Biophys. Res. Commun. 388, 205–211. Tamura, H., Ishikawa, Y., Hino, N., Maeda, M., Yoshida, S., Kaku, S., and Shiosaka, S. (2006). Neuropsin is essential for early processes of memory acquisition and Schaffer collateral long-term potentiation in adult mouse hippocampus in vivo. J. Physiol. 570, 541–551. Tatebe, H., Watanabe, Y., Kasai, T., Mizuno, T., Nakagawa, M., Tanaka, M., and Tokuda, T. (2010). Extracellular neurosin degrades alpha-synuclein in cultured cells. Neurosci. Res. 67, 341–346. Terayama, R., Bando, Y., Takahashi, T., and Yoshida, S. (2004). Differential expression of neuropsin and protease M/neurosin in oligodendrocytes after injury to the spinal cord. Glia 48, 91–101. Terayama, R., Bando, Y., Yamada, M., and Yoshida, S. (2005). Involvement of neuropsin in the pathogenesis of experimental autoimmune encephalomyelitis. Glia 52, 108–118. Terayama, R., Bando, Y., Murakami, K., Kato, K., Kishibe, M., and Yoshida, S. (2007). Neuropsin promotes oligodendrocyte death, demyelination and axonal degeneration after spinal cord injury. Neuroscience 148, 175–187. Tomizawa, K., He, X., Yamanaka, H., Shiosaka, S., and Yoshida, S. (1999). Injury induces neuropsin mRNA in the central nervous system. Brain Res. 824, 308–311. Turgeon, V.L., Lloyd, E.D., Wang, S., Festoff, B.W., and Houenou, L.J. (1998). Thrombin perturbs neurite outgrowth and induces apoptotic cell death in enriched chick spinal motoneuron cultures through caspase activation. J. Neurosci. 18, 6882–6891. Uchida, A., Oka, Y., Aoyama, M., Suzuki, S., Yokoi, T., Katano, H., Mase, M., Tada, T., Asai, K., and Yamada, K. (2004). Expression of myelencephalon-specific protease in transient middle cerebral artery occlusion model of rat brain. Brain Res. Mol. Brain Res. 126, 129–136. Vandell, A.G., Larson, N., Laxmikanthan, G., Panos, M., Blaber, S.I., Blaber, M., and Scarisbrick, I.A. (2008). Protease activated receptor dependent and independent signaling by kallikreins 1 and 6 in CNS neuron and astroglial cell lines. J. Neurochem. 107, 855–870.

372

Isobel A. Scarisbrick

Viel, T.A., Lima Caetano, A., Nasello, A.G., Lancelotti, C.L., Nunes, V.A., Araujo, M.S., and Buck, H.S. (2008). Increases of kinin B1 and B2 receptors binding sites after brain infusion of amyloid-beta 1–40 peptide in rats. Neurobiol. Aging 29, 1805–1814. Wagner, S., Kalb, P., Lukosava, M., Hilgenfeldt, U., and Schwaninger, M. (2002). Activation of the tissue kallikrein-kinin system in stroke. J. Neurol. Sci. 202, 75–76. Wahl, M., Whalley, E.T., Unterberg, A., Schilling, L., Parsons, A.A., Baethmann, A., and Young, A.R. (1996). Vasomotor and permeability effects of bradykinin in the cerebral microcirculation. Immunopharmacology 33, 257–263. Wang, H., Ubl, J.J., and Reiser, G. (2002). Four subtypes of protease-activated receptors, co-expressed in rat astrocytes, evoke different physiological signaling. Glia 37, 53–63. Wang, Y., Luo, W., and Reiser, G. (2007). Proteinase-activated receptor-1 and -2 induce the release of chemokine GRO/CINC-1 from rat astrocytes via differential activation of JNK isoforms, evoking multiple protective pathways in brain. Biochem. J. 401, 65–78. Xia, C.F., Yin, H., Borlongan, C.V., Chao, L., and Chao, J. (2004). Kallikrein gene transfer protects against ischemic stroke by promoting glial cell migration and inhibiting apoptosis. Hypertension 43, 452–459. Xia, C.F., Yin, H., Yao, Y.Y., Borlongan, C.V., Chao, L., and Chao, J. (2006). Kallikrein protects against ischemic stroke by inhibiting apoptosis and inflammation and promoting angiogenesis and neurogenesis. Hum. Gene Ther. 17, 206–219. Yamanaka, H., He, X., Matsumoto, K., Shiosaka, S., and Yoshida, S. (1999). Protease M/neurosin mRNA is expressed in mature oligodendrocytes. Brain Res. Mol. Brain Res. 71, 217–224. Yamashiro, K., Tsuruoka, N., Kodama, S., Tsujimoto, M., Yamamura, Y., Tanaka, T., Nakazato, H., and Yamaguchi, N. (1997). Molecular cloning of a novel trypsin-like serine protease (neurosin) preferentially expressed in brain. Biochim. Biophys. Acta 1350, 11–14. Yoon, H., Laxmikanthan, G., Lee, J., Blaber, S.I., Rodriguez, A., Kogot, J.M., Scarisbrick, I.A., and Blaber, M. (2007). Activation profiles and regulatory cascades of the human kallikrein-related peptidases. J. Biol. Chem. 282, 31852–31864. Yoon, H., Blaber, S.I., Evans, D.M., Trim, J., Juliano, M.A., Scarisbrick, I., and Blaber, M. (2008). Activation profiles of human kallikrein-related peptidases by proteases of the thrombostasis axis. Protein Sci. 17, 1998–2007. Yoon, H., Blaber, S.I., Debela, M., Goettig, P., Scarisbrick, I.A., and Blaber, M. (2009). A completed KLK activome profile: investigation of activation profiles of KLK9, 10, and 15. Biol. Chem. 390, 373–377. Yoshida, S., Taniguchi, M., Hirata, A., and Shiosaka, S. (1998a). Sequence analysis and expression of human neuropsin cDNA and gene. Gene 213, 9–16. Yoshida, S., Taniguchi, M., Suemoto, T., Oka, T., He, X., and Shiosaka, S. (1998b). cDNA cloning and expression of a novel serine protease, TLSP. Biochim. Biophys. Acta 1399, 225–228. Yousef, G.M., Chang, A., Scorilas, A., and Diamandis, E.P. (2000). Genomic organization of the human kallikrein gene family on chromosome 19q13.3-q13.4. Biochem. Biophys. Res. Commun. 276, 125–133. Zarghooni, M., Soosaipillai, A., Grass, L., Scorilas, A., Mirazimi, N., and Diamandis, E.P. (2002). Decreased concentration of human kallikrein 6 in brain extracts of Alzheimer’s disease patients. Clin. Biochem. 35, 225–231. Zausinger, S., Lumenta, D.B., Pruneau, D., Schmid-Elsaesser, R., Plesnila, N., and Baethmann, A. (2002). Effects of LF 16-0687 Ms, a bradykinin B(2) receptor antagonist, on brain edema formation and tissue damage in a rat model of temporary focal cerebral ischemia. Brain Res. 950, 268–278. Zweckberger, K., and Plesnila, N. (2009). Anatibant, a selective non-peptide bradykinin B2 receptor antagonist, reduces intracranial hypertension and histopathological damage after experimental traumatic brain injury. Neurosci. Lett. 454, 115–117.

Morley D. Hollenberg, John D. Hooper, Dalila Darmoul, and Katerina Oikonomopoulou

15 Kallikrein-related Peptidases (KLKs), Proteinase-mediated Signaling and Proteinase-activated Receptors (PARs) 15.1 Proteinases: shock troops of the innate immune response Proteolytic enzymes act as ‘shock troops’ which immediately mobilize our body’s ‘innate defense system’. This process includes activation of the clotting and complement cascades, stimulation of pain pathways, and the rapid recruitment of neutrophils to the site of the injury. These immediate responses generate all of the hallmark signs of inflammation: pain, redness, swelling, heat, and decreased function. So important are proteinases (commonly termed ‘proteases’), like the kallikrein-related peptidases (KLKs), for regulating body processes, that more than 2% of the human genome codes for either proteolytic enzymes or their inhibitors (Puente et al., 2005; Puente and Lopez-Otin, 2004). It was the discovery of hypotensive peptides in urine, which have contractile activity in uterine smooth muscle (Werle and Erdös, 1954), that helped crystallize the concept of proteinases generating inflammatory ‘kinin’ peptides from their precursors (summarized by Erdös, 2002). By the early 1970s, the mechanisms whereby proteinases can generate physiologically active peptides from polypeptide precursors were well established (e.g. conversion of pro-insulin to insulin: Steiner et al., 1967). However, what was not fully appreciated at the time was that the proteinases themselves, independent of their ability to produce active peptides, could also affect tissues directly to mimic the actions of peptide hormones. For example, in the mid-1960s, pepsin and chymotrypsin were shown to mimic the ability of insulin to promote glycogen formation in a rat diaphragm preparation (Rieser, 1967; Rieser and Rieser, 1964). This insulin-like action of proteinases was also observed in isolated fat cells, wherein trypsin, like insulin, can stimulate glucose oxidation and inhibit lipolysis (Kono and Barham, 1971). These actions of trypsin have been attributed to its ability to activate the insulin receptor via the tryptic cleavage of a regulatory domain of the extracellular receptor alpha-subunit (Shoelson et al., 1988). In terms of cell regulation, thrombin and trypsin have been shown, like insulin and epidermal growth factor (EGF), to stimulate mitogenesis in cultured cell systems, by acting at the cell surface (Burger, 1970; Carney and Cunningham, 1977; 1978; Chen and Buchanan, 1975; Sefton and Rubin, 1970). Given these pharmacological actions of proteinases, it was therefore reasonable to anticipate that the triggering of the inflammatory innate immune response by these enzymes might involve the activation of hormone-like signals in target tissues via ‘receptor’ mechanisms. Stimulated by this hypothesis, the search for the mechanism of action

374

Morley D. Hollenberg, John D. Hooper, Dalila Darmoul, and Katerina Oikonomopoulou

whereby thrombin activates platelets and stimulates fibroblast mitogenesis led to the discovery of the G-protein-coupled membrane receptor family responsible for many of the inflammation-related actions of proteinases (Adams et al., 2011; Coughlin, 2005; Ramachandran and Hollenberg, 2008). The proteinases that can participate in signaling, their biochemical mechanisms of catalysis, and their receptor-related mechanisms of action are summarized in the following sections, with a focus on the roles that the kallikrein-related peptidase (KLK) family can play in these processes. In part, progress in this field has been stimulated by a pharmacological approach to understanding the effects of proteinases on their target tissues. The aim of this chapter is to provide an overview of the multiple mechanisms whereby proteinases can affect tissue function and to illustrate the distinct roles that different members of the KLK family can play, in terms of their ability to signal to cells via proteinaseactivated receptors (termed: PARs). Furthermore, an overview will be provided to indicate how KLK signaling via the PARs can have an impact on inflammatory disease and cancer.

15.2 Multiple mechanisms for proteinase-mediated signaling Although PAR-mediated signaling (Fig. 15.1) represents one major way by which proteinases can affect cell function, it is important to take into account the many other possible ways proteolytic processes can generate cell signals, as outlined in Fig. 15.2. Thus, the cleavage of polypeptide precursors to generate active agonists, like insulin (Steiner et al., 1967) or the kinins (Silva et al., 1949), represents a major mechanism by which proteinases affect cell function. The proteinase-mediated release of membrane-tethered growth factor receptor activators (e.g. EGF, heparin-binding EGF or TGF-α) from the cell surface via G-protein-receptor induced metalloproteinase action is a novel extension of this ‘precursor-agonist’ mechanism (Fischer et al., 2003; Prenzel et al., 1999) (Fig. 15.2). This proteolytic precursor-product paradigm also relates to the generation of cytokines like interleukin-1-β upon activation of the inflammasome (van de Veerdonk et al., 2011). Often overlooked, proteinases can also signal via non-catalytic mechanisms, either due to non-catalytic interactions of the enzymes with other effector molecules or due to their content of sequences that on their own can have chemotactic or mitogenic actions (Fig. 15.2: (Bar-Shavit et al., 1984; 1991; Bar-Shavit and Wilner, 1986). Catalytically, as outlined in the previous section, proteinases can not only activate or disable growth factor receptors like the one for insulin (Cuatrecasas, 1969; 1971; Shoelson et al., 1988), but can also potentially disrupt the interactions between cell surface integrins and the extracellular matrix to affect ‘outside-in’ signaling. For the KLKs, although their ability to generate kinins from kininogen is well established, as is their ability to signal via the PARs (Adams et al., 2011), it is also likely that the KLK family can signal via the other mechanisms summarized in Fig. 15.2, in order to affect cell function.

Kallikrein-related Peptidases, Proteinase-mediated Signaling and PARs

potential sites of dis-arming or dis-abling

peptide activates trypsin or KLKs activate

GR

SLIGRL-NH2 SKGRSLIGRL

GRL SLI

LRGLI

C C

C C

SKGR

S

SK

activation

375

C

Gq, Gi

C

Gq, Gi

PAR2 response

PAR2 response

Fig. 15.1 Triggering and disarming proteinase-activated receptors (PARs). The scheme shows a representation of the 7-transmembrane PAR2 receptor, which can be triggered by the KLK-catalyzed proteolytic unmasking of its ‘Tethered Ligand’, SLIGRL… (Activation: middle panel). Alternatively, the receptor can be stimulated without the need for proteolysis by a ‘PAR-activating synthetic peptide’ that mimics the exposed ‘Tethered Ligand’ (e.g. SLIGRL-NH2: right-hand panel). Instead of activation, some proteinases can ‘disarm’ the receptor by proteolytic removal of the tethered ligand (blue arrow). The disarmed receptor can still respond to a PAR-activating peptide (right panel). Alternatively, cleavage of the extracellular loops ‘disables’ the receptor (red arrows, left panel), which then becomes non-functional. As outlined in the text, a ‘disarming’ cleavage by KLKs may possibly trigger ‘non-canonical’ ‘biased signaling’.

agonist generation /metabolism: pro-hormone; kininogen; fibrin processing; peptide agonist inactivation

extracellular matrix, integrins

membrane-tethered agonist release

proteinase

growth factor receptors activation/inactivation

non-catalytic domain interactions

PARs activation/inactivation: signal pathways in common with insulin, EGF and other growth factors

Fig. 15.2 Multiple mechanisms for proteinase-mediated cell signaling. The scheme shows six possible mechanisms whereby proteinases can signal to cells, ranging from agonist generation and metabolism to PAR activation and the release of membrane-tethered growth factor receptor agonists, as described in more detail in the text.

376

Morley D. Hollenberg, John D. Hooper, Dalila Darmoul, and Katerina Oikonomopoulou

15.3 Proteinases and PAR-mediated signaling PAR activation. As outlined in the previous paragraph, the hormone-like actions of proteinases, including the KLKs, can now be understood in part by their ability to signal to cells by cleaving and activating members of the PAR family (PARs 1 to 4) of G-protein-coupled receptors (Adams et al., 2011). The unique PAR-signaling mechanism involves the proteolytic unmasking of a cryptic N-terminal sequence that, remaining attached to the receptor, acts as a ‘tethered ligand’ (TL) binding intramolecularly to trigger cell responses (Fig. 15.1). Work with PAR1, the first receptor for thrombin to be cloned, identified a target serine proteinase cleavage site (arginine, R in Fig. 15.1) common to three of the PARs (PARs1, 2 and 4). Thus, thrombin cleaving (/) at the arginine (R) unmasks the tethered ligand sequences, R/SFLLRN… in human PAR1 and R/GYPGQV… in human PAR4. Although thrombin is not able to cleave the comparable arginine in PAR2, trypsin and KLK14 are able to unmask the PAR2 tethered ligand sequence R/SLIGKV… in human PAR2 (Oikonomopoulou et al., 2006a). Similarly, both trypsin and KLK14 are also able, like thrombin, to reveal the TL of human PAR4, GYPGQV…, so as to regulate platelet function (Oikonomopoulou et al., 2006a). However, in colon cancer-derived HT-29 cells, KLK14 preferentially disarms PAR1 (Gratio et al., 2011). PAR disarming and silencing. If, instead of unmasking the TL sequence of a PAR, a proteinase cleaves ‘downstream’, to release the TL from the N-terminal domain of a PAR, an activating proteinase like thrombin can no longer signal via its TL mechanism (Fig. 15.1). Thus, in a sense, proteinases like the KLKs can be considered as either agonists to reveal the TL sequences of the PARs or ‘antagonists’, due to their ability to ‘disarm’ the PARs. As an example, KLK14 is able to activate PARs 2 and 4, but can ‘disarm’ PAR1, to prevent thrombin signaling (Oikonomopoulou et al., 2006a). Non-canonical PAR-mediated activation by proteinases: biased signaling. The now ‘classical’, or ‘canonical’, mechanism whereby proteinases signal via the PARs involves the serine proteinase-mediated unmasking of a TL sequence that follows the target arginine (Fig. 15.1; Vu et al., 1991). However, some time after the seminal observations of Coughlin and coworkers, who established this process of PAR signaling (Vu et al., 1991), it became evident that cleavage of PARs at a site either upstream or C-terminal to the arginine that immediately precedes the TL sequence could also activate receptor signaling. Thus, a metalloproteinase, MMP-1, can cleave the N-terminal domain of PAR1 to unmask a novel MMP-1-revealed tethered ligand for PAR1, D/PRSFLL… , that can in turn trigger human platelet activation (Boire et al., 2005; Trivedi et al., 2009). The usual cleavage (/) target for PAR1 activation by thrombin is indicated by the bold underlined sequence: R/S. It is, however, not yet clear whether the PAR1 intracellular signaling networks activated by thrombin and MMP-1, which

Kallikrein-related Peptidases, Proteinase-mediated Signaling and PARs

377

unmask different receptor-activating sequences (e.g. PRSFLL… versus SFLLRN…), are identical. For PAR2, our work has shown that signaling via an exposed TL can differ, depending on its precise sequence (al-Ani et al., 2004; Ramachandran et al., 2009). Thus, for calcium signaling, a PAR2-revealed sequence SLAAAA can suffice for activating calcium signaling, but another revealed sequence AAIGRL cannot. Yet, the unmasked TL sequence AAIGRL can trigger PAR2-mediated ERK/2/MAPKinase (MAPK) signaling (Ramachandran et al., 2009). These data reveal the ability of TL sequences to cause what can be termed ‘functional selectivity’, or ‘biased’ signaling, by PAR2 (Kenakin and Miller, 2010). Thus, by assuming a selected conformation, PAR2 can interact differentially with its ‘effectors’ (e.g. Gq vs. Gi vs. β-arrestin), so as to stimulate distinct signaling pathways in a cell. We have extended these observations to show that the neutrophil serine proteinase, elastase, but neither cathepsin G nor proteinase 3, can cause PAR2 to activate MAPK signaling pathways selectively, without activating calcium signaling (Ramachandran et al., 2011). Interestingly, rather than cleaving PAR2 at the ‘canonical’ activation site, elastase ‘disarms’ PAR2, to prevent

thrombin/ trypsin/ KLKs PAR1/2/4

TGF-a EGF-R

Gq

b -ARR 앖Ca++, DAG

MMPs membrane bound TGF-a

P-Y-

-Y-P

Src 앖kinases

MEK ERK 1/2-P gene transcription cell proliferation

Fig. 15.3 Multiple mechanisms of PAR signaling and trans-activation of the EGF receptor. The scheme illustrates several PAR signal transduction pathways: (1) via a G-protein mechanism, involving the Gq-triggered activation of phospholipase Cβ, with the release of the kinase-stimulating second messengers, calcium and diacyl-glycerol (DAG), (2) the G-protein-independent β-arrestindependent formation of a signaling scaffold that enables MAPKinase and Src activation – Src activation can in turn trans-activate the EGF receptor, and (3) the stimulation of membrane-associated metalloproteinase (MMP) that cleaves and releases transforming growth factor-α from the cell surface, so as to trans-activate the EGF receptor (EGF-R). The trans-phosphorylated (Y-P) EGF receptor dimer activates growth factor signaling pathways downstream, including ERK1/2/MAPKinase (ERK 1/2-P).

