Foodborne Diseases 0128114967, 9780128114964

Table of contents :
Content: 1. Foodborne Diseases2. Recent advances in molecular techniques for diagnostics of food borne diseases3. Important emerging and re-emerging tropical food borne diseases4. Foodborne pathogens produced toxins acting on signal transduction5. Campylobacteriosis - An Emerging Infectious Foodborne Disease 6. Listeria monocytogenes: A foodborne pathogen7. Bacillus spp. as pathogens in the dairy industry8. Staphylococcus aureus - a food pathogen: virulence factors and antibiotic resistance9. Food-borne mycotoxicoses: Pathologies and public health impact10. Foodborne botulism from a systems biology perspective11. Pathogenic biofilm formation in the food industry and alternative control strategies12. Biosensor Based Methods For The Determination Of Foodborne Pathogens13. Molecular Typing of Major Foodborne Pathogens14. Environmental Pollution and the Burden of Food-borne Diseases15. Food borne illness: threats and control

Citation preview

Foodborne Diseases

Page left intentionally blank

Foodborne Diseases Handbook of Food Bioengineering, Volume 15

Edited by

Alina Maria Holban Alexandru Mihai Grumezescu

Academic Press is an imprint of Elsevier 125 London Wall, London EC2Y 5AS, United Kingdom 525 B Street, Suite 1800, San Diego, CA 92101-4495, United States 50 Hampshire Street, 5th Floor, Cambridge, MA 02139, United States The Boulevard, Langford Lane, Kidlington, Oxford OX5 1GB, United Kingdom Copyright © 2018 Elsevier Inc. All rights reserved. No part of this publication may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording, or any information storage and retrieval system, without permission in writing from the publisher. Details on how to seek permission, further information about the Publisher’s permissions policies and our arrangements with organizations such as the Copyright Clearance Center and the Copyright Licensing Agency, can be found at our website: www.elsevier.com/permissions. This book and the individual contributions contained in it are protected under copyright by the Publisher (other than as may be noted herein). Notices Knowledge and best practice in this field are constantly changing. As new research and experience broaden our understanding, changes in research methods, professional practices, or medical treatment may become necessary. Practitioners and researchers must always rely on their own experience and knowledge in evaluating and using any information, methods, compounds, or experiments described herein. In using such information or methods they should be mindful of their own safety and the safety of others, including parties for whom they have a professional responsibility. To the fullest extent of the law, neither the Publisher nor the authors, contributors, or editors, assume any liability for any injury and/or damage to persons or property as a matter of products liability, negligence or otherwise, or from any use or operation of any methods, products, instructions, or ideas contained in the material herein. Library of Congress Cataloging-in-Publication Data A catalog record for this book is available from the Library of Congress British Library Cataloguing-in-Publication Data A catalogue record for this book is available from the British Library ISBN: 978-0-12-811444-5 For information on all Academic Press publications visit our website at https://www.elsevier.com/books-and-journals

Publisher: Andre G. Wolff Acquisition Editor: Nina Rosa de Araujo Bandeira Editorial Project Manager: Jaclyn A. Truesdell Production Project Manager: Mohanapriyan Rajendran Designer: Matthew Limbert Typeset by Thomson Digital

Contents List of Contributors..............................................................................................xv Foreword..........................................................................................................xvii Series Preface.....................................................................................................xix Preface for Volume 15: Foodborne Diseases......................................................... xxiii Chapter 1: Microbial Foodborne Diseases................................................................1 Songül Ünüvar 1  Section 1. Bacterial Foodborne Diseases................................................................... 1  1.1 Aeromonas hydrophila–Induced Gastroenteritis.....................................................1  1.2 Bacillus cereus–Induced Gastroenteritis.................................................................2  1.3 Botulism..................................................................................................................6  1.4 Brucellosis...............................................................................................................6  1.5 Campylobacteriosis.................................................................................................7  1.6 Cholera....................................................................................................................7  1.7 Clostridium perfringens–Induced Necrotic Enteritis..............................................8  1.8 Enterobacter sakazakii Infection............................................................................8  1.9 Enterococcus faecalis Infection..............................................................................9 1.10  Escherichia coli Infection.......................................................................................9 1.11 Listeriosis..............................................................................................................11 1.12  Mycobacterium bovis Infection.............................................................................11 1.13  Q Fever..................................................................................................................12 1.14 Salmonellosis........................................................................................................12 1.15 Shigellosis.............................................................................................................13 1.16  Staphylococcus aureus Intoxication......................................................................14 1.17 Tularemia..............................................................................................................14 1.18  Typhoid Fever, Paratyphoid Fever........................................................................15 1.19  Vibrio parahaemolyticus-induced Gastroenteritis.................................................15 1.20  Vibrio vulnificus Infection.....................................................................................16 1.21 Yersiniosis.............................................................................................................16 2  Section 2. Parasitic Foodborne Diseases................................................................. 17  2.1 Amebiasis..............................................................................................................17  2.2 Anisakiasis............................................................................................................17  2.3 Ascariasis..............................................................................................................20 v

Contents  2.4 Clonorchiasis.........................................................................................................20  2.5 Cryptosporidiosis..................................................................................................20  2.6 Cyclosporiasis.......................................................................................................21  2.7 Diphyllobothriasis.................................................................................................21  2.8 Fascioliasis............................................................................................................21  2.9 Giardiasis..............................................................................................................22 2.10 Nanophyetiasis......................................................................................................22 2.11 Opisthorchiasis......................................................................................................22 2.12 Paragonimiasis......................................................................................................22 2.13  Taeniasis and Cysticercosis...................................................................................23 2.14  Toxoplasmosis and Congenital Toxoplasmosis.....................................................23 2.15 Trichinellosis.........................................................................................................24 3  Section 3. Viral Foodborne Diseases....................................................................... 24 3.1  Hepatitis A..............................................................................................................24 3.2  Hepatitis E...............................................................................................................26 3.3  Norovirus-Induced Gastroenteritis..........................................................................26 3.4 Poliomyelitis...........................................................................................................27 3.5  Rotavirus-Induced Gastroenteritis..........................................................................27 4 Conclusions............................................................................................................. 27 References................................................................................................................... 28

Chapter 2: Important Emerging and Reemerging Tropical Food-Borne Diseases............................................................................................33 Viroj Wiwanitkit 1 Introduction............................................................................................................. 33 2  Food-Borne Disease: Important Problem in Public Health..................................... 35 3  Examples of Important Food-Borne Diseases......................................................... 37 4  Emerging Infectious Diseases and Emerging Food-Borne Diseases....................... 42 5  Tropical Food-Borne Diseases: Important Tropical Diseases................................. 44 6 Databases and Computational Online Tools for Emerging and Reemerging Tropical Food-Borne Diseases���������������������������������������������������������������������������������45 7 How to Use the New Technologies for Management of the Emerging and Reemerging Tropical Food-Borne Diseases�����������������������������������������������������46 8  Further Important Issues Relating to Emerging Food-Borne Diseases................... 50 9 Conclusions............................................................................................................. 52 References................................................................................................................... 53 Chapter 3: Foodborne Pathogen–Produced Toxins and Their Signal Transduction.......57 Asit R. Ghosh 1 Introduction............................................................................................................. 57 2  Foodborne Pathogens (Bacterial, Viral, Fungal, and Algal).................................... 59 2.1 Bacteria...................................................................................................................59 2.2 Rotavirus.................................................................................................................64 2.3 Mycotoxins.............................................................................................................65 2.4 Cyanotoxins............................................................................................................65 vi

Contents

3  Toxins That Target Signal Transduction.................................................................. 65 3.1  Cholera Toxin and ETEC Heat-Labile Toxin..........................................................68 3.2  Shiga Toxins............................................................................................................68 3.3  ETEC Heat-Stable Enterotoxin...............................................................................69 3.4 Superantigens..........................................................................................................69 4  Signal Transduction................................................................................................. 69 4.1  Toxins Induce Enterocyte Intracellular Signaling...................................................70 5  Recent Developments.............................................................................................. 73 6 Conclusions............................................................................................................. 74 References................................................................................................................... 74

Chapter 4: Toxoplasmosis: Prevalence and New Detection Methods..........................79 Maryna Galat, Nickolaj Starodub, Vladyslav Galat 1 Introduction............................................................................................................. 79 1.1  General Characteristics of the Disease....................................................................79 1.2  Definitions, Classification, and General Characteristics of the Individual Types of Biosensors............................................................................86 2  Seroprevalence of Toxoplasmosis in Animals in Ukraine..................................... 102 2.1 Ruminants.............................................................................................................102 2.2 Pigs........................................................................................................................104 2.3 Cats.......................................................................................................................106 2.4 Poultry...................................................................................................................108 3  Comparison of New Methods of Diagnostics........................................................ 108 4  Discussion and Conclusions.................................................................................. 110 References................................................................................................................. 111

Chapter 5: Campylobacteriosis: An Emerging Infectious Foodborne Disease............119 Ying-Hsin Hsieh, Irshad M. Sulaiman 1 Introduction........................................................................................................... 119 2 Taxonomy.............................................................................................................. 119 2.1 Flagella..................................................................................................................120 2.2 Capsule..................................................................................................................121 2.3 Toxins....................................................................................................................121 3  Ecology and Transmission..................................................................................... 122 3.1 Water.....................................................................................................................122 3.2 Wildlife..................................................................................................................123 3.3  Farm and Domestic Animals.................................................................................123 3.4 Poultry...................................................................................................................124 4  Clinical Relevance................................................................................................. 125 4.1 Gastroenteritis.......................................................................................................128 4.2  Guillain–Barré Syndrome.....................................................................................129 4.3  Miller Fisher Syndrome........................................................................................129 4.4  Reactive Arthritis (RA).........................................................................................130 5  Epidemiology and Outbreak.................................................................................. 130 6 Isolation................................................................................................................. 134 vii

Contents 6.1  Sample Preparation...............................................................................................135 6.2  Preenrichment and Enrichment.............................................................................136 6.3  Isolation and Identification...................................................................................137 6.4 Culturing...............................................................................................................137 6.5  Isolation of Campylobacter spp. From Human Samples......................................139 7 Typing.................................................................................................................... 140 8 Conclusions........................................................................................................... 143 References................................................................................................................. 145

Chapter 6: Listeria monocytogenes: A Food-Borne Pathogen..............................157 Meenakshi Thakur, Rajesh Kumar Asrani, Vikram Patial 1 Introduction........................................................................................................... 157   1.1  Microbiology of  L. monocytogenes....................................................................158  1.2 Epidemiology......................................................................................................158  1.3 Pathophysiology of L. monocytogenes Infection................................................160  1.4 Pathogenesis........................................................................................................162   1.5  Virulence Factors.................................................................................................163   1.6  Molecular Determinants of  L. monocytogenes Pathogenesis.............................163   1.7 Adaptation Mechanisms in L. monocytogenes to Survive Under Adverse Environmental Conditions������������������������������������������������������������������� 166   1.8  Isolation and Detection of  L. monocytogenes.....................................................169   1.9  Growth and Incidence of  L. monocytogenes in Food.........................................173 1.10  Control Measures................................................................................................174 1.11  Advanced Strategies to Control L. monocytogenes.............................................178 2 Conclusions........................................................................................................... 181 References................................................................................................................. 181

Chapter 7: Bacillus spp. as Pathogens in the Dairy Industry..................................193 Alyssa A. Grutsch, Pierre S. Nimmer, Rachel H. Pittsley, John L. McKillip 1  Bacillus: General Information............................................................................... 193 2  Bacillus in Clinical Settings (General).................................................................. 195 2.1  Bacillus cereus–Mediated Endophthalmitis..........................................................195 3  Bacillus in Food..................................................................................................... 197 3.1  Bacillus spp. Biofilms...........................................................................................201 4  Quorum Sensing.................................................................................................... 202 5  Quorum Sensing and Bacillus spp. Pathogenesis.................................................. 202 6  Summary and Future Work.................................................................................... 205 References................................................................................................................. 207

Chapter 8: S  taphylococcus aureus, a Food Pathogen: Virulence Factors and Antibiotic Resistance.......................................................213 Ana Castro, Joana Silva, Paula Teixeira 1 Introduction........................................................................................................... 213 2  Staphylococcus aureus—General Characteristics.................................................. 214 viii

Contents

 3 Occurrence of Staphylococcus aureus................................................................. 215  3.1 S. aureus in Humans...........................................................................................215  3.2 S. aureus in Animals...........................................................................................216  3.3 S. aureus in Food.................................................................................................216   4  Staphylococcus aureus and Clinical Aspects: An Overview............................... 218   5  MRSA Strains...................................................................................................... 219   6  Staphylococcal Food Poisoning—Outbreaks...................................................... 220   7  Presence of Virulence Factors in Staphylococcus aureus.................................... 222  7.1 S. aureus Virulence Factors—An Overview.......................................................222   7.2  Antibiotic Resistance..........................................................................................227   8  Biocontrol and Staphylococcus aureus................................................................ 229   9 Preventing Staphylococcus aureus—Other Than Antibiotics.............................. 230 10 Conclusions......................................................................................................... 231 References................................................................................................................. 231

Chapter 9: Food-Borne Mycotoxicoses: Pathologies and Public Health Impact..........239 Vikram Patial, Rajesh Kumar Asrani, Meenakshi Thakur   1 Introduction.......................................................................................................... 239   2  Important Factors for Mycotoxin Production...................................................... 240   3 Aflatoxins............................................................................................................. 241   3.1  Effect on Humans................................................................................................242  3.2 Effect on Animals................................................................................................243  3.3 Pathology............................................................................................................244   4 Fumonisins........................................................................................................... 244   4.1  Effect on Humans................................................................................................245  4.2 Effect on Animals................................................................................................245  4.3 Pathology............................................................................................................246   5  Ochratoxin A........................................................................................................ 248   5.1  Effect on Humans................................................................................................249  5.2 Effect on Animals................................................................................................249  5.3 Pathology............................................................................................................250   6 Zearalenone.......................................................................................................... 251   6.1  Effect on Humans................................................................................................253  6.2 Effect on Animals................................................................................................253  6.3 Pathology............................................................................................................254   7 Trichothecenes..................................................................................................... 254   7.1  Effect on Humans................................................................................................255  7.2 Effect on Animals................................................................................................255  7.3 Pathology............................................................................................................256   8 Citrinin................................................................................................................. 256   8.1  Effect on Humans................................................................................................257  8.2 Effect on Animals................................................................................................257  8.3 Pathology............................................................................................................258   9 Moniliformin........................................................................................................ 258  9.1 Pathology............................................................................................................259 ix

Contents

10  Ergot Alkaloids.................................................................................................... 260 11  Public Health and Economic Impact of Mycotoxins........................................... 262 12 Conclusions......................................................................................................... 266 References................................................................................................................. 266

Chapter 10: Foodborne Botulism From a Systems Biology Perspective....................275 Frank J. Lebeda, Zygmunt F. Dembek, Michael Adler   1 Introduction.......................................................................................................... 275   2  Food Matrix System: Biophysical Properties...................................................... 279   3  Bacterial Neurotoxin-Producing System............................................................. 281   3.1  Growth Models for Clostridium botulinum Type A1..........................................282   3.2  Progenitor Toxin Complex (PTC) Subsystems...................................................283   4  Gastrointestinal Tract System.............................................................................. 285   4.1  Foodborne Botulism: Pathways and Kinetics of Neurotoxin Action..................285  4.2 Intestinal Barrier.................................................................................................286   5  Vascular and Lymphatic Systems......................................................................... 293   6  Peripheral Cholinergic Neuromuscular Junction System.................................... 294   7  Systems Biology of Secondary Reactions........................................................... 295   8  Future Directions in Systems Biology of Foodborne Botulism........................... 296   9 Conclusions.......................................................................................................... 298 10 Disclaimer............................................................................................................ 300 References................................................................................................................. 300

Chapter 11: Pathogenic Biofilm Formation in the Food Industry and Alternative Control Strategies...................................................309 Efstathios E. Giaouris, Manuel V. Simões 1 Introduction........................................................................................................... 309 2  Pathogenic Bacterial Biofilms in the Meat Industry.............................................. 314 3  Pathogenic Bacterial Biofilms in the Dairy Industry............................................. 319 4  Pathogenic Bacterial Biofilms in the Fresh Produce Industry............................... 322 5  Pathogenic Bacterial Biofilms in the Seafood Industry......................................... 325 6  Alternative Antibiofilm Strategies for Use in the Food Industry........................... 335 6.1 Enzymes................................................................................................................335 6.2 Bacteriophages......................................................................................................341 6.3  Interference with Cell-to-Cell Communication and Quorum Quenching.............347 7 Conclusions........................................................................................................... 353 References................................................................................................................. 355

Chapter 12: Biosensor-Based Methods for the Determination of Foodborne Pathogens..................................................................379 Burcin Bozal-Palabiyik, Aysen Gumustas, Sibel A. Ozkan, Bengi Uslu 1 Introduction........................................................................................................... 379 2  Causes of Foodborne Diseases.............................................................................. 380 x

Contents

3  Detection of Foodborne Pathogens........................................................................ 382 3.1  Culture Methods....................................................................................................387 3.2  ATP Bioluminescence Methods............................................................................387 3.3  Microscopic Methods............................................................................................387 3.4  Immunological Methods.......................................................................................389 3.5  Molecular Methods...............................................................................................390 3.6 Biosensors.............................................................................................................391 4 Conclusion............................................................................................................. 411 References................................................................................................................. 415

Chapter 13: Molecular Typing of Major Foodborne Pathogens...............................421 Spiros Paramithiotis, Agni Hadjilouka, Eleftherios H. Drosinos 1 Introduction........................................................................................................... 421 1.1 PFGE.....................................................................................................................422 1.2 MLVA....................................................................................................................423 1.3 MLST....................................................................................................................423 2  Listeria monocytogenes......................................................................................... 424 2.1 Introduction...........................................................................................................424 2.2 PFGE.....................................................................................................................425 2.3 MLVA....................................................................................................................425 2.4 MLST....................................................................................................................431 3  Salmonella............................................................................................................. 433 3.1 Introduction...........................................................................................................433 3.2 PFGE.....................................................................................................................434 3.3 MLVA....................................................................................................................435 3.4 MLST....................................................................................................................448 4  Campylobacter spp................................................................................................ 454 4.1 Introduction...........................................................................................................454 4.2 PFGE.....................................................................................................................454 4.3 MLST....................................................................................................................455 4.4  Flagellin Locus-Based Typing..............................................................................456 5  Escherichia coli O157:H7..................................................................................... 456 5.1 Introduction...........................................................................................................456 5.2 PFGE.....................................................................................................................457 5.3 MLST....................................................................................................................457 5.4 MLVA....................................................................................................................458 6 Conclusions........................................................................................................... 461 References................................................................................................................. 461

Chapter 14: Environmental Pollution and the Burden of Food-Borne Diseases.........473 Papiya Deb 1  Introduction: The Present Scenario....................................................................... 473 2  Food-Borne Diseases............................................................................................. 474 3  The Most Common Microbe of Food-Borne Ailment, Salmonella sp.................. 475 xi

Contents

 4 Climate Change................................................................................................... 476   4.1  Global Warming..................................................................................................476   4.2  Contamination in Meat.......................................................................................478   4.3  Climate Change Effect on Root Flavonoids........................................................479  5 Contaminated Water............................................................................................ 480   5.1  The Fresh Water Hassle......................................................................................480   5.2  Pathogens in Water..............................................................................................481   5.3  Unprocessed Biosolids in Water.........................................................................483   5.4  Heavy Metals in Water........................................................................................484   5.5  Arcobacters in Shellfish......................................................................................485   5.6  Concentrated Animal Feeding Operations..........................................................485   6  Pesticides and Other Chemicals.......................................................................... 486   6.1  Pesticides and the Threat of Cancer....................................................................488  7 Crops Contaminated With Antibiotics................................................................. 489   8  Polychlorinated and Polybrominated Biphenyls................................................. 490   9  Heavy Metals in Air............................................................................................. 490 10  Poor Sanitation.................................................................................................... 491 11  Undernourishment and Overnourishment............................................................ 492   11.1  Lifestyle, Food, and Cancer..............................................................................494 12  Genetically Modified Foods................................................................................ 494 13  Rare Earth Elements: A Future Concern............................................................. 495 14  Recommendations and Conclusions.................................................................... 495 References................................................................................................................. 497

Chapter 15: Foodborne Illness: Threats and Control.............................................501 Mian K. Sharif, Komal Javed, Ayesha Nasir 1  Foodborne Illness................................................................................................... 501 1.1 Introduction...........................................................................................................501 1.2  World Scenario......................................................................................................502 1.3 Types.....................................................................................................................502 2  Foodborne Pathogens............................................................................................. 504 2.1 Bacteria.................................................................................................................504 2.2 Viruses...................................................................................................................504 2.3 Fungi.....................................................................................................................505 2.4 Parasites................................................................................................................506 3  Common Foodborne Illnesses............................................................................... 506 3.1 Campylobacteriosis...............................................................................................506 3.2 Shigellosis.............................................................................................................508 3.3 Salmonlellosis.......................................................................................................508 3.4 Botulism................................................................................................................509 3.5  Escherichia coli.....................................................................................................509 3.6 Listeriosis..............................................................................................................510 3.7  Norwalk-Like Virus...............................................................................................510 3.8  Typhoid Fever.......................................................................................................510 xii

Contents

4  Pathology of Foodborne Illness............................................................................. 511 5  Detection Techniques............................................................................................. 512 5.1  Polymerase Chain Reaction..................................................................................513 5.2  Isothermal Amplification......................................................................................514 5.3  Microarray Detection............................................................................................514 5.4  Nucleic Acid Built Recognition............................................................................515 6  Impact on Human Health....................................................................................... 515 6.1  Foodborne Illness and Acute Illness.....................................................................515 6.2  Foodborne Illness and Chronic Diseases..............................................................517 6.3  Food Preservatives................................................................................................518 7  Prevention of Foodborne Illness............................................................................ 518 7.1  Food Safety Risk Assessment...............................................................................519 7.2  A Shared Responsibility........................................................................................519 8 Conclusions........................................................................................................... 521 References................................................................................................................. 522

Index��������������������������������������������������������������������������������������������������������������525

xiii

Page left intentionally blank

List of Contributors Michael Adler  US Army Medical Research Institute of Chemical Defense, MD, United States Rajesh Kumar Asrani  Dr. G.C. Negi College of Veterinary and Animal Sciences, Chaudhary Sarwan Kumar Himachal Pradesh Krishi Vishvavidyalaya, Palampur, Himachal Pradesh, India Burcin Bozal-Palabiyik  Ankara University, Ankara, Ankara, Turkey Ana Castro  CBQF—Center for Biotechnology and Fine Chemistry, Portuguese Catholic University, Porto, Portugal Papiya Deb  SVKM’s Mithibai College, University of Mumbai, Mumbai, Maharashtra, India Zygmunt F. Dembek  Uniformed Services University of the Health Sciences, Bethesda, MD, United States Eleftherios H. Drosinos  Agricultural University of Athens, Athens, Greece Maryna Galat  National University of Life and Environmental Sciences of Ukraine, Kiev, Ukraine Vladyslav Galat  National University of Life and Environmental Sciences of Ukraine, Kiev, Ukraine Asit R. Ghosh  Centre for Infectious Diseases & Control, VIT University, Vellore, Tamil Nadu, India Efstathios E. Giaouris  Department of Food Science and Nutrition, University of the Aegean, Myrina, Lemnos, Greece Alyssa A. Grutsch  Ball State University, Muncie, IN, United States Aysen Gumustas  Ankara University, Ankara, Ankara, Turkey Agni Hadjilouka  Agricultural University of Athens, Athens, Greece Ying-Hsin Hsieh  US Food and Drug Administration, Atlanta, GA, United States Komal Javed  National Institute of Food Science & Technology, University of Agriculture, Faisalabad, Pakistan Frank J. Lebeda  Systems Biology Collaboration Center, US Army Center for Environmental Health Research, US Army Medical Research and Materiel Command, Frederick, MD; Johns Hopkins University, Washington, DC, United States John L. McKillip  Ball State University, Muncie, IN, United States Ayesha Nasir  National Institute of Food Science & Technology, University of Agriculture, Faisalabad, Pakistan Pierre S. Nimmer  Ball State University, Muncie, IN, United States Sibel A. Ozkan  Ankara University, Ankara, Ankara, Turkey Spiros Paramithiotis  Agricultural University of Athens, Athens, Greece Vikram Patial  CSIR-Institute of Himalayan Bioresource Technology, Palampur, Himachal Pradesh, India Rachel H. Pittsley  Ball State University, Muncie, IN, United States

xv

List of Contributors Mian K. Sharif  National Institute of Food Science & Technology, University of Agriculture, Faisalabad, Pakistan Joana Silva  CBQF—Center for Biotechnology and Fine Chemistry, Portuguese Catholic University, Porto, Portugal Manuel V. Simões  LEPABE, University of Porto, Porto, Portugal Nickolaj Starodub  National University of Life and Environmental Sciences of Ukraine, Kiev, Ukraine Irshad M. Sulaiman  US Food and Drug Administration, Atlanta, GA, United States Paula Teixeira  CBQF—Center for Biotechnology and Fine Chemistry, Portuguese Catholic University, Porto, Portugal Meenakshi Thakur  Dr. G.C. Negi College of Veterinary and Animal Sciences, Chaudhary Sarwan Kumar Himachal Pradesh Krishi Vishvavidyalaya, Palampur, Himachal Pradesh, India Songül Ünüvar  İnönü University, Malatya, Turkey Bengi Uslu  Ankara University, Ankara, Ankara, Turkey Viroj Wiwanitkit  Hainan Medical University, Hainan, China; University of Niš, Niš, Serbia; Joseph Ayo Babalola University, Ikeji-Arakeji, Osun, Nigeria; Surin Rajabhat University, Surin, Thailand; Dr. DY Patil Medical University, Mumbai, Maharashtra, India

xvi

Foreword In the last 50 years an increasing number of modified and alternative foods have been developed using various tools of science, engineering, and biotechnology. The result is that today most of the available commercial food is somehow modified and improved, and made to look better, taste different, and be commercially attractive. These food products have entered in the domestic first and then the international markets, currently representing a great industry in most countries. Sometimes these products are considered as life-supporting alternatives, neither good nor bad, and sometimes they are just seen as luxury foods. In the context of a permanently growing population, changing climate, and strong anthropological influence, food resources became limited in large parts of the Earth. Obtaining a better and more resistant crop quickly and with improved nutritional value would represent the Holy Grail for the food industry. However, such a crop could pose negative effects on the environment and consumer health, as most of the current approaches involve the use of powerful and broad-spectrum pesticides, genetic engineered plants and animals, or bioelements with unknown and difficult-to-predict effects. Numerous questions have emerged with the introduction of engineered foods, many of them pertaining to their safe use for human consumption and ecosystems, long-term expectations, benefits, challenges associated with their use, and most important, their economic impact. The progress made in the food industry by the development of applicative engineering and biotechnologies is impressive and many of the advances are oriented to solve the world food crisis in a constantly increasing population: from genetic engineering to improved preservatives and advanced materials for innovative food quality control and packaging. In the present era, innovative technologies and state-of-the-art research progress has allowed the development of a new and rapidly changing food industry, able to bottom-up all known and accepted facts in the traditional food management. The huge amount of available information, many times is difficult to validate, and the variety of approaches, which could seem overwhelming and lead to misunderstandings, is yet a valuable resource of manipulation for the population as a whole. The series entitled Handbook of Food Bioengineering brings together a comprehensive collection of volumes to reveal the most current progress and perspectives in the field of food engineering. The editors have selected the most interesting and intriguing topics, and have dissected them in 20 thematic volumes, allowing readers to find the description of xvii

Foreword basic processes and also the up-to-date innovations in the field. Although the series is mainly dedicated to the engineering, research, and biotechnological sectors, a wide audience could benefit from this impressive and updated information on the food industry. This is because of the overall style of the book, outstanding authors of the chapters, numerous illustrations, images, and well-structured chapters, which are easy to understand. Nonetheless, the most novel approaches and technologies could be of a great relevance for researchers and engineers working in the field of bioengineering. Current approaches, regulations, safety issues, and the perspective of innovative applications are highlighted and thoroughly dissected in this series. This work comes as a useful tool to understand where we are and where we are heading to in the food industry, while being amazed by the great variety of approaches and innovations, which constantly changes the idea of the “food of the future.” Anton Ficai, PhD (Eng) Department Science and Engineering of Oxide Materials and Nanomaterials, Faculty of Applied Chemistry and Materials Science, Politehnica University of Bucharest, Bucharest, Romania

xviii

Series Preface The food sector represents one of the most important industries in terms of extent, investment, and diversity. In a permanently changing society, dietary needs and preferences are widely variable. Along with offering a great technological support for innovative and appreciated products, the current food industry should also cover the basic needs of an ever-increasing population. In this context, engineering, research, and technology have been combined to offer sustainable solutions in the food industry for a healthy and satisfied population. Massive progress is constantly being made in this dynamic field, but most of the recent information remains poorly revealed to the large population. This series emerged out of our need, and that of many others, to bring together the most relevant and innovative available approaches in the intriguing field of food bioengineering. In this work we present relevant aspects in a pertinent and easy-to-understand sequence, beginning with the basic aspects of food production and concluding with the most novel technologies and approaches for processing, preservation, and packaging. Hot topics, such as genetically modified foods, food additives, and foodborne diseases, are thoroughly dissected in dedicated volumes, which reveal the newest trends, current products, and applicable regulations. While health and well-being are key drivers of the food industry, market forces strive for innovation throughout the complete food chain, including raw material/ingredient sourcing, food processing, quality control of finished products, and packaging. Scientists and industry stakeholders have already identified potential uses of new and highly investigated concepts, such as nanotechnology, in virtually every segment of the food industry, from agriculture (i.e., pesticide production and processing, fertilizer or vaccine delivery, animal and plant pathogen detection, and targeted genetic engineering) to food production and processing (i.e., encapsulation of flavor or odor enhancers, food textural or quality improvement, and new gelation- or viscosity-enhancing agents), food packaging (i.e., pathogen, physicochemical, and mechanical agents sensors; anticounterfeiting devices; UV protection; and the design of stronger, more impermeable polymer films), and nutrient supplements (i.e., nutraceuticals, higher stability and bioavailability of food bioactives, etc.).

xix

Series Preface The series entitled Handbook of Food Bioengineering comprises 20 thematic volumes; each volume presenting focused information on a particular topic discussed in 15 chapters each. The volumes and approached topics of this multivolume series are: Volume 1: Food Biosynthesis Volume 2: Food Bioconversion Volume 3: Soft Chemistry and Food Fermentation Volume 4: Ingredients Extraction by Physicochemical Methods in Food Volume 5: Microbial Production of Food Ingredients and Additives Volume 6: Genetically Engineered Foods Volume 7: Natural and Artificial Flavoring Agents and Food Dyes Volume 8: Therapeutic Foods Volume 9: Food Packaging and Preservation Volume 10: Microbial Contamination and Food Degradation Volume 11: Diet, Microbiome and Health Volume 12: Impact of Nanoscience in the Food Industry Volume 13: Food Quality: Balancing Health and Disease Volume 14: Advances in Biotechnology for Food Industry Volume 15: Foodborne Diseases Volume 16: Food Control and Biosecurity Volume 17: Alternative and Replacement Foods Volume 18: Food Processing for Increased Quality and Consumption Volume 19: Role of Materials Science in Food Bioengineering Volume 20: Biopolymers for Food Design The series begins with a volume on Food Biosynthesis, which reveals the concept of food production through biological processes and also the main bioelements that could be involved in food production and processing. The second volume, Food Bioconversion, highlights aspects related to food modification in a biological manner. A key aspect of this volume is represented by waste bioconversion as a supportive approach in the current waste crisis and massive pollution of the planet Earth. In the third volume, Soft Chemistry and Food Fermentation, we xx

Series Preface aim to discuss several aspects regarding not only to the varieties and impacts of fermentative processes, but also the range of chemical processes that mimic some biological processes in the context of the current and future biofood industry. Volume 4, Ingredients Extraction by Physicochemical Methods in Food, brings the readers into the world of ingredients and the methods that can be applied for their extraction and purification. Both traditional and most of the modern techniques can be found in dedicated chapters of this volume. On the other hand, in volume 5, Microbial Production of Food Ingredients and Additives, biological methods of ingredient production, emphasizing microbial processes, are revealed and discussed. In volume 6, Genetically Engineered Foods, the delicate subject of genetically engineered plants and animals to develop modified foods is thoroughly dissected. Further, in volume 7, Natural and Artificial Flavoring Agents and Food Dyes, another hot topic in food industry— flavoring and dyes—is scientifically commented and valuable examples of natural and artificial compounds are generously offered. Volume 8, Therapeutic Foods, reveals the most utilized and investigated foods with therapeutic values. Moreover, basic and future approaches for traditional and alternative medicine, utilizing medicinal foods, are presented here. In volume 9, Food Packaging and Preservation, the most recent, innovative, and interesting technologies and advances in food packaging, novel preservatives, and preservation methods are presented. On the other hand, important aspects in the field of Microbial Contamination and Food Degradation are shown in volume 10. Highly debated topics in modern society: Diet, Microbiome and Health are significantly discussed in volume 11. Volume 12 highlights the Impact of Nanoscience in the Food Industry, presenting the most recent advances in the field of applicative nanotechnology with great impacts on the food industry. Additionally, volume 13 entitled Food Quality: Balancing Health and Disease reveals the current knowledge and concerns regarding the influence of food quality on the overall health of population and potential food-related diseases. In volume 14, Advances in Biotechnology for Food Industry, up-to-date information regarding the progress of biotechnology in the construction of the future food industry is revealed. Improved technologies, new concepts, and perspectives are highlighted in this work. The topic of Foodborne Diseases is also well documented within this series in volume 15. Moreover, Food Control and Biosecurity aspects, as well as current regulations and food safety concerns are discussed in the volume 16. In volume 17, Alternative and Replacement Foods, another broad-interest concept is reviewed. The use and research of traditional food alternatives currently gain increasing terrain and this quick emerging trend has a significant impact on the food industry. Another related hot topic, Food Processing for Increased Quality and Consumption, is considered in volume 18. The final two volumes rely on the massive progress made in material science and the great applicative impacts of this progress on the food industry. Volume 19, Role of Materials Science in Food Bioengineering, offers a perspective and a scientific introduction in the science of engineered materials, with important applications in food research and technology. Finally, in volume 20, Biopolymers for Food Design, we discuss the advantages and challenges related to the development of improved and smart biopolymers for the food industry. xxi

Series Preface All 20 volumes of this comprehensive collection were carefully composed not only to offer basic knowledge for facilitating understanding of nonspecialist readers, but also to offer valuable information regarding the newest trends and advances in food engineering, which is useful for researchers and specialized readers. Each volume could be treated individually as a useful source of knowledge for a particular topic in the extensive field of food engineering or as a dedicated and explicit part of the whole series. This series is primarily dedicated to scientists, academicians, engineers, industrial representatives, innovative technology representatives, medical doctors, and also to any nonspecialist reader willing to learn about the recent innovations and future perspectives in the dynamic field of food bioengineering. Alina M. Holban University of Bucharest, Bucharest, Romania Alexandru M. Grumezescu Politehnica University of Bucharest, Bucharest, Romania

xxii

Preface for Volume 15: Foodborne Diseases The quality and amount of daily food intake represent one of the most important factors in balancing health and disease in humans. Along with the nutritional value of ingested food, other factors, such as contaminants, contribute to food quality and may determine foodborne diseases. These health-threatening conditions may occur as a result of various chemical and biological contaminants, which may also have a huge impact on the food quality. Biological contaminants include microorganisms, such as bacteria, microfungi, and protozoa; but also viruses and parasites and nonetheless their toxins. Infectious and parasitic foodborne diseases cause severe illness in consumers, and sometimes epidemiologic outbreaks. In this book, we aim to present and dissect basic and novel information on the types of food-associated risks, foodborne diseases, main contaminants, and their characteristics; but also current and future perspectives for the early detection and prevention of food contamination. The volume contains 15 chapters prepared by outstanding authors from Turkey, Greece, Thailand, USA, Ukraine, Portugal, India, and Pakistan. The selected manuscripts are clearly illustrated and contain accessible information for a wide audience, especially food scientists, microbiologists, medical doctors, engineers, biotechnologists, biochemists, industrial companies; and also for any reader interested in learning about the most interesting and recent advances in the field of foodborne diseases. Chapter 1, entitled Microbial Foodborne Diseases, prepared by Ünüvar, introduces the readers in the field of foodborne diseases, focusing on the classification, causes, clinical features, and new approaches to reduce/prevent the risk of microbial related foodborne diseases. Chapter 2, Important Emerging and Reemerging Tropical Foodborne Diseases, written by Wiwanitkit, reviews and discusses emerging and reemerging tropical foodborne diseases and ways to combat this public health problem. Chapter 3, entitled Foodborne Pathogens—Produced Toxins Acting on Signal Transduction, was prepared by Ghosh. This manuscript discusses dominant pathogens that produce one or more toxins targeting signal transduction of the host, which finally leads to pathophysiological changes and subsequently to disease. Some inhibit protein synthesis; some are neurotoxic or some other target different cellular functions. xxiii

Preface for Volume 15: Foodborne Diseases Chapter 4, Toxoplasmosis: Prevalence and New Detection Methods, written by Galat et al., describes toxoplasmosis, the causing parasite, as well as prevalence of this parasitic disease. It is currently believed that the use of advanced biosensors to detect contaminated products would decrease the rate of diseases and associated defects. Chapter 5, entitled Campylobacteriosis: An Emerging Infectious Foodborne Disease, prepared by Hsieh and Sulaiman, offers an overview regarding Campylobacter infections, the wide spread of this disease and currently investigated methods to early detect and avoid the occurrence of massive infections. Recovery of these emerging infectious bacteria from food is still a difficult task. Molecular typing has been effective in characterizing Campylobacter isolated from food, outbreak, sporadic cases, surveillance, and environmental samples. Currently, multilocus sequence typing (MLST) and whole genome sequencing (WGS) is increasingly applied in epidemiologic investigations and transmission dynamics of bacteria causing foodborne diseases. Chapter 6, Listeria monocytogenes: A Foodborne Pathogen, prepared by Thakur et al., describes the most frequent illness produced by this foodborne pathogen, such as invasive listeriosis, gastroenteritis, septicemia, endocarditis, meningitis, rhombencephalitis, perinatal infections, ophthalmitis, and abortion. Various aspects of Listeria monocytogenes pathogenesis involving mechanisms of virulence, survival under adverse conditions, incidence and growth in food, methods of detection, and control measures so as to facilitate the development of better ways of disease prevention are presented here. Chapter 7, Bacillus spp. as Pathogens in the Dairy Industry, written by Grutsch et al., reveals the current status of knowledge with Bacillus spp. relevant to the dairy industry, virulence potential, and biofilm production from the perspective of food safety. This bacterial genus is capable of contaminating a wide range of food products, including rice, chicken, vegetables, spices, and dairy products, and causing many health-threatening conditions. Chapter 8, Staphylococcus aureus, a Food Pathogen: Virulence Factors and Antibiotic Resistance, prepared by Castro et al., aims to show the main virulence determinants and issues related with Staphylococcus aureus food contamination, empathizing on the great risk of antibiotic resistance. Antibiotics were widely used not only in human but also in animal husbandry and other agricultural activities. The occurrence of multiresistant strains in food has been increasing; contaminated food is considered as an important vehicle for antimicrobial resistance. Methicillin-resistant S. aureus (MRSA) commonly carry enterotoxin genes and antibiotic resistance associated to enterotoxins genes made S. aureus an evolving threat. In Chapter 9, Food-Borne Mycotoxicoses: Pathologies and Public Health Impact, Patial et al. present recent information regarding mycotoxins and the health-threatening conditions that they induce after the ingestion of contaminated food. This chapter discusses important food xxiv

Preface for Volume 15: Foodborne Diseases mycotoxins and the main diseases they produce, such as: aflatoxin, a liver damaging toxin; ochratoxin A, associated with kidney damage; fumonisins, causing liver damage, cancer, and developmental defects; moniliformin, causing acute cardiac damage; deoxynivalenol and zearalenone, causing immunotoxicity and gastroenteritis. Chapter 10, Foodborne Botulism From a Systems Biology Perspective, written by Lebeda et al., highlights the impact of a systems approach in helping scaling of the effectiveness of therapies and reduces the costs of hospitalizations in patients with botulism. Computational models describing Clostridium botulinum spore activation, bacterial growth, and neurotoxin production in food could be linked to risk assessments that help improve food safety procedures and public health policies. Combining experimental and clinical data is also critical in developing models designed to simulate illness onset times and durations. Chapter 11, entitled Pathogenic Biofilm Formation in the Food Industry and Alternative Control Strategies, was prepared by Giaouris and Simões. The ability of foodborne bacterial pathogens, such as Salmonella spp., Listeria monocytogenes, pathogenic Escherichia coli, Campylobacter spp., Bacillus cereus, and Staphylococcus aureus, to attach to various surfaces and create biofilms on them is a worrying hygienic trouble for the food industry, as this may cause serious food contamination and diseases transmission. The purpose of this chapter is to review the current knowledge related to pathogenic biofilm formation in the main food industries (meat, dairy, fresh produce, and seafood) and also to provide up-to-date data on some potential alternative or supplementary antibiofilm strategies. Chapter 12, Biosensor-Based Methods for the Determination of Foodborne Pathogens, written by Bozal-Palabiyik et al., gives an overview regarding the main progress made for the development of rapid methods for the detection of foodborne pathogens. Early screening of foodborne pathogens in foods plays an important role in preventing and controlling the outbreaks of foodborne diseases. Biosensors design is one of the important methods for foodborne pathogen detection, which present sensitive, rapid, and low-cost technologies. This study focused on the methods of immobilization of biological component to generate biosensors, applications of mostly used electrochemical and optical biosensors, and recent prospects for foodborne pathogen detection and determination. Chapter 13, Molecular Typing of Major Foodborne Pathogens, prepared by Paramithiotis et al., presents accurate methods for the identification of the infection source and the transmission route for the effective implementation of preventive measures against microbial foodborne pathogens. Techniques, such as pulsed-field gel electrophoresis (PFGE), multilocus variable number of tandem repeats analysis (MLVA), and multilocus sequence typing (MLST) are dissected and examples on typing approaches in Listeria monocytogenes, Salmonella serovars, Escherichia coli O157:H7, and Campylobacter spp. are integrated and critically discussed. xxv

Preface for Volume 15: Foodborne Diseases In Chapter 14, Environmental Pollution and the Burden of Food-Borne Diseases, Deb reveals the connection linking environmental contamination to foodborne ailments. Various types of environmental pollutions lead to distress, as they are often indirect and reliant on numerous adaptive forces. Numerous menaces to ecosystem directing to foodborne ailments comprise change in climate, contaminated water, use of excess fertilizers-pesticides, poor sanitation, etc. Climate change lays stress on agricultural production causing mass malnutrition and vulnerability to diseases. Furthermore, the dissemination and activity of carriers of foodborne pathogens as insects and rodents alter with changes in weather conditions; producing diseases. Atmospheric contaminants often migrate in food in small amounts causing lifethreats. Environmental pollution causing foodborne diseases being an area of serious concern at all echelons, the chapter discusses each of these issues in detail with special reference to the developing countries. Chapter 15, Foodborne Illness: Threats and Control, prepared by Sharif et al., gives an overview of the current threats in foodborne diseases, types, pathology, symptoms, adverse effects, contributory factors, major foodborne pathogens, molecular detection methods, toxin synthesis, hazard and risk analysis, and control measures. Furthermore, current and future efforts to be made to comprehensively deliberate impact of food quality, storage, and preservation on human health, role of consumer toward ensuring food security will be also dissected. Alina M. Holban University of Bucharest, Bucharest, Romania Alexandru M. Grumezescu Politehnica University of Bucharest, Bucharest, Romania

xxvi

CHAPTE R 1

Microbial Foodborne Diseases Songül Ünüvar ˙I nönü University, Malatya, Turkey

This chapter reviews microbial foodborne diseases caused by bacteria, parasites, and viruses and their significance as a health concern. Microbial foodborne illnesses constitute the majority of foodborne diseases (Fig. 1.1). Several pathogens cause serious microbial diseases in humans. Each year millions of people become sick or even die from food poisonings. Pathogen-induced foodborne diseases are a major health problem worldwide (Fig. 1.2).

1  Section 1. Bacterial Foodborne Diseases This section focuses on the classification, causes, and clinical features of bacterial foodborne diseases and on risk reduction and prevention of these diseases (Table 1.1).

1.1  Aeromonas hydrophila–Induced Gastroenteritis Aeromonas hydrophila is a Gram-negative, motile, nonspore-forming, facultatively anaerobic bacterium that causes Aeromonas-induced gastroenteritis. Aeromonas species can be found in various concentrations in drinking water, aquatic environments, sewage, and foods, including seafoods, raw milk, chicken, vegetables, and meats, such as lamb, veal, pork, and ground beef (Janda and Abbott, 2010; WHO, 2008a). The symptoms of infection include watery stools, abdominal cramps, mild fever, and vomiting. Bronchopneumonia and cholecystitis are observed in severe cases (Mossel et al., 1999). Aeromonas infections have been divided into four groups: (1) gastrointestinal tract syndromes, (2) wound infections and connective tissue infections, (3) bloodborne dyscrasias, and (4) a wide-ranging class that includes a myriad of less frequently encountered ailments and infectious processes (Janda and Abbott, 2010). Rehydration therapy and antimicrobial treatment are recommended in cases of chronic dysentery (Farrar et al., 2014). A. hydrophila strains are resistant to most of the β-lactams, including ceftazidime, cefepime, imipenem, and piperacillin-tazobactam (Janda and Abbott, 2010). Antimicrobials, such as fluoroquinolones may be effective (Farrar et al., 2014).

Foodborne Diseases http://dx.doi.org/10.1016/B978-0-12-811444-5.00001-4

1

Copyright © 2018 Elsevier Inc. All rights reserved.

2  Chapter 1

Figure 1.1: Classification of Foodborne Diseases.

Figure 1.2: Global Burden of Foodborne Diseases—2015 (WHO, 2015).

1.2  Bacillus cereus–Induced Gastroenteritis Bacillus cereus is a Gram-positive, facultatively anaerobic, generally mesophilic, heatresistant, spore-forming rod widely distributed in the environment. The natural environmental reservoir for B. cereus consists of decaying organic matter, fresh and marine waters, foods, such as boiled or fried rice, spices, dried foods, milk, dairy products, vegetable dishes, sauces, fomites, and the intestinal tracts of invertebrates (Bottone, 2010; WHO, 2008a). The pathogenicity of B. cereus is associated with two toxins, namely diarrheal toxin and emetic toxin. Diarrheal toxin causes diarrheal syndrome characterized with acute diarrhea, nausea, and abdominal pain. Emetic toxin leads to emetic syndrome characterized with acute nausea, vomiting, abdominal pain, and rarely diarrhea (Ehling-Schulz et al., 2004). B. cereus strains have been generally resistant to penicillins, erythromycin, tetracycline, and carbapenem due to the consequence of β-lactamase production. Empiric antibiotic therapy is recommended

Table 1.1: Major bacterial foodborne diseases and clinical features (FDA, 2012; WHO, 2008a). Organism

Illness

Incubation Period

Aeromonas hydrophila

Aeromonas enteritis

Bacillus cereus

Duration

Food Sources

24–48 h

Dysentery-like symptoms, blood and mucus in the stool, abdominal cramps, mild fever, vomiting

Days to weeks

B. cereus gastroenteritis

10–16 h

Abdominal cramps, watery diarrhea, nausea, vomiting, and pain

24–48 h

Brucella spp.

Brucellosis

3 weeks

Weeks to months

Campylobacter jejuni

Campylobacteriosis 2–5 days

Clostridium botulinum

Botulism

12–36 h

Intermittent fever, lassitude, sweat, headache, chills, constipation, arthralgias, generalized aching, weight loss, anorexia, malaise, joint and muscle pain, arrhythmia, edema, or chest pain, meningoencephalitis, stiff neck, confusion or seizures, spondylitis, such as back pain Bloody diarrhea, abdominal cramps, fever, vomiting, nausea, headache, and muscle pain Vomiting, abdominal pain, diarrhea, fatigue, blurred vision, double vision, muscle weakness, slurred speech, difficulty in swallowing, dry mouth, headache, dizziness, constipation

Seafood (fish, shrimp, oysters), snails, drinking water, meats (beef, pork, lamb, and poultry), certain vegetables, such as sprouts Meats, stews, gravies, boiled or fried rice, spices, dried foods, milk, dairy products, vegetable dishes, fish and sauces, other starchy foods, potato, pasta, and cheese products; food mixtures; puddings, soups, casseroles, pastries, and salads Unpasteurized goat’s or sheep’s milk and products made from the milk of infected animals

Clostridium perfringens

Clostridium perfringens enteritis

8–24 h

Abdominal cramps, watery diarrhea, rarely vomiting and fever

2–3 weeks Raw and undercooked poultry, beef, pork, unpasteurized milk, contaminated drinking water, vegetables, and seafood Weeks to Home-canned vegetables, fish and fish months products, baked potatoes in aluminum foil, condiments (e.g., pepper), meat and meat products, green beans, soups, beets, asparagus, mushrooms, ripe olives, spinach, chicken and chicken livers, liver pâté 1–2 days Meats, poultry, vegetables (spices and herbs), gravy, raw and processed foods, time- and/or temperature-abused foods (Continued)

Microbial Foodborne Diseases  3

Signs and Symptoms

Organism Coxiella burnetii

Illness Q fever

Incubation Period 2 weeks

E. coli

E. coli infection

1–6 days

Enterobacter sakazakii

Cronobacter infection

Variable

Francisella tularensis

Tularemia

Listeria monocytogenes

Listeriosis

Miscellaneous Miscellaneous Enterobacteriaceae bacterial enteric Mycobacterium bovis

Tuberculosis

Plesiomonas shigelloides

Plesiomonas shigelloides enteric infection

Signs and Symptoms Very high fever, severe headaches, muscle aches, chills, profuse sweating, nausea, vomiting, diarrhea, dry cough, abdominal cramps, chest pain Watery diarrhea, abdominal cramps, vomiting, high fever, nausea, malaise

Poor feeding response, irritability, jaundice, grunting respirations, instability of body temperature, seizures, brain abscess, hydrocephalus, developmental delay 3–6 days Symptoms varying according to the type of tularemia from mild diarrhea to severe bowel damage, chills, fever, and headaches Days to Influenza-like symptoms, such as several weeks fever, headache and fever, muscle aches, stiff neck, confusion, loss of balance, convulsions, nausea, vomiting, diarrhea 12–24 h Acute gastroenteritis may include vomiting, nausea, fever, chills, abdominal pain, and watery diarrhea Months to Fever, night sweats, fatigue, loss years of appetite, weight loss, chronic cough, bloodstained sputum, chest pain, diarrhea, abdominal pain 20–50 h Fever, chills, abdominal pain, nausea; watery, nonmucoid, nonbloody diarrhea; vomiting, dehydration

Duration Food Sources 1–2 weeks Contaminated unpasteurized milk or dairy products

Days to weeks

Water or food contaminated with human feces, raw or undercooked ground-meat products, raw milk from infected animals, vegetables 2–8 weeks Contaminated powdered infant formula, milk powders, cheese products, other dried foods

Variable

Milk and undercooked meats from infected animals (particularly rabbits and hares)

Days to weeks

Unpasteurized and raw milk and products (soft cheeses), chocolate milk, ice cream, meat-based paste, hot dogs and deli meats, raw and smoked fish and other seafood, raw vegetables, coleslaw Dairy products, raw shellfish, raw vegetables

Days to weeks Months to years

Raw and unpasteurized cow’s milk and its products, raw or undercooked meats of infected animals

1–7 days

Contaminated water, raw shellfish, improperly cooked or raw foods, seafoods, such as crabs, fish, and oysters

4  Chapter 1

Table 1.1: Major bacterial foodborne diseases and clinical features (FDA, 2012; WHO, 2008a). (cont.)

Organism

Illness

Incubation Period

Salmonella spp.

Salmonellosis

6–48 h

Diarrhea, fever, abdominal cramps, 4–7 days vomiting, nausea, headache

10–20 days

Nausea, high fever, abdominal pain, headache, rashes, loss of appetite

1–7 days

Abdominal cramps, fever, diarrhea, 5–7 days vomiting, pus or mucus in stools, tenesmus Severe nausea and vomiting, 24–48 h abdominal cramps, diarrhea and fever, prostration, dehydration, headache, muscle cramping, and transient changes in blood pressure and pulse rate Pain on swallowing, high fever, 4 days headache, nausea, vomiting, malaise, rhinorrhea

Salmonella typhi and Typhoid fever, paratyphoid fever S. paratyphi

Shigella spp.

Shigellosis or bacillary dysentery

Staphylococcus aureus Staphylococcus aureus 2–6 h intoxication

Signs and Symptoms

Duration

Several weeks to months

Food Sources Raw eggs, poultry, meat, unpasteurized milk or juice, cheese, chocolate, contaminated raw fruits and vegetables, spices, salads Prepared foods, dairy products, meat products, poultry, eggs, shellfish, shrimp; fruits and vegetables, such as tomatoes, peppers, and cantaloupes; chocolate, coconut, sauces Raw or uncooked foods, contaminated drinking water, mixed salads and vegetables, raw milk and dairy products Unrefrigerated or improperly refrigerated meats and meat products, poultry and egg products; salads, such as egg, tuna, chicken, potato, and macaroni; milk and dairy products

Streptococcus spp. intoxication

1–3 days

Vibrio cholerae

Cholera

1–3 days

Vibrio parahaemolyticus

Vibrio parahaemolyticus gastroenteritis

4–90 h

Vibrio vulnificus

Vibrio vulnificus infection

12 h–21 days Vomiting, diarrhea, abdominal Days to pain, fever, bleeding within the skin, weeks nausea, chills, pain in the extremities 24–36 h Abdominal pain, diarrhea, mild 1–3 weeks Raw milk and milk products, meats fever, sometimes vomiting (pork, beef, lamb, etc.), oysters, fish, crabs

Yersinia enterocolitica Yersiniosis

Profuse watery diarrhea, severe dehydration, abdominal pain and vomiting, with rice-water stools Watery and/or bloody diarrhea, abdominal cramps, nausea, vomiting, fever

Up to 7 days 2–6 days

Milk (both pasteurized and unpasteurized), ice cream, cream, eggs, cooked seafood, salads, such as potato, egg, and shrimp; custard, rice pudding Seafood, molluscan shellfish (oysters, mussels, and clams), crab, lobster, shrimp, squid, and finfish, vegetables Undercooked or raw seafood, such as shellfish, raw or undercooked fish and fishery products, raw or improperly cooked oysters, other seafood products, including finfish, squid, octopus, lobster, shrimp, crab, and clams Undercooked or raw seafood, such as shellfish (especially raw oysters)

Microbial Foodborne Diseases  5

Streptococcus spp.

6  Chapter 1 in suspected B. cereus infections while awaiting the antibiotic susceptibility testing profile. Vancomycin and broad-spectrum cephalosporins and ticarcillin-clavulanate should be choices for the empirical therapy of patients with suspected B. cereus infection (Bottone, 2010).

1.3 Botulism Clostridium botulinum is a Gram-positive, spore-forming, anaerobic bacteria motile rod that produces potent neurotoxins. Seven types of toxins have been identified (A–G). F type has been associated with botulism. C. botulinum is responsible for four syndromes: foodborne botulism (due to ingestion of foods contaminated with toxin), infant botulism (intestinal infection, colonization, and toxin production), wound botulism (infection of a wound with C. botulinum), and adult intestinal toxemia botulism (intestinal colonization and toxin production in adults) (Sobel, 2005). Foodborne botulism is caused by ingestion of foods, such as vegetables, condiments, fish and fish products, and meat and meat products contaminated with C. botulinum toxin. Honey consumption is a common vehicle of transmission of infant botulism (Fratamico et al., 2005). Botulism occurs by accidental or intentional exposure to botulinum toxins. Vomiting, abdominal pain, fatigue, muscle weakness, headache, dizziness, visual disturbance, constipation, dry mouth, difficulty in swallowing and speaking, and ultimately paralysis and respiratory or heart failure occur in foodborne botulism. Toxins are potentially lethal in very small doses, binding to the neuromuscular junction, blocking acetylcholine transmission, and causing neuromuscular blockade and flaccid paralysis. Persons with clinically suspected botulism should be admitted to an intensive care setting, with frequent monitoring of vital capacity and institution of mechanical ventilation if required. Paralysis from botulism is protracted, lasting weeks to months, and meticulous intensive care is required during this period of debilitation. The administration of antitoxin is the only specific therapy available for botulism. Antitoxin can arrest the progression of paralysis and decrease the duration of paralysis and dependence on mechanical ventilation (Sobel, 2005).

1.4 Brucellosis Brucellosis also known as undulant fever, Mediterranean fever, or Malta fever (Gul and Erdem, 2015). Brucella abortus, B. melitensis, and B. suis are the most common species that cause brucellosis in humans (Hossain et al., 2014). Characteristics of Brucella spp. are Gram-negative, aerobic, nonspore-forming, short, oval, nonmotile rods that grow optimally at 37°C and pH 6.6–7.4 and are heat-labile (Hui et al., 2001). Sources of Brucella spp. include common host species, especially cattle, sheep, goats, pigs, camels, yaks, buffaloes, and dogs, and consumption of raw or inadequately cooked milk or milk products, meat, and offal derived from these animals (WHO, 2006b). The clinical symptoms of brucellosis are nonspecific and include continuous, intermittent, or irregular fever, as well as lassitude, sweat, headache, chills, constipation, arthralgias, generalized aching, weight loss, and anorexia;

Microbial Foodborne Diseases  7 symptoms may persist for weeks or months. Osteoarticular problems are the most frequent complications of brucellosis, occurring in 20%–60% of cases; also, sacroiliitis, genitourinary complications (including orchitis, epididymitis, or sexual impotence), cardiovascular and neurological conditions, insomnia, and depression have been reported (Hui et al., 2001). Effective antibiotics can contribute to the treatment of human brucellosis. A variety of antimicrobial drugs have in vitro antimicrobial activity against Brucella spp.; however, the results of routine susceptibility tests do not always correlate with clinical efficacy. Tetracyclines (doxycycline), aminoglycosides (streptomycin, gentamicin), rifampicin, fluoroquinolones (nalidixic acid), trimethoprim-sulfamethoxazole, and cotrimoxazole have been used to treat brucellosis (WHO, 2006b).

1.5 Campylobacteriosis Campylobacter jejuni and C. coli are the two predominant species that cause gastrointestinal infections in humans. Campylobacter is an enteric, Gram-negative, nonspore-forming bacterium often found in domestic and wild animals; livestock, such as pigs, cattle, sheep, and birds; and contaminated water. Human transmissions occur by the ingestion of contaminated meat and raw milk, and chickens and turkeys are also considered important vehicles for foodborne campylobacteriosis. Campylobacteriosis typically develops 2–5 days after exposure and is characterized by fever, severe abdominal pain, nausea, and watery and rarely bloody diarrhea. Campylobacteriosis is one of the most frequently reported foodborne diseases in industrialized countries, and is a cause of infant and traveler’s diarrhea, hemolytic uremic syndrome, meningitis, pancreatitis, cholecystitis, colitis, endocarditis, erythema nodosum, and reactive arthritis occurring in approximately 2%–10% of cases. Infection is sometimes misdiagnosed as appendicitis. Campylobacteriosis is usually asymptomatic, and antibiotic treatment is often not required except for infants and children (Williams et al., 2015; WHO, 2008a).

1.6 Cholera Vibrio cholerae is a Gram-negative aerobic organism. The bacterium can ferment sucrose and is often found in the environment. V. cholerae spp. are divided into four serogroups as O1, O139, non-O1, and non-O139 (Chowdhury et al., 2016). V. cholerae O1 and O139 can lead to severe dehydration as a consequence of profuse watery diarrhea. Salt and fluid replacement help prevent collapse and death. The other two serogroups, namely non-O1 and non-O139, are associated with cholera-like diarrhea. Cholera infections are generally observed due to ingestion of seafood, vegetables, cooked rice, and ice contaminated with V. cholerae. Personto-person transmission through the fecal-oral route is also an important mode of transmission (Finkelstein, 1996). Antibiotics provide a beneficial complement to fluid replacement in cholera by substantially reducing the duration and volume of diarrhea and thereby lessening

8  Chapter 1 fluid requirements and shortening the duration of hospitalization. Tetracycline and derivatives have been reported as effective agents in the treatment of cholera (Greenough et al., 1964). Erythromycin can use as an alternative antibiotic to tetracycline in young children and during pregnancy. Both single-dose azithromycin and ciprofloxacin have also been used for treating cholera in adults (Saha et al., 2006).

1.7  Clostridium perfringens–Induced Necrotic Enteritis Clostridium perfringens is a Gram-positive, nonmotile, anaerobic, spore-forming bacterium (Wells and Wilkins, 1996). It can be found in many different environments but is most frequently found in the intestines of both sick and healthy animals (Lacey et al., 2016). The fecal-oral route of transmission is common, and other ways of transmission are contaminated feed, water, housing structures, and insects (Lee et al., 2011). C. perfringens causes several symptoms, including abdominal pain, diarrhea, rarely vomiting, fever, and a variety of diseases, such as gastrointestinal disorders, liver and kidney damage, dermatitis, and gas gangrene depending on the type of toxins produced by the microorganism (Lacey et al., 2016; WHO, 2008a). Morbidity is associated with these toxins. Food poisoning symptoms occur after ingestion of C. perfringens–contaminated foods (Omernik and Płusa, 2015). Subclinical necrotic enteritis infection is associated with decreased feed intake, which adversely affects growth rate, feed conversion, and flock uniformity; hepatitis; or cholangiohepatitis (Lee et al., 2011). In the absence of early radical surgery, antibiotic therapy, and (if available) hyperbaric treatment, the toxins can easily spread throughout the body, causing shock and coma and resulting in death. Epsilon-toxin produced by type B and D strains of C. perfringens is the third most potent clostridial toxin (Omernik and Płusa, 2015). Future studies that are focused on the immunobiology of host–pathogen interactions will contribute to novel control strategies against this disease, including second-generation recombinant vaccines, new delivery vectors, and novel adjuvants, as well as dietary immunomodulating agents, such as pre- or probiotics (Lee et al., 2011).

1.8  Enterobacter sakazakii Infection Enterobacter sakazakii, recently reclassified as Cronobacter, is a Gram-negative, motile, rod-shaped, nonsporulating pathogenic bacterium that can cause foodborne illness, primarily among infants and immunocompromised adults. Newborn infants are at high risk due to E. sakazakii contamination of dried foods, such as powdered infant formula. Ingestion of contaminated food is the primary route of exposure. But Cronobacter does not survive in powdered milk that is pasteurized. Cronobacter has been detected in some foods, such as bread, cereal, rice, fruit, vegetables, legume products, herbs, spices, milk, cheese, sausage meat, teas, and fish (FDA, 2012; Hunter et al., 2008). Although the bacterium has also been found in a variety of other foods, only powdered infant formula has been linked to

Microbial Foodborne Diseases  9 cases of illness. In 2002, the Food and Drug Administration (FDA) published a warning regarding the presence of E. sakazakii in baby formula (FDA, 2002). Survival of E. sakazakii in dried infant formula for up to 2 years of storage has been reported. Symptoms involve poor feeding, irritability, jaundice, grunting respirations, temperature changes, seizures, brain abscesses, hydrocephalus, and developmental delay (FDA, 2012; Hunter et al., 2008) E. sakazakii infection generally has been treated with antibiotics, such as ampicillin and gentamicin. Carbapenems have also been recommended because of E. sakazakii’s resistance to narrow-spectrum antibiotics. Gamma radiation and E. sakazakii–targeted bacteriophage therapy have been used to reduce the E. sakazakii contamination of infant formula. The International Commission on Microbiological Specifications for Foods (ICMSF) has ranked E. sakazakii a severe hazard for restricted populations. Premature, low-birth-weight infants, immunocompromised adults, and geriatric populations are at high risk, and consumption of dairy products should be avoided in these populations (Hunter et al., 2008).

1.9  Enterococcus faecalis Infection Gram-positive, facultative anaerobic Enterococcus faecalis is a catalase-negative, spherical, and ovoid bacterium. The cytolysin toxin that is produced by some E. faecalis strains has hemolytic and bactericidal activities. There is not much information about its role as a direct cause of foodborne illness. Examples of food sources have included sausage, evaporated milk, cheese, meat croquettes, meat pie, pudding, raw milk, and pasteurized milk. In some cases death can occur as a result of bacteremia; however, enterococcal infections generally do not lead to death. Symptoms that may include diarrhea, abdominal cramps, nausea, vomiting, fever, chills, dizziness occur within 2–36 h after contaminated food is eaten. The infection may produce a clinical syndrome similar to staphylococcal intoxication. Ampicillin, penicillin or vancomycin, ureidopenicillin, streptomycin, and gentamicin are used singly or in combination for treatment of various enterococcal infections (FDA, 2012).

1.10  Escherichia coli Infection Escherichia coli belongs to the Enterobacteriaceae family. The bacterium is a prokaryotic organism. Other features of E. coli can be specified as Gram-negative, not producing spores, and having capsules/microcapsules (Fratamico et al., 2005; Manning, 2010; Riemann and Cliver, 2006). E. coli can be found in the environment via fecal exposure of animals and humans. Foodborne transmission includes contaminated meat and drinking water (Riemann and Cliver, 2006). Optimum growth temperature of E. coli is 37°C. There are six strains of E. coli: (I) entherohemorrhagic E. coli (EHEC), which causes hemorrhagic colitis and hemolytic uremic syndrome; (II) enterotoxigenic E. coli (ETEC), which is responsible for traveler’s diarrhea; (III) enteropathogenic E. coli (EPEC), which is the main causative agent of watery diarrhea in infants and young children; (IV) enteroaggregative E. coli (EAEC),

10  Chapter 1 which can cause prolonged diarrhea in children; (V) enteroinvasive E. coli (EIEC), whose biochemical and genetic properties are similar to those of Shigella (as a result of this similarity, EIEC-associated symptoms are identical to those of Shigella infections); and (VI) diffusely adherent E. coli (DAEC), which causes diarrhea and adherence to mammalian cells (Fratamico et al., 2005; Riemann and Cliver, 2006). EHEC infections cause nonbloody diarrhea, severe stomach cramps, and watery diarrhea that may develop into bloody diarrhea, fever, and vomiting, and can affect the central nervous system. Infections may result in life-threatening complications, such as hemolytic uremic syndrome, which is a type of kidney failure, and also hemolytic anemia and thrombocytopenia in infants, children, and elderly patients. Other sequelae include erythema nodosum and thrombotic thrombocytopenic purpura (Fratamico et al., 2005). ETEC-produced toxins lead to watery diarrhea and abdominal pain. The symptoms of infection are characterized by tremor, vomiting, headache, anorexia, myalgia, and bloating. Target populations are infants and young children, especially in low-income countries for ETEC infections. The death rate can increase among children infected with ETEC due to serious dehydration and underfeeding. Traveler’s diarrhea usually lasts 1–5 days in adults. Generally, antibiotics are not necessary for the treatment of traveler’s diarrhea. Antibiotic use may lead to resistance to trimethoprim-sulfamethoxazole and ampicillin. However, trimethoprim-sulfmethoxazole is recommended in cases of infection with serious and prolonged diarrhea. In addition to antibiotic therapy, rehydration therapy is also recommended. Antidiarrheal drugs can be used to decrease gastrointestinal motility. Antibiotics and antimotility drugs are not advised for use in children infected with ETEC. EPEC adheres to the mucosa and then causes significant deformation and changes in its absorption capacity, along with vomiting, diarrhea, abdominal pain, and fever (WHO, 2008a). EPEC infections cause severe dehydration and malnutrition in addition to diarrhea (Manning, 2010; Riemann and Cliver, 2006). EAEC-related persistent diarrhea is commonly observed among children in developing countries. On the other hand, EAEC-induced diarrhea is underreported and underdiagnosed in children in industrialized countries. EAEC binds to the intestinal mucosa and causes watery diarrhea without fever. Generally EAEC infections have a noninvasive character (Riemann and Cliver, 2006). EIEC causes inflammatory disease of the mucosa and submucosa by invading and multiplying in the epithelial cells of the colon. This syndrome is identical to shigellosis, with profuse diarrhea and high fever. In some cases mucus and blood can be seen in stools. DAEC causes fever and vomiting, and stools can be watery and mucoid. DAEC is able to invade intestinal epithelial cells and replicate intracellularly. Symptoms include diarrhea, abdominal cramps, and vomiting, sometimes leading to dehydration and shock. EPEC,

Microbial Foodborne Diseases  11 ETEC, and EIEC infections are an underlying factor of malnutrition in infants and children in developing countries (WHO, 2008a).

1.11 Listeriosis Listeria monocytogenes is a Gram-positive, nonspore-forming, facultatively anaerobic bacterium that causes influenza-like symptoms, such as fever, headache, and occasionally gastrointestinal symptoms. The mortality rate of listeriosis is approximately 25% worldwide (Noordhout et al., 2014). L. monocytogenes is found in soil, water, plant material, sewage, decaying vegetables, silage, and feces of numerous wild and domestic animals, infected animals, and people. It also can be found in cooked foods if poor hygiene has been applied during food production and processing. Thus, it can be present in some foods, such as unpasteurized milk, raw milk, cheese, ice cream, raw vegetables, fermented meats and cooked sausages, raw and cooked poultry, raw meats, raw and smoked fish, and seafood (Allen et al., 2016; Leong et al., 2016). Using salt, detergents, and temperature to inactivate L. monocytogenes is not effective. Listeriosis can cross the feto–placental barrier and lead to spontaneous abortion or stillbirth during pregnancy and cause meningoencephalitis and septicemia in newborns. Pregnant women, fetuses, newborns, the elderly, and immunocompromised persons are at high risk for Listeria infections. The mortality rate of listeriosis varies from 20% to 30% and also may rise up to 70% in patients without adequate treatment (Leong et al., 2016; WHO, 2008a). Presence of L. monocytogenes in food-processing environments and foods may influence resistance to antimicrobials, such as ampicillin, penicillin, and trimethoprim-sulfamethoxazole. Food preservation contributes inhibition of microorganism development in foods and helps reduce transmission by the food chain (Allen et al., 2016).

1.12  Mycobacterium bovis Infection Mycobacterium bovis is a Gram-positive, aerobic, nonmotile, straight or slightly curved, rodshaped bacterium. M. bovis lacks an outer cell membrane that is known as Mycobacterium tuberculosis var. (Epstein, 2015; FDA, 2012). The Mycobacterium has a cell envelope that is classified as an acid-fast bacterium, not Gram-positive or Gram-negative. Human and animal tuberculosis are caused principally by both M. bovis and M. tuberculosis. M. bovis is also a causative agent of foodborne human tuberculosis. Tuberculosis is most commonly spread by inhalation of infected droplets, but also by consuming contaminated foods. Unpasteurized or raw cow’s milk and cheese or other food products made from them are causative agents of foodborne tuberculosis. Ingestion of contaminated milk is a significant way of infection. Consumption of unpasteurized milk increases the risk of foodborne tuberculosis in humans. Raw or undercooked meats from certain infected animals, including deer, also may cause tuberculosis. Generally, foodborne tuberculosis is asymptomatic, but in some cases symptoms occur for months or years. Typical symptoms include fever, night

12  Chapter 1 sweats, fatigue, loss of appetite, and weight loss. The part of the body that is affected by the infection plays a role in the manifestation of other symptoms; pulmonary tuberculosis manifests as chronic cough, weight loss, blood-stained sputum, fatigue, fever, night sweats, dyspnea, hemoptysis, anorexia, wasting, malaise, and chest pain. Diarrhea, abdominal pain, and swelling can be observed if the gastrointestinal tract is affected. Infections in humans also may be asymptomatic. M. bovis infections can cause death if they are left untreated. Children, elderly persons, and people with weakened immune system diseases (AIDS patients) are at higher risk of the disease than others are. The bacteria can develop resistance to the current antimicrobial drugs. Anti–tumor necrosis factor (TNF) therapy is recommended for treatment and should be started after standard drug therapy, including isoniazid, rifampicin, ethambutol, and pyrazinamide (Ali et al., 2013; FDA, 2012).

1.13  Q Fever Coxiella burnetii is an obligate intracellular, Gram-negative bacterial pathogen, and is the causative agent of Q fever. Breathing of aerosolized bacteria is the most common way that people become infected. Ingestion of nonpasteurized milk or dairy products is the main source of oral exposure. Ticks are also a reservoir and may transmit the bacteria directly via bite or indirectly via infected feces. The disease occurs in two stages: an acute stage that generally is less serious and a chronic stage in which severe complications and higher mortality rates can occur. Acute Q fever is characterized by flu-like symptoms, such as headaches, chills, and respiratory symptoms. Q fever signs and symptoms may differ from person to person, but common ones are high fever (105°F/40.6°C), severe headaches, muscle aches, chills, heavy sweating, nausea, vomiting or diarrhea, dry cough, and abdominal or chest pain. Chronic Q fever is more serious, and the patient may experience pneumonia, hepatitis, and myocarditis. Antibiotic treatment is required. Tetracycline and doxycycline have been used to reduce the symptomatic duration. Tetracyclines may cause gastric side effects, so fluoroquinolones may be used as an alternative to tetracyclines. But fluoroquinolones are not recommended for children and pregnant women. Instead, although cotrimoxazole does not prevent progression of the disease, it is recommended for pregnant women. Vaccination is also used for treatment of Q fever, as well as antibiotic therapy (FDA, 2012; Lydyard et al., 2010). Due to C. burnetii’s aerosol exposure route, the environmental stability of the spore forms, and its high infectivity at low dose (fewer than 10 bacteria), the Centers for Disease Control and Prevention (CDC) have declared it a Category B potential bioterrorism agent (CDC, 2005). The FDA mandates that the level of pasteurization of milk for human consumption must be lethal to C. burnetii (FDA, 2012).

1.14 Salmonellosis Salmonellosis is one of the most frequently encountered foodborne diseases and is the leading cause of death worldwide. Some 93.8 million human cases and 155,000 deaths are

Microbial Foodborne Diseases  13 reported each year caused by salmonella infections (Majowicz et al., 2010). There have been identified 2500 different salmonella strains and salmonellosis caused by the nontyphoid salmonella serotypes. Salmonella enterica and S. typhimurium are the two most important serotypes of salmonellosis transmitted from animals to humans in most parts of the world (Switt et al., 2009; WHO, 2013). The bacterium is widely distributed in domestic and wild animals. Salmonellosis in humans is generally contracted through the consumption of contaminated food of animal origin, including milk, meat, eggs, and poultry, and other contaminated foods, such as condiments, green vegetables, chocolate, and drinking water (Reddy et al., 2016; Rey Matias et al., 2016; Switt et al., 2009). The transmission of salmonella infections to infants and young children from pet animals (cats, dogs, turtles, etc.) is important and needs careful supervision (WHO, 2013). Symptoms of salmonellosis include acute onset of fever, headache, abdominal pain, diarrhea, nausea, and sometimes vomiting, enteritis, and systemic manifestations, including septicemia (Majowicz et al., 2010; Switt et al., 2009). The symptoms occur within 6–72 h after ingestion and illness lasts 2–7 days. Treatment of salmonellosis is generally symptomatic, including electrolyte replacement therapy and rehydration. Because antibiotic treatment contributes to the development of antimicrobial resistance, antimicrobial therapy is not necessary for mild or moderate cases (Eguale et al., 2015; Majowicz et al., 2010; WHO, 2013). Drug-resistant Salmonella spp. have been a serious problem in many developing countries in the past few decades. However, elderly patients, infants, and immunocompromised patients may need to receive antimicrobial therapy. Salmonella spp. are resistant to one or more of the first-line drugs, such as chloramphenicol, cotrimoxazole, and ampicillin. For optimal antimicrobial treatment of salmonellosis, Salmonella spp. must be isolated from the individual patient (Begum et al., 2015; Switt et al., 2009). The World Health Organization (WHO) recommended that novel typhoid, paratyphoid, and invasive typhoid salmonella vaccines are further important steps that will play a major role in management and control of salmonella infections (Kariuki et al., 2015; WHO, 2013).

1.15 Shigellosis The prevalence of shigellosis was found to be 55.6% in patients 2–5-years old. In addition, over 1 million deaths have been estimated yearly due to shigellosis worldwide. Shigella dysenteriae, S. flexneri, S. boydii, and S. sonnei are able to cause shigellosis. The symptoms of shigellosis include watery diarrhea, dysentery with mucoid bloody stools, abdominal pain, vomiting, fever, and tenesmus (Niyogi, 2005; Talebreza et al., 2015). Shigella spp. cause mucosal ulceration, inflammation, bleeding, and in 2%–3% of cases hemolytic uremic syndrome or erythema nodosum. Transmission occurs via food and water contaminated with fecal matter or through person-to-person contact. Food contamination can be caused by food handlers with poor personal hygiene in their preparation or by use of sewage/wastewater for fertilization. Foods, such as uncooked foods, salads, vegetables, water, or raw milk may be

14  Chapter 1 sources of shigellosis. It is the most common cause of diarrhea in infants and children under 5 years of age. Among young children, especially under 5 years of age, the morbidity and mortality incidence is high in developing countries. Elderly individuals may develop severe symptoms or even die due to malnutrition-induced shigellosis. Travelers are particularly at risk. Antimicrobial agents are used to treat cases of shigellosis (Niyogi, 2005; WHO, 2008a). Due to Shigella spp. being resistant to antibiotics, such as ampicillin, chloramphenicol, tetracycline, and trimethoprim-sulfamethoxazole, the choice of antimicrobial agents for treating shigellosis is limited. Generally, cotrimoxazole is a first-choice drug used for empirical therapy of diarrheal diseases; however, extensive use of cotrimoxazole has caused resistance in Shigella strains. Ampicillin and tetracycline are inexpensive, broad-spectrum, and widely used for prophylaxis and treating bacterial infections (Niyogi, 2005; Talebreza et al., 2015).

1.16  Staphylococcus aureus Intoxication Staphylococcus aureus is a Gram-positive, facultatively anaerobic, nonmotile, and nonsporeforming bacterium. S. aureus–related food poisoning is one of the most prevalent foodborne intoxication worldwide. It is caused by oral intake of S. aureus bacterial toxins in ham, chicken, and egg salads, as well as cream-filled products, ice cream, and cheese. Within 2–6 h after ingestion of contaminated food, patients present with symptoms of severe nausea, cramps, vomiting, and prostration, sometimes accompanied by diarrhea or acute gastroenteritis. The food chain is an important factor for the development of antimicrobial resistance. Such transfers can occur by means of residues of antibiotics in foods, through the transfer of resistant foodborne pathogens, or through the ingestion of resistant strains of the original food microflora and resistance transfer to pathogenic microorganisms. Methicillinresistant S. aureus strains were isolated from several food production animals, including pigs, cattle, chickens, and others. Some of these strains have been also resistant to penicillin and oxacillin (Hennekinne et al., 2012; Johler et al., 2015). Treatment failure rates and mortality rates remain high in patients with complicated S. aureus infections despite the introduction of newer antistaphylococcal antibiotics (Kaye et al., 2008).

1.17 Tularemia Francisella tularensis is a pathogenic species of a small pleomorphic, Gram-negative rod bacterium and the causative agent of severe, life-threatening illness in humans. Infection with F. tularensis can occur by several routes (oral, respiratory, insect bite, direct contact with contaminated objects, or handling sick or dying wild animals) and causes a disease called tularemia (rabbit fever, deerfly fever, hare fever, and lemming fever). Human-tohuman transmission of tularemia has not been shown (Busl and Bleck, 2012; Evans and Brachman, 1998). Vehicles for the transmission of F. tularensis are milk and undercooked

Microbial Foodborne Diseases  15 meat from an infected animal (rabbits, hares) or drinking contaminated water. There are many forms of disease, including pneumonic, gastrointestinal, oropharyngeal, typhoidal, oculoglandular, and ulceroglandular tularemia. The type of tularemia depends on the infecting strain, dose, and route of inoculation. Oropharyngeal tularemia occurs after ingestion of contaminated food, leading to symptoms that include painful exudative pharyngitis, tonsillitis, and necrotic cervical adenopathy. Invasion of the intestine can result in gastrointestinal tularemia. The symptoms of gastrointestinal tularemia occur in a wide range, including from mild diarrhea to severe bowel damage. Ulceroglandular tularemia, which is the most common form of tularemia, occurs as a result of the bite of an infected insect or from handling contaminated materials. Symptoms including chills, fever, headaches, and skin lesions. Pneumonic tularemia is similar to an atypical pneumonia and presents after contaminated aerosols are inhaled. The mortality rate is high among untreated cases. Typhoidal tularemia is the systemic form that occurs after inhalation of infectious aerosols. For any form of tularemia, getting immediate medical help is very important, to get the right kind of antibiotics to keep the infection from progressing. Antibiotics used to treat tularemia include intramuscularly applied streptomycin, intravenously or intramuscularly applied gentamicin, doxycycline, and ciprofloxacin. Ciprofloxacin or doxycycline have also been used for postexposure prophylaxis for 2 weeks (Busl and Bleck, 2012; FDA, 2012).

1.18  Typhoid Fever, Paratyphoid Fever Salmonella typhi and S. paratyphi cause enteric fever (typhoid and paratyphoid fever) characterized by high fever, abdominal pains, headache, vomiting, and diarrhea followed by constipation and rashes lasting for several weeks or months. Humans are the only reservoir for these organisms and can be both cases and vehicles. Sources of infection can be contaminated food and water, or contact with stools of infected people. These bacteria are in many foods, including prepared foods, dairy products, meat products, shellfish, vegetables, and salads. Chronic carriers play an important role in the spread of the disease throughout the community, and the treatment of the chronic carrier is a difficult problem. Antibiotic therapy is the main treatment for enteric fever. However, S. typhi is resistant to treatment with most of the commonly used antibiotics, such as chloramphenicol, ampicillin, trimethoprimsulfamethoxazole, streptomycin, and tetracycline. Multiple drug resistance results in increased morbidity and mortality. Vaccination is recommended for vulnerable populations, such as children under 15 years of age to control typhoid fever (Wain et al., 2015; WHO, 2008a).

1.19  Vibrio parahaemolyticus-induced Gastroenteritis Biochemical characteristics of Vibrio parahaemolyticus are similar to those of V. cholerae (Kim et al., 1999). V. parahaemolyticus–associated gastroenteritis typically occurs 4–96 h

16  Chapter 1 after consuming contaminated foods, such as raw or undercooked fish and fishery products or cooked foods subject to cross-contamination from raw fish with symptoms that include profuse watery diarrhea, nausea, abdominal cramps, headache, vomiting, and fever, and a dysenteric syndrome has been reported from some countries, particularly Japan (Liu et al., 2015). In rare cases, V. parahaemolyticus can cross the intestinal barriers and enter the bloodstream, and can cause septicemia (Alouf et al., 2015). Antibiotic treatment is not necessary for self-limited acute gastroenteritis. Antimicrobial therapy can also lead to adverse reactions, and unnecessary treatments add to resistance development. Nevertheless, empiric antimicrobial therapy is required by a clinical situation, such as bloody or febrile diarrhea with fever, symptoms persisting for >1 week, or immunocompromised persons (ZollnerSchwetz and Krause, 2015).

1.20  Vibrio vulnificus Infection Vibrio vulnificus is a virulent, Gram-negative, halophilic, nonspore-forming rod, motile bacterium that is found in seafood, particularly raw oysters. V. vulnificus–related infections are generally mild and uncommon, but they can be life-threatening. Common symptoms include profuse diarrhea with blood in stools. The infection exhibits two main clinical manifestations: wound infections and septicemia, which may originate from the gastrointestinal tract or traumatized epitelial surfaces. Persons with chronic liver disease, alcoholic liver disease, hemochromatosis, or immunosuppression are at high risk for V. vulnificus–induced septicemia. The case–fatality ratio is as high as 40%–60% and around 90% in hypotensive patients. The primary treatment of V. vulnificus infections with primary septicemia is surgical intervention within 24 h after admission and can be a significant protective factor for mortality in patients. Nevertheless, surgical intervention is not effective in patients with wound infections (Tsao et al., 2013; WHO, 2008a).

1.21 Yersiniosis Yersiniosis is primarily caused by Yersinia enterocolitica and less frequently by Y. pseudotuberculosis. Y. enterocolitica belongs to the Enterobacteriaceae family and is a Gramnegative, nonspore-forming, facultatively anaerobic bacterium. Illness is transmitted through consumption of pork products (tongue, tonsils, gut), cured or uncured, as well as milk and milk products. Yersiniosis usually manifests as a gastrointestinal disease characterized by abdominal pain, diarrhea, mild fever, and sometimes vomiting. Several chronic conditions have also been reported, including reactive arthritis in immunocompromised individuals, erythema nodosum, eye complaints, uveitis, glomerulonephritis, myocarditis, cholangitis, septicemia, hepatic and splenic abscesses, lymphadenitis, pneumonia, and spondylitis. The disease is often misdiagnosed as appendicitis. In addition to appendicitis, Yersinia infections have been confused with tumoral lesions, terminal ileitis, and Crohn’s disease. Although generally

Microbial Foodborne Diseases  17 infection is mild and self-limiting in healthy individuals, yersiniosis can cause morbidity and mortality in young children and immunocompromised individuals (Galindo et al., 2011; WHO, 2008a). Information about effective treatment of Yersinia spp. infections is unclear. Although treatment appears not to impact mild intestinal disease, fecal shedding decreases following antimicrobial treatment. This by itself does not justify treatment, as person-to-person transmission is rare. However, antimicrobial treatment may be lifesaving in invasive infections, and patients should receive therapy for 3 weeks with septicemia (Tauxe, 2015).

2  Section 2. Parasitic Foodborne Diseases This section focuses on the classification, causes, and clinical features of parasitic foodborne diseases and on risk reduction and prevention of these diseases (Table 1.2).

2.1 Amebiasis Amebiasis or amebic dysentery is caused by the parasite Entamoeba histolytica that is found in contaminated fruits, vegetables, and drinking water. Ingestion of cysts from food or water contaminated with feces is the main route of E. histolytica transmission. The infection can be asymptomatic and can cause severe bloody diarrhea, stomach pains, fever, and vomiting. Fulminant amebic dysentery is often fatal (55%–88%). Other complications include perforation of the colon, colonic ulcers, amoeboma, liver abscess, and chronic carriage. Symptoms develop in approximately 10%–20% of infected persons (Marie and Petri, 2013; WHO, 2008a). Metronidazole seems effective for the management of amebic dysentery in adults and children (Löfmark et al., 2010).

2.2 Anisakiasis Anisakiasis is a human parasitic infection caused by Anisakis spp. Symptoms and clinical signs of anisakiasis are similar to those of appendicitis. Although cases have also been encountered in other parts of the world, the highest prevalence of Anisakis infections in humans has been observed in Japan. Common sources of infection are raw or undercooked fish, including infected sushi and sashimi. The motile larvae burrow into the walls of the intestine, resulting in gastrointestinal symptoms: acute ulceration and nausea, vomiting, and epigastric pain, sometimes with hematemesis. Allergic reactions have also occurred after consumption of foods infected with Anisakis spp. Clinical signs of these reactions include anaphylaxis, urticaria, rhinitis, broncoconstriction, cough, and/or gastrointestinal responses. Improved diagnosis of anisakiasis using molecular or serological approaches is warranted, as this disease might be misdiagnosed as bacterial or viral gastroenteritis (Baird et al., 2014; WHO, 2008a). The FDA recommends all shellfish and fish intended for raw consumption be blast frozen to –35°C or below for 15 h or be regularly frozen to –20°C or below for 7 days

Organism

Illness

Anisakis spp.

Anisakiasis

Ascaris lumbricoides

Ascariasis

Clonorchis sinensis

Incubation Period

Duration

Food Sources

24 h–2 weeks Acute ulceration, nausea, vomiting, severe stomach or abdominal pain, diarrhea, hematemesis, allergic reactions, cough, eosinophilic abscesses 4–16 days Gastrointestinal discomfort, colic, vomiting, fever, pulmonary symptoms, neurological disorders

2–3 weeks

Raw fish dishes (e.g., sushi, sashimi, herring, cebiche)

12 months

Clonorchiasis

Variable

2–3 weeks

Ingestion of infective eggs from soil contaminated with feces or contaminated vegetables and water Undercooked, smoked, pickled, salted freshwater fish

Clostridium botulinum

Botulism

12–36 h

Cryptosporidium parvum

Cryptosporidiosis

7–10 days

Cyclospora cayetanensis

Cyclosporiasis

1–14 days

Diphyllobothrium Diphyllobothriasis Within spp. 15 days

Entamoeba histolytica

Amoebiasis

2–4 weeks

Signs and Symptoms

Eosinophilia, anorexia, indigestion, abdominal pain or distension and irregular bowel movement, weakness, weight loss, epigastric discomfort, diarrhea, anemia, edema, jaundice, portal hypertension, ascites and upper gastrointestinal bleeding Vomiting, abdominal pain, fatigue, diarrhea, headache, dizziness, blurred vision, double vision, dilated pupils, difficulty in swallowing, muscle weakness, constipation, paralysis Persistent diarrhea, nausea, vomiting, abdominal cramps, slight fever, dehydration Watery diarrhea, explosive bowel movements, loss of appetite, weight loss, stomach cramps, bloating, nausea, vomiting, fatigue Abdominal discomfort, diarrhea, altered appetite

Severe bloody diarrhea, stomach pains, fever, vomiting, abdominal distention, weight loss, fatigue

Variable

Several days to 3 weeks Days to months

5–6 weeks

Weeks to months

Home-canned vegetables, fish and fish products, baked potatoes in aluminum foil, vegetables, condiments (e.g., pepper), meat and meat products Uncooked food, contaminated food and drinking water, raw milk, apple cider, fresh produce, juices Various types of fresh produce (e.g., imported berries, lettuce, basil) Raw or undercooked fish dishes (e.g., sushi, sashimi, ceviche) and tartare meat and viscera (i.e., eggs, liver) Fecally contaminated food and drinking water, fruits, vegetables

18  Chapter 1

Table 1.2: Major parasitic foodborne diseases and clinical features (FDA, 2012; WHO, 2008a,b).

Organism

Illness

Incubation Period

Signs and Symptoms

Duration

Food Sources

Eustrongylides spp. Fasciola hepatica or F. gigantica

Eustrongylidiasis

Within 24 h

Severe abdominal pain

1–4 days

Live minnows, sushi

Fascioliasis

4–6 weeks

Fever, nausea, sweating, abdominal pain, dizziness, cough, bronchial asthma, skin rashes, urticari, jaundice, and anemia

Up to 4 months

Giardia lamblia

Giardiasis

1–2 weeks

2–6 weeks

Nanophyetus salmincola Opisthorchis viverrini, O. felineus

Nanophyetiasis

1–15 weeks

Opisthorchiasis

2–4 weeks

Paragonimus westermani

Paragonimiasis

Days to weeks

Malodorous diarrhea, flatulence, malaise, abdominal cramps, fatigue, weight loss, anorexia, and nausea Abdominal pain, diarrhea, gas/bloating, nausea, vomiting, weight loss, fatigue Fever, abdominal pain, dizziness, urticaria, dyspepsia, diarrhea or constipation, jaundice, hepatomegaly, lassitude, anorexia, emaciation, edema Fever, diarrhea, fatigue, generalized myalgia, abdominal pain, eosinophilia, chest pain

Aquatic plants, such as common watercress, wild watercress, dandelion leaves, lamb’s lettuce, spearmint, bero-bero (watercress), algas (algae), kjosco, and tortora Contaminated drinking water, home-canned salmon, noodle salad, vegetables Raw, undercooked, or smoked salmon or steelhead trout Raw or underprocessed freshwater fish

Taenia solium, T. saginata

Taeniasis

2–4 months

5–23 days

Trichinella spiralis Trichinellosis

1–4 weeks

Adult worms Raw, inadequately cooked, can live or otherwise underprocessed freshwater crustaceans (crabs and 20 years crayfish) Worms can Raw or undercooked meats (beef, live for years pork), contaminated foods, vegetables Days to Undercooked or raw meats (e.g., weeks pork, lamb, or wild game), fruits and vegetables, goat’s milk 2 weeks– 3 months

Meats (pork, horse, wild boar)

Microbial Foodborne Diseases  19

Toxoplasma gondii Toxoplasmosis and congenital toxoplasmosis

Nervousness, insomnia, anorexia, weight loss, abdominal pain, nausea, general malaise, digestive disturbance Lymphadenopathy, lymphocytosis, muscle pains, blurred or reduced vision, fever, headache, confusion, nausea, poor coordination, and seizures Nausea, abdominal discomfort, vomiting, fever, diarrhea, muscle pain, weakness

Several months Variable

20  Chapter 1 (FDA, 2012). There has been no effective medical therapy for anisakis infections, and the symptoms resolve with only symptomatic treatment in some patients. Gastric anisakiasis used to require endoscopic removal of the worm and surgical resection. Albendazole alone has also been used in treatment of anisakiasis (Moore et al., 2002).

2.3 Ascariasis Ascariasis is an infection of the small intestine caused by Ascaris lumbricoides. The infection is generally asymptomatic and occurs after ingestion of food or drinking water contaminated with Ascaris spp. eggs. The nematode eggs penetrate through the intestinal wall. These larvae migrate to the heart and lung via the blood. They break into alveoli and migrate through the bronchial tubes and trachea of the pharynx. Intestinal worms cause malnutrition. Symptoms include gastrointestinal discomfort, colic and vomiting, fever, observation of live worms in stools, and in rare cases pulmonary symptoms or neurological disorders (Cross, 1996). WHO has recommended albendazole, mebendazole, levamisole, and pyrantel for treatment of ascariasis infections (WHO, 2006a).

2.4 Clonorchiasis The infection named clonorchiasis is caused by Clonorchis sinensis. C. sinensis is a human liver fluke that is transmitted to humans by eating raw freshwater fish. This infection is included in WHO’s control programs of neglected tropical diseases. It has been classified as a biological carcinogen to humans (Group 1). However, most patients are asymptomatic; eosinophilia may occur in some cases. Other complications including anorexia, indigestion, abdominal pain or distension, irregular bowel movements, fever, loss of appetite, and general malaise. In severe infections weakness, weight loss, epigastric discomfort, abdominal fullness, diarrhea, anemia, and edema are observed. Clonorchiasis is endemic in some countries, such as Japan, Korea, Malaysia, Vietnam, East Russia, Taiwan, and particularly China. Praziquantel is recommended for treatment of clonorchiasis, and tribendimidine has also been found effective both in vitro and in vivo as an alternative chemotherapeutic agent (Hong and Fanq, 2012; WHO, 2008a).

2.5 Cryptosporidiosis At least 23 species of Cryptosporidium have been identified, but Cryptosporidium parvum is considered to be the only etiologic agent of human infections (Xiao et al., 2000). C. parvum is a zoonotic protozoan parasite that causes cryptosporidiosis, which is characterized by persistent diarrhea, nausea, vomiting, and abdominal pain, sometimes accompanied by an influenza-like illness with fever. The infection can be serious in both immunocompetent and immunocompromised patients, particularly AIDS patients, and children under 5-years old are also at higher risk of infection. The infection is transmitted to humans via consumption

Microbial Foodborne Diseases  21 of food and water and contact with contaminated soil or infected hosts. The oocysts of Cryptosporidium spp. are very resistant to chlorination, but conventional cooking procedures and using wash solutions, such as Alconox are effective methods for removing protozoan oocysts (Hong et al., 2014; Xiao et al., 2000).

2.6 Cyclosporiasis Cyclospora cayetanensis is an obligate intracellular coccidian parasite that causes an intestinal illness. People can become infected by consuming fresh foods, such as raspberries, basil, and several varieties of lettuce contaminated with C. cayetanensis. Symptoms generally begin 1 week after exposure and include watery diarrhea, cramping, bloating, loss of appetite, weight loss, increased gas, nausea, fatigue, vomiting, body aches, headache, fever, and other flu-like symptoms. The infection can be asymptomatic in some cases. The elderly or very young and immunecompromised people (patients with HIV/AIDS or cancer) and who live in tropical and subtropical regions of the world are at higher risk. Cyclosporiasis is treated with the antibiotic trimethoprim-sulfamethoxazole (CDC, 2015b; FDA, 2012).

