Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease [1 ed.] 9781619428126, 9781619428065

Citation preview

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved. Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved. Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

CELL BIOLOGY RESEARCH PROGRESS

GRANULOCYTES

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

PRODUCTION, TYPES AND ROLES IN DISEASE

No part of this digital document may be reproduced, stored in a retrieval system or transmitted in any form or by any means. The publisher has taken reasonable care in the preparation of this digital document, but makes no expressed or implied warranty of any kind and assumes no responsibility for any errors or omissions. No liability is assumed for incidental or consequential damages in connection with or arising out of information contained herein. This digital document is sold with the clear understanding that the publisher is not engaged in rendering legal, medical or any other professional services. Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

CELL BIOLOGY RESEARCH PROGRESS Additional books in this series can be found on Nova‟s website under the Series tab. Additional E-books in this series can be found on Nova‟s website under the E-book tab.

MICROBIOLOGY RESEARCH ADVANCES

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Additional books in this series can be found on Nova‟s website under the Series tab. Additional E-books in this series can be found on Nova‟s website under the E-book tab.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

CELL BIOLOGY RESEARCH PROGRESS

GRANULOCYTES

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

PRODUCTION, TYPES AND ROLES IN DISEASE

HISAO ABUKARA AND

MICHI JUMONJI EDITORS

Nova Science Publishers, Inc. New York

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012 by Nova Science Publishers, Inc. All rights reserved. No part of this book may be reproduced, stored in a retrieval system or transmitted in any form or by any means: electronic, electrostatic, magnetic, tape, mechanical photocopying, recording or otherwise without the written permission of the Publisher. For permission to use material from this book please contact us: Telephone 631-231-7269; Fax 631-231-8175 Web Site: http://www.novapublishers.com

NOTICE TO THE READER The Publisher has taken reasonable care in the preparation of this book, but makes no expressed or implied warranty of any kind and assumes no responsibility for any errors or omissions. No liability is assumed for incidental or consequential damages in connection with or arising out of information contained in this book. The Publisher shall not be liable for any special, consequential, or exemplary damages resulting, in whole or in part, from the readers‟ use of, or reliance upon, this material. Any parts of this book based on government reports are so indicated and copyright is claimed for those parts to the extent applicable to compilations of such works.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Independent verification should be sought for any data, advice or recommendations contained in this book. In addition, no responsibility is assumed by the publisher for any injury and/or damage to persons or property arising from any methods, products, instructions, ideas or otherwise contained in this publication. This publication is designed to provide accurate and authoritative information with regard to the subject matter covered herein. It is sold with the clear understanding that the Publisher is not engaged in rendering legal or any other professional services. If legal or any other expert assistance is required, the services of a competent person should be sought. FROM A DECLARATION OF PARTICIPANTS JOINTLY ADOPTED BY A COMMITTEE OF THE AMERICAN BAR ASSOCIATION AND A COMMITTEE OF PUBLISHERS. Additional color graphics may be available in the e-book version of this book.

Library of Congress Cataloging-in-Publication Data Granulocytes : production, types, and roles in disease / editors: Hisao Abukara and Michi Jumonji. p. cm. Includes index. ISBN 978-1-61942-812-6 (eBook) 1. Granulocytes. 2. Granulocytes--Diseases. I. Abukara, Hisao. II. Jumonji, Michi. QR185.8.G73G736 2011 616.07'99--dc23

Published by Nova Science Publishers, Inc. † New York

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

CONTENTS Preface Chapter 1

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Chapter 2

Chapter 3

Chapter 4

Chapter 5

vii Regulation of Granulocyte Differentiation by Micro-rna and Transcription Factors – Lessons Learned for Understanding Hematopoietic Diseases Alexander Brobeil The Essential Transcription Factor for Granulocytic Differentiation, Ccaat/Enhancer Binding Protein Alpha (C/Ebpα), and its Mutations or Inhibition Associated with Acute Myeloid Leukemias Ota Fuchs Chemotactic Assay of Human Neutrophils and Eosinophils Hyung-Ran Kim and Ju-Young Seoh Surface Expression of the Early Activation Marker (CD 69) and Degranulation of Eosinophils Can Be Disconnected János Fent and Susan Lakatos Basophilic Granulocytes Toshihisa Tsuruta and Kenzaburo Tani

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

1

33

69

91 101

vi Chapter 6

Contents Role of Granulocytes on the Onset of TissueDestructive Diseases when Exposed to Stress Toru Abo, Toshihiko Kawamura, Mayumi Watanabe, Hiroki Kawamura and Yasuhiro Kanda

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Index

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

119

133

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

PREFACE This book examines the latest research developments in the study of the production, types and roles in disease of granulocytes. Topics include the regulation of granulocyte differentiation by microRNA and transcription factors; chemotactic assay of human neutrophils and eosinophils; basophilic granulocytes; and the role of granulocytes on the onset of tissue-destructive diseases. Chapter 1 - Basic host defense relies on the normal function and release of granulocytes from the bone marrow. The steady state and the “emergency” granulopoiesis are regulated by a variety of chemical and physical mechanisms, e.g. cell-cell interactions or distinct factors, namely granulocyte colony stimulating factor and granulomonocyte colony stimulating factor, respectively. Ligand binding activates the corresponding receptor resulting in the activation of various signaling pathways, e.g. Janus kinase/Signal transducer and activator of transcription pathway, the mitogen activated protein kinase pathway, etc. Since the last decade dozens of new signal molecules were identified to contribute to granulocytic differentiation. Interestingly, the new signal molecules play important roles in hematopoietic malignancies. For example microRNAs (miR) are essential for normal granulopoiesis, but are also able to induce leukemia. miRs are small noncoding RNAs, which function in gene regulation. Both miR-223 and miR-34a are known to regulate granulopoieis. The interplay between miRs and transcription factors contributes to myeloid differentiation and is a main mechanism which helps to understand diseases. The actual review will summarize the state of the art of normal and ermegency granulopoiesis regulated by microRNA and associated transcription factors and will extend the data to pathomechanisms of common hematopoietic malignancies.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

viii

Hisao Abukara and Michi Jumonji

Chapter 2 - The multistep development of blood cells from hematopoietic stem cells (HSCs) is regulated by cytokines and cell-cell interactions. Transcription factors also play an important role in HSCs and not only in lineage restricted precursors. C/EBPα represses self-renewal of adult HSCs through an as yet unknown mechanism. C/EBPα is one of the major regulators in granulopoiesis, where it regulates differentiation during the transition from the common myeloid progenitor to the granulocyte-macrophage progenitor. C/EBPα induces myeloid differentiation via up-regulation of specific genes involved in granulocytic maturation and in inhibition of myeloid cell proliferation. Early markers of granulopoiesis induced by C/EBPα include granulocyte-colony stimulating factor (G-CSF), CD33 and CD13 surface markers, myeloperoxidase (MPO), neutrophil elastase, myeloblastin, and lysozyme. Later markers of neutrophil development, such as lactoferrin and neutrophil gelatinase are also induced by C/EBPα. C/EBPα rapidly induces expression of further two transcription factors functioning in granulocyte differentiation, C/EBPε and PU.1/Spi1. CEBPA gene knockout in mice caused a selective block in neutrophil differentiation at the myeloblast level, whereas other blood cells develop normally. CEBPA is intronless and generates two isoforms, CEBPα p30 (30 kDa) and p42 (42 kDa), as a result of the differential utilization of alternate translation start codons. It has been demonstrated that C/EBPα p30 not only inhibits DNA binding of CEBPα p42 and its transactivation function in the expression of key granulocytic target genes but also binds to the promoters of another target genes and alters their expression. Phosphorylation and sumoylation of C/EBPα are important posttranslational modifications which cause changes in function of this protein. Dominantnegative, loss of function mutations in CEBPA have been identified in acute myeloid leukemia (AML) as either monoallelic or biallelic mutations. Biallelic disruption of the N- and C- terminus of C/EBPα in AML patients with a normal karyotype confer favorable prognosis when Fms-like tyrosine kinase 3 (FLT3) is not mutated. Patients with CEBPA mutations had a 60% reduction of the risk for failure to achieve complete remission, relapse or death. Fusion proteins that are associated with chromosome translocations t(8;21), inv (16) or t(15;17) repress CEBPA expression by transcriptional or posttranscriptional regulation. CEBPA expression can be silenced also by CEBPA promoter hypermethylation or overexpression of TRIB2 or TRIB1 (Tribbles homologs). Trib1 and Trib2, but not Trib3 function as adaptors to recruit E3 ubiquitin ligase and to enhance ubiquitylation of C/EBPα to promote its degradation. CEBPA promoter methylation testing is probable as important as CEBPA

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Preface

ix

mutation testing for identifying AML cases with CEBPA dysregulation and has a prognostic significance. Chapter 3 - Chemotaxis is critical to the ordinary function of neutrophils and eosinophils, enabling their optimal tissue distribution. A variety of signals induce chemotactic response of neutrophils and/or eosinophils, and systematic chemotaxis study is fundamental to the understanding of their tissue distribution at physiological as well as pathological conditions. Meanwhile, the lifespan of the granulocytes is very short in vitro, and it is demanding to get sufficient number of human eosinophils for chemotactic assay. Therefore, granulocytic cell lines are useful alternatives for the chemotactic assay. HL-60 is a human promyelocytic cell line that can be induced to differentiate into neutrophils by stimulation with dimethylformamide (DMF), dimethylsulfoxide or all-trans-retinoic acid. Time-lapse video microscopic assay as well as transwell assay revealed that undifferentiated HL-60 cells did not show chemotactic response to CCL3, CCL5, CXCL-8 or CXCL-12. The chemokines slightly increased chemokinesis, but did not induce directional migration. By contrast, differentiated HL-60 cells stimulated with 0.8% DMF for 4 days showed chemotactic response to CCL3, CCL5, CXCL-8 or CXCL12, with a speed of 140 ~ 180 nm/sec, which is about one third or half of those of human peripheral blood neutrophils. Differentiated HL-60 cells showed vigorous chemokinesis even without any chemotactic stimulation, resulting in a substantial spontaneous migration in transwell assay that may hide the genuine chemotactic response to certain chemotactic stimuli. EoL-1 is a human leukemia cell line that can be differentiated into eosinophils by stimulation with dibutyryl cyclic AMP. Undifferentiated EoL-1 cells did not show chemotactic response to CCL11. By contrast, differentiated EoL-1 cells stimulated with dibutyryl cyclic AMP and subsequently pulsed with IFN-gamma, IL-3 and GM-CSF expressed chemokine receptors CCR7, CCR9 and CCR3, and developed chemotactic responsiveness to CCL21, CCL25 and CCL11, which bind to the respective receptors. Human PB eosinophils also showed chemotactic responsiveness to CCL21 and CCL25 upon stimulation with IFN-gamma, IL-3 and GM-CSF. In addition, the cytokine-stimulated dEoL-1 cells expressed costimulatory molecules, including CD40, CD80, CD86 and HLA-DR, and also expressed a tolerogenic and Th2-polarizing enzyme, indoleamine 2,3-dioxygenase. These in vitro observations raise the possibility that eosinophils may utilize lymphoid chemokines to enter lymph nodes (LNs) and serve antigen-presenting functions in the LN under certain inflammatory conditions.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

x

Hisao Abukara and Michi Jumonji

Taken together, differentiated HL-60 and EoL-1 cells are useful tools for the chemotactic study of human neutrophils and eosinophils. Chapter 4 – Background: The activation of eosinophils is inevitable in certain immunological reactions and it is a multi-step complex process. Any intervention into this process may provide a tool to regulate the eosinophilic inflammation. Methods: Eosinophils in the peripheral blood samples of healthy donors were activated in vitro with IL-5. The surface expression of the early activation marker (CD 69) and the intracellular major basic protein contents as marker of degranulation of eosinophils were measured by flow cytometry. In some cases stimulation was carried out concomitant with the inhibition of intracellular protein transport, or in the presence of various protease inhibitors or inhibitors of protein synthesis. Results: The time dependence of CD 69 expression upon activation of the eosinophils can be described by a sigmoid-like curve which has an inflexion point around 120-150 min. This process can be impeded by cycloheximide (a protein synthesis inhibitor), or by GolgiStop (Monensin A, the intracellular protein transport inhibitor), or by a specific serine protease inhibitor (4-(2Aminoethyl) benzenesulfonyl fluoride hydrochloride, AEBSF, Pefabloc SC), in a concentration dependent manner (Kd for AEBSF is about 65 µM). The intracellular MBP content of eosinophils is 77 ± 20%, 28 ± 17% and 31 ± 11% in the presence of IL-5, or AEBSF or AEBSF and IL-5, respectively. Conclusion: To attain a substantial increase in the expression of the early activation marker (CD 69) on the surface of the activated eosinophils de novo protein synthesis and intracellular protein transport are indispensable. CD 69 expression is regulated by an AEBSF inhibitable process. However, inhibition of CD 69 surface expression by AEBSF does not result in inhibition of degranulation of eosinophils. The fact that degranulation and CD 69 expression could be disconnected raises the possibility of the intervention into the regulation of the eosinophilic inflammation. Chapter 5 - Basophilic granulocytes (basophils) are a very small population of peripheral blood leukocytes. Because basophils have highaffinity immunoglobulin E receptors (FcRI) and secrete chemical mediators that contain histamine, they are thought to be very similar to mast cells. However, research characterizing the function of basophils was slow to proceed and their unique function and importance were not established for a significant period of time. Recently, a series of studies have characterized the role of basophils in anaphylactic shock, chronic allergic reactions, and other human immunological reactions. These studies have shown that basophils are

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Preface

xi

not a supplementary cell type but key players in very serious immune reactions. In this chapter the authors introduce the recently discovered characteristics of basophils. In addition, the authors consider how these aspects are clinically important and are connected with new cellular or molecular treatments for allergic reactions. Chapter 6 - Acute stress induces generally adrenergic stimulation and secretion of glucocorticoids and results in hypothermia and hyperglycemia. If those stress-induced conditions are continued for a long time, we fall victims into various diseases such as general fatigue, diabetes mellitus, mental disorders, etc. In some cases, acute or chronic stress is also related to the onset of tissue-destructive diseases, including periodontitis, sudden difficulty of hearing, gastric ulcer, ulcerative colitis, pancreatitis, hemorrhoids, etc. At that time, we have to consider the role of granulocytes which bear adrenergic receptors on the cell surface. Indeed, acute and chronic stresses have a potential to induce granulocytosis in the circulation and specific sites of the tissues. Granulocytes are important for the defense against bacterial infections. However, the excess number of granulocytes often induces tissue damage due to their secretion of superoxides. In addition to the cases of disease, some physiological phenomena are also responsible for the stress-induced granulocytosis (e.g., neonatal granulocytosis). The commencement of pulmonary respiration acts as oxygen stress in neonates and then induces neonatal granulocytosis. This granulocytosis is associated with subsequent destruction of fetal hematopoiesis in the liver and physiological jaundice. The authors will review the role of granulocytes associated with various diseases and some physiological responses.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved. Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

In: Granulocytes Editors: H. Abukara and M. Jumonji

ISBN: 978-1-61942-806-5 © 2012 Nova Science Publishers, Inc

Chapter 1

REGULATION OF GRANULOCYTE DIFFERENTIATION BY MICRO-RNA AND TRANSCRIPTION FACTORS – LESSONS LEARNED FOR UNDERSTANDING HEMATOPOIETIC DISEASES Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Alexander Brobeil* Institute of Anatomy and Cell Biology, Justus-Liebig-University, 35392 Giessen, Germany

ABSTRACT Basic host defense relies on the normal function and release of granulocytes from the bone marrow. The steady state and the “emergency” granulopoiesis are regulated by a variety of chemical and physical mechanisms, e.g. cell-cell interactions or distinct factors, namely granulocyte colony stimulating factor and granulomonocyte colony stimulating factor, respectively. Ligand binding activates the corresponding receptor resulting in the activation of various signaling pathways, e.g. Janus kinase/Signal transducer and activator of transcription pathway, the mitogen activated protein kinase pathway, etc. *

Corresponding author: Alexander Brobeil; Institute of Anatomy and Cell Biology; JustusLiebig-University; 35392 Giessen; Germany; Phone: +49.641.9947012; Fax: +49.641.9947009; [email protected]

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

2

Alexander Brobeil Since the last decade dozens of new signal molecules were identified to contribute to granulocytic differentiation. Interestingly, the new signal molecules play important roles in hematopoietic malignancies. For example microRNAs (miR) are essential for normal granulopoiesis, but are also able to induce leukemia. miRs are small non-coding RNAs, which function in gene regulation. Both miR-223 and miR-34a are known to regulate granulopoieis. The interplay between miRs and transcription factors contributes to myeloid differentiation and is a main mechanism which helps to understand diseases. The actual review will summarize the state of the art of normal and ermegency granulopoiesis regulated by microRNA and associated transcription factors and will extend the data to pathomechanisms of common hematopoietic malignancies.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

INTRODUCTION In 1993 two working groups - Lee et al. (1993) and Wightman et al. (1993) - discovered a new family of regulatory molecules in the Caenorhabditis elegans (C. elegans). C. elegans is the most studied model organism due to the fact of having 4 larval stages during development of the worm in which gene regulation is a pivotal mechanism to correctly express the specific proteins for each differentiation stage (Zhang et al. 2011; Ambros 1989). The knowledge of a regulatory gene, namely lin-4, was the basis for the analysis of mutations. Mutations of the lin-4 gene are accompanied by dysregulation of the developmental checkpoints passing from larval stadium I to larval stadium II (Ambros 1989). Lin-4 was first thought to be a regulatory protein with high impact on developmental control of C. elegans. Yet, the gene product of the lin-4 gene was identified as two small non-coding RNA strands (Lee et al. 1993; Wightman et al. 1993). The smaller one consist of about 22nts and the larger one of about 61nts. Noteworthy, the small RNA molecules lin-4 was identified to have a complementary nucleotide sequence to lin-14, an actual regulatory protein of C. elegans development (Lee et al. 1993; Wightman et al. 1993). The interaction takes place with the 3‟-UTR of the lin14 mRNA. The 3‟-UTR is known to be a regulatory site for protein translation (Lee et al. 1993; Wightman et al. 1993). Subsequent analyses of the interplay between lin-4 and the 3‟-UTR of the lin-14 mRNA revealed a mechanism for the regulation of lin-14 protein expression on translational level. mRNA levels of lin-14 were not compromised (Bartel 2004). Thus, the findings support a regulatory mechanism for the small RNA molecule lin-4 on lin-14 protein expression levels. Since the first description of such small RNA regulatory

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Regulation of Granulocyte Differentiation …

3

molecules, seven years passed till the identification of another tiny regulatory RNA molecule. Strikingly, in these seven years no homologues were found in other organisms. In nematodes the lin-4 RNA was the unique regulatory RNA which could be identified (Bartel 2004). In the year 2000 another gene of C. elegans came into the center of attention, namely let-7. This gene also codes for a non-coding small RNA with regulatory function. Let-7 is temporarily expressed in C. elegans. It interacts with mRNAs of two further regulatory proteins of C. elegans development. Here, let-7 also suppresses the translation of lin-41 and hbl1 (lin-57) without interfering mRNA levels (Reinhard et al. 2000; Lin et al. 2003; Abrahante et al. 2009). Both proteins control the late larval stages of the C. elegans (Abrahante et al. 2009). Since by then a common nomenclature for these new molecules was missing, they were called small temporal RNA (stRNA). This description based on the control of the developmental timing, namely the transition between various differentiation stages (Pasquinelli et al. 2000). Additional genomic analyses found let-7 to be present in various species, e.g. flies and human. The discovery of such regulatory molecules in human broadened the knowledge of gene regulation. Let-7 was the first tiny RNA that was found to be highly evolutionary conserved. This was the inducement to search the human genome for further small RNAs that adopt the mechanism of gene regulation (Bartel 2004). In the following year many laboratories cloned new stRNA in nematodes, flies and human. All cloned RNA exhibit a length of approximately 22nts. Remarkably, the new cloned small RNAs were not exclusively linked to timed differentiation processes, but to the general function of regulated gene expression. This applied to all newly identified tiny RNA strands meeting the criteria of the new RNA family. Thus, the group was named microRNA reflecting the tiny character of the new molecules (Bartel 2004). Gene regulation is important for all differentiation processes leading to specialized cells. Human stem cells can differentiate into manifold terminally differentiated cells with specific features maintaining homeostasis of the tissues. Terminal differentiation needs various transcription factors, which control developmental protein expression (Wiedemann 2009). The small noncoding RNA regulated the interplay of different transcription factors. Small non-coding RNAs were named as microRNA (miR or miRNA) by LagosQuintana et al. (2001). Up to now miRNA are known to regulate a number of cellular processes in different tissues of different species. miRNAs comprise control of cell proliferation, apoptosis and fat metabolism in flies, neuronal patterning in nematodes and the modulation of hematopoietic lineage differentiation in mammals (Bartel 2004). The hematopoietic tissue depends

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

4

Alexander Brobeil

on a strict control of protein expression to differentiate into erythroid, megakaryoid, myeloid and lymphoid lineages. These differentiation processes consist of a variety of regulatory mechanisms, e.g. signaling through multiple receptor tyrosine kinases, signaling nodes, gene regulation by transcription factors and the aforementioned microRNAs (Ward et al. 2000; Chen et al. 2004). The matured granulocytes are part of the first line in basic host defense. Neutrophil granulocyte cell number is up-regulated, when host infection is signalized by distinct cytokines activating the cellular response to these stimuli (Panopoulos and Watowich 2008). In the majority of cases interfering the regulatory mechanisms of normal myelopoiesis leads to an unregulated proliferation and an arrest in differentiation. These two processes are hallmarks of different cancers of the myeloid linage. The myelodysplastic syndrome inherits both processes and can be seen as a pre-stage of acute myeloid leukemia (Warlick and Smith 2007). Hypercellular bone marrow, peripheral cytopenia and trilineage dysplasia are hallmarks of the myelodysplastic syndrome (Mhawech and Saleem 2001). In contrast, acute myeloid leukemia results in a complete insufficient production of matured neutrophil granulocytes and accumulation of non-functional blasts. Blast cells proliferate in the bone marrow and replace the normal hematopoiesis (Estey and Döhner 2006). This disease is linked to manifold changes in cellular signaling and gene regulation (Estey and Döhner 2006). In contrast, chronic myeloid leukemia is characterized by the presence of the BCR-Abl fusion gene and its translated protein product. BCR-Abl is continuously expressed and activated tyrosine kinases lead to the phosphorylation of key signaling molecules contributing to myeloid cell fate development. This gives rise to high amounts of myeloid precursor cells and matured but impaired granulocytes (Hazlehurst et al. 2009). Strikingly, normal miRNA expression is restricted to different developmental stages and tissue types. Malignant transformation also changes the miR expression pattern (Lu et al. 2005). The present review summarizes the actual knowledge about miR biology and function, about transcription factors contributing to granulopoiesis and combines both fields giving insights in the complex regulation of granulocyte differentiation and function. Subsequently, the data are linked to diseases of the myeloid cell line, like myelodysplastic syndrome and myeloid leukemia.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Regulation of Granulocyte Differentiation …

5

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

BIOSYNTHESIS AND REGULATION OF MICRO-RNA IN MAMMALIAN CELLS miR are single stranded RNA molecules with a specific length of ~19-25 nucleotides (nts) (Kim 2005). Gene loci of miRNA are focused on specific intergenic regions of the genome or interspersed in the normal intron-exon structure of a subset of genes. Here, the preferred insertion of the miR sequence is the intronic region (Lin et al. 2006). Both types, the miR coded by the exons and those coded by the introns, are transcribed by the RNA polymerase II. This is in contrast to the normal production of small RNA molecules, e.g. tRNA and U6 snRNA, a component of the spliceosome (Brow and Guthrie 1988). These are transcribed by the RNA polymerase III (Lee et al. 2004). miRNA transcripts are polyadenylated and spliced (Tam 2001; Aukermann and Sakai 2009). These processing procedures are characteristic for class II genes, encompassing all protein coding genes of the genome. According to the maturation of mRNAs, miRNAs are expressed as a precursor double stranded molecule, namely primary microRNA (pri-miRNA) (Kim 2005). The primary transcript folds into an imperfect dsRNA hairpin, which is subsequently processed in the nucleus. The pri-miRNA is processed by a class III RNase called Drosha. For the correct function of Drosha a dsRNA binding domain containing protein is needed. The DiGeorge syndrome critical region gene 8 (DGCR8) acts as a partner for Drosha in mammals (Filipowicz et al. 2008). Subsequently, the Drosha/DGCR8 complex (or microprocessor complex) processes the pri-miRNA to the ~70nts spanning pre-miRNA with 2nucleotide-long 3‟ overlap, also folded as a hairpin (He and Hannon 2004). Recognition of pri-miRNA by Drosha is not exclusively sequence dependent, rather than driven by the specific structure of the pri-miRNA hairpin. For optimal cleavage a terminal loop with more than 10nts and an imperfect RNA stem that is ~30nts in length is required. Pri-miRNA containing larger or shorter stems are not effectively recognized by Drosha (Zeng et al. 2005). The sequence flanking the cleavage sites also contributes to Drosha processing, as revealed by experiments mutating such sites (He and Hannon 2004). Drosha encompasses two RNase class III domains, which catalyze the cleavage. The two RNase domains interact with each other and form an intramolecular dimer. One domain cleaves the 5‟ end and the other the 3‟ end with a mismatch of 2nts at the 5‟end (Kim et al. 2009). There is some evidence that the pri-miRNA processing is executed while the corresponding genes are

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

6

Alexander Brobeil

transcribed (Morlando et al. 2008). Cropping by Drosha was shown to be regulated through proteins binding to Drosha (Slezak-Prochazka et al. 2010). The DEAD-box RNA helicases p68 and p72, as well as the nuclear factors (NF) NF90 and NF45 are part of the microprocessor complex (Gregory et al. 2004). Formation of complexes of these molecules results in an enhanced or reduced pre-miRNA production. Yet, other proteins forming complexes either with p68, p72 or ND90, NF45 are also able to alter the pre-miRNA output with specific preference to subsets of pri-miRNAs (Fukuda et al. 2007; Davis et al. 2008; Sakamoto et al. 2009; Suzuki et al. 2009; Yamagata et al. 2009). Interaction of p68 with SMAD and consecutive interaction with Drosha results in an enhancement of pri-miRNA-21 processing (Davis et al. 2008). Moreover, p68 was found to interact with wild-type p53 also enhancing the pri-miRNA processing of miR-16-1, miR-143 and miR-145. Strikingly, mutant p53, as expressed in many cancer types, negatively regulates primiRNA processing (Suzuki et al. 2009). NF90 and NF45 revealed a higher binding affinity to pri-let7a-1 in comparison to DGCR8. This mechanism of higher binding affinity is suggested to interfere with the accessibility of substrates for the microprocessor complex (Sakamoto et al. 2009). Additionally, all of these aforementioned regulatory mechanisms are under the influence of cell signalling pathways. The interaction of p68 with SMAD is induced by transforming growth factor β and bone morphogenetic proteins (Davis et al. 2008). The estrogen receptor alpha also alters pri-miRNA expression by its interaction with the p68/p72 complex (Yamagata et al. 2009). Apart from this main processing pathway for pri-miRNA by Drosha, there is a small group of miRNA-like RNAs in mammals (Berezikov et al. 2007; Ruby et al. 2007). Special region encoding for tiny RNA molecules bypassing Drosha and acting as miRNAs are called mirtrons. The short hairpin introns use splicing instead of Drosha cleaving (Berezikov et al. 2007; Ruby et al. 2007). The next step of pre-miRNA processing is located in the cytoplasm (Kim 2005). Therefore, the pre-miRNA has to be exported from the nucleus. Exportin 5, a member of the nuclear transport receptor family, is responsible for the translocation of the pre-miRNA. Exportin 5 was first described to translocate tRNA into the cytoplasm, mainly when the basic transporter, exportin-t, is depleted or overloaded (Bohnsack et al. 2002). Yet, the main function of exportin 5 is to transport pre-miRNA into the cytoplasm in a RanGTP-dependent manor (Bohnsack et al. 2004). Both RanGTP and exportin 5 depletion results in a decreased pre-miRNA and matured miRNA level in the cytoplasm (Yi et al. 2003; Bohnsack et al. 2004). Interestingly, no

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Regulation of Granulocyte Differentiation …