378

Morley D. Hollenberg, John D. Hooper, Dalila Darmoul, and Katerina Oikonomopoulou

further signaling by trypsin or other proteinases that might reveal the ‘classical’ tethered ligand. This action of elastase thus stimulates complex, ‘biased’ signaling via PAR2, that will have a distinct impact on tissue function compared with activation by trypsin-like enzymes. The mechanism of this ‘non-canonical’ mechanism by which elastase causes this signaling (e.g. by unmasking an ‘alternate’ PAR2 tethered ligand) has not yet been determined. However, this observation raises the possibility for ‘biased signaling’ by other proteinases, such as the KLKs. In that regard, the KLKs (e.g. KLK5 vs. KLK6 vs. KLK14) each have distinct impacts on the PARs, cleaving at different sites (Oikonomopoulou et al., 2006a) and may therefore be able to cause ‘biased’ PAR signaling. Thus, via this ‘biased signaling’ mechanism, the different KLKs may in principle play different roles in terms of regulating tissue function via the PARs. For instance, as outlined in Fig. 15.3, PAR signaling pathways are diverse, including (1) Gq-triggered activation of phospholipase Cβ (generation of increased intracellular calcium and diacyl-glycerol second messengers), (2) creation of an internalized signal scaffold, enabling the activation of Src and MAPKinase (Defea, 2000; 2008) and (3) trans-activation of the EGF receptor, either directly via Src, or indirectly by the metalloproteinase (MMP)-catalyzed release of an EGF receptor-activating ligand (e.g. TGF-α, heparin-binding EGF or amphiregulin). The ability of the different KLKs to act as ‘biased agonists’, in order to stimulate one of these PAR signaling pathways directly, as does elastase (Ramachandran et al., 2011), has not yet been explored at any depth.

15.4 Linking PARs to the KLKs: the prostate connection A key observation that kindled our interest in the ability of KLKs to regulate PAR function came from the cloning of human PAR2 (Bohm et al., 1996). In the Northern blots of human tissues hybridized with a human PAR2 probe reported in that manuscript, the PAR2 signal from prostate tissue had almost the same intensity as that from the small intestine, which in the mouse also yielded a strong Northern blot signal (Nystedt et al., 1994). Our awareness of the production of KLKs by both human and rodent prostate led us to hypothesize that the co-localization of candidate activating proteinases, along with PAR2, pointed to a potential role for KLKs in activating PARs. Our early data supporting this hypothesis was presented at the First International Symposium on Kallikreins and Kallikrein-Related Peptidases, held in Lausanne in 2005 (Oikonomopoulou et al., 2006b and c). The subsequent, more in-depth, study (Oikonomopoulou et al., 2006a) consolidated these preliminary findings, pointing to the distinct PAR-regulating actions of the different KLKs, as mentioned above. Thus, the stage had been set to consider the PARs and the KLKs as ‘partners’ in the regulation of tissue function in key sites like the prostate, and the skin and its sensory nerves. Given the wide impact that the KLKs can have on a variety of physiological processes, resulting from their distinct catalytic activities (Goettig et al., 2010), the

Kallikrein-related Peptidases, Proteinase-mediated Signaling and PARs

379

challenge is to distinguish the effects of the KLKs that can be attributed to PAR signaling from other signaling mechanisms whereby the KLKs and other proteinases can affect tissue function (Fig. 15.2).

15.5 Proteolytic cascades, KLKs and the innate immune response An important question that arose early on in our work was what the role of a receptor system might be, that is essentially silent until activated by a proteinase of the clotting cascade. The hypothesis we put forward in order to deal with this question was that the PARs form an essential part of the ‘innate immune response’ system that, like the Toll-like Receptor family, is designed to respond rapidly to tissue damage or stress, including the invasion of pathogenic organisms. The very interesting interrelationship between PAR2 and TLR signaling strongly reinforces the concept that the PARs represent an integral component of the body’s rapid innate immune response mechanism (Nhu et al., 2010; Rallabhandi et al., 2008). But, in contrast with the TLR recognition process that is driven by the interaction between TLRs and their cognate ligands, the PAR response, like coagulation itself, is targeted by a proteolytic cascade that can greatly amplify the initial stimulus. This ‘cascade’ mechanism provides for a highly sensitive ‘detection’ system. Thus, the coagulation cascade represents a crucial point of entry for PAR-mediated signaling. We now suggest that crosstalk of coagulation enzymes with other proteolytic cascades, like those of the complement (Oikonomopoulou et al., 2012) and the KLK system (Blaber et al., 2010), can similarly play an amplification role to activate PAR signaling. In particular, the cross-relationship between the MASP-1 complement proteinase and endothelium-dependent PAR4 signaling supports this hypothesis (Megyeri et al., 2009). This kind of ‘proteolytic cascade’-driven PAR signaling is likely to play a role not only in the inflammatory response, but also in the setting of tumorigenesis, as outlined in the following sections.

15.6 KLKs, other serine proteinases, PARs and inflammation Generating inflammatory mediators via cleavage of agonist precursors. Amongst the members of the KLK family, kallikrein-related peptidase-1 (KLK1, formerly known as ‘tissue kallikrein’) has an established role in mediating the release of inflammatory kinin peptides from their kininogen precursor. In turn, kinins act as agonists of the bradykinin B1/B2 G-protein-coupled receptors and have several pathophysiological effects, including the regulation of blood pressure and inflammatory responses (Bhoola et al., 1992; Roberts and Gullick, 1989). While a role for kinin generation and subsequent B1/B2 receptor activation has been widely accepted for KLK1, several in vitro studies have shown that all members of the KLK family can target substrates such

380

Morley D. Hollenberg, John D. Hooper, Dalila Darmoul, and Katerina Oikonomopoulou

as peptide hormone precursors, extracellular matrix components or other proteinase zymogens (Borgoño et al., 2004; Borgoño and Diamandis, 2004). More recently, the repertoire of KLK substrates has grown to include proteinase-activated receptors, which mediate KLK signaling in the settings of both inflammation and tumorigenesis (Oikonomopoulou et al., 2010). In some instances, activation of a PAR (e.g. PAR4) can occur in concert with stimulation of kinin B2 receptors (Houle et al., 2005). Distinct PAR-mediated signaling via different KLKs. Although all of the KLKs can affect cell signaling by either activating or disarming PARs, each of the KLKs appears to affect PARs in a unique way in keeping with their distinct catalytic activities (Goettig et al., 2010). For instance, using a pharmacological approach, we and others have shown that KLKs 5, 6, and 14 can trigger signals via the activation of human and rodent PAR2 (Oikonomopoulou et al., 2006a and c; Stefansson et al., 2008). These KLKs were able to trigger PAR2-dependent increases in intracellular calcium and endothelium-derived vascular relaxation. Further, in addition to activating PARs 2 and 4, KLK14 disarms/inhibits subsequent PAR1 activation by thrombin (Oikonomopoulou et al., 2006a). In contrast, KLK1 can signal via PAR1 (Gao et al., 2010a and b), but is unable to signal via PAR2 (Molino et al., 1997a and b). Differing from these KLKs, KLK4 shows its own distinct PAR activation profile, stimulating signaling via PAR1 and PAR2, but not PAR4, in prostate cancer cells (Ramsay et al., 2008a). However, in colon cancer-derived cells, KLK4 stimulates Ca2+ signaling via PAR1, but not PAR2 (Gratio et al., 2010). These differences in signaling by an individual KLK may result from differential expression of the individual PARs in a given tumor tissue. In support of a comparable cell-specific action of KLKs, it has also been shown that KLK6 can cause signals in cultured neurons via PAR1, whereas in astrocytes KLK6 can act via either PAR1 or PAR2 (Vandell et al., 2008). Thus, the different KLKs acting on distinct PARs in different tissues may play quite different physiological roles. In particular, these KLK/PAR signaling mechanisms can be seen to contribute both to inflammation and to tumorigenesis, as summarized in the following sections.

15.7 KLKs, PARs and inflammation of the central nervous system and the skin It has now been established that the PARs can play a prominent role in a variety of inflammatory conditions, including arthritis, colitis and asthma (Adams et al., 2011; Ramachandran and Hollenberg, 2008). However, the proteinases responsible for activating PARs in these settings are largely unknown. We suggest that the KLKs can play this PAR-activating role at many sites, including the central nervous system and peripheral tissues such as the limbs and the skin. Subsequent to demonstrating the ability of KLKs to signal via the PARs in cells and tissues ex vivo, we have shown that KLK14, similar to trypsin (Vergnolle et al., 1999), is able to trigger

Kallikrein-related Peptidases, Proteinase-mediated Signaling and PARs

381

subcutaneous murine paw edema, an effect which can be attributed in part to PAR activation [(Oikonomopoulou et al., 2007) and Oikonomopoulou et al., unpublished]. The central nervous system also is a site where PARs can function physiologically in both normal and pathological conditions. Given the data demonstrating a role for PAR2 and PAR1 in the setting of inflammation of the central nervous system (Boven et al., 2003; Noorbakhsh et al., 2003; 2006), it was of considerable interest to us that high levels of KLK6 (formerly termed myelencephalon-specific protease or MSP) can be detected in infiltrating mononuclear cells, such as T cells and macrophages, at the sites of CNS demyelination in multiple sclerosis lesions (Scarisbrick et al., 2002; 2006). Furthermore, elevated serum levels of KLKs 1 and 6 are associated with higher disability scores in multiple sclerosis patients (Scarisbrick et al., 2008). Combining all these data, it was found that KLK6 can trigger PAR1 neuronal and astrocytic signals, as well as PAR2 astrocytic responses (Vandell et al., 2008). Moreover, the ability of KLK6 to promote the survival of murine splenocytes via PAR1 activation (Scarisbrick et al., 2011) adds weight to the hypothesis that KLKs, via PAR activation, can play an important role in CNS inflammatory-neurodegenerative diseases, including multiple sclerosis. The skin, as well as the CNS, represents a likely site wherein the KLK-PAR axis plays a prominent inflammatory role. In keeping with the localization of KLKs in multiple sclerosis lesions, the expression of multiple members of the KLK family (in particular, KLKs 5, 6, 7, 8, and 13) has been documented in normal skin, with an up-regulation observed for KLKs 6, 8, and 13 in tissues from individuals with atopic dermatitis or psoriasis vulgaris (Komatsu et al., 2005; 2006; 2007). Importantly, signaling by KLK5 via PAR2 has been implicated in the pathobiology of Netherton syndrome, an inherited disease caused by the absence of a functional KLK5 Kazal-type LEKTI proteinase inhibitor (Briot et al., 2009; Chavanas et al., 2000). In that situation, the regulation of PARs by the unopposed action of KLK5, along with other mechanisms whereby KLK5 may signal (Fig. 15.2), can account for a number of the pathological findings in this inherited disease. However, in a murine model of Netherton’s disease, wherein both the proteinase inhibitor and PAR2 are genetically deleted, the production of the inflammatory pro-Th2 cytokine (TSLP) was indeed markedly diminished (Briot et al., 2010), but tissue inflammation was still present. The results with the knockout mice suggest a role for KLK action via PARs other than PAR2, or via other proteolytic mechanisms that trigger the inflammatory response (Fig. 15.2). The concurrent expression of KLK14 and PAR2 in inflamed rosacea tissues has also been demonstrated, leading the authors to suggest a role for the KLK14-PAR2 axis in the pathogenesis of this skin disorder (Stefansson et al., 2008). Unlike KLKs 5 and 14, KLK7, which is also expressed in skin, appears unable to signal via PAR2 (Oikonomopoulou et al., 2006a and c; Stefansson et al., 2008). Thus, in summary, for inflammatory disorders of the skin, as well as inflammation in the central nervous system, both the KLKs and the PARs may be considered as promising therapeutic targets.

382

Morley D. Hollenberg, John D. Hooper, Dalila Darmoul, and Katerina Oikonomopoulou

15.8 KLKs, PARs and cancer Although KLKs are widely recognized as very useful biomarkers for cancer diagnosis and prognosis (Borgoño et al., 2004; Borgoño and Diamandis, 2004; Loeb and Catalona, 2007), their functional role in the tumorigenic process has yet to be clearly established. In contrast with the KLKs, a general oncogenic and metastatic role has for some time now been accepted for other proteinases, including matrix metalloproteinases (MMPs) and serine proteinases, such as thrombin and trypsin (Camerer, 2007; Lopez-Otin and Matrisian, 2007). In particular, the MMPs, which can play roles in either promoting or protecting against tumorigenesis, have been considered as therapeutic targets for cancer chemotherapy (Martin and Matrisian, 2007). As already mentioned, the mitogenic actions of trypsin and thrombin have been known for over 40 years (Burger, 1970; Sefton and Rubin, 1970). In particular, the mitogenic coagulation proteinase, thrombin, along with its platelet and endothelial cell PAR targets, have been singled out for attention in terms of tumor cell growth, metastasis, and tissue invasion (Karpatkin et al., 1981; Nierodzik and Karpatkin, 2006). Landmark work in terms of understanding the mechanisms whereby thrombin can promote tumor cell invasion via PAR1 has come from the Bar-Shavit laboratory, where the essential role of PAR1 in triggering the invasive process has been documented (EvenRam et al., 1998; 2001). Since then, work from the same laboratory has consolidated a novel role for PAR1 activation, in terms of promoting epithelial cell malignancies (BarShavit et al., 2011). However, as of yet, little consideration has been given to identify the potential proteinase activators of PAR1 specifically in the setting of a tumor, apart from tissue-derived trypsins (Nyberg et al., 2006; Soreide et al., 2006) and members of the coagulation cascade pathway (e.g. thrombin, Factor VIIa/Xa, Activated Protein C) (Rickles, 2006; Zwicker et al., 2007). In this regard, it is intriguing to note that the same androgen-induced up-regulation of KLK3/PSA, well known in the kallikreinrelated peptidase field, is paralleled by an androgen-induced up-regulation of prostatic PAR1 via an upstream androgen response element in the PAR1 gene (Salah et al., 2005). This coordinate up-regulation by androgens of both PAR1 and its possible activating KLK proteinases suggests an intimate link between KLK-regulated PAR function and cancer progression, pointing to a paracrine/autocrine PAR-KLK connection in the prostate for signaling in the setting of cancer. Indeed, the up-regulation of PARs in colon and prostate cancer has been well documented (Black et al., 2007; Darmoul et al., 2001; 2003; Gratio et al., 2009; Kaushal et al., 2006; Ramsay et al., 2008a and b), with an intriguing co-localization of KLK4, along with PAR2, not only in the prostate per se, but also at the site of prostate cancer bone metastasis (Ramsay et al., 2008a). In prostate cancer-derived cells, KLK4 is able to activate both PAR 1 and 2 (but not PAR4), whereas KLK2 appears to be selective for PAR2 activation (Mize et al., 2008; Ramsay et al., 2008a). In a tumor microenvironment, KLK4 may signal not only to PAR1 on the cancer cells, but also via PAR1 on the neighboring stromal cells, so as to stimulate the release of cytokines that can

Kallikrein-related Peptidases, Proteinase-mediated Signaling and PARs

383

further affect tumor cell behavior (Wang et al., 2010). Similarly, in melanomas, the keratinocytes and stromal cells located adjacent to the tumor cells have been found to produce KLK6, which can act in a paracrine fashion via PAR1 to enhance the malignant process (Krenzer et al., 2011). An autocrine-paracrine role for KLKs acting via the PARs may be particularly important in colon cancer. Not only are both KLK4 and KLK14 ectopically expressed in colon cancer cells, but these KLKs can regulate colon cancer cells by activating both PAR 1 and 2, so as to elevate intracellular calcium and stimulate both MAPKinase and cell proliferation (Gratio et al., 2010; 2011). As in a number of situations, the activation of the PARs may in turn trans-activate the EGF receptor by the metalloproteinase-mediated process already mentioned earlier (Fig. 15.2). Thus, there could be a ‘double hit’ by proteinases to stimulate colon cancer cells: first from the direct signaling of KLKs via the PAR signal pathways, and second from the concurrent ‘trans-activation’ of EGF receptor signaling pathways. Thus, the KLKs could trigger PAR-signaling pathways involving elevated intracellular calcium and activation of MAPKinases. Simultaneously, the PAR signal can cause a Srcmediated EGF receptor trans-activation, combined with a metalloproteinase triggered release of membrane-tethered EGF receptor ligands that in turn activate the EGF receptor (e.g. EGF itself, heparin-binding EGF, TGF-α, or amphiregulin). The ‘dual signaling’ including both PAR and EGF signal pathways can have a magnified impact on cancer cell function (Fig. 15.3; Darmoul et al., 2003; 2004a and b). In HT-29 cells, a human colon-cancer-derived cell line, KLK4 appears to activate PAR1 preferentially, whereas KLK14 primarily targets PAR2. What is striking in the colonic carcinoma tissue is the marked production of the KLKs by the dysplastic or neoplastic colon cancer cells at a site of tumor development, with minimal or no expression of KLK14 either in nearby cancer-free tissue in the same pathological sample, or by normal tissue from cancer-free healthy subjects (Gratio et al., 2011). Furthermore, it has been shown that antibodies targeting the cleavage-activation sites of PARs 1 and 2 are able to block KLK-mediated activation of cells via either PAR1 or PAR2 (Gratio et al., 2010; 2011). Thus, both the PARs and their activating proteinases, including the KLKs, can be considered as therapeutic targets for cancer, as is further discussed in the following sections.