2.7 Diphyllobothriasis Diphyllobothrium species are intestinal parasites of humans and other fish-eating mammals and birds. Diphyllobothrium latum is a causative agent of diphyllobothriasis and is known as the broad or fish tapeworm. It is the longest tapeworm in humans (about 10 m). The main food sources of infection are meat and viscera of raw or undercooked fresh fish (e.g., sushi, sashimi, ceviche, and tartare). The symptoms are generally mild and can include abdominal pain, diarrhea, and altered appetite. The tapeworm absorbs a large amount of vitamin B12 from the human intestine, which, in prolonged or heavy cases, may develop vitamin B12 deficiency anemia. All consumers of raw or undercooked fish contaminated with tapeworms are at risk. The standard treatment for diphyllobothriasis, as well as many other tapeworm infections, is with praziquantel and niclosamide (FDA, 2012).

2.8 Fascioliasis Fasciola hepatica and F. gigantica are the most important trematode species that cause fascioliasis. F. gigantica is found in tropical regions of Africa and Asia, such as Egypt, Ethiopia, and Iran. F. gigantica is bigger than F. hepatica, which is found in temperate zones. Symptoms recorded from human cases include fever, sweating, epigastric pain, dizziness, cough, bronchial asthma, urticaria, abdominal tenderness, obstructive jaundice, and leucocytosis with eosinophilea up to 60% (Carrada-Bravo, 2003; Valero et al., 2009; WHO, 2008a,b). Chronic fascioliasis causes immune suppression. Adult flukes can live approximately 10 years. Diagnosis of fascioliasis is crucial and based on classification of eggs found in stools, duodenal contents, or bile. Fascioliasis can be treated with intramuscular emetine hydrochloride, oral

22  Chapter 1 bithionol, and praziquantel. WHO has recommended that the only highly efficient drug available at present for human treatments is Egaten (Carrada-Bravo, 2003; WHO, 2008b).

2.9 Giardiasis Giardiasis is an intestinal infection characterized by chronic and relapsing diarrhea, abdominal cramps, fatigue, weight loss, anorexia, and nausea. The disease is caused by Giardia lamblia/Giardia duodenalis, which is a protozoan parasite in the genus Giardia. Giardiasis can be severe in patients with immunoglobulin deficiency states, and in immunocompromised individuals, particularly AIDS patients. It is rare for giardiasis infections to be life-threatening; however, deaths can be caused by severe dehydration, mainly in infants or malnourished children. The standard treatment for giardiasis consists of antibiotic therapy, including nitroimidazole derivatives (metronidazole or tinidazole), benzimidazole compounds, or acridine dyes (CFSPH, 2012; WHO, 2008a).

2.10 Nanophyetiasis Nanophyetus salmincola is a small parasitic trematode (fluke) in the flatworm phylum. Nanophyetiasis is an intestinal parasitic disease that is caused by N. salmincola. Sometimes known as the “fish flu,” the disease is caused by consuming contaminated raw or undercooked fish, especially salmon. Human infection with N. salmincola may cause abdominal discomfort, diarrhea, gas/bloating, nausea, vomiting, and unexplainable peripheral blood eosinophilia. Without treatment, symptoms may last several months, but medications prescribed by health professionals kill the worms. Treatment with anthelminthic drugs, such as praziquantel clears the symptoms and stops egg production (FDA, 2012; Harrell and Deardorff, 1990).

2.11 Opisthorchiasis Opisthorchis viverrini and O. felineus are responsible for opisthorchiasis. Acute symptoms occur 2–4 weeks after eating raw or underprocessed freshwater fish. The symptoms are highgrade fever, malaise, arthralgia, lymphadenopathy, abdominal pain, dizziness, and urticaria. Opisthorchiasis is associated with cholecystitis, cholangitis, liver abscess, gallstones, and also cholangiocarcinoma. Laboratory findings include eosinophilia and increased liver enzymes. These clinical signs may appear similar to those of acute viral hepatitis. The first drug of choice to treat opisthorchiasis may be praziquantel. Mebendazole and albendazole also have been used for eradication of infection (Mairiang and Mairiang, 2003; WHO, 2008a).

2.12 Paragonimiasis Paragonimiasis is a foodborne parasitic disease that is caused by Paragonimus trematodes and is sometimes called the lung fluke disease. Human paragonimiasis is associated with

Microbial Foodborne Diseases  23 eating raw or undercooked foods, such as crayfish or freshwater crustaceans (CDC, 2010). Mild infections are usually asymptomatic, but heavy infections cause fever, fatigue, generalized myalgia, and abdominal pain with eosinophilia (WHO, 2008a). Paragonimiasis most frequently involves the lungs, but worms can also reach other organs, including the skin and brain. For antiparasitic therapy of paragonimiasis, praziquantel is the drug of choice (CDC, 2010).

2.13  Taeniasis and Cysticercosis Taenia solium is associated with two parasitic infections; intestinal taeniasis is caused by adult tapeworms, and cysticercosis is caused by larval cysts. If the larval parasites localize in the eye, then central nervous system or heart-related complications occur. Cysts in the heart are generally asymptomatic in most patients, but ophthalmic cysticercosis can cause clinical hazards that affect visual acuity. Clinical symptoms of human cysticercosis can be varied depending on the location of the parasite—whether in or out of the brain parenchyma. The infection is caused by consumption of raw or undercooked beef or pork. Intraparencymal cysticercosis is associated with epilepsy and seizures. Taeniasis can be treated with praziquantel or niclosamide. There is no effective treatment for neurocysticercosis. Supportive treatment with corticosteroids and/or antiepileptic drugs, praziquantel and/ or albendazole, and surgical treatment are recommended by WHO (Gonzales et al., 2016; WHO, 2016).

2.14  Toxoplasmosis and Congenital Toxoplasmosis Toxoplasma gondii is a coccidian protozoan of the family Sarcocystidaea. There are three common modes of transmission of infection: oral intake of raw or undercooked meat containing the cysts or contaminated fruits, vegetables, and goats’ milk; ingestion of materials contaminated with cat feces; and transplacental infection during pregnancy (Martin, 2001; WHO, 2008a). At least a third of the world’s human population are infected with the parasite, making it one of the most successful parasitic infections. Congenitally infected fetuses and immunocompromised individuals are at high risk for severe or life-threatening infections. Intrauterine infections can cause abortion or stillbirth, chorioretinitis, and brain damage. Cerebritis, chorioretinitis, pneumonia, myocarditis, rash, and death have been noted in immunocompromised individuals. The risk and the severity of congenital infections are related to the gestational age at which the pregnant woman acquires the infection. Most infected neonates (80%–90%) with congenital toxoplasmosis are asymptomatic at birth (Martin, 2001; Saadatnia and Golkar, 2012). Cerebral toxoplasmosis is a particular threat for AIDS and organ transplant patients. In these patients it can result in death if not adequately treated (Saadatnia and Golkar, 2012; WHO, 2008a). Pyrimethamine and sulfadiazine are recommended in patients with symptoms,

24  Chapter 1 such as pneumonitis, myocarditis, meningoencephalitis, or polymyositis. Spiramycin and pyrimethamine-sulfadiazine are used during pregnancy and for children with congenital toxoplasmosis, but generally pyrimethamin-sulfonamide has been prescribed to patients (Rajapakse et al., 2013).

2.15 Trichinellosis Trichinosis, trichinellosis, or trichiniasis is a parasitic disease caused by roundworms (Trichinella spp.). The most important causative organism is the white intestinal nematode Trichinella spiralis. Trichinellosis occurs by consumption of raw or undercooked meat contaminated with encysted larvae, and the infection is a serious public health hazard. Clinical signs and symptoms can be variable depending on the number of larvae ingested. The infection may be asymptomatic; however, fulminating fatal disease can be observed. Ingested larvae grow in the epithelium of the intestine and penetrate the blood vessels. They spread throughout the body via the blood and then reach skeletal muscles. The initial phase lasts several days and is characterized by nausea, vomiting, diarrhea, and fever. When the parasite reaches tissues, cardiac and neurological complications may occur. Severe complications, such as meningoencephalitis, myocarditis, pneumonitis, and myocardial failure can result in death. In the early stages of trichinellosis, albendazole is recommended. For the treatment of severe symptoms during the parenteral phase, steroids have also been used with albendazole (CDC, 2015a; WHO, 2008a).

3  Section 3. Viral Foodborne Diseases This section focuses on the classification, causes, and clinical features of viral foodborne diseases and on risk reduction and prevention of these diseases (Table 1.3).

3.1  Hepatitis A Hepatitis A virus (HAV) is a small, nonenveloped spherical virus that is a member of Picornaviridae; it is around 28 nm in diameter and contains a single-stranded RNA. HAV is spread by the fecal-oral route, most commonly transmitted from person to person. The incubation period of hepatitis A infection lasts approximately 25–28 days. The virus is shed in the feces in the later part of incubation. The virus enters via the intestinal tract and is carried by the blood to the liver; then a viremic stage presents in which the virus can be detected in the bloodstream. Symptoms of the disease include loss of appetite, fever, malaise, headache, fatigue, nausea, vomiting, and abdominal discomfort. Acute liver failure can occur, particularly in older individuals. Foodborne infections are associated with consumption of contaminated shellfish, such as clams and mussels, raw fruit and vegetables, such as frozen strawberries, bakery products, and drinking fecally contaminated water or swimming in

Table 1.3: Major viral foodborne diseases and clinical features (FDA, 2012; WHO, 2008a). Organism

Illness

Incubation Period

Hepatitis A virus

Hepatitis A

Hepatitis E virus

Duration

Food Sources

25–28 days

Diarrhea, dark urine, jaundice, and flu-like symptoms (i.e., fever, headache, nausea, and abdominal pain), anorexia, vomiting, malaise, myalgia, hepatitis

1–2 weeks

Hepatitis E

3–8 weeks

Jaundice, malaise, anorexia, abdominal pain, arthralgia, hepatomegaly, vomiting, and fever

2 weeks

Many different viruses

Viral gastroenteritis

15–50 h

Diarrhea and vomiting, which is often severe and projectile with sudden onset

2 days

Noroviruses

Viral gastroenteritis, winter diarrhea, acute nonbacterial gastroenteritis

12–48 h

Nausea, vomiting, abdominal cramps, diarrhea, dehydration, fever, headache, chills, and muscle aches

12–60 h

Poliovirus

Poliomyelitis

7–14 days

Variable

Rotavirus

Rotavirus gastroenteritis

24–48 h

Fever, headache, nausea, vomiting, malaise, paralysis, severe muscle pain Watery diarrhea, nausea, vomiting, fever, dehydration, hypovolemic shock

Raw produce; cold cuts and sandwiches; fruits and fruit juices; contaminated drinking water, salads, shellfish, iced drinks, vegetables, bakery products, milk and milk products Undercooked wild boar meat, figatellu sausage, undercooked or raw pork, raw deer meat, contaminated fruits and vegetables, such as tomatoes and strawberries, shellfish Wide range of different cooked and uncooked foods have been implicated in secondary contamination by food handlers Raw produce, contaminated drinking water, shellfish from contaminated waters, salad ingredients, fruit, molluscan shellfish (particularly oysters) Milk and other foodstuffs contaminated with feces

3–7 days

Salads, fruits, and hors d’oevres, contaminated drinking water

Microbial Foodborne Diseases  25

Signs and Symptoms

26  Chapter 1 contaminated swimming pools and lakes. However, the case–fatality ratio is about 0.3%, and infection is more serious in adults over the age of 50 years than in children. Inactivated hepatitis A vaccine is highly effective in preventing infection. Vaccination is not generally recommended, although it may be cost-effective in some countries. Immune-serum globulin is effective in preventing illness if administered within 14 days of exposure to hepatitis A, and can also be used for preexposure prophylaxis in travelers who cannot be vaccinated (Koopmans et al., 2002; WHO, 2008a).

3.2  Hepatitis E The hepatitis E virus is transmitted mainly through contaminated food, water, and zoonotic transmission routes. The virus causes epidemic and endemic of acute hepatitis in humans. The hepatitis E virus is transmitted by the fecal-oral route. The infection can be associated with use of contaminated drinking or irrigation water, handling of infected pigs, and consumption of raw and undercooked animal meats. Consumption of wild and domestic pork products and game meats, such as undercooked or raw organs or tissues from infected swine and raw deer meats has been linked to numerous cases of hepatitis E worldwide (Yugo and Meng, 2013). After the consumption of contaminated food or water, the virus reaches the liver from the intestinal tract, but the exact route and mechanism are not clear yet. Immunocompetent individuals and pregnant women are at higher risk, and excess mortality has been reported among these vulnerable populations (0.5%–4% and 20%, respectively). In symptomatic patients, symptoms include anorexia, malaise, hepatomegaly, arthralgia, myalgia, jaundice, and sometimes abdominal pain, nausea, vomiting, and fever (FDA, 2012; Yugo and Meng, 2013). Treatment is aimed at preventing the symptoms, because there is no specific treatment for hepatitis; also, although there are vaccines for other forms of hepatitis (FDA, 2012), the hepatitis E vaccine has recently become available only in China but not in other countries (Yugo and Meng, 2013).

3.3  Norovirus-Induced Gastroenteritis Noroviruses are the most common cause of foodborne outbreaks of acute gastroenteritis worldwide. The virus exhibits a range of biochemical and physical characteristics. Noroviruses’ epidemiology is complex and influenced by many factors, including population immunity, virus evolution, the environment, and seasonality. Norovirus-induced gastroenteritis usually is spread by the fecal-oral route and person-to-person transmission (Ramani et al., 2014; WHO, 2008a). Infections are usually self-limiting, but severe dehydration can occur as a result of the higher degree of diarrhea and vomiting. Dehydration can result in serious life-threatening complications, particularly in children and the elderly. Treatment generally involves supportive care. Antibiotic treatment is ineffective for norovirus infections (FDA, 2012). Vaccines against rotavirus are now available (WHO, 2008a,b).

Microbial Foodborne Diseases  27

3.4 Poliomyelitis Poliomyelitis is an infectious disease caused by poliovirus, which is a small round virus that is a member of Picornaviridae and contains a single-stranded RNA. The virus commonly infects the intestinal tract and spreads to the regional lymph nodes and central nervous system cells, resulting in viremia characterized by fever and malaise. Poliovirus usually enters the body by the fecal-oral route. Drinking water and foodstuffs contaminated with feces have been vehicles for transmission. In most people with a normal immune system, poliovirus infection is asymptomatic, but it can be more severe in children and young adults. There is no curative medication for polio infections. The focus of treatment is based on symptoms. The WHO recommends polio vaccines; however, a number of doses are required for vaccines to be effective: an oral polio vaccine dose at birth (zero dose), followed by the primary series of three oral polio vaccine doses and at least one inactivated poliovirus vaccine dose (Wallace and Oberste, 2012; WHO, 2005).

3.5  Rotavirus-Induced Gastroenteritis Rotavirus causes severe diarrhea and dehydration in children and half a million deaths in children younger than 5-years old, worldwide, each year. Sources of foodborne rotavirus are salads, raw fruits, and vegetables. Rotaviruses are transmitted via the fecal-oral route. Symptoms including fever, watery diarrhea that starts in about 2 days, and vomiting that can cause dehydration and hypovolemic shock and lead to death in severe cases. Fluid and electrolyte replacement therapy is necessary. Rotavirus may activate secretomotor neurons of the enteric nervous system that stimulate secretion of fluids and solutes (FDA, 2012). Children may be protected by vaccination, which is available and effective against severe cases (Smulders et al., 2013).

4 Conclusions Microbial foodborne illnesses constitute the majority of foodborne diseases. Several pathogens cause serious microbial diseases in humans. Each year millions of people get sick or even die from food poisonings. Pathogen-induced foodborne diseases are a major health problem worldwide. Animals play a reservoir role in spreading infection to humans. Transmission of foodborne infections to humans occurs by ingestion of foods contaminated with animal feces or contact with infected animals. Consumption of raw, uncooked foods, including animal-origin foods, such as meat, milk, and other dairy products; unwashed fruits and vegetables; and raw seafood, such as fish and shellfish, is the main cause of microbial foodborne diseases. Microbial toxins reach humans via the food chain in increasing concentrations. Especially vulnerable groups, such as pregnant women, infants, young children, the elderly, and immunocompromised people are more

28  Chapter 1 susceptible to these infections. Generally the symptoms and signs of foodborne diseases are nonspecific. Sometimes a physician can make an incorrect diagnosis, resulting in ineffective treatment. Protection from microbial pathogens can frequently be difficult. To reduce the risk of microbial foodborne illnesses, hygiene rules must be adhered to in all food processes, including production, preparation, distribution, and consumption. The Hazard Analysis Critical Control Point (HACCP) principles must be applied in all stages of food manufacture to minimize microbial contaminations. This chapter has reviewed microbial foodborne diseases caused by bacteria, parasites, and viruses and their significance as a health concern.

References Ali, T., Kaitha, S., Mahmood, S., Ftesi, A., Stone, J., Bronze, M.S., 2013. Clinical use of anti-TNF therapy and increased risk of infections. Drug Healthc. Patient Saf. 5, 79–99. Allen, K.J., Wałecka-Zacharska, E., Chen, J.C., Katarzyna, K.P., Devlieghere, F., Meervenne, E.V., Osek, J., Wieczorek, K., Bania, J., 2016. Listeria monocytogenes—an examination of food chain factors potentially contributing to antimicrobial resistance. Food Microbiol. 54, 178–189. Alouf, J.E., Popoff, M.R., Ladant, D., 2015. The Comprehensive Sourcebook of Bacterial Protein Toxins, third ed. Academic Press, Burlington, MA. Baird, F.J., Gasser, R.B., Jabbar, A., Lopata, A.L., 2014. Foodborne anisakiasis and allergy. Mol. Cell. Probes. 28, 167–174. Begum, A., Bari, S., Chowdhury, F.R., Ahmed, N., Sayeed, K., 2015. Pattern of anti-microbial sensitivity and resistance against Salmonella species in a tertiary hospital in Dhaka. J. Enam Med. Coll. 5, 88–92. Bottone, E.J., 2010. Bacillus cereus, a volatile human pathogen. Clin. Microbiol. Rev. 23, 382–398. Busl, K.M., Bleck, T.P., 2012. Treatment of neuroterrorism. Neurotherapeutics 9, 139–157. Carrada-Bravo, T., 2003. Fascioliasis: diagnosis, epidemiology and treatment. Rev. Gastroenterol. Mex. 68, 135–142. CDC, 2005. Bioterrorism agents/diseases by categories. Centers for Disease Control and Prevention. Available from: http://www.bt.cdc.gov/agent/agentlist-category.asp. CDC, 2010. Human paragonimiasis after eating raw or undercooked crayfish: July 2006–September 2010, Missouri. Centers for Disease Control and Prevention. Available from: https://www.cdc.gov/mmwr/preview/ mmwrhtml/mm5948a1.htm. CDC, 2015. Trichinellosis surveillance—United States, 2008–2012. Centers for Disease Control and Prevention. Available from: http://www.cdc.gov/mmwr/preview/mmwrhtml/ss6401a1.htm. CDC, 2015. Cyclosporiasis. Centers for Disease Control and Prevention. Available from: http://www.cdc.gov/ parasites/cyclosporiasis/resources/pdf/cyclosporiasis_general-public_061214.pdf. CFSPH, 2012. Giardiasis. Center for Food Security and Public Health. Available from: http://www.cfsph.iastate. edu/Factsheets/pdfs/giardiasis.pdf. Chowdhury, G., Sangeeta, J., Sanjay, B., Uma, S., Balaji, B., Arpita, B., Sumio, S., Thandavarayan, R., 2016. Extraintestinal infections caused by non-toxigenic Vibrio cholerae non-O1/non-O139. Front. Microbiol. 7, 1–5. Cross, J.H., 1996. Enteric nematodes of humans. In: Baron, S. (Ed.), Medical Microbiology. fourth ed. University of Texas Medical Branch at Galveston, Galveston, TX. Eguale, T., Gebreyes, W.A., Asrat, D., Alemayehu, H., Gunn, J.S., Engidawork, E., 2015. Non-typhoidal salmonella serotypes, antimicrobial resistance and co-infection with parasites among patients with diarrhea and other gastrointestinal complaints in Addis Ababa, Ethiopia. BMC Infect. Dis. 15, 497. Ehling-Schulz, M., Fricker, M., Scherer, S., 2004. Identification of emetic toxin producing Bacillus cereus strains by a novel molecular assay. FEMS Microbiol. Lett. 232, 189–195.

Microbial Foodborne Diseases  29 Epstein, E., 2015. Disposal and Management of Solid Waste: Pathogens and Diseases, first ed. CRC Press, Boca Raton, FL. Evans, A.S., Brachman, P.S., 1998. Bacterial Infections of Humans: Epidemiology and Control, third ed. Springer Science+BusinessMedia, New York. Farrar, J., Hotez, P., Junghanss, T., Kang, G., Lalloo, D., White, N.J., 2014. Manson’s Tropical Diseases, 23rd ed. Elsevier Saunders, Philadelphia, PA. FDA, 2002. Isolation and enumeration of Enterobacter sakazakii from dehydrated infant formula. Food and Drug Administration. Available from: www.cfsanfdagov/∼comm/mmesakaz.html. FDA (Food and Drug Administration), 2012. Bad Bug Book: Foodborne Pathogenic Microorganisms and Natural Toxins, second ed. Center for Food Safety and Applied Nutrition (CFSAN), College Park, MD, United States. Finkelstein, R.A., 1996. Cholera, Vibrio cholerae O1 and O139, and other pathogenic vibrios. In: Baron, S. (Ed.), Medical Microbiology. fourth ed. University of Texas Medical Branch at Galveston, Galveston, TX. Fratamico, P.M., Bhunia, A.K., Smith, J.L., 2005. Foodborne Pathogens: Microbiology and Molecular Biology, first ed. Caister Academic Press, Poole, UK. Galindo, C.L., Rosenzweig, J.A., Kirtley, M.L., Chopra, A.K., 2011. Pathogenesis of Y. enterocolitica and Y. pseudotuberculosis in human yersiniosis. J. Pathog. 2011, 1–16. Gonzales, I., Rivera, J.T., Garcia, H.H., 2016. Pathogenesis of Taenia solium taeniasis and cysticercosis. Parasite Immunol. 38 (3), 136–146. Greenough, W.B., Rosenberg, I.S., Gordon, R.S., Davies, B.I., Benenson, A.S., 1964. Tetracycline in the treatment of cholera. Lancet 41, 355–357. Gul, H.C., Erdem, H., 2015. Brucellosis (Brucella species). In: Bennett, J.E., Dolin, R., Blaser, M.J. (Eds.), Mandell, Douglas, and Bennett’s Principles and Practice of Infectious Diseases. eighth ed. Elsevier Saunders, Philadelphia, PA, pp. 2584–2590. Harrell, L.W., Deardorff, T.L., 1990. Human nanophyetiasis: transmission by handling naturally infected coho salmon (Oncorhynchus kisutch). J. Infect. Dis. 161, 146–148. Hennekinne, J.A., De Buyser, M.L., Dragacci, S., 2012. Staphylococcus aureus and its food poisoning toxins: characterization and outbreak investigation. FEMS Microbiol. Rev. 36, 815–836. Hong, S.T., Fanq, Y., 2012. Clonorchis sinensis and clonorchiasis, an update. Parasitol. Int. 61, 17–24. Hong, S., Kim, K., Yoon, S., Park, W.Y., Sim, S., Yu, J.R., 2014. Detection of Cryptosporidium parvum in environmental soil and vegetables. J. Korean Med. Sci. 29, 1367–1371. Hossain, M., Uddin, M.B., Al Hassan, A., Islam, R., Cho, H.S., 2014. Potential risk factors analysis of dairy cattle management against brucellosis. Vet. Res. Int. 2, 96–102. Hui, Y.H., Pierson, M.D., Gorham, J.R., 2001. Foodborne Disease Handbook, Vol. 1: Bacterial Pathogens, second ed. Marcel Dekker, New York. Hunter, C.J., Petrosyan, M., Ford, H.R., Prasadarao, N.V., 2008. Enterobacter sakazakii: an emerging pathogen in infants and neonates. Surg. Infect. 9, 533–539. Janda, J.M., Abbott, S.L., 2010. The genus Aeromonas: taxonomy, pathogenicity, and infection. Clin. Microbiol. Rev. 23, 35–73. Johler, S., Giannini, P., Jermini, M., Hummerjohann, J., Baumgartner, A., Stephan, R., 2015. Further evidence for staphylococcal food poisoning outbreaks caused by egc-encoded enterotoxins. Toxins 7, 997–1004. Kariuki, S., Gordon, M.A., Feasey, N., Parry, C.M., 2015. Antimicrobial resistance and management of invasive salmonella disease. Vaccine 33, C21–C29. Kaye, K.S., Anderson, D.J., Choi, Y., Link, K., Thacker, P., Sexton, D.J., 2008. The deadly toll of invasive methicillin-resistant Staphylococcus aureus infection in community hospitals. Clin. Infect. Dis. 46, 1568–1577. Kim, Y.B., Okuda, J., Matsumoto, C., Takahashi, N., Hashimoto, S., Nishibuchi, M., 1999. Identification of Vibrio parahaemolyticus strains at the species level by PCR targeted to the toxR gene. J. Clin. Microbiol. 37, 1173–1177. Koopmans, M., von Bonsdorff, C.H., Vinjé, J., de Medici, D., Monroe, S., 2002. Foodborne viruses. FEMS Microbiol. Rev. 26, 187–205.

30  Chapter 1 Lacey, J.A., Johanesen, P.A., Lyras, D., Moore, R.J., 2016. Genomic diversity of necrotic enteritis associated strains of Clostridium perfringens: a review. Avian Pathol. 45, 302–307. Lee, K.W., Lillehoj, H.S., Jeong, W., Jeoung, H.Y., An, D.J., 2011. Avian necrotic enteritis: experimental models, host immunity, pathogenesis, risk factors, and vaccine development. Poult. Sci. 90, 1381–1390. Leong, D., Alvarez-Ordonez, A., Jooste, P., Jordan, K., 2016. Listeria monocytogenes in food: control by monitoring the food processing environment. Afr. J. Microbiol. Res. 10, 1–14. Liu, Y., Tam, Y.H., Yuan, J., Chen, F., Cai, W., Liu, J., Ma, X., Xie, C., Zheng, C., Zhuo, L., Cao, X., Tan, H., Li, B., Xie, H., Liu, Y., Ip, D., 2015. A foodborne outbreak of gastroenteritis caused by Vibrio parahaemolyticus and norovirus through non-seafood vehicle. PLoS One 10, e0137848. Löfmark, S., Edlund, C., Nord, C.E., 2010. Metronidazole is still the drug of choice for treatment of anaerobic infections. Clin. Infect. Dis. 50, 16–23. Lydyard, P., Cole, M., Holton, J., Irving, W., Porakishvili, N., Venkatesan, P., Ward, K., 2010. Case Studies in Infectious Disease, first ed. Taylor & Francis Group, New York. Mairiang, E., Mairiang, P., 2003. Clinical manifestation of opisthorchiasis and treatment. Acta Trop. 88, 221–227. Majowicz, S.E., Musto, J., Scallan, E., Angulo, F.J., Kirk, M., O’Brien, S.J., Jones, T.F., Fazil, A., Hoekstra, R.M., 2010. The global burden of nontyphoidal salmonella gastroenteritis. Clin. Infect. Dis. 50, 882–889. Manning, S.D., 2010. E. Coli Infections, second ed. Chelsea House, New York. Marie, C., Petri, W.A., 2013. Amoebic dysentery. BMJ Clin. Evid. 2013, 098. Martin, S., 2001. Congenital toxoplasmosis. Neonatal Netw. 20, 23–30. Moore, D.A., Girdwood, R.W., Chiodini, P.L., 2002. Treatment of anisakiasis with albendazole. Lancet 360, 54. Mossel, D.A.A., Jansen, J.T., Struijk, C.B., 1999. Microbiological safety assurance applied to smaller catering operations world-wide: from angst through ardour to assistance and achievement—the facts. Food Control. 10, 195–211. Niyogi, S.K., 2005. Shigellosis. J. Microbiol. 43, 133–143. Noordhout, C.M., Devleesschauwer, B., Angulo, F.J., Verbeke, G., Haagsma, J., Kirk, M., Havelaar, A., Speybroeck, N., 2014. The global burden of listeriosis: a systematic review and meta-analysis. Lancet Inf. Dis. 14, 1073–1082. Omernik, A., Płusa, T., 2015. Toxins of Clostridium perfringens as a natural and bioterroristic threats. Pol. Merkur. Lekarski 39, 149–152. Rajapakse, S., Chrishan Shivanthan, M., Samaranayake, N., Rodrigo, C., Deepika Fernando, S., 2013. Antibiotics for human toxoplasmosis: a systematic review of randomized trials. Pathog. Glob. Health. 107, 162–169. Ramani, S., Atmar, R.L., Estes, M.K., 2014. Epidemiology of human noroviruses and updates on vaccine development. Curr. Opin. Gastroenterol. 30, 25–33. Reddy, S.P., Wang, H., Adams, J.K., Feng, P.C., 2016. Prevalence and characteristics of salmonella serotypes isolated from fresh produce marketed in the United States. J. Food Prot. 79, 6–16. Rey Matias, C.A., Pereira, I.A., Santos de Araújo, M., Mercês Santos, A.F., Lopes, R.P., Christakis, S., 2016. Characteristics of Salmonella spp. isolated from wild birds confiscated in illegal trade markets, Rio de Janeiro, Brazil. Biomed. Int. Res. 2016, 1–7. Riemann, H.P., Cliver, D.O., 2006. Foodborne Infections and Intoxications, third ed. Academic Press, San Diego, CA. Saadatnia, G., Golkar, M., 2012. A review on human toxoplasmosis. Scand. J. Infect. Dis. 44, 805–814. Saha, D., Karim, M.M., Khan, W.A., Ahmed, S., Salam, M.A., Bennish, M.L., 2006. Single-dose azithromycin for the treatment of cholera in adults. N. Engl. J. Med. 354, 2452–2462. Smulders, F.J.M., Norrung, B., Budka, H., 2013. Food Borne Viruses and Prions and Their Significance for Public Health (Food Safety Assurance and Veterinary Public Health), first ed. Wageningen Academic Publishers, Wageningen, Gelderland, The Netherlands. Sobel, J., 2005. Botulism. Clin. Infect. Dis. 41, 1167–1173. Switt, A.I., Soyer, Y., Warnick, L.D., Wiedmann, M., 2009. Emergence, distribution, and molecular and phenotypic characteristics of Salmonella enterica serotype 4,5,12:i:–. Foodborne Pathog. Dis. 6, 407–415.

Microbial Foodborne Diseases  31 Talebreza, A., Memariani, M., Memariani, H., Shirazi, M.H., Shamsabad, P.E., Bakhtiari, M., 2015. Prevalence and antibiotic susceptibility of Shigella species isolated from pediatric patients in Tehran. Arch. Pediatr. Infect. Dis. 4, e32395. Tauxe, R.V., 2015. Treatment and prevention of Yersinia enterocolitica and Yersinia pseudotuberculosis infection. UpToDate. Available from: http://www.uptodate.com/contents/treatment-and-prevention-of-yersiniaenterocolitica-and-yersinia-pseudotuberculosis-infection. Tsao, C.H., Chen, C.C., Tsai, S.J., Li, C.R., Chao, W.N., Chan, K.S., Lin, D.B., Sheu, K.L., Chen, S.C., Lee, M.C., Bell, W.R., 2013. Seasonality, clinical types and prognostic factors of Vibrio vulnificus infection. J. Infect. Dev. Ctries. 7, 533–540. Valero, M.A., Perez-Crespo, I., Periago, M.V., Khoubbane, M., Mas-Coma, S., 2009. Fluke egg characteristics for the diagnosis of human and animal fascioliasis by Fasciola hepatica and F. gigantica. Acta Trop. 111, 150–159. Wain, J., Hendriksen, R.S., Mikoleit, M.L., Keddy, K.H., Ochiai, R.L., 2015. Typhoid fever. Lancet 385, 1136–1145. Wallace, G.S., Oberste, M.S., 2012. Poliomyelitis. In: Roush, S.W., Baldy, L.M. (Eds.), Manual for the Surveillance of Vaccine-Preventable Diseases. fifth ed. Centers for Disease Control and Prevention, Atlanta, GA, Chapter 12. Wells, C.L., Wilkins, T.D., 1996. Clostridia: sporeforming anaerobic bacilli. In: Baron, S. (Ed.), Medical Microbiology. fourth ed. University of Texas Medical Branch at Galveston, Galveston, TX. WHO, 2005. International Travel and Health, Chapter 6: Vaccine-preventable diseases and vaccines. World Health Organization, Geneva, Switzerland. Available from: http://www.who.int/ith/ITH_chapter_6.pdf. WHO, 2006a. Preventive Chemotherapy in Human Helminthiasis: Coordinated Use of Anthelminthic Drugs in Control Interventions: A Manual for Health Professionals and Programme Managers. World Health Organization, Geneva, Switzerland. WHO, 2006b. Brucellosis in Humans and Animals. World Health Organization, Geneva, Switzerland. WHO, 2008a. Foodborne Disease Outbreaks: Guidelines for Investigation and Control. World Health Organization, Geneva, Switzerland. WHO, 2008b. Fact sheet on fascioliasis. In: Action against Worms, World Health Organization, Headquarters Geneva (December 2007). Newsletter 10, pp. 1–8. WHO, 2013. Salmonella (non-typhoidal). World Health Organization, Geneva, Switzerland. Available from: http://www.who.int/mediacentre/factsheets/fs139/en. WHO, 2015. Estimates of the global burden of foodborne diseases, 2015. World Health Organization, Geneva, Switzerland. Available from: http://www.who.int/foodsafety/areas_work/foodborne-diseases/infographics_ combined_en.pdf?ua=1. WHO, 2016. Taeniasis/cysticercosis. World Health Organization, Geneva, Switzerland. Available from: http://www.who.int/mediacentre/factsheets/fs376/en/). Williams, M.S., Golden, N.J., Ebel, E.D., Crarey, E.T., Tate, H.P., 2015. Temporal patterns of campylobacter contamination on chicken and their relationship to campylobacteriosis cases in the United States. Int. J. Food Microbiol. 208, 114–121. Xiao, L., Morgan, U.M., Fayer, R., Thompson, R.C., Lal, A.A., 2000. Cryptosporidium systematics and implications for public health. Parasitol. Today 16, 287–292. Yugo, D.M., Meng, X.J., 2013. Hepatitis E virus: foodborne, waterborne and zoonotic transmission. Int. J. Environ. Res. Public Health 10, 4507–4533. Zollner-Schwetz, I., Krause, R., 2015. Therapy of acute gastroenteritis: role of antibiotics. Clin. Microbiol. Infect. 21, 744–749.

Page left intentionally blank

CHAPTE R 2

Important Emerging and Reemerging Tropical Food-Borne Diseases Viroj Wiwanitkit*,**,†,‡,§ *Hainan Medical University, Hainan, China; **University of Niš, Niš, Serbia; †Joseph Ayo Babalola University, Ikeji-Arakeji, Osun, Nigeria; ‡Surin Rajabhat University, Surin, Thailand; §Dr. DY Patil Medical University, Mumbai, Maharashtra, India

1 Introduction Food is an important essential requirement for anyone. It is one of the four requirements for a human life: food, clothing, shelter, and medicine. In general, food offers nutrients for human growth and health. If there is no food, there will be no life. To maintain a healthy life, an adequate amount of food has to be consumed and regulation of the quality of food is needed. In general, a good food has to have an appropriate amount of nutrients and be well prepared by the proper cooking technique. As noted, good preparation of food is needed and confirmation of safety is the basic concept in public health. In a perfect world, quality control and assurance would be present at all steps from the farm where food is grown to ingestion by human beings or animals. An error or problem in each step can cause the loss of quality of the food and might cause unwanted results, including to food-borne disease. Conceptually, to guarantee safety of food, these quality issues must be in place (Wiwanitkit, 2008): 1. There is no contamination in food (Wiwanitkit, 2009). The raw materials have to be free from any unwanted contaminants. The contamination in food may be chemical or biological unwanted objects. Several contaminations can be seen in food and can affect health. In the short term, a gastrointestinal problem may be experienced, which is a common problem in developing countries. In the long term, contaminated food might cause chronic diseases as well as cancer. There are many cancers that are proved to be caused by contaminated food. A good example is cholangiocarcinoma, which is linked to the intake of food contaminated with liver fluke metacercariae. Indeed, quality control should be initiated at the starting point. The care of animals and vegetables that are fed and grown to be foods is needed. As noted by Singer et al. (2007), only a small improvement in the quality of animal foods could significantly reduce incidences of human illness. Foodborne Diseases http://dx.doi.org/10.1016/B978-0-12-811444-5.00003-8

33

Copyright © 2018 Elsevier Inc. All rights reserved.

34  Chapter 2 2. The transportation of food material has to be efficient. Transportation is the way that a contaminated food can be passed from its origin to the consumer. This is a common issue that is usually forgotten. The logistics of food production have to be analyzed. Delayed transportation can be expected in many resource-limited countries, and this is an important cause of decreased quality of food and might increase the chances for contamination. Rotted food might be a good example of the unwanted effects of delayed transportation. Sometimes, more complex situations can be expected. The use of preservatives to extend the shelf-life of food is of great concern. These can cause health problems and this is a common illegal practice in many developing countries. The logistical analysis of the journey of food from the source until it reaches the consumer is useful and should be a basic requirement in any setting to have the information on this process. 3. There must be a process for rechecking the safety of food before it reaches the consumer. Indeed, this process is done in some countries. The effectiveness of the process depends on the method used, the accuracy of the procedure, the frequency of surveying food, as well as the number of tests. Kuiper and Paoletti (2015) noted that “high quality sampling should always be applied to ensure the use of adequate and representative samples as test materials for hazard identification, toxicological and nutritional characterization of identified hazards, as well as for estimating quantitative and reliable exposure levels of foods/feed or related compounds of concern for humans and animals.” 4. The food has to be well cooked. The possibility of contamination during cooking has to be eliminated. The standard technique for cooking is also required. In many processes, cooking might cause unwanted chemicals to be incorporated into foods. Many carcinogens occur during cooking and are related to poor cooking technique. The right cooking technique is usually a major problem in food safety and this is the role of food science education, to promote the knowledge of safe practices for the general population. In addition to the cooking process, the health status of the cook is of concern. Sometimes, there is no problem with a kitchen but problems are introduced by the cook. Some cooks might be ill or might be in the carrier state of disease and might cause local transmission of disease. 5. The food has to be properly served to the consumers. Sometimes, contamination can occur during serving of food in a restaurant or cafeteria. Food served by a waiter with poor cleanliness habits can be expected in developing countries. The waiter might not use a face mask and hairnet or cap while serving food, and contamination caused by poor sanitation can be expected. 6. The consumer has to practice proper eating sanitation. This is the final step before the food is consumed. Many poor eating behaviors can be observed. The most common unwanted behavior is no hand washing before eating a meal. 7. Finally, although it is not a direct food issue, the management of the waste from food intake has to be considered. This is also the important issue in food sanitation in public health.

Important Emerging and Reemerging Tropical Food-Borne Diseases  35

2  Food-Borne Disease: Important Problem in Public Health Everyone has to eat and food is what all of us know and need on a daily basis. Therefore, there is no doubt that food can cause disease if it is dirty and contaminated. In medicine, an illness caused by food is called a “food-borne disease.” Food-borne disease is common and is a public health problem in the present day. It affects millions of people around the world. To combat with food-borne disease is still an important issue for public health organizations. The reasons that there is a need to have a plan to combat the problem include (1) the disease usually reflects poor sanitation, which is also the possible underlying cause of other groups of disease; (2) the involvement of the gastrointestinal tract in sickness can be serious and can be fatal; (3) spreading of disease by fecal–oral route is of great concern, for example, cholera outbreaks in the past have been caused this way, and have proved a good lesson in public health; (4) the control of the food production process is needed and poor or low-quality processes can be seen in the outbreak or emergence of food-borne illnesses. Majowicz et al. (2016) noted that “public health practitioners working in infectious foodborne illness, food insecurity, dietary contaminants, obesity, and food allergy should actively consider how their seemingly targeted public health actions may produce unintended positive or negative population health impacts.” Hence, the issue of food-borne disease is an important public health topic that any public health and medical workers needs to focus on. How food-borne disease occurs is the first topic to be discussed. Food cannot cause a health problem if a human does not contact it or consume it. There must be a problematic unwanted germ or chemical in the food as well. This is the basic concept in medical epidemiology. The triads have to be fulfilled at the same time and same place: (1) host, (2) agent, and (3) environment (Fig. 2.1). A human or an animal can be the host that can suffer from a problem from food. In general, all ingested materials, including nutrients, will interact with the gastrointestinal tract (Hunt

Figure 2.1: Epidemiological Triad for Food-Borne Disease.

36  Chapter 2 et al., 2015). Hunt et al. (2015) noted that the stomach was the most important organ of the human gastrointestinal tract and also mentioned that the function of gastric acid secretion was not only for digestive process but also as the first line defensive mechanism against foodborne pathogens. Hence, if the host has immunity and strong physiology, the problem might not occur. A weak host can be more susceptible to disease. The weakness of a host may be due to underlying chronic disease (diabetes mellitus, tuberculosis, HIV, cancer, etc.), genetic disorder, old or young age, or pregnancy. The host has to have contact with the second factor, the unwanted particle in food. As already mentioned, there are many possible unwanted particles in food. The germ, pathogen, chemicals, contamination, or radioactive materials in food are common problems to be managed in public health. Pathogens are a common and well-known causative agent of food-borne illness. These particles are the causative agents of health disturbances in the host and this will result in food-borne disease. Certainly, if a host is strong but if the causative agent is extremely virulent, the disease can occur. Finally, as already mentioned, the environment has to promote the interrelationship between host and causative agent. At least, host and problematic agent must exist at the same place in the same time. There must also be contact between host and agent. In this scenario, the food has to be taken in by a human or an animal, which can be the starting point for the pathophysiological process of disease in the human’s or animal’s body. Also, there might be a vector or intermediate agent that stimulates transmission of the causative agent to the host. A good example is a fly that lands on food—the fly can also carry bacteria that can contaminate the food (Fig. 2.2). In food science, the main focus might be only on food. But in public health, the concern must be for all components of the triad: food, host, and causative agent. Food sanitation is a basic issue in public health and this is the worldwide concept to counteract food-borne disease. It should be noted that food-borne disease is one of a group of diseases to be managed. There are many patients who become sick due to food-borne disease each year and this results in much economic loss around the world. There is no doubt that the control of food-borne disease is included in important public health policies of the World Health Organization and this is still an actual important topic for all. In general, there are many food-borne diseases. Some are common and the others might be uncommon. However, health and disease are dynamic, due to many factors. It can be said that disease can be a multifactorial problem. Bio-, psycho-, social, and spiritual concern is needed. For food-borne disease, this holistic concept has to be focused as well. Focusing on the biological factor, the knowledge of a food and pathogen/food contaminant is needed. However, knowledge of only the food and unwanted disease-causing agent is not sufficient. The physiological and social contexts have to be accessed. There is no doubt that one who has improper psychological status might not be able to take care themselves, including having poor food sanitation. In addition, in some cultures, poor sanitation is a rooted behavior and this can be the cause of uncontrollable food-borne disease. Finally, there are many spiritual beliefs that relate to food. The religious practice of vegetarianism can be seen worldwide and this is a good example of a spiritual background that might affect the health status of local people (Fig. 2.3).

Important Emerging and Reemerging Tropical Food-Borne Diseases  37

Figure 2.2: Fly Causes Dirty Appearance and Contamination in Food. This is a common finding in poor sanitation settings in many tropical countries (A and B).

Finally, the clinical pictures of food-borne disease should be mentioned. Since the problem is caused by food and the direct contact is in the alimentary tract, hence, the common clinical presentation is a gastrointestinal disorder. Abdominal pain, diarrhea, and vomiting are usually observed. However, there are also specific clinical problems in each particular food-borne disease. Sometimes, fever might be seen and the systematic involvement can be observed. The details of each specific disease can be found in medical textbooks and will not be mentioned in this chapter.

3  Examples of Important Food-Borne Diseases As noted, there are many food-borne diseases with different etiologies. Kirk et al. (2015) recently concluded that food-borne diseases could result in a considerable disease burden, particularly in children, and also noted that attention must be paid to food safety interventions

38  Chapter 2

Figure 2.3: Cartoons Showing the Possible Clinical Manifestations of Food-Borne Diseases. Commonly, any food-borne disease usually has its main clinical presentation as gastrointestinal problems. The common complaints of the patients might be diarrhea, abdominal pain, or vomiting. The clinical problem is due to the host resistance, virulence of pathogen, and environment.

to prevent food-borne diseases, especially for low- and middle-income countries. The important groups of food-borne diseases are food-borne disease due to biological agents and food-borne disease due to chemical agents. The following lists will present and discuss some important examples in each group. 1. Food-borne diseases due to biological agents. The biological agent that can cause food-borne disease might be bacteria, virus, fungus, or parasite. The problematic biological agent is usually called a pathogen in medicine. Dhama et al. (2013) noted that “The foodborne pathogens include various bacteria viz.,

Important Emerging and Reemerging Tropical Food-Borne Diseases  39

2.



3.

4.

5.



Salmonella, Campylobacter, E. coli, Listeria monocytogenes, Yersinia enterocolitica, Staphylococcus, Arcobacter, Cl. perfringens, Cl. botulinum and Bacillus cereus and helminths viz., Taenia. They also include protozoa viz., Trichinella, Sarcocystis, Toxoplasma gondii and Cryptosporidium parvum.” The important diseases will be further discussed. Important bacterial food-borne diseases. Many bacteria can cause gastrointestinal diseases. Many bacteria can be identified as contaminants in food and become the health problem. Good examples of diseases in this group are tuberculosis, salmonellosis (typhoid and paratyphoid), Staphylococcus spp. infection, and Escherichia coli infection. The pathogenesis of the mentioned bacteria might be direct invasion or toxin production that further affects human beings or animals. A good example of bacteria that can cause toxins is the Clostridium botulinum that can produce botulinum toxin, which can cause botulism. Bacterial food-borne disease is the most well-known group of food-borne diseases and affects millions of people each year (Fleckenstein et al., 2010). Identification of possible microbial pathogens is widely practiced and is the basic rule for food safety. Narsaiah et al. (2012) noted that “the conventional methods for detection of food contamination based on culturing, colony counting, chromatography and immunoassay are tedious and time consuming” and proposed the need for new techniques, such as biosensors, for help in screening. Important viral food-borne diseases. Many viruses can cause gastrointestinal diseases. Many viruses can be identified as contaminants in food and become health problems. Good examples of important viral food-borne diseases are hepatitis A infection, hepatitis E infection (Sridhar et al., 2015), and Norwalk virus infection (Aliabadi et al., 2015). The main pathogenesis of the mentioned virus is usually the direct cytopathologic effect. Important fungal food-borne diseases. Many fungi can cause gastrointestinal diseases. Many fungi can be identified as contaminants in foods and become health problems. Mainly, fungi can produce toxins that cause health problems to the ones who intake it. Of interest, long-term health effects can also be seen. The best example is the aflatoxins from fungal-contaminated foods that can cause liver cancer in the long term. Important parasitic food-borne disease (Anantaphruti, 2001; Dorny et al., 2009). Many parasites can cause gastrointestinal diseases. Many parasites can be identified as contaminants in food and pose a health problem (Dorny et al., 2009). Dorny et al. (2009) noted that parasitic food-borne diseases were usually underrecognized but became more common; therefore, awareness is important. Torgerson et al. (2015) concluded that “parasites are frequently transmitted to humans through contaminated food” and “the disease burden due to most foodborne parasites is highly focal and results in significant morbidity and mortality among vulnerable

40  Chapter 2 populations.” The important examples of diseases in this group are opisthorchiasis (liver fluke infestation), cysticercosis, paragonimiasis, and sparganosis. Of interest, the longterm health effect can also be seen. The best example is cholangiocarcinoma, which is the chronic complication due to liver fluke infestation. Ito and Budke (2014) noted that “food-borne parasitic infections are still common diseases in developing countries, especially in rural areas.” Hence, the disease in this group is still the major precaution in travel medicine. The recommendation for awareness is required for any traveler with a plan to visit the tropical countries. Also, as already noted, because of good transportation, the disease is presently not confined to tropical countries. Recently, Ito and Budke (2014) noted that “due to increased globalization, food-borne parasitic infections are becoming more prevalent worldwide, including in countries where these parasites and parasitic diseases had previously been well controlled or eradicated.” Similar to bacterial contamination, the food safety procedure in tropical countries usually focuses on parasitic contamination. There are many standards and guidelines to counteract the problem. Examination of food is usually a routine procedure. A good example is the trichinoscopy, a cost-effective diagnostic technique (Forbes et al., 2003) that is the basic legal control to guarantee the safety of meat products. 6. Food-borne disease due to chemical agent The chemical agent that can cause food-borne disease might be toxic substance or contaminated (heavy metal, additive, or pesticide, etc.). The contamination of unwanted chemical might be due to natural process or intentionally added by human (Fig. 2.4, Table 2.1).

Figure 2.4: Tropical Dishes That Are Usually Contaminated With Chemicals and Additives.

Important Emerging and Reemerging Tropical Food-Borne Diseases  41 Table 2.1: Examples of important food-borne diseases. Groups Meat-borne disease • Cysticercosis

• Trichinellosis

Fish-borne disease • Opisthochiasis

• Clonorchiasis • Minute intestinal flukes infestation • Gnathostomiasis

Seafood-borne disease • Seafood poisoning

Uncommon disease

Details This is a parasitic infestation. It is a formation of parasitic cyst in tissue of human. The infestation causes a fatal infection and the patient might have no symptoms. Contaminated pork is the main problematic food source. The most serious form of this disease occurs when a parasitic cyst is located at the central nervous system. This deadly condition can cause neurological deficit and seizure. This condition is specifically called neurocysticercosis. This is another parasitic infestation. It is a serious muscle infestation by parasite. The infestation is serious and can be deadly. Contaminated meat, especially boar, is the main problematic food source. The outbreak of this disease is commonly seen among ethnic groups with low sanitation standards in Asia. This is another parasitic infestation. A parasite, namely liver fluke (Opisthorchis viverrini) is the main pathogen. The intake of raw fish dishes made from fresh water fishes contaminated with metacercariae of the parasite is the cause of infestation. It can cause chronic infestation in hepatobiliary tract of human beings, dogs, and cats. However, the serious problem is usually seen in human beings who carry long-term chronic infestation. Concomitant with other poor hygiene and bad health behavior (such as alcoholic drinking, ingestion of nitrosamine contaminated food), the chronic infestation might be the trigger point of cholangiocarcinogenesis. This disease is very common in Indochina. Clonorchis sinensis is a parasitic infestation similar to opisthorchiasis. It is the common problem in East Asia. Minute intestinal flukes infestation is the group of fish-borne disease with the same mode of transmission as opisthorchiasis and clonochiasis. This is another parasitic infestation. The intake of third-stage infective larva contaminated raw fish dishes is the big problem leading to gnathostomiasis. Migratory swelling is the classical clinical finding in this disease. The parasite might migrate to any organs and can cause serious problems if the parasite migrates to important organs such as eye and brain. The problem is due to the intake of seafood. The toxin from seafood is the cause of the problem and it can result in several serious clinical symptoms, including leading to death. The well-known specific poisoning is tetrodotoxin intoxication due to intake of puffer fish. It should also be noted that meat of amphibians and reptiles can harbor various kinds of parasites such as trematodes (Opisthorchis spp.), nematodes (Gnathostoma spp., Anisakine parasites), cestodes (Diphyllobothrium spp., Spirometra), and Pentastomid that can further cause diseases in human beings if poorly cooked or noncooked meat is eaten (Dorny et al., 2009).

42  Chapter 2

4  Emerging Infectious Diseases and Emerging Food-Borne Diseases Emerging infectious disease is an important problem in public health. In general, there are many diseases in medicine. Some might be common while others are not. The priority setting to manage the diseases is needed. An important concern for priority setting is the prevalence of the disease. The disease that is common means it is prevalent and this implies that there are many patients who get sicknesses. This can imply that there should be a method for management of this problem and it should receive high priority. Emerging infectious disease is a specific medical term that is used for describing the appearance of a new infection. The appearance of epidemic (more than 2 SD of normal status) is the common criteria for judgment of outbreak or emergence. To achieve this data, there must be already available information on the prevalence of disease. For the case of a new emerging disease, there might be no data, but there is the occurrence or incidence or new problem. This is an actual challenge in public health. Since the emerging infection or new emerging infectious disease is a new problem, the limitations can be seen. Limited data, limited knowledge, and limited preparation are the common problems. Without data, there can be no good preventive and corrective actions. Without knowledge, a practitioner cannot effectively comprehend the problem and ineffective management can be expected. Without good preparation, the control of the problem becomes a very hard activity. Many emerging infectious diseases become global problems. In the past, the emerging of Spanish flu resulted in a worldwide pandemic and caused millions of deaths (Yoshikura, 2014). The recent pandemic swine flu is also a good example that occurred in the 21st century. And the updated situation of Zika virus infection outbreak is the best scenario of a present-day emerging infectious disease. For the food-borne infectious disease, there are many new emerging infections. Historically, the emerging of cholera, a disease that can be transmitted by contaminated water, occurred several times and resulted in many deaths each time. Currently, emerging food-borne infections are sporadically reported around the world. Not only infectious disease but also noninfectious disease can be cause for concern. Emerging noninfectious food-borne disease might be due to food toxins or chemical contamination. Although a widespread outbreak is rare, a very big problem can still be seen. A good example is the problem of tainted milk, which became a big global issue in the past few years. This problem is called the tainted milk problem and this is the most recent well-known chemical contaminant–related food-borne disease. To help readers recognize the problem, good examples of well-known emerging food-borne disease will be further discussed. The first example is the case of renal disorder caused by melamine-contaminated milk (Skinner et al., 2010; Wei and Liu, 2012). This problem was caused by chemical contamination in milk product. The emerging problem was reported in the past few years. At that time, the contamination was detected in milk product from China.

Important Emerging and Reemerging Tropical Food-Borne Diseases  43 The problem occurred when infants ingested the contaminated milk. The clinical signs and symptoms in infants were usually not specific, but the stones were detectable (Skinner et al., 2010). Of interest, in some cases, the stone might be radiolucent and might not be seen in ultrasonography investigation (Skinner et al., 2010). The melamine was unethically added by some milk manufacturer to reduce the cost of the product. The contamination was aimed at luring the consumer into believing that the milk product had high protein content. This resulted in an outbreak of renal disorder among the infants who consumed the contaminated milk product. After careful investigation, it was finally shown that the problem was due to ingestion of milk and the identified contaminant in the milk was melamine. Melamine can form an abnormal molecule in the very small urinary tract of the infant and cause renal disease (Wiwanitkit and Wiwanitkit, 2012, 2013). The case is a good example of the necessity of food safety. It is also the best example of emerging food-borne disease due to a noninfectious agent. Another interesting situation is the case of emerging E. coli infection in many Europeans in the past few years. This problem was due to contamination of food products and the contamination caused the outbreak of serious infection in many countries. This is a serious situation occurring in Europe, where high food safety standards can be expected. This demonstrates that E. coli poses a challenge to the global public health system to establish a continuum of food safety surveillance. In addition to the emerging infectious diseases and emerging food-borne diseases discussed previously, the emerging and reemerging food-borne disease should also be mentioned. Reemerging infectious disease means a new round of an emerging or the reappearance of an old infectious disease, which might be already forgotten, and which becomes a big problem, similar to the case of emerging infectious disease. Reemerging food-borne disease can be seen worldwide and the situation is usually due to poor disease control at the significant time. The management of emerging and reemerging infectious diseases needs proper planning and action. The first step is to quickly respond to the emergence of the problem. First aid and rapid counteraction to the situation is required. Helping the sick people has to come first and before the investigation on anything. To investigate the cause or etiology of the emergence is needed. This has to be done using the disease verification process and proof of the causative agent is necessary and the “must.” After successful isolation and identification of the specific causative agent, the plan for proper and specific management can be done. The process should be timely and the process must fully cover the risk population. Finally, the aim of management of the emergence has to be set. In general, the main aims of management of emerging disease are to control and limit the spreading of disease and find the means for further prevention. For the case of reemerging disease, the main aim is similar to the case of emerging disease, but the additional aim should be to analyze the pitfalls and lessons learned from the problematic reemergence situation that can be useful for prevention of any possible repeated reemergence in the future (Table 2.2).

44  Chapter 2 Table 2.2: Important steps for management of emerging and reemerging food-borne disease. Step

Details

1. Verification

When there is a report on uncommon distribution or new occurrence of foodborne disease, it is necessary to check the actual situation. This is to confirm that the problem is present or not. If the problem occurs, the first important mission is to stop the problem as early as possible. Searching for the hidden, forgotten, or underdiagnosed case is needed since the silent or forgotten case can be the cause of further local transmission. To treat the detected case until a “cure” is determined is very important. Quarantine process and follow-up are necessary. The appropriate treatment must be selected and used. However, it should be noted that some diseases can be self-limited and need only supportive and symptomatic treatments. Dhama et al. (2013) noted that “most of the food-borne illnesses are self-limiting but in many instances antibiotics are recommended.” Monitoring of situation to find any new episode is very important. As noted by Hardy (2009) “continued epidemiologic studies are necessary and critical to assess the risks.” If there is no surveillance system, it is no doubt that the update situation cannot be known. The plan must be set based on the basic public health principles and lessons learned from the emergence. “Prevention is better than correction” is the basic principle in public health and medicine. To achieve the goal of prevention, education for the general population and medical personnel is important.

2. Control of problem 3. Searching for case 4. Treatment of the case

5. Surveillance

6. Prevention

5  Tropical Food-Borne Diseases: Important Tropical Diseases In tropical countries, the hot and humid climate is an important factor that can induce the occurrence and facilitate the spread of many diseases. There are many diseases that thrive in humid environments, called tropical diseases. Of interest, some diseases are confined to and specific to the tropical regions, and this may cause difficulty in diagnosis and treatment if the practitioner is not familiar with these diseases. This is the requirement of the specific field in medicine called “tropical medicine.” In the past, the role of tropical medicine might not be clearly seen, but the emergence of many tropical diseases in new, nontropical settings draws the attention of medical practitioners worldwide to the importance of tropical medicine. Indeed, there are many explanations for the emerging of tropical diseases in the nontropical region. The first fact is global warming. Global warming and environmental change is the big issue at present. Global warming has many effects on public health and the emergence of disease can be due to global warming. With rising temperatures, germs might be able to grow in new settings where they previously were not known. With increased temperature, the vector, especially for mosquito, can extend its habitat to the new area and this can result in the emergence of new mosquito-borne disease in the new setting. Hence, it can be said that the tropical disease can be now seen anywhere around the world. The second fact is

Important Emerging and Reemerging Tropical Food-Borne Diseases  45 that good transportation allows easy movement and migration of people and animals as well as vectors from one setting to the other. This can be a big problem if the disease is directly transferred to the new setting by the carrier. Many tropical diseases are already transferred by transportation systems to new settings. It is no doubt that this is also the issue in travel medicine. To have good disease control system at the immigration port is a necessary practice and basic requirement in the public health policies of every country. In addition, the tropical disease usually occurs in tropical countries where the poor live. This becomes the cause of lack of concern and funding. The private health business organization usually does not focus on tropical disease and this means that many tropical diseases have been neglected. Finally, it should be noted that sanitation problems are common in developing tropical countries. Poor sanitation can promote the occurrence of food-borne disease. The food-borne disease can occur elsewhere in the tropical countries. The food stall, restaurant, school cafeteria, or hospital canteen can be the place that the emergence of disease is first observed (Kaewla and Wiwanitkit, 2015). Also, it should be noted that the disease has never reduced the prevalence rates but instead increased for many years. As noted by Fleckenstein et al. (2010), “despite current knowledge of microbial pathogenicity, modern methods of food production and rigorous industrial hygiene, these infections are still commonplace and exact significant health and economic tolls on human populations in all parts of the globe.”

6  Databases and Computational Online Tools for Emerging and Reemerging Tropical Food-Borne Diseases In public health and medicine, there are many new databases and online tools at present. These are useful resources for research and manipulation. These advantages can be applied in the case of emerging and reemerging tropical food-borne diseases, as well. In this section, the author will summarize the data and further discuss some resources for identifying and tracking emerging and reemerging tropical food-borne diseases. 1. Databases There are many databases in medicine and public health. Some available databases are specific for emerging and reemerging tropical food-borne diseases. The examples of useful databases will be hereby discussed. a. PubMed PubMed is an online database with various collections of data in medicine and public health. It is a free online available database that can be accessed via www.pubmed.com. b. GMOMETHODS (Bonfini et al., 2012) GMOMETHODS is the database generated by the European Union database on reference methods for genetically modified organism (GMO) analysis. c. BACTIBASE (Hammami et al., 2010)

46  Chapter 2

BACTIBASE is an integrated open-access database. This database is specifically designed for “the characterization of bacterial antimicrobial peptides, commonly known as bacteriocins” that can be useful for application in food safety. d. ALMONELLABASE (Pushpa and Suresh, 2012) SALMONELLABASE is an online database that can be useful for finding druggable targets of Salmonella species. e. ColiBASE (Chaudhuri et al., 2004) This database is an online database for E. coli, Shigella, and Salmonella comparative genomics. 2. Online tools Some online tools can be applied in -omics science and used for clarification or prediction of the problems relating to emerging and reemerging tropical food-borne diseases. The specific details on such applications will be further discussion on the next heading in this chapter. Here, some important useful online tools will be discussed. • Salmonella In Silico Typing Resource (SISTR) (Yoshida et al., 2016) The Salmonella In Silico Typing Resource (SISTR) is a new “open web-accessible tool.” This new tool is designed for a rapid typing and subtyping draft of Salmonella genome assemblies. This tool is useful for integrating sequence-based typing analyses for “Multi-Locus Sequence Typing (MLST), ribosomal MLST (rMLST), and core genome MLST (cgMLST)” (Yoshida et al., 2016). • PhyResSE (Feuerriegel et al., 2015) PhyResSE is an online bioinformatics web tool for delineating Mycobacterium tuberculosis antibiotic resistance and lineage from whole-genome sequencing data that can be applied for the case of food-borne tuberculosis. • Predivac-2.0 (Oyarzun et al., 2015) Predivac-2.0 is a tool for “epitope-based vaccine design, particularly suited to be applied to virus-related emerging infectious diseases.” This online tool can be accessible at http://predivac.biosci.uq.edu.au. • CATH (Sillitoe et al., 2015) CATH is a new online tool for structural and functional annotations for genome sequences.

7  How to Use the New Technologies for Management of the Emerging and Reemerging Tropical Food-Borne Diseases As already noted in this chapter, there are many important food-borne diseases. To manage the problem, classical public health procedures are needed. However, the application of the new technology should be considered. Several new techniques can be applied and this is an interesting topic that is hereby discussed.

Important Emerging and Reemerging Tropical Food-Borne Diseases  47 1. Application of omics science Omics science, named for the group of technologies with names that end in “-omic,” integrates computer science and other sciences. It represents a bridging among sciences. In medicine, there are many new omics technique that are very useful for public health. In tropical medicine, the basic bioinformatics can be very useful in diagnosis and treatment of many diseases (Wiwanitkit, 2013). Wiwanitkit (2013) concluded that “the omics techniques can be used for answering the question on microbial pathogeny.” The application of omics techniques has been proved to have advantages. Indeed, knowledge of omics is required for better understanding of emerging and reemerging food-borne diseases. Martinovic´ et al. (2016) noted that the knowledge of the “genome and proteome of foodborne pathogens of bacterial or fungal origin and foodomic, mostly proteomic, peptidomic and metabolomic investigation of their toxin production and their mechanism of action is necessary to get further information about their virulence, pathogenicity and survival under stress conditions.” O’Flaherty and Klaenhammer (2011) noted that “omics technologies have exploded the areas of genomics, transcriptomics, and proteomics and revealed many fundamental processes driven by both pathogens and commensals.” Omics science can also be applied in medicine. The two main areas of application are in clarification and prediction. For clarification, there will be a problem and the omics science will be used to find the answer. The searching activity may be used and it is usually related to already existing information collected in electronic databases. For prediction, this is the finding of questions similar to clarification. However, prediction is the in silico or computational simulation approach to find a new answer, which has never been collected in a database or known before. Until the present day, omics science is well-known and there it comprises many specific techniques. Those techniques are commonly known as bioinformatics technique. The two most well-known and classical techniques are genomics and proteomics. Focusing on genomics, the classical “-omics” technique, Wiwanitkit (2013) noted that “using genomics, comparison of the puzzled microbial genome to standard genomes in database helps identify the similarity and can predict the microbial properties such as virulence and resistance.” This is useful in the case of emerging and reemerging foodborne tropical diseases. There are some recent reports on the mentioned application. The examples will be further discussed. Moreno Switt and Toledo (2015) recently reported and discussed the use of omics technique and database manipulation for “tracking of foodborne outbreaks, with emphasis in Salmonella and Listeria monocytogenes,” which is a good example of using genomics for management of emerging food-borne tropical infections. Borges et al. (2015) reported another interesting study on using genomics technique to investigate the Helicobacter pullorum pathogen isolated from samples of fresh chicken meat to find antibiotic resistance and genomic traits of this new

48  Chapter 2







emerging food-borne pathogen. Nyholm et al. (2015) reported on another study, using comparative genomics for investigation of Shiga toxigenic E. coli (STEC) and enterotoxigenic E. coli (ETEC), which can cause serious food-borne infections in human beings. Nyholm et al. (2015) found that “pathogroup-associated virulence genes of different E. coli can co-exist in strains originating from different phylogenetic lineages.” Based on the advanced genomics technology, there are some useful tools for the managing of emerging and reemerging food-borne disease (Abee et al., 2004). For example, there is a new tool, called ArrayTrack, which is a Food and Drug Administration (FDA) bioinformatics tool (Xu et al., 2010) that provide “an integrated environment for microarray data management, analysis and interpretation. Most of its functionality for statistical, pathway and gene ontology analysis ….” Focusing on another well-known technique, proteomics, Wiwanitkit (2013) also noted that “using proteomics, structure clarification and prediction can be done and this can be helpful in further assessment on the pathogenesis process and prediction on interaction with host cells and drugs.” The application of proteomics is the focused issue in the global public health expert forum (Kahn et al., 2012). It is agreed that proteomics technique can help identify many problematic pathogens that are important in food safety. There are many interesting reports on this application and the important ones are hereby listed in Table 2.3. Most applications use proteomics for analysis of protein component of the pathogen that can be further used for development of diagnostic tool and drug targeting. Last, one of the newest omics science, foodomics, should be mentioned. As suggested by its name, foodomics is the specific omics science dealing with food (Gallo and Ferranti, 2016; Putignani and Dallapiccola, 2016; Vallverdú-Queralt and Lamuela-Raventós, 2016). As described by Putignani and Dallapiccola (2016), “the functional complexity of human gut microbiota and its relationship with host physiology and environmental modulating

Table 2.3: Examples of applied proteomics technique for emerging and reemerging tropical food-borne diseases. Authors

Details

Brul et al. (2011)

Brul et al. (2011) introduced the system using “genome-wide genotyping, proteomics, and genome-wide expression analyses studies” for help in assessing “spores from the genus Bacilli.” Carrera et al. (2016) reported on using PRM mass spectrometry fast monitoring for the identification and detection of Anisakis. Singhal et al. (2015) reported and discussed using MALDI-TOF MS as a new “potential tool for microbial identification and diagnosis.”

Carrera et al. (2016) Singhal et al. (2015)

MALDI-TOF MS, Matrix-assisted laser desorption ionization-time of flight mass spectrometry; PRM, parallel reaction monitoring.

Important Emerging and Reemerging Tropical Food-Borne Diseases  49 factors, offers the opportunity to investigate (i) the host and microbiota role in organismenvironment relationship; (ii) the individual functional diversity and response to environmental stimuli (exposome); (iii) the host genome and microbiota metagenomes modifications by diet-mediated epigenomic controls (nutriepigenomics); and (iv) the genotype-phenotype ‘trajectories’ under physiological and disease constraints.” This means foodomics covers all parts of the previously mentioned epidemiological triad of food-borne disease: host, causative agent (microbio-data), and environment (eco-data). There is no doubt that the data on mentioned processes and interactions are very useful for management of emerging and reemerging tropical food-borne diseases. 2. Application of nanotechnology Nanotechnology is the new advent in science. It makes use of the nanomaterials and nanotechniques for help in managing microbial activity. The use of nanotechnology in medicine and public health is an important application in the field of nanomedicine. In general, to apply nanotechnology in nanomedicine has three important aims: (1) analysis of problem (diagnosing, imaging, or enhancing visualization), (2) therapy (nanopharmaceutical and nanopharmacology), and (3) prevention. Indeed, there are a variety of possible applications of nanotechnology in medicine and this can also be seen in the case of food-borne disease. Focusing on the applied nanomedicine for diagnostic purpose, applied nanomedicine technology is helpful for diagnosis of emerging food-borne disease. Since the nanotechnologies can help physicians in diagnosis at submolecular and molecular levels, it can be easily implemented as a diagnostic tool for disease search and surveillance. Arora et al. (2011) discussed and mentioned “microbe-based biosensing methods such as optical, surface plasmon resonance (SPR), amperometric, potentiometric, whole-cell, electrochemical, impedimetric, and piezoelectric for the rapid detection of foodborne pathogens” which are applications for diagnosis of emerging tropical food-borne diseases. Examples of applications are shown in Table 2.4. An actual interesting application of nanotechnology for management of emerging and reemerging tropical food-borne disease is the nanosensor. The recent new sensor for determine of pathogen using magnetic relaxation switching and magnetic separation techniques proposed by Chen et al. (2015) is the best example. In fact, there are many new sensors created by nanoengineering technology (Willner et al., 2002; Zhang et al., 2009). The application can be seen in not only physical science but also medical science. 3. Application of GIS technology Geographical information system (GIS) is a useful computational geographical technique that can be widely applied in many activities, including medicine and public health. The GIS integrate the basic data with the map or presents the data via mapping technique. To use GIS in disease monitoring, surveillance and control is an actual advantage in public health. The US Local Health Department approved the use of GIS in management of food-borne illness (Ruiz and Remmert, 2004). Ruiz and Sharma (2016) noted that “the

50  Chapter 2 Table 2.4: Examples of applied nanotechnology for diagnosis of emerging food-borne diseases. Authors

Details

Burris et al. (2013)

Burris et al. (2013) developed a new “mega-nano detection of foodborne pathogens and transgenes using molecular beacon and semiconductor quantum dot technologies.” Burris et al. (2013) used “fluorescent resonance energy transfer (FRET), luminescent nanoscale semiconductor quantum dots, and nanoscale quenchers” in their diagnostic tool development. Wang et al. (2007) reported on using “fluorescent nanoparticles for multiplexed bacteria monitoring.” In this work, Wang et al. (2007) developed “a method for sensitive, multiplexed monitoring of bacterial pathogens within 30 min using multicolored FRET (fluorescence resonance energy transfer) silica NPs (nanoparticles).” The tool was approved for effectiveness in diagnosis of many problematic bacteria that can cause emerging food-borne disease (including Escherichia coli, Salmonella typhimurium, and Staphylococcus aureus). Yamada et al. (2014) reported the success of developing of a single-walled carbon nanotube-based junction biosensor for detection of E. coli. In this work, Yamada et al. used “a gold tungsten wires (50-µm diameter) coated with polyethylenimine (PEI) and SWCNTs aligned to form a crossbar junction, which was functionalized with streptavidin and biotinylated antibodies” as a main system for diagnosis.

Wang et al. (2007)

Yamada et al. (2014)

need for scientists engaged in spatial health analysis to first digitize basic data, such as maps of road networks, hydrological features, and land use, is a strong impediment to efficiency” of GIS. For emerging and reemerging tropical food-borne disease, the GIS technology can be very useful in disease management. Basically, the data from primary (survey) or secondary source (record) are used for generation of the representative map by GIS technique. The application of other relevant information such as geological, climate, clinical, or ethnic data can also be integrated into the system. Good examples of application of GIS technology for managing emerging and reemerging tropical foodborne disease are presented in Table 2.5. Most reports are attempts to map the available data to the local geographical map to enable public health workers to use the data for surveillance and planning for specific public health actions. The prediction of the situation can also be seen in some reports and this can be a clue for implementation of a method to counteract the possibility of the emergence of a problem in the future. It should be the role of the local public health center to search for a collective data, and have the GIS information for its specific location.

8  Further Important Issues Relating to Emerging Food-Borne Diseases Further important issues regarding food-borne diseases are offered in the following list. 1. Terrorism Terrorism causes major disruptions in our present-day world. Terrorist actions might include agro- and bioterrorism. To play safe, each country should establish a plan to

Important Emerging and Reemerging Tropical Food-Borne Diseases  51 Table 2.5: Examples of GIS technology for managing merging and reemerging tropical food-borne disease. Authors

Details

Akil and Ahmad (2016)

Akil and Ahmad (2016) used GIS technology for describing the situation of Salmonella infections modeling in Mississippi. Kaewpitoon et al. (2016) GIS reported the use of database and Google map of the population at risk of cholangiocarcinoma, a cancer that results from chronic liver fluke infestation, in an endemic area of Thailand. Newbold et al. (2013) reported on the use of GIS technology for exploring the relationship between food access and food-borne illness. Rujirakul et al. (2015a) reported on risk areas of liver flukes in Surin Province of Thailand determined by GIS technique. Rujirakul et al. (2015b) reported on risk areas of liver flukes in Surin Province of Thailand determined by GIS technique. The data in this report overlapped with the previously mentioned report by Rujirakul et al. (2015a). Wiwanitkit (2005) reported the observation on the correlation between rainfall and the prevalence of Trematode metacercaria in freshwater fish in Thailand, which can be seen by GIS study.

Kaewpitoon et al. (2016)

Newbold et al. (2013) Rujirakul et al. (2015a) Rujirakul et al. (2015b)

Wiwanitkit (2005)

GIS, Geographical information system.

2.

3.

4.

5.

counteract the terrorism (Food and Drug Administration, 2016). If food-borne disease is intentionally caused by terrorists, it becomes a serious public health problem, and security precautions must include the possibility of that unwanted event (Disaster Preparedness Advisory Council, 2016). Safety of organically grown and genetically modified foods Genetically modified foods pose problems that are garnering attention worldwide. The fear of mutagenesis due to GMO products may be overstated; however, GMO materials may become unwanted contaminants in food. Safety of nanomaterials in food In the era of “nano” at present, the contamination of possible hazardous nanomaterial in the food is an important consideration in public health and there is still no protocol to verify the safety and screening for contaminants. Nanotoxicity is a big consideration that needs further specific research for archieving the knowledge. Emergence of drug resistance Emergence of pathogen is the big problem and the emerging of drug resistance is usually the problem that comes after the emergence of infectious disease. Improper use of antibiotics can be expected. This can be the root cause of drug resistance and can result in causing great difficulty in disease management. Currently, the case of multidrug resistant tuberculosis is the best example. Methods and technology for rapid and accurate detection Finding new methods and technologies for rapid and accurate detection is needed. Finding the tool can be applied to the principles of laboratory medicine and the

52  Chapter 2 verification of efficacy, effectiveness, and utility of any tool is needed. In addition, concern regarding the availability of a tool is needed. In many situations, although there are many tools, the tools are not affordable for managing emerging problems. Finally, rapid response to a emerging problem after detection is needed, since we cannot anticipate or estimate the exact impact of that emergence (which can be very serious if it is a terrorist act). Falenski et al. (2015) suggested that a quick respond-and-action plan was needed for reducing the numbers of affected people in the case of detecting “contamination in the food chain.” Falenski et al. (2015) also note that the ability to predict the “fate of agents” in foods could be helpful for risk assessment and decision making. Decision makers can assess and predict the potential effects of a specific contamination and can further plan for a good measure for deduction of the problem in such situations (Falenski et al., 2015). 6. Drug and vaccine for management of disease Finding for new drugs and vaccines for management of disease is very important in management of any new emerging disease. With advanced biotechnology, discovery of new drugs and vaccines occur faster than in the past. To collaborate in fight food-borne disease requires sharing of information and support, especially from high-tech countries toward developing countries. 7. Strategies to destroy or control food-borne diseases The implementation of effective strategies to destroy or control food-borne disease is very important. Strict policies are needed and are an essential tool to manage the crisis in a community during an outbreak or emergence of disease. In addition, the strategies for the prevention and control of plant and animal diseases that impact food safety have to be regularly accessed for efficacy and adjusted to correspond to updated scenarios. Biosecurity is an important concern and the implication of regulatory guidelines to manage this issue is very important (Food and Drug Administration, 2016). 8. Human rights and disease control Human rights must be a big concern in disease control and management. How to maintain the human rights during fighting an emerging problem is usually an ethical dilemma. The role of medical ethicists in maintaining the equilibrium of privacy and public issues is needed.

9 Conclusions Emerging and reemerging tropical food-borne diseases are important problems to be managed. The diseases are usually problematic and widely affect the public health system. To have a good method to prevent and correct the problem is the basic requirement. The application of new technologies, such as omics science and nanotechnology in the management of emerging and reemerging tropical food-borne diseases show promise and should be promoted.

Important Emerging and Reemerging Tropical Food-Borne Diseases  53

References Abee, T., van Schaik, W., Siezen, R.J., 2004. Impact of genomics on microbial food safety. Trends Biotechnol. 22, 653–660. Akil, L., Ahmad, H.A., 2016. Salmonella infections modelling in Mississippi using neural network and geographical information system (GIS). BMJ Open 6, e009255. Aliabadi, N., Lopman, B.A., Parashar, U.D., Hall, A.J., 2015. Progress toward norovirus vaccines: considerations for further development and implementation in potential target populations. Expert. Rev. Vaccines 14, 1241–1253. Anantaphruti, M.T., 2001. Parasitic contaminants in food. SE Asian J. Trop. Med. Publ. Health 32 (Suppl. 2), 218–228. Arora, P., Sindhu, A., Dilbaghi, N., Chaudhury, A., 2011. Biosensors as innovative tools for the detection of food borne pathogens. Biosens. Bioelectron. 28, 1–12. Bonfini, L., Van den Bulcke, M.H., Mazzara, M., Ben, E., Patak, A., 2012. GMOMETHODS: the European Union database of reference methods for GMO analysis. J. AOAC. Int. 95, 1713–1719. Borges, V., Santos, A., Correia, C.B., Saraiva, M., Ménard, A., Vieira, L., Sampaio, D.A., Pinheiro, M., Gomes, J.P., Oleastro, M., 2015. Helicobacter pullorum isolated from fresh chicken meat: antibiotic resistance and genomic traits of an emerging foodborne pathogen. Appl. Environ. Microbiol. 81, 8155–8163. Brul, S., van Beilen, J., Caspers, M., O’Brien, A., de Koster, C., Oomes, S., Smelt, J., Kort, R., Ter Beek, A., 2011. Challenges and advances in systems biology analysis of Bacillus spore physiology; molecular differences between an extreme heat resistant spore forming Bacillus subtilis food isolate and a laboratory strain. Food Microbiol. 28, 221–227. Burris, K.P., Wu, T.C., Vasudev, M., Stroscio, M.A., Millwood, R.J., Stewart, Jr., C.N., 2013. Mega-nano detection of foodborne pathogens and transgenes using molecular beacon and semiconductor quantum dot technologies. IEEE Trans. Nanobiosci. 12, 233–238. Carrera, M., Gallardo, J.M., Pascual, S., González, Á.F., Medina, I., 2016. Protein biomarker discovery and fast monitoring for the identification and detection of Anisakis by parallel reaction monitoring (PRM) mass spectrometry. J. Proteom. 142, 130–137. Chaudhuri, R.R., Khan, A.M., Pallen, M.J., 2004. coliBASE: an online database for Escherichia coli, Shigella and Salmonella comparative genomics. Nucleic Acids Res. 32 (Database issue), D296–D299. Chen, Y., Xianyu, Y., Wang, Y., Zhang, X., Cha, R., Sun, J., Jiang, X., 2015. One-step detection of pathogens and viruses: combining magnetic relaxation switching and magnetic separation. ACS Nano. 9, 3184–3191. Dhama, K., Rajagunalan, S., Chakraborty, S., Verma, A.K., Kumar, A., Tiwari, R., Kapoor, S., 2013. Food-borne pathogens of animal origin: diagnosis, prevention, control and their zoonotic significance: a review. Pak. J. Biol. Sci. 16, 1076–1085. Disaster Preparedness Advisory Council, 2016. Medical countermeasures for children in public health emergencies, disasters, or terrorism. Pediatrics 137, e20154273. Dorny, P., Praet, N., Deckers, N., Gabriel, S., 2009. Emerging food-borne parasites. Vet. Parasitol. 163, 196–206. Falenski, A., Weiser, A.A., Thöns, C., Appel, B., Käsbohrer, A., Filter, M., 2015. Towards a food safety knowledge base applicable in crisis situations and beyond. Biomed. Res. Int. 2015, 830809. Feuerriegel, S., Schleusener, V., Beckert, P., Kohl, T.A., Miotto, P., Cirillo, D.M., Cabibbe, A.M., Niemann, S., Fellenberg, K., 2015. PhyResSE: a web tool delineating Mycobacterium tuberculosis antibiotic resistance and lineage from whole-genome sequencing data. J. Clin. Microbiol. 53, 908–914. Fleckenstein, J.M., Bartels, S.R., Drevets, P.D., Bronze, M.S., Drevets, D.A., 2010. Infectious agents of food- and water-borne illnesses. Am. J. Med. Sci. 340, 238–246. Food and Drug Administration, HHS, 2016. Mitigation strategies to protect food against intentional adulteration: final rule. Fed. Regist. 81, 34165–34223. Forbes, L.B., Parker, S., Scandret, W.B., 2003. Comparison of a modified digestion assay with trichinoscopy for the detection of Trichinella larvae in pork. J. Food Prot. 66, 1043–1046. Gallo, M., Ferranti, P., 2016. The evolution of analytical chemistry methods in foodomics. J. Chromatogr. A 1428, 3–15, 2016.

54  Chapter 2 Hammami, R., Zouhir, A., Le Lay, C., Ben Hamida, J., Fliss, I., 2010. BACTIBASE second release: a database and tool platform for bacteriocin characterization. BMC Microbiol. 10, 22. Hardy, M.E., 2009. Norwalk and “Norwalk-like viruses” in epidemic gastroenteritis. Clin. Lab. Med. 19, 675–690. Hunt, R.H., Camilleri, M., Crowe, S.E., El-Omar, E.M., Fox, J.G., Kuipers, E.J., Malfertheiner, P., McColl, K.E., Pritchard, D.M., Rugge, M., Sonnenberg, A., Sugano, K., Tack, J., 2015. The stomach in health and disease. Gut 64, 1650–1668. Ito, A., Budke, C.M., 2014. Culinary delights and travel? A review of zoonotic cestodiases and metacestodiases. Travel. Med. Infect. Dis. 12, 582–591. Kaewla, W., Wiwanitkit, V., 2015. A small outbreak of food poisoning among attendees of a public health thesis examination conference. Infect. Control. Hosp. Epidemiol. 36, 1250. Kaewpitoon, S.J., Rujirakul, R., Joosiri, A., Jantakate, S., Sangkudloa, A., Kaewthani, S., Chimplee, K., Khemplila, K., Kaewpitoon, N., 2016. GIS database and Google map of the population at risk of Cholangiocarcinoma in Mueang Yang District, Nakhon Ratchasima Province of Thailand. Asian Pac. J. Cancer Prev. 17, 1293–1297. Kahn, R.E., Morozov, I., Feldmann, H., Richt, J.A., 2012. 6th International Conference on Emerging Zoonoses. Zoonoses. Public. Health 59 (Suppl. 2), 2–31. Kirk, M.D., Pires, S.M., Black, R.E., Caipo, M., Crump, J.A., Devleesschauwer, B., Döpfer, D., Fazil, A., FischerWalker, C.L., Hald, T., Hall, A.J., Keddy, K.H., Lake, R.J., Lanata, C.F., Torgerson, P.R., Havelaar, A.H., Angulo, F.J., 2015. World Health Organization estimates of the global and regional disease burden of 22 foodborne bacterial, protozoal, and viral diseases, 2010: a data synthesis. PLoS Med. 12, e1001921. Kuiper, H.A., Paoletti, C., 2015. Food and feed safety assessment: the importance of proper sampling. J. AOAC. Int. 98, 252–258. Majowicz, S.E., Meyer, S.B., Kirkpatrick, S.I., Graham, J.L., Shaikh, A., Elliott, S.J., Minaker, L.M., Scott, S., Laird, B., 2016. Food, health, and complexity: towards a conceptual understanding to guide collaborative public health action. BMC Public Health 16, 487. Martinovic´, T., Andjelkovic´, U., Gajdošik, M.Š., Rešetar, D., Josic´, D., 2016. Foodborne pathogens and their toxins. J. Proteom., pii: S1874-3919(16)30150-6. Moreno Switt, A.I., Toledo, V., 2015. Infectious diseases in the genomic era. Rev. Chilena. Infectol. 32, 571–576. Narsaiah, K., Jha, S.N., Bhardwaj, R., Sharma, R., Kumar, R., 2012. Optical biosensors for food quality and safety assurance: a review. J. Food Sci. Technol. 49, 383–406. Newbold, B., Watson, S., Mackay, K., Isaacs, S., 2013. Exploring the relationship between food access and foodborne illness by using spatial analysis. J. Food Prot. 6, 1615–1620. Nyholm, O., Halkilahti, J., Wiklund, G., Okeke, U., Paulin, L., Auvinen, P., Haukka, K., Siitonen, A., 2015. Comparative genomics and characterization of hybrid Shigatoxigenic and Enterotoxigenic Escherichia coli (STEC/ETEC) strains. PLoS One 10, e0135936. O’Flaherty, S., Klaenhammer, T.R., 2011. The impact of omic technologies on the study of food microbes. Annu. Rev. Food Sci. Technol. 2, 353–371. Oyarzun, P., Ellis, J.J., Gonzalez-Galarza, F.F., Jones, A.R., Middleton, D., Boden, M., Kobe, B., 2015. A bioinformatics tool for epitope-based vaccine design that accounts for human ethnic diversity: application to emerging infectious diseases. Vaccine 33, 1267–1273. Pushpa, O.B., Suresh, M.X., 2012. SALMONELLABASE: an online database of druggable targets of Salmonella species. Bioinformation 8, 734–737. Putignani, L., Dallapiccola, B., 2016. Foodomics as part of the host-microbiota-exposome interplay. J. Proteom. 147, 3–20. Ruiz, M.O., Remmert, D., 2004. A local department of public health and the geospatial data infrastructure. J. Med. Syst. 28, 385–395. Ruiz, M.O., Sharma, A.K., 2016. Application of GIS in public health in India: a literature-based review, analysis, and recommendations. Indian J. Public Health 60, 51–58. Rujirakul, R., Ueng-arporn, N., Kaewpitoon, S.J., Loyd, R.A., Kaewthani, S., Kaewpitoon, N., 2015a. GIS-based spatial statistical analysis of risk areas for liver flukes in Surin Province of Thailand. Asian Pac. J. Cancer Prev. 16, 2323–2326.

Important Emerging and Reemerging Tropical Food-Borne Diseases  55 Rujirakul, R., Ueng-arporn, N., Kaewpitoon, S.J., Loyd, R.A., Kaewthani, S., Kaewpitoon, N., 2015b. Risk areas of liver flukes in Surin Province of Thailand using Geographic Information System. J. Med. Assoc. Thai 98 (Suppl. 4), S22–S26. Sillitoe, I., Lewis, T.E., Cuff, A., Das, S., Ashford, P., Dawson, N.L., Furnham, N., Laskowski, R.A., Lee, D., Lees, J.G., Lehtinen, S., Studer, R.A., Thornton, J., Orengo, C.A., 2015. CATH: comprehensive structural and functional annotations for genome sequences. Nucleic Acids Res. 43 (Database issue), D376–D381. Singer, R.S., Cox, Jr., L.A., Dickson, J.S., Hurd, H.S., Phillips, I., Miller, G.Y., 2007. Modeling the relationship between food animal health and human foodborne illness. Prev. Vet. Med. 79, 186–203. Singhal, N., Kumar, M., Kanaujia, P.K., Virdi, J.S., 2015. MALDI-TOF mass spectrometry: an emerging technology for microbial identification and diagnosis. Front. Microbiol. 5, 791, 6. Skinner, C.G., Thomas, J.D., Osterloh, J.D., 2010. Melamine toxicity. Med. Toxicol. 6, 50–55. Sridhar, S., Lau, S.K., Woo, P.C., 2015. Hepatitis E: a disease of reemerging importance. J. Formos. Med. Assoc. 114, 681–690. Torgerson, P.R., Devleesschauwer, B., Praet, N., Speybroeck, N., Willingham, A.L., Kasuga, F., Rokni, M.B., Zhou, X.N., Fèvre, E.M., Sripa, B., Gargouri, N., Fürst, T., Budke, C.M., Carabin, H., Kirk, M.D., Angulo, F.J., Havelaar, A., de Silva, N., 2015. World Health Organization estimates of the global and regional disease burden of 11 foodborne parasitic diseases, 2010: a data synthesis. PLoS Med. 12, e1001920. Vallverdú-Queralt, A., Lamuela-Raventós, R.M., 2016. Foodomics: a new tool to differentiate between organic and conventional foods. Electrophoresis 37, 1784–1794. Wang, L., Zhao, W., O’Donoghue, M.B., Tan, W., 2007. Fluorescent nanoparticles for multiplexed bacteria monitoring. Bioconjug. Chem. 18, 297–301. Wei, Y., Liu, D., 2012. Review of melamine scandal: still a long way ahead. Toxicol. Ind. Health 28, 579–582. Willner, I., Willner, B., Katz, E., 2002. Functional biosensor systems via surface-nanoengineering of electronic elements. J. Biotechnol. 82, 325–355. Wiwanitkit, V., 2005. The correlation between rainfall and the prevalence of Trematode metacercaria in freshwater fish in Thailand. Southeast Asian J. Trop. Med. Public Health 36 (Suppl. 4), 120–122. Wiwanitkit, V., 2008. Focus on Emerging Food-Borne Infections. Nova Science Publishers, New York, NY. Wiwanitkit, V., 2009. Melamine and Other Problematic Food Carcinogens. Nova Science Publishers, New York, NY. Wiwanitkit, V., 2013. Utilization of multiple “omics” studies in microbial pathogeny for microbiology insights. Asian Pac. J. Trop. Biomed. 3, 330–333. Wiwanitkit, S., Wiwanitkit, V., 2012. Urinary pH, melamine, and kidney stone formation. Urol. Ann. 4, 195. Wiwanitkit, S., Wiwanitkit, V., 2013. Solubility of melamine crystal in different pH conditions: clinical implication for management of melamine intoxication. Saudi J. Kidney Dis. Transpl. 24, 1019–1021. Xu, J., Kelly, R., Fang, H., Tong, W., 2010. ArrayTrack: a free FDA bioinformatics tool to support emerging biomedical research—an update. Hum. Genom. 4, 428–434. Yamada, K., Kim, C.T., Kim, J.H., Chung, J.H., Lee, H.G., Jun, S., 2014. Single-walled carbon nanotube-based junction biosensor for detection of Escherichia coli. PLoS One 9, e105767. Yoshida, C.E., Kruczkiewicz, P., Laing, C.R., Lingohr, E.J., Gannon, V.P., Nash, J.H., Taboada, E.N., 2016. The Salmonella in silico typing resource (SISTR): an open web-accessible tool for rapidly typing and subtyping draft Salmonella genome assemblies. PLoS One 11, e0147101. Yoshikura, H., 2014. Spanish flu, Asian flu, Hong Kong flu, and seasonal influenza in Japan under social and demographic influence: review and analysis using the two-population model. Jpn. J. Infect. Dis. 67, 245–257. Zhang, X., Guo, Q., Cui, D., 2009. Recent advances in nanotechnology applied to biosensors. Sensors (Basel) 9, 1033–1053.

Page left intentionally blank

CHAPTE R 3

Foodborne Pathogen–Produced Toxins and Their Signal Transduction Asit R. Ghosh Centre for Infectious Diseases & Control, VIT University, Vellore, Tamil Nadu, India

1 Introduction Food is the foundation of nutrition and an inevitable source of energy for all heterotrophic living systems. Food is a good vehicle to carry pathogens and causing diseases in host. Such pathogens are termed as foodborne pathogens. Foodborne pathogens are microbes of diverse origins. They may be viruses (rotavirus, norovirus, hepatitis A), bacteria (Salmonella, Escherichia coli, Campylobacter, Staphylococcus), fungi (Aspergillus, Penicillium, Gyromitra, Psilocybe), or algae (Microcystis, Anabaena, Oscillatoria). These are widely distributed in anthropocentric environment. Majority of these pathogens cause diseases in humans by producing a variety of toxins. All these toxins are mostly microbial metabolites with various chemical natures, structures, biosynthetic pathways, toxicity, and modes of action (Pandey and Singh, 2012; Proft, 2009). Foodborne pathogens and contaminated foods pose a global threat and are major challenges in the public health domain. Since the time of Robert Koch and his postulates in the 19th century, toxin-established microbial metabolites are regarded as the most virulent factors for pathogenicity. Among foodborne pathogens, bacteria, cyanobacteria, and fungi are major groups of toxin-producing (toxigenic) microbes. Toxins produced by bacteria are bacterial toxins, by fungus are mycotoxins, by cyanobacteria are cyanotoxins, and by algae are phycotoxins. Besides origin, these may be of several kinds as they affect cells or tissues or are produced from like enterotoxins, cytotoxins, neurotoxins, hemolysins, hepatotoxins, leukocidines, and many more. Chemically, microbial toxins mainly may be peptides, lipopeptides, glycopeptides, cyclic peptides, proteins, glycoproteins, lipoproteins, lipopolysaccharides (LPS), alkaloids, and organophosphates. Microbial toxins are a unique cluster of metabolites; those that have little consensus in common classification. However, classification of toxins based on mode of action can be useful in understanding the nature of toxin participating in pathogenicity. These could be (1) pore-forming toxins, (2) toxins affecting intracellular trafficking, (3) toxins affecting signal transduction, (4) toxin affecting protein synthesis, (5) toxins affecting cytoskeleton, (6) toxins blocking ion channels, or (7) Foodborne Diseases http://dx.doi.org/10.1016/B978-0-12-811444-5.00004-X

57

Copyright © 2018 Elsevier Inc. All rights reserved.

58  Chapter 3 toxins with enzymatic activity (Beddoe et al., 2010; Pandey and Singh, 2012; Proft, 2009). All kinds of toxins show a varied degree of lethality to the target cell(s), tissue(s), or organ(s), and that defines the potency of lethality or toxicity. The microbial strain that produces toxin is called toxigenic strain and the property defines its toxigenicity. Toxigenicity is a salient virulence property that governs its pathogenicity. Foodborne pathogens may pose the danger of spoilage of food and also bring about economic disaster. Food intoxication is another problem of food poisoning. The emergence of novel pathogens or reemergence of multidrug-resistant, mutant pathogens has been shown to increase the rate of morbidity and mortality in recent times (Kirk et al., 2015). Contaminated food consumption and associated infections are becoming common in many countries. Foodborne infections due to microbial contamination have been reported worldwide. An estimate of 250,000 hospitalizations and 3,000 deaths occurred among 46 million foodborne infections each year in the United States (Scallan et al., 2011). FoodNet—a wing of the Centers for Disease Control and Prevention (CDC)—identified 19,507 laboratory-confirmed cases with 4,476 hospitalizations and 75 deaths in 2014 (http://www.cdc.gov/foodnet/reports/ annual-reports-2014.html) due to foodborne illness. Besides the United States, foodborne diseases are very high in France, the United Kingdom, Japan, and Australia (Astridge et al., 2011; Kirk et al., 2015). However, there are fewer reliable facts and figures on foodborne diseases and poisoning or intoxication from less-privileged countries. Foodborne infection appears to be a mirror of socioeconomic status of states or countries of the world. Furthermore, this condition makes us aware of the status of food safety and also the strength of personal hygiene to combat foodborne infections. Foodborne infections that are caused by toxigenic microbes are numerous. Among these microbial toxins, those that target intracellular signaling and/or signal transduction are also very high. By studying their signaling pathways, it could be possible to combat toxinassociated disease consequences. Among foodborne pathogens, bacteria pose a major threat to public health (Ghosh et al., 1991; Kirk et al., 2015; Tauxe et al., 2010). Furthermore, some bacterial toxins alter the function of various cellular proteins without directly killing the target cell. Interestingly, several such toxins have the specific protein or protein-like molecules as cells of that human system that function to receive chemical signals (toxins) as receptors and thereby the respective interaction enables transmission of the molecular signal from the cell’s exterior to the interior with critical modification of cellular function called cell signaling or signal transduction (Beddoe et al., 2010). There are several bacterial toxins that induce enterocyte intracellular signaling, such as type I: cyclic adenosine monophosphate (cAMP), type II: cyclic guanosine monophosphate (cGMP), type III: calcium-dependent pathways, and type IV: nitric oxide (NO). Major toxins involved in such cell signaling are cholera toxin (CT) of Vibrio cholerae O1 and O139; heat-labile (LT) enterotoxin of enterotoxigenic E. coli (ETEC); thermostable direct hemolysin (TDH) of Vibrio parahaemolyticus; Clostridium difficile toxin (CD); enteroaggregative E. coli heat-stable toxin 1 (EAST1); and heat-stable a

Foodborne Pathogen–Produced Toxins and Their Signal Transduction  59 (STa) enterotoxin of ETEC involving cAMP, cGMP, Ca (calcium), and cytoskeleton via four major signaling pathways (Beddoe et al., 2010; Fasano, 2002; Pandey and Singh, 2012).