7

accumulation of the pre-miRNA in the nucleus was detected. Thus, this indicates that pre-miRNA might be instable and degrade in the nucleus, if not stabilized by exportin 5 (Yi et al. 2003). The translocated pre-miRNA is processed in the cytoplasm by another protein containing two RNase class III domains. This endonuclease named Dicer is a highly conserved protein and was first described to be the main protein in the production of exogenous applied small interfering RNAs (siRNA). Dicer encompasses different domains acting in miRNA processing: a helicase domain, a Piwi-Argonaute-Zwille (PAZ) domain, two tandem RNaseIII domains and a dsRNA-binding domain (dsRBD). Moreover, Dicer contains a domain with unknown function, called domain of unknown function 283 (DUF283). The domains contribute to processing miRNA. Remarkably, the helicase domain is required for processing siRNA, but not for miRNA. For cleaving dsRNA, small RNAs with either blunt or 5‟ overlapping ends the helicase domain is essential (Welker et al. 2011). In contrast, the PAZ domain is required for normal dicer function and proper cleavage. Deleting the Paz domain in Giardia intestinalis dicer, its products vary in their length, suggesting that mutant Dicer cleaves at random positions (MacRae et al. 2007). So, binding to the PAZ domain determines product length of the matured miRNA depending on the helical-end. Measuring the length of the intended product strictly takes place at the 3‟ end of the pre-miRNA. Elongation of the 5‟end results in longer non-canonical sizes of miRNA (MacRae et al. 2007). Analogous to the cleavage mediated by Drosha, Dicer encompasses two RNase class III domains forming an intramolecular dimer and cleaving the pre-miRNA with 2-nucleotide-long 3‟ overlap to the double stranded miRNA (Zhang et al. 2004). Noteworthy, the cleavage depends on the ionic interactions, as Mg2+ is required for cleaving and high concentration of KCl inactivates Dicer, but does not disturb dsRNA binding (Provost et al. 2002). Additionally, the dsRBD is able to bind dsRNA and interfere with the cleavage of the dsRNA (Provost et al. 2002). As known for Drosha, Dicer is also regulated by distinct protein interactions. The complex consists of the Tar RNA binding protein (TRBP), the protein activator of PKR (PACT) and members of the Argonaute (Ago) protein family, mainly Ago2 (Chendrimada et al. 2005; Haase et al. 2005; Lee et al. 2006). TRBP is under the influence of the mitogen activated protein kinase (MAPK) pathway by phosphorylation (Paroo et al. 2009). Phosphorylation of TRBP results in an increase of growth promoting miRNA and in a decrease of the growth inhibiting miRNA (Paroo et al. 2009). In complex with PACT, TRBP facilitates the assembly of the RNA induced

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

8

Alexander Brobeil

silencing complex (RISC), whereas the miRNA output by dicer is neither enhanced nor reduced (Slezak-Prochazka et al. 2010). The Argonaute protein family plays key roles in the silencing of genes whether induced by miRNA, siRNA or piwi interacting RNA (Höck and Meister 2008). The function of this protein family is not exclusively restricted to the function in the RISC complex. Song and coworkers (2004) showed that Ago2 encompasses an intrinsic endoribonuclease activity. Remarkably, mutant Ago2 lacking the intrinsic endoribonuclease activity results in anaemia of new borne mice due to the loss of miR-451 (Cheloufi et al. 2010). An additional regulatory mechanism on miRNA production is executed by proteins binding to the terminal loop, named as terminal loop binding proteins. Lin28 binds to the terminal loop of both pri-let-7 and pre-let-7 (Newman et al. 2008). Interaction of Lin28 with the terminal loop results in a reduced processing of pri-let-7 by the microprocessor complex and pre-let-7 by Dicer. This is a specific regulatory process as other miRNA are not influenced (Newman et al. 2008). The exact underlying mechanism relies on terminal uridylation of the pre-let-7 by terminal uridylyl transferase 4 (TUT4) with subsequent degradation of prelet-7 by nucleases (Heo et al. 2009). An opposite effect of miRNA regulation was observed for the RNA binding proteins heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) and KH-type splicing regulatory protein (KSRP) (Michlewski et al. 2010; Trabucchi et al. 2009). Whereas hnRNP A1 mainly acts on the pri-miRNA maturation level, KSRP influences the microprocessor complex as well as Dicer. Both proteins bind to the terminal loop and may change the conformation for better cleavage (Michlewski et al. 2010; Trabucchi et al. 2009). These regulatory mechanisms are linked to specific subsets of miRNA concluding that several feedback loops using different binding proteins control miRNA production (Slezak-Prochazka et al. 2010). The product resulting from the aforementioned cleavage processes has an approximate length of 22nts and consists of two RNA strands, named guide strand (matured miRNA or miRNA) and the passenger strand (miRNA*) (Kim et al. 2009). The miRNA duplex is unwinded by helicases, e.g. p68 corroborated for let-7 (Salzman et al. 2007). Mechanisms for selecting the guide strand and passenger strand base on the thermodynamic stability of the 5‟ end. Unstable base pairs at the 5‟ end favour the selection as guide strand (Khvorova et al. 2003, Schwarz et al. 2003). Formation of the RISC simultaneously occurs with processing the pre-miRNA by Dicer, the dissociation of the RNA duplex and the selection of the guide strand (Gregory et al. 2005). Thus, the RISC is composed of Dicer, TRBP and Ago. In human

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Regulation of Granulocyte Differentiation …

9

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Ago2 contributes preferentially to the RISC leading to miRNA binding to the Ago (Gregory et al. 2005). Moreover, miRNA can more effectively silence genes compared to duplex siRNA (Gregory et al. 2005).

Figure 1. Schematic presentation of miRNA biosynthesis. RNA pol II = RNA polymerase II; DGCR8 = DiGeorge syndrome critical region gene 8; Dicer complex is a composition of Dicer, argonaute 2 (Ago2), Tar RNA binding protein (TRBP) and protein activator of PKR (PACT). RISC = RNA induced silencing complex. UTR = untranslated region.

Active RISC interferes protein translation in a multifunctional manor. The first mechanism of silencing was described to be post-initiation of the translation. Lin-14 mRNA is detected in polysomes while lacking the cognate protein product (Olsen and Ambros 1999). Maroney and co-worker (2006) provided evidence that the RISC is associated with translation of mRNA by inhibiting translation with specific inhibitors. The ribosomes are sensitive to the inhibition assuming an active translation while inhibited by the RISC (Maroney et al. 2006). Premature dissociation of the ribosomes display a possible mechanism for pre-initial silencing, as pharmacological inhibited ribosomes show a faster dissociation in the presence of miRNA compared to uninfluenced ribosomes (Petersen et al. 2006). In contrast, mRNAs are shown to be less associated with ribosomes in the presence of the cognate miRNA

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

10

Alexander Brobeil

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

pointing to a repression of translational initiation (Pillai et al. 2005). The interaction of the Cap-structure with the poly-A-tail promotes translation in eukaryotic cells (Jackson et al. 2010). The interaction is mediated by distinct translation factor (eIF4A, eIF4E and eIF4G) and poly-a-tail binding proteins (Jackson et al. 2010). Notable, miRNAs silence in a cap-dependent manor by inhibiting the eIF4E (Humphreys et al. 2005). The last mechanism is silencing by degradation of the target mRNAs. Remarkably, miRNA can directly cleave full complementary targets, but in animals this rarely occurs. In animals miRNA complementary is restricted to 7nts at the 5‟ end, called seed (Huntzinger and Izaurralde 2011). For correct silencing in humans the cofactor GW182 is essential (Rehwinkel et al. 2005). The main mechanism of mRNA degradation is through decapping and deadenylation. First the target mRNA is deadenylated by the CAF1-CCR4-NOT complex with subsequent decapping by DCP2. As last step, the target mRNA is ultimately degraded by the 5‟-to-3‟ exonuclease XRN1 (Huntzinger and Izzauralde 2011). Figure 1 gives an overview of the aforementioned facts on miRNA biosynthesis.

GENERAL MECHANISMS OF GRANULOPOIESIS AND REGULATION BY TRANSCRIPTION FACTORS Granulocytes arise in the bone marrow from pluripotent hematopoietic stem cells. Stem cells differentiate into the common myeloid progenitors, which group a colony forming unit (CFU) termed as the CFU-GEMM (granulocyte, erythrocyte, monocyte and megakaryocyte) and give rise to the erythroid, megakaryocytic and granulocytic/monocytic lineage. The next step is the formation and differentiation of a CFU which exclusively leads to granulocytic/monocytic development. These cells are called myeloblasts. Basophil, eosinophil and neutrophil granulocytes develop from these progenitor cells. The precursor cells consecutively termed as promyelocyte, myelocyte, metamyelocyte and band cell. Moreover, monocytes differentiate from the same progenitor cells. Hence, it is imperative, that gene expression of these processes is strictly controlled to guarantee the terminal differentiation into the manifold diverse cells. Production of granulocytes depends on the action of different cytokines binding to their cognate receptors. In granulopoiesis, one pivotal cytokine is the granulocyte-colony stimulating factor (G-CSF) binding to the G-CSF

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Regulation of Granulocyte Differentiation …

11

receptor (Ward et al. 2000). The response to the cytokine stimulation is mediated by distinct transcription factors expressed at specific stages of granulocytic differentiation (Miranda and Johnson 2007). Some of the signaling molecules act as both the linker protein for the cytokine receptor and as the transcription factor itself (Miranda and Johnson 2007). Thus, transcriptional control of granulocytic differentiation is related to signal transduction processes. Several signaling pathways are coupled to the G-CSF receptor, e.g. the janus kinase (JAK)/signal transducer and activator of transcription (STAT) pathway and the MAPK pathway (van de Geijn et al. 2003). The STAT protein family comprises seven members with additional division in isoforms of some members. The proteins are consecutively numbered as STAT1, STAT2, STAT3, STAT4, STAT5, STAT6 and STAT7. In granulopoiesis three members were identified to play pivotal roles in differentiation processes (Ward et al. 2000). The STAT3 transcription factor is activated upon G-CSF receptor activation (Ward et al. 1999). STAT3 governs the transcription of myeloid key regulator gene. p27Kip1 is enhanced by STAT3 binding leading to cell survival and differentiation. In contrast, p27Kip1 deficiency results in increased proliferation instead of differentiation (de Koning et al. 2000). Notably, the activation of STAT3 underlies a regulatory fine-tuning by the GCSF receptor. The mechanism depends on the location of STAT3/G-CSF receptor interaction, whereas Jak2 activity is also necessary (Ward et al. 1999). At low G-CSF concentration the STAT3 activation is tyrosine-depend, Y704 and Y744. In contrast, the interaction with the C-terminus of the G-CSF receptor mediates the STAT3 activation at saturating levels of G-CSF (Ward et al. 1999). Thus, these might be the mechanisms for basal granulocytic differentiation but not for emergency granulopoiesis, where high levels of GCSF are detected (Ward et al. 1999). A study by Lee and co-workers (2002) contradicts to the STAT3 dependency of granulopoiesis. Their results identified STAT3 as a negative regulator of the granulopoiesis. STAT3 deficiency results in severe neutrophilia (Lee et al. 2002). Nevertheless, STAT3 enhances transcription and activates a main transcription factor of granulopoiesis, the CCAAT/Enhancer-binding protein α (C/EBPα) (Numata et al. 2005). In emergency state the required CCAAT/Enhancer-binding protein β (C/EBPβ) expression is controlled by STAT3 (Zhang et al. 2010). In addition, both proteins co-regulate c-Myc, a growth promoting transcription factor, by promoter binding (Zhang et al. 2010). Granulopoiesis not exclusively relies on STAT3. STAT5, with the isoforms STAT5A and STAT5B, is also required for proliferation and differentiation in myeloid cells (Ilaria et al. 1999). Double

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

12

Alexander Brobeil

negative STAT5 murine bone marrow cells showed a decrease in CFU compared to controls (Ilaria et al. 1999). Elucidating the possible target gene of STAT5, the anti-apoptotic protein Bcl-XL is up-regulated (Kieslinger et al. 2000). The transcription of this antiapoptotic factor may promote cell survival during granulopoiesis (Miranda and Johnson 2007). Moreover, in the presence of granulocyte monocyte-colony stimulating factor (GM-CSF) STAT5A/Bnull neutrophil granulocytes exhibit a reduction in cell survival with sustained function (Kimura et al. 2009). STAT5A/B induces 389 of known genes, 211 genes are suppressed and 67 of unknown genes are differentially expressed after GM-CSF treatment. All data are deposited in the Gene Expression Omnibus database, under the accession number GSE14672 (Kimura et al. 2009). Besides, GM-CSF activates STAT1 in eosinophil granulocytes, whereas GM-CSF failed to activate STAT1 in neutrophil granulocytes. Of note, both types of granulocytes display sufficient levels of STAT1. Similar observations were made for the signal transduction of activated interferon γ receptor (Coffer et al. 2000). Interleukin 5, formerly known as eosinophil differentiation factor, is also capable of activating JAK2-STAT1 in eosinophil granulocytes (Lopez et al. 1986; Pazdrak et al. 1995). Increased proliferation of eosinophil granulocytes may resemble the growth promoting function of interleukin 5 (Lopez et al. 1986). The specific usage of the STAT proteins in different granulocyte populations probably resembles the lineage specific signal transduction. Specific isoforms of the aforementioned main transcription factor C/EBP are restricted to the myeloid lineage (Scott et al. 1992; Radomska et al. 1998). The C/EBP family belongs to the bZIP transcription factors and consists of the isoforms C/EBPα, C/EBPβ, C/EBPγ, C/EBPδ, C/EBPε and C/EBPδ (Lekstrom-Himes and Xanthopoulos 1998). C/EBPα is the most important factor for normal granulopoiesis (Radomska et al. 1998). A number of granulocyte specific genes were identified driven by C/EBPα, e.g. the G-CDF receptor, the neutrophil elastase, and the myeloperoxidase (Radomska et al. 1998). In C/EBPα deficient mice, no mature neutrophil and eosinophil granulocytes are observed in the peripheral blood. Remarkably, development of monocytes was not affected (Zhang et al. 1997). Furthermore, primary multipotent hematopoietic stem cells display no expression of C/EBPα, whereas all myeloid precursor cells express C/EBPα (Radomska et al. 1998). HL-60 and U937 cells treated with 12-O-tetradecanoylphorbol-13-acetate (TPA), an inductor of monocytic differentiation, show a decreased expression of the C/EBPα on both mRNA and protein level (Radomska et al. 1998). This might be for separating these two lineages during development. Cloning the

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Regulation of Granulocyte Differentiation …

13

C/EBPα gene into bipotential cells also determines the differentiation of these cells into granulocytes. Moreover, differentiation of transfected cells into monocytes is impeded by TPA treatment. In contrast, an accelerated granulopoiesis was observed. These findings probably resemble a possible checkpoint in monocytic and granulocytic differentiation, which is controlled by C/EBPα (Radomska et al. 1998). Noteworthy, transfected cells express the C/EBPε a gene (Radomska et al. 1998). C/EBPε is a transcription factor acting in late granulocytic differentiation (Leckstrom-Himes and Xanthopoulos 1999). C/EBPε deficient granulocytes lack neutrophil specific granules (Lekstrom-Himes and Xanthopoulos 1999). Defects of the C/EBPε transcription factor favor lactoferrin, neutrophil gelatinase and murine cathelin-like protein expression. Furthermore, cathelin B9 is absent in these cells and neutrophil collagenase and neutrophil gelatinase-associated lipocalin display severely decreased levels (Gombart et al. 2003). Similar defects occur in eosinophil granulocytes, where the major basic protein and the eosinophil peroxidase are absent in the granules (Gombart et al. 2003). Yet, C/EBPε is not exclusively responsible for correct granulocytic granule production. PU.1 supports C/EBPε in the development of secondary and tertiary granules (Gombart et al. 2003). PU.1 was first described in 1990. It is encoded by the SPI1 gene and belongs to the ets oncogene family (Klemsz et al. 1990). A variety of myeloid gene promoters are regulated by PU.1, such as the G-CSF receptor, the GM-CSF receptor, the macrophage CSF (M-CSF) receptor, CD11b, and the myeloperoxidase (Zhang et al. 1999). PU.1 contributes to granulocytic differentiation, but is unable inducing terminal differentiation (Anderson et al. 1998). Moreover, the induced neutrophil granulocytes seen under PU.1 overexpression exhibit specific differentiation markers, e.g. Gr-1 and chloroacetate esterase, but fail to respond to certain cytokine mediated stimuli (Anderson et al. 1998). Under PU.1 deficiency, granulocytic progenitors showed an impaired proliferation and differentiation in the presence of G-CSF and GM-CSF, accompanied with low levels of G-CSF and GM-CSF receptor expression (DeKoter et al 1998). In addition, PU.1 interacts with GATA-1 and GATA-2, a known transcription factor leading to erythroid commitment (Zhang et al. 1999). Hereby, GATA-1 and GATA-2 inhibits the expression of myeloid genes, normally enhanced by PU.1. The transactivation of PU.1 in transcriptional regulation is neither inhibited by DNA binding ability nor by the PU.1 activation domain inhibition. This inhibitory mechanism is driven by the direct interaction of PU.1 with GATA-1 and GATA2, respectively (Zhang et al. 1999). In fact, GATA-1 and GATA-2 disrupt the interaction of PU.1 with its co-activator, the proto-oncogene c-Jun

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

14

Alexander Brobeil

(Zhang et al. 1999). These mechanisms may contribute to the commitment to the erythroid or myeloid lineage during early hematopoiesis of multipotent stem cells (GEMM-CFU) (Zhang et al. 1999). Furthermore, the ratio of PU.1 and C/EBPα determines the division of the granulocytic and monocytic lineage in dependency of the cytokine concentration (Dahl et al. 2003). The function of PU.1 is not exclusively restricted to myeloid differentiation processes. PU.1 was shown to induce the transcription of the toll-like receptor 4 (TLR4) gene in humans (Lichtinger et al. 2007). The TLR4 is essential for proper lipopolysaccharide recognition of bacteria (Lichtinger et al. 2007). An additional interplay with a myeloid transcription factor was observed for PU.1 with the core binding factor family, namely AML-1 (Petrovick et al. 1998). The core binding factor (CBF) consists of Runt-related transcription factor 1 (Runx1), Runt-related transcription factor 2 (Runx2), Runt-related transcription factor 3 (Runx3) and core binding factor subunit β (CBFβ). Runx1, Runx2, Runx3 are members of the Runt domain-containing proteins (de Briujn and Speck 2004). The Runx proteins contain the DNA binding domain and interact with the non-DNA binding CBFβ. (de Bruijn and Speck 2004). Both proteins form a heterodimer which regulates the transcription by forming the core binding factor. A recent study showed that Runx1 is able to from homodimers binding to the GM-CSF enhancer (Bowers et al. 2010). Runx1, also known as AML1 or CBFα2, is robustly expressed in the myeloid lineage, but seems not to be essential for terminal maturation of granulocytes. Mice lacking Runx1 have morphologically normal granulocytes (Ichikawa et al. 2004). In contrast, CBFβ impairment leads to defects in neutrophil granulocytes (de Bruijn and Speck 2004). In addition, there is evidence that Runx1 is downregulated in normal granulopoiesis after induction of G-CSF with cognate receptor activation (Feng et al. 2009). Another group of transcription factors combines the receptor interacton and the transcription enhancement in a single molecule. Nuclear receptors act both in ligand binding and activation of transcription. The retinoic acid receptor (RAR) is expressed in three different isoforms (RARα, RARβ and RARγ), where RARα is the most important (Chute et al. 2010). RARα depleted mice show a suppression in granulocytic development (Tocci et al. 1996). Activation of the RAR occurs after binding of all trans retinoic acid (ATRA) or 9-cis retinoic acid. Both molecules are vitamin A derivates. The retinoid X receptors (RXR) with the RXRα, RXRβ and RXRγ isoforms bind only to 9-cis retinoic acid (Chambon 1996; Mangelsdorf and Evans 1995). The effect of RAR is dualspecific. Unligated RARα overexpression results in the proliferation of myeloid cells at early stages (Kastner and Chan 2001). In the

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Regulation of Granulocyte Differentiation …

15

presence of ATRA granulocytes only show markers of maturation if RARα is unimpaired (Kastner and Chan 2001). This effect was also seen in vivo. The RAR antagonist BMS493 if administrated to mice results in an increase of myeloid precursors (Kastner et al. 2001). Moreover, vitamin A deficient mice exhibit similar morphological changes in the bone marrow (Kastner et al. 2001). Target genes of the RAR containing a retinoic acid response element (RARE) are identified as members of the C/EBP family and c-Myc (Kastner and Chan 2001). Strikingly, the aforementioned C/EBPε contributes to late myeloid differentiation. Yet, C/EBPε is normally expressed in RARα deficient mutants (Kastner and Chan 2001). In addition, a RARE was identified as a member of the homebox (HOX) protein family (Pöpperl and Featherstone 1993). Hox proteins exhibit a special helix-turn-helix motif capable of DNA binding, termed the homeo domain (Ward et al. 2000). Hox proteins contribute in an isoform specific manner to normal granulopoiesis. For example, HoxA0 and HoxA10 are expressed in early hematopoietic progenitor cells. In case of myeloid differentiation both proteins are down-regulated. Strikingly, HoxA10 deficiency results in an increase in circulating neutrophil granulocytes, whereas HoxA9 disruption revealed reduced granulocytes (Ward et al. 2000). Moreover, HoxA5 inhibition results in an impaired granulopoiesis (Fuller et al. 1999). HoxA5 is a regulatory transcription factor for cell proliferation and differentiation. Yet, it is highly likely that other Hox proteins direct cells into the different lineages and induce differentiation (Fuller et al. 1999). Apparently, no transcription factor with associated functions can alone direct the commitment of granulocyte precursor cells to the different lineages. The mechanism orchestrates these various molecules playing a pivotal role in different stages of granulocytic development. Remarkably, most of these transcription factors also account for myeloid malignancies, such as leukemia. The implication of the involved proteins is discussed later in this article in relation to the leukemic potential of some miRNA.

MIRNA – ONE OF THE GATE KEEPER IN GRANULOPOIESIS In the previous section the transcription factors contributing to myeloid differentiation were discussed. Normal granulopoiesis depends on the unimpaired interplay of the transcription factors during each stage of

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

16

Alexander Brobeil

differentiation. Thus, the transcription has to be regulated by distinct mechanisms. As discussed before, miRNA are capable of regulating gene expression. In this section the mechanism of miRNA silencing and its impact on normal granulopoiesis in dependency of myeloid transcription factors is discussed. To indentify a specific function of miRNA in granulopoiesis, it is important to know which miRNA are specifically expressed during granulopoiesis. A recent study by Sun and co-worker (2011) elucidated the stage depended miRNA expression during granulopoiesis. The miRNA expression change comprises seven families: let-7/98 (5 out of 8), miR15/16/195/424/497 (5 out of 6), miR-30a/30a-5p/30b/30n-5p/30cde/384-5p (4 out of 5), miR-17-5p/20/93.mr/106/519.d (5 out of 6), miR-130/301 (3 out of 3), miR-181 (3 out of 3) and miR-99ab/100 (Sun et al. 2011). For some clusters, a potential function is assumed by the authors. miR-181 showed a sequential down-regulation during normal granulopoiesis (Sun et al. 2011). Moreover, the miR-15/16/195/424/497, known regulators of apoptosis and cell cycle, are upregulated during maturation of neutrophil granulocytes (Sun et al. 2011). miR-17-5p/20/93.mr/106/519.d regulates stem cell differentiation. These members are down-regulated in matured neutrophil, hinting to a stimulation of developmental genes (Sun et al. 2011). Interestingly, the clusters are not concomitantly up-regulated or down-regulated. Some specific miRNAs of one family, e.g. the miR-17-92 cluster, are stage dependently regulated. miR-17-5p was sequentially decreased from myeloblasts onwards. In contrast, miR-20a and miR-92 were specifically down-regulated in metamyelocytes and miR-18a, miR-19a and miR-19b were decreased in neutrophil granulocytes (Sun et al. 2011). In granulocytes, the transcription factor and zinc finger protein growth factor independent 1 (GFI1) is essential for neutrophil granulocyte development (de la Luz Sierra et al. 2010). GFI1 targets the promoter of the miRNA miR-196b. miR-196b is dualspecific in regard to lineage commitment. Myeloid progenitor cells are able to differentiate either into granulocytes or monocytes (El Gazzar and McCall 2011). The expression of miR-196b is repressed by GFI1 leading to neutrophil granulocyte lineage commitment (Velu et al. 2009). This mechanism was corroborated by overexpression of miR-196b resulting in blockage of neutrophil development (Velu et al. 2009). Moreover, GFI1 and its two target miRNA genes, miR-21 and miR-196b contribute to the passage from the common myeloid progenitor to the granulocyte/monocyte progenitor. In this case, GFI1 expression is strongly increased in granulocyte/monocyte progenitors, whereas miR-196b and miR21 levels significantly decrease (Velu et al. 2009). Remarkably, HL-60 cells

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Regulation of Granulocyte Differentiation …

17

exposed for inducing granulocytic differentiation show an increase in miR-21 expression and a loss of miR-196b expression. The sharp drop of miR-196b was observed after 24 hours of treatment with ATRA. In contrast, miR-20 expression was highest in the absence of GFI1, which decreased during differentiation (Velu et al. 2009). Overexpression experiments of either miR21 or miR-196b revealed an increase in CFU compared to the wild-type control. Of note, miR-196b reciprocally acts compared to miR-21. If miR-21 is overexpressed, CFU shows an increase of about 50%, whereas overexpression of miR-196b results in a decrease of CFU. Moreover, CFU observed in miR21 overexpression state are mainly indentified to be related to the monocytic lineage. Antagonizing miR-196b increases the CFU forming the granulocytic cell fate (Velu et al. 2009). Exposition of cells to G-CSF results in granulopoiesis, but also is accompanied by a two fold increase in monocytes. Blocked granulopoiesis by miR-196b is not rescued by the application of GCSF (Velu et al. 2009). Targeting normal granulopoiesis by miRNA on post-transcriptional level mediates such a mechanism. Contribution of miR-27 to myeloid differentiation was shown by targeting the Runx1 transcription factor (Feng et al. 2009). Cultured 32D.cl3 myeloid progenitors display a decrease of Runx1 protein after differentiation induction by G-CSF. Noteworthy, basal levels of Runx mRNA were detected pointing to a post-transcriptional regulation (Feng et al. 2009). Overexpression of miR-27a and miR-27b in 32D.cl3 myeloid progenitors results in a decrease of Runx1 expression and in an increase of band-type granulocytes. Furthermore, in pri-miR-27 transfected cells the GCSF receptor expression was augmented in comparison to the control (Feng et al. 2009). Post-transcriptional silencing siRNA application shows the same effects as the endogenous miR-27. Moreover, the transcriptional regulation of the pro-granulocytic regulator is bound to an important key regulator of granulocytic differentiation. C/EBPα binds to a promoter region of the C9orf3 gene. miR-27 is located on exon 14 of this gene. Thus, C/EBPα promotes its progranulocytic effect not only by induction of important receptors or signalling molecules, but also by the induction of miR-27 (Feng et al. 2009). For understanding the full feedback pathways these regulatory mechanisms are in need of deeper investigation. miR-223 is an effector of a well established minicircuitry. Here, the key transcription factor C/EBPα plays a pivotal role in the interplay with the nuclear factor 1 A (NFI-A) (Fazi et al. 2005). Remarkably, both transcription factors bind to the promoter region of the miR-223 gene (Fazi et al. 2005). Overexpression of miR-223 leads to granulocytic development as indicated by the presence of the CD11b and

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

18

Alexander Brobeil

absence of the CD14 surface markers. An up-regulation of the G-CSF receptor in the cells was observed. Moreover, inhibiting miR-223 with complementary oligonucleotides abolished the positive effects of miR-223 on granulopoiesis as indicated by a reduction in the CD11b surface marker (Fazi et al. 2005). Silencing the genes of the two regulatory transcription factors either C/EBPα or NFI-4 has impact on the miR-223 expression and sunsequent for the granulopoiesis. C/EBPα knock-down results in a decreased response to the induction with retinoic acid. Otherwise, an increased differentiation status was observed in NFI-A knock-down experiments. These data suggest, that NFI-4 binds to the miR-223 promoter in unstimulated cells and prevents the transcription of miR-233. Whereas in retinoic acid stimulated cells C/EBPα displaces NFI-4 leading to the transcription of miR-223. Moreover, miR-223 targets NFI-A which potentiates the effect of C/EBPα induced differentiation (Fazi et al. 2005). The function of miRNA is not exclusively restricted to differentiation processes. But in case of granulocytic reaction in innate immunity, there is less evidence for a functional aspect of the miRNA expression. Yet, miR-9 was identified to have regulatory function in neutrophil granulocytes exposed to proinflammatory signals (Bazzoni et al. 2009). Here, miR-9 is involved in the NF-κB regulation after lipopolysaccharide stimulation. Toll-like receptors were used for signal transduction by activating the MyD88 pathway that induces the expression of miR-9 (Bazzoni et al. 2009). In addition, the known regulator of granolcytic differentiation miR-223 also has an impact on granulocytic function (O‟Connell et al. 2010). miR-223 deficient granulocytes possess an increased capacity to undergo oxidative burst. Furthermore, these granulocytes more effectively killed Candida albicans than normal granulocytes with intact miR-223 (O‟Connell et al. 2010). These findings indicate that the effects of miRNA in normal granulocytes go far beyond regulation of differentiation. But up to now, knowledge of miRNA function in normal granulopoiesis is limited and further investigations are needed.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Regulation of Granulocyte Differentiation …

19

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

MIRNA – A CONTRIBUTOR TO MYELOID MALIGNANCIES AND A POTENT TOOL FOR PROGNOSIS AND CLASSIFICATION At present, miRNA expression in myeloid malignancies is intensively investigated for its usefulness as a prognostic and classification factor for various malignancies. Yet, the results of different studies are not in agreement with regard to the miRNA expression signature (Marcucci et al. 2011). Plenty of factors interfere with the correct miRNA expression. Some studies use stimulated CD34+, whereas other studies use cells directly isolated from bone marrow (Marcucci et al. 2011). So, it is not surprising that the results are hard to be reproduced in other labs. Such signatures may help to distinguish between closely related subtypes of diseases and of human cancers (Ebert et al. 2005; Lu et al. 2005). Mi et al. (2007) investigated several miRNA expression patterns in acute myeloid leukemia (AML) and acute lymphocytic leukemia (ALL) to distinguish between both malignancies. From 435 investigated miRNAs four genes showed a significant difference in the expression level between ALL and AML: miR-128a, miR-128b, miR-223 and let-7b (Mi et al. 2007). Subsequent testing of the identified miRNAs revealed an overall diagnostic accuracy of 97-99% (Mi et al. 2007). Analogous to the study of Mi et al. (2007), a variety of different AMLs with distinct chromosomal aberrations were analyzed for their miRNA expression (Seca et al. 2010). These studies are extensively described in reviews (O‟Connell et al. 2010; Vasilatou et al. 2010, Marcucci et al. 2011; Starczynowski et al. 2011). All these studies indicate a specific miRNA expression pattern tightly restricted to the underlying malignancy. Yet, the various studies differ in the number of the identified miRNAs and their potential for up- or down-regulation. For example, different investigations of MLL-rearrangement AML reported different miRNA signatures (Seca et al. 2010). One study identified miR-10a, miR-331 and miR-340 depletion as the cytogenetic alteration in AML (Dixon-McIver et al. 2008). A different study reported 24 altered miRNAs in MLL-gene-rearrangement AML and a third lab related 8 up-regulated and 14 down-regulated miRNAs to the malignancy (Garzon and Croce 2008). Noteworthy, members of the miRNA identified by Garzon and Croce (2008) comprise tumor suppression miRNA genes targeting critical oncogenes, e.g. CDK4 by miR-34b, BCL-2 by miR-15a, RAS by let-7, MCL-1 by miR-29 and Hox-A7, HoxA8, HoxD8 and HoxB8 by miR-196 (Seca et al. 2010).