15.9 KLKs and PARs: Therapeutic targets for inflammatory diseases, cancer and other disorders As summarized above, and elaborated upon briefly in following sections, PAR activation regulates a number of cellular responses that play a role in a variety of disease settings. To target the PARs for therapeutic purposes, substantial work has been done to block PAR activation. In principle, either targeting the activating proteinases, such as the KLKs, or developing PAR receptor antagonists could prove to be of equal thera-

384

Morley D. Hollenberg, John D. Hooper, Dalila Darmoul, and Katerina Oikonomopoulou

peutic use. As summarized below, the most promising progress has, however, been made in developing antagonists of PARs 1 and 2, whereas developing small molecule proteinase-selective inhibitors that block proteinase-mediated PAR activation has yet to yield reagents of value for clinical use. Several of the PAR1 receptor antagonists have yielded promising data in preclinical studies for a number of agents that are currently being evaluated in humans. Direct antagonism of PAR signaling. Numerous studies have now appeared indicating that PARs can be involved in inflammatory disorders, including those of the airways (Jenkins et al., 2006; Moraes et al., 2008; 2009; Vogel et al., 2000), skin (Briot et al., 2009; Cevikbas et al., 2011; Stefansson et al., 2008), joints (Busso et al., 2007; Ferrell et al., 2003; Kelso et al., 2006; Yang et al., 2005), and gastrointestinal tract (al-Ani et al., 1995; Cenac et al., 2004; Chin et al., 2003; Kawabata et al., 2001; 2008; Zheng et al., 1998), as well as in diseases of the cardiovascular (al-Ani et al., 1995; Hamilton et al., 2001a and b; Hamilton et al., 2002) and nervous systems (Greenwood and Bushell, 2010; Guo et al., 2004; Jin et al., 2005; Vaughan et al., 1995). Furthermore, a role for the PARs is envisioned in acute systemic infections that lead to sepsis (Kaneider et al., 2007; Pawlinski and Mackman, 2004). As already outlined, the upregulation of both PARs and their KLK-activating proteinases may be of particular significance for tumor development, metastasis, invasion and growth. Thus, selective and potent PAR antagonists could be of great value for treatment of disease. PAR1 small molecule antagonists. Even before the cloning of the PAR1 thrombin receptor, synthetic peptide analogues of low potency were able to block the action of thrombin on platelets, without inhibiting its proteolytic activity and its essential coagulation properties (Ruda et al., 1988; 1990). However, the cloning of PAR1 that could be used as a high-throughput therapeutic screening target has led to the synthesis of more potent small-molecule non-peptide PAR antagonists, as well as to a novel set of peptide-based, G-protein-coupled receptor antagonists, termed ‘pepducins’. The pepducins are N-palmitoylated peptides that contain sequences of about 7 to 18 amino acids derived from the first and third intracellular loop domains of G-proteincoupled receptors (GPCRs). These palmitoylated peptides are taken up by cells to act as ‘dominant-negative’ antagonists which block the interactions between the PARs or other GPCRs and their signal-transducing G-proteins (Tressel et al., 2011). Both the non-peptide small-molecule PAR1 inhibitors and the pepducins have proved to be of use as PAR antagonists in vivo in animal model systems, but have not as yet proved of value in the clinic. The first peptidomimetic low-molecular-weight PAR1 antagonists of sufficient potency and selectivity for clinical consideration were developed by Andrade-Gordon and colleagues at the Pharmaceutical Research and Development site of Johnson & Johnson. For example, the PAR1 antagonists RWJ-56110 and RWJ-58259 inhibit thrombin-induced platelet aggregation with IC50 values of 0.34 μM and 0.37 μM respec-

Kallikrein-related Peptidases, Proteinase-mediated Signaling and PARs

385

tively (Andrade-Gordon et al., 1999; 2001; Maryanoff et al., 2003; Zhang et al., 2001). Although some of these RWJ-designated PAR1 antagonists exhibited a number of unwanted side-effects (e.g. hypotension), RWJ-58259 was relatively side-effect-free and proved to have antirestenotic activity in vivo in a rat balloon angioplasty model (Andrade-Gordon et al., 2001) and antithrombotic activity in a cynomolgus monkey arterial injury model (Derian et al., 2003). Despite these attractive features, the RWJ compounds, originally designed for the treatment of cardiovascular disease, have yet to find a place in the clinic. Other groups have also developed PAR1 antagonists. A potent PAR1 antagonist ER129614-06, which has the advantage of being orally bioavailable, efficiently blocks platelet aggregation and is antithrombotic in a guinea pig model (Kawahara et al., 2004), but has yet to be evaluated in humans. Interestingly, two other recently reported compounds, F16357 and F16618, are less potent PAR1 antagonists (IC50 of 10 μM against receptor activation by the peptide SFLLR-NH2 in vitro), but have potent antithrombotic effects in a rat shunt model in vivo, very possibly because of off-target effects against non-PAR GPCRs (Blakeney et al., 2007; Perez et al., 2009). An additional potent and selective PAR1 antagonist and anti-platelet agent developed by the Schering group, SCH530348, although showing initial promise in trials for coronary artery disease (Chackalamannil et al., 2008), was recently withdrawn from clinical development (Gurbel et al., 2011). Another compound in clinical development, E5555, inhibits platelet function through antagonism of PAR1, while also interfering with mechanisms involving PECAM-I, GP IIb/IIIa, PAC-1, thrombospondin, and the formation of platelet-monocyte aggregates (Cirino and Severino, 2010; Goto et al., 2010; Serebruany et al., 2009). In summary, the PAR1 antagonist compounds developed to date have shown promise in both cell-based assays in vitro, and in animal models of vascular disease in vivo. However, in human clinical studies, their success in mitigating cardiovascular thrombotic disease due to their ability to block thrombin-mediated platelet activation has been disappointing. Nevertheless, the studies we have summarized in this chapter that link PAR1 activation to tumor growth, metastasis, and invasion suggest that these PAR1 antagonists may have an alternate therapeutic utility for cancer and inflammatory disease. One may suggest that the evaluation of the impact of the PAR1 antagonists on tumor growth and metastasis models merits an effort. Antagonists of PARs 2 and 4. In contrast with the successful development of a number of PAR1-targeted antagonists, the development of small-molecule peptidomimetic antagonists for PARs 2 and 4 has proved problematic. For example, a PAR2 antagonist that was able to attenuate arthritis in an in vivo rodent model (N1-3-methylbutyryl-N4-6-aminohexanoyl-piperazine: ENMD-1068) was of too low potency for clinical use and did not lead to the development of a therapeutic agent (Kelso et al., 2006). In a similar vein, the PAR1/PAR2-derived peptides, FSLLRY-NH2 and LSIGRLNH2, are able to block trypsin, but do not block PAR-activating peptide stimulation of PAR2. However, these peptides, while of use for in vitro studies, are not at all suit-

386

Morley D. Hollenberg, John D. Hooper, Dalila Darmoul, and Katerina Oikonomopoulou

able for clinical use. More recently, the novel compound GB88, derived from a peptidomimetic PAR2 agonist, GB110, at low concentrations, has been reported to inhibit PAR2 activation by proteinases (e.g. trypsin), by synthetic PAR2-activating peptides (e.g. 2f-LIGRLO-NH2) and by nonpeptide agonists (Barry et al., 2010; Suen et al., 2012). Interestingly, GB88 is a pathway-specific or ‘biased’ antagonist, inhibiting PAR2induced intracellular Ca2+ release, cAMP elevation, receptor internalization, and proinflammatory cytokine release, without affecting PAR2-mediated ERK1/2/MAPKinase phosphorylation/activation (Suen et al., 2012). Whether this promising PAR2 antagonist will lead to compounds for use in a clinical setting remains to be seen. That said, GB88 merits evaluation in a colon tumor model where KLK-mediated activation of PAR2 may play a role. The PAR4 antagonist, trans-cinnamoyl-YPGKF-NH2 (tc-YGPKF), derived from the PAR4 tethered ligand sequence, blocks rodent platelet aggregation induced by activating peptides and thrombin (Hollenberg and Saifeddine, 2001). Its use in vivo has yet to be evaluated in any depth. The low-molecular-weight PAR4 antagonist, YD-3, also inhibits thrombin-stimulated platelet aggregation in mice, where platelets are regulated by PAR4 alone. However, in human platelets, which express PAR1 as well as PAR4, YD-3 blocks aggregation induced by a PAR4 agonist peptide but not by thrombin (Wu et al., 2000; 2002). Pepducins: versatile peptide-based antagonists for PARs and other GPCRs. As mentioned above, palmitoylated peptide antagonists (pepducins), that act as ‘dominant negative’ reagents by mimicking the intracellular loop domain sequences of PARs 1, 2 and 4, are novel GPCR antagonists that can block the activation of PARs 1, 2 and 4 both in vitro and in vivo. The PAR1 pepducin, P1pal-12 (pal-RCLSSSAVANRS-NH2), with an IC50 of 1 μM against the PAR1-activating peptide, SFLLRN, is a potent, selective inhibitor of thrombin-mediated PAR1 activation, that unlike other pepducins, does not function as a partial agonist (Covic et al., 2002a and b). Inhibition of PAR1 with P1pal-12 protects against sepsis lethality, lung vascular damage and disseminated intravascular coagulation (Kaneider et al., 2007). Another PAR1 pepducin, P1pal-7 (pal-KKSRALF-NH2), blocks matrix metalloproteinase-1-induced receptor activation of the Akt survival pathway in breast cancer cells, resulting in apoptosis in tumor xenografts, and largely abolishing metastasis to the lungs (Yang et al., 2009). Furthermore, PAR1-targeted pepducins are also able to block cell migration, MAPKinase activation, and the growth of human lung-derived cancer cells (Cisowski et al., 2011). The potential anti-tumor action of these PAR1 pepducins reinforces the idea that blocking PAR1 can prove of therapeutic benefit in cancer treatment. Very recently a PAR2 pepducin, P2pal-18S (pal-RSSAMDENSEKKRKSAIK), has been described that completely blocks trypsin and mast cell tryptase induced signaling via PAR2 in both neutrophils and colon cancer cells, and efficiently antagonizes PAR2-dependent paw edema and neutrophil infiltration in an in vivo mouse paw inflammation model (Sevigny et al., 2011). While the PAR4 pepducin, P4pal10 (pal-

Kallikrein-related Peptidases, Proteinase-mediated Signaling and PARs

387

SGRRYGHALR-NH2), efficiently antagonises platelet aggregation to prolong bleeding times in mice, it also inhibits PAR1, possibly due to similarities between the intracellular loop 3 region of human PAR1 and PAR4 (Covic et al., 2002b). The PAR2 and PAR4 pepducins have yet to be further evaluated, but may well have an impact on KLKtriggered PAR2/4 activation in in vivo models of cancer and inflammatory disease.

15.10 Blocking proteinase-mediated PAR activation: PAR-targeted blocking antibodies versus proteinase inhibitors Two strategies, apart from the use of direct receptor-selective PAR antagonists, can successfully block PAR activation: (1) targeting the tethered ligand sequence with an antibody or (2) using small-molecule proteinase inhibitors, to block the enzymatic unmasking of the tethered ligand. Both of these approaches have succeeded in attenuating inflammation in a murine arthritis model (Kelso et al., 2006), and each approach has its strengths and weaknesses. PAR-targeted antibody ‘antagonists’. As indicated in Fig. 15.1, an antibody that targets the cleavage-activation sequence of a PAR can block access of a proteinase to the ‘tethered ligand’ sequence and may therefore act as an ‘antagonist’ for enzymetriggered PAR activation. Not only can an antibody, developed against the rat PAR2 tethered ligand sequence, 30GPNSKGRSLIGRLDT45P, block trypsin-mediated PAR2 activation in vitro (the so-called B5 anti-PAR2 antiserum recognizes rat, murine and human PAR2; al-Ani et al., 1999), but the polyclonal B5 rabbit antiserum, as well as a murine monoclonal PAR2-targeted antibody (SAM-11), was able to diminish PAR2associated joint inflammation when administered in vivo (Kelso et al., 2006). A comparable PAR1-targeted antibody, as well as an anti-human-PAR2 monoclonal antibody, can also block either KLK4-triggered activation of PAR1 or KLK14-stimulated activation of PAR2 in vitro (Gratio et al., 2010; 2011). Thus, in principle, such PAR-targeted monoclonal antibody ‘antagonists’ could have an impact not only on inflammatory disease but also on cancer progression in the setting of tumor-derived KLK-mediated PAR activation. The PAR-targeted monoclonals might prove of therapeutic value in humans, as have other monoclonals for treatment of inflammatory diseases (e.g. antiTNF-α antibodies used for the treatment of ulcerative colitis, or humanized anti-EGF receptor monoclonals (trastuzumab) for the treatment of EGF receptor-overexpressing mammary tumors). The drawbacks of such therapeutic monoclonal antibody reagents, including the expense of production and the necessity of parenteral administration, are well appreciated. Such PAR monoclonal antibody antagonists would be clinically attractive only if orally available potent and selective receptor antagonists could not be developed. Furthermore, the antibodies that prevent cleavage/activation of the tethered ligand would NOT be able to block receptor activation via a ‘noncanonical’ proteolytic activation mechanism, which is described above for elastase

388

Morley D. Hollenberg, John D. Hooper, Dalila Darmoul, and Katerina Oikonomopoulou

activation of PAR2 signaling, since elastase cleavage occurs at a site downstream from the tethered ligand sequence (Ramachandran et al., 2011). Proteinase inhibitors. As reviewed elsewhere (Goettig et al., 2010), closely related proteinases like the KLK family members can have distinct substrate and inhibitor profiles, even if they share a common catalytic mechanism, e.g. an active serine in the catalytic cleft. Thus, it is possible in principle to develop proteinase-selective inhibitors. However, although a number of high-potency small-molecule serine proteinase inhibitors have been found to block KLK enzyme activity, they display quite limited selectivity (a) for other members of the KLK family and (b) for other serine proteinases. Furthermore, some of the enzyme-selective inhibitors exhibit cell toxicity, which would preclude their therapeutic use. Thus, the development of small-molecule inhibitors that selectively block PAR activation by a specific KLK or by another proteinase is very challenging. That said, work on the development of selective thrombin-targeted inhibitors has been quite rewarding, very likely because of the use of the leech-derived antagonist, hirudin, as a template for inhibitor development. The drawback here, however, lies in the multifunctional properties of thrombin itself, which not only acts as an activator of PARs 1 and 4, but also as a well-recognized coagulation factor. Thus, blocking thrombin does indeed attenuate PAR1/4 activation, but also opens the liability of a bleeding diathesis. Here too, proteinase inhibition, even with highly specific hirudin-derived or heparin-derived thrombin inhibitors, has considerable drawbacks. Nonetheless, given the prominent role of thrombin-triggered tumor cell growth, metastasis and invasion via PAR1 and the impact of thrombin-mediated platelet activation on tumor metastasis, a role for thrombin inhibitors as adjuncts to cancer chemotherapy appears attractive. However, that strategy would not have an impact on KLK-mediated activation of the PARs either on human platelets or on other cancer- or inflammation-related cell targets. Similarly, the development of specific KLK-targeted inhibitors, even if based on a naturally occurring structure, like the Kazal-type LEKTI proteinase inhibitor, or on the novel sunflower-derived trypsin inhibitor (SFTI-1; Swedberg et al., 2009), would not block PAR activation by thrombin, MMP-1, or by other serine proteinases. That said, the very promising KLK4-selective inhibitor derived from the sunflower inhibitor structure is able to block PAR2 signaling in vitro, and may well prove of use as a probe to evaluate KLK4 function in vivo (Swedberg et al., 2009). In a similar vein, selective inhibitors of KLK2 and KLK4 have been developed, based on α1-antichymotrypsin as a scaffold (Cloutier et al., 2004; Felber et al., 2006). These inhibitors may as well prove of value in singling out the roles of KLKs 2 and 4 in vivo. Apart from these KLK-selective inhibitors, it may be suggested that the use of non-selective, broad-spectrum, KLK-targeted inhibitors may be of considerable value in certain clinical settings. For instance, the successful use of zinc salt paste as a therapeutic modality for abrasive skin ulcers in a hospital setting may depend on the KLK-selective, but broad, non-specific, inhibitory action of zinc on many KLKs. Thus, on balance, the development of targeted small molecule proteinase

Kallikrein-related Peptidases, Proteinase-mediated Signaling and PARs

389

inhibitors as a strategy to minimize PAR activation appears less attractive than does the use of PAR-targeted monoclonal antibody antagonists. Nevertheless, the KLKselective inhibitors currently being developed will be of considerable value to help elucidate the potential physiological roles of KLKs in vivo.