2  Foodborne Pathogens (Bacterial, Viral, Fungal, and Algal) Toxigenic foodborne pathogens are diverse and numerous. Major foodborne pathogens that are considered to be the cause of the high rate of morbidity and mortality in different geographic locations and targeting the signal transduction have been considered for discussion. A brief sketch of the major foodborne toxigenic pathogens is offered in this section.

2.1 Bacteria Major foodborne bacterial pathogens are: Salmonella, Shigella, toxigenic E. coli, Vibrio, Campylobacter, Yersinia, Staphylococcus, Streptococcus, Bacillus, and Clostridium (Kirk et al., 2015). 2.1.1  Salmonella Salmonellosis is a water- and foodborne infection caused by Salmonella spp. The salmonellae may serologically be subdivided into almost 2000 serotypes (Kauffmann, 1975) and may further be subdivided by phage typing. The species Salmonella enterica subspecies enterica is widely distributed, covering about 60% of all serovars and over 90% of infections in warm-blooded animals, including humans (FDA/CFSAN, 2008). The infection is usually spread from animal meat (pork and beef), fish, poultry, eggs, and tainted fruits and vegetables (the clinical picture may vary from asymptomatic carriage through mid or severe and febrile gastroenteritis to septicemia). The pathogenic mechanisms of these bacteria are not well understood, although the events of the infective process have been extensively studied and reviewed (Blaser and Newman, 1982; Wang et al., 2013). Due to the moderately large inoculums size, that is, 103–105 or more organisms necessary to produce disease in a healthy host, most causes of Salmonella gastroenteritis develop following the ingestion of contaminated food. The major reservoirs of human nontyphoid salmonellosis are poultry and domestic livestock, whereas the only important reservoir of the typhoid bacillus is human. The bacteria rapidly multiply in the lower parts of the small intestine, penetrate through the intestinal epithelium, and reach the lamina propria where they cause an inflammatory reaction and acute gastroenteritis. This is the usual event with nontyphoid Salmonella strains (Majowicz et al., 2010). If the organisms elicit mononuclear response, they may be carried into the systemic circulation through the portal system and cause enteric fever, toxemia, or localized suppuration (Pickering and DuPont, 1986). There is emerging evidence of the production of enterotoxin(s) by strains of Salmonella typhimurium (Sedlock et al., 1978).

60  Chapter 3 2.1.2  Shigella Shigellosis is caused by Shigella infection. Closely related to E. coli, Shigella with four different species can be further subtyped by serological and biochemical means into 50 subtypes (Edwards and Ewing, 1972). By virtue of their virulence property they may be divided into three groups: Shigella dysenteriae gives rise to the severest form of dysentery, whereas Shigella sonnei usually causes a mild disease, and Shigella flexneri and Shigella boydii form an intermediate group. The infective dose of Shigella is low; usually 101–102 bacteria are sufficient to cause disease, and therefore transmission of the disease by direct contact is likely to occur (Ghosh et al., 1990; Kirk et al., 2015). The course of shigellosis is extremely variable. Children tend to have mild infections, lasting not more than 1–3 days, but symptoms in adults persist for about 7 days (Ghosh and Sehgal, 1998c; Gorbach, 1987). Essentially, the pathogenesis involves the invasion of the colonic mucosa and destruction of epithelial cells with an inflammatory response, which causes abdominal pain, cramps, and watery or mucoid diarrhea with polymorphonuclear leukocytes and often blood. This is often preceded by a secretory reaction of the ileum (O’Brien and Holmes, 1987). S. dysenteriae type 1 has pandemic potentials with toxin production and results in small bowel secretory diarrhea and an acute bacterial colitis, resulting in at least two actions, one cytotoxic and the other secretory enterotoxic dysentery (Ram et al., 2008). 2.1.3  Escherichia coli During the first decade of this century, the bacterium E. coli was generally thought to be a harmless commensal residing within the intestinal tract (Taylor, 1961), although it was demonstrated that antiserum from an acute case of diarrhea agglutinated E. coli from other cases of the same epidemic, but not strains from nondiarrheal patients. Extensive research during the past 3 decades on water- and foodborne diseases has led to the recognition of several different groups with five major diarrheagenic E. coli, namely (1) the enteropathogenic E. coli (EPEC), (2) the enterotoxigenic E. coli (ETEC), (3) the enteroinvasive E. coli (EIEC), (4) the enterohemorrhagic E. coli (EHEC), and (5) the enteroadherent (EAEC) (Ghosh, 1990; Levine, 1987). 2.1.3.1 ETEC

In the study of the pathogenesis of cholera, the rabbit ileal loop test was first used by Violle and Crendiropopulo in 1915 and rediscovered by De and Chatterjie in 1953. The later workers evoked a secretory response in the rabbit ileum by injecting sterile culture filtrates into the ligated loops of the gut of anaesthetized animals, thereby demonstrating the diarrheagenic effect of exogenous product of V. cholerae O1 (De, 1959). In the late 1960s it was demonstrated that E. coli that caused diarrhea in piglets produced enterotoxin (Smith and Gyles, 1970). These strains of E. coli produce at least two different enterotoxins, either alone or both by individual strains. One is the low–molecular weight (∼2000 Da), nonimmunogenic, heat-stable enterotoxin (ST). More

Foodborne Pathogen–Produced Toxins and Their Signal Transduction  61 than one form of ST exist, namely STa or STI, which is methanol soluble and active in infant mouse, while STb or STII is methanol insoluble and active in older piglets and rabbits (Gross and Rowe, 1985). The other toxin is of high molecular weight (∼86,500 Da), immunologic, heat-labile enterotoxin (LT), which is structurally, functionally, and immunologically closely related to CT (Ghosh et al., 1996; Kunkel and Robertson, 1979; Raja et al., 2015). Both the toxins, LT and ST, are genetically encoded by transferable plasmids (Levine et al., 1983). Identification of LT and ST was originally done by the rabbit ileal loop and then infant mouse models, respectively. The Chinese hamster ovary (CHO) cell assay for LT belongs to a second generation of enterotoxin assay, followed by a number of pathophysiological and immunological assays (Fasano, 2002). 2.1.3.2 EHEC

The syndrome of hemorrhagic colitis (HC) was defined as a clinically distinct entity only about 3 decades ago (Sack, 1987). Although it may have features similar to bacterial dysenteries due to Shigella or Campylobacter, pseudomembranous enterocolitis due to C. difficile, ischemic colitis, and acute inflammatory bowel disease, HC is distinguished by a natural progression from watery to bloody diarrhea over the course of a few days and relative lack of the usual signs of inflammation, such as fever and large numbers of pus cells in the stool (Riley, 1987). The cause of the syndrome was unknown until 1982, when the occurrence of two separate outbreaks in the United Stated led to the discovery of a particular serotype of E. coli, O157:H7, as an etiologic agent (Riley, 1987) that did not belong to the recognized diarrheagenic strains of E. coli, and these newly discovered organisms were designated as EHEC. Blood diarrhea is the most common symptom of infection with E. coli O157:H7, which usually begins with severe abdominal cramps and watery diarrhea followed by grossly bloody stools, features that distinguish it from classic dysentery due to Shigella and EIEC. E. coli O157:H7 strains are not invasive like Shigella spp. and EIEC, but they produce high levels of phage-encoded potent cytotoxin active on HeLa and Vero cells, and have the same biologic properties as Shiga toxin (Stx) (Strockbine et al., 1986). One of these toxins, Shiga-like toxin 1 (SLT-1) or verotoxin 1 (VT-1), is apparently identical to the potent cytotoxin/neurotoxin/enterotoxin produced by S. dysenteriae type 1 (Stx) and reacts with and is neutralized by antibody to Stx. Many strains also elaborate a second potent cytotoxin, Shiga-like toxin 2 (SLT-2) (O’Brien and Holmes, 1987). Besides serotype O157:H7, at least one another serotype, belonging to O26:H11 is an abundant producer of VT (Levine, 1987). Stool toxin assay can be performed by conventional cell line assay (HeLa or Vero), by ELISA (against the toxin) (Kongmuang et al., 1987), by beads-ELISA (Oku et al., 1988), or by DNA probes (Scotland et al., 1988). 2.1.4 Vibrio Among traditional foodborne diarrhea-causing pathogens, V. cholerae O1 and O139 continue to cause special concern since the eighth pandemic of cholera, which began in 1961 (Ghosh et al., 1994). V. cholerae exerts its diarrheagenic effect by the chromosomally mediated

62  Chapter 3 enterotoxin (Baine et al., 1978), CT, which acts by activating the adenlyate cyclase system of the gut epithelial cells (Koley et al., 1995; Schafer et al., 1970). The marine halophilic V. parahaemolyticus was the most common cause of bacterial gastroenteritis in Japan, probably due to the Japanese habit of eating raw fish (sushi), but this occurred occasionally in other countries as well (Ghosh and Sehgal, 1998a; O’Brien et al., 1984). From the experimental data, it has been suggested that the thermostable direct hemolysin (TDH) is an important factor in causing gastroenteritis due to V. parahaemolyticus infection (Ghosh and Sehgal, 1998b). V. parahaemolyticus is also reported to be an important cause of traveler’s diarrhea (O’Brien et al., 1984). 2.1.5  Campylobacter It causes a disease called Campylobacter enteritis. Campylobacter as a significant cause of diarrhea was not appreciated until Butzler et al. (1973) isolated this bacterium from about 5% of patients with diarrhea in Belgium. The worldwide impact of Campylobacter enteritis has become evident after the work of Skirrow (1977), who demonstrated the selective culture of this thermotolerant organism. Campylobacter spp. causes disease in humans after oral ingestion of 1,000–10,000 organisms. It often causes foodborne illness (Kirk et al., 2015; Wilson et al., 2008). Many animals, such as poultry, pigs, sheep, and cattle, harbor Campylobacter. The common causative species is Campylobacter jejuni. This epizootic agent is particularly prevalent in young adults. Studies of patients with diarrhea in Europe, Africa, and North America have shown that Campylobacter organisms can be identified in stool specimen of 3%–8% of patients with diarrhea and in up to 2% of healthy persons. Day-care centers and family outbreaks of Campylobacter enteritis have been reported (Blaser et al., 1983). Some strains produce cholera-like toxin (Wassenaar, 1997) and may cause diarrhea, hemolytic uremic syndrome (HUS), and/or thrombotic thrombocytopenic purpura. Mainly the small intestine is affected. It usually causes an acute diarrheal illness that persists for several days with or without fever. The occurrence of mucus and blood in stool varied from 15% to 90% of patients with diarrhea. Campylobacter may enter the blood stream in some patients, producing septicemia during an episode of gastroenteritis (Ashkenazi and Pickering, 1989). 2.1.6  Yersinia Yersinia is a Gram-negative bacteria of the Enterobacteriaceae family that includes Yersinia enterocolitica, Yersinia pestis, and Yersinia pseudotuberculosis. It is a coccobacillary organism that was first reported as pathogenic for humans in New York State in 1933. It is an epizootic agent, worldwide in distribution, but different serotypes dominate different regions (Morris and Freeley, 1976). The organism invades the lymphatic tissue of the intestinal tract and the mesenteric lymph nodes. Strains of Y. enterocolitica have been shown to produce enterotoxin (Boyce et al., 1979). Its mechanism of action seems to be similar to that of E. coli ST in stimulating intestinal guanylate cyclase activity (Ashkenazi and Pickering, 1989).

Foodborne Pathogen–Produced Toxins and Their Signal Transduction  63 2.1.7  Laribacter Laribacter hongkongensis, an emerging foodborne pathogen, was discovered in 2001. L. hongkongensis, a seagull-shaped, Gram-negative bacillus, belongs to Neisseriaceae of Beta subclass of Proteobacteria. It is a nonfermentative facultative anaerobe and produces enzymes, such as catalase, oxidase, urease, and arginine dihydrolase, with nitrate-reducing capability. Due to acid and urease resistance properties, it survives and adheres to the human intestine and possesses a bile salt efflux pump. Display of several virulence factors enables it to autoaggregate, form biofilms, invade, and have cytotoxic properties, and produce collagenases, cytotoxins, hemolysins, repeats in toxin, LPS, patatin-like proteins, and phospholipase A1, which enhance its pathogenicity (Raja and Ghosh, 2014a,b). 2.1.8  Staphylococcus The common species of Staphylococcus that causes food poisoning is Staphylococcus aureus. It produces a large number of proteins of 22–28 kDa molecular weights and causes many diseases, including food poisoning. However, enterotoxin A (SEA-SEE, SEG-SEI, and SER-SET), the toxin protein produced by S. aureus is the cause of virulence for common food poisoning, which leads to nausea, violent vomiting, severe abdominal cramps, with or without diarrhea (Nema et al., 2007). It is heat (100°C for few minutes) and proteolytic enzymes (trypsin, rennin) resistant; single-chain, low–molecular weight proteins; and a superantigen. These possess all kinds of genetic elements, including plasmid, prophage, pathogenicity islands, and genomic islands. Food poisoning is caused due to consumption of preformed toxins via contaminated food (mainly meat, poultry, salad, dairy, and bakery based) (Argudín et al., 2010). 2.1.9  Streptococcus Group A Streptococcus is a major cause of food poisoning among streptococci. It mainly occurs with and is transmitted by food handlers. Contamination includes both pasteurized and raw milk, eggs, egg salad, creams, ice cream, rice pudding, raw and cooked meat, and seafoods (FDA, 2012). It may cause infection with less than 1000 organisms, with associated symptoms, such as sore throat, pharyngitis, headache, nausea, vomiting, and high fever. Group A Streptococcus pyogenes secrete a family of pyrogenic toxins (SpeA and SpeC). 2.1.10  Bacillus Bacillus cereus is a Gram-positive bacillus and causes food poisoning. It is a spore-forming, motile aerobic soil bacterium, and is transmitted through soil and vegetables. B. cereus causes food poisoning by the production of two different types of toxins: emetic toxin and enterotoxins. The toxin that causes nausea and vomiting is the emetic toxin, called cerelide (molecular weight of 1.2 kDa), which is produced while bacteria grow. B. cereus produces three different enterotoxins that result in diarrhea. Spores are cooking resistant; however, on

64  Chapter 3 ingestion, B. cereus grows in the small intestine and produces enterotoxins (Beecher, 1997; Lund and Granum, 1997). Only two of three enterotoxins cause food poisoning, having molecular weight of about 57 and 100 kDa (Lund and Granum, 1997; Stenfors et al., 2008). 2.1.11  Clostridium Clostridium perfringens is an anaerobic, Gram-positive, spore-bearing rod and is usually distributed in soil, sewage, and in intestines of humans and animals. More than 13 toxins have been reported, of which C. perfringens enterotoxin (CPE) is responsible for food poisoning outbreaks (Milton et al., 2005). Ingestion of food contaminated with 108 bacterial cells causes food poisoning. Contamination is mostly associated with meat and poultry products. Symptoms include diarrhea, vomiting, and abdominal pain. CPE is mainly produced by sporulation and is accumulated in a large inclusion body of the bacterium. It is a lethal toxin of α-, β-, ε-, and ι-toxin types. Clostridium botulinum is also well-known for food poisoning. The toxin produced by C. botulinum is the most potent naturally occurring neurotoxin, known as botulinum toxin (BoNT). The intoxication with BoNT is called botulism. Foodborne botulism is one of four different types of intoxications known to occur due to ingestion of food containing preformed toxin. Besides, there are seven different immunologically distinct types of BoNT (types A–G). BoNT is of 150-kDa, single-chain polypeptide, which on proteolytic cleavage produces two chains linked by a single disulphide bond (Kukreja and Singh, 2009).

2.2 Rotavirus The rotavirus is a 70-nm particle, containing double-stranded RNA as genomic material and has an outer capsid but no envelope, which was first identified by Bishop et al. (1973). Human rotavirus is a major cause of infantile gastroenteritis. There may be at least eight species (A, B, C, D, E, F, G, and H). However, rotavirus A is the most common cause of more than 90% of infections among children younger than 5 years and is transmitted mainly by fecal–oral route. In infants, rotavirus gastroenteritis may result in severe dehydration and deaths of more than 450,000 children globally every year (Tate et al., 2012). Infection leads to malabsorption due to the destruction of enterocytes and damages of secretion of the brush border membrane disaccharidases. The enterotoxic viral protein nonstructural protein 4 (NSP4 of 20 kDa) is found to play a pivotal role in gastroenteritis, disrupts sodium glucose–linked transporter 1 (SGLT1)–mediated water reabsorption, and activates calciumdependent secretory reflexes involving the enteric nervous system (Hyser and Estes, 2009). It is reported that the viral infections can stimulate enterochromaffin cells (sensory cells) lying on the side of the gastrointestinal tract and thus communicate with the brain by the vagus nerve to eventuate vomiting with the revelation of the fact that viral toxin induces gut cells to release serotonin (5-hydroxytryptamine), a monoamine neurotransmitter (Hagbom et al., 2011).

Foodborne Pathogen–Produced Toxins and Their Signal Transduction  65

2.3 Mycotoxins Fungal toxins are secondary metabolites that can cause several diseases in humans called mycoses in general, while dietary exposure to such metabolites produce the disease called mycotoxicoses. Mycotoxins are generally of low molecular weight and are natural contaminants of foods. Among major mycotoxins, aflatoxins (produced by Aspergillus flavus, indirect source of contaminants in milk products) (Manabe, 2001), citrinin (produced by Penicillium citrinum, common contaminant among cereals, such as wheat, oats, rye, corn, barley, and rice), ochratoxin (produced by Aspergillus spp., associated with cereals), and many more are food and food-associated contaminants known to cause human diseases (such as hepatotoxicity, nephrotoxicity, carcinogenicity, etc.) upon ingestion (Stoev, 2015).

2.4 Cyanotoxins The oldest known Gram-negative, photosynthetic, earthly prokaryotic organisms, cyanobacteria (blue-green algae), produce a wide range of bioactive compounds (cyanotoxins) having deleterious effects on diverse life forms, including humans (Ratha and Adhikary, 2006). Cyanotoxins are reported to enter the food chain as fish and birds ingest algal bloom or through water system (drinking and recreational) (Codd et al., 2005), causing a wide range of symptoms, such as skin irritation, stomach cramps, vomiting, nausea, diarrhea, fever, muscle pain, blisters of the mouth, and liver damage. Organisms responsible for cyanotoxin production include 40 genera, including Anabaena (anatoxin a and homoanatoxin a), Mycrocystis (mycrocystins), Nodularia (nodularins), Lyngbya (saxitoxins, lyngbyatoxin, and aplysiatoxin) (Codd et al., 2005). Cyanotoxins chemically belong to three groups: cyclic peptides, alkaloids, and LPS, and may be toxins of five different types (hepatotoxins, neurotoxins, cytotoxins, dermatotoxins, and irritant toxins), causing different biological effects in humans (Chorus et al., 2000). Potent cyanotoxins may be used biotechnologically to retrieve positive results. Anatoxin-a mimics acetyl choline and is used in the treatment of myasthenia gravis and in many other applications, and hepatotoxins (mycrocystins) are used to understand the cellular scaffolding (Chorus et al., 2000).

3  Toxins That Target Signal Transduction Most of the ingested enteropathogenic bacteria do not survive the highly acidic conditions of the human stomach (Fasano, 2002; Lemichez and Barbieri, 2013). The few bacteria that do survive conserve their energy and stored nutrients during the passage through the stomach by shutting down protein production. The thick mucus lining in the small intestine enables survived V. cholerae to propel forward and adhere to the intestinal wall through

66  Chapter 3 the production of a hollow cylindrical protein, flagellin. The bacteria do not produce flagellin until they reach the destination and conserve energy and nutrients. However, some nonmotile enteropathogens (Shigella sp.) have mechanisms of production of nonstructural proteins, such as adhesin, hemagglutinin, and so forth. On reaching the intestinal wall, most pathogens start producing the toxic proteins (enterotoxins); these give the infected person watery diarrhea. Foodborne bacterial pathogens execute their pathogenicity through several toxin proteins, which may be single protein or oligomeric protein complexes with distinct AB structure– function properties (Ghosh, 2012; Granum, 2006; Lemichez and Barbieri, 2013). Such toxins behave like enzymes, sensitive to heat and acid and act catalytically with substrate specific action. A subunit of AB complex functions as an enzyme, while B subunit binds to the cell surface receptor. Organizational arrangement of A and B subunits may be of several forms: A + B type (two subunits are synthesized, elaborated, and interact separately on the target cell surface), A–B or AB5 type (subunits are synthesized separately but remain associated together by noncovalent bond during secretion and interact at the target cell surface; here B subunit is a pentamer), or A/B type (synthesized as a single polypeptide and is cleaved enzymatically), or subAB type (subtilase cytotoxin). The B subunits binding to specific receptor on target cells/tissues are generally sialogangliosides (glycoproteins), often called G-proteins on cell membrane. Ganglioside GM1 is the receptor for CT, LT, while Stx binds to globotriaosylceramide (Gb). Major bacterial toxin is a holotoxin with a composition of AB5 configuration where B5 binds to the respective glycan receptor(s) in the gastrointestinal tract and A subunit, then activates the cell signaling cascades, which eventuate the pathophysiological changes in hosts, causing the disease. This structure is common among toxins produced by foodborne bacterial pathogens. As these toxins modulate the cellular activity of enterocytes, they are termed enterotoxins, a part of bacterial exotoxins. These are very unique weapons of bacterial pathogens (virulence factors), which kill a great number of people every year (Beddoe et al., 2010). The AB5 configuration is apparently unique and is ubiquitously present among foodborne pathogens, such as strains of V. cholera O1 and O139 (CT), strains of ETEC (LT), strains of S. dysenteriae type 1 (Stx), and subtilase cytotoxin (subAB) produced by strains of Stx-producing E. coli (Paton et al., 2006). They are further classified into three groups on the basis of the catalytic activity of A subunit and sequence homology. The A subunits of CT and LT catalyze the ADP-ribosylation of Gsα and Giα proteins in the host cell cytosol and thereby disrupt the signal transduction pathways, while A subunit of Stx activates RNA N-glycosidase activity and inhibits eukaryotic protein synthesis by cleaving a specific adenine base from 28S rRNA. A subunit of subAB is a subtilase-like serine protease that cleaves the endoplasmic reticulum (ER) chaperone binding immunoglobulin protein/glucose-regulated protein 78 (BiP/GRP78) and induce massive ER stress response, causing cellular apoptosis (Paton et al., 2006).

Foodborne Pathogen–Produced Toxins and Their Signal Transduction  67 CtxB and StxB, the B subunit of Ctx and Stx families, bind glycans displayed by host glycolipids, such as GM1 gangliosides, and Gb3 and Gb4 glycosphingolipids respectively, such as Gb3 and Gb4 ((Beddoe et al., 2010). Similar to CtxB and StxB, the B subunit of SubAB (SubB5) binds to glycoproteins, but differently. SubB binds glycans terminating in N-glycolylneuraminic acid (Neu5Gc), a sialic acid. Although humans cannot produce it due to a deletion mutation in the cytidine monophosphate-N-acetylneuraminic acid hydroxylaselike protein (cmah) gene, dietary supplement with Neu5Gc enables the expression of receptors on the cell surface, thereby conferring susceptibility to the lethal effects of SubAB (Byres et al., 2008). S. typhimurium and some other salmonellae show sequence homology (>51%) of their produced toxin with the pertussis toxin (Ptx), similar to the CT group. The putative toxin of S. typhimurium is called ADP-ribosylating toxin (ArtAB) (Beddoe et al., 2010; Wang et al., 2013). The action of enterotoxins leads to increased chloride ion permeability of the apical membrane of intestinal mucosal cells. These membrane pores are activated by either increased cAMP or by increased calcium ion concentration intracellularly. The pore formation has a direct effect on the osmolarity of the luminal contents of the intestines. Increased chloride permeability leads to leakage into the lumen followed by sodium and water movement. This leads to a secretory diarrhea within a few hours of producing or ingesting enterotoxins. Several microbial organisms contain the necessary enterotoxin to create such an effect, such as CT or ETEC-LT and ETEC-ST (Ghosh et al., 1996). Fig. 3.1 demonstrates the cascade of reactions by bacterial enterotoxins that cause diarrhea.

Figure 3.1: Cascades of Enterotoxin [Cholera Toxin (CT), Heat-Labile Enterotoxin (LT), and Heat-Stable Enterotoxin of Enterotoxigenic E. coli (ST)]-Induced Signal Transduction That Cause Diarrhea due to the Ingestion of Contaminated Food With Some Enterotoxigenic Bacteria.

68  Chapter 3

3.1  Cholera Toxin and ETEC Heat-Labile Toxin Structurally, the CT is an oligomer of six proteins with two subunits: subunit A (monomer) and subunit B (pentamer). Both subunits are connected by a disulfide bond. X-ray crystallography of the holotoxin reveals its three-dimensional structure (Zhang et al., 1995). Each of five B subunits is of 12 kDa and forms a five-membered ring. Subunit A has two segments: A1 is a globular enzyme that carries the ADP-ribosylating G-proteins, while A2 is an α-helical chain that seats in the central pore of the B subunit ring (De Haan and Hirst, 2004). A variant of lysogenic bacteriophage called CTXf or CTXφ (Davis and Waldor, 2003) encodes the CT, which was introduced into V. cholerae by horizontal gene transfer. Virulent strains of V. cholerae carry a variant of lysogenic bacteriophage called CTXf or CTXφ (Davis and Waldor, 2003). CT is similar by its structure, mechanism, sequence, and immunology to LT enterotoxin secreted by some strains of ETEC (Faruque and Nair, 2008). On secretion, the B subunit binds to receptor GM1 gangliosides on the intestinal surface and the toxin is internalized. The A1 chain is later released by the reduction of a disulfide bridge. Free A1 then binds to a protein called ADP-ribosylation factor 6 (Arf6) (O’Neal et al., 2005); binding to Arf6 drives a change in the conformation of CTA1, which exposes its active site and enables its catalytic activity. The CTA1 fragment catalyzes ADP ribosylation from NAD to the regulatory component of adenylate cyclase, thereby activating it. Increased adenylate cyclase activity increases cAMP synthesis, causing massive fluid and electrolyte efflux and secretion of H2O, Na+, K+, Cl–, and HCO3− into small intestine, resulting in secretory diarrhea (Faruque and Nair, 2008).

3.2  Shiga Toxins Stxs are a family of related toxins with two major groups, Stx1 and Stx2, whose genes are considered to be part of the genome of lambdoid prophages. The most common sources for Stx are S. dysenteriae and the shigatoxigenic group of E. coli, which includes serotype O157:H7 and other EHEC (Asakura et al., 2001; Rendón et al., 2007). Stx has many terms and these are often used interchangeably: (1) Stx is true Shiga toxin and is produced by S. dysenteriae type 1; (2) Shiga-like toxins 1 and 2 (SLT-1 and -2 or Stx-1 and -2) are the Stxs produced by some E. coli strains (O157:H7; O104:H4): Stx-1 differs from Stx by only 1 amino acid and Stx-2 shares 56% sequence homology with Stx-1; (3) Cytotoxins are used in a broad sense for Stx; and (4) verocytotoxins is term rarely used for Stx, which bring cytopathic effects on Vero cells (Pavithra and Ghosh, 2013). The toxin has two subunits—A and B—and is one of the AB5 toxins. The B subunit is a pentamer that binds to specific glycolipids on the host cell, specifically Gb3. Following this, the A subunit is internalized and cleaved into two parts. The A1 component then binds to the

Foodborne Pathogen–Produced Toxins and Their Signal Transduction  69 ribosome, disrupting protein synthesis. Stx-2 has been found to be approximately 400 times more toxic (as quantified by LD50 in mice) than Stx-1 (Sandvig and van Deurs, 2000). Gb3 is, for unknown reasons, present in greater amounts in renal epithelial tissues, to which the renal toxicity of Stx may be attributed. Gb3 is also found in CNS neurons and endothelium, which may lead to neurotoxicity (Obata et al., 2008). Stxs act to inhibit protein synthesis within target cells by a mechanism similar to that of ricin toxin produced by Ricinus communis. After entering a cell, the protein functions as an N-glycosidase, cleaving several adenine nucleobases from the RNA that comprises the ribosome, thereby halting protein synthesis (Obata et al., 2008; Sandvig and van Deurs, 2000).

3.3  ETEC Heat-Stable Enterotoxin Heat-stable enterotoxin of ETEC causes fluid accumulation in test animals (suckling mouse assay) (Giannella, 1979) and diarrhea among travelers, children, and cattle, and has two subfamilies, STa and STb. They may be STh (human origin) and STp (porcine) with an approximately 18 amino acid peptide. It has an N-terminal α-helix and a centrally located type Iβ turn with type IIβ turn at the C-terminal. STa binds guanylate cyclase C (guanylin) of the intestine and colon of humans and activates protein kinase G and protein kinase C, increasing IP3-mediated calcium to elevate intracellular cGMP, which eventuates phosphorylation to activate Cl– ion channel, CFTR, and increases Cl– ion in the intracellular space, which results in fluid accumulation or diarrhea (Henkel et al., 2010).

3.4 Superantigens Protein toxins produced by a large number of foodborne bacterial pathogens, such as S. aureus, Streptococcus spp., Y. pseudotuberculosis, and accountable for food poisoning and toxic shock syndrome are called superantigens. In general, they bind major histocompatibility complex II (MHC II) of antigen-processing cells and activate T cells via peptide-independent MHC II/T-cell receptor interaction and subsequently immune reactions. Staphylococcal and streptococcal superantigens bind the MHC IIα chain through the oligonucleotide/oligosaccharide binding (OB) fold without interacting with the peptide (Nielsen et al., 1998).

4  Signal Transduction Signal transduction is an essential mechanism for cellular communication. To a eukaryotic cell, signals received from outside stimulate receptors on the cell surface and are subsequently transmitted across the cell membrane by several known mechanisms. In general, signal transduction pathways involve a series of steps where signals on a

70  Chapter 3 cell surface are converted into a specific cellular response. The protein or protein-like biomolecule that initiates the biochemical reaction by receiving the signal is a receptor. Receptors, such as cell surface receptors, remain embedded in the plasma membrane, cytoplasmic receptors in cytoplasm, and nuclear receptors in the nucleus. Functionally, there are four general classes of signal-transducing receptors in human system: (1) receptors that are coupled to G-proteins (7-pass transmembrane proteins) inside the cell, (2) receptors that penetrate plasma membrane and have intrinsic enzymatic activity or are enzyme linked, (3) receptors that intracellularly bind to ligand and directly alter gene transcription (nuclear receptors), and (4) ligand-gated ion channels. In this discussion microbial toxin is the signal or ligand, whereas receptors are cell associated. Signal transduction pathways are simplified by the sequential process of reception → transduction → cellular response.

4.1  Toxins Induce Enterocyte Intracellular Signaling Enterocyte intracellular signaling induces intestinal secretion of water and electrolytes involving four major pathways: cAMP, cGMP, Ca, and cytoskeleton, respectively (Table 3.1). Biomolecules that induce these signaling pathways are CT, LT, TDH, CD, EAST1, STa, adenylate cyclase, guanylate cyclase, calmodulin, protein kinase C, zonula occludens toxin, epidermal growth factor receptor, and extracellular matrix (Table 3.2). Table 3.1: Toxins that activate enterocyte signal pathways. Type I: cAMP  CT Vibrio cholerae O1 and O139   E. coli LT   Salmonella enterotoxin   C. jejuni enterotoxin   S. dysenteriae enterotoxin Type II: cGMP   E. coli ST   Y. enterocolitica STI and STII enterotoxins   Yersinia bercovieri enterotoxin  Heat-stable V. cholerae non-O1 enterotoxin  EAST1 Type III: Calcium-dependent pathways   C. difficile enterotoxin   Ciguatera enterotoxin   Cryptosporidium enterotoxin   Helicobacter pylori vacuolating toxin   V. parahaemolyticus TDH Type IV: NO   Shigella flexneri 2a ShET1 cAMP, Cyclic adenosine monophosphate, cGMP, cyclic guanine monophosphate; EAST1, enteroaggregative E. coli heat-stable enterotoxin; NO, nitric oxide; ShET1, Shigella enterotoxin 1; TDH, thermostable direct hemolysin.

Table 3.2: Mechanisms of action of some enterotoxins that induce signal transduction to cause diarrhea. Toxins

Modes of Action

Targets

Biological Effects

Diseases

G-proteins: Gs, Gi,Golf Guanylate cyclase receptor DNA

Increase in cAMP Increase in cGMP

Diarrhea Diarrhea

Blockage of G2/M (cell cycle)

Diarrhea

EAST Toxin A

ADP-ribosyltransferase Stimulates guanylate cyclase DNAse (?) activating PI3 kinase ST-like Glucosyltransferase

Toxin B

Glucosyltransferase

Rho/Ras GTPases

Toxin C2

ADP-ribosyltransferase

Actin

Toxin C3

ADP-ribosyltransferase

Rho

BoNTs

Metalloproteases

CT (AB5)

ADP-ribosyltransferase

VAMP/synaptobrevin, SNAP-25 G-protein(s): Gs, Gi, Golf

Stxs (A/B5)

N-glycosidase

Ribosomal RNA

Activate second messenger pathway ETEC LT (AB5) E. coli ETEC ST CLDT

C. difficile

C. botulinum

V. cholerae Inhibit protein synthesis E. coli O157:H7 (EHEC)/ S. dysenteriae type 1

Unknown Rho/Ras GTPases

Breakdown of cytoskeletal structure Breakdown of cytoskeletal structure Failure in actin polymerization Breakdown of actin stress fibers

Increase in cAMP Inhibition of protein synthesis by enzymatic cleavage of 28S rRNA

Diarrhea Diarrhea Diarrhea Botulism Botulism Flaccid paralysis Cholera Diarrhea, HC, and HUS

BoNTs, Botulinum toxins; EHEC, enterohemorrhagic E. coli; ETEC, enterotoxigenic E. coli; HC, hemorrhagic colitis; HUS, hemolytic uremic syndrome; Stx, Shiga toxin.

Foodborne Pathogen–Produced Toxins and Their Signal Transduction  71

Sites of Action/ Organisms

72  Chapter 3 4.1.1  Type I: cyclic adenosine monophosphate Several foodborne enteropathogens activate cAMP/adenylate cyclase pathway (Table 3.1). However, the prototype toxins are CT and LT. However, while LT induces mild diarrhea, known as traveler’s diarrhea, CT is responsible for the severe, sometimes fatal, clinical condition typical of cholera. The differential toxicity of LT and CT is due to the presence of 10 more amino acid segments within the A2 fragment of CT, which also provides stability to CT as a holotoxin (Fasano, 2002). After entering into the enterocyte, CT translocates through Golgi apparatus to ER, after fusion with the Golgi apparatus. However, on activation, CTA1 acts on adenylate cyclase, which results in cAMP production. It in turn activates protein kinase A, which phosphorylates cystic fibrosis transmembrane regulator (CFTR) and secrets chloride ion (Cl–) (Viswanathan et al., 2009) (Fig. 3.1). 4.1.2  Type II: cyclic guanosine monophosphate Like adenylate cyclase, guanylate cyclase is activated by nonimmunogenic, small peptide enterotoxins that are heat stable in nature, called ST (STs, swine; STp, pig; STh, human) from ETEC, which cause an increased intracellular concentration of cGMP and evoke chloride of cGMP, which lead to chloride secretion and diarrhea (Fasano, 2002). STIp is a typical extracellular toxin consisting of 18 amino acid residues synthesized as a precursor protein. In addition to LT and ST exotoxins, LPS of ETEC acts as an endotoxin, which has been demonstrated to enhance the expression of the inducible nitric oxide synthase II (NOS II) and its effector enzyme soluble guanylate cyclase in colonic cells when LPS was orally administered to mice (Closs et al., 1998). This leads to hypersecretion and diarrhea (Closs et al., 1998). Another heat-stable enterotoxin (EAST1), genetically and structurally distinct from ST, was originally discovered in enteroaggregative E. coli and subsequently found in other diarrheogenic E. coli. The latest described member of the ST family has been reported from Y. bercovieri; however, it was genetically and immunologically distinct from Y. enterocolitica STI, STII, and other known enterotoxins (Sulakvelidze et al., 1999). 4.1.3  Type III: calcium-dependent pathways Several toxins, including C. difficile toxin, Cryptosporidium toxin, and the H. pylori vacuolating toxin seem to act through Ca (Table 3.1). In this pathway, enterotoxins increase the concentration of cytosolic calcium. Raimondi et al. (1995) demonstrated the enterotoxic effect of TDH elaborated by V. parahaemolyticus using direct measurement of calcium. Recently, Raghunath (2014) has shown that TDH involves both type III and type VI secretion systems. This toxin possibly interacts with a polysialoganglioside GT1b surface receptor in the intestine, whose physiological function remains to be established (Fasano, 2002; Raghunath, 2014).

Foodborne Pathogen–Produced Toxins and Their Signal Transduction  73 4.1.4  Type IV: nitric oxide The role of NO in intestinal fluid and electrolyte balance varies according to the pathophysiological conditions that activate this pathway. Under physiological circumstances, NO exerts a proabsorptive effect that involves the enteric nervous system (Izzo et al., 1998). However, high NO production has been shown to contribute to diarrhea in both animal models and humans (Fasano, 2002).

5  Recent Developments It is apparent that there is a need to bridge the gap in our knowledge regarding foodborne microbial toxin–associated pathology. Some areas for future research should include the following: (1) identifying all microbes and their toxins that induce illness; (2) classifying these toxins, based on their structural and functional properties; (3) characterizing the action of these toxins on each transport pathway in both luminal and basolateral regions; (4) discerning the binding of the toxin to the transport pathway and/or to a receptor that releases a second messenger regulating the transport pathway; (5) further characterizing the structural– functional properties of the channels formed by diarrhea-induced toxins; (6) adoption of a bioinformatics approach to find new inhibitors, effectors, and designed drug/common vaccine candidates; (7) improved socioeconomy, personal health and hygiene, sanitation, potability of water, and understanding of the environmental niches of pathogens; (8) understanding the strategic occurrence of indigenous microbes and their pathogenic counterparts; and (9) establishing effective and alternative role of probiotics in the control of foodborne illnesses. Besides understanding cell biological events caused by several toxins of diverse sources that cause a worrying rate of morbidity and mortality, biotechnological approaches are in place to constructively use these toxins. The immunomodulatory roles of these toxins (e.g., AB toxins) can lead to use in diagnosis (Sharma et al., 2015), in vaccine development (Faruque and Nair, 2008; WHO, 2008), and in dehydration management (Guerrant et al., 2003). The AB5 toxins (CT, LT, and Stx) are responsible for over a million deaths annually. The receptor for CT and LT is ganglioside GM1.The structure of CTB pentamer complexed with the complete GM1 pentasaccharide may give a view of the toxin:receptor binding mode at a molecular level. Structure-guided synthesis and combinatorial chemistry may enhance the understanding of the mechanisms, leading to the design of new drugs. Beyond these, attributes, such as the target specific catalytic properties, binding specificities, and their intercellular trafficking abilities, are of immense importance for their implementation in cellular modulation, including cancer treatments (Beddoe et al., 2010). High glycan (Gb3 or CD77)-binding ability of B (StxB) subunits of AB5 enterotoxins may be useful in cancer treatment, as it is expressed by a wide range of cancer cells of pancreas, colon, ovary, breast, testis, myelomas, lymphomas, and meningiomas, respectively (Beddoe et al., 2010). SubAB toxin also demonstrates its anticancerous ability. Hence, we believe the trend in research

74  Chapter 3 on toxins of foodborne origin will bring about new strategies in diagnosis, control, and prevention of several diseases in the near future.

6 Conclusions When the author began to write this chapter, the phrase “toxin and signal transduction” appeared in 22,326 publications in PubMed by April 28, 2016, which gave an indication of the importance of this study component. It is interesting to note that foodborne bacterial toxins are precisely and accurately designed to target human cells to eventuate pathophysiological changes leading to diseases (Schiavo and van der Goot, 2001). In fact, several schools of thoughts so far address inexplicable questions exploring coevolution, cooperation, and conflict in the host–microbe interface. Bacterial members in particular are specific in selection of targets and executing the cellular modulation of the host. Signal transduction is the result of such interactions . Food is humans’ source of energy and an easy vehicle for transportation of microbial contaminants (producers/products) with toxin-producing ability. Microbial metabolites and toxins enter the human system and demonstrate their cell biological activities by several communication systems, including signal transduction, and cause illness in humans. The other side of the toxin–cell interactions offers opportunities for wide exploration of drug targets and/or therapeutic implementation in control and diagnosis of several other diseases, including cancer. It is speculated that there could be a change, from battling against these toxins for their deleterious effects on public health, to enlisting their qualities in new avenues toward good health.

References Argudín, M.A., Mendoza, M.C., Rodicio, M.R., 2010. Food poisoning and Staphylococcus aureus enterotoxins. Toxins 2, 1751–1773. Asakura, H., Makino, S., Kobori, H., Watarai, M., Shirahata, T., Ikeda, T., Takeshi, K., 2001. Phylogenetic diversity and similarity of active sites of Shiga toxin (Stx) in Shiga toxin-producing Escherichia coli (STEC) isolates from humans and animals. Epidemiol. Infect. 127, 27–36. Ashkenazi, S., Pickering, L.K., 1989. Pathogenesis and diagnosis of bacterial diarrhoea. Eur. J. Clin. Microbiol. Infec. Dis. 8, 203–206. Astridge, K., McPherson, M., Kirk, M., et al., 2011. Foodborne disease outbreaks in Australia 2001–2009. Food Aust. 63 (12), 44–50. Baine, W.B., Vasi, M.L., Holmes, R.K., 1978. Genetic mapping of mutations in independently isolated nontoxigenic mutants of Vibrio cholerae. Infect. Immun. 21, 194–200. Beddoe, T., Paton, A.W., Le Nours, J., Rossjohn, J., Paton, J.C., 2010. Structure, biological functions and applications of the AB5 toxins. Trends Biochem. Sci. 35, 411–418. Beecher, D.J., 1997. Tripartite hemolysin BL from Bacillus cereus: hemolytic analysis of component interaction and model for its characteristic paradoxical zone phenomenon. J. Biol. Chem. 272, 233–239. Bishop, R.F., Davidson, G.P., Holmes, I.H., Ruck, B.J., 1973. Virus particules in epithelial cells of duodenal mucosa from children with acute non-bacterial gastroenteritis. Lancet ii, 1281–1283. Blaser, M.J., Newman, L.S., 1982. A review of human salmonellosis. I. Infective dose. Rev. Infect. Dis. 4, 1096–1104.

Foodborne Pathogen–Produced Toxins and Their Signal Transduction  75 Blaser, M.J., Taylor, D.N., Feldman, R.A., 1983. Epidemiology of Campylobacter jejuni infections. Epidemiol. Rev. 5, 157–172. Bryce, J.M., Evans, D.J., Evans, D.G., DuPont, H.L., 1979. Production of heat-stable methanol-soluble enterotoxin by Yersinia enterocolitica. Infect. Immun. 25, 532–537. Butzler, J.P., Dekeyser, P., Detrain, M., Dehaen, F., 1973. Related Vibrio in stool. J. Ped. 82, 737–765. Byres, E., Paton, A.W., Paton, J.C., Löfling, J.C., Smith, D.F., Wilce, M.C.J., Talbot, U.M., Chong, D.C., Yu, H., Huang, S., Chen, X., Varki, N.M., Varki, A., Rossjohn, Beddoe, T., 2008. Incorporation of a non-human glycan mediates human susceptibility to a bacterial toxin. Nature 456, 648–652. Chorus, J., Falconer, I.R., Salas, H.J., Bartram, J., 2000. Health risks caused by freshwater cyanobacteria in recreational waters. J. Toxicol. Environ. Health B 3, 323–347. Closs, E.J., Ensseleit, F., Koesling, D., PfeilschifterJM, Schwarz, P.M., Forstermann, U., 1998. Coexpression of inducible NO synthase and soluble guanylyl cyclase in colonic enterocytes: a pathophysiologic signaling pathway for the initiation of diarrhea by Gram-negative bacteria? FASEB J. 12, 1643–1649. Codd, G.A., Morrison, L.F., Metcaf, J.S., 2005. Cyanobacterial toxins: risk for health protection. Toxicol. Appl. Pharmacol. 203, 264–272. Davis, B., Waldor, M., 2003. Filamentous phages linked to virulence of Vibrio cholerae. Curr. Opin. Microbiol. 6, 35–42. De, S.N., 1959. Enterotoxicity of bacteria—free culture—filtrate of Vibrio cholerae. Nature 183, 1533–1534. De Haan, L., Hirst, T.R., 2004. Cholera toxin: a paradigm for multi-functional engagement of cellular mechanisms. Mol. Membr. Biol. 21, 77–92. Edwards, P.R., Ewing, W.H., 1972. Identification of Enterobacteriaceae. Burgess, Minneapolis, MN. Faruque, S.M., Nair, G.B. (Eds.), 2008. Vibrio cholerae: Genomics and Molecular Biology. Caister Academic Press, Norfolk. Fasano, A., 2002. Toxins and the gut: role in human disease. Gut 9 (Suppl. 3), 9–14. FDA/CFSAN, 2008. Food Safety A to Z Reference Guide—Salmonella. Center for Food Safety and Applied Nutrition, FDA, Washington, DC. FDA, 2012. Bad Bug Book, FDA, Washington, DC. Ghosh, A.R., 1990. Microbiological Studies on Acute Diarrhoea in Infants Aged Below Six Months With Particular Reference to Escherichia coli. Thesis. Calcutta University, India. Ghosh, A.R., 2012. Bacterial toxins and diarrhea. In: Pandey, V.D., Singh, S.K. (Eds.), Microbial Toxins and Toxigenic Microbes. Studium Press LLC, New Delhi, India, pp. 59–84. Ghosh, A.R., Koley, H., De, D., Garg, S., Bhattacharya, M.K., Bhattacarya, S.K., Nair, G.B., Shimada, T., Takeda, T., Takeda, Y., 1994. Incidence and toxigenicity of Vibrio cholerae in a freshwater lake during the epidemic of cholera caused by serogroup O139 Bengal in Calcutta, India. FEMS Microbiol. Ecol. 14, 281–285. Ghosh, A.R., Koley, H., De, D., Paul, M., Nair, G.B., Sen, D., 1996. Enterotoxigenic Escherichia coli associated diarrhoea among infants aged less than six months in Calcutta, India. Eur. J. Epid. 12, 81–84. Ghosh, A.R., Nair, G.B., Dutta, P., Pal, S.C., Sen, D., 1991. Acute diarrhoeal diseases in infants aged below six months in hospital in Calcutta, India: an aetiological study. Trans. R. Soc. Trop. Med. Hyg. 85, 796–798. Ghosh, A.R., Paul, M., Pal, S.C., Sen, D., 1990. Etiological agents of diarrhoea. Indian J. Publ. Health 34 (1), 54–61. Ghosh, A.R., Sehgal, S.C., 1998a. Detection of tdh, and trh genes in a urea-hydrolysing environmental isolate of Vibrio parahaemolyticus from Andamans. J. Diarrhoeal Dis. Res. 16 (2), 87–90. Ghosh, A.R., Sehgal, S.C., 1998b. Haemolysin production by environmental isolates of Vibrio parahaemolyticus from Andamans. Ind. J. Med. Res. 107, 151–154. Ghosh, A.R., Sehgal, S.C., 1998c. Shigella infections among children in Andaman: an archipelago of tropical islands of Bay of Bengal. Epid. Infect. 121, 43–48. Giannella, R.A., 1979. Suckling mouse model for detection of heat-stable E. coli enterotoxin: characterization of the model. Infect. Immun. 14, 95–99. Gorbach, S.L., 1987. Bacterial diarrhoea and its treatment. Lancet 2, 1378–1382. Granum, P.E., 2006. Bacterial toxins in food poisoning. In: Joseph, E.A., Michel, R.P. (Eds.), The Comprehensive Sourcebook of Bacterial Protein Toxins. third ed. Academic Press, London, pp. 949–958.

76  Chapter 3 Gross, R.J., Rowe, B., 1985. Escherichia coil diarrhoea. J. Hyg. Camb. 95, 531–550. Guerrant, R.L., Carneiro-Filho, B.A., Dillingham, R.A., 2003. Cholera, diarrhea, and oral rehydration therapy: triumph and indictment. Clin. Infect. Dis. 37, 398–405. Hagbom, M., Istrate, C., Engblom, D., Karlsson, T., Rodriguez-Diaz, J., Buesa, J., Taylor, J.A., Loitto, V.M., Magnusson, K.E., Ahlman, H., Lundgren, O., Svensson, L., 2011. Rotavirus stimulates release of serotonin (5-HT) from human enterochromaffin cells and activates brain structures involved in nausea and vomiting. PLoS Pathog. 7 (7), e1002115. Henkel, J.S., Baldwin, M.R., Barbieri, J.T., 2010. Toxins from bacteria. EXS 100, 1–29. Hyser, J.M., Estes, M.K., 2009. Rotavirus vaccines and pathogenesis: 2008. Curr. Opin. Gastroenterol. 25 (1), 36–43. Izzo, A.A., Mascolo, N., Capasso, F., 1998. Nitric oxide as a modulator of intestinal water and electrolyte transport. Dig. Dis. Sci. 43, 1605–1620. Kauffmann, F., 1975. Serological diagnosis of Salmonella species. Kauffmann White Schema, Maukgaurd, Copenhagen. Kirk, M.D., Pires, S.M., Black, R.E., Caipo, M., Crump, J.A., Devleesschauwer, B., et al., 2015. World Health Organization estimates of the global and regional disease burden of 22 foodborne bacterial, protozoal, and viral diseases, 2010: a data synthesis. PLoS Med. 12 (12), e1001921. Koley, H., Ghosh, A.N., Paul, Ghosh, A.R., Ganguly, P.K., Nair, G.B., 1995. Colonization ability and intestinal pathology of rabbits orally fed with Vibrio cholerae O139 Bengal. Ind. J. Med. Res. 101, 57–60. Kongmuang, U., Honda, T., Miwatani, T., 1987. Enzyme-linked immunosorbent assay to detect Shiga toxin of Shigella dysenteriae and related toxins. J. Clin. Microbiol. 25, 115–118. Kukreja, R., Singh, B.R., 2009. Botulinum neurotoxins: structure and mechanism of action. In: Proft, T. (Ed.), Microbial Toxins: Current Research and Future Trends. Caister Academic Press, Norfolk, pp. 15–40. Kunkel, S.L., Robertson, D.C., 1979. Purification and chemical characterization of the heat-labile enterototxin produced by enterotoxigenic Escherichia coli. Infect. Immun. 25, 586–596. Lemichez, E., Barbieri, J.T., 2013. General aspects and recent advances on bacterial protein toxins. Cold Spring Harb. Perspect. Med. 3, a013573. Levine, M.M., 1987. Escherichia coil that cause diarrhoea: enterotoxigenic, enteropathogenic, enteroinvasive, enterohemorrhagic, and enteroadherent. J. Infect. Dis. 155, 377–389. Levine, M.M., Kaper, J.B., Back, R.E., Clements, M.L., 1983. New knowledge on pathogenesis of bacterial enteric infections as applied to vaccine development. Microbiol. Rev. 47, 510–550. Lund, T., Granum, P.E., 1997. Comparison of biological effect of the two different enterotoxin complexes isolated from three different strains of Bacillus cereus. Microbiology 143, 3329–3339. Majowicz, S.E., Musto, J., Scallan, E., Angulo, F.J., Kirk, M., O’Brien, S.J., et al., 2010. The global burden of nontyphoidal Salmonella gastroenteritis. Clin. Infect. Dis. 50, 882–889. Manabe, M., 2001. Fermented foods and mycotoxins. Mycotoxins 51, 25–28. Milton, O.A., Patricia, V.S., Blas, M., Ana Maria, S.D.G., 2005. Prevalence and characterization of Clostridium perfringens from species in Argentina. Anaerobe 11, 327–334. Morris, G.K., Freeley, J.C., 1976. Yersinia enterocolitica: a review. Bull. WHO 54, 79–85. Nema, V., Agrawal, R., Kamboj, D.V., Goel, A.K., Singh, L., 2007. Isolation and characterization of heat resistant enterotoxigenic Staphylococcus aureus from a food poisoning outbreak in Indian subcontinent. Int. J. Food Microbiol. 117 (1), 29–35. Nielsen, M.B., Odum, N., Gerwien, J., Sveigaard, A., Bendtzen, K., Bregentholt, S., Ropke, C., Geisler, C., Dohlsten, M., Kaltoft, K., 1998. Staphylococcus enterotoxin: a directly stimulated signal transduction and interferon-gamma production in psoriatic T-cell lines. Tissue Antigen 52, 530–538. O’Brien, A.D., Chen, M.E., Holmes, R.K., Kaper, J.B., Levine, M.M., 1984. Environmental and human isolates of Vibrio cholerae and Vibrio parahaemolyticus produce a Shigella dysenteriae 1 (Shiga)-like cytotoxin. Lancet 1, 77. O’Brien, A.D., Holes, R.K., 1987. Shiga and Shiga-like toxins. Microbiol. Rev. 51, 206–220. Obata, F., Tohyama, K., Bonev, A.D., Kolling, G.L., Keepers, T.R., Gross, L.K., Nelson, M.T., Sato, S., Obrig, T.G., 2008. Shiga Toxin 2 affects the central nervous system through receptor globotriaosylceramide localized to neurons. J. Infect. Dis. 198, 1398–1406.

Foodborne Pathogen–Produced Toxins and Their Signal Transduction  77 Oku, Y., Uesaka, Y., Hirayama, T., Takeda, Y., 1988. Development of a highly sensitive Bead-ELISA to detect bacterial protein toxins. Microbiol. Immunol. 32, 807–816. O’Neal, C., Jobling, M., Holmes, R., Hol, W., 2005. Structural basis for the activation of cholera toxin by human ARF6-GTP. Science 309 (5737), 1093–1096. Pandey, V.D., Singh, S.K., 2012. Microbes and toxins. In: Pandey, V.D., Singh, S.K. (Eds.), Microbial Toxins and Toxigenic Microbes. Studium Press LLC, New Delhi, India, pp. 1–23. Paton, A.W., Beddoe, T., Thorpe, C.M., Whisstock, J.C., Wilce, M.C., Rossjohn, J., Talbot, U.M., Paton, J.C., 2006. AB5 subtilase cytotoxin inactivates the endoplasmic reticulum chaperone BiP. Nature 443, 548–552. Pavithra, M., Ghosh, A.R., 2013. Multidrug-resistant Stx-harboring Escherichia coli from meat shop and fast food. J. Food Safe. 33 (4), 453–460. Pickering, L.K., DuPont, H.L., 1986. Infectious diarrhea. In: Pickering, L.K., DuPont, H.L. (Eds.), Infectious Diseases of Children and Adults: A Step-by-Step Approach to Diagnose and Treatment. Addison-Wesley, Boston, pp. 361–402. Proft, T. (Ed.), 2009. Microbial Toxins: Current Research and Future Trends. Caister Academic Press, Norfolk. Raghunath, P., 2014. Roles of thermostable direct hemolysin (TDH) and TDH-related hemolysin (TRH) in Vibrio parahaemolyticus. Front. Microbiol. 5, 805. Raimondi, F., Kao, J.P.Y., Kaper, J.B., Guandalini, Fasano, A., 1995. Calcium-dependent intestinal chloride secretion by Vibrio parahaemolyticus thermostable direct hemolysin in a rabbit model. Gastroenterology 109, 381–386. Raja, M.K., Ghosh, A.R., 2014a. Laribacter hongkongensis: an emerging pathogen of infectious diarrhea. Folia Microbiol. 59 (4), 341–347. Raja, M.K., Ghosh, A.R., 2014b. Molecular insight of putative pathogenicity markers with ESBL genes and lipopolysaccharide in Laribacter hongkongensis. Appl. Biochem. Biotechnol. 174 (5), 1935–1944. Raja, M.K., Ghosh, A.R., Vino, S., Sajitha, L., 2015. Analysis and modeling of heat-labile enterotoxins of Escherichia coli suggests a novel space with insights into receptor preference. J. Biomol. Struct. Dyn. 33 (8), 1805–1818. Ram, P.K., Crump, J.A., Gupta, S.K., Miller, M.A., Mintz, E.D., 2008. Analysis of data gaps pertaining to Shigella infections in low and medium human development index countries, 1984–2005. Epidemiol. Infect. 136 (5), 577–603. Ratha, S.K., Adhikary, S.P., 2006. Cyanotoxin. Bioscan 1, 1–8. Rendón, M.A., Saldana, Z., Erdem, A.L., Monteiro-Neto, V., Vazquez, A., Kaper, J.B., Puente, J.L., Giron, J.A., 2007. Commensal and pathogenic Escherichia coli use a common pilus adherence factor for epithelial cell colonization. Proc. Natl. Acad. Sci. USA 104, 10637–10642. Riley, L.W., 1987. The epidemiologic, clinical and microbiological features of hemorrhagic colitis. Ann. Rev. Microbiol. 41, 383–407. Sack, R.B., 1987. Enterohemorrhagic Escherichia coli. N. Eng. J. Med. 317, 1535–1537. Sandvig, K., van Deurs, B., 2000. Entry of ricin and Shiga toxin into cells: molecular mechanisms and medical perspectives. EMBO J. 19 (22), 5943–5950. Scallan, E., Hoekstra, R.M., Angulo, F.J., Tauxe, R.V., Widdowson, M.A., Roy, S.L., Jones, J.L., Griffin, P.M., 2011. Foodborne illness acquired in the United States—major pathogens. Emerg. Infect. Dis. 17 (1), 7–15. Schafer, D.E., Lust, W.D., Sircar, B., Goldberg, N.D., 1970. Elevated concentration of adenosine 3′,5′-cyclic monophosphate in intestinal mucosa after treatment with cholera toxin. Proc. Natl. Acad. Sci. USA 67, 851–856. Schiavo, G., van der Goot, F.G., 2001. The bacterial toxin toolkit. Nat. Rev. Mol. Cell Biol. 2, 530–537. Scotland, S.M., Rowe, B., Smith, H.R., Willshaw, G.A., Gross, R.J., 1988. Vero cytotoxin-producing strains of Escherichia coli from children with haemolytic uremic syndrome and their detection by specific DNA probes. J. Med. Microbiol. 25, 237–243. Sedlock, D.N., Koupal, L.R., Deibel, R.H., 1978. Production and partial purification of Salmonella enterotoxin. Infect. Immun. 20, 375–380. Sharma, P., Wang, N., Chervin, A.S., Quinn, C.L., Stone, J.D., Kranz, D.M., 2015. A multiplex assay for detection of staphylococcal and streptococcal exotoxins. PLoS One 10 (8), e0135986.

78  Chapter 3 Skirrow, M.B., 1977. Campylobacter enteritis: a “new” disease. Br. Med. J. 2, 9–11. Smith, H.W., Gyles, O.L., 1970. The relationship between two apparently different enterotoxins produced by enteropathogenic Escherichia coli of porcine origin. J. Med. Microbiol. 3, 387–401. Stenfors, A.L.P., Fagerlund, A., Granum, P.E., 2008. From soil to gut: Bacillus cereus and its food poisoning toxins. FEMS Microbiol. Rev. 32 (4), 579–606. Stoev, S.D., 2015. Foodborne mycotoxicoses, risk assessment and underestimated hazard of masked mycotoxins and joint mycotoxin effects or interaction. Environ. Toxicol. Pharm. 39, 794–809. Strockbine, N.A., Marques, L.R.M., Newland, J.N., Smith, H.W., Holmes, R.K., O’Brien, A.D., 1986. Two toxin-converting phages from Escherichia coli O157:H7 strains 933 encode antigenically distinct toxins with similar biologic activities. Infect. Immun. 53, 135–140. Sulakvelidze, A., Kreger, A., Joseph, A., et al., 1999. Production of enterotoxin by Yersinia bercovieri, a recently identified Yersinia enterocolitica-like species. Infect. Immun. 67, 968–971. Tate, J.E., Burton, A.H., Boschi-Pinto, C., Steele, A.D., Duque, J., Parashar, U.D., 2012. 2008 Estimate of worldwide rotavirus-associated mortality in children younger than 5 years before the introduction of universal rotavirus vaccination programmes: a systematic review and meta-analysis. Lancet Infect. Dis. 12 (2), 136–141. Tauxe, R.V., Doyle, M.P., Kuchenmuller, T., Schlundt, J., Stein, C.E., 2010. Evolving public health approaches to the global challenge of foodborne infections. Int. J. Food Microbiol. (139 Suppl. 1), S16–S28. Taylor, T., 1961. Host specificity and enteropathogenicity of Escherichia coli. J. Appl. Bact. 24, 316–325. Viswanathan, V.K., Hodges, K., Hecht, G., 2009. Enteric infection meets intestinal function: how bacterial pathogens cause diarrhoea. Nat. Rev. Microbiol. 7 (2), 110–119. Wang, H., Paton, J.C., Herdman, B.P., Rogers, T.J., Beddoe, T., Paton, A.W., 2013. The B subunit of an AB5 toxin produced by Salmonella enterica serovar Typhi up-regulates chemokines, cytokines, and adhesion molecules in human macrophage, colonic epithelial, and brain microvascular endothelial cell lines. Infect. Immun. 81 (3), 673–683. Wassenaar, T.M., 1997. Toxin production by Campylobacter spp. Clin. Microbiol. Rev. 10 (3), 466–476. WHO, 2008.Vaccine: cholera vaccines. Health Topics. Wilson, D.J., Gabriel, E., Leatherbarrow, A.J.H., Cheesbrough, J., Gee, S., Bolton, E., Fox, A., Fearnhead, P., Hart, C.A., Diggle, P.J., 2008. Tracing the source of campylobacteriosis. PLoS Genet. 4 (9), e1000203. Zhang, R., Scott, D., Westbrook, M., Nance, S., Spangler, B., Shipley, G., Westbrook, E., 1995. The threedimensional crystal structure of cholera toxin. J. Mol. Biol. 251, 563–573.

CHAPTE R 4

Toxoplasmosis: Prevalence and New Detection Methods Maryna Galat, Nickolaj Starodub, Vladyslav Galat National University of Life and Environmental Sciences of Ukraine, Kiev, Ukraine

1 Introduction 1.1  General Characteristics of the Disease Toxoplasmosis is a common parasitic disease of animals and humans (Berger-Schoch et al., 2011). Toxoplasma gondii is an extremely successful protozoal parasite that infects almost all mammalian species, including humans. Approximately 30% of the human population worldwide is chronically infected with T. gondii. In general, human infection is asymptomatic, but the parasite may induce severe disease in fetuses and immunocompromised patients. In addition, T. gondii may cause sight-threatening posterior uveitis in immunocompetent patients. With few exceptions, humans acquire T. gondii from animals. The oral uptake of T. gondii oocysts released by specific hosts (i.e., Felidae) and of cysts persisting in muscle cells of animals both result in human toxoplasmosis (Schlüter et al., 2014). The agent of disease is a single-celled organism from the group of cyst-forming coccidia, T. gondii. Almost all kinds of animals, including humans, are intermediate Toxoplasma owners. In the role of the definitive host are representatives of the cat family (Felidae), mainly the domestic cat. The latter is an important source of infestation to humans (Westling et al., 2010). In the acute phase of infection, Felidae family representatives release into the environment millions of oocysts. It is therefore important to diagnose toxoplasmosis among cats in a timely fashion and in case of illness provide further treatment (Dubey et al., 2010; Nagel et al., 2013). Spanish researchers found that 23% of pigs, 44% of sheep, 43% of goats, and 8% of cows were positively reacting to a T. gondii agent (Chikweto et al., 2011). In addition, 14.6% of cattle were infected by Toxoplasma in Poland (Chikweto et al., 2011). T. gondii antibodies were detected using a modified agglutination test (MAT, cutoff 1:25) in 10.1% of 348 Foodborne Diseases http://dx.doi.org/10.1016/B978-0-12-811444-5.00002-6

79

Copyright © 2018 Elsevier Inc. All rights reserved.

80  Chapter 4 cats tested between May and July 2009 from clinics and hospitals located in and around Bangkok, Thailand. These samples also were tested for heartworm (Dirofilaria immitis), feline immunodeficiency virus (FIV), and feline leukemia virus (FeLV) using a commercial enzyme-linked immunosorbent assay (ELISA). Of the 746 samples, 4.6% (34/746) were positive for heartworm antigen, 24.5% (183/746) had circulating FeLV antigen, and 20.1% (150/746) had antibodies against FIV. Of the 35 T. gondii–seropositive cats, 42.9% (15/35) were coinfected with at least one of the other three pathogens (Sukhumavasi et al., 2012). Numerous studies have found that the number of animals positively reacting to T. gondii agent increases with their age (Berezovsky et al., 2013; Jiang et al., 2014). Serum samples from 304 donkeys (67.11%), 118 horses (26.05%), and 31 mules (6.84%) were analyzed by means of the indirect fluorescent antibody test (cutoff = 64). Antibodies against T. gondii were detected in 129 equids (28.47%) (82 donkeys, 32 horses, and 15 mules). Tissue samples from 19 seropositive and 50 seronegative animals were obtained in order to isolate the parasite by means of mouse bioassay, and T. gondii was isolated from a donkey. Through genotypic characterization of the isolate by means of polymerase chain reaction (PCR)– restriction fragment length polymorphism (RFLP) using 11 genotypic markers, the genotype #163 (TgCkBr220), which has already been described in chickens in Brazil, was identified (Gennari et al., 2015). Seropositivity for T. gondii was detected in 17.6% of slaughtered horses. Prevalence was higher in females than in males and in older (aged >9 years) than in younger horses. Grade horses were statistically more likely to be infected than purebred ones. Three (11.1%) randomly chosen heart samples harbored T. gondii DNA. PCR–RFLP analysis showed Type I, mixed II/III, and III genotypes from the portions of tongue, masseter muscle, and heart from seropositive horses (Papini et al., 2015). Recent population studies revealed that a few major clonal lineages of T. gondii dominate in different geographical regions. The Types II and III lineages are widespread in all continents and dominate in Europe, Africa, and North America. In addition, the Type 12 lineage is the most common type in wildlife in North America, the Africa 1 and 3 are among the major types in Africa, and ToxoDB PCR–RFLP #9 is the major type in China. Overall the T. gondii strains are more diverse in South America than in any other regions. From 164 T. gondii isolates analyzed from three countries in Central America (Guatemala, Nicaragua, and Costa Rica), from one country in the Caribbean (Grenada), and from five countries in South America (Venezuela, Colombia, Peru, Chile, and Argentina) the multilocous PCR– RFLP–based genotyping of 11 polymorphic markers (SAG1, SAG2, alt.SAG2, SAG3, BTUB, GRA6, L358, PK1, C22-8, C29-2, and Apico) was applied to 148 free-range chickens (Gallus domesticus) isolates and 16 isolates from domestic cats (Felis catus) in Colombia; 42 genotypes were identified. Linkage disequilibrium analysis indicated more frequent genetic recombination in populations of Nicaragua and Colombia, and to a lesser degree in populations of Costa Rica and Argentina. Bayesian structural analysis identified at least

Toxoplasmosis: Prevalence and New Detection Methods  81 three genetic clusters, and phylogenetic network analysis identified four major groups. The ToxoDB PCR–RFLP #7, Types II and III were major lineages identified from Central and South America, with high frequencies of the closely related ToxoDB PCR–RFLP #7 and Type III lineages. Taken together, was revealed high diversity within and between T. gondii populations in Central and South America, and the dominance of Type III and its closely related ToxoDB PCR–RFLP #7 lineages (Rajendran et al., 2012). According to Canadian researchers’ investigations, the biggest threats to poultry are diseases, such as cholera, campylobacteriosis, listeriosis, diseases caused by Clostridium and Salmonella spp., staphylococcal infection, and toxoplasmosis (Ding et al., 2012). Among food hazards that may be transmitted to humans through the consumption of poultry meat, the European Office for Food Safety provides only one agent of parasitic origin, T. gondii (Dubey et al., 2003). Various species of domestic and wild poultry, including chickens (G. domesticus) may be infected with toxoplasmosis. They are, like most other animal species, intermediate hosts of the agent. Definitive hosts are different species of the Felidae family. Most often there are no marked clinical signs among poultry positive for toxoplasmosis, but sometimes the known neurological phenomenon of nonsuppurative encephalitis with numerous T. gondii tachyzoites and tissue cysts is revealed postmortem in this case (Barakat et al., 2012). There are different methods for diagnosis of this disease among poultry in the world. The most used of them are PCR, immunohistochemical method, serological (e.g., modified agglutination) method, latex agglutination method, ELISA, immunochromatography, and immunofluorescence assays, among others. German scientists used purified surface antigen tachyzoites TgSAG1 for the ELISA diagnosis of toxoplasmosis in poultry (Chumpolbanchorn et al., 2013). It was revealed with the help of PCR that the organs most affected by agent of toxoplasmosis in poultry were liver (43.3%), breast muscle (26.7%), and heart (20%), while the brain was less frequently positive (6.7%) (Bisaillon et al., 2001). So, the real-time PCR-based detection of T. gondii is very sensitive and convenient for diagnosing toxoplasmosis. However, the performance of the PCR assays could be influenced by the target gene chosen. Primers were targeting the single copy SAG1 gene (X14080) and were designed with the Primer Express software (PE Applied Biosystem) to specifically amplify a 128 bp fragment. The forward and reverse sequences were 5′CTGATGTCGTTCTTGCGATGTGGC 3′ and 5′GTGAAGTGGTTCTCCGTCGGTGT′, respectively. These assays showed higher sensitivity than conventional PCR protocols using T. gondii DNA as a template. The detection limit of the developed real-time PCR assay was in the order of 1 tachyzoite. The assay was also assessed by experimentally infected mice and showed positive results for blood (25%), spleen (50%), and lung (50%) as early as 1 dpi. The specificity of the assay was confirmed by using DNA from Neospora caninum, Escherichia coli, Babesia bovis, Trypanosoma brucei,

82  Chapter 4 Cryptosporidium parvum, and Toxocara canis. Assay applicability was successfully tested in blood samples collected from slaughtered pigs. These results indicate that, based on SYBR green I, the quantitative SAG1 assay may also be useful in the study of the pathogenicity, immunoprophylaxis, and treatment of T. gondii (Yu et al., 2013). The prevalence of toxoplasmosis among chickens correlated with the degree of T. gondii oocysts spreading in the environment. That is why the most affected, according to many researchers’ investigations, are free-range chickens, whereas poultry kept in cages is less affected. In particular, among free-range chickens in Ghana, Indonesia, Poland, Italy, and Vietnam, extensiveness of toxoplasmosis infection is in the range of 12.5%–64.0% (Dubey et al., 2007), whereas among poultry kept in cages it is 0.34% (Czech Republic) (Glor et al., 2013). Considering the significant infestation of poultry in the different countries of the world, the risk of Toxoplasma infection is found to be low, but still possible, when meat of this species is used in human food (Dubey et al., 2003). The possibility of transmission of disease through human consumption of raw or insufficiently heat-treated meat from sick animals and unpasteurized milk has been confirmed (Meng et al., 2014). Thus, according to the literature, up to 63% of cases of human toxoplasmosis infection in the European Union are due to eating insufficiently heat-treated or raw meat products containing cysts of T. gondii bradyzoites. Tachyzoites of Toxoplasma were found in milk from cattle, sheep, and goats. The opinions of different scientists about the possibility of human infection through milk diverge. Some believe that milk may be the source of the infestation, whereas others hold the opposite view. Identification and isolation of the agent is carried out using a variety of immunological methods of research. Studies on naturally infected animals are important because they report what has actually occurred in farms, and they indicate what could be present in the human food chain and help to determine the relationship between the occurrence of T. gondii DNA in blood and milk based on the phase of infection. Using ELISA, the animals were divided into two groups, immunoglobulin M positive (IgM+) and negative (IgM−). With real-time PCR, T. gondii DNA was detected in seven milk samples (28%) and five blood samples (20%) of the IgM+ group (25 samples). In the IgM− group T. gondii DNA was detected in two milk samples (3.6%) out of 55 samples. One of the most important aims of diagnostic testing in animal production is to increase control of the introduction of human pathogens into the food chain (Luptakova et al., 2015). Lifetime diagnosis of toxoplasmosis is based on laboratory methods (Dubey and Prowell, 2013). Coproscopical (flotation) methods are used for the investigation of cat feces samples. These methods will establish the presence of Toxoplasma oocysts in the case of acute stage of the disease. However, their absence in coproscopical investigation does not give

Toxoplasmosis: Prevalence and New Detection Methods  83 rise to complete elimination of toxoplasmosis infection (Jiang et al., 2014). This is due to the fact that during the selection, oocysts in feces of cats are relatively short (Sroka et al., 2011). As cats are important in the epidemiology of toxoplasmosis because they are the only definitive hosts that excrete environmentally resistant T. gondii oocysts, unfrozen tissues of 42 cats and feces of 360 cats from China were bioassayed in mice for isolation of T. gondii. Antibodies to T. gondii were found in 21 of 42 (50%) of cats by the MAT (cutoff 1:25). Viable T. gondii was isolated from tissues of eight of 21 seropositive but not from 21 seronegative (65 years (http://wwwn.cdc.gov/ foodborneoutbreaks/). People with compromised immunity may also be vulnerable to this infection. From 1998 to 2014, a total of 404 outbreaks with 8,170 cases were reported to FoodNet, and many of these cases were related to the consumption of improperly handled or cooked food, primary with regards to poultry and dairy products. Poultry products, especially chicken, were responsible for causing at least 80% of the foodborne Campylobacter outbreaks from 1998 to 2014 (Table 5.2). Campylobacteriosis was responsible for causing 51.2% of milk-borne outbreaks reported from 1990 to 2006, and it was responsible for 77% from 2007 to 2012 (GIDEON, www.gideononline.com). During 2012–14, Campylobacter infection increased 1.13 fold while the infection of Salmonella or E. coli STEC O157 remained unchanged. In 2014, Campylobacter infection was recorded as the second lead cause of foodborne illness with a 13.45% incidence rate per 100,000 people, and 13% increase of incidence compared to the data recorded from 2006 to 2008. From 2004 to 2009, analysis also revealed that Campylobacter was the lead cause for travel-associated gastroenteritis, which accounted for almost 42% of cases (http://wwwn.cdc.gov/foodborneoutbreaks/). In addition, the prevalence in American military personnel stationed in Thailand with diarrhea was recorded

Years

No. of Outbreaks in USA

Species

Sources

1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014

15 6 15 20 22 22 15 26 27 30 26 16 29 33 39 30 33

C. jejuni C. jejuni C. jejuni C. jejuni C. jejuni, C. coli C. jejuni, C. coli, C. fetus C. jejuni C. jejuni, C. coli C. jejuni, C. fetus C. jejuni, C. coli C. jejuni, C. coli C. jejuni C. jejuni C. jejuni, C. coli C. jejuni C. coli, C. jejuni C. jejuni, C. coli

Milk, salad greens, potato, chicken, turkey, raw salmon, raw tuna, oyster Chicken Milk, salad greens Chicken, beef Milk, salad greens, potato, chicken Milk, beef Milk, salad greens, tomato, chicken, turkey Milk, salad greens, tomato, chicken Milk, salad greens, raw oyster Milk, cheese, butter, salad greens, duck liver Milk, clam Milk, chicken Milk, goat milk, beef, clam Milk, turkey Milk, chicken, beef Milk, chicken, duck, goose Milk, queso fresco, squash (yellow), zucchini, chicken, oyster, shrimp

Source: Original data is from Foodborne Outbreak Online Database. Centers for Disease Control and Prevention (CDC), U.S. Department of Health and Human Services (DHHS), Atlanta, GA. Available from: http://wwwn.cdc.gov/foodborneoutbreaks.

132  Chapter 5

Table 5.2: Etiology of Campylobacter outbreak in the United States.

Campylobacteriosis: An Emerging Infectious Foodborne Disease  133 at 67% in 2000, 55% in 2001, and at 35% in 2014 with acute diarrhea (GIDEON, www. gideononline.com). From 2009 to 2011, 9%–12% American travelers were determined to have campylobacteriosis, and these studies revealed that Campylobacter infections are widespread in the USA and abroad (GIDEON, www.gideononline.com). In the European Union (EU), campylobacteriosis is the most commonly reported foodborne disease among the 27 states members, with over 200,000 confirmed human cases each year (European Food Safety Authority, EFSA). However, epidemiologists have evaluated the incidences and suggest that the actual number of cases should be almost 9 million each year, costing the EU approximately EU 2.4 billion (Havelaar et al., 2013). So far, most of the outbreaks of campylobacteriosis were endemic with asymptomatic symptoms, and C. jejuni followed by C. coli were found responsible for causing almost 80% of the outbreaks in most of the EU countries and USA (Kaakoush et al., 2015). Since 1995, C. jejuni has resulted in 26–50 cases per 10,000 people. However, in 2011 a higher number (60 cases per 10,000 people) was recorded. Currently, about 55–60 per 10,000 people is recorded (GIDEON, www.gideononline.com), and majority of the outbreaks were associated with infected poultry food products, water, or milk. In Europe, a lot of farms and butchers are privately owned; thus, the cleanliness of the housing and feeding environments, as well as the food animal processes and consumers are important (Silva et al., 2011). In the United Kingdom, from 2008 to 2009 the prevalence of campylobacteriosis was recorded high as compared to other bacteria, such as E. coli or Salmonella (Tam et al., 2012). In Germany, the data collected from 2001 to 2011 indicated that the Campylobacter infections sustained the same or even higher prevalence for the last 10 years (Stingl et al., 2012). Unlike the outbreaks in the USA with mainly C. jejuni infections, several species have also been found to be associated with the outbreaks in Europe. In the Netherlands, almost 10 species of Campylobacter were isolated and confirmed by PCR (De Boer et al., 2013). The data suggested that the incidence of C. concisus is similar to C. jejuni. Similar results were observed in Denmark during the 2009–10 outbreaks (Nielsen et al., 2013). In Iceland, C. jejuni and C. ureolyticus had the same prevalence for the outbreaks (Bullman et al., 2011). To ease this public health burden, the EU has adopted an integrated approach for food safety to ensure that the products from farm to table are monitored to maintain the hygienic requirements to decrease the infections. In Asia, most studies dealing with Campylobacter infections are incomplete and undetermined due to the usage of inappropriate isolation protocols (Kaakoush et al., 2015). In Taiwan, an incidence of 35% was reported in 3 to 5-year-old toddlers during 2003 (http:// www.cdc.gov.tw/english/index.aspx). In China, the incidence was between 5% and 15% from 2005 to 2009 (Chen et al., 2011). Furthermore, C. jejuni and C. coli were detected more frequently in raw chicken and chicken products from 2007 to 2010 in China, and it was suggested that Campylobacter was the major source for acute gastroenteritis (http://www. chinacdc.cn/). According to the Infectious Disease Surveillance Center (IDSC, http://idsc.nih.

134  Chapter 5 go.jp/iasr/index.html), Salmonella and Vibrio were the two main bacteria responsible for food poisoning in Japan before 1999; however, low prevalence of Campylobacter infection was also evident. After 2000, the prevalence of Campylobacter infections has slightly increased while outbreaks caused by Salmonella and Vibrio have been significantly reduced. Although the infections caused by two or more bacteria were common, the Campylobacter species has been reported to be the major cause for food poisoning in Japan (Kubota et al., 2011). There are fewer systematic studies to evaluate the foodborne disease in India and other Middle East countries. Thus, the studies only reveal the regional incidence. From 2008 to 2010, 7%–16.2% of hospitalized patients were found positive for Campylobacter, especially C. jejuni (Piyali et al., 2013). From 2003 to 2011, children under 5 years were the main targets for campylobacteriosis in South India, Bangladesh, and Pakistan (Kotloff et al., 2013). While the case reports have been reviewed, it is still difficult to determine if the campylobacteriosis incidence is increasing in these countries because of incomplete epidemiological data. Campylobcater has been recognized to be the most common pathogen in Australia as well (Hall et al., 2005). The confirmed cases have increased enormously from 1990 to 2000 and stayed stable for a while. Nevertheless, the reported cases increased again in 2005 and the number reached its peak in 2013—120 per 100,000 people (GIDEON, www.gideononline. com). Most cases were found in children ages 5 or older with consumption of contaminated chicken as the major risk factor (Stafford et al., 2008). In New Zealand, the incidence of campylobacteriosis was high from 2002 to 2006. However, this high incidence decreased in 2008 and it has been low since then. This may due to the successful implementation of strategies for food animal safety (Sears et al., 2011). Limited data collected from countries in Africa have also indicated that campylobacteriosis disease has been widespread in children under 5 years of age (Mason et al., 2013; Mshana et al., 2009). Most industrial nations lack a national surveillance system and as such poor hygiene, sanitation, and frequent close contact with animals are the reasons for Campylobacter infections. Although C. jejuni and C. coli have been identified as the predominant species causing foodborne outbreaks, it is impossible to rule out other Campylobacter species (Lastovica, 2006).

6 Isolation The genus Campylobacter includes a group of microaerobic and thermophililc bacteria that thrive in the intestinal tract of humans and various animals, particularly poultry (Epps et al., 2013; Silva et al., 2011). During this stage, the bacteria transforms into an asymptomatic carrier for animals, ultimately causing illness in humans as well. The consumption of contaminated food usually results campylobacteriosis, and it has also been the leading cause for foodborne illness in the USA and worldwide. The at-risk foods include raw milk, meats (mostly poultry), fruit, vegetables, and water. Campylobacter isolation from various food matrices has been complicated, as the processing of contaminated food storage and transportation is not only a difficult task, but also needs a very unique growth

Campylobacteriosis: An Emerging Infectious Foodborne Disease  135 requirement. Studies have revealed that C. jejuni can survive at 4°C for 2–4 weeks, at –20°C for 2–5 months under limited oxygen and moist conditions (Haddad et al., 2009). It can also stay alive for a few days at room temperature (Haddad et al., 2009). Further, C. jejuni is typically reported to be sensitive to environmental stress due to its lack of stress response regulators and cold shock proteins (Silva et al., 2011). As it can survive at low temperatures, it can adapt to stress to minimize damage to the cell. However, exposure to oxygen, low moisture, low pH, heating, freezing, and prolonged storage can damage the cells and decrease the organism’s ability to recover (Fitzgerald and Nachamkin, 2015; Kaakoush et al., 2015; Levin, 2007; On, 2013). Several standard Campylobacter isolation protocols have been well practiced since 1995 (Corry et al., 1995). In 1998, the US Food and Drug Administration (FDA) Bacterial Analytical Manual (BAM) (Hunt et al., 1998) established a set of isolation procedures for Campylobacter in meats, vegetables, shellfish, and water samples. In general, the samples are incubated with preenrichment media in net-lined bags and are shaken for a certain amount of time. This is followed by secondary enrichment and plating. A summary of the isolation and detection protocols for Campylobacter is in the BAM standard protocol (Hunt et al., 1998).

6.1  Sample Preparation Initially a 25–100 g sample is incubated with enrichment broth in a net-lined bag, which is shaken gently for 5 minutes depending on the sample types. Although Campylobacter spp. can survive for weeks in cold temperatures (4°C), the cell numbers decrease as the temperature declines (Davis and Dirita, 2005; Hazeleger et al., 1998). In addition, oxygen exposure increases environmental stress in this organism, which ultimately damages the cells. Thus, the test samples are packed airtight during transportation and examined as soon as possible once the package is opened. As oxygen is a critical factor for the isolation of Campylobacter, freshly prepared media is also recommended to avoid the absorption of oxygen during storage (Corry et al., 1995). Further, FBP, hemin, blood, or charcoal is added into the media to serve as an oxygen scavenger. The liquid broth media could last for 2 months if stored in a tightly closed container away from light, while the agar plate can be stored away from light at 4°C for 2–3 weeks. To analyze a water sample, 2–4 L of water is collected for investigation, and 5 mM of sodium thiosulfate is added into the sample for pretreatment and it is then filtered through a 45 µm Zetapor filter. This type of filter carries a positive charge, so Campylobacter spp. is trapped on the filter paper. The filter is rinsed with sterile phosphate butter to remove the salt while analyzing seawater samples. Afterward, the filter is placed immediately into the enrichment media because Campylobacter is sensitive to both dry conditions and high salt (Cameron et al., 2012). For the analysis of milk products, the pH level is adjusted to 6–8 and centrifuged right away to separate the supernatant and the pellet. The pellet is then placed into the enrichment media for recovery.

136  Chapter 5

6.2  Preenrichment and Enrichment The impediments of Campylobacter isolation from various food matrices include the presence of low cell numbers in food, as well as cell damage during the recovery process. The cells of these bacteria are very sensitive to hydrogen peroxide, photochemically induced oxygen radicals, and selective agents and antibiotics (Bolton et al., 1984; Hutchinson and Bolton, 1984). Therefore, the major purpose for enrichment is to overcome these issues and improve recovery as much as possible for detection and investigation. Several proposals have been suggested for the improvement of enrichment media and the modification of existing procedures (Baylis et al., 2000; Corry et al., 1995). The FDA BAM recommends preenrichment at 37°C for 4–5 h followed by enrichment at 42°C for 24–48 h under microaerobic conditions for most Campylobacter species except C. fetus, for which both the preenrichment and enrichment processes are carried out at 37°C. On the other hand, several studies have recommended the use of selective media during the enrichment process for optimal recovery (Agulla et al., 1987; Baylis et al., 2000). The addition of antibiotics (including trimethoprim, chloramphenicol, streptomycin, and nalidixic acid) reduces the presence of other competitor organisms, and these common antibiotics are used in the enrichment media to inhibit the growth of other competitive pathogens (Table 5.3) (Davis and Dirita, 2005). In recent years, several selective media have been suggested for their efficacy in the isolation of Campylobacter (Table 5.4). In a study, three media, namely Bolton broth (BB), Campylobacter enrichment broth (CEB), and Preston broth (PB) were compared for enrichment, and BB and CEB were found to be better than PB for the recovery of Campylobacter (Baylis et al., 2000). BB and CEB are two selective media specifically designed to recover the damaged cells and to avoid the need for microaerobic conditions. Table 5.3: Medium supplement and antibiotics for Campylobacter culturing. Supplements

Blood

Antibiotics

FBP CCDA supplement Antibiotics

Defibrinated sheep blood Defibrinated horse blood

Trimethoprim Chloramphenicol Streptomycin Nalidixic acid

CCDA, Charcoal cefoperazone deoxycholate.

Table 5.4: Common medium used for Campylobacter culture. Enrichments

Selections

Culturing

Bolton broth CEB PB Broth enrichment medium

Abetya-Hunt-Bark agar Butzler agar Skirrow agar Modified Campylobacter blood-free selective agar BBL Campy CVA agar

Bolton medium Brucella medium Columbia medium Muellen–Hilton medium Trypticase soy medium

CEB, Campylobacter enrichment broth; PB, Preston broth.

Campylobacteriosis: An Emerging Infectious Foodborne Disease  137 The addition of oxyrase enzymes in selective broths has also been noted to improve the isolation of Campylobacter by reducing the oxygen level (Silva et al., 2011).

6.3  Isolation and Identification After 24–48 h of enrichment, the samples are diluted and plated on a selective agar plate (Table 5.4). Preston agar, Charcoal cefoperazone deoxycholate (CCDA), and Butzler agar have been recommended for isolation with similar efficacy. Nevertheless, modified CCDA and Abeyta–Hunt–Bark (AHB) have also been recommended in the FDA BAM as standard isolation methods (Hunt et al., 1998; Silva et al., 2011; Zanetti et al., 1996). The streaked agar plates are incubated in anaerobic conditions for 24–48 h at 42°C, and the plates are incubated at 37°C for 48–72 h for C. fetus. To reduce environmental stress, the plates are placed in the dark. Pure single colonies from the AHB plate are picked up as the plates start to stain to confirm the morphology, and a biochemical test is performed to attain the species level differentiation. The catalase and oxidase tests have been suggested for confirmation of the isolates picked from AHB plate. It is important to note that the most critical factor for the entire isolation process is the microaerobic atmosphere. Genetic analysis also suggested that Campylobacter spp. not only lacks the efficient enzymes to compete against ROS in the environment but also that it cannot produce enzymes to digest oxygen, and possesses a low respiratory rate (Dasti et al., 2010; Mace et al., 2015; Velayudhan et al., 2004). Exposure to an aerobic condition is harmful for all species of Campylobacter spp., especially C. jejuni. The Campylobacter spp. also requires high CO2 for its growth. As a canophilic bacterium, it can covert CO2 into pyruvate by flavodoxin quinone reductase (St Maurice et al., 2007). Based on the unique atmospheric features for Campylobacter growth, various gas systems have used. Currently, three systems (including the bubbler system, the shaking flask or bag system, and the gassed jar system) are frequently used and well described in the FDA BAM. For all of these three systems, a gas combination with 5% O2, 10% CO2, and 85% N2 has been recommended for the enrichment and isolation of these bacteria (St Maurice et al., 2007). Preenrichment is frequently performed with a gas bubbler to maintain the required microaerobic environment, and the gasbags or gas envelopes are used for plate inoculation. A gas jar with a gas generating system is another stable way for Campylobacter growth. However, there is no check procedure in these systems to detect the amount of gas in the sample containers, and in a study it was revealed that under these gas systems there is no optimal media for the growth (Davis and Dirita, 2005). These methods are more toward detection based on presence or absence of Campylobacter in food samples.

6.4 Culturing Culturing Campylobacter isolates is yet another challenge in detection, differentiation, and in carrying out research or epidemiologic investigations. The term “viable but nonculturable bacterial cells (VBNC)” was first introduced in 1982 to describe the cells

138  Chapter 5 that cannot form colonies on the solid agar media but retain regular metabolism and the ability for elongation under appropriate nutritional conditions (Oliver, 2005). Several human pathogenic bacteria, including E.coli, Salmonella enteritidis, Vibrio cholera, and Campylobacter have been confirmed to be in the VNBC state (Tholozan et al., 1999). Campylobacter spp. is capable of easily transforming to VNBC status during food processing. In various food matrices, bacteria interference is also dependent on factors, such as pH, chemical composition, environmental factors, including storage temperature, treatment, and packaging (Sun et al., 2008). Although these factors spontaneously trigger bacteria into VBNC status, the details about thisphenomena is still unclear. As temperature is one of the key factors for culture, C. jejuni is reported to lose culturable ability in 3 days when cells are incubated at 25°C (Medema et al., 1992). In aquatic mediums, some of the strains of C. jejuni developed into VBNC in 18–28 days at 4°C (Jones et al., 1991). With lower levels of nutrients and an unfavorable environment, the cells transform into VBNC states faster. Although VBNC cells can retain pathogenic characteristics, it is hard to detect unculturable cells by standard procedure. Several attempts have been made to convert VBNC cells back to culturable status, and the data revealed that the cells could convert back to normal cells through animal passage (Rollins and Colwell, 1986; Saha et al., 1991). In a study, seven of the 16 strains of C. jejuni were successfully reisolated by passing through rats’ intestines (Saha et al., 1991). In addition, successive passages through animal intestines have brought back the original toxin productions and the ability for cultivation. Without passage through animals, the VBNC cells could not grow on any growth media (Saha et al., 1991). As the VBNC cells are tough to culture, the rest of the viable and culturable cells are considered essential for the detection of bacteria. Several basal media have been used and compared to culture C. jejuni and C. coli, as these two species are the leading cause for campylobacteriosis (Baylis et al., 2000; Chon et al., 2014; Ng et al., 1985; Seliwiorstow et al., 2014; Teramura et al., 2015). In a study, the Brucella, Campylobacter basic, Columbia and Mueller–Hinton Agars with or without either blood or Campylobacter supplement (FBP) were tested, and Mueller–Hinton media was observed for the best recovery rate for the pure culture and the addition of FBP or blood showed no difference on bacterial recovery (Ng et al., 1985). A similar result was also observed for the recovery of C. jejuni (Davis and Dirita, 2005). A gas atmosphere is very critical for culturing Campylobacter; low O2 and high CO2 are required for C. jejuni and C. coli (Mace et al., 2015). Recent data identified that other species require different oxygen concentrations for successful culturing, such as O2 ranging from 3% to 15%, coupled with 10% CO2 and N2 (Haines et al., 2011; Lynch et al., 2011). Hydrogen (H2) has recently been added into the traditional O2–CO2–N2 gas combination for optimal growth. The addition of 2%–5% H2 in the gas mixture can serve as an antioxidant, helping cells defend against oxidative stress (Haines et al., 2011). Furthermore, H2 provides an energy source and enhances the culturing for other Campylobacter spp., including C. consisus, C. showwae, C. rectus, C. curvus, and

Campylobacteriosis: An Emerging Infectious Foodborne Disease  139 Table 5.5: Gas system used for Campylobacter culture. Gas Systems

Countries of Origin

AXNOMAT BD GasPak Oxoid CampyGen AnaeroGRO BDL Gas System Merck Anaerocult

Norwood, MA, USA Franklin Lakes, NJ, USA Rockville, MD, USA Santa Maria, CA, USA Germany France

C. upsaliensis. There are several gas systems available in the market (Table 5.5). Sealed bags and jars with particular gas pouches are the most common methods for culturing Campylobacter on agar plates. For liquid cultures, the key point is to limit the headspace and tightly screw on the lid to cut down the ambient atmosphere. Some studies have suggested that C. jejuni and C. coli grow better in a trigas flow incubator (Davis and Dirita, 2005; Haines et al., 2011; Mace et al., 2015). In brief, the gas systems, growth media, and culturing temperature are essential for bacterial cultivation and can be adjusted accordingly with depending on the purpose of the experiments.

6.5  Isolation of Campylobacter spp. From Human Samples Campylobacter spp. has been isolated from human blood or fecal samples caused by gastrointestinal infections. The isolation of Campylobacter spp. from human samples is similar to the isolation process used for food, and an enrichment step has also been recommended for the recovery of bacteria (Kaakoush et al., 2015). So far, no optimal protocol is considered for the isolation of human clinical samples. However, the Cape Town protocol is considered an ideal tool that can be used for the isolation of most species (Lastovica and Le Roux, 2000, 2001). The homogenized clinical samples are incubated with enrichment media for two days, and then filtered through a 0.45 or 0.65 µm pore size membrane and streaked onto the blood nutrition agar. The plates are incubated under microaerobic conditions at 37 or 42°C. A gas mixture comprising of high concentrations of CO2 and low concentrations of O2 (5%) is considered an essential requirement for the growth of these bacteria (Lastovica and Le Roux, 2000). In addition, it has recently been recommended that H2 be added into the gas mixture to improve recovery (Mace et al., 2015). Clinical samples typically follow the 3-day rule: the sooner the sample is processed, the higher the bacteria cell numbers that are recovered (Fitzgerald and Nachamkin, 2015). Furthermore, transportation of clinical samples is also a critical factor for isolation. Common transportation media, such as buffered glycerol saline, is not considered to be appropriate for Campylobacter. The modified Cary–Blair medium containing sheep blood with reduced agar is considered to be the best medium to transport most of the Campylobacter spp. Samples (Hurd et al., 2012). Although C. fetus, C. jejuni, and C. upsaliensis have been successfully isolated from blood samples, there are few studies available on the optimal conditions for Campylobacter isolation from blood (Francioli et al., 1985; Schmidt et al., 1980).