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

20

Alexander Brobeil

Furthermore, miRNA function is not exclusively restricted to the regulation of differentiation factors relevant for myeloid malignancies. Overexpression of miR-125b causes leukemia in mice. The mice exhibit distinct types of leukemia, e.g. myeloproliferative neoplasms (Bousquet et al. 2010). Yet, B-acute lymphocytic leukemia and T-acute lymphocytic leukemia (T-ALL) are also present in miR-125b overexpression (Bousquet et al. 2010). Of note, the level of miR-125b is related to the subtype of leukemia showing low levels in T-ALL and higher levels in myeloid neoplasms (Bousquet et al. 2010). This goes along with overexpression experiments in the myeloid cell line HL-60 blocking the myeloid differentiation (Bousquet et al. 2008). Moreover, miRNAs are also involved in the treatment of myeloid leukemia. miR-32 targets the pro-apoptotic protein Bim. Overexpression of miR-32 accelerates differentiation and down-regulates Bim expression. Repression of miR-32 has the opposite effect. Blockage of miR-32 results in significant higher levels of Bim and AML cells become more sensitized to the chemotherapeutic drug arabinocysteine. The regulation is driven by 1,25dihydroxyvitamin D3 (Gocek et al. 2011). Thus, miRNA may support the administrated drugs by specific inhibition or amplification (Gocek et al. 2011). Another regulatory circuit in AML is the miR-223-E2F1 negative feedback loop (Pulikkan et al. 2010). In this case, the main granulocytic transcription factor is down-regulated and in consequence its target C/EBPα. This transcription factor is essential for non-impaired granulopoiesis. In AML, deregulation leads to a differentiation block and cell cycle progression. In contrast miR-223 stops cell cycle progression by targeting E2F1. Moreover, E2F2 binds to the miR-223 promoter in AML and interferes with the correct expression of miR-223 (Pulikkan et al. 2010). Analogous to this mechanism, C/EBPα mutations cause down-regulation of miR-34a in AML with overexpression of E2F3 and E2F1, respectively (Pulikkan et al.2010). Overexpression of miR-34 in leukemic blasts restores granulopoiesis (Pulikkan et al. 2010). Thus, miR-34 acts as a tumor suppressor in AML (Pulikkan et al. 2010). The c-Kit proto-oncogen is frequently expressed in AML. The integration of this receptor into the miRNA regulation machinery was recently investigated by Gao et al. (2011). Noteworthy, c-Kit expression is under strict control of the miR-193b. In AML cell lines miR-193b was down-regulated. Rescue experiments with overexpression of miR-193b in AML cells revealed distinctly reduced c-Kit levels and reduced proliferation (Gao et al. 2011). This mechanism may contribute to c-Kit driven leukemogenesis and may be a potential target for therapy (Gao et al. 2011). Therapeutic implications for

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Regulation of Granulocyte Differentiation …

21

miRNA in AML treatment are described by Murray et al. (2011). Anti-miR technology and miRNA mimics are well established in the laboratories (Murray et al. 2011). These tools imply the possibility to target specific oncogenes (Murray et al. 2011). The c-Kit regulation by miR-193b represents such a sample (Gao et al. 2011). Another entity of myeloid malignancies is characterized by the continued expression and activation of a chimeric protein, termed BCR-Abl. This protein is a hallmark for chronic myeloid leukemia (Lopotová et al. 2011). Basing on latest analyses, CML was investigated in regard to the miR-451 expression during different clinical stages: at the time of diagnosis, in major molecular response, during hematological relapse and in suboptimal response (Lopotová et al. 2011). Noteworthy, cell cultures of CML cells exposed to imatinib exhibited elevated levels of miR-451 compared to healthy control leukocytes. Prior to the cultivation miR-451 levels were reduced in CML cells (Lopotová et al. 2011). Moreover, BCR-Abl transcripts correlated inversely with miR451 at the time of diagnosis as well as in major molecular response and in hematological relapse. No correlation was found for suboptimal response (Lopotová et al. 2011). As seen in in vitro experiments BCR-Abl activity was linked to miR-451 expression. BCR-Abl and miR-451 is thought to form a regulatory circuit. BCR-Abl negatively influences miR-451 function. In contrary, miR-451 reduces BCR-Abl activity. Imatinib breakes this regulatory mechanism, thus abolishing inhibition of miR-451 by BCR-Abl. In consequence miR-451 can now depress BCR-Abl activity (Lopotová et al. 2011). To sum up these findings, miRNAs provide a magnitude of diagnostic and therapeutic options, which can not be covered by this chapter. The knowledge about miRNAs will grow fast within the next years, realizing the use of miRNAs as therapeutic drugs in clinical treatment.

CONCLUDING REMARKS The present review summarizes the main functions of transcription factors implicated in normal granulopoiesis. Furthermore, latest knowledge on mechanisms in miRNA production is provided and selected examples of their actions in normal granulopoiesis and myeloid malignancies are presented. Transcription factors and miRNA both contribute to normal granulocytic differentiation and can not be considered as two independent regulatory pathways. Both mechanisms form a complex regulatory network influencing

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

22

Alexander Brobeil

each other in a regulatory manner. In particular, the miRNA regulatory pathway is intensively investigated in regard to its specific expression and as target in the therapy of various myeloid malignancies. The miRNA expression signature provides a powerful tool in diagnostics and classification of myeloid malignancies. Further studies will contribute to make these diagnostic and therapeutic options accessible for clinicians in daily medical.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

BIBLIOGRAPHY Abrahante JE; Daul AL; Li M; Volk ML; Tennessen JM; Miller EA; Rougvie AE. (2009). The Caenorhabditis elegans hunchback-like gene lin-57/hbl-1 controls developmental time and is regulated by microRNAs. Dev. Cell. 4, 625-637. Ambros V. (1989). A hierarchy of regulatory genes controls a larva-to-adult developmental switch in C. elegans. Cell. 57, 49-57. Anderson KL; Smith KA; Conners K; McKercher SR; Maki RA; Torbett BE. (1998) Myeloid development is selectively disrupted in PU.1 null mice. Blood. 91, 3702-3710. Aukerman MJ; Sakai H. (2009) Regulation of flowering time and floral organ identity by a MicroRNA and its APETALA2-like target genes. Plant Cell. 15, 2730-2741. Erratum in: Plant Cell. 6, 555 (2004). Bartel DP. (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 116, 281-297. Bazzoni F; Rossato M; Fabbri M; Gaudiosi D; Mirolo M; Mori L; Tamassia N; Mantovani A; Cassatella MA; Locati M. (2009). Induction and regulatory function of miR-9 in human monocytes and neutrophils exposed to proinflammatory signals. Proc. Natl. Acad. Sci. U. S. A. 106, 5282-5287. Berezikov E; Chung WJ; Willis J; Cuppen E; Lai EC. (2007). Mammalian mirtron genes. Mol. Cell. 28, 328-336. Bohnsack MT; Czaplinski K; Gorlich D. (2004). Exportin 5 is a RanGTPdependent dsRNA-binding protein that mediates nuclear export of premiRNAs. RNA. 10, 185-191. Bohnsack MT; Regener K; Schwappach B; Saffrich R; Paraskeva E; Hartmann E; Görlich D. (2002) Exp5 exports eEF1A via tRNA from nuclei and synergizes with other transport pathways to confine translation to the cytoplasm. EMBO J. 21, 6205-6215.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Regulation of Granulocyte Differentiation …

23

Bousquet M; Harris MH; Zhou B; Lodish HF. (2010). MicroRNA miR-125b causes leukemia. Proc. Natl. Acad. Sci. U. S. A. 107, 21558-21563. Bousquet M; Quelen C; Rosati R; Mansat-De Mas V; La Starza R; Bastard C; Lippert E; Talmant P; Lafage-Pochitaloff M; Leroux D; Gervais C; Viguié F; Lai JL; Terre C; Beverlo B; Sambani C; Hagemeijer A; Marynen P; Delsol G; Dastugue N; Mecucci C; Brousset P. (2008) Myeloid cell differentiation arrest by miR-125b-1 in myelodysplastic syndrome and acute myeloid leukemia with the t(2;11)(p21;q23) translocation. J. Exp. Med. 205, 2499-2506. Bowers SR; Calero-Nieto FJ; Valeaux S; Fernandez-Fuentes N; Cockerill PN. (2010) Runx1 binds as a dimeric complex to overlapping Runx1 sites within a palindromic element in the human GM-CSF enhancer. Nucleic Acids Res. 38, 6124-6134. Brow DA; Guthrie C. (1988). Spliceosomal RNA U6 is remarkably conserved from yeast to mammals. Nature. 334, 213-218. Chambon P. (1996) A decade of molecular biology of retinoic acid receptors. FASEB J. 10, 940-954. Cheloufi S; Dos Santos CO; Chong MM; Hannon GJ. (2010). A dicerindependent miRNA biogenesis pathway that requires Ago catalysis. Nature. 465, 584-589. Chen CZ; Li L; Lodish HF; Bartel DP. (2004) MicroRNAs modulate hematopoietic lineage differentiation. Science. 303, 83-86. Chendrimada TP; Gregory RI; Kumaraswamy E; Norman J; Cooch N; Nishikura K; Shiekhattar R. (2005) TRBP recruits the Dicer complex to Ago2 for microRNA processing and gene silencing. Nature. 436, 740-744. Chute JP; Ross JR; McDonnell DP. (2010) Minireview: Nuclear receptors, hematopoiesis, and stem cells. Mol. Endocrinol. 24, 1-10. Coffer PJ; Koenderman L; de Groot RP. (2000) The role of STATs in myeloid differentiation and leukemia. Oncogene. 19, 2511-2522. Dahl R; Walsh JC; Lancki D; Laslo P; Iyer SR; Singh H; Simon MC. (2003). Regulation of macrophage and neutrophil cell fates by the PU.1:C/EBPalpha ratio and granulocyte colony-stimulating factor. Nat. Immunol. 4, 1029-1036. Davis BN; Hilyard AC; Lagna G; Hata A. (2008). SMAD proteins control DROSHA-mediated microRNA maturation. Nature. 454, 56-61. de Bruijn MF; Speck NA. (2004). Core-binding factors in hematopoiesis and immune function. Oncogene. 23, 4238-4248. de Koning JP; Soede-Bobok AA; Ward AC; Schelen AM; Antonissen C; van Leeuwen D; Löwenberg B; Touw IP. (2000). STAT3-mediated

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

24

Alexander Brobeil

differentiation and survival and of myeloid cells in response to granulocyte colony-stimulating factor: role for the cyclin-dependent kinase inhibitor p27(Kip1). Oncogene. 19, 3290-3298. de la Luz Sierra M; Sakakibara S; Gasperini P; Salvucci O; Jiang K; McCormick PJ; Segarra M; Stone J; Maric D; Zhu J; Qian X; Lowy DR; Tosato G. (2010) The transcription factor Gfi1 regulates G-CSF signaling and neutrophil development through the Ras activator RasGRP1. Blood. 115, 3970-3979. DeKoter RP; Walsh JC; Singh H. (1998). PU.1 regulates both cytokinedependent proliferation and differentiation of granulocyte/macrophage progenitors. EMBO J. 17, 4456-4468. Dixon-McIver A; East P; Mein CA; Cazier JB; Molloy G; Chaplin T: Andrew Lister T; Young BD; Debernardi S. (2008). Distinctive patterns of microRNA expression associated with karyotype in acute myeloid leukaemia. PLoS One. 3, e2141 Ebert BL; Mak RH; Ferrando AA; Downing JR; Jacks T; Horvitz HR; Golub TR. (2005). MicroRNA expression profiles classify human cancers. Nature. 435, 834-838. El Gazzar M; McCall CE. (2011). MicroRNAs regulatory networks in myeloid lineage development and differentiation: regulators of the regulators. Immunol. Cell Biol. 10.1038/icb.2011.74. Estey E; Döhner H. (2006). Acute myeloid leukaemia. Lancet. 368, 18941907. Fazi F; Rosa A; Fatica A; Gelmetti V; De Marchis ML; Nervi C; Bozzoni I. (2005). A minicircuitry comprised of microRNA-223 and transcription factors NFI-A and C/EBPalpha regulates human granulopoiesis. Cell. 123, 819-831. Feng J; Iwama A; Satake M; Kohu K. (2009). MicroRNA-27 enhances differentiation of myeloblasts into granulocytes by post-transcriptionally downregulating Runx1. Br. J. Haematol. 145, 412-423. Filipowicz W; Bhattacharyya SN; Sonenberg N. (2008). Mechanisms of posttranscriptional regulation by microRNAs: are the answers in sight?. Nat. Rev. Genet. 9, 102-114. Fukuda T; Yamagata K; Fujiyama S; Matsumoto T; Koshida I; Yoshimura K; Mihara M; Naitou M; Endoh H; Nakamura T; Akimoto C; Yamamoto Y; Katagiri T; Foulds C; Takezawa S; Kitagawa H; Takeyama K; O'Malley BW; Kato S. (2007). DEAD-box RNA helicase subunits of the Drosha complex are required for processing of rRNA and a subset of microRNAs. Nat. Cell Biol. 9, 604-611.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Regulation of Granulocyte Differentiation …

25

Fuller JF; McAdara J; Yaron Y; Sakaguchi M; Fraser JK; Gasson JC. (1999). Characterization of HOX gene expression during myelopoiesis: role of HOX A5 in lineage commitment and maturation. Blood. 93, 3391-3400. Gao XN; Lin J; Gao L; Li YH; Wang LL; Yu L. (2011). MicroRNA-193b regulates c-Kit proto-oncogene and represses cell proliferation in acute myeloid leukemia. Leuk. Res. 35, 1226-1232. Garzon R; Croce CM. (2008). MicroRNAs in normal and malignant hematopoiesis. Curr. Opin. Hematol. 15, 352-358. Gocek E; Wang X; Liu X; Liu CG; Studzinski GP. (2011). MicroRNA-32 upregulation by 1,25-dihydroxyvitamin D3 in human myeloid leukemia cells leads to Bim targeting and inhibition of AraC-induced apoptosis. Cancer Res. 71, 6230-6239. Gombart AF; Kwok SH; Anderson KL; Yamaguchi Y; Torbett BE; Koeffler HP. (2003). Regulation of neutrophil and eosinophil secondary granule gene expression by transcription factors C/EBP epsilon and PU.1. Blood. 101, 3265-3273. Gregory RI; Chendrimada TP; Cooch N; Shiekhattar R. (2005). Human RISC couples microRNA biogenesis and posttranscriptional gene silencing. Cell. 123, 631-640. Gregory RI; Yan KP; Amuthan G; Chendrimada T; Doratotaj B; Cooch N; Shiekhattar R. (2004). The Microprocessor complex mediates the genesis of microRNAs. Nature. 432, 235-240. Haase AD; Jaskiewicz L; Zhang H; Lainé S; Sack R; Gatignol A; Filipowicz W. (2005). TRBP, a regulator of cellular PKR and HIV-1 virus expression, interacts with Dicer and functions in RNA silencing. EMBO Rep. 6, 961-967. Hazlehurst LA; Bewry NN; Nair RR; Pinilla-Ibarz J. (2009). Signaling networks associated with BCR-ABL-dependent transformation. Cancer Control. 16, 100-107. He L; Hannon GJ. (2004). MicroRNAs: small RNAs with a big role in gene regulation. Nat Rev Genet, 5, 522-531. Erratum in: Nat. Rev. Genet. 5, 631 (2004). Heo I; Joo C; Kim YK; Ha M; Yoon MJ; Cho J; Yeom KH; Han J; Kim VN. (2009). TUT4 in concert with Lin28 suppresses microRNA biogenesis through pre-microRNA uridylation. Cell. 138, 696-708. Höck J; Meister G. (2008). The Argonaute protein family. Genome Biol. 9, 210. Humphreys DT; Westman BJ; Martin DI; Preiss T. (2005). MicroRNAs control translation initiation by inhibiting eukaryotic initiation factor

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

26

Alexander Brobeil

4E/cap and poly(A) tail function. Proc. Natl. Acad. Sci. U. S. A. 102, 16961-16966. Huntzinger E; Izaurralde E. (2011). Gene silencing by microRNAs: contributions of translational repression and mRNA decay. Nat. Rev. Genet. 12, 99-110. Ichikawa M; Asai T; Saito T; Seo S; Yamazaki I; Yamagata T; Mitani K; Chiba S; Ogawa S; Kurokawa M; Hirai H. (2004). AML-1 is required for megakaryocytic maturation and lymphocytic differentiation, but not for maintenance of hematopoietic stem cells in adult hematopoiesis. Nat. Med. 10, 299-304. Ilaria RL Jr; Hawley RG; Van Etten RA. (1999) Dominant negative mutants implicate STAT5 in myeloid cell proliferation and neutrophil differentiation. Blood. 93, 4154-4166. Jackson RJ; Hellen CU; Pestova TV. (2010). The mechanism of eukaryotic translation initiation and principles of its regulation. Nat. Rev. Mo. Cell Biol. 11, 113-127. Kastner P; Chan S. (2001). Function of RARalpha during the maturation of neutrophils. Oncogene. 20, 7178-7185. Kastner P; Lawrence HJ; Waltzinger C; Ghyselinck NB; Chambon P; Chan S. (2001). Positive and negative regulation of granulopoiesis by endogenous RARalpha. Blood. 97, 1314-1320. Khvorova A; Reynolds A; Jayasena SD. (2003). Functional siRNAs and miRNAs exhibit strand bias. Cell, 115, 209-216. Erratum in: Cell. 115, 505 (2003). Kieslinger M; Woldman I; Moriggl R; Hofmann J; Marine JC; Ihle JN; Beug H; Decker T. (2000). Antiapoptotic activity of Stat5 required during terminal stages of myeloid differentiation. Genes Dev. 14, 232-244. Kim VN; Han J; Siomi MC. (2009). Biogenesis of small RNAs in animals. Nat. Rev. Mol. Cell Biol. 10, 126-139. Kim VN. (2005). MicroRNA biogenesis: coordinated cropping and dicing. Nat. Rev. Mol. Cell Biol. 6, 376-385. Kimura A; Rieger MA; Simone JM; Chen W; Wickre MC; Zhu BM; Hoppe PS; O'Shea JJ; Schroeder T; Hennighausen L. (2009). The transcription factors STAT5A/B regulate GM-CSF-mediated granulopoiesis. Blood. 114, 4721-4728. Klemsz MJ; McKercher SR; Celada A; Van Beveren C; Maki RA. (1990). The macrophage and B cell-specific transcription factor PU.1 is related to the ets oncogene. Cell. 61, 113-124.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Regulation of Granulocyte Differentiation …

27

Lagos-Quintana M; Rauhut R; Lendeckel W; Tuschl T. (2001). Identification of novel genes coding for small expressed RNAs. Science. 294, 853-858. Lee CK; Raz R; Gimeno R; Gertner R; Wistinghausen B; Takeshita K; DePinho RA; Levy DE. (2002). STAT3 is a negative regulator of granulopoiesis but is not required for G-CSF-dependent differentiation. Immunity. 17, 63-72. Lee RC; Feinbaum RL; Ambros V. (1993). The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 75, 843-854. Lee Y; Hur I; Park SY; Kim YK; Suh MR; Kim VN. (2006). The role of PACT in the RNA silencing pathway. EMBO J. 25, 522-532. Lee Y; Kim M; Han J; Yeom KH; Lee S; Baek SH; Kim VN. (2004). MicroRNA genes are transcribed by RNA polymerase II. EMBO J. 23, 4051-4060. Lekstrom-Himes J; Xanthopoulos KG. (1998). CCAAT/enhancer binding protein epsilon is critical for effective neutrophil-mediated response to inflammatory challenge. Blood. 93, 3096-3105. Lichtinger M; Ingram R; Hornef M; Bonifer C; Rehli M. (2007). Transcription factor PU.1 controls transcription start site positioning and alternative TLR4 promoter usage. J. Biol. Chem. 282, 26874-26883. Lin SL; Miller JD; Ying SY. (2006). Intronic microRNA (miRNA). J. Biomed. Biotechnol. 2006, 26818. Lin SY; Johnson SM; Abraham M; Vella MC; Pasquinelli A; Gamberi C; Gottlieb E; Slack FJ. (2003). The C elegans hunchback homolog, hbl-1, controls temporal patterning and is a probable microRNA target. Dev. Cell. 4, 639-650. Lopez AF; Begley CG; Williamson DJ; Warren DJ; Vadas MA; Sanderson CJ. (1986). Murine eosinophil differentiation factor. An eosinophil-specific colony-stimulating factor with activity for human cells. J. Exp. Med. 163, 1085-1099. Lopotová T; Záčková M; Klamová H; Moravcová J. (2011). MicroRNA-451 in chronic myeloid leukemia: miR-451-BCR-ABL regulatory loop? Leuk. Res. 35, 974-977. Lu J; Getz G; Miska EA; Alvarez-Saavedra E; Lamb J; Peck D; SweetCordero A; Ebert BL; Mak RH; Ferrando AA; Downing JR; Jacks T; Horvitz HR; Golub TR. (2005). MicroRNA expression profiles classify human cancers. Nature. 435, 834-838. MacRae IJ; Zhou K; Doudna JA. (2007). Structural determinants of RNA recognition and cleavage by Dicer. Nat. Struct. Mol. Biol. 14, 934-940.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

28

Alexander Brobeil

Mangelsdorf DJ; Evans RM. (1995). The RXR heterodimers and orphan receptors. Cell. 83, 841-850. Marcucci G; Mrózek K; Radmacher MD; Garzon R; Bloomfield CD. (2011). The prognostic and functional role of microRNAs in acute myeloid leukemia. Blood. 117, 1121-1129. Maroney PA; Yu Y; Fisher J; Nilsen TW. (2006). Evidence that microRNAs are associated with translating messenger RNAs in human cells. Nat. Struct. Mol. Biol. 13, 1102-1107. Mhawech P; Saleem A. (2001). Myelodysplastic syndrome: review of the cytogenetic and molecular data. Crit. Rev. Oncol. Hematol. 40, 229-238. Mi S; Lu J; Sun M; Li Z; Zhang H; Neilly MB; Wang Y; Qian Z; Jin J; Zhang Y; Bohlander SK; Le Beau MM; Larson RA; Golub TR; Rowley JD; Chen J. (2007). MicroRNA expression signatures accurately discriminate acute lymphoblastic leukemia from acute myeloid leukemia. Proc. Natl. Acad. Sci. U. S. A. 104, 19971-19976. Michlewski G; Guil S; Cáceres JF. (2010). Stimulation of pri-miR-18a processing by hnRNP A1. Adv. Exp. Med. Biol. 700, 28-35. Miranda MB; Johnson DE. (2007). Signal transduction pathways that contribute to myeloid differentiation. Leukemia. 21, 1363-1377. Morlando M; Ballarino M; Gromak N; Pagano F; Bozzoni I; Proudfoot NJ. (2008). Primary microRNA transcripts are processed co-transcriptionally. Nat. Struct. Mol. Biol. 15, 902-909. Murray MY; Rushworth SA; Macewan DJ. (2011 Sep 25). Micro RNAs as a new therapeutic target towards leukaemia signalling. Cell Signal. 10.1016/j.cellsig.2011.09.021 Newman MA; Thomson JM; Hammond SM. (2008). Lin-28 interaction with the Let-7 precursor loop mediates regulated microRNA processing. RNA. 14, 1539-1549. Numata A; Shimoda K; Kamezaki K; Haro T; Kakumitsu H; Shide K; Kato K; Miyamoto T; Yamashita Y; Oshima Y; Nakajima H; Iwama A; Aoki K; Takase K; Gondo H; Mano H; Harada M. (2005). Signal transducers and activators of transcription 3 augments the transcriptional activity of CCAAT/enhancer-binding protein alpha in granulocyte colonystimulating factor signaling pathway. J. Biol. Chem. 280, 12621-12629. O'Connell RM; Rao DS; Chaudhuri AA; Baltimore D. (2010). Physiological and pathological roles for microRNAs in the immune system. Nat. Rev. Immunol. 10, 111-122. Olsen PH; Ambros V. (1999). The lin-4 regulatory RNA controls developmental timing in Caenorhabditis elegans by blocking LIN-14

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Regulation of Granulocyte Differentiation …

29

protein synthesis after the initiation of translation. Dev. Biol. 216, 671680. Panopoulos AD; Watowich SS. (2008). Granulocyte colony-stimulating factor: molecular mechanisms of action during steady state and 'emergency' hematopoiesis. Cytokine. 42, 277-288. Paroo Z; Ye X; Chen S; Liu Q. (2009). Phosphorylation of the human microRNA-generating complex mediates MAPK/Erk signaling. Cell. 139, 112-122. Pasquinelli AE; Reinhart BJ; Slack F; Martindale MQ; Kuroda MI; Maller B; Hayward DC; Ball EE; Degnan B; Müller P; Spring J; Srinivasan A; Fishman M; Finnerty J; Corbo J; Levine M; Leahy P; Davidson E; Ruvkun G. (2000). Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature. 408, 86-89. Pazdrak K; Stafford S; Alam R. (1995). The activation of the Jak-STAT 1 signaling pathway by IL-5 in eosinophils. J. Immunol. 155, 397-402. Petersen CP; Bordeleau ME; Pelletier J; Sharp PA. (2006). Short RNAs repress translation after initiation in mammalian cells. Mol. Cell. 21, 533542. Petrovick MS; Hiebert SW; Friedman AD; Hetherington CJ; Tenen DG; Zhang DE. (1998). Multiple functional domains of AML1: PU.1 and C/EBPalpha synergize with different regions of AML1. Mol. Cell Biol. 18, 3915-3925. Pillai RS; Bhattacharyya SN; Artus CG; Zoller T; Cougot N; Basyuk E; Bertrand E; Filipowicz W. (2005). Inhibition of translational initiation by Let-7 MicroRNA in human cells. Science. 309, 1573-1576. Pöpperl H; Featherstone MS. (1993). Identification of a retinoic acid response element upstream of the murine Hox-4.2 gene. Mol. Cell Biol. 13, 257265. Provost P; Dishart D; Doucet J; Frendewey D; Samuelsson B; Rådmark O. (2002). Ribonuclease activity and RNA binding of recombinant human Dicer. EMBO J. 21, 5864-5874. Pulikkan JA; Peramangalam PS; Dengler V; Ho PA; Preudhomme C; Meshinchi S; Christopeit M; Nibourel O; Müller-Tidow C; Bohlander SK; Tenen DG; Behre G. (2010). C/EBPα regulated microRNA-34a targets E2F3 during granulopoiesis and is down-regulated in AML with CEBPA mutations. Blood. 116, 5638-5649. Radomska HS; Satterthwaite AB; Burn TC; Oliff IA; Huettner CS; Tenen DG. (1998). Multiple control elements are required for expression of the