15.11 Summary and outlook for the future To sum up, it can be said that proteolytic enzymes in general, including those that have been specifically dealt with in this overview, including the KLKs, represent nature’s most versatile regulators of physiological function, causing their effects by multiple mechanisms, as outlined in Fig. 15.2. The ability of proteinases to trigger and terminate cell signals, not only by processing and metabolizing agonists generated from polypeptide precursors, but also by regulating cell surface receptors, adds a unique dimension to the many roles that proteinases can play in cell regulation. Although originally discovered during the search for the ‘thrombin receptor’, the PARs can now be seen as generalized targets for proteinase regulation that are integrally linked to the body’s innate immune defense system. In this regard, the recent discovery that the KLKs can signal by either activating or silencing PARs provides a new perspective on understanding the mechanisms whereby these enzymes, known to date primarily for their utility as tumor biomarkers, can regulate tissue function in inflammatory diseases and cancer. Thus, the KLKs can be added to the coagulation and complement systems as a signal-amplification proteolytic cascade, involved in host innate-immune-defense and inflammatory processes. Clearly, an understanding of the signaling processes that the KLKs can initiate both via the PARs and via other mechanisms provides an infrastructure for the development of new therapeutic modalities for cancer and inflammatory diseases.

Acknowledgements The work in the authors’ laboratories which has provided information relevant to this chapter has been supported by grants from the Canadian Institutes of Health Research (MDH), The Heart & Stroke Foundation of Alberta, NWT & Nunavut (MDH), the Lung Association of Alberta and Northwest Territories (MDH), the Association pour la recherche sur le cancer (contract: No. 3937: DD), the Institut National de la Santé et de la Recherch Médicale (INSERM: DD), by the National Health and Medical Research Council of Australia (Fellowship 339732 to JDH), and by a National Science and Engineering Council of Canada (NSERC) post-doctoral fellowship (KO).

390

Morley D. Hollenberg, John D. Hooper, Dalila Darmoul, and Katerina Oikonomopoulou

Bibliography Adams, M.N., Ramachandran, R., Yau, M.K., Suen, J.Y., Fairlie, D.P., Hollenberg, M.D., and Hooper, J.D. (2011). Structure, function and pathophysiology of protease activated receptors. Pharmacol. Ther. 130, 248–282. al-Ani, B., Saifeddine, M., and Hollenberg, M.D. (1995). Detection of functional receptors for the proteinase-activated-receptor-2-activating polypeptide, SLIGRL-NH2, in rat vascular and gastric smooth muscle. Can. J. Physiol Pharmacol. 73, 1203–1207. al-Ani, B., Saifeddine, M., Kawabata, A., Renaux, B., Mokashi, S., and Hollenberg, M.D. (1999). Proteinase-activated receptor 2 (PAR(2)): development of a ligand-binding assay correlating with activation of PAR(2) by PAR(1)- and PAR(2)-derived peptide ligands. J. Pharmacol. Exp. Ther. 290, 753–760. al-Ani, B., Hansen, K.K., and Hollenberg, M.D. (2004). Proteinase-activated receptor-2: key role of amino-terminal dipeptide residues of the tethered ligand for receptor activation. Mol. Pharmacol. 65, 149–156. Andrade-Gordon, P., Maryanoff, B.E., Derian, C.K., Zhang, H.C., Addo, M.F., Darrow, A.L., Eckardt, A.J., Hoekstra, W.J., McComsey, D.F., Oksenberg, D., Reynolds, E.E., Santulli, R.J., Scarborough, R.M., Smith, C.E., and White, K.B. (1999). Design, synthesis, and biological characterization of a peptide-mimetic antagonist for a tethered-ligand receptor. Proc. Natl. Acad. Sci. USA 96, 12257–12262. Andrade-Gordon, P., Derian, C.K., Maryanoff, B.E., Zhang, H.C., Addo, M.F., Cheung, W., Damiano, B.P., D’Andrea, M.R., Darrow, A.L., de Garavilla, L., Eckardt, A.J., Giardino, E.C., Haertlein, B.J., and McComsey, D.F. (2001). Administration of a potent antagonist of protease-activated receptor-1 (PAR-1) attenuates vascular restenosis following balloon angioplasty in rats. J. Pharmacol. Exp. Ther. 298, 34–42. Bar-Shavit, R., Kahn, A., Mudd, M.S., Wilner, G.D., Mann, K.G., and Fenton, J.W. (1984). Localization of a chemotactic domain in human thrombin. Biochemistry 23, 397–400. Bar-Shavit, R., and Wilner, G.D. (1986). Biologic activities of nonenzymatic thrombin: elucidation of a macrophage interactive domain. Semin. Thromb. Hemost. 12, 244–249. Bar-Shavit, R., Sabbah, V., Lampugnani, M.G., Marchisio, P.C., Fenton, J.W., Vlodavsky, I., and Dejana, E. (1991). An Arg-Gly-Asp sequence within thrombin promotes endothelial cell adhesion. J. Cell Biol. 112, 335–344. Bar-Shavit, R., Turm, H., Salah, Z., Maoz, M., Cohen, I., Weiss, E., Uziely, B., and Grisaru-Granovsky, S. (2011). PAR1 plays a role in epithelial malignancies: transcriptional regulation and novel signaling pathway. IUBMB Life 63, 397–402. Barry, G.D., Suen, J.Y., Le, G.T., Cotterell, A., Reid, R.C., and Fairlie, D.P. (2010). Novel agonists and antagonists for human protease activated receptor 2. J. Med. Chem. 53, 7428–7440. Bhoola, K.D., Figueroa, C.D., and Worthy, K. (1992). Bioregulation of kinins: kallikreins, kininogens, and kininases. Pharmacol. Rev. 44, 1–80. Blaber, M., Yoon, H., Juliano, M.A., Scarisbrick, I.A., and Blaber, S.I. (2010). Functional intersection of the kallikrein-related peptidases (KLKs) and thrombostasis axis. Biol. Chem. 391, 311–320. Black, P.C., Mize, G.J., Karlin, P., Greenberg, D.L., Hawley, S.J., True, L.D., Vessella, R.L., and Takayama, T.K. (2007). Overexpression of protease-activated receptors-1,-2, and-4 (PAR-1, -2, and -4) in prostate cancer. Prostate 67, 743–756. Blakeney, J.S., Reid, R.C., Le, G.T., and Fairlie, D.P. (2007). Nonpeptidic ligands for peptide-activated G protein-coupled receptors. Chem. Rev. 107, 2960–3041. Bohm, S.K., Kong, W., Bromme, D., Smeekens, S.P., Anderson, D.C., Connolly, A., Kahn, M., Nelken, N.A., Coughlin, S.R., Payan, D.G., and Bunnett, N.W. (1996). Molecular cloning, expression and potential functions of the human proteinase-activated receptor-2. Biochem. J. 314, 1009–1016.

Kallikrein-related Peptidases, Proteinase-mediated Signaling and PARs

391

Boire, A., Covic, L., Agarwal, A., Jacques, S., Sherifi, S., and Kuliopulos, A. (2005). PAR1 is a matrix metalloprotease-1 receptor that promotes invasion and tumorigenesis of breast cancer cells. Cell 120, 303–313. Borgoño, C.A., and Diamandis, E.P. (2004). The emerging roles of human tissue kallikreins in cancer. Nat. Rev. Cancer 4, 876–890. Borgoño, C.A., Michael, I.P., and Diamandis, E.P. (2004). Human tissue kallikreins: physiologic roles and applications in cancer. Mol. Cancer Res. 2, 257–280. Boven, L.A., Vergnolle, N., Henry, S.D., Silva, C., Imai, Y., Holden, J., Warren, K., Hollenberg, M.D., and Power, C. (2003). Up-regulation of proteinase-activated receptor 1 expression in astrocytes during HIV encephalitis. J. Immunol. 170, 2638–2646. Briot, A., Deraison, C., Lacroix, M., Bonnart, C., Robin, A., Besson, C., Dubus, P., and Hovnanian, A. (2009). Kallikrein 5 induces atopic dermatitis-like lesions through PAR2-mediated thymic stromal lymphopoietin expression in Netherton syndrome. J. Exp. Med. 206, 1135–1147. Briot, A., Lacroix, M., Robin, A., Steinhoff, M., Deraison, C., and Hovnanian, A. (2010). Par2 inactivation inhibits early production of TSLP, but not cutaneous inflammation, in Netherton syndrome adult mouse model. J. Invest Dermatol. 130, 2736–2742. Burger, M.M. (1970). Proteolytic enzymes initiating cell division and escape from contact inhibition of growth. Nature 227, 170–171. Busso, N., Frasnelli, M., Feifel, R., Cenni, B., Steinhoff, M., Hamilton, J., and So, A. (2007). Evaluation of protease-activated receptor 2 in murine models of arthritis. Arthritis Rheum. 56, 101–107. Camerer, E. (2007). Protease signaling in tumor progression. Thromb. Res 120 (Suppl 2), S75-S81. Carney, D.H., and Cunningham, D.D. (1977). Initiation of check cell division by trypsin action at the cell surface. Nature 268, 602–606. Carney, D.H., and Cunningham, D.D. (1978). Transmembrane action of thrombin initiates chick cell division. J. Supramol. Struct. 9, 337–350. Cenac, N., Chin, A.C., Garcia-Villar, R., Salvador-Cartier, C., Ferrier, L., Vergnolle, N., Buret, A.G., Fioramonti, J., and Bueno, L. (2004). PAR2 activation alters colonic paracellular permeability in mice via IFN-gamma-dependent and -independent pathways. J. Physiol. 558, 913–925. Cevikbas, F., Seeliger, S., Fastrich, M., Hinte, H., Metze, D., Kempkes, C., Homey, B., and Steinhoff, M. (2011). Role of protease-activated receptors in human skin fibrosis and scleroderma. Exp. Dermatol. 20, 69–71. Chackalamannil, S., Wang, Y., Greenlee, W.J., Hu, Z., Xia, Y., Ahn, H.S., Boykow, G., Hsieh, Y., Palamanda, J., Gans-Fantuzzi, J., Kurowski, S., Graziano, M., and Chintala, M. (2008). Discovery of a novel, orally active himbacine-based thrombin receptor antagonist (SCH 530348) with potent antiplatelet activity. J. Med. Chem. 51, 3061–3064. Chavanas, S., Bodemer, C., Rochat, A., Hamel-Teillac, D., Ali, M., Irvine, A. D., Bonafe, J.L., Wilkinson, J., Taieb, A., Barrandon, Y., Harper, J.I., de Prost Y., and Hovnanian, A. (2000). Mutations in SPINK5, encoding a serine protease inhibitor, cause Netherton syndrome. Nat. Genet. 25, 141–142. Chen, L.B., and Buchanan, J.M. (1975). Mitogenic activity of blood components. I. Thrombin and prothrombin. Proc. Natl. Acad. Sci. USA 72, 131–135. Chin, A.C., Vergnolle, N., MacNaughton, W.K., Wallace, J L., Hollenberg, M.D., and Buret, A.G. (2003). Proteinase-activated receptor 1 activation induces epithelial apoptosis and increases intestinal permeability. Proc. Natl. Acad. Sci. USA 100, 11104–11109. Cirino, G., and Severino, B. (2010). Thrombin receptors and their antagonists: an update on the patent literature. Expert. Opin. Ther. Pat. 20, 875–884. Cisowski, J., O’Callaghan, K., Kuliopulos, A., Yang, J., Nguyen, N., Deng, Q., Yang, E., Fogel, M., Tressel, S., Foley, C., Agarwal, A., Hunt, S.W. III, McMurry, T., Brinckerhoff, L., and Covic, L. (2011). Targeting protease-activated receptor-1 with cell-penetrating pepducins in lung cancer. Am. J. Pathol. 179, 513–523.

392

Morley D. Hollenberg, John D. Hooper, Dalila Darmoul, and Katerina Oikonomopoulou

Cloutier, S.M., Kundig, C., Felber, L.M., Fattah, O.M., Chagas, J.R., Gygi, C.M., Jichlinski, P., Leisinger, H.J., and Deperthes, D. (2004). Development of recombinant inhibitors specific to human kallikrein 2 using phage-display selected substrates. Eur. J. Biochem. 271, 607–613. Coughlin, S.R. (2005). Protease-activated receptors in hemostasis, thrombosis and vascular biology. J. Thromb. Haemost. 3, 1800–1814. Covic, L., Gresser, A.L., Talavera, J., Swift, S., and Kuliopulos, A. (2002a). Activation and inhibition of G protein-coupled receptors by cell-penetrating membrane-tethered peptides. Proc. Natl. Acad. Sci. USA 99, 643–648. Covic, L., Misra, M., Badar, J., Singh, C., and Kuliopulos, A. (2002b). Pepducin-based intervention of thrombin-receptor signaling and systemic platelet activation. Nat. Med. 8, 1161–1165. Cuatrecasas, P. (1969). Interaction of insulin with the cell membrane: the primary action of insulin. Proc. Natl. Acad. Sci. USA 63, 450–457. Cuatrecasas, P. (1971). Properties of the insulin receptor of isolated fat cell membranes. J. Biol. Chem. 246, 7265–7274. Darmoul, D., Marie, J.C., Devaud, H., Gratio, V., and Laburthe, M. (2001). Initiation of human colon cancer cell proliferation by trypsin acting at protease-activated receptor-2. Br. J. Cancer 85, 772–779. Darmoul, D., Gratio, V., Devaud, H., Lehy, T., and Laburthe, M. (2003). Aberrant expression and activation of the thrombin receptor protease-activated receptor-1 induces cell proliferation and motility in human colon cancer cells. Am. J. Pathol. 162, 1503–1513. Darmoul, D., Gratio, V., Devaud, H., and Laburthe, M. (2004a). Protease-activated receptor 2 in colon cancer: trypsin-induced MAPK phosphorylation and cell proliferation are mediated by epidermal growth factor receptor transactivation. J. Biol. Chem. 279, 20927–20934. Darmoul, D., Gratio, V., Devaud, H., Peiretti, F., and Laburthe, M. (2004b). Activation of proteinaseactivated receptor 1 promotes human colon cancer cell proliferation through epidermal growth factor receptor transactivation. Mol. Cancer Res. 2, 514–522. DeFea, K.A., Zalevsky, J., Thoma, M.S., Dery, O., Mullins, R.D., and Bunnett, N.W. (2000). beta-arrestin-dependent endocytosis of proteinase-activated receptor 2 is required for intracellular targeting of activated ERK1/2. J. Cell Biol. 148, 1267–1281. Defea, K. (2008). Beta-arrestins and heterotrimeric G-proteins: collaborators and competitors in signal transduction. Br. J. Pharmacol. 153 (Suppl 1), S298-S309. Derian, C.K., Damiano, B.P., Addo, M.F., Darrow, A.L., D’Andrea, M.R., Nedelman, M., Zhang, H.C., Maryanoff, B.E., and Andrade-Gordon, P. (2003). Blockade of the thrombin receptor proteaseactivated receptor-1 with a small-molecule antagonist prevents thrombus formation and vascular occlusion in nonhuman primates. J. Pharmacol. Exp. Ther. 304, 855–861. Erdös, E.G. (2002). Kinins, the long march – A personal view. Cardiovascular Research 54, 485–491. Even-Ram, S., Uziely, B., Cohen, P., Grisaru-Granovsky, S., Maoz, M., Ginzburg, Y., Reich, R., Vlodavsky, I., and Bar-Shavit, R. (1998). Thrombin receptor overexpression in malignant and physiological invasion processes. Nat. Med. 4, 909–914. Even-Ram, S.C., Maoz, M., Pokroy, E., Reich, R., Katz, B.Z., Gutwein, P., Altevogt, P., and Bar-Shavit, R. (2001). Tumor cell invasion is promoted by activation of protease activated receptor-1 in cooperation with the alpha vbeta 5 integrin. J. Biol. Chem. 276, 10952–10962. Felber, L.M., Kundig, C., Borgoño, C.A., Chagas, J.R., Tasinato, A., Jichlinski, P., Gygi, C. M., Leisinger, H.J., Diamandis, E.P., Deperthes, D., and Cloutier, S.M. (2006). Mutant recombinant serpins as highly specific inhibitors of human kallikrein 14. FEBS J. 273, 2505–2514. Ferrell, W.R., Lockhart, J.C., Kelso, E.B., Dunning, L., Plevin, R., Meek, S.E., Smith, A.J., Hunter, G.D., McLean, J.S., McGarry, F., Ramage, R., Jiang, L., Kanke, T., and Kawagoe, J. (2003). Essential role for proteinase-activated receptor-2 in arthritis. J. Clin. Invest 111, 35–41.