140  Chapter 5

7 Typing Typing is a very important tool for the analysis and precise identification of isolates, and typing data is currently utilized worldwide in regards to the prevention and control of infectious disease, routine surveillance, epidemiological studies of sporadic cases and foodborne outbreaks, and understanding pathogenesis (Fitzgerald and Nachamkin, 2015; Taboada et al., 2013). Phenotyping is a technique that relies on unique expression of phenotypic characteristics from microorganisms and has been implemented for decades to characterize the isolates recovered from food or clinical samples. Genotyping is DNA-based analysis of chromosomal or extrachromosomal DNA. Several phenotyping methods, including biotyping, bacteriophage typing, and serotyping, have been applied for Campylobacter spp. differentiation. For Campylobacter, two types of serotyping methods (heat-labile and heat-stable) are currently used (Levin, 2007). When the heat-labile method was first introduced, over 100 serotypes were detected for C. jejuni, C. coli, and C. lari (Lior et al., 1982). The targeted proteins in this typing are uncharacterized bacterial surface antigens or flagella antigens. Penner serotyping is heat-stable serotyping and is more commonly used for Campylobacter isolates (Pike et al., 2013). This system targets the heatstable (HS) antigen extracted from capsular LOS. Most strains of Campylobacter can be typed now by way of the Penner method, and at least 60 types of C. jejuni and C. coli can be differentiated (Moran and Penner, 1999). Serotyping accuracy relies on the quality of antisera, thus maintaining good quality antisera are very important, which may be expensive and time consuming. Serotyping is also performed for GBS disease association with Campylobacter (Fitzgerald and Nachamkin, 2015; Nachamkin et al., 1998). Biotyping uses the pattern of metabolic activities expressed by an isolate, and bacteriophage typing is a tool to detect the phage’s susceptibility or resistance on isolates. Compared to the serotyping, it is less used and has no practical applications. Most of the phenotypic typing methods require heavy maintenance work to obtain a quality result, thus it is always a challenging task to have precise results. The genotyping method involves characterization of bacterial DNA (chromosomal or plasmid DNA), and by understanding the DNA composition, homology, and the presence or absence of specific genes, the bacteria is classified for its taxonomic identification at the species and strains levels. In 1993, two flagella genes, flaA and flaB were used for the genotyping of C. jejuni and C. coli and a study identified that the central regions of the flaA gene were highly polymorphic with a homology (74%–80%) between these two species (Alm et al., 1993a,b,c; Wegmuller et al., 1993). The 16S rRNA gene has been widely characterized in the development of rapid diagnostic methods for Campylobacter (Maher et al., 2003). The 16S rRNA has also been used in reconstructing phylogenies due to its slow evolution rate and the hypervariable sequence regions that provide the species-specific identification (Gharst et al., 2013; Muellner et al., 2013; On, 2013). In addition, the 23S rRNA and the

Campylobacteriosis: An Emerging Infectious Foodborne Disease  141 internal transcribed spacer (ITS) regions have also been used in sequence characterization of Campylobacter (Man et al., 2010; Wang, 2002; Wang et al., 2002). Nevertheless, it has been also reported that some of C. jejuni with C. coli isolates cannot be discriminated by 16S or 23S rRNA sequence typing (On, 2013). Thus, combinations of these three genetic markers have been used in typing and attaining precise genetic polymorphism of Campylobacter spp. Pulsed-field gel electrophoresis (PFGE): PFGE is a DNA based technique used for Campylobacter spp. subtyping (Gilpin et al., 2012). To perform PFGE, chromosomal DNA is digested by appropriate restriction enzymes to acquire a small number of large fragments. Subsequently the fragments are separated using agarose gel electrophoresis with an electric field that changes direction periodically to generate a DNA fingerprint. This method has been further improved on and used by the USA PulseNet to help type Campylobacter rapidly from outbreaks as well (http://www.cdc.gov/pulsenet/). It provides “real time” surveillance for outbreaks for epidemiologic surveys and sporadic cases (Ribot et al., 2001). In addition, it has been applied to track the Campylobacter spp. in US poultry products successfully, as well as for the C. jejuni subtyping (Gharst et al., 2013; Nielsen et al., 2000; Oyarzabal et al., 2013). However, recently questions have been raised about whether PFGE is an appropriate method for Campylobacter subtyping. Although PFGE was found to be highly discriminatory, it is not ideal for epidemiological investigation (Taboada et al., 2013). It is only useful to subtype the related strains, which indicates that the relatedness result may only be used for a guide, not as a phylogenetic measure (Champion et al., 2002). Besides, the instability of the Campylobacter chromosome is considered a factor for a reliable PFGE result (Steinbrueckner et al., 2001). Multilocus sequence typing (MLST): MLST is considered the gold standard for subtyping Campylobacter (Miller et al., 2012; On, 2013). This typing technique was first introduced in 2001 to provide portable and precise data for conducting epidemiological studies, and was comparable to traditional DNA-based techniques used in identifying population genetic structure and evolution of Campylobacter (Dingle et al., 2001, 2005). MLST uses the nucleotide sequence data belonging to 6–11 housekeeping genes of the bacteria to generate a unique sequence type to discriminate species based on existing genetic variations. The sequences of the given loci ultimately assign an allele number by order of discovery, and the allele numbers from a given isolate combine into an allelic profile and assign a sequence type (ST) (Enright and Spratt, 1999; Maiden et al., 1998). By comparing the allelic profile, the genetic relationship among the isolates is determined. MLST was successfully applied for the first time to study C. jejuni, and the data clearly indicated that C. jejuni was a genetically diverse species with weak clonal population structure and frequent intra- and interspecies genetic exchange (Levin, 2007). In addition, the isolates of C. jejuni from livestock, environmental, and clinical samples were sequenced and analyzed, and the data suggested that the pathogenic C. jejuni was

142  Chapter 5 transmitted from zoonotic sources to humans (Manning et al., 2003). MLST data for the C. jejuni isolates from swine was compared with MLST data from other sources, and it was suggested that there might be a particular swine-adapted C. jejuni MLST pattern (Manning et al., 2003). MLST targets the seven relatively stable housekeeping genes of C. jejuni and C. coli, which are considered to provide sufficient discriminatory potential (Tables 5.6–5.8). MLST has been utilized to determine the transmission Table 5.6: Multilocus sequence typing (MLST) primers for Campylobacter jejuni for performing PCR amplification. Genes

Forward Primers

Reverse Primers

aspA

A1 AAAGCTGCAGCTATGGC A3 ATGAGGTTTATTATGGAGTGC A9 AGTACTAATGATGCTTATCC A1 TAGGAACTTGGCATCATATTACC A1 GGGCTTGACTTCTACAGCTACTTG A1 GAGTTAGAGCGTCAATGTGAAGG A1 TTTAAGTGCTGATATGGTGC A3 GCAAACTCAGGACACCCAGG A1 TTGGAACTGATGGAGTTCG A3 TCAGGGCTTACTTCTATAGG A7 TACTAATAATATCTTAGTAGG A3 AAAGCTGATGAGATCACTTC A7 ATGGACTTAAGAATATTATGGC

A2 AAGCGCAATATCAGCCACTC A4 CCTCTTTGGCTATAGAAGCTG A10 ATTTCATCAATTTGTTCTTTGC A2 TTGGACGAGCTTCTACTGGC A2 CCAAATAAAGTTGTCTTGGACGG A2 AAACCTCTGGCAGTAAGGGC A4 CATAGCGTGTTCTCTGATACC A6 AAAGCATTGTTAATGGCTGC A2 AAGAGCTTAATATCTCTGGCTTCTAG A4 AGCTTAATATCTCTGGCTTC A8 CACAACATTTTTCATTTCTTTTTC A2 GCTAAGCGGAGAATAAGGTGG A4 ATTCTTTGTCCACGTTCAAG A8 ATAAATTCCATCTTCAAATTCC

glnA gltA glyA tkt pgm

uncA

Source: Multilocus sequence typing website (http://pubmlst.org/campylobacter/) cited in Jolley, K.A., Maiden, M.C., 2010. BIGSdb: scalable analysis of bacterial genome variation at the population level. BMC Bioinform. 11, 595.

Table 5.7: Multilocus sequence typing (MLST) primers used to perform nucleotide sequencing of Campylobacter jejuni. Genes

Forward Primers

Reverse Primers

aspA glnA

S3 CCAACTGCAAGATGCTGTACC S1 GCTCAATTCATGGATGGC S3 CATGCAATCAATGAAGAAAC S1 GTGGCTATCCTATAGAGTGGC S3 CTTATATTGATGGAGAAAATGG S3 AGCTAATCAAGGTGTTTATGCGG S5 GCTAATCAAGGTGTTTATAT S7 AGCCTAATTCAGGTTCTCAA S1 TGCACCTTTGGGCTTAGC S5 GCTTAGCAGATATTTTAAGTG S3 GCTTATAAGGTAGCACCTACTG S5 GGTTTTAGATGTGGCTCATG S3 AAAGTACAGTGGCACAAGTGG S5 TGTTGCAATTGGTCAAAAGC

S6 TTCATTTGCGGTAATACCATC S4 GCATACCATTGCCATTATCTCCG S6 TTCCATAAGCTCATATGAAC S6 CCAAAGCGCACCAATACCTG S8 TGCTATACAGGCATAAGGATG S4 AGGTGATTATCCGTTCCATCGC

gltA glyA

tkt pgm uncA

S4 ACTTCTTCACCCAAAGGTGCG S6 AAGCCTGCTTGTTCTTTGGC S2 TCCAGAATAGCGAAATAAGG S4 TGCCTCATCTAAATCACTAGC

Source: Multilocus sequence typing website (http://pubmlst.org/campylobacter/) sited in Jolley, K.A., Maiden, M.C., 2010. BIGSdb: scalable analysis of bacterial genome variation at the population level. BMC Bioinform. 11, 595.

Campylobacteriosis: An Emerging Infectious Foodborne Disease  143 Table 5.8: Multilocus sequence typing (MLST) primers for Campylobacter coli PCR amplification and nucleotide sequencing. Genes

Forward Primers

Reverse Primers

aspA glnA gltA glyA tkt pgm uncA

S1 CAACTTCAAGATGCAGTACC S1 TTCATGGATGGCAACCTATTG S1 GATGTAGTGCATCTTTTACTC S1 TCAAGGCGTTTATGCTGCAC S1 AGGCTTGTGTTTTCAGGCGG S1 TTATAAGGTAGCTCCGACTG S1 AAGCACAGTGGCTCAAGTTG

S2 ATCTGCTAAAGTATGCATTGC S2 GCTTTGGCATAAAAGTTGCAG S2 AAGCGCTCCAATACCTGCTG S2 CCATCACTTACAAGCTTATAC S2 TGACTTCCTTCAAGCTCTCC S2 GTTCCGAATAGCGAAATAACAC S2 CTACTTGCCTCATCCAATCAC

Source: Multilocus sequence typing website (http://pubmlst.org/campylobacter/) cited in Jolley, K.A., Maiden, M.C., 2010. BIGSdb: scalable analysis of bacterial genome variation at the population level. BMC Bioinform. 11, 595.

dynamics of C. jejuni related to geographic or host-specific delimitation. Despite its use in epidemiological studies, it has also been used in the poultry industry as an intervention strategy to decrease food contamination (Muellner et al., 2013; Sears et al., 2011). MLST was also applied for several Campylobacter species, including C. lari, C. upsaliensis, C. helveticus, C. fetus, C. sputorum, C. hyointestinalis, C. curvus, and C. concisus. The pubMLST (http://pubmlst.org/campylobacter/) is the public domain where all published data is compiled and curated. As most Campylobacter spp. (including C. jejuni) display high genetic polymorphism due to frequently horizontal gene transfer and intramolecular recombination, application of MLST provides a better understanding of their population, genetic structure, and evolutionary relationship (On, 2013; Taboada et al., 2013). Whole genome sequence (WGS): To date, WGS has the highest discriminatory power for Campylobacter subtyping at single base pair level (Pendleton et al., 2013). C. jejuni was the first species of Campylobacter that was analyzed by WGS. Since then, scientists attempted to study the population structure of C. jejuni and C. coli by performing WGS (Taboada et al., 2013). However, with relatively high cost and the heavy load for data analysis, it is still a challenging task to apply WGS for routine subtyping. However, there is a gradual decrease in WGS platforms and the respective kits/reagents. WGS will be used more frequently in the future to identify genetic diversity in Campylobacter spp. Above all, molecular subtyping methods have become the lead methods to identify and measure the genetic similarity between Campylobacter strains. These tools have been providing the most precise data for epidemiological studies and outbreak surveillance.

8 Conclusions Campylobacteriosis is an increasing burden in the USA, as well as other developed and developing parts of the world. Approximately, 90% of infections are due to contamination of C. jejuni and C. coli in food products. Researchers and health surveillance organizations have attempted to prevent contamination in the food chain by implanting antibiotic treatment

144  Chapter 5 in animals (Barton, 2014; Wieczorek and Osek, 2013). However, studies have confirmed that antimicrobial usage in the animal increases the chance for drug resistant Campylobacter (Abley et al., 2012; Luangtongkum et al., 2009). In recent years, the drug resistance in bacteria has become an increasing public health issue. Nevertheless, it is carefully monitored and controlled. Although Campylobacter infection is usually minor and does not require treatment, long-term infection may occur in the young, elderly, or people with decreased immune system function (Blaser and Engberg, 2008). Macrolide and fluoroquinolone (FQ) are the two common antibiotics for the treatment of campylobacteriosis. Macrolide resistance in Campylobacter is related to gene modification and the efflux pump (Luangtongkum et al., 2009). The 23S rRNA methylation has been reported to be responsible for macrolide antimicrobial resistance in C. rectus (Roe et al., 1995). In C. jejuni and C. coli, point mutations of domain V on 23S rRNA were required against macrolide (Vacher et al., 2005). FQ resistance has been the most common drug resistant type detected in Campylobacter spp. (Luangtongkum et al., 2009; Wieczorek and Osek, 2013). In the USA and Canada, almost 50% of Campylobacter strains isolated from patients are resistant to ciprofloxacin (Gupta et al., 2004). Similar observations were made in Europe, Asia, and Africa as well (Luangtongkum et al., 2009). The point mutations on the gyrA gene are responsible for Campylobacter FQ resistance. Although accumulation of point mutations on the quinolone resistance-determining region (QRDR) increases the resistance strength, one single mutation on gyrA gene is enough to lower the susceptibility to FQ (Luo et al., 2003). The efflux pump and CmeABC also play important roles for antimicrobial resistance in Campylobacter spp. (Yan et al., 2006). CmeABC has been suggested to be an effective modifier for either FQ or macrolide resistance (Wieczorek and Osek, 2013). It works synergistically with point mutations to elevate the resistance level (Luo et al., 2003; Wieczorek and Osek, 2013). In 2000, antibiotics were first introduced to the livestock to prevent the Campylobacter contamination in the food chain in the USA and Canada. However, with growing cases of Campylobacter antibiotic resistance in humans, the FDA prohibited the use of FQ antimicrobials in poultry products in 2005 (http://www. fda.gov/AnimalVeterinary/SafetyHealth/RecallsWithdrawals/ucm042004.htm). In 2014, the White House also announced the national strategy to combat drug resistance bacteria (http:// www.fda.gov/AnimalVeterinary/SafetyHealth/AntimicrobialResistance/). Recently, the new antimicrobial development is targeted on the CmeABC efflux pump (Guo et al., 2010). Another solution to prevent Campylobacter infection is vaccine development. As 90% of infection is caused by C. jejuni, researchers have been designing vaccine strategies against it (Riddle and Guerry, 2016). However, there is no approved vaccine available currently in the market to prevent campylobacteriosis. The challenge for vaccine development is due to the presence of enormous antigenic diversity within C. jejuni (Tribble et al., 2010). If the vaccine is targeted at the outer lipooligosaccharide, it may result in an autoimmune response during the infection as its structure mimics human gangliosides (Albert, 2014). The capsule

Campylobacteriosis: An Emerging Infectious Foodborne Disease  145 polysaccharide (CPS) is the other target for C. jejuni vaccine development, which is similar to LOS but cannot turn on the autoimmune system (Monteiro et al., 2009). So far, only vaccines that targeted the CPS have entered the phase I clinical trial (http://www.foodsafetynews.com), and one vaccine that targeted PEB1 protein has gone to a preclinical trial for human health surveillance (Status of Vaccine Research and Development for Campylobacter Prepared for WHO PD-VAC). A vaccination for the livestock has also been considered to reduce the chance of infection during the food process. More recently, the surfaced-exposed colonization proteins, such as CadF, FlaA, and CmeC, were used as vaccination targets for poultry vaccination (Neal-Mckinney et al., 2014). The goal for livestock vaccination is to provide food safety and further reduce campylobacteriosis. In general, Campylobacter infection is distributed globally and confirmed cases have dramatically increased worldwide. This bacterium commonly exists in food animals, environments, and house pets, and is associated with a foodborne outbreak of contaminated food (especially poultry products) and water. Although over 90% of the infection is caused by C. jejui and C. coli, several emerging species of Campylobacter have also been identified as responsible for infections (Kaakoush et al., 2015; Man, 2011). The infection is usually selflimited; however, reoccurring and persistent disease can occur. In addition, Campylobacter has also been associated with Guillain–Barré syndrome, a leading cause for acute flaccid paralysis. The understanding of Campylobacter has increased in recent years, and various strategies were developed to reduce infection. Nevertheless, unsolved questions still remain, such as the VBNC forms, bacteria serotypes characteristics, and antibiotic resistance (Epps et al., 2013). In addition, the campylobacteriosis rate remains high internationally. Thus, the goal for future studies is to reveal the details of infection mechanisms and the development of rapid diagnostic methods for their detection, as well as the development of a vaccine for public health and safety.

Acknowledgments The findings and conclusions made in this manuscript are those of the authors and do not necessarily represent the views or official position of the FDA. The names of vendors or manufacturers are provided as examples of available product sources; inclusion does not imply endorsement of the vendors, manufacturers, or products by the FDA or the US Department of Health and Human Services. The agency had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References Abley, M.J., Wittum, T.E., Funk, J.A., Gebreyes, W.A., 2012. Antimicrobial susceptibility, pulsed-field gel electrophoresis, and multi-locus sequence typing of Campylobacter coli in swine before, during, and after the slaughter process. Foodborne Pathog. Dis. 9, 506–512. Agulla, A., Merino, F.J., Villasante, P.A., Saz, J.V., Díaz, A., Velasco, A.C., 1987. Evaluation of four enrichment media for isolation of Campylobacter jejuni. J. Clin. Microbiol. 25, 174–175. Albert, M.J., 2014. Vaccine against Campylobacter jejuni. J. Clin. Immunol. 1, 1013–1015.

146  Chapter 5 Alm, R.A., Guerry, P., Power, M.E., Lior, H., Trust, T.J., 1991. Analysis of the role of flagella in the heat-labile Lior serotyping scheme of thermophilic Campylobacters by mutant allele exchange. J. Clin. Microbiol. 29, 2438–2445. Alm, R.A., Guerry, P., Trust, T.J., 1993a. The Campylobacter sigma 54 flaB flagellin promoter is subject to environmental regulation. J. Bacteriol. 175, 4448–4455. Alm, R.A., Guerry, P., Trust, T.J., 1993b. Distribution and polymorphism of the flagellin genes from isolates of Campylobacter coli and Campylobacter jejuni. J. Bacteriol. 175, 3051–3057. Alm, R.A., Guerry, P., Trust, T.J., 1993c. Significance of duplicated flagellin genes in Campylobacter. J. Mol. Biol. 230, 359–363. Alter, T., Gaull, F., Kasimir, S., Gurtler, M., Mielke, H., Linnebur, M., Fehlhaber, K., 2005. Prevalences and transmission routes of Campylobacter spp. strains within multiple pig farms. Vet. Microbiol. 108, 251–261. Asakura, M., Samosornsuk, W., Hinenoya, A., Misawa, N., Nishimura, K., Matsuhisa, A., Yamasaki, S., 2008. Development of a cytolethal distending toxin (cdt) gene-based species-specific multiplex PCR assay for the detection and identification of Campylobacter jejuni, Campylobacter coli and Campylobacter fetus. FEMS Immunol. Med. Microbiol. 52, 260–266. Aspinall, G.O., Lynch, C.M., Pang, H., Shaver, R.T., Moran, A.P., 1995a. Chemical structures of the core region of Campylobacter jejuni O:3 lipopolysaccharide and an associated polysaccharide. Eur. J. Biochem. 231, 570–578. Aspinall, G.O., Mcdonald, A.G., Pang, H., Kurjanczyk, L.A., Penner, J.L., 1993. Lipopolysaccharide of Campylobacter coli serotype O:30. Fractionation and structure of liberated core oligosaccharide. J. Biol. Chem. 268, 6263–6268. Aspinall, G.O., Monteiro, M.A., Pang, H., 1995b. Lipo-oligosaccharide of the Campylobacter lari type strain ATCC 35221. Structure of the liberated oligosaccharide and an associated extracellular polysaccharide. Carbohydr. Res. 279, 245–264. Atabay, H.I., Corry, J.E., 1998. The isolation and prevalence of campylobacters from dairy cattle using a variety of methods. J. Appl. Microbiol. 84, 733–740. Bachtiar, B.M., Coloe, P.J., Fry, B.N., 2007. Knockout mutagenesis of the kpsE gene of Campylobacter jejuni 81116 and its involvement in bacterium-host interactions. FEMS Immunol. Med. Microbiol. 49, 149–154. Bacon, D.J., Szymanski, C.M., Burr, D.H., Silver, R.P., Alm, R.A., Guerry, P., 2001. A phase-variable capsule is involved in virulence of Campylobacter jejuni 81-176. Mol. Microbiol. 40, 769–777. Barton, M.D., 2014. Impact of antibiotic use in the swine industry. Curr. Opin. Microbiol. 19, 9–15. Bax, M., Kuijf, M.L., Heikema, A.P., Van Rijs, W., Bruijns, S.C.M., García-Vallejo, J.J., Crocker, P.R., Jacobs, B.C., Van Vliet, S.J., Van Kooyk, Y., 2011. Campylobacter jejuni lipooligosaccharides modulate dendritic cell-mediated T cell polarization in a sialic acid linkage-dependent manner. Infect. Immun. 79, 2681–2689. Baylis, C.L., Macphee, S., Martin, K.W., Humphrey, T.J., Betts, R.P., 2000. Comparison of three enrichment media for the isolation of Campylobacter spp. from foods. J. Appl. Microbiol. 89, 884–891. Beach, J.C., Murano, E.A., Acuff, G.R., 2002. Prevalence of Salmonella and Campylobacter in beef cattle from transport to slaughter. J. Food. Protect. 65, 1687–1693. Berrang, M.E., Buhr, R.J., Cason, J.A., Dickens, J.A., 2001. Broiler carcass contamination with Campylobacter from feces during defeathering. J. Food. Protect. 64, 2063–2066. Blaser, M.J., Engberg, J., 2008. Clinical aspects of Campylobacter jejuni and Campylobacter coli infections. In: Nachamkin, I., Szymanski, C.M., Blaser, M.J. (Eds.), Campylobacter. ASM Press, Washington, DC, pp. 99–121. Bolton, F.J., Coates, D., Hutchinson, D.N., 1984. The ability of campylobacter media supplements to neutralize photochemically induced toxicity and hydrogen peroxide. J. Appl. Bacteriol. 56, 151–157. Bolton, F.J., Holt, A.V., Hutchinson, D.N., 1985. Urease-positive thermophilic campylobacters. Lancet 1, 1217–1218. Bras, A.M., Chatterjee, S., Wren, B.W., Newell, D.G., Ketley, J.M., 1999. A novel Campylobacter jejuni twocomponent regulatory system important for temperature-dependent growth and colonization. J. Bacteriol. 181, 3298–3302. Bullman, S., Corcoran, D., O’leary, J., O’hare, D., Lucey, B., Sleator, R.D., 2011. Emerging dynamics of human campylobacteriosis in Southern Ireland. FEMS Immunol. Med. Microbiol. 63, 248–253.

Campylobacteriosis: An Emerging Infectious Foodborne Disease  147 Butzler, J.P., 2004. Campylobacter, from obscurity to celebrity. Clin. Microbiol. Infect. 10, 868–876. Byrne, C.M., Clyne, M., Bourke, B., 2007. Campylobacter jejuni adhere to and invade chicken intestinal epithelial cells in vitro. Microbiology 153, 561–569. Callicott, K.A., Friethriksdottir, V., Reiersen, J., Lowman, R., Bisaillon, J.R., Gunnarsson, E., Berndtson, E., Hiett, K.L., Needleman, D.S., Stern, N.J., 2006. Lack of evidence for vertical transmission of Campylobacter spp. in chickens. Appl. Environ. Microbiol. 72, 5794–5798. Cameron, A., Frirdich, E., Huynh, S., Parker, C.T., Gaynor, E.C., 2012. Hyperosmotic stress response of Campylobacter jejuni. J. Bacteriol. 194, 6116–6130. Casanovas, L., De Simón, M., Ferrer, M.D., Arqués, J., Monzón, G., 1995. Intestinal carriage of campylobacters, salmonellas, yersinias and listerias in pigeons in the City of Barcelona. J. Appl. Bacteriol. 78, 11–13. Champion, O.L., Best, E.L., Frost, J.A., 2002. Comparison of pulsed-field gel electrophoresis and amplified fragment length polymorphism techniques for investigating outbreaks of enteritis due to campylobacters. J. Clin. Microbiol. 40, 2263–2265. Champion, O.L., Al-Jaberi, S., Stabler, R.A., Wren, B.W., 2008. Comparative genomics of Campylobacter jejuni. In: Nachamkin, I., Szymanski, C.M., Blaser, M.J. (Eds.), Campylobacter. third ed. ASM Press, Washington, DC, pp. 63–95. Chen, J., Sun, X.T., Zeng, Z., Yu, Y.Y., 2011. Campylobacter enteritis in adult patients with acute diarrhea from 2005 to 2009 in Beijing. China. Chin. Med. J. 124, 1508–1512. Chon, J.W., Kim, H.S., Kim, H., Oh, D.H., Seo, K.H., 2014. Evaluation of potassium-clavulanate-supplemented modified charcoal-cefoperazone-deoxycholate agar for enumeration of Campylobacter in chicken carcass rinse. J. Food. Sci. 79, M923–M926. Chou, W.K., Dick, S., Wakarchuk, W.W., Tanner, M.E., 2005. Identification and characterization of NeuB3 from Campylobacter jejuni as a pseudaminic acid synthase. J. Biol. Chem. 280, 35922–35928. Clark, A.G., Bueschkens, D.H., 1985. Laboratory infection of chicken eggs with Campylobacter jejuni by using temperature or pressure differentials. Appl. Environ. Microbiol. 49, 1467–1471. Colegio, O.R., Griffin, T.J.T., Grindley, N.D., Galan, J.E., 2001. In vitro transposition system for efficient generation of random mutants of Campylobacter jejuni. J. Bacteriol. 183, 2384–2388. Corry, J.E., Post, D.E., Colin, P., Laisney, M.J., 1995. Culture media for the isolation of campylobacters. Int. J. Food. Microbiol. 26, 43–76. Damborg, P., Olsen, K.E., Moller Nielsen, E., Guardabassi, L., 2004. Occurrence of Campylobacter jejuni in pets living with human patients infected with C. jejuni. J. Clin. Microbiol. 42, 1363–1364. Dasti, J.I., Tareen, A.M., Lugert, R., Zautner, A.E., Gross, U., 2010. Campylobacter jejuni: a brief overview on pathogenicity-associated factors and disease-mediating mechanisms. Int. J. Med. Microbiol. 300, 205–211. Davis, L., Dirita, V., 2005. Growth and laboratory maintenance of Campylobacter jejuni. Curr. Protoc. Microbiol. Chapter 8, Unit 8A.1.1–8A.1.7. De Boer, R.F., Ott, A., Güren, P., Van Zanten, E., Van Belkum, A., Kooistra-Smid, A.M.D., 2013. Detection of Campylobacter species and Arcobacter butzleri in stool samples by use of real-time multiplex PCR. J. Clin. Microbiol. 51, 253–259. Debruyne, L., Gevers, D., Vandamme, P., 2008. Taxonomy of the family Campylobacteraceae. In: Nachamkin, I., Szymanski, C.M., Blaser, M.J. (Eds.), Campylobacter. third ed. ASM Press, Washington, DC, pp. 3–25. Dingle, K.E., Colles, F.M., Wareing, D.R., Ure, R., Fox, A.J., Bolton, F.E., Bootsma, H.J., Willems, R.J., Urwin, R., Maiden, M.C., 2001. Multilocus sequence typing system for Campylobacter jejuni. J. Clin. Microbiol. 39, 14–23. Dingle, K.E., Colles, F.M., Falush, D., Maiden, M.C., 2005. Sequence typing and comparison of population biology of Campylobacter coli and Campylobacter jejuni. J. Clin. Microbiol. 43, 340–347. Enright, M.C., Spratt, B.G., 1999. Multilocus sequence typing. Trends Microbiol. 7, 482–487. Epps, S.V., Harvey, R.B., Hume, M.E., Phillips, T.D., Anderson, R.C., Nisbet, D.J., 2013. Foodborne Campylobacter: infections, metabolism, pathogenesis and reservoirs. Int. J. Environ. Res. Public Health 10, 6292–6304. Erganis, O., Kaya, O., Hadimli, H.H., Guler, L., 2002. Rapid diagnosis of ovine Brucella, Campylobacter and Salmonella infections from fetal stomach contents by coagglutination test. Small Rumin. Res. 45, 123–127.

148  Chapter 5 Fenwick, S.G., West, D.M., Hunter, J.E., Sargison, N.D., Ahmed, F., Lumsden, J.S., Collett, M.G., 2000. Campylobacter fetus fetus abortions in vaccinated ewes. N. Z. Vet. J. 48, 155–157. Fitzgerald, C., Nachamkin, I., 2015. Campylobacter and Arcobacter. In: Jorgensen, J.H., Pfaller, M.A. (Eds.), Manual of Clinical Microbiology. 11th Edition American Society of Microbiology, Washington DC, pp. 998–1012. Ford, A.C., Thabane, M., Collins, S.M., Moayyedi, P., Garg, A.X., Clark, W.F., Marshall, J.K., 2010. Prevalence of uninvestigated dyspepsia 8 years after a large waterborne outbreak of bacterial dysentery: a cohort study. Gastroenterology 138, 1727–1736. Francioli, P., Herzstein, J., Grob, J.P., Vallotton, J.J., Mombelli, G., Glauser, M.P., 1985. Campylobacter-fetus subspecies fetus bacteremia. Arch. Intern. Med. 145, 289–292. Futagami, S., Itoh, T., Sakamoto, C., 2015. Systematic review with meta-analysis: post-infectious functional dyspepsia. Aliment. Pharmacol. Ther. 41, 177–188. Gharst, G., Oyarzabal, O.A., Hussain, S.K., 2013. Review of current methodologies to isolate and identify Campylobacter spp. from foods. J. Microbiol. Methods. 95, 84–92. Gill, C.O., Harris, L.M., 1982. Contamination of red-meat carcasses by Campylobacter fetus subsp. jejuni. Appl. Environ. Microbiol. 43, 977–980. Gilpin, B., Robson, B., Lin, S., Scholes, P., On, S., 2012. Pulsed-field gel electrophoresis analysis of more than one clinical isolate of Campylobacter spp. from each of 49 patients in New Zealand. J. Clin. Microbiol. 50, 457–459. Gonzalez, M., Hanninen, M.L., 2012. Effect of temperature and antimicrobial resistance on survival of Campylobacter jejuni in well water: application of the Weibull model. J. Appl. Microbiol. 113, 284–293. Guerry, P., 2007. Campylobacter flagella: not just for motility. Trends Microbiol. 15, 456–461. Guerry, P., Alm, R.A., Power, M.E., Logan, S.M., Trust, T.J., 1991. Role of two flagellin genes in Campylobacter motility. J. Bacteriol. 173, 4757–4764. Guerry, P., Ewing, C.P., Schirm, M., Lorenzo, M., Kelly, J., Pattarini, D., Majam, G., Thibault, P., Logan, S., 2006. Changes in flagellin glycosylation affect Campylobacter autoagglutination and virulence. Mol. Microbiol. 60, 299–311. Guerry, P., Poly, F., Riddle, M., Maue, A.C., Chen, Y.H., Monteiro, M.A., 2012. Campylobacter polysaccharide capsules: virulence and vaccines. Front. Cell. Infect. Microbiol., 2. Guo, B., Lin, J., Reynolds, D.L., Zhang, Q., 2010. Contribution of the multidrug efflux transporter CmeABC to antibiotic resistance in different Campylobacter species. Foodborne Pathog. Dis. 7, 77–83. Gupta, A., Nelson, J.M., Barrett, T.J., Tauxe, R.V., Rossiter, S.P., Friedman, C.R., Joyce, K.W., Smith, K.E., Jones, T.F., Hawkins, M.A., Shiferaw, B., Beebe, J.L., Vugia, D.J., Rabatsky-Ehr, T., Benson, J.A., Root, T.P., Angulo, F.J., Group, N.W., 2004. Antimicrobial resistance among Campylobacter strains, United States, 1997–2001. Emerg. Infect. Dis. 10, 1102–1109. Gurgan, T., Diker, K.S., 1994. Abortion associated with Campylobacter upsaliensis. J. Clin. Microbiol. 32, 3093–3094. Gutierrez-Banuelos, H., Anderson, R.C., Carstens, G.E., Slay, L.J., Ramlachan, N., Horrocks, S.M., Callaway, T.R., Edrington, T.S., Nisbet, D.J., 2007. Zoonotic bacterial populations, gut fermentation characteristics and methane production in feedlot steers during oral nitroethane treatment and after the feeding of an experimental chlorate product. Anaerobe 13, 21–31. Haddad, N., Burns, C.M., Bolla, J.M., Prévost, H., Fédérighi, M., Drider, D., Cappelier, J.M., 2009. Long-term survival of Campylobacter jejuni at low temperatures is dependent on polynucleotide phosphorylase activity. Appl. Environ. Microbiol. 75, 7310–7318. Haines, M.D., Eberle, K.N., Mcdaniel, C.D., Kiess, A.S., 2011. Evaluating 3 gas-delivery systems for culturing Campylobacter jejuni in a microaerophilic environment. Poult. Sci. 90, 2378–2382. Hall, G., Becker, K.M., Gregory Je, N., Unicomb, L., Millard, G., 2005. Estimating foodborne gastroenteritis. Aust. Emerg. Infect. Dis. 11, 1257–1264. Hara-Kudo, Y., Takatori, K., 2011. Contamination level and ingestion dose of foodborne pathogens associated with infections. Epidemiol. Infect. 139, 1505–1510. Hassane, D.C., Lee, R.B., Mendenhall, M.D., Pickett, C.L., 2001. Cytolethal distending toxin demonstrates genotoxic activity in a yeast model. Infect. Immun. 69, 5752–5759.

Campylobacteriosis: An Emerging Infectious Foodborne Disease  149 Hassane, D.C., Lee, R.B., Pickett, C.L., 2003. Campylobacter jejuni cytolethal distending toxin promotes DNA repair responses in normal human cells. Infect. Immun. 71, 541–545. Havelaar, A.H., Ivarsson, S., Lofdahl, M., Nauta, M.J., 2013. Estimating the true incidence of campylobacteriosis and salmonellosis in the European Union, 2009. Epidemiol. Infect. 141, 293–302. Hazeleger, W.C., Wouters, J.A., Rombouts, F.M., Abee, T., 1998. Physiological activity of Campylobacter jejuni far below the minimal growth temperature. Appl. Environ. Microbiol. 64, 3917–3922. Heikema, A.P., Jacobs, B.C., Horst-Kreft, D., Huizinga, R., Kuijf, M.L., Endtz, H.P., Samsom, J.N., Van Wamel, W.J.B., 2013. SIGLEC-7 specifically recognizes Campylobacter jejuni strains associated with oculomotor weakness in Guillain–Barré syndrome and Miller Fisher syndrome. Clin. Microbiol. Infect. 19, E106–E112. Hendrixson, D.R., 2006. A phase-variable mechanism controlling the Campylobacter jejuni FlgR response regulator influences commensalism. Mol. Microbiol. 61, 1646–1659. Hendrixson, D.R., Dirita, V.J., 2003. Transcription of sigma54-dependent but not sigma28-dependent flagellar genes in Campylobacter jejuni is associated with formation of the flagellar secretory apparatus. Mol. Microbiol. 50, 687–702. Hendrixson, D.R., Dirita, V.J., 2004. Identification of Campylobacter jejuni genes involved in commensal colonization of the chick gastrointestinal tract. Mol. Microbiol. 52, 471–484. Hokajarvi, A.M., Pitkanen, T., Siljanen, H.M., Nakari, U.M., Torvinen, E., Siitonen, A., Miettinen, I.T., 2013. Occurrence of thermotolerant Campylobacter spp. and adenoviruses in Finnish bathing waters and purified sewage effluents. J. Water Health 11, 120–134. Hughes, R., 2004. Campylobacter jejuni in Guillain–Barré syndrome. Lancet Neurol. 3, 644. Humphrey, T., O’brien, S., Madsen, M., 2007. Campylobacters as zoonotic pathogens: a food production perspective. Int. J. Food. Microbiol. 117, 237–257. Hunt, J.M., Abeyta, C., Tran, T., 1998. Campylobacter. Food and Drug Administration bacteriological analytical manual. eight ed. AOAC International, Gaithersburg, MD. Hurd, S., Patrick, M., Hatch, J., Clogher, P., Wymore, K., Cronquist, A.B., Segler, S., Robinson, T., Hanna, S., Smith, G., Fitzgerald, C., 2012. Clinical laboratory practices for the isolation and identification of Campylobacter in Foodborne Diseases Active Surveillance Network (FoodNet) sites: baseline information for understanding changes in surveillance data. Clin. Infect. Dis. 54, S440–S445. Hutchinson, D.N., Bolton, F.J., 1984. Improved blood free selective medium for the isolation of Campylobacter jejuni from faecal specimens. J. Clin. Pathol. 37, 956–957. Jagannathan, A., Constantinidou, C., Penn, C.W., 2001. Roles of rpoN, fliA, and flgR in expression of flagella in Campylobacter jejuni. J. Bacteriol. 183, 2937–2942. Jensen, A.N., Dalsgaard, A., Baggesen, D.L., Nielsen, E.M., 2006. The occurrence and characterization of Campylobacter jejuni and C. coli in organic pigs and their outdoor environment. Vet. Microbiol. 116, 96–105. Johnson, W.M., Lior, H., 1986. Cytotoxic and cytotonic factors produced by Campylobacter jejuni, Campylobacter coli, and Campylobacter laridis. J. Clin. Microbiol. 24, 275–281. Jones, K., 2001. Campylobacters in water, sewage and the environment. J. Appl. Microbiol. 90, 68S–79S. Jones, D.M., Sutcliffe, E.M., Curry, A., 1991. Recovery of viable but non-culturable Campylobacter jejuni. J. Gen. Microbiol. 137, 2477–2482. Kaakoush, N.O., Castano-Rodriguez, N., Mitchell, H.M., Man, S.M., 2015. Global epidemiology of Campylobacter infection. Clin. Microbiol. Rev. 28, 687–720. Kakuda, T., Dirita, V.J., 2006. Cj1496c encodes a Campylobacter jejuni glycoprotein that influences invasion of human epithelial cells and colonization of the chick gastrointestinal tract. Infect. Immun. 74, 4715–4723. Karlyshev, A.V., Everest, P., Linton, D., Cawthraw, S., Newell, D.G., Wren, B.W., 2004. The Campylobacter jejuni general glycosylation system is important for attachment to human epithelial cells and in the colonization of chicks. Microbiology 150, 1957–1964. Karlyshev, A.V., Linton, D., Gregson, N.A., Lastovica, A.J., Wren, B.W., 2000. Genetic and biochemical evidence of a Campylobacter jejuni capsular polysaccharide that accounts for Penner serotype specificity. Mol. Microbiol. 35, 529–541. Karlyshev, A.V., Mccrossan, M.V., Wren, B.W., 2001. Demonstration of polysaccharide capsule in Campylobacter jejuni using electron microscopy. Infect. Immun. 69, 5921–5924.

150  Chapter 5 Karlyshev, A.V., Wren, B.W., 2001. Detection and initial characterization of novel capsular polysaccharide among diverse Campylobacter jejuni strains using alcian blue dye. J. Clin. Microbiol. 39, 279–284. Keithlin, J., Sargeant, J., Thomas, M.K., Fazil, A., 2014. Systematic review and meta-analysis of the proportion of Campylobacter cases that develop chronic sequelae. BMC Public Health 14, 1–19. Koenraad, P.M.F.J., Rombouts, F.M., Notermans, S.H.W., 1997. Epidemiological aspects of thermophilic Campylobacter in water-related environments: a review. Water Environ. Res. 69, 52–63. Komagamine, T., Yuki, N., 2006. Ganglioside mimicry as a cause of Guillain–Barré syndrome. CNS Neurol. Disord. Drug Targets 5, 391–400. Kotloff, K.L., Nataro, J.P., Blackwelder, W.C., Nasrin, D., Farag, T.H., Panchalingam, S., Wu, Y., Sow, S.O., Sur, D., Breiman, R.F., Faruque, A.S.G., Zaidi, A.K.M., Saha, D., Alonso, P.L., Tamboura, B., Sanogo, D., Onwuchekwa, U., Manna, B., Ramamurthy, T., Kanungo, S., Ochieng, J.B., Omore, R., Oundo, J.O., Hossain, A., Das, S.K., Ahmed, S., Qureshi, S., Quadri, F., Adegbola, R.A., Antonio, M., Hossain, M.J., Akinsola, A., Mandomando, I., Nhampossa, T., Acácio, S., Biswas, K., O’reilly, C.E., Mintz, E.D., Berkeley, L.Y., Muhsen, K., Sommerfelt, H., Robins-Browne, R.M., Levine, M.M., 2013. Burden and aetiology of diarrhoeal disease in infants and young children in developing countries (the Global Enteric Multicenter Study, GEMS): a prospective, case-control study. Lancet 382, 209–222. Kubota, K., Kasuga, F., Iwasaki, E., Inagaki, S., Sakurai, Y., Komatsu, M., Toyofuku, H., Angulo, F.J., Scallan, E., Morikawa, K., 2011. Estimating the burden of acute gastroenteritis and foodborne illness caused by Campylobacter, Salmonella, and Vibrio parahaemolyticus by using population-based telephone survey data, Miyagi Prefecture, Japan, 2005 to 2006. J. Food Protect. 74, 1592–1598. Kuroki, S., Saida, T., Nukina, M., Haruta, T., Yoshioka, M., Kobayashi, Y., Nakanishi, H., 1993. Campylobacter jejuni strains from patients with Guillain–Barré syndrome belong mostly to Penner serogroup 19 and contain beta-N-acetylglucosamine residues. Ann. Neurol. 33, 243–247. Laprade, N., Cloutier, M., Lapen, D.R., Topp, E., Wilkes, G., Villemur, R., Khan, I.U.H., 2016. Detection of virulence, antibiotic resistance and toxin (VAT) genes in Campylobacter species using newly developed multiplex PCR assays. J. Microbiol. Methods. 124, 41–47. Lara-Tejero, M., Galan, J.E., 2000. A bacterial toxin that controls cell cycle progression as a deoxyribonuclease I-like protein. Science 290, 354–357. Lara-Tejero, M., Galan, J.E., 2001. CdtA, CdtB, and CdtC form a tripartite complex that is required for cytolethal distending toxin activity. Infect. Immun. 69, 4358–4365. Lastovica, A.J., 2006. Emerging Campylobacter spp.: the tip of the iceberg. Clin. Microbiol. News 28, 49–56. Lastovica, A.J., Le Roux, E., 2000. Efficient isolation of campylobacteria from stools. J. Clin. Microbiol. 38, 2798–2799. Lastovica, A.J., Le Roux, E., 2001. Efficient isolation of Campylobacter upsaliensis from stools. J. Clin. Microbiol. 39, 4222–4223. Levin, R.E., 2007. Campylobacter jejuni: a review of its characteristics, pathogenicity, ecology, distribution, subspecies characterization and molecular methods of detection. Food Biotechnol. 21, 271–347. Levy, A.J., 1946. A gastro-enteritis cutbreak probably due to a bovine strain of Vibrio. Yale. J. Biol. Med. 18, 243–258. Lior, H., Butzler, J.P., 1986. Serotyping campylobacter. Lancet 1, 1381–1382. Lior, H., Woodward, D.L., Edgar, J.A., Laroche, L.J., Gill, P., 1982. Serotyping of Campylobacter jejuni by slide agglutination based on heat-labile antigenic factors. J. Clin. Microbiol. 15, 761–768. Luangtongkum, T., Jeon, B., Han, J., Plummer, P., Logue, C.M., Zhang, Q., 2009. Antibiotic resistance in Campylobacter: emergence, transmission and persistence. Future Microbiol. 4, 189–200. Luo, N., Sahin, O., Lin, J., Michel, L.O., Zhang, Q., 2003. In vivo selection of Campylobacter isolates with high levels of fluoroquinolone resistance associated with gyrA mutations and the function of the CmeABC efflux pump. Antimicrob. Agents Chemother. 47, 390–394. Lynch, O.A., Cagney, C., Mcdowell, D.A., Duffy, G., 2011. Occurrence of fastidious Campylobacter spp. in fresh meat and poultry using an adapted cultural protocol. Int. J. Food. Microbiol. 150, 171–177. Mace, S., Haddad, N., Zagorec, M., Tresse, O., 2015. Influence of measurement and control of microaerobic gaseous atmospheres in methods for Campylobacter growth studies. Food Microbiol. 52, 169–176.

Campylobacteriosis: An Emerging Infectious Foodborne Disease  151 Maher, M., Finnegan, C., Collins, E., Ward, B., Carroll, C., Cormican, M., 2003. Evaluation of culture methods and a DNA probe-based PCR assay for detection of Campylobacter species in clinical specimens of feces. J. Clin. Microbiol. 41, 2980–2986. Maiden, M.C., Bygraves, J.A., Feil, E., Morelli, G., Russell, J.E., Urwin, R., Zhang, Q., Zhou, J., Zurth, K., Caugant, D.A., Feavers, I.M., Achtman, M., Spratt, B.G., 1998. Multilocus sequence typing: a portable approach to the identification of clones within populations of pathogenic microorganisms. Proc. Natl. Acad. Sci. USA 95, 3140–3145. Man, S.M., 2011. The clinical importance of emerging Campylobacter species. Nat. Rev. Gastroenterol. Hepatol. 8, 669–685. Man, S.M., Kaakoush, N.O., Octavia, S., Mitchell, H., 2010. The internal transcribed spacer region, a new tool for use in species differentiation and delineation of systematic relationships within the Campylobacter genus. Appl. Environ. Microbiol. 76, 3071–3081. Mannering, S.A., West, D.M., Fenwick, S.G., Marchant, R.M., O’connell, K., 2006. Pulsed-field gel electrophoresis of Campylobacter jejuni sheep abortion isolates. Vet. Microbiol. 115, 237–242. Manning, G., Dowson, C.G., Bagnall, M.C., Ahmed, I.H., West, M., Newell, D.G., 2003. Multilocus sequence typing for comparison of veterinary and human isolates of Campylobacter jejuni. Appl. Environ. Microbiol. 69, 6370–6379. Mason, J., Iturriza-Gomara, M., O’brien, S.J., Ngwira, B.M., Dove, W., Maiden, M.C.J., Cunliffe, N.A., 2013. Campylobacter infection in children in Malawi is common and is frequently associated with enteric virus coinfections. PLoS One 8, e59663. Matsuda, M., Kaneko, A., Fukuyama, M., Itoh, T., Shingaki, M., Inoue, M., Moore, J.E., Murphy, P.G., Ishida, Y., 1996. First finding of urease-positive thermophilic strains of Campylobacter in river water in the Far East, namely, in Japan and their phenotypic and genotypic characterization. J. Appl. Bacteriol. 81, 608–612. Mcnally, D.J., Aubry, A.J., Hui, J.P., Khieu, N.H., Whitfield, D., Ewing, C.P., Guerry, P., Brisson, J.R., Logan, S.M., Soo, E.C., 2007. Targeted metabolomics analysis of Campylobacter coli VC167 reveals legionaminic acid derivatives as novel flagellar glycans. J. Biol. Chem. 282, 14463–14475. Mcnally, D.J., Hui, J.P., Aubry, A.J., Mui, K.K., Guerry, P., Brisson, J.R., Logan, S.M., Soo, E.C., 2006. Functional characterization of the flagellar glycosylation locus in Campylobacter jejuni 81-176 using a focused metabolomics approach. J. Biol. Chem. 281, 18489–18498. Medema, G.J., Schets, F.M., Van De Giessen, A.W., Havelaar, A.H., 1992. Lack of colonization of 1 day old chicks by viable, non-culturable Campylobacter jejuni. J. Appl. Bacteriol. 72, 512–516. Mendz, G.L., Petersen, R., Quinlivan, J.A., Kaakoush, N.O., 2014. Potential involvement of Campylobacter curvus and Haemophilus parainfluenzae in preterm birth. BMJ Case Rep. 2014doi: 10.1136/bcr-2014-205282. Miller, W., 2008. Comparative genomics of Campylobacter species other than Campylobacter jejuni. In: Nachamkin, I., Szymanski, C.M., Blaser, M.J. (Eds.), Campylobacter. third ed. ASM Press, Washington, DC, pp. 73–95. Miller, W.G., Chapman, M.H., Yee, E., On, S.L., Mcnulty, D.K., Lastovica, A.J., Carroll, A.M., Mcnamara, E.B., Duffy, G., Mandrell, R.E., 2012. Multilocus sequence typing methods for the emerging Campylobacter species C. hyointestinalis, C. lanienae, C. sputorum, C. concisus, and C. curvus. Front. Cell Infect. Microbiol. 2, 45. Monteiro, M.A., Baqar, S., Hall, E.R., Chen, Y.H., Porter, C.K., Bentzel, D.E., Applebee, L., Guerry, P., 2009. Capsule polysaccharide conjugate vaccine against diarrheal disease caused by Campylobacter jejuni. Infect. Immun. 77, 1128–1136. Moore, J.E., Corcoran, D., Dooley, J.S., Fanning, S., Lucey, B., Matsuda, M., Mcdowell, D.A., Megraud, F., Millar, B.C., O’mahony, R., O’riordan, L., O’rourke, M., Rao, J.R., Rooney, P.J., Sails, A., Whyte, P., 2005. Campylobacter. Vet. Res. 36, 351–382. Moran, A.P., Penner, J.L., 1999. Serotyping of Campylobacter jejuni based on heat-stable antigens: relevance, molecular basis and implications in pathogenesis. J. Appl. Microbiol. 86, 361–377. Mshana, S., Joloba, M., Kakooza, A., 2009. Campylobacter spp among children with acute diarrhea attending Mulago hospital in Kampala—Uganda. Afr. Health Sci. 9, 201–205.

152  Chapter 5 Muellner, P., Pleydell, E., Pirie, R., Baker, M.G., Campbell, D., Carter, P.E., French, N.P., 2013. Molecular-based surveillance of campylobacteriosis in New Zealand—from source attribution to genomic epidemiology. Euro. Surveill., 18, pii: 20365. Nachamkin, I., Allos, B.M., Ho, T., 1998. Campylobacter species and Guillain–Barré syndrome. Clin. Microbiol. Rev. 11, 555–567. Neal-Mckinney, J.M., Samuelson, D.R., Eucker, T.P., Nissen, M.S., Crespo, R., Konkel, M.E., 2014. Reducing Campylobacter jejuni colonization of poultry via vaccination. PLoS One 9, e114254. Nesbakken, T., Eckner, K., Hoidal, H.K., Rotterud, O.J., 2003. Occurrence of Yersinia enterocolitica and Campylobacter spp. in slaughter pigs and consequences for meat inspection, slaughtering, and dressing procedures. Int. J. Food Microbiol. 80, 231–240. Newell, D.G., Wagenaar, J.A., 2000. Poultry infections and their control at the farm level. In: Nachamkin, I., Blaser, M.J. (Eds.), Campylobacter. second ed. ASM Press, Washington, DC, pp. 497–510. Ng, L.K., Stiles, M.E., Taylor, D.E., 1985. Comparison of basal media for culturing Campylobacter jejuni and Campylobacter coli. J. Clin. Microbiol. 21, 226–230. Nielsen, H.L., Engberg, J., Ejlertsen, T., Bucker, R., Nielsen, H., 2012. Short-term and medium-term clinical outcomes of Campylobacter concisus infection. Clin. Microbiol. Infect. 18, E459–E465. Nielsen, H.L., Engberg, J., Ejlertsen, T., Nielsen, H., 2013. Clinical manifestations of Campylobacter concisus infection in children. Pediatr. Infect. Dis. J. 32, 1194–1198. Nielsen, E.M., Engberg, J., Fussing, V., Petersen, L., Brogren, C.H., On, S.L., 2000. Evaluation of phenotypic and genotypic methods for subtyping Campylobacter jejuni isolates from humans, poultry, and cattle. J. Clin. Microbiol. 38, 3800–3810. Nyati, K.K., Nyati, R., 2013. Role of Campylobacter jejuni infection in the pathogenesis of Guillain–Barré syndrome: an update. Biomed. Res. Int. 2013, 852195. Oliver, J.D., 2005. The viable but nonculturable state in bacteria. J. Microbiol. 43 (1), 93–100. Olson, C.K., Ethelberg, S., Van Pelt, W., Taux, R.V., 2008. Epidemiology of Campylobacter jejuni infections in industrialized nations. In: Nachamkin, I., Szymanski, C.M., Blaser, M.J. (Eds.), Campylobacter. ASM Press, Washington DC, pp. 163–189. On, S.L., 2001. Taxonomy of Campylobacter, Arcobacter, Helicobacter and related bacteria: current status, future prospects and immediate concerns. Symp. Ser. Soc. Appl. Microbiol., 1S–15S. On, S.L., 2013. Isolation, identification and subtyping of Campylobacter: where to from here? J. Microbiol. Methods 95, 3–7. Orr, K.E., Lightfoot, N.F., Sisson, P.R., Harkis, B.A., Tweddle, J.L., Boyd, P., Carroll, A., Jackson, C.J., Wareing, D.R., Freeman, R., 1995. Direct milk excretion of Campylobacter jejuni in a dairy cow causing cases of human enteritis. Epidemiol. Infect. 114, 15–24. Oyarzabal, O.A., Williams, A., Zhou, P., Samadpour, M., 2013. Improved protocol for isolation of Campylobacter spp. from retail broiler meat and use of pulsed field gel electrophoresis for the typing of isolates. J. Microbiol. Methods 95, 76–83. Pacha, R.E., Clark, G.W., Williams, E.A., 1985. Occurrence of Campylobacter jejuni and Giardia species in muskrat (Ondatra zibethica). Appl. Environ. Microbiol. 50, 177–178. Parkhill, J., Wren, B.W., Mungall, K., Ketley, J.M., Churcher, C., Basham, D., Chillingworth, T., Davies, R.M., Feltwell, T., Holroyd, S., Jagels, K., Karlyshev, A.V., Moule, S., Pallen, M.J., Penn, C.W., Quail, M.A., Rajandream, M.A., Rutherford, K.M., Van Vliet, A.H., Whitehead, S., Barrell, B.G., 2000. The genome sequence of the food-borne pathogen Campylobacter jejuni reveals hypervariable sequences. Nature 403, 665–668. Pendleton, S., Hanning, I., Biswas, D., Ricke, S.C., 2013. Evaluation of whole-genome sequencing as a genotyping tool for Campylobacter jejuni in comparison with pulsed-field gel electrophoresis and flaA typing. Poult. Sci. 92, 573–580. Penner, J.L., 1988. The genus Campylobacter: a decade of progress. Clin. Microbiol. Rev. 1, 157–172. Pickett, C.L., Pesci, E.C., Cottle, D.L., Russell, G., Erdem, A.N., Zeytin, H., 1996. Prevalence of cytolethal distending toxin production in Campylobacter jejuni and relatedness of Campylobacter sp. cdtB gene. Infect. Immun. 64, 2070–2078.

Campylobacteriosis: An Emerging Infectious Foodborne Disease  153 Pike, B.L., Guerry, P., Poly, F., 2013. Global distribution of Penner serotypes: a systematic review. PLoS One 8, e67375. Pitkanen, T., 2013. Review of Campylobacter spp. in drinking and environmental waters. J. Microbiol. Methods 95, 39–47. Piyali, M., Ramamurthy, T., Mihir, K.B., Rajendran, K., Asish, K.M., 2013. Campylobacter jejuni in hospitalized patients with diarrhea, Kolkata, India. Emerg. Infect. Dis. 19, 1155. Porter, C.K., Choi, D., Cash, B., Pimentel, M., Murray, J., May, L., Riddle, M.S., 2013. Pathogen-specific risk of chronic gastrointestinal disorders following bacterial causes of foodborne illness. BMC Gastroenterol. 13, 1–7. Ribot, E.M., Fitzgerald, C., Kubota, K., Swaminathan, B., Barrett, T.J., 2001. Rapid pulsed-field gel electrophoresis protocol for subtyping of Campylobacter jejuni. J. Clin. Microbiol. 39, 1889–1894. Riddle, M.S., Guerry, P., 2016. Status of vaccine research and development for Campylobacter jejuni. Vaccine 34, 2893–2906. Roe, D.E., Weinberg, A., Roberts, M.C., 1995. Characterization of erythromycin resistance in Campylobacter (Wolinella) rectus. Clin. Infect. Dis. 20 (Suppl 2), S370–S371. Rollins, D.M., Colwell, R.R., 1986. Viable but nonculturable stage of Campylobacter jejuni and its role in survival in the natural aquatic environment. Appl. Environ. Microbiol. 52, 531–538. Ruiz-Palacios, G.M., Torres, J., Torres, N.I., Escamilla, E., Ruiz-Palacios, B.R., Tamayo, J., 1983. Cholera-like enterotoxin produced by Campylobacter jejuni. Characterisation and clinical significance. Lancet 2, 250–253. Saha, S.K., Saha, S., Sanyal, S.C., 1991. Recovery of injured Campylobacter jejuni cells after animal passage. Appl. Environ. Microbiol. 57, 3388–3389. Saps, M., Pensabene, L., Di Martino, L., Staiano, A., Wechsler, J., Zheng, X., Di Lorenzo, C., 2008. Postinfectious functional gastrointestinal disorders in children. J. Pediatr. 152, 812–816.e1. Schmidt, U., Chmel, H., Kaminski, Z., Sen, P., 1980. The clinical spectrum of Campylobacter fetus infections: report of five cases and review of the literature. Q. J. Med. 49, 431–442. Schonberg-Norio, D., Takkinen, J., Hanninen, M.L., Katila, M.L., Kaukoranta, S.S., Mattila, L., Rautelin, H., 2004. Swimming and Campylobacter infections. Emerg. Infect. Dis. 10, 1474–1477. Sears, A., Baker, M.G., Wilson, N., Marshall, J., Muellner, P., Campbell, D.M., Lake, R.J., French, N.P., 2011. Marked campylobacteriosis decline after interventions aimed at poultry, New Zealand. Emerg. Infect. Dis. 17, 1007–1015. Sebald, M., Veron, M., 1963. Teneur en bases de l’ADN et classification des vibrions. Ann. Inst. Pasteur Paris 105, 897–910. Seliwiorstow, T., Bare, J., Verhaegen, B., Uyttendaele, M., De Zutter, L., 2014. Evaluation of a new chromogenic medium for direct enumeration of Campylobacter in poultry meat samples. J. Food. Protect. 77, 2111–2114. Shanker, S., Lee, A., Sorrell, T.C., 1986. Campylobacter jejuni in broilers: the role of vertical transmission. J. Hyg. 96, 153–159. Silva, J., Leite, D., Fernandes, M., Mena, C., Gibbs, P.A., Teixeira, P., 2011. Campylobacter spp. as a foodborne pathogen: a review. Front. Microbiol. 2, 200. Sippy, R., Sandoval-Green, C.M., Sahin, O., Plummer, P., Fairbanks, W.S., Zhang, Q., Blanchong, J.A., 2012. Occurrence and molecular analysis of Campylobacter in wildlife on livestock farms. Vet. Microbiol. 157, 369–375. Skarp, C.P.A., Akinrinade, O., Nilsson, A.J.E., Ellström, P., Myllykangas, S., Rautelin, H., 2015. Comparative genomics and genome biology of invasive Campylobacter jejuni. Sci. Rep. 5, 17300. Spiller, R., Garsed, K., 2009. Postinfectious irritable bowel syndrome. Gastroenterology 136, 1979–1988. St Maurice, M., Cremades, N., Croxen, M.A., Sisson, G., Sancho, J., Hoffman, P.S., 2007. Flavodoxin:quinone reductase (FqrB): a redox partner of pyruvate:ferredoxin oxidoreductase that reversibly couples pyruvate oxidation to NADPH production in Helicobacter pylori and Campylobacter jejuni. J. Bacteriol. 189, 4764–4773. Stafford, R.J., Schluter, P.J., Wilson, A.J., Kirk, M.D., Hall, G., Unicomb, L., et al., 2008. Population-attributable risk estimates for risk factors associated with Campylobacter infection. Emerg. Infect. Dis. 14 (6), 895–901. Stanley, K.N., Wallace, J.S., Currie, J.E., Diggle, P.J., Jones, K., 1998. The seasonal variation of thermophilic campylobacters in beef cattle, dairy cattle and calves. J. Appl. Microbiol. 85, 472–480.

154  Chapter 5 Steinbrueckner, B., Ruberg, F., Kist, M., 2001. Bacterial genetic fingerprint: a reliable factor in the study of the epidemiology of human campylobacter enteritis? J. Clin. Microbiol. 39, 4155–4159. Stingl, K., Knüver, M.-T., Vogt, P., Buhler, C., Krüger, N.-J., Alt, K., Tenhagen, B.-A., Hartung, M., Schroeter, A., Ellerbroek, L., Appel, B., Käsbohrer, A., 2012. Quo vadis? Monitoring Campylobacter in Germany. Eur. J. Microbiol. Immunol. 2, 88–96. Sun, F., Chen, J., Zhong, L., Zhang, X.H., Wang, R., Guo, Q., Dong, Y., 2008. Characterization and virulence retention of viable but nonculturable Vibrio harveyi. FEMS Microbiol. Ecol. 64, 37–44. Szymanski, C.M., Burr, D.H., Guerry, P., 2002. Campylobacter protein glycosylation affects host cell interactions. Infect. Immun. 70, 2242–2244. Szymanski, C.M., Yao, R., Ewing, C.P., Trust, T.J., Guerry, P., 1999. Evidence for a system of general protein glycosylation in Campylobacter jejuni. Mol. Microbiol. 32, 1022–1030. Taboada, E.N., Clark, C.G., Sproston, E.L., Carrillo, C.D., 2013. Current methods for molecular typing of Campylobacter species. J. Microbiol. Methods 95, 24–31. Tam, C.C., O’Brien, S.J., Tompkins, D.S., Bolton, F.J., Berry, L., Dodds, J., Choudhury, D., Halstead, F., IturrizaGómara, M., Mather, K., Rait, G., Ridge, A., Rodrigues, L.C., Wain, J., Wood, B., Gray, J.J.A., T.I.S.E.C., 2012. Changes in causes of acute gastroenteritis in the United Kingdom over 15 years: microbiologic findings from 2 prospective, population-based studies of infectious intestinal disease. Clin. Infect. Dis. 54, 1275–1286. Teramura, H., Iwasaki, M., Ogihara, H., 2015. Development of a novel chromogenic medium for improved Campylobacter detection from poultry samples. J. Food. Prot. 78, 1750–1755. Thakur, S., Gebreyes, W.A., 2005a. Campylobacter coli in swine production: antimicrobial resistance mechanisms and molecular epidemiology. J. Clin. Microbiol. 43, 5705–5714. Thakur, S., Gebreyes, W.A., 2005b. Prevalence and antimicrobial resistance of Campylobacter in antimicrobialfree and conventional pig production systems. J. Food. Protect. 68, 2402–2410. Thibault, P., Logan, S.M., Kelly, J.F., Brisson, J.R., Ewing, C.P., Trust, T.J., Guerry, P., 2001. Identification of the carbohydrate moieties and glycosylation motifs in Campylobacter jejuni flagellin. J. Biol. Chem. 276, 34862–34870. Tholozan, J.L., Cappelier, J.M., Tissier, J.P., Delattre, G., Federighi, M., 1999. Physiological characterization of viable-but-nonculturable Campylobacter jejuni cells. Appl. Environ. Microbiol. 65, 1110–1116. Thomas, C., Gibson, H., Hill, D.J., Mabey, M., 1998. Campylobacter epidemiology: an aquatic perspective. J. Appl. Microbiol. 85, 168S–177S. Tribble, D.R., Baqar, S., Scott, D.A., Oplinger, M.L., Trespalacios, F., Rollins, D., Walker, R.I., Clements, J.D., Walz, S., Gibbs, P., Burg, E.F., Moran, A.P., Applebee, L., Bourgeois, A.L., 2010. Assessment of the duration of protection in Campylobacter jejuni experimental infection in humans. Infect. Immun. 78, 1750–1759. Vacher, S., Menard, A., Bernard, E., Santos, A., Megraud, F., 2005. Detection of mutations associated with macrolide resistance in thermophilic Campylobacter spp. by real-time PCR. Microb. Drug Resist. 11, 40–47. Vandamme, P., De Ley, J., 1991. Proposal for a new family, Campylobacteraceae. Int. J. Syst. Evol. Microbiol. 41, 451–455. Vandamme, P., Falsen, E., Rossau, R., Hoste, B., Segers, P., Tytgat, R., De Ley, J., 1991. Revision of Campylobacter, Helicobacter, and Wolinella taxonomy: emendation of generic descriptions and proposal of Arcobacter gen. nov. Int. J. Syst. Bacteriol. 41, 88–103. Velayudhan, J., Jones, M.A., Barrow, P.A., Kelly, D.J., 2004. l-Serine catabolism via an oxygen-labile l-serine dehydratase is essential for colonization of the avian gut by Campylobacter jejuni. Infect. Immun. 72, 260–268. Waldenstrom, J., Broman, T., Carlsson, I., Hasselquist, D., Achterberg, R.P., Wagenaar, J.A., Olsen, B., 2002. Prevalence of Campylobacter jejuni, Campylobacter lari, and Campylobacter coli in different ecological guilds and taxa of migrating birds. Appl. Environ. Microbiol. 68, 5911–5917. Wang, H., 2002. Rapid methods for detection and enumeration of Campylobacter spp. in foods. J. AOAC Int. 85, 996–999.

Campylobacteriosis: An Emerging Infectious Foodborne Disease  155 Wang, G., Clark, C.G., Taylor, T.M., Pucknell, C., Barton, C., Price, L., Woodward, D.L., Rodgers, F.G., 2002. Colony multiplex PCR assay for identification and differentiation of Campylobacter jejuni, C. coli, C. lari, C. upsaliensis, and C. fetus subsp. fetus. J. Clin. Microbiol. 40, 4744–4747. Wegmuller, B., Luthy, J., Candrian, U., 1993. Direct polymerase chain reaction detection of Campylobacter jejuni and Campylobacter coli in raw milk and dairy products. Appl. Environ. Microbiol. 59, 2161–2165. Weijtens, M.J., Van Der Plas, J., Bijker, P.G., Urlings, H.A., Koster, D., Van Logtestijn, J.G., Huis In’t Veld, J.H., 1997. The transmission of Campylobacter in piggeries; an epidemiological study. J. Appl. Microbiol. 83, 693–698. Wesley, I.V., Wells, S.J., Harmon, K.M., Green, A., Schroeder-Tucker, L., Glover, M., Siddique, I., 2000. Fecal shedding of Campylobacter and Arcobacter spp. in dairy cattle. Appl. Environ. Microbiol. 66, 1994–2000. White, P.L., Baker, A.R., James, W.O., 1997. Strategies to control Salmonella and Campylobacter in raw poultry products. Rev. Sci. Tech. 16, 525–541. Wieczorek, K., Osek, J., 2013. Antimicrobial resistance mechanisms among Campylobacter. Biomed. Res. Int. 2013, 340605. Wolfs, T.F., Duim, B., Geelen, S.P., Rigter, A., Thomson-Carter, F., Fleer, A., Wagenaar, J.A., 2001. Neonatal sepsis by Campylobacter jejuni: genetically proven transmission from a household puppy. Clin. Infect. Dis. 32, E97–E99. Woodall, C.A., Jones, M.A., Barrow, P.A., Hinds, J., Marsden, G.L., Kelly, D.J., Dorrell, N., Wren, B.W., Maskell, D.J., 2005. Campylobacter jejuni gene expression in the chick cecum: evidence for adaptation to a lowoxygen environment. Infect. Immun. 73, 5278–5285. Wosten, M.M., Wagenaar, J.A., Van Putten, J.P., 2004. The FlgS/FlgR two-component signal transduction system regulates the fla regulon in Campylobacter jejuni. J. Biol. Chem. 279, 16214–16222. Yan, M., Sahin, O., Lin, J., Zhang, Q., 2006. Role of the CmeABC efflux pump in the emergence of fluoroquinolone-resistant Campylobacter under selection pressure. J. Antimicro. Chemother. 58, 1154–1159. Young, K.T., Davis, L.M., Dirita, V.J., 2007. Campylobacter jejuni: molecular biology and pathogenesis. Nat. Rev. Microbiol. 5, 665–679. Yu, R.K., Usuki, S., Ariga, T., 2006. Ganglioside molecular mimicry and its pathological roles in Guillain–Barré syndrome and related diseases. Infect. Immun. 74, 6517–6527. Zanetti, F., Varoli, O., Stampi, S., De Luca, G., 1996. Prevalence of thermophilic Campylobacter and Arcobacter butzleri in food of animal origin. Int. J. Food. Microbiol. 33, 315–321. Zhang, L., Man, S.M., Day, A.S., Leach, S.T., Lemberg, D.A., Dutt, S., Stormon, M., Otley, A., O’loughlin, E.V., Magoffin, A., Ng, P.H., Mitchell, H., 2009. Detection and isolation of Campylobacter species other than C. jejuni from children with Crohn’s disease. J. Clin. Microbiol. 47, 453–455.

Page left intentionally blank

CHAPTE R 6

Listeria monocytogenes: A Food-Borne Pathogen Meenakshi Thakur*, Rajesh Kumar Asrani*, Vikram Patial** *Dr. G.C. Negi College of Veterinary and Animal Sciences, Chaudhary Sarwan Kumar Himachal Pradesh Krishi Vishvavidyalaya, Palampur, Himachal Pradesh, India; **CSIR-Institute of Himalayan Bioresource Technology, Palampur, Himachal Pradesh, India

1 Introduction Listeria genus includes Gram-positive, nonsporulating, rod-shaped aerobic or facultative anaerobic microorganisms. The genus includes 10 species, Listeria monocytogenes, L. innocua, L. ivanovii, L. seeligeri, L. grayi, L. welshimeri (Hitchins et al., 2016), L. rocourtiae (Leclercq et al., 2010), L. marthii (Graves et al., 2010), L. weihenstephanensis (Lang Halter et al., 2013), and L. fleischmanni (Bertsch et al., 2013). Among these, only L. monocytogenes and L. ivanovii are pathogenic (Gomez et al., 2014; Liu, 2013). L. monocytogenes infects many vertebrates, including birds, whereas L. ivanovii infects ungulates (e.g., sheep and cattle) (Orndorff et al., 2006; Vazquez-Boland et al., 2001). Other species (L. innocua, L. seeligeri, L. grayi, L. welshimeri, L. rocourtiae, L. marthii, L. weihenstephanensis, and L. fleischmannii) are essentially saprophytes (Liu, 2013). L. monocytogenes mainly causes invasive listeriosis and gastroenteritis with associated clinical symptoms, such as diarrhea, vomiting, and fever (Riedo et al., 1994). Invasive listeriosis typically affects the elderly, pregnant women, neonates, and immunosuppressed individuals and causes meningitis, encephalitis, miscarriage, and stillbirth (CDC, 2011; Montville et al., 2012). L. monocytogenes also causes gastroenteritis, which is characterized by nausea, abdominal cramps, and diarrhea (Barbuddhe and Chakraborty, 2009). L. monocytogenes-infected people are prone to local inflammatory reactions, such as pyogenic abscesses in different organs, such as eyes, heart, bone, and peritoneum (Hof et al., 1992; Schlech, 1991). In the last few decades, the main cause of several food-borne disease outbreaks in different countries is the persistence of L. monocytogenes in various food-associated environments (Ferreira et al., 2014). However, the incidence of L. monocytogenes infections is low, but a high-mortality rate of 20%–30% makes the pathogen responsible for many of the food-borne fatalities (Carpentier and Cerf, 2011; Hoffmann et al., 2012; Nyarko and Donnelly, 2015; Foodborne Diseases http://dx.doi.org/10.1016/B978-0-12-811444-5.00006-3

157

Copyright © 2018 Elsevier Inc. All rights reserved.

158  Chapter 6 Scallan et al., 2011; Silk et al., 2012). In untreated cases, the mortality rate is as high as 90% (McLauchlin, 1990a,b; Schuchat et al., 1991). Scallan et al. (2011) reported that L. monocytogenes causes approximately 1600 illnesses each year in the United States. In 2013, 0.44 cases of human listeriosis per 100,000 population were observed in the European Union with 8.6% increase as compared with the year 2012 (EFSA, 2015). According to Rocourt et al. (2000), the annual incidence of human listeriosis ranges from 1.6 to 6.0 cases per million people. In ruminants, the incidence rate of listeriosis ranges from 1% to 20%, with a fatality rate of 20%–100% (Bundrant et al., 2011). L. monocytogenes is adaptable to processing and storage conditions, such as refrigeration temperature, high-salt concentration, acidic pH, and low-oxygen level (Kramarenko et al., 2013). L. monocytogenes has also been reported to be resistant to several antibiotics, such as ampicillin, ciprofloxacin, erythromycin, and chloramphenicol (Charpentier and Courvalin, 1999; Rahimi et al., 2010). The infective dose is suspected to be high; contamination levels in food responsible for listeriosis cases are typically >104 cfu/g (Ooi and Lorber, 2005; Vazquez-Boland et al., 2001). However, the infective level in immunocompromised people ranges from 102 to 104 cfu/g (McLauchlin et al., 2004; Vazquez-Boland et al., 2001). As L. monocytogenes is highly ubiquitous in food processing, distribution, and retail environments along with its effective adaptation to various stress conditions, as well as high levels of multiresistance make the control of the pathogen a great challenge in food industries and human health (Gelbicova and Karpiskova, 2012; Wang et al., 2015b).

1.1  Microbiology of  L. monocytogenes L. monocytogenes is a rod-shaped (0.4–0.5 µm in diameter and 0.5–2.0 µm in length), intracellular bacteria capable of growing at temperature ranging between −0.4 and 50°C, although 30–37°C is the optimal growth temperature (Allerberger et al., 2015; Pietzka et al., 2011; Sauders et al., 2012). L. monocytogenes is tolerant to extreme environmental stress conditions, such as broad pH range of 4.1–9.6, high salt concentrations of 10%–20% and occurrence of antimicrobial agents. The pathogen exists as single or double cells, but depending on the growth it may exist as long chains also (Arun, 2008). L. monocytogenes is catalase positive, l-rhamnose positive, and oxidase negative. The pathogen grows readily on blood agar, producing incomplete β-hemolysis (Farber and Peterkin, 1991). The bacterium possesses polar peritrichous flagella and exhibits a characteristic tumbling motility at 25°C (Soares et al., 2013). Table 6.1 shows various characteristics of L. monocytogenes.

1.2 Epidemiology L. monocytogenes is an important cause of zoonosis as it is found commonly in decaying vegetation and feces of many mammals (Linke et al., 2014; Schuchat et al., 1991). Sukhadeo

Listeria monocytogenes: A Food-Borne Pathogen  159 Table 6.1: Various characteristic features of L. monocytogenes. Characteristics

Positive/Negative

Tumbling motility Catalase production β-Hemolysis CAMP-test (Staphylococcus aureus) CAMP-test (Rhodococcus equi) l-Rhamnose Oxidase d-Xylose Hippurate Pathogenicity for mice

+ + + + – + – – + +

and Trinad (2009) reported that L. monocytogenes live as saprophytes in the decomposing plant matter. The pathogen can also be isolated from various environmental sources like soil, water, feces, silage, as well as tissues of numerous invertebrates and vertebrates, including humans (Oladunjoye et al., 2016). The pathogen also inhabits the intestinal tract of cattle, sheep, goats, rabbits, poultry, fish, mice, and so on. The pathogen has been isolated from 37 mammalian species, including domestic and feral, as well as 17 species of birds and some species of fish and shellfish. One out of 5% healthy humans is the carrier of L. monocytogenes (Arun, 2008). The pathogen is a common contaminant of a wide range of food products, including raw vegetables, raw milk, raw meat, soft cheese, fish, and poultry. The minimally processed and ready-to-eat (RTE) foods are the main sources of L. monocytogenes as the pathogen is highly tolerant to the detrimental effects of processing, such as freezing, drying, and heating (Choi et al., 2014; McCollum et al., 2013; McIntyre et al., 2015). L. monocytogenes is also capable to colonize the inert surfaces of food-processing plants to form biofilms (Allerberger and Wagner, 2010; Zhao et al., 2013a). The infective dose of listeriosis depends on the immunological status of the host and has been estimated to be the consumption of food containing 102–106 cells of L. monocytogenes (Arun, 2008). The immunocompromised individuals, such as the patients of AIDS, cancer, organ transplant, and high-risk people, such as the elderly, neonates, infants, pregnant women are severely infected by L. monocytogenes (Gilmartin et al., 2016; Schlech, 2000). The rate of listeriosis is also influenced by pathogenicity, size of ingested inoculum, and underlying hostdefense system (Sukhadeo and Trinad, 2009). Fever, headache, diarrhea, nausea, and joint and muscle pain are the clinical symptoms associated with listeriosis (Arun, 2008). There are 13 serotypes of L. monocytogenes that can infect humans potentially. However, most of the human outbreaks have been associated with three serotypes (1/2a, 1/2b, and 4b) as evidenced by the epidemiological data from different countries (Jamali et al., 2013; Martins and Leal Germano, 2011; Mead et al., 2006). This may reflect the greater adaptation

160  Chapter 6 of certain L. monocytogenes subtypes to food-associated environments and human infection. Serovar 1/2a and 1/2b are predominantly involved in gastrointestinal outbreaks, whereas serovar 4b is mainly involved in listeriosis outbreaks associated with central nervous system (CNS) manifestations, fetomaternal cases, and septicemia (Farber and Peterkin, 1991; Schuchat et al., 1991).

1.3  Pathophysiology of L. monocytogenes Infection Two forms of listeriosis can be distinguished, that is, perinatal listeriosis and adult listeriosis. In both instances, the predominant clinical forms correspond to disseminated infection or to local infection in the CNS. 1.3.1  Perinatal listeriosis Perinatal listeriosis may be fetomaternal or neonatal. In fetomaternal listeriosis, L. monocytogenes invade into the fetus via the placenta and results in the development of chorioamnionitis. It may either cause abortion from 5 months of gestation onward or the birth of a stillborn fetus or baby with a clinical syndrome known as granulomatosis infantiseptica, which is differentiated by the presence of pyogranulomatous microabscesses all over the body with a high mortality rate of 50% (Allerberger and Wagner, 2010; Schlech, 2000). In the mother, the infection is either asymptomatic or a mild flu-like symptoms may be present, such as chills, fatigue, headache, pain in muscles, and joints that exist about 2–14 days before miscarriage (Vazquez-Boland et al., 2001). The pathogen exists in the infant’s blood, cerebrospinal fluid (CSF), skin, and placenta with severe sepsis involving multiple organs (Schlech, 2000). Neonatal listeriosis involves two clinical forms, that is, early- and late-onset forms (Table 6.2). About 45%–70% of neonatal listeriosis is of early-onset and often present with sepsis rather than meningitis. In early-onset neonatal listeriosis, the infection occurs in utero Table 6.2: Clinical syndromes for neonatal listeriosis. Clinical Syndrome Characteristics

Early-Onset

Disease onset

Infection occurs in utero

Incidence rate Symptoms Mortality rate Infant status Conditions

Late-Onset

Occurs in infants from 1 to several weeks of life 45%–70% 30% Septicemia Meningitis 15%–50% 10%–20% Abortion, stillbirth, or premature delivery of Usually occurs in infants infant with low-birth weight Respiratory distress, cyanosis, apnea, Fever, poor feeding, meningeal irritability, pneumonia, widespread microabscesses, leukocytosis, and diarrhea and muscular hypotonia

Listeria monocytogenes: A Food-Borne Pathogen  161 and is prevalent during the first week after birth leading to 15%–50% mortality. Late-onset neonatal listeriosis happens from one to several weeks of life resulting in 10%–20% mortality. This type of listeriosis is present as meningitis (Schuchat et al., 1991; Synnott et al., 1994). Manifestations of neonatal listeriosis include respiratory distress syndrome, rashes, purulent conjunctivitis, pneumonia, hyperexcitability, vomiting, cramps, shortness of breath, shock, hematologic abnormalities, and either hyper- or hypothermia (Kessler and Dajani, 1990). 1.3.2  Adult listeriosis In nonpregnant adults, L. monocytogenes mainly affect the CNS (55%–70% of cases). The infection results in meningoencephalitis that is characterized by ataxia and multiple cranial nerve abnormalities, including changes in consciousness, movement disorders, and paralysis of the cranial nerves. Gram staining of CSF shows negative results with an increased level of protein and mononuclear cell counts (Schlech, 2000). In immunocompetent adults, L. monocytogenes is responsible for rhombencephalitis with symptoms, such as headache, fever, nausea, asymmetrical cranial-nerve palsies, hemiparesis or hypesthesia, and unconsciousness (Allerberger and Wagner, 2010; Armstrong and Fung, 1993). The mortality rate for adult listeriosis due to CNS infection is around 20% but in the case of underlying debilitating disease it may reach to 40%–60%. Another frequent form of adult listeriosis is bacteremia or septicemia (15%–50% of cases), with a high-mortality rate of 70% (Lorber, 1996). Clinical manifestations include myalgias and fever. A prodromal illness of diarrhea and nausea may occur. There are other atypical clinical forms (5%–10% of cases), such as endocarditis, myocarditis, arteritis, pneumonia, pleuritis, hepatitis, colecystitis, peritonitis, localized abscesses (liver and brain abscess), arthritis, osteomyelitis, sinusitis, otitis, conjunctivitis, and ophthalmitis (Rocourt, 1994; Slutsker and Schuchat, 1999). Listerial endocarditis is a rare but serious infection observed in about 8% of patients infected with L. monocytogenes with mortality rates ranging from 37% to 50% (Spyrou et al., 1997). Symptoms of listerial endocarditis include weakness, dyspnea, and cardiac murmur (Doganay, 2003; Fernandez Guerrero et al., 2004). In 50% of patients it can lead to acute congestive heart failure (Doganay, 2003). Neonates, pregnant women, elderly people, individuals with impaired cell-mediated immunity, and patients with a history of rheumatic heart disease, hypertrophic cardiomyopathy, mitral prolapse, or ischemic cardiomyopathy are at the risk of listerial endocarditis (Fernandez Guerrero et al., 2004). Table 6.3 depicts a list of clinical symptoms associated with L. monocytogenes infection. Myocarditis due to L. monocytogenes is quite rare. The clinical abnormalities include fever without localized infection, severe atherosclerotic heart disease, a myocardial infarct of indeterminate age, and a left ventricular aneurysm (McCue and Moore, 1979). In addition to humans, L. monocytogenes also infects ruminants, birds, fish, and crustaceans. In animals, especially cattle, goats, and sheep, the clinical manifestations of listeriosis include rhombencephalitis, septicemia, and abortion. The clinical symptoms include

162  Chapter 6 Table 6.3: List of clinical syndromes for listeriosis. 1. Perinatal listeriosis a. Fetomaternal listeriosis • Granulomatosis infantiseptica b. Neonatal listeriosis • Septicemia • Meningitis 2. Adult listeriosis • Meningoencephalitis • Rhombencephalitis • Septicemia • Myocarditis • Arterial infections • Pneumonia • Pleuritis • Hepatitis • Liver and brain abscess • Febrile gastroenteritis • Spontaneous bacterial peritonitis • Continuous ambulatory peritoneal dialysis peritonitis • Osteomyelitis • Septic arthritis • Colecystitis • Sinusitis • Otitis • Conjunctivitis • Ophthalmitis

depression, anorexia, head pressing, or turning of the head to one side and unilateral cranial nerve paralysis. In cattle, abortion may take place after 7 months and in sheep after 12 weeks of gestation (Walker, 1999). Septicemia generally occurs in neonates resulting in depression, inappetence, fever, and death. Walker and Morgan (1993) reported that bovine and ovine ophthalmitis have been associated with L. monocytogenes infection. Listerial keratoconjunctivitis and uveitis “silage eye” are common problems in ruminants in the United Kingdom, which negatively affects animal welfare and causes economic losses to farmers (Erdogan, 2010). In sheep, L. monocytogenes cause gastrointestinal infections (Clark et al., 2004).

1.4 Pathogenesis The gastrointestinal tract is the primary site of entry of L. monocytogenes into the host. The pathogen is tolerant to the microenvironments of the gastrointestinal tract and is capable of counteracting changes in pH, osmolarity, oxygen tension, and the challenging effects of bile and antimicrobial peptides. Begley et al. (2009) suggested the long-term presence of

Listeria monocytogenes: A Food-Borne Pathogen  163 L. monocytogenes in the body due to its ability to colonize and to persist in the gallbladder leading to chronic infections. Subsequent to entry into the host, bacteria escape from host vacuoles and enter the cytoplasm to multiply rapidly. Shortly thereafter, the bacteria appear to mediate the nucleation of host actin filaments, which rearrange to form a tail consisting of short actin filaments and actin-binding proteins. Actin polymerization is directly required for the movement, as cytochalasin D causes immediate cessation of movement. It has been observed through microscopy that the bacteria move through the cytoplasm at the rate of 1.5 µm/s (Dabiri et al., 1990). Some of the bacteria move to the surface of the cell and are extruded from the cell in pseudopod-like structures. The neighboring cells recognize and phagocytose the pseudopods from where the bacteria escape from the vacuole in order to enter the cytoplasm once again (Tilney et al., 1990).

1.5  Virulence Factors The secretion of extracellular protein hemolysin has been proposed as an important mechanism promoting L. monocytogenes virulence. Purified hemolysin binds to cholesterol specifically and is responsible for in vitro lysis of many eukaryotic cells, such as macrophages and hepatocytes. In vivo, hemolysin causes damage to reticuloendothelial system. In each step of L. monocytogenes pathogenesis, specific virulence factors are expressed. The majority of virulence genes lie in a cluster of genes on two different DNA loci. The protein PrfA acts as a positive regulator for these virulence genes. Several groups of virulence factors involved in the pathogenicity of L. monocytogenes include: • •

• • •

internalins (InlA and InlB), encoded by internalin genes (inl) that allow L. monocytogenes to invade the epithelial cells listeriolysin O (LLO), encoded by the gene hlyA, and phosphatidylinositol-specific phospholipase C (PI-PLC), encoded by the gene plcA that are responsible to lyse the phagosomes, thereby releasing L. monocytogenes into the host cytoplasm ActA protein, encoded by actA gene involved in intracellular movement of L. monocytogenes mediated by actin polymerization enzymes, such as lecithinase, zinc metal protease and serine protease a fibronectin-binding protein, FbpA, a novel multifunctional virulence factor of L. monocytogenes involved in intestinal and liver colonization processes. Fig. 6.1 shows various stages of life cycle of L. monocytogenes inside the host cells (Schuppler and Loessner, 2010).

1.6  Molecular Determinants of  L. monocytogenes Pathogenesis The pathogen has a facultative intracellular life cycle involving invasion of the cells, intracellular multiplication, and spreading within the cells without involving any extracellular

164  Chapter 6

Figure 6.1: Stages in the Intracellular Life Cycle of L. monocytogenes.

phase. Several genes are involved in cellular invasion and intracellular parasitism of L. monocytogenes. Virulence genes include gene cluster members (plcA, hly, mpl, actA, and plcB), their pleiotropic regulator prfA and the inl family of invasion genes (Chakraborty et al., 1992; Gaillard et al., 1991). Fig. 6.2 represents lysteriolysin gene (hly) and the two adjacent operons: the plcA-prfA operon and the lecithinase operon in L. monocytogenes (Portnoy et al., 1992). hly: This locus is a 9-kb virulence gene cluster that is involved in functions essential to intracellular survival (Vazquez-Boland et al., 2001). The hly gene encodes a hemolysin, listeriolysin O (LLO), which is mainly responsible for the pathogenesis of L. monocytogenes. It belongs to the family of sulfhydryl-activated pore forming cytolysins that lyse the host vacuoles and facilitate the intracellular growth of the pathogen (Freitag et al., 2009; Hamon et al., 2006). Its role was supported by a study in which the structural gene hly cloned into isopropyl-d-thiogalactopyranoside (IPTG)-inducible SPAC cassette and transformed into an asporogenic mutant of Bacillus subtilis expressed and secreted LLO. Following internalization by the J774 macrophage like cell line, the hemolytic B. subtilis lysed the phagosomal cell membrane and grew rapidly and extensively in the host cell cytoplasm (Bielecki et al., 1990). Lecithinase operon: Downstream from hly, there lies an operon that encodes lecithinase that is responsible to lyse the double-membrane vacuole formed during cell-to-cell spread. The operon consists of the genes mpl, actA, and plcB and three open reading frames of unknown

Listeria monocytogenes: A Food-Borne Pathogen  165

Figure 6.2: Listeria monocytogenes Listeriolysin Gene (hly) and the Two Adjacent Operons: The plcA-prfA Operon and the Lecithinase Operon. PrfA (depicted with an oval) upregulates (+) the transcription of other genes involved in virulence including hly (listeriolysin O), plcA (phosphatidylinositol-specific phospholipase C), mpl (thermolysin-related zinc-metalloprotease), actA (actin polymerization), and plcB (lysis of the double-membrane vacuole formed during cell-to-cell spread).

function, ORFX, -Y and -Z. Gene mpl encodes a metalloprotease, actA encodes a surface protein required for actin assembly, and plcB encodes a lecithinase. mpl: mpl is the first gene of the lecithinase operon (Vazquez-Boland et al., 1992). It encodes a thermolysin-related zinc-metalloprotease that is involved in the maturation of pro-PlcB (Raveneau et al., 1992). Mutants with transposon insertions in mpl are of reduced virulence and exhibit low production of lecithinase (Mengaud et al., 1991; Raveneau et al., 1992). actA: It is the second gene of the lecithinase operon (Vazquez-Boland et al., 1992). The actA gene encodes a 90 kDa protein ActA that contain 610 amino acid residues. This protein is required for polymerization of actin and intracytoplasmic movement of the pathogen (Hamon et al., 2006). actA mutants do not express lecithinase and do not polymerize actin filaments (Domann et al., 1992). plcB: This gene encodes an enzyme, plcB, which is 289 amino acid long polypeptide with sequence similarity to the phosphatidylcholine-phopholipase C of B. cereus and Clostridium perfringens. The enzyme plcB is involved in the lysis of the double-membrane vacuole formed during cell-to-cell spread as suggested by the fact that plcB mutants express no lecithinase activity (Vazquez-Boland et al., 1992). plcA: The plcA gene lying adjacent to hly gene, encodes a phosphatidylinositol-specific phospholipase C (PI-PLC) that hydrolyzes phosphatidylinositol and phosphatidylinositolglycan. Only pathogenic species in the genus Listeria secrete PI-PLC activity (Mengaud et al., 1991).

166  Chapter 6 prfA: This gene encodes a CRP/FNR-type protein PrfA that regulate the multigene virulence island responsible for the intracellular pathogenesis of L. monocytogenes (Freitag et al., 2009). PrfA act as a positive regulatory factor for hly, plcA, mpl, actA, and plcB. This gene is present in all the serovars of L. monocytogenes and its expression is thermoregulated. PrfA also regulates expression of factors required for cellular invasion (InlA and InlB) and intracellular growth (Hpt) that are located elsewhere on the chromosome (Hamon et al., 2006). L. monocytogenes mutants of prfA and inlA possess low virulence (Lopez et al., 2013; Roche et al., 2012). inlAB operon: inl family of genes encode internalin A (InlA) and internalin B (InlB) proteins that play an important role in binding and invasion of eukaryotic cells (Lingnau et al., 1995). The product of the first gene (inlA) of the operon, that is, InlA is a 80 kDa protein that confer invasion of the Listeria species to intestinal epithelial cells expressing the receptor E-cadherin (Gilmartin et al., 2016). Downstream to inlA gene there lies another gene inlB that encodes InlB protein that mediate the invasion of hepatocytes and is responsible for the infectivity of the fetoplacental unit (Disson et al., 2008). The entry of L. monocytogenes into a host cell is facilitated by both InlA and InlB (Gaillard et al., 1991). iap: This gene encodes a 60 kDa extracellular protein of 484 amino acid residues. The rough mutants of L. monocytogenes show reduced expression of p60 and decreased invasiveness (Kuhn and Goebel, 1989), but are relatively normal in intracellular growth and polymerization of actin filaments (Sun et al., 1990). lmaBA operon: lmaA gene encode a 20 kDa protein that induce a specific delayed hypersensitivity reaction in L. monocytogenes-immune mice (Gohmann et al., 1990). lmaA gene is preceded by the lmaB gene, which encodes a 14 kDa polypeptide. The role of the lmaBA operon is yet to be determined (Portnoy et al., 1992).

1.7  Adaptation Mechanisms in L. monocytogenes to Survive Under Adverse Environmental Conditions L. monocytogenes is well adapted to wide temperature ranges varying from refrigeration to pasteurization, acidic pH, high salt concentration, and within the host immune system (Rocourt and Cossart, 1997). The pathogen is able to grow in the stressful conditions, such as low temperatures (Mastronicolis et al., 2005); low pH (Mastronicolis et al., 2010); presence of disinfectants (Bisbiroulas et al., 2011); pressure; ion concentrations (Beales, 2004) due to its ability to modify the membrane lipid composition. Changes in lipid composition enhance the fluidity of the cytoplasmic membranes that enable L. monocytogenes to survive under these stress conditions (Mykytczuk et al., 2007). Expression of various stress-related proteins and general stress sigma factor in L. monocytogenes are also involved in its adaptation mechanism for survival under adverse environmental conditions.

Listeria monocytogenes: A Food-Borne Pathogen  167 1.7.1  Survival under low temperatures The pathogen survives under low temperature by changing the membrane lipid composition, expressing chaperone proteases, cold shock proteins, cold acclimation proteins, and accumulating cryoprotectant solutes, such as betaine and carnitine. •

•

•

Changes in membrane composition: At temperatures below optimum (7°C), the proportion of C15:0 increases at the expense of C17:0 in the cytoplasmic membrane of L. monocytogenes. As the growth temperature changes from 20 to 5°C, shortening of fatty acid chain (C17:0) takes place in the bacterial membrane that decreases the carbon– carbon interaction between neighboring chains in the cell membrane, thus maintaining the optimum degree of membrane fluidity for growth at low temperatures. Growth at low temperatures results in an increase in the degree of unsaturated fatty acids that enhance the fluidity of the membrane (Beales, 2004). Changes in gene expression and induction of proteins: At low temperatures, L. monocytogenes increases expression of mRNA for chaperone proteases, such as GroEL, ClpP, and ClpB that may be involved in the degradation of abnormal or damaged polypeptides arising due to growth at low temperatures (Liu et al., 2002). Synthesis of cold shock proteins (Csps) and cold acclimation proteins (Caps) in response to temperature downshock is also responsible for survival of L. monocytogenes at low temperatures (Bayles et al., 1996). Role of general stress sigma factor (σB): Temperature downshift results in the stimulation of the general stress sigma factor (σB) in L. monocytogenes leading to the transcription of genes responsible for accumulation of cryoprotectant solutes, such as glycine betaine and carnitine (Angelidis and Smith, 2003).

1.7.2  Survival under acid stress Low pH conditions are prevalent in acidic foods, gastric passage, and phagosome of the macrophage (Cotter and Hill, 2003). The pathogen utilizes a number of stress adaptation mechanisms for its survival in these stress conditions. •

•

Induction of proteins: The protein GroEL, ATP synthase, and various transcriptional regulators are induced in L. monocytogenes under acid stress (Phan-Thanh and Mahouin, 1999). Phan-Thanh et al. (2000) suggested that acid adaptation (pH 5.2, 2 h) in L. monocytogenes provides cross-protection against heat shock (52°C), osmotic shock (25%–30% NaCl), and alcohol stress. pH homeostasis: pH homeostasis is maintained within the microorganisms by regulating the proton transport across the cell membranes. The active transport of proton is coupled with electron transport chains in aerobic organisms. In anaerobic bacteria, the proton transport is carried out via H+-ATPase molecules by utilizing energy from the hydrolysis of ATP molecules. As L. monocytogenes is a facultative anaerobic bacterium, so it may utilize both the processes for pH homeostasis (Shabala et al., 2002).