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

30

Alexander Brobeil

human CD34 gene. Gene, 222, 305-318. Erratum in: Gene. 239, 203 (1999). Rehwinkel J; Behm-Ansmant I; Gatfield D; Izaurralde E. (2005). A crucial role for GW182 and the DCP1:DCP2 decapping complex in miRNAmediated gene silencing. RNA. 11, 1640-1647. Reinhart BJ; Slack FJ; Basson M; Pasquinelli AE; Bettinger JC; Rougvie AE; Horvitz HR; Ruvkun G. (2000). The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature. 403, 901-906. Ruby JG; Jan CH; Bartel DP. (2007). Intronic microRNA precursors that bypass Drosha processing. Nature. 448, 83-86. Sakamoto S; Aoki K; Higuchi T; Todaka H; Morisawa K; Tamaki N; Hatano E; Fukushima A; Taniguchi T; Agata Y. (2009). The NF90-NF45 complex functions as a negative regulator in the microRNA processing pathway. Mol. Cell Biol. 29, 3754-3769. Salzman DW; Shubert-Coleman J; Furneaux H. (2007). P68 RNA helicase unwinds the human let-7 microRNA precursor duplex and is required for let-7-directed silencing of gene expression. J. Biol. Chem. 282, 3277332779. Schwarz DS; Hutvágner G; Du T; Xu Z; Aronin N; Zamore PD. (2003). Asymmetry in the assembly of the RNAi enzyme complex. Cell. 115, 199208. Scott LM; Civin CI; Rorth P; Friedman AD. (1992). A novel temporal expression pattern of three C/EBP family members in differentiating myelomonocytic cells. Blood. 80, 1725-1735. Seca H; Almeida GM; Guimarães JE; Vasconcelos MH. (2010). miR signatures and the role of miRs in acute myeloid leukaemia. Eur. J. Cancer. 46, 1520-1527. Slezak-Prochazka I; Durmus S; Kroesen BJ; van den Berg A. (2010). MicroRNAs, macrocontrol: regulation of miRNA processing. RNA. 16, 1087-1095. Song JJ; Smith SK; Hannon GJ; Joshua-Tor L. (2004). Crystal structure of Argonaute and its implications for RISC slicer activity. Science. 305, 1434-1437. Starczynowski DT; Morin R; McPherson A; Lam J; Chari R; Wegrzyn J; Kuchenbauer F; Hirst M; Tohyama K; Humphries RK; Lam WL; Marra M; Karsan A. (2011). Genome-wide identification of human microRNAs located in leukemia-associated genomic alterations. Blood. 117, 595-607. Sun SM; Dijkstra MK; Bijkerk AC; Brooimans RA; Valk PJ; Erkeland SJ; Löwenberg B; Jongen-Lavrencic M. (2011). Transition of highly specific

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Regulation of Granulocyte Differentiation …

31

microRNA expression patterns in association with discrete maturation stages of human granulopoiesis. Br. J. Haematol. 155, 395-398. Suzuki HI; Yamagata K; Sugimoto K; Iwamoto T; Kato S; Miyazono K. (2009). Modulation of microRNA processing by p53. Nature. 460, 529533. Tam W. (2011). Identification and characterization of human BIC, a gene on chromosome 21 that encodes a noncoding RNA. Gene. 274, 157-167. Tocci A; Parolini I; Gabbianelli M; Testa U; Luchetti L; Samoggia P; Masella B; Russo G; Valtieri M; Peschle C. (1996). Dual action of retinoic acid on human embryonic/fetal hematopoiesis: blockade of primitive progenitor proliferation and shift from multipotent/erythroid/monocytic to granulocytic differentiation program. Blood. 88, 2878-2888. Trabucchi M; Briata P; Garcia-Mayoral M; Haase AD; Filipowicz W; Ramos A; Gherzi R; Rosenfeld MG. (2009). The RNA-binding protein KSRP promotes the biogenesis of a subset of microRNAs. Nature. 459, 10101014. van de Geijn GJ; Aarts LH; Erkeland SJ; Prasher JM; Touw IP. (2003). Granulocyte colony-stimulating factor and its receptor in normal hematopoietic cell development and myeloid disease. Rev. Physiol. Biochem. Pharmacol. 149, 53-71. Vasilatou D; Papageorgiou S; Pappa V; Papageorgiou E; Dervenoulas J. (2010). The role of microRNAs in normal and malignant hematopoiesis. Eur. J. Haematol. 84, 1-16. Velu CS; Baktula AM; Grimes HL. (2009). Gfi1 regulates miR-21 and miR196b to control myelopoiesis. Blood. 113, 4720-4728. Ward AC; Hermans MH; Smith L; van Aesch YM; Schelen AM; Antonissen C; Touw IP. (1999). Tyrosine-dependent and -independent mechanisms of STAT3 activation by the human granulocyte colony-stimulating factor (GCSF) receptor are differentially utilized depending on G-CSF concentration. Blood. 93, 113-124. Ward AC; Loeb DM; Soede-Bobok AA; Touw IP; Friedman AD. (2000). Regulation of granulopoiesis by transcription factors and cytokine signals. Leukemia. 14, 973-990. Warlick ED; Smith BD. (2007). Myelodysplastic syndromes: review of pathophysiology and current novel treatment approaches. Curr. Cancer Drug Targets. 7, 541-558. Welker N; Maity TS; Ye X; Aruscavage PJ; Krauchuk AA; Liu Q; Bass BL. (2011). Dicer's helicase domain discriminates dsRNA termini to promote an altered reaction mode. Mol. Cell. 41, 589-599.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

32

Alexander Brobeil

Wiedamann C. (2009). Development: Terminal differentiation. Nat. Rev. Neurosci. 10, 469. Wightman B; Ha I; Ruvkun G. (1993). Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell. 75, 855-862. Yamagata K; Fujiyama S; Ito S; Ueda T; Murata T; Naitou M; Takeyama K; Minami Y; O'Malley BW; Kato S. (2009). Maturation of microRNA is hormonally regulated by a nuclear receptor. Mol Cell, 36, 340-347. Erratum in: Mol. Cell. 37, 588 (2009). Yi R; Qin Y; Macara IG; Cullen BR. (2003). Exportin-5 mediates the nuclear export of pre-microRNAs and short hairpin RNAs. Genes Dev. 17, 30113016. Zeng Y; Yi R; Cullen BR. (2005). Recognition and cleavage of primary microRNA precursors by the nuclear processing enzyme Drosha. EMBO J. 24, 138-148. Zhang DE; Zhang P; Wang ND; Hetherington CJ; Darlington GJ; Tenen DG. (1997). Absence of granulocyte colony-stimulating factor signaling and neutrophil development in CCAAT enhancer binding protein alphadeficient mice. Proc. Natl. Acad. Sci. U. S. A. 94, 569-574. Zhang H; Kolb FA; Jaskiewicz L; Westhof E; Filipowicz W. (2004). Single processing center models for human Dicer and bacterial RNase III. Cell. 118, 57-68. Zhang H; Nguyen-Jackson H; Panopoulos AD; Li HS; Murray PJ; Watowich SS. (2010). STAT3 controls myeloid progenitor growth during emergency granulopoiesis. Blood. 116, 2462-2471. Zhang P; Behre G; Pan J; Iwama A; Wara-Aswapati N; Radomska HS; Auron PE; Tenen DG; Sun Z. (1999). Negative cross-talk between hematopoietic regulators: GATA proteins repress PU.1. Proc. Natl. Acad. Sci. U. S. A. 96, 8705-8710. Zhang S; Banerjee D; Kuhn JR. (2011). Isolation and culture of larval cells from C. elegans. PLoS One. 6, e19505.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

In: Granulocytes Editors: H. Abukara and M. Jumonji

ISBN: 978-1-61942-806-5 © 2012 Nova Science Publishers, Inc

Chapter 2

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

THE ESSENTIAL TRANSCRIPTION FACTOR FOR GRANULOCYTIC DIFFERENTIATION, CCAAT/ENHANCER BINDING PROTEIN ALPHA (C/EBPΑ), AND ITS MUTATIONS OR INHIBITION ASSOCIATED WITH ACUTE MYELOID LEUKEMIAS Ota Fuchs Institute of Hematology and Blood Transfusion, U Nemocnice 1, 128 20 Prague 2, Czech Republic

ABSTRACT The multistep development of blood cells from hematopoietic stem cells (HSCs) is regulated by cytokines and cell-cell interactions. Transcription factors also play an important role in HSCs and not only in lineage restricted precursors. C/EBPα represses self-renewal of adult HSCs through an as yet unknown mechanism. C/EBPα is one of the major regulators in granulopoiesis, where it regulates differentiation during the transition from the common myeloid progenitor to the granulocyte-macrophage progenitor. C/EBPα induces myeloid differentiation via up-regulation of specific genes involved in granulocytic maturation and in inhibition of myeloid cell proliferation. Early markers of granulopoiesis induced by C/EBPα include granulocyte-

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

34

Ota Fuchs colony stimulating factor (G-CSF), CD33 and CD13 surface markers, myeloperoxidase (MPO), neutrophil elastase, myeloblastin, and lysozyme. Later markers of neutrophil development, such as lactoferrin and neutrophil gelatinase are also induced by C/EBPα. C/EBPα rapidly induces expression of further two transcription factors functioning in granulocyte differentiation, C/EBPε and PU.1/Spi1. CEBPA gene knockout in mice caused a selective block in neutrophil differentiation at the myeloblast level, whereas other blood cells develop normally. CEBPA is intronless and generates two isoforms, CEBPα p30 (30 kDa) and p42 (42 kDa), as a result of the differential utilization of alternate translation start codons. It has been demonstrated that C/EBPα p30 not only inhibits DNA binding of CEBPα p42 and its transactivation function in the expression of key granulocytic target genes but also binds to the promoters of another target genes and alters their expression. Phosphorylation and sumoylation of C/EBPα are important posttranslational modifications which cause changes in function of this protein. Dominant-negative, loss of function mutations in CEBPA have been identified in acute myeloid leukemia (AML) as either monoallelic or biallelic mutations. Biallelic disruption of the N- and C- terminus of C/EBPα in AML patients with a normal karyotype confer favorable prognosis when Fms-like tyrosine kinase 3 (FLT3) is not mutated. Patients with CEBPA mutations had a 60% reduction of the risk for failure to achieve complete remission, relapse or death. Fusion proteins that are associated with chromosome translocations t(8;21), inv (16) or t(15;17) repress CEBPA expression by transcriptional or posttranscriptional regulation. CEBPA expression can be silenced also by CEBPA promoter hypermethylation or overexpression of TRIB2 or TRIB1 (Tribbles homologs). Trib1 and Trib2, but not Trib3 function as adaptors to recruit E3 ubiquitin ligase and to enhance ubiquitylation of C/EBPα to promote its degradation. CEBPA promoter methylation testing is probable as important as CEBPA mutation testing for identifying AML cases with CEBPA dysregulation and has a prognostic significance.

Keywords: C/EBPα, microRNA, granulopoiesis, differentiation, cell cycle, leukemia.

INTRODUCTION The CCAAT/enhancer binding proteins (C/EBPs) are a family of six basic region leucine zipper (bZIP) transcription factors playing an important role in controlling cell proliferation and differentiation. C/EBPα is the most well studied founding member of this family, which plays a critical role in the

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

The Essential Transcription Factor …

35

regulation of mitotic growth arrest and differentiation in numerous cell types, including preadipocytes, myeloid cells, hepatocytes, keratinocytes, and pneumocytes [1-7]. C/EBPα has lineage-instructive function in hematopoietic stem cells (HSCs) [8]. C/EBPα is one of the major regulators in granulopoiesis, where it regulates differentiation during the transition from the common myeloid progenitor to the granulocyte-macrophage progenitor [6, 917]. C/EBPα induces myeloid differentiation via up-regulation of specific genes involved in granulocytic maturation and in inhibition of myeloid cell proliferation. Early markers of granulopoiesis induced by C/EBPα include granulocyte-colony stimulating factor (G-CSF), CD33 and CD13 surface markers, myeloperoxidase (MPO), neutrophil elastase, myeloblastin, and lysozyme. Later markers of neutrophil development, such as lactoferrin and neutrophil gelatinase are also induced by C/EBPα. C/EBPα rapidly induces expression of further two transcription factors functioning in granulocyte differentiation, C/EBPε and PU.1/Spi1. Knockout experiments producing C/EBPα null mice display cell proliferative defects in the liver and lung and die at birth because of energy imbalance presumably from impaired glucose metabolism and altered fat metabolism with a failure of adipocytes to accumulate lipids [18-23]. Several human tumour types display reduction in the levels of C/EBPα suggesting that C/EBPα is a tumour suppressor [24-27]. However, genetic evidence supporting the tumor suppressor function of C/EBPα has been only obtained for myeloid leukemias [28-31]. Downregulation or functional inactivation of C/EBPα might be a required step in the development in several tumor types, indicating a general role for C/EBPα as a tumor suppressor. C/EBPα is abundantly expressed in mouse epidermal keratinocytes. On the other hand, C/EBPα mRNA and protein levels were greatly diminished in squamous cell carcinoma cell lines and also in the skin squamous cell carcinoma itself. Oncogenic Ras, which is present in squamous cell carcinoma cells, negatively regulates CEBPα expression and the loss of CEBPA expression may contribute to the development of skin squamous cell carcinoma [32]. Mice lacking C/EBPα in the epidermis, although showing normal differentiation and keratinocyte proliferation, were highly susceptible to skin tumorigenesis [33]. The role of impaired C/EBPα function in tumor progression is supported by experiments with reintroduction of C/EBPα. Reintroduced C/EBPα caused the growth arrest blocked in vivo tumorigenicity of AML and skin carcinomas [34-36]. On the other hand, overexpression of apparently normal C/EBPα RNA or protein was observed in 6 patients with B-cell precursor acute lymphoblastic leukemia (BCP-ALL) harboring the translocation t(14; 19)(q32; q13). CEBPA is activated in these

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

36

Ota Fuchs

BCP-ALL cells by juxtaposition to the immunoglobulin gene enhancer upon this rearrangement and exhibits oncogenic properties [37, 38].

STRUCTURE AND FUNCTION OF C/EBPΑ

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

CEBPA Gene and C/EBPα mRNA C/EBPα is encoded by an intronless gene that is 2783 bp long and maps to human chromosome 19q13.1 [39]. Expression patterns of C/EBPα mRNA are similar in the mouse and human with measurable levels in liver, adipose tissue, intestine, lung, adrenal gland, skeletal muscle, pancreas, placenta, prostate epithelium, mammary gland and peripheral blood mononuclear cells. However, the expression was undetectable or very low in brain, kidney, thymus, testis and ovary [40]. In liver and adipose tissue, highest levels of C/EBPα mRNA are detected only in differentiated tissue. C/EBPα mRNA is translated into two major proteins, full length C/EBPα p42 (42 kDa) and truncated C/EBPα p30 (30 kDa) by a ribosome-scanning mechanism in which a fraction of ribosomes ignore the first two AUG codons and initiate translation at the third AUG codon located 351 nucleotides downstream of the first one (Figure 1).

Figure 1. Schematic presentation of the domain structure of C/EBPα protein, phosphorylation and sumoylation sites, protein interaction regions and protein interaction partners. Numbers directly above the schema of protein indicate the amino acids of the rat C/EBPα protein. The full-length, 42 kDa form of C/EBPα protein and the shorter 30 kDa form of the protein are also shown.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

The Essential Transcription Factor …

37

Translation start site multiplicity of the C/EBPα mRNA is dictated by a small open reading frame in the 5‟ untranslated region that is out of frame with the coding region of C/EBPα [41, 42]. The translation product C/EBPα-30 initiated at the third AUG codon is devoid of the potent transcription-regulation domain contained in C/EBPα p42 and stimulates transcription of the target gene (e.g. albumin gene) much less efficiently than the C/EBPα p42 [43]. Activity of the translation initiation factors eIF2 and eIF4E plays an important role in translation of both isoforms (full length and truncated). High activity of these translation initiation factors results in the expression of C/EBPα p30 [42, 44]. Changes in the ratio of p42:p30 isoforms of C/EBPα play a critical role in contributing to AML.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Transcription Factor C/EBPα The full-length, 42 kDa form of C/EBPα contains three transactivation domains (TE-I, TE-II and TE-III, today they are often also described as two transcription activation domains TAD1 and TAD2) as well as the basic region/leucine zipper (bZIP) [45]. This bZIP domain contains a basic region (BR), which mediates DNA binding, and a leucine zipper region (LZ) for homodimerization and heterodimerization of C/EBPα with other C/EBP and different proteins (Figure 1). TE-I and TE-II domains (sometimes marked as TAD1) mediate cooperative binding of C/EBPα to TBP (TATA box-binding protein) and another basal transcription initiation factor TFIIB [46]. Both, TBP and TFIIB are essential components of the RNA polymerase II basal transcription apparatus. The TE-III domain (also known as TAD2) contains a negative regulatory subdomain [45, 47]. This negative regulatory region or transcriptional attenuator domain also inhibits transcriptional synergy of multiple DNA-binding regulators and was named synergy control (SC) motif [48]. The truncated C/EBPα p30 isoform acts as an inhibitor of C/EBPα p42mediated transactivation of transcription of target genes. This inhibition occurs by formation of heterodimers of both C/EBPα isoforms. These heterodimers have impaired DNA-binding ability and transcription transactivation capacity compared with C/EBPα p42 homodimers [43, 49]. There are examples where the C/EBPα p30 isoform has some transcriptional activity [50]. In these cases the truncated C/EBPα p30 isoform might stabilize binding of other

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

38

Ota Fuchs

transcription factors and activate transcription. This 30 kDa product also lacks the antimiotic activity exhibited by the full-length C/EBPα p42 [51]. The basic region (BR) of C/EBP which mediates DNA binding, preferentially recognizes the palindromic DNA sequence 5‟-ATTGCGCAAT3‟ [52, 53]. Although the C/EBPs possess similar DNA binding specificities and dimerization properties, each protein exhibits unique functional properties in vivo. The appearance of specific phenotypes in each C/EBP-deficient mouse shows that these proteins do not have fully redundant functions. Direct evidence for specific functions has come from experiments where the coding sequence for C/EBPα was replaced with the coding sequence C/EBPβ. This gene replacement strategy to generate a viable and fertile C/EBPα-null mouse line rescued hepatic-specific function to maintain normal blood glucose levels, but could not rescue function in white adipose tissue to regulate fat storage [54].

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

The Post-Translational Modifications of C/EBPα Phosphorylation and sumoylation of C/EBPα are important regulatory mechanisms which cause changes in function of this protein. Phosphorylation and sumoylation sites in the C/EBPα protein are shown in Figure 1.

Phosphorylation of C/EBPα The McDonough strain of feline sarcoma virus contains an oncogene called v-fms with tyrosine kinase activity. Fms-like tyrosine kinase 3 (Flt3) encodes a receptor tyrosine kinase for which activating mutations have been identified in a proportion of acute myelogenous leukemia (AML) patients. These mutations activate the Flt3 kinase activity constitutively, and result in increased cellular proliferation and viability. Activation of Flt3 inhibits C/EBPα function by extracellular signal receptor kinase (ERK)1/2-mediated phosphorylation on serine 21 (S21), which affects the ability of C/EBPα to induce granulocytic differentiation and may explain the differentiation block of leukemic blasts [55]. Dephosphorylation of C/EBPα on S21 was also seen with an Flt3 tyrosine kinase inhibitor [55]. Glycogen synthase kinase-3 (GSK3), an insulin-inhibited protein kinase phosphorylates C/EBPα on two threonine residues (T222 and T226, refer to rodent sequence) and on serine (S230). The functional importance of these

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

The Essential Transcription Factor …

39

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

phosphorylation events in the regulation of C/EBPα activity is not yet clear but plays some role in preadipocyte diferentiation [56]. Ras signalling phosphorylates C/EBPα on serine 248 of the transactivation domain, resulting in an enhancement of the ability of C/EBPα to transactivate the granulocyte-colony stimulating factor (G-CSF) receptor promoter, which contributes to the induction of granulocyte differentiation [57].

Figure 2. A proposed pathway by which Ser 193-dephosphorylated C/EBPα accelerates liver proliferation. In quiescent livers, C/EBPα arrests proliferation through inhibition of CDK2 and E2F transcription. Partial hepatectomy and liver tumors activate the PI3K/Akt/protein phosphatase PP2A pathway, which dephosphorylates Ser 193 and blocks the interactions of C/EBPα with CDK2 and catalytic subunit Brm (Brahma) of chromatin remodeling complex SWI/SNF. The Ser 193-dephosphorylated C/EBPα interacts with pRb and sequesters pRb from the E2F-pRb complexes, leading to accelerated proliferation.

The biological function of C/EBPα in liver cells also depends on phosphorylation-dephosphorylation of a single serine 193 (S193) residue within the C/EBPα growth-inhibitory region [58]. S193-phosphorylated C/EBPα binds to cyclin-dependent kinase 2 (CDK2) and to brahma (Brm, named according to the ATPase of the Drosophila SWI/SNF complex involved in chromatin remodelling during transcription) and inhibits proliferation. S193-dephosphorylated C/EBPα accelerates proliferation by neutralization

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

40

Ota Fuchs

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

growth-inhibitory activity of retinoblastoma protein (Rb) through sequestering Rb from E2F-Rb complex repressors (Figure 2). The E2F transcription factor plays a crucial role in the control of cell cycle progression and regulates the expression of genes required for G1/S transition (Figure 3). E2F activity is modulated by multiple mechanisms including negative regulation by interaction with the product of the Rb tumour suppressor gene expression. The binding of Rb to E2F results in active transcriptional repression of E2Fregulated genes and in growth suppression.

Figure 3. Regulation of G1-S progression during cell cycle by C/EBPα protein. Retinoblastoma protein (pRb) is phosphorylated by Cdks that are inhibited by C/EBPα protein and p21WAF1/CIP1 Cdk inhibitor induced by C/EBPα protein. Phosphorylation of pRb and its release from transcription factor E2F derepresses Sphase genes, which are otherwise inhibited by the pRb-E2F complex through recruitment of the SWI/SNF chromatin-remodelling complex and histone deacetylases (HDACs). C/EBPα protein may be bound to promoters of target S-phase genes indirectly by E2F or it could bind directly to target S-phase gene promoters.

Mass spectrometry-based proteomic approach was applied to identify putative coactivator proteins interacting with the DNA-binding domain (DBD) of C/EBP transcription factors [59]. c-Jun N-terminal kinase 1 (JNK1) among others was detected as protein interacting with DBD of C/EBPs from nuclear extract of myelomonocytic U937 cells. JNK1 phosphorylates C/EBPα at unidentified amino-acid residue and inhibits its ubiquitination, probably owing to altered conformation of C/EBPα [59]. This results in increased C/EBPα

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

The Essential Transcription Factor …

41

stability and availability which is reflected by enhanced DNA binding and transcriptional activity of C/EBPα. In some patients with acute myeloid leukemia (AML), the JNK1 mRNA expression and its kinase activity are decreased which suggests a possible reason for C/EBPα inactivation in AML. The activation of phospatidylinositol 3-kinase (PI3K)/Akt (protein kinase B) in liver tumours leads to accumulation of protein phosphatase 2A (PP2A) in the nuclei, where PP2A dephosphorylates C/EBPα on S193 and blocks its growth-inhibitory activity [60]. This PI3K/Akt-mediated block of C/EBPα inhibition leads to the lack of negative control of proliferation in the liver and to development of tumours.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Sumoylation of C/EBPα C/EBPα can be sumoylated at the lysine residue of SC motif within the transcriptional attenuator domain [61, 62]. Sumoylation of this motif can affect the inhibitory function by influencing protein-protein interactions, a mechanism by which sumoylation probably regulates the activity of the transcription factor. Sato et al. [62] investigated the level and functional roles of sumoylated C/EBPα during the differentiation of hepatocytes. SUMO-1 (small ubiquitin-related modifier-1) masks BRG1 (product of expression of brahma-related gene 1)-binding site of C/EBPα. BRG-1 is the core subunit of an ATP-dependent chromatin remodelling complex. Sumoylation of C/EBPα dramatically decreases the stimulation of C/EBPα-mediated transactivation of the liver-specific albumin gene by BRG1. Sumoylated C/EBPα failed to induce proliferation arrest because its interaction with with BRG1 was inhibited. Mutations in C/EBPα occur in approximately 5-14% of AML patients and are often associated with the induction of proliferation. N-terminal mutations cause truncation of the 42 kDa C/EBPα and overproduction of 30 kDa C/EBPα isoform that lacks TE-I and TE-II transactivation domains but retains TE-III and bZIP domains. 30 kDa C/EBPα isoform predominates and functions in a dominant negative manner resulting in a loss of C/EBPα function. One of target proteins of 30 kDa C/EBPα isoform is Ubc9, an essential E2 enzyme required for SUMO conjugation, or sumoylation [63]. Ubc9-mediated enhanced sumoylation of C/EBPα p42 decreases the transactivation capacity and thus the function of C/EBPα p42 (Figure 4).

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

42

Ota Fuchs

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Figure 4. Model for the role of the E-2 conjugating enzyme Ubc9,which is essential for sumoylation, in AML with C/EBPα N-terminal mutation, where expression of C/EBPα p30 dominant negative isoform is increased. C/EBPα p30 enhances C/EBPα p42 sumoylation via upregulation of Ubc9 and blocks the transcription and differentiation potential of C/EBPα p42. Small interference RNA for Ubc9 (Ubc9 si RNA) overcomes the C/EBPα p30-mediated block of transcription and differentiation potential of C/EBPα p42.