Kallikrein-related Peptidases, Proteinase-mediated Signaling and PARs

393

Fischer, O.M., Hart, S., Gschwind, A., and Ullrich, A. (2003). EGFR signal transactivation in cancer cells. Biochem. Soc. Trans. 31, 1203–1208. Gao, L., Chao, L., and Chao, J. (2010a). A novel signaling pathway of tissue kallikrein in promoting keratinocyte migration: activation of proteinase-activated receptor 1 and epidermal growth factor receptor. Exp. Cell Res. 316, 376–389. Gao, L., Smith, R.S., Chen, L.M., Chai, K.X., Chao, L., and Chao, J. (2010b). Tissue kallikrein promotes prostate cancer cell migration and invasion via a protease-activated receptor-1-dependent signaling pathway. Biol. Chem. 391, 803–812. Goettig, P., Magdolen, V., and Brandstetter, H. (2010). Natural and synthetic inhibitors of kallikreinrelated peptidases (KLKs). Biochimie 92, 1546–1567. Goto, S., Yamaguchi, T., Ikeda, Y., Kato, K., Yamaguchi, H., and Jensen, P. (2010). Safety and exploratory efficacy of the novel thrombin receptor (PAR-1) antagonist SCH530348 for non-STsegment elevation acute coronary syndrome. J. Atheroscler. Thromb. 17, 156–164. Gratio, V., Walker, F., Lehy, T., Laburthe, M., and Darmoul, D. (2009). Aberrant expression of proteinase-activated receptor 4 promotes colon cancer cell proliferation through a persistent signaling that involves Src and ErbB-2 kinase. Int. J. Cancer 124, 1517–1525. Gratio, V., Beaufort, N., Seiz, L., Maier, J., Virca, G.D., Debela, M., Grebenchtchikov, N., Magdolen, V., and Darmoul, D. (2010). Kallikrein-related peptidase 4: a new activator of the aberrantly expressed protease-activated receptor 1 in colon cancer cells. Am. J. Pathol. 176, 1452–1461. Gratio, V., Loriot, C., Virca, G.D., Oikonomopoulou, K., Walker, F., Diamandis, E.P., Hollenberg, M.D., and Darmoul, D. (2011). Kallikrein-related peptidase 14 acts on proteinase-activated receptor 2 to induce signaling pathway in colon cancer cells. Am. J. Pathol. 179, 2625–2636. Greenwood, S.M., and Bushell, T.J. (2010). Astrocytic activation and an inhibition of MAP kinases are required for proteinase-activated receptor-2-mediated protection from neurotoxicity. J. Neurochem. 113, 1471–1480. Guo, H., Liu, D., Gelbard, H., Cheng, T., Insalaco, R., Fernandez, J.A., Griffin, J.H., and Zlokovic, B.V. (2004). Activated protein C prevents neuronal apoptosis via protease activated receptors 1 and 3. Neuron 41, 563–572. Gurbel, P.A., Jeong, Y.H., and Tantry, U.S. (2011). Vorapaxar: a novel protease-activated receptor-1 inhibitor. Expert Opin. Investig. Drugs 20, 1445–1453. Hamilton, J.R., Frauman, A.G., and Cocks, T.M. (2001a). Increased expression of protease-activated receptor-2 (PAR2) and PAR4 in human coronary artery by inflammatory stimuli unveils endothelium-dependent relaxations to PAR2 and PAR4 agonists. Circ. Res 89, 92–98. Hamilton, J.R., Moffatt, J.D., Frauman, A.G., and Cocks, T.M. (2001b). Protease-activated receptor (PAR) 1 but not PAR2 or PAR4 mediates endothelium-dependent relaxation to thrombin and trypsin in human pulmonary arteries. J. Cardiovasc. Pharmacol. 38, 108–119. Hamilton, J.R., Moffatt, J.D., Tatoulis, J., and Cocks, T.M. (2002). Enzymatic activation of endothelial protease-activated receptors is dependent on artery diameter in human and porcine isolated coronary arteries. Br. J. Pharmacol. 136, 492–501. Hollenberg, M.D., and Saifeddine, M. (2001). Proteinase-activated receptor 4 (PAR4): activation and inhibition of rat platelet aggregation by PAR4-derived peptides. Can. J. Physiol Pharmacol. 79, 439–442. Houle, S., Papez, M.D., Ferazzini, M., Hollenberg, M.D., and Vergnolle, N. (2005). Neutrophils and the kallikrein-kinin system in proteinase-activated receptor 4-mediated inflammation in rodents. Br. J. Pharmacol. 146, 670–678. Jenkins, R.G., Su, X., Su, G., Scotton, C.J., Camerer, E., Laurent, G.J., Davis, G.E., Chambers, R.C., Matthay, M.A., and Sheppard, D. (2006). Ligation of protease-activated receptor 1 enhances alpha(v)beta6 integrin-dependent TGF-beta activation and promotes acute lung injury. J. Clin. Invest. 116, 1606–1614.

394

Morley D. Hollenberg, John D. Hooper, Dalila Darmoul, and Katerina Oikonomopoulou

Jin, G., Hayashi, T., Kawagoe, J., Takizawa, T., Nagata, T., Nagano, I., Syoji, M., and Abe, K. (2005). Deficiency of PAR-2 gene increases acute focal ischemic brain injury. J. Cereb. Blood Flow Metab. 25, 302–313. Kaneider, N.C., Leger, A.J., Agarwal, A., Nguyen, N., Perides, G., Derian, C., Covic, L., and Kuliopulos, A. (2007). ‚Role reversal‘ for the receptor PAR1 in sepsis-induced vascular damage. Nat. Immunol. 8, 1303–1312. Karpatkin, S., Pearlstein, E., Salk, P.L., and Yogeeswaran, G. (1981). Role of platelets in tumor cell metastases. Ann. NY Acad. Sci. 370, 101–118. Kaushal, V., Kohli, M., Dennis, R.A., Siegel, E.R., Chiles, W.W., and Mukunyadzi, P. (2006). Thrombin receptor expression is upregulated in prostate cancer. Prostate 66, 273–282. Kawabata, A., Kuroda, R., Nagata, N., Kawao, N., Masuko, T., Nishikawa, H., and Kawai, K. (2001). In vivo evidence that protease-activated receptors 1 and 2 modulate gastrointestinal transit in the mouse. Br. J. Pharmacol. 133, 1213–1218. Kawabata, A., Matsunami, M., and Sekiguchi, F. (2008). Gastrointestinal roles for proteinaseactivated receptors in health and disease. Br. J. Pharmacol. 153 (Suppl 1), S230-S240. Kawahara, T., Suzuki, S., Matsuura, F., Clark, R.S.J., Kogushi, M., Kobayashi, H., Hishinuma, L., Sato, N., Terauchi, T., Kajiwara, A., and Matsuoka, T. (2004). Discovery and optimization of potent orally active small molecular thrombin receptor (PAR-1) antagonists. Abstracts of Papers of the American Chemical Society 227, U21. Kelso, E.B., Lockhart, J.C., Hembrough, T., Dunning, L., Plevin, R., Hollenberg, M.D., Sommerhoff, C.P., McLean, J.S., and Ferrell, W.R. (2006). Therapeutic promise of proteinase-activated receptor-2 antagonism in joint inflammation. J. Pharmacol. Exp. Ther. 316, 1017–1024. Kenakin, T., and Miller, L.J. (2010). Seven transmembrane receptors as shapeshifting proteins: the impact of allosteric modulation and functional selectivity on new drug discovery. Pharmacol. Rev. 62, 265–304. Komatsu, N., Saijoh, K., Toyama, T., Ohka, R., Otsuki, N., Hussack, G., Takehara, K., and Diamandis, E.P. (2005). Multiple tissue kallikrein mRNA and protein expression in normal skin and skin diseases. Br. J. Dermatol. 153, 274–281. Komatsu, N., Tsai, B., Sidiropoulos, M., Saijoh, K., Levesque, M.A., Takehara, K., and Diamandis, E.P. (2006). Quantification of eight tissue kallikreins in the stratum corneum and sweat. J. Invest. Dermatol. 126, 925–929. Komatsu, N., Saijoh, K., Kuk, C., Liu, A.C., Khan, S., Shirasaki, F., Takehara, K., and Diamandis, E.P. (2007). Human tissue kallikrein expression in the stratum corneum and serum of atopic dermatitis patients. Exp. Dermatol. 16, 513–519. Kono, T. and Barham, F.W. (1971). Insulin-like effects of trypsin on fat cells. Localization of the metabolic steps and the cellular site affected by the enzyme. J. Biol. Chem. 246, 6204–6209. Krenzer, S., Peterziel, H., Mauch, C., Blaber, S.I., Blaber, M., Angel, P., and Hess, J. (2011). Expression and function of the kallikrein-related peptidase 6 in the human melanoma microenvironment. J. Invest Dermatol. 131, 2281–2288. Loeb, S., and Catalona, W.J. (2007). Prostate-specific antigen in clinical practice. Cancer Lett. 249, 30–39. Lopez-Otin, C., and Matrisian, L.M. (2007). Tumour micro environment – Opinion – Emerging roles of proteases in tumour suppression. Nat. Rev. Cancer 7, 800–808. Martin, M.D., and Matrisian, L.M. (2007). The other side of MMPs: Protective roles in tumor progression. Cancer Metastasis Rev. 26, 717–724. Maryanoff, B.E., Zhang, H.C., Andrade-Gordon, P., and Derian, C.K. (2003). Discovery of potent peptide-mimetic antagonists for the human thrombin receptor, protease-activated receptor-1 (PAR-1). Curr. Med. Chem. Cardiovasc. Hematol. Agents 1, 13–36.

Kallikrein-related Peptidases, Proteinase-mediated Signaling and PARs

395

Megyeri, M., Mako, V., Beinrohr, L., Doleschall, Z., Prohaszka, Z., Cervenak, L., Zavodszky, P., and Gal, P. (2009). Complement protease MASP-1 activates human endothelial cells: PAR4 activation is a link between complement and endothelial function. J. Immunol. 183, 3409–3416. Mize, G.J., Wang, W.B., and Takayama, T.K. (2008). Prostate-specific kallikreins-2 and -4 enhance the proliferation of DU-145 prostate cancer cells through protease-activated receptors-1 and-2. Mol. Cancer Res. 6, 1043–1051. Molino, M., Barnathan, E.S., Numerof, R., Clark, J., Dreyer, M., Cumashi, A., Hoxie, J.A., Schechter, N., Woolkalis, M., and Brass, L.F. (1997a). Interactions of mast cell tryptase with thrombin receptors and PAR-2. J. Biol. Chem. 272, 4043–4049. Molino, M., Woolkalis, M.J., Reavey-Cantwell, J., Pratico, D., Andrade-Gordon, P., Barnathan, E.S., and Brass, L.F. (1997b). Endothelial cell thrombin receptors and PAR-2 – Two protease-activated receptors located in a single cellular environment. J. Biol. Chem. 272, 11133–11141. Moraes, T.J., Martin, R., Plumb, J.D., Vachon, E., Cameron, C.M., Danesh, A., Kelvin, D.J., Ruf, W., and Downey, G.P. (2008). Role of PAR2 in murine pulmonary pseudomonal infection. Am. J. Physiol. Lung Cell. Mol. Physiol. 294, L368-L377. Moraes, T.J., Rafii, B., Niessen, F., Suzuki, T., Martin, R., Vachon, E., Vogel, W., Ruf, W., O’Brodovich, H., and Downey, G.P. (2009). Protease-activated receptor (Par)1 alters bioelectric properties of distal lung epithelia without compromising barrier function. Exp. Lung Res. 35, 136–154. Nhu, Q.M., Shirey, K., Teijaro, J.R., Farber, D.L., Netzel-Arnett, S., Antalis, T.M., Fasano, A., and Vogel, S.N. (2010). Novel signaling interactions between proteinase-activated receptor 2 and Toll-like receptors in vitro and in vivo. Mucosal Immunol. 3, 29–39. Nierodzik, M.L., and Karpatkin, S. (2006). Thrombin induces tumor growth, metastasis, and angiogenesis: Evidence for a thrombin-regulated dormant tumor phenotype. Cancer Cell 10, 355–362. Noorbakhsh, F., Vergnolle, N., Hollenberg, M.D., and Power, C. (2003). Proteinase-activated receptors in the nervous system. Nat. Rev. Neurosci. 4, 981–990. Noorbakhsh, F., Tsutsui, S., Vergnolle, N., Boven, L.A., Shariat, N., Vodjgani, M., Warren, K.G., Andrade-Gordon, P., Hollenberg, M.D., and Power, C. (2006). Proteinase-activated receptor 2 modulates neuroinflammation in experimental autoimmune encephalomyelitis and multiple sclerosis. J. Exp. Med. 203, 425–435. Nyberg, P., Ylipalosaari, M., Sorsa, T., and Salo, T. (2006). Trypsins and their role in carcinoma growth. Exp. Cell Res. 312, 1219–1228. Nystedt, S., Emilsson, I. E., Wahlestedt, C., and Sundelin, J. (1994). Molecular cloning of a potential proteinase activated receptor. Proc. Natl. Acad. Sci. USA 91, 9208–9212. Oikonomopoulou, K., Hansen, K.K., Saifeddine, M., Tea, I., Blaber, M., Blaber, S.I., Scarisbrick, I., Andrade-Gordon, P., Cottrell, G.S., Bunnett, N.W., Diamandis, E.P., and Hollenberg, M.D. (2006a). Proteinase-activated receptors, targets for kallikrein signaling. J. Biol. Chem. 281, 32095–32112. Oikonomopoulou, K., Hansen, K.K., Saifeddine, M., Vergnolle, N., Tea, I., Blaber, M., Blaber, S.I., Scarisbrick, I., Diamandis, E.P., and Hollenberg, M.D. (2006b). Kallikrein-mediated cell signalling: targeting proteinase-activated receptors (PARs). Biol. Chem. 387, 817–824. Oikonomopoulou, K., Hansen, K.K., Saifeddine, M., Vergnolle, N., Tea, I., Diamandis, E.P., and Hollenberg, M.D. (2006c). Proteinase-mediated cell signalling: targeting proteinase-activated receptors (PARs) by kallikreins and more. Biol. Chem. 387, 677–685. Oikonomopoulou, K., Hansen, K.K., Chapman, K., Vergnolle, N., Diamandis, E.P., and Hollenberg, M.D. (2007). Kallikrein-mediated activation of PARs in inflammation and nociception. Inflammation Res. 56, S499-S502. Oikonomopoulou, K., Diamandis, E.P., and Hollenberg, M.D. (2010). Kallikrein-related peptidases: proteolysis and signaling in cancer, the new frontier. Biol. Chem. 391, 299–310.

396

Morley D. Hollenberg, John D. Hooper, Dalila Darmoul, and Katerina Oikonomopoulou

Oikonomopoulou, K., Ricklin, D., Ward, P.A., and Lambris, J.D. (2012). Interactions between coagulation and complement-their role in inflammation. Semin. Immunopathol. 34, 151–165. Pawlinski, R., and Mackman, N. (2004). Tissue factor, coagulation proteases, and protease-activated receptors in endotoxemia and sepsis. Crit. Care Med. 32, S293-S297. Perez, M., Lamothe, M., Maraval, C., Mirabel, E., Loubat, C., Planty, B., Horn, C., Michaux, J., Marrot, S., Letienne, R., Pignier, C., Bocquet, A., Nadal-Wollbold, F., Cussac, D., de Vries, L., and Le Grand, B. (2009). Discovery of novel protease activated receptors 1 antagonists with potent antithrombotic activity in vivo. J. Med. Chem. 52, 5826–5836. Prenzel, N., Zwick, E., Daub, H., Leserer, M., Abraham, R., Wallasch, C., and Ullrich, A. (1999). EGF receptor transactivation by G-protein-coupled receptors requires metalloproteinase cleavage of proHB-EGF. Nature 402, 884–888. Puente, X.S. and Lopez-Otin, C. (2004). A genomic analysis of rat proteases and protease inhibitors. Genome Res. 14, 609–622. Puente, X.S., Sanchez, L.M., Gutierrez-Fernandez, A., Velasco, G., and Lopez-Otin, C. (2005). A genomic view of the complexity of mammalian proteolytic systems. Biochem. Soc. Trans. 33, 331–334. Rallabhandi, P., Nhu, Q.M., Toshchakov, V.Y., Piao, W., Medvedev, A.E., Hollenberg, M.D., Fasano, A., and Vogel, S.N. (2008). Analysis of proteinase-activated receptor 2 and TLR4 signal transduction – A novel paradigm for receptor cooperativity. J. Biol. Chem. 283, 24314–24325. Ramachandran, R., and Hollenberg, M.D. (2008). Proteinases and signalling: pathophysiological and therapeutic implications via PARs and more. Br. J. Pharmacol. 153, S263-S282. Ramachandran, R., Mihara, K., Mathur, M., Rochdi, M.D., Bouvier, M., Defea, K., and Hollenberg, M.D. (2009). Agonist-biased signaling via proteinase activated receptor-2: differential activation of calcium and mitogen-activated protein kinase pathways. Mol. Pharmacol. 76, 791–801. Ramachandran, R., Mihara, K., Chung, H., Renaux, B., Lau, C.S., Muruve, D.A., DeFea, K.A., Bouvier, M., and Hollenberg, M.D. (2011). Neutrophil elastase acts as a biased agonist for proteinaseactivated receptor-2 (PAR2). J. Biol. Chem. 286, 24638–24648. Ramsay, A.J., Dong, Y., Hunt, M.L., Linn, M., Samaratunga, H., Clements, J.A., and Hooper, J.D. (2008a). Kallikrein-related peptidase 4 (KLK4) initiates intracellular signaling via proteaseactivated receptors (PARs). J. Biol. Chem. 283, 12293–12304. Ramsay, A.J., Reid, J.C., Adams, M.N., Samaratunga, H., Dong, Y., Clements, J.A., and Hooper, J.D. (2008b). Prostatic trypsin-like kallikrein mediated peptidases (KLKs) and other prostateexpressed tryptic proteinases as regulators of signalling via proteinase-activated receptors (PARs). Biol. Chem. 389, 653–668. Rickles, F.R. (2006). Mechanisms of cancer-induced thrombosis in cancer. Pathophysiol. Haemost. Thromb. 35, 103–110. Rieser, P. (1967). Insulin-like action of pepsin and pepsinogen. Acta Endocrinol. 54, 375–379. Rieser, P., and Rieser, C.H. (1964). Anabolic responses of diaphragm muscle to insulin and to other pancreatic proteins. Proc. Soc. Exp. Biol. Med. 116, 669–671. Roberts, R.A., and Gullick, W.J. (1989). Bradykinin receptor number and sensitivity to ligand stimulation of mitogenesis is increased by expression of a mutant Ras oncogene. J. Cell Sci. 94, 527–535. Ruda, E.M., Petty, A., Scrutton, M.C., Tuffin, D.P., and Manley, P.W. (1988). Identification of small peptide analogs having agonist and antagonist activity at the platelet thrombin receptor. Biochem. Pharmacol. 37, 2417–2426. Ruda, E.M., Scrutton, M.C., Manley, P.W., and Tuffin, D.P. (1990). Thrombin receptor antagonists – structure-activity-relationships for the platelet thrombin receptor and effects on prostacyclin synthesis by human umbilical vein endothelial cells. Biochem. Pharmacol. 39, 373–381.