168  Chapter 6 •

•

•

Glutamate decarboxylase (GAD) system: The GAD system includes three genes, that is, gadA, gadB, and gadC. The gadA and gadB genes encode two glutamate decarboxylases and the gadC gene encodes a glutamate/γ-aminobutyrate antiporter (Cotter et al., 2001). Cells take glutamate via a specific transporter. Within the cytoplasm, decarboxylation of glutamate takes place to form γ-aminobutyrate with the utilization of an intracellular proton. An antiporter located in the cell membrane, then exports γ-aminobutyrate from the cell resulting in the loss of a proton. The release of alkaline γ-aminobutyrate slightly increases the external pH (Small and Waterman, 1998). The GAD system in L. monocytogenes is mainly responsible for its adaptation in acidic conditions. Cotter et al. (2001) observed that deletions of gadA, gadB, and gadC genes in L. monocytogenes enhance the sensitivity of the pathogen to low pH. It has been observed that the gadAB mutant exhibits reduced survival rates in gastric fluid, which confirm that a functional GAD system in L. monocytogenes is important for bypassing the acidic conditions of gastric environment so as to further infect the small intestine. Role of general stress sigma factor (σB): Wiedmann et al. (1998) observed that the sigB mutants were less resistant to decrease in pH as compared to the wild type. Ferreira et al. (2003) observed that the stress sigma factor σB is partially responsible for the persistence of L. monocytogenes in acidic conditions of the gastric fluid. According to Kazmierczak et al. (2003), σB regulates the expression of the gadB and OpuC genes that encode glutamate decarboxylase and carnitine transporter, respectively facilitating L. monocytogenes to survive in acidic pH. Two-component regulatory system: Cotter et al. (1999) identified a two-component regulatory system in L. monocytogenes, which consists of the lisK and lisR genes that encode the histidine kinase and a response regulator, respectively. Membraneassociated histidine kinase is responsible for sensing environment changes, such as low pH, oxidative stress, and so on, whereas the response regulator enables the pathogen to respond by altering the gene expression.

1.7.3  Survival under osmotic stress Salting is one of the widely used methods of food preservation. However, capability of L. monocytogenes to survive in high salt concentrations makes the pathogen difficult to control. Osmoadaptation in L. monocytogenes involve expression of genes responsible for its survival under osmotic stress (Hill et al., 2002). •

Induction of proteins: Duche et al. (2002) studied the expression pattern of proteins in L. monocytogenes using 2-D gel electrophoresis after inducing the salt stress. About 12 proteins were observed to be induced by salt stress and further identified by microsequencing and mass spectrometry. Salt shock proteins (Ssp) and stress acclimation proteins (Sap) induced rapidly in response to salt stress but former overexpressed

Listeria monocytogenes: A Food-Borne Pathogen  169

•

•

•

for a short period and later overexpressed several hours after conditions returned to normal. Gardan et al. (2003) identified two general stress proteins (DnaK and Ctc) in L. monocytogenes during salt stress. The DnaK protein acts as a heat shock protein and stabilizes the cellular proteins. The Ctc protein provides resistance to L. monocytogenes against high osmolarity in the absence of osmoprotectants, such as glycine betaine and carnitine in the medium. Compatible solutes as osmoprotectants: Bayles and Wilkinson (2000) showed the accumulation of osmoprotectants, such as glycine betaine, proline betaine, γ-butyrobetaine, carnitine, acetyl carnitine, and 3-dimethylsulphoniopropionate in L. monocytogenes at high salt concentrations. It was also suggested that L. monocytogenes take up osmolytes from the external environment that helps to regain the osmotic balance within cells. Role of general stress sigma factor (σB): Osmotic stress in L. monocytogenes stimulate general stress sigma factor (σB) that leads to the accumulation of osmoprotectants, such as betaine and carnitine (Becker et al., 1998). The ctc gene that plays an important role in the osmotic stress response in L. monocytogenes also depends on the general stress sigma factor (σB) (Kazmierczak et al., 2003). Two-component regulatory systems: Kallipolitis and Ingmer (2001) identified response regulators that are a part of the two-component signal transduction system and involved in the osmotic stress response. One of the proteins identified was homologous to KdpE proteins that are a part of the Kdp two-component system. The Kdp uptake system is involved in the transport of potassium (K+) into L. monocytogenes cells. Further studies by Brondsted et al. (2003) investigated the role of kdpE, which encodes the response regulator and the downstream gene (orfX) in adaptation to salt stress. Their results indicate that adaptation to high osmotic stress requires expression of both kdpE and orfX genes and this effect depends on the potassium level in the medium. Thus, the uptake of potassium from the environment via the Kdp system has a protective effect on L. monocytogenes against salt stress. The orfX gene is responsible for triggering the activation of σB.

1.8  Isolation and Detection of  L. monocytogenes The standard culture method and molecular methods depicted in Table 6.4 are used for isolation and detection of L. monocytogenes (Gasanov et al., 2005). 1.8.1  Standard culture method This is the classical detection method used for testing the presence or absence of L. monocytogenes in 25 g of food with the approximate detection limit of 1–5 cfu/test portion (Jasson et al., 2010). In this method, the test material is first enriched in Listeria enrichment broth. It is then followed by plating onto one or more Listeria selective agar(s),

170  Chapter 6 Table 6.4: Commercial methods used in food testing for L. monocytogenes. Type of Method

Analytical Technique

Approximate Main Use and Primary Time (h) Matrices

Culture Immunoassay

Chromogenic medium 24–48 Enzyme-linked fluorescent 1–2 assay (ELFA), enzyme-linked immunosorbent assay (ELISA) Molecular methods Nucleic acid hybridization probe 2–4 Real time PCR

≥2

Sensitivity (Cells/mL)

Isolation, food Screening, food

≤104 ≥105

Screening, food, and environmental samples Screening, food

≥107 ≥105

such as ALOA agar, chromogenic agar, L. monocytogenes blood agar, lithium chloridephenylethanol-moxalactam (LPM) agar, Oxford agar or PALCAM agar. The presence of L. monocytogenes in the test material is further confirmed by appropriate biochemical tests. Enrichment broth incubation and plating are done under aerobic conditions at 30–35°C for 24–48 h (Adzitey and Huda, 2010). Fig. 6.3 shows the testing protocol for L. monocytogenes in most food types (US FDA, 2016, 2017). 1.8.2  Molecular methods Isolation and detection of L. monocytogenes from foods by standard culture method involve prolonged incubation and biochemical testing that requires five to seven days to obtain a result (Datta et al., 2013; Jadhav et al., 2012). Due to perishable nature of RTE food products, alternative methods are needed to detect the pathogen. Methods used by the researchers for detecting L. monocytogenes include: • • • • • • •

Immunological methods Amplification methods Biosensors based methods Microarrays based methods MALDI-TOF MS-based methods Fluorescent in situ hybridization (FISH) methods Bacteriophage-based methods

Antibodies are stable, highly specific, and easy to immobilize (Singh et al., 2013). These have been extensively explored as probes for rapid detection of L. monocytogenes (Jahangiri et al., 2012; Ronholm et al., 2013). Tu et al. (2016) isolated two novel L. monocytogenesspecific clones from a phage display antibody library derived from the variable domain of heavy-chain antibodies (VHHs) of nonimmunized alpaca. Both isolated VHHs recognized three serotypes, that is, 1/2a, 1/2b, and 4b, which are responsible for more than 95% of documented human listeriosis cases. A sandwich enzyme-linked immunosorbent assay (ELISA) based on the VHH clone and a monoclonal antibody was developed to detect L. monocytogenes in pasteurized milk, with a detection limit of 1 × 104 cfu/mL. Zhao

Listeria monocytogenes: A Food-Borne Pathogen  171

Figure 6.3: Testing Protocol for L. monocytogenes in Most Food Types. Modified from Hitchins, A.D., Jinneman, K., Chen, Y., 2016. Detection and enumeration of Listeria monocytogenes in foods. Food and Drug Administration Bacteriological Analytical Manual (Chapter 10). Available from: http://www.fda.gov/Food/FoodScienceResearch/LaboratoryMethods/ucm071400.htm; US Food and Drug Administration, 2017. Bad Bug Book: foodborne Pathogenic Microorganisms and Natural Toxins Handbook: Listeria monocytogenes. Available from: https://www.fda.gov/downloads/food/foodsafety/ foodborneillness/foodborneillnessfoodbornepathogensnaturaltoxins/badbugbook/ucm297627.pdf, p. 99.

et al. (2016) developed a rapid and sensitive method for the detecting L. monocytogenes in food that uses antibody-modified biofunctionalized magnetic nanoparticles exhibiting high specificity for the pathogen. The nanoparticle-bacterial complex formed was then detected by nuclear magnetic resonance. The detection limit of this method ranged from three most probable number (MPN) to 103 cfu/mL.

172  Chapter 6 Molecular typing techniques allow rapid and sensitive differentiation between L. monocytogenes strains. Such methods include random amplification of polymorphic DNA (RAPD) and multilocus enzyme electrophoresis (MEE). Choi and Hong (2003) used a competitive polymerase chain reaction (cPCR) method for detecting L. monocytogenes in milk artificially inoculated with the pathogen. Quero et al. (2014) detected L. monocytogenes in raw milk and soft cheeses by TaqMan rt-PCR assay that targets the hlyA gene of the pathogen. It was observed that culture dependent rt-PCR approaches were more sensitive than the culture independent approaches. Liu et al. (2015) used multiplex PCR method for fast and accurate detection of L. monocytogenes in 150 deli meat samples. Zhang et al. (2015) detected L. monocytogenes in 48 commercial samples of raw shrimp using multiplex real-time PCR with 158 cfu/g limit of detection. The results were comparable to standard culture methods. Bang et al. (2013) developed a DNA microarray containing random genomic DNA fragments of L. monocytogenes for rapid detection of the pathogen in milk showing 98%–100% positive hybridization signals for the 16 strains tested. The detection limit of the DNA microarray was approximately 8 log cfu/mL. Hitchins (2014) developed a commercial test kit based on chemiluminescence reactions for the detection of L. monocytogenes in various food samples. The kit is based on a chemically tagged DNA probe that specifically hybridizes to a region of L. monocytogenes rRNA allowing the detection of the pathogen within an hour. Jadhav et al. (2014) used a simple and rapid proteomics-based MALDI-TOF MS approach to detect L. monocytogenes directly from selective enrichment broths with 1 cfu/mL limit of detection postenrichment within 30 h of initial incubation. Lee et al. (2015) generated specific and high affinity aptamers by using whole-bacteria SELEX (WB-SELEX) strategy for quantitative detection of live L. monocytogenes. An aptamer-based sandwich assay was developed further that exhibits a linear response over a wide concentration range of L. monocytogenes ranging from 20 to 2 × 106 cfu/mL. Kashisha et al. (2015) used a sensitive and label-free electrochemical DNA biosensor for detecting L. monocytogenes based on the conducting polymer probe. Electrochemical DNA biosensors have attracted the attention of several researches because of their reliability for sequence specific information combined with the advantages of their simple fabrication process, rapid response time, and better sensitivity (Mohan et al., 2010; Tolba et al., 2012). Wang et al. (2015a) used confocal micro-Raman spectroscopy coupled with chemometric analysis for rapid and high-throughput detection of L. monocytogenes in dairy products. The method required no extensive sample preparation and finished within a few hours with high identification accuracies ranging from 95.28% to 98.33%. More recently, Zhang et al. (2016) constructed a Fe3O4 nanoparticle cluster (Fe3O4 NPC) catalyzed signal amplification biosensor for visual detection of L. monocytogenes in food. The biosensor assayed L. monocytogenes whole cells within a linear range of 5.4 × 103–108 cfu/mL and a visual limit of detection of 5.4 × 103 cfu/mL. Walcher et al. (2010) used bacteriophage protein-coated beads for separating L. monocytogenes from artificially contaminated raw milk samples followed by their detection by plating

Listeria monocytogenes: A Food-Borne Pathogen  173 or RT-PCR. Moreno et al. (2012) used direct viable count (DVC)-FISH for detecting L. monocytogenes from fresh and frozen vegetable samples with a detection limit of 7.4 × 102 to 9.4 × 104 cfu/g.

1.9  Growth and Incidence of  L. monocytogenes in Food The main source of Listeria infection in humans is the consumption of the contaminated food. Poor conditions of food processing and handling result in the transmission of L. monocytogenes. Moreover, the pathogen can thrive under refrigeration as well as pasteurization temperatures, which act as a main hurdle in producing listeria-free foods. L. monocytogenes has been found in a variety of foods, such as raw milk, ice cream, raw vegetables, meat and meat products, such as fermented raw-meat sausages, poultry, raw and smoked fish, as well as in processed foods that become contaminated after processing, such as soft cheeses and cold cuts at the deli counter (Alonso-Hernando et al., 2012; Bouayad and Hamdi, 2012; Cokal et al., 2012; Jakobsen et al., 2011). Johansson (1998) observed 100% presence of L. monocytogenes in spiked soft cheeses. de Valk et al. (2001) reported 42 cases of listeriosis in France due to the consumption of pork rillettes and jellied pork tongue. Several cases has also been reported in the USA, including 109 cases due to the consumption of cooked turkey (Frye et al., 2002; Gottlieb et al., 2006; Olsen et al., 2005), 13 cases due to the consumption of Mexican-style soft cheese (MacDonald et al., 2005), and 108 cases from the consumption of frankfurters (Mead et al., 2006). Makino et al. (2005) reported 38 patients from the consumption of cheese in Japan. In England and Wales, Gillespie et al. (2006) reported 48 cases of listeriosis from consuming hospital sandwiches and butter. According to the CDC (2015), an outbreak of listeriosis in the United States due to the consumption of a commercially produced apple product resulted in the hospitalization of 34 cases and death of 7 patients. Potential sources of L. monocytogenes contamination of foods include incoming product, food handlers, consumers and environmental sources, such as utensils and equipment, which may harbor pathogenic microorganisms or serve as vehicles of contamination if cleaning and sanitation are poor (Lianou and Sofos, 2007). Poultry can become contaminated with L. monocytogenes either environmentally during production or from healthy carrier chicken in the processing plant (Bailey et al., 1990), while RTE meat and poultry products can be contaminated after cooking by cross-contamination either directly or via surfaces, equipment, and workers (Murphy et al., 2005). The food safety regulations of some countries, such as USA, are very strict due to the requirement of zero tolerance of L. monocytogenes in RTE food. However, the incidences of L. monocytogenes in RTE products generally range from 2.7% to 20% (Meloni et al., 2009; USDA FSIS, 2014; Vitas et al., 2004). According to EFSA (2015), European Union has established that the persistence of L. monocytogenes in RTE food products must be less than 100 cfu/g of food throughout their shelf life. The occurrence

174  Chapter 6 of L. monocytogenes in cold smoked, sliced, vacuum-packaged pork products during a 15-month period from 2003 to 2004 was studied by Berzins et al. (2007). The prevalence of L. monocytogenes in cold-smoked pork varied from 0% to 73%. In order to identify the main risk factors associated with the contamination of L. monocytogenes, all production steps were studied separately in each meat-processing plant. Berzins et al. (2007) suggested that brining by injection was a significant risk factor in contamination. Moreover, long coldsmoking times (12 h) had a significant predictive value for a sample to be positive for L. monocytogenes. Cold smoking temperatures between 24 and 30°C can have an inhibitory effect on the incidence of L. monocytogenes. Although, the occurence of L. monocytogenes in raw foods cannot be eliminated completely, but through the application of effective hygiene measures, it is possible to reduce its level in food products. In order to ensure the safety of food products, growing, harvesting, handling, storage, processing, and food supply systems must be managed by food handlers in such a way that they are able to reliably prevent the multiplication of L. monocytogenes to the deleterious level of >100 cfu/g (Roasto, 2009). The equipments of food-processing plants should not be ignored as these may serve as the important vehicles for L. monocytogenes transmission. The pathogen persists in the cool damp places, conveyers, floors, and drains of the processing plants, in spite of employing vigorous sanitary regimes (Adzitey and Huda, 2010).

1.10  Control Measures Listeriosis results in economy losses in agricultural sector by increasing costs for production animals due to illness, increased infertility, and abortion rates. The ubiquity and saprophytic nature of L. monocytogenes makes the pathogen hard to remove from the agricultural environment. However, control measures based on early disease recognition, improvements in postharvest monitoring, and a better understanding of host–pathogen interactions that influence disease pathogenesis may combine to ameliorate the often severe and widespread effects of listeriosis. L. monocytogenes is ubiquitous in the environment and readily introduced into abattoirs and other food-processing plants. It is a great challenge to effectively control the pathogen as it requires intensive management and resources. The occuence of L. monocytogenes in cooked and RTE poultry products varies from 12% to 27% at the point of retail sale (Ribeiro and Burge, 1992), in some cases at levels up to 700 cfu/g (Anonymous, 1989), thus emphasizing the need for improved control measures. The pathogen has repeatedly been found in raw milk, soft cheese, ice creams, meat and meat products, raw vegetables, and fish and fish products (Karthikeyan et al., 2015; Santorum et al., 2012). L. monocytogenes has been isolated from the milk of sheep, goat, and cow (Rahimi et al., 2010); cleaning cloths, chopping boards, mincing machines; poultry, meat and meat products (Mahmood et al., 2003), cured meats, smoked salmon, soft cheese, and raw vegetables (Vitas et al., 2004); RTE food products (Aurora et al., 2008); and raw eggs (Rivoal et al., 2010).

Listeria monocytogenes: A Food-Borne Pathogen  175 It has been suggested that the formation of biofilms by this pathogen on surfaces within the food-processing environment may play an important role in their survival (Pan et al., 2010). Biofilm formation on inert surfaces is known to protect L. monocytogenes from various chemical and physical stresses resulting in the contamination of food contact surfaces (Carpentier and Cerf, 2011). The occurence of L. monocytogenes in processed food is inevitable, but contamination can be reduced by providing attention to hygiene and processing practices. Proper sanitation conditions can reduce the colonization, transmission, and cross-contamination of the pathogen among various food products and the environment. Cleaning and sanitizing procedures are widely used for inactivation and removal of biofilms in the food industry (Yang et al., 2016). Winkelstroter et al. (2015) used culture method and fluorescence in situ hybridization for studying the inhibitory effect of Lactobacillus paraplantarum on production of biofilm by L. monocytogenes. The antibacterial activity of Lactob. paraplantarum was due to a bacteriocin encoded by the gene plantaricin NC8 that encode a bacteriocin, which is responsible for the antimicrobial activity against L. monocytogenes. Olszewska et al. (2016) investigated the effect of different sanitizers on L. monocytogenes biofilm. It was observed that quaternary ammonium compounds (QACs)based and phenolic-based sanitizers most effectively reduce L. monocytogenes, resulting in a reduction of 3.7–6.9 log cfu/mL and 4.9–8.2 log cfu/mL after a 60 min treatment for 37 and 15°C grown biofilms, respectively. Food-borne listeriosis can be prevented in three ways, that is, by controlling the pathogen in the environment, farm, or food-processing plants, by paying careful attention to the preparation of food and choosing RTE food products, and in specialized circumstances by antibiotic prophylaxis (Schlech, 2000). Standard operating measures should be undertaken so as to target the pathogen in the environment, farm, or food-processing plants. Cleanliness should be maintained in the environment where livestock are reared. Soil should be kept dry as the pathogen grows well in moist and damp environment. Livestock houses should be cleaned and disinfected thoroughly on a regular basis. Feed may also be the importance source of L. monocytogenes contamination in animals. Animal feed should be preserved by drying or by using chemical preservatives to check the microbial growth. The entry of wild animals to the feed storage area of the farm should be restricted as they may serve as carriers of L. monocytogenes. Proper monitoring plans for processing plants should be framed by each company for personal hygiene and sanitation practices of the workers, processing, and packaging operations, and routine testing programs for L. monocytogenes (Adzitey and Huda, 2010). A program entitled “Hazard Analysis at Critical Control Points” has been introduced by the food industries to improve the control of Listeria and other food-borne pathogens. This program has been associated with a reduction in sporadic disease in geographic regions where active surveillance for listeriosis is undertaken (Tappero et al., 1995). The US Food and Drug Administration has adopted a “zero tolerance” policy for Listeria in RTE foods, meaning

176  Chapter 6 that a recall is required if the detectable presence of L. monocytogenes exceeds ≥1 cfu in 25 g of food samples. Ivanek et al. (2004) reported that the estimated annual cost of recalls due to L. monocytogenes in the food industry in the United States ranges from $1.2 billion to $2.4 billion. However, in other countries where the rate of listeriosis is considerably less, the contamination of food with little amounts of L. monocytogenes is allowed. The food quality must be checked properly for the presence of L. monocytogenes. If the pathogen is detected in the food, investigations should be undertaken to determine its source so that the further transmission is checked. Contamination with L. monocytogenes after processing occurs by contact of the final product with contaminated surfaces like conveyor belts or slicing, dicing, and packaging machines (Milanov et al., 2009). The workers should maintain proper hygiene by wearing clean gloves, avoiding touching finished products after handling unsanitary utensils or equipments, and so on. Moisture should be limited in the cold storage units by using dehumidifiers. The processed foods should be packed properly and palletized so as to minimize the manual handling. In the retail displays, the products from different sources should not be mixed. The expiry date of the food products should be checked at regular intervals and expired products should be disposed of immediately. Consumers should be aware of food safety issues. The RTE food products should be heated or cooked well before being eaten (Adzitey and Huda, 2010). Various control measures have been employed by researchers against L. monocytogenes contamination in food. Min et al. (2005) observed that whey protein isolate films/ coatings incorporated with lactoperoxidase system can be used to prevent the growth of L. monocytogenes in smoked salmon. Nyachuba et al. (2007) suggested the role of nitrite in reducing the number of L. monocytogenes. Yuk et al. (2007) used the combined treatment of ozone and organic acid on mushrooms for reducing the growth of L. monocytogenes. Velazquez-Estrada et al. (2010) found that ultra high-pressure homogenization (UHPH) can be used to effectively reduce the viable counts of L. monocytogenes in grape juice. Bremer et al. (2002) used a steam treatment system for controlling L. monocytogenes in king salmon (Oncorhynchus tshawytscha). A pilot plant steam treatment system resulted in a 4 log reduction in L. monocytogenes contamination on the exterior surface of king salmon. Further, certain foods, such as liquid whole egg and dairy products, when processed by thermal treatments, such as pasteurization, result in undesirable changes in the sensory and nutritional qualities of the product. This has led to the development and use of nonthermal processing technologies, such as pulsed electric fields (PEF) in the food industry that avoid or reduce the detrimental changes in the sensory and physical properties of foods. Reina et al. (1998) studied the effect of high-voltage PEF on pasteurized whole, 2%, and skim milk inoculated with L. monocytogenes. At 25°C, 1–3 log reductions of L. monocytogenes were observed. With an increase in temperature up to 50°C, a 4-log reduction of the

Listeria monocytogenes: A Food-Borne Pathogen  177 pathogen was observed. Gomez et al. (2005) studied the effect of square-wave PEF against L. monocytogenes in McIlvaine buffers of different pH ranged from 3.5 to 7.0. Maximum sensitivity of L. monocytogenes for PEF was observed by the treatment of higher electric fields of 28 kV/cm for 400 µs, which inactivated 6.0 log10 cycles of bacteria at pH 3.5. Zhao et al. (2013b) determined the level of induction of lethal and sublethal injury in L. monocytogenes by PEF. It was observed that with an increase in the strength of electric field from 15 to 30 kV/cm, the proportion of sublethally injured L. monocytogenes increased from 18.98% to 43.64%. The recommendations for populations at risk and general public awareness of the problem of listeriosis have contributed to decreases in sporadic cases of infection. However, foodborne outbreaks continue to occur against a background of sporadic disease, and there is little likelihood of eliminating the organism from the food supply completely. Cooking or pasteurizing all foods would eliminate the risk of food-borne listeriosis entirely, but modern food preferences emphasize the “wholesomeness” of raw and minimally processed foods as part of a normal diet. The recent introduction of meat irradiation was met by public suspicion, but may lead to decreases in the incidence of listeriosis and other food-borne diseases (Schlech, 2000). Ultraviolet (UV) radiations have also been used to inactivate L. monocytogenes in milk (Lu et al., 2011), fruit juice (Gabriel and Nakano, 2009), meat products (Sommers et al., 2010), and vegetable surfaces (Chun et al., 2010). Turgis et al. (2012) evaluated the combined treatment of trans-cinnamaldehyde and gamma irradiation on L. monocytogenes in peeled carrots. The combined treatment resulted in synergistic action against the organism and increased the radio sensitivity of the organism. Kim et al. (2016) demonstrated the synergistic effect of treatments with a combination of ultraviolet (UV-C) irradiation and sodium hypochlorite (NaOCl) on L. monocytogenes biofilms formed on the surface of stainless steel and eggshells. It was observed that UV-C/NaOCl treatment on stainless steel and eggshells resulted in synergistic reductions of biofilms ranging from 0.95 to 3.68 log cfu/cm2 and −0.22 to 1.02 log cfu/cm2, respectively. Uesugi et al. (2016) studied the response of L. monocytogenes to pulsed light (PL) (3.20 J/cm2) and continuous UV light (33 mJ/cm2) by analyzing the gene expression using microarrays. Cells treated with PL or UV showed higher levels of multiple stress proteins, motility genes, and transcriptional regulators as compared to the nontreated cells. Prophylactic antibiotic therapy may prevent some cases of listeriosis. Ewert et al. (1995) reported that patients with advanced HIV infection treated with TMP-SMZ to prevent Pneumocystis carinii pneumonia also serve as an effective preventive measure for listeriosis in these patients. Cancer patients undergoing chemotherapy may also benefit from prophylactic antibacterial against listeriosis (Schlech, 2000). Table 6.5 represents the dietary recommendations for preventing food-borne listeriosis (CDC, 1992).

178  Chapter 6 Table 6.5: Dietary recommendations for preventing food-borne listeriosis. For all people • Thoroughly cook raw food from animal sources (e.g., beef, pork, and poultry) • Thoroughly wash raw vegetables before eating • Keep uncooked meats separate from vegetables, cooked foods, and RTE foods • Avoid consumption of raw (unpasteurized) milk or raw milk products Additional recommendations for persons at high risk (pregnant women, immunocompromised, or elderly people) • Avoid soft cheeses (e.g., Mexican-style, feta, Brie, Camembert, and blue-veined cheeses); there is no need to avoid hard cheeses, cream cheese, cottage cheese, or yogurt • Reheat leftover foods or RTE foods until steaming hot before eating • Although the risk for listeriosis associated with foods from delicatessen counters is relatively low, high-risk persons should avoid these foods or thoroughly reheat cold cuts before eating

1.11  Advanced Strategies to Control L. monocytogenes 1.11.1  Targeting general stress sigma factor (σB) for food preservation General stress sigma factor (σB) acts as a regulator of the stress response in L. monocytogenes. On sensing the environmental stress, the pathogen relays a signal to σB and its activation initiates transcription of the σB regulon. The protein products thus produced in response to environmental stress confer protection to L. monocytogenes. The advanced techniques in genomics can be aimed toward the inactivation of sigma factor σB, thereby controlling the stress response of the pathogen (van Schaik and Abee, 2005). 1.11.2  Multiple hurdle technology Multiple hurdle technology involves a combination of several preservation factors so as to achieve the microbial stability and safety in foods. In the last few years, an increasing demand by consumers for safe, natural, and minimally processed food products has been observed worldwide (Lucera et al., 2012). In this scenario, biopreservation is an interesting alternative to prevent the growth of pathogenic and spoilage microorganisms in foods and to extend the products shelf life (Acuna et al., 2011; Favaro et al., 2015). Bacteriocins are defined as ribosomally synthesized antimicrobial peptides by lactic acid bacteria that are of great importance in food preservation (Cotter et al., 2013). Nisin produced by Lactococcus lactis subsp. lactis strains is the widely used bacteriocin as a food preservative, recognized as safe by the World Health Organization (WHO) since 1969, and accepted by the US Food and Drug Administration since 1988 (Oshima et al., 2014; Ross et al., 2002). Nisin has also proved very useful as a part of hurdle technology, where a combination of two or more treatments is used to obtain a more effective method of food preservation (Cleveland et al., 2001). Nilsson et al. (2000) investigated the combined action of nisin and carbon dioxide on L. monocytogenes cells grown at 4°C. It was observed that nisin acted synergistically with carbon dioxide to give a 4 log reduction in cell count of L. monocytogenes. The presence of carbon dioxide increases the membrane permeability and the proportion of short-chain fatty acids in cell membrane

Listeria monocytogenes: A Food-Borne Pathogen  179 that facilitate nisin in the pore formation. Ettayebi et al. (2000) investigated the combined action of nisin and thymol against the pathogens L. monocytogenes and B. subtilis. Both nisin and thymol acted synergistically to reduce their growth. Thymol possesses antimicrobial activity and alters the bacterial membrane permeability resulting in its poration by nisin. Modi et al. (2000) studied the combined effect of heat and nisin on L. monocytogenes cells and observed a 3.7 log reduction in cell count within 7 min of treatment. The sublethal heat treatment alters the permeability of the cell membrane, which helps in its poration by nisin. Arques et al. (2004) found that reuterin, an antimicrobial compound produced by Lactob. reuteri and nisin act synergistically against L. monocytogenes growth in milk. Branen and Davidson (2004) studied the effect of ethylene diamine tetra acetic acid (EDTA) and lactoferrin on the antimicrobial activity of nisin against L. monocytogenes. EDTA at low levels enhanced the activity of nisin against L. monocytogenes. EDTA acts as the chelator of divalent cations and permeabilizes the bacterial outer membrane, thereby releasing the lipopolysaccharide and allowing nisin to act easily on the membrane. Lactoferrin also acted synergistically with nisin to inhibit L. monocytogenes growth. Razavi Rohani et al. (2011) observed that garlic essential oil, nisin, and sodium chloride (NaCl) synergistically enhance the antilisterial activity in brain heart infusion (BHI) broth. Rabiey et al. (2014) observed that Carum copticum essential oil, NaCl (4%) and smoke show synergistic antilisterial activity in fish model broths after 12 days of storage. High salt concentration increases the hydrophobicity of bacterial surface facilitating penetration of essential oils or contact with microorganisms (Angienda and Hill, 2011). Roman et al. (2014) observed that active packaging containing polypropylene film polymerized with acrylic acid enhances the antimicrobial activity of lysozyme against L. monocytogenes. Huq et al. (2015) microencapsulated oregano essential oil (250 µg/mL), cinnamon essential oil (250 µg/ mL), and nisin (16 µg/mL) and studied the combined antibacterial activity with γ-irradiation against L. monocytogenes in RTE meat. Microencapsulated oregano and cinnamon essential oil in combination with nisin resulted in higher bacterial radiosensitization as compared to the control. Takahashi et al. (2015) studied the effect of addition of ferulic acid or ferulic acid + glycine/sodium acetate on coleslaw and egg salads inoculated with L. monocytogenes. Ferulic acid @ 1500 ppm resulted in a 1.5 log cfu/g reduction in coleslaw salad, whereas no growth of L. monocytogenes was observed in egg salad by the treatment of ferulic acid @ 3000 ppm + glycine/sodium acetate @ 1%. Chen et al. (2016) used microdilution method to determine that nisin and P-anisaldehyde act synergistically to reduce the growth of L. monocytogenes under in vitro conditions. From scanning electron microscopy (SEM) and LIVE/DEAD BacLight experiments, it was suggested that the bactericidal mechanism of the combination of nisin and P-anisaldehyde involves cell wall lysis and membrane damage. Jovanovic et al. (2016) assessed the antibacterial activity of chitosan coatings prepared with acetic or lactic acid and composite chitosan-gelatin films prepared with essential oils against L. monocytogenes inoculated in fresh shredded black radish samples stored at 4°C for 7 days. Chitosan coating prepared with acetic acid was more effective than chitosan coating prepared

180  Chapter 6 with lactic acid in reducing the growth of L. monocytogenes over the period of storage. However, chitosan-gelatin film prepared with thyme essential oil (0.2%) exhibited maximum antibacterial activity against L. monocytogenes with a reduction of 2.1–2.4 log10 cfu/g in black radish samples after 24 h of storage. 1.11.3  Encapsulation technology Nisalpin, a commercial preparation of nisin is widely used as a food preservative. Benech et al. (2002) reported that the activity of nisin decreases over time in various food systems due to its degradation. This has led to the development of the technique of microencapsulation, that is, enclosing nisin into capsules before delivery into a food system. The encapsulated nisin molecules remain protected from the adverse effects of heat, moisture, pH changes, and their activity is maintained for prolonged storage periods (Gibbs et al., 1999). Various substances, such as fats, starches, proteins, and lipids are used for encapsulation using techniques, such as spray drying, extrusion coating, and entrapment in liposomes. Several studies have been reported that use encapsulation technology to deliver antimicrobial agents into food systems. Were et al. (2004) evaluated the antimicrobial activity of nisin encapsulated in phospholipid liposomes against L. monocytogenes and observed that encapsulated nisin inhibited the bacterial growth to a greater extent as compared to free nisin. Malheiros et al. (2010) observed that free nisin (0.5 mg/mL) possess better antibacterial properties than liposome-encapsulated nisin (0.5 mg/mL) against L. monocytogenes in milk. It was suggested that a higher dose of encapsulated nisin is required to obtain the equivalent inhibitory effect observed for the unencapsulated counterparts (Teixeira et al., 2008). Malheiros et al. (2012) studied the effectiveness of free and liposome-encapsulated nisin to control L. monocytogenes in cheese. Free nisin @ 0.25 mg/mL showed a bactericidal effect, whereas a bacteriostatic effect was observed for free nisin @ 0.1 mg/mL and lipsomeencapsulated nisin @ 0.25 mg/mL. The difference in antibacterial properties may be due to a gradual release of nisin from liposomes. Cui et al. (2016) evaluated the antibacterial activity of liposome-entrapped lemongrass oil (5.0 mg/mL) against L. monocytogenes in cheese stored at 4°C. The lemongrass oil liposomes showed satisfactory antibacterial activity against L. monocytogenes in cheese over the period of storage. Martinez et al. (2016) assessed the antibacterial effect of free as well as encapsulated commercial nisin (Nisaplin) against L. monocytogenes and B. cereus in refrigerated milk. Encapsulated commercial nisin (0.5 mg/L) exhibited the strongest antilisterial effect improving the food product microbiological safety. 1.11.4  Active packaging technology Active packaging technology involves the inclusion of subsidiary constituents in packaging material so as to enhance the performance of the package system by controlling the packaging atmosphere (such as moisture content, pH, oxygen level) or inhibiting the growth of spoilage and pathogenic organisms on the food products (Ozdemir and Floros, 2004; Robertson, 2006). Janes et al. (2002) investigated the effect of nisin added to zein film

Listeria monocytogenes: A Food-Borne Pathogen  181 coatings on RTE chicken against L. monocytogenes. About 4.5–5.0 log cfu/g suppression in L. monocytogenes growth was observed in RTE chicken after 16 days at 4°C. Sebti et al. (2002) incorporated nisin and stearic acid in packaging material that serve as an antimicrobial agent and moisture barrier, respectively, and inhibitory activity against L. monocytogenes and S. aureus. Mauriello et al. (2004) developed an antimicrobial packaging using a bacteriocin produced by Lactob. curvatus and tested its efficacy against L. monocytogenes-contaminated pork steak and ground beef. About 1 log reduction in L. monocytogenes cell numbers were observed. Jofre et al. (2007) observed that the combination of active packaging containing enterocins A and B, sakacin K, nisin, potassium lactate, and high-pressure processing effectively reduced L. monocytogenes growth in cooked ham. Beverlya et al. (2008) evaluated the use of chitosan dissolved with acetic or lactic acid as an edible film for its antimicrobial activity against L. monocytogenes in RTE roast beef. It was observed that acetic acid chitosan coating was more effective in reducing L. monocytogenes counts than the lactic acid chitosan coating. Marcos et al. (2008) assessed that combinations of high-pressure processing and antimicrobial packaging efficiently control L. monocytogenes growth in artificially inoculated cooked ham. Min et al. (2010) incorporated commercial antimicrobials, that is, Nisaplin and Guardian into edible gelatin film and observed their antilisterial effect on turkey bologna.

2 Conclusions L. monocytogenes is of great concern in the food industry and public health due to its ubiquity, resistance to low temperature, pH, desiccation, and ability to form biofilms. Most immunocompromised individuals, such as patients of AIDS, cancer, organ transplant, and high-risk individuals, that is, the elderly, pregnant women, neonates, are more susceptible to L. monocytogenes infection. Consumption of contaminated food, such as RTE foods, meat and meat products, milk and milk products are the main source of infection. The isolation as well as detection of L. monocytogenes in food requires highly reliable and accurate techniques. Although the growth of L. monocytogenes in food is inevitable, standard and hygienic practices must be adopted during farming, processing, storing, or marketing of the food products so as to reduce the incidence of listeriosis. Recent strategies involving targeting general stress sigma factor (σB) in L. monocytogenes, multiple hurdle technology, encapsulation technology, and active packaging technology have been proved to be highly efficient in preserving food against L. monocytogenes.

References Acuna, L., Morero, R.D., Bellomio, A., 2011. Development of wide-spectrum hybrid bacteriocins for food biopreservation. Food Bioproc. Technol. 4, 1029–1049. Adzitey, F., Huda, N., 2010. Listeria monocytogenes in foods: incidences and possible control measures. Afr. J. Microbiol. Res. 4 (25), 2848–2855. Allerberger, F., Wagner, M., 2010. Listeriosis: a resurgent infection. Clin. Microbiol. Infect. 16, 16–23.

182  Chapter 6 Allerberger, F., Bago, Z., Huhulescu, S., Pietzka, A., 2015. Listeriosis: the dark side of refrigeration and ensiling in Zoonoses. In: Sing, A. (Ed.), Infections Affecting Humans and Animals-Focus on Public Health Aspects. Springer Verlag, Heidelberg, pp. 249–286. Alonso-Hernando, A., Prieto, M., Garcia-Fernandez, C., Alonso-Calleja, C., Capita, R., 2012. Increase over time in the prevalence of multiple antibiotic resistance among isolates of Listeria monocytogenes from poultry in Spain. Food Control 23 (1), 37–41. Angelidis, A.S., Smith, G.M., 2003. Role of the glycine betaine and carnitine transporters in adaptation of Listeria monocytogenes to chill stress in defined medium. Appl. Environ. Microbiol. 69 (12), 7492–7498. Angienda, P.O., Hill, D.J., 2011. The effect of sodium chloride and pH on the antimicrobial effectiveness of essential oils against pathogenic and food spoilage bacteria: implications in food safety. Int. J. Biol. Biomol. Agr. Food Biotechnol. Eng. 5 (9), 572–577. Anonymous, 1989. UK establishes committee to investigate food safety. Food Chem. News 30 (51), 39–40. Armstrong, R.W., Fung, P.C., 1993. Brain stem encephalitis (rhombencephalitis) due to Listeria monocytogenes: case report and review. Clin. Infect. Dis. 16, 689–702. Arques, J.L., Fernandez, J., Gaya, P., Nunez, M., Rodriguez, E., Medina, M., 2004. Antimicrobial activity of reuterin in combination with nisin against food borne pathogens. Int. J. Food Microbiol. 95 (2), 225–229. Arun, K.B., 2008. General mechanism of pathogenesis for foodborne pathogens. Foodborne Microbial Pathogens. Springer, New York, pp. 165–182. Aurora, R., Prakash, A., Prakash, S., Rawool, D.B., Barbuddhe, S.B., 2008. Comparison of PI-PLC based assays and PCR along with in vivo pathogenicity tests for rapid detection of pathogenic Listeria monocytogenes. Food Control 19, 641–647. Bailey, J.S., Fletcher, D.L., Cox, N.A., 1990. Listeria monocytogenes colonization of broiler chickens. Poult. Sci. 69, 457–461. Bang, J., Beuchat, L.R., Song, H., Gu, M.B., Chang, H., Kim, H.S., Ryu, J., 2013. Development of a random genomic DNA microarray for the detection and identification of Listeria monocytogenes in milk. Int. J. Food Microbiol. 161 (2), 134–141. Barbuddhe, S.B., Chakraborty, T., 2009. Listeria as an enteroinvasive gastrointestinal pathogen. Curr. Top. Microbiol. Immunol. 337, 173–195. Bayles, D.O., Wilkinson, B.J., 2000. Osmoprotectants and cryoprotectants for Listeria monocytogenes. Lett. Appl. Microbiol. 30 (1), 23–27. Bayles, D.O., Annous, B.A., Wilkinson, B.J., 1996. Cold stress proteins induced in Listeria monocytogenes in response to temperature down shock and growth at low temperatures. Appl. Environ. Microbiol. 62 (3), 1116–1119. Beales, N., 2004. Adaptation of microorganisms to cold temperatures, weak acid preservatives, low pH, and osmotic stress: a review. Compr. Rev. Food Sci. Food Saf. 3, 1–20. Becker, L.A., Cetin, M.S., Hutkins, R.W., Benson, A.K., 1998. Identification of the gene encoding the alternative sigma factor sigma B from Listeria monocytogenes and its role in osmotolerance. J. Bacteriol. 180 (17), 4547–4554. Begley, M., Kerr, C., Hill, C., 2009. Exposure to bile influences biofilm formation by Listeria monocytogenes. Gut Pathog. 1, 11. Benech, R.O., Kheadr, E.E., Laridi, R., Lacroix, C., Fliss, I., 2002. Inhibition of Listeria innocua in cheddar cheese by addition of nisin Z in liposomes or by in situ production in mixed culture. Appl. Environ. Microbiol. 68 (8), 3683–3690. Bertsch, D., Rau, J., Eugster, M.R., Haug, M.C., Lawson, P.A., Lacroix, C., Meile, L., 2013. Listeria fleischmannii sp. nov., isolated from cheese. Int. J. Syst. Evol. Microbiol. 63, 526–532. Berzins, A., Horman, A., Lunden, J., Korkeala, H., 2007. Factors associated with Listeria monocytogenes contamination of cold-smoked pork products produced in Latvia and Lithuania. J. Food Microbiol. 115 (2), 173–179. Beverlya, R.L., Janes, M.E., Prinyawiwatkula, W., No, H.K., 2008. Edible chitosan films on ready-to-eat roast beef for the control of Listeria monocytogenes. Food Microbiol. 25 (3), 534–537.

Listeria monocytogenes: A Food-Borne Pathogen  183 Bielecki, J., Youngman, P., Connelly, P., Portnoy, D.A., 1990. Bacillus subtilis expressing a haemolysin gene from Listeria monocytogenes can grow in mammalian cells. Nature 345, 175–176. Bisbiroulas, P., Psylou, M., Iliopoulou, I., Diakogiannis, I., Berberi, A., Mastronicolis, S.K., 2011. Adaptational changes in cellular phospholipids and fatty acid composition of the food pathogen Listeria monocytogenes as a stress response to disinfectant sanitizer benzalkonium chloride. Lett. Appl. Microbiol. 52, 275–280. Bouayad, L., Hamdi, T.M., 2012. Prevalence of Listeria spp. in ready to eat foods (RTE) from Algiers (Algeria). Food Control 23 (2), 397–399. Branen, J.K., Davidson, P.M., 2004. Enhancement of nisin, lysozyme, and monolaurin antimicrobial activities by ethylene diamine tetraacetic acid and lactoferrin. Int. J. Food Microbiol. 90 (1), 63–74. Bremer, P.J., Monk, I.R., Osborne, C.M., Hills, S., Butler, R., 2002. Development of a steam treatment to eliminate Listeria monocytogenes from king salmon (Oncorhynchus tshawytscha). J. Food Sci. 67 (6), 2282–2287. Brondsted, L., Kallipolitis, B.H., Ingmer, H., Knochel, S., 2003. KdpE and a putative RsbQ homologue contribute to growth of Listeria monocytogenes at high osmolarity and low temperature. FEMS Microbiol. Lett. 219 (2), 233–239. Bundrant, B.N., Hutchins, T., den Bakker, H.C., Fortes, E., Wiedmann, M., 2011. Listeriosis outbreak in dairy cattle caused by an unusual Listeria monocytogenes serotype 4b strain. J. Vet. Diagn. Invest. 23, 155–158. CDC (Centres for Disease Control and Prevention), 1992. Preventing foodborne illness: listeriosis. Available from: http://wonder.cdc.gov/wonder/prevguid/p0000005/p0000005.asp. CDC (Centers for Disease Control and Prevention), 2011. Available from: http://www.cdc.gov/pregnancy/ infections-listeria.html. CDC (Centers for Disease Control and Prevention), 2015. Multistate outbreak of listeriosis linked to commercially produced, prepackaged caramel apples made from Bidart Bros. apples. Available from: http://www.cdc.gov/ listeria/outbreaks/caramel-apples-12-14/index.html. Carpentier, B., Cerf, P., 2011. Persistence of Listeria monocytogenes in food industry equipment and premises. Int. J. Food Microbiol. 145, 1–8. Chakraborty, T., Leimeister-Wachter, M., Doman, E., Hartl, M., Goebel, W., Nichterlein, T., Notermans, S., 1992. Coordinate regulation of the virulence genes in Listeria monocytogenes requires the product of the prfA gene. J. Bacteriol. 174, 568–574. Charpentier, E., Courvalin, P., 1999. Antibiotic resistance in Listeria spp. Antimicrob. Agents Chemother. 43, 2103–2108. Chen, X., Zhang, X., Meng, R., Zhao, Z., Liu, Z., Zhao, X., Shi, C., Guo, N., 2016. Efficacy of a combination of nisin and p-Anisaldehyde against Listeria monocytogenes. Food Control 66, 100–106. Choi, W.S., Hong, C.H., 2003. Rapid enumeration of Listeria monocytogenes in milk using competitive PCR. Int. J. Food Microbiol. 84 (1), 79–85. Choi, M.J., Jackson, K.A., Medus, C., Beal, J., Rigdon, C.E., Cloyd, T.C., Forstner, M.J., Ball, J., Bosch, S., Bottichio, L., et al., 2014. Notes from the field: multistate outbreak of listeriosis linked to soft-ripened cheese—United States, 2013. Morb. Mortal. Wkly. Rep. 63 (13), 294–295. Chun, H.H., Kim, J.Y., Song, K.B., 2010. Inactivation of foodborne pathogens in ready-to-eat salad using UV-C irradiation. Food Sci. Biotechnol. 19, 547–551. Clark, R.G., Gill, J.M., Swanney, S., 2004. Listeria monocytogenes gastroenteritis in sheep. N. Z. Vet. J. 52, 46–47. Cleveland, J., Montville, T.J., Nes, I.F., Chikindas, M.L., 2001. Bacteriocins: safe, natural antimicrobials for food preservation. Int. J. Food Microbiol. 71 (1), 1–20. Cokal, Y., Dagdelen, A., Cenet, O., Gunsen, U., 2012. Presence of L. monocytogenes and some bacterial pathogens in two Turkish traditional foods, Mihalic cheese and Hosmerim dessert. Food Control 26 (2), 337–340. Cotter, P.D., Hill, C., 2003. Surviving the acid test: responses of Gram-positive bacteria to low pH. Microbiol. Mol. Biol. Rev. 67 (3), 429–453. Cotter, P.D., Emerson, N., Gahan, C.G., Hill, C., 1999. Identification and disruption of lisRK, a genetic locus encoding a two-component signal transduction system involved in stress tolerance and virulence in Listeria monocytogenes. J. Bacteriol. 181 (21), 6840–6843.

184  Chapter 6 Cotter, P.D., Gahan, C.G., Hill, C., 2001. A glutamate decarboxylase system protects Listeria monocytogenes in gastric fluid. Mol. Microbiol. 40 (2), 465–475. Cotter, P.D., Ross, R.P., Hill, C., 2013. Bacteriocins-a viable alternative to antibiotics? Nat. Rev. Microbiol. 11, 95–105. Cui, H.Y., Wu, J., Lin, L., 2016. Inhibitory effect of liposome-entrapped lemongrass oil on the growth of Listeria monocytogenes in cheese. J. Dairy Sci. 99 (8), 6097–6104. Dabiri, G.A., Sanger, J.M., Portnoy, D.A., Southwick, F.S., 1990. Listeria monocytogenes moves rapidly through the host cytoplasm by inducing directional actin assembly. Proc. Natl. Acad. Sci. USA 87, 6068–6072. Datta, A.R., Laksanalamai, P., Marianne, S., 2013. Recent developments in molecular sub typing of Listeria monocytogenes. Food Addit. Contam. 30, 1437–1445. de Valk, H., Vaillant, V., Jacquet, C., Rocourt, J., Le Querrec, F., Stainer, F., Quelquejeu, N., Pierre, O., Pierre, V., Desenclos, J.C., Goulet, V., 2001. Two consecutive nationwide outbreaks of listeriosis in France, October 1999–February 2000. Am. J. Epidemiol. 154 (10), 944–950. Disson, O., Grayo, S., Grayo, S., 2008. Conjugated action of two species-specific invasion proteins for fetoplacental listeriosis. Nature 455 (7216), 1114–1118. Doganay, M., 2003. Listeriosis: clinical presentation. FEMS Immunol. Med. Microbiol. 35 (3), 173–175. Domann, E., Wehland, J., Rhode, M., Pistor, S., Goebel, W., Hartl, M., Leimeister-Wachter, M., Wuenscher, M., Chakraborty, T., 1992. A novel bacterial virulence gene in Listeria monocytogenes required for host cell microfilament interaction with homology to the proline-rich region of vinculin. EMBO J. 11 (5), 1981–1990. Duche, O., Tremoulet, F., Glaser, P., Labadie, J., 2002. Salt stress proteins induced in Listeria monocytogenes. Appl. Environ. Microbiol. 68 (4), 1491–1498. EFSA (European Food Safety Authority), 2015. The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2013. EFSA J. 13 (1), 3991. Erdogan, H.M., 2010. Listerial keratoconjunctivitis and uveitis (silage eye). Vet. Clin. North Am. Food Anim. Pract. 26, 505–510. Ettayebi, K., El Yamani, J., Rossi-Hassani, B., 2000. Synergistic effects of nisin and thymol on antimicrobial activities in Listeria monocytogenes and Bacillus subtilis. FEMS Microbiol. Lett. 183 (1), 191–195. Ewert, D.P., Lieb, P.S., Hayes, M.W., 1995. Listeria monocytogenes infection and serotype distribution among HIV-infected persons in Los Angeles County, 1985–1992. J. AIDS Hum. Retrovirol. 8, 461–465. Farber, J.M., Peterkin, P.I., 1991. Listeria monocytogenes, a food-borne pathogen. Microbiol. Rev. 55, 476–511. Favaro, L., Penna, A.L.B., Todorov, S.D., 2015. Bacteriocinogenic LAB from cheeses—application in biopreservation? Trends Food Sci. Technol. 41, 37–48. Fernandez Guerrero, M.L., Rivas, P., Rabago, R., Nunez, A., de Gorgolas, M., Martinell, J., 2004. Prosthetic valve endocarditis due to Listeria monocytogenes: report of two cases and reviews. Int. J. Infect. Dis. 8 (2), 97–102. Ferreira, A., Sue, D., O’Byrne, C.P., Boor, K.J., 2003. Role of Listeria monocytogenes sigma (B) in survival of lethal acidic conditions and in the acquired acid tolerance response. Appl. Environ. Microbiol. 69 (5), 2692–2698. Ferreira, V., Wiedmann, M., Teixeira, P., Stasiewicz, M.J., 2014. Listeria monocytogenes persistence in foodassociated environments: epidemiology, strain characteristics, and implications for public health. J. Food Prot. 1, 150–170. Freitag, N.E., Port, G.C., Miner, M.D., 2009. Listeria monocytogenes—from saprophyte to intracellular pathogen. Nat. Rev. Microbiol. 7, 623–628. Frye, D.M., Zweig, R., Sturgeon, J., Tormey, M., LeCavalier, M., Lee, I., Lawani, L., Mascola, L., 2002. An outbreak of febrile gastroenteritis associated with delicatessen meat contaminated with Listeria monocytogenes. Clin. Infect. Dis. 35 (8), 943–949. Gabriel, A.A., Nakano, H., 2009. Inactivation of Salmonella, E. coli and Listeria monocytogenes in phosphatebuffered saline and apple juice by ultraviolet and heat treatments. Food Control 20, 443–446. Gaillard, J.L., Berche, P., Frehel, C., Gouin, E., Cossart, P., 1991. Entry of L. monocytogenes into cells is mediated by internalin, a repeat protein reminiscent of surface antigens from gram-positive cocci. Cell 65, 1127–1141. Gardan, R., Duche, O., Leroy-Setrin, S., Labadie, J., 2003. Role of CTC from Listeria monocytogenes in osmotolerance. Appl. Environ. Microbiol. 69 (1), 154–161.

Listeria monocytogenes: A Food-Borne Pathogen  185 Gasanov, U., Hughes, D., Hansbro, P.M., 2005. Methods for the isolation and identification of Listeria spp. and Listeria monocytogenes: a review. FEMS Microbiol. Rev. 29, 851–875. Gelbicova, T., Karpiskova, R., 2012. Outdoor environment as a source of Listeria monocytogenes in food chain. Czech. J. Food Sci. 30, 83–88. Gibbs, B.F., Kermasha, S., Alli, I., Mulligan, C.N., 1999. Encapsulation in the food industry: a review. Int. J. Food Sci. Nutr. 50 (3), 213–224. Gillespie, I.A., McLauchlin, J., Grant, K.A., Little, C.L., Mithani, V., Penman, C., Lane, C., Regan, M., 2006. Changing pattern of human listeriosis, England and Wales, 2001–2004. Emerg. Infect. Dis. 12 (9), 1361–1366. Gilmartin, N., Giao, M.S., Keevil, C.W., O’Kennedy, R., 2016. Differential internalin A levels in biofilms of Listeria monocytogenes grown on different surfaces and nutrient conditions. Int. J. Food Microbiol. 219, 50–55. Gohmann, S., Leimeister-Wachter, M., Schiltz, E., Goebel, W., Chakraborty, T., 1990. Characterization of a Listeria monocytogenes-specific protein capable of inducing delayed hypersensitivity in Listeria-immune mice. Mol. Microbiol. 4, 1091–1099. Gomez, N., Garcia, D., Alvarez, I., Condon, S., Raso, J., 2005. Modelling inactivation of Listeria monocytogenes by pulsed electric fields in media of different pH. Int. J. Food Microbiol. 103, 199–206. Gomez, D., Azon, E., Marco, N., Carraminana, J.J., Rota, C., Arino, A., Yanguela, J., 2014. Antimicrobial resistance of Listeria monocytogenes and Listeria innocua from meat products and meat-processing environment. Food Microbiol. 42, 61–65. Gottlieb, S.L., Newbern, E.C., Griffin, P.M., Graves, L.M., Hoekstra, R.M., Baker, N.L., Hunter, S.B., Holt, K.G., Ramsey, F., Head, M., Levine, P., Johnson, G., Schoonmaker-Bopp, D., Reddy, V., Kornstein, L., Gerwel, M., Nsubuga, J., Edwards, L., Stonecipher, S., Hurd, S., Austin, D., Jefferson, M.A., Young, S.D., Hise, K., Chernak, E.D., Sobel, J., 2006. Multistate outbreak of listeriosis linked to turkey deli meat and subsequent changes in US regulatory policy. Clin. Infect. Dis. 42 (1), 29–36. Graves, L.M., Helsel, L.O., Steigerwalt, A.G., Morey, R.E., Daneshvar, M.I., Roof, S.E., Orsi, R.H., Fortes, E.D., Milillo, S.R., den Bakker, H.C., Wiedmann, M., Swaminathan, B., Sauders, B.D., 2010. Listeria marthii sp. nov., isolated from the natural environment, Finger Lakes National Forest. Int. J. Syst. Evol. Microbiol. 60, 1280–1288. Hamon, M., Bierne, H., Cossart, P., 2006. Listeria monocytogenes: a multifaceted model. Nat. Rev. Microbiol. 4, 423–434. Hill, C., Cotter, P.D., Sleator, R.D., Gahan, C.G.M., 2002. Bacterial stress response in Listeria monocytogenes: jumping the hurdles imposed by minimal processing. Int. Dairy J. 12 (2-3), 273–283. Hitchins, A.D., 2014. Listeria monocytogenes—Detection by chemiluminescent DNA hybridization. In: Batt, C.A., Tortorello, M.-L. (Eds.), Encyclopedia of Food Microbiology (2nd ed.). Elsevier, Amsterdam, pp. 494–500. Hitchins, A.D., Jinneman, K., Chen, Y., 2016. Detection and enumeration of Listeria monocytogenes in foods. Food and Drug Administration Bacteriological Analytical Manual (Chapter 10). Available from: http://www. fda.gov/Food/FoodScienceResearch/LaboratoryMethods/ucm071400.htm. Hof, H., Ulbricht, A., Stehle, G., 1992. Listeriosis—a puzzling disease. Infection 20 (5), 290–292. Hoffmann, S., Batz, M.B., Morris, J.G., 2012. Annual cost of illness and quality adjusted life year losses in the United States due to 14 foodborne pathogens. J. Food Prot. 75, 1292–1302. Huq, T., Vu, K.D., Riedl, B., Bouchard, J., Lacroix, M., 2015. Synergistic effect of gamma (γ)-irradiation and microencapsulated antimicrobials against Listeria monocytogenes on ready-to-eat (RTE) meat. Food Microbiol. 46, 507–514. Ivanek, R., Grohn, Y.T., Tauer, L.W., Wiedmann, M., 2004. The cost and benefit of Listeria monocytogenes food safety measures. Crit. Rev. Food Sci. Nutr. 44, 513–523. Jadhav, S., Bhave, M., Palombo, E.A., 2012. Methods used for the detection and sub-typing of Listeria monocytogenes. J. Microbiol. Methods 88, 327–341. Jadhav, S., Sevior, D., Bhave, M., Palombo, E.A., 2014. Detection of Listeria monocytogenes from selective enrichment broth using MALDI-TOF mass spectrometry. J. Proteomics 97, 100–106.

186  Chapter 6 Jahangiri, A., Rasooli, I., Rahbar, M.R., Khalili, S., Amani, J., Zanoos, K.A., 2012. Precise detection of L. monocytogenes hitting its highly conserved region possessing several specific antibody binding sites. J. Theor. Biol. 305, 15–23. Jakobsen, R.A., Heggebo, R., Sunde, E.B., Skjervheim, M., 2011. Staphylococcus aureus and Listeria monocytogenes in Norwegian raw milk cheese production. Food Microbiol. 28 (3), 492–496. Jamali, H., Radmehr, B., Thong, K.L., 2013. Prevalence, characterization, and antimicrobial resistance of Listeria species and Listeria monocytogenes isolates from raw milk in farm bulk tanks. Food Control 34 (1), 121–125. Janes, M.E., Kooshesh, S., Johnson, M.G., 2002. Control of Listeria monocytogenes on the surface of refrigerated, ready-to-eat chicken coated with edible zein film coatings containing nisin and/or calcium propionate. J. Food Sci. 67 (7), 2754–2757. Jasson, V., Jacxsens, L., Luning, P., Rajkovic, A., Uyttendaele, M., 2010. Alternative microbial methods: an overview and selection criteria. Food Microbiol. 27 (6), 710–730. Jofre, A., Garriga, M., Aymerich, T., 2007. Inhibition of Listeria monocytogenes in cooked ham through active packaging with natural antimicrobials and high-pressure processing. J. Food Prot. 70 (11), 2498–2502. Johansson, T., 1998. Enhanced detection and enumeration of Listeria monocytogenes from foodstuffs and foodprocessing environments. Int. J. Food Microbiol. 40 (1–2), 77–85. Jovanovic, G.D., Klaus, A.S., Niksic, M.P., 2016. Antimicrobial activity of chitosan coatings and films against Listeria monocytogenes on black radish. Rev. Argent. Microbiol. 48 (2), 128–136. Kallipolitis, B.H., Ingmer, H., 2001. Listeria monocytogenes response regulators important for stress tolerance and pathogenesis. FEMS Microbiol. Lett. 204 (1), 111–115. Karthikeyan, R., Gunasekaran, P., Rajendhran, J., 2015. Molecular serotyping and pathogenic potential of Listeria monocytogenes isolated from milk and milk products in Tamil Nadu, India. Foodborne Pathog. Dis. 12, 522–528. Kashisha, Sonib, D.K., Mishra, S.K., Prakash, R., Dubey, S.K., 2015. Label-free impedimetric detection of Listeria monocytogenes based on poly-5-carboxy indole modified ssDNA probe. J. Biotechnol. 200, 70–76. Kazmierczak, M.J., Mithoe, S.C., Boor, K.J., Wiedmann, M., 2003. Listeria monocytogenes sigma B regulates stress response and virulence functions. J. Bacteriol. 185 (19), 5722–5734. Kessler, S.L., Dajani, A.S., 1990. Listeria meningitis in infants and children. Pediatr. Infect. Dis. J. 9, 61–63. Kim, M., Park, S.Y., Ha, S.-D., 2016. Synergistic effect of a combination of ultraviolet-C irradiation and sodium hypochlorite to reduce Listeria monocytogenes biofilms on stainless steel and eggshell surfaces. Food Control 70, 103–109. Kramarenko, T., Roasto, M., Meremae, K., Kuningas, M., Poltsama, P., Elias, T., 2013. Listeria monocytogenes prevalence and serotype diversity in various foods. Food Control 30, 24–29. Kuhn, M., Goebel, W., 1989. Identification of an extracellular protein of Listeria monocytogenes possibly involved in intracellular uptake by mammalian cells. Infect. Immun. 57, 55–61. Lang Halter, E., Neuhaus, K., Scherer, S., 2013. Listeria weihenstephanensis sp. nov., isolated from the water plant Lemna trisulca taken from a freshwater pond. Int. J. Syst. Evol. Microbiol. 63, 641–647. Leclercq, A., Clermont, D., Bizet, C., Grimont, P.A., Le Fleche-Mateos, A., Roche, S.M., Buchrieser, C., CadetDaniel, V., Le Monnier, A., Lecuit, M., Allerberger, F., 2010. Listeria rocourtiae sp. nov. Int. J. Syst. Evol. Microbiol. 60, 2210–2214. Lee, S., Ahn, J., Lee, K., Um, H., Sekhon, S.S., Park, T.S., Min, J., Kim, Y., 2015. Analytical bioconjugates, aptamers, enable specific quantitative detection of Listeria monocytogenes. Biosens. Bioelectr. 68, 272–280. Lianou, A., Sofos, J.N., 2007. A review of the incidence and transmission of Listeria monocytogenes in ready to eat products in retail and food service environments. J. Food Prot. 70, 2172–2198. Lingnau, A., Domann, E., Hudel, M., Bock, M., Nichterlein, T., Wehland, J., Chakraborty, T., 1995. Expression of the Listeria monocytogenes EGD inlA and inlB genes, whose products mediate bacterial entry into tissue culture cell lines, by PrfA-dependent and -independent mechanisms. Infect. Immun. 63, 3896–3903. Linke, K., Ruckerl, I., Brugger, K., Karpiskova, R., Walland, J., Muri-Klinger, S., Stessl, B., 2014. Reservoirs of Listeria species in three environmental ecosystems. Appl. Environ. Microbiol. 80, 5583–5592. Liu, D., 2013. Molecular approaches to the identification of pathogenic and nonpathogenic listeriae. Microbiol. Insights 22 (6), 59–69.

Listeria monocytogenes: A Food-Borne Pathogen  187 Liu, S., Graham, J.E., Bigelow, L., Morse, P.D., Wilkinson, B.J., 2002. Identification of Listeria monocytogenes genes expressed in response to growth at low temperature. Appl. Environ. Microbiol. 68 (4), 1697–1705. Liu, H., Lu, L., Pan, Y., Sun, X., Hwang, C., Zhao, Y., Wu, V.C.H., 2015. Rapid detection and differentiation of Listeria monocytogenes and Listeria species in deli meats by a new multiplex PCR method. Food Control 52, 78–84. Lopez, V., Navas, J., Martinez-Suarez, J.V., 2013. Low potential virulence associated with mutations in the inlA and prfA genes in Listeria monocytogenes isolated from raw retail poultry meat. J. Food Prot. 76, 129–132. Lorber, B., 1996. Listeriosis. Clin. Infect. Dis. 24, 1–11. Lucera, A., Costa, C., Conte, A., Del Nobile, M.A., 2012. Food applications of natural antimicrobial compounds. Front. Microbiol. 3, 1–13. Lu, G., Li, C., Liu, P., 2011. UV inactivation of milk-related microorganisms with a novel electrodeless lamp apparatus. Eur. Food Res. Technol. 233, 79–87. MacDonald, P.D., Whitwam, R.E., Boggs, J.D., MacCormack, J.N., Anderson, K.L., Reardon, J.W., Saah, J.R., Graves, L.M., Hunter, S.B., Sobel, J., 2005. Outbreak of listeriosis among Mexican immigrants as a result of consumption of illicitly produced Mexican-style cheese. Clin. Infect. Dis. 40 (5), 677–682. Mahmood, M.S., Ahmed, A.N., Hussain, I., 2003. Prevalence of Listeria monocytogenes in poultry meat, poultry meat products and other related in animates at Faisalabad. Pak. J. Nut. 2 (6), 346–349. Makino, S.I., Kawamoto, K., Takeshi, K., Okada, Y., Yamasaki, M., Yamamoto, S., Igimi, S., 2005. An outbreak of food-borne listeriosis due to cheese in Japan, during 2001. Int. J. Food Microbiol. 104 (2), 189–196. Malheiros, P.S., Daroit, D.J., Silveira, N.P., Brandelli, A., 2010. Effect of nanovesicle-encapsulated nisin on growth of Listeria monocytogenes in milk. Food Microbiol. 27, 175–178. Malheiros, P.S., Daroit, D.J., Brandelli, A., 2012. Inhibition of Listeria monocytogenes in minas frescal cheese by free and nanovesicle-encapsulated nisin. Braz. J. Microbiol. 43 (4), 1414–1418. Marcos, B., Aymerich, T., Monfort, J.M., Garriga, M., 2008. High-pressure processing and antimicrobial biodegradable packaging to control Listeria monocytogenes during storage of cooked ham. Food Microbiol. 25 (1), 177–182. Martinez, R.C.R., Alvarenga, V.O., Thomazini, M., Favaro-Trindade, C.S., de Souza Sant’Ana, A., 2016. Assessment of the inhibitory effect of free and encapsulated commercial nisin (Nisaplin®), tested alone and in combination, on Listeria monocytogenes and Bacillus cereus in refrigerated milk. LWT Food Sci. Technol. 68, 67–75. Martins, E.A., Leal Germano, P.M., 2011. Listeria monocytogenes in ready-to-eat, sliced, cooked ham and salami products, marketed in the city of Sao Paulo, Brazil: occurrence, quantification, and serotyping. Food Control 22 (2), 297–302. Mastronicolis, S.K., Arvanitis, N., Karaliota, A., Litos, C., Stavroulakis, G., Moustaka, H., Tsakirakis, A., Heropoulos, G., 2005. Cold dependence of fatty acid profile of different lipid structures of Listeria monocytogenes. Food Microbiol. 22, 213–219. Mastronicolis, S.K., Berberi, A., Diakogiannis, I., Petrova, E., Kiaki, I., Baltzi, T., Xenikakis, P., 2010. Alteration of the phosphor- or neutral lipid content and fatty acid composition in Listeria monocytogenes due to acid adaptation mechanisms for hydrochloric, acetic, and lactic acids at pH 5.5 or benzoic acid at neutral pH. Antonie Van Leeuwenhoek 98, 307–316. Mauriello, G., Ercolini, D., La Storia, A., Casaburi, A., Villani, F., 2004. Development of polythene films for food packaging activated with an antilisterial bacteriocin from Lactobacillus curvatus 32Y. J. Appl. Microbiol. 97 (2), 314–322. McCollum, J.T., Cronquist, A.B., Silk, B.J., Jackson, K.A., O’Connor, K.A., Cosgrove, S., Mahon, B.E., 2013. Multistate outbreak of listeriosis associated with cantaloupe. N. Engl. J. Med. 369 (10), 944–953. McCue, M.J., Moore, E.E., 1979. Myocarditis with microabscess formation caused by Listeria monocytogenes associated with myocardial infarct. Hum. Pathol. 10 (4), 469–472. McIntyre, L., Wilcott, L., Naus, M., 2015. Listeriosis outbreaks in British Columbia, Canada, caused by soft ripened cheese contaminated from environmental sources. Biomed. Res. Int. 2015, 1–12. McLauchlin, J., 1990a. Human listeriosis in Britain, 1967–85, a summary of 722 cases. Listeriosis during pregnancy and in the newborn. Epidemiol. Infect. 104 (2), 181–189.

188  Chapter 6 McLauchlin, J., 1990b. Human listeriosis in Britain, 1967–85, a summary of 722 cases. Listeriosis in non-pregnant individuals, a changing pattern of infection and seasonal incidence. Epidemiol. Infect. 104 (2), 191–201. McLauchlin, J., Mitchell, R.T., Smerdon, W.J., Jewell, K., 2004. Listeria monocytogenes and listeriosis: a review of hazard characterisation for use in microbiological risk assessment of foods. Int. J. Food Microbiol. 92, 15–33. Mead, P.S., Dunne, E.F., Graves, L., Wiedmann, M., Patrick, M., Hunter, S., Salehi, E., Mostashari, F., Craig, A., Mshar, P., Bannerman, T., Sauders, B.D., Hayes, P., Dewitt, W., Sparling, P., Griffin, P., Morse, D., Slutsker, L., Swaminathan, B., 2006. Nationwide outbreak of listeriosis due to contaminated meat. Epidemiol. Infect. 134, 744–751. Meloni, D., Galluzzo, P., Mureddu, A., Piras, F., Griffiths, M., Mazzette, R., 2009. Listeria monocytogenes in RTE food marketed in Italy: prevalence and automated EcoRI ribotyping of the isolates. Int. J. Food Microbiol. 129, 166–173. Mengaud, J., Braun-Breton, C., Cossart, P., 1991. Identification of phosphatidylinositol-specific phospholipase C activity in Listeria monocytogenes: a novel type of virulence factor? Mol. Microbiol. 5, 367–372. Milanov, D., Asanin, R., Vidic, B., Katic, V., Plavsa, N., 2009. Examination of the capabilities of attachment and biofilm formation of different Listeria monocytogenes strains. Biotechnol. Anim. Husb. 25, 1255–1265. Min, S.C., Harris, L.J., Krochta, J.M., 2005. Listeria monocytogenes inhibition by whey protein films and coatings incorporating the lactoperoxidase system. J. Food Sci. 70 (7), 317–324. Min, B.J., Han, I.Y., Dawson, P.L., 2010. Antimicrobial gelatin films reduce Listeria monocytogenes on turkey bologna. Poult. Sci. 89 (6), 1307–1314. Modi, K.D., Chikindas, M.L., Montville, T.J., 2000. Sensitivity of nisin-resistant Listeria monocytogenes to heat and the synergistic action of heat and nisin. Lett. Appl. Microbiol. 30 (3), 249–253. Mohan, S., Nigam, P., Kundu, S., Prakash, R., 2010. A label-free genosensor for BRCA1related sequence based on impedance spectroscopy. Analyst 135, 2887–2893. Montville, T.J., Matthews, K.R., Kniel, K.E., 2012. Food Microbiology: An Introduction, third ed. ASM Press, Washington, DC. Moreno, Y., Sanchez-Contreras, J., Montes, R.M., Garcia-Hernandez, J., Ballesteros, L., Ferrus, M.A., 2012. Detection and enumeration of viable Listeria monocytogenes cells from ready-to-eat and processed vegetable foods by culture and DVC-FISH. Food Control 27 (2), 374–379. Murphy, R.Y., Hanson, R.E., Duncan, L.K., Feze, N., Lyon, B.G., 2005. Considerations for post-lethality treatments to reduce Listeria monocytogenes from fully cooked bologna using ambient and pressurized steam. Int. J. Food Microbiol. 22, 359–365. Mykytczuk, N.C.S., Trevors, J.T., Leduc, L.G., Ferroni, G.D., 2007. Fluorescence polarization in studies of bacterial cytoplasmic membrane fluidity under environmental stress (review). Prog. Biophys. Mol. Biol. 95, 60–82. Nilsson, L., Chen, Y., Chikindas, M.L., Huss, H.H., Gram, L., Montville, T.J., 2000. Carbon dioxide and nisin act synergistically on Listeria monocytogenes. Appl. Environ. Microbiol. 66 (2), 769–774. Nyachuba, D.G., Donnelly, C.W., Howard, A.B., 2007. Impact of nitrite on detection of Listeria monocytogenes in selected ready-to-eat (RTE) meat and seafood products. J. Food Sci. 72 (7), 267–275. Nyarko, E.B., Donnelly, C.W., 2015. Listeria monocytogenes: strain heterogeneity, methods, and challenges of subtyping. J. Food Sci. 80, M2668–M2678. Oladunjoye, A.O., Singh, S., Ijabadeniyi, O.A., 2016. Inactivation of Listeria monocytogenes ATCC 7644 on fresh-cut tomato using nisin in combinations with organic salts. Braz. J. Microbiol. 47, 757–763. Olsen, S.J., Patrick, M., Hunter, S.B., Reddy, V., Kornstein, L., MacKenzie, W.R., Lane, K., Bidol, S., Stoltman, G.A., Frye, D.M., Lee, I., Hurd, S., Jones, T.F., LaPorte, T.N., Dewitt, W., Graves, L., Wiedmann, M., Schoonmaker-Bopp, D.J., Huang, A.J., Vincent, C., Bugenhagen, A., Corby, J., Carloni, E.R., Holcomb, M.E., Woron, R.F., Zansky, S.M., Dowdle, G., Smith, F., Ahrabi-Fard, S., Ong, A.R., Tucker, N., Hynes, N.A., Mead, P., 2005. Multistate outbreak of Listeria monocytogenes infection linked to delicatessen turkey meat. Clin. Infect. Dis. 40 (7), 962–967. Olszewska, M.A., Zhao, T., Doyle, M.P., 2016. Inactivation and induction of sublethal injury of Listeria monocytogenes in biofilm treated with various sanitizers. Food Control 70, 371–379.

Listeria monocytogenes: A Food-Borne Pathogen  189 Ooi, S.T., Lorber, B., 2005. Gastroenteritis due to Listeria monocytogenes. Clin. Infect. Dis. 40, 1327–1332. Orndorff, P.E., Hamrick, T.S., Smoak, I.W., Havell, E.A., 2006. Host and bacterial factors in listeriosis pathogenesis. Vet. Microbiol. 114 (1-2), 1–15. Oshima, S., Hirano, A., Kamikado, H., Nishimura, J., Kawai, Y., Saito, T., 2014. Nisin A extends the shelf life of high-fat chilled dairy dessert, a milk-based pudding. J. Appl. Microbiol. 116, 1218–1228. Ozdemir, M., Floros, J.D., 2004. Active food packaging technologies. Crit. Rev. Food Sci. Nutr. 44 (3), 185–193. Pan, Y., Breidt, F., Gorski, L., 2010. Synergistic effect of sodium chloride, glucose and temperature on biofilm formation by Listeria monocytogenes serotype 1/2a and 4b strains. Appl. Environ. Microbio. 76, 1433–1441. Phan-Thanh, L., Mahouin, F., 1999. A proteomic approach to study the acid response in Listeria monocytogenes. Electrophoresis 20 (11), 2214–2224. Phan-Thanh, L., Mahouin, F., Alige, S., 2000. Acid responses of Listeria monocytogenes. Int. J. Food Microbiol. 55 (1–3), 121–126. Pietzka, A.T., Stoger, A., Huhulescu, S., Allerberger, F., Ruppitsch, W., 2011. Gene scanning of an internalin B gene fragment using high-resolution melting curve analysis as a tool for rapid typing of Listeria monocytogenes. J. Mol. Diagn. 13, 57–63. Portnoy, D.A., Chakraborty, T., Goebel, W., Cossart, P., 1992. Molecular determinants of Listeria monocytogenes pathogenesis. Infect. Immun. 60 (4), 1263–1267. Quero, G.M., Santovito, E., Visconti, A., Fusco, V., 2014. Quantitative detection of Listeria monocytogenes in raw milk and soft cheeses: Culture-independent versus liquid- and solid-based culture-dependent real time PCR approaches. LWT Food Sci. Technol. 58 (1), 11–20. Rabiey, S., Hosseini, H., Rezaei, M., 2014. Use Carum copticum essential oil for controlling the Listeria monocytogenes growth in fish model system. Braz. J. Microbiol. 45 (1), 89–96. Rahimi, E., Ameri, M., Momtaz, H., 2010. Prevalence and antimicrobial resistance of Listeria species isolated from milk and dairy products in Iran. Food Control 21, 1448–1452. Raveneau, J., Geoffroy, C., Beretti, J.L., Gaillard, J.L., Alouf, J.E., Berche, P., 1992. Reduced virulence of a Listeria monocytogenes phospholipase-deficient mutant obtained by transposon insertion into the zinc metalloprotease gene. Infect. Immun. 60, 916–921. Razavi Rohani, S.M., Moradi, M., Mehdizadeh, T., Saei-Dehkordi, S.S., Griffiths, M.W., 2011. The effect of nisin and garlic (Allium sativum L.) essential oil separately and in combination on the growth of Listeria monocytogenes. LWT Food Sci. Technol. 44, 2260–2265. Reina, L.D., Jin, Z.T., Zhang, Q.H., Yousef, A.E., 1998. Inactivation of Listeria monocytogenes in milk by pulsed electric field. J. Food Prot. 61 (9), 1203–1206. Ribeiro, C.D., Burge, S.H., 1992. Developing microbiological guidelines for food: first results from cooked chicken portions. PHLS Microbiol. Dig. 9, 100–102. Riedo, F.X., Pinner, R.W., Tosca, M.L., 1994. A point-source foodborne listeriosis outbreak: documented incubation period and possible milk illness. J. Infect. Dis. 170, 693–694. Rivoal, K., Queguiner, S., Boscher, E., Bougeard, S., Ermel, G., Salvat, G., Federighi, M., Jugiau, F., Protais, J., 2010. Detection of Listeria monocytogenes in raw and pasteurized liquid whole eggs and characterization by PFGE. Int. J. Food Microbiol. 138 (1–2), 56–62. Roasto, M., 2009. Listeria monocytogenes toidupatogeenina ja tootmishügieeni mõjutava faktorina. In: Veterinaarmeditsiin, pp. 68–72 (in Estonian). Robertson, G.L., 2006. Active and intelligent packaging. Food Packaging: Principles and Practice. second ed. CRC Press, Boca Raton, FL. Roche, S.M., Grepinet, O., Kerouanton, A., Ragon, M., Leclercq, A., Temoin, S., Schaeffer, B., Skoski, G., Mereghetti, L., Le Monnier, A., Velge, P., 2012. Polyphasic characterization and genetic relatedness of lowvirulent Listeria monocytogenes isolates. BMC Microbiol. 12, 304. Rocourt, J., 1994. Listeria monocytogenes: the state of the art. Dairy Food Environ. Sanit. 14, 70–82. Rocourt, J., Cossart, P., 1997. Listeria monocytogenes. In: Doyle, M.P., Beuchat, L.R., Montville, T.J. (Eds.), Food microbiology—Fundamentals and Frontiers. American Society for Microbiology Press, Washington, DC, pp. 337–352.

190  Chapter 6 Rocourt, J., Jacquet, C., Reilly, A., 2000. Epidemiology of human listeriosis and seafoods. Intern. J. Food Microbiol. 62, 197–209. Roman, M.J., Decker, E.A., Goddard, J.M., 2014. Metal-chelating active packaging film enhances lysozyme inhibition of Listeria monocytogenes. J. Food Prot. 77 (7), 1153–1160. Ronholm, J., van Faassen, H., MacKenzie, R., Zhang, Z.Y., Cao, X.D., Lin, M., 2013. Monoclonal antibodies recognizing the surface autolysin IspC of Listeria monocytogenes serotype 4b: epitope localization, kinetic characterization, and cross-reaction studies. PLOS ONE 8 (2), e55098. Ross, P.R., Morgan, S., Hill, S., 2002. Preservation and fermentation: past, present and future. Int. J. Food Microbiol. 79, 3–16. Santorum, P., Garcia, R., Lopez, V., Martinez-Suarez, J.V., 2012. Review. Dairy farm management and production practices associated with the presence of Listeria monocytogenes in raw milk and beef. Spanish J. Agric. Res. 10, 360–371. Sauders, B.D., Overdevest, J., Fortes, E., Windham, K., Schukken, Y., Lembo, A., Wiedmann, M., 2012. Diversity of Listeria species in urban and natural environments. Appl. Environ. Microbiol. 78, 4420–4433. Scallan, E., Hoekstra, R.M., Angulo, F.J., Tauxe, R.V., Widdowson, M.A., Roy, S.L., Jones, J.L., Griffin, P.M., 2011. Foodborne illness acquired in the United States—major pathogens. Emerg. Infect. Dis. 17, 7–15. Schlech, W.F., 1991. Lowbury Lecture. Listeriosis: epidemiology, virulence and the significance of contaminated foodstuffs. J. Hosp. Infect. 19 (4), 211–224. Schlech, W.F., 2000. Foodborne listeriosis. Clin. Infect. Dis. 31, 770–775. Schuchat, A., Swaminathan, B., Broome, C.V., 1991. Epidemiology of human listeriosis. Clin. Microbiol. Rev. 4 (2), 169–183. Schuppler, M., Loessner, M.J., 2010. The opportunistic pathogen Listeria monocytogenes: pathogenicity and interaction with the mucosal immune system. Int. J. Inflam. 2010, 1–12. Sebti, I., Ham-Pichavant, F., Coma, V., 2002. Edible bioactive fatty acid-cellulosic derivative composites used in food-packaging applications. J. Agr. Food Chem. 50 (15), 4290–4294. Shabala, L., Budde, B., Ross, T., Siegumfeldt, H., McMeekin, T., 2002. Responses of Listeria monocytogenes to acid stress and glucose availability monitored by measurements of intracellular pH and viable counts. Int. J. Food Microbiol. 75 (1–2), 89–97. Silk, B.J., Date, K.A., Jackson, K.A., Pouillot, R., Holt, K.G., Graves, L.M., Ong, K.L., Hurd, S., Meyer, R., Marcus, R., Shiferaw, B., Norton, D.M., Medus, C., Zansky, S.M., Cronquist, A.B., Henao, O.L., Jones, T.F., Vugia, D.J., Farley, M.M., Mahon, B.E., 2012. Invasive listeriosis in the foodborne diseases active surveillance network (FoodNet), 2004–2009: further targeted prevention needed for higher-risk groups. Clin. Infect. Dis. 54 (Suppl. 5), S396–S404. Singh, A., Poshtiban, S., Evoy, S., 2013. Recent advances in bacteriophage based biosensors for food-borne pathogen detection. Sensors 13, 1763–1786. Slutsker, L., Schuchat, A., 1999. Listeriosis in humans. In: Ryser, E.T., Marth, E.H. (Eds.), Listeria, Listeriosis, and Food Safety. second ed. Marcel Dekker Inc., New York, pp. 75–95. Small, P.L.C., Waterman, S.R., 1998. Acid stress, anaerobiosis and gadCB lessons from Lactococcus lactis and Escherichia coli. Trends Microbiol. 6 (6), 214–216. Soares, D., Lerin, L.A., Cansian, R.L., Oliveira, J.V., Mazutti, M.A., 2013. Inactivation of Listeria monocytogenes using supercritical carbon dioxide in a high-pressure variable-volume reactor. Food Control 31 (2), 514–518. Sommers, C.H., Sites, J.E., Musgrove, M., 2010. Ultraviolet light (254 nm) inactivation of pathogenes on foods and stainless steel surfaces. J. Food Saf. 30, 470–479. Spyrou, N., Anderson, M., Foale, R., 1997. Listeria endocarditis: current management and patient outcome— world literature review. Heart 77, 380–383. Sukhadeo, B.B., Trinad, C., 2009. Molecular mechanisms of bacterial infection via the gut. Cur. Top. in Microbiol. Immunol. 337, 173–195. Sun, A.N., Camilli, A., Portnoy, D.A., 1990. Isolation of Listeria monocytogenes small-plaque mutants defective for intracellular growth and cell-to-cell spread. Infect. Immun. 58, 3770–3778. Synnott, M.B., Morse, D.L., Hall, S.M., 1994. Neonatal meningitis in England and Wales: a review of routine national data. Arch. Dis. Child. 71, 75–80.

Listeria monocytogenes: A Food-Borne Pathogen  191 Takahashi, H., Takahashi, T., Miya, S., Yokoyama, H., Kuda, T., Kimura, B., 2015. Growth inhibition effects of ferulic acid and glycine/sodium acetate on Listeria monocytogenes in coleslaw and egg salad. Food Control 57, 105–109. Tappero, J.W., Schuchat, A., Deaver, K.A., Mascola, L., Wenger, J.D., 1995. Reduction in the incidence of human listeriosis in the United States: effectiveness of prevention efforts? J. Am. Med. Assoc. 273, 1118–1122. Teixeira, M.L., Santos, J., Silveira, N.P., Brandelli, A., 2008. Phospholipid nanovesicles containing a bacteriocinlike substance for control of Listeria monocytogenes. Innov. Food Sci. Emerg. Technol. 9, 49–53. Tilney, L.G., Connelly, P.S., Portnoy, D.A., 1990. The nucleation of actin filaments by the bacterial intracellular pathogen, Listeria monocytogenes. J. Cell Biol. 111, 2979–2988. Tolba, M., Tlili, M.U., Eichenseher, C., Loessner, M.J., Zourob, M., 2012. A bacteriophage endolysin-based electrochemical impedance biosensor for the rapid detection of Listeria cells. Analyst 137, 5749–5756. Tu, Z., Chen, Q., Li, Y., Xiong, Y., Xu, Y., Hu, N., Tao, Y., 2016. Identification and characterization of speciesspecific nanobodies for the detection of Listeria monocytogenes in milk. Anal. Biochem. 493, 1–7. Turgis, M., Millette, M., Salmieri, S., Lacroix, M., 2012. Elimination of Listeria monocytogenes in ready-to-eat carrots by combination of antimicrobial coating and γ-irradiation. Radiat. Phys. Chem. 81, 1170–1172. Uesugi, A.R., Hsu, L.C., Worobo, R.W., Moraru, C.I., 2016. Gene expression analysis for Listeria monocytogenes following exposure to pulsed light and continuous ultraviolet light treatments. LWT Food Sci. Technol. 68, 579–588. USDA FSIS (U.S. Department of Agriculture-Food Safety and Inspection Service), 2014. FSIS compliance guideline: Controlling Listeria monocytogenes in post-lethality exposed ready-to-eat meat and poultry products. FSIS Listeria Guideline. Available from: https://www.fsis.usda.gov/wps/wcm/connect/d337329950e6-47d6-a577-e74a1e549fde/Controlling-Lm-RTE-Guideline.pdf?MOD=AJPERES. US Food and Drug Administration, 2016. Bacteriological Analytical Manual (BAM). Chapter 10. Detection of Listeria monocytogenes in foods and environmental samples, and enumeration of Listeria monocytogenes in foods. Available from: http://www.fda.gov/Food/ScienceResearch/LaboratoryMethods/ BacteriolgicalAnalyticalManualBAM/ucm071400.htm. US Food and Drug Administration, 2017. Bad Bug Book: foodborne Pathogenic Microorganisms and Natural Toxins Handbook: Listeria monocytogenes. Available from: https://www.fda.gov/downloads/food/foodsafety/ foodborneillness/foodborneillnessfoodbornepathogensnaturaltoxins/badbugbook/ucm297627.pdf, p. 99. van Schaik, W., Abee, T., 2005. The role of sigmaB in the stress response of Gram-positive bacteria-targets for food preservation and safety. Curr. Opin. Biotechnol. 16 (2), 218–224. Vazquez-Boland, J., Kocks, C., Dramsi, S., Ohayon, H., Geoffroy, C., Mengaud, J., Cossart, P., 1992. Nucleotide sequence of the lecithinase operon of Listeria monocytogenes and possible role of lecithinase in cell-to-cell spread. Infect. Immun. 60, 219–230. Vazquez-Boland, J.A., Kuhn, M., Berche, P., Chakraborty, T., Dominguez-Bernal, G., Goebel, W., Gonzalez-Zorn, B., Wehland, J., Kreft, J., 2001. Listeria pathogenesis and molecular virulence determinants. Clin. Microbiol. Rev. 14 (3), 584–640. Velazquez-Estrada, R.M., Hernandez-Herrero, M.M., Lopez-Pedemonte, T.J., Brinez-Zambrano, W.J., GuamisLopez, B., Roig-Sagues, A.X., 2010. Inactivation of Listeria monocytogenes and Salmonella enterica serovar Senftenberg 775W inoculated into fruit juice by means of ultra high pressure homogenisation. Food Control 22 (2), 313–317. Vitas, A.I., Aguado, V., Garcia-Jalon, I., 2004. Occurrence of Listeria monocytogenes in fresh and processed foods in Navarra (Spain). Int. J. Food Microbiol. 90, 349–356. Walcher, G., Stessl, B., Wagner, M., Eichenseher, F., Loessner, M.J., Hein, I., 2010. Evaluation of paramagnetic beads coated with recombinant Listeria phage endolysin-derived cell-wall-binding domain proteins for separation of Listeria monocytogenes from raw milk in combination with culture-based and real-time polymerase chain reaction-based quantification. Foodborne Pathog. Dis. 7 (9), 1019–1024. Walker, R.L., 1999. Listeria. In: Hirsh, D.C., Zee, Y.C. (Eds.), Veterinary Microbiology. Blackwell Science, Malden, MA, pp. 225–228. Walker, J.K., Morgan, J.H., 1993. Ovine ophthalmitis associated with Listeria monocytogenes. Vet. Rec. 132, 636.

192  Chapter 6 Wang, J., Xie, X., Feng, J., Chen, J.C., Du, X., Luo, J., Lu, X., Wang, S., 2015a. Rapid detection of Listeria monocytogenes in milk using confocal micro-Raman spectroscopy and chemometric analysis. Int. J. Food Miocrobiol. 204, 66–74. Wang, K., Ye, K., Zhu, Y., Huang, Y., Wang, G., Wang, H., Zhou, G., 2015b. Prevalence, antimicrobial resistance and genetic diversity of Listeria monocytogenes isolated from chilled pork in Nanjing, China. LWT - Food Sci. Technol. 64, 905–910. Were, L.M., Bruce, B., Davidson, P.M., Weiss, J., 2004. Encapsulation of nisin and lysozyme in liposomes enhances efficacy against Listeria monocytogenes. J. Food Prot. 67 (5), 922–927. Wiedmann, M., Arvik, T.J., Hurley, R.J., Boor, K.J., 1998. General stress transcription factor sigmaB and its role in acid tolerance and virulence of Listeria monocytogenes. J. Bacteriol. 180 (14), 3650–3656. Winkelstroter, L.K., Tulini, F.L., De Martinis, E.C.P., 2015. Identification of the bacteriocin produced by cheese isolate Lactobacillus paraplantarum FT259 and its potential influence on Listeria monocytogenes biofilm formation. LWT Food Sci. Technol. 64, 586–592. Yang, Y., Miks-Krajnik, M., Zheng, Q., Lee, S.B., Lee, S.C., Yuk, H.G., 2016. Biofilm formation of Salmonella enteritidis under food-related environmental stress conditions and its subsequent resistance to chlorine treatment. Food Microbiol. 54, 98–105. Yuk, H.G., Yoo, M.Y., Yoon, J.W., Marshall, D.L., Oh, D.H., 2007. Effect of combined ozone and organic acid treatment for control of Escherichia coli O157:H7 and Listeria monocytogenes on enoki mushroom. Food Control 18 (5), 548–553. Zhang, Z., Xiao, L., Lou, Y., Jin, M., Liao, C., Malakar, P.K., Pan, Y., Zhao, Y., 2015. Development of a multiplex real-time PCR method for simultaneous detection of Vibrio parahaemolyticus, Listeria monocytogenes and Salmonella spp. in raw shrimp. Food Control 51, 31–36. Zhang, L., Huang, R., Liu, W., Liu, H., Zhou, X., Xing, D., 2016. Rapid and visual detection of Listeria monocytogenes based on nanoparticle cluster catalyzed signal amplification. Biosens. Bioelectr. 86, 1–7. Zhao, Y., Li, Y., Jiang, K., Wang, J., White, W.L., Yang, S., Lu, J., 2016. Rapid detection of Listeria monocytogenes in food by biofunctionalized magnetic nanoparticle based on nuclear magnetic resonance. Food Control 71, 110–116. Zhao, T., Podtburg, T.C., Zhao, P., Chen, D., Baker, D.A., Cords, B., Doyle, M.P., 2013a. Reduction by competitive bacteria of Listeria monocytogenes in biofilms and Listeria bacteria in floor drains in a ready-toeat poultry processing plant. J. Food Prot. 76, 601–607. Zhao, W., Yang, R., Shen, X., Zhang, S., Chen, X., 2013b. Lethal and sublethal injury and kinetics of Escherichia coli, Listeria monocytogenes and Staphylococcus aureus in milk by pulsed electric fields. Food Control 32, 6–12.

CHAPTE R 7

Bacillus spp. as Pathogens in the Dairy Industry Alyssa A. Grutsch, Pierre S. Nimmer, Rachel H. Pittsley, John L. McKillip Ball State University, Muncie, IN, United States

1  Bacillus: General Information Bacillus spp. bacteria show a wide range of characteristics that allow them to live in most natural environments (Griffiths, 2010). Bacillus comprises a large group of ubiquitous Grampositive, rod-shaped, aerobic-to-facultatively anaerobic, endospore-forming saprophytes (Weber and Rutala, 1988). Although the majority of Bacillus spp. are nonpathogenic, a few (B. cereus, B. anthracis, and B. thuringiensis) opportunistically infect animal hosts (mammals and insects) (Vilain et al., 2006). Bacillus microscopic morphology may be individual or as long chains in primary isolates from soil or water samples (Weber and Rutala, 1988). The size of an individual rod can range from 0.5 × 1.2 to 2.5 × 10 µm2. Spores produced by Bacillus spp. are resistant to heat (including to some extent, pasteurization conditions), cold, ionizing radiation, dehydration, and many disinfectants (Griffiths, 2010). The endospores are either oval or cylinder shaped and are found centrally, subterminally, or terminally. Over 30 species of Bacillus spp. are recognized and are divided into two groups based mostly on the 16S rRNA/DNA sequences: the B. subtilis group and the B. cereus group. B. subtilis, B. amyloliquefaciens, B. licheniformis, and B. pumilus are mesophilic, have ellipse shaped spores, and are the most common members of the B. subtilis group. B. cereus, B. anthracis, B. thuringiensis, B. weihenstephanensis, and B. mycoides do not ferment mannitol, produce lecithinase, and comprise the B. cereus group. The colony morphology of Bacillus spp. is diverse across species. Bacillus spp. grow on nutrient agar or peptone media and exhibit ideal growth at a pH of 7; however, some Bacillus spp. grow at a pH of 9, while other species can endure pH 2. Bacillus spp. grow best within a temperature range of 30°–45°C, but thermophilic variants grow optimally at 65°C. All Bacillus spp. metabolize organic substrates, such as amino acids, organic acids, and sugars, by aerobic respiration, anaerobic respiration, or fermentation, depending on species and environment. The enzymatic processes and metabolic characteristics are the typical criteria for Bacillus species differentiation.

Foodborne Diseases http://dx.doi.org/10.1016/B978-0-12-811444-5.00007-5

193

Copyright © 2018 Elsevier Inc. All rights reserved.