REGULATION OF CELL CYCLE PROGRESSION BY C/EBPΑ Growth-Inhibiting Activity of C/EBPα C/EBPα is a strong inhibitor of cell proliferation when overexpressed in cultured cells [30, 64]. C/EBPα mediates differentiation in several organ systems, including liver, adipose, lung and the hematopoietic tissue. C/EBPα promotes differentiation by the up-regulation of lineage-specific gene products and by the exit from cell cycle that means proliferation arrest. The capacity of C/EBPα to promote growth arrest has been studied in vitro, by analysis of knockout mice and by examination of leukemic cells [30, 65]. Several models of C/EBPα-induced growth arrest have been described [20, 53]. These include C/EBPα-mediated (1) stabilization of the cyclin-dependent kinase 2 (CDK2) inhibitor, p21WAF1/CIP1 [66], (2) regulation of growth-inhibiting Rb-E2F complexes [67], (3) interaction with free E2F, inhibition of E2F activity and down-regulation of the E2F target gene c-myc [68, 69], (4) interaction with Max, a member of the basic region-helix-loop-helix-leucine zipper proteins, that belongs to a network of transcription factors including the Myc and Mad

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

The Essential Transcription Factor …

43

families of protein [70, 71]. (5) inhibition of CDK2 and CDK4 activity [72], and (6) interaction with the SWI/SNF chromatin remodelling complexes [73, 74]. Models (1) and (2) have been questioned by experiments performed in p21WAF1/CIP1 [75] and Rb [76] null cell lines. Although the p21WAF1/CIP1 protein is a key element of growth regulation in cells in culture, p21WAF1/CIP1 knockout mice are morphologically normal and do not exhibit increased tumor formation. Overexpression of p21WAF1/CIP1 in liver resulted in a dramatic inhibition of liver proliferation during development as well as in response to the proliferative stimulus of partial hepatectomy. C/EBPα controls hepatocyte proliferation in vivo in the developing liver. In the absence of C/EBPα, p21WAF1/CIP1 protein levels are reduced and changes in p21WAF1/CIP1 protein levels do not correlate with p21WAF1/CIP1 mRNA levels. In the regenerating rat liver, C/EBPα and p21WAF1/CIP1 protein levels are coordinated. Pocket domain proteins (pRb, p107 and p130) plays a key role in controlling cell proliferation. They function mainly through their interaction with E2F transcription factors, forming complexes that repress transcription of S-phase genes (Figure 2 and Figure 3). Proteins p107 and p130 preferentially associate with E2F4 and E2F5, whereas pRb can bind to all the E2Fs [77]. C/EBPα regulates the formation of growth-inhibiting E2F-pRb complexes or enhances their activity. C/EBPα disrupts E2F-p107 complexes associated with proliferating liver cells [67]. However, C/EBPα increases the abundance of E2F-p130 complexes in 3T3-L1 preadipocytes [78]. This response involves induction or/and stabilization of p21WAF1/CIP1, which inhibits CDK activity. According to the model (3) C/EBPα suppresses cell proliferation through interaction with free E2F, as opposed to regulating pRb-E2F complexes. Different regions of C/EBPα are involved in growth inhibition (Figure 1). C/EBPα was found in complex with E2F and this complex was bound to E2F sites in genes such as dihydrofolate reductase (DHFR) in murine fibroblasts where C/EBPα inhibits proliferation [79]. E2F-1 was upregulated during the G1-S transition and C/EBPα also repressed transcription from reporter constructs containing the DHFR or E2F-1 promoters [79]. C/EBPα can repress transcription from the Myc promoter, which also contains an E2F-binding element [68]. C/EBPα in complex with E2F are thus present in repressors which inhibit S-phase gene transcription. Further support for the E2F corepression model was described by Porse et al. [69]. They identified transactivation element TE-I at the N-terminus of C/EBPα as a critical inhibitory domain. They also studied basic region of the C/EBPα which plays an important role in protein-protein interactions of C/EBPα. C/EBPα interacts

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

44

Ota Fuchs

with free E2F through the non-DNA binding surface of its basic region. These interactions are necessary for C/EBPα activity. Mutations in this basic region cause decreased repression of E2F-driven transcription compared with wildtype C/EBPα. These mutations also inhibit differentiation of adipocytes and neutrophils, whereas other hematopoietic lineages develop normally. No definitive evidence for C/EBPα-E2F complexes bound to E2F sites via the E2F has been reported till now [30, 65, 80]. The basic DNA-binding region of the C/EBPα is also involved in the C/EBPα and Max interaction, likely through C/EBPα R297, K298 and/or K302 in the fourth model [71]. C/EBPα R297 is known to participate in the interaction between C/EBPα and E2F [69]. Model (4) based on interaction of C/EBPα with the basic region-helixloop-helix-leucine zipper protein Max is conected with model (3) through the protein c-Myc, the E2F target gene. c-Myc is a basic helix-loop-helix leucine zipper protein that dimerizes with its partner Max to activate gene transcription through consensus E-box elements located on the promoters of certain genes [81, 82]. Myc was discovered to be an oncogene causing leukemia in birds and inducing in vitro transformation of avian myeloid cells [83]. Dysregulated c-Myc expression has been implicated in the development of lymphoid malignancies and other tumors [84,85], as well as in the induction of genomic instability [86]. This demonstates an important role of c-Myc in the regulation of the cell cycle [87]. Interaction of C/EBPα with Max involves the basic region of C/EBPα. Endogenous C/EBPα and Max but not Myc and Max, colocalize in intranuclear structures during granulocyte differentiation of myeloid U937 cells. Max enhanced the transactivation capacity of C/EBPα on a minimal promoter. A chromatin immunoprecipitation assay revealed occupancy of the human C/EBPα promoter in vivo by Max and Myc under cellular settings and by C/EBPα and Max under retinoic acid induced granulocytic differentiation [71]. Enforced expression of Max and C/EBPα results in granulocytic differentiation of the human hematopoietic CD34+ cells. Silencing of Max by short hairpin RNA in CD34+ and U937 cells strongly reduced the differentiation-inducing potential of C/EBPα, indicating the importance of C/EBPα-Max in myeloid progenitor differentiation [71]. In the CDK2/CDK4 inhibition model (5), C/EBPα interacts with and inhibits the activity of CDK2/CDK4 through the 15-amino acid proline- and histidine-rich region (PHR) located in the central part of C/EBPα [72]. CDK2 and CDK4 are key regulators of cell cycle progression. They phosphorylate pocket domain proteins thereby releasing their inhibition of E2F family members. C/EBPα binds to, and inhibits the activities of, both CDK2-cyclin E

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

The Essential Transcription Factor …

45

and CDK4-cyclin D complexes. Model (5) has also been questioned by control experiments with mice homozygous for the deletion of PHR [88]. C/EBPα∆PHR is responsible for interaction of C/EBPα with Cdk2/4. Mice homozygous for the ∆PHR allele did not display any phenotype that could be related to the role of C/EBPα as a growth repressor [88]. C/EBPα may promote growth arrest by cell-specific mechanisms. This means that different models of C/EBPαmediated cell-cycle arrest (Figure 2) operate in different cell types. components through a centrally located 75-amino acid region overlapping with the CDK2/CDK4 binding region [73, 74]. C/EBPα interacts with the SWI/SNF chromatin remodeling complex during the regulation of differentiation-specific genes. C/E Finally, according to the SWI/SNF recruitment model (6), C/EBPα interacts with SWI/SNF BPα fails to suppress proliferation in SWI/SNF defective cell lines after knock-down of SWI/SNF core components or after deletion of the SWI/SNF interaction domain in C/EBPα respectively. Reconstitution of SWI/SNF function restores C/EBPαdependent proliferation arrest. Antiproliferative activity of C/EBPα critically depends on components of the SWI/SNF core complex and suggest that the functional interaction between SWI/SNF and C/EBPα is a prerequisite for proliferation arrest. Although overexpression experiments and analysis of cells lacking known cell-cycle regulators are useful for identifying the pathways in which C/EBPα functions, these approaches do not necessarily reveal the primary target. A unifying mechanism of how C/EBPα suppresses proliferation has yet to be found.

FUNCTIONAL ROLE OF C/EBPΑ IN LINEAGE SPECIFICATION Hematopoietic stem cells (HSCs) undergo change from an actively cycling state to largely quiescent in mouse bone marrow 3 weeks after birth. Levels of C/EBPα regulate the proliferative states of HSCs [89]. C/EBPα excision in adult mice results in expansion of HSCs and in their elevated proliferation rates. Therefore, C/EBPα functions as a mitotic inhibitor of adult HSCs. Rapid increase of C/EBPα expression was found in agreement with state of HSCs 3 weeks after birth. Hematopoiesis is highly regulated multistage process wherein a pluripotent self-renewing HSC differentiates into more committed progenitor cells that give rise to all blood cell lineages.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

46

Ota Fuchs

Sequential lineage specification processes are called commitment. Transcription factors have emerged as key regulators of lineage determination and differentiation during hematopoiesis [8,13,90,91] C/EBPα affects hematopoietic cell fate decisions by inducing myeloid differentiation and inhibiting erythroid differentiation in progenitors more primitive than GMPs [15]. C/EBPα plays also a regulatory role in maintenance of the HSC population, since both C/EBPα-deficient fetal liver cells and adult bone marrow cells display a competitive advantage over wild type bone marrow cells in transplantation experiments [92]. It has been thought that the commitment was an irreversible process, and cells differentiated into a certain lineage would not change their own fate. However, recent evidence suggest that many immature progenitors still sustain latent differentiation programs to other lineages than their own. Lymphoid lineage-commited progenitors (CLPs, “common lymphoid progenitors“, see Figure 5) maintain a latent myeloid differentiation potential, which can be initiated through exogenously expressed interleukin-2 (IL-2) receptors. Transcription factor C/EBPα is promtly upregulated in CLPs after ectopic IL2 stimulation. This C/EBPα upregulation initiates myeloid differentiation from CLPs and decreases expression of a B lymphoid-specific transcription factor PAX5 which belongs to the paired box family of transcription factors [93]. Using transgenic mice expressing a conditional form of C/EBPα whose activity can be regulated, Fukuchi et al. [94] tested megakaryocyte/erythroid progenitors (MEPs) and CLPs if they could be redirected to myeloid lineage by C/EBPα activation. Lineage conversion was accomplished in both cases by a short-term activation of C/EBPα [94]. These data establish a critical role of C/EBPα not only in the myeloid lineage but also in a whole hematopoietic system. C/EBPα is highly expressed in granulocyte/monocyte progenitors (GMPs) but significantly decreased in basophil/mast cell progenitors (BMCPs) or in mast cell progenitors (MCPs), suggesting that the down-regulation of C/EBPα is critical for the development of basophil and mast cell lineages [95]. C/EBPα needs to be suppressed at the GMP stage for both basophil and mast cell development (Figure 5). C/EBPα is expressed in a biphasic manner for basophil development from GMPs through BMCPs. The downregulation of C/EBPα at the GMP stage proceedes into BMCPs and its reactivation at the BMCP stage gives rise to mature basophils [95]. Transcription factor GATA1 is important for the megakaryocyte/erythrocyte lineage commitment and the transcription factor GATA-2 instructs GMPs to exclusively select the eosinophil fate [95].

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

The Essential Transcription Factor …

47

Figure 5. Schematic presentation of roles of C/EBPα protein and other transcription factors in lineage specification. BaP- basophil progenitor, BMCP – basophil/mast cell progenitor, CLP – common lymphoid progenitor, CMP-common myeloid progenitor, EoP – eosinophil progenitor, GMP – granulocyte/monocyte progenitor, HSC – hematopoietic stem cell, MCP – mast cell progenitor, MEP – megakaryocyte/erythrocyte progenitor.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

C/EBPα Function in Granulopoiesis The main role of C/EBPα in hematopoiesis is in the development of granulocytes [13, 15, 96, 97]. A critical role for the function of C/EBPα in granulopoiesis was demonstrated in mice harboring a disruption of the CEBPA gene [18]. These mice show a selective early block in granulopoiesis, with the appearance of many myeloid blasts in fetal liver and peripheral blood [19]. Other lineages, including macrophages, were not affected. These mice had a selective loss of granulocyte colony-forming units and interleukin-6 (IL-6) responsive colony-forming units, which could be explained by the loss of expression of the granulocyte-colony-stimulating factor (G-CSF) receptor and IL-6 receptor [98, 99]. Hematopoietic cells from these mice failed to express mRNAs for primary or secondary neutrophil granule proteins, such as major primary granule protein (MPO) or lactoferrin [98]. Transcription activation function of C/EBPα is required for induction of granulocytic differentiation (Figure 5) [19]. Further studies demonstrated that at least in vitro, restoration of granulocytic differentiation could be effected by administration of the cytokines IL-3 and granulocyte-macrophage-colony stimulating factor (GMCSF), but not with all-trans retinoic acid (ATRA) [10, 19]. These studies support a model of at least two pathways leading to the differentiation of

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

48

Ota Fuchs

myeloid progenitors to granulocytes, one involving C/EBPα, and one involving IL-3 and GM-CSF [10].

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Cooperation of PU.1 and C/EBPα Transcription Factors in Lineage Decision C/EBPα can cooperate with additional factors to direct monocytic commitment of primary myeloid progenitors [14]. C/EBPα induces transcription factor PU.1 mRNA 2-fold in normal myeloid progenitors. C/EBPα binds and activates the endogenous PU.1 gene in myeloid cells Induction of PU.1 by C/EBPα may account for increased levels of PU.1 in myeloid as compared with B lymphoid cells, and this way may contribute to the to the specification of myeloid progenitors [99]. Genetic analyses suggest that elevation of PU.1 supports monocytic over granulocytic development. Lack of one PU.1 allele favors neutrophil development from embryonic stem cells in vitro and favors neutrophil development in vivo in the absence of GCSF receptor [100]. Cre recombinase-mediated deletion of PU.1 in adult mice preserves granulocytes at the expense of monocytes [101]. C/EBPα and PU.1 are expressed in HSC and are up-regulated in GMPs during granulocyte and macrophage development. However, these both transcription factors are downregulated in megakaryocyte-erythrocyte progenitors [15].

Regulation of MicroRNAs Involved in Granulocytic Differentiation by C/EBPα and Effect of MicroRNA on C/EBPα C/EBPα regulates not only growth factors receptors and other myeloidspecific gene products but it regulates also microRNA-223 (miR-223) which expression is confined to hematopoietic cells [102-106]. The granulocytic differentiation is also favored by a negative-feedback loop in which miR-223 represses nuclear factor I-A (NFI-A) translation. MicroRNA-223 is preferentially expressed in myeloid cells. This miR-223 negatively regulates progenitor proliferation and triggers granulocytic differentiation. However, miR-223 blocks erythroid differentiation. MicroRNA-223 is suppressed in AML by impaired upstream factors (CEBPA, PU.1 and nuclear factor I-A) competing for regulatory binding to upstream sites of the pre-miR-223 sequence and not by DNA sequence alterations or by promoter hypermethylation [107]. MiR-223 targets E2F1, a master cell-cycle regulator,

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

The Essential Transcription Factor …

49

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

by inhibiting translation of E2F1 mRNA [106]. Two transcriptional factors, NFI-A and C/EBPα compete for binding to the miR-223 promoter [103]. NFIA maintains miR-223 at low levels, whereas its replacement by C/EBPα, following retinoic acid-induced differentiation, up-regulates miR-223 expression (Figure 6).

Figure 6. Important roles of microRNA-223 (miR-223) and two transcription factors (C/EBPα and NFI-A) in undifferentiated acute promyelocytic NB4 cells (left panel) and after induction of granulocytic differentiation by retinoic acid (right panel). Two transcription factors, NFI-A and C/EBPα, compete for binding to the miR-223 promoter. NFI-A maintains miR-223 at low levels (left panel), whereas its replacement by C/EBPα, following retinoic acid-induced differentiation, up-regulates miR-223 expression (right panel).

The tumor-suppressive miR-29b is regulated by C/EBPα and blocked in human AML [108]. MicroRNA-328 acts as a decoy by binding to the RNA binding protein hnRNP E2, which interacts with the 5´-untranslated region of the C/EBPα mRNA leading to inhibition of its translation [109]. Gene and microRNA expression profiling of AML patients with CEBPA mutations or with wild type CEBPA have been also studied. Expression of multiple members of the homeobox gene family and lymphoid markers is downregulated in AML patients with biallelic CEBPA mutations. Overexpression of CD34, CD38, CD7 and the upregulation of genes involved in erythroid differentiation in contrast with downregulation of genes active in myeloid differentiation has been found. The analysis of miR expression profile showed 17 miRs that were significantly modulated by CEBPA mutations. Two miRs, miR-34a and miR-194 were downregulated and 15 miRs including miR-

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

50

Ota Fuchs

181 cluster were upregulated [110]. All these observations will be implemented into the clinic.

REGULATION OF C/EBPΑ EXPRESSION

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Decreased Expression of CEBPA by Transcriptional Regulation In the absence of specific CEBPA mutations, decreased exptression may serve as an alternative mechanism that disrupts C/EBPα function. AML with the t(8;21) translocation gives rise to the fusion gene RUNX1-CBF2T1 (also known as AML1-ETO) encoding the AML1-ETO fusion protein. In AML patient samples with this translocation as well as in cell lines (AML1-ETO positive Kasumi-1 cells) derived from these patients, C/EBPα is undetectable. The specific depletion of AML1-ETO (also known as AML1-MTG8) in Kasumi-1 cells by AML1-ETO small interfering RNAs (siRNAs) led to an approximately 15-fold increase in C/EBPα mRNA expression, whereas electroporation with control siRNAs had no effect [111]. AML1-ETO appears to suppress CEBPA expression indirectly by inhibiting positive autoregulation of the CEBPA promoter. Moreover, the application of AML1-ETO siRNAs followed by stimulation with inducers of differentiation (transforming growth factor β1 and vitamin D3) caused a higher expression of CEBPA in comparison to these inducers alone. In addition conditional expression of CEBPA overcomes the block of differentiation caused by AML1-ETO and is sufficient to trigger terminal neutrophilic differentiation. Restoring CEBPA expression will have therapeutic applications in AML1-ETO – positive leukemias [112].

Decreased Expression of CEBPA by Methylation of CEBPA Gene Promoter Epigenetic modification of the distal CEBPA gene promoter region (-1422 to -896 upstream of the transcription start site) results in the downregulation of CEBPA expression in lung cancer [27], head and neck squamous cell carcinoma [113] and pancreatic cancer cells [114]. Aberrant methylation of CEBPA gene core promoter (-141 to -15 from transcription start site was detected also in a small proportion (1.4-2.85%) of AML patients [115, 116]. Methylation in the distal CEBPA gene promoter region has been observed in 51% of selected AML patients [117]. Lin et al. [118] studied methylation of

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

The Essential Transcription Factor …

51

CEBPA gene promoter in 193 unselected patients with de novo AML. They found that CEBPA hypermethylation appeared to be a favorable prognostic marker, in addition to the favorable karyotypes, nucleophosmin (NPM1) mutation and CEBPA mutation, in patients with de novo AML. Similarly, Szankasi et al. [119] observed that methylated cases and those with bi-allelic CEBPA mutations have similar phenotypic features including expression of T cell associated genes such as CD7 and lack of co-incident NPM1 mutations. The CEBPA gene is down-regulated in acute promyelocytic leukemia and its upstream promoter, but not core promoter, is highly methylated [120].

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Decreased Expression of C/EBPα by Posttranscriptional Regulation Posttranscriptional regulation of C/EBPα in myeloid leukemias was demonstrated in AML with t(3;21)(q26;q22) translocation encoding the AML1-MDS1-EVI1 (AME) fusion gene [121]. The RNA-binding protein calreticulin was strongly activated in AML patient samples with AME fusion protein. Calreticulin binds strongly to GC-rich stem structure in stem loop within the coding region of C/EBPα mRNA and inhibits translation of this mRNA [121]. The same mechanism of inhibition of C/EBPα mRNA translation was described for CBFB-MYH11 (“core binding factor betasmooth muscle myosin heavy chain“) leukemic fusion protein, expressed as a result of inv(16)(p13q22), that activates calreticulin binding to C/EBPα mRNA [122].

Decreased or Increased expression of C/EBPα by Posttranslational Regulation Posttranslational regulation of C/EBPα activity in myeloid leukemias is based on phosphorylation and probably also on sumoylation of C/EBPα protein, described in the paragraph about the posttranscriptional modifications of C/EBPα. Further mechanism of C/EBPα protein inactivation is its proteasomal degradation after association with Tribbles homolog 2 (Trib2) [123, 124]. Analysis of 285 AMLs showed that elevated Trib2 expression preferentially associated with a cluster of AMLs characterized by C/EBPα defficiency. Trib2 is an oncoprotein that contributes to the pathogenesis of AML through the inhibition of C/EBPα function. On the other hand, a mass

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

52

Ota Fuchs

spectrometry-based proteomic approach to systematically identify putative coactivator proteins interacting with the DNA-binding domain (DBD) of C/EBPα identified c-Jun N-terminal kinase (JNK) 1 among others proteins as proteins interacting with DBD of C/EBPα from nuclear extract of myelomonocytic U937 cells [125, 126]. Kinase JNK1 physically interacts with DBD of C/EBPα in vitro and in vivo. Active JNK1 inhibits ubiquitination of C/EBPα possibly by phosphorylating in its DBD [125, 126]. Consequently, JNK1 prolongs C/EBPα protein half-life leading to its enhanced transactivation and DNA-binding capacity. In certain AML patients, however, the JNK1 mRNA expression and its kinase activity is decreased which suggests a possible reason for C/EBPα inactivation in AML. JNK1 is a positive regulator of C/EBPα [125, 126].

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

ROLE OF C/EBPΑ IN MYELOID DIFFERENTIATION AND LEUKEMIA A ctritical role for the function of C/EBPα in granulopoiesis was demonstrated in mice harbouring a disruption of the CEBPA gene [18]. These mice show a selective early block in granulopoiesis, with the appearance of many myeloid blasts in fetal liver and peripheral blood [18]. C/EBPα cooperates with additional factors to direct monocytic commitment of primary myeloid progenitors [14]. C/EBPα binds and activates the endogenous PU.1 gene in myeloid cells [16, 91]. Acute leukemias are clonal disorders that are characterized by a block of differentiation along one or more hematopoietic lineages. C/EBPα mutations have been observed in AML patients with the approximate frequency 5-14% [28-31,127-131]. In the absence of specific CEBPA mutations, decreased expression of C/EBPα is an alternative mechanism that disrupts C/EBPα function [28-31]. C/EBPα is not only a critical tumor suppressor in the hematopoietic system but acts as oncogen in human precursor-B lymphoblastic acute leukemia (BCP-ALL) cells by juxtaposition to the immunoglobulin gene enhancer upon the t(14;19)(q32;q13) chromosomal rearrangement. Translocations in BCP-ALL cells involving the immunoglobulin heavy chain locus (IGH) at chromosomal band 14q32 are a rare but recurrent event. These translocations can be connected with the translocation of the CEBPA gene on chromosome 19q13.1. This t(14;19)(q32;q13) chromosomal rearrangement leads to overexpression of C/EBPα protein, usually of normal

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

The Essential Transcription Factor …

53

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

sequence, which exhibits oncogenic properties [37, 38]. Thus it appears that either loss of function of C/EBPα or gain of function of C/EBPα has leukemogenic potential (Figure 7).

Figure 7. The effect of the amount of transcription factor C/EBPα in leukemogenesis. “Just the right“ amount of C/EBPα is needed for maintenance of normal hematopoiesis. “Too much or too little” of C/EBPα can contribute to leukemogenesis. Apparently normal C/EBPα is over-expressed in BCP-ALL harbouring the translocation t(14; 19)(q32; q13). Mutations or decreased expression of C/EBPα cause AML.

Acute myeloid leukemia with biallelic CEBPA gene mutations and normal karyotype represents a distinct genetic entity associated with a favorable clinical outcome [132-136]. Pediatric AML patients with normal karyotype and double CEBPA mutations without other negative prognostic markers (FLT3-ITD or overexpression of BAALC /brain and acute leukemia, cytoplasmic/ or ERG /ETS-related gene/) should not be candidates for transplantation in first complete remission in future pediatric AML studies. This avoids the mortality and long-term morbidity associated with this procedure [137]. Demethylating agents therapy should be studied in AML patients with epigenetic silencing of CEBPA [138].

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

54

Ota Fuchs

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

CONCLUSION AND PERSPECTIVES Transcription factor C/EBPα plays an important role in granulopoiesis. C/EBPα is in addition to its transcriptional role also a strong inhibitor of cell proliferation. It is apparent now that C/EBPα is able to regulate cellular proliferation and differentiation through a variety of mechanisms. Although overexpression experiments and analysis of cells lacking known cell-cycle regulators are useful for identifying the pathways in which C/EBPα functions, these approaches do not necessarily reveal the primary target. A unifying mechanism of how C/EBPα suppresses proliferation has yet to be found. C/EBPα coordinates terminal differentiation by the upregulation of differentiation specific gene products and by mediating exit from the cell cycle. Both these functions of C/EBPα are conceivable targets in tumorigenic processes. Mutations of CEBPA play an important role in the development of acute myeloid leukemia but not in other carcinomas such as lung, liver, skin and mammary gland. Downregulation or functional inactivation of CEBPA is a prerequisite in some types of these carcinomas. A novel mechanism of C/EBPα p42 repression in leukemia by Ubc9-mediated sumoylation has been described. Interestingly, either by mutating the SUMO site or by disrupting Ubc9 we could overcome the C/EBPα p30-mediated block of transcription and the differentiation potential of C/EBPα p42 [63,139]. Therefore, understanding such mechanisms leads to the development of new therapeutics that stimulate C/EBPα activity to overcome the differentiation block observed in AML. On the other hand, C/EBPα can also stimulate proliferation and behave as oncogen in human precursor-B lymphoblastic acute leukemia (BCP-ALL). The next challenge is to find a more comprehensive list of C/EBPα targets in different cell types and cellular states as well as networks of protein interactions and regulatory patways that control their activities. The capacity of C/EBPα to overcome the block of differentiation in AML blasts with suppressed C/EBPα activity makes it an obvious target of interest for differentiation-inducing therapy. A promising approach can be the activation of differentiation by small molecules modulating the expression of CEBPA on the level of C/EBPα mRNA or protein. Luciferase-based assays utilizing C/EBPα-regulated promoter construct allow the screening of a great number of small molecules in order to restore C/EBPα function. Better understanding of this transcription and differentiation factor is necessary for novel therapeutic strategies in AML and other malignant diseases. In addition, C/EBPα mRNA translation can be efficiently induced by a novel synthetic triterpenoid 2cyano-3,12-dioxoolean-1,9-dien-28-oic acid (CDDO), which alters the

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

The Essential Transcription Factor …

55

p42/p30 ratio of the C/EBPα isoforms [140]. CDDO and its derivatives are multifunctional compounds originally developed for the prevention and treatment of inflammation and oxidative stress. The mammalian target of rapamycin (mTOR) is a direct target of CDDO [141]. Other small molecules with similar function may be discovered in future, but further study is necessary before clinical application of such drugs.

ACKNOWLEDGMENTS This work was supported by the grant VZ 00023736 (MZO UHKT 2005) from the Ministry of Health of the Czech Republic, and grant LC 06044 from Ministry of Education, Youth and Sport of the Czech Republic.

REFERENCES

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

[1] [2] [3] [4]

[5]

[6]

Cao, Z; Umek, RM; McKnight, SL. Regulated expression of three C/EBP isoforms during adipose conversion of 3T-L1 cells. Genes. Dev., 1991, 5, 1538-1552. Scott, LM; Civin, CI; Rorth, P; Friedman AD. A novel temporal expression pattern of three C/EBP family members in differentiating myelomonocytic cells. Blood, 1992, 80, 1725-1735. Freytag, SO; Paielli, D; Gilbert, JD. Ectopic expression of the CCAAT/enhancer binding protein α promotes the adipogenic program in a variety of mouse fibroblastic cells. Genes. Dev., 1994, 8, 1654-1663. Flodby, P; Barlow, C; Kylefjord, H; Ährlund-Richter, L; Xanthopoulos, KG. Increased hepatic cell proliferation and lung abnormalities in mice deficient in CCAAT/enhancer binding protein α. J. Biol. Chem., 1996; 271, 24753-24760. Oh, HS; Smart, RC. Expression of CCAAT/enhancer binding proteins (C/EBP) is associated with squamous differentiation in epidermis and isolated primary keratinocytes and is altered in skin neoplasms. J. Invest. Dermatol., 1998, 110, 939-945. Radomska, HS; Huettner, CS; Zhang, P; Cheng, T; Scadden, DT; Tenen, DG. CCAAT/enhancer binding protein α is a regulatory switch sufficient for induction of granulocyte development from bipotential myeloid progenitors. Mol. Cell Biol., 1998, 18, 4301-4304.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

56 [7] [8]

[9] [10] [11]

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

[12]

[13] [14] [15]

[16] [17] [18]

Ota Fuchs Nerlov, C. The C/EBP family of transcription factors: a paradigm for interaction between gene expression and proliferation control. Trends. Cell Biol., 2007, 17, 318-324. Wölfler, A; Danen-van Oorschot, AA; Haanstra, JR; Valkhof, M; Bodner. C; Vroeqindeweij, E et al. Lineage-instructive function of C/EBPα in multipotent hematopoietic cells and early thymic progenitors. Blood, 2010, 116, 4116-4125. Friedman, AD. Transcriptional regulation of granulocyte and monocyte development. Oncogene., 2002, 21, 3377-3390. Zhang, P; Nelson, E; Radomska, HS; Iwasaka-Arai, J; Akashi, K; Friedman, AD; Tenen, DG. Induction of granulocytic differentiation by 2 pathways. Blood, 2002, 99, 4406-4412. Reddy, VA; Iwama, A; Iotzova, G; Schulz, M; Elsasser, A; Vangala RK et al. Granulocyte inducer C/EBPα inactivates the myeloid master regulator PU.1: possible role in lineage commitment decisions. Blood, 2002, 100, 483-490. Friedman, AD; Keefer, JR; Kummalue, T; Liu, H; Wang, Q; Cleaves R. Regulation of granulocyte and monocyte differentiation by CCAAT/enhancer binding protein α. Blood Cells Mol. Dis., 2003, 31, 338-341. Rosmarin, AG; Yang, Z; Resendes, KK. Transcriptional regulation in myelopoiesis: Hematopoietic fate choice, myeloid differentiation, and leukemogenesis. Exp. Hematol., 2005, 33, 131-143. Wang, D; D´Costa, J; Civin CI; Friedman, AD. C/EBPα directs monocyte commitment of primary myeloid progenitors. Blood, 2006, 108, 1223-1229. Suh, HC; Gooya, J; Renn, K; Friedman, AD; Johnson, PF; Keller, JR. C/EBPα determines hematopoietic cell fate in multipotential progenitor cells by inhibiting erythroid differentiation and inducing myeloid differentiation. Blood, 2006, 107, 4308-4316. Friedman, AD. C/EBPα induces PU.1 and interacts with AP-1 and NFκB to regulate myeloid development. Blood Cells Mol. Dis., 2007, 39, 340-343. Zhang, L; Friedman, AD. SHP2 tyrosine phosphatase stimulates CEBPA gene expression to mediate cytokine-dependent granulopoiesis. Blood, 2011, 118, 2266-2274. Wang, ND; Finegold, MJ; Bradley, A; Ou, CN; Abdelsayed, SV; Wilde, M et al. Impaired energy homeostasis in C/EBP alpha knockout mice. Science, 1995, 269, 1108-1112.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