Kallikrein-related Peptidases, Proteinase-mediated Signaling and PARs

397

Salah, Z., Maoz, M., Cohen, I., Pizov, G., Pode, D., Runge, M.S., and Bar-Shavit, R. (2005). Identification of a novel functional androgen response element within hPar1 promoter: implications to prostate cancer progression. FASEB J. 19, 62–72. Scarisbrick, I.A., Blaber, S.I., Lucchinetti, C.F., Genain, C.P., Blaber, M., and Rodriguez, M. (2002). Activity of a newly identified serine protease in CNS demyelination. Brain 125, 1283–1296. Scarisbrick, I.A., Blaber, S.I., Tingling, J.T., Rodriguez, M., Blaber, M., and Christophi, G.P. (2006). Potential scope of action of tissue kallikreins in CNS immune-mediated disease. J. Neuroimmunol. 178, 167–176. Scarisbrick, I.A., Linbo, R., Vandell, A.G., Keegan, M., Blaber, S.I., Blaber, M., Sneve, D., Lucchinetti, C.F., Rodriguez, M., and Diamandis, E.P. (2008). Kallikreins are associated with secondary progressive multiple sclerosis and promote neurodegeneration. Biol. Chem. 389, 739–745. Scarisbrick, I.A., Epstein, B., Cloud, B.A., Yoon, H., Wu, J.M., Renner, D.N., Blaber, S.I., Blaber, M., Vandell, A.G., and Bryson, A.L. (2011). Functional role of kallikrein 6 in regulating immune cell survival. Plos One 6, e18376. Sefton, B.M. and Rubin, H. (1970). Release from density dependent growth inhibition by proteolytic enzymes. Nature 227, 843–845. Serebruany, V.L., Kogushi, M., Stros-Pitei, D., Flather, M., and Bhatt, D.L. (2009). The in-vitro effects of E5555, a protease-activated receptor (PAR)-1 antagonist, on platelet biomarkers in healthy volunteers and patients with coronary artery disease. Thromb. Haemost. 102, 111–119. Sevigny, L.M., Zhang, P., Bohm, A., Lazarides, K., Perides, G., Covic, L., and Kuliopulos, A. (2011). Interdicting protease-activated receptor-2-driven inflammation with cell-penetrating pepducins. Proc. Natl. Acad. Sci. USA 108, 8491–8496. Shoelson, S.E., White, M.F., and Kahn, C.R. (1988). Tryptic activation of the insulin-receptor – proteolytic truncation of the alpha-subunit releases the beta-subunit from inhibitory control. J. Biol. Chem. 263, 4852–4860. Silva, M.R.E., Beraldo, W.T., and Rosenfeld, G. (1949). Bradykinin, a hypotensive and smooth muscle stimulating factor released from plasma globulin by snake venoms and by trypsin. Am. J. Physiol. 156, 261–273. Soreide, K., Janssen, E.A., Korner, H., and Baak, J.P. (2006). Trypsin in colorectal cancer: molecular biological mechanisms of proliferation, invasion, and metastasis. J. Pathol. 209, 147–156. Stefansson, K., Brattsand, M., Roosterman, D., Kempkes, C., Bocheva, G., Steinhoff, M., and Egelrud, T. (2008). Activation of proteinase-activated receptor-2 by human kallikrein-related peptidases. J. Invest. Dermatol. 128, 18–25. Steiner, D.F., Cunningham, D., Spigelman, L., and Aten, B. (1967). Insulin biosynthesis – evidence for a precursor. Science 157, 697–700. Suen, J.Y., Barry, G.D., Lohman, R.J., Halili, M.A., Cotterell, A.J., Le, G.T., and Fairlie, D.P. (2012). Modulating human proteinase activated receptor 2 with a novel antagonist (GB88) and agonist (GB110). Br. J. Pharmacol. 165, 1413–1423. Swedberg, J.E., Nigon, L.V., Reid, J.C., de Veer, S.J., Walpole, C.M., Stephens, C.R., Walsh, T.P., Takayama, T.K., Hooper, J.D., Clements, J.A., Buckle, A.M., and Harris, J.M. (2009). Substrateguided design of a potent and selective kallikrein-related peptidase inhibitor for kallikrein 4. Chem. Biol. 16, 633–643. Tressel, S.L., Koukos, G., Tchernychev, B., Jacques, S.L., Covic, L., and Kuliopulos, A. (2011). Pharmacology, biodistribution, and efficacy of GPCR-based pepducins in disease models. Methods Mol. Biol. 683, 259–275. Trivedi, V., Boire, A., Tchernychev, B., Kaneider, N.C., Leger, A.J., O’Callaghan, K., Covic, L., and Kuliopulos, A. (2009). Platelet matrix metalloprotease-1 mediates thrombogenesis by activating PAR1 at a cryptic ligand site. Cell 137, 332–343.

398

Morley D. Hollenberg, John D. Hooper, Dalila Darmoul, and Katerina Oikonomopoulou

van de Veerdonk, F.L., Netea, M.G., Dinarello, C.A., and Joosten, L.A. (2011). Inflammasome activation and IL-1beta and IL-18 processing during infection. Trends Immunol. 32, 110–116. Vandell, A.G., Larson, N., Laxmikanthan, G., Panos, M., Blaber, S.I., Blaber, M., and Scarisbrick, I.A. (2008). Protease-activated receptor dependent and independent signaling by kallikreins 1 and 6 in CNS neuron and astroglial cell lines. J. Neurochem. 107, 855–870. Vaughan, P.J., Pike, C.J., Cotman, C.W., and Cunningham, D.D. (1995). Thrombin receptor activation protects neurons and astrocytes from cell death produced by environmental insults. J. Neurosci. 15, 5389–5401. Vergnolle, N., Hollenberg, M.D., Sharkey, K.A., and Wallace, J.L. (1999). Characterization of the inflammatory response to proteinase-activated receptor-2 (PAR2)-activating peptides in the rat paw. Br. J. Pharmacol. 127, 1083–1090. Vogel, S.M., Gao, X., Mehta, D., Ye, R.D., John, T.A., Andrade-Gordon, P., Tiruppathi, C., and Malik, A.B. (2000). Abrogation of thrombin-induced increase in pulmonary microvascular permeability in PAR-1 knockout mice. Physiol. Genomics 4, 137–145. Vu, T.K., Hung, D.T., Wheaton, V.I., and Coughlin, S.R. (1991). Molecular cloning of a functional thrombin receptor reveals a novel proteolytic mechanism of receptor activation. Cell 64, 1057–1068. Wang, W., Mize, G.J., Zhang, X., and Takayama, T.K. (2010). Kallikrein-related peptidase-4 initiates tumor-stroma interactions in prostate cancer through protease-activated receptor-1. Int. J. Cancer 126, 599–610. Werle, E., and Erdös, E.G. (1954). A new hypotensive, enterotropic and hysterotropic substance in human urine. Naunyn Schmiedebergs Arch. Exp. Pathol. Pharmakol. 223, 234–243. Wu, C.C., Huang, S.W., Hwang, T.L., Kuo, S.C., Lee, F.Y., and Teng, C.M. (2000). YD-3, a novel inhibitor of protease-induced platelet activation. Br. J. Pharmacol. 130, 1289–1296. Wu, C.C., Hwang, T.L., Liao, C.H., Kuo, S.C., Lee, F.Y., Lee, C.Y., and Teng, C.M. (2002). Selective inhibition of protease-activated receptor 4-dependent platelet activation by YD-3. Thromb. Haemost. 87, 1026–1033. Yang, E., Boire, A., Agarwal, A., Nguyen, N., O’Callaghan, K., Tu, P., Kuliopulos, A., and Covic, L. (2009). Blockade of PAR1 signaling with cell-penetrating pepducins inhibits Akt survival pathways in breast cancer cells and suppresses tumor survival and metastasis. Cancer Res. 69, 6223–6231. Yang, Y.H., Hall, P., Little, C.B., Fosang, A.J., Milenkovski, G., Santos, L., Xue, J., Tipping, P., and Morand, E.F. (2005). Reduction of arthritis severity in protease-activated receptor-deficient mice. Arthritis Rheum. 52, 1325–1332. Zhang, H.C., Derian, C.K., Andrade-Gordon, P., Hoekstra, W.J., McComsey, D.F., White, K. B., Poulter, B.L., Addo, M.F., Cheung, W.M., Damiano, B.P., Oksenberg, D., Reynolds, E. E., Pandey, A., Scarborough, R.M., and Maryanoff, B.E. (2001). Discovery and optimization of a novel series of thrombin receptor (par-1) antagonists: potent, selective peptide mimetics based on indole and indazole templates. J. Med. Chem. 44, 1021–1024. Zheng, X.L., Renaux, B., and Hollenberg, M.D. (1998). Parallel contractile signal transduction pathways activated by receptors for thrombin and epidermal growth factor-urogastrone in guinea pig gastric smooth muscle: blockade by inhibitors of mitogen-activated protein kinasekinase and phosphatidyl inositol 3′-kinase. J. Pharmacol. Exp. Ther. 285, 325–334. Zwicker, J.I., Furie, B.C., and Furie, B. (2007). Cancer-associated thrombosis. Crit. Rev. Oncol. Hematol. 62, 126–136.

Index α1-antichymotrypsin (ACT, serpinA3) 123, 150, 176f., 252, 260, 276, 388 α1-protease inhibitor (API, serpinA1) 147, 276, 334, 337 α2-antiplasmin (AAP, serpinF2) 147 α2-macroglobulin 123, 320 α-synuclein 128, 362 ΨKLK1 9 aberrant expression 172, 338, 340 acanthosis 170 accessory gland 311, 316 acidic 4-disulphide core (WFDC) protein 336f. acinar cells 202, 272 acrosomal head 314 acrosome reaction 311 activation cascade 100, 110, 320f., 363 activation cleavage 253, 259, 262 activation mechanism 107, 252, 254, 387 activation pathway 255 activation process 317, 321 activation, reciprocal 256, 263 activation site 254f., 377 activation system 256 activome 131f., 252 adenocarcinoma 126, 168, 224f., 322 adhesion 17, 165, 172, 285, 332, 356 adhesion molecule 17, 172, 285, 332, 356 adrenal gland 207 agonist 166, 263, 279f., 285, 374, 376, 378f., 386, 389 airways 276, 284, 384 alanine 99, 105, 109, 126–130 alignment 9, 12, 80, 82f., 97, 104, 151, 261 allele 11, 13, 31f., 35f., 39, 50, 69, 282, 297, 304 alternative splicing 18 alternative transcript 12, 18 alveolar epithelium 207 Alzheimer’s disease (AD) 110, 128, 146, 173f., 188, 212, 359, 361 ameloblast 295, 298, 300, 304–307 ameloblastin 125, 304 amelogenesis imperfecta (AI) 39, 129, 258f., 297, 302, 304 amelogenin 125, 304 amino acid residue, acidic 127, 130f., 259, 276

amino acid residue, basic 105, 122, 128f., 131, 276 amino acid residue, hydrophobic 103, 124, 127f. aminopeptidase 259, 263 amplification 166, 252, 263, 321, 379, 389 amygdala 352f., 359 amyloid precursor protein (APP) 128, 146, 173, 212, 362 ancestor 81, 85, 89 androgen 13f., 36, 83, 88, 94, 125, 165, 363, 382 androgen receptor (AR) 36, 258, 315 androgen response element 13, 15, 36, 83, 94, 382 angiogenesis 207, 217, 257, 258, 286, 288 angiostatin 257 angiotensin-converting enzyme (ACE) 175 antagonist 279, 282, 360, 376, 383–388 antibody 100, 146, 221, 276, 283f., 313, 315, 318f., 356f., 361, 363, 383, 387, 389 antileukoprotease 147, 337 antimicrobial peptide 108, 196, 340 antithrombin III 147 apocrine metaplasia 192 apoptosis 162, 218, 363, 386 aprotinin (bovine pancreatic trypsin inhibitor, BPTI) 99, 104, 125, 144, 146, 276 arginine 88, 98f., 101, 103, 106, 109–111, 118, 122f., 126–132, 153, 253, 313, 317, 376 arginine esterase 88 Array Express Archive 188 arthritis 217, 257, 285, 288, 380, 385, 387 ascites 168, 218 Asp189 residue 98, 102, 105–107, 109f., 126–128, 130f. association study 38f., 69 astrocyte 357f. astroglial 358 atopic dermatitis (AD) 104, 108, 126, 162, 171f., 180, 215, 255, 336f., 339, 381 atopic skin 170f. auto-activation 253, 256, 321 autoimmunity 359 axon 173, 357, 360f. bamboo hair 170, 337 barrier function 170, 180, 329, 333, 339

400

Index

basal cell layer 329, 334 Bayesian analysis 21, 80f. Bcl2 358 bikunin 146 binding protein 165, 276, 317 biomarker 100, 104, 123, 126, 129–131, 162, 165, 192, 217f., 221f., 227, 322, 382, 389 bioscaffold 141, 149–152 blood brain barrier (BBB) 174, 350, 356f., 359f., 362 blood pressure 93, 98, 162, 271f., 281f., 287, 379 blood protein 218, 357 blood vessel 166, 278, 286, 338, 357 bone 130, 165, 167, 211, 302, 382 bone metastasis 165, 167, 382 bootstrapping 80, 85, 87, 92 bovine pancreatic trypsin inhibitor (BPTI, aprotinin) 99, 104, 125, 144, 146, 276 bradykinin 5, 122, 166, 211, 271, 277–279, 283, 285, 315, 349, 353, 357–361, 379 bradykinin B1 receptor 278–280, 285, 362 bradykinin B2 receptor 166, 211, 272, 277–282, 287, 359, 362, 379 bradykinin receptor 278–280, 285f., 315, 349, 353, 357–359, 361 bradykinin receptor antagonist 285f. brain 106, 111, 129, 173, 187f., 192, 215, 218, 222, 258, 349–353, 356, 358, 360–362 breast cancer 13, 17, 31, 50, 128, 131, 192, 222, 386 breast cancer cell line 131 breast cancer cells 386 breast cancer susceptibility gene 1/2 31 breast cancer tissue 13 breast cyst fluid 222 breast milk 131, 192 breast secretion 222 breast tissue 129, 162, 222 breast tumor 13 bronchoalveolar lavage fluid 284 calcification 295 calcium 164, 170, 262, 295, 311, 314f., 321, 377f., 380, 383 calcium-binding 304 calcium influx 315 calcium, intracellular 272, 279f., 386 calcium release 164, 262

calcium signaling 377 callitrichid species 84 cancer cell line 17, 125, 166, 286 cancer development 165 Cancer Genetic Markers of Susceptibility (CGEMS) 70 cancer therapy 218, 222 candidate gene study 39, 50, 71 capacitation 311, 314, 316 carcinogenesis 17, 165, 227, 286 carcinoma of the oral cavity (OSCC) 126, 225 cardiac and antral gastric glands 202 cascade 162, 251, 279, 349, 358, 363, 379 catalytic triad 39, 100, 105, 107f., 110, 142, 274 cathelicidin 108, 172, 340 cathelicidin LL-37 130, 172, 340 cathepsin 123, 176, 259, 262, 336, 377 cathepsin B 123 cathepsin C 259 cathepsin D 123 cathepsin G 176, 262, 336, 377 cation channels of sperm (CatSpers) 315 CCN intercellular signaling proteins 130 cell adhesion 162, 166, 261 cell invasion 168, 382 cell line 9, 13, 17f., 126f., 358 cell membrane 280f., 284 cell migration 218, 286, 386 central nervous system (CNS) 127, 162, 173, 188, 191, 212, 278, 349–351, 353, 356–363, 380f. centromere 9 cerebellum 130, 350, 352f. cerebral cortex 188, 352f. cerebrospinal fluid (CSF) 187f., 191, 215, 350f., 361, 363 cervicovaginal fluid 196 cervix 128, 130, 192 chemokine 257, 316 chemotherapy 168, 223, 382, 388 chimpanzee 21, 70, 84 chondroitin sulfate proteoglycan 357 choroid plexus 188, 351 chromosome 19 5, 7, 9, 32, 82, 141, 297, 349 chymotrypsin 88, 97, 125, 127, 129, 144, 253, 261, 314, 320, 373 chymotrypsin-like 94, 121, 124, 127, 129f., 187, 253, 255, 261, 312f., 320, 340 circulating tumor cells (CTCs) 165