194  Chapter 7 Bacillaceae family members demonstrate a wide range of characteristics, including the ability to produce a battery of enzymes, antibiotics, and other secondary metabolites (Schallmey et al., 2004). For example, Bacillus spp. have unique abilities to synthesize and/or secrete many substances that are beneficial and show great success in agriculture and industry. Many Bacillus species exhibit antibacterial and antifungal activity against phytopathogens through secretory products (Yu et al., 2002), a logical evolutionary strategy, as Bacillus spp. are soilborne or are found in epiphytes (a plant that grows nonparasitically on another plant) and/ or endophytes (living within a plant host) (Fravel, 2005). Many antimicrobial compounds that are well recognized in the biotechnology and biopharmaceutical industries for their surfactant properties are derived from B. subtilis (Ongena and Jacques, 2007). A surfactant lowers surface tension between two liquids or a solid and a liquid (Shaligram and Singhal, 2010). Surfactants are used for foam creation and stabilization in food processing, household products (paint, detergent, and fabric softener), solubilization of agrochemicals, oil recovery, crude oil drilling lubricants, and bioremediation of water-insoluble pollutants. Phenotypically, the genus is difficult to delineate into species, but using genotypic methods, determination of relatedness has been revisited in recent years (Sneath, 1986). The mole percent G + C content of the DNA is a well-regarded metric by which organisms may be compared genetically. The Bacillus genus is diverse and has a G + C content from 33%–69% (Winn et al., 2006). Sequencing of 16S rRNA genes and DNA–DNA hybridization methods have been used to assign species names (Goto et al., 2000). 16S rDNA has a hypervariant region on the 5′ end. This hypervariant region is highly specific to each Bacillus spp. and is a good genotyping target. Overall, much emphasis has been placed in recent years on defining criteria for species determination within the genus Bacillus, although no single accepted system or approach has been established yet. Other molecular techniques are also used to identify bacterial species, including Bacillus spp. The following molecular techniques are used to confirm the identify of Bacillus and other bacterial species: (1) polymerase chain reaction (PCR) (Adzitey et al., 2013), (2) pulsed field gel electrophoresis, (3) random amplified polymorphism deoxyribonucleic acid, and (4) matrix assisted laser desorption/ionization time of flight (MALDI-TOF) (Murray, 2012). PCR is a DNA replication process that amplifies small portions of DNA (amplicons) exponentially with the help of oligonucleotide primers and DNA polymerase. PCR has many different variations, including real-time PCR (qPCR). qPCR is a powerful approach wherein template bacterial DNA is amplified and quantified at the same time using a standard curvebased comparison of type strain standards. Pulsed field gel electrophoresis is an agarose gel electrophoresis method that separates large pieces of genomic DNA. This separation of DNA is done by applying an electrical current that periodically changes between three different directions, providing a means to accurately resolve small differences in genomic sequences for bacterial community analyses. Random amplified polymorphism deoxyribonucleic acid is a PCR-based method that uses arbitrary primers to randomly amplify segments of target

Bacillus spp. as Pathogens in the Dairy Industry  195 DNA, essentially acting as a DNA fingerprinting system for bacterial species. MALDI-TOF is a simple and rapid technique. Bacterial colonies are removed from the plate, mixed with a UV-absorbing matrix (saturated solution of α-cyano-4-hydroxy-cinnamic acid in 50% acetonitrile and 2.5% trifluoroacetic acid) and dried on a target plate. The target plates are exposed to laser pulses that develop an energy transfer from the matrix to the nonvolatile analyte molecules. The analyte is removed in the form of gas. The molecules are enhanced in a flight tube to the mass spectrometer. MALDI-TOF is accurate, rapid, and after initial purchase, inexpensive. These characteristics perhaps explain why MALDI-TOF is being used in hospitals for quick identification of bacterial infections.

2  Bacillus in Clinical Settings (General) Through biofilm production, B. cereus has been implicated in contaminating intravenous catheters (Hernaiz et al., 2003) resulting in B. cereus–mediated sepsis (Kuroki et al., 2009; Ozkocaman et al., 2006). The formation of biofilms also allows the release of planktonic bacteria that produce additional biofilms, increasing the severity of the infection (Costerton et al., 1999). In addition to catheter contamination, B. cereus and its endospores have been shown to contaminate air filtration and ventilation equipment (Bryce et al., 1993), fiber optic bronchoscopy equipment (Goldstein and Abrutyn, 1985; Richardson et al., 1986), linens (Barrie et al., 1994), gloves (York, 1990), specimen collection tubes and balloons used in manual ventilation (Van Der Zwet et al., 2000), alcohol-based hand wash solutions (Hsueh et al., 1999), plaster-impregnated gauze and many antiseptics, such as chlorhexidine and povidone iodine (Dubouix et al., 2005). The most common types of infections B. cereus causes, other than foodborne illness, include fulminant bacteremia, central nervous system involvement (meningitis and brain abscesses), pneumonia, gas gangrene–like cutaneous infections, and endophthalmitis.

2.1  Bacillus cereus–Mediated Endophthalmitis B. cereus is not only capable of causing food-associated toxicoinfections, but can cause endophthalmitis as well (Davey and Tauber, 1987; Hermandy et al., 1990; Ullman et al., 1987). B. cereus is not the only pathogen capable of causing endophthalmitis, but is considered one of the most aggressive pathogens causing this condition. As there is a limited immune response when a pathogen enters the eye, a wide spectrum of pathogens can enter and elicit a wide array of effects. Symptoms can range from a relatively painless anterior chamber inflammation (Aaberg et al., 1998), to an explosive ocular and periorbital infection caused by B. cereus (Schemmer and Driebe, 1987). Specific toxin production by a particular microorganism is theorized to account for the difference in symptoms. B. cereus– induced endophthalmitis is characterized by a corneal ring abscess followed by increased

196  Chapter 7 pain, chemosis, proptosis, retinal hemorrhage, and perivasculitis (Callegan et al., 1999a). Fever, leukocytosis, and general malaise often appear as the systemic manifestations of this condition (Martinez et al., 2007). B. cereus–induced endophthalmitis can be divided into two categories: exogenous and endogenous. An exogenous source is due to blunt trauma that penetrates the eye, which may occur due to occupation (e.g., metal workers), in an agricultural setting (David et al., 1994) or infection resulting from unsterile instruments during cataract surgery. In one example in Rome, an ophthalmologist had four of his cataract patients lose vision in their treated eye 1 day after their cataract surgery (Simini, 1998). B. cereus is ranked second behind Staphylococcus aureus that is responsible for about 70% of postcataract surgery endophthalmitis (Han et al., 1996). The three main risk factors surgeons need to be aware of to reduce posttraumatic endophthalmitis are the presence of an intraocular foreign body, delay in closure of the globe, and the location/extent of the laceration of the globe. Endogenous sources represent about 2%–8% of all endophthalmitis cases (Romero et al., 1999) and are due to bacteria entering the posterior segment of the eye. The most common pathogen to enter the posterior segment of the eye is Candida albicans, but other common pathogens include S. aureus, B. cereus, Escherichia coli, Neisseria meningitidis, and Klebsiella spp. B. cereus can accomplish this route of entry through blood transfusion, contaminated needles/illicit drug injection paraphernalia (Grossniklaus et al., 1985), or by iatrogenic administration of medications, such as B vitamins or insulin (Motoi et al., 1997). Moyer et al. (2009) demonstrated that B. cereus is capable of disrupting tight junctions between endothelial cells and the basement membrane of retinal capillaries and retinal pericytes as early as 4-h postinfection. Such changes are hypothesized to be responsible for causing the loss of retinal structure and function (Kopel et al., 2008; Moyer et al., 2009). The exact toxins from B. cereus responsible for causing this breakdown of the blood–retinal barrier are unknown, but are theorized to consist of the following molecules that may be working individually or in tandem to achieve this effect: the hemolysin B (Hbl) enterotoxin, the nonhemolytic enterotoxin (Nhe) enterotoxin, a crude exotoxin derived from cell-free B. cereus culture filtrates, phosphatidylcholine-preferring phospholipase C, collagenase, cereolysin O (Shany et al., 1974), or cereolysin AB (Scott et al., 1996). However, only the Hbl enterotoxin protein has been identified for its role in endophthalmitis (Callegan et al., 1999b). Hbl enterotoxin has been shown to cause irreversible tissue damage to the photoreceptors of the retina in less than 12–24 h, causing blindness in the infected eye (Beecher et al., 1995; Davey and Tauber, 1987). B. cereus is capable of disrupting the blood–retinal barrier as early as 4-h after infection in retinal tissues, 6-h postinfection in aqueous humor, and in all other ocular tissues 12 h postinfection (Callegan et al., 1999a). B. cereus has been shown to be a more rapid and virulent endophthalmitis pathogen compared to S. aureus and Enterococcus faecalis.

Bacillus spp. as Pathogens in the Dairy Industry  197 Additionally, B. cereus seems to exhibit an almost immediate inflammatory response despite low numbers of the organism present at the early stages of infection. Limited research exists that addresses the exact role the immune system plays in endophthalmitis, but the eye is known to be an immunoprivileged site as was first described by Medawar in 1948 (Cunha-Vaz, 1997). The eye restricts both the adaptive and innate immune systems in such a way to balance the challenge of pathogen infection against inflammation-induced vision loss (Streilein, 2003). In most instances of B. cereus–induced endophthalmitis, vision loss occurs regardless of the type of therapeutic or surgical intervention utilized because the severity of the disease has progressed to such a condition, that too many toxins have been released by B. cereus and many bacteria would have migrated in the eye out of the reach of antibiotics (Callegan et al., 2006). Thus, within a 12–18 h time frame, massive tissue destruction occurs to the retina and surrounding ocular tissues, resulting in antibiotics no longer being maximally effective (Callegan et al., 2002). In addition, the inflammatory response inside the eye is so aggressive that even if the antibiotics control B. cereus, the inflammation produced causes damage to surrounding ocular structures, thus making it difficult to manage ocular infections.

3  Bacillus in Food Foodborne illness from a variety of microorganisms affects on average 76 million individuals in the United States each year resulting in approximately 5000 deaths (Mead et al., 1999). Worldwide statistics on B. cereus foodborne illness are underestimated due to a variety of factors, including emetic symptoms similar to S. aureus intoxication and diarrheal symptoms similar to those elicited by Clostridium perfringens type A. Most affected individuals do not seek medical attention due to the short duration of signs and symptoms. B. cereus seems to account for between 1.4% and 12% of foodborne illness outbreaks worldwide (Stenfors Arnesen et al., 2008). Bacillus spp. are capable of contaminating a wide range of food products, including rice, chicken, vegetables, spices, and dairy products. Contamination in the dairy industry may occur when B. cereus spores come in contact with the udders of cows (Andersson et al. 1995), if the spores colonize feed or bedding, or if the spores survive pasteurization (Claus and Berkley, 1986; Sneath, 1986). This is a serious problem in the food industry because B. cereus endospores are in many instances partially resistant to the heat of pasteurization, dehydration, gamma radiation, and other physical stresses. This resistance is not only due to the ultrastructure of the endospore of course, but also in part to the hydrophobic nature of the spores that allows them to adhere strongly to surfaces and develop biofilm-like properties (Mattson et al., 2000; Ronner et al., 1990). For example, an irradiation dose of 1.25–4 kGy needs to be administered to reduce spores by 90% (De Lara et al., 2002). Also, pasteurization may result in the activation and germination of spores (Hanson et al., 2005). In addition,

198  Chapter 7 B. cereus endospores germinate in response to particular nutrients, such as glycine, or in response to physical stress, such as temperature (spore germination can occur over 5–50°C in cooked rice) (Granum, 1994) and high pressure (i.e., 500 MPa). Thus, foods need to be cooked at a temperature of at least 100°C (212°F) to kill most of the endospores (Griffiths and Schraft, 2002). Thermoduric spore formers are the subject of great interest within the dairy industry (Burgess et al., 2010). Thermophilic bacilli produce heat-resistant (80–100°C) and highly heatresistant (>106°C) endospores in ultrahigh temperature (UHT)–treated products, which can lay dormant for years. Heat, chemicals, and pH levels can activate a spore for germination and outgrowth. This is particularly important in the dairy industry because heat is used as a preservation mechanism. B. subtilis has a low activation temperature of 65–70°C. Once the spores are activated, germination is elicited by nutrients that bind to germination receptors. A nutrient mixture of asparagine, glucose, fructose, and K+ (AGFK) triggers B. subtilis spore germination (Setlow, 2003). Many people consider B. anthracis, B. thuringiensis, and B. cereus to be the same species (Helgason et al., 2000). B. anthracis is found in the soil and primarily infects herbivorous animals, causing human disease (Kolsto et al., 2009; Winn et al., 2006). This disease may be contracted through skin lesions, the gastrointestinal route, or by inhalation. Respiratory and gastrointestinal-acquired routes are highly lethal forms of anthrax. B. anthracis virulence mechanisms easily allow for the spread of the bacteria to the lymph nodes. Once in the lymph nodes, the bacteria disseminate via the bloodstream and internal organs. B. anthracis spores are highly resistant to adverse environmental conditions, and it is difficult to be certain that the organism has been fully eradicated from endemic areas (Winn et al., 2006). The endospores are maintained in soil and stay dormant indefinitely. The virulence determinants produced by B. anthracis are composed of three proteins: a protective antigen (PA), an edema factor (EF), and the lethal factor (LF). Virulent strains are also typically capsule-producers. Toxin expression and production is enhanced by elevated CO2 and growth temperatures of 35–37°C. B. anthracis strains harbor two large plasmids, pXO1 and pXO2 (Kolsto et al., 2009). These plasmids are needed for full virulence. pXO1 contains the coding for the PA (pag), EF (cya), and LF (lef). pXO2 contains a five-gene operon for the biosynthesis of a polyglutamate capsule. This capsule is important for the ability to escape the host immune system, by protecting the vegetative cells from phagocytosis. B. thuringiensis classification has been accomplished by H serotyping, which utilizes bacterial flagellar antigens (Sneath, 1986). This species has unique insecticidal properties that demonstrate activity against several insect orders, as well as nematodes, mites, and protozoa. B. thuringiensis produces protoxins during sporulation (Aronson et al., 1986). These toxins are either parasporal inclusions or found on the spore surface. B. thuringiensis produces parasporal crystals during sporulation, which are inclusions of insecticidal toxins. The midgut

Bacillus spp. as Pathogens in the Dairy Industry  199 of the larvae has proteases that convert protoxins to toxins, activating the toxin to bind to receptors on columnar midgut cells. This binding event results in pore formation of the midgut epithelium, and susceptible insects die from this extensive damage and pH changes as midgut contents mix with the hemocoel cavity. Three common subspecies variants have been recognized and well characterized over the last 40 years: (1) B. thuringiensis subsp. kurstaki, (2) B. thuringiensis subsp. israelensis, and (3) B. thuringiensis subsp. japanensis. Each species produces a crystalline endotoxin specific for a unique order of insects for selective toxic biological control. Interestingly, each species is also extremely genetically similar to the type strain pathogen in this family, B. cereus. B. cereus and other Bacillus spp. are major causes of foodborne illness globally and major causes of endophthalmitis (Moyer et al., 2008; Stenfors Arnesen et al., 2008; Weber and Rutala, 1988). B. cereus has an optimum growth temperature of 30°–40°C, although psychotrophic members can grow in temperatures as low as 4°C. B. cereus can grow in a pH of 5.0–8.8 with an optimal pH of 6.0–7.0. Food poisoning due to B. cereus is underreported because it is short term and self-limiting. In 2005, Bacillus spp. were responsible for 1.4% of foodborne illness in Europe. In the Netherlands between 1993 and 1998, 12% of foodborne illness was caused by B. cereus. In 2006, an average of 63,400 (0.4%) people were domestically affected with B. cereus food poisoning (Scallan et al., 2011). Reports of B. cereus–induced food poisoning have increased in industrialized countries; however, reporting and testing is variable. In the United States, passive surveillance is usually performed due to low hospitalization of B. cereus food poisoning. Foods frequently contaminated by B. cereus include milk, dairy products, dry foods, rice, egg products, and legumes. Two types of food-related illnesses are caused by B. cereus: (1) type 1: short incubation “emetic” and (2) type 2: long incubation “diarrheal.” Type 1 has an incubation time of 2 h and lasts approximately 9 h. Type 2 has an incubation time of 9 h and lasts 24 h. Type 1 is mostly associated with contaminated rice and type 2 is associated with contaminated meat or vegetables. The main virulence factor for type 1 food poisoning caused by B. cereus is cereulide (Ceuppens et al., 2011). Cereulide is a low–molecular weight heat-stable exotoxin that can withstand treatment at 121°C for 2 h at a pH of 7.0. This stability means the toxin can withstand frying, roasting, and microwave exposure, eliciting a foodborne emetic intoxication in susceptible individuals. The main causes of type 2 foodborne illness are Hbl and Nhe, both comprising three components encoded by separate operons (Fig. 7.1), typical AB toxin architecture. Hbl is made of the cytolytic subunits HblC and HblD, and the protein B–binding domains. The Hbl operon also has a fourth member, the hblB gene. However, hblB is not transcribed and is likely a pseudogene. Nhe is made of the cytolytic protein NheA, and the protein B–binding sections NheB and NheC. In recent research, 7.5% of reported emetic symptoms have been linked to Hbl and Nhe. These toxins are a product of aerobic, spore-forming B. cereus.

200  Chapter 7

Figure 7.1: Enterotoxin Operons for nhe and hbl. plcR is the regulator gene; it is described in more detail further in Fravel (2005).

Aerobic spore formers in food are ubiquitous. This ubiquity makes it impossible to prevent aerobic spore formers from being present in many fresh foods. Spore counts in raw milk vary throughout the year, but are highest in winter when dairy cows are primarily indoors. Pasteurization is effective in inactivating vegetative cells in raw milk, but fails to kill many spores. The spores have no competition from vegetative cells, so they proliferate rapidly if the product is mishandled or improperly stored. The sporulated Bacillus, upon germination, can adhere to pipelines and equipment, causing biofilm formation. These spores and vegetative cells in equipment and raw milk may be tolerant to sterilization. Biofilm extrapolymeric substances offer a significant survival strategy to established populations of bacteria. These counteractive techniques include UHT processing, previously known to inactivate all living material; however, spores are now known to survive UHT processing. UHT processing is achieved by treating fluid milk at 135–150°C for 1–8 s. The milk flows continuously during this process and is packaged into presterilized containers (aseptic packaging). The UHT process is designed to kill almost all organisms, including spores. The concern is that some spores still survive and there is no competition for these spores, giving them an ideal environment for proliferation. The growing concern for psychrotolerant spore formers is that they show potential of inducing foodborne illness and produce spoilage defects caused by enzymatic activity. These concerns are due to a combination of the following reasons: (1) longer refrigeration storage prepasteurization, (2) higher temperatures used for pasteurization, (3) prolonged shelf life, and (4) pasteurization activates the germination of spores. Combinations of these “advantages” are beneficial for B. cereus endospores to form from vegetative cells or vegetative cells to form endospores. Production length of milk treatment has been reduced to 6–8 h to help reduce thermophile growth (Burgess et al., 2010). Once a production cycle is complete, a cleaning-in-place method is performed on the equipment. CIP consists of the following steps: (1) a warm water rinse, (2) a 1.5% caustic wash at 75°C for 30 min, (3) a water rinse, (4) a 0.5% nitric acid wash at 70°C for 20 min, and (5) a second water rinse. These steps have helped with growth within the equipment, but not within the milk itself. Table 7.1 indicates

Bacillus spp. as Pathogens in the Dairy Industry  201 Table 7.1: United States time and temperature requirements for the pasteurization of milk. Temperatures (°C)

Time Periods

Designations

63 72 89 90 94 96 100 138 138–150

30 min 15 s 1s 0.5 s 0.1 s 0.05 s 0.01 s At least 2 s 1 or 2 s; aseptic packing

Low temperature–long time High temperature–short time

Ultrapasteurization Ultrahigh temperature

the time and temperature requirements laid out by the Food and Drug Administration (FDA) for pasteurization regimes, including UHT pasteurization (US Food and Drug Administration, 2001).

3.1  Bacillus spp. Biofilms Adherence of microbial biofilms to dairy production surfaces makes sanitization more difficult, and increases cost via labor and chemical usage along with lost production time. FDA involvement and subsequent product recalls can also occur, causing further financial problems for dairies. Araújo et al. have proposed a basic mechanism for biofilm adhesion based on six general stages. First, the biofilm surface must be primed for adhesion with the existence of food deposits. The biofilm-producing microorganism must then come into contact with the primed surface. Positive and negative biochemical forces, including van der Waals forces and other electrostatic forces, then allow the biofilm to make a nonpermanent attachment to the surface when microorganisms are between 20 and 50 nm away. Irreversible adhesion results within 1.5 nm when extracellular polysaccharide production, ionic bonds, and hydrophobic forces occur. The fourth stage is described by the multiplication of bacterial cells and an increase in secreted polysaccharides and the fifth stage involves strong metabolism in the biofilm. Last, microorganisms begin to be released from the biofilm during the sixth stage, shedding bacteria to generate new biofilms elsewhere. Several authors have identified a variety of mesophilic Bacillus subspecies capable of surviving UHT pasteurization via endospore formation (Scheldeman et al., 2006). Using bacterial cultures sampled from dairies, 16s rRNA, and PCR amplification some of the most prevalent and potentially problematic species, in regard to biofilm production, have been characterized. These species include B. cereus, B. amyloliquefaciens, and several others. The level of virulence activity in B. cereus cells is due to a number of different environmental factors, including temperature, pH, oxygen tension, glucose concentrations, and specific

202  Chapter 7 antimicrobial chemical compounds. Biofilm production is understood to be under similar regulation as toxins and other extracellular virulence determinants, which suggests that subinhibitory stress may have great influence on overall potential for Bacillus spp. to become problematic in dairy microbiology settings.

4  Quorum Sensing Quorum sensing is a regulatory system where the bacterium (B. cereus) recognizes an extracellular signal caused by an autoinducer (AI) to sense the density of B. cereus in the immediate environment. Quorum sensing is used to govern cell density, and the corresponding regulation of relevant gene expression that would enhance survival during the log-to-stationary phase transition in dense cultures, or in a natural environment, such as soil, food, or within a host (Gracias and McKillip, 2011). Quorum-sensing mechanisms control many processes in the bacterial cell, including sporulation, biofilm production, and virulence factor secretion (Goto et al., 2000). Quorum sensing involves direct or indirect activation of a related receptor protein by the AI (Graumann, 2012). This activation results in up- or downregulation of specific genes. All quorum-sensing routines are dependent on three principles: (1) the bacterial species produces AIs, (2) AIs are detected by membrane or cytoplasm receptors, and (3) AIs produce a positive feedback loop (Rutherford and Bassler, 2012). Gram-positive bacteria use small, posttranslationally modified peptides as same species AIs, called autoinducing peptides (AIPs) (Graumann, 2012). AIPs are expressed as large, precursor peptides and processed into smaller, cyclic, thiolactone-containing peptides that are transported across the membrane. This transportation can happen in two ways: (1) twocomponent signaling (Fig. 7.2) or (2) AIP-binding transcription factor signaling (Fig. 7.3). In the two-component signaling method, once the AIPs are transported outside of the cell they are too hydrophilic to cross the membrane without help. The AIPs remain in the extracellular matrix. The bacteria sense the AIP as it binds to the receptor protein (histidine kinase) located in the neighboring bacterial cell surface. This binding induces phosphorylation of the kinase. The phosphoryl group is then transferred to an aspartate residue of the response regulator. Then this binds to the promoter region of target genes, which activates or represses transcription.

5  Quorum Sensing and Bacillus spp. Pathogenesis Quorum sensing in B. cereus is dependent on a protein PlcR. PlcR is a pleiotropic regulator of most virulence factors specific to the B. cereus group (Nhe and Hbl) (Rutherford and Bassler, 2012). The activity of PlcR depends on binding to the AIP that is produced from the PapR protein. PapR is a small signaling peptide that acts as a quorum-sensing effector (Slamti

Figure 7.2: Two-Component Quorum Sensing of Gram-Positive Bacteria. Autoinducer (AI) synthase is used to process and transport the proautoinducing peptides (pro-AIP) out of the cell. Once the concentration of AIP outside the cell is high, AIP binds to histidine kinase receptors. This binding activates the kinase activity of the receptor, inducing autophosphorylation. The phosphoryl group binds to the response regulator and activates transcription of the quorum sensing system genes (Goto et al., 2000).

Figure 7.3: AIP Binding PlcR (Transcription Factor) Quorum Sensing Signaling in B. cereus. A high population density outside the cell activates PapR (pro-AIP) and then the PapR is secreted outside of the cell. PapR is processed by the protease NprB to become a heptapeptide AIP. AIP is transported back into the cell using an oligopeptide permease system (Opp). Once AIP is inside the cell, it binds and activates PlcR. This PlcR–AIP complex regulates virulence factors and also produces a positive feedback loop for PapR secretion (Goto et al., 2000).

204  Chapter 7 and Lereclus, 2005) (Fig. 7.3). PapR is 48 amino acid long and is encoded by an open reading frame located downstream from plcR. PapR is secreted from the cell forming a PapR pro-AIP. PapR pro-AIP is processed by neutral protease B (NprB) to form the active AIP. The AIP is transported back into the cell by an oligopeptide permease system (Opp). AIP then binds to the transcription factor PlcR, activating the protein. This PlcR–AIP complex regulates the production of virulence factors and a positive feedback loop for papR. It has been shown that PlcR expression is positively regulated by CodY expression (Frenzel et al., 2012). CodY is a global transcriptional regulator that facilitates advantageous changes in response to variations of available nutrients in Gram-positive bacteria (Sonenshein, 2005). CodY is a GTP- and isoleucine-binding protein that also initiates endosporulation. The binding of GTP and isoleucine causes the proteins to act as corepressors of the transcription of many genes. Endosporulation happens when there is a response to bacterial starvation by limited levels of carbon, nitrogen, or phosphorous. Endosporulation is a defense mechanism of Grampositive bacteria, like a turtle hiding in its shell, to protect its genome. Nucleotide synthesis is dependent on carbon, nitrogen, and phosphorus. This spore keeps the genome dormant until the environment is favorable enough to replicate. CodY is a transcriptional activator of the plcR gene (Graumann, 2012) (Fig. 7.4). In a ∆codY B. cereus strain, PlcR expression was strong in exponential, late exponential, and stationary phases of growth. In contrast, a wild-type B. cereus strain showed expression of PlcR in only the stationary phase of growth. CodY was first found in B. subtilis to control expression of more than 100 stationary phase genes. Thus, it is generally accepted that (like plcR), codY is widely conserved among Bacillaceae family members. B. amyloliquefaciens belongs to the B. subtilis group (Priest et al., 1987). Members of this group exhibit similar behaviors physiologically, although B. amyloliquefaciens is not a

Figure 7.4: CodY Regulates PapR and PlcR Expression in B. cereus. Nutrient availability for the cell regulates the expression of CodY (Goto et al., 2000; Graumann, 2012).

Bacillus spp. as Pathogens in the Dairy Industry  205 subspecies of B. subtilis due to the difference in α-amylase production. B. amyloliquefaciens has been found to share less than 5% homology at the DNA level with B. subtilis. B. subtilis has been shown to express CodY (Ratnayake-Lecamwasam et al., 2001; Serror and Sonenshein, 1996). Phelps and McKillip (2002), using DNA PCR, found that hblC, hblD, hblA, nheA, and nheB genes or gene homologs were present in a different strain of B. amyloliquefaciens obtained from a Louisiana creamery, although expression of these genes was not measured. Thus, the potential for this species to harbor and express these or other virulence factors (via global effectors CodY and/or PlcR) is a realistic possibility, despite this species being placed (at least currently) in the B. subtilis group rather than the B. cereus group.

6  Summary and Future Work The debate over proper identification and understanding of Bacillus virulence has been ongoing for over 50 years (Rasko et al., 2005). Recent public awareness of potential bioterrorism using the anthrax toxin produced by B. anthracis has lead government agencies to fund multiple studies aimed at rapidly differentiating B. anthracis from other closely related Bacillus species, such as B. cereus and B. thuringiensis, as B. anthracis produces the anthrax toxin encoded by two plasmid-based operons, pXO1 and pXO2. The anthrax toxin primarily kills herbivore mammals, but can also kill humans. Not to be underestimated, B. cereus can cause severe food poisoning through its production of emetic and diarrheal toxins. While heavily used as an insecticidal agent in crops with its Cry crystalline toxins, B. thuringiensis has also recently been demonstrated to cause food poisoning symptoms in humans similar to B. cereus. Ironically, species, such as B. coagulans, which has been found to harbor the nheA gene, are readily used as probiotics in human health. Bacillus spp. were originally differentiated into species at a time when biologists did not possess the molecular tools to delve deeper than biochemical tests and phenotypical observations. While this strategy worked well for other genera, 16S rRNA analysis of differences among B. cereus, B. thuringiensis, and B. anthracis have shown these species to have a nucleotide sequence difference of less than 1%. Recent advances in molecular biology have allowed scientists to scrutinize the genetic properties of these three “species.” After exhaustive studies using DNA–DNA hybridization, 16S and 23S rRNA comparative analyses, multilocus sequence typing, fluorescent amplified fragment length polymorphism analysis, rep-PCR, and small nucleotide polymorphism analyses, scientists have been unable to reliably differentiate these three Bacillus species. While many methods have been pursued, most results have suggested that B. cereus, B. thuringiensis, and B. anthracis should be considered the same species due to highly conserved nucleoidal genetic sequences. Due to the easily identifiable symptoms of B. anthracis and B. cereus, there is recent concern among biologists that the “B. anthracis” species may in fact be an oversampled subset of B. cereus. Other scientists speculate that

206  Chapter 7 B. anthracis may have only recently evolved to the point to be considered distinct from B. cereus. Unfortunately, recent literature is contradictory when discussing how similar two separate Bacillus genomes need to be in order to be considered the same species. There are claims that B. thuringiensis, B. cereus, and B. anthracis should be considered one species on the basis of genetic evidence. Alternatively, other scientists claim that current taxonomy has not divided Bacillus strains enough, suggesting that more species or subspecies than currently listed in literature exist. No commonly accepted definition has been found that separates these species on genetic evidence. There are three nhe genes that are encoded on the nheABC operon, and have been shown to remain conserved as a cluster during genetic recombination. It can reasonably be assumed that the presence of the most proximal subunit of nhe indicates the presence of the other two genes. In the literature, all genes encoding the Nhe and Hbl enterotoxins have been readily located downstream in both B. cereus and B. thuringiensis (Phelps and McKillip, 2002). The presence of the nheABC operon does not necessarily indicate a virulent strain, but has a very high likelihood of expressing these genes in a host environment or in food under permissive conditions. Thus, future work to determine the pathogenicity of nheA-positive samples could include the use of a Tecra VIA to detect enterotoxin proteins. Without this step, the virulence of nheA-positive samples cannot be definitively determined. A large degree of genetic variation exists in nhe sequences among Bacillus spp., giving rise to false negative results in PCR-based detection assays. Strains negative for nheA in qPCR have been found to produce the enterotoxin Nhe as determined using a Tecra VIA kit. The nheABC operon is mobile among Bacillus spp. through horizontal gene transfer (HGT). Indeed, HGT has been observed among Bacillus spp. and can serve as a mechanism explaining the incidence of non-B. cereus samples positive for nheA. While no data have been found to suggest that this gene transfer mechanism uses an integron, the anthrax-like operon pXO16 found in B. thuringiensis is part of a conjugative plasmid. It is a reasonable conjecture that other Bacillus species may also harbor conjugative plasmids that aid in HGT. Within Bacillus, most virulence factors are encoded on plasmids, which have been demonstrated to readily transfer between differing species. Indeed, a recent study indicated that the virulence genes associated with B. cereus infection undergo frequent rearrangement both within the bacterial nucleoid and between species. Thus, a better method than traditional biochemical tests to detect pathogenic Bacillus strains is to screen for virulence operons present in plasmids or in nucleoidal DNA. Bacillus genomes that have been sequenced display a high level of genetic synteny in their gene order. Two genes that encode for bacterial ribosomes, 16S and 23S rDNA, contain genetic sequences that are less than 1% different when compared between B. cereus, B. thuringiensis, and B. anthracis. A dissimilarity of 3% between 16S and 23S rDNA sequences

Bacillus spp. as Pathogens in the Dairy Industry  207 is the minimal “cut off” between two strains to be considered as distinct species. Additionally, the gyrB gene sequence shared among these species is very homologous. As these genes are shared among different species within the Bacillus genus, they cannot be used to differentiate species. However, 16S and 23S rRNA can be used to differentiate between different strains of B. anthracis. Interestingly, there are a number of mechanisms that facilitate the movement of genes between different members of the Bacillus genus. One such mechanism is through the natural action of the bacteriophage. After lysing its host cell, the bacteriophage will insert its genes into Bacillus genomes. While normally either lytic or lysogenic, it is possible for a prophage to undergo a random mutation, which renders it unable to enter the lysogenic cycle. In this way, genes from one species of bacteria can be transferred to Bacillus spp. As previously mentioned, Bacillus operons may be on conjugative plasmids. Additionally, Bacillus spp. are naturally competent, allowing these microbes to naturally take up random DNA in their vicinity. The virulence genes for Nhe are present in more strains of Bacillus than is currently accepted within the scientific community. This research identified several “species” of Bacillus that were not previously known to harbor the Nhe enterotoxin operon. Given that a debate is currently underway about the very identity of B. cereus and other strains, it is improper for food safety experts to screen food products only for B. cereus. Phenotypic-based classification techniques have failed to accurately differentiate Bacillus species. Additionally, no molecularbased approach can accurately differentiate Bacillus. The bottom line is that the determination of species within Bacillus does not even matter when concerned with food safety. Molecular techniques should instead screen for virulence determinants in microbes instead of identifying said microbes. As endospore formation enables Bacillus spp. to be ubiquitous in the environment and on food, all foods should be examined in this way. This is the only true way to determine whether food products are safe for human consumption.

References Aaberg, T.M., Flynn, H.W., Schiffman, J., Newton, J., 1998. Nosocomial acute-onset postoperative endophthalmitis survey: a 10-year review of incidence and outcomes. Ophthalmology 105, 1004–1010. Adzitey, F., Huda, N., Ali, G.R.R., 2013. Molecular techniques for detecting and typing of bacteria, advantages and application to foodborne pathogens isolated from ducks. Biotechnology 3 (2), 97–107. Andersson, A., Ronner, U., Granum, P.E., 1995. What problems does the food industry have with the sporeforming pathogens Bacillus cereus and Clostridium perfringens? Int. J. Food Microbiol. 28, 145–155. Aronson, A.I., Beckman, W., Dunn, P., 1986. Bacillus thuringiensis and related insect pathogens. Microbiol. Rev. 50 (1), 1–24. Barrie, D., Hoffman, P.N., Wilson, J.A., Kramer, J.M., 1994. Contamination of hospital linen by Bacillus cereus. Epidemiol. Infect. 113, 297–306. Beecher, D.J., Pulido, J.S., Barney, N.P., Wong, A.C.L., 1995. Extracellular virulence factors in Bacillus cereus endophthalmitis: methods and implication of involvement of hemolysin BL. Infect. Immun. 63, 632–639.

208  Chapter 7 Bryce, E.A., Smith, J.A., Tweeddale, M., Andruschak, B.J., Maxwell, M.R., 1993. Dissemination of Bacillus cereus in an intensive care unit. Infect. Control Hosp. Epidemiol. 14, 459–462. Burgess, S.A., Lindsay, D., Flint, S.H., 2010. Thermophilic bacilli and their importance in dairy processing. Int. J. Food Microbiol. 144 (2), 215–225. Callegan, M.C., Booth, M.C., Jett, B.D., Gilmore, M.S., 1999a. Pathogenesis of Gram-positive bacterial endophthalmitis. Infect. Immun. 67, 3348–3356. Callegan, M.C., Engelbert, M., Parke, II., D.W., Jett, B.D., Gilmore, M.S., 2002. Bacterial endophthalmitis: epidemiology, therapeutics, and bacterium-host interactions. Clin. Microbiol. Rev. 15, 111–124. Callegan, M.C., Jett, B.D., Hancock, L.E., Gilmore, M.S., 1999b. Role of hemolysin BL in the pathogenesis of extraintestinal Bacillus cereus infection assessed in an endophthalmitis model. Infect. Immun. 67, 3357–3366. Callegan, M.C., Novasad, B.D., Ramirez, R., Gherlardi, G., Senesi, S., 2006. Role of swarming migration in the pathogenesis of Bacillus endophthalmitis. Invest. Ophthalmol. Vis. Sci. 47, 4461–4467. Ceuppens, S., Rajkovic, A., Heyndrickx, M., Tsilia, V., Van De Wiele, T., Boon, N., Uytendaele, M., 2011. Regulation of toxin production by Bacillus cereus and its food safety implications. Crit. Rev. Microbiol. 37 (3), 188–213. Claus, D., Berkley, R.C.W., 1986. Genus Bacillus Cohn, 1872. In: Sneath, P.H.A., Mair, N.S., Sharpe, M.E., Holt, J.G. (Eds.), Bergey’s Manual of Systematic Bacteriology. Williams and Wilkins, Baltimore, MD, pp. 1105–1139. Costerton, J.W., Stewart, P.S., Greenberg, E.P., 1999. Bacterial biofilms: a common cause of persistent infection. Science 284, 1318–1322. Cunha-Vaz, J.G., 1997. The blood-ocular barriers: past, present, and future. Doc. Ophthalmol. 93, 149–157. Davey, Jr., R.T., Tauber, W.B., 1987. Posttraumatic endophthalmitis: the emerging role of Bacillus cereus infection. Rev. Infect. Dis. 9, 110–123. David, R.B., Khirkby, G.R., Noble, B.A., 1994. Bacillus cereus endophthalmitis. Br. J. Ophthalmol. 78, 577–580. De Lara, J., Fernandez, P.S., Periago, P.M., Palop, A., 2002. Irradiation of spores of Bacillus cereus and Bacillus subtilis with electron beams. Innov. Food Sci. Emerg. Technol. 3, 379–384. Dubouix, A., Bonnet, E., Bensafi, M.H., Archambaud, M., Chaminade, B., Echabanon, G., Marty, N., 2005. Bacillus cereus infections in Traumatology-Orthopedics Department: retrospective investigation and improvement of health practices. J. Infect. 50, 22–30. Fravel, D.R., 2005. Commercialization and Implementation of Biocontrol. Annu. Rev. Phytopathol. 43, 337–359. Frenzel, E., et al., 2012. CodY orchestrates the expression of virulence determinants in emetic Bacillus cereus by impacting key regulatory circuits. Mol. Microbiol. 85 (1), 67–88. Goldstein, B., Abrutyn, E., 1985. Pseudo-outbreak of Bacillus species related to fiberoptic bronchoscopy. J. Hosp. Infect. 6, 194–200. Goto, K., et al., 2000. Application of the partial 16S rDNA sequence as an index for rapid identification of species in the genus Bacillus. J. Gen. Appl. Microbiol. 46 (1), 1–8. Gracias, K.S., McKillip, J.L., 2011. Triplex PCR-based detection of enterotoxigenic Bacillus cereus ATCC 14579 in nonfat dry milk. J. Basic Microbiol. 51 (2), 147–152. Granum, P.E., 1994. Bacillus cereus and its toxins. J. Appl. Bacteriol. Symp. Suppl. 76, 615–665. Graumann, P., 2012. Bacillus: Cellular and Molecular Biology, second ed. Caister Academic Press, Norfolk. Griffiths, M.W., 2010. Bacillus cereus and other Bacillus spp. In: Juneja, V.K., Sofos, J.N. (Eds.), Pathogens and Toxins in Foods: Challenges and Interventions. ASM Press, Washington, DC, pp. 1–13. Griffiths, M.W., Schraft, H., 2002. Bacillus cereus food poisoning. In: Cliver, D. (Ed.), Foodborne Diseases. second ed. Elsevier Science, Ltd., London, England, pp. 261–270. Grossniklaus, H., Bruner, H., Frank, W.E., Purnell, E.W., 1985. Bacillus cereus panophthalmitis appearing as an acute glaucoma in a drug addict. Am J. Ophthalmol. 100, 334. Han, D.P., Wisniewski, S.R., Wilson, L.A., Barza, M., Vine, A.K., Doft, B.H., Kelsey, S.F., 1996. Spectrum and susceptibilities of microbiologic isolates in the Endophthalmitis Vitrectomy Study. Am. J. Ophthalmol. 122, 1–17. Hanson, M.L., Wendorff, W.L., Houck, K.B., 2005. Effect of heat treatment of milk on activation of Bacillus spores. J. Food Prot. 68, 1484–1486.

Bacillus spp. as Pathogens in the Dairy Industry  209 Helgason, E., et al., 2000. Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis—one species on the basis of genetic evidence. Appl. Environ. Microbiol. 66 (6), 2627–2630. Hermandy, R., Zaltas, M., Paton, B., Foster, C.S., Baker, A.S., 1990. Bacillus-induced endophthalmitis: a new series of 10 cases and review of the literature. Br. J. Opthalmol. 74, 26–29. Hernaiz, C., Picardo, A., Alos, J.I., Gomez-Garces, J.L., 2003. Nosocomial bacteremia and catheter infection by Bacillus cereus in an immunocompetent patient. Clin. Microbiol. Infect. 9, 973–975. Hsueh, P.-R., Teng, L.-J., Yang, P.-C., Pan, H.-L., Ho, S.-W., Luh, K.-T., 1999. Nosocomial pseudobacteremia caused by Bacillus cereus traced to contaminated ethyl alcohol from a liquor factory. J. Clin. Microbiol. 37, 2280–2284. Ongena, M., Jacques, P., 2007. Bacillus lipopeptides: versatile weapons for plant disease biocontrol. Trends Microbiol. 16, 115–125. Kolsto, A.B., Tourasse, N.J., Okstad, O.A., 2009. What sets Bacillus anthracis apart from other Bacillus species? Annu. Rev. Microbiol. 63, 451–476. Kopel, A.C., Carvounis, P.E., Holz, E.R., 2008. Bacillus cereus endophthalmitis following invitreous bevacizumab injection. Ophthalm. Surg. Lasers Imag. 39, 153–154. Kuroki, R., Kawakami, K., Qin, L., Kaji, C., Watanabe, K., Kimura, Y., Ishiguro, C., Tanimura, S., Tsuchiya, Y., Hamguchi, I., Sakakura, M., Sakabe, S., Tsuji, K., Inoue, M., Watanabe, H., 2009. Nosocomial bacteremia caused by biofilm-forming Bacillus cereus and Bacillus thuringiensis. Intern. Med. 48, 791–796. Martinez, M.F., Haines, T., Waller, M., Tingey, D., Bomez, W., 2007. Probable occupational endophthalmitis. Arch. Environ. Occup. Health 62, 157–160. Mattson, M.P., Culmsee, C., Fu, Z., Camandola, S., 2000. Roles of nuclear factor kB in neuronal survival and plasticity. J. Neurochem. 74, 443–456. Mead, P.S., Slutsker, L., Dietz, V., McCaid, L.F., Bresee, J.S., Shapiro, C., Griffin, P.M., Tauxe, R.V., 1999. Foodrelated illness and death in the United States. Emerg. Infect. Dis. 5, 607–625. Motoi, N., Ishida, T., Nakano, I., Akiyama, N., Mitani, K., Hirai, H., Yazaki, Y., Machinami, R., 1997. Necrotizing Bacillus cereus infection of the meninges without inflammatory reaction in a patient with acute myelogenous leukemia: a case report. Acta Neuropathol. 93, 301–305. Moyer, A.L., et al., 2008. Bacillus cereus induces permeability of an in vitro blood-retina barrier. Infect. Immun. 76 (4), 1358–1367. Moyer, A.L., Ramadan, R.T., Novosad, B.D., Astley, R., Collagen, M.C., 2009. Bacillus cereus-induced permeability of the blood ocular barrier during experimental endophthalmitis. Invest. Ophthalmol. Vis. Sci. 50, 3783–3793. Murray, P.R., 2012. What is new in clinical microbiology—microbial identification by MALDI-TOF mass spectrometry. J. Mol. Diagn. 14, 419–423. Ozkocaman, V., Ozcelik, T., Ali, R., Ozkalemkas, F., Ozkan, A., Ozakin, C., Akalin, H., Ursavaws, A., Coskun, F., Ener, B., Tunali, A., 2006. Bacillus spp. among hospitalized patients with haematological malignancies: clinical features, epidemics and outcomes. J. Hosp. Infect. 64, 169–176. Phelps, R.J., McKillip, J.L., 2002. Enterotoxin production in natural isolates of Bacillaceae outside the Bacillus cereus group. Appl. Environ. Microbiol. 68 (6), 3147–3151. Priest, F.G., Goodfellow, M., Shute, L.A., Berkeley, R.C.W., 1987. Bacillus amyloliquefaciens sp. nov., nom. rev. Int. J. Syst. Bacteriol. 37, 69–71. Rasko, D.A., Altherr, M.R., Han, C.S., Ravel, J., 2005. Genomics of the Bacillus cereus group of organisms. FEMS Microbiol. Rev. 29, 303–329. Ratnayake-Lecamwasam, M., et al., 2001. Bacillus subtilis CodY represses early-stationary-phase genes by sensing GTP levels. Genes Dev. 15 (9), 1093–1103. Richardson, A.J., Rothburn, M.M., Roberts, C., 1986. Pseudo-outbreak of Bacillus species: related to fiber optic bronchoscopy. J. Hosp. Infect. 7, 208–210. Romero, C.F., Rai, M.K., Lowder, C.Y., Adal, K.A., 1999. Endogenous endophthalmitis: a case report and brief review. Am. Fam. Phys. 60, 510–514. Ronner, U., Husmark, U., Henrikson, A., 1990. Adhesion of Bacillus cereus spores in relation to hydrophobicity. J. Appl. Bacteriol. 69, 550–556.

210  Chapter 7 Rutherford, S.T., Bassler, B.L., 2012. Bacterial quorum sensing: its role in virulence and possibilities for its control. Cold Spring Harb. Perspect. Med. 2 (11), 1–25. Scallan, E., et al., 2011. Foodborne illness acquired in the United States—major pathogens. Emerg. Infect. Dis. 17 (1), 7–15. Schallmey, M., Singh, A., Ward, O.P., 2004. Developments in the use of Bacillus species for industrial production. Can. J. Microbiol. 50 (1), 1–17. Scheldeman, P., et al., 2006. Bacillus sporothermodurans and other highly heat-resistant spore formers in milk. J. Appl. Microbiol. 101 (3), 542–555. Schemmer, G.R., Driebe, W.T., 1987. Post-traumatic Bacillus cereus endophthalmitis. Arch. Ophthalmol. 105, 342–344. Scott, I.U., Flynn, H.W., Feuer, W., Pflugfelder, S.C., Alfonso, E.C., Forster, R.K., Miller, D., 1996. Endophthalmitis associated with microbial keratitis. Ophthalmology 103, 1864–1870. Serror, P., Sonenshein, A.L., 1996. CodY is required for nutritional repression of Bacillus subtilis genetic competence. J. Bacteriol. 178 (20), 5910–5915. Setlow, P., 2003. Spore germination. Curr. Opin. Microbiol. 6 (6), 550–556. Shany, S., Bernheimer, A.W., Grushoff, P.S., Kim, K.W., 1974. Evidence of membrane cholesterol as the common binding site for cereolysin, streptolysin O, and saponin. Mol. Cell. Biochem. 3, 179–186. Simini, B., 1998. Outbreak of Bacillus cereus endophthalmitis in Rome. Lancet 351, 1258. Shaligram, N.S., Singhal, R.S., 2010. Surfactin—a review on biosynthesis, fermentation, purification and applications. Food Technol. Biotechnol. 48, 119–134. Slamti, L., Lereclus, D., 2005. Specificity and polymorphism of the PlcR-PapR quorum-sensing system in the Bacillus cereus group. J. Bacteriol. 187 (3), 1182–1187. Sneath, P., 1986. Endospore-forming Gram-positive rods and cocci. Sneath, P.H.A., Mair, N.S., Sharpe, M.E., Holt, J.G. (Eds.), Bergey’s Manual of Systematic Bacteriology, vol. 2, Williams and Wilkins, Baltimore, MD, pp. 1104–1207. Sonenshein, A.L., 2005. CodY, a global regulator of stationary phase and virulence in Gram-positive bacteria. Curr. Opin. Microbiol. 8 (2), 203–207. Stenfors Arnesen, L.P., Fagerlund, A., Granum, P.E., 2008. From soil to gut: Bacillus cereus and its food poisoning toxins. FEMS Microbiol. Rev. 32 (4), 579–606. Streilein, J.W., 2003. Ocular immune privilege: therapeutic opportunities from an experiment of nature. Nat. Rev. 3, 879–889. Ullman, S., Pflugfelder, S.C., Hughes, R., Forster, R.K., 1987. Bacillus cereus panophthalmitis manifesting as an orbital cellulitis. Am. J. Ophthalmol. 103, 105–106. US Food and Drug Administration, 2001. Grade “A” Pasteurized Milk Ordinance. Public Health Service, Department of Health and Human Services, Food and Drug Administration, Washington, DC. Van Der Zwet, W.C., Parlevliet, G.A., Savelkoul, P.H., Stoof, J., Kaiser, P.M., Van Furth, A.M., VanderbrouckeGrauls, C.M., 2000. Outbreak of Bacillus cereus infections in a neonatal intensive care unit traced to balloons used in manual ventilation. J. Clin. Microbiol. 38, 4131–4136. Vilain, S., Luo, Y., Hildreth, M.B., Brözel, V.S., 2006. Analysis of the life cycle of the soil saprophyte Bacillus cereus. Appl. Environ. Microbiol. 72 (7), 4970–4977. Weber, D.J., Rutala, W.A., 1988. Bacillus species. Infect. Control Hosp. Epidemiol. 9 (8), 368–373. Winn, W.C., Allen, S.D., Janda, W.M., Koneman, E.W., Procop, G.W., Schreckenberger, P.C., Woods, G.L., 2006. Koneman’s Color Atlas and Textbook of Diagnostic Microbiology. Lippincott Williams and Wilkins, Philadelphia, PA. York, M.K., 1990. Bacillus species pseudobacteremia traced to contaminated gloves used in collection of blood from patients with acquired immunodeficiency syndrome. J. Clin. Microbiol. 28, 2114–2116. Yu, G.Y., Sinclair, J.B., Hartman, G.L., Bertagnolli, B.L., 2002. Production of iturin A by Bacillus amyloliquefaciens suppressing Rhizoctonia solani. Soil Biol. Biochem. 34, 955–963.

Bacillus spp. as Pathogens in the Dairy Industry  211

Further Reading Chapman, K.W., Boor, K.J., 2001. Acceptance of 2% ultra-pasteurized milk by consumers, 6 to 11 years old. J. Dairy Sci. 84, 951–954. Pomerantsev, A.P., Pomerantseva, O.M., Leppla, S.H., 2004. A spontaneous translational fusion of Bacillus cereus PlcR and PapR activates transcription of PlcR-dependent genes in Bacillus anthracis via binding with a specific palindromic sequence. Infect. Immun. 72 (10), 5814–5823. Wilson, G.S., 1943. The pasteurization of milk. Br. Med. J. 1 (4286), 261–262.

Page left intentionally blank

CHAPTE R 8

Staphylococcus aureus, a Food Pathogen: Virulence Factors and Antibiotic Resistance Ana Castro, Joana Silva, Paula Teixeira CBQF—Center for Biotechnology and Fine Chemistry, Portuguese Catholic University, Porto, Portugal

1 Introduction Food-borne diseases are commonly associated with agents, for example, bacteria, virus, fungi, prions, parasites, or chemicals that are present in contaminated food and water. At least 200 food-borne diseases are associated with food as a vehicle of contamination causing serious public health problems all over the world (WHO, 2015). These account for about 23 million cases of illness and 5000 deaths in Europe every year; diarrheal diseases cause the majority of these cases contributing with about 22 million cases and 3000 deaths annually (WHO, 2015). Salmonella spp., Campylobacter spp., Clostridium perfringens, Staphylococcus aureus, Bacillus cereus, Escherichia coli, or viruses, such as norovirus, are considered the cause of acute food-borne diseases (often called food poisoning, WHO, 2015). Since 2003 it is mandatory to report food-borne outbreaks occurring in the European Union Member States (EU MS); in 2007, harmonized specifications on the reporting of foodborne outbreaks at the EU level have been implemented (EFSA-ECDC, 2015a). In 2014, a total of 5251 food-borne outbreaks were reported by the 26 MS. Bacterial toxins (i.e., toxins produced by Bacillus, Clostridium, and Staphylococcus) accounted for 16.1% of all outbreaks (EFSA-ECDC, 2015a). “Staphylococci” were identified as responsible for wound infections by the surgeon Sir Alexander Ogston in the 1880s (Ogston, 1984). S. aureus was the name attributed to a strain showing colonies with pigmented appearance isolated by the German surgeon Anton J. Rosenbach (Rosenbach, 1884). Since then, S. aureus has attracted much attention as a cause of human infections and is still considered as one of the most important agents involved in nosocomial infections (Khan et al., 2015). Global spread and increasing resistance to antibiotics of this pathogen is still a major threat. Methicillin-resistant S. aureus (MRSA) appeared in 1961 being responsible to cause serious morbidity and mortality rates in hospitals throughout the world. MRSA is known to be Foodborne Diseases http://dx.doi.org/10.1016/B978-0-12-811444-5.00008-7

213

Copyright © 2018 Elsevier Inc. All rights reserved.

214  Chapter 8 resistant to all the types of penicillins and lactams (Stefani and Goglio, 2010). In fact, the high capacity of this agent to acquire multiantibiotic resistance continues to be a paradigm for future chemotherapy against the multiresistant pathogens. S. aureus carriage rate varies with geographic location, age, sex, and body niches. In addition to staphylococcal infections, S. aureus is also responsible for food poisoning due to oral intake of enterotoxins present in foods (Johler et al., 2015a). The first description of staphylococcal poisoning was attributed to Vaughan (1984)—“Dryness of the throat, nausea vomiting, diarrhoea, nervous prostration, headache, and sometimes double vision. In short, the symptoms are those of a gastrointestinal irritant, with marked secondary effects upon the nervous system. Not withstanding the alarming symptoms, recovery follows”—during an investigation of an outbreak of “cheese-poisoning” in Michigan that affected about 300 individuals. Dack et al. (1930) demonstrated that staphylococcal food poisoning (SFP) was due to a filterable substance that maintained activity after being heated at 100°C for 30 min.

2  Staphylococcus aureus—General Characteristics Staphylococcus was first introduced by Ogston in 1883 for the group of micrococci causing inflammation and suppuration (Götz et al., 2006). Until the early 1970s, the genus Staphylococcus consisted of three species namely, (1) coagulase-positive species known as S. aureus, (2) coagulase negative species known as S. epidermidis and (3) S. saprophyticus (Götz et al., 2006). Nowadays, 51 species and several subspecies are recognized (www. bacterio.net/staphylococcus.html). S. aureus consists of irregular clusters (Staphyle, bunch of grapes) with “spheres” with 0.5–1.0 µm in diameter and cells usually occur singly or in pairs. S. aureus are facultative anaerobic Gram-positive cocci, nonmotile and nonspore forming bacteria. Catalase is produced by cells growing aerobically. As facultative anaerobes most strains produce acid aerobically and anaerobically from glucose, lactose, maltose, and mannitol. Typical colonies are yellow to golden yellow in color, smooth, raised, glistening, circular, entire, and translucent and may obtain a size of 6–8 mm in diameter on nonselective media used for propagation of staphylococci. The identification of this species is based on the production of coagulase, which is produced by nearly all strains (http://www.bergeys.org/pubinfo.html). However, additional characters needed to be considered because some staphylococci strains show a variable expression of coagulase (http://www.bergeys.org/pubinfo.html). As most strains of S. aureus produce a heat-resistant nuclease, thermonuclease also known as TNase, might be used as an indicator for the detection of S. aureus. In addition, S. aureus can grow at NaCl concentrations up to 10% but with limitations at 15% (http://www.bergeys.org/ pubinfo.html). Most strains grow at temperatures between 10 and 45°C (optimum 30°–37°C) and pH values between 4.2 and 9.3 (optimum pH 7.0–7.5) (http://www.bergeys.org/pubinfo. html). With respect to water activity (aw), S. aureus can tolerate values between 0.83 and

Staphylococcus aureus, a Food Pathogen: Virulence Factors and Antibiotic Resistance  215 0.99. These characteristics enable S. aureus to grow and survive in a variety of environmental conditions including stressful environments (e.g., dry surfaces) for long periods (Valero et al., 2009). In addition, development of stress resistance in S. aureus after exposure to sublethal environmental conditions might occur and should be avoided in food-processing environments (Cebrián et al., 2010).

3  Occurrence of Staphylococcus aureus 3.1  S. aureus in Humans S. aureus is carried by a significant proportion of the population in skin and the nose (Kluytmans and Wertheim, 2005) but can also be found in various niches of the human body, for example, throat and perineum, the most common in the general adult (Muenks et al., 2016). Intestinal colonization, particularly in hospitalized individuals, has also been reported (Boyce and Havill, 2005). As found by Kluytmans and Wertheim (2005), S. aureus colonizes the nares of approximately 50% of healthy adults, either persistently or intermittently. Endogeneous nasal colonization is believed to be a common source of infection and a strong risk factor for subsequent colonization; however, most carriers do not develop clinical disease (Kluytmans et al., 1997). S. aureus carriage rates vary between different ethnic groups (with higher rates in white people and in men) and age. Colonization with S. aureus was most common in persons aged 50%) in Europe (EFSA-ECDC, 2015b). Methicillin resistance is mediated by mecA gene that encodes penicillin-binding protein 2a (PBP2a that shows decreased affinity for binding β-lactam antibiotics). Recently, a new homologue of mecA gene designated as mecC gene (previously mecALGA251 gene) has been reported; however, little information about the frequency, epidemiology, and possible transmission between livestock and humans is available (Petersen et al., 2013). A β-lactamase, encoded by blaZ is also produced by MRSA strains being responsible of the decrease in the activity of β-lactam antibiotics. Although initially reported as a hospital-acquired pathogen, MRSA has also been associated with community infections and with livestock-associated infections (VanEperen and Segreti, 2016). Except in southern Europe, the percentage of MRSA isolates appears to be stable, even decreasing. Nevertheless, among all S. aureus isolates, this percentage remains above 25% in 8 of the 28 EU/EEA reporting countries (ECDC, 2013). LA-MRSA (livestockassociated MRSA) has been found in (1) pigs and in pig production chains (Beneke et al., 2011), (2) dairy sheep (Carfora et al., 2016), and (3) cows and in cow milk (Schlotter et al., 2012), among others. LA-MRSA is reported as having lower transmissibility compared with other MRSA genotypes (not associated with livestock). Recently, van Alen et al. (2016) reported the course of the LA-MRSA CC398 epidemic among patients of the University Hospital Münster. Overall, this strain emerged rapidly during the last decade, developed enormous sublineage diversity and contributed substantially to the total burden of MRSA colonization and infection at the hospital. These findings were also reported by Hadjirin et al. (2015), which report that in the United Kingdom pig farms are a potential pathway for the transmission of LA-MRSA CC398 from livestock to humans. Recently, Bosch et al. (2016) studied the next generation sequencing data of 539 LA-MRSA isolates obtained from humans (n = 206) and from nosocomial infections (n = 333) and confirmed that transmission of LA-MRSA in Dutch health-care facilities does occur between humans; therefore, a decision to discontinue the search and destroy policy for LA-MRSA should be taken with caution.

220  Chapter 8 HA-MRSA is frequently associated with people who have been in hospitals or other healthcare settings and risk factors include the immunocompromised and the elderly, intensive care unit admission, surgery, dialysis, presence of invasive medical devices, history of broadspectrum antibiotic use. These patients are older and have one or more comorbid conditions. HA-MRSA strains tend to cause pneumonia, bacteremia, and invasive infections (David and Daum, 2010). With respect to CA-MRSA infections they commonly affect healthy younger patients who lack established risk factors and have significant skin and soft tissue infections as well as severe and invasive staphylococcal and musculoskeletal infections (David and Daum, 2010). CA-MRSA has been emerging and disseminated in many countries as it is actually considered an important clinical pathogen. In fact, new successful lineages have been reported; the burden of CA-MRSA infections varies with the group of individuals and the region of the world. In addition, they are often more susceptible to “traditional” antibiotics although this is considered a dynamic and changing situation that must be prevented and controlled (Skov et al., 2012). The prevalence of CA-MRSA in the United States is higher than in Europe, however, serious CA-MRSA infections in young and healthy individuals have been reported and considered a public health concern (Mera et al., 2011). Given to the difficulty in establishing a clear delineation between CA-MRSA and HA-MRSA strains, a new category of MRSA infections—“health care-associated, community-onset”—MRSA have been reported being the molecular tools the best way to distinguish them (Parisi et al., 2016; Wang et al., 2015). Compared to methicillin-susceptible S. aureus (MSSA), MRSA strains are generally recognized as having higher morbidity and mortality rates, length of hospital stay, and costs (VanEperen and Segreti, 2016). Nevertheless, MSSA strains are also responsible for epidemic cases especially in neonates (Williams et al., 2011) and some of them might have resistance to vancomycin and doptamycin increasing the risk for further complications (San-Juan et al., 2016).

6  Staphylococcal Food Poisoning—Outbreaks The diagnosis of SFP is established by the detection of SE in food consumed by patients and identical regardless of whether infection is caused by MRSA or MSSA (EFSA, 2009). However, there are other factors that support the diagnosis: (1) the presence of enterotoxin together with large numbers of organisms in vomitus, (2) the presence of enterotoxin producing S. aureus in the studied food (>106/g), and (3) the presence of S. aureus strain in feces of affected patients following infection (EFSA, 2009). In some cases, confirmation of SFP is not possible by presence of S. aureus enterotoxigenic strains because the organism is only rarely isolated in implicated food and enumeration of SFP is difficult. In addition, SEs are resistant to environmental conditions (freezing, drying, heat treatment, and low pH) that easily destroy the enterotoxin-producing strain (Hennekinne et al., 2012). Hence, conclusive diagnosis is mainly based on the demonstration of SEs in the food.

Staphylococcus aureus, a Food Pathogen: Virulence Factors and Antibiotic Resistance  221 Table 8.1: Recent Staphylococcus aureus outbreaks. Locale of Outbreak

Year

Implicated Food SE Detected

Number of Cases

Country

2007

Thermized goat milk cheese Macaroni and fresh tomato “Kerala matta” rice Ice cream

5 (4 hospitalized)

Switzerland Store

2011 2012 2013

egc cluster

SEA and SED 42 (20 hospitalized) Unknown 46 SEA

Spain India

Restaurant Summer school Nursing hostel

13 (7 hospitalized) Germany

Christening party at hotel SEA, TSST-1, 12 (4 hospitalized) Germany Wedding egc cluster celebration catering 5 Switzerland Store egc cluster

2013

Pancakes with minced chicken

2014

Semi-hard goat cheese Raw-milk cheese SEA and SED 14 (including Switzerland Swiss boarding 10 children) school Packaged meals SEA and SED 27 (4 hospitalized) Australia Tourist, traveling

2014 2014

Reference Johler et al. (2015a) Solano et al. (2013) Basavegowda et al. (2014) Fetsch et al. (2014) Johler et al. (2013) Johler et al. (2015a) Johler et al. (2015b) Fletcher et al. (2015)

Studies on SEs began from the analysis of S. aureus strains involved in outbreaks. The first well-documented report that clearly identified SEs as a cause of SFP outbreaks was done in 1930 (Dack et al., 1930). Over time, several outbreaks concerning S. aureus have been reported worldwide. Table 8.1 aims to illustrate some recent reported outbreaks. Fetsch et al. (2014) reported a S. aureus food-poisoning outbreak associated with the consumption of ice cream. Because none of the employees carried the outbreak strain, according to these authors, either the equipment used for the production of the ice cream or a contaminated ingredient is the most likely introduction source. Solano et al. (2013) described an outbreak that occurred in 2011 at a Barcelona sports club. They observed at least eight   S. aureus strains that showed the same profile and spa type (t008) revealing that the source of transmission of the contamination was the same. According to the most recent European Food Safety Authority report, in 2014, 12 MS reported 393 food-borne outbreaks caused by staphylococcal toxins representing 7.5% of all outbreaks (EFSA-ECDC, 2015a). There was a small increase when compared with the previous year. The overall reporting rate in the EU was 0.12 per 100,000 population with the majority of cases occurring in France. In total, 2 deaths occurred and 264 persons were hospitalized (EFSA-ECDC, 2015a). In the same year it was reported several food vehicles related with outbreaks caused by staphylococcal toxins in the European Union (EFSA-ECDC, 2015a). Mixed food had the major number of outbreaks with 9 among 31 total outbreaks (29.0%). Broiler meat and pig meat had equal number of outbreaks (three) followed by cheese, dairy products, fish and fish products, vegetables and juices, and bakery products with two

222  Chapter 8 outbreaks each. With exception of vegetables and fruits or drinks including bottled water, all outbreaks came from protein-rich food, which is in accordance with the study of Crago et al. (2012). In 2000 in Japan, a large outbreak concerning S. aureus was studied; 13,420 victims were reported and the food vehicle was powdered skin milk (Asao et al., 2003). Jones et al. (2002) first reported an outbreak caused by community-acquired MRSA strains responsible for gastrointestinal illness. In this case study, a food handler, a food specimen, and three ill patrons were culture-positive for the same toxin-producing strain of MRSA. Kassis et al. (2011) reported an outbreak of CA-MRSA skin infections among health-care workers in a cancer center.

7  Presence of Virulence Factors in Staphylococcus aureus 7.1  S. aureus Virulence Factors—An Overview S. aureus strains possess a variety of virulence factors that are responsible for the potential of a given pathogen to cause disease. With respect to staphylococci, a given virulence factor may have several functions in pathogenesis and also multiple virulence factors may be responsible for the same function (Table 8.2). The virulence factors can be divided in structural and secreted products. The structural products are surface proteins, called Table 8.2: Staphylococcus aureus virulence factors and associated clinical syndromes. Selected Factors

Genes

Proteases, lipases, and nucleases MSCRAMMs (protein with affinity to fibrinogen, fibronectin, collagen, sialoprotein elastin, and other adhesins) Biofilm accumulation (PIA) Membrane-damaging toxins—hemolysins (α), leukocidins (PVL, γ-toxin, lukDE and lukAB) Toxins not membranedamaging (PSMs) SAgs toxins (enterotoxins, TSST-1) Secreted enzymes (exfoliative toxins)

Function of Virulence

Associated Clinical Syndromes

Involved in tissue invasion/penetration clfA, clfB, fnbA, cna, bbp, ebpS, sdrC, and sdrE

Tissue destruction and metastatic infections Involved in adherence Endovascular, bone to host tissues and joint, and prosthetic-device infections

Involved in persistence Hla, lukDE, lukAB, Destruction of host defences Hlg lukS-PV, and lukF-PV ica locus

psm-α gene cluster sea-q, tst eta, etb, and etc

Destruction of host defences Stimulation of host immune defences Cleavage of skin tissue

Evasion host defenses and antimicrobials SSTIs, abscess formation, and necrotizing pneumonia

Reference Otto (2014)

Gordon and Lowy (2008)

Watkins et al. (2012) Grumann et al. (2014)

Otto (2014) SFP, TSS SSSS

Grumann et al. (2014) Grumann et al. (2014)

Source: Adapted from Gordon, R.J., Lowy, F.D., 2008. Pathogenesis of methicillin-resistant Staphylococcus aureus. infection. Clin. Infect. Dis., 46, S350–S359.

Staphylococcus aureus, a Food Pathogen: Virulence Factors and Antibiotic Resistance  223 “microbial surface components recognizing matrix molecules” (MSCRAMMs) that mediate adherence to host tissues (Gordon and Lowy, 2008). These proteins bind molecules, such as collagen, fibronectin, and fibrinogen, and different MSCRAMMs may adhere to the same host-tissue component (Gordon and Lowy, 2008). The most common staphylococcal proteins anchored in the cell wall are proteins with affinity to fibrinogen (i.e., clumping factors A and B, encoded by the clfA and clfB genes, respectively), fibronectin (fnbA), collagen (cna), sialoprotein (bbp), elastin (ebpS), and adhesins with unknown function (sdrC and sdrE) (Jonsson et al., 1991). Another MSCRAMM is protein A. Most clinical isolates present the SpA staphylococcal protein A that is encoded by spa gene and is associated with the disruption of the humoral immune response in mice (Pauli et al., 2014). SpA contains four or five immunoglobulin-binding domains capable of binding the Fc of IgG antibodies; binding of Fc on the cell surface of staphylococci has long been recognized as a strategy to mask underlying surface antigens and inhibit opsonophagocytic killing of staphylococci by PMNs (Kim et al., 2012). Also SpA binds to Fab of variable heavy 3 (VH3) idiotype antibodies (Pauli et al., 2014). These facts demonstrate stimulation of B lymphocyte proliferation provoking their clonal expansion and subsequent death (Kim et al., 2012). The VH3-family of immunoglobulin idiotypes represents the largest portion of VH genes in B cell populations in humans suggesting a mechanism of S. aureus immune evasion by depletion of the B cell repertoire (Pauli et al., 2014). The antiphagocytic microcapsule production (i.e., type 5 or 8 frequently found in most clinical isolates) is known to enable the evasion of the host immune system during an infection (Gordon and Lowy, 2008). The secreted products by S. aureus consist of numerous enzymes and toxins that interfere directly with the host. During infection secretes enzymes, such as proteases, lipases, and elastases that enable it to invade and destroy host tissues and metastasize to other sites (Gordon and Lowy, 2008). In addition, nucleases produced by S. aureus can interfere negatively with the antibacterial activity of neutrophils (Otto, 2014). However, these mechanisms are poorly understood in S. aureus pathogenesis (Otto, 2014). The S. aureus toxins are divided into: (1) membrane-damaging toxins, (2) toxins that can interact with the receptor function, and (3) enzymes that are secreted (Otto, 2014). The first ones actuate on cytoplasmatic membrane causing pore formation leading to the removal of vital molecules and metabolites being considered cytolytic. These toxins could be receptor-mediated, such as hemolysins and leukotoxins whether they actuate on red or/and white blood cells or nonreceptor-mediated, such as PSMs (phenol-soluble modulins; Otto, 2014). Hemolysinα is a well-known S. aureus toxin with 33 kDa, with pore-forming and proinflammatory properties (Grumann et al., 2014; Otto, 2014). Hemolysin-α facilitates the efflux of monoand divalent ions (Otto, 2014). It is lytic to red blood cells and a series of leukocytes but not neutrophils (Otto, 2014). Other toxins structurally similar to α-toxin are bicomponent

224  Chapter 8 toxins, such as Panton-Valentine leukocidine or PVL (lukS and lukF proteins), leukocidins lukDE and lukAB and gamma-hemolysin (Hlg A, Hlg B, and Hlg C; Otto, 2014). The bicomponent (hetero-oligomeric) pore-forming leukotoxins can lyse cells, such as monocytes, macrophages, and neutrophils, which are considered important for S. aureus immune evasion. Gamma-hemolysin is made by virtually every strain of S. aureus. PVL is an S. aureus toxin frequently associated with skin and soft tissue infections (SSTIs) like abscess formation or furunculosis and also severe necrotizing pneumonia (Grumann et al., 2014; Watkins et al., 2012). These diseases are frequently associated as occurring outside the hospital setting (Grumann et al., 2014). In fact, since PVL was first associated with SSTIs in 1932 by Panton and Valentine numerous studies also associated PVLproducing strains with chronic or recurrent SSTIs and with CA-MRSA (Watkins et al., 2012). However, this issue is controversial about the pathogenic role of PVL (Grumann et al., 2014; Watkins et al., 2012; ). In addition, it has been noted that lukDE and lukGH, similar to PV, are also expressed by the majority of CA-MRSA (Grumann et al., 2014). However, the relative contribution to community-acquired SSTI and necrotizing pneumonia remains unknown (Grumann et al., 2014). Toxins nonreceptor-mediated, such as PSMs, are small amphipathic peptides with detergentlike properties (Otto, 2014). One of these is hemolysin δ (Hld), which is reported as having multiple functions in the pathogenesis of Sthaphylococcus; it contributes to atopic dermatitis by inducing cell degranulation (Otto, 2014). PSMs as well as α-toxin are produced by most S. aureus strains in contrast to many bicomponent leukocidins (Otto, 2014). The PSMα peptides are responsible to neutrophil lysis after phagocytosis. Toxins that interfere with receptor function (other than membrane damaging) are enterotoxins. Enterotoxins are secreted toxins of ∼20–30 kDa that interfere with intestine function and typically causes emesis and diarrhea (Otto, 2014). They are considered superantigens (SAgs). Even at low concentrations, they stimulate human T cells (Grumann et al., 2014). SEs, as SAgs actuate on dependence on Vβ elements of T-cell receptors and in association with the histocompatibility complex on antigen-presenting cells, activating a vast number of T cells (Hu and Nakane, 2014). After that, a cytokine release and systemic shock are observed (Hu and Nakane, 2014). Originally, the SAgs of S. aureus were termed SEs because they elicit vomiting and diarrhea after oral uptake, the hallmarks of S. aureus food poisoning (Grumann et al., 2014). However, some of the SAgs recently identified, lack the emetic properties being considered a difference on their superantigenicity (Grumann et al., 2014). Lina et al. (2004) defended that those toxins that were classified as emetic would be designated as SEs. Other toxins that lack the emetic capacity or have not been tested in the model after oral administration, should be designated “staphylococcal enterotoxinlike” (SEl) SAags to indicate that their potential role in SFP has not been confirmed (Lina et al., 2004). So far, 24 different staphylococcal SAgs have been described: the SEs A-E, G-J, and R-T (SEA-SEE, SEG-SEJ, SER-SET), the SE-like toxins K-Q and U-X (SElK-SElQ,

Staphylococcus aureus, a Food Pathogen: Virulence Factors and Antibiotic Resistance  225 SElU-SElX and TSST-1 (Grumann et al., 2014). They are encoded mainly by mobile genetic elements (MGEs), such as bacteriophages, plasmids, S. aureus pathogenicity islands (SaPI), and transposons (Grumann et al., 2014). The numerous locations for SE/SEl genes and TSST-1 as well as biological characteristics are described in Table 8.3. The emetic activity was determined on a nonhuman primate model (Macaca mulatta) to develop human-like enterotoxigenic disease along with a house musk shrew, Suncus murinus, as a small animal model used for emetic response to various emetic drugs (Hu and Nakane, 2014).

Table 8.3: Major characteristics of staphylococcal enterotoxins and staphylococcal enterotoxins-like toxins and TSST-1. Toxin

Genetic Element

SEA SEB

Prophage Chromosome, SaPI, plasmid SaPI SaPI SaPI SaPI – – Plasmid (pIB485) Prophage egc, chromosome Transposon egc, chromosome Plasmid (pIB485, pF5) SaPI SaPI egc, chromosome egc, chromosome egc, chromosome Prophage (Sa3n) SaPI Plasmid (pIB485, pF5) Plasmid (pF5) Plasmid (pF5) egc, chromosome egc, chromosome Chromosome SaPI

SEC1 SEC2 SEC3 SEC bovine SEC sheep SEC goat SED SEE SEG SEH SEI SElJ SElK SElL S SElN SElO SElP SElQ SER S SET SElU SElV SElX SEF or TSST

Molecular Weight (kDa)

Super Antigenic Activity

Emetic Monkeya

Activityb Suncusc

27.1 28.4

+

25 100

0.3 10

27.5 27.6 27.6 27.6 27.5 27.6 26.9 26.4 27.0 25.1 24.9 28.6 25.3 24.7 24.8 26.1 26.8 26.7 25.2 27.0 26.2 22.6 27.2 27.6 19.3 22.0

+ + + + + + + + + + + + + + + + + + + + + + + + + +

5 NE  rats > guinea pigs, whereas poultry and mice are the most resistant species. Acute mycotoxicosis causes digestive symptoms from 15 min to 2 h after ingestion of T-2 diacetoxyscirpenol or T-2–contaminated feed, followed by increased defecation, diarrhea, and congestion of jejunum and ileum mucosal membrane (Pinton et al., 2012). Stachybotryotoxicosis, another macroclyclic trichothecene disease, is also associated with causing cutaneous and mucocutaneous lesions, panleukopenia, abortions, and nervous signs in pigs, sheep, and poultry (Osweiler, 2014).

7.3 Pathology These mycotoxins induce gizzard erosions in poultry and at higher dose, hemorrhagic syndrome upon acute exposure. Chronic exposure to trichothecene mycotoxin results in dose-dependent necrosis of lymphocytic tissues in the digestive tract in poultry. Degenerative lesions were observed in lymphoid organs of poultry (Pinton et al., 2012). T-2 toxicosis in broiler chicken causes vacuolar degeneration in the hepatocytes and focal necrosis with mononuclear cell infiltration in the liver. The periporatal fibrosis and inflammatory response along with bile duct epithelial hyperplasia were also common. The kidneys develop mildto-moderate congestion and hemorrhages in addition to tubular cell vacuolation and nuclear pyknosis. The lymphoid cell depletion in the follicles of bursa and lymphoid cell necrosis and depletion in the spleen are the major changes in lymphoid organs (Manafi et al., 2015). Few studies on trichothecenes’ role in the development of esophageal cancer are reported, but still further investigation is required in this area.

8 Citrinin CTN, a mycotoxin is produced by molds of genera Penicillium, Aspergillus, and Monascus. It was first isolated from Penicillium citrinum before World War II (Bennett and Klich, 2003). It is a common contaminant of cereal grains, rice, barley, food, feed, and drinks. It is produced generally by the same fungal species that produces OTA, that is, P. verrucosum. Actual mechanism behind toxicity is not known, but it has been reported to cause nephrotoxicity via the induction of oxidative stress (Flajs and Peraica, 2009). Several oxidative stress genes were found to be upregulated upon treating yeast with CTN (Iwahashi et al., 2007). CTN also possesses antibiotic, bacteriostatic, antiprotozoal, and antifungal properties. Maximal acceptable dose of CTN is 0.2 µg/kg BW/day (Pascual-Ahuir et al., 2014). CTN is produced after harvest and occurs in stored grains, other plant products, such as fruits, vegetables, herbs, spices, and in spoiled dairy products. Ostry et al. (2013) reported

Food-Borne Mycotoxicoses: Pathologies and Public Health Impact  257 occurrence of CTN in a range of foodstuffs of vegetable origin, for example, cereals and cereal products, rice, pomaceous fruits (such as apples), black olive, roasted nuts (almonds, hazelnuts, and pistachio nuts), sunflower seeds, spices (turmeric, coriander, fennel, cardamom, and cumin), and food supplements based on rice fermented with red microfungi Monascus purpureus (EFSA, 2012). Studies have been carried out to study the degradation of CTN and revealed that decomposition of CTN occurs at >175°C in dry and at >100°C in wet conditions. CTN is hypothesized to be involved in the progression of nephropathy. In addition to nephrotoxicity, it is also embryocidal and fetotoxic. The mechanism of CTN toxicity is not fully understood. It has been hypothesized that CTN toxicity may be the consequence of oxidative stress or increased permeability of mitochondrial membranes. CTN was observed to exert antifungal activity under low pH conditions. In Saccharomyces cerevisiae, it completely inhibited cellular respiration (EFSA, 2012). CTN possesses anticancer activity, as it act as precursor of novel molecules against cancer. However, the highly toxic nature of CTN restricts its use as a drug molecule (Doughari, 2015).

8.1  Effect on Humans CTN is a severe problem in countries with a hot and humid climate, as it is a major source of food poisoning after fungal contamination. It is a powerful nephrotoxin. After ingestion of CTN-contaminated food, it affects kidneys, targeting the mitochondrial respiratory chain. It is also reported to be immunotoxic (Khosravi et al., 2012). It is implicated that CTN acts synergistically with OTA to cause BEN in humans. Coexposure to CTN and OTA has resulted in the modification of DNA adduct formation with development of C-C8dG-OTA DNA adduct (Ostry et al., 2013). CTN and OTA have also been reported to be causative agents of hepatic and renal carcinogenesis (Jeswal and Kumar, 2015).

8.2  Effect on Animals The harmful effects of CTN have been reported in pigs, rabbits, dogs, and poultry. In pigs, CTN at 20 µg/kg BW/day produced no adverse effect. However, acute lethal doses administered to pigs, rabbits, guinea pigs, and rats caused renal swelling and acute tubular necrosis. In poultry, the effects varied extensively in type and severity depending on the species and age of the birds (EFSA, 2012). CTN produced acute toxicity in the poultry at high doses, causing swelling and necrosis of renal tubules. Nephrotoxicity and hepatotoxicity occurred in chickens at dietary levels of 250 g of CTN, with liver and kidney enlargements of 11 and 22%, respectively (Wyatt, 1979). In male New Zealand white rabbits, oral treatment of CTN at dose of 120 mg/kg BW resulted in azotemia and metabolic acidosis with hemoconcentration and hypokalemia (Flajs and Peraica, 2009).

258  Chapter 9

8.3 Pathology CTN treatment in pregnant rats at a dose of 10 mg/kg BW resulted in pathological changes in the liver and kidneys of the fetuses. The liver showed swollen hepatocytes, vacuolar degeneration, and dilatation of sinusoids. The kidneys appeared more severely affected with degeneration and necrosis of PCTs, distorted glomerular tuft and Bowman’s space, and fibrosis of interstitial tissue (Singh et al., 2008). In CTN-treated pregnant rats, severe degenerative changes were observed in the renal tubular cells along with pyknosis, apoptosis, and loss of cellular cytoplasm. Liver cells showed vacuolation due to mitochondrial damage, pyknosis, and apoptosis. Similarly in fetuses, significant amounts of apoptosis were observed in the kidneys due to CTN toxicity. In addition, the immunosuppressive effect of CTN in pregnant rats was also observed (Singh et al., 2011, 2013). Subchronic CTN-induced toxicity in rats is characterized by enlarged kidneys, loss of brush border, hydropic degeneration, and pyknotic nuclei in the proximal tubules (Flajs and Peraica, 2009).

9 Moniliformin MON, a mycotoxin produced by Fusarium sp., is a small polar molecule possessing cyclobutanedione structure. It occurs as a sodium or potassium salt of 1-hydroxycyclobut-1-ene3,4-dione. It is produced by Fusarium moniliforme (F. verticillioides), along with other Fusarium sp.–producing mycotoxins. MON has not yet received much attention, as it is not reported to be carcinogenic, and comparatively high amounts are necessary for causing significant toxicological effects (Behrens et al., 2015). It is mainly found in cereals and grains, with temperatures and moisture playing an important role in the growth of the fungus (Tittlemier et al., 2013). Less data are available regarding its toxicity on mammals with oral LD50 in rodents ranged between 25 and 50 mg/kg and for newborn cockerels 4 mg/kg. In acute exposure, the main lesion was observed mainly to be intestinal hemorrhages; whereas, subacute and chronic exposure, in avian species and laboratory rodents showed heart damage due to moniliformin (Cao et al., 2007). The toxic mechanism of MON is not fully understood; however, it shows structural similarity to pyruvate and is supposed to substitute pyruvate and inhibit the activity of thiamine pyrophosphate–dependent enzymes. Due to similarity to pyruvate it might affect the tricarboxylic acid cycle, thus leading to cellular energy deprivation. This further explains its ability to cause the respiratory stress and myocardial damage in the experimental animals (Jonsson et al., 2015). It is a strong inhibitor of mitochondrial pyruvate and ketoglutarate oxidation, negatively affects reproduction and fetal development, and possesses mutagenic and carcinogenic potential (Burmeister et al., 1979). In few studies it was found to cause chromosomal aberrations and cytotoxicity to mammalian cells at higher concentrations. Broiler chickens fed with diets containing 50-mg/kg MON resulted in low weight gain. However, heart and proventriculus (thin-walled part of stomach) weights were increased as compared to mean

Food-Borne Mycotoxicoses: Pathologies and Public Health Impact  259 cell volumes. It was observed that diets containing MON at such a high concentration were toxic to chicken. Phytotoxic effects of MON were also observed. Quail birds fed with MON showed watery diarrhea (whitish in color), poor body growth, ruffled feathers, and low feed and water intake. Toxin was found to produce cardiotoxicity in quail, with increased levels of serum cardiac toxicity markers, that is, lactate dehydrogenase and creatine kinase (Sharma et al., 2012). MON is found to be endemic to certain areas of China where it has been linked to Keshan disease (Cao et al., 2007). Among chickens, ducklings, and turkeys, ducklings were observed to be the most susceptible, and necropsy showed the presence of ascites, hydropericardium, and myocardial pallor (Conkova et al., 2003). The effect of MON is also reported to be weakly cytotoxic for human white blood progenitors, CHO-K1, Caco-2, and HepG2 cells (Knasmuller et al., 1997).

9.1 Pathology A subacute toxicity study in rats at different doses (3, 6, 9, 12, and 15 mg/kg BW) showed acute pulmonary congestion, presence of little digesta in the stomach, and some bloodstained contents in the small intestines in a few rats. Microscopically, only lungs showed acute congestion and leukostasis, but no specific lesions were observed in the other organs (Jonsson et al., 2015). Quail birds fed with MON at a dose of 100 ppm proved to be toxic by causing poor growth performance, increased serum pyruvate levels, and cardiomyopathy. Cardiac damage was found to be the major cause of mortality in the birds. Major lesions were noticed in MONinduced cardiomyopathy in birds, including myocardial degeneration, hypertrophy, necrosis, and thinning of cardiomyocytes (Fig. 9.4). Ultrastructural changes were characterized by an increase in the number of mitochondria, resulting widespread separation of muscle fiber, mitochondrial pleumorphism, and swelling (Sharma et al., 2012).

Figure 9.4: (A) Gross photograph showing dilation and rounding of heart (right) after 21 days of continuous feeding of MON at 100-ppm level (left: control). (B) Photomicrograph showing hypertrophy of muscle fibers in MON-fed Japanese quail (H&E ×330).

260  Chapter 9

10  Ergot Alkaloids These are the group of compounds produced by Claviceps sp., mainly by C. purprurea and C. fusiformis. Due to colonization of Claviceps sp. on the grains, it looks like spur on legs of a rooster. These are nitrogen-containing alkaloids belonging to indole group and are divided into clavines, lysergic acid amides, and ergopeptides (Haarmann et al., 2009). The fungus grows during the wet spring and hibernates during the autumn season. These are harvested along with grains and contaminated feed. In wheat flour it ranges from 4 to 100 µg/kg and 15 to 400 µg/kg in rye flour. These can be removed by treating the crop with fungicides (Dusemund et al., 2006). Contamination of livestock feeds with ergot alkaloids has been known from a longer period and is well reported. In the United States, ergotism reports in livestock vary every year due to variation in rainfall and temperature. The fungus infects rye, millet, and other grains causing several epidemics resulting in ergotism or St. Anthony’s fire. In sorghum, ergot is caused by fungus Sphacelia sorghi. Ergotism leads to vasoconstriction of limbs, swelling of limbs, pain leading to gangrene, and also hallucinations (Schiff, 2006). In the early times it was popularly used to initiate uterine contractions in France, Germany, and United States (Groger and Floss, 1998). However, after warning from the New York Medical Society, it was limited to be used only during postpartum hemorrhage. It was also used for the treatment of vascular headache in Germany and United States until the 19th century. Several neurotoxic and vasoconstrictive properties of ergot alkaloids cause gangrene and prevent hemorrhage. The role of ergot alkaloids has also been reported in treating migraine (Kainulainen, 2003). When consumed, ergot results in either gangrenous or convulsive forms. In European countries, outbreaks of ergotism were observed and these were convulsive in nature, including deficiency of vitamin A (Eadie, 2003). Their symptoms include unclear illness, gastrointestinal symptoms, abnormal sensation in limbs, and local pain (Berde and Schild, 2012). In convulsive types, there is distortion of trunk and limbs, flexion of fingers and wrist, followed by intense pain, drowsiness, hallucination, and double vision. There are also reports of continuous sweating, fever, muscle twitching, and spasms persisting for minutes to hours (De Costa, 2002). Ergot alkaloids possess both inhibitory and stimulant properties because they interact with drug receptors and the binding depends on the type of ergot alkaloid and environment of the receptor. Ergot alkaloids show a strong affinity toward serotonin, dopamine, and adrenergic receptors of CNS. These alkaloids show structural similarity with three neurotransmitters acetylcholine, histamine, and tyramine. These alkaloids are well absorbed by the gastrointestinal tract and target mostly pre- and postsynaptic sites. In the CNS it binds antagonistically with the peripheral 5-HT2 (serotonin) receptor, and in vascular smooth muscle, it interacts with adrenergic receptors (Kainulainen, 2003).

Food-Borne Mycotoxicoses: Pathologies and Public Health Impact  261 Due to interaction of ergot alkaloids with monoamine receptors, there are undesirable effects on nervous, cardiovascular, reproductive, and immune systems (Panaccione and Coyle, 2005). Their prolonged exposure also induces myocardial infarction. Ergotamine, one of derivative of ergot alkaloid, is used for treating migraine with doses not exceeding 12 mg/week. Chronic consumption of ergot alkaloids results in ergotism that can either be convulsive or gangrenous. Administration of ergot alkaloids increases dopamine levels, thereby leading to amelioration of Parkinson’s disease. It is used in the treatment of hyperprolactinemia, prolactinomas, limiting lactation, premenstrual symptoms, benign breast disease, and acromegaly (Scott, 2009). In animals three syndromes were elucidated, that is, nervous ergotism, gangrenous ergotism, and agalactia. In cattle, a disease named fescue foot has been observed, which is derived from constriction of blood vessels and gangrene in their hooves and tails due to smooth muscle relaxation (Zain, 2011). It also results in loss of milk production, loss of body mass, and reduced fertility (Schneider et al., 1996). Table 9.1 depicts the combined interactions and the toxic effects of various mycotoxins. Table 9.1: Combined mycotoxin interactions and their toxic effects. Mycotoxin Combinations

Interactions

AFB1 + OTA

Synergistic and antagonistic Additive and synergistic

Combined Toxic Effects

Hepatotoxicity, nephrotoxicity, carcinogenicity, and teratogenicity (Klaric et al., 2013; Wangikar et al., 2004) AFB1 + fumonisin Hepatotoxicity, immunotoxicity, carcinogenic, oxidative stress, and apoptosis (Abbes et al., 2016; Klaric, 2012; Tessari et al., 2010) OTA + fumonisin Additive and Nephrotoxicity, hepatotoxicity, immunosuppression, synergistic and genotoxicity (Domijan et al., 2015; Heussner and Bingle, 2015; Khan et al., 2013; Klaric et al., 2013) OTA + ZEN Antagonistic In vitro cytotoxicity in HepG2 and KK-1 cells (Li et al., 2014; Wang et al., 2014) OTA + CTN Additive, synergistic, Nephrotoxicity, gastrointestinal ailments, fetal and antagonistic malformations, and lymphoid tissue damage (Heussner and Bingle, 2015; Klaric et al., 2013) OTA + trichothecenes Additive and Nephrotoxicity, hepatotoxicity, and immunotoxicity synergistic (Indresh and Umakantha, 2013; Xue et al., 2010) Fumonisin + MON Synergistic Cardiotoxicity, hepatotoxicity, nephrotoxicity, immunosuppression, pneumonitis, and hydropericardium (Javed et al., 2005; Sharma et al., 2008, 2012) Fumonisin + ZEA Synergistic and Immunomodulation and cytotoxicity (Luongo antagonistic et al., 2006) Fumonisin + Synergistic and Esophageal cancer, neural tube defects, liver damage, trichothecenes antagonistic intestinal cell toxicity, and hematotoxicity (Szabo et al., 2014; Wan et al., 2013) OTA + FB1 + CTN Additive and Cytotoxicity in human peripheral blood mononuclear cells synergistic (Stoev et al., 2009) ZEA + FB1 + trichothecenes Additive, synergistic, Inhibition of macromolecules synthesis, oxidative stress, and antagonistic and cytotoxicity in swine jejunal epithelial cells (Kouadio et al., 2007; Wan et al., 2013) AFB1, Aflatoxin B1; CTN, citrinin; FB1, fumonisin B1; MON, moniliformin; OTA, ochratoxin A; ZEA, ZEN, zearalenone.

262  Chapter 9

11  Public Health and Economic Impact of Mycotoxins Mycotoxins are toxic to animals and humans at low concentrations and cause food- or feedrelated, noncontagious, nontransferable disease called mycotoxicoses. These mycotoxins have a range of acute and chronic effects on both humans and animals, depending on the species along with their impact on health as influenced by age, weight, sex, diet, exposure to infectious agents, and occurrence of other mycotoxins causing synergistic effects (Milicevic et al., 2010; Zain, 2011). Table 9.2 summarizes the details of various mycotoxins. The risk assessment of mycotoxin damage is different in developed and developing countries. In the developed countries, there is a variation of diets and people are more aware of food quality and food processing, and companies compete to ensure providing high-standard food quality. In contrast, crops are grown in the developing countries with the main aim of providing food to the masses; therefore, less attention is paid toward quality resulting in the consumption of tolerable levels of toxins irrespective of proper quality due to food scarcity problems. The lack of a variety of food in the developing countries leads to an excessive intake of single cereal per day, increasing the risk of mycotoxin exposure at higher doses (Shephard, 2008). AFB1 has previously been linked to cause human liver cancer, acting synergistically with hepatitis B virus (HBV) infection and has been classified as a group 1 carcinogen. The combined exposure of aflatoxin and HBV is mostly responsible for the development of HCC in most of the developing countries, and the risk of HCC development increases multiplicatively in the presence of both etiological agents. Liver cancer is the sixth most common cancer diagnosed worldwide and is about 5.7% of all cancers (Wu et al., 2014). In the developed nations the average age of HCC diagnosis is 45; however, in high-risk regions it is as low as 20 years (Parkin et al., 2005). Aflatoxin is also important from a public health perspective as it is related to reduced growth in the children, immunosuppression, and their increased susceptibility to infectious diseases (Khlangwiset et al., 2011). Aflatoxins have been considered as a contributing factor to the childhood disease Kwashiorkor and Reye’s syndrome. Kwashiorkor is mainly protein energy malnutrition, whereas Reye’s syndrome is characterized by cerebral edema, encephalopathy, and enlargement of visceral organs along with liver and kidneys. The acute exposure to the toxin has been reported to cause incidences of toxic hepatitis, jaundice, and even death in the developing countries, such as India, Kenya, and Malaysia (Zain, 2011). Many studies have linked aflatoxin exposure to immunomodulation in humans and correlated to the presence of higher levels of aflatoxin– albumin adduct in the HIV-positive patients (Jiang et al., 2008). Fumonisin exposure is a major risk factor for esophageal cancer and several epidemiological reports from the countries, such as South Africa and China, supported its associations with cancer development. The fumonisin average daily intake was reported to be 92.4–460 µg/kg BW/day in China. In contrast to China, the average daily intake of fumonisins in the high-risk

Food-Borne Mycotoxicoses: Pathologies and Public Health Impact  263 Table 9.2: Summarized detail of various mycotoxins.

Mycotoxins

Fungal Sources

Contaminated Species Foodstuffs Affected

AFB1, AFB2, AFG1, AFG2, and AFM1

A. flavus, Aspergillus nomius, Aspergillus ochraceus, and A. parasiticus

Corn, rice, sorghum, soybeans, and peanuts

Human, swine, poultry, ovine, feline, and canine

OTA

A. ochraceus and A. verrucosum

Cereal grains, coffee, and grapes

Human, swine, poultry, and quail

FB1, FB2, and FB3

Fusarium proliferatum and F. verticillioides

Corn and silage

Human, equine, and swine

ZEN

F. culmorum and F. graminearum

Cereals

Human, swine, and bovine

MON

F. verticillioides and Maize, wheat, Chickens and rye, triticale, birds other Fusarium oats, and rice species

Cereals Trichothecenes Stachybotrys sp., Trichothecium sp., Fusarium sp., Cephalosporium sp., and Myrothecium sp. CTN Penicillium sp. and Grains, rice, beans, fruit Aspergillus sp. juices, herbs, and spices

Human, cattle, swine, equine, and poultry

Harmful Effects Liver damage, cancer (Liu and Wu, 2010), and gastrointestinal disturbances (Diekman and Green, 1992) Kidney damage, cancer (Reddy et al., 2010), and liver damage (Khan et al., 2014; Patial et al., 2013) Leukoencephalomalacia, pulmonary edema (Dvorak et al., 2008; Marasas et al., 2004), esophageal cancer, and neural tube defects (Mathur et al., 2001) Enlargement of uterus (Marczuk et al., 2012), abortion, and malformation of testicles and ovaries (Marin et al., 2010) Cardiotoxicity (Conkova et al., 2003), depression, and Keshan disease (Cao et al., 2007; Sharma et al., 2012) Diarrhea (Whitlow and Hagler, 2010), vomiting, and skin disorders (Wannemacher and Weiner, 2001)

Swine, rabbits, Swelling and necrosis poultry, and of kidney (Ostry canine et al., 2013)

Maximum Permissible Limits 10–20 mg/kg BW

 oral (Adler and Franz, 2016). From previous studies it is presumed that the potency of aerosolized type A toxin was an underestimate, because only a small amount was absorbed in the lungs and delivered to the circulatory system (Park and Simpson, 2003). Although there may be exceptions due to species and experimental differences, a qualitative rank-order potency (highest to lowest) for the oral delivery of type A botulinum toxin based on alimentary tract location is: upper small intestine > lower small intestine (ileum) > stomach > buccal > colon. The original work of Simpson’s group (Ravichandran et al., 2006) represents one of the first physiologically based pharmacokinetic–pharmacodynamic (PB–PK–PD) studies of botulinum neurotoxin conducted at the cellular or molecular level (Maksymowych and Simpson, 1998). Some of this later work has been done in this area only as a “by-product” of investigations into the spread of toxin from an injection site (Tang-Liu et al., 2003). As stated earlier, from ingestion of the toxin to the onset of paralysis, the neurotoxin enters and goes through the gastrointestinal (GI) tract, crosses the gut epithelium into the lymph (Fujinaga, 2010; Heckly et al., 1960), and enters and exits the systemic circulation to reach the binding sites in peripheral nerve endings (Fig. 10.3, upper part). The lower part of Fig. 10.3 represents the neurotoxin binding, translocating intraneuronally, and exerting an irreversible metalloprotease action by cleaving one or more SNARE proteins, depending on the neurotoxin serotype. This enzymatic action prevents synaptic vesicles from fusing with the internal leaflet of the neurolemmal bilayer, thus preventing the release of the neurotransmitter (acetylcholine) into the synaptic cleft following neurally evoked stimulation. It is anticipated that suitably labeled neurotoxins can eventually be developed and followed at the molecular level during animal experiments using computer-aided tomography scans or other imaging techniques (Simpson, 2013).