The Essential Transcription Factor …

57

[19] Zhang, DE; Zhang, P; Wang, ND; Hetherington, CJ; Darlington, GJ; Tenen, DG. Absence of granulocyte colony-stimulating factor signaling and neutrophil and development in CCAAT enhancer binding protein alpha-deficient mice. Proc. Natl. Acad. Sci. USA, 1997, 94, 569-574. [20] Kimura, T; Christoffels, VM; Chowdhury, S; Iwase, K; Matsuzaki, H; Mori, M et al. Impaired energy homeostasis in C/EBP alpha knockout mice. Science, 1995, 269, 1108-1112. [21] Inoue, Y; Inoue, J; Lambert, G; Yim, SH; Gonzalez, FJ. Disruption of hepatic C/EBPα results in impaired glucose tolerance and age-dependent hepatosteatosis. J. Biol. Chem., 2004, 279, 44740-44748. [22] Yang, J; Croniger, CM; Lekstrom-Himes, J; Zhang, P; Fenyus, M; Tenen, DG et al. Metabolic response of mice to a postnatal ablation of CCAAT/enhancer binding protein α. J. Biol. Chem., 2005, 280, 3868938699. [23] Bassėres, DS; Levantini, E; Ji, H; Monti, S; Elf, S; Dayaram, T et al. Respiratory failure due to differentiation arrest and expansion of alveoral cells Following lung-specific loss of the transcription factor C/EBPα in mice. Mol. Cell Biol., 2006, 26, 1109-1123. [24] Halmos, B; Huettner, CS, Kocher, O; Ferenczi, K; Karp, DD; Tenen, DG. Down-regulation and antiproliferative role of C/EBPα in lung cancer. Cancer Res., 2002, 62, 528-534. [25] Gery, S; Tanosaki, S; Bose, S; Vadgama, J; Koeffler, HP. Downregulation and growth inhibitory role of C/EBPα in breast cancer. Clin. Cancer Res., 2005, 11, 3184-3190. [26] Takai, N; Kawamata, N; Walsh, CS; Gery, S; Desmond, JC; Whittaker, S et al. Discovery of epigenetically masked tumor suppressor genes in endometrial cancer. Mol. Cancer Res., 2005, 3, 261-269. [27] Tada, Y; Brena, RM; Hackanson, B; Morrison, C; Otterson, GA; Plass, C et al. Epigenetic modulation of tumor suppressor CCAAT/enhancer binding protein α activity in lung cancer. J. Nat. Cancer Inst., 2006, 98, 396-406. [28] Nerlov, C. C/EBPα mutations in acute myeloid leukaemias. Nat. Rev. Cancer, 2004, 4, 394-400. [29] Mueller, BU; Pabst, T. C/EBPα and the pathophysiology of acute myeloid leukemia. Curr. Opin Hematol., 2006, 13, 7-14. [30] Schuster, MB; Porse, BT. C/EBPα: a tumour suppressor in multiple tissues? Biochim. Biophys. Acta., 2006, 1766, 88-103.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

58

Ota Fuchs

[31] Fuchs, O. Growth-inhibiting activity of transcription factor C/EBPα, its role in haematopoiesis and its tumour suppressor or oncogenic properties in leukaemias, Folia. Biol., (Praha) 2007, 53, 97-108. [32] Shim, M; Powers, KL; Ewing, SJ; Zhu, S; Smart, RC. Diminished expression of C/EBPα in skin carcinomas is linked to oncogenic Ras and reexpression of C/EBPα in carcinoma cells inhibits proliferation. Cancer Res., 2005, 65, 861-867. [33] Loomis, KD; Zhu, S; Yoon, K; Johnson, PF ; Smart, RC. Genetic ablation of CCAAT/enhancer binding protein α in epidermis reveals its role in suppression of epithelial tumorigenesis. Cancer Res., 2007, 67, 6768-6776. [34] Truong, BT; Lee, YJ; Lodie, TJ; Park, DJ; Perrotti, D; Watanabe, N et al. CCAAT/Enhancer binding proteins repress the leukemic phenotype of acute myeloid leukemia. Blood, 2003, 101, 1141-1148. [35] Schepers, H; Wierenga, ATJ; van Gosliga, D; Eggen, BJL; Vellenga, E; Schuringa, JJ. Reintroduction of C/EBPα in leukemic CD34+ stem/progenitor cells impairs self-renewal and partially restores myelopoiesis. Blood, 2007, 110, 1317-1326. [36] Tan, EH; Hooi, SC; Laban, M; Wong, E; Ponniah, S; Wee, A; Wang ND. CCAAT/Enhancer-binnding protein alpha knock-in mice exhibit early liver glycogen storage and reduced susceptibility to hepatocellular carcinoma. Cancer Res., 2005, 65, 10330-10337. [37] Chapiro, E; Russell, L; Radford-Weiss, I; Bastard, C; Lessard, M; Struski, S. et al. Overexpression of CEBPA resulting from the translocation t(14; 19)(q32; q13) of human precursor-B-cell acute lymphoblastic leukaemia. Blood, 2006, 108, 3560-3563. [38] Akasaka, T; Balasas, T; Russell, LJ; Sugimoto, KJ.; Majid, A; Walewska, et al. Five members of the CEBP transcription factor family are targeted by recurrent IGH translocations in B-cell precursor acute lymphoblastic leukemia (BCP-ALL). Blood, 2007, 109, 3451-3461. [39] Hendricks-Taylor, LR; Bachinski, LL; Sicilliano, MJ; Fertitta, A; Trask, B; de Jong, PJ; Ledbetter, DH, Darlington, GJ. The CCAAT/enhancer binding protein (C/EBPα) gene (CEBPA) maps to human chromosome 19q13.1 and the related nuclear factor NF-IL6 (C/EBP ß) gene (CEBPB) maps to human chromosome 20q13.1. Genomics, 14, 12-17. [40] Birkenmeier, EH; Gwynn, B; Howard, S; Jerry, J;. Gordon, JI; Landschulz, WH; McKnight, SL. Tissue-specific expression, developmental regulation and genetic mapping of the gene encoding CCAAT/enhancer binding protein. Genes. Dev., 3, 1146-1156.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

The Essential Transcription Factor …

59

[41] Calkhoven, CF; Bouwman, PRJ; Snippe, L; Geert, AB. Translation start site multiplicity of the CCAAT/enhancer binding protein α mRNA is dictated by a small 5´ open reading frame. Nucleic. Acids. Res., 1994, 22, 5540-5547. [42] Calkhoven, C. F., Muller, C., Leutz, A. Translational control of C/EBPα and C/EBPβ isoform expression. Genes. Dev., 2000, 14, 1920-1932. [43] Ossipow, V; Decombes, P; Schibler, U. CCAAT/enhancer-binding protein mRNA is translated into multiple proteins with different transcription activation potentials. Proc. Natl. Acad. Sci. USA, 1993, 90, 8219-8223. [44] Khanna-Gupta A. Regulation and deregulation of mRNA translation during myeloid maturation. Exp. Hematol., 2011, 39, 133-141. [45] Nerlov, C; Ziff, EB. Three levels of functional interaction determine the activity of CCAAT/enhancer binding protein-α on the serum albumin promoter. Genes. Dev., 1994, 8, 350-362. [46] Nerlov, C; Ziff, EB. CCAAT/enhancer binding protein-α amino acid motifs with dual TBP and TFIIB binding ability co-operate to activate transcription in both yeast and mammalian cells. EMBO J., 1995, 14, 4318-4328. [47] Pei, DQ; Shih, CH. An "attenuator domain" is sandwiched by two distinct trans-activation domains in the transcription factor C/EBP. Mol. Cell Biol., 1991, 11, 1480-1487. [48] Iniguez-Lluhí, J; Pearce, D. A common motif within the negative regulatory regions of multiple factors inhibit their transcriptional synergy. Mol. Cell Biol., 2000, 20, 6040-6050. [49] Cleaves, R; Wang, QF; Friedman AD. C/EBPα p30, a myeloid leukemia oncoprotein limits G-CSF receptor expression but not terminal granulopoiesis via site-selective inhibition of C/EBP DNA binding. Oncogene., 2004, 23, 716-772. [50] Calkhoven, CF; Snippe, L; Ab, G. Differential stimulation by CCAAT/enhancer-binding protein α isoforms of the estrogen-activated promoter of the very-low-density apolipoprotein II gene. Eur. J. Biochem., 1997, 249, 113-120. [51] Lin, FT; McDougold, CA; Diehl, AM; Lane, MD. A 30-kDa alternative translation product of the CCAAT/enhancer binding protein α message: transcriptional activator lacking antimiotic. activity. Proc. Natl. Acad. Sci. USA, 1993, 90, 9606-9610.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

60

Ota Fuchs

[52] Johnson, PF. Identification of C/EBP basic region residues involved in DNA sequence recognition and half-site spacing preference. Mol. Cell Biol., 1993, 13, 6916-6930. [53] Koldin, B; Suckow; M, Seydel, A; von Wilcken-Bergmann, B; MüllerHill, B. A comparison of the different DNA binding specificities of the bZIP proteins C/EBP and GCN4. Nucleic. Acids. Res., 1995, 23, 41624169. [54] Chen, S-S; Chen, J-F; Johnson, PF; Muppala, V; Lee, Y-H. C/EBPβ, when expressed from the C/ebpα gene locus, can functionally replace C/EBPα in liver but not in adipose tissue. Mol. Cell Biol., 2000, 20, 7292-7299. [55] Radomska, HS; Basseres, DS; Zheng, R; Zhang, P; Dayaram, T; Yamamoto, Y. et al. Block of C/EBPα function by phosphorylation in acute myeloid leukemia with FLT3 activating mutations. J. Exp. Med.,2006, 203, 371-381. [56] Liu, H-K; Perrier, S; Lipina, C; Finlay, D; McLauchlan, H; Hastie, CJ; Hundal, H. S., Sutherland, C. Functional characterisation of the regulation of CAAT enhancer binding protein alpha by GSK-3 phosphorylation of threonines 222/226. BMC Mol. Biol., 2006, 7, 1-12. [57] Behre, G; Singh, SM; Liu, H; Bortolin, LT; Christopei, M;Radomska, HS et al. Ras signaling enhances the activity of C/EBPα to induce granulocytic differentiation by phosphorylation of serine 248. J. Biol. Chem., 2002, 277, 26293-26299. [58] Wang, G-L; Timchenko, NA. Dephosphorylated C/EBPα accelerates cell proliferation through sequestering retinoblastoma protein. Mol. Cell Biol., 2005, 25, 1325-1338. [59] Trivedi, AK; Bararia, D; Christopeit, M; Peerzada, AA; Singh, SM; Kieser, A et al. Proteomic identification of C/EBP-DBD multiprotein complex: JNK1 activates stem cell regulator C/EBPalpha by inhibiting its ubiquitination. Oncogene., 2007, 26, 1789-1801. [60] Wang, G-L; Iakova, P.; Wilde, M; Awad, S; Timchenko, NA. Liver tumors escape negative control of proliferation via PI3K/Akt-mediated block of C/EBPα growth inhibitory activity. Genes. Dev., 2004, 18, 912925. [61] Subramanian, L; Benson, MD; Iniguez-Lluhí, JA. A synergy control motif within the the attenuator domain of CCAAT/enhancer-binding protein α inhibits transcriptional synergy through its PIASy-enhanced modification by SUMO-1 or SUMO-3. J. Biol. Chem., 2003, 278, 91349141.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

The Essential Transcription Factor …

61

[62] Sato, Y; Miyake, K; Kaneoka, H; Iijima, S. Sumoylation of CCAAT/enhancer- binding protein α and its functional roles in hepatocyte differentiation. J. Biol. Chem., 2006, 281, 21629-21639. [63] Geletu, M; Balkhi, MY; Zada, AAP; Christopeit, M; Pulikkan, JA; Trivedi, AK et al. Target proteins of C/EBPα p30 in AML: C/EBPα p30 enhances sumoylation of C/EBPα p42 via up-regulation of Ubc9. Blood, 2007, 110, 3301-3309. [64] Hendricks-Taylor, LR; Darlington, GJ. Inhibition of cell proliferation by C/EBPα occurs in many cell types, does not require the presence of p53 or Rb, and is not affected by large T-antigen. Nucleic. Acids. Res., 1995, 23, 426-433. [65] Johnson, PF. Molecular stop signs: regulation of cell cycle arrest by C/EBP transcription factors. J. Cell Sci., 2005, 118, 2545-2555. [66] Timchenko, NA; Harris, TE; Wilde, M; Bilyeu, TA; Burgess-Beusse, BL; Finegold, MJ; Darlington, GJ. CCAAT/enhancer-binding protein α regulates p21 protein and hepatocyte proliferation in newborn mice. Mol. Cell Biol., 1997, 17, 7353-7361. [67] Timchenko, NA; Wilde, M; Darlington, GJ. C/EBPα regulates formation of S-phase-specific E2F-p107 complexes in livers of newborn mice. Mol. Cell Biol., 1999, 19, 2936-2945. [68] Johansen, LM; Iwama, A; Lodie, TA; Sasaki, K; Felsher, DW; Golub, TR; Tenen DG. c-Myc is a critical target for C/EBPα in granulopoiesis. Mol. Cell Biol., 2001, 21, 3789-3806. [69] Porse, BT; Pedersen, TA; Xu, X; Lindberg, B; Wewer, UM; FriisHansen, L; Nerlov, C. E2F repression by C/EBPα is required for adipogenesis and granulopoiesis in vivo. Cell, 2001, 107, 247-258. [70] Grandori, C; Cowley, SM; James, LP; Eisenman, RN. The Myc/Max/Mad network and the transcriptional control of cell behavior. Annu. Rev. Cell Dev. Biol., 2000, 16, 653-699. [71] Zada, AA; Pulikkan, JA; Bararia, D; Geletu, M; Trivedi, AK; Balkhi, MY et al. Proteomic discovery of Max as a novel interacting partner of C/EBPα: a Myc/Max/Mad link. Leukemia, 2006, 20, 2137-2146. [72] Wang, H; Iakova, P; Wilde, M; Welm, A; Goode, T; Roesler, W.J; Timchenko, NA. C/EBPα arrests cell proliferation through direct inhibition of Cdk2 and Cdk4. Mol. Cell, 2001, 8, 817-828. [73] Pedersen, TA; Kowenz-Leutz, E; Leutz, A; Nerlov, C. Cooperation between C/EBPα, TBP/TFIIB and SWI/SNF recruiting domains is required for adipocyte differentiation. Genes. Dev., 2001, 15, 32083216.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

62

Ota Fuchs

[74] Műller, C; Calkhoven, C. F; Sha, X; Leutz, A. The CCAAT enhancerbinding protein α (C/EBPα) requires a SWI/SNF complex for proliferation arrest. J. Biol. Chem., 2004, 279, 7353-7358. [75] Műller, C; Alunni-Fabbroni, M; Kowenz-Leutz, E; Mo, X; Tommasino, M; Leutz, A. Separation of C/EBPα-mediated proliferation arrest and differentiation pathways. Proc. Natl. Acad. Sci. USA, 1999, 96, 72767281. [76] Hendricks-Taylor, LR; Darlington, GJ. Inhibition of cell proliferation by C/EBPα occurs in many cell types, does not require the presence of p53 or Rb, and is not affected by large T-antigen. Nucleic. Acids. Res., 1995, 23, 426-433. [77] Classon, M; Harlow, E. The retinoblastoma tumour suppressor in development and cancer. Nat. Rev. Cancer, 2002, 2, 910-917. [78] Timchenko, NA; Wilde, M; Iakova, P; Albrecht, JH; Darlington, GJ. E2F/p107 and E2F/p130 complexes are regulated by C/EBPα in 3T3-L1 adipocytes. Nucleic. Acids. Res., 1999, 27, 3621-3630. [79] Slomiany, BA; D‟Arigo, KL; Kelly, MM; Kurtz, DT. C/EBPα inhibits cell growth via direct repression of E2F-DP-mediated transcription. Mol. Cell Biol., 2000, 20, 5986-5997. [80] Porse, BT; Bryder, D; Theilgaard-Monch, K; Hasemann, MS; Anderson, K; Damgaard, I et al. Loss of C/EBPα cell cycle control increases myeloid progenitor Proliferation and transforms the neutrophil granulocyte lineage. J. Exp. Med., 2005, 202, 85-96. [81] Blackwell, TK; Kretzner; L; Blackwood, EM; Eisenman, RN; Weintraub, H. Sequence-specific DNA binding by the c-Myc protein. Science, 1990, 250, 1149- 1151. [82] Blackwood, EM; Eisenman, RN. Max: a helix-loop-helix zipper protein that forms a sequence-specific DNA-binding complex with c-Myc. Science, 1991, 251, 1211-1217. [83] Sheiness, D; Fanshier, L; Bishop, JM. Identification of nucleotide sequences which may encode the oncogenic capacity of avian retrovirus MC29. J. Virol., 1978, 28, 600-610. [84] Dalla-Favera, R; Martinotti, S; Gallo, RC; Erikson, J; Croce, CM. Translocation and rearrangements of the c-myc oncogene locus in human undifferentiated B-cell lymphomas. Science, 1983, 219, 963-967. [85] Leder, A; Pattengale, PK; Kuo, A; Stewart, TA; Leder, P. Consequences of widespread deregulation of the c-myc gene in transgenic mice: multiple neoplasms and normal development. Cell, 1986, 45, 485-495.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

The Essential Transcription Factor …

63

[86] Felsher, DW; Bishop, JM. Transient excess of MYC activity can elicit genomic instability and tumorigenesis. Proc. Natl. Acad. Sci. USA, 1999, 96, 3940-3944. [87] Obaya, AJ; Mateyak, MK; Sedivy JM. Mysterious liaisons: the relationship between c-Myc and the cell cycle. Oncogene., 1999, 18, 2934-2941. [88] Porse, BT; Pedersen, TA; Hasemann, MS; Schuster, MB; Kirstetter, P., Luedde, T et al. The proline-histidine-rich CDK2/CDK4 interaction region of C/EBPα is dispensable for C/EBPα-mediated growth regulation in vivo. Mol. Cell Biol., 2006, 26, 1028-1037. [89] Tenen, D. Role of myeloid transcription factors in normal and leukemic stem cell function. Exp. Hematol., 2011, 39 (8) Suppl.1, S6, abstract A1140860. [90] Sieweke, MH; Graf, T. A transcription factor party during blood cell differentiation. Curr. Opin. Genet. Dev., 1998, 8, 545-551. [91] Orkin, SH. Diversification of hematopoietic stem cells to specific lineages. Nat. Rev. Genet., 2000, 1, 57-64. [92] Zhang, P; Iwasaki-Arai, J; Iwasaki, H; Fenyus, ML; Dayaram, T; Owens, BM; Shigematsu, H; Levantini, E; Huettner, CS; LekstromHimes J; Akashi, K; Tenen, D G. Enhancement of hematopoietic stem cell repopulating capacity and self-renewal in the absence of the transcription factor C/EBPalpha. Immunity, 2004, 21, 853-863. [93] Hsu, CL; King-Fleischman, AG; Lai, AY; Matsumoto, Y; Weissman, IL; Kondo M. Antagonistic effect of CCAAT enhancer-binding proteinα and Pax5 in myeloid or lymphoid lineage choice in common lymphoid lineage choice in common lymphoid progenitors. Proc. Natl. Acad. Sci. USA, 2006, 103, 672-677. [94] Fukuchi, Y; Shibata, F; Miyuki, I; Goto-Koshino, Y; Sotomaru, Y; Ito, M; Kitamura, T; Nakajima, H. Comprehensive analysis of myeloid lineage conversion using mice expressing an inducible form of C/EBPα. EMBO J., 2006, 25, 3398-3410. [95] Iwasaki, H; Mizuno, S; Arinobu, Y; Ozawa, H; Mori, Y; Shigematsu, H; Takatsu, K; Tenen, DG; Akashi, K. The order of expression of transcription factors directs hierarchical specification of hematopoietic lineages. Genes. Dev., 2006, 20, 3010-3021. [96] Tenen, DG; Hromas, R; Licht, JD; Zhang, DE. Transcription factors, normal myeloid development, and leukemia. Blood, 1997, 90, 489-519.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

64

Ota Fuchs

[97] Keeshan, K; Santilli, G; Corradini, F; Perrotti, D; Calabretta, B. (2003) Transcription activation function of C/EBPα is required for induction of granulocyte differentiation. Blood, 2003, 102, 1267-1275. [98] Iwama, A; Zhang, P; Darlington, GJ; McKercher, SR; Maki, RA; Tenen, DG. Use of RDA analysis of knockout mice to identify myeloid genes regulated in vivo by PU.1 and C/EBPα. Nucleic. Acids. Res., 1998, 26, 3034-3043. [99] Zhang, P; Iwama, A; Datta, MW; Darlington, GJ; Link, DC; Tenen, DG. Upregulation of interleukin 6 and granulocyte colony-stimulating factor receptors by transcription factor CCAAT enhancer binding protein α (C/EBPα) is critical for granulopoiesis. J. Exp. Med., 1998, 188, 11731184. [100] Kummalue, T; Friedman, AD. Cross-talk between regulators of myeloid development: C/EBPα binds and activates the promoter of the PU.1 gene. J. Leukoc. Biol., 2003, 74, 464-470. [101] Dahl, R; Walsh, JC; Lancki, D; Laslo, P; Iyer, SR; Singh, H; Simon, MC. Regulation of macrophage and neutrophil cell fates by the PU.1: C/EBPα ratio and granulocyte colony-stimulating factor. Nat. Immunol., 2003, 4, 1029-1036. [102] Chen, C. Z., Li, L., Lodish, H. F., Bartel, D. P. (2004) MicroRNAs modulate hematopoietic lineage differentiation. Science, 2004, 303, 8386. [103] Fazi, F., Rosa, A., Fatica, A., Gelmetti, V., De Marchis, M. L., Nervi, C., Bozzoni, I. (2005) A minicircuitry comprised of microRNA-223 and transcription factors NFI-A and C/EBPalpha regulates human granulopoiesis. Cell, 2005, 123, 819-831. [104] Garzon, R; Pichiorri, F; Palumbo, T; Visentini, M; Aqeilan, R; Cimmino A et al. MicroRNA gene expression during retinoic acid-induced differentiation of human acute promyelocytic leukemia. Oncogene, 2007, 26, 4148-4157. [105] Johnnidis, JB; Harris, MH; Wheeler, RT; Stehling-Sun, S; Lam, MH; Kirak, O et al. Regulation of progenitor cell proliferation and granulocyte function by microRNA-223. Nature, 2008, 451, 1125-1129. [106] Pulikkan, JA; Dengler, V; Peramangalam, PS; Peer Zada, AA; MüllerTidow, C; Bohlander, SK et al. Cell-cycle regulator E2F1 and microRNA-223 comprise an autoregulatory negative feedback loop in acute myeloid leukemia. Blood, 2010, 115, 1768-1778.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

The Essential Transcription Factor …

65

[107] Eyholzer, M; Schmid, S; Schardt, JA; Haefliger, S; Mueller, BU; Pabst, T. Complexity of miR-223 regulation by CEBPA in human AML. Leuk. Res., 2010, 34, 672-676. [108] Eyholzer, M; Schmid, S; Wilkens, L; Mueller, BU; Pabst, T. The tumorsuppressive miR-29a/b1 cluster is regulated by CEBPA and blocked in human AML. Brit. J. Cancer, 2010, 103, 275-284. [109] Pulikkan, JA; Peramangalam, PS; Dengler, V; Ho, PA; Preudhomme, C; Meshinchi, S et al. C/EBPα regulated microRNA-34a targets E2F3 during granulopoiesis and is down regulated in AML with CEBPA mutations. Blood, 2010, 116, 5638-5649. [110] Marcucci, G; Maharry, K; Radmacher, MD; Mrózek, K; Vukosavljevic, T; Paschka, P et al. Prognostic significance of, and gene and microRNA expression signatures associated with, CEBPA mutations in cytogenetically normal acute myeloid leukemia with high-risk molecular features: a cancer and leukemia group B study. J. Clin. Oncol., 2008, 31, 5078-5087. [111] Heidenreich, O; Krauter, J; Riehle, H; Hadwiger, P; John, M; Heil, G et al. AML1/MTG8 oncogene suppression by small interfering RNAs supports myeloid differentiation of t(8;21)-positive leukemic cells. Blood, 2003, 101, 3157-3163. [112] Pabst, T; Mueller, BU; Harakawa, N; Schoch, C; Haferlach, T; Behre, G et al. AML1–ETO downregulates the granulocytic differentiation factor C/EBPα in t(8;21) myeloid leukemia. Nat. Med., 2001, 7, 444-451. [113] Bennett, KL; Hackanson, B; Smith, LT; Morrison, CD; Lang, JC; Schuller, DE et al. Tumor suppressor activity of CCAAT/enhancer binding protein alpha is epigenetically down-regulated in head and neck squamous cell carcinoma. Cancer Res., 2007, 67, 4657-4664. [114] Kumagai, T; Akagi, T; Desmond, JC; Kawamata, N; Gery, S; Imai, Y et al. Epigenetic regulation and molecular characterization of C/EBPα in pancreatic cancer cells. Int. J. Cancer, 2009, 124, 827-833. [115] Chim, CS; Wong, AS; Kwong, YL. Infrequent hypermethylation of CEBPA promoter in acute myeloid leukemia. Br. J. Haematol., 2002, 119, 988-990. [116] Wouters, BJ; Jorda, MA; Keeshan, K; Louwers, I; ErpelinckVerschueren, CA; Tielemans, D et al. Distinct gene expression profiles of acute myeloid/T-lymphoid leukemia with silenced CEBPA and mutations in NOTCH1. Blood, 2007, 110, 3706-3714. [117] Hackanson, B; Bennett, KL; Brena, RM; Jiang, J; Claus, R; Chen, SS et al. Epigenetic modification of CCAAT/enhancer binding protein alpha

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

66

Ota Fuchs

expression in acute myeloid leukemia. Cancer Res., 2008, 68, 31423151. [118] Lin, TC; Hou, HA; Chou, WC; Ou, DL; Yu, SL;Tien, HF; Lin, LI. CEBPA methylation as a prognostic biomarker in patients with de novo acute myeloid leukemia. Leukemia, 2011, 25, 32-40. [119] Szankasi, P; Ho, AK; Bahler, DW; Efimova, O; Kelley TW. Combined testing for CCAAT/enhancer binding protein alpha (CEBPA) mutations and promoter methylation in acute myeloid leukemia demonstrates shared phenotypic features. Leukemia Res., 2011, 35, 200-207. [120] Santana-Lemos, BA; Alencar de LimaLange, AP; de Lira Benício, MT; Donizete da Silva José, T; Lucena-Araújo, AR; Krause, A et al. The CEBPA gene is down-regulated in acute promyelocytic leukemia and its upstream promoter, but not core promoter, is highly methylated. Haematologica, 2011, 96, 617-620. [121] Helbling, D; Mueller, BU; Timchenko, NA; Hagemeijer, A; Jotterand, M; Meyer- Monard, S et al. The leukemic fusion gene AML1-MDS1EVI1 suppresses CEBPA in acute myeloid leukemia by activation of Calreticulin. Proc. Natl. Acad. Sci. USA, 2004, 101, 13312-13317. [122] Helbling, D; Mueller, BU; Timchenko, NA; Schardt, J; Eyer, M; Betts, DR et al. CBFB-SMMHC is correlated with increased calreticulin expression and suppresses the granulocytic differentiation factor CEBPA in AML with inv(16). Blood, 2005, 106, 1369-1375. [123] Keeshan, K; He, Y., Wouters, BJ; Shestova, O; Xu, L; Sai, H et al. Tribbles homolog 2 inactivates C/EBPα and causes acute myelogenous leukemia. Cancer Cell., 2006, 10, 401-411. [124] Dedhia, PH; Keeshan, K; Uljon, S; Xu, L; Vega, ME; Shestova, O et al. Differential ability of Tribbles family members to promote degradation of C/EBPalpha and induce acute myelogenous leukemia. Blood, 2010, 116, 1321-1328. [125] Trivedi, AK; Bararia, D; Christopeit, M; Peerzada, AA; Singh, SM; Kieser, A. et al. Proteomic identification of C/EBP-DBD multiprotein complex: JNK1 activates stem cell regulator C/EBPalpha by inhibiting its ubiquitination. Oncogene, 2007, 26, 1789-1801. [126] Trivedi, AK; Pal, P; Behre, G; Singh, SM. Multiple ways of C/EBPalpha inhibition in myeloid leukemia. Eur. J. Cancer, 2008, 44, 1516-1523. [127] Pabst, T; Mueller, BU; Zhang, P; Radomska, HS; Narravula, S; Schnittger, S et al. Dominant negative mutations of CEBPA, encoding CCAAT/enhancer binding protein-α (C/EBPα) in acute myeloid leukemia. Nat. Genet., 2001, 27, 263-270.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