Index

circulation 165, 176, 271, 276, 279 cleavage site 100, 118, 122–124, 128, 130f., 153, 176, 254, 260, 313, 316f., 376 clinical development 174, 180, 385 clinical outcome 126, 130, 224, 226 clinical practice 31, 227 clinical relevance 224 clinical value 18, 218, 221 clusterin 317 CNS injury 357–360 CNS physiology 349f., 359 CNS trauma 360 coagulation 141, 147, 152, 161, 179, 207, 255, 258, 312f., 321, 379, 382, 384, 386, 388f. coagulation factor Xa 118, 152, 258, 321 co-culture model 167 cognitive function 353, 361 colitis 217, 380 collagen 128–131, 258, 283, 285, 329, 356f., 362 colon 125, 127, 130f., 198, 202, 217f., 376, 380, 382f., 386 colon cancer cells 383, 386 colorectal cancer (CRC) 126f., 224, 376, 380, 383, 386 common marmoset 84 complement system 150, 317, 373, 389 confidence interval 69, 122, 252, 319 conformation 101, 107, 109 conservation 34f., 83–85, 90, 92 contusion 360f. conversion 87, 254, 256, 259, 261, 263, 373 copy number 9, 16 corneocyte 104, 169, 330, 331 corneodesmosin (Cds) 108, 126, 129, 169, 172, 332 corneodesmosomes 104, 108, 127, 169, 171, 332 corpus callosum 352 corpus striatum 352 cotton-top tamarin 84 cow 21, 91 CpG island 17, 277, 278 Crohns disease 217 crystal structure 90, 97f., 102, 105f., 108, 110f., 276 C-terminus 101, 109, 123, 253, 257, 280, 338, 376 cucurbita maxima trypsin inhibitor (CMTI) 147

401

cumulus cell 315 cytokine 164, 256f., 262, 278, 316, 339, 359, 374, 381f., 386 cytoplasm 202, 272, 338 cytosol 259 death 161, 174, 218, 226, 251, 359 deficiency 170f., 180, 338, 362 degradomics 130 deletion 32, 38, 110, 274, 357, 360 dementia 173, 362 demethylation 17, 278 demyelination 381 dendritic cell 316 depsipeptide 148 dermis 129, 329 desArg9-bradykinin 278–280 desArg10-kallidin (LysdesArg9-bradykinin) 278–280, 285 desmocollin 1 (Dsc1) 126, 169, 196, 332 desmoglein 1 (Dsg1) 104, 108, 126, 129, 169, 196, 332 desmoplakin 332 desmosome 332 desquamation 104, 108, 126, 129, 147, 162, 169–171, 196, 203, 330–332, 336–338, 340 diagnosis 227, 382 differentiation 16, 79, 162, 170, 172, 227, 256, 261, 330, 332, 335f., 338 dipeptidyl peptidase I 259 disease progression 165, 168, 174, 286 disease recurrence 218 DNA-methylation 17, 277 dog 21, 88–91, 93, 271 downregulation 17, 222–226, 252, 277 drugs 98, 154, 164f., 174f., 177, 179f., 278, 284 DU145 human prostate cancer cell line 176 ductus deferens 196 duodenum 202 duplication 8, 16, 21, 81,–92, 94 dysregulation 162, 167 E-cadherin 17, 127, 167f. ecotin 147, 149, 151 eczema 339 edema 283, 358–360, 362, 381, 386 efferent ductules 196 eglin C 147 ejaculate 122f., 126, 311, 318

402

Index

ejaculation 311, 313f., 318f. elafin 337 elastase 258, 276, 285, 336f., 377f., 387 enamel 39, 93, 125, 259, 295–298, 300, 302, 304, 306f. enamelin 125, 304 enamel malformation 295, 297, 302 enamel matrix serine protease-1 (EMSP1, see KLK4) 125, 297 enamel protein 296, 300, 305–307 endometrial cancer 223 endometrial mucosa 316 endometrium 192, 196, 223 endothelial cell 279, 281, 285f., 288, 382 endothelial NO synthase (eNOS) 279, 281, 287 enzymatic cascade 162, 349, 359 enzyme activity 331, 339, 388 enzyme linked immunosorbent assay (ELISA) 130, 172, 221 epidermal growth factor (EGF) 166, 277, 284, 373f., 378, 383, 387 epidermal growth factor receptor (EGFR) 166, 277, 284 epidermis 169f., 172, 203, 255, 329–331, 333–338 epididymis 196, 300, 311 epigenetic 17f., 277f. epigenetic regulation 17f., 277 epilepsy 110, 215, 361 epithelial cell 18, 123, 130, 187, 196, 217, 258, 272, 302, 336, 382 epithelial-mesenchymal transition (EMT) 125, 127, 167 esophageal cancer 225 esophagus 128, 130, 198, 335 estrogen 14f., 17 estrogen receptor 17 ETS translocation variant 4 (ETV4) 9 evolution 16, 18, 21f., 79–82, 84f., 87, 93f., 143, 304 excitotoxic 360 exocrine pancreas 202 exon 12, 18, 35, 83, 86, 89–91, 151, 274, 297, 304, 353 exonic splicing enhancer (ESE) 34 exosite 99, 101, 103, 105, 109, 150 experimental autoimmune encephalomyelitis (EAE) 362f. exposure 174, 254f., 259f., 262, 315, 317, 320

expressed sequence tag (EST) 301f., 304 expression analysis 334 expression level 69, 106, 129, 222, 224, 227, 312, 336, 352 expression pattern 169, 312, 331, 334, 340, 349, 351, 353, 363 extracellular matrix 125, 162, 165f., 173, 256, 286, 304, 331, 353, 356, 374, 380 extracellular matrix molecule 166, 168, 256f., 259, 262, 353, 356f., 361f. extracellular-regulated kinase 1/2 (ERK1/2) 279f., 285, 358, 386 fallopian tube 192 FAM83H (Family with sequence similarity 83, member H) 302, 304 feedback loop 319–321, 334 female reproductive tract 192, 222, 311, 314, 316–318 fertilization 251, 311f., 314, 316, 319 fibrinolysis 5, 256, 312f. fibronectin 110, 122–124, 126, 130f., 313f., 356f., 362 fibrosis 259, 283 fluid, prostatic 318 frog 92 fusion protein 332 gastric cancer (GC) 11, 224, 286 gastric mucosa 202 gastrointestinal cancer 168 gastrointestinal tract 198, 384 gene cluster 8, 273 gene duplication 82, 94 Gene Expression Omnibus 187 gene family 5, 7–9, 21, 334, 349, 353, 363 genes homologous 85, 87, 89 genes, paralogous 87 genetic variation 31, 38f., 50, 70f. genome 5, 7f., 31f., 50, 85, 93 genome project 7, 79, 81, 84, 87, 90, 94 genome-wide association study (GWAS) 50, 69–71 genotype 36, 38, 50, 70 glands 196, 202f., 217, 272, 284, 311, 331, 336 glandular epithelia 203, 312, 337 glia 356, 363 glial fibrillary acidic protein 361 glioblastoma 222

Index

glioma 192, 222 gliosis 358f., 361 glucocorticoid 14, 363 glucocorticoid response element 15 glutamate 361 glycosylation 107, 109, 168, 274, 306 goblet cells 207, 217 G-protein-coupled receptor (GPCR) 164, 166, 262, 277f., 280, 315, 376, 384–386 granulocyte 316 granulomas 217 granulosa cell 272 growth factor 111, 162, 165f., 253, 256f., 259, 261, 286, 316, 374 growth hormone 352 GT-GC boundary 21 Hassalls corpuscles 207 hepatocyte growth factor 126 high-molecular-weight 5, 272, 284, 313, 315, 319 high-risk variant 39 hippocampus 110f., 131, 173, 188, 215, 350, 352f., 356, 361f. hirustasin 99, 147 hormone 14, 143, 162, 196, 202, 271, 329 hormone response element (HRE) 15 hormone response elements (HREs) 15 horse 21, 90–93 human seminal inhibitor-1 (HUSI-1) 337 hydrogen bond 101, 105, 109, 144, 147f., 152 hyperactivation 311, 314f. hyperactivity 170f., 311, 338 hyperkeratosis 170, 336, 339 hypermethylation 17 hyperplasia 172, 192, 196, 211, 223, 272 hypertension 35, 50, 175, 187, 281–283 hypokeratosis 340 hypotension 360, 385 Icatibant 359 ichtyosis 330, 337, 340 ileum 202, 271 immunoassay 203, 301f. immunohistochemistry (ICH) 18, 188, 196, 202f., 207f., 217, 223, 225–227 immunoreactivity 188, 192, 225, 283, 352 imputation 69, 70 indicator 222, 226, 286

403

inducible NO synthase (iNOS) 280 infarction 283, 360 inflammation 106, 141, 162, 164, 166, 169–174, 187, 207, 256–258, 262, 276, 281, 283, 285, 316f., 332, 339f., 362, 373, 379–381, 383, 386f., 389 inherited disease 381 inhibitor, aldehyde-based 126, 153 inhibitor, canonical 147f., 152 inhibitor design 149f., 153f., 174, 388 inhibitors, angiogenesis 257 inhibitory mechanisms 319f. initiation region (IR) 16 innate immunity 170, 255, 317, 340, 373, 379, 389 inositol 272, 311 inositol trisphosphate 272, 279 insemination 316 in silico 12, 15, 21, 34f., 222, 225f. in situ hybridization 283, 298, 352 insulin-like growth factor binding protein (IGBP) 124, 126, 129, 131, 165, 167 insulin-like growth factor (IGF) 131, 165, 167 integrin 166, 285, 356, 374 interleukin 316, 361 interleukin-1 (IL-1) 278, 339 International Cancer Genome Consortium 187 International HapMap Project 31f., 36, 38, 70 intron 8, 11f., 18, 21, 83, 274 intron retention 18 invasion 166, 168, 218, 379, 382, 384f., 388 ischemia 211, 359f. ischemia/reperfusion injury 145, 360 isoform 18, 335, 353 itch 339 jejunum 202 kallidin (Lys-bradykinin) 121, 271f., 276, 278, 287 kallikrein-kinin system 207, 215, 315, 317, 358f., 362f. kallikrein loop 92, 99f., 110 kallistatin 121, 217, 274, 276, 286 Kazal domain 146, 152, 179, 334–336 Kazal-type inhibitor 146f., 151, 174, 334 keratinocyte 169–172, 226, 277, 329, 331, 334–337, 383 kidney 153, 218, 226, 258, 272, 281f., 352, 358

404

Index

kidney cancer 226 kinin 5, 271f., 277–281, 283–286, 315, 358f., 362, 373f., 379 kinin cascade 283, 285, 287 kininogen 5, 98, 121, 272, 276, 279, 284f., 315, 358 kininogenase 121f., 272, 284, 315, 358 kinin receptor signaling 280 KLK1 5, 7–9, 13f., 16, 21, 35, 50, 79, 81–94, 98, 104, 118, 121f., 126, 145–147, 162, 169, 171, 173, 187, 192, 202f., 207, 211, 215, 217f., 223–226, 252f., 255, 257, 263, 271–274, 276–279, 281–287, 311, 315, 317, 321, 332, 350f., 358f., 361, 363, 379f. KLK1b5 86 KLK1b23-ps pseudogene 86 KLK1b28-ps pseudogene 86 KLK1E2 90–93 KLK2 5, 8f., 14–16, 21, 35f., 50, 69, 71, 81–85, 87–94, 100, 104f., 111, 118, 121–124, 126, 131, 145–147, 149, 151, 154, 164–167, 176, 191f., 196, 203, 223f., 226, 252, 254–257, 259–261, 263, 312–315, 317, 319–321, 350, 357, 382, 388 KLK3 5, 8f., 13–16, 18, 21, 35f., 38, 50, 69–71, 81–85, 87–90, 92–94, 100, 104, 118, 121–124, 126, 131, 147, 149, 153, 165–167, 179, 187f., 192, 203, 207, 222–227, 252–255, 257, 260f., 301, 312–314, 318–322, 350, 357, 382 KLK4 8f., 11–16, 18, 21, 39, 50, 81, 85f., 88–91, 93, 101–103, 105f., 118, 125f., 145, 149, 152, 164–167, 176, 188, 196, 207, 217, 222–226, 255, 257–260, 262f., 295–298, 300–302, 304–307, 312, 314, 319, 321, 334, 350f., 380, 382f., 388 KLK5 9, 15, 18, 21, 79, 81, 90, 92, 94, 104–106, 108f., 118, 125–127, 131, 145f., 148f., 164, 168–173, 179f., 188, 192, 196, 202f., 207, 215, 217, 222–227, 255, 257, 259f., 262f., 313, 316f., 320f., 331–336, 338–340, 350–352, 358, 378, 381 KLK6 11, 15, 17f., 21, 79, 81, 106f., 118, 127, 164, 167–170, 172–174, 188, 191f., 196, 202f., 207, 212, 215, 222–227, 253–255, 257, 259–261, 263, 312, 332, 334, 338, 350–353, 357–362, 378, 380f., 383 KLK7 15, 18, 35f., 79, 81, 94, 104, 108f., 118, 125–127, 145, 147–149, 164, 168–173, 180,

187f., 192, 202f., 207, 215, 217, 222–226, 253, 255, 257, 259–262, 314, 331f., 334, 336–340, 350–352, 362, 381 KLK8 15, 18, 21, 79, 81, 110f., 118, 129, 147–149, 164, 168–173, 179f., 192, 203, 215, 222–227, 255, 257, 259–261, 312, 331, 334, 336, 338f., 350–353, 356, 359–363 KLK8-T4 226 KLK9 21, 70, 79, 81, 118, 130, 187, 207, 222f., 225–227, 253, 255, 350f. KLK10 12–15, 17, 21, 50, 79, 81, 118, 129f., 164, 168f., 172, 188, 192, 196, 202f., 207, 217, 222–227, 253, 255, 257, 339, 350–352, 362 KLK11 21, 79, 81, 92, 118, 130f., 148, 168f., 172, 173, 188, 192, 196, 202f., 207, 217, 222–227, 253, 255, 257, 259–261, 320f., 339, 350f., 353 KLK12 21, 35f., 79, 81, 118, 129f., 148, 188, 192, 196, 202f., 207, 211, 217, 222f., 225f., 255, 260, 334, 350f. KLK13 15, 17f., 21, 79, 81, 118, 127f., 148, 172, 188, 192, 196, 202f., 207, 222–226, 255, 260f., 312, 314, 320, 332, 339, 350f. KLK14 11, 18, 21, 70, 79, 81, 92, 104, 108, 118, 127f., 145, 148f., 151, 164f., 167, 169, 171, 173, 176, 180, 188, 192, 196, 202f., 207, 217, 222–226, 255f., 260, 263, 274, 313f., 317, 320f., 331f., 334, 336, 339, 350–352, 357f., 376, 378, 380f., 383 KLK15 8f., 16, 21, 50, 81–85, 88–91, 118, 130f., 196, 203, 222–226, 255, 257, 273, 350f. KLKB1 (plasma kallikrein) 5, 145, 147, 151–154, 162, 258, 276, 278, 284f., 321 KLKP1 pseudogene 9, 11, 16, 83, 85 knockout 282, 295, 297, 302, 307, 356, 360f., 363, 381 Kunitz domain 144, 146f., 149, 151f. laminin 124, 128f., 356, 357 Langerhans islets 202 large repeat 87, 90 larynx 207 leukocyte 208, 258, 288, 336, 362 leupeptin 104, 125, 148 Lewy body 362 libraries 117, 123, 125–129, 150–152, 154, 225, 274 ligand 101, 104f., 261f., 280, 285, 287, 376, 378, 387

Index

linkage disequilibrium (LD) 13, 36, 38, 69 lipid 330 liquefaction 93, 122, 124, 126, 129, 311, 313f., 318 lizard 92 localization 7, 151, 171, 187f., 196, 202f., 211, 261, 272, 297, 352, 356, 381 locus control region (LCRs) 16 long terminal repeat 86, 94 long-term potentiation (LTP) 215, 353, 356 low-risk genetic variant 39 lung 130, 207, 218, 226, 278, 286, 386 lung cancer 226, 278, 286 lung tumor 226 lymphatic 165, 207 lymphocyte 318, 358, 362 Lympho-epithelial Kazal-type-related inhibitor-2 (LEKTI-2) 148, 336 Lympho-epithelial Kazal-type-related inhibitor (LEKTI) 104, 108, 146, 148, 154, 170f., 179f., 217, 334–336, 338–340, 381, 388 lysine 99, 101, 106, 118, 122f., 125–132, 253 macrophage 217, 259, 316, 381 malignancy 11, 13, 128, 162, 218, 222, 256, 261, 382 mammals 21, 70, 81, 90, 92–94, 304 mammary 387 Matrigel 357 matrix metalloproteinase-1 (MMP-1) 376, 388 matrix metalloproteinase-2 (MMP-2) 166, 252, 257f., 261 matrix metalloproteinase-3 (MMP-3) 258 matrix metalloproteinase-9 (MMP-9) 127, 166, 257, 285 matrix metalloproteinase-14 (MMP-14, MT1-MMP) 258 matrix metalloproteinase-20 (MMP-20) 258, 295, 297, 302, 304 matrix metalloproteinase (MMP) 174, 180, 252, 256f., 263, 285f., 288, 321, 349, 359, 378, 382, 386 MDA-MB-231 breast cancer cells 130, 286 MDPK67b engineered serpin-type inhibitor 176f., 179 melanocyte 331 melanoma 225, 383 memory 110f., 173, 215, 353, 356, 362 memory formation 110f., 353, 356

405

meprin 256, 258f., 263, 334 MER8 repeat element 11 mesenchymal 211 mesothelioma 278, 286 messenger RNA 8, 11, 13f., 17f., 36, 131, 165f., 173, 187f., 191f., 196, 202, 211, 217f., 222–227, 274, 297, 301, 312, 331, 334, 336, 353 metalloproteinases 256 metastasis 123, 126, 166, 168, 218, 222f., 278, 382, 384–386, 388 metatherians 81 methylation 17f., 277f. MHS-5 sperm-coating antigen 318 microarray 217 microenvironment 312, 321, 330, 358 microglia 352, 360, 362 microRNA (miRNA) 35, 143 middle cerebral artery occlusion (MCAO) 359 migration 170, 256, 259, 261, 277, 285f., 288, 311f., 357 minisatellite element MSR1 11 minor allele frequency (MAF) 31f., 38 miRNA 35 mitogen-activated protein kinase (MAPK) 164, 262, 279f., 285, 358, 361, 377f., 383, 386 model 166, 172f., 177, 271, 277, 281–283, 338, 357, 359, 361f., 385, 387 monocyte 357, 360, 362 mortality 168, 170 mouse 5, 7f., 16f., 21, 81, 85, 87, 110f., 129, 171, 173, 176, 211, 215, 256f., 259, 279, 282f., 295, 297f., 300–302, 306f., 318, 338f., 350, 353, 356, 360–363, 378, 381, 386 mucin 196, 202 mucous alveoli 203 multiple sclerosis (MS) 106, 128, 173f., 212, 215, 357, 359, 362, 381 muscle 211 mutation 13, 17, 31, 39, 85, 87, 94, 107, 109, 132, 144, 146, 151, 170, 217, 253, 258f., 277, 295, 297, 304, 307, 337, 340 myelencephalon-specific protease (KLK6) 106, 128, 350, 381 myelin 106, 128, 215, 360, 362f. myelination 352 myelin basic protein (MBP) 106, 128, 363 myelin oligodendrocyte glycoprotein (MOG) 362f.