4.2  Intestinal Barrier A description of this subsystem begins with this organ’s inhospitable environment, which has a low pH, digestive enzymes, and food particles that are in transit. Of increasing importance in many areas of research is the presence of the host’s gut microbiome (Section 4.2.2). Anatomically this subsystem is composed of an epithelial monolayer made up of neuroendocrine crypt cells, microfold (M) cells, Paneth (antimicrobialproducing) cells, and goblet (mucus-producing) cells (Abreu, 2010; Fujinaga et al., 2013; Kaiko and Stappenbeck, 2014). At the molecular level, the initial receptor binding by the PTCs depends on cell type involved and on the serotype (Inoue et al., 2003). There are

Foodborne Botulism From a Systems Biology Perspective  287

Figure 10.3: A Minimal Representation of Reactions Associated With Foodborne Botulism. This series begins with the ingestion of the PTC, its journey through the gastrointestinal tract, and translocation through the intestinal barrier, with BoNT going into the lymph and systemic circulation, and eventually to peripheral NMJs where the neurotoxin exerts its enzymatic toxic effect. Pharmacodynamic steps involve nerve endings at the neuromuscular junction (NMJ). Pharmacokinetic pathways for the elimination of BoNT/A are represented at several locations. B, Brain; BoNT-R, receptor bound BoNT/A; E, internalized LC toxic domain; ES’, LC-substrate intermediate; GI, gastrointestinal tract; H, heart; K, kidney; L, liver; P1, P2, proteolytic products of S’; PTCs, progenitor toxin complexes; R, receptors for BoNT/A; S, spleen; S’, SNAP-25. Modified from Lebeda, F.J., Cer, R.Z., Stephens, R.M., Mudunuri, U. 2010b. Temporal characteristics of botulinum neurotoxin therapy. Expert Rev. Neurother. 10, 93–103, with permission from Taylor & Francis Ltd., www.tandfonline.com

many literature citations in which intestinal epithelial cells are assumed to be involved in neurotoxin translocation, yet crypt cells have also been implicated in this process (Couesnon et al., 2012). More recently attention has been paid to the follicle-associated epithelium covering Peyer’s patches, which includes M cells that express GP-2, a surface-residing galactose-containing glycoprotein (Matsumura et al., 2015). Toxicity caused by type A1 L-PTC (BoNT + NTNH + HAs) (Fig. 10.2) has been associated with the interaction of GP2 with the fully assembled HA complex. Closer examination revealed that the hexavalent HA1 galactose-binding sites interacted predominantly with the carbohydrates on GP2. From isothermal titration calorimetry studies, HA1/A was reported to have Kd values of 3–9 mM for galactose and related sugars (Inoue et al., 2003). Using similar techniques, HA1/C had a lower affinity for galactose and galactose-containing molecules with values for Kd of 20–30 mM (Nakamura et al., 2011). The type A1 M-PTC toxin (BoNT + NTNH) lacks HA and was ∼2 orders of magnitude less toxic when applied intragastrically (Matsumura et al., 2015). Importantly, this group demonstrated that in mice treated with an antibody that

288  Chapter 10 depletes M cells (anti-RANKL), oral administration of type A1 L-PTC was much less toxic, suggesting that M cells are a significant intestinal translocation route for this toxin complex. Once bound, all forms of the PTC serotypes cross this barrier. A resistance-barrier model has been proposed that describes the pathways through the apical and basolateral membranes of the epithelial cell layer and the paracellular space to account for the results from transmonolayer (also called, transepithelial) electrical resistance measurements (Blikslager et al., 2007). This model is made up of two pairs of resistances that are in parallel and connect the mucosal (apical or lumenal compartment) with the serosal (basolateral) sides. The transcellular path is represented by the sum of an apical membrane resistance and a basolateral membrane resistance. The paracellular path is an extracellular shunt that is represented by the sum of apical tight junction resistance and the intercellular space resistance. Epithelial cell preparations exhibit significant electrical differences. A typical value for unit area resistance of murine small intestine is ∼50 ohm-cm2 (Nighot and Blikslager, 2010). In contrast, a much higher transmonolayer electrical resistance was measured for rat alveolar epithelial cells (∼2100 ohm-cm2) (Kim et al., 1991). Transmonolayer resistance measurements with human colon carcinoma Caco-2 cells (Amatsu et al., 2013) exposed to type B L-PTC produced 50% decrements in a concentrationdependent manner (their Fig. 1D) with t1/2 values of 18, 8, and 4 h with 3, 10, and 30 nM, respectively; data that should be useful in future modeling studies. The participation of vesicle-mediated toxin translocation has also been examined. Another set of experiments by Simpson’s laboratory (Maksymowych and Simpson, 2004) used polarized monolayers of human colon carcinoma T-84 cells having a transmonolayer electrical resistance of ∼400 ohm-cm2. This study examined whether BoNT/A could be transcytosed across polarized monolayers by depleting potassium from the bathing medium that presumably disrupted clathrin-coated pits involved in receptor-mediated endocytosis and transcytosis. From these experiments, 10 nM BoNT/A transiently, within 3 h, reduced the measured flux of [131I]-BoNT/A by 68% but reduced the transmonolayer electrical resistance by only ∼15% (Maksymowych and Simpson, 2004). Moreover, treatments designed to disrupt lipid rafts did not produce specific effects. Rather, these results indicated that BoNT/A transcytosed through the intestinal barrier by clathrin-coated vesicles without markedly affecting the paracellular route. From the results with type B L-PTC (Amatsu et al., 2013), a similar 3 h incubation period with BoNT/A may represent an early stage in the process of developing an additional paracellular route. Detailed kinetic studies of BoNT binding to and crossing intestinal barriers have also been performed. Mucosal to serosal transcytosis flux rates of ∼0.1–100 fmole/h/cm2 have been reported (Maksymowych and Simpson, 1998) using concentrations of 10−10 to 10−7 M [125I]BoNT/A in transwell assays. A subsequent analysis was made by visualizing Alexa Fluor 488-labeled BoNT/A as it was initially bound to the apical side of polarized human colon T-84 epithelial cells, then transcytosed in an energy-dependent manner, and finally released

Foodborne Botulism From a Systems Biology Perspective  289 on the basolateral side (Ahsan et al., 2005). The estimated half time for association of the labeled BoNT/A to these cells was 30–40 min (k ∼ 0.693/t1/2, k = 0.023 to 0.017 min−1, respectively). The corresponding label dissociation half times from these cells were long (only a 16% loss of label after 90 min) and likely could not be accurately measured. Using a single-exponential decay equation with these values, a rough estimate can be made for the t1/2 of dissociation of the labeled BoNT/A (∼1188 min), a time that is essentially irreversible in a laboratory setting. The first amounts of the labeled BoNT/A appeared on the serosal side within 5 min while transcytosis was completed within 20–30 min, a time that corresponds to a t1/2 value of 10–15 min (k = 0.07 and 0.05 min−1, respectively). This sequence of reaction steps could form a module, or a small functional unit that has well-established values for the kinetic rate constants (Diamond et al., 2013). Of further interest is that these translocation times that take only a few minutes are much shorter when compared to the typical illness onset times of 18–38 h. This large difference between the time it takes for the toxin to cross the intestinal barrier and the time to first sign or symptom, together with the the slow clearance phase (t1/2 = 600 min) of BoNT/A from the circulation, support the important idea that the circulatory and lymphatic systems represent reservoir compartments (Al-Saleem et al., 2008; Lebeda and Adler, 2010; Lebeda et al., 2008) (Section 6). The appearance of BoNT in the lymphatic system is to be expected, given the lipid transport mechanisms in the gut leading to lymphatic transport (Abumrad and Davidson, 2012). 4.2.1  Proposed modes of crossing the intestinal barrier Three major modes for the BoNTs and PTCs crossing the intestinal barrier have been reviewed that involve transcytosis, and the disruption of cells and their intercellular contacts (Fujinaga, 2010; Fujinaga et al., 2013) (Fig. 10.4). Hemagglutinin-mediated transcytosis has been extensively reviewed (Fujinaga et al., 2013; Sugawara et al., 2010). The transcytosis of neurotoxin components besides the PTC have also been reported, including the BoNT/A holotoxin (Fig. 10.4, right side, top panel) and the C-terminal half of its heavy chain (HCC/A). Moreover, studies have shown that HCC/A preferentially enters through crypt cells to target specific neurons (Couesnon et al., 2012). The oral toxicity of the various PTCs could be reduced or inhibited if this carbohydrate-HA interaction was blocked (Lee et al., 2015). That group determined that the clinically used drug, lactulose, a synthetic disaccharide containing galactose, could be a prototype inhibitor (a receptor mimetic) against oral BoNT/A intoxication. Lactulose was found to bind to the HA complex at the same site where the host receptors bind. Lactulose is used as a treatment for chronic constipation and potentially represents a new class of inhibitors of foodborne botulism. As discussed in Section 1, if constipation in foodborne botulism is associated with the toxin itself, this idea would be supported by the interactions of the HAs with carbohydrate-

290  Chapter 10

Figure 10.4: Crossing the Intestinal Barrier Depends on Toxin Complex Serotype and Species. Step 1: transcytosis without cellular disruption of PTC (Route i) and of BoNT (Route ii). Step 2: different serotypes of transcytosed HA from Route i disrupt the barriers in a species-dependent manner, with (right side, type C) and without (left side, types A and B) cytotoxic effects. Cells: human intestinal epithelial monolayers (Caco-2, T84), and Madin–Darby canine kidney (MDCK). Step 3: in Route iii, type C PTCs (right side) can go through or between damaged cells while types A and B PTCs (left side) only cross by paracellular pathways. All of these BoNT serotypes also cross by Route iii. From Fujinaga, Y. 2010. Interaction of botulinum toxin with the epithelial barrier. J. Biomed. Biotechnol. 2010, 974943, an Open Access article from Hindawi Publishing Corporation.

containing receptors of the intestinal epithelium and the inhibition of toxic effects by certain sugar moieties. Experiments in which BoNT/A was directly administered into mouse ilea resulted in the block of spontaneous and field-stimulated smooth muscle contractions (Couesnon et al., 2012). As depicted by Route ii (Fig. 10.4, right side, top panel), HAs and NTNH are not necessary for absorption by the gut. The holotoxin, however, can only exert a minimal toxic effect when orally administered (Lamanna et al., 1967; Maksymowych et al., 1999). Because BoNT/A binds in varying degrees to certain acetylcholine-, glutamateand serotonin-releasing neurons in submucosal plexuses, the neurotoxin could decrease intestinal peristalsis and secretion, and possibly produce constipation. As reported by Couesnon et al. (2012) crypt cells are a preferential entryway. Interestingly, BoNT/A has been examined for its efficacy in treating idiopathic constipation, an action that may be involved with the same cholinergic and noncholinergic neurotransmitters (Keshtgar et al., 2007).

Foodborne Botulism From a Systems Biology Perspective  291 The HA-mediated disruption of cell contacts to form a paracellular pathway (Route i, Fig. 10.4, left side, middle panel) is a proposal based on several different experimental approaches (Fujinaga et al., 2013). Within the cadherin superfamily of proteins, the classical example is E-cadherin, a single-pass transmembrane glycoprotein comprised of five extracellular tandem repeats (EC1-EC5) of β-sandwich domains. These ∼110-residue domains extracellularly drive the initial stages of adherens junction formation between apposing cells (Brasch et al., 2012). Early work showed that the HA/B complex interacted with E-cadherin (Sugawara et al., 2010). A hybrid model has also been proposed in which a small amount of L-PTC (BoNT + NTNH + HAs) initially undergoes transcytosis, then dissociates into the HA and the other subcomponents. The HA complex is thought to exert its junction-disruption effect from the basolateral side, thus allowing more L-PTC to go through the paracellular pathway (Lee et al., 2014). It is noteworthy that different routes of translocation have been proposed for different serotype complexes crossing from the lumenal side of the intestinal barrier into the circulating fluid (lymph, blood) (Fujinaga et al., 2013). This is evident because some serotypes lack HA proteins (types A2, A3, E, F; see Section 3.2) but rather have open reading frame and other proteins (ORFX1-3, P47). Their functions are still apparently unknown, but they may play a role in facilitating the neurotoxin or a form of the PTC across the intestinal barrier. Furthermore, because the BoNT/C complex does not associate with human E-cadherin, this observation suggests a mechanistic explanation of why type C foodborne botulism in man is rare yet its neurotoxin can readily block neuromuscular transmission (Coffield et al., 1997; Lee et al., 2014). The molecular mechanism of cell–cell junction disruption involves the binding of HAs to the EC1–EC2 domains of E-cadherin (Brasch et al., 2012). E-cadherins of neighboring epithelial cells form trans dimers with their EC domains by having the Trp-2 residue in the first molecule of the pair fit into the Trp-binding pocket of its partner (Lee et al., 2014). The Kd for this dimer is ∼175 µM, a binding strength that is markedly weaker than E-cadherin’s affinity for the HA complex (2.3 µM; 76-fold less). When HA binds E-cadherin, E-cadherin is stabilized in a strained, monomeric conformation with hydrogen and hydrophobic bonds and with its Trp-2 residue binding to its own pocket. Two HA mutants, HA30/A-D263A/F278A and HA70/A-T527P/R528A, which can no longer bind carbohydrates, were able to cause a similar level of monolayer disruption as the wild type HA/A complex within a 24 period. However, a shorter incubation (150 min) produced less disruption than wild type HA/A indicating that initial carbohydrate mediated binding by these HAs may be important only in the early stages of monolayer disruption (Lee et al., 2014). Other findings indicate that while carbohydrate binding is not absolutely essential, these sites do play a role in disruption and overall binding processes.

292  Chapter 10 4.2.2  Intestinal barrier subsystem: its interactions with the host microbiome and immune systems Several issues can be addressed regarding the vulnerability of the foodborne C. botulinum spores when they are exposed to the microbiome present in the normal adult gut that prevents colonization at this site. One possible mechanism for a healthy adult intestinal microbiome in preventing the colonization of C. botulinum and other families is that normal gut flora release protective or defensive molecules (bacteriocins) (Kaiko and Stappenbeck, 2014). In that role IL-22 is an important regulator of the interactions between the microbiota and the intestinal epithelium (Parks et al., 2015). In the normal human gut microbiome, the species are mostly from the genera Bacteroidetes and Firmicutes (Heinken and Thiele, 2015). A number of studies have shown that other genera are capable of inhibiting the growth of specific botulinum toxin-producing strains. For example, certain nonproteolytic C. botulinum type B and F strains were inhibited by Lactobacillus, Lactococcus, Streptococcus, and Pediococcus (Rodgers et al., 2003). This result was not uniform across all species within these genera because some strains of Lactobacillus and other species did not inhibit any of the tested type B or F strains. The intestinal microbiome provides digestive and metabolic functions and defends against the propogation of pathogenic microorganisms (Shirey et al., 2015). Infant botulism is presumed to occur because an infant’s microbiome is not sufficiently mature to compete with C. botulinum for food (Sobel, 2005) and, thus, allowing it to colonize. A partial explanation for the mechanism underlying infant botulism in which over 90% are younger than 6 months (Cox and Hinkle, 2002) is thought to be related to an initial group of aerobic and facultative anaerobic bacteria that can thrive because of the presence of relatively high amounts of oxygen (Kaiko and Stappenbeck, 2014). With time, the intestinal climate becomes more anaerobic as oxygen is utilized and making it feasible for the colonization of clostridial species. Adult patients with abnormal intestines due to surgery, inflammatory bowel disease (Argov, 2009) ulcerative colitis, Crohn’s disease, or excessive treatment with antibiotics are susceptible to the growth of C. botulinum (Gillevet et al., 2010). It may be that critical protective species existing in a healthy microbiome can be used as safe and effective treatments of intestinal toxemia botulism in infants and in patients with intestinal disorders. A recent study was carried out to examine the composition of the microbiota in 14 infant botulism cases; 8 of these were laboratory confirmed and 6 were nonconfirmed. Fecal microbiota contained 20 bacterial families, of which the abundances, when comparing confirmed to nonconfirmed cases, were higher for Proteobacteria and Enterobacteriaceae and lower for Firmicutes (Shirey et al., 2015). In another study, strains of bifidobacteria and lactobacilli isolated from feces of healthy infants inhibited the growth of C. botulinum after 24–48 h of incubation (Sullivan et al., 1988). Bacteriocins from two Lactobacilus strains (brevis BG18 and plantarum BG33) inhibited growth of C. botulinum and other

Foodborne Botulism From a Systems Biology Perspective  293 Gram-positive bacteria (Uymaz et al., 2011). Lactobacilus paracasei inhibited growth and toxin formation by type A C. botulinum (Fernandez et al., 2013). As more data are obtained, systems biology approaches could be used to develop models of the molecular interactions among bacterial species in the gut environment that defend against C. botulinum and prevent its colonization. Several approaches have been critically reviewed in considerable detail. Studies designed to provide an understanding of host-microbe interactions (Heinken and Thiele, 2015) have been developed using experimental data and computer models that involve top-down (Martin et al., 2007), bottom-up (Ganter et al., 2013), and constraint-based methods (Thiele et al., 2013). Thus, in cases of outbreaks of foodborne botulism, an individual’s microbiome health status may be a factor in determining whether a person will be susceptible and, if so, the time course and extent of the illness.

5  Vascular and Lymphatic Systems Transcytosis of BoNT/A across endothelial monolayers was studied using immortalized human pulmonary adenocarcinoma (Calu-3) cells (Park and Simpson, 2003). The holotoxin and the L-toxin (BoNT + NTNHA + HAs) of C. botulinum type D were first shown to bind to sialic residues when incubated with bovine aortic endothelial cells (Yoneyama et al., 2008). The binding to cells by both toxins was inhibited by N-acetyl neuraminic acid or by neuraminidase, but not by galactose, lactose or N-acetyl galactosamine. This action is in contrast to the binding of HA to galactose-containing receptors on intestinal epithelial cells (Lee et al., 2015). As noted in Section 4.2.1, lactulose with its galactose-containing moiety blocked HA complexes from binding to epithelial cell receptors. The general circulation is involved in the elimination of neurotoxin from the circulatory system by delivering those molecules to the liver, spleen, and kidneys for their excretion or metabolic degradation (Al-Saleem et al., 2008; Lebeda et al., 2010b). Additional routes of elimination would presumably occur in nerve terminals that would account, at least partially, for termination of the toxic effect (Sepulveda et al., 2010). As discussed in Section 6, the circulatory system clears BoNT (e.g., type B, t1/2 ∼ 600 min) (Al-Saleem et al., 2008) with shorter durations than the observed times-to-onset (>1080 min) of neurological signs. Several other studies have also measured the clearance rates for the neurotoxins. Following intravenous administration, the amount of diethypyrocarbonate-inactivated 125I-BoNT/A in blood and serum samples from rats and mice declined as a single exponential (Ravichandran et al., 2006) with t1/2 values between 231 and 260 min (k ∼ 3e−3 min−1). In more detailed experiments, the pharmacokinetics of a triple point mutation, nontoxic recombinant form (ciBoNT/A) was followed after oral administration in mice (Cheng et al., 2009). A double exponential decay of the amount of ciBoNT/A in the serum could be described by fast (t1/2α = 63 min, k ∼ 1e−2min−1) and slow (t1/2β = 450 min, k ∼ 1.5e−3 min−1) components.

294  Chapter 10 The fast phase was considered to represent the redistribution of the mutant toxin to the tissues and the slow phase to represents its clearance from blood. These clearance rates are faster than the corresponding rates calculated from the timesto-onset of signs and symptoms, an observation that is consistent with the idea that the circulatory system acts as a “holding compartment” for the neurotoxin until there is sufficient fractional distribution and intoxication of the neuromuscular junction (NMJ) (Al-Saleem et al., 2008) (Section 4.2). A similar idea was expressed in which long times-to-peak effect could be related to nonspecific binding, possibly to extracellularly located sites in the circulatory (Lebeda and Adler, 2010; Lebeda et al., 2008) and lymphatic systems. In these studies, this conclusion was based on the integration of laboratory (in vitro and in vivo), computational modeling, and clinical data that related the onset kinetics and the clearance rates from the blood.

6  Peripheral Cholinergic Neuromuscular Junction System Detailed reviews have recently appeared for the structural domains of BoNTs that are associated with the molecular mechanisms of binding to neuronal receptors (Rummel, 2015), translocation across neuronal membranes (Montal, 2010) and zinc-dependent proteolytic activity of SNARE substrates (Rossetto et al., 2014). To a lesser extent, the topics of persistence and recovery have also been discussed (Keller, 2006; Tsai et al., 2010, 2014). The precise molecular mechanisms are not fully known for the binding of the BoNTs to presynaptic membranes. Additional insights on the BoNT binding process came from the electrical dipole calculations of (Fogolari et al., 2009). Electrostatic models revealed that the BoNTs are polar molecules with the HCC domain (Section 3.2) having a positive charge. This charge was hypothesized to create a dipole orientation that would, in the case of BoNT/A, direct the HCC toward its receptor, SV2, that is located in the negatively charged inner leaflet of the synaptic vesicle membrane (Fogolari et al., 2009). It was further hypothesized that this electrostatic effect would play a role in binding efficiency in which the Kd ∼ 200 nM was for the BoNT/A-SV2C interaction (Weisemann et al., 2016). Moreover, an N-linked glycan on SV2 is a conserved host posttranslational modification site in which the glycosylation allows a higher specific binding to the type A HC as evidenced by its Kd of ∼15 nM (Yao et al., 2016). It will be interesting to determine if the tight binding of some of the neurotoxins to their respective substrates are also influenced by this polarization. Moreover, the role of a dipole orientation may also contribute to the intraneuronal translocation of the LC or to the different toxins (BoNT, PTCs) crossing the intestinal barrier. The seminal pharmacodynamic model for the effects of BoNT/A at the NMJ was proposed by (Simpson, 1980). This empirical model accurately simulated the time course of paralytic action of BoNT/A on rat phrenic nerve–hemi diaphragm preparations. This minimalist model consists of 3 steps: binding, translocation and a lytic reaction that represents the

Foodborne Botulism From a Systems Biology Perspective  295 toxic action leading to muscle paralysis. All three-reaction rates (kB = 5.8 e−2 min−1, kT = 1.41 e−1 min−1, and kL = 1.3 e−2 min−1) were independently calculated from experimental data. The 3-step model could be viewed as an extreme-case representation of the tissue being directly exposed to a large amount of neurotoxin, and in which the rates were at their extreme values. In a later study, a reaction was added that precedes the 3-step NMJ model to account for the different times-to-peak of paralysis in the rat NMJ preparation, in mice injected with a sublethal dose of BoNT/A, and in a dystonic patient treated with BoNT/A to reduce pain (Lebeda et al., 2008). This new initial step was associated with the rate (kS) of toxin delivered from a distal site to a site proximal to the NMJ. The relatively long onset times ranged from 2 days (k ∼ 3.5 e−4 min−1) to 2 weeks (k ∼ 5 e−5 min−1) to reach a peak effect. To put these modeling results into a botulism framework, the study of the massive foodborne botulism outbreak in 2006 in Thailand that affected 209 people was examined (Kongsaengdao et al., 2006). These data provided the timing of neurological signs of 18 of those who were exposed to a potentially lethal dose of BoNT/A that produced severe respiratory failure. Using the first neurotoxin-induced sign presented (ptosis, diplopia, dysphasia, dysarthria, or generalized weakness), the time-to-onset of these first signs was 33 ± 15 h (mean ± SD; range = 18–72 h). The reciprocal of the mean value for the time-to-first symptom onset corresponds to kS ∼ 5 e−4 min−1, a value that is within the range of calculated values of kS (Lebeda et al., 2008) for simulating the times-to-peak neurotoxin effect in the experimental laboratory (in vivo mouse) (Aoki, 2004; Keller, 2006) and in the clinic (Dressler and Adib Saberi, 2005). These time-to-first symptom data from 2006 Thailand outbreak serve to illustrate that minimal models could form the temporal basis of predicting prognoses for foodborne botulism.

7  Systems Biology of Secondary Reactions An early, central theme of BoNT not causing morphologic changes at the NMJ (Guyton and MacDonald, 1947) was refuted by evidence of toxin-induced neural sprouting. The observation of neurites at poisoned nerve terminals was a landmark finding by Duchen and Strich. Although BoNT-induced atrophy of skeletal muscle was a well-established observation by 1967 (Duchen and Strich, 1967, 1968) morphological changes induced by BoNT in neurons were not found previously by either light or electron microscopy. Even in more recent reports, there is only evidence of diffuse muscular atrophy without structural alterations in peripheral nerves (Devers and Nine, 2010). Neuronal sprouting at the nerve endings could be a compensatory mechanism in response to BoNT/A or C. Sprouting could also be a sign of neural regeneration that would be of interest to the wound repair and clinical rehabilitation communities. Interestingly, surgical denervation does not induce neural sprouting (Dodd et al., 2005). In contrast, denervation-like chromatolysis of rat neurons was

296  Chapter 10 seen 3 days following a single injection of a sublethal dose of botulinum toxin type A into the rat anterior digastric muscle in the lower jaw (Kemplay and Cavanagh, 1983). Initial work has begun on alterations in host (neuronal) transcriptome (Scherf et al., 2014). It is expected that the metabolome will also be affected in neurons and other affected tissues that could lead to the development of a better understanding of the neurite formation process. A number of unexplained secondary actions of BoNT in neurons have been considered that are apparently not directly related to the cleavage of SNAP25 and, therefore, deserve further study (Matak and Lackovic´, 2015). Secondary BoNT/A-induced transcription changes have also been reported in epithelial cells (Thirunavukkarasu et al., 2011) and in skeletal muscles. Earlier, in rat extraocular skeletal muscles, BoNT/A exposure was associated with alterations in the myosin heavy chain (MHC) isoforms (Kranjc et al., 2001). Another group (Dodd et al., 2005) also found that a single BoNT/A injection induced changes in the MHC isoform profile distribution in limb muscles. An isoform profile of fast muscles (type IIb) shifted after BoNT/A to a slow profile (types I, IIx, and IIa). In contrast, these changes did not correspond to those seen following denervation but rather were similar to those seen with aging. Recovery from paralysis to the reestablishment of the original MHC isoform profiles was only partially complete after 67 days. The secondary contributions of muscle disuse and underloading (Rafferty et al., 2012) and other mechanical factors on bone structure associated with BoNT exposure remain to be determined. Additional data for toxin-induced changes in morphology come from the examination of structures associated with the inflammatory system. Histopathological changes were marked in the thymus, spleen and lymph nodes of those mice that received oral or IP administered crude or purified BoNT/A and exhibited labored breathing and paralysis (Cheng et al., 2008). As with neural sprouting these changes may be events secondary to the primary toxic event.

8  Future Directions in Systems Biology of Foodborne Botulism Features of a data-driven systems biology overview of botulinum neurotoxin production are illustrated in Fig. 10.5 (Ihekwaba et al., 2015a). A multiscale analysis is implied by the integration of experimental work with computational models that result in risk analyses (Eissing et al., 2011). Mechanism of action in risk assessment models (Edwards and Preston, 2008) at the cellular and molecular levels would make stronger links to systems biology, to predictive prognoses, and potentially support better health policy decisions (Tauxe et al., 2010). Neurotoxin production includes molecular events, such as gene regulatory networks, signal transduction and metabolic pathways. Events at the individual microorganism level would include pharmacodynamics of therapeutic drug effects. At the scale of bacterial populations,

Foodborne Botulism From a Systems Biology Perspective  297

Figure 10.5: A Proposed Systems Biology Approach for Integrating Risk Assessment With Clostridium Botulinum Toxin Production. BoNT, Botulinum neurotoxin; BotR, transcriptional activator; NTNH, nontoxic nonhemagglutinin; MTC, NTNH-BoNT; CBO0786, negative response regulator. From Ihekwaba, A.E., Mura, I., Malakar, P.K., Walshaw, J., Peck, M.W., Barker, G.C. 2015a. New elements to consider when modelling the hazards associated with botulinum neurotoxin in food. J. Bacteriol. 1–21, with permission from American Society for Microbiology.

more accurate simulations could be achieved by using sets of individuals with previously defined heterogeneous genomic backgrounds. Environmental conditions (time, temperature, pH, aw, atmospheric gases, etc.) and components (nutrients, ions, etc.) would affect events at all these levels. A microorganism’s response to these and other changes could be quantified by monitoring alterations in gene expression, as has been done for cold tolerance of C. botulinum (type A strain ATCC 3502) (Dahlsten et al., 2014). Statistical analysis along with in silico modeling studies that complement experimental approaches could also serve as tools for making risk assessments for regulatory agencies and invested stakeholders. Systems biology-based models could help identify additional important parameters for determining and improving food safety processes (Fig. 10.5). For example, in validating the effectiveness of low-moisture food processing, adequate tools and methods are lacking (Syamaladevi et al., 2016). In addition, while freezing times or heat transfer loads are major considerations in the food storage freezing process, the previously overlooked internal pressure effects on the freezing point could have effects on color, texture, flavor, microbial growth, and other food factors. To predict the effects of these physical factors, detailed modeling using a systems biology approach is needed (Pham, 2006). Other research has demonstrated that different stress factors can shape bacterial genomes to make inheritable epigenetic-induced phenotypic changes (Ni et al., 2012). A systems biology approach could be used to understand better and make accurate predictions about food security and safety (Schmidhuber and Tubiello, 2007).

298  Chapter 10 Following the massive 2006 Thai foodborne botulism outbreak (Ungchusak et al., 2007) policy suggestions were made about the global logistics and the timing for supplying antitoxin and other medical items. A “just-in-time” systems biology strategy as, for example, the one proposed to describe the deployment of bacterial adhesin proteins in response to surface contact stimulation (Li et al., 2012), could serve as a starting point for developing a logistics model. These models could help develop international response agreements for emergency mobilization plans. These would include processes (e.g., whole-genome sequencing) for detecting and verifying outbreaks (Gilchrist et al., 2015). Prior to an outbreak occurrence, plans would have to be made in establishing lines of communication among partner countries and organizations, creating stockpiles of antitoxin, equipment, and supplies and their accompanying release and transport procedures. A number of related questions can be asked regarding the vulnerability of C. botulinum when exposed to the microbiome present in the normal adult gut that prevents its colonization at this site. How does the healthy adult microbiome prevent the colonization of C. botulinum (and other pathogens)? Can a systems biology approach be used to model the interaction of different bacterial species in the gut environment to defend against C. botulinum? Is disruption of C. botulinum’s quorum sensing apparatus an activity occurring in the gut of healthy adults? Does the gut flora release protective or defensive molecules that work against C. botulinum and other organisms? If infant botulism is presumed to occur because an infant’s microbiome is not fully mature to compete with C. botulinum for food (Sobel, 2005), can critical species be identified for use as safe treatments of intestinal toxemia botulism in these infants? Could these species also be used in adults with this form of botulism? Could a model of an individual’s microbiome status help in making prognoses in cases of foodborne botulism?

9 Conclusions The term systems biology can be defined at different levels for the various systems and processes involved in foodborne botulism. The systems are the bacterial cells, the environments, the patients and their microbiomes that, in turn, are made up of interconnected, coordinated (regulated) subsystems and modules. The BoNT-producing bacterial systems have processes (e.g., growth, neurotoxin production, quorum sensing) that are associated with subsystem components (pathways, PTC structures) (Table 10.4). Energy-dependent pathways (translocation, metabolism, growth) and detailed gene regulatory networks for neurotoxin synthesis are only a few examples of reaction modules that could simulate interconnected subsystems that could eventually lead to describing emergent properties of larger molecular, cellular, multicellular, or organ systems. An important problem that could be addressed by a systems biology effort is to make predictions across the spectrum of botulism-related signs and symptoms. Currently, the basis

Foodborne Botulism From a Systems Biology Perspective  299 Table 10.4: Systems biology of foodborne botulism: a system of interacting components and processes. Major System Components

Description of System Processes

Food

Physical properties, contents affecting bacterial processes Growth models

a

Clostridium botulinum (baratii, butyricum, argentinensis)a

PTC production

Quorum sensing affecting growth Gastrointestinal Defensive actions: physical tracta and biochemical properties Defensive actions: prevent colonization in GI tract of healthy adults Binding, translocation across barrier mechanisms

Vasculature and lymphatic systemsb

Cholinergic nerve terminalsb

Other tissues/ organsb

System Subcomponents

References

Nutrients

Ihekwaba et al. (2015a); Syamaladevi et al. (2016) Ihekwaba et al. (2015b)

Metabolic and reproductive paths PTC: BoNT, HAs, NTNH

Quorum sensing signaling pathways Proteolytic enzymes Host microbiome

Epithelial cells

Benefield et al. (2013); Fujinaga et al. (2013); Ihekwaba et al. (2015a) Ihekwaba et al. (2015a) Giuffrida et al. (2014) Gillevet et al. (2010)

Maksymowych and Simpson (2004); Sugawara et al. (2010); Sugawara et al. (2015) BoNT-induced secondary Transcriptome changes in Thirunavukkarasu et al. changes epithelial cell culture (2011) Translocation across barrier Endothelial cells Park and Simpson (2003); Miyashita et al. (2014) Elimination of BoNT by other BoNT transported via blood to Lebeda et al. (2010b); tissues liver and other organs Sepulveda et al. (2010) Potential reservoir Endothelial cells Al-Saleem et al. (2008); compartments Lebeda et al. (2008); Lebeda and Adler (2010) Binding to terminals Receptors for BoNT HCC binding Rummel (2015) Translocation of toxic domain BoNT HCN translocation domain Rossetto et al. (2014) Intoxication mechanism; BoNT LC catalytic domain: Lebeda et al. (2010a); persistence proteolysis of substrates, Tsai et al. (2010) kinetics Recovery from intoxication Intraneuronal destruction by Tsai et al. (2010) proteasome BoNT-induced secondary Neurite sprouts; transcriptome Rogozhin et al. (2008); changes changes in neuronal culture Scherf et al. (2014) Cleavage of substrates SNARE substrates; synaptic Jurasinski et al. (2001); involved in vesicle mediated vesicles; readily releasable pool Meunier et al. (2003); neurotransmission Binz (2013) BoNT-induced secondary Transcriptome changes in Mukund et al. (2014) changes muscle

BoNT, Botulinum neurotoxin; GI, gastrointestinal tract; PTC, progenitor toxin complex. a Specifically related to foodborne botulism. b May occur with all types of botulism.

300  Chapter 10 of clinical diagnosis rests on clinical management decisions and public health interventions (Sobel, 2005). Perhaps the most important benefits of predictive models would be to make improvements in the life-saving recognition process and to provide assessments of treatment measures and diseases prognoses. Accurate PB-PK-PD models from a systems perspective could allow predictions to be made for the progression of the disease if therapeutic interventions were not administered. It would then be possible to access the effectiveness of the therapies received by a patient. The clinical course of the disease, specifically times-tosymptom onset, times-to-peak paralysis, duration and recovery times, for a patient could also be an outcome for developing more advanced or refined prognoses. Costs for patient care could also be affected by these models by helping to reduce durations of ventilatory support and other treatments, and the time spent in emergency departments, intensive care units, and rehabilitation facilities.

10 Disclaimer The views, opinions, and/or findings contained in this report are those of the authors and should not be construed as official Department of the Army, Johns Hopkins University or Uniformed Services University of the Health Sciences position, policy, or decision, unless so designated by other official documentation.

Acknowledgments This chapter was supported in part by the Defense Threat Reduction Agency Award no. CB4080 to Dr. Michael Adler. The authors thank Drs. Kenneth Curley, Eric Johnson, and Bal Ram Singh for valuable discussions and sage advice.

References Abreu, M.T., 2010. Toll-like receptor signalling in the intestinal epithelium: how bacterial recognition shapes intestinal function. Nat. Rev. Immunol. 10, 131–144. Abumrad, N.A., Davidson, N.O., 2012. Role of the gut in lipid homeostasis. Physiol. Rev. 92, 1061–1085. Adler, S., Bicker, G., Bigalke, H., Bishop, C., Blumel, J., Dressler, D., Fitzgerald, J., Gessler, F., Heuschen, H., Kegel, B., Luch, A., Milne, C., Pickett, A., Ratsch, H., Ruhdel, I., Sesardic, D., Stephens, M., Stiens, G., Thornton, P.D., Thurmer, R., Vey, M., Spielmann, H., Grune, B., Liebsch, M., 2010. The current scientific and legal status of alternative methods to the LD50 test for botulinum neurotoxin potency testing. The report and recommendations of a ZEBET Expert Meeting. Altern. Lab. Anim. 38, 315–330. Adler, M., Franz, D.R., 2016. Toxicity of botulinum neurotoxin by inhalation: implications in bioterrorism. In: Salem, H., Katz, S. (Eds.), Aerobiology: The Toxicology of Airborne Pathogens and Toxins. The Royal Society of Chemistry, London, United Kingdom, pp. 167–185. Ahsan, C.R., Hajnóczky, G., Maksymowych, A.B., Simpson, L.L., 2005. Visualization of binding and transcytosis of botulinum toxin by human intestinal epithelial cells. J. Pharmacol. Exp. Ther. 315, 1028–1035. Akbulut, D., Dennis, J., Gent, M., Grant, K., Hope, V., Ohai, C., Mclauchlin, J., Mithani, V., Mpamugo, O., Ncube, F., 2005. Wound botulism in injectors of drugs: upsurge in cases in England during 2004. Euro Surveillances 10 (9), 172–174.

Foodborne Botulism From a Systems Biology Perspective  301 Al-Saleem, F.H., Ancharski, D.M., Ravichandran, E., Joshi, S.G., Singh, A.K., Gong, Y., Simpson, L.L., 2008. The role of systemic handling in the pathophysiologic actions of botulinum toxin. J. Pharmacol. Exp. Ther. 326, 856–863. Alberghina, L., 2007. Systems Biology: Definitions and Perspectives. Springer Science & Business Media, New York, NY. Allerberger, F., 2001. An isolated case of foodborne botulism, Austria 2001. Euro Surveill. 5, 1–2. Amatsu, S., Sugawara, Y., Matsumura, T., Kitadokoro, K., Fujinaga, Y., 2013. Crystal structure of Clostridium botulinum whole hemagglutinin reveals a huge triskelion-shaped molecular complex. J. Biol. Chem. 288, 35617–35625. Anderson, N., Larkin, J., Cole, M., Skinner, G., Whiting, R., Gorris, L., Rodriguez, A., Buchanan, R., Stewart, C., Hanlin, J., 2011. Food safety objective approach for controlling Clostridium botulinum growth and toxin production in commercially sterile foods. J. Food Prot. 74, 1956–1989. Aoki, K.R., 2004. Botulinum toxin: a successful therapeutic protein. Curr. Med. Chem. 11, 3085–3092. Argov, Z., 2009. Neuromuscular transmission disorders caused by toxins and drugs. In: Lisak, R.P., Truong, D.D., Carroll, W.M., Bhidayasiri, R. (Eds.), International Neurology: A Clinical Approach. Wiley-Blackwell, Chichester, West Sussex, UK, pp. 445–446. Badhey, H., Cleri, D., D’amato, R., Vernaleo, J., Veinni, V., Tessler, J., Wallman, A., Mastellone, A., Giuliani, M., Hochstein, L., 1986. Two fatal cases of type E adult food-borne botulism with early symptoms and terminal neurologic signs. J. Clin. Microbiol. 23, 616–618. Bakheit, A., Ward, C., Mclellan, D., 1997. Generalised botulism-like syndrome after intramuscular injections of botulinum toxin type A: a report of two cases. J. Neurol. Neurosurg. Psychiatry 62, 198. Bar-Yam, Y., 2006. Improving the effectiveness of health care and public health: a multiscale complex systems analysis. Am. J. Public Health 96, 459–466. Baranyi, J., Tamplin, M.L., 2004. ComBase: a common database on microbial responses to food environments. J. Food Prot. 67, 1967–1971. Barash, J.R., Hsia, J.K., Arnon, S.S., 2010. Presence of soil-dwelling Clostridia in commercial powdered infant formulas. J. Pediatr. 156, 402–408. Bassal, A., Vasseur, J., Lebert, A., 1993. Measurement of water activity above 100°C. J. Food Sci. 58, 449–452. Benefield, D.A., Dessain, S.K., Shine, N., Ohi, M.D., Lacy, D.B., 2013. Molecular assembly of botulinum neurotoxin progenitor complexes. Proc. Natl. Acad. Sci. USA 110, 5630–5635. Beuchat, L.R., Komitopoulou, E., Beckers, H., Betts, R.P., Bourdichon, F., Fanning, S., Joosten, H.M., Ter Kuile, B.H., 2013. Low–water activity foods: increased concern as vehicles of foodborne pathogens. J. Food Prot. 76, 150–172. Binz, T., 2013. Clostridial neurotoxin light chains: devices for SNARE cleavage mediated blockade of neurotransmission. In: Rummel, A., Binz, T. (Eds.), Botulinum Neurotoxins. Springer-Verlag, Berlin, Germany, pp. 139–157. Blikslager, A.T., Moeser, A.J., Gookin, J.L., Jones, S.L., Odle, J., 2007. Restoration of barrier function in injured intestinal mucosa. Physiol. Rev. 87, 545–564. Botulism. 2015. Neuromuscular Disease Center, University of Washington, St. Louis, MO. Available from: http:// neuromuscular.wustl.edu/nother/bot.htm#clinical. Brasch, J., Harrison, O.J., Honig, B., Shapiro, L., 2012. Thinking outside the cell: how cadherins drive adhesion. Trends Cell Biol. 22, 299–310. Breidenbach, M.A., Brunger, A.T., 2004. Substrate recognition strategy for botulinum neurotoxin serotype A. Nature 432, 925–929. Burr, D.H., Sugiyama, H., 1982. Susceptibility to enteric botulinum colonization of antibiotic-treated adult mice. Infect. Immun. 36, 103–106. Calderón-Alvarado, M., Alvarado-Orozco, J., Herrera-Hernández, E., Martínez-González, G., Miranda-López, R., Jiménez-Islas, H., 2016. Effect of two viscosity models on lethality estimation in sterilization of liquid canned foods. Food Sci. Technol. Int. 22 (6), 496–515. Carter, A.T., Peck, M.W., 2015. Genomes, neurotoxins and biology of Clostridium botulinum Group I and Group II. Res. Microbiol. 166, 303–317.

302  Chapter 10 CDC, 1998. Botulism in the United States, 1899–1996. Handbook for Epidemiologists, Clinicians, and Laboratory Workers. Atlanta, GA, United States. Available from: https://sakai.ohsu.edu/access/content/public/Botulism/ References/handbook.pdf. CDC, 2010. National Notifiable Diseases Surveillance System (NNDSS): foodborne disease outbreak 2011 case definition. Available from: https://wwwn.cdc.gov/nndss/conditions/foodborne-disease-outbreak/casedefinition/2011/. CDC, 2011. CDC Foodborne Outbreak Online Database. Available from: http://wwwn.cdc.gov/ foodborneoutbreaks/. CDC, 2015. National Surveillance of Bacterial Foodborne Illnesses (Enteric Diseases): National Botulism Surveillance . Available from: http://www.cdc.gov/nationalsurveillance/botulism-surveillance.html. Chen, F., Kuziemko, G.M., Stevens, R.C., 1998. Biophysical characterization of the stability of the 150-kilodalton botulinum toxin, the nontoxic component, and the 900-kilodalton botulinum toxin complex species. Infect. Immun. 66, 2420–2425. Cheng, L.W., Onisko, B., Johnson, E.A., Reader, J.R., Griffey, S.M., Larson, A.E., Tepp, W.H., Stanker, L.H., Brandon, D.L., Carter, J.M., 2008. Effects of purification on the bioavailability of botulinum neurotoxin type A. Toxicology 249, 123–129. Cheng, L.W., Stanker, L.H., Henderson, T.D., Lou, J., Marks, J.D., 2009. Antibody protection against botulinum neurotoxin intoxication in mice. Infect. Immun. 77, 4305–4313. Cherington, M., 1998. Clinical spectrum of botulism. Muscle Nerve 21, 701–710. Chertow, D.S., Tan, E.T., Maslanka, S.E., Schulte, J., Bresnitz, E.A., Weisman, R.S., Bernstein, J., Marcus, S.M., Kumar, S., Malecki, J., 2006. Botulism in 4 adults following cosmetic injections with an unlicensed, highly concentrated botulinum preparation. JAMA 296, 2476–2479. Coffield, J., Bakry, N., Carlson, J., Gomella, L., Simpson, L., 1997. In vitro characterization of botulinum toxin types A, C and D action on human tissues: combined electrophysiologic, pharmacologic and molecular biologic approaches. J. Pharmacol. Exp. Ther. 280, 1489–1498. Cooksley, C.M., Davis, I.J., Winzer, K., Chan, W.C., Peck, M.W., Minton, N.P., 2010. Regulation of neurotoxin production and sporulation by a putative agrBD signaling system in proteolytic Clostridium botulinum. Appl. Environ. Microbiol. 76, 4448–4460. Couesnon, A., Molgó, J., Connan, C., Popoff, M.R., 2012. Preferential entry of botulinum neurotoxin A Hc domain through intestinal crypt cells and targeting to cholinergic neurons of the mouse intestine. PLoS Pathog. 8, e1002583. Cox, N., Hinkle, R., 2002. Infant botulism. Am. Fam. Physician 65, 1388–1408. Crane, J.K., 1999. Preformed bacterial toxins. Clin. Lab. Med. 19, 583–599. Dack, G., Hoskins, D., 1942. Absorption of botulinum toxin from the colon of Macaca mulatta. J. Infect. Dis. 71 (3), 260–263. Dahlsten, E., Isokallio, M., Somervuo, P., Lindström, M., Korkeala, H., 2014. Transcriptomic analysis of (group I) Clostridium botulinum ATCC 3502 cold shock response. PloS One 9, 1–13. Dembek, Z.F., 2005. Modeling for bioterrorism incidents. In: Lindler, L.E., Lebeda, F.J., Korch, G. (Eds.), Biological Weapons Defense. Springer Science & Business Media, New York, NY, United States, pp. 23–39. Dembek, Z., Smith, L., Rusnak, J.M., 2007. Botulinum toxin. In: Dembek, Z.F. (Ed.), Medical Aspects of Biological Warfare. Borden Institute, Walter Reed Army Medical Center, Washington, DC, pp. 337–353. Devers, K.G., Nine, J.S., 2010. Autopsy findings in botulinum toxin poisoning. J. Forensic Sci. 55, 1649–1651. Diamond, S.L., Purvis, J., Chatterjee, M., Flamm, M.H., 2013. Systems biology of platelet-vessel wall interactions. Front. Physiol. 4, 229. Dodd, S., Selsby, J., Payne, A., Judge, A., Dott, C., 2005. Botulinum neurotoxin type A causes shifts in myosin heavy chain composition in muscle. Toxicon 46, 196–203. Dressler, D., Adib Saberi, F., 2005. Botulinum toxin: mechanisms of action. Eur. Neurol. 53, 3–9. Duchen, L., Strich, S.J., 1967. Changes in the pattern of motor innervation of skeletal muscle in the mouse after local injection of Clostridium botulinum toxin. J. Physiol. 189, 2P–4P. Duchen, L., Strich, S.J., 1968. The effects of botulinum toxin on the pattern of innervation of skeletal muscle in the mouse. Q. J. Exp. Physiol. Cogn. Med. Sci. 53, 84–89.

Foodborne Botulism From a Systems Biology Perspective  303 Edwards, S.W., Preston, R.J., 2008. Systems biology and mode of action-based risk assessment. Toxicol. Sci. 106, 312–318. Eisele, K.-H., Fink, K., Vey, M., Taylor, H.V., 2011. Studies on the dissociation of botulinum neurotoxin type A complexes. Toxicon 57, 555–565. Eissing, T., Kuepfer, L., Becker, C., Block, M., Coboeken, K., Gaub, T., Goerlitz, L., Jaeger, J., Loosen, R., Ludewig, B., 2011. A computational systems biology software platform for multiscale modeling and simulation: integrating whole-body physiology, disease biology, and molecular reaction networks. Front. Physiol. 2, 1–10. Erbguth, F.J., 2004. Historical notes on botulism, Clostridium botulinum, botulinum toxin, and the idea of the therapeutic use of the toxin. Mov. Disord. 19, S2–S6. Erdal, E., Bartels, F., Binscheck, T., Erdmann, G., Frevert, J., Kistner, A., Weller, U., Wever, J., Bigalke, H., Frevert, J., 1995. Processing of tetanus and botulinum: a neurotoxins in isolated chromaffin cells. Naunyn Schmiedeberg’s Arch. Pharmacol. 351, 67–78. Fernandez, R.A., Carbone, M.L., Sánchez, M.L., Pareja, V., De Jong, L.I.T., Bianco, M.I., 2013. Interference of the developing and toxin production of Clostridium botulinum by Lactobacillus paracasei subspecies paracasei. Int. J. Sci. 10, 87–93. Fogolari, F., Tosatto, S.C., Muraro, L., Montecucco, C., 2009. Electric dipole reorientation in the interaction of botulinum neurotoxins with neuronal membranes. FEBS Lett. 583, 2321–2325. Frazier, W., 1958. Food Microbiology. McGraw-Hill Book Company, New York, NY, United States. Fujinaga, Y., 2010. Interaction of botulinum toxin with the epithelial barrier. J. Biomed. Biotechnol. 2010, 1–9. Fujinaga, Y., Sugawara, Y., Matsumura, T., 2013. Uptake of botulinum neurotoxin in the intestine. In: Rummel, A., Binz, T. (Eds.), Botulinum Neurotoxins. Springer-Verlag, Berlin, Germany, pp. 45–59. Gangarosa, E.J., Donaadio, J.A., Armstrong, R.W., Meyer, K., Brachman, P.S., Dowell, V., 1971. Botulism in the United States, 1899–1969. Am. J. Epidemiol. 93, 93–101. Ganter, M., Bernard, T., Moretti, S., Stelling, J., Pagni, M., 2013. MetaNetX. org: a website and repository for accessing, analysing and manipulating metabolic networks. Bioinformatics 29, 815–816. Gilchrist, C.A., Turner, S.D., Riley, M.F., Petri, W.A., Hewlett, E.L., 2015. Whole-genome sequencing in outbreak analysis. Clin. Microbiol. Rev. 28, 541–563. Gillevet, P., Sikaroodi, M., Keshavarzian, A., Mutlu, E.A., 2010. Quantitative assessment of the human gut microbiome using multitag pyrosequencing. Chem. Biodivers. 7, 1065–1075. Giuffrida, P., Biancheri, P., Macdonald, T.T., 2014. Proteases and small intestinal barrier function in health and disease. Curr. Opin. Gastroenterol. 30, 147–153. Gonzalez-Escalona, N., Thirunavukkarasu, N., Singh, A., Toro, M., Brown, E.W., Zink, D., Rummel, A., Sharma, S.K., 2014. Draft genome sequence of bivalent Clostridium botulinum strain IBCA10-7060, encoding botulinum neurotoxin B and a new FA mosaic type. Genome Announc. 2, e01275-14. Griffin, D. C. 2016. Investigating the Clostridium botulinum neurotoxin production process using a genome-scale metabolic network enhanced surrogate system. Doctoral thesis, University of Surrey, Guildford, United Kingdom. Gu, S., Jin, R., 2013. Assembly and function of the botulinum neurotoxin progenitor complex. In: Rummel, A., Binz, T. (Eds.), Botulinum Neurotoxins. Springer-Verlag, Berlin, Germany, pp. 21–44. Gu, S., Rumpel, S., Zhou, J., Strotmeier, J., Bigalke, H., Perry, K., Shoemaker, C.B., Rummel, A., Jin, R., 2012. Botulinum neurotoxin is shielded by NTNHA in an interlocked complex. Science 335, 977–981. Guyton, A.C., MacDonald, M.A., 1947. Physiology of botulinus toxin. Arch. Neurol. Psych. 57, 578–592. Heckly, R.J., Hildebrand, G., Lamanna, C., 1960. On the size of the toxic particle passing the intestinal barrier in botulism. J. Exp. Med. 111, 745–759. Heinken, A., Thiele, I., 2015. Systems biology of host–microbe metabolomics. Wiley Interdiscip. Rev. Sys. Biol. Med. 7, 195–219. Hennekinne, J.-A., De Buyser, M.-L., Dragacci, S., 2011. Staphylococcus aureus and its food poisoning toxins: characterization and outbreak investigation. FEMS Microbiol. Rev. 36, 815–836. Hill, K.K., Smith, T.J., 2013. Genetic diversity within Clostridium botulinum serotypes, botulinum neurotoxin gene clusters and toxin subtypes. In: Rummel, A., Binz, T. (Eds.), Botulinum Neurotoxins. Springer-Verlag, Berlin, Germany, pp. 1–20.

304  Chapter 10 Horowitz, B.Z., 2005. Botulinum toxin. Crit. Care Clin. 21, 825–839. Ihekwaba, A.E., Mura, I., Malakar, P.K., Walshaw, J., Peck, M.W., Barker, G.C., 2015a. New elements to consider when modelling the hazards associated with botulinum neurotoxin in food. J Bacteriol. 199 (17), 1–21. Ihekwaba, A.E., Mura, I., Peck, M.W., Barker, G., 2015b. The pattern of growth observed for Clostridium botulinum type A1 strain ATCC 19397 is influenced by nutritional status and quorum sensing: a modelling perspective. Pathog. Dis. 73, ftv084. INCOSE, 2016. What is systems engineering?. International Council on Systems Engineering. Available from: http://www.incose.org/AboutSE/WhatIsSE. Inoue, K., Sobhany, M., Transue, T.R., Oguma, K., Pedersen, L.C., Negishi, M., 2003. Structural analysis by X-ray crystallography and calorimetry of a haemagglutinin component (HA1) of the progenitor toxin from Clostridium botulinum. Microbiology 149, 3361–3370. Jankovic, J., 2004. Botulinum toxin in clinical practice. J. Neurol. Neurosurg. Psychiatry 75, 951–957. Josefsson, J.O., Thesleff, S., 1961. Electromyographic findings in experimental botulinum intoxication. Acta Physiol. Scand. 51, 163–168. Jost, W.H., Benecke, R., Hauschke, D., Jankovic, J., Kanˇovský, P., Roggenkämper, P., 2015. Clinical and pharmacological properties of incobotulinum toxin A and its use in neurological disorders. Drug Des. Dev. Ther. 9, 1913–1926. Juliao, P.C., Maslanka, S., Dykes, J., Gaul, L., Bagdure, S., Granzow-Kibiger, L., Salehi, E., Zink, D., Neligan, R.P., Barton-Behravesh, C., 2013. National outbreak of type A foodborne botulism associated with a widely distributed commercially canned hot dog chili sauce. Clin. Infect. Dis. 56, 376–382. Jurasinski, C.V., Lieth, E., Do, A.N.D., Schengrund, C.-L., 2001. Correlation of cleavage of SNAP-25 with muscle function in a rat model of botulinum neurotoxin type A induced paralysis. Toxicon 39, 1309–1315. Kaiko, G.E., Stappenbeck, T.S., 2014. Host–microbe interactions shaping the gastrointestinal environment. Trends Immunol. 35, 538–548. Keesey, J.C., 1989. AAEE minimonograph# 33: electrodiagnostic approach to defects of neuromuscular transmission. Muscle Nerve 12, 613–626. Keller, J., 2006. Recovery from botulinum neurotoxin poisoning in vivo. Neuroscience 139, 629–637. Kemplay, S., Cavanagh, J., 1983. Effects of acrylamide and botulinum toxin on horseradish peroxidase labelling of trigeminal motor neurons in the rat. J. Anat. 137, 477. Keshtgar, A.S., Ward, H.C., Sanei, A., Clayden, G.S., 2007. Botulinum toxin, a new treatment modality for chronic idiopathic constipation in children: long-term follow-up of a double-blind randomized trial. J. Pediatr. Surg. 42, 672–680. Kim, K.-J., Creek, J.M., Crandall, E.D., 1991. Contribution of active Na+ and Cl− fluxes to net ion transport by alveolar epithelium. Respir. Physiol. 85, 245–256. Kongsaengdao, S., Samintarapanya, K., Rusmeechan, S., Wongsa, A., Pothirat, C., Permpikul, C., Pongpakdee, S., Puavilai, W., Kateruttanakul, P., Phengtham, U., 2006. An outbreak of botulism in Thailand: clinical manifestations and management of severe respiratory failure. Clin. Infect. Dis. 43, 1247–1256. Kranjc, B.S., Sketelj, J., D’Albis, A., Erž En, I., 2001. Long-term changes in myosin heavy chain composition after botulinum toxin A injection into rat medial rectus muscle. Invest. Ophthalmol. Vis. Sci. 42, 3158–3164. Lacy, D.B., Tepp, W., Cohen, A.C., Dasgupta, B.R., Stevens, R.C., 1998. Crystal structure of botulinum neurotoxin type A and implications for toxicity. Nat. Struct. Mol. Biol. 5, 898–902. Lam, K.-H., Jin, R., 2015. Architecture of the botulinum neurotoxin complex: a molecular machine for protection and delivery. Curr. Opin. Struct. Biol. 31, 89–95. Lam, K.-H., Yao, G., Jin, R., 2015. Diverse binding modes, same goal: the receptor recognition mechanism of botulinum neurotoxin. Prog. Biophys. Mol. Biol. 117, 225–231. Lamanna, C., Hillowalla, R., Alling, C.C., 1967. Buccal exposure to botulinal toxin. J. Infect. Dis. 117 (4), 327–331. Lebeda, F.J., Adler, M., 2010. Hydrodynamic models for the diffusivity of type A botulinum neurotoxin. Botulinum J. 1, 393–406. Lebeda, F.J., Adler, M., Erickson, K., Chushak, Y., 2008. Onset dynamics of type A botulinum neurotoxin-induced paralysis. J. Pharmacokinet. Pharmacodyn. 35, 251–267.

Foodborne Botulism From a Systems Biology Perspective  305 Lebeda, F.J., Cer, R.Z., Mudunuri, U., Stephens, R., Singh, B.R., Adler, M., 2010a. The zinc-dependent protease activity of the botulinum neurotoxins. Toxins 2, 978–997. Lebeda, F.J., Cer, R.Z., Stephens, R.M., Mudunuri, U., 2010b. Temporal characteristics of botulinum neurotoxin therapy. Expert Rev. Neurother. 10, 93–103. Lederberg, J., 1997. Infectious disease and biological weapons: prophylaxis and mitigation. JAMA 278, 435–436. Lee, K., Gu, S., Jin, L., Le, T.T.N., Cheng, L.W., Strotmeier, J., Kruel, A.M., Yao, G., Perry, K., Rummel, A., 2013. Structure of a bimodular botulinum neurotoxin complex provides insights into its oral toxicity. PLoS Pathog. 9, e1003690. Lee, K., Lam, K.-H., Kruel, A.-M., Mahrhold, S., Perry, K., Cheng, L.W., Rummel, A., Jin, R., 2015. Inhibiting oral intoxication of botulinum neurotoxin A complex by carbohydrate receptor mimics. Toxicon 107, 43–49. Lee, K., Zhong, X., Gu, S., Kruel, A.M., Dorner, M.B., Perry, K., Rummel, A., Dong, M., Jin, R., 2014. Molecular basis for disruption of E-cadherin adhesion by botulinum neurotoxin A complex. Science 344, 1405–1410. L’Hommedieu, C., Stough, R., Brown, L., Kettrick, R., Polin, R., 1979. Potentiation of neuromuscular weakness in infant botulism by aminoglycosides. J. Pediatr. 95, 1065–1070. Li, G., Brown, P.J., Tang, J.X., Xu, J., Quardokus, E.M., Fuqua, C., Brun, Y.V., 2012. Surface contact stimulates the just-in-time deployment of bacterial adhesions. Mol. Microbiol. 83, 41–51. Maksymowych, A.B., Reinhard, M., Malizio, C.J., Goodnough, M.C., Johnson, E.A., Simpson, L.L., 1999. Pure botulinum neurotoxin is absorbed from the stomach and small intestine and produces peripheral neuromuscular blockade. Infect. Immun. 67, 4708–4712. Maksymowych, A.B., Simpson, L.L., 1998. Binding and transcytosis of botulinum neurotoxin by polarized human colon carcinoma cells. J. Biol. Chem. 273, 21950–21957. Maksymowych, A.B., Simpson, L.L., 2004. Structural features of the botulinum neurotoxin molecule that govern binding and transcytosis across polarized human intestinal epithelial cells. J. Pharmacol. Exp. Ther. 310, 633–641. Martin, F.P.J., Dumas, M.E., Wang, Y., Legido-Quigley, C., Yap, I.K., Tang, H., Zirah, S., Murphy, G.M., Cloarec, O., Lindon, J.C., 2007. A top-down systems biology view of microbiome-mammalian metabolic interactions in a mouse model. Mol. Syst. Biol. 3, 112. Matak, I., Lackovic´, Z., 2015. Botulinum neurotoxin type A: actions beyond SNAP-25? Toxicology 335, 79–84. Matsumura, T., Sugawara, Y., Yutani, M., Amatsu, S., Yagita, H., Kohda, T., Fukuoka, S.-I., Nakamura, Y., Fukuda, S., Hase, K., 2015. Botulinum toxin: a complex exploits intestinal M cells to enter the host and exert neurotoxicity. Nat. Commun. 6, 6255. May, A., Whaler, B., 1958. The absorption of Clostridium botulinum type A toxin from the alimentary canal. Br. J. Exp. Pathol. 39, 307. McCarty, C.L., Angelo, K., Beer, K.D., Cibulskas-White, K., Quinn, K., de Fijter, S., Bokanyi, R., St Germain, E., Baransi, K., Barlow, K., Shafer, G., 2015. Large outbreak of botulism associated with a church potluck meal—Ohio, 2015. Morb. Mortal. Wkly. Rep.: MMWR. 64, 802–803. Meunier, F.A., Lisk, G., Sesardic, D., Dolly, J.O., 2003. Dynamics of motor nerve terminal remodeling unveiled using SNARE-cleaving botulinum toxins: the extent and duration are dictated by the sites of SNAP-25 truncation. Mol. Cell. Neurosci. 22, 454–466. Mezzenga, R., Schurtenberger, P., Burbidge, A., Michel, M., 2005. Understanding foods as soft materials. Nat. Mater. 4, 729–740. Micheel, C.M., Ball, J.R. (Eds.), 2010. Evaluation of Biomarkers and Surrogate Endpoints in Chronic Disease. Institute of Medicine, National Academies Press, Washington, DC. Miller, L.S., Parkman, H.P., Schiano, T.D., Cassidy, M.J., Ter, R.B., Dabezies, M.A., Cohen, S., Fisher, R.S., 1996. Treatment of symptomatic nonachalasia esophageal motor disorders with botulinum toxin injection at the lower esophageal sphincter. Dig. Dis. Sci. 41, 2025–2031. Miyashita, S.-I., Niwa, K., Watanabe, T., Sagane, Y., 2014. Host-cell specificity and transcytosis of nontoxic nonhemagglutinin protein of botulinum neurotoxin serotype D. FEMS Microbiol. Lett. 357, 115–122. Montal, M., 2010. Botulinum neurotoxin: a marvel of protein design. Ann. Rev. Biochem. 79, 591–617. Montecucco, C., 1986. How do tetanus and botulinum toxins bind to neuronal membranes? Trends Biochem. Sci. 11, 314–317.

306  Chapter 10 Montecucco, C., Rossetto, M.B., 2015. On botulinum neurotoxin variability. MBio. 6, e02131-14. Mugnier, J., Jung, G., 1985. Survival of bacteria and fungi in relation to water activity and the solvent properties of water in biopolymer gels. Appl. Environ. Microbiol. 50, 108–114. Mukund, K., Mathewson, M., Minamoto, V., Ward, S.R., Subramaniam, S., Lieber, R.L., 2014. Systems analysis of transcriptional data provides insights into muscle’s biological response to botulinum toxin. Muscle Nerve 50, 744–758. Nakamura, K., Kohda, T., Seto, Y., Mukamoto, M., Kozaki, S., 2013. Improved detection methods by genetic and immunological techniques for botulinum C/D and D/C mosaic neurotoxins. Vet. Microbiol. 162, 881–890. Nakamura, T., Tonozuka, T., Ito, S., Takeda, Y., Sato, R., Matsuo, I., Ito, Y., Oguma, K., Nishikawa, A., 2011. Molecular diversity of the two sugar-binding sites of the β-trefoil lectin HA33/C (HA1) from Clostridium botulinum type C neurotoxin. Arch. Biochem. Biophys. 512, 69–77. Ni, M., Decrulle, A.L., Fontaine, F., Demarez, A., Taddei, F., Lindner, A.B., 2012. Pre-disposition and epigenetics govern variation in bacterial survival upon stress. PLoS Genet. 8, e1003148. Nighot, P.K., Blikslager, A.T., 2010. ClC-2 regulates mucosal barrier function associated with structural changes to the villus and epithelial tight junction. Am. J. Physiol. Gastrointest. Liver Physiol. 299, G449–G456. Park, J.-B., Simpson, L.L., 2003. Inhalational poisoning by botulinum toxin and inhalation vaccination with its heavy-chain component. Infect. Immun. 71, 1147–1154. Parks, O.B., Pociask, D.A., Hodzic, Z., Kolls, J.K., Good, M., 2015. Interleukin-22 signaling in the regulation of intestinal health and disease. Front. Cell Dev. Biol., 3. Peck, M.W., 2009. Biology and genomic analysis of Clostridium botulinum. Adv. Microb. Physiol. 55, 183–320. Peck, M.W., Stringer, S.C., Carter, A.T., 2011. Clostridium botulinum in the post-genomic era. Food Microbiol. 28, 183–191. Pellett, S., Tepp, W.H., Bradshaw, M., Kalb, S.R., Dykes, J.K., Lin, G., Nawrocki, E.M., Pier, C.L., Barr, J.R., Maslanka, S.E., 2016. Purification and characterization of botulinum neurotoxin FA from a genetically modified Clostridium botulinum strain. mSphere 1, 1–18. Pham, Q., 1987. Calculation of bound water in frozen food. J. Food Sci. 52, 210–212. Pham, Q.T., 2006. Modelling heat and mass transfer in frozen foods: a review. Int. J. Refrig. 29, 876–888. Postmes, T., Van Den Bogaard, A., Hazen, M., 1995. The sterilization of honey with cobalt 60 gamma radiation: a study of honey spiked with spores of Clostridium botulinum and Bacillus subtilis. Experientia 51, 986–989. Rafferty, K.L., Liu, Z.J., Ye, W., Navarrete, A.L., Nguyen, T.T., Salamati, A., Herring, S.W., 2012. Botulinum toxin in masticatory muscles: short-and long-term effects on muscle, bone, and craniofacial function in adult rabbits. Bone 50, 651–662. Ramirez-Castaneda, J., Jankovic, J., Comella, C., Dashtipour, K., Fernandez, H.H., Mari, Z., 2013. Diffusion, spread, and migration of botulinum toxin. Mov. Disord. 28, 1775–1783. Ravichandran, E., Gong, Y., Al Saleem, F.H., Ancharski, D.M., Joshi, S.G., Simpson, L.L., 2006. An initial assessment of the systemic pharmacokinetics of botulinum toxin. J. Pharmacol. Exp. Ther. 318, 1343–1351. Rechtin, E., 1992. The art of systems architecting. Spectrum, IEEE 29, 66–69. Rodgers, S., Peiris, P., Casadei, G., 2003. Inhibition of nonproteolytic Clostridium botulinum with lactic acid bacteria and their bacteriocins at refrigeration temperatures. J. Food Prot. 66, 674–678. Rogozhin, A., Pang, K., Bukharaeva, E., Young, C., Slater, C., 2008. Recovery of mouse neuromuscular junctions from single and repeated injections of botulinum neurotoxin A. J. Physiol. 586, 3163–3182. Rossetto, O., Megighian, A., Scorzeto, M., Montecucco, C., 2013. Botulinum neurotoxins. Toxicon 67, 31–36. Rossetto, O., Pirazzini, M., Montecucco, C., 2014. Botulinum neurotoxins: genetic, structural and mechanistic insights. Nat. Rev. Microbiol. 12, 535–549. Rummel, A., 2013. Double receptor anchorage of botulinum neurotoxins accounts for their exquisite neurospecificity. In: Rummel, A., Binz, T. (Eds.), Botulinum Neurotoxins. Springer-Verlag, Berlin, Germany, pp. 61–90. Rummel, A., 2015. The long journey of botulinum neurotoxins into the synapse. Toxicon 107, 9–24. Scallan, E., Hoekstra, R.M., Angulo, F.J., Tauxe, R.V., Widdowson, M.-A., Roy, S.L., Jones, J.L., Griffin, P.M., 2011. Foodborne illness acquired in the United States—major pathogens. Emerg. Infect. Dis. 17 (1), 7–15.

Foodborne Botulism From a Systems Biology Perspective  307 Scherf, J.M., Hu, X.S., Tepp, W.H., Ichtchenko, K., Johnson, E.A., Pellett, S., 2014. Analysis of gene expression in induced pluripotent stem cell-derived human neurons exposed to botulinum neurotoxin A subtype 1 and a type A atoxic derivative. PloS One 9, e111238. Schmidhuber, J., Tubiello, F.N., 2007. Global food security under climate change. Proc. Natl. Acad. Sci. USA 104, 19703–19708. Sepulveda, J., Mukherjee, J., Tzipori, S., Simpson, L.L., Shoemaker, C.B., 2010. Efficient serum clearance of botulinum neurotoxin achieved using a pool of small antitoxin binding agents. Infect. Immun. 78, 756–763. Shapiro, R.L., Hatheway, C., Swerdlow, D.L., 1998. Botulism in the United States: a clinical and epidemiologic review. Ann. Intern. Med. 129, 221–228. Sharma, D.K., 1999. Toxin production by Clostridium botulinum. Doctoral thesis, University of East Anglia, Norwich, United Kingdom. Shirey, T.B., Dykes, J.K., Lúquez, C., Maslanka, S.E., Raphael, B.H., 2015. Characterizing the fecal microbiota of infants with botulism. Microbiome 3, 54. Silva, F.V., Gibbs, P.A., 2010. Nonproteolytic Clostridium botulinum spores in low-acid cold-distributed foods and design of pasteurization processes. Trends Food Sci. Technol. 21, 95–105. Silvaggi, N.R., Boldt, G.E., Hixon, M.S., Kennedy, J.P., Tzipori, S., Janda, K.D., Allen, K.N., 2007. Structures of Clostridium botulinum neurotoxin serotype A light chain complexed with small-molecule inhibitors highlight active-site flexibility. Chem. Biol. 14, 533–542. Simpson, L., 2013. The life history of a botulinum toxin molecule. Toxicon 68, 40–59. Simpson, L.L., 1980. Kinetic studies on the interaction between botulinum toxin type A and the cholinergic neuromuscular junction. J. Pharmacol. Exp. Ther. 212, 16–21. Singh, A., Datta, S., Sachdeva, A., Maslanka, S., Dykes, J., Skinner, G., Burr, D., Whiting, R.C., Sharma, S.K., 2015. Evaluation of an enzyme-linked immunosorbent assay (ELISA) kit for the detection of botulinum neurotoxins A, B, E, and F in selected food matrices. Health Secur. 13, 37–44. Singh, B.R. 2009. Botulinum toxins: the good, bad, and the ugly. Available from: http://earthzine.org/2009/02/10/ botulinum-toxins-the-good-bad-and-the-ugly/. Smith, L.D., 1979. Clostridium botulinum: characteristics and occurrence. Rev. Infect. Dis. 1, 637–641. Sobel, J., 2005. Botulism. Clin. Infect. Dis. 41, 1167–1173. Sobel, J., Tucker, N., Sulka, A., Mclaughlin, J., Maslanka, S., 2004. Foodborne botulism in the United States, 1990–2000. Emerg. Infect. Dis. 10, 1606–1611. Souayah, N., Karim, H., Kamin, S., McArdle, J., Marcus, S., 2006. Severe botulism after focal injection of botulinum toxin. Neurology 67, 1855–1856. Sugawara, Y., Iwamori, M., Matsumura, T., Yutani, M., Amatsu, S., Fujinaga, Y., 2015. Clostridium botulinum type C hemagglutinin affects the morphology and viability of cultured mammalian cells via binding to the ganglioside GM3. FEBS J. 282, 3334–3347. Sugawara, Y., Matsumura, T., Takegahara, Y., Jin, Y., Tsukasaki, Y., Takeichi, M., Fujinaga, Y., 2010. Botulinum hemagglutinin disrupts the intercellular epithelial barrier by directly binding E-cadherin. J. Cell Biol. 189, 691–700. Sullivan, N.M., Mills, D.C., Riemann, H.P., Arnon, S.S., 1988. Inhibition of growth of Clostridium botulinum by intestinal microflora isolated from healthy infants. Microbial Ecol. Health Dis. 1, 179–192. Swenson, J., Thornsberry, C., McCroskey, L., Hatheway, C., Dowell, V., 1980. Susceptibility of Clostridium botulinum to thirteen antimicrobial agents. Antimicrob. Agents Chemother. 18, 13–19. Syamaladevi, R.M., Tang, J., Villa-Rojas, R., Sablani, S., Carter, B., Campbell, G., 2016. Influence of water activity on thermal resistance of microorganisms in low-moisture foods: a review. Compr. Rev. Food Sci. Food Saf. 15, 353–370. Takahashi, M., Kameyama, S., Sakaguchi, G., 1990. Assay in mice for low levels of Clostridium botulinum toxin. Int. J. Food Microbiol. 11, 271–277. Tang-Liu, D., Aoki, K.R., Dolly, J.O., De Paiva, A., Houchen, T.L., Chasseaud, L.F., Webber, C., 2003. Intramuscular injection of 125I-botulinum neurotoxin-complex versus 125I-botulinum-free neurotoxin: time course of tissue distribution. Toxicon 42, 461–469.

308  Chapter 10 Tauxe, R.V., Doyle, M.P., Kuchenmüller, T., Schlundt, J., Stein, C., 2010. Evolving public health approaches to the global challenge of foodborne infections. Int. J. Food Microbiol. 139, S16–S28. Thiele, I., Heinken, A., Fleming, R.M., 2013. A systems biology approach to studying the role of microbes in human health. Curr. Opin. Biotechnol. 24, 4–12. Thirunavukkarasu, N., Ghosal, K.J., Kukreja, R., Zhou, Y., Dombkowski, A., Cai, S., Singh, B.R., 2011. Microarray analysis of differentially regulated genes in human neuronal and epithelial cell lines upon exposure to type A botulinum neurotoxin. Biochem. Biophys. Res. Commun. 405, 684–690. Tighe, A.P., Schiavo, G., 2013. Botulinum neurotoxins: mechanism of action. Toxicon 67, 87–93. Tsai, Y.C., Maditz, R., Kuo, C.-l., Fishman, P.S., Shoemaker, C.B., Oyler, G.A., Weissman, A.M., 2010. Targeting botulinum neurotoxin persistence by the ubiquitin-proteasome system. Proc. Natl. Acad. Sci. USA 107, 16554–16559. Tsai, Y.C., Moller, B.E., Adler, M., Oyler, G.A., 2014. Molecular basis for persistence of botulinum neurotoxin: the role of intracellular protein degradation pathways. In: Foster, K.A. (Ed.), Molecular Aspects of Botulinum Neurotoxin. Springer, New York, NY, United States, pp. 191–205. Tseng, C.-K., Tsai, C.-H., Tseng, C.-H., Tseng, Y.-C., Lee, F.-Y., Huang, W.-S., 2009. An outbreak of foodborne botulism in Taiwan. Int. J. Hyg. Environ. Health 212, 82–86. Ungchusak, K., Chunsuttiwat, S., Braden, C., Aldis, W., Ueno, K., Olsen, S., Wiboolpolprasert, S., 2007. The need for global planned mobilization of essential medicine: lessons from a massive Thai botulism outbreak. Bull. World Health Organ. 85, 238–240. Uymaz, B., Akkoç, N., Akçelik, M., 2011. Partial characterization of bacteriocins produced by two Lactobacilus strains with probiotic properties. Acta Biol. Hung. 62, 95–105. Vaillant, V., Valk, H.D., Baron, E., Ancelle, T., Colin, P., Delmas, M.-C., Dufour, B., Pouillot, R., Strat, Y.L., Weinbreck, P., 2005. Foodborne infections in France. Foodborne Pathog. Dis. 2, 221–232. Van Regenmortel, M.H., 2004. Reductionism and complexity in molecular biology. EMBO Rep. 5, 1016–1020. Weisemann, J., Stern, D., Mahrhold, S., Dorner, B.G., Rummel, A., 2016. Botulinum neurotoxin serotype A recognizes its protein receptor SV2 by a different mechanism than botulinum neurotoxin B synaptotagmin. Toxins 8, 154. Whitehouse, C., Schmaljohn, A., Dembek, Z., 2007. Emerging infectious diseases and future threats. In: Dembek, Z.F. (Ed.), Medical Aspects of Biological Warfare. Borden Institute, Walter Reed Army Medical Center, Washington, DC, pp. 579–607. Wilder-Kofie, T.D., Lúquez, C., Adler, M., Dykes, J.K., Coleman, J.D., Maslanka, S.E., 2011. An alternative in vivo method to refine the mouse bioassay for botulinum toxin detection. Comp. Med. 61, 235–242. Yamashita, S., Yoshida, H., Uchiyama, N., Nakakita, Y., Nakakita, S.-i., Tonozuka, T., Oguma, K., Nishikawa, A., Kamitori, S., 2012. Carbohydrate recognition mechanism of HA70 from Clostridium botulinum deduced from X-ray structures in complexes with sialylated oligosaccharides. FEBS Lett. 586, 2404–2410. Yao, G., Zhang, S., Mahrhold, S., Lam, K.-h., Stern, D., Bagramyan, K., Perry, K., Kalkum, M., Rummel, A., Dong, M., 2016. N-linked glycosylation of SV2 is required for binding and uptake of botulinum neurotoxin A. Nat. Struct. Mol. Biol. 23 (7), 656–662. Yoneyama, T., Miyata, K., Chikai, T., Mikami, A., Suzuki, T., Hasegawa, K., Ikeda, T., Watanabe, T., Ohyama, T., Niwa, K., 2008. Clostridium botulinum serotype D neurotoxin and toxin complex bind to bovine aortic endothelial cells via sialic acid. FEMS Immunol. Med. Microbiol. 54, 290–298. Yuan, J., Inami, G., Mohle-Boetani, J., Vugia, D.J., 2011. Recurrent wound botulism among injection drug users in California. Clin. Infect. Dis. 52, 862–966.

CHAPTE R 11

Pathogenic Biofilm Formation in the Food Industry and Alternative Control Strategies Efstathios E. Giaouris*, Manuel V. Simões** *Department of Food Science and Nutrition, University of the Aegean, Myrina, Lemnos, Greece; **LEPABE, University of Porto, Porto, Portugal

1 Introduction Biofilms are multicellular microbial communities attached to surfaces or associated with interfaces and embedded in self-produced or even acquired hydrated extracellular polymeric matrixes (Davey and O’Toole, 2000; Stoodley et al., 2002). These represent the prevalent way of life for microorganisms in most environments, both natural and man-made ones (Hall-Stoodley et al., 2004). Their development involves the initial attachment of planktonic (free-swimming) bacteria to a surface, followed by replication and production of extracellular polymeric substances (EPS), formation of microcolonies, maturation (development of biofilm architecture), and detachment (Fig. 11.1). Microorganisms switch from planktonic to the biofilm state through a complex and highly regulated mechanism that is influenced by environmental conditions (e.g., low nutrient availability, high-population density, etc.) (O’Toole et al., 2000). Within a biofilm population, cells with diverse genotypes and phenotypes, expressing distinct metabolic pathways, stress responses and other specific biological activities, may be closely placed together (Stewart and Franklin, 2008). Interestingly, many bacteria, including foodborne pathogens, are known to control their metabolism through a process called quorum sensing (QS), in which cells communicate by synthesizing, detecting, and replying to small diffusible signaling molecules called autoinducers (AI) or bacterial pheromones (Skandamis and Nychas, 2012). As biofilms typically contain a high concentration of cells, AI activity and QS cell-density dependent regulation of gene expression have been proposed as essential components of biofilm physiology (Parsek and Greenberg, 2005). The formation of biofilms is believed to offer significant ecological advantages to the enclosed microorganisms, and more particularly: (1) protection from adverse environmental conditions, such as chemical antimicrobial agents, nutritional and oxidative stresses, heat Foodborne Diseases http://dx.doi.org/10.1016/B978-0-12-811444-5.00011-7

309

Copyright © 2018 Elsevier Inc. All rights reserved.

310  Chapter 11

Figure 11.1: Stages of Biofilm Life Cycle. 1, Initial attachment; 2, replication and production of EPS; 3, formation of microcolonies; 4, maturation (development of biofilm architecture); 5, detachment. Each stage of the life cycle in the diagram is paired with a photomicrograph of a developing Pseudomonas aeruginosa biofilm. All photomicrographs are shown in the same scale (Monroe, 2007).

and acid challenges, UV light exposure, pH shifts, osmotic shock, and desiccation (Bridier et al., 2011, 2015; Sanchez-Vizuete et al., 2015), (2) nutrient availability and metabolic cooperativity (Davey and O’Toole, 2000; Jefferson, 2004), and (3) acquisition of new genetic traits, with biofilm communities particularly suited for horizontal gene transfer (Madsen et al., 2012). While the molecular mechanisms involved in the survival of microorganisms on surfaces are not fully known, transcriptional studies have demonstrated that biofilm growth induces the expression of specific sets of genes (Hamilton et al., 2009). This differential gene expression profile in biofilm cells compared to planktonic ones is tightly coordinated by complex genetic networks and depends both on the temporal stage of biofilm development, and also on the spatial localization of the cells within the biofilm (Kuchma and O’Toole, 2000; Martínez and Vadyvaloo, 2014). Biofilms formed on food contact surfaces are of considerable interest in the context of food hygiene, since these may contain both spoilage and pathogenic bacteria and can result in postprocessing contamination, leading to lowered shelf life of products and transmission of diseases (Brooks and Flint, 2008; Shi and Zhu, 2009). Besides the significant incidence of foodborne illness in public health, there are also huge economic costs, which are estimated to exceed $50 billion annually in the United States alone (Scharff, 2012). From an ecological point of view, food processing facilities could be considered as microbial habitats that are constantly disturbed by sanitizing procedures (Valderrama and Cutter, 2013), with the majority

Pathogenic Biofilm Formation in the Food Industry and Alternative Control Strategies  311 of foodborne bacteria able to attach to various surfaces encountered in these areas and form biofilms, where they can persist and survive for long periods, depending on the strain and the surrounding environmental conditions (Winkelströter et al., 2014). Thus, once biofilms have formed in the factory environment, they are difficult to remove, often resulting in persistent and endemic populations (Abdallah et al., 2014; Hall-Stoodley and Stoodley, 2005; Vestby et al., 2009). Interestingly, persistent Listeria monocytogenes strains have been found to present enhanced adhesion within shorter contact times to stainless steel (SS) surfaces compared to nonpersistent strains, promoting their survival in food processing facilities and possibly having an effect on initiation of persistent plant contamination (Lundén et al., 2000). In recent decades, biofilm formation in the food industry by bacterial pathogens, such as Salmonella spp., L. monocytogenes, pathogenic Escherichia coli, Campylobacter spp., Bacillus cereus, and Staphylococcus aureus, has attracted much attention, given that microorganisms within biofilms are protected from sanitizers, increasing the likelihood of survival and subsequent contamination of food (Chmielewski and Frank, 2003). Thus, a unique feature of biofilms is that once these have been developed on food processing facility and equipment surfaces, they are difficult to eradicate, mainly due to their stable and extremely strong matrix. This covers the cells and contains EPS, such as bacterialderived exopolysaccharides and sugars, proteins, lipids, teichoic and nucleic acids, and other minor components. All these provide biofilms with mechanical stability, mediate their strong adhesion to surfaces and form a cohesive, three-dimensional polymer network that interconnects and transiently immobilizes the enclosed cells (Flemming and Wingender, 2010). More generally, the increased resistance of surface-attached microbial communities to antimicrobial agents can be, in parallel, due to the: (1) limitations to the free diffusion of antimicrobial agents through the biofilm matrix; (2) variability in the physical and chemical microenvironments within the biofilm (e.g., varied conditions of pH, osmotic strength, or nutrients), leading to varied levels of metabolic activity of the biofilm cells and also to alteration of sanitizer’s efficiency; (3) adaptive stress responses, resulting from mutations, altered gene expression and also through possible horizontal transfer of genes coding for resistance; and (4) the differentiation of bacterial cells into physiological states less susceptible to treatments (e.g., dormant, viable but not culturable, VBNC, persisters) (Giaouris and Nesse, 2015). There is also growing evidence that interspecies interactions may profoundly increase the resistance of multispecies biofilms to biocides, with particular concern the protection of pathogenic species by resident surface flora when subjected to disinfectant treatments (Sanchez-Vizuete et al., 2015) (Fig. 11.2). Modern food processing provides an environment for biofilm formation on surfaces due to the great complexity of processing equipment (making it difficult to adequately sanitize), mass production of products, lengthy production cycles, and the vast surface areas available for biofilm development (Lindsay and Von Holy, 2006). Materials such as conveyor belts, food crates, and cutting tools are highly subject to contamination, due to their frequent use,

312  Chapter 11

Figure 11.2: Spatial Organization in Mixed-Species Biofilms. B. subtilis NDmed mCherry (elongated cells) displays a specific distribution when grown with different pathogenic partners labeled with green fluorescence protein (GFP): (A) S. enterica; (B) S. aureus; (C) E. coli K12; (D) E. coli SS2 (Sanchez-Vizuete et al., 2015).

and are important contributors to cross-contamination through direct contact with food products (Giaouris et al., 2014). These surfaces are abraded with repeated use and the control of microbial contamination on such food contact materials often requires different cleaning and disinfection approaches. Generally, food-processing plants employing well-designed equipment with effective daily sanitation programs should not have true biofilms on most of the food contact surfaces. However, these can be formed on surfaces that may not receive sufficient exposure to sanitizing chemicals, such as drains, walls and ceilings, pipelines, pumps, valves, gaskets, corners, and joints (also commonly called “dead zones”). Cracks and crevices can also provide hiding sites for microorganisms. All these surfaces could be a reservoir for pathogenic bacteria forming complex multispecies biofilm communities with other environmental microflora, which may help them avoid being removed or inactivated

Pathogenic Biofilm Formation in the Food Industry and Alternative Control Strategies  313 by disinfectants (Liu et al., 2016). An example of this is L. monocytogenes surviving in Pseudomonas biofilms (Puga et al., 2016). Interestingly, a study conducted to determine the presence of S. aureus on food contact surfaces in dairy, meat, and seafood environments and to identify coexisting microbiota confirmed the presence of S. aureus in 6.1% of 422 samples collected, while PCR-denaturing gradient gel electrophoresis (PCR-DGGE) fingerprints of bacterial communities coexisting with S. aureus revealed the presence of bacteria either involved in food spoilage or of concern for food safety in all food environments (Gutiérrez et al., 2012). Similarly, pyrosequencing of 16S rRNA genes of drain water and drain biofilm bacterial communities, in a L. monocytogenes-contaminated food processing environment, yielded 16 phyla dominated by Proteobacteria, Firmicutes, and Bacteroidetes (Dzieciol et al., 2016). Under such conditions, cell-to-cell interactions are inevitable and may ultimately lead to the establishment of dense, complex, and highly structured biofilm populations capable of coordinated and collective behavior (Giaouris et al., 2015). In any food-processing environment, food residues adsorbed on a substratum create conditioning films that can affect, either enhance or reduce, bacterial attachment (Bernbom et al., 2009; Brown et al., 2014; Whitehead et al., 2010). Moreover, bacterial survival and growth may be motivated by the presence of food residues that may increase the resistance of surface-adherent bacteria to various stresses (e.g., desiccation), also rendering sanitization processes ineffective and encouraging cross-contamination (Gram et al., 2007; Kuda et al., 2015). Most chemical cleaning agents used in the food processing industry are alkali or acid compounds that act as detergents for fat/protein and precipitated minerals, respectively (Chmielewski and Frank, 2003). These suspend and dissolve food residues by decreasing surface tension, emulsifying fats, and denaturating proteins and can be used in combination with chelators and anionic wetting agents (compatible with acid or alkali cleaners) (Simões et al., 2010). An effective cleaning procedure should effectively remove food debris and other soils that may contain microorganisms or promote microbial growth, and must also break up or dissolve the EPS matrix associated with the biofilm, so that sanitizing agents can gain access to the viable cells (Gibson et al., 1999). However, surfaces that appear visually clean can still be contaminated with large numbers of viable microorganisms that could contaminate food. Therefore, after removal of food residues and soil, additional disinfection measures are needed to reduce the number of microorganisms present. Disinfection is especially important in food handling environments producing ready-toeat (RTE) foods (e.g., dairy products, fresh produce, smoked fishes). Undoubtedly, if sanitizing procedures are not followed properly, biofilm-producing bacteria may survive and progressively adapt to the environment, which makes them even harder to be removed through conventional sanitizing methods (Chaitiemwong et al., 2010). Disinfection aims to kill microorganisms and, in the food industry, this is traditionally achieved by means of heat (in the form of hot water or steam), and usually by applying a spectrum of liquid chemicals (disinfectants), such as alogens, quaternary ammonium compounds (QACs), amphoteric products, acids, biguanides, iodophores, peroxygens, and

314  Chapter 11 so forth (Holah, 1995; Taylor et al., 1999). Chlorine is commonly applied as a disinfectant in the food industry, mainly as sodium hypochlorite (NaClO), due to its great oxidizing power, which can target many types of bacteria and molds in short contact times (Rossoni and Gaylarde, 2000). However, although chlorine-containing compounds are relatively inexpensive and partly tolerate hard water, these are relatively unstable, can be very corrosive to the equipment, while their reaction with organic matter can produce various toxic disinfection by-products (DBPs), such as trihalomethanes, chloramines, and haloacetic acids, which present potential risks to public health and are also of environmental concern (Meireles et al., 2016b). In addition, conventional cleaning and disinfection strategies employed in food production facilities, including chemical agents and physical treatments, do not proficiently deal with biofilm-related problems and may also contribute to the dissemination of resistance (Yang et al., 2012). Noteworthily, the standards for testing bactericidal activity of chemical disinfectants, such as the European EN 1040 and 1276 quantitative suspension tests (European Standard, 1997a,b), widely utilize planktonic cultures and results do not necessarily reflect the efficacy against biofilm bacteria. It has even been suggested that the action of some biocides might strengthen the attachment of bacteria to a surface, rather than remove or weaken their attachment (Eginton et al., 1998). Such issues have prompted an increasing interest in recent years for the use of additional or alternative disinfectants, for example, enzymes, bacteriophages, ultrasounds, electrolyzed oxidizing water, and ozone (Meireles et al., 2016a,b). Obviously, there is an urgent need to develop novel strategies to control robust biofilms in both industrial and clinical settings. In past years, a wide range of promising approaches have been successfully evaluated in different biofilm model systems (Simões et al., 2010; Teixeira and Rodrigues, 2014). Currently, there is interest in using green biocides and ecofriendly alternatives in food processing environments, because of the potential hazards of synthetic chemical agents both for public health and the environment (Ashraf et al., 2014). The purpose of this chapter is to review the current available knowledge related to pathogenic biofilm formation in the main food industries (meat, dairy, fresh produce, and seafood) and also to provide up-todate data on some promising alternative or supplementary antibiofilm strategies (enzymes, bacteriophages, and quorum-quenching agents).