The Essential Transcription Factor …

67

[128] Bereshchenko, O; Mancini, E; Moore, S; Bilbao, D; Manson R; Luc, S et al. Hematopoietic stem cell expansion precedes the generation of commited myeloid leukemia-initiating cells in C/EBPα mutant AML. Cancer Cell, 2009, 16, 390-400. [129] Pabst, T; Mueller, BU. Complexity of CEBPA dysregulation in human acute myeloid leukemia. Clin. Cancer Res., 2009, 15, 5303-5307. [130] Koschmieder, S; Halmos, B, Levantini, E, Tenen DG. Dysregulation of the C/EBPα differentiation pathway in human cancer. J. Clin. Oncol., 2009, 27, 619-628. [131] Reckzeh, K; Cammenga, J. Molecular mechanisms underlying deregulation of C/EBPalpha in acute myeloid leukemia. Int. J. Hematol., 2010, 91, 557-568. [132] Wouters, BJ; Lowenberg, B; Erpelinck-Verschueren, CA; van Putten, WL; Valk, PJ; Delwel, R. Double CEBPA mutations, but not single CEBPA mutations, define a subgroup of acute myeloid leukemia with a distinctive gene expression profile that is uniquely associated with a favorable outcome. Blood, 2009, 113, 3088-3091. [133] Pabst, T; Eyholzer, M; Fos, J; Mueller, BU. Heterogeneity within AML with CEBPA mutations, only CEBPA double mutations, but not single CEBPA mutations are associated with favourable prognosis. Br. J. Cancer, 2009, 100, 1343-1346. [134] Dufour, A; Schneider, F; Metzler, KH; Hoster, E; Schneider, S; Zellmeier, E et al. Acute myeloid leukemia with biallelic CEBPA gene mutations and normal karyotype represents a distinct genetic entity associated with clinical outcome. J. Clin. Oncol., 2010, 28, 570-577. [135] Marcucci, G; Haferlach, T; Döhner, H. Molecular genetics of adult acute myeloid leukemia: prognostic and therapeutic implications. J. Clin. Oncol., 2011, 29, 475-486. [136] Burnett, A; Wetzler, M; Löwenberg B. Therapeutic advances in acute myeloid leukemia. J. Clin. Oncol., 2011, 29, 487-494. [137] Green, CL; Koo, KK; Hills, RK; Burnett, AK; Linch, DC; Gale, RE. Prognostic significance of CEBPA mutations in a large cohort of younger adult patients with acute myeloid leukemia: impact of double CEBPA nutations and the interaction with FLT3 and NPM1 mutations. J. Clin. Oncol., 2010, 28, 2739-2747. [138] Jost, E; do Ó, N; Wilop, S; Herman, JG; Osieka, R; Galm, O. Aberrant DNA methylation of the transcription factor C/EBPα in acute myelogenous leukemia. Leuk. Res., 2009, 33, 443-449.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

68

Ota Fuchs

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

[139] Khanna-Gupta, A. Sumoylation and the function of CCAAT enhancer binding protein alpha (C/EBPα). Blood, 2008, 41, 77-81. [140] Koschmieder, S; D´Alo, F; Radomska, H; Schöneich, C; Chang, JS; Konopleva, M. CDDO induces granulocytic differentiation of myeloid leukemic blaststhrough translational up-regulation of p42CCAAT enhancer binding protein α. Blood, 2007, 110, 3695-3705. [141] Yore, MM; Kettenbach, AN; Sporn, MB; Gerber, SA; Liby KT. Proteomic analysis shows synthetic oleane triterpenoid binds to mTOR. PLOS One, 2011, 6, e 22862.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

In: Granulocytes Editors: H. Abukara and M. Jumonji

ISBN: 978-1-61942-806-5 © 2012 Nova Science Publishers, Inc

Chapter 3

CHEMOTACTIC ASSAY OF HUMAN NEUTROPHILS AND EOSINOPHILS Hyung-Ran Kim and Ju-Young Seoh

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Department of Microbiology, Ewha Womans University Graduate School of Medicine, Seoul, South Korea

INTRODUCTION Chemotaxis is critical to the ordinary function of neutrophils and eosinophils, enabling their optimal tissue distribution. A variety of signals induce chemotactic response of neutrophils and/or eosinophils, and systematic chemotaxis study is fundamental to the understanding of their tissue distribution at physiological as well as pathological conditions. Meanwhile, the lifespan of the granulocytes is very short in vitro, and it is demanding to get sufficient number of human eosinophils for chemotactic assay. Therefore, granulocytic cell lines are useful alternatives for the chemotactic assay. HL-60 is a human promyelocytic cell line that can be induced to differentiate into neutrophils by stimulation with dimethylformamide (DMF), dimethylsulfoxide or all-trans-retinoic acid. Time-lapse video microscopic assay as well as transwell assay revealed that undifferentiated HL-60 cells did not show chemotactic response to CCL3, CCL5, CXCL-8 or CXCL-12. The chemokines slightly increased chemokinesis, but did not induce directional migration. By contrast, differentiated HL-60 cells stimulated with 0.8% DMF for 4 days showed chemotactic response to CCL3, CCL5, CXCL-8 or CXCL-

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

70

Hyung-Ran Kim and Ju-Young Seoh

12, with a speed of 140 ~ 180 nm/sec, which is about one third or half of those of human peripheral blood neutrophils. Differentiated HL-60 cells showed vigorous chemokinesis even without any chemotactic stimulation, resulting in a substantial spontaneous migration in transwell assay that may hide the genuine chemotactic response to certain chemotactic stimuli. EoL-1 is a human leukemia cell line that can be differentiated into eosinophils by stimulation with dibutyryl cyclic AMP. Undifferentiated EoL-1 cells did not show chemotactic response to CCL11. By contrast, differentiated EoL-1 cells stimulated with dibutyryl cyclic AMP and subsequently pulsed with IFN-gamma, IL-3 and GM-CSF expressed chemokine receptors CCR7, CCR9 and CCR3, and developed chemotactic responsiveness to CCL21, CCL25 and CCL11, which bind to the respective receptors. Human PB eosinophils also showed chemotactic responsiveness to CCL21 and CCL25 upon stimulation with IFN-gamma, IL-3 and GM-CSF. In addition, the cytokine-stimulated dEoL-1 cells expressed costimulatory molecules, including CD40, CD80, CD86 and HLA-DR, and also expressed a tolerogenic and Th2-polarizing enzyme, indoleamine 2,3-dioxygenase. These in vitro observations raise the possibility that eosinophils may utilize lymphoid chemokines to enter lymph nodes (LNs) and serve antigen-presenting functions in the LN under certain inflammatory conditions. Taken together, differentiated HL-60 and EoL-1 cells are useful tools for the chemotactic study of human neutrophils and eosinophils.

1. CHEMOTAXIS IS CRITICAL TO THE DEFENSIVE FUNCTION OF NEUTROPHILS AND EOSINOPHILS Neutrophils and eosinophils play important roles in the defense against bacterial and parasitic invasion. After generated in bone marrow, the granulocytes are released into the circulation and are recruited to the inflammatory sites when and where necessary. After they leave blood vessels, neutrophils live in the tissue for a short time, while eosinophils for a longer but limited time, too [1]. Therefore, accurate and coordinated distribution of the granulocytes is critical to their defensive role. The granulocytes are distributed by chemotaxis according to the geographical cues provided by chemokines, inflammatory mediators and other microbe-derived substances. Inappropriate regulation of the chemotaxis is closely associated with functional defect of the granulocytes and may result in diseases [2].

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Chemotactic Assay of Human Neutrophils and Eosinophils

71

Chemotaxis assay is an important functional test of the granulocytes. Meanwhile, the lifespan of the granulocytes is very short in vitro, and it is demanding to get sufficient number of human eosinophils for chemotactic assay. Therefore, granulocytic cell lines are useful alternatives for the chemotactic assay. In the present study, we describe the general and chemotactic properties of the most popularly used granulocytic cell lines, HL60 and EoL-1 cells [3].

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

2. MORPHOLOGICAL CHANGE OF HL-60 CELLS DURING DIFFERENTIATION HL-60 is a promyelocytic cell line which is known to be differentiated into granulocytes by stimulation with all-trans retinoic acid, dimethylformamide (DMF), dimethylsulfoxide [4]. HL-60 cells can also be differentiated into monocytes by stimulation with vitamin D3 or phorbol 12myristate 13-acetate (PMA). Unstimulated HL-60 cells showed high N/C ratio, cytoplsmic granules, and 2 to 3 prominent nucleoli (Fig. 1). These findings are consistent with neoplstic promyelocytes. After stimulation with 0.8% DMF for 4 days, about 20 - 30% cells showed granulocytic differentiation. Full maturated neutrophils with segmented nuclei and azurophilic granules were observed. Small number of metamyelocyte-/myelocyte-like cells with cytoplasmic granules was also observed. In the PMA-stimulated cell fraction, almost all cells were large in size and showed convoluted nucleus with relatively fine chromatin and abundant ground glassy cytoplasm with fine cytoplasmic granules (Fig. 1c). On day 7, DMF-stimulated HL-60 cells show increased fraction of differentiated cells to myelocytes, while almost all cells appeared nearly fully mature monocytes in the PMA-stimulated H-L60 cells.

3. PHENOTYPIC CHANGE OF HL-60 CELLS DURING DIFFERENTIATION Along with the morphological change, HL-60 cells show a typical phenotypic change during differentiation [5]. Flow cytometric analysis showed a substantial increase in the expression of CD11b and CD18, which comprise type 2 complement receptor, on the surface of HL-60 cells at day 4 after stimulation with DMF (Fig. 2A, B) [6]. Thereafter until day 7, both the

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

72

Hyung-Ran Kim and Ju-Young Seoh

expressions of CD11b and CD18 declined. Meanwhile, stimulation with PMA induced a relatively small increase in the expression of CD18 at day 4, while CD11b was not increased at all. CD32 and CD64 are receptors for Fc portion of IgG with an intermediate and high affinity, respectively [7]. CD32 was already expressed on the surface of unstimulated HL-60 cells at a high level, whereas CD64 at a very low level that is hard to say even „expressed‟ (Fig. 2C, D). Expression of CD32 was increased only slightly on the surface of HL60 cells stimulated with DMF or PMA. By contrast, expression of CD64 was increased remarkably on the surface of HL-60 cells stimulated with DMF or PMA with a slight difference in time sequence; relatively fast increase in the stimulation with DMF than with PMA.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

4. FUNCTIONAL MATURATION OF HL-60 CELLS DURING DIFFERENTIATION Along with the morphological and phenotypic change, myelocytic function of HL-60 cells, such as phagocytosis, oxidative burst, antibodydependent cell mediated cytoxicity (ADCC), and opsonophagocytic activity, mature during differentiation [4]. Among them, unstimulated HL-60 cells already exert a substantial phagocytic activity that is not increased by stimulation with DMF or PMA, suggesting that phagocytosis is one of the most primitive functions of myelocytic cells that are already developed at the promyelocytic stage (Fig. 3A) [8]. By contrast, capability to produce reactive oxygen species assayed by chemiluminescnece assay was developed by stimulation with DMF or PMA with a little difference in time sequence (Fig. 3B). ADCC was also developed by stimulation with DMF, but not with PMA (Fig. 3C). Meanwhile, opsonophagocytic activity was developed by both the stimulation with DMF or PMA with a parallel time sequence (Fig. 3D).

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Chemotactic Assay of Human Neutrophils and Eosinophils

73

Figure 1. Morphology of HL-60 cells during in vitro differentiation by stimulation with dimethylformamide (DMF) or phorbol 12-myristate 13-acetate (PMA). HL-60 cells (ATCC CCL-240) cells were cultured in complete RPMI1640 supplemented with 10% FBS. HL-60 cells (5.0 x 105 cells/ml) were stimulated by adding DMF (Wako Pure Chemical Industries, Tokyo, Japan, final concentration 0.8%), PMA (Sigma, St. Louis, MO, final concentration 50 ng/ml) or vehicle (DMSO, final concentration 0.05%). After 4 days, the cells were harvested for the analysis of morphology, flow cytometry and chemotactic response. HL-60 cells became adherent after stimulation with PMA. So, the PMA-stimulated cells were harvested by vigorous pipetting. When necessary, dead cells were removed before use by centrifugation on Ficoll-Hypaque (d=1.077, Pharmacia, Piscataway, NJ) because DMF induces apoptosis as well as differentiation. For morphological analysis, the cells were spun at 500 r.p.m. for 5 min onto glass slides. The slides were air-dried and were stained with May-GrunwaldGiemsa solution. Unstimulated HL-60 cells showed high N/C ratio, cytoplsmic granules, and 2 to 3 prominent nucleoli. These findings are consistent with neoplstic promyelocytes. After stimulation with 0.8% DMF for 4 days, about 20 - 30% cells showed granulocytic differentiation. Full maturated neutrophils with segmented nuclei and azurophilic granules were observed. Small number of metamyelocyte-/myelocytelike cells with cytoplasmic granules was also observed. In the PMA-stimulated cell fraction, almost all cells were large in size and showed convoluted nucleus with relatively fine chromatin and abundant ground glassy cytoplasm with fine cytoplasmic granules. On day 7, DMF-stimulated HL-60 cells show increased fraction of differentiated cells to myelocytes, while almost all cells appeared nearly fully mature monocytes in the PMA-stimulated HL-60 cells.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

74

Hyung-Ran Kim and Ju-Young Seoh

Figure 2. Phenotypic change of HL-60 cells during in vitro differentiation by stimulation with dimethylformamide (DMF) or phorbol 12-myristate 13-acetate (PMA). HL-60 cells were cultured as in Fig. 1. For flow cytometric analysis, the cells were blocked by incubation with 10% human AB+ sera for 10 min, and were stained for 10 min in ice with PE-anti-human CD11b (mouse IgG1), PE-anti-human CD32 (mouse IgG1), PE-anti-human CD64 (mouse IgG1) or PE-anti-human CD18 (rat IgG2b). For isotype control, PE-mouse IgG1 and PE-rat IgG2b were also used. All the antibodies were purchased from Serotec (Oxford, UK). Samples were analyzed on a FACSCalibur flow cytometer (BD, Franklin Lakes, NJ). For absolute counts of the surface molecules, fluorescence intensity of each surface molecule was transformed into molecules of equivalent soluble fluorochrome (MESF) using Quantum 1,000 QuickCal Calibration/Compensation kit (Flow Cytometry Standards Co., San Juan, PR).

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Chemotactic Assay of Human Neutrophils and Eosinophils

75

Figure 3. Functional change of HL-60 cells during in vitro differentiation by stimulation with dimethylformamide (DMF) or phorbol 12-myristate 13-acetate (PMA). HL-60 cells were cultured as in Fig. 1. A. Phagocytic activity. Twenty five microliters of 2.67% FluoresbriteTM PC Red latex beads (diameter 1 μm, Polysciences, Warrington, PA) were added to 5.0 x 105 HL-60 cells in 1 ml and were cultured for 1 hour at 37oC in a shaking incubator. Then, the cells were fixed by mixing with equal volume of 1% paraformaldehyde. Free microbeads were separated from the mixture by centrifugation on the density of fetal calf serum for 5 min at 300 g. The cell pellet was washed and analyzed on a FACSCalibur flow cytometer. B. Chemiluminescence assay. In order to assess the capability of respiratory burst, 5.0 x 105 HL-60 cells in 200 μL PBS were added to the mixture of 785 μL PBS, 5 μL luminol (5-amino-2,3-dihydro1,4-phthalazinedione, 50 mM, Sigma) and 10 μL of PMA. The luminescence emitted from the mixture was measured on a luminometer (Multi-biolumat 9505C, Berthhold, Germany). C. Antibody-dependent cell-mediated cytotoxicity (ADCC). We devised a hemoglobin release assay for the assessment of ADCC, employing human Rh-D+ type O erythrocytes sensitized with RhoGAMTM antibody (Ortho Diagnostic Systems, Paritan, NJ) as target cells. Target cell lysis could be assessed by measuring the concentration of hemoglobin released from the lysed target cells by spectrophotometry (414 nm). For the spectrophotometric assay of hemoglobin, we used phenol red-free RPMI1640 (BioWhittaker, Walkersville, MD). D. Opsonophagocytic assay. Opsonophagocytic activity of the cells were evaluated by measuring fungicidal activity of Candida albicans sensitized with human pooled sera.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

76

Hyung-Ran Kim and Ju-Young Seoh

5. APOPTOSIS OF HL-60 CELLS DURING DIFFERENTIATION

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Cell viability is critical in the in vitro functional assay. During in vitro proliferation, 5~10% of the unstimulated HL-60 cells are apoptotic, suggesting spontaneous apoptosis rate (Fig. 4). Stimulation of HL-60 cells with DMF induced a rapid increase in the apoptosis rate, more than 30% at day 4 and around 70% at day 7. Stimulation with PMA also increased apoptosis rate, but at a much slower rate.

Figure 4. Phenotypic change of HL-60 cells during in vitro differentiation by stimulation with dimethylformamide (DMF) or phorbol 12-myristate 13-acetate (PMA). HL-60 cells were cultured as in Fig. 1. Annexin V conjugated with FITC (Pharmingen, San Diego, CA) was used for measurement of apoptosis. Cells were stained with annexin V (I mM) in 10 mM HEPES buffer (pH 7.4) containing 140 mM NaCl and 2.5 mM CaCl2. Samples were analyzed on a FACSCalibur flow cytometer.

6. CHEMOTACTIC RESPONSE OF HL-60 CELLS BY TRANSWELL ASSAY Considering the functional state as well as the apoptosis rate during differentiation, day 4 seems to be optimum for the chemotactic assay of HL-60 cells stimulated with DMF or PMA [9]. Unstimulated HL-60 cells showed little (0.81+0.05%) spontaneous migration in transwell assay (Fig. 5A).

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Chemotactic Assay of Human Neutrophils and Eosinophils

77

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

CXCL12/SDF-1α increased the migrated proportion of unstimulated HL-60 cells slightly but significantly (4.70+0.28%). On the other hand, at day 4, substantial proportions of in PMA- or DMF-stimulated HL-60 cells migrated spontaneously without any chemokine stimulation (20.4+2.18% and 31.0+2.76%, respectively) (Fig. 5B, C). CXCL12/SDF-1α also significantly increased the migrated proportions in PMA- and DMF-stimulated HL-60 cells.

Figure 5. Chemotaxis assay using transwell. HL-60 cells, unstimulated (A) and stimulated with 0.8% DMF (B) or PMA (50 ng/ml) (C) for 4 days, were washed and resuspended in chemotaxis buffer (complete RPMI1640 containing 0.25% BSA) in a cell density of 106 cells/ml. One hundred μl of the prepared cells were placed into the upper chamber of transwells (6.5 mm diameter, polycarbonate membranes with pore size 5 μm and 8 μm for DMF-stimulated cells and unstimulated/PMA-stimulated cells, respectively, Corning, Corning, NY). Six hundred μl of chemotaxis buffer with or without CXCL12 (20 ng/ml, Techne Co., Minneapolis, MN), CXCL8 (20 ng/ml, Techne Co.) and/or CCL3 (20 ng/ml, R&D Systems, Minneapolis, MN), was placed in the lower chamber of transwells. After 4 hours at 37oC, migrating (lower chamber) cells were counted with the use of a FACScalibur.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

78

Hyung-Ran Kim and Ju-Young Seoh

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

7. CHEMOTACTIC RESPONSE OF HL-60 CELLS OBSERVED BY VIDEO MICROSCOPY Video microscopic observation of the real motion of HL-60 cells showed a quite different pattern of chemotactic response. Unstimulated HL-60 cells showed a very tiny vibration that seemed to be increased by stimulation with chemokines (Fig. 6). However, directional migration was not observed by stimulation with any chemokine. The vibration speed of PMA-stimulated HL60 cells seemed to be higher than that of unstimulated HL-60 cells, and it was also increased by stimulation with chemokines. However, directional migration was not observed in PMA-stimulated cells, neither. On the other hand, DMF-stimulated cells showed genuine migration with a relatively high speed instead of just vibration even without chemokine stimulation, compared with unstimulated or PMA-stimulated HL-60 cells. Without chemokine stimulation, DMF-stimulated HL-60 cells showed only random migration. Chemokine stimulation with either or combination of CXCL12/SDF-1α, CXCL8/IL-8 and/or CCL3/MIP-1α not only induced directional migration but also increased the speed of migration in DMF-stimulated HL-60 cells. The moving speed was between 140 and 180 nm/sec, which is about one third or half of those of human peripheral blood neutrophils [10]. The directional migration of DMF-stimulated HL-60 cells was inhibited by pertussis toxin, implying the critical involvement of Gαi commonly associated with the 7transmembrane chemokines receptors (Fig. 7) [11]. Taken together, video microscopic observation of the real motion of the cells is complementary to the transwell assay that cannot discriminate true chemotaxis from random chemokinesis in understanding the chemotactic responsiveness of the granulocytes.

8. EOSINOPHILS ARE MULTIFUNCTIONAL LEUKOCYTES Eosinophils are multifunctional leukocytes that have been implicated in the pathogenesis of numerous inflammatory processes, including helminth infections and allergic diseases. Although eosinophils have been considered as terminally differentiated cells that mainly act as the first-line defense against parasites in the tissues in which they reside [12], it has been suggested that eosinophils are recruited from the circulation into inflammatory foci, where they modulate immune responses to diverse stimuli [13]. Recent reports have shown that eosinophils are also involved in numerous homeostatic processes in

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Chemotactic Assay of Human Neutrophils and Eosinophils

79

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

the thymus, mammary gland, uterus, and gastrointestinal tract [13]. In addition, several lines of evidence indicate that they may exhibit characteristics seen in antigen-presenting cells (APCs) in certain situations [14]. It has also been demonstrated that eosinophils migrate and accumulate in the draining lymph nodes of the lungs in the case of an intranasal antigen challenge in sensitized mice [15]. The antigen presentation and allergeninduced recruitment of eosinophils into lung tissues have been suggested as evidence of interaction with T lymphocytes [16]. More specifically, interferon(IFN-)-treated eosinophils are known to interact with T cells and promote Th2 polarization through the expression of functionally active indoleamine 2,3dioxygenase (IDO) in lymphoid tissue [17]. In regard to eosinophil chemotaxis, CCL11-CCR3 is the most selective eosinophil chemoattractant axis to be identified thus far [18, 19]. The molecular mechanisms underlying the migration of eosinophils into LNs, however, are not fully understood, and lymphoid chemokines could be the source of trafficking for those cells.

Figure 6. Chemotaxis assay using video microscopy. Chemotactic activity of the cells was also analyzed by the use of a newly developed time-lapse video microscopic technique [28]. Six microchennels (depth, 5 μm) were created between a fibronectincoated cover slip and silicon chip by assembling the holder set of the equipment (EZTAXIscan, ECI, Tokyo, Japan) according to the manufacturer‟s instruction. One thousand cells in 1 μL of chemotaxis medium were injected into each well at one side of the microchamber and 1 μL of chemokine (10 μM) was injected into the well at the other side. Then, assay runtime was 90 min at 37oC with still images being automatically captured every 30 s. After the assay, digital images were converted into movies for analysis, and the number of the cells moving into the assay field was counted using software (TAXIscan Analyzer) provided by the manufacturer.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

80

Hyung-Ran Kim and Ju-Young Seoh

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Figure 7. Inhibitory effect of pertussis toxin (PTX) on the directional migration of HL-60 cells stimulated with DMF for 4 days. Before application, the cells were pretreated with PTX (100 ng/ml in 10 mM sodium phosphate buffer (pH 7.0) containing 50 mM NaCl; Calbiochem, San Diego, CA) or buffer-only for 1 hr at 37oC. Then, chemotaxis assay for CXCL8 was done as in Fig. 6.

9. EOL-1 CELL IS A USEFUL MODEL FOR THE FUNCTIONAL STUDY OF EOSINOPHILS Although considerable progress has been made, eosinophil research has been hindered by the small number of cells that can be obtained from peripheral blood (PB) of healthy donors and the inability to expand eosinophils in vitro [20]. A human eosinophilic cell line, EoL-1, has been established, and is considered to be a useful in vitro model with which to study human eosinophils [21, 22]. EoL-1, stopped proliferating at the G1 phase, can be induced to differentiate into eosinophilic granule-containing cells, and die by apoptosis when differentiated by a number of stimuli, including butyric acid [23] and dibutyryl cyclic AMP (dbcAMP) [24, 25]. For this reason, EoL1 cells have been used as a model of eosinophil function including chemotaxis, receptor expression, mediator release, and apoptosis induction [23, 26, 27]. Here, we show that when EoL-1 cells were first differentiated with dbcAMP (dEoL-1) and then stimulated with a combination of IFN-γ, interleukin (IL)-3, and granulocyte macrophage-colony stimulating factor

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Chemotactic Assay of Human Neutrophils and Eosinophils

81

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

(GM-CSF), they responded to certain lymphoid chemokines such as CCL21 and CCL25 by expressing the respective cognate receptors, i.e., CCR7 and CCR9. Responsiveness to the lymphoid chemokines was also observed in cytokine-stimulated PB eosinophils. In addition, the cytokine-stimulated dEoL-1 cells expressed a few of the costimulatory molecules as well as a tolerogenic enzyme, IDO, which raised the possibility that eosinophils may modulate the nature of the T cell response.

Figure 8. Morphological differentiation observed in stimulated EoL-1 cells. EoL-1 cells were maintained in RPMI 1640 medium supplemented with 10% FBS in 5% CO 2 at 37C (A). EoL-1 cells were induced to differentiate by the addition of 0.1 mM dibutyryl cyclic AMP (dbcAMP, Sigma) for 9 days (B). Cell number readjustment to 5 x 105/ml was performed every 3 days. Then cells were further stimulated for another day with IFN-γ, IL-3, and GM-CSF and the concentration of each of the three cytokines was 10 ng/mL (C, D). The cultured EoL-1 cells were spun at 500 rpm for 5 min on glass slides. The slides were air-dried, stained with Diff-Quik stain solution, and observed under a light microscope. The unstimulated EoL-1 cells show a high nuclear-cytoplasmic ratio and a lack of nuclear lobulation. dEoL-1 as well as cytokine stimulated dEoL-1 cells show nuclear lobulation, formation of cytoplasmic vacuoles, and increased cellular aggregation. Although crystalloid inclusion had not yet developed, uniformly dense or round-shaped internal structures were frequently observed in the large granules (arrow) in electron microscopic examination (D). Scale bars, 10 μm (A-C), 0.4 μm (D). (Courtesy from S. Karger AG, Basel).

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

82

Hyung-Ran Kim and Ju-Young Seoh

10. EOSINOPHILIC PRECURSOR EOL-1 CELLS EXPRESSED LYMPHOID CHEMOKINE RECEPTORS CCR7 AND CCR9 FOLLOWING CYTOKINE-INDUCED DIFFERENTIATION

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

The EoL-1 cells represent the undifferentiated promyelocytic phase of eosinophils bearing a large nucleus with fine chromatin and prominent nucleoli (Fig. 8A) [28]. After treatment with dbcAMP and stimulation with the IFN-γ, IL-3, and GM-CSF cytokines, EoL-1 cells displayed morphological signs of differentiation; they showed nuclear lobulation, distinct vacuoles (Fig. 8B & 8C), and large granules in the cytoplasm (Fig. 8D), although the crystalloid inclusion typical of eosinophils had not yet developed in the granules. Consistent with these morphological observations, the cytokine stimulated dEoL-1 cells strongly expressed CCR3, the receptor for the eosinophil-directing chemokine, CCL11 (Fig. 9A) [28]. Interestingly, the stimulated dEoL-1 cells also expressed CCR7 and CCR9, the receptors for the lymphoid chemokines CCL21 and CCL25, respectively (Fig. 9A). In contrast, unstimulated EoL-1 did not express CCR7 or CCR9. Flow cytometric analysis confirmed the expression of CCR3, CCR7, and CCR9 in the cytokine stimulated dEoL-1 cells (Fig. 9B).

11. CYTOKINE-STIMULATED DEOL-1 CELLS SHOWED DIRECTIONAL MIGRATION TO THE LYMPHOID CHEMOKINES Next, we examined the functional abilities of the chemokine receptors induced on the stimulated dEoL-1 cells using a time-lapse video microscopic chemotaxis assay [29, 30]. dEoL-1 cells stimulated with IFN-γ, IL-3, and GMCSF migrated directionally in response to CCL11, CCL21, and CCL25 (Fig. 10A), whereas neither undifferentiated EoL-1 cells nor those treated with dbcAMP alone showed this type of migration (data not shown) [28]. Furthermore, the PB eosinophils stimulated with the cytokines for one day also migrated directionally in response to CCL11, CCL21, and CCL25 (Fig. 10B), whereas unstimulated eosinophils showed directional migration in response to CCL11, but not to CCL21 and CCL25 (data not shown). The proportion of the migrating cells was high, in the order of CCL21, CCL11, and CCL25, in both stimulated dEoL-1 cells and PB eosinophils, and the initiation of migration was faster in eosinophils than in EoL-1 cells (Fig. 10). Pretreatment with PTX

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Chemotactic Assay of Human Neutrophils and Eosinophils

83

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

almost completely abolished the directional migration of the cytokine stimulated dEoL-1 cells and eosinophils, demonstrating the Gi-mediated signaling processes (Fig. 10).