406

Index

National Center for Biotechnology Information (NCBI) 32, 38, 79, 82, 92, 187 nerve 111, 215, 352, 357 nervous system 188, 349f., 353f., 356, 381, 384 Netherton syndrome (NS) 126, 144, 146f., 162, 170–172, 180, 217, 255, 337f., 340, 349, 381 neurodegeneration 187 neurodegenerative disorders 127, 162, 191, 212, 215, 222, 349, 361 neuroinflammatory disorder 349, 362 neuron 145, 174, 188, 351–353, 356, 358f., 361, 363, 380 neurosin (KLK6) 106, 127, 173, 350 neutrophils 172, 258, 272, 276, 283–285, 288, 338, 373, 377, 386 New World monkey 84 nipple 222 nipple aspirate fluid (NAF) 222 nitric oxide 279, 359 NLS-lacZ reporter 297 N-methyl-D-aspartate (NMDA) 356, 358 nomenclature 5, 8, 86, 253, 271, 350 NO synthase 280 N-terminus 102, 107, 144, 146, 252, 254, 259, 262, 274, 277, 321, 338, 376 nucleus 298, 352f. odds ratio 69 Old World monkey 84 olfactory 352 oligodendrocyte 188, 360, 362f. oligodendroglia 352, 360 oligomer 104, 321 oncocytoma and chromophobe renal cell carcinoma 226 oocyte 311, 314 opossum 21, 81f., 92f. oral cavity 198, 225 outcome 92, 130, 167, 223f., 227, 280, 360 ovarian cancer 9, 15, 18, 50, 125f., 128–131, 164, 167f., 192, 222f. ovary 13, 130, 192, 218, 223, 272, 300 ovum 311 oxyphilic cells 208 pain 283, 362, 373 pancreas 5, 92, 98, 121, 144, 167f., 187, 198, 202, 218, 225, 254, 258f., 262, 271f., 282 pancreatic adenocarcinoma 168

pancreatic cancer 167f., 225, 262 pancreatic duct 168, 202, 225 parakeratosis 203 paralogue 16, 97 parathyroid gland 207f., 334 parietal cells of the glomeruli 207 Parkinson’s disease 128, 212, 359, 362 pathogenesis 39, 69, 215, 259, 282, 286, 288, 322, 349, 359, 362, 381 pathology 173, 179, 300, 358, 361 patients, hypertensive 282 PC3 human prostate cancer cell line 167 peeling skin syndrome 172, 340 pepducin 384, 386 peptidase 79, 92f., 97, 104, 107f., 110f., 126, 261, 295, 297, 374, 378, 382 peptide hormone 98, 287, 373, 380 peptide substrate 117, 122, 124, 130, 142, 169 peripheral nervous system 188, 191, 212, 352f. pH 171, 254, 298, 315, 320, 330–333, 335 phage display 98, 100, 106, 117, 122f., 128f., 150–152, 154, 176 phenotype 39, 69, 171f., 282, 297, 302, 304, 338 phosphorylation 262, 280, 285, 386 phylogenetic analysis 21, 79f., 85–88, 90–92, 118 phylogenetic tree 80 phylogeny 80, 82 physiology 16, 145, 149, 187, 196, 227, 281, 311, 314, 337, 340 pituitary 188, 207, 272, 286, 352 plakoglobin 332 plasma kallikrein (KLKB1) 5, 145, 147, 151–154, 162, 258, 276, 278, 284f., 321 plasma membrane 262, 277, 279f. plasmin 123, 166, 218, 256, 258, 261–263, 314, 317, 320f. plasminogen 110, 124, 128f., 131, 166, 252, 256, 263, 314, 350 plasminogen activator inhibitor 1 (PAI-1) 166, 168, 252, 260, 314 platypus 81 pleomorphism 11 polyadenylation 8, 12 polymorphism 13, 31–33, 35f., 38, 50, 282, 339 positional scanning synthetic combinatorial library (PSSCL) 118, 125–131, 150 post-mating inflammatory response 316, 317

Index

potency 144, 145, 148–150, 152–154, 176, 279, 285, 384f., 388 precursors 252–258, 263, 373f., 379, 389 prediction 16, 32, 34f., 131, 192, 218, 222–224 predictors 166, 223 premordial follicles 192 primary tumor 168 prodrug 123 progenitor 82f., 85, 88, 90 progesterone 315, 363 progestin 14 prognosis 13, 168, 187, 218, 222–227, 382 prognosis, favorable 222, 224, 226 prognostic 69, 131, 168, 192, 218, 222–224, 226f., 286 prognostic factor 222, 226 prognostic value 168f., 227 proliferation 161f., 164, 170, 218, 262, 284, 286, 317, 330, 334, 338, 340, 383 promoter 11, 13–16, 18, 36, 83, 164, 277f., 282, 286, 297, 353 propeptide 102, 144, 147 prostacyclin 279 prostate cancer 9, 13, 17, 32, 36, 38f., 69–71, 82, 100, 122f., 125, 127, 131, 151, 154, 164–168, 176, 179, 223f., 277, 380, 382 prostate cancer cells 122, 277, 380 prostate specific antigen (PSA) 5, 13, 36, 38, 69, 82, 90, 100, 123, 165, 166, 179, 223, 252, 301, 312, 322, 382 protease-inhibitor complex 98f., 104, 108, 260 protease inhibitors, serpin-type 254 proteinase-activated receptor 1 (PAR-1) 101, 106, 126, 128f., 164, 262f., 277, 286, 349, 358f., 361, 376, 380–388 proteinase-activated receptor 2 (PAR-2) 126, 128f., 164, 171, 176, 262f., 277, 315, 338–340, 358, 361, 376–383, 385–388 proteinase-activated receptor 3 (PAR-3) 277 proteinase-activated receptor 4 (PAR-4) 128f., 164, 262f., 277, 358, 376, 379f., 382, 386 proteinase-activated receptor (PAR) 164, 166f., 169, 215, 258, 262f., 277, 306, 315, 349, 353, 357–359, 374, 376, 378–389 proteinase-activated receptor signaling 376, 378–380, 384 protein C inhibitor (PCI) 122, 147, 252, 260, 276, 319 protein, intracellular 84, 161, 302

407

protein kinase B (AKT) 358 protein, multi-domain 146 proteolipid protein 363 proteolysis 5, 128, 144, 162, 169, 252, 256, 317–319, 349 proteolytic activity 88, 141, 143f., 147, 162, 164, 252f., 256, 260, 263, 295, 384 proteolytic cascade 104, 128, 147, 167, 203, 217, 313, 321, 333, 379, 389 pseudogene 8f., 83–85, 87, 89f., 93, 304 psoriasis vulgaris 128, 162, 172, 180, 215, 255, 330, 338f., 381 psoriatic lesion 336–338 quantitative reverse transcription PCR (qRT-PCR) 226 rat 5, 7f., 21, 81, 87, 94, 105, 109, 273, 279, 282f., 350, 358f., 373, 385, 387 reactive center loop (RCL) 147, 149f., 176, 276 reactive oxygen species (ROS) 359 receptor 9, 162, 165–167, 211, 252, 256f., 262f., 272, 277, 279f., 315, 349, 356, 358, 362, 374, 379, 384, 389 region, linker 261, 262 region, untranslated 11, 13, 18, 21, 33, 36, 274 regulation of vessel tone and permeability 207 remodeling 35, 93, 110, 125, 161f., 165f., 196, 286, 288, 316 renal 187, 207, 226, 272, 274, 281f., 286 renal cancer 226 renal cell carcinoma (RCC) 227, 274 repeat element 11 reproductive system 196, 223, 315–318 residual tumor 168 resistance 146, 279, 281 respiratory tract 207, 284 reverse transcription polymerase chain reaction (RT-PCR) 130, 283, 336 rhesus macaque 70, 84 RNA 192, 223, 350–352, 360f., 363 rodent 5f., 8, 21, 90, 93, 177, 352, 358, 361, 378, 380, 385f. rosacea 172, 215, 339f., 381 saliva 187, 276 salivary gland 128, 130, 198, 202, 225, 271f., 300f. sauropsids 92, 94

408

Index

Schaffer collateral 356 screening 82, 118, 151f., 253, 384 secretion 170, 262, 272, 311, 318, 338, 357, 361 secretory calcium-binding phosphoprotein 304 secretory leukocyte protease inhibitor (SLPI) 124, 337 seizure 361 selectivity 128, 132, 141f., 148–153, 174, 176, 320, 377, 384, 388 semen 100, 141, 162, 254, 311–321 semen liquefaction 100, 141, 162, 313f., 317f. semenogelin 93, 100f., 122, 131, 313f., 320 seminal fluid 123, 125, 261 seminal plasma 88, 90, 93, 124, 131, 165, 167, 187, 301, 311f., 315–318, 320, 322 seminal vesicle 93, 196, 311, 313, 318f. seminomas 224 sensitivity 187, 255, 281, 282 Ser189 residue 100, 124 Ser195 residue 105, 107, 109, 142, 147, 253 serine 99, 101, 105, 122–130, 253, 274 serine protease inhibitor of Kazal-type 5 (SPINK5) 146, 170f., 179, 217, 335, 337, 339f. serine protease inhibitor of Kazal-type 6 (SPINK6) 146, 148, 179, 336 serine protease inhibitor of Kazal-type 9 (SPINK9) 146, 336 serpin 98, 122, 147, 149f., 174–176, 252, 260, 276, 319, 334 serpinB6 148 Siglecs (sialic acid-binding immunoglobulin superfamily lectins) 9, 79 signaling, biased 376, 378 signaling pathway 14, 117, 167, 312, 315, 317, 322, 377 signal peptide 274, 338 signal transduction 166, 262 similarity 8, 21, 82, 85, 87f., 90f., 142 single nucleotide polymorphism (SNP) 13, 31f., 34–36, 38f., 50, 69–71, 171, 173 skeletomuscular system 211 skin barrier 171, 180, 329, 331 skin-derived antileukoprotease (SKALP) 337 skin desquamation 126–128, 141, 169–171, 217, 225, 255 skin disease 104, 108, 127, 151, 164, 169f., 172–174, 180, 187, 340 small cell lung carcinoma (SCLC) 286

smooth muscle 211, 262, 271, 279, 373 soybean trypsin inhibitor (SBTI) 146 sparse matrix library 152 specificity 93f., 97–101, 104, 106, 108, 110, 117f., 121, 123f., 126f., 129–131, 176, 276, 279, 295, 297, 299, 335 specificity constant (kcat/Km) 122–131 sperm 311f., 314–318, 320, 322 spinal cord 130, 188, 350–352, 358, 360 splice site 8, 12, 18, 21, 338 splice variant 18, 21, 226, 274, 353 splicing 17f., 21, 34, 36 squamous cell carcinoma (SqCC) 225 squamous epithelium 196, 198, 331 steroid hormone 15, 88, 350 stomach 130, 198, 218, 224 stratum basale 169f. stratum corneum and the stratum granulosum 203 stratum corneum (SC) 104, 126f., 129, 147, 169–172, 180, 203, 330–332, 334, 336, 338–340 stratum spinosum 169f., 203 stroke 359 stroma 165, 192 stromal cells 226, 382 subcutis 329 submandibular salivary gland 300 submucosal gland 198, 207 subsite 97f., 100f., 103–106, 108–110, 142, 144 substitution 34f., 150, 152 substrate, fluorogenic 101, 122f., 127, 254, 321 substrate, peptide 117, 122, 124, 130, 142, 169 substrate, potential 98, 110f., 118, 126, 130, 187 substrate specificity 5, 117f., 122–124, 128, 130f., 152, 259, 312f. substrate, synthetic 117, 121, 127f., 276 subunits 111, 146 sunflower trypsin inhibitor (SFTI) 147, 149, 152 supranuclear 202 surface loop 97f. surgery 168 survival 50, 165f., 225f., 256, 261, 311, 317, 360, 363, 381, 386 – disease-free survival 125, 127, 131, 167, 222 – overall survival 167f., 222f., 225f. sweat 187, 203, 217, 261, 331, 336, 339 synapse 173, 356, 361 synaptic plasticity 353, 356f.

Index

synaptic rearrangement 357, 361 synthesis 90, 272, 276, 279, 281, 384 tandem duplication 81, 83, 93 tandem repeat 85 TATA box 8, 14 temporal lobe 215, 361 teratomas 224 testicular cancer 13, 128, 224 testicular germ cell tumors 224 testis 13, 122, 128, 130, 196, 300 tethered ligand (TL) 262f., 277, 376f., 386f. therapeutic target 162, 170, 277, 363, 381–383 therapy 123, 168, 172, 217f., 227, 349 therapy, endocrine 222 therapy response prediction 227 threshold 36, 38, 82 thrombin 101, 105, 152, 162, 179, 218, 258, 263, 277, 284f., 313, 373, 376, 380, 382, 384, 386, 388f. thrombostasis 320f., 349, 359, 363 thyroid gland 122, 131, 207f. Tigger2 repeat element 11 tissue extract 215 tissue factor 258, 313 tissue injury 258, 283, 359 tissue-type plasminogen activator (tPA) 130, 256f., 314, 319 T-lymphocyte 172, 338, 357, 362f., 381 trachea 130, 207, 272 transcript 9, 11, 15, 18, 21, 84, 122, 165, 191, 274, 301, 335, 338, 350, 353 transcriptional control 143 transcription start site (TSS) 15 transforming growth factor 287, 316–318 transgenic 16, 166, 283 translocation 279 trauma 329, 359f. trypsin 92, 97f., 102, 105f., 109, 111, 121, 126, 129, 131f., 142, 144, 253–255, 258f., 261, 263, 271, 274, 277, 336, 373, 376, 378, 380, 382, 385f., 388 trypsin-like 21, 36, 94, 118, 122, 124f., 128–131, 142, 187, 252f., 256f., 313, 338–340, 359, 378

409

tumor growth 166, 176, 262, 385 tumorigenesis 123, 126, 286, 379f., 382 tumor invasion 166 tumor microenvironment 162, 165, 168, 382 tumor progression 165, 167 tumor suppressor 17, 278 ulcerative colitis 217, 387 untranslated region 11f., 18, 33, 339, 353 urethra 196, 311, 318 urethral glands 311 urinary system 207, 226 urine 5, 121, 207, 257, 271, 276, 373 urokinase-type plasminogen activator receptor (uPAR) 101, 126, 166, 261–263 urokinase-type plasminogen activator (uPA) 124, 126, 152, 166, 168, 218, 252, 256f., 260–262, 314, 319, 321 urothelial 207, 227 uterine serous papillary cancer 223 variants 13f., 18, 31, 38f., 50, 69f., 98, 152, 336, 353 vascular dementia 173 vascular endothelial growth factor (VEGF) 166, 286 vascular endothelium 211, 286, 362 vascular permeability 258, 283, 285, 360, 362 vascular relaxation 164, 380 vesicles 93, 272, 280, 311, 313, 318 vitamin D response element 15 vitronectin 129, 166, 262, 356 water 102, 105, 109, 329, 331, 333 WFDC4, secretory leukocyte protease inhibitor (SLPI) 337 WFDC14, elafin 337f. xenograft 166, 171, 176 zinc 97, 100, 102–105, 108–111, 149, 174, 258, 311, 319f., 333, 388 zona pellucida 315 zymogen 97, 107f., 127, 130, 252, 255–257, 259f., 306, 321, 333, 380