2  Pathogenic Bacterial Biofilms in the Meat Industry In the meat industry, contamination of products with foodborne pathogenic bacteria is a serious public health concern and often results in product recalls with significant financial loss. As meat consumption increases around the world, so do concerns and challenges to meat hygiene and safety (Sofos and Geornaras, 2010). Meat is typically subjected to bacterial contamination at some point following the slaughter of the animal and further processing (Sofos et al., 1999), with the equipment recognized to be the primary vehicle of crosscontamination throughout the meat processing chain (Buncic et al., 2014). In situ biofilms

Pathogenic Biofilm Formation in the Food Industry and Alternative Control Strategies  315 have been recognized in meat processing environments (Gounadaki et al., 2008; MarouaniGadri et al., 2009; Zhao et al., 2006), while several studies on the bacterial attachment to meat contact surfaces and its implication for meat contamination have been conducted (Giaouris, 2015). Salmonella, one of the most important pathogens transmitted by food, especially chicken meat, can create biofilms on a variety of surfaces (Ben Abdallah et al., 2014; Giaouris et al., 2012). This ability is rigorously regulated by a coordinated and complex program of gene expression and protein activity (Simm et al., 2014), and can be influenced by serotype, cell surface characteristics, environmental conditions, and physicochemical properties of these surfaces (Castelijn et al., 2013; Díez-García et al., 2012; Schonewille et al., 2012). Salmonella uses thin aggregative (curli) fimbriae and produces cellulose as the main biofilm matrix components (De Oliveira et al., 2014; Jain and Chen, 2007; Solomon et al., 2005; Wang et al., 2013a). However, the morphology and chemical composition of these sessile structures may significantly differ between the different strains and also the surrounding conditions (Wang et al., 2013b). Biofilms may play a crucial role in the survival and persistence of salmonellae under unfavorable environmental conditions (Giaouris and Nesse, 2015), such as in animal slaughterhouses and processing plants (Vestby et al., 2009). Interestingly, the in vitro assessment of biofilm formation by 40 S. enterica isolates isolated in pig abattoirs from animal and environmental sources (surfaces in contact and not in contact with meat) showed that the quantity of biofilm formed after incubation at 22°C was significantly higher than at 35°C (Piras et al., 2015). The characteristics of the 172 S. Typhimurium isolates taken from the pork chain for their biofilm-forming abilities on a range of different surfaces, under defined environmental growth conditions, revealed that the majority of strains possessed biofilm-forming capabilities depending on the surface, and also survived in this form high chlorine concentrations (O’Leary et al., 2013). L. monocytogenes is a significant foodborne pathogen that causes listeriosis, a relatively rare but life-threatening disease primarily affecting immunocompromised individuals. This is capable of adhering to and producing biofilms on processing equipment (Valderrama and Cutter, 2013), making it difficult to eliminate from meat-processing environments and allowing potential contamination of the products (Tresse et al., 2007). It persists in food processing plants for years, or even decades, is an important factor in its transmission, and the reason behind a number of human listeriosis outbreaks (Ferreira et al., 2014). Although some researchers have reported that persistent L. monocytogenes strains possess specific characteristics that may facilitate persistence (e.g., ability to adhere to solid surfaces, biofilm formation, and better adaptation to stress conditions), other researchers have not found significant differences between persistent and nonpersistent strains in the phenotypic characteristics that might facilitate persistence (Ferreira et al., 2014; Szlavik et al., 2012). Thus, the increased adhesion and biofilm formation capacity, rather than sanitizer tolerance, has been suggested as the main reason for the persistence of L. monocytogenes strains in retail

316  Chapter 11 deli meat environments (Wang et al., 2015b). On the other hand, a characterization of the genetics of 29 L. monocytogenes isolates obtained from bovine carcasses and beef processing facilities indicated a wide diversity of PFGE profiles of persistent L. monocytogenes isolates, without relation to their adhesion characteristics (Galvão et al., 2012). Also, it was observed that typical stressing conditions of beef processing environments (low levels of nutrients, pH variations, and low temperature) did not enhance the adhesion profile of the isolates (Galvão et al., 2012). Rather strangely, a greater incidence of strong adherence to abiotic surfaces was observed for L. monocytogenes strains isolated from RTE meats than for those isolated from environmental surfaces in meat-processing plants (Gamble and Muriana, 2007). In a simulated RTE meatprocessing environment, L. monocytogenes was able to develop biofilms on a variety of food contact and nonfood contact surfaces and survive at reduced temperatures for up to 5 days, with the types of surface, as well as the presence of soil, found to be major factors in cleanability (Somers and Wong, 2004). L. monocytogenes was present in all parts of a pork slaughter and cutting plant, with low levels of pathogenic strain contamination in the lairage pens (Larivière-Gauthier et al., 2015). These strains may be introduced by shedding pigs and then amplified by the emergence of environmentally adapted strains in the slaughtering and cutting room areas, even after washing and disinfection (Larivière-Gauthier et al., 2015). Noteworthily, L. monocytogenes can also form multispecies biofilms with other meatrelated bacteria, such as Pseudomonas spp., Carnobacterium spp., Enterobacteriaceae, and lactic acid bacteria (LAB), an attitude that can influence both its individual cell counts and resistance against sanitizers (Daneshvar Alavi and Truelstrup Hansen, 2013; Puga et al., 2016; Rodríguez-López et al., 2015). Enterohemorrhagic E. coli (EHEC) are Shiga-toxin producing E. coli (STEC) responsible for foodborne disease outbreaks mainly incriminated in the consumption of contaminated animal food products, vegetables, and watery drinks. These pathogens usually colonize cattle asymptomatically, with high amounts of them to be also discarded in cows’ feces (Munns et al., 2015). Interestingly, STEC are able to survive for prolonged time periods in environments outside their host, with biofilms to be hypothesized to significantly contribute to this (Vogeleer et al., 2014). Different sets of genes encoding for various surface structures are known to be involved in the interactions of STEC with biotic and abiotic surfaces, while most of these structures are expressed under biofilm conditions (Matheus-Guimarães et al., 2014). While meat can be contaminated all along the meat-processing chain, EHEC contamination essentially occurs at the dehiding stage of slaughtering. The extracellular matrix (ECM) is the most exposed part of the skeletal muscles in beef carcasses. Environmental factors, such as the growth medium, temperature, and pH, have been shown to influence EHEC colonization to the main muscle fibrous ECM proteins (i.e., insoluble fibronectin, collagen I, III, and IV, laminin-α2, and elastin), as well as biofilm formation (Chagnot et al., 2013). Among the hundreds of STEC serotypes identified, EHEC mainly belong to O157:H7, but non-O157 can

Pathogenic Biofilm Formation in the Food Industry and Alternative Control Strategies  317 represent 20%–70% of EHEC infections per year. Discrepancies in the colonization abilities among EHEC serogroups to ECM proteins have also been shown (Chagnot et al., 2014). Similarly, potentially human-pathogenic E. coli from the ovine reservoir can form biofilm on various surfaces and at several temperatures relevant for food production and handling, although variation was seen both between and within serotypes (Nesse et al., 2014). In the meat industrial sector, a “high-event period” (HEP) is the time period during which meat plants encounter a higher than usual incidence of E. coli O157:H7 contamination. Meat-processing conditions may be conducive to the attachment of this bacterium onto meat contact surfaces and subsequent biofilm formation (Simpson Beauchamp et al., 2012). However, conditions leading to E. coli O157:H7 long-term existence in meat establishments are not likely to occur when adequate refrigeration and hygienic conditions exist (MarouaniGadri et al., 2010). E. coli O157:H7 attachment to beef contact surfaces has been shown to be affected by the type of soiling matter and temperature (Dourou et al., 2011). The comparison of a collection of E. coli O157:H7 strains, either isolated from HEP beef contamination incidents or being of diverse origin, for biofilm formation and sanitizer tolerance, has shown that the HEP strains were significantly more capable of forming “mature” biofilms, while these biofilms also presented significantly stronger tolerance to sanitation (Wang et al., 2014). These data advocate that biofilm formation and sanitation tolerance could play a role in HEP beef contamination by E. coli O157:H7, which emphasizes the significance of adequate sanitation of food contact surfaces and processing equipment in meat establishments. Microorganisms that withstand disinfection of a meat-processing plant may play a supportive role on E. coli O157:H7 attachment (Marouani-Gadri et al., 2009). For instance, the presence of a meat industry commensal bacterium, Acinetobacter calcoaceticus, was found to influence the spatial spreading of E. coli O157:H7 surface colonization and also favor its biofilm formation (Habimana et al., 2010). Interestingly, the sequence of colonization has been found to determine the composition of mixed biofilms by STEC O157:H7 and O111:H8 strains, with the precolonizer of either serotype to be able to outgrow the other serotype in both planktonic and biofilm phases (Wang et al., 2015a). Such competitive interactions among the various STEC serotypes and their influence on the composition and structure of the mixed biofilms may have potential impacts to food safety and public health. In another study, interspecies interactions sometimes resulted in enhanced biofilm formation by cocultures of bacteria isolated from a meat-processing environment (Røder et al., 2015). The bacterial pathogen Campylobacter jejuni is one of the most frequent causes of bacterial gastrointestinal foodborne infection worldwide and is primarily transmitted via the consumption of contaminated foodstuffs, especially poultry. Compared to other foodborne pathogens, C. jejuni is more fastidious in its growth requirements and is also very susceptible to various environmental stressors (Bronowski et al., 2014). Biofilm formation is suggested to play a significant role in the survival of C. jejuni in the food production and processing

318  Chapter 11 environment (Teh et al., 2014). Interestingly, a comparative genomic analysis, using DNA microarrays, showed that the gene contents of C. jejuni strains that efficiently formed biofilms were different from those that did not, suggesting that biofilm formation might be a lineage specific property, allowing C. jejuni to both survive environmental stress at the slaughterhouse and to attach to the surface of meat (Kudirkienė et al., 2012). C. jejuni’s attachment to surfaces can be facilitated by preestablished biofilms and survival of culturable C. jejuni may be extended in some preestablished biofilms, but these biofilms do not fully explain longterm survival of culturable C. jejuni outside hosts (Hanning et al., 2008). Food soils, such as chicken juice, have been shown to contribute to C. jejuni biofilm formation by covering and conditioning the abiotic surfaces and also as a source of nutrients (Brown et al., 2014). S. aureus is one of the major bacterial agents causing foodborne intoxications in humans through the production of a range of heat stable enterotoxins in various foods (Hennekinne et al., 2012). Meat products can be contaminated by infected food handlers, which can be asymptomatic carriers of enterotoxigenic S. aureus in nose, throat and skin, during slaughter and processing of livestock or by cross contamination during food preparation. The ability of S. aureus to attach to surfaces and create biofilms can allow its survival in hostile environments, such as those of food processing (Giaouris et al., 2015) (Fig. 11.3). For instance, S. aureus isolated from food contact surfaces presented high capacity to adhere and form biofilm on SS and polypropylene surfaces when cultivated in a meat-based broth at 28 and 7°C. Moreover, the biofilm cells were resistant for total removal when submitted to the exposure to sodium hypochlorite (250 mg/L) and peracetic acid (30 mg/L) sanitizers (De Souza et al., 2014). In another study, staphylococci from the food industry were found to differ greatly in their abilities to form biofilms on polystyrene (PS), with this ability to be also positively correlated with biofilm formation on SS and with resistance to QACs (Møretrø et al., 2003). The role of phenol-soluble modulins (PSMs), short, amphipathic, α-helical peptides, on the rapid colonization of wet surfaces by S. aureus and the colonization of fresh meat has also been shown (Tsompanidou et al., 2013).

Figure 11.3: Electromicrographs of S. aureus Cells. Cells adhered onto glass (A) and SS (B) surfaces, visualized by scanning electron microscopy (SEM) (Marques et al., 2007).

Pathogenic Biofilm Formation in the Food Industry and Alternative Control Strategies  319

3  Pathogenic Bacterial Biofilms in the Dairy Industry Milk produced in udder cells is sterile but can be a good growth substrate for contaminating bacteria, due to its high nutrient content. Mainly because of this, dairy plants harbor various microenvironments where many microorganisms can grow, with in situ biofilms well recognized in such environments (Agarwal et al., 2006; Didienne et al., 2012; Guillier et al., 2008; Gunduz and Tuncel, 2006; Latorre et al., 2010; Licitra et al., 2007; Sharma and Anand, 2002). Following inappropriate cleaning of the equipment, bacteria can readily proliferate in milk debris and quickly create biofilms (Jayarao and Wang, 1999). These can be developed almost everywhere; in tanks, pipes, on working surfaces and even on walls and floors (Austin and Bergeron, 1995; Mariani et al., 2007; Somers et al., 2001; Wong, 1998). However, bacteria mainly resist and form biofilms in places that are incompletely reached by conventional sanitizing practices. Thus, crevices and junctions from a sanitized milk processing plant were found to harbor bacteria, such as Pseudomonas spp., Serratia spp., Staphylococcus sciuri, and Stenotrophomonas maltophilia (Cleto et al., 2012). Interestingly, the heat resistance of thermo-resistant streptococci attached to SS was also increased in the presence of milk (Flint et al., 2002). A variety of different microorganisms can also form multispecies biofilms on dairy ultrafiltration and reverse osmosis membranes that can withstand cleaning and disinfection, and be a possible source of milk contamination (Anand and Singh, 2013; Hassan et al., 2010; Tang et al., 2009a,b). Besides this, formation of biofilms in dairy plants can create a number of other serious problems, such as membrane pore blocking, energy costs increases, impedance of heat transfer processes, and biodeterioration of the components of metallic and polymeric systems, resulting in economic losses of billions of dollars each year (Mittelman, 1998). Milk and products derived from it can be also important sources of foodborne pathogens (Oliver et al., 2005). Their presence in milk can be due to direct contact with contaminated sources in the dairy processing environment and/or to excretion from the udder of an infected animal. Entry of foodborne pathogens via contaminated raw milk into dairy processing plants can lead to their persistence in biofilms (Oliver et al., 2005; Poimenidou et al., 2009). These may be a source of postpasteurization contamination of processed milk products and exposure of consumers to pathogenic bacteria. Prevention of the formation of biofilms in the dairy industry is therefore a crucial step in fulfilling the requirement of safe, high-quality milk. It should be noted that the high presence of LAB in dairy environments, mainly ones producing fermented products, such as cheeses, can have a strong antagonistic effect on both the settlement of pathogens on surfaces and their proliferation (Guerrieri et al., 2009; Gutiérrez et al., 2016a; Sambanthamoorthy et al., 2014). L. monocytogenes is commonly encountered in raw milk and nonpasteurized dairy products and as member of biofilm consortia found on surfaces of the milking equipment (Osman et al., 2014). Thus, scanning electron microscopy (SEM) of samples removed directly from

320  Chapter 11

Figure 11.4: SEM Image of Scratches on the Surface of the Bottom Cover of Milk Meter 3-Left (Scale: 1000 nm). Arrows indicate the presence of bacteria associated with these scratches on the plastic material. Reprinted from Latorre, A.A., Van Kessel, J.S., Karns, J.S., Zurakowski, M.J., Pradhan, A.K., Boor, K.J., Jayarao, B.M., Houser, B.A., Daugherty, C.S., Schukken, Y.H., 2010. Biofilm in milking equipment on a dairy farm as a potential source of bulk tank milk contamination with Listeria monocytogenes. J. Dairy Sci. 93 (6), 2792– 2802. Copyright (2010), with permission from Elsevier.

the bottom cover of two milk meters showed the presence of a L. monocytogenes–containing biofilm with cells primarily found in surface scratches (Latorre et al., 2010) (Fig. 11.4). The embodiment of L. monocytogenes strains in raw milk biofilms has also been investigated, with the inclusion of individual strains to raw milk to provoke important changes in the biofilm biomass, in the chemical, as well as in the bacterial community balance (Weiler et al., 2013). However, the added L. monocytogenes strains were not dominant, given that primarily members of the genera Citrobacter and Lactococcus predominated in the bacterial sessile consortium. During food processing, and particularly in cheese manufacturing processes, L. monocytogenes may also be routinely exposed to environments of low pH or high-salt concentration. Interestingly, marked intrastrain variation in response of L. monocytogenes dairy isolates to acid or salt stress has been revealed, with salt adaptation to also enhance the adherence of some strains to PS (Adrião et al., 2008).

Pathogenic Biofilm Formation in the Food Industry and Alternative Control Strategies  321 S. aureus is the main etiological organism responsible for acute and chronic bovine mastitis, the disease that is most costly to the dairy industry worldwide (Budd et al., 2016). The ability of S. aureus to form biofilms is considered to be an important virulence property in the pathogenesis of mastitis (Gomes et al., 2016; Salimena et al., 2016), with the majority of S. aureus strains isolated from the milk of sick cows to be strong biofilm producers (Fabres-Klein et al., 2015). These have also been found to present high resistance to antimicrobials, either planktonically (Zhang et al., 2016a) and/or under biofilm conditions (Melchior et al., 2006). Biofilm formation in S. aureus is usually associated with the production of polysaccharide intercellular adhesin (PIA) and several proteins (Oniciuc et al., 2016). Interestingly, lactose has been found to increase biofilm formation of two clinical S. aureus bovine isolates, predominantly by enhancing PIA production, whereas milk increased biofilm formation through PIA, as well as by increasing production of biofilm-associated proteins (Xue et al., 2014). Interestingly, S. aureus has been shown to adhere on hydrophobic surfaces and survive within preformed biofilm at temperatures prevalent in dairy industries (Pagedar et al., 2010). In another study, approximately 45% of 31 S. aureus pulsotypes isolated from dairy farms had the ability to produce biofilms on at least one surface (PS, SS, rubber, and silicone), indicating possible persistence of this pathogen in the milking environment (Lee et al., 2014b). The application of peracetic acid (PAA, 0.5%) was able to inactivate biofilms of both S. aureus and L. monocytogenes strains (previously isolated from dairy plants) formed on SS, but it was only able to remove adherent cells of S. aureus from PS (Lee et al., 2016). Bacillus and other spore-forming bacteria are of particular concern in the dairy industry, as they can survive pasteurization and form biofilms within milking pipelines and on SS equipment (Burgess et al., 2014; Gopal et al., 2015). In particular, bacilli are routinely isolated from populations attached to processing-equipment surfaces (Lindsay et al., 2006; Parkar et al., 2001). Common controlling approaches include specific cleaning-in-place (CIP) processes, using chemical biocides. However, spores and, to a lesser extent, vegetative cells embedded in biofilms may be protected against inactivation (Ryu and Beuchat, 2005). Interestingly, butyric acid, a free fatty acid that is released during lipolysis of milk fat has been shown to trigger formation of biofilm-related structures, termed bundles, among members of the Bacillus genus (Pasvolsky et al., 2014). B. cereus is an example of a sporeforming, beta hemolytic, motile bacterium commonly contaminating raw milk and milkderived products, such as milk powder and infant food formulas. This is considered a major hygienic problem in the dairy industry, given that besides provoking spoilage, many strains are harmful to humans causing foodborne illness (Andersson et al., 1995). Noteworthily, spores of B. cereus isolates from dairy silo tanks have been found to present extreme resistance to hot alkali (pH > 13) and hot acid (pH 103 CFU/cm2) even after washing these products with water (Silagyi et al., 2009). E. coli O157:H7 was shown to multiply rapidly in fresh spinach lysates, with a growth rate comparable to that in rich culture broth (Carter et al., 2012b). This is especially important since the harvesting and processing of leafy vegetables, such as spinach, inherently injures plant tissue and causes leakage of cell contents onto tools and equipment where biofilms may form. E. coli O157:H7 biofilm formation on Romaine lettuce and spinach leaf surfaces decreased the effectiveness of irradiation and sodium hypochlorite washes (Niemira and Cooke, 2010). Flagella and some other cell superficial structures are significant in the mechanism of initial attachment and in the development of biofilms by a variety of bacteria. Filament-deficient E. coli O157:H7 mutants connected to the spinach leaves and glass surfaces less firmly compared to the wild type strain (Nagy et al., 2015). Aggregative adherence fimbria I (AAF/I) are known to take part in cellular aggregation and biofilm development in human intestine by Shiga toxigenic Enteroaggregative E. coli O104:H4 strain isolated during a major outbreak spread throughout Europe in 2011. These were also found to mediate colonization of spinach and abiotic surface (Nagy et al., 2016). Several species of enteric pathogens produce curli fimbriae, which may affect their interaction with surfaces and other microbes. Strong curli-expressing E. coli O157:H7 strains were more hydrophobic and attached to cabbage and iceberg lettuce surfaces at significantly higher numbers than other weak curliexpressing strains (Patel et al., 2011b). Curli significantly enhanced the first attachment of E. coli O157:H7 to spinach leaves and SS surfaces by 5-fold (Carter et al., 2016). Curli was also needed for E. coli O157:H7 biofilm formation on SS and significantly enhanced biofilm production on glass in Luria–Bertani (LB) no-salt broth. However, this contribution was not observed when cells were grown in sterile spinach lysates. Importantly, curli played an essential role in the formation of mixed biofilm by E. coli O157:H7 and plant-associated microorganisms in spinach-leaf washes (Carter et al., 2016).

5  Pathogenic Bacterial Biofilms in the Seafood Industry Seafood includes finfish (e.g., anchovy, salmon, and tuna), marine mammals (e.g., seal and whale), fish and shellfish eggs (roe), mollusks (e.g., oysters, clams, and mussels) and crustaceans (e.g., shrimp, crab, and lobster). Although seafood consumption is an integral part of a healthy diet, this is not without risk, being responsible worldwide for an important part of foodborne disease outbreaks, caused by a variety of bacteria, viruses, and parasites (Iwamoto et al., 2010). While viruses provoke approximately 50% of these illnesses, bacterial agents are responsible for the most cases of hospitalizations and deaths (Butt et al., 2004).

326  Chapter 11 Fish are surrounded by a continuous layer of mucus, which is the first physical, chemical, and biological barrier to external hazards. Although numerous antibacterial factors, such as immunoglobulins, agglutinins, lectins, lysins, and lysozyme, are included in the mucus composition, skin mucus represents an important portal of entry of pathogenic bacteria, the main disease agents for fish (Benhamed et al., 2014). Some seafood commodities are inherently more risky than others, owing to many factors, including the nature of the environment from which they come, their mode of feeding, the season during which they are harvested, and the way they are prepared and served (Iwamoto et al., 2010). Thus, all seafood may be susceptible to surface or tissue contamination originating from the marine environment. Contamination by pathogens with a human reservoir can occur when growing areas are contaminated with human sewage. Bivalve mollusks (e.g., clams, oysters, mussels, and scallops) can accumulate and concentrate pathogenic microorganisms that are naturally present in harvest waters, such as vibrios, during their feeding, which is accomplished by filtering large volumes of seawater. Undoubtedly, the factor most commonly associated with infection is consumption of raw or undercooked seafood. The composition of the microflora found on seafood processing equipment has been the subject of some studies. In such a study, the microflora adhering to the processing equipment during production and after cleaning and disinfection, in four different fish-processing plants (i.e., cold-smoked salmon, semipreserved herring, and caviar processing plants), was identified (Bagge-Ravn et al., 2003). Results revealed that, overall; many microorganisms that are often isolated from fish were also isolated from the fish-processing plants. However, some selection depending on processing parameters occurred, since halo- and osmo-tolerant organisms dominated in the caviar processing. In addition, the dominant adhering organisms after sanitation were pseudomonads and yeasts independent of the microflora during processing (Bagge-Ravn et al., 2003). In another study, the microflora adhering to processing surfaces in a shrimp factory and a fish processing plant was also identified (GuÐbjörnsdóttir et al., 2005). The predominant bacteria attached to the surfaces were Pseudomonas spp. (66%) in the shrimp factory and Enterobacteriaceae (27%) in the fish factory. Noteworthily, the presence of mixed Pseudomonas spp. was found to significantly enhance the colonization of L. monocytogenes on SS surfaces (GuÐbjörnsdóttir et al., 2005). The microbiota surviving sanitation of conveyor belts in three salmon processing plants was found to be dominated by Gram-negative bacteria and especially Pseudomonas spp. (Langsrud et al., 2016). In addition, a cocktail of bacterial isolates representing all genera isolated from conveyor belts (Listeria, Pseudomonas, Stenotrophomonas, Brochothrix, Serratia, Acinetobacter, Rhodococcus, and Chryseobacterium) formed stable biofilms on SS coupons (12°C, salmon broth) of about 109 CFU/cm2 after 2 days. High-throughput sequencing showed that L. monocytogenes represented 0.1–0.01% of the biofilm population and that Pseudomonas spp. dominated. The common seafood bacterial pathogens able to form biofilms are Vibrio spp., A. hydrophila, Salmonella spp., and L. monocytogenes (Mizan et al., 2015) (Table 11.1). Biofilm forming

Table 11.1: Representative studies and key conclusions on pathogenic biofilms related to seafood.

Vibrio parahaemolyticus

Substratum

Key Conclusions

References

Pacific oyster (Crassostrea gigas) SS coupon (type 302), 96-well PS microtiter plate

Type I pili, type IV pili, and both flagellar systems contribute to V. parahaemolyticus persistence in Pacific oysters, whereas type III secretion systems and phase variation do not. Biofilm formation ability of V. parahaemolyticus is positively correlated with cell surface hydrophobicity, autoinducer (AI-2) production, and protease activity. Strong-biofilmforming strains established thick 3-D structures, whereas poor-biofilm-forming strains produced thin inconsistent biofilms. Biofilm-associated genes were present in almost all the strains, irrespective of other phenotypes. V. parahaemolyticus isolates display variation in colony morphology, alternating between opaque (OP) and translucent (TR) cell types. A diverse repertoire of cell surface elements that participate in determining multicellular architecture is identified. The toxin-coregulated pilus (TCP) of V. cholerae mediates bacterial interactions required for biofilm differentiation on chitinaceous surfaces. Undifferentiated TCP-biofilms have reduced ecological fitnes. In a simple, static culture system, wild type V. cholerae El Tor forms a 3-D biofilm with characteristic water channels and pillars of bacteria. It is suggested that the type IV pilus and flagellum accelerate attachment to the abiotic surface, the flagellum mediates spread along the abiotic surface, and exopolysaccharide is involved in the formation of three-dimensional biofilm architecture. The in vitro ability of V. cholerae to colonize and form mature biofilms on SS with substantial differences between clinical and environmental strains regarding the morphology, exopolysaccharide (VPS) production and developmental time is presented. Environmental scanning electron microscopy (ESEM) was applied to visualize biofilm development. Biofilm production was observed in most of V. cholerae isolates from seafood, and there was no difference in the presence of a biofilm between the smooth and rugose isolates. Multiple QS circuits function in parallel to control virulence and biofilm formation in V. cholerae. In contrast to other bacterial pathogens that induce virulence factor production and/or biofilm formation at high cell density in the presence of QS autoinducers, V. cholerae represses these behaviors at high cell density.

Aagesen et al. (2013) Mizan et al. (2016)

96-well PS microtiter plate V. cholerae

Chitin

Glass coverslip, polyvinylchloride (PVC) microtitre dish SS coupon (type 304)

V. vulnificus

96-well PS microtiter plate Glass test tube, glass coverslip, 96-well filtration plate (plate: PS; filter: nylon mesh) Oyster (Crassostrea This review summarizes the current knowledge of the environmental interactions between V. vulnificus and oysters, including the effects of salinity and temperature on colonization, virginica) uptake, and depuration rates of various phenotypes and genotypes of the bacterium, and host-microbe immunological interactions

Enos-Berlage et al. (2005) Reguera and Kolter (2005) Watnick and Kolter (1999)

FernándezDelgado et al. (2016)

Preeprem et al. (2014) Hammer and Bassler (2003)

Froelich and Oliver (2013)

(Continued)

Pathogenic Biofilm Formation in the Food Industry and Alternative Control Strategies  327

Bacterial Pathogen(s)

Bacterial Pathogen(s)

Substratum Chitin PS plate

Borosilicate tube, 96-well PS microtitre plate 96-well PS microtiter plate

V. cholerae, V. parahaemolyticus, V. vulnificus, and V. fischeri Aeromonas hydrophila

Biotic and abiotic substrata

96-well PS microtiter plate

Key Conclusions QS is a negative regulator of type IV pilus expression, which results in decreased chitin attachment. Starvation or dormancy can alter the efficiency of chitin attachment. Capsular polysaccharide (CPS) expression is shown to inhibit attachment and biofilm formation, which contrast with other studies describing polysaccharides as integral to biofilms in related species. A CPS-deficient mutant formed significantly more biofilm than wild type, due to increased hydrophobicity of the cell surface, adherence to abiotic surfaces, and cell aggregation. Analyzing transcription of the CPS gene cluster revealed that it was activated by SmcR, a QS master regulator, via binding to the upstream region of the cluster. Biofilm development varied among V. vulnificus isolates and was affected by nutrient and glucose concentration, but not by NaCl concentration or temperature under the conditions used in that study. Factors regulated by the QS system play a role in proper biofilm development and maintenance. This review presents the mechanisms and regulation of biofilm formation by Vibrio species, with a focus on V. cholerae, V. parahaemolyticus, V. vulnificus, and V. fischeri. Although many aspects are the same, others differ dramatically.

Aeromonas food isolates (n = 22) were highly variable in their biofilm forming abilities with the majority of them to be weak biofilm producers in 2 different media, TSB and M9 minimal medium supplemented with 0.4% glucose. The majority (81.8%) of isolates produced N-butanoyl homoserine lactone (C4-HSL) and N-hexanoyl homoserine lactone (C6-HSL). SS (type 304) A. hydrophila readily attaches to SS to produce a thin biofilm with a complex 3D structure flow-cell covering 40%–50% of the available surface and producing large microcolonies. AHLdependent QS seems to play a role in biofilm development. 96-well PS More than 0.05% glucose significantly impaired QS, biofilm formation, protease microtiter plate production, and swarming and swimming motility, whereas bacteria treated with 0.05% glucose had activity similar to that of the control (0% glucose). SS, glass and crab Overall, 0%–0.25% salinity enhanced biofilm formation and expression of QS regulatory shell genes in young cultures, whereas these responses were reduced when salinity was >0.25%. In old cultures, salinity at any concentrations (0.1%–3%) induced stress in A. hydrophila.

References Williams et al. (2015) Joseph and Wright (2004) Lee et al. (2013b)

McDougald et al. (2006)

Yildiz and Visick (2009)

Nagar et al. (2015)

Lynch et al. (2002) Jahid et al. (2013) Jahid et al. (2015b)

328  Chapter 11

Table 11.1: Representative studies and key conclusions on pathogenic biofilms related to seafood. (cont.)

Bacterial Pathogen(s) Salmonella spp.

L. monocytogenes, S. Senftenberg, and S. Typhimurium

Key Conclusions Significant differences were found between serovars regarding the abilities to form biofilm on PS (microtiter plate assay) and in the air-liquid interface of nutrient broth (pellicle assay). Strains of serovar Agona and serovar Montevideo were good biofilm producers. Persistent strains were found to produce more biofilm than presumed nonpersisting strains. 96-well PS Seafood isolates of S. Weltevreden produced more biofilm on PS under nutrient limited microtiter plate conditions (1:100 diluted TSB) compared to rich ones (TSB). gcpA is critical for activating cellulose synthesis and biofilm formation both in undiluted and diluted TSB. Biotic and abiotic This review presents important data regarding the occurrence of L. monocytogenes in smoked substrata salmon industry. The main issue for producers is to prevent colonization of the processing environment and spread of the bacteria to products. This should be achieved by the systemic implementation of hygienic measures, including the HACCP approach. 96-well PS Sodium chloride enhanced adherence to a plastic surface and aggregation and strain microtiter plate variation influenced invasiveness of L. monocytogenes strains. SS coupon (type The protective effect of biofilm formation, salt and osmoadaptation on the desiccation 316) survival (43% relative humidity and 15°C) of L. monocytogenes on SS coupons, which in turn increased the potential for cross-contamination to salmon products is shown. PVC microtiter All raw RTE seafood isolates tested (n = 61) were able to form biofilms to various degrees. plate, SS and PVC Biofilm formation by isolates of lineage I was significantly greater than that by isolates of slides lineage II. The ability to form a biofilm is also affected by environmental factors. PVC microtiter The comparison of the ability to form biofilm and resist to the sanitizing effects of BC of plate a persistent and a transient strain of L. monocytogenes isolated from a fish processing plant showed that the persistent strain produced greater amounts of biofilm and EPS than the transient strain, which resulted in greater resistance of the former strain to BC. 96-well PS This work confirmed the presence of L. monocytogenes in raw and processed product microtiter plate (i.e., mussels), and the importance of cross-contamination from external and internal environments. Processing plants had L. monocytogenes pulsotypes that were detected more than once over 6 months. No correlation was found between biofilm-forming ability and persistent isolates. BC-adapted L. monocytogenes biofilm cells were more resistant to the application of SS coupon (type 304), mussel modified atmosphere packaging (rich in CO2) and nisin once they have been transferred (both live and to cooked mussels by contact (simulating cross-contamination), than nonadapted cells. L. cooked) monocytogenes could persist after cross-contamination during the processing of live mussels. Shrimp Attached and colonized Listeria and Salmonella showed significantly greater resistance to heat (50, 60, and 70°C), hypochlorite (100 ppm) and acids (acetic, hydrochloric and lactic acids; pH 4.0) than their planktonic counterparts. There were no significant differences in the survival of planktonic, attached, or colonized cells stored under refrigerated conditions (4°C).

References Vestby et al. (2009)

Bhowmick et al. (2011a) Rørvik (2000)

Jensen et al. (2007) Hansen and Vogel (2011) Takahashi et al. (2009) Nakamura et al. (2013)

Cruz and Fletcher (2011)

Saá Ibusquiza et al. (2011)

Wan Norhana et al. (2009)

Pathogenic Biofilm Formation in the Food Industry and Alternative Control Strategies  329

Listeria monocytogenes

Substratum 96-well PS microtiter plate

330  Chapter 11 pathogens commonly colonize certain types of seafood, such as oysters (Aagesen et al., 2013; Froelich and Oliver, 2013), crabs (Reguera and Kolter, 2005), shrimp (Wan Norhana et al., 2009), and whelks (Inns et al., 2013). Both attachment to, and subsequent colonization of, seafood surfaces by pathogens may reduce the efficacy of methods used in their control. Interestingly, the association of Listeria and Salmonella with shrimp surfaces has been shown to enhance their resistance to heat, chlorine, and acids (Wan Norhana et al., 2010). The genus Vibrio consists of a ubiquitous group of bacteria that is naturally present in aquatic habitats and develops symbiotic or pathogenic associations with eukaryotic hosts. The human-pathogenic marine bacteria Vibrio parahaemolyticus, V. cholerae, and V. vulnificus are strongly correlated with water temperature, with concentrations increasing as waters warm seasonally. These bacteria can be concentrated in filter-feeding shellfish, especially oysters (Froelich and Noble, 2016). Biofilms formed by pathogenic Vibrio strains pose serious problems to marine aquaculture. These bacteria are known to adhere to several substrates in the environment, including chitin, one of the most abundant polymers in the ocean, being the major constituent of the exoskeleton of shellfish (e.g., crabs, lobsters, shrimps, and oysters). Chitinous substrates are therefore considered to play a pivotal role in the survival and persistence of vibrios, serving as a critical reservoir for pathogens such as V. cholerae (Vezzulli et al., 2010). Diatoms are abundant in estuarine waters and some species produce chitin as a component of the silica cell wall or as extracellular fibrils. Diatom blooms may harbor high concentrations of V. parahaemolyticus, leading to its environmental persistence (Frischkorn et al., 2013). Numerous studies have shown that the capability of vibrios to create biofilms is dependent on specific structural genes (pili, flagella, and exopolysaccharide synthesis) and regulatory mechanisms (two-component regulators, QS, and c-di-GMP signaling) (Yildiz and Visick, 2009). V. parahaemolyticus is a marine microorganism that causes acute gastroenteritis connected to the consumption of contaminated raw or undercooked seafood. During infection, the bacterium utilizes a wide variety of virulence factors, including adhesins, toxins, and type III secretion systems, to cause enterotoxicity in animal models (Zhang and Orth, 2013). Biofilmassociated genes were present in almost all of 22 V. parahaemolyticus seafood isolates, with the strong-biofilm-forming ones to establish thick 3-D structures (Mizan et al., 2016). These results indicate that biofilm formation on seafood may constitute a major factor in the dissemination of V. parahaemolyticus and the ensuing disease (Mizan et al., 2016). Seafood has been identified as an important source of V. cholerae, a versatile bacterium that flourishes in diverse environments, including the human intestine, rivers, lakes, estuaries, and the ocean. This is a human pathogen responsible for the diarrheal disease of cholera and has been studied as a model organism for understanding biofilm formation in environmental pathogens (Fig. 11.6). V. cholerae spends much of its life cycle outside of the human host in the aquatic environment, with biofilm formation to increase its survival in natural habitats

Pathogenic Biofilm Formation in the Food Industry and Alternative Control Strategies  331

Figure 11.6: Analysis of V. cholerae Biofilm Formation. (A) Formation of corrugated colony (scale is 0.5 mm), also termed colony biofilm, is dependent on the production of biofilm matrix materials; (B) top–down CLSM view of the biofilm as the central box, and the side view of the biofilm in the adjacent rectangles (scale is 40 µm); (C) pellicle biofilm (scale is 2 mm). Reprinted from Macmillan Publishers Ltd: Teschler, J.K., Zamorano-Sánchez, D., Utada, A.S., Warner, C.J., Wong, G.C., Linington, R.G., Yildiz, F.H., 2015. Living in the matrix: assembly and control of Vibrio cholerae biofilms. Nat. Rev. Microbiol. 13, 255–268, with permission. Copyright (2015).

and its transfer during cholera outbreaks (Teschler et al., 2015; Silva and Benitez, 2016). Many QS systems simultaneously work to regulate virulence and biofilm development in V. cholerae (Hammer and Bassler, 2003). In contrast to other bacterial pathogens that induce virulence factor production and/or biofilm development at high cell population in the presence of QS autoinducers (AIs), V. cholerae represses these phenotypes at high cell population (Hammer and Bassler, 2003). In a simple, static culture system, wild-type V. cholerae El Tor formed a 3-D biofilm with characteristic water channels and pillars of bacteria (Watnick and Kolter, 1999). The in vitro ability of V. cholerae to colonize and form biofilms on SS used in food processing has also been shown (Fernández-Delgado et al., 2016). Biofilm production was observed in most of V. cholerae isolates from seafood, and there was no difference in the presence of a biofilm between the smooth and rugose isolates (Preeprem et al., 2014). V. vulnificus is an opportunistic human pathogen that can cause potentially fatal septicemia after ingestion of undercooked seafood. With a case fatality rate of up to 50%, the majority (95%) of deaths associated with seafood in the United States are caused by this pathogen. V. vulnificus readily associates with chitin, facilitating the persistence of this pathogen in its native environment (Williams et al., 2015). Extracellular polysaccharides, such as lipopolysaccharide and loosely associated exopolysaccharides, are essential for V. vulnificus to form biofilms (Lee et al., 2013b). Capsular polysaccharide (CPS) is considered the primary virulence factor for this organism. Its expression was shown to inhibit attachment and biofilm formation, which contrasted with other studies describing polysaccharides as integral to biofilms in related species (Joseph and Wright, 2004). Similarly, a mutant unable to produce CPS formed significantly more biofilm than wild type, due to increased hydrophobicity of the cell surface, adherence to abiotic surfaces and cell aggregation (Lee et al., 2013b). It has been found that biofilm development by V. vulnificus varied among isolates and was affected

332  Chapter 11 by nutrient and glucose concentration, but not by NaCl concentration or temperature, under the conditions used in that study (McDougald et al., 2006). Like in many other bacteria, factors regulated by the QS system play a role in proper development and maintenance of V. vulnificus biofilm (McDougald et al., 2006). Aeromonas are regarded as opportunistic, as well as primary pathogens of humans and fish, and are associated with gastroenteritis and septicemia in humans. In a retail survey of seafood, motile Aeromonas were found in 66% of shellfish and 34% of finfish. Seafood probably becomes contaminated by Aeromonas spp. through the growing waters and the animals themselves, with many fish species containing Aeromonas spp. in their gut (Aberoum and Jooyandeh, 2010). In a study determining biofilm-forming abilities of 22 Aeromonas isolates, from different food products in India, strains were found to be highly variable in these abilities with the majority of them to be classified as weak biofilm producers in 2 different media, Tryptone Soy Broth (TSB) and M9 minimal medium supplemented with 0.4% glucose (Nagar et al., 2015). A. hydrophila is the most common species of this genus, is present in freshwater and brackish environments and is frequently isolated from raw and processed seafood products (Aberoum and Jooyandeh, 2010; Janda and Abbott, 2010). A. hydrophila biofilm formation and its control are a major concern for food safety because biofilms are related to virulence (Jahid et al., 2013). This bacterium readily attaches to SS to produce a thin biofilm with a complex 3-D structure covering 40%–50% of the available surface and producing large microcolonies (Lynch et al., 2002). A. hydrophila possesses an N-acylhomoserine lactone (AHL)-dependent QS system based on the ahyRI locus. Biofilm development by this bacterium has been shown to be regulated by QS (Lynch et al., 2002). Glucose may be present in food or added as a preservative. More than 0.05% glucose significantly impaired QS, biofilm formation, protease production, and swarming and swimming motility of A. hydrophila (Jahid et al., 2013). In another similar study, the effect of salinity and age of cultures on QS, exoprotease production, and biofilm formation by A. hydrophila on SS, glass, and crab shell as substrates was examined (Jahid et al., 2015b). Overall, 0%–0.25% salinity enhanced biofilm formation and expression of QS regulatory genes in young cultures, whereas these responses were reduced when salinity was >0.25%. In old cultures, salinity at any concentrations (0.1%–3%) induced stress in A. hydrophila. Seafood is not considered the natural habitat of Salmonella except the river fish, but still, the incidence of Salmonella in seafood is in a steady rise (Bhowmick et al., 2011b; Huang et al., 2012; Kumar et al., 2015). Persistent Salmonella strains isolated from Norwegian feed and fishmeal factories were found to produce more biofilm than presumed nonpersisting strains, suggesting that biofilm forming ability may be an important factor for persistence of Salmonella in the factory environment (Vestby et al., 2009). In agreement with studies showing that Salmonella spp. usually produces more biofilm under nutrient-poor conditions

Pathogenic Biofilm Formation in the Food Industry and Alternative Control Strategies  333 (Kostaki et al., 2012; Stepanovic´ et al., 2004), seafood isolates of S. Weltevreden produced more biofilm on PS under nutrient limited conditions (1:100 diluted TSB) compared to rich ones (TSB) (Bhowmick et al., 2011a). L. monocytogenes and other Listeria spp. have been isolated from seafood, while numerous studies have been conducted on the ecology and prevalence of these bacteria in fish processing environments (Hoffman et al., 2003; Leong et al., 2015; Norton et al., 2001; Thimothe et al., 2002, 2004). Noteworthily, L. monocytogenes can persist throughout the salmon production system (Rørvik, 2000). A relatively high incidence of this organism (6%–36%) in RTE cold smoked salmon and other cooked fish products has raised concern about the survival and growth potential of this organism in these food products, as these are not processed further before consumption (Ben Embarek, 1994). While the sources of L. monocytogenes in smoked salmon processing plants have still to be determined, raw salmon does not seem to be an important source. Thus, producers are mainly advised to prevent colonization of the processing environment and spread of the bacteria to products (Rørvik, 2000). L. monocytogenes may be transmitted between slaughter and smoking operations or may be unique to smoking operations (Klaeboe et al., 2006). Many RTE foods, such as cold-smoked fish, contain sodium chloride (NaCl) at concentrations from 2% to 5%, and NaCl is present in the processing environment. Interestingly, NaCl has been found to enhance adherence to a plastic substratum and cellular aggregation (biofilm development) of L. monocytogenes strains (Jensen et al., 2007). The protecting influence of biofilm development, salt and osmoadaptation on the desiccation survival (43% relative humidity and 15°C) of L. monocytogenes on SS coupons, which in turn increased the potential for crosscontamination to salmon products, has also been shown (Hansen and Vogel, 2011). Four smoked fish processing plants were used as a model system to characterize L. monocytogenes contamination patterns in RTE food production environments (Thimothe et al., 2004). L. monocytogenes was isolated from 3.8% of the raw fish samples, 1.3% of the finished product samples, and 12.8% of the environmental samples. Among the environmental samples, L. monocytogenes was found in 23.7% of the samples taken from drains, 4.8% of the samples taken from food contact surfaces, 10.4% of the samples taken from employee contact surfaces (aprons, hands, and door handles), and 12.3% of the samples taken from other nonfood contact surfaces. Takahashi et al. (2009) examined 71 L. monocytogenes strains for their capability to create biofilms and whether this ability is related to strain subtype. All raw RTE seafood isolates tested (n = 61) were able to form biofilms to various degrees. Biofilm formation by L. monocytogenes isolates of lineage I was significantly greater than that by isolates of lineage II. However, isolates of clonal lineages formed different levels of biofilms, indicating that the ability to form a biofilm is also affected by environmental factors. Benzalkonium chloride (BC) is representative QAC that is commonly used for the disinfection of food processing environments. The tolerance of L. monocytogenes isolates

334  Chapter 11 from seafood processing facilities to this chemical has been found to range from 5.5 to 8.5 ppm of BC (Leong et al., 2015). The observation of the capability to create biofilm and withstand the sanitizing effects of BC of a persistent and a transient strain of L. monocytogenes isolated from a fish processing plant showed that the persistent strain produced greater amounts of biofilm and EPS than the transient strain, which resulted in greater resistance of the former strain to BC (Nakamura et al., 2013). The long-term existence of the strain in the fish processing plant might be thus attributable to these properties. However, the analysis of the incidence and biofilm-forming capability of L. monocytogenes in mussel-processing establishments did not show any association between biofilm-forming capability and persistence (Cruz and Fletcher, 2011). The presence of the pathogen was confirmed in both raw and processed product, and the importance of cross-contamination from external and internal environments was also highlighted. In another study, BC-adapted L. monocyogenes biofilm cells were more resistant than nonadapted cells to the application of modified atmosphere packaging (MAP; rich in CO2) and nisin once they have been transferred to cooked mussels by contact (simulating cross-contamination) (Saá Ibusquiza et al., 2011). Results also demonstrated that L. monocytogenes could persist after cross-contamination during the processing of live mussels, with this pathogen to be of concern as a contaminant in live mussels packaged in high-O2 atmospheres. The study of the adhesion and biofilm-forming ability of 26 S. aureus strains previously isolated from fishery products on SS, showed that all strains reached counts higher than 104 CFU/cm2 after 5 h at 25°C. Most strains also presented a biofilm-forming ability higher than S. aureus ATCC 6538, which is a reference strain in bactericidal standard tests (Vázquez-Sánchez et al., 2014). Noteworthily, doses recommended by manufacturers for BC, PAA, and NaClO to disinfect food-contact surfaces were lower than doses for complete biofilm removal under some environmental conditions common in the food industry (Vázquez-Sánchez et al., 2014). It is a common perception that food materials facilitate bacterial adhesion to surfaces (Brown et al., 2014); however, a study has demonstrated that aqueous coatings of food origin may actually reduce bacterial adhesion (Bernbom et al., 2009). Aqueous extract of cod fish muscle displayed significant antiadhesive properties when used for the coating of SS surfaces, with the resulting conditioning film to be able to significantly diminish adhesion of several different bacterial species (Bernbom et al., 2007). The antiadhesive activity of this extract was linked to the formation of a proteinaceous conditioning film, primarily composed of fish tropomyosins. These fibrous proteins formed a considerable antiadhesive conditioning layer on and reduced bacterial adhesion to several different materials including PS, vinyl plastic, SS, and glass (Vejborg et al., 2008). The biofilm-reducing activity did, however, vary depending on the substratum physicochemical characteristics and the environmental conditions studied (Vejborg and Klemm, 2008).

Pathogenic Biofilm Formation in the Food Industry and Alternative Control Strategies  335

6  Alternative Antibiofilm Strategies for Use in the Food Industry 6.1 Enzymes The use of enzymes is an interesting ecofriendly strategy for controlling detrimental biofilms (Table 11.2) (Meireles et al., 2016a). These may have the abilities to: (1) degrade different crucial components of the biofilm matrix, (2) cause cell lysis, (3) interrupt cell-to-cell communication system governing biofilm development and maintenance (Bzdrenga et al., 2016; Grandclément et al., 2016), and (4) catalyze the formation of antimicrobials, promoting thus biofilm disruption (Meireles et al., 2016a; Thallinger et al., 2013). Indeed, the employment of enzymes targeting biofilm cohesion, rather than killing microorganisms, is advantageous as this does not impose any selective pressure on bacteria, limiting the possibility for resistance development. Interestingly, externally secreted enzymes (amylase, trypsin, and lysozyme) are known to be used by decapod crustaceans (e.g., crabs), both for feeding and fouling management (i.e., biofilm removal from their surfaces) (Essock-Burns et al., 2016). There are mainly four types of antibiofilm enzymes: deoxyribonucleases (DNases), polysaccharide-degrading enzymes, proteolytic enzymes, and anti-QS enzymes (Meireles et al., 2016a; Thallinger et al., 2013). Taking into account the specific character of enzymes toward their selective substratum, together with the complex heterogeneous composition of the biofilm matrix, the successful removal of robust biofilms usually requires the use of multienzyme formulations that contain enzymes targeting several different components of EPS (Johansen et al., 1997). Noteworthily, EPS composition can vary between closely related strains and species, and also with growth conditions; thus, empirical testing is necessary to define the most important matrix components before any enzymatic application (Nguyen and Burrows, 2014). For instance, the enzymatic detachment of staphylococcal biofilms has been found to depend on the nature of their constituents and varied between some tested clinical isolates (Chaignon et al., 2007). Several enzyme-based products have already been commercialized for application in the healthcare, food, marine, and biomedical industries (Chaignon et al., 2007; Kristensen et al., 2008; Leroy et al., 2008; Marcato-Romain et al., 2012; Parkar et al., 2004). Bacterial biofilm removal (P. fluorescens) using fungal enzymes has also been shown (Orgaz et al., 2006). Enzymes can enhance biofilm removal efficiency of cleaners. For instance, a novel enzymatic endoscope cleaner was able to reduce more than 99% CFU of S. aureus and P. aeruginosa biofilms and more than 90% their EPS, enabling subsequent complete disinfection (Stiefel et al., 2016). Undoubtedly, the choice of disinfectant or cleaning agent along with the optimum concentration and the time of action are very important when destroying microorganisms (Augustin et al., 2004). Also, food residues can limit the effectiveness of disinfectants, enzymes included. For instance, proteinase disinfectants showed a good effect against P. aeruginosa biofilm when applied in the absence of milk. On the other hand, their efficacy was decreased in the presence of milk (Augustin et al., 2004).

Action

Enzyme Class

Enzyme Applied

Target Biofilm Producer

Surface Material

Effect

References

Anti-QS enzymes

Hydrolase

Lactonase

P. aeruginosa

Polystyrene

Kiran et al. (2011)

Hydrolase

Acylase

Bacteria in a reverse osmosis membrane

Hydrolase

P. aeruginosa and E. coli

Biofilm formation inhibition

Pei and LamasSamanamud (2014)

Hydrolase

Lactonase (expressed by an engineered T7 bacteriophage) DNase

Reverse osmosis membrane (material not specified) Polyvinyl chloride

69%–77% biofilm removal 9.0% biofilm removal

E. faecalis

Polystyrene

Hydrolase

DNase

L. monocytogenes

Polystyrene

Hydrolase

DispersinB

S. epidermidis

Glass

Hydrolase

α-Amylase

S. aureus, S. epidermidis

Polystyrene

Pandion, resinase, spezyme and paradigm used individually Bacteriophage enzyme

P. aeruginosa

Polystyrene

E. coli Ol57:H7

Stainless steel

Bacteriophage enzyme Pronase

E. coli

Plastic pegs

P. fluorescens

Borosilicate glass

Oxidative enzymes

Polysaccharidedegrading enzymes

Proteolytic enzymes Hydrolase

Hydrolase

Hydrolase Hydrolase

Kim et al. (2013)

Biofilm removal

Thomas et al. (2008) 50% biofilm Nguyen and removal Burrows (2014) 40% biofilm Brindle et al. removal (2011) Craigen et al. 79% S. aureus biofilm removal; no (2011) biofilm removal for S. epidermidis 4 log CFU/mL Augustin et al. biofilm removal (2004)

Removal of 2.8 log CFU per stainless steel coupon 99.997% removal 30% biofilm removal

Sharma et al. (2005) Lu and Collins (2007) Orgaz et al. (2007)

336  Chapter 11

Table 11.2: Antibiofilm applications of enzymes, their classification and targets. Reprinted from Meireles, A., Borges, A., Giaouris, E., Simões, M., 2016. The current knowledge on the application of anti-biofilm enzymes in the food industry. Food Res. Int., 86, 140–146, Copyright (2016), with permission from Elsevier.

Enzyme Applied Savinase

Hydrolase

Savinase

Target Biofilm Producer Pseudoalteromonas sp. P. fluorescens

Hydrolase

Endolysin (LysH5)

S. aureus

Polystyrene

Anti QS + Hydrolase proteolytic enzymes

Acylase 1 + proteinase K

Bacteria in a reverse osmosis membrane

Oxidative + polysaccharidedegrading enzymes

Oxidoreductase + hydrolase

Glucose oxidase + lactoperoxidase

S. aureus, S. epidermidis, P. aeruginosa, P. fluorescens

Reverse osmosis membrane (material not specified) Stainless steel

Proteolytic + polysaccharidedegrading enzymes Proteolytic enzyme + shear stress Proteolytic enzymes + ultrasounds Polysaccharidedegrading enzymes + chemical treatment Polysaccharidedegrading enzymes + antibiotic

Hydrolase

Cellulase + pronase P. fluorescens

Borosi ieate glass

Hydrolase

Savinase + shear stress Amyloglucosidase + US α-amylase + buffer with an anionic surfactant

P. aeruginosa

Polyethylene

E. coli

Stainless steel

B. mycoides

Stainless steel

P. aeruginosa

Cellulose fibbers

Hydrolase Hydrolase

Lyase

Alginate lyase + gentamycin

Surface Material Polystyrene Glass wool

Effect Complete biofilm removal 80% biofilm removal 1–3 log biofilm removal 34% biofilm removal

References Leroy et al. (2008)

1–2 log CFU/disc biofilm removal of Staphylococcus; 3 log CFU/disc biofilm removal of Pseudomonas spp. 94% of biofilm removal

Johansen et al. (1997)

Molobela et al. (2010) Gutiérrez et al. (2014) Kim et al. (2013)

Orgaz et al. (2007)

90% biofilm removal 96% biofilm removal 2.98 log CFU/crrr2 biofilm removal

Pechaud et al. (2012) Oulahal-Lagsir et al. (2003) Lequette et al. (2010)

Complete biofilm removal

Alkawash et al. (2006)

Pathogenic Biofilm Formation in the Food Industry and Alternative Control Strategies  337

Enzyme Class Hydrolase

Action

338  Chapter 11 Extracellular DNA (eDNA) is a matrix component of many biofilms, and is therefore an attractive target to combat them (Okshevsky and Meyer, 2014). eDNA is produced by active secretion or controlled cell lysis and its enzymatic degradation can prevent biofilm formation, disperse already preformed biofilms, or sensitize biofilms to antimicrobials (Okshevsky et al., 2015). Thus, DNase I has been reported to block or alter biofilm formation and morphology in various unrelated both Gram-positive and -negative bacteria (Tetz et al., 2009). Biofilms formed in the presence of DNase I (5.0 µg/mL) displayed reduced biomass, decreased viability of bacteria and decreased tolerance to antibiotics (Tetz and Tetz, 2010). The treatment of E. faecalis biofilms with the same enzyme reduced the accumulation of biofilm, implying again a critical role for eDNA in biofilm development (Thomas et al., 2008). In addition to preventing biofilm attachment, Harmsen et al. (2010) showed that the treatment of L. monocytogenes biofilms on glass with DNase I for 18 h removed 80% of the biomass. Similarly, DNase I and proteinase K impaired L. monocytogenes biofilm formation and induce dispersal of preexisting biofilms (Nguyen and Burrows, 2014). Although, DNase I was found to both repress and cause dispersal of S. aureus biofilms, it was not effective to detach S. epidermidis biofilms (Izano et al., 2008). eDNA is also an important component of the C. jejuni biofilm when attached to SS surfaces, in aerobic conditions and on conditioned surfaces (Brown et al., 2015a). Its degradation by exogenous addition of DNase I led to rapid biofilm removal, without loss of C. jejuni viability. Following treatment of a surface with DNase I, C. jejuni was unable to reestablish a biofilm population within 48 h. Similar results were obtained by digesting eDNA with restriction enzymes, suggesting the need for high molecular weight DNA (Brown et al., 2015a). Interestingly, a search of 2791 C. jejuni genomes revealed that almost half of these contains at least one eDNase gene, but only a minority of isolates contains two or three of these eDNase genes, such as C. jejuni strain RM1221 which cannot form biofilms due to the eDNase activity (Brown et al., 2015b). Extracellular polysaccharides are essential in biofilm formation and function (Limoli et al., 2015), while enzymes degrading them have been successfully evaluated against biofilms (Meireles et al., 2016a). Commercially obtainable α-amylase products from a variety of biological origins were capable to quickly disperse biofilms of S. aureus, as well as repress biofilm development (Craigen et al., 2011). These products were also capable of decreasing and dispersing S. aureus cellular aggregates grown in a liquid system (Craigen et al., 2011). Cellulase was effective in partially inhibiting biomass and CFU formation by P. aeruginosa on glass surfaces by degrading the EPS (Loiselle and Anderson, 2003). While cellulase does not provide total inhibition of biofilm formation, this enzyme could be used in combination with other treatments, or other enzymes, to increase its effectiveness. Single and combined polysaccharide-degrading enzymes (pectin esterase, Pronase, and cellulase) were tested in P. fluorescens biofilm removal, evaluating both the cell and biomass removal yields (Orgaz et al., 2007). Among the three single enzymes tested, pectin esterase was the most effective as it removed about three quarters of the biofilm cells. Soluble Pronase removed about 30% of the biofilm biomass and 80% of the cells. Sequential (two-step) treatment with cellulase,

Pathogenic Biofilm Formation in the Food Industry and Alternative Control Strategies  339 pectin esterase, followed by soluble Pronase, resulted in up to 94% biomass removal (Orgaz et al., 2007). DispersinB (DspB) is a naturally occurring noncytotoxic antibiofilm enzyme with β-N-acetylglucosaminidase activity (Kaplan et al., 2003), which has been shown to inhibit and disrupts the integrity of diverse bacterial biofilms (Itoh et al., 2005). In such a study, S. epidermidis biofilms grown in a capillary flow cell and treated with DspB became more deformable and exhibited significant biofilm loss (40%) during the post-treatment shear challenge, imparted through increased fluid flow (Brindle et al., 2011). A-glucanases can limit the cariogenic properties of the dental plaque extracellular polysaccharides (Pleszczyńska et al., 2015). Proteolytic enzymes, such as proteases, can also be used against biofilms. For instance, proteinase K was reported to be an effective dispersant for L. monocytogenes clinical isolates (Franciosa et al., 2009). In studies of S. aureus biofilm formation, initial attachment of strain V329, which expresses biofilm-associated protein (Bap) on its surface, was reduced upon proteinase K treatment, whereas the attachment of strain M556, which lacks Bap, was unaffected (Kumar Shukla and Rao, 2013). Addition of 0.01% trypsin to the attachment medium during L. monocytogenes cells exposure to Buna-N rubber and SS surfaces resulted in a 99.9% reduction in the adhered cell population when compared to controls (Smoot and Pierson, 1998). Treatment of L. monocytogenes with sublethal concentrations of serratiopeptidase (SPEP), an extracellular metalloprotease produced by Serratia marcescens, reduced its ability to form biofilms and also to invade host cells (Longhi et al., 2008). The antibiofilm activities of a set of proteases immobilized on chitosan against biofilm formation by S. aureus has also been shown (Elchinger et al., 2015). Lysostaphin is a glycylglycine endopeptidase which specifically cleaves the pentaglycine cross-bridges found in the staphylococcal peptidoglycan (Kumar, 2008). Wu et al. (2003) showed that lysostaphin not only provoked the killing of S. aureus in biofilms but also damaged the extracellular matrix of its in vitro biofilms on plastic and glass surfaces upon its application at concentrations as low as 1 µg/mL. A commercial protease (Savinase, subtilisin) was the most effective hydrolase in both the prevention of bacterial adhesion of marine Pseudoalteromonas sp. strain on a microtiter plate and the removal of adhered bacteria (Leroy et al., 2008). However, hydrolases could conversely increase bacterial adhesion, depending on enzymatic concentrations and the type of enzymes tested (Leroy et al., 2008). Commercial proteases (Everlase and Savinase) were effective on removing biofilms formed by P. fluorescens on glass wool and degrading the EPS (Molobela et al., 2010). Proteases were shown to have better performances than amylases on biofilm removal. Similar findings were also observed by Huang et al. (2014) who treated an organic-based aging biofilm from a full-scale moving bed biofilm reactor treating pharmaceutical wastewater. Interestingly, Gutiérrez et al. (2014) showed the effective removal of biofilms formed by S. aureus and S. epidermidis through the action of the phage lytic enzyme endolysin LysH5. The discovery that many bacteria use QS circuits to develop biofilms makes it an attractive target for their control (Irie and Parsek, 2008; Lazar, 2011; Simões et al., 2010). Three main

340  Chapter 11 QS systems can be distinguished: the acylhomoserine lactone (AHL) QS circuit in Gramnegative bacteria, the autoinducing peptide (AIP) QS circuit in Gram-positive bacteria and the autoinducer-2 (AI-2) QS circuit in both Gram-negative and -positive bacteria (Brackman and Coenye, 2015). Consequently, two main groups of AHL-disruption enzymes (provoking quorum quenching, QQ) exist: AHL lactonases, which hydrolyse the lactone ring in AHLs, and AHL acylases (syn. AHL amidases), which release a free homoserine lactone and a fatty acid. In addition, AHL oxidoreductase, a novel type of AHL inactivating enzyme, has also been described (Czajkowski and Jafra, 2009). The action of these enzymes provokes the repression of the QS-regulated mechanisms, as degradation products are not able anymore to act as signals. The inclusion of anti-QS enzymes may prevent biofilm reformation (Thallinger et al., 2013). Interestingly, lactonase treatment has been shown to increase antibiotic susceptibility of the biofilms of multidrug resistant P. aeruginosa (MDRPA) strains, as well as a decrease in the production of virulence factors (Kiran et al., 2011). Biofouling is a major problem in membrane-based treatment systems because it causes a flux decline and necessitates an increase in cleaning frequency. Different strategies including physical cleaning and use of antimicrobial chemicals, or even antibiotics, have been tried for reducing membrane biofouling. Enzymes have also been successfully evaluated to remove bacterial biofilms on dairy processing membranes (Anand et al., 2014). The use of QQ enzymes is a potential environmental friendly approach for control of membrane biofouling (Lade et al., 2014). In a flow cell experiment, the direct immobilization of acylase onto a nanofiltration membrane prohibited the formation of mushroom-shaped mature biofilm, due to the reduced secretion of EPS (Kim et al., 2011). In another similar study, 5 µg/mL of acylase I, 100 µg/mL of proteinase K, and a combination of both enzymes (5 µg/mL of acylase I and 100 µg/mL of proteinase K) removed 9.0, 56.6, and 33.7% of the bacteria on a reverse osmosis membrane, respectively (Kim et al., 2013). The use of enzymes for biofilm control in the food industry could consist a promising alternative when the classical CIP procedures, involving chemical agents, are not sufficient in terms of hygiene. For instance, the cleaning efficacy of polysaccharidases and proteolytic enzymes applied against biofilms of 16 foodborne bacterial species was investigated, together with the enzyme effects on the composition of EPS and biofilm removal in a CIP procedure (Lequette et al., 2010). Proteolytic enzymes caused biofilm eradication of a larger range of bacterial species than polysaccharidases. Lequette et al. (2010) compared the efficiency of enzyme treatments to NaOH treatments; a cleaner thoroughly used in current CIP procedures in food industries. NaOH is known to act by weakening the matrix of biofilms, and thus increasing the susceptibility of biofilms to hydrodynamic stresses (Simões et al., 2005). Results showed that cells were equivalently removed by NaOH and enzyme treatments. Nevertheless, NaOH did not remove EPS as sufficiently as enzyme treatments, advocating that cells were efficiently detached by NaOH, while the EPS of the matrix partly stayed on the surface, contrary to the enzyme treatments.

Pathogenic Biofilm Formation in the Food Industry and Alternative Control Strategies  341

6.2 Bacteriophages Bacteriophages (phages) are obligate parasites of bacteria and the most abundant entities on Earth (Campbell, 2003). Adsorption of these viruses to cells through specific surface receptors is followed by infection, that in the case of lytic bacteriophages results in cellular lysis and release of large numbers of phage particles capable of infecting and lysing more cells, thus releasing their progeny (Hagens and Loessner, 2010). The interest on various practical applications of bacteriophages has been increased in the last years, with perhaps the most attention focused on their use to combat foodborne pathogens and improve food safety, in an approach commonly called “phage biocontrol” (Goodridge and Bisha, 2011; Hertwig et al., 2013; Pérez Pulido et al., 2015; Sulakvelidze, 2013). Indeed, commercial products containing phages specific for L. monocytogenes, S. enterica, and E. coli O157:H7 have already been accepted as food preservatives (Bai et al., 2016) and disinfectants on foods and food-processing surfaces, while these are also generally recognized as safe (GRAS) by the US Food and Drug Administration (FDA) and Environmental Protection Agency (EPA), based on their absence of toxicity and any other adverse effects to human health and the environment (FDA, 2006). The European Food Safety Authority (EFSA) consider bacteriophages are biodegradable nontoxic food grade bactericidal agents effective in the elimination of pathogens, however, it is also reported that it is not clear whether bacteriophages can protect food against a recontamination (EFSA, 2012; Gutiérrez et al., 2016b). Despite advances in modern technologies, the food industry is continuously challenged with the threat of microbial contamination. The overuse of antibiotics has further increased this problem, resulting in the emergence of antibiotic-resistant foodborne pathogens. As a result of the search for complementary agents to antibiotics, “phage therapy” has emerged as an effective means to prevent and treat biofilm related infectious diseases (Abedon, 2016; Azeredo and Sutherland, 2008; Danis-Wlodarczyk et al., 2016; Donlan, 2009; Khalifa et al., 2015; Mapes et al., 2016). In parallel, phages and phage-encoded lytic proteins have appeared as novel and safe options for the elimination of foodborne pathogens on both raw and RTE foods, such as fresh produce, cheese and smoked salmon, without affecting their organoleptic quality (i.e., color, taste and appearance) (Boyacioglu et al., 2013; Carter et al., 2012a; Endersen et al., 2014; Perera et al., 2015; Sharma, 2013; Sharma et al., 2009). In addition, encapsulation technologies have been successfully used to protect phages against extreme environmental conditions encountered in many food-processing operations (Hussain et al., 2015). Phage therapy also presents great potential to solve the problem of membrane biofouling (Bhattacharjee et al., 2015). However, successful application of phages requires a detailed understanding of phage-host interactions under both free-living and surfaceassociated growth conditions. Lytic bacteriophages can be efficient biofilm-disrupting agents, with the use of them for biofilm destruction to have gain much interest over the past years (Bhattacharjee et al., 2015;

342  Chapter 11 Donlan, 2009; Gutiérrez et al., 2015a,b, 2016b; Lu and Collins, 2007; Motlagh et al., 2016; Siringan et al., 2011; Son et al., 2010) (Table 11.3). The specificity of bacteriophages for a host bacterium, without affecting anything else, and their ability to propagate at the site of infection distinguishes them from all the other antimicrobials (Campbell, 2003). This specificity enables their use as biocides to inactivate pathogenic or spoilage bacteria in situations that also rely on the presence of natural (technological) flora, for example, in the case of desired fermentation of meat products (Sharma et al., 2005). In addition, the use of bacteriophages in wastewater plants could rapidly target and reduce undesirable bacteria without harming the useful bacteria needed for biodegradation (Jassim et al., 2016). Bacteriophages having human pathogenic bacteria as hosts can be retrieved from natural habitats, such as animal feces and industrial wastes, where the target bacteria may inhabit. The first observation that a bacteriophage can infect and multiply within cells growing as a biofilm was done by Doolittle et al. (1995), who showed the lytic infection of E. coli biofilms created on the surface of polyvinylchloride (PVC) coupons by bacteriophage T4. Experimental studies with bacteriophages and mixtures thereof, expressing lytic properties against numerous biofilm-forming bacterial species showed that bacteriophages may both prevent biofilm formation and contribute to eradication of biofilm bacteria (Chan and Abedon, 2015; Sillankorva and Azeredo, 2014). A specific role is played here by phage depolymerases, enzymes able to degrade polymeric substances, such as the EPS of the biofilm matrixes, facilitating the permeation of bacteriophages into deeper biofilm layers and lysis of the susceptible bacteria (Hughes et al., 1998; Parasion et al., 2014; Yan et al., 2014). A heat-stable bacteriophage-borne polysaccharide depolymerase significantly reduced biofilm formed by Klebsiella (Chai et al., 2014). Noteworthily, 160 putative depolymerases, including sialidases, levanases, xylosidases, dextranases, hyaluronidases, peptidases, as well as pectate/pectin lyases, were found in 143 phages infecting 24 genera of bacteria (Pires et al., 2016). However, despite the accessibility of phages to cells situated deeper into the biofilm structure, bacteriophages preferably infect exponentially growing bacteria (Jamal et al., 2015), such as the newly divided biofilm-surface bacteria, and as thus, may not present sufficient efficiency against persisters and stationary phase bacteria enclosed in biofilms, which have a slow metabolism, resulting in less than complete overall biofilm clearance (Abedon, 2016; Gutiérrez et al., 2016b). It is yet suggested that persister cells can be removed by phage lytic proteins (Gutiérrez et al., 2014), given their ability to easily penetrate into the biofilm structure (Shen et al., 2013). Drawbacks of phages to consider include their narrow host range, the possible resistance of bacteria to some phages and also the possibility of phage-encoded virulence and antibiotic resistance genes to be incorporated into the host bacterial genome. The use of phage mixtures, engineered phages, the combination of phages with other antimicrobials, together with the application of phage endolysins (lysins) could provide effective strategies to overcome these hurdles (Alves et al., 2016; Donlan, 2009; Gong and Jiang, 2015). The latter are hydrolytic enzymes produced by bacteriophages that digest the bacterial cell wall, killing selectively

Table 11.3: Application of bacteriophages and phage proteins for biofilm removal (Gutiérrez et al., 2016b). Bacteria

Efficacy of the Treatment

References

Phages LiMN4L, LiMN4p, and LiMN17 Phage P100

Stainless steel

L. monocytogenes

Stainless steel

L. monocytogenes

Phage P100

Stainless steel

L. monocytogenes

Phage K and phage derivatives

Polystyrene

S. aureus

Ganegama Arachchi et al. (2013) Soni and Nannapaneni (2010) Montañez-Izquierdo et al. (2012) Kelly et al. (2012)

Phage K and DRA88

Polystyrene

S. aureus

Phages ISP, Romulus, and Remus

Polystyrene

S. aureus

Phages philPLA-RODI and philPLA-C1C Phage SAP-26

Polystyrene

S. aureus

Polystyrene

S. aureus

Phage CP8 and CP30

Glass

Phage KH1

Stainless steel

Campylobacter jejuni E. coli O157:H7

BEC8 (phage mixture)

Stainless steel, E. coli O157:H7 ceramic tile, and high density polyethylene Spinach E. coli O157:H7 harvester blade Polystyrene E. coli O157:H7

Phage cocktail reduced biofilm cell counts to undetectable levels after 75 min Reduction in the cell counts from 3.5 to 5.4 log units/ cm2 Reduction of the biofilm cell counts to undetectable levels after 48 h Complete elimination of the biomass after 72 h of incubation. Complete inhibition of biofilm formation was achieved when coculturing phage mixture and bacteria Complete elimination of the biomass after 48 h of treatment Biofilm reduction of 37.8, 34.4, and 60.4% after 24 h treatment when using phages ISP, Romulus, and Remus, respectively Reduction by 2 log units/well was achieved after 8 h of treatment Reduction of bacteria about 28% after phage treatment, while a synergistic effect with rifampicin allows a reduction of about 65% Reduction in the biofilm cell counts of 1–3 log units/ cm2 Reduction of 1.2 log units per coupon after 4 days treatment at 4°C Reduction of the biofilm cell counts to undetectable levels after 1 h of treatment at 37, 23, and 12°C

Reduction of biofilm cell counts by 4.5 log units per blade after 2 h of treatment Complete elimination of the biomass after phage treatment combined with céfotaxime

Patel et al. (2011a)

Phage mixture Phage T4

Alves et al. (2014) Vandersteegen et al. (2013) Gutiérrez et al. (2015b) Rahman et al. (2011)

Siringan et al. (2011) Sharma et al. (2005) Viazis et al. (2011b)

Ryan et al. (2012) (Continued)

Pathogenic Biofilm Formation in the Food Industry and Alternative Control Strategies  343

Scope of Application

Phage or Phage Protein

Scope of Application

Bacteria

Efficacy of the Treatment

References

Endolysin from phage phil 1 Endolysin SAL-2

Polystyrene

S. aureus

Polystyrene

S. aureus

Sass and Bierbaum (2007) Son et al. (2010)

Endolysin LysH5

Polystyrene

S. aureus

Domain CHAPK derived from endolysin LysK

Polystyrene

S. aureus

Chimeric lysin

Polystyrene

S. aureus

Complete elimination of the biomass after 2 h of treatment at 37°C Reduction of the biomass after 2 h of treatment at 37°C Reduction of biofilm cell counts by 1–3 log units after 3 h of treatment Complete elimination of the biomass after 4 h of incubation Complete inhibition of biofilm formation was achieved Reduction of the biomass in more than 60% after 30 min of treatment

ClyH Endolysin Lys68

Polystyrene

S. Typhimurium

Oliveira et al. (2014)

Polystyrene

S. aureus

Reduction of biofilm cell counts by 1 log unit after 2 h of treatment in the presence of outer membrane permeabilizers Degradation of 30% of the polysaccharidic matrix of the biofilm

Phage or Phage Protein

Exopolysaccharide depolymerase Dpo7

Gutiérrez et al. (2014) Fenton et al. (2013)

Yang et al. (2014)

Gutiérrez et al. (2015a)

344  Chapter 11

Table 11.3: Application of bacteriophages and phage proteins for biofilm removal (Gutiérrez et al., 2016b). (cont.)

Pathogenic Biofilm Formation in the Food Industry and Alternative Control Strategies  345 and rapidly (≥3 log CFU in 30 min), while showing a larger host specificity compared to lytic bacteriophages (Fischetti, 2008, 2015). The potential for bacterial resistance to lysins is considered low due to targeting of highly conserved peptidoglycan components (Pastagia et al., 2013). Interestingly, a thermostable Salmonella phage endolysin (Lys68) was able to lyse a wide panel of Gram-negative bacteria (13 different species) in combination with the outer membrane permeabilizers EDTA, citric and malic acid (Oliveira et al., 2014). The broad killing capacity of malic/citric acid-Lys68 was explained by the destabilization and major disruptions of the cell outer membrane integrity due to the acidity caused by the organic acids and a relatively high muralytic activity of Lys68 at low pH. E. coli O157:H7 is a prevalent foodborne pathogen with a low infectious dose. A phage cocktail was effective within an hour against low levels of EHEC O157:H7 strains applied on materials typically used in food processing surfaces [SS, ceramic tile, and high density polyethylene (HDPE)] (Viazis et al., 2011b). In another study, application of a cocktail of specific bacteriophages reduced E. coli O157:H7 populations by 4.5 log CFU on spinach harvester blades after 2 h of treatment (Patel et al., 2011a). Bioprocessing using a phage cocktail of 140 highly lytic designed coliphages was successful in eliminating completely E. coli in all processed food products after 48 h of storage at 4°C. Moreover, E. coli biofilms were reduced >3 log cycles upon using this phage bioprocessing (Jassim et al., 2012). The biocidal effect of three novel phages against three L. monocytogenes strains adhered to SS surfaces (clean and conditioned with fish proteins) and in a biofilm at low temperature was investigated by Ganegama Arachchi et al. (2013). The three phages were effective in controlling L. monocytogenes on SS, either clean or soiled with fish proteins. Phages were more effective on biofilm cells dislodged from the surface compared with undisturbed biofilm cells. The ability of bacteriophage P100 (Listex P100) to reduce L. monocytogenes biofilm cells by using 21 L. monocytogenes strains representing 13 different serotypes was determined (Soni and Nannapaneni, 2010). Irrespective of the serotype, growth conditions, or biofilm levels, the phage P100 treatment significantly reduced L. monocytogenes cell populations under biofilm conditions. In another study, epifluorescence microscopy was used to assess the effectiveness of phage P100 in controlling L. monocytogenes biofilms on SS surfaces (Montañez-Izquierdo et al., 2012) (Fig. 11.7). Despite its efficacy, these authors concluded that phage treatment must be used in combination with other hygienization measures to increase performance. Chaitiemwong et al. (2014) performed a study to simulate the practical situation where a Listeria biofilm is formed in cracks in the equipment and to investigate the effect of two commercial disinfectants, based on chlorine and QAC and a Listex P100 against L. monocytogenes in SS carrier tests with flat and rutted (grooved) surfaces. The presence of grooves or spaces on surfaces, humidity, and presence of food substrates influenced the antimicrobial effect of disinfectants and bacteriophages. Bacteriophages showed a better antimicrobial effect than the chemical disinfectants, in the shallow grooves but not in the deep grooves.

346  Chapter 11

Figure 11.7: Epifluorescence Digital Images of L. monocytogenes Biofilm Cells on SS Surfaces Treated With Phage P100 at 48 h. (A) 5 log PFU/mL, (B) 6 log PFU/mL, (C) 7 log PFU/mL, and (D) 8 log PFU/mL. Viable and nonviable cells stain green and red, respectively (following treatment with LIVE/DEAD BacLight bacterial viability kit). Reprinted from Montañez-Izquierdo, V.Y., Salas-Vázquez, D.I., Rodrígez-Jerez, J.J., 2012. Use of epifluorescence microscopy to assess the effectiveness of phage P100 in controlling Listeria monocytogenes biofilms on stainless steel surfaces. Food Control 23 (2), 470–477. Copyright (2012), with permission from Elsevier.

A study was conducted to investigate the ability of a mixture of phage K and six of its modified derivatives to prevent biofilm formation by S. aureus and also to reduce the established biofilm density (Kelly et al., 2012). Results suggested that established S. aureus biofilms in microtiter plates were eliminated in a time-dependent manner, with biofilm biomass reduction significantly greater after 72 h than after 24–48 h. In addition, initial challenge of S. aureus with the phage cocktail resulted in the complete inhibition of biofilm formation over a 48 h period with no appearance of phage resistance. A significant reduction of biomass of established S. aureus biofilms over 48 h of combined treatment of bacteriophage K with a novel bacteriophage (DRA88) was shown in another study (Alves et al., 2014). The advances in molecular biology and gene engineering can also allow the construction of bacteriophages with an extended host range or longer viability under adverse conditions, enhancing their potential as alternatives to conventional antibiotic and disinfection treatments.

Pathogenic Biofilm Formation in the Food Industry and Alternative Control Strategies  347 For instance, the insertion of active depolymerase genes to their genomes can enforce their antibiofilm potential (Bárdy et al., 2016). Recombinant lysins have been successfully applied against S. aureus biofilms (Sass and Bierbaum, 2007; Yang et al., 2014). For instance, an engineered endolysin (P128), which was constructed to combin the cell wall binding domain of lysostaphin and also the peptidoglycan-degrading murein hydrolase derived from phage K, was shown to be efficient against biofilms of S. aureus (Drilling et al., 2016). The addition of an engineered T7 phage that encoded a lactonase enzyme to mixed-species biofilms containing P. aeruginosa and E. coli resulted in inhibition of biofilm formation (Pei and Lamas-Samanamud, 2014). Such phages that can lyse host bacteria and express QQ enzymes to affect diverse bacteria in biofilm communities may become novel antifouling and antibiofilm agents in both industrial and clinical settings. Despite the positive results, there is evidence in the literature that phage predation can also lead to an increase in bacterial biofilm levels under certain conditions (Heilmann et al., 2012; Lacqua et al., 2006; Gödeke et al., 2011). Thus, the exposure of E. coli MG1655 to environmental bacteriophages resulted in rapid selection for phage-tolerant subpopulations displaying increased biofilm formation (Lacqua et al., 2006). Phage-induced lysis of a fraction of the bacterial population, due to spontaneous phage induction, has been shown to enhance biofilm formation in Shewanella oneidensis through the release of crucial biofilmpromoting factors for the remaining bacterial population, in particular eDNA (Gödeke et al., 2011). Similarly, prophage spontaneous activation promoted DNA release and enhanced biofilm formation in Streptococcus pneumoniae (Carrolo et al., 2010). Filamentous Pf bacteriophages have been shown to promote P. aeruginosa biofilm assembly and function, by converting matrix polymers into viscous liquid crystals (Secor et al., 2015). Fd, a related bacteriophage of E. coli, has similar biofilm-building capabilities (Secor et al., 2015). Biofilms may also act as active phage reservoirs that can entrap and amplify viral particles and protect them from harsh environments (Briandet et al., 2008; Hosseinidoust et al., 2013; Kay et al., 2011; Rossmann et al., 2015; Sutherland et al., 2004; Tan et al., 2015). A study on the spontaneous phage release from biofilm and planktonic lysogenic S. aureus cells revealed that phages were detected over a much longer period in biofilm cultures than in planktonic supernatants because, in the latter case, these were degraded by secreted proteases (Resch et al., 2005). It was also suggested that the resulting lysis of cells in a biofilm might promote the persistence and survival of the remaining cells, as they gain a nutrient reservoir from their dead and lysed neighboring cells.

6.3  Interference with Cell-to-Cell Communication and Quorum Quenching Although much remains to be learned about the involvement of QS in biofilm development, maintenance, and dispersal, QS inhibitors (QSIs) have been evaluated as promising antibiofilm agents (Bhardwaj et al., 2013; Brackman and Coenye, 2015; Burt et al., 2014; Persson et al., 2005). Interestingly, many organisms (including bacteria, plants, fungi, and

348  Chapter 11 algae) produce such bioactive molecules (e.g., halogenated furanones, N-acyl homoserine lactonases and acylases) (Du et al., 2014; Nazzaro et al., 2013; Petrovic´ et al., 2014; You et al., 2007), while synthetic compounds have also been successfully created (De Lima Pimenta et al., 2013; Kalia, 2013). A common characteristic of these compounds is that they can influence QS and thus inhibit biofilm formation without any apparent effect on the growth of planktonic cells, something that limits the possibility of resistance development. In fact, the disruption of QS signaling, also termed quorum quenching (QQ), may take place through different mechanisms, including: (1) inhibition of AI synthesis; (2) inhibition of AI transport and/or secretion; (3) sequestration or degradation of AIs; (4) antagonistic action of QSI with AI; and (5) inhibition of targets downstream of the AI binding by its receptor (Defoirdt et al., 2013; Grandclément et al., 2016; Nazzaro et al., 2013). Indeed, it is believed that biocontrol strategies for combating bacterial biofilm formation through the use of QSIs can enhance food safety, protect and improve human health. Nonetheless, it should be noted that the practical application of some QSIs alone in the food industry may encounter nonmanageable difficulties, such as their inability to be effective against food relevant biofilms, which may incorporate a high amount of food residues and mineral components (Giaouris et al., 2014). In that case, however, these compounds could be used in combination with other antibiofilm strategies, such as enzymes and surfactants, to increase their efficiency (Lequette et al., 2010). As development of biofilms on vascular plants may not be advantageous to the hosts, plants have developed inhibitors to interfere with these processes (Ta and Arnason, 2015). Therefore several QQ molecules have been identified from plants (Musthafa et al., 2010), with many extracts and also individual molecules to show in parallel anti-QS and antibiofilm activities. These compounds namely include phenolics and polyphenolics (such as phenolic acids, flavones, flavanones, anthocyanidins, catechins, tannins, and coumarins), terpenoids, essential oils, alkaloids, isothiocyanates (ICTs), and organosulfur compounds (Borges et al., 2015; Huber et al., 2003; Musthafa et al., 2010; Ta and Arnason, 2015; Vattem et al., 2007). Many of these act as QSIs due to their structural similarity with QS signals (AHLs) (Nazzaro et al., 2013). For instance, the presence of AHL-mimic QS molecules in diverse Oryza sativa (rice) and Phaseolus vulgaris (bean) plant-samples that specifically interfere with the capacity to form biofilms by plant-associated bacteria has been identified (Pérez-Montaño et al., 2013). More particularly, the compounds that inhibit AHL-mediated QS systems can be classified into three main groups depending on their structure: AHL analogues, 2(5H)-furanones, and compounds that are not structurally related to AHLs (Janssens et al., 2008a). Interestingly, an antibiofilm screening of 560 purified phytochemicals against EHEC showed that ginkgolic acids C15:1 and C17:1 (at 5 µg/mL) and Ginkgo biloba extract at (100 µg/mL) significantly inhibited EHEC O157:H7 and S. aureus biofilm formation (Lee et al., 2014a). In another study, of the 498 plant extracts screened against EHEC, 16 inhibited biofilm formation by >85% without inhibiting the growth of planktonic cells (Lee et al., 2013a). Transresveratrol (at 10 µg/mL) in the extract of a wetland perennial plant (Carex dimorpholepis)

Pathogenic Biofilm Formation in the Food Industry and Alternative Control Strategies  349 significantly inhibited EHEC biofilm formation, but importantly, the extract of C. dimorpholepis and trans-resveratrol did not inhibit the formation of biofilm in four beneficial commensal E. coli strains (Lee et al., 2013a). Two other phytochemicals, 7-hydroxycoumarin (7-HC) and indole-3-carbinol (I3C) were effective against E. coli and S. aureus, with both affecting the motility and QS activity, without however being able to completely remove formed biofilms (Monte et al., 2014). Several studies have shown the QQ and/or antibiofilm activities of compounds (signaling molecules included) contained in the cell-free culture supernatant (CFS) of one bacterial species against another species (Chorianopoulos et al., 2010; Nithya and Pandian, 2010; Zhao et al., 2016). In such a study, the presence of CFS from P. fluorescens significantly inhibited biofilm development by S. baltica. Various signal molecules in the CFS of P. fluorescens culture were detected, including seven AHLs, AI-2 and two diketopiperazines (DKPs) (Zhao et al., 2016). The inhibitory activity of CFS from the marine bacterium Pseudoalteromonas sp. strain 3J6 against biofilm formation on glass flow cells by S. enterica and other Gram-negative bacteria has also been shown (Dheilly et al., 2010). Compounds present in Hafnia alvei CFS cumulatively negatively influenced the early stage of biofilm development by S. Enteritidis on SS, while they also reduced the overall metabolic activity of its planktonic cells. Although AHLs were detected among these compounds, the use of several synthetic AHLs was not able to affect the initial stage of biofilm formation by this pathogen (Chorianopoulos et al., 2010). In another study, cell extracts of Bifidobacterium longum resulted in a 98-fold reduction in AI-2 activity in EHEC O157:H7, as well as in the V. harveyi reporter strain, even though they did not inhibit the growth of EHEC O157:H7. In addition, they resulted in a 36% reduction in biofilm formation by the pathogen (Kim et al., 2012). Cell-free lysates of two endophytic bacteria, B. firmus PT18 and Enterobacter asburiae PT39, exhibited potent AHL-degrading ability and significantly inhibited biofilm formation by P. aeruginosa, due to the AHL lactonase present in them (Rajesh and Ravishankar Rai, 2014). However, the opposite effect (i.e., increase in biofilm formation) may also take place in some cases. Thus, the presence of AHLs, particularly C12-HSL, increased S. Enteritidis biofilm formation and promoted expression of genes related to biofilm formation and virulence (Campos-Galvão et al., 2016). In another study, the addition of exogenous AHLs inhibited biofilm formation by S. liquefaciens, whereas it enhanced biofilm formation by A. sobria. Even so, the addition of a QSI (5-bromomethylene-2(5H)-furanone, BMF) inhibited biofilm formation in both bacterial strains (Zhang et al., 2016b). The best investigated example of an eukaryotic organism that is capable of producing metabolites that specifically interfere with QS is the Australian red alga Delisea pulchra, which produces halogenated (brominated) furanones, compounds that structurally resemble AHLs and show a wide range of biological activities, including antimicrobial and antifouling properties (Manefield et al., 1999, 2002; Ni et al., 2009; Sintim et al., 2010). Brominated furanones inhibited biofilm formation by S. Typhimurium at nongrowth-inhibiting concentrations (Janssens et al., 2008b). However, no evidence was found that furanones act

350  Chapter 11 on the currently known QS systems in Salmonella. Marine algae are known as a rich source of unique bioactive compounds. Red seaweed water extracts (SWEs) from two such species, Sarcodiotheca gaudichaudii (SG) and Chondrus crispus (CC), at concentrations from 0.4 to 2 mg/mL, significantly reduced the growth of S. Enteritidis (log CFU 4.5–5.3 and log 5.7–6.0, respectively). Addition of SWEs (0.2 mg/mL) also significantly decreased biofilm formation and reduced the motility of S. Enteritidis (Kulshreshtha et al., 2016). Food is now more and more recognized as a natural resource of novel antimicrobial agents, including those that target the virulence mechanisms of bacterial pathogens (Jakobsen et al., 2012a,b). For instance, honey has good antibacterial activity against numerous microorganisms with important impact also on biofilm development, QS, and virulence potential (Maddocks and Jenkins, 2013; Jenkins et al., 2014). Thus, aqueous extract of chestnut honey (0.2 g/mL) repressed the biosynthesis of AHLs and biofilm development in Erwinia carotovora, Yersinia enterocolitica, and A. hydrophila (Truchado et al., 2009). Honey, at a low concentration of 0.5% (v/v), significantly reduced biofilm formation in EHEC O157:H7 without inhibiting the growth of planktonic cells (Lee et al., 2011a). Transcriptome analyses showed that honey significantly repressed curli genes (csgBAC), QS genes (AI-2 importer and indole biosynthesis) and virulence genes (LEE genes). Certain food matrices, including poultry meat and ground-beef extracts, possess compounds capable of inhibiting AI-2 activity. Both medium- and long-chain fatty acids in ground beef had the ability to interfere with AI-2-based cell signaling (Soni et al., 2008). A mixture of these fatty acids (prepared at concentrations equivalent to those present in the ground beef extract) also negatively affected E. coli K-12 biofilm formation. A similar inhibition effect of poultry meat-derived fatty acids to AI-2-based cell signaling has also been shown (Widmer et al., 2007). Agaricus is a genus of edible mushrooms, either cultivated (A. bisporus) or growing wild in nature (A. bitorquis, A. campestris, and A. macrosporus). Ethanolic extracts of three such mushrooms reduced the biofilm forming capability of P. aeruginosa PAO1 in a concentration-dependent manner at sub-MIC values (Glamocˇlija et al., 2015). Naturally occurring furocoumarins from grapefruit showed >95% inhibition of AI-1 and AI-2 activities based on a V. harveyi bioassay (Girennavar et al., 2008). Grapefruit juice and furocoumarins also inhibited biofilm formation by E. coli O157:H7, S. Typhimurium, and P. aeruginosa (Girennavar et al., 2008). Certain limonoids, such as obacunone from grapefruit seed and isolimonic acid from citrus, inhibited QS, biofilm formation, and expression of (EHEC) type three-secretion system (TTSS) (Vikram et al., 2010, 2012). An orange extract and its main flavanone components (naringin, neohesperidin, and hesperidin) decreased QS-associated biofilm maturation of Y. enterocolitica without affecting bacterial growth (Truchado et al., 2012). Quercetin, a typical flavonoid present in fruits, vegetables, nuts, and grains, significantly inhibited biofilm formation by P. aeruginosa, Y. enterocolitica, and Klebsiella pneumoniae in a concentration-dependent manner (Gopu et al., 2015b). The antioxidant phloretin, a flavonoid that is abundant in apples, markedly decreased E. coli

Pathogenic Biofilm Formation in the Food Industry and Alternative Control Strategies  351 O157:H7 biofilm formation without affecting the growth of planktonic cells, while phloretin did not harm commensal E. coli K-12 biofilms (Lee et al., 2011b). Ajoene, a sulfur-rich molecule from garlic, has been shown to inhibit genes controlled by QS in P. aeruginosa including ones involved in biofilm formation (Jakobsen et al., 2012b). A similar effect has also been revealed for iberin from horseradish, an isothiocyanate produced by many members of the Brassicaceae family (Jakobsen et al., 2012a; Tan et al., 2014). Volatile metabolites from Merremia dissecta creeper, a food and medicinal plant, were able to interfere with the P. aeruginosa QS system by a strong decrease (63%–75%) of AHL biosynthesis and attenuation (55%) of biofilm formation (Luciardi et al., 2016). QS inhibitory action of a naturally occurring anthocyanin, cyanidin, and its antibiofilm potential were examined against the opportunistic pathogen K. pneumoniae, using a biosensor strain. Cyanidin at sublethal concentration greatly repressed QS-dependent phenotypes like violacein production (74%), biofilm development (72.4%), and exopolysaccharide production (68.7%) in a manner that was dependent on its concentration (Gopu and Shetty, 2016). Cranberry juice has long been used to prevent infections of the urinary tract, which are often related to biofilm formation. Studies have found that cranberry extracts have antibiofilm properties against E. coli and Staphylococcus species (LaPlante et al., 2012). Cranberry proanthocyanidins (PACs), which have been implicated as the active constituents responsible for the bacterial antiadhesive properties, reduced swarming motility and significantly disrupted biofilm formation by P. aeruginosa (Ulrey et al., 2014). Similarly, commercially available cranberry juice inhibited QS and hence elaboration of virulence factors of P. aeruginosa, including its adherence ability to a urinary tract infection mouse model (Harjai et al., 2014). Nordic berries are known to be rich in phenolic compounds and could contain QSI compounds. Out of the 13 berry extracts and wood-derived terpenes screened, four compounds (betulin, raspberry extract, and two cloudberry extracts) decreased AHL signaling without affecting planktonic growth, displaying also a varied influence on biofilm development by six bacterial strains recovered from breweries (P. libaniensis, S. marcescens, Acinetobacter sp., B. amyloliquefaciens, H. paralvei, and Obesumbacterium proteus). The phenolic extract of freeze-dried cloudberry fruit caused a statistically significant reduction of biofilm formation of O. proteus strain (Priha et al., 2014). Polyphenol compounds with a gallic acid moiety, such as epigallocatechin gallate (EGCG), ellagic acid and tannic acid, which are commonly produced by many plants, are capable of specifically interfering with and blocking AHL-mediated bacterial communication (Nazzaro et al., 2013). The inhibitory effects of EGCG on virulence phenotypes and QS-regulated gene expression in E. coli O157:H7 were demonstrated at concentrations lower than the minimum inhibitory concentration (MIC). Thus, at 25 µg/mL, the growth rate was not affected, but AI-2 concentration, biofilm formation, and swarming motility decreased to 13.2, 11.8, and 50%, respectively (Lee et al., 2009). Green tea polyphenols (TPs) at subinhibitory concentrations interfered with AI-2 and DKPs activities of S. baltica without inhibiting

352  Chapter 11 cell growth and promoted degradation of AI-2. They also inhibited biofilm development, exopolysaccharide production and swimming motility of S. baltica in a concentrationdependent manner. EGCG-enriched in green TPs significantly inhibited AI-2 activity of S. baltica (Zhu et al., 2015). Curcumin, a yellow pigment (diferuloylmethane) in the spice turmeric (Curcuma longa, also called curry powder) and used for centuries as a treatment for inflammatory diseases. (Aggarwal et al., 2007), was shown to inhibit the biofilm formation of uropathogens, such as E. coli, P. aeruginosa, Proteus mirabilis, and S. marcescens, possibly by interfering with their QS systems (Packiavathy et al., 2014). Numerous other extracts of various plants contain compounds have been shown to present in parallel significant anti-QS and antibiofilm activities, against important human bacterial pathogens, including foodborne ones. Representative examples are extracts of Capparis spinosa (Issac Abraham et al., 2011), pomegranate (Yang et al., 2016), Dalbergia trichocarpa (a tropical legume) (Rasamiravaka et al., 2015), Lagerstroemia speciosa (Asian tree more commonly known as “Jarul”) (Singh et al., 2012), Sclerocarya birrea (Marula, an African plant) (Sarkar et al., 2014), Melia dubia (Ravichandiran et al., 2013), Kalanchoe blossfeldiana (Sarkar et al., 2015), Euodia ruticarpa (Bezek et al., 2016), Syzygium cumini (commonly called Jamun, Indian blackberry used in the treatment of various diseases, in particular diabetes) (Gopu et al., 2015a), wheat-bran (González-Ortiz et al., 2014), and Trigonella foenum-graecum (fenugreek) (Husain et al., 2015a) (Fig. 11.8). Essential oils (EOs) and their major components have also been proven efficient to inhibit QS signals and regulated functions, such as biofilm formation, in different bacteria (Kerekes et al., 2013; Khan et al., 2009; Szabó et al., 2010). Peppermint (Mentha piperita) oil (PMO) at sub-MICs strongly interfered with AHL-regulated virulence and biofilm formation in P. aeruginosa and A. hydrophila. The result of molecular docking analysis attributed the QS inhibitory activity exhibited by PMO to menthol. Assessment of ability of menthol to interfere with QS systems of various Gram-negative pathogens, comprising diverse AHL molecules, revealed that it was able to reduce, among others, their biofilm formation abilities, indicating thus broad-spectrum anti-QS activity (Husain et al., 2015b). Eugenol, the major constituent of clove EO, exhibited QS inhibitory activity and reduced P. aeruginosa biofilm formation at sub-MICs (Zhou et al., 2013). However, in another study, eugenol could not exhibit anti-QS activity, as this was tested by the inhibition of QS-controlled violacein production in Chromobacterium violaceum (Khan et al., 2009). Carvacrol, the major constituent of the EOs of oregano and thyme, was able to inhibit, at sublethal concentrations (107 CFU gm–1 24 h (diarrhea) Mild diarrhea, blood and mucus in the stool, and symptoms of septicemia Brucellosis 3 weeks Headache, intermittent fever, 106 poisoning 6 to 15 hours; watery diarrhea; emetic type: vomiting organisms g–1 and nausea emetic type: 0.5 to 6 h Campylobacteriosis 106 spores g–1 Gastroenteritis 107 to 1010 8 to 44 h (travelers’ diarrhea) billion cells

107 to 1010 Enteropathogenic Infantile diarrhea E. coli (EPEC) billion cells Enterohemorrhagic Hemorrhagic colitis 10 to 100 cells E.a coli (EHEC)

4 hours 1 to 9 days

Vomiting, diarrhea, blurred vision, double vision, muscle weakness, difficulty in swallowing, may result in respiratory failure and death Watery diarrhea and intense abdominal cramps Watery diarrhea (without blood or mucus), abdominal cramps, rarely accompanied by high fever or vomiting, low-grade fever, nausea, malaise Profuse, watery diarrhea; vomiting; low-grade fever Watery diarrhea (grossly bloody and occurring every 15 to 30 minutes), abdominal cramps, nausea or vomiting, low-grade or absent fever

Food Sources Fish, shellfish, beef, pork, lamb, and poultry Cattle (Br. abortus); pigs, hares, reindeer, and wild rodents (Br. suis) Diarrheal type: Meats, vegetables, milk; emetic type: rice products, soups, and puddings Raw and undercooked poultry, unpasteurized milk, and contaminated water Improperly canned foods, especially home-canned vegetables, fermented fish, baked potatoes in aluminum foil Meats, poultry, gravy, dried or precooked foods, time and/or temperature-abused foods Brie cheese, curried turkey, mayonnaise, crabmeat, deli food, and salads

Raw beef, chicken, mayonnaise, lettuce, and pickles Yogurt, mayonnaise, fermented sausages, cheeses, unpasteurized fruit juices, lettuce, spinach (Continued)

Biosensor-Based Methods for the Determination of Foodborne Pathogens  383

Brucella abortus; Br. suis

Infective Dose

Pathogen

Disease

Infective Dose

Time of Onset Symptoms

Food Sources

Enteroinvasive E. coli (EIEC)

Bacillary dysentery

200 to 5,000 cells

12 to 72 h

Listeria monocytogenes

Listeriosis