Figure 9. Expression of chemokine recpetors, CCR3, CCR7 and CCR9, on the differentiated EoL-1 cells only after stimulation with cytokines, with IFN-γ, IL-3, and GM-CSF. (A) RT-PCR for chemokine receptors. Total mRNA was extracted from the cultured cells. One μg of mRNA was reverse-transcribed using a reverse transcription system (Promega, Madison, WI), and the complementary DNA was amplified with Taq DNA polymerase (Takara, Shiga, Japan) as follows: an initial denaturation step (at 94°C for 3 min), 35 cycles of PCR (95°C for 30 s, 55°C for 30 s, 72°C for 15 s) and 72°C for 10 min using the GeneAmp PCR system 9600 (Perkin Elmer, Norwalk, CT, USA). The following primers were used for amplification: human glyceraldehyde 3phosphate dehydrogenase (GAPDH), 5‟-GTCTTCTCCACCATGGAGAAGGCT-3‟ and 5‟- CATGCCAGTGAGCTTCCCGTTCA-3‟; CCR7, 5‟- TCCTTCTCATC AGCAAGCTGTC-3‟ and 5‟- GAGGCAGCCCAGGTCCTTGAAG-3; CCR3, 5‟ATGCTGGTGACAGAGGTGAT-3‟ and 5- AGGTGA GTGTGGAAGGCTTA-3‟; CCR9, 5‟- TTCCTCCCACCCTTGTACTG-3‟, 5‟- AAGCCTTTTCTCCCTCCAAG3‟. The amplified DNA products were electrophoresed on 1% agarose gels and then stained with 0.5 g/mL of ethidium bromide. The chemokine receptors, CCR3, CCR7, and CCR9, were expressed only after stimulation with IFN-, IL-3, and GM-CSF in the dbcAMP-treated EoL-1 cells. (B) Flow cytometry for chemokine recpetors. Aliquots of EoL-1 cells, before and after stimulation with dbcAMP and IFN-, IL-3, and GM-CSF, were stained with PE anti-CCR3, PE anti-CCR7, and FITC anti-CCR9 (R&D Systems). The expression levels are shown as the ratio of the mean fluorescence intensity (MFI) of the stimulated and unstimulated EoL-1 cells. Error bar indicates SEM. (Courtesy from S. Karger AG, Basel).

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

84

Hyung-Ran Kim and Ju-Young Seoh

Figure 10. Kinetic analysis of the migrating cells showed the chemotactic response to CCL21 and CCL25, as well as to CCL11, in the cytokine-stimulated dEoL1 cells (A) and PB eosinophils (B). Human PB eosinophils were purified by centrifugation on a Histopaque (density 1.083 g/mL), erythrocyte settlement by adding dextran 500 followed by depletion of CD16 + neutrophils by immunomagnetic selection. The cells migrating toward the chemokines in the assay field were automatically counted using software (TAXISCAN analyzer). Note that significant fractions of the cytokine-stimulated dEoL-1 cells and PB eosinophils had begun migrating after the additions of CCL11, CCL21, and CCL25. Pretreatment of cells with pertussis toxin (PTX) almost completely abolished the migratory response of both the stimulated dEoL-1 cells and the PB eosinohpils. (Courtesy from S. Karger AG, Basel).

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Chemotactic Assay of Human Neutrophils and Eosinophils

85

CCL21 was first known to serve a homing function for T lymphocytes and also to direct mature DCs into T cell zones of LNs [31, 32]. CCL21 is expressed at high levels in the paracortical areas of LNs [33]. Findings of this study may provide a clue as to how eosinophils are recruited to regional LNs under inflammatory conditions, but further in vivo studies are needed. Eosinophils are mainly tissue-dwelling cells that are preferentially distributed in the thymus and gastrointestinal (GI) tract under steady state conditions [13]. The tissue levels of eosinophils are orchestrated by chemokines; CCL11, in particular, is the most selective eosinophil chemoattractant to be identified so far [19, 20]. In CCL11-deficient mice, eosinophils in the jejunum are substantially reduced, but are not completely absent [34], which indicates that CCL11 is important, but it is not the only chemokine that critically regulates the intestinal distribution of eosinophils. In addition, the widespread distribution of CCL11 in various tissues, including the skin, heart, skeletal muscle, lung, and intestine [35], does not explain the selective tissue distribution of eosinophils under steady-state conditions. In contrast, the expression of CCL25 is restricted only to the thymus and GI tract, exactly coinciding with the tissue distribution of eosinophils [36, 37]. In the present study, the video microscopic assay demonstrated that both the eosinophils and the EoL-1 cells are capable of responding to CCL25 (Fig. 11). This finding may provide evidence to support that CCL25 is involved in the selective tissue distribution of eosinophils in steady-state conditions, and this issue warrants further in vivo studies for confirmation.

12. CYTOKINE-STIMULATED DEOL-1 CELLS SHOWED SURFACE EXPRESSION OF APC-RELATED COSTIMULATORY MOLECULES, AS WELL AS IDO Because it has been reported previously that eosinophils may function as APCs upon activation [16], we examined the expression of costimulatory molecules that are essential for antigen presentation in the cytokine-stimulated dEoL-1 cells. As shown in Fig. 11A, the cytokine-stimulated dEoL-1 cells showed a marked increase in the expression of HLA-DR [28]. They also showed upregulated expression of CD80, CD86, and CD40. In addition, they showed prominent expression of a Th2-inducing enzyme, IDO, at the mRNA level, which was not seen in unstimulated EoL-1 cells (Fig. 11B). Collectively, these findings are consistent with the finding that eosinophils that may

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

86

Hyung-Ran Kim and Ju-Young Seoh

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

function as APCs in vivo in inflammatory conditions [38, 39]. Furthermore, IDO, one of the key enzymes of eosinophils that are involved in the polarization of the Th2 response, has also been demonstrated to be expressed in stimulated dEoL-1 cells (Fig. 11B). Taken together, these findings allow us to speculate that tissue eosinophils, in a certain microenvironment where cytokines such as IFN-γ, IL3, and GM-CSF are present, may traffic to the places where CCL21 is expressed. During the migration, they may functionally mature to express the APC-related molecules. Considering that eosinophils are armed with various kinds of mediators, including both the Th1 and Th2 type cytokines, the pattern of the eosinophil response may play a pivotal role in the following adaptive immune response [13].

Figure 11. (A) Antigen-presenting and costimulatory molecules were increased by treatment with dbcAMP and cytokines in EoL-1 cells. The expressions of antigenpresenting (HLA-DR) and costimulatory (CD80, CD86, CD40) molecules were analyzed by flow cytometry using FITC anti-CD40, PE anti-HLA-DR, PE anti-CD80, and FITC anti-CD86, that were purchased from BD Biosciences. Data represent the MFI ratio of each molecule between the unstimulated and stimulated EoL-1 cells. Error bar indicates SEM. (B) Indoleamine 2,3-dioxygenase was expressed at the mRNA level only after stimulation with IFN-γ, IL-3, and GM-CSF in the dbcAMPtreated EoL-1 cells. (Courtesy from S. Karger AG, Basel).

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Chemotactic Assay of Human Neutrophils and Eosinophils

87

ACKNOWLEDGMENT This work was supported by the RP-Grant 2010 of Ewha Womans University to JYS.

REFERENCES

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

[1]

Konno, M., Matsuda, S., Kariyone, S. (1993) Eosinophil kinetics. Nihon Rinsho. 51, 747-51. [2] Gao, J.L., Wynn, T.A., Chang, Y., Lee, E.J., Broxmeyer, H.E., Cooper, S., Tiffany, H.L., Westphal, H., Kwon-Chung, J., Murphy, P.M. (1997) Impaired host defense, hematopoiesis, granulomatous inflammation and type 1-type 2 cytokine balance in mice lacking CC chemokine receptor 1. J. Exp. Med. 185, 1959-68. [3] Koeffler, H.P., Golde, D.W. (1980) Human myeloid leukemia cell lines: a review. Blood. 56, 344-50. [4] Fleck, R.A., Athwal, H., Bygraves, J.A., Hockley, D.J., Feavers, I.M., Stacey, G.N. (2003) Optimization of NB-4 and HL-60 differentiation for use in opsonophagocytosis assays. In Vitro Cell Dev. Biol. Anim. 39, 235-42. [5] Cotter, T.G., Henson, P.M. (1983) A cell surface differentiation antigen involved in human neutrophil chemotaxis and degranulation. Clin. Exp. Immunol. 53, 249-53. [6] Liu, D., Zhu, J.Y., Niu, Z.X. (2008) Molecular structure and expression of anthropic, ovine, and murine forms of complement receptor type 2. Clin. Vaccine Immunol. 15, 901-10. [7] Fanger, N.A., Wardwell, K., Shen, L., Tedder, T.F., Guyre, P.M. (1996) Type I (CD64) and type II (CD32) Fc gamma receptor-mediated phagocytosis by human blood dendritic cells. J. Immunol. 157, 541-8. [8] Krajewski, A., Garg, M., De, M., Chandawarkar, R.Y. (2009) Phagocytosis: reemerging roles for a primitive function. Plast. Reconstr. Surg. 123, 834-47. [9] Hauert, A.B., Martinelli, S., Marone, C., Niggli, V. (2002) Differentiated HL-60 cells are a valid model system for the analysis of human neutrophil migration and chemotaxis. Int. J. Biochem. Cell Biol. 34, 83854. [10] Bae, S.Y., Jung, Y.J., Woo, S.Y., Park, M.H., Seoh, J.Y., Ryu, K.H.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

88

[11]

[12] [13] [14]

[15]

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

[16] [17]

[18]

[19]

[20] [21]

Hyung-Ran Kim and Ju-Young Seoh (2008) Distinct locomotive patterns of granulocytes, monocytes and lymphocytes in a stable concentration gradient of chemokines. Int. J. Lab. Hematol. 30, 139-48. Wieland, T., Gierschik, P., Jakobs, K.H. (1992) G protein-mediated receptor-receptor interaction: studies with chemotactic receptors in membranes of human leukemia (HL 60) cells. Naunyn Schmiedebergs Arch. Pharmacol. 346, 475-81. Butterworth, A.E. (1977) The eosinophil and its role in immunity to helminth infection. Curr. Top Microbiol. Immunol. 77, 127-68. Rothenberg, M.E., Hogan, S.P. (2006) The eosinophil. Annu. Rev. Immunol. 24, 147-74. Oehler, L., Majdic, O., Pickl, W.F., Stockl, J., Riedl, E., Drach, J., Rappersberger, K., Geissler, K., Knapp, W. (1998) Neutrophil granulocyte-committed cells can be driven to acquire dendritic cell characteristics. J. Exp. Med. 187, 1019-28. Duez, C., Dakhama, A., Tomkinson, A., Marquillies, P., Balhorn, A., Tonnel, A.B., Bratton, D.L., Gelfand, E.W. (2004) Migration and accumulation of eosinophils toward regional lymph nodes after airway allergen challenge. J. Allergy Clin. Immunol. 114, 820-5. Shi, H.Z. (2004) Eosinophils function as antigen-presenting cells. J. Leukoc. Biol. 76, 520-7. Odemuyiwa, S.O., Ghahary, A., Li, Y., Puttagunta, L., Lee, J.E., MusatMarcu, S., Ghahary, A., Moqbel, R. (2004) Cutting edge: human eosinophils regulate T cell subset selection through indoleamine 2,3dioxygenase. J. Immunol. 173, 5909-13. Jose, P.J., Griffiths-Johnson, D.A., Collins, P.D., Walsh, D.T., Moqbel, R., Totty, N.F., Truong, O., Hsuan, J.J., Williams, T.J. (1994) Eotaxin: a potent eosinophil chemoattractant cytokine detected in a guinea pig model of allergic airways inflammation. J. Exp. Med. 179, 881-7. Ponath, P.D., Qin, S., Ringler, D.J., Clark-Lewis, I., Wang, J., Kassam, N., Smith, H., Shi, X., Gonzalo, J.A., Newman, W., Gutierrez-Ramos, J.C., Mackay, C.R. (1996) Cloning of the human eosinophil chemoattractant, eotaxin. Expression, receptor binding, and functional properties suggest a mechanism for the selective recruitment of eosinophils. J. Clin. Invest. 97, 604-12. Zimmermann, N., Daugherty, B.L., Stark, J.M., Rothenberg, M.E. (2000) Molecular analysis of CCR-3 events in eosinophilic cells. J. Immunol. 164, 1055-64. Saito, H., Bourinbaiar, A., Ginsburg, M., Minato, K., Ceresi, E.,

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Chemotactic Assay of Human Neutrophils and Eosinophils

[22] [23]

[24]

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

[25]

[26] [27]

[28]

[29]

[30]

89

Yamada, K., Machover, D., Breard, J., Mathe, G. (1985) Establishment and characterization of a new human eosinophilic leukemia cell line. Blood. 66, 1233-40. Mayumi, M. (1992) EoL-1, a human eosinophilic cell line. Leuk. Lymphoma. 7, 243-50. Saito, H., Hayakawa, T., Mita, H., Akiyama, K., Shida, T. (1993) Effect of butyric acid on induction of differentiation into eosinophil-like cells in human eosinophilic leukemia cells, EoL-1 cell line: possible role of granulocyte-macrophage colony-stimulating factor as an autocrine differentiating factor. Int. Arch. Allergy Immunol. 100, 240-7. Tai, G., Eun-Young, J., Yuji, H., Masahiko, K., Toshio, H., Kenji, K., Kenshi, F., Mitsufumi, M. (1996) Different effects of cyclic AMP and butyrate on eosinophilic differentiation, apoptosis and bcl-2 expression of a human eosinophilic leukemia cell line, EoL-1. Hematol. Oncol. 14, 181-92. Wong, C.K., Ho, C.Y., Lam, C.W., Zhang, J.P., Hjelm, N.M. (1999) Differentiation of a human eosinophilic leukemic cell line, EoL-1: characterization by the expression of cytokine receptors, adhesion molecules, CD95 and eosinophilic cationic protein (ECP). Immunol. Lett. 68, 317-23. Al-Rabia, M.W., Blaylock, M.G., Sexton, D.W., Walsh, G.M. (2004) Membrane receptor-mediated apoptosis and caspase activation in the differentiated EoL-1 eosinophilic cell line. J. Leukoc. Biol. 75, 1045-55. Uenoyama, Y., Ohshima, Y., Morita, M., Akutagawa, H., Nambu, M., Kim, K.M., Mayumi, M., Mikawa, H. (1991) Dibutyryl cyclic AMP induces formyl peptide receptor expression and chemotactic responses in a human eosinophilic cell line, EoL-1. Exp. Hematol. 19, 823-8. Jung, Y.J., Woo, S.Y., Jang, M.H., Miyasaka, M., Ryu, K.H., Park, H.K., Seoh, J.Y. (2008) Human eosinophils show chemotaxis to lymphoid chemokines and exhibit antigen-presenting-cell-like properties upon stimulation with IFN-gamma, IL-3 and GM-CSF. Int. Arch. Allergy Immunol. 146, 227-34. Kanegasaki, S., Nomura, Y., Nitta, N., Akiyama, S., Tamatani, T., Goshoh, Y., Yoshida, T., Sato, T., Kikuchi, Y. (2003) A novel optical assay system for the quantitative measurement of chemotaxis. J. Immunol. Methods. 282, 1-11. Nitta, N., Tsuchiya, T., Yamauchi, A., Tamatani, T., Kanegasaki, S. (2007) Quantitative analysis of eosinophil chemotaxis tracked using a novel optical device -- TAXIScan. J. Immunol. Methods. 320, 155-63.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

90

Hyung-Ran Kim and Ju-Young Seoh

[31] Gunn, M.D., Tangemann, K., Tam, C., Cyster, J.G., Rosen, S.D., Williams, L.T. (1998) A chemokine expressed in lymphoid high endothelial venules promotes the adhesion and chemotaxis of naive T lymphocytes. Proc. Natl. Acad. Sci. U. S. A. 95, 258-63. [32] Gunn, M.D., Kyuwa, S., Tam, C., Kakiuchi, T., Matsuzawa, A., Williams, L.T., Nakano, H. (1999) Mice lacking expression of secondary lymphoid organ chemokine have defects in lymphocyte homing and dendritic cell localization. J. Exp. Med. 189, 451-60. [33] Cyster, J.G. (1999) Chemokines and the homing of dendritic cells to the T cell areas of lymphoid organs. J. Exp. Med. 189, 447-50. [34] Matthews, A.N., Friend, D.S., Zimmermann, N., Sarafi, M.N., Luster, A.D., Pearlman, E., Wert, S.E., Rothenberg, M.E. (1998) Eotaxin is required for the baseline level of tissue eosinophils. Proc. Natl. Acad. Sci. U. S. A. 95, 6273-8. [35] Rothenberg, M.E., Luster, A.D., Leder, P. (1995) Murine eotaxin: an eosinophil chemoattractant inducible in endothelial cells and in interleukin 4-induced tumor suppression. Proc. Natl. Acad. Sci. U. S. A. 92, 8960-4. [36] Wurbel, M.A., Philippe, J.M., Nguyen, C., Victorero, G., Freeman, T., Wooding, P., Miazek, A., Mattei, M.G., Malissen, M., Jordan, B.R., Malissen, B., Carrier, A., Naquet, P. (2000) The chemokine TECK is expressed by thymic and intestinal epithelial cells and attracts doubleand single-positive thymocytes expressing the TECK receptor CCR9. Eur. J. Immunol. 30, 262-71. [37] Kunkel, E.J., Campbell, J.J., Haraldsen, G., Pan, J., Boisvert, J., Roberts, A.I., Ebert, E.C., Vierra, M.A., Goodman, S.B., Genovese, M.C., Wardlaw, A.J., Greenberg, H.B., Parker, C.M., Butcher, E.C., Andrew, D.P., Agace, W.W. (2000) Lymphocyte CC chemokine receptor 9 and epithelial thymus-expressed chemokine (TECK) expression distinguish the small intestinal immune compartment: Epithelial expression of tissue-specific chemokines as an organizing principle in regional immunity. J. Exp. Med. 192, 761-8. [38] Weller, P.F., Rand, T.H., Barrett, T., Elovic, A., Wong, D.T., Finberg, R.W. (1993) Accessory cell function of human eosinophils. HLA-DRdependent, MHC-restricted antigen-presentation and IL-1 alpha expression. J. Immunol. 150, 2554-62. [39] Lucey, D.R., Nicholson-Weller, A., Weller, P.F. (1989) Mature human eosinophils have the capacity to express HLA-DR. Proc. Natl. Acad. Sci. U. S. A. 86, 1348-51.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

In: Granulocytes Editors: H. Abukara and M. Jumonji

ISBN: 978-1-61942-806-5 © 2012 Nova Science Publishers, Inc

Chapter 4

SURFACE EXPRESSION OF THE EARLY ACTIVATION MARKER (CD 69) AND DEGRANULATION OF EOSINOPHILS CAN BE DISCONNECTED János Fent and Susan Lakatos* Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Department of Pathophysiology, Research Institute of Military Health Centre, Hungarian Army, Budapest, Hungary

ABSTRACT Background: The activation of eosinophils is inevitable in certain immunological reactions and it is a multi-step complex process. Any intervention into this process may provide a tool to regulate the eosinophilic inflammation. Methods: Eosinophils in the peripheral blood samples of healthy donors were activated in vitro with IL-5. The surface expression of the early activation marker (CD 69) and the intracellular major basic protein contents as marker of degranulation of eosinophils were measured by flow cytometry. In some cases stimulation was carried out concomitant with the inhibition of intracellular protein transport, or in the presence of various protease inhibitors or inhibitors of protein synthesis. *

Corresponding author: Susan Lakatos. Department of Pathophysiology, Research Institute of Military Health Centre, Hungarian Army, H-1134 Róbert Károly krt. 44. Budapest, Hungary. Tel.: (361) 474-1111/35981; e-mail: [email protected]

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

92

János Fent and Susan Lakatos Results: The time dependence of CD 69 expression upon activation of the eosinophils can be described by a sigmoid-like curve which has an inflexion point around 120-150 min. This process can be impeded by cycloheximide (a protein synthesis inhibitor), or by GolgiStop (Monensin A, the intracellular protein transport inhibitor), or by a specific serine protease inhibitor (4-(2-Aminoethyl) benzenesulfonyl fluoride hydrochloride, AEBSF, Pefabloc SC), in a concentration dependent manner (Kd for AEBSF is about 65 µM). The intracellular MBP content of eosinophils is 77 ± 20%, 28 ± 17% and 31 ± 11% in the presence of IL-5, or AEBSF or AEBSF and IL-5, respectively. Conclusion: To attain a substantial increase in the expression of the early activation marker (CD 69) on the surface of the activated eosinophils de novo protein synthesis and intracellular protein transport are indispensable. CD 69 expression is regulated by an AEBSF inhibitable process. However, inhibition of CD 69 surface expression by AEBSF does not result in inhibition of degranulation of eosinophils. The fact that degranulation and CD 69 expression could be disconnected raises the possibility of the intervention into the regulation of the eosinophilic inflammation.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Keywords: Eosinophil activation, CD 69, AEBSF (Pefabloc SC), IL-5, eosinophil major basic protein, flow cytometry

INTRODUCTION Eosinophils are major cells in host defense against invasive metazoan parasites and in allergic inflammation [1, 2]. The severity of some diseases like asthma depends on the degree of eosinophil infiltration and activation. Activation of eosinophils leading to degranulation and the release of several inflammatory mediators into the host tissue is a multi-step complex process [38]. Blocking any point of this cascade may provide a means to control or ease the detrimental effects of activated eosinophils. The CD 69 antigen the so-called early activation marker [9] appears on the surface of the eosinophils only upon activation. The surface expression of CD 69 is a useful marker of the activation state of eosinophils in certain pathological cases such as asthma, hypereosinophilia or helminthiasis and in vitro studies as well [10-12]. Neither the mechanism of expression nor the function of CD 69 in eosinophils is completely clarified so far, however, it is

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Surface Expression of the Early Activation Marker …

93

known that it acts as a signal-transducing receptor involved in the activation events and apoptosis [13-15]. We aimed to reveal some feature of the activation of eosinophils in order to acquire a better ability to limit the detrimental effect of the in vivo activation of eosinophils.

MATERIALS AND METHODS Blood Sampling Blood samples were collected from the cubital vein of healthy volunteers into EDTA containing Vacuette tubes (Greiner, Austria) with the permission of the Local Ethical Committee after the donor had given informed consent.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Activation of Eosinophils in the Whole Blood EDTA anticoagulated blood samples were used. Samples were incubated at 37 C in the presence of 5% CO2 with 100 ng/ml rh-IL-5 (ICN Biomedicals Inc., USA), or with 100 ng/ml IL-5+cycloheximide (1, 10 and 100 μg/ml, Sigma) or with 100 ng/ml IL-5+Monensin A according to the manufacturer‟s instruction (GolgiStop, Becton-Dickinson, USA). In some cases along with the IL-5 (100 ng/ml) “Complete™” protease inhibitor cocktail or individual components of the protease inhibitor set (Roche GmbH, Germany) were added to the whole blood samples at final concentrations as suggested by the manufacturer. Blood samples without any additives supplemented with an appropriate volume of RPMI -1640 (Gibco, Scotland) served as controls. For time dependent measurements samples for flow cytometry were withdrawn at various time points: 10, 20, 30, 60, 90, 120, 150, 180 and 240 min, otherwise after 4 hours.

Flow Cytometry Immunofluorescent Staining of Surface Antigens The unstimulated as well as the stimulated blood samples (100 µL) were stained with 10 µL PC5 labeled anti-CD 69 (Immunotech, France) and with 10 µL FITC labeled anti-CD16 (DAKO, Denmark) monoclonal antibodies or

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

94

János Fent and Susan Lakatos

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

with the appropriate isotype controls at room temperature, in dark, for 30 minutes. The samples were then lysed with 2 ml of FACSLyse solution (Becton-Dickinson, USA) and washed twice with PBS (16 mM Na2HPO4, 2mM KH2PO4, 137 mM NaCl, 2.7 mM KCl, 2 mM EDTA, pH 7.4) supplemented with 1% BSA (Plazmed Kft, Hungary). The samples were measured in a FACScan flow cytometer (Becton Dickinson, USA). The eosinophil cells were gated on the basis of their higher side-scatter value and their low CD16 expression [16]. In every case 50000 events were collected. The amount of CD 69 expression on the eosinophil cells was measured in the eosinophil gate and expressed in specific mean fluorescence intensity (MFI) units, which are defined as the difference of mean fluorescence intensities of anti-CD 69 and isotype-stained samples.

Immunofluorescent Staining of Intracellular Antigens First the blood eosinophils were stained for their surface CD 16 with antiCD16 (DAKO, Denmark) antibody. After lysing the red blood cells samples were fixed and permeabilised by using the IntraStain kit of DAKO (Denmark) according to the manufacturer‟s instructions. After permeabilisation unlabeled mouse anti-human eosinophil major basic protein (MBP) (Becton Dickinson, USA) was added to the samples and as a second step reagent anti-mouse IgG-FITC (DAKO, Denmark) was used. Control samples were treated in the same way using appropriate isotype controls. Viability Analysis of Eosinophils At the end of a given treatment blood samples were stained with FITC labeled anti-CD16 (DAKO, Denmark) and then incubated with ViaProbe (Becton-Dickinson, USA) at 4 oC for 15 min. Red blood cells were lysed with FACSLyse solution (Becton-Dickinson, USA) for 5 min and samples were run immediately in the flow cytometer. Lysis of red blood cells did not affect the extent of ViaProbe staining as it was checked in separate experiments.

Statistics The Wilcoxon test was used to check differences for significance between treated and control samples. Values of p< 0.05 were considered to be statistically significant. Data in Figure 1,2 and 4 were fitted using Origin ver. 7.5 (Origin Lab. Corp., USA).

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

Surface Expression of the Early Activation Marker …

95

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

RESULTS Incubation of whole blood at 37 0C with IL-5 resultes in the appearance of CD 69 on the surface of the eosinophils in time-dependent manner. The time course of the CD 69 expression on the surface of the eosinophils has a sigmoid-like curve with an inflexion point around 120-150 min as it is represented in Figure 1 by a typical experiment. When cycloheximide – a protein synthesis inhibitor - is added along with IL-5 no CD 69 is detectable in the eosinophilic gate in the flow cytometer. Monensin A - the intracellular protein transport inhibitor - has the same effect when added along with IL-5 at the very beginning of the incubation of the whole blood. However, when incubation of the blood is first started with IL-5 and Monensin A is added later, its inhibitory effect on the CD 69 expression decreases as a function of time of addition. The inhibitoty effect of Monensin A on CD 69 expression completely disappeares if it is added two hours later than IL-5. Figure 2 represents a typical time dependence of CD 69 expression as a function of the addition time of Monensin A. To check whether some proteolytic processes are involved in the CD 69 expression in some cases the Roche protease inhibitor cocktail was added to the reaction mixture at the beginning of incubation (Figure 3). This protease inhibitor cocktail completely preventes the IL-5 induced CD 69 expression on the eosinophils. To reveal which of the components was responsible for this inhibition we examined the effect of those individual protease inhibitors which are sold by Roche as a protease inhibitor set since the manufacturer was not prepared to provide the composition of the protease inhibitor cocktail. As it is shown in Figure 3 none of the components but AEBSF mimics almost completely the inhibitory effect of the protease inhibitor cocktail. AEBSF inhibits the CD 69 expression on the surface of the activated eosinophils in a concentration dependent manner (Figure 4). The inhibitory constant estimated from data of Fig. 4 is about 65 µM. In spite of its inhibitory effect AEBSF does not influence substantially the viability of cells; i. e. the viability of cells was at least 85% even in the presence of 1 mM AEBSF. The intracellular MBP content is characteristic to the extent of degarnulation of the eosinophilic cells. Figure 5 shows the intracellular MBP content of resting, IL-5 activated or IL-5 activated eosinophils in the presence of AEBSF or eosinophils in the presence of AEBSF without activating agent. According to data presented in Figure 5 AEBSF itself induces degranulation of

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

96

János Fent and Susan Lakatos

CD69 expression (relative MFI, %)

100

80

60

40

20

0 0

50

100

150

200

250

time, min

100

CD69 expression (relative MFI, %)

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Figure 1. Time dependence of the CD 69 surface expression on the IL-5 stimulated eosinophils. Squares represent measured data in case of a typical experiment. CD 69 MFI values are expressed as per cent of the maximal asymptotic value of the sigmoid curve (solid line) fitted on the experimental points.

80

60

40

20

0 0

50

100

150

200

250

addition of Monensin A, min

Figure 2. Time dependence of CD 69 surface expression on the IL-5 stimulated eosinophils as a function of time when Monensin A was added. Squares represent measured data in case of a typical experiment. CD 69 MFI values are expressed as per cent of the maximal asymptotic value of the sigmoid curve (solid line) fitted on the experimental points.

Granulocytes: Production, Types and Roles in Disease : Production, Types and Roles in Disease, Nova Science Publishers,

97

CD69 expression (relative MFI, %)

Surface Expression of the Early Activation Marker …

100 80 60 40

*

*

20 0 1

2

3

4

5

6

7

8

9

10

11

12

100 CD 69 expression (relative MFI, %)

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Figure 3. Surface expression of CD 69 on the IL-5 stimulated eosinophils in the presence of various protease inhibitors. MFI data (mean+SD) are expressed as per cent of CD 69 expression on IL-5 stimulated eosinophils (control). 1: control; 2: inhibitor cocktail; 3: aprotinin; 4: antipain; 5: bestatin; 6: pepstatin; 7: chymostatin; 8: DMSO; 9: leupeptin; 10: E-64; 11: phosphoramidon; 12: AEBSF. * denotes significant (p